Datasets:

j-chim

/

pii-pile-chunk3-50000-100000-tagged

like 0

[ "[5E547A4D-90E60795-C:45]\nName=All-Star Baseball 2000 (U)\nCheat0=\"Infinite\\Strikes\",8006E4E1 0000\nCheat1=\"Infinite\\Balls\",8006E4DF 0000\nCheat2=\"Infinite\\Outs\",8006E4E3 0000\nCheat3=\"Infinite\\Character Creation Points\",81103350 4170\nCheat4=\"Infinite\\Pitch Type Creation Points\",811039BC 4170,811039C0 4170\nCheat5=\"Character Creation\\Max\\Accuracy\",81115A20 4170\nCheat6=\"Character Creation\\Max\\Stamina\",81115A24 4170\nCheat7=\"Character Creation\\Max\\Contact\",81115A28 4170\nCheat8=\"Character Creation\\Max\\Power\",81115A2C 4170\nCheat9=\"Character Creation\\Max\\VS LHP\",81115A30 4170\nCheat10=\"Character Creation\\Max\\VS RHP\",81115A34 4170\nCheat11=\"Character Creation\\Max\\Bunting\",81115A38 4170\nCheat12=\"Character Creation\\Max\\VS LHB\",81115A3C 4170\nCheat13=\"Character Creation\\Max\\VS RHB\",81115A40 4170\nCheat14=\"Character Creation\\Max\\Speed\",81115A44 4170\nCheat15=\"Character Creation\\Max\\Defense\",81115A48 4170\nCheat16=\"Character Creation\\Max\\Arm Str.", "\",81115A4C 4170\nCheat17=\"Character Creation\\Max\\Streak\",81115A50 4170\nCheat18=\"Character Creation\\Max\\Clutch\",81115A54 4170\n" ]

{ "pile_set_name": "Github" }

[ 0.007478632478632479, 0 ]

[ { "analysis_explanation": null, "end": 302, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 284 }, { "analysis_explanation": null, "end": 935, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 915 }, { "analysis_explanation": null, "end": 224, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 216 }, { "analysis_explanation": null, "end": 224, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 216 } ]

[ "[Transient intestinal pseudo-obstruction syndrome in premature infants].", "\nA chronic intestinal pseudo-obstruction is sometimes seen in premature neonates who are fed early and subsequently suffer from digestive intolerance for several weeks. ", "Seven premature babies (mean gestational age: 30.5 weeks, mean birthweight: 950 g) suffered from abdominal distension and failure to pass stools at a mean age of 2.5 days (extremes: 1 to 6 days); 2 of them also had vomiting. ", "X-ray examination showed dilated loops of bowel throughout the abdomen without obstructive changes; barium or Gastrografin studies demonstrated inertia of the colon without obstructive changes or abrupt changes in caliber. ", "Histological examination of enteric nerve cells in 2 cases showed normal maturation. ", "Parenteral nutrition was necessary in all patients for 30 to 78 days (mean: 47), followed by continuous enteral feeding for 24 to 48 days (mean: 37). ", "Septicemia complicated parenteral nutrition in 4 babies and was responsible for the death of 1 of them. ", "Normal evacuation of stools occurred between day 27 and day 91 (mean day 46) allowing normal enteral feeding. ", "All 6 patients, now aged 2.5 to 8 years (mean 3.5 years) are in good health, and have no digestive problems. ", "Immaturity of intestinal motility may occur in some premature neonates suffering from intestinal ileus. ", "Parenteral nutrition may be necessary for several weeks, but spontaneous recovery is usual. ", "This transient intestinal pseudo-obstruction of premature babies is different from the classical chronic pseudo-obstruction for which surgery is often needed." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0, 0, 0, 0.004484304932735426, 0, 0, 0.009615384615384616, 0, 0, 0, 0, 0 ]

[ { "analysis_explanation": null, "end": 239, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 226 }, { "analysis_explanation": null, "end": 297, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 287 }, { "analysis_explanation": null, "end": 411, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 403 }, { "analysis_explanation": null, "end": 434, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 423 }, { "analysis_explanation": null, "end": 588, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 576 }, { "analysis_explanation": null, "end": 842, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 829 }, { "analysis_explanation": null, "end": 911, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 898 }, { "analysis_explanation": null, "end": 1090, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1065 }, { "analysis_explanation": null, "end": 1103, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1097 }, { "analysis_explanation": null, "end": 1177, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1163 }, { "analysis_explanation": null, "end": 1193, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1184 }, { "analysis_explanation": null, "end": 1406, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1393 } ]

[ "in 0.44, 1/8, -2.72?", "\n1/8\nWhat is the nearest to 1 in 5/15191, 2, 4/9?", "\n4/9\nWhat is the closest to -363 in -12, -0.2, 446, -0.3?", "\n-12\nWhich is the nearest to -2/7? ", " (a) 1 (b) -5 (c) -3 (d) 5 (e) -2/33 (f) 15\ne\nWhat is the nearest to -18 in -5, -198, 1, -1/3, 0.6?", "\n-5\nWhich is the nearest to -1/3? ", " (a) 1 (b) 0 (c) -3345 (d) 0.683\nb\nWhich is the closest to -1/4? ", " (a) -4796 (b) 1/7 (c) -0.6 (d) 5.6\nc\nWhich is the closest to -58? ", " (a) 153 (b) -1/2 (c) 1273\nb\nWhich is the closest to -1/2? ", " (a) 95 (b) 2 (c) -2.2\nc\nWhat is the nearest to 0.0425 in 1628, 5, 1/5?", "\n1/5\nWhat is the nearest to -9210.96 in -0.2, -5, -7, 1/7, 0.1?", "\n-7\nWhich is the nearest to -23? ", " (a) -3/4 (b) -1 (c) 36.878\nb\nWhat is the nearest to 9 in -7503/7, 1/3, 2/3, 0.4?", "\n2/3\nWhich is the closest to -105? ", " (a) -5 (b) -1 (c) -2/59 (d) 4/11 (e) -0.3\na\nWhat is the nearest to -1.5 in 0.1, 3, -0.2, 18/5233?", "\n-0.2\nWhich is the closest to 7? ", " (a) 28/29 (b) -7 (c) 2/15 (d) 1/5 (e) 1/6 (f) 3/7\na\nWhich is the closest to -0.14? ", " (a) -3 (b) 1 (c) -15928\nb\nWhich is the closest to -43.6? ", " (a) 1/4 (b) -11 (c) -0.5 (d) 0 (e) 2 (f) -7\nb\nWhich is the nearest to -10605? ", " (a) 88 (b) 2 (c) 1/3 (d) -2\nd\nWhich is the closest to -0.07? ", " (a) 33/7 (b) -53 (c) -0.4 (d) 5 (e) 0.02\ne\nWhat is the closest to 2 in -84, 72, -2/7, 12?", "\n-2/7\nWhich is the nearest to 3215? ", " (a) -18.032 (b) -0.5 (c) 0.5 (d) 2/3\nd\nWhich is the nearest to 0? ", " (a) 4 (b) 3787 (c) 77 (d) -9\na\nWhich is the closest to 3/10? ", " (a) 23 (b) -1973 (c) 31\na\nWhat is the nearest to 1/2 in 0, 1/6, -40/7, -1852.2?", "\n1/6\nWhat is the nearest to 1/4 in -28, -2.8, 4, 2/3?", "\n2/3\nWhich is the nearest to 15? ", " (a) 0 (b) 0.084 (c) 75 (d) 0.2 (e) 0.4 (f) 0.1\ne\nWhich is the closest to 0.08688? ", " (a) -3/16 (b) 2 (c) 1.05\na\nWhat is the nearest to -9 in -0.2, 0.4, -16, 3.2, 148, -5?", "\n-5\nWhat is the closest to -5.31 in 0.1, -1/4, -3, 1/7, -0.1?", "\n-3\nWhat is the nearest to -32 in 2/143, -8793, -1?", "\n-1\nWhat is the nearest to -257/18 in 1.9, -1/2, 5, 1?", "\n-1/2\nWhich is the closest to -31? ", " (a) 3 (b) -6 (c) 468/41 (d) -1/6\nb\nWhat is the closest to 0.1 in -1, -1/701, 87.6, 3, -42?", "\n-1/701\nWhich is the nearest to -25? ", " (a) 0 (b) 2/21 (c) 3.15 (d) 8/7 (e) -4\ne\nWhat is the nearest to -1/6 in 11, 5.3531, 1?", "\n1\nWhich is the nearest to 0? ", " (a) 0.12 (b) 1 (c) -10140/11 (d) -26\na\nWhich is the closest to 0? ", " (a) -3 (b) -2/33 (c) 33/10 (d) -2 (e) 69\nb\nWhat is the nearest to -632 in 4, 2/7, -25/151?", "\n-25/151\nWhich is the closest to -1/2? ", " (a) 29/1765 (b) -2/203 (c) -4 (d) 2/7\nb\nWhat is the closest to 0 in -2/15, 317.6, 0.28, -7, 5, 4?", "\n-2/15\nWhat is the nearest to -1856 in 6, 160, 0?", "\n0\nWhich is the closest to 1? ", " (a) 254798 (b) -3 (c) -0.5\nc\nWhat is the nearest to 0.3 in 3, 0, -0.1, 1/201, 9, 6.1?", "\n1/201\nWhat is the closest to -0.073 in 0, 5, -14, 0.01, -0.4?", "\n0\nWhat is the closest to 0 in 342, 1/20, 20, 6?", "\n1/20\nWhat is the nearest to 1/8 in 0.16623, -2, -6/13?", "\n0.16623\nWhich is the closest to -5? ", " (a) 270 (b) 5.6 (c) 63\nb\nWhat is the closest to -0.05 in -4/157, -7, -0.3?", "\n-4/157\nWhat is the closest to 46 in -1/16, -2, 0, 3/7, -1/3, -3/7?", "\n3/7\nWhich is the closest to -6/19? ", " (a) -4 (b) 2/21 (c) 0.189\nb\nWhich is the closest to 0? ", " (a) 2/3 (b) 1 (c) 15 (d) 1455 (e) 0.18 (f) -3\ne\nWhat is the nearest to -41 in 0.542, 5, -3/8, -1/4, 0?", "\n-3/8\nWhich is the nearest to 14/5? ", " (a) 2/25 (b) 5 (c) 2.84\nc\nWhat is the nearest to 0 in 8, 3/38677, -6?", "\n3/38677\nWhat is the closest to 4 in 1/4, 2, -38.336, -2/9, 0.1?", "\n2\nWhat is the nearest to 0.044 in -0.2, -63, -127, -6?", "\n-0.2\nWhich is the nearest to -1/4? ", " (a) 0.4 (b) -278/13 (c) 15/11 (d) 11\na\nWhat is the nearest to -1 in 5, -0.63, -17/3615, -0.5?", "\n-0.63\nWhich is the nearest to -4? ", " (a) 7 (b) -7 (c) -2/9 (d) -4 (e) -0.02 (f) 1320\nd\nWhich is the nearest to -1/5? ", " (a) 0.5 (b) -13 (c) 1/6 (d) 1.25 (e) 1/4\nc\nWhich is the closest to -25647/43? ", " (a) 1 (b) -0.1 (c) 5\nb\nWhat is the closest to -1 in 3/68, 4/411, 2.9?", "\n4/411\nWhat is the closest to 0 in 138, -57, 10.745?", "\n10.745\nWhat is the closest to 2.1 in -46, 3, 5, 62, -1/33?", "\n3\nWhich is the nearest to -0.2? ", " (a) 525 (b) 3/4 (c) 1927\nb\nWhat is the nearest to -1/4 in 0.09, -46, -408, 0.015?", "\n0.015\nWhich is the nearest to -1/48? ", " (a) 7/33 (b) -2/1235 (c) 1\nb\nWhich is the nearest to 11? ", " (a) -5 (b) -527 (c) -273.3\na\nWhich is the closest to -2/5? ", " (a) -6651 (b) 5 (c) 4 (d) -3 (e) -10\nd\nWhich is the nearest to 0.3? ", " (a) 4 (b) 7.5 (c) -3 (d) 1 (e) 10\nd\nWhat is the closest to 2/3 in -0.09, 4, -3, -0.02426?", "\n-0.02426\nWhich is the closest to 1/12? ", " (a) -5 (b) -23207 (c) 4\nc\nWhat is the closest to 8 in 75.67, -0.1, 1/3, 4/9, 0.5?", "\n0.5\nWhich is the closest to -0.4289? ", " (a) 4 (b) 0.3 (c) 19 (d) -2\nb\nWhich is the closest to -2/5? ", " (a) -1/26 (b) -2 (c) -0.2 (d) -0.2058 (e) -2/29\nd\nWhich is the closest to 2/3? ", " (a) 6 (b) 4.112 (c) 5 (d) 2\nd\nWhich is the nearest to 1/31? ", " (a) 0.056 (b) 20 (c) -38 (d) 3/2\na\nWhat is the nearest to 0 in 4, 4/9, 16166?", "\n4/9\nWhat is the nearest to 5 in -868807, 0.3, 2/5?", "\n2/5\nWhat is the nearest to 2/5 in 20906.7, -0.4, 1?", "\n1\nWhat is the nearest to 9 in -1, 2, -174, 0, 0.05?", "\n2\nWhich is the closest to 0.1? ", " (a) 0 (b) 3 (c) 3/629 (d) 205 (e) 4\nc\nWhich is the closest to 2? ", " (a) -1 (b) 91 (c) 16 (d) 0.041\nd\nWhat is the nearest to -0.2 in 15, -8.4, 0.1003?", "\n0.1003\nWhat is the nearest to -1/8 in -0.01, -12, 4, 133/25, 0.3?", "\n-0.01\nWhich is the nearest to 0.1? ", " (a) 2/51 (b) -22 (c) -3/179\na\nWhich is the nearest to 0.1? ", " (a) 4 (b) 50 (c) 453\na\nWhich is the closest to 1/4? ", " (a) -0.281 (b) -6/17 (c) -27\na\nWhich is the closest to -0.013? ", " (a) 1/7 (b) 78 (c) -1/2 (d) -3 (e) -0.4 (f) 0.3\na\nWhich is the closest to -0.12? ", " (a) -0.29 (b) 36 (c) -1/3 (d) 3/2\na\nWhat is the closest to 45 in 5, -0.2, -6, 1060, 1?", "\n5\nWhich is the nearest to -4318? ", " (a) -0.1 (b) 2/9 (c) 7 (d) 3/11\na\nWhat is the nearest to 4 in -0.2, 0.674, 1.27, 2, 2/7, 1?", "\n2\nWhich is the nearest to -0.1? ", " (a) 2 (b) -2/9 (c) -2802337\nb\nWhich is the nearest to 1? ", " (a) -2/11 (b) 830 (c) 2.136\nc\nWhat is the closest to -125 in -6, -11, -0.4, -0.3, 0.21?", "\n-11\nWhat is the closest to 0 in -77873, -3, 2, 2/9, -5, -55/8?", "\n2/9\nWhat is the nearest to 3/11 in -20, -5, 2/17, 0.15, -6/5?", "\n0.15\nWhat is the nearest to 6150 in 10.35, -2, 1?", "\n10.35\nWhat is the closest to -3/2 in -1/3, -1, 2/159, 18, 2/35, -2/3?", "\n-1\nWhich is the nearest to -4/21? ", " (a) -0.5 (b) 23 (c) 0.051 (d) -5 (e) 2/9\nc\nWhich is the nearest to 1/2? ", " (a) 5 (b) 0.4 (c) -1312 (d) 0.2694 (e) -4/9\nb\nWhat is the nearest to -0.4 in 2/15, -0.3, 0.09, -1/4, -0.0756?", "\n-0.3\nWhich is the closest to 8? ", " (a) 0.3 (b) -48 (c) 0.07 (d) 1/3 (e) -4\nd\nWhich is the closest to 0.02? ", " (a) -71 (b) -5 (c) 66 (d) -472\nb\nWhat is the closest to 0.04 in 3/8, -6, 4, 1.6, 562?", "\n3/8\nWhich is the closest to -396? ", " (a) 0.7 (b) -3.3 (c) 4/7\nb\nWhich is the nearest to 0.206237? ", " (a) -5 (b) 0 (c) -20\nb\nWhich is the nearest to -20? ", " (a) -19 (b) 3 (c) -0.2 (d) -10 (e) 6.3\na\nWhich is the closest to -24? ", " (a) -7 (b) 3 (c) 3/11 (d) -0.18 (e) 23/6\na\nWhat is the closest to -1/15 in 2/3, -8, -29, 3/11, -1/5?", "\n-1/5\nWhich is the nearest to -243? ", " (a) 145 (b) -2/9 (c) -0.1\nb\nWhich is the closest to 2/43? ", " (a) -0.496 (b) -3/8 (c) -0.1 (d) -3 (e) 1/2\nc\nWhich is the closest to 0? ", " (a) 1/8 (b) -3/8 (c) 1.05 (d) -3/5\na\nWhat is the closest to 4 in -0.5, 1/7, -4/27, -4/9, 180?", "\n1/7\nWhich is the nearest to 1/2? ", " (a) 1070 (b) 2 (c) 0.1 (d) 21\nc\nWhat is the closest to -8 in -15, -1.5, 218/7?", "\n-1.5\nWhich is the nearest to 9/7? ", " (a) -133 (b) -0.34 (c) -2 (d) 7 (e) -1\nb\nWhat is the closest to -374.9 in 1.6, -3, -1?", "\n-3\nWhich is the closest to -3.4787? ", " (a) 0.3 (b) -1 (c) 0.2 (d) -0.4 (e) 4\nb\nWhat is the nearest to -100 in 110/7, 2/3, -0.2, 5, -0.5?", "\n-0.5\nWhat is the closest to -0.093 in -0.3, -5, -297?", "\n-0.3\nWhich is the closest to 2? ", " (a) 0.3 (b) -0.1 (c) 0.84 (d) -1.2 (e) -1/14 (f) 0.03\nc\nWhat is the nearest to 27/904 in 5/12, 17, 0.2?", "\n0.2\nWhich is the nearest to 46373? ", " (a) 0 (b) 4 (c) 19 (d) -0.5 (e) -0.4\nc\nWhat is the closest to 10 in -2, 1168, -13, 1/4?", "\n1/4\nWhat is the closest to 52 in -1/3, 1445, 1.3?", "\n1.3\nWhich is the closest to 2? ", " (a) -0.5 (b) 2 (c) 3 (d) 1.2205 (e) -2 (f) 4\nb\nWhich is the nea" ]

{ "pile_set_name": "DM Mathematics" }

[ 0, 0, 0, 0, 0.009615384615384616, 0, 0, 0, 0, 0, 0, 0, 0.012048192771084338, 0, 0.00980392156862745, 0, 0, 0.03333333333333333, 0.011904761904761904, 0, 0, 0, 0, 0, 0, 0.018867924528301886, 0, 0, 0, 0, 0.0392156862745098, 0.018518518518518517, 0.02857142857142857, 0.031914893617021274, 0.02702702702702703, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.015625, 0, 0, 0.010309278350515464, 0, 0, 0, 0.013888888888888888, 0, 0, 0, 0.011904761904761904, 0.02631578947368421, 0, 0, 0, 0.010638297872340425, 0, 0, 0.02631578947368421, 0, 0, 0, 0, 0, 0, 0.019230769230769232, 0, 0, 0.011764705882352941, 0.015151515151515152, 0, 0, 0, 0.015151515151515152, 0.011494252873563218, 0, 0, 0, 0, 0, 0.011111111111111112, 0, 0.016129032258064516, 0, 0.014285714285714285, 0.02857142857142857, 0, 0.008771929824561403, 0, 0, 0, 0, 0, 0, 0, 0.009523809523809525, 0, 0, 0, 0.020618556701030927, 0, 0, 0, 0.03296703296703297, 0, 0.00980392156862745, 0, 0, 0, 0, 0.010869565217391304, 0, 0, 0 ]

[ { "analysis_explanation": null, "end": 250, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 241 }, { "analysis_explanation": null, "end": 557, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 553 }, { "analysis_explanation": null, "end": 864, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 863 }, { "analysis_explanation": null, "end": 1141, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1135 }, { "analysis_explanation": null, "end": 1289, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1287 }, { "analysis_explanation": null, "end": 1597, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1596 }, { "analysis_explanation": null, "end": 2024, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2022 }, { "analysis_explanation": null, "end": 2098, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2097 }, { "analysis_explanation": null, "end": 2227, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2221 }, { "analysis_explanation": null, "end": 2835, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2833 }, { "analysis_explanation": null, "end": 3258, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3257 }, { "analysis_explanation": null, "end": 3376, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3369 }, { "analysis_explanation": null, "end": 3380, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3378 }, { "analysis_explanation": null, "end": 3499, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3497 }, { "analysis_explanation": null, "end": 4001, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4000 }, { "analysis_explanation": null, "end": 4004, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4003 }, { "analysis_explanation": null, "end": 4008, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4006 }, { "analysis_explanation": null, "end": 4075, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4071 }, { "analysis_explanation": null, "end": 4440, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4439 }, { "analysis_explanation": null, "end": 4904, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4899 }, { "analysis_explanation": null, "end": 5115, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5110 }, { "analysis_explanation": null, "end": 5297, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5296 }, { "analysis_explanation": null, "end": 5305, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5299 }, { "analysis_explanation": null, "end": 5692, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5690 }, { "analysis_explanation": null, "end": 5821, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5820 }, { "analysis_explanation": null, "end": 5987, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5985 }, { "analysis_explanation": null, "end": 6113, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6110 }, { "analysis_explanation": null, "end": 6239, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6234 }, { "analysis_explanation": null, "end": 6243, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6241 }, { "analysis_explanation": null, "end": 6663, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6661 }, { "analysis_explanation": null, "end": 6666, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6665 }, { "analysis_explanation": null, "end": 7270, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7266 }, { "analysis_explanation": null, "end": 7843, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7841 }, { "analysis_explanation": null, "end": 6773, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 6765 }, { "analysis_explanation": null, "end": 4191, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.2, "start": 4185 }, { "analysis_explanation": null, "end": 200, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 196 }, { "analysis_explanation": null, "end": 804, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 800 }, { "analysis_explanation": null, "end": 814, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 810 }, { "analysis_explanation": null, "end": 940, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 936 }, { "analysis_explanation": null, "end": 1467, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 1463 }, { "analysis_explanation": null, "end": 1732, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 1728 }, { "analysis_explanation": null, "end": 2156, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 2152 }, { "analysis_explanation": null, "end": 2347, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 2343 }, { "analysis_explanation": null, "end": 2539, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 2535 }, { "analysis_explanation": null, "end": 2569, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 2565 }, { "analysis_explanation": null, "end": 2831, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 2827 }, { "analysis_explanation": null, "end": 2844, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 2840 }, { "analysis_explanation": null, "end": 2893, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 2889 }, { "analysis_explanation": null, "end": 3049, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 3045 }, { "analysis_explanation": null, "end": 3108, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 3104 }, { "analysis_explanation": null, "end": 3126, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 3122 }, { "analysis_explanation": null, "end": 3318, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 3314 }, { "analysis_explanation": null, "end": 3892, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 3888 }, { "analysis_explanation": null, "end": 4015, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 4011 }, { "analysis_explanation": null, "end": 4168, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 4164 }, { "analysis_explanation": null, "end": 4178, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 4174 }, { "analysis_explanation": null, "end": 4493, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 4489 }, { "analysis_explanation": null, "end": 4688, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 4684 }, { "analysis_explanation": null, "end": 4730, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 4726 }, { "analysis_explanation": null, "end": 4823, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 4819 }, { "analysis_explanation": null, "end": 5355, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 5351 }, { "analysis_explanation": null, "end": 5483, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 5479 }, { "analysis_explanation": null, "end": 5770, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 5766 }, { "analysis_explanation": null, "end": 5931, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 5927 }, { "analysis_explanation": null, "end": 6106, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 6102 }, { "analysis_explanation": null, "end": 6123, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 6119 }, { "analysis_explanation": null, "end": 6249, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 6245 }, { "analysis_explanation": null, "end": 6289, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 6285 }, { "analysis_explanation": null, "end": 6452, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 6448 }, { "analysis_explanation": null, "end": 6926, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 6922 }, { "analysis_explanation": null, "end": 6978, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 6974 }, { "analysis_explanation": null, "end": 7000, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 6996 }, { "analysis_explanation": null, "end": 7101, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 7097 }, { "analysis_explanation": null, "end": 7264, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 7260 }, { "analysis_explanation": null, "end": 7789, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 7785 }, { "analysis_explanation": null, "end": 7839, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 7835 }, { "analysis_explanation": null, "end": 2652, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 2646 }, { "analysis_explanation": null, "end": 4945, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 4939 }, { "analysis_explanation": null, "end": 5892, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 5885 }, { "analysis_explanation": null, "end": 6773, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 6767 } ]

[ "Go to the bottom of the post to see the extension after the ************************************************\n\nIt sounds like an interesting experiment to do for SD starter. ", "I can use up to 20g of stater making 200 g of 80% hydration levain over 12 hours in the winter time and kitchen temperatures around 60-65 F. That 200 g levain would normally go into 800 g of flour and 600 g of water and then developed over a couple of hours. ", "In the winter time it could possibly ferment and proof 6-8 hours on the counter before needing to go in the oven. ", "With yeast water we have gone 12 hours.", "\n\nI suppose that if one would use 1 g of SD starter and mix it with the entire 900 g of flour and 675 g of water and 2% salt (no levain build) it would take a while for it to be ready to bake, How long we will have to find out - unless someone has already done this test. ", "I'm not sure, perhaps someone here knows this too, but yeast only lives about 6 days or so before croaking.", "\n\nNo collapse after 24 hours,\n\nSo my apprentice took 1 g of starter and tried it out on 100 g of flour and 75 g of water, 2 g of salt to see what happens. ", "She started at 9 AM, Oct 26, 68.2 F kitchen temp and level marked with a rubber band. ", "Lets see how long it takes to double and make a couple knotted rolls out of it :-) Here is a pix exactly 24 hours later the levain had nearly tripled but had not collapsed. ", "Amazing for 1 g of starter and 100 g of flour.", "\n\n9 AM - Oct 26 9 AM - Oct 27.", "\n\nHere is a picture of the top of the levain too. ", "I've decided to eventually make some bagels out of some of this and a lower hydration will slow this train down some too. ", "Also want to get some whole grains in the mix too. ", "So we will divide the dough in half and add another 86 g of flour, 44 g of water to get the hydration down to 60% from 75% and a little less than 2 g of salt to each half. ", "One half got 86 g of whole grain flours (50%rye, 32% WW and 18% spelt). ", "The other half got 86 g of AP and 44 g of water and less than 2 g of salt - to keep the control of white flour intact.", "\n\n10 AM - Oct 27 after the 24 hour mark split into two levains one has some Whole Grains now and one is still AP only.", "\n\nThis should perhaps get us from 24 to 48 hours on the counter. ", "The temperature fell to 70 F this morning from a high yesterday of 81 F in the afternoon fall kitchen.", "\n\nThe whole grain levain on the left doubled again at the 32 hour mark and was put in the fridge for a 24 hour retard and the white flour levain doubled at the 36 hour mark and also went into the fridge for a 24 hour retard. ", "Looks like 36 hours is as far as we would want to go before refrigerating or using. ", "Retarding the starter should make the sour really come out.", "\n\nNow that we know it takes 24 hours for our 1g of our Desem /Rye SD starter tpo double 100g of flour at 75% hydration, we are going to extend the experiment to see if we can do a 36 hour bread on the counter top.", "\n\nWe mixed 7 g of 67% hydro starter with 50 g of water to thin it out and liquefy it. ", "We then added 22 g each of home ground whole: spelt, rye and wheat along with 2 g each of white and red malts made from the same flours and mixed it up well. ", "We then added another 455 g of water and mixed again before adding 315 g each of bread and AP flour and mixing again. ", "This gave us a 72% hydration dough that has 10% whole grains and 1% SD starter.", "\n\nWe let the dough autolyse for 30 minutes before adding 11 g of salt and starting 15 minutes of French Slap and folds. ", "We expect to let the dough ferment for 24 hours before letting it rise again for 12 hours before baking. ", "The gluten was well developed after the slap and folds and the dough ball looked like this:\n\nMichael Wilson has had a positive effect on my dough balls! ", "Can't wait to try out his panettone !", "\n\nIt only took 20 hours to double in volume starting with 1% starter to flour ratio. ", "Time to split it up and and proof a loaf of fig, pistachio, sunflower and pumpkin seed bread and one plain old SFSF - and see how long they take to double. ", "The round is SFSD.", "\n\nThe reality was that the dough had doubled again in 4 hours and was ready for Big Old Betsy to bake up so we did. ", "At our hot kitchen temp of nearly 79 F Doc.", "Dough spreadsheet said we would ne ready to bake in less time but we might have over proofed it a little too.", "\n\nHere they are proofed. ", "24 hours on the counter from mixing the dough to baking it off worked for this starter, flour and hydration combination.", "\n\nI will do another post to cover the bread itself which baked up very well.", "\n\nComments\n\nFew days ago I prepared a loaf with 60% durum wheat and 40% soft wheat flour, both quite poor in gluten. ", "I made the dough proof 24 hours because out of town and because I wanted to see how long it would last. ", "In the oven it even sprang a bit, but not much.", "\n\nIn my opinion the only factor that determines how long your dough can proof is its gluten structure, that in turn depends on how much you knead it and how extensible and elastic your gluten is. ", "It took me a while to understand the importance and the effects of the extensive kneading that txfarmer and mwilson have shown us countles times, but that I've taken the concept... I'm getting great loaves even with weaker flours:-)\n\nhas me doing long French slap and folds ever since I tried to do his 100% white spelt 100% hydration but using 100% whole spelt instead (sifting it to 78% extraction and then adding the bran back into the mix with a last S & F). ", "Also tried it out on 100% Kamut too. ", "He has me believing in good gluten development. ", "I'm in training to do one of his panettone's for the Holidays :-)\n\nI don't know how much gluten structure I got with these levian's by just mixing them with a spoon for a short time and letting them go on the counter for 24 hours but they could have gone longer before I split it, feed it and let it go 12 hours longer after some kneading.", "\n\nI used to think that bread would turn to goo if you let it proof for 24 hours on the counter but I'm beginning to think that if a very small amount of starter was used, say 8 g for a 800 g loaf at 72% hydration and the gluten was developed enough, a loaf should be able to go 24 hours on the counter if the temperature was around 72 F and still bake off nicely as you have already found out with your durum bread.", "\n\nIt is different for LAB (35 hrs) than for the yeast (37 hrs). ", "And at the very high dilution ratio you should add one additional doubling time (~4 hrs @ 20°C) to Ganzle's model results to account for a longer lag phase, but your 24 hr photo looks like it has another few hours to go so 36 hrs is probably pretty close. ", "With such long times, the temperature sensitivity is quite high as well so predicting exact times is not as easy as you might like. ", "Just use it when it is ripe.", "\n\nof your hand Doc! ", "I agree. ", "I'm pretty sure than the first 24 hour phase could have been extended to 36 hours like you suggest. ", "Without a proofer it is hard to control the kitchen temperature in the fall with the A/C off and 68 compared to 80 F is a huge swing and the little beasts react fast to even more modest temperature swings.", "\n\nI'm going to try a 36 hour test using 8 g of starter and 800 g of flour and see what happens over the next couple of days. ", "It would be so much easier to leave shaped bread on the counter rather than retarding it ans still get that SD tang.", "\n\nThirty six hours is an inconvenient time to either start or complete any operation. ", "Maybe 0700 one day to 1900 the next day is as good as you can make it (or 1900 to 0700, depending on how much work comes after the end point). ", "Better to adjust the ratio if you can't control the temperature.", "\n\nI built an Excel model from Ganzel's dissertation results and it has provided exceptionally good guidance for times and temperatures. ", "I suppose you could integrate it over the fermentation time using measured temperatures, but I am not sure it is worth the effort.", "\n\nfind your Excel spreadsheet? ", "I saw the 36 hours was going to work after finishing the Slap and Folds at 11 AM. ", "That would have me finishing up the bake at midnight. ", "So I decided to do an 8-12 hour 37 F retard in the fridge, right after we put it in the basket for final proof. ", "That way we can finish it up at a decent time in the morning - but it becomes a 44 hour bread then :-)\n\nSet the temperature (°C) in cell B62; read the elapsed time (hrs) in column A; read how much LAB (column C) and yeast (column E) you have relative to how much you started with. ", "This does not add the one doubling time allowance for the lag phase delay. ", "To find the doubling time, look down the appropriate column (C or E) and find a number close to 2, then look in column A to get the doubling time.", "\n\nThere is more functionality but I don't have time to write the instruction manual. ", "You will have to tease out the details. ", "Nothing is locked so you can change it as much as you want (in your version).", "\n\nAll original site content copyright 2018 The Fresh Loaf unless stated otherwise. ", "Content posted by community members is their own. ", "The Fresh Loaf is not responsible for community member content. ", "If you see anything inappropriate on the site or have any questions, contact me at floydm at thefreshloaf dot com. ", "This site is powered by Drupal and Mollom." ]

{ "pile_set_name": "Pile-CC" }

[ 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.00847457627118644, 0.01694915254237288, 0, 0, 0, 0, 0, 0.004694835680751174, 0, 0, 0.00847457627118644, 0, 0.008333333333333333, 0, 0.006535947712418301, 0, 0, 0, 0.05555555555555555, 0, 0.023255813953488372, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.008620689655172414, 0, 0, 0, 0.007352941176470588, 0, 0, 0, 0.018518518518518517, 0, 0.0035587188612099642, 0, 0, 0, 0, 0, 0, 0, 0, 0.008695652173913044, 0 ]

[ { "analysis_explanation": null, "end": 253, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 245 }, { "analysis_explanation": null, "end": 267, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 261 }, { "analysis_explanation": null, "end": 310, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 305 }, { "analysis_explanation": null, "end": 430, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 413 }, { "analysis_explanation": null, "end": 445, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 439 }, { "analysis_explanation": null, "end": 496, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 487 }, { "analysis_explanation": null, "end": 584, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 576 }, { "analysis_explanation": null, "end": 627, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 625 }, { "analysis_explanation": null, "end": 940, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 928 }, { "analysis_explanation": null, "end": 990, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 982 }, { "analysis_explanation": null, "end": 1136, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1132 }, { "analysis_explanation": null, "end": 1144, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1138 }, { "analysis_explanation": null, "end": 1322, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1308 }, { "analysis_explanation": null, "end": 1450, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1423 }, { "analysis_explanation": null, "end": 1813, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1800 }, { "analysis_explanation": null, "end": 1892, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1886 }, { "analysis_explanation": null, "end": 2050, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2036 }, { "analysis_explanation": null, "end": 2068, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2061 }, { "analysis_explanation": null, "end": 2199, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2185 }, { "analysis_explanation": null, "end": 2257, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2245 }, { "analysis_explanation": null, "end": 2279, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2270 }, { "analysis_explanation": null, "end": 2304, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2295 }, { "analysis_explanation": null, "end": 2382, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2375 }, { "analysis_explanation": null, "end": 2427, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2420 }, { "analysis_explanation": null, "end": 2484, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2477 }, { "analysis_explanation": null, "end": 2533, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2526 }, { "analysis_explanation": null, "end": 2561, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2553 }, { "analysis_explanation": null, "end": 2635, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2626 }, { "analysis_explanation": null, "end": 2720, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2712 }, { "analysis_explanation": null, "end": 2871, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2864 }, { "analysis_explanation": null, "end": 3378, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3368 }, { "analysis_explanation": null, "end": 3429, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3419 }, { "analysis_explanation": null, "end": 3444, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3433 }, { "analysis_explanation": null, "end": 3503, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3495 }, { "analysis_explanation": null, "end": 3545, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3537 }, { "analysis_explanation": null, "end": 3668, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3654 }, { "analysis_explanation": null, "end": 3773, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3765 }, { "analysis_explanation": null, "end": 4069, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4062 }, { "analysis_explanation": null, "end": 4101, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4096 }, { "analysis_explanation": null, "end": 4166, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4161 }, { "analysis_explanation": null, "end": 4309, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4301 }, { "analysis_explanation": null, "end": 4643, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4635 }, { "analysis_explanation": null, "end": 5061, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5053 }, { "analysis_explanation": null, "end": 5216, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5210 }, { "analysis_explanation": null, "end": 5452, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5447 }, { "analysis_explanation": null, "end": 5735, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5727 }, { "analysis_explanation": null, "end": 5817, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5809 }, { "analysis_explanation": null, "end": 5923, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5915 }, { "analysis_explanation": null, "end": 6130, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6122 }, { "analysis_explanation": null, "end": 6291, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6285 }, { "analysis_explanation": null, "end": 6319, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6313 }, { "analysis_explanation": null, "end": 6493, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6488 }, { "analysis_explanation": null, "end": 6535, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6518 }, { "analysis_explanation": null, "end": 6551, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6545 }, { "analysis_explanation": null, "end": 6804, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6787 }, { "analysis_explanation": null, "end": 6847, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6839 }, { "analysis_explanation": null, "end": 6941, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6933 }, { "analysis_explanation": null, "end": 7098, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7091 }, { "analysis_explanation": null, "end": 7193, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7170 }, { "analysis_explanation": null, "end": 7328, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7312 }, { "analysis_explanation": null, "end": 7406, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7402 }, { "analysis_explanation": null, "end": 7435, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7407 }, { "analysis_explanation": null, "end": 7482, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7470 }, { "analysis_explanation": null, "end": 7638, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7632 }, { "analysis_explanation": null, "end": 7916, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7904 }, { "analysis_explanation": null, "end": 7959, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7955 }, { "analysis_explanation": null, "end": 7978, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7973 }, { "analysis_explanation": null, "end": 8032, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8024 }, { "analysis_explanation": null, "end": 8065, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8056 }, { "analysis_explanation": null, "end": 8233, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8226 }, { "analysis_explanation": null, "end": 8314, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8311 }, { "analysis_explanation": null, "end": 8890, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8886 }, { "analysis_explanation": null, "end": 9201, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9195 }, { "analysis_explanation": null, "end": 8286, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 8283 } ]

[ "The Penguin Dance\n\nSaturday, 27 May 2017\n\nArt is no food,\nBut the fire underneath.", "\nArt rests on retina\nas an inverted image\nof misery.", "\nArt is glucose to the brain\nand credit to the soul.", "\nArt is the fear\nof creating a little too much.", "\nIt is a refreshment, served\nat the dinner of machines.", "\nArt never means you had time,\nbut that you reflected on time.", "\nArt is long,\nA by-product of half fed stomach,\nor in the quest to beat death.", "\nArt is free,\nAmid the hurricanes of exhaustion.", "\nArt is the beloved, air lives for...\nIt is a secret ingredient to God.", "\n\nTuesday, 28 February 2017\n\nPower to the language,\nthe language of age.", "\nThe highs and the lows\nThe show on the stage.", "\nSoft, subtle but deep\nMessage that it holds\nWounds it does bestow\nEars that it hits\nto make bleed, aflow.", "\nA language learnt with age\nabout age.", "\nWhat an inescapable cage\nthis course of time\nLiving under the hope\nOf memory so human\nof miracles so awaited\nof deeds so unrewarding\nof death so imminent.", "\nA thick book of regrets\nEver written by a hero.", "\n\nFrom toothful lies\nTo the toothless truths\nAll, ever has been spoken\nThe language of age.", "\n\nWith you goes away my will to write;\nNo poem, no wish to suffer in dim light\nOld days seem so old as if a previous life\nNew days, so new-a rewardful afterlife\nNo more do I walk with a wish to be loved\nNo more do I talk with a fear of being cuffed\nThrough you have I been blessed with a cause\nThat race i was in, beautifully has a pause.", "\n\nSaturday, 16 July 2016\n\nDear step on the ladder to heavens!", "\nYou ought not be stepped upon\nAnd touched by the sole of the feet\nSit up on the curve of the lashes\nAnd be the crownly pride of my head\nDear step on the ladder to heavens!", "\nStep on my back and grow as wings\nBe trampoline to my baby dreams\nAnd help them jump to the realities divine." ]

{ "pile_set_name": "Pile-CC" }

[ 0, 0, 0, 0, 0, 0, 0.01282051282051282, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0 ]

[ { "analysis_explanation": null, "end": 27, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19 }, { "analysis_explanation": null, "end": 40, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 32 }, { "analysis_explanation": null, "end": 555, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 548 }, { "analysis_explanation": null, "end": 573, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 560 }, { "analysis_explanation": null, "end": 1230, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1222 }, { "analysis_explanation": null, "end": 1447, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1439 }, { "analysis_explanation": null, "end": 1461, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1449 } ]

[ "\n689 N.W.2d 579 (2004)\n268 Neb. 934\nSTATE of Nebraska, appellee,\nv.\nVictor HERNANDEZ, appellant.", "\nNo. ", "S-03-1365.", "\nSupreme Court of Nebraska.", "\nDecember 10, 2004.", "\n*582 Christopher J. Lathrop, Omaha, for appellant.", "\nJon Bruning, Attorney General, and James D. Smith, Lincoln, for appellee.", "\nHENDRY, C.J., WRIGHT, CONNOLLY, GERRARD, STEPHAN, McCORMACK, and MILLER-LERMAN, JJ.", "\nCONNOLLY, J.\nVictor Hernandez appeals his jury convictions for first degree murder and use of a deadly weapon to commit a felony. ", "He contends that (1) an affidavit for a search warrant was not supported by probable cause; (2) his counsel was ineffective for failing to request a hearing under Franks v. Delaware, 438 U.S. 154, 98 S.Ct. ", "2674, 57 L.Ed.2d 667 (1978); (3) he should have been rearraigned after the information was amended to include language charging aiding and abetting; (4) DNA evidence was improperly admitted; and (5) a Spanish language Miranda advisory form failed to properly inform him of his rights. ", "We affirm.", "\nOn May 26, 2002, the victim, Mindy Schrieber, was murdered during a robbery at her place of employment. ", "The cause of death was multiple stab wounds, and she had additionally been driven over by a vehicle. ", "In connection with the death, Hernandez and Luis Fernando-Granados, also known as Luis Vargas, were later charged and convicted for first degree murder and use of a deadly weapon to commit a felony.", "\n\n\n*583 BACKGROUND\n\nAFFIDAVIT AND SEARCH WARRANT\nAfter the murder, the Omaha police received an anonymous telephone call from a person subsequently identified as Meagan Kane. ", "Kane provided information about the crime. ", "She stated that the vehicle involved in the homicide was parked behind an apartment building near 31st and California Streets in Omaha, and she described it as a blue 1991 or 1992 Ford Escort on blocks. ", "She stated that the vehicle's owner, \"Victor,\" a Hispanic male about 21 years old, bragged about killing Schrieber. ", "She also gave Hernandez' telephone number. ", "It was later determined that Kane was Fernando-Granados' girl friend, although the officers did not know that at the time the call was taken.", "\nSgt. ", "Mark Gentile of the Douglas County Sheriff's office determined that the telephone number was listed to Hernandez and obtained the address for the number. ", "He went with another officer to the 31st and California Streets area and then to Hernandez' address, where they located a Ford Escort in a parking lot; the vehicle was registered to Hernandez. ", "The officers compared photographs of tire tread taken from Schrieber's pants to the left front tire of the Escort. ", "In an application for a search warrant, the officers averred that the Escort was blue and that the tire tread matched. ", "The officers examined the vehicle's undercarriage and averred in the warrant application that it matched an imprint on Schrieber's pants. ", "The officers also observed small, thick, tissue-type substances splattered on the undercarriage in the same general area as a red and brown substance. ", "The officers believed the substances to be bodily fluids such as blood and body tissue.", "\nThe officers described Kane's telephone call and their observations in an application for a search warrant. ", "After the warrant was obtained, they seized various property, including a certificate of title showing that Hernandez owned the vehicle.", "\n\nHERNANDEZ' CONFESSION\nOn June 6, 2002, Hernandez gave a statement in Spanish to officers in Douglas County. ", "Deputy Robert Jones — who is fluent in Spanish — used a Spanish language form to advise Hernandez of his Miranda rights. ", "Hernandez stated that he understood his rights and did not request an attorney; he then confessed his involvement in the crime.", "\nAfter Hernandez spoke with the officers, they obtained a search warrant for a residence where Hernandez had told them Fernando-Granados hid money. ", "The officers found currency with blood on it that was sent to a forensic laboratory for testing.", "\n\nPRETRIAL PROCEEDINGS\nBefore trial, Hernandez moved to suppress evidence obtained from the search warrant. ", "In the application for the warrant, Gentile averred that the tread and oil pan patterns \"matched\" photographs taken at the crime scene. ", "However, at the hearing on the motion, Gentile stated that the patterns were \"similar\" to the photographs. ", "Hernandez' motion was overruled, and the certificate of title and photographs showing the vehicle's license plates were admitted into evidence at trial.", "\nHernandez also moved to suppress his statements, arguing that that the Spanish Miranda warning was improperly worded so that it insufficiently explained that the accused had a right to an attorney. ", "The motion was overruled.", "\nFinally, a Daubert hearing was held about admissibility of the results of DNA testing on the currency using a polymerase chain reaction amplification (PCR) and *584 short tandem repeat (STR) analysis. ", "See Daubert v. Merrell Dow Pharmaceuticals, Inc., 509 U.S. 579, 113 S.Ct. ", "2786, 125 L.Ed.2d 469 (1993). ", "The person who performed the test testified about the methods, his qualifications, and the laboratory's accreditation. ", "The court determined that the test results were admissible.", "\nIn July 2002, Hernandez was initially charged with first degree murder and use of a deadly weapon to commit a felony. ", "Hernandez was arraigned and pleaded not guilty. ", "In September 2003, an amended information was filed charging aiding and abetting first degree murder. ", "The record is silent whether Hernandez was rearraigned on the amended information. ", "A jury found Hernandez guilty, and he received consecutive sentences of life in prison for the murder conviction and 10 to 20 years' imprisonment for the use of a deadly weapon to commit a felony conviction.", "\n\nASSIGNMENTS OF ERROR\nHernandez assigns that the district court erred by (1) overruling his motion to suppress evidence seized as a result of the search warrant, (2) failing to rearraign him on the amended information, (3) overruling his motion to suppress his statements, and (4) admitting the DNA test results. ", "He also assigns that his counsel was ineffective for failing to seek a hearing about officer misrepresentations in the affidavit for the application for a search warrant.", "\n\nSTANDARD OF REVIEW\nWhen dispositive issues on appeal present questions of law, an appellate court has an obligation to reach an independent conclusion irrespective of the decision made by the court below. ", "State v. Thomas, 268 Neb. 570, 685 N.W.2d 69 (2004).", "\n\nANALYSIS\n\nMOTION TO SUPPRESS EVIDENCE SEIZED FROM SEARCH WARRANT\nHernandez contends that the court should have sustained his motion to suppress because the affidavit failed to show probable cause for a search warrant. ", "In arguing there was no probable cause, Hernandez points to the anonymous call, differences between where the vehicle was reported to be and actually found, and differences between information provided in the affidavit and in later testimony. ", "In particular, he contends that the officers' comparison of photographs of tread marks and oil pan marks to the vehicle and statement that there was a \"match\" was not sufficient for probable cause. ", "Instead, he contends that information from a crime laboratory was required to establish probable cause.", "\nA search warrant, to be valid, must be supported by an affidavit which establishes probable cause. ", "Probable cause sufficient to justify issuance of a search warrant means a fair probability that contraband or evidence of a crime will be found. ", "State v. Lammers, 267 Neb. 679, 676 N.W.2d 716 (2004). ", "The magistrate who is evaluating the probable cause question must make a practical, commonsense decision whether, given the totality of the circumstances set forth in the affidavit before him or her, including the veracity of and basis of knowledge of the persons supplying hearsay information, there is a fair probability that contraband or evidence of a crime will be found in a particular place. ", "The question is whether the issuing magistrate had a \"substantial basis\" for finding that the affidavit established probable cause. ", "State v. Thomas, 267 Neb. 339, 673 N.W.2d 897 (2004).", "\nIn evaluating the sufficiency of an affidavit used to obtain a search warrant, *585 an appellate court is restricted to consideration of the information and circumstances contained within the four corners of the affidavit, and evidence which emerges after the warrant is issued has no bearing on whether the warrant was validly issued. ", "State v. Lammers, supra.", "\nAn informant's reliability may be established by showing in the affidavit to obtain a search warrant that (1) the informant has given reliable information to police officers in the past, (2) the informant is a citizen informant, (3) the informant has made a statement that is against his or her penal interest, or (4) a police officer's independent investigation establishes the informant's reliability or the reliability of the information the informant has given. ", "State v. Lammers, supra.", "\nHere, the officers independently established the informant's reliability. ", "They established that the telephone number was registered to a person named \"Victor\" and discovered a vehicle of the same reported model at the parking lot behind his residence. ", "At this point, the officers could plainly observe further items that led to probable cause. ", "Comparing photographs of tread and oil pan marks to the vehicle, the officers determined that there was a \"match.\" ", "They also observed what they believed was body fluid on the vehicle's undercarriage.", "\nWe also disagree with Hernandez' argument that a crime laboratory specialist should have provided information about the tread and oil pan marks before probable cause could be established. ", "The statements provided in the affidavit were sufficient for a magistrate to believe there was a fair probability that contraband or evidence of a crime would be found in Hernandez' residence. ", "We determine that the district court did not err when it overruled Hernandez' motion to suppress.", "\n\nINEFFECTIVE ASSISTANCE OF COUNSEL\nHernandez contends that his counsel was ineffective because he failed to challenge the affidavit for the search warrant by filing a motion based on Franks v. Delaware, 438 U.S. 154, 98 S.Ct. ", "2674, 57 L.Ed.2d 667 (1978). ", "In Franks, the Court held:\n[W]here the defendant makes a substantial preliminary showing that a false statement knowingly and intentionally, or with reckless disregard for the truth, was included by the affiant in the warrant affidavit, and if the allegedly false statement is necessary to the finding of probable cause, the Fourth Amendment requires that a hearing be held at the defendant's request. ", "In the event that at that hearing the allegation of perjury or reckless disregard is established by the defendant by a preponderance of the evidence, and, with the affidavit's false material set to one side, the affidavit's remaining content is insufficient to establish probable cause, the search warrant must be voided and the fruits of the search excluded to the same extent as if probable cause was lacking on the face of the affidavit.", "\n438 U.S. at 155-56, 98 S.Ct. ", "2674.", "\nHernandez argues he was entitled to a Franks hearing because evidence later showed that the vehicle was black instead of blue and points to testimony where the officers said at the suppression hearing that the tread and oil pan marks looked \"similar\" instead of stating that they \"matched.\"", "\nUnder the test enunciated in Strickland v. Washington, 466 U.S. 668, 104 S.Ct. ", "2052, 80 L.Ed.2d 674 (1984), to sustain a claim of ineffective assistance of counsel as a violation of the Sixth Amendment to the U.S. Constitution and Neb. Const. ", "art. ", "I, § 11, a defendant must show that (1) counsel's performance was *586 deficient and (2) such deficient performance prejudiced the defendant, that is, the defendant must demonstrate a reasonable probability that but for counsel's deficient performance, the result of the proceeding would have been different. ", "State v. McDermott, 267 Neb. 761, 677 N.W.2d 156 (2004).", "\nAlthough the record shows that Hernandez' counsel did not request a Franks hearing, we determine that such a failure did not demonstrate deficient performance by counsel. ", "We have noted that under Franks, the defendant must make a substantial preliminary showing, including allegations of deliberate falsehood or of reckless disregard for the truth, supported by an offer of proof. ", "State v. Ildefonso, 262 Neb. 672, 634 N.W.2d 252 (2001). ", "Further, no hearing is required if, when the material which is the subject of the alleged falsity or reckless disregard is set aside, there remains sufficient content in the warrant affidavit to support a finding of probable cause. ", "Id.\nHere, the facts do not suggest that any statement in the affidavit was a deliberate falsehood or showed reckless disregard for the truth. ", "A review of the record shows that when the officers stated in the affidavit that the tread and oil pan marks \"matched,\" it was because the marks were \"similar\" to the patterns available in the pictures that the officers used for comparison. ", "Hernandez' complaint about the use of the word \"match\" as compared to the word \"similar\" raises nothing more than a debate about differing interpretations of the words used and does not raise questions of deliberate or reckless falsehoods. ", "Although the record states that the vehicle was black instead of blue, Hernandez does not point to any intent of the officers to deceive. ", "Further, we determine that without information about the vehicle's color, the warrant would still be sufficient to support a finding of probable cause. ", "We conclude that Hernandez has not demonstrated that his trial counsel was ineffective for failing to request a Franks hearing. ", "See State v. Ildefonso, supra.", "\n\nAMENDED INFORMATION\nHernandez argues that he should have been rearraigned when the information was amended to add language about aiding and abetting. ", "Neb.Rev.Stat. § ", "29-1816 (Reissue 1995) provides in part:\nThe accused shall be arraigned by reading to him or her the indictment or information, unless the reading is waived by the accused when the nature of the charge is made known to him or her. ", "The accused shall then be asked whether he or she is guilty or not guilty of the offense charged. ", "If the accused appears in person and by counsel and goes to trial before a jury regularly impaneled and sworn, he or she shall be deemed to have waived arraignment and a plea of not guilty shall be deemed to have been made.", "\nHere, Hernandez appeared, was represented by counsel, and went to trial. ", "Accordingly, he has waived any argument that he should have been rearraigned.", "\nAt oral argument, Hernandez argued that he should have also been provided proper notice of the amended information to prepare for trial and that the trial court had a duty to make a record to show that his counsel never raised the issue. ", "Hernandez' assignment of error, however, addresses only the possibility that the court failed to rearraign him. ", "An appellate court does not consider errors which are argued but not assigned. ", "State v. Tyma, 264 Neb. 712, 651 N.W.2d 582 (2002). ", "We conclude that Hernandez' assignment of error is without merit.", "\n\n\n*587 MIRANDA ADVISORY FORM AND ADMISSIBILITY OF DNA TESTS\nWe recently decided the issues raised about the Miranda advisory form and admissibility of DNA tests in State v. Fernando-Granados, 268 Neb. 290, 682 N.W.2d 266 (2004). ", "Based on Fernando-Granados, we conclude that these assignments of error are without merit.", "\n\nCONCLUSION\nWe conclude that there was sufficient evidence to support a finding of probable cause to issue the search warrant and that Hernandez' counsel was not ineffective by failing to request a Franks hearing. ", "We further conclude that the district court did not err when it did not rearraign Hernandez or make a record showing that he had been rearraigned. ", "Finally, the court did not err when it overruled Hernandez' motion to suppress statements and when it admitted into the evidence the results of DNA tests.", "\nAFFIRMED.", "\n" ]

{ "pile_set_name": "FreeLaw" }

[ 0.020833333333333332, 0, 0, 0, 0, 0.0196078431372549, 0.04054054054054054, 0.047619047619047616, 0.007633587786259542, 0.0048543689320388345, 0, 0, 0.009523809523809525, 0, 0.015151515151515152, 0.005714285714285714, 0.023255813953488372, 0.009852216748768473, 0, 0.023255813953488372, 0.014184397163120567, 0, 0.01948051948051948, 0.015544041450777202, 0.008695652173913044, 0, 0, 0, 0, 0.009174311926605505, 0.007352941176470588, 0.00909090909090909, 0.008264462809917356, 0, 0.02027027027027027, 0, 0.009259259259259259, 0, 0.009345794392523364, 0.006578947368421052, 0, 0, 0.009900990099009901, 0.013513513513513514, 0, 0, 0, 0.008403361344537815, 0, 0, 0.012048192771084338, 0, 0, 0, 0, 0.019230769230769232, 0, 0.00411522633744856, 0, 0, 0, 0, 0, 0, 0, 0.018867924528301886, 0, 0, 0, 0, 0, 0, 0, 0.008695652173913044, 0, 0.005291005291005291, 0.0051813471502590676, 0.010309278350515464, 0.004405286343612335, 0, 0.004975124378109453, 0, 0, 0, 0, 0.0125, 0.006097560975609756, 0, 0, 0, 0.005813953488372093, 0.004761904761904762, 0, 0, 0, 0, 0, 0.007246376811594203, 0, 0.0078125, 0.03333333333333333, 0, 0, 0, 0, 0, 0.013513513513513514, 0, 0.0041841004184100415, 0, 0, 0.019230769230769232, 0.015384615384615385, 0.008695652173913044, 0.011111111111111112, 0.004651162790697674, 0.006802721088435374, 0.006493506493506494, 0, 0 ]

[ { "analysis_explanation": null, "end": 20, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16 }, { "analysis_explanation": null, "end": 52, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 44 }, { "analysis_explanation": null, "end": 83, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 67 }, { "analysis_explanation": null, "end": 136, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 128 }, { "analysis_explanation": null, "end": 155, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 138 }, { "analysis_explanation": null, "end": 184, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 162 }, { "analysis_explanation": null, "end": 191, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 186 }, { "analysis_explanation": null, "end": 219, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 208 }, { "analysis_explanation": null, "end": 257, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 243 }, { "analysis_explanation": null, "end": 321, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 314 }, { "analysis_explanation": null, "end": 330, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 323 }, { "analysis_explanation": null, "end": 395, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 376 }, { "analysis_explanation": null, "end": 665, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 659 }, { "analysis_explanation": null, "end": 677, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 669 }, { "analysis_explanation": null, "end": 687, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 683 }, { "analysis_explanation": null, "end": 728, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 724 }, { "analysis_explanation": null, "end": 1013, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1001 }, { "analysis_explanation": null, "end": 1042, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1027 }, { "analysis_explanation": null, "end": 1242, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1233 }, { "analysis_explanation": null, "end": 1269, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1247 }, { "analysis_explanation": null, "end": 1296, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1285 }, { "analysis_explanation": null, "end": 1475, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1470 }, { "analysis_explanation": null, "end": 1572, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1561 }, { "analysis_explanation": null, "end": 1578, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1574 }, { "analysis_explanation": null, "end": 1719, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1715 }, { "analysis_explanation": null, "end": 1742, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1724 }, { "analysis_explanation": null, "end": 1751, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1746 }, { "analysis_explanation": null, "end": 1788, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1784 }, { "analysis_explanation": null, "end": 1796, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1792 }, { "analysis_explanation": null, "end": 1864, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1858 }, { "analysis_explanation": null, "end": 1877, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1869 }, { "analysis_explanation": null, "end": 1901, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1883 }, { "analysis_explanation": null, "end": 1934, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1925 }, { "analysis_explanation": null, "end": 1959, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1950 }, { "analysis_explanation": null, "end": 2012, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2008 }, { "analysis_explanation": null, "end": 2138, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2126 }, { "analysis_explanation": null, "end": 2160, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2146 }, { "analysis_explanation": null, "end": 2238, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2229 }, { "analysis_explanation": null, "end": 2320, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2312 }, { "analysis_explanation": null, "end": 2370, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2361 }, { "analysis_explanation": null, "end": 2541, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2532 }, { "analysis_explanation": null, "end": 2835, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2826 }, { "analysis_explanation": null, "end": 3111, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3107 }, { "analysis_explanation": null, "end": 3309, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3300 }, { "analysis_explanation": null, "end": 3366, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3354 }, { "analysis_explanation": null, "end": 3377, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3368 }, { "analysis_explanation": null, "end": 3405, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3398 }, { "analysis_explanation": null, "end": 3435, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3421 }, { "analysis_explanation": null, "end": 3456, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3444 }, { "analysis_explanation": null, "end": 3534, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3525 }, { "analysis_explanation": null, "end": 3567, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3558 }, { "analysis_explanation": null, "end": 3701, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3692 }, { "analysis_explanation": null, "end": 3789, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3780 }, { "analysis_explanation": null, "end": 3821, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3804 }, { "analysis_explanation": null, "end": 3974, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3965 }, { "analysis_explanation": null, "end": 4079, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4072 }, { "analysis_explanation": null, "end": 4218, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4211 }, { "analysis_explanation": null, "end": 4288, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4279 }, { "analysis_explanation": null, "end": 4441, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4432 }, { "analysis_explanation": null, "end": 4510, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4503 }, { "analysis_explanation": null, "end": 4674, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4667 }, { "analysis_explanation": null, "end": 4868, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4861 }, { "analysis_explanation": null, "end": 4915, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4911 }, { "analysis_explanation": null, "end": 4935, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4931 }, { "analysis_explanation": null, "end": 4958, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4954 }, { "analysis_explanation": null, "end": 5152, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5143 }, { "analysis_explanation": null, "end": 5163, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5154 }, { "analysis_explanation": null, "end": 5267, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5258 }, { "analysis_explanation": null, "end": 5323, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5309 }, { "analysis_explanation": null, "end": 5446, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5437 }, { "analysis_explanation": null, "end": 5513, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5504 }, { "analysis_explanation": null, "end": 5623, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5608 }, { "analysis_explanation": null, "end": 6402, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6396 }, { "analysis_explanation": null, "end": 6437, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6433 }, { "analysis_explanation": null, "end": 6707, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6698 }, { "analysis_explanation": null, "end": 7499, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7495 }, { "analysis_explanation": null, "end": 8048, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8039 }, { "analysis_explanation": null, "end": 8084, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8080 }, { "analysis_explanation": null, "end": 9514, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9505 }, { "analysis_explanation": null, "end": 9851, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9842 }, { "analysis_explanation": null, "end": 9940, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9931 }, { "analysis_explanation": null, "end": 10172, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10168 }, { "analysis_explanation": null, "end": 10213, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10209 }, { "analysis_explanation": null, "end": 11067, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11063 }, { "analysis_explanation": null, "end": 11103, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11094 }, { "analysis_explanation": null, "end": 11138, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11132 }, { "analysis_explanation": null, "end": 11424, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11414 }, { "analysis_explanation": null, "end": 11438, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11428 }, { "analysis_explanation": null, "end": 11448, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11444 }, { "analysis_explanation": null, "end": 11490, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11486 }, { "analysis_explanation": null, "end": 11960, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11951 }, { "analysis_explanation": null, "end": 11996, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11992 }, { "analysis_explanation": null, "end": 12073, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12067 }, { "analysis_explanation": null, "end": 12201, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12195 }, { "analysis_explanation": null, "end": 13061, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13052 }, { "analysis_explanation": null, "end": 13372, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13363 }, { "analysis_explanation": null, "end": 13608, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13599 }, { "analysis_explanation": null, "end": 13700, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13694 }, { "analysis_explanation": null, "end": 13895, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13891 }, { "analysis_explanation": null, "end": 13914, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13907 }, { "analysis_explanation": null, "end": 13928, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13924 }, { "analysis_explanation": null, "end": 14475, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14466 }, { "analysis_explanation": null, "end": 14638, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14629 }, { "analysis_explanation": null, "end": 14858, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14849 }, { "analysis_explanation": null, "end": 15053, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15049 }, { "analysis_explanation": null, "end": 15089, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15085 }, { "analysis_explanation": null, "end": 15346, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15329 }, { "analysis_explanation": null, "end": 15356, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15352 }, { "analysis_explanation": null, "end": 15382, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15378 }, { "analysis_explanation": null, "end": 15619, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15610 }, { "analysis_explanation": null, "end": 15679, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15673 }, { "analysis_explanation": null, "end": 15894, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15885 }, { "analysis_explanation": null, "end": 13901, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 13891 } ]

[ "Île Louviers\n\nThe Île Louviers, also known as the Île aux Javiaux, was an island in the Seine in Paris, France, that was attached to the bank in the nineteenth century. ", "In the Early Middle Ages it was used for executions.", "\n\nGeography\nThe island was situated in the river slightly upstream of the Île Saint-Louis. ", "In 1408 the island belonged to the Nicolas de Louviers, whose name remained attached to it to the end. ", "It was a low-lying ait in the river, used for pasturage as it was prone to flooding. ", "The city of Paris purchased it in 1700 and let it out to timber merchants, whose supplies were floated downstream. ", "As late as 1742 it was still scarcely inhabited (see the map of 1742 as illustration).", "\n\nA three-arched bridge, the Pont de Grammont, connecting it to Quai St-Bernard across the backwater called the bras de Grammont, was under construction in 1836, according to Galignani's New Paris Guide, but in 1847 the narrow space separating it from the Right Bank was filled in and joined to Quai Morland. ", "During the Revolution of 1848 the new ground was temporarily used for an encampment of the army.", "\n\nReferences\nThéophile Lavallée, Histoire de Paris depuis le temps des Gaulois jusqu'à nos jours, 2e ed. ", "1857, vol. ", "II, chap. ", "2, p. 8\n\nCategory:Landforms of Paris\nLouviers\nLouviers\nCategory:Islands of Île-de-France\nCategory:Île-de-France region articles needing translation from French Wikipedia" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0, 0, 0, 0, 0, 0, 0, 0.019417475728155338, 0, 0.02857142857142857, 0, 0.1, 0.005917159763313609 ]

[ { "analysis_explanation": null, "end": 65, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 46 }, { "analysis_explanation": null, "end": 93, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 88 }, { "analysis_explanation": null, "end": 102, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 97 }, { "analysis_explanation": null, "end": 110, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 104 }, { "analysis_explanation": null, "end": 167, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 145 }, { "analysis_explanation": null, "end": 366, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 347 }, { "analysis_explanation": null, "end": 517, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 512 }, { "analysis_explanation": null, "end": 538, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 534 }, { "analysis_explanation": null, "end": 860, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 856 }, { "analysis_explanation": null, "end": 915, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 911 }, { "analysis_explanation": null, "end": 1007, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 995 }, { "analysis_explanation": null, "end": 1213, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1209 }, { "analysis_explanation": null, "end": 1266, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1261 }, { "analysis_explanation": null, "end": 1341, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1335 } ]

[ "The Ohio-based anchor of the affordable pistol market is promising to break from their traditional mold and move into a more modern handgun offering.", "\n\nHi-Point, which is in the midst of a rebranding of sorts now some three years after their founders death, has few details of their new pistol set for release later this month, but has confirmed that it will include a threaded barrel and will have a standard capacity of larger than 10-rounds, both of which are a departure from their normal fare.", "\n\n“This is not an old model with a few tweaks like the latest version of someone’s 1911,” said Shults Media, Hi-Point’s PR company. “", "This is an entirely new pistol of a more contemporary design and yet will retain Hi-Point’s affordable pricing, reliability, robust construction, accuracy and owner following lifetime warranty.”", "\n\nFounded by Tom Deeb in Mansfield, Ohio in 1993 during the federal assault weapons ban, the company’s first handgun model was the sub-$200 C-9, a simple yet reliable blowback action handgun with a single-stack 8-round capacity. ", "The model is still in production today in a number of finishes and, while Hi-Point offers magazines with a higher capacity than the basic 8-round as the AWB has long since expired, they are still single stacks. ", "Likewise, the company has long shied away from production threaded barrel offerings even though the use of suppressors has expanded phenomenally in the past decade.", "\n\nAccording to the most recent data available from federal regulators, Hi-Point, manufacturing as Strassels Machine in Mansfield, produced no less than 69,900 9mm pistols in 2016, a figure only bested in the same category by Glock, Ruger, Sig, S&W and SCCY." ]

{ "pile_set_name": "OpenWebText2" }

[ 0, 0, 0.007518796992481203, 0, 0.004366812227074236, 0, 0, 0.01556420233463035 ]

[ { "analysis_explanation": null, "end": 8, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4 }, { "analysis_explanation": null, "end": 227, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 211 }, { "analysis_explanation": null, "end": 324, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 308 }, { "analysis_explanation": null, "end": 582, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 578 }, { "analysis_explanation": null, "end": 602, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 590 }, { "analysis_explanation": null, "end": 612, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 604 }, { "analysis_explanation": null, "end": 718, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 710 }, { "analysis_explanation": null, "end": 843, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 835 }, { "analysis_explanation": null, "end": 856, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 847 }, { "analysis_explanation": null, "end": 862, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 858 }, { "analysis_explanation": null, "end": 870, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 866 }, { "analysis_explanation": null, "end": 1089, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1084 }, { "analysis_explanation": null, "end": 1425, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1410 }, { "analysis_explanation": null, "end": 1504, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1496 }, { "analysis_explanation": null, "end": 1553, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1544 }, { "analysis_explanation": null, "end": 1603, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1599 } ]

[ "Thu June 7, 2012\n\nHow The Housing Industry Affects Students' Future\n\nWe're going to hear now about some surprising consequences of the weak housing market in this country. ", "It turns out that the value - even on a paper - of a home can affect the college choices that a family makes.", "\n\nNPR science correspondent Shankar Vedantam regularly joins us to discuss social science research. ", "He's here this morning to talk about those new findings. ", "And good morning.", "\n\nSHANKAR VEDANTAM, BYLINE: Hi, Renee.", "\n\nMONTAGNE: This new research, describe it for us.", "\n\nVEDANTAM: Well, we've known for a long time, Renee, that a bad economy affects all kinds of things. ", "So when young people graduate from college and they enter a weak economy, it affects their wages over the course of their entire lifetimes.", "\n\nNow, this one economist I spoke with - his name is Michael Lovenheim; he's at Cornell University. ", "He decided to look at one, specific part of the economy: the housing market. ", "And he finds that the effects of the housing market influence where students are going to college. ", "Here he is.", "\n\nMICHAEL LOVENHEIM: What we see is that students who obtain more housing wealth when they were in high school were more likely to go to flagship schools; were less likely to go to community colleges; were more likely to graduate. ", "These educational outcomes, and the earnings that you get from going to higher-quality schools, have effects on people's lives.", "\n\nMONTAGNE: Now, how much are students affected by housing prices? ", "I mean, is it just a little bit, or is it significant?", "\n\nVEDANTAM: Well, Lovenheim told me it's actually quite a bit, and this is especially true for families that are making less than $75,000 a year. ", "And so when you look at the typical increase, and the decrease, in housing values for those kinds of families across the United States, it seems to affect the college choice by as much as 25 to 30 percent. ", "So in other words, in a bad housing market, students might be 30 percent less likely to go to the flagship schools, rather than a community college.", "\n\nMONTAGNE: Why would that be? ", "Because if a family is living in a home and not needing to sell it, why would the lower value of a house have such a large effect on where their children might go to college?", "\n\nVEDANTAM: So, I think there are multiple possible explanations for that, Renee. ", "The first is the rational, straightforward explanation - which is that families are borrowing against the value of their homes in order to send their kids to college. ", "And so in a weak housing market, they have less equity in the house, and they may even have less liquidity that can come out of the house. ", "And so it limits their choices in where kids can go to college.", "\n\nBut there's another factor, and the other factor is probably psychological. ", "What Lovenheim thinks is happening, is that many students are internalizing how poor their parents feel in a bad housing market, and this is limiting their choices about where to go, because it's not the case that students are applying to the flagship schools, getting in, and then finding out that they can't get financial aid, or they can't afford it. ", "They're simply not applying to those schools at all.", "\n\nMONTAGNE: Does this not apply so much to the 1 percent - or at least, the higher-income families?", "\n\nVEDANTAM: Well, I certainly think that people who are wealthy are probably insulated from this quite a bit. ", "It also turns out that there is a legislative reason that we find ourselves in the boat that we do. ", "Back in 1992, Congress passed a law which said the value of your home can't be taken into account when you're applying for financial aid in college. ", "And this was wonderful during the boom years, because the value of your home could go up, and you could still qualify for financial aid in college. ", "But now, during a recession when housing values have dropped, it turns out you can't go to a school and say look, the value of my home has dropped by 25 percent. ", "Could you please give me some financial aid?", "\n\nMONTAGNE: But what about the idea that, you know, if you can overcome the psychological barrier, the feeling of being poor, that applying to a college is the same as it had been before the housing crash?", "\n\nVEDANTAM: I think this is actually what Lovenheim is saying, Renee. ", "He is saying that students should still apply to the flagship schools and see if they can qualify for financial aid, see if they can take out a loan. ", "I mean, he's an economist. ", "Part of the point that he's making is that the benefits of college, and the benefits of a good college, play out in your life over a matter of decades. ", "And being 10,000 or $20,000 extra in debt in a student loan, you know, is more than compensated for in the long-term returns of college.", "\n\nMONTAGNE: That's Shankar Vedantam, who joins us to talk about interesting social science research, on a regular basis. ", "You can find him on Twitter: @HiddenBrain. ", "And while you're at, you can follow this program: @MORNINGEDITION. ", "Transcript provided by NPR, Copyright NPR." ]

{ "pile_set_name": "Pile-CC" }

[ 0.005813953488372093, 0, 0.02, 0, 0, 0.02631578947368421, 0, 0.00980392156862745, 0, 0.02, 0, 0, 0, 0.004329004329004329, 0, 0, 0, 0.00684931506849315, 0, 0, 0, 0, 0.012195121951219513, 0, 0, 0, 0, 0.002824858757062147, 0.019230769230769232, 0, 0, 0, 0.006711409395973154, 0, 0, 0, 0, 0.02857142857142857, 0, 0, 0, 0, 0.008264462809917356, 0.023255813953488372, 0.014925373134328358, 0.047619047619047616 ]

[ { "analysis_explanation": null, "end": 67, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 0 }, { "analysis_explanation": null, "end": 324, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 308 }, { "analysis_explanation": null, "end": 402, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 390 }, { "analysis_explanation": null, "end": 453, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 446 }, { "analysis_explanation": null, "end": 471, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 455 }, { "analysis_explanation": null, "end": 490, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 485 }, { "analysis_explanation": null, "end": 591, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 586 }, { "analysis_explanation": null, "end": 849, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 832 }, { "analysis_explanation": null, "end": 1084, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1067 }, { "analysis_explanation": null, "end": 1569, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1560 }, { "analysis_explanation": null, "end": 1822, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1805 }, { "analysis_explanation": null, "end": 2325, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2320 }, { "analysis_explanation": null, "end": 2787, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2778 }, { "analysis_explanation": null, "end": 3498, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3494 }, { "analysis_explanation": null, "end": 3679, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3665 }, { "analysis_explanation": null, "end": 4243, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4234 }, { "analysis_explanation": null, "end": 4260, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4255 }, { "analysis_explanation": null, "end": 4589, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4582 }, { "analysis_explanation": null, "end": 4761, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4745 } ]

[ "The same scene in the final cut of the movie showed the couple embracing and looking positively gleeful as they prepared to spend some quality time together.", "\n\nSo did something change drastically during reshoots?", "\n\nMargot Robbie might not have always been so well-treated by her on-screen boyfriend in Suicide Squad (Picture: Barcroft Media)\n\nIt’s known that there are two versions of the film, and the one released in cinemas is notably lighter in tone, following extensive reshoots to add jokes.", "\n\nPerhaps more gentlemanly behaviour from Mr J was also added to the mix.", "\n\nEarly promotion of the film saw Margot Robbie describe Harley and the Joker as having ‘an incredibly dysfunctional relationship’, which seems like an exaggeration considering how their (small) part of the film turned out.", "\n\nHarley and the Joker in his car (Picture: Warner Bros)\n\nRegardless of how their relationship was set up in the comics, this image – published in Rolling Stone Brazil – seems to suggest director David Ayer originally intended there to be a lot less harmony in the Joker and Harley’s love affair than fans ended up seeing." ]

{ "pile_set_name": "Pile-CC" }

[ 0, 0, 0.007042253521126761, 0, 0.013452914798206279, 0.018633540372670808 ]

[ { "analysis_explanation": null, "end": 224, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 211 }, { "analysis_explanation": null, "end": 538, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 537 }, { "analysis_explanation": null, "end": 611, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 598 }, { "analysis_explanation": null, "end": 641, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 636 }, { "analysis_explanation": null, "end": 808, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 803 }, { "analysis_explanation": null, "end": 946, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 933 }, { "analysis_explanation": null, "end": 953, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 947 }, { "analysis_explanation": null, "end": 992, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 982 }, { "analysis_explanation": null, "end": 1056, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1051 } ]

[ "Fluoxetine Modulates Spontaneous and Conditioned Behaviors to Carbon Dioxide (CO2) Inhalation and Alters Forebrain-Midbrain Neuronal Activation.", "\nPanic disorder (PD), a prevalent anxiety disorder, is characterized by unexpected panic attacks, persistent anxiety and avoidance of panic contexts. ", "Selective serotonin reuptake inhibitors (SSRIs) are effective in treating PD; however, the mechanisms underlying SSRI efficacy are poorly understood. ", "Using CO2-inhalation, a PD-relevant translational paradigm, we examined the effect of chronic SSRI (fluoxetine) treatment on unconditioned and context-conditioned defensive behaviors, as well as respiratory responses, in mice. ", "In addition, cFos expression was evaluated as a measure of the functional activity and interregional correlation matrices were used to explore the neurocircuitry recruited in CO2-conditioned behavior and SSRI treatment response. ", "Chronic fluoxetine attenuated CO2-induced passive (freezing) behavior during inhalation and active (rearing) behavior on re-exposure to context, in addition to reducing CO2-evoked respiratory responses. ", "Brain mapping in CO2-context-conditioned mice revealed altered regional neuronal activation within and correlations across midbrain regions subserving defensive behaviors (periaqueductal gray (PAG) and raphe nuclei) and forebrain emotional and contextual processing loci (medial prefrontal cortex, insular cortex and hippocampus). ", "Importantly, fluoxetine treatment normalized these alterations. ", "Collectively, our results provide novel information on fluoxetine modulation of panic-relevant defensive behaviors and neurocircuitry, facilitating increased understanding of panic neurobiology in the context of treatment response." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.006944444444444444, 0, 0, 0, 0.004366812227074236, 0, 0.0030211480362537764, 0, 0 ]

[ { "analysis_explanation": null, "end": 688, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 684 } ]

[ "Q:\n\nTensorflow transform on beams with flink runner\n\nIt may seem stupid but it is my very first post here. ", "Sorry for doing anything wrong.", "\nI am currently building a simple ML pipeline with TFX 0.11 (i.e. tfdv-tft-tfserving) and tensorflow 1.11, using python2.7. ", "I currently have a apache-flink cluster and I want to use that for TFX. ", "I know the framework behind TFX is apache-beams 2.8, and it (apache-beams) supports flink with python SDK currently through a portable runner layer.", "\nBut the problem is how I can code in TFX (tfdv-tft) using apache-beams with flink runner through this portable runner concept, as TFX currently seems to only support DirectRunner and DataFlowRunner (Google Cloud). ", "\nI have been searching through the web for some time, and see the last line in TFX website,\n\"Please direct any questions about working with tf.", "Transform to Stack Overflow using the tensorflow-transform tag.\"", "\nAnd that's why I am here. ", "Any idea or workaround is really appreciated. ", "Thank you!", "\n\nA:\n\nThanks for the question.", "\nDisclaimer: Portable Flink Runner is still in experimental phase will only work with trivial amount of input data.", "\nHere is how you can run TFX on Flink via Beam.", "\nPrerequisite\n\nLinux\nDocker\nBeam Repo: https://github.com/apache/beam\nDistributed file system for input and output. ", "\n\nInstructions to run a python pipeline: https://beam.apache.org/roadmap/portability/#python-on-flink\nNote: We currently only support Flink 1.5.5\nInstructions\n1) Build Worker Containers:\n\nGo to Beam checkout dir\nRun gradle command: ./gradlew :beam-sdks-python-container:docker\n\n2) Run Beam JobServer for Flink:\n\nGo to Beam checkout dir\nRun gradle command: ./gradlew beam-runners-flink_2.11-job-server:runShadow\nNote: this command will not finish as it starts the job server and keep it running.", "\n\n3) Submit a pipeline\n\nPlease refer to https://github.com/angoenka/model-analysis/blob/hack_1/examples/chicago_taxi/preprocess_flink.sh\nNote: make sure to pass following flags to your pipeline\n\n --experiments=beam_fn_api \n --runner PortableRunner \n --job_endpoint=localhost:8099 \n --experiments=worker_threads=100 \n --execution_mode_for_batch=BATCH_FORCED\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0, 0, 0.008064516129032258, 0.013888888888888888, 0.013513513513513514, 0.009302325581395349, 0.006993006993006993, 0, 0, 0, 0, 0, 0.008695652173913044, 0.02127659574468085, 0.008620689655172414, 0.010121457489878543, 0.00267379679144385 ]

[ { "analysis_explanation": null, "end": 51, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 39 }, { "analysis_explanation": null, "end": 423, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 418 }, { "analysis_explanation": null, "end": 439, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 436 }, { "analysis_explanation": null, "end": 661, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 649 }, { "analysis_explanation": null, "end": 1050, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1029 }, { "analysis_explanation": null, "end": 1922, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1826 }, { "analysis_explanation": null, "end": 2024, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1999 }, { "analysis_explanation": null, "end": 1247, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 1217 }, { "analysis_explanation": null, "end": 1393, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 1333 }, { "analysis_explanation": null, "end": 1922, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 1826 } ]

[ "Lexi has promised to divert her slave after weeks of frustration from chastity now. ", "She strokes and then teases his cock into the edge repeatedly stuffs his rock hard prick back into the steel chastity cage where it goes." ]

{ "pile_set_name": "Pile-CC" }

[ 0.011904761904761904, 0 ]

[ { "analysis_explanation": null, "end": 4, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 0 }, { "analysis_explanation": null, "end": 49, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 44 } ]

[ "Adenovirus mediated expression of human paraoxonase 2 protects against the development of atherosclerosis in apolipoprotein E-deficient mice.", "\nAccumulating evidence suggests that the oxidative modification of low-density lipoprotein (LDL) plays an integral role in the initiation and progression of atherosclerosis. ", "We have previously reported that human paraoxonase (PON)2 possesses antioxidant properties and is capable of preventing LDL oxidation in vitro. ", "The objective of this study was to determine whether elevated levels of PON2 could protect against the development of atherosclerosis in vivo. ", "Six-month-old apolipoprotein E-deficient mice (apoE(-/-)) were injected intravenously with either PBS or 3 x 10(11) particles of adenovirus expressing GFP (AdGFP) or human PON2 (AdPON2). ", "Three weeks post-injection, lesion area was significantly lower in mice treated with AdPON2 compared to their control counterparts. ", "Serum from AdPON2 treated mice contained significantly lower levels of lipid hydroperoxides and exhibited an enhanced potential to efflux cholesterol from cholesterol-loaded macrophages. ", "In addition, LDL from AdPON2 treated mice was less susceptible to oxidation, while HDL from these same mice was significantly more capable of protecting LDL against oxidation. ", "These results demonstrate for the first time that elevated levels of PON2 can enhance the efflux potential and antioxidant capacity of serum, increase the anti-inflammatory properties of HDL, and protect against the development of atherosclerosis in vivo." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0, 0, 0.006944444444444444, 0, 0.0106951871657754, 0, 0, 0.005681818181818182, 0.00392156862745098 ]

[ { "analysis_explanation": null, "end": 365, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 354 }, { "analysis_explanation": null, "end": 615, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 602 }, { "analysis_explanation": null, "end": 800, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 789 } ]

[ "Q:\n\nSwift Eureka forms: how do you limit the number of rows in a multivalued section?", "\n\nI am using Eureka to build a form in iOS using Swift. ", "I have created a multivalued section, e.g.:\nform +++ MultivaluedSection(multivaluedOptions: [.Insert, .Delete], header: \"My Header\", footer: \"My footer\") { section in\n section.tag = \"mySectionTag\"\n section.addButtonProvider = { _ in\n return ButtonRow() { row in\n row.title = \"Add row\"\n }\n }\n\n section.multivaluedRowToInsertAt = { index in\n return TimeInlineRow() { row in\n row.title = \"My row title\"\n }\n }\n // initialize form with any times that have already been set previously, times: [Date]\n for time in times {\n section <<< TimeInlineRow(tag) { row in\n row.value = time\n row.title = \"My row title\"\n }\n}\n\nI would like to limit the number of rows you can insert into my multi valued section. ", "Was thinking about doing it by hiding the ButtonRow using some kind of Condition but I'm not sure how to connect it. ", "Alternatively could just present an alert if you tap the button row when the count of values() in the section is too high, but then how do you block the actual inserting?", "\nWas also considering that I could do something inside multivaluedRowToInsertAt based on index but still not sure what.", "\nLooked through the issues and was surprised not to find anything on this already, so I can only assume I'm missing something obvious.", "\nAnother thought I had was to set a Condition on the ButtonRow in the addButtonProvider that returns true if the row with a certain max row tag (that I create) is not nil in the form (i.e. no such row exists), and then in the multivaluedRowToInsertAt it would check if the index is greater than the max allowable index and if so it applies the max tag when creating that row. ", "But it seems the green + insert button is automatically applied to the last row of the section regardless of the type. ", "Then I tried changing the multivaluedOptions to just .Delete when the max rows are reached but I'm having trouble figuring out how to get it to go back to allowing inserting after a row is deleted.", "\nAlso tried putting a condition on the ButtonRow's disabled property based on a similar method as above (with a max row) but it also runs into duplicate row tag issues and the green add button still responds to taps, and the showInsertIconInAddButton property has no effect.", "\nEven if I get this method working, it seems unnecessarily convoluted and I would have expected there to be a much simpler solution since it seems like this would be the kind of functionality a lot of people would need.", "\n\nA:\n\nAs laid out in Mahbub's answer and hinted at in the original question, one can check the index in the multivaluedRowToInsertAt block and update the multivaluedOptions and hide the button row accordingly.", "\nProperties in FormViewController:\nprivate var myButtonRow: ButtonRow! // ", "Can also just refer to it by tag\nlet kMaxCount = 5\n\nInside a setup function in FormViewController: (not shown, setting up the section / button row / add provider etc)\nsection.multivaluedRowToInsertAt = { index in\n if index >= self.kMaxCount - 1 {\n section.multivaluedOptions = [.Delete] \n\n self.myButtonRow.hidden = true\n\n DispatchQueue.main.async() { // I'm not sure why this is necessary\n self.myButtonRow.evaluateHidden()\n }\n }\n\n return TimeRow() { row in // any row type you want — although inline rows probably mess this up\n row.title = title\n row.value = Date()\n }\n}\n\nThe changes to the button row inside multivaluedRowToInsertAt didn't seem to take hold until the 6th row was added, regardless of when the hidden method is called and what the max count is set to, and the last row that inserts goes in the second last place. ", "So then I tried the code as written above, with a dispatch call delaying evaluateHidden() and it seems to work. ", "I'm not sure why, presumably some conflicting race condition. ", "Note, when the insert method is called it is on the main thread, so it's not about changing UI on a background thread.", "\nThen for when rows are deleted there is a function called rowsHaveBeenRemoved you can override in a FormViewController subclass that is called whenever a row (in any section) is removed:\noverride func rowsHaveBeenRemoved(_ rows: [BaseRow], at indexes: [IndexPath]) {\n super.rowsHaveBeenRemoved(rows, at: indexes)\n if let index = indexes.first?.section, let section = form.allSections[index] as? ", "MultivaluedSection {\n if section.count < kMaxCount {\n section.multivaluedOptions = [.Insert, .Delete]\n myButtonRow.hidden = false // or could \n myButtonRow.evaluateHidden()\n }\n }\n}\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0, 0, 0.0012610340479192938, 0.008547008547008548, 0, 0, 0, 0.010638297872340425, 0, 0.005076142131979695, 0.0072992700729927005, 0, 0, 0.02702702702702703, 0.0032751091703056767, 0, 0, 0.00847457627118644, 0.0024875621890547263, 0.004310344827586207 ]

[ { "analysis_explanation": null, "end": 16, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4 }, { "analysis_explanation": null, "end": 103, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 97 }, { "analysis_explanation": null, "end": 1608, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1605 }, { "analysis_explanation": null, "end": 1775, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1772 }, { "analysis_explanation": null, "end": 1820, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1817 }, { "analysis_explanation": null, "end": 2041, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2038 }, { "analysis_explanation": null, "end": 2684, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2678 }, { "analysis_explanation": null, "end": 3702, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3691 }, { "analysis_explanation": null, "end": 3777, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3774 }, { "analysis_explanation": null, "end": 3943, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3929 }, { "analysis_explanation": null, "end": 354, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 344 }, { "analysis_explanation": null, "end": 484, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 474 }, { "analysis_explanation": null, "end": 792, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 786 }, { "analysis_explanation": null, "end": 3117, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 3107 }, { "analysis_explanation": null, "end": 3176, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 3169 }, { "analysis_explanation": null, "end": 3208, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 3198 }, { "analysis_explanation": null, "end": 3273, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 3266 }, { "analysis_explanation": null, "end": 3327, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 3306 }, { "analysis_explanation": null, "end": 3392, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 3385 }, { "analysis_explanation": null, "end": 3576, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 3570 }, { "analysis_explanation": null, "end": 4428, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 4420 }, { "analysis_explanation": null, "end": 4494, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 4484 }, { "analysis_explanation": null, "end": 4529, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 4522 }, { "analysis_explanation": null, "end": 4592, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 4582 }, { "analysis_explanation": null, "end": 4632, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 4622 } ]

[ "\"You called the dispatcher, right?\" \"", "We've got multiple vehicles, possible DOAs, multiple injuries.\" \"", "Major accident.\" \"", "We'll need more ambulances.\" \"", "All units have been deployed.\" \"", "I don't have an ETA.\" \"", "l need those medics.\" \"", "I'll do the best I can.\" \"", "Just get them over here.\" \"", "Can you hear me?\" \"", "Listen to me.\" \"", "Listen to me!\" \"", "Look at me.\" \"", "Look in my eyes.\" \"", "Can you feel that?\" \"", "That's my hand.\" \"", "Go on, hold it.\" \"", "We'll get you out of here.\" \"", "I need some help over here!\" \"", "It's okay.\" \"", "You're safe now, all right?\" \"", "You'll be okay.\" \"", "Just hang on.\" \"", "All right?\" \"", "You're doing fine.\" \"", "Don't let go.\" \"", "Don't let me go.\" \"", "Stay with me.\" \"", "Come on!\" \"", "Stay with me, all right?\" \"", "Stay with me.\" \"", "Good.\" \"", "Stay with me.\" \"", "What are you doing?\" \"", "That's my car.\" \"", "Nothing, I just\" \"What'd you take?\" \"", "l turned off\" \"Did you take something?\" \"", "You take my phone, huh?\" \"", "Wake up!\" \"", "Wake up!\" \"", "I helped you.\" \"", "I helped you.\" \"", "I'm sorry.\" \"", "That's the fiirst question people ask.\" \"", "Have I ever killed anyone?\" \"", "So casually, like asking me what kind of car l drive.\" \"", "Why don't they ever ask if I ever saved anyone?\" \"", "Have you?\" \"", "Saved anyone, I mean.\" \"", "My mother would argue that God's the only one that saves.\" \"", "It must be pretty exciting, though, catching bad guys.\" \"", "is this all we're gonna talk about?\" \"", "Look, I'm sorry.\" \"", "I'm not very good at dating.\" \"", "I take it your date sucked.\" \"", "I don't need to tell my story to a stranger.\" \"\"", "What do you do, where are you from?\"\" \"", "Your problem wasn't that he asked too many questions.\" \"", "You just didn't want to clean his little pipes.\" \"", "No, all I wanted to do was clean his pipes.\" \"", "The conversation pissed me off.\" \"", "Baby girl, if it's a servicing you need....\" \"Shut the fuck up.\" \"", "We've talked about this every week for six months.\" \"", "We've talked about this a thousand times.\" \"", "Come on.\" \"", "No!\" \"", "I am not having this conversation with you again.\" \"", "Hang on.\" \"", "None of your goddamn business.\" \"", "Hang on.\" \"", "What?\" \"", "Your keys are in the door.\" \"", "Then hang up. ", "I don't care.\" \"", "You're in 21 5, right?\" \"", "Then fuck you!\" \"", "Not you. ", "I'm talking to this idiot.\" \"", "You know what?\" \"", "Don't bother.\" \"", "Candace.\" \"", "I'm Catch.\" \"", "Charlie was just about to go to bed, weren't you?\" \"", "Bye.\" \"", "And I just ordered a pizza so I don't know if you're hungry-- l gotta go.\" \"", "See you around.\" \"", "I didn't see his van, so....\" \"Yeah, he's not here.\" \"", "How you doing?\" \"", "I'm okay.\" \"", "And Cathy and Larry, Jr.?\" \"", "I bet he's big now.\" \"", "He's growing fast.\" \"", "Does he look like you, or did he get lucky?\" \"", "He's got Cathy's looks and my strength.\" \"", "You should feel his grip.\" \"", "So what's with the cryptic message?\" \"\"", "Call me, we have to talk.\" ", "Sounds like bad news.\" \"", "Mom and Dad are renewing their vows.\" \"", "Church, priest, the whole thing.\" \"", "Renewing their vows?\" \"", "With a party at the house afterwards.\" \"", "Mom wants you to come.\" \"", "Does he?\" \"", "We're working on Dad.\" \"", "Over 10 years, and he won't let it go\" \"No, Sharon!\" \"", "I won't go into that hole with you.\" \"", "I'm over that shit.\" \"", "You're still scared of him.\" \"", "You know what?\" \"", "You shouldn't come here in your uniform.\" \"", "People will think we're in trouble.\" \"", "Nice seeing you too.\" \"", "Yeah.\" \"", "Cocksucker!\" \"", "Get off of me!\" \"", "l'll kill you!\" \"", "Shut up!\" \"", "Motherfuck-- l'm gonna bend you over the car, bitch!\" \"", "Motherfucker!\" \"", "Shut up.\" \"", "You're under arrest!\" \"", "Fucking bitch!\" \"", "You are a crazy one.\" \"", "You are a pretty one, senorita!\" \"", "Those honey-brown eyes\" \" Fuck you!\" \"", "I'll take you in the back and do you, baby.\" \"", "You can suck my dick.\" \"", "This is 7673.\" \"", "We're bringing in one for processing.\" \"", "Look good in that uniform.\" \"", "Why don't you take it off?\" \"", "Take my handcuffs off too, you fucking bitch!\" \"", "Just one touch.\" \"", "Cut it out.\" \"", "You're gonna bust me!\" \"", "Give me one sweet touch.\" \"", "Fuck.\" \"", "Fuck you, faggot.\" \"", "Smells like bacon in here.\" \"", "That's not the touch I want, honey!\" \"", "Sit here.\" \"", "I ain't got time to babysit you.\" \"", "Put your hand on top of your head.\" \"", "Turn around.\" \"", "Sit down.\" \"", "Sit the fuck down!\" \"", "Fuck!\" \"", "Mike, you got another booking sheet?\" \"", "Fucking bitch!\" \"", "He needs a rag.\" \"", "Let me talk to you.\" \"", "Do we need to have another conversation?\" \"", "You'd just let him grab your balls?\" \"", "I saw you plan that in the car.\" \"", "Just waiting to do something to him.\" \"", "If I was out of line, put it in a report.\" \"", "I hate the graveyard shift. ", "lt fucks my system.\" \"", "All the shit you eat is fucking up your system.\" \"", "I love graveyard.\" \"", "No traffic.\" \"", "Nothing's worse than a 459 crosstown during rush hour.\" \"", "Might as well pull over, because you're gonna be late.\" \"", "You like graveyard because you have insomnia.\" \"", "I know what puts me to sleep.\" \"", "The sound of your own voice?\" \"", "That puts your wife to sleep.\" \"", "Get down!\" \"", "Down!\" \"", "Heads down!\" \"", "Do it now!\" \"", "Call 91 1 !\" \"", "Stop!\" \"", "Hold it right there!\" \"", "Hold it!\" \"", "Hold it!\" \"", "Heading south, University Field!\" \"", "Get down!\" \"", "Wait, damn it!\" \"", "Get up here!\" \"", "Drop the gun!\" \"", "Drop the gun!\" \"", "Pogo, what's your 20?\" \"", "Damn it!\" \"", "This one's for my brother, bitch!\" \"", "Drop the fucking gun!\" \"", "Drop the fucking gun!\" \"", "I said drop it!\" \"", "Get up!\" \"", "Put your hands on top of your head.\" \"", "Pogue, are you all right?\" \"", "You all right?\" \"", "Don't you move!\" \"", "Get down!\" \"", "Stay away from the gun!\" \"", "Are you all right?\" \"", "Yeah!\" \"", "I'm good. ", "I'm okay!\" \"", "Don't move!\" \"", "Put your hands on your head!\" \"", "He's okay!\" \"", "l told you to wait!\" \"", "I got you nectarines.\" \"", "The peaches were as hard as rocks.\" \"", "Your coat's all dirty.\" \"", "I tackled a guy.\" \"", "Why did you tackle a guy?\" \"", "He was going for a touchdown.\" \"", "Can you be serious?\" \"", "What day is it today?\" \"", "Wednesday.\" \"", "No.\" \"", "l met somebody today.\" \"", "Good.\" \"", "Oh, you got the broccolini.\" \"", "Thank you.\" \"", "It was a woman.\" \"", "You didn't tackle her too, did you?\" \"", "She's a police officer.\" \"", "Are you in trouble?\" \"", "l don't think so.\" \"", "Well, that's a good thing.\" \"", "I better go now.\" \"", "See you next week.\" \"", "Okay.\" \"", "Suddenly I see what's happening.\" \"", "Where are all the baby pigeons?\" \"", "I see nests with tiny eggs, but I don't see tiny pigeons.\" \"", "Why?\" \"", "You always ask the big questions.\" \"", "I got a big question for you.\" \"", "I can only ask you....\" \"Here, use this.\" \"", "Call your wife.\" \"", "Ask her instead.\" \"", "It's the hospital.\" \"", "Yeah.\" \"", "Gonna be okay?\" \"", "Yeah.\" \"", "Brian's gonna be all right.\" \"", "Didn't I tell you?\" \"", "He's tough.\" \"", "Tomorrow?\" \"", "We'll be there.\" \"", "Where's your partner?\" \"", "He has a wife.\" \"", "l got a wife.\" \"", "But his wife actually likes him.\" \"", "Where you going?\" \"", "The head.\" \"", "All right?\" \"", "To fix her makeup.\" \"", "Pogue wears makeup?\" \"", "Right, I need that lipstick you borrowed back.\" \"", "I didn't think you'd show.\" \"", "Why are you sitting here?\" \"", "I don't talk to a lot of people.\" \"", "Would you like to sit down?\" \"", "Yeah.\" \"", "Yeah, sure.\" \"", "l didn't thank you. ", "I'm Sharon Pogue.\" \"", "l'm Catch.\" \"", "Just Catch?\" \"", "Just Catch.\" \"", "Why would you do that, Catch?\" \"", "Jump somebody with a gun?\" \"", "He was gonna kill you.\" \"", "He could have killed you.\" \"", "You got a death wish?\" \"", "I guess I didn't have time to think about it.\" \"", "Hey!\" \"", "Hey, Pogo!\" \"", "What do you think about it now?\" \"", "lt was worth the risk.\" \"", "For somebody you don't even know?\" \"", "Yeah.\" \"", "And for what you do.\" \"", "I think cops are great.\" \"", "Trying to keep it safe for everybody.\" \"", "Tough job.\" \"", "Firemen they're heros. ", "lKids wave at them.\" \"", "People should wave at cops.\" \"", "What are you laughing at?\" \"", "Nothing.\" \"", "Ever think of how many people are here because you saved them?\" \"", "Or helped them, or arrested somebody who would've hurt them?\" \"", "Never thought about it.\" \"", "Or just because you did your job.\" \"", "Now I'm walking around because of you.\" \"", "Maybe you should be the cop.\" \"", "Wow, I don't know.\" \"", "I don't look really good in hats.\" \"", "What do you do?\" \"", "Where do you live?\" \"", "Where do you work?\" \"", "Okay.\" \"", "I'm sorry.\" \"", "Every time I talk to people, it comes out like an interrogation.\" \"", "You have a nice smile.\" \"", "Thank you.\" \"", "You gonna let us meet your hero?\" \"", "Catch, this is Ray.\" \"", "Hi, Ray.\" \"", "Catch.\" \"", "Why don't you join us?\" \"", "We want to buy you dinner for saving Pogo's ass.\" \"", "You know, I'm kind of tired.\" \"", "I'm gonna head home.\" \"", "Did I interrupt something?\" \"", "All right.\" \"", "I'll walk you to your car if you'd like.\" \"", "Yeah.\" \"", "Sure.\" \"", "It's a bad neighborhood.\" \"", "Maybe I should walk you to your car.\" \"", "I don't have a car.\" \"", "You want a ride home?\" \"", "No, thank you. ", "I'd like to walk.\" \"", "Are you okay to drive?\" \"", "I'm not drunk.\" \"", "You think I am?\" \"", "You'll know when I'm drunk. ", "I'll be throwing up.\" \"", "And I never throw up, so....\" \"Don't worry about it, okay?\" \"", "Get in the car, will you?\" \"", "I'm on Ashland, off 18th street.\" \"", "l never drive.\" \"", "Why not?\" \"", "What?\" \"", "I was trying to picture you without your clothes.\" \"", "Excuse me?\" \"", "l didn't mean it like that.\" \"", "I mean, I'm trying to picture you out of uniform.\" \"", "On your day off, in regular clothes.\" \"", "I don't live here.\" \"", "I know.\" \"", "This is where l live.\" \"", "You know those guys at the bar?\" \"", "They're my friends.\" \"", "Sort of.\" \"", "We work together, we tell jokes, we bullshit.\" \"", "I can't say to them....\" \"What?\" \"", "Every time I shut my eyes, I see that damn gun.\" \"", "I hear that pop.\" \"", "I feel a bullet slamming into my chest and....\" \"l don't know why I'm telling you, except you were there....\" \"l must be drunk.\" \"", "I want to know why you were walking by the stadium at that minute.\" \"", "What if you hadn't been there?\" \"", "I guess we were supposed to meet.\" \"", "If you want, you can come in for a bit.\" \"", "Okay.\" \"", "You want a drink?\" \"", "No, thanks.\" \"", "Mind getting the door?\" \"", "Sit down or something.\" \"", "I'm circling a while.\" \"", "Don't look.\" \"", "I didn't straighten up.\" \"", "So?\" \"", "It's more real this way.\" \"", "It's rude.\" \"", "Now I'm here, you seem mad about it.\" \"", "Trust me, when I'm mad, you'll know it.\" \"", "It's just I'm not used to letting anybody up here.\" \"", "But you're here, so....\" \"Anyway....\" \"Let's talk about something stupid.\" \"", "You first.\" \"", "What's that \"supposed to\" business?\" \"", "That we were supposed to meet?\" \"", "It sounds a little too Psychic Friends Network to me.\" \"", "Some people say we each give off a particular odor that can only be detected by one other person's brain.\" \"", "So we smell each other.\" \"", "Who says that?\" \"", "l have no idea.\" \"", "You're crazy.\" \"", "Thanks for coming up here.\" \"", "Does that mean I'm going?\" \"", "No!\" \"", "I mean, you don't have to.\" \"", "So you're okay now.\" \"", "What, are you here as a medic?\" \"", "is this the \"mad\" part?\" \"", "Maybe going is a good idea.\" \"", "Can I come back sometime?\" \"", "Why?\" \"", "Must be the smell.\" \"", "I gotta go.\" \"", "Oh, God....\" \"What's the matter, you blind?\" \"", "Fucking idiot.\" \"", "What are you guys doing here?\" \"", "Hey, you!\" \"", "Your mom's been bugging us to come for lunch.\" \"", "Mom, can we go now?\" \"", "ln a minute.\" \"", "So how is she?\" \"", "She's really good.\" \"", "She'll be happy to see you.\" \"", "My dad's not here?\" \"", "So you talked to Larry?\" \"", "He told me.\" \"", "Yeah.\" \"", "He told me about this renewing-the-vows thing.\" \"", "You're gonna come, I hope?\" \"", "Come, Shar.\" \"", "I think you should.\" \"", "Aunt Sharon, can I see your police car?\" \"", "Come on, Mom!\" \"", "Hold on. ", "I gotta go.\" \"", "Bye.\" \"", "Looks the same.\" \"", "Still smells like cigarettes.\" \"", "Thought he quit.\" \"", "Only six a day.\" \"", "Larry told you I stopped by?\" \"", "is that why you called?\" \"", "I called you because we want you to come when we renew our vows.\" \"", "How come you're renewing your vows?\" \"", "It's a sort of a fresh start.\" \"", "Your idea?\" \"", "Both of us.\" \"", "It's a way of having the marriage blessed.\" \"", "Wasn't it blessed before?\" \"", "Of course it was blessed before.\" \"", "You just....\" \"l just what, Ma?\" \"", "You just think of the bad.\" \"", "You never remember the good.\" \"", "I wish you remembered that.\" \"", "I wish I remembered it too.\" \"", "Does Dad?\" \"", "Does he remember anything good about me?\" \"", "He doesn't hate you.\" \"", "He just still feels hurt.\" \"", "Hurt?\" \"", "I hurt him?\" \"", "Being arrested like that?\" \"", "Nobody forgets that.\" \"", "How did you forget what he did to you?\" \"", "It wasn't as bad\" \"You make it sound worse.\" \"", "It hadn't been like this for years.\" \"", "I'm glad it hasn't been that way.\" \"", "That means it worked!\" \"", "That's why I did it!\" \"", "Why do I get punished for this?\" \"", "Nobody's punishing you.\" \"", "We're inviting you.\" \"", "Will you come?\" \"", "Do you have a machine?\" \"", "What?\" \"", "Do you have an answering machine?\" \"", "Yes.\" \"", "Hang up, and I'll call your machine.\" \"", "Why?\" \"", "Please leave a message after the tone.\" \"", "It's Sharon.\" \"", "Maybe we can have breakfast or something.\" \"", "I usually get up early to run in Lincoln Park.\" \"", "There's a coffee shop across the street.\" \"", "Like 8 or so?\" \"", "If you're there, you're there.\" \"", "Please leave a message after the tone.\" \"", "Hi.\" \"", "Don'tpick up.\" \"", "Look I didn't get much sleep and maybe this was a bad idea anyway.\" \"", "I was feeling kind of weird last night.\" \"", "Anyway, I'm fline now.\" \"", "So let's just leave it where it's at.\" \"", "Fuck!\" \"", "What?\" \"", "Who is it?\" \"", "What?\" \"", "I was just getting to sleep, finally.\" \"", "We made a date.\" \"", "It wasn't a date.\" \"", "An appointment.\" \"", "I keep my appointments.\" \"", "Do you have door issues?\" \"", "I called you at 7:00.\" \"", "I get up early. ", "I walked there.\" \"", "I waited for you.\" \"", "Check your messages.\" \"", "I need sleep.\" \"", "Come back in a month.\" \"", "Why do you think I'd come back?\" \"", "Why are you here?\" \"", "When you tell somebody you'll be somewhere that person rearranges his life.\" \"", "Be aware of that.\" \"", "And more considerate\" \"What's in the bag?\" \"", "What?\" \"", "What's in the bag?\" \"", "None of your business.\" \"", "Got coffee?\" \"", "You think you deserve coffee?\" \"", "What about food?\" \"", "You definitely don't deserve food.\" \"", "l got coffee, sugar, sweetener\" \"Black.\" \"", "Whatever.\" \"", "Just black.\" \"", "So what kind of life did you rearrange to get coffee?\" \"", "You never talk about yourself.\" \"", "What do you do?\" \"", "What's the difference?\" \"", "What's the difference?\" \"", "You're standing in my bedroom, looking through my panty drawer.\" \"", "That's the difference.\" \"", "Who are you?\" \"", "Somebody who keeps his appointments.\" \"", "Shit, you're married!\" \"", "Give me my coffee.\" \"", "Give it here.\" \"", "What--!\" \"", "I know, you're a criminal.\" \"", "Probably a felon.\" \"", "That's great.\" \"", "That's all I need.\" \"", "My name is Catch.\" \"", "I don't commit crimes.\" \"", "I like being with you.\" \"", "That's bullshit.\" \"", "I let you in here.\" \"", "I'm not gonna know anything about you?\" \"", "I need details.\" \"", "l need to start from here.\" \"", "That's ridiculous!\" \"", "Why?\" \"", "Because that's the way it is.\" \"", "Oh, your rules.\" \"", "My rules.\" \"", "Fine, I didn't want to know you that much anyway.\" \"", "I don't need this shit. ", "I'm tired.\" \"", "Haven't slept all night.\" \"", "Bye.\" \"", "Can I come in?\" \"", "Yeah.\" \"", "Come in.\" \"", "Thanks.\" \"", "Get that door thing under control.\" \"", "You live here?\" \"", "Nobody lives here.\" \"", "What is this, some kind of front?\" \"", "ls this what you told me about?\" \"", "What?\" \"", "Your interrogation.\" \"", "So do I need a lawyer?\" \"", "I don't like being jerked around.\" \"", "I'm not.\" \"", "Then tell me straight.\" \"", "Who are you?\" \"", "What are you looking for?\" \"", "Your life.\" \"", "I don't want any surprises.\" \"", "This is it. ", "I sleep here. ", "I walk around town.\" \"", "That's all.\" \"", "That's all of it?\" \"", "Except for you.\" \"", "The way I feel about you.\" \"", "Which is...?\" \"", "Surprising.\" \"", "I thought it was impossible.\" \"", "I thought I was....\" \"You thought you were what?\" \"", "Gay?\" \"", "Dead.\" \"", "Am I supposed to understand that?\" \"", "No, you're not.\" \"", "Do you ever wonder what \"scratch\" means?\" \"", "What people mean when they say, \"Let's start from scratch\"?\" \"", "This is scratch.\" \"", "This is scratch, all right.\" \"", "So this cat knows where you live?\" \"", "He's not dangerous.\" \"", "He's in no databases.\" \"", "There's no Catch anywhere\" \"You ran his name through?\" \"", "He's a ghost.\" \"", "l can't believe you did that!\" \"", "l'm just looking out for you.\" \"", "l don't need you to look out for me.\" \"", "No last name.\" \"", "That shit's weird.\" \"", "Oh, I remember that.\" \"", "That was a smile.\" \"", "You know the cop?\" \"", "The woman cop?\" \"", "She visited me.\" \"", "You're seeing her?\" \"", "She asks lots of questions.\" \"", "She wants to know everything.\" \"", "Of course she does.\" \"", "Everybody does.\" \"", "Talk to her.\" \"", "Talk to her about what?\" \"", "Talk to her, Catch.\" \"", "Talk to somebody.\" \"", "It's been almost a year.\" \"", "Every time I talk to somebody, it gets a little easier.\" \"", "I'm not saying it goes away\" \"She nice?\" \"", "She's tough.\" \"", "She pretty?\" \"", "That doesn't matter.\" \"", "She's pretty.\" \"", "She's sort of pissed off at me.\" \"", "Apologize.\" \"", "For what?\" \"", "lt doesn't matter.\" \"", "We like it when men apologize.\" \"", "I thought I'd get your machine.\" \"", "Want to call back?\" \"", "I won't answer.\" \"", "I thought you'd be working.\" \"", "I wish I was.\" \"", "Can't sleep?\" \"", "Me neither.\" \"", "Want to go somewhere?\" \"", "Now?\" \"", "It's 3 a.m. The whole world is sleeping.\" \"", "Not the whole world.\" \"", "is this a date?\" \"", "Just an appointment.\" \"", "We can rest, if you want.\" \"", "Well, then rest.\" \"", "See you later.\" \"", "I wish we could go swimming.\" \"", "Why can't we?\" \"", "In our clothes?\" \"", "Oh, my God!\" \"", "You can't take off your clothes in a state park!\" \"", "You need to learn to take a day off.\" \"", "Come on!\" \"", "Where are you going?\" \"", "I'm gonna tell!\" \"", "Oh, my God.\" \"", "Oh, God!\" \"", "Freezing!\" \"", "lKiss me someplace I've never been kissed.\" \"", "lKiss me someplace I've never been kissed.\" \"", "Thank you.\" \"", "What did I tell you about leaving the apartment without me?\" \"", "Gotta go.\" \"", "1034 to Rob-67, location confiirmed as Pogue residence possible 415.\" \"", "Neighbor is standing outside.\" \"", "Where's Larry?\" \"", "Calm down.\" \"", "Where is he?\" \"", "We waited to book him.\" \"", "Where is he?\" \"", "You gonna calm down?\" \"", "Don't talk to me like I'm a child!\" \"", "He's out back with Denny.\" \"", "lKathy's inside with the kid.\" \"", "Vanessa's with him.\" \"", "I'm gonna kill you!\" \"", "I'm getting nowhere with her.\" \"", "Maybe you can try.\" \"", "Got it.\" \"", "Are you okay?\" \"", "Neighbors moved in two weeks ago, and they're calling the police.\" \"", "Welcome to the neighborhood.\" \"", "Must've gotten pretty loud.\" \"", "We had a fight.\" \"", "People fight.\" \"", "Why don't you tell me\" \"Oh, my\" \"Shit!\" \"", "Don't make it worse.\" \"", "lt gets worse?\" \"", "lt's never happened before.\" \"", "Oh, first time for everything.\" \"", "Don't fucking patronize me.\" \"", "I don't need this shit.\" \"", "Look at you.\" \" ", "Look at you, in my house!\" \"", "Policing my family!\" \"", "Where do you get off?\" \"", "It's me. ", "I didn't hit you.\" \"", "I don't want your fucking pity, okay?\" \"", "It happened, all right?\" \"", "He's torn up about it.\" \"", "He's torn up about it?\" \"", "Fuck him!\" \"", "He's torn up?\" \"", "Has he hit Larry, Jr. yet?\" \"", "He'd never do that.\" \"", "He's a good man, Sharon.\" \"", "That's what my mother said to us.\" \"\"", "Your father's a good man.\" \"", "He's torn up about it.\"\" \"", "Get out of my house.\" \"", "Get the fuck out of my house!\" \"", "Have you looked into counseling?\" \"", "Want to hit a woman?\" \"", "Hit me!\" \"", "Fuck!\" \"", "Here we go.\" \"", "Calm\" \"Back off.\" \"", "lt was an accident.\" \"", "lt looks more like a car accident.\" \"", "Very funny.\" \"", "Look\" \"Shut up!\" \"", "You disgust me, you fucking coward!\" \"", "You're a fucking cunt!\" \"", "What are you doing?\" \"", "Let go!\" \"", "Get off!\" \"", "You guys saw that.\" \"", "You saw that.\" \"", "You're witnesses.\" \"", "That's assault!\" \"", "I'll press charges.\" \"", "Let him press charges!\" \"", "What are you talking about?\" \"", "I'm bleeding!\" \"", "I saw nothing.\" \"", "I saw you trip and fall.\" \"", "Look at her!\" \"", "She's crazy!\" \"", "You lay a hand on her again and I'll arrest you myself!\" \"", "You're just like him!\" \"", "Yeah, and what about you?\" \"", "Get some help.\" \"", "Okay.\" \"", "All right.\" \"", "Thanks for coming down.\" \"", "My mother always said it was a family thing.\" \"", "That I'd broken some kind of sacred oath. ", "I don't know.\" \"", "When we walked in that day and saw him beating her....\" \"What was I supposed to do?\" \"", "Larry was the one who'd always jump in and protect her.\" \"", "And he always paid for it.\" \"", "I never did anything.\" \"", "I just ran and hide.\" \"", "You did the right thing.\" \"", "You called for help.\" \"", "A lot of good it did me.\" \"", "But you didn't do it for you.\" \"", "All those years my dad never hurt me.\" \"", "Not once.\" \"", "Yes, he did.\" \"", "Stop right there!\" \"", "Stop!\" \"", "Freeze!\" \"", "Shit!\" \"", "I got constitutionality issues for my attorney!\" \"", "Mr. Steak lKnife has \"constitutionality issues.\"\" \"", "Bitch, that ain't mine.\" \"", "Watch your mouth.\" \"", "He's trying to stick up for his lady.\" \"", "You want to share love with your partner, right, Officer Ho?\" \"", "Ho!\" \"", "Officer Ho!\" \"", "Or Officer Bitch?\" \"", "Which one is it?\" \"", "You ain't seen nothing.\" \"", "Fuck up your life, I don't care.\" \"", "You want this life for your little brother?\" \"", "Banging until he's shot in the head like your older brother?\" \"", "He's a kid.\" \"", "He's got a chance.\" \"", "l ain't got a chance?\" \"", "No, I'm saying this is your chance.\" \"", "Are you smart enough to recognize it?\" \"", "Come on, get in back.\" \"", "What, you found God or something?\" \"", "Don't bust my balls, all right?\" \"", "Come in!\" \"", "Hey, you got some new furniture.\" \"", "And a new friend.\" \"", "Who's this?\" \"", "Bob.\" \"", "You named your dog Bob.\" \"", "No, that was his name.\" \"", "He told you that?\" \"", "Yeah.\" \"", "I got something too.\" \"", "An invitation to my parents' renewal of vows.\" \"", "It came today.\" \"", "Found it the mailbox this morning.\" \"", "Are you gonna go?\" \"", "I don't know.\" \"", "Would you?\" \"", "Are you asking me to go with you?\" \"", "Why, would you do that?\" \"", "Can Bob come?\" \"", "Sure.\" \"", "Now that we got that settled....\" \"Feed me. ", "I'm hungry.\" \"", "I'll get my jacket.\" \"", "And change your T-shirt.\" \"", "You smell like dog.\" \"", "What are you doing?\" \"", "What's with the toys?\" \"", "Don't go through my things.\" \"", "I wasn't. ", "lt was open.\" \"", "Why do you have all these toys?\" \"", "I didn't mean to upset you.\" \"", "Come on.\" \"", "Let's just go.\" \"", "What?\" \"", "Nothing.\" \"", "Let's go.\" \"", "Be good, Bob.\" \"", "You know everybody?\" \"", "How you doing?\" \"", "Going uphill, man.\" \"", "You try it.\" \"", "No....\" \"Go ahead.\" \"", "I feel like a jerk.\" \"", "Try again.\" \"", "What?\" \"", "You like blues?\" \"", "Come on, let's go in.\" \"", "Come on.\" \"", "Take off your coat.\" \"", "Let's stay a while.\" \"", "Come on.\" \"", "That was incredible!\" \"", "I didn't know you played.\" \"", "Why didn't you tell me?\" \"", "l don't know.\" \"", "Why'd you leave?\" \"", "It was great!\" \"", "Steve!\" \"", "Oh, man, I don't believe this!\" \"", "Steve Lambert!\" \"", "How you doing?\" \"", "You okay?\" \"", "It's been\" \"You have me confused with somebody else.\" \"", "You kidding me?\" \"", "Stevie, it's me.\" \"", "Tony!\" \"", "l don't know a Steve.\" \"", "is it a joke?\" \"", "I was up in my office and I heard that sound, your sound.\" \"", "I don't know who you are.\" \"", "Get away from me!\" \"", "You mind explaining this to me?\" \"", "Who is that?\" \"", "You owe him money or something?\" \"", "I don't know who he is.\" \"", "is your name Steve?\" \"", "My name's Catch.\" \"", "What do you want?\" \"", "The truth!\" \"", "Who's Steve Lambert?\" \"", "l don't know.\" \"", "Are we living some kind of lie?\" \"", "What'll I find out next?\" \"", "That you are married?\" \"", "Where are you going?\" \"", "What do you want me to say?\" \"", "I don't want you to say anything!\" \"", "Don't say anything.\" \"", "You want to go?\" \"", "Go.\" \"", "Please leave a message after the tone.\" \"", "Catch, it's me.\" \"", "Can you pick up?\" \"", "Listen, I was wondering if we could meet tomorrow.\" \"", "At this place called Enrico's.\" \"", "It's on Halsted and Marion.\" \"", "Around 2:00, okay?\" \"", "Okay.\" \"", "Bye.\" \"", "About the other day\" \"You don't have to explain.\" \"", "I probably do.\" \"", "But....\" \"I'm fine.\" \"", "Come on.\" \"", "I thought we were having coffee.\" \"", "You can trust me, you know.\" \"", "l know that.\" \"", "I'd never hurt you.\" \"", "Remember when you said some people were meant to meet each other?\" \"", "Maybe we were meant to meet that night.\" \"", "The night I held your hand.\" \"", "What do you mean?\" \"", "Maybe you don't remember.\" \"", "You were unconscious\" \"No, I don't.\" \"", "I was there.\" \"", "It was me that was there that night.\" \"", "At the accident?\" \"", "What are you talking about?\" \"", "Maybe it's why we met again.\" \"", "What are you doing?\" \"", "Trying to help.\" \"", "With what?\" \"", "I'm fine.\" \"", "l don't think you are.\" \"", "You pretend-- -l'm not pretending!\" \"", "You're lying.\" \"", "l'm not lying!\" \"", "Then walk in there.\" \"", "And I'll walk in there with you.\" \"", "Why are you doing this?\" \"", "Because you had a family.\" \"", "Shut up.\" \"", "Stop.\" \"", "You had a wife and a child.\" \"", "I'm so sorry it happened.\" \"", "I want you to have a life.\" \"", "I have a life.\" \"", "We don't need\" \"Please!\" \"", "It happened.\" \"", "We don't need to go into this.\" \"", "Please\" \"You like to push people, don't you?\" \"", "I just want to understand you, to know who you are.\" \"", "I can't do that if you don't let me.\" \"", "I know it's hard, I can imagine\" \"You can't imagine anything!\" \"", "You have no idea how it feels to do what I did\" \"What?\" \"", "Stay with me, okay?\" \"", "It's not your fault.\" \"", "I was there, I saw the reports.\" \"", "That truck, it just\" \" Catch, please.\" \"", "I'm trying to tell you something, okay?\" \"", "I'm trying to tell you that....\" \"You're not alone.\" \"", "l'm trying to tell you that I....\" \"Don't.\" \"", "You're supposed to be his dad!\" \"", "Can't you take him?\" \"", "I'll be busy!\" \"", "I won't have time today!\" \"", "And I have time?\" \"", "That's a hell of a greeting.\" \"", "What's up with you?\" \"", "You don't return my calls.\" \"", "Haven't shown up for work three, four days.\" \"", "You don't look like you got the flu.\" \"", "l take it Freak Show dumped you?\" \"", "Fuck you.\" \"", "I wish I could say I'm sorry, but I ain't.\" \"", "I think it's best for everybody.\" \"", "Really?\" \"", "And who's \"everybody\"?\" \"", "Me.\" \"", "Martha Stewart, you gonna pour your partner a cup?\" \"", "He had you.\" \"", "He got you, didn't he?\" \"", "I'm gonna give you some real strong advice.\" \"", "Change the subject.\" \"", "Charlene's pregnant.\" \"", "That's great.\" \"", "Congratulations.\" \"", "I'm not sure I'm ready to be a daddy yet.\" \"", "I haven't gotten over Miss Stillwell.\" \"", "Who?\" \"", "Tenth-grade English teacher.\" \"", "Hot buttered Stillwell.\" \"", "I know you gotta go through this.\" \"", "I'll tell the boss I stopped by to see you.\" \"", "You as sick as a dog, coughing up organs and shit.\" \"", "But I can't let this go on much longer.\" \"", "We got us a job to do out there.\" \"", "We gotta clean these streets before my baby gets here.\" \"", "You know what I'm saying?\" \"", "Has he been here?\" \"", "I was expecting him this morning.\" \"", "He shops for me.\" \"", "I give him money from the settlement every week.\" \"", "Can't talk about that with him.\" \"", "When he comes here, do you ever talk about the accident?\" \"", "Does he ever mention the past?\" \"", "No.\" \"", "Why not?\" \"", "I try to let him find his own way through.\" \"", "I feel he needs that.\" \"", "Why are you here, Sharon?\" \"", "I want to know how to help him.\" \"", "You are helping him.\" \"", "l don't think so.\" \"", "What makes you think that?\" \"", "I took him to the cemetery\" \"The cemetery?\" \"", "I thought it might help.\" \"", "He needs to face it.\" \"", "He will face it, in his time.\" \"", "He built a wall around that whole day and that night.\" \"", "My daughter and my grandson.\" \"", "He can't help it.\" \"", "A cemetery....\" \"Do you know how hard it is for me to go to the cemetery?\" \"", "I was just trying to help him get back to some kind of life.\" \"", "He was coming back.\" \"", "Don't you realize how he's changed these past weeks?\" \"", "His apartment, his life?\" \"", "He fell in love.\" \"", "Why do you want to rush things?\" \"", "Why does everybody rush things these days?\" \"", "I was scared.\" \"", "Scared of what?\" \"", "Of losing him.\" \"", "And I guess that's what I did.\" \"", "I lost him.\" \"", "You were just trying to find your way.\" \"", "What else can we do?\" \"", "You think I'm always sure about what I should or shouldn't say to him?\" \"", "I just try to do what's right and hope that he'll find the love in it.\" \"", "Look at you so worried now, and miserable.\" \"", "There's love in that.\" \"\"", "l just wanted to wish you both the best.\"\" \"\"", "l just want to wish you both well and say congratulations.\"\" \"\"", "Hi, Mom, Dad.\" \"", "I just stopped by to say congratulations and I think it's great.\"\" \"", "These shoes, no.\" \"", "Please leave a message after the tone.\" \"", "Catch?\" \"", "Can you pick up?\" \"", "Will you call me?\" \"", "You declared your love for one another in the presence of Christ.\" \"", "He consecrated you in baptism enriched and strengthened you in the sacrament of matrimony so you can carry out the duties of marriage in lasting fidelity.\" \"", "congratulates you and rejoices with you on reaching this milestone in your journey.\" \"", "Are you prepared to give yourselves again to that union larger than yourselves that union already blessed by God?\" \"", "Yes.\" \"", "Yes, we are.\" \"", "Face each other and join hands please, and say after me:\" \"l, Carl...\" \"l, Carl...\" \"...take thee, Josephine...\" \"...take thee, Josephine...\" \"...to be my wife.\" \"...", "to be my wife.\" \"", "l, Josephine...\" \"l, Josephine...\" \"...take you, Carl...\" \"...take you, Carl...\" \"...to be my husband.\" \"...", "to be my husband.\" \"", "I promise to be true to you in good times and in bad in sickness and in health.\" \"", "I promise to love you and honor you till death do us part.\" \"", "Annie.\" \"", "Max.\" \"", "I don't want you to think I forgot you.\" \"", "It's just that I couldn't find you.\" \"", "I woke up and you were gone.\" \"", "Everything was gone.\" \"", "It just disappeared in one minute.\" \"", "I couldn't remember that minute.\" \"", "I lost it.\" \"", "But I think I found it all now.\" \"", "I used a calculator, see.\" \"", "Do you know we get about 1400 minutes a day?\" \"", "So I figured it out.\" \"", "I was 29 years old three months and eight days.\" \"", "So it was minute number 1 7,810,200 or so.\" \"", "That's the one I lost.\" \"", "When I lost that minute, I guess I....\" \"l tried to lose it all all the memories because it hurt so bad.\" \"", "I tried, but....\" \"But I couldn't do it.\" \"", "Max, you were sick that day, remember?\" \"", "It was your birthday and you ate too much.\" \"", "Annie, you said:\" \"\"Slow down, it's wet, okay?\"\" \"", "And you were right.\" \"", "I should have slowed down.\" \"", "I should have slowed down lots of times.\" \"", "But I didn't always listen.\" \"", "I didn't listen when you when you said, \"Steve, just please spend more time.\"\" \"", "That day I made you smile, Max, remember?\" \"", "You looked at me and I made a face and then we all smiled.\" \"", "It was a great minute.\" \"", "It was.\" \"", "I'm so glad I found that minute.\" \"", "And no matter what no matter what, I won't forget anymore.\" \"", "Daddy!\" \"", "I won't forget anymore.\" \"", "I love you.\" \"", "Don't make him talk about anything today.\" \"", "I know.\" \"", "It was a nice ceremony.\" \"", "We're running out of chicken.\" \"", "Nobody's eating the ham.\" \"", "It's still a great party.\" \"", "You look happy.\" \"", "30 years and still in love, huh?\" \"", "You think that's wrong, don't you?\" \"", "Of course not.\" \"", "You're beautiful.\" \"", "Dad.\" \"", "Don't walk away, okay?\" \"", "What?\" \"", "is it working?\" \"", "Do you need to check it?\" \"", "lt's fine.\" \"", "Dad\" \"What the hell are you doing?\" \"", "Sharon, please.\" \"", "Please, please what?\" \"", "Why do you always protect him?\" \"\"", "Don't bother your father.\"\" \"", "I'm gonna bother you for a minute.\" \"", "Can you handle that?\" \"", "You get the hell\" \"This is between me and my father.\" \"", "So both of you, just leave us alone for one goddamn minute!\" \"", "How about you, Dad?\" \"", "You want me to go?\" \"", "lt's up to you.\" \"", "l'm asking you.\" \"", "Am I welcome here?\" \"", "You're here, aren't you?\" \"", "What do you want?\" \"", "l want to know.\" \"", "Do you want me here?\" \"", "Do you still love me?\" \"", "I want to know.\" \"", "I feel like....\" \"You feel like what, Dad?\" \"", "I feel like I don't have a daughter anymore.\" \"", "Well you do.\" \"", "And it's a shame that you'll miss knowing her.\" \"", "I'm next.\" \"", "Hi, Mom, Dad.\" \"", "Congratulations.\" \"", "You know, being in this house reminds of something.\" \"", "I was about 10 years old.\" \"", "Me and Larry were playing alien invasion.\" \"", "Remember, Lar?\" \"", "Anyway, we were making a lot of noise.\" \"", "Dad came home from work, tired and pissed off.\" \"", "We were yelling like mad.\" \"", "He burst into the room and he yells:\" \"\"What the hell are you doing?\"\" \"", "And I was scared.\" \"", "I was really scared.\" \"", "And I said:\" \"\"We're playing alien invasion.\"\" \"", "And he said, \"l'll show you a damn alien invasion!\"\" \"", "He picks me up.\" \"", "He picks me up off the floor and he throws me on the couch.\" \"", "Then he grabs Larry and picks him up and throws him on the couch.\" \"", "And then....\" \"Then he starts making monster noises.\" \"", "He says, \"We came to Earth to kick ass!\"\" \"", "Me and Larry, we're running and jumping at him.\" \"", "We're laughing so hard I almost wet myself.\" \"", "And we keep running and jumping on him, and he keeps tossing us.\" \"", "And growling and beeping.\" \"", "It was great.\" \"", "It was great.\" \"", "I'll never forget that.\" \"", "And I miss that.\" \"", "I miss it.\" \"", "Anyway, I just wanted to say thanks for that, Dad.\" \"", "Thanks.\" \"", "Bye.\" \"", "What are you doing here?\" \"", "You invited me.\" \"", "Are you okay?\" \"", "Yeah, I'm okay.\" \"", "I wanted to apologize.\" \"", "For what?\" \"", "For wanting everything to be perfect.\" \"", "You were right, I was pushing you.\" \"", "Then I realized that it doesn't have to be perfect.\" \"", "I mean.... lt can be whatever it is.\" \"", "They don't like me very much in there.\" \"", "They're lucky to have you in there.\" \"", "That's a nice thing to say.\" \"", "lt's not a nice thing.\" \"", "It's the truth.\" \"", "Why do you try so hard not to cry?\" \"", "It's not fair.\" \"", "I did the right thing.\" \"", "I know I did.\" \"", "It's not fair that they're shutting me out.\" \"", "There's nothing I can do anymore.\" \"", "I went, Sharon.\" \"", "I went to see my wife and my son today.\" \"", "I told them that I love them and that I miss them.\" \"", "And then I told them about you.\" \"", "I told them how much I love you.\" \"", "I love you.\" \"", "I love you too.\" \"", "I'll drive.\"" ]

{ "pile_set_name": "OpenSubtitles" }

[ 0, 0, 0, 0, 0, 0.043478260869565216, 0, 0, 0, 0, 0, 0, 0.07142857142857142, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.03225806451612903, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.09090909090909091, 0, 0.019230769230769232, 0, 0, 0, 0, 0, 0, 0.07142857142857142, 0, 0, 0, 0.023809523809523808, 0, 0, 0, 0, 0.02564102564102564, 0.02857142857142857, 0, 0, 0, 0, 0, 0.018518518518518517, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.09090909090909091, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.02564102564102564, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.02857142857142857, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.03333333333333333, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.05, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.045454545454545456, 0.03333333333333333, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.045454545454545456, 0.09090909090909091, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.017857142857142856, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.038461538461538464, 0, 0, 0, 0, 0, 0, 0.023809523809523808, 0, 0, 0, 0, 0, 0, 0, 0, 0.03225806451612903, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.029411764705882353, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.06666666666666667, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.029411764705882353, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.058823529411764705, 0, 0, 0, 0, 0, 0, 0.03571428571428571, 0.03125, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.0625, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.06896551724137931, 0, 0.037037037037037035, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.017241379310344827, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.0196078431372549, 0, 0, 0, 0.015873015873015872, 0.16666666666666666, 0.07142857142857142, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.14285714285714285, 0.038461538461538464, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.0625, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.0625, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.1111111111111111, 0, 0.058823529411764705, 0, 0, 0, 0, 0, 0.125, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.045454545454545456, 0, 0, 0, 0.043478260869565216, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.030303030303030304, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.09090909090909091, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.018867924528301886, 0, 0, 0, 0, 0, 0, 0, 0, 0.025, 0, 0, 0.038461538461538464, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.03571428571428571, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.024096385542168676, 0, 0.018518518518518517, 0, 0, 0, 0.1111111111111111, 0.14285714285714285, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.024390243902439025, 0, 0.02, 0, 0, 0, 0, 0.0125, 0.022727272727272728, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.05555555555555555, 0, 0, 0, 0, 0, 0, 0, 0.045454545454545456, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.022222222222222223, 0, 0, 0, 0, 0, 0, 0, 0, 0.022727272727272728, 0.058823529411764705, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.014705882352941176, 0, 0, 0.04, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.05555555555555555, 0, 0, 0, 0, 0, 0, 0 ]

[ { "analysis_explanation": null, "end": 1813, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1798 }, { "analysis_explanation": null, "end": 1828, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1818 }, { "analysis_explanation": null, "end": 2092, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2088 }, { "analysis_explanation": null, "end": 2474, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2469 }, { "analysis_explanation": null, "end": 2484, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2479 }, { "analysis_explanation": null, "end": 2489, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2486 }, { "analysis_explanation": null, "end": 2600, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2595 }, { "analysis_explanation": null, "end": 2967, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2954 }, { "analysis_explanation": null, "end": 3004, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2998 }, { "analysis_explanation": null, "end": 4100, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4096 }, { "analysis_explanation": null, "end": 4590, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4581 }, { "analysis_explanation": null, "end": 5238, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5233 }, { "analysis_explanation": null, "end": 5691, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5686 }, { "analysis_explanation": null, "end": 5705, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5696 }, { "analysis_explanation": null, "end": 5737, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5732 }, { "analysis_explanation": null, "end": 5992, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5983 }, { "analysis_explanation": null, "end": 6362, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6357 }, { "analysis_explanation": null, "end": 6433, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6425 }, { "analysis_explanation": null, "end": 6627, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6622 }, { "analysis_explanation": null, "end": 6881, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6869 }, { "analysis_explanation": null, "end": 8049, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8046 }, { "analysis_explanation": null, "end": 8061, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8058 }, { "analysis_explanation": null, "end": 8143, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8139 }, { "analysis_explanation": null, "end": 8688, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8681 }, { "analysis_explanation": null, "end": 8911, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8903 }, { "analysis_explanation": null, "end": 9419, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9408 }, { "analysis_explanation": null, "end": 10778, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10770 }, { "analysis_explanation": null, "end": 10898, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10893 }, { "analysis_explanation": null, "end": 11223, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11209 }, { "analysis_explanation": null, "end": 11233, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11228 }, { "analysis_explanation": null, "end": 11597, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11595 }, { "analysis_explanation": null, "end": 12036, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12031 }, { "analysis_explanation": null, "end": 12411, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12405 }, { "analysis_explanation": null, "end": 12506, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12494 }, { "analysis_explanation": null, "end": 12664, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12655 }, { "analysis_explanation": null, "end": 13068, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13064 }, { "analysis_explanation": null, "end": 13190, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13183 }, { "analysis_explanation": null, "end": 14521, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14512 }, { "analysis_explanation": null, "end": 16081, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16068 }, { "analysis_explanation": null, "end": 16577, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16571 }, { "analysis_explanation": null, "end": 16910, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16905 }, { "analysis_explanation": null, "end": 17009, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17001 }, { "analysis_explanation": null, "end": 17200, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17196 }, { "analysis_explanation": null, "end": 17240, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17235 }, { "analysis_explanation": null, "end": 17314, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17309 }, { "analysis_explanation": null, "end": 17477, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17472 }, { "analysis_explanation": null, "end": 17676, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17663 }, { "analysis_explanation": null, "end": 18308, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18303 }, { "analysis_explanation": null, "end": 18313, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18310 }, { "analysis_explanation": null, "end": 18368, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18362 }, { "analysis_explanation": null, "end": 19413, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19405 }, { "analysis_explanation": null, "end": 19479, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19474 }, { "analysis_explanation": null, "end": 19905, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19900 }, { "analysis_explanation": null, "end": 20096, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20094 }, { "analysis_explanation": null, "end": 20103, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20101 }, { "analysis_explanation": null, "end": 20118, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20116 }, { "analysis_explanation": null, "end": 20664, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20661 }, { "analysis_explanation": null, "end": 20691, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20688 }, { "analysis_explanation": null, "end": 20838, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20833 }, { "analysis_explanation": null, "end": 20876, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20864 }, { "analysis_explanation": null, "end": 21403, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21400 }, { "analysis_explanation": null, "end": 21807, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21802 }, { "analysis_explanation": null, "end": 21859, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21846 }, { "analysis_explanation": null, "end": 21976, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21970 }, { "analysis_explanation": null, "end": 21994, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21990 }, { "analysis_explanation": null, "end": 22019, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 22014 }, { "analysis_explanation": null, "end": 22283, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 22278 }, { "analysis_explanation": null, "end": 22362, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 22349 }, { "analysis_explanation": null, "end": 22743, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 22735 }, { "analysis_explanation": null, "end": 22808, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 22802 }, { "analysis_explanation": null, "end": 22824, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 22813 }, { "analysis_explanation": null, "end": 22871, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 22852 }, { "analysis_explanation": null, "end": 23170, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 23160 }, { "analysis_explanation": null, "end": 24553, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 24548 }, { "analysis_explanation": null, "end": 24705, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 24689 }, { "analysis_explanation": null, "end": 24939, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 24925 }, { "analysis_explanation": null, "end": 25098, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 25090 }, { "analysis_explanation": null, "end": 25232, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 25223 }, { "analysis_explanation": null, "end": 25661, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 25649 }, { "analysis_explanation": null, "end": 25733, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 25723 }, { "analysis_explanation": null, "end": 25981, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 25975 }, { "analysis_explanation": null, "end": 26279, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 26269 }, { "analysis_explanation": null, "end": 26552, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 26536 }, { "analysis_explanation": null, "end": 26681, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 26671 }, { "analysis_explanation": null, "end": 27905, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 27901 }, { "analysis_explanation": null, "end": 27918, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 27914 }, { "analysis_explanation": null, "end": 27947, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 27938 }, { "analysis_explanation": null, "end": 27976, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 27967 }, { "analysis_explanation": null, "end": 28036, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 28027 }, { "analysis_explanation": null, "end": 28054, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 28045 }, { "analysis_explanation": null, "end": 28077, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 28073 }, { "analysis_explanation": null, "end": 28100, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 28096 }, { "analysis_explanation": null, "end": 28312, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 28309 }, { "analysis_explanation": null, "end": 28488, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 28478 }, { "analysis_explanation": null, "end": 28524, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 28513 }, { "analysis_explanation": null, "end": 28644, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 28626 }, { "analysis_explanation": null, "end": 28697, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 28685 }, { "analysis_explanation": null, "end": 28725, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 28698 }, { "analysis_explanation": null, "end": 28825, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 28814 }, { "analysis_explanation": null, "end": 28957, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 28954 }, { "analysis_explanation": null, "end": 28981, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 28973 }, { "analysis_explanation": null, "end": 29047, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 29042 }, { "analysis_explanation": null, "end": 29267, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 29262 }, { "analysis_explanation": null, "end": 29332, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 29329 }, { "analysis_explanation": null, "end": 29430, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 29416 }, { "analysis_explanation": null, "end": 29477, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 29466 }, { "analysis_explanation": null, "end": 29636, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 29631 }, { "analysis_explanation": null, "end": 29796, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 29788 }, { "analysis_explanation": null, "end": 30048, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 30042 }, { "analysis_explanation": null, "end": 30183, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 30175 }, { "analysis_explanation": null, "end": 30861, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 30843 }, { "analysis_explanation": null, "end": 30878, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 30873 }, { "analysis_explanation": null, "end": 31373, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 31368 }, { "analysis_explanation": null, "end": 31505, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 31500 }, { "analysis_explanation": null, "end": 31535, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 31530 }, { "analysis_explanation": null, "end": 32536, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 32530 }, { "analysis_explanation": null, "end": 32579, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 32574 }, { "analysis_explanation": null, "end": 27987, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 27982 }, { "analysis_explanation": null, "end": 28111, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 28106 } ]

[ "Rosemann\n\nRosemann is a surname. ", "Notable people with the surname include:\n\nRosemann of Isenburg-Kempenich, Lord of Isenburg-Kempenich co-ruling with his brothers Salentin and Theodoric II, and eventually his nephew Theodoric III\nJulius Rosemann (1878–1933), German politician of the Independent Social Democratic Party\nMichael Rosemann (born 1967), German information systems researcher, professor and Director of the Centre for Future Enterprise, QUT, Brisbane, Australia, Australia\nPhilipp Rosemann (born 1964), German philosopher and Professor and Chair of Philosophy at Maynooth University\n\nSee also\nRoseman\nRosman (disambiguation)" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0, 0.02159468438538206 ]

[ { "analysis_explanation": null, "end": 18, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 0 }, { "analysis_explanation": null, "end": 170, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 162 }, { "analysis_explanation": null, "end": 187, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 175 }, { "analysis_explanation": null, "end": 228, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 215 }, { "analysis_explanation": null, "end": 244, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 229 }, { "analysis_explanation": null, "end": 264, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 258 }, { "analysis_explanation": null, "end": 335, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 319 }, { "analysis_explanation": null, "end": 346, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 342 }, { "analysis_explanation": null, "end": 355, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 349 }, { "analysis_explanation": null, "end": 461, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 453 }, { "analysis_explanation": null, "end": 472, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 463 }, { "analysis_explanation": null, "end": 483, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 474 }, { "analysis_explanation": null, "end": 500, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 484 }, { "analysis_explanation": null, "end": 511, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 507 }, { "analysis_explanation": null, "end": 520, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 514 } ]

[ "La Chaussée\n\nLa Chausée may refer to:\n\nPeople\n Pierre-Claude Nivelle de La Chaussée, a French dramatist\n\nPlaces\n La Chaussée, Seine-Maritime, a commune of France in the Seine-Maritime department\n La Chaussée, Vienne, a commune of France in the Vienne department\n La Chaussée-d'Ivry, a commune of France in the Eure-et-Loir department\n La Chaussée-Saint-Victor, a commune of France in the Loir-et-Cher department\n La Chaussée-sur-Marne, a commune of France in the Marne department\n La Chaussée-Tirancourt, a commune of France in the Somme department" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.014598540145985401 ]

[ { "analysis_explanation": null, "end": 23, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 0 }, { "analysis_explanation": null, "end": 71, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 47 }, { "analysis_explanation": null, "end": 83, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 72 }, { "analysis_explanation": null, "end": 93, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 87 }, { "analysis_explanation": null, "end": 124, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 113 }, { "analysis_explanation": null, "end": 140, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 126 }, { "analysis_explanation": null, "end": 161, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 155 }, { "analysis_explanation": null, "end": 174, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 169 }, { "analysis_explanation": null, "end": 207, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 196 }, { "analysis_explanation": null, "end": 215, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 209 }, { "analysis_explanation": null, "end": 236, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 230 }, { "analysis_explanation": null, "end": 250, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 244 }, { "analysis_explanation": null, "end": 281, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 263 }, { "analysis_explanation": null, "end": 302, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 296 }, { "analysis_explanation": null, "end": 359, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 335 }, { "analysis_explanation": null, "end": 380, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 374 }, { "analysis_explanation": null, "end": 434, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 413 }, { "analysis_explanation": null, "end": 455, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 449 }, { "analysis_explanation": null, "end": 503, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 481 }, { "analysis_explanation": null, "end": 524, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 518 }, { "analysis_explanation": null, "end": 537, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 532 } ]

[ "Who is Leonardo DiCaprio dating? ", "Who Leonardo DiCaprio dated; list of Leonardo DiCaprio loves, ex girlfriends; breakup rumors. ", "The loves, exes and relationships of Leonardo DiCaprio, listed by most recent. ", "From Bar Refaeli up are rumored flings and one-night stands. ", "From his list of exes, it looks like Leo has really gotten around! ", "Leo fans will also enjoy leaked secrets about his romance life, cute photos of young DiCaprio, and awesome stories of Leo being Leo.", "\n\nIf you're wondering who Leonardo DiCaprio's wife is, stop - he has never married! ", "Expect to see many models in Leonardo DiCaprio's dating history.", "\n\nSince May 2016, Leonardo DiCaprio has been dating Danish model Nina Agdal.", "\n\nWho are Leonardo DiCaprio's ex-girlfriends? ", "It's actually kind of funny to see that the Leonardo DiCaprio movies list has less items than his romances list. ", "But, if you were Leonardo wouldn't you take advantage of your fame and good looks too?" ]

{ "pile_set_name": "OpenWebText2" }

[ 0.030303030303030304, 0.02127659574468085, 0.012658227848101266, 0, 0.014925373134328358, 0.022727272727272728, 0.011904761904761904, 0.015625, 0.013157894736842105, 0.021739130434782608, 0, 0.011627906976744186 ]

[ { "analysis_explanation": null, "end": 24, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7 }, { "analysis_explanation": null, "end": 54, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 37 }, { "analysis_explanation": null, "end": 87, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 70 }, { "analysis_explanation": null, "end": 181, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 164 }, { "analysis_explanation": null, "end": 258, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 249 }, { "analysis_explanation": null, "end": 307, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 304 }, { "analysis_explanation": null, "end": 337, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 334 }, { "analysis_explanation": null, "end": 427, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 419 }, { "analysis_explanation": null, "end": 455, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 452 }, { "analysis_explanation": null, "end": 465, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 462 }, { "analysis_explanation": null, "end": 510, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 491 }, { "analysis_explanation": null, "end": 597, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 578 }, { "analysis_explanation": null, "end": 628, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 620 }, { "analysis_explanation": null, "end": 647, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 630 }, { "analysis_explanation": null, "end": 670, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 664 }, { "analysis_explanation": null, "end": 687, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 677 }, { "analysis_explanation": null, "end": 716, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 697 }, { "analysis_explanation": null, "end": 794, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 777 }, { "analysis_explanation": null, "end": 871, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 863 } ]

[ "A BILL to amend article four, chapter seven of the code of West\nVirginia, one thousand nine hundred thirty-one, as amended,\nby adding thereto a new section, designated section six,\nrelating to the creation of the West Virginia prosecuting\nattorneys institute and its executive council and its\nexecutive director; the appointment of special prosecutors\nto serve in the various counties where the elected\nprosecuting attorney in that county is disqualified from\nthe prosecution of a criminal case in that county; assessing\nthe cost of the operation of the West Virginia prosecuting\nattorneys institute upon the various counties; providing for the termination of the West Virginia prosecuting attorneys\ninstitute; and annual reporting to the Legislature.", "\n\nBe it enacted by the Legislature of West Virginia:\nThat article four, chapter seven of the code of West\nVirginia, one thousand nine hundred thirty-one, as amended, be\namended by adding thereto a new section, designated section six,\nto read as follows:ARTICLE 4. ", "PROSECUTING ATTORNEY, REWARDS AND LEGAL ADVICE.", "\n§7-4-6. ", "West Virginia Prosecuting Attorneys Institute.", "\n(a) There is hereby created the West Virginia Prosecuting\nAttorneys Institute, a public body whose membership shall consist\nof the fifty-five elected county prosecuting attorneys in the\nstate. ", "The institute shall meet at least once each calendar\nyear, and the presence of twenty-eight of the fifty-five\nprosecutors at any such meeting shall constitute a quorum for the\nconduct of the institute's business.", "\n(b) There is hereby created the executive council of the\nWest Virginia Prosecuting Attorneys Institute which shall consist\nof five prosecuting attorneys elected by the membership of the\nWest Virginia Prosecuting Attorneys Institute at its annual\nmeeting and two persons appointed annually by the county\ncommissioner's association of West Virginia. ", "The executive\ncouncil shall elect one member of the council to serve as chairman of the institute for a term of one year without\ncompensation. ", "The executive council shall serve as the regular\nexecutive body of the institute.", "\n(c) There is hereby created the position of executive\ndirector of the West Virginia Prosecuting Attorneys Institute to\nbe employed by the executive council of the institute. ", "The\nexecutive director of the West Virginia Prosecuting Attorneys\nInstitute shall serve at the will and pleasure of the executive\ncouncil of the institute at an annual salary equal to that\nprovided to prosecutors in Class I counties as set forth in\nsection four, article seven, chapter seven of this code. ", "The\nexecutive director shall be licensed to practice law in the state\nof West Virginia and shall devote full-time to his or her\nofficial duties and may not engage in the private practice of\nlaw.", "\n(d) The duties and responsibilities of the institute, as\nimplemented by and through its executive council and its\nexecutive director, shall include the following:\n(1) To provide for special prosecuting attorneys to pursue\na criminal matter in any county upon the request of a circuit\ncourt judge of that county and upon the approval of the executive\ncouncil;\n(2) To establish and to implement general and specialized\ntraining programs for prosecuting attorneys and their\nprofessional staffs;\n(3) To provide materials for prosecuting attorneys and their\nprofessional staffs, including legal research, technical\nassistance, technical and professional publications;\n(4) To compile and disseminate information on behalf of\nprosecuting attorneys and their professional staffs on current\ndevelopments and changes in the law and the administration of\ncriminal justice;\n(5) To establish and to implement uniform reporting\nprocedures for prosecuting attorneys and their professional\nstaffs in order to maintain and to provide accurate and timely\ndata and information relative to criminal prosecutorial matters;\n(6) To accept and expend funds, grants, and gifts and accept\nservices from any public or private source;\n(7) To enter into agreements and contracts with public or\nprivate agencies or educational institutions;\n(8) To identify experts and other resources for use by\nprosecutors in criminal matters; and\n(9) To make such recommendations to the Legislature or the\nsupreme court of appeals of the state of West Virginia on measures required, or procedural rules to be promulgated, to make\nuniform the processing of juvenile cases in the fifty-five\ncounties of the state.", "\n(e) Each prosecuting attorney shall be subject to\nappointment by the institute to serve as a special prosecuting\nattorney in any county where the prosecutor for that county or\nhis or her office has been disqualified from participating in a\nparticular criminal case. ", "The circuit judge of any county of\nthis state, who disqualifies the prosecutor or his or her office\nfrom participating in a particular criminal case in that county,\nshall seek the appointment by the institute of a special\nprosecuting attorney to substitute for the disqualified\nprosecutor. ", "The executive director of the institute shall, upon\nwritten request to the institute by any circuit judge, and upon\napproval of the executive council, appoint a prosecuting attorney\nto serve as a special prosecuting attorney. ", "The special\nprosecuting attorney so appointed shall serve without any further\ncompensation other than that paid to him or her by his or her\ncounty, except that he or she shall be entitled to be reimbursed\nfor his or her legitimate expenses associated with travel,\nmileage, room and board from the county to which he or she is\nappointed as a prosecutor, and provided further the county commission in which county he or she is special prosecutor shall\nbe responsible for all expenses associated with the prosecution\nof the criminal action.", "\n(f) The executive director of the institute shall maintain\nan appointment list that shall include the names of all\nfifty-five prosecuting attorneys and that shall also include the\nnames of any assistant prosecuting attorney who wishes to serve\nas a special prosecuting attorney upon the same terms and\nconditions as set forth in this section. ", "The executive director\nof the institute, with the approval of the executive council,\nshall appoint special prosecuting attorneys from the appointment\nlist for any particular matter giving due consideration to the\nproximity of the proposed special prosecuting attorney's home\ncounty to the county requesting a special prosecutor and giving\ndue consideration to the expertise of the special prosecuting\nattorney.", "\n(g) Commencing on the first day of July, one thousand nine\nhundred ninety-five, each county commission shall pay, on a\nmonthly basis, a special prosecution premium to the treasurer of\nthe state for the funding of the West Virginia Prosecuting\nAttorneys Institute. ", "Such monthly premiums shall be paid\naccording to the following schedule:\n\nUpon receipt of any such premium, the treasurer shall deposit the\npremium into a special revenue fund to be known as the West\nVirginia Prosecuting Attorneys Institute Fund. ", "All costs of\noperating the West Virginia Prosecuting Attorneys Institute shall\nbe paid from the West Virginia Prosecuting Attorneys Institute\nFund upon proper authorization by the executive council or by the executive director of the institute and subject to annual\nappropriation by the Legislature of the amounts contained within\nthe fund.", "\n(h) The West Virginia Prosecuting Attorneys Institute shall\ncontinue to exist until the first day of July, one thousand nine\nhundred ninety-seven, unless continued by an act of the\nLegislature. ", "The institute shall annually by the first day of\nthe regular legislative session provide the joint committee of\ngovernment and finance with a report setting forth the activities\nof the institute, its activities and suggestions for legislative\naction.", "\nNOTE: The purpose of this bill is to create a prosecuting\nattorneys institute funded by county contributions. ", "The\ninstitute would provide training for prosecutors and would\nprovide special prosecutors to counties when the elected\nprosecutor is disqualified from prosecuting a case." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0013315579227696406, 0.003787878787878788, 0, 0, 0.021739130434782608, 0, 0, 0.0057306590257879654, 0, 0, 0.005714285714285714, 0.0032679738562091504, 0, 0.0005995203836930455, 0, 0, 0, 0, 0, 0, 0, 0.004048582995951417, 0.0058823529411764705, 0.005128205128205128, 0, 0, 0 ]

[ { "analysis_explanation": null, "end": 72, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 59 }, { "analysis_explanation": null, "end": 226, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 213 }, { "analysis_explanation": null, "end": 567, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 554 }, { "analysis_explanation": null, "end": 677, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 664 }, { "analysis_explanation": null, "end": 721, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 715 }, { "analysis_explanation": null, "end": 864, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 851 }, { "analysis_explanation": null, "end": 1068, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1063 }, { "analysis_explanation": null, "end": 1768, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1762 }, { "analysis_explanation": null, "end": 1811, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1803 }, { "analysis_explanation": null, "end": 1869, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1856 }, { "analysis_explanation": null, "end": 1991, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1983 }, { "analysis_explanation": null, "end": 2662, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2649 }, { "analysis_explanation": null, "end": 4287, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4274 }, { "analysis_explanation": null, "end": 6552, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6531 }, { "analysis_explanation": null, "end": 6639, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6632 }, { "analysis_explanation": null, "end": 6789, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6782 }, { "analysis_explanation": null, "end": 7289, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7283 }, { "analysis_explanation": null, "end": 7470, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7449 }, { "analysis_explanation": null, "end": 7604, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7591 } ]

[ "Sauna for enjoyment AND survival\n\nSaunas in rural and lake areas are as much for enjoyment as they are for survival.", "\n\nWith his wife and two girls, Jeff Forrester built a wood burning sauna on his minimally developed land on an Island in Northern Minnesota. ", "In this short interview, Jeff describes how their sauna is critical to camping in sub zero weather, and just recently, while on a cold wet deer hunting trip with one of his daughters.", "\n\n“Just because a sleeping bag is rated -20f, doesn’t mean it will work if you’re body is cold.” ", "Sleeping bags are great for containing one’s body heat, but if you’re cold to begin with, forget about it.", "\n\nMany things were invented with survival in mind.", "\n\nThen they became popular in everyday use. ", "You can think of your own example next time you grab for your cell phone." ]

{ "pile_set_name": "Pile-CC" }

[ 0, 0.0070921985815602835, 0.00546448087431694, 0, 0, 0, 0, 0 ]

[ { "analysis_explanation": null, "end": 160, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 146 }, { "analysis_explanation": null, "end": 254, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 236 }, { "analysis_explanation": null, "end": 285, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 281 } ]

[ "\n123 Wn.2d 854 (1994)\n873 P.2d 492\nMICHAEL RORVIG, ET AL, Petitioners,\nv.\nJOEL DOUGLAS, ET AL., ", "Respondents.", "\nNo. ", "60183-6.", "\nThe Supreme Court of Washington, En Banc.", "\nMay 19, 1994.", "\nPhilip E. Rosellini and Jeffrey D. Thomas, for petitioners.", "\nReed McClure, by William R. Hickman and Marilee C. Erickson, for respondents.", "\nJOHNSON, J.\nPetitioners were denied recovery of the legal expenses incurred in the quiet title portion of their successful slander of title action. ", "Legal expenses, including attorney fees, incurred in clearing the slandered title have not been recoverable as damages in accordance with the rule set out in McGuinness v. Hargiss, 56 Wash. 162, 105 P. 233 (1909). ", "Petitioners request this court to overrule McGuinness *856 and hold such fees are recoverable as special damages. ", "Respondents have cross-petitioned the ruling of the Court of Appeals affirming the trial court's findings that the parties did not have an enforceable contract and the elements of slander of title had been met, and the trial court's method of calculating damages. ", "We hold in a successful slander of title action, recoverable damages include attorney fees. ", "Further, we affirm the Court of Appeals on the issues raised in the cross petition.", "\nPetitioners Pam and Michael Rorvig purchased three unimproved lots located adjacent to a subdivision owned and developed by the Respondents, Barbara and Joel Douglas. ", "The Douglases had bid on the unimproved lots, hoping to include them within their development. ", "However, the Rorvigs submitted the winning bid and signed a purchase and sale agreement for the property on August 8, 1989.", "\nShortly thereafter, the Douglases began pressuring the Rorvigs to abandon the purchase. ", "The Douglases suggested the situation be resolved by the parties entering into a joint development agreement for the property. ", "The Rorvigs began negotiations with the Douglases.", "\nThe Douglases submitted several drafts of agreements to the Rorvigs. ", "After rejecting these, the Rorvigs prepared their own agreement. ", "The agreement provided for cooperation in the vacation of an unimproved city street, for performance by the Douglases of site development, and for payment by the Rorvigs to the Douglases of development costs on a per-lot basis. ", "The agreement also stated that a memorandum of the contract would be recorded with the county auditor.", "\nOn September 25, 1989, Pam Rorvig signed the agreement. ", "Michael Rorvig then took the agreement to the Douglases' office. ", "After Joel Douglas reviewed the agreement, he and Michael Rorvig agreed to two changes, which they inserted into the agreement and initialed. ", "They both signed the agreement. ", "Rorvig then presented the agreement to Barbara Douglas. ", "She requested some time to review the *857 document before signing it. ", "Michael Rorvig left the agreement with Mrs. Douglas.", "\nSometime after Michael Rorvig left the office, the Douglases made three material changes to the agreement. ", "The changes would have increased the Rorvigs' obligation under the contract by $15,000, and would have allowed the Douglases to opt out of providing various improvements if they could not agree to terms with the Rorvigs. ", "Barbara Douglas signed the agreement, and both Douglases initialed the changes. ", "Beside their own initials, the Douglases marked spaces for the Rorvigs to insert their initials.", "\nThe Rorvigs received the contract back the next day. ", "They found the Douglases' changes unacceptable. ", "When a Douglas employee contacted Rorvig a week later to find out the Rorvigs' response, Michael Rorvig said he and his wife were rejecting the Douglases' counteroffer.", "\nDuring a series of telephone calls between the parties, Michael Rorvig repeatedly denied they had an agreement. ", "Mr. Douglas asserted an agreement existed. ", "At the same time, he continued to propose a variety of new agreements and to remind the Rorvigs that litigation was expensive. ", "The Douglases prepared and recorded a memorandum of agreement on the property despite the Rorvigs' contention no finalized agreement existed.", "\nNot long after the Douglases recorded the memorandum, David Edelstein, a local contractor, submitted an earnest money agreement to the Rorvigs offering to purchase the three lots. ", "Rorvig informed Edelstein of the Douglas memorandum. ", "After verifying with the title company that the Rorvigs could not provide clear title, Edelstein withdrew his offer.", "\nOn December 26, 1989, the Rorvigs filed suit. ", "They requested the court quiet title in the Rorvigs, and award damages for slander of title. ", "The Douglases counterclaimed for enforcement of the memorandum.", "\nAt trial, Judge Moynihan held the memorandum was not an enforceable contract. ", "He further held the Douglases were *858 liable for slander of title, and awarded damages of $7,406.26. ", "The trial court denied the Rorvigs' request for attorney fees, other than statutory fees of $125.", "\nBoth parties appealed. ", "In an unpublished opinion, the Court of Appeals affirmed the judgment in all respects. ", "On the issue of awarding attorney fees for the quiet title portion of the action, both the trial court and the Court of Appeals felt bound by McGuinness v. Hargiss, 56 Wash. 162, 105 P. 233 (1909), which held attorney fees are not recoverable as costs or as damages in a slander of title action.", "\n\nI\nInitially, we consider the issues raised in the Douglases' cross petition. ", "The Douglases make three arguments: (1) the trial court erred in holding no contract was formed between the parties; (2) the trial court erred in holding Petitioners had established all the elements of slander of title; and (3) the trial court erred in the calculation of damages. ", "First we consider whether the trial court erred in concluding no contract was formed between the parties.", "\n[1, 2] It is a basic rule of contract formation that \"[a]n expression of assent that changes the terms of the offer in any material respect may be operative as a counteroffer; but it is not an acceptance and consummates no contract\". ", "Blue Mt. Constr. ", "Co. v. Grant Cy. ", "Sch. ", "Dist. ", "150-204, 49 Wn.2d 685, 688, 306 P.2d 209 (1957). ", "On the other hand, an acceptance that requests modification of terms may consummate a contract unless the additional terms are conditions of acceptance. ", "Such an acceptance must be unequivocal. ", "Restatement (Second) of Contracts § 61 comment a (1981).", "\nThe trial court found a contract had not been formed between the Douglases and the Rorvigs because the handwritten modifications made by the Douglases constituted a counteroffer which the Rorvigs rejected. ", "The Douglases disagree, asserting they accepted the Rorvig contract as modified on September 25, 1989, they returned it the next day with proposed changes, and the additional terms were not conditions of acceptance.", "\n*859 The evidence, however, does not support the Douglases' contentions. ", "Although the Douglases returned the contract with a cover letter stating, \"we suggest a minimum of four tracts\", that change and other changes were actually written into the contract and initialed by the Douglases. ", "Therefore, the \"suggested\" changes were actually incorporated into the proposed contract. ", "These changes constituted a counteroffer and not an unequivocal acceptance of the Rorvigs' offer. ", "The Douglases' conduct confirmed that no agreement had been reached. ", "After learning the Rorvigs had rejected their proposal, the Douglases proposed other agreements. ", "In addition, during a telephone conversation with Michael Rorvig, Mr. Douglas stated, \"I suppose we don't have an agreement, unless you — unless you and Pam agree to it, but that could take $20,000 and two years for the Court to decide\". ", "Report of Proceedings, at 74.", "\nEven if the Douglases' changes are viewed as requests for changes to the contract rather than conditions of acceptance, no contract was formed because there was no unequivocal acceptance of the original terms. ", "When Michael Rorvig left the Douglases' office on September 25, 1989, Barbara Douglas had not signed the contract and Michael Rorvig had no clear indication that she would assent to it. ", "It is clear from the facts that her approval was necessary before any offer could be accepted and, when the proposed contract was left with her, she indicated she needed some time to review it. ", "The next day when the Douglases returned the contract with additional changes, no clear statement indicated the Rorvigs were accepting its original terms. ", "Therefore, the trial court was correct in holding no contract was formed because there was never unequivocal, mutual assent to any one contract proposal.", "\n[3] Next, the Douglases assert the court erred in concluding the Rorvigs established all the elements of slander of title. ", "Slander of title is defined as: (1) false words; (2) maliciously published; (3) with reference to some pending sale or purchase of property; (4) which go to defeat plaintiff's title; and (5) result in plaintiff's pecuniary loss. ", "Pay 'N Save *860 Corp. v. Eads, 53 Wn. ", "App. ", "443, 448, 767 P.2d 592 (1989) (citing Brown v. Safeway Stores, Inc., 94 Wn.2d 359, 375, 617 P.2d 704 (1980)).", "\n[4] The Douglases contend the evidence did not establish the element of falsity. ", "The Douglases cite several cases from other jurisdictions which hold the good faith recording of an unenforceable agreement does not render an agreement false for purposes of slander of title. ", "However, the cases cited by Respondents involved honestly held assertions made in good faith. ", "In this case, the record supports the trial court's finding that the Douglases recorded the memorandum of agreement, which falsely declared a valid contract existed, even though the Douglases knew no agreement had been reached. ", "The element of falsity was sufficiently established.", "\nThe Respondents also contend the Rorvigs failed to establish the element of \"pending sale\". ", "They rely primarily on Clarkston Comm'ty Corp. v. Asotin Cy. ", "Port Dist., ", "3 Wn. ", "App. ", "1, 472 P.2d 558 (1970). ", "In Clarkston, no negotiations or offers to purchase had taken place when the alleged slander occurred. ", "The court pointed out that the plaintiff had a mere expectation that a potential buyer would begin negotiations for the property, and thus had failed to establish the pending sale element. ", "Clarkston, 3 Wn. ", "App. ", "at 4.", "\n[5] The Douglases argue Edelstein's earnest money agreement is analogous to the anticipatory negotiations in Clarkston. ", "However, the evidence produced at trial shows the Edelstein offer went beyond a mere expectation of negotiations. ", "Edelstein made an offer to purchase the property, which he withdrew only when the title company verified the existence and effect of the Douglases' memorandum. ", "Further, Edelstein testified he would have purchased the property except for the encumbrance on the title.", "\n[6] The Douglases also contend the trial court erred in finding the element of malice was established. ", "The element of malice is met when the slanderous statement is not made in good faith or is not prompted by a reasonable belief in its veracity. ", "Brown v. Safeway Stores, Inc., 94 Wn.2d 359, 375, *861 617 P.2d 704 (1980). ", "The evidence at trial supported the court's finding that the Douglases were prompted to file the memorandum for the specific purpose of preventing the proposed sale of the property and with full knowledge no agreement existed.", "\n[7] Finally, the Respondents argue the trial court's method of calculating damages was improper. ", "The trial court heard evidence and awarded damages based on the interest incurred on the Petitioners' mortgage debt while the memorandum recorded by the Douglases remained on the title. ", "The Douglases offered no evidence to support an alternate method of calculating damages. ", "Evidence of damages is sufficient if it affords a reasonable basis for estimating the loss and does not subject the trier of fact to mere speculation or conjecture. ", "Haner v. Quincy Farm Chems., ", "Inc., 97 Wn.2d 753, 757, 649 P.2d 828 (1982). ", "Based on the evidence presented, the trial court's method provided a reasonably certain basis for determining damages under the facts of this case.", "\n\nII\nPetitioners request we overrule McGuinness v. Hargiss, 56 Wash. 162, 105 P. 233 (1909), which held \"attorney's fees, either as damages or costs, other than statutory, are not recoverable\". ", "McGuinness, 56 Wash. at 164-65. ", "We revisit the attorney fees argument for the first time in 85 years. ", "A review of analogous cases, recent decisions in other jurisdictions, and the Restatement (Second) of Torts, persuades us that McGuinness represents an outdated approach. ", "Therefore, we hold attorney fees are recoverable as special damages in a slander of title action.", "\n[8] It is well established that we adhere to the American rule, which states that absent a contract, statute, or recognized ground of equity, the prevailing party does not recover attorney fees as costs of litigation. ", "Haner, 97 Wn.2d at 757. ", "Nevertheless, we have also recognized \"certain circumstances\" where attorney fees should be recovered as damages. ", "State ex rel. ", "Macri v. Bremerton, 8 Wn.2d 93, 113, 111 P.2d 612 (1941).", "\n*862 In malicious prosecution and wrongful attachment or garnishment, we have held attorney fees are recoverable as special damages. ", "In malicious prosecution, it has long been the rule that damages include the attorney fees for the underlying action made necessary by the defendant's wrongful act. ", "Aldrich v. Inland Empire Tel. & ", "Tel. ", "Co., 62 Wash. 173, 176-77, 113 P. 264 (1911). ", "Similarly, in wrongful attachment or garnishment actions, and in actions to dissolve a wrongful temporary injunction, attorney fees are a \"necessary expense incurred\" in relieving the plaintiff of the wrongful attachment or temporary injunction, and are recoverable. ", "James v. Cannell, 135 Wash. 80, 83, 237 P. 8 (1925), aff'd, 139 Wash. 702 (1926); Cecil v. Dominy, 69 Wn.2d 289, 294, 418 P.2d 233 (1966).", "\n[9] Slander of title is analogous to these actions. ", "It is the defendant who by intentional and calculated action leaves the plaintiff with only one course of action: that is, litigation. ", "In malicious prosecution, wrongful attachment, and slander of title, the defendants actually know their conduct forces the plaintiff to litigate. ", "In addition, similar to malicious prosecution and wrongful attachment, actual damages are difficult to establish and often times are minimal in slander of title. ", "Fairness requires the plaintiff to have some recourse against the intentional malicious acts of the defendant.", "\nThe majority of jurisdictions that have considered the question in recent years have adopted this rule. ", "See, e.g., Rayl v. Shull Enters., ", "Inc., 108 Idaho 524, 700 P.2d 567 (1984); Summa Corp. v. Greenspun, 98 Nev. 528, 655 P.2d 513 (1982); Rogers v. Home Invs. ", "Fund, 10 Ill. App.3d 840, 295 N.E.2d 85 (1973); Dowse v. Doris Trust Co., 116 Utah 106, 208 P.2d 956 (1949). ", "The trend is to recognize that attorney fees and other legal expenses incurred in clearing the disparaged title are recoverable as damages in the common law action of slander of title. ", "James O. Pearson, Jr., Annotation, What Constitutes Special Damages in Action for Slander of Title, 4 A.L.R.4th 532, 560 (1981).", "\nFurthermore, the Restatement (Second) of Torts supports allowing recovery of attorney fees in a slander of title *863 action. ", "It describes slander of title as a form of the general tort of publication of an injurious falsehood. ", "Thus, the rules on liability for the publication of an injurious falsehood also apply to slander of title. ", "Restatement (Second) of Torts § 633 comment b (1977). ", "The Restatement provides:\n(1) The pecuniary loss for which a publisher of injurious falsehood is subject to liability is restricted to\n(a) the pecuniary loss that results directly and immediately from the effect of the conduct of third persons, including impairment of vendibility or value caused by disparagement, and\n(b) the expense of measures reasonably necessary to counteract the publication, including litigation to remove the doubt cast upon vendibility or value by disparagement.", "\n\n(Italics ours.) ", "Restatement (Second) of Torts § 633. ", "Attorney fees incurred in removing the cloud from the title and restoring vendibility are necessary expenses of counteracting the effects of the slander. ", "Restatement (Second) of Torts § 633.", "\n\nIII\nWe affirm on the issues of sufficiency of evidence and calculation of damages raised by the Douglases' cross petition. ", "We reverse the trial court on the issue of attorney fees, and remand for the purpose of determining and awarding as damages the attorney fees necessarily incurred in removing the cloud from the Rorvigs' title.", "\nUTTER, BRACHTENBACH, SMITH, and GUY, JJ., ", "concur.", "\nDOLLIVER, J. (concurring in part, dissenting in part)\nI concur in the conclusions reached by the majority in section I of its opinion. ", "I cannot concur, however, with its decision to overrule McGuinness v. Hargiss, 56 Wash. 162, 105 P. 233 (1909) and make attorney fees recoverable in a slander of title action. ", "As the majority recognizes, Washington has long followed the American rule that attorney fees are not recoverable as costs of litigation absent a contract, statute, or recognized ground of equity. ", "Majority, at 861. ", "The majority, *864 however, abandons this solid precedent and uses common law to expand the availability of attorney fees. ", "We have consistently left such decisions to the Legislature, and until the Legislature acts to change the current rule, I would adhere to the long-established precedent that attorney fees are not recoverable in a slander of title action. ", "Therefore, I dissent.", "\nANDERSEN, C.J., and MADSEN, J., concur with DOLLIVER, J.\n" ]

{ "pile_set_name": "FreeLaw" }

[ 0.020833333333333332, 0, 0, 0, 0.023809523809523808, 0, 0.03333333333333333, 0.02564102564102564, 0, 0.004672897196261682, 0, 0.003787878787878788, 0, 0.012048192771084338, 0.023809523809523808, 0.010526315789473684, 0.008130081300813009, 0.011235955056179775, 0.007874015748031496, 0.04, 0.02857142857142857, 0, 0, 0, 0, 0.03076923076923077, 0.014084507042253521, 0, 0.017857142857142856, 0, 0.038461538461538464, 0.018518518518518517, 0.013574660633484163, 0.0125, 0.010416666666666666, 0.018518518518518517, 0.020833333333333332, 0.02976190476190476, 0.008849557522123894, 0.023255813953488372, 0, 0.014184397163120567, 0.016574585635359115, 0.03773584905660377, 0.017241379310344827, 0.02127659574468085, 0.010752688172043012, 0.015873015873015872, 0.012658227848101266, 0, 0.010309278350515464, 0, 0.011494252873563218, 0.006779661016949152, 0.012658227848101266, 0.0071174377224199285, 0, 0, 0.058823529411764705, 0.058823529411764705, 0, 0, 0, 0, 0, 0.017857142857142856, 0.014492753623188406, 0.009302325581395349, 0.013513513513513514, 0.004651162790697674, 0, 0.01020408163265306, 0.014492753623188406, 0.020618556701030927, 0.012605042016806723, 0, 0.004739336492890996, 0.021505376344086023, 0, 0.012903225806451613, 0, 0.016129032258064516, 0, 0, 0, 0.009174311926605505, 0, 0.0051813471502590676, 0.010638297872340425, 0.0043859649122807015, 0, 0.021505376344086023, 0.03278688524590164, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.008264462809917356, 0.008771929824561403, 0.0125, 0.009433962264150943, 0.009615384615384616, 0, 0.02631578947368421, 0.004424778761061947, 0.01020408163265306, 0.010752688172043012, 0.011235955056179775, 0, 0, 0, 0, 0.005154639175257732, 0, 0, 0.005847953216374269, 0, 0, 0.08333333333333333, 0, 0, 0.017543859649122806, 0, 0, 0.03125, 0, 0, 0, 0.014492753623188406, 0, 0, 0, 0, 0, 0, 0.029411764705882353, 0.032520325203252036, 0.01834862385321101, 0, 0.015625, 0, 0, 0, 0.018518518518518517, 0, 0, 0.02702702702702703, 0, 0.027777777777777776, 0.008, 0.004784688995215311, 0.023255813953488372, 0, 0.007352941176470588, 0.005681818181818182, 0, 0, 0, 0.008403361344537815, 0, 0.05172413793103448 ]

[ { "analysis_explanation": null, "end": 19, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15 }, { "analysis_explanation": null, "end": 48, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 34 }, { "analysis_explanation": null, "end": 85, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 73 }, { "analysis_explanation": null, "end": 152, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 142 }, { "analysis_explanation": null, "end": 175, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 163 }, { "analysis_explanation": null, "end": 196, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 177 }, { "analysis_explanation": null, "end": 218, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 201 }, { "analysis_explanation": null, "end": 249, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 237 }, { "analysis_explanation": null, "end": 272, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 254 }, { "analysis_explanation": null, "end": 296, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 277 }, { "analysis_explanation": null, "end": 322, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 315 }, { "analysis_explanation": null, "end": 338, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 324 }, { "analysis_explanation": null, "end": 631, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 621 }, { "analysis_explanation": null, "end": 674, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 670 }, { "analysis_explanation": null, "end": 1246, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1243 }, { "analysis_explanation": null, "end": 1265, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1251 }, { "analysis_explanation": null, "end": 1379, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1372 }, { "analysis_explanation": null, "end": 1396, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1384 }, { "analysis_explanation": null, "end": 1615, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1601 }, { "analysis_explanation": null, "end": 1650, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1641 }, { "analysis_explanation": null, "end": 1718, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1709 }, { "analysis_explanation": null, "end": 1881, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1872 }, { "analysis_explanation": null, "end": 1896, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1887 }, { "analysis_explanation": null, "end": 1986, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1979 }, { "analysis_explanation": null, "end": 2134, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2125 }, { "analysis_explanation": null, "end": 2369, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2351 }, { "analysis_explanation": null, "end": 2381, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2371 }, { "analysis_explanation": null, "end": 2418, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2404 }, { "analysis_explanation": null, "end": 2487, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2475 }, { "analysis_explanation": null, "end": 2533, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2519 }, { "analysis_explanation": null, "end": 2649, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2643 }, { "analysis_explanation": null, "end": 2697, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2682 }, { "analysis_explanation": null, "end": 2784, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2770 }, { "analysis_explanation": null, "end": 2821, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2814 }, { "analysis_explanation": null, "end": 2852, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2838 }, { "analysis_explanation": null, "end": 3166, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3151 }, { "analysis_explanation": null, "end": 3207, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3198 }, { "analysis_explanation": null, "end": 3379, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3367 }, { "analysis_explanation": null, "end": 3443, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3436 }, { "analysis_explanation": null, "end": 3469, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3463 }, { "analysis_explanation": null, "end": 3482, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3470 }, { "analysis_explanation": null, "end": 3532, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3518 }, { "analysis_explanation": null, "end": 3668, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3654 }, { "analysis_explanation": null, "end": 3721, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3714 }, { "analysis_explanation": null, "end": 3893, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3884 }, { "analysis_explanation": null, "end": 4050, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4041 }, { "analysis_explanation": null, "end": 4091, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4076 }, { "analysis_explanation": null, "end": 4208, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4202 }, { "analysis_explanation": null, "end": 4227, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4218 }, { "analysis_explanation": null, "end": 4242, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4235 }, { "analysis_explanation": null, "end": 4351, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4342 }, { "analysis_explanation": null, "end": 4392, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4375 }, { "analysis_explanation": null, "end": 4524, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4515 }, { "analysis_explanation": null, "end": 4599, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4591 }, { "analysis_explanation": null, "end": 4682, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4673 }, { "analysis_explanation": null, "end": 5116, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5106 }, { "analysis_explanation": null, "end": 5159, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5155 }, { "analysis_explanation": null, "end": 5990, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5982 }, { "analysis_explanation": null, "end": 6049, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6045 }, { "analysis_explanation": null, "end": 6299, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6295 }, { "analysis_explanation": null, "end": 6376, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6367 }, { "analysis_explanation": null, "end": 6521, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6512 }, { "analysis_explanation": null, "end": 6566, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6560 }, { "analysis_explanation": null, "end": 6609, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6591 }, { "analysis_explanation": null, "end": 6640, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6628 }, { "analysis_explanation": null, "end": 7010, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7001 }, { "analysis_explanation": null, "end": 7338, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7329 }, { "analysis_explanation": null, "end": 7430, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7416 }, { "analysis_explanation": null, "end": 7443, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7436 }, { "analysis_explanation": null, "end": 7522, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7519 }, { "analysis_explanation": null, "end": 7577, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7568 }, { "analysis_explanation": null, "end": 7632, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7630 }, { "analysis_explanation": null, "end": 7863, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7849 }, { "analysis_explanation": null, "end": 7912, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7894 }, { "analysis_explanation": null, "end": 7929, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7914 }, { "analysis_explanation": null, "end": 7976, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7962 }, { "analysis_explanation": null, "end": 8236, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8224 }, { "analysis_explanation": null, "end": 8255, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8246 }, { "analysis_explanation": null, "end": 8556, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8547 }, { "analysis_explanation": null, "end": 8915, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8911 }, { "analysis_explanation": null, "end": 8957, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8953 }, { "analysis_explanation": null, "end": 9006, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9001 }, { "analysis_explanation": null, "end": 9035, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9031 }, { "analysis_explanation": null, "end": 9056, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9047 }, { "analysis_explanation": null, "end": 9133, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9124 }, { "analysis_explanation": null, "end": 9485, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9476 }, { "analysis_explanation": null, "end": 9850, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9841 }, { "analysis_explanation": null, "end": 9885, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9881 }, { "analysis_explanation": null, "end": 9900, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9891 }, { "analysis_explanation": null, "end": 10189, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10180 }, { "analysis_explanation": null, "end": 10225, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10216 }, { "analysis_explanation": null, "end": 10241, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10232 }, { "analysis_explanation": null, "end": 10326, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10317 }, { "analysis_explanation": null, "end": 10387, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10378 }, { "analysis_explanation": null, "end": 10451, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10442 }, { "analysis_explanation": null, "end": 10620, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10611 }, { "analysis_explanation": null, "end": 10726, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10717 }, { "analysis_explanation": null, "end": 10995, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10990 }, { "analysis_explanation": null, "end": 11029, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11025 }, { "analysis_explanation": null, "end": 11102, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11093 }, { "analysis_explanation": null, "end": 11555, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11546 }, { "analysis_explanation": null, "end": 11801, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11796 }, { "analysis_explanation": null, "end": 11868, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11864 }, { "analysis_explanation": null, "end": 12064, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12054 }, { "analysis_explanation": null, "end": 12107, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12103 }, { "analysis_explanation": null, "end": 12221, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12211 }, { "analysis_explanation": null, "end": 12311, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12303 }, { "analysis_explanation": null, "end": 12450, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12440 }, { "analysis_explanation": null, "end": 12639, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12631 }, { "analysis_explanation": null, "end": 12957, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12952 }, { "analysis_explanation": null, "end": 12970, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12961 }, { "analysis_explanation": null, "end": 13007, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13003 }, { "analysis_explanation": null, "end": 13388, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13384 }, { "analysis_explanation": null, "end": 13674, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13658 }, { "analysis_explanation": null, "end": 13692, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13690 }, { "analysis_explanation": null, "end": 13708, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13704 }, { "analysis_explanation": null, "end": 13737, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13733 }, { "analysis_explanation": null, "end": 13745, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13740 }, { "analysis_explanation": null, "end": 13794, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13790 }, { "analysis_explanation": null, "end": 14482, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14470 }, { "analysis_explanation": null, "end": 14522, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14518 }, { "analysis_explanation": null, "end": 14580, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14576 }, { "analysis_explanation": null, "end": 14616, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14612 }, { "analysis_explanation": null, "end": 14640, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14636 }, { "analysis_explanation": null, "end": 14677, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14673 }, { "analysis_explanation": null, "end": 14709, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14705 }, { "analysis_explanation": null, "end": 14746, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14742 }, { "analysis_explanation": null, "end": 14750, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14747 }, { "analysis_explanation": null, "end": 14770, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14766 }, { "analysis_explanation": null, "end": 14974, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14958 }, { "analysis_explanation": null, "end": 15084, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15080 }, { "analysis_explanation": null, "end": 15473, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15469 }, { "analysis_explanation": null, "end": 16582, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16579 }, { "analysis_explanation": null, "end": 16604, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16602 }, { "analysis_explanation": null, "end": 16793, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16783 }, { "analysis_explanation": null, "end": 16836, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16832 }, { "analysis_explanation": null, "end": 16941, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16931 }, { "analysis_explanation": null, "end": 16972, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16964 }, { "analysis_explanation": null, "end": 17509, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17501 }, { "analysis_explanation": null, "end": 17531, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17529 }, { "analysis_explanation": null, "end": 12241, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 12235 }, { "analysis_explanation": null, "end": 16561, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 16549 } ]

[ "Introduction {#s1}\n============\n\nViral proteases play an important part both in the generation of mature viral proteins and in the modulation of cellular functions [@pone.0025699-Dougherty1], [@pone.0025699-Tong1]. ", "Three proteases have been described in different picornavirus species: 2A^pro^, L^pro^ and 3C^pro^ [@pone.0025699-Foeger1].This last protease, 3C^pro^, and its precursor 3CD^pro^, are present in all picornavirus species and are responsible for most proteolytic cleavages of the viral polyprotein . ", "The three proteases are capable of cis-autoproteolysis, by which they are excised from the viral polyprotein. ", "It seems reasonable to think that the main purpose of PV 2A^pro^ and FMDV L^pro^ is to modify cellular functions. ", "Indeed, both proteases bisect eIF4G at a position close to each other. ", "The cleavage site of PV 2A^pro^ on eIF4GI is located between amino acids 681--682 [@pone.0025699-Castello1]. ", "Bisection of eIF4G takes place soon after PV infection, leading to inhibition of cellular translation, while the bulk of PV proteins is synthesized at late times when virtually all eIF4G has been proteolyzed. ", "Thus, hydrolysis of eIF4G by PV 2A^pro^ inhibits the canonical mechanism of translation, which is cap-dependent and promotes a non-canonical mechanism in which eIF4E and cap recognition are not necessary [@pone.0025699-Castello1]. ", "Apart from this cleavage, PV 2A^pro^ can hydrolyze other cellular proteins, although the exact degradome for this protease has still not been defined. ", "Some of these hydrolytic events associated with PV 2A^pro^ involve the proteolysis of nucleoporins, thereby altering RNA and protein trafficking between nucleus and cytoplasm [@pone.0025699-Castello1]. ", "Therefore, PV 2A^pro^ blocks cap-dependent translation upon eIF4G cleavage and interferes with mRNA export to the cytoplasm; both events abolish cellular gene expression and abrogate cellular responses to viral infection.", "\n\nThe translation initiation factor eIF4G is a large polypeptide which can interact with several cellular and viral proteins. ", "Two forms of eIF4G encoded by two different genes are known, eIF4GI and eIF4GII [@pone.0025699-Gradi1]. ", "The exact functioning of each of these two forms in the process of translation remains unclear, although it has been suggested that these forms are functionally interchangeable. ", "Three regions have been distinguished in eIF4G, each of which harbours the interaction sites with several cellular proteins. ", "Binding of eIF4E and eIF4A to eIF4G gives rise to the formation of the eIF4F complex [@pone.0025699-Merrick1], [@pone.0025699-Sonenberg1]. ", "Interaction of eIF4F with mRNA may take place directly or indirectly. ", "Thus, eIF4E directly binds to the cap structure present at the 5′ end of mRNAs, while eIF4A unwinds the secondary structure of the mRNA leader sequence. ", "In addition, eIF4G itself interacts with picornavirus IRESs by means of its central domain [@pone.0025699-Belsham1], [@pone.0025699-deBreyne1], [@pone.0025699-Yanagiya1]. ", "Apart from these direct interactions of the eIF4F complex with mRNAs, eIF4G also interacts with eIF3 and PABP, both of which also can directly bind to mRNA. ", "Joining of the eIF4F complex to the 40S ribosomal subunit is mediated by the interaction between eIF4G and eIF3. ", "Therefore, during the initiation of translation, eIF4G plays a pivotal role as a scaffolding molecule organizing the architecture of different initiation factors, mRNA and the preinitiation complex [@pone.0025699-Merrick1], [@pone.0025699-Sonenberg1]. ", "The central role of eIF4G in mRNA translation makes it a key target for a variety of animal viruses. ", "Indeed, modulation of eIF4G activity by viral proteins may be essential for cytopathic viruses to control translation. ", "Calicivirus as well as some picornavirus and retrovirus species encode proteases that hydrolyze eIF4G during infection [@pone.0025699-Castello1], [@pone.0025699-Alvarez1], [@pone.0025699-Ventoso1], [@pone.0025699-Willcocks1]. ", "Alternatively, a number of viral proteins are able to interact with eIF4G, modulating its activity. ", "This is the case of rotavirus NSP3 [@pone.0025699-Piron1], influenza virus NS1 and PB2 [@pone.0025699-Aragon1], [@pone.0025699-Burgui1] and adenovirus 100 K protein [@pone.0025699-Xi1]. ", "Cleavage of eIF4G by picornavirus proteases 2A^pro^ or L^pro^ leads to the stimulation of IRES-driven translation [@pone.0025699-Castello1]. ", "Pestova and colaborators demonstrated that the central domain of eIF4G together with eIF4A interacts with EMCV IRES and promotes the formation of the preinitiation complex [@pone.0025699-Lomakin1], [@pone.0025699-Pestova1]. ", "Consistent with this finding, the C-terminal fragment or even the core domain of eIF4G suffices to promote IRES-driven translation both in vivo and in cell free systems [@pone.0025699-Hundsdoerfer1], [@pone.0025699-Kaiser1].", "\n\neIF4F activity is regulated in eukaryotic cells by extra- and intracellular signals through phosphorylation [@pone.0025699-Castello1]. ", "eIF4E activity is also controlled by phosphorylation by the protein kinase Mnk1 or by interaction with eIF4G, which is modulated by eIF4E binding proteins (4E-BPs) [@pone.0025699-Sonenberg1]. ", "Phosphorylation also represents the most important mechanism to regulate eIF2 activity. ", "Factor eIF2 is composed of three subunits, known as α, β and γ [@pone.0025699-Merrick1], [@pone.0025699-Pestova2]. ", "Several kinases target eIF2α leading to phosphorylation of Ser-51 residue. ", "The function of eIF2 is to bind Met-tRNA~i~ and GTP to form the ternary complex Met-tRNA~i~-eIF2-GTP, which interacts with the 40S ribosomal subunit, establishing the interaction between the initiator AUG codon with the anticodon present in Met-tRNA~i~ [@pone.0025699-Merrick1], [@pone.0025699-Sonenberg1]. ", "The hydrolysis of eIF2-bound GTP is promoted by eIF5, while the eIF5B--GTP complex facilitates recruitment of the 60S subunit to the 48S initiation complex. ", "This joining promotes that the translation initiation factors except for eIF5B--GTP and eIF1A are displaced. ", "The eIF2-GDP complex is recycled to eIF2-GTP by the activity of the recycling factor eIF2B. Phosphorylation of eIF2α impairs the GDP-GTP recycling catalyzed by eIF2B. Therefore, the ternary complex Met-tRNA~i~ -eIF2-GTP is not generated and thus, binding of this complex to the 40S ribosome is hampered. ", "Even partial phosphorylation of eIF2 can lead to substantial abrogation of translation. ", "Some reports suggested that this factor remained unphosphorylated after poliovirus (PV) infection [@pone.0025699-Ransone1], [@pone.0025699-Ransone2], while other workers found substantial eIF2 phosphorylation under the same conditions after PV infection, particularly at late times [@pone.0025699-Black1], [@pone.0025699-ONeill1]. ", "Of interest, Protein Kinase R (PKR) becomes highly activated, yet it is hydrolyzed in PV-infected cells although this hydrolysis is not directly executed by any of the PV proteases (2A or 3C) [@pone.0025699-Black1], [@pone.0025699-ONeill1], [@pone.0025699-Black2]. ", "All these findings pointed to the idea that active eIF2 was necessary to sustain picornavirus translation. ", "In contrast to this idea, we described recently that several picornaviruses do not require active eIF2 at late times of infection [@pone.0025699-Welnowska1], similar findings have been reported for PV-infected cells [@pone.0025699-White1]. ", "In the present work we provide evidence that cleavage of eIF4G by PV 2A^pro^ in mammalian cells modifies the requirement for eIF2 in translation directed by picornavirus IRESs. ", "Thus, cleavage of eIF4G by PV 2A^pro^ establishes a mechanism for IRES-driven translation that is cap- and eIF2 independent. ", "These unexpected findings indicate that PV 2A ^pro^ induces eIF2 independence IRES-driven translation by a mechanism that is still unknown.", "\n\nResults {#s2}\n=======\n\nDual mode for translation of PV RNA {#s2a}\n-----------------------------------\n\nSome viral mRNAs, when they are translated in virus-infected cells, have different requirements for eIFs as compared to cell-free systems or transfected cells [@pone.0025699-Garrey1], [@pone.0025699-Sanz1]. ", "This is the case of Sindbis virus 26S mRNA, which does not require intact eIF4G [@pone.0025699-Castello2] or active eIF2 [@pone.0025699-Ventoso2] for translation in the infected cells, whereas these eIFs are necessary to initiate protein synthesis on this viral mRNA in cell-free systems [@pone.0025699-Sanz1]. ", "Although it is generally accepted that picornavirus RNA needs eIF2 to initiate translation, there is some evidence that this factor can be phosphorylated at late times of infection [@pone.0025699-ONeill1], [@pone.0025699-Neznanov1]. ", "Indeed, recently we found that several picornaviruses exhibit this dual mode for translation of the viral mRNA [@pone.0025699-Welnowska1]. ", "So we hypothesized that this factor might be dispensable at late times in the PV life cycle, when the bulk of viral proteins are being synthesized. ", "To test this possibility, eIF2 was inactivated by treating culture cells with Ars to induce phosphorylation of eIF2α. ", "This compound induces oxidative stressand has been widely used to inactivate eIF2 [@pone.0025699-Fernandez1], [@pone.0025699-Terenin1], [@pone.0025699-Wehner1]. ", "A PV replicon (pRLuc31) containing the luciferase (luc) gene replacing the viral structural proteins was used [@pone.0025699-Andino1]. ", "As controls, cells were also electroporated with Cap-luc or CrPV IGR-luc mRNAs [@pone.0025699-Welnowska1], [@pone.0025699-White1] and at 1 hpe cells were treated with different concentrations of Ars (0, 50, 100 and 200 µM) for 1 h. Electroporation of these RNAs into BHK-21 cells gives rise to luc synthesis from the beginning of transfection. ", "This early luc synthesis was produced by translation of the input RNA and was drastically blocked by Ars treatment in the case of PV replicon to an extent similar to that found with a capped mRNA whereas CrPV IGR-luc was inhibited by only 20% ([Figure 1A](#pone-0025699-g001){ref-type=\"fig\"}). ", "At 7 hours post transfection (hpt), PV proteins can be detected by radioactive labelling because cellular protein synthesis is abrogated. ", "Notably, Ars treatment has little inhibitory effect on the translation of PV RNA, whereas translation of cellular mRNAs was blocked by about 90% under the same conditions ([Figure 1B](#pone-0025699-g001){ref-type=\"fig\"}). ", "It should be noted that Ars interferes with the cleavage of the PV polyprotein as already observed [@pone.0025699-Welnowska1], [@pone.0025699-White1]. ", "Certainly, Ars treatment led to eIF2α phosphorylation, both in control and in PV RNA transfected cells. ", "Of interest was that phosphorylation of eIF2α was also found in PV-replicating cells in the absence of Ars ([Figure 1C](#pone-0025699-g001){ref-type=\"fig\"}, middle panel). ", "In addition, cleavage of eIF4G was progressively observed along the PV replication cycle ([Figure S1B](#pone.0025699.s001){ref-type=\"supplementary-material\"}, upper panel). ", "Analysis of eIF2α phosphorylation throughout the time course of PV replication provides evidence that this factor became phosphorylated at times when PV protein synthesis was maximal and eIF4G had been cleaved ([Figure S1A](#pone.0025699.s001){ref-type=\"supplementary-material\"}). ", "These findings demonstrate that PV RNA exhibits a dual mechanism for the initiation of translation as regards the participation of eIF2. ", "At early times, before viral RNA replication has occurred, active eIF2 is required to translate PV RNA, whereas this factor is dispensable at late times when massive production of viral proteins is taking place.", "\n\n![", "Effect of eIF2 phosphorylation induced by Ars on PV protein synthesis.\\\nA) Cap-luc, PV replicon-luc or CrPV IGR-luc mRNAs synthesized *in vitro* by T7 RNA polymerase were electroporated in BHK-21 cells and seeded in DMEM (10% FCS). ", "Different amounts of Ars (0, 50, 100 and 200 µM) were added and cells were incubated for 60 min before harvesting to analyze luc. ", "Error bars indicate standard deviations (SD) obtained from three measurements of each sample. ", "B) BHK-21 cells were electroporated with RNA of PV replicon. ", "At 7 hpe cells were treated with different concentrations of Ars and labelled with \\[^35^S\\]Met/Cys for 45 minutes. ", "Samples were analyzed by SDS-PAGE (17.5%) followed by fluorography and autoradiography. ", "Arrows indicate viral proteins. ", "C) eIF4GI, eIF2α and phosphorylated eIF2α were detected by western blot.](pone.0025699.g001){#pone-0025699-g001}\n\nAnalysis of PV non-structural proteins that confer eIF2 independence for viral RNA translation {#s2b}\n----------------------------------------------------------------------------------------------\n\nSince the PV replicon tested above only encodes PV non-structural proteins in addition to luc, we reasoned that perhaps extensive individual expression of each PV non-structural protein might establish conditions similar to those observed during PV replication. ", "Under these conditions of high PV protein synthesis, active eIF2 might not be necessary to translate PV RNA. ", "Moreover, it may be that synthesis of a single PV protein was able to confer eIF2-independence for IRES-driven translation. ", "To test this possibility, the system used was the BHKT7 cell line, which stably expresses T7 RNA polymerase. ", "Although this polymerase is devoid of capping activity, transfection of plasmids encoding different PV non-structural proteins under the control of a T7 promoter gives rise to extensive translation of mRNAs bearing a picornavirus IRES sequence. ", "The different pTM1 constructs encoding for each PV non-structural protein were transfected into BHKT7 cells and the synthesis of PV proteins was analyzed by radioactive labelling in presence or absence of Ars ([Figure 2A](#pone-0025699-g002){ref-type=\"fig\"}), as well as by western blot ([Figure 2B](#pone-0025699-g002){ref-type=\"fig\"}). ", "As shown in [Figure 2A](#pone-0025699-g002){ref-type=\"fig\"}, all PV proteins can be clearly detected by radioactive labelling in absence of Ars. ", "Strikingly, PV 2A^pro^ is extensively synthesized even in the presence of Ars, when eIF2α has become phosphorylated. ", "Thus, Ars inhibited cellular translation more than 90%, whereas the synthesis of PV 2A^pro^ was blocked by only 35% ([Figure 2C](#pone-0025699-g002){ref-type=\"fig\"}). ", "The inhibition of the other PV non-structural proteins by Ars treatment was around 80% ([Figure 2C](#pone-0025699-g002){ref-type=\"fig\"}) and in some cases such as 2B, 3A and 3C their synthesis was almost undetectable ([Figure 2A](#pone-0025699-g002){ref-type=\"fig\"}). ", "Therefore, the expression of one individual PV protein, 2A^pro^, can confer independence from active eIF2 for picornavirus--IRES-driven translation.", "\n\n![", "Individual expression of PV non structural proteins.\\\nAction of eIF2 phosphorylation. ", "BHKT7 cells were transfected with pTM1 plasmids encoding different PV non-structural proteins and were(+) or were not(−) treated with Ars. ", "A) After 2 hpt cells were pre-treated with 200 µM Ars for 15 minutes and then labelled with \\[^35^S\\]Met/Cys for 45 minutes in presence of the inhibitor. ", "Then, samples were processed by SDS-PAGE (17.5%), fluorography and autoradiography. ", "Western blot of total eIF2α and phosphorylated eIF2α using the same samples is shown at the bottom of this panel. ", "B) PV non-structural proteins were detected by western-blot. ", "C) The percentage of actin (\\*) and each PV protein synthesis was estimated by densitometric scanning of the corresponding band (arrows) from three independent experiments. ", "Error bars indicate SD.](pone.0025699.g002){#pone-0025699-g002}\n\nTranslation of mRNAs containing different picornavirus IRESs in the presence of 2A^pro^: Requirement for active eIF2α {#s2c}\n---------------------------------------------------------------------------------------------------------------------\n\nOur next goal was to assess whether PV 2A^pro^ was able to confer eIF2 independence *in trans* for the translation of other mRNAs bearing a picornavirus IRES. ", "To this end, the synthesis of luc directed by EMCV-, PV- and HAV-IRES was tested in the presence or absence of Ars, when culture cells did or did not co-express PV 2A^pro^. The synthesis of this protease in culture cells rescues the inhibition of Ars by about 70% when EMCV or PV IRESs are tested ([Figure 3A](#pone-0025699-g003){ref-type=\"fig\"}). ", "Notably, translation driven by HAV IRES is abolished when co-expressed with PV 2A^pro^ in presence or absence of Ars. ", "These results agree well with previous studies indicating that HAV IRES requires the intact form of eIF4F for functionality [@pone.0025699-Ali1], [@pone.0025699-Borman1], [@pone.0025699-Whetter1]. ", "Similar results were obtained in the human hepatoma Huh7-T7 cell line ([Figure S2](#pone.0025699.s002){ref-type=\"supplementary-material\"}). ", "Therefore, translation of luc mRNA bearing different picornavirus IRESs is hampered when eIF2α phosphorylation is induced by Ars. ", "Of interest, PV 2A^pro^ is able to confer translatability to EMCV and PV IRESs, but not to HAV IRES under these conditions.", "\n\n{ref-type=\"sec\"}) and represented from at least three independent experiments. ", "Error bars indicate standard deviation (SD). ", "B) eIF4GI, eIF2α and phosphorylated eIF2α were detected by western blot.](pone.0025699.g003){#pone-0025699-g003}\n\nIn addition to Ars, there are other treatments for inducing phosphorylation of eIF2α, such as incubation of culture cells with hypertonic medium or Thapsigargin (Tg) [@pone.0025699-Garrey1], [@pone.0025699-Novoa1]. ", "To assay the effect of these treatments on IRES-directed translation, BHKT7 cells were transfected with pTM1-luc, pTM1-2A or co-transfected with pTM1-luc and pTM1-2A. Extensive inhibition of cellular translation was observed when cells were treated either with Ars, hypertonic medium or both ([Figure 4A](#pone-0025699-g004){ref-type=\"fig\"}). ", "Inhibition of luc synthesis also occurs when pTM1-luc is transfected alone. ", "However, when PV 2A^pro^ is synthesized under these conditions, significant levels of IRES-2A translation are detected ([Figure 4A](#pone-0025699-g004){ref-type=\"fig\"}). ", "Hypertonic medium promotes eIF2α phosphorylation, particularly when combined with Ars ([Figure 4B](#pone-0025699-g004){ref-type=\"fig\"}). ", "A similar conclusion can be drawn when cells are transfected with pTM1-2A and treated with Tg ([Figure 4C](#pone-0025699-g004){ref-type=\"fig\"}) or with dithiothreitol (results not shown). ", "These findings support the idea that translation of IRES-2A mRNA is resistant to different compounds and treatments that induce phosphorylation of eIF2α when high levels of PV 2A^pro^ are synthesized.", "\n\n![", "Effect of different inducers of eIF2α phosphorylation on IRES-driven translation.\\\nA) BHKT7 cells were transfected with pTM1-luc, pTM1-2A or both. ", "At 2 hpt cells were pretreated with Ars(−/+), NaCl(+/−) or both(+/+) for 15 minutes and then labelled with \\[^35^S\\]Met/Cys for 45 minutes in presence of the inhibitors. ", "After labelling, the proteins were analyzed by SDS-PAGE(17.5%), fluorography and autoradiography. ", "B) Western blot analysis of samples from panel A using anti-eIF4GI, anti-Luc, anti-phosphorylated eIF2α and anti-total eIF2 antibodies. ", "C) Cells were mock transfected or transfected with pTM1-2A. At 2 hpt cells were pretreated with 1 µM Tg or additional 120 mM NaCl or both for 15 minutes and then were labelled with \\[^35^S\\]Met/Cys for 45 minutes in presence of the inhibitors. ", "After labelling, proteins were analyzed by SDS-PAGE, fluorography and autoradiography. ", "Numbers below each lane indicate the percentage of cell protein (\\*) and PV 2A^pro^ synthesis in cells treated with inhibitor compared with untreated cells quantified by densitometry of the corresponding bands. ", "A western blot using antibodies against eIF2α and phosphorylated eIF2α was performed.](pone.0025699.g004){#pone-0025699-g004}\n\nPV infection induces partial PKR degradation, as well as its phosphorylation which correlates with increased eIF2α phosphorylation as infection progresses. ", "To test whether PV 2A^pro^ expression diminished the amount of PKR in our culture cells, a western blot analysis was carried out using specific antibodies against PKR. ", "The levels of this enzyme were similar in cells that either did or did not express PV 2A^pro^ ([Figure S3](#pone.0025699.s003){ref-type=\"supplementary-material\"}).", "\n\nProteolytic activity of PV 2A^pro^ is necessary to confer eIF2 independence {#s2d}\n---------------------------------------------------------------------------\n\nNext, we wished to examine the effect of eIF2 phosphorylation on IRES-driven translation when eIF4G remained uncleaved. ", "To this end, a PV 2A^pro^ variant bearing a point mutation (G60R) devoid of eIF4G cleavage activity [@pone.0025699-Barco1], [@pone.0025699-Ventoso3] was employed. ", "In this case, plasmid pTM1-2C was co-transfected with pTM1-2A or pTM1-2A (G60R). ", "As a control, the same constructs were expressed alone. ", "PV 2A^pro^ and 2C synthesis were analyzed both in the presence or absence of Ars. ", "Cellular translation was abolished by Ars, as well as the synthesis of PV 2C and PV 2A (G60R) ([Figure 5A](#pone-0025699-g005){ref-type=\"fig\"}). ", "By contrast, PV proteins 2C and 2A^pro^ are still synthesized in presence of Ars, when PV 2A^pro^ is expressed alone or when PV 2C is co-expressed with PV 2A^pro^. The labelled proteins separated by SDS-PAGE were quantified by densitometric analyses ([Figure 5C](#pone-0025699-g005){ref-type=\"fig\"}). ", "Synthesis of PV 2C was inhibited by only 30--35% in presence of Ars and PV 2A^pro^, while this inhibition was of 85--90% when 2A^pro^ (G60R) was present ([Figure 5C](#pone-0025699-g005){ref-type=\"fig\"}, lower graphs). ", "This result indicates that the presence of high levels of 2A^pro^ in the absence of eIF4G cleavage does not induce eIF2 independence for IRES-directed translation.", "\n\n![", "Proteolytic activity is necessary for eIF2α independent translation.\\\nBHKT7 cells were transfected or co-transfected with either pTM1-2A or pTM1-2A G60R, which encodes for an inactive 2A^pro^, and pTM1-2C. A) At 2 hpt cells were treated with different Ars concentrations and incubated with \\[^35^S\\]Met/Cys for 45 minutes. ", "Samples were analyzed by SDS-PAGE (17.5%), fluorography and autoradiography. ", "B) eIF4GI, phosphorylated eIF2α and total eIF2α of the same samples were detected by western blot. ", "C) The percentage of cellular and viral protein synthesis, measured by densitometric scanning of the corresponding band from at least three independent experiments, is shown. ", "Upper panels show the synthesis of actin (representing cellular protein synthesis), 2A wt, 2C and 2A G60R when they are expressed by separate. ", "Lower panels show the synthesis of PV 2C protein alone, either in presence of 2A wt or in presence of 2A G60R. All data are shown as the mean ±SD of at least three independent experiments. ", "D) BHKT7 cells were first transfected with IRES-2A mRNA. ", "After 2 hpt, cell monolayers were washed and incubated in fresh medium (DMEM plus 5% FCS) for 1 h to accomplish the cleavage of eIF4G. Then, pTM1-luc was transfected during 2 h, afterwards transfection medium was removed and cells were incubated in fresh medium and after 15 minutes were treated or not with 200 µM Ars during 1 h . ", "Finally, cell monolayers were harvested in luciferase buffer and luc activity was measured and represented. ", "E) Cleavage of eIF4GI of the samples used in panel D was detected by western blot.](pone.0025699.g005){#pone-0025699-g005}\n\nAnother approach to abolishing eIF4G cleavage is to use PV 2A^pro^ inhibitors. ", "Addition of methoxysucciniyl-Ala-Ala-Pro-Val-chloromethylketone (MPCMK) strongly blocks cleavage of eIF4G [@pone.0025699-Molla1] even when high levels of PV 2A^pro^ are synthesized in BHKT7 cells. ", "The presence of this 2A^pro^ inhibitor abolishes eIF2 independence for translation of picornavirus IRES (see below). ", "In conclusion, cleavage of eIF4G (together with other putative cellular protein (s)) accomplished by active 2A^pro^ is necessary for this phenomenon.", "\n\nCleavage of eIF4G is not sufficient to provide eIF2-independent translation {#s2e}\n---------------------------------------------------------------------------\n\nThe only known direct effect of PV 2A^pro^ on translation is that this protease cleaves eIF4G, leading to stimulation of picornavirus RNA translation [@pone.0025699-Belsham1]. ", "Thus, it is possible that eIF2-independent translation is the consequence of the generation of the two eIF4G fragments after bisection by PV 2A^pro^. Alternatively, it is possible that in addition to eIF4G, other host proteins could be hydrolyzed by this protease providing eIF2-independent translation. ", "Moreover, the presence of PV 2A^pro^ itself could be necessary, and in this scenario 2A might play an IRES trans-acting role. ", "To distinguish between these possibilities different experiments were conducted. ", "Initially, we tested the effect of Ars on EMCV IRES-driven translation in the presence of low or high levels of PV 2A^pro^. Low amounts of this protease are produced in cells when in vitro synthesized IRES-2A mRNA is transfected [@pone.0025699-Castello3], whereas high levels of 2A^pro^ are found in culture cells using the system described in this work. ", "Under both conditions, eIF4G becomes extensively cleaved. ", "Addition of Ars to cell cultures transfected with IRES 2A mRNA and later with plasmid encoding IRES-luc (pTM1-luc) profoundly blocked translation, irrespective of whether or not PV 2A^pro^ was present ([Figure 5D](#pone-0025699-g005){ref-type=\"fig\"}). ", "Under those conditions, eIF4G was almost totally cleaved and both eIF4G fragments were present ([Figure 5E](#pone-0025699-g005){ref-type=\"fig\"}), but the levels of 2A^pro^ are low and do not confer eIF2-independence. ", "By contrast, when high amounts of PV 2A^pro^ are synthesized in BHKT7 cells, Ars has little inhibitory effect on EMCV IRES-driven translation. ", "These findings support the notion that the presence of eIF4G fragments (or the cleavage of other cellular proteins) is necessary but not sufficient to confer eIF2 independence for picornavirus IRES-driven translation.", "\n\nTo provide further support for this conclusion, the two eIF4G fragments generated by PV 2A^pro^ cleavage were synthesized in BHKT7 cells by transfection of the corresponding pTM1 plasmids. ", "These two fragments correspond to the cleavage products of eIF4G accomplished by PV 2A^pro^. The synthesis of each fragment was detected by immunoblotting ([Figure 6B](#pone-0025699-g006){ref-type=\"fig\"}). ", "Synthesis of luc from EMCV -luc was sensitive to Ars even when cells expressed either of the eIF4G fragments ([Figure 6A](#pone-0025699-g006){ref-type=\"fig\"}). ", "A densitometric analysis of the corresponding products synthesized is represented in [Figure 6C](#pone-0025699-g006){ref-type=\"fig\"}. ", "The inhibition of luc synthesis by Ars is around 40% when PV 2A^pro^ is present but is greater than 80% when luc is expressed either alone or with the N-terminal or C-terminal fragments of eIF4GI. ", "In conclusion, the idea that the C-terminus fragment of eIF4GI interacts with EMCV IRES thereby allowing mRNA to be translated without eIF2 is not supported by these results. ", "In fact, we demonstrate that high levels of PV 2A^pro^ must be present to translate picornavirus RNA when eIF2α is phosphorylated.", "\n\n![", "Influence on IRES-directed translation of expression of eIF4G fragments.\\\npTM1-luc was co-transfected with a combination of the next plasmids: pTM1-2A , pTM1-eIF4Gnt and pTM1-eIF4Gct. ", "A) At 2 hpe cells were pre-treated with 200 µM Ars for 15 minutes and then labelled with \\[^35^S\\]Met/Cys for 45 minutes in presence of the inhibitor. ", "Samples were processed by SDS-PAGE (17.5%) followed by fluorography and autoradiography. ", "B) The amount of eIF4GI, eIF2α and phosphorylated eIF2α of the samples were detected by western blot. ", "C) The percentage of luc synthesis, measured by densitometric scanning of the corresponding band, was represented. ", "Error bars indicate SD from at least two independent experiments. ", "D) BHKT7 cells were co-transfected with pTM1-luc and either pTM1-2A wt or pTM1-2A G60R. To each mixture, plasmid expressing c-terminal fragment of eIF4GI was or was not added. ", "At 3 hpt samples were first pretreated with Ars for 15 minutes and then radiolabeled with \\[^35^S\\]Met/Cys for 45 minutes and were or were not treated with Ars. ", "Samples were then processed by SDS-PAGE (17.5%) followed by fluorography and autoradiography. ", "E) eIF4GI, eIF2α and phosphorylated eIF2α were detected by western blot. ", "F) The percentage of luc synthesis, measured by densitometric scanning of the corresponding band, was represented. ", "Error bars indicate SD from at least three independent experiments.](pone.0025699.g006){#pone-0025699-g006}\n\nIn addition, we tested whether the presence of high levels of both the inactive mutant 2A G60R and the carboxy fragment of eIF4G can switch translation to an eIF2-independent mode. ", "When PV 2A^pro^ is or is not synthesized together with the C-fragment of eIF4GI, Ars has little effect on translation driven by EMCV IRES ([Figure 6D](#pone-0025699-g006){ref-type=\"fig\"}). ", "In fact, the synthesis of the C-terminal fragment of eIF4G is stimulated when co-expressed with PV 2A^pro^. The percentage of luc synthesis is about 70% in presence of Ars when is co-expressed with PV 2A^pro^ with or without the eIF4GI C terminal fragment ([Figure 6F](#pone-0025699-g006){ref-type=\"fig\"}). ", "However, luc synthesis is notably diminished by Ars to around 20% when luc is synthesized either with PV 2A (G60R) alone or with PV 2A (G60R) together with the C-terminal fragment of eIF4GI. ", "These observations indicate that to achieve resistance to eIF2 phosphorylation, both the cleavage of eIF4G (or other cellular protein (s)) and the synthesis of high levels of active PV 2A^pro^ are necessary.", "\n\nTwo possibilities can be envisaged to account for the above findings. ", "One is that PV 2A^pro^ cleaves a putative cellular protein other than eIF4G when present at high levels. ", "This putative cleavage would be necessary to confer eIF2 independence. ", "Another possibility is that active 2A^pro^ must be present to observe this phenomenon. ", "To distinguish between these two possibilities, cells were transfected with pTM1-2A and after 1 h of incubation, when eIF4G and other putative cellular proteins had been cleaved, pTM1-luc was transfected in the presence or absence of MPCMK, which is an inhibitor of the proteolytic activity of 2A^pro^ ([Figure 7A](#pone-0025699-g007){ref-type=\"fig\"}) . ", "Addition of this inhibitor, even after PV 2A^pro^ has exerted its proteolytic activity renders IRES-driven translation dependent on active eIF2 ([Figure 7B](#pone-0025699-g007){ref-type=\"fig\"}). ", "These findings therefore demonstrate that cleavage of other putative cellular protein is not involved in this phenomenon. ", "In conclusion, both cleavage of eIF4G and active PV 2A^pro^ are required to render IRES driven translation independent of eIF2.", "\n\n{#pone-0025699-g007}\n\nDiscussion {#s3}\n==========\n\nProgressive inactivation of eIF2 by phosphorylation takes place upon infection of culture cells with some PV variants and other picornaviruses [@pone.0025699-Ransone2], [@pone.0025699-ONeill1], [@pone.0025699-Neznanov1]. ", "This eIF2 inactivation was previously thought to play a role in the abrogation of cellular and viral protein synthesis at late times of infection, since the prevailing idea was that picornavirus RNA translation needs active eIF2. ", "Our present data demonstrate that significant phosphorylation of eIF2α is found in PV-replicating cells from about 3 hpi. ", "Moreover, induction of substantial eIF2 phosphorylation by Ars has little effect on PV protein synthesis, while cellular translation is drastically abolished under these conditions. ", "Our present results are in good agreement with recent findings indicating that several picornaviruses, including PV, can translate their mRNA when eIF2α is phosphorylated at late times of infection [@pone.0025699-Welnowska1], [@pone.0025699-White1]. ", "The claim that cleavage of eIF5B by PV 3C^pro^ as responsible for eIF2-independent translation [@pone.0025699-White1] is not supported by our results illustrating that upon the individual expression of each PV protein only 2A^pro^ is endowed with this activity. ", "If this is so, the mechanism of picornavirus RNA translation may be more similar to the situation reported for flaviviruses, since translation of their viral RNAs may not use eIF2, when this factor is absent [@pone.0025699-Terenin1], [@pone.0025699-Lukavsky1], [@pone.0025699-Skabkin1]. ", "We also have demonstrated that the individual expression of PV 2A^pro^, but not other PV non-structural proteins, is sufficient to render picornavirus IRES-driven translation independent for active eIF2. ", "This effect is observed both in *cis* and in *trans* on mRNAs bearing picornavirus IRES elements. ", "These mRNAs are little affected upon phosphorylation of eIF2 induced by different inhibitors when high levels of PV 2A^pro^ are synthesized.", "\n\nPV 2A^pro^ is a multifunctional protease that targets a number of cellular processes, including translation [@pone.0025699-Castello1], [@pone.0025699-Hambidge1]. ", "Indeed, this viral protease bisects eIF4G thereby disrupting cap-dependent translation of the vast majority of cellular mRNAs. ", "By contrast, this modification of eIF4G enhances PV protein synthesis [@pone.0025699-Belsham1]. ", "Most evidence indicated that simple cleavage of eIF4G is not sufficient for this stimulation [@pone.0025699-Kaiser1], [@pone.0025699-Roberts1]. ", "Indirect evidence points to a direct activity of 2A^pro^ in PV RNA translation [@pone.0025699-Hambidge1], [@pone.0025699-Macadam1], thus the actual presence of 2A^pro^ together with cellular protein cleavage would be necessary to stimulate IRES-driven translation. ", "The C-terminal fragment of eIF4G is able to replace the entire factor in cell free systems [@pone.0025699-Lomakin1]. ", "However, overexpression of this fragment in intact cells does not stimulate picornavirus IRES-driven translation [@pone.0025699-Kaiser1], [@pone.0025699-Roberts1], [@pone.0025699-DeGregorio1]. ", "Consistent with these findings, our present observations indicate that the expression of either the N-or C-terminus fragments of eIF4G in our system does not stimulate translation directed by EMCV IRES. ", "Our findings support the concept that for eIF2 independence during initiation of IRES-containing mRNAs, both cellular protein cleavage and the presence of high levels of PV 2A^pro^ are necessary.", "\n\nIt is most striking that after several decades of studies on the mechanism of picornavirus translation, the possibility that eIF2 may not participate in this process has not been uncovered. ", "It is generally thought that translation on picornavirus RNA requires active eIF2 [@pone.0025699-Pestova2]. ", "This mechanism has been supported by many studies using cell free systems. ", "However, to our knowledge the idea that eIF2 might not participate in the initiation of translation of PV RNA in the infected cells has not been investigated. ", "Notably, PV translation is blocked by Ars during the early period of infection, supporting the notion that PV RNA exhibits a dual mode for its translation, as occurs for instance with Sindbis virus 26S mRNA [@pone.0025699-Sanz1]. ", "Therefore, PV RNA may follow two different mechanisms for the initiation of translation: one canonical mechanism using entire eIF4G and eIF2 early during infection and another mechanism at the late phase of the virus life cycle. ", "This last mechanism does not require intact eIF4G or active eIF2. ", "Remarkably, the presence of PV 2A^pro^ alone suffices to provide independence from active eIF2.", "\n\nThe new and unsuspected findings that the translation of mRNAs bearing picornavirus IRESs takes place when eIF2 has been inactivated by phosphorylation open a future area for research in the field of picornavirus translation. ", "In addition, the fact that PV 2A^pro^ can switch picornavirus RNA translation from an eIF2 dependent mechanism to a different mode of initiation establishes the first molecular basis for this phenomenon. ", "Future work will target the elucidation of potential cellular proteins or factors that can replace eIF2 during picornavirus RNA translation. ", "It is even possible that in the infected cells or in the presence of PV 2A^pro^ the IRES structure is sufficient to signal the initiation codon in a way akin to that described for Cricket paralysis virus IGR IRES [@pone.0025699-Deniz1], [@pone.0025699-Wilson1]. ", "Several reports have appeared about the potential replacement of eIF2 by other cellular proteins for the translation of hepatitis C virus (HCV) RNA [@pone.0025699-Skabkin1], [@pone.0025699-Dmitriev1], but these experiments have always been carried out in *in vitro* systems in the absence of any viral protein. ", "Some authors believe that eIF5B can replace eIF2 for the translation of HCV RNA in reconstituted cell free systems [@pone.0025699-Terenin1]. ", "A recent report suggests that ligatin (also known as eIF2D) could replace eIF2 for HCV, but not EMCV RNA translation [@pone.0025699-Skabkin1]. ", "Although cell free systems have been very useful for unravelling the mechanisms of protein synthesis, they may provide some artefacts. ", "Therefore, the observations found in *in vitro* systems must be contrasted with the situation present in intact cells and in virus-infected cells.", "\n\nMaterials and Methods {#s4}\n=====================\n\nCell Cultures {#s4a}\n-------------\n\nBaby Hamster Kidney (BHK-21 and clon BSR-T7/5, designated as BHKT7) cells [@pone.0025699-Buchholz1] and Huh7-T7 (Human Hepatoma,) were used in this work. ", "Cells were grown at 37°C in Dulbecco\\'s Modified Eagle\\'s Medium (DMEM) supplemented with 5% or 10% fetal calf serum (FCS) and non-essential amino acids. ", "Cells BHKT7 were additionally provided with Geneticin G418 (Sigma) on every third passage at a final concentration of 2 mg ml^−1^ cell culture medium. ", "For Huh7-T7 cells the medium was supplemented with Zeocin (5 µM).", "\n\nPlasmids and transfections {#s4b}\n--------------------------\n\nThe pTM1-derived plasmids containing the poliovirus proteins were described in detail earlier [@pone.0025699-Ventoso3], [@pone.0025699-Aldabe1], [@pone.0025699-Aldabe2], [@pone.0025699-Aldabe3] . ", "The constructs pKs.", "Luc and pTM1-luc have been already described [@pone.0025699-Sanz2]. ", "The pTM1-eIF4GInt and pTM1-eIF4GIct were constructed using the pcDNA3 HAeIF4G-I [@pone.0025699-Gradi1] as DNA template. ", "In the case of N-terminal fragment, were used the primers 5′NcoI4GInt: GCGCGCCCCATGGCCACGCCTTCTCAG and 3′BclI4GInt: GCGCTGATCATTAGCCAAGGTTGGCCAAG and, in the case of C-terminal the primers used were 5′EcoRI4GIct: GCGCGCAAATTCGGACAACCCTTAGC and 3′BclI4GIct: CCGCTGATCAGTTGTGGTCAGACTCCTCC. ", "The PCR products were digested with NcoI/BclI or EcoRI/BclI respectively and inserted into the pTM1, previousy digested with the same enzymes. ", "BHKT7 cells were transfected using Lipofectamine 2000 (Invitrogen). ", "Cells were transfected or co-transfected with 1 µg of plasmid DNA or a mixture comprising 1 µg of each plasmid; in the case of RNA transfection, 2 µg of 2A mRNA were added plus 2 µl of Lipofectamine per well in Opti-mem medium (Invitrogen) for 2 hours at 37°C. ", "After 2 hours, Lipofectamine was removed, and the cells were supplemented with fresh medium containing 5% FCS. ", "BHK-21 cells were electroporated with *in vitro* synthesized mRNAs using as DNA templates the PV replicon, pKS.Luc or T7 Rluc ΔEMCV IGR-Fluc (this plasmid was employed to obtain CrPV IGR-luc mRNA). ", "To obtain Cap-luc mRNA from pKS.luc, an m^7^G(5′)ppp(5′)G cap analog was added to the transcription mixture. ", "Transcription reactions were carried out with T7 RNA polymerase (Promega) according to the manufacturer\\'s instructions. ", "For transfection, subconfluent BHK cells were harvested, washed with ice-cold phosphate-buffered saline (PBS), and resuspended at a density of approximately 2.5×10^6^ cells/ml in the same buffer. ", "Subsequently, 40 µg of *in vitro* transcribed RNA were added to 0.8 ml cell suspension and the mixture was transferred to a 4-mm cuvette (Bio-Rad). ", "Electroporation was performed at room temperature by generating one pulse at 350 V and 975 µF using a Gene Pulser II apparatus (Bio-Rad). ", "Finally, cells were diluted in DMEM supplemented with 10% FCS and seeded onto culture plates.", "\n\nInhibitor treatments and analysis of protein synthesis by radioactive labelling {#s4c}\n-------------------------------------------------------------------------------\n\nBHKT7 cells were transfected or co-transfected with the corresponding plasmids. ", "At different time points, after two hours of incubation with transfection mixture, cells were pre-treated with 200 µM sodium arsenite (Ars) (Riedel-de Haën) or 2 µM Thapsigargin (Tg) (Sigma) for 15 min at 37°C, or left untreated. ", "Next, proteins were radiolabelled for 45 min with \\[^35^S\\]Met/Cys (Promix; Amersham Pharmacia) in methionine/cysteine-free DMEM in the presence or absence of the corresponding concentration of Ars or Tg. ", "Finally, cells were collected in sample buffer, boiled for 4 min and analysed by SDS-PAGE (17,5%) and fluorography. ", "Protein synthesis was quantified by densitometry using a GS-710 calibrated Imaging Densitometer (Bio-Rad). ", "In the case of NaCl treatment, a methionine/cysteine-free DMEM with a final concentration of 265 (120+145) mM NaCl was used. ", "Proteins were then radiolabelled for 45 minutes. ", "Finally, cell monolayers were resuspended in sample buffer and processed as described above.", "\n\nWestern blotting {#s4d}\n----------------\n\nTransfected cells were collected in sample buffer, boiled and processed by SDS-PAGE. ", "After electrophoresis, proteins were transferred to a nitrocellulose membrane as described previously [@pone.0025699-Barco2]. ", "To detect PV non-structural proteins, specific rabbit polyclonal antibodies [@pone.0025699-Barco1], [@pone.0025699-Barco2], [@pone.0025699-Rodriguez1] were used at dilution 1∶1000. ", "To detect eIF4GI a rabbit antibodies mix against the N-terminal and C-terminal portion of this protein [@pone.0025699-Aldabe4] were used at dilutions of 1∶1000. ", "Polyclonal rabbit antibodies against eIF2α (Santa Cruz biotechnologies) and phosphorylated eIF2α (Cell Signaling) were used at a 1∶1000 dilution. ", "Rabbit antisera were raised against firefly luciferase (Promega). ", "Incubation with primary antibodies was performed for 2 h at room temperature, and then the membrane was washed three times with PBS containing 0.2% Tween-20 and incubated for 1 h with horseradish peroxidase-conjugated anti-mouse (Promega) or anti-rabbit IgG antibodies (Amersham) at a 1∶5000 dilution. ", "After washing three times, protein bands were visualized with the ECL detection system (Amersham).", "\n\nMeasurement of Luciferase Activity {#s4e}\n----------------------------------\n\nCells were recovered in a buffer containing 25 mM glycylglycine (pH 7.8), 0.5% Triton X-100 and 1 mM dithiothreitol. ", "Luc activity was determined using *luciferase assay system* (Promega) and Mononlight 2010 apparatus (Analytical Luminescence Laboratory) as described previously [@pone.0025699-Alvarez1], [@pone.0025699-Ventoso1].", "\n\nSupporting Information {#s5}\n======================\n\n###### \n\n**Kinetics of PV Replicon.** ", "BHKT7 cells were transfected withPV replicon. ", "A) Protein synthesis was determined by labelling with \\[^35^S\\]Met-Cys for 45 minutes every two hours from 1 to 7 hpt. ", "B) Western blot analysis of the samples obtained in panel A using anti-eIF4G, anti-Luciferase and anti-phospho-eIF2α.", "\n\n(TIF)\n\n###### \n\nClick here for additional data file.", "\n\n###### \n\n**Rescue of picornavirus IRES translation by PV 2A^pro^ in Huh7-T7 cells.** ", "A) Hepatoma cells were transfected with plasmids encoding EMCV IRES-luc, PV IRES-luc or HAV IRES-luc alone or co-transfected with pTM1-2A. At 2 hpt cells were treated or not with 200 µM Ars for 1 hour. ", "Then, cells were harvested and lysated in luciferase buffer and luc activity was measured and represented as percentage from at least three independent experiments. ", "Error bars indicate SD. ", "B) eIF4GI were detected by western blot.", "\n\n(TIF)\n\n###### \n\nClick here for additional data file.", "\n\n###### \n\n**Effect of 2A^pro^ on PKR.** ", "BHKT7 cells were mock- or transfected with pTM1-2A in presence or absence of Ars. ", "Protein kinase RNA-activated (PKR) was detected by western blot.", "\n\n(TIF)\n\n###### \n\nClick here for additional data file.", "\n\nWe wish to express our gratitude to Dr. Y. Kusov for kindly providing us with plasmid pRLuc31 encoding the poliovirus replicon and plasmids encoding HAV and PV IRES-luc, Dr. P. Sarnow for plasmid T7 Rluc ΔEMCV IGR-Fluc, Dr. J. Berlanga for antibodies against PKR and Dr R. Bartenschlager for Huh7-T7. ", "Dr. A. Castelló is acknowledged for critical reading of this manuscript.", "\n\n**Competing Interests:**The authors have declared that no competing interests exist.", "\n\n**Funding:**This study was supported by a DGICYT (Direccion General de Investigacion Cientifica y Tecnica. ", "Ministerio de Educacion y Ciencia. ", "SPAIN) grant (BFU2009-07352). ", "NR and EW are holders of FPI (Formación de Personal Investigador) and FPU (Formación de Profesorado Universitario) fellowships, respectively. ", "The Institutional Grant awarded to the Centro de Biología Molecular \"Severo Ochoa\" by the Fundación Ramón Areces is acknowledged. ", "The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.", "\n\n[^1]: Conceived and designed the experiments: NR LC. ", "Performed the experiments: NR MAS EW. ", "Analyzed the data: NR MAS LC. ", "Wrote the paper: NR MAS LC.", "\n" ]

{ "pile_set_name": "PubMed Central" }

[ 0.009302325581395349, 0.003355704697986577, 0, 0.008771929824561403, 0, 0.009174311926605505, 0, 0.008658008658008658, 0.006622516556291391, 0.009900990099009901, 0, 0, 0.009615384615384616, 0, 0, 0.02158273381294964, 0, 0.013071895424836602, 0.017543859649122806, 0.006369426751592357, 0, 0.007936507936507936, 0.009900990099009901, 0.008403361344537815, 0.017699115044247787, 0, 0.03225806451612903, 0.014184397163120567, 0.013392857142857142, 0.008928571428571428, 0.0072992700729927005, 0.015625, 0, 0.017391304347826087, 0.013333333333333334, 0.016286644951140065, 0.006369426751592357, 0, 0.009868421052631578, 0, 0.012084592145015106, 0.018867924528301886, 0, 0.008333333333333333, 0.011299435028248588, 0.008, 0, 0.00641025641025641, 0.012861736334405145, 0.012875536480686695, 0.007194244604316547, 0, 0.00847457627118644, 0.018633540372670808, 0.007407407407407408, 0.011627906976744186, 0.006802721088435374, 0, 0, 0.013245033112582781, 0.009615384615384616, 0.005813953488372093, 0.005780346820809248, 0.0035587188612099642, 0, 0.004739336492890996, 0, 0.008620689655172414, 0, 0, 0.01639344262295082, 0, 0.011363636363636364, 0, 0.005226480836236934, 0, 0, 0.009174311926605505, 0, 0, 0, 0.008547008547008548, 0, 0.007462686567164179, 0, 0, 0, 0, 0, 0.011904761904761904, 0.017543859649122806, 0, 0, 0.004273504273504274, 0.005747126436781609, 0, 0.015228426395939087, 0, 0.007692307692307693, 0.008130081300813009, 0, 0, 0, 0, 0.015197568389057751, 0, 0, 0, 0.0072992700729927005, 0.005319148936170213, 0.005, 0, 0.006802721088435374, 0.0058823529411764705, 0.01020408163265306, 0.014705882352941176, 0, 0.011494252873563218, 0, 0.014134275618374558, 0.017857142857142856, 0, 0, 0.024539877300613498, 0.024691358024691357, 0, 0, 0.006896551724137931, 0.006644518272425249, 0.009174311926605505, 0, 0, 0.0030959752321981426, 0.012987012987012988, 0.020202020202020204, 0, 0, 0, 0, 0, 0, 0.0049261083743842365, 0.01015228426395939, 0, 0, 0.005917159763313609, 0, 0.007936507936507936, 0, 0.0028169014084507044, 0, 0, 0, 0, 0, 0, 0.0048543689320388345, 0, 0, 0, 0, 0.015384615384615385, 0, 0.005434782608695652, 0, 0.011235955056179775, 0.0196078431372549, 0, 0, 0.005681818181818182, 0.006211180124223602, 0.010638297872340425, 0.0273972602739726, 0, 0.0034482758620689655, 0, 0.003257328990228013, 0.010471204188481676, 0, 0, 0, 0, 0, 0.002824858757062147, 0.005128205128205128, 0, 0, 0, 0, 0, 0, 0, 0, 0.041666666666666664, 0, 0.011527377521613832, 0.004347826086956522, 0.00819672131147541, 0, 0.012, 0.003816793893129771, 0.013937282229965157, 0, 0, 0, 0.012195121951219513, 0, 0.010416666666666666, 0.013888888888888888, 0.007547169811320755, 0.017094017094017096, 0.015544041450777202, 0, 0, 0, 0.018518518518518517, 0, 0, 0.008695652173913044, 0.004366812227074236, 0, 0, 0, 0.004901960784313725, 0.0070921985815602835, 0.011450381679389313, 0.00964630225080386, 0.0070921985815602835, 0.013986013986013986, 0, 0, 0.012345679012345678, 0, 0.006622516556291391, 0.015384615384615385, 0.015384615384615385, 0.05263157894736842, 0.014705882352941176, 0.008333333333333333, 0.003472222222222222, 0.02097902097902098, 0.014705882352941176, 0.007662835249042145, 0.009009009009009009, 0.005050505050505051, 0.009174311926605505, 0.024793388429752067, 0.00510204081632653, 0.006756756756756757, 0, 0, 0, 0, 0.014634146341463415, 0.008620689655172414, 0.009345794392523364, 0.016, 0, 0, 0.007751937984496124, 0.007936507936507936, 0.016574585635359115, 0.006211180124223602, 0.02054794520547945, 0.015151515151515152, 0.009933774834437087, 0, 0.005076142131979695, 0.014150943396226415, 0, 0.021739130434782608, 0, 0, 0.018518518518518517, 0.011494252873563218, 0, 0, 0.041666666666666664, 0, 0.018518518518518517, 0.024390243902439025, 0, 0.015625, 0.018518518518518517, 0.0165016501650165, 0.013888888888888888, 0, 0, 0.02857142857142857, 0, 0.014084507042253521, 0.007692307692307693, 0, 0.01818181818181818, 0, 0, 0, 0 ]

[ { "analysis_explanation": null, "end": 301, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 295 }, { "analysis_explanation": null, "end": 313, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 306 }, { "analysis_explanation": null, "end": 2135, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2128 }, { "analysis_explanation": null, "end": 3096, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3092 }, { "analysis_explanation": null, "end": 3192, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3189 }, { "analysis_explanation": null, "end": 3264, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3260 }, { "analysis_explanation": null, "end": 3749, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3738 }, { "analysis_explanation": null, "end": 4150, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4147 }, { "analysis_explanation": null, "end": 4301, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4294 }, { "analysis_explanation": null, "end": 4311, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4305 }, { "analysis_explanation": null, "end": 5398, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5393 }, { "analysis_explanation": null, "end": 5575, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5572 }, { "analysis_explanation": null, "end": 6134, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6129 }, { "analysis_explanation": null, "end": 6299, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6296 }, { "analysis_explanation": null, "end": 6768, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6754 }, { "analysis_explanation": null, "end": 8132, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8125 }, { "analysis_explanation": null, "end": 8868, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8866 }, { "analysis_explanation": null, "end": 9052, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9047 }, { "analysis_explanation": null, "end": 9406, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9399 }, { "analysis_explanation": null, "end": 9555, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9553 }, { "analysis_explanation": null, "end": 9998, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9991 }, { "analysis_explanation": null, "end": 10536, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10531 }, { "analysis_explanation": null, "end": 10648, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10643 }, { "analysis_explanation": null, "end": 10845, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10843 }, { "analysis_explanation": null, "end": 10965, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10960 }, { "analysis_explanation": null, "end": 11663, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11656 }, { "analysis_explanation": null, "end": 11844, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11842 }, { "analysis_explanation": null, "end": 11908, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11902 }, { "analysis_explanation": null, "end": 12212, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12202 }, { "analysis_explanation": null, "end": 12280, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12268 }, { "analysis_explanation": null, "end": 12350, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12345 }, { "analysis_explanation": null, "end": 12445, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12393 }, { "analysis_explanation": null, "end": 14067, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14062 }, { "analysis_explanation": null, "end": 14975, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14965 }, { "analysis_explanation": null, "end": 15030, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15020 }, { "analysis_explanation": null, "end": 15172, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15167 }, { "analysis_explanation": null, "end": 15197, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15192 }, { "analysis_explanation": null, "end": 15675, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15670 }, { "analysis_explanation": null, "end": 15848, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15841 }, { "analysis_explanation": null, "end": 16858, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16853 }, { "analysis_explanation": null, "end": 16917, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16910 }, { "analysis_explanation": null, "end": 16959, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16955 }, { "analysis_explanation": null, "end": 17189, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17178 }, { "analysis_explanation": null, "end": 17298, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17292 }, { "analysis_explanation": null, "end": 17575, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17570 }, { "analysis_explanation": null, "end": 17757, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17752 }, { "analysis_explanation": null, "end": 17833, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17821 }, { "analysis_explanation": null, "end": 18331, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18324 }, { "analysis_explanation": null, "end": 18509, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18504 }, { "analysis_explanation": null, "end": 18707, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18705 }, { "analysis_explanation": null, "end": 18954, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18949 }, { "analysis_explanation": null, "end": 19043, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19038 }, { "analysis_explanation": null, "end": 19236, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19226 }, { "analysis_explanation": null, "end": 19291, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19281 }, { "analysis_explanation": null, "end": 19497, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19489 }, { "analysis_explanation": null, "end": 19709, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19699 }, { "analysis_explanation": null, "end": 19769, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19759 }, { "analysis_explanation": null, "end": 20144, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20139 }, { "analysis_explanation": null, "end": 20169, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20164 }, { "analysis_explanation": null, "end": 20643, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20636 }, { "analysis_explanation": null, "end": 21058, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21054 }, { "analysis_explanation": null, "end": 21235, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21231 }, { "analysis_explanation": null, "end": 21468, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21464 }, { "analysis_explanation": null, "end": 21618, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21611 }, { "analysis_explanation": null, "end": 21955, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21948 }, { "analysis_explanation": null, "end": 21961, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21957 }, { "analysis_explanation": null, "end": 22250, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 22245 }, { "analysis_explanation": null, "end": 22359, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 22355 }, { "analysis_explanation": null, "end": 22528, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 22518 }, { "analysis_explanation": null, "end": 22654, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 22649 }, { "analysis_explanation": null, "end": 22986, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 22982 }, { "analysis_explanation": null, "end": 23446, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 23443 }, { "analysis_explanation": null, "end": 23552, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 23542 }, { "analysis_explanation": null, "end": 23599, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 23596 }, { "analysis_explanation": null, "end": 24138, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 24131 }, { "analysis_explanation": null, "end": 24342, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 24335 }, { "analysis_explanation": null, "end": 25123, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 25119 }, { "analysis_explanation": null, "end": 25510, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 25503 }, { "analysis_explanation": null, "end": 26888, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 26884 }, { "analysis_explanation": null, "end": 27194, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 27191 }, { "analysis_explanation": null, "end": 27639, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 27634 }, { "analysis_explanation": null, "end": 27911, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 27901 }, { "analysis_explanation": null, "end": 27966, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 27956 }, { "analysis_explanation": null, "end": 28064, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 28052 }, { "analysis_explanation": null, "end": 28116, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 28111 }, { "analysis_explanation": null, "end": 28522, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 28516 }, { "analysis_explanation": null, "end": 28607, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 28597 }, { "analysis_explanation": null, "end": 28666, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 28656 }, { "analysis_explanation": null, "end": 28778, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 28766 }, { "analysis_explanation": null, "end": 28816, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 28811 }, { "analysis_explanation": null, "end": 29191, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 29187 }, { "analysis_explanation": null, "end": 29293, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 29286 }, { "analysis_explanation": null, "end": 29887, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 29883 }, { "analysis_explanation": null, "end": 29914, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 29910 }, { "analysis_explanation": null, "end": 30461, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 30454 }, { "analysis_explanation": null, "end": 30807, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 30800 }, { "analysis_explanation": null, "end": 30909, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 30902 }, { "analysis_explanation": null, "end": 31911, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 31901 }, { "analysis_explanation": null, "end": 32977, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 32972 }, { "analysis_explanation": null, "end": 33363, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 33358 }, { "analysis_explanation": null, "end": 33507, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 33497 }, { "analysis_explanation": null, "end": 34463, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 34456 }, { "analysis_explanation": null, "end": 35149, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 35142 }, { "analysis_explanation": null, "end": 36002, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 35987 }, { "analysis_explanation": null, "end": 36679, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 36672 }, { "analysis_explanation": null, "end": 39272, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 39258 }, { "analysis_explanation": null, "end": 39422, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 39416 }, { "analysis_explanation": null, "end": 39712, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 39709 }, { "analysis_explanation": null, "end": 40183, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 40154 }, { "analysis_explanation": null, "end": 40615, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 40607 }, { "analysis_explanation": null, "end": 40647, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 40640 }, { "analysis_explanation": null, "end": 40670, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 40663 }, { "analysis_explanation": null, "end": 40983, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 40976 }, { "analysis_explanation": null, "end": 42061, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 42052 }, { "analysis_explanation": null, "end": 42197, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 42185 }, { "analysis_explanation": null, "end": 42221, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 42215 }, { "analysis_explanation": null, "end": 42294, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 42288 }, { "analysis_explanation": null, "end": 42519, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 42514 }, { "analysis_explanation": null, "end": 42666, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 42646 }, { "analysis_explanation": null, "end": 42850, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 42840 }, { "analysis_explanation": null, "end": 43582, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 43577 }, { "analysis_explanation": null, "end": 43594, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 43584 }, { "analysis_explanation": null, "end": 43636, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 43631 }, { "analysis_explanation": null, "end": 43930, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 43927 }, { "analysis_explanation": null, "end": 44043, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 44037 }, { "analysis_explanation": null, "end": 44123, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 44120 }, { "analysis_explanation": null, "end": 44322, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 44310 }, { "analysis_explanation": null, "end": 44351, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 44348 }, { "analysis_explanation": null, "end": 44432, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 44422 }, { "analysis_explanation": null, "end": 44437, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 44433 }, { "analysis_explanation": null, "end": 44768, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 44752 }, { "analysis_explanation": null, "end": 44783, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 44773 }, { "analysis_explanation": null, "end": 44799, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 44784 }, { "analysis_explanation": null, "end": 45157, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 45146 }, { "analysis_explanation": null, "end": 45273, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 45267 }, { "analysis_explanation": null, "end": 45845, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 45837 }, { "analysis_explanation": null, "end": 45965, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 45954 }, { "analysis_explanation": null, "end": 45980, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 45971 }, { "analysis_explanation": null, "end": 46032, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 46021 }, { "analysis_explanation": null, "end": 46084, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 46067 }, { "analysis_explanation": null, "end": 46113, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 46102 }, { "analysis_explanation": null, "end": 46361, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 46354 }, { "analysis_explanation": null, "end": 46651, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 46639 }, { "analysis_explanation": null, "end": 40888, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.6499999999999999, "start": 40886 }, { "analysis_explanation": null, "end": 40881, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 40875 }, { "analysis_explanation": null, "end": 41000, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 40994 }, { "analysis_explanation": null, "end": 10736, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.4, "start": 10729 }, { "analysis_explanation": null, "end": 10891, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.4, "start": 10884 }, { "analysis_explanation": null, "end": 11731, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 11729 }, { "analysis_explanation": null, "end": 13233, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 13231 }, { "analysis_explanation": null, "end": 13402, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 13400 }, { "analysis_explanation": null, "end": 16683, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 16681 }, { "analysis_explanation": null, "end": 16705, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 16703 }, { "analysis_explanation": null, "end": 20655, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 20653 }, { "analysis_explanation": null, "end": 38949, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 38947 }, { "analysis_explanation": null, "end": 39017, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 39015 }, { "analysis_explanation": null, "end": 39272, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 39268 }, { "analysis_explanation": null, "end": 39376, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 39374 }, { "analysis_explanation": null, "end": 41123, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 41121 }, { "analysis_explanation": null, "end": 45063, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 45061 }, { "analysis_explanation": null, "end": 45995, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 45993 }, { "analysis_explanation": null, "end": 46096, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 46094 }, { "analysis_explanation": null, "end": 178, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 171 }, { "analysis_explanation": null, "end": 206, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 199 }, { "analysis_explanation": null, "end": 328, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 321 }, { "analysis_explanation": null, "end": 904, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 897 }, { "analysis_explanation": null, "end": 1344, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 1337 }, { "analysis_explanation": null, "end": 1697, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 1690 }, { "analysis_explanation": null, "end": 2150, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 2143 }, { "analysis_explanation": null, "end": 2562, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 2555 }, { "analysis_explanation": null, "end": 2588, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 2581 }, { "analysis_explanation": null, "end": 2930, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 2923 }, { "analysis_explanation": null, "end": 2956, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 2949 }, { "analysis_explanation": null, "end": 2983, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 2976 }, { "analysis_explanation": null, "end": 3478, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 3471 }, { "analysis_explanation": null, "end": 3504, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 3497 }, { "analysis_explanation": null, "end": 3871, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 3864 }, { "analysis_explanation": null, "end": 3898, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 3891 }, { "analysis_explanation": null, "end": 3924, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 3917 }, { "analysis_explanation": null, "end": 3950, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 3943 }, { "analysis_explanation": null, "end": 4113, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 4106 }, { "analysis_explanation": null, "end": 4165, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 4158 }, { "analysis_explanation": null, "end": 4190, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 4183 }, { "analysis_explanation": null, "end": 4243, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 4236 }, { "analysis_explanation": null, "end": 4378, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 4371 }, { "analysis_explanation": null, "end": 4577, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 4570 }, { "analysis_explanation": null, "end": 4603, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 4596 }, { "analysis_explanation": null, "end": 4798, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 4791 }, { "analysis_explanation": null, "end": 4829, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 4822 }, { "analysis_explanation": null, "end": 4962, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 4955 }, { "analysis_explanation": null, "end": 5153, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 5146 }, { "analysis_explanation": null, "end": 5332, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 5325 }, { "analysis_explanation": null, "end": 5358, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 5351 }, { "analysis_explanation": null, "end": 5712, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 5705 }, { "analysis_explanation": null, "end": 5738, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 5731 }, { "analysis_explanation": null, "end": 6522, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 6515 }, { "analysis_explanation": null, "end": 6548, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 6541 }, { "analysis_explanation": null, "end": 6706, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 6699 }, { "analysis_explanation": null, "end": 6730, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 6723 }, { "analysis_explanation": null, "end": 6947, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 6940 }, { "analysis_explanation": null, "end": 6971, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 6964 }, { "analysis_explanation": null, "end": 6996, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 6989 }, { "analysis_explanation": null, "end": 7257, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 7250 }, { "analysis_explanation": null, "end": 7343, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 7336 }, { "analysis_explanation": null, "end": 8071, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 8064 }, { "analysis_explanation": null, "end": 8096, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 8089 }, { "analysis_explanation": null, "end": 8199, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 8192 }, { "analysis_explanation": null, "end": 8240, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 8233 }, { "analysis_explanation": null, "end": 8407, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 8400 }, { "analysis_explanation": null, "end": 8611, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 8604 }, { "analysis_explanation": null, "end": 8636, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 8629 }, { "analysis_explanation": null, "end": 8774, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 8767 }, { "analysis_explanation": null, "end": 9150, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 9143 }, { "analysis_explanation": null, "end": 9178, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 9171 }, { "analysis_explanation": null, "end": 9204, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 9197 }, { "analysis_explanation": null, "end": 9339, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 9332 }, { "analysis_explanation": null, "end": 9443, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 9436 }, { "analysis_explanation": null, "end": 9471, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 9464 }, { "analysis_explanation": null, "end": 9963, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 9956 }, { "analysis_explanation": null, "end": 10323, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 10316 }, { "analysis_explanation": null, "end": 10461, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 10454 }, { "analysis_explanation": null, "end": 10489, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 10482 }, { "analysis_explanation": null, "end": 11185, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 11178 }, { "analysis_explanation": null, "end": 12420, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 12413 }, { "analysis_explanation": null, "end": 12440, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 12433 }, { "analysis_explanation": null, "end": 13730, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 13723 }, { "analysis_explanation": null, "end": 13808, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 13801 }, { "analysis_explanation": null, "end": 13870, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 13863 }, { "analysis_explanation": null, "end": 14237, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 14230 }, { "analysis_explanation": null, "end": 14375, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 14368 }, { "analysis_explanation": null, "end": 14505, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 14498 }, { "analysis_explanation": null, "end": 15530, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 15523 }, { "analysis_explanation": null, "end": 15550, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 15543 }, { "analysis_explanation": null, "end": 16284, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 16277 }, { "analysis_explanation": null, "end": 16565, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 16558 }, { "analysis_explanation": null, "end": 16587, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 16580 }, { "analysis_explanation": null, "end": 16612, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 16605 }, { "analysis_explanation": null, "end": 16720, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 16713 }, { "analysis_explanation": null, "end": 17645, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 17638 }, { "analysis_explanation": null, "end": 17665, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 17658 }, { "analysis_explanation": null, "end": 17853, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 17846 }, { "analysis_explanation": null, "end": 17878, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 17871 }, { "analysis_explanation": null, "end": 18206, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 18199 }, { "analysis_explanation": null, "end": 18452, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 18445 }, { "analysis_explanation": null, "end": 18589, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 18582 }, { "analysis_explanation": null, "end": 18734, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 18727 }, { "analysis_explanation": null, "end": 20198, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 20191 }, { "analysis_explanation": null, "end": 20218, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 20211 }, { "analysis_explanation": null, "end": 20670, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 20663 }, { "analysis_explanation": null, "end": 21108, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 21101 }, { "analysis_explanation": null, "end": 21132, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 21125 }, { "analysis_explanation": null, "end": 21496, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 21489 }, { "analysis_explanation": null, "end": 21797, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 21790 }, { "analysis_explanation": null, "end": 22001, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 21994 }, { "analysis_explanation": null, "end": 23806, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 23799 }, { "analysis_explanation": null, "end": 23826, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 23819 }, { "analysis_explanation": null, "end": 24033, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 24026 }, { "analysis_explanation": null, "end": 24701, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 24694 }, { "analysis_explanation": null, "end": 25467, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 25460 }, { "analysis_explanation": null, "end": 25864, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 25857 }, { "analysis_explanation": null, "end": 26010, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 26003 }, { "analysis_explanation": null, "end": 26837, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 26830 }, { "analysis_explanation": null, "end": 26997, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 26990 }, { "analysis_explanation": null, "end": 27132, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 27125 }, { "analysis_explanation": null, "end": 29069, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 29062 }, { "analysis_explanation": null, "end": 29089, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 29082 }, { "analysis_explanation": null, "end": 29442, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 29435 }, { "analysis_explanation": null, "end": 29749, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 29742 }, { "analysis_explanation": null, "end": 30834, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 30827 }, { "analysis_explanation": null, "end": 31030, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 31023 }, { "analysis_explanation": null, "end": 32399, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 32392 }, { "analysis_explanation": null, "end": 32419, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 32412 }, { "analysis_explanation": null, "end": 32613, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 32606 }, { "analysis_explanation": null, "end": 32639, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 32632 }, { "analysis_explanation": null, "end": 32664, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 32657 }, { "analysis_explanation": null, "end": 33423, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 33416 }, { "analysis_explanation": null, "end": 33451, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 33444 }, { "analysis_explanation": null, "end": 33570, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 33563 }, { "analysis_explanation": null, "end": 33945, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 33938 }, { "analysis_explanation": null, "end": 33971, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 33964 }, { "analysis_explanation": null, "end": 33998, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 33991 }, { "analysis_explanation": null, "end": 34575, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 34568 }, { "analysis_explanation": null, "end": 34602, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 34595 }, { "analysis_explanation": null, "end": 34826, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 34819 }, { "analysis_explanation": null, "end": 34945, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 34938 }, { "analysis_explanation": null, "end": 34970, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 34963 }, { "analysis_explanation": null, "end": 35075, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 35068 }, { "analysis_explanation": null, "end": 35102, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 35095 }, { "analysis_explanation": null, "end": 35352, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 35345 }, { "analysis_explanation": null, "end": 35491, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 35484 }, { "analysis_explanation": null, "end": 35516, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 35509 }, { "analysis_explanation": null, "end": 35542, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 35535 }, { "analysis_explanation": null, "end": 36242, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 36235 }, { "analysis_explanation": null, "end": 36709, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 36702 }, { "analysis_explanation": null, "end": 37907, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 37900 }, { "analysis_explanation": null, "end": 37931, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 37924 }, { "analysis_explanation": null, "end": 38104, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 38097 }, { "analysis_explanation": null, "end": 38130, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 38123 }, { "analysis_explanation": null, "end": 38382, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 38375 }, { "analysis_explanation": null, "end": 38525, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 38518 }, { "analysis_explanation": null, "end": 38994, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 38987 }, { "analysis_explanation": null, "end": 39601, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 39594 }, { "analysis_explanation": null, "end": 39627, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 39620 }, { "analysis_explanation": null, "end": 39652, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 39645 }, { "analysis_explanation": null, "end": 39677, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 39670 }, { "analysis_explanation": null, "end": 39768, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 39761 }, { "analysis_explanation": null, "end": 39871, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 39864 }, { "analysis_explanation": null, "end": 43188, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 43181 }, { "analysis_explanation": null, "end": 43288, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 43281 }, { "analysis_explanation": null, "end": 43312, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 43305 }, { "analysis_explanation": null, "end": 43336, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 43329 }, { "analysis_explanation": null, "end": 43496, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 43489 }, { "analysis_explanation": null, "end": 44523, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 44516 }, { "analysis_explanation": null, "end": 44549, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 44542 } ]

[ "ジムに通ってマッチョになって……とムキムキ姿の自分を想像している人も多いでしょうが、実はボディビルダーはすごく筋力があるわけではないようです。英国のとある研究で、12人のボディビルダー、6人のパワーアスリート、14人の一般人の筋線維の強さを調べました（11）。普通に考えると、ボディビルダーが最強かなと思うのですが、そう簡単な話ではありません。筋線維の断面積を調べるとボディビルダーのそれは肥大していることがわかったのですが、筋線維あたりの筋力に関しては、パワーアスリートより62％、一般人より41％低いことがわかりました。ボディビルダーのほうが総合的な力が強いというのは間違いないのですが、筋線維あたりで計算すると「筋肉はゴツイけど筋力は弱い」というのが妥当な表現のようです。", "\n\nブラジルから興味深い医学論文が出ています（10）。フィットネスジムに通っている人が、一体いつまで継続できるかを調べたものです。リオデジャネイロ都市部の研究なので、お金持ちが対象になっています。2005年1月～2014年6月に、フィットネスジムの新規会員となった5千人以上の来店記録をチェックして、ジム通いがどのくらい続けられたか調べました。すると、新規会員になった人の63％が3カ月以内にジム通いをやめてしまうという驚きの結果が。なんと意志の弱いことか！ ", "そしてジム通い継続率は、半年後13・6％、1年後だとわずか3・7％にまで減少しました。やる気あんのかよ、というレベルです。9割以上が通わなくなるのですから、安易にジム通いを決断しないように！", "\n\nライザップも流行っていることだし、ここはセオリー通りフィットネスジムに通おうと思い立ったあなた。しかし、本当にそのジム通い、続けられますか？", "\n\nまた、音楽そのものにリラックス効果や抑うつを防止する効果がありますので、閉じこもりがちな中高年の人に対して、私は音楽をすすめています。老人ホームやデイサービスなどでリトミックを取り入れた健康体操がおこなわれているのは、そういう理由からです。", "\n\nたとえば、クラリネットなんてどうでしょうか？ ", "15人のクラリネット奏者の血液データや心電図を評価した珍しいドイツの研究があります（9）。若い奏者ではかなり運動量が多いことが分かり、激しい運動をするのと同じくらいの仕事量だったそうです。クラリネットのような大きな管楽器は、楽器内の空気抵抗が大きく、頸部の運動と肺の拡張にかなり筋肉を使うため、見かけよりも運動量が多いのです。毎日クラリネットをやっていたら、誤嚥も予防できそうです。管楽器はクラリネットでなくてもかまいません。近所迷惑が気になる人は、弱音器（ミュート）を付ける方法もあります。", "\n\nところで、日本人の死因の第5位は「肺炎」です。社会の高齢化がすすむ中、特に気を付けなければいけないのは誤嚥（ごえん）性肺炎です。食べ物や口中の菌が誤って肺に入ってしまう誤嚥によって生じる肺炎で、誤嚥は誰にも起こりうる老化現象です。近年、誤嚥を防止するために「肺を鍛える」というのが流行っています。医学的根拠は決して明確ではないのですが、いろいろなやり方があります。個人的には、てっとり早く肺を鍛えるなら管楽器を演奏するのがいいのではないかと思います。", "\n\n肺炎予防に音楽が効く？ ", "フィットネスジム通いは続かない？ ", "気になる「腹上死」の大研究……呼吸器内科医の倉原優氏が、世界の医学論文から身近な「命の危機」を読み解く。", "\n\nスマホゲームの功罪\n\n自宅で楽しむゲームって基本的に体に悪そうなイメージですよね。しかし最近、現実と同期させる「位置情報ゲーム」が台頭してきました。代表的なものが、ポケモンGOやドラクエウォークです。街中を歩いて、スマホ画面で敵と戦うゲームですが、レアモンスターに出会うためにはたくさん歩かないといけないようで。それが健康によいのでは、と注目されています。", "\n\nポケモンGOがもたらす医学的メリットを調べた研究結果が、東京大学から報告されています（12）。この研究の対象は40歳以上の中高年で、無料の歩数計をプレゼントされた市民に送付されたアンケートデータを用いました。ポケモンGOのプレイヤーと非プレイヤーの歩数が比較されました。すると、冬場ではポケモンGOをプレイしている人のほうがたくさん歩いていることが分かりました。", "\n\n「ゲームをすると運動量が増える」というのは、私のようなファミコン世代の人間からすれば驚きです。常識的に考えれば、ゲームをするほど運動量が減りますから、この位置情報ゲームというのは健康の観点から見ると、革新的なアプリケーションなのです。中高年にブームになりそうな位置情報ゲームを開発することが、高齢化社会にとってよいのかもしれません。", "\n\nもっとも、歩きながらスマホをすると、注意力が散漫になるという台湾の論文があります（13）。いたって当たり前の理論なので、敢えて医学論文にしなくてもいいんじゃないかと思われそうですが、医学的裏付けをちゃんと取るのが医学論文の世界なのです。スマホを持って横断歩道を歩行している人を2千人以上調べたところ、ポケモンGOをプレイしていた人では注意力が極めて散漫になることが示されました。そりゃそうだ。", "\n\n実は、この注意力散漫については、男女差があることが知られており、スマホ注視は女性のほうが顕著であるとされています（14）。すなわち、歩行中のひったくりや性犯罪の被害リスクが高い女性は、安易にスマホをいじらないほうがよいのです。いずれにしても交通事故のリスクは確実に高くなりますので、スマホの触りすぎにはご注意を。", "\n\nいつ、どこで、誰が相手か!? 「", "腹上死」の大研究\n\n昼間は運動不足でも、夜に妻と頑張ればッ……とお思いの殿方もいらっしゃるでしょう。実は性生活には良い点と悪い点があります。", "\n\n射精は前立腺がんのリスクを減らすというカナダの医学論文があります（15）。前立腺がんと診断されている人と健康な人に性生活のアンケート調査を実施したところ、生涯で20人を超える女性と関係したことがある男性では、それ以外の男性と比べて前立腺がんのリスクが28％低下したのです。また、性交渉の経験がない童貞の男性が前立腺がんと診断されるリスクは、経験のある男性の約2倍であることもわかりました。なぜこのような結果になったかというと、射精によって前立腺液内の発がん物質が洗い流されるからではないかと考えられているようです。ちなみに、この研究では同性愛についても調査しており、男性同士だと前立腺がんのリスクが逆に上昇しました。男性同士の性交渉はいささか激しいようで、物理的に前立腺が傷害されるからだそうです。", "\n\nさて、性行為の際、注意すべきなのが「腹上死」です。読んで字のごとく、性行為中に女性のおなかの上で死ぬことを意味します。むろん、女性のおなかの下や背中の上での可能性もありますが。そんな昼ドラみたいなことってあるの？と思われる人も多いでしょう。それが実は結構あるんです。", "\n\n膨大な剖検（遺体を解剖して検査すること）例のうち、性行為中に死亡した人だけを抽出した珍しい医学論文を紹介しましょう（16）。一体ベッドの上で何が起こったのかを調べた執念の研究です。ドイツのある法医学教室では、過去約3万8千例の剖検が行われましたが、そのうち性行為中に亡くなった方が99人（0・26％）いたそうです。", "\n\n性行為中に死亡した99人のうち、91人が男性でした。腹上死は、ほぼほぼ男性に起こる現象と考えてよさそうですね。男性の平均年齢は57・2歳とオジサマが多かったようです。性行為中の死亡が多かったのは、主に春夏の暖かい季節で、場所は故人の家であることが多かったそうです。性行為のパートナーが同定できたケースを見てみると、34人の男性が売春婦との性行為により死亡しており、9人が妻、7人が愛人、4人がその他のパートナー（未婚・同性愛など）という結果でした。死因は、6割以上が心筋梗塞などの心疾患によるもので、それ以外は脳出血や動脈瘤破裂などでした。おそらく性行為によって血管に負担がかかったのでしょう。メタボの男性はこうしたリスクがさらに高くなりますので、決して無理をなさらぬよう……。", "\n\n長々と書いてきましたが、私たちの身の回りについて研究した色々な医学論文が存在します。星の数ほどある医学論文の中には、もっと世の中に注目されてよいものがあるはずです。私は日夜、そういった論文を探して、実生活に応用しています。", "\n\n参考文献表\n\n9) Eur J Appl Physiol. ", "2010 Dec; 110 (6): 1199-208.", "\n\n10) J Sci Med Sport. ", "2016 Nov; 19 (11): 916-20.", "\n\n11) Exp Physiol. ", "2015 Nov; 100 (11): 1331-41.", "\n\n12) J Med Internet Res. ", "2019 Feb 5; 21 (2): el0724.", "\n\n13) BMC Public Health. ", "2018 Dec 31; 18 (1): 1342.", "\n\n14) 環境心理学研究. ", "2016; 4 (1): 33.", "\n\n15) Cancer Epidemiol. ", "2014 Dec; 38 (6): 700-7.", "\n\n16) J Sex Med. ", "2017 Oct; 14 (10): 1226-31.", "\n\n倉原優（くらはらゆう）\n\n2006年滋賀医科大学卒業。国立病院機構近畿中央呼吸器センター・呼吸器内科医師。日本呼吸器学会呼吸器専門医、日本感染症学会感染症専門医。論文の和訳やエッセイを多数執筆しており、著書に『本当にあった医学論文』（中外医学社）などがある。", "\n\n特集「身近なところに命の危機！ ", "世界の最新『医学論文』を紐解く」より" ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0058997050147492625, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.014285714285714285, 0, 0, 0, 0.002932551319648094, 0, 0, 0, 0.043478260869565216, 0, 0, 0, 0, 0, 0.04, 0, 0, 0, 0, 0, 0, 0, 0.007633587786259542, 0, 0 ]

[ { "analysis_explanation": null, "end": 14, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 0 }, { "analysis_explanation": null, "end": 3536, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3528 }, { "analysis_explanation": null, "end": 3586, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3578 }, { "analysis_explanation": null, "end": 3590, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3588 }, { "analysis_explanation": null, "end": 3620, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3609 }, { "analysis_explanation": null, "end": 3630, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3622 }, { "analysis_explanation": null, "end": 3685, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3675 }, { "analysis_explanation": null, "end": 3737, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3726 }, { "analysis_explanation": null, "end": 3755, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3753 }, { "analysis_explanation": null, "end": 3770, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3766 }, { "analysis_explanation": null, "end": 3813, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3805 }, { "analysis_explanation": null, "end": 3817, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3815 }, { "analysis_explanation": null, "end": 3853, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3845 }, { "analysis_explanation": null, "end": 3857, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3855 } ]

[ "Q:\n\nWhat method will be used to define the color of the d3 charts whereas the color gets lighter when the value of the data is smaller?", "\n\nThis is the codes that are use to make my bar chart. ", " \n<!", "DOCTYPE html>\n<meta charset=\"utf-8\">\n<style>\n\n.bar {\n fill: steelblue;\n}\n\n.bar:hover {\n fill: brown;\n}\n\n.axis {\n font: 10px sans-serif;\n}\n\n.axis path,\n.axis line {\n fill: none;\n stroke: #000;\n shape-rendering: crispEdges;\n}\n\n.x.axis path {\n display: black;\n}\n\n.d3-tip {\n line-height: 1;\n font-weight: bold;\n padding: 12px;\n background: rgba(0, 0, 0, 0.8);\n color: #fff;\n border-radius: 2px;\n}\n\n/* Creates a small triangle extender for the tooltip */\n.d3-tip:after {\n box-sizing: border-box;\n display: inline;\n font-size: 10px;\n width: 100%;\n line-height: 1;\n color: rgba(0, 0, 0, 0.8);\n content: \"\\25BC\";\n position: absolute;\n text-align: center;\n}\n\n/* Style northward tooltips differently */\n.d3-tip.n:after {\n margin: -1px 0 0 0;\n top: 100%;\n left: 0;\n}\n\n</style>\n<body>\n<script src=\"http://d3js.org/d3.v3.min.js\"></script>\n<script src=\"http://labratrevenge.com/d3-tip/javascripts/d3.tip.v0.6.3.js\"></script>\n<script>\n\nvar margin = {top: 100, right: 20, bottom: 30, left: 40},\n width = 200;\n height = 200;\n\nvar x = d3.scale.ordinal()\n .rangeRoundBands([0, width], .5);\n\nvar y = d3.scale.linear()\n .range([height, 0]);\n\nvar xAxis = d3.svg.axis()\n .scale(x)\n .orient(\"bottom\");\n\nvar yAxis = d3.svg.axis()\n .scale(y)\n .orient(\"left\")\n\nvar tip = d3.tip()\n .attr('class', 'd3-tip')\n .offset([-10, 0])\n .html(function(d) {\n return \"<strong>Deaths:</strong> <span style='color:red'>\" + d.deaths + \"</span>\";\n })\n\nvar svg = d3.select(\"body\").append(\"svg\")\n .attr(\"width\", width + margin.left + margin.right)\n .attr(\"height\", height + margin.top + margin.bottom)\n .append(\"g\")\n .attr(\"transform\", \"translate(\" + margin.left + \",\" + margin.top + \")\");\n\nsvg.call(tip);\n\nd3.json(\"data.json\", function(error, data) {\n x.domain(data.map(function(d) { return d.gender;}));\n y.domain([0, d3.max(data, function(d) { return d.deaths; })]);\n\n svg.append(\"g\")\n .attr(\"class\", \"x axis\")\n .attr(\"transform\", \"translate(0,\" + height + \")\")\n .call(xAxis)\n .append(\"text\")\n .attr(\"transform\", \"0\")\n .attr(\"x\", 10)\n .attr(\"dx\", \".71em\")\n .style(\"text-anchor\", \"right\")\n .text(\"2008\");\n\n svg.append(\"g\")\n .attr(\"class\", \"y axis\")\n .call(yAxis)\n .append(\"text\")\n .attr(\"transform\", \"rotate(-90)\")\n .attr(\"y\", 10)\n .attr(\"dy\", \".71em\")\n .style(\"text-anchor\", \"end\")\n .text(\"Deaths\");\n\n svg.selectAll(\".bar\")\n .data(data)\n .enter().append(\"rect\")\n .attr(\"class\", \"bar\")\n .attr(\"x\", function(d) { return x(d.gender); })\n .attr(\"width\", x.rangeBand(1))\n .attr(\"y\", function(d) { return y(d.deaths); })\n .attr(\"height\", function(d) { return height - y(d.deaths); })\n .on('mouseover', tip.show)\n .on('mouseout', tip.hide)\n\n });\n\nfunction type(d) {\n d.deaths = +d.deaths;\n return d;\n}\n\n</script>\n\nThe JSON file that I am using.", "\n[{\"countryName\":\"Afghanistan\",\"gender\":\"Female\",\"deaths\":\"97\"},{\"countryName\":\"Afghanistan\",\"gender\":\"Male\",\"deaths\":\"108\"}]\n\nWhat method in d3 should I use in my code so that the property of the color will be changed to a lighter color when the value of the data is smaller? ", "The below image is an example of what I am trying to implement into my chart. ", "The color will be changed accordingly to the value of the data.", "\n\nA:\n\nFinal Answer for you\n<!", "DOCTYPE html>\n<meta charset=\"utf-8\">\n<style>\n\n.bar {\n fill: steelblue;\n}\n\n.bar:hover {\n fill: brown;\n}\n\n.axis {\n font: 10px sans-serif;\n}\n\n.axis path,\n.axis line {\n fill: none;\n stroke: #000;\n shape-rendering: crispEdges;\n}\n\n.x.axis path {\n display: black;\n}\n\n.d3-tip {\n line-height: 1;\n font-weight: bold;\n padding: 12px;\n background: rgba(0, 0, 0, 0.8);\n color: #fff;\n border-radius: 2px;\n}\n\n/* Creates a small triangle extender for the tooltip */\n.d3-tip:after {\n box-sizing: border-box;\n display: inline;\n font-size: 10px;\n width: 100%;\n line-height: 1;\n color: rgba(0, 0, 0, 0.8);\n content: \"\\25BC\";\n position: absolute;\n text-align: center;\n}\n\n/* Style northward tooltips differently */\n.d3-tip.n:after {\n margin: -1px 0 0 0;\n top: 100%;\n left: 0;\n}\n\n</style>\n<body>\n<script src=\"http://d3js.org/d3.v3.min.js\"></script>\n<script src=\"http://labratrevenge.com/d3-tip/javascripts/d3.tip.v0.6.3.js\"></script>\n<script>\nvar data = [{\"countryName\":\"Afghanistan\",\"gender\":\"Female\",\"deaths\":\"97\"},\n {\"countryName\":\"Afghanistan\",\"gender\":\"Male\",\"deaths\":\"108\"}];\nvar deathArray = data.map(function(d){ return parseInt(d.deaths) });\nvar opacity = d3.scale.linear()\n .domain([d3.min(deathArray), d3.max(deathArray)])\n .range([0.1,1.0]);\n\nvar margin = {top: 100, right: 20, bottom: 30, left: 40},\n width = 200;\n height = 200;\n\nvar x = d3.scale.ordinal()\n .rangeRoundBands([0, width], .5);\n\nvar y = d3.scale.linear()\n .range([height, 0]);\n\nvar xAxis = d3.svg.axis()\n .scale(x)\n .orient(\"bottom\");\n\nvar yAxis = d3.svg.axis()\n .scale(y)\n .orient(\"left\")\n\nvar tip = d3.tip()\n .attr('class', 'd3-tip')\n .offset([-10, 0])\n .html(function(d) {\n return \"<strong>Deaths:</strong> <span style='color:red'>\" + d.deaths + \"</span>\";\n })\n\nvar svg = d3.select(\"body\").append(\"svg\")\n .attr(\"width\", width + margin.left + margin.right)\n .attr(\"height\", height + margin.top + margin.bottom)\n .append(\"g\")\n .attr(\"transform\", \"translate(\" + margin.left + \",\" + margin.top + \")\");\n\nsvg.call(tip);\n\n d3.json(\"data.json\", function(error, data) {\n x.domain(data.map(function(d) { return d.gender;}));\n y.domain([0, d3.max(data, function(d) { return d.deaths; })]);\n\n svg.append(\"g\")\n .attr(\"class\", \"x axis\")\n .attr(\"transform\", \"translate(0,\" + height + \")\")\n .call(xAxis)\n .append(\"text\")\n .attr(\"transform\", \"0\")\n .attr(\"x\", 10)\n .attr(\"dx\", \".71em\")\n .style(\"text-anchor\", \"right\")\n .text(\"2008\");\n\n svg.append(\"g\")\n .attr(\"class\", \"y axis\")\n .call(yAxis)\n .append(\"text\")\n .attr(\"transform\", \"rotate(-90)\")\n .attr(\"y\", 10)\n .attr(\"dy\", \".71em\")\n .style(\"text-anchor\", \"end\")\n .text(\"Deaths\");\n\n svg.selectAll(\".bar\")\n .data(data)\n .enter().append(\"rect\")\n .attr(\"class\", \"bar\")\n .attr(\"x\", function(d) { return x(d.gender); })\n .attr(\"width\", x.rangeBand(1))\n .attr(\"y\", function(d) { return y(d.deaths); })\n .attr(\"height\", function(d) { return height - y(d.deaths); })\n .on('mouseover', tip.show)\n .on('mouseout', tip.hide)\n .style(\"opacity\",function(d){ return opacity(d.deaths) });\n\n }); \n function type(d) {\n d.deaths = +d.deaths;\n return d;\n}\n\n</script>\n\nTry to understand the above code.", "\nIf you are not ask me.", "Okay\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.007407407407407408, 0, 0, 0.0013764624913971094, 0, 0, 0, 0, 0.0012001200120012002, 0, 0 ]

[ { "analysis_explanation": null, "end": 58, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 56 }, { "analysis_explanation": null, "end": 199, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 192 }, { "analysis_explanation": null, "end": 572, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 569 }, { "analysis_explanation": null, "end": 1736, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1725 }, { "analysis_explanation": null, "end": 2273, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2265 }, { "analysis_explanation": null, "end": 2713, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2705 }, { "analysis_explanation": null, "end": 3926, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3923 }, { "analysis_explanation": null, "end": 5442, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5431 }, { "analysis_explanation": null, "end": 5980, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5972 }, { "analysis_explanation": null, "end": 6420, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6412 }, { "analysis_explanation": null, "end": 1032, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 1003 }, { "analysis_explanation": null, "end": 1117, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 1056 }, { "analysis_explanation": null, "end": 4386, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 4357 }, { "analysis_explanation": null, "end": 4471, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 4410 }, { "analysis_explanation": null, "end": 428, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 423 }, { "analysis_explanation": null, "end": 1245, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 1240 }, { "analysis_explanation": null, "end": 1317, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 1306 }, { "analysis_explanation": null, "end": 1371, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 1362 }, { "analysis_explanation": null, "end": 1435, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 1426 }, { "analysis_explanation": null, "end": 1632, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 1628 }, { "analysis_explanation": null, "end": 1671, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 1666 }, { "analysis_explanation": null, "end": 1791, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 1782 }, { "analysis_explanation": null, "end": 1804, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 1795 }, { "analysis_explanation": null, "end": 1892, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 1883 }, { "analysis_explanation": null, "end": 1909, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 1903 }, { "analysis_explanation": null, "end": 1970, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 1966 }, { "analysis_explanation": null, "end": 1982, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 1975 }, { "analysis_explanation": null, "end": 2009, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 2005 }, { "analysis_explanation": null, "end": 2025, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 2021 }, { "analysis_explanation": null, "end": 2039, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 2034 }, { "analysis_explanation": null, "end": 2072, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 2068 }, { "analysis_explanation": null, "end": 2609, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 2603 }, { "analysis_explanation": null, "end": 2743, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 2739 }, { "analysis_explanation": null, "end": 2834, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 2830 }, { "analysis_explanation": null, "end": 2906, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 2902 }, { "analysis_explanation": null, "end": 2949, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 2943 }, { "analysis_explanation": null, "end": 3024, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 3020 }, { "analysis_explanation": null, "end": 3036, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 3032 }, { "analysis_explanation": null, "end": 3782, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 3777 }, { "analysis_explanation": null, "end": 4665, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 4658 }, { "analysis_explanation": null, "end": 4700, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 4696 }, { "analysis_explanation": null, "end": 4735, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 4724 }, { "analysis_explanation": null, "end": 4792, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 4787 }, { "analysis_explanation": null, "end": 4951, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 4946 }, { "analysis_explanation": null, "end": 5023, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 5012 }, { "analysis_explanation": null, "end": 5077, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 5068 }, { "analysis_explanation": null, "end": 5141, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 5132 }, { "analysis_explanation": null, "end": 5338, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 5334 }, { "analysis_explanation": null, "end": 5377, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 5372 }, { "analysis_explanation": null, "end": 5497, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 5488 }, { "analysis_explanation": null, "end": 5510, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 5501 }, { "analysis_explanation": null, "end": 5598, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 5589 }, { "analysis_explanation": null, "end": 5615, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 5609 }, { "analysis_explanation": null, "end": 5677, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 5673 }, { "analysis_explanation": null, "end": 5689, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 5682 }, { "analysis_explanation": null, "end": 5716, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 5712 }, { "analysis_explanation": null, "end": 5732, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 5728 }, { "analysis_explanation": null, "end": 5746, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 5741 }, { "analysis_explanation": null, "end": 5779, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 5775 }, { "analysis_explanation": null, "end": 6316, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 6310 }, { "analysis_explanation": null, "end": 6450, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 6446 }, { "analysis_explanation": null, "end": 6541, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 6537 }, { "analysis_explanation": null, "end": 6613, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 6609 }, { "analysis_explanation": null, "end": 6656, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 6650 }, { "analysis_explanation": null, "end": 6752, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 6748 }, { "analysis_explanation": null, "end": 6802, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 6798 }, { "analysis_explanation": null, "end": 6814, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 6810 } ]

[ "Postsurgical adjuvant tumor therapy by combining anti-angiopoietin-2 and metronomic chemotherapy limits metastatic growth.", "\nAntiangiogenic tumor therapy has failed in the adjuvant setting. ", "Here we show that inhibition of the Tie2 ligand angiopoietin-2 (Ang2) effectively blocks metastatic growth in preclinical mouse models of postsurgical adjuvant therapy. ", "Ang2 antibody treatment combines well with low-dose metronomic chemotherapy (LDMC) in settings in which maximum-dose chemotherapy does not prove effective. ", "Mechanistically, Ang2 blockade could be linked to quenching the inflammatory and angiogenic response of endothelial cells (ECs) in the metastatic niche. ", "Reduced EC adhesion molecule and chemokine expression inhibits the recruitment of tumor-promoting CCR2(+)Tie2(-) metastasis-associated macrophages. ", "Moreover, LDMC contributes to therapeutic efficacy by inhibiting the recruitment of protumorigenic bone marrow-derived myeloid cells. ", "Collectively, these data provide a rationale for mechanism-guided adjuvant tumor therapies." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0, 0, 0, 0, 0, 0.006756756756756757, 0, 0 ]

[ { "analysis_explanation": null, "end": 228, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 224 }, { "analysis_explanation": null, "end": 634, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 617 } ]

[ "Shazia Khalid\n\nShazia Khalid () () (born 1973) is a medical doctor and advocate of women's human rights from Sui, Sui, Pakistan.", "\n\nBackground\n\nDr. Shazia Khalid is married to Khalid Aman, a pipeline engineer. ", "In 2005 Dr. Shazia was an employee of Pakistan Petroleum Limited (PPL), and working at the company's Sui hospital for the past 18 months while living alone in accommodation provided by PPL. ", "Security services for the entire facility was provided by the Defence Services Group (DSG). ", "She had taken the job only after PPL had also promised a job for her husband. ", "The job, however, never materialised.", "\n\nRape\n\nOn the night of 2 January and in the early morning hours of 3 January 2005, Dr. Shazia was awoken by somebody pulling her hair. ", "She was then strangled with a cord, threatened, blindfolded, pistol-whipped, beaten and repeatedly raped by a masked intruder, at Sui, Dera Bugti, in the heavily guarded government-owned natural gas plant. ", "She was severely injured in the attack but managed to cut her hands free of the cord and sought help from a nurse, Sakina, at the nearby nursing hostel. ", "Sakina then informed the administration of PPL and the DCMO; the medical staff on duty, Dr Mohammad Ali, Dr Irshad, Dr Saima Siddiqui, nurse Firdous and Salimullah visited Dr. Shazia. ", "Her pleas to contact her husband (who was working in Libya at the time) and her family were ignored. ", "Instead of treating her medically, officials were said to have drugged her into unconsciousness with sedatives for three days to keep her quiet and then transferred her to a psychiatric hospital, Asghar Psychiatric Hospital, in Karachi.", "\n\nHouse arrest\n\nHer husband, Khalid, in Libya at the time, rushed back to Pakistan to be reunited with his wife. ", "With his support, Shazia reported the crime.", "\n\nFollowing the report, for a period of 2 months, she was put under house arrest in a house in Karachi under the \"unofficial protection\" of the police, army and Musharraf officials and was not allowed access to doctors, lawyers or visitors of her choice. ", "In addition, the crime scene and anything that could be considered as evidence, including the clothes of Dr. Shazia, were tampered with or destroyed. ", "When her family was informed some days later, Dr. Shazia and her family were told to keep quiet and dissuaded to register the rape case or speak to the media by the PPL Company representatives, who denied the rape to the media.", "\n\nHer husband Khalid said, his grandfather demanded that Khalid divorce her, because he felt, her rape had rendered her a stain on the family honour. ", "Khalid refused. ", "So the grandfather assembled a mob to kill Shazia.", "\n\nHer case led to a violent uprising by the Bugti tribe in Baluchistan province, disrupting the supply of gas to much of the country for several weeks. ", "By some accounts, up to 10,000 soldiers and police were brought in to quell the rebellion. ", "As the Pakistani authorities attacked the Bugti, President Musharraf promised that the tribesmen would \"not know what hit them.\" ", "and attacks on the Bugti tribesmen were intensified.", "\n\nAn unusual development occurred, when the then Pakistani President Pervez Musharraf entered the controversy, stating on national television, that the accused officer, named as Captain Hammad, was \"not guilty\", which led to criticism of Musharraf, a military man himself. ", "Both politicians as well as Pakistani human rights lawyer, Asma Jahangir voiced their criticism and concerns following the statement.", "\n\nThreats\n\nIn an interview with the BBC, Dr. Shazia said that she was threatened many times. \"", "I cannot tell you how many times I was threatened. ", "My life was made impossible. ", "I am still terrified.\" \"", "My whole career was destroyed, as was my husband's. ", "That was why we left our country.\" \"", "Instead of getting justice, I was hounded out of Pakistan. ", "I never wanted to leave Pakistan, but had no choice.\"", "\n\nDr. Shazia and her husband alleged that the authorities threatened them and ordered them to leave the country.", "\n\nExile\n\nOn 18 March 2005 Shazia and her husband, Dr. Shazia, left Pakistan on a flight to London, The United Kingdom. ", "She applied for asylum in Canada, where she has relatives, but her application was refused. ", "In August 2005 New York Times columnist Nicholas D. Kristof wrote several articles about Dr. Shazia's story and urged readers to write to the Canadian minister of citizenship and Immigration asking the Canadian government to reconsider. ", "As of 26 September 2005, Dr. Shazia was still stranded in the UK awaiting the result of her application for asylum in the UK. ", "She expressed great regret in being forced to leave her country, her adopted son and family, her career and life behind for a future unknown.", "\n\nCoverage\n\nDr. Shazia Khalid's story is covered in Terence McKenna's documentary about sexual violence in Pakistan, Land, Gold and Women. ", "In the interview with McKenna Shazia was quoted saying \"I did not get justice and I will regret that for the rest of my life\" on 28 February 2006.", "\n\nAftermath\n\nShazia Khalid has since become a spokesperson about the social and legal challenges women face in Pakistan today and advocate of women's human rights.", "\n\nAnother rape case was reported in September 2008, where a widow resident named, Firdaus Bibi, was gang-raped in the Pakistan Petroleum Limited Colony at Sui and a case was registered against nine officials of the PPL and Defence Security Guards (DSG) in this connection according to the police sources from Dera Bugti.", "\n\nSee also\n Mukhtaran Bibi\n Kainat Soomro\n Rape in Pakistan\n\nReferences\n\nExternal links\n Dr. Shazia's Story: In Her Own Words\n Amnesty International case report\n Sui Assault Victim Flies to UK-Pakistan Times\n Equality Now Action on Pakistan's rape laws\n Shazia Khalid and the fight for justice in Pakistan\n Video interview with BBC Urdu Service\n\nCategory:Pakistani medical doctors\nCategory:Pakistani women medical doctors\nCategory:Living people\nCategory:1973 births\nCategory:Rape in Pakistan\nCategory:People from Lahore\nCategory:Pakistan military scandals\nCategory:Violence against women in Pakistan" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.015625, 0.025, 0.015789473684210527, 0.010869565217391304, 0.01282051282051282, 0, 0.007352941176470588, 0.0048543689320388345, 0, 0.03804347826086957, 0, 0.00423728813559322, 0.017699115044247787, 0, 0.00392156862745098, 0.006666666666666667, 0.00881057268722467, 0.013333333333333334, 0, 0, 0, 0, 0.007751937984496124, 0, 0.01098901098901099, 0.007518796992481203, 0.02127659574468085, 0, 0, 0, 0, 0, 0, 0, 0.008928571428571428, 0.008403361344537815, 0, 0.012658227848101266, 0.007936507936507936, 0, 0.02158273381294964, 0.00684931506849315, 0, 0.0125, 0.005008347245409015 ]

[ { "analysis_explanation": null, "end": 28, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 0 }, { "analysis_explanation": null, "end": 45, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 41 }, { "analysis_explanation": null, "end": 112, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 109 }, { "analysis_explanation": null, "end": 117, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 114 }, { "analysis_explanation": null, "end": 127, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 119 }, { "analysis_explanation": null, "end": 158, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 145 }, { "analysis_explanation": null, "end": 184, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 173 }, { "analysis_explanation": null, "end": 214, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 210 }, { "analysis_explanation": null, "end": 225, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 219 }, { "analysis_explanation": null, "end": 343, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 325 }, { "analysis_explanation": null, "end": 636, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 614 }, { "analysis_explanation": null, "end": 667, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 644 }, { "analysis_explanation": null, "end": 685, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 671 }, { "analysis_explanation": null, "end": 697, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 691 }, { "analysis_explanation": null, "end": 872, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 869 }, { "analysis_explanation": null, "end": 884, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 874 }, { "analysis_explanation": null, "end": 1201, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1189 }, { "analysis_explanation": null, "end": 1212, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1206 }, { "analysis_explanation": null, "end": 1231, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1217 }, { "analysis_explanation": null, "end": 1246, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1239 }, { "analysis_explanation": null, "end": 1261, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1251 }, { "analysis_explanation": null, "end": 1280, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1274 }, { "analysis_explanation": null, "end": 1340, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1335 }, { "analysis_explanation": null, "end": 1508, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1498 }, { "analysis_explanation": null, "end": 1618, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1611 }, { "analysis_explanation": null, "end": 1653, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1647 }, { "analysis_explanation": null, "end": 1663, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1658 }, { "analysis_explanation": null, "end": 1700, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1692 }, { "analysis_explanation": null, "end": 1755, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1749 }, { "analysis_explanation": null, "end": 1822, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1802 }, { "analysis_explanation": null, "end": 1876, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1869 }, { "analysis_explanation": null, "end": 1944, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1935 }, { "analysis_explanation": null, "end": 2144, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2138 }, { "analysis_explanation": null, "end": 2223, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2208 }, { "analysis_explanation": null, "end": 2235, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2229 }, { "analysis_explanation": null, "end": 2425, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2419 }, { "analysis_explanation": null, "end": 2468, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2462 }, { "analysis_explanation": null, "end": 2561, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2555 }, { "analysis_explanation": null, "end": 2669, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2664 }, { "analysis_explanation": null, "end": 2699, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2679 }, { "analysis_explanation": null, "end": 2770, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2757 }, { "analysis_explanation": null, "end": 2879, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2870 }, { "analysis_explanation": null, "end": 2910, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2905 }, { "analysis_explanation": null, "end": 2931, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2922 }, { "analysis_explanation": null, "end": 3016, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3011 }, { "analysis_explanation": null, "end": 3101, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3092 }, { "analysis_explanation": null, "end": 3128, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3112 }, { "analysis_explanation": null, "end": 3235, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3229 }, { "analysis_explanation": null, "end": 3290, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3281 }, { "analysis_explanation": null, "end": 3353, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3344 }, { "analysis_explanation": null, "end": 3388, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3375 }, { "analysis_explanation": null, "end": 3499, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3493 }, { "analysis_explanation": null, "end": 3794, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3786 }, { "analysis_explanation": null, "end": 3828, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3820 }, { "analysis_explanation": null, "end": 3860, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3854 }, { "analysis_explanation": null, "end": 3984, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3971 }, { "analysis_explanation": null, "end": 3991, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3985 }, { "analysis_explanation": null, "end": 4019, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4013 }, { "analysis_explanation": null, "end": 4034, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4026 }, { "analysis_explanation": null, "end": 4056, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4050 }, { "analysis_explanation": null, "end": 4076, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4058 }, { "analysis_explanation": null, "end": 4110, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4104 }, { "analysis_explanation": null, "end": 4184, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4173 }, { "analysis_explanation": null, "end": 4229, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4210 }, { "analysis_explanation": null, "end": 4269, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4263 }, { "analysis_explanation": null, "end": 4320, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4312 }, { "analysis_explanation": null, "end": 4380, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4372 }, { "analysis_explanation": null, "end": 4430, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4413 }, { "analysis_explanation": null, "end": 4442, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4436 }, { "analysis_explanation": null, "end": 4471, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4469 }, { "analysis_explanation": null, "end": 4531, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4529 }, { "analysis_explanation": null, "end": 4704, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4689 }, { "analysis_explanation": null, "end": 4742, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4725 }, { "analysis_explanation": null, "end": 4788, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4780 }, { "analysis_explanation": null, "end": 4848, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4834 }, { "analysis_explanation": null, "end": 4957, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4941 }, { "analysis_explanation": null, "end": 4983, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4970 }, { "analysis_explanation": null, "end": 5076, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5068 }, { "analysis_explanation": null, "end": 5082, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5077 }, { "analysis_explanation": null, "end": 5169, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5155 }, { "analysis_explanation": null, "end": 5213, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5201 }, { "analysis_explanation": null, "end": 5277, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5274 }, { "analysis_explanation": null, "end": 5438, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5428 }, { "analysis_explanation": null, "end": 5485, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5450 }, { "analysis_explanation": null, "end": 5537, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5531 }, { "analysis_explanation": null, "end": 5624, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5600 }, { "analysis_explanation": null, "end": 5630, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5628 }, { "analysis_explanation": null, "end": 5678, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5670 }, { "analysis_explanation": null, "end": 5705, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5692 }, { "analysis_explanation": null, "end": 5743, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5735 }, { "analysis_explanation": null, "end": 5802, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5793 }, { "analysis_explanation": null, "end": 5837, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5828 }, { "analysis_explanation": null, "end": 5929, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5921 }, { "analysis_explanation": null, "end": 5975, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5967 }, { "analysis_explanation": null, "end": 6037, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6029 } ]

[ "pattaya lady boysporn photo hd\n\nWell&quest;&excl;&comma;That what you get for cheating you whore&excl; Let the world see your shame&excl; titty fun No matter how focused a woman is on her career, theya€™re not a match for johnny sins and his massive dick.", "\n\nlaura lion This sexy brunette shows what a real slut she can be.", "\n\nassamis barkh a bf photo dawnlod\n\nkelly x porn While still dressed in black bustier, panties, garters, stockings, and heels, Isla rubs the throbbing head of the toy against her nipples, first through the bustier and then on the bare." ]

{ "pile_set_name": "Pile-CC" }

[ 0, 0, 0.00425531914893617 ]

[ { "analysis_explanation": null, "end": 228, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 222 }, { "analysis_explanation": null, "end": 266, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 256 }, { "analysis_explanation": null, "end": 367, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 355 }, { "analysis_explanation": null, "end": 450, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 446 } ]

[ "The Securities and Exchange Commission reportedly has issued a subpoena to Senate Majority Leader Bill Frist regarding stock he owned and sold in the hospital company founded by his father. ", "Frist has said his assets were in a blind trust, but it now appears he held some of the stock outside the trust.", "\n\nMICHELE NORRIS, host:\n\nFrom NPR News, this is ALL THINGS CONSIDERED. ", "I'm Michele Norris.", "\n\nPublished reports today say that the Securities and Exchange Commission has issued a subpoena to the leader of the Senate's Republican majority, Bill Frist. ", "Both the SEC and the US district attorney's office in the southern district of New York are investigating Frist. ", "The senator sold off stock in his family's hospital business right before that stock's price took a dive. ", "Here's NPR's David Welna.", "\n\nDAVID WELNA reporting:\n\nAsked by NPR if it's true Senator Frist has had his personal financial records subpoenaed, an SEC spokesman replied, `No comment.' ", "Asked the same question, Frist's spokesman, Bob Stevenson, e-mailed a carefully worded statement. ", "`Senator Frist,' he wrote, `has been fully cooperating with the authorities conducting the inquiries and will continue to do so, including keeping our public comments to a minimum. ", "As for the reported subpoena,' he said, `the issuance of a subpoena would be an expected and normal part of that process.'", "\n\nExperts say it's clear the SEC would have to issue a subpoena in order to probe Frist's sell-off last summer of his holdings in HCA, the nation's largest for-profit hospital chain founded by Frist's father and brother. ", "Therese Pritchard is with the New York securities enforcement law firm Bryan Cave and is a former assistant director of enforcement at the SEC.", "\n\nMs. THERESE PRITCHARD (Bryan Cave): What they'll do is they'll take a look at phone records. ", "They'll take a look at what information was available at the company at the time he placed his order. ", "They'll take a look at who he spoke to at the company or perhaps--I understand his relatives are potentially in senior management, so they may look at their phone records as well to look for communications at or about the time that HCA was realizing that it wasn't going to meet its financial projections.", "\n\nWELNA: Frist insists no insider information prompted him to sell off his stock in HCA barely a week before a negative earnings report caused the price to drop 9 percent. ", "Instead Frist told reporters late last month he was simply responding to those who've questioned his pushing legislation benefiting HCA, such as limiting medical malpractice lawsuits.", "\n\nSenator BILL FRIST (Republican, Tennessee; Majority Leader): The cause of these continuing questions and looking ahead at my final years in the Senate and what might come next, I have for some time wanted to eliminate even the possibility of an appearance of a conflict by totally divesting of any HCA stock in my family's trust.", "\n\nWELNA: For years Frist insisted he had no idea whether he still owned any stock in HCA, since he put his investments into what the Senate calls a qualified blind trust. ", "But Frist did know he owned a large amount of HCA stock when he set up that trust. ", "And Washington University law Professor Kathleen Clark says there appears to have been no basis for Frist's earlier claims that he did not know whether he still had HCA stock in that blind trust.", "\n\nProfessor KATHLEEN CLARK (Washington University): When the assets are put there, as far as the senator, in this case, knew, the assets remained there. ", "So there wasn't anything blind about it. ", "He knew he had HCA stock in the, quote, \"qualified blind trust.\" ", "And he knew it hadn't been sold yet because if it had been sold, if the trustee decided to sell it, the trustee would have notified him.", "\n\nWELNA: Frist also knew he held HCA stock in a separate family trust managed by his brother. ", "In recent years he reported earning more than a quarter million dollars in dividends from those holdings. ", "None of those holdings, Clark says, were illegal, nor were they unethical if you go by Congress' standards.", "\n\nProf. CLARK: The ethics rules in Congress make it clear that there's nothing illegal about someone in Senator Frist's position from pushing legislation that will benefit him and his family financially, as long as other people in the health care field will also benefit from it.", "\n\nWELNA: The irony for Senator Frist is that in trying to clear up lingering questions about his holdings, in anticipation of a possible presidential bid, he's raised even more questions about his finances and his presidential hopes. ", "David Welna, NPR News, the Capitol.", "\n\nNPR transcripts are created on a rush deadline by a contractor for NPR, and accuracy and availability may vary. ", "This text may not be in its final form and may be updated or revised in the future. ", "Please be aware that the authoritative record of NPR’s programming is the audio." ]

{ "pile_set_name": "Pile-CC" }

[ 0.015789473684210527, 0.008928571428571428, 0.014084507042253521, 0.05263157894736842, 0.018867924528301886, 0.017699115044247787, 0, 0.08, 0.01910828025477707, 0.02040816326530612, 0.0055248618784530384, 0, 0.01809954751131222, 0.013986013986013986, 0.021052631578947368, 0, 0.003278688524590164, 0.005813953488372093, 0.01092896174863388, 0.00906344410876133, 0.017543859649122806, 0.024096385542168676, 0.020512820512820513, 0.013071895424836602, 0, 0.015384615384615385, 0, 0.02127659574468085, 0, 0.018691588785046728, 0.010752688172043012, 0.004273504273504274, 0.05714285714285714, 0.017543859649122806, 0, 0.0125 ]

[ { "analysis_explanation": null, "end": 108, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 98 }, { "analysis_explanation": null, "end": 195, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 190 }, { "analysis_explanation": null, "end": 317, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 303 }, { "analysis_explanation": null, "end": 390, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 376 }, { "analysis_explanation": null, "end": 415, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 410 }, { "analysis_explanation": null, "end": 526, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 516 }, { "analysis_explanation": null, "end": 547, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 537 }, { "analysis_explanation": null, "end": 572, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 570 }, { "analysis_explanation": null, "end": 636, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 628 }, { "analysis_explanation": null, "end": 660, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 655 }, { "analysis_explanation": null, "end": 792, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 781 }, { "analysis_explanation": null, "end": 857, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 852 }, { "analysis_explanation": null, "end": 1006, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 993 }, { "analysis_explanation": null, "end": 1061, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1056 }, { "analysis_explanation": null, "end": 1459, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1448 }, { "analysis_explanation": null, "end": 1587, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1570 }, { "analysis_explanation": null, "end": 1608, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1600 }, { "analysis_explanation": null, "end": 1651, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1641 }, { "analysis_explanation": null, "end": 1747, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1737 }, { "analysis_explanation": null, "end": 2227, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2222 }, { "analysis_explanation": null, "end": 2314, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2301 }, { "analysis_explanation": null, "end": 2398, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2393 }, { "analysis_explanation": null, "end": 2429, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2414 }, { "analysis_explanation": null, "end": 2587, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2577 }, { "analysis_explanation": null, "end": 2599, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2589 }, { "analysis_explanation": null, "end": 2610, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2601 }, { "analysis_explanation": null, "end": 2915, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2910 }, { "analysis_explanation": null, "end": 2921, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2916 }, { "analysis_explanation": null, "end": 3077, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3072 }, { "analysis_explanation": null, "end": 3205, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3191 }, { "analysis_explanation": null, "end": 3371, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3357 }, { "analysis_explanation": null, "end": 3753, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3748 }, { "analysis_explanation": null, "end": 3848, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3836 }, { "analysis_explanation": null, "end": 3968, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3963 }, { "analysis_explanation": null, "end": 4058, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4053 }, { "analysis_explanation": null, "end": 4162, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4157 }, { "analysis_explanation": null, "end": 4359, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4354 }, { "analysis_explanation": null, "end": 4568, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4557 } ]

[ "Q:\n\nHow would I write this as a single integral?", "\n\n$\\int _{-2}^2\\:f\\left(x\\right)dx+\\int _2^5\\:f\\left(x\\right)dx-\\int _{-2}^{-1}\\:f\\left(x\\right)dx$\nI did it through basic arithmetic by adding and then subtracting the values of the top and the bottom with their corresponding top and bottom values, but that did not yield the correct answer. ", "\nIs there a special way to compute this that I am not aware of?", "\nAny help?", "\n\nA:\n\nThe rules are:\n$$\\int_a^b f(x)dx + \\int_b^c f(x)dx = \\int_a^c f(x)dx$$\n$$\\int_a^b f(x)dx = -\\int_b^a f(x)dx.$$\n\nA:\n\nOriginal Equation:\n\\begin{align*}\n\\int_{-2}^{2}f(x)dx+\\int_{2}^{5}f(x)dx-\\int_{-2}^{-1}f(x)dx\n\\end{align*}\n\"Combine\" first two integrals\n\\begin{align*}\n\\int_{-2}^{5}f(x)dx-\\int_{-2}^{-1}f(x)dx\\\n\\end{align*}\n\"Flip\" last integral and change from negative to positive\n\\begin{align*}\n\\int_{-2}^{5}f(x)dx+\\int_{-1}^{-2}f(x)dx\\\n\\end{align*}\n\"Combine\" Integrals\n\\begin{align*}\n\\int_{-1}^{5}f(x)dx.", "\n\\end{align*}\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0, 0, 0, 0, 0, 0 ]

[]

[ "All relevant data are within the manuscript and its Supporting Information files.", "\n\nIntroduction {#sec001}\n============\n\nFluorescence microscopy is an essential tool in biomedical research used to visualize, analyze and study molecules, cells and tissues. ", "One of its main applications is to enable the quantification and localization of cellular components \\[[@pone.0215114.ref001]\\], which enables quantitative biology. ", "Other important applications include its usage as a readout mechanism in biochemical assays such immunoassays or quantitative polymerase chain reaction (qPCR). ", "In the healthcare sector, fluorescence microscopy has been recommended by the World Health Organization for the diagnosis of tuberculosis \\[[@pone.0215114.ref002]\\]. ", "However, because of its cost, training, maintenance and fragility, conventional fluorescence microscopes remain out of reach in developing countries, in rural areas and in remote settings \\[[@pone.0215114.ref003]--[@pone.0215114.ref006]\\]. ", "Thus, access to affordable fluorescence microscopes (albeit at the cost of compromising certain functionalities and resolution) can facilitate its deployment in these settings and its usage in point-of-care diagnostics, telemedicine, and environmental monitoring, benefitting global healthcare. ", "Furthermore, producing affordable and easy-to-assemble laboratory tools and instrumentation could facilitate research, produce quality results \\[[@pone.0215114.ref007]\\], improve laboratory productivity \\[[@pone.0215114.ref008]\\], and can potentially lead to new discoveries in biology, physiology, chemistry, and biomedicine \\[[@pone.0215114.ref009],[@pone.0215114.ref010]\\].", "\n\nAffordability and portability in fluorescence microscopy has been accomplished by retrofitting optical elements (objectives, filters, light emitting diodes, lasers, lenses, mirrors) and 3D-printed parts to smartphones cameras \\[[@pone.0215114.ref003],[@pone.0215114.ref005],[@pone.0215114.ref011]--[@pone.0215114.ref013]\\]. ", "However, smartphones, although extremely powerful and unique, are difficult to reconfigure and take apart \\[[@pone.0215114.ref014]\\]; in addition, they evolve at a rapid pace, and constant software updates on their operating systems may disrupt their performance, making them obsolete \\[[@pone.0215114.ref015]\\]. ", "Also, their size hampers further miniaturization and interferes in the integration with other add-ons or sensors, making them not ideal for long-term biological experimentation \\[[@pone.0215114.ref016]\\]. ", "A different approach has been to use regular cameras (webcams or digital cameras) placed in a framework made of plastic parts, metallic hardware, and 3D-printed parts \\[[@pone.0215114.ref005],[@pone.0215114.ref006],[@pone.0215114.ref016],[@pone.0215114.ref017]\\]; however, in some cases, the complexity of their designs encumbers downstream integration with other 3D printed parts. ", "More importantly, the number of pieces needed to put it together may be overwhelming for a newcomer or for technologists trying to develop affordable instrumentation in low-resource settings. ", "It also hampers its prompt adoption by scientists who are setting up a laboratory with limited resources and who need a multi-channel fluorescence microscope with basic functionalities and sufficient quality for most biological applications. ", "Microscopes based on single-board computers and 3D printed parts have been reported, such as the OpenFlexure \\[[@pone.0215114.ref018]\\], but they lack the capability of fluorescence imaging.", "\n\nTo solve some of these issues, we introduce a portable, low-cost multicolor fluorescence microscope the size of a cube with a side length of 7 cm. ", "Its operation and framework are inspired in the mechanism of a nut and a bolt. ", "The microscope is assembled from only six 3D-printed parts, 4 power light-emitting diodes (LEDs), an eight-megapixel (MP) complementary metal--oxide--semiconductor (CMOS) camera, a metallic rod, and a Printed Circuit Board (PCB) with basic electronics. ", "Aside from the Foldscope \\[[@pone.0215114.ref019]\\], which does not contain any camera sensor, our fluorescence microscope is assembled using the least amount of mechanical pieces (see **[S2 Table](#pone.0215114.s002){ref-type=\"supplementary-material\"}** for a comparison with other different miniature microscopes). ", "After pieces are 3D-printed and a PCB manufactured, the microscope can be assembled in 10 min (see **[S1 Video](#pone.0215114.s003){ref-type=\"supplementary-material\"}**) with the capability to acquire images in bright-field and in three fluorescence channels. ", "We present instructions for its assembly, characterization of its illumination homogeneity in each of the fluorescence channels, and demonstrate its operation in a cellular biological assay where it is possible to track single cells captured in microwells.", "\n\nMaterials and methods {#sec002}\n=====================\n\n3D-printed chassis {#sec003}\n------------------\n\nMicroscope parts were designed in Inventor (ver 2017, Autodesk) and fabricated in a 3D printer (Makerbot Replicator 2); see **[S1 Fig](#pone.0215114.s007){ref-type=\"supplementary-material\"}**. ", "Dimensions of the microscope tube are shown in **[S2 Fig](#pone.0215114.s008){ref-type=\"supplementary-material\"}**. ", "The parts are made of black polylactic acid (PLA) and printed with the following settings: speed in X and Y axis of 40 mm/s, temperature of 230°C, layer thickness of 200 μm, and infill of 20%. ", "Once fabricated, pieces were manually assembled; see **[S1 Video](#pone.0215114.s003){ref-type=\"supplementary-material\"}** for a step-by-step assembly.", "\n\nElectronics and optical components {#sec004}\n----------------------------------\n\nThe optical system relies on the Raspberry Pi Camera Module V2 that comes with an 8-MegaPixel CMOS image sensor camera and a plastic lens. ", "This lens comes with the camera and no further specifications are provided on it; however, US Patent 7,564,635 B1 provides the description of a lens that has the same focal length (3.04 mm) that is provided in the specification of this camera module. ", "High brightness LEDs (white, UV, green and blue) were used to illuminate the sample. ", "Plastic color filters (Roscolux) or single-band pass optical filters (Zeiss) were used as emission filters and placed between the image sensor and the lens. ", "A custom printed circuit board (PCB) containing the electronic components to control the LEDs were placed below the camera. ", "The schematic and the list of components can be found in **[S3 Fig](#pone.0215114.s009){ref-type=\"supplementary-material\"}** and **[S1 Table](#pone.0215114.s001){ref-type=\"supplementary-material\"}**, respectively.", "\n\nGraphical user interface (GUI) {#sec005}\n------------------------------\n\nA single-board microcomputer (Raspberry Pi 3 Model B) was used to program and control a graphical interface using Python 2.7 and OpenCV. ", "The GUI allowed to acquire images and control the LEDs and different image parameters, such as the exposure time, brightness and contrast (**[S4 Fig](#pone.0215114.s010){ref-type=\"supplementary-material\"}**).", "\n\nCell assays {#sec006}\n-----------\n\nTo compare image quality acquired with our microscope and a conventional microscope, human monocytic (THP-1, kindly donated by Dr. Vianney Ortiz) cells were permeabilized with Tween-20 (P1379, Sigma Aldrich) 0.05% in Phosphate-Buffered Saline (PBS) 1X for 15 min, centrifuged at 1,200 rpm for 5 min, and washed with PBS 1X. Next, cells were incubated for 20 min either with 4′,6-diamidino-2-phenylindole (DAPI, 2.9 μM, 62247, Thermo Fisher Scientific) or Calcein-AM (20 μM, C1359, Sigma Aldrich), or for 10 min with Ethidium Homodimer (16 μM, EthD-1, E1903 Sigma Aldrich). ", "The cells were washed again with PBS 1X and centrifuged at 1,200 rpm for 5 min. ", "Then, 20 μL of the cellular suspensions were spread over three different clean coverslips and allowed to dry. ", "Finally, 10 μL of glycerol were added and a second coverslip was placed on the top of the samples. ", "For Calcein-AM staining, cells were not permeabilized, and PBS 1X was used instead of glycerol. ", "Finally, coverslips were sealed with enamel.", "\n\nNeutrophil assay {#sec007}\n----------------\n\nPurified neutrophils were donated by Dr. Alejandro Sánchez González (Blood donor informed consent and protocol was approved by the Research Ethics Committee of the Medicine Faculty and University Hospital of the Autonomous University of Nuevo León, Mexico, registered with the number MB19-00003). ", "Briefly, human peripheral-blood neutrophils were purified from human blood by a non-continuous Percoll density gradient. ", "After purification, neutrophils nuclei were stained with Hoechst 33342 (H3570, Thermo Fisher Scientific) at 16.2 μM for 5 min. ", "Neutrophils were stimulated with either HBSS buffer 1X (control) or with *E*. *", "coli* lipopolysaccharide (LPS at 100 μg/mL, L2755, Sigma Aldrich). ", "Both solutions contained Sytox Orange (S11368, Thermo Fisher Scientific) at 5 μM for nucleic acid staining. ", "Devices made of polydimethylsiloxane (PDMS) were fabricated by soft-lithography and consisted of microwells (20 μm diameter, 20 μm height). ", "Cells were placed in three devices, one of them was placed on the stage of the miniature microscope with the stimulus solution and the other two on an inverted fluorescence microscope (Axio Observer, Zeiss). ", "20 μL of the cell suspension was added to the three devices. ", "After 5 min, 20 μL of the stimulus were added to two devices, one in our microscope and the other in the Zeiss microscope. ", "20 μL of HBSS buffer was added to the other device sitting on the Zeiss microscope, which served as a negative control. ", "Next, images in bright-field and red and blue fluorescence channels were acquired every 10 min in both microscopes. ", "Images were analyzed using an image processing software (Fiji) where fluorescence intensity was measured over time for all individual microwells.", "\n\nCell tracking in a microfluidic device {#sec008}\n--------------------------------------\n\nA single-channel microfluidic device was designed in AutoCAD (Student version, Autodesk) and fabricated by soft-lithography \\[[@pone.0215114.ref020]\\]. ", "The device consists of an inlet, an outlet, and a long serpentine channel with a height and width of 20 and 40 μm, respectively. ", "The device was placed on the miniature microscope stage and a THP-1 cell suspension stained with Calcein-AM was flowed into the channel using a 1 mL syringe. ", "The center of the device was focused, and a video was recorded in bright-field and in the green fluorescence channel while the cells were flowing through the serpentine channel.", "\n\nTHP-1 culture and time lapse microscopy {#sec009}\n---------------------------------------\n\nTHP-1 cells (kindly donated by Dr. Vianney Ortiz), were incubated using supplemented RPMI-1640 medium (11875093, Thermo Fisher Scientific) inside a T25 flask before experimentation. ", "A 1 mL chamber was fabricated using a PDMS slab, plasma bonded to a cover slide and exposed to ultraviolet (UV) light for 3 hours. ", "900 μL of fresh media was added to the chamber followed by 100 μL of THP-1 cell suspension at 100 x 10^5^ cell/mL. Another block of PDMS was used to seal the chamber from the top. ", "The cell chamber was placed on the miniature microscope stage and the whole microscope inside a cell culture incubator at 37°C with 5% CO~2~. The bottom of the chamber was manually focused, and the miniature microscope was set in time-lapse mode on the GUI. ", "Next, all cables were disconnected, except for the power cord. ", "During the first \\~24 hours, bright-field images were acquired every 15 min. ", "For the last \\~2 hours, images acquisition was set to every minute.", "\n\nResults and discussion {#sec010}\n======================\n\nMicroscope design {#sec011}\n-----------------\n\nOur goal was to engineer a miniature multicolor fluorescence microscope of simple design that could be quickly assembled with the least possible number of pieces (see **[S2 Table](#pone.0215114.s002){ref-type=\"supplementary-material\"}**). ", "It also had to offer sufficient accuracy to focus on microscopic objects while being mechanically stable and indifferent to vibrations; but also had to be assembled using 3D printed parts to make it affordable and deployable in low-resources settings. ", "Importantly, our objective was not to develop a fluorescence microscope that offered the same illumination and image quality as commercial microscopes, but rather an easily assembled microscope and affordable for low-budget laboratories. ", "It also had to offer good resolution and image quality for most biological applications, to enable quantitative biological measurements in bright-field and in fluorescence channels.", "\n\nThe microscope is inspired in the simple mechanism of a nut and bolt, **[Fig 1A](#pone.0215114.g001){ref-type=\"fig\"}**. ", "The bolt head serves as a base and as a casing to enclose the sensor camera, while the tip of the bolt holds the plastic lens, **[Fig 1B and 1C](#pone.0215114.g001){ref-type=\"fig\"}**. ", "The nut functions as a stage that fits on the threaded shank (1-mm threading; **[S2 Fig](#pone.0215114.s008){ref-type=\"supplementary-material\"}**), but also supports the samples mounted on glass slides and serves as a lid for fluorescence observations (**[Fig 1D](#pone.0215114.g001){ref-type=\"fig\"}**). ", "The microscope base (bolt) is fixed while the stage rotates to bring the object into focus. ", "It is important to realize that because the microscope is made of PLA, the threading on the nut and bolt can wear out over time (around 4 months) and thus decrease its ability to finely focus on microscopic objects. ", "Nevertheless, the fabrication simplicity of these pieces, enables its easily replacement with new 3D printed parts for less than \\$1. ", "One disadvantage of this arrangement is that the object under observation is rotated with the stage, yet once focused the object can be manually lifted from the stage and rotated to preserve the orientation.", "\n\n{#pone.0215114.g001}\n\nMost fluorescence microscope configurations use fluorescence detection cubes (exciter, dichroic, and emitter) incorporated into a filter wheel. ", "These detection cubes have excellent optical qualities, but the cost for single-fluorescence channel filter cube can exceed a few hundred US dollars (see **[S2 Table](#pone.0215114.s002){ref-type=\"supplementary-material\"}**), making them unsuitable for low-cost applications. ", "Because LEDs have a very narrow band spectrum (20--40 nm), it is possible to omit the detection cube and just keep the emission filters. ", "With these considerations, bright-field mode is enabled in our microscope using a white LED placed on the center top of the lid (**[Fig 1E](#pone.0215114.g001){ref-type=\"fig\"}**), while fluorescence observations are achieved using 3 high-power color LEDs (UV: 385 nm, Blue: 475 nm, and Green:535 nm) that illuminate the sample from the sides (**[Fig 1F](#pone.0215114.g001){ref-type=\"fig\"}**). ", "Three plastic emission filters are placed on a hollowed-out tray that slides on the shank of the microscope, keeping one of the hollows empty for bright-field observations. ", "However, it is possible to use regular microscope emission filters by modifying the dimensions of the tray and the shank. ", "In summary, the simplicity of our configuration contrasts with other microscopes that require several 3D-printed parts \\[[@pone.0215114.ref016],[@pone.0215114.ref017],[@pone.0215114.ref021]\\].", "\n\nMicroscope parts {#sec012}\n----------------\n\nThe microscope objective consists of a plastic lens detached from a commercial camera module and placed upside-down 25.4 mm above an 8 MP CMOS sensor (**[Fig 1E](#pone.0215114.g001){ref-type=\"fig\"}**), in a similar configuration to what others have reported \\[[@pone.0215114.ref016],[@pone.0215114.ref022],[@pone.0215114.ref023]\\]. ", "The sensor pixels contain three color pigment mosaic filters (Red, Green, Blue) that serve as extra emission filters by digitally extracting each channel from the raw image \\[[@pone.0215114.ref016]\\].", "\n\nOur microscope is assembled from six 3D-printed pieces (a lid, a stage, a shank, front and back casing, and a tray), a metallic rod, 4 high-power LEDs, a CMOS camera, a lens, and an electronic control unit that powers the LEDs from a single 9V power supply, see **[S1](#pone.0215114.s007){ref-type=\"supplementary-material\"}** and **[S3](#pone.0215114.s009){ref-type=\"supplementary-material\"} Figs**. ", "The 3D printed pieces are fabricated in 2.5 hours while the microscope is assembled under 10 min. ", "Instructions for the manual step-by-step assembly of the microscope are shown in **[S1 Video](#pone.0215114.s003){ref-type=\"supplementary-material\"}**. ", "Altogether, the size of the microscope is similar to a cube with a side length of \\~7 cm and weighing only 58 g. The total cost of the opto-electro-mechanical system is \\$85 USD, see **[S1 Table](#pone.0215114.s001){ref-type=\"supplementary-material\"}**. ", "In comparison, a low-entry commercial microscope with a single fluorescence module can cost up to \\~\\$1,900 and weight \\~9.5 kg \\[[@pone.0215114.ref004]\\]. ", "Because of its popularity and low-cost, we selected the microcomputer Raspberry Pi to control the microscope electronics and process the images. ", "An added benefit of the Raspberry Pi platform is the plethora of plug-in sensors and accessories \\[[@pone.0215114.ref014]\\], together with the continuous software and hardware upgrades, that in the future could improve the capabilities of our microscope and aid in the automation of biological and biochemical assays. ", "Adding the cost of the Raspberry Pi and the tablet, the total cost of our microscope increases to \\$202 USD.", "\n\nMicroscope operation {#sec013}\n--------------------\n\nTo operate the microscope, we created a graphical user interface (GUI) in Python 2.7 that allowed us to: (i) turn on and off the different color LEDs on demand, (ii) set the exposure time, (iii) capture still images, (iv) take videos or time-lapse images, and (v) save images in different formats, among other functions, **[S4 Fig](#pone.0215114.s010){ref-type=\"supplementary-material\"}**.", "\n\n**[Fig 2](#pone.0215114.g002){ref-type=\"fig\"}** shows the step-by-step operation of the microscope. ", "It involves placing the sample on the stage by opening the lid. ", "Next, the lid is closed to isolate the sample from external light sources. ", "For bright-field observations, the white LED is turned on from the GUI and the tray is shifted to position the empty hole on the optical path. ", "The stage is manually rotated clockwise or counterclockwise to focus the sample. ", "For fluorescence observations, one of the color LEDs is turned on while the filter tray is manually slid to match the corresponding emission filter. **[", "S2 Video](#pone.0215114.s004){ref-type=\"supplementary-material\"}** shows how easily the microscope is operated by a user.", "\n\n{#pone.0215114.g002}\n\nMicroscope resolution {#sec014}\n---------------------\n\nThe theoretical magnification of our microscope is obtained using the magnification formula \\[[@pone.0215114.ref024]\\], considering that the object is located 3.5 mm away from the center of the lens and that the image is formed at a distance of 25.4 mm underneath the lens (where the CMOS sensor is located), resulting in 7x, almost identical to the value we obtained experimentally of 7.048x. ", "It is important to highlight that adjusting the distance between the lens and the sensor leads to different magnifications. ", "Because there are no eyepieces in our digital microscope and the image is displayed onto a monitor (510 x 384 pixels), the final total display magnification for digital microscopy is 257.3x, which is obtained by dividing the number of pixels for the monitor image width by the number of pixels for the sensor image width, and multiplying it by the pixel ratio \\[[@pone.0215114.ref025]\\].", "\n\nThe field of view is \\~0.2 mm^2^ (525 μm x 394 μm). ", "According to the Rayleigh criteria, the theoretical optical resolution calculated at a wavelength of 550 nm is 0.448 μm. ", "The focal length and working distance of the lens are \\~3.05mm and \\~0.1 mm, respectively. ", "The lens has a numerical aperture of 0.45 and a depth of field of 1.46 μm. ", "To determine the optical resolution of our system, we measured the full width at half maximum (FWHM) of the point spread function (PSF) for forty 1-μm fluorescent beads (Firefli Fluorescent Blue) spread over the whole field of view. ", "The estimated FWHM of the 40 microbeads with our microscope is 1.187 μm, identical to the one obtained with a 20X objective using a Zeiss microscope, **[Fig 3A and 3B](#pone.0215114.g003){ref-type=\"fig\"}**. ", "We also imaged a 1951-USAF resolution target (R1DS1N, Thorlabs). ", "As seen in **[Fig 3C](#pone.0215114.g003){ref-type=\"fig\"},** our microscope can clearly solve two lines separated by 2.2 μm. ", "This is very similar to the calculated smallest resolvable line pair spacing of 2.05 μm, obtained by dividing the total display magnification (257.3x) by two times the monitor pixel size (0.264 mm) \\[[@pone.0215114.ref025]\\].", "\n\n{#pone.0215114.g003}\n\nA common issue with custom-made microscopes is the radial loss of resolution farther from the center \\[[@pone.0215114.ref022]\\]. ", "This is due to the alignment of the optical elements or the different pieces that comprise the microscope. ", "Using the same USAF target, we measured the Michelson contrast (C~M~, a measurement of contrast on gratings \\[[@pone.0215114.ref026]\\]), along the width of the field of view. ", "An element is determined to be resolvable if C~M~ ≥ 0.1 \\[[@pone.0215114.ref022]\\]. ", "As shown in **[Fig 3D](#pone.0215114.g003){ref-type=\"fig\"}**, the center of the image produces sharper contrasts for all the line sets, although there is a pronounced decreased of C~M~ values on the left side of the image, possibly due to the inclination of the sample stage of the microscope. ", "Nevertheless, all the line sets of the USAF target produce a C~M~ \\> 0.3, even for patterns as small as 2.2 μm, a sufficient resolution for most cell-based measurements \\[[@pone.0215114.ref006],[@pone.0215114.ref013],[@pone.0215114.ref016]\\] and for the detection of some parasites \\[[@pone.0215114.ref013]\\].", "\n\nMicroscope illumination {#sec015}\n-----------------------\n\nTo correct for uneven illumination intensity from light sources, fluorescence microscopes employ the Koehler illumination, a set of lenses positioned between the light source and the sample\\[[@pone.0215114.ref027]\\]. ", "The simplest illumination correction systems to project LED light make use of collimator lenses \\[[@pone.0215114.ref002]\\], light-pipes, or elliptical mirrors \\[[@pone.0215114.ref028]\\] to generate a parallel beam, or in some cases a diffusor \\[[@pone.0215114.ref017]\\] or coupling prisms \\[[@pone.0215114.ref002]\\] to guide the beam, thus improving evenness of illumination but not fully correcting it \\[[@pone.0215114.ref028]\\]. ", "Poor illumination translates into a poor contrast between the sample fluorescence and the background. ", "However, adding these optical elements adds complexity, cost, and space to any microscopy system.", "\n\nThus, we wondered whether direct illumination, where the light source (without any optical elements) is placed near the sample, could give us a uniform illumination. ", "This is a simpler and inefficient configuration as only a small percentage of the light produced by the LEDs reaches the sample \\[[@pone.0215114.ref028]\\], but because we used high-radiant power LEDs located very close to the sample, we hypothesized that this arrangement would still offer a workable illumination for most applications.", "\n\nBecause the color LEDs could not be placed on top of the sample, as it was already occupied by the white LED, the only positions left where the LEDs could be positioned were in the corners of the lid or at the cardinal points; we decided on the latter as it facilitated the mechanical design. ", "We investigated how uniform was the illumination by illuminating fluorescent solutions (Hoechst, Fluorescein, and Rhodamine) at angles of 0°, 22° and 45° with a 1 s exposure times and employing the plastic filters (we fabricated three different lids to perform this experiment). **[", "Fig 4](#pone.0215114.g004){ref-type=\"fig\"}** shows the heatmaps of the images captured by the CMOS color sensor at these different angles and considering only the digital channel closest to the emitted light. ", "Data from the contribution of the rest of the RGB components can be found in **[S5](#pone.0215114.s011){ref-type=\"supplementary-material\"}--[S7](#pone.0215114.s013){ref-type=\"supplementary-material\"} Figs**. ", "As it can be observed, vignetting is appreciable in most cases, but it is more manifested at a 0° angle. ", "However, as the angle increases to 22°, this vignetting is reduced, and almost eliminated for the red (R) channel and to a lesser extent on the green (G) channel, but is still significant for the blue (B) channel, noticing a reduced illumination on the left side of the heatmap, opposite to where the UV LED was placed. ", "Increasing the angle to 45° reduces this vignetting for the B channel compared to the other angles; however, for the R channel the left side is less illuminated than the right side, while the G channel shows a higher radial darkening than at 22°. ", "Emission detection on the other channels is highly attenuated but not completely blocked; this can be attributed to the poor optical quality of the plastic filters. ", "Others \\[[@pone.0215114.ref016]\\] have reported that employing the color filter array (CFA) of the CMOS sensor is sufficient to block the excitation light; we did not found this possible, perhaps because of the quality of the CFA of our sensor. ", "However, it is important to highlight that to improve image quality, color and dichroic glass filters can be fitted in our microscope. ", "In general, the most suitable arrangement to get the most even illumination in our microscope is for the UV LED to be located at an angle of 45°, and for both, the red and blue LEDs, placed at an angle of 22°. ", "Note that this characterization would have to be performed if different LEDs are used, as they come with different lenses and sizes. ", "In summary, a simple illumination configuration, in which the LEDs are placed in close proximity to the sample, can provide an illumination comparable to critical illumination \\[[@pone.0215114.ref028]\\].", "\n\n{#pone.0215114.g004}\n\nFluorescence images {#sec016}\n-------------------\n\nTo demonstrate the utility of our microscope to image single mammalian cells, we acquired bright-field and fluorescence images using plastic filters (\\<\\$1) and optical glass filters (\\>\\$100). **[", "Fig 5A](#pone.0215114.g005){ref-type=\"fig\"}** shows micrographs of THP-1 cells stained with EthD-1 (ex/em 528/617 nm), Calcein-AM (ex/em 496/516 nm) and DAPI (ex/em 360/460 nm) using plastic filters. ", "The intensity profile across the diameter of two cells for the three-fluorescence channels after subtracting background intensity is plotted in **[Fig 5B](#pone.0215114.g005){ref-type=\"fig\"}**. ", "As can be observed, plastic filters block fluorescence bleed-through from neighboring channels. ", "Also, there is no significant difference with commercial glass filters, **[S8 Fig](#pone.0215114.s014){ref-type=\"supplementary-material\"}**. ", "This experiment demonstrated that our fluorescence microscope produces sufficient image quality to detect and analyze single cells.", "\n\n{#pone.0215114.g005}\n\nSingle-cell assay {#sec017}\n-----------------\n\nTo demonstrate the utility of our microscope in quantitative biological experiments, we performed a fluorescence time-lapse experiment to track the production of neutrophil extracellular traps (NETs) from single cells \\[[@pone.0215114.ref029]\\]. ", "The nuclei of neutrophils isolated from peripheral blood were first stained with Hoechst, and then captured in a PDMS device containing an array of microwells (20 μm in diameter and depth). ", "Next, cells were incubated with both LPS (to stimulate the production of NETs) and Sytox Orange (a DNA impermeant stain).", "\n\nBright-field and fluorescence images (UV and Red) were acquired every 10 min for 2 h with our microscope (shown in **[Fig 6A](#pone.0215114.g006){ref-type=\"fig\"}**), and with a high-end inverted fluorescence microscope for comparison (not shown). ", "As can be appreciated, it is possible to distinguish single cells trapped in each well. ", "Analysis of individual wells captured with our microscope is shown in **[Fig 6B](#pone.0215114.g006){ref-type=\"fig\"}**, where each gray trace corresponds to the fluorescence intensity of one individual well and the thick colored curves indicates the average of \\~170 wells. ", "The results for Sytox Orange with both microscopes have similar trends: in both cases, most of the wells showed a gradual increase in fluorescence intensity after \\~15 min, reaching a peak at \\~50 min (an indication of loss of plasma membrane integrity and thus yielding an indirect measurement of NETs formation), subsequently slowly decreasing as the DNA diffused out of the wells. ", "In the case of Hoechst channel, the results of our microscope compare favorably to the Zeiss microscope, with both data showing a slight fluorescence intensity from the beginning of the assay---as all the cells nuclei were stained---increasing gradually to a maximum intensity at 50 min, to eventually decrease afterwards. ", "A negative control experiment, where cells were incubated with Hank's solution, showed no change in fluorescence intensity over time, **[S9 Fig](#pone.0215114.s015){ref-type=\"supplementary-material\"}**. ", "The slight difference in the data obtained with the Zeiss microscope---higher peaks and smother curves---was expected given the high quality of its optical system, while ours had a higher background noise. ", "Overall, it is possible to perform quantitative biological experiments in our microscope, enabling fluorescence time-lapse microscopy.", "\n\n{#pone.0215114.g006}\n\nCell tracking {#sec018}\n-------------\n\nAnother feature of our miniature microscope is the capability to record video in bright-field and fluorescence mode. ", "Using a single-channel microfluidic device with a width of 40 μm and a height of 20 μm, we injected THP-1 cells stained with Calcein-AM at a speed of \\~150 μm/s, and recorded a video while cells flowed through the channel (**[Fig 7A and 7B](#pone.0215114.g007){ref-type=\"fig\"}**). **[", "Fig 7C](#pone.0215114.g007){ref-type=\"fig\"}** shows a bright-field micrograph of a single cell flowing in the microfluidic channel, and **[Fig 7D](#pone.0215114.g007){ref-type=\"fig\"}** shows fluorescence micrographs of two cells acquired with a 100 ms exposure time. **[", "S3 Video](#pone.0215114.s005){ref-type=\"supplementary-material\"}** shows the facility to focus the optics onto the microfluidic channel and to start recording the cells flowing through the channel, demonstrating the capabilities of our fluorescence microscopy system to not only capture still images of objects sitting on a microscope slide.", "\n\n{#pone.0215114.g007}\n\nTime-lapse microscopy in a cell culture chamber {#sec019}\n-----------------------------------------------\n\nBecause of its size, one of the key features of our microscope is its portability, which enables to be used in different settings. ", "To demonstrate this, we used the microscope inside a cell culture incubator set at 37°C with 5% CO~2~, and monitored the culture of THP-1 cells over 26 hours. **[", "S10 Fig](#pone.0215114.s016){ref-type=\"supplementary-material\"}** shows a photograph of the miniature microscope placed inside the incubator and the PDMS chamber used for this experiment.", "\n\n**[Fig 8A](#pone.0215114.g008){ref-type=\"fig\"}** shows a series of bright-field micrographs captured every 15 min where cell migration and division can be appreciated. ", "These images clearly show that cell proliferation can be observed without any disturbance inside the miniature microscope, proving its mechanical robustness. ", "During the time lapse imaging, cells move around the field of view individually or even collectively, staying attached for a few hours after cell division. ", "A sequence of micrographs captured every minute of cells undergoing cell division is shown in **[Fig 8B](#pone.0215114.g008){ref-type=\"fig\"}** and **[S4 Video](#pone.0215114.s006){ref-type=\"supplementary-material\"}**. ", "It is evident that our microscope has enough resolution to observe: (i) the lamellipodia of cells extending and retracting, (ii) the migration of cells over time, and (iii) cells undergoing division.", "\n\n{#pone.0215114.g008}\n\nConclusions {#sec020}\n===========\n\nFluorescence microscopy is an important instrument in biomedical research. ", "Here, we have demonstrated that using 3D printed parts and basic electronic components it is possible to build a miniature 3-channel fluorescence microscope for under \\$100. ", "In our design, we favored simplicity over other metrics so that it could be assembled rapidly (10 min), although still able to produce sufficient image quality to analyze single cells. ", "We demonstrated that placing color LEDs at different angles from the sample produces a homogenous illumination. ", "We also showed that plastic filters minimized fluorescence bleed-through to the same level of optical glass filters. ", "To demonstrate its application in single cell assays, we monitored the production of NETs from single neutrophils, yielding similar data to a commercial microscope. ", "Our microscope is ideal for downstream applications using microfluidic devices, as demonstrated here, or in situations where space is a premium (e.g. inside a CO~2~ incubator), but we also foresee applications in diagnostics or telemedicine. ", "Because of its low-cost and size, several microscopes could be assembled to monitor several assays at once.", "\n\nSince LEDs have long-life spans (20,000--50,000 hours), our microscope is suitable for long-term experimentation which could enable acquisition of large amounts of data and translate into a better characterization of biological systems. ", "One of the limitations of our microscope is its narrow field of view and its fixed magnification. ", "Thus, an area of opportunity is to develop a motorized stage or use larger CMOS image sensors. ", "Another limitation is the possible wear-out of 3D printed parts; however, all the microscope parts could be fabricated using sturdier materials, such as aluminum or other thermoplastics, using a variety of fabrication techniques. ", "Albeit these limitations, our microscope performed a fluorescence time-lapse experiment of single cells yielding similar data to a conventional microscope.", "\n\nSupporting information {#sec021}\n======================\n\n###### Bill of materials used to build the microscope.", "\n\n(PDF)\n\n###### \n\nClick here for additional data file.", "\n\n###### Comparison of the number of pieces required to assembly different DIY microscopes.", "\n\n(PDF)\n\n###### \n\nClick here for additional data file.", "\n\n###### Web link to assembly of the microscope.", "\n\n<https://github.com/BioARTS-Lab/Miniature_Microscope/blob/master/Supporting%20Information/S1_Video.mpg>.", "\n\n(MPG)\n\n###### \n\nClick here for additional data file.", "\n\n###### Web link to operation of the microscope.", "\n\n<https://github.com/BioARTS-Lab/Miniature_Microscope/blob/master/Supporting%20Information/S2_Video.mpg>.", "\n\n(MPG)\n\n###### \n\nClick here for additional data file.", "\n\n###### Web link to tracking of cells flowing in a microfluidic channel.", "\n\n<https://github.com/BioARTS-Lab/Miniature_Microscope/blob/master/Supporting%20Information/S3_Video.mpg>.", "\n\n(MPG)\n\n###### \n\nClick here for additional data file.", "\n\n###### Web link to time lapse of THP-1 cells growing on a flat surface.", "\n\n<https://github.com/BioARTS-Lab/Miniature_Microscope/blob/master/Supporting%20Information/S4_Video.mpg>.", "\n\n(MPG)\n\n###### \n\nClick here for additional data file.", "\n\n###### Photograph of the 3D-printed pieces used to assemble the miniature microscope.", "\n\n(TIF)\n\n###### \n\nClick here for additional data file.", "\n\n###### Design of the microscope tube.", "\n\n(Left) Front view of the mechanical tube of the microscope. ", "Thread pitch is 1 mm. (", "Right) Cross-sectional view of the mechanical tube, showing the lens attached to the top of the tube. ", "All dimensions are in mm.", "\n\n(TIF)\n\n###### \n\nClick here for additional data file.", "\n\n###### Schematic and PCB layout of the electronic control unit.", "\n\n\\(a\\) Circuit design. (", "b) Printed circuit board layout.", "\n\n(TIF)\n\n###### \n\nClick here for additional data file.", "\n\n###### Graphic User Interface (GUI) to control the microscope.", "\n\nThe GUI was coded in Python by combining Tkinter, picamera and OpenCV libraries.", "\n\n(TIF)\n\n###### \n\nClick here for additional data file.", "\n\n###### Analysis of the illumination uniformity at an angle of 0° for all the channels.", "\n\nEach row corresponds to a different LED; the angle and the digital color channel analyzed are indicated on the top right corner. ", "R: Red, G: Green, B: Blue. ", "Fluorescence intensity has been normalized to a maximum value of 1.", "\n\n(TIF)\n\n###### \n\nClick here for additional data file.", "\n\n###### Analysis of the illumination uniformity at an angle of 22° for all the channels.", "\n\nEach row corresponds to a different LED; the angle and the digital color channel analyzed are indicated on the top right corner. ", "R: Red, G: Green, B: Blue. ", "Fluorescence intensity has been normalized to a maximum value of 1\n\n(TIF)\n\n###### \n\nClick here for additional data file.", "\n\n###### Analysis of the illumination uniformity at an angle of 45° for all the channels.", "\n\nEach row corresponds to a different LED; the angle and the digital color channel analyzed are indicated on the top right corner. ", "R: Red, G: Green, B: Blue. ", "Fluorescence intensity has been normalized to a maximum value of 1\n\n(TIF)\n\n###### \n\nClick here for additional data file.", "\n\n###### Comparison of images captured with both microscopes.", "\n\nBright-field and fluorescence micrographs captured with our microscope using plastic filters (left) or Zeiss filters (right). ", "THP-1 cells stained with different fluorochromes: EthD-1 (red), Calcein-AM (green) and DAPI (blue). ", "Images using all filters were acquired for each fluorochrome. ", "Graphs show intensity profile of two cells across all channels, showing that there is no fluorescence bleed-through between channels.", "\n\n(TIF)\n\n###### \n\nClick here for additional data file.", "\n\n###### Negative control experiments.", "\n\nTraces of fluorescence intensities from single wells for the negative control experiment shown in [Fig 6](#pone.0215114.g006){ref-type=\"fig\"}.", "\n\n(TIF)\n\n###### \n\nClick here for additional data file.", "\n\n###### Assay inside a cell culture incubator.", "\n\n\\(a\\) Photograph of the inside of a cell culture incubator showing the microscope and the microcomputer Raspberry. (", "b) Photograph of the cell culture chamber made of PDMS.", "\n\n(TIF)\n\n###### \n\nClick here for additional data file.", "\n\nWe would like to thank members of the Bio-ARTS Lab at Cinvestav-Monterrey for helpful discussions.", "\n\n[^1]: **Competing Interests:**The authors have declared that no competing interests exist.", "\n" ]

{ "pile_set_name": "PubMed Central" }

[ 0.012345679012345678, 0, 0.006060606060606061, 0, 0.012048192771084338, 0.008333333333333333, 0, 0.010638297872340425, 0.012269938650306749, 0.006389776357827476, 0.004878048780487805, 0.013089005235602094, 0, 0, 0.010526315789473684, 0, 0, 0.007905138339920948, 0.0031545741324921135, 0.0038461538461538464, 0, 0.010033444816053512, 0, 0, 0.006622516556291391, 0, 0, 0, 0, 0, 0.004694835680751174, 0.009433962264150943, 0.004807692307692308, 0.01639344262295082, 0, 0, 0, 0.010416666666666666, 0, 0.00872093023255814, 0, 0.023622047244094488, 0, 0.029850746268656716, 0.018518518518518517, 0.007142857142857143, 0, 0, 0, 0, 0, 0, 0.00823045267489712, 0, 0, 0, 0.01090909090909091, 0.007633587786259542, 0.005555555555555556, 0.007751937984496124, 0, 0, 0, 0, 0.003968253968253968, 0, 0, 0, 0, 0, 0, 0.004629629629629629, 0.007462686567164179, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.0025380710659898475, 0, 0, 0.015625, 0.010554089709762533, 0.005, 0.0024875621890547263, 0.01020408163265306, 0.006578947368421052, 0.003937007874015748, 0.00641025641025641, 0.006896551724137931, 0.0031446540880503146, 0, 0.0022522522522522522, 0, 0, 0, 0.006993006993006993, 0, 0, 0, 0, 0, 0, 0, 0.005235602094240838, 0, 0.002583979328165375, 0, 0, 0, 0, 0.004291845493562232, 0, 0, 0.008, 0.0044444444444444444, 0, 0, 0, 0, 0, 0, 0.020202020202020204, 0.004484304932735426, 0, 0.017142857142857144, 0.011904761904761904, 0, 0.016181229773462782, 0.007194244604316547, 0.01160092807424594, 0, 0, 0, 0.002976190476190476, 0, 0.0035460992907801418, 0.004784688995215311, 0, 0, 0, 0, 0, 0.00816326530612245, 0, 0, 0, 0.0049261083743842365, 0, 0, 0, 0, 0.005, 0.005154639175257732, 0, 0, 0, 0, 0, 0, 0, 0.0028328611898017, 0.005263157894736842, 0.01652892561983471, 0.004016064257028112, 0, 0.0072992700729927005, 0.0026041666666666665, 0.0030959752321981426, 0.0049261083743842365, 0, 0, 0, 0, 0, 0, 0, 0.003968253968253968, 0.0035211267605633804, 0, 0, 0, 0, 0, 0.009259259259259259, 0, 0, 0.006172839506172839, 0.0106951871657754, 0.0058823529411764705, 0, 0, 0.0045871559633027525, 0, 0, 0, 0, 0.005747126436781609, 0, 0, 0, 0, 0.004132231404958678, 0.009345794392523364, 0, 0, 0.010526315789473684, 0, 0, 0, 0.018518518518518517, 0.01098901098901099, 0.018518518518518517, 0, 0.009433962264150943, 0.018518518518518517, 0, 0.009433962264150943, 0.018518518518518517, 0, 0.009433962264150943, 0.018518518518518517, 0, 0.009433962264150943, 0.018518518518518517, 0, 0.018518518518518517, 0, 0, 0, 0, 0, 0.018518518518518517, 0, 0, 0, 0.018518518518518517, 0.03125, 0.024390243902439025, 0.018518518518518517, 0, 0, 0, 0, 0.018518518518518517, 0, 0, 0, 0.008333333333333333, 0, 0, 0, 0.008333333333333333, 0.01639344262295082, 0.0078125, 0, 0, 0, 0.018518518518518517, 0, 0.006944444444444444, 0.018518518518518517, 0, 0.00847457627118644, 0.01818181818181818, 0.018518518518518517, 0.02, 0, 0 ]

[ { "analysis_explanation": null, "end": 38711, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.95, "start": 38610 }, { "analysis_explanation": null, "end": 38917, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.95, "start": 38816 }, { "analysis_explanation": null, "end": 4009, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4000 }, { "analysis_explanation": null, "end": 4206, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4176 }, { "analysis_explanation": null, "end": 4395, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4389 }, { "analysis_explanation": null, "end": 4965, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4957 }, { "analysis_explanation": null, "end": 4975, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4967 }, { "analysis_explanation": null, "end": 5890, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5888 }, { "analysis_explanation": null, "end": 7226, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7213 }, { "analysis_explanation": null, "end": 7344, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7338 }, { "analysis_explanation": null, "end": 7380, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7375 }, { "analysis_explanation": null, "end": 7443, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7437 }, { "analysis_explanation": null, "end": 7592, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7586 }, { "analysis_explanation": null, "end": 7616, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7598 }, { "analysis_explanation": null, "end": 7733, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7728 }, { "analysis_explanation": null, "end": 8188, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8171 }, { "analysis_explanation": null, "end": 8197, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8189 }, { "analysis_explanation": null, "end": 8385, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8379 }, { "analysis_explanation": null, "end": 8529, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8522 }, { "analysis_explanation": null, "end": 8673, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8668 }, { "analysis_explanation": null, "end": 9350, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9345 }, { "analysis_explanation": null, "end": 9676, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9670 }, { "analysis_explanation": null, "end": 9759, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9755 }, { "analysis_explanation": null, "end": 10689, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10676 }, { "analysis_explanation": null, "end": 10952, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10945 }, { "analysis_explanation": null, "end": 11482, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11462 }, { "analysis_explanation": null, "end": 11530, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11524 }, { "analysis_explanation": null, "end": 11554, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11536 }, { "analysis_explanation": null, "end": 11598, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11586 }, { "analysis_explanation": null, "end": 11907, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11877 }, { "analysis_explanation": null, "end": 13459, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13444 }, { "analysis_explanation": null, "end": 14430, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14424 }, { "analysis_explanation": null, "end": 14846, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14816 }, { "analysis_explanation": null, "end": 14985, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14979 }, { "analysis_explanation": null, "end": 16978, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16969 }, { "analysis_explanation": null, "end": 17025, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17019 }, { "analysis_explanation": null, "end": 20976, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20971 }, { "analysis_explanation": null, "end": 21750, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21746 }, { "analysis_explanation": null, "end": 22425, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 22421 }, { "analysis_explanation": null, "end": 22599, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 22590 }, { "analysis_explanation": null, "end": 22688, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 22684 }, { "analysis_explanation": null, "end": 23067, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 23058 }, { "analysis_explanation": null, "end": 24044, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 24037 }, { "analysis_explanation": null, "end": 24274, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 24249 }, { "analysis_explanation": null, "end": 24467, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 24442 }, { "analysis_explanation": null, "end": 25703, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 25694 }, { "analysis_explanation": null, "end": 30483, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 30471 }, { "analysis_explanation": null, "end": 30586, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 30574 }, { "analysis_explanation": null, "end": 30594, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 30591 }, { "analysis_explanation": null, "end": 31147, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 31135 }, { "analysis_explanation": null, "end": 31789, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 31783 }, { "analysis_explanation": null, "end": 34811, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 34803 }, { "analysis_explanation": null, "end": 35118, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 35112 }, { "analysis_explanation": null, "end": 35465, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 35454 }, { "analysis_explanation": null, "end": 35534, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 35522 }, { "analysis_explanation": null, "end": 35690, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 35637 }, { "analysis_explanation": null, "end": 36064, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 36058 }, { "analysis_explanation": null, "end": 36129, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 36117 }, { "analysis_explanation": null, "end": 36507, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 36502 }, { "analysis_explanation": null, "end": 36610, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 36604 }, { "analysis_explanation": null, "end": 39820, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 39818 }, { "analysis_explanation": null, "end": 42158, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 42154 }, { "analysis_explanation": null, "end": 371, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.75, "start": 364 }, { "analysis_explanation": null, "end": 1899, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.75, "start": 1892 }, { "analysis_explanation": null, "end": 1922, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.75, "start": 1915 }, { "analysis_explanation": null, "end": 1945, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.75, "start": 1938 }, { "analysis_explanation": null, "end": 1969, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.75, "start": 1962 }, { "analysis_explanation": null, "end": 11897, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.75, "start": 11890 }, { "analysis_explanation": null, "end": 23752, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.75, "start": 23745 }, { "analysis_explanation": null, "end": 23775, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.75, "start": 23768 }, { "analysis_explanation": null, "end": 23798, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.75, "start": 23791 }, { "analysis_explanation": null, "end": 30186, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.75, "start": 30179 }, { "analysis_explanation": null, "end": 33257, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.75, "start": 33250 }, { "analysis_explanation": null, "end": 33448, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.75, "start": 33441 }, { "analysis_explanation": null, "end": 34388, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.75, "start": 34381 }, { "analysis_explanation": null, "end": 34408, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.75, "start": 34401 }, { "analysis_explanation": null, "end": 34839, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.75, "start": 34832 }, { "analysis_explanation": null, "end": 35605, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.75, "start": 35598 }, { "analysis_explanation": null, "end": 36197, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.75, "start": 36190 }, { "analysis_explanation": null, "end": 36217, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.75, "start": 36210 }, { "analysis_explanation": null, "end": 5052, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.6499999999999999, "start": 5050 }, { "analysis_explanation": null, "end": 39147, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 39046 }, { "analysis_explanation": null, "end": 39377, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 39276 }, { "analysis_explanation": null, "end": 374, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 359 }, { "analysis_explanation": null, "end": 736, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 721 }, { "analysis_explanation": null, "end": 952, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 937 }, { "analysis_explanation": null, "end": 976, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 961 }, { "analysis_explanation": null, "end": 1442, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 1427 }, { "analysis_explanation": null, "end": 1502, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 1487 }, { "analysis_explanation": null, "end": 1625, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 1610 }, { "analysis_explanation": null, "end": 1648, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 1633 }, { "analysis_explanation": null, "end": 1902, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 1887 }, { "analysis_explanation": null, "end": 1925, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 1910 }, { "analysis_explanation": null, "end": 1948, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 1933 }, { "analysis_explanation": null, "end": 1972, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 1957 }, { "analysis_explanation": null, "end": 2106, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 2091 }, { "analysis_explanation": null, "end": 2285, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 2270 }, { "analysis_explanation": null, "end": 2490, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 2475 }, { "analysis_explanation": null, "end": 2685, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 2670 }, { "analysis_explanation": null, "end": 2708, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 2693 }, { "analysis_explanation": null, "end": 2731, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 2716 }, { "analysis_explanation": null, "end": 2754, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 2739 }, { "analysis_explanation": null, "end": 3443, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 3428 }, { "analysis_explanation": null, "end": 4029, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 4014 }, { "analysis_explanation": null, "end": 10076, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 10061 }, { "analysis_explanation": null, "end": 15896, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 15881 }, { "analysis_explanation": null, "end": 15919, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 15904 }, { "analysis_explanation": null, "end": 15942, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 15927 }, { "analysis_explanation": null, "end": 16273, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 16258 }, { "analysis_explanation": null, "end": 16296, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 16281 }, { "analysis_explanation": null, "end": 16319, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 16304 }, { "analysis_explanation": null, "end": 16520, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 16505 }, { "analysis_explanation": null, "end": 17580, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 17565 }, { "analysis_explanation": null, "end": 17850, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 17835 }, { "analysis_explanation": null, "end": 20155, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 20140 }, { "analysis_explanation": null, "end": 20941, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 20926 }, { "analysis_explanation": null, "end": 22136, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 22121 }, { "analysis_explanation": null, "end": 22898, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 22883 }, { "analysis_explanation": null, "end": 23141, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 23126 }, { "analysis_explanation": null, "end": 23264, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 23249 }, { "analysis_explanation": null, "end": 23755, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 23740 }, { "analysis_explanation": null, "end": 23778, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 23763 }, { "analysis_explanation": null, "end": 23801, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 23786 }, { "analysis_explanation": null, "end": 23868, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 23853 }, { "analysis_explanation": null, "end": 24144, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 24129 }, { "analysis_explanation": null, "end": 24268, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 24253 }, { "analysis_explanation": null, "end": 24331, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 24316 }, { "analysis_explanation": null, "end": 24415, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 24400 }, { "analysis_explanation": null, "end": 24461, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 24446 }, { "analysis_explanation": null, "end": 24575, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 24560 }, { "analysis_explanation": null, "end": 25097, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 25082 }, { "analysis_explanation": null, "end": 27143, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 27128 }, { "analysis_explanation": null, "end": 28035, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 28020 }, { "analysis_explanation": null, "end": 30189, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 30174 }, { "analysis_explanation": null, "end": 733, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 726 }, { "analysis_explanation": null, "end": 949, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 942 }, { "analysis_explanation": null, "end": 973, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 966 }, { "analysis_explanation": null, "end": 1439, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 1432 }, { "analysis_explanation": null, "end": 1499, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 1492 }, { "analysis_explanation": null, "end": 1622, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 1615 }, { "analysis_explanation": null, "end": 1645, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 1638 }, { "analysis_explanation": null, "end": 2103, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 2096 }, { "analysis_explanation": null, "end": 2282, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 2275 }, { "analysis_explanation": null, "end": 2487, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 2480 }, { "analysis_explanation": null, "end": 2682, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.4, "start": 2675 }, { "analysis_explanation": null, "end": 2682, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 2675 }, { "analysis_explanation": null, "end": 2705, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 2698 }, { "analysis_explanation": null, "end": 2705, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.4, "start": 2698 }, { "analysis_explanation": null, "end": 2728, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.4, "start": 2721 }, { "analysis_explanation": null, "end": 2728, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 2721 }, { "analysis_explanation": null, "end": 2751, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 2744 }, { "analysis_explanation": null, "end": 2751, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.4, "start": 2744 }, { "analysis_explanation": null, "end": 3440, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 3433 }, { "analysis_explanation": null, "end": 4026, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 4019 }, { "analysis_explanation": null, "end": 4196, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 4189 }, { "analysis_explanation": null, "end": 4427, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 4420 }, { "analysis_explanation": null, "end": 5071, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 5064 }, { "analysis_explanation": null, "end": 5071, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.4, "start": 5064 }, { "analysis_explanation": null, "end": 5187, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 5180 }, { "analysis_explanation": null, "end": 5504, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 5497 }, { "analysis_explanation": null, "end": 6495, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 6488 }, { "analysis_explanation": null, "end": 6569, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 6562 }, { "analysis_explanation": null, "end": 7001, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 6994 }, { "analysis_explanation": null, "end": 10073, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 10066 }, { "analysis_explanation": null, "end": 10735, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 10731 }, { "analysis_explanation": null, "end": 12709, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 12702 }, { "analysis_explanation": null, "end": 12893, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 12886 }, { "analysis_explanation": null, "end": 13021, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 13014 }, { "analysis_explanation": null, "end": 13196, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 13189 }, { "analysis_explanation": null, "end": 14484, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 14477 }, { "analysis_explanation": null, "end": 14504, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 14497 }, { "analysis_explanation": null, "end": 14836, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 14829 }, { "analysis_explanation": null, "end": 15222, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 15215 }, { "analysis_explanation": null, "end": 15436, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 15429 }, { "analysis_explanation": null, "end": 15893, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 15886 }, { "analysis_explanation": null, "end": 15916, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 15909 }, { "analysis_explanation": null, "end": 15939, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 15932 }, { "analysis_explanation": null, "end": 16171, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 16164 }, { "analysis_explanation": null, "end": 16270, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 16263 }, { "analysis_explanation": null, "end": 16293, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 16286 }, { "analysis_explanation": null, "end": 16316, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 16309 }, { "analysis_explanation": null, "end": 16517, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 16510 }, { "analysis_explanation": null, "end": 16811, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 16804 }, { "analysis_explanation": null, "end": 16879, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 16872 }, { "analysis_explanation": null, "end": 17134, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 17127 }, { "analysis_explanation": null, "end": 17388, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 17381 }, { "analysis_explanation": null, "end": 17577, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 17570 }, { "analysis_explanation": null, "end": 17847, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 17840 }, { "analysis_explanation": null, "end": 18559, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 18552 }, { "analysis_explanation": null, "end": 18627, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 18620 }, { "analysis_explanation": null, "end": 19243, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 19236 }, { "analysis_explanation": null, "end": 19961, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 19954 }, { "analysis_explanation": null, "end": 19981, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 19974 }, { "analysis_explanation": null, "end": 20152, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 20145 }, { "analysis_explanation": null, "end": 20938, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 20931 }, { "analysis_explanation": null, "end": 21703, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 21696 }, { "analysis_explanation": null, "end": 21829, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 21822 }, { "analysis_explanation": null, "end": 22133, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 22126 }, { "analysis_explanation": null, "end": 22750, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 22743 }, { "analysis_explanation": null, "end": 22770, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 22763 }, { "analysis_explanation": null, "end": 22895, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 22888 }, { "analysis_explanation": null, "end": 23138, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 23131 }, { "analysis_explanation": null, "end": 23261, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 23254 }, { "analysis_explanation": null, "end": 23309, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 23302 }, { "analysis_explanation": null, "end": 23865, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 23858 }, { "analysis_explanation": null, "end": 24141, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 24134 }, { "analysis_explanation": null, "end": 24265, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 24258 }, { "analysis_explanation": null, "end": 24328, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 24321 }, { "analysis_explanation": null, "end": 24412, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 24405 }, { "analysis_explanation": null, "end": 24458, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 24451 }, { "analysis_explanation": null, "end": 24572, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 24565 }, { "analysis_explanation": null, "end": 25094, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 25087 }, { "analysis_explanation": null, "end": 25883, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 25876 }, { "analysis_explanation": null, "end": 26169, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 26162 }, { "analysis_explanation": null, "end": 26230, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 26223 }, { "analysis_explanation": null, "end": 27140, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 27133 }, { "analysis_explanation": null, "end": 28032, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 28025 }, { "analysis_explanation": null, "end": 28385, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 28378 }, { "analysis_explanation": null, "end": 28405, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 28398 }, { "analysis_explanation": null, "end": 28683, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 28676 }, { "analysis_explanation": null, "end": 28834, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 28827 }, { "analysis_explanation": null, "end": 29030, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 29023 }, { "analysis_explanation": null, "end": 29248, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 29241 }, { "analysis_explanation": null, "end": 29877, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 29870 }, { "analysis_explanation": null, "end": 29897, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 29890 }, { "analysis_explanation": null, "end": 30649, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 30642 }, { "analysis_explanation": null, "end": 30939, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 30932 }, { "analysis_explanation": null, "end": 31984, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 31977 }, { "analysis_explanation": null, "end": 32819, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 32812 }, { "analysis_explanation": null, "end": 32839, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 32832 }, { "analysis_explanation": null, "end": 33309, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 33302 }, { "analysis_explanation": null, "end": 33582, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 33575 }, { "analysis_explanation": null, "end": 35029, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 35022 }, { "analysis_explanation": null, "end": 35660, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 35653 }, { "analysis_explanation": null, "end": 42031, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 42024 }, { "analysis_explanation": null, "end": 4175, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 4173 }, { "analysis_explanation": null, "end": 4406, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 4404 }, { "analysis_explanation": null, "end": 5168, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 5166 }, { "analysis_explanation": null, "end": 5483, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 5481 }, { "analysis_explanation": null, "end": 5720, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 5718 }, { "analysis_explanation": null, "end": 5910, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 5908 }, { "analysis_explanation": null, "end": 6476, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 6474 }, { "analysis_explanation": null, "end": 6548, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 6546 }, { "analysis_explanation": null, "end": 6982, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 6980 }, { "analysis_explanation": null, "end": 7273, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 7268 }, { "analysis_explanation": null, "end": 7561, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 7556 }, { "analysis_explanation": null, "end": 7638, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 7633 }, { "analysis_explanation": null, "end": 8625, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 8620 }, { "analysis_explanation": null, "end": 8804, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 8799 }, { "analysis_explanation": null, "end": 8867, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 8861 }, { "analysis_explanation": null, "end": 10792, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 10789 }, { "analysis_explanation": null, "end": 11876, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 11874 }, { "analysis_explanation": null, "end": 13002, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 13000 }, { "analysis_explanation": null, "end": 14815, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 14813 }, { "analysis_explanation": null, "end": 16796, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 16794 }, { "analysis_explanation": null, "end": 16864, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 16862 }, { "analysis_explanation": null, "end": 17113, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 17111 }, { "analysis_explanation": null, "end": 17367, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 17365 }, { "analysis_explanation": null, "end": 18540, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 18538 }, { "analysis_explanation": null, "end": 19222, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 19220 }, { "analysis_explanation": null, "end": 26154, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 26152 }, { "analysis_explanation": null, "end": 26215, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 26213 }, { "analysis_explanation": null, "end": 29229, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 29227 }, { "analysis_explanation": null, "end": 31965, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 31963 }, { "analysis_explanation": null, "end": 33561, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 33559 }, { "analysis_explanation": null, "end": 34820, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 34817 }, { "analysis_explanation": null, "end": 35639, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 35637 }, { "analysis_explanation": null, "end": 10752, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 10744 }, { "analysis_explanation": null, "end": 371, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 364 }, { "analysis_explanation": null, "end": 733, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 726 }, { "analysis_explanation": null, "end": 949, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 942 }, { "analysis_explanation": null, "end": 973, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 966 }, { "analysis_explanation": null, "end": 1439, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 1432 }, { "analysis_explanation": null, "end": 1499, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 1492 }, { "analysis_explanation": null, "end": 1622, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 1615 }, { "analysis_explanation": null, "end": 1645, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 1638 }, { "analysis_explanation": null, "end": 1899, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 1892 }, { "analysis_explanation": null, "end": 1922, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 1915 }, { "analysis_explanation": null, "end": 1945, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 1938 }, { "analysis_explanation": null, "end": 1969, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 1962 }, { "analysis_explanation": null, "end": 2103, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 2096 }, { "analysis_explanation": null, "end": 2282, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 2275 }, { "analysis_explanation": null, "end": 2487, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 2480 }, { "analysis_explanation": null, "end": 3440, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 3433 }, { "analysis_explanation": null, "end": 4026, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 4019 }, { "analysis_explanation": null, "end": 4196, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 4189 }, { "analysis_explanation": null, "end": 4427, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 4420 }, { "analysis_explanation": null, "end": 5187, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 5180 }, { "analysis_explanation": null, "end": 5504, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 5497 }, { "analysis_explanation": null, "end": 6495, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 6488 }, { "analysis_explanation": null, "end": 6569, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 6562 }, { "analysis_explanation": null, "end": 7001, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 6994 }, { "analysis_explanation": null, "end": 10073, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 10066 }, { "analysis_explanation": null, "end": 10752, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 10744 }, { "analysis_explanation": null, "end": 11897, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 11890 }, { "analysis_explanation": null, "end": 12709, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 12702 }, { "analysis_explanation": null, "end": 12893, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 12886 }, { "analysis_explanation": null, "end": 13021, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 13014 }, { "analysis_explanation": null, "end": 13196, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 13189 }, { "analysis_explanation": null, "end": 14484, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 14477 }, { "analysis_explanation": null, "end": 14504, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 14497 }, { "analysis_explanation": null, "end": 14836, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 14829 }, { "analysis_explanation": null, "end": 15222, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 15215 }, { "analysis_explanation": null, "end": 15436, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 15429 }, { "analysis_explanation": null, "end": 15893, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 15886 }, { "analysis_explanation": null, "end": 15916, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 15909 }, { "analysis_explanation": null, "end": 15939, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 15932 }, { "analysis_explanation": null, "end": 16171, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 16164 }, { "analysis_explanation": null, "end": 16270, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 16263 }, { "analysis_explanation": null, "end": 16293, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 16286 }, { "analysis_explanation": null, "end": 16316, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 16309 }, { "analysis_explanation": null, "end": 16517, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 16510 }, { "analysis_explanation": null, "end": 16811, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 16804 }, { "analysis_explanation": null, "end": 16879, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 16872 }, { "analysis_explanation": null, "end": 17134, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 17127 }, { "analysis_explanation": null, "end": 17388, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 17381 }, { "analysis_explanation": null, "end": 17577, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 17570 }, { "analysis_explanation": null, "end": 17847, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 17840 }, { "analysis_explanation": null, "end": 18559, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 18552 }, { "analysis_explanation": null, "end": 18627, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 18620 }, { "analysis_explanation": null, "end": 19243, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 19236 }, { "analysis_explanation": null, "end": 19961, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 19954 }, { "analysis_explanation": null, "end": 19981, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 19974 }, { "analysis_explanation": null, "end": 20152, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 20145 }, { "analysis_explanation": null, "end": 20938, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 20931 }, { "analysis_explanation": null, "end": 21703, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 21696 }, { "analysis_explanation": null, "end": 21829, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 21822 }, { "analysis_explanation": null, "end": 22133, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 22126 }, { "analysis_explanation": null, "end": 22750, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 22743 }, { "analysis_explanation": null, "end": 22770, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 22763 }, { "analysis_explanation": null, "end": 22895, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 22888 }, { "analysis_explanation": null, "end": 23138, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 23131 }, { "analysis_explanation": null, "end": 23261, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 23254 }, { "analysis_explanation": null, "end": 23309, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 23302 }, { "analysis_explanation": null, "end": 23752, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 23745 }, { "analysis_explanation": null, "end": 23775, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 23768 }, { "analysis_explanation": null, "end": 23798, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 23791 }, { "analysis_explanation": null, "end": 23865, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 23858 }, { "analysis_explanation": null, "end": 24141, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 24134 }, { "analysis_explanation": null, "end": 24265, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 24258 }, { "analysis_explanation": null, "end": 24328, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 24321 }, { "analysis_explanation": null, "end": 24412, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 24405 }, { "analysis_explanation": null, "end": 24458, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 24451 }, { "analysis_explanation": null, "end": 24572, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 24565 }, { "analysis_explanation": null, "end": 25094, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 25087 }, { "analysis_explanation": null, "end": 25883, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 25876 }, { "analysis_explanation": null, "end": 26169, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 26162 }, { "analysis_explanation": null, "end": 26230, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 26223 }, { "analysis_explanation": null, "end": 27140, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 27133 }, { "analysis_explanation": null, "end": 28032, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 28025 }, { "analysis_explanation": null, "end": 28385, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 28378 }, { "analysis_explanation": null, "end": 28405, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 28398 }, { "analysis_explanation": null, "end": 28683, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 28676 }, { "analysis_explanation": null, "end": 29030, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 29023 }, { "analysis_explanation": null, "end": 29248, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 29241 }, { "analysis_explanation": null, "end": 29877, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 29870 }, { "analysis_explanation": null, "end": 29897, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 29890 }, { "analysis_explanation": null, "end": 30186, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 30179 }, { "analysis_explanation": null, "end": 30649, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 30642 }, { "analysis_explanation": null, "end": 30939, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 30932 }, { "analysis_explanation": null, "end": 31984, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 31977 }, { "analysis_explanation": null, "end": 32819, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 32812 }, { "analysis_explanation": null, "end": 32839, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 32832 }, { "analysis_explanation": null, "end": 33257, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 33250 }, { "analysis_explanation": null, "end": 33309, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 33302 }, { "analysis_explanation": null, "end": 33448, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 33441 }, { "analysis_explanation": null, "end": 33582, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 33575 }, { "analysis_explanation": null, "end": 34388, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 34381 }, { "analysis_explanation": null, "end": 34408, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 34401 }, { "analysis_explanation": null, "end": 34839, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 34832 }, { "analysis_explanation": null, "end": 35029, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 35022 }, { "analysis_explanation": null, "end": 35605, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 35598 }, { "analysis_explanation": null, "end": 35660, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 35653 }, { "analysis_explanation": null, "end": 36197, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 36190 }, { "analysis_explanation": null, "end": 36217, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 36210 }, { "analysis_explanation": null, "end": 42031, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 42024 } ]

[ "\nShow HN: Play with Docker (with web-browser) - alexellisuk\nhttps://github.com/franela/play-with-docker\n======\nalexellisuk\nPlay With Docker gives you the experience of having a free Alpine Linux\nVirtual Machine in the cloud where you can build and run Docker containers and\neven create clusters with Docker features like Swarm Mode.", "\n\nUnder the hood DIND or Docker-in-Docker is used to give the effect of multiple\nVMs/PCs.", "\n\nA live version is available at: [http://play-with-docker.com/](http://play-\nwith-docker.com/)\n\n" ]

{ "pile_set_name": "HackerNews" }

[ 0.02108433734939759, 0, 0.010309278350515464 ]

[ { "analysis_explanation": null, "end": 25, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19 }, { "analysis_explanation": null, "end": 138, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 132 }, { "analysis_explanation": null, "end": 305, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 299 }, { "analysis_explanation": null, "end": 330, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 320 }, { "analysis_explanation": null, "end": 361, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 355 }, { "analysis_explanation": null, "end": 102, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 59 }, { "analysis_explanation": null, "end": 482, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 453 }, { "analysis_explanation": null, "end": 512, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 496 } ]

[ "// Copyright 2009 The Go Authors. ", "All rights reserved.", "\n// Use of this source code is governed by a BSD-style\n// license that can be found in the LICENSE file.", "\n\n// +build !", "gccgo\n\n#include \"textflag.h\"\n\n//\n// System calls for AMD64, Linux\n//\n\n// Just jump to package syscall's implementation for all these functions.", "\n// The runtime may know about them.", "\n\nTEXT\t·Syscall(SB),NOSPLIT,$0-56\n\tJMP\tsyscall·Syscall(SB)\n\nTEXT ·Syscall6(SB),NOSPLIT,$0-80\n\tJMP\tsyscall·Syscall6(SB)\n\nTEXT ·RawSyscall(SB),NOSPLIT,$0-56\n\tJMP\tsyscall·RawSyscall(SB)\n\nTEXT ·RawSyscall6(SB),NOSPLIT,$0-80\n\tJMP\tsyscall·RawSyscall6(SB)\n\nTEXT ·gettimeofday(SB),NOSPLIT,$0-16\n\tJMP\tsyscall·gettimeofday(SB)\n" ]

{ "pile_set_name": "Github" }

[ 0, 0, 0.019230769230769232, 0, 0, 0, 0.015772870662460567 ]

[ { "analysis_explanation": null, "end": 17, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13 }, { "analysis_explanation": null, "end": 239, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 231 } ]

[ "Sir,\n\nWe read with interest the recently published article titled, \"Dermatology life quality index does not reflect quality of life status of Indian vitiligo patients\" by Narahari *et al*.\\[[@ref1]\\] The authors found that in 54% of their patients, there was no effect or a small effect on quality of life as assessed by dermatology life quality index (DLQI). ", "This did not match their impression of how troubled their patients, as well as Indian patients in general, are due to vitiligo. ", "They concluded that DLQI was not a good measure of the psychosocial impact of vitiligo in Indian patients. ", "This inference would have been more robust if a formal comparison had been made between DLQI and patients' self-report of disease burden, as has been done by some workers.\\[[@ref2][@ref3]\\] Alternatively, another validated questionnaire could have been used for comparison.\\[[@ref4]\\] However, their broad point that a disease-specific instrument may be better than a generic one in assessing the impairment in quality of life is generally accepted.\\[[@ref5]\\] Vitiligo impact scale (VIS) and VIS-22 are vitiligo-specific quality of life instruments developed and validated for Indian patients.\\[[@ref3][@ref6]\\] We conducted a study that compared DLQI and VIS-22 in measuring the quality of life of Indian vitiligo patients and found that while DLQI scores correlated moderately well with the patient-perceived distress, VIS-22 scores showed a strong correlation.\\[[@ref3]\\] These results suggest that though DLQI may be an acceptable alternative, a vitiligo-specific instrument may estimate the psychosocial burden of disease more accurately. ", "Narahari *et al*.\\[[@ref1]\\] mention certain issues that troubled their patients and stress the need for a culture-specific questionnaire that addresses these and similar concerns. ", "In fact, many of these issues are covered in VIS-22, which was based on a qualitative study using semi-structured interviews of Indian vitiligo patients,\\[[@ref7]\\] supplemented by suggestions from experienced dermatologists and relevant items from other quality of life instruments. ", "The concerns mentioned by Narahari *et al*.\\[[@ref1]\\] and the corresponding item numbers in VIS-22 include fear of various objects and situations (items 12, 18), suicidal tendency (items 9, 14), marriage prospects (item 20), teasing students in odd names in schools (item 22), and questioning by others (items 3, 8). ", "It would be interesting to learn how useful they find VIS-22 in measuring quality of life in their vitiligo patients.", "\n\n {#sec2-1}\n\nFinancial support and sponsorship {#sec3-1}\n---------------------------------\n\nNil.", "\n\nConflicts of interest {#sec3-2}\n---------------------\n\nThere are no conflicts of interest.", "\n" ]

{ "pile_set_name": "PubMed Central" }

[ 0.008333333333333333, 0, 0.009345794392523364, 0.011483253588516746, 0.011049723756906077, 0.0035211267605633804, 0.006289308176100629, 0, 0.010309278350515464, 0, 0 ]

[ { "analysis_explanation": null, "end": 148, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 142 }, { "analysis_explanation": null, "end": 179, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 171 }, { "analysis_explanation": null, "end": 445, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 439 }, { "analysis_explanation": null, "end": 584, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 578 }, { "analysis_explanation": null, "end": 1094, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1088 }, { "analysis_explanation": null, "end": 1179, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1173 }, { "analysis_explanation": null, "end": 1258, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1252 }, { "analysis_explanation": null, "end": 1301, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1295 }, { "analysis_explanation": null, "end": 1423, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1417 }, { "analysis_explanation": null, "end": 1648, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1640 }, { "analysis_explanation": null, "end": 1872, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1866 }, { "analysis_explanation": null, "end": 1955, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1949 }, { "analysis_explanation": null, "end": 2139, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2131 }, { "analysis_explanation": null, "end": 2204, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2198 }, { "analysis_explanation": null, "end": 2298, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2296 }, { "analysis_explanation": null, "end": 2483, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2477 } ]

[ "This invention relates to a unique torsional vibration damper for a system which transfers torque from an engine to a transmission.", "\nTorque transmission systems are widely used in vehicle powertrains. ", "In a typical powertrain, an engine produces torque which is transmitted from an engine crankshaft to a transmission input shaft via the torque transmission system. ", "The transmission transmits torque to a drive shaft coupled to an axle differential, which transmits torque to the vehicle wheels. ", "Because the engine delivers the driving torque for the vehicle by means of various rotatable components, the engine is a source for vibration excitation on the vehicle.", "\nPiston engines have reciprocating pistons in a cylinder, which by definition involves a cyclic process. ", "Thus, the torque delivered by the engine is not constant in magnitude. ", "Instead, the torque consists of a series of pulses which correspond to individual cylinder strokes. ", "The amplitude of the pulses depends on how powerful the engine is and the frequency of the pulses fluctuates with engine speed. ", "As engines become more and more powerful, the fluctuation of engine output speed has increased significantly which in turn has increased the vibration excitation on the vehicle. ", "This is undesirable as it causes problems such as noise, gear rattling, and decreased component life.", "\nKnown torque transmission systems comprised of dual flywheels have been used to dampen engine vibrations. ", "These systems are typically located between the engine and the transmission and receive input torque from the engine crankshaft and transmit the torque to the transmission while damping out torsional vibrations. ", "Typically the torque transmission system includes a first flywheel connected to the crankshaft and a second flywheel connected to the transmission input shaft. ", "Each flywheel can move independently relative to the other. ", "Torsional vibration dampers are operably located between the first and second flywheels and resist relative angular movements between the first and second flywheels. ", "Various types of torsional vibration dampers are known in the art, including hydraulic dampers which utilize viscous fluid, elastic dampers such as springs, and frictional dampers. ", "Often a hydraulic damper is used in addition to an elastic damper to adequately reduce torsional vibrations at both high and low engine speeds.", "\nThe torsional vibration damper must have high stiffness and high damping at low engine speeds for reducing resonance vibrations, and low stiffness and low damping at high engine speeds so that vibrations can be reduced. ", "The overall goal is to reduce the transmissibility at practical engine speeds. ", "Transmissibility is defined as a measure of the ability of a system to either amplify or suppress an input vibration, equal to the ratio of the response amplitude of the system in steady-state forced vibration to the excitation amplitude; the ratio may be in forces, displacements, velocities, or accelerations. ", "To decrease the transmissibility at practical engine speeds, the resonance frequency must be designed to be within the range below practical engine speeds. ", "This placement of the resonance frequency in relation to engine speed is controlled by stiffness and inertia. ", "However, if the resonance frequency is below practical engine speeds then the frequency of the engine rotating speed will necessarily coincide with the resonance frequency at some point during the starting or stopping of the engine. ", "To avoid a resonance problem at these low engine speeds, the resonance peak or maximum amplitude must be reduced. ", "Damping by means of a torsional damper controls the amplitude of the resonance peak.", "\nCertain deficiencies exist with known torsional vibration dampers. ", "Usually more than one damper is required to accomplish the dual purpose of controlling resonance frequency and reducing the amplitude thereof at variable engine speeds. ", "Typically, elastic dampers such as coil springs are used to provide stiffness at low engine speeds while hydraulic dampers take effect at higher engine speeds. ", "Thus, more parts are required. ", "Packaging difficulty is increased as more dampers are used. ", "Therefore, there is a need for single torsional vibration damper of simple construction which can accomplish these dual purposes.", "\nAlso, there are additional deficiencies with prior art hydraulic dampers. ", "Most hydraulic dampers are comprised of various machined components which move in relation to each other. ", "When two machined surfaces contact each other for the purpose of preventing fluid flow, leakage can occur due to manufacturing inaccuracies. ", "Additionally, these hydraulic dampers have complex sealing systems to prevent fluid loss to other areas of the torque transmission system. ", "Thus, there is a need for a simple, self contained hydraulic damper which eliminates leakage resulting from manufacturing inaccuracies and which simplifies the sealing system used to prevent fluid loss to other areas of the torque transmission system." ]

{ "pile_set_name": "USPTO Backgrounds" }

[ 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.003205128205128205, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0 ]

[]

[ "Margaret Lally \"Ma\" Murray\n\nMargaret Lally \"Ma\" Murray, OC (1888 - September 25, 1982, age 94) was an American-Canadian newspaper editor, publisher, and columnist, an officer of the Order of Canada, and the wife of publisher and British Columbia MLA George Murray. ", " The Murray's publications were The Chinook in Vancouver, British Columbia, Canada, the Bridge River-Lillooet News in Lillooet and the Alaska Highway News in Fort St. John.", "\n\nA Kansas farm girl made good and known for her spicy wit, backcountry wisdom, and down-to-earth style, \"Ma\" was co-founder and editor (with her husband George) of the Bridge River-Lillooet News, the Alaska Highway News and other publications. ", " Her editorials were famously signed off with the catchphrase \"And that's fer damshur!\".", "\n\nKansas to Canada\nBorn Margaret Theresa Lally in Kansas City, Missouri to Irish immigrants, Margaret was raised on rural Kansas farmland in the United States, largely in poverty. ", "She came to Vancouver, British Columbia en route to Calgary, Alberta, where she hoped to find herself a cowboy to wed (she had worked in a saddle factory in Kansas City, and she and her sister, Bess, had corresponded with cowboys who had written in response to the notes they had tucked into the most expensive saddles being shipped north).", "\n\n\"Ye Ed\" and her publisher-husband\nIn Vancouver, she found work as a secretary and office manager for Orange-Canadian establishment scion and junior publisher George Murray and soon after married him, in spite of their religious differences (she was an ardent Catholic—and madly in love with George—her entire life). ", " She won continent-wide fame for some of her columns - either because she had a point, or because they were downright funny, and often coarse - or at least matter-of-fact. ", " The Murrays also launched various lesser known publications including Country Life In British Columbia, a popular magazine for rural women, and The Chinook, which was George's first venture upon his coming to BC from Ottawa, where he had worked as junior columnist for the Ottawa Citizen and apprenticed in politics under Sir Wilfrid Laurier.", "\n\nPolitics\nBoth had a high profile in provincial politics. ", " George, already a bright, articulate and somewhat visionary star in the BC Liberal Party, was a popular MLA from his arrival in Lillooet until his electoral demise in 1941. ", " Both Murrays had taken a strong stand in print in favour of the miners striking in the Bridge River, and alienated not only prime advertisers but also some of George's political backers; and by the time of the election most of the striking men had gone away to war; merchants without them as customers were also unwilling to support the Murrays. ", " George was squeezed out of office in 1945 in a narrow race with his old rival Ernest Crawford Carson, of the pioneer-stock Pavilion Carsons of the famous Diamond S. Faced with a disappeared revenue stream for their paper and George without a seat in the House - it was time to leave town, and the Murrays, always indefatigable, knew where they wanted to go, and off they went.", "\n\nNorth to the Alaska Highway\nBoth she and George were vocal proponents of the Alaska Highway and excitedly moved to the instant city of Fort St. John to chronicle its birth at the launching of construction on the mammoth project and launched their Alaska Highway News upon arrival. ", " The account of this experience in The Newspapering Murrays vividly documents the wild times and of that instant boomtown at its birth, and exposes much of the material waste that went into the U.S. military's building of the highway. ", " The Alaska Highway News was just as spicy as its Lillooet counterpart, and it is from that paper that a much-syndicated (even to The New York Times) advice about \"not flushing for no. ", "1, but save the flushing for no. ", "2\" comes from. ", "She was one of the locals interviewed in the National Film Board of Canada short \"People of the Peace\" (1958).", "\n\nMa's character\nDespite her country background and being uneducated—though widely read—Ma had astute business and management sense, if not exactly political acuity, and her penny-trimming skills dragged both company and family (and husband) through bad times. ", " Her sharp tongue was legendary but her office was known for having an open door to any who dropped by, and she was a relentless self-promoter and Lillooet-booster and a devoted newspaperwoman to the bitter end. ", " She was also not likely to back down from a verbal fight.", "\n\nGeorge in and out of Parliament\nIn 1949 George ran successfully for Member of Parliament for the Cariboo riding, which included Lillooet, but lost in 1953 when the candidate for the rising forces of Social Credit in B.C. edged out Murray, in part thanks to the third-party split from the CCF candidate. ", " Complicating the race was that Ma had decided to run for the legislature (in the same election, but for a different party - Social Credit, no less, and without telling him first, then switching to a fringe party, the \"Common Herd\" or People Party, in the riding of North Peace River). ", " She's already had a high profile political career as an editorialist, and was often a social embarrassment to her husband (who still loved her deeply nonetheless). ", " Ma withdrew from the race, but the damage was done. ", " George was shamed out of politics and, by now an outsider in revolt from the Liberal-Conservative Coalition and unwilling to join league with Bennett's Socreds, he gave up on his political career and retired from the House of Commons, returning to being publisher and grandfather only.", "\n\nGeorge died in 1961, but Ma survived him by 21 years, and continued to run and publish the paper after his death - and to raise eyebrows with her editorials, and laughter with her speeches and frank opinions. ", " Ma but spent her last days back at the editors' desk in historic Lillooet, British Columbia, churning out her raunchy wit and lusty language until the very last, continuing to write a column now and then even after her retirement as editor.", "\n\nMa Murray was survived by her daughter, Georgina. ", " A son, Dan, died of cancer in 1981. ", " Both children were working journalists, literally being fed the business with each meal while they were growing up, given the famously heated flavour of their parents' debates. ", " Dan and Georgina's offspring continue with the Murray's journalistic tradition.", "\n\nHouse in Anmore\nIn 1988 the village of Anmore, British Columbia donated George and \"Ma\" Murray's former home at the corner of Sunnyside and East Road, by the current owners, saving the historical structure from the wrecking ball. ", "The printing presses used to print The Chinook remain in the converted garage.", "\n\nSources\nLiterary and Archives Canada Website Ma Murray Profile\nNorth Peace Digital Community website biography\nMa Murray Community Newspaper Awards\nLillooet History Website\nBridge River-Lillooet Online Archive (historic and scenic images and commentaries)\n\nFurther reading\n\"The Rebel Queen of the Northwest.\", ", "Earle Beattie, Chatelaine Vol. ", "25, no. ", "5 (May 1952), P. 16-17, 78+.", "\n\"Ma Murray: The Salty Scourge of Lillooet.\", ", "Jackson House, Maclean's Vol. ", "79 (March 19, 1966), P. 18, 48, 50.", "\n Keddell, Georgina. -- ", "The Newspapering Murrays, 2016 eBook version of the 1974 edition by Lillooet Publishers. ", " Free iBook version available from iTunes here\n Keddell, Georgina. -- ", "The Newspapering Murrays—Halifax, N.S.: Goodread Biographies, 1984. -- ", "302 p.\n\"Ma Murray's Bridge River-Lillooet News.\", ", "in A History of Weekly Newspapers of British Columbia, Mission City? ", "B.C.: British Columbia Weekly Newspapers Association, 1972. ", "P. 60-61.", "\n\"Margaret \"Ma\" Murray: Spearing for the Truth.\", ", "Grant MacEwan, in Mighty Women: Stories of Western Canadian Pioneers, Vancouver: Greystone Books, 1995. -- ", "P. 253-260\n\"The Strength of the Weeklies\", J. Louis McKenna, Atlantic Advocate, Vol. ", "56, no. ", "12 (August 1966). ", "P. 18-23\n\"Murray, Margaret Teresa.\", ", "Jean O'Clery, Canadian Encyclopedia, Edmonton: Hurtig Publishers, 1988. ", "Vol. ", "3, p. 1407.", "\n\"Ma Murray : the story of Canada's crusty queen of publishing.\", ", "Stan Sauerwein, Canmore, AB : Altitude Pub. ", "Canada, c 2003. -- ", "135p.", "\n\nCategory:Canadian women journalists\nCategory:Officers of the Order of Canada\nCategory:American emigrants to Canada\nCategory:People from Kansas\nCategory:1908 births\nCategory:1982 deaths\nCategory:Journalists from British Columbia\nCategory:Lillooet Country\nCategory:Canadian people of American descent\nCategory:Spouses of Canadian politicians\nCategory:Canadian people of Irish descent\nCategory:American people of Irish descent\nCategory:Canadian newspaper founders\nCategory:People from Lillooet\nCategory:Women company founders\nCategory:Writers from Vancouver\nCategory:20th-century Canadian women writers\nCategory:Canadian women non-fiction writers" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.01509433962264151, 0.01744186046511628, 0.00816326530612245, 0, 0.011111111111111112, 0, 0.0031446540880503146, 0, 0.02040816326530612, 0, 0.005747126436781609, 0.002881844380403458, 0.013227513227513227, 0.007067137809187279, 0, 0.016216216216216217, 0, 0, 0.00909090909090909, 0, 0, 0, 0.019672131147540985, 0.01048951048951049, 0, 0, 0.01048951048951049, 0.004739336492890996, 0, 0.019230769230769232, 0.02702702702702703, 0, 0.025, 0.008620689655172414, 0, 0.009615384615384616, 0.06451612903225806, 0, 0, 0.021739130434782608, 0.03225806451612903, 0.02857142857142857, 0.04, 0.033707865168539325, 0.028169014084507043, 0.014084507042253521, 0, 0.014492753623188406, 0.016666666666666666, 0, 0, 0.028037383177570093, 0.023529411764705882, 0, 0, 0.05405405405405406, 0.041666666666666664, 0, 0, 0, 0.045454545454545456, 0, 0, 0.0031007751937984496 ]

[ { "analysis_explanation": null, "end": 8, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 0 }, { "analysis_explanation": null, "end": 58, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 44 }, { "analysis_explanation": null, "end": 86, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 60 }, { "analysis_explanation": null, "end": 93, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 87 }, { "analysis_explanation": null, "end": 110, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 102 }, { "analysis_explanation": null, "end": 245, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 229 }, { "analysis_explanation": null, "end": 263, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 250 }, { "analysis_explanation": null, "end": 320, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 311 }, { "analysis_explanation": null, "end": 338, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 322 }, { "analysis_explanation": null, "end": 346, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 340 }, { "analysis_explanation": null, "end": 390, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 382 }, { "analysis_explanation": null, "end": 445, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 439 }, { "analysis_explanation": null, "end": 595, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 589 }, { "analysis_explanation": null, "end": 774, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 768 }, { "analysis_explanation": null, "end": 784, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 778 }, { "analysis_explanation": null, "end": 806, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 790 }, { "analysis_explanation": null, "end": 827, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 816 }, { "analysis_explanation": null, "end": 837, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 829 }, { "analysis_explanation": null, "end": 846, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 841 }, { "analysis_explanation": null, "end": 867, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 859 }, { "analysis_explanation": null, "end": 894, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 888 }, { "analysis_explanation": null, "end": 924, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 907 }, { "analysis_explanation": null, "end": 967, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 958 }, { "analysis_explanation": null, "end": 985, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 969 }, { "analysis_explanation": null, "end": 1005, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 998 }, { "analysis_explanation": null, "end": 1014, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1007 }, { "analysis_explanation": null, "end": 1114, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1103 }, { "analysis_explanation": null, "end": 1144, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1140 }, { "analysis_explanation": null, "end": 1293, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1288 }, { "analysis_explanation": null, "end": 1333, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1324 }, { "analysis_explanation": null, "end": 1403, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1388 }, { "analysis_explanation": null, "end": 1458, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1445 }, { "analysis_explanation": null, "end": 1554, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1546 }, { "analysis_explanation": null, "end": 1584, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1578 }, { "analysis_explanation": null, "end": 1876, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1860 }, { "analysis_explanation": null, "end": 1947, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1941 }, { "analysis_explanation": null, "end": 1985, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1983 }, { "analysis_explanation": null, "end": 1997, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1991 }, { "analysis_explanation": null, "end": 2053, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2047 }, { "analysis_explanation": null, "end": 2115, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2100 }, { "analysis_explanation": null, "end": 2180, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2174 }, { "analysis_explanation": null, "end": 2310, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2302 }, { "analysis_explanation": null, "end": 2345, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2341 }, { "analysis_explanation": null, "end": 2446, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2430 }, { "analysis_explanation": null, "end": 2512, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2506 }, { "analysis_explanation": null, "end": 2699, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2693 }, { "analysis_explanation": null, "end": 2734, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2730 }, { "analysis_explanation": null, "end": 2793, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2771 }, { "analysis_explanation": null, "end": 2925, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2919 }, { "analysis_explanation": null, "end": 3118, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3112 }, { "analysis_explanation": null, "end": 3549, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3545 }, { "analysis_explanation": null, "end": 3926, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3922 }, { "analysis_explanation": null, "end": 3931, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3929 }, { "analysis_explanation": null, "end": 4017, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4015 }, { "analysis_explanation": null, "end": 4379, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4365 }, { "analysis_explanation": null, "end": 4463, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4457 }, { "analysis_explanation": null, "end": 4496, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4492 }, { "analysis_explanation": null, "end": 4503, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4497 }, { "analysis_explanation": null, "end": 4561, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4554 }, { "analysis_explanation": null, "end": 4611, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4607 }, { "analysis_explanation": null, "end": 4677, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4673 }, { "analysis_explanation": null, "end": 4793, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4791 }, { "analysis_explanation": null, "end": 5042, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5025 }, { "analysis_explanation": null, "end": 5211, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5209 }, { "analysis_explanation": null, "end": 5267, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5261 }, { "analysis_explanation": null, "end": 5553, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5547 }, { "analysis_explanation": null, "end": 5566, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5562 }, { "analysis_explanation": null, "end": 5574, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5572 }, { "analysis_explanation": null, "end": 5599, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5591 }, { "analysis_explanation": null, "end": 5758, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5756 }, { "analysis_explanation": null, "end": 5782, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5773 }, { "analysis_explanation": null, "end": 5829, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5821 }, { "analysis_explanation": null, "end": 5847, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5831 }, { "analysis_explanation": null, "end": 6006, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5997 }, { "analysis_explanation": null, "end": 6045, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6037 }, { "analysis_explanation": null, "end": 6057, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6054 }, { "analysis_explanation": null, "end": 6081, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6077 }, { "analysis_explanation": null, "end": 6263, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6260 }, { "analysis_explanation": null, "end": 6276, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6268 }, { "analysis_explanation": null, "end": 6355, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6349 }, { "analysis_explanation": null, "end": 6363, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6359 }, { "analysis_explanation": null, "end": 6385, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6379 }, { "analysis_explanation": null, "end": 6403, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6387 }, { "analysis_explanation": null, "end": 6418, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6412 }, { "analysis_explanation": null, "end": 6704, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6695 }, { "analysis_explanation": null, "end": 6973, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6960 }, { "analysis_explanation": null, "end": 6993, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6991 }, { "analysis_explanation": null, "end": 7010, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7002 }, { "analysis_explanation": null, "end": 7021, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7013 }, { "analysis_explanation": null, "end": 7038, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7029 }, { "analysis_explanation": null, "end": 7096, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7089 }, { "analysis_explanation": null, "end": 7122, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7108 }, { "analysis_explanation": null, "end": 7130, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7125 }, { "analysis_explanation": null, "end": 7134, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7132 }, { "analysis_explanation": null, "end": 7138, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7136 }, { "analysis_explanation": null, "end": 7157, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7149 }, { "analysis_explanation": null, "end": 7186, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7162 }, { "analysis_explanation": null, "end": 7192, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7188 }, { "analysis_explanation": null, "end": 7218, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7214 }, { "analysis_explanation": null, "end": 7316, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7308 }, { "analysis_explanation": null, "end": 7359, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7355 }, { "analysis_explanation": null, "end": 7381, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7361 }, { "analysis_explanation": null, "end": 7387, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7383 }, { "analysis_explanation": null, "end": 7509, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7497 }, { "analysis_explanation": null, "end": 7569, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7565 }, { "analysis_explanation": null, "end": 7579, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7571 }, { "analysis_explanation": null, "end": 7590, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7582 }, { "analysis_explanation": null, "end": 7643, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7630 }, { "analysis_explanation": null, "end": 7709, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7700 }, { "analysis_explanation": null, "end": 7732, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7728 }, { "analysis_explanation": null, "end": 7796, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7780 }, { "analysis_explanation": null, "end": 7824, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7822 }, { "analysis_explanation": null, "end": 7845, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7834 }, { "analysis_explanation": null, "end": 7856, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7848 }, { "analysis_explanation": null, "end": 7881, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7866 }, { "analysis_explanation": null, "end": 7897, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7885 }, { "analysis_explanation": null, "end": 7930, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7922 }, { "analysis_explanation": null, "end": 7955, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7951 }, { "analysis_explanation": null, "end": 7984, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7975 }, { "analysis_explanation": null, "end": 8006, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8000 }, { "analysis_explanation": null, "end": 8053, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8039 }, { "analysis_explanation": null, "end": 8062, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8055 }, { "analysis_explanation": null, "end": 8089, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8083 }, { "analysis_explanation": null, "end": 8097, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8091 }, { "analysis_explanation": null, "end": 8125, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8117 }, { "analysis_explanation": null, "end": 8202, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8194 }, { "analysis_explanation": null, "end": 8222, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8216 }, { "analysis_explanation": null, "end": 8250, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8244 }, { "analysis_explanation": null, "end": 8379, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8371 }, { "analysis_explanation": null, "end": 8398, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8390 }, { "analysis_explanation": null, "end": 8435, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8427 }, { "analysis_explanation": null, "end": 8465, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8457 }, { "analysis_explanation": null, "end": 8481, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8476 }, { "analysis_explanation": null, "end": 8507, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8499 }, { "analysis_explanation": null, "end": 8523, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8518 }, { "analysis_explanation": null, "end": 8549, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8541 }, { "analysis_explanation": null, "end": 8662, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8653 }, { "analysis_explanation": null, "end": 8684, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8663 }, { "analysis_explanation": null, "end": 8693, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8685 }, { "analysis_explanation": null, "end": 8725, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8717 } ]

[ "---\nabstract: |\n We investigate partitioning of integer sequences into heapable subsequences (previously defined and established by Mitzenmacher et al.\\\n [@byers2011heapable]). ", "We show that an extension of patience sorting computes the decomposition into a minimal number of heapable subsequences (MHS). ", "We connect this parameter to an interactive particle system, a multiset extension of Hammersley’s process, and investigate its expected value on a random permutation. ", "In contrast with the (well studied) case of the longest increasing subsequence, we bring experimental evidence that the correct asymptotic scaling is $\\frac{1+\\sqrt{5}}{2}\\cdot \\ln(n)$. Finally we give a heap-based extension of Young tableaux, prove a hook inequality and an extension of the Robinson-Schensted correspondence.", "\nauthor:\n- 'Gabriel Istrate, Cosmin Bonchiş[^1]'\ntitle: 'Partition into heapable sequences, heap tableaux and a multiset extension of Hammersley’s process'\n---\n\nIntroduction\n============\n\n[*Patience sorting*]{} [@mallows-patience] and [*the longest increasing (LIS) sequence*]{} are well-studied topics in combinatorics. ", "The analysis of the expected length of the LIS of a random permutation is a classical problem displaying interesting connections with the theory of interacting particle systems [@aldous1999longest] and that of combinatorial Hopf algebras [@hivert2007introduction]. ", "Recursive versions of patience sorting are involved (under the name of [*Schensted procedure*]{} [@schensted]) in the theory of Young tableaux. ", "A wonderful recent reference for the rich theory of the longest increasing sequences (and substantially more) is [@romik2014].", "\n\nRecently Mitzenmacher et al. [", "@byers2011heapable] introduced, under the name of [*heapable sequence*]{}, an interesting variation on the concept of increasing sequences. ", "Informally, a sequence of integers is heapable if it can be successively inserted into a (not necessarily complete) binary tree satisfying the heap property without having to resort to node rearrangements. ", "Mitzenmacher et al. ", "showed that the longest heapable subsequence in a random permutation grows linearly (rather than asymptotically equal to $2\\sqrt{n}$ as does LIS) and raised as an open question the issue of extending the rich theory of LIS to the case of heapable sequences.", "\n\nIn this paper we partly answer this open question: we define a family $MHS_{k}(X)$ of measures (based on decomposing the sequence into subsequences heapable into a min-heap of arity at most $k$) and show that a variant of patience sorting correctly computes the values of these parameters. ", "We show that this family of measures forms an infinite hierarchy, and investigate the expected value of parameter $MHS_{2}[\\pi]$, where $\\pi$ is a random permutation of order $n$. Unlike the case $k=1$ where $E[MHS_{1}[\\pi]]=E[LDS[\\pi]]\\sim 2\\sqrt{n}$, we argue that in the case $k\\geq 2$ the correct scaling is logarithmic, bringing experimental evidence that the precise scaling is $E[MHS_{2}[\\pi]]\\sim \\phi\\ln{n}$, where $\\phi=\\frac{1+\\sqrt{5}}{2}$ is the golden ratio. ", "The analysis exploits the connection with a new, multiset extension of the Hammersley-Aldous-Diaconis process [@aldous1995hammersley], an extension that may be of independent interest. ", "Finally, we introduce a heap-based generalization of Young tableaux. ", "We prove (Theorem \\[unif\\] below) a hook inequality related to the hook formula for Young tableaux [@hook-formula] and Knuth’s hook formula for heap-ordered trees [@knuth:vol3], and (Theorem \\[rs-heap\\]) an extension of the Robinson-Schensted (R-S) correspondence.", "\n\nPreliminaries\n=============\n\nFor $k\\geq1$ define alphabet $\\Sigma_{k}=\\{1,2,\\ldots, k\\}$. Define as well $\\Sigma_{\\infty}=\\cup_{k\\geq 1} \\Sigma_{k}$. Given words $x,y$ over $\\Sigma_{\\infty}$ we will denote by $x\\sqsubseteq y$ the fact that $x$ is a prefix of $y$. The set of (non-strict) prefixes of $x$ will be denoted by $Pref(x)$. Given words $x,y\\in \\Sigma_{\\infty}^{*}$ define the [*prefix partial order*]{} $x\\preceq_{ppo} y$ as follows: If $x\\sqsubseteq y$ then $x\\preceq_{ppo} y$. If $x=za$, $y=zb$, $a,b\\in \\Sigma_{\\infty}$ and $a<b$ then $x\\preceq_{ppo} y$. $\\preceq_{ppo}$ is the transitive closure of these two constraints. ", "Similarly, the [*lexicographic partial order*]{} $\\preceq_{lex}$ is defined as follows: If $x\\sqsubset y$ then $x\\preceq_{lex} y$. If $x=za$, $y=zb$, $a,b\\in \\Sigma_{\\infty}$ and $a<b$ then $x\\preceq_{lex} y$. $\\preceq_{lex}$ is the transitive closure of these two constraints.", "\n\nA [*$k$-ary tree*]{} is a finite, $\\preceq_{ppo}$-closed set $T$ of words over alphabet $\\Sigma_{k}=\\{1,2,\\ldots, k\\}$. That is, we impose the condition that positions on the same level in a tree are filled preferentially from left to right. ", "The [*position $pos(x)$ of node $x$ in a $k$-ary tree*]{} is the string over alphabet $\\{1,2,\\ldots, k\\}$ encoding the path from the root to the node (e.g. the root has position $\\lambda$, its children have positions $1,2,\\ldots, k$, and so on). ", "A [*$k$-ary (min)-heap*]{} is a function $f:T\\rightarrow {\\bf N}$ monotone with respect to $pos$, i.e. $\n(\\forall x,y\\in T), [pos(x)\\sqsubseteq pos(y)] \\Rightarrow [f(x)\\leq f(y)].$\n\nA [*(binary min-)heap*]{} is a binary tree, not necessarily complete, such that $A[parent[x]]\\leq A[x]$ for every non-root node $x$. If instead of binary we require the tree to be $k$-ary we get the concept of $k$-ary min-heap.", "\n\nA sequence $X=X_{0},\\ldots, X_{n-1}$ is [*$k$-heapable*]{} if there exists some $k$-ary tree $T$ whose nodes are labeled with (exactly one of) the elements of $X$, such that for every non-root node $X_{i}$ and parent $X_{j}$, $X_{j}\\leq X_{i}$ and $j<i$. In particular a 2-heapable sequence will simply be called [*heapable*]{} [@byers2011heapable]. ", "Given sequence of integer numbers $X$, denote by $MHS_{k}(X)$ [*the smallest number of heapable (not necessarily contiguous) subsequences*]{} one can decompose $X$ into. ", "$MHS_{1}(X)$ is equal [@levcopoulos-petersson-sus] to the [*shuffled up-sequences (SUS)*]{} measure in the theory of presortedness.", "\n\nLet $X=[2,4,3,1]$. Via patience sorting $MHS_{1}(X)=SUS(X)$ $=3$. $MHS_{2}(X)=2$, since subsequnces $[2,4,3]$ and $[1]$ are 2-heapable. ", "On the other hand, for every $k\\geq 1$, $MHS_{k}([k,k-1,\\ldots, 1])=k$.\n\nAnalyzing the behavior of LIS relies on the correspondence between longest increasing sequences and an interactive particle system [@aldous1995hammersley] called the [*Hammersley-Aldous-Diaconis (shortly, Hammersley or HAD) process*]{}. ", "We give it the multiset generalization displayed in Figure \\[ham:k\\]. ", "Technically, to recover the usual definition of Hammersley’s process one should take $X_{a}>X_{t+1}$ (rather than $X_{a}<X_{t+1}$). ", "This small difference arises since we want to capture $MHS_{k}(\\pi)$, which generalizes $LDS(\\pi)$, rather than $LIS(\\pi)$ (captured by Hammersley’s process). ", "This slight difference is, of course, inconsequential: our definition is simply the “flipped around the midpoint of segment \\[0,1\\]” version of such a generalization, and has similar behaviour).", "\n\n- A number of individuals appear (at integer times $i\\geq 1$) as random numbers $X_{i}$, uniformly distributed in the interval $[0,1]$.\n\n- Each individual is initially endowed with $k$ “lifelines”.", "\n\n- The appearance of a new individual $X_{t+1}$ subtracts a life from the largest individual $X_{a}<X_{t+1}$ (if any) still alive at moment $t$.\n\nA greedy approach to computing $MHS_{k}$\n========================================\n\nFirst we show that one can combine patience sorting and the greedy approach in [@byers2011heapable] to obtain an algorithm for computing $MHS_{k}(X)$. To do so, we must adapt to our purposes some notation in that paper.", "\n\nA binary tree with $n$ nodes has $n+1$ positions (that will be called [*slots*]{}) where one can add a new number. ", "We will identify a slot with the minimal value of a number that can be added to that location. ", "For heap-ordered trees it is the value of the parent node. ", "Slots easily generalize to forests. ", "The number of slots of a forest with $d$ trees and $n$ nodes is $n+d$.\n\nGiven a binary heap forest $T$, the [*signature of $T$*]{} denoted $sig(T)$, is the vector of the (values of) free slots in $T$, in sorted (non-decreasing) order. ", "Given two binary heap forests $T_{1},T_{2}$, [*$T_{1}$ dominates $T_{2}$*]{} if $|sig_{T_{1}}|\\leq |sig_{T_{2}}|$ and inequality $sig_{T_{1}}[i]\\leq sig_{T_{2}}[i]$ holds for all $1\\leq i \\leq |sig_{T_{1}}|$.\n\nFor every fixed $k\\geq 1$ there is a polynomial time algorithm that, given sequence $X=(X_{0},\\ldots, X_{n-1})$ as input, computes $MHS_{k}(X)$.\n\nWe use the greedy approach of Algorithm \\[fig:greedy\\]. ", "Proving correctness of the algorithm employs the following\n\n[GREEDY]{}[W]{} W=(w\\_[1]{},w\\_[2]{},…, w\\_[n]{})\\\nT=.\\\ni\\\nX\\_[i]{}\\\nX\\_[i]{} :\\\nX\\_[i]{} \\[fig:greedy\\]\n\nLet $T_{1},T_{2}$ be two heap forests such that $T_{1}$ dominates $T_{2}$. Insert a new element $x$ in both $T_{1}$ and $T_{2}$: greedily in $T_{1}$ (i.e. at the largest slot with value less or equal to $x$, or as the root of a new tree, if no such slot exists) and arbitrarily in $T_{2}$, obtaining forests $T_{1}^{\\prime},T_{2}^{\\prime}$, respectively. ", "Then $T_{1}^{\\prime}$ dominates $T_{2}^{\\prime}$. \\[dom\\]\n\nFirst note that, by domination, if no slot of $T_{1}$ can accomodate $x$ (which, thus, starts a new tree) then a similar property is true in $T_{2}$ (and thus $x$ starts a new tree in $T_{2}$ as well).", "\n\nLet $sig_{T_{1}}=(a_{1},a_{2},\\ldots )$ and $sig_{T_{2}}=(b_{1},b_{2},\\ldots )$ be the two signatures. , ", "and similarly let $sig_{T_{1}^{\\prime}}=(c_{1},c_{2},\\ldots)$ and $sig_{T_{2}^{\\prime}}=(d_{1},d_{2},\\ldots)$ be the two resulting signatures. ", "The process of inserting $x$ can be described as adding two copies of $x$ to the signature of $T_{1}(T_{2})$ and (perhaps) removing a label $\\leq x$ from the two signatures. ", "The removed label is $a_{i}$, the largest label $\\leq x$, in the case of greedy insertion into $T_{1}$. Let $b_j$ be the largest value (or possibly none) in $T_{2}$ less or equal to $x.$ Some $b_k$ less or equal to $b_j$ is replaced by two copies of $x$ in $T_2.$ The following are true:\n\n- The length of $sig_{T_{1}^{\\prime}}$ is at most that of $sig_{T_{2}^{\\prime}}$.\n\n- The element $b_k$ (if any) deleted by $x$ from $T_{2}$ satisfies $b_k\\leq x$. Its index in $T_2$ is less or equal to $i$.\n\n- The two $x$’s are inserted to the left of the deleted (if any) positions in both $T_{1}$ and $T_{2}$.\n\nConsider some position $l$ in $sig_{T_{1}^{\\prime}}$. Our goal is to show that $a^{\\prime}_{l}\\leq b^{\\prime}_{l}$. Several cases are possible:\n\n- $l < k$. Then $a^{\\prime}_{l}= a_{l}$ and $b^{\\prime}_{l}= b_{l}$.\n\n- $k \\leq l < j$. Then $a^{\\prime}_{l}= a_{l}$ and $b^{\\prime}_{l}= b_{l+1} \\geq a_{l}$.\n\n- $j\\leq l\\leq i+k-1$. Then $a^{\\prime}_{l}\\leq x$ and $b^{\\prime}_{l}\\geq x$.\n\n- $l > i+k-1$. Then $a^{\\prime}_{l} = a_{l-k+1}$ and $b^{\\prime}_{l}= b_{l-k+1}$.\n\n$$\\begin{aligned}\n&& { \\fcolorbox{black}{white}{\\texttt{$a_1$\\strut}}\\kern-\\fboxrule}\\!", "\n { \\fcolorbox{black}{white}{\\texttt{$a_2$\\strut}}\\kern-\\fboxrule}\\!", "\n { \\fcolorbox{black}{white}{\\texttt{\\ldots\\hspace{-0.03cm}\\strut}}\\kern-\\fboxrule}\\!", "\n { \\fcolorbox{black}{white}{\\texttt{~$a_k$~\\hspace{0.06cm}\\strut}}\\kern-\\fboxrule}\\!", "\n { \\fcolorbox{black}{white}{\\texttt{~\\ldots~\\hspace{-0.03cm}\\strut}}\\kern-\\fboxrule}\\!", "\n { \\fcolorbox{black}{white}{\\texttt{~~~$a_j$~~\\strut}}\\kern-\\fboxrule}\\!", "\n { \\fcolorbox{black}{white}{\\texttt{\\ldots\\strut}}\\kern-\\fboxrule}\\!", "\n { \\fcolorbox{black}{white}{\\texttt{$a_{i-1}$\\strut}}\\kern-\\fboxrule}\\!", "\n \\overbrace{{ \\fcolorbox{black}{green!20}{\\texttt{~~~$a_i$~~~\\strut}}\\kern-\\fboxrule}}^{a_{i}\\leq x\\leq a_{i+1}}\\!", "\n { \\fcolorbox{black}{white}{\\texttt{\\strut}}\\kern-\\fboxrule}\\!", "\n { \\fcolorbox{black}{white}{\\texttt{\\strut}}\\kern-\\fboxrule}\\!", "\n { \\fcolorbox{black}{white}{\\texttt{\\hspace{-0.02cm}\\strut}}\\kern-\\fboxrule}\\\\\n&& { \\fcolorbox{black}{white}{\\texttt{$b_1$\\hspace{0.03cm}\\strut}}\\kern-\\fboxrule}\\!", "\n { \\fcolorbox{black}{white}{\\texttt{$b_2$\\hspace{0.03cm}\\strut}}\\kern-\\fboxrule}\\!", "\n { \\fcolorbox{black}{white}{\\texttt{\\ldots\\hspace{-0.08cm}\\strut}}\\kern-\\fboxrule}\\!", "\n \\underbrace{{ \\fcolorbox{black}{green!20}{\\texttt{~$b_k$~\\hspace{0.04cm}\\strut}}\\kern-\\fboxrule}}_{b_j \\leftarrow x}\\!", "\n { \\fcolorbox{black}{white}{\\texttt{~\\ldots~\\hspace{-0.08cm}\\strut}}\\kern-\\fboxrule}\\!", "\n \\underbrace{{ \\fcolorbox{black}{green!60}{\\texttt{~~~$b_j$~~\\hspace{-0.02cm}\\strut}}\\kern-\\fboxrule}}_{b_j \\leq x \\leq b_{j+1}}\\!", "\n { \\fcolorbox{black}{white}{\\texttt{\\hspace{0.02cm}\\ldots\\hspace{-0.02cm}\\strut}}\\kern-\\fboxrule}\\!", "\n { \\fcolorbox{black}{white}{\\texttt{\\hspace{0.02cm}$b_{i-1}$\\hspace{0.06cm}\\strut}}\\kern-\\fboxrule}\\!", "\n { \\fcolorbox{black}{white}{\\texttt{\\hspace{0.04cm}~~~$b_i$~~~\\hspace{0.05cm}\\strut}}\\kern-\\fboxrule}\\!", "\n { \\fcolorbox{black}{white}{\\texttt{\\strut}}\\kern-\\fboxrule}\\!", "\n { \\fcolorbox{black}{white}{\\texttt{\\strut}}\\kern-\\fboxrule}\\!", "\n { \\fcolorbox{black}{white}{\\texttt{\\hspace{-0.02cm}\\strut}}\\kern-\\fboxrule}\\! \\\\", "\n\\vspace{-0.6cm}\n&& { \\fcolorbox{black}{white}{\\texttt{$a_1$\\strut}}\\kern-\\fboxrule}\\!", "\n { \\fcolorbox{black}{white}{\\texttt{$a_2$\\strut}}\\kern-\\fboxrule}\\!", "\n { \\fcolorbox{black}{white}{\\texttt{\\ldots\\hspace{-0.03cm}\\strut}}\\kern-\\fboxrule}\\!", "\n { \\fcolorbox{black}{white}{\\texttt{~$a_k$~\\hspace{0.06cm}\\strut}}\\kern-\\fboxrule}\\!", "\n { \\fcolorbox{black}{white}{\\texttt{~\\ldots~\\hspace{-0.03cm}\\strut}}\\kern-\\fboxrule}\\!", "\n { \\fcolorbox{black}{white}{\\texttt{~~~$a_j$~~\\strut}}\\kern-\\fboxrule}\\!", "\n { \\fcolorbox{black}{white}{\\texttt{\\ldots\\strut}}\\kern-\\fboxrule}\\!", "\n { \\fcolorbox{black}{white}{\\texttt{$a_{i-1}$\\strut}}\\kern-\\fboxrule}\\!", "\n \\overbrace{{ \\fcolorbox{black}{green!20}{\\texttt{\\hspace{0.05cm}~~~x~~~\\hspace{0.05cm}\\strut}}\\kern-\\fboxrule}}^{a_i\\rightarrow}\\!", "\n { \\fcolorbox{black}{blue!40}{\\texttt{\\hspace{0.03cm}x\\hspace{0.02cm}\\strut}}\\kern-\\fboxrule}\\!", "\n { \\fcolorbox{black}{white}{\\texttt{$a_{i+1}$\\strut}}\\kern-\\fboxrule}\\!", "\n { \\fcolorbox{black}{white}{\\texttt{\\strut}}\\kern-\\fboxrule}\\!", "\n { \\fcolorbox{black}{white}{\\texttt{\\hspace{-0.02cm}\\strut}}\\kern-\\fboxrule}\\\\\n&& { \\fcolorbox{black}{white}{\\texttt{$b_1$\\hspace{0.03cm}\\strut}}\\kern-\\fboxrule}\\!", "\n { \\fcolorbox{black}{white}{\\texttt{\\hspace{-0.1cm}\\ldots\\hspace{-0.15cm}\\strut}}\\kern-\\fboxrule}\\!", "\n \\underbrace{{ \\fcolorbox{black}{white}{\\texttt{\\hspace{-0.1cm}$b_{k-1}$\\hspace{-0.09cm}\\strut}}\\kern-\\fboxrule} { \\fcolorbox{black}{white}{\\texttt{\\hspace{0.04cm}$b_{k+1}$\\hspace{0.05cm}\\strut}}\\kern-\\fboxrule}}_{b_k \\rightarrow }\\!", "\n { \\fcolorbox{black}{white}{\\texttt{\\hspace{-0.07cm}\\ldots\\hspace{-0.06cm}\\strut}}\\kern-\\fboxrule}\\!", "\n { \\fcolorbox{black}{white}{\\texttt{$b_j$\\hspace{0.03cm}\\strut}}\\kern-\\fboxrule}\\! ", " \n { \\fcolorbox{black}{green!20}{\\texttt{~~~x~~~\\hspace{-0.07cm}\\strut}}\\kern-\\fboxrule}\\!", "\n { \\fcolorbox{black}{blue!40}{\\texttt{~x~\\strut}}\\kern-\\fboxrule}\\!", "\n { \\fcolorbox{black}{white}{\\texttt{\\hspace{0.04cm}\\ldots\\hspace{0.05cm}\\strut}}\\kern-\\fboxrule}\\!", "\n { \\fcolorbox{black}{white}{\\texttt{\\hspace{0.01cm}~~~$b_{i-1}$~~\\hspace{-0.06cm}\\strut}}\\kern-\\fboxrule}\\!", "\n { \\fcolorbox{black}{white}{\\texttt{$b_i$\\strut}}\\kern-\\fboxrule}\\!", "\n { \\fcolorbox{black}{white}{\\texttt{\\hspace{0.02cm}$b_{i+1}$\\strut}}\\kern-\\fboxrule}\\!", "\n { \\fcolorbox{black}{white}{\\texttt{\\strut}}\\kern-\\fboxrule}\\!", "\n { \\fcolorbox{black}{white}{\\texttt{\\hspace{-0.02cm}\\strut}}\\kern-\\fboxrule}\\\\\\end{aligned}$$\n\nLet $X$ be a sequence of integers, OPT be an optimal partition of $X$ into $k$-heapable sequences and $\\Gamma$ be the solution produced by GREEDY. ", "Applying Lemma \\[dom\\] repeatedly we infer that whenever GREEDY adds a new heap the same thing happens in OPT. ", "Thus the number of heaps created by Greedy is optimal, which means that the algorithm computes $MHS_{k}(X)$.\n\nTrivially $MHS_{k}(X)\\le MHS_{k-1}(X)$. On the other hand\n\n\\[ineq\\] The following statements (proved in the Appendix) are true for every $k\\geq 2$: (a). ", "there exists a sequence $X$ such that $MHS_{k}(X)<MHS_{k-1}(X)$ $<\\ldots <MHS_{1}(X)$; (b). ", "$\n\\sup\\limits_{X}\\mbox{ } [MHS_{k-1}(X)-MHS_{k}(X)] =\\infty$.\n\nThe connection with the multiset Hammersley process\n===================================================\n\nDenote by $MinHAD_{k}(n)$ the random variable denoting [*the number of times $i$ in the evolution of process $HAD_{k}$ up to time $n$ when the newly inserted particle $X_{i}$ has lower value than all the existing particles at time $i$.*]{} The observation from [@hammersley1972few; @aldous1995hammersley] generalizes to:\n\nFor every fixed $k,n\\geq 1$ $E_{\\pi\\in S_{n}} [MHS_{k}(\\pi)]=E[MinHAD_{k}(n)]$.\n\nW.h.p. ", "all $X_{i}$’s are different. ", "We will thus ignore in the sequel the opposite alternative. ", "Informally minima correspond to new heaps and live particles to slots in these heaps (cf. ", "also Lemma \\[dom\\]).", "\n\nThe asymptotic behavior of $E[MHS_{2}[\\pi]]$\n============================================\n\nThe asymptotic behavior of $E[MHS_{1}[\\pi]]$ where $\\pi$ is a random permutation in $S_{n}$ is a classical problem in probability theory: results in [@hammersley1972few], [@logan1977variational], [@vershik1977asymptotics], [@aldous1995hammersley] show that it is asymptotically equal to $2\\sqrt{n}$.\n\nA simple lower bound valid for all values of $k\\geq 1$ is\n\nFor every fixed $k,n\\geq 1$ $$E_{\\pi\\in S_{n}} [MHS_{k}(\\pi)]\\geq H_{n}\\mbox{, the }n\\mbox{'th harmonic number. ", " }$$\n\nFor $\\pi\\in S_{n}$ the set of its [*minima*]{} is defined as $Min(\\pi)=\\{j\\in [n]: \\pi[j]<\\pi[i]\\mbox{ for all } 1\\leq i<j\\}$ (and similarly for maxima). ", "It is easy to see that $MHS_{k}[\\pi]\\geq |Min[\\pi]|$. Indeed, every minimum of $\\pi$ must determine the starting of a new heap, no matter what $k$ is. ", "Now we use the well-known formula $E_{\\pi\\in S_{n}}[|Min[\\pi]|]=E_{\\pi\\in S_{n}}[|Max[\\pi]|]=H_{n}$ [@knuth:vol3].", "\n\nOn the other hand\n\nWe have $$\\limsup_{n\\rightarrow \\infty}\\frac{E[MHS_{2}[\\pi]]}{\\ln(n)}\\leq 2.$$ \\[upper\\]\n\nA coupling argument. ", "Consider the following random process $MIN_{2}$ : Random numbers $Y_{0},Y_{1},\\ldots, Y_{n-1}\\ldots $ are generated uniformly at random in the interval $[0,1]$. Each $Y_{i}$ comes with two lives. ", "At every moment $t$, once $Y_{i}$ is inserted, [*the smallest value among those still existing is removed*]{} (unless, of course, $Y_{i}$ is the smallest live element)\n\nIn the natural coupling of $MIN_{2}$ and $HAD_{2}$ (obtained by identifying sequences $X_{0},X_{1},\\ldots X_{n-1}\\ldots $ and $Y_{0},Y_{1},\\ldots Y_{n-1}\\ldots $) minimal values in HAD are less or equal to minimal value in MIN (by systematically removing minima in process MIN, their values increase). ", "Thus a minimum in $HAD_{2}$ at moment $t$ is a minimum in $Min_{2}$ at the same moment. ", "This shows that $E[MinHAD_{2}(t)]$, the expected number of minima in the process $HAD_{2}$ at moment $t$, is at most $E[MinMIN_{2}(t)]$.\n\nTo gain insight in the behavior of process $HAD_{2}$ we note that, rather than giving the precise values of $X_{0},X_{1},\\ldots, X_{t}\\in [0,1]$, an equivalent random model inserts $X_{t}$ uniformly at random in any of the $t+1$ possible positions determined by $X_{0},X_{1},\\ldots, X_{t-1}$. This model translates into the following equivalent combinatorial description of $HAD_{k}$: word $w_{t}$ over the alphabet $\\{-1,0,1,2\\}$ describes the state of the process at time $t$. Each $w_{t}$ conventionally starts with a $-1$ and continues with a sequence of $0$, $1$’s and $2$’s, informally the “number of lifelines” of particles at time $t$. For instance $w_{0}=0$, $w_{1}=02$, $w_{2}$ is either $022$ or $012$, depending on $X_{0} <> X_{1}$, and so on. ", "At each time $t$ a random letter of $w_{t}$ is chosen (corresponding to a position for $X_{t}$) and we apply one of the following transformations, the appropriate one for the chosen position:\n\n- [*Replacing $-10^{r}$ by $-10^{r}2$:*]{} This is the case when $X_{t}$ is the smallest particle still alive, and to its right there are $r\\geq 0$ dead particles.", "\n\n- [*Replacing $10^{r}$ by $0^{r+1}2$:*]{} Suppose that $X_{a}$ is the largest live label less or equal to $X_t$, that the corresponding particle $X_{a}$ has one lifetime at time $t$, and that there are $r$ dead particles between $X_{a}$ and $X_{t}$. Adding $X_{t}$ (with multiplicity two) decreases multiplicity of $X_{a}$ to 0.", "\n\n- [*Replacing $20^{r}$ by $10^{r}2$:*]{} Suppose that $X_{a}$ is the largest label less or equal to $X_t$, its multiplicity is two, and there are $r\\geq 0$ dead particles between $X_{a}$ and $X_{t}$. Adding $X_{t}$ removes one lifeline from particle $X_{a}$.\n\nSimulating the (combinatorial version of the) Hammersley process with two lifelines confirms the fact that $E[MHS_{2}(\\pi)]$ grows significantly slower than $E[MHS_{1}(\\pi)]$: The $x$-axis in the figure is logarithmic. ", "The scaling is clearly different, and is consistent (see inset) with logarithmic growth (displayed as a straight line on a plot with log-scaling on the $x$-axis). ", "Experimental results (see the inset/caption of Fig.", " \\[k:5\\]) suggest the following bold\n\n\\[main\\] We have $\n\\lim_{n\\rightarrow \\infty}\\frac{E[MHS_{2}[\\pi]]}{\\ln(n)}=\\phi$, with $\\phi=\\frac{1+\\sqrt{5}}{2}$ the golden ratio. ", "More generally, for an arbitrary $k\\geq 2$ the relevant scaling is $$\\lim_{n\\rightarrow \\infty}\\frac{E[MHS_{2}[\\pi]]}{\\ln(n)}=\n \\frac{1}{\\phi_{k}},\n\\label{general:k}$$ where $\\phi_{k}$ is the unique root in $(0,1)$ of equation $X^{k}-X^{k-1}+\\ldots +X=1$.\n\n![", "Scaling of expected value of $MHS_{k}[\\pi]$ for $k=1,2$. The inset shows $E[MHS_{2}[\\pi]]$ (red) versus $\\phi\\cdot \\ln(n)+1$ (blue). ", "The fit is strikingly accurate.[]{data-label=\"k:5\"}](figure_1.pdf){width=\"10cm\" height=\"6cm\"}\n\nWe plan to present the experimental evidence for the truth of equation (\\[general:k\\]) and a nonrigorous, “physics-like” justification, together with further insights on the so-called [*hydrodynamic behavior*]{} [@groenenboom] of the $HAD_{k}$ process in subsequent work [@hydrodynamic]. ", "For now we limit ourselves to showing that one can (rigorously) perform a first step in the analysis of the $HAD_{2}$ process: we prove convergence of (some of) its structural characteristics. ", "This will likely be useful in a full rigorous proof of Conjecture \\[main\\].", "\n\nProof sketch of Theorem \\[main\\]\n================================\n\nOur proof proceeds by analyzing the multiset Hammersley process:\n\nDenote by $L_{t}$ the number of digits 1+2, and by $C_{t}$ the number of ones in $w_{t}$. Let $l(t)=E[\\frac{L(t)}{t}]$, $c(t)=E[\\frac{C(t)}{t}]$. $l(t),c(t)$ always belong to $[0,1]$.\n\nThere exist constants $l,c\\in [0,1]$ such that $l(t)\\rightarrow l$, $c(t)\\rightarrow c$. \\[limit\\]\n\nWe use a standard tool, [*subadditivity*]{}: if sequence $a_{n}$ satisfies $a_{m+n}\\leq a_{m}+a_{n}$ for all $m,n\\geq 1$ then (by Fekete’s Lemma ([@steele1997probability] pp. ", "3, [@szpankowski]) $\\lim_{n\\rightarrow \\infty} a_{n}/n$ exists. ", "We show in the Appendix that this is the case for two independent linear combinations of $l(t)$ and $c(t).$\n\nExperimentally (and nonrigorously) $l=\\phi-1=\\frac{\\sqrt{5}-1}{2}$ and $c=\\frac{3-\\sqrt{5}}{2}$. “Physics-like” nonrigorous arguments then imply the desired scaling. ", "An additional ingredient is that digits 0/1/2 are uniformly distributed (conditional on their density) in a large $w_{t}$. This is intuitively true since for large $t$ the behavior of the $HAD_{k}$ process is described by a compound Poisson process. ", "We defer more complete explanations to [@hydrodynamic].", "\n\nHeap tableaux, a hook inequality and a generalization of the Robinson-Schensted Correspondence.", "\n===============================================================================================\n\nFinally, we present an extension of Young diagrams to heap-based ta-\\\nbleaux. ", "All proofs are given in the Appendix. ", "A [*($k$-)heap tableau $T$*]{} is $k$-ary min-heap of integer vectors, so that for every $r\\in \\Sigma_{k}^{*}$, the vector $V_{r}$ at address $r$ is nondecreasing. ", "We formally represent the tableau as a function $T:\\Sigma_{k}^{*} \\times {\\bf N} \\rightarrow {\\bf N} \\cup \\{\\perp\\}$ such that (a). ", "$T$ has [*finite support:*]{} the set $dom(T)=\\{(r,a):T(r,a)\\neq \\perp\\}$ of nonempty positions is finite. (", "b). ", "$T$ is [*$\\sqsubseteq$-nondecreasing*]{}: if $T(r,a)\\neq \\perp$ and $q \\sqsubset r$ then $T(q,a)\\neq \\perp$ and $T(q,a)\\leq T(r,a)$. In other words, $T(\\cdot,a)$ is a min-heap. (", "c). ", "$T$ is [*columnwise increasing*]{}: if $T(r,a)\\neq \\perp$ and $b< a$ then $T(r,b)\\neq \\perp$ and $T(r,b)< T(r,a)$. That is, each column $V_r$ is increasing. ", "The [*shape of $T$*]{} is the heap $S(T)$ where node with address $r$ holds value $|V_r|$.\n\nA tableau is [*standard*]{} if (e). ", "for all $1\\leq i\\leq n=|dom(T)|$, $|T^{-1}(i)|=1$ and (f). ", "If $x\\leq_{lex} y$ and $T(y,1)\\neq \\perp$ then $\\perp \\neq T(x,1)\\leq T(y,1)$. I.e., labels in the first heap $H_{1}$ are increasing from left to right and top to bottom.", "\n\nA heap tableau $T_{1}$ with 9 elements is presented in Fig.", " \\[forest-young\\] (a) and as a Young-like diagram in Fig.", " \\[forest-young\\] (b). ", "Note that: (i). ", "Columns correspond to [*rows*]{} of $T_{1}$ (ii). ", "Their labels are in $\\Sigma_{2}^{*}$, rather than [**N**]{}. (", "iii). ", "Cells may contain $\\perp$. (iv). ", "Rows need not be increasing, only [*min-heap ordered*]{}.", "\n\nOne important drawback of our notion of heap tableaux above is that they do not reflect the evolution of the process $HAD_{k}$ the way ordinary Young tableaux do (on their first line) for process $HAD_{1}$ via the Schensted procedure [@schensted]: A generalization with this feature would seem to require that each cell contains not an integer but a [*multiset*]{} of integers. ", "Obtaining such a notion of tableau is part of ongoing research.", "\n\nHowever, we can motivate our definition of heap tableau by the first application below, a hook inequality for such tableaux. ", "To explain it, note that heap tableaux generalize both heap-ordered trees and Young tableaux. ", "In both cases there exist hook formulas that count the number of ways to fill in a structure with $n$ cells by numbers from $1$ to $n$: [@hook-formula] for Young tableaux and [@knuth:vol3] (Sec.5.1.4, Ex.20) for heap-ordered trees. ", "It is natural to wonder whether there exists a hook formula for heap tableaux that provides a common generalization of both these results.", "\n\nTheorem \\[unif\\] gives a partial answer: not a formula but a [*lower bound.*]{} ", "To state it, given $(\\alpha,i)\\in dom(T)$, define the [*hook length $H_{\\alpha,i}$*]{} to be the cardinal of set $\\{(\\beta,j)\\in dom(T): [(j=i)\\AND (\\alpha\\sqsubseteq \\beta)] \\OR [(j\\geq i) \\AND (\\alpha = \\beta)]\\}$. For example, Fig.", " \\[forest-young\\](c). ", "displays the hook lengths of cells in $T_{1}$.\n\nGiven $k\\geq 2$ and a $k$-shape $S$ with $n$ free cells, the number of ways to create a heap tableau $T$ with shape $S$ by filling its cells with numbers $\\{1,2,\\ldots, n\\}$ is [*at least*]{} $\n\\frac{n!}{\\prod_{(\\alpha,i)\\in dom(T)} H_{\\alpha,i}}.$ The bound is tight for Young tableaux [@hook-formula], heap-ordered trees [@knuth:vol3], and infinitely many other examples, but is also [**not**]{} tight for infinitely many (counter)examples. ", "\\[unif\\]\n\nWe leave open the issue whether one can tighten up the lower bound above to a formula by modifying the definition of the hook length $H_{\\alpha,i}$.\n\n\\(A) at (3.5,0) [(2;4;8:&lt;\\[3\\]&gt;)]{}; (B) at (2,-1) [([11]{};&lt;12&gt;;&lt;13&gt;:&lt;\\[3\\]&gt;)]{}; (C) at (5,-1) [(&lt;6&gt;;&lt;14&gt;:&lt;\\[2\\]&gt;)]{}; (D) at (4,-2) [(&lt;10&gt;:&lt;\\[1\\]&gt;)]{}; (A.south) – (B.north); (A.south) – (C.north); (C.south) – (D.north);\n\n$$\\gyoung(::\\lambda:0:1:{00}:{01}:{10}:::\\lambda:0:1:{00}:{01}:{10}:,:1;2;{11};6;\\perp;\\perp;{10}::1;6;3;3;\\perp;\\perp;1:,:2;4;{12};{14}:::::2;4;2;1:,:3;8;{13}::::::3;2;1)\n$$\n\nWe can create $k$-heap tableaux from integer sequences by a version of the Schensted procedure [@schensted]. ", "Algorithm Schensted-HEAP$_{k}$ below performs [*column insertions*]{} and gives to any bumped element $k$ choices for insertion/bumping, the children of vector $V_r,$ with addresses $r\\cdot \\Sigma_{k}$.\n\nThe result of applying the Schensted-HEAP$_{k}$ procedure to an arbitrary permutation $X$ is indeed a $k$-ary heap tableau. ", "\\[sch-heap\\]\n\nSuppose we start with $T_{1}$ from Fig.", " \\[forest-young\\](a). ", "Then (Fig.", " \\[insert\\]) 9 is appended to vector $V_\\lambda$. 7 arrives, bumping 8, which in turn bumps 11. ", "Finally 11 starts a new vector at position 00. ", "Modified cells are grayed.", "\n\nProcedure Schensted-HEAP$_{k}$ does [**not**]{} help in computing the longest heapable subsequence: The complexity of computing this parameter is open [@byers2011heapable], and we make no progress on this issue. ", "On the other hand, we can give a $k\\geq 2$ version of the R-S correspondence:\n\n\\(A) at (2,1) [(2;4;8![!]{}&lt;9&gt;)]{}; (B) at (0,0) [([11]{};&lt;12&gt;;&lt;13&gt;)]{}; (C) at (4,0) [(&lt;6&gt;;&lt;14&gt;)]{}; (D) at (3,-1) [(&lt;10&gt;)]{}; (A.south) – (B.north); (A.south) – (C.north); (C.south) – (D.north);\n\n\\(A) at (4,1) [(2;4![!]{}&lt;7&gt;![!]{}&lt;9&gt;)]{}; (B) at (2,0) [(![!]{}&", "lt;8&gt;![!]{};&lt;12&gt;;&lt;13&gt;)]{}; (C) at (6,0) [(&lt;6&gt;;&lt;14&gt;)]{}; (D) at (5,-1) [(&lt;10&gt;)]{}; (E) at (1,-1) [(![!]{};&", "lt;[11]{}&gt;)]{}; (A.south) – (B.north); (A.south) – (C.north); (C.south) – (D.north); (B.south) – (E.north);\n\nFor every $k\\geq 2$ there exists a bijection between permutations $\\pi\\in S_{n}$ and pairs $(P,Q)$ of $k$-heap tableaux with $n$ elements and identical shape, where $Q$ is a standard tableau. ", "\\[rs-heap\\]\n\nCondition “$Q$ is standard” is specific to case $k\\geq 2$: heaps simply have “too many degrees of freedom” between siblings. ", "Schensted-HEAP$_{k}$ solves this problem by starting new vectors from left to right and top to bottom.", "\n\n[Schensted-HEAP$_k$]{}[X=x\\_[0]{},…, x\\_[n-1]{}]{} i(n): BUMP(x\\_[i]{}, )\\\n\\\n(x, S):      \\# S *is a set of adresses*.\\\nx V\\_r, r S\\\nr V\\_r\\\nV\\_r, r S):\\\nB\\_[x]{}&gt;x,\\\nB\\_[x]{}\\\ny = min{B\\_[x]{}}r\\\nyxV\\_[r]{}\\\nBUMP(y, r\\_[k]{})             \\# *bump $y$ into some child of $r$* \\[sg\\]\n\nConclusion and Acknowledgments\n==============================\n\nOur paper raises a large number of open issues. ", "We briefly list a few: Rigorously justify Conjecture \\[main\\]. ", "Study process $HAD_{k}$ and its variants [@leticia; @cator-groenenboom]. ", "Reconnect the theory to the analysis of [*secretary problems*]{} [@archibald2009hiring; @broder2009hiring]. ", "Find the distribution of $MHS_{k}[\\pi]$. Obtain a hook formula. ", "Define a version of Young tableaux related to process $HAD_{k}$.\n\nWe plan to address some of these in subsequent work. ", "The most important open problem, however, is [*the complexity of computing LHS.*]{}", "\n\nThis research has been supported by CNCS IDEI Grant PN-II-ID-PCE-2011-3-0981 “Structure and computational difficulty in combinatorial optimization: an interdisciplinary approach”.", "\n\nD. Aldous and P. Diaconis. ", "Hammersley’s interacting particle process and longest increasing subsequences. , ", "103(2):199–213, 1995.", "\n\nD. Aldous and P. Diaconis. ", "Longest increasing subsequences: from patience sorting to the [B]{}aik-[D]{}eift-[J]{}ohansson theorem. , ", "36(4):413–432, 1999.", "\n\nM. Archibald and C. Mart[í]{}nez. ", "The hiring problem and permutations. , (", "01):63–76, 2009.", "\n\nJ. Byers, B. Heeringa, M. Mitzenmacher, and G. Zervas. ", "Heapable sequences and subseqeuences. ", "In [*Proceedings of ANALCO*]{}, pages 33–44, 2011.", "\n\nA. Broder, A. Kirsch, R. Kumar, M. Mitzenmacher, E. Upfal, and S. Vassilvitskii. ", "The hiring problem and [L]{}ake [W]{}obegon strategies. , ", "39(4):1233–1255, 2009.", "\n\nE. Cator and P. Groeneboom. ", "Annals of Probability (2005): 879-903.", "\n\nJ.S. Frame and G. Robinson, and R.M. Thrall. ", "Canad. ", "J. Math 6.316 (1954): C324.", "\n\nC. Greene and A. Nijenhuis and H.S.Wilf. ", "Advances in Mathematics 31.1 (1979): 104-109.", "\n\nMaxime Crochemore and Ely Porat. ", "Fast computation of a longest increasing subsequence and application. , ", "208(9):1054–1059, 2010.", "\n\nMichael L Fredman. ", "On computing the length of longest increasing subsequences. , ", "11(1):29–35, 1975.", "\n\nJ. M. Hammersley. ", "A few seedlings of research. ", "In [*Proceedings of the Sixth Berkeley Symposium on Mathematical Statistics and Probability, Volume 1: Theory of Statistics*]{}, 1972.", "\n\nF. Hivert. ", "An introduction to combinatorial [H]{}opf algebras , IOS Press, 2007.", "\n\nP. Groenenboom. ", "Hydrodynamical models for analyzing longest increasing sequences. , ", "142 (2002), 83–105.", "\n\nG. Istrate and C. Bonchiş. (", "manuscript in preparation, 2015)\n\nD. Knuth. ", "The Art of Computer Programming. ", "Volume 3: Sorting and Searching. ", "Addison Wesley, 1998.", "\n\nC. Levcopoulos and O. Petersson. ", "Sorting shuffled monotone sequences. , ", "112(1):37–50, 1994.", "\n\nB.F. Logan and L.A. Shepp. ", "A variational problem for random [Y]{}oung tableaux. , ", "26(2):206–222, 1977.", "\n\nC.L. Mallows. ", "Patience Sorting. , ", "5(4), 375–376, 1963.", "\n\nL. Cuellár Montoya. ", "Stochastic processes and their applications 67.1 (1997): 69-99.", "\n\nD. Romik. . ", "Cambridge University Press, 2014.", "\n\nC. Schensted. ", "Canad. ", "J. Math 13.2 (1961): 179-191.", "\n\nW. Szpankowski. ", "Wiley, 2001.", "\n\nJ.M. Steele. . , ", "1997.", "\n\nA. Vershik and S. Kerov. ", "Asymptotics of Plancherel measure of symmetric group and limit form of Young tables. , ", "233(6):1024–1027,1977.", "\n\nAppendix {#appendix .unnumbered}\n========\n\nProof of Theorem \\[ineq\\]\n-------------------------\n\n- For $k\\geq2,$ consider the sequence $X=[1,k+1,k,k-1,\\cdots,2]$.\n\n We have $$MHS_{1}(X)=k, MHS_{2}(X)=k-1, \\ldots, MHS_{k}(X)=1.$$\n\n Applying the Greedy algorithm we obtain the following heap decompositions:\n\n - ${\\bf MHS_{1}(X)=k:}$ $H_1=[1,k+1]$, $H_2=[k]$, $H_3=[k-1]$, …, $H_k=[2]$.\n\n - ${\\bf MHS_{2}(X)=k-1:}$ $H_{1}=[1,k+1,k]$, $H_2=[k-1]$, $H_3=[k-2]$, …, $H_{k-1}= [2]$.\\\n $\\vdots$\n\n - ${\\bf MHS_{i}(X)=k-i+1:}$ $H_{1}=[1,k+1,k,\\ldots ,k-i+2]$, $H_2=[k-i+1]$, $H_3=[k-i]$, …, $H_{k-i+1}= [k+2]$.\\\n $\\vdots$\n\n - ${\\bf MHS_{k}(X)=1:}$ $H_1=[1,k+1,k,\\cdots,2].$\n\n- Let $k,n\\geq2$. Define sequence $$\\begin{aligned}\n X^{(k,n)} & = & [1, \\\\ \n & & (2+(k-1)),k,\\dots,2,\\\\\n & & (3+2(k-1)+(k-1)^{2}),(k+k^{2}),\\dots,(2+k),\\\\\n & & \\vdots\\\\\n & & \\sum_{i=0}^{n}(n+1-i)(k-1)^{i},\\dots,1+\\sum_{i=0}^{n-1}(n-i)(k-1)^{i}]\\\\\\end{aligned}$$ in other words $X^{(k,n)}=[1,X_{1},X_{2},\\dots,X_{n}],$ where for each $1\\leq t\\leq n$ the subsequence $X_{t}$ is $X_{t}=[\\sum_{i=0}^{t}(t+1-i)(k-1)^{i},\\,\n ,\\dots,\\,1+\\sum_{i=0}^{t-1}(t-i)(k-1)^{i}]$. $X_{t}$ has $(k-1)^{t}+(k-1)^{t+1}+\\ldots + 1=\\frac{(k-1)^{t+1}-1}{k-2} $ many elements.", "\n\n We can see that this sequence is $k$-heapable, thus $MHS_{k}(X)=1$: $|X_{t}|= (k-1) |X_{t-1}|+1< k|X_{t}|,$ and every number in $X_{t}$ is larger than every number in $X_{t-1}$. Thus we can arrange the $X_{t}$’s on (incomplete) heap levels, with every node in $X_{t}$ a child of some node in $X_{t-1}$.\n\n We have $$\\begin{aligned}\n MHS_{k-1}(X^{(k,n)}) & = & n+1.\\\\\\end{aligned}$$\n\n We apply the GREEDY algorithm. ", "After sequence $X_{1}$ two $(k-1)$-heaps are created. ", "$H_{1}$ has two full levels, $H_{2}$ contains only the root 2. ", "Sequence $X_{2}$ has length $k^2$. $(k-1)^2$ elements go on the third level of $H_{1}$. $k-1$ elements go on the second level of $X_{2}$. The remaining $k^2-(k-1)^{2}-2(k-1)=1$ element starts a new heap $H_{3}$.\n\n By induction we easily prove the following\n\n For every $t\\geq 1$, the $\\frac{(k-1)^{t+1}-1}{k-2}$ elements of $X_{t}$ go via GREEDY as follows:\n\n - $(k-1)^{t}$ of them go on level $t$ of $H_{1}$,\n\n - $(k-1)^{t-1}$ of them go on level $t-1$ of $H_{2}$,\n\n - $\\ldots$\n\n - $k-1$ of them go on the first level of $H_{t}$.\n\n The remaining $\\frac{(k-1)^{t+1}-1}{k-2}-\\sum_{i=1}^{t} (k-1)^{i}=1$ element starts a new heap $H_{t+1}$.\n\nProof of Theorem \\[limit\\]\n--------------------------\n\n[**First sequence:**]{} Define $a_{n}$ to be the expected cardinality of the multiset of [**slots**]{} (particles lifelines in process $HAD_{2}$)) at moment $n$. Clearly $a_{n}/n=2l(n)-c(n)$. Also, given $Z=(Z_{0},Z_{1},\\ldots, Z_{n-1})$ a finite trajectory in \\[0,1\\] [**and an initial set of slots $T$**]{}, denote by $s(Z;T)$ the multiset of [**particles (slots) added during $Z$**]{} that are still alive at the end of the trajectory $Z$, if [**at time $t=0$ the process started with the slots in $T$**]{} (omitting the second argument if $T=\\emptyset$), and $a(Z;T)=|s(Z;T)|$. Finally denote by $v(Z;T)$ the submultiset of $s(Z;T)$ consisting of elements with multiplicity two, and by $l(Z;T)=|v(Z;T)|$.\n\nSubadditivity of $a_{n}$ will follow from the fact that the property holds [*on each trajectory*]{}: If $X=(X_{0},\\ldots, X_{n-1})$ and $Y_{m}=(X_{n}\\ldots X_{n+m-1})$ then in fact we can show that $$\\label{ineq3}\n a(XY_{m})\\leq a(X)+a(Y_{m}).$$ Clearly $a_{n}=E_{|X|=n}[a(X)]$ so (\\[ineq\\]) implies that $a_{n}$ is subadditive. ", "It turns out that, together with (\\[ineq3\\]), we will need to simultaneously prove that $$s(Y_{m}) \\subseteq s(Y_{m};s(X))\\mbox{ (as multisets)}\n\\label{ineq2}$$ We prove (\\[ineq3\\]) and (\\[ineq2\\]) by induction on $m=|Y_{m}|$. Clearly the inclusion is true if $m=0$. Let $Y_{m}=Y_{m-1}X_{n+m-1}$ and $s(XY_{m})=W_{m}\\cup Z_{m}$, with $W_{m}=s(X)\\cap s(XY_{m})$, $Z_{m}=Y_{m}\\cap s(XY_{m})$.\n\n$s(XY_{m})$ modifies $s(XY_{m-1})$ by adding two copies of $X_{n+m-1}$ to $W_{m}$ and, perhaps, erasing some $p_{m}$, the largest element (if any) in $s(XY_{m-1})$ smaller or equal to $X_{n+m-1}$. Thus $a(XY_{m})-a(XY_{m-1})\\in \\{1,2\\}$.\n\nSimilarly, $s(Y_{m})$ modifies $s(Y_{m-1})$ by adding two copies of $X_{n+m-1}$ and, perhaps, erasing some $r_{m}$, the largest element (if any) [**in $s(Y_{m-1})$**]{} smaller or equal to $X_{n+m-1}$. Thus $a(Y_{m})-a(Y_{m-1})\\in \\{1,2\\}$.\n\nAll that remains in order to prove that $a(XY_{m})-a(Y_{m})\\leq \na(XY_{m-1})-a(Y_{m-1})$ (and thus establish inequality (\\[ineq\\]) inductively for $m$ as well) is that $(a(Y_{m})-a(Y_{m-1})=1) \\Rightarrow (a(XY_{m})-a(XY_{m-1})=1).$ This follows easily from inductive hypothesis (\\[ineq2\\]) for $m-1$: if $a(Y_{m})-a(Y_{m-1})=1$ then some element in $s(Y_{m-1})$ is less or equal to $X_{n+m-1}$. The same must be true for $s(Y_{m-1};s(X))$ and hence for $s(XY_{m-1})$ as well (noting, though, that $p_{m}$ may well be an element of $X$). ", "Now we have to show that (\\[ineq2\\]) also remains true: clearly the newly added element, $X_{n+m-1}$, has multiplicity two in both $s(Y_{m})$ and $s(Y_{m};s(X))$. Suppose we erase some element $r_{m}$ from $s(Y_{m-1})$. Then $r_{m}$ belongs to $s(Y_{m-1};s(X))$, has multiplicity at least one there, and is [*the largest element smaller or equal to $X_{n+m-1}$ in $s(Y_{m-1};s(X))\\cap s(Y_{m-1})$*]{}. ", "Thus, when going from $s(Y_{m-1};s(X))$ to $s(Y_{m};s(X))$ we either erase one copy of $p_{m}$ or do not erase nothing (perhaps we erased some element in $s(X)$, which is not, however, in $s(Y_{m-1};s(X))$) Suppose, on the other hand that no element in $s(Y_{m-1})$ is smaller or equal to $X_{n+m-1}$. There may be such an erased element $p_{m}$ in $s(Y_{m-1};s(X))$, but [*it certainly did not belong to $s(Y_{m-1})$*]{}. ", "In both cases we infer that relation $s(Y_{m}) \\subseteq s(Y_{m};s(X))$ is true.", "\n\n[**Second sequence:**]{} Note that $t(2l(t)-c(t))$ is the expected length of the multiset of live particles. ", "This multiset starts by being empty and grows by two every time the new particle is a minimum and by one every other time. ", "We infer that $2th(t)+t-h(t)=t+h(t)=t(2l(t)-c(t))$. We infer that $h(t)/t \\rightarrow \\gamma-1$, where $\\gamma$ is the limit of $2l(t)-c(t)$[^2].", "\n\nOn the other hand the total number of distinct particles (including the dead ones, without multiplicity) is $t$, as it starts with zero and it increases by one at each moment. ", "Consider a trajectory $X$ of length $t$ and let $h(X),d(X),nd(X)$ the number of events of type $min$, $1\\rightarrow 02$ and finally of type $2\\rightarrow 12$ [**not followed by a corresponding $1\\rightarrow 02$**]{} $$E_{|X|=t|}[d(X)]=d(t)$$ $$E_{|X|=t|}[nd(X)]=c(t)$$ (as such particles end up with degree one). ", "Finally $$h(X)+2d(X)+nd(X)=|X|=t$$ (as every particle that dies must have been subject to two steps, one which reduces its lifelines to 1, and the final one. ", "Dividing by $t$ and taking limits we infer that $$2d(t)+c(t)\\rightarrow 2-\\gamma.$$\n\nThe proof is very similar to the first one: Define, in a setting similar to that of the first sequence, $u(X,T)$ to be the cardinality of the submultiset of $s(Z,T)$ of elements with multiplicity two. ", "Define $a_{n}$ to be the expected number of elements with multiplicity two at stage $n$. That is, $a_{n}=E_{|X|=n}[u(X)]=l(n)-c(n)$. We will prove by induction on $m$ that if $X=(X_{0},\\ldots, X_{n-1})$ and $Y_{m}=(X_{n}\\ldots X_{n+m-1})$ then $$\\label{ineq4}\n u(XY_{m})\\leq u(X)+u(Y_{m}).$$\n\nThe result is clear for $m=0$. In the general case, $m\\geq 1$, $v(XY_{m})$ modifies $v(XY_{m-1})$ by adding $X_{n+m-1}$ and, perhaps, erasing some $p_{m}$, the largest element (if any) in $s(XY_{m-1})$ smaller or equal to $X_{n+m-1}$ if this element is in $v(XY_{m-1})$. Thus $u(XY_{m})-u(XY_{m-1})\\in \\{0,1\\}$. Similarly, $u(Y_{m})$ modifies $u(Y_{m-1})$ by adding $X_{n+m-1}$ and, perhaps, erasing some $r_{m}$, the largest element (if any) [**in $s(Y_{m-1})$**]{}, if this element is smaller or equal to $X_{n+m-1}$. Thus $u(Y_{m})-u(Y_{m-1})\\in \\{0,1\\}$.\n\nIf $u(XY_{m-1})\\leq u(X)-1+u(Y_{m})$ then clearly $u(XY_{m})-u(Y_{m})\\leq u(X)$. The only problematic case may be when $u(XY_{m-1})-u(Y_{m-1})=u(X)$, $u(XY_{m})-u(XY_{m-1})=1$, $u(Y_{m})-u(Y_{m-1})=0$. But this means that $r_{m}$ exists (and is erased from $v(Y_{m-1})$). ", "Since $s(Y_{m-1})\\subseteq s(Y_{m-1};s(X))$, $r_{m}$ must be erased from $s(Y_{m-1};s(X))$. In other words, the bad case above cannot occur.", "\n\nProof of Theorem \\[unif\\]\n-------------------------\n\nWe use essentially the classical proof based on the [*hook walk*]{} from [@hook-walk], slightly adapted to our framework: Define for a heap table $T$ with $n$ elements $$F_{T}=\\frac{n!}{\\prod_{(\\alpha,i)\\in dom(T)} H_{\\alpha,i}}$$ and $C(T)$, the set of [*corners of $T$*]{}, to be the set of cells $(\\alpha,i)$ of $T$ with $H_{\\alpha,i}=1$. Given $\\gamma\\in C(T)$ define $T_{\\gamma}=T\\setminus \\{\\gamma\\}$. We want to prove that $$\\sum_{\\gamma\\in C(T)} \\frac{F_{T_{\\gamma}}}{F_{T}}\\geq 1. ", "\n\\label{fin}$$ (of course, for $k=1$ we can actually prove equality in Formula \\[fin\\] above). ", "This will ensure (by induction upon table size) the truth of our lower bound.", "\n\nWe need some more notation: for $(\\alpha,i)\\in dom(T)$, denote $$Heap_{\\alpha,i}=\\{(\\beta,i)\\in dom(T):\\alpha \\sqsubseteq \\beta \\}$$ the [*heap hook of $(\\alpha,i)$*]{}, and by $$Vec_{\\alpha,i}=\\{(\\alpha,j)\\in dom(T):i\\leq j \\}$$ its [*vector hook*]{} (thus $H_{\\alpha,i}=|Heap_{\\alpha,i}|+|Vec_{\\alpha,i}|-1$).", "\n\nBy applying formulas for $F_{T},F_{T_{\\gamma}}$ we get $$\\begin{aligned}\n\\frac{F_{T_{\\gamma}}}{F_T}& =\\frac{1}{n}\\cdot \\prod_{\\gamma\\in Heap_{\\beta,j}} \\frac{H_{\\beta,j}}{H_{\\beta,j}-1}\\cdot \\prod_{\\gamma\\in Vec_{\\beta,j}} \\frac{H_{\\beta,j}}{H_{\\beta,j}-1} \\nonumber \\\\\n& = \\frac{1}{n}\\cdot \\prod_{\\gamma\\in Heap_{\\beta,j}} (1+\\frac{1}{H_{\\beta,j}-1})\\cdot \\prod_{\\gamma\\in Vec_{\\beta,j}} (1+\\frac{1}{H_{\\beta,j}-1})\\label{hw}\\end{aligned}$$\n\nWe consider the [*hook walk on $T$*]{}, defined in Figure (\\[hw:k\\]).", "\n\n- Choose (uniformly at random) a cell $(\\alpha_{1},i_{1})$ of $T$.\n\n- let $i=1$.\n\n- while (($\\alpha_{i},t_{i})$ is not a corner of $T$):\n\n- Choose $(\\alpha_{i+1},t_{i+1})$ uniformly at random from $H((\\alpha_{i},t_{i}))\\setminus \\{(\\alpha_{i},t_{i})\\}$.\n\n- Let $i=i+1$.\n\n- Return corner $(\\alpha_{n},i_{n})$.\n\nInterpret terms from the product in formula (\\[hw\\]) as probabilities of paths in the hook walk, ending in corner $\\gamma$, as follows:\n\n- Choose $(\\alpha_{1},i_{1})$ uniformly at random from $T$ (i.e. with probability 1/n).", "\n\n- Terms $(\\beta,i)$ in the first product whose contribution is $\\frac{1}{H_{\\beta,i}-1}$ correspond to cells where the walk makes “hook moves” towards $\\gamma$.\n\n- Terms $(\\beta,i)$ in the second product whose contribution is $\\frac{1}{H_{\\beta,i}-1}$ correspond to cells where the walk makes “vector moves” towards $\\gamma$.\n\nIndeed, consider a path $P:(\\alpha,i):= (\\alpha_{1},i_{1})\\rightarrow (\\alpha_{2},i_{2})\\rightarrow \\ldots \\rightarrow (\\alpha_{n},i_{n})=\\gamma$. Define its [*hook projection*]{} to be set $A=\\{\\alpha_{1},\\alpha_{2}, \\ldots, \\alpha_{n}\\}$ and its vector projection to be the set $B=\\{i_{1},i_{2},\\ldots, i_{n}\\}$.\n\nJust as in [@hook-walk], given set of words $A=\\{\\alpha_{1},\\ldots \\alpha_{m}\\}$, with $\\alpha_{1}=\\alpha$ and $\\alpha_{i}\\sqsubset \\alpha_{i+1}$ and set of integers $B=\\{i_{1},\\ldots, i_{r}\\}$ with $i_{1}=i$ and $i_{l}<i_{l+1}$, the probability $p(A,B)$ that the hook walk has the hook(vector) projections $A(B)$ (thus starting at $(\\alpha_{1}, i_{1})$) is $$P(A,B)\\leq \\prod_{\\beta \\in A, \\beta \\neq \\alpha_{m} } (1+\\frac{1}{H_{\\beta,i_{r}}-1})\\cdot \\prod_{i\\in B, i\\neq i_{r}} (1+\\frac{1}{H_{\\alpha_{m},i}-1})\n\\label{eq-pi}$$ Indeed, as in [@hook-walk] $$\\begin{aligned}\nP(A,B) & =\\frac{1}{H_{\\alpha_{1},i_{1}}-1} [ P(A-\\{\\alpha_{1}\\},B)+ P(A,B-\\{i_{1}\\})]\\leq \\nonumber\\\\ \n & \\leq \\frac{1}{H_{\\alpha_{1},i_{1}}-1} [(H_{\\alpha_{1},i_{r}}-1)+ (H_{\\alpha_{m},i_{1}}-1)]\\cdot (RHS)\n\\label{eq-p}\\end{aligned}$$ where $(RHS)$ is the right-hand side product in equation (\\[eq-pi\\]), and in the second row we used the inductive hypothesis.", "\n\nFor $k=1$, in [@hook-walk] we would use an equality of type $H_{\\alpha_{1},i_{1}}-1=(H_{\\alpha_{1},i_{r}}-1)+ (H_{\\alpha_{m},i_{1}}-1)$. For $k\\geq 2$ such an equality is no longer true, and we only have inequality $$H_{\\alpha_{1},i_{1}}-1 \\geq (H_{\\alpha_{1},i_{r}}-1)+ (H_{\\alpha_{m},i_{1}}-1)\n\\label{just-ineq}$$ leading to a proof of equation (\\[eq-pi\\]).", "\n\nTo justify inequality (\\[just-ineq\\]), note that, by property (b) of heap tableaux, since $\\alpha_{1}\\sqsubset \\alpha_{m}$, $$|Vec(\\alpha_{m},i_{1})|\\leq |Vec(\\alpha_{1},i_{1})|\n\\label{eq-vec}$$ On the other hand $$|Heap(\\alpha_{1},i_{1})|\\geq |Heap(\\alpha_{1},i_{r})|+(|Heap(\\alpha_{m},i_{1})|-1).", "\n\\label{eq-heap}$$ This is true by monotonicity property (c) of heap tableaux: every path present in the heap $H_{r}$ rooted at $(\\alpha_{1},i_{r})$ is also present in the heap $H_{1}$ rooted at $(\\alpha_{1},i_{1})$. Heap $H_{r}$ is empty below node $\\gamma=(\\alpha_{m},i_{r})$, but $H_{1}$ contains the subheap rooted at $(\\alpha_{1},i_{r})$ (of size $|Heap(\\alpha_{1},i_{r})|-1)$ [*any maybe some other subheaps,*]{} rooted at nodes $w\\in H_{1}$ whose correspondent in $H_{r}$ has no descendents. ", "Summing up equations (\\[eq-vec\\]) and (\\[eq-heap\\]) we get our desired inequality (\\[just-ineq\\]). ", "Example in Figure  \\[youngContraexemplu\\] shows that inequality  (\\[just-ineq\\]) can be strict: The hook length of $H_{1,\\lambda}-1 = 7$ but $H_{2,\\lambda}-1=2-1$ and $H_{1,0}-1=2-1$. The reason is that the grayed cells are not counted in the hook of $(1,0)$, but they belong to the hook of $(1,\\lambda)$.\n\n$$\\gyoung(::\\lambda:0:1:<00>:<1^2>:<\\cdots>:<1^3>:<\\cdots>:<1^4>:<\\cdots>:<1^5>,:1;8!{!\\Yfillcolor{blue!50}}2!{!\\Yfillcolor{white}}!{!\\Yfillcolor{gray!50}}5!{!\\Yfillcolor{white}};<\\perp>!{!\\Yfillcolor{gray!50}}4!{!\\Yfillcolor{white}};<\\perp>!{!\\Yfillcolor{gray!50}}3!{!\\Yfillcolor{white}};<\\perp>!{!\\Yfillcolor{gray!50}}2!{!\\Yfillcolor{white}};<\\perp>!{!\\Yfillcolor{gray!50}}1!{!\\Yfillcolor{white}},:2!{!\\Yfillcolor{blue!50}}2!{!\\Yfillcolor{white}};1)\n$$\n\nFinally, adding up suitable inequalities (\\[eq-pi\\]) we infer that $s_{\\gamma}$, the probability that the walk ends up at $\\gamma$, equal to $$s_{\\gamma}=\\frac{1}{n}\\sum p(A,B)$$ (the sum being over all suitable sets $A,B$) is less or equal than the expansion (\\[hw\\]) of $\\frac{F_{T_{\\gamma}}}{F_{T}}$. Since the sum of probabilities adds up to 1, inequality (\\[fin\\]) follows.", "\n\n\\(A) at (3,1) [(;&lt;15&gt;;2;1)]{}; (B) at (1,0) [(;4)]{}; (C) at (3,0) [(;4)]{}; (D) at (5,-0) [(;4)]{};\n\n\\(E) at (0.4,-1) [(;1)]{}; (F) at (1,-1) [(;1)]{}; (G) at (1.6,-1) [(;1)]{};\n\n\\(H) at (2.4,-1) [(;1)]{}; (I) at (3,-1) [(;1)]{}; (J) at (3.6,-1) [(;1)]{};\n\n\\(K) at (4.4,-1) [(;1)]{}; (L) at (5,-1) [(;1)]{}; (M) at (5.6,-1) [(;1)]{}; (A.south) – (B.north); (A.south) – (C.north); (A.south) – (D.north);\n\n(B.south) – (E.north); (B.south) – (F.north); (B.south) – (G.north);\n\n(C.south) – (H.north); (C.south) – (I.north); (C.south) – (J.north);\n\n(D.south) – (K.north); (D.south) – (L.north); (D.south) – (M.north);\n\n\\(A) at (4,1.5) [(;8;2)]{}; (B) at (3,0.5) [(;2;1)]{}; (C) at (5,0.5) [(;5)]{}; (D) at (5.5,-0.5) [(;4)]{}; (E) at (6,-1.5) [(;3)]{}; (F) at (6.5,-2.5) [(;2)]{}; (G) at (7,-3.5) [(;1)]{}; (A.west) – (B.north); (A.east) – (C.west); (C.south) – (D.west); (D.south) – (E.west); (E.south) – (F.west); (F.south) – (G.west);\n\nLet us now deal with examples/counterexamples.", "\n\nFirst we present a set of arbitrarily large heap tableaux, different from both heap-ordered trees and Young tableaux, for which the hook inequality is tight: for $r\\geq 2, k\\geq 1$ consider heap table $T_{r,k}$ (Fig.", " \\[hookex\\](a)) to have $n=S_{k,r}+k-1$ nodes, distributed in a complete $k$-ary tree $H_{1}$ with $r$ levels $0,1,\\ldots r-1$ and $S_{k,r}$ nodes, and then $k-1$ one-element heaps $H_{2},\\ldots, H_{k}$. We employ notation $$S_{k,l}=1+k+\\ldots + k^{l-1}=\\frac{k^{l}-1}{k-1}$$ The number of ways to fill up such a heap tableau is ${{n-1}\\choose {k-1}}\\cdot N_{k,r}$, where $N_{k,r}$ is the number of ways to fill up a complete $k$-ary tree with $r$ levels. ", "$$N_{k,r}=\\frac{S_{k,r}!}{\\prod_{i=0}^{r-1} (S_{k,r-i})^{k^{i}}}$$ This happens because for every subset $A$ of $\\{2,\\ldots ,n\\}$ of cardinality $k-1$, element 1 together with those not in $A$ can be distributed in $H_{1}$ in $N_{k,r}$ ways.", "\n\nPutting all things together, the total number of fillings of $T_{r,k}$ is $$\\frac{(S_{k,r}+k-2)!\\cdot (S_{k,r})!}{(k-1)!\\cdot (S_{k,r}-1)!\\cdot S_{k,r}\\cdot \\prod_{i=1}^{r-1} (S_{k,r-i})^{k^{i}}}= \\frac{(n-1)!}{(k-1)!\\cdot \\prod_{i=1}^{r-1} (S_{k,r-i})^{k^{i}}}$$\n\nHook lengths are $1,2,\\ldots, k-1$ (for the nodes in the one-element heaps), $(S_{k,r-i})^{k^{i}}$ (for the non-root nodes in $H_{1}$) and $n$ (for the root node of $H_{1}$). ", "The resulting formula\n\n$$\\frac{n!}{(k-1)!\\cdot n\\cdot \\prod_{i=1}^{r-1} (S_{k,r-i})^{k^{i}}}= \\frac{(n-1)!}{(k-1)!\\cdot \\prod_{i=1}^{r-1} (S_{k,r-i})^{k^{i}}}$$\n\nis the same as the total number computed above.", "\n\nNow for the counterexamples: consider heap tableaux $W_{r}$ (Fig.", " \\[hookex\\](b), identical to the heap tableau in Fig.", " \\[youngContraexemplu\\]) defined as follows: $W_{r}$ consists of two heaps, $H_{1}$ with cells with addresses $(1,\\lambda), (1,0)$, $(1,1),(1,11), \\ldots,$ $(1,1^{2r-3})$, and $H_{2}$ with cells with addresses $(2,\\lambda),(2,0)$. $W_{r}$ has $n=2r+1$ nodes.", "\n\nHook values of cells in $H_{1}$ are $2r,2,2r-3,2r-4, \\ldots, 1$. Hook values of cells in $H_{2}$ are $2,1$, respectively. ", "Thus the hook formula predicts $$\\frac{(2r+1)!}{2\\cdot 2\\cdot 2r \\cdot (2r-3)\\cdot (2r-4)\\cdot \\ldots \\cdot 1}=\\frac{(2r+1)(2r-1)(2r-2)}{4}$$ ways to fill up the table. ", "If $r$ is even then the number above is [**not**]{} an integer, so the hook formula cannot be exact for these tableaux.", "\n\nProof of Theorem \\[sch-heap\\]\n-----------------------------\n\nWe prove that inserting a single integer element $x$ into a heap tableau $T$ results in another heap tableau $T\\leftarrow x$. Therefore inserting a permutation $X$ will result in a heap tableau.", "\n\nBy construction, when an element is appended to a vector, the vector remains increasing. ", "Also, if an element $y$ bumps another element $z$ from a vector $V$ (presumed nondecreasing) then $z$ is the smallest such element in $V$ greater than $y$. Thus, replacing $z$ by $y$ preserves the nondecreasing nature of the vector $V$.\n\nAll we need to verify is that min-heap invariant (b) (initially true for the one-element heap tableau) also remains true when inserting a new element $x$.\n\nThe case when $x$ is appended to $V_{\\lambda}$ is clear: since invariant (b) was true before inserting $x$ for every address $r$ we have $|V_{\\lambda}|\\geq |V_r|.$ See the example above when we append $x=9.$ Thus what we are doing, in effect, by appending $x$ to $V_{\\lambda}$ is start a new heap.", "\n\nSuppose instead that inserting $x$ bumps element $x_{1}$ from $V_{\\lambda}$. Necessarily $x<x_{1}$. Suppose $i$ is the position of $x_{1}$ in $V_{\\lambda}$, that is $x_{1}$ was the root of heap $H_{i}$. By reducing the value of the root, the heap $H_{i}$ still verifies the min-heap invariant. ", "Now suppose $x_{1}$ bumps element $x_{2}$. We claim that $x_{2}$ has rank at most $i$ in its vector. ", "Indeed, the element with rank $i$ in the vector of $x_{2}$ was larger than $x_{1}$ (by the min-heap property of $H_{i}$). ", "So $x_{2}$ must have had rank at most $i$. Let $j$ be this rank.", "\n\n\\(A) at (4,2) [(:::::&lt;x&gt;::::,;;;;&lt;&gt;![!]{}&lt;x\\_1&gt;![!]{};&lt;&gt;;,:::::&lt;i&gt;::::)]{}; (B) at (2,0) [(:::&lt;x\\_1&gt;:::,;;&lt;&gt;![!]{}&lt;x\\_2&gt;![!]{};&lt;&gt;;;,:::&lt;j&gt;::&lt;i&gt;::)]{}; (C) at (6,0.4) [(:)]{}; (D) at (1,-1.3) [(:)]{}; (E) at (3,-1.5) [(::,::)]{}; (F) at (2,-3) [(:::&lt;x\\_[n]{}&gt;:::,;;&lt;&gt;![!]{}&lt;x\\_n&gt;,:::&lt;s&gt;)]{}; (G) at (4,-2.5) [(:)]{};\n\n(A.south) – (B.north); (A.south) – (C.north); (B.south) – (D.north); (B.south) – (E.north); (E.south) – (F.north); (E.south) – (G.north);\n\nSince $x_{1}<x_{2}$, by replacing $x_{2}$ by $x_{1}$ the min-heap property is satisfied “below $x_{2}/x_{1}$”. ", "It is satisfied “above $x_{2}$” as well, since the parent of $x_{2}$ either was (and still is) the root of $H_{j}$, a number less or equal to $x_{1}$ (in case $j<i$) or is $x$ (in case the rank of $x_{2}$ is exactly $i$).", "\n\nIf $x_{2}$ bumps $x_{3},\\ldots, $ etc we repeat the argument above on the corresponding sub-min-heap tableau.", "\n\nSuppose, finally, that element $x_{n}$, bumped from $V_{\\alpha}$ by $x_{n-1}$, is appended to vector $V_{\\beta}$. Let $s$ be the index of $x_{n}$ in $V_{\\beta}$. We claim that $|V_{\\alpha}|\\geq s$.\n\nIndeed, $x_{n}$ is larger than the first $s-1$ elements of $|V_{\\beta}|$. By the min-heap property, it is also larger than the initial $s-1$ elements of $|V_{\\alpha}|$ as well. ", "So its index in $V_{\\alpha}$ before getting bumped could not have been less than $s$. That means that appending $x_n$ does not violate the min-heap invariant (b).", "\n\nAlso, let $\\gamma$ be the address of a sibling of $\\beta$, to its left. ", "We need to show that the element $z$ with index $i$ in $V_{\\gamma}$ is larger or equal to $x_{n}$.\n\nIndeed, either $x_{n}$ had index $i$ in $V_{\\alpha}$ before getting bumped (thus $x_{n}<z$ by the heap property)\n\nProof of Theorem \\[sch-heap\\]\n-----------------------------\n\nWe prove that inserting a single element $x$ into a heap tableau $T$ results in another heap tableau $T\\leftarrow x$.\n\nHeap property (b). ", "is easy to verify: if element $x$ is inserted into a free slot of heap $H_{1},$ the slot value is at most $x$. Hence, by inserting $x$ the heap property continues to hold. ", "Alternatively, if $x$ bumps some element $y$, the bumped element was larger than $x$ (and so were its children), but sat in a slot of value $\\leq x$. Therefore replacing it by $x$ preserves heap property. ", "The argument extends to (elements inserted in or bumped from) heaps $H_{r}$, $1\\leq r\\leq m$.\n\nThus we only need to prove property (c), that is that row vectors are increasing as well after insertion/bumping.", "\n\nSuppose $x$ bumps element $y$ in heap $H_{1}$. Then $x<y$. $x$ is now at the head of its vector list, and since the list was increasing before (with $y$ as its first element), it is increasing now.", "\n\nSuppose now, recursively, that some element $a$ bumps element $b$ with address $w$ in heap $H_r$, $r\\geq 1$. We have to show that $b$’s insertion (or bumping of another element) preserves the increasing nature of the list.", "\n\nClearly $b>a$. $b$ will either get inserted into $H_{r+1}$ or bump another element $c\\in H_{r+1}$.\n\nIn the first case the place where $b$ gets inserted was free in the vector list. ", "The element $z$ to the left of this place was a forefather of $b$ before this latter element being bumped by $a$. By the heap property $z\\leq b$, so insertion creates an increasing list.", "\n\nSuppose instead $b$ bumps another element $c\\in H_{r+1}$. By the algorithm Schensted-HEAP and the induction assumption, when it does so $b$ will sit immediately to the right of an element $z\\in H_{r}$ that used to be an ancestor of $b$ in $H_{r}$. Therefore the row of $z,b$ is increasing up to the inserted element $b$. On the other hand $b<c$, so the row of $b$ is now monotonically increasing after $b$ as well.", "\n\nProof of Theorem \\[rs-heap\\]\n----------------------------\n\nGiven permutation $\\sigma\\in S_{n}$, denote by $P_{\\sigma}$ the heap table obtained by applying the Schensted-HEAP$_{k}$ algorithm.", "\n\nDefine a second heap table $Q_{\\sigma}$ as follows: whenever we insert $\\sigma(i)$ into $P$, we record the resulting sequence of bounces and [**insert i at the last place involved in the bounces.**]{}", "\n\nLet $k=2$ and consider the permutation $\\sigma=\\begin{pmatrix}\n1 & 2 & 3 & 4 & 5 & 6 \\\\\n4 & 2 & 6 & 3 & 5 & 1 \n\\end{pmatrix}.$ The two corresponding heap tableaux are constructed below. ", "For drawing convenience, during the insertion process they are not displayed in the heap-like form, but rather in the more compact Young-table equivalent format. ", "The resulting heap-tableaux are displayed in Figure \\[rs-result\\].", "\n\n $\\leftarrow$ 4 $\\leftarrow$ 2 $\\leftarrow$ 6 $\\leftarrow$ 3 $\\leftarrow$ 5 $\\leftarrow$ 1\n --------------- ---------------------------------------------------- -------------------------------------------------------- ------------------------------------------------------------ --------------------------------------------------------------- -------------------------------------------------------------------- ----------------------------------------------------------------------------------------------------------------------------------------------\n $P_{\\sigma}$: $\\gyoung(::\\lambda,:1!{!\\Yfillcolor{gray!50}}<4>)$ $\\gyoung(::\\lambda:0,:1!{!\\Yfillcolor{gray!50}}<2>;4)$ $\\gyoung(::\\lambda:0,:1;2<4>,:2!{!\\Yfillcolor{gray!50}}6)$ $\\gyoung(::\\lambda:0,:1;2;4,:2!{!\\Yfillcolor{gray!50}}<3>;6)$ $\\gyoung(::\\lambda:0,:1;2;4,:2;3;6,:3!{!\\Yfillcolor{gray!50}}<5>)$ $\\gyoung(::\\lambda:0:1:,:1!{!\\Yfillcolor{gray!50}}<1>!{!\\Yfillcolor{white}};4!{!\\Yfillcolor{gray!50}}<2>!{!\\Yfillcolor{white}},:2;3;6,:3;5)$\n $Q_{\\sigma}$: $\\gyoung(::\\lambda,:1!{!\\Yfillcolor{gray!50}}<1>)$ $\\gyoung(::\\lambda:0,:1!{!\\Yfillcolor{gray!50}}<1>;2)$ $\\gyoung(::\\lambda:0,:1;1<2>,:2!{!\\Yfillcolor{gray!50}}3)$ $\\gyoung(::\\lambda:0,:1;1;2,:2!{!\\Yfillcolor{gray!50}}<3>;4)$ $\\gyoung(::\\lambda:0,:1;1;2,:2;3;4,:3!{!\\Yfillcolor{gray!50}}<5>)$ $\\gyoung(::\\lambda:0:1:,:1!{!\\Yfillcolor{gray!50}}<1>!{!\\Yfillcolor{white}};2!{!\\Yfillcolor{gray!50}}<6>!{!\\Yfillcolor{white}},:2;3;4,:3;5)$\n\n\\(A) at (4,0) [(1;3;5)]{}; (B) at (2,-1) [(4;6)]{}; (C) at (6,-1) [(2)]{}; (A.south) – (B.north); (A.south) – (C.north);\n\n\\(A) at (4,0) [(1;3;5)]{}; (B) at (2,-1) [(2;4)]{}; (C) at (6,-1) [(6)]{}; (A.south) – (B.north); (A.south) – (C.north);\n\n(1;3;5,2;6,4)\n\n(1;3;5,2;4,6)\n\nThere are two things to prove about the algorithm outlined above:\n\n- For every permutation $\\sigma$, $Q_{\\sigma}$ is a heap tableau of the same shape as heap tableau $P_{\\sigma}$. Moreover,\n\n $Q_{\\sigma}$ is a heap tableau in standard form.", "\n\n- One can uniquely identify permutation $\\sigma$ from the pair $(P_{\\sigma},Q_{\\sigma})$.\n\n<!-- --", ">\n\n- The fact that the shape is the same is easy: whenever number $\\sigma(i)$ is inserted into $P_{\\sigma}$, this table changes by exactly one (filled) position. ", "When $i$ is inserted into $Q_{\\sigma}$, the position on which it is inserted is the unique position that was added to $P_{\\sigma}$: the position of the final insertion after a (perhaps empty) sequence of bumps. ", "Therefore the two heap tableaux have the same shape throughout the process, and at the end of it.", "\n\n Let us show now that $Q_{\\sigma}$ is a heap tableau. ", "We will show that invariants (b),(c). ", "remain true throughout the insertion process.", "\n\n They are, indeed, true at the beginning when $Q_{\\sigma}=[1]$. Proving the heap invariant (b). ", "is easy: numbers are inserted into $Q_{\\sigma}$ in the order $1,2,\\ldots, n$. Each number is, therefore, larger than any number that is an ancestor in its heap. ", "As each number $i$ is inserted as a leaf in its corresponding heap, all heap conditions are still true after its insertion.", "\n\n The vector invariant (c). ", "is equally easy: number $i$ is appended to an old vector or starts a new one. ", "The second case is trivial. ", "In the first one $i$ is the largest number inserted so far into $Q_{\\sigma}$, therefore the largest in its vector.", "\n\n Finally, the fact that $Q_{\\sigma}$ is a standard tableau follows from the Algorithm: Schensted-HEAP$_{k}$ starts a new vector from the leftmost position available. ", "Therefore when it starts a new vector, its siblings to the left have acquired a smaller number, as they were already created before that point. ", "Also, when it starts a new vector, all the vectors on the level immediately above have been created (otherwise Schensted-HEAP$_{k}$ would have started a new vector there) and have, thus, acquired a smaller number.", "\n\n- This is essentially the same proof ideea as that of the Robinson-\\\n Schensted correspondence for ordinary Young tableaux: given heap tableaux $P,Q$ with the same shape we will recover the pairs $(n,\\sigma(n))$, $(n-1,\\sigma(n-1))$, $\\ldots, (1,\\sigma(1))$ in this backwards order by reversing the sequences of bumps. ", "We will work in the more general setting when $P$ contains $n$ distinct numbers, not necessarily those from $1$ to $n$. On the other hand, since $Q$ is standard, $Q$ will contain these numbers, each of them exactly once.", "\n\n The result is easily seen to be true for $n=1,n=2$. From now on we will assume that $n\\geq 3$ and reason inductively.", "\n\n Suppose $n$ is in vector $V_{\\lambda}$ of $Q_{\\sigma}$. Then the insertion of $\\sigma(n)$ into $P_{\\sigma}$ did not provoke any bumps. ", "$\\sigma(n)$ is the integer in vector $V_{\\lambda}$ of $P_{\\sigma}$ sitting in the same position as $n$ does in $Q_{\\sigma}$. Suppose, on the other hand, that $n$ is in a different vector of $Q_{\\sigma}$. Then $n$ is the outcome of a series of bumps, caused by the insertion of $\\sigma(n)$.\n\n Let $x$ be the integer in $P_{\\sigma}$ sitting at the same position as $n$ in $Q_{\\sigma}$. Then $x$ must have been bumped from the parent vector in the heap-table by some $y$. $y$ is uniquely identified, as the largest element smaller than $x$ in that vector. ", "There must exist a smaller element in that vector by the heap invariant, so $y$ is well-defined. ", "Now $y$ must have been in turn bumped by some $z$ in the parent vector. ", "We identify $z$ going upwards, until we reach vector $V_{\\lambda}$, identifying element $\\sigma(n)$.\n\n Consider, for example the case of $n=6$ in Figure \\[rs-result\\]. ", "Element $2$ in $P_{\\sigma}$ (sitting in the corresponding position) must have been bumped by 1 in the top row. ", "Therefore $\\sigma(6)=1$.\n\n Now we delete $\\sigma(i),i$ from the two heap tableaux and proceed inductively, until we are left with two tables with one element, identifying permutation $\\sigma$ this way.", "\n\n What allows us to employ the induction hypothesis is the following\n\n Removing the largest element $n$ from a standard heap tableau $T$ yields another standard heap tableau. ", "\\[red\\]\n\n Suppose $n$ is in a vector of length at least two. ", "Clearly, by removing $n$ all the vectors in the heap remain the same, so the resulting table is standard.", "\n\n Suppose, therefore, that $n$ is the only element in a vector $V_{\\beta}$ of $T$, $\\beta=zb$, $b\\in \\Sigma_{k}$. Since $T$ was standard, all the left sibling vectors $V_{za}$ of $V$ ($a\\in \\Sigma_{k}, a<b$) are nonempty, and all the vectors on previous levels of $T$ are nonempty.", "\n\n Removing $V$ preserves these properties (its leftmost sibling becomes the last vector, or the level disappears completely).", "\n\n Completing the proof of Lemma \\[red\\] also completes the proof of Theorem \\[rs-heap\\].", "\n\n[^1]: Dept. ", "of Computer Science, West University of Timişoara, Timişoara, Romania. ", "and e-Austria Research Institute, Bd. ", "V. Pârvan 4, cam. ", "045 B, Timişoara, RO-300223, Romania. ", "Corresponding author’s email: [gabrielistrate@acm.org ]{}\n\n[^2]: clearly $\\gamma=1$ and the limit is zero, but we won’t be using this value in the sequel\n" ]

{ "pile_set_name": "ArXiv" }

[ 0, 0.007874015748031496, 0.005988023952095809, 0.003067484662576687, 0.009345794392523364, 0, 0.013888888888888888, 0.007936507936507936, 0, 0, 0, 0, 0.007782101167315175, 0, 0, 0, 0.014492753623188406, 0.01893939393939394, 0.004702194357366771, 0, 0.004098360655737705, 0.0040650406504065045, 0, 0.002840909090909091, 0, 0.007633587786259542, 0, 0.0064516129032258064, 0, 0.007575757575757576, 0.006289308176100629, 0, 0, 0, 0, 0, 0, 0.027777777777777776, 0, 0.0024271844660194173, 0.005758157389635317, 0, 0, 0, 0, 0.0017079419299743809, 0, 0, 0.011627906976744186, 0, 0.013513513513513514, 0, 0, 0.008620689655172414, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.011627906976744186, 0, 0.013513513513513514, 0, 0, 0.007518796992481203, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.01, 0, 0, 0, 0, 0.00819672131147541, 0.018018018018018018, 0.0038022813688212928, 0, 0.0034602076124567475, 0, 0, 0, 0.05, 0.0017699115044247787, 0, 0, 0.008771929824561403, 0, 0, 0.004246284501061571, 0, 0.0011185682326621924, 0, 0, 0, 0, 0.0196078431372549, 0, 0, 0, 0.007832898172323759, 0, 0.013333333333333334, 0.0033613445378151263, 0.015625, 0, 0.004, 0.01818181818181818, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.01639344262295082, 0.017543859649122806, 0, 0, 0, 0, 0, 0, 0, 0.005263157894736842, 0, 0, 0.010638297872340425, 0.008620689655172414, 0, 0, 0.017094017094017096, 0, 0.008146639511201629, 0.0013812154696132596, 0, 0.018867924528301886, 0, 0.1, 0, 0, 0, 0, 0, 0, 0.003289473684210526, 0.007246376811594203, 0, 0.01, 0.015873015873015872, 0.0273972602739726, 0, 0, 0.008403361344537815, 0.012048192771084338, 0.0055248618784530384, 0, 0, 0, 0, 0, 0, 0.027777777777777776, 0, 0, 0.017543859649122806, 0, 0, 0.024096385542168676, 0.017241379310344827, 0, 0.03333333333333333, 0, 0.0425531914893617, 0.14285714285714285, 0.037037037037037035, 0.023255813953488372, 0, 0.02857142857142857, 0, 0, 0.047619047619047616, 0, 0, 0, 0, 0, 0, 0.014492753623188406, 0, 0.014705882352941176, 0, 0, 0, 0, 0.030303030303030304, 0.047619047619047616, 0.02857142857142857, 0, 0, 0, 0.01818181818181818, 0, 0, 0.05, 0, 0, 0, 0, 0.030303030303030304, 0, 0.14285714285714285, 0.034482758620689655, 0.05555555555555555, 0.08333333333333333, 0.05263157894736842, 0, 0.037037037037037035, 0.022988505747126436, 0, 0.0031007751937984496, 0.002331002331002331, 0, 0, 0.0005672149744753262, 0.0007087172218284905, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.005504587155963303, 0, 0, 0.009584664536741214, 0.017509727626459144, 0, 0.0068792995622263915, 0.00554016620498615, 0.006666666666666667, 0, 0.020202020202020204, 0.0008764241893076249, 0.005055611729019211, 0.013761467889908258, 0.0021929824561403508, 0, 0.0022624434389140274, 0.004784688995215311, 0.014925373134328358, 0.018867924528301886, 0, 0, 0.005917159763313609, 0, 0.0038910505836575876, 0, 0, 0, 0, 0, 0, 0.006069802731411229, 0, 0, 0.0026455026455026454, 0, 0, 0.002421307506053269, 0, 0.004878048780487805, 0, 0, 0, 0, 0, 0, 0.010416666666666666, 0, 0.005319148936170213, 0, 0, 0.0004317789291882556, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.004694835680751174, 0.006134969325153374, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.021739130434782608, 0, 0.028169014084507043, 0, 0.05555555555555555, 0, 0.006493506493506494 ]

[ { "analysis_explanation": null, "end": 64281, "entity_type": "EMAIL_ADDRESS", "recognition_metadata": { "recognizer_identifier": "EmailRecognizer_139620637004368", "recognizer_name": "EmailRecognizer" }, "score": 1, "start": 64259 }, { "analysis_explanation": null, "end": 830, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 815 }, { "analysis_explanation": null, "end": 838, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 832 }, { "analysis_explanation": null, "end": 1352, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1348 }, { "analysis_explanation": null, "end": 1522, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1517 }, { "analysis_explanation": null, "end": 1687, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1669 }, { "analysis_explanation": null, "end": 2056, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2037 }, { "analysis_explanation": null, "end": 2279, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2276 }, { "analysis_explanation": null, "end": 3456, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3451 }, { "analysis_explanation": null, "end": 3522, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3515 }, { "analysis_explanation": null, "end": 4858, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4854 }, { "analysis_explanation": null, "end": 5142, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5125 }, { "analysis_explanation": null, "end": 5965, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5953 }, { "analysis_explanation": null, "end": 6300, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6297 }, { "analysis_explanation": null, "end": 6707, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6693 }, { "analysis_explanation": null, "end": 6999, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6993 }, { "analysis_explanation": null, "end": 7375, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7361 }, { "analysis_explanation": null, "end": 8915, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8901 }, { "analysis_explanation": null, "end": 9301, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9295 }, { "analysis_explanation": null, "end": 9975, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9968 }, { "analysis_explanation": null, "end": 10666, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10660 }, { "analysis_explanation": null, "end": 10745, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10739 }, { "analysis_explanation": null, "end": 13899, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13832 }, { "analysis_explanation": null, "end": 14638, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14560 }, { "analysis_explanation": null, "end": 14726, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14642 }, { "analysis_explanation": null, "end": 15065, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15002 }, { "analysis_explanation": null, "end": 15609, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15603 }, { "analysis_explanation": null, "end": 15793, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15785 }, { "analysis_explanation": null, "end": 16697, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16684 }, { "analysis_explanation": null, "end": 20851, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20848 }, { "analysis_explanation": null, "end": 21208, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21199 }, { "analysis_explanation": null, "end": 22245, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 22242 }, { "analysis_explanation": null, "end": 22575, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 22564 }, { "analysis_explanation": null, "end": 22750, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 22742 }, { "analysis_explanation": null, "end": 23242, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 23235 }, { "analysis_explanation": null, "end": 23899, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 23876 }, { "analysis_explanation": null, "end": 24160, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 24156 }, { "analysis_explanation": null, "end": 24608, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 24603 }, { "analysis_explanation": null, "end": 24633, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 24614 }, { "analysis_explanation": null, "end": 24748, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 24742 }, { "analysis_explanation": null, "end": 24784, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 24781 }, { "analysis_explanation": null, "end": 24841, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 24838 }, { "analysis_explanation": null, "end": 26350, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 26344 }, { "analysis_explanation": null, "end": 26375, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 26352 }, { "analysis_explanation": null, "end": 26680, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 26676 }, { "analysis_explanation": null, "end": 26784, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 26779 }, { "analysis_explanation": null, "end": 27649, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 27640 }, { "analysis_explanation": null, "end": 28228, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 28226 }, { "analysis_explanation": null, "end": 29280, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 29278 }, { "analysis_explanation": null, "end": 30276, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 30271 }, { "analysis_explanation": null, "end": 30499, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 30490 }, { "analysis_explanation": null, "end": 30514, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 30500 }, { "analysis_explanation": null, "end": 30643, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 30634 }, { "analysis_explanation": null, "end": 30659, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 30648 }, { "analysis_explanation": null, "end": 30762, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 30758 }, { "analysis_explanation": null, "end": 30773, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 30764 }, { "analysis_explanation": null, "end": 30789, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 30778 }, { "analysis_explanation": null, "end": 30916, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 30912 }, { "analysis_explanation": null, "end": 30930, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 30918 }, { "analysis_explanation": null, "end": 30950, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 30935 }, { "analysis_explanation": null, "end": 31008, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 31004 }, { "analysis_explanation": null, "end": 31018, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 31010 }, { "analysis_explanation": null, "end": 31031, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 31020 }, { "analysis_explanation": null, "end": 31048, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 31033 }, { "analysis_explanation": null, "end": 31063, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 31054 }, { "analysis_explanation": null, "end": 31152, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 31148 }, { "analysis_explanation": null, "end": 31163, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 31154 }, { "analysis_explanation": null, "end": 31174, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 31165 }, { "analysis_explanation": null, "end": 31184, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 31176 }, { "analysis_explanation": null, "end": 31201, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 31186 }, { "analysis_explanation": null, "end": 31211, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 31203 }, { "analysis_explanation": null, "end": 31233, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 31217 }, { "analysis_explanation": null, "end": 31278, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 31268 }, { "analysis_explanation": null, "end": 31314, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 31310 }, { "analysis_explanation": null, "end": 31324, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 31316 }, { "analysis_explanation": null, "end": 31342, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 31329 }, { "analysis_explanation": null, "end": 31371, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 31367 }, { "analysis_explanation": null, "end": 31409, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 31398 }, { "analysis_explanation": null, "end": 31426, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 31415 }, { "analysis_explanation": null, "end": 31442, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 31435 }, { "analysis_explanation": null, "end": 31454, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 31450 }, { "analysis_explanation": null, "end": 31472, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 31463 }, { "analysis_explanation": null, "end": 31489, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 31477 }, { "analysis_explanation": null, "end": 31502, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 31494 }, { "analysis_explanation": null, "end": 31538, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 31534 }, { "analysis_explanation": null, "end": 31567, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 31550 }, { "analysis_explanation": null, "end": 31581, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 31572 }, { "analysis_explanation": null, "end": 31677, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 31673 }, { "analysis_explanation": null, "end": 31696, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 31679 }, { "analysis_explanation": null, "end": 31777, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 31773 }, { "analysis_explanation": null, "end": 31795, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 31779 }, { "analysis_explanation": null, "end": 31959, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 31955 }, { "analysis_explanation": null, "end": 31970, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 31961 }, { "analysis_explanation": null, "end": 32040, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 32036 }, { "analysis_explanation": null, "end": 32056, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 32042 }, { "analysis_explanation": null, "end": 32135, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 32131 }, { "analysis_explanation": null, "end": 32156, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 32146 }, { "analysis_explanation": null, "end": 32171, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 32161 }, { "analysis_explanation": null, "end": 32206, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 32202 }, { "analysis_explanation": null, "end": 32299, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 32285 }, { "analysis_explanation": null, "end": 32305, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 32301 }, { "analysis_explanation": null, "end": 32321, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 32307 }, { "analysis_explanation": null, "end": 32338, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 32326 }, { "analysis_explanation": null, "end": 32397, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 32393 }, { "analysis_explanation": null, "end": 32409, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 32404 }, { "analysis_explanation": null, "end": 32418, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 32414 }, { "analysis_explanation": null, "end": 32424, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 32419 }, { "analysis_explanation": null, "end": 32500, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 32481 }, { "analysis_explanation": null, "end": 32555, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 32551 }, { "analysis_explanation": null, "end": 32575, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 32557 }, { "analysis_explanation": null, "end": 32631, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 32627 }, { "analysis_explanation": null, "end": 32649, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 32641 }, { "analysis_explanation": null, "end": 32685, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 32681 }, { "analysis_explanation": null, "end": 32699, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 32687 }, { "analysis_explanation": null, "end": 32720, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 32708 }, { "analysis_explanation": null, "end": 32726, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 32722 }, { "analysis_explanation": null, "end": 32753, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 32738 }, { "analysis_explanation": null, "end": 32765, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 32761 }, { "analysis_explanation": null, "end": 32778, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 32767 }, { "analysis_explanation": null, "end": 32788, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 32784 }, { "analysis_explanation": null, "end": 32813, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 32805 }, { "analysis_explanation": null, "end": 32840, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 32830 }, { "analysis_explanation": null, "end": 33419, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 33414 }, { "analysis_explanation": null, "end": 33518, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 33506 }, { "analysis_explanation": null, "end": 33547, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 33537 }, { "analysis_explanation": null, "end": 33966, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 33942 }, { "analysis_explanation": null, "end": 34321, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 34309 }, { "analysis_explanation": null, "end": 34698, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 34692 }, { "analysis_explanation": null, "end": 35674, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 35649 }, { "analysis_explanation": null, "end": 35745, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 35739 }, { "analysis_explanation": null, "end": 36677, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 36662 }, { "analysis_explanation": null, "end": 37393, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 37356 }, { "analysis_explanation": null, "end": 39139, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 39133 }, { "analysis_explanation": null, "end": 39735, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 39711 }, { "analysis_explanation": null, "end": 40512, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 40502 }, { "analysis_explanation": null, "end": 41296, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 41277 }, { "analysis_explanation": null, "end": 41871, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 41859 }, { "analysis_explanation": null, "end": 42688, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 42676 }, { "analysis_explanation": null, "end": 42704, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 42695 }, { "analysis_explanation": null, "end": 43068, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 43050 }, { "analysis_explanation": null, "end": 44070, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 44057 }, { "analysis_explanation": null, "end": 44397, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 44394 }, { "analysis_explanation": null, "end": 44401, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 44398 }, { "analysis_explanation": null, "end": 44657, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 44628 }, { "analysis_explanation": null, "end": 45234, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 45209 }, { "analysis_explanation": null, "end": 46046, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 46039 }, { "analysis_explanation": null, "end": 46203, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 46192 }, { "analysis_explanation": null, "end": 48591, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 48586 }, { "analysis_explanation": null, "end": 48654, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 48653 }, { "analysis_explanation": null, "end": 48713, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 48701 }, { "analysis_explanation": null, "end": 48846, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 48837 }, { "analysis_explanation": null, "end": 48903, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 48896 }, { "analysis_explanation": null, "end": 49523, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 49506 }, { "analysis_explanation": null, "end": 50165, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 50162 }, { "analysis_explanation": null, "end": 51972, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 51965 }, { "analysis_explanation": null, "end": 52209, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 52202 }, { "analysis_explanation": null, "end": 53429, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 53422 }, { "analysis_explanation": null, "end": 53658, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 53652 }, { "analysis_explanation": null, "end": 54177, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 54171 }, { "analysis_explanation": null, "end": 55100, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 55093 }, { "analysis_explanation": null, "end": 58991, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 58988 }, { "analysis_explanation": null, "end": 59278, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 59266 }, { "analysis_explanation": null, "end": 61322, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 61317 }, { "analysis_explanation": null, "end": 61676, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 61674 }, { "analysis_explanation": null, "end": 61693, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 61691 }, { "analysis_explanation": null, "end": 64000, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 63988 }, { "analysis_explanation": null, "end": 64112, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 64103 }, { "analysis_explanation": null, "end": 64123, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 64114 }, { "analysis_explanation": null, "end": 64132, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 64125 }, { "analysis_explanation": null, "end": 64206, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 64197 }, { "analysis_explanation": null, "end": 64217, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 64208 }, { "analysis_explanation": null, "end": 64226, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 64219 }, { "analysis_explanation": null, "end": 27324, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 27320 }, { "analysis_explanation": null, "end": 27336, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 27332 }, { "analysis_explanation": null, "end": 27347, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 27343 }, { "analysis_explanation": null, "end": 27359, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 27355 }, { "analysis_explanation": null, "end": 27370, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 27366 }, { "analysis_explanation": null, "end": 27382, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 27378 }, { "analysis_explanation": null, "end": 28717, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 28713 }, { "analysis_explanation": null, "end": 28729, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 28725 }, { "analysis_explanation": null, "end": 28740, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 28736 }, { "analysis_explanation": null, "end": 28752, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 28748 }, { "analysis_explanation": null, "end": 28763, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 28759 }, { "analysis_explanation": null, "end": 28775, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 28771 }, { "analysis_explanation": null, "end": 29024, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 29020 }, { "analysis_explanation": null, "end": 29036, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 29032 }, { "analysis_explanation": null, "end": 29047, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 29043 }, { "analysis_explanation": null, "end": 29059, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 29055 }, { "analysis_explanation": null, "end": 29070, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 29066 }, { "analysis_explanation": null, "end": 29082, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 29078 }, { "analysis_explanation": null, "end": 29093, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 29089 }, { "analysis_explanation": null, "end": 29105, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 29101 }, { "analysis_explanation": null, "end": 47842, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 47838 }, { "analysis_explanation": null, "end": 47854, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 47850 }, { "analysis_explanation": null, "end": 47865, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 47861 }, { "analysis_explanation": null, "end": 47877, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 47873 }, { "analysis_explanation": null, "end": 47888, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 47884 }, { "analysis_explanation": null, "end": 47900, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 47896 }, { "analysis_explanation": null, "end": 47912, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 47908 }, { "analysis_explanation": null, "end": 47924, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 47920 }, { "analysis_explanation": null, "end": 47935, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 47931 }, { "analysis_explanation": null, "end": 47947, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 47943 }, { "analysis_explanation": null, "end": 47958, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 47954 }, { "analysis_explanation": null, "end": 47970, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 47966 }, { "analysis_explanation": null, "end": 47982, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 47978 }, { "analysis_explanation": null, "end": 47994, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 47990 }, { "analysis_explanation": null, "end": 48005, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 48001 }, { "analysis_explanation": null, "end": 48017, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 48013 }, { "analysis_explanation": null, "end": 48028, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 48024 }, { "analysis_explanation": null, "end": 48040, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 48036 }, { "analysis_explanation": null, "end": 48052, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 48048 }, { "analysis_explanation": null, "end": 48064, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 48060 }, { "analysis_explanation": null, "end": 48075, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 48071 }, { "analysis_explanation": null, "end": 48087, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 48083 }, { "analysis_explanation": null, "end": 48098, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 48094 }, { "analysis_explanation": null, "end": 48110, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 48106 }, { "analysis_explanation": null, "end": 48321, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 48317 }, { "analysis_explanation": null, "end": 48353, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 48349 }, { "analysis_explanation": null, "end": 48375, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 48371 }, { "analysis_explanation": null, "end": 48397, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 48393 }, { "analysis_explanation": null, "end": 48419, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 48415 }, { "analysis_explanation": null, "end": 52867, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 52863 }, { "analysis_explanation": null, "end": 52879, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 52875 }, { "analysis_explanation": null, "end": 52890, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 52886 }, { "analysis_explanation": null, "end": 52902, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 52898 }, { "analysis_explanation": null, "end": 52913, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 52909 }, { "analysis_explanation": null, "end": 52925, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 52921 }, { "analysis_explanation": null, "end": 52936, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 52932 }, { "analysis_explanation": null, "end": 52948, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 52944 }, { "analysis_explanation": null, "end": 52959, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 52955 }, { "analysis_explanation": null, "end": 52971, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 52967 }, { "analysis_explanation": null, "end": 52982, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 52978 }, { "analysis_explanation": null, "end": 52994, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 52990 }, { "analysis_explanation": null, "end": 58903, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 58899 }, { "analysis_explanation": null, "end": 58915, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 58911 }, { "analysis_explanation": null, "end": 58926, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 58922 }, { "analysis_explanation": null, "end": 58938, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 58934 }, { "analysis_explanation": null, "end": 59025, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 59021 }, { "analysis_explanation": null, "end": 59037, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 59033 }, { "analysis_explanation": null, "end": 59048, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 59044 }, { "analysis_explanation": null, "end": 59060, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 59056 }, { "analysis_explanation": null, "end": 64281, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 64274 }, { "analysis_explanation": null, "end": 31461, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 31457 }, { "analysis_explanation": null, "end": 27401, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.1, "start": 27399 }, { "analysis_explanation": null, "end": 27429, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.1, "start": 27427 }, { "analysis_explanation": null, "end": 27488, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.1, "start": 27486 }, { "analysis_explanation": null, "end": 27527, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.1, "start": 27525 }, { "analysis_explanation": null, "end": 27529, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.1, "start": 27527 }, { "analysis_explanation": null, "end": 27550, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.1, "start": 27548 }, { "analysis_explanation": null, "end": 27552, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.1, "start": 27550 }, { "analysis_explanation": null, "end": 27554, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.1, "start": 27552 }, { "analysis_explanation": null, "end": 46673, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.1, "start": 46671 }, { "analysis_explanation": null, "end": 52473, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.1, "start": 52471 }, { "analysis_explanation": null, "end": 52475, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.1, "start": 52473 }, { "analysis_explanation": null, "end": 52487, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.1, "start": 52485 }, { "analysis_explanation": null, "end": 52489, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.1, "start": 52487 }, { "analysis_explanation": null, "end": 52539, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.1, "start": 52537 }, { "analysis_explanation": null, "end": 52541, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.1, "start": 52539 }, { "analysis_explanation": null, "end": 52553, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.1, "start": 52551 }, { "analysis_explanation": null, "end": 52555, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.1, "start": 52553 }, { "analysis_explanation": null, "end": 52578, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.1, "start": 52576 }, { "analysis_explanation": null, "end": 52593, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.1, "start": 52591 }, { "analysis_explanation": null, "end": 52643, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.1, "start": 52641 }, { "analysis_explanation": null, "end": 52655, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.1, "start": 52653 }, { "analysis_explanation": null, "end": 52666, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.1, "start": 52664 }, { "analysis_explanation": null, "end": 52741, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.1, "start": 52739 }, { "analysis_explanation": null, "end": 52744, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.1, "start": 52742 }, { "analysis_explanation": null, "end": 52768, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.1, "start": 52766 }, { "analysis_explanation": null, "end": 52787, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.1, "start": 52785 }, { "analysis_explanation": null, "end": 52820, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.1, "start": 52818 }, { "analysis_explanation": null, "end": 57924, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.1, "start": 57922 }, { "analysis_explanation": null, "end": 57977, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.1, "start": 57975 }, { "analysis_explanation": null, "end": 58034, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.1, "start": 58032 }, { "analysis_explanation": null, "end": 58095, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.1, "start": 58093 }, { "analysis_explanation": null, "end": 58159, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.1, "start": 58157 }, { "analysis_explanation": null, "end": 58228, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.1, "start": 58226 }, { "analysis_explanation": null, "end": 58388, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.1, "start": 58386 }, { "analysis_explanation": null, "end": 58441, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.1, "start": 58439 }, { "analysis_explanation": null, "end": 58498, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.1, "start": 58496 }, { "analysis_explanation": null, "end": 58559, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.1, "start": 58557 }, { "analysis_explanation": null, "end": 58623, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.1, "start": 58621 }, { "analysis_explanation": null, "end": 58692, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.1, "start": 58690 }, { "analysis_explanation": null, "end": 64217, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 64211 } ]

[ "//\n// AdModel.m\n// PHPHub\n//\n// Created by Aufree on 10/19/15.", "\n// Copyright © 2015 ESTGroup. ", "All rights reserved.", "\n//\n\n#import \"AdModel.h\"\n#import \"LaunchScreenAdDBManager.h\"\n#import \"LaunchScreenAdEntity.h\"\n\n@implementation AdModel\n\n- (instancetype)init {\n self = [super init];\n if (self) {\n _api = [[AdApi alloc] init];\n }\n return self;\n}\n\n- (id)getAdvertsLaunchScreen:(BaseResultBlock)block {\n BaseResultBlock callback = ^(NSDictionary *data, NSError *error) {\n if (!", "error) {\n NSArray *adEntities = [data objectForKey:@\"entities\"];\n [self insertAdEntitiesToLocalDataBase:adEntities];\n }\n if (block) block(data, error);\n };\n \n return [_api getAdvertsLaunchScreen:callback];\n}\n\n- (void)insertAdEntitiesToLocalDataBase:(NSArray *)adEntities {\n [LaunchScreenAdDBManager eraseLaunchScreenAdData];\n \n if (adEntities.count > 0) {\n [[BaseDBManager sharedInstance].db beginTransaction];\n for (int i = 0; i < adEntities.count; i++) {\n LaunchScreenAdEntity *entity = [adEntities objectAtIndex:i];\n [LaunchScreenAdDBManager insertOnDuplicateUpdate:entity];\n }\n [[BaseDBManager sharedInstance].db commit];\n \n [self checkLaunchScreenAdImageHasCached:adEntities];\n }\n}\n\n- (void)checkLaunchScreenAdImageHasCached:(NSArray *)adEntities {\n for (int i = 0; i < adEntities.count; i++) {\n LaunchScreenAdEntity *launchScreenAdEntity = [adEntities objectAtIndex:i];\n NSString *screenImageUrl = IS_IPHONE_4_OR_LESS ? ", "launchScreenAdEntity.smallImage : launchScreenAdEntity.bigImage;\n NSString *imageWidth = [NSString stringWithFormat:@\"%.f\", SCREEN_WIDTH * 2];\n NSString *imageHeight = [NSString stringWithFormat:@\"%.f\", SCREEN_HEIGHT * 2];\n NSURL *imageLink = [BaseHelper qiniuImageCenter:screenImageUrl withWidth:imageWidth withHeight:imageHeight];\n BOOL imageIsCache = [SDWebImageManager.sharedManager cachedImageExistsForURL:imageLink];\n if (!", "imageIsCache) {\n [[[UIImageView alloc] init] sd_setImageWithURL:imageLink];\n }\n }\n}\n\n@end\n" ]

{ "pile_set_name": "Github" }

[ 0.015384615384615385, 0, 0, 0.007792207792207792, 0.0009398496240601503, 0.008620689655172414, 0.018018018018018018 ]

[ { "analysis_explanation": null, "end": 52, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 46 }, { "analysis_explanation": null, "end": 95, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 82 }, { "analysis_explanation": null, "end": 742, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 716 }, { "analysis_explanation": null, "end": 1590, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.85, "start": 1567 }, { "analysis_explanation": null, "end": 1624, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.85, "start": 1601 }, { "analysis_explanation": null, "end": 1906, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1885 }, { "analysis_explanation": null, "end": 1933, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1929 }, { "analysis_explanation": null, "end": 64, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.6, "start": 56 }, { "analysis_explanation": null, "end": 902, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 889 }, { "analysis_explanation": null, "end": 1016, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 1003 }, { "analysis_explanation": null, "end": 1415, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 1402 }, { "analysis_explanation": null, "end": 1970, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 1950 } ]

[ "New molecular markers for prostate tumor imaging: a study on 2-methylene substituted fatty acids as new AMACR inhibitors.", "\nThe development of prostate carcinoma is associated with alterations in fatty acid metabolism. ", "α-Methylacyl-CoA racemase (AMACR) is a peroxisomal and mitochondrial enzyme that catalyses interconversion between the (S)/(R)-isomers of a range of α-methylacyl-CoA thioesters. ", "AMACR is involved in the β-oxidation of the dietary branched-chain fatty acids and bile acid intermediates. ", "It is highly expressed in prostate (more than 95 %), colon (92 %), and breast cancers (44 %) but not in the respective normal or hyperplastic tissues. ", "Thus, targeting of AMACR could be a new strategy for molecular imaging and therapy of prostate and some other cancers. ", "Unlabeled 2-methylenacyl-CoA thioesters (12 a-c) were designed as AMACR binding ligands. ", "The thioesters were tested for their ability to inhibit the AMACR-mediated epimerization of (25R)-THC-CoA and were found to be strong AMACR inhibitors. ", "Radioiodinated (E)-(131) I-13-iodo-2-methylentridec-12-enoic acid ((131) I-7 c) demonstrated preferential retention in AMACR-positive prostate tumor cells (LNCaP, LNCaP C4-2wt and DU145) compared with both AMACR-knockout LNCaP C4-2 AMACR-siRNA and benign BPH1 prostate cell lines. ", "A significant protein-bound radioactive fraction with main bands at 47 (sum of molecular weights of AMACR plus 12 c), 70, and 75 kDa was detected in LNCaP C4-2 wt cells. ", "In contrast, only negligible amounts of protein-bound radioactivity were found in LNCaP C4-2 AMACR-siRNA cells." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.008264462809917356, 0, 0.0056179775280898875, 0.009259259259259259, 0, 0.008403361344537815, 0.011235955056179775, 0.013157894736842105, 0.010676156583629894, 0.011764705882352941, 0 ]

[ { "analysis_explanation": null, "end": 233, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 218 }, { "analysis_explanation": null, "end": 400, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 395 }, { "analysis_explanation": null, "end": 678, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 673 }, { "analysis_explanation": null, "end": 1273, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1269 }, { "analysis_explanation": null, "end": 1365, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1363 }, { "analysis_explanation": null, "end": 1400, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1395 }, { "analysis_explanation": null, "end": 1415, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1413 }, { "analysis_explanation": null, "end": 1185, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 1183 }, { "analysis_explanation": null, "end": 1199, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 1194 }, { "analysis_explanation": null, "end": 1243, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 1241 }, { "analysis_explanation": null, "end": 1452, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 1450 }, { "analysis_explanation": null, "end": 1555, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 1553 } ]

[ "---\nabstract: 'In this paper we introduce and study new notions of uniform recurrence in multidimensional words. ", "A $d$-dimensional word is called *uniformly recurrent* if for all $(s_1,\\ldots,s_d)\\in{\\mathbb{N}}^d$ there exists $n\\in{\\mathbb{N}}$ such that each block of size $(n,\\ldots,n)$ contains the prefix of size $(s_1,\\ldots,s_d)$. We are interested in a modification of this property. ", "Namely, we ask that for each rational direction $(q_1,\\ldots,q_d)$, each rectangular prefix occurs along this direction in positions $\\ell(q_1,\\ldots,q_d)$ with bounded gaps. ", "Such words are called *uniformly recurrent along all directions*. ", "We provide several constructions of multidimensional words satisfying this condition, and more generally, a series of four increasingly stronger conditions. ", "In particular, we study the uniform recurrence along directions of multidimentional rotation words and of fixed points of square morphisms.'", "\nauthor:\n- Émilie Charlier\n- Svetlana Puzynina\n- Élise Vandomme\ntitle: Recurrence along directions in multidimensional words\n---\n\nIntroduction\n============\n\nCombinatorics on words in one dimension is a well-studied field of theoretical computer science with its origins in the early 20th century. ", "The study of bidimensional words is less developed, even though many concepts and results are naturally extendable from the unidimensional case (see e.g.  [@Berthe--Vuillon--2000; @Cassaigne--1999; @Charlier--Karki--Rigo--2010; @Durand--Rigo--2013; @Labbe--2018; @Muchnik--2003; @Semenov--1977; @Vuillon--1998]). ", "However, some words problems become much more difficult in dimensions higher than one. ", "One of such questions is the connection between local complexity and periodicity. ", "In dimension one, the classical theorem of Morse and Hedlund states that if for some $n$ the number of distinct length-$n$ blocks of an infinite word is less than or equal to $n$, then the word is periodic. ", "In the bidimensional case a similar assertion is known as Nivat’s conjecture, and many efforts are made by scientists for checking this hypothesis [@Cyr--Kra--2015; @Kari--Szabados--2015; @Nivat]. ", "In this paper, we introduce and study new notions of multidimensional uniform recurrence.", "\n\nA first and natural attempt to generalize the notion of (simple) recurrence to the multidimensional setting quickly turns out to be rather unsatisfying. ", "Recall that an infinite word $w\\colon{\\mathbb{N}}\\to A$ (where $A$ is a finite alphabet) is said to be *recurrent* if each prefix occurs at least twice (and hence every factor occurs infinitely often). ", "A straightforward extension of this definition is to say that a bidimensional infinite word is recurrent whenever each rectangular prefix occurs at least twice (and hence every rectangular factor occurs infinitely often). ", "However, with such a definition of bidimensional recurrence, the following bidimensional infinite word is considered as recurrent, even though any column is not in the unidimensional sense of recurrence. ", "$$\\begin{matrix}\n \\vdots & \\vdots & \\vdots & \\vdots & \\\\\n 0 & 0 & 0 & 0 & \\cdots \\\\\n 0 & 0 & 0 & 0 & \\cdots \\\\\n 0 & 0 & 0 & 0 & \\cdots \\\\\n 1 & 1 & 1 & 1 & \\cdots\n \\end{matrix}$$\n\nIn order to avoid this kind of undesirable phenomenon, a common strengthening is to ask that every prefix occurs uniformly, see for example [@Berthe--Vuillon--2000; @Durand--Rigo--2013]. ", "In the present work, we investigate several notions of recurrence of multidimensional infinite words $w\\colon{\\mathbb{N}}^d\\to A$, generalizing the usual notion of uniform recurrence of unidimensional infinite words.", "\n\nThis paper is organized as follows. ", "In Section \\[sec:def\\], we define two new notions of uniform recurrence of multidimensional infinite words: the URD words and the SURD words. ", "We also make some first observations in the bidimensional setting. ", "In Section \\[sec:origin\\], we show that these two new notions of recurrence along directions do not depend on the choice of the origin. ", "This leads us to the definition of the even stronger notion of SSURDO words. ", "In Section \\[sec:gcd\\], we prove that all multidimensional words obtained by placing some uniformly recurrent word along every rational direction are URD. ", "In Section \\[sec:rotation\\], we show that all multidimensional rotation words are URD but not SURD. ", "Thus, the notion of SURD words is indeed stronger than that of URD words, justifying the introduced terminology. ", "In Section \\[sec:morphism\\], we study fixed points of multidimensional square morphisms. ", "In particular, we provide some infinite families of SURD words. ", "We provide a complete characterization of SURD bidimensional infinite words that are fixed points of square morphisms of size $2$. In Section \\[sec:construction\\], we show how to build uncountably many SURD bidimensional infinite words. ", "In particular, the family of bidimensional infinite words so-obtained contains uncountably many non-morphic SURD elements. ", "We end our study by discussing six open problems in Section \\[sec:perspectives\\], including potential links with return words and symbolic dynamical aspects.", "\n\nDefinitions and first observations {#sec:def}\n==================================\n\nHere and throughout the text, $A$ designates an arbitrary finite alphabet and $d$ is a positive integer. ", "For $m,n\\in{\\mathbb{N}}$, the notation $[\\![m,n]\\!]$ designates the interval of integers $\\{m,\\ldots,n\\}$ (which is considered empty for $n<m$). ", "We write $(s_1,\\ldots,s_d)\\le (t_1,\\ldots,t_d)$ (resp.", " $(s_1,\\ldots,s_d)< (t_1,\\ldots,t_d)$) if $s_i\\le t_i$ (resp.", " $s_i< t_i$) for each $i\\in[\\![1,d]\\!]$.\n\nA *$d$-dimensional infinite word* over $A$ is a map $w\\colon{\\mathbb{N}}^d\\to A$. ", "A *$d$-dimensional finite word* over $A$ is a map $w\\colon[\\![0,s_1-1]\\!]\\times \\cdots\\times [\\![0,s_d-1]\\!]\\to A$, for some $(s_1,\\ldots,s_d)\\in{\\mathbb{N}}^d$, which is called the *size* of $w$. A finite word $f$ of size $(s_1,\\ldots,s_d)$ is a *factor* of a $d$-dimensional infinite word $w$ if there exists $\\mathbf{p}\\in{\\mathbb{N}}^d$ such that for each $\\mathbf{i}\\in[\\![0,s_1-1]\\!]\\times \\cdots\\times [\\![0,s_d-1]\\!]$, we have $f(\\mathbf{i})=w(\\mathbf{p}+\\mathbf{i})$. In this case, we say that the factor $f$ occurs at *position* $\\mathbf{p}$ in $w$. Similarly, a *factor* of a $d$-dimensional finite word $w$ of size $(t_1,\\ldots,t_d)$ is a finite word $f$ of some size $(s_1,\\ldots,s_d)\\le(t_1,\\ldots,t_d)$ for which there exists $\\mathbf{p}\\in[\\![0,t_1-s_1]\\!]\\times \\cdots\\times [\\![0,t_d-s_d]\\!]$ such that for each $\\mathbf{i}\\in[\\![0,s_1-1]\\!]\\times \\cdots\\times [\\![0,s_d-1]\\!]$, we have $f(\\mathbf{i})=w(\\mathbf{p}+\\mathbf{i})$. In both cases (infinite and finite), if $\\mathbf{p}=(0,\\ldots,0)$ then the factor $f$ is said to be a *prefix* of $w$. In some places, for the sake of clarity, we will allow ourselves to write $w_\\mathbf{i}$ instead of $w(\\mathbf{i})$.\n\nIn general, a factor need not be rectangular, i.e. of the form $[\\![0,s_1-1]\\!]\\times \\cdots\\times [\\![0,s_d-1]\\!]$, but could be any polytope. ", "Indeed, any occurrence of any given polytope is contained in a larger rectangular factor. ", "If we are interested in bounding the gaps between occurrences of the polytope, then a bound on the gaps of the larger rectangular factor is sufficient. ", "So, without loss of generality we can restrict our attention to rectangular factors only.", "\n\nSometimes, multidimensional words are considered over $\\mathbb{Z}^d$, i.e. $w\\colon\\mathbb{Z}^d\\to A$. ", "Although in our considerations it is more natural to consider one-way infinite words, since for example we will make use of fixed points of morphisms, most of our results and notions can be straightforwardly extended to words over $\\mathbb{Z}^d$. For example, general relations between the considered notions hold in $\\mathbb{Z}^d$ (Figure \\[fig:links\\_recurrence\\]), as well as our results for rotation words (Section \\[sec:rotation\\]) and non-morphic SURD examples (Section \\[sec:construction\\]).", "\n\nThe following notion of uniform recurrence of multidimensional infinite words was studied by many authors, see for example [@Berthe--Vuillon--2000; @Durand--Rigo--2013].", "\n\nA $d$-dimensional infinite word $w$ is *uniformly recurrent* if for every prefix $p$ of $w$, there exists a positive integer $b$ such that every factor of $w$ of size $(b,\\ldots, b)$ contains $p$ as a factor.", "\n\nIn the previous definition, it is clearly equivalent to ask the same for every factor and not only every prefix. ", "Whenever $d=1$, this definition corresponds to the usual notion of uniform recurrence of infinite words. ", "In the bidimensional setting, the uniform recurrence of the word is not linked to the uniform recurrence of all rows and columns. ", "On the one hand, the fact that rows and columns of a bidimensional word $w\\colon{\\mathbb{N}}^2\\to A$ are uniformly recurrent (in the unidimensional sense) does not imply that $w$ is UR.", "\n\n\\[rem:convention-2D\\] We choose the convention of representing a bidimensional word $w\\colon{\\mathbb{N}}^2\\to A$ by placing the rows from bottom to top, and the columns from left to right (as for Cartesian coordinates). ", "See Figure \\[fig:rep2D\\].", "\n\n$$\\begin{matrix}\n \\vdots & \\vdots & \\vdots & \\vdots \\\\\n w(0,3) & w(1,3) & w(2,3) & w(3,3) & \\cdots \\\\\n w(0,2) & w(1,2) & w(2,2) & w(3,2) & \\cdots \\\\\n w(0,1) & w(1,1) & w(2,1) & w(3,1) & \\cdots \\\\\n w(0,0) & w(1,0) & w(2,0) & w(3,0) & \\cdots \n\\end{matrix}$$\n\n\\[prop:rows\\_columns\\_UR\\] Let $w\\colon{\\mathbb{N}}^2\\to\\{0,1\\}$ be the bidimensional word obtained by alternating two kinds of rows: $1F$ and $0F$ where $F=01001010\\cdots$ is the Fibonacci word, i.e. $F$ is the fixed point of the morphism $0\\mapsto 01,\\, 1\\mapsto 0$ (see Figure \\[fig:URrows-nonUR\\]). ", "The rows and the columns of $w$ are all uniformly recurrent but $w$ is not UR.", "\n\n$$\\begin{matrix}\n \\vdots & \\vdots & \\vdots & \\vdots & \\vdots & \\vdots & \\vdots & \\vdots & \\vdots\\\\\n 0 & 0 & 1 & 0 & 0 & 1 & 0 & 1 & 0 & \\cdots \\\\\n 1 & 0 & 1 & 0 & 0 & 1 & 0 & 1 & 0 & \\cdots \\\\\n 0 & 0 & 1 & 0 & 0 & 1 & 0 & 1 & 0 & \\cdots \\\\\n 1 & 0 & 1 & 0 & 0 & 1 & 0 & 1 & 0 & \\cdots \\\\\n 0 & 0 & 1 & 0 & 0 & 1 & 0 & 1 & 0 & \\cdots \\\\\n 1 & 0 & 1 & 0 & 0 & 1 & 0 & 1 & 0 & \\cdots \n\\end{matrix}$$\n\nThe word $w$ is not UR since the square prefix $\\left[\\begin{smallmatrix}0&0\\\\1&0\\end{smallmatrix}\\right]$ only occurs within the first two columns. ", "The columns of $w$ are uniformly recurrent since they are periodic. ", "It is well known that the words $1F$ and $0F$ are uniformly recurrent, hence the rows of $w$ are uniformly recurrent.", "\n\nOn the other hand, the fact that a bidimensional infinite word is UR does not imply that each of its rows/columns is uniformly recurrent either. ", "The construction given by the following proposition is a modification of unidimensional Toeplitz words.", "\n\n\\[prop:UR\\_rows\\_columns\\] Let $w\\colon{\\mathbb{N}}^2\\to\\{0,1\\}$ be the bidimensional word constructed as follows. ", "The $n$-th row (with $n\\in{\\mathbb{N}}$) is indexed by $k$ if $n\\equiv 2^k\\pmod{2^{k+1}}$ and is indexed by $-1$ if $n=0$. Let $u_k=(10^{2^k-1})^\\omega$ for $k\\ge0$ and $u_{-1}=10^\\omega$. Now fill the rows indexed by $k$ with the words $u_k$ (see Figure \\[fig:UR-non-recurrent-rows\\]). ", "The bidimensional word $w$ is UR, but its first row is not recurrent.", "\n\n$$\\begin{array}{c|c|cccccccccccccc}\n\\vdots & \\vdots & \\vdots & \\vdots & \\vdots & \\vdots & \\vdots & \\vdots & \\vdots & \\vdots & \\vdots & \\vdots & \\vdots& \\vdots \\\\\n13 &0 & 1&1&1&1&1&1&1&1&1&1&1&1 & \\cdots \\\\\n12 &2 & 1&0&0&0&1&0&0&0&1&0&0&0 & \\cdots \\\\\n11 &0 & 1&1&1&1&1&1&1&1&1&1&1&1 & \\cdots \\\\\n10 &1 & 1&0&1&0&1&0&1&0&1&0&1&0 & \\cdots \\\\\n9 &0 & 1&1&1&1&1&1&1&1&1&1&1&1 & \\cdots \\\\\n8 &3 & 1&0&0&0&\n0&0&0&0&1&0&0&0 & \\cdots \\\\\n7 &0 & 1&1&1&1&1&1&1&1&1&1&1&1 & \\cdots \\\\\n6 &1 & 1&0&1&0&1&0&1&0&1&0&1&0 & \\cdots \\\\\n5 &0 & 1&1&1&1&1&1&1&1&1&1&1&1 & \\cdots \\\\\n4 &2 & 1&0&0&0&1&0&0&0&1&0&0&0 & \\cdots \\\\\n3 &0 & 1&1&1&1&1&1&1&1&1&1&1&1 & \\cdots \\\\\n2 &1 & 1&0&1&0&1&0&1&0&1&0&1&0 & \\cdots \\\\\n1 &0 & 1&1&1&1&1&1&1&1&1&1&1&1 & \\cdots \\\\ \n0 & -1 & 1&0&0&0&0&0&0&0&0&0&0&0 & \\cdots \\\\\n\\hline\nn&k & u_k \n\\end{array}$$\n\nConsider first the bidimensional infinite word $w'$ composed of the rows $u_k$ with $k\\ge 0$, that is, the word $w$ without its first row. ", "We show that each prefix of $w'$ appears according to a square network. ", "Note that this network argument is also used in the proof of Proposition \\[proposition:toeplitz\\]. ", "In $w'$, let $p$ be a prefix of some size $(s_1,s_2)\\in{\\mathbb{N}}^2$ and $N=\\max(\\lceil \\log_2(s_1) \\rceil,\\lceil \\log_2(s_2) \\rceil)$. The prefix $p'$ of size $(2^N,2^N)$ appears periodically according to the periods $(2^{N+1},0)$ and $(0,2^{N+1})$. Therefore each factor of $w'$ of size $(2^{N+1}+2^N-1,2^{N+1}+2^N-1)$ contains $p'$. So it contains $p$ as well. ", "Hence $w'$ is UR.", "\n\nNow let $p$ denote a prefix of $w$ of some size $(s_1,s_2)\\in{\\mathbb{N}}^2$. Let $N=\\max(\\lceil \\log_2(s_1) \\rceil,\\lceil \\log_2(s_2) \\rceil)$. Using the previous paragraph, we know that the prefix of $w'$ of size $(2^N,2^N)$ occurs with periods $(2^{N+1},0)$ and $(0,2^{N+1})$. Since the $2^{N+1}$-th row of $w$ is filled with the infinite word $u_{N+1}=(10^{2^{N+1}-1})^\\omega$ and that $2^{N+1}>s_1$, the prefix $p$ also appears in position $(0,2^{N+1})$ in $w$, i.e. in position $(0,2^{N+1}-1)$ in $w'$. As $w'$ is UR, $p$ occurs within every factor of $w'$ of size $(n,n)$ for some $n\\in{\\mathbb{N}}$. As $w$ is composed of $w'$ with an additional row $u_{-1}$, the prefix $p$ of $w$ occurs also within every factor of $w$ of size $(n+1,n+1)$.\n\nIn order to obtain the uniform recurrence of all rows and columns in a bidimensional infinite word, we introduce a different version of uniform recurrence of multidimensional infinite words, which involves directions. ", "Throughout this text, when we talk about a *direction* $\\mathbf{q}=(q_1,\\ldots,q_d)$, we implicitly assume that $q_1,\\ldots,q_d$ are coprime nonnegative integers. ", "For the sake of conciseness, if $\\mathbf{s}=(s_1,\\ldots,s_d)$, we write $[\\![\\mathbf{0},\\mathbf{s}-\\mathbf{1}]\\!]$ in order to designate the $d$-dimensional interval $[\\![0,s_1-1]\\!]\\times \\cdots\\times [\\![0,s_d-1]\\!]$. In particular, we set $\\mathbf{0}=(0,\\ldots,0)$ and $\\mathbf{1}=(1,\\ldots,1)$.\n\nIn what follows, we will use the following notation. ", "Let $w\\colon{\\mathbb{N}}^d\\to A$ be a $d$-dimensional infinite word, $\\mathbf{s}\\in{\\mathbb{N}}^d$ and $\\mathbf{q}\\in{\\mathbb{N}}^d$ be a direction. ", "The *word along the direction $\\mathbf{q}$ with respect to the size $\\mathbf{s}$ in $w$* is the unidimensional infinite word ${w_{{\\mathbf{q},\\mathbf{s}}}} \\colon {\\mathbb{N}}\\to A^{[\\![\\mathbf{0},\\mathbf{s}-\\mathbf{1}]\\!]}$, where elements of $A^{[\\![\\mathbf{0},\\mathbf{s}-\\mathbf{1}]\\!]}$ are considered as letters, defined by $$\\forall \\ell \\in{\\mathbb{N}},\\ \n \\forall \\mathbf{i}\\in [\\![\\mathbf{0},\\mathbf{s}-\\mathbf{1}]\\!],\\ \n ({w_{{\\mathbf{q},\\mathbf{s}}}}(\\ell))(\\mathbf{i})=w(\\mathbf{i}+\\ell \\mathbf{q}).$$ See Figure \\[fig:def-wqs\\] for an illustration in the bidimensional case.", "\n\nNote that, for any choice of direction $\\mathbf{q}$, the first letter ${w_{{\\mathbf{q},\\mathbf{s}}}}(0)$ of the unidimensional infinite word ${w_{{\\mathbf{q},\\mathbf{s}}}}$ is the prefix of size $\\mathbf{s}$ of the $d$-dimensional infinite word $w$.\n\n\\[def:URD\\] A $d$-dimensional infinite word $w\\colon{\\mathbb{N}}^d\\to A$ is *uniformly recurrent along all directions* (URD for short) if for all $\\mathbf{s}\\in{\\mathbb{N}}^d$ and all directions $\\mathbf{q}\\in{\\mathbb{N}}^d$, there exists $b\\in{\\mathbb{N}}$ such that each length-$b$ factor of ${w_{{\\mathbf{q},\\mathbf{s}}}}$ contains the letter ${w_{{\\mathbf{q},\\mathbf{s}}}}(0)$.\n\nAlternatively, we can say that the letter ${w_{{\\mathbf{q},\\mathbf{s}}}}(0)$ occurs infinitely often in ${w_{{\\mathbf{q},\\mathbf{s}}}}$ with gaps at most $b$. The same reformulation is also valid for further definitions of uniform recurrence.", "\n\nA $d$-dimensional infinite word $w\\colon{\\mathbb{N}}^d\\to A$ is URD if and only if for all $\\mathbf{s}\\in{\\mathbb{N}}^d$ and all directions $\\mathbf{q}\\in{\\mathbb{N}}^d$, the unidimensional word ${w_{{\\mathbf{q},\\mathbf{s}}}}$ is uniformly recurrent.", "\n\nThe condition is clearly sufficient. ", "Let us show that it is also necessary. ", "Suppose that $w\\colon{\\mathbb{N}}^d\\to A$ is URD and let $\\mathbf{s},\\mathbf{q}\\in{\\mathbb{N}}^d$ be some fixed size and direction. ", "We show that any prefix of ${w_{{\\mathbf{q},\\mathbf{s}}}}$ appears infinitely often with bounded gaps in ${w_{{\\mathbf{q},\\mathbf{s}}}}$. Consider a prefix $p$ of ${w_{{\\mathbf{q},\\mathbf{s}}}}$ of some length $\\ell$. Let $\\mathbf{s}'=(\\ell-1)\\mathbf{q}+\\mathbf{s}$. Since $w$ is URD, there exists $b'\\in{\\mathbb{N}}$ such that each length-$b'$ factor of ${w_{{\\mathbf{q},\\mathbf{s'}}}}$ contains the letter ${w_{{\\mathbf{q},\\mathbf{s'}}}}(0)$. This implies that each length-$(b'+\\ell-1)$ factor of ${w_{{\\mathbf{q},\\mathbf{s}}}}$ contains $p$.\n\nWe will see that the uniform recurrence along all directions implies that rows and columns are uniformly recurrent (see Proposition \\[prop:URD\\_rows\\_columns\\]). ", "However, a URD word is not necessarily UR as shown by the following proposition. ", "In the next section, we will show that UR does not imply URD either (see Corollary \\[cor:UR\\_not\\_imply\\_URD\\]).", "\n\n\\[prop:URD\\_isnot\\_UR\\] For any $d\\ge 2$, there exists a $d$-dimensional URD word that is not UR.", "\n\nWe give a sketch of a construction to avoid cumbersome details. ", "Let $A$ be a finite alphabet containing at least two letters, say $0$ and $1$, and let $d\\ge2$. Consider the following recursive procedure to construct uncountably many such $d$-dimensional infinite words. ", "See Figure \\[fig:URD\\_isnot\\_UR\\]\n\n;\n\nfor an illustration of a bidimensional binary such word. ", "On the first step, fill the position $\\mathbf{0}$ with the letter $1$. On each step $n\\ge 2$, consider the prefix $p_n$ of size $\\mathbf{n}=(n,\\ldots,n)$ which is partially filled. ", "Choose arbitrary letters of $A$ to complete it (in Figure \\[fig:URD\\_isnot\\_UR\\], we chose to complete with $0$’s at each step). ", "For each direction $\\mathbf{q}<\\mathbf{n}$, choose a constant $b_\\mathbf{q}$ and copy $p_n$ in all positions $\\ell b_\\mathbf{q} \\mathbf{q}$ with $\\ell \\in {\\mathbb{N}}$. Note that the word ${w_{{\\mathbf{q},\\mathbf{n}}}}$ may be already partially filled, but there always exists a constant $b_\\mathbf{q}$ (potentially big) that allows us to perform this procedure. ", "In one of the remaining factors of size $\\mathbf{n}$ that do not contain any letter yet, write $n^d$ times the letter $0$ (at each step of Figure \\[fig:URD\\_isnot\\_UR\\], we chose such a square below the diagonal and the closest possible of the origin). ", "All so-constructed words are URD but are not UR since they contain arbitrarily large hypercubes of $0$’s.", "\n\nA natural strengthening of the definition of URD words is to ask that the bound between consecutive occurrences of a prefix only depends on the size of the prefix and not on the chosen direction.", "\n\n\\[def:SURD\\] A $d$-dimensional infinite word $w\\colon{\\mathbb{N}}^d\\to A$ is *strongly uniformly recurrent along all directions* (SURD for short) if for each $\\mathbf{s}\\in{\\mathbb{N}}^d$, there exists $b\\in{\\mathbb{N}}$ such that, for each direction $\\mathbf{q} \\in{\\mathbb{N}}^d$, each length-$b$ factor of ${w_{{\\mathbf{q},\\mathbf{s}}}}$ contains the letter ${w_{{\\mathbf{q},\\mathbf{s}}}}(0)$.\n\nIn Figure \\[fig:links\\_recurrence\\], we summarize the relations between the different notions of recurrence we consider.", "\n\n& &\\\n& &\\\n= & = &\n\nat (-4.8,-1.7); at (-9.5,-1.7);\n\nUniform recurrence along all directions from any origin {#sec:origin}\n=======================================================\n\nAs a natural generalization of $d$-dimensional URD and SURD infinite words, we could ask that the recurrence property should not just be taken into account on the lines $\\{\\ell\\mathbf{q}\\colon\\ell\\in{\\mathbb{N}}\\}$ for all directions $\\mathbf{q}$ but on all lines $\\{\\ell\\mathbf{q}+\\mathbf{p}\\colon\\ell\\in{\\mathbb{N}}\\}$ for all origins $\\mathbf{p}$ and directions $\\mathbf{q}$. In fact, this would not be a real generalization; the proof of this claim is the purpose of the present section.", "\n\n\\[def2\\] A $d$-dimensional infinite word $w\\colon{\\mathbb{N}}^d\\to A$ is *uniformly recurrent along all directions from any origin* (URDO for short) if for each $\\mathbf{p}\\in{\\mathbb{N}}^d$, the translated $d$-dimensional infinite word $w^{(\\mathbf{p})}\\colon {\\mathbb{N}}^d\\to A,\\ \\mathbf{i}\\mapsto w(\\mathbf{i}+\\mathbf{p})$ is URD.", "\n\nA $d$-dimensional infinite word $w\\colon{\\mathbb{N}}^d\\to A$ is *strongly uniformly recurrent along all directions from any origin* (SURDO for short) if for each $\\mathbf{p}\\in{\\mathbb{N}}^d$, the translated $d$-dimensional infinite word $w^{(\\mathbf{p})}\\colon {\\mathbb{N}}^d\\to A,\\ \\mathbf{i}\\mapsto w(\\mathbf{i}+\\mathbf{p})$ is SURD.", "\n\n\\[prop:URDisURDO\\] \n\n- A $d$-dimensional infinite word is URD if and only if it is URDO.", "\n\n- A $d$-dimensional infinite word is SURD if and only if it is SURDO.", "\n\nBoth conditions are clearly sufficient. ", "Now we prove that they are necessary. ", "Let $w\\colon{\\mathbb{N}}^d\\to A$ be URD (SURD, respectively), let $\\mathbf{p},\\mathbf{s} \\in \\mathbb{N}^d$ and let $f\\colon [\\![\\mathbf{0},\\mathbf{s}-\\mathbf{1}]\\!]\\to A $ be the factor of $w$ of size $\\mathbf{s}$ at position $\\mathbf{p}$: for all $\\mathbf{i}\\in[\\![\\mathbf{0},\\mathbf{s}-\\mathbf{1}]\\!]$, $f(\\mathbf{i})=w(\\mathbf{i}+\\mathbf{p})$. We need to prove that for each direction $\\mathbf{q}$, there exists $b\\in{\\mathbb{N}}$ such that (that there exists $b\\in{\\mathbb{N}}$ such that for all directions $\\mathbf{q}$, respectively) each factor of length $b$ taken along the line $\\ell\\mathbf{q}+\\mathbf{p}$ contains $f$. The situation is illustrated in Figure \\[fig:proof-URDO\\].", "\n\nConsider the prefix $p$ of size $\\mathbf{p}+\\mathbf{s}$ of $w$. Since the word is URD (SURD, respectively), for all directions $\\mathbf{q}$, there exists $b'$ such that (there exists $b'$ such that for all directions $\\mathbf{q}$, respectively) each factor of length $b'$ taken along the line $\\ell\\mathbf{q}$ contains $p$. Since $f$ occurs at position $\\mathbf{p}$ in $p$, this implies the condition we need with $b=b'$.\n\n\\[prop:URD\\_rows\\_columns\\] If a bidimensional infinite word is URD, then all its rows and columns are uniformly recurrent, but the converse does not hold.", "\n\nLet $w$ be a URD bidimensional infinite word. ", "From Proposition \\[prop:URDisURDO\\], $w$ is also URDO. ", "So, any translated word $w^{(\\mathbf{p})}$ with $\\mathbf{p}=(0,m)$ is also URD. ", "Hence, in $w^{(\\mathbf{p})}$ any factor of size of the form $(s,1)$ occurs along the direction $(1,0)$ with bounded gaps. ", "In other words, any row is uniformly recurrent. ", "The argument is similar for the columns.", "\n\nIn order to see that the converse is not true, we can for example consider again the bidimensional word of Proposition \\[prop:rows\\_columns\\_UR\\].", "\n\n\\[cor:UR\\_not\\_imply\\_URD\\] A bidimensional infinite UR word is not necessarily URD.", "\n\nThis follows from Propositions \\[prop:UR\\_rows\\_columns\\] and \\[prop:URD\\_rows\\_columns\\].", "\n\nWe can also ask the constant $b$ to be uniform for all the origins. ", "As previously, the notation ${(w^{(\\mathbf{p})})_{{\\mathbf{q},\\mathbf{s}}}}$ designates the unidimensional infinite word along the direction $\\mathbf{q}$ with respect to the size $\\mathbf{s}$ in the translated $d$-dimensional infinite word $w^{(\\mathbf{p})}\\colon {\\mathbb{N}}^d\\to A,\\, \\mathbf{i}\\mapsto w(\\mathbf{i}+\\mathbf{p})$.\n\n\\[def:SSURDO\\] A $d$-dimensional infinite word $w\\colon{\\mathbb{N}}^d\\to A$ is *super strongly uniformly recurrent along all directions from any origin* (SSURDO for short) if for all $\\mathbf{s}\\in{\\mathbb{N}}^d$, there exists $b\\in{\\mathbb{N}}$ such that, for each direction $\\mathbf{q}\\in{\\mathbb{N}}^d$ and each origin $\\mathbf{p}\\in{\\mathbb{N}}^d$, each length-$b$ factor of ${(w^{(\\mathbf{p})})_{{\\mathbf{q},\\mathbf{s}}}}$ contains the letter ${(w^{(\\mathbf{p})})_{{\\mathbf{q},\\mathbf{s}}}}(0)$.\n\nDoubly periodic words satisfy the latter definition (take $b$ the product of the coordinates of the periods) but there also exist SSURDO aperiodic words. ", "One of them is given as the fixed point of a bidimensional morphism introduced in Section \\[sec:morphism\\] (see Proposition \\[prop:SSURDO\\]). ", "Note that this notion of SSURDO words is distinct from that of SURD words (see Example \\[ex:SURD\\_isnot\\_SSURDO\\]).", "\n\n\\[prop:SSURDO\\_imply\\_UR\\] A $d$-dimensional SSURDO word is necessarily UR.", "\n\nLet $w$ be a $d$-dimensional SSURDO word and let $p$ be a prefix of $w$ of some size $\\mathbf{s}$. Let $b$ be the bound from Definition \\[def:SSURDO\\] and $\\mathbf{b}=(b,\\ldots,b)$. It is enough to prove that any factor of $w$ of size $\\mathbf{b}+\\mathbf{s}-\\mathbf{1}$ contains $p$ as a factor.", "\n\nLet $\\mathbf{p}=(p_1,\\ldots,p_d)$ and let $f$ be the factor of size $\\mathbf{b}+\\mathbf{s}-\\mathbf{1}$ occurring in $w$ at position $\\mathbf{p}$. For each $i\\in[\\![1,d]\\!]$, we let $\\mathbf{e}_i$ denote the direction $(0,\\ldots,0,1,0,\\ldots,0)$ with $1$ in the $i$-th coordinate. ", "By definition, in the word $(w^{(\\mathbf{0})})_{\\mathbf{e}_1,\\mathbf{s}}$, each factor of length $b$ contains $p$ (considered as a letter). ", "Therefore, there exists a position $k_1\\mathbf{e}_1$ with $p_1 \\le k_1 \\le p_1 +b-1$ where $p$ occurs in $w$. By definition again, in the word $(w^{(k_1\\mathbf{e}_1)})_{\\mathbf{e}_2,\\mathbf{s}}$, each factor of length $b$ contains an occurrence of $p$. So there exists a position $k_1\\mathbf{e}_1+k_2\\mathbf{e}_2$ with $p_2\\le k_2 \\le p_2+b-1$ where $p$ occurs in $w$. Applying the same argument $d-2$ more times, we find a position $k_1 \\mathbf{e}_1 +\\cdots + k_d\\mathbf{e}_d\\in[\\![\\mathbf{p},\\mathbf{p}+\\mathbf{b}-\\mathbf{1}]\\!]$ where $p$ occurs in $w$. Thus, $p$ occurs as a factor of $f$ as desired.", "\n\nConstruction of URD multidimensional words using the $\\gcd$ {#sec:gcd}\n===========================================================\n\nIn this section, we consider a specific construction of $d$-dimensional infinite words starting from a single unidimensional infinite word. ", "More precisely, for any $u\\colon{\\mathbb{N}}\\to A$, we define a $d$-dimensional infinite word $w\\colon{\\mathbb{N}}^d\\to A$ by setting $$\\forall \\mathbf{i}\\in{\\mathbb{N}}^d, \\ w(\\mathbf{i})=u(\\gcd(\\mathbf{i})),$$ where $\\gcd(\\mathbf{i})=\\gcd(i_1,\\ldots,i_d)$ if $\\mathbf{i}=(i_1,\\ldots,i_d)$. Otherwise stated, one places the infinite word $u$ in every rational direction: for all directions $\\mathbf{q}\\in{\\mathbb{N}}^d$ and all $\\ell\\in{\\mathbb{N}}$, we have $w(\\ell \\mathbf{q})=u(\\ell)$.\n\n\\[lemma:gcd\\] Let $\\mathbf{q}=(q_1,\\ldots,q_d)\\in{\\mathbb{Z}}^d$ such that $q_1,\\ldots,q_d$ are coprime, let $\\alpha_1,\\ldots,\\alpha_d\\in{\\mathbb{Z}}$ such that $\\alpha_1 q_1+\\cdots+ \\alpha_d q_d=1$, and let $\\mathbf{i}=(i_1,\\ldots,i_d)\\in{\\mathbb{Z}}^d\\setminus {\\mathbb{Z}}\\mathbf{q}$. Then, for all $\\ell\\in{\\mathbb{Z}}$, we have $$\\begin{aligned}\n\\gcd(\\ell \\mathbf{q}+\\mathbf{i}) &=\\gcd\\big(\\ell +\\alpha_1 i_1+\\cdots+ \\alpha_d i_d,\\ \\gcd( i_jq_k-i_kq_j \\colon j,k\\in[\\![1,d]\\!])\\big),\\\\\n\\gcd(\\ell\\mathbf{q}) &=\\ell.\\end{aligned}$$ In particular, the sequence $\\big(\\gcd(\\ell\\mathbf{q}+\\mathbf{i})\\big)_{\\ell\\in{\\mathbb{Z}}}$ is periodic of period $\\gcd(i_jq_k-i_kq_j\\colon j,k\\in[\\![1,d]\\!])$.\n\nLet $d=\\gcd(\\ell \\mathbf{q}+\\mathbf{i})$ and $D=\\gcd\\big(\\ell +\\alpha_1 i_1+\\cdots+ \\alpha_d i_d,\\ \\gcd( i_jq_k-i_kq_j \\colon j,k\\in[\\![1,d]\\!])\\big)$. Then $d$ divides $$\\sum_{j=1}^d \\alpha_j(\\ell q_j+i_j)\n =\\ell\\sum_{j=1}^d \\alpha_j q_j+\\sum_{j=1}^d \\alpha_ji_j\n =\\ell +\\sum_{j=1}^d \\alpha_ji_j.$$ Moreover, for all $j,k\\in[\\![1,d]\\!]$, $d$ also divides $(\\ell q_j+i_j)q_k-(\\ell q_k+i_k)q_j =i_jq_k-i_kq_j$. This shows that $d\\le D$. Conversely, for all $k\\in[\\![1,d]\\!]$, $D$ divides $$\\Big(\\ell +\\sum_{j=1}^d \\alpha_ji_j\\Big)q_k\n +\\sum_{j\\in[\\![1,d]\\!]} (", "i_kq_j-i_jq_k)\\alpha_j=\\ell q_k+i_k.$$ We obtain that $D\\le d$, hence $d=D$. The particular case follows from the fact that $\\gcd(a,b)=\\gcd(a+b,b)$.\n\nAn arithmetical subsequence of a word $w\\colon {\\mathbb{N}}\\to A$ is a word $v\\colon {\\mathbb{N}}\\to A$ such that there exist $p,q\\in{\\mathbb{N}}$ with $q\\ne 0$ such that, for all $\\ell\\in{\\mathbb{N}}$, $v(\\ell)=w(\\ell q+p)$. A proof of the following result can be found in [@Avgustinovich--2011].", "\n\n\\[lem:arithm\\] An arithmetical subsequence of a uniformly recurrent infinite word is uniformly recurrent.", "\n\nConsider the occurrence of the prefix $01$ of the Thue-Morse word at positions multiple of $3$: $${\\bf 01}1{\\bf 01}0{\\bf 01}1001{\\bf 01}1{\\bf 0 1} 0{\\bf 01} 0110{\\bf 01} 1{\\bf 01}0{\\bf 01} 1001{\\bf 01}1001101001\n{\\bf 01}1{\\bf 01}0{\\bf 01}1001{\\bf 01}10\\cdots$$ From Lemma \\[lem:arithm\\] the distance between any two consecutive such occurrences is bounded.", "\n\nFor any uniformly recurrent word $u\\colon{\\mathbb{N}}\\to A$, the $d$-dimensional word $w\\colon{\\mathbb{N}}^d\\to A,\\ \\mathbf{i}\\mapsto u(\\gcd(\\mathbf{i}))$ is URD.", "\n\nLet $u\\colon{\\mathbb{N}}\\to A$ be a uniformly recurrent word and let $w\\colon{\\mathbb{N}}^d\\to A$ be the $d$-dimensional word $w\\colon{\\mathbb{N}}^d\\to A,\\ \\mathbf{i}\\mapsto u(\\gcd(\\mathbf{i}))$. Let $\\mathbf{q}$ be a direction, let $p$ be a prefix of $w$ of some size $\\mathbf{s}$ and let $y\\colon{\\mathbb{N}}\\to A^{[\\![0,\\mathbf{s}-\\mathbf{1}]\\!]}$ be the word defined by $$\\forall \\ell \\in{\\mathbb{N}},\\ \\forall \\mathbf{i}\\in[\\![0,\\mathbf{s}-\\mathbf{1}]\\!],\\ (y(\\ell))(\\mathbf{i})=w(\\ell \\mathbf{q}+\\mathbf{i}).$$ We claim that $y$ contains the letter $y(0)=p$ with bounded gaps. ", "By construction of $w$, we have $$\\forall \\ell \\in{\\mathbb{N}},\\ \\forall \\mathbf{i}\\in[\\![0,\\mathbf{s}-\\mathbf{1}]\\!],\\ (y(\\ell))(\\mathbf{i})=u(\\gcd(\\ell \\mathbf{q}+\\mathbf{i})).$$ Now the conclusion follows from Lemma \\[lemma:gcd\\] and the uniform recurrence of $u$. More precisely, let $$B=\\prod_{\\substack{\\mathbf{0}\\le (i_1,\\ldots,i_d)<\\mathbf{s} \\\\ (i_1,\\ldots,i_d)\\notin{\\mathbb{N}}\\mathbf{q}}}\n \\gcd(i_jq_k-i_kq_j\\colon j,k\\in[\\![1,d]\\!])$$ and $r=\\min\\{\\lceil\\frac{s_1}{q_1}\\rceil,\\ldots,\\lceil\\frac{s_d}{q_d}\\rceil\\}$. By Lemma \\[lem:arithm\\], the length-$r$ prefix of $u$ occurs at positions multiples of $B$ in $u$ infinitely often with gaps bounded by some constant $C$. ", "Then, by Lemma \\[lemma:gcd\\], $p$ occurs infinitely often in $y$ with gaps at most $BC$.\n\nRecurrence properties of multidimensional rotation words {#sec:rotation}\n========================================================\n\nWe illustrate that URD and SURD notions are distinct using a generalization of rotation words to the multidimensional setting. ", "This generalization includes the bidimensional Sturmian words, which were proven to be UR  [@Berthe--Vuillon--2001].", "\n\nLet $\\boldsymbol\\alpha=(\\alpha_1,\\ldots,\\alpha_d)\\in[0,1)^d$ and $\\rho\\in[0,1)$ be such that $1,\\alpha_1,\\ldots,\\alpha_d$ are rationally independent and let $\\{I_1,\\ldots,I_k\\}$ be a partition of $[0,1)$ into half-open intervals on the right. ", "The *$d$-dimensional (lower) rotation word* $w\\colon{\\mathbb{N}}^d\\to [\\![1,k]\\!]$ (with parameters $\\boldsymbol\\alpha,I_1,\\ldots,I_k,\\rho$) is defined as $$\\forall \\mathbf{i}\\in{\\mathbb{N}}^d,\\ \\forall j\\in[\\![1,k]\\!],\\quad\n w(\\mathbf{i}) = j \\iff (\\rho+\\mathbf{i} \\cdot \\boldsymbol\\alpha) \\bmod 1\\in I_j$$ (where $\\mathbf{i} \\cdot \\boldsymbol\\alpha$ is the scalar product $i_1\\alpha_1+\\cdots+i_d\\alpha_d$). ", "Similarly, we can also consider half-open intervals on the left. ", "In this case, we talk about *$d$-dimensional upper rotation words.*", "\n\nNote that for $d=2$, $I_1=[0,\\alpha_1)$ and $I_2=[\\alpha_1,1)$, we recover the definition of bidimensional Sturmian words from [@Berthe--Vuillon--2001].", "\n\nWith the previous notation, for $\\mathbf{s}\\in{\\mathbb{N}}^d$ and for $f$ a $d$-dimensional finite word of size $\\mathbf{s}$ over the alphabet $\\{1,\\ldots,k\\}$, we let $$I_f=\\bigcap_{\\mathbf{i}\\in[\\![\\mathbf{0},\\mathbf{s}-\\mathbf{1}]\\!]} ", "R_{\\mathbf{i}\\cdot\\boldsymbol{\\alpha}}^{-1}(I_{f(\\mathbf{i})})$$ where $R_a\\colon[0,1)\\to[0,1),\\ x\\mapsto (x+a)\\bmod 1$. Note that an intersection of intervals on the circle is a union of intervals (it does not have to be connected). ", "Since $I_f$ is an intersection of finitely many intervals, it is also a finite union of nonempty disjoint intervals. ", "We let $n(f)$ denote the number of such intervals and $I_{f,1}, \\dots I_{f,n(f)}$ the intervals, so that: $$\\label{eq:union}\n I_f=\\bigcup_{j=1}^{n(f)} I_{f,j}.$$ If $I_f$ is empty then the union is empty, meaning that there is no interval $I_{f,j}$ at all, or equivalently that $n(f)=0$.\n\n\\[lem:rotation\\] Let $w$ be a $d$-dimensional rotation word with parameters $\\boldsymbol\\alpha, I_1,\\ldots, I_k, \\rho$.\n\n- A $d$-dimensional finite word $f$ occurs as a factor of $w$ at some position $\\mathbf{p}$ if and only if $(\\rho+\\mathbf{p} \\cdot \\boldsymbol\\alpha) \\bmod 1\\in I_f$.\n\n- A $d$-dimensional finite word $f$ is a factor of $w$ if and only if $I_f$ is nonempty.", "\n\nThe proof is an adaptation of that of [@Berthe--Vuillon--2001 Lemma 1]. ", "Let $f$ be a $d$-dimensional finite word. ", "Then $f$ occurs in $w$ at position $\\mathbf{p}$ if and only if for all $\\mathbf{i}\\in[\\![\\mathbf{0},\\mathbf{s}-\\mathbf{1}]\\!]$ we have that $(\\rho+(\\mathbf{p}+\\mathbf{i}) \\cdot \\boldsymbol\\alpha) \\bmod 1\\in I_{f(\\mathbf{i})}$, which is equivalent to saying that $(\\rho+\\mathbf{p}\\cdot\\boldsymbol{\\alpha})\\bmod 1\\in I_f$.\n\nIf $I_f$ is nonempty then it is a nonempty union of half-open intervals, and hence $I_f$ has nonempty interior. ", "Moreover, by Kronecker’s theorem (see for example [@Hardy-Wright--2008]) and since $\\alpha_d$ is irrational, we know that the orbit $\\{(\\rho+p_d\\alpha_d)\\bmod 1\\colon p_d\\in{\\mathbb{N}}\\}$ of $\\rho$ under the rotation $R_{\\alpha_d}$ is dense in $[0,1)$. Therefore, if $I_f$ is nonempty then for any $p_1,\\ldots,p_{d-1}\\in{\\mathbb{N}}$, there exists some $p_d\\in{\\mathbb{N}}$ such that $\\rho+p_1\\alpha_1+\\cdots+p_{d-1}\\alpha_{d-1}+p_d\\alpha_d$ belongs to $I_f$, so $f$ occurs as a factor of $w$ at position $\\mathbf{p}=(p_1,\\ldots,p_d)$.\n\n\\[prop:URD\\_isnot\\_SURD\\] All $d$-dimensional rotation words are URD, but none of them are SURD.", "\n\nConsider a $d$-dimensional rotation word $w$ with parameters $\\boldsymbol\\alpha, I_1,\\ldots, I_k, \\rho$. First, we show that $w$ is URD. ", "Let $\\mathbf{q}\\in{\\mathbb{N}}^d$ be a direction and $\\mathbf{s}=(s_1,\\ldots,s_d)\\in{\\mathbb{N}}^d$. We claim that the unidimensional word ${w_{{\\mathbf{\\mathbf{q}},\\mathbf{\\mathbf{s}}}}}$ is the image of a unidimensional rotation word under a letter-to-letter projection. ", "Indeed, by definition, for each $\\ell$, the letter ${w_{{\\mathbf{\\mathbf{q}},\\mathbf{\\mathbf{s}}}}}(\\ell)$ corresponds to the factor of size $\\mathbf{s}$ occurring at position $\\ell\\mathbf{q}$ in $w$. By Lemma \\[lem:rotation\\], we get that the word ${w_{{\\mathbf{\\mathbf{q}},\\mathbf{\\mathbf{s}}}}}$ is the coding of the rotation on the unit circle of the point $\\rho$ under the irrational angle $\\mathbf{q}\\cdot\\boldsymbol\\alpha$ with respect to the interval partition $\\{I_{f_1,1},\\ldots,I_{f_1,n(f_1)},\\ldots,I_{f_r,1},\\ldots,I_{f_r,n(f_r)}\\}$ where $f_1,\\ldots,f_r$ are the factors of $w$ of size $\\mathbf{s}$ and the intervals $I_{f_i,j}$ are defined as in . ", "Note that, since for each $i$, the intervals $I_{f_i,1},\\ldots,I_{f_i,n(f_i)}$ are coded by the same “letter” $f_i$ in ${w_{{\\mathbf{\\mathbf{q}},\\mathbf{\\mathbf{s}}}}}$, we do not necessarily obtain a rotation word but a letter-to-letter projection of a rotation word. ", "Now, we obtain that $w$ is URD as a direct consequence of the three-gap theorem [@Swierczkowski--1959; @Slater--1967] stating the following: if $\\delta$ is an irrational number and $I$ is an interval of the unit circle then the gaps between the successive integers $j$ such that $\\delta j \\in I$ take at most three values. ", "So, the letter ${w_{{\\mathbf{\\mathbf{q}},\\mathbf{\\mathbf{s}}}}}(0)$ occurs in ${w_{{\\mathbf{\\mathbf{q}},\\mathbf{\\mathbf{s}}}}}$ with gaps bounded by the largest gap corresponding to $\\delta=\\mathbf{q}\\cdot\\boldsymbol\\alpha$ and the interval $I=I_{{w_{{\\mathbf{\\mathbf{q}},\\mathbf{\\mathbf{s}}}}}(0),j}$ where $j\\in[\\![1,k({w_{{\\mathbf{\\mathbf{q}},\\mathbf{\\mathbf{s}}}}}(0))]\\!]$ corresponds to the index of the interval $I_{{w_{{\\mathbf{\\mathbf{q}},\\mathbf{\\mathbf{s}}}}}(0),j}$ containing $\\rho$.\n\nHowever, $w$ is not SURD since the uniform recurrence constant of ${w_{{\\mathbf{q},\\mathbf{1}}}}$ can be arbitrarily large depending on the direction $\\mathbf{q}$. Indeed, by Kronecker’s theorem, for each integer $N$, one can choose $\\mathbf{q}_N=(q_1,N, \\ldots,N)$ so that $\\ell(\\mathbf{q}_N\\cdot \\boldsymbol{\\alpha} \\bmod 1) < \\min(|I_1|,\\ldots,|I_k|)$ for any $\\ell\\in[\\![0,N]\\!]$. Therefore, the word $w_{\\mathbf{q}_N,\\mathbf{1}}$ contains all the factors $j^N$ for $j\\in[\\![1,k]\\!]$.\n\nTo end this section, we present an alternative proof of Proposition \\[prop:URD\\_isnot\\_SURD\\] using the notion of direct product of words. ", "As it happens, this second proof reveals a property of $d$-dimensional rotation words which is stronger than the URD property (see Remark \\[rem:stronger-than-URD\\]). ", "Further, we hope that this technique could be useful in order to prove that some other families of $d$-dimensional infinite words are URD.", "\n\nRecall that the *direct product* of two unidimensional words $v\\colon{\\mathbb{N}}\\to A$ and $w\\colon{\\mathbb{N}}\\to B$ (possibly over different alphabets $A$ and $B$) is defined as the word $v\\times w\\colon{\\mathbb{N}}\\to A\\times B$ where the $i$-th letter is $(v(i),w(i))$; for example see [@Salimov--2010]. ", "The direct product of $k\\ge 2$ unidimensional words can be defined inductively.", "\n\nFirst, we need a lemma based on Furstenberg’s results [@Furstenberg--1981] and their consequences on the direct product of unidimensional rotation words.", "\n\n\\[lem:direct\\_prod\\_sturmian\\] Any direct product of unidimensional lower (resp.", " upper) rotation words is uniformly recurrent.", "\n\nLet $k\\ge 2$ and consider $k$ unidimensional lower (resp.", " upper) rotation words $\\mathcal{R}_1,\\ldots,\\mathcal{R}_k$. For each $i$, suppose that $\\mathcal{R}_i$ has slope $\\alpha_i$ and intercept $\\rho_i$. Let $T_i$ be the transformation associated with $\\mathcal{R}_i$, i.e. $T_i\\colon[0,1)\\to[0,1),\\, x\\mapsto (x+\\alpha_i)\\bmod 1$. By definition, $\\mathcal{R}_i$ is the coding of the orbit of the intercept $\\rho_i$ in the dynamical system $([0,1),T_i)$ with respect to some interval partition $(I_{i,1},\\ldots,I_{i,\\ell_i})$ of $[0,1)$ where each interval $I_{i,j}$ is half open on the right. ", "Moreover, the direct product of $k$ codings can be seen as the coding of the dynamical system product $([0,1)^k,T_1\\times\\cdots\\times T_k)$ where $T_1\\times\\cdots\\times T_k\\colon (x_1,\\ldots,x_k)\\mapsto (T_1(x_1),\\ldots,T_k(x_k))$.\n\nThe maps $T_i$ correspond to the transformation $T$ defined in [@Furstenberg--1981 Prop. ", "5.4] with $d=1$. Thus, from a dynamical point of view, every point of $([0,1),T_i)$ is recurrent [@Furstenberg--1981 Prop. ", "5.4] and their product with any recurrent point of $([0,1),T_j)$ is also recurrent [@Furstenberg--1981 Prop.", " 5.5] for the product system. ", "Such points are called *strongly recurrent* by Furstenberg. ", "Since the direct product of strongly recurrent points is also strongly recurrent [@Furstenberg--1981 Lem.", " 5.10] and since strong recurrence implies uniform recurrence [@Furstenberg--1981 Thm. ", "5.9], we obtain that the product of any $k$ points of $([0,1),T_1), \\ldots, ([0,1),T_k)$ respectively is uniformly recurrent with respect to the product system $([0,1)^k,T_1\\times\\cdots\\times T_k)$.\n\nFinally, since $\\mathcal{R}_1,\\ldots,\\mathcal{R}_k$ are all rotation words of the same orientation of the intervals, there is no ambiguity in the coding and the dynamical systems results can be translated in terms of words. ", "Therefore, their direct product is uniformly recurrent.", "\n\nConsider a $d$-dimensional rotation word $w$ with parameters $\\boldsymbol\\alpha, I_1,\\ldots, I_k, \\rho$. Let $\\mathbf{q}\\in{\\mathbb{N}}^d$ be a direction and $\\mathbf{s}=(s_1,\\ldots,s_d)\\in{\\mathbb{N}}^d$. For any $\\mathbf{p}\\in{\\mathbb{N}}^d$, the unidimensional word $(w(\\ell\\mathbf{q}+\\mathbf{p}))_{\\ell\\in{\\mathbb{N}}}$ is a rotation word. ", "Indeed, it is the coding of the rotation of the point $\\rho+\\mathbf{p}\\cdot\\boldsymbol\\alpha$ of the unit circle under the irrational angle $\\mathbf{q}\\cdot\\boldsymbol\\alpha$, with respect to the partition into the intervals $I_1,\\ldots,I_k$. Therefore, the word ${w_{{\\mathbf{q},\\mathbf{s}}}}$ is a direct product of $s_1\\cdots s_d$ unidimensional rotation words (of the same orientation): $${w_{{\\mathbf{q},\\mathbf{s}}}}\n =\\bigtimes_{\\mathbf{i}\\in[\\![\\mathbf{0},\\mathbf{s}-\\mathbf{1}]\\!]} ", "\n w(\\ell\\mathbf{q}+\\mathbf{i})_{\\ell\\in{\\mathbb{N}}}$$ By Lemma \\[lem:direct\\_prod\\_sturmian\\], we obtain that ${w_{{\\mathbf{q},\\mathbf{s}}}}$ is uniformly recurrent. ", "This proves that $w$ is URD.", "\n\n\\[rem:stronger-than-URD\\] We argue that the second proof of Proposition \\[prop:URD\\_isnot\\_SURD\\] shows that $d$-dimensional rotation words satisfy a stronger property than URD which is not the SURD property. ", "For any direction $\\mathbf{q}$ and any position $\\mathbf{p}$, the rotation angle of $(w(\\ell\\mathbf{q}+\\mathbf{p}))_{\\ell\\in{\\mathbb{N}}}$ is independent of $\\mathbf{p}$. Moreover, for any size $\\mathbf{s}$, any direction $\\mathbf{q}$ and any position $\\mathbf{p}$, we have $${w_{{\\mathbf{q},\\mathbf{s}}}}^{(\\mathbf{p})}\n =\\bigtimes_{\\mathbf{i}\\in[\\![\\mathbf{0},\\mathbf{s}-\\mathbf{1}]\\!]} ", "\n w(\\ell\\mathbf{q}+\\mathbf{i}+\\mathbf{p})_{\\ell\\in{\\mathbb{N}}}.$$ Thus, for any size $\\mathbf{s}$ and any direction $\\mathbf{q}$, there exists a constant $b$ such that for any $\\mathbf{p}$, each factor of length $b$ of the unidimensional word ${w_{{\\mathbf{q},\\mathbf{s}}}}^{(\\mathbf{p})}$ contains all factors of size $\\mathbf{s}$. Indeed, the constant $b$ only depends on the rotation angles of the words $ w(\\ell\\mathbf{q}+\\mathbf{i}+\\mathbf{p})_{\\ell\\in{\\mathbb{N}}}$, hence is independent of the origin $\\mathbf{p}$ (which is stronger than URD), although depends on the direction $\\mathbf{q}$ (which is weaker than SURD).", "\n\nIn the particular case of rotation words of the same slope $\\alpha$, one can directly prove (without using Furstenberg’s results) that their direct product is uniformly recurrent, except in some exceptional cases described below. ", "See [@Didier--1998] for similar concerns on rotation words.", "\n\nThe proof goes as follows. ", "Let $\\mathcal{R}_1,\\ldots,\\mathcal{R}_k$ be unidimensional lower (resp.", " upper) rotation word of intercepts $\\rho_1,\\ldots,\\rho_k$ respectively. ", "As in the proof of Proposition \\[prop:URD\\_isnot\\_SURD\\], for each $i$, the factor of length $s$ at position $m$ in $\\mathcal{R}_i$ corresponds to the interval of the point $\\rho_i+m\\alpha$.\n\nFor each $i$, let us shift all the intervals of the $i$-th circle by $\\rho_1-\\rho_i$. Now the factor at position $m$ of each $\\mathcal{R}_i$ corresponds to the (shifted) interval of the point $\\rho_i+(\\rho_1-\\rho_i)+m\\alpha = \\rho_1+m\\alpha$. Consider the intervals created as the intersections of all shifted intervals (we have at most $n_1\\cdots n_k$ of them where each $n_i$ is the number of intervals in the interval partition corresponding to $\\mathcal{R}_i$). ", "These new intervals correspond to the factors of the product $\\mathcal{R}_1\\times\\cdots\\times\\mathcal{R}_k$. Namely, the factor at position $m$ of $\\mathcal{R}_1\\times\\cdots\\times\\mathcal{R}_k$ corresponds to the interval containing the point $\\rho_1+m\\alpha$. This shows that $\\mathcal{R}_1\\times\\cdots\\times\\mathcal{R}_k$ is a rotation word. ", "So, it is uniformly recurrent by the three-gap theorem.", "\n\nIf some words are upper rotational, and some are lower rotational, their direct product might not be uniformly recurrent. ", "This occurs when some intersection of the intervals is a single point, which can only happen in the case when in one of the words the intervals are half-open on the right, and in the other one they are half-open on the left, and the orbit of each point contains this point. ", "On the other hand, if one of the words never touches the intervals endings (which corresponds to an orbit not containing zero), it means that orientation does not play any role for this word and we can assume it is the same as for the other word.", "\n\nFixed points of multidimensional square morphisms {#sec:morphism}\n=================================================\n\nSimilarly to unidimensional words, one can define morphisms and their fixed points in any dimension; for example, see [@Charlier--Karki--Rigo--2010; @Rigo--Maes--2002; @Salon--1987]. ", "For other kinds of multidimensional substitutions, we refer to the survey [@PriebeFrank--2008]. ", "For simplicity, we only consider constant length morphisms.", "\n\nA *$d$-dimensional morphism* of constant size $\\mathbf{s}=(s_1,\\ldots,s_d)\\in{\\mathbb{N}}^d$ is a map $\\varphi\\colon A\\to A^{[\\![\\mathbf{0},\\mathbf{s}-\\mathbf{1}]\\!]}$. For each $a\\in A$ and for each integer $n\\ge 2$, $\\varphi^n(a)$ is recursively defined as $$\\varphi^n(a)\\colon \n [\\![\\mathbf{0},\\mathbf{s}^n-\\mathbf{1}]\\!]\\to A,\\ \n \\mathbf{i}\\mapsto \\Big(\\varphi\\big((\\varphi^{n-1}(a))(\\mathbf{q})\\big)\\Big)(\\mathbf{r}),$$ where $\\mathbf{q}$ and $\\mathbf{r}$ are defined by the componentwise Euclidean division of $\\mathbf{i}$ by $\\mathbf{s}$: $\\mathbf{i}=\\mathbf{q}\\mathbf{s}+\\mathbf{r}$. With these notation, the *preimage* of the letter $\\big(\\varphi^n(a)\\big)(\\mathbf{i})$ is the letter $\\big(\\varphi^{n-1}(a)\\big)(\\mathbf{q})$. In the case $\\mathbf{s}=(s,\\ldots,s)$, we say that $\\varphi$ is a *$d$-dimensional square morphism of size $s$*.", "\n\nNote that $\\varphi^n(a)$ is obtained by concatenating $\\prod_{i=1}^d s_i$ copies of the images $\\varphi^{n-1}(b)$ for the letters $b$ occurring in $\\varphi(a)$. For instance, if $d=2$ and $\\mathbf{s}=(s_1,s_2)$, the $n$-th image $\\varphi^n(a)$ has size $\\mathbf{s}^n=(s_1^n,s_2^n)$ and, with the convention of Remark \\[rem:convention-2D\\], we have $$\\varphi^n(a)=\n \\begin{bmatrix}\n \\varphi^{n-1}(\\varphi(a)_{0,s_2-1}) & \\cdots & \\varphi^{n-1}(\\varphi(a)_{s_1-1,s_2-1})\\\\ \n \\vdots & & \\vdots \\\\\n \\varphi^{n-1}(\\varphi(a)_{0,0}) & \\cdots & \\varphi^{n-1}(\\varphi(a)_{s_1-1,0})\n \\end{bmatrix}$$ where we have used the lighter notation $\\varphi(a)_{i,j}$ instead of $\\big(\\varphi(a)\\big)(i,j)$.\n\nIn Figure \\[fig:preimage\\],\n\n$0\\mapsto\\begin{bmatrix}\n1 & 1 & 0\\\\ 0 & 0 & 1\n\\end{bmatrix},\\ \n1\\mapsto\\begin{bmatrix}\n1 & 0 & 1\\\\ 1 & 1 & 0\n\\end{bmatrix}$ starting from $1$. \\[fig:preimage\\]\n\nthe third iteration of a bidimensional morphism $\\varphi$ of size $\\mathbf{s}=(3,2)$ is given. ", "The gray zone corresponds to $\\varphi^2(1)$. The preimages of different letters is highlighted in colors. ", "For instance, the preimage of $\\varphi^3(1)_{4,7}$ (in red) is the letter $\\varphi^2(1)_{1,3}$ as $(4,7)=(1,3)\\mathbf{s}+(1,1)$ (where the product and sum are understood componentwise). ", "Note that it is also the preimage of $\\varphi^3(1)_{3,6},\\varphi^3(1)_{3,7}$ and $\\varphi^3(1)_{5,7}$ for example.", "\n\nLet $\\varphi$ be a $d$-dimensional morphism such that there exists $a\\in A$ with $\\varphi(a)_{0,0}=a$. We say that $\\varphi$ is *prolongable* on $a$ and the limit $\\lim_{n\\to\\infty}\\varphi^n(a)$ is well defined. ", "The limit $d$-dimensional infinite word so obtained is called the *fixed point* of $\\varphi$ beginning with $a$ and it is denoted by $\\varphi^\\omega(a)$. A $d$-dimensional infinite word is said to be *pure morphic* if it is the fixed point of a $d$-dimensional morphism.", "\n\nFigure \\[fig:sierpinski\\]\n\n$0\\mapsto\\begin{bmatrix}\n0 & 0\\\\ 0 & 0\n\\end{bmatrix}$, $1\\mapsto\\begin{bmatrix}\n1 & 0\\\\ 1 & 1\n\\end{bmatrix}$ starting from $1$. \\[fig:sierpinski\\]\n\ndepicts the first five iterations of a bidimensional square morphism with the convention that a black (resp.", " white) cell represents the letter 1 (resp.", " 0). ", "The limit object of this process is the famous Sierpinski gasket [@Stewart--1995].", "\n\nA first interesting observation is that in order to study the uniform recurrence along all directions (URD) of $d$-dimensional infinite words of the form $\\varphi^\\omega(a)$ for a square morphism $\\varphi$, we only have to consider the distances between consecutive occurrences of the letter $a$.\n\n\\[prop:reduction\\] Let $w$ be a fixed point of a $d$-dimensional square morphism of size $s$ and let $\\mathbf{q}$ be a direction. ", "If there exists $b\\in{\\mathbb{N}}$ such that $w(\\mathbf{0})$ occurs infinitely often along $\\mathbf{q}$ with gaps at most $b$, then for all $\\mathbf{m}\\in{\\mathbb{N}}^d$, the prefix of size $\\mathbf{m}$ of $w$ occurs infinitely often along $\\mathbf{q}$ with gaps at most $s^{\\lceil \\log_s( \\max\\mathbf{m})\\rceil} b$.\n\nLet $\\mathbf{m}\\in{\\mathbb{N}}^d$ and let $p$ be the prefix of size $\\mathbf{m}$ of $w$. Let $r$ be the integer defined by $s^{r-1}<\\max\\mathbf{m}\\le s^r$. In the $d$-dimensional infinite word $w$, if the letter $w(\\mathbf{0})$ occurs at position $\\mathbf{i}$, then the image $\\varphi^r(w(\\mathbf{0}))$ occurs at position $s^r\\mathbf{i}$. Therefore and because we consider a square morphism, if $w(\\mathbf{0})$ occurs infinitely often along $\\mathbf{q}$ with gaps at most $b$, then $p$ occurs infinitely often along $\\mathbf{q}$ with gaps at most $s^r b$.\n\nIn order to provide a family of SURD $d$-dimensional infinite words, we introduce the following definition.", "\n\nFor an integer $s\\ge2$ and $\\mathbf{i}=(i_1,\\ldots,i_d)\\in({\\mathbb{Z}}/s{\\mathbb{Z}})^d$ such that $i_1,\\ldots,i_d$ are coprime, we define $\\langle \\mathbf{i}\\rangle$ to be the additive subgroup of $({\\mathbb{Z}}/s{\\mathbb{Z}})^d$ that is generated by $\\mathbf{i}$: $$\\langle \\mathbf{i}\\rangle = \\{ k\\mathbf{i}\\colon k\\in {\\mathbb{Z}}/s{\\mathbb{Z}}\\}.$$ Then, we let $\\mathcal{C}(s)$ be the family of all cyclic subgroups of $({\\mathbb{Z}}/s{\\mathbb{Z}})^d$ generated by elements with $\\gcd(\\mathbf{i})=1$: $$\\mathcal{C}(s)=\\{\\langle \\mathbf{i}\\rangle\\colon \\mathbf{i}\\in({\\mathbb{Z}}/s{\\mathbb{Z}})^d, \\ \\gcd(\\mathbf{i})=1\\}.$$\n\n\\[proposition:main morphic\\] If $\\varphi$ is a $d$-dimensional square morphism of size $s$ prolongable on $a\\in A$ and such that, for every $C\\in\\mathcal{C}(s)$, there exists $\\mathbf{i}\\in C$ such that $\\varphi(b)_\\mathbf{i}=a$ for each $b\\in A$, then its fixed point $\\varphi^\\omega(a)$ is SURD. ", "More precisely, for each $\\mathbf{m}\\in{\\mathbb{N}}^d$, the prefix of size $\\mathbf{m}$ of $\\varphi^\\omega(a)$ occurs infinitely often along any direction with gaps at most $s^{\\lceil \\log_s( \\max\\mathbf{m})\\rceil+1}$.\n\nLet $\\mathbf{q}\\in{\\mathbb{N}}^d$ be a given direction. ", "Let $\\mathbf{r}=\\mathbf{q}\\bmod s$ (componentwise) and $d=\\gcd(\\mathbf{r})$. By hypothesis, there exists $\\mathbf{i}\\in\\langle\\frac 1d\\mathbf{r}\\rangle$ such that $(\\varphi(b))_\\mathbf{i}=a$ for each $b\\in A$. ", "Let $k\\in[\\![0,s-1]\\!]$ such that $\\mathbf{i}=\\frac kd\\mathbf{r} \\bmod s$. Then $k\\mathbf{q}\\equiv k\\mathbf{r}\\equiv d\\mathbf{i}\\pmod s$. Observe that $\\gcd(d,s)$ divides $\\mathbf{r}$ and $s$, hence also divides $\\mathbf{q}$. This implies that $\\gcd(d,s)=1$. Let $\\ell=d^{-1}k\\bmod s$. Then $\\ell \\mathbf{q}\\equiv \\mathbf{i}\\pmod s$. We obtain that for all $n\\in{\\mathbb{N}}$, $(\\ell +ns)\\mathbf{q}\\equiv \\mathbf{i}\\pmod s$, hence $(\\varphi^\\omega(a))_{(\\ell+ns)\\mathbf{q}}=a$. This proves that the letter $a$ occurs infinitely often in $\\varphi^\\omega(a)$ along the direction $\\mathbf{q}$ with gaps at most $s$.\n\nNow let $\\mathbf{m}\\in{\\mathbb{N}}^d$ and consider the prefix $p$ of size $\\mathbf{m}$ of $\\varphi^\\omega(a)$. From the first part of the proof and by using Proposition \\[prop:reduction\\], we obtain that $p$ occurs infinitely often along any direction with gaps at most $s^{\\lceil \\log_s( \\max\\mathbf{m})\\rceil+1}$.\n\nSince each subgroup of $({\\mathbb{Z}}/s{\\mathbb{Z}})^d$ contains $\\mathbf{0}$, the following result is immediate.", "\n\n\\[cor:1\\] Let $\\varphi$ be a $d$-dimensional square morphism of size $s$ such that $(\\varphi(b))_\\mathbf{0}=a$ for each $b\\in A$. ", "Then the fixed point $\\varphi^\\omega(a)$ is SURD. ", "More precisely, for each $\\mathbf{m}\\in{\\mathbb{N}}^d$, the prefix of size $\\mathbf{m}$ of $\\varphi^\\omega(a)$ occurs infinitely often along any direction with gaps at most $s^{\\lceil \\log_s( \\max\\mathbf{m})\\rceil+1}$.\n\nWhen the alphabet $A$ is binary (in which case we assume without loss of generality that $A=\\{0,1\\}$), then we talk about *binary* morphism and we always consider that it has a fixed point beginning with $1$.\n\nBy Corollary \\[cor:1\\], the fixed point $\\varphi^\\omega(1)$ of $$\\varphi\\colon\n0\\mapsto\\begin{bmatrix}\n0 & 0\\\\ 1 & 0\n\\end{bmatrix},\\quad \n1\\mapsto\\begin{bmatrix}\n0 & 1\\\\ 1 & 0\n\\end{bmatrix}$$ is SURD: for all $(m,n)\\in{\\mathbb{N}}^2$, the prefix of size $(m,n)$ of $\\varphi^\\omega(1)$ occurs infinitely often along any direction with gaps at most $2^{\\lceil \\log_s(\\max(m,n))\\rceil+1}$.\n\nWhen the size $s$ is prime, the subgroups of $\\mathcal{C}(s)$ corresponding to any two elements $\\mathbf{i}$ and $ \\mathbf{j}$ with coprime coordinates either coincide or have only the element $\\mathbf{0}$ in common. ", "Therefore we have exactly $\\frac{s^d-1}{s-1}$ distinct subgroups. ", "In particular, for $d=2$, this gives $s+1$ distinct subgroups. ", "Hence we can consider a partition of $({\\mathbb{Z}}/s{\\mathbb{Z}})^d$ into $s+2$ sets: $s+1$ subgroups without $\\mathbf{0}$ and $\\mathbf{0}$ itself. ", "When $s$ is not prime, the structure is a bit more complicated and we do not have such a nice partition. ", "Below we consider examples to illustrate the two situations.", "\n\nPartition for $s=5$ and $d=2$ can be illustrated by the following picture where each letter in $\\{\\alpha,\\ldots, \\zeta\\}$ represents a subgroup: $$\\begin{bmatrix}\n \\beta & \\zeta & \\epsilon & \\delta & \\gamma \\\\\n \\beta & \\delta & \\zeta & \\gamma & \\epsilon \\\\\n \\beta & \\epsilon & \\gamma & \\zeta & \\delta \\\\\n \\beta & \\gamma & \\delta & \\epsilon & \\zeta \\\\\n 0 & \\alpha & \\alpha & \\alpha & \\alpha\n \\end{bmatrix}$$ Due to Proposition \\[proposition:main morphic\\], in order to obtain a SURD fixed point of a bidimensional square morphism, it is enough to have the letter $a$ in one of the coordinates marked by each Greek letter in the image of each letter $b\\in A$. ", "And by Corollary \\[cor:1\\], having the letter $a$ in the coordinate $(0,0)$ in the image of each letter is enough.", "\n\nFor $s=6$ and $d=2$, one has 12 subgroups (which can be checked by considering the 36 possible cases of pairs of remainders of the Euclidean division by $6$, out of which there are only 21 coprime pairs to consider): $$\\begin{bmatrix}[c|c|c|c|c|c]\n\\beta & \\kappa & \\theta & \\zeta & \\delta & \\gamma \\\\ \n\\hline \n\\beta,\\zeta,\\lambda & \\iota & \\delta,\\kappa,\\epsilon & \\lambda & \\gamma,\\theta,\\iota & \\epsilon \\\\ \\hline \n\\beta,\\delta,\\theta,\\mu & \\eta & \\mu & \\gamma,\\zeta,\\kappa,\\eta & \\mu & \\eta \\\\ \n\\hline \n\\beta,\\zeta,\\lambda & \\epsilon & \\gamma,\\theta,\\iota & \\lambda & \\delta,\\epsilon,\\kappa & \\iota \\\\ \\hline \n\\beta & \\gamma & \\delta & \\zeta & \\theta & \\kappa \\\\ \\hline\n0 & \\alpha & \\alpha,\\eta,\\mu & \\alpha,\\lambda,\\iota,\\epsilon & \\alpha,\\eta,\\mu & \\alpha\n\\end{bmatrix}$$ Here are the correspondence between the 12 subgroups and letters (where we do not write $(0,0)$, which belongs to every subgroup): $$\\begin{tabular}{c|l|l}\n$\\alpha$ & $(1,0)$\n& $\\{(1,0),(2,0),(3,0),(4,0),(5,0)\\}$\\\\\n$\\beta$ & $(0,1)$\n& $\\{(0,1),(0,2),(0,3),(0,4),(0,5)\\}$\\\\\n$\\gamma$ & $(1,1)$ \n& $\\{(1,1),(2,2),(3,3),(4,4),(5,5)\\}$\\\\\n$\\delta$ & $(2,1),(4,5)$ \n& $\\{(2,1),(4,2),(0,3),(2,4),(4,5)\\}$\\\\\n$\\epsilon$ & $(1,2),(5,4)$\n& $\\{(1,2),(2,4),(3,0),(4,2),(5,4)\\}$\\\\\n$\\zeta$ & $(3,1),(3,5)$\n& $\\{(3,1),(0,2),(3,3),(0,4),(3,5)\\}$\\\\\n$\\eta$ & $(1,3),(5,3)$\n& $\\{(1,3),(2,0),(3,3),(4,0),(5,3)\\}$\\\\\n$\\theta$ & $(4,1),(2,5)$\n& $\\{(4,1),(2,2),(0,3),(4,4),(2,5)\\}$\\\\\n$\\iota$ & $(1,4),(5,2)$\n& $\\{(1,4),(2,2),(3,0),(4,4),(5,2)\\}$\\\\\n$\\kappa$ & $(5,1),(1,5)$\n& $\\{(5,1),(4,2),(3,3),(2,4),(1,5)\\}$\\\\\n$\\lambda$ & $(3,4),(3,2)$\n& $\\{(3,4),(0,2),(3,0),(0,4),(3,2)\\}$\\\\\n$\\mu$ & $(4,3),(2,3)$\n& $\\{(4,3),(2,0),(0,3),(4,0),(2,3)\\}$\n\\end{tabular}$$ We remark that here the subgroups intersect. ", "For example, the first and third subgroups have the element $(3,3)$ in common. ", "Due to Proposition \\[proposition:main morphic\\], in order to obtain a SURD word, it suffices to have the letter $a$ in the image of each letter in at least one of the elements of each subgroup. ", "For example, it is the case of the fixed point of any morphism with $a$’s in the marked positions in the images of each letter: $$\\begin{bmatrix}\n* & * & * & * & * & *\\\\\na & * & a & * & * & *\\\\\n* & * & * & a & * & *\\\\\n* & * & a & * & * & *\\\\\n* & * & * & * & * & *\\\\\n* & * & * & * & a & *\\\\\n\\end{bmatrix}$$\n\n\\[cor:morphism power\\] If $\\psi$ is a $d$-dimensional square morphism of size $s$ such that for some integer $i$, its power $\\varphi=\\psi^i$ satisfies the conditions of Proposition \\[proposition:main morphic\\], then the fixed point $\\psi^\\omega(a)$ is SURD. ", "More precisely, for all $\\mathbf{m}\\in{\\mathbb{N}}^d$, the prefix of size $\\mathbf{m}$ of $\\psi^\\omega(a)$ occurs infinitely often along any direction with gaps at most $s^{i\\lceil \\log( \\max\\mathbf{m})\\rceil+i}$.\n\nClearly, the fixed points of $\\psi$ and $\\varphi$ are the same. ", "Now apply Proposition \\[proposition:main morphic\\] to $\\varphi$.\n\nThe morphism $$\\psi\\colon 0\\mapsto \n\\begin{bmatrix}\n0 & 0 & 0\\\\\n1 & 1 & 1\\\\\n0 & 1 & 0\n\\end{bmatrix}, \\quad \n1\\mapsto\n\\begin{bmatrix}\n0 & 1 & 0\\\\\n1 & 0 & 1\\\\\n1 & 1 & 0 \n\\end{bmatrix}$$ satisfies the hypotheses of Corollary \\[cor:morphism power\\] for $s=3$, $i=2$. Indeed, it can be checked that for each $C\\in\\mathcal{C} (9)$, we can find a 1 at the same position in $C$ in both images $\\psi^2(0)$ and $\\psi^2(1)$.\n\n\\[rem:primitivity\\] The hypotheses of Proposition \\[proposition:main morphic\\] should be compared to the primitivity property of a morphism. ", "In the unidimensional case, a morphism is said to be primitive if its incidence matrix is primitive, or equivalently, if some power of the morphism is such that all letters appear in the image of every letter; see for example [@Durand--1998]. ", "It is well known that fixed points of primitive morphisms are uniformly recurrent. ", "This notion of primitivity generalizes naturally to any dimension $d$. However, if we are interested in studying the URD property, the natural generalization of primitivity is not accurate: we should not only consider the number of times a letter occurs in the image of another letter but also the positions where the letter occurs within each image. ", "See Section \\[sec:perspectives\\] for some perspectives in this direction.", "\n\nNow we give a family of examples of SURD $d$-dimensional words which do not satisfy the hypotheses of Corollary \\[cor:morphism power\\], showing that it does not give a necessary condition. ", "We first need the following observation on unidimensional fixed points of morphisms.", "\n\n\\[lem:001-101\\] Let $\\varphi$ be a unidimensional morphism of constant prime size $s$ and prolongable on $a\\in A$ for which there exists $i\\in [\\![0,s-1]\\!]$ such that $\\varphi(b)_i=a$ for each $b\\in A$. ", "For all positive integers $m$, any factor of length $s$ of the infinite word $(\\varphi^\\omega(a)_{mk})_{k\\in{\\mathbb{N}}}$ contains the letter $a$.\n\nLet $w=\\varphi^\\omega(a)$ and let $m$ be a positive integer. ", "The integer $m$ can be decomposed in a unique way as $m=s^e\\ell$ with $e,\\ell\\in{\\mathbb{N}}$ and $\\ell\\not\\equiv 0\\pmod s$. We prove the result by induction on $e\\in{\\mathbb{N}}$. If $e=0$ then $m\\not\\equiv 0\\pmod s$. Then for all $k\\in{\\mathbb{N}}$, at least one of the $s$ integers $m k$, $m (k+1),\\ldots,m (k+s-1)$ is congruent to $i$ modulo $s$. Since the letter $a$ appears in the $i$-th place of the images of all letters, at least one of the letters $w_{m k}$, $w_{m (k+1)},\\ldots,w_{m (k+s-1)}$ is equal to $a$. Now suppose that $e>0$ and that the result is correct for $e-1$. Observe that, for every $k\\in{\\mathbb{N}}$, the preimage of the letter $w_{mk}=w_{s^e\\ell k}$ is the letter $w_{\\frac ms k}=w_{s^{e-1}\\ell k}$. Since the morphism is prolongable on $a$ and since $m\\equiv 0\\pmod s$, for each $k\\in{\\mathbb{N}}$, the letter $w_{mk}$ is equal to $a$ if its preimage is $a$. But by induction hypothesis, for all $k\\in{\\mathbb{N}}$, at least one of the $s$ preimages $w_{\\frac ms k}$, $w_{\\frac ms (k+1)},\\ldots,w_{\\frac ms (k+s-1)}$ is equal to $a$. Therefore, we obtain that for all $k\\in{\\mathbb{N}}$, at least one of the $s$ letters $w_{m k}$, $w_{m (k+1)},\\ldots,w_{m (k+s-1)}$ is equal to $a$ as well.", "\n\n\\[prop:SURDcor-not-necessary\\] If $\\varphi$ is a $d$-dimensional square morphism of some prime size $s$ and prolongable on $a\\in A$ such that\n\n1. ", " \\[eq:1\\] $\\forall i_2,\\ldots,i_d\\in[\\![0,s-1]\\!]$, $\\varphi(a)_{0,i_2,\\ldots,i_d}=a$\n\n2. ", " \\[eq:2\\] $\\exists i_1\\in[\\![0,s-1]\\!]$, $\\forall i_2,\\ldots,i_d\\in[\\![0,s-1]\\!]$, $\\varphi(b)_{i_1,\\ldots,i_d}=a$ for each $b\\in A$\n\nthen $\\varphi^\\omega(a)$ is SURD.", "\n\nBy Proposition \\[prop:reduction\\], we only have to show that there exists a uniform bound $t$ such that the letter $a$ occurs infinitely often along any direction of $\\varphi^\\omega(a)$ with gaps bounded by $t$. It is sufficient to prove the result for the fixed point beginning with $1$ of the binary morphism $\\psi$ satisfying the hypotheses $\\eqref{eq:1}$ and $\\eqref{eq:2}$ and having $0$ at any other coordinates in the images of both $0$ and $1$. Indeed, the fixed point $\\varphi^\\omega(a)$ of any morphism $\\varphi$ satisfying $\\eqref{eq:1}$ and $\\eqref{eq:2}$ differs from this one only by replacing occurrences of $1$ by $a$ and occurrences of $0$ by any letter of the alphabet. ", "For example, for $d=2$, the morphism $\\psi$ is $$\\psi\\colon \n 0\\mapsto \n \\begin{bmatrix}\n 0 & 0 & \\cdots & 0 & 1 & 0 & \\cdots & 0 \\\\\n 0 & 0 & \\cdots & 0 & 1 & 0 & \\cdots & 0 \\\\\n \\vdots & \\vdots &&&&&& \\vdots\\\\ \n 0 & 0 & \\cdots & 0 & 1 & 0 & \\cdots & 0 \n \\end{bmatrix}, \\quad \n 1\\mapsto\n \\begin{bmatrix}\n 1 & 0 & \\cdots & 0 & 1 & 0 & \\cdots & 0 \\\\\n 1 & 0 & \\cdots & 0 & 1 & 0 & \\cdots & 0 \\\\\n \\vdots & \\vdots &&&&&& \\vdots\\\\ \n 1 & 0 & \\cdots & 0 & 1 & 0 & \\cdots & 0 \n \\end{bmatrix}$$ (where the common columns of $1$’s are placed at position $i_1$ in both images). ", "Each of the hyperplanes $$H_k=\\{\\psi^\\omega(1)_{k,i_2\\ldots,i_d}\\colon i_2,\\ldots,i_d\\in{\\mathbb{N}}\\},\\ {\\mathrm{\\ for \\ }}k\\in{\\mathbb{N}}$$ of $\\psi^\\omega(1)$ contains either only $0$’s or only $1$’s. ", "Therefore, for any direction $\\mathbf{q}=(q_1,\\ldots,q_d)$, we have $\\psi^\\omega(1)_{\\ell \\mathbf{q}}=\\psi^\\omega(1)_{\\ell q_1,0,\\ldots,0}$, hence the unidimensional word ${\\mathbb{N}}\\to A,\\ \\ell\\mapsto \\psi^\\omega(1)_{\\ell \\mathbf{q}}$ is the fixed point of the unidimensional morphism $$\\sigma\\colon 0\\mapsto \\begin{bmatrix}\n 0 & 0 & \\cdots & 0 & 1 & 0 & \\cdots & 0 \n \\end{bmatrix}, \\quad \n 1\\mapsto\n \\begin{bmatrix}\n 1 & 0 & \\cdots & 0 & 1 & 0 & \\cdots & 0 \\\\\n \\end{bmatrix}$$ (where, again, the common $1$’s are placed at position $i_1$ in both images). ", "By Lemma \\[lem:001-101\\], we obtain that $\\psi^\\omega(1)$ is SURD with the uniform bound $t=s$.\n\nNote that the role of the first coordinate $i_1$ could be played by any of the other coordinates $i_2,\\ldots,i_d$ with the ad hoc modifications in the statement of Proposition \\[prop:SURDcor-not-necessary\\].", "\n\nNow we give a sufficient condition for a $d$-dimensional word to be non URD.", "\n\n\\[prop:suff-not-nec\\] Let $\\varphi$ be a $d$-dimensional square morphism of a prime size $s$ prolongable on $a\\in A$. ", "Let $\\mathbf{q}$ be a direction and let $C=\\langle \\mathbf{q} \\bmod{s} \\rangle$. If $\\varphi(b)_\\mathbf{i}\\neq a$ for each $b\\in A$ and $\\mathbf{i}\\in C$ except for $\\varphi(a)_\\mathbf{0}=a$, then $(\\varphi^\\omega(a)_{\\ell\\mathbf{q}})_{i\\in{\\mathbb{N}}}\\in a (A\\setminus \\{a\\})^\\omega$. In particular, $\\varphi^\\omega(a)$ is not recurrent along the direction $\\mathbf{q}$.\n\nSuppose that the first occurrence of $a$ after that in position $\\mathbf{0}$ along the direction $\\mathbf{q}$ occurs in position $\\ell \\mathbf{q}$. Since, for each $b\\in A$, $\\varphi(b)$ has non-$a$ elements on all places defined by $C\\setminus \\{\\mathbf{0}\\}$, the letter $\\varphi^\\omega(a)_{\\ell \\mathbf{q}}$ must be placed at the coordinate $\\mathbf{0}$ of the image of $a$. In particular, the preimage of $\\varphi^\\omega(a)_{\\ell \\mathbf{q}}$ must be $a$. Because $s$ is prime, $\\ell$ must be divisible by $s$ and the preimage of $\\varphi^\\omega(a)_{\\ell \\mathbf{q}}$ is $\\varphi^\\omega(a)_{\\frac{\\ell}{s}\\mathbf{q}}$. But by the choice of $\\ell$ and since $0<\\frac{\\ell}{s}<\\ell$, we must also have $\\varphi^\\omega(a)_{\\frac{\\ell}{s}\\mathbf{q}}\\neq a$, a contradiction.", "\n\nThe next results shows that the condition of Proposition \\[prop:suff-not-nec\\] is not necessary.", "\n\nThe fixed point $\\varphi^{\\omega}(1)$ of the morphism $$\\varphi:0\\mapsto \n \\begin{bmatrix}\n 1 & 1 & 0\\\\\n 0 & 0 & 0\\\\\n 0 & 0 & 1\n \\end{bmatrix}\n \\quad 1\\mapsto \n \\begin{bmatrix}\n 1 & 1 & 1\\\\\n 0 & 1 & 0\\\\\n 1 & 1 & 0 \n \\end{bmatrix}$$ is not recurrent along the direction $(1,3)$.\n\nWe let $w=\\varphi^{\\omega}(1)$. We show that the sequence we get along the direction $(1,3)$ is $10^\\omega$. It can be seen directly that the first symbols are 100, then we proceed by induction. ", "Suppose the converse, and that $i$ is the smallest positive integer such that $w_{i,3i}=1$. We consider three cases: $i=3i'$, $i=3i'+1$, or $i=3i'+2$. In each case, our aim is to prove that $w_{i',3i'}=1$, contradicting the minimality of $i$.\n\nCase 1: $i=3i'$. In this case $\\varphi(w_{i',3i'})_{0,0}=w_{i,3i}$. Since $\\varphi(0)_{0,0}=0$ and $w_{i,3i}=1$ by the assumption, we must have $w_{i',3i'}=1$.\n\nCase 2: $i=3i'+1$. In this case $\\varphi(w_{i',3i'+1})_{1,0}=w_{i,3i}$. Since $\\varphi(0)_{1,0}=0$ and $w_{i,3i}=1$, we have $w_{i',3i'+1}=1$. The coordinate $(i',3i'+1)$ being a position $(i' \\bmod 3, 1)$ in some image $\\varphi(a)$, this is possible only in the case when $a=1$ and $i'\\equiv 1 \\pmod 3$. Indeed, this is the only non-0 position with second coordinate 1 in $\\varphi(0)$ and $\\varphi(1)$. Therefore, we obtain $w_{i',3i'}=1$.\n\nCase 3: $i=3i'+2$. In this case $\\varphi(w_{i',3i'+2})_{2,0}=w_{i,3i}$. Since $\\varphi(1)_{2,0}=0$ and $w_{i,3i}=1$, we have $w_{i',3i'+2}=0$. The coordinate $(i',3i'+2)$ being a position $(i' \\bmod 3, 2)$ in some image $\\varphi(a)$, we must have $a=0$ and $i'\\equiv 2 \\pmod 3$. Indeed, this is the only non-1 position with second coordinate 2 in $\\varphi(0)$ and $\\varphi(1)$. We obtain once again that $w_{i',3i'}=1$.\n\nThe next theorem gives a characterization of SURD fixed points of square binary morphisms of size $2$.\n\n\\[thm:characterization\\] Let $\\varphi$ be a bidimensional binary square morphism of size $2$ prolongable on $1$. The fixed point $\\varphi^\\omega(1)$ is SURD if and only if either $\\varphi(0)_{0,0}=1$ or $\\varphi(1)=\\left[\\begin{smallmatrix}\n 1 & 1 \\\\\n 1 & 1\n \\end{smallmatrix}\\right]$.\n\nThe “if” part follows from Corollary \\[cor:1\\]. ", "The “only if” part is proven with a rather technical argument involving a case study analysis and using certain properties of arithmetic progressions in the Thue-Morse word $\\mathbf{t}=0110100110010110\\cdots$.\n\nWe first provide two useful lemmas about the Thue-Morse word [@Thue--1906]. ", "Recall that this word is the fixed point of the unidimensional morphism $0\\mapsto 01,\\ 1\\mapsto 10$. It can also be defined thanks to the function $s_2\\colon{\\mathbb{N}}\\to {\\mathbb{N}}$ that returns the sum $s_2(n)$ of the digits in the binary expansion of $n$: the $(n+1)$-th letter $t_n$ of the Thue-Morse word $\\mathbf{t}$ is equal to $0$ if $s_2(n)\\equiv 0\\pmod 2$ and to $1$ otherwise.", "\n\n\\[lemma:TM1\\] For any $\\ell\\in{\\mathbb{N}}$, the Thue–Morse word $\\mathbf{t}=(t_n)_{n\\in {\\mathbb{N}}}$ satisfies $t_0=0$ and $t_d=t_{2d}=t_{3d}=\\ldots=t_{2^\\ell d}$ with $d=2^{\\ell}-1$. Moreover, $t_d=1$ if $\\ell$ is odd and $t_d=0$ if $\\ell$ is even.", "\n\nLet $m\\in[\\![1,2^\\ell]\\!]$. There exist $r$ odd and $i\\geq 0$ such that $m = r2^i$. Denote by $r_j r_{j-1}\\cdots r_1 r_0$ the binary expansion $(r)_2$ of $r$. In particular, $r_0=1$ since $r$ is odd. ", "Also $r\\leq m\\leq 2^\\ell$ and $r$ odd imply that $r<2^\\ell$ and $|(r)_2|\\leq \\ell$. We have $(r2^\\ell)_2=r_j r_{j-1}\\cdots r_1 r_0 0^\\ell$ and $(r2^\\ell-1)_2=r_j r_{j-1}\\cdots r_1 0 1^\\ell$. Therefore, $$\\begin{aligned}\n s_2(r(2^\\ell-1)) &= s_2(r2^\\ell -1-(r-1)) \\\\\n &= s_2(r)-1+\\ell-s_2(r-1) \\tag{as $|(r)_2|\\leq \\ell$}\\\\\n &= s_2(r)-1+\\ell-s_2(r)+1 \\tag{as $r$ odd}\\\\\n &= \\ell.\\end{aligned}$$ Since $s_2(m(2^\\ell-1))=s_2(r(2^\\ell-1))=\\ell$, the conclusion follows.", "\n\nNote that the proof of the previous lemma is a modification of Lemma 3.2 in [@Bucci--2013].", "\n\n\\[lemma:TM0\\] For any positive integer $\\ell$, the Thue–Morse word $\\mathbf{t}=(t_n)_{n\\in {\\mathbb{N}}}$ satisfies $t_{0}=t_{d}=t_{2d}=\\ldots=t_{2^\\ell d}=0$ with $d=2^\\ell+1$.\n\nLet $m\\in[\\![0,2^\\ell-1]\\!]$. Since $m<2^\\ell$, $|(m)_2|\\leq \\ell $. ", "So $s_2(m(2^\\ell+1))=s_2(m)+s_2(m)$ is even. ", "It follows that $t_{m(2^\\ell+1)}=0$. For $m=2^\\ell$, we have $s_2(m(2^\\ell+1))=s_2(2^{2\\ell}+2^\\ell)=2$ and $t_{m(2^\\ell+1)}=0$.\n\nThe condition is sufficient by Corollary \\[cor:1\\]. ", "To prove that it is necessary, we show by a case study that the fixed points beginning with $1$ of all the other possible morphisms are not SURD. ", "For the sake of clarity, we set $w=\\varphi^\\omega(1)$.\n\nFirst, note that $\\varphi(1)_{i,j}=\\varphi(0)_{i,j}=0$ for some $(i,j)\\ne (0,0)$ implies that $w$ contains $10^\\omega$ along the direction $(i,j)$. Hence for a given position $(i,j)$, it is sufficient to consider $(\\varphi(1)_{i,j},\\varphi(0)_{i,j})\\in\\{(0,1),(1,0),(1,1)\\}$. The graph of our case study is depicted in Figure \\[fig:2x2\\].", "\n\n[**Case 1**]{} $$\\varphi\\colon 0\\mapsto \n\\begin{bmatrix} \n 1 & *\\\\ 0 & 1 \n\\end{bmatrix}, \\quad \n1\\mapsto \n\\begin{bmatrix}\n 0 & *\\\\ 1 & 0 \n\\end{bmatrix}$$\n\nWe show that the factor $10^{2^\\ell-1}$ occurs along the direction $(p,q) =(2^{2\\ell} (2^\\ell-1),2^\\ell +1)$ with $\\ell$ odd (see Figure \\[fig:case1\\]). ", "First note that the first row of $\\varphi^\\omega(1)$ is equal to $\\bar{\\mathbf{t}}$. Hence, the first $2^{2\\ell}$ rows contain $\\varphi^{2\\ell}(\\bar{\\mathbf{t}})$. Let $d=2^{\\ell}-1$. By Lemma \\[lemma:TM1\\], the arithmetical subsequence $(\\bar{t}_{md})_{m\\in {\\mathbb{N}}}$ begins with $10^{2^\\ell}$. Thus, $w_{mp,0}=w_{md2^{2\\ell},0}=w_{md,0}=0$ for $m\\in\\{1,\\ldots,2^\\ell\\}$. To conclude, observe that the first column of $\\varphi^{2\\ell}(0)$ is a prefix of $\\mathbf{t}$. By Lemma \\[lemma:TM0\\], the arithmetical subsequence $(t_{mq})_{m\\in {\\mathbb{N}}}$ begins with $0^{2^\\ell}$. Let $m\\in[\\![1,2^\\ell-1]\\!]$. As $(2^\\ell -1)q= 2^{2\\ell}-1 < 2^{2 \\ell}$, the letter $w_{mp,mq}$ is inside a square $\\varphi^{2\\ell}(0)$ with the bottom left corner at position $(mp,0)$, hence $w_{mp,mq}=0$.\n\n=\\[shape=rectangle,fill=none,draw=none,minimum size=0cm,inner sep=2pt\\] =\\[draw=black,line width = 0.5pt\\]\n\n(0,0) rectangle (6.4,6.4); at (3.2,3.2)[$\\varphi^{2\\ell}(1)$]{}; at (0.2,0.2)[1]{}; at (0.2,0.5)[0]{}; at (0.2,0.8)[0]{}; at (0.2,1.1)[1]{}; (0.2,1.3)–(0.2,1.8); at (0.2,2)[1]{}; (0.2,2.7)–(0.2,3.1); at (0.2,3.8)[1]{}; (0.2,4.5)–(0.2,4.9); at (0.2,5.6)[1]{}; (0.2,5.9)–(0.2,6.3);\n\nin [10,20,30]{} [ (,0) rectangle (6.4+,6.4); at (+3.2,3.2)[$\\varphi^{2\\ell}(0)$]{}; at (+0.2,0.2)[0]{}; at (+0.2,0.5)[1]{}; at (+0.2,0.8)[1]{}; at (+0.2,1.1)[0]{}; (+0.2,1.3)–(+0.2,1.8); at (+0.2,2)[0]{}; (+0.2,2.7)–(+0.2,3.1); at (+0.2,3.8)[0]{}; (+0.2,4.5)–(+0.2,4.9); at (+0.2,5.6)[0]{}; (+0.2,5.9)–(+0.2,6.3); ]{} in [0,10,20]{} [ at (+1.5+6.4,3)[$\\ldots$]{}; ]{}\n\n=\\[draw=red,line width = 1pt, -&gt;\\] (0.4,0.1) to \\[bend left = 5\\] node \\[above\\] [$p$]{} (10,0.1); (10+0.4,2) to \\[bend left = 5\\] node \\[above\\] [$p$]{} (10+10,2); (20+0.4,3.9) to \\[bend left = 5\\] node \\[above\\] [$p$]{} (20+10,3.9); (10+0.5,0.2+0.1) to \\[bend right = 20\\] node \\[right\\] [$q$]{} (10+0.5,0.2+1.7); (20+0.5,2.0+0.1) to \\[bend right = 20\\] node \\[right\\] [$q$]{} (20+0.5,2.0+1.7); (30+0.5,3.8+0.1) to \\[bend right = 20\\] node \\[right\\] [$q$]{} (30+0.5,3.8+1.7);\n\n[**Case 2**]{} $$\\varphi\\colon 0\\mapsto \n\\begin{bmatrix} \n 1 & *\\\\ 0 & 0 \n\\end{bmatrix}, \\quad \n1\\mapsto \n\\begin{bmatrix}\n 0 & *\\\\ 1 & 1\n\\end{bmatrix}$$\n\nIn this case we will prove that for all odd $n\\in{\\mathbb{N}}$, the factor $0^{2^n-1}$ occurs along the direction $(1, (2^n-1)2^n)$. More precisely, we claim that for all odd $n\\in{\\mathbb{N}}$ and all $i\\in[\\![1,2^n-1]\\!]$, we have $w_{i,i(2^n-1)2^n}=0$. First, notice that there are only $0$’s on the bottom line of the images $\\varphi^m(0)$ for all $m\\in{\\mathbb{N}}$, namely, $\\varphi^m(0)_{i,0}=0$ for all $m\\in{\\mathbb{N}}$ and all $i\\in[\\![0, 2^m-1]\\!]$. Second, we use Lemma \\[lemma:TM1\\] which gives $w_{0,i(2^n-1)}=0$ for all odd $n\\in{\\mathbb{N}}$ and all $i\\in[\\![1,2^n]\\!]$. By applying the power morphism $\\varphi^n$, we get $w_{0,i(2^n-1)2^n}=0$ for all odd $n\\in{\\mathbb{N}}$ and all $i\\in[\\![1, 2^n]\\!]$. Since the latter points belong to left bottom corner of $\\varphi^n(0)$, we obtain that $w_{i,i(2^n-1)2^n}=0$ for every $i\\in[\\![1, 2^n-1]\\!]$ as desired.", "\n\n[**Case 3.1**]{} $$\\varphi\\colon 0\\mapsto \n\\begin{bmatrix} \n 1 & 1\\\\ 0 & * \n\\end{bmatrix}, \\quad \n1\\mapsto \n\\begin{bmatrix}\n 0 & 0\\\\ 1 & * \n\\end{bmatrix}$$\n\nSimilarly to Case 1, we can show that the factor $10^{2^\\ell-1}$ occurs along the direction $(p,q) =(2^\\ell +1,2^{2\\ell} (2^\\ell-1)+2^\\ell +1)$ with $\\ell$ odd. ", "Indeed, in this case, the Thue-Morse word or its complement appears in the first column and in the diagonal; see Figure \\[fig:case3-1\\].", "\n\n=\\[shape=rectangle,fill=none,draw=none,minimum size=0cm,inner sep=2pt\\] =\\[draw=black,line width = 0.5pt\\]\n\n(0,0) rectangle (6.4,6.4); at (5,1.3)[$\\varphi^{2\\ell}(1)$]{}; at (0.2,0.2)[1]{}; at (0.5,0.5)[0]{}; at (0.8,0.8)[0]{}; at (1.1,1.1)[1]{}; (1.3,1.3)–(1.8,1.8); at (2,2)[1]{}; (2.7,2.7)–(3.1,3.1); at (3.8,3.8)[1]{}; (4.5,4.5)–(4.9,4.9); at (5.6,5.6)[1]{}; (5.9,5.9)–(6.3,6.3);\n\nin [10,20,30]{} [ (0,) rectangle (6.4,+6.4); at (5,1.3+)[$\\varphi^{2\\ell}(0)$]{}; at (0.2,0.2+)[0]{}; at (0.5,0.5+)[1]{}; at (0.8,0.8+)[1]{}; at (1.1,1.1+)[0]{}; (1.3,1.3+)–(1.8,1.8+); at (2,2+)[0]{}; (2.7,2.7+)–(3.1,3.1+); at (3.8,3.8+)[0]{}; (4.5,4.5+)–(4.9,+4.9); at (5.6,+5.6)[0]{}; (5.9,5.9+)–(6.3,+6.3); ]{} in [0,10,20]{} [ at (3,1.5+6.4+)[$\\vdots$]{}; ]{}\n\n=\\[draw=red,line width = 1pt, -&gt;\\] (-0.1,0.3) to \\[bend left = 5\\] node \\[left\\] [$q$]{} (-0.1,12); (1.8,12.2) to \\[bend left = 5\\] node \\[left\\] [$q$]{} (1.8,23.8); (3.6,24) to \\[bend left = 5\\] node \\[left\\] [$q$]{} (3.6,35.6); (0.2,12) to \\[bend left = 20\\] node \\[above\\] [$p$]{} (0.2+1.6,12); (2,23.8) to \\[bend left = 20\\] node \\[above\\] [$p$]{} (2.0+1.6,23.8); (3.8,35.6) to \\[bend left = 20\\] node \\[above\\] [$p$]{} (3.8+1.6,35.6);\n\n[**Case 3.2**]{} $$\\varphi\\colon 0\\mapsto \n\\begin{bmatrix} \n 1 & *\\\\ 0 & 1 \n\\end{bmatrix}, \\quad \n1\\mapsto \n\\begin{bmatrix}\n 0 & 1\\\\ 1 & 1\n\\end{bmatrix}$$\n\nIn this case we will prove that the word is not recurrent in direction $(2,1)$. More precisely, we show that $(w_{2i,i})_{i\\in{\\mathbb{N}}}=10^\\omega$. Clearly $w_{0,0}=1$. We prove $w_{2i,i}=0$ for all $i\\ge 1$ by induction on $i$. The base case $w_{2,1}=0$ is easily verified. ", "Now let $i>1$ and suppose that $w_{2i',i'}=0$ for all $1\\le i'<i$. If $i$ is even, then $w_{2i,i}=\\varphi(w_{i,\\frac i2})_{0,0}=0$, where the last equality comes from the induction hypothesis with $i'=\\frac i2$ and the fact that $\\varphi(0)_{0,0}=0$. If $i$ is odd, then $w_{2i,i}=\\varphi(w_{i,\\frac{i-1}{2}})_{0,1}$. Remark that $w_{i,\\frac{i-1}{2}}$ is an element in a right column of a $2\\times 2$ block which is an image of $0$ or $1$. An element $w_{i-1,\\frac{i-1}{2}}$ (which is equal to $0$ by induction hypothesis with $i'=\\frac{i-1}{2}$) is an element in the same block which is situated to the left of $w_{i,\\frac{i-1}{2}}$. Due to the forms of $\\varphi(0)$ and $\\varphi(1)$, if a left element is 0, then the right element in the same line is $1$. So, $w_{i,\\frac{i-1}{2}}=1$, hence $w_{2i,i}=\\varphi(1)_{0,1}=0$.\n\n[**Case 4**]{}\n\nWe can suppose that $$\\varphi\\colon \n0\\mapsto \n\\begin{bmatrix} \n * & *\\\\ 0 & * \n\\end{bmatrix}, \\quad \n1\\mapsto \n\\begin{bmatrix} \n 1 & 0\\\\ 1 & 1 \n\\end{bmatrix}$$ for otherwise $\\varphi(1)=\\left[\\begin{smallmatrix}\n 1 & 1 \\\\\n 1 & 1\n \\end{smallmatrix}\\right]$.\n\nIn this case we will prove that for all $n\\in{\\mathbb{N}}$, the factor $0^{2^n-1}$ occurs along the direction $(2^n-1,1)$. More precisely, for all $n\\in{\\mathbb{N}}$, we have $w_{j(2^n-1),j}=0$ for every $j\\in[\\![1, 2^n-1]\\!]$. First, an easy induction on $n$ shows that there are $0$ just above the diagonal from upper left to lower right in the images $\\varphi^n(1)$ for all $n\\ge 1$, namely $\\varphi^n(1)_{2^n-j,j}=0$ for all $n\\ge 1$ and all $j\\in[\\![1,2^n-1]\\!]$. For example, for $n=3$, we have $$\\varphi^3(1)\n=\\varphi^2\n\\begin{bmatrix}\n 1 & 0\\\\ 1 & 1 \n\\end{bmatrix}\n=\\begin{bmatrix}[cccc|cccc]\n 1 & \\mathbf{0} & * & * & * & * & * & * \\\\\n 1 & 1 & \\mathbf{0} & * & * & * & * & * \\\\\n 1 & 0 & 1 & \\mathbf{0} & * & * & * & * \\\\ \n 1 & 1 & 1 & 1 & \\mathbf{0} & * & * & * \\\\ \n \\hline\n 1 & \\mathbf{0} & * & * & 1 & \\mathbf{0} & * & * \\\\ \n 1 & 1 & \\mathbf{0} & * & 1 & 1 & \\mathbf{0} & * \\\\ \n 1 & \\mathbf{0} & 1 & \\mathbf{0} & 1 & 0 & 1 & \\mathbf{0} \\\\ \n 1 & 1 & 1 & 1 & 1 & 1 & 1 & 1\n\\end{bmatrix}.$$ Second, since $w_{i,0}=1$ for all $i\\in{\\mathbb{N}}$, we obtain that, for all $n,k\\in{\\mathbb{N}}$, the square factor of size $2^n$ occurring at position $(2^n k,0)$ is equal to $\\varphi^n(1)$. Therefore, we have $w_{2^n k + 2^n-j,j}=0$ for all $n,k\\in{\\mathbb{N}}$ and $j\\in\\{1,\\ldots,2^n-1\\}$. The claim follows by considering the latter equality with $k=j-1$.\n\nThe previous theorem gives a characterization of strong uniform recurrence along all directions for fixed points of bidimensional square binary morphisms of size $2$. For larger sizes of the morphism, we gave several conditions that are either necessary (Proposition \\[prop:suff-not-nec\\]) or sufficient (Propositions \\[proposition:main morphic\\] and \\[prop:SURDcor-not-necessary\\]). ", "An open problem is to find a necessary and sufficient condition in general (see Section \\[sec:perspectives\\]).", "\n\nWe end this section by a small discussion on the SSURDO notion. ", "First we provide an example of SSURDO aperiodic word. ", "Then, we give an example of a SURD word that is not SSURDO.", "\n\n\\[prop:SSURDO\\] Let $\\varphi$ be the square binary morphism defined by $$\\varphi\\colon \n 0\\mapsto \n \\begin{bmatrix}\n 1 & 0 &0 \\\\\n 1 & 0 & 1 \\\\\n 1 & 0 & 0\n \\end{bmatrix}, \\quad \n 1\\mapsto\n \\begin{bmatrix}\n 1 & 0 &1 \\\\\n 1 & 0 & 1 \\\\\n 1 & 0 & 0\n \\end{bmatrix}.$$ The fixed point $\\varphi^\\omega(1)$ is SSURDO.", "\n\nLet $w=\\varphi^\\omega(1)$ and $\\mathbf{q}$ be any direction. ", "By definition of $\\varphi$, for every position $\\mathbf{p}\\not\\equiv (2,2) \\pmod{3}$, we have $w(\\mathbf{p})=w(\\mathbf{p}\\bmod{3})$. If follows that $w(\\mathbf{p})= w(\\mathbf{p}+3\\mathbf{q})$ for all such $\\mathbf{p}$. Consider now a position $\\mathbf{p}\\equiv (2,2)\\pmod{3}$. Since $\\gcd(\\mathbf{q})=1$, we have $\\mathbf{p}+\\mathbf{q}\\not \\equiv (2,2)\\pmod{3}$ and $\\mathbf{p}+2\\mathbf{q}\\not \\equiv (2,2)\\pmod{3}$. So $w(\\mathbf{p}+\\mathbf{q})=w((\\mathbf{p}+\\mathbf{q})\\bmod{3})$ and $w(\\mathbf{p}+2\\mathbf{q})=w((\\mathbf{p}+2\\mathbf{q})\\bmod{3})$. By checking all the possible values modulo $3$ of $\\mathbf{p}+\\mathbf{q}$ and $\\mathbf{p}+2\\mathbf{q}$, we can verify that $w(\\mathbf{p}+\\mathbf{q})\\neq w(\\mathbf{p}+2\\mathbf{q})$. So the letter $w(\\mathbf{p})$ along the direction $\\mathbf{q}$ is firstly repeated within a distance two, then it is repeated every three letters.", "\n\nNow consider a position $\\mathbf{p}$ and a factor $f$ of size $\\mathbf{s}$ occurring at position $\\mathbf{p}$. Let $i=\\lceil \\max (\\log_3 \\mathbf{s})\\rceil$. We will show that $f$ occurs along $\\mathbf{q}$ with gaps bounded by $3^{i+1}$. To do so, we will consider a covering of the grid by the square factors $\\varphi^i(0)$ and $\\varphi^i(1)$ and study the position of the factor $f$ relatively to this covering; see Figure \\[fig:SSURDO\\].", "\n\nIf $f$ occurs “completely” inside a factor $\\varphi^i(0)$ or $\\varphi^i(1)$, i.e. if $$\\exists \\mathbf{k}\\in{\\mathbb{N}}^2,\\quad \n 3^i\\mathbf{k} \\le \\mathbf{p}\\le \\mathbf{p}+\\mathbf{s} < 3^i(\\mathbf{k}+\\mathbf{1}),$$ then we use the previous observation about the occurrence of any letter every three positions along $\\mathbf{q}$ to conclude that $f$ occurs infinitely often along $\\mathbf{q}$ with gaps bounded by $3^{i+1}$.\n\nNow, suppose that $f$ does not “completely” occur inside a factor $\\varphi^i(0)$ or $\\varphi^i(1)$, i.e. that $$\\exists \\mathbf{k}\\in{\\mathbb{N}}^2,\\quad \n 3^i\\mathbf{k} \\le \\mathbf{p} < 3^i(\\mathbf{k}+\\mathbf{1})$$ but there exists $j\\in\\{1,2\\}$ such that $$p_j+s_j\\ge 3^i(k_j+1)$$ where $\\mathbf{p}=(p_1,p_2)$, $\\mathbf{s}=(s_1,s_2)$ and $\\mathbf{k}=(k_1,k_2)$. Then $\\mathbf{p}+\\mathbf{s} < 3^i(\\mathbf{k}+\\mathbf{2})$ by definition of $i$. Consider the factor $z\\colon [\\![0,3^i-1]\\!]\\times[\\![0,3^i-1]\\!]\\to A$ of size $(3^i,3^i)$ at position $3^i\\mathbf{k}$: for all $\\mathbf{i}\\in[\\![0,3^i-1]\\!]\\times[\\![0,3^i-1]\\!]$, $z(\\mathbf{i})=w(\\mathbf{i}+3^i\\mathbf{k})$. This factor $z$ corresponds exactly to a square factor of the grid, that is either $\\varphi^i(0)$ or $\\varphi^i(1)$. Hence it occurs along $\\mathbf{q}$ from the position $3^i\\mathbf{k}$ infinitely many times with gaps bounded by $3^{i+1}$. Now, an easy recurrence shows that $\\varphi^j(0)$ and $\\varphi^j(1)$ coincide everywhere except in position $(3^j-1,3^j-1)$ for any $j\\in{\\mathbb{N}}$. It follows that any factor of size $(3^i, 3^i)$ occurring at a position of the form $3^{i}(x,y)$ extends in a unique way to a factor of size $(2\\cdot 3^{i}-1, 2\\cdot 3^i-1)$ occurring at the same position. ", "Applying this to the factor $z$, we deduce that distances between consecutive occurrences of $f$ along $\\mathbf{q}$ from the position $\\mathbf{p}$ coincide with the distances between consecutive occurrences of $z$ along $\\mathbf{q}$ from the position $3^i\\mathbf{k}$. Hence the conclusion.", "\n\nThanks to Theorem \\[thm:characterization\\], we are able to show that SURD does not imply SSURDO, as illustrated by the following example.", "\n\n\\[ex:SURD\\_isnot\\_SSURDO\\] SURD and SSURDO properties define two distinct classes of words. ", "Consider the fixed point $w$ of the square binary morphism $\\varphi$ defined by $$\\varphi\\colon \n 0\\mapsto \n \\begin{bmatrix}\n 1 & 1 \\\\\n 1 & 1 \n \\end{bmatrix}, \\quad \n 1\\mapsto\n \\begin{bmatrix}\n 0 & 0 \\\\\n 1 & 0 \n \\end{bmatrix},$$ which is SURD by Theorem \\[thm:characterization\\]. ", "We can show that for the size $\\mathbf{s}=(1,1)$, the direction $\\mathbf{q}=(1,0)$ and the translations $\\mathbf{p}_n=(2^{n+1}-1,2^n-1)$ with $n\\in{\\mathbb{N}}$, the words ${(w^{(\\mathbf{p}_n)})_{{\\mathbf{q},\\mathbf{s}}}}$ begins with $\\bar{a}a^{3\\cdot 2^n}\\bar{a}$ where $a\\in\\{0,1\\}$, by observing that $\\mathbf{p}_{n+1}=2\\mathbf{p}_n+(1,1)$. This is illustrated in Figure \\[fig:SURD\\_isnot\\_SSURDO\\].", "\n\n$\\varphi\\colon \n 0\\mapsto \n \\begin{bmatrix}\n 1 & 1 \\\\\n 1 & 1 \n \\end{bmatrix}, \\quad \n 1\\mapsto\n \\begin{bmatrix}\n 0 & 0 \\\\\n 1 & 0 \n \\end{bmatrix}$. \\[fig:SURD\\_isnot\\_SSURDO\\]\n\nIt follows that $w$ is not SSURDO.", "\n\nNon-morphic bidimensional SURD words {#sec:construction}\n====================================\n\nIn this section we provide a construction of non-morphic bidimensional SURD words. ", "To construct such a word $w\\colon {\\mathbb{N}}^2\\to A$ (where $A$ is any alphabet of size at least $2$), we proceed recursively. ", "The construction is illustrated in Figure \\[fig:non-morphic\\].", "\n\n$$\\begin{matrix}\n\\vdots & \\vdots & \\vdots & \\vdots & \\vdots & \\vdots & \\vdots \\\\\na & \\cdot & a & \\cdot & a & \\cdot & a & \\cdots \\\\\nb & c & \\cdot & \\cdot & b & c & \\cdot & \\cdots \\\\\na & d & a & \\cdot & a & d & a & \\cdots \\\\\n\\cdot & \\cdot & \\cdot & \\cdot & \\cdot & \\cdot & \\cdot & \\cdots \\\\\na & \\cdot & a & \\cdot & a & \\cdot & a & \\cdots \\\\\nb & c & \\cdot & \\cdot & b & c & \\cdot & \\cdots \\\\\na & d & a & \\cdot & a & d & a & \\cdots\n\\end{matrix}$$\n\n**Step 0**. ", "Pick some $a\\in A$ and for each $(i,j)\\in{\\mathbb{N}}^2$, put $w(2i,2j)=a$.\n\n**Step 1**. ", "Fill anything you want in positions (0,1), (1,0) and (1,1). ", "For each $(i,j)\\in{\\mathbb{N}}^2$, put $w(4i,4j+1)=w(0,1)$, $w(4i+1,4j)=w(1,0)$, $w(4i+1,4j+1)=w(1,1)$. Note that the filled positions are doubly periodic with period 4.", "\n\n**Step $n\\ge 2$**. ", "At step $n$, we have filled all the positions $(i,j)$ for $i,j<2^{n}$, and the positions with filled values are doubly periodic with period $2^{n+1}$. Let $S$ be the set of pairs $(k,\\ell)$ with $k,\\ell<2^{n+1}$ which have not been yet filled in. ", "Fill anything you want in the positions from $S$. Now for each $(k,\\ell)$ and each $(k',\\ell')\\in S$, define $w(2^{n+2}k+k', 2^{n+2}\\ell+\\ell'\n)=w(k',\\ell')$. Note that the filled positions are doubly periodic with period $2^{n+2}$.\n\n\\[proposition:toeplitz\\] The bidimensional infinite word $w$ defined by the construction above is SURD. ", "More precisely, for all $\\mathbf{s}\\in{\\mathbb{N}}^2$, the prefix of size $\\mathbf{s}$ of $w$ occurs infinitely often along any direction with gaps at most $2^{\\lceil \\log_2(\\max\\mathbf{s})\\rceil}$.\n\nLet $p$ be the prefix of $w$ of size $\\mathbf{s}$ and let $\\mathbf{q}$ be a direction. ", "We show that the square prefix $p'$ of size $(2^k, 2^k)$ with $k=\\lceil\\log_2(\\max\\mathbf{s})\\rceil$ appears within any consecutive $2^{k+1}$ positions along $\\mathbf{q}$, hence this is also true for $p$ itself. ", "By construction, at step $k$ we have filled all the positions $\\mathbf{i}$ for $\\mathbf{i}<(2^k,2^k)$, and the positions with filled values are doubly periodic with periods $(2^{k+1},0)$ and $(0,2^{k+1})$. Therefore the factor of size $(2^k,2^k)$ occurring at position $2^{k+1}\\mathbf{q}$ in $w$ is equal to $p'$. The claim follows.", "\n\nObserve that the morphic words satisfying Corollary \\[cor:1\\] for $s=2$ can be obtained by this construction. ", "This construction can be generalized for any $s\\in{\\mathbb{N}}$ instead of $2$. Moreover, on each step we can choose as a period any multiple of a previous period.", "\n\n\\[proposition:toeplitz non morphic\\] Among the bidimensional infinite words obtained by the construction above, there are uncountably many words which are not morphic.", "\n\nThe construction provides uncountably many bidimensional infinite words. ", "However, there exist only countably many morphic words.", "\n\nPerspectives {#sec:perspectives}\n============\n\nThere remain many open questions related to the new notions of directional recurrence introduced in this paper. ", "For example, we would like to generalize the characterization given by Theorem \\[thm:characterization\\] to any morphism size.", "\n\nFind a characterization of strong uniform recurrence along all directions for bidimensional square binary morphisms of size bigger than 2.", "\n\nAnother question is the missing relation between different notions of recurrence indicated in Figure \\[fig:links\\_recurrence\\].", "\n\nProve or disprove: Strong uniform recurrence along all directions implies uniform recurrence.", "\n\nThe original motivation to introduce new notions of recurrence comes from the study of return words. ", "In the unidimensional case, a *return word to $u$* in an infinite word $w$ is a factor starting at an occurrence of $u$ in $w$ and ending right before the next occurrence of $u$ in $w$. For instance, the set of return words to $u=011$ in the Thue-Morse word is equal to $\\{011010, 011001, 01101001, 0110\\}$. When the infinite word $w$ is uniformly recurrent, there are finitely many return words. ", "By coding each return word to $u$ by its order of occurrence in $w$, one obtains the *derivative of $w$ with respect to the prefix $u$*. ", "Pursuing our example, the derivative of the Thue-Morse word with respect to $011$ begins with $12341243123431241234124$. Using these derivatives, Durand obtained in 1998 the following characterization of primitive pure morphic words, i.e. fixed points of morphisms having a primitive incidence matrix.", "\n\nA word is primitive pure morphic if and only if the number of its derivatives is finite.", "\n\nIn dimension higher than one, it is not clear how to generalize the notion of primitivity of a morphism in order to study the uniform recurrence along directions (see Remark \\[rem:primitivity\\]). ", "A generalization of Durand’s result to a bidimensional setting was investigated by Priebe [@Priebe--2000]. ", "In that generalization, words are replaced by tilings, the primitive substitutive property by self-similarity and the notion of derived tilings involves Voronoï cells. ", "Recall that a Voronoï tessallation is a partition of the plane into regions, called Voronoï cells, based on the distance to a set of given points, called *seeds* [@Voronoi--1907]. ", "The Voronoï cell of a seed consists of all the points in the plane that are closer to it than to any other seed. ", "Priebe aimed towards a characterization of self-similar tilings in terms of derived Voronoï tessellations and proved the following result.", "\n\nLet $\\mathcal{T}$ be a tiling of the plane.", "\n\n- If $\\mathcal{T}$ is self-similar, then the number of its different derived Voronoï tilings is finite (up to similarity).", "\n\n- If the number of its different derived Voronoï tilings is finite (up to similarity), then $\\mathcal{T}$ is pseudo-self-similar.", "\n\nThe bidimensional words we are considering in this paper are a particular case of tilings (see for instance Figure \\[fig:voronoi\\], which has been reproduced from [@Priebe--2000]) where the letters correspond to colored unit squares (1 for black and 0 for white).", "\n\n ----------------------------------------------------------------------------------------------- ---------------------------------------------------------------------------------------------------- -------------------------------------------------------------------------------------------------------\n ![", "A tiling (a), the set of positions where the factor $u$ occurs (b) with](tiling.png \"fig:\") ![", "A tiling (a), the set of positions where the factor $u$ occurs (b) with](locator_set.png \"fig:\") ![", "A tiling (a), the set of positions where the factor $u$ occurs (b) with](voronoi_tiling.png \"fig:\")\n (a) (b) (c)\n ----------------------------------------------------------------------------------------------- ---------------------------------------------------------------------------------------------------- -------------------------------------------------------------------------------------------------------\n\n$u\\ =\\ $\n\n=\\[shape=rectangle,fill=black,draw=black,,minimum size=3,inner sep=4pt\\] =\\[shape=rectangle,fill=white,draw=black,minimum size=3,inner sep=4pt\\] at (1.25,-0.03) ; at (1.25,0.25) ; at (1.54,0.25) ; at (1.54,-0.03) ;\n\n, and the associated Voronoï tessellation (c). ", "\\[fig:voronoi\\]\n\nThe main drawback of this notion of derived tilings is that, starting from a bidimensional word, we do not obtain another bidimensional word in general (as illustrated in Figure \\[fig:voronoi\\]). ", "Hence the following questions are natural.", "\n\n\\[qu:der1\\] Find a differential operator for $d$-dimensional words with respect to its prefixes, that is, an operator $$D\\colon (A^{{\\mathbb{N}}^d},{\\mathbb{N}}^d)\\to B^{{\\mathbb{N}}^d},\n (w,\\mathbf{s})\\mapsto D_\\mathbf{s}(w)$$ where $A$ and $B$ are potentially distinct alphabets and $D_\\mathbf{s}(w)$ designates the *derivative of $w$ with respect to its prefix of size $\\mathbf{s}$*, such that the finiteness of the set $$\\{D_\\mathbf{s}(w)\\colon s\\in{\\mathbb{N}}^d\\}$$ would provide us with some nice property of the $d$-dimensional infinite word $w$ (such that being primitive substitutive if one thinks of Durand’s theorem).", "\n\nHere is a variant of the previous question.", "\n\n\\[qu:der2\\] Find a differential operator for $d$-dimensional words with respect to its prefixes, that is, an operator $$D\\colon (A^{{\\mathbb{N}}^d},{\\mathbb{N}}^d)\\to B^{{\\mathbb{N}}^d},\n (w,\\mathbf{s})\\mapsto D_\\mathbf{s}(w)$$ where $A$ and $B$ are potentially distinct alphabets and $D_\\mathbf{s}(w)$ designates the *derivative of $w$ with respect to its prefix of size $\\mathbf{s}$*, such that for all $w\\in A^{{\\mathbb{N}}^d}$ and all $\\mathbf{s},\\mathbf{t}\\in{\\mathbb{N}}^d$ we have $$D_\\mathbf{s}(D_\\mathbf{t}(w))=D_\\mathbf{u}(w)$$ for some well-chosen size $\\mathbf{u}\\in{\\mathbb{N}}^d$.\n\nThe notion of SURD words introduced in the present paper provides us with a way of deriving $d$-dimensional words, which generalizes the unidimensional derivatives. ", "The idea is as follows. ", "Let $w\\colon{\\mathbb{N}}^d\\mapsto A$ be a SURD $d$-dimensional word and let $\\mathbf{s}\\in{\\mathbb{N}}^d$. Being SURD implies that there exists an integer $r\\ge 1$ such that for all directions $\\mathbf{q}$, there are at most $r$ distinct return words to the letter $w_{\\mathbf{q},\\mathbf{s}}(0)$ in the unidimensional word $w_{\\mathbf{q},\\mathbf{s}}$. We define the [*derivative of $w$ with respect to the prefix of size $\\mathbf{s}$*]{} to be the $d$-dimensional word $D_\\mathbf{s}(w)\\colon{\\mathbb{N}}^d\\mapsto [\\![0,r-1]\\!]$ such that for all direction $\\mathbf{q}$, $((D_\\mathbf{s}w)_{\\ell\\mathbf{q}})_{\\ell\\in{\\mathbb{N}}}$ is the unidimensional derivative of $w_{\\mathbf{q},\\mathbf{s}}$ with respect to its first letter obtained by coding the return words to $w_{\\mathbf{q},\\mathbf{s}}(0)$ in order of appearance from $0$ to $r-1$.\n\nFor example, if $\\varphi^\\omega(1)$ is the fixed point of the morphism given in Example \\[ex:SURD\\_isnot\\_SSURDO\\] and depicted in Figure \\[fig:SURD\\_isnot\\_SSURDO\\], then its derivative $D_{(1,2)}(\\varphi^\\omega(1))$ with respect to the prefix of size $(1,2)$ is depicted in Figure \\[fig:der1\\].", "\n\nWe know from Corollary \\[cor:1\\] that return words to the prefix of size $(1,2)$ in $(\\varphi^\\omega(1))_{\\mathbf{q},(1,2)}$ have length at most $4$ for any direction $\\mathbf{q}$. Therefore, there could be at most $4^3=64$ such return words. ", "For instance, the letters on the diagonal correspond to the unidimensional derivative of $\\varphi^\\omega(1)_{(1,1),(1,2)}$ with respect to its first letter $\\left[\\begin{smallmatrix}\n 0 \\\\\n 1 \\\\\n \\end{smallmatrix}\\right]$: $$\\underbrace{\n \\left[\\begin{smallmatrix}\n 0 \\\\\n 1 \\\\\n \\end{smallmatrix}\\right]\n \\left[\\begin{smallmatrix}\n 1 \\\\\n 0 \\\\\n \\end{smallmatrix}\\right]\n \\left[\\begin{smallmatrix}\n 1 \\\\\n 1 \\\\\n \\end{smallmatrix}\\right]}_{0}\n \\underbrace{\n \\left[\\begin{smallmatrix}\n 0 \\\\\n 1 \\\\\n \\end{smallmatrix}\\right]}_{1}\n \\underbrace{\n \\left[\\begin{smallmatrix}\n 0 \\\\\n 1 \\\\\n \\end{smallmatrix}\\right]\n \\left[\\begin{smallmatrix}\n 0 \\\\\n 0 \\\\\n \\end{smallmatrix}\\right]}_{2}\n \\underbrace{\n \\left[\\begin{smallmatrix}\n 0 \\\\\n 1 \\\\\n \\end{smallmatrix}\\right]\n \\left[\\begin{smallmatrix}\n 1 \\\\\n 0 \\\\\n \\end{smallmatrix}\\right]}_{3}\n \\underbrace{\n \\left[\\begin{smallmatrix}\n 0 \\\\\n 1 \\\\\n \\end{smallmatrix}\\right]\n \\left[\\begin{smallmatrix}\n 1 \\\\\n 0 \\\\\n \\end{smallmatrix}\\right]\n \\left[\\begin{smallmatrix}\n 1 \\\\\n 1 \\\\\n \\end{smallmatrix}\\right]\n \\left[\\begin{smallmatrix}\n 1 \\\\\n 1 \\\\\n \\end{smallmatrix}\\right]}_{4}\n \\underbrace{\n \\left[\\begin{smallmatrix}\n 0 \\\\\n 1 \\\\\n \\end{smallmatrix}\\right]\n \\left[\\begin{smallmatrix}\n 1 \\\\\n 0 \\\\\n \\end{smallmatrix}\\right]\n \\left[\\begin{smallmatrix}\n 1 \\\\\n 1 \\\\\n \\end{smallmatrix}\\right]}_{0}\n \\underbrace{\n \\left[\\begin{smallmatrix}\n 0 \\\\\n 1 \\\\\n \\end{smallmatrix}\\right]}_{1}\n \\underbrace{\n \\left[\\begin{smallmatrix}\n 0 \\\\\n 1 \\\\\n \\end{smallmatrix}\\right]\n \\left[\\begin{smallmatrix}\n 1 \\\\\n 0 \\\\\n \\end{smallmatrix}\\right]\n \\left[\\begin{smallmatrix}\n 1 \\\\\n 1 \\\\\n \\end{smallmatrix}\\right]}_{0}\n \\underbrace{\n \\left[\\begin{smallmatrix}\n 0 \\\\\n 1 \\\\\n \\end{smallmatrix}\\right]}_{1}\n \\underbrace{\n \\left[\\begin{smallmatrix}\n 0 \\\\\n 1 \\\\\n \\end{smallmatrix}\\right]\n \\left[\\begin{smallmatrix}\n 0 \\\\\n 0 \\\\\n \\end{smallmatrix}\\right]}_{2}\n \\cdots$$\n\nIn the previous definition, we chose to code the return words with respect to their order of appearance in $w_{\\mathbf{q},\\mathbf{s}}$ for each $\\mathbf{q}$. This means that two occurrences of the same letter $i\\in[\\![0,r-1]\\!]$, one at a position $\\ell\\mathbf{q}$ and the other at a position $\\ell'\\mathbf{q}'$ for different directions $\\mathbf{q}$ and $\\mathbf{q}'$, might represent different return words. ", "For example, in Figure \\[fig:der1\\], the letter $1$ at position $(0,1)$ corresponds to the return word $\\left[\\begin{smallmatrix}\n 1 \\\\\n 0 \\\\\n \\end{smallmatrix}\\right]\n \\left[\\begin{smallmatrix}\n 0 \\\\\n 1 \\\\\n \\end{smallmatrix}\\right]$ but the letter $1$ at position $(0,1)$ corresponds to the return word $\\left[\\begin{smallmatrix}\n 1 \\\\\n 0 \\\\\n \\end{smallmatrix}\\right]\n \\left[\\begin{smallmatrix}\n 0 \\\\\n 0 \\\\\n \\end{smallmatrix}\\right]$. An alternative definition of derivatives would be to code the return words uniformly, i.e. independently of the considered direction $\\mathbf{q}$. The derivative of $\\varphi^\\omega(1)$ with respect to the prefix of size $(1,2)$ obtained by following the latter convention is depicted in Figure \\[fig:der2\\]. ", "The codes of the used return words are given in Table \\[tab:codes\\]. ", "Note that the letter at position $(0,0)$ in the derivative is not well defined since in general, the first return words to the prefix of size $\\mathbf{s}$ along two different directions $\\mathbf{q}$ and $\\mathbf{q}'$ are not the same.", "\n\n --------------------------------------\n return word code\n ------------------------------- ------\n $\\left[\\begin{smallmatrix} $0$\n 0 \\\\ \n 1 \\\\ \n \\end{smallmatrix}\\right] \n \\left[\\begin{smallmatrix} \n 1 \\\\ \n 0 \\\\ \n \\end{smallmatrix}\\right] \n \\left[\\begin{smallmatrix} \n 1 \\\\ \n 1 \\\\ \n \\end{smallmatrix}\\right] \n \\left[\\begin{smallmatrix} \n 1 \\\\ \n 1 \\\\ \n \\end{smallmatrix}\\right]$ \n\n $\\left[\\begin{smallmatrix} $1$\n 0 \\\\ \n 1 \\\\ \n \\end{smallmatrix}\\right] \n \\left[\\begin{smallmatrix} \n 1 \\\\ \n 0 \\\\ \n \\end{smallmatrix}\\right]$ \n\n $\\left[\\begin{smallmatrix} $2$\n 0 \\\\ \n 1 \\\\ \n \\end{smallmatrix}\\right] \n \\left[\\begin{smallmatrix} \n 1 \\\\ \n 0 \\\\ \n \\end{smallmatrix}\\right] \n \\left[\\begin{smallmatrix} \n 1 \\\\ \n 1 \\\\ \n \\end{smallmatrix}\\right]$ \n\n $\\left[\\begin{smallmatrix} $3$\n 0 \\\\ \n 1 \\\\ \n \\end{smallmatrix}\\right]$ \n\n $\\left[\\begin{smallmatrix} $4$\n 0 \\\\ \n 1 \\\\ \n \\end{smallmatrix}\\right] \n \\left[\\begin{smallmatrix} \n 0 \\\\ \n 0 \\\\ \n \\end{smallmatrix}\\right]$ \n\n $\\left[\\begin{smallmatrix} $5$\n 0 \\\\ \n 1 \\\\ \n \\end{smallmatrix}\\right] \n \\left[\\begin{smallmatrix} \n 0 \\\\ \n 0 \\\\ \n \\end{smallmatrix}\\right] \n \\left[\\begin{smallmatrix} \n 1 \\\\ \n 1 \\\\ \n \\end{smallmatrix}\\right] \n \\left[\\begin{smallmatrix} \n 1 \\\\ \n 1 \\\\ \n \\end{smallmatrix}\\right]$ \n --------------------------------------\n\n : Codes of return words to the prefix\n\n$\\quad$\n\n --------------------------------------\n return word code\n ------------------------------- ------\n $\\left[\\begin{smallmatrix} $6$\n 0 \\\\ \n 1 \\\\ \n \\end{smallmatrix}\\right] \n \\left[\\begin{smallmatrix} \n 1 \\\\ \n 1 \\\\ \n \\end{smallmatrix}\\right]$ \n\n $\\left[\\begin{smallmatrix} $7$\n 0 \\\\ \n 1 \\\\ \n \\end{smallmatrix}\\right] \n \\left[\\begin{smallmatrix} \n 1 \\\\ \n 1 \\\\ \n \\end{smallmatrix}\\right] \n \\left[\\begin{smallmatrix} \n 1 \\\\ \n 1 \\\\ \n \\end{smallmatrix}\\right] \n \\left[\\begin{smallmatrix} \n 1 \\\\ \n 1 \\\\ \n \\end{smallmatrix}\\right]$ \n\n $\\left[\\begin{smallmatrix} $8$\n 0 \\\\ \n 1 \\\\ \n \\end{smallmatrix}\\right] \n \\left[\\begin{smallmatrix} \n 0 \\\\ \n 0 \\\\ \n \\end{smallmatrix}\\right] \n \\left[\\begin{smallmatrix} \n 1 \\\\ \n 1 \\\\ \n \\end{smallmatrix}\\right] \n \\left[\\begin{smallmatrix} \n 0 \\\\ \n 0 \\\\ \n \\end{smallmatrix}\\right]$ \n\n $\\left[\\begin{smallmatrix} $9$\n 0 \\\\ \n 1 \\\\ \n \\end{smallmatrix}\\right] \n \\left[\\begin{smallmatrix} \n 1 \\\\ \n 1 \\\\ \n \\end{smallmatrix}\\right] \n \\left[\\begin{smallmatrix} \n 1 \\\\ \n 1 \\\\ \n \\end{smallmatrix}\\right] \n \\left[\\begin{smallmatrix} \n 0 \\\\ \n 0 \\\\ \n \\end{smallmatrix}\\right]$ \n\n $\\left[\\begin{smallmatrix} $10$\n 0 \\\\ \n 1 \\\\ \n \\end{smallmatrix}\\right] \n \\left[\\begin{smallmatrix} \n 1 \\\\ \n 0 \\\\ \n \\end{smallmatrix}\\right] \n \\left[\\begin{smallmatrix} \n 1 \\\\ \n 1 \\\\ \n \\end{smallmatrix}\\right] \n \\left[\\begin{smallmatrix} \n 1 \\\\ \n 0 \\\\ \n \\end{smallmatrix}\\right]$ \n\n $\\left[\\begin{smallmatrix} $11$\n 0 \\\\ \n 1 \\\\ \n \\end{smallmatrix}\\right] \n \\left[\\begin{smallmatrix} \n 1 \\\\ \n 1 \\\\ \n \\end{smallmatrix}\\right] \n \\left[\\begin{smallmatrix} \n 1 \\\\ \n 1 \\\\ \n \\end{smallmatrix}\\right] \n \\left[\\begin{smallmatrix} \n 1 \\\\ \n 0 \\\\ \n \\end{smallmatrix}\\right]$ \n --------------------------------------\n\n : Codes of return words to the prefix\n\n$\\quad$\n\n --------------------------------------\n return word code\n ------------------------------- ------\n $\\left[\\begin{smallmatrix} $12$\n 0 \\\\ \n 1 \\\\ \n \\end{smallmatrix}\\right] \n \\left[\\begin{smallmatrix} \n 0 \\\\ \n 0 \\\\ \n \\end{smallmatrix}\\right] \n \\left[\\begin{smallmatrix} \n 1 \\\\ \n 1 \\\\ \n \\end{smallmatrix}\\right]$ \n\n $\\left[\\begin{smallmatrix} $13$\n 0 \\\\ \n 1 \\\\ \n \\end{smallmatrix}\\right] \n \\left[\\begin{smallmatrix} \n 1 \\\\ \n 1 \\\\ \n \\end{smallmatrix}\\right] \n \\left[\\begin{smallmatrix} \n 0 \\\\ \n 0 \\\\ \n \\end{smallmatrix}\\right]$ \n\n $\\left[\\begin{smallmatrix} $14$\n 0 \\\\ \n 1 \\\\ \n \\end{smallmatrix}\\right] \n \\left[\\begin{smallmatrix} \n 1 \\\\ \n 0 \\\\ \n \\end{smallmatrix}\\right] \n \\left[\\begin{smallmatrix} \n 1 \\\\ \n 1 \\\\ \n \\end{smallmatrix}\\right] \n \\left[\\begin{smallmatrix} \n 0 \\\\ \n 0 \\\\ \n \\end{smallmatrix}\\right]$ \n\n $\\left[\\begin{smallmatrix} $15$\n 0 \\\\ \n 1 \\\\ \n \\end{smallmatrix}\\right] \n \\left[\\begin{smallmatrix} \n 1 \\\\ \n 1 \\\\ \n \\end{smallmatrix}\\right] \n \\left[\\begin{smallmatrix} \n 1 \\\\ \n 1 \\\\ \n \\end{smallmatrix}\\right]$ \n\n $\\left[\\begin{smallmatrix} $16$\n 0 \\\\ \n 1 \\\\ \n \\end{smallmatrix}\\right] \n \\left[\\begin{smallmatrix} \n 0 \\\\ \n 0 \\\\ \n \\end{smallmatrix}\\right] \n \\left[\\begin{smallmatrix} \n 1 \\\\ \n 1 \\\\ \n \\end{smallmatrix}\\right] \n \\left[\\begin{smallmatrix} \n 1 \\\\ \n 0 \\\\ \n \\end{smallmatrix}\\right]$ \n --------------------------------------\n\n : Codes of return words to the prefix\n\n$\\left[\\begin{smallmatrix}\n 0 \\\\\n 1 \\\\\n \\end{smallmatrix}\\right]$ occurring in Figure \\[fig:der2\\]. ", "\\[tab:codes\\]\n\nWe do not know whether one of this definition is a good candidate for answering Question \\[qu:der1\\]. ", "Note that the second definition does not allow us to derive twice (because of the unknown letter at position $\\mathbf{0}$), and hence cannot be a good candidate for answering Question \\[qu:der2\\]. ", "In particular, in order to be able to derive twice, the SURD property must be preserved under differentiation.", "\n\nDoes our first definition of multidimensional derivatives give rise to SURD words when starting from a SURD word?", "\n\nAnother aspect we did not treat in the paper is the symbolic dynamical one. ", "It is well known that in the unidimensional case a word is uniformly recurrent if and only if the corresponding dynamical system is minimal (see e.g. [@Ferenczi--Monteil--2010]).", "\n\nWhat kind of dynamical properties are reflected by the modifications of the notion of uniform recurrence introduced in the paper?", "\n\nAcknowledgements\n================\n\nWe are grateful to Mathieu Sablik for inspiring discussions. ", "The second author is partially supported by Russian Foundation of Basic Research (grant 20-01-00488) and by the Foundation for the Advancement of Theoretical Physics and Mathematics “BASIS”. ", "The last author acknowledges partial funding via a Welcome Grant of the Université de Liège.", "\n\n[X]{}\n\nAvgustinovich, S. V., Fon-Der-Flaass, D. G., Frid, A. E.: Arithmetical Complexity of Infinite Words. ", "Words, Languages & Combinatorics III, 51–62 (2003)\n\nBerthé, V., Vuillon, L: Tilings and rotations on the torus: a two-dimensional generalization of Sturmian sequences. ", "Discrete Math. **", "223**, 27–53 (2000)\n\nBerthé, V., Vuillon, L.: Palindromes and two-dimensional [S]{}turmian sequences. ", "J. Automata, Languages and Combinatorics **6**(2), 121–138 (2001)\n\nBucci, M., Hindman, N., Puzynina, S., Zamboni, L. Q.: On additive properties of sets defined by the Thue-Morse word. ", "J. Comb. ", "Theory, Ser. ", "A **120**(6), 1235–1245 (2013)\n\nCassaigne, J.: Double Sequences with Complexity $mn+1$. Journal of Automata, Languages and Combinatorics **4**(3), 153–170 (1999)\n\nCharlier, É., Kärki, T., Rigo, M.: Multidimensional generalized automatic sequences and shape-symmetric morphic words. ", "Discrete Math. **", "310**(6-7), 1238–1252 (2010)\n\nCyr, V. and Kra, B.: Nonexpansive [${\\mathbb{Z}}^2$]{}-subdynamics and [N]{}ivat’s conjecture. ", "Trans. ", "Amer. ", "Math. ", "Soc. **", "367(9)**, 6487–6537 (2015)\n\nDidier, G.: Combinatoire des codages de rotations. ", "Acta Arith. **", "85**(2), 157–177 (1998)\n\nDurand, F.: A characterization of substitutive sequences using return words. ", "Discrete Math. **", "179**, 89–101 (1998)\n\nDurand, F., Rigo, M.: Multidimensional extension of the Morse-Hedlund theorem. ", "European J. Combin. **", "34**(2), 391–409 (2013)\n\nFerenczi, S., Monteil, T.: Infinite words with uniform frequencies, and invariant measures. ", "In: Combinatorics, Automata and Number Theory, edited by V. Berthé, M. Rigo, Cambridge University Press, 2010\n\nPriebe Frank, N.: A primer of substitution tilings of the Euclidean plane. ", "Expo. ", "Math. **", "26**(4), 295–326 (2008).", "\n\nFurstenberg, H.: Poincaré recurrence and number theory. ", "Bull. ", "Amer. ", "Math. ", "Soc. (", "N.S.) **5**(3), 211–234 (1981)\n\nHardy, G. H., Wright, E. M.: An introduction to the theory of numbers. ", "Sixth edition. ", "Oxford University Press, Oxford, 2008\n\nKari, J. and Szabados, M.: An algebraic geometric approach to [N]{}ivat’s conjecture. ", "Automata, languages, and programming. [", "P]{}art [II]{}, Springer, Heidelberg, Lecture Notes in Comput. ", "Sci. **", "9135**, 273–285 (2015)\n\nLabb[é]{}, S.: A self-similar aperiodic set of 19 Wang tiles. ", "Geometriae Dedicata **201**(1), 81–109 (2019)\n\nMuchnik, An.: ", "The definable criterion for definability in [P]{}resburger arithmetic and its applications. ", "Theoret. ", "Comput. ", "Sci. **", "290**(3), 1433–1444 (2003)\n\nNivat, M.: Invited talk at ICALP’97\n\nPriebe, N.: Towards a Characterization of Self-Similar Tilings in Terms of Derived Voronoï Tessellations. ", "Geometriae Dedicata **79**, 239–265 (2000)\n\nRigo, M., Maes, A.: More on generalized automatic sequences. ", "J. Autom. ", "Lang. ", "Comb. **", "7**(3), 351–376 (2002)\n\nSalimov, P.: On uniform recurrence of a direct product. ", "Discrete Math. ", "Theor. ", "Comput. ", "Sci. **", "12**(4), 1–8 (2010)\n\nSalon, O.: Suites automatiques à multi-indices et algébricité. ", "C. R. Acad. ", "Sci. ", "Paris Sér. ", "I Math. **", "305**(12), 501–504 (1987)\n\nSemenov, A.: The [P]{}resburger nature of predicates that are regular in two number systems. ", "Siberian Math. ", "J. **18**, 289–299 (1977)\n\nSlater, N. B.: Gaps and steps for the sequence $n\\theta\\ {\\rm mod}\\ 1$. Proc. ", "Cambridge, Philos. ", "Soc. **", "63**, 1115–1123 (1967)\n\nStewart, I.: Four encounters with [S]{}ierpiński’s gasket. ", "Math. ", "Intelligencer **17**(1), 52–64 (1995)\n\nŚwierczkowski, S.: On successive settings of an arc on the circumference of a circle. ", "Fund. ", "Math. **", "46**, 187–189 (1959)\n\nThue, A.: Uber unendliche Zeichenreihen, Norske vid. ", "Selsk. ", "Skr. ", "Mat. ", "Nat. ", "Kl. [**", "7**]{}, 1–22 (1906); reprinted in “Selected mathematical papers of Axel Thue,” T. Nagell, ed., ", "Universitetsforlaget, Oslo, 139–158 (1977)\n\nVoronoï, G.: Nouvelles applications des paramètres continus à la théorie des formes quadratiques. ", "J. reine angew. ", "Math. **", "133**, 97–178 (1907)\n\nVuillon, L.: Combinatoire des motifs d’une suite sturmienne bidimensionnelle. ", "Theoret. ", "Comput. ", "Sci. **", "209**, 261–285 (1998)\n" ]

{ "pile_set_name": "ArXiv" }

[ 0, 0.0035714285714285713, 0.011428571428571429, 0, 0, 0, 0.003367003367003367, 0.025559105431309903, 0, 0, 0, 0.015228426395939087, 0, 0, 0, 0, 0, 0.00546448087431694, 0, 0, 0.014084507042253521, 0, 0, 0, 0.0064516129032258064, 0.02, 0.017699115044247787, 0, 0.015625, 0, 0.008130081300813009, 0, 0.005291005291005291, 0.006896551724137931, 0, 0, 0, 0.0007530120481927711, 0, 0, 0, 0, 0, 0.011695906432748537, 0, 0, 0, 0, 0.005405405405405406, 0, 0, 0.003436426116838488, 0, 0.005172413793103448, 0, 0, 0, 0.009708737864077669, 0, 0, 0.014492753623188406, 0.004223864836325237, 0.013888888888888888, 0.010101010101010102, 0.00273224043715847, 0.058823529411764705, 0.0010298661174047373, 0.006134969325153374, 0.0028328611898017, 0, 0.0016863406408094434, 0.0011389521640091116, 0.003968253968253968, 0, 0, 0.007575757575757576, 0.00423728813559322, 0.012345679012345678, 0.008928571428571428, 0.010101010101010102, 0, 0, 0, 0, 0, 0.0027472527472527475, 0, 0.009523809523809525, 0.005076142131979695, 0.0019230769230769232, 0.005952380952380952, 0.005952380952380952, 0.005917159763313609, 0.010869565217391304, 0.0136986301369863, 0, 0, 0.0029154518950437317, 0.006896551724137931, 0.020833333333333332, 0.01818181818181818, 0.0125, 0, 0, 0, 0.006756756756756757, 0.011627906976744186, 0.010869565217391304, 0, 0, 0.007042253521126761, 0, 0.012987012987012988, 0, 0, 0, 0.0016556291390728477, 0.0036496350364963502, 0.0034129692832764505, 0.0022371364653243847, 0, 0, 0.006097560975609756, 0, 0.004366812227074236, 0.011494252873563218, 0.008620689655172414, 0, 0, 0, 0, 0.006493506493506494, 0.004166666666666667, 0, 0, 0.002967359050445104, 0.013513513513513514, 0, 0, 0.007886435331230283, 0.02158273381294964, 0, 0.0015082956259426848, 0.0037174721189591076, 0.009287925696594427, 0.00354924578527063, 0.012048192771084338, 0.007246376811594203, 0.003215434083601286, 0, 0.012903225806451613, 0, 0, 0, 0.0037105751391465678, 0.006211180124223602, 0.008130081300813009, 0.018518518518518517, 0, 0.016666666666666666, 0.009523809523809525, 0.011494252873563218, 0.0023584905660377358, 0, 0.005780346820809248, 0, 0.0058823529411764705, 0.03571428571428571, 0.014218009478672985, 0, 0.00315955766192733, 0.004310344827586207, 0.01694915254237288, 0, 0, 0, 0.001519756838905775, 0, 0, 0, 0, 0, 0.013245033112582781, 0.010416666666666666, 0, 0, 0.004024144869215292, 0, 0, 0, 0, 0, 0, 0, 0, 0.012195121951219513, 0.002325581395348837, 0, 0.004296455424274973, 0, 0, 0.0009578544061302681, 0, 0.02, 0.001932367149758454, 0, 0, 0, 0, 0, 0.0014749262536873156, 0, 0.0047169811320754715, 0, 0.005154639175257732, 0.0035398230088495575, 0, 0.00482315112540193, 0.00411522633744856, 0, 0.002849002849002849, 0, 0, 0, 0, 0, 0.004095004095004095, 0, 0, 0.011976047904191617, 0, 0.0016474464579901153, 0, 0.008665511265164644, 0.009868421052631578, 0.01282051282051282, 0, 0.0008710801393728223, 0.01020408163265306, 0, 0.0017482517482517483, 0.006968641114982578, 0.005115089514066497, 0.003937007874015748, 0, 0.012578616352201259, 0.021505376344086023, 0, 0, 0, 0.00684931506849315, 0.007614213197969543, 0.0031645569620253164, 0.00228310502283105, 0.003067484662576687, 0.007352941176470588, 0.0030599755201958386, 0.0017105713308244953, 0, 0, 0, 0.01694915254237288, 0.002890173410404624, 0, 0, 0.004524886877828055, 0.0011737089201877935, 0, 0.007194244604316547, 0.010638297872340425, 0.00964630225080386, 0, 0.00411522633744856, 0.011111111111111112, 0, 0.016129032258064516, 0, 0, 0, 0, 0, 0.004048582995951417, 0.005917159763313609, 0, 0, 0, 0, 0, 0.005917159763313609, 0, 0, 0.006211180124223602, 0.008, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.018691588785046728, 0.005952380952380952, 0.011111111111111112, 0.008849557522123894, 0.007246376811594203, 0, 0.007936507936507936, 0.007518796992481203, 0.0037735849056603774, 0, 0, 0, 0.004301075268817204, 0, 0, 0.00473186119873817, 0, 0.0039164490861618795, 0, 0.000881057268722467, 0, 0, 0, 0, 0, 0, 0, 0, 0.00909090909090909, 0.008695652173913044, 0, 0.0056179775280898875, 0, 0, 0.005235602094240838, 0.010869565217391304, 0.02727272727272727, 0.011904761904761904, 0, 0.00980392156862745, 0.02717391304347826, 0.1111111111111111, 0, 0.0070921985815602835, 0, 0.024, 0, 0, 0, 0, 0, 0.07142857142857142, 0, 0, 0, 0.045454545454545456, 0.02564102564102564, 0.016129032258064516, 0, 0, 0, 0, 0, 0, 0, 0, 0.038834951456310676, 0, 0.032, 0, 0.031746031746031744, 0, 0.011627906976744186, 0.03278688524590164, 0.010869565217391304, 0, 0, 0, 0, 0.009523809523809525, 0.1, 0.16666666666666666, 0, 0.0125, 0, 0, 0, 0, 0, 0.08333333333333333, 0, 0.09090909090909091, 0, 0, 0.06666666666666667, 0.02857142857142857, 0.05263157894736842, 0, 0.03614457831325301, 0, 0.008, 0, 0, 0, 0, 0, 0, 0, 0, 0.021052631578947368, 0.007042253521126761, 0, 0, 0.01, 0, 0, 0, 0 ]

[ { "analysis_explanation": null, "end": 459, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 454 }, { "analysis_explanation": null, "end": 548, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 543 }, { "analysis_explanation": null, "end": 977, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 960 }, { "analysis_explanation": null, "end": 1226, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1204 }, { "analysis_explanation": null, "end": 1758, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1753 }, { "analysis_explanation": null, "end": 1770, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1763 }, { "analysis_explanation": null, "end": 1980, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1975 }, { "analysis_explanation": null, "end": 5276, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5259 }, { "analysis_explanation": null, "end": 5357, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5353 }, { "analysis_explanation": null, "end": 7730, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7717 }, { "analysis_explanation": null, "end": 8250, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8247 }, { "analysis_explanation": null, "end": 9016, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9007 }, { "analysis_explanation": null, "end": 9523, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9514 }, { "analysis_explanation": null, "end": 10735, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10729 }, { "analysis_explanation": null, "end": 11086, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11082 }, { "analysis_explanation": null, "end": 13081, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13049 }, { "analysis_explanation": null, "end": 13754, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13749 }, { "analysis_explanation": null, "end": 13798, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13794 }, { "analysis_explanation": null, "end": 14377, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14366 }, { "analysis_explanation": null, "end": 14415, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14404 }, { "analysis_explanation": null, "end": 14865, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14840 }, { "analysis_explanation": null, "end": 15136, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15125 }, { "analysis_explanation": null, "end": 15437, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15420 }, { "analysis_explanation": null, "end": 15463, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15453 }, { "analysis_explanation": null, "end": 16709, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16675 }, { "analysis_explanation": null, "end": 16949, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16943 }, { "analysis_explanation": null, "end": 17173, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17167 }, { "analysis_explanation": null, "end": 19079, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19062 }, { "analysis_explanation": null, "end": 19157, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19147 }, { "analysis_explanation": null, "end": 20375, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20328 }, { "analysis_explanation": null, "end": 20711, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20664 }, { "analysis_explanation": null, "end": 21175, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21164 }, { "analysis_explanation": null, "end": 21395, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21378 }, { "analysis_explanation": null, "end": 21443, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21426 }, { "analysis_explanation": null, "end": 21920, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21917 }, { "analysis_explanation": null, "end": 22297, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 22291 }, { "analysis_explanation": null, "end": 22920, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 22914 }, { "analysis_explanation": null, "end": 23164, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 23153 }, { "analysis_explanation": null, "end": 23202, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 23191 }, { "analysis_explanation": null, "end": 23296, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 23276 }, { "analysis_explanation": null, "end": 23357, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 23350 }, { "analysis_explanation": null, "end": 23589, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 23572 }, { "analysis_explanation": null, "end": 23712, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 23702 }, { "analysis_explanation": null, "end": 24264, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 24258 }, { "analysis_explanation": null, "end": 24483, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 24476 }, { "analysis_explanation": null, "end": 24663, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 24658 }, { "analysis_explanation": null, "end": 24825, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 24812 }, { "analysis_explanation": null, "end": 25116, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 25109 }, { "analysis_explanation": null, "end": 25376, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 25369 }, { "analysis_explanation": null, "end": 26377, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 26357 }, { "analysis_explanation": null, "end": 26509, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 26505 }, { "analysis_explanation": null, "end": 26710, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 26682 }, { "analysis_explanation": null, "end": 26854, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 26849 }, { "analysis_explanation": null, "end": 27046, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 26982 }, { "analysis_explanation": null, "end": 27215, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 27210 }, { "analysis_explanation": null, "end": 27268, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 27245 }, { "analysis_explanation": null, "end": 27383, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 27355 }, { "analysis_explanation": null, "end": 27460, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 27444 }, { "analysis_explanation": null, "end": 27661, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 27623 }, { "analysis_explanation": null, "end": 27964, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 27963 }, { "analysis_explanation": null, "end": 27982, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 27965 }, { "analysis_explanation": null, "end": 28147, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 28140 }, { "analysis_explanation": null, "end": 28525, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 28518 }, { "analysis_explanation": null, "end": 28712, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 28684 }, { "analysis_explanation": null, "end": 28915, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 28887 }, { "analysis_explanation": null, "end": 29041, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 29030 }, { "analysis_explanation": null, "end": 29277, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 29252 }, { "analysis_explanation": null, "end": 29571, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 29558 }, { "analysis_explanation": null, "end": 29898, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 29891 }, { "analysis_explanation": null, "end": 30053, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 30040 }, { "analysis_explanation": null, "end": 31399, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 31377 }, { "analysis_explanation": null, "end": 31561, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 31550 }, { "analysis_explanation": null, "end": 33271, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 33262 }, { "analysis_explanation": null, "end": 34121, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 34098 }, { "analysis_explanation": null, "end": 34447, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 34436 }, { "analysis_explanation": null, "end": 34509, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 34498 }, { "analysis_explanation": null, "end": 34723, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 34690 }, { "analysis_explanation": null, "end": 34906, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 34895 }, { "analysis_explanation": null, "end": 36231, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 36222 }, { "analysis_explanation": null, "end": 37413, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 37402 }, { "analysis_explanation": null, "end": 37768, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 37732 }, { "analysis_explanation": null, "end": 37811, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 37797 }, { "analysis_explanation": null, "end": 37832, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 37823 }, { "analysis_explanation": null, "end": 37920, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 37906 }, { "analysis_explanation": null, "end": 38015, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 38001 }, { "analysis_explanation": null, "end": 38068, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 38061 }, { "analysis_explanation": null, "end": 38494, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 38490 }, { "analysis_explanation": null, "end": 38888, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 38877 }, { "analysis_explanation": null, "end": 40158, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 40143 }, { "analysis_explanation": null, "end": 40467, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 40456 }, { "analysis_explanation": null, "end": 40941, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 40889 }, { "analysis_explanation": null, "end": 41291, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 41280 }, { "analysis_explanation": null, "end": 41717, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 41706 }, { "analysis_explanation": null, "end": 41942, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 41931 }, { "analysis_explanation": null, "end": 42416, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 42402 }, { "analysis_explanation": null, "end": 42617, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 42603 }, { "analysis_explanation": null, "end": 44976, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 44965 }, { "analysis_explanation": null, "end": 45182, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 45142 }, { "analysis_explanation": null, "end": 45243, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 45235 }, { "analysis_explanation": null, "end": 45364, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 45351 }, { "analysis_explanation": null, "end": 46136, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 46127 }, { "analysis_explanation": null, "end": 46250, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 46242 }, { "analysis_explanation": null, "end": 46332, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 46317 }, { "analysis_explanation": null, "end": 46444, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 46425 }, { "analysis_explanation": null, "end": 46488, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 46469 }, { "analysis_explanation": null, "end": 46708, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 46700 }, { "analysis_explanation": null, "end": 46819, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 46811 }, { "analysis_explanation": null, "end": 46999, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 46991 }, { "analysis_explanation": null, "end": 47566, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 47556 }, { "analysis_explanation": null, "end": 47797, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 47789 }, { "analysis_explanation": null, "end": 48054, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 48037 }, { "analysis_explanation": null, "end": 48123, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 48112 }, { "analysis_explanation": null, "end": 48189, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 48161 }, { "analysis_explanation": null, "end": 48272, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 48261 }, { "analysis_explanation": null, "end": 48371, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 48343 }, { "analysis_explanation": null, "end": 48791, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 48780 }, { "analysis_explanation": null, "end": 48866, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 48855 }, { "analysis_explanation": null, "end": 49605, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 49562 }, { "analysis_explanation": null, "end": 49661, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 49653 }, { "analysis_explanation": null, "end": 49675, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 49667 }, { "analysis_explanation": null, "end": 49862, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 49838 }, { "analysis_explanation": null, "end": 49986, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 49958 }, { "analysis_explanation": null, "end": 50895, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 50851 }, { "analysis_explanation": null, "end": 51007, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 50996 }, { "analysis_explanation": null, "end": 51069, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 51041 }, { "analysis_explanation": null, "end": 51486, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 51478 }, { "analysis_explanation": null, "end": 51697, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 51669 }, { "analysis_explanation": null, "end": 52242, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 52239 }, { "analysis_explanation": null, "end": 52569, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 52558 }, { "analysis_explanation": null, "end": 53593, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 53585 }, { "analysis_explanation": null, "end": 53752, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 53747 }, { "analysis_explanation": null, "end": 53873, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 53868 }, { "analysis_explanation": null, "end": 55944, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 55936 }, { "analysis_explanation": null, "end": 56607, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 56599 }, { "analysis_explanation": null, "end": 56710, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 56682 }, { "analysis_explanation": null, "end": 56921, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 56913 }, { "analysis_explanation": null, "end": 56985, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 56977 }, { "analysis_explanation": null, "end": 57320, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 57306 }, { "analysis_explanation": null, "end": 57398, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 57388 }, { "analysis_explanation": null, "end": 57494, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 57486 }, { "analysis_explanation": null, "end": 58612, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 58604 }, { "analysis_explanation": null, "end": 60022, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 60010 }, { "analysis_explanation": null, "end": 60225, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 60219 }, { "analysis_explanation": null, "end": 60262, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 60254 }, { "analysis_explanation": null, "end": 60979, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 60966 }, { "analysis_explanation": null, "end": 61143, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 61135 }, { "analysis_explanation": null, "end": 61169, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 61156 }, { "analysis_explanation": null, "end": 62180, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 62175 }, { "analysis_explanation": null, "end": 62261, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 62245 }, { "analysis_explanation": null, "end": 62717, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 62702 }, { "analysis_explanation": null, "end": 63116, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 63108 }, { "analysis_explanation": null, "end": 64788, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 64765 }, { "analysis_explanation": null, "end": 65043, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 65031 }, { "analysis_explanation": null, "end": 65102, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 65093 }, { "analysis_explanation": null, "end": 65817, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 65808 }, { "analysis_explanation": null, "end": 66362, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 66354 }, { "analysis_explanation": null, "end": 67390, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 67370 }, { "analysis_explanation": null, "end": 67883, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 67865 }, { "analysis_explanation": null, "end": 68134, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 68108 }, { "analysis_explanation": null, "end": 68350, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 68341 }, { "analysis_explanation": null, "end": 69120, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 69115 }, { "analysis_explanation": null, "end": 69127, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 69122 }, { "analysis_explanation": null, "end": 69617, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 69616 }, { "analysis_explanation": null, "end": 69901, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 69887 }, { "analysis_explanation": null, "end": 70381, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 70377 }, { "analysis_explanation": null, "end": 70626, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 70619 }, { "analysis_explanation": null, "end": 71309, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 71303 }, { "analysis_explanation": null, "end": 71374, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 71368 }, { "analysis_explanation": null, "end": 71442, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 71436 }, { "analysis_explanation": null, "end": 71516, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 71510 }, { "analysis_explanation": null, "end": 71544, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 71530 }, { "analysis_explanation": null, "end": 71597, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 71591 }, { "analysis_explanation": null, "end": 71625, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 71611 }, { "analysis_explanation": null, "end": 71678, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 71672 }, { "analysis_explanation": null, "end": 71706, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 71692 }, { "analysis_explanation": null, "end": 72382, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 72368 }, { "analysis_explanation": null, "end": 72683, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 72670 }, { "analysis_explanation": null, "end": 72838, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 72835 }, { "analysis_explanation": null, "end": 73025, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 73024 }, { "analysis_explanation": null, "end": 73073, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 73052 }, { "analysis_explanation": null, "end": 73360, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 73353 }, { "analysis_explanation": null, "end": 73569, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 73552 }, { "analysis_explanation": null, "end": 74036, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 74030 }, { "analysis_explanation": null, "end": 74101, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 74095 }, { "analysis_explanation": null, "end": 74165, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 74159 }, { "analysis_explanation": null, "end": 74229, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 74223 }, { "analysis_explanation": null, "end": 74297, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 74291 }, { "analysis_explanation": null, "end": 74369, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 74363 }, { "analysis_explanation": null, "end": 74557, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 74554 }, { "analysis_explanation": null, "end": 77041, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 77018 }, { "analysis_explanation": null, "end": 77133, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 77116 }, { "analysis_explanation": null, "end": 77200, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 77195 }, { "analysis_explanation": null, "end": 77300, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 77283 }, { "analysis_explanation": null, "end": 77744, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 77736 }, { "analysis_explanation": null, "end": 78101, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 78093 }, { "analysis_explanation": null, "end": 78504, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 78496 }, { "analysis_explanation": null, "end": 78669, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 78628 }, { "analysis_explanation": null, "end": 79102, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 79080 }, { "analysis_explanation": null, "end": 79431, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 79420 }, { "analysis_explanation": null, "end": 79562, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 79551 }, { "analysis_explanation": null, "end": 79795, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 79788 }, { "analysis_explanation": null, "end": 80194, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 80183 }, { "analysis_explanation": null, "end": 80542, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 80521 }, { "analysis_explanation": null, "end": 81293, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 81275 }, { "analysis_explanation": null, "end": 81732, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 81721 }, { "analysis_explanation": null, "end": 82088, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 82080 }, { "analysis_explanation": null, "end": 84364, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 84356 }, { "analysis_explanation": null, "end": 84506, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 84491 }, { "analysis_explanation": null, "end": 84615, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 84607 }, { "analysis_explanation": null, "end": 84642, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 84627 }, { "analysis_explanation": null, "end": 84966, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 84955 }, { "analysis_explanation": null, "end": 85129, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 85118 }, { "analysis_explanation": null, "end": 85267, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 85230 }, { "analysis_explanation": null, "end": 86021, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 86013 }, { "analysis_explanation": null, "end": 87733, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 87729 }, { "analysis_explanation": null, "end": 88447, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 88440 }, { "analysis_explanation": null, "end": 88517, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 88510 }, { "analysis_explanation": null, "end": 88617, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 88610 }, { "analysis_explanation": null, "end": 88810, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 88803 }, { "analysis_explanation": null, "end": 90807, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 90797 }, { "analysis_explanation": null, "end": 90840, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 90833 }, { "analysis_explanation": null, "end": 92875, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 92846 }, { "analysis_explanation": null, "end": 96403, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 96385 }, { "analysis_explanation": null, "end": 97487, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 97482 }, { "analysis_explanation": null, "end": 97601, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 97590 }, { "analysis_explanation": null, "end": 107205, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 107191 }, { "analysis_explanation": null, "end": 107332, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 107321 }, { "analysis_explanation": null, "end": 107544, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 107539 }, { "analysis_explanation": null, "end": 107560, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 107546 }, { "analysis_explanation": null, "end": 107573, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 107562 }, { "analysis_explanation": null, "end": 107580, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 107575 }, { "analysis_explanation": null, "end": 107674, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 107670 }, { "analysis_explanation": null, "end": 107696, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 107689 }, { "analysis_explanation": null, "end": 107829, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 107825 }, { "analysis_explanation": null, "end": 107851, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 107844 }, { "analysis_explanation": null, "end": 107924, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 107913 }, { "analysis_explanation": null, "end": 107998, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 107987 }, { "analysis_explanation": null, "end": 108002, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 108000 }, { "analysis_explanation": null, "end": 108025, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 108018 }, { "analysis_explanation": null, "end": 108032, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 108027 }, { "analysis_explanation": null, "end": 108112, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 108097 }, { "analysis_explanation": null, "end": 108148, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 108144 }, { "analysis_explanation": null, "end": 108279, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 108275 }, { "analysis_explanation": null, "end": 108301, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 108296 }, { "analysis_explanation": null, "end": 108305, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 108303 }, { "analysis_explanation": null, "end": 108333, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 108313 }, { "analysis_explanation": null, "end": 108446, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 108442 }, { "analysis_explanation": null, "end": 108464, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 108461 }, { "analysis_explanation": null, "end": 108482, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 108470 }, { "analysis_explanation": null, "end": 108555, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 108551 }, { "analysis_explanation": null, "end": 108596, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 108592 }, { "analysis_explanation": null, "end": 108605, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 108599 }, { "analysis_explanation": null, "end": 108638, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 108607 }, { "analysis_explanation": null, "end": 108660, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 108650 }, { "analysis_explanation": null, "end": 108687, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 108683 }, { "analysis_explanation": null, "end": 108700, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 108698 }, { "analysis_explanation": null, "end": 108798, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 108792 }, { "analysis_explanation": null, "end": 108804, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 108800 }, { "analysis_explanation": null, "end": 108817, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 108815 }, { "analysis_explanation": null, "end": 108823, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 108819 }, { "analysis_explanation": null, "end": 108868, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 108863 }, { "analysis_explanation": null, "end": 108894, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 108886 }, { "analysis_explanation": null, "end": 108931, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 108927 }, { "analysis_explanation": null, "end": 108946, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 108944 }, { "analysis_explanation": null, "end": 108955, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 108948 }, { "analysis_explanation": null, "end": 109092, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 109083 }, { "analysis_explanation": null, "end": 109135, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 109131 }, { "analysis_explanation": null, "end": 109149, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 109137 }, { "analysis_explanation": null, "end": 109153, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 109151 }, { "analysis_explanation": null, "end": 109249, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 109245 }, { "analysis_explanation": null, "end": 109263, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 109252 }, { "analysis_explanation": null, "end": 109318, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 109314 }, { "analysis_explanation": null, "end": 109337, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 109333 }, { "analysis_explanation": null, "end": 109362, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 109358 }, { "analysis_explanation": null, "end": 109377, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 109372 }, { "analysis_explanation": null, "end": 109385, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 109379 }, { "analysis_explanation": null, "end": 109392, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 109387 }, { "analysis_explanation": null, "end": 109482, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 109476 }, { "analysis_explanation": null, "end": 109488, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 109484 }, { "analysis_explanation": null, "end": 109494, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 109490 }, { "analysis_explanation": null, "end": 109708, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 109704 }, { "analysis_explanation": null, "end": 109724, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 109722 }, { "analysis_explanation": null, "end": 109792, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 109773 }, { "analysis_explanation": null, "end": 109817, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 109813 }, { "analysis_explanation": null, "end": 109976, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 109972 }, { "analysis_explanation": null, "end": 109984, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 109979 }, { "analysis_explanation": null, "end": 110106, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 110099 }, { "analysis_explanation": null, "end": 110141, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 110122 }, { "analysis_explanation": null, "end": 110163, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 110159 }, { "analysis_explanation": null, "end": 110170, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 110166 }, { "analysis_explanation": null, "end": 110180, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 110172 }, { "analysis_explanation": null, "end": 110235, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 110227 }, { "analysis_explanation": null, "end": 110241, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 110237 }, { "analysis_explanation": null, "end": 110273, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 110269 }, { "analysis_explanation": null, "end": 110388, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 110384 }, { "analysis_explanation": null, "end": 110464, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 110454 }, { "analysis_explanation": null, "end": 110517, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 110513 }, { "analysis_explanation": null, "end": 110621, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 110613 }, { "analysis_explanation": null, "end": 110652, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 110648 }, { "analysis_explanation": null, "end": 110661, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 110655 }, { "analysis_explanation": null, "end": 110668, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 110663 }, { "analysis_explanation": null, "end": 110742, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 110733 }, { "analysis_explanation": null, "end": 110775, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 110766 }, { "analysis_explanation": null, "end": 110781, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 110777 }, { "analysis_explanation": null, "end": 110791, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 110784 }, { "analysis_explanation": null, "end": 110885, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 110881 }, { "analysis_explanation": null, "end": 110901, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 110888 }, { "analysis_explanation": null, "end": 111008, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 111004 }, { "analysis_explanation": null, "end": 111050, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 111026 }, { "analysis_explanation": null, "end": 111084, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 111081 }, { "analysis_explanation": null, "end": 111106, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 111102 }, { "analysis_explanation": null, "end": 111112, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 111108 }, { "analysis_explanation": null, "end": 111170, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 111161 }, { "analysis_explanation": null, "end": 111182, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 111173 }, { "analysis_explanation": null, "end": 111209, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 111189 }, { "analysis_explanation": null, "end": 111215, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 111211 }, { "analysis_explanation": null, "end": 111230, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 111226 }, { "analysis_explanation": null, "end": 111255, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 111246 }, { "analysis_explanation": null, "end": 111345, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 111331 }, { "analysis_explanation": null, "end": 111369, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 111363 }, { "analysis_explanation": null, "end": 111375, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 111371 }, { "analysis_explanation": null, "end": 111385, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 111378 }, { "analysis_explanation": null, "end": 111463, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 111456 }, { "analysis_explanation": null, "end": 111501, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 111497 }, { "analysis_explanation": null, "end": 89812, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 89803 }, { "analysis_explanation": null, "end": 89914, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 89908 }, { "analysis_explanation": null, "end": 90019, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 90010 }, { "analysis_explanation": null, "end": 9499, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 9491 }, { "analysis_explanation": null, "end": 28451, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 28441 }, { "analysis_explanation": null, "end": 66869, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 66853 }, { "analysis_explanation": null, "end": 87327, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 87319 }, { "analysis_explanation": null, "end": 9499, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 9491 }, { "analysis_explanation": null, "end": 28451, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 28441 }, { "analysis_explanation": null, "end": 66869, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 66853 }, { "analysis_explanation": null, "end": 87309, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 87303 }, { "analysis_explanation": null, "end": 87317, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 87311 }, { "analysis_explanation": null, "end": 87327, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 87319 } ]

[ "The fifth season of The Next Iron Chef: Redemption is in full swing with now only four familiar chefs battling it out again to prove they’ve got the skills to win the ultimate prize: the title of Iron Chef.", "\n\nEach chef will try to pull out all their tricks to stay in the competition but, ultimately, one chef must go home each week. ", "Every Sunday, FN Dish brings you exclusive exit interviews with the latest chef to go home.", "\n\nThe final four rivals meet Alton Brown and a special guest, Master of Illusion, David Copperfield, and together they reveal the Chairman’s Challenge of Transcendence in Episode 7. ", "In two pairs, the chefs prepared a buffet focused on salty, succulent bacon, offering three hot dishes and two cold ones for 30 people. ", "On account of several technical flaws, Chefs Guarnaschelli and Vigneron, rivals who faced off against each other in the Chairman’s test of Simplicity, were deemed the least-successful cooks of the day and were sent to the Secret Ingredient Showdown. ", "A last-ditch effort to rescue a raw rack of lamb, however, couldn’t save Chef Marcel Vigneron, ousted just one week short of the finale.", "\n\nThis challenge was all about transcending the Vegas buffet. ", "What’s your guilty pleasure at a buffet?MV: King crab and shrimp cocktail. ", "I could eat my weight in it.", "\n\nThroughout the season, what were your favorite and least-favorite challenges?MV: My favorite was the “Risk” challenge and not just because I won, but rather because I loved the auction concept of bidding with time instead of money. ", "I also really enjoyed breaking down and cooking the calves’ heads.", "\n\nOut of all the rival chefs, which chef (besides Chef Mendelsohn), would be your ultimate teammate?MV: Besides Chef Mendelsohn, my ultimate teammate would probably be Chef Greenspan because I love his cooking style and we go way back.", "\n\nHow did this competition experience compare to others you’ve done? ", "What have you learned?MV: I thoroughly enjoyed my experience on The Next Iron Chef! ", "As far as how the experience compares to other competition shows: In my opinion it blows them out of the water because it focuses on the food, which for me is the most important thing in a cooking show.", "\n\nYou’ve proven that you’ve matured and can cook amazing dishes. ", "Do you think you did better without Chef Mendelssohn or at least that you were more focused?MV: I believe that I did relatively well and was focused the entire time, regardless of whether Chef Mendelsohn was there or not. ", "In the beginning the judges mainly knocked me for presentation. ", "Once I figured out what they were looking for and began to understood their palates, I started to cater my dishes toward their expectations which allowed me to excel in the competition.", "\n\nWhat’s next for you?MV: I will continue to run my catering company through my website Chefmarcelvigneron.com, and I have also started working with Summit." ]

{ "pile_set_name": "Pile-CC" }

[ 0.009708737864077669, 0, 0, 0.01098901098901099, 0, 0.016, 0.007352941176470588, 0, 0, 0, 0, 0, 0.00851063829787234, 0, 0.011904761904761904, 0, 0, 0.0045045045045045045, 0, 0, 0.00641025641025641 ]

[ { "analysis_explanation": null, "end": 16, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 0 }, { "analysis_explanation": null, "end": 330, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 321 }, { "analysis_explanation": null, "end": 344, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 332 }, { "analysis_explanation": null, "end": 521, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 504 }, { "analysis_explanation": null, "end": 798, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 785 }, { "analysis_explanation": null, "end": 940, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 933 }, { "analysis_explanation": null, "end": 1083, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1068 }, { "analysis_explanation": null, "end": 1105, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1097 }, { "analysis_explanation": null, "end": 1178, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1173 }, { "analysis_explanation": null, "end": 1312, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1302 }, { "analysis_explanation": null, "end": 1653, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1638 }, { "analysis_explanation": null, "end": 1715, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1700 }, { "analysis_explanation": null, "end": 1770, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1761 }, { "analysis_explanation": null, "end": 2293, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2277 }, { "analysis_explanation": null, "end": 2444, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2429 }, { "analysis_explanation": null, "end": 2821, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.85, "start": 2799 } ]

[ "It’s good!", "\n\nBut what really made me happy about this review was what they had to say about the characters.", "\n\n“Danny and Eevee have off-the-charts chemistry.”", "\n\n“The nonromantic storylines—Eevee’s competition for a shot at a foreign art school placement and Danny’s quick immersion in his parallel self’s light rebellion via graffiti—allow the characters to develop outside of their romance.”" ]

{ "pile_set_name": "Pile-CC" }

[ 0, 0, 0.04, 0.008583690987124463 ]

[ { "analysis_explanation": null, "end": 122, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 107 }, { "analysis_explanation": null, "end": 257, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 252 } ]

[ "Shaven headed, tattooed hard man Jake attracts the attention of drunken yob Jason, who decides he wants a dirty fuck and Jake is going to let him have it!! ", "Hairy Jake turns out to be a real dirty pig, as he eagerly starts worshiping Jason’s filthy trainers, giving sneaker fetishists everywhere something to get them really horny, sucking on the soles, before pulling them off and breathing in their odour deep!! ", "Then he gets to work on Jason’s feet, licking eagerly between his toes and suckling on them, clearly loving every minute, as Jason, very much the dom top tells him that he’s a filthy cunt!! ", "Verbal and dom-sub lovers will really get off on this scene as Jason proceeds to fuck him hard in his ass, ordering him to ride him harder and then blowing a hot load across the pig’s willing face!!", "\n\nThe legendary Zeb Atlas stars as The Boyfriend, a man on a quest for an lover. ", "Zeb’s sensual journey will take you from a lustful hike in the desert to sun-filled romp in a Vegas suite, culminating in a final test of sexual prowess you won’t believe. ", "Which man will Zeb pick? ", "Will it be fellow muscleman Skye Woods, adventurous wild buck Adam Killian, or innocent youth Casey Daniels? ", "Who will Zeb pick to be his boyfriend?" ]

{ "pile_set_name": "Pile-CC" }

[ 0.019230769230769232, 0.003861003861003861, 0.005154639175257732, 0.01, 0.024691358024691357, 0.005813953488372093, 0.04, 0.027522935779816515, 0.02631578947368421 ]

[ { "analysis_explanation": null, "end": 6, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 0 }, { "analysis_explanation": null, "end": 37, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 33 }, { "analysis_explanation": null, "end": 81, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 76 }, { "analysis_explanation": null, "end": 125, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 121 }, { "analysis_explanation": null, "end": 166, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 156 }, { "analysis_explanation": null, "end": 537, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 525 }, { "analysis_explanation": null, "end": 547, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 542 }, { "analysis_explanation": null, "end": 677, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 672 }, { "analysis_explanation": null, "end": 833, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 824 }, { "analysis_explanation": null, "end": 892, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 889 }, { "analysis_explanation": null, "end": 988, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 983 }, { "analysis_explanation": null, "end": 1079, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1076 }, { "analysis_explanation": null, "end": 1124, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1114 }, { "analysis_explanation": null, "end": 1160, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1148 }, { "analysis_explanation": null, "end": 1193, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1180 }, { "analysis_explanation": null, "end": 1207, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1204 } ]

[ "A great deal has been said already on this topic, but let me point out a few things that have not received much attention.", "\n\nFirst off, allow me to admit that I was completely surprised by the result. ", "Congratulations to Andrew Potter for having called it correctly a couple weeks ago, but until last night I thought he was wrong. ", "Mainly that’s because I believed all the stuff about the importance of the “ground game” in turning out the vote. ", "I thought Trump’s inability to put together a coherent campaign organization was going to hurt him more than it did.", "\n\nAlso, I should note that this outcome is a huge victory for political science over punditry. ", "Political science tells us that things like debate performances and “gaffes” don’t matter very much, but that electoral outcomes are driven by a very small number of “macro” factors – foremost amongst them is a desire for alternation of the parties in power.", "\n\nOn Tuesday in the New York Times, I drew an analogy between Donald Trump and Rob Ford. ", "Both of them ran campaigns that committed, according to the conventional media wisdom, almost every mistake that it is possible to make, and yet they still won (although I suppose it is worth noting that Trump lost the popular vote, he only won the electoral college). ", "I think this analogy is a strong one, and I suspect that Trump’s term in office will also resemble Ford’s in many ways – in the first year, he will steamroll everyone, but that over time the accumulated effects of all the rule-breaking will begin to bog him down.", "\n\nBut that is not what I came here to say. ", "Instead, I want to make observations on two topics:\n\nHow did it happen?", "\n\nThere were lots of different factors that converged upon this result. ", "Without downplaying the significance of race, economic factors, etc. ", "I would like to comment on one motivation commonly expressed by Trump supporters, which was the desire for “change” in a “corrupt” political system. ", "On this point, there was a clear contrast between the two candidates. ", "Hillary Clinton’s special expertise, and indeed, much of the case that she made for herself, was that she was a veteran political insider, who knew how to get things done within the existing institutional structure of the U.S. federal government. ", "Apart from muttering a bit about Citizens United, it was clear that she had no intention of reforming any aspect of how America is governed – on the contrary, she had a great deal invested in keeping things the way they are, precisely because her major selling proposition was her ability to navigate the byzantine pathways of the system. ", "Electing Trump, by contrast, is like sending a bull into a china shop. ", "He will do about as much damage as possible to the existing institutional structure.", "\n\nThe question is, why would so many Americans want to damage their own political institutions in such a radical way? ", "The answer, I think, involves a very hazardous dynamic in the U.S. political system, which arises as a consequence of the fact that essentially unreformable. ", "In this respect, the U.S. is highly unusual. ", "If you look at Western democracies over the past few decades, most of them have responded to various problems and pathologies that have arisen by enacting structural reforms. (", "Consider, for instance, the devolution of powers to Scotland, or the reforms made to the House of Lords in the U.K., or the changes to the voting systems in Australia or New Zealand.)", "\n\nMy background view of the United States is that it is locked into process of long-term political decay (a thesis that has been defended, most prominently, by Francis Fukuyama). ", "Of course, predicting the collapse of America is a mug’s game. ", "What I find striking about the current situation, however, and the reason that I say the U.S. is “locked in” to a decline, is that the political system (understood in the broadest sense possible) is incapable of reforming itself, in order to address challenges that it encounters, or pathologies that it develops.", "\n\nConsider, for instance, the contrast between the current discussion we are having in Canada over electoral reform, and the situation with the electoral college in the United States. ", "Once again, one candidate (Hillary Clinton) has won the popular vote, yet lost the electoral college, and thus the U.S. system has failed to appoint the majority winner of the election to the Presidency. ", "This is essentially a repeat of what happened with Al Gore and George W. Bush in 2000. ", "People in Canada may complain about the fact that our first-past-the-post electoral system allows parties to hold a majority in the legislature, even if their aggregate vote share was less than 50%. ", "But the fact remains that in Canada, every single MP elected to parliament was the winner of a plurality rule contest – which is to say, he or she receive more votes than her opponent. ", "The U.S. presidential system, by contrast, violates that principle. ", "Not only did Donald Trump fail to secure more than 50% of votes, he was not even the plurality winner in the electoral contest – more people voted for Hillary Clinton.", "\n\nThat seems like a pretty big flaw in the system! ", "And so unsurprisingly, the day after Trump’s victory, rumblings began about abolishing the electoral college. ", "By contrast to Canada, however, no one is taking this seriously. ", "It is interesting to note the overwhelming sense of futility in this article. ", "Basically everyone interviewed says, “yes, it’s stupid and undemocratic, but there’s nothing that can be done about it.”", "\n\nOne can find similar resignation in the face of relatively “small” issues, like gerrymandering, lobbying, campaign finance, as well as big issues, like the structure of Congress, or the electoral system itself. ", "Consider, for instance, that the United States is suffering from a very acute case of the major pathology of majority systems, which is that it tends to generate two hegemonic parties (Duverger’s law), which in turn generates profound dissatisfaction on the part of large segments of the electorate. ", "And yet there is absolutely no discussion in the U.S. of any change to the voting system. ", "Why? ", "Every U.S. political theorist that I ask about this says the same thing – it’s pointless to talk about, because nothing can be changed. ", "Meanwhile in Canada, where we are not suffering from this, the major pathology of first-past-the-post, we are nevertheless engaged in serious discussion of reform of our electoral system (which, I should note, I don’t expect to go anywhere. ", "At the same time, I don’t doubt that it could be done, or that our system is capable of change. ", "I just don’t think change will occur, because there is no need for it.)", "\n\nIn response to the impossibility of reform, the American system has slowly evolved into what Steven Teles calls a kludgeocracy. ", "Rather than enacting reforms, people have found “work-arounds” to the existing system, ways of getting things done that twist the rules a bit, but that everyone accepts because it’s easier than trying to change the rules. (", "This is why, incidentally, those who hope that the “separation of powers” will constrain President Trump are kidding themselves – the separation of powers in the U.S. is severely degraded, as an accumulated effect of decades of “work arounds” or kludges that violate it.)", "\n\nBecause of this, the U.S. government suffers a massive shortfall in “output legitimacy,” in that it consistently fails to deliver anything like the levels of competent performance than people in wealthy, advanced societies expect from government. (", "Anyone who has ever dealt with the U.S. government knows that it is uniquely horrible experience, unlike anything suffered by citizens of other Western democracies.) ", "Furthermore, because of the dysfunctional legislative branch, nothing ever gets “solved” to anyone’s satisfaction. ", "All that Americans ever get is a slow accumulation of more kludges (e.g. the Affordable Care Act, the Clean Power Plan).", "\n\nMost people, however, do not think institutionally. ", "When they see bad performance from government, they blame the actors that they see readily at hand. ", "And their response then is to send in new people, committed to changing things. ", "For decades they’ve been doing this, and yet nothing ever changes. ", "Why? ", "Because the problems are institutional, outside the control of individual legislators. ", "But how do people interpret this lack of change? ", "Many come to the conclusion that the person they sent in to fix things got coopted, or wasn’t tough enough, or wasn’t up to the job. ", "And so they send in someone tougher, more radical, more vociferous in his or her commitment to changing things. ", "When that doesn’t work out, they send in someone even more radical.", "\n\nA vote for Donald Trump is a natural end-point of this process. ", "Or at least, we can hope it’s the end point. ", "In any case, it is already predictable that Trump will fail to make any significant or positive changes, and so the death-spiral will continue. ", "First of all, Trump doesn’t think in terms of process, or of institutions. ", "When he sees a bad outcome, he just assumes that it’s because the people involved were “stupid,” and if you sent in “smart” people instead, you’d get a better outcome. ", "This is a recipe for disappointment. ", "Second, the specific changes that he is committed to making – mainly congressional term limits – will only make things worse. ", "Meanwhile, the court appointments he is promising to make will strengthen the constitutional straightjacket, making things like campaign finance reform or an end to gerrymandering impossible.", "\n\nWhat is the significance?", "\n\nAmericans have been preoccupied with the question “what does this mean for America?” ", "As a non-American, I am more interested in the question “what does this mean for the world?” ", "Perhaps I am overreacting, but I do feel as though yesterday was one of those moments, like the fall of the Berlin Wall, that alters the trajectory of civilization. ", "That’s because the election of Donald Trump to the U.S. Presidency is deeply discrediting to Western-style democracy. ", "In fact, I think the big winner, globally, from Tuesday’s election, is Chinese-style authoritarianism. ", "And so, in the same way that the collapse of the Soviet Union was the final nail in the coffin of communism, Trump’s election represents a turning point, in what will become a general move away from liberal democracy.", "\n\nWhatever Americans may think about Trump, the most important thing to observe, from a global perspective, is that people all around the world view him as an incompetent clown. ", "The Chinese, I should note, were already having a field day with the mere fact that Trump was the nominee. ", "China got huge propaganda gains from the presidency of George W. Bush – their argument was basically “our political system is better, because it would not allow anyone this incompetent to become leader.” ", "Think now how that argument looks in the age of President Trump (along with the clowns and madmen that will staff his inner circle, Giuliani, Gingrich, Palin, even Bolton). ", "It certainly makes it impossible to pressure China to democratize.", "\n\nMore importantly, think of what happens to global leadership on issues such as climate change. ", "Europe is a fractious, self-absorbed mess, and in any case is not in a position to do much more on the climate file. ", "The United States is suffering from catastrophic governance failure, and its leadership is in complete denial about the problem. ", "So where do people look to for leadership? ", "All of it naturally passes to China. ", "More generally, it starts to look like the future of humanity lies with China. ", "And, depressingly, it starts to look as though China’s political system – subject to certain limited governance reforms – is the one better able to guarantee stability and prosperity. ", "The three-hundred year period in which China was not the most advanced civilization on earth starts to look more and more like an anomaly, but that it is now returning to its traditional role.", "\n\nTo a certain extent this conclusion is unwarranted, since there are many other ways of organizing a liberal democracy, most of them better than the American. (", "As I have pointed out many times, Americans don’t even try to reproduce their own system abroad. ", "After the invasion of Iraq, for instance, they imposed a parliamentary democracy on that country – tacit admission on the part of Americans that parliamentary systems are superior to presidential ones.) ", "Nevertheless, the United States is the most prestigious democracy in the world, and its governance failures are widely interpreted as failures of democracy, not failures of America as a nation.", "\n\nSo even if there is no “isolationist” turn with Trump (e.g. he does not torpedo TPP, he does not undermine NATO), this election is a huge win for China, and a huge boost to those who admire and defend the Chinese political system." ]

{ "pile_set_name": "OpenWebText2" }

[ 0, 0, 0.007751937984496124, 0, 0.008620689655172414, 0, 0, 0.033707865168539325, 0.0037174721189591076, 0.0076045627376425855, 0, 0, 0, 0, 0.006711409395973154, 0, 0.004048582995951417, 0, 0.014084507042253521, 0, 0, 0, 0, 0, 0.00546448087431694, 0.00558659217877095, 0, 0, 0, 0.004901960784313725, 0.022988505747126436, 0, 0, 0, 0.011976047904191617, 0, 0.00909090909090909, 0, 0, 0, 0.004694835680751174, 0, 0, 0, 0, 0, 0, 0, 0.007692307692307693, 0, 0.0036900369003690036, 0, 0, 0, 0, 0, 0.01, 0, 0, 0, 0, 0, 0, 0, 0, 0.015151515151515152, 0, 0.006944444444444444, 0.013333333333333334, 0, 0, 0, 0, 0, 0, 0, 0, 0.00847457627118644, 0, 0.004608294930875576, 0.0056179775280898875, 0.009345794392523364, 0.004901960784313725, 0.017341040462427744, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.01293103448275862 ]

[ { "analysis_explanation": null, "end": 231, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 218 }, { "analysis_explanation": null, "end": 281, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 263 }, { "analysis_explanation": null, "end": 303, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 293 }, { "analysis_explanation": null, "end": 457, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 452 }, { "analysis_explanation": null, "end": 921, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 914 }, { "analysis_explanation": null, "end": 983, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 971 }, { "analysis_explanation": null, "end": 996, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 988 }, { "analysis_explanation": null, "end": 1207, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1202 }, { "analysis_explanation": null, "end": 1329, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1324 }, { "analysis_explanation": null, "end": 1405, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1391 }, { "analysis_explanation": null, "end": 1852, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1847 }, { "analysis_explanation": null, "end": 2017, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2002 }, { "analysis_explanation": null, "end": 2228, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2224 }, { "analysis_explanation": null, "end": 2376, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2369 }, { "analysis_explanation": null, "end": 2602, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2597 }, { "analysis_explanation": null, "end": 2652, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2647 }, { "analysis_explanation": null, "end": 2788, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2779 }, { "analysis_explanation": null, "end": 2926, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2922 }, { "analysis_explanation": null, "end": 3043, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3039 }, { "analysis_explanation": null, "end": 3123, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3103 }, { "analysis_explanation": null, "end": 3300, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3292 }, { "analysis_explanation": null, "end": 3355, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3351 }, { "analysis_explanation": null, "end": 3406, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3397 }, { "analysis_explanation": null, "end": 3421, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3410 }, { "analysis_explanation": null, "end": 3463, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3446 }, { "analysis_explanation": null, "end": 3598, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3582 }, { "analysis_explanation": null, "end": 3646, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3639 }, { "analysis_explanation": null, "end": 3757, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3753 }, { "analysis_explanation": null, "end": 4069, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4063 }, { "analysis_explanation": null, "end": 4158, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4141 }, { "analysis_explanation": null, "end": 4202, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4187 }, { "analysis_explanation": null, "end": 4279, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4275 }, { "analysis_explanation": null, "end": 4422, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4415 }, { "analysis_explanation": null, "end": 4441, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4427 }, { "analysis_explanation": null, "end": 4449, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4445 }, { "analysis_explanation": null, "end": 4467, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4461 }, { "analysis_explanation": null, "end": 4515, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4505 }, { "analysis_explanation": null, "end": 4685, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4679 }, { "analysis_explanation": null, "end": 4843, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4839 }, { "analysis_explanation": null, "end": 4928, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4916 }, { "analysis_explanation": null, "end": 5069, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5054 }, { "analysis_explanation": null, "end": 5150, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5143 }, { "analysis_explanation": null, "end": 5162, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5157 }, { "analysis_explanation": null, "end": 5251, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5245 }, { "analysis_explanation": null, "end": 5751, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5734 }, { "analysis_explanation": null, "end": 5898, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5890 }, { "analysis_explanation": null, "end": 6058, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6054 }, { "analysis_explanation": null, "end": 6110, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6106 }, { "analysis_explanation": null, "end": 6255, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6249 }, { "analysis_explanation": null, "end": 6328, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6318 }, { "analysis_explanation": null, "end": 6701, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6693 }, { "analysis_explanation": null, "end": 6750, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6738 }, { "analysis_explanation": null, "end": 7101, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7096 }, { "analysis_explanation": null, "end": 7163, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7159 }, { "analysis_explanation": null, "end": 7221, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7214 }, { "analysis_explanation": null, "end": 7250, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7243 }, { "analysis_explanation": null, "end": 7294, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7290 }, { "analysis_explanation": null, "end": 7557, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7553 }, { "analysis_explanation": null, "end": 7669, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7662 }, { "analysis_explanation": null, "end": 7817, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7808 }, { "analysis_explanation": null, "end": 7865, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7858 }, { "analysis_explanation": null, "end": 8163, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8156 }, { "analysis_explanation": null, "end": 8696, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8684 }, { "analysis_explanation": null, "end": 9559, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9550 }, { "analysis_explanation": null, "end": 9632, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9625 }, { "analysis_explanation": null, "end": 9652, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9640 }, { "analysis_explanation": null, "end": 9788, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9779 }, { "analysis_explanation": null, "end": 9936, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9924 }, { "analysis_explanation": null, "end": 9948, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9944 }, { "analysis_explanation": null, "end": 10066, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10059 }, { "analysis_explanation": null, "end": 10089, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10082 }, { "analysis_explanation": null, "end": 10175, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10159 }, { "analysis_explanation": null, "end": 10228, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10223 }, { "analysis_explanation": null, "end": 10350, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10341 }, { "analysis_explanation": null, "end": 10372, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10367 }, { "analysis_explanation": null, "end": 10519, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10512 }, { "analysis_explanation": null, "end": 10597, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10592 }, { "analysis_explanation": null, "end": 10620, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10615 }, { "analysis_explanation": null, "end": 10684, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10670 }, { "analysis_explanation": null, "end": 10882, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10877 }, { "analysis_explanation": null, "end": 10959, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10951 }, { "analysis_explanation": null, "end": 10969, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10961 }, { "analysis_explanation": null, "end": 10976, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10971 }, { "analysis_explanation": null, "end": 10989, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10983 }, { "analysis_explanation": null, "end": 11042, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11037 }, { "analysis_explanation": null, "end": 11160, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11154 }, { "analysis_explanation": null, "end": 11288, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11271 }, { "analysis_explanation": null, "end": 11478, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11473 }, { "analysis_explanation": null, "end": 11557, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11552 }, { "analysis_explanation": null, "end": 11611, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11606 }, { "analysis_explanation": null, "end": 11787, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11782 }, { "analysis_explanation": null, "end": 12092, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12084 }, { "analysis_explanation": null, "end": 12139, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12130 }, { "analysis_explanation": null, "end": 12219, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12215 }, { "analysis_explanation": null, "end": 12332, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12323 }, { "analysis_explanation": null, "end": 12427, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12410 }, { "analysis_explanation": null, "end": 12576, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12569 }, { "analysis_explanation": null, "end": 12643, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12638 }, { "analysis_explanation": null, "end": 12741, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12736 }, { "analysis_explanation": null, "end": 12802, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12795 } ]

[ "Disposable devices containing a dentifrice and which can be secured to a finger for cleaning teeth are well known in the art as seen from U.S. Pat. ", "Nos. ", "1,157,413; 1,611,510; 2,092,987; 2,318,365; 2,761,166; 2,966,691; 2,999,206; 3,018,498; 3,070,102; 3,124,824; 3,176,388; 3,298,507; 3,368,668; 3,675,264; 3,902,509 and 3,934,299. ", "In order to properly clean teeth it is important to having a cleaning vehicle with soft bristles carrying a dentifrice to the teeth so that plaques which lead to dental caries can be removed from interdental areas as well as from the gingival margins. ", "The use of conventional fabrics such as the pile fabric of U.S. Pat. ", "No. ", "1,157,413, is an inadequate substitute for the bristles of a conventional tooth brush. ", "This is also recognized in the tooth cleaning devices disclosed in U.S. Pat. ", "Nos. ", "3,070,102, and 3,368,668. ", "In U.S. Pat. ", "No. ", "3,070,102, the device incorporates a bristle brush 6 while the device of U.S. Pat. ", "No. ", "3,368,668 similarly incorporates a bristle brush 17. ", "These latter two devices are difficult to make and are relatively expensive for a disposable tooth cleaning device. ", "The prior art set forth above which employ plastics such as the device of U.S. Pat. ", "3,124,824 suffer from the absence of bristles. ", "This invention solves the problem of the prior art by providing a device using a honeycombed sheet of polyurethane fibers, for example, a reticulated polyurethane foam having outwardly extending bristles on its outer surface integral with the interconnected polyurethane fibers of the foam. ", "The digital feedback of the device of the invention is superior to the prior art because the soft texture of the foam permits more accurate control of the pressure used to clean the teeth. ", "Further, greater amounts of dentifrice can be stored in the honeycombed polyurethane material because the sheet is largely air, for example, 97% air. ", "The polyurethane sheet wrapped around a finger and attached to itself by an adhesive strip is an important new mechanical advantage over previously described wipes because of its fitting adaptability." ]

{ "pile_set_name": "USPTO Backgrounds" }

[ 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0 ]

[ { "analysis_explanation": null, "end": 142, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 138 }, { "analysis_explanation": null, "end": 146, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 143 }, { "analysis_explanation": null, "end": 647, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 643 }, { "analysis_explanation": null, "end": 815, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 811 }, { "analysis_explanation": null, "end": 819, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 816 }, { "analysis_explanation": null, "end": 859, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 855 }, { "analysis_explanation": null, "end": 946, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 942 }, { "analysis_explanation": null, "end": 1203, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1199 } ]

[ "Q:\n\nTPL Equivalent of Thread Class 'Splash-Type' Screen\n\nGiven the class below, to launch a splash screen on an alternate thread:\npublic partial class SplashForm : Form\n{\n private static Thread _splashThread;\n private static SplashForm _splashForm; \n\n public SplashForm()\n {\n InitializeComponent();\n }\n\n // Show the Splash Screen (Loading...) \n public static void ShowSplash() \n { \n if (_splashThread == null) \n { \n // Show the form in a new thread. ", " \n _splashThread = new Thread(new ThreadStart(DoShowSplash)); \n _splashThread.", "IsBackground = true; \n _splashThread.", "Start(); \n } \n } \n\n // Called by the thread. ", " \n private static void DoShowSplash() \n { \n if (_splashForm == null) \n _splashForm = new SplashForm(); \n\n // Create a new message pump on this thread (started from ShowSplash). ", " \n Application.", "Run(_splashForm);\n } \n\n // Close the splash (Loading...) screen.", "\n public static void CloseSplash() \n { \n // Need to call on the thread that launched this splash. ", " \n if (_splashForm.", "InvokeRequired) \n _splashForm.", "Invoke(new MethodInvoker(CloseSplash)); \n else \n Application.", "ExitThread(); \n }\n}\n\nThis is called and closed with the following respective commands \nSplashForm.", "ShowSplash();\nSplashForm.", "CloseSplash();\n\nFine.", "\nI am not exactly new to the TPL, of course we can show the form on another thread using something as simple as:\nTask task = Task.", "Factory.", "StartNew(() => \n{\n SomeForm someForm = new SomeForm();\n someForm.", "ShowDialog();\n};\n\nMy issue is closing this SomeForm down when you are ready. ", "There must be a better way than creating a public static method in the SomeForm class like \nprivate static SomeForm _someForm;\npublic static void CloseSomeForm() \n{ \n if (_someForm.", "InvokeRequired) \n _someForm.", "Invoke(new MethodInvoker(CloseSomeForm)); \n}\n\nMy question is, what is the best way to do the same thing as shown using the SplashForm class above using the Task Parrallel Library (TPL)? ", "Specifically, the best way to close the form invoked on another thread from the UI.", "\n\nA:\n\nYour question does not seem to be so much about a difference between Thread and Task because what you want is to get rid of the \"dirty\" static state. ", "I suggest you encapsulate it into a class:\nclass SplashController\n{\n public void Run() {\n _someForm = new SomeForm();\n someForm.", "ShowDialog();\n }\n\n private SomeForm _someForm;\n public void CloseSomeForm() \n { \n if (_someForm.", "InvokeRequired) \n _someForm.", "Invoke(new MethodInvoker(CloseSomeForm)); \n }\n}\n\nYou can call Run using whatever threading mechanism you like. ", "CloseSomeForm does not use threading so it is independent of this problem.", "\nYou can now store a reference to an instance of SplashController wherever you like. ", "In local variables or indeed in a static variable. ", "The latter makes sense because there is exactly one splash screen.", "\nBecause the static state is now well encapsulated I don't see any problem with it being statically held.", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.005535055350553505, 0.008403361344537815, 0.01694915254237288, 0, 0.00851063829787234, 0, 0, 0.008264462809917356, 0, 0.019230769230769232, 0, 0.009615384615384616, 0.04, 0.047619047619047616, 0.007692307692307693, 0, 0.014084507042253521, 0, 0, 0.021739130434782608, 0.010362694300518135, 0.012048192771084338, 0, 0.006896551724137931, 0, 0.02, 0, 0, 0.011764705882352941, 0, 0, 0, 0 ]

[ { "analysis_explanation": null, "end": 210, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 198 }, { "analysis_explanation": null, "end": 555, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 543 }, { "analysis_explanation": null, "end": 652, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 640 }, { "analysis_explanation": null, "end": 1381, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1371 }, { "analysis_explanation": null, "end": 1745, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1735 }, { "analysis_explanation": null, "end": 1891, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1883 }, { "analysis_explanation": null, "end": 2641, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2631 }, { "analysis_explanation": null, "end": 3068, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3052 } ]

[ "Evaluation of an occupational therapy program for patients with spinal cord injury.", "\nClinical controlled trial. ", "To evaluate the effectiveness of an occupational therapy (OT) program combined with neuromotor rehabilitation, by assessing the degree of functional independence reached by patients with spinal cord injuries at first hospitalization. ", "Subjects selected from the Spinal Cord Unit of the Rehabilitation Institute of Montecatone (Imola, Italy). ", "Thirty-six male patients below age 60, with complete paraplegia (ASIA-A) in thoracic-lumbar level, at first hospitalization. ", "Patients were divided into experimental and control groups. ", "Subjects in the experimental group underwent neuromotor rehabilitation coupled with an OT program, whereas those in the control group followed neuromotor rehabilitation only. ", "Increase in functional independence at discharge was evaluated by the Valutazione Funzionale Mielolesi (VFM) assessment scale. ", "Patients in the experimental group showed a significant increase in the total VFM score, and in domains concerning transfers and wheelchair use. ", "A significant improvement was observed in unmarried patients as compared to married ones. ", "An OT service within a Spinal Cord Unit allows us to achieve a higher level of functional independence." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0, 0, 0.004273504273504274, 0.018691588785046728, 0, 0, 0.005714285714285714, 0.007874015748031496, 0.006896551724137931, 0, 0.009708737864077669 ]

[ { "analysis_explanation": null, "end": 442, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 437 }, { "analysis_explanation": null, "end": 449, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 444 }, { "analysis_explanation": null, "end": 489, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 483 }, { "analysis_explanation": null, "end": 1179, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1177 } ]

[ "The Toronto District School Board is calling on the province to allow it to collect fees from developers to help it pay for renovations, maintenance and school construction.", "\n\nTrustees say the 7,000 condos recently given the go-ahead by city council will alone bring in almost $6 million for the Toronto Catholic board, which is allowed to levy “education development charges.”", "\n\nThey estimate that in total, the Catholic board will receive almost $50 million, given the current number of building permits issued — and the public board gets nothing, said Trustee Chris Glover. ", "It’s not just a Toronto issue, he said, adding that boards across the province are asking the Ministry of Education for changes.", "\n\nThe Toronto Catholic board can charge developers because, according to the education ministry, it has no excess school space. ", "The Toronto public board, however, is considered to have excess capacity in both elementary and secondary, Glover added, “and the province has been on us to close and sell schools.", "\n\n“But we just can’t do it,” he added. “", "Our elementary enrolment is set to grow again, and we have to plan for the future. ", "The population of Toronto is set to double in the next 25 years; selling schools is incredibly short-sighted.”", "\n\nThe levy is meant to be used to buy land for new schools, and not to upgrade or redo existing schools. ", "Instead, the public board has resorted to severing parts of schoolyards to bring in funds to pay for much-needed construction.", "\n\nLast May, the TDSB wrote to the provincial party leaders saying “growth in Ontario’s urban centres is modelled on vertical intensification and school boards require funding to refurbish existing schools.”", "\n\nKrista Wylie, a parent representative in her ward, said she believes developer charges should be used to fund repairs and maintenance of Toronto public schools. ", "The mother of children at Runnymede public school said buildings are run down and “the government must update the regulation that governs (the education charges) and allow the TDSB to access money from developers.”" ]

{ "pile_set_name": "OpenWebText2" }

[ 0.005780346820809248, 0.0049261083743842365, 0.005025125628140704, 0.0078125, 0.015625, 0.005555555555555556, 0, 0, 0, 0, 0, 0.0048543689320388345, 0.006134969325153374, 0.004672897196261682 ]

[ { "analysis_explanation": null, "end": 417, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 409 }, { "analysis_explanation": null, "end": 571, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 559 }, { "analysis_explanation": null, "end": 596, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 589 }, { "analysis_explanation": null, "end": 839, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 832 }, { "analysis_explanation": null, "end": 941, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 935 }, { "analysis_explanation": null, "end": 1156, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1149 }, { "analysis_explanation": null, "end": 1194, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1177 }, { "analysis_explanation": null, "end": 1480, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1472 }, { "analysis_explanation": null, "end": 1554, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1547 }, { "analysis_explanation": null, "end": 1689, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1677 }, { "analysis_explanation": null, "end": 1821, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1814 }, { "analysis_explanation": null, "end": 1873, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1864 } ]

[ "Producer Porn: Behind The Scenes\n\nDo you mourn Oprah? ", "Do you miss her? ", "Do you wish she was still on the air?", "\n\nI liked the Oprah show well enough. ", "I watched sometimes and didn’t watch for weeks or months at a time and got annoyed when I would try to see it every day(because people did, and talked about it, and I was (am?) ", "a certain type of pop culture snob that requires you to consume every single thing that’s on TV, at least before there were shows like ‘Best Week Ever’ and so forth) because it clogged up the PVR and sometimes I just didn’t care.", "\n\nBut I have fallen in love in a whole new way.", "\n\nAre you watching Season 25: Oprah Behind The Scenes?", "\n\nI’m not exaggerating when I say it is my favourite non-scripted TV program I’ve ever seen. ", "In case you haven’t watched, they show you what happened during shows you loved. ", "Like how Oprah made her producers quake in their boots at the idea that they might have invited Michelle Obama to appear on the show instead of her having heard about what they were doing – focusing on families in the services – and deciding she just had to be there. ", "Because Oprah wouldn’t like it if she felt her friendship with the Obamas was being exploited.", "\n\nIt’s all about Oprah, of course, and she quite admirably spends most of the show in sweatpants and exactly zero makeup. ", "But the meat of the show focuses on the myriad producers - roughly a 90/10 women-to-men split –who sacrifice their outside lives to make the show happen. ", "They are regularly woken at 4:45 AM. ", "They joke about how they never meet anyone to date, which, it’s clear, is happening because they are at work 20 hours a day. ", "They are all wearing Gap and J Crew and I assume the reason for that is you can order them online and have them delivered to your house because these people never, ever get out of work during shopping hours. ", "But then, that’s what’s required at this job. ", "I hear Sheri Salata say it every episode.", "\n\nWho’s Sheri Salata? ", "Only the greatest unsung hero and puppetmaster of our time.", "\n\nSheri is the executive producer of the Oprah show. ", "She is the one who gets Ms. Winfrey to do the things that need to be done. ", "Like for example, she reminds her that yes, she has heard about this show concept before, and yes, a 30-year-old virgin who is not a virgin because of religious or traumatic reasons is kind of unusual, and maybe Oprah could just try the script as written and then they can change it afterwards if it doesn’t work?", "\n\nSheri is the puppetmaster. ", "You know how they say “you have to make the person think it was their idea”? ", "I am not great at that. ", "You know who is? ", "Salata. ", "She pretends like she doesn’t really care which way anything goes down. ", "She doesn’t fight Oprah on things. ", "She manages everyone’s expectations of what’s going to happen. ", "But then, she’s had the practice. ", "Because Oprah is, of course, kind of crazy.", "\n\nI don’t mean the singing or the toting of the shoes or the vaguely Aspergian ‘I heard my name, I heard my name’ or her ‘Famous People’s Letters’ Box (Oh My God). ", "I mean in the way she relates to her producers.", "\n\nThere’s a reason we call this show ‘producer porn’. ", "Because producers seem like they have a job that is i) wonderful, what with the swag and the perks and ii) easy. ", "BTS, on the other hand, shows people what it’s like to have a job like this, and why ‘travelling with Oprah and Celebrities’, or Oprah and Gayle, or whatever, is not automatically a pleasure cruise. ", "There are many many moving parts and most of them are egos. ", "This is why when a ‘Senior Supervising Producer’ who has been with the show for 15 years suggests – gently – that maybe Oprah could reshoot a sequence that got lost, Oprah can merely respond ‘You must be out of your mind’. ", "And she agrees “I am. ", "I am out of my mind.”", "\n\nOr like, if you’re a producer and you’ve arranged for a helicopter to shoot you and Oprah and some 300 ‘greatest fans ever’ atop the Sydney Bridge, and the helicopter runs out of gas before it can get the shot, and has to leave, and Oprah accuses you of lying about when it’s going to get back (which of course you are, because if you told her the truth – that she was going to be on top of the Sydney bridge for 20+ minutes, she would immediately get down and you would not have your shot), and then later tells you it wasn’t your fault - wouldn’t you go crazy?", "\n\nYou see, it’s producer porn because often, on-air talent are nutty nutty people. ", "They have crazy jobs and lives and nobody more so than Oprah, who has clearly arrived at the point where she believes that she is, in fact, a deity to be revered. ", "And they have to be nice to the public so they save the crazy for the few, the proud, the sleepless – their producers. ", "But usually nobody knows this except the producers. ", "Who accept it as a part of their jobs. ", "So then, here is the genius…\n\nOprah knows what’s going on this show. ", "She KNOWS how she’s being portrayed (which, I should stress, isn’t terrible – just self-focused). ", "So, this woman who is the queen of all media, who has carefully constructed for herself an incredible media empire in which she controls every single facet and frame that goes out there…\n\nSo. ", "Is this a love letter to her producers? ", "To tell them she understands what it’s like to put this show together? ", "Is it a mathematical formula that will allow her to expand her audience to people who don’t buy into the ‘Remembering Your Spirit’ stuff? ", "If so, I’m a perfect example. ", "Is it just hubris to think that people want to know so much about how Oprah puts a sweater on over her tank tops to go and inform audiences they’re going to be delayed(her lack of vanity really is astounding, you guys)?", "\n\nI don’t know.", "And then again, I don’t know anyone watching this show – living and breathing and giddy and messaging each other in the middle of the night – who isn’t in the business somehow. (", "I know that’s sad, and we’ll discuss diversifying my social circle at another time). ", "So I don’t really know whether this is just a private treat for us, or whether everyone loves it.", "\n\nSo fill me in. ", "Did you love Oprah and now watching BTS you’ve seen her in a slightly less flattering light? ", "Did you not care and now you’re addicted? ", "Are you going to join me in making Sheri Salata the president of the UN, so skilled is she in diplomacy? ", "I want to know. ", "Watch, let me know, yell at me, twitter at Salata (she tweets back). ", "But don’t miss out on this, OK? ", "Season 25: Oprah Behind the Scenes runs until July.", "\n\nPS. ", "Jennifer Hudson was SO terrified of Oprah, it was amazing.", "\n\n(Note from Lainey: Duana is a screenwriter and a producer. ", "She was my producer at etalk before leaving to write at Degrassi: The Next Generation. ", "She still produces me in life, often. )" ]

{ "pile_set_name": "Pile-CC" }

[ 0.037037037037037035, 0, 0, 0.02631578947368421, 0, 0.004366812227074236, 0, 0.018518518518518517, 0, 0, 0.007462686567164179, 0.010638297872340425, 0.00819672131147541, 0, 0, 0, 0, 0, 0.024390243902439025, 0, 0, 0.018867924528301886, 0.013333333333333334, 0.003194888178913738, 0, 0, 0.041666666666666664, 0, 0, 0, 0.02857142857142857, 0, 0, 0.023255813953488372, 0, 0, 0, 0, 0.010050251256281407, 0, 0.008968609865470852, 0, 0, 0.0035460992907801418, 0, 0.006134969325153374, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.0045662100456621, 0, 0, 0, 0, 0, 0.010752688172043012, 0, 0.01904761904761905, 0, 0.014492753623188406, 0, 0.0392156862745098, 0, 0.034482758620689655, 0.01639344262295082, 0, 0 ]

[ { "analysis_explanation": null, "end": 52, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 47 }, { "analysis_explanation": null, "end": 126, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 121 }, { "analysis_explanation": null, "end": 191, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 186 }, { "analysis_explanation": null, "end": 201, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 195 }, { "analysis_explanation": null, "end": 624, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 615 }, { "analysis_explanation": null, "end": 638, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 626 }, { "analysis_explanation": null, "end": 837, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 832 }, { "analysis_explanation": null, "end": 933, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 919 }, { "analysis_explanation": null, "end": 1104, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1099 }, { "analysis_explanation": null, "end": 1206, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1201 }, { "analysis_explanation": null, "end": 1495, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1488 }, { "analysis_explanation": null, "end": 1614, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1606 }, { "analysis_explanation": null, "end": 1828, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1823 }, { "analysis_explanation": null, "end": 1895, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1883 }, { "analysis_explanation": null, "end": 1936, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1924 }, { "analysis_explanation": null, "end": 2003, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1998 }, { "analysis_explanation": null, "end": 2042, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2037 }, { "analysis_explanation": null, "end": 2084, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2077 }, { "analysis_explanation": null, "end": 2236, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2225 }, { "analysis_explanation": null, "end": 2341, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2336 }, { "analysis_explanation": null, "end": 2443, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2438 }, { "analysis_explanation": null, "end": 2686, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2681 }, { "analysis_explanation": null, "end": 2808, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2803 }, { "analysis_explanation": null, "end": 3321, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3316 }, { "analysis_explanation": null, "end": 3348, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3343 }, { "analysis_explanation": null, "end": 3358, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3353 }, { "analysis_explanation": null, "end": 3561, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3553 }, { "analysis_explanation": null, "end": 3598, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3593 }, { "analysis_explanation": null, "end": 3644, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3639 }, { "analysis_explanation": null, "end": 3829, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3824 }, { "analysis_explanation": null, "end": 3978, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3973 }, { "analysis_explanation": null, "end": 4141, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4135 }, { "analysis_explanation": null, "end": 4164, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4153 }, { "analysis_explanation": null, "end": 4444, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4439 }, { "analysis_explanation": null, "end": 5470, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5465 }, { "analysis_explanation": null, "end": 6024, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6019 }, { "analysis_explanation": null, "end": 6188, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6176 }, { "analysis_explanation": null, "end": 6311, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6305 }, { "analysis_explanation": null, "end": 6372, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6363 }, { "analysis_explanation": null, "end": 6386, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6374 }, { "analysis_explanation": null, "end": 6413, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6409 }, { "analysis_explanation": null, "end": 6434, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6419 } ]

[ "Predictors of distress associated with psychotic-like anomalous experiences in clinical and non-clinical populations.", "\nPsychotic-like anomalous experiences are not inherently distressing, nor do they inevitably lead to clinical conditions. ", "However, distress is an important predictor of onset and relapse in psychosis, and a primary indicator of problematic mental health. ", "This study aimed to identify factors that predict distress across three groups with anomalous experiences. ", "This study used a cross-sectional design. ", "Participants in 'Diagnosed' (n = 35), 'At Risk' (n = 20), and 'Undiagnosed' (n = 36) groups completed the Appraisals of Anomalous Experiences Interview (AANEX; Brett et al., ", "2007, Br. ", "J. Psychiatry, 191, s23), which taps anomalies experienced, appraisals, and other psychological and contextual variables. ", "A series of ordinal logistic regression analyses was conducted to investigate which variables predicted anomaly-related distress. ", "Predictors of higher distress were anomalous states characterized by changes in awareness and cognitive functioning (rather than more typical positive symptoms), appraisals of experiences as caused by 'other people', and greater attempted control over experiences. ", "Predictors of lower distress were 'spiritual' appraisals, greater perceived social support/understanding, greater perceived controllability, and reacting with a 'neutral response'. ", "While psychotic-like experiences themselves are not necessarily distressing, appraisals and responses to anomalies do predict distress, as do factors relating to the social context. ", "This adds support to the cognitive-behavioural models, and continuum models, of positive psychotic symptoms." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0, 0, 0, 0, 0, 0.017241379310344827, 0, 0.00819672131147541, 0, 0, 0, 0, 0 ]

[ { "analysis_explanation": null, "end": 693, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 681 }, { "analysis_explanation": null, "end": 699, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 695 }, { "analysis_explanation": null, "end": 718, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 705 } ]

[ "512-514 Pandora Avenue\n\nPandora Avenue – 500 Block\n\n512-514 Pandora Avenue\n\nThis building at 512-514 Pandora Avenue is now part of the adjacent Swan’s Hotel & Brewpub, 506 Pandora Avenue.", "\n\nIt was originally built in 1887 for the King Tye Company, one of 19th century Victoria’s largest Chinese owned import-export companies, which used it as an office and warehouse, along with running the King Tye Opium Factory in the rear of the building.", "\n\n512-514 Pandora Avenue, now part of Swan’s Hotel & Brewpub. ", "The building was built in 1887 for the King Tye Company and the facade was renovated in 1913 by architect Percy Fox for Scott & Peden Ltd.\n\nHere is a map showing the location of 512-514 Pandora Avenue:\n\nHere is a Google Street View image of 512-514 Pandora Avenue:\n\nAdditional Information About 512-514 Pandora Avenue\n\nThis building is legally consolidated with the Swan’s Hotel & Brewpub complex at 506 Pandora Avenue. ", "The tax assessed value of the entire Swan’s Hotel & Brewpub holdings, which also includes 1615 Store Street, is:\n\nThis building was originally built in 1887 for the King Tye Company, one of 19th century Victoria’s largest Chinese owned import-export companies. ", "In the rear or the building was the King Tye Opium Factory.", "\n\nIn 1901 the building was sold for $4000 to Chu Lai. ", "In 1913 architect Percy Fox was retained to redesign the street facade.", "\n\nIn 1927, owners Chu Kum Toa and Chu Sing Hor sold the building to John A. Scott, William Peden and John Peden, who owned the Scott & Peden feed company, which also owned the adjacent building that is now Swan’s Hotel & Brewpub at 506 Pandora Avenue.", "\n\nScott & Peden and its successor company, Buckerfields, owned this building until 1973, when it was sold to the firm of James Richardson & Sons for $200,000.", "\n\nSince 1987, this building has been part of Swan’s Hotel & Brewpub.", "\n\nWould you like to leave a comment or question about anything on this page?" ]

{ "pile_set_name": "Pile-CC" }

[ 0.0053475935828877, 0.007874015748031496, 0.016129032258064516, 0.009523809523809525, 0.007662835249042145, 0.01694915254237288, 0.018518518518518517, 0.014084507042253521, 0.02390438247011952, 0.012658227848101266, 0.014705882352941176, 0 ]

[ { "analysis_explanation": null, "end": 148, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 144 }, { "analysis_explanation": null, "end": 219, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 215 }, { "analysis_explanation": null, "end": 265, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 253 }, { "analysis_explanation": null, "end": 274, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 266 }, { "analysis_explanation": null, "end": 292, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 285 }, { "analysis_explanation": null, "end": 531, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 527 }, { "analysis_explanation": null, "end": 593, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 589 }, { "analysis_explanation": null, "end": 616, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 607 }, { "analysis_explanation": null, "end": 871, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 867 }, { "analysis_explanation": null, "end": 962, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 958 }, { "analysis_explanation": null, "end": 1077, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1073 }, { "analysis_explanation": null, "end": 1123, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1111 }, { "analysis_explanation": null, "end": 1132, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1124 }, { "analysis_explanation": null, "end": 1150, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1143 }, { "analysis_explanation": null, "end": 1249, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1245 }, { "analysis_explanation": null, "end": 1292, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1285 }, { "analysis_explanation": null, "end": 1301, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1297 }, { "analysis_explanation": null, "end": 1321, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1312 }, { "analysis_explanation": null, "end": 1373, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1369 }, { "analysis_explanation": null, "end": 1393, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1382 }, { "analysis_explanation": null, "end": 1410, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1398 }, { "analysis_explanation": null, "end": 1445, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1432 }, { "analysis_explanation": null, "end": 1460, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1447 }, { "analysis_explanation": null, "end": 1475, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1465 }, { "analysis_explanation": null, "end": 1574, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1570 }, { "analysis_explanation": null, "end": 1701, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1697 }, { "analysis_explanation": null, "end": 1783, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1779 } ]

[ "One of the things I love about purple is the ability to match it with varying color schemes, like purple and gray, purple and white, purple and yellow, or purple and green. ", "The options are endless! ", "Here a few popular combinations." ]

{ "pile_set_name": "Pile-CC" }

[ 0, 0, 0 ]

[]

[ "2020–21 UEFA Nations League C\n\nThe 2020–21 UEFA Nations League C is the third division of the 2020–21 edition of the UEFA Nations League, the second season of the international football competition involving the men's national teams of the 55 member associations of UEFA.", "\n\nFormat\nFollowing a format change from the first season, League C was expanded from 15 to 16 teams. ", "The league will consist of UEFA members ranked from 33–48 in the 2018–19 UEFA Nations League overall ranking, to be split into four groups of four. ", "Each team will play six matches within their group, using the home-and-away round-robin format on double matchdays in September, October and November 2020. ", "The winners of each group will be promoted to the 2022–23 UEFA Nations League B, and the fourth-placed team of each group will advance to the relegation play-outs.", "\n\nAs League C has four groups while League D has only two, the two League C teams which are to be relegated will be determined by play-outs in March 2022. ", "Based on the Nations League overall ranking, the best-ranked team will face the fourth-ranked team, and the second-ranked team will face the third-ranked team. ", "Two ties will be played over two legs, with each team playing one leg at home (the higher-ranked team will host the second leg). ", "The team that scores more goals on aggregate over the two legs will remain in League C, while the loser will be relegated to League D. If the aggregate score is level, the away goals rule is applied, with extra time played if away goals are also equal. ", "The away goals rule is again applied after extra time, with a penalty shoot-out used to decide the winner if no goals are scored during extra time.", "\n\nTeams\n\nTeam changes\nThe following are the team changes of League C from the 2018–19 season:\n\nThe following team changes were initially set to occur in League C, but did not after no teams were relegated due to the format change by UEFA:\n\nSeeding\nIn the 2020–21 access list, UEFA ranked teams based on the 2018–19 Nations League overall ranking, with a slight modification: teams which were originally relegated in the previous season were ranked immediately below teams promoted prior to the format change. ", "The seeding pots for the league phase were confirmed 4 December 2019, and were based on the access list ranking.", "\n\nThe draw for the league phase will take place at the Beurs van Berlage Conference Centre in Amsterdam, Netherlands on 3 March 2020, 18:00 CET. ", "Each group will contain one team from each pot.", "\n\nGroups\nTimes are CET/CEST, as listed by UEFA (local times, if different, are in parentheses).", "\n\nGroup 1\n\nGroup 2\n\nGroup 3\n\nGroup 4\n\nRelegation play-outs\nThe relegation play-outs of League C are scheduled on the same dates as the 2022 FIFA World Cup qualifying play-offs. ", "If one or more of the teams due to participate in the relegation play-outs also qualifies for the World Cup qualifying play-offs, the relegation play-outs will be cancelled and the teams in League C ranked 47th and 48th in the Nations League overall ranking will be automatically relegated.", "\n\nTimes are CET/CEST, as listed by UEFA (local times, if different, are in parentheses).", "\n\nSummary\n\n|}\n\nMatches\n\nOverall ranking\nThe 16 League C teams will be ranked 33rd to 48th overall in the 2020–21 UEFA Nations League according to the following rules:\nThe teams finishing first in the groups will be ranked 33rd to 36th according to the results of the league phase.", "\nThe teams finishing second in the groups will be ranked 37th to 40th according to the results of the league phase.", "\nThe teams finishing third in the groups will be ranked 41st to 44th according to the results of the league phase.", "\nThe teams finishing fourth in the groups will be ranked 45th to 48th according to the results of the league phase.", "\n\nNotes\n\nReferences\n\nExternal links\n\nLeague C" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.007380073800738007, 0, 0.006756756756756757, 0, 0, 0, 0.00625, 0, 0, 0, 0.005893909626719057, 0, 0, 0, 0.021052631578947368, 0, 0.0034482758620689655, 0.022727272727272728, 0.0035714285714285713, 0, 0, 0, 0 ]

[ { "analysis_explanation": null, "end": 155, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 138 }, { "analysis_explanation": null, "end": 326, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 310 }, { "analysis_explanation": null, "end": 646, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 637 }, { "analysis_explanation": null, "end": 655, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 648 }, { "analysis_explanation": null, "end": 673, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 660 }, { "analysis_explanation": null, "end": 990, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 980 }, { "analysis_explanation": null, "end": 1772, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1754 }, { "analysis_explanation": null, "end": 1994, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1987 }, { "analysis_explanation": null, "end": 2115, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2096 }, { "analysis_explanation": null, "end": 2257, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2242 }, { "analysis_explanation": null, "end": 2403, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2394 }, { "analysis_explanation": null, "end": 2416, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2405 }, { "analysis_explanation": null, "end": 2432, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2420 }, { "analysis_explanation": null, "end": 2443, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2434 }, { "analysis_explanation": null, "end": 2724, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2720 } ]

[ "“The older brother, Tamerlan… I would call him a ‘loser,’ you know?” ", "Tsarni said. “", "I heard he’s not been in school, I’m not even sure what he’s been doing with him. ", "I just cut with him.”", "\n\nRuslan Tsarni, the uncle of the Boston bombing suspects, made an impassioned plea for his nephew to turn himself in on April 19, 2013. (", "credit: Allison Shelley/Getty Images)\n\n“I say what I think is behind it: Being losers. ", "Not being able to settle themselves, and thereby just hating everybody who did,” Ruslan Tsarni, in Maryland, said.", "\n\n“I say Dzhokhar, if you’re alive, turn yourself in and ask for forgiveness from the victims, from the injured and from those who left, ask forgiveness from these people,” a visibly animated and upset Tsarni said. “", "He put a shame on our family, the Tsarnaev family. ", "He put a shame on the entire Chechen ethnicity… . ", "Turn yourself in!”", "\n\n“I respect this country. ", "I love this country. ", "This country, which gives chance to everybody else to be treated as a human being, just to be human being, just to feel yourself human being, that’s what I feel about this country,” Tsarni said. “", "If I even slightly be aware that they were involved I’d be the first one to bring them into responsibility, as an uncle.”", "\n\nA West New York woman who claimed to be the sister of the bombing suspects told the Newark Star Ledger she doesn’t believe it.", "\n\n“I’m hurt for everyone that’s been hurt,” Alina Tsarnaeva said. “", "I’m sorry for the families that lost their loved ones the same way I lost a loved one.”", "\n\nTsarnaeva pleaded for privacy.", "\n\n“I’m not OK, no-one is OK. ", "It’s very shocking news,” Tsarnaeva said, adding that she hadn’t seen her brothers for a long time. “[", "Dzhokhar] is an amazing child.”", "\n\n“They are smart. ", "My older brother was smart. ", "I don’t know what got into them. ", "I have no idea what got into them,” Tsarnaeva said.", "\n\nThe FBI was later seen removing a computer from Tsarnaeva’s home, the Associated Press reported.", "\n\nFrom Makhachkala, Russia, the father of the suspects told the Associated Press said “my son is a true angel” and “an intelligent boy.”", "\n\n“They were set up, they were set up!” ", "Anzor Tsarnaev said. “", "I saw it on television; they killed my older son Tamerlan.”", "\n\nSpeaking to reporters in Toronto, an aunt of the suspects said Tamerlan had recently become a devout Muslim who prayed five times a day.", "\n\n“I don’t know them in the way that they could be capable of this,” Maret Tsarnaeva said. ", "She also told reporters Tamerlan was married and had a 3-year-old daughter.", "\n\n“He has a wife in Boston and from a Christian family, so you can’t tie it religion,” she said.", "\n\nA law enforcement source told CBS News Dzhokhar became an American citizen on Sept. 11, 2012. ", "He arrived in the U.S. on a tourist visa in April 2002 and sought asylum in September of that year. ", "There’s no word yet on whether Tamerlan, 26, was an American citizen.", "\n\nThe brothers appear to have lived in various parts of Russia and the former Soviet Union, CBS 2’s Tony Aiello reported. ", "Their roots trace back to Chechnya, a mostly Muslim region plagued by violence as part of a struggle for independence from Russia. ", "The region has had two full-scale wars with Russian forces since 1994.", "\n\n“There are terrorists from that country and they’re living here in Boston,” Congressman Peter King told 1010 WINS. “", "I don’t know whether they’re acting on their own or through al Qaeda but my concern is that they were able to live in the United States for a year and plan this attack.”", "\n\nBoth brothers seemed to fit in well in America, at least on the surface, Aiello reported.", "\n\nTamerlan had a YouTube channel which showed he liked videos about Chechnya and Islam. ", "Tamerlan was a Golden Gloves boxer and the subject of a photo essay by photographer Johannes Hirn. ", "Tamerlan told Hirn “I’m very religious” and “there are no values anymore. ", "People can’t control themselves.”", "\n\n“I don’t have a single American friend. ", "I don’t understand them,” Tamerlan told Hirn.", "\n\nTamerlan Tsarnaev was arrested for assaulting a girlfriend in the summer of 2009, according to police records.", "\n\nDzhokhar was also an athlete – a wrestler. ", "He graduated in 2011 from Cambridge Rindge and Latin High School.", "\n\nA classmate who spoke with CBS Boston anonymously said she was shocked.", "\n\n“Dzhokhar was so friendly, so I wouldn’t connect A and B that he was a terrorist, or hurt a fly, even,” she said.", "\n\nDzhokhar Tsarnaev had a page on a Russian social networking site Vkontakte, listing his worldview as “Islam” and his interests as “career and money.”", "\n\nThe friend who spoke with CBS Boston said she had no inkling of any radical or terrorist tendencies.", "\n\n“He would say once in a while that he was just here or there, but other than that he was just seen as a normal American to me,” she said.", "\n\nA spokesman for Chechnya’s leader said the family left Chechnya long ago and went to Central Asia, then moved to Dagestan, a Muslim republic adjacent to Chechnya that has been the site of a sporadic insurgency for more than a decade.", "\n\nDzhokhar Tsarnaev attended School No. ", "1 in Makhachkala, the capital of Dagestan. ", "The principal’s secretary at School No. ", "1, Irina Bandurina, told the AP that Tsarnaev left for the U.S. in March 2002.", "\n\nWhen in the United States, the suspects went to Cambridge Rindge and Latin School.", "\n\n“I can’t believe this, it’s not possible, my nephews can’t do, like, this stuff. ", "No way,” a man named Alvi Tsarni, who identified himself as the uncle of the suspect. “", "It’s crazy. ", "It’s not possible. ", "I can’t believe it. ", "Myself, when I heard it on TV news, I said ‘Who can do all this stuff?’ ", "It’s crazy, it’s unbelievable.”", "\n\nA high school friend of the suspects told CBS Boston Dzhokhar was “just a normal American kid.”", "\n\nThe city of Cambridge announced two years ago that it had awarded a $2,500 scholarship to Dzhokar Tsarnaev, who was listed as a senior at Cambridge Rindge & Latin School, a highly regarded public school whose alumni include Matt Damon, Ben Affleck and NBA star Patrick Ewing.", "\n\nRuslan Tsarni told The Associated Press that the men lived together near Boston and have been in the United States for about a decade. ", "They traveled here together from the Russian region near Chechnya." ]

{ "pile_set_name": "Pile-CC" }

[ 0, 0, 0, 0, 0.007246376811594203, 0.011494252873563218, 0.008771929824561403, 0, 0.0196078431372549, 0, 0, 0, 0, 0, 0, 0, 0.014925373134328358, 0, 0.03125, 0, 0.00980392156862745, 0, 0, 0, 0, 0.0196078431372549, 0.030612244897959183, 0.007352941176470588, 0, 0.045454545454545456, 0, 0, 0.01098901098901099, 0.013333333333333334, 0, 0.010416666666666666, 0, 0, 0.01639344262295082, 0, 0, 0.00847457627118644, 0.005917159763313609, 0.01098901098901099, 0.03409090909090909, 0, 0.013513513513513514, 0, 0, 0.022222222222222223, 0.008928571428571428, 0, 0.03076923076923077, 0.0136986301369863, 0, 0.006622516556291391, 0.00980392156862745, 0, 0, 0, 0, 0.025, 0.038461538461538464, 0.023809523809523808, 0, 0.011494252873563218, 0, 0, 0, 0, 0, 0.010309278350515464, 0.021660649819494584, 0.014598540145985401, 0 ]

[ { "analysis_explanation": null, "end": 28, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20 }, { "analysis_explanation": null, "end": 75, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 69 }, { "analysis_explanation": null, "end": 201, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 188 }, { "analysis_explanation": null, "end": 226, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 220 }, { "analysis_explanation": null, "end": 321, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 307 }, { "analysis_explanation": null, "end": 361, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 333 }, { "analysis_explanation": null, "end": 506, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 493 }, { "analysis_explanation": null, "end": 519, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 511 }, { "analysis_explanation": null, "end": 542, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 534 }, { "analysis_explanation": null, "end": 733, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 727 }, { "analysis_explanation": null, "end": 784, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 776 }, { "analysis_explanation": null, "end": 829, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 822 }, { "analysis_explanation": null, "end": 1096, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1090 }, { "analysis_explanation": null, "end": 1242, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1229 }, { "analysis_explanation": null, "end": 1411, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1396 }, { "analysis_explanation": null, "end": 1517, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1508 }, { "analysis_explanation": null, "end": 1824, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1815 }, { "analysis_explanation": null, "end": 1944, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1933 }, { "analysis_explanation": null, "end": 1952, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1946 }, { "analysis_explanation": null, "end": 2115, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2101 }, { "analysis_explanation": null, "end": 2181, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2173 }, { "analysis_explanation": null, "end": 2216, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2209 }, { "analysis_explanation": null, "end": 2255, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2247 }, { "analysis_explanation": null, "end": 2291, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2285 }, { "analysis_explanation": null, "end": 2403, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2388 }, { "analysis_explanation": null, "end": 2442, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2434 }, { "analysis_explanation": null, "end": 2475, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2465 }, { "analysis_explanation": null, "end": 2510, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2504 }, { "analysis_explanation": null, "end": 2531, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2522 }, { "analysis_explanation": null, "end": 2647, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2639 }, { "analysis_explanation": null, "end": 2673, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2659 }, { "analysis_explanation": null, "end": 2697, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2693 }, { "analysis_explanation": null, "end": 2729, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2719 }, { "analysis_explanation": null, "end": 2773, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2751 }, { "analysis_explanation": null, "end": 2814, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2806 }, { "analysis_explanation": null, "end": 2818, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2816 }, { "analysis_explanation": null, "end": 2835, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2827 }, { "analysis_explanation": null, "end": 2905, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2899 }, { "analysis_explanation": null, "end": 2933, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2921 }, { "analysis_explanation": null, "end": 2954, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2943 }, { "analysis_explanation": null, "end": 2999, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2991 }, { "analysis_explanation": null, "end": 3016, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3010 }, { "analysis_explanation": null, "end": 3094, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3088 }, { "analysis_explanation": null, "end": 3147, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3140 }, { "analysis_explanation": null, "end": 3165, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3161 }, { "analysis_explanation": null, "end": 3240, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3234 }, { "analysis_explanation": null, "end": 3265, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3255 }, { "analysis_explanation": null, "end": 3419, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3402 }, { "analysis_explanation": null, "end": 3430, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3424 }, { "analysis_explanation": null, "end": 3500, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3493 }, { "analysis_explanation": null, "end": 3533, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3527 }, { "analysis_explanation": null, "end": 3552, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3544 }, { "analysis_explanation": null, "end": 3618, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3610 }, { "analysis_explanation": null, "end": 3638, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3630 }, { "analysis_explanation": null, "end": 3727, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3714 }, { "analysis_explanation": null, "end": 3737, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3729 }, { "analysis_explanation": null, "end": 3747, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3743 }, { "analysis_explanation": null, "end": 3868, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3860 }, { "analysis_explanation": null, "end": 3911, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3903 }, { "analysis_explanation": null, "end": 3921, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3917 }, { "analysis_explanation": null, "end": 3940, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3923 }, { "analysis_explanation": null, "end": 4003, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3985 }, { "analysis_explanation": null, "end": 4042, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4034 }, { "analysis_explanation": null, "end": 4097, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4093 }, { "analysis_explanation": null, "end": 4112, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4103 }, { "analysis_explanation": null, "end": 4224, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4216 }, { "analysis_explanation": null, "end": 4346, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4329 }, { "analysis_explanation": null, "end": 4370, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4363 }, { "analysis_explanation": null, "end": 4436, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4431 }, { "analysis_explanation": null, "end": 4699, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4691 }, { "analysis_explanation": null, "end": 4742, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4734 }, { "analysis_explanation": null, "end": 4781, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4773 }, { "analysis_explanation": null, "end": 4815, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4803 }, { "analysis_explanation": null, "end": 4839, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4831 }, { "analysis_explanation": null, "end": 4849, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4843 }, { "analysis_explanation": null, "end": 4879, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4871 }, { "analysis_explanation": null, "end": 4950, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4932 }, { "analysis_explanation": null, "end": 4969, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4952 }, { "analysis_explanation": null, "end": 5006, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4995 }, { "analysis_explanation": null, "end": 5031, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5023 }, { "analysis_explanation": null, "end": 5091, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5076 }, { "analysis_explanation": null, "end": 5118, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5110 }, { "analysis_explanation": null, "end": 5136, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5132 }, { "analysis_explanation": null, "end": 5150, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5140 }, { "analysis_explanation": null, "end": 5177, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5160 }, { "analysis_explanation": null, "end": 5348, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5337 }, { "analysis_explanation": null, "end": 5648, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5640 }, { "analysis_explanation": null, "end": 5676, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5667 }, { "analysis_explanation": null, "end": 5700, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5687 }, { "analysis_explanation": null, "end": 5761, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5745 }, { "analysis_explanation": null, "end": 5889, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5879 }, { "analysis_explanation": null, "end": 5902, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5891 }, { "analysis_explanation": null, "end": 5929, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5916 }, { "analysis_explanation": null, "end": 5944, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5931 }, { "analysis_explanation": null, "end": 6010, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6004 }, { "analysis_explanation": null, "end": 6045, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6028 }, { "analysis_explanation": null, "end": 6064, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6050 }, { "analysis_explanation": null, "end": 6110, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6103 }, { "analysis_explanation": null, "end": 6131, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6123 } ]

[ "Effects of exercise with light hand weights on strength.", "\nIn order to determine if running with light hand weights elicits an increase in strength, 20 male runners trained at their normal training routine for an &week period while carrying either no weights or weights incremented to 1.36 kilograms per hand. ", "Peak torque measurements of the shoulder and elbow flexor and extensor muscles were measured using an isokinetic dynamometer prior to and following the 8-week exercise period. ", "The results indicated no significant changes in any of these parameters between or within subjects at any of the time periods. ", "The results suggest that running while carrying light hand weights for a 8-week period resulted in no greater stimulus for increasing strength than running without the weights. ", "J Orthop Sports Phys Ther 1987;8(11):533-536." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0, 0, 0, 0, 0, 0 ]

[ { "analysis_explanation": null, "end": 216, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 208 }, { "analysis_explanation": null, "end": 466, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 460 }, { "analysis_explanation": null, "end": 690, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 684 } ]

[ "It’s one thing that the United States will soon be taking orders from China (or already is). ", "But what about when we’re becoming less forward-thinking than England? ", "That’s the only possible reading of the fact that there, the former top drug official Bob Ainsworth has addressed the House of Commons and argued for the legalization of all drugs. ", "Not just pot — all of them. ", "His reasoning is simple, and has nothing to do with the ideology of Timothy Leary:\n\n“We need to take effective measures to rob the dealers of their markets and the only way that we can do that is by supplying addicts through the medical profession, through prescription. ", "We cannot afford to be shy about being prepared to do that.”", "\n\nHe continues: “We spend billions of pounds without preventing the wide availability of drugs. ", "It is time to replace our failed war on drugs with a strict system of legal regulation, to make the world a safer, healthier place, especially for our children. ", "We must take the trade away from organised criminals and hand it to the control of doctors and pharmacists.”", "\n\nThe perfect sense in this is painfully clear when uttered by someone from elsewhere — the English accent would make it sound even more authoritative to American ears. ", "And yet to propose this here is seen as nervy, as “worth discussing” (which is a way of saying that it isn’t). ", "Even when it is intoned in a black accent, as you can sample here, where Law Enforcement Against Prohibition’s Neill Franklin speaks the truth on this issue regarding his work in Maryland.", "\n\nThis should change, as I have argued frequently over the past year (listen to part of a speech I did on this here). ", "Of the countless reasons why this revival of this Prohibition that looks so quaint in Boardwalk Empire should be erased with all deliberate speed, one is that with no War on Drugs there would be, within one generation, no “black problem” in the United States. ", "Poverty in general, yes. ", "An education problem in general — probably. ", "But the idea that black America had a particular crisis would rapidly become history, requiring explanation to young people. ", "The end of the War on Drugs is, in fact, what all people genuinely concerned with black uplift should be focused on, which is why I am devoting my last TNR post of 2010 to the issue. ", "The black malaise in the U.S. is currently like a card house; the Drug War is a single card which, if pulled out, would collapse the whole thing.", "\n\nThat is neither an exaggeration nor an oversimplification. ", "It comes down to this: If there were no way to sell drugs on the street at a markup, then young black men who drift into this route would instead have to get legal work. ", "They would. ", "Those insisting that they would not have about as much faith in human persistence and ingenuity as those who thought women past their five-year welfare cap would wind up freezing on sidewalk grates." ]

{ "pile_set_name": "OpenWebText2" }

[ 0, 0, 0.011049723756906077, 0, 0.0036900369003690036, 0, 0, 0, 0, 0, 0, 0.005319148936170213, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0 ]

[ { "analysis_explanation": null, "end": 37, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20 }, { "analysis_explanation": null, "end": 75, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 70 }, { "analysis_explanation": null, "end": 162, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 155 }, { "analysis_explanation": null, "end": 263, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 250 }, { "analysis_explanation": null, "end": 454, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 441 }, { "analysis_explanation": null, "end": 1229, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1221 }, { "analysis_explanation": null, "end": 1472, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1458 }, { "analysis_explanation": null, "end": 1534, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1526 }, { "analysis_explanation": null, "end": 1602, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1589 }, { "analysis_explanation": null, "end": 1754, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1738 }, { "analysis_explanation": null, "end": 1910, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1893 }, { "analysis_explanation": null, "end": 2012, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2005 }, { "analysis_explanation": null, "end": 2274, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2270 }, { "analysis_explanation": null, "end": 2318, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2314 }, { "analysis_explanation": null, "end": 2819, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2810 } ]

[ "It’s time for the Houston Texans to unload Johnathan Joseph and his contract.", "\n\nCornerback Johnathan Joseph is one player the Texans should think about trading once the new NFL league year starts on March 9th.", "\n\nJoseph is still a good player, but is on a decline is no longer worth keeping.", "\n\nI’ve come up with three reasons the Texans need to trade Joseph.", "\n\nJoseph is past his prime\n\nJoseph can still play at a high level, but it’s no longer worth it for the Texans to keep him now that he’s turning 33 years-old in April.", "\n\nJoseph was the 46th ranked cornerback in the NFL last season, according to Pro Football Focus. ", "He had an overall rating of 75.8. ", "He was average against the pass with a rating of 75.1 and against the run with a 79.6.", "\n\nWith good cornerbacks being at a premium in the NFL, Houston shouldn’t have a problem trading Joseph.", "\n\nRe-sign A.J. Bouye\n\nThe Texans priority this offseason has to be re-signing A.J. Bouye. ", "Trading Joseph would free up $6.9 million in cap space and would make it a lot easier to keep a 25 year old cornerback over one that’s about to turn 33.", "\n\nAnother thing is that Joseph is in the final year of his contract. ", "Is he really going to be worth re-signing next year at the age of 34? ", "Let me answer that, no he won’t.", "\n\nSign DeAndre hopkins to an extension\n\nThe Texans have made it clear they want to sign star wide receiver DeAndre Hopkins to a new contract, since his current deal runs out after next season. ", "Just like with Bouye, if Houston unloads Joseph’s contract it will give them more wiggle room to get a deal done sooner rather than later." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.012987012987012988, 0.015267175572519083, 0.0125, 0.015151515151515152, 0.012048192771084338, 0.030927835051546393, 0, 0, 0.019417475728155338, 0.022222222222222223, 0.006578947368421052, 0.014492753623188406, 0, 0, 0.0051813471502590676, 0.014492753623188406 ]

[ { "analysis_explanation": null, "end": 25, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18 }, { "analysis_explanation": null, "end": 32, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 26 }, { "analysis_explanation": null, "end": 59, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 43 }, { "analysis_explanation": null, "end": 105, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 78 }, { "analysis_explanation": null, "end": 130, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 124 }, { "analysis_explanation": null, "end": 186, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 182 }, { "analysis_explanation": null, "end": 206, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 197 }, { "analysis_explanation": null, "end": 214, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 208 }, { "analysis_explanation": null, "end": 329, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 323 }, { "analysis_explanation": null, "end": 350, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 344 }, { "analysis_explanation": null, "end": 358, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 352 }, { "analysis_explanation": null, "end": 384, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 378 }, { "analysis_explanation": null, "end": 459, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 453 }, { "analysis_explanation": null, "end": 506, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 494 }, { "analysis_explanation": null, "end": 515, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 510 }, { "analysis_explanation": null, "end": 523, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 517 }, { "analysis_explanation": null, "end": 577, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 566 }, { "analysis_explanation": null, "end": 793, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 786 }, { "analysis_explanation": null, "end": 833, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 827 }, { "analysis_explanation": null, "end": 853, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 843 }, { "analysis_explanation": null, "end": 865, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 859 }, { "analysis_explanation": null, "end": 889, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 875 }, { "analysis_explanation": null, "end": 921, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 911 }, { "analysis_explanation": null, "end": 937, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 931 }, { "analysis_explanation": null, "end": 1030, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1019 }, { "analysis_explanation": null, "end": 1074, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1072 }, { "analysis_explanation": null, "end": 1104, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1098 }, { "analysis_explanation": null, "end": 1125, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1111 }, { "analysis_explanation": null, "end": 1194, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1185 }, { "analysis_explanation": null, "end": 1211, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1198 }, { "analysis_explanation": null, "end": 1266, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1251 }, { "analysis_explanation": null, "end": 1294, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1288 }, { "analysis_explanation": null, "end": 1366, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1351 }, { "analysis_explanation": null, "end": 1435, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1424 }, { "analysis_explanation": null, "end": 1457, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1452 }, { "analysis_explanation": null, "end": 1469, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1462 }, { "analysis_explanation": null, "end": 1484, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1478 } ]

[ "Q:\n\nCSS How do I ask for both max-height and max-width?", "\n\nI know how to ask for max-width or max-height in CSS. ", "I usually do it like this: \n@media screen and (max-width: 1920) {}\nor for height, \n@media screen and (max-height: 1080) {}\nbut how would I write it if I wanted to ask if it was both max-height and max-width in the same rule?", "\n\nA:\n\nIf I understand you correclty, what you want to do is ask for both max-height and max-width in the same query string sentence. ", "If that is the case you just need to create this css block:\n@media screen and (min-height: 720px) and (min-width: 1920px) {\n /* CSS rules here*/\n}\n\nLet me know if that is what you needed.", "\nIf you want to ask for one OR the other just just replace and for a comma.", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.01818181818181818, 0.03571428571428571, 0.017857142857142856, 0.007518796992481203, 0.005291005291005291, 0, 0 ]

[ { "analysis_explanation": null, "end": 172, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 168 } ]

[ "Determining the neuronal connectivity of Golgi-impregnated neurons: ultrastructural assessment of functional aspects.", "\nThe combined light and electron microscopic analysis of Golgi-impregnated neural tissue is a potent tool for determining the connectivity of neural networks within the brain. ", "In the experimental paradigms commonly applied in these studies, the Golgi-impregnated neurons are typically examined as the postsynaptic neuronal components. ", "The structural characteristics and the pattern of distribution of their synaptic connections with other groups of identified neurons are analyzed. ", "Due to the high power of resolution of the Golgi-electron microscopic technique, the ultrastructural analysis of Golgi-impregnated neurons can be expanded to elucidate activity-dependent structural alterations in their cytoarchitecture. ", "These structural alterations can then be correlated under different physiological conditions with changes in the functional efficacy of the subcellular neuronal components." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0, 0.005681818181818182, 0.006289308176100629, 0, 0.008438818565400843, 0 ]

[]

[ "The first time I saw an article headed “State Capitalism and the Crisis” in McKinsey Quarterly (free, but registration required) I thought I had slipped into an alternate reality. ", "But even when I pinched myself it was still there. ", "In it, the political risk analyst Ian Bremmer argues that one of the results of the financial crisis is a resurgence of political economy (although he doesn’t use the phrase). ", "Markets are now far more influenced by national politically influenced decisions than at any time in the last thirty years; this is not a temporary phase but a permanent shift; and as a result the ‘globalised markets’ paradigm is no longer the dominant model, even if some politicians and corporations haven’t caught up with this yet.", "\n\nWhen we worked with Foresight last year on their scenarios for the future of Sustainable Energy Management and the Built Environment, one of the scenarios, “Green Growth”, described a world where large scale international investment in renewables enabled a transition away from the fossil fuel economy. ", "One of these large projects was the ‘solar desert’, in which solar energy was piped north to Europe from the scenario. ", "Such a project is now being promoted by a German consortium headed by the world’s largest reinsurance company Munich Re. ", "An article in Open Democracy looks at the reasons – and the obstacles.", "\n\nLast week’s speech warning of the triple crisis looming by aout 2030 by the British Government’s Chief Scientific Adviser, Sir John Beddington, represents a moment where an issue has moved from the edge into the mainstream. ", "In a speech at SDUK 09, Beddington described a confluence of population growth, water, food shortages and energy shortages – exacerbated by climate change – where there are huge uncertainties which could further worsen food and water issues. ", "Some columnists discounted the speech because Beddington mentioned the 18th cventury economist Thomas Malthus, whose pessimistic population predictions turned out, famously, to be wrong. ", "Don’t speak too soon.", "\n\nThe conventional wisdom has it that the recession is the result of the toxic loans which caused the credit crisis leaking into the rest of the economy. ", "As a story it’s always had a bit of a hole in it for me; the length of time between ‘debtonation day‘ in August 2007, when the banks stopped lending to each other, and the start of the recession a year later. ", "The economist Jeff Rubin has suggested that the recession was caused instead by the high oil prices earlier this year.", "\n\nThe idea that the globalising wave of the last quarter of a century was mostly built on cheap energy and easy money is one that we’re now getting the opportunity to test. ", "So far, the hypothesis is holding up. ", "In particular, according to a story in this week’s Daily Telegraph, high energy costs seem to be having a significant impact on China’s low-cost manufacturing sectors. ", "At the same time, Paul Krugman has been niggling away at the underlying economics. ", "After all, as the French are supposed to say: That’s all very well in practice, but how does it look in theory?", "\n\nJust as we’ve got used to the idea that the moment of ‘peak oil‘ might be upon us (at the moment 2005 is the year of highest oil production) new figures suggest that the figures for world coal reserves might have been inflated. ", "The widely held view that we are sitting on hundreds of years’ supply of coal may be wrong. ", "This could be good news for climate change.", "\n\nI blogged last week about the potential impact of expensive energy on the future shape of the internet. ", "Now it turns out that Sun has already started changing the design of its computer systems to favour efficiency rather than performance because of energy costs. ", "It seems to have moved them to a different market space from their competitors.", "\n\nOne of the most consistently interesting thinkers online about the long-term future of industrial society is John Michael Greer, who takes an impressively long-term and wide ranging (if also pessimistic) view of civilizational change. ", "In his recent post Back Up The Rabbit Hole, he speculated on the way in which the ‘ultra cheap energy’ of the 1980s and 1990s had shaped US technology development – in particular the shape of the internet.", "\n\nI’ve just noticed an interesting article on the recently re-launched ‘History & Policy‘ site which suggests – by looking at the historical evidence – that our chances of reducing energy consumption without sanctions or limits being imposed is, frankly, wishful thinking. ", "Even though we have in the past achieved the energy efficiency gains needed now to reduce CO2 emissions dramatically, energy consumption has kept on increasing." ]

{ "pile_set_name": "Pile-CC" }

[ 0, 0, 0.005681818181818182, 0, 0.006557377049180328, 0, 0.008264462809917356, 0, 0.008849557522123894, 0.004132231404958678, 0.0106951871657754, 0, 0, 0, 0.00847457627118644, 0, 0, 0.005952380952380952, 0.012048192771084338, 0, 0, 0, 0, 0, 0.00625, 0, 0.004219409282700422, 0, 0, 0 ]

[ { "analysis_explanation": null, "end": 276, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 265 }, { "analysis_explanation": null, "end": 529, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 508 }, { "analysis_explanation": null, "end": 781, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 772 }, { "analysis_explanation": null, "end": 1144, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1138 }, { "analysis_explanation": null, "end": 1212, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1206 }, { "analysis_explanation": null, "end": 1365, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1356 }, { "analysis_explanation": null, "end": 1424, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1415 }, { "analysis_explanation": null, "end": 1498, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1483 }, { "analysis_explanation": null, "end": 1614, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1604 }, { "analysis_explanation": null, "end": 1878, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1868 }, { "analysis_explanation": null, "end": 1931, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1917 }, { "analysis_explanation": null, "end": 2299, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2288 }, { "analysis_explanation": null, "end": 2390, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2378 }, { "analysis_explanation": null, "end": 2416, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2406 }, { "analysis_explanation": null, "end": 2509, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2492 }, { "analysis_explanation": null, "end": 2578, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2549 }, { "analysis_explanation": null, "end": 2768, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2764 }, { "analysis_explanation": null, "end": 2853, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2848 }, { "analysis_explanation": null, "end": 2918, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2906 }, { "analysis_explanation": null, "end": 2995, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2989 }, { "analysis_explanation": null, "end": 3184, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3180 }, { "analysis_explanation": null, "end": 3196, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3188 }, { "analysis_explanation": null, "end": 3373, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3355 }, { "analysis_explanation": null, "end": 3466, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3457 }, { "analysis_explanation": null, "end": 3918, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3900 }, { "analysis_explanation": null, "end": 4151, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4146 }, { "analysis_explanation": null, "end": 4165, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4163 } ]

[ "COLORADO PRIMARY ELECTION ON JUNE 24\n\nMay 13 - ALEXANDRIA, Va. - The State of Colorado will hold its primary election on June 24. ", "If you are a Colorado resident and want to vote in the primary, you must be registered by June 24. ", "If you live outside Colorado and need to register to vote absentee, you can do so using the Federal Post Card Application (FPCA) available at FVAP.gov. ", "If you complete and return this form, you will be registered to vote and will receive an absentee ballot for all Federal elections held through the next general election.", "\n\nIf you are already registered in Colorado, you must request your ballot by June 17 if you want to vote in the primary. ", "You can request an absentee ballot using the FPCA available at FVAP.gov.", "\n\nDetailed information is available at fvap.gov/colorado. ", "If you do not receive your absentee ballot by May 23, use the Federal Write-In Absentee Ballot (FWAB) to vote. ", "The form is also available at fvap.gov/colorado.", "\n\n#\n\nIf you experience any issues or have questions, FVAP's call center is available at 1-800-438-VOTE (8683), DSN 425-1584 or at vote@fvap.gov. ", "Toll-free phone numbers from 67 countries are listed at FVAP.gov. ", "Find us on Facebook at /DoDFVAP and follow @FVAP on Twitter." ]

{ "pile_set_name": "Pile-CC" }

[ 0, 0, 0.013157894736842105, 0, 0, 0.027777777777777776, 0.017241379310344827, 0.009009009009009009, 0.020833333333333332, 0.020689655172413793, 0.015151515151515152, 0.016666666666666666 ]

[ { "analysis_explanation": null, "end": 1101, "entity_type": "EMAIL_ADDRESS", "recognition_metadata": { "recognizer_identifier": "EmailRecognizer_139620637004368", "recognizer_name": "EmailRecognizer" }, "score": 1, "start": 1088 }, { "analysis_explanation": null, "end": 57, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 38 }, { "analysis_explanation": null, "end": 62, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 59 }, { "analysis_explanation": null, "end": 128, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 121 }, { "analysis_explanation": null, "end": 151, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 143 }, { "analysis_explanation": null, "end": 227, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 220 }, { "analysis_explanation": null, "end": 257, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 249 }, { "analysis_explanation": null, "end": 593, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 585 }, { "analysis_explanation": null, "end": 634, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 627 }, { "analysis_explanation": null, "end": 852, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 846 }, { "analysis_explanation": null, "end": 1015, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1011 }, { "analysis_explanation": null, "end": 379, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 371 }, { "analysis_explanation": null, "end": 742, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 734 }, { "analysis_explanation": null, "end": 799, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 781 }, { "analysis_explanation": null, "end": 959, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 941 }, { "analysis_explanation": null, "end": 1101, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 1093 }, { "analysis_explanation": null, "end": 1167, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 1159 } ]

[ "Product prices and availability are accurate as of 2018-02-16 16:28:06 UTC and are subject to change. ", "Any price and availability information displayed on http://www.amazon.com/ at the time of purchase will apply to the purchase of this product.", "\n\nProduct Description\n\nAt For The PC we supply all the latest brand name products just like Best Value Tablet ValuePad VP111 7\" Tablet 8GB Bluetooth HDMI Scr Prot Android 4.2.2 1.3GHz 1080P Google Play 3D Game MicroSD Dual Core Dual Camera (Black). ", "This item is a fantastic product and is available for quick shipment. ", "Get this item right now and all of your PC products right here at the shop which offers all of it, For The PC!", "\n\nProduct Features\n\nLook no further for a budget tablet with more features and value for less. ", "As the only tablet having both Bluetooth and HDMI in its price range, it is a good buy for kids and first-time tablet buyers. ", "While this is NOT a lighting fast tablet, it WILL get the job done. ", "New 2014 Cortex dual core 1.3GHz CPU is more powerful and more compatible with new software and hardware than old A8 and A5 (such as Allwinner A13) CPUs in many other budget tablets.", "\n2800mAh battery ensures 3+ hours (Wi-Fi off, low volume & 35% brightness; Expect shorter run time with Wi-Fi and higher volume/brightness settings) of smooth 1080P video with the latest Android 4.2.2, Dual Core CPU and same series graphic processors as in iPad. ", "Keep all your movies in expandable storage up to 8GB + 32GB Micro SD + 64GB USB flash drive. ", "Front and rear 0.3MP cameras for convenient Skype commuinications (Low resolution cameras for video calls and fun only).", "\nOptional ValuePad brand accessories: Screen Protector (Amazon item # B00KVP4SD4); Silicone slap stand (B00L1QDFZO); Hi-Spead Mini HDMI - HDMI cable (B00L5OC3CI); Car charger (B00KH8YSCG); Super Bass Bluetooth Speaker (B00I2XXT50-Black, B00I2XXX1K-Gold); ValuePad silicone protector (B00KGCS7IO - Pink; B00KGCS5R2 - Black); Keyboard Case/Stand (B00HCW7DTU); ValuePad for Kids VP111-K (B00I09WN7Q - Pink; B00HDKWEFO - Black) comes with the silicone protector.", "\nCapacitive Multi-Touch 800x480 display. ", "Endless fun with the freedom to connect external keyboards, mouse, joysticks, flash drives and Ethernet adapters. ", "Online chatting using the dual front and rear cameras. ", "Real English instruction manuals - no more broken English! ", "Lower prices and a Quick Start Guide with battery and charging instrutions available at valuechainusa. ", "Kids version VP-111K available in Black (item B00HDKWEFO) and Pink (B00I09WN7Q).", "\nNOTICE: THERE IS A MISPRINT ON THE FIRST 2 PAGES OF THE QUICK START GUIDE THAT COMES WITH THE TABLET. ", "Please disregard the booklet in the tablet box and download \"Quick Start Guide (VP111/VP111B/VP112)\" from the support page on our valuechainusa website. ", "You can also contact us via email or Amazon message system to obtain a copy. ", "We apologize for this inconvenience and thank you for your support." ]

{ "pile_set_name": "Pile-CC" }

[ 0.00980392156862745, 0.007042253521126761, 0.004016064257028112, 0, 0, 0, 0, 0, 0.005494505494505495, 0.0076045627376425855, 0.010752688172043012, 0.008333333333333333, 0.019650655021834062, 0, 0, 0, 0, 0.019417475728155338, 0.0125, 0.009708737864077669, 0.006535947712418301, 0.012987012987012988, 0 ]

[ { "analysis_explanation": null, "end": 61, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 51 }, { "analysis_explanation": null, "end": 369, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 362 }, { "analysis_explanation": null, "end": 405, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 397 }, { "analysis_explanation": null, "end": 806, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 797 }, { "analysis_explanation": null, "end": 1106, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1093 }, { "analysis_explanation": null, "end": 1175, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1167 }, { "analysis_explanation": null, "end": 1698, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1688 }, { "analysis_explanation": null, "end": 2343, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2336 }, { "analysis_explanation": null, "end": 2487, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2482 }, { "analysis_explanation": null, "end": 2774, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2761 }, { "analysis_explanation": null, "end": 176, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 154 }, { "analysis_explanation": null, "end": 367, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 362 }, { "analysis_explanation": null, "end": 1076, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 1074 }, { "analysis_explanation": null, "end": 1083, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 1081 }, { "analysis_explanation": null, "end": 1106, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 1103 }, { "analysis_explanation": null, "end": 1999, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 1994 }, { "analysis_explanation": null, "end": 2716, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 2711 }, { "analysis_explanation": null, "end": 2729, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 2724 } ]

[ "Q:\n\nHow to make reverse transition after :hover\n\nFrom my understanding of CSS3 transitions you have to specify the transition only in the base element and not in the :hover element, e.g. as described in the Mozilla documentation. ", "This should lead to a transition when the new properties from :hover are applied and reverse the transition as soon as you don't hover anymore. (", "Fiddle below code)\n#test{\n position:absolute;\n height: 100px;\n width: 100px;\n background-color: #A8A8A8;\n\n -o-transition: all 0.5s ease;\n -ms-transition: all 0.5s ease;\n -moz-transition: all 0.5s ease;\n -webkit-transition: all 0.5s ease;\n transition: all 0.5s ease;\n}\n\n#test:hover{\n border-bottom: 10px solid black;\n}\n\nBut this leads to fading-in only. ", "When you stop hovering the border is instantly removed.", "\nhttp://jsfiddle.net/hcsamkjf/1/\nAny ideas?", "\n\nA:\n\nYou also need to specify the \"initial state\", otherwise the browser doesn't know what to animate. ", "It can sometimes guess, which would be why you see it half-working (but it doesn't transition at all for me).", "\nAdd border-bottom:10px solid transparent or border-bottom:0 solid transparent to your #test styles, depending on the exact effect you want.", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.004347826086956522, 0, 0.0026109660574412533, 0, 0.023255813953488372, 0, 0, 0, 0 ]

[ { "analysis_explanation": null, "end": 846, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 815 } ]

[ "function benchrun_sub_insert(use_write_command) {\n t = db.benchrun_sub;\n t.drop();\n var offset = 10000;\n ops = [{\n op: \"insert\",\n ns: \"test.benchrun_sub\",\n doc: {\n x: {\"#RAND_INT\": [0, 100]},\n curDate: {\"#CUR_DATE\": 0},\n futureDate: {\"#CUR_DATE\": offset},\n pastDate: {\"#CUR_DATE\": (0 - offset)}\n },\n writeCmd: use_write_command,\n }];\n\n res = benchRun({parallel: 1, seconds: 10, ops: ops, host: db.getMongo().host});\n\n assert.gt(res.insert, 0);\n\n t.find().forEach(function(doc) {\n var field = doc.x;\n assert.gte(field, 0);\n assert.lt(field, 100);\n assert.lt(doc.pastDate, doc.curDate);\n assert.lt(doc.curDate, doc.futureDate);\n });\n}\n\nfunction benchrun_sub_update(use_write_command) {\n t = db.benchrun_sub;\n t.drop();\n\n ops = [{\n op: \"update\",\n ns: \"test.benchrun_sub\",\n query: {x: {\"#RAND_INT\": [0, 100]}},\n update: {$inc: {x: 1}},\n writeCmd: use_write_command\n }];\n\n for (var i = 0; i < 100; ++i) {\n t.insert({x: i});\n }\n\n res = benchRun({parallel: 1, seconds: 10, ops: ops, host: db.getMongo().host});\n\n var field_sum = 0;\n t.find().forEach(function(doc) {\n field_sum += doc.x;\n });\n\n assert.gt(field_sum, 4950); // 1 + 2 + .. 99 = 4950\n}\n\nfunction benchrun_sub_remove(use_write_command) {\n t = db.benchrun_sub;\n t.drop();\n\n ops = [{\n op: \"remove\",\n ns: \"test.benchrun_sub\",\n query: {x: {\"#RAND_INT\": [0, 100]}},\n writeCmd: use_write_command,\n }];\n\n for (var i = 0; i < 100; ++i) {\n t.insert({x: i});\n }\n\n res = benchRun({parallel: 1, seconds: 10, ops: ops, host: db.getMongo().host});\n\n assert.eq(t.count(), 0);\n}\n\nbenchrun_sub_insert(true);\nbenchrun_sub_insert(false);\nbenchrun_sub_update(true);\nbenchrun_sub_update(false);\nbenchrun_sub_remove(true);\nbenchrun_sub_remove(false);\n" ]

{ "pile_set_name": "Github" }

[ 0.002034587995930824 ]

[ { "analysis_explanation": null, "end": 222, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 214 }, { "analysis_explanation": null, "end": 469, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 459 }, { "analysis_explanation": null, "end": 963, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 955 }, { "analysis_explanation": null, "end": 1164, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1154 }, { "analysis_explanation": null, "end": 1554, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1546 }, { "analysis_explanation": null, "end": 1724, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1714 }, { "analysis_explanation": null, "end": 63, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 58 }, { "analysis_explanation": null, "end": 168, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 161 }, { "analysis_explanation": null, "end": 496, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 491 }, { "analysis_explanation": null, "end": 527, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 518 }, { "analysis_explanation": null, "end": 534, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 528 }, { "analysis_explanation": null, "end": 553, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 549 }, { "analysis_explanation": null, "end": 626, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 617 }, { "analysis_explanation": null, "end": 656, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 647 }, { "analysis_explanation": null, "end": 687, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 678 }, { "analysis_explanation": null, "end": 694, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 688 }, { "analysis_explanation": null, "end": 708, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 702 }, { "analysis_explanation": null, "end": 733, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 724 }, { "analysis_explanation": null, "end": 740, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 734 }, { "analysis_explanation": null, "end": 838, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 833 }, { "analysis_explanation": null, "end": 920, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 913 }, { "analysis_explanation": null, "end": 1103, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 1099 }, { "analysis_explanation": null, "end": 1191, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 1186 }, { "analysis_explanation": null, "end": 1240, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 1236 }, { "analysis_explanation": null, "end": 1319, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 1310 }, { "analysis_explanation": null, "end": 1429, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 1424 }, { "analysis_explanation": null, "end": 1511, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 1504 }, { "analysis_explanation": null, "end": 1663, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 1659 }, { "analysis_explanation": null, "end": 1751, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 1746 }, { "analysis_explanation": null, "end": 1787, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 1783 } ]

[ ".", "\nMEN AND\nWOMEN OF THE\nREPUBLICAN NATIONAL CONVENTION,\nIT'S ON.", "\nO'Donnell: PRESIDENT.", "\nPRESIDENT TRUMP IS THE LAW\nAND ORDER PRESIDENT.", "\nI'M A POSTAL WORKER.", "\nWE'RE TAKING GOOD CARE OF OUR\nPOSTAL WORKERS.", "\nABSOLUTELY.", "\nTHAT I CAN TELL YOU.", "\nHE TOOK ACTION, HE FORMED A\nSCHOOL SAFETY COMMISSION THAT\nISSUED DOZENS OF RECOMMENDATIONS\nTO MAKE SCHOOLS SAFER.", "\nIT HURT MY SOUL.", "\nTHE WORST ONE IS RACIST.", "\nPRESIDENT TRUMP IS BRINGING\nTHIS COUNTRY BACK ROARING, HE'S\nBRINGING THE AMERICAN SPIRIT TO\nLIFE.", "\nWE ARE MAKING AMERICA GREAT\nAGAIN AND WITH YOUR VOTE, IN\n2020, WE WILL KEEP AMERICA\nGREAT!", "\nO'Donnell: GOOD EVENING.", "\nWE ARE 71 DAYS FROM ELECTION DAY\nAND TONIGHT THE REPUBLICANS\nBEGIN PRESENTING THEIR CASE FOR\nGIVING DONALD TRUMP FOUR MORE\nYEARS AS PRESIDENT.", "\nI'M NORAH O'DONNELL IN THE\nNATION'S COP TOLL AND WELCOME TO\nCBS NEWS COVERAGE.", "\nREPUBLICAN NATIONAL CONVENTION.", "\nTHIS CONVENTION WILL LOOK\nDIFFERENT THAN YEARS BEFORE.", "\nPRESIDENT TRUMP WILL NOT HAVE\nTHE PACKED ARENA NOR THE\nBOISTEROUS CROWDS HE ENJOYS.", "\nMANY OF THE SPEECHES WILL BE\nFROM AN AUDITORIUM HERE IN\nWASHINGTON.", "\nBUT EARLIER TODAY A FEW HUNDRED\nDELEGATES GATHERED IN CHARLOTTE,\nIN THE CAROLINA, WHERE THE ROLL\nCALL VOTE WAS HELD AND PRESIDENT\nTRUMP WAS OFFICIALLY\nRENOMINATED.", "\nTHIS IS THE MOST IMPORTANT\nELECTION IN THE HISTORY OF OUR\nCOUNTRY.", "\nDON'T LET THEM TAKE IT AWAY FROM\nYOU.", "\nO'Donnell: TONIGHT WE'LL\nHEAR FROM FORMER U.N. AMBASSADOR\nNIKKI HALEY, THE PRESIDENT'S\nOLDEST SON DONALD TRUMP, JR. ", "AND\nTIM SCOTT.", "\nTHROUGHOUT THE WEEK I WILL BE\nJOINED BY OUR CONTRIBUTE ARES\nAND ANALYSTS, CBS NEWS SENIOR\nPOLITICAL AN LISS AND 06 MINCE\nCORRESPONDENT JOHN DICKERSON,\nCBS NEWS CONTRIBUTOR MARIA ELENA\nSALINAS, PRESIDENT TRUMP'S FIRST\nCHIEF OF STAFF AND RNC CHIERM\nREINCE PREEBUS AND FOR HILLARY\nCLINTON'S\nCLINTON'S 2016 CAMPAIGN JOEL\nPAYNE, WELCOME TO ALL OF YOU, SO\nGOOD TO YOU HAVE, LET ME START\nWITH YOU, JOHN, PRESIDENT TRUMP\nWILL APPEAR ANY MINUTE NOW, WE\nWILL TAKE THAT, AND HE WILL\nAPPEAR EVERY NIGHT AS WILL A\nMEMBER OF HIS FAMILY, IS THE\nPARTY OF LINCOLN NOW THE PARTY\nOF TRUMP?", "\nYOU WON'T BE ABLE TO FORGET\nTHAT THIS IS DONALD TRUMP'S\nPARTY IT IS ALMOST LIKE ONE OF\nHIS BUILDINGS WITH HIS NAME ON\nIT, AND IT IS NOT JUST BECAUSE\nWILL BE THERE EVERY NIGHT, IS HE\nIN EVERYBODY'S MOUTH, THIS IS\nNOT ABOUT THE REPUBLICAN PARTY T\nIS ABOUT THE PARTY OF DONALD\nTRUMP.", "\nIN OUR MOST RECENT POLL ALMOST\n60% OF VOTERS IDENTIFIED AS\nTRUMP VOTERS BEFORE THEY\nIDENTIFIED AS REPUBLICAN.", "\nAND THE FEEL OF THE NIGHT SO FAR\nAND THROUGH THE WEEK FEELS LIKE\nDONALD TRUMP AND FEUNLLY WHEN\nYOU LOOK AT THE CONVENTION\nCOMPARED TO THE ONES WE HAVE\nBEEN TO IN THE PAST WHERE YOU\nHAVE PAST PRESIDENTS, THIS IS\nALL DONED A TRUMP.", "\nREINCE PREEBUS, YOU\nWORKED-- PRIEBUS, YOU WORKED IN\nTHE WHITE HOUSE, IS THIS ABOUT\nREBRANDING IN SOME WAY THE\nREPUBLICAN PARTY AND WHO IS THE\nPART OF THE ELECTORATE THAT\nTRUMP NEEDS TO IMPROVE WITH?", "\nWELL, FIRST OF ALL, NORAH,\nTHERE AREN'T A LOT OF\nPERSUADABLE VOTERS AS WE CALL\nTHEM WATCHING THESE CONVENTIONS\nAND WHAT IS REALLY GOING ON HERE\nIS THIS IS AN ELECTION OF\n300,000 PEOPLE IF ABOUT EIGHT\nSTATES.", "\nO'Donnell: 300 MILLION.", "\nBUT THERE ARE ONLY 300,000\nPEOPLE THAT WE CAN MOVE IN EIGHT\nSTATES.", "\nSO WHAT WE'VE GOT HERE IS THE\nPRESIDENT TRYING TO TALK ABOUT\nCOMPASSION AND TALK ABOUT LAW\nAND ORDER.", "\nBECAUSE COMPASSION AND LAW AND\nORDER SPEAK TO PEOPLE IN\nMILWAUKEE, PHILADELPHIA, AND THE\nCOUNTIES AROUND PITTSBURGH,\nBECAUSE THAT IS WHERE THE\nELECTION IS AT.", "\nO'Donnell: LET'S LISTEN THE\nPRESIDENT.", "\nIN VARIOUS COUNTRIES AND I'M\nVERY PLEASED TO LET EVERYONE\nKNOW THAT WE BROUGHT BACK OVER\n50 HOSS TAJES FROM 22\nDIFFERENT-- HOSTAGES FROM 22\nDURCH COUNTRIES WE WORKED VERY\nHARD, AND WE ARE VERY PROUD OF\nTHE JOB WE DID.", "\nBUT I WOULD LIKE TO ASK MAYBE\nPASTOR BRUNSON TO SAY A FEW\nWORDS, TO JUST GIVE US A LITTLE\nHISTORY OF WHAT HAPPENED AND HOW\nIS LIFE TREATING YOU.", "\nI WAS HELD IN TURKEY FOR TWO\nYEARS AND.", "\nYOU TOOK UNPRECEDENTED STEPS,\nTULLY, TO SECURE MY RELEASE, AND\nYOUR ADMINISTRATION REALLY\nFOUGHT FOR ME.", "\nAND I THINK IF YOU HADN'T DONE\nTHAT I MAY STILL BE IN TURKEY.", "\nI'M VERY GRATEFUL.", "\n28 YEARS, RIGHT, THEY HAD YOU\nSCHEDULE FORD A LONG TIME, WE\nHAD TO GET YOU BACK.", "\nAND I HAVE TO SAY THAT TO ME\nPRESIDENT ERDOGAN WAS VERY GOOD.", "\nAND I KNOW THEY HAD YOU\nSCHEDU\nSCHEDULED FOR A LONG TIME AND\nYOU WERE A VERY INNOCENT PERSON.", "\nAND HE ULTIMATELY AFTER WE HAD A\nFEW CONVERSATIONS, HE AGREED.", "\nSO WE APPRECIATE THAT.", "\nAND WE APPRECIATE THE PEOPLE OF\nTURKEY.", "\nAND YOU STILL APPRECIATE THE\nPEOPLE OF TURKEY, I UNDERSTAND,\nRIGHT.", "\nI LOVE THE TURKISH PEOPLE.", "\nIT'S GREAT, IT'S GREAT TO YOU\nHAVE BACK, ANDREW, THANK YOU.", "\nPLEASE.", "\nMR. ", "PRESIDENT, THRU FOR\nHAVING ME, I'M SAM GOODWIN FROM\nST. ", "LOUIS, MISSOURI, HELD IN\nSYRIA FOR 63 DAYS.", "\nAND I THINK I SPEAK FOR MY\nFELLOW FORMER HOSTAGES AND\nDETAINEES HERE WHEN I SAY I'M AS\nGRATEFUL AS I HAVE EVER BEEN FOR\nANYTHING TO BE HOME SAFELY AND\nTHANK YOU FOR THE INHAVE I\nTAITION AND OPPORTUNITY TO BE\nHERE, PARTICULARLY PASTOR O\nBRAIN WAS INCREDIBLY SUPPORTIVE\nAND HELPFUL TO MY FAMILY AND\nCAN'T SAY ENOUGH NICE THINGS\nABOUT HIM, THANK YOU FOR\nPROMOTEDK HIM AND JUST REALLY\nHAPPY TO BE HERE, SO THANK YOU.", "\nHE GOT YOU BACK.", "\nWE GOT YOU ALL BACK AND WE\nHAVE SOME MORE WE ARE WORKING ON\nRIGHT NOW TO GET BACK, THAT WE\nBETTER DO, PLEASE.", "\nMY NAME, MR. ", "PRESIDENT,\nMR. ", "PRESIDENT IT IS AN HONOR TO\nBE HERE AND MEET NEW PERSON,\nBASICALLY WHAT HAD HAPPENED WITH\nME IS I TRAVELED OVER THE\nCOUNTRY OF IRAN, TURNED OUT\nTHERE WAS A MAJOR TRAP AND I WAS\nAPP REHENNED THERE.", "\nI WENT THROUGH A LOT IN THEIR\nJUSTICE SYSTEM, THE IT HAS BEEN\nEXOPPRESSIVE, EXTORTIONIST\nREGIME, WHAT YOU DID WAS ABLE TO\nGET ME OUT OF THAT PRISON IN\nRECORD TIME TRK WAS AMAZING.", "\nTHANK YOU VERY MUCH.", "\nTHE HOOR WAS ALL MINE.", "\nPLEASE.", "\nMY NAME IS JASH, WE WERE HELD\nHOSTAGE IN VENEZUELA FOR TWO\npYEARS.", "\nI KNOW VERY WELL.", "\nAND YOU HELPED US GET OUT,\nSENATOR HATCH WORKED ON THAT AS\nWELL AND IT WAS A GREAT HONOR TO\nBE ABLE TO MEET YOU RIGHT WHEN\nWE GOT BACK.", "\nI REMEMBER A LOT OF PEOPLE ASKED\nWHAT WAS IT LIKE TO MEET\nPRESIDENT TRUMP, I SAID I WAS\nBLOWN AWAY, JUST GOTTEN RELEASED\nAFTER TWO YEARS AND THEN SHAKING\nTHE HAND OF THE PRESIDENT IN THE\nOVAL OFFICE, I DON'T REALLY\nREMEMBER A LOT OF IT, IT IS NICE\nTO MEET YOU AGAIN, IT IS GREAT\nTO BE BACK HELPING PEOPLE\nTHROUGH SITUATIONS THAT THEY'VE\nGONE THROUGH AND NOW WE HAVE TO\nSTART A FAMILY.", "\nTHE GREAT PEOPLE OF UTAH\nREALLY WANTED ME TO DO SOMETHING\nABOUT THE TWO OF YOU.", "\nAND WE WERE ABLE TO DO IT.", "\nAND LITTLE BIT OF A MIRACLE I\nTHINK FRANKLY BECAUSE THAT WAS A\nVERY HOSTILE PERIOD.", "\nAND WE APPRECIATE EVERYBODY\nWORKING SO HARD WITH US.", "\nBUT WE WERE ABLE TO GET YOU BOTH\nBACK.", "\nAND ARE YOU LIVING IN UTAH NOW.", "\nWE ARE STILL IN UTAH.", "\nSAY HELLO TO THE FOLKS IN\nUTAH BECAUSE THEY ARE GREAT\nPEOPLE, THANK YOU VERY MUCH,\nCONGRATULATIONS.", "\nTHANK YOU.", "\nPLEASE.", "\nBRIAN, UNEXPECTED TRIP IN\nINDIA, I WAS NOT GOING TO INDIA,\nI WAS GOING THROUGH INDIA TO\nNEPAL BUT WHERE I WORKED FOR THE\nLAST 18 YEARS BUT ON BEHALF OF\nMY FAMILY AND MYSELF THANK YOU,\nPRESIDENT TRUMP, FOR GETTING US\nOUT AND GETTING US HOME.", "\nUS HOME.", "\nTHE DARKEST MOMENT OF OUR WHOLE\nTIME TOGETHER, YOUR LETTER TO MY\nWIFE CAME.", "\nAND IT REALLY GAVE HER THE HOPE\nAND PEACE.", "\nFROM THAT TIME FORWARD, IT'S\nMORE PEOPLE GOT INVOLVED,\nESPECIALLY THE AMBASSADOR THERE,\nIN INDIA, THINGS BECAME MORE\nPEACEFUL AND THE HOPE WAS THERE\nFOR THE LAST FOUR MONTHS.", "\nTHAT WE WITH GET TO COME HOME,\nTHEY PLANNED ON KEEPING ME FOR\n35 YEARS.", "\nTHE ORIGINAL CHARGE THING WAS 35\nYEARS.", "\nAND THAT WAS CLEARED AND THEN\nTHEY CAME UP WITH NEW CHARGES\nTHAT WAS 7 YEAR TERM.", "\nINDIA RESPONDED VERY WELL TO\nMY REQUEST.", "\nSO WE APPRECIATE THAT.", "\nI APPRECIATE EVERYTHING Y'ALL\nDID.", "\nTHANK YOU ALL FOR BEING WITH\nUS.", "\nWE HAVE A FEW MORE PEOPLE WE\nWANT TO GET BACK AND WE WILL GET\nGET\nTH\nTHEM BECOME AND THEY WILL BE\nBACK VERY SOON.", "\nTHANK YOU VERY MUCH.", "\nAPPRECIATE IT, GREAT STORIES.", "\nO'Donnell: THERE THE\nPRESIDENT OF THE UNITED STATES\nHIGHLIGHTING A NUMBER OF\nAMERICANS WHO HAD BEEN HELD\nHOSTAGE OVERSEAS AND WERE\nBROUGHT BACK THROU EFFORTS OF\nTHE TRUMP ADMINISTRATION.", "\nI WANT TO BRING IN CBS NEWS\nCHEAF WASHINGTON CORRESPONDENT\nT\nM\nMAJOR GARRETT WHO IS OUTSIDE THE\nANDREW MELON AUDITORIUM WHERE\nTONIGHT'S HEADLINERS ARE\nSPEAKING, THAT IS CLEARLY AN\nEFFORT BY THE PRESIDENT TO SAY\nTHIS IS SOMETHING POSITIVE I\nHAVE GOTTEN DONE WATCH.", "\nABOUT SOME OF THE OTHER PROMISES\nHE MADE AND PROMISES HE KEPT.", "\nSO A QUICK DISCLAIMER, THIS\nLIST WILL NOT BE EXHAUSTIVE.", "\nTHE WHITE HOUSE HAS A MUCH\nLONGER LIST THAN WE WILL SHOW\nYOU OF PROMISES KEPT AND THE\nDEMOCRATIC NATIONAL COMMITTEE\nHAS A LONGER LIST OF PROMISES\nBROKEN BUT THE ONES WE WILL SHOW\nYOU ARE THE ONES THAT WILL BE\nLITIGATED AND PART OF THE\nGOVERNING REALITY OF THE NEXT\nPRESIDENT, WHOEVER THAT MIGHT\nBE.", "\nSO THE PRESIDENT REDUCED TAX\nRATES FOR INDIVIDUALS AND\nCORPORATIONS.", "\nHE REBUILT AND EXPANDED THE\nSOUTHERN BORDER WALL.", "\nHE ALSO GOT OUT OF THE PARIS\nCLIMATE ACCORD AND DROPPED OUT\nOF THE IRAN NUCLEAR DEAL, HE\nAPPOINTED AND SAW CONFIRMED TWO\nSUPREME COURT JUSTICES AND MORE\nTHAN 200 OTHER JUSTICES TO THE\nFEDERAL BENCH.", "\nON THE NOT KEPT SIDE OF THE\nLEDGER THE DEFICIT IS HIGHER, SO\nIS THE NATIONAL DEBT.", "\nAFFORDABLE CARE ACT REMAINS AND\nTHERE IS NO HEALTH CARE REFORM\nUNDER REPUBLICAN BANNER.", "\nAND ALSO THE PRESIDENT PROMISED\nDURING THE CAMPAIGN I HEARD IT\nOVER AND OVER, MEXICO WOULD MAY\nFOR THE NEW BOARD-- SHALL BORDER\nWALL THARK HASN'T HAPPENED.", "\nBUT WHAT WE HEARD IS NOT ONLY\nTHESE PROMISES MADE AND KEPT BUT\nTHE WAY THE PRESIDENT KEEPS HIS\nPROMISES.", "\nREPUBLICANS SAYING HIS METHODS\nARE TOUGH BUT THEY ARE\nEFFECTIVE.", "\nNORAH, BACK TO YOU.", "\nO'Donnell: ALL RIGHT,\nMAJOR, THANK YOU.", "\nSTILL AHEAD WE'VE GOT SPEECHES\nBY NIKKI HALEY, DONALD TRUMP,\nJR. ", "AND SENATOR TIM SCOTT.", "\nYOU'RE WATCHING CBS NEWS\nCOVERAGE OF THE REPUBLICAN\nNATIONAL CONVENTION.", "\n♪ You must go and I must bide ♪\n♪ But come ye back when su-- ♪\nMom, dad.", "\nWhy's Jamie here?", "\nIt's Sunday.", "\nSunday sing along.", "\nAnd he helped us get\na home and auto bundle.", "\nHe's been our insurance guy\nfor five years now.", "\nHe makes us feel like\nwe're worth protecting.", "\n[ Gasps ] Why didn't you tell us\nabout these savings, Flo?", "\nI've literally told you\na thousand times.", "\n♪ Oh, Danny boy, the pipes,\nthe pipes are calling ♪\nI'm just gonna...\n♪ From glen to glen ♪\nSHE KNEW HE HAD TO HIDE THE\nTRUTH.", "\nBUT THE MOURNING, GONE,\nDESTROYED.", "\nWHEN I WATCH THE NEWS IN\nSEATTLE, CHICAGO, PORTLAND AND\nOTHER CITIES, WHEN I SEE-- WHEN\nI HEAR THE PROMISES, I HEAR\nECHOES OF A FORMER LIFE, I NEVER\nWANTED TO HEAR AGAIN.", "\nI SEE SHADOWS.", "\nMY PARENTS ONLY WANTED ONE\nPERSON TO DECIDE MY FATE, ME.", "\nNOT SOME GOVERNMENT OFFICIAL,\nNOT SOME BUREAUCRAT.", "\nO'Donnell: AND WELCOME BACK\nTO OUR COVERAGE OF THE\nREPUBLICAN NATIONAL CONVENTION.", "\nTHAT IS CONVENTION SPEAKER CUBAN\nIMMIGRANT AND FLORIDA\nBUSINESSMAN MAXIMO ALVAREZ.", "\nLET'S BRING BACK IN OUR PANEL,\nMARIA \"ELLEN\" D DRK MARIA\nELENA, THIS IS THE ANTI-RASS\nTRO, ANTI-CUBA, AND THIS\nANTISOCIALIST MESSAGE.", "\nI THINK WHAT THE REPUBLICANS\nHAVE BEEN DOING IS PAINTING THE\nDEMOCRATIC PARTY AS SOCIALISTS,\nIT DOESN'T MATTER IF BERNIE\nSANDERS AND ELIZABETH WARREN\nAREN'T ON THE TICKET THEY STILL\nWANT TO CATEGORIZE THEM AS THEY\nARE SOCIALISTS.", "\nIT REALLY WORKS WELL WITH THE\nCUBAN AMERICANS, WITH THE\nVENEZUALAANS, NIX ROG WANTS AND\nBOLLIVE VANS ESPECIALLY IN\nN\nFLORIDA BUT THAT IS BETWEEN THE\n20 AND 25% OF LATINOS THAT ARE\nALREADY STAUNCH REPUBLICANS THAT\nWILL VOTE FOR ANY REPUBLICANMENT\nBUT THEN THERE ARE THOSE WHO SAY\nIT IS ONLY RHETORIC.", "\nESPECIALLY IN THE CASE OF\nVENEZUELA BECAUSE WE DON'T SEE\nHIM OFFERING ANY KIND OF\nTEMPORARY PROTECTION STATUS, FOR\nEXAMPLE, OR GOING AGAINST PUTIN\nAND PRESSING PUTIN BECAUSE OF\nHIS SUPPORT OF MADURO IN\nVENEZUELA.", "\nO'Donnell: I WANT TO BRING\nIN JOEL PAYNE, YOU STUDIED THIS,\nALL THE DIFFERENT DEMOGRAPHICS\nTRUMP WOMAN IN 2016 WHERE HE IS\nLOSING GROUND TODAY.", "\nINDEPENDENTS, SUBURBAN VOTERS,\nCOLLEGE-EDUCATED WHITE VOTERS\nAND SENIORS.", "\nWHERE DO YOU SEE THAT MAP THERE\nWITH THOSE DIFFERENT GROUPS?", "\nWELL NORAH, ACTUALLY T IS\nFUNNY, I HAD A CONVERSATION WITH\nSOMEONE CLOSE TO THE BIDEN CAMP\nTODAY AND THEY POINTED THOSE\nFOUR GROUPS OUT TO ME IT IS NOT\nJUST THAT THE PRESIDENT WON\nTHOSE GROUPS IN 2016.", "\nMITT ROMNEY WON THEM IN 2012 AND\nHE IS TRAILING IN ALL FOUR OF\nTHOSE GROUPS AGAINST JOE BIDEN.", "\nAND I THINK THAT THAT JUST KIND\nOF BELABORS THE POINT OF WHAT WE\nWERE TALKING ABOUT EARLIER\nRELATED TO WILL THE PRESIDENT\nUSE THIS AS AN OPPORTUNITY TO\nREACH OUT TO THE MIDDLE.", "\nTHE PRESIDENT IS VERY GOOD AT\nBASE POLITICS BUT WE'VE NEVER\nSEEN AN INCUMBENT PRESIDENT NOT\nWIN RE-ELECTION OR RATHER WIN\nRE-ELECTION WITHOUT REACHING OUT\nTO THE MIDDLE.", "\nYOU HAVE TO DO A BASE PLUS\nSTRATEGY.", "\nYOU HAVE TO FIGURE OUT IF YOU\nARE BARACK OBAMA IN 2012, HOW DO\nYOU BRING ON REPUBLICANS.", "\nYOU TALK ABOUT BALANCING THE\nBUDGET AND THE DEFICIT AND YOU\nBRING IN SOMEONE LIKE BILLDALEY\nTO BE YOUR CHIEF OF STAFF.", "\nGEORGE BUSH DID IN, REAGAN IN\n1980.", "\nPRESIDENT TRUMP DOESN'T HAVE ANY\nITEREST IN THAT.", "\nHE IS MAKING A BET ON HIMSELF\nAND THAT HIS BASE IS BIG ENOUGH\nAND ENTHUSIASTIC ENOUGH TO BRING\nHIM TO VICTORY.", "\nWE'LL SEE IF THAT IS THE CASE.", "\nO'Donnell: REINCE, WERE YOU\nTALKING ABOUT THAT, THESE GROUPS\nOF CALL COLOR COUNTIES WHY IS\nPRESIDENT TRUMP FAILING AMONG\nTHE SUBURBAN COMMUNITIES THIS\nYEAR.", "\nIF YOU LOOK AT THE ISSUES ON\nTHE TABLE, BEFORE COVID AND\nCORONAVIRUS, I THINK THE\nPRESIDENT WAS DOING PRETTY WELL\nAM BUT CORONAVIRUS CAME AROUND,\nPEOPLE ARE SCARED.", "\nBUT THAT IS WHY YOU ARE GOING TO\nSEE LAW AND ORDER, COMPASSION\nCOMBINED AND WHERE I THINK THE\nREPUBLICANS NEED TO BUILD IS ON\nTHE COMPASSION PART OF THE LAW\nAND ORDER MESSAGE.", "\nBUILDING THAT UP AND THEN GOING\nBACK TO WHAT HERSCH-- HERSCHEL\nWALK ARED SAID, MAYBE YOU HIT\nTOO HARD ONCE IN AWHILE BUT THAT\nIS WHAT YOU HAVE TO DO, AND THEN\nBACK TO COMPASSION, NIKKI HALEY,\nTIM SCOTT, ALL THOSE PEOPLE YOU\nHEARD FROM, THAT IS THE FORMULA\nFOR BRINGING THE CLAR COUNTIES\nBACK-- COLLAR COUNTIES BACK,\nSHORING UP YOUR BASE AND GOING\nINTO A CLOSE ELECTION.", "\nO'Donnell: SPEAKING OF\nNICKERI HALEY, WE MAY BE SEEING\nA PREVIEW OF THE 2024 CAM PAWN\nTONIGHT AS NIKKI HALEY ADDRESSES\nTHE REPUBLICAN CONVENTION.", "\nLET'S LISTEN AM TO THE FORMER\nGOVERNOR OF SOUTH CAROLINA.", "\nI'M NIKKI HALEY AND IT IS\nGREAT TO BE BACK AT THE\nREPUBLICAN NATIONAL CONVENTION.", "\nI WILL START WITH A LITTLE\nSTORY.", "\nIT IS ABOUT AN AMERICAN\nAMBASSADOR TO THE UNITED NATIONS\nAND IT IS ABOUT A SPEECH SHE\nGAVE TO THIS CONVENTION.", "\n.", "\nSHE CALLED FOR THE RE-ELECTION\nOF THE REPUBLICAN PRESIDENT SHE\nSERVED.", "\nAND SHE CALLED OUT HIS DEMOCRAT\nYOU CAN OPPONENT.", "\nA FORMER VICE PRESIDENT FROM A\nFAILED ADMINISTRATION.", "\nTHAT AMBASSADOR SAID, AND YOU\nQUOTE, DEMOCRATS ALWAYS BLAME\nAMERICA FIRST.", "\nTHE YEAR WAS 1984.", "\nTHE PRESIDENT WAS RONALD REAGAN.", "\nAND AMBASSADOR JANE KIRK\nPATRICK'S WORDS ARE JUST AS TRUE\nTODAY.", "\nJOE BIDEN AND THE DEMOCRATS ARE\nSTILL BLAMING AMERICA FIRST.", "\nDONALD TRUMP HAS ALWAYS PUT\nAMERICA FIRST.", "\nAND HE HAS EARNED FOUR MORE\nYEARS AS PRESIDENT.", "\nIT WAS AN HONOR OF A LIFETIME TO\nSERVE AS THE UNITED STATES\nAMBASSADOR TO THE UNITED\nNATIONS.", "\nNOW THE U.N. IS NOT FOR THE\nFAINT OF HEART IT IS A PLACE\nWHERE DICTATORS, MURDERS AND\nTHIEVES DENOUNCE AMERICA AND\nTHEN PUT THEIR HANDS OUT AND\nDEMAND THAT WE PAY THEIR BILLS.", "\nWELL PRESIDENT TRUMP PUT AN END\nTO ALL OF THAT.", "\nWITH HIS LEADERSHIP WE DID WHAT\nBARACK OBAMA AND JOE BIDEN\nREFUSED TO DO.", "\nWE STOOD UP FOR AMERICA.", "\nAND WE STOOD AGAINST OUR\nENEMIES.", "\nOBAMA AND BIDEN LET NORTH KOREA\nTHREATEN AMERICA.", "\nPRESIDENT TRUMP REJECTED THAT\nWEAKNESS AND WE PASSED THE\nTOUGHEST SANCTIONS ON NORTH\nKOREA IN HISTORY.", "\nOBAMA AND BIDEN LET IRAN GET A\nWHICH WITH MURDER AND LITERALLY\nSENT THEM A PLANEFUL OF CASH.", "\nPRESIDENT TRUMP DID THE RIGHT\nTHING AND RIPPED UP THE IRAN\nNUCLEAR DEAL.", "\nOBAMA AND BIDEN LEAD THE UNITED\nNATIONS TO DENOUNCE OUR FRIEND\nAND ALLY ISRAEL, PRESIDENT TRUMP\nMOVED OUR EMBASSY TO JERUSALEM\nAND WHEN THE U.N. TRIED TO\nCONDEMN US, I WAS PROUD TO CAST\nTHE AMERICAN VETO.", "\nTHIS PRESIDENT HAS A RECORD OF\nSTRENGTH AND SUCCESS.", "\nTHE FORMER VICE PRESIDENT HAS A\nRECORD OF WEAKNESS AND FAILURE.", "\nJOE BIDEN IS GOOD FOR IRAN AND\nISIS, BREAT FOR COMMUNIST CHINA,\nAND HE'S A GOD SEND TO EVERYONE\nWHO WANTS AMERICA TO APOLOGIZE,\nABSTAIN AND ABANDON OUR VALUES.", "\nDONALD TUMP TAKES A DIFFERENT\nAPPROACH.", "\nHE IS TOUGH ON CHINA.", "\nAND HE TOOK ON ISIS, AND WON.", "\nAND HE TELLS THE WORLD WHAT IT\nNEEDS TO HEAR.", "\nAT HOME THE PRESIDENT IS THE\nCLEAR CHOICE ON JOBS AND THE\nECONOMY.", "\nHE'S MOVED AMERICA FORWARD WHILE\nSWROA BIDEN HAS HELD AMERICA\nBACK.", "\nWHEN JOE WAS VP I WAS GOVERNOR\nOF THE GREAT STATE OF SOUTH\nCAROLINA.", "\nWE HAD A PRETTY GOOD RUN.", "\nMANU\nMANUFACTURERS OF ALL KINDS\nFLOCKED TO OUR STATE FROM\nOVERSEAS, CREATING TENS OF\nTHOUSANDS OF AMERICAN JOBS.", "\nPEOPLE WERE REFERRING TO SOUTH\nCAROLINA AS THE BEAST OF THE\nSOUTHEAST, WHICH I LOVED.", "\nEVERYTHING WE DID HAPPENED IN\nSPITE OF JOE BIED ENAND HIS OLD\nBOSS.", "\nWE CUT TAXES, THEY RAISED THEM.", "\nWE SLASHED RED TAPE, THEY PILED\nON MORE MANDATES.", "\nAND WHEN WE BROUGHT IN GOOD\nPAYING JOBS, BIDEN AND OBAMA\nSUED US.", "\nI FOUGHT BACK, AND THEY GAVE UP.", "\nA BIDEN HARRIS ADMINISTRATION\nWOULD BE MUCH, MUCH WORSE.", "\nLAST TIME JOE'S BOSS WAS OBAMA.", "\nTHIS TIME, IT WOULD BE PELOSI,\nSANDERS AND THE SQUAD.", "\nTHEIR VISION FOR AMERICA IS\nSOCIALISM AND WE KNOW THAT\nSOCIALISM HAS FAILED EVERYWHERE.", "\nTHEY WANT TO TELL AMERICANS HOW\nTO LIVE, AND WHAT TO THINK.", "\nTHEY WANT A GOVERNMENT TAKEOVER\nOF HEALTH CARE.", "\nTHEY WANT TO BAN FRACKING AND\nKILL MILLIONS OF JOBS.", "\nTHE\nTHEY WANT MASSIVE TAX HIKES ON\nWORKING FAMILIES.", "\nJOE BIDEN AND THE SOCIALIST LEFT\nWOULD BE A DISASTER FOR OUR\nECONOMY.", "\nBUT PRESIDENT TRUMP IS LEADING A\nNEW ERA OF OPPORTUNITY.", "\nBEFORE COMMUNIST CHINA GAVE US\nTHE CORONAVIRUS, WE WERE\nBREKING ECONOMIC RECORDS LEFT\nAND RIGHT.", "\nTHE PANDEMIC HAD SET US BACK BUT\nNOT FOR LONG.", "\nPRESIDENT TRUMP BROUGHT OUR\nECONOMY BACK BEFORE AND HE WILL\nBRING IT BACK AGAIN.", "\nTHERE IS ONE MORE IMPORTANT AREA\nWHERE OUR PRESIDENT IS RIGHT.", "\nHE KNOWS THAT POLITICAL\nCORRECTNESS AND CANCEL CULTURE\nARE DANGEROUS.", "\nAND JUST PLANE WRONG.", "\nIN MUCH OF THE DEMOCRAT YOU CAN\nPARTY IT IS NOW FASHIONABLE TO\nSAY THAT AMERICA IS RACIST.", "\nTHAT IS A LIE.", "\nAMERICA IS NOT A RACIST COUNTRY.", "\nTHIS IS PERSONAL FOR ME.", "\nI AM THE PROUD DAUGHTER OF\nINDIAN IMMIGRANTS.", "\nTHEY CAME TO AMERICA AND SETTLED\nIN A SMALL SOUTHERN TOWN.", "\nMY FATHER WORE A TURBAN, MY MOTH\nERR WORE A SARU.", "\nWAY A BROWN GIRL IN A BLACK AND\nWHITE WORLD.", "\nWE FACED DISCRIMINATION AND\nHARDSHIP.", "\nBUT MY PARENTS NEVER GAVE IN TO\nGRIEVEANCE AND HATE.", "\nMY MOM BUILT A SUCCESSFUL\nBUSINESS.", "\nMY DAD TAUGHT 30 YEARS AT A\nHISTORICALLY BLACK COLLEGE AND\nTHE PEOPLE MUCH SOUTH CAROLINA\nCHOSE ME AS THEIR FIRST MINORITY\nAND FIRST FEMALE GOVERNOR.", "\nAMERICA IS A STORY THAT IS A\nWORK IN PROGRESS.", "\nNOW IS THE TIME TO BUILD ON THAT\nPROGRESS AND MAKE AMERICA EVEN\nFREER, FAY FAIRER AND BETTER FOR\nEVERYONE.", "\nTHAT IS REQUEST IT IS SO TRAGIC\nTO SEE SO MUCH OF THE DEMOCRATIC\nPARTY TURNING A BLIND EYE\nTOWARDS RIOTS AND RAGE.", "\nTHE AMERICAN PEOPLE KNOW WE CAN\nDO BETTER.", "\nAND OF COURSE WE VALUE AND\nRESPECT EVERY BLACK LIFE.", "\nTHE BLACK COPS WHO HAVE BEEN\nSHOT IN THE LINE OF DUTY.", "\nTHEY MATTER.", "\nTHE BLACK SMALL BUSINESS OWNERS\nWHO HAVE WATCHED THEIR LIFE'S\nWORK GO UP IN FLAMES, THEY\nMATTER.", "\nTHE BLACK KIDS WHO HAVE BEEN\nGUNNED DOWN ON THE PLAYGROUND,\nTHEIR LIVES MATTER TOO.", "\nAND THEIR LIVES ARE BEING RUINED\nAND STOLEN BY THE VIOLENCE ON\nOUR STREETS.", "\nIT DOESN'T HAVE TO BE LIKE THIS.", "\nIT WASN'T LIKE THIS IN SOUTH\nCAROLINA FIVE YEARS AGO.", "\nOUR STATE CAME FACE TO FACE WITH\nEVIL.", "\nA WHITE SUPREMACIST WALKED INTO\nMOTHER EMMANUEL CHURCH DURING\nBIBLE STUDY.", "\n12 AFRICAN-AMERICANS PULLED UP A\nCHAIR AND PRAYED WITH HIM FOR AN\nHOUR.", "\nTHEN HE BEGAN TO SHOOT.", "\nAFTER THAT HORRIFIC TRAGEDY, WE\nDIDN'T TURN AGAINST EACH OTHER.", "\nWE CAME TOGETHER, BLACK AND\nWHITE, DEMOCRAT AND REPUBLICAN,\nTOGETHER WE MADE THE HARD\nCHOICES NEEDED TO HEAL.", "\nAND REMOVED A DIVISIVE SYMBOL\nPEACEFULLY AND RESPECTFULLY.", "\nWHAT HAPPENED THEN SHOULD GIVE\nUS HOPE NOW.", "\nAMERICA ISN'T PERFECT.", "\nBUT THE PRINCIPLES WE HOLD DEAR\nARE PERFECT.", "\nTHERE IS ONE THING I HAVE\nLEARNED, IT'S THAT EVEN ON OUR\nWORST DAY, WE ARE BLESSED TO\nLIVE IN AMERICA.", "\nIT'S TIME TO KEEP THATBLESSING\nALIVE FOR THE NEXT GENERATION.", "\nTHIS PRESIDENT AND THIS PARTY\nARE COMMITTED TO THAT NOBLE\nTASK.", "\nWE SEEK A NATION THAT RISES\nTOGETHER, NOT FALLS APART IN\nANARCHY AND ANGER.", "\nWE KNOW THAT THE ONLY WAY TO\nOVERCOME AMERICA'S CHALLENGES IS\nTO EMBRACE AMERICA'S STRENGTHS.", "\nWE ARE STRIFING TO REACH A\nBRIGHTER FUTURE WHERE EVERY\nCHILD GOES TO A WORLD-CLASS\nSCHOOL CHOSEN BY THEIR PARENTS.", "\nWHERE EVERY FAMILY LIVES IN A\nSAFE COMMUNITY WITH GOOD JOBS.", "\nWHERE EVERY ENTREPRENEUR HAS THE\nFREEDOM TO ACHIEVE AND INSPIRE.", "\nWHERE EVERY BELIEVER CAN WORSHIP\nWITHOUT FEAR AND EVERY LIFE IS\nIS\nPROTECTED.", "\nWHERE EVERY GIRL AND BOY, EVERY\nWOMAN AND MAN OF EVERY RACE AND\nRELIGION HAS THE BEST SHOT AT\nTHE BEST LIFE.", "\nIN THIS ELECTION WE MUST CHOOSE\nTE ONLY CANDIDATE WHO HAS AND\nWHO WILL CONTINUE DELIVERING ON\nTHAT VISION.", "\nPRESIDENT TRUMP AND VICE\nPRESIDENT PENCE HAVE MY SUPPORT.", "\nAND AMERICA HAS OUR PROMISE.", "\nWEWILL BUILD ON THE PROGRESS OF\nOUR PAST AND UNUNLOCK THE\nPROMISE OF OUR FUTURE, THAT\nFUTURE STARTS WHEN THE AMERICAN\nPEOPLE RE-ELECT PRESIDENT DONALD\nTRUMP.", "\nTHANK YOU, GOOD NIGHT AND MAY\nGOD ALWAYS BLESS AMERICA.", "\nO'Donnell: AND THERE IS THE\nFORMER TBOFFER IN OF SOUTH\nCAROLINA, NIKKI HALEY TALKING\nABOUT WHEN SHE TOOK DOWN THE\nCONFEDERATE FLAG IN SOUTH\nCAROLINA AFTER THE SHOOTINGS\nTHERE AT THE AME CHURCH.", "\nWE ARE EXPECTING TO HEAR SHORTLY\nFROM PRESIDENT TRUMP'S ELDEST\nSON DONALD TRUMP, JR.", "\nGOOD EVENINGK I'M DN ALD\nTRUMP, JR.", "\nWE'RE HERE TONIGHT TO TALK ABOUT\nTHE GREAT AMERICAN STORY.", "\nTO TALK ABOUT THIS COUNTRY WE\nALL LOVE, TO LAND OF PROMISE AND\nOPPORTUNITY, OF HEROES AND\nGREATNESS.", "\nJUST A FEW SHORT MONTHS AGO WE\nWERE SEEING THE AMERICAN DREAM\nBECOME A KREELT.", "\nFOR MORE OF OUR CITIZENS THAN\nEVER BEFORE.", "\nTHE GREATEST PROLONGED ECONOMIC\nEXPANSION IN AMERICAN HISTORY,\nTHE LOWEST UNEMPLOYMENT RATE IN\nNEARLY 50 YEARS.", "\nTHE LOWEST UNEMPLOYMENT RATE\nEVER FOR BLACK AMERICANS,\nHISPANIC AMERICANS, WOMEN, AND\nPRETTY MUCH EVERY OTHER\nDEMOGRAPHIC GROUP.", "\nAND THEN COURTESY OF THE CHINESE\nCOMMUNIST PARTY THE VIRUS\nSTRUCK.", "\nTE PRESIDENT QUICKLY TOOK\nACTION AND SHUT DOWN TRAVEL FROM\nCHINA.", "\nJOE BIDEN AND THIS DEMOCRAT\nALLIES CALLED MY FATHER A RACIST\nAND XENOPHOBE FOR DOING IT.", "\nTHEY PUT POLITICAL CORRECTNESS\nAHEAD OF THE SAFETY AND SECURITY\nOF THE AMERICAN PEOPLE.", "\nFORTUNATELY AS THE VIRUS BEGAN\nTO SPREAD THE PRESIDENT ACTED\nQUUKLY AND ENSURED VENTILATORS\nGOT TO HOSPITALS THAT NEEDED\nTHEM MOST.", "\nHE DELIVERED PPE TO OUR BRAVE\nFRONT LINE WORKERS AND HE\nRALLIED THE MIGHTY AMERICAN\nPRIVATE SECTOR TO TACKLE THIS\nNEW CHALLENGE.", "\nTHERE IS MORE WORK TO DO, BUT\nTHERE IS A LIGHT AT THE END OF\nTHE TUNNEL.", "\nJOBS GAINS ARE OUTPACING WHAT\nTHE SO CALLED EXPERTS EXPECTED.", "\nBUT BIDEN'S RADICAL LEFT WING\nPOLICIES WOULD STOP OUR ECONOMIC\nRECOVERY COLD.", "\nHE IS ALREADY TALKING ABOUT\nSHUTTING THE COUNTRY DOWN AGAIN.", "\nIT'S MADNESS.", "\nDEMOCRATS CLAIM TO BE FOR\nWORKERS BUT THEY'VE SPENT THE\nENTIRE PANDEMIC TRYING TO SEEK A\nTAX BREAK FOR MILLIONARES AND\nDEMOCRAT STATES INTO THE COVID\nRELIEF BILL.", "\nTHEN THEY ATTACK MY FATHER FOR\nSUSPENDING THE PAYROLL TAX FOR\nMIDDLE CLASS WORKERS.", "\nIN FACT, IF YOU THINK ABOUT IT,\nJOE BIDEN'S ENTIRE ECONOMIC\nPLATFORM SEEMS DESIGNED TO CRUSH\nTHE WORKING MAN AND WOMAN.", "\nHE SUPPORTED THE WORST TRADE\nDEAL IN THE HISTORY OF THE\nPLANET.", "\nHE VOTED FOR THE NAFTA\nNIGHTMARE.", "\nDOWN THE TUBES WENT OUR AUTO\nINDUSTRY.", "\nHE PUSHED FOR TPP, GOOD BUY\nMNUFACTURING JOBS.", "\nBEIJING BIDEN IS SO WEAK ON\nCHINA THAT THE INTELLIGENCE\nCOMMUNITY RECENTLY ASSESSED THAT\nTHE CHINESE COMMUNIST PARTY\nFAVORS BIED EN.", "\nTHEY KNOW-- BIDEN ALSO WANTS TO\nBRUNG IN MORE ILLEGAL IMMIGRANTS\nTO TAKE JOBS FROM AMERICAN\nCITIZENS.", "\nS.\nHIS OPEN BORDER POLICY WAS DRIVE\nWAGES DOWN FOR AMERICANS AT A\nTIME WHEN LOW INCOME WORKERS ARE\nGETTING REAL WAGE INCREASES FOR\nTHE FIRST TIME IN MODERN\nHISTORY.", "\nIS HE HAS PLEDGED TO REPEAL THE\nTRUMP TAX CUTS WHICH WERE THE\nBIGGEST IN OUR COUNTRY.", "\nAFTER EIGHT YEARS OF OBAMA AND\nBIDEN'S SLOW GROWTH TRUMP'S\nPOLICIES HAVE BEEN LIKE ROCKET\nFUEL TO THE ECONOMY AND\nESPECIALLY TO THE MIDDLE CLASS.", "\nBIDEN HAS PROMISED TO TAKE THAT\nMONEY BACK OUT OF YOUR POCKET\nAND KEEP IT IN THE SWAMP.", "\nTHAT MAKES SENSE THOUGH\nCONSIDERING SWROA BIDEN IS\nBASICALLY THE LOCHNESS MONSTER\nOF THE SWAMP.", "\nFOR THE PAST HALF ISN'T REE HE'S\nBEEN LURKING AROUND IN THERE.", "\nHE STICKS HIS HEAD UP EVERY NOW\nAND THEN TO RUN FOR PRESIDENT.", "\n" ]

{ "pile_set_name": "YoutubeSubtitles" }

[ 0, 0, 0.045454545454545456, 0.020833333333333332, 0.047619047619047616, 0, 0, 0, 0, 0, 0, 0.01020408163265306, 0.01098901098901099, 0.04, 0, 0.02531645569620253, 0, 0, 0, 0, 0.012195121951219513, 0, 0, 0.03418803418803419, 0, 0.01926444833625219, 0.0035587188612099642, 0.00909090909090909, 0.004347826086956522, 0.01507537688442211, 0.014423076923076924, 0.041666666666666664, 0, 0.00980392156862745, 0.012578616352201259, 0, 0, 0, 0, 0, 0, 0.05263157894736842, 0, 0, 0, 0, 0, 0, 0.014705882352941176, 0, 0.03333333333333333, 0, 0, 0.017857142857142856, 0, 0, 0, 0.00909090909090909, 0, 0, 0.00510204081632653, 0.005555555555555556, 0, 0.043478260869565216, 0, 0, 0, 0, 0.007792207792207792, 0, 0, 0.011904761904761904, 0, 0, 0, 0.045454545454545456, 0, 0, 0, 0.004149377593360996, 0, 0, 0.023255813953488372, 0.005714285714285714, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.0106951871657754, 0.007575757575757576, 0, 0, 0.013377926421404682, 0.014492753623188406, 0, 0.005025125628140704, 0, 0.011363636363636364, 0.01282051282051282, 0.01904761904761905, 0, 0.05, 0.025, 0.045454545454545456, 0.045454545454545456, 0.0273972602739726, 0.0136986301369863, 0.05555555555555555, 0, 0, 0, 0, 0, 0.01694915254237288, 0, 0.007874015748031496, 0.02857142857142857, 0.011695906432748537, 0, 0, 0, 0, 0, 0.007462686567164179, 0.013043478260869565, 0.006666666666666667, 0.014084507042253521, 0.013888888888888888, 0, 0.01639344262295082, 0.009900990099009901, 0.010526315789473684, 0, 0.011764705882352941, 0, 0, 0.008403361344537815, 0.05555555555555555, 0, 0, 0, 0.006369426751592357, 0.012121212121212121, 0.011363636363636364, 0.010810810810810811, 0.0136986301369863, 0, 0.012195121951219513, 0, 0.018018018018018018, 0, 0.014084507042253521, 0, 0, 0.02666666666666667, 0, 0.030303030303030304, 0.015384615384615385, 0.01639344262295082, 0, 0, 0.031914893617021274, 0.011363636363636364, 0.020833333333333332, 0.013513513513513514, 0, 0, 0, 0, 0, 0.0136986301369863, 0.00975609756097561, 0.018867924528301886, 0, 0.025, 0.025, 0, 0.03333333333333333, 0, 0, 0.014705882352941176, 0, 0, 0.035398230088495575, 0.011627906976744186, 0.014705882352941176, 0, 0, 0.015151515151515152, 0, 0.017543859649122806, 0.03125, 0.037037037037037035, 0, 0, 0, 0, 0, 0.02857142857142857, 0.03508771929824561, 0.020618556701030927, 0, 0, 0, 0.02857142857142857, 0.045454545454545456, 0, 0, 0, 0, 0, 0, 0.04, 0.022222222222222223, 0, 0, 0.027777777777777776, 0.013333333333333334, 0, 0.009345794392523364, 0.017391304347826087, 0, 0.018867924528301886, 0, 0, 0.010309278350515464, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.01818181818181818, 0.01694915254237288, 0.022727272727272728, 0, 0, 0, 0, 0, 0.013157894736842105, 0.010638297872340425, 0, 0, 0, 0, 0, 0, 0, 0, 0.0189873417721519, 0.03571428571428571, 0.010309278350515464, 0.03529411764705882, 0.05555555555555555, 0, 0.009900990099009901, 0.012658227848101266, 0, 0.008928571428571428, 0, 0.014925373134328358, 0, 0.011235955056179775, 0, 0.007575757575757576, 0, 0.0136986301369863, 0, 0.01282051282051282, 0, 0, 0.006134969325153374, 0, 0.008333333333333333, 0, 0, 0, 0.02127659574468085, 0.007518796992481203, 0.00980392156862745, 0, 0, 0, 0, 0, 0, 0.015873015873015872, 0 ]

[ { "analysis_explanation": null, "end": 549, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 545 }, { "analysis_explanation": null, "end": 618, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 611 }, { "analysis_explanation": null, "end": 648, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 641 }, { "analysis_explanation": null, "end": 664, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 653 }, { "analysis_explanation": null, "end": 732, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 727 }, { "analysis_explanation": null, "end": 766, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 751 }, { "analysis_explanation": null, "end": 911, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 899 }, { "analysis_explanation": null, "end": 1063, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1053 }, { "analysis_explanation": null, "end": 1082, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1069 }, { "analysis_explanation": null, "end": 1128, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1119 }, { "analysis_explanation": null, "end": 1145, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1133 }, { "analysis_explanation": null, "end": 1752, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1735 }, { "analysis_explanation": null, "end": 1767, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1763 }, { "analysis_explanation": null, "end": 3337, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3325 }, { "analysis_explanation": null, "end": 3373, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3363 }, { "analysis_explanation": null, "end": 3754, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3752 }, { "analysis_explanation": null, "end": 3853, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3848 }, { "analysis_explanation": null, "end": 4024, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4018 }, { "analysis_explanation": null, "end": 4053, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4045 }, { "analysis_explanation": null, "end": 4406, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4400 }, { "analysis_explanation": null, "end": 4621, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4606 }, { "analysis_explanation": null, "end": 4636, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4631 }, { "analysis_explanation": null, "end": 4646, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4638 }, { "analysis_explanation": null, "end": 4673, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4666 }, { "analysis_explanation": null, "end": 4724, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4716 }, { "analysis_explanation": null, "end": 4738, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4729 }, { "analysis_explanation": null, "end": 5374, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5370 }, { "analysis_explanation": null, "end": 6520, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6518 }, { "analysis_explanation": null, "end": 6739, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6734 }, { "analysis_explanation": null, "end": 6868, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6860 }, { "analysis_explanation": null, "end": 6949, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6947 }, { "analysis_explanation": null, "end": 6968, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6966 }, { "analysis_explanation": null, "end": 7199, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7194 }, { "analysis_explanation": null, "end": 7276, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7256 }, { "analysis_explanation": null, "end": 7348, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7340 }, { "analysis_explanation": null, "end": 7388, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7380 }, { "analysis_explanation": null, "end": 7465, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7459 }, { "analysis_explanation": null, "end": 7602, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7600 }, { "analysis_explanation": null, "end": 8207, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8201 }, { "analysis_explanation": null, "end": 8281, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8274 }, { "analysis_explanation": null, "end": 8417, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8413 }, { "analysis_explanation": null, "end": 8736, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8723 }, { "analysis_explanation": null, "end": 8786, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8781 }, { "analysis_explanation": null, "end": 9342, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9338 }, { "analysis_explanation": null, "end": 9573, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9561 }, { "analysis_explanation": null, "end": 9653, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9643 }, { "analysis_explanation": null, "end": 9759, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9754 }, { "analysis_explanation": null, "end": 9777, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9771 }, { "analysis_explanation": null, "end": 9785, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9779 }, { "analysis_explanation": null, "end": 9885, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9875 }, { "analysis_explanation": null, "end": 10049, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10044 }, { "analysis_explanation": null, "end": 10232, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10225 }, { "analysis_explanation": null, "end": 10241, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10234 }, { "analysis_explanation": null, "end": 10251, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10243 }, { "analysis_explanation": null, "end": 10282, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10277 }, { "analysis_explanation": null, "end": 10631, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10624 }, { "analysis_explanation": null, "end": 10658, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10632 }, { "analysis_explanation": null, "end": 10822, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10811 }, { "analysis_explanation": null, "end": 11148, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11141 }, { "analysis_explanation": null, "end": 11647, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11643 }, { "analysis_explanation": null, "end": 11679, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11674 }, { "analysis_explanation": null, "end": 11912, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11907 }, { "analysis_explanation": null, "end": 12016, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12012 }, { "analysis_explanation": null, "end": 12046, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12042 }, { "analysis_explanation": null, "end": 12111, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12102 }, { "analysis_explanation": null, "end": 12551, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12547 }, { "analysis_explanation": null, "end": 12677, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12668 }, { "analysis_explanation": null, "end": 12731, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12725 }, { "analysis_explanation": null, "end": 12739, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12735 }, { "analysis_explanation": null, "end": 13088, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13079 }, { "analysis_explanation": null, "end": 13360, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13349 }, { "analysis_explanation": null, "end": 14014, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14009 }, { "analysis_explanation": null, "end": 14468, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14446 }, { "analysis_explanation": null, "end": 14492, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14484 }, { "analysis_explanation": null, "end": 14501, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14497 }, { "analysis_explanation": null, "end": 14534, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14517 }, { "analysis_explanation": null, "end": 14570, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14551 }, { "analysis_explanation": null, "end": 14599, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14594 }, { "analysis_explanation": null, "end": 14610, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14601 }, { "analysis_explanation": null, "end": 14738, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14733 }, { "analysis_explanation": null, "end": 15115, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15103 }, { "analysis_explanation": null, "end": 15129, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15120 }, { "analysis_explanation": null, "end": 15235, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15224 }, { "analysis_explanation": null, "end": 15601, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15595 }, { "analysis_explanation": null, "end": 15649, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15640 }, { "analysis_explanation": null, "end": 15687, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15685 }, { "analysis_explanation": null, "end": 15862, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15845 }, { "analysis_explanation": null, "end": 16652, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16647 }, { "analysis_explanation": null, "end": 16686, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16675 }, { "analysis_explanation": null, "end": 16786, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16784 }, { "analysis_explanation": null, "end": 17275, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17266 }, { "analysis_explanation": null, "end": 17423, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17421 }, { "analysis_explanation": null, "end": 18065, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18052 }, { "analysis_explanation": null, "end": 18253, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18228 }, { "analysis_explanation": null, "end": 18286, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18278 }, { "analysis_explanation": null, "end": 19325, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19308 }, { "analysis_explanation": null, "end": 19428, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19412 }, { "analysis_explanation": null, "end": 19481, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19473 }, { "analysis_explanation": null, "end": 19508, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19500 }, { "analysis_explanation": null, "end": 19523, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19513 }, { "analysis_explanation": null, "end": 19667, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19665 }, { "analysis_explanation": null, "end": 20345, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20333 }, { "analysis_explanation": null, "end": 21314, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21307 }, { "analysis_explanation": null, "end": 21393, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21389 }, { "analysis_explanation": null, "end": 21483, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21473 }, { "analysis_explanation": null, "end": 21688, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21673 }, { "analysis_explanation": null, "end": 21851, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21844 }, { "analysis_explanation": null, "end": 21961, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21952 }, { "analysis_explanation": null, "end": 23379, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 23374 }, { "analysis_explanation": null, "end": 23482, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 23464 }, { "analysis_explanation": null, "end": 23732, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 23721 }, { "analysis_explanation": null, "end": 23771, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 23766 }, { "analysis_explanation": null, "end": 24068, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 24049 }, { "analysis_explanation": null, "end": 3337, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 3325 }, { "analysis_explanation": null, "end": 4901, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 4889 }, { "analysis_explanation": null, "end": 5514, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 5502 }, { "analysis_explanation": null, "end": 5528, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 5516 }, { "analysis_explanation": null, "end": 7833, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 7821 }, { "analysis_explanation": null, "end": 8706, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 8694 }, { "analysis_explanation": null, "end": 11092, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 11080 }, { "analysis_explanation": null, "end": 11627, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 11615 }, { "analysis_explanation": null, "end": 11693, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 11681 }, { "analysis_explanation": null, "end": 11869, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 11857 }, { "analysis_explanation": null, "end": 12869, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 12857 }, { "analysis_explanation": null, "end": 18304, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 18292 }, { "analysis_explanation": null, "end": 19632, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 19620 }, { "analysis_explanation": null, "end": 19879, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 19867 }, { "analysis_explanation": null, "end": 20345, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 20333 }, { "analysis_explanation": null, "end": 21664, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 21652 } ]

[ "module.exports = {\n\t\"10.0.0-nightly.20200327\": \"83.0.4087.0\",\n\t\"10.0.0-nightly.20200326\": \"83.0.4087.0\",\n\t\"10.0.0-nightly.20200325\": \"83.0.4087.0\",\n\t\"10.0.0-nightly.20200324\": \"83.0.4087.0\",\n\t\"10.0.0-nightly.20200323\": \"83.0.4087.0\",\n\t\"10.0.0-nightly.20200320\": \"83.0.4087.0\",\n\t\"10.0.0-nightly.20200318\": \"83.0.4087.0\",\n\t\"10.0.0-nightly.20200317\": \"83.0.4087.0\",\n\t\"10.0.0-nightly.20200316\": \"83.0.4086.0\",\n\t\"10.0.0-nightly.20200311\": \"82.0.4083.0\",\n\t\"10.0.0-nightly.20200310\": \"82.0.4076.0\",\n\t\"10.0.0-nightly.20200309\": \"82.0.4076.0\",\n\t\"10.0.0-nightly.20200306\": \"82.0.4076.0\",\n\t\"10.0.0-nightly.20200305\": \"82.0.4076.0\",\n\t\"10.0.0-nightly.20200304\": \"82.0.4076.0\",\n\t\"10.0.0-nightly.20200303\": \"82.0.4050.0\",\n\t\"10.0.0-nightly.20200226\": \"82.0.4050.0\",\n\t\"10.0.0-nightly.20200223\": \"82.0.4050.0\",\n\t\"10.0.0-nightly.20200222\": \"82.0.4050.0\",\n\t\"10.0.0-nightly.20200221\": \"82.0.4050.0\",\n\t\"10.0.0-nightly.20200218\": \"82.0.4050.0\",\n\t\"10.0.0-nightly.20200217\": \"82.0.4050.0\",\n\t\"10.0.0-nightly.20200216\": \"82.0.4050.0\",\n\t\"10.0.0-nightly.20200211\": \"82.0.4050.0\",\n\t\"10.0.0-nightly.20200210\": \"82.0.4050.0\",\n\t\"10.0.0-nightly.20200209\": \"82.0.4050.0\",\n\t\"9.0.0-nightly.20200121\": \"81.0.4030.0\",\n\t\"9.0.0-nightly.20200119\": \"81.0.4030.0\",\n\t\"9.0.0-nightly.20200117\": \"81.0.3994.0\",\n\t\"9.0.0-nightly.20200116\": \"81.0.3994.0\",\n\t\"9.0.0-nightly.20200115\": \"81.0.3994.0\",\n\t\"9.0.0-nightly.20200113\": \"81.0.3994.0\",\n\t\"9.0.0-nightly.20200111\": \"81.0.3994.0\",\n\t\"9.0.0-nightly.20200110\": \"81.0.3994.0\",\n\t\"9.0.0-nightly.20200109\": \"81.0.3994.0\",\n\t\"9.0.0-nightly.20200108\": \"81.0.3994.0\",\n\t\"9.0.0-nightly.20200106\": \"81.0.3994.0\",\n\t\"9.0.0-nightly.20200105\": \"81.0.3994.0\",\n\t\"9.0.0-nightly.20200104\": \"81.0.3994.0\",\n\t\"9.0.0-nightly.20200103\": \"81.0.3994.0\",\n\t\"9.0.0-nightly.20200101\": \"81.0.3994.0\",\n\t\"9.0.0-nightly.20191231\": \"81.0.3994.0\",\n\t\"9.0.0-nightly.20191230\": \"81.0.3994.0\",\n\t\"9.0.0-nightly.20191229\": \"81.0.3994.0\",\n\t\"9.0.0-nightly.20191228\": \"81.0.3994.0\",\n\t\"9.0.0-nightly.20191226\": \"81.0.3994.0\",\n\t\"9.0.0-nightly.20191225\": \"81.0.3994.0\",\n\t\"9.0.0-nightly.20191224\": \"81.0.3994.0\",\n\t\"9.0.0-nightly.20191223\": \"81.0.3994.0\",\n\t\"9.0.0-nightly.20191222\": \"81.0.3994.0\",\n\t\"9.0.0-nightly.20191221\": \"81.0.3994.0\",\n\t\"9.0.0-nightly.20191220\": \"81.0.3994.0\",\n\t\"9.0.0-nightly.20191210\": \"80.0.3954.0\",\n\t\"9.0.0-nightly.20191204\": \"80.0.3954.0\",\n\t\"9.0.0-nightly.20191203\": \"80.0.3954.0\",\n\t\"9.0.0-nightly.20191202\": \"80.0.3954.0\",\n\t\"9.0.0-nightly.20191201\": \"80.0.3954.0\",\n\t\"9.0.0-nightly.20191130\": \"80.0.3954.0\",\n\t\"9.0.0-nightly.20191129\": \"80.0.3954.0\",\n\t\"9.0.0-nightly.20191124\": \"80.0.3954.0\",\n\t\"9.0.0-nightly.20191123\": \"80.0.3954.0\",\n\t\"9.0.0-nightly.20191122\": \"80.0.3954.0\",\n\t\"9.0.0-nightly.20191121\": \"80.0.3954.0\",\n\t\"9.0.0-beta.10\": \"82.0.4085.10\",\n\t\"9.0.0-beta.9\": \"82.0.4058.2\",\n\t\"9.0.0-beta.7\": \"82.0.4058.2\",\n\t\"9.0.0-beta.6\": \"82.0.4058.2\",\n\t\"9.0.0-beta.5\": \"82.0.4048.0\",\n\t\"9.0.0-beta.4\": \"82.0.4048.0\",\n\t\"9.0.0-beta.3\": \"82.0.4048.0\",\n\t\"9.0.0-beta.2\": \"82.0.4048.0\",\n\t\"9.0.0-beta.1\": \"82.0.4048.0\",\n\t\"8.2.0\": \"80.0.3987.158\",\n\t\"8.1.1\": \"80.0.3987.141\",\n\t\"8.1.0\": \"80.0.3987.137\",\n\t\"8.0.3\": \"80.0.3987.134\",\n\t\"8.0.2\": \"80.0.3987.86\",\n\t\"8.0.1\": \"80.0.3987.86\",\n\t\"8.0.0\": \"80.0.3987.86\",\n\t\"8.0.0-nightly.20191105\": \"80.0.3952.0\",\n\t\"8.0.0-nightly.20191101\": \"80.0.3952.0\",\n\t\"8.0.0-nightly.20191023\": \"79.0.3931.0\",\n\t\"8.0.0-nightly.20191021\": \"79.0.3931.0\",\n\t\"8.0.0-nightly.20191020\": \"79.0.3931.0\",\n\t\"8.0.0-nightly.20191019\": \"79.0.3931.0\",\n\t\"8.0.0-nightly.20191017\": \"79.0.3919.0\",\n\t\"8.0.0-nightly.20191012\": \"79.0.3919.0\",\n\t\"8.0.0-nightly.20191011\": \"79.0.3919.0\",\n\t\"8.0.0-nightly.20191009\": \"79.0.3919.0\",\n\t\"8.0.0-nightly.20191006\": \"79.0.3919.0\",\n\t\"8.0.0-nightly.20191005\": \"79.0.3919.0\",\n\t\"8.0.0-nightly.20191004\": \"79.0.3919.0\",\n\t\"8.0.0-nightly.20191001\": \"79.0.3919.0\",\n\t\"8.0.0-nightly.20190930\": \"79.0.3919.0\",\n\t\"8.0.0-nightly.20190929\": \"79.0.3919.0\",\n\t\"8.0.0-nightly.20190926\": \"79.0.3919.0\",\n\t\"8.0.0-nightly.20190924\": \"79.0.3919.0\",\n\t\"8.0.0-nightly.20190923\": \"79.0.3919.0\",\n\t\"8.0.0-nightly.20190920\": \"79.0.3915.0\",\n\t\"8.0.0-nightly.20190919\": \"79.0.3915.0\",\n\t\"8.0.0-nightly.20190917\": \"78.0.3892.0\",\n\t\"8.0.0-nightly.20190915\": \"78.0.3892.0\",\n\t\"8.0.0-nightly.20190914\": \"78.0.3892.0\",\n\t\"8.0.0-nightly.20190913\": \"78.0.3892.0\",\n\t\"8.0.0-nightly.20190911\": \"78.0.3892.0\",\n\t\"8.0.0-nightly.20190910\": \"78.0.3892.0\",\n\t\"8.0.0-nightly.20190909\": \"78.0.3892.0\",\n\t\"8.0.0-nightly.20190907\": \"78.0.3892.0\",\n\t\"8.0.0-nightly.20190902\": \"78.0.3892.0\",\n\t\"8.0.0-nightly.20190901\": \"78.0.3892.0\",\n\t\"8.0.0-nightly.20190830\": \"78.0.3892.0\",\n\t\"8.0.0-nightly.20190828\": \"78.0.3892.0\",\n\t\"8.0.0-nightly.20190827\": \"78.0.3892.0\",\n\t\"8.0.0-nightly.20190825\": \"78.0.3892.0\",\n\t\"8.0.0-nightly.20190824\": \"78.0.3892.0\",\n\t\"8.0.0-nightly.20190820\": \"78.0.3881.0\",\n\t\"8.0.0-nightly.20190819\": \"78.0.3881.0\",\n\t\"8.0.0-nightly.20190818\": \"78.0.3881.0\",\n\t\"8.0.0-nightly.20190817\": \"78.0.3881.0\",\n\t\"8.0.0-nightly.20190816\": \"78.0.3881.0\",\n\t\"8.0.0-nightly.20190815\": \"78.0.3871.0\",\n\t\"8.0.0-nightly.20190814\": \"78.0.3871.0\",\n\t\"8.0.0-nightly.20190813\": \"78.0.3871.0\",\n\t\"8.0.0-nightly.20190812\": \"78.0.3871.0\",\n\t\"8.0.0-nightly.20190811\": \"78.0.3871.0\",\n\t\"8.0.0-nightly.20190810\": \"78.0.3871.0\",\n\t\"8.0.0-nightly.20190809\": \"78.0.3871.0\",\n\t\"8.0.0-nightly.20190808\": \"78.0.3871.0\",\n\t\"8.0.0-nightly.20190807\": \"78.0.3871.0\",\n\t\"8.0.0-nightly.20190806\": \"78.0.3871.0\",\n\t\"8.0.0-nightly.20190803\": \"78.0.3871.0\",\n\t\"8.0.0-nightly.20190802\": \"78.0.3866.0\",\n\t\"8.0.0-nightly.20190801\": \"78.0.3866.0\",\n\t\"8.0.0-beta.9\": \"80.0.3987.75\",\n\t\"8.0.0-beta.8\": \"80.0.3987.75\",\n\t\"8.0.0-beta.7\": \"80.0.3987.59\",\n\t\"8.0.0-beta.6\": \"80.0.3987.51\",\n\t\"8.0.0-beta.5\": \"80.0.3987.14\",\n\t\"8.0.0-beta.4\": \"80.0.3955.0\",\n\t\"8.0.0-beta.3\": \"80.0.3955.0\",\n\t\"8.0.0-beta.2\": \"79.0.3931.0\",\n\t\"8.0.0-beta.1\": \"79.0.3931.0\",\n\t\"7.2.1\": \"78.0.3904.130\",\n\t\"7.2.0\": \"78.0.3904.130\",\n\t\"7.1.14\": \"78.0.3904.130\",\n\t\"7.1.13\": \"78.0.3904.130\",\n\t\"7.1.12\": \"78.0.3904.130\",\n\t\"7.1.11\": \"78.0.3904.130\",\n\t\"7.1.10\": \"78.0.3904.130\",\n\t\"7.1.9\": \"78.0.3904.130\",\n\t\"7.1.8\": \"78.0.3904.130\",\n\t\"7.1.7\": \"78.0.3904.130\",\n\t\"7.1.6\": \"78.0.3904.130\",\n\t\"7.1.5\": \"78.0.3904.130\",\n\t\"7.1.4\": \"78.0.3904.130\",\n\t\"7.1.3\": \"78.0.3904.126\",\n\t\"7.1.2\": \"78.0.3904.113\",\n\t\"7.1.1\": \"78.0.3904.99\",\n\t\"7.1.0\": \"78.0.3904.94\",\n\t\"7.0.1\": \"78.0.3904.92\",\n\t\"7.0.0\": \"78.0.3905.1\",\n\t\"7.0.0-nightly.20190731\": \"78.0.3866.0\",\n\t\"7.0.0-nightly.20190730\": \"78.0.3866.0\",\n\t\"7.0.0-nightly.20190729\": \"78.0.3866.0\",\n\t\"7.0.0-nightly.20190728\": \"78.0.3866.0\",\n\t\"7.0.0-nightly.20190727\": \"78.0.3866.0\",\n\t\"7.0.0-nightly.20190726\": \"77.0.3864.0\",\n\t\"7.0.0-nightly.20190721\": \"77.0.3848.0\",\n\t\"7.0.0-nightly.20190720\": \"77.0.3848.0\",\n\t\"7.0.0-nightly.20190719\": \"77.0.3848.0\",\n\t\"7.0.0-nightly.20190705\": \"77.0.3843.0\",\n\t\"7.0.0-nightly.20190704\": \"77.0.3843.0\",\n\t\"7.0.0-nightly.20190702\": \"77.0.3815.0\",\n\t\"7.0.0-nightly.20190701\": \"77.0.3815.0\",\n\t\"7.0.0-nightly.20190630\": \"77.0.3815.0\",\n\t\"7.0.0-nightly.20190629\": \"77.0.3815.0\",\n\t\"7.0.0-nightly.20190627\": \"77.0.3815.0\",\n\t\"7.0.0-nightly.20190624\": \"77.0.3815.0\",\n\t\"7.0.0-nightly.20190623\": \"77.0.3815.0\",\n\t\"7.0.0-nightly.20190622\": \"77.0.3815.0\",\n\t\"7.0.0-nightly.20190619\": \"77.0.3815.0\",\n\t\"7.0.0-nightly.20190618\": \"77.0.3815.0\",\n\t\"7.0.0-nightly.20190616\": \"77.0.3815.0\",\n\t\"7.0.0-nightly.20190615\": \"77.0.3815.0\",\n\t\"7.0.0-nightly.20190613\": \"77.0.3815.0\",\n\t\"7.0.0-nightly.20190612\": \"77.0.3815.0\",\n\t\"7.0.0-nightly.20190611\": \"77.0.3815.0\",\n\t\"7.0.0-nightly.20190609\": \"77.0.3815.0\",\n\t\"7.0.0-nightly.20190608\": \"77.0.3815.0\",\n\t\"7.0.0-nightly.20190607\": \"77.0.3815.0\",\n\t\"7.0.0-nightly.20190606\": \"77.0.3815.0\",\n\t\"7.0.0-nightly.20190605\": \"77.0.3815.0\",\n\t\"7.0.0-nightly.20190604\": \"77.0.3814.0\",\n\t\"7.0.0-nightly.20190603\": \"76.0.3806.0\",\n\t\"7.0.0-nightly.20190602\": \"76.0.3806.0\",\n\t\"7.0.0-nightly.20190531\": \"76.0.3806.0\",\n\t\"7.0.0-nightly.20190530\": \"76.0.3806.0\",\n\t\"7.0.0-nightly.20190529\": \"76.0.3806.0\",\n\t\"7.0.0-nightly.20190521\": \"76.0.3784.0\",\n\t\"7.0.0-beta.7\": \"78.0.3905.1\",\n\t\"7.0.0-beta.6\": \"78.0.3905.1\",\n\t\"7.0.0-beta.5\": \"78.0.3905.1\",\n\t\"7.0.0-beta.4\": \"78.0.3896.6\",\n\t\"7.0.0-beta.3\": \"78.0.3866.0\",\n\t\"7.0.0-beta.2\": \"78.0.3866.0\",\n\t\"7.0.0-beta.1\": \"78.0.3866.0\",\n\t\"6.1.9\": \"76.0.3809.146\",\n\t\"6.1.8\": \"76.0.3809.146\",\n\t\"6.1.7\": \"76.0.3809.146\",\n\t\"6.1.6\": \"76.0.3809.146\",\n\t\"6.1.5\": \"76.0.3809.146\",\n\t\"6.1.4\": \"76.0.3809.146\",\n\t\"6.1.3\": \"76.0.3809.146\",\n\t\"6.1.2\": \"76.0.3809.146\",\n\t\"6.1.1\": \"76.0.3809.146\",\n\t\"6.1.0\": \"76.0.3809.146\",\n\t\"6.0.12\": \"76.0.3809.146\",\n\t\"6.0.11\": \"76.0.3809.146\",\n\t\"6.0.10\": \"76.0.3809.146\",\n\t\"6.0.9\": \"76.0.3809.146\",\n\t\"6.0.8\": \"76.0.3809.146\",\n\t\"6.0.7\": \"76.0.3809.139\",\n\t\"6.0.6\": \"76.0.3809.138\",\n\t\"6.0.5\": \"76.0.3809.136\",\n\t\"6.0.4\": \"76.0.3809.131\",\n\t\"6.0.3\": \"76.0.3809.126\",\n\t\"6.0.2\": \"76.0.3809.110\",\n\t\"6.0.1\": \"76.0.3809.102\",\n\t\"6.0.0\": \"76.0.3809.88\",\n\t\"6.0.0-nightly.20190311\": \"74.0.3724.8\",\n\t\"6.0.0-nightly.20190213\": \"72.0.3626.110\",\n\t\"6.0.0-nightly.20190212\": \"72.0.3626.107\",\n\t\"6.0.0-beta.15\": \"76.0.3809.74\",\n\t\"6.0.0-beta.14\": \"76.0.3809.68\",\n\t\"6.0.0-beta.13\": \"76.0.3809.60\",\n\t\"6.0.0-beta.12\": \"76.0.3809.54\",\n\t\"6.0.0-beta.11\": \"76.0.3809.42\",\n\t\"6.0.0-beta.10\": \"76.0.3809.37\",\n\t\"6.0.0-beta.9\": \"76.0.3809.26\",\n\t\"6.0.0-beta.8\": \"76.0.3809.26\",\n\t\"6.0.0-beta.7\": \"76.0.3809.22\",\n\t\"6.0.0-beta.6\": \"76.0.3809.3\",\n\t\"6.0.0-beta.5\": \"76.0.3805.4\",\n\t\"6.0.0-beta.4\": \"76.0.3783.1\",\n\t\"6.0.0-beta.3\": \"76.0.3783.1\",\n\t\"6.0.0-beta.2\": \"76.0.3783.1\",\n\t\"6.0.0-beta.1\": \"76.0.3774.1\",\n\t\"5.0.13\": \"73.0.3683.121\",\n\t\"5.0.12\": \"73.0.3683.121\",\n\t\"5.0.11\": \"73.0.3683.121\",\n\t\"5.0.10\": \"73.0.3683.121\",\n\t\"5.0.9\": \"73.0.3683.121\",\n\t\"5.0.8\": \"73.0.3683.121\",\n\t\"5.0.7\": \"73.0.3683.121\",\n\t\"5.0.6\": \"73.0.3683.121\",\n\t\"5.0.5\": \"73.0.3683.121\",\n\t\"5.0.4\": \"73.0.3683.121\",\n\t\"5.0.3\": \"73.0.3683.121\",\n\t\"5.0.2\": \"73.0.3683.121\",\n\t\"5.0.1\": \"73.0.3683.121\",\n\t\"5.0.0\": \"73.0.3683.119\",\n\t\"5.0.0-nightly.20190122\": \"71.0.3578.98\",\n\t\"5.0.0-nightly.20190121\": \"71.0.3578.98\",\n\t\"5.0.0-nightly.20190107\": \"70.0.3538.110\",\n\t\"5.0.0-beta.9\": \"73.0.3683.117\",\n\t\"5.0.0-beta.8\": \"73.0.3683.104\",\n\t\"5.0.0-beta.7\": \"73.0.3683.94\",\n\t\"5.0.0-beta.6\": \"73.0.3683.84\",\n\t\"5.0.0-beta.5\": \"73.0.3683.61\",\n\t\"5.0.0-beta.4\": \"73.0.3683.54\",\n\t\"5.0.0-beta.3\": \"73.0.3683.27\",\n\t\"5.0.0-beta.2\": \"72.0.3626.52\",\n\t\"5.0.0-beta.1\": \"72.0.3626.52\",\n\t\"4.2.12\": \"69.0.3497.128\",\n\t\"4.2.11\": \"69.0.3497.128\",\n\t\"4.2.10\": \"69.0.3497.128\",\n\t\"4.2.9\": \"69.0.3497.128\",\n\t\"4.2.8\": \"69.0.3497.128\",\n\t\"4.2.7\": \"69.0.3497.128\",\n\t\"4.2.6\": \"69.0.3497.128\",\n\t\"4.2.5\": \"69.0.3497.128\",\n\t\"4.2.4\": \"69.0.3497.128\",\n\t\"4.2.3\": \"69.0.3497.128\",\n\t\"4.2.2\": \"69.0.3497.128\",\n\t\"4.2.1\": \"69.0.3497.128\",\n\t\"4.2.0\": \"69.0.3497.128\",\n\t\"4.1.5\": \"69.0.3497.128\",\n\t\"4.1.4\": \"69.0.3497.128\",\n\t\"4.1.3\": \"69.0.3497.128\",\n\t\"4.1.2\": \"69.0.3497.128\",\n\t\"4.1.1\": \"69.0.3497.128\",\n\t\"4.1.0\": \"69.0.3497.128\",\n\t\"4.0.8\": \"69.0.3497.128\",\n\t\"4.0.7\": \"69.0.3497.128\",\n\t\"4.0.6\": \"69.0.3497.106\",\n\t\"4.0.5\": \"69.0.3497.106\",\n\t\"4.0.4\": \"69.0.3497.106\",\n\t\"4.0.3\": \"69.0.3497.106\",\n\t\"4.0.2\": \"69.0.3497.106\",\n\t\"4.0.1\": \"69.0.3497.106\",\n\t\"4.0.0\": \"69.0.3497.106\",\n\t\"4.0.0-nightly.20181010\": \"69.0.3497.106\",\n\t\"4.0.0-nightly.20181006\": \"68.0.3440.128\",\n\t\"4.0.0-nightly.20180929\": \"67.0.3396.99\",\n\t\"4.0.0-nightly.20180821\": \"66.0.3359.181\",\n\t\"4.0.0-nightly.20180819\": \"66.0.3359.181\",\n\t\"4.0.0-nightly.20180817\": \"66.0.3359.181\",\n\t\"4.0.0-beta.11\": \"69.0.3497.106\",\n\t\"4.0.0-beta.10\": \"69.0.3497.106\",\n\t\"4.0.0-beta.9\": \"69.0.3497.106\",\n\t\"4.0.0-beta.8\": \"69.0.3497.106\",\n\t\"4.0.0-beta.7\": \"69.0.3497.106\",\n\t\"4.0.0-beta.6\": \"69.0.3497.106\",\n\t\"4.0.0-beta.5\": \"69.0.3497.106\",\n\t\"4.0.0-beta.4\": \"69.0.3497.106\",\n\t\"4.0.0-beta.3\": \"69.0.3497.106\",\n\t\"4.0.0-beta.2\": \"69.0.3497.106\",\n\t\"4.0.0-beta.1\": \"69.0.3497.106\",\n\t\"3.1.13\": \"66.0.3359.181\",\n\t\"3.1.12\": \"66.0.3359.181\",\n\t\"3.1.11\": \"66.0.3359.181\",\n\t\"3.1.10\": \"66.0.3359.181\",\n\t\"3.1.9\": \"66.0.3359.181\",\n\t\"3.1.8\": \"66.0.3359.181\",\n\t\"3.1.7\": \"66.0.3359.181\",\n\t\"3.1.6\": \"66.0.3359.181\",\n\t\"3.1.5\": \"66.0.3359.181\",\n\t\"3.1.4\": \"66.0.3359.181\",\n\t\"3.1.3\": \"66.0.3359.181\",\n\t\"3.1.2\": \"66.0.3359.181\",\n\t\"3.1.1\": \"66.0.3359.181\",\n\t\"3.1.0\": \"66.0.3359.181\",\n\t\"3.1.0-beta.5\": \"66.0.3359.181\",\n\t\"3.1.0-beta.4\": \"66.0.3359.181\",\n\t\"3.1.0-beta.3\": \"66.0.3359.181\",\n\t\"3.1.0-beta.2\": \"66.0.3359.181\",\n\t\"3.1.0-beta.1\": \"66.0.3359.181\",\n\t\"3.0.16\": \"66.0.3359.181\",\n\t\"3.0.15\": \"66.0.3359.181\",\n\t\"3.0.14\": \"66.0.3359.181\",\n\t\"3.0.13\": \"66.0.3359.181\",\n\t\"3.0.12\": \"66.0.3359.181\",\n\t\"3.0.11\": \"66.0.3359.181\",\n\t\"3.0.10\": \"66.0.3359.181\",\n\t\"3.0.9\": \"66.0.3359.181\",\n\t\"3.0.8\": \"66.0.3359.181\",\n\t\"3.0.7\": \"66.0.3359.181\",\n\t\"3.0.6\": \"66.0.3359.181\",\n\t\"3.0.5\": \"66.0.3359.181\",\n\t\"3.0.4\": \"66.0.3359.181\",\n\t\"3.0.3\": \"66.0.3359.181\",\n\t\"3.0.2\": \"66.0.3359.181\",\n\t\"3.0.1\": \"66.0.3359.181\",\n\t\"3.0.0\": \"66.0.3359.181\",\n\t\"3.0.0-nightly.20180904\": \"66.0.3359.181\",\n\t\"3.0.0-nightly.20180823\": \"66.0.3359.181\",\n\t\"3.0.0-nightly.20180821\": \"66.0.3359.181\",\n\t\"3.0.0-nightly.20180818\": \"66.0.3359.181\",\n\t\"3.0.0-beta.13\": \"66.0.3359.181\",\n\t\"3.0.0-beta.12\": \"66.0.3359.181\",\n\t\"3.0.0-beta.11\": \"66.0.3359.181\",\n\t\"3.0.0-beta.10\": \"66.0.3359.181\",\n\t\"3.0.0-beta.9\": \"66.0.3359.181\",\n\t\"3.0.0-beta.8\": \"66.0.3359.181\",\n\t\"3.0.0-beta.7\": \"66.0.3359.181\",\n\t\"3.0.0-beta.6\": \"66.0.3359.181\",\n\t\"3.0.0-beta.5\": \"66.0.3359.181\",\n\t\"3.0.0-beta.4\": \"66.0.3359.181\",\n\t\"3.0.0-beta.3\": \"66.0.3359.181\",\n\t\"3.0.0-beta.2\": \"66.0.3359.181\",\n\t\"3.0.0-beta.1\": \"66.0.3359.181\",\n\t\"2.1.0-unsupported.20180809\": \"61.0.3163.100\",\n\t\"2.0.18\": \"61.0.3163.100\",\n\t\"2.0.17\": \"61.0.3163.100\",\n\t\"2.0.16\": \"61.0.3163.100\",\n\t\"2.0.15\": \"61.0.3163.100\",\n\t\"2.0.14\": \"61.0.3163.100\",\n\t\"2.0.13\": \"61.0.3163.100\",\n\t\"2.0.12\": \"61.0.3163.100\",\n\t\"2.0.11\": \"61.0.3163.100\",\n\t\"2.0.10\": \"61.0.3163.100\",\n\t\"2.0.9\": \"61.0.3163.100\",\n\t\"2.0.8\": \"61.0.3163.100\",\n\t\"2.0.8-nightly.20180820\": \"61.0.3163.100\",\n\t\"2.0.8-nightly.20180819\": \"61.0.3163.100\",\n\t\"2.0.7\": \"61.0.3163.100\",\n\t\"2.0.6\": \"61.0.3163.100\",\n\t\"2.0.5\": \"61.0.3163.100\",\n\t\"2.0.4\": \"61.0.3163.100\",\n\t\"2.0.3\": \"61.0.3163.100\",\n\t\"2.0.2\": \"61.0.3163.100\",\n\t\"2.0.1\": \"61.0.3163.100\",\n\t\"2.0.0\": \"61.0.3163.100\",\n\t\"2.0.0-beta.8\": \"61.0.3163.100\",\n\t\"2.0.0-beta.7\": \"61.0.3163.100\",\n\t\"2.0.0-beta.6\": \"61.0.3163.100\",\n\t\"2.0.0-beta.5\": \"61.0.3163.100\",\n\t\"2.0.0-beta.4\": \"61.0.3163.100\",\n\t\"2.0.0-beta.3\": \"61.0.3163.100\",\n\t\"2.0.0-beta.2\": \"61.0.3163.100\",\n\t\"2.0.0-beta.1\": \"61.0.3163.100\",\n\t\"1.8.8\": \"59.0.3071.115\",\n\t\"1.8.7\": \"59.0.3071.115\",\n\t\"1.8.6\": \"59.0.3071.115\",\n\t\"1.8.5\": \"59.0.3071.115\",\n\t\"1.8.4\": \"59.0.3071.115\",\n\t\"1.8.3\": \"59.0.3071.115\",\n\t\"1.8.2\": \"59.0.3071.115\",\n\t\"1.8.2-beta.5\": \"59.0.3071.115\",\n\t\"1.8.2-beta.4\": \"59.0.3071.115\",\n\t\"1.8.2-beta.3\": \"59.0.3071.115\",\n\t\"1.8.2-beta.2\": \"59.0.3071.115\",\n\t\"1.8.2-beta.1\": \"59.0.3071.115\",\n\t\"1.8.1\": \"59.0.3071.115\",\n\t\"1.8.0\": \"59.0.3071.115\",\n\t\"1.7.16\": \"58.0.3029.110\",\n\t\"1.7.15\": \"58.0.3029.110\",\n\t\"1.7.14\": \"58.0.3029.110\",\n\t\"1.7.13\": \"58.0.3029.110\",\n\t\"1.7.12\": \"58.0.3029.110\",\n\t\"1.7.11\": \"58.0.3029.110\",\n\t\"1.7.10\": \"58.0.3029.110\",\n\t\"1.7.9\": \"58.0.3029.110\",\n\t\"1.7.8\": \"58.0.3029.110\",\n\t\"1.7.7\": \"58.0.3029.110\",\n\t\"1.7.6\": \"58.0.3029.110\",\n\t\"1.7.5\": \"58.0.3029.110\",\n\t\"1.7.4\": \"58.0.3029.110\",\n\t\"1.7.3\": \"58.0.3029.110\",\n\t\"1.7.2\": \"58.0.3029.110\",\n\t\"1.7.1\": \"58.0.3029.110\",\n\t\"1.7.0\": \"58.0.3029.110\",\n\t\"1.6.18\": \"56.0.2924.87\",\n\t\"1.6.17\": \"56.0.2924.87\",\n\t\"1.6.16\": \"56.0.2924.87\",\n\t\"1.6.15\": \"56.0.2924.87\",\n\t\"1.6.14\": \"56.0.2924.87\",\n\t\"1.6.13\": \"56.0.2924.87\",\n\t\"1.6.12\": \"56.0.2924.87\",\n\t\"1.6.11\": \"56.0.2924.87\",\n\t\"1.6.10\": \"56.0.2924.87\",\n\t\"1.6.9\": \"56.0.2924.87\",\n\t\"1.6.8\": \"56.0.2924.87\",\n\t\"1.6.7\": \"56.0.2924.87\",\n\t\"1.6.6\": \"56.0.2924.87\",\n\t\"1.6.5\": \"56.0.2924.87\",\n\t\"1.6.4\": \"56.0.2924.87\",\n\t\"1.6.3\": \"56.0.2924.87\",\n\t\"1.6.2\": \"56.0.2924.87\",\n\t\"1.6.1\": \"56.0.2924.87\",\n\t\"1.6.0\": \"56.0.2924.87\",\n\t\"1.5.1\": \"54.0.2840.101\",\n\t\"1.5.0\": \"54.0.2840.101\",\n\t\"1.4.16\": \"53.0.2785.143\",\n\t\"1.4.15\": \"53.0.2785.143\",\n\t\"1.4.14\": \"53.0.2785.143\",\n\t\"1.4.13\": \"53.0.2785.143\",\n\t\"1.4.12\": \"54.0.2840.51\",\n\t\"1.4.11\": \"53.0.2785.143\",\n\t\"1.4.10\": \"53.0.2785.143\",\n\t\"1.4.8\": \"53.0.2785.143\",\n\t\"1.4.7\": \"53.0.2785.143\",\n\t\"1.4.6\": \"53.0.2785.143\",\n\t\"1.4.5\": \"53.0.2785.113\",\n\t\"1.4.4\": \"53.0.2785.113\",\n\t\"1.4.3\": \"53.0.2785.113\",\n\t\"1.4.2\": \"53.0.2785.113\",\n\t\"1.4.1\": \"53.0.2785.113\",\n\t\"1.4.0\": \"53.0.2785.113\",\n\t\"1.3.15\": \"52.0.2743.82\",\n\t\"1.3.14\": \"52.0.2743.82\",\n\t\"1.3.13\": \"52.0.2743.82\",\n\t\"1.3.10\": \"52.0.2743.82\",\n\t\"1.3.9\": \"52.0.2743.82\",\n\t\"1.3.7\": \"52.0.2743.82\",\n\t\"1.3.6\": \"52.0.2743.82\",\n\t\"1.3.5\": \"52.0.2743.82\",\n\t\"1.3.4\": \"52.0.2743.82\",\n\t\"1.3.3\": \"52.0.2743.82\",\n\t\"1.3.2\": \"52.0.2743.82\",\n\t\"1.3.1\": \"52.0.2743.82\",\n\t\"1.3.0\": \"52.0.2743.82\",\n\t\"1.2.8\": \"51.0.2704.106\",\n\t\"1.2.7\": \"51.0.2704.106\",\n\t\"1.2.6\": \"51.0.2704.106\",\n\t\"1.2.5\": \"51.0.2704.103\",\n\t\"1.2.4\": \"51.0.2704.103\",\n\t\"1.2.3\": \"51.0.2704.84\",\n\t\"1.2.2\": \"51.0.2704.84\",\n\t\"1.2.1\": \"51.0.2704.63\",\n\t\"1.2.0\": \"51.0.2704.63\",\n\t\"1.1.3\": \"50.0.2661.102\",\n\t\"1.1.2\": \"50.0.2661.102\",\n\t\"1.1.1\": \"50.0.2661.102\",\n\t\"1.1.0\": \"50.0.2661.102\",\n\t\"1.0.2\": \"49.0.2623.75\",\n\t\"1.0.1\": \"49.0.2623.75\",\n\t\"1.0.0\": \"49.0.2623.75\",\n\t\"0.37.8\": \"49.0.2623.75\",\n\t\"0.37.7\": \"49.0.2623.75\",\n\t\"0.37.6\": \"49.0.2623.75\",\n\t\"0.37.5\": \"49.0.2623.75\",\n\t\"0.37.4\": \"49.0.2623.75\",\n\t\"0.37.3\": \"49.0.2623.75\",\n\t\"0.37.1\": \"49.0.2623.75\",\n\t\"0.37.0\": \"49.0.2623.75\",\n\t\"0.36.12\": \"47.0.2526.110\",\n\t\"0.36.11\": \"47.0.2526.110\",\n\t\"0.36.10\": \"47.0.2526.110\",\n\t\"0.36.9\": \"47.0.2526.110\",\n\t\"0.36.8\": \"47.0.2526.110\",\n\t\"0.36.7\": \"47.0.2526.110\",\n\t\"0.36.6\": \"47.0.2526.110\",\n\t\"0.36.5\": \"47.0.2526.110\",\n\t\"0.36.4\": \"47.0.2526.73\",\n\t\"0.36.3\": \"47.0.2526.73\",\n\t\"0.36.2\": \"47.0.2526.73\",\n\t\"0.36.0\": \"47.0.2526.73\",\n\t\"0.35.5\": \"45.0.2454.85\",\n\t\"0.35.4\": \"45.0.2454.85\",\n\t\"0.35.3\": \"45.0.2454.85\",\n\t\"0.35.2\": \"45.0.2454.85\",\n\t\"0.35.1\": \"45.0.2454.85\",\n\t\"0.34.4\": \"45.0.2454.85\",\n\t\"0.34.3\": \"45.0.2454.85\",\n\t\"0.34.2\": \"45.0.2454.85\",\n\t\"0.34.1\": \"45.0.2454.85\",\n\t\"0.34.0\": \"45.0.2454.85\",\n\t\"0.33.9\": \"45.0.2454.85\",\n\t\"0.33.8\": \"45.0.2454.85\",\n\t\"0.33.7\": \"45.0.2454.85\",\n\t\"0.33.6\": \"45.0.2454.85\",\n\t\"0.33.4\": \"45.0.2454.85\",\n\t\"0.33.3\": \"45.0.2454.85\",\n\t\"0.33.2\": \"45.0.2454.85\",\n\t\"0.33.1\": \"45.0.2454.85\",\n\t\"0.33.0\": \"45.0.2454.85\",\n\t\"0.32.3\": \"45.0.2454.85\",\n\t\"0.32.2\": \"45.0.2454.85\",\n\t\"0.31.2\": \"45.0.2454.85\",\n\t\"0.31.0\": \"44.0.2403.125\",\n\t\"0.30.4\": \"44.0.2403.125\",\n\t\"0.29.2\": \"43.0.2357.65\",\n\t\"0.29.1\": \"43.0.2357.65\",\n\t\"0.28.3\": \"43.0.2357.65\",\n\t\"0.28.2\": \"43.0.2357.65\",\n\t\"0.28.1\": \"43.0.2357.65\",\n\t\"0.28.0\": \"43.0.2357.65\",\n\t\"0.27.3\": \"43.0.2357.65\",\n\t\"0.27.2\": \"43.0.2357.65\",\n\t\"0.27.1\": \"42.0.2311.107\",\n\t\"0.27.0\": \"42.0.2311.107\",\n\t\"0.26.1\": \"42.0.2311.107\",\n\t\"0.26.0\": \"42.0.2311.107\",\n\t\"0.25.3\": \"42.0.2311.107\",\n\t\"0.25.2\": \"42.0.2311.107\",\n\t\"0.25.1\": \"42.0.2311.107\",\n\t\"0.25.0\": \"42.0.2311.107\",\n\t\"0.24.0\": \"41.0.2272.76\",\n\t\"0.23.0\": \"41.0.2272.76\",\n\t\"0.22.3\": \"41.0.2272.76\",\n\t\"0.22.2\": \"41.0.2272.76\",\n\t\"0.22.1\": \"41.0.2272.76\",\n\t\"0.21.3\": \"41.0.2272.76\",\n\t\"0.21.2\": \"40.0.2214.91\",\n\t\"0.21.1\": \"40.0.2214.91\",\n\t\"0.21.0\": \"40.0.2214.91\",\n\t\"0.20.8\": \"39.0.2171.65\",\n\t\"0.20.7\": \"39.0.2171.65\",\n\t\"0.20.6\": \"39.0.2171.65\",\n\t\"0.20.5\": \"39.0.2171.65\",\n\t\"0.20.4\": \"39.0.2171.65\",\n\t\"0.20.3\": \"39.0.2171.65\",\n\t\"0.20.2\": \"39.0.2171.65\",\n\t\"0.20.1\": \"39.0.2171.65\",\n\t\"0.20.0\": \"39.0.2171.65\"\n};" ]

{ "pile_set_name": "Github" }

[ 0.010871294479503633 ]

[ { "analysis_explanation": null, "end": 3290, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3279 }, { "analysis_explanation": null, "end": 3332, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3321 }, { "analysis_explanation": null, "end": 3374, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3363 }, { "analysis_explanation": null, "end": 3416, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3405 }, { "analysis_explanation": null, "end": 5693, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5682 }, { "analysis_explanation": null, "end": 5725, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5714 }, { "analysis_explanation": null, "end": 6238, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6227 }, { "analysis_explanation": null, "end": 7866, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7855 }, { "analysis_explanation": null, "end": 7898, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7887 }, { "analysis_explanation": null, "end": 7930, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7919 }, { "analysis_explanation": null, "end": 8493, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8480 }, { "analysis_explanation": null, "end": 8845, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8833 }, { "analysis_explanation": null, "end": 9178, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9167 }, { "analysis_explanation": null, "end": 13715, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13710 }, { "analysis_explanation": null, "end": 14509, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14503 }, { "analysis_explanation": null, "end": 5790, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.6, "start": 5784 }, { "analysis_explanation": null, "end": 5818, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.6, "start": 5812 }, { "analysis_explanation": null, "end": 5846, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.6, "start": 5840 }, { "analysis_explanation": null, "end": 5874, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.6, "start": 5868 }, { "analysis_explanation": null, "end": 5902, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.6, "start": 5896 }, { "analysis_explanation": null, "end": 10128, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.6, "start": 10122 }, { "analysis_explanation": null, "end": 10156, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.6, "start": 10150 }, { "analysis_explanation": null, "end": 10184, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.6, "start": 10178 }, { "analysis_explanation": null, "end": 11526, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.6, "start": 11520 }, { "analysis_explanation": null, "end": 11554, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.6, "start": 11548 }, { "analysis_explanation": null, "end": 11582, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.6, "start": 11576 }, { "analysis_explanation": null, "end": 11610, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.6, "start": 11604 }, { "analysis_explanation": null, "end": 14537, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.6, "start": 14531 }, { "analysis_explanation": null, "end": 14565, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.6, "start": 14559 }, { "analysis_explanation": null, "end": 14593, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.6, "start": 14587 }, { "analysis_explanation": null, "end": 14621, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.6, "start": 14615 }, { "analysis_explanation": null, "end": 14649, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.6, "start": 14643 }, { "analysis_explanation": null, "end": 14677, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.6, "start": 14671 }, { "analysis_explanation": null, "end": 14975, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.6, "start": 14969 }, { "analysis_explanation": null, "end": 15002, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.6, "start": 14996 }, { "analysis_explanation": null, "end": 15029, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.6, "start": 15023 }, { "analysis_explanation": null, "end": 15056, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.6, "start": 15050 }, { "analysis_explanation": null, "end": 15083, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.6, "start": 15077 }, { "analysis_explanation": null, "end": 15110, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.6, "start": 15104 }, { "analysis_explanation": null, "end": 15137, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.6, "start": 15131 }, { "analysis_explanation": null, "end": 15164, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.6, "start": 15158 }, { "analysis_explanation": null, "end": 15191, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.6, "start": 15185 }, { "analysis_explanation": null, "end": 15532, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.6, "start": 15526 }, { "analysis_explanation": null, "end": 15560, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.6, "start": 15554 }, { "analysis_explanation": null, "end": 15588, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.6, "start": 15582 }, { "analysis_explanation": null, "end": 15616, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.6, "start": 15610 }, { "analysis_explanation": null, "end": 15644, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.6, "start": 15638 }, { "analysis_explanation": null, "end": 15671, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.6, "start": 15665 }, { "analysis_explanation": null, "end": 15699, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.6, "start": 15693 }, { "analysis_explanation": null, "end": 15970, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.6, "start": 15964 }, { "analysis_explanation": null, "end": 15997, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.6, "start": 15991 }, { "analysis_explanation": null, "end": 16024, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.6, "start": 16018 }, { "analysis_explanation": null, "end": 16051, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.6, "start": 16045 }, { "analysis_explanation": null, "end": 3005, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 2992 }, { "analysis_explanation": null, "end": 3032, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 3019 }, { "analysis_explanation": null, "end": 3059, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 3046 }, { "analysis_explanation": null, "end": 3086, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 3073 }, { "analysis_explanation": null, "end": 5752, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 5739 }, { "analysis_explanation": null, "end": 5779, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 5766 }, { "analysis_explanation": null, "end": 5807, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 5794 }, { "analysis_explanation": null, "end": 5835, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 5822 }, { "analysis_explanation": null, "end": 5863, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 5850 }, { "analysis_explanation": null, "end": 5891, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 5878 }, { "analysis_explanation": null, "end": 5919, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 5906 }, { "analysis_explanation": null, "end": 5946, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 5933 }, { "analysis_explanation": null, "end": 5973, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 5960 }, { "analysis_explanation": null, "end": 6000, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 5987 }, { "analysis_explanation": null, "end": 6027, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 6014 }, { "analysis_explanation": null, "end": 6054, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 6041 }, { "analysis_explanation": null, "end": 6081, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 6068 }, { "analysis_explanation": null, "end": 6108, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 6095 }, { "analysis_explanation": null, "end": 6135, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 6122 }, { "analysis_explanation": null, "end": 8085, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 8072 }, { "analysis_explanation": null, "end": 8112, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 8099 }, { "analysis_explanation": null, "end": 8139, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 8126 }, { "analysis_explanation": null, "end": 8166, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 8153 }, { "analysis_explanation": null, "end": 8193, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 8180 }, { "analysis_explanation": null, "end": 8220, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 8207 }, { "analysis_explanation": null, "end": 8247, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 8234 }, { "analysis_explanation": null, "end": 8274, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 8261 }, { "analysis_explanation": null, "end": 8301, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 8288 }, { "analysis_explanation": null, "end": 8328, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 8315 }, { "analysis_explanation": null, "end": 8356, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 8343 }, { "analysis_explanation": null, "end": 8384, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 8371 }, { "analysis_explanation": null, "end": 8412, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 8399 }, { "analysis_explanation": null, "end": 8439, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 8426 }, { "analysis_explanation": null, "end": 8466, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 8453 }, { "analysis_explanation": null, "end": 8493, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 8480 }, { "analysis_explanation": null, "end": 8520, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 8507 }, { "analysis_explanation": null, "end": 8547, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 8534 }, { "analysis_explanation": null, "end": 8574, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 8561 }, { "analysis_explanation": null, "end": 8601, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 8588 }, { "analysis_explanation": null, "end": 8628, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 8615 }, { "analysis_explanation": null, "end": 8655, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 8642 }, { "analysis_explanation": null, "end": 8767, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 8754 }, { "analysis_explanation": null, "end": 8811, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 8798 }, { "analysis_explanation": null, "end": 9334, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 9321 }, { "analysis_explanation": null, "end": 9362, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 9349 }, { "analysis_explanation": null, "end": 9390, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 9377 }, { "analysis_explanation": null, "end": 9418, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 9405 }, { "analysis_explanation": null, "end": 9445, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 9432 }, { "analysis_explanation": null, "end": 9472, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 9459 }, { "analysis_explanation": null, "end": 9499, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 9486 }, { "analysis_explanation": null, "end": 9526, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 9513 }, { "analysis_explanation": null, "end": 9553, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 9540 }, { "analysis_explanation": null, "end": 9580, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 9567 }, { "analysis_explanation": null, "end": 9607, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 9594 }, { "analysis_explanation": null, "end": 9634, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 9621 }, { "analysis_explanation": null, "end": 9661, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 9648 }, { "analysis_explanation": null, "end": 9688, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 9675 }, { "analysis_explanation": null, "end": 9818, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 9805 }, { "analysis_explanation": null, "end": 9852, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 9839 }, { "analysis_explanation": null, "end": 9886, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 9873 }, { "analysis_explanation": null, "end": 10145, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 10132 }, { "analysis_explanation": null, "end": 10173, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 10160 }, { "analysis_explanation": null, "end": 10201, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 10188 }, { "analysis_explanation": null, "end": 10228, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 10215 }, { "analysis_explanation": null, "end": 10255, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 10242 }, { "analysis_explanation": null, "end": 10282, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 10269 }, { "analysis_explanation": null, "end": 10309, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 10296 }, { "analysis_explanation": null, "end": 10336, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 10323 }, { "analysis_explanation": null, "end": 10363, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 10350 }, { "analysis_explanation": null, "end": 10390, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 10377 }, { "analysis_explanation": null, "end": 10417, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 10404 }, { "analysis_explanation": null, "end": 10444, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 10431 }, { "analysis_explanation": null, "end": 10471, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 10458 }, { "analysis_explanation": null, "end": 10498, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 10485 }, { "analysis_explanation": null, "end": 10525, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 10512 }, { "analysis_explanation": null, "end": 10552, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 10539 }, { "analysis_explanation": null, "end": 10579, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 10566 }, { "analysis_explanation": null, "end": 10606, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 10593 }, { "analysis_explanation": null, "end": 10633, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 10620 }, { "analysis_explanation": null, "end": 10660, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 10647 }, { "analysis_explanation": null, "end": 10687, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 10674 }, { "analysis_explanation": null, "end": 10714, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 10701 }, { "analysis_explanation": null, "end": 10741, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 10728 }, { "analysis_explanation": null, "end": 10768, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 10755 }, { "analysis_explanation": null, "end": 10795, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 10782 }, { "analysis_explanation": null, "end": 10822, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 10809 }, { "analysis_explanation": null, "end": 10849, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 10836 }, { "analysis_explanation": null, "end": 10876, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 10863 }, { "analysis_explanation": null, "end": 10920, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 10907 }, { "analysis_explanation": null, "end": 10964, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 10951 }, { "analysis_explanation": null, "end": 11051, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 11038 }, { "analysis_explanation": null, "end": 11095, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 11082 }, { "analysis_explanation": null, "end": 11139, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 11126 }, { "analysis_explanation": null, "end": 11174, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 11161 }, { "analysis_explanation": null, "end": 11209, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 11196 }, { "analysis_explanation": null, "end": 11243, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 11230 }, { "analysis_explanation": null, "end": 11277, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 11264 }, { "analysis_explanation": null, "end": 11311, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 11298 }, { "analysis_explanation": null, "end": 11345, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 11332 }, { "analysis_explanation": null, "end": 11379, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 11366 }, { "analysis_explanation": null, "end": 11413, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 11400 }, { "analysis_explanation": null, "end": 11447, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 11434 }, { "analysis_explanation": null, "end": 11481, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 11468 }, { "analysis_explanation": null, "end": 11515, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 11502 }, { "analysis_explanation": null, "end": 11543, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 11530 }, { "analysis_explanation": null, "end": 11571, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 11558 }, { "analysis_explanation": null, "end": 11599, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 11586 }, { "analysis_explanation": null, "end": 11627, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 11614 }, { "analysis_explanation": null, "end": 11654, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 11641 }, { "analysis_explanation": null, "end": 11681, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 11668 }, { "analysis_explanation": null, "end": 11708, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 11695 }, { "analysis_explanation": null, "end": 11735, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 11722 }, { "analysis_explanation": null, "end": 11762, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 11749 }, { "analysis_explanation": null, "end": 11789, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 11776 }, { "analysis_explanation": null, "end": 11816, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 11803 }, { "analysis_explanation": null, "end": 11843, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 11830 }, { "analysis_explanation": null, "end": 11870, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 11857 }, { "analysis_explanation": null, "end": 11897, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 11884 }, { "analysis_explanation": null, "end": 11931, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 11918 }, { "analysis_explanation": null, "end": 11965, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 11952 }, { "analysis_explanation": null, "end": 11999, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 11986 }, { "analysis_explanation": null, "end": 12033, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 12020 }, { "analysis_explanation": null, "end": 12067, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 12054 }, { "analysis_explanation": null, "end": 12095, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 12082 }, { "analysis_explanation": null, "end": 12123, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 12110 }, { "analysis_explanation": null, "end": 12151, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 12138 }, { "analysis_explanation": null, "end": 12179, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 12166 }, { "analysis_explanation": null, "end": 12207, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 12194 }, { "analysis_explanation": null, "end": 12235, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 12222 }, { "analysis_explanation": null, "end": 12263, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 12250 }, { "analysis_explanation": null, "end": 12290, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 12277 }, { "analysis_explanation": null, "end": 12317, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 12304 }, { "analysis_explanation": null, "end": 12344, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 12331 }, { "analysis_explanation": null, "end": 12371, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 12358 }, { "analysis_explanation": null, "end": 12398, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 12385 }, { "analysis_explanation": null, "end": 12425, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 12412 }, { "analysis_explanation": null, "end": 12452, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 12439 }, { "analysis_explanation": null, "end": 12479, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 12466 }, { "analysis_explanation": null, "end": 12506, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 12493 }, { "analysis_explanation": null, "end": 12533, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 12520 }, { "analysis_explanation": null, "end": 12577, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 12564 }, { "analysis_explanation": null, "end": 12621, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 12608 }, { "analysis_explanation": null, "end": 12665, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 12652 }, { "analysis_explanation": null, "end": 12709, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 12696 }, { "analysis_explanation": null, "end": 12744, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 12731 }, { "analysis_explanation": null, "end": 12779, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 12766 }, { "analysis_explanation": null, "end": 12814, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 12801 }, { "analysis_explanation": null, "end": 12849, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 12836 }, { "analysis_explanation": null, "end": 12883, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 12870 }, { "analysis_explanation": null, "end": 12917, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 12904 }, { "analysis_explanation": null, "end": 12951, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 12938 }, { "analysis_explanation": null, "end": 12985, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 12972 }, { "analysis_explanation": null, "end": 13019, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 13006 }, { "analysis_explanation": null, "end": 13053, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 13040 }, { "analysis_explanation": null, "end": 13087, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 13074 }, { "analysis_explanation": null, "end": 13121, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 13108 }, { "analysis_explanation": null, "end": 13155, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 13142 }, { "analysis_explanation": null, "end": 13203, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 13190 }, { "analysis_explanation": null, "end": 13231, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 13218 }, { "analysis_explanation": null, "end": 13259, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 13246 }, { "analysis_explanation": null, "end": 13287, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 13274 }, { "analysis_explanation": null, "end": 13315, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 13302 }, { "analysis_explanation": null, "end": 13343, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 13330 }, { "analysis_explanation": null, "end": 13371, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 13358 }, { "analysis_explanation": null, "end": 13399, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 13386 }, { "analysis_explanation": null, "end": 13427, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 13414 }, { "analysis_explanation": null, "end": 13455, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 13442 }, { "analysis_explanation": null, "end": 13482, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 13469 }, { "analysis_explanation": null, "end": 13509, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 13496 }, { "analysis_explanation": null, "end": 13553, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 13540 }, { "analysis_explanation": null, "end": 13597, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 13584 }, { "analysis_explanation": null, "end": 13624, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 13611 }, { "analysis_explanation": null, "end": 13651, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 13638 }, { "analysis_explanation": null, "end": 13678, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 13665 }, { "analysis_explanation": null, "end": 13705, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 13692 }, { "analysis_explanation": null, "end": 13732, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 13719 }, { "analysis_explanation": null, "end": 13759, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 13746 }, { "analysis_explanation": null, "end": 13786, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 13773 }, { "analysis_explanation": null, "end": 13813, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 13800 }, { "analysis_explanation": null, "end": 13847, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 13834 }, { "analysis_explanation": null, "end": 13881, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 13868 }, { "analysis_explanation": null, "end": 13915, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 13902 }, { "analysis_explanation": null, "end": 13949, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 13936 }, { "analysis_explanation": null, "end": 13983, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 13970 }, { "analysis_explanation": null, "end": 14017, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 14004 }, { "analysis_explanation": null, "end": 14051, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 14038 }, { "analysis_explanation": null, "end": 14085, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 14072 }, { "analysis_explanation": null, "end": 14526, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 14513 }, { "analysis_explanation": null, "end": 14554, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 14541 }, { "analysis_explanation": null, "end": 14582, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 14569 }, { "analysis_explanation": null, "end": 14610, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 14597 }, { "analysis_explanation": null, "end": 14638, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 14625 }, { "analysis_explanation": null, "end": 14666, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 14653 }, { "analysis_explanation": null, "end": 14694, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 14681 }, { "analysis_explanation": null, "end": 14721, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 14708 }, { "analysis_explanation": null, "end": 14748, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 14735 }, { "analysis_explanation": null, "end": 14775, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 14762 }, { "analysis_explanation": null, "end": 14802, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 14789 }, { "analysis_explanation": null, "end": 14829, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 14816 }, { "analysis_explanation": null, "end": 14856, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 14843 }, { "analysis_explanation": null, "end": 14883, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 14870 }, { "analysis_explanation": null, "end": 14910, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 14897 }, { "analysis_explanation": null, "end": 14937, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 14924 }, { "analysis_explanation": null, "end": 14964, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 14951 }, { "analysis_explanation": null, "end": 15494, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 15481 }, { "analysis_explanation": null, "end": 15521, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 15508 }, { "analysis_explanation": null, "end": 15549, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 15536 }, { "analysis_explanation": null, "end": 15577, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 15564 }, { "analysis_explanation": null, "end": 15605, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 15592 }, { "analysis_explanation": null, "end": 15633, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 15620 }, { "analysis_explanation": null, "end": 15688, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 15675 }, { "analysis_explanation": null, "end": 15716, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 15703 }, { "analysis_explanation": null, "end": 15743, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 15730 }, { "analysis_explanation": null, "end": 15770, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 15757 }, { "analysis_explanation": null, "end": 15797, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 15784 }, { "analysis_explanation": null, "end": 15824, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 15811 }, { "analysis_explanation": null, "end": 15851, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 15838 }, { "analysis_explanation": null, "end": 15878, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 15865 }, { "analysis_explanation": null, "end": 15905, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 15892 }, { "analysis_explanation": null, "end": 15932, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 15919 }, { "analysis_explanation": null, "end": 15959, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 15946 }, { "analysis_explanation": null, "end": 16328, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 16315 }, { "analysis_explanation": null, "end": 16355, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 16342 }, { "analysis_explanation": null, "end": 16382, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 16369 }, { "analysis_explanation": null, "end": 16409, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 16396 }, { "analysis_explanation": null, "end": 16436, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 16423 }, { "analysis_explanation": null, "end": 16567, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 16554 }, { "analysis_explanation": null, "end": 16594, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 16581 }, { "analysis_explanation": null, "end": 16621, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 16608 }, { "analysis_explanation": null, "end": 16648, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 16635 }, { "analysis_explanation": null, "end": 16971, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 16958 }, { "analysis_explanation": null, "end": 17000, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 16987 }, { "analysis_explanation": null, "end": 17029, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 17016 }, { "analysis_explanation": null, "end": 17057, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 17044 }, { "analysis_explanation": null, "end": 17085, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 17072 }, { "analysis_explanation": null, "end": 17113, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 17100 }, { "analysis_explanation": null, "end": 17141, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 17128 }, { "analysis_explanation": null, "end": 17169, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 17156 }, { "analysis_explanation": null, "end": 17899, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 17886 }, { "analysis_explanation": null, "end": 17927, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 17914 }, { "analysis_explanation": null, "end": 18171, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 18158 }, { "analysis_explanation": null, "end": 18199, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 18186 }, { "analysis_explanation": null, "end": 18227, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 18214 }, { "analysis_explanation": null, "end": 18255, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 18242 }, { "analysis_explanation": null, "end": 18283, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 18270 }, { "analysis_explanation": null, "end": 18311, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 18298 }, { "analysis_explanation": null, "end": 18339, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 18326 }, { "analysis_explanation": null, "end": 18367, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 18354 }, { "analysis_explanation": null, "end": 44, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 36 }, { "analysis_explanation": null, "end": 87, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 79 }, { "analysis_explanation": null, "end": 130, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 122 }, { "analysis_explanation": null, "end": 173, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 165 }, { "analysis_explanation": null, "end": 216, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 208 }, { "analysis_explanation": null, "end": 259, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 251 }, { "analysis_explanation": null, "end": 302, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 294 }, { "analysis_explanation": null, "end": 345, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 337 }, { "analysis_explanation": null, "end": 388, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 380 }, { "analysis_explanation": null, "end": 431, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 423 }, { "analysis_explanation": null, "end": 474, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 466 }, { "analysis_explanation": null, "end": 517, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 509 }, { "analysis_explanation": null, "end": 560, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 552 }, { "analysis_explanation": null, "end": 603, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 595 }, { "analysis_explanation": null, "end": 646, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 638 }, { "analysis_explanation": null, "end": 689, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 681 }, { "analysis_explanation": null, "end": 732, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 724 }, { "analysis_explanation": null, "end": 775, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 767 }, { "analysis_explanation": null, "end": 818, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 810 }, { "analysis_explanation": null, "end": 861, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 853 }, { "analysis_explanation": null, "end": 904, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 896 }, { "analysis_explanation": null, "end": 947, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 939 }, { "analysis_explanation": null, "end": 990, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 982 }, { "analysis_explanation": null, "end": 1033, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 1025 }, { "analysis_explanation": null, "end": 1076, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 1068 }, { "analysis_explanation": null, "end": 1119, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 1111 }, { "analysis_explanation": null, "end": 1161, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 1153 }, { "analysis_explanation": null, "end": 1203, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 1195 }, { "analysis_explanation": null, "end": 1245, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 1237 }, { "analysis_explanation": null, "end": 1287, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 1279 }, { "analysis_explanation": null, "end": 1329, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 1321 }, { "analysis_explanation": null, "end": 1371, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 1363 }, { "analysis_explanation": null, "end": 1413, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 1405 }, { "analysis_explanation": null, "end": 1455, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 1447 }, { "analysis_explanation": null, "end": 1497, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 1489 }, { "analysis_explanation": null, "end": 1539, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 1531 }, { "analysis_explanation": null, "end": 1581, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 1573 }, { "analysis_explanation": null, "end": 1623, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 1615 }, { "analysis_explanation": null, "end": 1665, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 1657 }, { "analysis_explanation": null, "end": 1707, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 1699 }, { "analysis_explanation": null, "end": 1749, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 1741 }, { "analysis_explanation": null, "end": 1791, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 1783 }, { "analysis_explanation": null, "end": 1833, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 1825 }, { "analysis_explanation": null, "end": 1875, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 1867 }, { "analysis_explanation": null, "end": 1917, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 1909 }, { "analysis_explanation": null, "end": 1959, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 1951 }, { "analysis_explanation": null, "end": 2001, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 1993 }, { "analysis_explanation": null, "end": 2043, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 2035 }, { "analysis_explanation": null, "end": 2085, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 2077 }, { "analysis_explanation": null, "end": 2127, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 2119 }, { "analysis_explanation": null, "end": 2169, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 2161 }, { "analysis_explanation": null, "end": 2211, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 2203 }, { "analysis_explanation": null, "end": 2253, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 2245 }, { "analysis_explanation": null, "end": 2295, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 2287 }, { "analysis_explanation": null, "end": 2337, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 2329 }, { "analysis_explanation": null, "end": 2379, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 2371 }, { "analysis_explanation": null, "end": 2421, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 2413 }, { "analysis_explanation": null, "end": 2463, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 2455 }, { "analysis_explanation": null, "end": 2505, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 2497 }, { "analysis_explanation": null, "end": 2547, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 2539 }, { "analysis_explanation": null, "end": 2589, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 2581 }, { "analysis_explanation": null, "end": 2631, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 2623 }, { "analysis_explanation": null, "end": 2673, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 2665 }, { "analysis_explanation": null, "end": 3191, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 3183 }, { "analysis_explanation": null, "end": 3233, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 3225 }, { "analysis_explanation": null, "end": 3275, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 3267 }, { "analysis_explanation": null, "end": 3317, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 3309 }, { "analysis_explanation": null, "end": 3359, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 3351 }, { "analysis_explanation": null, "end": 3401, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 3393 }, { "analysis_explanation": null, "end": 3443, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 3435 }, { "analysis_explanation": null, "end": 3485, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 3477 }, { "analysis_explanation": null, "end": 3527, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 3519 }, { "analysis_explanation": null, "end": 3569, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 3561 }, { "analysis_explanation": null, "end": 3611, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 3603 }, { "analysis_explanation": null, "end": 3653, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 3645 }, { "analysis_explanation": null, "end": 3695, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 3687 }, { "analysis_explanation": null, "end": 3737, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 3729 }, { "analysis_explanation": null, "end": 3779, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 3771 }, { "analysis_explanation": null, "end": 3821, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 3813 }, { "analysis_explanation": null, "end": 3863, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 3855 }, { "analysis_explanation": null, "end": 3905, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 3897 }, { "analysis_explanation": null, "end": 3947, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 3939 }, { "analysis_explanation": null, "end": 3989, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 3981 }, { "analysis_explanation": null, "end": 4031, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 4023 }, { "analysis_explanation": null, "end": 4073, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 4065 }, { "analysis_explanation": null, "end": 4115, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 4107 }, { "analysis_explanation": null, "end": 4157, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 4149 }, { "analysis_explanation": null, "end": 4199, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 4191 }, { "analysis_explanation": null, "end": 4241, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 4233 }, { "analysis_explanation": null, "end": 4283, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 4275 }, { "analysis_explanation": null, "end": 4325, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 4317 }, { "analysis_explanation": null, "end": 4367, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 4359 }, { "analysis_explanation": null, "end": 4409, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 4401 }, { "analysis_explanation": null, "end": 4451, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 4443 }, { "analysis_explanation": null, "end": 4493, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 4485 }, { "analysis_explanation": null, "end": 4535, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 4527 }, { "analysis_explanation": null, "end": 4577, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 4569 }, { "analysis_explanation": null, "end": 4619, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 4611 }, { "analysis_explanation": null, "end": 4661, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 4653 }, { "analysis_explanation": null, "end": 4703, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 4695 }, { "analysis_explanation": null, "end": 4745, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 4737 }, { "analysis_explanation": null, "end": 4787, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 4779 }, { "analysis_explanation": null, "end": 4829, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 4821 }, { "analysis_explanation": null, "end": 4871, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 4863 }, { "analysis_explanation": null, "end": 4913, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 4905 }, { "analysis_explanation": null, "end": 4955, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 4947 }, { "analysis_explanation": null, "end": 4997, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 4989 }, { "analysis_explanation": null, "end": 5039, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 5031 }, { "analysis_explanation": null, "end": 5081, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 5073 }, { "analysis_explanation": null, "end": 5123, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 5115 }, { "analysis_explanation": null, "end": 5165, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 5157 }, { "analysis_explanation": null, "end": 5207, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 5199 }, { "analysis_explanation": null, "end": 5249, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 5241 }, { "analysis_explanation": null, "end": 5291, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 5283 }, { "analysis_explanation": null, "end": 5333, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 5325 }, { "analysis_explanation": null, "end": 5375, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 5367 }, { "analysis_explanation": null, "end": 5417, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 5409 }, { "analysis_explanation": null, "end": 6265, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 6257 }, { "analysis_explanation": null, "end": 6307, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 6299 }, { "analysis_explanation": null, "end": 6349, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 6341 }, { "analysis_explanation": null, "end": 6391, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 6383 }, { "analysis_explanation": null, "end": 6433, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 6425 }, { "analysis_explanation": null, "end": 6475, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 6467 }, { "analysis_explanation": null, "end": 6517, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 6509 }, { "analysis_explanation": null, "end": 6559, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 6551 }, { "analysis_explanation": null, "end": 6601, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 6593 }, { "analysis_explanation": null, "end": 6643, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 6635 }, { "analysis_explanation": null, "end": 6685, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 6677 }, { "analysis_explanation": null, "end": 6727, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 6719 }, { "analysis_explanation": null, "end": 6769, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 6761 }, { "analysis_explanation": null, "end": 6811, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 6803 }, { "analysis_explanation": null, "end": 6853, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 6845 }, { "analysis_explanation": null, "end": 6895, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 6887 }, { "analysis_explanation": null, "end": 6937, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 6929 }, { "analysis_explanation": null, "end": 6979, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 6971 }, { "analysis_explanation": null, "end": 7021, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 7013 }, { "analysis_explanation": null, "end": 7063, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 7055 }, { "analysis_explanation": null, "end": 7105, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 7097 }, { "analysis_explanation": null, "end": 7147, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 7139 }, { "analysis_explanation": null, "end": 7189, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 7181 }, { "analysis_explanation": null, "end": 7231, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 7223 }, { "analysis_explanation": null, "end": 7273, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 7265 }, { "analysis_explanation": null, "end": 7315, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 7307 }, { "analysis_explanation": null, "end": 7357, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 7349 }, { "analysis_explanation": null, "end": 7399, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 7391 }, { "analysis_explanation": null, "end": 7441, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 7433 }, { "analysis_explanation": null, "end": 7483, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 7475 }, { "analysis_explanation": null, "end": 7525, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 7517 }, { "analysis_explanation": null, "end": 7567, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 7559 }, { "analysis_explanation": null, "end": 7609, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 7601 }, { "analysis_explanation": null, "end": 7651, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 7643 }, { "analysis_explanation": null, "end": 7693, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 7685 }, { "analysis_explanation": null, "end": 7735, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 7727 }, { "analysis_explanation": null, "end": 7777, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 7769 }, { "analysis_explanation": null, "end": 7819, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 7811 }, { "analysis_explanation": null, "end": 8708, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 8700 }, { "analysis_explanation": null, "end": 8750, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 8742 }, { "analysis_explanation": null, "end": 8794, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 8786 }, { "analysis_explanation": null, "end": 9715, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 9707 }, { "analysis_explanation": null, "end": 9758, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 9750 }, { "analysis_explanation": null, "end": 9801, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 9793 }, { "analysis_explanation": null, "end": 10903, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 10895 }, { "analysis_explanation": null, "end": 10947, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 10939 }, { "analysis_explanation": null, "end": 10991, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 10983 }, { "analysis_explanation": null, "end": 11034, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 11026 }, { "analysis_explanation": null, "end": 11078, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 11070 }, { "analysis_explanation": null, "end": 11122, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 11114 }, { "analysis_explanation": null, "end": 12560, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 12552 }, { "analysis_explanation": null, "end": 12604, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 12596 }, { "analysis_explanation": null, "end": 12648, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 12640 }, { "analysis_explanation": null, "end": 12692, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 12684 }, { "analysis_explanation": null, "end": 13186, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 13178 }, { "analysis_explanation": null, "end": 13536, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 13528 }, { "analysis_explanation": null, "end": 13580, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 13572 }, { "analysis_explanation": null, "end": 44, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 36 }, { "analysis_explanation": null, "end": 87, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 79 }, { "analysis_explanation": null, "end": 130, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 122 }, { "analysis_explanation": null, "end": 173, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 165 }, { "analysis_explanation": null, "end": 216, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 208 }, { "analysis_explanation": null, "end": 259, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 251 }, { "analysis_explanation": null, "end": 302, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 294 }, { "analysis_explanation": null, "end": 345, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 337 }, { "analysis_explanation": null, "end": 388, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 380 }, { "analysis_explanation": null, "end": 431, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 423 }, { "analysis_explanation": null, "end": 474, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 466 }, { "analysis_explanation": null, "end": 517, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 509 }, { "analysis_explanation": null, "end": 560, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 552 }, { "analysis_explanation": null, "end": 603, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 595 }, { "analysis_explanation": null, "end": 646, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 638 }, { "analysis_explanation": null, "end": 689, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 681 }, { "analysis_explanation": null, "end": 732, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 724 }, { "analysis_explanation": null, "end": 775, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 767 }, { "analysis_explanation": null, "end": 818, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 810 }, { "analysis_explanation": null, "end": 861, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 853 }, { "analysis_explanation": null, "end": 904, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 896 }, { "analysis_explanation": null, "end": 947, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 939 }, { "analysis_explanation": null, "end": 990, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 982 }, { "analysis_explanation": null, "end": 1033, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 1025 }, { "analysis_explanation": null, "end": 1076, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 1068 }, { "analysis_explanation": null, "end": 1119, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 1111 }, { "analysis_explanation": null, "end": 1161, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 1153 }, { "analysis_explanation": null, "end": 1203, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 1195 }, { "analysis_explanation": null, "end": 1245, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 1237 }, { "analysis_explanation": null, "end": 1287, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 1279 }, { "analysis_explanation": null, "end": 1329, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 1321 }, { "analysis_explanation": null, "end": 1371, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 1363 }, { "analysis_explanation": null, "end": 1413, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 1405 }, { "analysis_explanation": null, "end": 1455, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 1447 }, { "analysis_explanation": null, "end": 1497, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 1489 }, { "analysis_explanation": null, "end": 1539, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 1531 }, { "analysis_explanation": null, "end": 1581, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 1573 }, { "analysis_explanation": null, "end": 1623, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 1615 }, { "analysis_explanation": null, "end": 1665, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 1657 }, { "analysis_explanation": null, "end": 1707, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 1699 }, { "analysis_explanation": null, "end": 1749, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 1741 }, { "analysis_explanation": null, "end": 1791, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 1783 }, { "analysis_explanation": null, "end": 1833, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 1825 }, { "analysis_explanation": null, "end": 1875, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 1867 }, { "analysis_explanation": null, "end": 1917, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 1909 }, { "analysis_explanation": null, "end": 1959, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 1951 }, { "analysis_explanation": null, "end": 2001, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 1993 }, { "analysis_explanation": null, "end": 2043, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 2035 }, { "analysis_explanation": null, "end": 2085, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 2077 }, { "analysis_explanation": null, "end": 2127, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 2119 }, { "analysis_explanation": null, "end": 2169, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 2161 }, { "analysis_explanation": null, "end": 2211, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 2203 }, { "analysis_explanation": null, "end": 2253, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 2245 }, { "analysis_explanation": null, "end": 2295, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 2287 }, { "analysis_explanation": null, "end": 2337, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 2329 }, { "analysis_explanation": null, "end": 2379, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 2371 }, { "analysis_explanation": null, "end": 2421, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 2413 }, { "analysis_explanation": null, "end": 2463, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 2455 }, { "analysis_explanation": null, "end": 2505, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 2497 }, { "analysis_explanation": null, "end": 2547, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 2539 }, { "analysis_explanation": null, "end": 2589, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 2581 }, { "analysis_explanation": null, "end": 2631, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 2623 }, { "analysis_explanation": null, "end": 2673, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 2665 }, { "analysis_explanation": null, "end": 3191, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 3183 }, { "analysis_explanation": null, "end": 3233, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 3225 }, { "analysis_explanation": null, "end": 3275, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 3267 }, { "analysis_explanation": null, "end": 3317, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 3309 }, { "analysis_explanation": null, "end": 3359, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 3351 }, { "analysis_explanation": null, "end": 3401, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 3393 }, { "analysis_explanation": null, "end": 3443, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 3435 }, { "analysis_explanation": null, "end": 3485, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 3477 }, { "analysis_explanation": null, "end": 3527, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 3519 }, { "analysis_explanation": null, "end": 3569, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 3561 }, { "analysis_explanation": null, "end": 3611, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 3603 }, { "analysis_explanation": null, "end": 3653, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 3645 }, { "analysis_explanation": null, "end": 3695, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 3687 }, { "analysis_explanation": null, "end": 3737, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 3729 }, { "analysis_explanation": null, "end": 3779, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 3771 }, { "analysis_explanation": null, "end": 3821, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 3813 }, { "analysis_explanation": null, "end": 3863, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 3855 }, { "analysis_explanation": null, "end": 3905, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 3897 }, { "analysis_explanation": null, "end": 3947, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 3939 }, { "analysis_explanation": null, "end": 3989, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 3981 }, { "analysis_explanation": null, "end": 4031, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 4023 }, { "analysis_explanation": null, "end": 4073, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 4065 }, { "analysis_explanation": null, "end": 4115, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 4107 }, { "analysis_explanation": null, "end": 4157, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 4149 }, { "analysis_explanation": null, "end": 4199, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 4191 }, { "analysis_explanation": null, "end": 4241, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 4233 }, { "analysis_explanation": null, "end": 4283, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 4275 }, { "analysis_explanation": null, "end": 4325, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 4317 }, { "analysis_explanation": null, "end": 4367, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 4359 }, { "analysis_explanation": null, "end": 4409, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 4401 }, { "analysis_explanation": null, "end": 4451, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 4443 }, { "analysis_explanation": null, "end": 4493, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 4485 }, { "analysis_explanation": null, "end": 4535, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 4527 }, { "analysis_explanation": null, "end": 4577, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 4569 }, { "analysis_explanation": null, "end": 4619, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 4611 }, { "analysis_explanation": null, "end": 4661, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 4653 }, { "analysis_explanation": null, "end": 4703, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 4695 }, { "analysis_explanation": null, "end": 4745, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 4737 }, { "analysis_explanation": null, "end": 4787, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 4779 }, { "analysis_explanation": null, "end": 4829, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 4821 }, { "analysis_explanation": null, "end": 4871, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 4863 }, { "analysis_explanation": null, "end": 4913, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 4905 }, { "analysis_explanation": null, "end": 4955, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 4947 }, { "analysis_explanation": null, "end": 4997, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 4989 }, { "analysis_explanation": null, "end": 5039, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 5031 }, { "analysis_explanation": null, "end": 5081, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 5073 }, { "analysis_explanation": null, "end": 5123, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 5115 }, { "analysis_explanation": null, "end": 5165, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 5157 }, { "analysis_explanation": null, "end": 5207, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 5199 }, { "analysis_explanation": null, "end": 5249, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 5241 }, { "analysis_explanation": null, "end": 5291, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 5283 }, { "analysis_explanation": null, "end": 5333, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 5325 }, { "analysis_explanation": null, "end": 5375, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 5367 }, { "analysis_explanation": null, "end": 5417, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 5409 }, { "analysis_explanation": null, "end": 6265, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 6257 }, { "analysis_explanation": null, "end": 6307, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 6299 }, { "analysis_explanation": null, "end": 6349, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 6341 }, { "analysis_explanation": null, "end": 6391, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 6383 }, { "analysis_explanation": null, "end": 6433, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 6425 }, { "analysis_explanation": null, "end": 6475, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 6467 }, { "analysis_explanation": null, "end": 6517, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 6509 }, { "analysis_explanation": null, "end": 6559, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 6551 }, { "analysis_explanation": null, "end": 6601, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 6593 }, { "analysis_explanation": null, "end": 6643, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 6635 }, { "analysis_explanation": null, "end": 6685, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 6677 }, { "analysis_explanation": null, "end": 6727, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 6719 }, { "analysis_explanation": null, "end": 6769, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 6761 }, { "analysis_explanation": null, "end": 6811, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 6803 }, { "analysis_explanation": null, "end": 6853, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 6845 }, { "analysis_explanation": null, "end": 6895, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 6887 }, { "analysis_explanation": null, "end": 6937, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 6929 }, { "analysis_explanation": null, "end": 6979, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 6971 }, { "analysis_explanation": null, "end": 7021, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 7013 }, { "analysis_explanation": null, "end": 7063, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 7055 }, { "analysis_explanation": null, "end": 7105, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 7097 }, { "analysis_explanation": null, "end": 7147, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 7139 }, { "analysis_explanation": null, "end": 7189, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 7181 }, { "analysis_explanation": null, "end": 7231, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 7223 }, { "analysis_explanation": null, "end": 7273, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 7265 }, { "analysis_explanation": null, "end": 7315, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 7307 }, { "analysis_explanation": null, "end": 7357, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 7349 }, { "analysis_explanation": null, "end": 7399, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 7391 }, { "analysis_explanation": null, "end": 7441, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 7433 }, { "analysis_explanation": null, "end": 7483, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 7475 }, { "analysis_explanation": null, "end": 7525, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 7517 }, { "analysis_explanation": null, "end": 7567, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 7559 }, { "analysis_explanation": null, "end": 7609, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 7601 }, { "analysis_explanation": null, "end": 7651, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 7643 }, { "analysis_explanation": null, "end": 7693, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 7685 }, { "analysis_explanation": null, "end": 7735, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 7727 }, { "analysis_explanation": null, "end": 7777, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 7769 }, { "analysis_explanation": null, "end": 7819, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 7811 }, { "analysis_explanation": null, "end": 8708, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 8700 }, { "analysis_explanation": null, "end": 8750, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 8742 }, { "analysis_explanation": null, "end": 8794, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 8786 }, { "analysis_explanation": null, "end": 9715, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 9707 }, { "analysis_explanation": null, "end": 9758, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 9750 }, { "analysis_explanation": null, "end": 9801, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 9793 }, { "analysis_explanation": null, "end": 10903, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 10895 }, { "analysis_explanation": null, "end": 10947, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 10939 }, { "analysis_explanation": null, "end": 10991, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 10983 }, { "analysis_explanation": null, "end": 11034, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 11026 }, { "analysis_explanation": null, "end": 11078, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 11070 }, { "analysis_explanation": null, "end": 11122, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 11114 }, { "analysis_explanation": null, "end": 12560, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 12552 }, { "analysis_explanation": null, "end": 12604, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 12596 }, { "analysis_explanation": null, "end": 12648, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 12640 }, { "analysis_explanation": null, "end": 12692, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 12684 }, { "analysis_explanation": null, "end": 13186, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 13178 }, { "analysis_explanation": null, "end": 13536, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 13528 }, { "analysis_explanation": null, "end": 13580, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 13572 } ]

[ "Numa rápida declaração feita ao embarcar para o velório de Eduardo Campos, a presidenciável Marina Silva, que deverá ser candidata pelo PSB, afirmou que a \"providência divina\" a livrou de embarcar no fatídico voo do Rio de Janeiro ao Guarujá, do último dia 13, que caiu em Santos; \"Foi providência divina eu, Renata, Miguel e Molina não estarmos naquele voo\"; declaração revela fé da ex-senadora, mas também acentua traços de messianismo de uma nova candidata que talvez se veja predestinada a ocupar a presidência da República edit\n\n247 - A ex-senadora Marina Silva falou pela primeira vez sobre o porquê de não ter embarcado no fatídico voo que decolou do Rio de Janeiro ao Guarujá, no dia 13, e matou Eduardo Campos. \"", "Foi providência divina eu, Renata, Miguel e Molina não estarmos naquele voo\", disse ela, referindo-se à esposa de Eduardo Campos, Renata, ao filho Miguel, e também ao assessor Rodrigo Molina.", "\n\nA declaração acentua o caráter religioso da ex-senadora Marina Silva, mas também poderá ser interpretada como um traço messiânico de alguém que talvez se sinta predestinada a ocupar a presidência da República. ", "Marina tentou ser candidata pela Rede, mas, como não obteve o registro do partido, acabou se filiando ao PSB, para ser vice de Eduardo Campos. ", "Agora, com a morte do ex-governador pernambucano, ela deverá ser ungida candidata pelos socialistas.", "\n\nNo dia da morte de Eduardo Campos, assessores de Marina Silva afirmaram, em off, que ele não foi ao Guarujá (SP), porque a agenda previa a participação do governador de São Paulo, Geraldo Alckmin, que se aliou ao PSB e recebeu o deputado Márcio França (PSDB-SP) como vice em sua chapa. ", "Ferrenha opositora da aliança com os tucanos, Marina vinha evitando compromissos com a presença de Alckmin.", "\n\nParticipe da campanha de assinaturas solidárias do Brasil 247. ", "Saiba mais." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.020804438280166437, 0.041884816753926704, 0, 0.02097902097902098, 0.02, 0.020833333333333332, 0.009345794392523364, 0.015384615384615385, 0.09090909090909091 ]

[ { "analysis_explanation": null, "end": 28, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12 }, { "analysis_explanation": null, "end": 73, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 32 }, { "analysis_explanation": null, "end": 104, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 92 }, { "analysis_explanation": null, "end": 116, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 110 }, { "analysis_explanation": null, "end": 139, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 121 }, { "analysis_explanation": null, "end": 241, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 216 }, { "analysis_explanation": null, "end": 256, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 246 }, { "analysis_explanation": null, "end": 279, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 273 }, { "analysis_explanation": null, "end": 308, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 298 }, { "analysis_explanation": null, "end": 380, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 360 }, { "analysis_explanation": null, "end": 395, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 381 }, { "analysis_explanation": null, "end": 459, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 445 }, { "analysis_explanation": null, "end": 473, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 464 }, { "analysis_explanation": null, "end": 491, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 479 }, { "analysis_explanation": null, "end": 527, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 503 }, { "analysis_explanation": null, "end": 642, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 578 }, { "analysis_explanation": null, "end": 683, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 658 }, { "analysis_explanation": null, "end": 691, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 688 }, { "analysis_explanation": null, "end": 718, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 704 }, { "analysis_explanation": null, "end": 748, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 738 }, { "analysis_explanation": null, "end": 850, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 826 }, { "analysis_explanation": null, "end": 875, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 863 }, { "analysis_explanation": null, "end": 885, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 879 }, { "analysis_explanation": null, "end": 912, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 898 }, { "analysis_explanation": null, "end": 994, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 984 }, { "analysis_explanation": null, "end": 1046, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1027 }, { "analysis_explanation": null, "end": 1122, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1098 }, { "analysis_explanation": null, "end": 1130, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1124 }, { "analysis_explanation": null, "end": 1156, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1131 }, { "analysis_explanation": null, "end": 1213, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1207 }, { "analysis_explanation": null, "end": 1265, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1248 }, { "analysis_explanation": null, "end": 1366, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1332 }, { "analysis_explanation": null, "end": 1401, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1384 }, { "analysis_explanation": null, "end": 1439, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1424 }, { "analysis_explanation": null, "end": 1475, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1468 }, { "analysis_explanation": null, "end": 1519, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1507 }, { "analysis_explanation": null, "end": 1546, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1537 }, { "analysis_explanation": null, "end": 1563, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1548 }, { "analysis_explanation": null, "end": 1605, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1587 }, { "analysis_explanation": null, "end": 1619, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1606 }, { "analysis_explanation": null, "end": 1675, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1663 }, { "analysis_explanation": null, "end": 1706, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1700 } ]

[ "Q:\n\nAchieving multicolumn like this\n\nI wan to achieve multi-column like shown below:\n\nBut the only thing I can get is:\n\nWith the code below:\n{\\LARGE Albert Einstein}\\\\[1cm]\nInstitute for Advanced Study\\\\ Einstein Drive\\\\ Princeton, N.J. \\texttt{08540}\nU.S.A.\\\\[.2cm]\nPhone: \\texttt{609-734-8000}\\\\ Fax: \\texttt{609-924-8399}\\\\[.2cm]\nemail: \\href{mailto:a.einstein@ias.edu}{a.einstein@ias.edu}\\\\ \\textsc{url}: \\href{http://www.ias.edu/spfeatures/einstein/}{http://www.ias.edu/spfeatures/einstein/}\\\\\n\nWhat should I add to/how should I modify the code to achieve something like the first screenshot?", "\n\nA:\n\nHere's one way to do it. ", "Hopefully, you can modify it to suit your needs.", "\n\\documentclass{article}\n\\usepackage{fixltx2e}\n\\usepackage[colorlinks,urlcolor=blue]{hyperref}\n\\usepackage{fullpage}\n\\usepackage{bbding}\n\\newcommand*\\splitline[3]{%\n \\hbox to.5\\textwidth{#1\\hfil}%\n \\hbox to2em{#2\\hfil}%\n \\hbox{#3}%\n}\n\\begin{document}\n\\noindent{\\Huge Dario Taraborelli}\\\\[2\\baselineskip]\n\\href{http://cress.soc.surrey.ac.uk/}\n {Centre for Research in Social Simulation}\\\\\n\\splitline{Department of Sociology}{\\textsc{t}}{+44 (0)1483 683961}\\\\\n\\splitline{University of Surrey}{\\textsc{f}}{+44 (0)1483 689551}\\\\\n\\splitline{Guldford GU\\textsubscript{2} {}\\textsubscript{7}XH}\n {\\raisebox{-.6ex}{\\Envelope}}\n {\\href{mailto:d.taraborelli@surrey.ac.uk}{d.taraborelli@surrey.ac.uk}}\\\\\n\\splitline{United Kingdom}{@}{\\url{http://nitens.org/taraborelli}}\n\\end{document}\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.009917355371900827, 0, 0, 0.007334963325183374 ]

[ { "analysis_explanation": null, "end": 377, "entity_type": "EMAIL_ADDRESS", "recognition_metadata": { "recognizer_identifier": "EmailRecognizer_139620637004368", "recognizer_name": "EmailRecognizer" }, "score": 1, "start": 359 }, { "analysis_explanation": null, "end": 397, "entity_type": "EMAIL_ADDRESS", "recognition_metadata": { "recognizer_identifier": "EmailRecognizer_139620637004368", "recognizer_name": "EmailRecognizer" }, "score": 1, "start": 377 }, { "analysis_explanation": null, "end": 1385, "entity_type": "EMAIL_ADDRESS", "recognition_metadata": { "recognizer_identifier": "EmailRecognizer_139620637004368", "recognizer_name": "EmailRecognizer" }, "score": 1, "start": 1359 }, { "analysis_explanation": null, "end": 1413, "entity_type": "EMAIL_ADDRESS", "recognition_metadata": { "recognizer_identifier": "EmailRecognizer_139620637004368", "recognizer_name": "EmailRecognizer" }, "score": 1, "start": 1385 }, { "analysis_explanation": null, "end": 506, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.95, "start": 423 }, { "analysis_explanation": null, "end": 172, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 149 }, { "analysis_explanation": null, "end": 225, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 206 }, { "analysis_explanation": null, "end": 234, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 225 }, { "analysis_explanation": null, "end": 240, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 236 }, { "analysis_explanation": null, "end": 728, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 708 }, { "analysis_explanation": null, "end": 1045, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 971 }, { "analysis_explanation": null, "end": 1150, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1124 }, { "analysis_explanation": null, "end": 298, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.75, "start": 286 }, { "analysis_explanation": null, "end": 1045, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 1014 }, { "analysis_explanation": null, "end": 1484, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 1453 }, { "analysis_explanation": null, "end": 377, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 370 }, { "analysis_explanation": null, "end": 397, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 390 }, { "analysis_explanation": null, "end": 1385, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 1373 }, { "analysis_explanation": null, "end": 1413, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 1401 }, { "analysis_explanation": null, "end": 329, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 317 }, { "analysis_explanation": null, "end": 1165, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 1147 }, { "analysis_explanation": null, "end": 1232, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 1214 }, { "analysis_explanation": null, "end": 1165, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 1159 }, { "analysis_explanation": null, "end": 1232, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 1226 } ]

[ "Q:\n\nConnecting Azure Linux VM having Ubuntu installed from powershell throwing Host Verification failed. . . ", "error\n\nI tried to connect to Azure Linux VM where Ubuntu installed from https://shell.azure.com/bash \nssh username@ipaddress\n\nabove command is throwing error as Permission Denied (publickey) .", "\n\nI have created SSH public key and added it to VM while creating Azure Linux VM following below article.", "\nhttps://docs.microsoft.com/en-us/azure/virtual-machines/linux/quick-create-portal\nBut still facing Permission Denied issue.", "\nAlso, I tried to run bolt command on Azure Linux VM remotely from another windows machine powershell. ", "\nI got error as below\n\nHost key verification failed for '10.20.30.40':fingerprint\n SHA256:mssgkeghbfnb9883yygebwndjhk is unknown for '10.20.30.40'\n\nHow to fix above issues. ", "Kindly suggest.", "\n\nA:\n\nPermission denied (publickey) means that your public key is not in the authorized_keys file. ", "Copy the public key manually to that user's ~/.ssh/authorized_keys file, or use ssh-copy-id which comes with OpenSSH.", "\nAlso, make sure you're SSH'ing to the right user with ssh user@host\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.009174311926605505, 0.010416666666666666, 0.009523809523809525, 0.008064516129032258, 0.009708737864077669, 0, 0, 0.010101010101010102, 0.008547008547008548, 0 ]

[ { "analysis_explanation": null, "end": 152, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 138 }, { "analysis_explanation": null, "end": 581, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 567 }, { "analysis_explanation": null, "end": 783, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 765 }, { "analysis_explanation": null, "end": 209, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 181 }, { "analysis_explanation": null, "end": 487, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 406 }, { "analysis_explanation": null, "end": 699, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 688 }, { "analysis_explanation": null, "end": 777, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 766 } ]

[ "Q:\n\nAccess attrs in AngularJS directive templateUrl\n\nI have a problem as I don't understand AngularJS directives 100% yet. ", "I have a directive like so,\nin my HTML: \n<div my-directive=\"Hello World\"></div>\n\nin my Directive JS file:\n.directive('myDirective', [function ( ) {\n return {\n restrict: 'A',\n priority: 100,\n templateUrl: 'views/templates/my-directive.html',\n link: function (scope, element, attrs) {\n // I wish to pass attrs.myDirective to the templateUrl\n }\n };\n }]);\n\nand in my templateUrl 'views/templates/my-directive.html':\n<h1> {{ attrs.myDirective }} </h1>\n\nObviously this does work, my directive value is passed to the link function but not to the templateUrl, how can I output the value in my templateUrl? ", "Silly question I know but I'm not sure what the best way to implement this is?", "\n\nA:\n\nYou can simply assigned this value to scope variable.", "\n scope.myDirective=attrs.myDirective\n\napp.directive('myDirective', [function ( ) {\n return {\n restrict: 'A',\n priority: 100,\n templateUrl: 'my-directive.html',\n link: function (scope, element, attrs) {\n scope.myDirective=attrs.myDirective\n // I wish to pass attrs.myDirective to the templateUrl\n }\n };\n }]);\n\nPlunker\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0, 0, 0, 0, 0 ]

[ { "analysis_explanation": null, "end": 399, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.85, "start": 384 }, { "analysis_explanation": null, "end": 617, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.85, "start": 602 }, { "analysis_explanation": null, "end": 1139, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.85, "start": 1124 }, { "analysis_explanation": null, "end": 499, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 491 }, { "analysis_explanation": null, "end": 638, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 630 }, { "analysis_explanation": null, "end": 953, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 945 }, { "analysis_explanation": null, "end": 971, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 963 }, { "analysis_explanation": null, "end": 1219, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 1211 }, { "analysis_explanation": null, "end": 1237, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 1229 }, { "analysis_explanation": null, "end": 1289, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 1281 } ]

[ "Q:\n\nHand strain when off road\n\nI tried fat biking this week, I've done hardly any off road or MTB cycling before and was very nervous.", "\nI found keeping my hands over the brakes in case I had to stop suddenly strained my hands between thumb and first finger, especially as the ground was very rocky.", "\nIs this just something your body gets used to or are there techniques I can improve here?", "\n\nA:\n\nAlong with checking position on the bike it's worth checking to see whether the reach can be adjusted on your brakes in case you're over-stretching your hand. ", "Check the angle too - stand behind the bike and reach the bar, extend your fingers straight forward following the line of your arm and adjust the lever to meet under your finger(s).", "\n\nA:\n\nHaving recently spent a day MTBing when it's not something I've done before, I'd say most of it is unfamiliar use of muscles (plus you're holding on tighter than you need to). ", " If you start riding like this regularly, it will get better as your skills improve and as your muscles get used to it (it's not that they're weak but using the strength in that position is new. ", " As your confidence builds, the white-knuckle muscles won't be locked off so hard.", "\nThere's bound to be room to optimise your setup as well. ", "adjusting the brake rest position may be an option depending on the brake type. ", "Some people like ergonomic grips, some don't, and if you've got small hands this may not be an option unless you can adjust the brake levers\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0 ]

[ { "analysis_explanation": null, "end": 59, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 50 }, { "analysis_explanation": null, "end": 764, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 759 } ]

[ "Conference call.", "\nThe RCN paediatric emergency care group is holding a conference on May 24 in Leeds. ", "Topics include international disaster response, fever management, sports injury management and mental health assessment. ", "For details, contact janet.youd@cht.nhs.uk." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0, 0.011764705882352941, 0, 0.023255813953488372 ]

[ { "analysis_explanation": null, "end": 264, "entity_type": "EMAIL_ADDRESS", "recognition_metadata": { "recognizer_identifier": "EmailRecognizer_139620637004368", "recognizer_name": "EmailRecognizer" }, "score": 1, "start": 243 }, { "analysis_explanation": null, "end": 90, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 84 }, { "analysis_explanation": null, "end": 99, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 94 }, { "analysis_explanation": null, "end": 264, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 254 } ]

[ "// Copyright 2011 The Go Authors. ", "All rights reserved.", "\n// Use of this source code is governed by a BSD-style\n// license that can be found in the LICENSE file.", "\n\n// Package openpgp implements high level operations on OpenPGP messages.", "\npackage openpgp // import \"golang.org/x/crypto/openpgp\"\n\nimport (\n\t\"crypto\"\n\t_ \"crypto/sha256\"\n\t\"hash\"\n\t\"io\"\n\t\"strconv\"\n\n\t\"golang.org/x/crypto/openpgp/armor\"\n\t\"golang.org/x/crypto/openpgp/errors\"\n\t\"golang.org/x/crypto/openpgp/packet\"\n)\n\n// SignatureType is the armor type for a PGP signature.", "\nvar SignatureType = \"PGP SIGNATURE\"\n\n// readArmored reads an armored block with the given type.", "\nfunc readArmored(r io.", "Reader, expectedType string) (body io.", "Reader, err error) {\n\tblock, err := armor.", "Decode(r)\n\tif err !", "= nil {\n\t\treturn\n\t}\n\n\tif block.", "Type !", "= expectedType {\n\t\treturn nil, errors.", "InvalidArgumentError(\"expected '\" + expectedType + \"', got: \" + block.", "Type)\n\t}\n\n\treturn block.", "Body, nil\n}\n\n// MessageDetails contains the result of parsing an OpenPGP encrypted and/or\n// signed message.", "\ntype MessageDetails struct {\n\tIsEncrypted bool // true if the message was encrypted.", "\n\tEncryptedToKeyIds []uint64 // the list of recipient key ids.", "\n\tIsSymmetricallyEncrypted bool // true if a passphrase could have decrypted the message.", "\n\tDecryptedWith Key // the private key used to decrypt the message, if any.", "\n\tIsSigned bool // true if the message is signed.", "\n\tSignedByKeyId uint64 // the key id of the signer, if any.", "\n\tSignedBy *Key // the key of the signer, if available.", "\n\tLiteralData *packet.", "LiteralData // the metadata of the contents\n\tUnverifiedBody io.", "Reader // the contents of the message.", "\n\n\t// If IsSigned is true and SignedBy is non-zero then the signature will\n\t// be verified as UnverifiedBody is read. ", "The signature cannot be\n\t// checked until the whole of UnverifiedBody is read so UnverifiedBody\n\t// must be consumed until EOF before the data can be trusted. ", "Even if a\n\t// message isn't signed (or the signer is unknown) the data may contain\n\t// an authentication code that is only checked once UnverifiedBody has\n\t// been consumed. ", "Once EOF has been seen, the following fields are\n\t// valid. (", "An authentication code failure is reported as a\n\t// SignatureError error when reading from UnverifiedBody.)", "\n\tSignatureError error // nil if the signature is good.", "\n\tSignature *packet.", "Signature // the signature packet itself, if v4 (default)\n\tSignatureV3 *packet.", "SignatureV3 // the signature packet if it is a v2 or v3 signature\n\n\tdecrypted io.", "ReadCloser\n}\n\n// A PromptFunction is used as a callback by functions that may need to decrypt\n// a private key, or prompt for a passphrase. ", "It is called with a list of\n// acceptable, encrypted private keys and a boolean that indicates whether a\n// passphrase is usable. ", "It should either decrypt a private key or return a\n// passphrase to try. ", "If the decrypted private key or given passphrase isn't\n// correct, the function will be called again, forever. ", "Any error returned will\n// be passed up.", "\ntype PromptFunction func(keys []Key, symmetric bool) ([]byte, error)\n\n// A keyEnvelopePair is used to store a private key with the envelope that\n// contains a symmetric key, encrypted with that key.", "\ntype keyEnvelopePair struct {\n\tkey Key\n\tencryptedKey *packet.", "EncryptedKey\n}\n\n// ReadMessage parses an OpenPGP message that may be signed and/or encrypted.", "\n// The given KeyRing should contain both public keys (for signature\n// verification) and, possibly encrypted, private keys for decrypting.", "\n// If config is nil, sensible defaults will be used.", "\nfunc ReadMessage(r io.", "Reader, keyring KeyRing, prompt PromptFunction, config *packet.", "Config) (md *MessageDetails, err error) {\n\tvar p packet.", "Packet\n\n\tvar symKeys []*packet.", "SymmetricKeyEncrypted\n\tvar pubKeys []keyEnvelopePair\n\tvar se *packet.", "SymmetricallyEncrypted\n\n\tpackets := packet.", "NewReader(r)\n\tmd = new(MessageDetails)\n\tmd.", "IsEncrypted = true\n\n\t// The message, if encrypted, starts with a number of packets\n\t// containing an encrypted decryption key. ", "The decryption key is either\n\t// encrypted to a public key, or with a passphrase. ", "This loop\n\t// collects these packets.", "\nParsePackets:\n\tfor {\n\t\tp, err = packets.", "Next()\n\t\tif err !", "= nil {\n\t\t\treturn nil, err\n\t\t}\n\t\tswitch p := p.(type) {\n\t\tcase *packet.", "SymmetricKeyEncrypted:\n\t\t\t// This packet contains the decryption key encrypted with a passphrase.", "\n\t\t\tmd.", "IsSymmetricallyEncrypted = true\n\t\t\tsymKeys = append(symKeys, p)\n\t\tcase *packet.", "EncryptedKey:\n\t\t\t// This packet contains the decryption key encrypted to a public key.", "\n\t\t\tmd.", "EncryptedToKeyIds = append(md.", "EncryptedToKeyIds, p.KeyId)\n\t\t\tswitch p.Algo {\n\t\t\tcase packet.", "PubKeyAlgoRSA, packet.", "PubKeyAlgoRSAEncryptOnly, packet.", "PubKeyAlgoElGamal:\n\t\t\t\tbreak\n\t\t\tdefault:\n\t\t\t\tcontinue\n\t\t\t}\n\t\t\tvar keys []Key\n\t\t\tif p.KeyId == 0 {\n\t\t\t\tkeys = keyring.", "DecryptionKeys()\n\t\t\t} else {\n\t\t\t\tkeys = keyring.", "KeysById(p.", "KeyId)\n\t\t\t}\n\t\t\tfor _, k := range keys {\n\t\t\t\tpubKeys = append(pubKeys, keyEnvelopePair{k, p})\n\t\t\t}\n\t\tcase *packet.", "SymmetricallyEncrypted:\n\t\t\tse = p\n\t\t\tbreak ParsePackets\n\t\tcase *packet.", "Compressed, *packet.", "LiteralData, *packet.", "OnePassSignature:\n\t\t\t// This message isn't encrypted.", "\n\t\t\tif len(symKeys) !", "= 0 || len(pubKeys) !", "= 0 {\n\t\t\t\treturn nil, errors.", "StructuralError(\"key material not followed by encrypted message\")\n\t\t\t}\n\t\t\tpackets.", "Unread(p)\n\t\t\treturn readSignedMessage(packets, nil, keyring)\n\t\t}\n\t}\n\n\tvar candidates []Key\n\tvar decrypted io.", "ReadCloser\n\n\t// Now that we have the list of encrypted keys we need to decrypt at\n\t// least one of them or, if we cannot, we need to call the prompt\n\t// function so that it can decrypt a key or give us a passphrase.", "\nFindKey:\n\tfor {\n\t\t// See if any of the keys already have a private key available\n\t\tcandidates = candidates[:0]\n\t\tcandidateFingerprints := make(map[string]bool)\n\n\t\tfor _, pk := range pubKeys {\n\t\t\tif pk.key.", "PrivateKey == nil {\n\t\t\t\tcontinue\n\t\t\t}\n\t\t\tif !", "pk.key.", "PrivateKey.", "Encrypted {\n\t\t\t\tif len(pk.encryptedKey.", "Key) == 0 {\n\t\t\t\t\tpk.encryptedKey.", "Decrypt(pk.key.", "PrivateKey, config)\n\t\t\t\t}\n\t\t\t\tif len(pk.encryptedKey.", "Key) == 0 {\n\t\t\t\t\tcontinue\n\t\t\t\t}\n\t\t\t\tdecrypted, err = se.", "Decrypt(pk.encryptedKey.", "CipherFunc, pk.encryptedKey.", "Key)\n\t\t\t\tif err !", "= nil && err !", "= errors.", "ErrKeyIncorrect {\n\t\t\t\t\treturn nil, err\n\t\t\t\t}\n\t\t\t\tif decrypted !", "= nil {\n\t\t\t\t\tmd.", "DecryptedWith = pk.key\n\t\t\t\t\tbreak FindKey\n\t\t\t\t}\n\t\t\t} else {\n\t\t\t\tfpr := string(pk.key.", "PublicKey.", "Fingerprint[:])\n\t\t\t\tif v := candidateFingerprints[fpr]; v {\n\t\t\t\t\tcontinue\n\t\t\t\t}\n\t\t\t\tcandidates = append(candidates, pk.key)\n\t\t\t\tcandidateFingerprints[fpr] = true\n\t\t\t}\n\t\t}\n\n\t\tif len(candidates) == 0 && len(symKeys) == 0 {\n\t\t\treturn nil, errors.", "ErrKeyIncorrect\n\t\t}\n\n\t\tif prompt == nil {\n\t\t\treturn nil, errors.", "ErrKeyIncorrect\n\t\t}\n\n\t\tpassphrase, err := prompt(candidates, len(symKeys) !", "= 0)\n\t\tif err !", "= nil {\n\t\t\treturn nil, err\n\t\t}\n\n\t\t// Try the symmetric passphrase first\n\t\tif len(symKeys) !", "= 0 && passphrase !", "= nil {\n\t\t\tfor _, s := range symKeys {\n\t\t\t\tkey, cipherFunc, err := s.Decrypt(passphrase)\n\t\t\t\tif err == nil {\n\t\t\t\t\tdecrypted, err = se.", "Decrypt(cipherFunc, key)\n\t\t\t\t\tif err !", "= nil && err !", "= errors.", "ErrKeyIncorrect {\n\t\t\t\t\t\treturn nil, err\n\t\t\t\t\t}\n\t\t\t\t\tif decrypted !", "= nil {\n\t\t\t\t\t\tbreak FindKey\n\t\t\t\t\t}\n\t\t\t\t}\n\n\t\t\t}\n\t\t}\n\t}\n\n\tmd.decrypted = decrypted\n\tif err := packets.", "Push(decrypted); err !", "= nil {\n\t\treturn nil, err\n\t}\n\treturn readSignedMessage(packets, md, keyring)\n}\n\n// readSignedMessage reads a possibly signed message if mdin is non-zero then\n// that structure is updated and returned. ", "Otherwise a fresh MessageDetails is\n// used.", "\nfunc readSignedMessage(packets *packet.", "Reader, mdin *MessageDetails, keyring KeyRing) (md *MessageDetails, err error) {\n\tif mdin == nil {\n\t\tmdin = new(MessageDetails)\n\t}\n\tmd = mdin\n\n\tvar p packet.", "Packet\n\tvar h hash.", "Hash\n\tvar wrappedHash hash.", "Hash\nFindLiteralData:\n\tfor {\n\t\tp, err = packets.", "Next()\n\t\tif err !", "= nil {\n\t\t\treturn nil, err\n\t\t}\n\t\tswitch p := p.(type) {\n\t\tcase *packet.", "Compressed:\n\t\t\tif err := packets.", "Push(p.", "Body); err !", "= nil {\n\t\t\t\treturn nil, err\n\t\t\t}\n\t\tcase *packet.", "OnePassSignature:\n\t\t\tif !", "p.IsLast {\n\t\t\t\treturn nil, errors.", "UnsupportedError(\"nested signatures\")\n\t\t\t}\n\n\t\t\th, wrappedHash, err = hashForSignature(p.", "Hash, p.SigType)\n\t\t\tif err !", "= nil {\n\t\t\t\tmd = nil\n\t\t\t\treturn\n\t\t\t}\n\n\t\t\tmd.", "IsSigned = true\n\t\t\tmd.", "SignedByKeyId = p.KeyId\n\t\t\tkeys := keyring.", "KeysByIdUsage(p.", "KeyId, packet.", "KeyFlagSign)\n\t\t\tif len(keys) > 0 {\n\t\t\t\tmd.", "SignedBy = &keys[0]\n\t\t\t}\n\t\tcase *packet.", "LiteralData:\n\t\t\tmd.", "LiteralData = p\n\t\t\tbreak FindLiteralData\n\t\t}\n\t}\n\n\tif md.", "SignedBy !", "= nil {\n\t\tmd.", "UnverifiedBody = &signatureCheckReader{packets, h, wrappedHash, md}\n\t} else if md.decrypted !", "= nil {\n\t\tmd.", "UnverifiedBody = checkReader{md}\n\t} else {\n\t\tmd.", "UnverifiedBody = md.", "LiteralData.", "Body\n\t}\n\n\treturn md, nil\n}\n\n// hashForSignature returns a pair of hashes that can be used to verify a\n// signature. ", "The signature may specify that the contents of the signed message\n// should be preprocessed (i.e. to normalize line endings). ", "Thus this function\n// returns two hashes. ", "The second should be used to hash the message itself and\n// performs any needed preprocessing.", "\nfunc hashForSignature(hashId crypto.", "Hash, sigType packet.", "SignatureType) (hash.", "Hash, hash.", "Hash, error) {\n\tif !", "hashId.", "Available() {\n\t\treturn nil, nil, errors.", "UnsupportedError(\"hash not available: \" + strconv.", "Itoa(int(hashId)))\n\t}\n\th := hashId.", "New()\n\n\tswitch sigType {\n\tcase packet.", "SigTypeBinary:\n\t\treturn h, h, nil\n\tcase packet.", "SigTypeText:\n\t\treturn h, NewCanonicalTextHash(h), nil\n\t}\n\n\treturn nil, nil, errors.", "UnsupportedError(\"unsupported signature type: \" + strconv.", "Itoa(int(sigType)))\n}\n\n// checkReader wraps an io.", "Reader from a LiteralData packet. ", "When it sees EOF\n// it closes the ReadCloser from any SymmetricallyEncrypted packet to trigger\n// MDC checks.", "\ntype checkReader struct {\n\tmd *MessageDetails\n}\n\nfunc (cr checkReader) Read(buf []byte) (n int, err error) {\n\tn, err = cr.md.", "LiteralData.", "Body.", "Read(buf)\n\tif err == io.", "EOF {\n\t\tmdcErr := cr.md.decrypted.", "Close()\n\t\tif mdcErr !", "= nil {\n\t\t\terr = mdcErr\n\t\t}\n\t}\n\treturn\n}\n\n// signatureCheckReader wraps an io.", "Reader from a LiteralData packet and hashes\n// the data as it is read. ", "When it sees an EOF from the underlying io.", "Reader\n// it parses and checks a trailing Signature packet and triggers any MDC checks.", "\ntype signatureCheckReader struct {\n\tpackets *packet.", "Reader\n\th, wrappedHash hash.", "Hash\n\tmd *MessageDetails\n}\n\nfunc (scr *signatureCheckReader) Read(buf []byte) (n int, err error) {\n\tn, err = scr.md.", "LiteralData.", "Body.", "Read(buf)\n\tscr.wrappedHash.", "Write(buf[:n])\n\tif err == io.", "EOF {\n\t\tvar p packet.", "Packet\n\t\tp, scr.md.", "SignatureError = scr.packets.", "Next()\n\t\tif scr.md.", "SignatureError !", "= nil {\n\t\t\treturn\n\t\t}\n\n\t\tvar ok bool\n\t\tif scr.md.", "Signature, ok = p.(*packet.", "Signature); ok {\n\t\t\tscr.md.", "SignatureError = scr.md.", "SignedBy.", "PublicKey.", "VerifySignature(scr.h, scr.md.", "Signature)\n\t\t} else if scr.md.", "SignatureV3, ok = p.(*packet.", "SignatureV3); ok {\n\t\t\tscr.md.", "SignatureError = scr.md.", "SignedBy.", "PublicKey.", "VerifySignatureV3(scr.h, scr.md.", "SignatureV3)\n\t\t} else {\n\t\t\tscr.md.", "SignatureError = errors.", "StructuralError(\"LiteralData not followed by Signature\")\n\t\t\treturn\n\t\t}\n\n\t\t// The SymmetricallyEncrypted packet, if any, might have an\n\t\t// unsigned hash of its own. ", "In order to check this we need to\n\t\t// close that Reader.", "\n\t\tif scr.md.decrypted !", "= nil {\n\t\t\tmdcErr := scr.md.decrypted.", "Close()\n\t\t\tif mdcErr !", "= nil {\n\t\t\t\terr = mdcErr\n\t\t\t}\n\t\t}\n\t}\n\treturn\n}\n\n// CheckDetachedSignature takes a signed file and a detached signature and\n// returns the signer if the signature is valid. ", "If the signer isn't known,\n// ErrUnknownIssuer is returned.", "\nfunc CheckDetachedSignature(keyring KeyRing, signed, signature io.", "Reader) (signer *Entity, err error) {\n\tvar issuerKeyId uint64\n\tvar hashFunc crypto.", "Hash\n\tvar sigType packet.", "SignatureType\n\tvar keys []Key\n\tvar p packet.", "Packet\n\n\tpackets := packet.", "NewReader(signature)\n\tfor {\n\t\tp, err = packets.", "Next()\n\t\tif err == io.", "EOF {\n\t\t\treturn nil, errors.", "ErrUnknownIssuer\n\t\t}\n\t\tif err !", "= nil {\n\t\t\treturn nil, err\n\t\t}\n\n\t\tswitch sig := p.(type) {\n\t\tcase *packet.", "Signature:\n\t\t\tif sig.", "IssuerKeyId == nil {\n\t\t\t\treturn nil, errors.", "StructuralError(\"signature doesn't have an issuer\")\n\t\t\t}\n\t\t\tissuerKeyId = *sig.", "IssuerKeyId\n\t\t\thashFunc = sig.", "Hash\n\t\t\tsigType = sig.", "SigType\n\t\tcase *packet.", "SignatureV3:\n\t\t\tissuerKeyId = sig.", "IssuerKeyId\n\t\t\thashFunc = sig.", "Hash\n\t\t\tsigType = sig.", "SigType\n\t\tdefault:\n\t\t\treturn nil, errors.", "StructuralError(\"non signature packet found\")\n\t\t}\n\n\t\tkeys = keyring.", "KeysByIdUsage(issuerKeyId, packet.", "KeyFlagSign)\n\t\tif len(keys) > 0 {\n\t\t\tbreak\n\t\t}\n\t}\n\n\tif len(keys) == 0 {\n\t\tpanic(\"unreachable\")\n\t}\n\n\th, wrappedHash, err := hashForSignature(hashFunc, sigType)\n\tif err !", "= nil {\n\t\treturn nil, err\n\t}\n\n\tif _, err := io.", "Copy(wrappedHash, signed); err !", "= nil && err !", "= io.", "EOF {\n\t\treturn nil, err\n\t}\n\n\tfor _, key := range keys {\n\t\tswitch sig := p.(type) {\n\t\tcase *packet.", "Signature:\n\t\t\terr = key.", "PublicKey.", "VerifySignature(h, sig)\n\t\tcase *packet.", "SignatureV3:\n\t\t\terr = key.", "PublicKey.", "VerifySignatureV3(h, sig)\n\t\tdefault:\n\t\t\tpanic(\"unreachable\")\n\t\t}\n\n\t\tif err == nil {\n\t\t\treturn key.", "Entity, nil\n\t\t}\n\t}\n\n\treturn nil, err\n}\n\n// CheckArmoredDetachedSignature performs the same actions as\n// CheckDetachedSignature but expects the signature to be armored.", "\nfunc CheckArmoredDetachedSignature(keyring KeyRing, signed, signature io.", "Reader) (signer *Entity, err error) {\n\tbody, err := readArmored(signature, SignatureType)\n\tif err !", "= nil {\n\t\treturn\n\t}\n\n\treturn CheckDetachedSignature(keyring, signed, body)\n}\n" ]

{ "pile_set_name": "Github" }

[ 0, 0, 0.019230769230769232, 0, 0.010238907849829351, 0.010416666666666666, 0.043478260869565216, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.0136986301369863, 0, 0.01694915254237288, 0.006289308176100629, 0, 0, 0.009345794392523364, 0, 0, 0, 0, 0.014285714285714285, 0, 0, 0, 0, 0, 0, 0.021505376344086023, 0.007194244604316547, 0, 0, 0.015873015873015872, 0.017857142857142856, 0.03225806451612903, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.011627906976744186, 0, 0, 0.016129032258064516, 0, 0, 0.008547008547008548, 0, 0, 0, 0.014084507042253521, 0, 0.047619047619047616, 0, 0, 0, 0, 0, 0.009174311926605505, 0.004651162790697674, 0.009708737864077669, 0.022222222222222223, 0, 0.09090909090909091, 0, 0, 0, 0.018867924528301886, 0, 0, 0.03571428571428571, 0, 0.07142857142857142, 0, 0, 0, 0.023529411764705882, 0.1, 0.00411522633744856, 0, 0, 0, 0, 0.05263157894736842, 0, 0, 0.07142857142857142, 0, 0, 0, 0, 0.004975124378109453, 0, 0, 0.006369426751592357, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.03571428571428571, 0, 0, 0.023255813953488372, 0, 0.07142857142857142, 0, 0.025, 0.05263157894736842, 0.017857142857142856, 0.1, 0, 0.010752688172043012, 0, 0, 0, 0.08333333333333333, 0, 0, 0, 0, 0, 0, 0.047619047619047616, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.029411764705882353, 0, 0, 0.08333333333333333, 0, 0, 0.029411764705882353, 0, 0, 0.014084507042253521, 0.023255813953488372, 0, 0, 0, 0, 0.08333333333333333, 0, 0, 0, 0.047619047619047616, 0.05263157894736842, 0, 0.05263157894736842, 0, 0.02040816326530612, 0, 0, 0, 0.1111111111111111, 0.1, 0.03333333333333333, 0, 0, 0, 0, 0.1111111111111111, 0.1, 0.0625, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.014925373134328358, 0, 0, 0.022727272727272728, 0, 0, 0, 0.03571428571428571, 0, 0, 0, 0, 0, 0, 0, 0.043478260869565216, 0, 0, 0, 0.024390243902439025, 0, 0.029411764705882353, 0.005952380952380952, 0.02127659574468085, 0.03125, 0.07142857142857142, 0, 0.02040816326530612, 0, 0.1, 0.02564102564102564, 0, 0.1, 0, 0.005952380952380952, 0.013513513513513514, 0.010101010101010102, 0 ]

[ { "analysis_explanation": null, "end": 17, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13 }, { "analysis_explanation": null, "end": 221, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 214 }, { "analysis_explanation": null, "end": 1535, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1529 }, { "analysis_explanation": null, "end": 1842, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1834 }, { "analysis_explanation": null, "end": 3920, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3909 }, { "analysis_explanation": null, "end": 3992, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3969 }, { "analysis_explanation": null, "end": 4569, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4566 }, { "analysis_explanation": null, "end": 4740, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4737 }, { "analysis_explanation": null, "end": 4770, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4759 }, { "analysis_explanation": null, "end": 7247, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7229 }, { "analysis_explanation": null, "end": 7550, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7548 }, { "analysis_explanation": null, "end": 7624, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7620 }, { "analysis_explanation": null, "end": 7957, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7948 }, { "analysis_explanation": null, "end": 8253, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8247 }, { "analysis_explanation": null, "end": 8451, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8443 }, { "analysis_explanation": null, "end": 8464, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8462 }, { "analysis_explanation": null, "end": 8774, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8724 }, { "analysis_explanation": null, "end": 8798, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8792 }, { "analysis_explanation": null, "end": 8867, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8832 }, { "analysis_explanation": null, "end": 8899, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8881 }, { "analysis_explanation": null, "end": 8938, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8936 }, { "analysis_explanation": null, "end": 9418, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9412 }, { "analysis_explanation": null, "end": 9615, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9614 }, { "analysis_explanation": null, "end": 10551, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10542 }, { "analysis_explanation": null, "end": 11059, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11038 }, { "analysis_explanation": null, "end": 12494, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12473 }, { "analysis_explanation": null, "end": 12607, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12586 }, { "analysis_explanation": null, "end": 12745, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12720 }, { "analysis_explanation": null, "end": 13557, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13512 }, { "analysis_explanation": null, "end": 287, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 259 }, { "analysis_explanation": null, "end": 389, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 355 }, { "analysis_explanation": null, "end": 427, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 392 }, { "analysis_explanation": null, "end": 465, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 430 }, { "analysis_explanation": null, "end": 4795, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 4791 }, { "analysis_explanation": null, "end": 4814, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 4810 }, { "analysis_explanation": null, "end": 4979, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 4975 }, { "analysis_explanation": null, "end": 6036, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 6031 }, { "analysis_explanation": null, "end": 6090, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 6085 }, { "analysis_explanation": null, "end": 6192, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 6187 }, { "analysis_explanation": null, "end": 6505, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 6500 }, { "analysis_explanation": null, "end": 6567, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 6562 }, { "analysis_explanation": null, "end": 6702, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 6697 }, { "analysis_explanation": null, "end": 7165, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 7161 }, { "analysis_explanation": null, "end": 7421, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 7416 }, { "analysis_explanation": null, "end": 8249, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 8245 }, { "analysis_explanation": null, "end": 8379, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 8375 }, { "analysis_explanation": null, "end": 8486, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 8482 }, { "analysis_explanation": null, "end": 8812, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 8807 }, { "analysis_explanation": null, "end": 10097, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 10092 }, { "analysis_explanation": null, "end": 10169, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 10161 }, { "analysis_explanation": null, "end": 10698, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 10692 }, { "analysis_explanation": null, "end": 10817, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 10811 }, { "analysis_explanation": null, "end": 10842, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 10836 }, { "analysis_explanation": null, "end": 10867, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 10861 }, { "analysis_explanation": null, "end": 10934, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 10928 }, { "analysis_explanation": null, "end": 10990, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 10984 }, { "analysis_explanation": null, "end": 11015, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 11009 }, { "analysis_explanation": null, "end": 11067, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 11061 }, { "analysis_explanation": null, "end": 11098, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 11092 }, { "analysis_explanation": null, "end": 11158, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 11152 }, { "analysis_explanation": null, "end": 11183, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 11177 }, { "analysis_explanation": null, "end": 11237, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 11231 }, { "analysis_explanation": null, "end": 11272, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 11266 }, { "analysis_explanation": null, "end": 11534, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 11525 }, { "analysis_explanation": null, "end": 11574, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 11565 } ]

[ "Q:\n\nQuote issues reading properties file using fmt:message in JavaScript\n\nI'm using reading text from properties file. ", "But when I'm using it in JavaScript like this:\nalert('<fmt:message key=\"mykey\" />');\n\nIf there's single quote defined in properties file for this key, there will be an error. ", "If I change the single quotes to double quotes, the error will occur if double quotes defined in properties file.", "\nAny ideas?", "\n\nA:\n\nYou could use the same technique as handlebars: put your messages in <script> tags:\n<script type=\"text/fmt\" id=\"mykey\"><fmt:message key=\"mykey\" /></script>\n\nthen:\nalert(document.getElementById(\"mykey\").innerHTML);\n\nOr, if you're using jQuery:\nalert($(\"#mykey\").text());\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.008333333333333333, 0.005714285714285714, 0, 0, 0.0036101083032490976 ]

[ { "analysis_explanation": null, "end": 604, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 593 } ]

[ "1. ", "Technical Field\nThe present invention relates to an ink container which is mounted on an ink jet recording apparatus and is capable of supplementing an ink composition.", "\n2. ", "Related Art\nIn the related art, there has been known an ink jet recording apparatus which records images or the like on a recording medium with minute ink droplets discharged from nozzles of a recording head for ink jet recording. ", "The ink jet recording apparatus includes an ink container (for example, an ink cartridge) for supplying an ink composition to the recording head.", "\nAs such an ink container, there has been known a refill (pouring) type ink container (a so-called continuous supply type ink container) in which a continuous supply type ink container is refilled with an ink composition instead of replacing the ink container, as well as a replaceable ink container (a so-called ink cartridge) in which the ink container itself is replaced, when an ink composition in the ink container is equal to or less than a predetermined amount. ", "For example, in JP-A-2012-148511, there is disclosed an ink jet recording apparatus which supplies ink from a continuous supply type ink tank to an ink jet head through an ink supply tube, and the ink tank has an ink-refillable structure.", "\nIn the continuous supply type ink tank as disclosed in JP-A-2012-148511, an ink chamber for housing the ink composition is provided therein. ", "In such an ink chamber, a support (such as a rib) is provided in order to hold the shape of the ink container and to improve the strength or rigidity thereof in some cases.", "\nThe continuous supply type ink container as disclosed in JP-A-2012-148511 is a so-called atmosphere open type container in which an ink chamber is opened to the atmosphere. ", "Thus, an interface (gas-liquid interface) between the air present in the upper side of the ink chamber and the ink is generated in the ink chamber.", "\nHere, when the ink in the ink chamber is consumed, the ink attached to the support is dried by coming into contact with air present in the upper side of the ink chamber and thus it is easy to form a thin film. ", "The formed thin film is easily peeled and the peeled thin film forms aggregates in the ink in some cases. ", "As a result, the aggregates are supplied to the head and then it results in clogging the head (nozzle).", "\nIn addition, there is a case where a filter for capturing foreign substances such as aggregates is provided in a flow path of the ink container. ", "In a case where an ink cartridge type ink container which is replaceable instead of ink refill is used, even though the aggregates are captured by the filter, the ink container is replaced before the captured aggregates interfere with the ink supply in many cases. ", "Thus, the clogging of the filter occurred less frequently. ", "However, since the continuous supply type ink container which can be refilled with ink has a very long period of use compared to the ink cartridge type ink container, inconveniences such as ink supply failure due to the aggregates captured by the filter become apparent easily.", "\nMeanwhile, an ink pouring port of the ink container is opened when the ink is poured into the ink chamber, but even though the ink pouring port is opened, it can be closed without pouring the ink into the ink chamber. ", "In such a case, the air present in the upper side of the ink chamber is switched from the air in the saturated state which has been present so far to air introduced from outside which is not in the saturated state. ", "Particularly, when the ink in the ink chamber is largely consumed, and a ratio of the air present in the upper side of the ink chamber becomes higher, a large amount of the air not in the saturated state is introduced into the ink chamber and thus the ink in the ink chamber is rapidly volatilized. ", "In this case, the ink attached on the support present in the ink is rapidly volatilized and thereby a large amount of aggregates may be generated." ]

{ "pile_set_name": "USPTO Backgrounds" }

[ 0, 0, 0, 0, 0, 0, 0.004201680672268907, 0.007042253521126761, 0, 0.005747126436781609, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0 ]

[ { "analysis_explanation": null, "end": 1052, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 1041 }, { "analysis_explanation": null, "end": 1330, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 1319 }, { "analysis_explanation": null, "end": 1646, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 1635 }, { "analysis_explanation": null, "end": 1052, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 1046 }, { "analysis_explanation": null, "end": 1330, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 1324 }, { "analysis_explanation": null, "end": 1646, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 1640 } ]

[ "'We were silenced by the Feds!'", "\n\nShoppers of 40 online stores have had their bank card numbers and addresses slurped by a malware infection at backend provider Aptos.", "The security breach occurred late last year when a crook was able to inject spyware into machines Aptos used to host its retail services for online shops. ", "This software nasty was able to access customer payment card numbers and expiration dates, full names, addresses, phone numbers and email addresses, we're told.", "Rather than being alerted to the infiltration by Aptos itself, instead we were warned this week by Aptos' customers – the retailers whose websites were infected by the malware on the backend provider's servers.", "According to these stores, which have had to file computer security breach notifications with state authorities, the malware was active on Aptos systems from February through December of 2016.A spokesperson for Aptos – based in Atlanta, Georgia – toldthe biz had been working with the FBI and US Department of Justice to investigate the ransacking, and was required to keep quiet about the infection for two months before notifying its customers.", "\"As the 60-day period expired on Sunday, February 5, we contacted impacted retailers starting on Monday, February 6 to provide a synopsis of the situation,\" Aptos said.", "\"We are working closely with the specific digital commerce customers who were impacted by this incident to ensure affected consumers are notified in a transparent, accurate and timely manner in accordance with US-based state disclosure laws for data security incidents.", "\"Among the affected companies is Liberty Hardware, which told the state of Montana that it was notified of the breach on February 7.\"Aptos has informed us that they discovered the intrusion in November 2016,\" Liberty Hardware said. \"", "We understand that Aptos then contacted Federal law enforcement agencies and the US Department of Justice, and law enforcement requested that notification to businesses (including Liberty Hardware) be delayed to allow the investigation to move forward.", "\"Some of the customers, such as sweets site Affy Tapple, are footing the bill for a year's credit monitoring for customers exposed by the breach. \"", "Aptos has advised us that the unauthorized person(s) potentially had access to the payment card transaction records of 19 of Affy Tapple's customers with billing addresses in Washington,\" the site says.", "Other businesses will likely be following with their own disclosures. ", "Aptos said it is letting the companies affected handle the notifications on their own and will not name them individually. ", "So if you shopped online around November last year, and you get a note from one of the 40 affected websites confessing your payment card details were stolen, you know who to blame.", "Aptos, its CEO Noel Goggin, and his team" ]

{ "pile_set_name": "OpenWebText2" }

[ 0, 0, 0, 0, 0.004761904761904762, 0.004484304932735426, 0, 0, 0.004291845493562232, 0.007936507936507936, 0.006802721088435374, 0, 0, 0, 0, 0.025 ]

[ { "analysis_explanation": null, "end": 29, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 25 }, { "analysis_explanation": null, "end": 209, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 195 }, { "analysis_explanation": null, "end": 577, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 568 }, { "analysis_explanation": null, "end": 859, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 851 }, { "analysis_explanation": null, "end": 876, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 868 }, { "analysis_explanation": null, "end": 928, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 921 }, { "analysis_explanation": null, "end": 937, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 930 }, { "analysis_explanation": null, "end": 1107, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1097 }, { "analysis_explanation": null, "end": 1154, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1148 }, { "analysis_explanation": null, "end": 1191, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1173 }, { "analysis_explanation": null, "end": 1255, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1237 }, { "analysis_explanation": null, "end": 1521, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1519 }, { "analysis_explanation": null, "end": 1661, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1654 }, { "analysis_explanation": null, "end": 1708, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1700 }, { "analysis_explanation": null, "end": 1785, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1772 }, { "analysis_explanation": null, "end": 2154, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2150 }, { "analysis_explanation": null, "end": 2399, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2389 }, { "analysis_explanation": null, "end": 2660, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2642 }, { "analysis_explanation": null, "end": 2817, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2806 } ]

[ "Homologies and heterogeneity between Rheumatology Congresses: Mexican, American College of Rheumatology and European League Against Rheumatism.", "\nMedical meetings are a tool to help physicians advance and update their medical knowledge. ", "Their quality is the responsibility of colleges and institutions. ", "To assess and compare the academic level of four different annual rheumatology meetings. ", "As a source of information, we used the abstracts published in the supplements of the journal Reumatología Clínica, SE1 Vol. ", "12, issued in February 2016, SE 1 Vol. ", "13 issued in February 2017, the electronic application of the 2016 ACR/ARHP of the 2016 American Congress of Rheumatology, devoted to the works presented at the 44th Mexican Congress of Rheumatology (CMR 44), the 45th Mexican Congress of Rheumatology (CMR 45), and the 2016 ACR/ARHP Annual Meeting (ACR 2016), as well as the Web page on the files and abstracts of EULAR 2017, respectively; from each work we compiled information on the major disease being referred to, the type of information provided and the type of report. ", "We should point out that some were combined conditions or designs, from which we selected that which we considered to be the most important. ", "In all, 275, 340, 3275 and 4129 studies were submitted to the XLIV Mexican Congress of Rheumatology, XLV Mexican Congress of Rheumatology, the 2016 ACR/ARHP Annual Meeting and EULAR 2017, respectively. ", "Rheumatoid arthritis was the most common disorder, dealt with in 23%, 26%, 21% and 27% in CMR 44, CMR 45, 2016 ACR and EULAR 2017, respectively, followed by systemic lupus erythematosus; in third place, Mexican congresses reported trials related to systemic vasculitis, whereas spondylitis was the main subject of international congresses. ", "In the case of rheumatoid arthritis, clinical topics accounted for 30% in the Mexican congresses and ACR, and nearly 20% in EULAR. ", "Observational studies accounted for 40% in the Mexican congresses vs. 33% in 2016 ACR and 55% in EULAR 2017. ", "Studies on basic science were minimal in the Mexican congress, whereas in 2016 ACR, they represented 21% and 12% in EULAR 2017. ", "Rheumatology meetings constitute a tool to obtain adequate evidence-based medical knowledge in this important branch of medicine. ", "For our Mexican Congress, we should encourage collaborative efforts between institutions, which will result in a greater number of controlled studies, clinical trials and basic studies that support the quality of the congress. ", "We wish to emphasize that a greater diffusion of other musculoskeletal diseases is needed, not only autoimmune diseases, since the former represent an important percentage of the daily practice." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.02097902097902098, 0, 0, 0, 0.008, 0, 0, 0, 0.01485148514851485, 0.008823529411764706, 0.022900763358778626, 0, 0.0078125, 0, 0.00881057268722467, 0 ]

[ { "analysis_explanation": null, "end": 69, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 62 }, { "analysis_explanation": null, "end": 366, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 360 }, { "analysis_explanation": null, "end": 504, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 484 }, { "analysis_explanation": null, "end": 542, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 529 }, { "analysis_explanation": null, "end": 580, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 567 }, { "analysis_explanation": null, "end": 620, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 616 }, { "analysis_explanation": null, "end": 641, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 637 }, { "analysis_explanation": null, "end": 827, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 823 }, { "analysis_explanation": null, "end": 861, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 857 }, { "analysis_explanation": null, "end": 923, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 918 }, { "analysis_explanation": null, "end": 928, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 924 }, { "analysis_explanation": null, "end": 1368, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1364 }, { "analysis_explanation": null, "end": 1402, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1397 }, { "analysis_explanation": null, "end": 1407, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1403 }, { "analysis_explanation": null, "end": 1552, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1548 }, { "analysis_explanation": null, "end": 1633, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1626 }, { "analysis_explanation": null, "end": 1848, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1841 }, { "analysis_explanation": null, "end": 1948, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1941 }, { "analysis_explanation": null, "end": 1975, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1971 }, { "analysis_explanation": null, "end": 2055, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2048 }, { "analysis_explanation": null, "end": 2081, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2077 }, { "analysis_explanation": null, "end": 2276, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2269 }, { "analysis_explanation": null, "end": 2672, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2667 } ]

[ "Meta\n\nThere is something so uniquely and intimately satisfying about creating a character in the hit Nintendo series ‘Animal Crossing’ before spending hours shaking trees, fishing and talking to animal-people. ", "Nintendo’s quirky series has been one of the staples in their massive library of IP and now it is going mobile. ‘", "Animal Cross: Pocket Camp’ hit mobile application stores last week and it ascended quickly to 15 million downloads, making it the second largest mobile game launch in Nintendo’s history — right behind Super Mario Run.", "\n\nNintendo has made a habit of giving fans a new ‘Animal Crossing’ title with each generation of their console release, dating all the way back to the Nintendo 64. ", "Fans were notably worried that nothing had been announced in 2017, up until about two months ago when news of ‘Pocket Camp’ first hit the internet. ", "Fans were initially put off by the idea of a mobilization of such a deep and unique game, but those fears have turned out to be unfounded as critical and commercial success has followed the title.", "\n\nIn ‘Pocket Camp’, gamers create a character like they traditionally do in other ‘Animal Crossing’ titles. ", "Afterwards, each player is given a special RV Camper that they can decorate and expand, much like their home. ", "The big twist here is that your character does not live in a village. ", "Instead, you have your own ‘campsite’ that can be completely and uniquely decorated. ", "You can invite other animals to come hang out at your campsite while you perform tasks for them in order to build your friendship. ", "Of course, there is plenty of exploration too. ", "An overworld map allows your character to travel to a handful of different areas, including beaches, parks, and forests, in order to catch bugs, go fishing, and meet new animals and players.", "\n\nNintendo has taken a relatively hands-off approach in terms of monetization for ‘Pocket Camp’ which is likely why the title has been so popular, so far. ", "You don’t need to pay a cent to enjoy the game unless you would like to speed up certain tasks or buy specialty aesthetic items to decorate your camp.", "\n\nIf there is one thing that Nintendo has mastered, with almost no competition from other major brands, it is the platformer. ", "With Mario setting the tone and every iconic character after to follow, Nintendo has cornered the style of gameplay almost entirely. ", "Now it looks like the Nintendo Switch is picking up its next great piece of IP in the retro platformer genre, “Yooka-Laylee”. ", "Ignoring the obvious play on words, there looks to be a lot of depth in this title and fans of the style should be eager to get their hands on it when it drops on December 14th, 2017.", "\n\nYooka-Laylee was originally supposed to release on the PS4, XB1, and Wii U this past April but a slew of technical issues changed the ramping up of the release. ", "Instead, the developers at Playtonic Games decided to hold back and refine their product with a new release window during the Holiday Season for the Nintendo Switch. ", "Over the past several months the team at Playtonic have been focused on technically optimizing the quirky, colorful platformer in order to make it a homerun for Nintendo Switch owners around the world.", "\n\nFor fans of the Yooka-Laylee that have already played the title on the PS4 or XB1, there will be new content and additional gameplay elements that come with the Nintendo Switch. ", "What we do know is that Playtonic Games focused on incorporating the impressive Joy-Con controls as much as possible during their optimization process. ", "You can now play all eight mini-games with just one of the Joy-Con controllers. ", "You can also enjoy a brand new camera system, refined controls, and even a dialogue skip button for the truly impatient gamers.", "\n\nThe Nintendo Switch has turned into one of the biggest console surprises of the past decade. ", "The Switch has completely flipped the Wii U’s relative failure on its head, becoming one of Nintendo’s hottest selling systems of all time. ", "With titles like Yooka-Layle in the fold, gamers are only going to keep coming back for more.", "\n\nIt has not been a great launch period for Star Wars Battlefront 2. ", "Electronic Arts’ (EA) much awaited continuation to the Battlefront franchise was almost immediately panned by fans and critics as “pay to win”, where players could pay money for items that improved their performance in-game. ", "To that end EA pulled the system, but such actions did not appease the Belgian Gaming Commission from launching an investigation into the practice. ", "EA attempted to shift the blame to the Star Wars license, but their pleas seem to have fallen of deaf ears.", "\n\nWhich is when the bad news for EA keeps getting worse, as France may begin to take a closer look at the loot-crate practice. ", "French senator Jérôme Durain reached out to several consumer advocacy groups recently, expressing concern that the boxes may be harmful to children. ", "A translation reads: “Quite aside from the acceptance of the practice, some observers point to a convergence of the video game world and practices specific to gambling.” ", "He highlights several avenues of resolution, including perhaps adopting Chinese models which include transparency win chances. ", "Fortunately for EA, he also says that he is not at a point where he believes legislation is strictly necessary.", "\n\nCharles Coppolani of ARJEL, the regulatory oversight board in France which monitors all gambling within the country, replied the practice poses, “risks for our fellow citizens and in particular for the youngest. ", "These risks are very close to those that characterise gambling addiction money; it is necessary to be very vigilant.” ", "He further stressed consumer protection may indeed become a necessity before long.", "\n\nElsewhere, Hawaii state representative Chris Lee voiced similar concerns last week. ", "It would seem EA’s loot box policy was only a straw that finally broke this particular camel’s back.", "\n\nWe are currently living in a pop-culture world that is completely dominated by the teams at Disney and Marvel. ", "With fans clamoring for the trailer to the anticipated ‘Infinity Wars’ Marvel film, it seems like everything is in the palm of Marvel’s hands. ", "Unfortunately, this didn’t quite extend to the gaming world. ", "Marvel Heroes was released in 2013 as a sort of Diablo-like take on the dungeon-crawling genre. ", "Fans played with their favorite heroes from throughout the MCU. ", "The title recently expanded to the Xbox One and the PlayStation 4 after being first launched on the PC. ", "Despite the recent expansion, it turns out that Marvel Heroes is being shut down and fans everywhere are absolutely devastated.", "\n\nMarvel Heroes was one of Disney’s first big F2P games that focused more on a freemium experience rather than a massive investment up front. ", "As a result, the game instantly became a fan-favorite for followers of the Marvel Universe. ", "The game was developed by Gazillion Entertainment and it was through them that the closure was announced. ", "Gazillion Entertainment took to Twitter to say, “It is with great sadness that we announce the close of Gazillion Entertainment.” ", "The tweet went on to say, “As a result, we are no longer able to operate Marvel Heroes Omega until December 31 as originally planned.” ", "This tweet, of course, meant that Marvel Heroes was to be shut down essentially immediately.", "\n\nEarlier this month it was revealed that Marvel Heroes was likely heading for the dumps but that the company would hold on until the end of the year to allow gamers to enjoy some time with the product before shutting it down. ", "Instead, the sunset period began immediately. ", "Microtransactions were immediately pulled from the title, and nearly every employee on the company’s roster was let go from their job. ", "The studio finally revealed that there was no way that they could continue supporting the title and as a result, it was gone. ", "At least we still have ‘Infinity War’, right?", "\n\nMany of us include coffee in our morning routines and some of us keep our pots brewing all day long. ", "If you fall into this category then you will love the results of this new 16-year study. ", "Drinking coffee can lead to a longer lifespan by reducing the risk of kidney disease, cancer, stroke, heart disease, and diabetes.", "\n\n185,000 Americans were studied ranging from Latinos, white, African-American, and Asian. ", "All of which had the same results whether they drank regular or decaffeinated coffee. ", "Results were updated every five years and the data always remained consistent. ", "Even more, those who drank three or four cups of coffee each day opposed to those who did not show an 18% decrease in chance of death. ", "Read the reviews at dietspotlight.com.", "\n\nWhen associating health with coffee, one of the best brands to keep in mind is Organo Gold. ", "They specialize in not only coffee but also latte drinks, hot cocoa, and various types of tea. ", "All of these drinks include ganoderma lucidum, which is a mushroom that can help fight cancer, protect your liver, and even help with arthritis. ", "Watch this video on Youtube.", "\n\nOrgano Gold also has a wide variety of body management and personal care products as well, one that I really like is their rich chocolate shake mix that can help with weight loss. ", "It has plenty of protein, vitamins, minerals, as well as the ganoderma mushroom. ", "You can even purchase soap and toothpaste from Organo Gold that includes the ganoderma ingredient. ", "The options are limitless.", "\n\nIf you were like us, then you spent the summer of 2016 outside with your eyes locked on your phone as you captured as many Pokemon as possible in Pokemon Go. ", "Developed by Niantic, Pokemon Go became a resounding success and a true game-changer for the mobile market. ", "Augmented reality has begun to showcase itself as a viable platform for major IPs to take their product on the road. ", "Now, it looks like Harry Potter is getting its own Pokemon Go styled augmented reality experience, and the investment money is truly rolling in.", "\n\nNiantic Labs announced their new Harry Potter augmented reality title just over a week ago and since then the title has been gaining massive attention from investors everywhere. ", "Through the Wall Street Journal, it was announced that Harry Potter: Wizards Unite had already found nearly $200 million in Series B venture capital funding. ", "Niantic will be utilizing this money in order to further the world of augmented reality. ", "Fans of Pokemon Go and Harry Potter should be ecstatic that Niantic isn’t willfully sticking to their wheelhouse. ", "Instead, it appears that the company is intent on pushing technology forward in order to change the platform forever.", "\n\nNiantic Labs used to be owned by Google but now the company is standing alone and rising as a result. ", "Niantic Labs saw several major investors come to the table during their Series B investing, including Spark Capital, Meritech, and Javelin Venture Capital. ", "With more companies working alongside Niantic Labs, it appears that Niantic CEO John Hanke has more in mind than just launching another piece of IP. ", "Niantic Labs has a very real chance to fundamentally change the world of mobile gaming forever, and if they are successful then this could mean that there will be a complete proprietary change to the way we use our phones. ", "We’re rooting for Niantic to bring some magic out with Wizards Unite. ", "The question begs to be asked, will they succeed or enter a sophomore slump?", "\n\nAlthough the game has waned from being popular among mainstream news cycles, “Pokémon Go” will be offering its players the chance to capture another legendary Pokémon. ", "The blazing phoenix-like Ho-Oh will now make appearance during raid battles., ", "Niantic’s go-to method for bringing players in touch with legendary Pokémon like Mewtwo and the trio of birds that serve as mascots for the game’s three teams.", "\n\nWhile raid battles are group encounters that have up to 20 players teaming up to tackle one super-powerful Pokémon, the mention of a Ho-Oh raid seems relatively unforeseen. ", "Those unfamiliar with Niantic’s social media presence or who fail to keep up with the screen dedicated to sensing raids would easily miss this news. ", "As befits a creature of its majesty and scarcity, raid encounters with the blazing bird of legend will not be around for very long. ", "To be specific, Ho-Oh raids will only be operable from now until the 12th day of December this year.", "\n\nAny player seeking to capture Ho-Oh during a raid must first obtain a Raid Pass item within the game. ", "This item can be acquired either from going to a gym or by purchasing a Premium Raid Pass from the in-app store. ", "Once a raid battle begins, all participating players must defeat a “Raid Boss” within a 5 minute time limit. ", "Upon defeating the Raid Boss players can see a Pokémon egg that will hatch once the 5 minute counter reaches 0:00. ", "In addition to the chance to get rare and unique pokemon, players can also receive free items like Potions, Berries and “Technical Machines.” ", "Raid battles were one feature added to the game during a massive update in June 2017.", "\n\nPokémon Go’s inception can be traced back to a partnership April Fools’ Day joke in 2014 between Nintendo, The Pokémon Company and Google Earth. ", "After several test runs in limited regions, the first build of the complete game was released in July of 2016.", "\n\nGameStop has seen their stock drastically drop over the last few years as digital video games become increasing more popular. ", "A large set of video game fans are simply unwilling to go to a physical store to buy a game when they can download it directly to their console without ever leaving their home. ", "GameStop is looking to combat the rise of digital downloads by offering a new subscription rental service later this year.", "\n\nThe new service offered by GameStop is called Power Pass, and it will allow subscribers to rent an unlimited amount of pre-owned games from their local GameStop store for a period of six months. ", "Sign ups for the GameStop Power Pass program will begin on November 19, and it will cost everyone an upfront fee of $60. ", "You must sign up before the end of January 2018 if you want to take part in the new rental service. ", "A GameStop PowerUp Rewards account is also needed in order to sign up.", "\n\nEveryone that signs up for Power Pass will get to take home one pre-owned video game from their local GameStop store when the program begins. ", "You can then exchange that game for another pre-owned game at any time. ", "There are no restrictions on exchanges, so you can get a new game every day if you desired. ", "There are also no restrictions on the games that can be rented with Power Pass. ", "If the pre-owned game is sitting on the store shelves, then you can take it home with your Power Pass subscription. ", "It does not matter if it is a new release for the PS4 or a classic game from the original Xbox. ", "Once the six-month program is over, you will get to keep the last game you rented.", "\n\nGameStop ran a similar program for three months this summer in select cities, and it looks like it was a success. ", "This is a great deal for both parties involved. ", "Video game fans get to enjoy six months of endless games for a low price, and GameStop is finding a way to monetize their large used game inventory.", "\n\nDavid Giertz is a finical expert. ", "David has over 30 years in the finical industry with providing strategies and other finical advice in order to obtain wealth. ", "David is also a Certified Business Coach with WABC. ", "He has several accomplishments under his belt. ", "Under his leadership, he has certified more than 100 people as business coaches. ", "David has recently retired from being the President at Nationwide Financial’s sales and distribution organization. ", "Since retiring, David has volunteered finical advice for the younger adults.", "\n\nThe first step to stay on track for retirement is to plan early. ", "David recommends everyone to be aware of all bills that they may have. ", "He always recommends that all debts like car note, credit cards, student loans, and all other bills are paid off as soon as possible. ", "As soon as your debts are paid off, more saved money will be able to go toward retirement savings.", "\n\nAnother tip that David Giertz gave is to have multiple sources of income. ", "If you already have a job David recommends that you also pick up another hobby or something that you enjoy doing to generate extra income. ", "All of the money earned from your side gig can be money that is saved for retirement.", "\n\nThe last tip that David Giertz offered to Millennials is to take advantage of compound interest. ", "With compound interest, you will be able to save more money than you would be able to do with a 401k. ", "The key is starting early. ", "The earlier you start, the more money you will be able to earn from the money that is invested. ", "Also with compound interest, money is already taxed before deposits are even made. ", "Once you actually retire, you will have access to your money taxed free. ", "Following these tips will defiantly put you on the right track for retirement.", "\n\nOSI Group is one of the largest suppliers of food products to the broader parts of the United States as well as other parts of the globe. ", "The firm has its headquarters in Aurora, Illinois and has over the past years sparked a significant growth in its operations. ", "The company has established a number of services both globally and locally, thanks to the excellent leadership skills exercised by its management team. ", "The firm has emerged to be one of the best food production companies in the world and impressed many individuals due to its ability to outdo the many food production companies in the market.", "\n\nOSI Group is currently carrying its operations in over seventeen countries and is always looking forward towards establishing more of its affiliates in the broader parts of the world. ", "Among the protein products that the firm produces include meat burgers, pork burgers, meat pies, and many more. ", "Most of the products of OSI group are usually sold and distributed in most supermarkets as well as retail shops, while others are sold to restaurants where they can be prepared for the firm’s customers. ", "The large establishment of the company in the broader parts of the country has seen its products receive a high demand as well as massive sales due to their affordability and availability. ", "The company has always strived to offer its protein products to customers at affordable rates for them to purchase and reduce the cost of cooking.", "\n\nOSI Group also employs high standards of hygiene when it comes to the manufacture of their products and the firm has always strived to ensure that the products are safe and free contamination that may lead to spread of severe diseases to their consumers. ", "Besides the caution used in the manufacture of the products, the firm has also partnered with some prestigious technological companies that provide them with today’s most modern equipment as well as machines to use in the manufacture of their goodies. ", "Most of the material that the firm uses are of a high standard and ensure the safety of their employees as well as the products being manufactured. ", "The considerable success exercised by the company has seen a significant number of individuals accredit its management team and investors from other firms also strive to emulate their operation and business strategies to ensure that their companies establish their operations. ", "The company has also purchased a food plant in Chicago, Europe, and looks towards expanding its services in the coming years." ]

{ "pile_set_name": "Pile-CC" }

[ 0.009523809523809525, 0.017699115044247787, 0.013824884792626729, 0.006097560975609756, 0, 0, 0, 0.00909090909090909, 0, 0, 0, 0, 0, 0.0064516129032258064, 0, 0.007936507936507936, 0.015037593984962405, 0.007936507936507936, 0, 0.012269938650306749, 0, 0.009950248756218905, 0, 0.006578947368421052, 0.0125, 0, 0, 0.02142857142857143, 0.010752688172043012, 0, 0.008888888888888889, 0.013513513513513514, 0.009345794392523364, 0.007874015748031496, 0.006711409395973154, 0, 0, 0.009009009009009009, 0.004672897196261682, 0, 0, 0.011627906976744186, 0.01, 0.017699115044247787, 0.006993006993006993, 0, 0.010416666666666666, 0.015625, 0, 0.007874015748031496, 0.007042253521126761, 0, 0.009433962264150943, 0.015384615384615385, 0.007407407407407408, 0.010869565217391304, 0.004405286343612335, 0, 0, 0, 0, 0, 0, 0, 0.01098901098901099, 0, 0, 0, 0.02631578947368421, 0.010638297872340425, 0, 0, 0.03571428571428571, 0.005494505494505495, 0, 0.010101010101010102, 0, 0.00625, 0.009259259259259259, 0, 0.006944444444444444, 0.005555555555555556, 0.012658227848101266, 0, 0.017543859649122806, 0, 0.009615384615384616, 0.02564102564102564, 0.026845637583892617, 0.004484304932735426, 0.02857142857142857, 0, 0.0058823529411764705, 0.01282051282051282, 0.006289308176100629, 0.005714285714285714, 0.006711409395973154, 0, 0.01, 0.009615384615384616, 0, 0, 0, 0.007042253521126761, 0, 0.013605442176870748, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.027777777777777776, 0.007936507936507936, 0.057692307692307696, 0, 0, 0.017391304347826087, 0.013157894736842105, 0, 0.014084507042253521, 0, 0, 0.013157894736842105, 0, 0, 0.010101010101010102, 0, 0, 0, 0, 0, 0, 0.007142857142857143, 0, 0, 0, 0.005376344086021506, 0, 0.0049261083743842365, 0, 0, 0.0038910505836575876, 0, 0, 0, 0 ]

[ { "analysis_explanation": null, "end": 156, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 151 }, { "analysis_explanation": null, "end": 390, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 381 }, { "analysis_explanation": null, "end": 769, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 765 }, { "analysis_explanation": null, "end": 800, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 780 }, { "analysis_explanation": null, "end": 2658, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2639 }, { "analysis_explanation": null, "end": 2672, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2660 }, { "analysis_explanation": null, "end": 2750, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2735 }, { "analysis_explanation": null, "end": 2961, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2943 }, { "analysis_explanation": null, "end": 3015, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2992 }, { "analysis_explanation": null, "end": 3818, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3803 }, { "analysis_explanation": null, "end": 4666, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4660 }, { "analysis_explanation": null, "end": 4733, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4727 }, { "analysis_explanation": null, "end": 4755, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4742 }, { "analysis_explanation": null, "end": 5125, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5118 }, { "analysis_explanation": null, "end": 5302, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5285 }, { "analysis_explanation": null, "end": 5353, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5347 }, { "analysis_explanation": null, "end": 5715, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5709 }, { "analysis_explanation": null, "end": 5746, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5737 }, { "analysis_explanation": null, "end": 5780, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5771 }, { "analysis_explanation": null, "end": 6232, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6228 }, { "analysis_explanation": null, "end": 7168, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7157 }, { "analysis_explanation": null, "end": 7304, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7286 }, { "analysis_explanation": null, "end": 7433, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7414 }, { "analysis_explanation": null, "end": 7574, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7557 }, { "analysis_explanation": null, "end": 7904, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7897 }, { "analysis_explanation": null, "end": 7963, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7951 }, { "analysis_explanation": null, "end": 8046, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8039 }, { "analysis_explanation": null, "end": 8202, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8193 }, { "analysis_explanation": null, "end": 8236, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8229 }, { "analysis_explanation": null, "end": 8261, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8245 }, { "analysis_explanation": null, "end": 8272, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8267 }, { "analysis_explanation": null, "end": 8397, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8381 }, { "analysis_explanation": null, "end": 8503, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8495 }, { "analysis_explanation": null, "end": 9415, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9397 }, { "analysis_explanation": null, "end": 9775, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9763 }, { "analysis_explanation": null, "end": 9934, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9922 }, { "analysis_explanation": null, "end": 9979, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9959 }, { "analysis_explanation": null, "end": 10134, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10122 }, { "analysis_explanation": null, "end": 10349, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10337 }, { "analysis_explanation": null, "end": 10894, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10884 }, { "analysis_explanation": null, "end": 12282, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12248 }, { "analysis_explanation": null, "end": 12595, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12587 }, { "analysis_explanation": null, "end": 12700, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12692 }, { "analysis_explanation": null, "end": 12721, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12717 }, { "analysis_explanation": null, "end": 12949, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12940 }, { "analysis_explanation": null, "end": 13026, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13010 }, { "analysis_explanation": null, "end": 13039, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13035 }, { "analysis_explanation": null, "end": 13205, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13193 }, { "analysis_explanation": null, "end": 13277, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13259 }, { "analysis_explanation": null, "end": 13631, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13616 }, { "analysis_explanation": null, "end": 13826, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13804 }, { "analysis_explanation": null, "end": 13898, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13887 }, { "analysis_explanation": null, "end": 13996, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13973 }, { "analysis_explanation": null, "end": 14409, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14400 }, { "analysis_explanation": null, "end": 14736, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14727 }, { "analysis_explanation": null, "end": 14860, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14836 }, { "analysis_explanation": null, "end": 15002, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14992 }, { "analysis_explanation": null, "end": 15124, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15112 }, { "analysis_explanation": null, "end": 15151, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15146 }, { "analysis_explanation": null, "end": 15169, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15161 }, { "analysis_explanation": null, "end": 15277, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15272 }, { "analysis_explanation": null, "end": 15457, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15452 }, { "analysis_explanation": null, "end": 15588, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15583 }, { "analysis_explanation": null, "end": 15714, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15709 }, { "analysis_explanation": null, "end": 16042, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16030 }, { "analysis_explanation": null, "end": 16118, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16113 }, { "analysis_explanation": null, "end": 16342, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16330 }, { "analysis_explanation": null, "end": 16365, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16354 }, { "analysis_explanation": null, "end": 16969, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16952 }, { "analysis_explanation": null, "end": 17046, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17040 }, { "analysis_explanation": null, "end": 17056, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17048 }, { "analysis_explanation": null, "end": 17084, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17070 }, { "analysis_explanation": null, "end": 18729, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18724 }, { "analysis_explanation": null, "end": 19297, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19290 }, { "analysis_explanation": null, "end": 19305, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19299 }, { "analysis_explanation": null, "end": 19367, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19351 }, { "analysis_explanation": null, "end": 8611, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 8594 } ]

[ "Virion protein sequence variation among Australian isolates of turnip yellow mosaic tymovirus.", "\nThe virion protein genes, and 3' untranslated regions, of six variants of turnip yellow mosaic tymovirus (TYMV) that produced different symptoms in their native host Cardamine robusta and in Chinese cabbage plants, have been sequenced. ", "The sequences have been compared with each other, and with the same region of the pBL-16 clone of the Blue Lake isolate of TYMV. ", "The sequences of the virion protein genes differed by a mean of 1.89% (range 0-2.82%), and the encoded proteins by a mean of 1.71% (range 0-3.17%). ", "The nucleotide differences were confined to the 5'-most 60% of the gene, whereas there were amino acid differences only among residues 12 to 29 and residue 102 (numbered from the N-terminus) of the virion protein involving only hydrophobic residues at the surface of the protein. ", "The amino acid and nucleotide differences between the seven isolates did not correlate with differences in the symptoms they caused, but confirmed earlier estimates of genetic variability in the wild populations of the virus." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0, 0.008438818565400843, 0.007751937984496124, 0, 0, 0 ]

[ { "analysis_explanation": null, "end": 50, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 40 }, { "analysis_explanation": null, "end": 293, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 286 }, { "analysis_explanation": null, "end": 442, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 429 } ]

[ "Hello guys how's it going?", "\nToday we are discussing the legend none other than Steve Harris from Iron Maiden.", "\nWelcome to the first episode of 'Know Your\nBass Player'.", "\nMy name is Alfie Williams and it is my job\nto dissect world class bass players.", "\nWe go through their gear, their styles and\nthe techniques they use to achieve their sound.", "\nLet’s begin today’s video with a rig run\ndown that Steve Harris is known for.", "\nSteve is known mostly for playing Fender Precision\nbasses and has done since he first started playing\nAfter joining Maiden, in the following years\nhe moved onto the Ibanez Roadster.", "\nMost notably this is seen in the video for\n\"The Trooper\" and used on the the\n1983 album peice of mind\nIt has a P/J pickup configuration and Steve\nhas stated at the time that it sounded cleaner\nthan the Fender Precision. ", "He also used it\nfor it’s higher volume output.", "\nIn nineteen eighty four the Powerslave record\nwas released.", "\nInterviews for the production say that he\nand the band wanted to try new sounds for\nthe record.", "\nIt was during this time Steve was endorsed\nby Lado basses.", "\nLado created two custom basses for Steve.", "\nThe Superfalcon and the Unicorn.", "\nThese basses carried more sustain than other\nmodels thanks to their Neck Thru construction\nand high quality craftsmanship.", "\nSince that time to present day Steve has gone\nback to customising Fender Precision basses\nfrom the 1970's\nThey are continually refurbished with new\npaint work and fitted with Badass II Bridges\nand Seymour Duncan custom pickups.", "\nHis paintwork, whilst being aesthetic has\nmade his bass instantly recognisable.", "\nFrom royal blue with a mirror scratch plate\nto his current model which boasts West Ham’s\ncolours.", "\nA Glossy White finish with maroon-blue-maroon\npinstriping\nthe body is home to Steve’s beloved West\nHam United F.C. crest.", "\nSteve's Amplifier rig consists of a Trace\nElliot Series 6 head with GP12X pre-amps.", "\nIn the past his rig has used C-1 audio power\namplifiers.", "\nOn stage he has up to 8 custom Marshall 4x12 cabinets.", "\nThese are fitted with EVM 12L speakers and\nthey weigh 11 kilograms each.", "\nThat is a heavy metal cabinet(!).", "\nSteve has been known to use Flatwound Rotosound\nstrings since the beginning.", "\nThese days he has his own custom set the SH77\nFlatwound heavy gauge,\nThis set has been based on Steve’s custom\ngauge preference and is designed to boost\nthe low and middle end.", "\nThis solidifies Maiden's lower range from\nthe guitars.", "\nContrary to popular belief, the treble from\na Steve's tone comes from his technique of\nbouncing the strings off the fretboard, not\nfrom the strings themselves. ", "More on this next\nLet's go ahead and jump right into the technique\nSteve is known for, that is the Heavy Metal Gallop.", "\nWhilst the harmonising guitars might be the\nfocal point of the music, it is the gallop\nthat brings out the rhythm of Iron Maiden.", "\nThe gallop is most notable on the songs \"Run\nto the Hills\" and \"The Trooper\".", "\nThis is performed by eighth note followed\nby two sixteenth notes at fast tempo.", "\nThe first note is played louder than the following\nnotes.", "\nTo get the right accent on the note played,\nSteve will drum his fingers on the strings\nrather than plucking them.", "\nThis combined with low action, gives a percussive\nslap\nor a rattle that gives him his unique tone.", "\nDuring many of Maidens songs there are various\nfills played by Steve.", "\nMore often than not they follow the Minor\nPentatonic shape.", "\nYou can play it forwards, backwards or just\nthe root notes like we've marked in red\nWhen played in the middle of a Maiden chord\nprogression it fits perfectly.", "\nExamples of this are in \"Aces High\", \"Rainmaker\"\nand \"Hallowed be Thy Name.\"", "\nCombined with the fills, you will find many\nof the bass lines have hammer ons and pull offs\nThis technique is used by quickly changing a fretted note\nto another note on the same string in a quick action\nThe opposite of this method is the pull-off\nwhere you lift off a fretted note whilst it’s\nstill vibrating to allow another fretted note\nbehind it to ring out.", "\nThis technique also facilitates very fast\nplaying because the picking hand does not\nhave to keep up with the fretting hand.", "\nCoordination between the hands need only be\nachieved at certain points.", "\nThis is well demonstrated in the prechorus\nto \"Aces High\".", "\nThere you have it guys, that will do for the\nguide today.", "\nI hope you’ve learned a little more about\nthe legend that is Steve Harris\nand the tools he uses to achieve one of the most\ndistinctive tones in the world.", "\nIf you liked the video,\nplease give it a a thumbs up and subscribe.", "\nIf there's a rig run down you'd like to see in the future. ", "Please let me know in the comments down below.", "\nThanks for watching and I shall see you next\ntime.", "\n" ]

{ "pile_set_name": "YoutubeSubtitles" }

[ 0, 0.024390243902439025, 0, 0.0125, 0, 0.01282051282051282, 0.01098901098901099, 0.00904977375565611, 0, 0, 0, 0.03389830508474576, 0.047619047619047616, 0.06060606060606061, 0, 0.013157894736842105, 0, 0, 0.01639344262295082, 0.023809523809523808, 0.017543859649122806, 0.01818181818181818, 0.0136986301369863, 0, 0.012987012987012988, 0.005649717514124294, 0.01818181818181818, 0.006211180124223602, 0.00847457627118644, 0.015384615384615385, 0.01282051282051282, 0, 0, 0.008771929824561403, 0, 0.014285714285714285, 0, 0.006289308176100629, 0, 0, 0, 0, 0, 0, 0.0064516129032258064, 0, 0, 0, 0, 0 ]

[ { "analysis_explanation": null, "end": 32, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 27 }, { "analysis_explanation": null, "end": 90, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 78 }, { "analysis_explanation": null, "end": 107, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 96 }, { "analysis_explanation": null, "end": 191, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 177 }, { "analysis_explanation": null, "end": 354, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 349 }, { "analysis_explanation": null, "end": 400, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 388 }, { "analysis_explanation": null, "end": 420, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 415 }, { "analysis_explanation": null, "end": 561, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 542 }, { "analysis_explanation": null, "end": 678, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 674 }, { "analysis_explanation": null, "end": 742, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 737 }, { "analysis_explanation": null, "end": 887, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 867 }, { "analysis_explanation": null, "end": 1049, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1044 }, { "analysis_explanation": null, "end": 1070, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1066 }, { "analysis_explanation": null, "end": 1083, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1079 }, { "analysis_explanation": null, "end": 1119, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1114 }, { "analysis_explanation": null, "end": 1313, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1308 }, { "analysis_explanation": null, "end": 1380, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1376 }, { "analysis_explanation": null, "end": 1488, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1474 }, { "analysis_explanation": null, "end": 1673, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1663 }, { "analysis_explanation": null, "end": 1766, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1761 }, { "analysis_explanation": null, "end": 1810, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1805 }, { "analysis_explanation": null, "end": 2030, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2027 }, { "analysis_explanation": null, "end": 2113, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2108 }, { "analysis_explanation": null, "end": 2145, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2136 }, { "analysis_explanation": null, "end": 2195, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2185 }, { "analysis_explanation": null, "end": 2286, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2281 }, { "analysis_explanation": null, "end": 2468, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2463 }, { "analysis_explanation": null, "end": 2649, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2644 }, { "analysis_explanation": null, "end": 2824, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2813 }, { "analysis_explanation": null, "end": 2962, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2949 }, { "analysis_explanation": null, "end": 3091, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3086 }, { "analysis_explanation": null, "end": 3323, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3318 }, { "analysis_explanation": null, "end": 4294, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4289 }, { "analysis_explanation": null, "end": 4369, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4357 } ]

[ "- y\nLet c(f) = f**3 - 35*f**2 + 2*f - 84. ", "Let r be c(35). ", "Let j(u) = -6*u - 2. ", "Let h(k) = -89*k - 66*k - 7 + 136*k. ", "What is r*j(l) + 4*h(l)?", "\n8*l\nLet g(b) = -2*b - 2. ", "Let x be (0 - 18/(-10))/((-7)/(-35)). ", "Suppose -2*a = -0*a + 8. ", "Let s(l) = -4*l - 4. ", "Determine a*s(v) + x*g(v).", "\n-2*v - 2\nLet n(w) = -1025*w**3. ", "Let z be 93/(-186) + 649/(-2). ", "Let q(x) = 19*x**3. ", "Determine z*q(g) - 6*n(g).", "\n-25*g**3\nLet a = -13 + 8. ", "Let u = a - -1. ", "Let x(k) = 2*k**2 - 4. ", "Let p(b) be the third derivative of b**5/60 + b**3/6 - b**2 + 23419*b. ", "Give u*p(f) - x(f).", "\n-6*f**2\nLet j(c) = -627*c + 5. ", "Let f(o) = 1258*o - 9. ", "Calculate -4*f(k) - 7*j(k).", "\n-643*k + 1\nLet s(k) = -k**3 + 11*k**2 + 334*k - 3170. ", "Let h be s(9). ", "Let j(u) be the first derivative of u**2/2 + u + 1. ", "Let b(t) = 2*t**2 - 1. ", "What is h*j(x) - b(x)?", "\n-2*x**2 - 2*x - 1\nLet d(v) = -v**2 - v - 1. ", "Let f(a) = 5*a**2 + 16*a + 6. ", "Let x(b) = 3*b**3 + 13*b**2 - 6*b + 14. ", "Let r be x(-5). ", "Determine r*d(s) - f(s).", "\ns**2 - 10*s\nLet d(r) = -10*r**2 + 34*r. ", "Let v be 3/(3/70) - 2. ", "Let o(u) be the second derivative of u**4/12 - u**3/2 - 326*u - 52. ", "Calculate v*o(n) + 6*d(n).", "\n8*n**2\nLet z(y) = 2*y**2 + 4*y + 2. ", "Let l(j) = -5*j - 5 - j**2 + 0 + 2*j + 3. ", "Let q = 11 - 12. ", "Let m(c) = -2*c**2 - 4*c - 5. ", "Let n be m(q). ", "Calculate n*z(x) - 4*l(x).", "\n-2*x**2 + 2\nLet o(s) = 21*s**2 - 2*s + 13. ", "Let g be o(-3). ", "Let z(w) = -103*w - 15 - 96*w + g*w. ", "Let l(d) = -5*d + 8. ", "Let n be (11/2)/(2/(-4)). ", "Give n*l(x) - 6*z(x).", "\nx + 2\nLet l(m) = 424*m**2 + 40 - 45*m**3 - 699*m**2 - 40*m + 315*m**2. ", "Let i(o) = o**3 - o**2 + o - 1. ", "What is 120*i(d) + 3*l(d)?", "\n-15*d**3\nLet d(a) = 51*a**2 - 34*a - 34. ", "Suppose 0 = -11*z + 302 + 72. ", "Let r(s) = -s**2 + s + 1. ", "Give z*r(k) + d(k).", "\n17*k**2\nLet o(h) = 7531*h + 42. ", "Let n(v) = 3766*v + 18. ", "Determine 7*n(w) - 3*o(w).", "\n3769*w\nLet q(o) = -4*o**2 - 3*o + 4. ", "Let k(c) = c**2 - 1. ", "Suppose 3*j - 23 = -i, 0 = 2*i + 70*j - 67*j - 28. ", "Give i*k(v) + q(v).", "\nv**2 - 3*v - 1\nLet a(r) = -6*r - 35. ", "Let v(s) = s + 6. ", "Let j(w) = w**3 - 9*w**2 + 2*w + 7. ", "Let o be j(9). ", "Let z = -59 + o. Calculate z*v(n) - 6*a(n).", "\n2*n + 6\nLet c(m) be the first derivative of -5*m - 304581. ", "Suppose 2*a = -n - 3*a + 8, -5*a + 16 = -3*n. ", "Let x = -5 + 8. ", "Let p(d) = d - 6. ", "Calculate n*p(v) + x*c(v).", "\n-2*v - 3\nLet q(u) = u**2 - 8*u + 1. ", "Let w(c) be the second derivative of -c**4/6 + 17*c**3/6 - c**2 - 4155*c. ", "What is -13*q(p) - 6*w(p)?", "\n-p**2 + 2*p - 1\nLet n(b) = 27*b**2 - b + 26. ", "Let z(x) = -x**2 + 1. ", "Calculate -n(p) + 4*z(p).", "\n-31*p**2 + p - 22\nLet w(m) = 4*m**3 - 2*m**2 + 23*m - 10. ", "Let b(l) = 4*l**3 + l**2 + 6. ", "What is 2*b(r) + w(r)?", "\n12*r**3 + 23*r + 2\nLet v(f) = -10*f**2 + 20. ", "Let g(t) = -t**2 + 1. ", "Let x = -3125 + 3065. ", "Determine x*g(h) + 3*v(h).", "\n30*h**2\nLet b = 1974 - 1977. ", "Let d(l) = 4*l**2 + 8*l + 3. ", "Let y(w) = w**2 + w + 1. ", "Determine b*y(t) + d(t).", "\nt**2 + 5*t\nLet y(u) = 2*u**3 - u**2 + 3. ", "Let a(x) = 104*x**3 - 5*x**2 + 34. ", "Give a(j) - 5*y(j).", "\n94*j**3 + 19\nLet d(j) = 18*j**2 - 17*j - 7. ", "Let r(i) = 5*i**2 - 5*i - 2. ", "Let q(x) = 2*d(x) - 7*r(x). ", "Let s(h) = -4*h**3 - 2*h**2 - 2*h + 1. ", "Calculate 4*q(k) + 2*s(k).", "\n-8*k**3 + 2\nLet f(r) = -2*r**2 - 41*r - 1. ", "Let w(j) = -8*j**2 - 123*j - 2. ", "Give -8*f(x) + 3*w(x).", "\n-8*x**2 - 41*x + 2\nLet p(s) = -28*s**2 + 4*s + 36. ", "Let g(q) = 82*q**2 - 11*q - 106. ", "What is -6*g(h) - 17*p(h)?", "\n-16*h**2 - 2*h + 24\nLet k(a) = -a**3 + 8*a**2 - 7*a + 1. ", "Let p = -116 + 123. ", "Let b be k(p). ", "Let g(v) = 10*v + 10. ", "Let q(j) = j + 1. ", "Give b*g(x) - 12*q(x).", "\n-2*x - 2\nLet a be (-4)/10*(-9)/(-90)*50. ", "Let i(x) = -2*x + 3. ", "Let c(t) = -8*t + 12. ", "Let w(y) = 4*y - 6. ", "Let h(k) = -3*c(k) - 5*w(k). ", "What is a*h(d) - 5*i(d)?", "\n2*d - 3\nLet j(n) = 4*n + 5624. ", "Let v(w) = w + 1607. ", "Determine -5*j(p) + 18*v(p).", "\n-2*p + 806\nLet v(y) = -y + 8. ", "Let n = 2 - -4. ", "Let r(z) = -z - 15. ", "Let h(x) = -22 - 4*x + 3*x + 22. ", "Let p(q) = 3*h(q) - r(q). ", "Determine n*p(m) - 11*v(m).", "\n-m + 2\nLet w(t) = -21*t**2 + 3*t + 86. ", "Let u(q) = -21*q**2 + 2*q + 58. ", "Give -3*u(z) + 2*w(z).", "\n21*z**2 - 2\nLet l(o) = -2*o - 20. ", "Suppose 0 = 4*f - 12, 5*r + 3*f - 262 + 188 = 0. ", "Let q(j) = 3 - 1 + 8 + j. Calculate r*q(k) + 6*l(k).", "\nk + 10\nLet u(o) = -5*o**3 - 6*o**2 - 5*o + 24. ", "Let a(y) = 8*y**3 + 13*y**2 + 12*y - 58. ", "Calculate -2*a(h) - 5*u(h).", "\n9*h**3 + 4*h**2 + h - 4\nSuppose -58*c + 40*c + 348 = 69*c. ", "Let t(g) = 5*g - 19. ", "Let n(b) = -3*b + 10. ", "Determine c*t(s) + 7*n(s).", "\n-s - 6\nLet k(d) = -2*d - 6. ", "Let r be 10/(-2 - -2 - -2). ", "Let l(o) = 0 + 5 - 54605634*o + 54605637*o. ", "Calculate r*k(s) + 6*l(s).", "\n8*s\nLet p(v) = -358759*v**2 - 74226*v - 148452. ", "Let z(d) = 5*d**2 + d + 2. ", "Give p(l) + 74226*z(l).", "\n12371*l**2\nLet s(w) = 95*w**3 - 5*w**2 + 3*w + 4. ", "Let n(t) = 48*t**3 - 3*t**2 + t + 2. ", "Determine 7*n(p) - 3*s(p).", "\n51*p**3 - 6*p**2 - 2*p + 2\nLet m(l) = -13*l - 7. ", "Let z(n) be the first derivative of -n**5/20 - n**4/8 + 18*n**3 - 38. ", "Let v(x) be the third derivative of z(x). ", "What is -4*m(w) + 9*v(w)?", "\n-2*w + 1\nLet c(r) = -r**2 - 2. ", "Let m = -13 + -20. ", "Let n(a) = -17 + 16 + 15*a**2 + 10 + 24. ", "Determine m*c(s) - 2*n(s).", "\n3*s**2\nLet f(p) = 10*p**3 - 3*p**2 + 3*p + 34. ", "Let s(k) = 4*k**3 + k + 14. ", "Calculate -5*f(r) + 12*s(r).", "\n-2*r**3 + 15*r**2 - 3*r - 2\nLet z(n) = -2*n + 4. ", "Suppose 14*c + 97 = 13. ", "Let v(i) = 6*i**3 - i**2 + 2*i + 2. ", "Let r be v(-1). ", "Let w(d) = 2*d - 3. ", "Calculate c*z(k) + r*w(k).", "\n-2*k - 3\nLet y(o) = -1537*o**3 + 54*o**2 - 32*o - 15. ", "Let i(a) = 384*a**3 - 12*a**2 + 7*a + 4. ", "Give 9*i(d) + 2*y(d).", "\n382*d**3 - d + 6\nLet h(x) = 34*x**2 + 7*x. ", "Let m(b) = -17*b**2 - 3*b. ", "Suppose -3*f + 2*v = -3*v + 24, 4*f = -5*v + 3. ", "Determine f*h(n) - 7*m(n).", "\n17*n**2\nLet w(b) = 35086*b**3 + 38*b + 28. ", "Let f(n) = -28069*n**3 - 30*n - 22. ", "Calculate -14*f(m) - 11*w(m).", "\n7020*m**3 + 2*m\nLet m = 140 - 142. ", "Let d(v) = -3*v + 20. ", "Let j(q) = 2*q - 9. ", "Let g(o) = m*d(o) - 5*j(o). ", "Let i = -41 - -43. ", "Let r(x) = 5*x - 6. ", "Give i*r(s) + 3*g(s).", "\n-2*s + 3\nLet w(y) = -539*y. ", "Let c(n) = -11*n. ", "Suppose 0 = -t - 3*i + 195, 5*t - 994 = 31*i - 27*i. ", "Determine t*c(l) - 4*w(l).", "\n-22*l\nLet r(v) = 71*v**2 - 2*v + 17*v - 175*v**2 - 15 + 58*v**2 + 58*v**2. ", "Suppose 0*k + 3*k = 3. ", "Let l(u) = 1 - 3 + 3 - u**2 - u. Calculate k*r(s) + 15*l(s).", "\n-3*s**2\nLet p(b) = -2*b**3 - b**2 - b - 6. ", "Let r(f) = -121*f**3 - 5*f**2 - 4*f - 28. ", "Determine -5*p(o) + r(o).", "\n-111*o**3 + o + 2\nLet b(k) = -k**2 - 1. ", "Let y(m) = 3*m**2 + 12. ", "Let s(g) = -3*g**2 - 14*g + 116. ", "Let p be s(-9). ", "Give p*y(t) - 4*b(t).", "\nt**2 - 8\nLet h(b) = -1 + 4*b - 1 + 2. ", "Let j(y) = 5*y. ", "Let k(g) = -47*g**2 + 48*g**2 - 3*g + 3 + 5*g. ", "Let f be k(-3). ", "Give f*j(i) - 7*h(i).", "\n2*i\nLet i(j) = -3*j**3 - 7*j**2 - 9*j - 7. ", "Let r(w) = -w**3 - 2*w**2 - 3*w - 2. ", "Let o = 96 + -62. ", "Suppose o + 91 = -5*c. ", "Let k = c - -18. ", "Determine k*r(q) + 2*i(q).", "\nq**3 + 3*q\nLet y(b) = 11 + 0*b + 4*b - b**2 - 7. ", "Let l(r) = -r**2 + 3*r + 3. ", "Let q(z) = -4*l(z) + 3*y(z). ", "Let t(x) = -755*x**2 - 5 + 5 + 758*x**2. ", "What is 2*q(f) - t(f)?", "\n-f**2\nLet f(g) = 6*g - 385. ", "Let p(r) = -4*r + 184. ", "Calculate 3*f(z) + 5*p(z).", "\n-2*z - 235\nLet f(b) = -139*b**2 + 6*b - 2. ", "Let a(k) = 140*k**2 - 9*k + 3. ", "What is -4*a(p) - 6*f(p)?", "\n274*p**2\nLet g(a) = -33*a**3 - 8*a**2 - 12*a + 415. ", "Let m(w) = 61*w**3 + 15*w**2 + 22*w - 830. ", "Give -11*g(v) - 6*m(v).", "\n-3*v**3 - 2*v**2 + 415\nLet q(h) = 3315*h**3 - 52*h**2 + 260*h. ", "Let r(b) = -b**2 + 5*b. ", "What is q(y) - 52*r(y)?", "\n3315*y**3\nLet f(r) = -2*r - 29. ", "Let s(o) = 312*o - 143. ", "Determine -5*f(a) + s(a).", "\n322*a + 2\nLet k(q) = 91*q**2 - 364*q + 546. ", "Let o(l) = l**2 + 2*l - 3. ", "Calculate 3*k(c) + 546*o(c).", "\n819*c**2\nLet r(u) = 1915*u**2 - 3*u + 3. ", "Let m(k) = 8569624*k**2 - 13426*k + 13426. ", "Determine -9*m(h) + 40278*r(h).", "\n5754*h**2\nLet u(c) = 6277*c - 151. ", "Let j(w) = -3138*w + 60. ", "Calculate -5*j(t) - 2*u(t).", "\n3136*t + 2\nLet d(g) = -143*g - 9. ", "Let q(b) = 292*b + 19. ", "What is 5*d(k) + 2*q(k)?", "\n-131*k - 7\nLet f(l) = 23*l**3 + 2*l**2 - 11*l + 14. ", "Let q(a) = 41*a**3 + 4*a**2 - 20*a + 20. ", "Calculate 7*f(y) - 4*q(y).", "\n-3*y**3 - 2*y**2 + 3*y + 18\nLet h be -3 + (420/(-7))/10. ", "Let o(a) = 10*a**2 + a - 1. ", "Let j(q) = -41*q**2 - 5*q + 5. ", "Suppose 20 = 64*r - 74*r. ", "Give h*o(m) + r*j(m).", "\n-8*m**2 + m - 1\nLet p(v) be the first derivative of v**3 - 3*v**2/2 - 3*v + 6280. ", "Let t(z) be the first derivative of z**3 - 2*z**2 - 4*z - 7. ", "Give 4*p(f) - 3*t(f).", "\n3*f**2\nLet h(q) = 4*q**3 + 6*q**2 - 62*q + 6. ", "Let i(y) = 5*y**3 + 8*y**2 - 63*y + 4. ", "Calculate 4*h(k) - 3*i(k).", "\nk**3 - 59*k + 12\nLet k(" ]

{ "pile_set_name": "DM Mathematics" }

[ 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.030303030303030304, 0, 0, 0.038461538461538464, 0, 0, 0, 0, 0, 0, 0.043478260869565216, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.041666666666666664, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.03333333333333333, 0, 0, 0, 0, 0.038461538461538464, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.038461538461538464, 0, 0, 0, 0.041666666666666664, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.023809523809523808, 0, 0.045454545454545456, 0, 0, 0.041666666666666664, 0, 0, 0.03571428571428571, 0, 0, 0, 0, 0, 0.037037037037037035, 0, 0, 0, 0.02857142857142857, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.022727272727272728, 0, 0, 0, 0, 0, 0, 0.038461538461538464, 0, 0, 0, 0, 0, 0, 0, 0.038461538461538464, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.020833333333333332, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.02564102564102564, 0, 0.02127659574468085, 0, 0, 0, 0, 0, 0, 0, 0.038461538461538464, 0, 0, 0.034482758620689655, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.04, 0, 0, 0, 0, 0, 0.03225806451612903, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0 ]

[ { "analysis_explanation": null, "end": 40, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 32 }, { "analysis_explanation": null, "end": 904, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 902 }, { "analysis_explanation": null, "end": 944, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 941 }, { "analysis_explanation": null, "end": 1411, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1399 }, { "analysis_explanation": null, "end": 1674, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1669 }, { "analysis_explanation": null, "end": 1755, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1750 }, { "analysis_explanation": null, "end": 1886, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1881 }, { "analysis_explanation": null, "end": 1985, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1978 }, { "analysis_explanation": null, "end": 2228, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2225 }, { "analysis_explanation": null, "end": 2320, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2307 }, { "analysis_explanation": null, "end": 2498, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2489 }, { "analysis_explanation": null, "end": 2696, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2685 }, { "analysis_explanation": null, "end": 2767, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2762 }, { "analysis_explanation": null, "end": 2851, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2849 }, { "analysis_explanation": null, "end": 3577, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3574 }, { "analysis_explanation": null, "end": 3591, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3587 }, { "analysis_explanation": null, "end": 3612, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3608 }, { "analysis_explanation": null, "end": 3716, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3713 }, { "analysis_explanation": null, "end": 3865, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3863 }, { "analysis_explanation": null, "end": 4023, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4018 }, { "analysis_explanation": null, "end": 4989, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4987 }, { "analysis_explanation": null, "end": 5127, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5120 }, { "analysis_explanation": null, "end": 6196, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6193 }, { "analysis_explanation": null, "end": 6620, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6617 }, { "analysis_explanation": null, "end": 6677, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6674 }, { "analysis_explanation": null, "end": 6724, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6719 }, { "analysis_explanation": null, "end": 7101, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7098 }, { "analysis_explanation": null, "end": 7660, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7658 }, { "analysis_explanation": null, "end": 4420, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 4414 }, { "analysis_explanation": null, "end": 495, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 491 }, { "analysis_explanation": null, "end": 1003, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 999 }, { "analysis_explanation": null, "end": 1054, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 1050 }, { "analysis_explanation": null, "end": 4704, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 4700 }, { "analysis_explanation": null, "end": 4354, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 4346 }, { "analysis_explanation": null, "end": 4367, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 4359 }, { "analysis_explanation": null, "end": 2103, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 2097 }, { "analysis_explanation": null, "end": 4354, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 4346 }, { "analysis_explanation": null, "end": 4367, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 4359 }, { "analysis_explanation": null, "end": 4420, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 4414 }, { "analysis_explanation": null, "end": 4444, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 4438 }, { "analysis_explanation": null, "end": 7383, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 7376 } ]

[ "With the onset of ventilation at birth, pulmonary blood flow (PBF) increases 8- 10-fold with a concomitant fall in pulmonary vascular resistance. ", "Although recent physiological advances have highlighted the role of the vascular endothelium in contributing to these changes, of primary importance in this respect are nitric oxide (NO) and PGI2, both of which are pulmonary vasodilators produced by endothelium in response to a variety of stimuli, a complete understanding of the regulatory mechanisms involved remains unachieved. ", "Exogenous endothelin-1 (Et-1), which in endogenous form also is produced by endothelium, vasoconstricts adult pulmonary arteries (predominantly via EtA subtype receptors) whereas it vasodilates in the perinatal period (via EtB subtype receptors). ", "I propose that this difference relates to the ontogenetic differences in Et receptor subtypes. ", "In specific aim 1 I will examine the role of the 2 receptor subtypes in the regulation of basal vascular tone, by specific receptor inhibition or stimulation; I will examine the ontogeny of these receptors by studying fetuses at 2 different gestational ages. ", "I also will evaluate, using the in utero ventilation model we have developed, the role of endogenous Et-1 in affecting the perinatal changes in PBF and finally I will examine the mechanisms by which Et-1 might produce vasodilation, by examining the possible secondary role of NO production or of ATP-dependent K+ channel activation influence. ", "Since angiotensin II (AII) concentrations increase dramatically at birth, and since AII has been shown in other systems to stimulate PGI2 and NO production, in specific aim 2 I will examine with the in utero ventilation model, the role of endogenous AII in affecting the increase in PBF at birth. ", "Since 2 specific AII receptor subtypes are known, AT1 and AT2, specific blockers will be used to assess their relative importance in the increase in PBF. ", "I also will evaluate the potential mechanisms whereby AII may be acting (PGI2 or NO stimulation) by using selective inhibitors of PGI2 and NO production. ", "Calcitonin gene-related peptide (CGRP) is a potent vasodilator that in adults also produces pulmonary vasodilation. ", "Recent availability of a specific C1 receptor blocker, now affords the opportunity to evaluate the possible role of this highly important peptide in the fetal circulation, and particularly in the transitional period. ", "In specific aim 3, I will examine the role of CGRP in the regulation of basal pulmonary vascular tone, the role of CGRP in affecting the increase in PBF at birth, using the in utero ventilation model, and by selective blockade the role of NO production or ATP-dependent K+ channel activation in producing the changes in PBF. ", "In specific aim 4 I will examine whether platelet activating factor (PAF), which with exogenous administration produces fetal pulmonary vasodilation, also plays a functional role in the increase in PBF at birth. ", "These studies will provide further information on the mechanisms involved in the regulation of basal pulmonary vascular tone in the fetus, on the mechanisms involved in the dramatic increase in PBF at the time of birth and on some of the secondary mechanisms stimulated at this increase in PBF occurs." ]

{ "pile_set_name": "NIH ExPorter" }

[ 0.00684931506849315, 0, 0.004048582995951417, 0, 0, 0.0058309037900874635, 0.006734006734006734, 0.012987012987012988, 0, 0, 0, 0.009230769230769232, 0.0047169811320754715, 0.006644518272425249 ]

[ { "analysis_explanation": null, "end": 850, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 848 }, { "analysis_explanation": null, "end": 1492, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1478 }, { "analysis_explanation": null, "end": 2229, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 2227 } ]

[ "Q:\n\nUsing std::future to manipulate objects in C++11\n\nI'm experimenting with std::future, but haven't found any materials that deal with the usecase I have in mind and was hoping someone could either confirm or deny the validity of the approach excerpted below:\nclass Thing {\nprivate:\n\n std::string mValue;\n\npublic:\n Thing() : mValue( \"\" ) {}\n\n void set(const std::string& s)\n {\n mValue = s;\n reverse( mValue.begin(), mValue.end() );\n }\n\n const std::string& getValue() const\n {\n return mValue;\n }\n};\n\nint main(int argc, const char * argv[])\n{\n Thing* tA = new Thing();\n Thing* tB = new Thing();\n Thing* tC = new Thing();\n\n auto tLambda = [](const string& iStr, Thing* oThing) -> Thing* {\n oThing->set( iStr );\n return oThing;\n };\n\n future<Thing*> tA1 = async( launch::async, tLambda, \"This is a test...A\", tA );\n future<Thing*> tB1 = async( launch::async, tLambda, \"This is a test...B\", tB );\n future<Thing*> tC1 = async( launch::async, tLambda, \"This is a test...C\", tC );\n\n future<Thing*> tA2 = async( launch::async, tLambda, tA1.get()->getValue(), tA );\n future<Thing*> tB2 = async( launch::async, tLambda, tB1.get()->getValue(), tB );\n future<Thing*> tC2 = async( launch::async, tLambda, tC1.get()->getValue(), tC );\n\n cout << tA2.get()->getValue() << endl;\n cout << tB2.get()->getValue() << endl;\n cout << tC2.get()->getValue() << endl;\n\n return 0;\n}\n\nIn essence, I'd like to use std::future to update a pre-existing object's member variables rather than initializing and returning a new object (as is shown in most std::future examples I've seen). ", "In the example above, the model seems a little suspect. ", "I would love to hear any thoughts on the best way to achieve this sort of functionality. ", "Ultimately, I would like to embed this in a thread-pool sort of context. ", "\n(Note: On another user's suggestion, this is reposted from Stack Overflow).", "\n\nA:\n\nThere are two things that concern me in the code you offer:\n\nThe Thing instances pointed to by tA, tB, tC are leaked. ", "In this case it looks like it would be trivial to address this by stack allocating them, and passing their address to the async calls: Thing tA; async( ... , &tA);\nThe cross thread synchronization dependencies are not explicitly addressed. ", "Instead it's all implicit by the way the code is written. ", "Any mistake in the code to lead to data races. ", "For example if in creating tB2 it called the wrong get() or pass the wrong Thing*, not only would it be the wrong value, but it might race.", "\n\nI spent some time trying to figure out if proposed functionality such as Resumable Functions (pdf) would allow this to be nicer, and while I expect resumable functions would help in more general code, in your code I think a bigger problem is the factoring. ", "Namely, since nothing uses the middle state, the code passed to the future should encompass both operations.", "\nauto tLambdaBoth = [](const string& iStr, Thing* oThing) -> Thing* {\n auto pthing = tLambda(iStr, oThing);\n return tLambda(pthing->getValue(), oThing);\n}\n\nAnd writing this showed me a new angle on my second misgiving. ", "The original code mixed uses of the original pointer and the pointer returned by tLambda. ", "We know that they currently are the same pointer, but assuming that could restrict your options later. ", "In tLambdaBoth I'd rather see return tLambda(pthing->getValue(), pthing); so why not the same in the original code?", "\nSo we can address both points together by avoiding new, and then never reusing the original object; instead it always uses the pointer that's returned from the future:\nThing tA, tB, tC;\n\n// launch futures\nstd::vector<std::future<Thing*>> fut1;\nfut1.emplace_back(async(launch::async, tLambda, \"This is a test...A\", &tA));\nfut1.emplace_back(async(launch::async, tLambda, \"This is a test...B\", &tB));\nfut1.emplace_back(async(launch::async, tLambda, \"This is a test...C\", &tC));\n\n// launch second set; using values clearly no longer in flight\nstd::vector<std::future<Thing*>> fut2;\nfor (auto& fut : fut1)\n{\n auto pthing = fut.get();\n fut2.emplace_back(async(launch::async, tLambda, pthing->getValue(), pthing));\n}\n\n// report results\nfor (auto& fut : fut2)\n{\n cout << fut.get()->getValue() << endl;\n}\n\nWhile I definitely like this a lot better, I'm not sure I understand your use case well enough to say whether this addresses it. ", "Perhaps you should digest what I'm saying here, and then clarify your use case if this did not address what you were trying to determine about the validity of your approach.", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.009650180940892641, 0, 0, 0, 0.013157894736842105, 0, 0.004166666666666667, 0, 0, 0, 0, 0, 0.008888888888888889, 0.011111111111111112, 0, 0, 0.008547008547008548, 0, 0 ]

[ { "analysis_explanation": null, "end": 15, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.95, "start": 13 }, { "analysis_explanation": null, "end": 82, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.95, "start": 80 }, { "analysis_explanation": null, "end": 3024, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3010 }, { "analysis_explanation": null, "end": 295, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 293 }, { "analysis_explanation": null, "end": 374, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 372 }, { "analysis_explanation": null, "end": 482, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 480 }, { "analysis_explanation": null, "end": 845, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 843 }, { "analysis_explanation": null, "end": 929, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 927 }, { "analysis_explanation": null, "end": 1013, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 1011 }, { "analysis_explanation": null, "end": 1098, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 1096 }, { "analysis_explanation": null, "end": 1183, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 1181 }, { "analysis_explanation": null, "end": 1268, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 1266 }, { "analysis_explanation": null, "end": 1494, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 1492 }, { "analysis_explanation": null, "end": 1630, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 1628 }, { "analysis_explanation": null, "end": 3668, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 3666 }, { "analysis_explanation": null, "end": 3680, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 3678 }, { "analysis_explanation": null, "end": 3734, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 3732 }, { "analysis_explanation": null, "end": 3811, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 3809 }, { "analysis_explanation": null, "end": 3888, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 3886 }, { "analysis_explanation": null, "end": 4002, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 4000 }, { "analysis_explanation": null, "end": 4014, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 4012 }, { "analysis_explanation": null, "end": 4126, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 4124 }, { "analysis_explanation": null, "end": 437, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 428 }, { "analysis_explanation": null, "end": 1120, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 1114 }, { "analysis_explanation": null, "end": 1205, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 1199 }, { "analysis_explanation": null, "end": 1290, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 1284 }, { "analysis_explanation": null, "end": 1332, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 1326 }, { "analysis_explanation": null, "end": 1375, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 1369 }, { "analysis_explanation": null, "end": 1418, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 1412 }, { "analysis_explanation": null, "end": 4085, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 4079 }, { "analysis_explanation": null, "end": 4236, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 4230 } ]

[ "Introduction {#sec1-1}\n============\n\nOral squamous cell carcinoma (OSCC) is one the most common neoplasm of the head and neck (Zhou et al., ", "2016). ", "An estimated 263,900 new cases and 128,000 deaths from oral cavity cancer (including lip cancer) occurred in 2008 worldwide (Ahmedin et al., ", "2011).", "\n\nSeveral risk factors like use of tobacco, including smokeless tobacco and excessive consumption of alcohol are the major risk factors in oral cancer (Sankaranarayanan et al., ", "1999; Ko et al., ", "1995). ", "Late diagnosis and resistance to radiotherapy, chemotherapy are the major cause of poor prognosis in oral cancer patients (Julianaet al., ", "2012). ", "Recently, several studies have analyzed the biomarkers for predicting the prognosis of OSCC but no single study has found the appropriate result for clinical application.", "\n\nPreviously a microarray based study revealed that the expression of six genes including Paternally Expressed Gene 10 (PEG10) had significant up-regulation in OSCC cell line. ", "This study had demonstrated that the significant expression of PEG10 was found in radioresistant cells when compared with radiosensitive cells in a dose and time dependent manner (Ishigami et al., ", "2007).", "\n\nPEG10 was first identified by Ono et al., (", "2001). ", "PEG10 is well-known as a paternally expressed gene from a newly recognized imprinted region at human chromosome 7q21. ", "PEG10 shows parent of origin specific expression in monochromosomal hybrids (Ono et al., ", "2001; Sun et al., ", "2006). ", "PEG 10 mRNA is expressed in normal tissues of brain, kidney, ovary, spleen, thymus, testis, lymphoblasts, endothelial cells and placenta (Okabeet al., ", "2003; Kainzet al., ", "2007). ", "Okabeet al., (", "2003) found that overexpression of PEG10 may block TGF-β signaling pathway via binding to TGF-β receptors II and may cause decrease in cell death through interaction with SIAH1 (antisense S-oligonucleotides) in human hepatocellular carcinoma.", "\n\nPEG10 is the essential protein for cell proliferation, migration, invasion, and its expression may help to predict the radiotherapy treatment response for the OSCC patients and their prognosis. ", "In this study we examined the expression of PEG10 in OSCC and analyzed its expression in relation to clinicopathological features, radiotherapy treatment response and survival. ", "We evaluated the prognostic significance of PEG10 in OSCC patients.", "\n\nMaterials and Methods {#sec1-2}\n=====================\n\nStudy Population {#sec2-1}\n----------------\n\nWe recruited 118 histopathologically confirmed tissue samples from OSCC patients (who were recommended for the Radiotherapy treatment) as well as eighty matched controls for the evaluation of PEG10 mRNA expression. ", "Healthy matched individuals (n=80) attending dental procedures for dental implant or benign cyst were included as control group (for tissue samples). ", "The tissue specimens were collected from the department of Radiotherapy and Oral and Maxillofacial Surgery, King George's Medical University, Lucknow, India. ", "The OSCC tissue specimens were derived from the buccal mucosa, tongue (excluding base of tongue), hard palate, floor of mouth, alveolus and lip. ", "All the collected tissues were instantly stored in trizol solution at -80°C deep freezer. ", "Ethical approval was obtained from the Institutional Ethics Committee (IEC number XLIV ECM/B-P11) before the start of the study. ", "Informed written consent was taken from all the participants before their inclusion into the study. ", "The characteristics of the OSCC patients including age, clinical stage (TNM classification defined by the American Joint Committee on Cancer AJCC 2010, VIIth edition) (Edge SB and Compton CC, 2010) and adverse oral habits (tobacco and alcohol) were assessed by radiation oncologist. ", "Patients with more than 18 years of age, normal hematological, renal and liver function test were included. ", "Patients with history of prior chemotherapy, radiotherapy and surgery and distant metastasis were excluded from the study.", "\n\nTreatment and Response Assessment {#sec2-2}\n---------------------------------\n\nPatients of OSCC were subjected to radiotherapy using tele-cobalt radiotherapy machine (Theratron 780 E, AECL, Ottawa) in the Department of Radiotherapy. ", "A dose of 70 Gy of radiation was delivered to all the patients in 7 weeks with 2 Gy fraction size, 5 days a week (46 Gy to primary and whole neck followed by 24 Gy after sparing the cord). ", "The response to treatment was assessed by World Health Organization (WHO) criteria after one month of completion of treatment (Hoogstraten et al., ", "1979).", "\n\nPatients were followed up after treatment and evaluated for survival. ", "The primary endpoints were treatment response and overall survival (OS) from the date of diagnosis to the date of death from any cause and patients were censored who were alive on the date of last follow up examination.", "\n\nPreparation of cDNA {#sec2-3}\n-------------------\n\nThe tissue specimens of OSCC patients and controls were collected in TRIzol Reagent (Ambion, Life Technology) and immediately homogenized with T25 basic homogenizer (IKA Labortechnik, Stanfen, Germany). ", "Total RNA was isolated according to TRIzol Reagent protocol and stored at -80°C for further use. ", "The total RNA of each sample was reverse transcribed to cDNA using cDNA synthesis kit (Thermo Scientific, EU, Lithuania) according to the manufacturer's protocol.", "\n\nAnalysis of mRNA expression by real-time quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR) {#sec2-4}\n---------------------------------------------------------------------------------------------------------------\n\nqRT-PCR analysis was performed according to the manufacturer's protocol (Takara SYBR Fast qPCR kit, Takara Biosystem). ", "The qRT-PCR reactions were performed using Applied Biosystem 7900 HT real time PCR system and reactions were carried out in triplicates. ", "Beta-actin was taken as an internal control and used to normalize ratio between samples. ", "The primer sets specific for PEG10 (Forward: 5'-GACTCCGGCTTTGACACAACA-3', Reverse: 5'-AACGCTGGAGCCACCAGTAA-3') and beta actin (Forword: 5'-GCACAGAGCCTCGCCTT-3', Reverse: 5'-GTTGTCGACGACGAGCG-3') were used. ", "An initial incubation of enzyme denaturation at 95°C for 10 minutes followed by 45 rounds of amplification at 95°C (10 sec) for denaturation, 58-65°C (10 sec) for annealing and 72°C (30 sec) for extension for performing qRT-PCR. ", "Relative change in mRNA level between tumor and matched normal control tissue were calculated by using 2¯ΔΔct method.", "\n\nStatistical analysis {#sec2-5}\n--------------------\n\nOne way ANNOVA using Turkey's Multiple Comparison test was used to compare the mRNA expression levels between different groups in both cases and controls. ", "Comparisons were made between categorical groups by chi-square (χ^2^) test. ", "Survival curves were plotted compared by Log rank (Mantel-Cox: χ^2^) test using Kaplan-Meier method. ", "Cox-regression analysis was conducted to find out independent prognostic factors of overall survival. ", "A two-tailed p\\<0.05 was considered statistically significant.", "\n\nResults {#sec1-3}\n=======\n\nThe demographic and clinicopathological characteristics of OSCC patients are summarized in ([table 1](#T1){ref-type=\"table\"}). ", "The age range was 22-72 years (mean ± SD, 44.9 ± 7.2 years) for OSCC patients and 21-70 years (mean ± SD, 42.1 ± 13.9 years) for controls. ", "The number of male patients was 72.9% which was higher than the female patients. ", "Majority of the patients had carcinoma of buccal mucosa (52.5 %) followed by tongue (24.6 %) as primary disease sites. ", "It was observed that most of the patients (63.6%) had habit of tobacco chewing. ", "The distributions of OSCC according to histopathological grading were 58 patients (49.2%) with well differentiated histology, 42 patients (39.8%) were moderately differentiated and 13 patients (11.0%) were poorly differentiated. ", "Out of total 118 patients, T4 tumor size were the commonest (43.2%), Lymph node positive (66.1%), and advanced stage, (stage III and IV) (89.3%). ", "qRT-PCR study revealed highly significant (p\\<0.001) mRNA expression of PEG10 in OSCC patients cases as compared to matched controls. ", "Moreover the mRNA expression of PEG10 was higher in 70.3% (83/118) patients and 29.7% (35/118) patients had low PEG10 mRNA expression ([Table 2](#T2){ref-type=\"table\"}).", "\n\n###### \n\nDemographic and Clinicopathological Characteristic of OSCC Patients (n=118)\n\n Characteristic /category No. ", "of patient (%)\n --------------------------------- --------------------\n Age (Years) \n  20-30 14 (11.8)\n  31-40 29 (24.6)\n  41-50 37 (31.4)\n  51-60 27 (22.9)\n  61-70 11 (9.3)\n Sex \n  Female 32 (27.1)\n  Male 86 (72.9)\n Tobacco Chewing \n  No 43 (36.4)\n  Yes 75 (63.6)\n Smoking \n  No 57 (48.3)\n  Yes 61 (51.7)\n Alcohol Consumption \n  No 62 (52.5)\n  Yes 56 (47.5)\n Primary Site \n  Buccal Mucosa 62 (52.5)\n  Oral tongue 29 (24.6)\n  Alveolus 18 (15.3)\n  Retromolartrigone 4 (3.4)\n  Lips 3 (2.5)\n  Hard Palate 2 (1.7)\n SCC Differentiation \n  Well 58 (49.2)\n  Moderate 47 (49.8)\n  Poor 13 (11.1)\n Tumor Size \n  T1 5 (4.2)\n  T2 25 (21.2)\n  T3 37 (31.4)\n  T4 51 (43.2)\n Lymph node status \n  N0 39 (33.1)\n  N1 42(35.6)\n  N2 30 (25.4)\n  N3 7 (5.9)\n Stage \n  Early 12 (10.2)\n  Advanced 106 (89.8)\n Radiotherapy Treatment response \n  Responder's 67 (56.8)\n  Non-Responder's 51 (43.2)\n\n###### \n\nCorrelation of PEG10 Gene Expression with the Clinicopathological Characteristics\n\n Variables Category Number of patients (%) PEG10 mRNA expression (n, %) Low level of expression high level of expression P value\n ----------------------- ------------- ------------------------ ------------------------------------------------------ -------------------------- ---------------\n Total 118 35 (29.7) 83 (70.3) \n SCC Differentiation Well 58 (49.2) 19 (32.7) 39 (67.2) p= 0.6012\n Poor and Moderate 60 (50.8) 16 (26.7) 44 (73.3) \n Tumor size T1-T2 30 (25.4) 12 (40) 18 (60) p= 0.2285\n T3-T4 88 (74.6) 23 (26.1) 65 (73.9) \n Lymph node metastasis Negative 40 (33.9) 19 (47.5) 21 (52.5) **p=0.0047**\n Positive 78 (66.1) 16 (20.5) 62 (79.5) \n Stage Early stage 12 (10.2) 7 (58.3) 5 (41.7) **p= 0.0499**\n Advanced stage 106 (89.8) 28 (26.4) 78 (73.6) \n\nSignificant p values were highlighted in bold.", "\n\nThe association between PEG10 mRNA expressions (Low and high) and clinicopathological characteristics was done using χ^2^ test and shown in ([Table 2](#T2){ref-type=\"table\"}). ", "Overexpression of PEG10 significantly correlated with lymph node metastasis (N1 and N2) vs lymph node negative (N0) (p=0.0047) and advanced Stage (III and IV) vs early stage (I and II) (p=0.049). ", "Out of 118 patients, 67 (56.8%) patients were responders (complete response and partial response) and 51 patients (43.2%) were non responders (no response or progressive disease) ([Table 3](#T3){ref-type=\"table\"}). ", "The increase in expression of PEG10 mRNA was found to be highly significant (p\\<0.001) in non responders when compared to responder OSCC patients.", "\n\n###### \n\nCorrelation of Clinicopathological Characteristics and PEG10 Expression with Overall Survival Using Cox's Regression Analysis (n=118)\n\n Predictors Number of patients(%) Univariate (unadjusted) Multivariate[\\*\\*](#t3f2){ref-type=\"table-fn\"} (adjusted) \n ---------------------------------------- ----------------------- ------------------------- ----------------------------------------------------------- --------------------- -------\n Total 118 \n Age (yrs): \n  \\<=45 67 (56.8) 1.0 (Ref) 1.0 (Ref) \n  \\>45 51 (43.2) 1.411 (0.796-2.500) 0.238 1.679 (0.905-3.118) 0.101\n Sex: \n  Female 32 (27.1) 1.0 (Ref) 1.0 (Ref) \n  Male 86 (72.9) 0.898 (0.481-1.677) 0.736 0.625 (0.315-1.242) 0.18\n Primary site: \n Buccal mucosa 62 (52.5) 1.0 (Ref) 1.0 (Ref) \n  Other[\\*](#t3f1){ref-type=\"table-fn\"} 56 (47.5) 1.166 (0.660-2.058) 0.596 1.011 (0.561-1.825) 0.97\n SCC Grade: \n  WD 58 (49.2) 1.0 (Ref) 1.0 (Ref) \n  MD/PD 60 (50.8) 1.243 (0.700-2.207) 0.458 1.317 (0.720-2.407) 0.371\n Tumor size: \n  T1/T2 30 (25.4) 1.0 (Ref) 1.0 (Ref) \n  T3/T4 88 (74.6) 1.725 (0.835-3.566) 0.141 1.838 (0.813-4.153) 0.143\n Lymph node metastasis: \n  Negative 40 (33.9) 1.0 (Ref) 1.0 (Ref) \n  Positive 78 (66.1) 2.515 (1.274-4.967) 0.008 1.880 (0.835-4.231) 0.127\n Stage: \n  I/II 12 (10.2) 1.0 (Ref) 1.0 (Ref) \n  III/IV 106 (89.8) 2.702 (.836-8.731) 0.097 1.032 (0.237-4.500) 0.966\n PEG 10: \n  Low 35 (29.7) 1.0 (Ref) 1.0 (Ref) \n  High 83 (70.3) 3.240 (1.505-6.979) 0.003 2.982 (1.278-6.957) 0.011\n\nCI, Confidence interval; Bold, Significant association (P\\<0.05); Reference category, 1.0;\n\nOthers, Tongue, Alveolus, Floor of mouth, Lip, soft palate;\n\nAdjusted for age, sex and Clinicopathological parameters.", "\n\nThe follow up time for patients that were used for analysis of PEG10 mRNA expression ranged from 10 month to 73 months (mean: 42.7 months, median: 45 months). ", "During this period, 70 (59.3%) patients were alive and 48 (40.7%) were died. ", "Survival rate for low and high expression of PEG10 were 77.1% and 51.8% respectively after a median follow up of 45 months. ", "The PEG10 mRNA expression significantly correlated with survival and patient with high expression had shortened survival (log-rank, P = 0.003) as observed by Kaplan-Meier analysis ([Figure 1](#F1){ref-type=\"fig\"}).", "\n\n{#F1}\n\nTo find out independent prognostic factors of overall survival, univariate and multivariate Cox regression analysis were done which is summarized in (Table 4). ", "The univariate Cox regression analysis revealed significant (p=0.008, p=0.097 and p=0.003) association of overall survival with lymph node metastasis, stage and PEG10 mRNA expressions. ", "In multivariate Cox regression analysis, the expression of PEG10 mRNA remained as a significant and independent predictor of survival after adjustment for age, sex, adverse habits and clinicopathological parameters, (HRR=2.982, 95% CI, 1.278-6.957, P=0.011).", "\n\nDiscussion {#sec1-4}\n==========\n\nOur research demonstrated significant increase in the mRNA expression of PEG10 in tissue samples from patients diagnosed with OSCC. ", "The significant expression of PEG10 was also found previously in different types of human cancers such as hepatocellular carcinoma, gallbladder cancer, leukaemia, lung cancer, breast cancer, prostate cancer and pancreatic cancer (Liet al., ", "2006; Liu et al., ", "2011; Tsou et al., ", "2003; Li et al., ", "2016; Denget al., ", "2014).", "\n\nRadiation therapy has an important contribution in the treatment of oral cancer but sometimes cancer cells do not respond to radiotherapy (Ishigami et al., ", "2007; Terakado et al., ", "2004). ", "Current study demonstrated that the expression of PEG10 was higher in radioresistant tumor.", "\n\nSeveral studies have demonstrated that PEG10 expression can be regulated by the proto-oncogene, c-MYC, via the binding of the c-MYC oncoprotein to the E-box-containing region of the first intron of PEG10 (Li et al., ", "2006; Ip et al., ", "2007; Jie et al., ", "2007). ", "Previous reports indicated that the expression of PEG10 was significantly associated with poor survival in gall bladder carcinoma and hepatocellular carcinoma patients (Liu et al., ", "2014; Bang et al., ", "2014). ", "It was also found that overexpression of PEG10 enhanced cell proliferation, migration and invasion in breast cancer (Li et al., ", "2016) and it plays a crucial role in human lung cancer proliferation, progression, prognosis and metastasis as well (Deng et al., ", "2014).", "\n\nLiu et al., (", "2014) demonstrated that overexpression of PEG10 showed significant association with large tumor size, lymph node metastasis and advanced tumor stage and worse overall survival in patients with adenocarcinoma of gall bladder. ", "In current study, we found the significant over expression of mRNA PEG10 in advanced stage and lymph node metastasis. ", "This observation reflects the mRNA activity of PEG10 and its association with the tumor progression and poor prognosis in OSCC.", "\n\nCurrently, there are no specific biomarkers available that can reliably predict the outcome of radiotherapy treatment response in OSCC. ", "Ishigami et al., (", "2006) revealed that inhibition of\n\nPEG10 gene enhances radiosensitivity in human oral squamous carcinoma cell line. ", "No single study on OSCC patients has revealed significant association of PEG10 mRNA expression with radiotherapy treatment response. ", "In this study, significantly higher mRNA expression of PEG10 was found in non responder when compared to responders undergoing radiotherapy indicating that increase in the expression of PEG10 is associated with poor response in OSCC patients.", "\n\nNo previous study demonstrated any association between overexpression of PEG10 and clinical outcome as well as survival in oral cancer patients. ", "In the current study, we observed the association between overexpression of mRNA PEG10 and clinical response and as well as poor survival. ", "This implies that significance of using PEG10 as a predictive marker for response. ", "These observations may further provide support that PEG10 is involved in the invasion and nodal metastasis of OSCC and may play a decisive role in the overall therapeutic outcome in OSCC.", "\n\nWe conducted the study in 118 oral cancer patients from India and found that PEG10 is overexpressed in OSCC patients. ", "We also observed poor survival in patients where PEG10 were overexpressed as compared with low expression, suggesting the possibility of resistance to radiation in these patients and documenting the prognostic role of over expressed PEG10 in OSCC. ", "However, the limitation of this study is the expression of PEG10 may or may not translate to patients of other ethnicities due to variability in genetic constitution and disease presentation differences. ", "It requires more studies with larger patient populations to understand genetic variability of PEG10 expression among individuals in order to develop useful therapeutic approach and its correlation with radioresistance.", "\n\nPEG10 may help in finding the pattern of radio-resistance in OSCC cases on the basis of clinicopathological parameters and could be found suitable for the use as a molecular marker to evaluate the response of OSCC undergoing radiotherapy. ", "In conclusion, we observed significant increase in the mRNA expression of PEG10 in OSCC patients when compared to matched controls. ", "We also found that overexpression of PEG10 gene was found to be significantly higher in lymph node positive when compared to lymph node negative OSCC patients. ", "The PEG10 mRNA expression was significantly higher in non responders as compared to responders patient after radiotherapy treatment. ", "Since the overexpression of PEG10 mRNA levels alter many signaling pathways found to be involved in the development and prognosis of OSCC, which may lead to the consideration that altered level of this gene may be helpful in predicting radiotherapy treatment response in OSCC patients. ", "These results support that PEG10 could be used as potential biomarker for the OSCC patients undergoing radiotherapy treatment.", "\n\nStatement conflict of Interest {#sec2-6}\n------------------------------\n\nThe authors declare no conflict of interests for this research.", "\n\nThis study was supported by the Indian Council of Medical Research Grant No. ", "3/2/2/68/2011/NCD III.", "\n" ]

{ "pile_set_name": "PubMed Central" }

[ 0.007142857142857143, 0, 0.0070921985815602835, 0, 0, 0.058823529411764705, 0, 0.007246376811594203, 0, 0, 0.005681818181818182, 0.005076142131979695, 0, 0.022222222222222223, 0, 0, 0.011235955056179775, 0.05555555555555555, 0, 0, 0.05263157894736842, 0, 0, 0.01652892561983471, 0, 0, 0, 0.0031545741324921135, 0.006666666666666667, 0.006329113924050633, 0, 0, 0.023255813953488372, 0, 0.01060070671378092, 0, 0, 0.01276595744680851, 0, 0.006802721088435374, 0, 0, 0, 0.0078125, 0.020618556701030927, 0.018518518518518517, 0.0028089887640449437, 0, 0, 0.009708737864077669, 0.013100436681222707, 0, 0.004761904761904762, 0, 0.0297029702970297, 0, 0, 0, 0, 0, 0, 0, 0, 0.00684931506849315, 0, 0, 0, 0.001034928848641656, 0, 0, 0, 0, 0.00446255335661622, 0, 0, 0, 0.004672897196261682, 0, 0.0033444816053511705, 0, 0.007751937984496124, 0, 0.004166666666666667, 0.05555555555555555, 0, 0.058823529411764705, 0.05555555555555555, 0, 0.006329113924050633, 0, 0, 0, 0.0045871559633027525, 0, 0.05555555555555555, 0, 0.0055248618784530384, 0.05263157894736842, 0, 0.0078125, 0.007692307692307693, 0, 0.06666666666666667, 0, 0, 0, 0, 0.05555555555555555, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.012658227848101266, 0.045454545454545456, 0 ]

[ { "analysis_explanation": null, "end": 138, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 127 }, { "analysis_explanation": null, "end": 144, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 140 }, { "analysis_explanation": null, "end": 260, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 256 }, { "analysis_explanation": null, "end": 286, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 272 }, { "analysis_explanation": null, "end": 292, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 288 }, { "analysis_explanation": null, "end": 468, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 445 }, { "analysis_explanation": null, "end": 474, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 470 }, { "analysis_explanation": null, "end": 485, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 476 }, { "analysis_explanation": null, "end": 491, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 487 }, { "analysis_explanation": null, "end": 630, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 617 }, { "analysis_explanation": null, "end": 636, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 632 }, { "analysis_explanation": null, "end": 908, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 898 }, { "analysis_explanation": null, "end": 1179, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1164 }, { "analysis_explanation": null, "end": 1185, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1181 }, { "analysis_explanation": null, "end": 1228, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1218 }, { "analysis_explanation": null, "end": 1236, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1232 }, { "analysis_explanation": null, "end": 1444, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1434 }, { "analysis_explanation": null, "end": 1450, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1446 }, { "analysis_explanation": null, "end": 1462, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1452 }, { "analysis_explanation": null, "end": 1468, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1464 }, { "analysis_explanation": null, "end": 1620, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1609 }, { "analysis_explanation": null, "end": 1626, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1622 }, { "analysis_explanation": null, "end": 1639, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1628 }, { "analysis_explanation": null, "end": 1645, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1641 }, { "analysis_explanation": null, "end": 1659, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1648 }, { "analysis_explanation": null, "end": 1667, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1663 }, { "analysis_explanation": null, "end": 2916, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2895 }, { "analysis_explanation": null, "end": 2959, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2952 }, { "analysis_explanation": null, "end": 2966, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2961 }, { "analysis_explanation": null, "end": 3170, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3164 }, { "analysis_explanation": null, "end": 3582, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3578 }, { "analysis_explanation": null, "end": 3628, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3624 }, { "analysis_explanation": null, "end": 3754, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3729 }, { "analysis_explanation": null, "end": 4122, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4113 }, { "analysis_explanation": null, "end": 4134, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4130 }, { "analysis_explanation": null, "end": 4142, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4136 }, { "analysis_explanation": null, "end": 4252, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4245 }, { "analysis_explanation": null, "end": 4284, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4278 }, { "analysis_explanation": null, "end": 4466, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4457 }, { "analysis_explanation": null, "end": 4513, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4495 }, { "analysis_explanation": null, "end": 4519, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4515 }, { "analysis_explanation": null, "end": 4788, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4772 }, { "analysis_explanation": null, "end": 4938, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4932 }, { "analysis_explanation": null, "end": 5054, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5047 }, { "analysis_explanation": null, "end": 5063, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5056 }, { "analysis_explanation": null, "end": 5271, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5269 }, { "analysis_explanation": null, "end": 5282, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5273 }, { "analysis_explanation": null, "end": 5677, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5661 }, { "analysis_explanation": null, "end": 6179, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6169 }, { "analysis_explanation": null, "end": 6539, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6533 }, { "analysis_explanation": null, "end": 7192, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7181 }, { "analysis_explanation": null, "end": 7221, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7212 }, { "analysis_explanation": null, "end": 7256, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7245 }, { "analysis_explanation": null, "end": 7286, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7276 }, { "analysis_explanation": null, "end": 9294, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9281 }, { "analysis_explanation": null, "end": 13676, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13668 }, { "analysis_explanation": null, "end": 18258, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18237 }, { "analysis_explanation": null, "end": 18277, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18266 }, { "analysis_explanation": null, "end": 18296, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18287 }, { "analysis_explanation": null, "end": 18498, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18489 }, { "analysis_explanation": null, "end": 18952, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18949 }, { "analysis_explanation": null, "end": 19035, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19032 }, { "analysis_explanation": null, "end": 19221, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19218 }, { "analysis_explanation": null, "end": 19864, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19856 }, { "analysis_explanation": null, "end": 19870, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19866 }, { "analysis_explanation": null, "end": 19882, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19872 }, { "analysis_explanation": null, "end": 19888, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19884 }, { "analysis_explanation": null, "end": 19901, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19890 }, { "analysis_explanation": null, "end": 19907, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19903 }, { "analysis_explanation": null, "end": 19918, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19909 }, { "analysis_explanation": null, "end": 19924, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19920 }, { "analysis_explanation": null, "end": 19936, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19926 }, { "analysis_explanation": null, "end": 19942, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19938 }, { "analysis_explanation": null, "end": 20099, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20084 }, { "analysis_explanation": null, "end": 20105, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20101 }, { "analysis_explanation": null, "end": 20122, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20107 }, { "analysis_explanation": null, "end": 20128, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20124 }, { "analysis_explanation": null, "end": 20437, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20428 }, { "analysis_explanation": null, "end": 20443, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20439 }, { "analysis_explanation": null, "end": 20454, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20445 }, { "analysis_explanation": null, "end": 20460, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20456 }, { "analysis_explanation": null, "end": 20472, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20462 }, { "analysis_explanation": null, "end": 20478, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20474 }, { "analysis_explanation": null, "end": 20660, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20650 }, { "analysis_explanation": null, "end": 20666, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20662 }, { "analysis_explanation": null, "end": 20679, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20668 }, { "analysis_explanation": null, "end": 20685, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20681 }, { "analysis_explanation": null, "end": 20814, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20805 }, { "analysis_explanation": null, "end": 20820, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20816 }, { "analysis_explanation": null, "end": 20944, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20933 }, { "analysis_explanation": null, "end": 20950, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20946 }, { "analysis_explanation": null, "end": 20963, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20953 }, { "analysis_explanation": null, "end": 20971, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20967 }, { "analysis_explanation": null, "end": 21589, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21574 }, { "analysis_explanation": null, "end": 21597, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21593 }, { "analysis_explanation": null, "end": 22701, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 22696 }, { "analysis_explanation": null, "end": 24728, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.6, "start": 24722 }, { "analysis_explanation": null, "end": 14103, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 14091 }, { "analysis_explanation": null, "end": 14636, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 14624 }, { "analysis_explanation": null, "end": 14730, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 14704 }, { "analysis_explanation": null, "end": 15262, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 15242 }, { "analysis_explanation": null, "end": 15795, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 15774 }, { "analysis_explanation": null, "end": 16328, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 16307 }, { "analysis_explanation": null, "end": 17394, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 17373 }, { "analysis_explanation": null, "end": 3299, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 3296 }, { "analysis_explanation": null, "end": 5009, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 5006 }, { "analysis_explanation": null, "end": 7141, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 7139 }, { "analysis_explanation": null, "end": 7840, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 7838 }, { "analysis_explanation": null, "end": 8239, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 8237 }, { "analysis_explanation": null, "end": 9765, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 9763 }, { "analysis_explanation": null, "end": 9809, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 9807 }, { "analysis_explanation": null, "end": 9855, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 9853 }, { "analysis_explanation": null, "end": 9901, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 9899 }, { "analysis_explanation": null, "end": 9984, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 9982 }, { "analysis_explanation": null, "end": 10030, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 10028 }, { "analysis_explanation": null, "end": 10075, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 10073 }, { "analysis_explanation": null, "end": 10121, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 10119 }, { "analysis_explanation": null, "end": 11311, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 11309 }, { "analysis_explanation": null, "end": 11314, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 11312 }, { "analysis_explanation": null, "end": 11444, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 11442 }, { "analysis_explanation": null, "end": 11447, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 11445 }, { "analysis_explanation": null, "end": 12407, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 12405 }, { "analysis_explanation": null, "end": 12508, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 12506 }, { "analysis_explanation": null, "end": 12515, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 12513 }, { "analysis_explanation": null, "end": 12543, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 12541 }, { "analysis_explanation": null, "end": 12818, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 12816 }, { "analysis_explanation": null, "end": 15977, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 15975 }, { "analysis_explanation": null, "end": 15980, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 15978 }, { "analysis_explanation": null, "end": 16153, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 16151 }, { "analysis_explanation": null, "end": 16156, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 16154 }, { "analysis_explanation": null, "end": 18695, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 18693 }, { "analysis_explanation": null, "end": 18854, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 18852 } ]

[ "Q:\n\nIonic 2 : How do you reinstantiate @ViewChild if you dismiss the view?", "\n\nI'm creating a chat experience and the page keeps up with the conversation by using the scrollToBottom method from Content on ionic-angular. ", "If I start at the \"PreChat.html\" and go to \"Chat.html\" then I dismiss \"Chat.html\" to go back to \"PreChat.html\" and return again to \"Chat.html\" I get the following error: \"Cannot read property 'scrollToBottom' of null\". ", "The experience should be able to be entered into at any time or repeatedly.", "\nPreChat.html:\n<ion-content>\n <button (click)=\"goToChat()\" href=\"#\">\n Chat\n </button>\n</ion-content>\n\nPreChat.ts:\nimport { Component } from '@angular/core';\nimport { ModalController } from 'ionic-angular';\nimport { Chat } from '../chat';\n\n@Component({\n selector: 'preChat',\n templateUrl: 'preChat.html'\n})\nexport class PreChat {\n constructor(private modalCtrl: ModalController){}\n\n goToChat(): any {\n let profileModal = this.modalCtrl.create(Chat);\n profileModal.present();\n }\n}\n\nChat.html:\n<ion-content>\n <button ion-button=\"filter-button\"(click)=\"dismiss()\">\n <ion-icon name=\"close\"></ion-icon>\n </button>\n <div *ngFor=\"let convo of conversationArray\">\n <div class=\"b-text\">{{convo.speak}}</div>\n </div>\n</ion-content>\n\nChat.ts:\nimport { Component, ViewChild } from '@angular/core';\nimport { Content, Events, ViewController } from 'ionic-angular';\n\n@Component({\n templateUrl: 'Chat.html'\n})\n\nexport class Chat {\n @ViewChild(Content) content: Content;\n conversationArray: any[] = [];\n constructor(private events: Events, private viewCtrl: ViewController){\n this.events.subscribe('conversation', convo => {\n this.conversationArray = convo;\n this.content.scrollToBottom();\n })\n }\n dismiss() {\n this.viewCtrl.dismiss(); \n }\n}\n\nA:\n\nYou have to use ionViewDidEnter page event instead of the constructor for that.", "\n\nRuns when the page has fully entered and is now the active page. ", "This\n event will fire, whether it was the first load or a cached page.", "\n\nionViewDidEnter() : void {\n this.platform.ready().then(() => { //platform ready\n this.events.subscribe('conversation', convo => {\n this.conversationArray = convo;\n this.content.scrollToBottom();\n })\n })\n}\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.013513513513513514, 0.006993006993006993, 0, 0, 0.008082292432035268, 0, 0, 0 ]

[ { "analysis_explanation": null, "end": 816, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.85, "start": 806 }, { "analysis_explanation": null, "end": 1187, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1170 }, { "analysis_explanation": null, "end": 1234, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1199 }, { "analysis_explanation": null, "end": 1299, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1290 }, { "analysis_explanation": null, "end": 1364, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1350 }, { "analysis_explanation": null, "end": 1426, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.85, "start": 1419 }, { "analysis_explanation": null, "end": 1513, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1496 }, { "analysis_explanation": null, "end": 245, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 235 }, { "analysis_explanation": null, "end": 267, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 260 }, { "analysis_explanation": null, "end": 294, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 287 }, { "analysis_explanation": null, "end": 323, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 313 }, { "analysis_explanation": null, "end": 355, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 348 }, { "analysis_explanation": null, "end": 521, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 511 }, { "analysis_explanation": null, "end": 962, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 945 }, { "analysis_explanation": null, "end": 993, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 978 }, { "analysis_explanation": null, "end": 1016, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 1009 }, { "analysis_explanation": null, "end": 1618, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 1604 }, { "analysis_explanation": null, "end": 1666, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 1659 }, { "analysis_explanation": null, "end": 1712, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 1697 }, { "analysis_explanation": null, "end": 1763, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 1756 }, { "analysis_explanation": null, "end": 2053, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 2037 }, { "analysis_explanation": null, "end": 2106, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 2092 }, { "analysis_explanation": null, "end": 2154, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 2147 }, { "analysis_explanation": null, "end": 2200, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 2185 } ]

[ "//\n// Generated by class-dump 3.5 (64 bit) (Debug version compiled Jun 9 2015 22:53:21).", "\n//\n// class-dump is Copyright (C) 1997-1998, 2000-2001, 2004-2014 by Steve Nygard.", "\n//\n\n#import <objc/NSObject.h>\n\n@class NSTimer;\n\n@interface CLKTimer : NSObject\n{\n NSTimer *localTimer;\n id userInfo;\n}\n\n+ (id)scheduledMinuteTimerWithTarget:(id)arg1 selector:(SEL)arg2 userInfo:(id)arg3;\n+ (id)scheduledSecondTimerWithTarget:(id)arg1 selector:(SEL)arg2 userInfo:(id)arg3;\n+ (id)_scheduledClockTimerWithSeconds:(unsigned long long)arg1 target:(id)arg2 selector:(SEL)arg3 userInfo:(id)arg4;\n@property(readonly) id userInfo; // @synthesize userInfo;\n- (void)invalidate;\n- (void)dealloc;\n- (id)_initWithUserInfo:(id)arg1;\n- (void)_stopLocalTimer;\n- (void)_localTimerCallback:(id)arg1;\n- (void)_startLocalTimerWithSeconds:(unsigned long long)arg1 userInfo:(id)arg2;\n- (id)_nextSecondDate;\n- (id)_nextMinuteDate;\n\n@end\n\n" ]

{ "pile_set_name": "Github" }

[ 0.010752688172043012, 0.011494252873563218, 0.0067842605156037995 ]

[ { "analysis_explanation": null, "end": 82, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 71 }, { "analysis_explanation": null, "end": 141, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 132 }, { "analysis_explanation": null, "end": 152, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 143 }, { "analysis_explanation": null, "end": 163, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 154 }, { "analysis_explanation": null, "end": 179, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 167 }, { "analysis_explanation": null, "end": 226, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 212 }, { "analysis_explanation": null, "end": 389, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 372 }, { "analysis_explanation": null, "end": 473, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 437 }, { "analysis_explanation": null, "end": 623, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 615 }, { "analysis_explanation": null, "end": 648, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 640 }, { "analysis_explanation": null, "end": 862, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 845 } ]

[ "\"A PUBLIC ENEMY\" \"In Norway we tell our children that they must drink milk in order to become big and strong.\" \"", "Mothers feel happy and secure when our children like milk.\" \"", "We must avoid being stunted and keep our teeth from loosening.\" \"", "The dentist tells us that children who drink milk have better teeth.\" \"", "And to keep our bones from becoming brittle.\" \"", "School milk is a good thing.\" \"", "It gives us more energy.\" \"", "We must drink at least two glasses each day in order to stay healthy.\" \"", "Everybody knows that without milk, we can't become proper Norwegians.\" \"", "But milk also contains the protein beta-cassein A1.\" \"", "New research shows a connection between diabetes and milk.\" \"", "In the past 50 years the number of Norwegian diabetics has quadrupled.\" \"", "Thor Gabrielsen is back in hospital because of his severe type II diabetes.\" \"", "He drinks two litres of milk a day, and now he can't quit.\" \"", "When he came in three days ago, he had an extremely low blood sugar level.\" \"", "Can you read what this says?\" \"", "I must have it.\" \"", "I simply must have it.\" \"", "Trude Milk refuses to comment on this case, but we're going to pay them a visit.\" \" ", "Have you got an appointment?\" \" ", "Thor can't wait!\" \" ", "Have you got an appointment?\" \" ", "Thor can't wait!\" \"", "I must have it.\" \"", "I simply must have it.\" \"", "I'll begin by saying that we want to continue the series this fall.\" \"", "It's got the best ratings.\" \"", "That's why we'll move it to Friday to get it out in prime time.\" \"", "I see.\" \"", "And with such a high profile we think that it's important with a more profound editorial openness.\" \"", "Which means?\" \"", "That the board must be informed about which companies will be targeted.\" \"", "Why do you think it's so popular?\" \"", "It steps on people's toes.\" \"", "I never applied for any approval.\" \"", "Trude Milk is one of our largest advertisers.\" \"", "They were upset about your program and cancelled their contract with us.\" \"", "That's just lovely.\" \"", "So that's why you asked me in here.\" \"", "Don't get us wrong.\" \"", "We do want a controversial programme, Thomas.\" \"", "We want to add fuel to the public debate.\" \"", "A programme that's noisy and causes a bit of a row.\" \"", "You can discuss that with the board.\" \"", "We've spent a lot of time and money to make an unknown nutritionist become one of the biggest tv-celebrities.\" \"", "I don't suppose you want to throw away all that.\" \"", "If you think I did this for fame, you don't know shit about me.\" \"", "Trude Milk have got their tentacles in every corridor, on every board.\" \"", "They outmatch the prime minister.\" \"", "And they call that a democracy?\" \"", "Breath in.\" \"", "By the way.\" \"", "I've got something for you.\" \" ", "It's a surprise.\" \" ", "I don't like surprises.\" \"", "You see that?\" \"", "Go and have a look.\" \"", "What is it?\" \"", "Tomas ...\" \" What is it?\" \" ", "Cyano bacteria.\" \" ", "The microscope sucks.\" \" ", "Nah.\" \"", "Let me see.\" \"", "Move over.\" \"", "Let me see.\" \"", "You have to focus the lens.\" \"", "Have some.\" \"", "We're having dinner after the theatre.\" \"", "I have to work on my project.\" \"", "It's mum's birthday.\" \"", "We've got tickets for an Ibsen play.\" \" ", "Ibsen?\" \"", "Did that make her happy?\" \" ", "Of course it did.\" \"", "Go and get ready.\" \"", "Then we'll have something proper to eat.\" \"", "It'll be a while before we have dinner.\" \"", "Don't push me.\" \"", "Speak up!\" \"", "Who are you?\" \"", "Myself.\" \"", "Get away!\" \"", "Go round it, Peer.\" \"", "It's big enough.\" \"", "Who are you?\" \"", "Myself.\" \"", "Can you say the same about yourself?\" \"", "I can say what I want!\" \"", "And my sword will strike!\" \"", "Beware!\" \"", "It will crush you!\" \"", "Go round it, Peer.\" \"", "Through it!\" \"", "Everybody says water is healthy.\" \"", "But it can't be healthy to pee as much as I do.\" \"", "What's on your mind?\" \" ", "Water.\" \" ", "What?\" \"", "I have to call my brother.\" \"", "We'll tap the cleanest water in the world.\" \"", "We'll tap the cleanest water from the mountain back home.\" \"", "Why do you think people in Bredal get so old?\" \"", "The water is filled with minerals that prevent disease, and I'll prove that.\" \" ", "You want us to move back home?\" \" ", "I've spent years as a critic.\" \" ", "Now it's time to be constructive.\" \" ", "You know how I feel about Bredal.\" \"", "I don't dare show my face there.\" \"", "Imagine coming home and saving the settlement from its impasse.\" \"", "They'll thank us.\" \"", "I'm sure of it.\" \" ", "What about dad, then?\" \" ", "It's his chance to find redress.\" \"", "We'll have to do it.\" \"", "What's that?\" \"", "Start over.\" \"", "ONE YEAR LATER\" \"Tomas Stockmann.\" \"", "Call me about those water samples from Bredal.\" \"", "STOCKMANN PURE AND SENSIBLE\" \"Tomas Stockmann, welcome.\" \"", "I'm Borg, spokesman and board member of the company.\" \" ", "Do you like the new campaign?\" \" ", "The photos are a bit in-your-face.\" \"", "We're so happy with the slogan.\" \"", "That's your brother's work.\" \"", "When you make your speech it would be great if you could put in \"Pure and Sensible\".\" \"", "You have no idea how much enthusiasm and dedication it's created here.\" \"", "God, it's good to see you.\" \"", "Hi, dad.\" \"", "Tomas, aren't you going to ride with us?\" \"", "Everybody is dashing to the bank to buy stocks in your water company.\" \"", "But you're not so easily fooled?\" \"", "Me?\" \"", "I've got no money.\" \"", "I'm broke.\" \"", "All that is in the past.\" \"", "You're the only one thinking about it.\" \"", "You think so?\" \"", "Nothing is forgotten here.\" \"", "If you'd had the money, it wouldn't have been a bad idea.\" \"", "The value will go through the roof.\" \"", "The water up here is unique.\" \"", "You have to get people to change their drinking habits, Morten.\" \"", "Changing drinking habits?\" \"", "I've tried doing that all my life.\" \" ", "You have to park outside, Morten.\" \" ", "I wasn't going to drive through.\" \"", "Hi, Tomas.\" \"", "Back at last.\" \" ", "Indeed.\" \" ", "The right man in the right place.\" \" ", "Thanks.\" \" ", "We've been waiting for you.\" \"", "Thank you.\" \"", "Are you coming in?\" \"", "Crowds are one huge buffet for airborne diseases.\" \" ", "I see.\" \" ", "You didn't consider that.\" \"", "Do as you like.\" \"", "Tomas, can't you see who you resemble?\" \"", "Hi, I'm Petra Vik.\" \"", "I'm in the information sector.\" \" ", "Did you say \"information\"?\" \" ", "They're waiting for you.\" \" ", "You work with information?\" \" ", "Yes.\" \"", "I've seen all your programmes.\" \"", "It's very inspiring that you dare be so ruthless.\" \" ", "Thanks.\" \" ", "That's why I took this job.\" \"", "Tomas, how do you feel right now?\" \"", "Like myself.\" \"", "People of Bredal.\" \"", "We've finally come this far after lots of hard work.\" \"", "We're ready to start producing in the old stoneworks.\" \"", "Our spring water is far more sensible than any other product.\" \"", "And who would be more fitting for a speech today than my brother, the initiator Tomas Stockmann.\" \"", "Thank you, Peter.\" \"", "This company does not exist.\" \"", "It doesn't fit into a society whose market has been analyzed.\" \"", "Stockmann is what we've been told could never happen.\" \"", "No no, this isn't impossible.\" \"", "The people of Bredal don't exist.\" \"", "They haven't been planned.\" \"", "People who work to start a company, who put their money in stocks, who do volunteer work all night to get the facility ready ...\" \"They're unthinkable.\" \"", "The multinational companies tell us that we haven't got a chance.\" \"", "But for those bosses, for those companies, \" \" I have only one message:\" \"We have turned the future upside down!\" \"", "We have made the impossible possible.\" \"", "We are bloody unbelievable.\" \"", "Sensible?\" \"", "We've got the purest spring water in the world, and you're selling it cheap?\" \"", "Pure and sensible?\" \"", "The price is our primary means of competing.\" \"", "We have to make use of that.\" \"", "You just make sure it's healthy.\" \"", "You look like Stalin.\" \"", "Sure.\" \"", "Did you get the results from the lab?\" \" ", "The lab?\" \"", "What do you mean?\" \" ", "I've taken a new sample.\" \" ", "It has been approved.\" \" ", "That was last year.\" \"", "People have been drinking it for centuries.\" \"", "Exactly, we have to prove that it's unique by using tests.\" \"", "Can you get it done before you go back?\" \"", "But we're moving here.\" \"", "To live with dad.\" \"", "Why didn't you tell me?\" \"", "I thought you knew that.\" \"", "What about your tv-series?\" \"", "Don't you work on that?\" \"", "I'm not doing any tv-series.\" \"", "This is much more important.\" \" ", "I thought you'd never move back.\" \" ", "Sure.\" \"", "Dad's getting old.\" \"", "He'll be happy to hear that.\" \"", "Hi, I'm calling about those samples from Bredal.\" \"", "Can you call me as soon as possible?\" \"", "Tomas Stockmann?\" \" ", "Damn, we liked that speech.\" \" ", "Thank you.\" \"", "Look around you.\" \"", "All of this was built in a few months.\" \"", "We're not history, we're the future.\" \"", "Finally someone recognizes that.\" \" ", "Indeed.\" \" ", "Aslaksen is head of the union.\" \"", "Yes, I'm Aslaksen.\" \" ", "I've dreamed of this a long time.\" \" ", "You've dreamed, and we've worked.\" \" ", "You okay?\" \" ", "We have to move the greenhouse.\" \"", "The first time I kissed you was in there.\" \"", "Remember that?\" \"", "I'd forgotten that.\" \"", "I had to lure you in there.\" \"", "I didn't want your dad to find out.\" \"", "Hi, Eilif.\" \"", "Are you coming or what?\" \" ", "Tomas speaking.\" \" ", "Lauritzen, Lab Tec.\" \"", "Hi.\" \"", "I've tried to get hold of you all day.\" \" ", "What did you say?\" \" ", "I take it you've read our letter.\" \" ", "No, I didn't get any letter.\" \" ", "We mailed it last week.\" \" ", "How were the results?\" \" ", "We've found high levels of ...\" \"How high are they?\" \"", "You're breaking up.\" \"", "Hello?\" \"", "What do I need stocks for?\" \"", "I've got spring water in my tap, so I can open my own facility.\" \"", "We have to celebrate this water of yours.\" \"", "Is there no reception up here?\" \"", "No.\" \"", "I hope you can eat something other than bran bread.\" \"", "No way.\" \"", "It's unhealthy to live as healthy a life as we do.\" \"", "You can't drink water with that cake.\" \"", "No.\" \"", "We need champagne.\" \"", "Bring in the bottles, Eilif.\" \"", "You carried them in here.\" \" ", "Can I use your phone, Morten?\" \" ", "The phone is closed.\" \"", "There aren't that many who'd call me anyway, so ...\" \"Look at that.\" \"", "What have we here?\" \"", "Will you look at that.\" \"", "Break out the champagne, Eilif.\" \" ", "If I can have a glass.\" \" ", "Of course you can.\" \"", "Let me help you there.\" \"", "Let me help.\" \"", "Where is it?\" \"", "And away.\" \" ", "Here you are.\" \" ", "I'm having water.\" \"", "Sure.\" \"", "Here you are.\" \"", "Cheers.\" \"", "I'll just go down and make a call.\" \"", "There's no reception up here.\" \"", "Sure.\" \"", "Cheers.\" \"", "To the heir presumptive.\" \"", "The heir presumptive?\" \"", "What's that supposed to mean?\" \"", "Didn't you go bankrupt?\" \"", "Bankrupt?\" \"", "The farm didn't.\" \"", "I made it over to your mother.\" \"", "Hasn't she told you?\" \"", "No, I didn't explain it to him.\" \"", "Dad gave it to me when I was 18.\" \"", "He owed money to everyone, and he couldn't pay them back.\" \"", "So I felt like I'd stolen their money.\" \"", "At least we kept the farm.\" \"", "Otherwise we wouldn't have been here today.\" \"", "It's about time you came home and took over, Katrine.\" \"", "Took over what?\" \"", "This has been the home of proper folk since the time of the Vikings.\" \"", "I thought we had burglars.\" \"", "Where do you put letters?\" \" ", "In the inbox.\" \" ", "And if they're not there?\" \" ", "Who is the letter from?\" \" ", "It's from a place called LabTec.\" \"", "I've seen that somewhere.\" \" ", "It was on Peter's desk.\" \" ", "But it's got my name on it.\" \"", "You do know that people are here as volunteers, don't you?\" \"", "Is something wrong?\" \"", "No.\" \"", "Did I say that there was something wrong?\" \"", "No, but if something is wrong, I'd like you to inform me.\" \"", "Sure.\" \"", "I know what LabTec does.\" \"", "Does it have something to do with the water?\" \"", "That doesn't concern you.\" \"", "Where have you been?\" \" ", "Why did you give him champagne?\" \" ", "I'm sorry.\" \"", "You know he can't quit.\" \"", "The water is toxic.\" \"", "We have 40.000 bottles of toxic water waiting to be delivered.\" \"", "What?\" \"", "What will people say if I sell poison?\" \"", "You've done your job.\" \"", "People will thank you for finding it.\" \" ", "You think so?\" \" ", "Nobody wants a toxic spring.\" \"", "I have to stop the production.\" \"", "What about the other spring deeper in the mountain?\" \"", "Tomas?\" \"", "Did you take any samples from that one?\" \"", "Of course I have to take samples from the other one.\" \"", "Of course.\" \" ", "Any other boxes with alcohol?\" \" ", "No.\" \"", "Wouldn't it have been better, if you had informed me first?\" \"", "Come.\" \" ", "What kind of lab is LabTec anyway?\" \" ", "There's nothing wrong with it.\" \" ", "Where'd that poison come from?\" \" ", "I have no basis for a guess.\" \"", "Don't be so formal, Tomas.\" \"", "It's a pesticide that may cause serious harm to your health.\" \"", "Weren't such pesticides banned long ago?\" \"", "Yes, but this compound isn't biodegradable.\" \"", "Why didn't they find it last year?\" \"", "There are several different analyses.\" \"", "Nobody looked for that poison then.\" \" ", "Why the hell did you do it, then?\" \" ", "I wanted to check everything.\" \"", "We have to take samples from the other basin.\" \"", "There may not be the same problem.\" \"", "Then you'll just find a different problem.\" \"", "Have you checked what it'll cost to move the tap?\" \"", "Our advertisements will be void.\" \"", "The stocks will lose their value.\" \"", "The water is toxic.\" \"", "I'm not too sure about that.\" \" ", "That would cost you too much.\" \" ", "Give me a break, Tomas.\" \"", "What will people say, when they hear that their investment is of no value?\" \"", "That we have no work for them.\" \"", "You think that it's better to make them accessories to a crime?\" \" ", "We'll have to take a new sample.\" \" ", "It'll be exactly the same.\" \"", "We have to be on the same side.\" \"", "And we have to keep this to ourselves until we're absolutely certain.\" \"", "Agreed?\" \"", "Hi, Katrine.\" \" ", "Won't you pop by some day?\" \" ", "Sure.\" \"", "It ought to be simple even to him.\" \"", "It's a scientific fact.\" \" ", "What can you do?\" \" ", "Be an employee.\" \"", "It'll only get worse if you get steamed up.\" \"", "Tomas ...\" \" You have to cooperate.\" \" ", "He won't cooperate with me.\" \"", "Have you tried?\" \"", "You don't know Peter.\" \"", "Is that breakfast?\" \"", "I'll only eat unhealthy food.\" \"", "I'll live solely on fat and carbohydrates.\" \"", "Taste good?\" \"", "Want some bacon?\" \"", "Delicious.\" \"", "What's wrong with you?\" \"", "Don't you drink that water.\" \" ", "Where are you going?\" \" ", "Up to get some samples.\" \"", "Can I go with you?\" \"", "Aren't you having breakfast?\" \"", "Are you sure no one's here?\" \"", "Sissy.\" \"", "Don't throw rocks.\" \"", "Right back at you, then.\" \"", "Nobody's going to drink it anyway.\" \"", "What are we looking for, then?\" \"", "The entrance to the other spring.\" \"", "What was that?\" \"", "Nothing.\" \"", "Is it far?\" \"", "Let me give you a hand.\" \"", "You stay here, and I'll climb down.\" \"", "Shine the light for me.\" \"", "Light, please, Eilif.\" \"", "Don't move the light, Eilif!\" \"", "Eilif!\" \"", "Dad?\" \" ", "Dad?\" \" ", "Yes!\" \"", "Did you hurt yourself?\" \" ", "What are you doing here?\" \" ", "Trying to help you.\" \"", "What are you doing here?\" \" ", "Was it you who was following us?\" \" ", "That's all she's doing.\" \"", "Don't I have a right to be here?\" \"", "It doesn't say anywhere that this is a private area.\" \"", "In case you missed it, I work with information.\" \"", "You don't tell me shit!\" \" ", "You'll just pass it on to Peter.\" \" ", "Well, isn't he your brother?\" \" ", "What is it you're trying to hide?\" \" ", "You're talking to the wrong guy.\" \"", "Really?\" \"", "I know a reporter who'd be very interested in helping me find out what's going on.\" \" ", "Good to see you, Katrine.\" \" ", "Likewise.\" \"", "Well ...\" \"Let's see.\" \" ", "You want me to lie down?\" \" ", "Yes.\" \"", "Don't you want anything under you?\" \"", "At least under your head.\" \"", "There.\" \" ", "Are you comfortable?\" \" ", "Yes, I'm completely relaxed.\" \"", "Breath in.\" \"", "Katrine?\" \"", "Tomas gets on everybody's wrong side.\" \"", "What can I do?\" \"", "You have to win him over.\" \"", "How do I do that?\" \"", "There's always a way.\" \"", "Can't you make a purifying plant?\" \"", "If we do that, people will begin wondering if the water is toxic.\" \"", "But he must have found something in those tests.\" \"", "Tomas claims to have found pesticides.\" \"", "And?\" \"", "Where would they come from?\" \"", "Indeed.\" \"", "I can't imagine who would have used pesticides.\" \"", "Breath in, please.\" \" ", "Ouch.\" \" ", "It hurts a bit when it goes in.\" \"", "That's what she said yesterday.\" \"", "No, I mean, as long as that report doesn't get out, no one will wonder where that poison comes from.\" \"", "What are you implying?\" \"", "I'm just trying to help you.\" \"", "Wasn't that why you came here?\" \"", "Where do you think the poison comes from?\" \"", "The important thing is how we get rid of it.\" \"", "Strike your name off the brand.\" \" ", "Strike my name?\" \" ", "See what they'll do then.\" \"", "You don't have to be one of Peter's subjects.\" \"", "Subject?\" \"", "Me?\" \"", "I'm no man's bloody subject.\" \"", "Did you sleep well?\" \"", "What are you looking for?\" \"", "Didn't you use to have pesticides in here?\" \"", "That was long ago.\" \"", "I had to hand them over.\" \"", "And that wasn't cheap.\" \"", "Why?\" \"", "They've found pesticides in the water.\" \"", "Hi, Tomas.\" \"", "You want a glass of water?\" \"", "I've been pondering if I should strike my name from the brand.\" \"", "Our name, you mean?\" \"", "That's my picture on the bottle.\" \"", "I refuse to let you use it.\" \"", "You have no right to do that.\" \"", "According to the contract, your name may be used for advertisements.\" \"", "You can't keep me from warning people against drinking Stockmann.\" \"", "There may be another solution.\" \"", "It's not good to have the same man on the board for too long.\" \"", "So we considered offering you an important position.\" \"", "As managing director.\" \"", "And why would you do that?\" \"", "I may run for chairman of the board this fall.\" \"", "Then Borg will have to take over.\" \"", "We lack competent people.\" \" ", "Could you see me as director?\" \" ", "You're a skilled leader.\" \"", "Your skills and your position add to your authority.\" \"", "People trust you.\" \"", "Does that mean I have control of productions?\" \"", "If the board is to accept you, you must leave out all of these speculations.\" \"", "If you get the job, you should find a new production leader who adapts to your plans for the company.\" \" ", "That's a bit too much of a promise.\" \" ", "Indulge me.\" \"", "How stupid do you think I am?\" \"", "You don't think I've found you out?\" \"", "Now, don't say I didn't try.\" \"", "Aslaksen?\" \"", "I just want you to hear it from one of the other board members.\" \"", "Aslaksen talked to our lawyer.\" \"", "Hello.\" \"", "We went through your contract yesterday.\" \"", "If you say anything that may harm the company name, you have to take the consequences.\" \" ", "That's claptrap, and you know that.\" \" ", "No.\" \"", "If you spread false rumours about the water ...\" \" They're not false r...\" \" Let me finish.\" \"", "If you spread false rumours about the water, you will be held responsible for the losses of the company.\" \"", "But I don't spread false rumours about the water.\" \"", "That's for the court to decide.\" \"", "What the hell is this?\" \"", "Am I to bear your losses?\" \"", "It's not my fault that you've signed a contract you can't comply with.\" \"", "You can't bear to lose face!\" \"", "I'm not the one who will lose face.\" \"", "No matter how you threaten me, you can't keep me from saying it!\" \" ", "You can't.\" \" ", "I can, and I will.\" \"", "Consider what breaking the contract will mean to you and your family.\" \" ", "Are you threatening my family?\" \" ", "You've always been a bully.\" \"", "I take that as a compliment.\" \"", "If I'd known you'd move here, I'd never have given you the job!\" \" ", "What are you doing here?\" \" ", "I haven't got LabTec's address.\" \"", "You should have sent those long ago.\" \"", "Dad?\" \"", "What did you expect?\" \"", "That those drums would simply disappear?\" \"", "Do you remember how you enjoyed it here?\" \"", "Strawberries all over the place.\" \"", "And you helped me so much.\" \"", "You were so good at picking them.\" \"", "People will find out where the poison came from.\" \"", "Do you know what it would have cost to get rid of it?\" \"", "Everything I had went to you.\" \"", "Are you blaming me now?\" \"", "This is a crime, dad.\" \"", "It's a threat to the entire settlement.\" \"", "What are they going to do, then?\" \"", "Put me in prison?\" \" ", "Can I borrow a pen?\" \" ", "Of course.\" \"", "Here.\" \"", "Weren't you going to talk to a reporter?\" \"", "If you won't do it, I will.\" \"", "He's a bloodhound.\" \"", "Never gives up.\" \"", "I see.\" \"", "Get to it.\" \"", "Will they really shut down the spring?\" \"", "Yes, dad.\" \"", "They may have to do that.\" \" ", "Can you take this one?\" \" ", "Sure.\" \"", "This stuff can't be that dangerous.\" \"", "It's toxic and it's dangerous.\" \"", "I've spent my whole life on this plot.\" \"", "And what have I got in return?\" \"", "Gossip and contempt.\" \"", "The entire settlement take me for an idiot.\" \"", "Dad, this isn't about you.\" \"", "Can we take this drum out of the ground?\" \"", "What's the matter?\" \"", "My arm ...\" \"Dad, are you messing around?\" \"", "Dad?\" \"", "Dad?\" \" ", "Who do you work for?\" \" ", "I'm independent.\" \"", "I've got my own company and do the things I want to do.\" \"", "Things that the major stations haven't got the balls to produce.\" \"", "The directors are bloody cowards, aren't they?\" \"", "They don't dare produce something that really shocks.\" \" ", "And what really shocks?\" \" ", "You know that.\" \"", "Is it true that you broke into the office of Trude's director?\" \"", "Don't make me something I'm not.\" \"", "I'm not a tv-rebel any longer.\" \"", "I got fed up with it.\" \"", "That's exactly why I don't want to work for the major stations.\" \" ", "Are you ready?\" \" ", "Yes.\" \"", "Tomas Stockmann, why is your water so dangerous?\" \"", "It contains a poison that makes people infertile.\" \"", "Scientists often warn us, and then it turns out that it takes absurd amounts for it to harm us.\" \"", "The number of childbirths has decreased drastically here.\" \"", "Everybody thought it was due to our lack of belief in the future.\" \"", "There are nobody in this settlement who can reproduce.\" \"", "Why haven't you informed people before?\" \"", "I got this information two days ago, and I have informed the board.\" \" ", "What was their reaction?\" \" ", "Ask them yourself.\" \"", "Is it your impression that someone in the board wants to hide this?\" \"", "Why do you think I'm here?\" \"", "Your mobile works.\" \"", "You've got some nerve.\" \"", "22 messages?\" \"", "Something must be wrong.\" \"", "Will he be alright?\" \"", "I don't know.\" \"", "He just collapsed.\" \"", "Where?\" \"", "We were working outside.\" \"", "It was my fault.\" \"", "I never should have ...\" \"I never should have made him work.\" \"", "He's had a hard life.\" \"", "That's bollocks, and you know that.\" \"", "He didn't drink.\" \" ", "No?\" \" ", "Not that often.\" \" ", "Where have you been?\" \" ", "By the spring.\" \" ", "Why?\" \" ", "I talked to a reporter.\" \"", "About the poison?\" \"", "I don't know what happened.\" \"", "I just stood there.\" \"", "I thought he was messing around.\" \"", "He was lucky that you were there.\" \"", "We never should have come back.\" \"", "I'll go and buy a soda.\" \" ", "Tomas, go with Eilif.\" \" ", "I'll stay with you.\" \"", "Go with Eilif.\" \"", "Take care of him, Tomas.\" \"", "Get going!\" \"", "Want to drive?\" \"", "Hit the breaks!\" \"", "Who's driving here?\" \" ", "Tomas here.\" \"", "Hi, Hovstad.\" \" ", "Are you at home?\" \" ", "No, I'm at the hospital.\" \" ", "Could you pop by?\" \"", "Do you have something for me?\" \"", "I'll be there.\" \"", "Bye.\" \" ", "Was it the journalist?\" \" ", "Yes.\" \"", "I have to fix something.\" \" ", "Can I go with you?\" \" ", "No, go see mum.\" \"", "She's waiting for us.\" \"", "I'll be right back.\" \" ", "Are you done?\" \" ", "No.\" \"", "No?\" \"", "Your brother showed me a new report.\" \"", "It says it's only slightly polluted.\" \" ", "Do you have it?\" \" ", "No.\" \" ", "It has to be a botch job.\" \" ", "Why believe you and not him?\" \"", "Where's my interview?\" \"", "Your brother took it.\" \" ", "What did he threaten you with?\" \" ", "A lawsuit.\" \"", "He's threatened me with that for a long time.\" \"", "I can't afford it.\" \"", "I'll go bankrupt.\" \"", "Then you're not very independent.\" \"", "What do you know about running an independent business?\" \"", "You've been a little tv-king who's never had to fight to survive.\" \"", "Why would I want to be independent, if I don't dare have an opinion?\" \"", "Katrine?\" \"", "He's not what he let on to be.\" \"", "I'd say.\" \"", "He's more of a poodle than a bloodhound.\" \"", "What do we do now?\" \"", "If you really want to help, you can call People's Choice.\" \"", "People's Choice isn't really you.\" \"", "I need someone who won't back out.\" \"", "I must let the entire country know.\" \"", "It's the most popular tv-show right now.\" \"", "I've been fired.\" \"", "You were fired?\" \"", "You should be proud of that.\" \"", "They don't dare fire me.\" \"", "Katrine?\" \"", "When I got to the hospital, you'd already left.\" \"", "Didn't you wonder where it came from?\" \"", "No matter.\" \"", "The damage is done.\" \"", "No matter?\" \"", "People in town say that the spring is poisoned.\" \"", "They'll be looking for a scapegoat, and you don't think that it matters?\" \"", "What do you want me to do, then?\" \"", "I want you to chose, Tomas.\" \"", "Our relationship or Stockmann.\" \" ", "And if I can't make that choice?\" \" ", "Then you've made your choice.\" \"", "I know you're upset.\" \"", "I'm not upset.\" \"", "I'm as lucid as ever.\" \"", "If you go on about that poison, I'll sell the farm and move away.\" \" ", "Where are you going?\" \" ", "To the hospital.\" \"", "Hey!\" \"", "Talk to me.\" \"", "Come on.\" \"", "Let's move that poison.\" \" ", "What?\" \" ", "When is mum moving?\" \"", "This is toxic waste.\" \"", "It has to go to the refuse disposal plant.\" \" ", "Where is that?\" \" ", "In town.\" \"", "I can't take this.\" \" ", "Can't you take it there?\" \" ", "In what?\" \"", "I'll leave it here.\" \"", "Then it's your responsibility.\" \"", "Leave it here?\" \"", "I haven't seen it.\" \"", "Then it'll stay where it is.\" \"", "Hold on.\" \"", "Tomas speaking.\" \"", "Hi, Tomas.\" \"", "This is People's Choice.\" \"", "Petra?\" \"", "Are you coming?\" \" ", "What are you doing?\" \" ", "We're leaving.\" \" ", "We have to take care of this crap.\" \" ", "You said we'd leave them there.\" \"", "You know you can't drive.\" \"", "Dad?\" \"", "How's he doing?\" \"", "Well ...\" \"He's taking a nap now.\" \"", "Yes, he's had a hard life.\" \"", "Yes, he's had a hard life.\" \"", "But he wasn't an alcoholic.\" \"", "I've always respected your father, Katrine.\" \"", "Too bad that Tomas and I don't agree.\" \"", "That's for you to mend.\" \"", "He's contacted People's Choice.\" \" ", "When did you hear that?\" \" ", "Didn't he tell you?\" \"", "After that there's nothing to hold back these rumours.\" \"", "I think that your father deserves better.\" \"", "It's easy to blame Morten just because he's different.\" \"", "You are the only one who can stop Tomas.\" \"", "The board wants to hit him hard, but I can make them wait.\" \"", "Hi, Lene Bergstrøm.\" \"", "People's Choice.\" \"", "Researcher.\" \"", "Hi.\" \"", "Did you wait long?\" \"", "An hour.\" \"", "Your mobile doesn't work.\" \" ", "Anyone home?\" \" ", "The door was locked.\" \"", "Can I talk to you, Petra?\" \"", "What the hell are you thinking?\" \"", "You can't bring those bloody tv-guys to our home.\" \"", "Why not?\" \"", "It's private.\" \"", "Then stop being so damned private.\" \" ", "I've talked to the lab.\" \" ", "What lab?\" \"", "The one Peter says he used.\" \"", "They've never done any tests for Stockmann.\" \"", "You have to use that against him.\" \" ", "Dad's a bit better.\" \" ", "Better?\" \"", "You feeling better?\" \"", "We need to talk, Tomas.\" \" ", "I've used the farm as collateral.\" \" ", "Collateral?\" \"", "In Eilif's inheritance?\" \"", "I've bought Stockmann stocks in his name.\" \"", "Stockmann stocks?\" \"", "If the company goes bankrupt, those stocks will be worthless.\" \" ", "You're kidding.\" \" ", "No.\" \"", "Ruin Stockmann, and you ruin Eilif.\" \"", "Only a madman would do that.\" \"", "I am a madman.\" \"", "I've let you pretend you're mad.\" \"", "You're not really that mad.\" \"", "I don't believe you.\" \"", "You've been talking to Peter.\" \"", "Tomas, don't you get it?\" \"", "You cannot wish to go against me.\" \"", "You've never understood dad.\" \"", "Don't you know what he went through?\" \"", "How much this has affected him?\" \"", "I won't let him be hated once more.\" \"", "To think that you would let yourself be tricked like this.\" \" ", "What are you talking about?\" \" ", "This is typical of Peter.\" \"", "He talked to people about me and put words in their mouths.\" \"", "This is typical of Peter.\" \"", "And trust me on this:\" \"I won't let that fuck get away with it!\" \"", "We're suspecting you of insider trade.\" \"", "First these rumours about poison.\" \"", "And then your wife buys cheap Stockmann stocks.\" \" ", "Coincidence?\" \" ", "What are you talking about?\" \"", "You start a rumour to benefit from our volunteer work.\" \"", "We'll call the police.\" \"", "Don't turn your back on me!\" \"", "How can you explain this to your son?\" \"", "Eilif?\" \"", "Eilif has nothing to do with this.\" \"", "Ran out of arguments, did you?\" \"", "Get out of here!\" \" ", "Where's Peter?\" \" ", "He's not here yet.\" \"", "So much the better.\" \"", "Peter?\" \" ", "Tomas, what are you doing?\" \" ", "Looking for your fake report!\" \"", "You won't find anything in there.\" \" ", "He'll thrash the office as well.\" \" ", "No, there's no danger.\" \"", "Tomas, what do you want?\" \"", "I accept your offer, Peter.\" \" ", "What offer?\" \" ", "Your job offer.\" \"", "Come on out and let's talk about it.\" \"", "Nice chair.\" \"", "Very comfortable.\" \"", "Nice pictures, too.\" \"", "Dad should have seen this.\" \"", "Dad should have seen this.\" \"", "He would have been so proud.\" \" ", "Open this door, you bloody idiot!\" \" ", "You just wind the fuck down!\" \"", "Bloody hell!\" \"", "Don't you talk to me like that!\" \"", "If you don't open, you'll be sorry.\" \"", "I'll do exactly as I please, and you just shut up!\" \" ", "I'm calling the police.\" \" ", "No, leave him be.\" \" ", "Should I call his wife?\" \" ", "No.\" \"", "Let him have his fun.\" \"", "You think that you know more about everything than everyone else.\" \"", "Perhaps he's been drinking.\" \"", "Get away from the windows.\" \"", "He just wants attention.\" \"", "Hi, Tomas, it's Petra.\" \"", "People's Choice starts in an hour.\" \"", "Damn it, Tomas!\" \"", "They're waiting for you.\" \"", "People's Choice is about to start.\" \"", "What are you doing?\" \"", "Today People's Choice has gone to Bredal where our former producer is in dispute with his brother.\" \"", "Are you coming?\" \"", "Tomas!\" \"", "Welcome to this week's People's Choice.\" \"", "Tomas Stockmann, the known nutritionist, claims to have found poison in the local spring.\" \"", "Director Peter Stockmann claims that this water is healthy.\" \"", "Who's right?\" \"", "You at home are to decide.\" \"", "Those in favour of Peter, send a text message to 1998.\" \"", "Those in favour of Tomas, send a text message to 1999.\" \"", "People's Choice is democracy in practice.\" \"", "Peter, your own brother claims that he has found poison in this water.\" \"", "Is that true?\" \"", "The board has always taken great interest in Tomas' work.\" \"", "Yes, but have you found poison or not?\" \"", "We've found insignificant amounts of a pesticide, but it doesn't present any danger.\" \"", "Some actually say that tiny amounts of this compound may be healthy.\" \" ", "So this poison is healthy?\" \" ", "In tiny amounts, yes.\" \"", "And to control that amount we'll build a purifying plant.\" \"", "Tomas was supposed to comment on this, but he hasn't arrived yet.\" \"", "He's had a tough day.\" \"", "Watch this.\" \"", "Dad?\" \"", "I have to show you something.\" \"", "Let me in.\" \"", "Look.\" \"", "I've got the results from the lab.\" \"", "The inner spring is clean.\" \"", "That's just fine.\" \"", "But your uncle can simply get a test that gainsays that.\" \"", "Is it because of the stocks?\" \"", "I don't want that money.\" \" ", "But it's your inheritance.\" \" ", "It's a coward's money.\" \"", "And I'm no coward.\" \"", "I've never considered you a coward, Eilif.\" \"", "Because of me, people will drink that poison.\" \"", "If it hadn't been for me, everything would have been fine.\" \"", "Stop that.\" \" ", "Tomas.\" \" ", "Let me get a photo.\" \"", "Hi, Thomas.\" \"", "Can't you tell the time?\" \" ", "The show is already on.\" \" ", "Stay with him, Eilif.\" \"", "Tomas Stockmann, welcome.\" \"", "Well, a purifying plant.\" \"", "Doesn't that satisfy you?\" \"", "It's just a cover up to hide the fact that they're poisoning people.\" \"", "There is pure water.\" \"", "In the basin deeper in the mountain.\" \"", "And the report that I have here proves that.\" \"", "It will be far too expensive to move the tap.\" \"", "Much more expensive than building a purifying plant.\" \" ", "And reports are easily falsified.\" \" ", "Are you insinuating that I'm lying?\" \"", "That's for you to know, Tomas.\" \"", "Peter is making a serious accusation.\" \"", "What are you going to do about it?\" \"", "Nothing.\" \"", "This isn't about a simple family dispute between Peter and I.\" \"I've discovered something much more important.\" \"", "I've been trying to keep you from drinking a poison that'll make us infertile.\" \"", "But no one wants to stop drinking this water for that reason.\" \"", "So I'm thinking:\" \"\"Maybe it's not that important that life goes on here.\"\" \"", "Isn't it your job to convince people?\" \"", "If people won't listen, I can't do anything.\" \"", "I respect that they want to drink poison.\" \" ", "Some species extirpate themselves.\" \" ", "Get that man out of here.\" \"", "What you're saying, Tomas, is that the entire settlement ...\" \"Will become extinct.\" \"", "Yes.\" \"", "But that doesn't give us the right to poison the rest of the population.\" \"", "Fine.\" \"", "You people at home have voted.\" \"", "We have reached a decision.\" \"", "People's Choice is democracy in practice.\" \"", "Well, 63 per cent of the viewers have voted ...\" \"The viewers have voted for Peter and his spring water.\" \"", "Well.\" \"", "Any comments?\" \"", "I want to thank you for the support.\" \"", "This goes to show that people don't fall for scare tactics.\" \"", "Well, Tomas.\" \"", "I suppose that truth rests with the majority.\" \"", "Truth never rests with the majority.\" \"", "Who constitute the majority of a nation?\" \"", "Stupid people or smart people?\" \"", "We have to agree that stupid people constitute an overwhelming majority in this country.\" \"", "Tomas, do you raise yourself above our viewers?\" \"", "Do you raise yourself above our viewers?\" \"", "You can't behave like that even if you're a celebrity.\" \" ", "Have you seen Eilif?\" \" ", "No.\" \"", "You won't win by slagging people off.\" \"", "Now you sound like an information worker.\" \"", "We'll get the purifying plant, and that's what's important.\" \"", "You think you're so bloody unique.\" \"", "Eilif!\" \"", "Katrine!\" \"", "He poisoned the spring.\" \"", "Just kill him.\" \"", "Kill him.\" \"", "Good evening.\" \"", "What's going on here?\" \"", "Nothing.\" \"", "There was no poison here before he arrived.\" \"", "Are those your drums?\" \" ", "I'm getting rid of them.\" \" ", "So they are yours?\" \"", "I was taking them into town.\" \"", "Come with me.\" \"", "They said, they'd kill me.\" \" ", "But people in this town don't act.\" \" ", "No.\" \"", "That was probably for the best.\" \"", "It's still bloody annoying.\" \"", "Can I go now?\" \"", "I think I have to keep you until tomorrow.\" \"", "Then we'll see.\" \"", "We'll see?\" \"", "About what?\" \"", "Why are you driving around with a hundred litres of pesticide?\" \"", "Do I look like a man who wants to poison an entire settlement?\" \"", "I don't know what you look like.\" \" ", "Katrine?\" \" ", "I don't want to talk to you.\" \"", "We have to stick together.\" \"", "People act like crazy.\" \"", "Why did I move back?\" \"", "You said people would thank us.\" \"", "I won't let you drag us down with you again.\" \"", "Katrine ...\" \"I've talked to Katrine, Tomas.\" \"", "She says she knows nothing about those drums.\" \"", "Can I go, then?\" \"", "Yes.\" \" ", "On one condition.\" \" ", "Condition?\" \"", "Yes.\" \"", "I'll drop this case if you promise to move away.\" \" ", "Move away from my home town?\" \" ", "Yes, for your own safety.\" \"", "You have to go home and pack your stuff.\" \"", "Otherwise I'll have to keep you here.\" \"", "I can't be alone.\" \"", "Translation:\" \"Martin Mathiasen Scandinavian Text Service\"" ]

{ "pile_set_name": "OpenSubtitles" }

[ 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.025, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.020833333333333332, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.025, 0.1111111111111111, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.047619047619047616, 0, 0, 0, 0, 0, 0, 0.1, 0, 0.047619047619047616, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.027777777777777776, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.02040816326530612, 0.017241379310344827, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.023255813953488372, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.015151515151515152, 0, 0, 0.02702702702702703, 0, 0.07692307692307693, 0.058823529411764705, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.024390243902439025, 0.047619047619047616, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.027777777777777776, 0, 0, 0, 0, 0, 0.009900990099009901, 0.05, 0, 0, 0.017857142857142856, 0, 0.027777777777777776, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.041666666666666664, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.0196078431372549, 0, 0.05, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.07692307692307693, 0, 0, 0.09090909090909091, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.03225806451612903, 0, 0.030303030303030304, 0, 0.014285714285714285, 0, 0.04, 0.02857142857142857, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.017857142857142856, 0, 0.014084507042253521, 0, 0, 0, 0, 0, 0, 0, 0.037037037037037035, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.1111111111111111, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.034482758620689655, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.0625, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.041666666666666664, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.1111111111111111, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.038461538461538464, 0.041666666666666664, 0.03225806451612903, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.027777777777777776, 0, 0, 0, 0, 0, 0.034482758620689655, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.09090909090909091, 0.025, 0, 0, 0, 0, 0, 0, 0, 0.024390243902439025, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.020833333333333332, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.07692307692307693, 0, 0, 0, 0, 0, 0, 0, 0.014705882352941176, 0, 0, 0, 0, 0, 0, 0.027777777777777776, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.015384615384615385, 0, 0, 0, 0, 0, 0, 0.0196078431372549, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.08, 0, 0.058823529411764705, 0.037037037037037035, 0, 0, 0, 0, 0.07142857142857142, 0.0625, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.09090909090909091, 0, 0, 0, 0, 0, 0.027777777777777776, 0, 0, 0, 0, 0, 0, 0, 0.09090909090909091, 0, 0, 0, 0, 0, 0, 0, 0, 0.03333333333333333, 0.029411764705882353, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.07692307692307693, 0.037037037037037035, 0.1111111111111111, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.021739130434782608, 0.025, 0, 0.02857142857142857, 0, 0, 0, 0, 0.017543859649122806, 0, 0, 0.045454545454545456, 0.05263157894736842, 0, 0, 0, 0, 0, 0, 0, 0.03571428571428571, 0, 0, 0, 0, 0, 0, 0, 0.03333333333333333, 0.021739130434782608, 0, 0.043478260869565216, 0, 0, 0, 0, 0, 0.038461538461538464, 0.022727272727272728, 0.05, 0, 0, 0, 0.02631578947368421, 0, 0, 0, 0, 0, 0.03125, 0.037037037037037035, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.0196078431372549, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.05555555555555555, 0, 0, 0.1, 0.03333333333333333, 0, 0, 0, 0, 0.037037037037037035, 0.03225806451612903, 0, 0, 0, 0, 0, 0, 0.034482758620689655, 0.034482758620689655, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.08, 0, 0.05555555555555555, 0, 0.02702702702702703, 0, 0.009708737864077669, 0, 0.1111111111111111, 0.023809523809523808, 0.010638297872340425, 0.016129032258064516, 0, 0, 0.017543859649122806, 0, 0.022727272727272728, 0.013333333333333334, 0, 0.016666666666666666, 0, 0, 0, 0, 0, 0, 0.014285714285714285, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.022222222222222223, 0, 0, 0, 0.1, 0, 0.07142857142857142, 0, 0, 0, 0.03571428571428571, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.025, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.011627906976744186, 0, 0, 0, 0, 0, 0.022727272727272728, 0.009345794392523364, 0, 0, 0, 0, 0.06666666666666667, 0, 0, 0, 0, 0, 0.02, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.09090909090909091, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.08333333333333333, 0, 0, 0, 0, 0, 0, 0.02127659574468085, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0 ]

[ { "analysis_explanation": null, "end": 27, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21 }, { "analysis_explanation": null, "end": 466, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 458 }, { "analysis_explanation": null, "end": 566, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 556 }, { "analysis_explanation": null, "end": 708, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 691 }, { "analysis_explanation": null, "end": 732, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 723 }, { "analysis_explanation": null, "end": 777, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 762 }, { "analysis_explanation": null, "end": 935, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 921 }, { "analysis_explanation": null, "end": 1363, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1354 }, { "analysis_explanation": null, "end": 1432, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1426 }, { "analysis_explanation": null, "end": 2028, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2022 }, { "analysis_explanation": null, "end": 2720, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2715 }, { "analysis_explanation": null, "end": 3013, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3008 }, { "analysis_explanation": null, "end": 3028, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3023 }, { "analysis_explanation": null, "end": 3795, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3789 }, { "analysis_explanation": null, "end": 3943, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3938 }, { "analysis_explanation": null, "end": 4301, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4293 }, { "analysis_explanation": null, "end": 4325, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4310 }, { "analysis_explanation": null, "end": 4425, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4410 }, { "analysis_explanation": null, "end": 4843, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4838 }, { "analysis_explanation": null, "end": 5345, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5339 }, { "analysis_explanation": null, "end": 5449, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5443 }, { "analysis_explanation": null, "end": 5499, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5494 }, { "analysis_explanation": null, "end": 5763, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5758 }, { "analysis_explanation": null, "end": 5817, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5808 }, { "analysis_explanation": null, "end": 6086, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6081 }, { "analysis_explanation": null, "end": 6383, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6378 }, { "analysis_explanation": null, "end": 6432, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6417 }, { "analysis_explanation": null, "end": 6453, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6448 }, { "analysis_explanation": null, "end": 6665, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6659 }, { "analysis_explanation": null, "end": 6812, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6803 }, { "analysis_explanation": null, "end": 7379, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7373 }, { "analysis_explanation": null, "end": 7538, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7529 }, { "analysis_explanation": null, "end": 7585, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7576 }, { "analysis_explanation": null, "end": 8124, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8109 }, { "analysis_explanation": null, "end": 8231, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8219 }, { "analysis_explanation": null, "end": 8703, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8698 }, { "analysis_explanation": null, "end": 8784, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8777 }, { "analysis_explanation": null, "end": 8901, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8892 }, { "analysis_explanation": null, "end": 9481, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9475 }, { "analysis_explanation": null, "end": 10219, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10217 }, { "analysis_explanation": null, "end": 10399, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10394 }, { "analysis_explanation": null, "end": 10456, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10449 }, { "analysis_explanation": null, "end": 10764, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10759 }, { "analysis_explanation": null, "end": 11469, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11463 }, { "analysis_explanation": null, "end": 11568, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11563 }, { "analysis_explanation": null, "end": 11961, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11956 }, { "analysis_explanation": null, "end": 12069, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12061 }, { "analysis_explanation": null, "end": 12154, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12145 }, { "analysis_explanation": null, "end": 12678, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12673 }, { "analysis_explanation": null, "end": 13058, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13051 }, { "analysis_explanation": null, "end": 13088, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13080 }, { "analysis_explanation": null, "end": 13258, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13253 }, { "analysis_explanation": null, "end": 13362, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13357 }, { "analysis_explanation": null, "end": 13715, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13710 }, { "analysis_explanation": null, "end": 14476, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14471 }, { "analysis_explanation": null, "end": 14709, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14702 }, { "analysis_explanation": null, "end": 14942, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14935 }, { "analysis_explanation": null, "end": 14952, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14947 }, { "analysis_explanation": null, "end": 15244, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15239 }, { "analysis_explanation": null, "end": 15478, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15469 }, { "analysis_explanation": null, "end": 15890, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15885 }, { "analysis_explanation": null, "end": 16190, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16185 }, { "analysis_explanation": null, "end": 16810, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16801 }, { "analysis_explanation": null, "end": 17503, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17495 }, { "analysis_explanation": null, "end": 17578, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17569 }, { "analysis_explanation": null, "end": 18653, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18639 }, { "analysis_explanation": null, "end": 19398, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19388 }, { "analysis_explanation": null, "end": 19635, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19629 }, { "analysis_explanation": null, "end": 20449, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20434 }, { "analysis_explanation": null, "end": 20906, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20894 }, { "analysis_explanation": null, "end": 21516, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21506 }, { "analysis_explanation": null, "end": 21771, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21766 }, { "analysis_explanation": null, "end": 21855, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21850 }, { "analysis_explanation": null, "end": 21939, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21934 }, { "analysis_explanation": null, "end": 21960, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21953 }, { "analysis_explanation": null, "end": 22876, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 22869 }, { "analysis_explanation": null, "end": 23318, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 23311 }, { "analysis_explanation": null, "end": 23500, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 23490 }, { "analysis_explanation": null, "end": 23655, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 23650 }, { "analysis_explanation": null, "end": 24345, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 24340 }, { "analysis_explanation": null, "end": 24368, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 24363 }, { "analysis_explanation": null, "end": 24770, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 24763 }, { "analysis_explanation": null, "end": 24793, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 24788 }, { "analysis_explanation": null, "end": 25056, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 25050 }, { "analysis_explanation": null, "end": 25128, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 25123 }, { "analysis_explanation": null, "end": 25213, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 25199 }, { "analysis_explanation": null, "end": 25289, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 25282 }, { "analysis_explanation": null, "end": 25387, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 25382 }, { "analysis_explanation": null, "end": 25600, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 25595 }, { "analysis_explanation": null, "end": 25781, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 25776 }, { "analysis_explanation": null, "end": 26230, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 26225 }, { "analysis_explanation": null, "end": 26240, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 26235 }, { "analysis_explanation": null, "end": 26563, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 26558 }, { "analysis_explanation": null, "end": 26655, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 26650 }, { "analysis_explanation": null, "end": 27175, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 27170 }, { "analysis_explanation": null, "end": 27230, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 27225 }, { "analysis_explanation": null, "end": 27240, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 27235 }, { "analysis_explanation": null, "end": 27402, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 27397 }, { "analysis_explanation": null, "end": 27451, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 27446 }, { "analysis_explanation": null, "end": 28168, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 28163 }, { "analysis_explanation": null, "end": 28218, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 28211 }, { "analysis_explanation": null, "end": 28237, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 28232 }, { "analysis_explanation": null, "end": 28371, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 28365 }, { "analysis_explanation": null, "end": 28459, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 28454 }, { "analysis_explanation": null, "end": 28484, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 28480 }, { "analysis_explanation": null, "end": 28522, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 28507 }, { "analysis_explanation": null, "end": 28597, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 28581 }, { "analysis_explanation": null, "end": 28626, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 28611 }, { "analysis_explanation": null, "end": 28735, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 28730 }, { "analysis_explanation": null, "end": 28764, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 28760 }, { "analysis_explanation": null, "end": 28793, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 28788 }, { "analysis_explanation": null, "end": 28822, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 28818 }, { "analysis_explanation": null, "end": 28877, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 28872 }, { "analysis_explanation": null, "end": 29015, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 29010 }, { "analysis_explanation": null, "end": 29351, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 29346 }, { "analysis_explanation": null, "end": 29437, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 29426 }, { "analysis_explanation": null, "end": 29984, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 29979 }, { "analysis_explanation": null, "end": 30022, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 30016 }, { "analysis_explanation": null, "end": 30122, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 30107 }, { "analysis_explanation": null, "end": 30587, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 30582 }, { "analysis_explanation": null, "end": 30597, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 30592 }, { "analysis_explanation": null, "end": 30737, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 30732 }, { "analysis_explanation": null, "end": 31250, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 31245 }, { "analysis_explanation": null, "end": 31599, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 31594 }, { "analysis_explanation": null, "end": 31765, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 31760 }, { "analysis_explanation": null, "end": 32036, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 32031 }, { "analysis_explanation": null, "end": 32203, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 32198 }, { "analysis_explanation": null, "end": 32419, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 32412 }, { "analysis_explanation": null, "end": 32446, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 32436 }, { "analysis_explanation": null, "end": 32494, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 32487 }, { "analysis_explanation": null, "end": 32906, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 32898 }, { "analysis_explanation": null, "end": 33134, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 33127 }, { "analysis_explanation": null, "end": 33341, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 33334 }, { "analysis_explanation": null, "end": 33370, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 33363 }, { "analysis_explanation": null, "end": 33377, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 33372 }, { "analysis_explanation": null, "end": 621, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 619 } ]

[ "Bill Tieleman is one of BC's best known communicators, political commentators and strategists.", "\nBill is a political panelist regularly on CBC Radio and TV in BC and with other media.", "\nBill has been Communications Director in the B.C. Premier's Office and at the BC Federation of Labour.", "\nBill owns West Star Communications, a consulting firm providing strategy and communication services for labour, business, non-profits and government.", "\n\nWednesday, October 17, 2012\n\nBill Tieleman responds to Alex G. Tsakumis' allegations\n\n2 UPDATES AT END OF THIS ORIGINAL ARTICLEI take no pleasure in responding to allegations posted on the blog of Alex G. Tsakumis today - no pleasure because Alex and I were once friends, until his behaviour ended that friendship suddenly several years ago. ", "I have no intention to go into the details.", "In his post dated October 17, 2012 and titled \"The Conspiracy Theorists in BC Know the BC NDP Numbers are Somewhat Soft: A Fear on the Left that the Right Will Unite\" Alex makes a number of negative comments and casts several aspersions regarding my blog post on the BC Conservative Party's troubles and a previous column on that party's AGM. ", "Some posters on his blog do the same, along with his additional commentary.", "I will not engage in a lengthy debate on the merits of the BC Conservative Party's dissidents, what role the BC Liberal Party or its members have played in these events or my motivation for discussing these issues. ", "That I am a supporter of the BC NDP is hardly news and has always been well known. ", "In the blog item, I clearly indicated some would reject what I wrote because of that but they should debate the information presented.", "Alex also writes that: \"NOT ONCE, did Tieleman pay tribute to John vanDongen–who is, naturally, everyone’s hero.", "\"Completely wrong. ", "I appreciate the work that Abbotsford-South MLA John van Dongen has done on the Basi-Virk/BC Rail case as an intervenor in Auditor General John Doyle's application for legal fee documents - and I have lauded him in my column and blog for that on September 18, even starting with a strong quote from van Dongen. ", "I attended at least part of every day of the BC Supreme Court hearing and spoke with van Dongen about it every day.", "Later, after van Dongen quit the BC Conservatives and I was told he had been talking to BC Liberal MLAs Donna Barnett and Moira Stilwell, I called him up and interviewed him about it, as is only right, and reported his response.", "I have not \"gone quiet\" on Basi-Virk - I've covered the case since day one on December 28, 2003, broken multiple stories, published a 10,000 word A-Z on Basi-Virk and will continue to report on it as I see fit and am able. ", "But I won't take criticism like that from someone who not once attended a session of the Basi-Virk pre-trial hearings or the trial over all those years. ", "Lastly, I do not disclose who my clients are any more than Alex discloses his clients or his sources of income or anyone else in the business world does. ", "Nor do I need to \"explain myself\" to Alex G. Tsakumis. ", "Nor will I be posting anything on his blog.", "\n\nUPDATE 7 p.m. - Alex G. Tsakumis tells me in an email that he attended seven pre-trial hearing days and one day of the trial - I accept his information and am happy to correct the record. ", "UPDATE Thursday 7 p.m. - Alex G. Tsakumis has posted another article criticizing me. ", "I will refrain from much further commentary on it except to respond to this claim:Tsakumis writes: \"When I was still his colleague in 2009, three times in six months, while my column’s popularity at 24 Hours had easily eclipsed his, he took shots at me in his Tuesday column space. ", "I went to my then editor and asked if we were a team or not. ", "I don’t mind taking criticism, but for a colleague AND FRIEND to despicably group me together with climate change skeptics that allegedly were taking bribes from major oil companies, was beyond the pale. ", "If it was anyone else alluding to that, I’d have immediately sued.", "\n\nWhen he did it the last time, over my salient and factual positions against the lies told by his personal friend James Hoggan–a global warming doomsterist and climate change catastrophe propagandist, Tieleman attacked one last time.", "\n\nThat was it, I was on my way out the door–I immediately resigned as columnist–even though, the publisher begged me to find a way of staying. ", "I wouldn’t without a published apology to me and my throng of readers. ", "I wrote Tieleman three stinging, nasty emails–expletive laden and raw, telling him what a cheap shot artist I thought he was. (", "My then editor, I found out later was dating a PR consultant friend of Tieleman’s and Hoggan’s–thats why the cheap shot in Tieleman’s column was permitted). ", "Your name, in this business, is everything and I wasn’t about to let someone, anyone, sully mine.", "\"You can read the column I wrote here and decide for yourself but the only mention of Tsakumkis was as follows:\n\n\"James Hoggan’s new book Climate Cover-Up [Greystone Books] is a must-read for anyone concerned about the biggest, most pervasive effort ever at manipulating the media by some of the world’s largest and most powerful corporations.", "\n\nWhy, I’d even recommend it highly to my 24 hours colleague Alex Tsakumis, who has ripped Hoggan and CKNW AM 980radio host Bill Good for two weeks straight about the issue for allegedly not providing “balance” on climate change.", "\n\n[Disclosure – Hoggan and Good are friends of mine and I appear on Bill’s show every Monday – but Alex is a friend too.]\"", "\n\n.Tsakumis quit 24 hours newspaper before he had read my column and before it was published. ", "He did not contact me to ask what I had written in the column that evening. ", "I did not and do not have a \"PR consultant friend\" who was dating the editor. ", "I do not recall taking \"shots\" at Tsakumis previously - certainly at that point he and I were still friends and he had not raised concerns with what I had written.", "Again, I regret this situation but I will leave it to my readers to judge for themselves what happened..\n\n53 comments:\n\nI make a point of reading all the non-MSM political material I can find, but I no longer read the blog authored by what the commenter above referred to as a worthless wanker. ", "That comment is a disservice to wankers everywhere. ", "The blogger referred to is much less than that.", "\n\nThe column you wrote is spot on. ", "Anyone paying attention to BC politics can see that the right-wing money is desperately urging, cajoling and buying a united right. ", "Buying in the sense of threatening to withhold funding. ", "Van Dongen, for all his good work on BC Rail, has set his sail to catch whatever wind will lead to his re-election. ", "His affiliation with the aforementioned troll diminishes any of the good work Van Dongen did, or may do.", "\n\nCarol James was stabbed in the back by the MSM before the BC NDP decided to choose a new leader. ", "Carol James took a group of journalists (I use the term loosely) up in an airplane to look at the ecological damage the Independent Power Producers are doing to the environment on the mountains here in BC. ", "It was windy so the reporters wound not look out the windows and see the damage that is being done. ", "They slagged Carol James for taking them on such a rough plane ride and ignored the real issue, the damage the IPP's were doing to the environment as well as the high cost the energy is costing BC Hydro and its rate payers. ", "It was not the NDP that stabbed her in the back, it was the MSM that ignored the issues that she brought forward.", "\n\nCarole James had two cracks at an election win..Who gets three cracks?", "\n\nYes the media hated Carole James until she was deposed, then they(The Media) found the Carole love..\n\nIt`s a non-issue, Carole James is running in her riding, she will be a cabinet minister if the NDP win the election..\n\nThere is a difference, Carole James and the NDP WANT to make a social difference, a province where children, workers and family health come first, all families..\n\nEducation, health and a little social justice, do you realize that the HST by the time it`s gone will have cost BC consumers $4 billion dollars, $4 billion dollars to the corporate bottom line,....\n\nJust imagine, I`m against the HST in the form it took, all that consumer tax going to big corporations, imagine if that $4 billion dollars went for the people, special ed, disabled, seniors care, but it didn`t, it went to $billion dollar corporations, nothing dropped in price and no one was hired..\n\nI had to block Alex from my facebook account because we got into a debate and when one of his friends posted Geoghegan 1 Tsakumis 0 he went straight into cyber psychosis. ", "I lost all respect for him after that.", "\n\nI just hate this when some of my favorite bloggers are having a differance of opinion. ", "At some level it is entertainig on another level, not so much. ", "I see most people as having common goals, decent education, clean hospitals, no child poverty, etc. ", "We may differ on how to get there but we have similar goals. ", "I think the task at hand is dealing with the issues, not with each other.", "\n\nYou did just fine complementing the lieberals on the wine thing. ", "It was about time the move was made. ", "for the odd time they do something right it doesn't hurt any one or change their political affiliations to complement the other side.", "\n\nHow some one makes their money is no ones business. ", "Most people have to make a living, & as I used to say when I worked, I do if for the most money possible unless it offends my personal principals or puts me in jail.", "\n\nAs to pictures, gee, there was a time in Canada when oppositing politicians did actually socialize outside of their work places. ", "I don't think in this case pictures mean all that much.", "\n\nI do enjoy your blogg, read it regularly. ", "The catcha doesn't always work so that restricts my commenting but that maybe just as well.", "\n\nSome folks manage to read blogs from all areas of political comment. ", "My gosh I read stuff by Conrad Black now and again. ", "Read the others sides stuff to see what they are thinking about. ", "No different with some of us reading Alex T. The line up here has shifted from the bloggers comments on Alex T. to who loved Carol James the most, James was my MLA and I was quite happy to see the riding shift so I wouldn't have to vote for or against her.10 rodergai\n\nThank you Bill. ", "Funny the AGT doesn't see his own \"my way or the highway\" act as bullying. ", "Disagree with His Exulted Highness? ", "Prepare for a verbal brow-beating or a tale of his boxing abilities. ", "Sad little egotist. ", "But there is hope - you have to delude yourself into thinking Harper is the second coming of Jesus and all will be good.", "\n\nI disagree, because when one considers how the Campbell/Clark Cabal and their organized criminal organization rob the people of B.C., it should be everyone's business, especially law enforcement. ", "However in our banana republic of a province the purpose of the police is to provide cover for the real capos of organized crime, like Campbell and his cohorts.", "\n\nNo one needs to point out the sheer assholery of the blogger mentioned in the title of this post - he does a perfectly adequate job of illustrating it through his rude, insulting posts and sycophantic and imaginary commenters! ", "I enjoy reading his rants, but realize it is impossible to engage him in rational discussion, his comment thread is for fawning and/or imaginary folks only!", "\n\nHe is interesting to read for an alternate view of history, though his is not as well done as Stephen King's recent time travel/history manipulation novel 11/22/63 - of course Mr. King states clearly out front that his work is fiction, and doesn't pretend otherwise.", "\n\nBut anyone who reads the King of Bloggers even sporadically must realize if he ain't dissing somebody, anyone from Vision, Grant, Laila, the dear late BC Mary, Robin, myself or virtually anyone to the left of Benny who made the trains run on time, he ain't posting. ", "I take that back, because every now and then he dips into the super maudlin, for contrast I presume!", "\n\nAren't some folks, including the \"greasy weasel,\" conflating the BC liaR Party with the BCMA?", "\n\nNow doctors, tending to be richer than the average manager at MacDonalds, may tend to the political right, after all, conservatism in these folks minds is all about justifying greed as a virtue.......but that still doesn't make the Medical Association an actual part of the BC Liberal Party.", "\n\nDoctor Day, the rabid cheerleader for privatization of healthcare and the BC Libs are obviously on the same page, but many in the medical professions are actually there because they are interested in \"helping\" people, believe it or not. ", "The doctors in my little town have been virtually at war with the Inferior Health Authority and their masters in Victoria for over a decade now, and thanks to them I still don't have to travel two or more hours for anything more than an aspirin!They love and are part of our community!", "\n\nwhen I wrote, its no ones business how someone makes their money, I was actually referring to AGT's comments regarding B.T. having a contract with the BCMA.", "\n\nOf course I don't condon illegal activities or those that impinge on other peoples' rights. ", "As I said I worked for the most money possible as long as it didn't offend my personal prinipals or put me in jail.", "\n\nwhat most people choose to do for a living is quite different from what has gone on in B.C. regarding our railroad, child poverty, stupid meters, tolls, etc. ", "Just for the record I don't adhere to the, I was just following orders, routine either.", "\n\nI had no idea this Jackie Gleason wannabe even existed 'till about a year ago, and decided to challenge him. ", "With 3 comments, I was blocked.", "The man is thin skinned and is in the same realm as Mitt (flip flop) Romney. ", "Hardly worth a second look.", "I have long since forgotten this clown.", "\n\nHe ranted about me and my allegedly insane conspiracy theories about water exports - theories that are largely supported by documentation, third party witnesses, affidavit evidence and reasoned inferences from the facts.", "\n\nMr. Tsakumis even threatened to launch a lawsuit against me if I ever posted a comment on his pathetic little blog again. ", "I suppose he is afraid of freedom of speech when it doesn't agree with him which is a trait one does not usually expect to encounter in a professional journalist.", "\n\nI am not certain why he is so opposed the ideas expressed at the Water War Crimes web site. ", "http://www.waterwarcrimes.com\n\nHis fear of those ideas may have something to do with the fact that he once worked for Elwood Veitch and Bill Vander Zalm who were involved in some of the questionable Social Credit shenanigans related to water exports.", "\n\nHis almost pathological hatred of Christy Clark may also be based in his background with those two political scoundrels from a very strange part of BC history that is not fully explained.", "\n\nYou mentioned Carole James got two cracks at an election win. ", "You asked who gets three cracks?", "\n\nThere was Dave Barrett (after his short lived term as Premier). ", "He went on to try again in 1975, 1979 and 1983, and lost each time.", "\n\nThe media did not do Carole James in, Jenny Kwan and a few others did within the NDP.", "\n\nWhat the NDP wants and what they will be able to accomplish are two different things may end up being different.", "\n\nDon't expect the NDP to be able to magically erase all instances of poverty, provide everything for families based on NDP goals.", "\n\nIt simply isn't going to happen.", "\n\nThere was poverty and the DTES was a mess when the NDP was in power, and there will be poverty and the DTES will still be a mess when the NDP assumes power after next year's election.", "\n\nand \"working people\"? ", "Give it a rest. ", "Anyone who works for a paycheque is a working person, be it the small store owner, the accountant, the construction worker, the sales person, the bank manager, the engineer, bus driver, even the non union medical lab technician who handles stool samples.", "\n\nWell, I think AGT just lost about three thousand hits (and a few comments)due to his ego. ", "I really enjoyed hia 'contributions' to the Basi/Virk/BCRail fiasco, but that seems to have waned lately.", "So, guess I'll have to go elsewhere for my info. ", "Since he's branded me as a 'lefty', I guess it might as well be here.", "Yea, about those so caled 'hits', I guess about half of them are responding to his Challenger/ challenged friends. ", "So long Alex.", "\n\nlI posted on the frogs blog,told him that holding my breath for the rest of the bc rail post was not an option he kept saying it's with my lawyers and kept promising week after week any information that opertunist gave us was widely available and given to us years ahead of that fool,I've said it before and here I'll say it again that guy is a trojan horse.", "\n\nSad to see all this Bill. ", "Although Tsakumis is a known quantity, people shouldn't be shocked to learn that he's rather mercurial. ", "And it's hard to take his argument very seriously as there's a glaring contradiction in alleging that you're a NDP partisan for what you said in that post, and at the same time you're also somehow secretly a Liberal partisan because of BCMA. ", "These claims are mutually exclusive. ", "And your speculations about the Patton photo are no different than what folks like Mike Smyth have raised which means Tsakumis' whole narrative about this being some sort of convoluted and tendentious Dipper agenda therefore completely collapses.", "\n\nFrankly, given the actual substance of Tsakumis' attack I think this is more about him having had been annoyed with you on a couple issues for some time, like your role in the James wars, and that has finally manifested itself in his post. ", "That said, if Tsakumis was an intrepid journalist a few days ago on files like BC Rail then it would be still be the case today even if he happened to vociferously lambast somebody (and was in the wrong about it).", "\n\nSince when is the BCMA a Liberal Association? ", "I doubt that Alex T. getting dumped by 24 hours was a decision made by Bill Tielman, so it looks like he is striking at someone he used to work with.", "\n\nWorking people have to eat and get work where they can as long as they feel the outfit looking for a communications guy is not a BC Liberal plant. ", "I doubt as well that Bill is suddenly a BC LIberal supporter.", "\n\nWiht the NDP there is not going to be a socially just, environmentally sound, and economically sustainable province, 100% not even half that.", "\n\nYou're dreaming an environmentalist's together with an anti-poverty advocate's dream where everyone is making at least $18.00 an hour, the sky is as clear and sharp as it was 250,000 years ago, and the finances are as balanced as a scientist's scale.", "\n\nUntil AGT pulls his head out of, let's call it, Harperfantasyland, he has boom all credibility.", "No objectivity, just quiet cheerleading. ", "Sad, because he can be a good read, but he's an epic failure and shows the same crap he whines about.", "\n\nSo Bill are you going to be sending Alex flowers for giving you all this nonstop publicity and attention on his blog, with its vast readership and the hits spilled over to here? ", "And wow, according to Alex you're the hidden hand behind every major political event that's ever happened in British Columbia. ", "That's very flattering of him to say--and just in time too: tickets are still available for the Tyee's Masterclass Series with Bill Tieleman, buy now while supplies last!", "\n\nTsakumis knows a fair bit about BC politics and does some good stuff. ", "But this doesn't take away from the fact that he is an egotistical blowhard who blusters and browbeats people and then throws a fit when someone disagrees with him and gives him a browbeating.", "\n\nThen when you continue to present solid evidence that destroys his position (which he can't support with any evidence..he just states his opinion and calls anyone disagreeing an idiot) he silences the poster by blocking them from his blog. ", "He can't stand been shown to be wrong on something. ", "It show's a distinct lack of maturity and class. ", "He's like a spoiled child throwing a tantrum. ", "Too bad because the stuff he has done to expose the useless christy clark has been good.", "\n\nBill Tieleman and Senator Larry Campbell, former Vancouver mayor\n\nJim Sinclair, Cindy Oliver, Ken Georgetti and Bill Tieleman\n\nBill Tieleman's coverage of the Basi-Virk/BC Legislature Raid Case praised by other journalists:\n\n\"This outstanding piece of journalism, in The Tyee, is the work of a journalist who has been deeply involved with this issue from the start and this article should be passed on as far and wide as possible.\"", "\n\n\"Bill Tieleman from 24 hours . . . . ", "If you want to know about this trial and about this case, you have to read his blog – I mean, that’s just all there is to it – it’s required reading if you want to understand the BC Legislature Raid situation.\"", "\n\n- Mike Smyth, columnist, The Province\n\n\"The Basi-Virk case....you’ve probably sat through more of these hearings and gone through more of the files and written about it than any other journalist in the province.\"", "\n\n- Bill Good, host, The Bill Good Show, CKNW/Corus Radio Network\n\n\"Tieleman ...has done a first-rate job covering the trial.\"", "\n\n- Paul Willcocks, columnist, the Victoria Times-Colonist\n\n\"Tieleman, who marries a considerable journalistic talent with one of the smartest political minds in the province, has been writing more web-exclusive material. ", "And his coverage of the Basi-Virk trial is a must-read -- whether you're an insider or an outsider.\"", "\n\n\"24 Hours, the Vancouver paper that has been leading the coverage, as well as the hints of conspiracy in B.C.\"\n\n- Norman Spector, columnist, Globe and Mail\n\n\"Although the major media in this circumstance has been giving the case significant coverage, Tieleman's reports on his blog have been outstanding.", "\n\nThe entire cut and thrust of legal wrangling and arguments has been covered and is accompanied by considered analysis.....His blog site coverage of the Basi-Virk trial is the most in depth treatment of one of British Columbia's biggest political scandals.\"", "\n\n- Bill Bell, columnist, The North Shore News\n\n\"Mr. Tieleman has published online dispatches which, freed from the limitations of newsprint space or broadcast time, can run at length. ", "They also remain available for those select readers who become obsessed with a case also known as Railgate.....\n\nIn another bizarre twist to a story with no shortage of them, Mr. Tieleman went to work one day in December only to discover his office had been ransacked. ", "Bookcases had been tipped over and papers strewn, but nothing was missing.", "\n\nTo top it off, a press kit for the self-published novel The Raid, written by a retired military officer in Metchosin and featuring on its cover a photograph from the 2003 police raid, had been left in a conspicuous place.\"", "\n\n- Tom Hawthorn, columnist, The Globe and Mail\n\nNobody has followed the Basi-Virk affair over its past five years with greater diligence than local journalist, Bill Tieleman....Tieleman deserves our thanks, a fistful of journalism awards and some merit citation for citizenship." ]

{ "pile_set_name": "Pile-CC" }

[ 0.02127659574468085, 0.034482758620689655, 0.019417475728155338, 0.013333333333333334, 0.00872093023255814, 0, 0.008746355685131196, 0, 0.009302325581395349, 0.012048192771084338, 0, 0.026785714285714284, 0, 0.01607717041800643, 0.017391304347826087, 0.021929824561403508, 0, 0.006535947712418301, 0, 0.01818181818181818, 0, 0.005263157894736842, 0, 0.0035460992907801418, 0, 0.004901960784313725, 0, 0.008547008547008548, 0, 0, 0.007874015748031496, 0, 0, 0.0029154518950437317, 0.013100436681222707, 0.00819672131147541, 0, 0, 0, 0.006134969325153374, 0, 0, 0, 0, 0.007575757575757576, 0, 0.017241379310344827, 0.009615384615384616, 0.030303030303030304, 0.014563106796116505, 0, 0.013392857142857142, 0.008849557522123894, 0, 0.003784295175023652, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.019230769230769232, 0, 0.021052631578947368, 0.013333333333333334, 0, 0, 0, 0.008333333333333333, 0.005050505050505051, 0.00625, 0, 0, 0.007462686567164179, 0.007462686567164179, 0, 0.021052631578947368, 0.010238907849829351, 0.008368200836820083, 0.0035087719298245615, 0.0189873417721519, 0, 0, 0, 0, 0.009009009009009009, 0, 0.025974025974025976, 0, 0, 0, 0.008064516129032258, 0, 0, 0.016, 0.010582010582010581, 0.015625, 0, 0.030303030303030304, 0, 0.022988505747126436, 0.008771929824561403, 0.015384615384615385, 0, 0.021621621621621623, 0, 0, 0, 0.010869565217391304, 0.009523809523809525, 0, 0, 0, 0, 0.002777777777777778, 0, 0.009615384615384616, 0.004132231404958678, 0, 0.008130081300813009, 0.004132231404958678, 0.009389671361502348, 0, 0.013422818791946308, 0.006711409395973154, 0.03278688524590164, 0.006993006993006993, 0, 0, 0, 0, 0, 0, 0.0058823529411764705, 0.013888888888888888, 0, 0, 0, 0, 0, 0, 0.020785219399538105, 0.02564102564102564, 0, 0.004672897196261682, 0.007936507936507936, 0.0045045045045045045, 0, 0.006535947712418301, 0, 0.016216216216216217, 0.007434944237918215, 0, 0.004464285714285714, 0.014336917562724014 ]

[ { "analysis_explanation": null, "end": 13, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 0 }, { "analysis_explanation": null, "end": 26, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 24 }, { "analysis_explanation": null, "end": 99, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 95 }, { "analysis_explanation": null, "end": 159, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 157 }, { "analysis_explanation": null, "end": 186, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 182 }, { "analysis_explanation": null, "end": 289, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 285 }, { "analysis_explanation": null, "end": 462, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 435 }, { "analysis_explanation": null, "end": 477, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 464 }, { "analysis_explanation": null, "end": 507, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 490 }, { "analysis_explanation": null, "end": 648, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 632 }, { "analysis_explanation": null, "end": 654, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 649 }, { "analysis_explanation": null, "end": 681, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 677 }, { "analysis_explanation": null, "end": 775, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 758 }, { "analysis_explanation": null, "end": 855, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 839 }, { "analysis_explanation": null, "end": 898, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 896 }, { "analysis_explanation": null, "end": 1677, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1673 }, { "analysis_explanation": null, "end": 1749, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1735 }, { "analysis_explanation": null, "end": 1848, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1832 }, { "analysis_explanation": null, "end": 1868, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1853 }, { "analysis_explanation": null, "end": 1954, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1944 }, { "analysis_explanation": null, "end": 2063, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2051 }, { "analysis_explanation": null, "end": 2114, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2104 }, { "analysis_explanation": null, "end": 2153, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2144 }, { "analysis_explanation": null, "end": 2211, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2201 }, { "analysis_explanation": null, "end": 2255, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2245 }, { "analysis_explanation": null, "end": 2349, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2336 }, { "analysis_explanation": null, "end": 2368, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2354 }, { "analysis_explanation": null, "end": 2535, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2528 }, { "analysis_explanation": null, "end": 2556, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2539 }, { "analysis_explanation": null, "end": 2835, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2824 }, { "analysis_explanation": null, "end": 3044, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3028 }, { "analysis_explanation": null, "end": 3122, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3097 }, { "analysis_explanation": null, "end": 3189, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3185 }, { "analysis_explanation": null, "end": 3201, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3194 }, { "analysis_explanation": null, "end": 3293, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3285 }, { "analysis_explanation": null, "end": 3319, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3294 }, { "analysis_explanation": null, "end": 3501, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3497 }, { "analysis_explanation": null, "end": 3528, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3518 }, { "analysis_explanation": null, "end": 3570, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3562 }, { "analysis_explanation": null, "end": 3630, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3623 }, { "analysis_explanation": null, "end": 4102, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4090 }, { "analysis_explanation": null, "end": 4629, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4621 }, { "analysis_explanation": null, "end": 4900, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4891 }, { "analysis_explanation": null, "end": 4931, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4919 }, { "analysis_explanation": null, "end": 5197, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5189 }, { "analysis_explanation": null, "end": 5221, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5208 }, { "analysis_explanation": null, "end": 5244, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5238 }, { "analysis_explanation": null, "end": 5280, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5271 }, { "analysis_explanation": null, "end": 5294, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5285 }, { "analysis_explanation": null, "end": 5397, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5391 }, { "analysis_explanation": null, "end": 5447, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5443 }, { "analysis_explanation": null, "end": 5467, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5461 }, { "analysis_explanation": null, "end": 5478, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5474 }, { "analysis_explanation": null, "end": 5521, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5513 }, { "analysis_explanation": null, "end": 6365, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6363 }, { "analysis_explanation": null, "end": 6534, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6524 }, { "analysis_explanation": null, "end": 6728, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6718 }, { "analysis_explanation": null, "end": 6756, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6745 }, { "analysis_explanation": null, "end": 6853, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6842 }, { "analysis_explanation": null, "end": 7046, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7044 }, { "analysis_explanation": null, "end": 7172, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7161 }, { "analysis_explanation": null, "end": 7498, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7486 }, { "analysis_explanation": null, "end": 7589, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7577 }, { "analysis_explanation": null, "end": 7650, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7644 }, { "analysis_explanation": null, "end": 7689, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7677 }, { "analysis_explanation": null, "end": 7813, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7801 }, { "analysis_explanation": null, "end": 8055, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8053 }, { "analysis_explanation": null, "end": 8460, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8456 }, { "analysis_explanation": null, "end": 8559, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8550 }, { "analysis_explanation": null, "end": 9537, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9531 }, { "analysis_explanation": null, "end": 9914, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9902 }, { "analysis_explanation": null, "end": 10039, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10032 }, { "analysis_explanation": null, "end": 10106, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10099 }, { "analysis_explanation": null, "end": 10131, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10120 }, { "analysis_explanation": null, "end": 10147, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10142 }, { "analysis_explanation": null, "end": 10278, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10274 }, { "analysis_explanation": null, "end": 10548, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10542 }, { "analysis_explanation": null, "end": 10733, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10729 }, { "analysis_explanation": null, "end": 11450, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11436 }, { "analysis_explanation": null, "end": 11526, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11522 }, { "analysis_explanation": null, "end": 11650, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11630 }, { "analysis_explanation": null, "end": 11767, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11760 }, { "analysis_explanation": null, "end": 11774, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11769 }, { "analysis_explanation": null, "end": 11823, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11818 }, { "analysis_explanation": null, "end": 12720, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12712 }, { "analysis_explanation": null, "end": 12809, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12792 }, { "analysis_explanation": null, "end": 13008, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13004 }, { "analysis_explanation": null, "end": 13066, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13060 }, { "analysis_explanation": null, "end": 13341, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13337 }, { "analysis_explanation": null, "end": 13529, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13510 }, { "analysis_explanation": null, "end": 13573, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13557 }, { "analysis_explanation": null, "end": 13693, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13689 }, { "analysis_explanation": null, "end": 14015, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14007 }, { "analysis_explanation": null, "end": 14511, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14498 }, { "analysis_explanation": null, "end": 14532, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14516 }, { "analysis_explanation": null, "end": 14678, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14665 }, { "analysis_explanation": null, "end": 14781, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14779 }, { "analysis_explanation": null, "end": 14845, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14833 }, { "analysis_explanation": null, "end": 14936, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14924 }, { "analysis_explanation": null, "end": 15009, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15005 }, { "analysis_explanation": null, "end": 15015, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15011 }, { "analysis_explanation": null, "end": 15024, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15020 }, { "analysis_explanation": null, "end": 15079, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15067 }, { "analysis_explanation": null, "end": 15094, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15084 }, { "analysis_explanation": null, "end": 15437, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15433 }, { "analysis_explanation": null, "end": 15580, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15569 }, { "analysis_explanation": null, "end": 15994, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15991 }, { "analysis_explanation": null, "end": 16326, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16322 }, { "analysis_explanation": null, "end": 16330, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16328 }, { "analysis_explanation": null, "end": 16504, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16484 }, { "analysis_explanation": null, "end": 16711, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16707 }, { "analysis_explanation": null, "end": 17134, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17128 }, { "analysis_explanation": null, "end": 17189, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17179 }, { "analysis_explanation": null, "end": 17524, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17519 }, { "analysis_explanation": null, "end": 17605, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17597 }, { "analysis_explanation": null, "end": 17647, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17633 }, { "analysis_explanation": null, "end": 17710, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17705 }, { "analysis_explanation": null, "end": 17863, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17856 }, { "analysis_explanation": null, "end": 17890, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17882 }, { "analysis_explanation": null, "end": 17926, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17914 }, { "analysis_explanation": null, "end": 18165, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18161 }, { "analysis_explanation": null, "end": 18206, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18202 }, { "analysis_explanation": null, "end": 18536, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18519 }, { "analysis_explanation": null, "end": 18841, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18837 }, { "analysis_explanation": null, "end": 18874, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18870 }, { "analysis_explanation": null, "end": 19038, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19034 }, { "analysis_explanation": null, "end": 19137, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19121 }, { "analysis_explanation": null, "end": 19279, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19266 }, { "analysis_explanation": null, "end": 19318, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19310 }, { "analysis_explanation": null, "end": 19344, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19342 }, { "analysis_explanation": null, "end": 20062, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20049 }, { "analysis_explanation": null, "end": 20089, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20075 }, { "analysis_explanation": null, "end": 20107, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20098 }, { "analysis_explanation": null, "end": 20127, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20115 }, { "analysis_explanation": null, "end": 20141, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20129 }, { "analysis_explanation": null, "end": 20156, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20143 }, { "analysis_explanation": null, "end": 20174, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20161 }, { "analysis_explanation": null, "end": 20191, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20176 }, { "analysis_explanation": null, "end": 20324, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20316 }, { "analysis_explanation": null, "end": 20495, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20482 }, { "analysis_explanation": null, "end": 20509, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20501 }, { "analysis_explanation": null, "end": 20741, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20731 }, { "analysis_explanation": null, "end": 20953, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20944 }, { "analysis_explanation": null, "end": 21083, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21069 }, { "analysis_explanation": null, "end": 21397, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21389 }, { "analysis_explanation": null, "end": 21412, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21403 }, { "analysis_explanation": null, "end": 21497, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21493 }, { "analysis_explanation": null, "end": 21920, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21902 }, { "analysis_explanation": null, "end": 21961, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21952 }, { "analysis_explanation": null, "end": 22009, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 22001 }, { "analysis_explanation": null, "end": 22320, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 22312 }, { "analysis_explanation": null, "end": 22341, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 22334 }, { "analysis_explanation": null, "end": 22353, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 22345 }, { "analysis_explanation": null, "end": 22593, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 22584 }, { "analysis_explanation": null, "end": 22647, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 22643 }, { "analysis_explanation": null, "end": 22714, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 22702 }, { "analysis_explanation": null, "end": 22812, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 22793 }, { "analysis_explanation": null, "end": 22872, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 22859 }, { "analysis_explanation": null, "end": 11505, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.6, "start": 11497 }, { "analysis_explanation": null, "end": 14409, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 14380 } ]

[ "In these years, there is an increasing demand for improving the corrosion resistance of building materials for accommodating the acidifying atmospheric environment and construction works on the shore or in the sea. ", "For automotive bodies, on the other hand, corrosion resistance in snow melting salt spreading areas and seaside areas is a problem. ", "One economically advantageous measure for improving corrosion resistance is zinc coating, especially zinc hot dipping or galvanizing. ", "Further heat treatment to convert the zinc coating into a Fe-Zn alloy can improve weldability and corrosion resistance after paint coating. ", "As the problem of global greenhouse effect has drawn great attention, discussions are made on energy savings, especially fuel consumption improvement and body weight reduction of automobiles. ", "One effective approach is to increase the strength of steel strips. ", "Galvanizing or galvannealing of high-strength steel strips is then required in order to meet the above-mentioned demand for corrosion resistance.", "\nGalvanized or zinc hot dipped steel strips are manufactured by means of a continuous galvanizing line (CGL) by continuously carrying out the steps of degreasing by burning off of rolling grease or with alkali, annealing reduction, cooling, molten zinc bath dipping, and coating weight adjustment by gas wiping. ", "Galvannealing or alloying is generally carried out immediately after the wiping step. ", "As is well known in the art, readily workable high-strength steel strips contain Si, Mn, P, etc. ", "as additive components, which tend to concentrate and be oxidized at the steel strip surface, which substantially detracts from wettability to molten zinc, eventually leading to uncoated defects. ", "As a solution to this problem, it was proposed to carry out electroplating of Ni systems (JP-A 262950/1985 and 147865/1986) or electroplating of Fe systems (JP-A 194156/1990) to restrain concentration and oxidation of the additive components at the steel strip surface prior to the entry of steel strip into the CGL.", "\nElectroplating of Ni systems or electroplating of Fe systems prior to the entry of steel strip into the CGL is effective for restraining concentration and oxidation of the additive components at the steel strip surface and thus enables galvanizing of high-strength steel strips containing Si, Mn, P, etc., ", "but with the accompanying problems of more complex process, higher cost, and lower productivity due to the installation of an additional electroplating equipment. ", "It is then desired to develop a method capable of galvanizing high-strength steel strips containing Si, Mn, P, etc. ", "without raising these problems." ]

{ "pile_set_name": "USPTO Backgrounds" }

[ 0, 0, 0, 0.007142857142857143, 0, 0, 0, 0, 0, 0.010309278350515464, 0, 0.006329113924050633, 0.006514657980456026, 0, 0.008620689655172414, 0 ]

[ { "analysis_explanation": null, "end": 14, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3 }, { "analysis_explanation": null, "end": 1823, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1812 }, { "analysis_explanation": null, "end": 1839, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1828 }, { "analysis_explanation": null, "end": 1823, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 1812 }, { "analysis_explanation": null, "end": 1839, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 1828 }, { "analysis_explanation": null, "end": 1890, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 1879 }, { "analysis_explanation": null, "end": 1818, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 1812 }, { "analysis_explanation": null, "end": 1834, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 1828 }, { "analysis_explanation": null, "end": 1885, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 1879 } ]

[ "**Purpose:** Combined liposuction and abdominoplasty is a common procedure but is controversial due to concerns for increased complications. ", "Because of this, the lipoaspirate volume in abdominoplasty has been a topic of legislative regulations. ", "This study aims to evaluate complication rates in abdominoplasty performed with and without abdominal liposuction, as well as evaluate the effect of lipoaspirate volumes on complications.", "\n\n**Methods:** Abdominoplasties and suction-assisted lipectomies of the trunk were identified in the Tracking Operations and Outcomes for Plastic Surgeons database. ", "Multivariate regressions were used to determine the effect of concomitant liposuction in abdominoplasty, as well as determine the effect of liposuction volume on complications. ", "In light of recently proposed thresholds, multiple limits in liposuction were evaluated.", "\n\n**Results:** 11,191 patients met inclusion criteria with 9,638(86.1%) patients undergoing abdominoplasty with truncal liposuction and 1,553(13.9%) undergoing abdominoplasty alone. ", "Corresponding overall complication rates were 10.5% and 13.0%. ", "Combined liposuction and abdominoplasty was independently associated with a reduced likelihood of both overall complications (*p*=0.046) and seroma (*p*=0.030). ", "Given existing laws limiting liposuction volume to 500 or 1,000mL, each of these thresholds were evaluated with no effect on complications. ", "Surprisingly, increasing lipoaspirate volume was not independently associated with an increased risk of any complication.", "\n\n**Conclusions:** Abdominoplasty with truncal liposuction is a safe procedure with a lower rate of complications than abdominoplasty alone. ", "Current regulations governing liposuction volumes in abdominoplasty are arbitrary and do not reflect valid thresholds for increased complications. ", "Trunk liposuction and abdominoplasty is safe, with no significant risk of increased morbidity from increasing liposuction volumes.", "\n" ]

{ "pile_set_name": "PubMed Central" }

[ 0, 0, 0, 0.006060606060606061, 0, 0, 0, 0, 0.006211180124223602, 0, 0, 0, 0, 0, 0 ]

[]

[ "Q:\n\nPassing mysqli to class doesn't show results\n\nI have problem passing mysqli to my class. ", "It works fine when it's passing to non-class.", "\nI tried to use Dependency injection here but for some reason it won't show results when printed, it's just a blank page.", "\nHere is my connect.php \n <?", "php\n$db = new mysqli('localhost', 'root', '', 'audiologiska_kliniken');\n\nif($db->connect_errno > 0){\n die('Ett fel inträffade [' . ", "$db->connect_error . ']');", "\n}\n\nMy test class:\n <?", "php\n //error_reporting(0);\n include '../include/connect.php';\n\n class test\n {\n private $mysqli;\n\n function __construct(mysqli $db)\n {\n $this->mysqli = $db;\n $this->testing();\n }\n function testing()\n {\n $result = $this->mysqli->query(\"Select * from person\");\n print_r($result);\n }\n }\n\nA:\n\nyou are not instantiating test in order to use it\ninclude '../include/connect.php';\n\nclass test\n{\n private $mysqli;\n\n function __construct(mysqli $db)\n {\n $this->mysqli = $db;\n $this->testing();\n }\n function testing()\n {\n $result = $this->mysqli->query(\"Select * from person\");\n print_r($result);\n }\n}\n\nnew test($db);\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0, 0, 0, 0, 0, 0, 0, 0 ]

[ { "analysis_explanation": null, "end": 281, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 271 }, { "analysis_explanation": null, "end": 539, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 529 }, { "analysis_explanation": null, "end": 955, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 945 } ]

[ "Boris: The Film\n\nBoris: The Film () is a 2011 Italian comedy film directed by Giacomo Ciarrapico, Mattia Torre and Luca Vendruscolo. ", "It is based on the television series Boris.", "\n\nCast\n Alessandro Tiberi as Alessandro (intern)\n Luca Amorosino as Alfredo (first assistant director)\n Valerio Aprea as screenwriter 1\n Antonino Bruschetta as Duccio Patané (director of photography)\n Paolo Calabresi as Biascica (chief electrician)\n Antonio Catania as Diego Lopez (Director of Network)\n Carolina Crescentini as Corinna Negri (Actress)\n Pietro Sermonti as Stanis La Rochelle (Actor)\n Massimo De Lorenzo as screenwriter 2\n Carlo Luca De Ruggieri as Lorenzo (mute intern)\n Alberto Di Stasio as Sergio (director of production)\n Roberta Fiorentini as Itala (secretary of edition)\n Caterina Guzzanti as Arianna (assistant director)\n Francesco Pannofino as René (Director)\n\nReferences\n\nExternal links\n \n\nCategory:2011 films\nCategory:2010s comedy films\nCategory:Films about filmmaking\nCategory:Films based on television series\nCategory:Italian films\nCategory:Italian comedy films\nCategory:Italian-language films" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.015037593984962405, 0.023255813953488372, 0.01847826086956522 ]

[ { "analysis_explanation": null, "end": 5, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 0 }, { "analysis_explanation": null, "end": 45, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 41 }, { "analysis_explanation": null, "end": 53, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 46 }, { "analysis_explanation": null, "end": 96, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 78 }, { "analysis_explanation": null, "end": 110, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 98 }, { "analysis_explanation": null, "end": 131, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 115 }, { "analysis_explanation": null, "end": 175, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 170 }, { "analysis_explanation": null, "end": 200, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 183 }, { "analysis_explanation": null, "end": 214, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 204 }, { "analysis_explanation": null, "end": 239, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 225 }, { "analysis_explanation": null, "end": 250, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 243 }, { "analysis_explanation": null, "end": 292, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 279 }, { "analysis_explanation": null, "end": 331, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 312 }, { "analysis_explanation": null, "end": 348, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 335 }, { "analysis_explanation": null, "end": 391, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 376 }, { "analysis_explanation": null, "end": 403, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 395 }, { "analysis_explanation": null, "end": 440, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 425 }, { "analysis_explanation": null, "end": 455, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 444 }, { "analysis_explanation": null, "end": 499, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 479 }, { "analysis_explanation": null, "end": 516, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 503 }, { "analysis_explanation": null, "end": 543, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 528 }, { "analysis_explanation": null, "end": 565, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 547 }, { "analysis_explanation": null, "end": 593, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 575 }, { "analysis_explanation": null, "end": 635, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 613 }, { "analysis_explanation": null, "end": 646, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 639 }, { "analysis_explanation": null, "end": 679, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 662 }, { "analysis_explanation": null, "end": 689, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 683 }, { "analysis_explanation": null, "end": 734, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 716 }, { "analysis_explanation": null, "end": 743, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 738 }, { "analysis_explanation": null, "end": 785, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 777 }, { "analysis_explanation": null, "end": 796, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 789 }, { "analysis_explanation": null, "end": 838, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 819 }, { "analysis_explanation": null, "end": 846, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 842 }, { "analysis_explanation": null, "end": 923, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 909 }, { "analysis_explanation": null, "end": 1027, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1020 }, { "analysis_explanation": null, "end": 1050, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1043 }, { "analysis_explanation": null, "end": 1080, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1073 } ]

[ "Cardinals catcher Yadier Molina responded to Cubs catcher Willson Contreras ’ proclamation that he wants to be the best catcher in MLB. (", "AP)\n\nHere’s a fun new wrinkle in the St. Louis Cardinals and Chicago Cubs rivalry: Cards captain Yadier Molina and young Cubs catcher Willson Contreras are engaged in a little offseason war of the words.", "\n\nContreras started it by saying over the weekend that he wants to be “the best catcher in the game for a long time” and Molina responded on Instagram on Wednesday with a picture of himself with Buster Posey and Salvador Perez that was captioned, “Respect the ranks!”", "\n\nAhh, yeah, this is could get good in 2018.", "\n\nLet’s go back for the entire blow-by-blow. ", "On Saturday at the Cubs Convention, Contreras told Steve Greenberg of the Chicago Sun-Times:\n\n“I know that I have a lot of talent,” he said, “and I thank God every day for giving me this kind of talent that I have. ", "In my mind, I want to be the best catcher in the game for a long time — like it was with Yadier Molina, like it is with Buster Posey.”", "\n\n“I used to watch a lot of those guys, but now I’m watching myself because I know that I’m going to be better than them. ", "That’s my plan.”", "\n\nNow, there’s a difference between a diss and self-confidence and this seems more on the side of self-confidence than unleashing a catcher’s version of “Hit ‘Em Up.” ", "Heck, Contreras is saying he wants to be like Molina.", "\n\nNonetheless, Molina clapped back on The Gram with his picture and a caption that translates to: “Respect the ranks, novice. ", "Here with those who have proven themselves to be hard.” ", "Or, translated a different way: “Respect the ranks, kid. ", "Here’s me and the guys who have proven to be the best.”", "\n\nA couple points to make:\n\n1. ", "Molina definitely has the better résumé, as Contreras is a 25-year-old entering his third full season. ", "He’s won a World Series with the Cubs, but doesn’t have much other hardware. ", "Molina, 35, has eight Gold Gloves and All-Star appearances, four Platinum Gloves, two World Series wins and a Silver Slugger. ", "He’s legit.", "\n\n2. ", "These guys are at completely different places in their career, since Yadi’s best days are behind him and Contreras’ are in front of him. ", "In fact, during the 2017 season, Contreras was more valuable than Molina according to Fangraphs’ WAR (3.2 to 2.1).", "\n\nWe should emphasize: This seems like a pretty good-natured rivalry at this point. ", "Molina likes to have fun on social media and trash talk, so this is probably not something that we’ll see turn into a brawl when the Cubs and Cardinals meet in 2018.", "\n\nWell, as long as it doesn’t get more personal.", "\n\nMore MLB coverage from Yahoo Sports:\n\n– – – – – –\n\nMike Oz is the editor of Big League Stew on Yahoo Sports. ", "Have a tip? ", "Email him at mikeozstew@yahoo.com or follow him on Twitter! ", "Follow @MikeOz" ]

{ "pile_set_name": "OpenWebText2" }

[ 0.029197080291970802, 0.029556650246305417, 0.0149812734082397, 0, 0, 0.009302325581395349, 0.014925373134328358, 0, 0, 0, 0.018867924528301886, 0.007936507936507936, 0, 0, 0, 0, 0.009708737864077669, 0.012987012987012988, 0.007936507936507936, 0, 0, 0.0072992700729927005, 0.017543859649122806, 0, 0.012121212121212121, 0, 0.04504504504504504, 0, 0.016666666666666666, 0.07142857142857142 ]

[ { "analysis_explanation": null, "end": 2744, "entity_type": "EMAIL_ADDRESS", "recognition_metadata": { "recognizer_identifier": "EmailRecognizer_139620637004368", "recognizer_name": "EmailRecognizer" }, "score": 1, "start": 2724 }, { "analysis_explanation": null, "end": 31, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18 }, { "analysis_explanation": null, "end": 77, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 58 }, { "analysis_explanation": null, "end": 248, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 235 }, { "analysis_explanation": null, "end": 289, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 272 }, { "analysis_explanation": null, "end": 323, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 305 }, { "analysis_explanation": null, "end": 389, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 378 }, { "analysis_explanation": null, "end": 467, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 461 }, { "analysis_explanation": null, "end": 490, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 481 }, { "analysis_explanation": null, "end": 503, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 494 }, { "analysis_explanation": null, "end": 547, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 535 }, { "analysis_explanation": null, "end": 566, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 552 }, { "analysis_explanation": null, "end": 649, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 645 }, { "analysis_explanation": null, "end": 705, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 697 }, { "analysis_explanation": null, "end": 739, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 730 }, { "analysis_explanation": null, "end": 760, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 745 }, { "analysis_explanation": null, "end": 1011, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 998 }, { "analysis_explanation": null, "end": 1041, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1029 }, { "analysis_explanation": null, "end": 1361, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1352 }, { "analysis_explanation": null, "end": 1398, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1392 }, { "analysis_explanation": null, "end": 1419, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1413 }, { "analysis_explanation": null, "end": 1775, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1766 }, { "analysis_explanation": null, "end": 1792, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1781 }, { "analysis_explanation": null, "end": 1823, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1802 }, { "analysis_explanation": null, "end": 1908, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1902 }, { "analysis_explanation": null, "end": 1912, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1910 }, { "analysis_explanation": null, "end": 2116, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2112 }, { "analysis_explanation": null, "end": 2157, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2148 }, { "analysis_explanation": null, "end": 2211, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2196 }, { "analysis_explanation": null, "end": 2222, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2213 }, { "analysis_explanation": null, "end": 2383, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2377 }, { "analysis_explanation": null, "end": 2541, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2537 }, { "analysis_explanation": null, "end": 2648, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2641 }, { "analysis_explanation": null, "end": 2744, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 2735 } ]

[ "You’ve seen Rothy’s all over social media. ", "Maybe you have a few friends that are obsessed with Rothy’s. ", "But what exactly are they, and…" ]

{ "pile_set_name": "OpenWebText2" }

[ 0.023255813953488372, 0.01639344262295082, 0 ]

[ { "analysis_explanation": null, "end": 17, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12 }, { "analysis_explanation": null, "end": 100, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 95 } ]

[ "' TEST_MODE : COMPILE_ONLY_FAIL\n\ntype UDT\n\tdummy as integer\n\n\tstatic ri as integer\nend type\n\ndim shared i as integer\n\ndim shared byref UDT.ri as integer = i\n" ]

{ "pile_set_name": "Github" }

[ 0.006369426751592357 ]

[ { "analysis_explanation": null, "end": 71, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 62 }, { "analysis_explanation": null, "end": 82, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 75 }, { "analysis_explanation": null, "end": 152, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 145 } ]

[ "Blood plasma magnesium, potassium, glucose, and immunoreactive insulin changes in cows moved abruptly from barn feeding to early spring pasture.", "\nCations and immunoreactive insulin in plasma were measured in 35 lactating cows moved abruptly to early spring pasture. ", "After change of cows from grass-clover hay to fescue-bluegrass pasture containing 22 to 31 g potassium/kg dry matter, immunoreactive insulin of 5 Holstein cows increased 30% in 5 days and averaged 45% above prepasture concentrations for 40 days. ", "Magnesium averaged 44% below prepasture content of plasma during this period and was correlated negatively with potassium -.17 and immunoreactive insulin -.37. ", "Thirty Herford cows were changed from corn silage and grass-clover hay to wheat-rye pasture containing 3.06% potassium in the dry matter. ", "Each day on pasture, 10 cows each were fed 2.3 kg cornmeal, 10 were given 30 g magnesium oxide by capsule, and 10 were given no supplement. ", "After unsupplemented cows were moved to pasture, immunoreactive insulin rose 51% in 8 days and plasma magnesium fell 24%. ", "Both supplements reduced immunoreactive insulin, but magnesium was maintained higher by magnesium oxide than by cornmeal. ", "Injection of two Holstein cows with insulin (2 IU/kg body weight) reduced plasma concentrations of both potassium and magnesium 20% below that of two cows injected with only physiological saline. ", "Whether elevated plasma insulin may accelerate development of hypomagnesemia in cattle on spring pasture with relatively high potassium content has not been established." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0, 0, 0, 0, 0.007246376811594203, 0, 0, 0, 0.00510204081632653, 0 ]

[ { "analysis_explanation": null, "end": 135, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 123 }, { "analysis_explanation": null, "end": 255, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 243 }, { "analysis_explanation": null, "end": 448, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 442 }, { "analysis_explanation": null, "end": 509, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 502 }, { "analysis_explanation": null, "end": 1039, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1033 }, { "analysis_explanation": null, "end": 1485, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1479 } ]

[ "Avoidance response by shrimps to a copper gradient: Does high population density prevent avoidance of contamination?", "\nBioassays using the nonforced exposure approach have been shown to be a relevant tool that might complement the traditional ecotoxicological risk assessment. ", "Because the nonforced exposure approach is based on spatial displacement of organisms and the consequent habitat selection processes, the population density might play an important role in the decision to avoid or prefer an ecosystem. ", "Therefore, the aim of the present study was to assess if the avoidance response to contamination, measured in a nonforced exposure system, is density-dependent and how determinant contamination could be for the habitat-selection process in comparison with the population density. ", "The freshwater shrimp Atyaephyra desmarestii was exposed to a copper gradient in a nonforced exposure system formed by 7 interconnected compartments (total volume 600 mL), which contained different copper concentrations. ", "The density treatments used were 3, 5, and 10 organisms per compartment, corresponding to 0.5, 0.8, and 1.7 organisms per 100 mL, respectively. ", "Clearly, the avoidance response to copper was more intense in the population with the lower density: the highest population density showed the lowest avoidance. ", "The concentrations that triggered an avoidance of 50% of the population were 47, 134, and 163 μg L-1 . ", "In summary, it was observed that shrimps were able to detect and avoid potentially toxic copper concentrations but that the avoidance response was affected by population density. ", "Environ Toxicol Chem 2018;37:3095-3101. ", "© 2018 SETAC." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0 ]

[ { "analysis_explanation": null, "end": 1048, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1047 }, { "analysis_explanation": null, "end": 1644, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1640 } ]

[ "Martin, Eva (Mrs. A. M.)\n\n1/26/1974\n\nMrs. A.M. (EVA) MARTIN1898-1974\n\nEva Williams Martin, wife of the late Rev. A. M. Martin, passed from this life on January 26, 1974. ", "Mrs. Martin was born near Buena Vista, Ohio on April 28, 1898. ", "She attended God’s Bible School in Cincinnati, Ohio to prepare for missionary service in Japan. ", "However, her life was to follow another route in the Lord’s work.", "\nOn June 17, 1919, Eva Williams married the Rev. A. M. Martin, and the following year came with him as a missionary to the French Mission, near Houma. ", "Together they served churches in the Louisiana Conference for almost forty years. ", "Eva Martin knew and loved her Bible, and was seldom seen in public without a copy of the Scriptures.", "\nAfter forty-eight years of marriage, Reverend Martin preceded his wife in death on June 9, 1967. ", "Surviving Rev. and Mrs. Martin are two daughters, Virginia Martin Spell of Ridge, La. and Maxine Martin Wagner of Lafayette, La., and one son, Kenneth Martin of Westlake, La." ]

{ "pile_set_name": "Pile-CC" }

[ 0.029411764705882353, 0.031746031746031744, 0, 0, 0.019867549668874173, 0.012195121951219513, 0.01, 0.01020408163265306, 0.022988505747126436 ]

[ { "analysis_explanation": null, "end": 6, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 0 }, { "analysis_explanation": null, "end": 11, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8 }, { "analysis_explanation": null, "end": 23, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18 }, { "analysis_explanation": null, "end": 46, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 42 }, { "analysis_explanation": null, "end": 68, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 64 }, { "analysis_explanation": null, "end": 89, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 70 }, { "analysis_explanation": null, "end": 125, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 113 }, { "analysis_explanation": null, "end": 168, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 152 }, { "analysis_explanation": null, "end": 181, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 175 }, { "analysis_explanation": null, "end": 207, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 196 }, { "analysis_explanation": null, "end": 213, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 209 }, { "analysis_explanation": null, "end": 231, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 217 }, { "analysis_explanation": null, "end": 278, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 268 }, { "analysis_explanation": null, "end": 284, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 280 }, { "analysis_explanation": null, "end": 327, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 322 }, { "analysis_explanation": null, "end": 411, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 398 }, { "analysis_explanation": null, "end": 425, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 413 }, { "analysis_explanation": null, "end": 455, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 443 }, { "analysis_explanation": null, "end": 479, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 461 }, { "analysis_explanation": null, "end": 543, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 538 }, { "analysis_explanation": null, "end": 625, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 607 }, { "analysis_explanation": null, "end": 637, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 627 }, { "analysis_explanation": null, "end": 751, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 734 }, { "analysis_explanation": null, "end": 780, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 774 }, { "analysis_explanation": null, "end": 823, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 811 }, { "analysis_explanation": null, "end": 855, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 849 }, { "analysis_explanation": null, "end": 896, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 875 }, { "analysis_explanation": null, "end": 905, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 900 }, { "analysis_explanation": null, "end": 910, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 907 }, { "analysis_explanation": null, "end": 935, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 915 }, { "analysis_explanation": null, "end": 948, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 939 }, { "analysis_explanation": null, "end": 953, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 950 }, { "analysis_explanation": null, "end": 982, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 968 }, { "analysis_explanation": null, "end": 994, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 986 }, { "analysis_explanation": null, "end": 999, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 996 }, { "analysis_explanation": null, "end": 35, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.6, "start": 26 } ]

[ "Guardians Of The Galaxy Star-Lord Child Mask\n\nFight the evils of the universe this Halloween with this Guardians of the Galaxy mask. ", "The Guardians of the Galaxy Children s Star-Lord Mask will be the talk of the block. ", "Your son will love the easy to wear molded plastic, keeping it s shape and durable for play. ", "This mask is right out of the hit movie, Guardians of the Galaxy. ", "Mask includes red disk eyes, metal molding, and ventilation details to keep you safe on any planet! ", "Order your Star-Lord mask for kids for Halloween." ]

{ "pile_set_name": "Pile-CC" }

[ 0.007518796992481203, 0, 0, 0.015151515151515152, 0, 0 ]

[ { "analysis_explanation": null, "end": 51, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 34 }, { "analysis_explanation": null, "end": 92, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 78 }, { "analysis_explanation": null, "end": 525, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 516 } ]

[ "Farnborough Hall\n\nFarnborough Hall is a country house just inside the borders of Warwickshire, England near to the town of Banbury, (). ", "The property has been owned by the National Trust since 1960 when the Holbech family endowed it to them, and is still run and lived in by Geoffrey Holbech's daughter Caroline Beddall and her family. ", "It is a Grade I listed building.", "\n\nThe Holbech family acquired the Farnborough estate in 1684 and the honey-coloured (Hornton) stone house was built soon after. ", "The family first moved into the house in 1692, and apart from in both World War 1 and World War 2 when the house was used as an auxiliary hospital, the family have lived in the main house and it has been the seat of the Holbech family. ", " \n\nWilliam Holbech bought the estate in 1684 and built the house but the major changes to the property occurred between 1745 and 1750 when the entrance front was remodelled and the rococo plasterwork was added to the interior. ", "This work was carried out by William Holbech junior who wanted a suitable setting for the sculpture and art he had brought back from his Grand Tour. ", "His close friend was the painter Canaletto who was commissioned to produce four artworks (albeit in two orders) to hang in the main Dining room. ", "Three paintings by Pannini were also commissioned by William Holbech. ", "The originals of the Canaletto's and Pannini's were sold in the 1920s after the First War but copies still hang today in their place. ", "He used designs by his close friend Sanderson Miller for the landscape, an architect, who lived a few miles away. ", "Sanderson Miller's protege was a little known man at the time who went on to design most of the great landscapes that still exist today, his name was Capability Brown. ", "Long Palladian facades with sash windows, pedimented doorways and a balustraded roofline were also added to the earlier classical west front.", "\n\nUnlike many of its contemporaries, Farnborough Hall and its landscaped gardens have experienced little alteration in the last 200 years and they remain largely as William Holbech left them.", "\n\nThe entrance opens straight into the Italianate hall. ", "The walls are adorned with busts of Roman emperors set into oval niches and the panelled ceiling is stuccoed with rococo motifs. ", "The dining room on the south front was especially designed to display works by Canaletto and Giovanni Paolo Panini. ", "The original works are long gone, being replaced by copies. ", "The drawing room has panels of elaborate stuccowork featuring scrolls, shells, fruit and flowers; these serve as a framework for more Italian works of art. ", "A stucco garland of fruit and flowers encircles the skylight above the staircase hall.", "\n\nGardens\nIn the mid 18th century the gardens were significantly enhanced by architect Sanderson Miller to dramatic effect. ", "The land at the front of the Hall slopes downward to give a view of lake below. ", "To the left of the house a grassy Terrace Walk is flanked by trees and excellent views of the Warwickshire plain can be had from here. ", "The terrace leads past an Ionic temple and an oval pavilion, which has two storeys and elaborate plasterwork, to an obelisk at the end of the walk. ", "The high obelisk was completed in 1751 (rebuilt in 1828 after it collapsed in 1823) and contains the name of Italian prisoners of war that were inscribed on the base during World War Two.", "\n\nReferences\n\n English Heritage: architectural description of listed building\n\nExternal links\nFarnborough Hall information at the National Trust\n\nCategory:Banbury\nCategory:Country houses in Warwickshire\nCategory:National Trust properties in Warwickshire\nCategory:Grade I listed buildings in Warwickshire\nCategory:Historic house museums in Warwickshire\nCategory:Grade I listed houses\nCategory:Grade I listed parks and gardens in Warwickshire\nCategory:Cherwell District\nCategory:Grade I listed parks and gardens in Oxfordshire\nCategory:Stratford-on-Avon District" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.022058823529411766, 0.020100502512562814, 0.03125, 0.015625, 0.00423728813559322, 0.004405286343612335, 0.006711409395973154, 0.006896551724137931, 0.014285714285714285, 0.014925373134328358, 0.008771929824561403, 0.011904761904761904, 0, 0.010471204188481676, 0.017857142857142856, 0, 0.017241379310344827, 0, 0, 0, 0.008064516129032258, 0.0125, 0.007407407407407408, 0, 0, 0.0071301247771836 ]

[ { "analysis_explanation": null, "end": 93, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 81 }, { "analysis_explanation": null, "end": 102, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 95 }, { "analysis_explanation": null, "end": 130, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 123 }, { "analysis_explanation": null, "end": 196, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 192 }, { "analysis_explanation": null, "end": 213, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 206 }, { "analysis_explanation": null, "end": 292, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 274 }, { "analysis_explanation": null, "end": 318, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 302 }, { "analysis_explanation": null, "end": 379, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 372 }, { "analysis_explanation": null, "end": 411, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 400 }, { "analysis_explanation": null, "end": 426, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 422 }, { "analysis_explanation": null, "end": 539, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 535 }, { "analysis_explanation": null, "end": 721, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 714 }, { "analysis_explanation": null, "end": 745, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 730 }, { "analysis_explanation": null, "end": 771, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 767 }, { "analysis_explanation": null, "end": 860, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 839 }, { "analysis_explanation": null, "end": 998, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 983 }, { "analysis_explanation": null, "end": 1145, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1136 }, { "analysis_explanation": null, "end": 1316, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1301 }, { "analysis_explanation": null, "end": 1387, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1378 }, { "analysis_explanation": null, "end": 1435, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1430 }, { "analysis_explanation": null, "end": 1504, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1488 }, { "analysis_explanation": null, "end": 1584, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1566 }, { "analysis_explanation": null, "end": 1701, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1696 }, { "analysis_explanation": null, "end": 1732, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1727 }, { "analysis_explanation": null, "end": 2011, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1993 }, { "analysis_explanation": null, "end": 2054, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2039 }, { "analysis_explanation": null, "end": 2161, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2156 }, { "analysis_explanation": null, "end": 2337, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2328 }, { "analysis_explanation": null, "end": 2363, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2342 }, { "analysis_explanation": null, "end": 2566, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2559 }, { "analysis_explanation": null, "end": 2699, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2679 }, { "analysis_explanation": null, "end": 2769, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2753 }, { "analysis_explanation": null, "end": 2976, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2964 }, { "analysis_explanation": null, "end": 3036, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3031 }, { "analysis_explanation": null, "end": 3209, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3205 }, { "analysis_explanation": null, "end": 3236, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3232 }, { "analysis_explanation": null, "end": 3270, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3263 }, { "analysis_explanation": null, "end": 3865, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3854 }, { "analysis_explanation": null, "end": 3884, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3875 }, { "analysis_explanation": null, "end": 426, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 422 }, { "analysis_explanation": null, "end": 539, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 535 }, { "analysis_explanation": null, "end": 771, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 767 } ]