SENTENCE_SRC,SENTENCE_TGT,ALIGNMENT_CONFIRMED,ALIGNMENT_COST,SENTENCE_COSINE,LENGTH_SRC,LENGTH_TGT,LENGTH_DIFF,CHARCOUNT_SRC,CHARCOUNT_TGT,CHARCOUNT_DIFF
"외력(K)이 제1 힘 전달 수단(2)에 작용할 때 명확한 가청음을 생성하기 위한 다중-부품 장치(1)로서, 스프링 시스템(4, 5, 8)을 통해, 심정지(cardiac arrest)의 경우 인체의 제어된 심폐소생술을 위한 장치 내의 베이스 플레이트(3) 상에 작용하는, 상기 다중-부품 장치(1)에 있어서,외부 기하학적 치수 및 형상이 흉골(sternum)에 가까운 흉부(thorax)의 해부학적 조건에 맞춰지고, 특히, 상기 스프링 시스템(4, 5, 8)은 적어도 하나의 진동 요소(8)에 작용하는 신호를 생성하고, 상기 스프링 시스템(4, 5)은 상기 제1 힘 전달 수단(2)과 상기 베이스 플레이트(3) 사이에 배치되고, 상기 스프링 시스템은 본질적으로 적어도 하나의 스프링 요소(4) 및 평탄-형성된 스프링 요소(5)로 구성되며, 특히 상기 스프링 요소(4)는 원추형 스프링 요소인것을 특징으로 하는,다중-부품 장치.","A multi-part device (1) for generating a clearly audible sound when an external force (K) acts on a first force transmission means (2), which, via a spring system (4, 5, 8), acts on a base plate (3) in an apparatus for the controlled cardio-pulmonary resuscitation of the human body in the event of cardiac arrest, characterized in that the outer geometric dimensions and shapes are adapted to the anatomical conditions of the thorax close to the sternum, in particular wherein the spring system (4, 5, 8) generates a signal, which acts on at least one oscillatory element (8), wherein the spring system (4, 5) is arranged between the first force transmission means (2) and the base plate (3), which spring system consists essentially of at least one spring element (4) and a flat-formed spring element (5), in particular wherein the spring element (4) is a conical spring element.",True,0.1921272575855255,0.9204214391073484,95,148,-53,461,881,-420
"제1항에 있어서,상기 적어도 하나의 스프링 요소(4)는, 특히 클릭 플레이트(5)인 상기 평탄-형성된 스프링 요소(5)로부터 측방향으로 원형 경로 상에 배치되는 것을 특징으로 하는,다중-부품 장치.","The multi-part device (1) according to claim 1, characterized in that the at least one spring element (4) is arranged on a circular path laterally from the flat formed spring element (5), which is in particular a click plate (5).",True,0.1880235224962234,0.9276349556645174,22,40,-18,110,229,-119
"제1항 또는 제2항에 있어서,상기 장치(1)는, 각 경우에, 상기 평탄-형성된 스프링 요소(5)로부터 측방향으로 배치되는 적어도 2개, 바람직하게 적어도 3개, 특히 바람직하게 적어도 4개의 스프링 요소(4)를 포함하는 것을 특징으로 하는,다중-부품 장치.","The multi-part device (1) according to claim 1 or 2, characterized in that the device (1) comprises at least two, preferably at least three, and particularly preferably at least four spring elements (4), which are in each case arranged laterally from the flat-formed spring element (5).",True,0.1531280428171157,0.9446759640989256,29,46,-17,143,286,-143
"제1항 내지 제3항 중 어느 한 항에 있어서,각각의 스프링 요소(4)는 원추형 스프링 요소(4)인 것을 특징으로 하는,다중-부품 장치.","The multi-part device (1) according to at least one of the preceding claims, characterized in that each of the spring elements (4) are conical spring elements (4).",True,0.2494876831769943,0.8893921885458101,17,27,-10,75,163,-88
"제1항 내지 제4항 중 어느 한 항에 있어서,적어도 하나의 스프링 요소(4)는 스프링 요소(4)의 스프링 단면이 상기 베이스 플레이트(3)를 향하는 방향으로 상기 힘 전달 수단(2)에서 시작하여 원추형으로 증가하거나 감소하는 방식으로 상기 제1 힘 전달 수단(2)과 상기 베이스 플레이트(3) 사이에 원추형으로 배치되는 것을 특징으로 하는,다중-부품 장치.","The multi-part device (1) according to at least one of the preceding claims, characterized in that at least one spring element (4) is arranged conically between the first force transmission means (2) and the base plate (3) in such a way that a spring cross section of the spring element (4) increases or decreases conically, starting at the force transmission means (2) in the direction towards the base plate (3).",True,0.2050027549266815,0.9251516558666528,44,70,-26,199,414,-215
"제1항 내지 제5항 중 어느 한 항에 있어서,상기 다중-부품 장치(1)는 단일 스프링 요소(4)만을 갖고, 반경 방향(R)에서 상기 베이스 플레이트(3)에 연결된 상기 스프링 요소(4)의 단부는 반경방향(R)으로 상기 평탄-형성된 스프링 요소(5)를 포함하여 둘러싸는 것을 특징으로 하는,다중-부품 장치.","The multi-part device (1) according to at least one of the preceding claims, characterized in that the multi-part device (1) has only a single spring element (4), wherein in a radial direction (R) an end of the spring element (4), which is connected to the base plate (3), encloses and surrounds the flat-formed spring element (5) in the radial direction (R).",True,0.2010574340820312,0.9273258970504396,35,61,-26,170,359,-189
"제1항 내지 제6항 중 어느 한 항에 있어서,추가적인 스프링 요소(8)인 상기 스프링 요소(8)는 상기 평탄-형성된 스프링 요소(5)와 상기 힘 전달 수단(2) 사이에 배치되어, 상기 힘 전달 수단(2)에 외부적으로 가해지는 압력이 상기 스프링 요소(8)를 통해 상기 평탄-형성된 스프링 요소(5)에 적어도 부분적으로 전달되는 것을 특징으로 하는,다중-부품 장치.","The multi-part device (1) according to at least one of the preceding claims, characterized in that the spring element (8), which is a further spring element (8), is arranged between the flat-formed spring element (5) and the force transmission means (2), so that a pressure applied externally to the force transmission means (2) is at least partially transmitted to the flat-formed spring element (5) via the spring element (8).",True,0.2201496362686157,0.9177193526028696,45,69,-24,203,428,-225
"제1항 내지 제7항 중 어느 한 항에 있어서,상기 힘 전달 수단(2)에 연결된 단일 스프링 요소의 단부는 반경방향(R)으로 상기 스프링 요소(8)를 포함하여 둘러싸는 반경방향 단면을 갖는 것을 특징으로 하는,다중-부품 장치.","The multi-part device (1) according to at least one of the preceding claims, characterized in that an end of the single spring element, which is connected to the force transmission cINO01100claimsenglishtranslation22March2O22 - 21 means (2), has such a radial cross section that this end encloses and surrounds the spring element (8) in the radial direction (R).",False,0.3989852368831634,0.8274322088583697,29,56,-27,125,362,-237
"제1항 내지 제8항 중 어느 한 항에 있어서,상기 장치는 대칭축으로부터 떨어져 있는 추가적인 스프링 요소가 없어, 반경방향(R)으로 상기 평탄-형성된 스프링 요소(5)를 통과하는 것을 특징으로 하는,다중-부품 장치.","The multi-part device (1) according to at least one of the preceding claims, characterized in that the device is free from further spring elements away from an axis of symmetry, which runs through the flat spring element (5) in the radial direction (R).",True,0.2810427546501159,0.8756066000233995,26,43,-17,120,253,-133
"외력(K)이 제1 힘 전달 수단(2)에 작용할 때 명확한 가청음을 생성하기 위한 방법으로서, 스프링 시스템(4, 5, 8, 16)을 통해, 심정지(cardiac arrest)의 경우 인체의 제어된 심폐소생술을 위한 장치 내의 베이스 플레이트(3) 상에 작용하는, 상기 방법에 있어서,설정가능한 한계 압력(Kmax)에 도달하면 상기 스프링 시스템(4, 5, 8)의 연동에 의해 진동 요소(8)에 전달되는 명확한 가청 신호(S)가 생성되는것을 특징으로 하는,방법.","A method for generating a clearly audible sound when an external force K acts on a first force transmission means (2), which, via a spring system (4, 5, 8, 16), acts on a base plate (3) in an apparatus for the controlled cardio pulmonary resuscitation of the human body in the event of cardiac arrest, characterized in that a clearly audible signal (S) is generated, which is transmitted to oscillatory elements (8), by means of the cooperation of the spring system (4, 5, 8) when reaching a settable limit pressure Kmax.",True,0.1233056634664535,0.9338329130826636,53,91,-38,257,521,-264
"병렬 멀티 팩 시스템에 포함된 상호 병렬 연결된 제1 내지 제n 배터리 팩에 대한 동작 특성값을 측정하는 제1 내지 제n센서 유닛; 상기 병렬 멀티 팩 시스템의 총 출력에 대응하도록 부하에서 소모되는 전력 또는 충전 장치에서 제공하는 전력을 제어하는 출력 관리 유닛; 및상기 제1 내지 제n센서 유닛 및 상기 출력 관리 유닛과 동작 가능하게 결합된 멀티 팩 관리 유닛을 포함하고,상기 멀티 팩 관리 유닛은, 상기 제1 내지 제n센서 유닛으로부터 수신되는 각 배터리 팩의 동작 특성값에 기초하여 제1 내지 제n배터리 팩의 팩 저항을 각각 결정하고, 팩 저항과 가용 출력 사이의 미리 정의된 상관관계 정보를 이용하여 각 배터리 팩의 팩 저항에 대응되는 가용 출력들 중에서 최소 가용 출력을 결정하고, 팩 저항이 가장 낮은 배터리 팩의 팩 출력이 최소 가용 출력과 동일하도록 병렬 멀티 팩 시스템의 총 출력을 결정하여 상기 출력 관리 유닛으로 제공하도록 구성되고,상기 출력 관리 유닛은, 상기 병렬 멀티 팩 시스템의 총 출력을 초과하지 않도록 부하에서 소모되는 전력 또는 충전 장치에서 제공하는 전력을 제어하도록 구성된 것을 특징으로 하는 병렬 멀티 팩 시스템의 출력 제어 장치.","An apparatus for controlling a power of a parallel multi pack system, comprising: first to nth sensor units configured to measure operation characteristic values of first to nth battery packs that are included in the parallel multi pack system and connected to each other in parallel; a power management unit configured to control a power consumed in a load or a power provided by a charging device to correspond to a total power of the parallel multi pack system; and a multi pack management unit operatively coupled to the first to nth sensor units and the power management unit, wherein the multi pack management unit is configured to determine a pack resistance of each of the first to nth battery packs based on the operation characteristic value of each battery pack received from the first to nth sensor units, determine a minimum available power among available powers respectively corresponding to the pack resistances of the battery packs by using pre-defined correlation information between pack resistance and available power, determine the total power of the parallel multi pack system so that the pack power of a battery pack having a lowest pack resistance becomes identical to the minimum available power, and transmit the determined total power of the parallel multi pack system to the power management unit, and the power management unit is configured to control the power consumed in the load or the power provided by the charging device so as not to exceed the total power of the parallel multi pack system.",True,0.2579189240932464,0.911791206437526,163,253,-90,601,1527,-926
"제1항에 있어서, 상기 상관관계 정보는 배터리 팩의 팩 저항에 따라 배터리 팩의 가용 출력을 정의한 팩 저항-가용 출력 룩업 테이블임을 특징으로 하는 병렬 멀티 팩 시스템의 출력 제어 장치.","The apparatus for controlling power of a parallel multi pack system according to claim 1, wherein the correlation information is a pack resistance-available power look-up table in which the available power of the battery pack is defined according to the pack resistance of the battery pack.",True,0.3882791996002197,0.8576998397665795,29,46,-17,106,290,-184
"제1항에 있어서, 상기 멀티 팩 관리 유닛은, 상기 제1 내지 제n센서 유닛으로부터 각 배터리 팩의 전압 측정값 및 전류 측정값을 주기적으로 입력 받고, 복수의 전압 측정값 및 복수의 전류 측정값을 선형 회귀 분석법을 이용하여 분석함으로써 각 배터리 팩의 팩 저항을 결정하도록 구성된 것을 특징으로 하는 병렬 멀티 팩 시스템의 출력 제어 장치.","The apparatus for controlling power of a parallel multi pack system according to claim 1, wherein the multi pack management unit is configured to: periodically receive a measured voltage value and a measured current value of each battery pack from the first to nth sensor units, and determine the pack resistance of each battery pack by analyzing the plurality of measured voltage values and the plurality of measured current values by means of linear regression analysis.",True,0.3000248968601227,0.892153489299403,52,76,-24,192,472,-280
"제1항에 있어서, 상기 멀티 팩 관리 유닛은,하기 수식에 의해 병렬 멀티 팩 시스템의 총 출력을 산출하도록 구성된 것을 특징으로 하는, Ptotal= min(Ppack,k)*min(Rpack,k)/RsystemRsystem= [Σ(1/Rpack,k)]-1 (k는 1이상 n 이하의 정수; n은 배터리 팩의 수량; Ptotal은 병렬 멀티 팩 시스템의 총 출력; Pk는 k번째 배터리 팩의 팩 출력; Rpack,k는 k번째 배터리 팩의 팩 저항; Rsystem은 병렬 멀티 팩 시스템의 총 저항; min()은 복수의 입력 변수들 중에서 최소값을 반환하는 함수)병렬 멀티 팩 시스템의 출력 제어 장치.","The apparatus for controlling power of a parallel multi pack system according to claim 1, wherein the multi pack management unit is configured to calculate the total power of the parallel multi pack system using the following equation: P total = min P pack, k ∗ min R pack, k / R system R system = ∑ 1 / R pack, k − 1 (k is an integer from 1 to n; n is the number of battery packs; Ptotal is the total power of the parallel multi pack system; Ppack,k is a pack power of a kth battery pack; Rpack,k is a pack resistance of the kth battery pack; Rsystem is a total resistance of the parallel multi pack system; and min() is a function that returns a minimum value among a plurality of input variables).",True,0.228419542312622,0.9259605346736558,72,137,-65,334,700,-366
"제4항에 있어서, 상기 멀티 팩 관리 유닛은, 각 배터리 팩의 팩 출력을 하기 수식에 의해 산출하도록 구성된 것을 특징으로 하는, Ppack,k= Ptotal*Rsystem/Rpack,k(Ppack,k는 k번째 배터리 팩에 대한 팩 출력; Ptotal은 병렬 멀티 팩 시스템의 총 출력; Rsystem은 병렬 멀티 팩 시스템의 총 저항; Rpack,k는 k번째 배터리 팩의 팩 저항) 병렬 멀티 팩 시스템의 출력 제어 장치.","The apparatus for controlling power of a parallel multi pack system according to claim 4, wherein the multi pack management unit is configured to calculate the pack power of each battery pack using the following equation: P pack, k = P total * R system / R pack, k (Ppack,k is the pack power of the kth battery pack; Ptotal is the total power of the parallel multi pack system; Rsystem is the total resistance of the parallel multi pack system; and Rpack,k is the pack resistance of the kth battery pack).",True,0.3116991519927978,0.8994369522956421,55,92,-37,237,505,-268
"제1항에 있어서,상기 멀티 팩 관리 유닛과 상기 출력 관리 유닛 사이에 개재된 통신 유닛을 더 포함하는 것을 특징으로 하는 병렬 멀티 팩 시스템의 출력 제어 장치.","The apparatus for controlling power of a parallel multi pack system according to claim 1, further comprising: a communication unit interposed between the multi pack management unit and the power management unit.",True,0.2938557267189026,0.8738602624262228,26,32,-6,91,211,-120
"제6항에 있어서,상기 병렬 멀티 팩 시스템은 전기 구동 자동차에 탑재되며, 상기 출력 관리 유닛은 상기 전기 구동 자동차의 제어 시스템에 포함된 것을 특징으로 하는 병렬 멀티 팩 시스템의 출력 제어 장치.","The apparatus for controlling power of a parallel multi pack system according to claim 6, wherein the parallel multi pack system is mounted to an electric-driven vehicle, and the power management unit is included in a control system of the electric-driven vehicle.",True,0.2740981876850128,0.8937368517242539,31,42,-11,114,264,-150
제1항에 따른 병렬 멀티 팩 시스템의 출력 제어 장치를 포함하는 배터리 관리 시스템.,"A battery management system, comprising the apparatus for controlling power of a parallel multi pack system according to claim 1.",True,0.2780641913414001,0.8814672249749039,13,20,-7,47,129,-82
제1항에 따른 병렬 멀티 팩 시스템의 출력 제어 장치를 포함하는 전기 구동 장치.,"An electric driving mechanism, comprising the apparatus for controlling power of a parallel multi pack system according to claim 1.",True,0.2928422391414642,0.8697634836389404,13,20,-7,45,131,-86
(a) 병렬 멀티 팩 시스템에 포함된 상호 병렬 연결된 제1 내지 제n 배터리 팩에 대한 동작 특성값을 측정하는 제1 내지 제n센서 유닛을 제공하는 단계;(b) 상기 제1 내지 제n센서 유닛으로부터 수신되는 각 배터리 팩의 동작 특성값에 기초하여 제1 내지 제n배터리 팩의 팩 저항을 각각 결정하는 단계;(c) 팩 저항과 가용 출력 사이의 미리 정의된 상관관계 정보를 이용하여 각 배터리 팩의 팩 저항에 대응되는 n개의 가용 출력과 최소 가용 출력을 결정하는 단계;(d) 팩 저항이 가장 낮은 배터리 팩의 팩 출력이 최소 가용 출력과 동일하도록 병렬 멀티 팩 시스템의 총 출력을 결정하는 단계; 및(e) 상기 병렬 멀티 팩 시스템의 총 출력을 초과하지 않도록 상기 제1 내지 제n배터리 팩의 충전 또는 방전을 제어하는 단계를 포함하는 것을 특징으로 하는 병렬 멀티 팩 시스템의 충전 제어 방법.,"A method for controlling a power of a parallel multi pack system, comprising: (a) providing first to nth sensor units configured to measure operation characteristic values of first to nth battery packs that are included in the parallel multi pack system and connected to each other in parallel; (b) determining a pack resistance of each of the first to nth battery packs based on the operation characteristic value of each battery pack received from the first to nth sensor units; (c) determining an n number of available powers respectively corresponding to the pack resistances of the battery packs by using pre-defined correlation information between pack resistance and available power, and a minimum available power thereof; (d) determining the total power of the parallel multi pack system so that the pack power of a battery pack having a lowest pack resistance becomes identical to the minimum available power; and (e) controlling charging or discharging of the first to nth battery packs so as not to exceed the total power of the parallel multi pack system.",True,0.2274077087640762,0.9234850522066276,120,174,-54,444,1067,-623
"제10항에 있어서,상기 상관관계 정보는 배터리 팩의 팩 저항에 따라 배터리 팩의 가용 출력을 정의한 팩 저항-가용 용량 룩업 테이블임을 특징으로 하는 병렬 멀티 팩 시스템의 출력 제어 방법.","The method for controlling power of a parallel multi pack system according to claim 10, wherein the correlation information is a pack resistance-available power look-up table in which the available power of the battery pack is defined according to the pack resistance of the battery pack.",True,0.3532279431819916,0.8664658063772911,28,46,-18,106,288,-182
"제10항에 있어서, 상기 (b) 단계는,(b1) 상기 제1 내지 제n센서 유닛으로부터 각 배터리 팩의 전압 측정값 및 전류 측정값을 주기적으로 입력 받는 단계; 및(b2) 복수의 전압 측정값 및 복수의 전류 측정값을 선형 회귀 분석법을 이용하여 분석함으로써 각 배터리 팩의 팩 저항을 결정하는 단계를 포함하는 것을 특징으로 하는 병렬 멀티 팩 시스템의 출력 제어 방법.","The method for controlling power of a parallel multi pack system according to claim 10, wherein the step (b) includes: (b1) periodically receiving a measured voltage value and a measured current value of each battery pack from the first to nth sensor units; and (b2) determining the pack resistance of each battery pack by analyzing the plurality of measured voltage values and the plurality of measured current values by means of linear regression analysis.",True,0.2277462035417556,0.9073647155569288,53,74,-21,206,458,-252
"제10항에 있어서, 상기 (d) 단계는, 하기 수식에 의해 병렬 멀티 팩 시스템의 총 출력을 산출하는 단계임을 특징으로 하는, Ptotal= min(Ppack,k)*min(Rpack,k)/RsystemRsystem= [Σ(1/Rpack,k)]-1 (k는 1이상 n 이하의 정수; n은 배터리 팩의 수량; Ptotal은 병렬 멀티 팩 시스템의 총 출력; Pk는 k번째 배터리 팩의 팩 출력; Rpack,k는 k번째 배터리 팩의 팩 저항; Rsystem은 병렬 멀티 팩 시스템의 총 저항; min()은 복수의 입력 변수들 중에서 최소값을 반환하는 함수)병렬 멀티 팩 시스템의 출력 제어 방법.","The method for controlling power of a parallel multi pack system according to claim 10, wherein in the step (d), the total power of the parallel multi pack system is calculated using the following equation: P total = min P pack,k * min R pack,k R system R system = ∑ 1 / R pack,k − 1 (k is an integer from 1 to n; n is the number of battery packs; Ptotal is the total power of the parallel multi pack system; Ppack,k is a pack power of a kth battery pack; Rpack,k is a pack resistance of the kth battery pack; Rsystem is a total resistance of the parallel multi pack system; and min() is a function that returns a minimum value among a plurality of input variables).",True,0.2266616225242614,0.9206068871066988,70,130,-60,329,666,-337
"제10항에 있어서, 상기 (e) 단계는, 각 배터리 팩의 팩 출력을 하기 수식에 의해 산출하는 단계를 포함하는 것을 특징으로 하는,Ppack,k= Ptotal*Rsystem/Rpack,k(Ppack,k는 k번째 배터리 팩의 팩 출력; Ptotal은 병렬 멀티 팩 시스템의 총 출력; Rsystem은 병렬 멀티 팩 시스템의 총 저항; Rpack,k는 k번째 배터리 팩의 팩 저항) 병렬 멀티 팩 시스템의 출력 제어 방법.","The method for controlling power of a parallel multi pack system according to claim 10, wherein in the step (e), the pack power of each battery pack is calculated using the following equation: P pack,k = P total * R system / R pack,k (Ppack,k is the pack power of the kth battery pack; Ptotal is the total power of the parallel multi pack system; Rsystem is the total resistance of the parallel multi pack system; and Rpack,k is the pack resistance of the kth battery pack).",True,0.343329519033432,0.87996268587901,52,87,-35,234,474,-240
"본 출원은 아세토하이드록시산 신타제 단백질의 신규 변이체, 이를 코딩하는 폴리뉴클레오티드, 상기 변이체를 포함하는 미생물 및 상기 미생물을 이용한 L-이소류신의 생산방법에 관한 것이다.","[DESCRIPTION] [Invention Title] NOVEL ACETOHYDROXY ACID SYNTHASE VARIANT AND MICROORGANISM INCLUDING THE SAME [Technical Field] The present disclosure relates to a novel variant of acetohydroxy acid synthase protein, a polynucleotide encoding the variant, a microorganism including the variant, and a method of producing L-isoleucine using the microorganism.",False,0.3529872894287108,0.814655135838433,22,47,-25,103,358,-255
"분지쇄 아미노산, 즉 L-발린, L-류신, L-이소류신은 개체에서 단백질을 증가시키는 작용을 하며, 운동시 에너지원으로 중요한 역할을 하는 것이 알려져, 의약품, 식품 등에 사용되고 있다.","[Background Art] Branched-chain amino acids, i.e., L-valine, L-leucine, and L-isoleucine, are known to increase protein levels in an individual and play an important role as an energy source during exercise, and thus are widely used in medical products, foods, etc.",False,0.2577598392963409,0.8491689100480907,23,40,-17,105,265,-160
분지쇄 아미노산 생산 미생물로 코리네박테리움 글루타미쿰 (Corynebacterium glutamicum)과 대장균 (Escherichia coli)이 대표적인 미생물로 이용되고 있다.,"As representative microorganisms producing branched-chain amino acids, Corynebacterium glutamicum and Escherichia coli are used.",True,0.1600660532712936,0.8906836506261306,15,14,1,103,128,-25
"이 미생물들에서 분지쇄 아미노산 중 L-이소류신은 다른 분지쇄 아미노산인 L-발린, L-류신과 주된 생합성 경로를 공유하고 있다.","In these microorganisms, L-isoleucine among branched-chain amino acids shares its main biosynthesis pathways with the other branched-chain amino acids such as L-valine or L-leucine.",True,0.1629932224750518,0.909075853751031,16,24,-8,72,181,-109
L-이소류신의 생합성 경로를 살펴보면 해당 과정 (Glycolysis)에서 생성되는 피루브산 (pyruvate)과 아스파르트산 (Aspartate; Aspartic acid) 유래 아미노산인 L-쓰레오닌으로부터 생성된 2-케토부티르산(2-ketobutyrate)이 전구체로 사용된다.,"With regard to L-isoleucine biosynthesis pathways, pyruvate produced during glycolysis and 2 ketobutyrate produced from L-threonine, which is an aspartate (aspartic acid)-derived amino acid, are used as precursors.",True,0.1608064472675323,0.904947294146982,21,28,-7,158,214,-56
"두 개의 전구체로부터 아세토하이드록시산 신타제 (acetohydroxy acid synthase, AHAS)라는 효소의 작용을 통해 2-아세토-2-하이드록시아세트산 (2-aceto-2-hydroxyacetate)이 합성된 후, 아세토하이드록시산 아이소머리덕타제 (acetohydroxy acid isomeroreductase)를 통해 2,3-디하이드록시-3-메틸발레르산(2,3-dihydroxy-3-methylvalerate)이 생성된다.","From the two precursors, 2-aceto-2-hydroxyacetate is synthesized by the enzymatic action of acetohydroxy acid synthase (AHAS), and subsequently, 2,3-dihydroxy-3-methylvalerate is produced by acetohydroxy acid isomeroreductase, and 2-keto-3-methylvalerate is produced by dihydroxy acid dehydratase.",False,0.1149181649088859,0.9320921088779338,24,33,-9,245,297,-52
"그 후, 디하이드록시산 디하이드라타제 (dihydroxy acid dehydratase)를 통해 2-케토-3-메틸발레르산(2-keto-3-methylvalerate)을 거쳐 아미노트랜스퍼라제 (aminotransferase)의 반응을 통해 최종적으로 L-이소류신이 생산된다.","Finally, L-isoleucine is produced by the action of aminotransferase.",False,0.4118427634239197,0.7553937577632952,17,9,8,153,68,85
"또한, 상기 아세토하이드록시산 신타아제는 피루브산(pyruvate)의 디카르복실화(decarboyxlation)와 다른 피루브산 분자와의 축합 반응을 촉매하여 발린 및 류신의 전구체인 아세토젖산을 생산한다.","Further, the acetohydroxy acid synthase catalyzes decarboxylation of pyruvate and a condensation reaction with another pyruvate molecule to produce acetolactate, which is a precursor of valine and leucine.",True,0.2013187855482101,0.8851621033445253,18,28,-10,115,205,-90
"생합성 경로를 공유하는 분지쇄 아미노산 중 특히, L-이소류신과 L-발린은 화학적 구조와 특성이 매우 유사하며, 노르발린 (Norvaline)과 아미노부티릭산 (Alpha amino butyric acid, AABA)과 같은 부산물 또한 L-이소류신과 생합성 경로를 공유하고 있기 때문에, L-이소류신의 생산이 증가되면 부산물도 다량 생성되게 된다.","- 1Among the branched-chain amino acids sharing biosynthesis pathways, L isoleucine and L-valine have very similar chemical structures and properties, and by products such as norvaline and alpha-amino butyric acid (AABA) also share biosynthetic pathways with L-isoleucine.",False,0.230132982134819,0.8750526754677566,38,37,1,195,272,-77
"이러한 이유로 L-이소류신을 고수율, 고순도로 생산하기 위해서는 많은 정제 비용이 요구되기 때문에 부산물의 생성은 최대한 저감되면서 목적 산물의 생성은 증가된 능력을 갖는 균주 개발이 필수적이다.","For this reason, to produce L isoleucine in a high yield and with high purity, high purification costs are required, and thus it is necessary to develop a strain having the increased ability to produce a target product while reducing production of by-products as much as possible.",True,0.2035366594791412,0.8719739986099451,25,47,-22,109,280,-171
"아세토하이드록시산 신타제 (acetohydroxy acid synthase, AHAS)는 분지쇄 아미노산의 생합성 경로에서 중요한 역할을 하는 효소로서 미생물 종류에 따라 ilvBN, ilvGM, ilvIH 유전자에 의해 암호화되며, 코리네박테리움 글루타미쿰의 경우 ilvBN 유전자에 의해 암호화된다.","Acetohydroxy acid synthase (AHAS) is an enzyme that plays an important role in biosynthesis pathways of branched-chain amino acids, and is encoded by ilvBN, ilvGM, or ilvIH gene according to the kind of microorganisms.",True,0.1687194108963012,0.9077787322900616,30,34,-4,169,218,-49
"ilvBN은 최종 산물인 분지쇄 아미노산 중 L-이소류신에 의해서 유전자 발현과 효소 활성이 저해되는 피드백 억제 작용을 받기 때문에 이 유전자의 발현을 최적화하고 효소의 활성을 조절하는 것이 L-이소류신의 고수율 생산 균주를 만드는데 매우 중요하나, 이에 관한 선행연구는 주로 작은 소단위체(acetohydroxy acid synthase small subunit; IlvN 단백질)의 변이로 인한 피드백 해제에 관련된 연구가 대부분으로(Protein Expr Purif. 2015 May;109:106-12., US2014-0335574, US2009-496475, US2006-303888, US2008-245610) 관련 연구가 부족한 실정이다.","Thus, it is very important to optimize expression of the gene and regulate activity of the enzyme for producing high-yield L-isoleucine-producing strains.",False,0.5503303408622742,0.6753883479118378,64,22,42,365,154,211
"이러한 배경 하에, 본 발명자들은 L-이소류신 생산능이 증가된 미생물을 개발하기 위해 예의 노력한 결과, 아세토하이드록시산 신타아제의 변이체, 구체적으로 큰 소단위체(ilvB) 변이체를 개발하였다.","In view of this technical background, the present inventors have made extensive efforts to develop a microorganism having an enhanced ability to produce L-isoleucine, and as a result, they have developed a variant of acetohydroxy acid synthase, specifically, a large subunit (ilvB) variant.",True,0.2185503095388412,0.8809375180928968,22,43,-21,110,290,-180
"이에, 상기 변이체를 포함하는 미생물로부터 L-이소류신 생산 증가를 확인하고 본 출원을 완성하였다.","Accordingly, the present inventors confirmed high production of L-isoleucine in a microorganism including the variant, thereby completing the present disclosure.",True,0.367521435022355,0.7734152557325372,12,20,-8,55,161,-106
"본 출원의 하나의 목적은 서열번호 1의 아미노산 서열위치 136번째 아미노산인 글루타민이 글루타민 이외의 다른 아미노산으로 치환된, 아세토하이드록시산 신타제 활성을 가지는 단백질 변이체를 제공하는 것이다.","-2[Disclosure] [Technical Problem] An object of the present disclosure is to provide a protein variant having acetohydroxy acid synthase activity, wherein glutamine, which is an amino acid at position 136 in an amino acid sequence of SEQ ID NO: 1, is substituted with an amino acid other than glutamine.",False,0.2876879274845123,0.8496642024685659,24,49,-25,114,303,-189
본 출원의 다른 목적은 상기 단백질 변이체를 코딩하는 폴리뉴클레오티드 및 이를 포함하는 벡터를 제공하는 것이다.,"Another object of the present disclosure is to provide a polynucleotide encoding the protein variant, and a vector including the same.",True,0.1552873253822326,0.9037439187649292,15,21,-6,62,134,-72
본 출원의 또 다른 목적은 상기 단백질 변이체를 포함하는 L-이소류신을 생산하는 미생물을 제공하는 것이다.,"Still another object of the present disclosure is to provide a microorganism producing L-isoleucine, which includes the protein variant.",True,0.1973587274551391,0.886712285539885,14,19,-5,59,136,-77
본 출원의 또 다른 목적은 상기 L-이소류신을 생산하는 미생물을 배지에서 배양하는 단계를 포함하는 L-이소류신 생산방법을 제공하는 것이다.,"Still another object of the present disclosure is to provide a method of producing L isoleucine, the method including culturing the microorganism producing L-isoleucine in a medium.",True,0.2194009721279144,0.8736246045372394,17,27,-10,77,181,-104
"이하에서는, 본 출원을 더욱 상세히 설명한다.",[Technical Solution] The present disclosure will be described in more detail.,False,0.4732900559902191,0.6454163543459124,6,11,-5,25,77,-52
"한편, 본 출원에서 개시되는 각각의 설명 및 실시형태는 각각의 다른 설명 및 실시 형태에도 적용될 수 있다.","Meanwhile, each description and embodiment disclosed in the present disclosure may also be applied to other descriptions and embodiments.",True,0.1361632794141769,0.9154093178237808,17,19,-2,60,137,-77
"즉, 본 출원에서 개시된 다양한 요소들의 모든 조합이 본 출원의 범주에 속한다.","That is, all combinations of various elements disclosed in the present disclosure fall within the scope of the present disclosure.",True,0.1579428911209106,0.8960660714135753,12,20,-8,44,130,-86
"또한, 하기 기술되는 구체적인 서술에 의하여 본 출원의 범주가 제한된다고 할 수 없다.","Further, the scope of the present disclosure is not limited by the specific description below.",True,0.260815680027008,0.8121933983032166,13,15,-2,48,94,-46
"또한, 당해 기술분야의 통상의 지식을 가진 자는 통상의 실험만을 사용하여 본 출원에 기재된 본 출원의 특정 양태에 대한 다수의 등가물을 인지하거나 확인할 수 있다.","Further, those skilled in the art will recognize or be able to ascertain, using no more than routine experimentation, many equivalents to the specific embodiments of the present disclosure described herein.",True,0.329631894826889,0.7816464312522192,24,31,-7,91,206,-115
"또한, 이러한 등가물은 본 출원에 포함되는 것으로 의도된다.","Further, these equivalents should be interpreted to fall within the present disclosure.",True,0.3685212433338165,0.731197813069375,8,12,-4,33,87,-54
"본 출원의 하나의 양태는, 서열번호 1의 아미노산 서열에서 아미노산 서열위치 136번째의 아미노산이 글루타민 이외의 다른 아미노산으로 치환된 아세토하이드록시산 신타제 활성을 가지는 단백질 변이체를 제공한다.","One aspect of the present disclosure provides a protein variant having -3acetohydroxy acid synthase activity, wherein glutamine, which is an amino acid at position 136 in an amino acid sequence of SEQ ID NO: 1, is substituted with an amino acid other than glutamine.",True,0.2213788479566574,0.8860449254984485,24,44,-20,115,266,-151
"상기 아세토하이드록시산 신타제 활성을 가지는 단백질 변이체는 변이체 단백질, 변이형 단백질, 아세토하이드록시산 신타제 변이체, 변이체 아세토하이드록시산 신타제 또는 변이형 아세토하이드록시산 신타제 등으로 혼용되어 사용될 수 있다.","The protein variant having acetohydroxy acid synthase activity may be used interchangeably with a variant protein, a modified protein, an acetohydroxy acid synthase variant, a variant acetohydroxy acid synthase, a modified acetohydroxy acid synthase, etc.",True,0.2303461879491806,0.8762425284424865,26,35,-9,128,255,-127
"구체적으로, 상기 폴리펩티드는 서열번호 1의 아미노산 서열에서 상기 136번째 아미노산인 글루타민이 아스파라진, 알지닌, 페닐알라닌, 세린, 타이로신, 메치오닌, 시스테인, 프롤린, 히스티딘, 류신, 이소류신, 쓰레오닌, 라이신, 발린, 알라닌, 아스파르산, 글루탐산, 글라이신 또는 트립토판으로 치환된, 아세토하이드록시산 신타제 (acetohydroxy acid synthase, AHAS) 활성을 가지는 단백질 변이체일 수 있으나, 이에 제한되는 것은 아니다.","Specifically, the polypeptide may be a protein variant having acetohydroxy acid synthase (AHAS) activity, wherein glutamine, which is an amino acid at position 136 in the amino acid sequence of SEQ ID NO: 1, is substituted with asparagine, arginine, phenylalanine, serine, tyrosine, methionine, cysteine, proline, histidine, leucine, isoleucine, threonine, lysine, valine, alanine, aspartic acid, glutamic acid, glycine, or tryptophan, but is not limited thereto.",True,0.1389578431844711,0.9294174333344102,48,64,-16,259,463,-204
"본 출원에서 용어, ""아세토하이드록시산 신타제(acetohydroxy acid synthase, AHAS)"" 또는 ""아세토하이드록시산 신타아제""는 분지쇄 아미노산의 생합성에 관여하는 효소로, 분지쇄 아미노산 생합성의 첫 번째 단계에 관여할 수 있다.","As used herein, the term ""acetohydroxy acid synthase (AHAS)"" refers to an enzyme involved in the biosynthesis of branched-chain amino acids, and it may be involved in the first step of the biosynthesis of branched-chain amino acids.",True,0.1921376883983612,0.897325231554739,25,37,-12,139,232,-93
"구체적으로, 아세토하이드록시산 신타제는 피루브산(pyruvate)의 디카르복실화(decarboyxlation)와 다른 피루브산 분자와의 축합 반응을 촉매하여 발린의 전구체인 아세토젖산을 생산하거나 피루브산의 디카르복실화와 2-케토부티레이트(2-ketobutyrate)와의 축합 반응을 촉매하여 이소류신의 전구체인 아세토히드록시부티레이트를 생산할 수 있다.","Specifically, acetohydroxy acid synthase may catalyze decarboxylation of pyruvate and a condensation reaction with another pyruvate molecule to produce acetolactate, which is a precursor of valine, or may catalyze decarboxylation of pyruvate and a condensation reaction with 2 ketobutyrate to produce acetohydroxybutyrate, which is a precursor of isoleucine.",True,0.1566515266895294,0.9168939953409734,27,48,-21,198,358,-160
"생산된 아세토히드록시부티레이트으로부터 출발하여 아세토하이드록시산 이소메로리덕타아제 (acetohydroxy acid isomeroreductase), 디하이드록시산 디하이드레타제(dihydroxy acid dehydratase), 트랜스 아미나제 B(transaminase B)에 의하여 촉매된 반응을 순차적으로 거치면 L- 이소류신이 생합성될 수 있다.","Starting from the produced acetohydroxybutyrate, L-isoleucine may be biosynthesized through sequential reactions catalyzed by acetohydroxy acid isomeroreductase, dihydroxy acid dehydratase, and transaminase B.",True,0.1228693202137947,0.9301079128840096,26,23,3,198,209,-11
"따라서, 상기 아세토하이드록시산 신타제는 분지쇄 아미노산의 생합성 경로에 있어서 중요한 효소이다.","Accordingly, the acetohydroxy acid synthase is an important enzyme in the biosynthesis pathways of branched-chain amino acids.",True,0.1745107471942901,0.8910348447636227,11,17,-6,54,126,-72
"아세토하이드록시산 신타아제는 ilvB 및 ilvN, 두 유전자에 의하여 코딩되며, ilvB 유전자는 아세토하이드록시산 신타아제의 큰 소단위체(large subunit; IlvB)를, ilvN 유전자는 아세토하이드록시산 신타아제의 작은 소단위체(small subunit; IlvN)를 각각 코딩한다.","The ilvB gene encodes the large subunit of acetohydroxy acid synthase (IlvB), and the ilvN gene encodes the small subunit of acetohydroxy acid synthase (IlvN).",False,0.1889742612838745,0.8957201998316663,27,25,2,166,159,7
"본 출원의 용어, ""분지쇄 아미노산""이란 곁사슬에 분지알킬기가 있는 아미노산을 말하며, 발린, 류신 및 이소류신을 포함한다.","As used herein, the term ""branched-chain amino acid"" refers to an amino acid with -4a branched alkyl group on the side chain, and it includes valine, leucine, and isoleucine.",True,0.4247320294380188,0.7568774280808024,15,29,-14,69,174,-105
"구체적으로, 본 출원에서 상기 분지쇄 아미노산은 L-이소류신, L-발린 또는 L-류신일 수 있으나, 이에 제한되는 것은 아니다.","Specifically, in the present disclosure, the branched-chain amino acid may be L-isoleucine, L-valine, or L-leucine, but is not limited thereto.",True,0.1340997368097305,0.9254488162088162,16,20,-4,71,143,-72
"본 출원에서 아세토하이드록시산 신타아제는 코리네박테리움 속 미생물 유래일 수 있고, 구체적으로 코리네박테리움 글루타미쿰(Corynebacterium glutamicum) 유래일 수 있다.","In the present disclosure, the acetohydroxy acid synthase may be derived from a microorganism of the genus Corynebacterium, and specifically, from Corynebacterium glutamicum.",True,0.2065161615610122,0.8798509187851623,17,23,-6,104,174,-70
코리네박테리움 글루타미쿰(Corynebacterium glutamicum) 유래의 아세토하이드록시산 신타아제의 큰 소단위체 ilvB 단백질은 예를 들면 서열번호 1의 아미노산 서열을 포함하는 단백질일 수 있다.,"The large subunit ilvB protein of acetohydroxy acid synthase derived from Corynebacterium glutamicum may be, for example, a protein including the amino acid sequence of SEQ ID NO: 1.",True,0.1704613864421844,0.9101989632091668,20,29,-9,117,182,-65
"상기 서열번호 1의 아미노산 서열을 포함하는 단백질은 서열번호 1의 아미노산 서열을 가지는 단백질, 서열번호 1의 아미노산 서열로 구성되는 단백질과 혼용되어 사용될 수 있다.",The protein including the amino acid sequence of SEQ ID NO: 1 may be used interchangeably with a protein having the amino acid sequence of SEQ ID NO: 1 or a protein consisting of the amino acid sequence of SEQ ID NO: 1.,True,0.2642870545387268,0.8650152001998354,23,43,-20,97,219,-122
"또한, 본 출원에서의 아세토하이드록시산 신타아제의 큰 소단위체 ilvB 단백질은 비록 서열번호 1의 아미노산을 포함하는 단백질이라고 정의하였지만, 서열번호 1의 아미노산 서열 앞뒤로의 무의미한 서열 추가 또는 자연적으로 발생할 수 있는 돌연변이, 혹은 이의 잠재성 돌연변이 (silent mutation)를 제외하는 것이 아니며, 서열번호 1의 아미노산 서열을 포함하는 단백질과 서로 동일 또는 상응하는 활성을 가지는 경우라면 본원의 아세토하이드록시산 신타아제의 큰 소단위체 ilvB 단백질에 해당됨은 당업자에게 자명하다.","Further, although the large subunit ilvB protein of acetohydroxy acid synthase in the present disclosure is defined as the protein including the amino acid sequence of SEQ ID NO: 1, it does not exclude a mutation that may occur by adding a meaningless sequence upstream or downstream of the amino acid sequence of SEQ ID NO: 1, a naturally occurring mutation, or a silent mutation, and it is apparent to those skilled in the art that as long as a protein has activity identical or corresponding to that of the protein including the amino acid sequence of SEQ ID NO: 1, it corresponds to the large subunit ilvB protein of acetohydroxy acid synthase of the present disclosure.",True,0.1964536756277084,0.9065640042605224,62,117,-55,292,674,-382
"구체적인 예를 들어, 본원의 아세토하이드록시산 신타아제의 큰 소단위체 ilvB 단백질은 서열번호 1의 아미노산 서열 또는 이와 80%, 90%, 95%, 97% 또는 99%이상의 상동성 또는 동일성을 갖는 아미노산 서열로 구성되는 단백질일 수 있다.","As a specific example, the large subunit ilvB protein of acetohydroxy acid synthase of the present disclosure may be a protein consisting of the amino acid sequence of SEQ ID NO: 1, or a protein consisting of an amino acid sequence having 80%, 90%, 95%, 97%, or 99% or more homology or identity thereto.",True,0.1494273394346237,0.9264642760516256,32,54,-22,139,303,-164
"또한, 이러한 상동성 또는 동일성을 가지며 상기 단백질에 상응하는 효능을 나타내는 아미노산 서열이라면, 일부 서열이 결실, 변형, 치환 또는 부가된 아미노산 서열을 갖는 단백질도 본 출원의 변이 대상이 되는 단백질의 범위 내에 포함됨은 자명하다.","Additionally, it is obvious that any protein having an amino acid sequence with deletion, modification, substitution, or addition in part of the sequence may also be included within the scope of the protein to be mutated in the present disclosure, as long as the amino acid sequence has a homology or identity described above and exhibits efficacy corresponding to that of the protein.",True,0.2625029683113098,0.8691186514920227,34,63,-29,137,385,-248
"즉, 본 출원에서 '특정 서열번호로 기재된 아미노산 서열을 갖는 단백질 또는 폴리펩티드', '특정 서열번호로 기재된 아미노산 서열로 이루어진 단백질 또는 폴리펩티드'라고 기재되어 있다 하더라도, 해당 서열번호의 아미노산 서열로 이루어진 폴리펩티드와 동일 혹은 상응하는 활성을 가지는 경우라면, 일부 서열이 결실, 변형, 치환 또는 부가된 아미노산 서열을 갖는 단백질도 본 출원에서 사용될 수 있음은 자명하다.","In other words, although described as ""a protein or polypeptide having an amino acid sequence of a specific SEQ ID NO"" or ""a protein or polypeptide consisting of an -5amino acid sequence of a specific SEQ ID NO"" in the present disclosure, it is obvious that any protein having an amino acid sequence with deletion, modification, substitution, or addition in part of the sequence may also be used in the present disclosure, as long as the protein may have an activity identical or corresponding to that of a polypeptide consisting of the amino acid sequence of the corresponding SEQ ID NO.",True,0.2047101110219955,0.9033468473024584,53,101,-48,228,588,-360
"예를 들어, '서열번호 1의 아미노산 서열로 이루어진 폴리펩티드'는, 이와 동일 혹은 상응하는 활성을 가지는 경우라면 '서열번호 1의 아미노산 서열로 이루어진 폴리펩티드'에 속할 수 있음은 자명하다.","For example, it is obvious that any polypeptide may belong to the ""polypeptide consisting of the amino acid sequence of SEQ ID NO: 1"", as long as it has an activity identical or corresponding to that of the ""polypeptide consisting of the amino acid sequence of SEQ ID NO: 1"".",True,0.2053964883089065,0.8932203830374427,25,50,-25,111,275,-164
"본 출원에서 제공하는 아세토하이드록시산 신타제 활성을 가지는 단백질 변이체는, 상기에서 설명한 아세토하이드록시산 신타제 활성을 갖는 단백질 중 특이적 위치의 아미노산이 치환되어, 아세토하이드록시산 신타제 활성이 변이 전 단백질 대비 100% 초과되거나 L-이소류신 또는 이의 아날로그 유사체에 의한 피드백저해가 해제된 변이체를 의미할 수 있다.","The protein variant having acetohydroxy acid synthase activity provided in the present disclosure may refer to a variant for which acetohydroxy acid synthase activity exceeds 100% by substituting an amino acid at a specific position in the protein having acetohydroxy acid synthase activity described above, as compared with the protein before modification, or a variant for which feedback inhibition by L-isoleucine or an analog thereof is released.",True,0.2050780057907104,0.897172819052661,42,67,-25,192,450,-258
"본 출원에서 용어, ""변이체(variant)""는 하나 이상의 아미노산이 보존적 치환(conservative substitution) 및/또는 변형(modification)에 있어서 상기 열거된 서열 (the recited sequence)과 상이하나, 상기 단백질의 기능(functions) 또는 특성(properties)이 유지되는 단백질을 지칭한다.","As used herein, the term ""variant"" refers to a protein, of which one or more amino acids differ from the recited sequence in conservative substitutions and/or modifications, but it retains functions or properties of the protein.",True,0.1425117999315261,0.923115134079214,28,36,-8,197,228,-31
"변이체는 수 개의 아미노산 치환, 결실 또는 부가에 의해 식별되는 서열(identified sequence)과 상이하다.","Variants differ from an identified sequence by substitution, deletion, or addition of several amino acids.",True,0.3437318801879883,0.7780162329297993,13,15,-2,67,106,-39
"이러한 변이체는 일반적으로 상기 단백질의 아미노산 서열 중 하나 이상의 아미노산을 변형하고, 상기 변형된 단백질의 특성을 평가하여 식별될 수 있다.",Such variants may be generally identified by modifying one or more amino acids in the amino acid sequence of the protein and evaluating the properties of the modified protein.,True,0.2447309345006942,0.8596298569703905,20,29,-9,82,175,-93
"즉, 변이체의 능력은 본래 단백질(native protein)에 비하여 증가되거나, 변하지 않거나, 또는 감소될 수 있다.","In other words, an ability of a variant may be increased, unchanged, or decreased, as compared with that of a native protein.",True,0.2076517343521118,0.8627704934391824,14,22,-8,68,125,-57
다른 변이체는 성숙 단백질 (mature protein) 의 N- 및/또는 C-말단으로부 터 일부분이 제거된 변이체를 포함할 수 있다.,Other variants may include variants in which a portion has been removed from the N- and/or C-terminus of a mature protein.,True,0.1234178021550178,0.9282181976304912,17,21,-4,75,122,-47
"상기 용어 ""변이체""는 변이형, 변형, 변이된 단백질, 변이형 폴리펩티드, 변이, 등의 용어(영문 표현으로는 modification, modified protein, modified polypeptide, mutant, mutein, divergent, variant 등)가 사용될 수 있으며, 변이된 의미로 사용되는 용어라면 이에 제한되지 않는다.","The term ""variant"" may be used interchangeably with terms such as modification, modified protein, modified polypeptide, mutant, mutein, divergent, variant, etc., and the term is not limited as long as it is used with a meaning of modification.",True,0.1239629089832305,0.9242967314453434,33,38,-5,195,243,-48
"본 출원의 목적상, 상기 변이체는 천연의 야생형 또는 비변형 단백질과 대비하여 단백질의 활성이 증가되거나 피드백저해가 해제된 것일 수 있으나, 이에 제한되지 않는다.","With respect to the object of the -6present disclosure, the variant may be a variant in which the activity of the protein is increased or feedback inhibition is released, as compared with a natural wild-type or non modified protein, but is not limited thereto.",True,0.2712983191013336,0.8345463004425839,22,44,-22,92,260,-168
"본 출원에서 용어 ""보존적 치환(conservative substitution)""은 한 아미노산을 유사한 구조적 및/또는 화학적 성질을 갖는 또 다른 아미노산으로 치환시키는 것을 의미한다.","As used herein, the term ""conservative substitution"" means substitution of one amino acid with another amino acid that has similar structural and/or chemical properties.",True,0.119850143790245,0.9319850606071198,20,24,-4,105,169,-64
"이러한 아미노산 치환은 일반적으로 잔기의 극성, 전하(염기성, 산성), 용해도, 소수성, 친수성 및/또는 양친매성(amphipathic nature)에서의 유사성에 근거하여 발생할 수 있다.","Such amino acid substitutions may be generally made on the basis of similarity in polarity, charge (basic/acidic), solubility, hydrophobicity, hydrophilicity, and/or the amphipathic nature of residues.",True,0.1590611040592193,0.903538452362215,19,26,-7,106,201,-95
"또한, 변이체는 폴리펩티드의 특성과 2차 구조에 최소한의 영향을 갖는 아미노산들의 결실 또는 부가를 포함할 수 있다.","Further, variants may include deletion or addition of amino acids that have minimal influence on properties and a secondary structure of the polypeptide.",True,0.1988226473331451,0.8797557064905563,16,23,-7,65,153,-88
예를 들면 폴리펩티드는 번역-동시에(co-translationally) 또는 번역-후에(post-translationally) 단백질의 이전(transfer)에 관여하는 단백질 N-말단의 시그널 (또는 리더)서열과 컨쥬게이트 할 수 있다.,"For example, a polypeptide may be conjugated to a signal (or leader) sequence at the N terminus of the protein, which co-translationally or post-translationally directs transfer of the protein.",True,0.136010393500328,0.9208133058983896,18,29,-11,133,193,-60
"또한 상기 폴리펩티드는 폴리펩티드를 확인, 정제, 또는 합성할 수 있도록 다른 서열 또는 링커와 컨쥬게이트 될 수 있다.","In addition, the polypeptide may also be conjugated to another sequence or a linker for identification, purification, or synthesis of the polypeptide.",True,0.1476566046476364,0.9099070854146022,18,22,-4,67,150,-83
닦아내기용 시트 및 당해 닦아내기용 시트의 제조 방법,The present invention relates to a wiping sheet and a method for manufacturing the wiping sheet.,False,0.4128063917160034,0.7434797000804498,8,16,-8,29,96,-67
[본 발명은 닦아내기용 시트 및 당해 닦아내기용 시트의 제조 방법에 관한 것이다.],[Background Art],False,0.9953027963638305,0.3439487744769386,12,2,10,46,16,30
"[닦아내기용 시트의 원료인 부직포에 패턴부를 형성하기 위한 방법은, 스펀레이스법 등의 웨브 섬유를 결합할 때에 형성하는 방법이나, 무지 (無地) 부직포에 열 엠보스 가공하는 방법 등이 있다 (특허문헌 1 참조).]","There are several methods of forming patterned parts in a nonwoven fabric, which is a material for wiping sheets, such as forming the patterned parts when web fibers are joined by a spunlace method, or by heat embossing process of plain nonwoven fabrics (see patent document 1).",True,0.2558417916297912,0.8661509782591058,28,47,-19,119,278,-159
[PatentCitationText[attributes={}; value=[일본 공개특허공보 2010-200860 공보]]],[Patent Document 1] JP 2010-200860 A,False,0.402582585811615,0.7080521994651174,5,6,-1,69,36,33
"[그러나, 스펀레이스법으로는 부직포에 패턴부에 의해 요철을 형성하는 것이 어렵다.","However, in the spun lace method, it is difficult to form unevenness in the nonwoven fabric by forming the patterned parts.",True,0.3804733753204345,0.7408043077720547,9,21,-12,45,123,-78
"또, 열 엠보스 가공을 실시하려면 상응하는 설비가 필요하다.","Also, the heat embossing process requires large scaled equipment.",True,0.3207035958766937,0.7456435550996422,8,9,-1,33,65,-32
"그 때문에, 용이하게 부직포에 패턴부에 의해 요철을 형성하는 방법이 요망되고 있었다. ]","Therefore, it has been desired to easily form unevenness on nonwoven fabrics by forming the patterned parts.",True,0.4174602925777435,0.714573170986166,12,17,-5,49,108,-59
"[본 발명의 목적은, 용이하게 부직포에 패턴부에 의해 요철을 형성할 수 있는 닦아내기용 시트 및 당해 닦아내기용 시트의 제조 방법을 제공하는 것이다.]","An object of the present invention is to provide a wiping sheet that enables easy formation of unevenness on nonwoven fabrics by forming a patterned part, and a method for manufacturing the wiping sheet.",True,0.3270849585533133,0.8215477093266764,21,34,-13,84,203,-119
"[상기 과제를 해결하기 위해서, 청구항 1 에 기재된 발명은, ]",[Solution to Problem],False,0.7825314998626709,0.452906599070722,10,3,7,36,21,15
"[부직포에 셀룰로오스 나노파이버를 함유하는 패턴부와, 상기 셀룰로오스 나노파이버를 함유하지 않는 비패턴부, 를 구비한다.]","In order to achieve the object, according to the invention recited in claim 1, there is provided a wiping sheet including: a patterned part of a nonwoven fabric, the patterned part including cellulose nanofiber; and a non-patterned part of the nonwoven fabric, the non-patterned part not including the cellulose nanofiber.",False,0.5805422067642212,0.6658301044885576,13,50,-37,68,322,-254
[상기 패턴부의 면적이 부직포 전체 크기의 10 ∼ 60 ％ 이다.],"According to the invention recited in claim 2, there is provided a wiping sheet according to claim 1, wherein the patterned part has an area of 10 to 60% of a total area of the nonwoven fabric.",False,0.5016701817512512,0.6932888169023568,11,37,-26,38,193,-155
"[청구항 3 에 기재된 발명은, 청구항 1 또는 2 에 기재된 닦아내기용 시트에 있어서, ]","According to the invention recited in claim 3, there is provided a wiping sheet according to claim 1 or 2, wherein the patterned part is formed only on one surface of the nonwoven fabric.",False,0.5098192691802979,0.7087463657636147,15,34,-19,51,187,-136
"[부직포에, 0.75 ∼ 2.00 ％ 의 셀룰로오스 나노파이버 용액을 설정된 패턴에 따라서 도포함으로써 패턴부를 형성하는 도포 스텝과,]","According to the invention recited in claim 4, there is provided method for manufacturing a wiping sheet, including: applying a cellulose nanofiber solution of 0.75 to 2.00% to a nonwoven fabric according to a set pattern, thereby forming a patterned part; and thermal drying of the nonwoven fabric to which the cellulose nanofiber solution has been applied.",False,0.514518141746521,0.6970961036492,17,57,-40,76,358,-282
"[셀룰로오스 나노파이버 용액이 도포된 부직포를 열 건조시키는 건조 스텝,]","According to the invention recited in claim 5, there is provided a method for manufacturing a wiping sheet according to claim 4, wherein, in the applying, the cellulose nanofiber solution is applied to an area of 10 to 60% of a total area of the nonwoven fabric.",False,0.9192259311676024,0.4121933069120624,9,47,-38,41,262,-221
"[청구항 5 에 기재된 발명은, 청구항 4 에 기재된 닦아내기용 시트의 제조 방법에 있어서, ]","According to the invention recited in claim 6, there is provided a method for manufacturing a wiping sheet according to claim 4 or 5, wherein, in the applying, the cellulose nanofiber solution is applied using a spray.",False,0.4550228118896484,0.7459987249789297,15,37,-22,53,218,-165
"[상기 도포 스텝은, 부직포 전체 크기의 10 ∼ 60 ％ 의 도포 면적에 도포한다.]",[Advantageous Effects of Invention],False,1.0176974534988403,0.2645756916935505,14,4,10,48,35,13
"[청구항 6 에 기재된 발명은, 청구항 4 또는 5 에 기재된 닦아내기용 시트의 제조 방법에 있어서, ]","According to the present invention, there is provided a wiping sheet that enables easy formation of unevenness on nonwoven fabrics by forming a patterned part, and a method for manufacturing the wiping sheet.",False,0.7755611538887024,0.5606235929085311,17,33,-16,58,208,-150
"[상기 도포 스텝은, 스프레이에 의해 도포한다.]",[Brief Description of Drawings],False,0.9239989519119264,0.314358330651548,6,4,2,27,31,-4
"[도 1 는, 실시형태에 관련된 부직포에 대한 패턴부의 형성 방법의 일례를 나타내는 도면이다.",FIG. 1 is a diagram showing an example of a method of forming a patterned part on a nonwoven fabric according to an embodiment.,True,0.4258061051368713,0.7530996018729023,13,24,-11,52,127,-75
"도 2A 는, 실시형태에 관련된 부직포의 패턴부의 일례를 나타내는 도면이다.",FIG. 2A is a diagram of an example of a patterned part of a nonwoven fabric according to an embodiment.,True,0.3639405965805053,0.7675246422729014,10,20,-10,42,103,-61
"도 2B 는, 실시형태에 관련된 부직포의 패턴부의 일례를 나타내는 도면이다.",FIG. 2B is a diagram of an example of a patterned part of a nonwoven fabric according to an embodiment.,True,0.341628760099411,0.7832376011324462,10,20,-10,42,103,-61
"도 2C 는, 실시형태에 관련된 부직포의 패턴부의 일례를 나타내는 도면이다.",FIG. 2C is a diagram of an example of a patterned part of a nonwoven fabric according to an embodiment.,True,0.3516964912414551,0.7763743711258501,10,20,-10,42,103,-61
"도 2D 는, 실시형태에 관련된 부직포의 패턴부의 일례를 나타내는 도면이다.",FIG. 2D is a diagram of an example of a patterned part of a nonwoven fabric according to an embodiment.,True,0.3574675023555755,0.7743810428193915,10,20,-10,42,103,-61
"도 2E 는, 실시형태에 관련된 부직포의 패턴부의 일례를 나타내는 도면이다.",FIG. 2E is a diagram of an example of a patterned part of a nonwoven fabric according to an embodiment.,True,0.35040482878685,0.7761687978830374,10,20,-10,42,103,-61
"도 3 은, 실시형태에 관련된 닦아내기용 시트의 제조 방법의 플로 차트이다.]",FIG. 3 is a flowchart of a method for manufacturing a wiping sheet according to an embodiment.,True,0.1904462724924087,0.8869104890689431,11,17,-6,43,94,-51
[[닦아내기용 시트] ],[Wiping Sheet],True,0.2978486120700836,0.7930710880266165,3,2,1,13,14,-1
"[본 발명에 관련된 닦아내기용 시트 (P) 는, 예를 들어 부직포 등의 시트상의 섬유 집합 기재의 편면에 대하여, 정제수에 각종 성분을 첨가한 용액을 도포하고, 열 건조시킨 것이다. ]","A wiping sheet P of the present invention is prepared by applying a solution including various ingredients added to purified water to one surface of a fiber assembling base material in a shape of a sheet such as a nonwoven fabric, for example, and then by thermal drying.",True,0.3088545501232147,0.8153770994421033,27,48,-21,103,271,-168
"[닦아내기용 시트 (P) 는, 예를 들어, 도 1 에 나타내는 바와 같이, 전체면 중, 격자 도트 형상으로 형성된 패턴부 (1) 와, 그 이외의 부분인 비패턴부 (2) 를 구비한다.]","As shown in FIG. 1, for example, the wiping sheet P has a patterned part(s) 1 formed in a shape of a lattice point(s) on the entire surface, and a non-patterned part(s) 2, which is the part(s) other than the patterned part(s) 1.",True,0.1981869488954544,0.8902069683182888,28,43,-15,102,228,-126
"[패턴부 (1) 는, 셀룰로오스 나노파이버 (이하, CNF) 가 함유되어 있고, 열수축에 의해 섬유 밀도가 비패턴부 (2) 보다 높게 되어 있다. ]",The patterned part 1 contains cellulose nanofiber (hereafter referred to as CNF) and has a higher fiber density than the non-patterned part 2 due to heat shrinkage.,True,0.1706988662481308,0.9007531014676878,21,27,-6,83,164,-81
"[비패턴부 (2) 는, CNF 가 함유되어 있지 않은 부분이며, 패턴부 (1) 에 비해 섬유 밀도가 낮게 되어 있다. ]",The non-patterned part 2 does not contain CNF and has a lower fiber density than the patterned part 1.,True,0.1334014981985092,0.9222666943091334,19,19,0,67,102,-35
"[패턴부 (1) 는, 열수축에 의해 움푹 패이기 때문에, 닦아내기용 시트 (P) 는, 패턴부 (1) 와 비패턴부 (2) 에 의해 요철이 형성된다.",The patterned part 1 and the non-patterned part 2 forms unevenness in the wiping sheet P as a result of depression of the patterned part 1 due to heat shrinkage.,True,0.3499846160411834,0.7864102358945678,21,30,-9,81,161,-80
"보다 구체적으로는, CNF 가 도포된 부분이 과열되면, CNF 용액 중의 물이 증발하고, CNF 끼리의 수소 결합이 보다 강고해짐으로써, CNF 가 도포된 부분의 부직포 섬유가 응축 (수축) 하여, 비패턴부 (2) 와 고저차가 발생한다.","More specifically, when a part where CNF is applied is heated, water in a CNF solution evaporates such that the hydrogen bond between CNF becomes stronger, and fibers of the nonwoven fabric in the part where CNF is applied are condensed (shrinked), and resulting in a height difference from the non-patterned part 2.",True,0.1179149895906448,0.9270422635204664,32,53,-21,132,316,-184
"한편, 예를 들어, 카르복시메틸셀룰로오스 (이하, CMC) 는, CNF 와 비교해서 수소 결합의 수가 많지 않기 때문에, 부직포에 CMC 를 도포하고, 당해 부분이 과열되어도, 부직포 섬유가 응축 (수축) 하지 않아, 비패턴부 (2) 와 고저차는 잘 발생하지 않는다]","On the other hand, since carboxymethyl cellulose (hereinafter referred to as ""CMC""), for example, does not have as many hydrogen bonds as CNF, even when CMC is applied to a nonwoven fabric and the part is heated, the fibers of the nonwoven fabric are not condensed (shrinked) and are unlikely to form the height difference from the non-patterned part 2.",True,0.1483419686555862,0.907761935285856,36,60,-24,149,353,-204
"[또한, 패턴부 (1) 의 형상, 배치, 방향은 임의이며, 도포에 의해 형성 가능한 패턴이면, 어떠한 것이어도 된다. ]","The pattern part 1 may have any designs, arrangement, and orientation, and may be any pattern as long as it can be formed by application.",True,0.3445757329463959,0.7748195524158648,17,25,-8,67,137,-70
"[예를 들어, 닦아내기용 시트 (P) 는, 도 2A 에 나타내는 바와 같이, 세로 방향의 수선 (垂線) 형상으로 형성된 패턴부 (1) 와, 그 이외의 비패턴부 (2) 를 구비하는 형상이어도 된다.","For example, as shown in FIG. 2A, the wiping sheet P may be shaped so as to have patterned parts 1 that are formed as perpendicular lines in a vertical direction and non-patterned parts 2 that are parts other than the patterned parts 1.",True,0.1878366321325302,0.8947006558895105,29,44,-15,109,236,-127
"또, 패턴부 (1) 는, 도 2B 에 나타내는 바와 같이 비스듬한 격자 도트 형상이어도 되고, 도 2C 에 나타내는 바와 같이 가로 방향의 수선 형상이어도 된다.","Alternatively, the patterned parts 1 may be in the form of diagonal lattice points as shown in FIG. 2B, or may be in the form of perpendicular lines in a horizontal direction as shown in FIG. 2C.",True,0.224193662405014,0.8613328038935666,26,37,-11,90,195,-105
"또, 도 2D 에 나타내는 바와 같이 직선파 형상이어도 되고, 도 2E 에 나타내는 바와 같이 사선 형상이어도 된다.]","Alternatively, the patterned parts 1 may be in the form of triangle waves as shown in FIG. 2D, or may be in the form of diagonal lines as shown in FIG. 2E.",True,0.3204310834407806,0.7875891305972237,19,32,-13,66,155,-89
"[또, 이 때, 닦아내기용 시트 (P) 전체에 적당한 요철감을 부여하기 위해서, 패턴부 (1) 의 면적이 부직포 전체 크기의 10 ∼ 60 ％ 가 되도록 CNF 용액을 도포하는 것이 바람직하다.","At this time, in order that the entire wiping sheet P has a suitable unevenness, it is preferable to apply the CNF solution such that an area of the patterned part(s) 1 is 10 to 60% of the total area of the nonwoven fabric.",True,0.1728179007768631,0.8997125920946083,29,44,-15,108,223,-115
"패턴부 (1) 의 면적이 10 ％ 보다 작은 경우, 요철이 적고, 닦아내기성이나, 긁어내기성이 발휘되지 않기 때문이다.","This is because, when the area of the patterned part(s) 1 is smaller than 10%, it has little unevenness and does not exhibit wiping or scraping properties.",True,0.1592532396316528,0.8947012197831616,16,27,-11,66,155,-89
"또, 패턴부 (1) 의 면적이 60 ％ 보다 큰 경우, 패턴부 (1) 가 많아져 부드러움이 손상되기 때문이다.]","When the area of the patterned part(s) 1 is larger than 60%, the patterned part(s) 1 is so large that softness is impaired.",True,0.1410093158483505,0.9079615328800416,17,23,-6,62,123,-61
"[닦아내기용 시트 (P) 는, 제품 형태에서는, 복수 매 적층된 적층체의 상태로서, 개폐 뚜껑에 의해 밀폐 가능하게 된 시트 취출구를 갖는 밀폐 용기나 봉투 등의 포장 수단 내에 수용할 수 있다. ]","The wiping sheets P as a product is formed into a stack of a plurality of sheets so as to be stored in a packaging means that has a sheet outlet and can be sealed by an open/close lid, such as a sealed container or a bag.",True,0.2935378849506378,0.8095345554413517,31,47,-16,111,221,-110
"[사용 시에는, 닦아내기용 시트 (P) 를 용기 또는 봉투 내에 직접 넣은 것, 혹은 닦아내기용 시트 (P) 를 직접 넣은 봉투를 용기 내에 넣은 것으로부터, 사용자가 취출구를 열어 내부의 시트를 꺼내어 사용한다. ]","For use, a user opens the outlet and pulls out a sheet in the container or bag directly containing the wiping sheets P, or in a container containing a bag directly containing the wiping sheets P.",True,0.3016585409641266,0.79345476926862,33,36,-3,121,195,-74
"[이러한 닦아내기용 시트 (P) 는, 예를 들어, 신체닦기 시트, 플로어 등의 청소용 시트 등, 광범위한 용도에 사용된다.]","Such wiping sheets P can be used for a variety of purposes, for example, as body wiping sheets, cleaning sheets for floors, and the like.",True,0.2983100712299347,0.799339930049186,17,25,-8,69,137,-68
[[섬유 집합 기재] ],[Fiber Assembling Base Material],True,0.2623084783554077,0.8053479943705786,4,4,0,13,32,-19
"[섬유 집합 기재로는, 소정의 섬유를 섬유 소재로 하여, 예를 들어, 스펀 레이스, 에어스루, 에어레이드, 포인트 본드, 스펀 본드, 니들 펀치 등의 주지의 기술에 의해 제조되는 부직포를 사용할 수 있다. ]","The nonwoven fabric is manufactured by using a well-known technology such as spunlace, air through, air laid, point bond, spun bond, needle punch, or the like.",False,0.4389264583587646,0.726200795402619,30,26,4,116,159,-43
"[소정의 섬유로는, 천연, 재생, 합성을 불문하고 사용할 수 있지만, 예를 들어, 레이온, 리요셀, 텐셀, 코튼 등의 셀룰로오스계 섬유, 폴리에틸렌, 폴리프로필렌, 폴리비닐알코올 등의 폴리올레핀계 섬유, 폴리에틸렌테레프탈레이트, 폴리부틸렌테레프탈레이트 등의 폴리에스테르 섬유, 나일론 등의 폴리아미드계 섬유를 들 수 있다.","The predetermined fiber is, for example, cellulose fiber such as rayon, lyocell, tencel, and cotton; polyolefin fiber such as polyethylene, polypropylene, and polyvinyl alcohol; polyester fiber such as polyethylene terephthalate and polybutylene terephthalate; and polyamide fiber such as nylon.",False,0.2922548949718475,0.8177202421973954,36,39,-3,180,295,-115
"이들은 단독으로, 혹은 2 종 이상을 조합하여 사용할 수 있다. ]",These can be used alone or in combination of two or more kinds of these.,True,0.1661852896213531,0.8731501825861852,11,15,-4,37,72,-35
[본 발명에서는 적어도 친수성 섬유를 함유하는 것이 바람직하다.,"In the present invention, hydrophilic fiber is preferably contained at least.",True,0.2297575324773788,0.8522089050623397,8,11,-3,35,77,-42
"닦아내기용 시트 (P) 는, 친수성 섬유를 포함한 부직포 쪽이 친수성 섬유를 포함하지 않는 부직포와 비교해서, 오염의 닦아내기 효과가 높기 때문이다.]",This is because a nonwoven fabric containing hydrophilic fiber is more effective in wiping off dirt than a nonwoven fabric that does not contain hydrophilic fiber.,True,0.4152289927005768,0.730461682672709,20,26,-6,84,163,-79
[(친수성 섬유) ],(Hydrophilic Fiber),True,0.3501426577568018,0.7398959612252404,3,2,1,11,19,-8
"[친수성 섬유로는, 면, 펄프 등의 천연 섬유, 레이온, 큐프라 등의 재생 섬유 등을 사용할 수 있다.","Hydrophilic fiber may be natural fiber such as cotton and pulp, and recycled fiber such as rayon and cupra.",True,0.3504334986209869,0.7574776032017957,16,19,-3,57,107,-50
이들 섬유 중에서도 특히 레이온이 적합하다.,"Among these kinds of fiber, rayon is particularly preferred.",True,0.2670285999774933,0.7979208065978862,6,9,-3,24,60,-36
[본 발명은 오늘날 일반적으로 T-빔 또는 이중 T-빔으로 알려진 강재로 만들어진 건설 부문에서 일반적으로 사용되는 표준 프로파일의 개발에 관한 것입니다.],"1/9 Support made from stone and tension-resistant material The present invention relates to the development of a standard profile commonly used in the construction sector, which today is usually made of steel material, known as a T-beam or double T-beam.",False,0.3009976446628569,0.8128573664535886,20,40,-20,87,254,-167
"[이러한 거더는 길이 방향으로 서로 연결되고 서로 직각으로 배열된 세 개의 긴 판으로 구성되며, 플랜지라고도 하는 압력에 안정적인 상현재와 인장에 안정적인 하현재를 갖고, 일반적으로 플랜지 중앙에 대칭으로 배열되는 하부 현재와 상부 현재를 연결하는 웹. 또한 양쪽 중 하나에 융기가 있는 U-프로파일 또는 측면에 2개의 융기가 있는 상자 프로파일이 있습니다.]","Such a girder consists of three elongated plates, which are connected to each other in the longitudinal direction and arranged at right angles to one another, has a pressure-stable upper chord and a tension-stable lower chord, also called a flange, and a web connecting the lower chord and upper chord, which is typically arranged symmetrical in the middle of the flanges.",True,0.270407497882843,0.817485714394487,49,61,-12,201,372,-171
[본 발명은 또한 다음과 같은 또는 유사한 프로파일 및 기타 프로파일에 관한 것입니다:],"There are also U-profiles with a ridge on one of the two sides, or box profiles with 2 ridges on the sides.",False,0.881177544593811,0.3711634618502272,13,22,-9,49,107,-58
"[·""Peiner"" 또는 Peiner 캐리어라고도 하는 플랜지의 평행 내부 표면이 있는 P-프로파일]","The invention also relates to such or similar and other profiles such as: • P-profile with parallel inner surfaces of the flanges, also known as ""Peiner"" or Peiner carrier • U-profile with inclined inner surfaces of the flanges • U-profile with parallel inner surfaces of the flanges • T-profile isosceles • L-profile (also angle iron, angle profile or angle bracket) • as well as all possible variations of box sections and • V-profiles and combinations of these profiles With such profiles, an optimal load-bearing capacity for the respective application is achieved in relation to the mass of the material used and thus its weight.",False,0.5435828566551208,0.6226262473943164,11,104,-93,56,634,-578
[I형 보의 경우 중심 철근 또는 웨브의 높이는 본질적으로 보의 강성을 결정합니다.,"In the case of I-beams, the height of the central bar or web essentially determines the rigidity of the beam.",True,0.2658694088459015,0.8073435290218876,12,20,-8,46,109,-63
강성을 증가시키기 위한 두 번째 조치는 하부 플랜지의 인장 안정성의 목표 증가와 상부 플랜지의 압축 강성의 목표 증가입니다.,Secondary measures for increasing the rigidity are the targeted increase in the tensile stability of the lower flange and the targeted increase in the compressive rigidity of the upper flange.,True,0.1764319092035293,0.8779566836963599,18,30,-12,69,192,-123
이러한 거더는 강철로 열간 압연되기 때문에 단순성을 위해 상현재와 하현재가 동일합니다.],"Since such girders are hot-rolled from steel, the upper and lower chords are identical for the sake of simplicity.",True,0.3099500238895416,0.7673264596962059,11,19,-8,49,114,-65
[이 유형의 강재 빔의 장점은 대량으로 저렴하게 제조할 수 있고 신뢰할 수 있는 하중 지지 능력입니다.,2/9 The advantage of steel beams of this type is cheap manufacturability in large quantities and reliable load-bearing capacity.,True,0.3591471910476684,0.7456884172714886,16,19,-3,57,128,-71
이러한 프로파일에서는 결함이 거의 없으며 실제 사용에서는 무시할 수 있습니다.,Defects are rare in such profiles and can be neglected in practical use.,True,0.190392717719078,0.8451293623637163,10,13,-3,43,72,-29
"또한, 다른 내하중 부품에 빔을 연결하기 위한 추가 강철 부품은 건설 현장에서 필요에 따라 언제 어디서나 쉽게 용접될 수 있습니다.]","In addition, additional steel parts for connecting beams to other load-bearing parts can be easily welded at the construction site at any time and place as required.",True,0.2146502137184143,0.8520108213470179,20,27,-7,74,165,-91
"[단점은 7.8g/cm3의 매우 높은 밀도의 강철과 강철 생산에 많은 양의 에너지와 높은 CO, Sub[attributes={}; value=[2]], 배출량이 포함된다는 사실입니다.",The disadvantage is the extremely high density of steel at 7.8g/cm3 and the fact that steel production involves large amounts of energy and high C02emissions.,False,0.2569241523742676,0.8244299268477961,18,25,-7,102,158,-56
지금까지 강철을 대체할 수 있는 유일한 방법은 강철보다 가벼우면서도 생태학적 발자국이 훨씬 더 높은 알루미늄이었습니다.,"So far, the only replacement for steel has been aluminum, which is lighter but has an even higher ecological footprint than steel.",True,0.1895590871572494,0.8647595820729475,15,22,-7,66,130,-64
이러한 이유로 필요한 양의 강철을 알루미늄으로 생산할 수 없습니다.],"For this reason, the quantities of mass steel required cannot be produced with aluminum.",True,0.2121333926916122,0.8498811114491353,9,14,-5,38,88,-50
"[이러한 이유로 철강은 일반적으로 필수 불가결한 건축 자재로 간주되며, 이는 기후 보호 관점에서도 대체할 수 없는 데다, 이는 철강을 생산하기 위해 더욱 많은 에너지 집약성을 만드는 수소로 강철을 줄이는 작업을 수행하고 있습니다.]","For this reason, steel is generally regarded as an indispensable building material, which apparently cannot be replaced even from a climate protection point of view, which is why work is being done on reducing steel with hydrogen, which makes steel even more energy-intensive to produce.",True,0.2263743132352829,0.8584981766999122,32,45,-13,129,287,-158
"[그러나 핀란드 정부가 의뢰한 SITRA의 최근 보고서에서 파리 기후 협정에 따라 2℃ 목표를 달성해야 하는 경우 오늘날의 철강, 알루미늄 및 시멘트 만으로도 2100년까지 배출될 남은 CO2 금액을 차지하는 것이 분명합니다.","However, in recent reports by SITRA, commissioned by the Finnish government, it is clear that today's levels of steel, aluminum and cement alone account for the remaining amountsof C02 to be emitted by 2100, if that 2°C target according to the Paris climate Agreement is to be met.",True,0.1839562356472015,0.8697493831031922,30,48,-18,126,281,-155
이 사실은 먼저 강철이나 금속의 필수 불가결 패러다임을 재고하는 것을 어렵게 만듭니다.],This fact makes it compelling to first reconsider the indispensability paradigm of steel or metal.,True,0.2101375609636306,0.8504679242578006,12,15,-3,49,98,-49
[EP 106 20 92 및 EP 273 94 71은 강철과 알루미늄이 극도로 단단한 탄소 섬유로 인해 인장 안정성이 부족한 석재와 탄소 섬유 적층체(CFRP - 탄소 섬유 복합재)의 조합으로 대체될 수 있는 방법을 설명합니다.,EP 106 20 92 and EP 273 94 71 describe how steel and aluminum can be replaced by a combination of stone and carbon fiber laminate (CFRP - carbon fiber composite) if the stone is given the lack of tensile stability by the extremely stiff carbon fiber.,True,0.202495202422142,0.8765716949444297,33,47,-14,127,250,-123
석재와 섬유 사이의 연결은 탄소 재료와 가교 또는 결합할 수 있는 물유리 및 실리콘을 기반으로 하는 에폭시 수지 또는 고온 안정 바인더와 같은 수지의 도움으로 이루어집니다.,"The connection between stone and fiber is made with the help of resins, for example epoxy resins or high temperature stable binders based on water glass and silicone, which are able to crosslink or bond with the carbon material.",True,0.2398224920034408,0.8498581597449735,26,39,-13,96,228,-132
특정 상황에서 이러한 연결은 연결에 또는 연결을 통해 영구적으로 구축될 수 있는 프리스트레스를 생성합니다.],"Under certain 3/9 circumstances, these connections also produce a prestress which can be permanently built into or through the connection.",False,0.30740886926651,0.7720050393051037,14,20,-6,60,138,-78
[본 발명은 이러한 이중 T-빔이 CFRP 석재 합성물(CFS - CarbonFaserStein 또는 CarbonFiberStone)의 활용을 건축 분야에서 이미 알려진 바와 같이 실용적이고 최적화된 구조 또는 형상으로 전환하도록 예시적으로 설계될 수 있는 방법의 기술적 방법을 설명합니다.,"The invention describes a technical way of how such a double T-beam can be exemplary designed to transfer the utilization of the CFRP stone composite (CFS - CarbonFaserStein or CarbonFiberStone) to practicable and optimized structures or geometries, as being known in the construction area already.",True,0.1247118562459945,0.9282731342682108,33,45,-12,162,298,-136
이중 T빔과 단일 T빔에 대한 기술 설계는 그림 1~8에 예시로 나와 있습니다.,The technical design is shown in Figures 1 to 8 as an example for a double T-beam and a single T-beam.,True,0.1307988464832306,0.9090158988673968,12,21,-9,44,102,-58
여기서 주요 과제는 국부적 응력 피크가 없는 강제 맞춤 방식으로 서로 수직인 표면을 연결하여 국부적 파손을 통해 초기 단계에서 형상이 완전히 파손되도록 하는 것입니다.,The main challenge here is to connect the surfaces that are perpendicular to one another in a force-fitting manner without local stress peaks causing the geometry to fail completely at an early stage through local failure.,True,0.2140765786170959,0.8485383894673179,24,36,-12,93,222,-129
표면의 마찰 연결은 원칙적으로 접착제 또는 접착제를 사용하여 설정됩니다.,The frictional connection of the surfaces is in principle established with the help of glues or adhesives.,True,0.215375080704689,0.8348952064552799,9,17,-8,40,106,-66
이것은 CFRP 석재 합성물(CFS)의 생산과 CFS 부품 자체의 연결에 적용됩니다.,This applies to the production of the CFRP stone composite (CFS) and to the connection of the CFS parts themselves.,True,0.1003622114658355,0.934752092135869,10,20,-10,47,115,-68
이를 위해 먼저 두 개의 석판 사이의 중간에 탄소층(4)을 배열하는 그림 1의 베이스 플레이트 재료가 생성됩니다.],"For this purpose, the base plate material in Figure 1 is first produced, which arranges the carbon layer (4) in the middle between two stone plates.",True,0.1193459182977676,0.9260774016372194,16,26,-10,64,148,-84
[그런 다음 연결될 부품은 목공 나무 패널과 마찬가지로 나무 패널의 직교 연결을 최적화하는 도브테일로 준비된 것처럼 도베도링으로 제공됩니다.,"Then the parts to be connected are provided with dovetailing, just as in carpentry wooden panels are prepared with dovetails, which optimize the orthogonal connection of wooden panels.",True,0.2777759730815887,0.813062396321722,18,28,-10,78,184,-106
"나무의 경우, 기하학적 중첩없이 엉덩이 접착만이 접착될 수 있기 때문에, 기하학적 중첩없이 엉덩이 접착은 궁극적으로 그 부족한 인장 안정성으로 인해 신속하게 실패 할 접착제의 접착에 제한될 것이기 때문에, 기체 접합 섬유 층이 교차 또는 겹치는 방식으로 서로 연결되어 궁극적으로 효과가 사용된다.","In the case of wood, too, the effect is ultimately used that orthogonally meeting fiber layers are connected to one another in a cross-over or overlapping manner, since butt bonding without geometric overlapping would only be limited to the adhesion of the adhesive, which would ultimately fail quickly due to its insufficient tensile stability.",True,0.2086677700281143,0.8707670697411573,41,54,-13,165,345,-180
"전환의 도베도링으로 인해, 한 장력 안정 평면에서 다른 직교장 안정 평면으로의 동력 전송은 두 개의 장력 안정 평면이 거의 완전히 달성되며, 그림 1에서 8까지의 예시적인 경우 - 돌 층 내에서 - 단면의 관점에서 공간적으로 겹칩니다.]","Due to the dovetailing of the transitions, the power transmission from one tension-stable plane to the other orthogonal tension-stable plane is almost completely achieved when the two tension stable planes, in our exemplary case in Figures 1 to 8 the carbon layers within the stone layer(s)-, are spatially overlapping in view of the cross sections.",True,0.2162033468484878,0.8611043072909677,35,55,-20,132,349,-217
"[골절 테스트에서 CFS 플레이트로 만들어진 이중 T 빔이 유사한 강철 빔과 유사하게 높은 하중을 운반할 수 있다는 것이 입증될 수 있으며, 이에 따라 CFS 빔은 2.8g/cm3의 특정 중량을 가진 돌이 강철보다 상당히 가볍고, 돌과 탄소는 강철보다 생산 중 CO2 배출량이 현저히 적기 때문에 상당히 가볍습니다.","4/9 In fracture tests, it could be proven that a double T-beam made of CFS plates can carry similarly high loads as a comparable steel beam, whereby the CFS beam is significantly lighter, since stone with a specific weight of 2.8g/ cm3 is significantly lighter than steel, and stone and carbon cause significantly less C02 emissions during production than steel.",False,0.1941634863615036,0.8849562322180016,45,60,-15,176,362,-186
30~50%의 절감효과를 기대할 수 있습니다.,Savings of 30-50% can be expected.,True,0.1261941194534301,0.9052777415970682,5,6,-1,25,34,-9
전체 적인 구조는 보가 구부러질 때 접합 된 도브테일이 부서지지 않고 골절 테스트에서 탄력적일 수 있습니다.],"The overall construction shows itself to be elastic in the fracture test, without the bonded dovetail breaking up when the beam bends.",True,0.3017300367355346,0.7775887881802859,16,22,-6,61,134,-73
"[하부 벨트에서 충분한 인장 안정성을 보장하기 위해 상대적으로 얇고 가벼운 탄소 층이 필요하며, 이는 또한 총 부피에 비해 총 중량을 감소시킵니다.","In order to ensure sufficient tensile stability in the lower belt, only relatively thin and light layers of carbon are required, which also reduce the total weight in relation to the total volume.",True,0.2642009258270263,0.8257082327474349,21,33,-12,82,196,-114
상현재와 웹의 압축 강성은 석재 구성 요소에 의해 달성됩니다.,The compressive rigidity on the upper chord and in the web is achieved by the stone component.,True,0.3394919037818908,0.7321578663814872,9,17,-8,34,94,-60
탄소 외에도 탄소 섬유보다 생태 발자국이 훨씬 작은 다른 많은 섬유 재료도 사용할 수 있습니다.,"In addition to carbon, many other fiber materials can also be used that have a significantly smaller ecological footprint than carbon fibers.",True,0.1632242351770401,0.8886621741971761,15,22,-7,53,141,-88
"유리 섬유, 현무암 섬유, 석재 섬유, 강철 섬유 및 아마 섬유도 응용 분야에 따라 예로서 적합합니다.","Glass fibres, basalt fibres, stone fibres, steel fibers and flax fibers are also suitable as examples depending on the application.",True,0.1396614909172076,0.9050077204539516,16,20,-4,57,131,-74
그러나 기술적인 관점에서 탄소 섬유는 대부분의 다른 섬유와 달리 인장 강성이 훨씬 높기 때문에 특히 중요합니다.,"From a technical point of view, however, the carbon fiber is of particular importance because, in contrast to most other fibers, it has a significantly higher tensile stiffness.",True,0.1600589901208877,0.8975513101324979,16,28,-12,62,177,-115
이것은 특히 엄밀한 의미에서 섬유가 아니지만 미래에 보강재로 사용될 수 있는 그래핀 기반 구조에 적용됩니다.],"This applies in particular to graphene-based structures, which are not fibers in the strict sense, but can also be used as reinforcement in the future.",True,0.2122488468885421,0.8570686174161408,15,25,-10,61,151,-90
"[탄소 발자국을 더욱 줄이기 위한 또 다른 효과적인 척도는 조류 오일 이나 조류 또는 효모의 다른 식물성 오일, 즉 제지 생산에서 목재 폐기물, 또는 확장 된 피셔-트로슈 합성 및 수가스 시프트 반응을 사용하여 합성 생산 메탄올에서 탄소 섬유와 같은 지속 가능한 자원에서 탄소와 그래 핀의 생산입니다.","Another effective measure to further reduce the carbon footprint is the production of carbon and graphene from sustainable resources, for example from algae oil or other vegetable-based oils from algae or yeasts, carbon fibers from lignin, i.e. from wood waste from paper production, or carbon fibers from synthetically produced methanol using the extended Fischer-Tropsch synthesis and water-gas shift reaction.",True,0.2519794404506683,0.8309378282979152,46,59,-13,168,412,-244
그래 핀은 또한 전기 에너지를 사용하여 CO2에서 직접 얻을 수 있습니다.,Graphene can also be obtained directly from002using electrical energy.,False,0.2637083530426025,0.8092013242891315,11,9,2,41,70,-29
"이러한 경우, 건물 재료의 일부 - 장력 성 층이 탄소 섬유 또는 그래핀으로 구성된 경우 - 본질적으로 CO2 소스에서 유래하여 이전에 CO2 의 형태로 기후 손상 효과를 가졌던 탄소는 이제 섬유 내에서 영구적으로 결합되어 따라서 고체 형태로 건축 재료에 있습니다.","In these cases, a part of the building material - in the case that the tension-resistant layer consists of carbon fibers or graphene - essentially comes fromC02 sources, whereby the carbon, which previously had a climate-damaging effect in the formof C02, is now bound permanently within the fiber and thus also in the Building material in solid form.",True,0.2033497840166092,0.8837160762626269,40,58,-18,148,351,-203
이것은 탄소 섬유가 높은 인장 강도를 가진 물질로서 특히 중요한 이유 중 하나입니다.],This is one of the reasons why carbon fiber is particularly important as a material with high tensile 5/9 strength.,True,0.3401179313659668,0.781829065649736,13,20,-7,48,115,-67
"[본 발명의 많은 가능한 버전 중 하나는 도 1 및 도 2 CFS 플레이트(1)를 상부 화음으로 설명하고 제2기 안정화 CFS 플레이트(2)를 하부 화음으로, 각각 내부 탄소층(4)을 플레이트에 포함시키고, 각각 은 (3)을 플레이트에 수직으로 배열하여 CFS, (2)로 제작된다.","One of the many possible versions of the invention describes in Figure 1 and Figure 2 a CFS plate (1) as the upper chord and a second underlying stabilizing CFS plate (2) as the lower chord, each with an internal carbon layer (4) in the plates, with a web (3) arranged vertically to the plates (1) and (2) which is made of CFS, having also an internal carbon layer, which stiffens the overall arrangement.",False,0.1777694523334503,0.8901623592325096,37,74,-37,157,405,-248
"또한 내부 탄소 층을 갖는, 이는 전체 배열을 경화. 도면(1)은 패널이 접착제와 연동될 때 패널이 교차 패널 접착력을 보장하는 연동 구조를 가질 수 있도록 하는 모든 패널의 도베돌링 및 컷아웃(5)을 보여 줍니다.",Figure (1) shows the dovetailing and cutouts (5) of all panels which allow the panels to have interlocking structures which ensure cross-panel adhesion when the panels are interlocked with adhesives.,False,0.268133133649826,0.8258180511894117,32,30,2,120,199,-79
구성 요소의 최적화는 상부 코드보다 더 많은 돌 우발을 받고 상부 코드에 의해 달성되고 상부 코드보다 더 많은 탄소 우발. 같은 방법으로 탄소 발자국을 최적화할 수 있습니다.],The optimization of the components is achieved by the upper chord getting more stone contingent than the lower chord and the lower chord more carbon contingent than the upper chord.,False,0.3813375234603882,0.7363643785622179,27,30,-3,98,181,-83
"[도 3 및 4는 단면(F-F) 및 (G-G)에서 도 2의 구조를 나타내며, 이 두 플레이트(1)와 (2)는 CFS 플레이트(3)를 통해 도브테일의 도움으로 기계적으로 피팅된다.]","Figures 3 and 4 show the structure of Figure 2 in cross section (F-F) and (G-G), with which the two plates (1) and (2) are mechanically force fitting connected with the help of dovetails via the CFS plate (3).",True,0.1184766441583633,0.9243382026167724,22,39,-17,100,209,-109
[그림 5에서 8까지의 T 빔에 대해도 동일하게 표시됩니다.,The same is shown for a T-beam in Figures 5 to 8 as an example.,True,0.2071035057306289,0.8529733348249852,8,15,-7,33,63,-30
"두 디자인은 CFS 패널을 연결하여 가능한 모든 다른 구조물을 직각또는 각도및 힘에 맞추기 위해 접착된 가장자리 토브 e의 도움으로 연결되는 원리를 대표하며, 단면의 관점에서 볼 수 있는 높은 인장 강도를 가진 탄소 표면이 교차하거나 적어도 절단선에서 만나는 것을 알 수 있다.]",The two designs are representative of the principle of connecting the CFS panels with the help of dovetailing of the edges tob e glued together in order to also connect all possible other structures at right angles or at an angle and force-fitting by the fact that the carbon surfaces with high tensile strength viewed from the perspective of the cross section are in intersect or at least meet at a cutting line.,True,0.1783739179372787,0.8930452079704626,41,73,-32,156,413,-257
[본 발명의 실시형태는 공기 조화 장치 및 제어 방법에 관한 것이다.],[DESCRIPTION] [TITLE OF INVENTION] AIR CONDITIONER AND CONTROL METHOD [Technical Field] [0001] Embodiments of the present invention relate to an air conditioner and a control method.,False,0.2290421724319458,0.8717175855051333,11,26,-15,39,182,-143
"[종래, 2개의 실외 유닛을 갖추는 공기 조화 장치의 난방 운전중, 일방이 응축기로서 타방이 증발기로서 기능하도록 사방밸브를 전환함으로써 제상(除霜) 운전을 실현하는 기술이 있다.","[Background Art] [0002] Conventionally, a technique for realizing a defrosting operation by switching a four-way valve so that one outdoor unit functions as a condenser and the other outdoor unit functions as an evaporator during a heating operation of an air conditioner including two outdoor units is known.",False,0.2914349436759949,0.8520575451264476,22,48,-26,100,309,-209
"그러나 이러한 방법으로 실현되는 제상 운전으로는 제상의 대상이 되는 실외 유닛(이하 「제상 유닛」이라고 한다.) 옆의 압축기의 흡입 압력이 상승하기 때문에, 압축기가 고장날 가능성이 높아지는 경우가 있었다.]","However, in the defrosting operation realized by such a method, since the suction pressure of the compressor on the outdoor unit (hereinafter referred to as ""defrosting unit"") side to be defrosted increases, the likelihood that the compressor will break down may increase.",True,0.2708101868629455,0.8299272113078031,26,42,-16,116,272,-156
[본 발명이 해결하고자 하는 과제는 제상 운전에 의해서 압축기에 과도한 부하가 걸리는 것을 억제할 수 있는 공기 조화 장치 및 제어 방법을 제공하는 것이다.],"[Citation List] [Patent Literature] [0003] [Patent Document 1] Japanese Unexamined Patent Application, First Publication No. 2008-25901 [Summary of Invention] [Technical Problem] [0004] An object to be solved by the present invention is to provide an air conditioner 2 and a control method capable of inhibiting application of an excessive load to the compressor due to the defrosting operation.",False,0.4889383018016815,0.7166224573275255,24,58,-34,88,395,-307
[실시형태의 공기 조화 장치는 복수의 실외 유닛과 1개 이상의 실내 유닛과 제어부를 가진다.,"[Solution to Problem] [0005] An air conditioner of an embodiment includes a plurality of outdoor units, one or more indoor units, and a control unit.",False,0.1782384812831878,0.9047515787195676,13,25,-12,51,149,-98
"실외 유닛은 압축기, 사방밸브, 실외 열교환기, 실외 팽창밸브 및 실외 송풍기를 갖추고, 실외 공기와 냉매 사이에서의 열교환을 실시한다.","The outdoor unit includes a compressor, a four-way valve, an outdoor heat exchanger, an outdoor expansion valve and an outdoor blower, and the outdoor units exchange heat between the outside air and a refrigerant.",True,0.2047834247350692,0.8914656735525389,18,34,-16,76,213,-137
"실내 유닛은 상기 복수의 실내 유닛과 냉매 배관에 의해 접속되는 실내 유닛으로서, 실내 열교환기, 실내 팽창밸브 및 실내 송풍기를 갖추고, 실내 공기와 냉매 사이에서 열교환을 실시한다.","The indoor unit is an indoor unit connected to the plurality of indoor units by a refrigerant pipe, includes an indoor heat exchanger, an indoor expansion valve, and an indoor blower, and exchanges heat between the indoor air and the refrigerant.",True,0.1769092679023742,0.9064393942354452,26,41,-15,103,246,-143
제어부는 상기 복수의 실외 유닛 및 상기 1개 이상의 실내 유닛을 제어한다.,The control unit controls the plurality of outdoor units and the one or more indoor units.,True,0.1171310022473335,0.9243189833550108,12,16,-4,42,90,-48
"상기 제어부는 어느 하나의 실외 유닛이 제상 운전중인 경우, 난방 운전중인 다른 실외 유닛의 응축 압력, 또는 제상 운전중인 실외 유닛의 흡입 압력을 난방 운전시의 정격 최고 압력의 1/1.5배인 상한 압력 이하로 제어한다.]","The control unit controls the condensation pressure of the other outdoor unit in a heating operation and the suction pressure of the outdoor unit in a defrosting operation such that they are equal to or smaller than an upper limit pressure, which is 1/1.5 times the rated maximum pressure during the heating operation when any of the outdoor units is in the defrosting operation.",True,0.2604287564754486,0.857191636521073,33,64,-31,126,379,-253
[도 1은 제1 실시형태에서의 공기 조화 장치 구성의 구체적인 예를 나타내는 도면이다.,[Brief Description of Drawings] [0006] FIG. 1 is a diagram showing a specific example of the configuration of an air conditioner according to a first embodiment.,False,0.1860487163066864,0.8902097043490956,12,26,-14,48,161,-113
"도 2는 2개의 실외 유닛을 구비하는 공기 조화 장치의 일방의 실외 유닛이 난방 운전중이고, 타방의 실외 유닛이 제상 운전중인 경우의 각 실내 유닛의 흡입 압력 및 응축 압력의 구체적인 예를 나타내는 도면이다.",FIG. 2 a diagram showing a specific example of a suction pressure and condensation pressure of each indoor unit when one outdoor unit of an air conditioner including two outdoor units is in a heating operation and the other outdoor unit is in a defrosting operation.,True,0.2061687558889389,0.9047413988286486,32,46,-14,117,266,-149
도 3은 제1 실시형태의 공기 조화 장치가 실시하는 응축 압력 제어 처리의 흐름의 구체적인 예를 나타내는 제1 흐름도이다.,3 FIG. 3 is a first flowchart showing a specific example of the flow of a condensation pressure control process performed by the air conditioner of the first embodiment.,True,0.1237896233797073,0.9319703469202772,18,29,-11,68,169,-101
도 4는 제1 실시형태의 공기 조화 장치가 실시하는 응축 압력 제어 처리의 흐름의 구체적인 예를 나타내는 제2 흐름도이다.],FIG. 4 is a second flowchart showing a specific example of the flow of the condensation pressure control process performed by the air conditioner of the first embodiment.,True,0.1062984466552734,0.9412260251561892,18,28,-10,69,170,-101
"[이하, 실시형태의 공기 조화 장치 및 제어 방법을 도면을 참조하여 설명한다.]","[Description of Embodiments] [0007] Hereinafter, an air conditioner and a control method of the embodiment will be described with reference to the drawings.",False,0.2161103338003158,0.8641868902018845,11,23,-12,44,156,-112
[도 1은 제1 실시형태에서의 공기 조화 장치(1)의 구성의 구체적인 예를 나타내는 도면이다.,[0008] (First Embodiment) FIG. 1 is a diagram showing a specific example of the configuration of an air conditioner 1 according to the first embodiment.,False,0.1600676625967025,0.9105601393955928,12,25,-13,52,152,-100
"공기 조화 장치(1)는 제1 실외 유닛(2A), 제2 실외 유닛(2B), 제1 실내 유닛(3A), 제2 실내 유닛(3B) 및 제3 실내 유닛(3C)을 갖춘다.","The air conditioner 1 includes a first outdoor unit 2A, a second outdoor unit 2B, a first indoor unit 3A, a second indoor unit 3B, and a third indoor unit 3C.",True,0.1124181300401687,0.942305217784634,20,31,-11,88,158,-70
"이하, 특별히 구별하지 않는 경우, 제1 실외 유닛(2A) 및 제2 실외 유닛(2B)을 실외 유닛(2)로 기재한다.","Unless otherwise specified below, the first outdoor unit 2A and the second outdoor unit 2B are referred to as the outdoor unit 2.",True,0.1159346550703048,0.9320760214507908,15,23,-8,64,129,-65
"다만, 제1 실외 유닛(2A) 및 제2 실외 유닛(2B)이 갖추는 각 기능부를 구별할 필요가 있는 경우에는, 기능부를 나타내는 부호의 숫자에 “A” 또는 “B”를 부가함으로써 실외 유닛(2)와 같은 구별을 하는 것으로 한다.","However, when it is necessary to distinguish the functional units included in the first outdoor unit 2A and the second outdoor unit 2B, the outdoor units 2 are similarly distinguished by adding ""A"" or ""B"" to the number of the reference sign representing the functional units.",True,0.1026892513036727,0.939227257706738,30,46,-16,125,275,-150
"마찬가지로, 이하, 특별히 구별하지 않는 경우, 제1 실내 유닛(3A), 제2 실내 유닛(3B), 및 제3 실내 유닛(3C)을 실내 유닛(3)으로 기재한다.","Similarly, unless otherwise specified below, the first indoor unit 3A, the second indoor unit 3B, and the third indoor unit 3C are referred to as the indoor unit 3.",True,0.0922746062278747,0.9446460302271532,19,29,-10,87,164,-77
"다만, 제1 실내 유닛(3A), 제2 실내 유닛(3B), 및 제3 실내 유닛(3C)이 갖추는 각 기능부를 구별할 필요가 있는 경우에는, 기능부를 나타내는 부호의 숫자에 “A”“B” 또는 “C”를 부가함으로써 실내 유닛(3)과 같은 구별을 하는 것으로 한다.]","However, when it is necessary to distinguish the functional units included in the first indoor unit 3A, the second indoor unit 3B, and the third indoor unit 3C, the indoor units 3 are similarly distinguished by adding ""A, "" ""B, "" or ""C"" to the number of the reference sign 4 representing the functional unit.",True,0.1100382134318351,0.9305708635462288,33,55,-22,144,308,-164
"[실외 유닛(2)은 실외 공기(이하 「외기」라고 한다.)를 받아들이고, 받아들인 외기와 냉매의 사이에서의 열교환을 실시한다.","[0009] The outdoor unit 2 takes in outdoor air (hereinafter referred to as ""outside air"") and exchanges heat between the taken-in outside air and the refrigerant.",True,0.1698033213615417,0.9184054412327576,13,26,-13,69,162,-93
"마찬가지로, 실내 유닛(3)은 실내 공기(이하 「내기」라고 한다.)를 받아들이고, 받아들인 내기와 냉매의 사이에서의 열교환을 실시한다.]","Similarly, the indoor unit 3 takes in indoor air (hereinafter referred to as ""inside air"") and exchanges heat between the taken-in inside air and the refrigerant.",True,0.1191190704703331,0.939761084855202,14,26,-12,76,162,-86
"[구체적으로는, 실외 유닛(2)은 실외 열교환기(21), 사방밸브(22), 압축기(23), 실외 팽창밸브(24), 실외 송풍기(25) 및 제어부(4)를 갖춘다.","[0010] Specifically, the outdoor unit 2 includes an outdoor heat exchanger 21, a four-way valve 22, a compressor 23, an outdoor expansion valve 24, an outdoor blower 25, and a control unit 4.",True,0.1259988695383072,0.9411316407407552,14,33,-19,89,191,-102
실외 열교환기(21)는 실내 유닛(3)으로부터 공급되는 냉매와 외기 사이의 열교환을 실시한다.,The outdoor heat exchanger 21 exchanges heat between the refrigerant supplied from the indoor unit 3 and the outside air.,True,0.1609392464160919,0.9211904299803508,10,20,-10,52,121,-69
"예를 들면, 실외 열교환기(21)는 핀 튜브식 열교환기이다.","For example, the outdoor heat exchanger 21 is a finned tube type heat exchanger.",True,0.1611208170652389,0.915433415543784,7,14,-7,33,80,-47
"예를 들면, 도 1은 제1 실외 유닛(2A)이 난방 운전중인 상태를 나타낸다.","For example, FIG. 1 shows a state in which the first outdoor unit 2A is in a heating operation.",True,0.1370632797479629,0.928295305481671,11,19,-8,43,95,-52
"이 경우, 제1 실외 유닛(2A)의 실외 열교환기(21A)는 외기로부터 냉매로 열을 받아들여서 냉매를 기화시키는 증발기로서 기능한다.","In this case, the outdoor heat exchanger 21A of the first outdoor unit 2A functions as an evaporator that takes heat from the outside air into the refrigerant and vaporizes the refrigerant.",True,0.1297211796045303,0.940089904607943,15,32,-17,74,189,-115
"한편, 도 1은 제2 실외 유닛(2B)이 제상 운전중인 상태를 나타낸다.","On the other hand, FIG. 1 shows a state in which the second outdoor unit 2B is in a defrosting operation.",True,0.2231800109148025,0.8712264865230832,10,21,-11,40,105,-65
"이 경우, 제2 실외 유닛(2B)의 실외 열교환기(21B)는 제1 실외 유닛으로부터 공급되는 고온의 냉매에 의해서 실외 열교환기(21B)에 부착한 서리를 융해시켜서 제거하는 응축기로서 기능한다.]","In this case, the outdoor heat exchanger 21B of the second outdoor unit 2B functions as a condenser that melts and removes the frost adhering to the outdoor heat exchanger 21B by the high-temperature refrigerant supplied from the first outdoor unit.",True,0.1430490911006927,0.934297819337544,22,41,-19,109,249,-140
[사방밸브(22)는 공기 조화 장치(1)의 내부에서 냉매를 순환시키는 방향을 난방 운전용 방향과 제상 운전용 방향(냉방 운전용 방향과 같다)의 어느 한 쪽으로 전환하는 장치이다.,[0011] The four-way valve 22 is a device that switches the direction in which the refrigerant is circulated inside the air conditioner 1 to either the direction for the heating operation or the direction for the defrosting operation (same as the direction for a cooling operation).,True,0.1923996657133102,0.9048823847953664,22,46,-24,99,281,-182
사방밸브(22)는 제어부(4)의 지시에 따라서 냉매의 순환 방향을 전환한다.,The four-way valve 22 switches the circulation direction of the refrigerant according to the instruction of the control unit 4.,True,0.1261284202337265,0.9187729740462512,8,20,-12,42,127,-85
"예를 들면, 도 1은 사방밸브(22A)에 의해서 냉매의 순환 방향이 난방 운전용 방향으로 전환된 상태를 나타낸다.","For example, FIG. 1 shows a state in which the circulation direction of the refrigerant is switched to the direction for the heating operation by the four-way valve 22A.",True,0.1830992996692657,0.8999810848759161,15,29,-14,63,169,-106
"이 경우, 사방밸브(22A)는 실외 열교환기(21A)를 압축기(23A)의 흡입측(어큐뮬레이터(261A))에 접속하는 동시에, 압축기(23A)의 토출측(오일 분리기(262A))을 가스관 접속부(263A)에 접속한다.","In this case, the four-way valve 22A connects the outdoor heat exchanger 21A to the suction side (accumulator 261A) of the compressor 23A, and connects the discharge side (oil separator 262A) of the compressor 23A to a gas pipe connection portion 263A.",True,0.1180040389299392,0.940426151839344,15,42,-27,119,252,-133
"한편, 도 1은 사방밸브(22B)에 의해서 냉매의 순환 방향이 제상 운전용 방향으로 전환된 상태를 나타낸다.","On the other hand, FIG. 1 shows a state in which the circulation direction of the refrigerant is switched to the direction for the defrosting operation by the four-way valve 22B.",True,0.1865644752979278,0.8887743047559329,14,31,-17,60,178,-118
"이 경우, 사방밸브(22B)는 압축기(23B)의 토출측(오일 분리기(262B))을 실외 열교환기(21B)에 접속하는 동시에, 가스관 접속부(263B)를 압축기(23B)의 흡입측(어큐뮬레이터(261B))에 접속한다.]","In this case, the four-way valve 22B connects the discharge side (oil separator 262B) of the compressor 23B to the outdoor heat exchanger 21B, and connects the gas pipe connection portion 263B to the suction side (accumulator 261B) of the compressor 23B.",True,0.1508126407861709,0.9242881887433336,15,42,-27,120,254,-134
[압축기(23)는 자신에게 공급되는 냉매를 압축하여 내보내는 장치이다.,[0012] The compressor 23 is a device that compresses and sends out the refrigerant supplied thereto.,True,0.2212272584438324,0.8742278625227168,7,16,-9,39,100,-61
"구체적으로, 압축기(23)는 흡입 컵(265)을 통해서 냉매를 흡입하여 압축하고, 압축한 냉매를 토출하여 오일 분리기(262)를 통해서 실내 유닛(3)으로 내보낸다.]","Specifically, the compressor 23 sucks the refrigerant through a suction cup 265, compresses the refrigerant, discharges the compressed refrigerant, and sends the compressed refrigerant to the indoor unit 3 through the oil separator 262.",True,0.1790882498025894,0.9056563792101752,17,34,-17,93,236,-143
[실외 팽창밸브(24)는 냉매를 감압하는 장치이다.,[0013] The outdoor expansion valve 24 is a device for decompressing the refrigerant.,True,0.220731034874916,0.8796880836936869,5,13,-8,28,84,-56
"예를 들면, 실외 팽창밸브(24)는 전자 팽창밸브(PMV: Pulse Motor Valve)이고, 그 개도(開度)가 전기적 조작에 의해 변경 가능한 밸브 장치이다.","For example, the outdoor expansion valve 24 is an electronic expansion valve (PMV: Pulse Motor Valve), which is a valve device whose opening degree can be changed by an electrical operation.",True,0.1174717023968696,0.936746305509554,18,31,-13,91,190,-99
"예를 들면, 도 1은 난방 운전중인 제1 실외 유닛(2A)에 있어서, 실외 팽창밸브(24A)가 실내 유닛(3)으로부터 보내어지는 냉매를 감압하여, 저온화한 냉매를 실외 열교환기(21A)에 공급하는 상태를 나타낸다.","For example, FIG. 1 shows a state in which the outdoor expansion valve 24A in the first outdoor unit 2A during the heating operation decompresses the refrigerant sent from the indoor unit 3 and supplies the cooled refrigerant to the outdoor heat exchanger 21A.",True,0.1772049069404602,0.9244864389657036,24,44,-20,119,260,-141
"한편, 도 1은 제상 운전중인 제2 실외 유닛(2B)에 있어서, 실외 팽창밸브(24B)가 실외 열교환기(21B)로부터 보내어지는 냉매를 감압하여, 저온화한 냉매를 제1 실외 유닛(2A)에 공급하는 상황을 나타낸다.","On the other hand, FIG. 1 shows a state in which the outdoor expansion valve 24B in the second outdoor unit 2B during the defrosting operation depressurizes the refrigerant sent from the outdoor heat exchanger 21B, and supplies the 6 cooled refrigerant to the first outdoor unit 2A.",True,0.1574966311454773,0.9312400212551436,24,48,-24,119,282,-163
저온화한 냉매는 제1 실외 유닛(2A)에 있어서 고온화되어 다시 제2 실외 유닛(2B)으로 공급된다.],The cooled refrigerant is heated in the first outdoor unit 2A and supplied to the second outdoor unit 2B again.,True,0.1325714290142059,0.9290637269092814,12,20,-8,57,111,-54
[실외 송풍기(25)는 실외 열교환기(21)에 대해서 외기를 강제로 내보냄으로써 실외 열교환기(21)에서의 냉매와 외기의 열교환을 촉진하는 장치이다.,[0014] The outdoor blower 25 is a device that promotes heat exchange between the refrigerant and the outside air in the outdoor heat exchanger 21 by forcibly sending out the outside air to the outdoor heat exchanger 21.,True,0.1572566777467727,0.9277539545388708,15,38,-23,83,219,-136
"예를 들면, 실외 송풍기(25)는 프로펠러 팬을 갖추고 있다.","For example, the outdoor blower 25 includes a propeller fan.",True,0.1481465250253677,0.9182031330563084,8,10,-2,34,60,-26
실외 송풍기(25)의 팬은 실외 열교환기(21)에 대향하도록 배치되어 있다.],The fan of the outdoor blower 25 is arranged so as to face the outdoor heat exchanger 21.,True,0.2250644564628601,0.8791366647200582,8,18,-10,43,89,-46
"[또한, 실내 유닛(3)은 실내 열교환기(31) 및 실내 팽창밸브(32)를 갖춘다.",[0015] The indoor unit 3 includes an indoor heat exchanger 31 and an indoor expansion valve 32.,True,0.2051314562559127,0.896266647647919,9,17,-8,46,95,-49
"가압 분석용 구조체, X선 회절 장치 및 가압 분석 시스템{STRUCTURE FOR PRESSURIZATION ANALYSIS, X-RAY DIFFRACTION APPARATUS AND PRESSURIZATION ANALYSIS SYSTEM}",FIELD OF THE INVENTION,False,1.1105579137802124,0.2304695184915102,20,4,16,135,22,113
"[본 발명은, 가압 하에 있는 시료의 분석 평가에 이용되고, 특히 전고체 전지의 분석 평가에 호적한 가압 분석용 구조체, X선 회절 장치 및 가압 분석 시스템에 관한 것이다.]","The present invention relates to a structure for pressurization analysis, an X-ray diffraction apparatus and a pressurization analysis system that are used for analysis and evaluation of a sample under pressurization, and are particularly suitable for analysis and evaluation of an all-solid-state battery.",True,0.262155532836914,0.8591317986814038,27,43,-16,98,306,-208
"[전고체 전지는, 전해질 층의 양단 측에 전극 활물질 층을 가지는 구성으로 되어 있고, 충방전 사이클 시에 용량 열화(劣化)나 저항 상승을 야기한다.","An all-solid-state battery is configured to have electrode active material layers on both end sides of an electrolyte layer, which causes capacity deterioration and resistance increase during a charging and discharging cycle.",True,0.3496990501880646,0.7706174456908993,21,32,-11,83,225,-142
"예를 들면, 전고체 리튬 이온 전지에서는 리튬 이온(Li)의 삽입·이탈에 수반하여, 결정 구조에 변화를 일으키기 쉽다.","For example, in an all-solid-state lithium-ion battery, the crystal structure is likely to change with insertion and removal of lithium ions (Li).",True,0.2292957752943039,0.8362905921498877,15,22,-7,66,146,-80
"그 때문에, 열화 기구의 해명에 있어서, 충방전에 수반하는 결정 구조의 변화를 X선 회절 측정에 의해 평가하는 것이 행해지고 있다.]","Therefore, in order to elucidate the deterioration mechanism, changes in the crystal structure due to charging and discharging are evaluated by X-ray diffraction measurement.",True,0.3600976169109344,0.7516017634921399,19,24,-5,74,174,-100
"[일본공개특허 특개2012－159311호 공보(특허문헌 1) 및 일본공개특허 특개2017－72530호 공보(특허문헌 2)에는, X선 회절 측정에 의한 시료 전지의 평가에 이용되는, 종래의 전지 분석용 구조체(가압 분석용 구조체)가 개시되어 있다.]",Japanese Patent Laid-Open No. 2012-159311 (hereinafter referred to as Patent Literature 1) and Japanese Patent Laid-Open No. 2017-72530 (hereinafter referred to as Patent Literature 2) disclose conventional structures for battery analysis (structures for pressurization analysis) which are used for evaluation of sample batteries by X-ray diffraction measurement.,True,0.2731362283229828,0.841587696916703,25,47,-22,138,363,-225
"[특허문헌 1에 개시된 X선 측정용 전지 구조체는, 전지 요소(2)를 부극측 커버(5a)와 정극측 커버(5b) 사이에 끼워넣고, 대부분의 너트(22)를 사용해서 이들 각 커버(5a, 5b)를 조여서 전지 요소(2)를 밀봉하여, 대기와 차단하는 구성을 구비하고 있다.","A battery structure for X-ray measurement disclosed in Patent Literature 1 is configured so that a battery element (2) is interposed between a negative electrode side cover (5a) and a positive electrode side cover (5b), and these covers (5a, 5b) are tightened by using many nuts (22) to hermetically seal the battery element (2), thereby shielding the battery structure for X-ray measurement from the atmosphere.",True,0.2976924777030945,0.8371490057442789,31,65,-34,148,412,-264
"또한, 너트(22)에 의한 조임 구조는, 전지 요소(2)의 기밀성을 확보하기 위한 것이다(상기 특허문헌 1의 명세서 단락 「0020」참조).]","Here, the tightening structure using the nuts (22) is used to ensure the airtightness of the battery element (2) (see paragraph ""0020"" in the specification of Patent Literature 1).",True,0.2990556359291076,0.7976625663069533,16,29,-13,79,180,-101
"[또, 특허문헌 2에 개시된 분석용 셀은, 제1 부재(11), 제2 부재(21), 제3 부재(31)를 포함하는 케이싱(筐體)(10)을 구비하고 있고, 이 케이싱(10) 내에 시료 전지(100)를 수용해서, X선 회절 측정에 의해 평가를 행하는 구성을 구비하고 있다.","Further, an analysis cell disclosed in Patent Literature 2 is configured to include a housing (10) having a first member (11), a second member (21), and a third member (31), and accommodate a sample battery (100) in the housing (10) to perform evaluation by X-ray diffraction measurement.",True,0.1523871570825576,0.9135972668326012,31,47,-16,148,288,-140
"케이싱(10)을 구성하는 각 부재(11, 21, 31)는, 그들 각 부재에 마련된 다수의 관통 구멍(12, 22, 32)에 볼트를 삽입하고, 너트로 조임으로써 조립된다(상기 특허문헌 2의 명세서 단락 「0053」참조).]","The respective members (11, 21, 31) constituting the housing (10) are assembled by inserting bolts into a large number of through-holes (12, 22, 32) formed in the respective members and tightening the bolts with nuts (see paragraph ""0053"" in the specification of Patent Literature 2).",True,0.1801125854253769,0.8779687054733627,25,45,-20,123,284,-161
"[여기서, 괄호 안의 부호는, 각 특허문헌에 있어서, 각각 각 구성요소에 부가되어 있던 것이다(이하, 마찬가지).]","Here, reference numerals in parentheses are those assigned to the respective components in each Patent Literature (hereinafter, the same applies).",True,0.2307706326246261,0.8362443672927881,14,20,-6,64,146,-82
"[그런데, 전고체 전지에서는, 전해질 층에 고체의 전해질이 이용되고 있다.","In all-solid-state batteries, a solid electrolyte is used for an electrolyte layer.",True,0.5922587513923645,0.5277382669474301,9,12,-3,41,83,-42
"전고체 전지의 내부에서는, 충방전에 수반하여, 각 요소로 되는 전극 활물질 층, 고체 전해질 층, 도전재 등이 팽창 수축하여, 입자 간의 공극이나 고체 전해질 층과 전극 활물질 층의 계면의 박리, 또는 내부 크랙 등의 현상이 생기기 쉽고, 이들 현상이 생긴 경우에 전지로서 정상적으로 기능하지 않게 되어 버린다.","Inside the all-solid-state battery, an electrode active material layer, a solid electrolyte layer, a conductive material, etc. which are components of the all-solid-state battery expand and contract due to charging and discharging, and phenomena such as voids between particles, exfoliation of the interface between the solid electrolyte layer and the electrode active material layer or internal cracks are likely to occur, and if these phenomena occur, the battery would not function normally.",True,0.240153819322586,0.852325272903425,46,72,-26,174,494,-320
"그래서, 이런 종류의 전고체 전지를 시료 전지로 해서 분석 평가를 실시하는 경우에는, 시료 전지를 균일한 가압 상태로 유지하여, 도전 패스의 확보나 충방전에 수반하는 팽창 수축을 억제할 필요가 있다.]","Therefore, when analysis and evaluation are performed on this type of all-solid-state battery as a sample battery, it is necessary to hold the sample battery in a uniform pressurized state so that a conductive path is secured and expansion and contraction caused by charging and discharging are suppressed.",True,0.3194630444049835,0.7983789227849809,28,48,-20,112,306,-194
"[그렇지만, 상술한 특허문헌 1 및 2에 개시된 종래의 전지 분석용 구조체(분석용 셀)는, 어느 것이나(모두) 시료 전지를 균일한 가압 상태로 유지해서, 도전 패스의 확보나 충방전에 수반하는 시료 전지의 팽창 수축을 억제할 수 있는 구성을 구비하고 있지 않다.]","However, all of the conventional structures for battery analysis (analysis cells) disclosed in Patent Literatures 1 and 2 described above do not have any configuration for holding sample batteries in a uniform pressurized state to secure a conductive path and suppress the expansion and contraction of the sample batteries caused by charging and discharging.",True,0.226994052529335,0.8694285258052983,36,54,-18,146,358,-212
"[덧붙여서, 특허문헌 1에 개시된 너트(22)에 의한 조임 구조는, 전지 요소(2)의 기밀성을 확보하기 위한 것이고, 게다가 탄성 부재(4a, 4b)가 개재되기 때문에, 너트(22)를 조여도, 도전 패스의 확보나 팽창 수축을 억제할 수 있을 정도의 큰 압력을 시료 전지에 균일하게 작용시킬 수가 없다.]","Incidentally, the tightening structure using the nuts (22) disclosed in Patent Literature 1 is used to ensure the airtightness of the battery element (2), and also elastic members (4a, 4b) are interposed, so that it is impossible to uniformly apply a large pressure to the sample battery to the extent that the conductive path can be secured and the expansion and contraction can be suppressed even when the nuts (22) are tightened.",True,0.2210128754377365,0.8662684136737794,39,72,-33,169,432,-263
"[또, 특허문헌 2에는, 누름봉으로 구성된 가압 기구(46)가 개시되어 있지만, 이 가압 기구(46)는, 시료 전지의 요소인 전극 활물질(112), 시료 전극(110) 및 창부재(51)의 일부를, 케이싱(10)의 창부(13)로부터 돌출시키기 위한 것이다(상기 특허문헌 2의 명세서 단락 「0042」와 도 3 참조).]","Further, Patent Literature 2 discloses a pressurizing mechanism (46) including a pushing rod, and the pressurizing mechanism (46) is used to protrude, from a window portion (13) of the housing (10), an electrode active material (112), the sample electrode (110) and a part of a window member (51) which are components of a sample battery (see paragraph ""0042"" in the specification and FIG. 3 of Patent Literature 2).",True,0.1893309205770492,0.8961519528755385,35,68,-33,177,416,-239
"[이와 같이 전극 활물질(112), 시료 전극(110) 및 창부재(51)의 일부를, 케이싱(10)의 창부(13)로부터 돌출시킴으로써, 전극 활물질(112)과 시료 전극(110) 주위를 창부재(51)에 의해 피복하여, 시료 전극(110)과 창부재(51) 사이로의 전해액의 침입 방지와 시료 전지의 밀폐성 향상이 도모된다(상기 특허문헌 2의 명세서 단락 「0054」 참조).]","By protruding the electrode active material (112), the sample electrode (110), and the part of the window member (51) from the window portion (13) of the housing (10) as described above, the peripheries of the electrode active material (112) and the sample electrode (110) are covered by the window member (51) to prevent an electrolytic solution from infiltrating in between the sample electrode (110) and the window member (51) and improve the airtightness of the sample battery (see paragraph ""0054"" in the specification of Patent Literature 2).",True,0.2118878364562988,0.8757481503119077,38,87,-49,208,548,-340
"[그렇지만, 상기 특허문헌 2의 가압 기구(46)에서는, 누름봉과 대향하는 측에 누름봉의 압압력(押壓力)을 받는 부재가 배치되어 있지 않아, 창부재(51)가 잡아 늘여지면서 그 압압력을 받는 구조로 되어 있으므로, 이러한 가압 기구(46)에 의해서도, 도전 패스의 확보나 팽창 수축을 억제할 수 있을 정도의 큰 압력을 시료 전지에 균일하게 작용시킬 수가 없다.]","However, the pressurizing mechanism (46) of Patent Literature 2 is configured so that a member for receiving the pressing force of the pushing rod is not arranged on a side facing the pushing rod, and thus the window member (51) receives the pressing force while being stretched.",False,0.2683047652244568,0.8469521846797108,46,47,-1,202,279,-77
"[본 발명은, 상술한 사정을 감안해서 이루어진 것으로서, 큰 압력으로 시료를 균일하게 가압한 상태에서의 분석 평가의 실현을 목적으로 한다.]","The present invention has been made in view of the above-described circumstances, and has an object to implement analysis and evaluation under a state where a sample is uniformly pressurized with a large pressure.",True,0.2493375986814499,0.8376162218462092,18,34,-16,78,213,-135
"[또한, 본 발명은, 전고체 전지의 분석에 한정되지 않고, 각종 시료에 대한 가압된 상태에서의 분석 평가에 적용할 수가 있다.]","The present invention is not limited to analysis of an all-solid-state battery, and can be applied to analysis and evaluation of various types of samples under a pressurized state.",True,0.3412942886352539,0.7841485084757644,18,29,-11,71,180,-109
"[본 발명에 관계된 가압 분석용 구조체는, 시료를 수용해서 배치하기 위한 시료실이 내부에 형성된 시료 수용 유닛과, 시료 수용 유닛에 장착되어, 시료실 내의 시료에 압력을 작용시키기 위한 가압 기구를 포함하는 가압 유닛을 구비하고 있다.",A structure for pressurization analysis according to the present invention comprises: a sample accommodating unit in which a sample chamber for accommodating and placing a sample therein is formed; and a pressurizing unit that is mounted on the sample accommodating unit and includes a pressurizing mechanism for causing pressure to act on the sample in the sample chamber.,True,0.24638631939888,0.879000902569694,33,58,-25,132,373,-241
"시료 수용 유닛은, 가압 유닛으로부터의 압력을 시료실 내의 시료를 사이에 두는 대향 위치에서 받는 압력받이부(壓受部)와, 가압 유닛으로부터의 압력의 작용 방향과 교차하는 방향에 마련한 X선 창을 가지고 있다.","The sample accommodating unit includes a pressure receiving portion for receiving pressure from the pressurizing unit at a position opposite to the pressurizing unit with respect to the sample in the sample chamber, and an X-ray window provided in a direction intersecting an acting direction of the pressure from the pressurizing unit.",True,0.1635819673538208,0.908260356826698,27,52,-25,116,336,-220
"그리고, X선을 X선 창으로부터 받아들여서(취입해서) 시료실 내의 시료에 조사함과 함께, 시료로부터 반사되어 오는 회절 X선을 상기 X선 창으로부터 외부로 출사하는 구성으로 되어 있다.]","The sample accommodating unit is configured to receive X-rays through the X-ray window to irradiate the sample in the sample chamber with the X-rays, and emit diffracted X-rays reflected from the sample to an outside of the sample accommodating unit from the X-ray window.",True,0.2490862011909485,0.85170127369495,23,44,-21,104,272,-168
"[여기서, 시료 수용 유닛은, 일단면이 개구된 바닥 있는(유저) 실린더의 수용 유닛 본체를 구비하고, 수용 유닛 본체의 내부에 시료실이 형성되고, 수용 유닛 본체의 개구된 일단면 측으로부터 시료실 내의 시료를 향해 가압 유닛의 압력을 받음과 함께, 상기 개구된 일단면과 대향하는 안바닥부에 압력받이부를 형성한 구성으로 할 수가 있다.]","Here, the sample accommodating unit may include a bottomed cylindrical accommodating unit main body having opened one end surface and may be configured so that the sample chamber is formed inside the accommodating unit main body, and the pressure receiving portion receives the pressure of the pressurizing unit in a direction from an opened one end surface side of the accommodating unit main body to the sample in the sample chamber, and is formed at an inner bottom portion opposite to the opened one end surface.",True,0.2571417987346649,0.8672777602677777,45,86,-41,187,516,-329
"[또, 수용 유닛 본체의 외주면을 향해 X선 창을 마련하고, 또한 X선을 투과하는 재료로 형성된 밀폐 부재에 의해 상기 X선 창을 폐색한 구성으로 할 수가 있다.]","Further, the X-ray window may be provided to face an outer peripheral surface of the accommodating unit main body, and the X-ray window may be blocked by a hermetically sealing member formed of a material through which X-rays are transmitted.",True,0.314640611410141,0.8169821874165553,25,40,-15,91,242,-151
"[또, 수용 유닛 본체의 외주면으로부터 내부로 관통하는 단차 있는(계단식) 절결홈을 형성함과 함께, 그 절결홈의 단차부로부터 외주면까지의 공간의 개구 폭을, 상기 단차부로부터 내부까지의 공간의 개구 폭보다도 넓게 형성하고, 상기 단차부에 X선 창을 마련한 구성으로 할 수가 있다.]","Further, the structure for pressurization analysis may be configured so that a stepped cutout groove is formed so as to penetrate from the outer peripheral surface of the accommodating unit main body to an inside of the accommodating unit main body, the stepped cutout groove may be configured so that an opening width of a space extending from a step portion of the cutout groove to the outer peripheral surface is larger than an opening width of a space extending from the step portion to the inside, and the X-ray window may be provided at the step portion.",True,0.3564909994602203,0.7941581433851481,36,98,-62,157,560,-403
"[또, 시료 수용 유닛은, 시료실 내에 배치된 시료의 온도를 조정하기 위한 온도 조정 부재와, 상기 시료의 온도를 측정하기 위한 온도 측정 부재를 포함하는 구성으로 할 수도 있다.]","The sample accommodating unit may be configured to include a temperature adjusting member for adjusting the temperature of the sample placed in the sample chamber, and a temperature measuring member for measuring the temperature of the sample.",True,0.2445404678583145,0.8628679701536984,27,37,-10,101,243,-142
"[또, 본 발명에 관계된 가압 분석용 구조체는, 축방향으로 복수의 요소를 적층해서 구성되는 시료를 분석 대상으로 해서, 다음과 같이 구성할 수도 있다.]","Further, the structure for pressurization analysis according to the present invention may be configured as follows by applying a sample including a plurality of laminated components in the axial direction as an analysis target.",True,0.2849088609218597,0.8316821340585571,21,34,-13,85,227,-142
"[즉, 시료 수용 유닛의 내부에 끼워넣어서 장착하는 시료 홀더를 구비하고, 시료 홀더에는, 시료를 수용함과 함께, 그 시료에 있어서의 복수의 요소의 적층 상태를 관찰할 수 있는 외면을 X선 창에 대해서 노출시키는 절결부를 형성한다.]","The structure for pressurization analysis may further comprise a sample holder to be fitted and mounted in the sample accommodating unit, and the sample holder accommodates the sample therein, and is provided with a cutout portion through which an outer peripheral surface of the sample for enabling observation of a lamination state of the plurality of components of the sample is exposed to the X-ray window.",True,0.4799664318561554,0.7442257343620976,32,66,-34,130,410,-280
"[여기서, 한쪽 단면이 시료 배치부에 배치된 시료의 일단면과 접촉하고, 또한 다른쪽 단면이 압력받이부와 접촉하는 압력받이 부재를, 시료실 내에 가지는 구성으로 하는 것이 바람직하다.]","Here, the structure for pressurization analysis preferably further comprises a pressure receiving member that is provided in the sample chamber and configured so that one end surface thereof is in contact with one end surface of the sample placed in a sample placing portion, and the other end surface thereof is in contact with the pressure receiving portion.",True,0.3751944899559021,0.8064937590166301,23,58,-35,102,360,-258
"[또, 본 발명에 관계된 가압 분석용 구조체는, 전해질 층의 양단 측에 전극 활물질 층이 배치되고, 또 각 전극 활물질 층의 외측에 각각 집전체 층이 배치된 전고체 전지를 시료로 하는 경우는, 다음의 구성을 도입하는 것이 바람직하다.]","When the sample is an all-solid-state battery including an electrolyte layer, electrode active material layers arranged at both end sides of the electrolyte layer, and current collector layers arranged outside the electrode active material layers respectively, it is preferable that the structure for pressurization analysis according to the present invention adopts the following configuration.",True,0.3203913569450378,0.8390707292531941,35,54,-19,131,395,-264
"[즉, 한쪽 집전체 층과 전기적으로 도통되는 제1 전극 단자와, 다른쪽 집전체 층과 전기적으로 도통되는 제2 전극 단자를 구비한 구성으로 한다.]","The structure for pressurization analysis is configured to further comprise a first electrode terminal in electrical communication with one of the current collector layers, and a second electrode terminal in electrical communication with the other current collector layer.",True,0.4521026909351349,0.7361147287162766,20,38,-18,81,272,-191
"[여기서, 제1 전극 단자는, 시료 수용 유닛의 외부에 마련함과 함께, 시료 수용 유닛은, 도전성을 가지는 구성요소를 포함하고, 그 도전성을 가지는 구성요소를 거쳐 한쪽 집전체 층과 제1 전극 단자를 전기적으로 도통시킬 수가 있다.]","Here, the first electrode terminal may be provided outside the sample accommodating unit, the sample accommodating unit may include a component having electrical conductivity, and the one current collector layer and the first electrode terminal may be in electrical communication with each other via the component having electrical conductivity.",True,0.3207069337368011,0.8268488202603156,32,49,-17,130,345,-215
"[또, 가압 기구는, 도전성을 가지는 금속 부재로 구성하고, 그 가압 기구를 거쳐 다른쪽 집전체 층과 제2 전극 단자를 전기적으로 도통시킬 수가 있다.]","Further, the pressurizing mechanism may be formed of a metal member having electrical conductivity, and the other current collector layer and the second electrode terminal may be in electrical communication with each other via the pressurizing mechanism.",True,0.323051244020462,0.8101981985948761,22,37,-15,85,254,-169
"[다음에, 본 발명에 관계된 X선 회절 장치는, 상술한 구성의 가압 분석용 구조체와, 그 가압 분석용 구조체를 배치하기 위한 시료 스테이지와, 시료실 내의 시료를 향해 X선을 조사하기 위한 X선원과, 상기 시료로부터 반사되어 온 회절 X선을 검출하는 X선 검출기를 포함하고 있다.]","Next, an X-ray diffraction apparatus according to the present invention comprises: the structure for pressurization analysis having the above-described configuration; a sample stage for arranging the structure for pressurization analysis thereon; an X-ray source for applying X-rays to a sample in the sample chamber; and an X-ray detector for detecting diffracted X-rays reflected from the sample.",True,0.2202019989490509,0.8931634082776195,39,56,-17,157,398,-241
"[또, 시료 스테이지는, 시료실 내의 시료의 중심축 및 이 중심축과 직교하는 축을 포함하는 측정 기준 평면이 수평 배치로 되도록, 가압 분석용 구조체를 지지하는 지지부와, 측정 기준 평면이 수평 배치된 상태에서, 시료실 내의 시료를 X선원으로부터의 X선의 조사 위치에 위치결정하기 위한 이동 조정 기구를 구비한 구성으로 되어 있다.]","The sample stage is configured to include a support portion for supporting the structure for pressurization analysis so that a measurement reference plane including a central axis of the sample in the sample chamber and an axis orthogonal to the central axis is arranged horizontally, and a movement adjusting mechanism for positioning the sample in the sample chamber to an X-ray irradiation position of X-rays from the X-ray source in a state where the measurement reference plane is arranged horizontally.",True,0.2403223663568496,0.8716994031080263,46,80,-34,186,508,-322
"[여기서, 지지부는, 기밀 케이스 유닛을 지지하는 제1 지지부와, 시료 수용 유닛을 지지하는 제2 지지부를 가지고, 이들 제1, 제2 지지부에 의해 시료실 내의 시료의 중심축을 수평 배치하고, 또한 제2 지지부에 의해 상기 시료의 중심축과 직교하는 축을 수평 배치하는 구성으로 할 수가 있다.]","Here, the support portion may include a first support portion for supporting an airtight case unit mounted on an end surface side of the pressurizing unit to hermetically seal the periphery of the end surface side of the pressurizing unit and a second support portion for supporting the sample accommodating unit, and may be configured so that the central axis of the sample in the sample chamber is arranged horizontally by the first and second support portions, and the axis orthogonal to the central axis of the sample is arranged horizontally by the second support portion.",True,0.2860884964466095,0.8451646087127054,41,96,-55,164,577,-413
"[다음에, 본 발명에 관계된 가압 분석 시스템은, 상술한 구성의 X선 회절 장치와, 가압 분석용 구조체를 수납해서 대기로부터 차단하는 기밀 장치와, 가압 분석용 구조체에 수용된 시료의 압력 및 전기화학 특성을 기밀 장치의 외부에서 계측하기 위한 계측 기기를 구비한 것을 특징으로 한다.]","Next, a pressurization analysis system according to the present invention comprises: the X-ray diffraction apparatus having the above-described configuration; an airtight device for accommodating the structure for pressurization analysis therein to shield the structure for pressurization analysis from an atmosphere; and a measuring device for measuring pressure and electrochemical characteristics of the sample accommodated in the structure for pressurization analysis outside the airtight device.",True,0.2337888926267624,0.8850466479980865,40,64,-24,160,500,-340
"[도 1은, 본 발명의 실시형태에 관계된 가압 분석용 구조체의 외관을 도시하는 사시도이다.",BRIEF DESCRIPTION OF THE DRAWINGS,False,0.9700329899787904,0.3009251094239882,12,5,7,50,33,17
"도 2는, 본 발명의 실시형태에 관계된 가압 분석용 구조체의 전체 구조를 도시하는 도 1의 A－A선 단면도이다.","FIG. 1 is a perspective view showing the appearance of a structure for pressurization analysis (hereinafter referred to as ""pressurization analysis structure"") according to an embodiment of the present invention; FIG. 2 is a cross-sectional view taken along a line A-A of FIG. 1, which shows an overall structure of the pressurization analysis structure according to the embodiment of the present invention; FIG. 3 is an exploded perspective view of the pressurization analysis structure according to the embodiment of the present invention; FIG. 4 is a cross-sectional view taken along the line A-A of FIG. 1, which shows the pressurization analysis structure according to the embodiment of the present invention while the structure is exploded; FIG. 5 is an exploded perspective view showing a configuration of a sample accommodating unit; FIG. 6A and FIG. 6B are front cross-sectional views showing a configuration in which the outer diameter dimensions of a pressure receiving member and a pressing member and the inner diameter dimension of a sample holder are matched with the outer diameter dimension of an all-solid-state battery; FIG. 7A is a cross-sectional view schematically showing a cutout structure around an X-ray window and an action and an effect thereof, and FIG. 7B is a cross-sectional view schematically showing a structure to be compared with FIG. 7A ; Fig. 8A and 8B are schematic diagrams showing a method of irradiating an outer surface of the all-solid-state battery with X-rays; FIG. 9 is a perspective view showing the appearance of an X-ray diffraction apparatus according to the embodiment of the present invention; FIG. 10A is a perspective view showing a support stand provided on a sample stage of the X-ray diffraction apparatus according to the embodiment of the present invention, and FIG. 10B is a perspective view showing a state in which the pressurization analysis structure is supported by the support stand; FIG. 11 is a configuration diagram schematically showing an overall structure of a pressurization analysis system according to the embodiment of the present invention; and FIG. 12A is a perspective view showing the appearance of the sample accommodating unit in which a temperature adjusting/measuring cell is installed, and Fig. 12B is a cross-sectional view taken along a line C-C of FIG. 12A.",False,0.6345973610877991,0.6421932076922301,16,372,-356,62,2346,-2284
"도 3은, 본 발명의 실시형태에 관계된 가압 분석용 구조체의 분해 사시도이다.",DETAILED DESCRIPTION OF EMBODIMENTS,False,0.9859713315963744,0.2674360200466528,11,4,7,43,35,8
"도 4는, 본 발명의 실시형태에 관계된 가압 분석용 구조체를 분해해서 도시하는 도 1의 A－A선 단면도이다.","Hereinafter, embodiments of the present invention will be described in detail with reference to the drawings.",False,0.8377218246459961,0.4330739635007657,15,16,-1,60,109,-49
"도 5는, 시료 수용 유닛의 구성을 도시하는 분해 사시도이다.",The present embodiment shows a configuration when a sample as an analysis target is an all-solid-state battery.,False,0.7609806656837463,0.4495870596741445,9,17,-8,34,111,-77
"도 8A 및 도 8B는, 각각 전고체 전지의 외측면으로의 X선의 조사 방법을 도시하는 모식도이다.","The all-solid-state battery is configured so that electrode active material layers are arranged on both end sides of an electrolyte layer, and a current collector layer is arranged outside each of the electrode active material layers.",False,0.7858444452285767,0.4929581503032412,14,36,-22,54,234,-180
"디코딩 장치에 의하여 수행되는 영상 디코딩 방법에 있어서,비트스트림으로부터 예측 관련 정보를 포함하는 영상 정보를 획득하는 단계;상기 예측 관련 정보를 기반으로 현재 블록에 대한 인터 예측 모드를 도출하는 단계;상기 현재 블록에 대한 참조 픽처 리스트들을 도출하는 단계;상기 참조 픽처 리스트들 내에 포함된 참조 픽처들 각각과 현재 픽처 간의 POC(picture order count) 차분들을 도출하는 단계;상기 POC 차분들을 기반으로 SMVD(symmetric motion vector differences)를 위한 참조 픽처 인덱스들을 포함하는 움직임 정보를 도출하는 단계; 및상기 움직임","An image decoding method performed by a decoding apparatus, the method comprising: obtaining image information including prediction related information from a bitstream; deriving an inter prediction mode for a current block based on the prediction related information; deriving reference picture lists for the current block; deriving picture order count (POC) differences between each of reference pictures included in the reference picture lists and current picture; deriving motion information including reference picture indices for symmetric motion vector differences (SMVD) based on the POC differences; and generating predicted samples based on the motion information, wherein the reference picture indices for the SMVD are derived based on short-term reference pictures included in the reference picture lists.",True,0.2499040365219116,0.91167917414132,71,113,-42,334,817,-483
"정보는 움직임 벡터들을 포함하고,상기 MVD에 관한 정보를 기반으로 L0 예측을 위한 제1 MVD가 도출되고,상기 제1 MVD를 기반으로 L1 예측을 위한 제2 MVD가 도출되고,상기 움직임","The method of claim 1, wherein the image information includes information on motion vector differences (MVD), the motion information include motion vectors, a first MVD for L0 prediction is derived based on the information on MVD, a second MVD for L1 prediction is derived based on the first MVD, and the motion vectors are derived based on the first and second MVDs.",False,0.2952326834201813,0.8931014795816152,24,62,-38,106,367,-261
"제2항에 있어서,상기 제2 MVD의 크기는 상기 제1 MVD의 크기와 동일하고,상기 제2 MVD의 부호는 상기 제1 MVD의 부호와 반대인 것을 특징으로 하는, 영상 디코딩 방법.","The method of claim 2, wherein the size of the second MVD is the same as that of the first MVD, and the sign of the second MVD is opposite to that of the first MVD.",True,0.2371149361133575,0.888897458584167,24,36,-12,100,164,-64
"제1항에 있어서,상기 참조 픽처 리스트들은 L0 예측을 위한 참조 픽처 리스트 L0 및 L1 예측을 위한 참조 픽처 리스트 L1을 포함하고,상기 POC 차분들은 상기 참조 픽처 리스트 L0에 포함된 제1 숏텀 참조 픽처와 상기 현재 픽처 간의 제1 POC 차분, 및 상기 참조 픽처 리스트 L1에 포함된 제2 숏텀 참조 픽처와 상기 현재 픽처 간의 제2 POC 차분을 포함하고,상기 참조 픽처 인덱스들은 상기 제1 숏텀 참조 픽처를 가리키는 제1 참조 픽처 인덱스, 및 상기 제2 숏텀 참조 픽처를 가리키는 제2 참조 픽처 인덱스를 포함하고,상기 제1 참조 픽처 인덱스는 상기 제1 POC 차분을 기반으로 도출되고,상기 제2 참조 픽처 인덱스는 상기 제2 POC 차분을 기반으로 도출되는 것을 특징으로 하는, 영상 디코딩 방법.","The method of claim 1, wherein the reference picture lists include reference picture list L0 for L0 prediction and reference picture list L1 for L1 prediction, the POC differences include a first POC difference between a first short-term reference picture included in the reference picture list L0 and the current picture and a second POC difference between a second short-term reference picture included in the reference picture list L1 and the current picture, the reference picture indices include a first reference picture index indicating the first short-term reference picture and a second reference picture index indicating the second short-term reference picture, the first reference picture index is derived based on the first POC difference, and the second reference picture index is derived based on the second POC difference.",True,0.2222210615873336,0.9282392223838348,110,128,-18,407,837,-430
"제4항에 있어서,상기 제1 POC 차분은 상기 제2 POC 차분과 동일한 것을 특징으로 하는, 영상 디코딩 방법.","The method of claim 4, wherein the first POC difference is the same as the second POC difference.",True,0.3144862651824951,0.8500122608356411,16,18,-2,63,97,-34
"제1항에 있어서,상기 참조 픽처 리스트들은 L0 예측을 위한 참조 픽처 리스트 L0를 포함하고,상기 참조 픽처 리스트 L0는 제3 숏텀 참조 픽처 및 제4 숏텀 참조 픽처를 포함하고,상기 POC 차분들은 상기 제3 숏텀 참조 픽처와 상기 현재 픽처 간의 제3 POC 차분, 및 상기 제4 숏텀 참조 픽처와 상기 현재 픽처 간의 제4 POC 차분을 포함하고,상기 제3 및 제 4 POC 차분들 간의 비교를 기반으로 상기 제3 숏텀 참조 픽처가 상기 SMVD를 위한 참조 픽처 인덱스들 중 하나로 도출되는 것을 특징으로 하는, 영상 디코딩 방법.","The method of claim 1, wherein the reference picture lists include reference picture list L0 for L0 prediction, the reference picture list L0 includes a third short-term reference picture and a fourth short-term reference picture, the POC differences include a third POC difference between the third short-term reference picture and the current picture and a fourth POC difference between the fourth short-term reference picture and the current picture, and the third short-term reference picture is derived as one of the reference picture indices for SMVD based on the comparison between the third and fourth POC differences.",True,0.300168514251709,0.9042103566614194,84,96,-12,303,626,-323
"제6항에 있어서,상기 제3 POC 차분이 상기 제4 POC 차분보다 작은 경우, 상기 제3 숏텀 참조 픽처가 상기 SMVD를 위한 참조 픽처 인덱스들 중 하나로 도출되는 것을 특징으로 하는, 영상 디코딩 방법.","The method of claim 6, wherein, when the third POC difference is smaller than the fourth POC difference, the third short-term reference picture is derived as one of the reference picture indices for SMVD.",True,0.2563076317310329,0.9001485349184771,31,34,-3,117,204,-87
"인코딩 장치에 의하여 수행되는 영상 인코딩 방법에 있어서,현재 블록을 위해 인터 예측 모드를 도출하는 단계;침조 픽처들을 포함하는 참조 픽처 리스트들을 도출하는 단계;상기 참조 픽처 리스트들에 포함되는 상기 참조 픽처들과 현재 픽처 간의 POC(picture order count) 차분들을 도출하는 단계;상기 POC 차분들을 기반으로 SMVD(symmetric motion vector differences)를 위한 참조 픽처 인덱스들을 포함하는 움직임 정보를 도출하는 단계;상기 움직임 정보를 기반으로 예측 샘플들을 생성하는 단계;상기 인터 예측 모드를 포함하는 예측 관련 정보를 생성하는 단계;상기 예측 샘플들을 기반으로 레지듀얼 정보를 도출하는 단계;상기 예측 관련 정보 및 상기 레지듀얼 정보를 포함하는 영상 정보를 인코딩하는 단계를 포함하되,상기 SMVD를 위한 참조 픽처 인덱스들은 상기 참조 픽처 리스트들 내에 포함된 숏텀(short-term) 참조 픽처들을 기반으로 도출되는 것을 특징으로 하는, 영상 인코딩 방법.","An image encoding method performed by an encoding apparatus, the method comprising: deriving an inter prediction mode for a current block; deriving reference picture lists including reference pictures; deriving picture order count (POC) differences between the reference pictures included in the reference picture lists and the current picture; deriving motion information including reference picture indices for symmetric motion vector differences (SMVD) based on the POC differences; generating predicted samples based on the motion information; generating prediction related information including the inter prediction mode; deriving residual information based on the predicted samples; and encoding image information including the prediction related information and the residual information, wherein the reference picture indices for SMVD are derived based on short-term reference pictures included in the reference picture lists.",True,0.2445525527000427,0.9146389248365734,112,124,-12,521,933,-412
"정보는 움직임 벡터들을 포함하고,상기 MVD에 관한 정보는 L0 예측을 위한 제1 MVD를 나타내고,상기 제1 MVD를 기반으로 L1 예측을 위한 제2 MVD가 도출되는 것을 특징으로 하는, 영상 인코딩 방법.","The method of claim 8, wherein the image information includes information on motion vector differences (MVD), the motion information includes motion vectors, the information on MVD indicates a first MVD for L0 prediction, and a second MVD for L1 prediction is derived based on the first MVD.",False,0.274972140789032,0.9056783241744556,28,47,-19,117,291,-174
"제9항에 있어서,상기 제2 MVD의 크기는 상기 제1 MVD의 크기와 동일하고,상기 제2 MVD의 부호는 상기 제1 MVD의 부호와 반대인 것을 특징으로 하는, 영상 인코딩 방법.","The method of claim 9, wherein the size of the second MVD is the same as that of the first MVD, and the sign of the second MVD is opposite to that of the first MVD.",True,0.2282419949769973,0.8932712819181984,24,36,-12,100,164,-64
"제8항에 있어서,상기 참조 픽처 리스트들은 L0 예측을 위한 참조 픽처 리스트 L0 및 L1 예측을 위한 참조 픽처 리스트 L1을 포함하고,상기 POC 차분들은 상기 참조 픽처 리스트 L0에 포함된 제1 숏텀 참조 픽처와 상기 현재 픽처 간의 제1 POC 차분, 및 상기 참조 픽처 리스트 L1에 포함된 제2 숏텀 참조 픽처와 상기 현재 픽처 간의 제2 POC 차분을 포함하고,상기 참조 픽처 인덱스들은 상기 제1 숏텀 참조 픽처를 가리키는 제1 참조 픽처 인덱스, 및 상기 제2 숏텀 참조 픽처를 가리키는 제2 참조 픽처 인덱스를 포함하고,상기 제1 참조 픽처 인덱스는 상기 제1 POC 차분을 기반으로 도출되고,상기 제2 참조 픽처 인덱스는 상기 제2 POC 차분을 기반으로 도출되는 것을 특징으로 하는, 영상 인코딩 방법.","The method of claim 8, wherein the reference picture lists include reference picture list L0 for L0 prediction and reference picture list L1 for L1 prediction, the POC differences include a first short-term reference picture included in the reference picture list L0 and a second POC difference between a second short-term reference picture included in the reference picture list L1 and the current picture, the reference picture indices include a first reference picture index indicating the first short-term reference picture and a second reference picture index indicating the second short-term reference picture, the first reference picture index is derived based on the first POC difference, and the second reference picture index is derived based on the second POC difference.",True,0.2319123744964599,0.9250962694966568,110,119,-9,407,782,-375
"제11항에 있어서,상기 제1 POC 차분은 상기 제2 POC 차분과 동일한 것을 특징으로 하는, 영상 인코딩 방법.","The method of claim 11, wherein the first POC difference is the same as the second POC difference.",True,0.3406749367713928,0.8293674231205201,16,18,-2,64,98,-34
"제8항에 있어서,상기 참조 픽처 리스트들은 L0 예측을 위한 참조 픽처 리스트 L0를 포함하고,상기 참조 픽처 리스트 L0는 제3 숏텀 참조 픽처 및 제4 숏텀 참조 픽처를 포함하고,상기 POC 차분들은 상기 제3 숏텀 참조 픽처와 상기 현재 픽처 간의 제3 POC 차분, 및 상기 제4 숏텀 참조 픽처와 상기 현재 픽처 간의 제4 POC 차분을 포함하고,상기 제3 및 제 4 POC 차분들 간의 비교를 기반으로 상기 제3 숏텀 참조 픽처가 상기 SMVD를 위한 참조 픽처 인덱스들 중 하나로 도출되는 것을 특징으로 하는, 영상 인코딩 방법.","The method of claim 8, wherein the reference picture lists include reference picture list L0 for L0 prediction, the reference picture list L0 includes a third short-term reference picture and a fourth short-term reference picture, the POC differences include a third POC difference between the third short-term reference picture and the current picture and a fourth POC difference between the fourth short-term reference picture and the current picture, and the third short-term reference picture is derived as one of the reference picture indices for SMVD based on the comparison between the third and fourth POC differences.",True,0.3025828301906585,0.9014977916232052,84,96,-12,303,626,-323
"제12항에 있어서,상기 제3 POC 차분이 상기 제4 POC 차분보다 작은 경우, 상기 제3 숏텀 참조 픽처가 상기 SMVD를 위한 참조 픽처 인덱스들 중 하나로 도출되는 것을 특징으로 하는, 영상 인코딩 방법.","The method of claim 12, wherein, when the third POC difference is smaller than the fourth POC difference, the third short-term reference picture is derived as one of the reference picture indices for SMVD.",True,0.3100016117095947,0.8798850086773006,31,34,-3,118,205,-87
"영상 디코딩 장치가 영상 디코딩 방법을 수행하도록 야기하는 인코딩된 정보를 저장하는 컴퓨터 판독 가능한 저장 매체에 있어서, 상기 영상 디코딩 방법은:비트스트림으로부터 예측 관련 정보를 포함하는 영상 정보를 획득하는 단계;상기 예측 관련 정보를 기반으로 현재 블록에 대한 인터 예측 모드를 도출하는 단계;상기 현재 블록에 대한 참조 픽처 리스트들을 도출하는 단계;상기 참조 픽처 리스트들 내에 포함된 참조 픽처들 각각과 현재 픽처 간의 POC(picture order count) 차분들을 도출하는 단계;상기 POC 차분들을 기반으로 SMVD(symmetric motion vector differences)를 위한 참조 픽처 인덱스들을 포함하는 움직임 정보를 도출하는 단계; 및상기 움직임","A computer readable storage medium storing encoded information causing an image decoding apparatus to perform an image decoding method, wherein the image decoding method comprising: obtaining image information including prediction related information from a bitstream; deriving an inter prediction mode for a current block based on the prediction related information; deriving reference picture lists for the current block; deriving picture order count (POC) differences between each of reference pictures included in the reference picture lists and current picture; deriving motion information including reference picture indices for symmetric motion vector differences (SMVD) based on the POC differences; and generating predicted samples based on the motion information, wherein the reference picture indices for the SMVD are derived based on short-term reference pictures included in the reference picture lists.",True,0.2170334458351135,0.9220976827714352,84,126,-42,386,916,-530
"동력모듈;상기 동력모듈과 연결되어 회전하고, 외주면에 제1 관통공이 형성되는 몸체부;상기 몸체부 내의 중공에 상기 몸체부의 길이방향으로 삽입되고, 상기 몸체부 내에서 상기 몸체부의 길이방향으로 소정길이 왕복 운동하는 샤프트; 상기 몸체부의 외주면에 상기 몸체부의 길이방향을 따라 접하는 브러쉬부; 상기 브러쉬부의 상기 몸체부의 외주면에 접하는 면으로부터 상기 제1 관통공을 통하여 상기 샤프트의 외주면을 향해 연장되는 제1 캠; 및상기 샤프트의 외주면으로부터 상기 제1 캠을 향해 연장되는 제 2캠을 포함하고,상기 제1 캠 및 제2 캠 중 어느 하나는 일 측에 상기 길이방향을 따라 경사진 경사면이 형성되며,상기 제1 캠 및 제2 캠 중 다른 하나는 상기 샤프트가 왕복 운동함에 따라, 상기 경사면을 가압하여 상기 브러쉬부를 상기 샤프트의 방사방향으로 승강시키도록 형성되는, 청소용 유닛.","A cleaning unit comprising: a power module; a body part that is connected to the power module to rotate and includes a first through-hole defined in an outer circumferential surface thereof; a shaft that is inserted into a hollow hole of the body part in a lengthwise direction of the body part and performs a reciprocating motion in the body part in the lengthwise direction of the body part; a brush assembly in contact with the outer circumferential surface of the body part along the lengthwise direction of the body part; a first cam extending from a surface in contact with the outer circumferential surface of the body part toward an outer circumferential surface of the shaft through the first through-hole; and a second cam extending from the outer circumferential surface of the shaft toward the first cam, wherein one of the first cam and the second cam is provided at one side thereof with an inclined surface that is inclined along the lengthwise direction of the body part, and wherein a remaining one of the first cam and the second cam presses the inclined surface as the shaft performs the reciprocating motion, so that the brush assembly moves upward and downward in a radial direction of the shaft.",False,0.3205370903015136,0.9054551422465974,105,209,-104,441,1217,-776
"제1항에 있어서,상기 몸체부는,상기 제1 관통공을 구비하고, 양단이 개방되는 중공형 몸체부재; 상기 몸체부재의 일 단으로부터 상기 몸체부재의 내측으로 소정 길이 삽입되어 상기 일 단을 복개하고, 상기 샤프트의 일 측을 수용하는 제1 앤드캡; 및상기 몸체부재의 타 단으로부터 상기 몸체부재의 내측으로 소정 길이 삽입되어 상기 타 단을 복개하고, 상기 샤프트의 타 측을 수용하는 제2 앤드캡을 포함하는, 청소용 유닛.","The cleaning unit of claim 1, wherein the body part comprises: a body member provided with the first through-hole and having a hollow 95 shape with both ends open; a first end cap that is inserted into the body member from one end of the body member by a predetermined length so as to cover the one end of the body member and accommodates one side of the shaft; and a second end cap that is inserted into the body member from another end of the body member by a predetermined length so as to cover the another end of the body member and accommodates another side of the shaft.",True,0.4781894087791443,0.8438436352750595,55,110,-55,231,576,-345
"제1항에 있어서,상기 몸체부의 외주면에 제2 관통공이 형성되고, 상기 브러쉬부에는 상기 브러쉬부의 일 측으로부터 상기 제2 관통공을 통하여 상기 몸체부 내측으로 연장되고, 상기 브러쉬부가 방사??향으로 상승함에 따라 상기 몸체부의 내측면을 가압하는 탄성부재가 형성되는, 청소용 유닛.","The cleaning unit of claim 1, wherein a second through-hole is defined in the outer circumferential surface of the body part, and wherein the brush assembly is provided with an elastic member that extends from one side thereof to an inside of the body part through the second through-hole and presses an inner surface of the body member as the brush assembly is raised in the radial direction.",True,0.3681116700172424,0.8775326494696924,34,68,-34,158,393,-235
"제3항에 있어서,상기 탄성부재는,상기 브러쉬부의 일 측으로부터 상기 제2 관통공을 통하여 상기 몸체부의 내측으로 연장되는 제1 탄성부; 및상기 제1 탄성부로부터 구부러져 샤프트의 길이방향을 따라 연장되는 제2 탄성부를 구비하는, 청소용 유닛.","The cleaning unit of claim 3, wherein the elastic member comprises: a first elastic portion extending from the one side of the brush assembly to the inside of the body part through the second through-hole; and a second elastic portion bent from the first elastic portion to extend along a lengthwise direction of the shaft.",True,0.2125591039657592,0.9275623460308902,29,55,-26,135,323,-188
"제1항에 있어서,상기 몸체부의 외주면에는 제3 관통구멍이 형성되고,상기 브러쉬부에는 상기 브러쉬부의 일 측으로부터 상기 제3 관통구멍을 통하여 상기 몸체부의 내측으로 연장되고, 상기 몸체부와 상기 샤프트의 방사방향으로 적어도 일부가 중첩되는 이탈방지부가 형성되는, 청소용 유닛.","The cleaning unit of claim 1, wherein a third through-hole is defined in the outer circumferential surface of the body part, and wherein the brush assembly is provided with a separation prevention portion that extends from one side thereof to an inside of the body part through 96 the third through-hole and at least partially overlaps the body part in the radial direction of the shaft.",True,0.4063335955142975,0.8479372003343985,32,66,-34,155,387,-232
"제2항에 있어서,상기 브러쉬부는,브러쉬; 및상기 몸체부재의 외주면에 상기 샤프트의 길이방향으로 접하고, 일 측은 상기 제1 캠을 구비하며, 타 측은 상기 브러쉬와 결합되는 브러쉬홀더를 구비하는, 청소용 유닛.","The cleaning unit of claim 2, wherein the brush assembly comprises: a brush; and a brush holder that is in contact with an outer circumferential surface of the body member in a lengthwise direction of the shaft, and has one side thereof provided with the first cam and another side thereof coupled to the brush.",True,0.3264153003692627,0.8880616544427478,25,55,-30,116,311,-195
"제6항에 있어서,상기 몸체부재에 상기 샤프트의 길이방향을 따라 상기 브러쉬홀더를 수용하는 수용홈이 형성되고, 상기 제1 앤드캡은 상기 수용홈의 일 단을 복개하며,상기 제2 앤드캡은 상기 수용홈의 타 단을 복개하고,상기 제1 앤드캡 및 제2 앤드캡이 상기 수용홈의 일 단을 복개하는 면에는 각각 방사방향 가이드홈이 형성되고,상기 브러쉬홀더의 상기 제1 앤드캡과 대향하는 면 및 상기 브러쉬홀더의 상기 제2 앤드캡과 대향하는 면에는 방사방향 가이드돌부가 각각 형성되며,상기 방사방향 가이드돌부는 상기 방사방향 가이드홈에 삽입되어 상기 샤프트의 방사방향으로 가이드되는, 청소용 유닛.","The cleaning unit of claim 6, wherein the body member is provided with an accommodation groove in which the brush holder is accommodated along the lengthwise direction of the shaft, wherein the first end cap covers one end of the accommodation groove, wherein the second end cap covers another end of the accommodation groove, wherein each of the first end cap and the second end cap is provided with a radial guide groove, the radial guide grooves formed on a surface of the first end cap that covers the one end of the accommodation groove and a surface that covers the another end of the accommodation groove, respectively, wherein the brush holder is provided with radial guide protrusions formed on a surface opposite to the first end cap and a surface opposite to the second end cap, respectively, and wherein the radial guide protrusions are inserted into the radial guide grooves, respectively, so as to be guided in the radial direction of the shaft.",True,0.3773744702339172,0.8778270272120874,72,164,-92,323,959,-636
"제2항에 있어서, 상기 제1 앤드캡의 일 측에는 상기 제1 앤드캡의 일 측으로부터 상기 몸체부재의 내측방향으로 함몰 형성된 공동이 형성되고, 상기 제1 앤드캡의 타 측에는 상기 샤프트의 일 측 방향 단부를 수용하여 상기 공동으로 유도하는 가이드공이 형성되는, 청소용 유닛.","The cleaning unit of claim 2, wherein a cavity is recessed from one side of the first end cap toward the body member, and a guide hole is defined in another side of the first end cap to accommodate an end portion of the one side of the shaft so as to guide the end portion of the one side of the shaft to the cavity.",True,0.429349273443222,0.8598945994268213,38,66,-28,152,316,-164
"제8항에 있어서,상기 샤프트의 일 측 방향 단부 및 상기 가이드공은 서로 맞물리는 다각기둥형으로 형성되는, 청소용 유닛.","The cleaning unit of claim 8, wherein the end portion of the one side of the shaft and the guide hole each have a polygonal column shape to be engaged with each other.",True,0.2654084861278534,0.8563207296605186,16,33,-17,67,167,-100
"제9항에 있어서,일 측이 상기 동력모듈과 연결되고, 타 측이 상기 공동에 삽입되는 동력전달부를 포함하고, 상기 공동과 상기 동력전달부의 타 측은 서로 맞물리는 다각기둥형으로 형성되는, 청소용 유닛.","The cleaning unit of claim 9, further comprising a power transmission unit having one side connected to the power module and another side inserted into the cavity, wherein the cavity and the another side of the power transmission unit each have a polygonal column shape to be engaged with each other.",True,0.2691204845905304,0.8844202852578484,25,51,-26,110,300,-190
"제2항에 있어서,상기 제2 앤드캡의 일 측에는 상기 제1 앤드캡의 일 측으로부터 상기 몸체부재의 내측방향으로 함몰 형성된 공동이 형성되고, 상기 제1 앤드캡의 타 측에는 상기 샤프트의 타 측을 상기 공동으로 돌출되도록 수용하여 상기 샤프트의 방사방향으로 지지하는 가이드공이 형성되는, 청소용 유닛.","The cleaning unit of claim 2, wherein a cavity is recessed from one side of the second end cap toward the body member, and a guide hole is defined in another side of the second end cap to accommodate the another side of the shaft to allow the another side of the shaft to protrude to the cavity, so as to support the another side of the shaft in the radial direction of the shaft.",True,0.3973089456558227,0.8699830797598483,39,75,-36,166,380,-214
"제11항에 있어서, 상기 샤프트의 타 측 방향 단부를 수용하는 수용공간 및 상기 샤프트의 타 측 방향 단부의 외주면과 상기 수용공간의 내주면 사이에 삽입되는 베어링을 구비하는 샤프트 수용부를 포함하는, 청소용 유닛.","The cleaning unit of claim 11, further comprising a shaft accommodating part that includes an accommodation space in which an end portion of the another side of the shaft is accommodated and a bearing that is inserted between an outer circumferential surface of the end portion of the 98 another side of the shaft and an inner circumferential surface of the accommodation space.",True,0.4051483273506164,0.837859521657735,30,63,-33,120,378,-258
"제12항에 있어서, 상기 동력모듈은,상기 샤프트를 회전시키는 제1 동력모듈; 및상기 샤프트 수용부와 연결되며, 작동 정보에 따라 상기 샤프트 수용부를 가압하는 제2 동력모듈을 포함하고,상기 제1 동력모듈과 연결되어 상기 제1 동력모듈의 전류 값을 감지하도록 구성되는 센서부; 및상기 작동 정보를 연산하고, 상기 제2 동력모듈과 통전 가능하게 연결되어 상기 제2 동력모듈에 연산된 상기 작동 정보를 전달하며, 상기 센서부와 통전 가능하게 연결되어 상기 센서부로부터 감지된 상기 제1 동력모듈의 전류 값을 전달받도록 구성되는 제어부를 포함하며, 상기 제어부는,감지된 상기 제1 동력모듈의 전류 값을 이용하여 상기 작동 정보를 연산하는,청소용 유닛.","The cleaning unit of claim 12, wherein the power module comprises: a first power module configured to rotate the shaft; a second power module that is connected to the shaft accommodating part and is configured to press the shaft accommodating part according to operation information; a sensor connected to the first power module to detect a current value of the first power module; and a controller that is configured to calculate the operation information, is electrically connected to the second power module to transmit the calculated operation information to the second power module, and is electrically connected to the sensor to receive the current value of the first power module, and wherein the controller calculates the operation information using the detected current value of the first power module.",True,0.2022936940193176,0.9201714119540404,81,128,-47,360,811,-451
"제13항에 있어서,상기 작동 정보는 제1 작동 정보 및 제2 작동 정보를 포함하고,상기 제2 동력모듈은, 제1 작동 정보를 전달받아 정지되고, 제2 작동 정보를 전달받아 기 설정된 압력으로 상기 샤프트 수용부를 가압하며, 상기 제어부는,감지된 상기 제1 동력모듈의 전류 값이 제1 값 미만인 경우 제1 작동 정보를 연산하고, 감지된 상기 제1 동력모듈의 전류 값이 제1 값 이상인 경우 제2 작동 정보를 연산하는, 청소용 유닛.","The cleaning unit of claim 13, wherein the operation information includes first operation information and second operation information, wherein the second power module is configured to: stop upon receiving the first operation information; and press the shaft accommodating part at a predetermined pressure upon receiving the second operation information, and wherein the controller is configured to: calculate the first operation information when the detected current value 99 of the first power module is less than a first value; and calculate the second operation information when the detected current value of the first power module is greater than or equal to the first value.",True,0.2878310978412628,0.8716970135086928,61,103,-42,239,680,-441
"제14항에 있어서,상기 작동 정보는 제1 작동 정보, 제2 작동 정보 및 제3 작동 정보를 포함하고,상기 제2 동력모듈은, 제1 작동 정보를 전달받아 정지되고, 제2 작동 정보를 전달받아 제1 압력으로 상기 샤프트 수용부를 가압하고, 제3 작동 정보를 전달받아 제2 압력으로 상기 샤프트 수용부를 가압하며,상기 제어부는,감지된 상기 제1 동력모듈의 전류 값이 제1 값 미만인 경우 제1 작동 정보를 연산하고, 감지된 상기 제1 동력모듈의 전류 값이 제1 값 이상인 경우 제2 작동 정보를 연산하며, 감지된 상기 제1 동력모듈의 전류 값이 제2 값 이상인 경우 제3 작동 정보를 연산하고,상기 제2 압력은 상기 제1 압력보다 크고,상기 제2 값은 상기 제1 값보다 큰,청소용 유닛.","The cleaning unit of claim 13, wherein the operation information includes first operation information, second operation information, and third operation information, wherein the second power module is configured to: stop upon receiving the first operation information; press the shaft accommodating part at a first pressure upon receiving the second information; and press the shaft accommodating part at a second pressure upon receiving the third information, wherein the controller is configured to: calculate the first operation information when the detected current value of the first power module is less than a first value, calculate the second operation information when the detected current value of the first power module is greater than or equal to the first value; and calculate the third operation information when the detected current value of the first power module is greater than or equal to a second value, and wherein the second pressure is greater than the first pressure, and the second value is greater than the first value.",False,0.2435359358787536,0.8946225821446703,97,162,-65,380,1045,-665
"동력모듈;상기 동력모듈와 연결되어 회전하고, 외주면에 관통공이 형성되는 몸체부;상기 몸체부 내의 중공에 상기 몸체부의 길이방향으로 삽입되고, 상기 몸체부 내에서 상기 몸체부의 길이방향으로 소정길이 왕복 운동하는 샤프트; 상기 몸체부의 외주면에 상기 몸체부의 길이방향을 따라 접하는 브러쉬부; 상기 브러쉬부의 상기 몸체부의 외주면에 접하는 면으로부터 상기 관통공을 통하여 상기 샤프트의 외주면을 향해 연장되는 제1 캠; 및상기 샤프트의 외주면으로부터 상기 제1 캠을 향해 연장되는 제2 캠을 포함하고,상기 제1 캠 및 제2 캠 중 어느 하나는,상기 샤프트의 길이방향을 따라 경사진 단부를 갖는 한 쌍의 벽 부; 및 상기 한 쌍의 벽 부의 단부 사이를 연결하여 내측공간을 형성하는 경사부를 구비하며,상기 제1 캠 및 제2 캠 중 다른 하나는,상기 경사부의 일 측면을 따라 상기 내측공간으로 미끄러지듯 삽입되는 삽입부; 및상기 경사부의 타 측면과 접하여 상기 타 측면을 가압하는 가압부를 구비하고, 상기 샤프트가 왕복 운동함에 따라, 상기 경사부를 가압하여 상기 브러쉬부를 상기 샤프트의 방사방향으로 승강시키도록 형성되는, 청소용 유닛.","A cleaning unit comprising: a power module; 100 a body part that is connected to the power module to rotate and includes a through-hole defined in an outer circumferential surface thereof; a shaft that is inserted into a hollow hole in the body part in a lengthwise direction of the body part and performs a reciprocating motion in the body part in the lengthwise direction of the body part; a brush assembly in contact with the outer circumferential surface of the body part along the lengthwise direction of the body part; a first cam extending from a surface in contact with the outer circumferential surface of the body part toward an outer circumferential surface of the shaft through the through-hole; and a second cam extending from the outer circumferential surface of the shaft toward the first cam, wherein one of the first cam and the second cam comprises: a pair of wall portions each having an end portion that is inclined along a lengthwise direction of the shaft; and an inclined portion that connects between the end portions of the pair of wall portions to form an inner space, wherein a remaining one of the first cam and the second cam comprises: an insertion portion slidably inserted into the inner space of the inclined portion along one surface of the inclined portion; and a pressing portion in contact with another surface of the inclined portion to press the another surface of the inclined portion, and wherein the inclined portion is pressed as the shaft performs the reciprocating motion, so that the brush assembly moves upward and downward in a radial direction of the shaft.",False,0.3896347880363464,0.8753102015313756,138,274,-136,577,1606,-1029
"제16항에 있어서,상기 몸체부는,상기 관통공을 구비하고, 양단이 개방되는 중공형 몸체부재; 상기 몸체부재의 일 단으로부터 상기 몸체부재의 내측으로 소정 길이 삽입되어 상기 몸체부재의 일 단을 복개하고, 상기 샤프트의 일 측을 수용하는 제1 앤드캡; 및상기 몸체부재의 타 단으로부터 상기 몸체부재의 내측으로 소정 길이 삽입되어 상기 몸체부재의 타 단을 복개하고, 상기 샤프트의 타 측을 수용하는 제2 앤드캡을 포함하는, 청소용 유닛.","The cleaning unit of claim 16, wherein the body part comprises: a body member provided with the through-hole and having a hollow shape with both ends open; a first end cap that is inserted into the body member from one end of the body member by a predetermined length so as to cover the one end of the body member and accommodates one side of the shaft; and a second end cap that is inserted into the body member from another end of the body member by a predetermined length so as to cover the another end of the body member and accommodates another side of the shaft.",True,0.4259642958641052,0.8600422694120315,56,108,-52,241,568,-327
"제17항에 있어서,상기 샤프트의 일 측에는 상기 샤프트의 외주로부터 상기 샤프트의 방사방향으로 소정길이 돌출된 림부가 형성되고, 상기 샤프트의 일 측을 감싸고, 양 단이 상기 제1 앤드캡 및 상기 림부에 고정 결합되는 스프링을 포함하는, 청소용 유닛.","The cleaning unit of claim 17, wherein a rim portion that protrudes from the outer circumferential surface of the shaft by a predetermined length in the radial direction of the shaft is provided at the one side of the shaft, and wherein the shaft includes a spring that surrounds the one side of the shaft and has both ends fixedly coupled to the first end cap and the rim portion, respectively.",True,0.4305032193660736,0.837999432863897,34,71,-37,140,395,-255
"제18항에 있어서,상기 제1 앤드캡의 일 측에는 상기 제1 앤드캡의 일 측으로부터 상기 몸체부재의 내측방향으로 함몰 형성된 공동이 형성되고, 상기 제1 앤드캡의 타 측에는 상기 샤프트의 일 측 방향 단부를 수용하여 상기 공동으로 유도하는 가이드공이 형성되며,상기 가이드공의 내주면과 상기 샤프트의 일 측 방향 단부의 외주면은 서로 맞물리고, 상기 가이드공으로 수용되는 상기 샤프트의 일 측 방향 단부의 외주면과 상기 샤프트의 일 측 방향 단부와 연결되는 연결부의 외주면 사이에 단차면이 형성되는, 청소용 유닛.","The cleaning unit of claim 18, wherein a cavity is recessed from one side of the first end cap toward an inside of the body member, wherein a guide hole is defined in another side of the first end cap to guide an end portion of the one side of the shaft to the cavity, wherein an inner circumferential surface of the guide hole and an outer circumferential surface of the end portion of the one side of the shaft are engaged with each other, and 102 wherein a stepped surface is formed between the outer circumferential surface of the end portion of the one side of the shaft that is accommodated in the guide hole and an outer circumferential surface of a connecting portion that is connected to the end portion of the one side of the shaft.",True,0.4157434105873108,0.8655266869647802,70,139,-69,285,742,-457
일산화질소를 이산화질소로 산화시키는 단계(S100)；이산화질소를 환원시키는 단계(S101)； 및 산성 폐가스를 처리하는 단계(S102)를 포함하는 것을 특징으로 하는 질소 산화물 폐가스의 습식 처리 방법.,"A method for wet treatment of nitrogen oxide waste gas, comprising: S100: oxidizing nitrogen monoxide to nitrogen dioxide; S101: reducing nitrogen dioxide; and S102: treating an acidic waste gas.",True,0.3123455047607422,0.8787665560642766,21,29,-8,114,195,-81
"제1항에 있어서,단계 S100에서, 산화제 용액을 사용하여 산화를 수행하며, 상기 산화제 용액 내의 산화제는 가용성 염 산화제인 것을 특징으로 하는 질소 산화물 폐가스의 습식 처리 방법.","The method according to claim 1, wherein in the S100, an oxidizer solution is used to perform the oxidizing, and an oxidizer in the oxidizer solution is a soluble salt oxidizer.",True,0.3860636949539184,0.8538434946637962,25,31,-6,104,177,-73
"제2항에 있어서,상기 산화제 용액 내의 산화제는 차아염소산염, 아염소산염 또는 과망간산염 중 적어도 하나로부터 선택되는 것을 특징으로 하는 질소 산화물 폐가스의 습식 처리 방법.","The method according to claim 2, wherein the oxidizer in the oxidizer solution is selected from at least one of hypochlorite, chlorite or permanganate.",True,0.4461432695388794,0.8071648994544927,23,24,-1,99,151,-52
"제2항에 있어서,상기 산화제 용액 내의 산화제는 NaClO, NaClO2, KMnO4중 적어도 하나로부터 선택되는 것을 특징으로 하는 질소 산화물 폐가스의 습식 처리 방법.","The method according to claim 2, wherein the oxidizer in the oxidizer solution is selected from at least one of NaClO, NaClO2, or KMnO4.",True,0.2211377024650573,0.9086080618842712,21,24,-3,96,136,-40
"제2항에 있어서,단계 S100에서, 일산화질소를 이산화질소로 산화시킬 때 상기 산화제 용액의 산화환원 전위는 200mV~800mV인것을 특징으로 하는 질소 산화물 폐가스의 습식 처리 방법.","The method according to claim 2, wherein in the S100, a redox potential of the oxidizer solution is between 200mV and 800mV in response to oxidize nitrogen monoxide to nitrogen dioxide.",True,0.3189218044281006,0.8640308362930772,21,31,-10,105,185,-80
"제1항에 있어서,단계 S101에서, 환원제 용액을 사용하여 환원을 수행하며, 상기 환원제 용액 내의 환원제는 가용성 염 환원제인것을 특징으로 하는 질소 산화물 폐가스의 습식 처리 방법.","The method according to claim 1, wherein in the S101, a reductant solution is used to perform the reducing, and a reductant in the reductant solution is a soluble salt reductant.",True,0.4439044892787933,0.8111435576536122,24,31,-7,103,178,-75
"제6항에 있어서,가용성 염 환원제는 설파이드 염, 하이드로설파이드 염, 설페이트 또는 티오설페이트 중 적어도 하나를 포함하는 것을 특징으로 하는 질소 산화물 폐가스의 습식 처리 방법.","The method according to claim 6, wherein the soluble salt reductant comprises at least one of a sulfide salt, a hydrosulphide salt, a sulfate or a thiosulfate.",True,0.3023717701435089,0.8757993152650237,24,27,-3,102,159,-57
"제6항에 있어서,상기 환원제 용액 내의 환원제는 Na2S, NaHS, Na2SO3, Na2S2O3중 적어도 하나로부터 선택되는것을 특징으로 하는 질소 산화물 폐가스의 습식 처리 방법.","The method according to claim 6, wherein the reductant in the reductant solution is selected from at least one of Na2S, NaHS, Na2SO3, or Na2S2O3.",True,0.2384372949600219,0.9032264671113468,21,25,-4,102,145,-43
"제6항에 있어서,단계 S101에서, 이산화질소를 환원시킬 때 상기 환원제 용액의 산화환원 전위는 -200mV~-500mV인것을 특징으로 하는 질소 산화물 폐가스의 습식 처리 방법.","The method according to claim 6, wherein in the S101, a redox potential of the reductant solution is between -200mV and -500mV in response to reduce nitrogen dioxide.",True,0.3947182893753052,0.8287998290107551,20,28,-8,100,166,-66
"제1항에 있어서,단계 S102에서, 알칼리 용액을 사용하여 산성 폐가스를 처리하는 것을 특징으로 하는 질소 산화물 폐가스의 습식 처리 방법.","The method according to claim 1, wherein in the S102, an alkali solution is used for treating the acidic waste gas.",True,0.3181889653205871,0.8670547479747573,18,21,-3,78,115,-37
"제10항에 있어서,상기 알칼리 용액은 수산화나트륨, 수산화칼륨, 수산화바륨 또는 암모니아 중 적어도 하나를 포함하는 것을 특징으로 하는 질소 산화물 폐가스의 습식 처리 방법.","The method according to claim 10, wherein the alkali solution comprises at least one of sodium hydroxide, potassium hydroxide, barium hydroxide or an ammonia solution.",True,0.3158867061138153,0.8732247122929572,22,25,-3,97,167,-70
"제10항에 있어서,단계 S102에서, 수산화나트륨 용액을 사용하여 산성 폐가스를 처리하는 것을 특징으로 하는 질소 산화물 폐가스의 습식 처리 방법.","The method according to claim 10, wherein in the S102, a sodium hydroxide solution is used for treating the acidic waste gas.",True,0.3402124345302582,0.8680176154460059,18,22,-4,82,125,-43
"제12항에 있어서,상기 수산화나트륨 용액의 pH값은 9~13인 것을 특징으로 하는 질소 산화물 폐가스의 습식 처리 방법.","The method according to claim 12, wherein the sodium hydroxide solution has a pH value of 9 to 13.",True,0.2874720692634582,0.8689949539869336,15,19,-4,67,98,-31
"상류에서 하류로 순서대로 배열된 일산화질소 산화 장치, 이산화질소 환원 장치, 및 산성 폐가스 처리 장치를 포함하는 것을 특징으로 하는 질소 산화물 폐가스의 습식 처리 시스템.","A system for wet treatment of nitrogen oxide waste gas, comprising: a nitrogen monoxide oxidizing device, a nitrogen dioxide reducing device, and an acidic waste gas treating device, which are arranged in sequence from upstream to downstream.",True,0.2956768870353699,0.8722696388806982,25,37,-12,98,242,-144
"제14항에 있어서,상기 시스템은 공기 유입 파이프라인, 공기 배출 장치 및 공기 배출 파이프라인을 더 포함하고, 상기 공기 배출 장치는 상기 산성 폐가스 처리 장치의 하류에 설치되고, 상기 공기 배출 파이프라인는 상기 공기 배출 장치의 하류에 설치되고, 상기 공기 유입 파이프라인은 상기 일산화질소 산화 장치의 상류에 설치되고, 상기 일산화질소 산화 장치에 연결되는 것을 특징으로 하는 질소 산화물 폐가스의 습식 처리 시스템.","The system according to claim 14, further comprising an air inlet pipeline, an air exhaust device and an air exhaust pipeline, wherein the air exhaust device is arranged a downstream of the acidic waste gas treating device and the air exhaust pipeline is arranged a downstream of the air exhaust device; the air inlet pipeline is arranged a upstream of the nitrogen monoxide oxidizing device and is connected to the nitrogen monoxide oxidizing device.",True,0.2063028812408447,0.915017821265574,60,74,-14,238,451,-213
"제14항에 있어서,상기 일산화질소 산화 장치는 하우징, 분사구, 순환 유체 저장소, 순환 유체 펌프, 액면계, 산화환원 전위계, 전도도계, 산화제 급수관, 급수관, 하수배수관, 산화제 용액의 보충을 제어하는 제1 밸브, 물의 보충을 제어하는 제2 밸브, 하수배출을 제어하는 제3 밸브, 자동제어장치, 질소 산화물 폐가스의 유입을 위한 유입구, 처리된 폐가스의 배출을 위한 가스 유출구, 및 순환 유체 수집 포트를 포함하고；상기 하우징 내에 상기 분사구가 배여되며, 상기 하우징의 상류에 상기 유입구가 배여되며, 하류에 상기 가스 유출구가 배여되며, 상기 하우징과 상기 순환 유체 저장소 사이에 순환 유체 수집 포트가 배여되며, 상기 순환 유체 펌프는 상기 순환 유체 저장소 내의 순환 유체를 펌핑하고, 분사구에 의해 상기 하우징에 진입시키고；상기 순환 유체 저장소는 상기 액면계, 상기 산화환원 전위계 및 상기 전도도계에 별도로 연결되며, 상기 자동제어장치는 상기 액면계에 전기적으로 연결되고, 상기 자동제어장치는 상기 제2 밸브에 전기적으로 연결되고, 상기 자동제어장치는 상기 산화환원 전위계에 전기적으로 연결되고, 상기 자동제어장치는 상기 제1 밸브에 전기적으로 연결되고, 상기 자동제어장치는 상기 전도도계에 전기적으로 연결되고, 상기 자동제어장치는 제3 밸브 전기적으로 연결되고, 상기 제1 밸브는 상기 산화제 급수관에 설치되며, 상기 제2 밸브는 상기 급수관에 설치되며, 상기 제3 밸브는 상기 하수배수관에 설치되는 것을 특징으로 하는 질소 산화물 폐가스의 습식 처리 시스템.","The system according to claim 14, wherein the nitrogen monoxide oxidizing device comprises a housing, a spray port, a circulating fluid reservoir, a circulating fluid pump, a liquid level gauge, a redox potential meter, a conductivity meter, an oxidizer solution supply pipe, a water supply pipe, a sewage discharge pipe, a first valve for controlling replenishment of an oxidizer solution, a second valve for controlling replenishment of water, a third valve for controlling discharge of sewage, an automatic controller, a gas inlet for entry of nitrogen oxide waste gas, a gas outlet for discharge of the treated waste gas, and a circulating fluid collection port; the spray port is arranged in the housing, the gas inlet is arranged a upstream of the housing and the gas outlet is arranged a downstream of the housing; the circulating fluid collection port is arranged between the housing and the circulating fluid reservoir; and a circulating fluid in the circulating fluid reservoir is pumped by the circulating fluid pump, and enters the housing through the spray port; and the circulating fluid reservoir is separately connected to the liquid level gauge, the redox potential meter, and the conductivity meter; the automatic controller is electrically connected to the liquid level gauge, the automatic controller is electrically connected to the second valve, the automatic controller is electrically connected to the redox potential meter, the automatic controller is electrically connected to the first valve, the automatic controller is electrically connected to the conductivity meter, and the automatic controller is electrically connected to the third valve; and the first valve is arranged on the oxidizer solution supply pipe, the second valve is arranged on the water supply pipe, and the third valve is arranged on the sewage discharge pipe.",True,0.224509134888649,0.9032198463300964,180,290,-110,774,1859,-1085
"제14항에 있어서,상기 이산화질소 환원 장치는 하우징, 분사구, 순환 유체 저장소, 순환 유체 펌프, 액면계, 산화환원 전위계, 전도도계, 환원제 급수관, 급수관, 하수배수관, 환원제 용액 보충을 제어하는 제1 밸브, 물의 보충을 제어하는 제2 밸브, 하수배출을 제어하는 제3 밸브, 자동제어장치, 일산화질소 산화 장치에 의해 처리된 폐가스의 유입을 위한 유입구, 처리된 폐가스의 배출을 위한 가스 유출구 및 순환 유체 수집 포트를 포함하고,상기 하우징 내에 상기 분사구가 배여되며, 상기 하우징의 상류에 상기 유입구가 배여되며, 하류에 상기 가스 유출구가 배여되며, 상기 하우징과 상기 순환 유체 저장소 사이에 순환 유체 수집 포트가 배여되며, 상기 순환 유체 펌프는 상기 순환 유체 저장소 내의 순환 유체를 펌핑하고, 분사구에 의해 상기 하우징에 진입시키고；상기 순환 유체 저장소는 상기 액면계, 상기 산화환원 전위계 및 상기 전도도계에 별도로 연결되며, 상기 자동제어장치는 상기 액면계에 전기적으로 연결되고, 상기 자동제어장치는 상기 제2 밸브에 전기적으로 연결되고, 상기 자동제어장치는 상기 산화환원 전위계에 전기적으로 연결되고, 상기 자동제어장치는 상기 제1 밸브에 전기적으로 연결되고, 상기 자동제어장치는 상기 전도도계에 전기적으로 연결되고, 상기 자동제어장치는 제3 밸브 전기적으로 연결되고, 상기 제1 밸브는 상기 환원제 급수관에 설치되고, 상기 제2 밸브는 상기 급수관에 설치되며, 상기 제3 밸브는 상기 하수배수관에 설치되는 것을 특징으로 하는 질소 산화물 폐가스의 습식 처리 시스템.","The system according to claim 14, wherein the nitrogen dioxide reducing device comprises a housing, a spray port, a circulating fluid reservoir, a circulating fluid pump, a liquid level gauge, a redox potential meter, a conductivity meter, a reductant solution supply pipe, a water supply pipe, a sewage discharge pipe, a first valve for controlling replenishment of a reductant solution, a second valve for controlling replenishment of water, a third valve for controlling discharge of sewage, an automatic controller, a gas inlet for entry of waste gas treated by the nitrogen monoxide oxidizing device, a gas outlet for discharge of the treated waste gas, and a circulating fluid collection port; the spray port is arranged in the housing, the gas inlet is arranged a upstream of the housing and the gas outlet is arranged a downstream of the housing; the circulating fluid collection port is arranged between the housing and the circulating fluid reservoir; and a circulating fluid in the circulating fluid reservoir is pumped by the circulating fluid pump, and enters the housing through the spray port; and the circulating fluid reservoir is separately connected to the liquid level gauge, the redox potential meter, and the conductivity meter; the automatic controller is electrically connected to the liquid level gauge, the automatic controller is electrically connected to the second valve, the automatic controller is electrically connected to the redox potential meter, the automatic controller is electrically connected to the first valve, the automatic controller is electrically connected to the conductivity meter, and the automatic controller is electrically connected to the third valve; and the first valve is arranged on the reductant solution supply pipe, the second valve is arranged on the water supply pipe and the third valve is arranged on the sewage discharge pipe.",True,0.218277171254158,0.9045167416582848,183,295,-112,785,1892,-1107
"제14항에 있어서,상기 산성 폐가스 처리 장치는 하우징, 분사구, 순환 유체 저장소, 순환 유체 펌프, 액면계, pH 값 테스터, 전도도계, 수산화나트륨 급수관, 급수관, 하수배수관，수산화나트륨 용액 보충을 제어하는 제1 밸브, 물의 보충을 제어하는 제2 밸브, 하수배출을 제어하는 제3 밸브, 자동제어장치, 산화질소 환원 장치에 의해 처리된 폐가스의 유입을 위한 유입구, 처리된 폐가스의 배출을 위한 가스 유출구, 및 순환 유체 수집 포트를 포함하고,상기 하우징 내에 상기 분사구가 배여되며, 상기 하우징의 상류에 상기 유입구가 배여되며, 하류에 상기 가스 유출구가 배여되며, 상기 하우징과 상기 순환 유체 저장소 사이에 순환 유체 수집 포트가 배여되며, 상기 순환 유체 펌프는 상기 순환 유체 저장소 내의 순환 유체를 펌핑하고, 분사구에 의해 상기 하우징에 진입시키고；상기 순환 유체 저장소는 상기 액면계, 상기 pH 값 테스터 및 상기 전도도계에 별도로 연결되고, 상기 자동제어장치는 상기 액면계에 전기적으로 연결되고, 상기 자동제어장치는 상기 제2 밸브에 전기적으로 연결되고, 상기 자동제어장치는 상기 pH 값 테스터에 전기적으로 연결되고, 상기 자동제어장치는 상기 제1 밸브에 전기적으로 연결되고, 상기 자동제어장치는 상기 전도도계에 전기적으로 연결되고, 상기 자동제어장치는 제3 밸브 전기적으로 연결되고, 상기 제1 밸브는 상기 수산화나트륨 급수관에 설치되고, 상기 제2 밸브는 상기 급수관에 설치되며, 상기 제3 밸브는 상기 하수배수관에 설치되는 것을 특징으로 하는 질소 산화물 폐가스의 습식 처리 시스템.","The system according to claim 14, wherein the acidic waste gas treating device comprises a housing, a spray port, a circulating fluid reservoir, a circulating fluid pump, a liquid level gauge, a pH value tester, a conductivity meter, a sodium hydroxide solution supply pipe, a water supply pipe, a sewage discharge pipe, a first valve for controlling replenishment of a sodium hydroxide solution, a second valve for controlling replenishment of water, a third valve for controlling discharge of sewage, an automatic controller, a gas inlet for entry of waste gas treated by the nitrogen dioxide reducing device, a gas outlet for discharge of the treated waste gas, and a circulating fluid collection port; the spray port is arranged in the housing, the gas inlet is arranged a upstream of the housing and the gas outlet is arranged a downstream of the housing; the circulating fluid collection port is arranged between the housing and the circulating fluid reservoir; and a circulating fluid in the circulating fluid reservoir is pumped by the circulating fluid pump, and enters the housing through the spray port; and the circulating fluid reservoir is separately connected to the liquid level gauge, the pH value tester, and the conductivity meter; the automatic controller is electrically connected to the liquid level gauge, the automatic controller is electrically connected to the second valve, the automatic controller is electrically connected to the pH value tester, the automatic controller is electrically connected to the first valve, the automatic controller is electrically connected to the conductivity meter, and the automatic controller is electrically connected to the third valve; and the first valve is arranged on the sodium hydroxide solution supply pipe, the second valve is arranged on the water supply pipe, and the third valve is arranged on the sewage discharge pipe.",True,0.1968561112880706,0.9148079880996568,186,299,-113,794,1894,-1100
"또는 상기 단백질 변이체는 서열번호 1의 아미노산 서열에서 N-말단으로부터 136번째 아미노산이 아스파라진(Asparagine), 알지닌(Arginine), 페닐알라닌(Phenylalanine), 세린(Serine), 타이로신(Tyrosine), 메치오닌(Methionine), 시스테인(Cysteine), 프롤린(Proline), 히스티딘(Histidine), 류신(Leucine), 이소류신(Isoleucine), 쓰레오닌(Threonine), 라이신(Lysine), 발린(Valine), 알라닌(Alanine), 아스파르산(Aspartic acid), 글루탐산(Glutamic acid), 글라이신(Glycine) 또는 트립토판(Tryptophan)으로 치환된 변이체일 수 있으나, 이에 제한되지 않는다.","Alternatively, the protein variant may be a variant in which the amino acid at position 136 from the N-terminus of the amino acid sequence of SEQ ID NO: 1 is substituted with asparagine, arginine, phenylalanine, serine, tyrosine, methionine, cysteine, proline, histidine, leucine, isoleucine, threonine, lysine, valine, alanine, aspartic acid, glutamic acid, glycine, or tryptophan, but is not limited thereto.",True,0.1901573091745376,0.8936861258397917,40,59,-19,397,410,-13
이와 같은 본 출원의 단백질 변이체는 변이 전 단백질에 비해 활성이 강화된 아세토하이드록시산 신타제 활성을 갖는다.,"As described, the protein variant of the present disclosure has the enhanced -7acetohydroxy acid synthase activity, as compared with that of the protein before modification.",True,0.3598493635654449,0.7558523320698298,16,25,-9,64,173,-109
"본 출원의 서열번호 1의 서열에서 N-말단으로부터 136번째 아미노산이 다른 아미노산으로 치환된 단백질 변이체는, 상기 136번에 상응하는 위치의 아미노산이 다른 아미노산으로 치환된 단백질 변이체를 포함하는 것은 자명하다.","It is apparent that the protein variant of the present disclosure, in which the amino acid at position 136 from the N-terminus of the sequence of SEQ ID NO: 1 is substituted with another amino acid, includes a protein variant in which an amino acid at a position corresponding to position 136 is substituted with another amino acid.",True,0.1808662265539169,0.900696563982302,26,58,-32,124,332,-208
"상기 서열번호 1의 서열에서 N-말단으로부터 136번째 아미노산이 다른 아미노산으로 치환된 단백질 변이체는 서열번호 12, 서열번호 47, 서열번호 48, 서열번호 49, 서열번호 50, 서열번호 51, 서열번호 52, 서열번호 53, 서열번호 54, 서열번호 55, 서열번호 56, 서열번호 57, 서열번호 58, 서열번호 59, 서열번호 60, 서열번호 61, 서열번호 62 또는 서열번호 63의 아미노산 서열을 포함하는 것일 수 있고, 구체적으로는 서열번호 12, 서열번호 47, 서열번호 48, 서열번호 49, 서열번호 50, 서열번호 51, 서열번호 52, 서열번호 53, 서열번호 54, 서열번호 55, 서열번호 56, 서열번호 57, 서열번호 58, 서열번호 59, 서열번호 60, 서열번호 61, 서열번호 62 및 서열번호 63 중 어느 하나의 아미노산 서열로 필수적으로 구성되는(consisting essentially of) 것일 수 있고, 보다 구체적으로는 서열번호 12, 서열번호 47, 서열번호 48, 서열번호 49, 서열번호 50, 서열번호 51, 서열번호 52, 서열번호 53, 서열번호 54, 서열번호 55, 서열번호 56, 서열번호 57, 서열번호 58, 서열번호 59, 서열번호 60, 서열번호 61, 서열번호 62 및 서열번호 63 중 어느 하나의 아미노산 서열로 이루어진 것일 수 있으나 이에 제한되지 않는다.","The protein variant, in which the amino acid at position 136 from the N-terminus of the sequence of SEQ ID NO: 1 is substituted with another amino acid, may include an amino acid sequence of SEQ ID NO: 12, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, or SEQ ID NO: 63, specifically, may consist essentially of any one of amino acid sequences of SEQ ID NO: 12, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, and SEQ ID NO: 63, and more specifically, may consist of any one of amino acid sequences of SEQ ID NO: 12, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, and SEQ ID NO: 63, but is not limited thereto.",True,0.1977599412202835,0.8964648254415472,156,284,-128,697,1188,-491
"또한, 상기 단백질 변이체는 서열번호 12, 서열번호 47, 서열번호 48, 서열번호 49, 서열번호 50, 서열번호 51, 서열번호 52, 서열번호 53, 서열번호 54, 서열번호 55, 서열번호 56, 서열번호 57, 서열번호 58, 서열번호 59, 서열번호 60, 서열번호 61, 서열번호 62 및 서열번호 63 중 어느 하나의 아미노산 서열 또는 서열번호 1의 아미노산 서열에서, N-말단으로부터 136번째 아미노산은 고정되고, 이와 80% 이상의 상동성 또는 동일성을 갖는 아미노산 서열을 포함할 수 있으나, 이에 제한되는 것은 아니다.","Further, the protein variant may include any one amino acid sequence of SEQ ID NO: 12, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, and SEQ ID NO: 63, or may include an amino acid sequence having 80% or more homology or identity to the amino acid sequence of SEQ ID NO: 1, provided that -8the amino acid at position 136 from the N-terminus of the amino acid sequence of SEQ ID NO: 1 is not changed, but is not limited thereto.",True,0.1379220634698867,0.9298858230003711,71,138,-67,305,621,-316
"구체적으로 본 출원의 상기 변이형 폴리펩티드는 서열번호 12, 서열번호 47, 서열번호 48, 서열번호 49, 서열번호 50, 서열번호 51, 서열번호 52, 서열번호 53, 서열번호 54, 서열번호 55, 서열번호 56, 서열번호 57, 서열번호 58, 서열번호 59, 서열번호 60, 서열번호 61, 서열번호 62 및 서열번호 63 중 어느 하나 및, 상기 서열번호 12, 서열번호 47, 서열번호 48, 서열번호 49, 서열번호 50, 서열번호 51, 서열번호 52, 서열번호 53, 서열번호 54, 서열번호 55, 서열번호 56, 서열번호 57, 서열번호 58, 서열번호 59, 서열번호 60, 서열번호 61, 서열번호 62 및 서열번호 63 중 어느 하나의 아미노산 서열과 적어도 80%, 90%, 95%, 96%, 97%, 98%, 또는 99% 상동성 또는 동일성을 가지는 폴리펩티드를 포함할 수 있다.","Specifically, the variant polypeptide of the present disclosure may include a polypeptide having at least 80%, 90%, 95%, 96%, 97%, 98%, or 99% homology or identity to any one amino acid sequence of SEQ ID NO: 12, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, and SEQ ID NO: 63, andto any one amino acid sequence of SEQ ID NO: 12, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, and SEQ ID NO: 63.",True,0.1890729665756225,0.9020166075720903,107,186,-79,455,782,-327
"또한, 이러한 상동성 또는 동일성을 가지며 상기 단백질에 상응하는 효능을 나타내는 아미노산 서열이라면 136번 아미노산 위치 이외에, 일부 서열이 결실, 변형, 치환 또는 부가된 아미노산 서열을 갖는 단백질도 본 출원의 범위 내에 포함됨은 자명하다.","Further, it is apparent that any protein having an amino acid sequence, part of which is deleted, modified, substituted, or added, in addition to the amino acid at position 136, may also be within the scope of the present disclosure, as long as the protein has such a homology or identity and exhibits efficacy corresponding to that of the above protein.",True,0.2268664091825485,0.879920678895599,34,61,-27,139,354,-215
본 출원에서 용어 '상동성(homology)' 또는 '동일성(identity)'은 두 개의,"As used herein, the term ""homology"" or ""identity"" refers to a degree of matching between two given amino acid sequences or nucleotide sequences, and may be expressed as a percentage.",False,0.5523027777671814,0.6444202114115164,8,30,-22,50,182,-132
용어 상동성 및 동일성은 종종 상호교환적으로 이용될 수 있다.,"The terms ""homology"" and ""identity"" may often be used interchangeably with each other.",True,0.239685907959938,0.8273366771843561,9,13,-4,34,86,-52
"보존된 (conserved) 폴리뉴클레오티드 또는 폴리펩티드의 서열 상동성 또는 동일성은 표준 배열 알고리즘에 의해 결정되며, 사용되는 프로그램에 의해 확립된 디폴트 갭 페널티가 함께 이용될 수 있다.","The sequence homology or identity of the conserved polynucleotide or polypeptide may be determined by standard alignment algorithms, and may be used with default gap penalties established by the program used.",True,0.1523934155702591,0.9153523242302936,25,31,-6,112,208,-96
"실질적으로, 상동성을 갖거나 (homologous) 또는 동일한 (identical) 서열은 일반적으로 서열 전체 또는 전체-길이의 적어도 약 50%, 60%, 70%, 80% 또는 90%를 따라 중간 또는 높은 엄격한 조건(stringent conditions)에서 하이브리드할 수 있다.","Substantially, homologous or identical sequences may hybridize under moderately or highly stringent conditions such that the full length of the sequence or at least about 50%, 60%, 70%, 80%, or 90% or more of the full length may hybridize.",True,0.1907726973295211,0.8898123266056771,31,39,-8,162,239,-77
하이브리드화는 폴리뉴클레오티드에서 코돈 대신 축퇴 코돈을 함유하는 폴리뉴클레오티드 또한 고려된다.,"In addition, contemplated are polynucleotides that contain degenerate codons in place of codons in the hybridization.",True,0.3340311348438263,0.7640930592886949,10,16,-6,54,117,-63
"임의의 두 폴리뉴클레오티드 또는 폴리펩티드 서열이 상동성, 유사성 또는 동일성을 갖는지 여부는 예를 들어, Pearson et al (1988)[Proc. Natl. Acad. Sci. USA 85]: 2444에서와 같은 디폴트 파라미터를 이용하여 ""FASTA"" 프로그램과 같은 공지의 컴퓨터 알고리즘을 이용하여 결정될 수 있다.","Whether or not any two polynucleotide or polypeptide sequences have homology, -9similarity, or identity may be determined using known computer algorithms such as the ""FASTA"" program, using, for example, the default parameters as in Pearson et al. (1988) [Proc.",True,0.2249562740325927,0.8826745695686704,38,39,-1,184,260,-76
"또는, EMBOSS 패키지의 니들만 프로그램(EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277)(버전 5.0.0 또는 이후 버전)에서 수행되는 바와 같은, 니들만-운치(Needleman-Wunsch) 알고리즘(Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453)이 사용되어 결정될 수 있다. (GCG 프로그램 패키지 (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP,BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego,1994, 및 [CARILLO ETA/.](1988) SIAM J Applied Math 48: 1073을 포함한다). 예를 들어, 국립 생물공학 정보 데이터베이스 센터의 BLAST, 또는 ClustalW를 이용하여 상동성, 유사성 또는 동일성을 결정할 수 있다.","48: 443-453) as implemented in the Needleman program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet.",False,0.501707911491394,0.6946506973339636,107,26,81,645,168,477
"폴리뉴클레오티드 또는 폴리펩티드의 상동성, 유사성 또는 동일성은 예를 들어, Smith and Waterman, Adv. Appl. Math (1981) 2:482 에 공지된 대로, 예를 들면, Needleman et al. (1970), J Mol Biol.48 : 443과 같은 GAP 컴퓨터 프로그램을 이용하여 서열 정보를 비교함으로써 결정될 수 있다.","Homology, similarity, or identity of polynucleotides or polypeptides may be determined, for example, by comparing sequence information using a GAP computer program such as Needleman et al. (1970), J Mol Biol.",False,0.2554017305374145,0.8590912540144517,42,31,11,200,208,-8
"요약하면, GAP 프로그램은 두 서열 중 더 짧은 것에서의 기호의 전체 수로, 유사한 배열된 기호(즉, 뉴클레오티드 또는 아미노산)의 수를 나눈 값으로 정의한다.","Briefly, the GAP program defines similarity as the number of aligned symbols (i.e., nucleotides or amino acids), which are similar, divided by the total number of symbols in the shorter of the two sequences.",True,0.155200183391571,0.9045897382172764,22,34,-12,90,207,-117
"GAP 프로그램을 위한 디폴트파라미터는 (1) 일진법 비교 매트릭스(동일성을 위해 1 그리고 비-동일성을 위해 0의 값을 함유함) 및 Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358 (1979)에 의해 개시된 대로, Gribskov et al(1986) Nucl. Acids Res. 14: 6745의 가중된 비교 매트릭스 (또는 EDNAFULL(NCBI NUC4.4의 EMBOSS 버전) 치환 매트릭스); (2) 각 갭을 위한 3.0의 페널티 및 각 갭에서 각 기호를 위한 추가의 0.10 페널티 (또는 갭 개방 패널티 10, 갭 연장 패널티 0.5); 및 (3) 말단 갭을 위한 무 페널티를 포함할 수 있다.",Default parameters for the GAP program may include: (1) a unary comparison matrix (containing a value of 1 for identities and 0 for non-identities) and the weighted comparison matrix of Gribskov et al. (1986) Nucl.,False,0.3821625113487243,0.7664480519179359,89,35,54,437,214,223
"또한, 임의의 두 폴리뉴클레오티드 또는 폴리펩티드 서열이 상동성, 유사성 또는 동일성을 갖는지 여부는 정의된 엄격한 조건하에서 써던 혼성화 실험에 의해 서열을 비교함으로써 확인할 수 있으며, 정의되는 적절한 혼성화 조건은 해당 기술 범위 내이고, 당업자에게 잘 알려진 방법(예컨대, J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; F.M. Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York)으로 결정될 수 있다.","Further, whether or not any two polynucleotide or polypeptide sequences have homology, similarity, or identity may be determined by comparing sequences by Southern - 10hybridization experiments under defined stringent conditions, and the defined appropriate hybridization conditions may be within the technical scope of the art and may be determined by a method well known to those skilled in the art (e.g., J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; F.M. Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York).",True,0.1458775848150253,0.9248429236459574,78,99,-21,411,650,-239
본 출원의 다른 하나의 양태는 상기 단백질 변이체를 코딩하는 폴리뉴클레오티드를 제공한다.,Another aspect of the present disclosure provides a polynucleotide encoding the protein variant.,True,0.1934626549482345,0.871854255271478,11,13,-2,49,96,-47
"본 출원에서 용어, ""폴리뉴클레오티드""는 뉴클레오티드 단위체(monomer)가 공유결합에 의해 길게 사슬모양으로 이어진 뉴클레오티드의 중합체(polymer)로 일정한 길이 이상의 DNA 또는 RNA 가닥으로서, 보다 구체적으로는 상기 단백질 변이체를 코딩하는 폴리뉴클레오티드 단편을 의미한다.","As used herein, the term ""polynucleotide"" refers to a DNA or RNA strand having a predetermined length or more, which is a long-chain polymer of nucleotides formed by linking nucleotide monomers via covalent bonds.",False,0.1797190457582473,0.8999404780511294,29,34,-5,163,213,-50
본 출원의 단백질 변이체를 코딩하는 폴리뉴클레오티드에는 아세토하이드록시산 신타제 활성을 갖는 단백질 변이체를 코딩하는 폴리뉴클레오티드 서열이라면 제한 없이 포함될 수 있다.,"The polynucleotide encoding the protein variant of the present disclosure may include any polynucleotide sequence without limitation, as long as it is a polynucleotide sequence encoding the protein variant having acetohydroxy acid synthase activity.",True,0.2301551699638366,0.872744464045344,20,34,-14,96,249,-153
"본 출원에서 상기 아세토하이드록시산 신타제 활성을 갖는 단백질의 아미노산 서열을 코딩하는 유전자는 ilvB 유전자일 수 있으며, 코리네박테리움 글루타미쿰(Corynebacterium glutamicum) 유래일 수 있고, 구체적으로는 서열번호 1의 아미노산 서열을 코딩하는 염기서열일 수 있으나, 이에 제한되지 않는다.","In the present disclosure, the gene encoding the amino acid sequence of the protein having acetohydroxy acid synthase activity may be ilvB gene, and may be derived from Corynebacterium glutamicum.",False,0.2679454088211059,0.8481589835992654,34,30,4,178,196,-18
"본 출원의 단백질 변이체를 코딩하는 폴리뉴클레오티드는 구체적으로, 서열번호 1의 아미노산 서열에서 136번 아미노산이 다른 아미노산으로 치환된 단백질 변이체를 코딩하는 폴리뉴클레오티드 서열이라면 제한없이 포함할 수 있다.","Specifically, the polynucleotide encoding the protein variant of the present disclosure may include any polynucleotide sequence without limitation, as long as it encodes the protein variant in which the amino acid at position 136 in the amino acid sequence of SEQ ID NO: 1 is substituted with another amino acid.",True,0.28006312251091,0.8605104792196065,25,50,-25,123,312,-189
"예를 들어, 본 출원의 폴리뉴클레오티드는 본 출원의 단백질 변이체, 구체적으로는 상기 서열번호 12, 서열번호 47, 서열번호 48, 서열번호 49, 서열번호 50, 서열번호 51, 서열번호 52, 서열번호 53, 서열번호 54, 서열번호 55, 서열번호 56, 서열번호 57, 서열번호 58, 서열번호 59, 서열번호 60, 서열번호 61, 서열번호 62 및 서열번호 63중의 어느 하나의 아미노산 서열을 포함하는 단백질 또는 이와 상동성 또는 동일성을 갖는 폴리펩티드를 코딩하는 폴리뉴클레오티드 서열일 수 있으나, 이에 제한되지 않는다.","For example, the polynucleotide of the present disclosure may be a polynucleotide sequence encoding the protein variant of the present disclosure, specifically, a protein including any one amino acid sequence of SEQ ID NO: 12, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, - 11 SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, and SEQ ID NO: 63, or a polypeptide having homology or identity thereto, but is not limited thereto.",True,0.1468162536621093,0.9309066388598874,69,119,-50,302,572,-270
상기 상동성 또는 동일성에 대해서는 전술한 바와 같다.,The homology or identity is the same as described above.,True,0.2624807953834533,0.8014418386972912,8,10,-2,30,56,-26
"또한, 상기 단백질 변이체를 코딩하는 폴리뉴클레오티드는 코돈의 축퇴성(degeneracy)으로 인하여 또는 상기 폴리펩티드를 발현시키고자 하는 생물에서 선호되는 코돈을 고려하여, 폴리펩티드의 아미노산 서열을 변화시키지 않는 범위내에서 코딩 영역에 다양한 변형이 이루어질 수 있다.","Additionally, in the polynucleotide encoding the protein variant, various modifications may be made in the coding region provided that they do not change the amino acid sequence of the polypeptide, due to codon degeneracy or in consideration of the codons preferred by the organism in which the polypeptide is to be expressed.",True,0.1641517132520675,0.9119873121534734,31,52,-21,156,326,-170
"또한, 상기 단백질 변이체를 코딩하는 폴리뉴클레오티드는 공지의 유전자 서열로부터 조제될 수 있는 프로브, 예를 들면, 상기 폴리뉴클레오티드 서열 전체 또는 일부에 대한 상보 서열과 엄격한 조건 하에 하이브리드화할 수 있는 서열번호 1의 아미노산 서열의 136번 아미노산이 다른 아미노산으로 치환된 단백질 변이체를 코딩하는 서열에 상응하는 서열을 포함하는 프로브라면 제한 없이 포함할 수 있다.","Further, the polynucleotide encoding the protein variant may include a probe which may be produced from a known nucleotide sequence, for example, any probe without limitation as long as it includes a sequence which hybridizes with a sequence complementary to all or a part of the polynucleotide sequence under stringent conditions to encode the protein variant in which another amino acid is substituted for the amino acid at position 136 in the amino acid sequence of SEQ ID NO: 1.",True,0.2474196851253509,0.8857329254055009,52,80,-28,219,482,-263
"상기 ""엄격한 조건""이란 폴리뉴클레오티드 간의 특이적 혼성화를 가능하게 하는 조건을 의미한다.","The term ""stringent conditions"" means conditions under which specific hybridization between polynucleotides is allowed.",True,0.1173244565725326,0.9194054811896304,11,14,-3,52,119,-67
"이러한 조건은 문헌 (예컨대, J. Sambrook et al., 상동)에 구체적으로 기재되어 있다.","Such conditions are described in detail in the literature (e.g., J. Sambrook et al., supra).",True,0.1099981069564819,0.926316645721855,12,15,-3,56,92,-36
"예를 들어, 상동성이 높은 유전자끼리, 40% 이상, 구체적으로는 90% 이상, 보다 구체적으로는 95% 이상, 더욱 구체적으로는 97% 이상, 특히 구체적으로는 99% 이상의 상동성을 갖는 유전자끼리 하이브리드화하고, 그보다 상동성이 낮은 유전자끼리 하이브리드화하지 않는 조건, 또는 통상의 써던 하이브리드화의 세척 조건인 60℃ 1X SSC, 0.1% SDS, 구체적으로는 60℃ 0.1X SSC, 0.1% SDS, 보다 구체적으로는 68℃ 0.1X SSC, 0.1% SDS에 상당하는 염 농도 및 온도에서, 1회, 구체적으로는 2회 내지 3회 세정하는 조건을 열거할 수 있다.","For example, the stringent conditions may include conditions under which genes having high homology of 40% or higher, specifically 90% or higher, more specifically 95% or higher, much more specifically 97% or higher, particularly specifically 99% or higher homology are hybridized with each other, and genes having homology lower than the above homology are not hybridized with each other, or ordinary washing conditions of Southern hybridization, i.e., washing once, specifically, twice or three times at a salt concentration and a temperature corresponding to 60°C 1X SSC, 0.1% SDS, specifically, 60°C 0.1X SSC, 0.1% SDS, and more specifically 68°C 0.1X SSC, 0.1% SDS.",True,0.110630452632904,0.9366081281548184,72,102,-30,325,670,-345
"그러나 이에 제한되는 것은 아니며, 그 목적에 따라 당업자에 의해 적절히 조절될 수 있다.","However, the stringent conditions are not limited thereto, and may be appropriately controlled by one of ordinary skill in the art according to the purposes.",True,0.2436786293983459,0.815413679956037,14,25,-11,50,157,-107
"혼성화는 비록 혼성화의 엄격도에 따라 염기 간의 미스매치 (mismatch)가 가능할지라도, 두 개의 폴리뉴클레오티드가 상보적 서열을 가질 것을 요구한다.","Although mismatch between nucleotides may occur due to the stringency of -12hybridization, it is required that the two polynucleotides have a complementary sequence.",True,0.3058072030544281,0.802895256591206,18,23,-5,86,165,-79
"용어, ""상보적""은 서로 혼성화가 가능한 뉴클레오티드 염기 간의 관계를 기술하는데 사용된다.","The term ""complementary"" is used to describe the relationship between nucleotide bases which may hybridize with each other.",True,0.2227205485105514,0.847652345206486,11,18,-7,51,123,-72
"예를 들면, DNA에 관하여, 아데노신은 티민에 상보적이며 시토신은 구아닌에 상보적이다.","For example, with respect to DNA, adenosine is complementary to thymine, and cytosine is complementary to guanine.",True,0.123745672404766,0.9128248350532184,10,17,-7,49,114,-65
"따라서, 본 출원은 또한 실질적으로 유사한 폴리뉴클레오티드 서열뿐만 아니라 전체 서열에 상보적인 단리된 폴리뉴클레오티드 단편을 포함할 수 있다.","Accordingly, the present disclosure may include not only the substantially similar polynucleotide sequences but also isolated polynucleotide fragments which are complementary to the entire sequence.",True,0.2139739692211151,0.8764938475292475,18,25,-7,80,198,-118
"구체적으로, 상동성을 가지는 폴리뉴클레오티드는 55℃의 Tm 값에서 혼성화 단계를 포함하는 혼성화 조건을 사용하고 상술한 조건을 사용하여 탐지할 수 있다.","Specifically, the polynucleotide having homology may be detected using hybridization conditions including the hybridization at a Tm value of 55°C and the conditions described above.",True,0.1223700419068336,0.9290918986540404,19,25,-6,86,181,-95
"또한, 상기 Tm 값은 60℃, 63℃ 또는 65℃일 수 있으나, 이에 제한되는 것은 아니고 그 목적에 따라 당업자에 의해 적절히 조절될 수 있다.","Additionally, the Tm value may be 60°C, 63°C, or 65°C, but is not limited thereto, and may be appropriately controlled by one of ordinary skill in the art according to the purposes.",True,0.1041512191295623,0.9307015671642824,23,32,-9,82,181,-99
"폴리뉴클레오티드를 혼성화하는 적절한 엄격도는 폴리뉴클레오티드의 길이 및 상보성 정도에 의존하고 변수는 해당기술분야에 잘 알려져 있다 (Sambrook et al., supra, 9.50-9.51, 11.7-11.8 참조).","Appropriate stringency for the hybridization of polynucleotides depends on the length and degree of complementarity of the polynucleotides, and the variables are well known in the art (see Sambrook et al., supra, 9.50-9.51, 11.7-11.8).",True,0.131292924284935,0.9199170419105238,22,34,-12,124,235,-111
본 출원의 다른 하나의 양태는 상기 단백질 변이체를 코딩하는 폴리뉴클레오티드를 포함하는 벡터를 제공한다.,Still another aspect of the present disclosure provides a vector including the polynucleotide encoding the protein variant.,True,0.1806715130805969,0.8842557696766492,13,17,-4,58,123,-65
"본 출원에서 사용된 용어 ""벡터""는 적합한 숙주 내에서 목적 단백질을 발현시킬 수 있도록 적합한 조절 서열에 작동 가능하게 연결된 상기 목적 단백질을 코딩하는 폴리뉴클레오티드의 염기서열을 함유하는 DNA 제조물을 의미한다.","As used herein, the term ""vector"" refers to a DNA construct that includes a nucleotide sequence of a polynucleotide encoding a target protein operably linked to an appropriate regulatory sequence to enable expression of the target protein in an appropriate host cell.",True,0.1831120997667312,0.898113576775665,29,42,-13,124,267,-143
"상기 조절 서열은 전사를 개시할 수 있는 프로모터, 그러한 전사를 조절하기 위한 임의의 오퍼레이터 서열, 적합한 mRNA 리보좀 결합부위를 코딩하는 서열, 및 전사 및 해독의 종결을 조절하는 서열을 포함할 수 있다.","The regulatory sequence may include a promoter capable of initiating transcription, any operator sequence for the regulation of such transcription, a sequence encoding an appropriate mRNA ribosome-binding domain, and a sequence regulating termination of transcription and translation.",True,0.1809401959180832,0.8924210155218893,31,37,-6,120,284,-164
"벡터는 적당한 숙주세포 내로 형질전환된 후, 숙주 게놈과 무관하게 복제되거나 기능할 수 있으며, 게놈 그 자체에 통합될 수 있다.","After the vector is transformed into the appropriate host cell, it may replicate or function independently of the host genome, and may be integrated into the genome itself.",True,0.1663688570261001,0.8880322254850899,19,28,-9,72,172,-100
"또한, 상기에서 용어 ""작동 가능하게 연결""된 것이란 본 출원의 목적 단백질을 코딩하는 폴리뉴클레오티드의 전사를 개시 및 매개하도록 하는 프로모터 서열과 상기 폴리뉴클레오티드 서열이 기능적으로 연결되어 있는 것을 의미한다.","As used herein, the term ""operably linked"" means a functional linkage between a - 13promoter sequence which initiates and mediates transcription of the polynucleotide encoding the target protein of the present disclosure and the polynucleotide sequence.",True,0.3457994759082794,0.7998284168796472,28,36,-8,124,253,-129
"작동 가능한 연결은 당업계의 공지된 유전자 재조합 기술을 이용하여 제조할 수 있으며, 부위-특이적 DNA 절단 및 연결은 당업계의 절단 및 연결 효소 등을 사용하여 제작할 수 있으나, 이에 제한되지 않는다.","The operable linkage may be prepared using a gene recombinant technique known in the art, and site-specific DNA cleavage and linkage may be prepared using enzymes for cleavage and ligation known in the art, etc., but is not limited thereto.",True,0.1482274979352951,0.9095367294885536,30,40,-10,115,240,-125
"본 출원에서 사용되는 벡터는 숙주세포 내에서 복제 가능한 것이면 특별히 한정되지 않으며, 당업계에 알려진 임의의 벡터를 이용할 수 있다.","The vector used in the present disclosure is not particularly limited, as long as it is able to replicate in the host cell, and any vector known in the art may be used.",True,0.1769460886716842,0.8822475412724695,19,33,-14,76,168,-92
"친수성 섬유의 함유량이 40 질량％ 미만인 경우에는, 충분한 유연성과 보수성을 부여할 수 없고, 70 질량％ 를 초과하는 경우에는, 습윤 시 강도가 지나치게 낮아서 찢어짐 등이 발생하기 쉬워짐과 함께, 용기로부터 팝업식으로 꺼낼 때에 신장이 지나치게 발생하게 된다.]","When the hydrophilic fiber is contained at a content of more than 70% by mass, the sheet has too small wet strength and is easy to be torn, so as to be stretched too much when taken out from the container by a pop-up method.",True,0.33919695019722,0.7637264216113602,36,45,-9,149,224,-75
[(겉보기 중량) ],(Basis Weight),True,0.347950667142868,0.7288621775873246,3,2,1,11,14,-3
"[본 발명의 닦아내기용 시트 (P) 의 경우, 시트의 겉보기 중량은 20 ∼ 80 g/㎡, 특히 30 ∼ 60 g/㎡ 정도인 것이 바람직하다.","A basis weight of the wiping sheet P of the present invention is preferably 20 to 80 g/m2, and particularly preferably 30 to 60 g/m2.",True,0.1251406520605087,0.9125740936300164,22,25,-3,79,133,-54
"시트의 겉보기 중량이 20 g/㎡ 미만에서는 오염 유지 능력이 부족해지고, 80 g/㎡ 를 초과하면 유연성이 부족해진다.]","When the basis weight of the sheet is less than 20 g/m2, the ability of the sheet to retain dirt becomes poor, and when the basis weight of the sheet exceeds 80 g/m2, the softness of the sheet becomes poor.",True,0.1706308126449585,0.8757884495314634,16,40,-24,68,206,-138
[[CNF] ],[CNF],True,0.0891748070716857,0.9431258796275812,2,1,1,8,5,3
"[CNF 는, 수분을 유지하는 특성을 갖고, 또한 안전성이 높은 소재로서, 펄프 섬유를 해섬하여 얻어지는 미세한 셀룰로오스 섬유이며, 일반적으로 섬유폭이 나노 사이즈 (1 ㎚ 이상, 1000 ㎚ 이하) 인 셀룰로오스 미세 섬유를 포함하는 셀룰로오스 섬유를 말하지만, 평균 섬유폭은 100 ㎚ 이하인 미세 섬유가 바람직하다.","Generally, cellulose fiber containing cellulose fine fibers having a fiber width of nano-scale (1 nm or more and 1000 nm or less) are referred to as CNF, and an average fiber width of the fine fibers is preferably less than 100 nm.",False,0.2759785056114192,0.8361714339063642,43,42,1,180,231,-51
"평균 섬유폭의 산출은, 예를 들어, 일정 수의 수평균, 메디안, 모드 지름 (최빈값) 등을 사용한다.]","The average fiber width is calculated from a certain number of fibers by using, for example, a number average, a median, or a mode diameter (the most frequent value).",True,0.2972267270088196,0.7848764952273232,14,29,-15,57,166,-109
[(CNF 에 사용 가능한 펄프 섬유) ],(Pulp Fiber used for CNF),True,0.2272068262100219,0.8458217678617057,7,5,2,23,25,-2
"[CNF 로서 사용 가능한 펄프 섬유로는, 예를 들어, 활엽수 펄프 (LBKP), 침엽수 펄프 (NBKP) 등의 화학 펄프, 표백 서모 메커니컬 펄프 (BTMP), 스톤 그라운드 펄프 (SGP), 가압 스톤 그라운드 펄프 (PGW), 리파이너 그라운드 펄프 (RGP), 케미그라운드 펄프 (CGP), 서모 그라운드 펄프 (TGP), 그라운드 펄프 (GP), 서모 메커니컬 펄프 (TMP), 케미 서모 메커니컬 펄프 (CTMP), 리파이너 메커니컬 펄프 (RMP) 등의 기계 펄프, 차 (茶) 고지 (古紙), 크라프트 봉투 고지, 잡지 고지, 신문 고지, 광고지 고지, 오피스 고지, 골판지 고지, 상백 (上白) 고지, 켄트 고지, 모조 (模造) 고지, 지권 (地券) 고지, 갱지 고지 등으로부터 제조되는 고지 펄프, 고지 펄프를 탈묵 처리한 탈묵 펄프 (DIP) 등을 들 수 있다.","Examples of pulp fiber that can be used as CNF include: chemical pulp such as hardwood pulp (LBKP) and conifer pulp (NBKP); mechanical pulp such as bleached thermo-mechanical pulp (BTMP), stone ground pulp (SGP), pressurized stone ground pulp (PGW), refiner ground pulp (RGP), chemi-ground pulp (CGP), thermo-ground pulp (TGP), ground pulp (GP), thermo-mechanical pulp (TMP), chemi-thermo-mechanical pulp (CTMP), refiner mechanical pulp (RMP); used paper pulp made from used brown paper, used craft envelope paper, used magazine paper, used newsprint paper, used leaflet paper, used office paper, used corrugated paper, used woodfree paper, used Kent paper, used simili paper, used grey cardboard paper, used coarse paper, and the like; and deinked pulp (DIP) made by deinking used paper pulp.",True,0.1727352887392044,0.8878603461683426,106,118,-12,437,793,-356
"이들은, 본 발명의 효과를 저해하지 않는 한, 단독으로 사용해도 되고, 복수 종을 조합하여 사용해도 된다.]","These may be used alone or in combination or two or more, as long as the effects of the invention are not impaired.",True,0.2106532752513885,0.839095597670684,15,23,-8,60,115,-55
[(해섬 방법) ],(Fibrillation Method),True,0.5528651475906372,0.5729952940560661,3,2,1,10,21,-11
"[CNF 의 제조에 사용되는 해섬 방법으로는, 예를 들어, 고압 호모게나이저법, 마이크로플루이다이저법, 그라인더 마쇄법, 비드 밀 동결 분쇄법, 초음파 해섬법 등의 기계적 수법을 들 수 있지만, 이들 방법에 한정되는 것은 아니다. ]","The fibrillation methods used in manufacturing the CNF may be, but are not limited to, a mechanical method such as high-pressure homogenizer, microfluidizer, grinder grinding, bead mill freezing and pulverizing, and ultrasonic fibrillation.",True,0.1949845105409622,0.8734966067451638,31,33,-2,130,240,-110
"[또한, 상기 해섬 방법 등에 의해 기계적 처리만 실시한 (변성시키지 않았다) CNF, 즉, 관능기 미수식의 CNF 는, 인산기나 카르복시메틸기 등의 관능기 수식된 것에 대하여, 열안정성이 높기 때문에, 보다 폭넓은 용도에 사용 가능하지만, 인산기나 카르복시메틸기 등의 관능기 수식된 CNF 를 본 발명에 사용하는 것도 가능하다.]","CNF that has been only mechanically treated by the above fibrillation methods (in other words, CNF that has not been modified), namely, CNF that has been subjected to no modification with functional groups, has higher thermal stability and therefore can be used in a wider range of applications than CNF that has been subjected to modification with functional groups such as phosphate groups and carboxymethyl groups.",False,0.2866049706935882,0.8300027297530799,44,66,-22,185,417,-232
"[또, 예를 들어, 펄프 섬유에 대하여 기계적 수법의 해섬 처리를 실시한 것에, 카르복시메틸화 등의 화학적 처리를 실시해도 되고, 효소 처리를 실시해도 된다.","Alternatively, for example, the pulp fiber may be mechanically treated by the fibrillation methods, and then chemically treated by carboxymethylation, or enzymatically treated.",True,0.2564389109611511,0.8285187840708251,22,23,-1,88,176,-88
"화학적 처리를 실시한 CNF 로는, 예를 들어, TEMPO 산화 CNF, 인산에스테르화 CNF, 아인산에스테르화 CNF 등의, 직경이 3 ∼ 4 ㎚ 가 되는 iCNF (individualized CNF) (싱글 나노 셀룰로오스) 를 들 수 있다. ]","Chemically treated CNF include, for example, iCNF (individualized CNF) (single nanocellulose) having a diameter of 3 to 4 nm, such as TEMPO-oxidized CNF, phosphorylated CNF, and phosphite esterified CNF.",True,0.1281535625457763,0.9256683108594114,33,29,4,139,203,-64
"[또, 화학적 처리나 효소 처리만을 실시한 CNF 나, 화학적 처리나 효소 처리를 실시한 CNF 에, 기계적 수법의 해섬 처리를 실시한 CNF 여도 된다.]","Alternatively, CNF treated only chemically or enzymatically, or CNF treated chemically or enzymatically and then treated mechanically by the fibrillation method may also be used.",True,0.2673370838165283,0.8277324315187338,23,25,-2,87,178,-91
[[CMC] ],[CMC],True,0.084395132958889,0.9421269566112516,2,1,1,8,5,3
"[또한, CNF 의 용액 중에서의 응집을 방지하기 위해서, 수용성 고분자인 CMC 를 첨가해도 된다. ]","In order to prevent CNF from aggregating in the solution, CMC, which is a water-soluble polymer, may be added to the solution.",True,0.2737423181533813,0.8287709337457619,15,22,-7,58,126,-68
"[CNF 를 수계 용매에 첨가한 경우, CNF 의 마이크로피브릴 섬유끼리가 결합하여 응집해 버리는 바, CMC 를 첨가하여 CNF 와 CMC 를 공존시킴으로써, CNF 의 OH 기와, CMC 의 OH 기가 수소 결합하고, 분자 사슬의 정전 상호 작용과 입체 장애 효과에 의해, CNF 의 응집이 방지되어, CNF 를 용액 중에 균일하게 분산시킬 수 있다.]","However, when CMC is added thereto so that CNF and CMC exist together, OH groups of the CNF and OH groups of the CMC form hydrogen bonds, and the electrostatic interaction of the molecular chains and the steric hindrance effect prevent CNF from aggregating.",False,0.3242162466049194,0.7975049736915666,53,44,9,199,257,-58
"[또한, CMC 는, 셀룰로오스를 원료로서 얻어지고, 완만한 생분해성을 가지며, 또한 사용 후의 소각 폐기가 가능하기 때문에, 매우 친환경 소재라는 점에서 바람직하게 사용되지만, CNF 의 용액 중에서의 응집을 방지할 수 있는 것이면, CMC 이외의 수용성 고분자를 사용하는 것으로 해도 된다.]","CMC is preferably used because it is obtained from cellulose as a raw material, has moderate biodegradability, and can be incinerated after use, thus being an extremely environmentally friendly material.",False,0.3339041769504547,0.7843591281649283,39,30,9,165,203,-38
"[또, CMC 를 첨가하는 경우에는, 용액 전체를 100.000 질량％ 로 했을 때에, 물을 93.000 ∼ 99.790 질량％, CNF 를 0.002 ∼ 0.020 질량％, 및 CMC 를 0.100 ∼ 1.000 질량％ 의 비율로 함유하고 있는 것이 바람직하다.]","CMC is preferably added such that the solution contains 93.000 to 99.790% by mass of water, 0.002 to 0.020% by mass of CNF, and 0.100 to 1.000% by mass of CMC, when the entire solution is 100.000% by mass.",True,0.1844432801008224,0.8913943000318081,36,39,-3,148,205,-57
"[또, 용액은, 섬유 집합 기재의 건조 중량에 대하여 100 ∼ 500 질량％ 의 범위 내에서 함침시킬 수 있지만, 200 ∼ 350 질량％ 로 함침시키는 것이 바람직하다.]","The solution can be impregnated in the range of 100 to 500% by mass relative to the dry weight of the fiber assembling base material, but preferably in the range of 200 to 350% by mass.",True,0.1818495690822601,0.8827413752936477,26,36,-10,97,185,-88
[U[attributes={}; value=[실시예]]],[Examples],False,0.5954400897026062,0.6165687604497192,2,1,1,31,10,21
"[이하, 실시예 및 도 3 에 나타내는 닦아내기용 시트 (P) 의 제조 방법의 플로 차트에 의해 본 발명을 구체적으로 설명하는데, 본 발명은 이들에 한정되는 것은 아니다.]","Hereinafter, the present invention is described in detail referring to examples and a flowchart of a manufacturing method of the wiping sheet P shown in FIG. 3, but the present invention is not limited to these.",True,0.2089617997407913,0.8554088563022533,26,36,-10,96,211,-115
[[샘플 제조] ],[Preparation of Sample],True,0.2063850462436676,0.8632123685813432,3,3,0,10,23,-13
"[먼저, 드라이 상태로 칭량 70 g/㎡ 의 11 ㎝ × 11 ㎝ 의 부직포 (섬유 배합 ; 레이온 : PET = 50 : 50) 를 준비하였다.","First, nonwoven fabrics (fiber blend; rayon : PET = 50 : 50) of 11 cm by 11 cm having a basis weight of 70 g/m2 in a dry state were prepared.",True,0.1421033442020416,0.9090619645395338,26,31,-5,81,141,-60
"드라이 상태란, 약액 등의 액체가 시트에 함침되어 있지 않은 상태이다. ]",The dry state means that the sheet is not impregnated with any liquid such as a pharmaceutical liquid.,True,0.2905342876911163,0.7767589640936584,11,18,-7,41,102,-61
"[이어서, 상기 부직포의 편면에만, 실시예 1 - 13 및 비교예 1 - 10 의 조건으로 용액을 도포하였다 (스텝 S1). ]","Next, solutions were applied to only one surface of the above nonwoven fabrics under respective conditions of Examples 1 to 13 and Comparative Examples 1 to 10 (Step S1).",True,0.299846738576889,0.8175586424368338,20,29,-9,71,170,-99
"[이어서, 60 ℃ 항온조에서 각 부직포를 1 일 정치 (靜置) 하여 열 건조시켜 (스텝 S2), 닦아내기용 시트 (P) 를 제조하였다. ]","Next, the nonwoven fabrics were left in a 60°C thermostatic bath for one day for thermal drying (Step S2), and the wiping sheets P were prepared.",True,0.2180284708738327,0.8491213814908499,21,26,-5,78,145,-67
[실시예 1 - 13 및 비교예 1 - 10 의 조건은 이하와 같다.],The conditions of Examples 1 to 13 and Comparative Examples 1 to 10 are as follows.,True,0.1971762478351593,0.880626736028421,13,16,-3,39,83,-44
[(실시예 1 - 4) ],(Examples 1 to 4),True,0.1341333836317062,0.9197877821192316,5,4,1,14,17,-3
"[도 1 에 나타내는 바와 같이, 직경 2 ∼ 3 ㎜ 이고, 서로 10 ∼ 15 ㎜ 떨어지도록, 마이크로피펫 (니치펫 EXII00-NPX2-1000) 으로 각각 농도 0.75 ％, 1.00 ％, 1.50 ％, 2.00 ％ 의 기계 처리 CNF 용액을 도트 형상으로 도포하였다.","Mechanically treated CNF solutions with respective concentrations of 0.75%, 1.00%, 1.50%, and 2.00% were applied using a micropipette (Nichipet EXII00-NPX2-1000) in the form of dots each having a diameter of 2 to 3 mm and separated from each other by 10 to 15 mm as shown in FIG. 1.",True,0.1919931918382644,0.882073270841316,40,49,-9,154,282,-128
"예를 들어, 0.75 ％ CNF 용액이란, 용매의 물 : CNF = 99.25 ％ : 0.75 ％ 인 용액이다.]","The CNF solution of 0.75%, for example, is a solution in which [water as solvent]: CNF = 99.25%: 0.75%.",True,0.1072999313473701,0.9428046822169702,18,19,-1,63,103,-40
[(실시예 5 - 8) ],(Examples 5 to 8),True,0.1318178921937942,0.9176411879476792,5,4,1,14,17,-3
"[각각 농도 0.75 ％, 1.00 ％, 1.50 ％, 2.00 ％ 의 효소 처리 CNF 용액을 도포하였다. ]","Enzymatically treated CNF solutions with respective concentrations of 0.75%, 1.00%, 1.50%, and 2.00% were applied.",True,0.2134556770324707,0.8700787825499554,17,15,2,62,114,-52
"[다른 조건은, 실시예 1 과 동일하다.]",The other conditions were the same as those in Example 1.,True,0.2598341703414917,0.8510255363656436,6,11,-5,23,57,-34
[(실시예 9 - 11) ],(Examples 9 to 11),True,0.1131434887647628,0.9307543031197044,5,4,1,15,18,-3
"[각각 농도 0.75 ％, 1.00 ％, 1.50 ％ 의 TEMPO 산화 CNF 용액을 도포하였다. ]","TEMPO-oxidized CNF solutions with respective concentrations of 0.75%, 1.00%, and 1.50% were applied.",True,0.2105478793382644,0.8760341943225197,15,13,2,57,100,-43
"[다른 조건은, 실시예 1 과 동일하다.]",The other conditions were the same as those in Example 1.,True,0.2598341703414917,0.8510255363656436,6,11,-5,23,57,-34
[(실시예 12 - 13) ],(Examples 12 to 13),True,0.1097065880894661,0.9297637199697792,5,4,1,16,19,-3
"[각각 농도 0.75 ％, 1.00 ％ 의 ELLEX-☆ 용액 (아인산에스테르화 CNF 수분산액) 을 도포하였다. ]",ELLEX-☆ (star) solutions (phosphite esterified CNF dispersed in water) with respective concentrations of 0.75% and 1.00% were applied.,True,0.3334885537624359,0.7984989195264772,15,18,-3,65,134,-69
[다른 조건은 실시예 1 과 동일하다.],The other conditions were the same as those in Example 1.,True,0.2663509547710418,0.8471600600130457,6,11,-5,22,57,-35
[(비교예 1) ],(Comparative Example 1),True,0.1563045978546142,0.9118616827883934,3,3,0,10,23,-13
[농도 0.50 ％ 의 기계 처리 CNF 용액을 도포하였다. ],A mechanically treated CNF solution with a concentration of 0.50% was applied.,True,0.2246992737054824,0.8629927977191515,10,12,-2,35,78,-43
[다른 조건은 실시예 1 과 동일하다.],The other conditions were the same as those in Example 1.,True,0.2663509547710418,0.8471600600130457,6,11,-5,22,57,-35
[(비교예 2) ],(Comparative Example 2),True,0.1530542075634002,0.909140060608172,3,3,0,10,23,-13
[농도 0.50 ％ 의 효소 처리 CNF 용액을 도포하였다. ],An enzymatically treated CNF solution with a concentration of 0.50% was applied.,True,0.2068404257297516,0.8763371059045424,10,12,-2,35,80,-45
[다른 조건은 실시예 1 과 동일하다.],The other conditions were the same as those in Example 1.,True,0.2663509547710418,0.8471600600130457,6,11,-5,22,57,-35
[(비교예 3) ],(Comparative Example 3),True,0.1489370614290237,0.911051190682962,3,3,0,10,23,-13
[농도 0.50 ％ 의 TEMPO 산화 CNF 용액을 도포하였다. ],A TEMPO-oxidized CNF solution with a concentration of 0.50% was applied.,True,0.1894347816705703,0.8884274143348925,10,11,-1,38,72,-34
[다른 조건은 실시예 1 과 동일하다.],The other conditions were the same as those in Example 1.,True,0.2663509547710418,0.8471600600130457,6,11,-5,22,57,-35
[(비교예 4) ],(Comparative Example 4),True,0.1610875427722931,0.9042158650262944,3,3,0,10,23,-13
[농도 0.50 ％ 의 ELLEX-☆ 용액을 도포하였다. ],An ELLEX-☆ (star) solution with a concentration of 0.50% was applied.,True,0.2296043038368225,0.8440360106625088,8,11,-3,33,69,-36
[다른 조건은 실시예 1 과 동일하다.],The other conditions were the same as those in Example 1.,True,0.2663509547710418,0.8471600600130457,6,11,-5,22,57,-35
[(비교예 5 - 9) ],(Comparative Examples 5 to 9),True,0.1646711975336074,0.8966417246404511,5,5,0,14,29,-15
"[각각 농도 0.50 ％, 0.75 ％, 1.00 ％, 1.50 ％, 2.00 ％ 의 CMC 용액을 도포하였다. ]","CMC solutions with respective concentrations of 0.50%, 0.75%, 1.00%, 1.50%, and 2.00% were applied.",True,0.204859972000122,0.8716340088321297,17,14,3,64,99,-35
"텍스타일 그리드 보강재와 고내구성 무기계 결합재를 이용하여 보수보강하는 콘크리트 구조물 및 그 보수보강 공법 {CONCRETE STRUCTURE FOR REPAIRING AND STRENGTHENING USING TEXTILE GRID REINFORCEMENT AND HIGHLY DURABLE INORGANIC BINDER, AND REPAIR AND STRENGTHENING METHOD FOR THE SAME}",BACKGROUND,False,1.0929375886917114,0.2045722488264047,37,1,36,232,10,222
"본 발명은 노후된 콘크리트 구조물의 보수보강 공법에 관한 것으로, 보다 구체적으로, 부착력을 향상시킨 텍스타일 그리드 보강재와 사용환경과 보강목적에 따라 염해저항성능이나 화학저항성능을 갖는 고내구성 무기계 결합재를 이용하여 노후 콘크리트 구조물을 보수보강하는, 텍스타일 그리드 보강재와 고내구성 무기계 결합재를 이용하여 보수보강하는 콘크리트 구조물 및 그 보수보강 공법에 관한 것이다.","The present invention relates to a method of repairing and reinforcing an old concrete structure and, more particularly, to a concrete structure repaired and reinforced using a textile grid reinforcement and a highly durable inorganic binder and a method of repairing and reinforcing the same, capable of repairing and reinforcing an old concrete structure using a highly durable inorganic binder having chloride penetration resistance performance or chemical resistance performance according to a use environment and a reinforcement purpose and a textile grid reinforcement having improved adhesiveness.",True,0.1964049488306045,0.9134720872725304,46,86,-40,215,604,-389
"2020년 기준 우리나라 사회기반시설 현황자료에 따르면, 노후시설물을 준공 후 30년을 기준으로 했을 때 교량, 터널, 지하철 등 사회기반시설의 37%는 노후시설물이고, 향후 20년 후에는 80%까지 증가될 예정이다.","According to data on the current state of infrastructure in Korea as of 2020, when facilities are considered old based on 30 years after completion, 37% of infrastructure such as bridges, tunnels, and subways are old facilities, and this is expected to rise to 80% in the next 20 years.",True,0.125450313091278,0.9233671525555688,26,50,-24,121,286,-165
"그러나 이러한 노후시설물은 예산 부족 등의 이유로 일시에 교체할 수 없기 때문에 수시로 점검을 실시하여 유지보수를 해야 하고, 특히, 구조적 성능이 부족한 시설물은 성능 개선공사를 실시하여 시설물의 안전을 확보하고 사용수명을 연장하는 것이 필요하다.","However, since these old facilities cannot be replaced at once due to reasons such as a budget shortage, the old facilities should be subjected to inspection and maintenance at any time.",False,0.2614351511001587,0.8127448812132837,33,31,2,139,186,-47
"교량, 터널, 지하철 등 사회기반시설은 물론 주택, 아파트 등 시설물의 90% 이상은 철근콘크리트로 시공되어 있다.","In addition to the infrastructure such as bridges, tunnels, and subways, 90% or more of facilities such as houses and apartments are constructed of reinforced concrete.",True,0.1780716180801391,0.8863961062676351,15,26,-11,64,168,-104
현재 노후 콘크리트 시설물 보수를 위해 다양한 보강공법이 적용중에 있다.,"At present, various reinforcing methods are applied to repair old concrete facilities.",True,0.1256183385848999,0.917674307158866,10,12,-2,40,86,-46
"그중에서도 고강도 탄소섬유, 아라미드섬유 등으로 제작된 시트(Sheet), 스트립(Strip), 패널(Panel) 등을 기존 구조물에 접착 시공하는 섬유보강재 접착 공법이 가장 일반적으로 사용되고 있다.","Among the reinforcing methods, a fiber reinforcement adhering method of adhering a sheet, a strip, a panel, etc. formed of a high-strength carbon fiber, an aramid fiber, or the like to an existing structure is most commonly used.",True,0.2851572930812835,0.8415072170471274,21,38,-17,113,229,-116
"한편, 도 1은 종래의 기술에 따른 섬유보강재 접착 공법으로서 탄소섬유 시트를 구조물에 접착 시공하는 것을 예시하는 사진으로서, 도 1의 a)는 구조물(10)에 탄소섬유 시트(20)를 접착한 것을 예시하는 사진이고, 도 1의 b)는 기둥 보강을 위해 기둥(10a)에 탄소섬유 시트(20)를 접착한 것을 예시하는 사진이고, 도 1의 c)는 빌딩 슬래브 보강을 위해 빌딩 천장(10b)에 탄소섬유 시트(20)를 접착한 것을 예시하는 사진이다.",FIG. 1C is a photograph illustrating how to adhere a carbon fiber sheet 20 to a building ceiling 10b in order to reinforce a building slab.,False,0.3475475013256073,0.827776643571711,55,26,29,245,139,106
"도 1의 a) 내지 c)에 도시된 바와 같이, 종래의 기술에 따른 고강도 섬유를 활용한 기존 노후구조물 보강 공법은 구조물(10)에 에폭시 수지 등 유기계 접착제를 먼저 도포하고, 그 위에 탄소섬유 시트(20)와 같은 섬유시트나 패널을 부착하는 방식이다.","As illustrated in FIGS. 1A to 1C, an existing old structure reinforcing method of utilizing a high-strength carbon fiber according to the related art is a method of applying an organic adhesive such as an epoxy resin to a structure 10 first, and adhering a fiber sheet such as a carbon fiber sheet 20 or a panel onto the organic adhesive.",True,0.2006420046091079,0.904502133614292,35,61,-26,142,338,-196
"하지만, 종래의 기술에 따른 섬유보강재 접착공법에 사용되는 유기계 접착제는 화재에 취약하여 고열에서 연소되어 접착력을 상실할 수 있다.","However, the organic adhesive used in the fiber reinforcement adhering method according to the related art is vulnerable to fire, and thus may burn at high temperature and lose adhesiveness.",True,0.1541579961776733,0.9044282706363596,17,30,-13,75,190,-115
"또한, 지하구조물 등 대부분의 시설물은 우수 등에 노출되기 때문에 표면이 젖기 쉽고, 이러한 유기계 접착제는 젖은 구조물 표면에 시공할 수 없는 단점이 있다.","Further, because most facilities such as underground structures are exposed to rainwater or the like, surfaces thereof easily become wet, and there is a disadvantage in that this organic adhesive cannot be applied on the surfaces of the wet structures.",True,0.1829491555690765,0.8907735493969751,23,40,-17,88,252,-164
"이에 따라, 유기계 접착제가 시공된 후, 접착 부위가 누수 등으로 인하여 수분에 노출되는 경우 접착력을 상실하여 섬유보강재가 탈락할 수 있다는 문제점이 있었다.","Thus, in the case where an adhered portion is exposed to moisture due to the leakage of water after the organic adhesive is applied, there is a problem in that the adhered portion may lose adhesiveness and a fiber reinforcement may be separated.",True,0.2264053076505661,0.8673219483408273,22,43,-21,89,245,-156
"한편, 선행기술로서, 대한민국 등록특허번호 제10-1740906호에는 ""콘크리트 구조물 바닥의 보수보강 공법""이라는 명칭의 발명이 개시되어 있는데, 도 2a 및 도 2b를 참조하여 설명한다.","Meanwhile, an invention entitled ""Repairing and reinforcing method of concrete floor"" is disclosed in Korean Patent No. 10-1740906 as the prior art, and will be described with reference to FIGS. 2A and 2B.",True,0.2223807424306869,0.872378274446484,21,33,-12,106,205,-99
"도 2a는 종래의 기술에 따른 콘크리트 구조물 바닥의 보수보강 공법을 적용한 구조물을 나타내는 구성도이고, 도 2b는 도 2a에 도시된 콘크리트 구조물 바닥의 보수보강 공법의 정착구를 나타내는 평면도이다.","FIG. 2A is a configuration diagram illustrating a structure to which a method of repairing and reinforcing a concrete floor according to the related art is applied, and FIG. 2B is a plan view illustrating an anchorage for the method of repairing and reinforcing a concrete floor illustrated in FIG. 2A.",True,0.298925518989563,0.8502877084099488,27,51,-24,114,302,-188
"도 2a를 참조하면, 종래의 기술에 따른 콘크리트 구조물 바닥의 보수보강 공법은, 콘크리트 구조물의 바닥(70)을 치핑하는 단계; 치핑된 콘크리트 구조물의 바닥(70)을 고압으로 세척하는 단계; 세척된 콘크리트 구조물의 바닥(70)에 접착제(30)를 도포하는 단계; 접착제(30)가 도포된 바닥에 보강그리드(40)를 포설하는 단계; 포설된 보강그리드(40)를 정착구(50)를 사용해서 바닥에 고정하는 단계; 및 보강그리드(40)가 고정된 콘크리트 구조물의 바닥(70)에 수중 마이크로 콘크리트(60)를 타설하는 단계를 포함하여 이루어진다.","Referring to FIG. 2A, the method of repairing and reinforcing a concrete floor according to the related art includes: an operation of chipping a concrete floor 70; an operation of washing the chipped concrete floor 70 with high pressure; an operation of applying an adhesive 30 to the washed concrete floor 70; an operation of installing a reinforcement grid 40 on the concrete floor to which the adhesive 30 is applied; an operation of fixing the installed reinforcement grid 40 to the floor using an anchorage 50, and an operation of pouring underwater micro concrete 60 on the concrete floor 70 to which the reinforcement grid 40 is fixed.",True,0.1650216877460479,0.9278857362866472,56,109,-53,301,642,-341
"여기서, 정착구(50)는 보강그리드(40)를 콘크리트 구조물의 바닥(70)에서 소정거리 이격시켜 고정시키도록 콘크리트 구조물의 바닥(70)에 입설되어 있는 지지부재로서, 도 2a 및 도 2b에 도시된 바와 같이, 매립편(51), 지지편(52) 및 고정편(53)을 포함하여 이루어지는 이지","Here, the anchorage 50 is an upright support member that is installed on the concrete floor 70 so as to fix the reinforcement grid 40 at a predetermined distance from the concrete floor 70.",False,0.3395261764526367,0.8325012910438018,30,34,-4,160,189,-29
스페이서(easy spacer) 정착구이다.,"As illustrated in FIGS. 2A and 2B, the anchorage 50 is an easy spacer anchorage that includes embedding pieces 51, a support piece 52, and a fixing piece 53.",False,0.7560436725616455,0.4577151598010167,3,29,-26,24,157,-133
"구체적으로, 정착구(50)는, 도 2a 및 도 2b에 도시된 바와 같이, 바닥의 상부에 지지되며 격자형상의 보강그리드의 교차부위의 하부를 지지하는 지지편(52); 지지편(52)을 바닥에 고정시키도록 바닥에 매립되는 매립편(51); 및 지지편(52)의 상부에 설치되어 보강그리드(40)를 고정시키는 고정편(53)을 포함한다.","Specifically, as illustrated in FIGS. 2A and 2B, the anchorage 50 includes the support piece 52 that is supported at an upper portion of the floor and supports a lower portion of a cross portion of a grid-shaped reinforcement grid, the embedding pieces 51 that are embedded in the floor so as to fix the support piece 52 to the floor, and the fixing piece 53 that is installed at an upper portion of the support piece 52 and fixes the reinforcement grid 40.",True,0.1297768354415893,0.9373489896235964,33,84,-51,180,457,-277
"또한, 도 2a 및 도 2b에 도시된 바와 같이, 지지편(52)의 상부 둘레에는 매립편(51)이 삽입되어 체결고정되는 복수개의 고정홀(52a)이 상하방향으로 관통 형성되어 있고, 지지편(52)의 상면에는 격자형상의 보강그리드의 교차부위가 끼워맞춤되는 일자형상의 끼움홈(52b)이 서로 교차하도록 형성되어 있고, 지지편(52)의 측면 둘레에는 고정편과 결합하기 위한 결합턱(52c)이 돌출형성되어 있다.","Further, as illustrated in FIGS. 2A and 2B, a plurality of fixing holes 52a, into which the embedding pieces 51 are inserted, fastened, and fixed, are formed around the upper portion of the support piece 52 so as to pass through the support piece 52 in a vertical direction.",False,0.2369386851787567,0.8743243201890978,42,49,-7,224,274,-50
"종래의 기술에 따른 콘크리트 구조물 바닥의 보수보강 공법에 따르면, 콘크리트 구조물의 바닥(70)에 보강그리드(40)를 정착구(50)에 의해 고정하고 수중 마이크로 콘크리트(60)를 타설해서 보수 및 보강함으로써, 콘크리트 구조물의 바닥(70)에 대한 보수성능 및 보강강도를 향상시킬 수 있고, 또한, 보강그리드(40)로 보강하도록 구성함으로써, 보강그리드(40)와 수중 마이크로 콘크리트(60) 사이의 결합성 및 혼합성을 향상시킬 수 있다.","According to the method of repairing and reinforcing a concrete floor according to the related art, the concrete floor is repaired and reinforced by fixing the reinforcement grid 40 to the concrete floor 70 using the anchorage 50 and pouring the underwater micro concrete 60, and thereby repairing performance and reinforcing strength of the concrete floor 70 can be improved.",False,0.2273415923118591,0.8991913910770696,48,60,-12,247,376,-129
"또한, 종래의 기술에 따른 콘크리트 구조물 바닥의 보수보강 공법에 따르면, 보강그리드(40)를 바닥에서 소정거리 이격시켜 고정시키도록 콘크리트 구조물 바닥(70)에 정착구(50)를 입설함으로써, 보강그리드(40)를 콘크리트 구조물 바닥(70)에서 소정거리 이격시켜 보강그리드(40)의 매립깊이를 일정하게 유지할 수 있고, 또한, 정착구(50)로서 매립편(51), 지지편(52) 및 고정편(53)을 구비함으로써, 수중 마이크로 콘크리트(60)의 타설 높이에 따라 보강그리드(40)의 이격거리를 조절해서 고정할 수 있다.","Further, according to the method of repairing and reinforcing a concrete floor according to the related art, the upright anchorage 50 is installed on the concrete floor 70 such that the reinforcement grid 40 is fixed at a predetermined distance from the floor, and thereby an embedded depth of the reinforcement grid 40 can be constantly maintained by spacing the reinforcement grid 40 apart from the concrete floor 70 by a predetermined distance.",False,0.2616531252861023,0.8814855229380922,51,73,-22,289,447,-158
"전술한 바와 같이, 종래의 기술에 따른 콘크리트 구조물 바닥의 보수보강 공법의 경우, 콘크리트 구조물 바닥(70)을 치핑한 후, 세척하고 접착제(30)를 도포한 뒤, 보강그리드(40)를 포설하되, 정착구(50)를 사용해 바닥에 고정시키며, 그 상면에 수중 마이크로 콘크리트(60)를 타설하여 보강함으로써 콘크리트 구조물 바닥(70)의 보수성능 및 보강강도를 향상시킬 수 있다. 하지만, 종래의 기술에 따른 콘크리트 구조물 바닥의 보수보강 공법의 경우, 보강그리드(40)의 고정을 위해 별도의 접착제(30)를 도포하는 방식이므로, 접착제(30)가 시공된 후, 접착 부위가 누수 등으로 인하여 수분에 노출되는 경우 접착력을 상실하여 보강그리드(40)가 탈락할 수 있다는 문제점이 있었다.","As described above, in the case of the method of repairing and reinforcing a concrete floor according to the related art, by chipping and then washing the concrete floor 70, applying the adhesive 30, installing the reinforcement grid 40, fixing the reinforcement grid 40 to the floor using the anchorage 50, and pouring and reinforcing the underwater micro concrete 60 on an upper surface of the reinforcement grid 40, repairing performance and reinforcing strength of the concrete floor 70 can be improved.",False,0.2315601110458374,0.9012329744168298,79,82,-3,382,507,-125
"한편, 다른 선행기술로서, 대한민국 등록특허번호 제10-1972265호에는 ""고강도 모르타르 조성물 및 보강재를 이용한 콘크리트 구조물 보수보강 공법""이라는 명칭의 발명이 개시되어 있는데, 도 3a 및 도 3b를 참조하여 설명한다.","Meanwhile, an invention entitled ""Method of repairing and reinforcing concrete structure using high strength mortar composition and stiffener"" is disclosed in Korean Patent No. 10-1972265 as another prior art and will be described with reference to FIGS. 3A and 3B.",True,0.2477671355009079,0.8626716798046824,27,40,-13,129,265,-136
"도 3a는 종래의 기술에 따른 콘크리트 구조물 보수보강 공법에 적용되는 와이어메쉬 부재를 나타낸 정면도이고, 도 3b는 종래의 기술에 따른 콘크리트 구조물 보수보강 공법에 의해 와이어메쉬 부재가 시공된 상태를 나타낸 도면이다.","FIG. 3A is a front view illustrating a wire mesh member applied in a method of repairing and reinforcing a concrete structure according to the related art, and FIG. 3B is a view illustrating a state in which the wire mesh member is constructed by the method of repairing and reinforcing a concrete structure according to the related art.",True,0.3063850104808807,0.8426484932424635,30,59,-29,126,337,-211
"도 3a 및 도 3b를 참조하면, 종래의 기술에 따른 콘크리트 구조물 보수보강 공법은, a) 보수하고자 하는 콘크리트 구조물(91)의 보수 시공면(91a)을 다듬어 면처리하는 기초보수단계; b) 기초보수단계를 거친 시공면(91a)에 스테인레스-스틸로 이루어진 와이어메쉬 부재(80)를 배치하고 볼트로 시공면(91a)에 고정시키는 와이어메쉬 부착단계; c) 시공면(91a)에 콘크리트 구조물 보수보강용 모르타르를 도포하여 와이어메쉬 부재(80)가 매립되도록 보강층(92)을 형성시킨 후 경화시키는 보강층 형성단계; 및 d) 상기 형성된 보강층(92)의 표면에 표면보호재를 도포하여 코팅시키는 코팅층 형성단계를 포함하여 이루어진다.","Referring to FIGS. 3A and 3B, the method of repairing and reinforcing a concrete structure according to the related art includes: a) a foundation repairing operation of trimming and surface-treating a repair work surface 91a of a concrete structure 91 to be repaired; b) a wire mesh attaching operation of disposing a wire mesh member 80 formed of stainless steel and steel on the work surface 91a after the foundation repairing operation and fixing the wire mesh member 80 to the work surface 91a with bolts; c) a reinforcement layer forming operation of forming and hardening a reinforcement layer 92 such that the wire mesh member 80 is embedded by applying mortar for repairing and reinforcing a concrete structure to the construction surface 91a; and d) a coating layer forming operation of applying and coating a surface protective agent on a surface of the formed reinforcement layer 92.",True,0.160945251584053,0.9311710024960618,66,148,-82,351,894,-543
"여기서, 와이어메쉬 부재(80)는 금속재로 이루어진 와이어(81)들과 상기 와이어(81)들을 고정시키는 금속재로 이루어지며 박판인 다수의 연결패널(82)로 이루어진다.","Here, the wire mesh member 80 includes wires 81 formed of a metal, and numerous connecting panels 82 that are formed of a metal for fixing the wires 81 and are thin sheets.",True,0.1139304414391517,0.9348195167132114,15,33,-18,93,172,-79
"이때, 연결패널(82)은 가압에 의해 절곡되는 강판이나 알루미늄판 또는 합금판을 사용할 수 있다.","In this case, a steel plate, an aluminum plate, or an alloy plate bent by pressing under pressure may be used for the connecting panels 82.",True,0.1843963712453842,0.8869750548053802,12,26,-14,54,139,-85
"구체적으로, 연결패널(82)은, 도 3a 및 도 3b에 도시된 바와 같이, 볼트가 체결되도록 길이방향을 따라 형성되는 다수의 체결홀(82a); 와이어(81)들을 고정시키도록 연결패널(82)의 양측에 일단이 연결되도록 절취되게 형성되어 와이어(81)를 감싸면서 절곡되는 고정날개부(82b)들; 및 연결패널(82)에 형성되며 고정날개부(82b)들 사이에 배치되고, 절곡선이 형성되며 절곡선을 중심으로 하향 절곡되어, 시공면(91a)에 지지되는 지지다리부(82c)들로 이루어진다.","Specifically, as illustrated in FIGS. 3A and 3B, each of the connecting panels 82 is made up of: numerous fastening holes 82a that are provided in a lengthwise direction such that bolts are fastened; fixing wings 82b that are provided on both sides of the connecting panel 82 so as to fix each wire 81 such that one ends thereof are connected and are bent while surrounding each wire 81; and support legs 82c that are provided at the connecting panel 82, are disposed between the fixing wings 82b, have bending lines, are bent downward from bending lines, and are supported on the work surface 91a.",True,0.1549786329269409,0.9151123262006536,45,106,-61,265,598,-333
"여기서, 절곡선은 절곡이 용이하도록 프레스로 가압하여 형성시킨 긴 홈이다.","Here, the bending lines are long grooves that are pressed and formed by a press such that bending is made easy.",True,0.2157398909330368,0.8387611313227898,9,21,-12,41,111,-70
"이에 따라, 지지다리부(82c)는 도 3b에 도시된 것과 같이, 길이 방향을 따라 길게 형성되어, 볼트를 체결하여 연결패널(82)이 시공면(91a) 방향으로 가압되어도 지지다리(82c)가 눌려지거나 휘어지지 않게 된다.","Accordingly, as illustrated in FIG. 3B, the support legs 82c are formed long in a lengthwise direction, and are not distorted or warped even if bolts are fastened and the connecting panel 82 is pressed toward the work surface 91a.",True,0.1420942395925521,0.9180740445498494,24,40,-16,122,230,-108
"또한, 연결패널(82)에는 고정날개부(82b)와 지지다리부(82c)가 상호 교차되게 반복 형성되어, 일정 간격을 유지하며 배치되는 와이어(81)를 고정시킬 수 있다.","Further, the fixing wings 82b and the support legs 82c are alternately provided on the connecting panel 82 to be able to fix the wires 81 disposed at regular intervals.",True,0.2024391293525695,0.8790386454344574,16,30,-14,92,168,-76
"또한, 콘크리트 구조물 보수보강용 모르타르는, 시멘트 100중량부에 대하여 폴리머 1~10중량부, 실리카 퓸 0.1~8중량부, 세라믹 복합섬유 0.5~5.0중량부; 강도증진제 1~8중량부; 골재 30~50중량부; 수축방지제 0.5~2.0 중량부; 폴리비닐알콜(PVA) 분말 수지 3~7중량부; 소포제 0.1~1.0중량부; 팽창제 5~10중량부; 분말형 실리콘 발수제 1~5중량부; 내구성 강화제 5~15중량부; 석회석 분말 성분 1~15중량부; 및 나노 금속 산화물 분말 0.1~2중량부를 포함한다.","Further, the mortar for repairing and reinforcing a concrete structure includes, with respect to 100 parts by weight of cement, 1 to 10 parts by weight of a polymer, 0.1 to 8 parts by weight of silica fume, 0.5 to 5.0 parts by weight of a ceramic composite fiber, 1 to 8 parts by weight of a strength enhancer, 30 to 50 parts by weight of aggregate, 0.5 to 2.0 parts by weight of an anti-shrinkage agent, 3 to 7 parts by weight of a poly(vinyl alcohol) (PVA) powder resin, 0.1 to 1.0 parts by weight of a defoamer, 5 to 10 parts by weight of an expansion agent, 1 to 5 parts by weight of a powdered silicon water repellent agent, 5 to 15 parts by weight of a durability enhancing agent, 1 to 15 parts by weight of a limestone powder component, and 0.1 to 2 parts by weight of a nano metal oxide powder.",True,0.1500602513551712,0.9217808442383434,49,157,-108,279,802,-523
"또한, 표면보호재의 도포는, d-1) 아크릴계 수지, 고무칩, 에어로겔 및 분말 성분을 포함하는 1차 표면 보호재를 도포하는 단계; 및 상기 1차 표면 보호재가 도포된 위에 메틸메타크릴레이트(MMA) 수지를 포함하는 액상 성분 100중량부와 무기분말 성분 30~300중량부를 포함하는 2차 표면 보호재를 도포하는 단계를 포함한다.","Further, the application of the surface protective agent includes d-1) an operation of applying a primary surface protective agent including an acrylic resin, a rubber chip, aerogel, and a powder component, and d-2) an operation of applying a secondary surface protective agent including 100 parts by weight of a liquid component including a methyl methacrylate (MMA) resin and 30 to 300 parts by weight of an inorganic power component after the primary surface protective agent is applied.",True,0.1786661297082901,0.9051281661952226,40,77,-37,184,490,-306
"또한, 내구성 강화제는 경화발현재 30~40중량부와 몬모릴로 나이트계 점토광물 1~3중량부, 알루미늄염 1~2중량부 및 물 50~60중량부를 포함하는 제1 조성물과, 경화촉진제 5~7중량부, 점토광물 12~18중량부, 나노아연 분말 0.1~2중량부, 안정제 0.1~0.5중량부 및 물 60~70중량부를 포함하는 제2 조성물을 혼합한 것을 특징으로 한다.","Further, the durability enhancing agent is characterized by mixing a first composition including 30 to 40 parts by weight of a hardening promoter, 1 to 3 parts by weight of a montmorillonite clay mineral, 1 to 2 parts by weight of an aluminum salt, and 50 to 60 parts by weight of water, and a second composition including 5 to 7 parts by weight of a hardening accelerator, 12 to 18 parts by weight of a clay mineral, 0.1 to 2 parts by weight of a nano zinc powder, 0.1 to 0.5 parts by weight of a stabilizer, and 60 to 70 parts by weight of water.",True,0.165815457701683,0.9086623222728456,36,107,-71,197,548,-351
"또한, 나노 금속 산화물 분말은 다공성 구조로 이루어지고 흑연 산화물로 표면이 코팅된다.","Further, the nano metal oxide powder has a porous structure, and a surface thereof is coated with graphite oxide.",True,0.2305229753255844,0.845041048827988,12,19,-7,49,113,-64
"종래의 기술에 따른 콘크리트 구조물 보수보강 공법은, 열화된 콘크리트 구조물의 손상 부분을 보수보강함에 있어 발수효과가 우수하고 흡수율을 낮게 유지할 수 있으므로 내구성이 우수하며, 압축강도, 휨강도 등의 물리적 특성이 우수하고 모르타르의 단위 중량을 줄이고 초기 및 장기 부착성능을 향상시켜 콘크리트 구조물에 대한 보수보강 시공성이 매우 우수한 동시에 유기 용제를 사용하지 않으므로 친환경적이며, 모르타르를 치밀하게 형성할 수 있으므로 각종 응력을 균일하게 흡수할 수 있는 동시에, 시공면에 고정되는 스테인레스스틸 보강재를 사용하여 모르타르의 타설이 용이하고 모르타르가 견고하게 고정될 수 있으며, 표면강도 및 내수성이 우수하고 동결 융해에 대한 저항성이 우수한 특징을 갖는다.","The method of repairing and reinforcing a concrete structure according to the related art is characterized in that, because a water repellent effect is excellent and water absorption can be kept low when a damaged portion of a degraded concrete structure is repaired and reinforced, durability is excellent and physical properties such as compressive strength, flexural strength, etc. are excellent, repairing and reinforcing work for a concrete structure is very excellent by reducing a unit weight of mortar and improving initial and long-term adhering performance, the method is ecofriendly because an organic solvent is not used, various types of stress can be uniformly absorbed because the mortar can be densely formed, and the mortar is easily poured and can be firmly fixed, surface strength and water resistance are excellent, and resistance to freezing and thawing is excellent because a stainless steel reinforcement fixed to the construction surface is used.",True,0.2469865977764129,0.8827400942265787,87,149,-62,380,970,-590
"종래의 기술에 따른 콘크리트 구조물 보수보강 공법의 경우, 실리카퓸, 세라믹복합섬유, 강도증진제, 골재, 수축방지제, 폴리비닐알콜 분말 수지, 소포제, 팽창제, 분말형 실리콘 발수제, 내구성 강화제, 석회석 분말 성분, 나노 금속 산화물 분말, 알칼리활성화제로 구성된 콘크리트 구조물 보수보강용 모르타르를 제작하고, 콘크리트 보강면에 와이어메쉬 부재(80)를 매립한 후, 콘크리트 구조물 보수보강용 모르타르를 타설하여 보강층을 형성시키는 방법에 관한 것이다.","The method of repairing and reinforcing a concrete structure according to the related art is a method of making mortar for repairing and reinforcing a concrete structure, which is composed of silica fume, a ceramic composite fiber, a strength enhancer, aggregate, an anti-shrinkage agent, a poly(vinyl alcohol) powder resin, a defoamer, an expansion agent, a powdered silicon water repellent agent, a durability enhancing agent, a limestone powder component, a nano metal oxide powder, and an alkali activator, and embedding the wire mesh member 80 in a concrete reinforcing surface and then pouring the mortar for repairing and reinforcing a concrete structure to form a reinforcing layer.",True,0.1928788125514984,0.9136811774341124,53,106,-53,256,690,-434
"하지만, 종래의 기술에 따른 콘크리트 구조물 보수보강 공법의 경우, 격자 형태로 조립한 스테인리스-스틸 와이어메쉬(Stainless-Steel Wire Mesh)를 이용하여 콘크리트 구조물의 내하력을 증진시키는 공법으로서, 와이어메쉬를 이용하여 콘크리트 구조물을 보수/보강하는 경우, 콘크리트 구조물에 부착되는 와이어메쉬의 긴장 상태에 따라 품질이 좌우될 수 있고, 또한, 와이어메쉬의 긴장력을 확보하는 것이 용이하지 않기 때문에 보수/보강 효과를 감소시키는 단점이 있다.","However, since the method of repairing and reinforcing a concrete structure according to the related art is a method of increasing a load carrying capacity of the concrete structure using a stainless steel wire mesh assembled in a grid form, in the case where the concrete structure is repaired/reinforced using the wire mesh, quality may be depend on a state of tension of the wire mesh attached to the concrete structure.",False,0.281548410654068,0.8685783134246393,52,71,-19,264,423,-159
"전술한 문제점을 해결하기 위한 본 발명이 이루고자 하는 기술적 과제는, 코팅재를 코팅하여 부착력을 향상시킨 텍스타일 그리드 보강재를 노후 콘크리트 구조물에 부착하되, 사용환경과 보강목적에 따라 염해저항성능이나 화학저항성능을 갖는 고내구성 무기계 결합재를 선택적으로 사용하여 텍스타일 그리드 보강재를 부착함으로써, 노후 콘크리트 구조물을 보수보강할 수 있는, 텍스타일 그리드 보강재와 고내구성 무기계 결합재를 이용하여 보수보강하는 콘크리트 구조물 및 그 보수보강 공법을 제공하기 위한 것이다.","To solve the aforementioned problems, the technical problem to be solved by the present invention is directed to providing a repairing and reinforcing concrete structure and method using a textile grid reinforcement and a highly durable inorganic binder, capable of repairing and reinforcing an old concrete structure by adhering the textile grid reinforcement, which is coated with a coating material to improve adhesiveness, to the old concrete structure, and particularly by adhering the textile grid reinforcement using selectively a highly durable inorganic binder having chloride penetration resistance performance or chemical resistance performance according to a use environment and a reinforcement purpose.",True,0.2155897319316864,0.9051585059982876,59,101,-42,274,715,-441
"전술한 기술적 과제를 달성하기 위한 수단으로서, 본 발명에 따른 텍스타일 그리드 보강재와 고내구성 무기계 결합재를 이용한 콘크리트 구조물 보수보강 공법은, a) 노후 콘크리트 구조물과의 부착력 향상을 위해 코팅재가 코팅된 텍스타일 그리드 보강재를 형성하는 단계; b) 상기 노후 콘크리트 구조물의 사용환경과 보수보강 목적에 따른 고내구성 무기계 결합재를 배합 제조하는 단계; c) 상기 노후 콘크리트 구조물 표면에 상기 고내구성 무기계 결합재로 형성된 솟크리트를 타설하여 1차 몰탈층을 형성하는 단계; d) 상기 텍스타일 그리드 보강재를 상기 1차 몰탈층 상부에 거치하는 단계; e) 그리드 고정장치를 사용하여 상기 텍스타일 그리드 보강재를 상기 노후 콘크리트 구조물에 고정시키는 단계; f) 상기 고내구성 무기계 결합재로 형성된 숏크리트를 상기 텍스타일 그리드 보강재 상에 타설하여 2차 몰탈층을 형성하는 단계; 및 g) 상기 2차 몰탈층을 경화시켜 상기 노후 콘트리트 구조물의 보수보강을 완료하는 단계를 포함하되, 상기 b) 단계의 고내구성 무기계 결합재는 염해저항성능을 갖는 염해 저항성 무기계 결합재이거나 화학저항성능을 갖는 화학적 저항성 무기계 결합재인 것을 특징으로 한다.","As means for accomplishing the above technical problem, a method of repairing and reinforcing a concrete structure using a textile grid reinforcement and a highly durable inorganic binder according to the present invention includes: a) forming a textile grid reinforcement coated with a coating material to improve adhesiveness with an old concrete structure; b) mixing and making a highly durable inorganic binder according to a use environment of the old concrete structure and repair and reinforcement purposes; c) pouring shotcrete formed of the highly durable inorganic binder on a surface of the old concrete structure to form a primary mortar layer; d) placing the textile grid reinforcement at an upper portion of the primary mortar layer; e) fixing the textile grid reinforcement to the old concrete structure using a grid fixing unit; f) pouring shotcrete formed of the highly durable inorganic binder on the textile grid reinforcement to form a secondary mortar layer; and g) hardening the secondary mortar layer to complete repairing and reinforcing of the old concrete structure, wherein the highly durable inorganic binder of the operation b) is a chloride penetration resistant inorganic binder having chloride penetration resistance performance or a chemical resistant inorganic binder having chemical resistance performance.",True,0.1807983517646789,0.9251428205112028,143,202,-59,606,1341,-735
"여기서, 상기 노후 콘크리트 구조물에 열화 부위가 있는 경우, 상기 c) 단계를 수행하기 전에 상기 노후 콘크리트 구조물에 열화 부위를 미리 제거하되, 상기 노후 콘크리트 구조물 내에 매립된 철근이 부식된 경우 철근 깊이까지 열화 단면을 제거하고, 필요시 추가 철근을 배근할 수 있다.","Here, in the case where a degraded portion is present in the old concrete structure, the degraded portion may be previously removed from the old concrete structure prior to performing the operation c), and in the case where a reinforcing bar embedded in the old concrete structure is corroded, a degraded cross section can be removed up to a depth of the reinforcing bar, and an additional reinforcing bar may be arranged if necessary.",True,0.2235047519207,0.8806423452182975,42,74,-32,159,435,-276
"여기서, 상기 e) 단계 전에 상기 텍스타일 그리드 보강재가 수평을 유지하도록 양측에서 잡아당겨 긴장력을 도입하는 것이 바람직하다.","Further, before the operation e), the textile grid reinforcement is preferably pulled from both sides thereof to introduce a tensile force such that the textile grid reinforcement is horizontally maintained.",True,0.3025935292243957,0.8094621744185356,17,30,-13,73,207,-134
"여기서, 상기 e) 단계에서 상기 그리드 고정장치를 화약식 또는 에어타카로 상기 노후 콘크리트 구조물에 타입시켜 상기 텍스타일 그리드 보강재를 견고하게 상기 노후 콘크리트 구조물에 고정시킬 수 있다.","Further, in the operation e), the grid fixing unit may be driven into the old concrete structure by an explosive or pneumatic tacker such that the textile grid reinforcement can be firmly fixed to the old concrete structure.",True,0.245585948228836,0.8746456295302579,27,38,-11,111,224,-113
"한편, 전술한 기술적 과제를 달성하기 위한 다른 수단으로서, 본 발명에 따른 텍스타일 그리드 보강재와 고내구성 무기계 결합재를 이용한 콘크리트 구조물 보수보강 공법은, a) 노후 콘크리트 구조물과의 부착력 향상을 위해 코팅재가 코팅된 텍스타일 그리드 보강재를 형성하는 단계; b) 상기 노후 콘크리트 구조물의 사용환경과 보수보강 목적에 따른 고내구성 무기계 결합재를 배합 제조하는 단계; c) 상기 텍스타일 그리드 보강재를 상기 노후 콘크리트 구조물 표면에 거치하는 단계; d) 텍스타일 그리드 고정장치를 사용하여 상기 텍스타일 그리드 보강재를 상기 노후 콘크리트 구조물에 고정시키는 단계; e) 고내구성 무기계 결합재로 형성된 숏크리트를 상기 텍스타일 그리드 보강재 상에 타설하여 상기 텍스타일 그리드 보강재가 매립된 몰탈층을 형성하는 단계; 및 f) 상기 몰탈층을 경화시켜 상기 노후 콘트리트 구조물의 보수보강을 완료하는 단계를 포함하되, 상기 b) 단계의 고내구성 무기계 결합재는 염해저항성능을 갖는 염해 저항성 무기계 결합재이거나 화학저항성능을 갖는 화학적 저항성 무기계 결합재인 것을 특징으로 한다.","Meanwhile, as another means for accomplishing the above technical problem, a method of repairing and reinforcing a concrete structure using a textile grid reinforcement and a highly durable inorganic binder according to the present invention includes: a) forming a textile grid reinforcement coated with a coating material to improve adhesiveness with an old concrete structure; b) mixing and making a highly durable inorganic binder according to a use environment of the old concrete structure and repair and reinforcement purposes; c) placing the textile grid reinforcement on a surface of the old concrete structure; d) fixing the textile grid reinforcement to the old concrete structure using a grid fixing unit; e) pouring shotcrete formed of the highly durable inorganic binder on the textile grid reinforcement to form a mortar layer in which the textile grid reinforcement is embedded; and f) hardening the mortar layer to complete repairing and reinforcing of the old concrete structure, wherein the highly durable inorganic binder of the operation b) is a chloride penetration resistant inorganic binder having chloride penetration resistance performance or a chemical resistant inorganic binder having chemical resistance performance.",True,0.1968870908021927,0.9209875719999384,132,185,-53,564,1245,-681
"한편, 전술한 기술적 과제를 달성하기 위한 다른 수단으로서, 본 발명에 따른 텍스타일 그리드 보강재와 고내구성 무기계 결합재를 이용하여 보수보강하는 콘크리트 구조물은, 보수보강을 위한 노후 콘크리트 구조물; 상기 노후 콘크리트 구조물의 보수보강을 위해 상기 노후 콘크리트 구조물의 표면에 부착되며, 상기 노후 콘크리트 구조물의 표면과의 부착력을 향상시키도록 코팅재로 코팅된 텍스타일 그리드 보강재; 무기계 결합재로서, 상기 노후 콘크리트 구조물의 사용환경과 보수보강 목적에 따라 염해저항성능 또는 화학저항성능을 갖도록 배합되며, 상기 텍스타일 그리드 보강재를 상기 노후 콘크리트 구조물에 부착시키는 고내구성 무기계 결합재; 및 상기 텍스타일 그리드 보강재를 상기 노후 콘크리트 구조물 상에 거치시, 상기 텍스타일 그리드 보강재를 고정시키는 그리드 고정장치를 포함하되, 상기 고내구성 무기계 결합재는 염해저항성능을 갖는 염해 저항성 무기계 결합재이거나 화학저항성능을 갖는 화학적 저항성 무기계 결합재인 것을 특징으로 한다.","Meanwhile, as another means for accomplishing the above technical problem, a concrete structure repaired and reinforced using a textile grid reinforcement and a highly durable inorganic binder according to the present invention includes: an old concrete structure to be repaired and reinforced; a textile grid reinforcement adhered to a surface of the old concrete structure to repair and reinforce the old concrete structure and coated with a coating material to improve adhesiveness with the surface of the old concrete structure; a highly durable inorganic binder formulated as an inorganic binder so as to have chloride penetration resistance performance or chemical resistance performance according to a use environment of the old concrete structure and repair and reinforcement purposes, and configured to adhere the textile grid reinforcement to the old concrete structure; and a grid fixing unit configured to fix the textile grid reinforcement when the textile grid reinforcement is placed on the old concrete structure, wherein the highly durable inorganic binder is a chloride penetration resistant inorganic binder having chloride penetration resistance performance or a chemical resistant inorganic binder having chemical resistance performance.",True,0.2054689079523086,0.9159383213462976,115,182,-67,515,1258,-743
"여기서, 상기 텍스타일 그리드 보강재에 코팅되는 코팅재는 샌드페이퍼 마모재로 사용되는 산화알루미나 분말이고, 상기 코팅재의 입도는 상기 텍스타일 그리드 보강재의 종류와 규격에 따라 결정될 수 있다.","Here, the coating material with which the textile grid reinforcement is coated is an alumina (Al2O3) powder used as a sandpaper abrasive material, and a particle size of the coating material may be determined according to the type and specifications of the textile grid reinforcement.",True,0.3650131225585937,0.7923619463179223,25,45,-20,110,284,-174
"여기서, 상기 염해 저항성 무기계 결합재는, 100중량부의 시멘트, 100중량부의 염해 저항성 결합재, 210~250중량부의 잔골재, 55~65중량부의 배합수 및 1.5~3중량부의 고성능 감수제를 혼합하여 형성될 수 있다.","Further, the chloride penetration resistant inorganic binder may be formed by mixing 100 parts of weight of cement, 100 parts of weight of a chloride penetration resistant binder, 210 to 250 parts of weight of fine aggregate, 55 to 65 parts of weight of mixing water, and 1.5 to 3 parts of weight of a high-performance water reducing admixture.",True,0.2502228617668152,0.8592095343177283,24,59,-35,124,344,-220
"여기서, 상기 염해 저항성 결합재는 90~95중량%의 고로슬래그 미분말과 5~10중량%의 염분흡착제를 혼합하여 형성되며, 상기 염분흡착제는 탄산칼슘인 것이 바람직하다.","Further, the chloride penetration resistant binder may be formed by mixing 90 to 95 wt% of a fine blast furnace slag powder and 5 to 10 wt% of a salt adsorbent, and the salt adsorbent may be calcium carbonate.",True,0.2504329085350036,0.850950064905216,17,39,-22,93,209,-116
"여기서, 상기 화학적 저항성 무기계 결합재는 무시멘트계 결합재로서, 100중량부의 고로슬래그 미분말, 35~45중량부의 플라이애시, 165~180중량부의 잔골재, 55~65중량부의 배합수 및 8~20중량부의 알칼리 자극제를 혼합하여 형성될 수 있다.","Further, the chemical resistant inorganic binder may be a cement-free binder, and formed by mixing 100 parts of weight of a fine blast furnace slag powder, 35 to 45 parts of weight of fly ash, 165 to 180 parts of weight of fine aggregate, 55 to 65 parts of weight of mixing water, and 8 to 20 parts of weight of an alkali accelerator.",True,0.2479166835546493,0.8515891523803478,25,64,-39,139,334,-195
"여기서, 상기 d) 단계의 그리드 고정장치는, 상기 노후 콘크리트 구조물에 타입되는 몸체로서 ㄷ자 형상의 앵커핀; 및 상기 앵커핀의 타입시 상기 텍스타일 그리드 보강재를 타입 충격으로부터 보호하도록 상기 앵커핀 상단에 구비되는 타입충격 완충재를 포함할 수 있다.","Further, the grid fixing unit may include a U-shaped anchor pin as a body driven into the old concrete structure, and a driving impact buffer provided at an upper end of the anchor pin so as to protect the textile grid reinforcement form a driving impact when the anchor pin is driven.",True,0.444602221250534,0.7727704716747376,35,52,-17,146,285,-139
"예를 들면, 도 1은 난방 운전중인 실내 유닛(3)에 있어서, 실내 팽창밸브(32)가 실내 열교환기(31)에 의해서 열교환을 한 후의 냉매를 감압하여, 저온화한 냉매를 실외 유닛(2)에 공급하는 상태를 나타낸다.","For example, FIG. 1 shows a state in which the indoor expansion valve 32 in the indoor unit 3 during the heating operation decompresses the refrigerant after heat exchange is performed by the indoor heat exchanger 31 and supplies the cooled refrigerant to the outdoor unit 2.",True,0.1645216196775436,0.9177622990818912,26,47,-21,118,275,-157
저온화한 냉매는 실외 유닛(2)에서 고온화되어 다시 실내 유닛(3)으로 공급된다.],The cooled refrigerant is heated in the outdoor unit 2 and supplied to the indoor unit 3 again.,True,0.1663587093353271,0.8984708503726251,9,18,-9,46,95,-49
"[실내 송풍기(33)는 실내 열교환기(31)에 대해서 내기를 강제적으로 내보냄으로써, 실내 열교환기(31)에서의 냉매와 내기의 열교환을 촉진하는 장치이다.",7 [0017] The indoor blower 33 is a device that promotes heat exchange between the refrigerant and the inside air in the indoor heat exchanger 31 by forcibly sending out the inside air to the indoor heat exchanger 31.,True,0.124562531709671,0.9297037740446626,15,39,-24,86,216,-130
"예를 들면, 실내 송풍기(33)는 원심식 팬을 갖추고 있다.","For example, the indoor blower 33 includes a centrifugal fan.",True,0.1636761426925659,0.8951804230647781,8,10,-2,33,61,-28
실내 송풍기(33)의 팬은 실내 열교환기(31)에 대향하도록 배치되어 있다.],The fan of the indoor blower 33 is arranged so as to face the indoor heat exchanger 31.,True,0.1951580196619033,0.8747522198497697,8,18,-10,43,87,-44
"[실외 유닛(2) 및 실내 유닛(3)은 각각 가스관 접속부(263, 341)와 액관 접속부(264, 342)를 갖추고, 실외 유닛(2)과 실내 유닛(3)이 가스관과 액관을 통해서 배관 접속된다.]","[0018] The outdoor unit 2 and the indoor unit 3 each include a gas pipe connection portion (263, 341) and a liquid pipe connection portion (264, 342), respectively, and the outdoor unit 2 and the indoor unit 3 are connected via piping through a gas pipe and a liquid pipe.",True,0.1287235170602798,0.9258184322415862,22,50,-28,109,272,-163
"[또한, 도 1에는 2개의 실외 유닛(2) 및 3개의 실내 유닛(3)을 갖추는 공기 조화 장치(1)를 예시하고 있지만, 실시형태의 공기 조화 장치(1)는 복수의 실외 유닛(2) 및 1개 이상의 실내 유닛(3)을 갖추는 것이면 된다.","[0019] Although FIG. 1 illustrates the air conditioner 1 including two outdoor units 2 and three indoor units 3, the air conditioner 1 of the embodiment may include a plurality of outdoor units 2 and one or more indoor units 3.",True,0.1511862277984619,0.9189401499809696,31,41,-10,129,227,-98
"즉, 공기 조화 장치(1)가 갖추는 실외 유닛(2)의 개수는 3개 이상이어도 좋다.","That is, the number of outdoor units 2 included in the air conditioner 1 may be three or more.",True,0.2260951101779937,0.865411759043224,11,19,-8,46,94,-48
"또한, 공기 조화 장치(1)가 갖추는 실내 유닛(3)의 개수는 1개 또는 2개여도 좋고, 4개 이상이어도 좋다.]","The number of indoor units 3 included in the air conditioner 1 may be one or two, or may be four or more.",True,0.2956513464450836,0.8194551153047275,15,23,-8,63,105,-42
[제어부(4)는 버스로 접속된 CPU(Central Processing Unit)나 메모리나 보조기억장치 등을 갖추고 프로그램을 실행한다.,"[0020] The control unit 4 includes a central processing unit (CPU), a memory, an auxiliary storage device, and the like connected by a bus, and executes a program.",True,0.1633756011724472,0.9005580346602267,12,28,-16,77,163,-86
제어부(4)는 프로그램의 실행에 의해서 실외 유닛(2)이 전체적으로 1개의 실외기로서 기능하도록 각 기능부의 동작을 제어한다.,The control unit 4 controls the operation of each functional unit by executing the program so that the outdoor units 2 function as one outdoor unit as a whole.,True,0.1526064276695251,0.9117705085062596,14,29,-15,70,159,-89
"또한, 제어부(4)의 각 기능의 전부 또는 일부는 ASIC(Application Specific Integrated Circuit)이나 PLD(Programmable Logic Device)나 FPGA(Field Programmable Gate Array) 등의 하드웨어를 이용하여 실현되어도 좋다.","All or part of the functions of the control unit 4 may be realized using hardware such as an application specific integrated circuit (ASIC), a programmable logic device (PLD), or a field programmable gate array (FPGA).",True,0.0828087851405143,0.9479142919615602,23,36,-13,167,218,-51
프로그램은 컴퓨터 판독 가능한 기록 매체에 기록되어도 좋다.,The program may be recorded on a 8 computer-readable recording medium.,True,0.2901378870010376,0.7647167277546589,8,11,-3,33,70,-37
"컴퓨터 판독 가능한 기록 매체란, 예를 들면 플렉시블 디스크, 광자기 디스크, ROM, CD－ROM 등의 가반 매체, 컴퓨터 시스템에 내장되는 하드 디스크 등의 기억장치이다.","The computer-readable recording medium is, for example, a portable medium such as a flexible disk, a magneto-optical disk, a ROM, or a CD-ROM, or a storage device such as a hard disk built into a computer system.",True,0.1506562083959579,0.8911845509403636,23,37,-14,97,212,-115
프로그램은 전기 통신 회선을 통해서 송신되어도 된다.],The program may be transmitted over a telecommunication line.,True,0.1977098882198333,0.8423481666901793,7,9,-2,30,61,-31
"[구체적으로는, 제어부(4)는 자기(自) 유닛(실외 유닛(2))이 제상 개시 조건을 만족하는지 여부를 감시하여, 제상 개시 조건을 만족시킨 경우, 자기 유닛에 제상 운전을 실행시킨다.","[0021] Specifically, the control unit 4 monitors whether the subject unit (outdoor unit 2) satisfies the defrosting start condition, and causes the subject unit to execute the defrosting operation if the defrosting start condition is satisfied.",True,0.2888273596763619,0.8547488719688348,21,36,-15,102,244,-142
"제상 개시 조건은 실외 유닛(2)에 제상 운전을 실행시킬지 여부를 판정할 때의 조건으로서, 개개의 실외 유닛(2)별로 판정된다.","The defrosting start condition is a condition for determining whether to cause the outdoor unit 2 to execute the defrosting operation, and is determined for individual outdoor units 2.",True,0.2782306671142578,0.8381398271519175,16,29,-13,71,184,-113
"예를 들면, 제상 개시 조건은 실외 열교환기(21)에 대한 착상(着霜)량이 소정의 임계치 이상이 된 것으로 할 수 있다.","For example, the defrosting start condition can be that the amount of frost formed on the outdoor heat exchanger 21 is equal to or greater than a predetermined threshold value.",True,0.2430794686079025,0.8561612036889142,17,30,-13,67,176,-109
"여기에서, 이 착상량의 측정을 위해서, 실외 열교환기(21)에는 착상량 센서가 갖춰져 있는 것으로 한다.","Here, it is assumed that the outdoor heat exchanger 21 is provided with a frost formation sensor for measuring the frost formation amount.",True,0.2943223118782043,0.8191731069614334,13,23,-10,58,138,-80
"제어부(4)는 착상량 센서의 측정 데이터에 근거하여 자기 유닛의 제상 개시 조건을 판정하고, 제상 개시 조건을 만족시킨 경우에는 기 자유닛에 대해서 제상 운전을 실시하게 한다.","The control unit 4 determines the defrosting start condition of the subject unit on the basis of the measurement data of the frost formation sensor, and causes the subject unit to perform the defrosting operation when the defrosting start condition is satisfied.",True,0.3383770585060119,0.8008180141472245,24,42,-18,98,262,-164
"한편, 제어부(4)는 자기 유닛 이외의 다른 실외 유닛(2)에서 제상 운전이 개시된 경우, 가스관내의 압력이 난방 운전시 최고 압력에 대해서 소정의 비율 이하가 되도록 자기 유닛의 각 기능부를 제어한다.]","On the other hand, when the defrosting operation is started in the outdoor unit 2 other than the subject unit, the control unit 4 controls the functional units of the subject unit so that the pressure in the gas pipe is equal to or smaller than a predetermined ratio with respect to the maximum pressure during the heating operation.",True,0.305718183517456,0.850552436196271,28,59,-31,114,333,-219
"[도 2는 2개의 실외 유닛을 갖추는 공기 조화 장치의 일방의 실외 유닛이 난방 운전중이며, 타방의 실외 유닛이 제상 운전중인 경우에 있어서의 각 실내 유닛의 흡입 압력 및 응축 압력의 구체적인 예를 나타내는 도면이다.",[0022] FIG. 2 is a diagram showing a specific example of the suction pressure and condensation pressure of each indoor unit when one outdoor unit of the air conditioner including two outdoor units is in the heating operation and the other outdoor unit is in the 9 defrosting operation.,True,0.2400018125772476,0.8744844971574245,33,49,-16,122,285,-163
"이하, 난방 운전중인 실외 유닛을 「난방 유닛」이라고 하고, 제상 운전중인 실외 유닛을 「제상 유닛」이라고 한다.","Hereinafter, the outdoor unit in the heating operation is referred to as a ""heating unit"", and the outdoor unit in the defrosting operation is referred to as a ""defrosting unit"".",True,0.2854874730110168,0.8169657086298787,15,30,-15,63,178,-115
"도 2에 나타내듯이, 2개의 실외 유닛의 일방이 난방 유닛으로서 기능하고, 타방이 제상 유닛으로서 기능하는 상황에서는, 난방 유닛측의 응축 압력이 제상 유닛측의 흡입 압력과 동일해진다.","As shown in FIG. 2, in a state where one of the two outdoor units functions as a heating unit and the other outdoor unit functions as a defrosting unit, the condensation pressure on the heating unit side becomes equal to the suction pressure on the defrosting unit side.",True,0.1250753104686737,0.9342407048351344,24,49,-25,103,270,-167
"예를 들면, 도 1의 예에서는 제1 실외 유닛(2A)이 가스관으로부터 토출하는 냉매의 압력과, 제2 실외 유닛(2B)이 가스관으로부터 흡입하는 냉매의 압력이 동일하다는 것이다.","For example, in the example of FIG. 1, the pressure of the refrigerant discharged from the gas pipe by the first outdoor unit 2A is equal to the pressure of the refrigerant sucked from the gas pipe by the second outdoor unit 2B.",True,0.1082322970032692,0.941474226784095,21,43,-22,98,228,-130
"그리고 이 경우, 제상 유닛측 압축기에는 난방 운전중일 때보다 흡입이 높은 압력이 가해지게 된다.","In this case, higher suction pressure than during the heating operation is applied to the compressor on the defrosting unit side.",True,0.3186904788017273,0.7893909837225418,14,21,-7,54,129,-75
"한편, 압축기에는 적절한 동작 환경으로서 소정의 압력 범위(이하 「적정 압력 범위」라고 한다.)가 정해져 있고, 이 압력 범위를 넘는 흡입 압력으로 동작시키는 것은 압축기의 내구성을 저하시킬 가능성이 있다.]","On the other hand, a predetermined pressure range (hereinafter referred to as ""appropriate pressure range"") is defined for the compressor as an appropriate operating environment, and operating at a suction pressure exceeding this pressure range may reduce the durability of the compressor.",True,0.1466656178236007,0.9139465508118264,27,42,-15,116,289,-173
"[여기서, 본 실시형태에서의 공기 조화 장치(1)에서 각 실외 유닛(2)의 제어부(4)는 난방 유닛측의 응축 압력(=제상 유닛측의 흡입 압력)이 난방 운전시에서의 최고 압력의 1/1.5의 압력(이하 「상한 압력」이라고 한다.) 이하가 되도록 자기 유닛의 각 기능부를 제어한다.","[0023] Therefore, in the air conditioner 1 of the present embodiment, the control unit 4 of each outdoor unit 2 controls the functional units of the subject unit so that the condensation pressure on the heating unit side (= the suction pressure on the defrosting unit side) is equal to or smaller than the pressure (hereinafter referred to as an ""upper limit pressure"") which is 1/1.5 times the maximum pressure during the heating operation.",True,0.1802022606134414,0.9164279996340312,33,74,-41,154,441,-287
난방 유닛측의 응축 압력(=제상 유닛측의 흡입 압력)을 상한 압력 이하로 함으로써 제상 유닛의 압축기(23)의 흡입 압력을 적정 압력 범위내로 유지할 수 있다.,"By setting the condensation pressure on the heating unit side (= the suction pressure on the defrosting unit side) to be equal to or smaller than the upper limit pressure, the suction pressure of the compressor 23 of the defrosting unit can be maintained within an appropriate pressure range.",True,0.2185210138559341,0.8837277143563743,22,49,-27,89,292,-203
"또한, 본 실시형태에서의 공기 조화 장치(1)에는 난방 유닛측의 응축 압력 또는 제상 유닛측의 흡입 압력을 측정하기 위한 압력 센서가 갖춰져 있다.",It is assumed that the air conditioner 1 of the present embodiment is provided with a pressure sensor for measuring the condensation pressure on the heating unit side or the suction pressure on the defrosting unit side.,True,0.3170358836650848,0.8391542920161413,21,37,-16,82,219,-137
각 제어부(4)는 이 압력 센서로부터 취득되는 측정 데이터에 근거하여 난방 유닛측의 응축 압력 또는 제상 유닛측의 흡입 압력을 관측할 수 있다.],Each control unit 4 can observe the condensation pressure on the heating unit side or the suction pressure on the defrosting unit side on the basis of the measurement data acquired from the pressure sensor.,True,0.2165462374687194,0.8838009776221453,21,35,-14,81,206,-125
"[도 3 및 도 4는 제1 실시형태의 공기 조화 장치(1)가 제상 운전중인 실외 유닛(2, 제상 유닛)이 있을 때 난방 운전중인 실외 유닛(난방 유닛)의 응축 압력을 조정함으로써, 가스관 내의 압력이 상한 압력 이하가 되도록 각 실외 유닛(2)을 제어하는 처리(이하 「응축 압력 제어 처리」라고 한다.)의 흐름의 구체예를 나타내는 흐름도이다.","[0024] FIGS. 3 and 4 are flowcharts showing a specific example of the flow of the process (hereinafter referred to as a ""condensation pressure control process"") of the air conditioner 1 of the first embodiment controlling the outdoor units 2 so that the pressure in the gas pipe is equal to or smaller than the upper limit pressure by adjusting the condensation pressure of the outdoor unit (the heating unit) during the heating operation when any of the outdoor units 2 (the defrosting units) is in the defrosting operation.",True,0.1949237138032913,0.9101904622479106,47,89,-42,191,525,-334
어떤 흐름도도 제어 대상인 실외 유닛(2)이 난방 운전을 하는 상태에서 개시되는 것으로 한다.,It is assumed that each flowchart is started in a state where the outdoor unit 2 to be controlled is in the heating operation.,True,0.3271196186542511,0.8041799613174788,13,24,-11,52,126,-74
"우선, 도 3에서 제상 유닛이 되는 실외 유닛(2)의 제어의 흐름을 설명한다.]","First, the flow of control of the outdoor unit 2 serving as the defrosting unit will be described with reference to FIG. 3.",True,0.3385470509529114,0.8003773948980508,11,23,-12,44,123,-79
"[우선, 제어부(4)가 자기 유닛이 제상 개시 조건을 만족했는지 여부를 판정한다(스텝 S101). 자기 유닛은 제상 개시 조건을 만족시키지 않았다고 판정한 경우(스텝 S101－NO), 제어부(4)는 제상 개시 조건을 만족할 때까지 스텝 S101을 반복하여 실행한다.","When it is determined that the subject unit does not satisfy the defrosting start condition (step S101-NO), the control unit 4 repeatedly executes step S101 until the defrosting start condition is satisfied.",False,0.2039370834827423,0.8837988627532695,31,32,-1,148,207,-59
"한편, 자기 유닛이 제상 개시 조건을 만족시켰다고 판정한 경우(스텝 S101－YES), 제어부(4)는 자기 유닛에서 제상 운전을 개시할 것을 결정하고, 그 취지를 통지하는 제상 운전 개시 통지를 다른 실외 유닛(2, 즉, 난방 유닛)에 통지한다.]","On the other hand, when it is determined that the subject unit satisfies the defrosting start condition (step S101-YES), the control unit 4 determines to start the defrosting operation in the subject unit and sends a defrosting operation start notification to the other outdoor unit 2 (that is, the heating unit).",True,0.1983470916748047,0.9040671947332576,32,51,-19,138,313,-175
"[계속해서, 제어부(4)는 자유닛에서의 냉매의 순환 방향이 제상 운전용 방향이 되도록 사방밸브(22)를 전환한다(스텝 S103). 제어부(4)는 냉매의 순환 방향을 전환한 후, 압축기(23)를 제상 운전용 주파수(이하 「제상 주파수」라고 한다.)로 운전함(스텝 S104)에 따라, 자기 유닛에 제상 운전을 개시하도록 한다.","After switching the circulation direction of the refrigerant, the control unit 4 operates the compressor 23 at a frequency for the defrosting operation (hereinafter referred to as a ""defrosting frequency"") (step S104), thereby causing the subject unit to start the defrosting operation.",False,0.2760750651359558,0.8567483990359576,35,42,-7,180,286,-106
"자유닛이 제상 운전을 개시한 후에는, 제어부(4)는 자기 유닛이 제상 종료 조건을 만족했는지 여부를 판정한다(스텝 S105). 제상 종료 조건은 실외 유닛(2)에 제상 운전을 종료하도록 할지 여부를 판정할 때의 조건이다.","After the subject unit starts the defrosting operation, the control unit 4 determines whether the subject unit satisfies the defrosting end condition (step S105).",False,0.3256304860115051,0.8216689961319062,28,24,4,123,162,-39
"예를 들면, 제상 종료 조건은 실외 열교환기(21)에 대한 착상량이 소정의 임계치 미만이 된 것으로 할 수 있다.","For example, the defrosting end condition can be that the amount of frost formed on the outdoor heat exchanger 21 is smaller than a predetermined threshold value.",True,0.2649254202842712,0.8401145670396698,17,27,-10,63,162,-99
제어부(4)는 착상량 센서의 측정 데이터를 바탕으로 자기 유닛의 제상 종료 조건을 판정한다.],The control unit 4 determines the defrosting end condition of the subject unit on the basis of the measurement data of the frost formation sensor.,True,0.2847604751586914,0.8260026827020257,12,25,-13,52,146,-94
"[자기 유닛은 제상 종료 조건을 만족하지 않았다고 판정한 경우(스텝 S105－NO), 제어부(4)는 제상 종료 조건이 만족될 때까지 스텝 S105를 반복하여 실행한다.","[0027] If it is determined that the subject unit does not satisfy the defrosting end condition (step S105-NO), the control unit 4 repeatedly executes step S105 until the defrosting end condition is satisfied.",True,0.1253751367330551,0.926201911609798,20,33,-13,93,208,-115
"한편, 자기 유닛이 제상 종료 조건을 만족시켰다고 판정한 경우(스텝 S105－YES), 제어부(4)는 자기 유닛에서 제상 운전을 종료할 것을 결정하고, 그 취지를 통지하는 제상 운전 종료 통지를 다른 실외 유닛(2, 즉 난방 유닛)에 통지한다.]","On the other hand, when it is determined that the subject unit satisfies the defrosting end condition (step S105-YES), the control unit 4 determines to end the defrosting operation in the subject unit and sends a defrosting operation end notification to the other outdoor unit 2 (that is, the heating unit).",True,0.2205451130867004,0.8910856446311974,32,51,-19,137,307,-170
"[그 다음, 도 4에서 난방 유닛이 되는 실외 유닛(2)의 제어의 흐름을 설명한다.","[0028] Next, the flow of control of the outdoor unit 2 serving as the heating unit will be described with reference to FIG. 4.",True,0.2375906854867935,0.8694984272932917,12,24,-12,46,126,-80
"우선, 제어부(4)는 제상 유닛으로부터 제상 운전 개시 통지가 통지되었는지 여부를 판정한다(스텝 S201). 제상 운전 개시 통지는 통지되어 있지 않다고 판정한 경우(스텝 S201－NO), 제어부(4)는 제상 운전 개시 통지가 통지될 때까지 스텝 S201을 반복하여 실행한다.]","If it is determined that the defrosting operation start notification has not been sent (step S201-NO), the control unit 4 repeatedly executes step S201 until the defrosting operation start notification is sent.",False,0.2430315613746643,0.8606978486082871,33,32,1,155,210,-55
"[한편, 제상 운전 개시 통지가 통지되었다고 판정한 경우(스텝 S201－YES), 제어부(4)는 자기 유닛의 압축기(23)의 운전 주파수를 정격 최대 주파수로 변경한다(스텝 S202). 여기서, 운전 주파수가 목표치 추종형 수법에 따라서 제어되는 경우, 최대 주파수는 운전 주파수의 목표치로 설정되어도 좋다.]","12 [0029] On the other hand, when it is determined that the defrosting operation start notification has been sent (step S201-YES), the control unit 4 changes the operating frequency of the compressor 23 of the subject unit to the rated maximum frequency (step S202).",True,0.2498656958341598,0.8717288512943885,36,44,-8,173,266,-93
"[본 실시형태에서 시료로 하는 전고체 전지는, 원기둥형으로 가공되어 있고, 그의 축방향에 압력을 받은 상태에서 분석된다.","The all-solid-state battery as a sample in this embodiment is processed to have a cylindrical shape, and is analyzed while pressurized in an axial direction thereof.",True,0.336310476064682,0.7845733149578695,15,26,-11,67,165,-98
"또한, 시료가 되는 전고체 전지는, 원기둥형에 한하지 않고, 블록 형상 등 다른 형상으로 가공되어 있어도 된다.",The all-solid-state battery as a sample may be processed to have another shape such as a block-like shape as well as a cylindrical shape.,True,0.4062367677688598,0.7133366486282936,16,24,-8,62,137,-75
"어느 형상이더라도, 압력의 작용 방향으로 구성요소의 각 층이 적층되고, 그들 각 층을 외면(구체적으로는, 외측면 또는 외주면)으로부터 측정할 수 있도록 되어 있다.]","Regardless of the shape, the all-solid-state battery is configured so that the respective layers of the components are laminated in a pressure applying direction (pressurization direction), and each of the layers can be measured from an outer surface (specifically, an outer side surface or an outer peripheral surface).",True,0.2818830907344818,0.8332507100725436,21,48,-27,92,320,-228
"[리튬 이온 전지 등의 종래의 전지는, 전해질 층에 액상의 전해질이 이용되고 있었지만, 근래 개발이 진행되는 전고체 전지에서는, 전해질 층에 고체의 전해질이 이용되고 있다.","In conventional batteries such as lithium-ion batteries, a liquid electrolyte has been used for the electrolyte layer.",False,0.4220045506954193,0.6823879017188489,23,17,6,96,118,-22
"전고체 전지의 내부에서는, 충방전에 수반하는 팽창 수축에 의해, 입자 간의 공극이나 고체 전해질 층과 전극 활물질 층의 계면의 박리, 또는 내부 크랙 등이 생기기 쉽고, 이들 현상이 생긴 경우에 전지로서 정상적으로 기능을 하지 않게 되어 버린다.","In the all-solid-state batteries, voids between particles, exfoliation of the interface between the solid electrolyte layer and the electrode active material layer, or internal cracks are likely to occur due to expansion and contraction caused by charging and discharging, and when these phenomena occur, the all-solid-state batteries do not function normally as batteries.",True,0.2494551539421081,0.8307272454350577,36,53,-17,137,373,-236
"그래서, 이런 종류의 전고체 전지를 시료로 해서 분석 평가를 실시하는 경우에는, 전고체 전지를 가압 상태로 유지하여, 충방전에 수반하는 도전 패스의 확보나, 팽창 수축을 억제할 필요가 있다.]","Therefore, when analysis and evaluation are performed on this type of all-solid-state batteries as samples, it is necessary to hold the all-solid-state batteries in a pressurized state so that a conductive path is secured and expansion and contraction caused by charging and discharging are suppressed.",True,0.3518843054771423,0.7771452679162945,26,45,-19,107,302,-195
"[또, 전고체 전지를 구성하는 각 요소는, 수분이나 공기에 반응하는 재료이다.",The components constituting the all-solid-state battery are formed of materials that react with moisture and air.,True,0.4195895791053772,0.6983010120538183,10,16,-6,43,113,-70
"그래서, 일반적으로, 가압 분석용 구조체를 조립하는 작업은, 고순도의 아르곤 가스(불활성 가스) 분위기 하에서 한 글로브 박스(GB)의 내부 공간 등에서 행해진다.]","Therefore, in general, a work of assembling a pressurization analysis structure is performed in an internal space of a glove box (GB) which is kept in a high-purity argon gas (inert gas) atmosphere or the like.",True,0.1807330250740051,0.8880497099354672,20,36,-16,92,210,-118
"[그리고, 가압 분석용 구조체의 내부에 밀폐 상태로 수용된 전고체 전지에 대해, 대기 중에서 X선 회절 장치를 이용하여, 분석 평가가 실행된다.","Further, an all-solid-state battery which has been accommodated in a hermetically sealed state inside the pressurization analysis structure is analyzed and evaluated by using an X-ray diffraction apparatus in the atmosphere.",True,0.3594329357147217,0.782383683045486,20,31,-11,80,224,-144
"여기서, X선 회절 장치는, 범용성이 높은 반사형 X선 회절 장치를 이용하여, 분석 평가할 수 있는 것이 바람직하다.]","Here, it is preferable that analysis and evaluation can be performed by using a highly versatile reflection type X-ray diffraction apparatus as the X-ray diffraction apparatus.",True,0.1946917623281479,0.8550467446142068,17,26,-9,66,176,-110
"[이하에 설명하는 본 실시형태에 관계된 가압 분석용 구조체는, 상술한 이들 조건을 모두 만족시키는 구성으로 되어 있다.]",The pressurization analysis structure according to the present embodiment described below is configured to satisfy all of these conditions described above.,True,0.1702294498682022,0.8919805869166743,16,21,-5,67,155,-88
"[우선, 본 실시형태에 관계된 가압 분석용 구조체에 대하여, 도면을 참조해서 상세하게 설명한다.]","First, the pressurization analysis structure according to the present embodiment will be described in detail with reference to the drawings.",True,0.2542964816093445,0.8348203703152398,12,20,-8,54,140,-86
"[도 1은 본 실시형태에 관계된 가압 분석용 구조체의 외관을 도시하는 사시도, 도 2는 동일하게 가압 분석용 구조체의 전체 구조를 도시하는 도 1의 A－A선 단면도이다.","FIG. 1 is a perspective view showing the appearance of the pressurization analysis structure according to the present embodiment, and FIG. 2 is a cross-sectional view taken along a line A-A of FIG. 1, which shows an overall structure of the pressurization analysis structure.",True,0.2264418751001358,0.8703290984075593,24,44,-20,94,275,-181
"또, 도 3은 본 실시형태에 관계된 가압 분석용 구조체의 분해 사시도, 도 4는 동일하게 도 1의 A－A선 분해 단면도이다.]","Further, FIG. 3 is an exploded perspective view of the pressurization analysis structure according to the present embodiment, and FIG. 4 is an exploded cross-sectional view taken along the line A-A of FIG. 1.",True,0.2933811545372009,0.8135285976582316,19,34,-15,70,208,-138
"[가압 분석용 구조체는, 도 3 및 도 4에 도시하는 바와 같이, 시료 수용 유닛(10), 가압 유닛(30), 기밀 케이스 유닛(40)의 각 유닛을 구성요소에 포함하고 있다.","As shown in FIGS. 3 and 4, the pressurization analysis structure includes respective units of a sample accommodating unit 10, a pressurizing unit 30, and an airtight case unit 40 as components.",True,0.1876359730958938,0.8902110556655598,24,32,-8,97,193,-96
"가압 유닛(30)은, 시료 수용 유닛(10)의 개구된 일단면 측(도면의 하단면 측)에 장착된다.]",The pressurizing unit 30 is mounted on one end surface side (lower end surface side in FIGS. 3 and 4 ) which is opened in the sample accommodating unit 10.,True,0.267255574464798,0.8402713035481922,11,30,-19,54,155,-101
"[분석 대상이 되는 전고체 전지(S)(시료)는, 시료 수용 유닛(10) 내에 수용되어, 밀폐 상태에서 대기로부터 차단된다.]",An all-solid-state battery S (sample) as an analysis target is accommodated in the sample accommodating unit 10 in a hermetically sealed state to be shielded from the atmosphere.,True,0.3514640033245086,0.7923408259656469,14,28,-14,69,178,-109
[도 5는 시료 수용 유닛의 구성을 도시하는 분해 사시도이다.],FIG. 5 is an exploded perspective view showing a configuration of the sample accommodating unit.,True,0.3157862424850464,0.7760804372232505,9,15,-6,35,96,-61
"[도 2 내지 도 5에 도시하는 바와 같이, 시료 수용 유닛(10)은, 수용 유닛 본체(11), 압력받이(壓受) 부재(21), 압압(押壓) 부재(22), 시료 홀더(23)의 각 구성요소를 포함하고 있다.","As shown in FIGS. 2 to 5, the sample accommodating unit 10 includes an accommodating unit main body 11, a pressure receiving member 21, a pressing member 22, and a sample holder 23 as components.",True,0.1956488043069839,0.8937093312474109,24,35,-11,113,195,-82
"수용 유닛 본체(11)는, 일단이 개구되고, 타단이 폐색된 바닥 있는(유저) 원통형으로 형성되어 있다.",The accommodating unit main body 11 is formed in a bottomed cylindrical shape which is opened at one end thereof and closed on the other end thereof.,True,0.4561091363430023,0.7031743159161242,12,27,-15,57,149,-92
"수용 유닛 본체(11)의 내부는, 개구된 일단면으로부터 중심축을 따라 횡단면이 원형상인 중공부로 되어 있다.",The inside of the accommodating unit main body 11 has a hollow portion having a circular cross-section along a central axis from the opened one end surface.,True,0.1891581863164901,0.8821866377349922,13,27,-14,60,156,-96
"이 중공부는, 전고체 전지(S)를 수용해서 배치하기 위해 시료실을 형성한다.",This hollow portion forms a sample chamber for accommodating and placing the all-solid-state battery S therein.,True,0.3052813112735748,0.7951366611383356,9,16,-7,42,111,-69
"이 중공부의 안바닥부(즉, 타단의 내벽부)는, 후술하는 가압 유닛(30)으로부터의 압력을 받는 압력받이부(12)를 구성한다.","An inner bottom portion (that is, an inner wall portion at the other end) of the hollow portion constitutes a pressure receiving portion 12 for receiving pressure from the pressurizing unit 30 described later.",True,0.1765798032283783,0.9041757177725336,12,34,-22,69,209,-140
"이 압력받이부(12)는 오목홈에 의해 형성되어 있고, 이 압력받이부(12)(오목홈)에 압력받이 부재(21)가 삽탈 자유롭게 끼워넣어진다.]","The pressure receiving portion 12 is formed by a concave groove, and the pressure receiving member 21 is insertably and detachably fitted into the pressure receiving portion 12 (concave groove).",True,0.2738853096961975,0.8493887441266694,13,30,-17,77,194,-117
"[압력받이 부재(21)는, 수용 유닛 본체(11)의 내부에 있어서, 한쪽 단면이 시료실에 배치된 전고체 전지(S)의 일단면과 접촉되고, 다른쪽 단면이 압력받이부(12)와 접촉된다.]","In the accommodating unit main body 11, one end surface of the pressure receiving member 21 is in contact with one end surface of the all-solid-state battery S placed in the sample chamber, and the other end surface of the pressure receiving member 21 is in contact with the pressure receiving portion 12.",True,0.2633548974990845,0.8651430597961478,19,53,-34,101,305,-204
"[압압 부재(22)는, 후술하는 가압 유닛(30)으로부터의 압력을 전고체 전지(S)에 작용시키기 위한 압력 전달 수단으로서의 기능을 가지고 있다.",The pressing member 22 has a function as pressure transmitting means for applying the pressure from the pressurizing unit 30 described later to the all-solid-state battery S. The pressing member 22 can also be treated as a component constituting the pressurization mechanism of the pressurizing unit 30 described later.,False,0.2974535524845123,0.8325345948590975,16,49,-33,81,319,-238
"[시료 홀더(23)는, 원통 형상으로 형성되어 있고, 수용 유닛 본체(11)의 중공부에 끼워넣은 상태에서, 체결구(締結具)를 이용하여 수용 유닛 본체(11)에 장착된다.","The sample holder 23 is formed in a cylindrical shape, and is mounted in the accommodating unit main body 11 by using a fastener while fitted in the hollow portion of the accommodating unit main body 11.",True,0.1950987428426742,0.8906250589621654,18,37,-19,94,203,-109
"시료 홀더(23)의 내부에는, 도 4에 도시하는 바와 같이, 중심축을 따라 뻗는 횡단면이 원형상인 중공부(23a)가 형성되어 있고, 이 중공부(23a)의 내벽이 전고체 전지(S)를 수용 유닛 본체(11)의 내부에 수용해서 배치할 때의 안내 경로를 구성한다.","As shown in FIG. 4, a hollow portion 23a having a circular cross-section extending along the central axis is formed inside the sample holder 23, and the inner wall of the hollow portion 23a constitutes a guide path when the all-solid-state battery S is accommodated and placed in the accommodating unit main body 11.",True,0.1939548999071121,0.8946527593614275,31,54,-23,143,316,-173
"또, 시료 홀더(23)의 중공부(23a) 내에 있어서, 후술하는 X선 창(14)과 대향하는 위치가 시료 배치부(23b)로 되어 있고, 전고체 전지(S)는 이 시료 배치부(23b)에 배치된다.]","Further, in the hollow portion 23a of the sample holder 23, a position facing an X-ray window 14 described later is a sample placing portion 23b, and the all-solid-state battery S is placed in the sample placing portion 23b.",True,0.2661792933940887,0.8534322085052909,21,39,-18,107,224,-117
"[도 2에 도시하는 바와 같이, 원기둥형의 전고체 전지(S)는, 시료 홀더(23)의 내벽을 따라 그의 중공부(23a) 내에 삽입되고, 그의 내부에서 압력받이 부재(21)와 압압 부재(22) 사이에 끼여서 시료 배치부(23b)에 배치된다.","As shown in FIG. 2, the cylindrical all-solid-state battery S is inserted into the hollow portion 23a along the inner wall of the sample holder 23, and is placed in the sample placing portion 23b while sandwiched between the pressure receiving member 21 and the pressing member 22 in the hollow portion 23a.",True,0.2463928163051605,0.8733209983077473,27,53,-26,132,307,-175
"그리고, 압압 부재(22)를 거쳐 가압 유닛(30)으로부터의 압력이 전고체 전지(S)에 작용한다.",The pressure from the pressurizing unit 30 acts on the all-solid-state battery S via the pressing member 22.,True,0.3288283050060272,0.8065753553469186,10,18,-8,54,108,-54
"압력받이 부재(21)는, 압압 부재(22)의 대향 위치에서 이 압력을 받아낸다.",The pressure receiving member 21 receives this pressure at a position facing the pressing member 22.,True,0.1902628391981125,0.8870560378079582,9,16,-7,44,100,-56
"즉, 전고체 전지(S)는, 압력받이 부재(21)와 압압 부재(22) 사이에 끼인 상태에서 가압된다.","In other words, the all-solid-state battery S is pressurized while sandwiched between the pressure receiving member 21 and the pressing member 22.",True,0.2459501177072525,0.864770237766448,11,22,-11,55,146,-91
"이 구성에 의해, 큰 압력을 전고체 전지(S)에 작용시킬 수가 있다.]",This configuration enables a large pressure to be applied to the all-solid-state battery S.,True,0.3211533427238464,0.7743062886764778,10,14,-4,39,91,-52
"[여기서, 압력받이 부재(21)와 이것을 안바닥부에서 지지하는 수용 유닛 본체(11)는, 가압 유닛(30)으로부터의 압력에 충분히 견딜 수 있는 경도와 강성을 구비한 금속 재료로 제작되어 있고, 전고체 전지(S)를 치우침","Here, the pressure receiving member 21 and the accommodating unit main body 11 that supports the pressure receiving member 21 at the inner bottom portion are formed of metal materials having hardness and rigidity that can sufficiently withstand the pressure from the pressurizing unit 30, and configured so that the all-solid-state battery S can be evenly and uniformly pressurized.",False,0.2432014793157577,0.8747613456261262,26,59,-33,123,382,-259
"마찬가지로, 압압 부재(22)도 가압 유닛(30)으로부터의 압력에 충분히 견딜 수 있는 경도와 강성을 구비한 금속 재료로 제작되어 있다.]","Likewise, the pressing member 22 is also formed of a metal material having hardness and rigidity that can sufficiently withstand the pressure from the pressurizing unit 30.",True,0.1414082646369934,0.9218149118937974,17,27,-10,77,172,-95
"[또, 수용 유닛 본체(11), 압력받이 부재(21), 압압 부재(22)를 형성하는 금속 재료는, 전고체 전지(S)를 충방전하기 위해서 도전성을 가지는 것을 선정한다.","Further, materials having electrical conductivity are selected as the metal materials forming the accommodating unit main body 11, the pressure receiving member 21, and the pressing member 22 in order to charge and discharge the all-solid-state battery S. A structure for charging and discharging the all-solid-state battery S will be described later.",False,0.2646030783653259,0.8596022291839327,19,52,-33,93,351,-258
"[한편, 시료 홀더(23)는, 전고체 전지(S)를 구성하는 각 요소 간의 단락(短絡)을 방지하기 위해서 절연 재료로 구성되어 있다.]","On the other hand, the sample holder 23 is formed of an insulating material in order to prevent a short circuit between the components constituting the all-solid-state battery S.",True,0.2672359645366668,0.8397176488633133,16,29,-13,74,178,-104
"[또, 압력받이 부재(21)는, 단차 있는 원기둥 형상으로 가공되고, 그의 일단면이 전고체 전지(S)의 일단면과 면접촉하는 평탄한 압력받이면을 형성하고 있다.","Further, the pressure receiving member 21 is processed to have a stepped cylindrical shape, and one end surface thereof forms a flat pressure receiving surface that is in surface contact with one end surface of the all-solid-state battery S. Further, the pressing member 22 is processed to have a cylindrical shape, and one end surface thereof forms a flat pressing surface that is in surface contact with the other end surface of the all-solid-state battery S.",False,0.449802815914154,0.7630240430419445,18,76,-58,88,461,-373
"또, 압압 부재(22)는 원기둥형으로 가공되고, 그의 일단면이 전고체 전지(S)의 타단면과 면접촉하는 평탄한 압압면을 형성하고 있다.]","As a result, the pressure receiving member 21 and the pressing member 22 are in surface contact with both the end surfaces of the all-solid-state battery S, whereby the all-solid-state battery S can be pressurized more evenly and uniformly.",False,0.6140658855438232,0.6623196538111413,15,39,-24,75,240,-165
"[이것에 의해, 압력받이 부재(21)와 압압 부재(22)가, 전고체 전지(S)의 양단면에 각각 면접촉해서, 한층 더 치우침","Regardless of which end face 21a or 21b of the pressure receiving member 21 is brought into contact with the all-solid-state battery S, the all-solid-state battery S is placed in the sample placing portion 23b.",False,0.7531525492668152,0.5695275301257797,14,35,-21,68,210,-142
"QoS (Quality of Service ) 정보를 수정하는 방법에 있어서,원격 UE (User Equipment)가 QoS 정보 수정을 위해 중계 UE에 제 1 메시지를 송신하는 단계를 포함하고, 상기 제 1 메시지는 적어도 하나의 QoS 규칙 및/또는 PDU (Protocol Data Unit) 세션과 연관된 적어도 하나의 QoS 플로우 설명을 포함하는, 방법.","A method for modifying Quality of Service, in the following also referred to as QoS, information, comprising: a remote user equipment, in the following also referred to as UE, transmits a first message to a relay UE for QoS information modification, wherein the first message includes at least one QoS rule and/or at least one QoS flow description associated with a Protocol Data Unit, in the following also referred to as PDU, session (1405).",True,0.2937221229076385,0.8902298166333404,46,74,-28,206,443,-237
"제 1 항에 있어서, 상기 원격 UE가 상기 중계 UE로부터 제 2 메시지를 수신하여 상기 QoS 정보 수정을 완료하는 단계를 더 포함하는, 방법.","The method of claim 1, further comprising: the remote UE receives a second message from the Relay UE to complete the QoS information modification.",True,0.1648229658603668,0.9243377580741912,23,24,-1,82,146,-64
"제 1 항에 있어서, 상기 제 1 메시지는 상기 PDU 세션의 아이덴티티 또는 상기 PDU 세션과 연관된 중계 서비스 코드 (RSC)를 포함하고, 및/또는 상기 제 2 메시지는 상기 PDU 세션의 아이덴티티 또는 상기 PDU 세션과 연관된 RSC 코드를 포함하는, 방법.","The method of claim 1 or 2, wherein the first message includes an identity of the PDU session or a relay service code, in the following also referred to as RSC, associated with the PDU session and/or the second message includes the identity of the PDU session or a RSC associated with the PDU session.",True,0.1693203002214431,0.9342941138188408,40,55,-15,151,301,-150
"제 1 항에 있어서, 각 QoS 규칙은 다음 파라미터들: QRI (QoS rule identifier), QFI (QoS flow identifier), 패킷 필터 세트 및 우선순위 값 중 적어도 하나를 포함하는, 방법.","The method of any one of claims 1 to 3, wherein each QoS rule contains at least one of the following parameters: a QoS rule identifier, in the following also referred to as QRI, a QoS flow identifier, in the following also referred to as QFI, a set of packet filters, and a precedence value.",True,0.2341167777776718,0.9029438596067424,28,55,-27,123,291,-168
"제 1 항에 있어서, 각 QoS 플로우 설명은 다음 파라미터들: QFI, QoS 식별자, GFRB (Guaranteed flow bit rate), MFBR (Maximum flow bit rate), 및 EBI (EPS bearer identity) 중 적어도 하나를 포함하는, 방법.","The method of any one of claims 1 to 4, wherein each QoS flow description contains at least one of the following parameters: a QFI, a QoS identifier, Guaranteed flow bit rate, in the following also referred to as GFBR, Maximum flow bit rate, in the following also referred to as MFBR, and an EPS bearer identity, in the following also referred to as EBI.",True,0.2006059736013412,0.9169597377529412,33,65,-32,160,354,-194
"제 5 항에 있어서, 각 QoS 플로우 설명에서 상기 QoS 식별자는 Uu 레그에 대한 QoS 요구조건 (들) 또는 단대단 (end-to-end) QoS 요구조건 (들)을 표시하는, 방법.","The method of claim 5, wherein the QoS identifier in each QoS flow description indicates QoS requirement(s) over a Uu leg or end-to-end QoS requirement(s).",True,0.1435056775808334,0.9389116285706672,25,25,0,105,155,-50
"제 1 항에 있어서, 상기 PDU 세션은 상기 원격 UE에 대해 수립되어 상기 중계 UE를 통해 데이터 네트워크로부터 서비스에 액세스하는, 방법.","The method of any one of claims 1 to 6, wherein the PDU session is established for the Remote UE to access a service from a data network via the Relay UE.",True,0.2401724010705948,0.8836829788309402,21,32,-11,81,154,-73
"제 2 항에 있어서, 상기 제 1 메시지는 링크 수정 요청 (Link Modification Request) 메시지 및/또는 상기 제 2 메시지는 링크 수정 수락 (Link Modification Accept) 메시지인, 방법.","The method of any one of claims 1 to 7, wherein the first message is a Link Modification Request message and/or the second message is a Link Modification Accept message.",True,0.1782068610191345,0.912843354477367,28,30,-2,127,169,-42
"제 4 항에 있어서, 각 패킷 필터는 다음: 소스/목적지 IP 주소 또는 IPv6 프리픽스, 소스/목적지 포트 번호, IP/다음 헤더 타입 상위의 프로토콜의 프로토콜 ID, 서비스 타입 (TOS) (IPv4)/트래픽 등급 (IPv6), 및 마스크, 플로우 레이블 (IPv6), 보안 파라미터 인덱스, 및 패킷 필터 방향, 에 대한 적어도 임의 결합에 의해 형성되는, 방법.","The method of claim 4 or any one of claims 5 to 8 in combination with claim 4, wherein each packet filter is formed by at least any combination of: source/destination IP address or IPv6 prefix, source/destination port number, Protocol ID of the protocol above IP/Next header type, Type of Service, in the following also referred to as TOS, in case of IPv4/Traffic class in case of IPv6 and Mask, Flow Label in case of IPv6, security parameter index, and Packet Filter direction.",True,0.1940599530935287,0.9165318729796388,50,83,-33,208,478,-270
"제 9 항에 있어서, 상기 소스 IP 주소 또는 IPv6 프리픽스는 상기 원격 UE의 IP 주소 또는 IPv6 프리픽스이고, 상기 목적지 IP 주소 또는 IPv6 프리픽스는 상기 중계 UE의 IP 주소 또는 IPv6 프리픽스인, 방법.","The method of claim 9, wherein the source IP address or IPv6 prefix is the IP address or IPv6 prefix of the Remote UE, and the destination IP address or IPv6 prefix is the IP address or IPv6 prefix of the Relay UE.",True,0.1324407458305359,0.9402817358816288,35,43,-8,131,214,-83
"제 9 항에 있어서, 상기 소스 IP 주소 또는 IPv6 프리픽스는 상기 원격 UE의 IP 주소 또는 IPv6 프리픽스이고, 상기 목적지 IP 주소 또는 IPv6 프리픽스는 상기 데이터 네트워크의 IP 주소 또는 IPv6 프리픽스인, 방법.","The method of claim 9, wherein the source IP address or IPv6 prefix is the IP address or IPv6 prefix of the Remote UE, and the destination IP address or IPv6 prefix is the IP address or IPv6 prefix of the data network.",True,0.1101926863193512,0.9501578183889036,35,43,-8,134,218,-84
"원격 UE (User Equipment)에 있어서,제어회로;상기 제어회로에 설치된 프로세서; 및상기 제어회로에 설치되고 상기 프로세서와 동작하도록(operatively) 결합된 메모리를 포함하고,상기 프로세서는 상기 메모리에 저장된 프로그램 코드를 실행하도록 구성되어: QoS (Quality of Service)정보 수정을 위해 중계 UE에게 제 1 메시지를 송신하도록 구성되되, 상기 제 1 메시지는 적어도 하나의 QoS 규칙 및/또는 PDU (Protocol Data Unit) 세션과 연관된 적어도 하나의 QoS 플로우 설명을 포함하는, 원격 UE.","A remote User Equipment, in the following also referred to as UE, comprising: a control circuit (306); a processor (308) installed in the control circuit (306); and a memory (310) installed in the control circuit (306) and operatively coupled to the processor (308); wherein the processor (308) is configured to execute a program code (312) stored in the memory (310) to perform the method steps as defined in any one of the preceding claims.",True,0.750326931476593,0.6173448362080656,61,74,-13,311,442,-131
"치료제 A 또는 이의 약학적으로 허용가능한 염; 치료제 B 또는 이의 약학적으로 허용가능한 염; 및 적어도 하나의 약학적으로 허용가능한 부형제를 포함하는 약학 조성물로서, 치료제 A는 비스테로이드성 항염증 약물이고, 치료제 B는 지방산 산화 억제제인 약학 조성물.","A pharmaceutical composition, comprising a therapeutic agent A or a pharmaceutically acceptable salt thereof; a therapeutic agent B or a pharmaceutically acceptable salt thereof; and at least one pharmaceutically acceptable excipient, wherein the therapeutic agent A is a non steroidal anti-inflammatory drug, and the therapeutic agent B is a fatty acid oxidation inhibitor.",True,0.1504695415496826,0.9355866121074816,35,53,-18,147,374,-227
"제1항에 있어서, 약학 조성물에서, 치료제 A 및 치료제 B는 단일 투여 형태로 함유되는, 약학 조성물.","The pharmaceutical composition according to claim 1, wherein in the pharmaceutical composition, the therapeutic agent A and the therapeutic agent B are contained in a single dosage form.",True,0.1816739737987518,0.9293196246138028,15,28,-13,58,186,-128
"제1항에 있어서, 약학 조성물에서, 치료제 A 및 치료제 B는 개별 투여 형태로 존재하는, 약학 조성물.","The pharmaceutical composition according to claim 1, wherein in the pharmaceutical composition, the therapeutic agent A and the therapeutic agent B are present in separate dosage forms.",True,0.2024077773094177,0.9213278691750116,15,27,-12,58,185,-127
"제1항 내지 제3항 중 어느 한 항에 있어서, 치료제 A는 살리실레이트, 이부프로펜, 인도메타신, 플루르비프로펜, 페녹시이부프로펜, 나프록센, 나부메톤, 피록시캄, 페닐부타존, 디클로페낙, 펜프로펜, 케토프로펜, 케토로락, 테트라클로페남산, 설린닥, 및 톨메틴으로부터 선택된 적어도 하나인, 약학 조성물.","The pharmaceutical composition according to claims 1 to 3, wherein the therapeutic agent A is at least one selected from a salicylate, ibuprofen, indomethacin, flurbiprofen, phenoxyibuprofen, naproxen, nabumetone, piroxicam, phenylbutazone, diclofenac, fenprofen, ketoprofen, ketorolac, tetraclofenamic acid, sulindac, and tolmetin.",True,0.165394514799118,0.9257948132105036,32,39,-7,170,332,-162
"제1항 내지 제4항 중 어느 한 항에 있어서, 치료제 B는 트리메타지딘, 에토목시르, 아미노카르니틴 또는 카르니틴의 포스포노옥시 유도체로부터 선택되는, 약학 조성물.","The pharmaceutical composition according to claims 1 to 4, wherein the therapeutic agent B is selected from trimetazidine, etomoxir, aminocamitine or a phosphonooxy derivative of camitine.",True,0.1453645825386047,0.931888743269734,20,26,-6,92,188,-96
"제1항 내지 제5항 중 어느 한 항에 있어서, 치료제 A는 살리실레이트로서 선택되고, 치료제 B는 트리메타지딘으로서 선택되는, 약학 조성물.","The pharmaceutical composition according to claims 1 to 5, wherein the therapeutic agent A is selected as a salicylate, and the therapeutic agent B is selected as trimetazidine.",True,0.1363334059715271,0.9457875169285042,18,28,-10,78,177,-99
"제1항 내지 제6항 중 어느 한 항에 있어서, 치료제 A는 아스피린(아세틸살리실산)으로서 선택되는, 약학 조성물.","The pharmaceutical composition according to claims 1 to 6, wherein the therapeutic agent A is selected as aspirin (acetylsalicylic acid).",True,0.1330548971891403,0.943566182747172,14,20,-6,63,137,-74
"제1항 내지 제7항 중 어느 한 항에 있어서, 치료제 A 대 치료제 B의 중량 비는 1:1 내지 10:1, 바람직하게는 6:1인, 약학 조성물.","The pharmaceutical composition according to claims 1 to 7, wherein a weight ratio of the therapeutic agent A to the therapeutic agent B is from 1:1 to 10:1, and preferably 6:.",True,0.2050549685955047,0.9181109277883656,22,31,-9,80,175,-95
"이를 필요로 하는 대상체에서 과체중, 비만, 비알코올성 지방간, 비알코올성 지방간염, 및 대사 증후군의 치료; 또는 간에서 지방의 비정상적 축적을 야기하는 질환 또는 상태 치료; 또는 죽상동맥경화증 및 죽상동맥경화증의 합병증 치료; 또는 녹내장 및 녹내장의 합병증 치료; 또는 이상지질혈증/고지질혈증 및 이상지질혈증/고지질혈증의 합병증 치료를 위한 약제의 제조에서의 치료제 A 및 치료제 B의 용도로서, 치료제 A는 비스테로이드성 항염증 약물이고, 치료제 B는 지방산 산화 억제제인 용도.","A use (or method) of a therapeutic agent A and a therapeutic agent B in the preparation of a medicament for treating type 2 diabetes, impaired glucose tolerance, impaired fasting glucose, hyperglycemia, postprandial hyperglycemia, type 1 diabetes, overweight, obesity, non alcoholic fatty liver, non-alcoholic steatohepatitis, and metabolic syndrome; or improving glycemic control and/or reducing fasting plasma glucose, postprandial plasma glucose and/or a glycated hemoglobin HbAlc; or slowing, delaying or reversing progression from impaired glucose tolerance, impaired fasting glucose, insulin resistance and/or metabolic syndrome to type 2 diabetes; or treating diabetic complications such as cataracts, as well as microvascular and macrovascular diseases such as nephropathy, retinopathy, neuropathy, tissue ischemia, arteriosclerosis, myocardial infarction, stroke and peripheral arterial occlusive disease; or losing weight or promoting weight loss; or treating pancreatic p-cell degeneration and/or decreased pancreatic p-cell function, and/or restoring pancreatic p-cell function, and/or restoring pancreatic insulin secretion; or treating a disease or condition that causes abnormal buildup of fat in the liver; or maintaining and/or improving insulin sensitivity and/or treating hyperinsulinemia and/or insulin resistance; or treating atherosclerosis and complications of atherosclerosis; or treating glaucoma and complications of glaucoma; or treating dyslipidemia/hyperlipidemia and complications of dyslipidemia/hyperlipidemia, or treating reproductive-related metabolic diseases in a subject in need thereof, wherein the therapeutic agent A is a non-steroidal anti inflammatory drug, and the therapeutic agent B is a fatty acid oxidation inhibitor.",False,0.2968190014362335,0.8248495831801355,62,225,-163,273,1764,-1491
"제9항에 있어서, 대상체는 과체중, 비만, 내장 비만, 및 복부 비만으로 이루어진 군으로부터 선택된 하나 이상의 상태를 진단받은 개인인, 용도.","The use (or method) according to claim 9, wherein the subject is an individual who is diagnosed with one or more conditions selected from the group consisting of overweight, obesity, visceral obesity, and abdominal obesity.",True,0.2126367837190628,0.8749550298940167,19,35,-16,80,223,-143
"제9항 또는 제10항에 있어서, 치료제 A는 아스피린으로서 선택되는, 용도.","The use (or method) according to claim 9 to 14, wherein the therapeutic agent A is selected as aspirin.",True,0.2991791069507599,0.8707754629216633,9,19,-10,42,103,-61
"제9항 내지 제11항 중 어느 한 항에 있어서, 치료제 A 대 치료제 B의 중량 비는 1:1 내지 10:1, 바람직하게는 6:1인, 용도.","The use (or method) according to claim 9 to 15, wherein a weight ratio of the therapeutic agent A to the therapeutic agent B is from 1:1 to 10:1, and preferably 6:.",True,0.2863477766513824,0.8844438287428156,21,32,-11,77,164,-87
"제9항 내지 제12항 중 어느 한 항에 있어서, 치료제 A 및 치료제 B는 동시 투여되는, 용도.","The use (or method) according to claim 9 to 16, wherein the therapeutic agent A and the therapeutic agent B are administered simultaneously.",True,0.3249790668487549,0.8659598696642958,16,23,-7,54,140,-86
"제13항에 있어서, 치료제 A 및 치료제 B는 단일 투여 형태로 함유되는, 용도.","The use (or method) according to claim 17, wherein the therapeutic agent A and the therapeutic agent B are contained in a single dosage form.",True,0.3917400240898132,0.8396676614961545,12,25,-13,45,141,-96
"제9항 내지 제12항 중 어느 한 항에 있어서, 치료제 A 및 치료제 B는 개별 투여되는, 용도.","The use (or method) according to claim 9 to 16, wherein the therapeutic agent A and the therapeutic agent B are administered separately.",True,0.3430776596069336,0.8624600922248915,16,23,-7,54,136,-82
"제15항에 있어서, 치료제 A는 치료제 B 전에 투여되는, 용도.","The use (or method) according to claim 20, wherein the therapeutic agent A is administered before the therapeutic agent B.",True,0.4068674743175506,0.8239249385905032,9,20,-11,36,122,-86
"제15항에 있어서, 치료제 A는 치료제 B 후에 투여되는, 용도.","The use (or method) according to claim 20, wherein the therapeutic agent A is administered after the therapeutic agent B.",True,0.4045605957508087,0.8250697193715942,9,20,-11,36,121,-85
"제9항 내지 제17항 중 어느 한 항에 있어서, 치료제 A 및 치료제 B는 경구적으로 또는 주사에 의해 투여되는, 용도.","The use (or method) according to claim 9 to 22, wherein the therapeutic agent A and the therapeutic agent B are administered orally or by injection.",True,0.3196966350078583,0.8683318760151296,19,26,-7,67,148,-81
"[본 발명은 기판 상에 금속 포일(metal foil)을 스탬핑하기 위한 핫 포일 스탬핑 기계(hot foil stamping machine)에 관한 것으로, 스탬핑 기계는 제1 표면 및 반대쪽 제2 표면을 갖는 가열 플레이트, 적어도 가열 플레이트의 영역에서 가열 플레이트의 온도를 측정하기 위한 적어도 하나의 온도 센서, 그리고 제5 표면 및 반대쪽 스탬핑 계면을 갖는 적어도 하나의 스탬핑 플레이트를 포함하며, 스탬핑 플레이트의 제5 표면은 가열 플레이트의 제2 표면에 부착되고, 스탬핑 플레이트 계면은 스탬핑 기계의 스탬핑 요소에 의해 금속 포일이 스탬핑될 기판을 배치하게 구성된다.","The invention relates to a hot foil stamping machine for stamping a metal foil onto a substrate, the stamping machine comprising a heating plate having a first surface and an opposite second surface, at least one heating device for heating at least a region of the heating plate, at least one temperature sensor for measuring a temperature of the heating plate, at least in a region of the heating plate and at least one stamping plate having a fifth surface and an opposite stamping interface surface, wherein the fifth surface of the stamping plate is attached to the second surface of the heating plate, wherein the stamping plate interface surface is configured for arranging the substrate onto which the metal foil is to be stamped by means of a stamping element of the stamping machine.",True,0.1869918853044511,0.91537425185893,78,135,-57,330,792,-462
본 발명은 또한 구성요소의 제2 표면에 대한 측정 불가능한 온도를 결정하는 방법에 관한 것이다.],The invention further relates to a method for determining a non-measurable temperature of a second surface of a component.,True,0.1410023123025894,0.920957902462567,14,19,-5,54,122,-68
[핫 포일 스탬핑 기계는 일반적으로 비교적 높은 온도와 적절한 압력으로 기판 위에 바람직하게는 금속으로 만들어진 포일을 인쇄하는 데 사용된다.,"Hot foil stamping machines are commonly used to print a foil, preferably made of metal, onto a substrate at a relatively high temperature and proper pressure.",True,0.2030024230480194,0.8896576791473341,19,26,-7,79,158,-79
"핫 포일 스탬핑 기계는 기본적으로 가열 플레이트, 이에 부착된 설치 플레이트 및 설치 플레이트에 설치될 수 있는 하나 이상의 핫 스탬핑 플레이트로 구성된다.","A hot foil stamping machine essentially consists of a heating plate, an installation plate attached thereto and one or more hot stamping plates, which can be installed onto the installation plate.",True,0.1468153446912765,0.9256780308236684,23,31,-8,87,196,-109
"다른 특정한 포일 스탬핑 작업을 수행하기 위해서 하나 이상의 핫 스탬핑 플레이트의 갯수, 크기 및 설치 위치를 조정할 수 있다.","The number, sizes, and installation positions of the one or more hot stamping plates can be adjusted in order to perform different specific foil stamping operations.",True,0.2126550525426864,0.8725559324203049,20,26,-6,71,165,-94
각 스탬핑 플레이트에는 금속 포일이 스탬핑 헤드에 의해 스탬핑될 기판을 배치하기 위한 스탬핑 계면 표면(stamping interface surface)이 제공된다.,"On each stamping plate, a stamping interface surface is provided for arranging the substrate, onto which the metal foil is to be stamped by a stamping head.",True,0.1664656996726989,0.8977913048701266,18,27,-9,92,156,-64
핫 포일 스탬핑 기계가 작동하는 동안 가열 플레이트는 예를 들어 저항 히터와 같은 가열 장치를 통해 가열된다.,"During operation of the hot foil stamping machine, the heating plate is heated by means of a heating device, e.g. a resistance heater.",True,0.1883137971162796,0.8892978021573067,17,23,-6,61,134,-73
"따라서, 각 스탬핑 계면의 온도는 설치 플레이트 및 스탬핑 플레이트를 통해 가열 플레이트로부터의 열 전도에 의해 특정 작동 온도까지 상승한다.]","Thus, the temperature of each stamping interface surface is raised to a certain operating temperature by heat conduction from the heating plate via the installation plate and the stamping plate.",True,0.1868640333414077,0.8967727502924356,20,30,-10,80,194,-114
"[각각의 스탬핑 공정의 말미에서, 스탬핑 계면에 기판이 접착되는 것을 방지하기 위해, 일련의 분사 노즐을 설치 플레이트의 외부 가장자리에 추가로 고정할 수 있다.",A set of blowing nozzles can additionally be fixed at the outer edge of the installation plate in order to avoid adhesion of the substrate on the stamping interface at the end of each stamping process.,True,0.1885545402765274,0.8851436777327265,22,36,-14,90,201,-111
"만족스러운 스탬핑 품질을 얻기 위해서는, 주변 온도, 분사 노즐의 분사 강도, 작동 속도 및 핫 스탬핑 영역에 관계없이, 스탬핑 계면 온도를 바람직하게는 일정한 값으로 유지하는 것이 필수적 이다.","In order to obtain satisfactory stamping quality, it is essential that the stamping interface temperature is maintained at a preferably constant value regardless of the ambient temperature, the blowing intensity of the blowing nozzles, the operating speed and area of the hot stamping.",True,0.1502854973077774,0.9213633227596744,28,43,-15,109,285,-176
그렇지 않으면 기판의 완성된 금속 포일이 원하지 않는 열화로 인해 열악한 스탬핑 품질을 초래할 수 있다.,"Otherwise poor stamping quality can result, due to undesired deteriorations in the finished metal foil on the substrate.",True,0.1931916624307632,0.8730675584761174,16,18,-2,58,120,-62
"그러나, 스탬핑 공정 중 기판과 스탬핑 유닛이 스탬핑 계면 표면을 덮는 스탬핑 공정의 특성으로 인해, 스탬핑 계면 표면에 대한 직접적인 온도 측정이 불가능하여, 계면 온도를 필요한 온도로 제어하기 위한 폐쇄 루프 제어 시스템을 구현하기가 어렵다.]","However, due to the nature of the stamping process with the substrate and the stamping unit covering the stamping interface surface during the stamping process, direct temperature measurement of the stamping interface surface is not available, which makes it difficult to implement a closed-loop control system for controlling the interface temperature to the desired temperature.",True,0.2094428986310959,0.8898356329094949,35,55,-20,138,380,-242
"[이러한 단점을 극복하기 위해서, 가열 플레이트를 스탬핑 계면 표면의 지정한 원하는 온도에 대해 미리 설정된 상승된 온도까지 가열하는 것으로 알려져 있으며, 여기서는 상승된 온도 값을 룩업 테이블에서 얻으며, 룩업 테이블에는 가열 플레이트와 스탬핑 계면 표면 사이의 정상 상태 온도 차가 다양한 조건(예: 다양한 스탬핑 계면 표면 온도, 다양한 영역, 다양한 처리 속도, 다양한 주변 온도 등)에 대해 저장되어 있다.]","To overcome this shortcoming, it is known to heat the heating plate to a preset elevated temperature for a given desired temperature of the stamping interface surface, where the elevated temperature values are obtained from a look-up table, in which steady-state temperature differences between the heating plate and the stamping interface surface are stored for different conditions (e.g. various stamping interface surface temperatures, various areas, various processing speed, various ambient temperatures, etc.).",True,0.1638984680175781,0.9227293040657832,59,72,-13,234,516,-282
"[그러나, 종래의 룩업 테이블 방법에는 예를 들어 적절한 온도 제어 성능을 달성하는 데 필요한 이용할 수 있는 역학적 온도 차이(dynamic temperature differences)가 없는 것과 같은, 많은 제한 사항이 있다.","However, the conventional look-up table method has a number of limitations, e.g. that no dynamic temperature differences are available, which are required to achieve proper temperature control performance.",True,0.2285444289445877,0.8700637194492622,29,28,1,129,205,-76
따라서 비효율적인 가열 및 온도 결정의 큰 오류가 정상 상태 조건 이전의 과도 가열(transient heating) 중에 발생할 수 있다.,"Therefore, inefficient heating and large errors in the temperature determination may result during the transient heating before steady-state conditions.",True,0.1944035291671753,0.8763296742231463,19,19,0,78,152,-74
"또한, 룩업 테이블로 얻은 균일한 온도 분포를 얻기 위해서는, 설치 플레이트에 설치된 스탬핑 플레이트의 수에 관계없이, 가열 플레이트의 사용 가능한 모든 가열 영역이 완전히 여기된다.","Further, to obtain even temperature distribution under which the look-up tables were obtained, all of the available heating zones of the heating plate are fully excited, independent of the number of stamping plates, installed on the installation plate.",True,0.2068485915660858,0.8865562071824773,25,38,-13,102,252,-150
특히 다중 스탬핑 플레이트가 하나 또는 두 개의 가열 영역에 모여 있는 경우에 그러할 것이다.,"Consequently, a large part of input energy will be wasted, especially when multiple stamping plates are clustered in the region of one or two heating zones.",False,0.3944032490253448,0.7477405558667076,15,26,-11,52,156,-104
"또한, 주변 온도, 작동 속도, 설치된 스탬핑 플레이트의 수 및 분사 노즐의 기류에 의해 유도되는 강제 대류가 비교적 넓은 범위에서 변할 수 있다.","Furthermore, the ambient temperature, the operating speed, the number of stamping plates installed and also forced convection induced by the air-flow from the blowing nozzles may change in relatively wide ranges.",False,0.1307218968868255,0.9257581279625168,23,31,-8,82,212,-130
"룩업 테이블 방식으로 가능한 한 높은 정확도를 보장하기 위해서는, 적절한 데이터 베이스를 만들기 위해 서로 다른 작동 조건에서 여러 테스트를 수행하는 데 상당한 노력과 그에 따른 많은 시간을 필요로 한다.]","To ensure as much accuracy as possible with the loop-up table method, huge efforts and thus a large amount of time are required to conduct multiple tests under different operating conditions for creating a proper data base.",True,0.1801770180463791,0.8814319728417663,30,37,-7,115,223,-108
"[따라서, 본 발명의 제1 목적은 변하는 조건하에서도 개선된 스탬핑 품질을 얻을 수 있는 핫 포일 스탬핑 기계를 제공하는 것이다.","A first object of the invention was therefore to provide a hot foil stamping machine, which allows for an improved stamping quality also under changing conditions.",True,0.1972064524888992,0.8909096036017943,19,26,-7,72,163,-91
제2 목적은 구성요소의 표면에 대한 측정 불가능한 온도를 결정하는 방법을 제공하는 것이다.],A second object was to provide a method for the determination of a non-measurable temperature of a component's surface.,True,0.2200185507535934,0.8659435499632493,12,19,-7,51,119,-68
"[제1 목적은 스탬핑 계면 표면의 온도를 미리 정의된 원하는 온도로 제어하기 위한 제어 유닛을 포함하는 핫 포일 스탬핑 기계로 본 발명에 따라 달성되며, 제어 유닛은 가열 플레이트의 적어도 하나의 온도 센서로부터의 적어도 가열 플레이트의 실제 온도를 수신하여 적어도 하나의 가열 장치에 조작된 변수(manipulated variable)를 제공하도록 구성되며, 스탬핑 기계는 가열 플레이트와 스탬핑 플레이트 사이의 열 전달에 대한 적어도 하나의 물리적 기반 분석 모델에 기초한 적어도 하나의 스탬핑 플레이트의 스탬핑 계면 표면의 실제 온도를 추정하기 위한 상태 관찰기(state observer)를 더 포함하고, 그리고 제어 유닛은 상태 관찰기에 의해 제공된, 미리 정의된 원하는 온도 및 스탬핑 계면 표면의 추정된 실제 온도에 기초하여, 적어도 하나의 가열 장치에 대한 조작 변수를 계산하기 위한 피드백 제어기를 더 포함한다.]","The first object is achieved according to the invention with a hot foil stamping machine which comprises a control unit for controlling the temperature of the stamping interface surface to a predefined desired temperature, wherein the control unit is configured to receive at least an actual temperature of the heating plate from the at least one temperature sensor of the heating plate and to provide a manipulated variable to the at least one heating device, wherein the stamping machine further comprises a state observer for estimating an actual temperature of the stamping interface surface of the at least one stamping plate based on at least one physics-based analytical model of the heat transfer between the heating plate and the stamping plate, and wherein the control unit further comprises a feedback controller for calculating the manipulated variable for the at least one heating device based on the predefined desired temperature and the estimated actual temperature of the stamping interface surface, provided by the state observer.",True,0.1771509796380996,0.9193214813182372,111,164,-53,464,1048,-584
"[바람직하게는, 스탬핑 기계는 가열 플레이트와 스탬핑 플레이트 사이에 배치된 설치 플레이트를 추가로 포함하고, 상기 설치 플레이트는 가열 플레이트의 제2 표면에 부착된 제3 표면, 및 스탬핑 플레이트의 제5 표면이 부착되는 반대쪽 제4 표면을 갖는다.","Preferably the stamping machine further comprises an installation plate arranged between the heating plate and the stamping plate, the installation plate having a third surface attached to the second surface of the heating plate, and an opposite fourth surface onto which the fifth surface of the stamping plate is attached.",True,0.1347458362579345,0.9341968968180784,33,50,-17,140,324,-184
"따라서 예를 들어 적절한 장착 브래킷을 사용하여 하나 이상의 스탬핑 플레이트의 설치를 용이하게 하는, 예를 들어 벌집형 플레이트 등의 형태의 설치 플레이트(installation plate)가 사용될 수 있다.]","Thus, e.g. an installation plate in the form of a honeycomb plate or the like can be used, which facilitates the installation of the one or more stamping plates, e.g. using suitable mounting brackets.",True,0.1917123198509216,0.8894478293210439,26,34,-8,118,200,-82
"[유리한 실시예에서, 제어 유닛은 적어도 하나의 물리적 기반 분석 모델(physics-based analytical model)에 기초하여 스탬핑 계면 표면의 미리 정의된 원하는 온도로부터 피드포워드 제어 값을 계산하기 위한 피드포워드 제어기를 추가로 포함한다.","In an advantageous embodiment, the control unit further comprises a feedforward controller for calculating a feedforward control value from the predefined desired temperature of the stamping interface surface based on the at least one physics-based analytical model.",True,0.1717398166656494,0.9137437867362912,29,37,-8,146,266,-120
"이러한 방식으로 피드백 제어기는 더 작은 오류만 조정하면 되기 때문에, 제어 성능이 향상된다.]","In this way the feedback controller only needs to adjust smaller errors, which improves the control performance.",True,0.1637103706598281,0.8714109424070794,13,17,-4,53,112,-59
"[만일, 상태 관찰기가 바람직하게 PID 제어기 형태의 관찰기 보상기(observer compensator)를 포함하여, 이용 가능한 온도 측정에 기초하여 적어도 하나의 스탬핑 플레이트의 스탬핑 계면 표면의 추정된 실제 온도를 수정하면, 더 유익할 수 있고, 여기서 이용 가능한 온도 측정은 적어도 하나의 온도 센서 및/또는 주변 온도로 측정된 가열 플레이트의 실제 온도를 적어도 포함하는 것이다.]","It can be further beneficial, if the state observer comprises an observer compensator, preferably in the form of a PID-controller, for correcting the estimated actual temperature of the stamping interface surface of the at least one stamping plate based on available temperature measurements, wherein the available temperature measurements at least include the actual temperature of the heating plate, measured with the at least one temperature sensor and/or an ambient temperature.",True,0.1665813475847244,0.9202568187917992,51,70,-19,223,482,-259
"[바람직하게는 물리적 기반 분석 모델은 분산 매개변수 모델 및 집중 매개변수 모델을 포함하는 하이브리드 모델이며, 바람직한 실시예에서 분산 매개변수 모델은 고유 함수(eigen-function) 전개 모델이고 그리고 집중 매개변수 모델(lumped-parameter model)은 열 임피던스 회로 모델(thermal impedance circuit model)이다.","Preferably the physics-based analytical model is a hybrid model comprising a distributed-parameter model and a lumped-parameter model, wherein in a preferred embodiment the distributed-parameter model is an eigen-function expansion model and the lumped-parameter model is a thermal impedance circuit model.",True,0.2200907766819,0.8650959490096938,36,40,-4,205,306,-101
"이에 의해, 가열 플레이트의 가열 장치(들)의 국부 제어 입력과 다양한 열유속 교란에 영향을 받는 스탬핑 계면 표면 온도 사이의 관계에 대한 실시간으로 가능하고 계산적으로 효율적인 모델이 제공되어, 온라인 온도 추정을 가능하게 하여서, 스탬핑 계면 표면의 우수한 온도 제어 성능을 제공한다.]","By this, a real-time capable and therefore computationally-efficient model for the relation between the local control inputs of the heating device(s) of the heating plate and the stamping interface surface temperature subject to various heat-flux disturbances is provided, which enables an online temperature estimation and hence a good temperature control performance of the stamping interface surface.",True,0.1834630966186523,0.908689191436666,40,56,-16,163,403,-240
"[유리하게, 하이브리드 모델에서, 적어도 하나의 가열 플레이트, 바람직하게 제공된 적어도 하나의 설치 플레이트, 및 적어도 하나의 스탬핑 플레이트가 각각 주축을 따라서, 바람직하게는 제1, 제2, 제3, 제4, 제5 표면 또는 계면 표면 중 하나에 대해 직교하는 축을 따라서 다중 레이어로 각각 분할되며, 여기서 분산-매개변수 모델은 다중 레이어 각각의 온도 분포를 계산하고 그리고 집중 매개변수 모델은 주축 방향으로 다중 레이어 사이의 열유속(heat flux)을 계산한다.","It is advantageous, that in the hybrid model the at least one heating plate, the preferably provided at least one installation plate and the at least one stamping plate are each divided into multiple layers along a principal axis, preferably perpendicular to one of the first, second, third, fourth, fifth surface or interface surface, wherein the distributed-parameter model calculates a temperature distribution in each of the multiple layers and wherein the lumped-parameter model calculates a heat flux between the multiple layers in the direction of the principal axis.",True,0.1962087005376815,0.9003495447060464,62,88,-26,266,574,-308
"따라서, 스탬핑 계면 표면에 대한 과도 온도의 지배적인 영향 요인(dominant influence factors)인 주축을 따른 평면 열 확산 및 열 전도가 처음에 별도로 공식화될 수 있으며, 이후 결합되어 하이브리드 모델을 형성할 수 있다.]","Hence, planar heat diffusion and heat conduction along the principle axis, which are the dominant influence factors of the transient temperature of stamping interface surface can at first be formulated separately and can then be combined to form the hybrid model.",True,0.2077941745519638,0.8866755856370861,32,41,-9,137,263,-126
"[하이브리드 모델은 포워드 경로(forward path) 및 피드백 경로를 포함하는 폐쇄 루프(closed-loop) 모델이고, 분산 매개변수 모델은 포워드 경로에서 구현되고 그리고 집중 매개변수 모델은 피드백 경로에서 구현되는 것이 더 바람직하다.","It is further preferred, that the hybrid model is a closed-loop model comprising a forward path and a feedback path, wherein the distributed-parameter model is implemented in the forward path and the lumped-parameter model is implemented in the feedback path.",True,0.2272827178239822,0.8423298331959239,28,40,-12,139,259,-120
"따라서 물리적으로 직관적이며, 열 전달의 고유한 구조를 나타내는 모델이 제공된다.]","Thus, a model is provided which is physically intuitive and which represents the inherent structure of the heat transfer.",True,0.2002813518047332,0.8560749345204859,10,19,-9,46,121,-75
"[제2 목적은, 본 발명에 따라 제2 표면으로부터 이격된, 바람직하게는 제2 표면 반대쪽에 구성요소의 제1 표면의 실제 온도를 측정하는 단계, 및 제1 표면과 제2 표면 사이의 열 전달에 대한 적어도 하나의 물리적 기반 분석 모델을 사용하는 제1 표면의 측정된 실제 온도에 기초하여 제2 표면의 실제 온도를 추정하는 단계를 포함하는 방법으로 달성되며, 여기서 분산-매개변수 모델 및 집중-매개변수 모델을 포함하는 하이브리드 모델이 물리적 기반 분석 모델로서 사용된다.]","The second object is achieved according to the invention with a method comprising measuring an actual temperature of a first surface of the component, spaced from the second surface, preferably opposite the second surface, and estimating an actual temperature of the second surface based on the measured actual temperature of the first surface using at least one physics-based analytical model of the heat transfer between the first surface and the second surface.",True,0.1890990585088729,0.9096710350290348,64,72,-8,262,464,-202
"[바람직하게는, 상기 방법은: 피드백 제어기로 제2 표면의 추정된 실제 온도 및 제2 표면의 미리 정의된 원하는 온도에 기초하여 가열 장치에 대한 조작 변수를 계산함으로써, 구성요소의 제2 표면의 온도를 미리 정의된 원하는 온도로 제어하는 단계, 및 계산된 조작 변수를 사용하여 가열 장치로 구성요소의 제1 표면을 가열하는 단계를 추가로 포함한다.",Preferably the method further comprises: controlling the temperature of the second surface of the component to a predefined desired temperature by calculating with a feedback controller a manipulated variable for a heating device based on the estimated actual temperature of the second surface and the predefined desired temperature of the second surface and heating the first surface of the component with the heating device using the calculated manipulated variable.,True,0.1382051259279251,0.9339586007522184,48,69,-21,194,468,-274
"이에 의해, 추정된 실제 온도는 피드백 제어에서 실제 값으로 유리하게 사용될 수 있다.]",By this the estimated actual temperature can advantageously be used as an actual value in a feedback control.,True,0.166918084025383,0.8923522358981694,13,18,-5,49,109,-60
"[본 발명에 따른 방법은 구성요소의 표면, 바람직하게는 핫 포일 스탬핑 기계의 스탬핑 플레이트의 스탬핑 계면 표면, 열 밀봉 머신의 가열 유닛의 가열 표면, 반도체 생산에서 웨이퍼 표면 또는 전자 장치에서 전자 부품의 열 임계 표면의 측정 불가능한 온도를 결정 및/또는 제어하는 데 유리하게 사용될 수 있다.","The method according to the invention can advantageously be used for determining and/or controlling a non-measurable temperature of a surface of a component, preferably a stamping interface surface of a stamping plate of a hot foil stamping machine, a heating surface of a heating unit of a heat sealing machine, a surface of a wafer in semiconductor production or a heat-critical surface of an electronic component of an electronic device.The present invention is explained in further detail below with reference to FIGS. 1 to 4, which show exemplary, schematic and non-limiting advantageous embodiments of the invention.",False,0.240523874759674,0.8911487308469044,46,96,-50,172,622,-450
도 3은 온도 추정에 사용되는 하이브리드 모델을 도시한다.,"Fig.1 shows the basic components of a hot foil stamping machine, Fig.2 shows a control scheme for temperature control, Fig.3 shows a hybrid model used for temperature estimation, Fig.4 shows a heating plate for the description of an analytical heat transfer model.",False,0.6727269291877747,0.6061480908750305,8,42,-34,32,264,-232
[도 1은 핫 포일 스탬핑 기계(1)의 예를 개략적으로 도시한다.,Fig.1 shows a schematic example of a hot foil stamping machine 1.,True,0.2035750895738601,0.8777096988291998,9,12,-3,36,65,-29
"핫 포일 스탬핑 기계의 구조 및 작동은 관련 기술분야에서 잘 알려져 있기 때문에, 본 발명과 관련된 구성요소들 만이 도시되었다.","Since the structure and operation of a hot foil stamping machine is well known in the art, only those components are shown, which are relevant for the invention.",True,0.1657480597496032,0.8929428423951027,19,28,-9,71,161,-90
핫 포일 스탬핑 기계(1)는 예를 들어 간략한 도시를 위해 도시되지 않은 베이스 구조 상에 배치될 수 있는 가열 플레이트(2)를 포함한다.,"The hot foil stamping machine 1 comprises a heating plate 2, which can, for example, be arranged on a base structure, which is not shown for the sake of simplicity.",True,0.3455949425697326,0.8205872064706246,20,30,-10,77,164,-87
"가열 플레이트(2)는 예를 들어, 적절한 열 전도성을 갖는 금속 등과 같은 강성 재료(rigid material), 예를 들어 강철 합금으로 제조될 수 있다.","The heating plate 2 can, for example, be made of a rigid material like a metal or the like with suitable heat conductivity, e.g. a steel alloy.",True,0.1480205208063125,0.916575459663882,21,27,-6,88,143,-55
"가열 플레이트(2)는 정사각형, 직사각형 또는 임의의 다른 형상일 수 있고, 제1 표면(A1) 및 반대쪽 제2 표면(A2)을 포함할 수 있다.","The heating plate 2 can be of a square, rectangular or any other shape and can comprise a first surface A1 and an opposite second surface A2.",True,0.106448970735073,0.9395045393942858,19,27,-8,79,141,-62
"바람직하게는, 가열 플레이트(2)는 대향 표면(A1, A2) 사이에서 균일한 두께를 갖는다.","Preferably, the heating plate 2 has a uniform thickness between the opposite surfaces A1, A2.",True,0.1146805435419082,0.9328096790909892,10,15,-5,51,93,-42
가열 플레이트(2)는 예를 들어 가열 플레이트(2)의 제1 표면(A1) 상에 격자 패턴으로 배열될 수 있는 하나 이상의 저항 히터 형태의 적어도 하나의 가열 장치(7)를 포함한다.,"The heating plate 2 comprises at least one heating device 7, for example, in the form of one or more resistance heaters, which can be arranged in a grid pattern on the first surface A1 of the heating plate 2.",True,0.1358916014432907,0.9329051883725512,24,40,-16,100,208,-108
"가열 장치(들)(7)에 의해, 가열 플레이트(2)는 특정 온도로 가열될 수 있다.","By means of the heating device(s) 7, the heating plate 2 can be heated to a certain temperature.",True,0.1639777719974517,0.9034518573275084,10,18,-8,45,96,-51
"상기 발현 카세트는 통상 상기 폴리뉴클레오티드에 작동 가능하게 연결되어 있는 프로모터 (promoter), 전사 종결신호, 리보좀 결합부위 및 번역 종결신호를 포함할 수 있다.","Commonly, the expression cassette may include a promoter operably linked to the polynucleotide, transcriptional termination signals, ribosome binding sites, and translation termination signals.",True,0.222417414188385,0.870620425310905,22,23,-1,98,193,-95
상기 발현 카세트는 자체 복제가 가능한 발현 벡터 형태일 수 있다.,The expression cassette may be in the form of a self-replicable expression vector.,True,0.1987326890230178,0.865500538606495,11,13,-2,37,82,-45
"또한, 상기 폴리뉴클레오티드는 그 자체의 형태로 숙주세포에 도입되어 숙주세포에서 발현에 필요한 서열과 작동 가능하게 연결되어 있는 것일 수도 있으며, 이에 한정되지 않는다.","Additionally, the polynucleotide as it is may be introduced into the host cell and operably linked to sequences required for expression in the host cell, but is not limited thereto.",True,0.2358839660882949,0.8645401524030837,22,30,-8,96,181,-85
"상기 형질전환 하는 방법은 핵산을 세포 내로 도입하는 어떤 방법도 포함되며, 숙주세포에 따라 당 분야에서 공지된 바와 같이 적합한 표준 기술을 선택하여 수행할 수 있다.","The transformation method includes any method of introducing a polynucleotide into a cell, and may be performed by selecting a suitable standard technique known in the art, depending on the host cell.",True,0.2748760282993316,0.8357066143188132,25,32,-7,94,200,-106
"예를 들어, 전기천공법 (electroporation), 인산칼슘 (Ca(H2PO4)2, CaHPO4, 또는 Ca3(PO4)2) 침전, 염화칼슘 (CaCl2) 침전, 미세주입법 (microinjection), 폴리에틸렌글리콜 (PEG)법, DEAE-덱스트란법, 양이온 리포좀법, 및 초산 리튬-DMSO법 등이 있으나, 이에 제한되지 않는다.","For example, the method may include electroporation, calcium phosphate (Ca(H2PO 4 )2, CaHPO 4, or Ca3(PO4 )2) precipitation, calcium chloride (CaCl2) precipitation, microinjection, a polyethyleneglycol (PEG) method, a DEAE-dextran method, a cationic liposome method, a lithium acetate-DMSO method, etc., but the method is not limited thereto.",True,0.0827664583921432,0.9509096358261024,28,46,-18,190,342,-152
"본 출원의 다른 하나의 양태는, 상기 아세토하이드록시산 신타제 활성을 갖는 단백질 변이체를 포함하는, 미생물을 제공한다.",Still another aspect of the present disclosure provides a microorganism including the protein variant having acetohydroxy acid synthase activity.,True,0.2108946740627288,0.8656161394573122,15,19,-4,67,145,-78
"구체적으로 상기 미생물은 본 출원의 아세토하이드록시산 신타제 활성을 갖는 단백질 변이체를 발현하는, L-이소류신을 생산하는 미생물일 수 있다.","Specifically, the microorganism may be a microorganism producing L-isoleucine, which expresses the protein variant having acetohydroxy acid synthase activity of the present disclosure.",True,0.1820731163024902,0.9006356981258633,17,23,-6,79,184,-105
"본 출원에서 용어, 단백질이 ""발현되도록/되는/하는""은 목적 단백질이 미생물 내에 도입되거나, 미생물내에서 발현되도록 변형된 상태를 의미한다.","As used herein, the term ""protein allowed to be expressed/to be expressed/expressed"" refers to a state in which the target protein is introduced into the microorganism or is modified to be expressed in the microorganism.",True,0.2292096614837646,0.8716138494991181,15,35,-20,79,220,-141
상기 목적 단백질이 미생물내 존재하는 단백질인 경우 내재적 또는 변형전에 비하여 그 활성이 강화된 상태를 의미한다.,"When the target - 15protein is a protein present in the microorganism, it means a state in which its activity is enhanced, as compared with the endogenous activity or activity before modification.",True,0.3334097564220428,0.7879672653331811,16,32,-16,64,196,-132
"본 출원의 목적상 ""목적 단백질""은 전술한 아세토하이드록시산 신타제 활성을 가지는 단백질의 변이체일 수 있다.","With respect to the objects of the present disclosure, the ""target protein"" may be a variant of the protein having acetohydroxy acid synthase activity described above.",True,0.1924813389778137,0.8847349199345894,14,26,-12,61,167,-106
"구체적으로, ""단백질의 도입""은, 미생물이 본래 가지고 있지 않았던 특정 단백질의 활성을 나타나게 되는 것 또는 해당 단백질의 내재적 활성 또는 변형 전 활성에 비하여 향상된 활성을 나타나게 되는 것을 의미한다.","Specifically, ""introduction of the protein"" means that a microorganism exhibits activity of a particular protein that was not originally possessed, or exhibits enhanced activity, as compared with the endogenous activity of the corresponding protein or the activity before modification.",True,0.1301891803741455,0.9267966668807772,30,39,-9,118,285,-167
"예를 들어, 특정 단백질을 코딩하는 폴리뉴클레오티드가 미생물 내 염색체로 도입되거나, 특정 단백질을 코딩하는 폴리뉴클레오티드를 포함하는 벡터가 미생물 내로 도입되어 이의 활성이 나타나는 것일 수 있다.","For example, a polynucleotide encoding a particular protein may be introduced into a chromosome in a microorganism, or a vector containing a polynucleotide encoding a particular protein may be introduced into a microorganism to exhibit its activity.",True,0.215443953871727,0.895921131558516,25,37,-12,112,249,-137
"또한, ""활성의 강화""는 미생물이 가진 특정 단백질 활성이 그 내재적 활성 또는 변형 전 활성에 비하여 향상되거나, 특정 단백질에 대한 피드백 저해 효과가 해제되어 이의 내재적 활성 또는 변형전 활성에 비하여 활성이 저해되지 않게 되는 것을 의미한다. ""내재적 활성""은 자연적, 또는 인위적 요인에 의한 유전적 변이로 미생물의 형질이 변화하는 경우, 형질 변화 전 모균주가 본래 가지고 있던 특정 단백질의 활성을 말한다.","Further, the ""enhancement of activity"" means that particular protein activity of a microorganism is enhanced, as compared with its endogenous activity or activity before modification, or a feedback inhibition effect on a particular protein is released, and thus activity is not inhibited, as compared with its endogenous activity or activity before modification.",False,0.1662727296352386,0.9077843552084456,61,52,9,235,362,-127
"구체적으로, 본 출원의 활성 강화는 목적하는 단백질을 코딩하는 폴리뉴클레오티드의 세포 내 카피수 증가, 목적하는 단백질을 암호화하는 폴리뉴클레오티드의 발현 조절 서열에 변이를 도입하는 방법, 목적하는 단백질을 암호화하는 폴리뉴클레오티드 발현 조절 서열을 활성이 강력한 서열로 교체하는 방법, 염색체상의 목적하는 단백질을 코딩하는 폴리뉴클레오티드를 활성이 강화된 단백질 변이체를 암호화하는 폴리뉴클레오티드로 대체하거나 변이를 추가적으로 도입시키는 것과 같은 폴리뉴클레오티드 서열을 변형시키는 방법 및 미생물에 단백질 변이체를 도입하는 방법으로 이루어진 군으로부터 선택되는 어느 하나 이상의 방법으로 이루어질 수 있으나 이에 제한되지 않는다.","Specifically, the enhancement of activity in the present disclosure may be achieved by any one method selected from the group consisting of methods of modifying a polynucleotide sequence, such as a method of increasing the copy number of a polynucleotide encoding the target protein in a cell, a method of introducing a modification in the expression regulatory sequence of the polynucleotide encoding the target protein, a method of substituting the expression regulatory sequence of the polynucleotide encoding the target protein with a sequence having strong activity, a method of substituting the polynucleotide encoding the target protein on the chromosome with a polynucleotide encoding a protein variant having enhanced activity, or a method of additionally introducing a mutation; and a method of introducing a protein variant into a - 16microorganism, but is not limited thereto.",True,0.2397356629371643,0.8857371667711835,75,134,-59,357,888,-531
상기 목적하는 단백질을 코딩하는 폴리뉴클레오티드는 목적 유전자를 의미할 수 있다.,The polynucleotide encoding the target protein may refer to a target gene.,True,0.2014008462429046,0.8719754537449792,10,12,-2,45,74,-29
"상기에서 폴리뉴클레오티드의 카피수 증가는, 특별히 이에 제한되지 않으나, 벡터에 작동 가능하게 연결된 형태로 수행되거나, 숙주세포 내의 염색체 내로 삽입됨으로써 수행될 수 있다.","In the above, the increase in the copy number of the polynucleotide, while not particularly limited thereto, may be performed in a state operably linked to a vector, or by being inserted into the chromosome within a host cell.",True,0.2564615309238434,0.8562777006851308,22,39,-17,99,226,-127
"구체적으로, 본 출원의 단백질을 코딩하는 폴리뉴클레오티드가 작동 가능하게 연결된, 숙주와 무관하게 복제되고 기능할 수 있는 벡터가 숙주세포내에 도입되는 것일 수 있다.","Specifically, the method may be executed by introducing a vector into a host cell, the vector to which the polynucleotide encoding the protein of the present disclosure is operably linked, and which may replicate and function irrespective of a host; or introducing a vector into the chromosome of the host cell, the vector to which the polynucleotide is operably linked and capable of inserting the polynucleotide into the chromosome of the host cell.",False,0.4427510201931,0.7740289903005485,21,73,-52,93,451,-358
"상기 폴리뉴클레오티드의 염색체내로의 삽입은 당업계에 알려진 임의의 방법, 예를 들면, 상동재조합에 의하여 이루어질 수 있다.","The insertion of the polynucleotide into the chromosome may be performed using a known method in the art, for example, by homologous recombination.",True,0.3297830820083618,0.7944839978076026,15,23,-8,69,147,-78
"다음으로, 폴리뉴클레오티드의 발현이 증가하도록 발현 조절서열을 변형하는 것은, 특별히 이에 제한되지 않으나, 상기 발현 조절서열의 활성을 더욱 강화하도록 핵산 서열을 결실, 삽입, 비보전적 또는 보전적 치환 또는 이들의 조합으로 서열상의 변이를 유도하여 수행하거나, 더욱 강한 활성을 갖는 핵산 서열로 교체함에 의하여 수행될 수 있다.","Next, the modification of the expression regulatory sequence for increasing expression of a polynucleotide, while not particularly limited thereto, may be performed by inducing a modification in the polynucleotide sequence via deletion, insertion, non conservative or conservative substitution, or a combination thereof so as to further enhance the activity of the expression regulatory sequence, or by replacing the polynucleotide sequence with a nucleotide sequence with a stronger activity.",True,0.1850673556327819,0.903892187520064,44,68,-24,187,493,-306
"상기 발현 조절서열은, 특별히 이에 제한되지 않으나, 프로모터, 오퍼레이터 서열, 리보좀 결합부위를 코딩하는 서열, 전사 및 해독의 종결을 조절하는 서열 등을 포함할 수 있다.","The expression regulatory sequence may include, but is not particularly limited to, a promoter, an operator sequence, a sequence encoding a ribosome-binding domain, a sequence regulating termination of transcription and translation, etc.",True,0.2538539469242096,0.8462682736515271,24,32,-8,98,237,-139
상기 발현 조절서열의 활성을 더욱 강화하기 위하여 더욱 강한 활성을 갖는 핵산 서열로 교체하는 것은 본래의 프로모터 대신 보다 강력한 프로모터가 연결되는 것일 수 있으며 이에 한정되는 것은 아니다.,"The replacement with a nucleotide sequence with a stronger activity to further enhance the activity of the expression regulatory sequence is to connect a stronger promoter, instead of the original promoter, but is not limited thereto.",True,0.2001084238290786,0.8771479195711267,29,36,-7,110,234,-124
"공지된 강력한 프로모터의 예에는 cj1 내지 cj7 프로모터(대한민국 등록특허 제10-0620092호), lac 프로모터, trp 프로모터, trc 프로모터, tac 프로모터, 람다 파아지 PR 프로모터, PL 프로모터, tet 프로모터, gapA 프로모터, SPL7 프로모터, SPL13(sm3) 프로모터 (대한민국 등록특허 제 10-1783170호), O2 프로모터(대한민국 등록특허 제10-1632642), tkt 프로모터 및 yccA 프로모터 등이 있으나 이에 한정되는 것은 아니다.","Examples of the known strong promoters may include cjl to cj7 promoters (Korean Patent No. 10 0620092), lac promoter, trp promoter, trc promoter, tac promoter, lambda phage PR promoter, PL promoter, tet promoter, gapA promoter, SPL7 promoter, SPL13(sm3) promoter (Korean Patent No. 10-1783170), 02 promoter (Korean Patent No. 10-1632642), - 17tkt promoter, yccA promoter, etc., but the promoter is not limited thereto.",True,0.1571668684482574,0.9023975853650462,51,62,-11,274,418,-144
"아울러, 염색체상의 폴리뉴클레오티드 서열의 변형은, 특별히 이에 제한되지 않으나, 상기 폴리뉴클레오티드 서열의 활성을 더욱 강화하도록 핵산 서열을 결실, 삽입, 비보전적 또는 보전적 치환 또는 이들의 조합으로 발현 조절서열상의 변이를 유도하여 수행하거나, 더욱 강한 활성을 갖도록 개량된 폴리뉴클레오티드 서열로 교체함에 의하여 수행될 수 있다.","Additionally, the modification of the polynucleotide sequence on the chromosome, while not particularly limited thereto, may be performed by inducing a modification in the expression regulatory sequence via deletion, insertion, non-conservative or conservative substitution, or a combination thereof so as to further enhance the activity of the polynucleotide sequence, or by replacing the polynucleotide sequence with a polynucleotide sequence which is improved to have stronger activity.",True,0.2311081886291504,0.8810230954048547,43,66,-23,192,489,-297
"이와 같은 단백질 활성의 도입 및 강화는, 상응하는 단백질의 활성 또는 농도가 야생형이나 비변형 미생물 균주에서의 단백질의 활성 또는 농도를 기준으로 하여 일반적으로 최소 1%, 10%, 25%, 50%, 75%, 100%, 150%, 200%, 300%, 400% 또는 500%, 최대 1000% 또는 2000%까지 증가되는 것일 수 있으나, 이에 제한되는 것은 아니다.","Such introduction and enhancement of the protein activity may increase the activity or concentration of the corresponding protein relative to the activity or concentration of a protein of a wild-type or non-modified microorganism strain from at least 1%, 10%, 25%, 50%, 75%, 100%, 150%, 200%, 300%, 400%, or 5 0 0 %, to a maximum of 1,000% or 2,000%, but is not limited thereto.",True,0.2368634939193725,0.8627340239841323,48,64,-16,208,378,-170
"본 출원에서 용어, ""L-이소류신을 생산하는 미생물""은 배지 중의 탄소원으로부터 L-이소류신을 야생형이나 비변형 미생물과 비교하여 과량으로 생산할 수 있는 미생물을 말한다.","As used herein, the term ""microorganism producing L-isoleucine"" refers to a microorganism capable of producing a large amount of L-isoleucine from a carbon source in a medium, as compared with a wild-type or non-modified microorganism.",True,0.2235113829374313,0.8691038934830949,20,35,-15,96,235,-139
"또한, 상기 L-이소류신을 생산하는 미생물은 재조합 미생물일 수 있다.","Further, the microorganism producing L-isoleucine may be a recombinant microorganism.",True,0.1357543021440506,0.9212540431367584,9,10,-1,39,85,-46
"구체적으로 L-이소류신을 생산할 수 있다면 그 종류가 특별히 제한되지 않으나, 엔테로박터(Enterbacter) 속, 에스케리키아(Escherichia) 속, 어위니 아(Erwinia) 속, 세라티아(Serratia) 속, 프로비덴시아(Providencia) 속, 코리네박테리움(Corynebacterium) 속 및 브레비박테리움(Brevibacterium) 속에 속하는 미생물 일 수 있다.","Specifically, the kind of the microorganism is not particularly limited, as long as it is able to produce L-isoleucine, and the microorganism may be a microorganism belonging to the genus Enterobacter, the genus Escherichia, the genus Erwinia, the genus Serratia, the genus Providencia, the genus Corynebacterium, or the genus Brevibacterium.",True,0.2237603366374969,0.8761535498702226,31,50,-19,219,342,-123
보다 구체적으로는 코리네박테리움(Corynebacterium) 속 또는 에스케리키아(Escherichia) 속에 속하는 미생물일 수 있다.,"More specifically, the microorganism may be a microorganism belonging to the genus Corynebacterium or the genus Escherichia.",True,0.140533298254013,0.9125612978172492,11,17,-6,77,124,-47
"보다 더욱 구체적으로는 에스케리키아속(Escherichia) 미생물은 대장균(Escherichia coli)일 수 있으며, 코리네박테리움(Corynebacterium) 속 미생물은 코리네박테리움 글루타미쿰 (Corynebacterium glutamicum)일 수 있으나, 아세토하이드록시산 신타제 활성을 갖는 단백질이 도입 또는 강화되어 L-이소류신 생산량이 증가될 수 있는 에스케리키아 속 또는 코리네박테리움 속에 속하는 미생물은 제한 없이 포함될 수 있다.","Much more specifically, the microorganism belonging to the genus Escherichia may be Escherichia coli, and the microorganism belonging to the genus Corynebacterium may be Corynebacterium glutamicum.",False,0.4176122546195984,0.7679009573833905,43,26,17,257,197,60
본 출원에서 아세토하이드록시산 신타제 활성을 갖는 단백질 변이체가 발현되도록 변형된 L-이소류신을 생산하는 미생물의 모균주는 L-이소류신을 생산하는 미생물이라면 특별히 제한되지 않는다.,"In the present disclosure, a parent strain of the microorganism producing L isoleucine which is modified to express the protein variant having acetohydroxy acid synthase activity is not particularly limited, as long as it is a microorganism producing L isoleucine.",True,0.2088557779788971,0.8835626538027017,20,40,-20,103,264,-161
L-이소류신을 생산하는 미생물은 천연형 미생물 자체 또는 외부 L-이소류신 생산 기작과 관련된 유전자가 삽입되거나 내재적 유전자의 활성을 강화시키거나 불활성시켜 향상된 L-이소류신 생산능을 가지게 된 미생물일 수 있다.,The microorganism producing L-isoleucine may be a natural microorganism itself or a microorganism having improved L-isoleucine productivity by inserting an exogenous gene related to the L-isoleucine production mechanism or by enhancing or inactivating the activity of the endogenous gene.,True,0.1876341998577118,0.8984814413088943,27,39,-12,122,288,-166
"본 출원의 다른 하나의 양태는, 상기 아세토하이드록시산 신타제 활성을 갖는 단백질 변이체를 발현하는, L-이소류신을 생산하는 미생물을 배지에서 배양하는 것을 포함하는, L-이소류신의 생산 방법에 대한 것이다.","Still another aspect of the present disclosure provides a method of producing L isoleucine, the method including culturing, in a medium, a microorganism producing L isoleucine, the microorganism expressing the protein variant having acetohydroxy acid synthase activity.",True,0.208239734172821,0.8812182399244951,25,37,-12,116,269,-153
"상기 L-이소류신, 서열번호 1의 아미노산 서열을 포함하는 아세토하이드록시산 신타제 활성을 갖는 단백질, 단백질의 발현, 및 미생물에 대해서는 상기에서 설명한 바와 같다.","The L-isoleucine, the protein having acetohydroxy acid synthase activity including the amino acid sequence of SEQ ID NO: 1, the expression of the protein, and the microorganism are the same as described above.",True,0.2011223137378692,0.8789294235056305,21,33,-12,95,209,-114
"본 출원의 ""L-이소류신""은 L-이소류신 그 자체 형태뿐 아니라, 이의 염 형태도 모두 포함될 수 있다.","As used herein, the ""L-isoleucine"" may include L-isoleucine itself as well as salts thereof.",True,0.3780739903450012,0.7634774385869438,15,14,1,58,92,-34
"본 출원에서 용어, ""배양""은 상기 미생물을 적당히 조절된 환경 조건에서 생육시키는 것을 의미한다.","As used herein, the term ""culturing"" refers to growing the microorganism in appropriately controlled environmental conditions.",True,0.1952048987150192,0.8683528433351141,13,16,-3,55,126,-71
본 출원의 배양과정은 당업계에 알려진 적당한 배지와 배양조건에 따라 이루어질 수 있다.,The culturing process of the present disclosure may be performed according to appropriate medium and culture conditions known in the art.,True,0.2818152606487274,0.7937528128871565,12,21,-9,48,137,-89
이러한 배양 과정은 선택되는 균주에 따라 당업자가 용이하게 조정하여 사용할 수 있다.,The culturing process may be easily adjusted for use by a skilled person in the art according to the strain to be selected.,True,0.2776023745536804,0.7905472041823686,12,23,-11,47,123,-76
"구체적으로 상기 배양은 회분식, 연속식및 유가식일 수 있으나, 이에 제한되는 것은 아니다.","Specifically, the culturing may be performed in a batch, continuous, or fed batch mode, but is not limited thereto.",True,0.2274451553821563,0.8431870427828796,12,19,-7,50,115,-65
"본 출원에서 용어, ""배지""는 상기 미생물을 배양하기 위해 필요로 하는 영양 물질을 주성분으로 혼합한 물질을 의미하며, 생존 및 발육에 불가결한 물을 비롯하여 영양물질 및 발육인자 등을 공급한다.","As used herein, the term ""medium"" refers to a substance in which nutrients required for culturing the microorganism are mixed as main components, and supplies nutrients and growth factors, including water essential to survival and development.",True,0.1927185654640197,0.8738391334899844,27,36,-9,109,243,-134
"구체적으로, 본 출원의 미생물의 배양에 사용되는 배지 및 기타 배양 조건은 통상의 미생물의 배양에 사용되는 배지라면 특별한 제한 없이 어느 것이나 사용할 수 있으나, 본 출원의 미생물을 적당한 탄소원, 질소원, 인원, 무기화합물, 아미노산 및/또는 비타민 등을 함유한 통상의 배지내에서 호기성 조건 하에서 온도, pH 등을 조절하면서 배양할 수 있다.","Specifically, the medium and other culture conditions used for culturing the -19microorganism of the present disclosure may be used without particular limitation as long as they are commonly used for culturing microorganisms.",False,0.5271473526954651,0.6885650926511748,49,32,17,196,225,-29
"본 출원에서 상기 탄소원으로는 글루코오스, 프룩토오스, 수크로오스, 말토오스 등과 같은 탄수화물; 만니톨, 소르비톨 등과 같은 당 알코올, 피루브산, 락트산, 시트르산 등과 같은 유기산; 글루탐산, 메티오닌, 리신 등과 같은 아미노산 등이 포함될 수 있다.","The microorganism of the present disclosure may be cultured in a common medium containing appropriate carbon sources, nitrogen sources, phosphorus sources, inorganic compounds, amino acids, and/or vitamins while controlling temperature, pH, etc. under aerobic conditions.",False,0.8181010484695435,0.503215631819499,33,35,-2,143,271,-128
"또한, 전분 가수분해물, 당밀, 블랙스트랩 당밀, 쌀겨울, 카사버, 사탕수수 찌꺼기 및 옥수수 침지액 같은 천연의 유기 영양원을 사용할 수 있으며, 구체적으로는 글루코오스 및 살균된 전처리 당밀(즉, 환원당으로 전환된 당밀)등과 같은 탄수화물이 사용될 수 있으며, 그 외의 적정량의 탄소원을 제한 없이 다양하게 이용할 수 있다.","In the present disclosure, the carbon sources may include carbohydrates such as glucose, fructose, sucrose, maltose, etc.; sugar alcohols such as mannitol, sorbitol, etc.; organic acids such as pyruvate, lactate, citrate, etc.; and amino acids such as glutamic acid, methionine, lysine, etc. Additionally, natural organic nutrients such as starch hydrolysate, molasses, blackstrap molasses, rice bran, cassava, sugar cane molasses, corn steep liquor, etc., and specifically, carbohydrates such as glucose and sterile pretreated molasses (i.e., molasses converted to a reducing sugar), etc. may be used.",False,0.3854327201843261,0.7720867644822229,44,84,-40,183,602,-419
"이들 탄소원은 단독으로 사용되거나 2 종 이상이 조합되어 사용될 수 있으며, 이에 한정되는 것은 아니다.","Furthermore, various other carbon sources may be used in a suitable amount without limitation.",False,0.6562079787254333,0.5210591793036425,15,14,1,58,94,-36
"이들 질소원은 단독으로 사용되거나 2 종 이상이 조합되어 사용될 수 있으며, 이에 한정되는 것은 아니다.","These carbon sources may be used alone or in a combination of two or more thereof, but are not limited thereto.",False,0.2056911289691925,0.8511839417780167,15,21,-6,58,111,-53
[정제수를 도포하였다. ],Purified water was applied.,True,0.6266456842422485,0.5207599992524587,3,4,-1,14,27,-13
"[다른 조건은, 실시예 1 과 동일하다.]",The other conditions were the same as those in Example 1.,True,0.2263927608728408,0.8510254713144196,6,11,-5,23,57,-34
"[상기 실시예 및 비교예의 시트를 사용하여, 이하의 시험 1 - 5 를 실시하였다.]","Using the above sheets of Examples and Comparative Examples, the following Tests 1 to 5 were conducted.",True,0.2559140622615814,0.8443083120668111,13,17,-4,47,103,-56
[[시험 1. 기계 처리 CNF 용액의 농도와 요철의 유무 및 부직포의 부드러움,[Test 1.,False,0.7926974296569824,0.536410358566515,12,2,10,44,8,36
검토] ],"Examination of Concentration of Mechanically treated CNF Solution, Presence of Unevenness, and Softness of Nonwoven Fabric]",False,1.056206226348877,0.226592723261051,2,16,-14,5,123,-118
"[실시예 1 - 4 및 비교예 1 에 대응하는 샘플에 대해, 이하의 2 가지 시험을 실시하였다.]",The following two tests were conducted for the samples of Examples 1 to 4 and Comparative Example 1.,True,0.2005218565464019,0.8801209945687286,16,18,-2,54,100,-46
[[평가 방법] ],[Evaluation Method],True,0.1308512538671493,0.9119904310871468,3,2,1,10,19,-9
[(요철의 관능 평가) ],(Sensory Evaluation of Unevenness),True,0.4711556136608124,0.6153297645571699,4,4,0,14,34,-20
"[실시예 및 비교예의 샘플을 10 명의 피험자에게 비교시킨 후, 요철의 유무에 대해 평가를 실시하였다. ]","The samples of Examples and Comparative Example were compared by ten testers, and the presence or absence of unevenness was evaluated.",True,0.4647716879844665,0.6845886531030488,15,21,-6,59,134,-75
"[시험 결과는, 10 명 중 7 명 이상이 요철이 있다고 회답한 경우를 ○, 10 명 중 7 명 이상이 요철이 없다고 회답한 경우를 ×, 그 이외를 △ 로 하였다.]","The test result was set as AA when seven or more out of the ten testers answered that the sheet was uneven, as CC when seven or more out of the ten testers answered that the sheet was not uneven, and as BB in the other cases.",True,0.4820417761802673,0.6667291129929411,29,47,-18,92,225,-133
[(부드러움의 관능 평가) ],(Sensory Evaluation of Softness),True,0.2367914319038391,0.8162621977327794,4,4,0,16,32,-16
"[실시예 및 비교예의 샘플을 10 명의 피험자에게 비교시킨 후, 부드러움에 대해 평가를 실시하였다. ]","The samples of the Examples and the Comparative Example were compared by ten testers, and the softness was evaluated.",True,0.5006242990493774,0.6568024868220377,14,19,-5,57,117,-60
"[시험 결과는, 10 명 중 7 명 이상이 CNF 를 도포하고 있지 않은 부직포와 동등 이상의 부드러움이라고 회답한 경우를 ○, 10 명 중 7 명 이상이 CNF 를 도포하고 있지 않은 부직포와 비교해서 딱딱하다고 회답한 경우를 ×, 그 이외를 △ 로 하였다.]","The test result was set as AA when seven or more out of the ten testers answered that the sheet was as soft as or softer than a nonwoven fabric without CNF application, as CC when seven or more out of the ten testers answered that the sheet was harder than a nonwoven fabric without CNF application, and as BB in the other cases.",True,0.3858096301555633,0.7658603640051646,42,64,-22,146,329,-183
[시험 결과를 표 1 에 나타낸다.],Results of the tests are shown in Table I.[Table 1],True,0.1792462915182113,0.8931204168756679,6,10,-4,20,51,-31
[[평가] ],[Evaluation],True,0.1503446102142334,0.8992528248925802,2,1,1,7,12,-5
"[표 1 의 실시예 1 - 4 와 비교예 1 을 각각 비교하면, 기계 처리 CNF 용액에 있어서는, 농도 0.75 ∼ 2.00 ％, 보다 바람직하게는 0.75 ∼ 1.50 ％ 의 용액을 도포하면, 요철의 형성과 시트 (P) 의 부드러움을 양립시킬 수 있는 것을 알 수 있었다.]","Comparison of each of Examples 1 to 4 and Comparative Example 1 in Table I revealed that both unevenness formation and softness of the sheet P could be achieved as a result of applying the mechanically treated CNF solution with a concentration of 0.75 to 2.00%, more preferably 0.75 to 1.50%.",True,0.2074380069971084,0.8868635615785332,45,51,-6,155,292,-137
[[시험 2. 효소 처리 CNF 용액의 농도와 요철의 유무 및 부직포의 부드러움,[Test 2.,False,0.7718421816825867,0.5308381289077472,12,2,10,44,8,36
검토] ],"Examination of Concentration of Enzymatically treated CNF Solution, Presence of Unevenness, and Softness of Nonwoven Fabric]",False,1.0787349939346311,0.2085984096368753,2,16,-14,5,124,-119
"[다음으로, 실시예 5 - 8 및 비교예 2 에 대응하는 샘플에 대해, 시험 1 과 동일한 시험을 실시한 결과를 표 2 에 나타낸다.]","Next, tests similar to Test 1 were conducted for the samples of Examples 5 to 8 and Comparative Example 2.",False,0.2615577280521393,0.8462574169578818,23,20,3,75,106,-31
"[Table[attributes={}; value=[TableImage[attributes={tableNumber=2}; value=[ImageFormatCategory[attributes={}; value=[TIFF]], ImageFileName[attributes={}; value=[pct00002.tif]], HeightMeasure[attributes={measureUnitCode=Px}; value=[38]], WidthMeasure[attributes={measureUnitCode=Px}; value=[143]]]]]]]",The results of the tests are shown in Table II.[Table 2],False,0.7282999753952026,0.5150093535016901,10,11,-1,300,56,244
[[평가] ],[Evaluation],True,0.1503446102142334,0.8992528248925802,2,1,1,7,12,-5
"[표 2 의 실시예 5 - 8 과 비교예 2 를 각각 비교하면, 효소 처리 CNF 에 있어서도, 농도 0.75 ∼ 2.00 ％, 보다 바람직하게는 1.00 ∼ 1.50 ％ 의 용액을 도포하면, 요철의 형성과 시트 (P) 의 부드러움을 양립시킬 수 있는 것을 알 수 있었다.]","Comparison of each of Examples 5 to 8 and Comparative Example 2 in Table II revealed that both unevenness formation and softness of the sheet P could be also achieved as a result of applying the enzymatically treated CNF solution with a concentration of 0.75 to 2.00%, more preferably 1.00 to 1.50%.",True,0.2109309434890747,0.8844181362494636,45,52,-7,153,299,-146
[[시험 3. TEMPO 산화 CNF 용액의 농도와 요철의 유무 및 부직포의 부드러움,[Test 3.,False,0.7184178233146667,0.5531487844018942,12,2,10,47,8,39
검토] ],"Examination of Concentration of TEMPO-oxidized CNF Solution, Presence of Unevenness, and Softness of Nonwoven Fabric]",False,1.0800145864486694,0.2227188186535985,2,15,-13,5,117,-112
"[다음으로, 실시예 9 - 11 및 비교예 3 에 대응하는 샘플에 대해, 시험 1 과 동일한 시험을 실시한 결과를 표 3 에 나타낸다.]","Next, tests similar to Test 1 were conducted for the samples of Examples 9 to 11 and Comparative Example 3.",False,0.2163182944059372,0.8713899582206774,23,20,3,76,107,-31
"[Table[attributes={}; value=[TableImage[attributes={tableNumber=3}; value=[ImageFormatCategory[attributes={}; value=[TIFF]], ImageFileName[attributes={}; value=[pct00003.tif]], HeightMeasure[attributes={measureUnitCode=Px}; value=[37]], WidthMeasure[attributes={measureUnitCode=Px}; value=[137]]]]]]]",The results of the tests are shown in Table III.[TABLE 3],False,0.6846519112586975,0.5391054696657718,10,11,-1,300,57,243
[[평가] ],[Evaluation],True,0.1503446102142334,0.8992528248925802,2,1,1,7,12,-5
"[표 3 의 실시예 9 - 11 과 비교예 3 을 각각 비교하면, TEMPO 산화 CNF 용액에 있어서도, 농도 0.75 ∼ 1.50 ％, 보다 바람직하게는 1.50 ％ 의 용액을 도포하면, 요철의 형성과 시트 (P) 의 부드러움을 양립시킬 수 있는 것을 알 수 있었다.]","Comparison of each of Examples 9 to 11 and Comparative Example 3 in Table III revealed that both unevenness formation and softness of the sheet P could be also achieved as a result of applying the TEMPO-oxidized CNF solution with a concentration of 0.75 to 1.50%, more preferably 1.50%.",True,0.2123342007398605,0.8826421128188376,43,49,-6,152,286,-134
[[시험 4. ELLEX-☆ 용액의 농도와 요철의 유무 및 부직포의 부드러움,[Test 4.,False,0.6805346608161926,0.5734514252687899,10,2,8,42,8,34
검토] ],"Examination of Concentration of ELLEX-☆ (star) solution, Presence of Unevenness, and Softness of Nonwoven Fabric]",False,1.000410795211792,0.2440490038385004,2,15,-13,5,113,-108
"[다음으로, 실시예 12 - 13 및 비교예 4 에 대응하는 샘플에 대해, 시험 1 과 동일한 시험을 실시한 결과를 표 4 에 나타낸다.]","Next, tests similar to Test 1 were conducted for the samples of Examples 12 to 13 and Comparative Example 4.",False,0.2218173146247863,0.8662777162628517,23,20,3,77,108,-31
"[Table[attributes={}; value=[TableImage[attributes={tableNumber=4}; value=[ImageFormatCategory[attributes={}; value=[TIFF]], ImageFileName[attributes={}; value=[pct00004.tif]], HeightMeasure[attributes={measureUnitCode=Px}; value=[31]], WidthMeasure[attributes={measureUnitCode=Px}; value=[142]]]]]]]",The results of the tests are shown in Table IV.[TABLE 4],False,0.6575216054916382,0.5701877105217653,10,11,-1,300,56,244
[[평가] ],[Evaluation],True,0.1503446102142334,0.8992528248925802,2,1,1,7,12,-5
"[표 4 의 실시예 12 - 13 과 비교예 4 를 각각 비교하면, ELLEX-☆ 용액에 있어서도, 농도 0.75 ∼ 1.00 ％ 의 용액을 도포하면, 요철의 형성과 시트 (P) 의 부드러움을 양립시킬 수 있는 것을 알 수 있었다.]",Comparison of each of Examples 12 to 13 and Comparative Example 4 in Table IV revealed that both unevenness formation and softness of the sheet P could be also achieved as a result of applying the ELLEX-☆ (star) solution with a concentration of 0.75 to 1.00%.,True,0.1912631541490554,0.8861781069457271,37,46,-9,130,259,-129
[[시험 5. CNF 를 함유하지 않는 액체를 도포했을 경우의 요철의 유무 검토] ],Examination of Presence of Unevenness in response to Application of Liquid including no CNF],False,0.4466311633586883,0.709047951071958,13,14,-1,47,92,-45
"[다음으로, 비교예 5 - 10 에 대응하는 샘플에 대해, 시험 1 과 동일한 시험을 실시한 결과를 표 5 에 나타낸다.]","Next, tests similar to Test 1 were conducted for the samples of Comparative Examples 5 to 10.",False,0.2428277283906936,0.8594440119243332,20,17,3,68,93,-25
"[Table[attributes={}; value=[TableImage[attributes={tableNumber=5}; value=[ImageFormatCategory[attributes={}; value=[TIFF]], ImageFileName[attributes={}; value=[pct00005.tif]], HeightMeasure[attributes={measureUnitCode=Px}; value=[31]], WidthMeasure[attributes={measureUnitCode=Px}; value=[142]]]]]]]",The results of the test are shown in Table V.[TABLE 5],False,0.7327513098716736,0.5270617053707074,10,11,-1,300,54,246
[[평가] ],[Evaluation],True,0.1503446102142334,0.8992528248925802,2,1,1,7,12,-5
"[표 5 의 비교예 5 - 10 으로부터, CNF 를 함유하지 않는 액체를 도포한 경우에는, 열 건조를 실시해도 요철이 형성되지 않는 것을 알 수 있었다.]",Comparative Examples 5 to 10 in Table V revealed that unevenness was not formed even after thermal drying when a liquid including no CNF was applied.,True,0.2007838785648346,0.8830263143283991,25,26,-1,87,149,-62
"[이상, 시험 1 - 5 로부터 알 수 있는 바와 같이, 본 실시형태에 의하면, 농도 0.75 ∼ 2.00 ％, 바람직하게는 0.75 ∼ 1.50 ％ 의 CNF 용액을 부직포에 도포하고, 열 건조시킴으로써, 요철 형성과, 유연성이 확보되는 것을 알 수 있다. ]","As can be seen from Tests 1 to 5 above, according to the present embodiment, by applying a CNF solution with a concentration of 0.75 to 2.00%, preferably 0.75 to 1.50%, to the nonwoven fabric and then by thermal drying, the formation of unevenness and softness can be achieved.",True,0.2146873325109481,0.8822711186656965,40,49,-9,146,277,-131
"[또, 시험 1 - 4 로부터, 도포하는 용액에 포함시키는 CNF 는, 어떠한 방법으로 해섬되어 있어도 되는 것을 알 수 있다.]","Also, from Tests 1 to 4, the CNF contained in the solution to be applied can be fibrillated by any method.",True,0.23075532913208,0.8620050296514794,20,21,-1,72,106,-34
[[실시형태의 효과] ],[Effect of Embodiment],True,0.1166964471340179,0.9252470103363514,3,3,0,13,22,-9
"[닦아내기용 시트 (P) 의 제조 공정에 있어서는, 모양이 없는 부직포에 CNF 를 함유하는 용액을 도포하고, 열 건조시킴으로써, 용이하게 패턴부에 의해 요철을 형성할 수 있다.]","In the manufacturing processes of the wiping sheet P, unevenness by the patterned parts can be easily formed by applying the solution containing CNF to the nonwoven fabric with no pattern and then by thermal drying.",True,0.2306762635707855,0.8563313726010636,24,36,-12,100,215,-115
"[또, 부직포의 편면에만 패턴부 (1) 가 형성되어 있음으로써, 두께감 부여와 접촉 면적의 증가가 초래된 CNF 용액 도포면으로 오염을 닦아낸 후, 평활하고 부드러운 CNF 용액 비도포면으로 마무리 닦아내기를 실시할 수 있어, 1 매의 닦아내기용 시트 (P) 에 대해, 두 가지의 효과를 얻을 수 있다.]","As a result, after wiping off the dirt using the surface to which the CNF solution is applied so as to provide thickness feeling and to increase a contacting area, it is possible to perform wiping as a finish using a smooth and soft surface to which the CNF solution is not applied.",False,0.4022677540779114,0.7659758953692752,43,53,-10,170,282,-112
"[이상, 본 발명을 실시형태에 기초하여 구체적으로 설명해 왔지만, 본 발명은 상기 실시형태에 한정되는 것은 아니고, 그 요지를 일탈하지 않는 범위에서 변경 가능하다.]","Although the present invention has been described in detail based on the above embodiments, the present invention is not limited to the above embodiments but can be modified as long as it does not depart from the gist of the present invention.",True,0.3299429416656494,0.7676909530484891,22,42,-20,93,243,-150
"[예를 들어, 상기 실시형태에 있어서는, 닦아내기용 시트 (P) 는 청소에 사용되는 것으로서 설명했지만, 그 용도는 이것에 한정되는 것은 아니다.","For example, in the above embodiments, the wiping sheet P is described as being used for cleaning, but is not limited to be used in this way.",True,0.2151850163936615,0.8551612813425044,19,27,-8,81,141,-60
"또, 용도에 따라, 용액에 첨가되는 성분이나 도포의 패턴이 변경되는 것은 물론이다.]","In addition, depending on the usage, components to be added to the solution and the pattern of application are of course changed.",True,0.2597391009330749,0.8141357953421864,11,22,-11,47,129,-82
"[또, 본 발명에 있어서의 부직포는, 제법이나 조성, 겉보기 중량에는 특별히 제한은 갖지 않는다.","The nonwoven fabric in the present invention is not particularly limited in its manufacturing method, composition, or basis weight.",True,0.3406284749507904,0.7556747161523244,13,19,-6,54,131,-77
"또, 상기 실시형태에 기초하여 형성되는 요철은, 웨트 상태에서도 무너지지 않는 것이므로, 용도에 따라 시트가 건성인지 습성인지도 한정되는 것은 아니다.]","Therefore, whether the sheet is dry or wet is also not limited according to the usage.",False,0.4984687864780426,0.6462229421426209,19,16,3,85,86,-1
"[또, 부직포에 대한 CNF 의 도포 방법으로는, 균일하게 도포할 수 있는 점 등에서, 스프레이 도포인 것이 바람직하지만, 디스펜서 등에 의한 액적 형상의 도포나, 롤에 용액을 한 번 도포하고, 시트면에 접촉시켜 도포하는 롤 도포, 플렉소 인쇄기나 그라비아 인쇄기 등을 사용한 롤 전사 등, 본 발명의 효과를 저해하지 않는 한, 다른 방법이어도 상관없다.]","However, other methods are also applicable as long as they do not impair the effect of the present invention, such as droplet application using a dispenser; roll application where the solution is applied once to a roll and then the roll is brought into contact with the sheet surface for application of the solution; roll transfer using a flexographic or gravure printing machine.",False,0.3739261031150818,0.7676012687611334,51,63,-12,199,380,-181
"[또, 부직포의 열 건조 방법으로는, 건조 시간의 짧음이나, 저렴하고 도입 가능한 점 등에서, 열풍 건조인 것이 바람직하지만, 양키 드럼 등의 가열 롤의 표면에 직접 부직포를 접촉시켜 건조시키는 방법 등, 본 발명의 효과를 저해하지 않는 한, 다른 방법을 단독으로, 또 필요에 따라 조합하여 사용해도 상관없다.]","However, other methods may be used alone or in combination as necessary, as long as the effects of the present invention are not impaired, for example, a method of drying the nonwoven fabric by directly contacting it on a surface of a heating roll such as a Yankee drum.",False,0.3894842565059662,0.7349066485282164,44,49,-5,174,270,-96
"[본 발명의 몇 가지 실시형태를 설명했지만, 본 발명의 범위는, 상기 서술한 실시형태에 한정되는 것은 아니며, 특허 청구의 범위에 기재된 발명의 범위와 그 균등 범위를 포함한다.]","Although some embodiments of the present invention have been described, the scope of the present invention is not limited to the above mentioned embodiments, but includes the scope of the invention described in the claims and their equivalents.",True,0.3037859499454498,0.7918592380615809,25,38,-13,100,244,-144
[U[attributes={}; value=[산업상 이용가능성]]],[Industrial Applicability],False,0.4354417324066162,0.6916016292046342,3,2,1,37,26,11
"[본 발명은, 용이하게 부직포에 패턴부에 의해 요철을 형성할 수 있는 닦아내기용 시트 및 당해 닦아내기용 시트의 제조 방법에 이용할 수 있다.]","The present invention is applicable to a wiping sheet and a manufacturing method of the wiping sheet, which can easily form unevenness on the nonwoven fabric with a patterned part.",True,0.3183827996253967,0.7906207148324802,21,30,-9,80,180,-100
[P : 닦아내기용 시트 1 : 패턴부 2 : 비패턴부],P Wiping sheet 1 Patterned part 2 Non-patterned part,True,0.306245356798172,0.7779455064549189,10,9,1,31,52,-21
도 1은 종래의 기술에 따른 섬유보강재 접착 공법으로서 탄소섬유 시트를 구조물에 접착 시공하는 것을 예시하는 사진이다.,"According to the present invention, because both a textile grid reinforcement (a fiber reinforcement) such as a carbon fiber and a highly durable inorganic binder are incombustible materials, the concrete structure has excellent refractory performance, and particularly can be applied to reinforcing facilities exposed to the danger of fire.",False,0.9238235354423524,0.502323654646201,16,49,-33,66,341,-275
도 18은 본 발명의 실시예에 따른 텍스타일 그리드 보강재와 고내구성 무기계 결합재를 이용한 콘크리트 구조물 보수보강 공법에 의해 보수보강된 콘크리트 구조물인 콘크리트 슬래브 파괴시험을 설명하기 위한 도면이다.,"The above and other objects, features and advantages of the present invention will become more apparent to those having ordinary skill in the art by describing in detail exemplary embodiments thereof with reference to the accompanying drawings, in which: FIG. 1 is a photograph illustrating a method of adhering a fiber reinforcement according to the related art, and particularly how to adhere a carbon fiber sheet to a structure; FIG. 2A a configuration diagram illustrating a structure to which a method of repairing and reinforcing a concrete floor according to the related art is applied; FIG. 2B is a plan view illustrating an anchorage for the method of repairing and reinforcing a concrete floor illustrated in FIG. 2A ; FIG. 3A is a front view illustrating a wire mesh member applied in a method of repairing and reinforcing a concrete structure according to the related art; FIG. 3B is a view illustrating a state in which the wire mesh member is constructed by the method of repairing and reinforcing a concrete structure according to the related art; FIG. 4 is a view schematically illustrating a concrete structure repaired and reinforced using a textile grid reinforcement and a highly durable inorganic binder according to an embodiment of the present invention; FIG. 5 is a view illustrating the concrete structure repaired and reinforced using a textile grid reinforcement and a highly durable inorganic binder according to an embodiment of the present invention; FIGS. 6A to 6C are views specifically illustrating a textile grid reinforcement; FIG. 7 is a view illustrating types of particle sizes of an alumina powder that is a coating material with which a textile grid reinforcement is coated in the concrete structure repaired and reinforced using a textile grid reinforcement and a highly durable inorganic binder according to an embodiment of the present invention; FIG. 8 is a view illustrating a direct pull-out test of a textile grid reinforcement in the concrete structure repaired and reinforced using a textile grid reinforcement and a highly durable inorganic binder according to an embodiment of the present invention; FIG. 9 is a view illustrating an uncoated textile grid reinforcement and a coated textile grid reinforcement in the concrete structure repaired and reinforced using a textile grid reinforcement and a highly durable inorganic binder according to an embodiment of the present invention; FIG. 10 is a view specifically illustrating a grid fixing unit in the concrete structure repaired and reinforced using a textile grid reinforcement and a highly durable inorganic binder according to an embodiment of the present invention; FIG. 11 is a view illustrating a composition of chloride penetration resistant mortar in the concrete structure repaired and reinforced using a textile grid reinforcement and a highly durable inorganic binder according to an embodiment of the present invention; FIG. 12 is a view illustrating a composition of chemical resistant mortar in the concrete structure repaired and reinforced using a textile grid reinforcement and a highly durable inorganic binder according to an embodiment of the present invention; FIG. 13 is a view illustrating reinforcing bar corrosion time evaluation results for evaluating chloride penetration performance with respect to the concrete structure repaired and reinforced using a textile grid reinforcement and a highly durable inorganic binder according to an embodiment of the present invention; FIG. 14 is a view illustrating results of evaluating chemical resistant performance with respect to the concrete structure repaired and reinforced using a textile grid reinforcement and a highly durable inorganic binder according to an embodiment of the present invention; FIG. 15 is a process flow chart illustrating a method of repairing and reinforcing a concrete structure using a textile grid reinforcement and a highly durable inorganic binder according to an embodiment of the present invention; FIG. 16 is a view specifically illustrating the method of repairing and reinforcing a concrete structure using a textile grid reinforcement and a highly durable inorganic binder according to an embodiment of the present invention; FIG. 17 is a process flow chart illustrating a method of repairing and reinforcing a concrete structure using a textile grid reinforcement and a highly durable inorganic binder according to another embodiment of the present invention; and FIG. 18 is a view illustrating a fracture test of a concrete slab that is a concrete structure repaired and reinforced by the method of repairing and reinforcing a concrete structure using a textile grid reinforcement and a highly durable inorganic binder according to an embodiment of the present invention.",False,0.7472517490386963,0.6372799068313119,27,746,-719,117,4786,-4669
아래에서는 첨부한 도면을 참조하여 본 발명이 속하는 기술분야에서 통상의 지식을 가진 자가 용이하게 실시할 수 있도록 본 발명의 실시예를 상세히 설명한다.,"Hereinafter, embodiments of the present invention will be described in detail with reference to the accompanying drawings so as to be easily carried out by those having ordinary skill in the art to which the present invention pertains.",True,0.1438857167959213,0.9042466075784154,21,38,-17,85,235,-150
그러나 본 발명은 여러 가지 상이한 형태로 구현될 수 있으며 여기에서 설명하는 실시예에 한정되지 않는다.,"The present invention may, however, be embodied in various forms, and should not be construed as being limited to the embodiments set forth herein.",True,0.1345433741807937,0.9029598144982912,15,24,-9,58,147,-89
"그리고 도면에서 본 발명을 명확하게 설명하기 위해서 설명과 관계없는 부분은 생략하였으며, 명세서 전체를 통하여 유사한 부분에 대해서는 유사한 도면 부호를 붙였다.","To clearly describe the present invention in the drawings, portions irrelevant to the description are omitted, and similar portions throughout the specification are given similar reference signs.",True,0.1355122476816177,0.9054060394637996,21,27,-6,90,195,-105
"명세서 전체에서, 어떤 부분이 어떤 구성요소를 ""포함""한다고 할 때, 이는 특별히 반대되는 기재가 없는 한 다른 구성요소를 제외하는 것이 아니라 다른 구성요소를 더 포함할 수 있는 것을 의미한다.","When any portion ""includes"" and/or ""has"" any constituent element throughout the specification, this means that, unless otherwise mentioned, any portion does not preclude another constituent element but can further include another constituent element.",True,0.2008305191993713,0.8677839107452242,28,33,-5,109,250,-141
[텍스타일 그리드 보강재와 고내구성 무기계 결합재를 이용하여 보수보강하는 콘크리트 구조물(100)],[Concrete structure 100 repaired and reinforced using textile grid reinforcement and highly durable inorganic binder],True,0.187551811337471,0.8851187308841149,10,15,-5,55,117,-62
"도 4는 본 발명의 실시예에 따른 텍스타일 그리드 보강재와 고내구성 무기계 결합재를 이용하여 보수보강하는 콘크리트 구조물을 개략적으로 나타내는 도면이고, 도 5는 본 발명의 실시예에 따른 텍스타일 그리드 보강재와 고내구성 무기계 결합재를 이용하여 보수보강하는 콘크리트 구조물을 예시하는 도면으로서, 도 5의 a)는 텍스타일 그리드 보강재에 의해 보강된 하수박스를 나타내며, 도 5의 b)는 텍스타일 그리드 보강재에 의해 보강된 콘크리트 벽체를 나타낸다.","FIG. 4 is a view schematically illustrating a concrete structure repaired and reinforced using a textile grid reinforcement and a highly durable inorganic binder according to an embodiment of the present invention, and FIG. 5 is a view illustrating the concrete structure repaired and reinforced using a textile grid reinforcement and a highly durable inorganic binder according to an embodiment of the present invention, wherein FIG. 5A illustrates a waste water box reinforced by the textile grid reinforcement, and FIG. 5B illustrates a concrete wall reinforced by the textile grid reinforcement.",True,0.2105887234210968,0.8987765534240368,58,91,-33,253,599,-346
"도 4를 참조하면, 본 발명의 실시예에 따른 텍스타일 그리드 보강재와 고내구성 무기계 결합재를 이용하여 보수보강하는 콘크리트 구조물(100)은, 노후 콘크리트 구조물(110), 텍스타일 그리드 보강재(120) 및 고내구성 무기계 결합재(130)를 포함하며, 또한, 후술하는 도 10에 도시된 바와 같이, 그리드 고정장치(140)를 포함한다.","Referring to FIG. 4, a concrete structure 100 repaired and reinforced using a textile grid reinforcement and a highly durable inorganic binder according to an embodiment of the present invention includes an old concrete structure 110, a textile grid reinforcement 120, and a highly durable inorganic binder 130, and further includes a grid fixing unit 140 as illustrated in FIG. 10 to be described below.",False,0.1659754365682602,0.9287359190355516,38,65,-27,190,404,-214
"노후 콘크리트 구조물(110)은 열화 부위를 미리 제거한 콘크리트 구조물로서, 상기 노후 콘크리트 구조물(110) 내에 매립된 철근이 부식된 경우 철근 깊이까지 열화 단면을 제거하고, 필요시 추가 철근을 배근하는 것이 바람직하다.","In the case where any reinforcing bar embedded in the old concrete structure 110 is corroded, it is preferable to remove a degraded section up to a depth of the reinforcing bar and to arrange an additional reinforcing bar if necessary.",True,0.275737464427948,0.845260325293796,29,41,-12,128,235,-107
"텍스타일 그리드 보강재(120)는 상기 노후 콘크리트 구조물(110)의 보수보강을 위해 상기 노후 콘크리트 구조물(110)의 표면에 부착되며, 이후 고내구성 무기계 결합재(130)와의 부착력을 향상시키도록 코팅재로 코팅된다.","The textile grid reinforcement 120 is adhered to a surface of the old concrete structure 110 in order to repair and reinforce the old concrete structure 110, and then is coated with a coating material in order to improve adhesiveness with the highly durable inorganic binder 130.",True,0.1614694893360138,0.9269417751734962,23,47,-24,125,279,-154
"여기서, 상기 텍스타일 그리드 보강재(120)에 코팅되는 코팅재는 샌드페이퍼 마모재로 사용되는 산화알루미나(Al2O3) 분말이고, 상기 코팅재의 입도는 상기 텍스타일 그리드 보강재(120)의 종류와 규격에 따라 결정될 수 있다.","Here, the coating material with which the textile grid reinforcement 120 is coated is an alumina (Al2O3) powder used as a sandpaper abrasive material, and a particle size of the coating material may be determined according to the type and specifications of the textile grid reinforcement 120.",True,0.195559486746788,0.9014668196341936,25,47,-22,127,292,-165
"고내구성 무기계 결합재(130)는 무기계 결합재로서, 상기 노후 콘크리트 구조물(110)의 사용환경과 보수보강 목적에 따라 염해저항성능 또는 화학저항성능을 갖도록 배합되며, 상기 텍스타일 그리드 보강재(120)를 상기 노후 콘크리트 구조물(110)에 부착시킨다.","The highly durable inorganic binder 130 is an inorganic binder, is mixed to have chloride penetration resistance performance or chemical resistance performance according to a use environment of the old concrete structure 110 and repair and reinforcement purposes, and adheres the textile grid reinforcement 120 to the old concrete structure 110.",True,0.1904554218053817,0.9049939905322848,27,51,-24,146,345,-199
"그리드 고정장치(140)는, 후술하는 도 10에 도시된 바와 같이, 상기 텍스타일 그리드 보강재(120)를 고정시키는 역할을 하며, 상기 텍스타일 그리드 보강재(120)를 상기 노후 콘크리트 구조물(110) 상에 거치시, 상기 텍스타일 그리드 보강재(120)가 소정간격을 유지하도록 배치된다.","As illustrated in FIG. 10 to be described below, the grid fixing unit 140 functions to fix the textile grid reinforcement 120, and is disposed such that the textile grid reinforcement 120 maintains a predetermined interval when the textile grid reinforcement 120 is placed on the old concrete structure 110.",True,0.2017245292663574,0.9049257845086192,32,50,-18,163,307,-144
"이때, 상기 텍스타일 그리드 보강재(120)의 거치시 상기 그리드 고정장치(140)의 앵커핀(141)이 상기 노후 콘크리트 구조물(110)에 타입된다.","In this case, when the textile grid reinforcement 120 is placed, an anchor pin 141 of the grid fixing unit 140 is driven into the old concrete structure 110.",True,0.1797283738851547,0.9076579231772516,15,29,-14,84,157,-73
"구체적으로, 상기 그리드 고정장치(140)는, 후술하는 도 10에 도시된 바와 같이, 상기 노후 콘크리트 구조물(110)에 타입되는 몸체로서 ㄷ자 형상의 앵커핀(141); 및 상기 앵커핀(141)의 타입시 상기 텍스타일 그리드 보강재(120)를 타입 충격으로부터 보호하도록 상기 앵커핀 상단에 구비되는 타입충격 완충재(142)를 포함하며, 상기 그리드 고정장치(140)는 상기 텍스타일 그리드 보강재(120)의 거치시 그리드 위사 및 경사 교차지점을 상부를 관통하여 상기 노후 콘크리트 구조물(110)에 타입 고정된다.","Specifically, as illustrated in FIG. 10 to be described below, the grid fixing unit 140 includes a U-shaped anchor pin 141 as a body driven into the old concrete structure 110, and a driving impact buffer 142 that is provided at an upper end of the anchor pin so as to protect the textile grid reinforcement 120 from a driving impact when the anchor pin 141 is driven.",False,0.2746106386184692,0.8697781692874833,58,68,-10,290,368,-78
"이때, 상기 그리드 고정장치(140)를 화약식 또는 에어타카로 상기 노후 콘크리트 구조물(110)에 타입시켜 상기 텍스타일 그리드 보강재(120)를 견고하게 상기 노후 콘크리트 구조물(110)에 고정시킬 수 있다.","In this case, the grid fixing unit 140 is driven into the old concrete structure 110 by an explosive or pneumatic tacker, and enables the textile grid reinforcement 120 to be firmly fixed to the old concrete structure 110.",True,0.2055315673351287,0.9034649193284388,24,39,-15,119,222,-103
"본 발명의 실시예에 따른 텍스타일 그리드 보강재와 고내구성 무기계 결합재를 이용하여 보수보강하는 콘크리트 구조물(100)에서, 상기 고내구성 무기계 결합재(130)는 염해저항성능을 갖는 염해 저항성 무기계 결합재이거나 화학저항성능을 갖는 화학적 저항성 무기계 결합재인 것이 바람직하다.","In the concrete structure 100 repaired and reinforced using a textile grid reinforcement and a highly durable inorganic binder according to an embodiment of the present invention, the highly durable inorganic binder 130 is preferably a chloride penetration resistant inorganic binder having chloride penetration resistance performance or a chemical resistant inorganic binder having chemical resistance performance.",True,0.215831309556961,0.9033108331873116,32,56,-24,159,415,-256
"구체적으로, 상기 염해 저항성 무기계 결합재는, 100중량부의 시멘트, 100중량부의 염해 저항성 결합재, 210~250중량부의 잔골재, 55~65중량부의 배합수 및 1.5~3중량부의 고성능 감수제를 혼합하여 형성되며, 이때, 상기 염해 저항성 결합재는 90~95중량%의 고로슬래그 미분말과 5~10중량%의 염분흡착제를 혼합하여 형성되며, 상기 염분흡착제는 탄산칼슘인 것이 바람직하다.","Specifically, the chloride penetration resistant inorganic binder is obtained by mixing 100 parts of weight of cement, 100 parts of weight of a chloride penetration resistant binder, 210 to 250 parts of weight of fine aggregate, 55 to 65 parts of weight of mixing water, and 1.5 to 3 parts of weight of a high-performance water reducing admixture.",False,0.3102067410945892,0.8340642914421911,39,58,-19,215,347,-132
"또한, 상기 화학적 저항성 무기계 결합재는 무시멘트계 결합재로서, 100중량부의 고로슬래그 미분말, 35~45중량부의 플라이애시, 165~180중량부의 잔골재, 55~65중량부의 배합수 및 8~20중량부의 알칼리 자극제(또는 알칼리 활성화제)를 혼합하여 형성될 수 있다.","Further, the chemical resistant inorganic binder is a cement-free binder, and may be obtained by mixing 100 parts of weight of a fine blast furnace slag powder, 35 to 45 parts of weight of fly ash, 165 to 180 parts of weight of fine aggregate, 55 to 65 parts of weight of mixing water, and 8 to 20 parts of weight of an alkali accelerator (or an alkali activator).",True,0.2169682532548904,0.873644480859451,27,69,-42,151,364,-213
"또한, 본 발명의 실시예에 따른 텍스타일 그리드 보강재와 고내구성 무기계 결합재를 이용하여 보수보강하는 콘크리트 구조물(100)은, 도로 및 철도시설물인 교량, 터널, 지하철은 물론 댐, 항만구조물, 오폐수시설물 등일 수 있지만, 이에 국한되는 것은 아니다.","Further, the concrete structure 100 repaired and reinforced using a textile grid reinforcement and a highly durable inorganic binder according to an embodiment of the present invention may be a dam, a harbor structure, a waste water facility, etc. as well as a bridge, a tunnel, a subway, etc. that are road and railroad facilities, but is not limited thereto.",False,0.2010158896446228,0.90076885829055,32,60,-28,144,360,-216
"한편, 도 6a 내지 도 6c는 텍스타일 그리드 보강재를 구체적으로 설명하기 위한 도면으로서, 도 6a는 텍스타일 그리드 보강재를 나타내고, 도 6b는 직조(Weaving) 방법으로 생산된 텍스타일 그리드 보강재를 나타내는 도면이고, 6c는 편직(Knitting) 방법으로 생산된 텍스타일 그리드 보강재를 나타내는 도면이다.","Meanwhile, FIGS. 6A to 6C are views concretely illustrating a textile grid reinforcement, wherein FIG. 6A illustrates a textile grid reinforcement, FIG. 6B is a view illustrating a textile grid reinforcement produced by a weaving method, and FIG. 6C is a view illustrating a textile grid reinforcement produced by a knitting method.",True,0.1523663252592086,0.9160364320627234,38,52,-14,181,332,-151
"텍스타일 그리드 보강재(120)는 탄소섬유, 아라미드섬유 등 고강도 섬유를 이용하여 격자형태의 직물로 직조(Weaving)하거나 편직(Knitting)함으로써, 텍스타일 그리드를 제작한 후 에폭시, 폴리에스테르, 아크릴레이트, SBR 수지 등으로 함침시켜 텍스타일 그리드를 제작한다.","The textile grid reinforcement 120 is manufactured by manufacturing a textile grid in which a grid type textile is woven or knitted using a high-strength fiber such as a carbon fiber, an aramid fiber, or the like, and impregnating the textile grid with epoxy, polyester, acrylate, an SBR resin, or the like.",True,0.2112242579460144,0.889917697017297,27,52,-25,158,307,-149
"도 6a에 도시한 바와 같이, 텍스타일 그리드 보강재(120)는 최근 탄소섬유, 아라미드섬유 등 고강도 섬유를 이용하여 격자형태의 직물로 제직하거나 편직함으로써 텍스타일 그리드를 제작한 후, 에폭시, 비닐에스테르, SBR 수지 등으로 함침시켜 텍스타일 그리드 보강재(120)를 제조하고 있다.","As illustrated in FIG. 6A, recently, the textile grid reinforcement 120 has been manufactured by manufacturing a textile grid in which a grid type textile is woven or knitted using a high-strength fiber such as a carbon fiber, an aramid fiber, or the like, and impregnating the textile grid with epoxy, vinyl ester, an SBR resin, or the like.",True,0.1636224836111068,0.9205742550725616,34,59,-25,163,342,-179
"도 6b에 도시한 바와 같이, 텍스타일 그리드 보강재(120)는 위사(Weft: 120a)와 경사(Warp: 120b)로 구성되는데, 위사(120a)와 경사(120b) 각각은 섬유다발(121)과 수지(122)가 함침되어 있지만, 완성된 텍스타일 그리드 보강재(120)는 롤(Roll) 형태로 권취할 수 있을 정도로 연성을 갖는다.","As illustrated in FIG. 6B, the textile grid reinforcement 120 consists of a weft 120a and a warp 120b.",False,0.3309349715709668,0.8248105462571852,32,19,13,184,102,82
이러한 제직방법으로 생산되는 텍스타일 그리드 보강재(120)는 경사(120b)를 꼬아서 직조하기 때문에 주방향인 직선으로 배치되는 위사(120a)의 위사방향에 비하여 경사 방향의 연신율이 크다는 특징이 있다.,"The textile grid reinforcement 120 produced by this weaving method has a characteristic that, because the warp 120b is woven by twisting, an elongation in a warp direction is greater than that in a weft direction of the weft 120a disposed in a straight line that is a main direction.",True,0.3218191266059875,0.8095312503007259,22,50,-28,116,283,-167
"또한, 도 6c에 도시된 바와 같이, 상기 텍스타일 그리드 보강재(120)는 위사(120a)와 경사(120b)를 직각으로 겹쳐두고 일반적으로 폴리에스터로 제작된 바인더 얀(Binder Yarn)(120c)을 경사방향으로 바느질하여 제작하는 경우도 있는데, 이를 편직 방법이라 한다.","Further, as illustrated in FIG. 6C, the textile grid reinforcement 120 may be manufactured by sewing a binder yarn 120c, which is generally made of polyester, in a warp direction with the weft 120a and the warp 120b overlapping at a right angle to each other, which refers to a knitting method.",True,0.168673574924469,0.9102090667444896,29,52,-23,157,294,-137
이러한 편직 방법은 직조 방법에 비하여 텍스타일 그리드 제작속도가 빠르다는 장점이 있다.,This knitting method has an advantage that a textile grid manufacturing speed is faster than that of the weaving method.,True,0.2446450740098953,0.8203627113432926,12,20,-8,49,120,-71
"한편, 사용하는 고강도 섬유에 따라 약간의 차이는 있으나 탄소섬유로 제작된 텍스타일 그리드는 철근에 비하여 콘크리트와의 부착강도가 1/3 수준으로 작기 때문에 텍스타일 그리드로 보강된 콘크리트 구조물이 부착강도 이상의 하중(응력)을 받는 경우, 텍스타일 그리드가 매트릭스(고결된 결합재) 내부에서 부분적으로 미끄러지는 슬립이 발생할 우려가 있다.","However, since the textile grid made of a carbon fiber has weak adhesive strength with concrete, which is a one-third level of the reinforcing bar, in the case where the concrete structure reinforced with the textile grid is subjected to a load (stress) above the adhesive strength, there is a risk of slipping in which the textile grid partly slips inside a matrix (a solidified binder).",False,0.358471542596817,0.8139804916587703,41,66,-25,193,388,-195
"이에 따라, 매트릭스와 그리드간 부착력을 상실하게 되는 경우, 일체화 작용을 할 수 없어 합성작용(Composite Action)에 의한 보강효과가 발생하지 않을 수 있다.","Accordingly, in the case where adhesiveness between the matrix and the grid is lost, an integration action is of little use, and so a reinforcing effect caused by a composite action may not occur.",True,0.2330570071935653,0.8475814257895087,21,34,-13,96,196,-100
"이에 따라, 본 발명의 실시예에 따른 텍스타일 그리드 보강재와 고내구성 무기계 결합재를 이용하여 보수보강하는 콘크리트 구조물(100)의 경우, 텍스타일 그리드의 부착강도를 향상시키기 위하여 텍스타일 그리드 표면을 마모재로 코팅한다.","Accordingly, in the case of the concrete structure 100 repaired and reinforced using a textile grid reinforcement and a highly durable inorganic binder according to an embodiment of the present invention, the surface of the textile grid is coated with a abrasive material to improve the adhesive strength of the textile grid.",True,0.23006372153759,0.90193903564625,27,52,-25,129,325,-196
"도 7은 본 발명의 실시예에 따른 텍스타일 그리드 보강재와 고내구성 무기계 결합재를 이용하여 보수보강하는 콘크리트 구조물에서 텍스타일 그리드 보강재에 코팅되는 코팅재인 산화알루미나 분말의 입도 종류를 예시하는 도면이고, 도 8은 본 발명의 실시예에 따른 텍스타일 그리드 보강재와 고내구성 무기계 결합재를 이용하여 보수보강하는 콘크리트 구조물에서 텍스타일 그리드 보강재에 대한 직접인발강도 시험을 설명하기 위한 도면이며, 도 9는 본 발명의 실시예에 따른 텍스타일 그리드 보강재와 고내구성 무기계 결합재를 이용하여 보수보강하는 콘크리트 구조물에서 무코팅 텍스타일 그리드 보강재와 코팅 텍스타일 그리드 보강재를 나타내는 도면이다.",FIG. 7 is a view illustrating types of particle sizes of an alumina powder that is a coating material with which a textile grid reinforcement is coated in the concrete structure repaired and reinforced using a textile grid reinforcement and a highly durable inorganic binder according to an embodiment of the present invention.,False,0.4382703602313995,0.7887137464002172,78,53,25,350,327,23
"도 7에 도시된 바와 같이, 코팅재는 샌드페이퍼 마모재로 사용되는 산화알루미나(Al2O3) 분말을 적용하며, 상기 코팅재의 입도는 그리드의 종류와 규격에 따라 결정될 수 있다.","As illustrated in FIG. 7, an alumina (Al2O3) powder used as a sandpaper abrasive material may be applied as the coating material, a particle size of the coating material may be determined according to the types and specifications of grid.",True,0.178360104560852,0.8961653135158255,22,40,-18,98,238,-140
"예를 들면, 작은 입도의 마모재는 얀(Yarn)의 굵기가 작은 텍스타일 그리드를 코팅하는데 유리하고, 굵은 입도의 마모재는 얀(Yarn)의 굵기가 큰 텍스타일 그리드를 코팅하는데 유리하다.","For example, a small particle sized abrasive material is advantageous for coating a textile grid having small diameter yarn, and a large particle sized abrasive material is advantageous for coating a textile grid having large diameter yarn.",True,0.1736354380846023,0.9023412272578356,22,37,-15,105,240,-135
"또한, 도 8에 도시된 바와 같이, 그리드 비닐에스테르 수지를 도포한 후, 마모재를 흡착시켜 경화시킨 후, 몰탈 블록에 매립시키고, 상기 몰탈이 양생된 후, 직접인발 부착강도시험을 실시하였다.","Further, as illustrated in FIG. 8, after a grid vinyl ester resin is applied and then an abrasive material is adsorbed and hardened, the grid is embedded in a mortar block.",False,0.3504413664340973,0.7967729956988546,25,31,-6,107,172,-65
"구체적으로, 도 7에 도시된 바와 같이, 총 4가지 입도를 갖는 산화알루미나 분말로 그리드를 코팅한 후, 직접인발 부착강도 측정한 결과를 표 1에 나타내었다.","Specifically, as illustrated in FIG. 7, after a grid is coated with an alumina powder having a total of four particle sizes, direct pull-out adhesive strength was measured and results thereof are shown in Table 1.",True,0.2051292806863784,0.8671554107302446,22,36,-14,88,213,-125
표 1에 나타낸 결과에 따르면 마모재 코팅 이후의 그리드의 부착강도는 코팅 이전에 비하여 그리드의 부착강도가 약 2배 증가하였다.,"According to the results shown in Table 1, the adhesive strength of the grid after coating of the abrasive material is increased two-fold compared to that before coating of the abrasive material.",True,0.2002984285354614,0.8760939449160605,18,32,-14,72,195,-123
"본 발명의 실시예에서, 텍스타일 그리드의 부착강도를 증가시키기 위하여 #24호 산화알루미나 분말로 텍스타일 그리드를 코팅한 사례를 도 9에 도시하였다.","In the embodiment of the present invention, a case in which a textile grid is coated with a #24 alumina powder to increase the adhesive strength of the textile grid is illustrated in FIG. 9.",True,0.1971583217382431,0.8920601541022279,18,35,-17,84,190,-106
"또한, 표 1은 코팅 마모재 입도별 그리드 부착강도시험 결과를 나타내며, #80호 산화알루미나 분말로 텍스타일 그리드를 코팅한 경우, 부착강도 증가비율이 가장 큰 것으로 나타냈다.","Further, Table 1 shows the results of the grid adhesive strength test for each particle size of the coated abrasive material.",True,0.483221024274826,0.7139710580856892,23,21,2,100,125,-25
[표 1],"In the case where the textile grid is coated with a #80 alumina powder, the adhesive strength shows the largest rate of increase.[Table 1]",False,0.7921730875968933,0.4316403679534041,2,24,-22,5,138,-133
"한편, 종래의 기술에 따른 텍스타일 보강 콘크리트(TRC)를 시공하는 경우 콘크리트 구조물 벽체 또는 슬래브 하면에 텍스타일 그리드를 거치할 때 고정할 수 있는 적절한 방법이 없기 때문에 시공중 텍스타일 그리드가 탈락하는 등 시공이 곤란하였다.","Meanwhile, in the case of constructing textile reinforced concrete (TRC) according to the related art, because there is no proper method capable of fixing a textile grid when the textile grid is placed on a concrete wall or a lower surface of a slab, construction is difficult, for instance, the textile grid falls off during construction.",True,0.2472200691699981,0.8682026632783311,33,56,-23,136,339,-203
"이러한 문제점을 해결하도록, 본 발명의 실시예에 따른 텍스타일 그리드 보강재와 고내구성 무기계 결합재를 이용하여 보수보강하는 콘크리트 구조물의 경우, 그리드 고정장치(140)를 사용한다.","To solve this problem, in the case of the concrete structure repaired and reinforced using a textile grid reinforcement and a highly durable inorganic binder according to an embodiment of the present invention, the grid fixing unit 140 is used.",True,0.2376723140478134,0.8843992671282161,21,40,-19,104,244,-140
"도 10은 본 발명의 실시예에 따른 텍스타일 그리드 보강재와 고내구성 무기계 결합재를 이용하여 보수보강하는 콘크리트 구조물에서 그리드 고정장치를 구체적으로 설명하기 위한 도면으로서, 도 10의 a)는 그리드 고정장치(140)가 텍스타일 그리드 보강재의 위사와 경사가 만나는 교차점 상단에 고정된 것을 나타내며, 도 10의 b)는 그리드 고정장치(140)의 구성과 형상을 나타낸다.","FIG. 10 is a view specifically illustrating a grid fixing unit in the concrete structure repaired and reinforced using a textile grid reinforcement and a highly durable inorganic binder according to an embodiment of the present invention, wherein FIG. 10A illustrates that the grid fixing unit 140 is fixed to an upper end of an intersection at which the weft and warp of the textile grid reinforcement meet each other, and FIG. 10B illustrates a configuration and shape of the grid fixing unit 140.",True,0.2267919778823852,0.896119745606956,46,84,-38,212,499,-287
"이때, 상기 그리드 고정장치(140)는 텍스타일 그리드 보강재(120)를 고정한 후, 노후 콘크리트 구조물(110)에 타입되는 몸체인 앵커핀(141)과 상기 앵커핀(141) 타입시 텍스타일 그리드 보강재(120)를 타입충격으로부터 보호하는 플라스틱 또는 폴리프로필렌 재질의 타입충격 완충재(142)로 구성된다.","In this case, the grid fixing unit 140 is made up of an anchor pin 141 that is a body driven into the old concrete structure 110 after the textile grid reinforcement 120 is fixed, and a driving impact buffer 142 that is made of a plastic or polypropylene and protects the textile grid reinforcement 120 from a driving impact when the anchor pin 141 is driven.",True,0.2480238080024719,0.8806294432345956,30,67,-37,173,359,-186
도 10의 c)는 타입충격 완충재(142)를 상기 앵커핀(141)이 관통한 상태를 나타낸다.,FIG. 10C illustrates a state in which the anchor pin 141 passes through the driving impact buffer 142.,True,0.2832159101963043,0.8085289240437824,10,18,-8,51,102,-51
"이때, 상기 앵커핀(141)의 길이는 몰탈층의 두께에 따라 결정되며 타입충격 완충재(142)의 길이는 상기 앵커핀(141) 폭보다 크고, 두께는 2㎜ 내외인 것이 바람직하다.","In this case, it is preferable that a length of the anchor pin 141 is determined according to a thickness of a mortar layer, and a length of the driving impact buffer 142 is larger than a width of the anchor pin 141 and has a thickness of about 2 mm.",True,0.1595565229654312,0.909798553618484,20,51,-31,97,250,-153
"구체적으로, 상기 앵커핀(141)은 스테인리스 스틸 등 고강도 비부식 금속재질로 형성되며, 상기 노후 콘크리트 구조물(110)에 타입되는 부분은 뾰쪽하게 제작되어 상기 노후 콘크리트 구조물(110)에 용이하게 타입되도록 한다.","Specifically, the anchor pin 141 is formed of a high-strength corrosion resistant metal material such as stainless steel, and a portion thereof driven into the old concrete structure 110 is made sharp so as to be easily driven into the old concrete structure 110.",True,0.1926390826702118,0.900321848932939,25,44,-19,126,263,-137
"에를 들면, 상기 텍스타일 그리드 보강재(120)의 거치시, 상기 그리드 고정장치(140)는 20㎝~30㎝의 수평 및 수직 간격으로 설치되어 상기 텍스타일 그리드 보강재(120)를 상기 노후 콘크리트 구조물(110) 표면에 견고하게 고정시킬 수 있다.","For example, when the textile grid reinforcement 120 is placed, the grid fixing unit 140 is installed at horizontal and vertical intervals of 20 cm to 30 cm, and thus textile grid reinforcement 120 can be firmly fixed to a surface of the old concrete structure 110.",True,0.1396981626749038,0.9339623434461868,29,47,-18,140,265,-125
"한편, 종래의 기술에 따른 텍스타일 보강 콘크리트(TRC) 시공시, 일반 시멘트 몰탈 또는 콘크리트를 사용하고 있었다.","Meanwhile, in the case of constructing the TRC according to the related art, typical cement mortar or concrete is used.",True,0.2495999038219452,0.8413945021720114,15,20,-5,66,119,-53
"이때, 텍스타일 보강 콘크리트(TRC)는 20㎜ 두께로 얇게 시공될 수 있는 장점에도 불구하고, 몰탈의 내구성이 낮아 필요 이상으로 두껍게 시공해야 하며, 이에 따라, 보강 이후 사용공간이 감소되거나 재료비 및 시공비 증가로 경제성이 낮은 단점이 있었다.","In this case, despite an advantage that the TRC can be constructed at a thin thickness of 20 mm, the TRC should be constructed to be thicker than necessary due to low durability of the mortar, and thus there is a disadvantage that economical efficiency is low because material costs and construction costs are increased or a usage space after the reinforcement is reduced.",True,0.1776156276464462,0.8986531186800263,34,64,-30,142,372,-230
"이하, 본 발명의 실시예에 따른 텍스타일 그리드 보강재와 고내구성 무기계 결합재를 이용하여 보수보강하는 콘크리트 구조물에서 고내구성 무기계 결합재에 대해 상세히 설명하도록 한다.","Hereinafter, the highly durable inorganic binder in the case of the concrete structure repaired and reinforced using a textile grid reinforcement and a highly durable inorganic binder according to an embodiment of the present invention will be described in detail.",True,0.2104691267013549,0.8955491283028557,22,40,-18,99,264,-165
"[계속해서, 제어부(4)는 자기 유닛에서의 응축 압력(가스관 내부 압력)이 상한 압력(α) 이하인지 아닌지를 판정한다(스텝 S203). 응축 압력이 상한 압력(α)보다 큰 경우(스텝 S203－NO), 제어부(4)는 압축기(23)의 운전 주파수를 저하시켜서(스텝 S204), 스텝 S203으로 처리를 되돌린다.","Here, while the condensation pressure is greater than the upper limit pressure a, the condensation pressure is adjusted to be equal to or lower than the upper limit pressure a by repeatedly executing step S204.",False,0.5783895254135132,0.6790083976835023,31,35,-4,172,210,-38
"여기서, 응축 압력이 상한 압력(α)보다 큰 동안에는 스텝 S204가 반복해서 실행하도록 함으로써 응축 압력이 상한 압력(α) 이하로 조정된다.]","[0031] On the other hand, when the condensation pressure is equal to or lower than the upper limit pressure a (step S203-YES), the control unit 4 determines whether the defrosting operation end notification has been sent from the defrosting unit (step SO5).",False,0.6531341671943665,0.6377910038603517,18,42,-24,81,257,-176
"[한편, 응축 압력이 상한 압력(α) 이하인 경우(스텝 S203－YES), 제어부(4)는 제상 유닛으로부터 제상 운전 종료 통지가 통지되었는지 여부를 판정한다(스텝 S05). 제상 운전 종료 통지는 통지되어 있지 않다고 판정한 경우(스텝 S205－NO), 제어부(4)는 제상 운전 종료 통지가 통지될 때까지 스텝 S205를 반복하여 실행한다.","If it is determined that the defrosting operation end notification has not been sent (step S205-NO), the control unit 4 repeatedly executes step S205 until the defrosting operation end notification is sent.",False,0.3058384656906128,0.8164885665508329,40,32,8,191,206,-15
"한편, 제상 운전 종료 통지가 통지되었다고 판정한 경우(스텝 S205－YES), 제어부(4)는 응축 압력 제어 처리를 종료한다.]","On the other hand, when it is determined that the defrosting operation end notification has been sent (step S205-YES), the control unit 4 ends the condensation pressure control process.",True,0.1516283899545669,0.911068558538372,15,29,-14,72,185,-113
"[이와 같이 구성된 제1 실시형태에서의 공기 조화 장치(1)는 복수의 실외 유닛(2)과 1개 이상의 실내 유닛(3)을 갖추고, 어느 하나의 실외 유닛이 제상 운전중인 경우, 그 때 난방 운전중인 실외 유닛의 응축 압력 또는 제상 운전중인 실외 유닛의 흡입 압력을 상한 압력(난방 운전시의 정격 최고 압력의 1/1.5배) 이하로 제어하는 제어부를 갖춘다.","13 [0032] The air conditioner 1 according to the first embodiment configured as described above includes a plurality of outdoor units 2 and one or more indoor units 3, and includes a control unit that controls the condensation pressure of the outdoor unit in the heating operation or the suction pressure of the outdoor unit in the defrosting operation to be equal to or smaller than the upper limit pressure (1/1.5 times the rated maximum pressure during the heating operation) when any of the outdoor units is in the defrosting operation.",True,0.1978152096271515,0.9152566758701824,49,91,-42,197,540,-343
"이에 따라, 공기 조화 장치(1)는 제상 운전시의 가스관 내의 압력을 통상의 난방 운전시보다 낮게 할 수 있기 때문에, 제상 운전에 의해서 압축기에 과도한 부하가 걸리는 것을 억제하는 것이 가능해진다.]","In this way, since the air conditioner 1 can reduce the pressure in the gas pipe during the defrosting operation to be lower than that during the normal heating operation, it is possible to inhibit application of an excessive load to the compressor due to the defrosting operation.",True,0.3166321814060211,0.837461408811526,29,48,-19,113,281,-168
"[도 4의 응축 압력 제어 처리에 있어서, 응축 압력이 상한 압력(α) 이하인 상태로부터 상한 압력(α)보다 커질 가능성이 상정되는 경우, 제어부(4)는 스텝 S205－NO에서 스텝 S203으로 처리를 되돌리도록 구성되어도 좋다.]","[0033] <Modification example> In the condensation pressure control process of FIG. 4, when it is expected that the condensation pressure will be greater than the upper limit pressure a from the state where the condensation pressure is equal to or smaller than the upper limit pressure a, the control unit 4 may return the process to step S203 in step S205-NO.",True,0.2348469495773315,0.8776700651523169,28,61,-33,129,359,-230
"[난방 유닛의 제어부(4)는 어느 하나의 실내 유닛(3)의 실내 송풍기(33)가 운전중인 경우, 자기 유닛의 응축 압력을 포화 온도가 30℃ 이상인 압력으로 제어하도록 구성되어도 좋다.",[0034] The control unit 4 of the heating unit may be configured to control the condensation pressure of the subject unit to be a pressure at which the saturation temperature becomes 30°C or higher when an indoor blower 33 of any of the indoor units 3 is in operation.,True,0.2166476547718048,0.90178914703683,23,49,-26,103,267,-164
"이러한 구성에 의하면, 공기 조화 장치(1)는 어느 하나의 실외 유닛(2)이 제상 운전중인 경우라도 실내에 냉기가 아닌 난기를 공급하는 것이 가능해진다.]","According to such a configuration, the air conditioner 1 can supply warm air instead of cold air to the room even when any of the outdoor units 2 is in the defrostingoperation.",True,0.2743165194988251,0.8667949232817611,20,32,-12,86,176,-90
"[난방 유닛의 제어부(4)는 어떤 실내 유닛(3)에서도 실내 송풍기(33)가 정지중인 경우, 자기 유닛의 응축 압력을 포화 온도가 30℃ 미만인 압력으로 제어하도록 구성되어도 좋다.",[0035] 14 The control unit 4 of the heating unit may be configured to control the condensation pressure of the subject unit to be a pressure at which the saturation temperature is smaller than 30°C when the indoor blower 33 in any of the indoor units 3 is stopped.,True,0.2245371490716934,0.896736955814358,22,49,-27,101,264,-163
"이러한 구성에 의하면, 공기 조화 장치(1)는 실내로의 난기 공급을 억제하여 압축기(23)에 공급하는 냉매를 저압화 할 수 있다.","According to such a configuration, the air conditioner 1 can reduce the pressure of the refrigerant supplied to the compressor 23 by suppressing the supply of warm air to the room.",True,0.2446022480726242,0.8778498487318009,17,31,-14,72,180,-108
"그렇기 때문에, 제상 운전시에 난방 유닛의 압축기(23)가 고장나버리는 리스크를 저감할 수 있다.]","Therefore, it is possible to reduce the risk that the compressor 23 of the heating unit will break down during the defrosting operation.",True,0.2989505529403686,0.8179943992011793,12,23,-11,55,136,-81
[난방 유닛의 제어부(4)는 제상 유닛이 제상 운전을 실시할 때는 자기 유닛의 실외 팽창밸브(24)의 개도를 통상의 난방 운전을 실시할 때의 개도보다 작게 하도록 구성되어도 좋다.,"[0036] When the defrosting unit is performing the defrosting operation, the control unit 4 of the heating unit may be configured to make the opening degree of the outdoor expansion valve 24 of the subject unit smaller than the opening degree when the defrosting unit is performing the normal heating operation.",True,0.3189305961132049,0.8505789634370386,24,51,-27,100,310,-210
"여기서의 통상의 난방 운전이란, 제상 운전중인 실외 유닛(2)이 존재하지 않는 경우의 난방 운전을 의미한다.",The normal heating operation here means a heating operation when the outdoor unit 2 in the defrosting operation is not present.,True,0.3066386282444,0.8252774499395223,14,21,-7,60,127,-67
"일반적으로, 난방 유닛에는 제상 유닛으로부터 냉각된 액냉매가 유입하기 때문에, 실외 팽창밸브(24)의 개도를 통상의 난방 운전시와 같은 개도로 하여 난방 운전을 실시하면, 이른바 액백(Continuous Floodback)이 발생하여 압축기(23)가 고장나버리는 경우가 있다.","Generally, since cooled the liquid refrigerant flows from the defrosting unit into the heating unit, so-called liquid back may occur and the compressor 23 may break down when the heating operation is performed with the opening degree of the outdoor expansion valve 24 set to the same opening as during the normal heating operation.",True,0.2286197394132614,0.8836523686762952,29,54,-25,154,331,-177
"그렇기 때문에, 난방 유닛의 실외 팽창밸브(24)의 개도를 통상의 난방 운전을 실시할 때의 개도보다 작게 하여 압축기(23)가 고장나 버리는 것을 억제할 수 있다.]","Therefore, by making the opening degree of the outdoor expansion valve 24 of the heating unit smaller than the opening degree during the normal heating operation, it is possible to prevent the compressor 23 from breaking down.",True,0.2091275304555893,0.8951021108958745,22,37,-15,92,226,-134
"[제1 실시형태에서의 공기 조화 장치(1)는 난방 유닛의 압축기(23)의 운전 주파수를 조절하여 가스관 내의 압력(난방 유닛의 응축 압력 또는 제상 유닛의 흡입 압력과 동일하다)을 제어했지만, 이를 대신하여 공기 조화 장치(1)는 제상 유닛의 압축기(23)의 운전 주파수를 조절하여 가스관 내의 압력을 제어하도록 구성되어도 좋다.]",[0037] The air conditioner 1 of the first embodiment controls the pressure in the gas pipe (equal to the condensation pressure of the heating unit or the suction pressure of the defrosting unit) by adjusting the operating frequency of the compressor 23 of the heating unit.,False,0.2372436374425888,0.8969020225649552,41,46,-5,185,273,-88
[(제2 실시형태)],"However, alternatively, the air conditioner 1 may be configured to control the pressure in the gas pipe by adjusting the operating frequency of the compressor 23 of the defrosting unit.",False,1.1913213729858398,0.307314600052769,2,30,-28,11,185,-174
"[제2 실시형태에서의 공기 조화 장치(1)는 제어부(4)가 제상 유닛의 수와 난방 유닛의 수를 제어하는 기능을 가지는 점에서 제1 실시형태에서의 공기 조화 장치(1)와 다를 뿐이고, 그 외의 구성은 제1 실시형태에서의 공기 조화 장치(1)와 같다.",[0038] (Second Embodiment) The air conditioner 1 of the second embodiment is different from the air conditioner 1 of the first embodiment only in that the control unit 4 has a function of controlling the number of defrosting units and the number of heating units.,False,0.1549153327941894,0.931642001621472,32,45,-13,138,263,-125
"그렇기 때문에, 이하에서는 필요에 따라서 도 1을 참조하여 제2 실시형태에서의 공기 조화 장치(1)의 구성의 도시를 생략한다.]","Therefore, in the following, the illustration of the configuration of the air conditioner 1 of the second embodiment will be omitted by referring to FIG. 1 as necessary.",True,0.1855631172657013,0.8935646552356917,16,28,-12,71,169,-98
"[제어부(4)는 다른 실외 유닛(2)의 제어부(4)와 운전 상태를 공유함으로써, 제상 유닛의 대수와 난방 유닛의 대수가 동일 또는 1대 차이가 되도록 실외 유닛(2)의 운전 대수를 제어한다.","[0039] By sharing the operating state with the control unit 4 of the other outdoor unit 2, the control unit 4 controls the number of operating outdoor units 2 so that the number of defrosting units and the number of heating units are the same or different by one.",True,0.2789473831653595,0.8689698432946835,24,49,-25,106,263,-157
"예를 들면, 제어부(4)는 5대의 실외 유닛(2)이 있는 경우로 1대의 실외 유닛(2)을 제상 운전시키는 경우, 난방 운전시키는 실외 유닛(2)의 대수를 1대 또는 2대로 한다.","For example, when there are five outdoor units 2 and one outdoor unit 2 is in the defrosting operation, the control unit 4 controls the number of outdoor units 2 in the heating operation to be one or two.",True,0.2786123156547546,0.8730299727121971,23,39,-16,99,204,-105
"또한, 예를 들면, 제어부(4)는 5대의 실외 유닛(2)이 있는 경우로 2대의 실외 유닛(2)을 제상 운전시키는 경우, 난방 운전시키는 실외 유닛(2)의 대수를 1대~3대의 어느 하나로 한다.","Further, for example, when there are five outdoor units 2 and two outdoor units 2 are in the defrosting operation, the control unit 4 controls the number of outdoor units 2 in the heating operation to be any one of one to three.",True,0.2980910539627075,0.8644195190245796,24,43,-19,107,228,-121
"또한 예를 들면, 제어부(4)는 5대의 실외 유닛(2)이 있는 경우로 3대의 실외 유닛(2)을 제상 운전시키는 경우, 난방 운전시키는 실외 유닛(2)의 대수를 2대로 한다.]","Further, for example, when there are five outdoor units 2 and three outdoor units 2 are in the defrosting operation, the control unit 4 controls the number of outdoor units 2 in the heating operation to be two.",True,0.2962480783462524,0.8604090159618396,22,38,-16,97,210,-113
"반면, 난방 유닛의 대수가 너무 많은 경우에는 가스관 내의 압력이 필요 이상으로 높아져서 제상 유닛측 압축기의 고장 리스크가 높아져 버린다.]","[0040] Generally, if the number of defrosting units is too large, the amount of heat required for defrosting is insufficient and the defrosting time becomes long. On the 16 other hand, if the number of heating units is too large, the pressure in the gas pipe becomes higher than necessary, and the risk of failure of the compressor on the defrosting unit side increases.",False,0.3781054615974426,0.7805496404011628,20,64,-44,79,370,-291
[이러한 과제에 대해서 제2 실시형태에서의 공기 조화 장치(1)는 제상 유닛과 난방 유닛의 대수를 조절함으로써 가스관 내의 압력을 상한 압력 이하로 제어할 수 있다.,"[0041] In regard to such a problem, the air conditioner 1 of the second embodiment can control the pressure in the gas pipe to be equal to or smaller than the upper limit pressure by adjusting the number of defrosting units and the number of heating units.",True,0.2618155479431152,0.8806490423751326,23,47,-24,92,256,-164
"그렇기 때문에, 제2 실시형태에서의 공기 조화 장치(1)에 의하면, 제상 운전에 의해서 압축기에 과도한 부하가 걸리는 것을 억제하는 것이 가능해진다.]","Therefore, according to the air conditioner 1 of the second embodiment, it is possible to inhibit the application of an excessive load to the compressor due to the defrosting operation.",True,0.2499456256628036,0.8719816004161779,19,30,-11,84,185,-101
[제어부(4)는 제상 유닛 및 난방 유닛을 포함하는 2개의 그룹별로 교대로 제상 운전을 하도록 구성되어도 좋다.,[0042] <Modificationexample> The control unit 4 may be configured so that two groups including the defrosting unit and the heating unit alternately perform the defrosting operation.,True,0.2490717619657516,0.859212013236599,15,26,-11,62,181,-119
"예를 들면, A, B, C, D의 4대의 실외 유닛(2)이 있는 경우, 4대의 실외 유닛(2)의 제어부(4)는 서로 연계하여 동작함으로써, 예를 들면 {A, B}, {C, D}의 그룹별로 교대로 제상 운전을 하도록 구성된다.","For example, when there are four outdoor units 2 of A, B, C, and D, the control units 4 of the four outdoor units 2 may operate in cooperation with each other, for example, so that the groups fA, B} and {C, D} alternately perform the defrosting operation.",True,0.1945936679840088,0.8941683504972018,30,48,-18,125,255,-130
"또한 예를 들면, 제어부(4)는 각 그룹 중에서는 각 실외 유닛(2)이 각 회의 제상 운전마다 제상 유닛과 난방 유닛을 전환하도록 구성되어도 좋다.","Further, for example, the control unit 4 may be configured such that the defrosting unit and the heating unit are replaced in each defrosting operation of each outdoor unit 2 in each group.",True,0.279509425163269,0.8644821531370751,21,33,-12,82,189,-107
"이러한 구성에 의하면, 공기 조화 장치(1)에서 빈번하게 제상 운전을 실시하는 것을 억제할 수 있기 때문에, 개개의 실외 유닛(2)별로 제상 운전을 실시하는데 비해서 난방 운전의 연장 시간을 더욱 길게 할 수 있다.]","According to such a configuration, since it is possible to suppress the frequent defrosting operation in the air conditioner 1, the total time of the heating operation can be made longer than that when the defrosting operation is performed in the individual outdoor units 2.",True,0.3874003291130066,0.80523761202023,31,45,-14,121,274,-153
"[제1 실시형태 및 제2 실시형태에서는, 응축 압력 제어 처리를 각 실외 유닛(2)의 제어부(4)가 실시하는 양태에 대해서 설명했지만, 이 처리는 반드시 각 실외 유닛(2)의 제어부에 의해서 실시될 필요는 없다.","[0043] In the first embodiment and the second embodiment, the mode in which the condensation pressure control process is performed by the control unit 4 of each outdoor 17 unit 2 has been described, but this process does not necessarily have to be performed by the control unit of each outdoor unit 2.",True,0.1906171888113021,0.91021530824805,28,53,-25,118,301,-183
"예를 들면, 공기 조화 장치(1)는 각 실외 유닛(2)의 제어부(4) 중에서 주가 되는 1개의 제어부(4)가 응축 압력 제어 처리를 실행하도록 구성되어도 좋다.","For example, the air conditioner 1 may be configured such that one main control unit 4 of the control units 4 of the outdoor units 2 executes the condensation pressure control process.",True,0.2193690240383148,0.9090849629382324,21,32,-11,89,184,-95
"이 경우, 다른 제어부(4)는 주가 되는 1개의 제어부(4)의 지시에 따라서 동작하면 좋다.","In this case, the other control units 4 may operate according to the instruction of one main control unit 4.",True,0.1736006736755371,0.9047046515388236,12,20,-8,51,108,-57
"또한, 공기 조화 장치(1)는 실외 유닛(2)이 갖추는 제어부와는 다른 제2 제어부를 갖추어도 좋다.",The air conditioner 1 may include a second control unit different from the control unit included in the outdoor unit 2.,True,0.1920922994613647,0.9062967448116392,13,21,-8,56,119,-63
"이 경우, 예를 들면, 공기 조화 장치(1)는 제2 제어부가 응축 압력 제어 처리를 실행하도록 구성되어도 좋다.","In this case, for example, the air conditioner 1 may be configured such that the second control unit executes the condensation pressure control process.",True,0.1684669405221939,0.9216008891788908,16,24,-8,62,152,-90
"이 경우, 실외 유닛(2)의 제어부(4)는 제2 제어부의 지시에 따라서 동작하면 좋다.]","In this case, the control unit 4 of the outdoor unit 2 may operate according to the instruction of the second control unit.",True,0.1546673774719238,0.9205010619290536,11,23,-12,49,123,-74
[상술한 실시형태에서의 공기 조화 장치(1)의 일부 또는 전부를 컴퓨터로 실현하도록 해도 좋다.,[0044] Apart or all of the air conditioner 1 of the above-described embodiment may be realized by a computer.,True,0.2344598621129989,0.8683543416463502,12,19,-7,53,109,-56
"그 경우, 이 기능을 실현하기 위한 프로그램을 컴퓨터 판독 가능한 기록 매체에 기록하고, 이 기록 매체에 기록된 프로그램을 컴퓨터 시스템이 읽도록 하여 실행함으로써 실현해도 좋다.","In that case, the program for realizing this function may be recorded on a computer-readable recording medium, and the program recorded on the recording medium may be read and executed by a computer system.",True,0.1860793083906173,0.8750900180987098,25,34,-9,100,206,-106
"또한, 여기서 말하는 「컴퓨터 시스템」이란 OS나 주변기기 등의 하드웨어를 포함하는 것으로 한다.","The term ""computer system"" as used herein includes an OS and hardware such as peripheral devices.",True,0.1722860038280487,0.8845347652686943,12,16,-4,54,97,-43
"또한, 「컴퓨터 판독 가능한 기록 매체」란 플렉시블 디스크, 광자기 디스크, ROM, CD－ROM 등의 가반매체, 컴퓨터 시스템에 내장되는 하드 디스크 등의 기억장치를 말한다.","The ""computer-readable recording medium"" refers to a portable medium such as a flexible disk, a magneto-optical disk, a ROM, or a CD-ROM, or a storage device such as a hard disk built into a computer system.",True,0.2073159515857696,0.8602104328219131,22,36,-14,98,207,-109
"또한, 「컴퓨터 판독 가능한 기록 매체」란 인터넷 등의 네트워크나 전화 회선 등의 통신회선을 통해서 프로그램을 송신하는 경우의 통신선과 같이, 단시간 동안 동적으로 프로그램을 유지하는 것, 그 경우의 서버나 클라이언트가 되는 컴퓨터 시스템 내부의 휘발성 메모리와 같이, 일정 시간 프로그램을 유지하고 있는 것도 포함해도 좋다.","Further, the ""computer readable recording medium"" may include a medium configured to hold the program dynamically for a short period of time like a communication line when the program is transmitted over a network such as the Internet and a communication circuit such as a telephone line and a medium configured to hold the program for a certain period of time like a volatile memory inside a computer system serving as a server and a client in that case.",True,0.1353217810392379,0.9135216449704916,44,79,-35,182,455,-273
"또한, 상기 프로그램은 상술한 기능의 일부를 실현하기 위한 것이어도 좋고, 추가로 상술한 기능을 컴퓨터 시스템에 이미 기록되어 있는 프로그램과의 조합으로 실현될 수 있는 것이어도 좋으며, FPGA(Field Programmable Gate Array) 등의 프로그램 가능 논리 소자를 이용하여 실현되는 것이어도 좋다.]","18 In addition, the above-described functions may be realized using a combination with a program which is already recorded in a computer system and may be realized using a programmable logic device such as a field programmable gate array (FPGA).",False,0.1831196099519729,0.8791746783185119,38,40,-2,178,245,-67
"[이상에서 설명한 적어도 하나의 실시형태에 의하면, 압축기, 사방밸브, 실외 열교환기, 실외 팽창밸브 및 실외 송풍기를 갖추고, 실외 공기와 냉매 사이에서의 열교환을 실시하는 복수의 실외 유닛과, 복수의 실내 유닛과 냉매 배관에 의해 접속되는 실내 유닛으로서, 실내 열교환기, 실내 팽창밸브 및 실내 송풍기를 갖추고, 실내 공기와 냉매 사이에서의 열교환을 실시하는 1개 이상의 실내 유닛과 복수의 실외 유닛 및 1개 이상의 실내 유닛을 제어하는 제어부로서, 어느 하나의 실외 유닛이 제상 운전중인 경우, 난방 운전중인 실외 유닛의 응축 압력, 또는 제상 운전중인 실외 유닛의 흡입 압력을 난방 운전시의 정격 최고 압력의 1/1.5배인 상한 압력 이하로 제어하는 제어부를 가짐으로써, 제상 운전에 의해 압축기에 과도한 부하가 걸리는 것을 억제할 수 있다.]","[0045] According to at least one embodiment described above, the air conditioner includes a plurality of outdoor units each including a compressor, a four-way valve, an outdoor heat exchanger, an outdoor expansion valve, and an outdoor blower, the outdoor unit exchanging heat between outdoor air and refrigerant; one or more indoor units each being connected to the plurality of indoor units by a refrigerant pipe, including an indoor heat exchanger, an indoor expansion valve, and an indoor blower, the indoor unit exchanging heat between indoor air and refrigerant; and a control unit that controls the plurality of outdoor units and the one or more indoor units, the control unit controlling condensation pressure of an outdoor unit in a heating operation or suction pressure of an outdoor unit in a defrosting operation to be equal to or smaller than an upper limit pressure which is 1/1.5 times the rated maximum pressure during the heating operation when any of the outdoor units is in the defrosting operation.",False,0.2286070138216018,0.8950485566514671,105,165,-60,422,1018,-596
"[본 발명의 여러 가지 실시형태를 설명했지만, 이들 실시형태는 예시로서 제시한 것이고, 발명의 범위를 한정하는 것을 의도하지 않는다.","[0046] While certain embodiments have been described, these embodiments have been presented by way of example only, and are not intended to limit the scope of the inventions.",True,0.1726789027452469,0.8779639023097934,17,28,-11,74,174,-100
"이들 실시형태는 그 외의 다양한 형태로 실시되는 것이 가능하고, 발명의 요지를 일탈하지 않는 범위에서 여러 가지 생략, 치환, 변경을 할 수 있다.","Indeed, the novel embodiments described herein may be embodied in a variety of other forms; furthermore, various omissions, substitutions and changes in the form of the embodiments described herein may be made without departing from the spirit of the inventions.",True,0.2932737469673157,0.8046513152238011,22,40,-18,82,262,-180
"이들 실시형태나 그 변형은 발명의 범위나 요지에 포함되는 동시에, 특허청구범위에 기재된 발명과 그 균등한 범위에 포함되는 것이다.]",The accompanying claims and their equivalents are intended to cover 19 such forms or modifications as would fall within the scope and spirit of the inventions.,True,0.3827998042106628,0.7329850799666446,17,26,-9,73,159,-86
[1…공기 조화 장치 2…실외 유닛 2A…제1 실외 유닛 2B…제2 실외 유닛 21…실외 열교환기 22…사방밸브 23…압축기 24…실외 팽창밸브 25…실외 송풍기 261…어큐뮬레이터 262…오일 분리기 263…가스관 접속부 264…액관 접속부 265…흡입 컵 3…실내 유닛 3A…제1 실내 유닛 3B…제2 실내 유닛 3C…제3 실내 유닛 341…가스관 접속부 342…액관 접속부 31…실내 열교환기 32…실내 팽창밸브 33…실내 송풍기 4…제어부],[Reference Signs List] [0047] 1 Air conditioner 2 Outdoor unit 2A First outdoor unit 2B Second outdoor unit 21 Outdoor heat exchanger 22 Four-way valve 23 Compressor 24 Outdoor expansion valve Outdoor blower 261 Accumulator 262 Oil separator 263 Gas pipe connection portion 264 Liquid pipe connection portion 265 Suction cup 3 Indoor unit 3A First indoor unit 3B Second indoor unit 3C Third indoor unit 341 Gas pipe connection portion 342 Liquid pipe connection portion 31 Indoor heat exchanger 32 Indoor expansion valve 33 Indoor blower 4 Control unit,False,0.3365509212017059,0.8180307405261207,50,90,-40,250,552,-302
"[또, 도 6B에 도시하는 바와 같이, 외경 치수가 작은 둘째 전고체 전지(S)에 대해서는, 그의 외경 치수(D2)에 맞추어, 압력받이 부재(21)의 다른쪽 단면(21b)의 외경을 가공함과 함께, 상기 외경 치수(D2)에 맞추어 외경을 가공한 압압 부재(22)와, 상기 외경 치수(D2)에 맞추어 중공부(23a)의 내경을 가공한 시료 홀더(23)를 준비하면 된다.]","Further, as shown in FIG. 6B, for a second type of all-solid-state battery S having a smaller outer diameter dimension, the outer diameter of the other end surface 21b of the pressure receiving member 21 may be processed in accordance with the outer diameter dimension D2 of the second type of all-solid-state battery S, and in addition, a pressing member 22 whose outer diameter has been processed in accordance with the outer diameter dimension D2 and a sample holder 23 having a hollow portion 23a whose inner diameter has been processed in accordance with the outer diameter dimension D2 may be prepared.",True,0.2256179302930832,0.8859436282127983,43,102,-59,204,608,-404
"[또한, 시료 홀더(23)의 중공부(23a)의 내경 치수는, 전고체 전지(S)를 매끄럽게(순조롭게) 삽입할 수 있도록 치수 공차를 고려해야 하는 것은 물론이다.]",Note that dimensional tolerance should be considered for the inner diameter dimension of the hollow portion 23a of the sample holder 23 so that the all-solid-state batteries S can be smoothly inserted.,True,0.3267953097820282,0.823285828224789,18,32,-14,90,201,-111
"[또한, 복수의 상이한 두께의 압력받이 부재(21)를 준비해 두고, 전고체 전지(S)의 두께나, 그의 측정 개소에 따라, 적당히 바꿔 달아서 사용하는 구성으로 해도 된다.]","Note that a plurality of pressure receiving members 21 having different thicknesses may be prepared, and replaced and used as appropriate according to the thicknesses of the all-solid-state batteries S and the measurement locations thereof.",True,0.2790955305099487,0.8282774062128899,22,35,-13,96,240,-144
"[수용 유닛 본체(11)에는, 도 1 내지 도 5에 도시하는 바와 같이, 전고체 전지(S)에의 압력의 작용 방향(전고체 전지(S)의 축방향)과 교차하는 방향(구체적으로는, 직교하는 지름 방향)에, X선 창(14)이 마련되어 있다.","As shown in FIGS. 1 to 5, the accommodating unit main body 11 is provided with the X-ray window 14 in a direction intersecting with (specifically, a radial direction orthogonal to) a direction of applying pressure to the all-solid-state battery S (the axial direction of the all-solid-state battery S).",True,0.2858282625675201,0.8574662066248976,27,49,-22,128,302,-174
"구체적으로는, 수용 유닛 본체(11)에는, 외주면으로부터 내부로 관통하는 단차 있는 절결홈(13)이 형성되어 있다.","Specifically, the accommodating unit main body 11 is provided with a stepped cutout groove 13 which is formed so as to penetrate from the outer peripheral surface to the inside of the accommodating unit main body 11.",True,0.290516585111618,0.8350490193542021,12,37,-25,64,216,-152
"이 절결홈(13)은, 단차부로부터 외주면까지의 폭을, 단차부로부터 내부까지의 폭보다도 넓게 형성되어 있다.",The stepped cutout groove 13 is configured so that the width from a step portion thereof to the outer peripheral surface of the accommodating unit main body 11 is larger than the width from the step portion to the inside of the accommodating unit main body 11.,True,0.4549530744552612,0.7282830788503432,11,47,-36,59,260,-201
"그리고, 절결홈(13) 내의 단차부에 X선 창(14)을 마련한 구성으로 되어 있다.]",The X-ray window 14 is provided at the step portion in the cutout groove 13.,True,0.4448740184307098,0.7344397999253764,10,15,-5,47,76,-29
"[이와 같이 구성함으로써, 전고체 전지(S)와 X선 창(14)의 거리를 짧게 할 수 있고, 전고체 전지(S)로부터의 X선 회절선을 X선 검출기에 의해 효율적으로 검출하여, 고강도 측정이 가능해진다.","This configuration makes it possible to shorten the distance between the all-solid-state battery S and the X-ray window 14 and efficiently detect diffracted X-rays from the all-solid-state battery S by an X-ray detector, whereby high-intensity measurement can be performed.",True,0.3336843252182007,0.8260957472172523,24,39,-15,110,273,-163
"즉, X선 회절 측정 시에, 전고체 전지(S)의 외측면(외주면)을 향해 X선이 입사된다.","In other words, X-rays are incident to the outer side surface (outer peripheral surface) of the all-solid-state battery S at the time of X-ray diffraction measurement.",True,0.292664885520935,0.8427142790621384,11,26,-15,49,167,-118
"이 때, 전고체 전지(S)와 X선 창(14) 사이의 거리 관계에 의해, 측정으로 얻어지는 X선의 강도에 영향이 생긴다.]","At this time, the intensity of X-rays obtained by the measurement is affected by the relation between the distance between the all-solid-state battery S and the X-ray window 14.",True,0.3422099649906158,0.81883407326591,16,29,-13,67,177,-110
"[예를 들면, 도 7A에 도시하는 바와 같이, 전고체 전지(S)의 외측면(외주면)과 X선 창(14) 사이의 거리가 짧은 경우는, 예를 들면 전고체 전지(S)의 소정의 점으로부터 반사되어 온 회절 X선을 꺼냄(취출) 가능한 각도 A를 크게 확보할 수 있고, 따라서 전고체 전지(S)로부터 반사되어 온 회절 X선을 X선 검출기(102)에 의해 효율적으로 검출하여, 고강도 측정이 가능해진다.]","For example, when the distance between the outer side surface (outer peripheral surface) of the all-solid-state battery S and the X-ray window 14 is short as shown in FIG. 7A, it is possible to secure a large angle A at which diffracted X-rays reflected from a predetermined point of the all-solid-state battery S can be extracted, so that the diffracted X-rays reflected from the all-solid-state battery S can be efficiently detected by an X-ray detector 102, and high-intensity measurement can be performed.",True,0.2155282497406005,0.9034862182754648,49,82,-33,217,509,-292
"[한편, 도 7B에 도시하는 바와 같이, 전고체 전지(S)의 외측면(외주면)과 X선 창(14) 사이의 거리가 긴 경우는, 전고체 전지(S)의 동일한 소정의 점으로부터 반사되어 온 회절 X선을 꺼냄 가능한 각도 A가 작아져 버려, X선 검출기(102)에 입사되는 회절 X선의 강도가 저하한다.]","On the other hand, when the distance between the outer side surface (outer peripheral surface) of the all-solid-state battery S and the X-ray window 14 is long as shown in FIG. 7B, the angle A at which the diffracted X-rays reflected from the same predetermined point of the all-solid-state battery S can be extracted is smaller, so that the intensity of the diffracted X-rays incident to the X-ray detector 102 decreases.",True,0.1836605668067932,0.9161401364108708,37,71,-34,163,422,-259
"[여기서, 도 7A 및 도 7B는, 도 1에 있어서의 B-B선 단면을 모식적으로 도시한 도면이고, 시료 홀더(23) 등의 구성요소는 생략되어 있다.","Here, FIGS. 7A and 7B are schematic diagrams depicting a cross-section taken along a line B-B in FIG. 1, and components such as the sample holder 23 are omitted.",True,0.2011018693447113,0.8756651237479895,20,29,-9,82,161,-79
"또, 도면 중의 회절 X선은, 전고체 전지(S)의 외측면(외주면)에 있어서의 X선의 조사점으로부터 반사되어 온 회절 X선을 모식적으로 나타내고 있다.]","Further, the diffracted X-rays in the figures schematically show diffracted X-rays reflected from an irradiation point of X-rays on the outer side surface (outer peripheral surface) of the all-solid-state battery S.",True,0.2247453331947326,0.885182463466925,18,31,-13,84,215,-131
"[또, 절결홈(13) 내의 단차부에 X선 창(14)을 마련해서 밀폐 부재(15)를 배치함으로써, 오퍼레이터가 작업 시에 잘못해서 밀폐 부재(15)에 닿아(접촉해) 버리는 부적당함을 회피해서, 밀폐 부재(15)의 파손을 유효하게 방지할 수가 있다.]","Further, the X-ray window 14 is provided at the step portion in the cutout groove 13 and a hermetically sealing member 15 is arranged there, thereby avoiding a trouble that an operator accidentally touches the hermetically sealing member 15 during a work, and effectively preventing the hermetically sealing member 15 from being damaged.",True,0.3069495856761932,0.8274996372544542,27,53,-26,138,337,-199
"[또, 절결홈(13) 내의 단차부 면을 이용해서 밀폐 부재(15)를 첩부함(붙임)으로써, X선 창(14)을 용이하면서도 확실하게 폐색할 수 있어, 조립 작업의 용이화를 도모할 수가 있다.]","Still further, the surface of the step portion in the cutout groove 13 is used to attach the hermetically sealing member 15, whereby the X-ray window 14 can be easily and surely blocked, and an assembly work can be facilitated.",True,0.3620769679546356,0.7992332449787785,22,40,-18,105,227,-122
"[앞서 기술한 시료 홀더(23)에 있어서, 이 절결홈(13)(즉, X선 창(14))과 대향하는 부위에는, 도 5에 도시하는 바와 같이 중공부(23a)에 이르는 절결부(23c)가 형성되어 있고, 중공부(23a)에 설정한 시료 배치부(23b)가 이 절결부(23c)를 통해 X선 창(14)과 대향하도록 되어 있다.","The sample holder 23 described above is provided with a cutout portion 23c which is formed at a location facing the cutout groove 13 (that is, the X-ray window 14) so as to extend to the hollow portion 23a as shown in FIG. 5, whereby the sample placing portion 23b set in the hollow portion 23a is caused to face the X-ray window 14 through the cutout portion 23c.",True,0.2292836457490921,0.8855178863152486,33,69,-36,172,364,-192
"이것에 의해, 시료 배치부(23b)에 배치된 전고체 전지(S)의 외측면(외주면)을 X선 창(14)에 대해서 노출시킬 수가 있다.]","As a result, the outer side surface (outer peripheral surface) of the all-solid-state battery S placed in the sample placing portion 23b can be exposed to the X-ray window 14.",True,0.2918848395347595,0.8688548461098362,14,30,-16,72,175,-103
"[여기서, X선 창(14)은, X선 회절 장치에 의한 X선 회절 측정의 실시를 전제로 해서, 외부에 마련된 X선원으로부터의 X선을 받아들여서(취입해서) 전고체 전지(S)에 조사함과 함께, 전고체 전지(S)로부터 반사되어 오는 회절 X선을, 외부에 마련된 X선 검출기를 향해 출사할 수 있도록, 넓은 각도 범위에 연장존재해서 형성되어 있다.","Here, on the premise that the X-ray diffraction measurement is performed by the X-ray diffraction apparatus, the X-ray window 14 is formed to spread over a wide angle range so that X-rays from an X-ray source arranged outside can be taken in to irradiate the all-solid-state battery S and diffracted X-rays reflected from the all-solid-state battery S can be emitted to the X-ray detector arranged outside.",True,0.2648992538452148,0.8784173118406678,42,66,-24,189,406,-217
"이것에 의해, 반사식의 X선 회절 측정을 실행하는 것이 가능해진다.]","As a result, reflection type X-ray diffraction measurement can be performed.",True,0.2834691107273102,0.8002172328586525,9,11,-2,38,76,-38
"[또한, X선 창(14)은, X선원으로부터의 X선을 받아들여서 전고체 전지(S)에 조사하기 위한 X선 창과, 전고체 전지(S)로부터 반사되어 오는 회절 X선을, 외부에 마련된 X선 검출기를 향해 출사하기 위한 X선 창을, 따로 따로 마련해도 된다.]","Note that the X-ray window 14 may be separated into an X-ray window for taking in X-rays from the X-ray source and irradiating the all-solid-state battery S with the X-rays, and an X-ray window for emitting diffracted X-rays reflected from the all-solid-state battery S to the X-ray detector arranged outside.",True,0.3178375959396362,0.8459259690795942,31,50,-19,139,309,-170
"[또, X선 창(14)은, 밀폐 부재(15)에 의해 폐색되어 있다.","Further, the X-ray window 14 is blocked by the hermetically sealing member 15.",True,0.3892619609832763,0.7618062079770415,8,13,-5,37,78,-41
"밀폐 부재(15)는, X선을 투과율이 높고, 공기 등의 기체의 투과가 작은 재료(예를 들면, 베릴륨)로 형성되어 있다.","The hermetically sealing member 15 is formed of a material (for example, beryllium) that has a high transmittance for X-rays and a small permeability for a gas such as air.",True,0.1998692154884338,0.8755501392574971,15,30,-15,66,172,-106
"이 밀폐 부재(15)에 의해 수용 유닛 본체(11)의 내부를 기밀 상태로 하여, X선 창(14)으로부터의 대기의 침입을 방지할 수가 있다.]","The hermetically sealing member 15 makes the inside of the accommodating unit main body 11 airtight, and can prevent intrusion of air from the X-ray window 14.",True,0.2419360429048538,0.8596938270322232,18,27,-9,78,159,-81
"[X선 창(14)은, 시료 배치부(23b)에 배치된 전고체 전지(S)의 외측면(외주면)과 대향해서 마련되어 있으므로, 전고체 전지(S)의 외측면(외주면)을 향해 X선이 조사된다.","Since the X-ray window 14 is provided so as to face the outer side surface (outer peripheral surface) of the all-solid-state battery S placed in the sample placing portion 23b, X-rays are irradiated in the direction to the outer side surface (outer peripheral surface) of the all-solid-state battery S. Here, the outer side surface (outer peripheral surface) of the all-solid-state battery S is an outer surface on which the lamination state of a plurality of components constituting the all-solid-state battery S can be observed.",False,0.4387537240982055,0.8080778897664831,17,84,-67,99,530,-431
"따라서, X선 창(14)을 통해, 상기 복수의 요소의 적층 상태를 관찰할 수 있는 외면에 X선을 조사할 수가 있다.]","Therefore, the outer side surface on which the lamination state of the plurality of components can be observed can be irradiated with X-rays through the X-ray window 14.",True,0.2948816418647766,0.843239554343741,17,28,-11,65,169,-104
"[이와 같이 구성함으로써, 시료에 있어서의 복수의 요소를 측정할 수 있는 외면에 X선을 조사해서, 그들 각 요소를 개별적으로, 또는 그들을 각 일괄해서 분석 평가하는 것이 가능해진다.","This configuration makes it possible to radiate X-rays to the outer side surface on which the plurality of components in the sample can be measured, and analyze and evaluate each of these components individually or in a lump.",True,0.2877317368984222,0.8239840823688999,25,38,-13,102,225,-123
"즉, 도 8A에 도시하는 바와 같이, 전고체 전지(S)를 구성하는 복수의 요소(예를 들면, 전해질 층(S1), 전극 활물질 층(S2), 집전체 층(S3)) 전체에 X선을 조사하는 광학 조건에서, 이들 각 요소를 일괄해서 분석 평가하는 것이 가능해진다.","In other words, as shown in FIG. 8A, under an optical condition that the whole of the plurality of components (for example, an electrolyte layer S1, electrode active material layers S2, and current collector layers S3) constituting the entire all-solid-state battery S is irradiated with X-rays, it is possible to analyze and evaluate each of these components in a lump.",True,0.154447317123413,0.9176804374748948,32,60,-28,140,370,-230
"또, 도 8B에 도시하는 바와 같이, 전고체 전지(S)를 구성하는 일부 요소에만 X선을 조사하는 광학 조건에서, 상기 일부 요소를 개별적으로 분석 평가할 수도 있다.]","Further, as shown in FIG. 8B, under an optical condition that only some components constituting the entire all-solid-state battery S are irradiated with X-rays, it is possible to individually analyze and evaluate the components which have been irradiated with X-rays.",True,0.233927845954895,0.8673415123036049,23,40,-17,93,267,-174
"[여기서, 앞서 기술한 압력받이 부재(21)는, X선 창(14)과의 관계에 있어서, 전고체 전지(S) 전체(두께 방향 전체)가 X선 창(14)과 대향해서 배치되도록, 적어도 압력받이 부재(21)의 단면이 X선 창(14)과 대향하는 위치에 돌출해서 배치하는 것이 바람직하다.","Here, with respect to the relation with the X-ray window 14, it is preferable that at least the end surface of the pressure receiving member 21 described above is arranged so as to protrude to a position facing the X-ray window 14 so that the entire all-solid-state battery S (the entire body in the thickness direction) faces the X-ray window 14.",True,0.2433871477842331,0.8886083633955315,30,61,-31,152,347,-195
"또, 전고체 전지(S)의 두께 방향의 중심부가, X선 창(14)의 중심과 대향하는 위치에 배치되도록 압력받이 부재(21)의 두께 치수를 조정하는 것이 바람직하다.","Further, it is preferable to adjust the thickness dimension of the pressure receiving member 21 so that the central portion in the thickness direction of the all-solid-state battery S is arranged at a position facing the center of the X-ray window 14.",True,0.2470134198665619,0.8758932445523605,19,42,-23,90,251,-161
"이와 같이 조정함으로써, 전고체 전지(S)로부터 반사되어 오는 회절 X선의 꺼냄(취출) 각도를 최대화할 수가 있다.]","By adjusting the thickness dimension of the pressure receiving member 21 as described above, the angle at which diffracted X-rays reflected from the all-solid-state battery S are extracted can be maximized.",True,0.6377872228622437,0.6260626252843925,14,31,-17,65,206,-141
"[도 2 내지 도 4로 되돌아가서, 가압 유닛(30)은, 시료 수용 유닛(10)의 중공부 내(자세하게는, 시료 홀더(23)의 중공부(23a) 내)에 수용된 전고체 전지(S)에 압력을 작용시키는 기능을 가지고 있다.]","Returning to FIGS. 2 to 4, the pressurizing unit 30 has a function of applying pressure to the all-solid-state battery S accommodated in the hollow portion of the sample accommodating unit 10 (specifically, in the hollow portion 23a of the sample holder 23).",True,0.2055755108594894,0.8971526161410811,25,43,-18,120,258,-138
"[이 가압 유닛(30)은, 원통형의 동체부를 가지고 있다.",This pressurizing unit 30 has a cylindrical body portion.,True,0.2343173623085022,0.8383691737538366,7,9,-2,32,57,-25
"동체부는, 외측 동체부(30A)와 내측 동체부(30B)로 구성되어 있고, 원통형의 외측 동체부(30A)의 내부(중공부 내)에, 동일하게 원통형의 내측 동체부(30B)를 끼워넣고, 볼트 등의 체결구(50)에 의해서 고정시킴으로써 일체화되어 있다(도 4 참조).]","The cylindrical inner body portion 30B is fitted in and fixed to (a hollow portion of) the cylindrical outer body portion 30A by fasteners 50 such as bolts, whereby the cylindrical outer body portion 30A and the cylindrical inner body portion 30B are integrated with each other (see FIG. 4 ).",False,0.1867845058441162,0.9008045262407576,26,51,-25,145,292,-147
"[여기서, 외측 동체부(30A)는, 전기적인 절연성을 가지고, 또한 가압력의 반작용에 견딜 수 있는 강도와 기밀성을 가진 합성 수지 재료(예를 들면, 폴리염화 바이닐(PVC), 폴리염화 바이닐리덴(PVdC), 폴리스타이렌(PS), 아크릴로나이트릴·스타이렌 공중합체(AS 수지), 아크릴로나이트릴·뷰타다이엔·스타이렌 공중합체(ABS 수지), 고밀도 폴리에틸렌(HDPE), 폴리프로필렌(PP), 폴리아세탈(POM), 폴리메틸메타크릴레이트(PMMA), 메틸메타크릴레이트·스타이렌 공중합(MS), 폴리카보네이트(PC), 삼불화 염화 에틸렌(PCTFE), 사불화 에틸렌(PTFE) 등으로 형성되어 있다.","Here, the outer body portion 30A is formed of a synthetic resin material having electrical insulation properties and having strength and airtightness capable of withstanding the reaction of pressing force (for example, polyvinyl chloride (PVC), polyvinylidene chloride (PVdC), polystyrene (PS), acrylonitrile-styrene copolymer (AS resin), acrylonitrile-butadiene-styrene copolymer (ABS resin), high-density polyethylene (HDPE), polypropylene (PP), polyacetal (POM), polymethyl methacrylate (PMMA), methacrylic aid styrene copolymer (MS), polycarbonate (PC), polychlorotrifluoroethylene (PCTFE), polytetrafluoroethylene (PTFE) or the like).",True,0.1033923327922821,0.9392244626820704,46,72,-26,332,639,-307
"한편, 내측 동체부(30B)는, 가압력의 반작용에 견딜 수 있는 강도를 가진 금속 재료로 형성되어 있다.]","Further, the inner body portion 30B is formed of a metal material having the strength capable of withstanding the reaction of pressing force.",True,0.1416733562946319,0.9129017527625544,14,23,-9,59,141,-82
"[내측 동체부(30B)의 내주면은, 도 4에 도시하는 바와 같이 단차 있는(계단식) 형상으로 형성되어 있고, 내경이 작은 후방부의 내주면에 너트부(31)가 형성되어 있다.","The inner peripheral surface of the inner body portion 30B is formed in a stepped shape as shown in FIG. 4, and a nut portion 31 is formed on the inner peripheral surface of a rear portion having a small inner diameter.",True,0.1617496162652969,0.9107914665352504,20,42,-22,95,219,-124
"이 너트부(31)에는, 1개의 볼트 부재(32)가 나사결합된다.",One bolt member 32 is screwed into the nut portion 31.,True,0.2577109634876251,0.8321670900491096,6,11,-5,35,54,-19
"볼트 부재(32)는, 시료 수용 유닛(10)의 중공부 내에 수용된 전고체 전지(S)에 압력을 작용시키기 위한 가압 기구를 구성한다.",The bolt member 32 constitutes a pressurizing mechanism for applying pressure to the all-solid-state battery S accommodated in the hollow portion of the sample accommodating unit 10.,True,0.2531764507293701,0.8546497102555213,16,27,-11,73,182,-109
"전방 부분(10a) 및 후방 부분(10b)을 갖는 프레임(10), 상기 프레임(10)의 후방 부분(10b)을 지지하도록 배치되는 한 쌍의 바퀴(11), 및 상기 프레임의 전방 부분을 지지하도록 배치되는 적어도 하나의 바퀴(12)를 포함하는 전동 보행기(1)로서, 상기 적어도 하나의 바퀴는 주행 모터(20)에 결합되고, 상기 전동 보행기(1)는: - 상기 프레임(10)에는 두개의 수직화 램프(100)가 장착되며, 상기 수직화 램프(100)는 지면에 수직인 축과 각도를 20°내지 40° 사이에서 형성하는 길이 방향 축을 가지고, 상기 수직화 램프(100) 각각은 관련되는 상기 수직화 램프(100)를 따라 병진 이동이 가능한 전자 핸들(200)과 관련되며,- 상기 수직화 램프(100)를 따라 상기 전자 핸들(200)의 동기화 이동을 허용하도록 배치되는 적어도 하나의 수직화 모터(30)를 포함하고, 상기 변위는 앉은 위치에서 서 있는 위치로 상기 보행기의 사용자를 이동시킬 수 있으며, 그리고- 적어도 하나의 전자 핸들(200)은 제어 모듈(40)에 작동적으로 결합되는 하나 이상의 센서를 포함하며, 상기 제어 모듈(40)은 상기 수직화 모터(30) 및 상기 주행 모터(20)를 제어할 수 있도록 구성되는 것을 특징으로 하는 전동 보행기(1).","A motorized walker (1) comprising a frame (10) having a front portion (1Oa) and a rear portion (1ob), a pair of wheels (11) being arranged to support the rear portion (1Ob) of the frame (10), and at least one wheel (12) being arranged to support the front portion of the frame, at least one of the wheels being coupled to a traveling motor (20), said motorized walker (1) being characterized in that: - the frame (10) is equipped with two verticalization ramps (100), said verticalization ramps (100) having a longitudinal axis forming an angle with an axis perpendicular to the ground, between 200 and 40°, each of said verticalization ramps (100) being associated with an electronic handle (200) movable in translation along the verticalization ramp (100) to which it is associated, - it comprises at least one verticalization motor (30) arranged to allow a synchronous movement of the electronic handles (200) along the verticalization ramps (100), said displacement being capable of moving a user of the walker from a sitting position to a standing position, and - at least one of the electronic handles (200) comprising one or more sensors operatively coupled to a control module (40), said control module (40) being configured to be able to control the verticalization motor (30) and the traveling motor (20).",True,0.1783890128135681,0.9356422669370882,137,217,-80,642,1315,-673
"그/그녀가 일어서거나 앉기를 원하는지 여부에 해당하는 인덱스를 계산하도록 구성되고, 상기 인덱스는 상기 전자 핸들(200)의 하나 이상의 센서에 의해 생성되는 데이터로부터 계산되는 것을 특징으로 하는 전동 보행기(1).","The motorized walker (1) according to claim 1, characterized in that the control module (40) is configured to calculate an index corresponding to an intention of a user of the walker, for example whether he/she wishes to stand up or sit down, said index being calculated from data generated by the one or more sensors of the electronic handles (200).",False,0.4792845547199249,0.8261640934678055,26,60,-34,122,350,-228
"제2항에 있어서, 상기 보행기의 사용자의 의도에 해당하는 인덱스의 계산은 상기 사용자에 의해 상기 전동 보행기(1)를 사용하는 동안, 상기 전자 핸들(200)의 하나 이상의 센서에 의해 생성되는 데이터로부터 훈련된 예측 모델을 추가로 사용하는 것을 특징으로 하는 전동 보행기(1).","The motorized walker (1) according to claim 2, characterized in that the calculation of the index corresponding to the intention of a user of the walker further uses a prediction model trained from data generated, by the one or more sensors of the electronic handles (200), during the use of the motorized walker (1) by said user.",True,0.1632886379957199,0.9393605081250485,36,57,-21,157,330,-173
"제1항 내지 제3항 중 어느 한 항에 있어서, 상기 제어 모듈(40)은 상기 전자 핸들(200)의 하나 이상의 센서에 의해 생성되는 데이터로부터 상기 보행기에 기대는 동안 상기 보행기의 사용자가 서 있는지 여부를 추가로 결정하도록 구성되는 것을 특징으로 하는 전동 보행기(1).","The motorized walker (1) according to any one of claims 1 to 3, characterized in that the control module (40) is configured to further determine whether a user of the walker is standing while leaning on the walker from data generated by the one or more sensors of the electronic handles (200).",True,0.2111071050167083,0.93447151892211,38,52,-14,155,293,-138
"제1항 내지 제4항 중 어느 한 항에 있어서, 상기 제어 모듈(40)은 상기 보행기의 사용자가 앉아 있고 사용자가 상기 보행기에 기대 있지 않은 때, 특히 상기 사용자에 의해 상기 전동 보행기(1)의 사용 동안 상기 전자 핸들(200)의 하나 이상의 센서에 의해 생성되는 데이터로부터 훈련된 예측 모델로부터 결정하도록 추가로 구성되는 것을 특징으로 하는 전동 보행기(1).","The motorized walker (1) according to any one of claims 1 to 4, characterized in that the control module (40) is configured to further determine when a user of the walker is seated and the user is not leaning on the walker, in particular from a prediction model trained from data generated, by the one or more sensors of the electronic handles (200), during the use of the motorized walker (1) by said user.",True,0.2237695753574371,0.9282739098632266,52,74,-22,208,407,-199
"제1항 내지 제5항 중 어느 한 항에 있어서, 상기 수직화 램프(100) 각각은 상기 전자 핸들(200)이 상기 수직화 램프(100)을 따라 이동하게 하는 상기 수직화 모터(30)에 의해 구동되는 전동식 나사 너트 시스템을 포함하는 것을 특징으로 하는 전동 보행기(1).","The motorized walker (1) according to any one of claims 1 to 5, characterized in that each of the verticalization ramps (100) comprises a motorized screw-nut system driven by the verticalization motor (30) allowing the electronic handles (200) to move along the verticalization ramps (100).",True,0.2299994677305221,0.9161777559024632,36,45,-9,151,290,-139
"제1항 내지 제6항 중 어느 한 항에 있어서, 상기 수직화 램프(100)는 나사 너트 시스템에 대해 상기 수직화 모터(30)의 반대쪽에 위치된 베어링을 포함하는 것을 특징으로 하는 전동 보행기(1).","The motorized walker (1) according to any one of claims 1 to 6, characterized in that the verticalization ramps (100) comprise a bearing located opposite the verticalization motor (30) with respect to a screw-nut system.",True,0.243704155087471,0.8939068043065824,27,35,-8,111,220,-109
"제1항 내지 제7항 중 어느 한 항에 있어서, 상기 전자 핸들(200)과 상기 수직화 램프(100)는 내부 가이드 시스템을 통해 결합되는 것을 특징으로 하는 전동 보행기(1).","The motorized walker (1) according to any one of claims 1 to 7, characterized in that the electronic handles (200) and the verticalization ramps (100) are coupled via an internal guide system.",True,0.1641802191734314,0.9313045965311564,24,32,-8,98,192,-94
"제1항 내지 제7항 중 어느 한 항에 있어서, 상기 전자 핸들(200)과 상기 수직화 램프(100)는 외부 가이드 시스템을 통해 결합되는 것을 특징으로 하는 전동 보행기(1).","The motorized walker (1) according to any one of claims 1 to 7, characterized in that the electronic handles (200) and the verticalization ramps (100) are coupled via an external guide system.",True,0.1637334376573562,0.931401555542961,24,32,-8,98,192,-94
"제1항 내지 제9항 중 어느 한 항에 있어서, 각각이 상기 수직화 램프(100) 중 하나에 결합되고 바람직하게 상기 수직화 램프(100)의 일 단부에 위치되는 두개의 수직화 모터(30)를 포함하는 것을 특징으로 하는 전동 보행기(1).","The motorized walker (1) according to any one of claims 1 to 9, characterized in that it comprises two verticalization motors (30), each coupled to one of the verticalization ramps (100) and preferably positioned at one end of the verticalization ramp (100).",True,0.2366425693035125,0.9012208488246288,31,42,-11,131,258,-127
"제1항 내지 제10항 중 어느 한 항에 있어서, 데이터 메모리(42)를 포함하고, 상기 데이터 메모리는 상기 수직화 램프(100) 각각에 대한 상기 핸들의 최대 높이를 저장하며, 상기 전자 핸들의 최대 높이는 상기 전자 핸들(200)의 하나 이상의 센서에 의해 생성되는 데이터 및 예측 모델로부터 계산되도록 구성되는 것을 특징으로 하는 전동 보행기(1).","The motorized walker (1) according to any one of claims 1 to 10, characterized in that it comprises a data memory (42), said data memory being configured to store a maximum height of the handles on each of the verticalization ramps (100), said maximum height of the electronic handles having been calculated from a prediction model and data generated by the one or more sensors of the electronic handles (200).",True,0.1989986002445221,0.9361683870573267,48,70,-22,198,410,-212
"제1항 내지 제11항 중 어느 한 항에 있어서, 데이터 메모리(42)를 포함하고, 상기 데이터 메모리는 상기 수직화 램프(100) 각각에서 상기 전자 핸들의 최소 높이 및 최대 높이를 저장하도록 구성되는 것을 특징으로 하는 전동 보행기(1).","The motorized walker (1) according to any one of claims 1 to 11, characterized in that it comprises a data memory (42), said data memory being configured to store a minimum height and a maximum height of the electronic handles on each of the verticalization ramps (100).",True,0.1655178666114807,0.9397825463418386,33,47,-14,135,270,-135
"제1항 내지 제12항 중 어느 한 항에 있어서, 사용자의 의도 및 사용자가 여전히 기립 장치와 연결되어 있는지 여부를 감지하도록 구성되는 인간-기계 인터페이스를 포함하는 것을 특징으로 하는 전동 보행기(1).","The motorized walker (1) according to any one of claims 1 to 12, characterized in that it comprises a human-machine interface configured to: detect the intention of the user and whether the user is still in connection with the sit-to-stand device.",True,0.2034119516611099,0.9031675837706158,28,41,-13,116,247,-131
"제1항 내지 제13항 중 어느 한 항에 있어서, 상기 센서는 포스 센서, 압력 센서, 광전 배리어 전지, 변위 센서로부터 선택되는 것을 특징으로 하는 전동 보행기(1).","The motorized walker (1) according to any one of claims 1 to 13, characterized in that the sensor is selected from: a force sensor, a pressure sensor, a photoelectric barrier cell, a displacement sensor.",True,0.2033288478851318,0.9058439857948052,25,34,-9,94,203,-109
"제1항 내지 제14항 중 어느 한 항에 있어서, 상기 제어 모듈(40)은 시간 간격에 대해 상기 전자 핸들(200)에 가해지는 힘 변동 값을 계산하고 상기 계산된 가해진 힘 변동 값이 미리 결정된 힘 변동 값보다 큰 경우 상기 전자 핸들의 이동을 시작하도록 추가로 구성되는 것을 특징으로 하는 전동 보행기.","The motorized walker according to any one of claims 1 to 14, characterized in that the control module (40) is configured to further calculate a force variation value applied to the electronic handle (200) over a time interval and to initiate movement of the electronic handles when the calculated applied force variation value is greater than a predetermined force variation value.",True,0.1915700733661647,0.9311910150537902,47,61,-14,171,381,-210
"제1항 내지 제15항 중 어느 한 항에 있어서, 상기 제어 모듈(40)은 상기 전자 핸들(200)에 가해지는 힘 값을 계산하고 상기 전자 핸들에 가해지는 힘 값이 미리 결정된 힘 값 이상인 경우에만 수직화를 시작하도록 추가로 구성되는 것을 특징으로 하는 전동 보행기(1).","The motorized walker (1) according to any one of claims 1 to 15, characterized in that the control module (40) is configured to further calculate a force value applied to the electronic handle (200) and to initiate verticalization only if the force value applied to the electronic handle is greater than or equal to a predetermined force value.",True,0.2536922991275787,0.909749272468252,39,58,-19,152,344,-192
"제1항 내지 제16항 중 어느 한 항에 있어서, 근접 센서(50), 바람직하게 상기 보행기의 사용자의 몸통과 상기 프레임 사이의 근접 값을 측정하도록 구성되는 근접 센서(50)를 포함하고, 상기 제어 모듈(40)은 상기 측정된 근접 값이 미리 결정된 근접 값보다 큰 경우 수직화를 시작하도록 추가로 구성되는 것을 특징으로 하는 전동 보행기(1).","The motorized walker (1) according to any one of claims 1 to 16, characterized in that it comprises a proximity sensor (50), preferably configured to measure a proximity value between the trunk of a user of the walker and the frame, and in that the control module (40) is further configured to initiate verticalization when the measured proximity value is greater than a predetermined proximity value.",True,0.2051429897546768,0.923969563488534,47,66,-19,193,401,-208
"제1항 내지 제17항 중 어느 한 항에 있어서, 상기 제어 모듈(40)은 상승 동안 저크를 최소화하도록 적어도 하나의 수직화 모터(30)를 제어하도록 추가로 구성되고, 바람직하게 상승 동안 상기 전자 핸들(200)의 위치를 제어하여 이들의 위치(X(t))가 하기 방정식을 만족하는 것을 특징으로 하는 전동 보행기(1): 여기서:X(t)는 시간(t)의 함수로서, 가장 낮은 위치(Xi)에 대한 수직 축 상의 상기 전자 핸들의 위치이다.","The motorized walker (1) according to any one of claims 1 to 17, characterized in that the control module (40) is further configured to control at least one verticalization motor (30) so as to minimize jerk during ascent, and preferably to control the position of the electronic handles (200) during ascent so that their position X(t) satisfies the following equation: X(t) = X + (Xf - XI)* 10 * - 15* + 6* ( Where: 41 X(t) is the position of the electronic handle, on a vertical axis, with respect to a lowest position Xi, as a function of time t; Xf is a maximum height of the electronic handle, and T is a total verticalization time.",False,0.2621868550777435,0.8949775818480679,54,117,-63,242,636,-394
"제1항 내지 제18항 중 어느 한 항에 따른 전동 보행기(1)를 제어하기 위한 방법(300)으로서, 상기 제어 방법은:- 적어도 하나의 전자 핸들(200)의 센서에 의해, 상기 전자 핸들(200)에 가해지는 적어도 하나의 힘 값을 측정하는 단계(320)- 제어 모듈(40)에 의해, 상기 적어도 하나의 힘 값을 가해진 힘의 미리 결정된 임계값과 비교하는 단계(330), 및- 상기 제어 모듈(40)에 의해, 상기 적어도 하나의 전자 핸들(200)의 결정된 위치 및 측정된 가해진 힘 값에 따라 수직화(30) 및 주행(20) 모터 중 적어도 하나에 대한 제어 명령을 생성하는 단계(370)를 포함하는 방법.","A method (300) for controlling a motorized walker (1) according to claim 1 to 18, said control method comprising the following steps: - Measuring (320), by a sensor of at least one electronic handle (200), at least one force value applied to the electronic handle (200), - Comparing (330), by a control module (40), the at least one force value applied to a predetermined threshold value of an applied force, and - Generating (370), by the control module (40), a control command to at least one of the verticalization (30) and traveling (20) motors according to the determined position of the at least one electronic handle (200) and the measured applied force value.",True,0.1334043592214584,0.9540927686010736,79,113,-34,338,667,-329
"[가열 플레이트(2)의 제2 표면(A2)의 상부에, 선택적인 설치 플레이트(3)가 배치될 수 있으며, 이는 적절한 열 전도성을 갖는 강철 합금과 같은 적절한 강성 재료로 제조될 수 있다.","On top of the second surface A2 of the heating plate 2, an optional installation plate 3 can be arranged, which can again be made of a suitable rigid material like steel alloy, with suitable heat conductivity.",True,0.1652699112892151,0.9170781756863448,25,37,-12,104,209,-105
"설치 플레이트(3)는 정사각형, 직사각형, 원형 또는 임의의 다른 형상을 가질 수 있다.","Again, the installation plate 3 can have a square, rectangular, round or any other shape.",True,0.245839238166809,0.856266242133572,12,15,-3,49,89,-40
"설치 플레이트(3)는 제3 표면(A3) 및 반대쪽 제4 표면(A4)을 포함하며, 제3 표면(A3)은 가열 플레이트(2)의 제2 표면(A2)과 접촉한다.","The installation plate 3 comprises a third surface A3 and an opposite fourth surface A4, wherein the third surface A3 is in contact with the second surface A2 of the heating plate 2.",True,0.100702129304409,0.949168125495596,16,33,-17,84,182,-98
가열 플레이트(2)의 제1 표면(A1)과 설치 플레이트(3)의 제4 표면(A4)은 서로 반대 편에 있다.,The fourth surface A4 of the installation plate 3 and the first surface A1 of the heating plate 2 are opposite to each other.,True,0.1054310053586959,0.9438319978996478,12,24,-12,58,125,-67
"설치 플레이트(3)는 차례로 바람직하게는 제3 및 제4 표면(A3, A4) 사이에서 균일한 두께를 가지며, 본질적으로 나사 또는 브래킷(도시되지 않음)과 같은 임의의 적절한 장착 수단에 의해 가열 플레이트(2)에 고정될 수 있다.","The installation plate 3 has in turn a preferably uniform thickness between the third and fourth surfaces A3, A4 and can be fixed on the heating plate 2 essentially by means of any suitable mounting means, like screws or brackets (not shown).",True,0.1563615947961807,0.9253249594636638,29,42,-13,128,242,-114
"설치 플레이트(3)는 적어도 하나의 스탬핑 플레이트(4)의 설치를 위해 구성되지만, 물론 도 1에서 점선으로 도시된 바와 같이 다중 스탬핑 플레이트(4)가 동시에 설치 플레이트(3)에 설치될 수도 있다.","The installation plate 3 is configured for the installation of at least one stamping plate 4, but of course also multiple stamping plates 4 can be installed on the installation plate 3 at the same time, as shown in Fig.1 in dashed lines.",True,0.1505439728498459,0.9299239610170392,25,43,-18,113,237,-124
"그러나 설치 플레이트(3)는 선택 사항일 뿐이며, 적어도 하나의 스탬핑 플레이트(4)는 가열 플레이트(2)에 직접 부착될 수도 있다.","However, the installation plate 3 is only optional and the at least one stamping plate 4 could also be directly attached to the heating plate 2.",True,0.1538740694522857,0.9252465225313444,16,26,-10,74,144,-70
"이 경우, 스탬핑 플레이트(4)의 설치를 위한 적절한 고정 요소가 가열 플레이트(2)에 제공된다.","In this case, suitable fastening elements for the installation of the stamping plate 4 are provided on the heating plate 2.",True,0.1245165690779686,0.9337371859747448,12,21,-9,54,123,-69
"따라서, 가열 플레이트(2)는 가열을 위한 가열 플레이트 및 하나 또는 다수의 스탬핑 플레이트(4)의 설치를 위한 설치 플레이트로서의 역할을 한다.","Hence, the heating plate 2 serves as both heating plate for heating and installation plate for installation of the one or multiple stamping plates 4.",True,0.1485230475664138,0.9247527972806638,19,25,-6,82,149,-67
"이하, 본 발명은 하나의 스탬핑 플레이트(4)만을 참조하여 설명될 것이다.]","In the following, the invention will be described with reference to one stamping plate 4 only.",True,0.1348964720964431,0.9155966726032804,9,16,-7,42,94,-52
[적어도 하나의 스탬핑 플레이트(4)가 강철 합금과 같은 적절한 열 전도성을 갖는 강성 재료로 제조될 수 있다.,The at least one stamping plate 4 can again be made of a rigid material with suitable heat conductivity like steel alloy.,True,0.2288050204515457,0.8739273017710614,16,22,-6,62,121,-59
"스탬핑 플레이트(4)는 정사각형, 직사각형, 원형 또는 임의의 다른 형상을 가질 수 있다.","Again, the stamping plate 4 can have a square, rectangular, round or any other shape.",True,0.2318380773067474,0.8720430775481312,12,15,-3,50,85,-35
스탬핑 플레이트(4)는 제5 표면(A5) 및 대향하는 스탬핑 계면 표면(ASI)을 포함한다.,The stamping plate 4 comprises a fifth surface A5 and an opposite stamping interface surface ASI.,True,0.1565638333559036,0.915760417593083,10,16,-6,51,97,-46
"도 1에 도시된 예에 따라 가열 플레이트(2)와 스탬핑 플레이트(4) 사이에 별도의 설치 플레이트(3)가 배치된다고 가정하면, 제5 표면(A5)은 설치 플레이트(3)의 제4 표면(A4)과 접촉한다.","Assuming that a separate installation plate 3 is arranged between the heating plate 2 and the stamping plate 4 according to the example shown in Fig.1, the fifth surface A5 is in contact with the fourth surface A4 of the installation plate 3.",True,0.1522841453552246,0.9277874265619394,22,43,-21,110,242,-132
"그러나, 스탬핑 기계(1)에 별도의 설치 플레이트(3)가 제공되지 않는 경우, 스탬핑 플레이트(4)의 제5 표면(A5)은 가열 플레이트(2)의 제2 표면(A2)에 부착된다.","However, in case where no separate installation plate 3 is provided in the stamping machine 1, the fifth surface A5 of the stamping plate 4 is attached to the second surface A2 of the heating plate 2.",True,0.1417804360389709,0.93140186645753,18,37,-19,96,200,-104
스탬핑 플레이트(4)는 제5 표면(A5)과 스탬핑 계면 표면(ASI) 사이에서 바람직하게 균일한 두께를 차례로 갖는다.,The stamping plate 4 has in turn a preferably uniform thickness between the fifth surface A5 and the stamping interface surface ASI.,True,0.1591522991657257,0.9178489289629812,13,22,-9,66,132,-66
스탬핑 플레이트(4)는 예를 들어 도 1에 도시된 바와 같이 적절한 장착 브래킷(5)에 의해 설치 플레이트(3)에 고정될 수 있다.,"The stamping plate 4 can be fixed on the installation plate 3 e.g. by means of suitable mounting brackets 5, as indicated in Fig.1.",True,0.1310549676418304,0.9378216930984156,18,24,-6,73,131,-58
"설치 플레이트(3) 상의 다른 위치에도 하나 이상의 스탬핑 플레이트(4)를 빠르고 간단하게 설치할 수 있도록 하기 위해, 설치 플레이트(3)는 예를 들어 다수의 오목부를 갖는 벌집 구조를 가질 수 있다.","In order to enable a quick and simple installation of one or more stamping plates 4 also at different positions on the installation plate 3, the installation plate 3 can, for example, have a honeycomb construction with multiple recesses.",True,0.2069342136383056,0.9002026246535354,28,39,-11,113,237,-124
"도 1에 도시된 예시적인 설치 플레이트(3)는 대향 표면(A3, A4)을 연결하고 바람직하게는 벌집형 구조를 달성하기 위해 설치 플레이트(3) 위에 고르게 분포하는 다수의 구멍(6)을 포함한다.]","The exemplary installation plate 3 shown in Fig.1 comprises multiple holes 6, which connect the opposite surfaces A3, A4 and which are preferably evenly spread over the installation plate 3 in order to achieve a honeycomb-like construction.",True,0.1946285665035247,0.8996545672215751,23,37,-14,109,240,-131
[스탬핑 플레이트(4)의 상부에는 스탬핑 기계(1)에 의한 스탬핑 공정을 수행함으로써 포일(9)이 스탬핑될 기판(S)이 배치될 수 있다.,"On top of the stamping plate 4, a substrate S can be arranged, onto which a foil 9 is to be stamped by performing a stamping process by means of the stamping machine 1.",True,0.2067448496818542,0.9018689087451128,15,34,-19,76,168,-92
기판(S) 및 포일(9)에 다양한 재료 조합물을 사용할 수 있다.,A large variety of material-combinations can be used for the substrate S and the foil 9.,True,0.2529850602149963,0.8428152024972448,9,16,-7,36,88,-52
"종이, 판지, 플라스틱, 가죽, 나무 등과 같은 재료를 기판(S)에 사용할 수 있다.","Materials such as paper, cardboard, plastics, leather, wood, etc. can be used for the substrate S. Essentially all metals and plastics, which are suitable for joining with the material of the used substrate S, can be used as material for the foil 9.",False,0.3569166362285614,0.7862057057594057,12,43,-31,47,249,-202
"그러나 금속 포일은 금, 은, 청동, 구리 또는 다른 금속 합금과 같이 주로 사용된다.","However, metal foils are mostly used, e.g. gold, silver, bronze, copper or different metal alloys.",True,0.1552542746067047,0.9033987246552078,14,15,-1,48,98,-50
"기판(S)은 예를 들어 스탬핑 플레이트(4)의 스탬핑 계면 표면(ASI) 상에 느슨하게 배치될 수 있고, 또는 적절한 고정 요소(들)에 의해 고정될 수 있지만, 그것은 기판(S)보다 약간 더 얇은 두께를 가져야 한다.]","The substrate S could, for example, be loosely arranged on the stamping interface surface ASI of the stamping plate 4 or could be fixed by means of any suitable fixing elements(s), which however need(s) to have a slightly smaller thickness than the substrate S.",True,0.1754492372274398,0.9191127050678268,29,44,-15,122,261,-139
[포일(9)은 예를 들어 포일(9)이 감겨 있는 하나 이상의 코일(9A)의 형태로 제공될 수 있다.,"The foil 9 can, for example, be provided in the form of one or more coils 9A onto which the foil 9 is wound up.",True,0.1757383346557617,0.905917566327296,13,25,-12,55,111,-56
"코일(9A)로부터, 포일(9)은 스탬핑 기계의 처리 영역에서, 예를 들어, 하나 이상의 고정 또는 조정 가능한 롤러(12)에 걸쳐 기판(S)에 공급될 수 있다.","From the coil 9A, the foil 9 can be supplied to the substrate S in a processing region of the stamping machine, e.g. over one or more fixed or adjustable rollers 12.",True,0.1767857819795608,0.9128689111695792,20,32,-12,89,165,-76
"간단한 실시예에서, 포일(9)은 예를 들어, 수동으로 포일(9)을 풀고 이동시켜 수동적으로 공급될 수 있다.","In a simple embodiment the foil 9 can by supplied manually, e.g. by manually unwinding and moving the foil 9.",True,0.1630456298589706,0.9035180817714668,13,20,-7,60,109,-49
"그러나 더 높은 생산성을 달성하기 위해서는 포일(9)을 처리 영역으로, 예를 들어 적절한 드라이브로 자동으로 공급하는 것이 유리할 수 있다.","However, to achieve higher productivity it can be advantageous to automatically feed the foil 9 to the processing region, e.g. by a suitable drive.",True,0.1515788733959198,0.9096323628338798,19,24,-5,78,147,-69
"예를 들어, 코일(9A) 및/또는 롤러(12)는 전기 모터(도시되지 않음)에 의해 구동될 수 있다.]","For example, the coil 9A and/or the rollers 12 can be driven by means of an electric motor (not shown).",True,0.100515641272068,0.9444523101142274,12,20,-8,56,103,-47
[핫 포일 스탬핑 기계(1)는 도 1에서 이중 화살표로 나타낸 바와 같이 일반적으로 스탬핑 플레이트(4) 위에 이동 가능하게 배치되는 적어도 하나의 스탬핑 헤드(10)를 더 포함할 수 있다.,"The hot foil stamping machine 1 can further comprise at least one stamping head 10, which is usually movably arranged above the stamping plate 4, as indicated with the double arrow in Fig.1.",True,0.1624122262001037,0.92018952183437,26,33,-7,106,190,-84
"스탬핑 헤드(10)는 적절한 재료, 예를 들어, 스탬핑 플레이트(4), 설치 플레이트(3) 또는 가열 플레이트(2)와 유사한 금속인 적절한 재료로 제조될 수 있다.","The stamping head 10 can be made of a suitable material, e.g. a metal similar to the stamping plate 4, the installation plate 3 or the heating plate 2.",True,0.149463415145874,0.931198078125406,20,29,-9,91,151,-60
"스탬핑 공정을 수행하기 위해, 스탬핑 헤드(10)는 기판(S) 위로 포일(9)을 누르기 위해 기판(S) 쪽으로 이동할 수 있어서, 특정 스탬핑 힘이 포일(9)과 기판(S)에 가해지게 된다.","For performing a stamping process, the stamping head 10 can be moved towards the substrate S in order to press the foil 9 onto the substrate S, whereby a certain stamping force is applied onto the foil 9 and the substrate S. During the stamping process, the substrate S is heated to a certain desired stamping temperature by means of the heat generated by the heating plate 2 and conducted from the heating plate 2 via the installation plate 3 to the stamping plate 4.",False,0.3728430271148681,0.8058449404735724,23,85,-62,105,468,-363
"가열 플레이트(2)에 의해 제공되는 열 및 가압력의 작용을 받아서, 포일(9)이 기판(S)에 도금된다.]","Under the action of the pressing force and the heat provided by the heating plate 2, the foil 9 is plated onto the substrate S.",True,0.2674422264099121,0.8439632228915477,12,25,-13,58,127,-69
"[특정한 처리공정 시간 후, 스탬핑 헤드(10)가 철회되고, 부착된 포일(9)을 포함하는 완성된 기판(S)이 제거될 수 있다.","After a certain processing time, the stamping head 10 is retracted and the finished substrate S including the attached foil 9 can be removed.",True,0.1635813117027282,0.9057071449629724,15,24,-9,70,141,-71
"지정된 조건(기판(S)의 재료 및 모양과 포일(9)의 재료)에 대해, 스탬핑 계면 표면(ASI)의 요구 온도는 알려져 있는 것으로 가정하고, 다음과 같이 스탬핑 플레이트(4)에 대한 계면 표면(ASI)의 원하는 온도(T, Sub[attributes={}; value=[SI_D]], )로 지정 한다.","The required processing temperature of the substrate S of course depends on the material of the foil 9 and the material of the substrate S itself and is usually in the range between 100°C and 300°C. For given conditions (material and shape of the substrate S as well as the material of the foil 9), the required temperature of the stamping interface surface ASI is assumed to be known and is in the following designated as desired temperature TSI_D of the interface surface ASI of the stamping plate 4.",False,0.3161436915397644,0.8333366706166184,31,89,-58,167,502,-335
"스탬핑 플레이트(4)로부터 포일(9)이 스탬핑된 완성된 기판(S)의 제거를 용이하게 하기 위해, 분사 노즐(18)이 스탬핑 기계(1), 예를 들어 설치 플레이트(3)의 외부 모서리에 선택적으로 제공될 수 있다.","In order to facilitate the removal of the finished substrate S with the foil 9 stamped thereon from the stamping plate 4, blowing nozzles 18 can optionally be provided in the stamping machine 1, for example, on the outer edge of the installation plate 3.",True,0.1846849173307418,0.9137405534337444,24,45,-21,117,254,-137
"분사 노즐(18)에 의해, 압축 공기가 기판(S)에 공급될 수 있다.","By means of the blowing nozzles 18 pressurized air can be supplied to the substrate S, e.g. preferably between the substrate S and the stamping interface surface ASI.",False,0.4936307370662689,0.7156052623612617,9,28,-19,38,166,-128
"[로고, 텍스트 등과 같이 기판(S)에 스탬핑된 포일(9)의 특정 패턴을 달성하기 위해, 스탬핑 헤드(10)의 표면(기판(S)을 향함)도 각각의 방식으로 성형될 수 있다.","In order to achieve specific patterns of the foil 9 stamped on the substrate S, like logos, texts, etc., the surface of the stamping head 10 (facing the substrate S) can also be shaped in a respective fashion.",True,0.1481383740901947,0.9266909467643926,20,38,-18,95,209,-114
"패턴을 유연하게 변경하기 위해, 다른 패턴의 교체 가능한 인서트가 제공될 수 있다.","In order to change the pattern flexibly, interchangeable inserts with different patterns could be provided.",True,0.1805537790060043,0.878287072439782,12,15,-3,46,107,-61
"간단한 구현예에서, 스탬핑 헤드(10)는 예를 들어 수동으로 예를 들면 레버(도시되지 않음)를 통해 작동될 수 있다..","In a simple implementation, the stamping head 10 can, for example, be manually operable, e.g. by means of a lever (not shown).",True,0.104466326534748,0.9389475140024046,15,22,-7,66,126,-60
"그러나, 더 높은 생산성과 더 나은 스탬핑 품질을 달성하기 위해, 스탬핑 헤드가 예를 들어, (전기)-기계적으로 또는 (전기)-유압적으로 적절한 드라이브(11)에 의해 자동으로 작동되는 것이 유리할 수 있다.","However, to achieve higher productivity and better stamping quality it can be advantageous that the stamping head is operated automatically by a suitable drive 11, e.g. (electro)-mechanically or (electro)-hydraulically.",True,0.1528659760951995,0.9133109593409772,26,29,-3,116,219,-103
"따라서 일관된 공정처리 속도(기본적으로 프레스 동작의 지속 시간에 대응 함)와 일관된 스탬핑력에 도달할 수 있으며, 이는 일정한 스탬핑 품질로 이어진다.]","Thus, a consistent processing speed (which essentially corresponds to the duration of the pressing action) and a consistent stamping force can be reached, which lead to constant stamping quality.",True,0.0947191193699836,0.9405793207904292,20,29,-9,86,195,-109
"[핫 포일 스탬핑 기계(1)를 제어하기 위해, 적어도 하나의 제어 유닛(8)이 예를 들어 적절한 마이크로프로세서 기반 하드웨어 및/또는 소프트웨어의 형태로 핫 포일 스탬핑 기계(1)에 제공된다.","For controlling the hot foil stamping machine 1, at least one control unit 8 is provided in the hot foil stamping machine 1, e.g. in the form of a suitable microprocessor-based hardware and/or software.",True,0.1578341722488403,0.9143651895973772,24,34,-10,108,202,-94
"제어 유닛(8)은 또한, 예를 들어 PLC(Programmable Logic Controller), FPGA(Field Programmable Gate Array), ASIC(application-specific integrated circuit), 아날로그 컴퓨터 또는 아날로그 회로를 포함할 수도 있다.","The control unit 8 can, for example, also comprise a Programmable Logic Controller (PLC), a Field Programmable Gate Array (FPGA), an application-specific integrated circuit (ASIC), an analogue computer, or an analogue circuit.",True,0.070425808429718,0.9598006359870538,23,32,-9,171,226,-55
"제어 유닛(8)으로, 적어도 가열 플레이트(2), 특히 하나 이상의 가열 장치(7)가 제어될 수 있다.","With the control unit 8, at least the heating plate 2, in particular the one or more heating devices 7, can be controlled.",True,0.0939493030309677,0.9468747183146918,13,23,-10,57,122,-65
"스탬핑 헤드(10)가 자동으로 예를 들어 드라이브(11)에 의해 구동되는 경우 및/또는 포일(9)이 예를 들어 롤러(12)의 드라이브에 의해 자동으로 공급되는 경우, 제어 유닛(8)이 또한 도 1의 연결 라인으로 표시된 바와 같이 드라이브(11) 및/또는 롤러(12)의 드라이브를 제어하는데 사용될 수도 있다.","If the stamping head 10 is automatically driven, e.g. by a drive 11 and/or the foil 9 is automatically supplied, e.g. by a drive of a roller 12, the control unit 8 can also be used for controlling the drive 11 and/or the drive of a roller 12, as is indicated by the connection lines in Fig. 1.",True,0.1257737874984741,0.9340393027120812,37,58,-21,173,293,-120
"서버로부터 복수의 수업차량의 훈련상황을 취득하기 위한 통신모듈; 상기 복수의 수업차량의 훈련상황을 디스플레이하기 위한 디스플레이모듈; 훈련현장내의 코치의 지시에 따라 운전 트레이닝을 위한 제어명령을 생성하기 위한 제어모듈;을 포함하되, 상기 통신모듈은 상기 제어명령을 대응되는 수업차량의 차량용 단말에 발송하기 위한 것으로도 사용되는, 운전 트레이닝을 보조하기 위한 모바일기기.","A mobile device for assisting driving training, comprising: a communication module (101, 201) configured for acquiring training situations of a plurality of teaching vehicles from a server; a display module (102, 202) configured for displaying the training situations of the plurality of teaching vehicles; and a control module (103, 203) configured for generating a control command for driving training according to an instruction of a trainer in a training site, wherein the communication module (101, 201) is further configured for sending the control command to a vehicle-mounted terminal of a corresponding teaching vehicle.",True,0.3967475593090057,0.8502524916502473,43,93,-50,211,629,-418
"제1항에 있어서,상기 제어모듈은,훈련현장내의 코치의 브레이크 지시에 따라 대응되는 수업차량을 제어하여 정차하도록 하기 위한 브레이크명령을 형성하기 위한 브레이크 제어유닛을 포함하는, 운전 트레이닝을 보조하기 위한 모바일기기.","The mobile device of claim 1, wherein the control module (203) comprises: a brake control unit (2031) configured for generating a brake command for controlling the corresponding teaching vehicle to stop, according to a brake instruction of the trainer in the training site.",True,0.4138799905776977,0.8194487935948603,24,43,-19,125,273,-148
"제1항에 있어서,상기 통신모듈은 상기 서버로부터 상기 복수의 수업차량의 차량정보를 획득하기 위한 것으로도 사용되고, 상기 디스플레이모듈은 상기 복수의 수업차량의 차량정보를 디스플레이 하기 위한 것으로도 사용되는, 운전 트레이닝을 보조하기 위한 모바일기기.","The mobile device of claim 1 or 2, wherein the communication module (101, 201) is further configured for acquiring vehicle information of the plurality of teaching vehicles from the server; and the display module (102, 202) is further configured for displaying the vehicle information of the plurality of teaching vehicles, optionally, wherein the vehicle information comprises at least one of a real-time location of a vehicle or whether the vehicle is abnormal.",False,0.6593939065933228,0.7345255344322862,29,72,-43,142,463,-321
"제1항에 있어서, 상기 통신모듈은,상기 복수의 수업차량의 차량용 단말중의 어느 하나와 음성 또는 영상통신하거나, 또는 상기 복수의 수업차량의 차량용 단말중의 적어도 2개와 그룹 음성 또는 영상통신하기 위한 것으로도 사용되는, 운전 트레이닝을 보조하기 위한 모바일기기.","The mobile device of any one of claims 1 to 3, wherein the communication module (101, 201) is further configured for at least one of: performing voice or video communication with any one of vehicle-mounted terminals of the plurality of teaching vehicles, or performing group voice or video communication with at least two of the vehicle-mounted terminals of the plurality of teaching vehicles, and communicating with a control end of a central control room through the server, and synchronizing data.",False,0.5351830124855042,0.7881699422770154,33,80,-47,149,500,-351
"제1항에 있어서,수강자의 수업시간 정보, 훈련과정 정보, 심사평가정보 및 수업일기 정보중의 적어도 하나를 기록하기 위한 기록모듈을 더 포함하는, 운전 트레이닝을 보조하기 위한 모바일기기.","The mobile device of any one of claims 1 to 4, further comprising at least one of: a recording module configured for recording at least one of study time information, training process information, assessment information, or teaching log information of a learner, and a playing module configured for performing a historical playback operation on the training situations of the plurality of teaching vehicles.",False,0.3989886045455932,0.8333397498293654,22,63,-41,104,407,-303
"제1항 내지 제8항 중 어느 한항에 있어서,상기 통신모듈은 4G, 5G 또는wifi 방식에 의해 서버 및 복수의 수업차량의 차량용 단말과 통신하는, 운전 트레이닝을 보조하기 위한 모바일기기.","The mobile device of any one of claims 1 to 5, wherein the communication module communicates with the server and the vehicle-mounted terminals of the plurality of teaching vehicles through 4G, 5G or WiFi.",True,0.2927041947841644,0.8638179108745535,25,34,-9,106,204,-98
"모바일기기에 적용되는 방법에 있어서,서버로부터 복수의 수업차량의 훈련상황을 취득하는 단계;상기 복수의 수업차량의 훈련상황을 디스플레이하는 단계;훈련현장내의 코치의 지시에 따라 운전 트레이닝을 위한 제어명령을 생성하는 단계; 및 상기 제어명령을 대응되는 수업차량의 차량용 단말로 발송하는 단계를 포함하는 운전 트레이닝을 보조하기 위한 방법.","A method for assisting driving training, wherein the method is applied to a mobile device, and comprises: acquiring (S701) training situations of a plurality of teaching vehicles from a server; displaying (S702) the training situations of the plurality of teaching vehicles; generating (S703) a control command for driving training according to an instruction of a trainer in a training site; and sending (S704) the control command to a vehicle-mounted terminal of a corresponding teaching vehicle.",True,0.4040847420692444,0.8442692847373425,38,75,-37,189,498,-309
"제10항에 있어서,상기 훈련현장내의 코치의 지시에 따라 운전 트레이닝을 위한 제어명령을 생성하는 단계는,훈련현장내의 코치의 브레이크 지시에 따라 대응되는 수업차량을 제어하여 정차하도록 하기 위한 브레이크명령을 생성하는 단계를 포함하는, 운전 트레이닝을 보조하기 위한 방법.","The method of claim 7, wherein the generating (S703) the control command for driving training according to the instruction of the trainer in the training site, comprises: generating a brake command for controlling the corresponding teaching vehicle to stop, according to a brake instruction of the trainer in the training site.",True,0.3951362371444702,0.8234299628524088,31,51,-20,152,327,-175
"제10항에 있어서,상기 서버로 부터 상기 복수의 수업차량의 차량정보를 취득하고, 상기 복수의 수업차량의 차량정보를 디스플레이하는 단계를 더 포함하는, 운전 트레이닝을 보조하기 위한 방법.","The method of claim 7 or 8, further comprising: acquiring vehicle information of the plurality of teaching vehicles from the server, and displaying the vehicle information of the plurality of teaching vehicles, optionally, wherein the vehicle information comprises at least one of a real-time location of a vehicle or whether the vehicle is abnormal.",False,0.6856350898742676,0.7071486365625175,22,54,-32,104,350,-246
"제10항에 있어서,복수의 수업차량의 차량용 단말중의 어느 하나와 음성 또는 영상통신하거나, 또는 복수의 수업차량의 차량용 단말중의 적어도 2개와 그룹 음성 또는 영상통신하는 단계를 더 포함하는, 운전 트레이닝을 보조하기 위한 방법.","The method of any one of claims 7 to 9, further comprising at least one of: performing voice or video communication with any one of vehicle-mounted terminals of the plurality of teaching vehicles, or performing group voice or video communication with at least two of the vehicle-mounted terminals of the plurality of teaching vehicles, and communicating with a control end of a central control room through the server, and synchronizing data.",False,0.5256170034408569,0.7865505873093935,29,71,-42,129,442,-313
"제10항에 있어서,수강자의 수업시간 정보, 훈련과정 정보, 심사평가정보 및 수업일기 정보중의 적어도 하나를 기록하는 단계를 더 포함하는, 운전 트레이닝을 보조하기 위한 방법.","The method of any one of claims 7 to 10, further comprising at least one of: recording at least one of study time information, training process information, assessment information, or teaching log information of a learner, and performing a historical playback operation on the training situations of the plurality of teaching vehicles.",False,0.3966917693614959,0.8236325788909865,21,52,-31,97,335,-238
"제10항 내지 제17항 중 어느 한 항에 있어서,상기 서버 및 상기 복수의 수업차량의 차량용 단말과 통신하는 방식은 4G, 5G 또는 wifi 방식을 포함하는, 운전 트레이닝을 보조하기 위한 방법.","The method of any one of claims 7 to 11, wherein a way of communicating with the server and the vehicle-mounted terminals of the plurality of teaching vehicles comprises 4G, 5G or WiFi.",True,0.2294739782810211,0.8922329273846209,28,33,-5,110,185,-75
"적어도 하나의 프로세서; 및상기 적어도 하나의 프로세서와 통신적으로 연결되는 메모리를 포함하며, 상기 메모리에는 상기 적어도 하나의 프로세서에 의해 실행 가능한 명령이 저장되어 있고, 상기 명령은 상기 적어도 하나의 프로세서에 의해 실행되어 제10항 내지 제17항 중 어느 한 항의 방법을 수행하도록 하는 전자 기기.","An electronic device, comprising: at least one processor; and a memory communicatively connected with the at least one processor, wherein the memory stores instructions executable by the at least one processor, and the instructions, when executed by the at least one processor, enable the at least one processor to perform the method of any one of claims 7 to 12.",True,0.1808024942874908,0.92210604288945,43,60,-17,177,363,-186
"컴퓨터 명령이 저장된 비일시적 컴퓨터 판독 가능 저장 매체로서,상기 컴퓨터 명령은 컴퓨터가 제10항 내지 제17항 중 어느 한 항의 방법을 수행하도록 하는 저장 매체.","A non-transitory computer-readable storage medium storing computer instructions, wherein the computer instructions, when executed by a computer, cause the computer to perform the method of any one of claims 7 to 12.",True,0.3257224857807159,0.8283636294679578,24,32,-8,93,215,-122
"컴퓨터 판독 가능 저장 매체에 저장된 컴퓨터 프로그램으로서,컴퓨터 프로그램 중의 명령이 프로세서에 의해 실행될 경우, 제10항 내지 제17항 중 어느 한 항의 방법을 구현하는 컴퓨터 판독 가능 저장 매체에 저장된 컴퓨터 프로그램.","A computer program product comprising a computer program, wherein the computer program, when executed by a processor, implements the method of any one of claims 7 to 12.",True,0.3809740245342254,0.7955156933450245,32,28,4,128,169,-41
"상기 정제공정은 당해 기술 분야에 공지된 적합한 방법을 이용하여, 회수된 L-이소류신을 정제할 수 있다.",The purification process may be performed to purify the recovered L-isoleucine by using an appropriate -21method known in the art.,True,0.25121009349823,0.8280440201667849,14,20,-6,58,130,-72
"본 출원의 다른 하나의 양태는 서열번호 1의 아미노산 서열에서 136번 아미노산이 다른 아미노산으로 치환된, 아세토하이드록시산 신타제 활성을 갖는 단백질 변이체가 발현되도록 미생물을 변형하는 것을 포함하는, L-이소류신 생산능을 증가시키는 방법을 제공한다.","Still another aspect of the present disclosure provides a method of increasing L isoleucine productivity, the method including modifying a microorganism to express the protein variant having acetohydroxy acid synthase activity, wherein the amino acid at position 136 in the amino acid sequence of SEQ ID NO: 1 is substituted with another amino acid.",True,0.1516269594430923,0.9152710331294024,30,54,-24,143,349,-206
본 출원의 다른 하나의 양태는 상기 단백질 변이체의 L-이소류신 생산능 증가 용도를 제공한다.,Still another aspect of the present disclosure provides use of the protein variant for increasing L-isoleucine productivity.,True,0.2395947128534317,0.8423945220409467,13,17,-4,52,124,-72
"상기 단백질 변이체, 다른 아미노산에 관해서는 전술한 바와 같다.",The protein variant and another amino acid are the same as described above.,True,0.2713051438331604,0.786788823572016,9,13,-4,36,75,-39
"본 출원의 아세토하이드록시산 신타제 변이체를 포함하는 미생물을 배양하는 경우, 고수율의 L-이소류신 생산이 가능하다.","[Advantageous Effects] When a microorganism including the acetohydroxy acid synthase variant of the present disclosure is cultured, it is possible to produce L-isoleucine in a high yield.",True,0.2716604471206665,0.8307975712546399,13,27,-14,65,187,-122
"이에, 산업적인 면에서 생산의 편의성 및 제조원가 절감의 효과를 기대할 수 있다.","Accordingly, from an industrial point of view, it is possible to expect the effects of production convenience and reduction of production costs.",True,0.121282123029232,0.9065915601778424,12,22,-10,45,144,-99
이하 본 출원을 실시예에 의해 보다 상세하게 설명한다.,"[DETAILED DESCRIPTION OF THE INVENTION] Hereinafter, the present disclosure will be described in more detail with reference to the following Examples.",True,0.3029932975769043,0.7783688246800339,8,21,-13,30,150,-120
"그러나 이들 실시예는 본 출원을 예시적으로 설명하기 위한 것으로, 본 출원의 범위가 이들 실시예에 의해 제한되는 것은 아니다.","However, these Examples are for illustrative purposes only, and the scope of the present disclosure is not intended to be limited by these Examples.",True,0.1789625287055969,0.8631679946252474,18,24,-6,70,148,-78
실시예 1. 인공변이법을 통한 무작위 돌연변이주 선별,Example 1.,False,0.710178792476654,0.4724063140296003,7,2,5,29,10,19
본 실시예에서는 L-이소류신의 생산능이 향상된 미생물 변이주를 얻기 위해 하기와 같은 방법을 사용하여 미생물의 변이를 유도하였다.,"Selection of Random Mutant Strains by Artificial Mutagenesis In this Example, in order to obtain a microorganism mutant strain having an enhanced ability to produce L-isoleucine, a mutation in a microorganism was induced in the following manner.",False,0.3525267541408539,0.7955580131818366,16,37,-21,72,245,-173
"먼저 야생형 코리네박테리움 글루타미쿰 ATCC 13032 균주에 이소류신 생합성에서 중요한 효소로 작용하는 L-threonine dehydratase(ilvA)의 피드백 저해(feedback inhibition) 해소를 위한 ilvA(F383A) 변이를 도입하기 위해 서열번호 72, 서열번호 73 서열번호 74, 및 서열번호 75의 프라이머를 제작하였다.","First, in order to introduce, into a wild-type Corynebacterium glutamicum ATCC 13032 strain, ilvA(F383A) mutation for releasing feedback inhibition of L-threonine -22dehydratase (ilvA), which functions as an important enzyme in the biosynthesis of isoleucine, primers of SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 74, and SEQ ID NO: 75 were prepared.",True,0.1282816231250763,0.9239812630203592,34,55,-21,199,348,-149
코리네박테리움 글루타미쿰(Corynebacterium glutamicum) ATCC 13032의 게놈 DNA를 주형으로 서열번호 72와 73 및 서열번호 74와 서열번호 75의 프라이머를 이용하여 PCR을 수행하였다.,"PCR was carried out using a genomic DNA of Corynebacterium glutamicum ATCC 13032 as a template and primers of SEQ ID NOS: 72 and 73 and SEQ ID NO: 74, and SEQ ID NO: 75.",True,0.0987700000405311,0.9402543800654146,20,35,-15,121,169,-48
"PfuUltraTM 고-신뢰 DNA 폴리머라제(Stratagene)를 사용하여 PCR 하였으며, PCR 조건은 변성 95℃ 30초; 어닐링 55℃ 30초; 및 중합반응 72℃ 1분을 25회 반복하였다.","PCR was carried out using PfuUltra TM high-fidelity DNA polymerase (Stratagene), and PCR conditions were as follows: 25 cycles of denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization at 72°C for 1 minute.",True,0.1457536220550537,0.917356479516683,21,39,-18,112,241,-129
"그 결과, 1000bp의 ilvA 유전자 상단부위와 1000bp ilvA 유전자 하단부위의 유전자 단편을 각각 획득하였고, QIAGEN사의 PCR Purification kit를 사용하여 각 증폭산물을 정제하여 벡터 제작을 위한 삽입 DNA 단편으로 사용하였다.","As a result, a 1,000 bp DNA fragment of the upstream region of ilvA gene, and a 1,000 bp DNA fragment of the downstream region of ilvA gene were obtained, and each amplification product was purified using a PCR purification kit of QIAGEN, and used as an insert DNA fragment for vector construction.",True,0.1362519115209579,0.9258471354610228,29,53,-24,146,298,-152
제한효소 smaI으로 처리한 후 65℃에서 20분간 열처리한 pDZ(대한민국 등록 특허 번호 제0924065호) 벡터와 DNA 단편들을 몰농도 (M) 1:2가 되도록 하여 다카라(TaKaRa)의 Infusion Cloning Kit를 사용하여 제공된 매뉴얼에 따라 클로닝함으로써 F383A 변이를 염색체상에 도입하기 위한 벡터 pDZ-F383A를 제작하였다.,"After treatment with a restriction enzyme smaI, a pDZ vector (Korean Patent No. 0924065) which was heat-treated at 65°C for 20 minutes and the DNA fragments were cloned at a molar concentration (M) of 1:2 using an Infusion Cloning Kit (TaKaRa) according to the manual provided, thereby constructing a pDZ-F383A vector for introducing an F383A mutation on the chromosome.",True,0.1355389654636383,0.9202573330255808,37,59,-22,200,370,-170
"제작된 벡터를 전기천공법에 의해 코리네박테리움 글루타미쿰 ATCC 13032 에 형질전환하고, 2차 교차 과정을 거쳐 염색체 상에서 각각 변이형 염기로 치환되어 있는 균주를 얻었다.",The constructed vector was transformed into Corynebacterium glutamicum ATCC 13032 by electroporation.,False,0.3364764750003814,0.7800386276784819,23,12,11,101,101,0
"적절한 치환 여부는 하기의 프라이머 조합을 사용하여 MASA(Mutant Allele Specific Amplification) PCR 기법(Takeda et al., Hum. Mutation, 2, 112-117 (1993))을 사용하여 변이형 서열에 부합하는 프라이머 조합(서열번호 68 및 서열번호 76)에서는 증폭되는 균주를 선별함으로써 1차 결정하였으며, 선별된 균주의 ilvA 서열분석은 서열번호 77 및 서열번호 78의 프라이머 조합을 이용하여 변이형 서열 분석함으로써 2차 확인하였다.","Mutation, 2, 112-117 (1993)) by selecting a strain which was amplified by a primer combination (SEQ ID NO: 68 and SEQ ID NO: 76) corresponding to the mutated sequence, and the ilvA sequence of the selected strain was analyzed using a primer combination of SEQ ID NO: 77 and SEQ ID NO: 78 to secondarily confirm the mutated sequence.",False,0.2672108113765699,0.8452904492226123,52,59,-7,279,332,-53
"다음으로 상기 ilvA(F383A) 변이가 도입된 균주에 hom(R407H)(한국등록특허 10-1996769호) 변이가 추가적으로 도입된 균주를 제작하기 위하여 서열번호 64, 서열번호 서열번호 65, 서열번호 66 및 서열번호 67의 프라이머를 제작하였다.","Next, in order to prepare a strain in which hom(R407H) (Korean Patent No. 10 1996769) mutation was additionally introduced into the ilvA(F383A) mutant-introduced - 23strain, primers of SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, and SEQ ID NO: 67 were prepared.",True,0.1543791592121124,0.9050876744535792,26,46,-20,144,262,-118
코리네박테리움 글루타미쿰(Corynebacterium glutamicum) ATCC 13032로부터 추출한 게놈 DNA를 주형으로 서열번호 64 와 서열번호 65 및 서열번호 66 및 서열번호 67의 프라이머를 사용하여 PCR을 수행하였다.,"PCR was carried out using genomic DNA extracted from Corynebacterium glutamicum ATCC 13032 as a template and primers of SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, and SEQ ID NO: 67.",True,0.1102289408445358,0.9350953623022844,24,36,-12,134,183,-49
"PfuUltraTM 고-신뢰 DNA 폴리머라제(Stratagene)를 사용하여 PCR 하였으며, PCR 조건은 변성 95℃ 30초; 어닐링 55℃ 30초; 및 중합반응 72℃ 1분을 25회 반복하였다.","PCR was carried out using PfuUltra TM high fidelity DNA polymerase (Stratagene), and PCR conditions were as follows: 25 cycles of denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization at 72°C for 1 minute.",True,0.1472466439008712,0.9164527948146378,21,40,-19,112,241,-129
"그 결과, 1000bp의 hom 유전자 상단부위와 1000bp hom 유전자 하단부위의 유전자 단편을 각각 획득하였다.","As a result, a 1,000 bp DNA fragment of the upstream region of hom gene, and a 1,000 bp DNA fragment of the downstream region of hom gene were obtained, and each amplification product was purified using a PCR purification kit of QIAGEN, and used as an insert DNA fragment for vector construction.",True,0.5268222689628601,0.6830388744193227,14,53,-39,66,296,-230
"한편 제한효소 smaI으로 처리한 후, 65℃에서 20분간 열처리한 pDZ(대한민국 등록 특허 번호 제0924065호) 벡터와 상기 PCR을 통하여 증폭한 삽입 DNA 단편의 몰농도(M) 비율이 1:2가 되도록 하여 다카라(TaKaRa)의 Infusion Cloning Kit를 사용하여 제공된 매뉴얼에 따라 클로닝함으로써 R407H 변이를 염색체상에 도입하기 위한 벡터 pDZ-R407H를 제작하였다.","Meanwhile, after treatment with a restriction enzyme smaI, a pDZ vector (Korean Patent No. 0924065) which was heat-treated at 65°C for 20 minutes and the insert DNA fragment amplified by PCR were cloned at a molar concentration (M) of 1:2 using an Infusion Cloning Kit (TaKaRa) according to the manual provided, thereby constructing a pDZ-R407H vector for introducing an R407H mutation on the chromosome.",False,0.1267880052328109,0.928568824529762,43,64,-21,225,404,-179
"제작된 벡터를 전기천공법에 의해 코리네박테리움 글루타미쿰 ATCC 13032 ilvA(F383A)에 형질전환하고, 2차 교차 과정을 거쳐 염색체 상에서 각각 변이형 염기로 치환되어 있는 균주를 얻었다.",The constructed vector was transformed into Corynebacterium glutamicum ATCC 13032 ilvA(F383A) by electroporation.,False,0.3228259086608886,0.7906677629843821,23,13,10,112,113,-1
"적절한 치환 여부는 하기의 프라이머 조합을 사용하여 MASA(Mutant Allele Specific Amplification) PCR 기법(Takeda et al., Hum. Mutation, 2, 112-117 (1993))을 사용하여 변이형 서열에 부합하는 프라이머 조합(서열번호 68 및 서열번호 69)에서는 증폭되는 균주를 선별함으로써 1차 결정하였으며, 선별된 균주의 hom 서열분석은 서열번호 70 및 서열번호 71의 프라이머 조합을 이용하여 변이형 서열 분석함으로써 2차 확인하였다.","Mutation, 2, 112-117 (1993)) by selecting a strain which was amplified by a primer combination (SEQ ID NO: 68 and SEQ ID NO: 69) corresponding to the mutated sequence, and the hom sequence of the selected strain was analyzed using a primer combination of SEQ ID NO: 70 and SEQ ID NO: 71 to secondarily confirm the mutated sequence.",False,0.2996538877487182,0.8228313472707623,52,59,-7,278,331,-53
"구체적으로, 모균주인 코리네박테리움 글루타미쿰 ATCC 13032 hom(R407H) ilvA(F383A)를 활성화 배지에서 16시간 동안 배양하여 활성화된 균주를 121℃에서 15분간 멸균한 종배지에 접종하여 14시간 동안 배양한 후, 배양액 5 ㎖을 회수하였다.","Specifically, Corynebacterium glutamicum ATCC 13032 hom(R407H) ilvA(F383A), which is a parent strain, was cultured in an activation medium for 16 hours, - 24and the activated strain was inoculated into a seed medium, which was sterilized at 121°C for 15 minutes, and cultured for 14 hours, and 5 mL of the culture was recovered.",True,0.1636430621147155,0.9024723057645412,28,53,-25,148,328,-180
"회수한 배양액을 100 mM 시트르산 완충용액 (citric buffer)으로 세척한 후, NTG (N-Methyl-N'-nitro-N-nitrosoguanidine)를 최종농도 200 mg/ℓ가 되게 첨가한 후, 20분 동안 처리하고, 100 mM 인산 완충용액 (phosphate buffer)으로 세척하였다.","The recovered culture was washed with 100 mM citric acid buffer, and N-methyl-N'-nitro-N nitrosoguanidine (NTG) was added thereto to a final concentration of 200 mg/L and treated for 20 minutes, and washed with 100 mM phosphate buffer.",True,0.1003425940871238,0.941191672064908,28,37,-9,175,235,-60
"NTG가 처리된 균주를 최소배지에 도말하여 사멸율을 구해본 결과 사멸율은 85%였으며 생존한 세포들을 종배지에 접종 배양, 최종적으로 우수한 이소류신 생산능을 나타내는 변이주를 선별하여 코리네박테리움 글루타미쿰 CJILE-42 (Corynebacterium glutamicum, CJILE-42)로 명명하였다.","The strain treated with NTG was plated on a minimal medium and the death rate was calculated, and as a result, the death rate was 85%.",False,0.5311898589134216,0.6615776372209872,29,26,3,173,134,39
<활성화배지>,"The surviving cells were inoculated and cultured in the seed medium, and finally, a mutant strain showing an excellent ability to produce isoleucine was selected and designated as Corynebacterium glutamicum CJILE-42 (CJILE-42).",False,1.0703961849212646,0.1921755034782867,1,32,-31,7,227,-220
"소고기 추출물 1%, 폴리펩톤 1%, 소듐클로라이드 0.5%, 효모추출물 1%, 한천 2%, pH 7.2","Compositions of the media used in Example 1 are as follows: <Activation medium> Beef Extract 1%, Polypeptone 1%, Sodium Chloride 0.5%, Yeast Extract 1%, Agar 2%, pH 7.2 <Seed medium> Glucose 5%, Bactopeptone 1%, Sodium Chloride 0.25%, Yeast Extract 1%, Urea 0.4%, pH 7.2 <Minimal Medium> Glucose 1.0%, Ammonium Sulfate 0.",False,0.362538069486618,0.763540403060863,13,51,-38,58,321,-263
"포도당 1.0%, 황산암모늄 0.4%, 황산마그네슘 0.04%, 인산제1칼륨 0.1%, 요소 0.1%, 티아민 0.001%, 비오틴 200 ㎍/L, 한천 2%, pH 7.2","4 %, Magnesium Sulfate 0.",False,0.6556974649429321,0.5133553945501211,19,5,14,96,25,71
상기 실시예 1에서 얻어진 변이주인 코리네박테리움 글루타미쿰 CJILE-42의 L-이소류신 생산성을 확인하기 위해 하기와 같은 방법으로 배양하였다.,"04 %, Monopotassium Phosphate 0.1%, Urea 0.1%, Thiamine 0.001%, Biotin 200 pg/L, Agar 2%, pH 7.2 Example 2: Examination of L-Isoleucine Productivity of Random Mutant Strain Producing L-Isoleucine To examine L-isoleucine productivity of Corynebacterium glutamicum CJILE-42, which is the mutant strain obtained in Example 1, the strain was cultured by the following method.",False,0.4866873919963836,0.7163480233174763,16,53,-37,82,371,-289
"생산배지 25㎖을 함유하는 250㎖ 코너-바풀 플라스크에 모균주 및 상기 변이주를 접종한 후, 32℃에서 60시간동안 200rpm으로 진탕 배양하여 L-이소류신을 제조하였다.",The parent strain and the mutant strain were each inoculated into 250 mL -25comer-baffle flasks containing 25 mL of a production medium and cultured in a shaking incubator at 200 rpm at 32°C for 60 hours to produce L-isoleucine.,True,0.2204635739326477,0.8664572359119964,19,39,-20,97,228,-131
"포도당 10%, 효모추출물 0.2%, 황산암모늄 1.6%, 제1인산칼륨 0.1%, 황산마그네슘7수염 0.1%, 황산철7수염 10mg/ℓ, 황산망간1수염 10 mg/ℓ, 비오틴 200 ㎍/ℓ, pH 7.2","A composition of the production medium used in Example 2 is as follows: <Production medium> Glucose 10%, Yeast Extract 0.2%, Ammonium Sulfate 1.6%, Monopotassium Phosphate 0.1%, Magnesium Sulfate Heptahydrate 0.1%, Ferrous Sulfate Heptahydrate mg/L, Manganese Sulfate Monohydrate 10 mg/L, Biotin 200 pg/L, pH 7.2 After completing the culture, the amount of L-isoleucine produced was measured using high-performance liquid chromatography(HPLC), and the L-isoleucine concentration in the culture medium for each strain was shown in Table 1 below.",False,0.4764034450054168,0.7073169314255285,20,76,-56,113,544,-431
"배양종료 후, 액체고속크로마토그래피(HPLC)를 이용하여 L-이소류신의 생산량을 측정하였고, 실험한 각 균주에 대한 배양액 중의 L-이소류신 농도는 하기 표 1에 나타내었다.","[Table 1] Comparison of L-isoleucine productivity between parent strain and CJILE-42 Corynebacterium glutamicum Corynebacteriumglutamicum A TCC 13032 hom(R407H) CJILE-42 (mutant strain) ilvA(F383A) (parent strain) L-Isoleucine concentration 0.2 1.8 (g/L) As a result, as shown in Table 1, the parent strain Corynebacterium glutamicum ATCC 13032 hom(R407H) ilvA(F383A) produced L-isoleucine at a concentration of 0.2 g/L, whereas Corynebacterium glutamicum CJILE-42, which is the mutant strain according to the present disclosure, produced L-isoleucine at a concentration of 1.8 g/L, indicating an about 9-fold or more increase in the L-isoleucine productivity as compared - 26with the parent strain.",False,0.8434710502624512,0.5057403632814041,19,94,-75,97,699,-602
"그 결과, 상기 표 1에 나타난 바와 같이, 모균주인 코리네박테리움 글루타미쿰 ATCC 13032 hom(R407H) ilvA(F383A)은 0.2g/ℓ의 농도로 L-이소류신을 생산하였으나, 본 출원에 따른 변이주 코리네박테리움 글루타미쿰 CJILE-42은 1.8g/ℓ의 농도로 L-이소류신을 생산하여, 모균주에 비해 약 9배 이상 L-이소류신 생산성이 증가한 것을 확인하였다.","Based on the result above, genomic sequencing of the genes in the synthesis pathway of L-isoleucine from L-threonine was performed.",False,0.907532274723053,0.4659746173783169,40,20,20,211,131,80
"상기의 결과를 바탕으로 L-쓰레오닌으로부터 L-이소류신이 합성되는 경로에 있는 유전자를 게놈 시퀀싱 한 결과, 아세토하이드록시산 신타제 (acetohydroxy acid synthase, AHAS) 활성을 나타내는 ilvBN의 ilvB 유전자에서 무작위 변위가 확인되었으며, 변이형 ilvB 유전자를 서열번호 2로 나타내었다.","As a result, random mutation was observed in ilvB gene of ilvBN exhibiting acetohydroxy acid synthase (AHAS) activity, and this mutant ilvB gene was represented by SEQ ID NO: 2.",False,0.2593260109424591,0.8580438938677085,33,30,3,182,177,5
"상기의 결과로 무작위 돌연변이법을 통해 얻어진 변이주가 결과적으로 피드백 저해를 받지 않으며, L-이소류신을 고효율 및 고수율로 생산 할 수 있음을 확인하였다.","From the result above, it was confirmed that the mutant strain obtained by random mutagenesis is able to produce L-isoleucine with high efficiency and high yield without feedback inhibition.",True,0.210114985704422,0.8660422454837349,21,29,-8,89,190,-101
"아세토하이드록시산 신타제 (acetohydroxy acid synthase, AHAS) 활성을 갖는 변이형 ilvB의 활성을 평가하기 위해 아세토하이드록시산 신타제 (acetohydroxy acid synthase, AHAS) 활성이 없어 피루브산 (pyruvate)과 2-케토부티르산(2-ketobutyrate)을 기질로 하여 2-아세토-2-하이드록시아세트산 (2-aceto-2-hydroxyacetate)으로 전환이 불가능한 ilvBNC가 결손된 균주를 제작하였다.","Example 3: Preparation of ilvBNC-Deleted Strain for Comparison of Acetohydroxy Acid Synthase (AHAS) Activity In order to evaluate activity of the mutant ilvB having acetohydroxy acid synthase (AHAS) activity, an ilvBNC-deleted strain was prepared, in which the strain is not able to convert pyruvate and 2-ketobutyrate as substrates into 2-aceto-2-hydroxyacetate due to lack of acetohydroxy acid synthase (AHAS) activity.",False,0.2102566212415695,0.8746450459179992,34,59,-25,262,421,-159
"ilvB의 활성을 측정하는 것이지만 코리네박테리움 글루타미쿰은 ilvB, ilvC, ilvN 유전자가 오페론으로 서로 이웃해 있기 때문에 세 유전자의 발현이 통일적으로 조절된다.","Although it was intended to measure the activity of ilvB, expression of ilvB, ilvC, and ivN genes are uniformly regulated because these three genes are adjacent to each other as an operon in Corynebacterium glutamicum.",True,0.1732520759105682,0.8811141986947058,20,35,-15,99,218,-119
따라서 ilvBNC 유전자를 결손하기 위하여 WT 유래의 ilvBNC유전자의 염기서열 정보를 기반으로 ilvBNC 유전자의 5'상단 부위를 증폭하기 위한 프라이머 한 쌍 (서열번호 3 및 4)과 3'하단 부위를 증폭하기 위한 프라이머 한 쌍 (서열번호 5 및 6)을 고안하였다.,"Therefore, in order to delete the ilvBNC gene, a pair of primers (SEQ ID NOS: 3 and 4) for amplifying the 5'-upstream region of the ilvBNC gene, and a pair of primers (SEQ ID NOS: 5 and 6) for amplifying the 3'-downstream region of the ilvBNC gene were designed, based on the nucleotide sequence information of WT derived ilvBNC gene.",True,0.1267639100551605,0.9277343576429868,36,60,-24,155,334,-179
서열번호 3 및 6의 프라이머는 각 말단에 XbaⅠ 제한 효소 부위(밑줄로 표시)를 삽입하였다.,"At each end of the primers of SEQ ID NOS: 3 and 6, the XbaI restriction site (underlined) was inserted.",True,0.2013035118579864,0.8531119444303794,13,20,-7,53,103,-50
각 서열은 하기 표 2에 나타내었다.,Each sequence is shown in Table 2 below.,True,0.0885206460952758,0.9377884438264676,6,8,-2,20,40,-20
"코리네박테리움 글루타미쿰 ATCC 13032 hom(R407H) ilvA(F383A)의 염색체를 주형으로 하여 서열번호 3 및 서열번호 4, 서열번호 5 및 서열번호 6의 프라이머를 이용하여 PCR을 수행하였다.","[Table 2] SEQ ID NO: Sequence (5'-3') 3 ATTCTAGAGGCCAAGAAGTCCGC - 274 CTTGTTGCTGCTACACACATCGAGTTTCC TGTAGCAGCAACAAGATTTTGGCAAAATG 6 ATTCTAGAGCCGAACGGCGCCCC PCR was carried out using the chromosome of Corynebacterium glutamicum ATCC 13032 hom(R407H) ilvA(F383A) as a template and primers of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, and SEQ ID NO: 6.",False,0.2993944585323334,0.8211366840431856,23,52,-29,118,349,-231
"중합효소는 SolgTM Pfu-X DNA 폴리머라제 (SolGent co.,Ltd.)를 사용하였으며, PCR 조건은 95℃에서 10분간 변성 후, 95℃초 변성, 56℃초 어닐링, 72℃ 45초 중합을 30회 반복한 후, 72℃에서 5분간 중합반응을 수행하였다.","As a polymerase, Solg TM Pfu-X DNA polymerase (SolGent co., Ltd.) was used, and PCR conditions were as follows: denaturation at 95°C for 10 minutes; 30 cycles of denaturation at 95°C, annealing at 56°C, and polymerization at 72°C for 45 seconds; and polymerization at 72°C for 5 minutes.",False,0.1785109043121338,0.8982101765012486,28,48,-20,146,287,-141
그 결과 ilvBNC유전자의 5` 상단 부위의 500 bp DNA 단편과 3' 하단 부위의 500 bp의 DNA 단편을 수득하였다.,"As a result, a 500 bp DNA fragment of the 5'-upstream region of ilvBNC gene and a 500 bp DNA fragment of the 3'-downstream region of ilvBNC gene were obtained.",False,0.1469859927892685,0.9127313394746932,18,30,-12,73,159,-86
"전면에 세제개구부가 마련되는 캐비닛;상기 캐비닛 내부에 구비되며, 세탁수가 저장되는 터브;상기 터브 내부에 회전 가능하게 구비되며, 의류가 저장되는 드럼; 및상기 터브로 공급되는 세제가 저장되며, 상기 세제개구부를 통해 상기 캐비닛 내부로 인입 또는 인출되는 저장유닛;을 포함하고,상기 저장유닛은,상기 세제가 저장되는 세제저장공간이 형성되고, 상기 세제저장공간이 개방되도록 상면이 개방되는 저장프레임;상기 저장프레임에 마련되고, 상기 세제저장공간의 둘레에 마련되는 덮개안착부; 및상기 덮개안착부에 착탈 가능하도록 결합되어 상기 세제저장공간의 개방된 상면의 적어도 일부를 차폐하는 덮개부;를 포함하는 것을 특징으로 하는 의류처리장치.","A laundry treating apparatus comprising: a cabinet (10) having a detergent opening (15) defined a front surface thereof; a tub (20) located inside the cabinet (10) and configured to store wash water therein; a drum (30) rotatably disposed inside the tub (20) and configured to store laundry therein; and a storage (300) for storing detergent to be supplied to the tub (20) therein, wherein the storage (300) is configured to be retracted into or extended out of the cabinet (10) through the detergent opening (15), wherein the storage (300) includes: a storage frame (310) having a detergent storage space (S) defined therein for storing the detergent, wherein a top surface of the storage frame (310) is opened such that the detergent storage space (S) is opened; a cover seat portion (320) formed on the storage frame (310) and formed along a perimeter of the detergent storage space (S); and a cover (350) detachably coupled to the cover seat portion (320) to cover at least a portion of an open top surface of the detergent storage space (S).",True,0.488750696182251,0.8218708863194493,70,177,-107,353,1046,-693
"제 1항에 있어서,상기 저장프레임은,프레임바닥면;상기 프레임바닥면의 테두리에서 상방으로 연장되어 상기 세제저장공간을 형성하는 프레임외벽부;상기 프레임바닥면에서 상방으로 연장되어 상기 세제저장공간을 분리하는 프레임격벽부;를 포함하고,상기 덮개안착부는 상기 프레임외벽부와 상기 프레임격벽부의 상부에 마련되는 것을 특징으로 하는 의류처리장치.","The laundry treating apparatus of claim 1, wherein the storage frame (310) includes: a frame bottom surface (311); a frame outer wall (330) extending upward from edges of the frame bottom surface (311) to define the detergent storage space (S); and a frame partition wall (340) extending upward from the frame bottom surface (311) to divide the detergent storage space (S), wherein the cover seat portion (320) is formed on top of the frame outer wall (330) and the frame partition wall (340).",True,0.597529947757721,0.7775371161162608,31,83,-52,188,493,-305
"제 2항에 있어서,상기 프레임외벽부는,상기 저장프레임의 전방측에 위치되는 전방외벽;상기 저장프레임의 후방측에 위치되는 후방외벽;을 포함하고,상기 프레임격벽부는,상기 프레임외벽부와 이격되고, 상기 세제저장공간의 일부를 둘러싸는 보조저장격벽부;상기 전방외벽과 상기 보조저장격벽부를 연결하는 전방격벽; 및상기 후방외벽과 상기 보조저장격벽부를 연결하는 후방격벽;을 포함하는 것을 특징으로 하는 의류처리장치.","The laundry treating apparatus of claim 2, wherein the frame outer wall (330) includes: a front outer wall (331) positioned on a front side of the storage frame (310); and a rear outer wall (332) positioned on a rear side of the storage frame (310), wherein the frame partition wall (340) includes: an auxiliary storage partition wall (343) spaced apart from the frame outer wall (330) and surrounding a portion of the detergent storage space (S); a front partition wall (341) for connecting the front outer wall (331) and the auxiliary storage partition wall (343); and a rear partition wall (342) for connecting the rear outer wall (332) and the auxiliary storage partition wall (343).",True,0.6518210768699646,0.7713953510502277,37,115,-78,223,687,-464
"제 3항에 있어서,상기 프레임외벽부는 상기 전방외벽과 상기 후방외벽을 연결하는 제1측방외벽 및 제2측방외벽을 더 포함하고,상기 세제저장공간은,상기 제1측방외벽과 상기 프레임격벽부 사이에 형성되는 제1저장공간;상기 제2측방외벽과 상기 프레임격벽부 사이에 형성되는 제2저장공간; 및상기 보조저장격벽부에 의해 둘러싸인 제3저장공간;을 포함하며,상기 덮개부는,상기 제1저장공간의 개방된 상면을 차폐하는 제1덮개; 및상기 제2저장공간의 개방된 상면을 차폐하는 제2덮개;를 포함하는 것을 특징으로 하는 의류처리장치.","The laundry treating apparatus of claim 3, wherein the frame outer wall (330) further includes a first side outer wall (333) and a second side outer wall (334) for connecting the front outer wall (331) and the rear outer wall (332), wherein the detergent storage space (S) includes: a first storage space (S1) defined between the first side outer wall (333) and the frame partition wall (340); a second storage space (S2) defined between the second side outer wall (334) and the frame partition wall (340); and a third storage space (S3) surrounded by the auxiliary storage partition wall (343), wherein the cover (350) includes: a first cover (351) for covering an open top surface of the first storage space (S1); and a second cover (352) for covering an open top surface of the second storage space (S2).",True,0.542048990726471,0.8072127417619065,50,138,-88,282,807,-525
"제 4항에 있어서상기 덮개안착부는,상기 제1저장공간의 둘레를 따라 연장되어 상기 제1덮개가 결합되는 제1안착부; 및상기 제2저장공간의 둘레를 따라 연장되어 상기 제2덮개가 결합되는 제2안착부;를 포함하고,상기 프레임격벽부에는 상기 제1안착부 및 상기 제2안착부가 각각 마련되는 것을 특징으로 하는 의류처리장치.","The laundry treating apparatus of claim 4, wherein the cover seat portion (320) includes: a first seat portion (321) extending along a perimeter of the first storage space (S1) and coupled to the first cover (351); and a second seat portion (322) extending along a perimeter of the second storage space (S2) and coupled to the second cover (352), wherein the first seat portion (321) and the second seat portion (322) are respectively disposed on the frame partition wall (340).",True,0.6502209901809692,0.7434342789613941,34,80,-46,173,478,-305
"제 5항에 있어서상기 캐비닛의 내부에서 상기 저장프레임의 상방에 위치되고, 상기 저장프레임을 향해 돌출되는 걸림탄성부; 및상기 저장프레임에 마련되어 상방으로 돌출되고, 상기 저장유닛의 인출과정에서 상기 걸림탄성부와 접촉되는 걸림돌출부;를 더 포함하고,상기 걸림돌출부는 상기 후방격벽에 마련되어 상기 제1안착부 및 상기 제2안착부 사이에 위치되는 것을 특징으로 하는 의류처리장치.","The laundry treating apparatus of claim 5, further comprising: a fastening elastic portion (210) positioned inside the cabinet (10) and above the storage frame (310) and protruding toward the storage frame (310); and a fastening protrusion (360) disposed in the storage frame (310) and protruding upward, wherein the fastening protrusion (360) is in contact with the fastening elastic portion (210) during the extension and the retraction of the storage (300), wherein the fastening protrusion (360) is disposed on the rear partition wall (342) and positioned between the first seat portion (321) and the second seat portion (322).",False,0.648442268371582,0.7639360961286652,43,97,-54,211,631,-420
"제 2항에 있어서,상기 덮개부는,상기 프레임바닥면과 나란하게 마련되어 상기 세제저장공간의 개방된 상면을 차폐하는 덮개베이스; 및상기 덮개베이스의 둘레를 따라 연장되고, 상기 덮개안착부가 삽입되는 결합삽입부를 포함하는 덮개결합부;를 포함하는 것을 특징으로 하는 의류처리장치.","The laundry treating apparatus of any one of claims 2 to 6, wherein the cover (350) includes: a cover base (353) disposed in parallel with the frame bottom surface (311) to cover the open top surface of the detergent storage space (S); and a cover coupling portion (354) extending along a perimeter of the cover base (353) and including a coupling insertion portion (3541), wherein the cover seat portion (320) is inserted into the coupling insertion portion (3541).",True,0.7570027112960815,0.7002226366274217,29,78,-49,152,466,-314
"제 8항에 있어서,상기 저장프레임은 전방측에 전방외벽이 마련되고, 후방측에 후방외벽이 마련되며, 측방향 양측에 각각 제1측방외벽 또는 제2측방외벽이 마련되고,상기 덮개결합부는,상기 제1측방외벽 또는 상기 제2측방외벽과 결합되는 부분으로부터 상기 프레임격벽부와 멀어지도록 연장되는 덮개손잡이를 더 포함하는 것을 특징으로 하는 의류처리장치.","The laundry treating apparatus of claim 7, wherein the storage frame (310) includes a front outer wall (331) on a front surface thereof, a rear outer wall (332) on a rear surface thereof, and a first side outer wall (333) and a second side outer wall (334) respectively on both side surfaces thereof, wherein the cover coupling portion (354) further includes a cover handle (357) extending in a direction away from the frame partition wall (340) from a portion thereof coupled to the first side outer wall (333) or the second side outer wall (334).",True,0.7323068380355835,0.7221630456413712,35,95,-60,188,548,-360
"제 9항에 있어서,상기 제1측방외벽과 상기 제2측방외벽은 각각 측방향으로 돌출되어 상기 덮개결합부를 지지하는 결합리브를 포함하며,상기 덮개손잡이는 상기 결합리브와 이격되도록 마련되는 것을 특징으로 하는 의류처리장치.","The laundry treating apparatus of claim 8, wherein each of the first side outer wall (333) and the second side outer wall (334) includes a coupling rib (335) protruding laterally to support the cover coupling portion (354), wherein the cover handle (357) is disposed to be spaced apart from the coupling rib (335).",True,0.7213443517684937,0.698167724363642,23,53,-30,120,314,-194
"제 9항에 있어서,상기 캐비닛 내부에 구비되고, 상기 세제개구부에 인입된 상기 저장유닛의 개방된 상면을 마주보도록 배치되며, 상기 저장프레임을 향해 돌출되는 스토퍼를 포함하는 고정유닛;을 더 포함하고,상기 저장유닛은상기 고정유닛을 향해 돌출되며, 상기 저장유닛의 인출과정에서 상기 스토퍼에 접촉되어 상기 저장유닛의 인출거리를 제한하는 인출제한부;를 더 포함하는 것을 특징으로 하는 의류처리장치.","The laundry treating apparatus of claim 8 or 9, further comprising a fixing assembly (200) disposed inside the cabinet (10), wherein the fixing assembly (200) is disposed to face an open top surface of the storage (300) retracted into the detergent opening (15), wherein the fixing assembly (200) includes a stopper (220) protruding toward the storage frame (310), wherein the storage (300) further includes an extension limiting portion (370) protruding toward the fixing assembly (200) and contacting the stopper (220) during the extension of the storage (300) to limit an extension distance of the storage (300).",True,0.6357875466346741,0.7569349099441746,45,96,-51,220,615,-395
"제 11항에 있어서,상기 덮개손잡이는 상기 인출제한부보다 후방에 형성되는 것을 특징으로 하는 의류처리장치.","The laundry treating apparatus of claim 10, wherein the cover handle (357) is formed rearwardly of the extension limiting portion (370).",True,0.5923097729682922,0.6808316985812685,12,21,-9,59,136,-77
"제 8항에 있어서,상기 덮개안착부는 상기 덮개결합부를 향해 돌출되고,상기 덮개결합부는,상기 덮개안착부의 돌출방향에 대해 경사진 가이드면이 형성되어 상기 덮개안착부와 상기 덮개결합부의 결합을 유도하도록 마련되는 결합가이드부; 및상기 가이드면과 마주보게 형성되어 상기 덮개안착부를 가압하는 결합가압부;를 포함하는 것을 특징으로 하는 의류처리장치.","The laundry treating apparatus of any one of claims 7 to 11, wherein the cover seat portion (320) protrudes toward the cover coupling portion (354), wherein the cover coupling portion (354) includes: a coupling guide portion (355) having a guide surface inclined with respect to a protruding direction of the cover seat portion (320) to induce coupling between the cover seat portion (320) and the cover coupling portion (354); and a coupling pressure portion (356) formed to face the guide surface to press the cover seat portion (320).",False,0.6287303566932678,0.7265724185691211,36,88,-52,191,537,-346
"제 14항에 있어서,상기 덮개안착부는,상기 결합가압부를 향하여 돌출되는 가압돌기를 포함하는 것을 특징으로 하는 의류처리장치.","The laundry treating apparatus of claim 12, wherein the cover seat portion (320) includes a pressing protrusion (323) protruding toward the coupling pressure portion (356).",True,0.6065354347229004,0.6650161038969842,13,25,-12,69,172,-103
"제 4항에 있어서,상기 저장유닛은,상기 후방외벽을 관통하며 상기 제1저장공간 또는 상기 제2저장공간에 저장된 세제의 배출을 단속하도록 마련되는 세제밸브;를 더 포함하는 것을 특징으로 하는 의류처리장치.","The laundry treating apparatus of any one of claims 4 to 13, wherein the storage (300) further includes a detergent valve (380) penetrating the rear outer wall (332), wherein the detergent valve (380) is constructed to regulate discharge of detergent stored in the first storage space (S1) or the second storage space (S2).",True,0.635385274887085,0.735898943316733,23,53,-30,112,323,-211
"제 4항에 있어서,상기 후방외벽에 마련되고, 센서전극을 통해 상기 제1저장공간 또는 상기 제2저장공간에 저장된 세제량을 감지하는 잔량감지센서;를 더 포함하고,상기 잔량감지센서는 상기 센서전극이 마련되는 전면의 적어도 일부에 상기 세제저장공간으로 노출되는 노출면이 형성되는 것을 특징으로 하는 의류처리장치.","The laundry treating apparatus of any one of claims 4 to 14, further comprising a detecting sensor (390) disposed on the rear outer wall (332), wherein the detecting sensor (390) detects an amount of detergent stored in the first storage space (S1) or the second storage space (S2) through a sensor electrode (391), wherein an exposed surface exposed to the detergent storage space (S) is formed on at least a portion of a front surface of the detecting sensor (390) where the sensor electrode (391) is disposed.",True,0.4883131086826324,0.7916798175628044,34,87,-53,170,512,-342
"구체적으로, 본 발명의 실시에에 따른 염해저항성 결합재는 치밀한 조직을 형성하여 콘크리트 구조물에 보강재로 적용되었을 때, 염소이온이 결합재 내부를 통과하는 속도(침투속도) 속도를 일반 콘크리트나 결합재에 비하여 현저하게 저하시켜 염소이온이 철근에 도달하는 시기를 늦추고, 이에 따라 콘크리트 구조물의 내구수명을 크게 향상시키는 원리이다.","Specifically, the chloride penetration resistant binder according to an embodiment of the present invention is based on a principle that the binder forms a dense structure to significantly reduce a speed at which the chloride ions pass through the inside of the binder (a penetration speed) compared to ordinary concrete or an ordinary binder when applied to the concrete structure as a reinforcement material, thereby delaying the time taken for the chloride ions to reach the reinforcing bar, and thus greatly improving a durability life of the concrete structure.",True,0.1970015913248062,0.9053980245811564,40,89,-49,189,566,-377
"예를 들면, 현행 우리나라 철근콘크리트 설계기준 및 콘크리트 시방서를 적용하여 콘크리트 피복두께를 50㎜로 시공한 구조물의 철근의 부식시기는 약 50년이다.","For example, a corrosion time of a reinforcing bar in a structure that is constructed at a concrete cover thickness of 50 mm by applying current Korean reinforced concrete design standards and concrete specifications is about 50 years.",True,0.1568594574928283,0.9104256980650628,19,38,-19,87,235,-148
"본 발명의 실시예로서, 다양한 고내구성 재료를 고려한 최적배합설계를 통하여 표 2로 나타낸 바와 같이 염해저항성 무기계 결합재를 개발하였으며, 표 2는 염해저항성 결합재 배합표(단위: kg/㎥)를 나타낸다.","As an embodiment of the present invention, the chloride penetration resistant inorganic binder is developed through an optimum mixing design considering a variety of highly durable materials as shown in Table 2, and Table 2 shows a mixing table for a chloride penetration resistant binder (in units of kg/m3).[Table 2]",True,0.2053155153989792,0.8871521011499061,25,50,-25,115,318,-203
본 발명의 실시예에 따른 염해저항성 결합재는 철강산업 부산물의 고로슬래그 미분말 90~95중량% 및 탄산칼슘으로 구성된 염분흡착제 5~10중량%로 구성되어 있다.,"The chloride penetration resistant binder according to an embodiment of the present invention is composed of 90 to 95 wt% of a fine blast furnace fine powder, which is a byproduct in the steel industry, and 5 to 10 wt% of a salt adsorbent composed of calcium carbonate.",True,0.2282837927341461,0.8698859265520361,18,48,-30,90,269,-179
"본 발명의 실시예에 따른 염해저항성 결합재 결합재에 대하여 국제시험규격의 염소이온침투시험(NT Build 492)을 실시하였고, 그 결과를 분석하여 철근의 부식시기를 추정한 결과 도 13에 도시한 바와 같이 약 150년 수준으로 분석되었다.","A chloride ion migration test (NT Build 492) of international test standards is performed on the chloride penetration resistant binder according to an embodiment of the present invention, and as a result of analyzing test results to estimate the corrosion time of the reinforcing bar, the corrosion time is analyzed to be at a level of about 150 years as illustrated in FIG. 13.",True,0.1823218613862991,0.8985910026365703,29,64,-35,134,378,-244
"따라서, 본 발명의 실시예에 따른 염해저항성능 결합재를 활용하여 해양항만구조물 등 염해피해가 우려되는 구조물에 대하여 텍스타일 보강 콘크리트(TRC) 보수보강을 실시하는 경우, 종래의 기술에 따른 결합재를 적용하는 것에 비하여 최대 3배의 내구수명을 확보할 수 있는 것으로 확인되었다.","Therefore, in the case of performing TRC repairing and reinforcing on structures, such as marine and harbor structures, which have concerns about damage caused by chloride penetration, using a chloride penetration resistance performance binder according to an embodiment of the present invention, it is confirmed that a durability life increased up to three times can be secured compared to applying a binder according to the related art.",True,0.2575811445713043,0.8736522309445013,35,67,-32,159,438,-279
"한편, 주로 시멘트를 사용하여 만들어진 시멘트관 및 콘크리트관으로 만들어진 하수시설물, 폐수처리시설 등 오폐수시설물은 오폐수로 인하여 발생되는 혐기성 세균에 의한 황화수소(H2S)와 산소(O2)에 노출되어 있다.","Meanwhile, sewage and wastewater facilities such as sewage facilities, wastewater treatment facilities, etc. made of a cement pipe and a concrete pipe that is mainly produced using cement are exposed to oxygen (O2) and hydrogen sulfide (H2S) caused by anaerobic bacteria generated due to sewage and wastewater.",True,0.1483072638511657,0.9107946244014132,23,47,-24,118,310,-192
이로 인해 황산(H2SO4) 및 악질하수로 인해 콘크리트 구조물이 화학적 침식 등으로 열화가 촉진되어 내구수명이 짧아질 뿐만 아니라 내부의 철근부식이 급격히 진행된다.,"For this reason, due to sulfuric acid (H2SO4) and bad sewage, a concrete structure is subjected to, for instance, chemical erosion, and degradation thereof is accelerated to reduce a durability life thereof, and internal reinforcing bars thereof are rapidly corroded.",True,0.2470199763774871,0.8619213747338739,21,40,-19,93,267,-174
"본 발명의 실시예에 따른 텍스타일 그리드 보강재와 고내구성 무기계 결합재를 이용한 콘크리트 구조물의 경우, 오폐수시설 등에 적용하는 결합재의 화학저항성능을 향상시키기 위하여 시멘트를 사용하지 않고 알칼리 활성화제를 사용하는 무시멘트계 결합재를 제공한다.","In the case of the concrete structure using a textile grid reinforcement and a highly durable inorganic binder according to an embodiment of the present invention, to improve chemical resistance performance of a binder applied to, for instance, sewage and wastewater facilities, a cement-free binder using an alkali activator rather than cement is provided.",True,0.2510824799537658,0.8815052993153761,30,54,-24,141,357,-216
표 3은 화학적 저항성능 고내구성 결합재의 배합표(단위: kg/㎥)를 나타낸다.,Table 3 shows a mixing table for a highly durable binder with chemical resistance performance (in units of kg/m3).[Table 3],True,0.2120517194271087,0.8619310737007159,9,20,-11,44,123,-79
"본 발명의 실시예에 따른 텍스타일 그리드 보강재와 고내구성 무기계 결합재를 이용한 콘크리트 구조물은, 도 14에 도시된 바와 같이, 화학적 저항성능 고내구성 결합재의 성능을 평가하기 위하여 기존 시멘트 결합재와 본 발명의 실시예에 따른 화학적 저항성능 고내구성 결합재로 제작한 콘크리트 시편을 황산 15%용액에 28일간 침지시킨 후 무게를 측정한 결과를 도시하였다.","As illustrated in FIG. 14, in the concrete structure using a textile grid reinforcement and a highly durable inorganic binder according to an embodiment of the present invention, to evaluate performance of the highly durable binder with chemical resistance performance, an existing cement binder and a concrete specimen made of the highly durable binder with chemical resistance performance according to an embodiment of the present invention are immersed in a 15% sulfuric acid solution for 28 days and then their weight was measured, and the results are shown.",True,0.1813814342021942,0.9182445979610484,48,88,-40,204,562,-358
실험결과에 따르면 기존 시멘트계 결합재는 약 25%의 질량감소가 있었으나 본 발명의 고내구성 결합재는 화학적 저항성능이 우수하여 질량 감소가 없었다.,"According to the test results, the weight of the existing cement binder is reduced by about 25%, but the weight of the highly durable binder of the present invention is not reduced due to excellent chemical resistance performance.",True,0.2131613343954086,0.872934940822694,19,38,-19,83,230,-147
"결국, 본 발명의 실시예에 따르면, 코팅재를 코팅하여 부착력을 향상시킨 텍스타일 그리드 보강재를 노후 콘크리트 구조물에 부착하되, 사용환경과 보강목적에 따라 염해저항성능이나 화학저항성능을 갖는 고내구성 무기계 결합재를 선택적으로 사용하여 텍스타일 그리드 보강재를 부착함으로써, 노후 콘크리트 구조물을 용이하게 보수보강할 수 있다.","Finally, according to an embodiment of the present invention, a textile grid reinforcement that is coated with a coating material and improves adhesiveness is adhered to an old concrete structure, but a highly durable inorganic binder having chloride penetration resistance performance or chemical resistance performance is selectively used to adhere the textile grid reinforcement according to a use environment and a reinforcement purpose, and thereby an old concrete structure can be easily repaired and reinforced.",True,0.2009211182594299,0.9157709816464548,38,75,-37,184,518,-334
"즉, 유기계 접착제 대신에 시멘트 등 무기계 결합재를 활용하여 텍스타일 그리드 보강재를 부착함으로써 노후 콘크리트 구조물을 용이하게 보수보강할 수 있다.","That is, a textile grid reinforcement is adhered using an inorganic binder such as cement in place of an organic adhesive, and thereby an old concrete structure can be easily repaired and reinforced.",True,0.2493229806423187,0.8679842842729524,20,33,-13,85,199,-114
[(제1 실시예) 텍스타일 그리드 보강재와 고내구성 무기계 결합재를 이용한 콘크리트 구조물 보수보강 공법],[(First embodiment) Method of repairing and reinforcing concrete structure using textile grid reinforcement and highly durable inorganic binder],True,0.2000181227922439,0.8901763622337772,13,18,-5,59,144,-85
"도 15는 본 발명의 실시예에 따른 텍스타일 그리드 보강재와 고내구성 무기계 결합재를 이용한 콘크리트 구조물 보수보강 공법의 동작흐름도이고, 도 16a 내지 도 16d는 각각 본 발명의 실시예에 따른 텍스타일 그리드 보강재와 고내구성 무기계 결합재를 이용한 콘크리트 구조물 보수보강 공법을 구체적으로 설명하기 위한 도면들이다.","FIG. 15 is a process flow chart illustrating a method of repairing and reinforcing a concrete structure using a textile grid reinforcement and a highly durable inorganic binder according to a first embodiment of the present invention, and FIGS. 16A to 16D are views specifically illustrating the method of repairing and reinforcing a concrete structure using a textile grid reinforcement and a highly durable inorganic binder according to an embodiment of the present invention, respectively.",True,0.2789927423000335,0.8711943759754349,43,75,-32,182,492,-310
"본 발명의 실시예에 따른 텍스타일 그리드 보강재와 고내구성 무기계 결합재를 이용한 콘크리트 구조물 보수보강 공법은, 전술한 도 4에 도시된 바와 같이, 노후 콘크리트 구조물(110) 표면에 일반적으로 격자 형상으로 제작된 섬유보강재인 텍스타일 그리드 보강재(120)를 고내구성 무기계 결합재(130) 내부에 매립하여 시공하는 노후 콘크리트 구조물 보수보강 공법으로서, 이때, 고내구성 무기계 결합재(130)가 접착제 역할을 하게 된다.","As illustrated in FIG. 4 described above, the method of repairing and reinforcing a concrete structure using a textile grid reinforcement and a highly durable inorganic binder according to an embodiment of the present invention is an old concrete structure repairing and reinforcing method of embedding and constructing the textile grid reinforcement 120, which is a fiber reinforcement that is generally made on the surface of the old concrete structure 110 in a grid shape, in the highly durable inorganic binder 130.",False,0.2341859638690948,0.909229879805142,52,82,-30,243,519,-276
이러한 공법으로 시공된 콘크리트를 일반적으로 텍스타일 보강 콘크리트(Textile Reinforce Concrete: TRC)라고 한다.,Concrete constructed by this method is generally referred to as textile reinforced concrete (TRC).,True,0.1559167057275772,0.907394328920084,12,14,-2,76,98,-22
"도 15를 참조하면, 본 발명의 실시예에 따른 텍스타일 그리드 보강재와 고내구성 무기계 결합재를 이용한 콘크리트 구조물 보수보강 공법은, 먼저, 노후 콘크리트 구조물(110)과의 부착력 향상을 위해 코팅재가 코팅된 텍스타일 그리드 보강재(120)를 형성한다(S110). 이때, 상기 코팅재는 샌드페이퍼 마모재로 사용되는 산화알루미나(Al2O3) 분말이고, 상기 코팅재의 입도는 상기 텍스타일 그리드 보강재(120)의 종류와 규격에 따라 결정될 수 있다.","Referring to FIG. 15, a method of repairing and reinforcing a concrete structure using a textile grid reinforcement and a highly durable inorganic binder according to a first embodiment of the present invention forms a textile grid reinforcement 120 coated with a coating material to improve adhesiveness with an old concrete structure 110 (S110).",False,0.3353002071380615,0.8694404884629716,52,54,-2,253,347,-94
"다음으로, 상기 노후 콘크리트 구조물(110)의 사용환경과 보수보강 목적에 따른 고내구성 무기계 결합재(130)를 배합 제조한다(S120).","Next, a highly durable inorganic binder 130 is mixed and made according to a use environment of the old concrete structure 110 and repair and reinforcement purposes (S120).",True,0.129689946770668,0.9317980088587258,14,28,-14,78,172,-94
"다음으로, 상기 노후 콘크리트 구조물(110)에 열화 부위가 있는 경우, 상기 노후 콘크리트 구조물(110)에 열화 부위를 미리 제거한다(S130). 이때, 상기 노후 콘크리트 구조물(110) 내에 매립된 철근이 부식된 경우 철근 깊이까지 열화 단면을 제거하고, 필요시 추가 철근을 배근하는 것이 바람직하다.","Next, in the case where a degraded portion is present in the old concrete structure 110, the degraded portion is pre-removed from the old concrete structure 110 (S130).",False,0.292337954044342,0.843929701495321,38,28,10,172,168,4
"다음으로, 도 16a에 도시된 바와 같이, 상기 노후 콘크리트 구조물(110) 표면에 상기 고내구성 무기계 결합재(130)로 형성된 솟크리트를 타설하여 1차 몰탈층(150)을 형성한다(S140).","Next, as illustrated in FIG. 16A, shotcrete formed of the highly durable inorganic binder 130 is poured on the surface of the old concrete structure 110, and a primary mortar layer 150 is formed (S140).",True,0.1263642013072967,0.939476238235872,21,35,-14,109,202,-93
"다음으로, 상기 텍스타일 그리드 보강재(120) 및 그리드 고정장치(140)를 상기 1차 몰탈층(150) 상부에 거치한다(S150). 보다 구체적으로, 도 16b에 도시된 바와 같이, 상기 그리드 고정장치(140)는, 상기 노후 콘크리트 구조물(110)에 타입되는 몸체로서 ㄷ자 형상의 앵커핀(141); 및 상기 앵커핀(141)의 타입시 상기 텍스타일 그리드 보강재(120)를 타입 충격으로부터 보호하도록 상기 앵커핀 상단에 구비되는 타입충격 완충재(142)를 포함하며, 상기 그리드 고정장치(140)는 상기 텍스타일 그리드 보강재(120)의 거치시 그리드 위사 및 경사 교차지점을 상부를 관통하여 상기 노후 콘크리트 구조물(110)에 타입 고정된다.","More specifically, as illustrated in FIG. 16B, the grid fixing unit 140 is a body driven into the old concrete structure 110, and includes the U-shaped anchor pin 141 and the a driving impact buffer 142 that is provided at an upper end of the anchor pin so as to protect the textile grid reinforcement 120 from a driving impact when the anchor pin 141 is driven.",False,0.369844913482666,0.8276903003205113,71,67,4,364,362,2
"이때, 상기 그리드 고정장치(140)를 화약식 또는 에어타카로 상기 노후 콘크리트 구조물(110)에 타입시켜 상기 텍스타일 그리드 보강재(120)를 견고하게 상기 노후 콘크리트 구조물(110)에 고정시킬 수 있다.","In this case, the grid fixing unit 140 is driven into the old concrete structure 110 by an explosive or pneumatic tacker, and enables the textile grid reinforcement 120 to be firmly fixed to the old concrete structure 110.",True,0.2071656584739685,0.9034649193284388,24,39,-15,119,222,-103
"다음으로, 상기 그리드 고정장치(140)를 사용하여 상기 텍스타일 그리드 보강재(120)를 상기 노후 콘크리트 구조물(110)에 고정시킨다(S160). 보다 구체적으로, 도 16c에 도시된 바와 같이, 상기 그리드 고정장치(140)를 화약식 또는 에어타카로 상기 노후 콘크리트 구조물(110)에 타입시켜 상기 텍스타일 그리드 보강재(120)를 견고하게 상기 노후 콘크리트 구조물(110)에 고정시킬 수 있다.","More specifically, as illustrated in FIG. 16C, the grid fixing unit 140 is driven into the old concrete structure 110 by an explosive or pneumatic tacker, and enables the textile grid reinforcement 120 to be firmly fixed to the old concrete structure 110.",False,0.2707913815975189,0.8819386465954016,44,43,1,228,255,-27
"만일, 상기 1차 몰탈층(150)이 거치하는 상기 텍스타일 그리드 보강재(120)를 지지할 수 있을 정도로 경화된 경우, 상기 그리드 고정장치(140)의 타입 깊이를 조절하여 경화된 상기 1차 몰탈층(150)에 상기 텍스타일 그리드 보강재(120)를 고정할 수도 있다.","If the primary mortar layer 150 is hardened enough to support the placed textile grid reinforcement 120, the textile grid reinforcement 120 can be fixed to the hardened primary mortar layer 150 by adjusting a driven depth of the grid fixing unit 140.",True,0.1825195997953415,0.9033831214774304,32,43,-11,150,250,-100
"다음으로, 도 16d에 도시된 바와 같이, 상기 고내구성 무기계 결합재(130)로 형성된 숏크리트를 상기 텍스타일 그리드 보강재(120) 상에 타설하여 2차 몰탈층(160)을 형성한다(S170). 이때, 상기 텍스타일 그리드 보강재(120)가 수평을 유지하도록 양측에서 잡아당겨 긴장력을 도입하는 것이 바람직하다.","Next, as illustrated in FIG. 16D, the shotcrete formed of the highly durable inorganic binder 130 is poured on the old concrete structure 110, and forms a secondary mortar layer 160 (S170).",False,0.3493950068950653,0.8326080118358351,34,32,2,175,189,-14
"다음으로, 상기 2차 몰탈층(160)을 경화시켜 상기 노후 콘트리트 구조물(110)의 보수보강을 완료한다(S180).","Next, the secondary mortar layer 160 is hardened to complete repairing and reinforcing of the old concrete structure 110 (S180).",True,0.121876835823059,0.9347929793082502,11,20,-9,65,128,-63
"본 발명의 실시예에 따른 텍스타일 그리드 보강재와 고내구성 무기계 결합재를 이용한 콘크리트 구조물 보수보강 공법에서, 상기 고내구성 무기계 결합재(130)는 염해저항성능을 갖는 염해 저항성 무기계 결합재이거나 화학저항성능을 갖는 화학적 저항성 무기계 결합재일 수 있다.","In the method of repairing and reinforcing a concrete structure using a textile grid reinforcement and a highly durable inorganic binder according to an embodiment of the present invention, the highly durable inorganic binder 130 may be a chloride penetration resistant inorganic binder having chloride penetration resistance performance or a chemical resistant inorganic binder having chemical resistance performance.",True,0.2447809278964996,0.8927551621633566,33,58,-25,150,418,-268
"구체적으로, 상기 염해 저항성 무기계 결합재는, 100중량부의 시멘트, 100중량부의 염해 저항성 결합재, 210~250중량부의 잔골재, 55~65중량부의 배합수 및 1.5~3중량부의 고성능 감수제를 혼합하여 형성되고, 이때, 상기 염해 저항성 결합재는 90~95중량%의 고로슬래그 미분말과 5~10중량%의 염분흡착제를 혼합하여 형성되며, 상기 염분흡착제는 탄산칼슘인 것이 바람직하다.","Specifically, the chloride penetration resistant inorganic binder is made by mixing 100 parts of weight of cement, 100 parts of weight of a chloride penetration resistant binder, 210 to 250 parts of weight of fine aggregate, 55 to 65 parts of weight of mixing water, and 1.5 to 3 parts of weight of a high-performance water reducing admixture.",False,0.3208648264408111,0.8301652900737129,39,58,-19,215,343,-128
"또한, 상기 화학적 저항성 무기계 결합재는 무시멘트계 결합재로서, 100중량부의 고로슬래그 미분말, 35~45중량부의 플라이애시, 165~180중량부의 잔골재, 55~65중량부의 배합수 및 8~20중량부의 알칼리 자극제를 혼합하여 형성될 수 있다.","Further, the chemical resistant inorganic binder is a cement-free binder, and may be made by mixing 100 parts of weight of a fine blast furnace slag powder, 35 to 45 parts of weight of fly ash, 165 to 180 parts of weight of fine aggregate, 55 to 65 parts of weight of mixing water, and 8 to 20 parts of weight of an alkali accelerator.",True,0.2392467111349105,0.8608567153284712,25,65,-40,138,335,-197
[(제2 실시예) 텍스타일 그리드 보강재와 고내구성 무기계 결합재를 이용한 콘크리트 구조물 보수보강 공법],[(Second embodiment) Method of repairing and reinforcing concrete structure using textile grid reinforcement and highly durable inorganic binder],True,0.1931416690349578,0.8931025776615434,13,18,-5,59,145,-86
도 17은 본 발명의 제2 실시예에 따른 텍스타일 그리드 보강재와 고내구성 무기계 결합재를 이용한 콘크리트 구조물 보수보강 공법의 동작흐름도이다.,FIG. 17 is a process flow chart illustrating a method of repairing and reinforcing a concrete structure using a textile grid reinforcement and a highly durable inorganic binder according to a second embodiment of the present invention.,True,0.228259727358818,0.8811882121394045,19,37,-18,81,235,-154
"도 17을 참조하면, 본 발명의 제2 실시예에 따른 텍스타일 그리드 보강재와 고내구성 무기계 결합재를 이용한 콘크리트 구조물 보수보강 공법은, 먼저, 노후 콘크리트 구조물(110)과의 부착력 향상을 위해 코팅재가 코팅된 텍스타일 그리드 보강재(120)를 형성한다(S210).","Referring to FIG. 17, first, a method of repairing and reinforcing a concrete structure using a textile grid reinforcement and a highly durable inorganic binder according to a second embodiment of the present invention forms the textile grid reinforcement 120 coated with a coating material to improve adhesiveness with the old concrete structure 110 (S210).",True,0.1617476642131805,0.9358461426443608,32,55,-23,153,358,-205
"다음으로, 상기 노후 콘크리트 구조물(110)의 사용환경과 보수보강 목적에 따른 고내구성 무기계 결합재(130)를 배합 제조한다(S220).","Next, a highly durable inorganic binder 130 is mixed and made according to a use environment of the old concrete structure 110 and repair and reinforcement purposes (S220).",True,0.1316264867782592,0.9311559572066004,14,28,-14,78,172,-94
"다음으로, 상기 노후 콘크리트 구조물(110)에 열화 부위가 있는 경우, 상기 노후 콘크리트 구조물(110)에 열화 부위를 미리 제거한다(S230).","Next, in the case where a degraded portion is present in the old concrete structure 110, the degraded portion is pre-removed from the old concrete structure 110 (S230).",True,0.1842622011899948,0.9002828099750119,17,28,-11,83,168,-85
"다음으로, 상기 텍스타일 그리드 보강재(120) 및 그리드 고정장치(140)를 상기 노후 콘크리트 구조물(110) 표면에 거치하고(S240), 다음으로, 상기 그리드 고정장치(140)를 사용하여 상기 텍스타일 그리드 보강재(120)를 상기 노후 콘크리트 구조물(110)에 고정시킨다(S250).","Next, the textile grid reinforcement 120 and the grid fixing unit 140 are placed on a surface of the old concrete structure 110 (S240), and then the textile grid reinforcement 120 is fixed to the old concrete structure 110 using the grid fixing unit 140 (S250).",True,0.1075551584362983,0.9513428985546822,28,46,-18,164,261,-97
"다음으로, 내구성 무기계 결합재(130)로 형성된 숏크리트를 상기 텍스타일 그리드 보강재(120) 상에 타설하여 상기 텍스타일 그리드 보강재(120)가 매립된 몰탈층을 형성한다(S260).","Next, shotcrete formed of the highly durable inorganic binder 130 is poured on the textile grid reinforcement 120, and a mortar layer in which the textile grid reinforcement 120 is embedded is formed (S260).",True,0.1621510237455368,0.919420584002838,19,34,-15,105,207,-102
"다음으로, 상기 몰탈층을 경화시켜 상기 노후 콘트리트 구조물(110)의 보수보강을 완료한다(S270).","Next, the mortar layer is hardened to complete repairing and reinforcing of the old concrete structure 110 (S270).",True,0.187698408961296,0.892105303313787,10,18,-8,57,114,-57
"본 발명의 제2 실시예에 따른 텍스타일 그리드 보강재와 고내구성 무기계 결합재를 이용한 콘크리트 구조물 보수보강 공법의 경우, 전술한 본 발명의 제1 실시예에 따른 텍스타일 그리드 보강재와 고내구성 무기계 결합재를 이용한 콘크리트 구조물 보수보강 공법과 비교하면, 텍스타일 그리드 보강재(120)를 그리드 고정장치(140)로 상기 노후 콘크리트 구조물(110) 표면에 선고정한 후, 소요 두께만큼 몰탈을 일괄 시공하는 방식이다.","In the case of the method of repairing and reinforcing a concrete structure using a textile grid reinforcement and a highly durable inorganic binder according to a second embodiment of the present invention, in comparison with the above-mentioned method of repairing and reinforcing a concrete structure using a textile grid reinforcement and a highly durable inorganic binder according to a first embodiment of the present invention, after the textile grid reinforcement 120 is prefixed to the surface of the old concrete structure 110 using the grid fixing unit 140, the mortar is constructed en bloc to a required thickness.",True,0.1920424401760101,0.9239504405432148,53,99,-46,239,627,-388
"한편, 도 18은 본 발명의 실시예에 따른 텍스타일 그리드 보강재와 고내구성 무기계 결합재를 이용한 콘크리트 구조물 보수보강 공법에 의해 보수보강된 콘크리트 구조물인 콘크리트 슬래브 파괴시험을 설명하기 위한 도면이다.","Meanwhile, FIG. 18 is a view illustrating a fracture test of a concrete slab that is a concrete structure repaired and reinforced by the method of repairing and reinforcing a concrete structure using a textile grid reinforcement and a highly durable inorganic binder according to an embodiment of the present invention.",True,0.2029724419116974,0.905419926813014,28,51,-23,121,319,-198
"본 발명의 실시예에 따른 텍스타일 그리드 보강재와 고내구성 무기계 결합재를 이용한 콘크리트 구조물 보수보강 공법의 성능 향상 효과를 검증하기 위하여, 길이 2m, 폭 1m, 두께 20㎝로 제작된 철근콘크리트 슬래브(철근 보강비 = 0.004)의 하면을 두께 20㎜의 TRC로 보강한 후 도 18에 도시한 만능재하시험기를 이용하여 파괴시험을 실시하였다.","To verify a performance improving effect of the method of repairing and reinforcing a concrete structure using a textile grid reinforcement and a highly durable inorganic binder according to an embodiment of the present invention, after a lower surface of a reinforced concrete slab (reinforcing bar reinforcement ratio=0.004) formed with a length of 2 m, a width of 1 m, and a thickness of 20 cm was reinforced by TRC having a thickness of 20 mm, the fracture test was performed using a universal loading test machine illustrated in FIG. 18.",True,0.1644120514392852,0.9259535424538032,45,91,-46,196,542,-346
표 4는 파괴시험 결과를 나타낸다.,Table 4 shows results of the fracture test.[Table 4],False,0.2060052752494812,0.851601330583421,5,9,-4,19,52,-33
[표 4],"According to the fracture test results shown in Table 4, in the case of a test specimen having a reinforced one ply grid, a crack initiation load is increased to 200%, and a fracture load is increased to 150% compared to an unreinforced slab test specimen.",False,0.947715699672699,0.3634212642612367,2,46,-44,5,256,-251
"표 4로 나타낸 파괴시험 결과에 따르면 그리드를 1겹으로 보강한 시험체의 경우 무보강 슬래브 시험체에 비하여 균열발생하중은 200%, 파괴하중은 150%로 증가하였으며, 그리드 2겹으로 보강한 시험체의 경우 무보강 시험체에 비하여 균열발생하중은 200%, 파괴하중은 207%로 증가하였다.","In the case of a test specimen having a reinforced two ply grid, a crack initiation load is increased to 200%, and a fracture load is increased to 207% compared to an unreinforced slab test specimen.",False,0.3195278644561767,0.8109690773982061,33,36,-3,161,199,-38
"따라서, 본 발명의 TRC 보강공법은 불과 20㎜ 두께로 보강하는 경우에도 구조적 성능향상 효과가 매우 큰 것을 알 수 있다.","Therefore, it can be seen from the TRC reinforcing method of the present invention that a structural performance improving effect was very large despite reinforcing with only a thickness of 20 mm.",True,0.129241794347763,0.922986496111845,19,32,-13,70,196,-126
"결국, 본 발명의 실시예에 따르면, 탄소섬유와 같은 텍스타일 그리드 보강재(섬유보강재) 및 고내구성 무기계 결합재 모두 불연소재이기 때문에 내화성능이 우수하고, 특히, 화재위험에 노출된 시설물 보강에 효과적으로 활용할 수 있다.","Finally, according to an embodiment of the present invention, because both the textile grid reinforcement (the fiber reinforcement) such as a carbon fiber and the highly durable inorganic binder are incombustible materials, refractory performance is excellent, and particularly the present invention can be applied to reinforcing facilities exposed to the danger of fire.",True,0.1882731169462204,0.9098432460951356,28,53,-25,127,371,-244
"또한, 본 발명의 실시예에 따르면, 젖은 구조물이나 동절기에도 시공이 가능한 무기계 결합재를 사용함으로써, 누수가 발생해도 탈락하지 않는 등 종래의 기술에 따른 접착 공법의 문제점을 해결할 수 있다.","Further, according to an embodiment of the present invention, the inorganic binder that can be constructed for a wet structure or in the winter season is used, and thereby the problem of the adhering method according to the related art can be solved, for instance, the concrete structure does not fall off despite a leakage of water.",True,0.2678829133510589,0.8550108717679122,27,57,-30,111,333,-222
"특히, 탄소섬유와 같은 텍스타일 그리드 보강재(섬유보강재)는 철근처럼 부식하지 않기 때문에 제설제를 사용하는 도로시설물이나 염분에 노출되는 방파제와 같은 해양항만시설물을 효과적으로 보수보강할 수 있다.","Especially, because the textile grid reinforcement (the fiber reinforcement) such as a carbon fiber is not corroded like the reinforcing bar, road facilities on which a snow-removing agent is used or marine and harbor facilities such as a breakwater exposed to salt can be effectively repaired and reinforced.",True,0.2388775199651718,0.8735205293894933,22,48,-26,112,309,-197
"전술한 본 발명의 설명은 예시를 위한 것이며, 본 발명이 속하는 기술분야의 통상의 지식을 가진 자는 본 발명의 기술적 사상이나 필수적인 특징을 변경하지 않고서 다른 구체적인 형태로 쉽게 변형이 가능하다는 것을 이해할 수 있을 것이다.","The above description of the present invention is for illustration, and those having ordinary knowledge in the art to which the present invention pertains should understand that the embodiments of the present invention can be easily modified in other specific forms without changing the technical spirit or essential characteristics of the present invention.",True,0.1252427250146865,0.920101247467874,34,53,-19,130,358,-228
그러므로 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적이 아닌 것으로 이해해야만 한다.,"Therefore, it should be understood that the embodiments described above are illustrative and non-restrictive in every aspect.",True,0.1571623086929321,0.8774360256805606,13,17,-4,57,125,-68
"예를 들어, 단일형으로 설명되어 있는 각 구성 요소는 분산되어 실시될 수도 있으며, 마찬가지로 분산된 것으로 설명되어 있는 구성 요소들도 결합된 형태로 실시될 수 있다.","For example, components described in a single form may be implemented in a dispersed form, and similarly components described in a dispersed form may be implemented in a combined form.",True,0.2184490114450454,0.8571756614203869,24,30,-6,94,184,-90
"본 발명의 범위는 상기 상세한 설명보다는 후술하는 특허청구범위에 의하여 나타내어지며, 특허청구범위의 의미 및 범위 그리고 그 균등 개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본 발명의 범위에 포함되는 것으로 해석되어야 한다.",The scope of the present invention is defined by the claims to be described below rather than the detailed description.,False,0.6038612127304077,0.5588532480276381,31,20,11,130,119,11
100: 보수보강 콘크리트 구조물 141: 앵커핀 142: 타입충격 완충재,It should be interpreted that all the modifications and alterations derived from the meanings and scope of the claims and their equivalents are included in the scope of the present invention.,False,1.336857795715332,0.0140365398716157,9,31,-22,41,191,-150
"고온 열 저장 유닛, 저온 저장 유닛, 적어도 하나의 압축기(102) 및 적어도 하나의 터빈(104)을 포함하고,상기 고온 열 저장 유닛, 상기 저온 저장 유닛의 상기 적어도 하나의 터빈(104), 및 상기 적어도 하나의 압축기(102)는 라인을 통해 서로 연결되어, 상기 라인에서 순환하는 기체 작업 매체가 반시계방향 히트 펌프 사이클 또는 시계방향 작업 사이클을 통해 흐르고, 상기 압축기(102)의 출구(151)는 상기 터빈(104)의 입구(153)와 연결되고, 상기 터빈(104)의 출구(155)는 상기 압축기(102)의 입구(157)와 연결되고,상기 압축기(102)의 출구(151) 및 상기 터빈(104)의 입구(153) 사이에 제1 열 교환기(116)가 있고, 상기 터빈(104)의 출구(155) 및 상기 압축기(102)의 입구(157) 사이에 제2 열 교환기(126)가 있고, 상기 작업 매체가 상기 제1 열 교환기(116) 및 상기 제2 열 교환기(126) 각각의 일측을 횡단하는 열 에너지 저장 시스템으로서,상기 고온 열 저장 유닛(112-HM) 및 상기 저온 저장 유닛(112-KM)은 충전층 저장 유닛이고,상기 제1 열 교환기(116) 및 상기 고온 열 저장 유닛(112-HM) 사이에 제1 열 전달 시스템(159)이 있고,상기 제2 열 교환기(116) 및 상기 저온 저장 유닛(122-KM) 사이에 제2 열 전달 시스템(161)이 있고,상기 열 전달 시스템(159, 161)이 기체 열 전달 매체와 함께 작동하는 열 에너지 저장 시스템.","Thermal energy storage system comprising a high temperature heat storage unit, a cold storage unit, at least one compressor (102), and at least one turbine (104), wherein the high-temperature heat storage unit, the at least one turbine (104) of the cold storage unit, and the at least one compressor (102) are connected to each other via lines such that a gaseous work medium circulating in the lines can either run through a counterclockwise heat pump cycle or a clockwise work cycle, wherein an outlet (151) of the compressor (102) is connected with an inlet (153) of the turbine (104), wherein an outlet (155) of the turbine (104) is connected with an inlet (157) of the compressor (102), wherein there is a first heat exchanger (116) between the outlet (151) of the compressor (102) and the inlet (153) of the turbine (104), wherein there is a second heat exchanger (126) between the outlet (155) of the turbine (104) and the inlet (157) of the compressor (102), wherein one side each of the first heat exchanger (116) and the second heat exchanger (126) is traversed by the work medium, characterized in that, 18557677_1 (GHMatters) P11.",False,0.176569253206253,0.9336540856074552,163,193,-30,760,1142,-382
"고온 열 저장 유닛, 저온 저장 유닛, 적어도 하나의 압축기(102) 및 적어도 하나의 터빈(104)을 포함하고,상기 고온 열 저장 유닛, 상기 적어도 하나의 터빈(104), 상기 저온 저장 유닛 및 상기 적어도 하나의 압축기(102)는 라인을 통해 서로 연결되어, 상기 라인에서 흐르는 기체 작업 매체가 반시계방향 히트 펌프 사이클 또는 시계방향 작업 사이클을 통해 흐를 수 있고, 상기 압축기(102)의 출구(151)는 상기 터빈(104)의 입구(153)와 연결되고, 상기 터빈(104)의 출구(155)는 상기 압축기(102)의 입구(157)와 연결되고,상기 압축기(102)의 출구(151) 및 상기 터빈(104)의 입구(153) 사이에 제1 열 교환기(116)가 있고, 상기 작업 매체가 상기 제1 열 교환기(116)의 한쪽을 횡단하는 열 에너지 저장 시스템으로서,상기 고온 열 저장 유닛(112-HM) 및 상기 저온 저장 유닛(112-KM)은 충전층 저장 유닛으로서 설계되고,상기 제1 열 교환기(116) 및 상기 고온 열 저장 유닛(112-HM) 사이에 제1 열 전달 시스템(159)이 있고,상기 제1 열 전달 시스템(159)이 기체 열 전달 매체와 함께 작동하고,상기 저온 저장 유닛(122-KM)은 터빈(104)의 출구(155) 및 압축기(102)의 입구(157) 사이의 사이클에서 통합되어, 작업 매체가 상기 저온 저장 유닛(122-KM)을 통해 흐르는 열 에너지 저장 시스템.","Thermal energy storage system comprising a high temperature heat storage unit, a cold storage unit, at least one compressor (102), and at least one turbine (104), wherein the high-temperature heat storage unit, the at least one turbine (104), the cold storage unit, and the at least one compressor (102) are connected to each other via lines such that a gaseous work medium flowing in the lines can either run through a counterclockwise heat pump cycle or a clockwise work cycle, wherein an outlet (151) of the compressor (102) is connected with an inlet (153) of the turbine (104), 18557677_1 (GHMatters) P11.",False,0.2339606881141663,0.9154617039630186,153,101,52,723,610,113
"제1항 또는 제2항에 있어서, 상기 고온 열 저장 유닛(112-HM) 및/또는 저온 저장 유닛(122-KM)은, 미립(fine-grained)/과립(granulate), 바람직하게 광물, 저장 재료가 존재하는 하나 이상의 저장 모듈(HM, KM)로 구성되는 열 에너지 저장 시스템.","AU 41 (122-KM) consist of one or more storage modules (HM, KM) in which fine-grained/granulate, preferably mineral, storage material is present.",False,0.4130252599716186,0.80135589605481,29,21,8,157,144,13
"제3항에 있어서, 저장 모듈(HM, KM) 내의 저장 재료가 공기 또는 기체 투과성 벽(167)의 형태로 배치되는 열 에너지 저장 시스템.","Thermal energy storage system according to claim 3, characterized in that the storage material in the storage modules (HM, KM) is arranged in the form of air- or gas-permeable walls (167).",False,0.1119741797447204,0.9498432112755508,19,31,-12,77,188,-111
"제1항 또는 제3항 및 제1항 또는 제4항 및 제3항 및 제1항에 있어서, 상기 제1 및 제2 열 전달 시스템(159, 161)은 적어도 하나의 송풍기(HF, KF), 파이프라인 및 플랩(Hi, Kj)을 포함하고, 상기 제1 및 제2 열 전달 시스템(159, 161)은 플랩의 활성화를 통해 하나 이상의 저장 모듈(HM, KM)을 로딩 또는 언로딩하도록 설정되는 열 에너지 저장 시스템.","Thermal energy storage system according to claim 1, or claims 3 and 1, or claims 4 and 3 and 1, characterized in that the first and second heat transfer systems (159, 161) comprise at least one blower (HF, KF), pipelines, and flaps (Hi, Kj), and that the first and second heat transfer systems (159, 161) are set up to load or unload one or more storage modules (HM, KM) via activation of the flaps.",False,0.1153772175312042,0.9605743970339512,53,74,-21,216,399,-183
"선행하는 항 중 어느 한 항에 있어서, 반시계방향 히트 펌프 사이클로서 동작하는 제1 압축기(104 E) 및 시계방향 작업 사이클로서 동작하는 제2 압축기(102 B)를 포함하는 열 에너지 저장 시스템.","Thermal energy storage system according to one of the preceding claims, characterized in that it comprises a first compressor (104 E) for operation as a counterclockwise heat pump cycle, and a second compressor (102 B) for operation as a clockwise work cycle.",True,0.1498338878154754,0.9371592650303168,28,42,-14,113,259,-146
"선행하는 항 중 어느 한 항에 있어서, 반시계방향 히트 펌프 사이클로서 동작하는 제1 터빈(102 E) 및 시계방향 작업 사이클로서 동작하는 제2 터빈(104 B)을 포함하는 열 에너지 저장 시스템.","Thermal energy storage system according to one of the preceding claims, characterized in that it comprises a first turbine (102 E) for operation as a counterclockwise heat pump cycle, and a second turbine (104 B) for operation as a clockwise work cycle.",True,0.1292034238576889,0.9448295244626992,28,42,-14,111,253,-142
"선행하는 항 중 어느 한 항에 있어서, 적어도 하나의 전기 기계(100, 101)를 포함하고, 상기 적어도 하나의 전기 기계(100, 101)는 상기 압축기(102) 및/또는 터빈(104)과 연결되는 열 에너지 저장 시스템.","Thermal energy storage system according to one of the preceding claims, characterized in that it comprises at least one electrical machine (100, 101), and that the at least one electrical machine (100, 101) is connected with the compressor (102) and/or the turbine (104).",True,0.1323734521865844,0.9481254954195714,28,43,-15,125,271,-146
"제2항 내지 제8항 중 어느 한 항에 따른 열 에너지 저장 시스템을 로딩하는 방법으로서,적어도 하나의 압축기 및 적어도 하나의 터빈을 반시계방향 사이클로서 동작시키는 단계; 및상기 제1 열 전달 시스템(159)을 동작시켜 상기 열 캐리어가 상기 저장 모듈(HM1 내지 HMn)을 연속적으로 또는 동시에 횡단하도록 하는 단계를 포함하는 방법.","Method for loading a thermal energy storage system according to one of the claims 2 through 8, comprising the steps: operating at least one compressor and at least one turbine as a counterclockwise cycle and operating the first heat transfer system (159) such that the storage modules (HM1 to HMn) are successively or simultaneously traversed by the heat carrier.",True,0.2209520936012268,0.928422140968364,46,59,-13,190,363,-173
"제1항 및 제3항 내지 제9항 중 어느 한 항에 따른 열 에너지 저장 시스템을 로딩하는 방법으로서,적어도 하나의 압축기 및 적어도 하나의 터빈을 반시계방향 사이클로서 동작시키는 단계; 및상기 제1 열 전달 시스템(159)을 동작시켜 상기 열 캐리어가 상기 저장 모듈(HM1 내지 HMn)을 연속적으로 또는 동시에 횡단하도록 하는 단계; 및 상기 제2 열 전달 시스템(161)을 동작시켜 상기 열 캐리어가 상기 저장 모듈(KM1 내지 KMn)을 연속적으로 또는 동시에 횡단하도록 하는 단계는 방법.","Method for loading a thermal energy storage system according to one of the claims 1 and 3 through 9, comprising the steps: operating at least one compressor and one turbine as a counterclockwise cycle, operating the first heat transfer system (159) such that the storage modules (HM1 to HMn) are successively or simultaneously traversed by the heat carrier, and operating the second heat transfer system (161) such that the storage modules (KM1 to KMn) are successively or simultaneously traversed by the heat carrier.",True,0.2151825428009033,0.931849206320028,68,83,-15,277,518,-241
"제2항 내지 제9항 중 어느 한 항에 따른 열 에너지 저장 시스템을 로딩하는 방법으로서,적어도 하나의 압축기 및 적어도 하나의 터빈을 반시계방향 사이클로서 동작시키는 단계; 및상기 제1 열 전달 시스템(159)을 동작시켜 상기 열 캐리어가 상기 저장 모듈(HM1 내지 HMn)을 연속적으로 또는 동시에 횡단하도록 하는 단계를 포함하는 방법.","Method for unloading a thermal energy storage system according to one of the claims 2 through 9, comprising the steps: operating at least one compressor and one turbine as a clockwise work cycle, and operating the first heat transfer system (159) such that the storage modules (HM1 to HMn) are successively or simultaneously traversed by the heat carrier.",True,0.239694058895111,0.922423699242898,46,58,-12,190,355,-165
"제1항 및 제3항 내지 제9항 중 어느 한 항에 따른 열 에너지 저장 시스템을 로딩하는 방법으로서,적어도 하나의 압축기 및 적어도 하나의 터빈을 반시계방향 사이클로서 동작시키는 단계; 및상기 제1 열 전달 시스템(159)을 동작시켜 상기 열 캐리어가 상기 저장 모듈(HM1 내지 HMn)을 연속적으로 또는 동시에 횡단하도록 하는 단계; 및 상기 제2 열 전달 시스템(161)을 동작시켜 상기 열 캐리어가 상기 저장 모듈(KM1 내지 KMn)을 연속적으로 또는 동시에 횡단하도록 하는 단계를 포함하는 방법.","Method for loading a thermal energy storage system according to one of the claims 1 and 3 through 9, comprising the steps: operating at least one compressor and one turbine as a clockwise cycle, operating the first heat transfer system (159) such that the storage modules (HM1 to HMn) are successively or simultaneously traversed by the heat carrier, and operating the second heat transfer system (161) such that the storage modules (KM1 to KMn) are successively or simultaneously traversed by the heat carrier.",True,0.2187931686639785,0.9307540493037336,69,83,-14,282,511,-229
"제9항 내지 제12항 중 어느 한 항에 있어서, 상기 제1 열 전달 시스템(159) 및/또는 상기 제2 열 전달 시스템(161) 내의 열 캐리어의 흐름 방향은 동작 모드 ""로딩"" 및 ""언로딩""이 교번될 때 반전되는 방법.","Method according to one of the claims 9 through 12, characterized in that the flow direction of the heat carrier in the first heat transfer system (159) and/or the second heat transfer system (161) is reversed when the operating modes ""loading"" and ""unloading"" are alternated.",True,0.1533281952142724,0.9353657161039012,33,45,-12,123,276,-153
"제9항 내지 제13항 중 어느 한 항에 있어서, 상기 저장 모듈(HM, KM)은 개별적으로 로딩 및/또는 언로딩되는 방법.","Method according to one of the claims 9 to 13, characterized in that the storage modules (HM, KM) are individually loaded and/or unloaded.",True,0.1317922919988632,0.9367865521783348,17,23,-6,68,138,-70
"제9항 내지 제13항 중 어느 한 항에 있어서, 다수의 저장 모듈(HM, KM)은 로딩 및/또는 언로딩 동안 연속적으로 또는 병렬적으로 전환되는 방법.","Method according to one of the claims 9 to 13, characterized in that multiple storage modules (HM, KM) are switched over successively or in parallel during loading and/or unloading.",True,0.1380248367786407,0.9363862623236968,21,29,-8,84,181,-97
"[또한, 압력 측정 수단으로서는, 로드 셀에 한정되는 것이 아니라, 예를 들면, 로드 셀 대신에 토오크렌치를 이용하여, 볼트 부재(32)에 작용하는 토오크로부터 압력을 구할 수도 있다.]","Note that the pressure measuring means is not limited to the load cell, and for example, a torque wrench can be used instead of the load cell to obtain the pressure from the torque acting on the bolt member 32.",True,0.2636839747428894,0.8516625925531242,24,40,-16,104,210,-106
"[도 2에 도시하는 바와 같이, 가압 유닛(30)은, 시료 수용 유닛(10)의 일단면 측(도면의 하단면 측)에 장착한다.","As shown in FIG. 2, the pressurizing unit 30 is mounted on one end surface side (lower end surface side in FIG. 2 ) of the sample accommodating unit 10.",True,0.1714612394571304,0.9158468791816832,15,30,-15,67,152,-85
"그리고, 시료 수용 유닛(10)의 중공부 내(자세하게는, 시료 홀더(23)의 중공부(23a) 내)에는, 원기둥형으로 형성된 압압 부재(22)를 삽입한다.]","The pressing member 22 formed in a cylindrical shape is inserted into the hollow portion of the sample accommodating unit 10 (specifically, the hollow portion 23a of the sample holder 23).",True,0.2257411777973175,0.8819970205396243,15,31,-16,86,188,-102
"[이 압압 부재(22)는, 로드 셀(34)과 전고체 전지(S) 사이에 개재하여, 볼트 부재(32)로부터의 압압력을 갖고서 전고체 전지(S)를 압력받이 부재(21) 방향으로 압압하는 기능을 가지고 있다.","The pressing member 22 is interposed between the load cell 34 and the all-solid-state battery S, and has a function of pressing the all-solid-state battery S in the direction to the pressure receiving member 21 with the pressing force from the bolt member 32.",True,0.2779145538806915,0.8535620208970277,22,44,-22,112,259,-147
"즉, 볼트 부재(32)의 나사조임 조작에 수반하여, 압력 전달 부재(33), 로드 셀(34) 및 압압 부재(22)를 거쳐, 전고체 전지(S)에 압압력이 작용해서, 전고체 전지(S)가 압력받이 부재(21)에 밀어붙여진다.]","In other words, as the bolt member 32 is screwed in, the pressing force acts on the all-solid-state battery S via the pressure transmission member 33, the load cell 34, and the pressing member 22, so that the all-solid-state battery S is pressed against the pressure receiving member 21.",True,0.2169854193925857,0.8887596715524261,24,49,-25,123,287,-164
"[이것에 의해, 전고체 전지(S)를 가압할 수가 있다.","As a result, the all-solid-state battery S can be pressurized.",True,0.3996130228042602,0.7086999704814427,7,10,-3,30,62,-32
"그 가압값은, 압력 표시기(도시하지 않음)의 표시를 참조하면서, 볼트 부재(32)의 나사조임량을 조정함으로써, 임의로 설정할 수가 있다.]",The pressurization value can be arbitrarily set by adjusting the screwing amount of the bolt member 32 while checking the display of the pressure indicator (not shown).,True,0.1885546445846557,0.8845261207146398,15,27,-12,77,168,-91
"[여기서, 압압 부재(22)도, 후술하는 바와 같이 전고체 전지(S)에의 충전 및 방전을 행하기 위한 도통 경로를 형성한다.","Here, the pressing member 22 also forms a conductive path for charging and discharging the all-solid-state battery S as described later.",True,0.2897764444351187,0.8258942949030134,16,21,-5,69,136,-67
"그 때문에, 앞서 기술한 바와 같이 도전성을 가진 금속 재료로 형성되어 있다.]","Therefore, as described above, it is formed of a metal material having electrical conductivity.",True,0.267099529504776,0.8126080054741538,12,14,-2,44,95,-51
"[도 2 내지 도 4에 도시하는 바와 같이, 기밀 케이스 유닛(40)은, 바닥 있는 원통형으로 형성되어 있고, 개구된 일단면 측(도면의 상단면 측)이, 가압 유닛(30)의 타단면 측(도면의 하단면 측)에 장착된다.","As shown in FIGS. 2 to 4, the airtight case unit 40 is formed in a bottomed cylindrical shape, and one end surface side (upper end surface side in the figures) thereof which is opened is mounted on the other end surface side (lower end surface side in the figures) of the pressurizing unit 30.",True,0.2007735520601272,0.9049425005532136,28,55,-27,119,293,-174
"이와 같이, 가압 유닛(30)의 타단면 측에 기밀 케이스 유닛(40)을 장착함으로써, 상기 타단면 측 주위가, 기밀 케이스 유닛(40)에 의해 밀폐되어 대기와 차단된다.]","As described above, the airtight case unit 40 is mounted on the other end surface side of the pressurizing unit 30, whereby the periphery of the other end surface side is hermetically sealed by the airtight case unit 40, and shielded from the atmosphere.",True,0.2935859560966491,0.8597245926583411,21,44,-23,95,254,-159
"[가압 유닛(30)에 마련된 볼트 부재(32)의 머리부는, 이 가압 유닛(30)의 타단면 측에 노출되어 있고, 기밀 케이스 유닛(40)의 중공부 내에 배치된다.","The head portion of the bolt member 32 provided in the pressurizing unit 30 is exposed on the other end surface side of the pressurizing unit 30, and is placed in the hollow portion of the airtight case unit 40.",True,0.1960390210151672,0.9059978629791016,19,40,-21,89,211,-122
"기밀 케이스 유닛(40)의 중공부 내는 밀폐 공간으로 되어 있으므로, 볼트 부재(32)와 너트부(31)가 맞물리는 부분의 약간의(얼마 안되는) 간극을 경유한, 시료 수용 유닛(10) 내로의 공기의 침입을 저지할 수가 있다.]","The hollow portion of the airtight case unit 40 is a hermetically sealed space, so that air can be prevented from infiltrating into the sample accommodating unit 10 through a slight gap at an engaging portion between the bolt member 32 and the nut portion 31.",True,0.2083054184913635,0.8849469288716001,27,46,-19,125,259,-134
"[기밀 케이스 유닛(40)은, 전기적인 절연성을 가지는 합성 수지 재료(예를 들면, 폴리염화 바이닐(PVC), 폴리염화 바이닐리덴(PVdC), 폴리스타이렌(PS), 아크릴로나이트릴·스타이렌 공중합체(AS 수지), 아크릴로나이트릴·뷰타다이엔·스타이렌 공중합체(ABS 수지), 고밀도 폴리에틸렌(HDPE), 폴리프로필렌(PP), 폴리아세탈(POM), 폴리메틸메타크릴레이트(PMMA), 메틸메타크릴레이트·스타이렌 공중합(MS), 폴리카보네이트(PC), 삼불화 염화 에틸렌(PCTFE), 사불화 에틸렌(PTFE) 등으로 형성되어 있다.]","The airtight case unit 40 is formed of a synthetic resin material having electrical insulation properties (for example, polyvinyl chloride (PVC), polyvinylidene chloride (PVdC), polystyrene (PS), acrylonitrile-styrene copolymer (AS resin), acrylonitrile-butadiene-styrene copolymer (ABS resin), high-density polyethylene (HDPE), polypropylene (PP), polyacetal (POM), polymethyl methacrylate (PMMA), methacrylic aid styrene copolymer (MS), polycarbonate (PC), polychlorotrifluoroethylene (PCTFE), polytetrafluoroethylene (PTFE) or the like).",True,0.0934290289878845,0.9418418113204486,37,58,-21,296,540,-244
"[그런데, 상술한 시료 수용 유닛(10)의 개구된 일단면 측(도면의 하단면 측)에는 수나사부(16)가 마련되어 있고, 한편, 이 일단면 측에 장착되는 가압 유닛(30)의 일단면 측(도면의 상단면 측)에는 암 나사부(35)가 마련되어 있다.","A male screw portion 16 is provided on the opened one end surface side (lower end surface side in the figures) of the sample accommodating unit 10 described above, and a female screw portion 35 is provide on one end surface side (upper end surface side in the figures) of the pressurizing unit 30 to be mounted on the opened one end surface side of the sample accommodating unit 10.",True,0.3116130530834198,0.8496273486976978,28,70,-42,133,382,-249
"그리고, 이들 수나사부(16)와 암 나사부(35)를 나사결합하여, 나사조임 조작하는 것에 의해서, 가압 유닛(30)의 일단면 측을 시료 수용 유닛(10)의 일단면 측에 장착하는 구조로 되어 있다.]","The male screw portion 16 and the female screw portion 35 are screwed together (that is, a screwing operation is performed), so that the one end surface side of the pressurizing unit 30 is mounted on the one end surface side of the sample accommodating unit 10.",True,0.3344044983386993,0.837770553927995,23,47,-24,110,261,-151
"[또, 상술한 가압 유닛(30)의 타단면 측(도면의 하단면 측)에는 제2 수나사부(37)가 마련되어 있고, 한편, 이 타단면 측에 장착되는 기밀 케이스 유닛(40)의 일단면 측(도면의 상단면 측)에는 제2 암 나사부(41)가 마련되어 있다.","Further, a second male screw portion 37 is provided on the other end surface side (lower end surface side in the figures) of the pressurizing unit 30 described above, and a second female screw portion 41 is provided on one end surface side (upper end surface side in the figures) of the airtight case unit 40 to be mounted on the other end surface side of the pressurizing unit 30.",True,0.1987094134092331,0.90737016065906,29,70,-41,134,381,-247
"그리고, 이들 제2 수나사부(37)와 제2 암 나사부(41)를 나사결합하여, 나사조임 조작하는 것에 의해서, 기밀 케이스 유닛(40)의 일단면 측을 가압 유닛(30)의 타단면 측에 장착하는 구조로 되어 있다.]","The second male screw portion 37 and the second female screw portion 41 are screwed together (that is, the screwing operation is performed), so that the one end surface side of the airtight case unit 40 is mounted on the other end surface side of the pressurizing unit 30.",True,0.2991632521152496,0.8572565174738594,25,49,-24,117,272,-155
"[이와 같이, 암수 한쌍의 나사부를 나사조임 조작하는 것만의 간단한 작업으로, 가압 유닛(30)을 시료 수용 유닛(10)에 장착해서, 전고체 전지(S)를 수용한 시료 수용 유닛(10)과 가압 유닛(30) 사이를 밀폐시킬 수가 있다.","As described above, by a simple work of merely screwing a pair of male and female screw portions together (that is, performing the screwing operation), it is possible to mount the pressurizing unit 30 on the sample accommodating unit 10 and hermetically seal the gap between the pressurizing unit 30 and the sample accommodating unit 10 in which the all-solid-state battery S is accommodated.",True,0.3301148414611816,0.8367461486903935,28,64,-36,129,392,-263
"마찬가지로, 암수 한쌍의 나사부를 나사조임 조작하는 것만의 간단한 작업으로, 기밀 케이스 유닛(40)을 가압 유닛(30)에 장착해서, 볼트 부재(32)(가압 기구)가 노출되는 가압 유닛(30)의 타단면 측 주위를 밀폐시킬 수가 있다.]","Likewise, by a simple work of merely screwing a pair of male and female screw portions together (that is, performing the screwing operation), it is possible to mount the airtight case unit 40 on the pressurizing unit 30 and hermetically seal the periphery of the other end surface side of the pressurizing unit 30 to which the bolt member 32 (pressurizing mechanism) is exposed.",True,0.2470300793647766,0.8883686788925965,27,64,-37,131,378,-247
"[따라서, 작업자는, 글로브를 거친 글로브 박스 외부로부터의 조립 작업이더라도, 용이하게 그 작업을 행할 수가 있다.]","Therefore, a worker can easily perform an assembly work even when the assembling work must be performed via a glove from the outside of a glove box.",True,0.2690002024173736,0.8149190149865915,15,27,-12,66,148,-82
"[이들 나사조임 조작에 특별한 공구는 필요로 하지 않아, 예를 들면, 나사조임 대상이 되는 한쪽 유닛을 고정시켜 두고, 다른쪽 유닛을 파지해서 사람 힘(인력)으로 용이하게 나사조임 조작을 할 수가 있다.]","For example, it is possible to easily perform the screwing operation on units to be screwed together by fixing one of the units and screwing the other unit manually while grasping the other unit.",False,0.5495352149009705,0.658978273844468,28,34,-6,114,195,-81
"[또한, 본 실시형태에서는, 도 3에 도시하는 바와 같이, 시료 수용 유닛(10), 가압 유닛(30), 기밀 케이스 유닛(40)의 각 외주면에, 나사조임 조작용의 조작봉(52)이 마련되어 있다.","In the present embodiment, as shown in FIG. 3, an operating rod 52 for the screwing operation is provided on the outer peripheral surface of each of the sample accommodating unit 10, the pressurizing unit 30, and the airtight case unit 40.",True,0.2355623543262481,0.8892717616584229,23,42,-19,108,239,-131
"이 조작봉(52)은, 180° 사이를 떼고 외경 방향으로 2개 돌출해서 마련되어 있다.","Particularly, two operating rods 52 are provided on each of the units 10, 30 and 40 so as to be arranged away from each other at an angular interval of 180° and protrude outward in the radial direction.",True,0.5580480098724365,0.6143865999084457,11,38,-27,48,202,-154
"작업원은 이 조작봉(52)을 손으로 돌리는 것만으로, 상기의 각 나사조임 조작을 한층 더 용이하게 행하는 것이 가능해진다.]",The worker can more easily perform each of the screwing operations described above by merely turning the operating rods 52 by hand.,True,0.1773495227098465,0.8763201447006327,16,22,-6,69,131,-62
"[또한, 수나사부(16)는, 금속제의 시료 수용 유닛(10)에 형성되어 있으므로, 이것에 나사결합되는 암 나사부(35)도, 도 3에 도시하는 바와 같이, 금속 고리(36)의 내주면에 형성하고, 이 금속 고리(36)를 합성 수지제의 가압 유닛(30)의 외측 동체부(30A)에 볼트 등의 체결구(50)에 의해 부착한 구성으로 되어 있다.","Since the male screw portion 16 is formed in the metal sample accommodating unit 10, the female screw portion 35 to be threaded with the male screw portion 16 is also formed on the inner peripheral surface of a metal ring 36 as shown in FIG. 3, and the metal ring 36 is attached to the outer body portion 30A of the pressurizing unit 30 formed of synthetic resin by a fastener 50 such as a bolt.",True,0.2103338539600372,0.9019576212327378,38,77,-39,186,395,-209
"이것에 의해, 수나사부(16)와 동등한 내마모성이나 강도 등을 암 나사부(35)에 부여할 수가 있다.]","As a result, the female screw portion 35 can be provided with wear resistance and strength having the same level as the male screw portion 16.",True,0.3332394361495971,0.779646329878412,12,26,-14,57,142,-85
"[또, 가압 유닛(30)의 일단면 측에 밀착되는 시료 수용 유닛(10) 일단면에는, O링(51)이 마련되어 있다.",An O-ring 51 is provided on the one end surface of the sample accommodating unit 10 to be in close contact with the one end surface side of the pressurizing unit 30.,True,0.3525455296039581,0.8104419749252518,13,32,-19,63,165,-102
"또, 가압 유닛(30)의 타단면 측에 밀착되는 기밀 케이스 유닛(40)의 일단면에도, 밀폐 부재(15)로서의 O링(51)이 마련되어 있다.","Further, an O-ring 51 as the hermetically sealing member 15 is also provided on the one end surface of the airtight case unit 40 to be in close contact with the other end surface side of the pressurizing unit 30.",True,0.3279285430908203,0.8371533466959881,15,40,-25,77,212,-135
"이들 O링(51)을 개재시킴으로써, 사람 손에 의한 나사조임 조작만으로도, 각 유닛의 상호 간을 용이하게 밀폐시키는 것이 가능해진다.]","By interposing these O-rings 51, it is possible to easily hermetically seal the gaps between the respective units by merely performing a manual screwing operation.",True,0.2484614998102188,0.8210608922464728,16,25,-9,75,163,-88
"[도 1로 되돌아가서, 본 실시형태의 가압 분석용 구조체는, 외부에 제1 전극 단자(26)와 제2 전극 단자(42)를 구비하고 있다.]","Returning to FIG. 1, the pressurization analysis structure of the present embodiment includes a first electrode terminal 26 and a second electrode terminal 42 on the outside thereof.",True,0.1614749282598495,0.9110793350491238,17,28,-11,75,182,-107
"[제1 전극 단자(26)는, 수용 유닛 본체(11)의 외면에 볼트 등의 체결구(50)에 의해서 고정되어 있다.",The first electrode terminal 26 is fixed to the outer surface of the accommodating unit main body 11 by a fastener 50 such as a bolt.,True,0.2104235738515854,0.886603340596796,13,26,-13,61,133,-72
"앞서 기술한 바와 같이, 수용 유닛 본체(11) 및 압력받이 부재(21)는, 도전성을 가지는 금속 재료로 형성되어 있다.","As described above, the accommodating unit main body 11 and the pressure receiving member 21 are formed of metal materials having electrical conductivity.",True,0.1776902228593826,0.8987764243106693,16,23,-7,67,154,-87
"따라서, 도 2에 도시하는 바와 같이, 수용 유닛 본체(11) 및 압력받이 부재(21)를 거쳐, 제1 전극 단자(26)가 전고체 전지(S)의 한쪽 집전체 층과 전기적으로 도통된 상태로 된다.]","Therefore, as shown in FIG. 2, the first electrode terminal 26 is set to a state where it is in electrical communication with one of the current collector layers of the all-solid-state battery S via the accommodating unit main body 11 and the pressure receiving member 21.",True,0.2413456588983518,0.8754641179501738,25,47,-22,107,272,-165
"[제2 전극 단자(42)는, 기밀 케이스 유닛(40)의 외주면에 볼트 등의 체결구(50)에 의해서 고정되어 있다.",The second electrode terminal 42 is fixed to the outer peripheral surface of the airtight case unit 40 by a fastener 50 such as a bolt.,True,0.2117846459150314,0.8910592315398164,13,26,-13,63,135,-72
"기밀 케이스 유닛(40)의 내부에는, 이 제2 전극 단자(42)와 전기적으로 도통되는 도전 부재(43)가 배치되어 있다.",A conductive member 43 that electrically conducts with the second electrode terminal 42 is arranged inside the airtight case unit 40.,True,0.3481138050556183,0.8058411071173731,14,21,-7,67,133,-66
"이 도전 부재(43)는, 스프링 특성(탄성)을 가지는 금속판으로 형성되어 있고, 기밀 케이스 유닛(40)을 가압 유닛(30)에 장착했을 때, 볼트 부재(32)의 머리부가, 이 도전 부재(43)에 맞닿도록 위치결정되어 있다.]","The conductive member 43 is formed of a metal plate having a spring property, and positioned so that the head portion of the bolt member 32 abuts against the conductive member 43 when the airtight case unit 40 is mounted on the pressurizing unit 30.",True,0.2715324759483337,0.8682577819783251,25,45,-20,125,249,-124
"[따라서, 도 2에 도시하는 바와 같이, 제2 전극 단자(42)는, 도전 부재(43), 볼트 부재(32)(또는 내측 동체부(30B)), 압력 전달 부재(33), 로드 셀(34), 압압 부재(22)로 형성된 도통 경로를 거쳐, 전고체 전지(S)의 다른쪽 전극 활물질 층과 전기적으로 도통된 상태로 된다.]","Therefore, as shown in FIG. 2, the second electrode terminal 42 is set to a state where it is in electrical communication with the other electrode active material layer of the all-solid-state battery S through a conductive path formed by the conductive member 43, the bolt member 32 (or the inner body portion 30B), the pressure transmission member 33, the load cell 34, and the pressing member 22.",True,0.2294725775718689,0.8911648373862462,36,68,-32,169,398,-229
"[따라서, 이들 제1 전극 단자(26)와 제2 전극 단자(42) 사이에 전기를 흘림으로써, 시료 수용 유닛(10)의 내부에 수용된 전고체 전지(S)를 충전할 수 있고, 또 이들 전극 단자 사이를, 저항을 개재시켜서 도통시킴으로써, 전고체 전지(S)를 방전할 수가 있다.]","Therefore, the all-solid-state battery S accommodated in the sample accommodating unit 10 can be charged by causing current to flow between the first electrode terminal 26 and the second electrode terminal 42, and further the all-solid-state battery S can be discharged by conducting these electrode terminals with a resistor interposed therebetween.",True,0.2526786029338836,0.8675782078398844,34,51,-17,151,350,-199
"[도 2에 도시하는 바와 같이, 제1 전극 단자(26)와 제2 전극 단자(42) 사이는, 가압 유닛(30)에 있어서의 합성 수지제의 외측 동체부(30A)와, 동일하게 합성 수지제인 기밀 케이스 유닛(40)에 의해서 절연되어 있다.]","As shown in FIG. 2, the first electrode terminal 26 and the second electrode terminal 42 are insulated from each other by the outer body portion 30A formed of synthetic resin in the pressurizing unit 30 and the airtight case unit 40 which is also formed of synthetic resin.",True,0.2242413759231567,0.8939032730101422,28,49,-21,129,273,-144
"[다음에, 본 발명의 실시형태에 관계된 X선 회절 장치에 대하여 설명한다.]","Next, an X-ray diffraction apparatus according to an embodiment of the present invention will be described.",True,0.2290213853120803,0.8347416291240503,10,16,-6,42,107,-65
"[도 9는 본 실시형태에 관계된 X선 회절 장치의 외관을 도시하는 사시도이고, 도 10A 및 도 10B는 그 X선 회절 장치에 마련된 시료 스테이지의 구성을 도시하는 사시도이다.]","FIG. 9 is a perspective view showing the appearance of the X-ray diffraction apparatus according to the present embodiment, and FIGS. 10A and 10B are perspective views showing a configuration of a sample stage provided in the X-ray diffraction apparatus.",True,0.2285021096467971,0.8527036638565157,26,40,-14,100,254,-154
"[X선 회절 장치는, X선원(101)으로부터 방사된 X선을 시료(전고체 전지(S))의 표면에 조사했을 때, 시료의 결정 구조에 따라 소정의 각도로 반사되어 오는 회절 X선을 X선 검출기(102)로 검출하는 것에 의해, 시료를 분석하는 장치이다.",The X-ray diffraction apparatus is an apparatus for analyzing a sample (all-solid-state battery S) by detecting diffracted X-rays reflected at a predetermined angle from a sample (all-solid-state battery S) according to a crystal structure of the sample with the X-ray detector 102 when the surface of the sample is irradiated with X-rays emitted from the X-ray source 101.,True,0.1762647032737732,0.8894823047037359,29,58,-29,136,373,-237
"가시선(LOS: line-of-sight) 무선 통신 시스템의 수신 디바이스에 있어서,상기 수신 디바이스의 외부에 있는 송신 디바이스에 대한 상기 수신 디바이스의 회전 추정치(rotational estimate) 및 병진 추정치(translational estimate)를 결정하는 프로세서; 및피드백 정보를 상기 송신 디바이스로 보내는 상기 수신 디바이스 내부에 있는 송신기를 포함하되,상기 피드백 정보는, 상기 수신 디바이스와 상기 송신 디바이스 사이의 LOS 통신을 위한 최적의 빔포밍 행렬을 결정하기 위해 상기 송신 디바이스에 의해 사용되며, 상기 피드백 정보는,상기 수신 디바이스와 상기 송신 디바이스 사이의 추정된 회전 각도 및 상기 수신 디바이스와 상기 송신 디바이스 사이의 추정된 병진 거리, 또는상기 수신 디바이스의 안테나들의 제1 평면과 상기 송신 디바이스의 안테나들의 제2 평면 사이의 오프셋 각도, 안테나들의 상기 제1 평면의 법선 벡터, 및 상기 추정된 병진 거리를 포함하는, 수신 디바이스.","A receiving device in a line-of-sight (LOS) wireless communication system, the receiving device comprising: a processor that determines a rotational estimate and a translational estimate of the receiving device with respect to a sending device that is external to the receiving device; and a transmitter that is internal to the receiving device that sends feedback information to the sending device, wherein the feedback information is used by the sending device to determine an optimal beamforming matrix for LOS communications between the receiving device and the sending device, the feedback information comprising: estimated rotational angles between the receiving device and the sending device and an estimated translational distance between the receiving device and the sending device, or an offset angle between a first plane of antennas of the receiving device and a second plane of antennas of the sending device, a normal vector of the first plane of antennas and the estimated translational distance.",True,0.1692446023225784,0.9342239664347676,114,153,-39,512,1011,-499
"제1항에 있어서,상기 추정된 회전 각도는 추정된 베어링(bearing) 각도, 추정된 다운틸트(downtilt) 각도 및 추정된 슬랜트(slant) 각도를 포함하고,상기 법선 벡터는 상기 송신 디바이스의 서브어레이의 평면과 매칭되는 평면에 수직인 벡터를 포함하는, 수신 디바이스.","The receiving device of claim 1, wherein the estimated rotational angles include an estimated bearing angle, an estimated downtilt angle, and an estimated slant angle, and wherein the normal vector comprises a vector that is perpendicular to a plane that is a best match to a plane of subarrays of the sending device.",True,0.284951776266098,0.8863730026653539,30,53,-23,156,317,-161
"제1항에 있어서,상기 송신기에 커플링된 적어도 하나의 단일 요소 안테나를 더 포함하는 수신 디바이스.","The receiving device of claim 1, further comprising at least one single-element antenna coupled to the transmitter.",True,0.2283434569835662,0.9003957321736794,13,17,-4,56,115,-59
"제1항에 있어서,상기 송신기에 커플링된 안테나 요소의 적어도 하나의 서브어레이를 더 포함하는 수신 디바이스.","The receiving device of claim 1, further comprising at least one subarray of antenna elements coupled to the transmitter.",True,0.2451179027557373,0.8942607291951268,13,19,-6,60,121,-61
"제4항에 있어서,상기 프로세서는, 상기 송신 디바이스에 대한 상기 수신 디바이스의 각각의 서브어레이에 대해 결정된 다수의 도래각(AOA: angle-of-arrival) 방향에 기반하여 상기 수신 디바이스와 상기 송신 디바이스 사이의 상기 추정된 회전 각도를 더 결정하는, 수신 디바이스.","The receiving device of claim 4, wherein the processor further determines the estimated rotational angles between the receiving device and the sending device based on multiple angle-of-arrival directions determined for each subarray of the receiving device with respect to the sending device.",True,0.2747035920619964,0.8982968207256099,34,42,-8,161,292,-131
"제5항에 있어서,상기 프로세서는, 상기 송신 디바이스에 대한 상기 수신 디바이스의 각각의 서브어레이에 대해 결정된 상기 다수의 도래각 방향에 기반하여 상기 수신 디바이스와 상기 송신 디바이스 사이의 상기 추정된 회전 각도를 결정하기 위해 각각의 서브어레이의 추정된 중심을 더 결정하는, 수신 디바이스.","The receiving device of claim 5, wherein the processor further determines an estimated center of each subarray to determine the estimated rotational angles between the receiving device and the sending device based on the multiple angle-of-arrival directions determined for each subarray of the receiving device with respect to the sending device.",True,0.2509337663650512,0.9068647914635556,40,51,-11,168,346,-178
"제1항에 있어서,상기 송신 디바이스는 상기 수신 디바이스로부터 송신된 상기 피드백 정보를 수신하고, 상기 피드백 정보에 기반하여 상기 수신 디바이스와 상기 송신 디바이스 사이의 LOS 통신을 위한 상기 최적의 빔포밍 행렬을 결정하는, 수신 디바이스.","The receiving device of claim 1, further comprising the sending device, the sending device receiving the feedback information sent from the receiving device and determining the optimal beamforming matrix for LOS communications between the receiving device and the sending device based on the feedback information.",True,0.2799916267395019,0.8892628697858531,33,45,-12,139,313,-174
"가시선(LOS) 무선 통신 시스템의 송신 디바이스에 있어서,상기 송신 디바이스의 외부에 있는 수신 디바이스로부터 피드백 정보를 수신하는 수신기로서, 상기 피드백 정보는,상기 수신 디바이스와 상기 송신 디바이스 사이의 추정된 회전 각도 및 상기 수신 디바이스와 상기 송신 디바이스 사이의 추정된 병진 거리, 또는상기 수신 디바이스의 안테나의 제1 평면과 상기 송신 디바이스의 안테나의 제2 평면 사이의 오프셋 각도, 안테나들의 상기 제1 평면의 법선 벡터, 및 상기 추정된 병진 거리를 포함하는 수신기; 및상기 피드백 정보를 사용하여 상기 송신 디바이스와 상기 수신 디바이스 사이의 LOS 통신을 위한 최적의 빔포밍 행렬을 결정하는 프로세서를 포함하는 송신 디바이스.","A sending device in a line-of-sight (LOS) wireless communication system, the sending device comprising: a receiver that receives feedback information from a receiving device that is external to the sending device, the feedback information comprising: estimated rotational angles between the receiving device and the sending device and an estimated translational distance between the receiving device and the sending device, or an offset angle between a first plane of antennas of the receiving device and a second plane of antennas of the sending device, a normal vector of the first plane of antennas and the estimated translational distance; and a processor that determines an optimal beamforming matrix for LOS communications between the sending device and the receiving device using the feedback information.",True,0.1608772724866867,0.9387088591584692,90,121,-31,372,812,-440
"제8항에 있어서,상기 추정된 회전 각도는 추정된 베어링 각도, 추정된 다운틸트 각도 및 추정된 슬랜트 각도를 포함하고,상기 법선 벡터는 상기 송신 디바이스의 서브어레이들의 평면과 가장 잘 매칭되는 평면에 수직인 벡터를 포함하는, 송신 디바이스.","The sending device of claim 8, wherein the estimated rotational angles include an estimated bearing angle, an estimated downtilt angle, and an estimated slant angle, and wherein the normal vector comprises a vector that is perpendicular to a plane that is a best match to a plane of subarrays of the sending device.",True,0.2358390837907791,0.9043302459006872,32,53,-21,136,315,-179
"제8항에 있어서,상기 수신 디바이스는 상기 송신 디바이스에 커플링된 적어도 하나의 단일 요소 안테나를 포함하는, 송신 디바이스.","The sending device of claim 10, wherein the receiving device comprises at least one single-element antenna coupled to the sending device.",True,0.2128457576036453,0.9175997525962476,16,21,-5,71,137,-66
"제8항에 있어서,상기 수신 디바이스는 상기 송신 디바이스에 커플링된 안테나 요소의 적어도 하나의 서브어레이를 포함하는, 송신 디바이스.","The sending device of claim 10, wherein the receiving device further comprises at least one subarray of antenna elements coupled to the sending device.",True,0.2555467486381531,0.90250134113848,16,24,-8,75,151,-76
"제11항에 있어서,상기 수신 디바이스와 상기 송신 디바이스 사이의 상기 추정된 회전 각도는 상기 송신 디바이스에 대한 상기 수신 디바이스의 각각의 서브어레이에 대해 결정된 다수의 도래각 방향에 기반하여 결정되는, 송신 디바이스.","The sending device of claim 12, wherein the estimated rotational angles between the receiving device and the sending device are determined based on multiple angle-of-arrival directions determined for each subarray of the receiving device with respect to the sending device.",True,0.2286828011274337,0.9153372290833176,30,40,-10,127,273,-146
"제12항에 있어서,상기 프로세서는 상기 수신 디바이스와 상기 송신 디바이스 사이의 상기 추정된 회전 각도를 결정하기 위해 각각의 서브어레이의 추정된 중심을 더 결정하는, 송신 디바이스.","The sending device of claim 13, wherein the processor further determines an estimated center of each subarray to determine the estimated rotational angles between the receiving device and the sending device.",True,0.2924731075763702,0.8770735194131248,24,31,-7,103,207,-104
"제 1 항에 있어서,그 원주를 따라 비연속적으로 치형체형성되는 상기 치형체들의 링은 연속적으로 치형체형성되는 상기 치형체들의 링의 치형체들의 수의 0.5 내지 30% 사이에 있는 치형체들의 수를 포함하는 것을 특징으로 하는, 기구(1).",and 30% of the number of teeth of said ring of teeth which is toothed continuously.,False,0.8205916881561278,0.5284026796370166,30,16,14,132,83,49
"제 2 항에 있어서,상기 리세스 치형체들(28)의 링은 연속적으로 치형체형성되지만, 상기 돌기 치형체들(50)의 링은 그 원주를 따라 120°에 분포된 3개의 치형체들을 포함하는 것을 특징으로 하는, 기구(1).","13 [Claim 3] 3 - The instrument (1) as claimed in claim 2, characterized in that the ring of recess teeth (28) is toothed continuously, while the ring of protuberance teeth (50) comprises 3 teeth distributed at 120 along its circumference.",False,0.356925904750824,0.8398820940539947,25,41,-16,118,239,-121
"제 1 항 내지 제 3 항 중 어느 한 항에 있어서,상기 치형체들의 링들의 치형체들은 날카로운 각도들을 가진 삼각형 형태를 갖는 것을 특징으로 하는, 기구(1).","[Claim 4] 4 - The instrument as claimed in any one of claims 1 to 3, characterized in that the teeth of the rings of teeth have a triangular form with sharp angles.",True,0.2899239957332611,0.8601657368567541,25,33,-8,90,164,-74
"제 1 항 내지 제 4 항 중 어느 한 항에 있어서,상기 리세스(25)는 상기 돌기(5)의 대응하는 테이퍼링 섹션(40)이 상기 조립 위치에서 유극없이 끼워지는 테이퍼링 섹션(26)을 포함하는 것을 특징으로 하는, 기구(1).","[Claim 5] 5 - The instrument as claimed in any one of claims 1 to 4, characterized in that the recess (25) comprises a tapered section (26) into which a corresponding tapered section (40) of the protuberance (5) fits without play in the position of assembly.",True,0.2240118682384491,0.911439337424578,30,46,-16,126,258,-132
"제 5 항에 있어서,상기 치형체들의 링들은 상기 테이퍼링 섹션들(26, 40)의 큰 직경 상에 형성되는 것을 특징으로 하는, 기구(1).","[Claim 6] 6 - The instrument as claimed in claim 5, characterized in that the rings of teeth are formed on the large diameter of the tapered sections (26, 40).",True,0.3413416445255279,0.8403039841595381,18,30,-12,76,159,-83
"제 6 항에 있어서,상기 치형체들의 링들은 상기 테이퍼링 섹션들의 작은 직경 상에 형성되는 것을 특징으로 하는, 기구(1).","[Claim 7] 7 - The instrument as claimed in claim 6, characterized in that the rings of teeth are formed on the small diameter of the tapered sections.",True,0.3745898604393005,0.8128235009366024,17,28,-11,69,150,-81
"제 5 항 내지 제 7 항 중 어느 한 항에 있어서,상기 테이퍼링 섹션들은 원뿔형 섹션들인 것을 특징으로 하는, 기구(1).","[Claim 8] 8 - The instrument as claimed in any one of claims 5 to 7, characterized in that the tapered sections are conical sections.",True,0.3159813284873962,0.8473665037285055,20,25,-5,69,133,-64
"제 1 항 내지 제 8 항 중 어느 한 항에 있어서,상기 리세스 치형체들(28)의 링 및 상기 돌기 치형체들(50)의 링은 상기 중공 리세스(25)의 및 상기 돌기(5)의 길이의 절반 미만, 바람직하게는 상기 중공 리세스(25)의 및 상기 돌기(5)의 길이의 1/3 미만인 길이를 점유하는 것을 특징으로 하는, 기구(1).","[Claim 9] 9 - The instrument as claimed in any one of claims 1 to 8, characterized in that the ring of recess teeth (28) and the ring of protuberance teeth (50) occupy a length less than half the length of the hollow recess (25) and of the protuberance (5), preferably less than a third of the length of the hollow recess (25) and of the protuberance (5).",True,0.2340003997087478,0.8985261996915483,45,68,-23,180,355,-175
"제 1 항 내지 제 9 항 중 어느 한 항에 있어서,상기 자기 인력 요소(7)는 제 2 자석 또는 상기 제 1 자석(6)에 의해 생성된 자기장에 의해 끌릴 수 있는 재료로 만든 부분인 것을 특징으로 하는, 기구(1).","[Claim 10] 10 - The instrument as claimed in any one of claims 1 to 9, characterized in that the magnetic attraction element (7) is a second magnet or a part made of a material capable of being attracted by the magnetic field produced by the first magnet (6).",True,0.1925393044948578,0.9020396454573456,37,49,-12,121,259,-138
"제 1 항 내지 제 10 항 중 어느 한 항에 있어서,상기 리세스(25)는 상기 핸들 피팅 요소(24)에 위치되지만, 상기 돌기(5)는 상기 체결 요소(30) 상에 위치되는 것을 특징으로 하는, 기구(1).","[Claim 11] 11 - The instrument as claimed in any one of claims 1 to 10, characterized in that the recess (25) is situated in the handle fitting element (24), while the protuberance (5) is situated on the fastening element (30).",True,0.1792338341474528,0.932474823198178,29,41,-12,115,227,-112
"제 1 항 내지 제 11 항 중 어느 한 항에 있어서,상기 핸들 피팅 요소(24)는 상기 기구 몸체(2)에 부가되고 고정되는 부분인 것을 특징으로 하는, 기구(1).","[Claim 12] 12 - The instrument as claimed in any one of claims 1 to 11, characterized in that the handle fitting element (24) is a part added and fixed onto the instrument body (2).",True,0.1644123792648315,0.9371362773042238,25,35,-10,92,181,-89
"제 1 항 내지 제 12 항 중 어느 한 항에 있어서,상기 핸들 피팅 요소(24)는 상기 기구 몸체(2)의 단부에 부가되고 고정되는 부분인 것을 특징으로 하는, 기구(1).","[Claim 13] 13 - The instrument as claimed in any one of claims 1 to 12, characterized in that the handle fitting element (24) is a part added and fixed onto an end of the instrument body (2).",True,0.20128133893013,0.9222426367873864,26,38,-12,96,191,-95
"제 1 항 내지 제 13 항 중 어느 한 항에 있어서,상기 핸들 피팅 요소(24)는 상기 리세스의 나머지보다 더 벌어진 깔때기-형 입력 섹션(27)을 포함하는 것을 특징으로 하는, 기구(1).","[Claim 14] 14 - The instrument as claimed in any one of claims 1 to 13, characterized in that the handle fitting element (24) comprises a funnel-shaped input section (27) that is more flared than the rest of the recess.",True,0.1654373854398727,0.9337470467001296,28,40,-12,107,219,-112
"제 1 항 내지 제 14 항 중 어느 한 항에 있어서,상기 체결 요소(30)는 상기 핸들(3)의 파지 섹션(4)으로 부가된 핸들 단부 피팅인 것을 특징으로 하는, 기구(1).","14 [Claim 15] 15 - The instrument as claimed in any one of claims 1 to 14, characterized in that the fastening element (30) is a handle end fitting added onto the gripping section (4) of the handle (3).",True,0.1938211172819137,0.9244627022602382,26,39,-13,97,202,-105
"제 1 항 내지 제 15 항 중 어느 한 항에 있어서,상기 핸들 피팅 요소(24)는, 그 외부 표면 상에서, 사용자의 손가락의 단부의 맞물림을 허용하도록 순응된 환형 홈(100)을 포함하는 것을 특징으로 하는, 기구(1).","[Claim 16] 16 - The instrument as claimed in any one of claims 1 to 15, characterized in that the handle fitting element (24) comprises, on its outer surface, an annular groove (100) conformed to allow the engagement of the end of a finger of the user.",True,0.1710196137428283,0.9259242917041356,32,47,-15,124,252,-128
"모발을 처리하기 위한 기구들의 세트에 있어서,제 1 항 내지 제 16 항 중 어느 한 항에 청구된 바와 같이 적어도 하나의 분리 가능한 핸들(3) 및 복수의 기구 몸체들(2)을 포함하는, 기구들의 세트.","[Claim 17] 17 - A set of instruments for treating hair, comprising at least one detachable handle (3) and a plurality of instrument bodies (2) as claimed in any one of claims 1 to.",False,0.1565043181180954,0.9287223592782512,31,34,-3,113,180,-67
"스탬핑 공정의 다양한 매개변수(예: 처리 속도, 스탬핑 계면 표면(ASI)의 원하는 온도, 스탬핑 압력 등)를 조정하기 위해, 유저 인터페이스(8a)가 스탬핑 기계(1)에, 예를 들어 제어 유닛(8)에 제공될 수 있다. ]","For adjusting different parameters of the stamping process (e.g. processing speed, desired temperature of the stamping interface surface ASI, stamping pressure, etc.), a user interface 8a can be provided in the stamping machine 1, for example, in the control unit 8.",True,0.0913679674267768,0.9537319493674984,28,41,-13,124,266,-142
"[서두에서 설명한 바와 같이, 스탬핑 플레이트(4)의 스탬핑 계면 표면(ASI)의 온도의 직접적인 온도 측정이 불가능하기 때문에, 제어 입력은 지금까지 룩업 테이블을 기반으로 했으며, 여기서 가열 플레이트(2), 특히 가열 플레이트(2)의 제1 표면(A1)의 온도와, 스탬핑 플레이트(4)의 스탬핑 계면 표면(ASI) 사이의 안정 상태종속성(steady state dependency)이 저장된다.","As described at the outset, since no direct temperature measurement of the temperature of the stamping interface surface ASI of the stamping plate 4 is possible, the control input was hitherto based on a look-up-table, in which a steady state dependency between the temperature of the heating plate 2, especially of the first surface A1 of the heating plate 2, and the stamping interface surface ASI of the stamping plate 4 is stored.",True,0.1291229277849197,0.9380885866047772,42,73,-31,222,434,-212
"그러나 룩업 테이블 방식으로는 가공 조건(스탬핑 플레이트 설치 수, 주변 온도, 가공 속도, 분사 노즐(18)에 의해 공급되는 공기의 온도 및 체적 유량 등)이 변화되기 때문에, 고품질 표준을 충분하게 충족시킬 수가 없다.","However, due to changing processing conditions (number of stamping plates installed, ambient temperature, processing speed, temperature and volume flow of the air supplied by blowing nozzles 18, etc.) with the look-up-table method, high quality standards cannot be sufficiently met.",True,0.1537982523441314,0.9141421827342656,31,39,-8,124,282,-158
"따라서, 본 발명에 따르면, 도 2 및 도 3을 참조하여 이하에서 설명되는 바와 같이, 보다 양호한 성능을 갖는 개선된 스탬핑 기계(1)가 제공된다.]","Therefore, according to the invention an improved stamping machine 1 with better performance is provided, as will be described in the following with reference to Fig.2 + Fig.3.",True,0.1365497261285781,0.912102108291752,22,28,-6,84,176,-92
"[본 발명에 따르면, 스탬핑 기계(1)는 스탬핑 계면 표면(ASI)의 온도(T, Sub[attributes={}; value=[SI]], )를 미리 정의된 원하는 온도(T, Sub[attributes={}; value=[SI_D]], )로 제어하기 위한 제어 유닛(8)을 포함하며, 상기 제어 유닛(8)은 가열 플레이트(2)의 적어도 하나의 온도 센서(13)로부터의 가열 플레이트(2)의 실제 온도(T, Sub[attributes={}; value=[H_ACT]], )를 적어도 수신하고 그리고 조작 변수(u)를 적어도 하나의 가열 장치(7)에 제공하게 구성된다.","According to the invention, the stamping machine 1 comprises a control unit 8 for controlling the temperature TSI of the stamping interface surface ASI to a predefined desired temperature TSI_D, wherein the control unit 8 is configured to receive at least an actual temperature TH_ACT of the heating plate 2 from the at least one temperature sensor 13 of the heating plate 2 and to provide a manipulated variable u to the at least one heating device 7.",True,0.208627164363861,0.8999630155498594,51,78,-27,315,452,-137
"스탬핑 기계(1)는 가열 플레이트(2)와 스탬핑 플레이트(4) 사이의 열 전달에 대한 적어도 하나의 물리적 기반 분석 모델(17)에 기초한 적어도 하나의 스탬핑 플레이트(4)의 스탬핑 계면 표면(ASI)의 실제 온도(, I[attributes={}; value=[T]], I[attributes={}; value=[Sub[attributes={}; value=[SI_ACT]]]], )를 추정하기 위한 상태 관찰기(14)를 추가로 포함한다.]",The stamping machine 1 further comprises a state observer 14 for estimating an actual temperature T̂SI_ ACT of the stamping interface surface ASI of the at least one stamping plate 4 based on at least one physics-based analytical model 17 of the heat transfer between the heating plate 2 and the stamping plate 4.,True,0.2291104644536972,0.8945317177758619,38,54,-16,247,313,-66
"[상태 관찰기(14)는, 예를 들어, 도 2에 도시된 바와 같이 별도의 구성요소(예를 들어, 하드웨어 또는 소프트웨어의 일부)의 형태로 제공되거나 또는 제어 유닛(8)에서(예를 들어, 소프트웨어로서) 구현될 수 있다.","The state observer 14 can, for example, be provided in form of a separate component (e.g. a piece of hardware or software) or can be implemented in the control unit 8 (e.g. as software), as shown in Fig.2.",True,0.1099636331200599,0.9333887738967426,26,38,-12,121,205,-84
"제어 유닛(8)은 일반적으로 원하는 온도(T, Sub[attributes={}; value=[SI_D]], )와 추정된 실제 온도(, I[attributes={}; value=[T]], I[attributes={}; value=[Sub[attributes={}; value=[SI_ACT]]]], )와의 사이의 오차를 기반으로 하며, 상태 관찰기(14)에 의해 제공되는, 미리 정의된 원하는 온도(T, Sub[attributes={}; value=[SI_D]], ) 및 스탬핑 계면 표면(ASI)의 추정된 실제 온도(, I[attributes={}; value=[T]], I[attributes={}; value=[Sub[attributes={}; value=[SI_ACT]]]], )에 기초하여 적어도 하나의 가열 장치(7)에 대한 조작 변수(u)를 계산하기 위한 피드백 제어기(15)를 더 포함한다.","The control unit 8 further comprises a feedback controller 15 for calculating the manipulated variable u for the at least one heating device 7 based on the predefined desired temperature TSI_D and the estimated actual temperature T̂SI_ ACT of the stamping interface surface ASI, provided by the state observer 14, usually based on an error between the desired temperature TSI_D and the estimated actual temperature T̂SI_ ACT.",True,0.2883202135562897,0.8585866089180972,59,67,-8,449,425,24
"피드백 제어기(15)는 예를 들어, 당업계에 공지된 적절한 제어기, 예를 들어, PID 제어기 또는 PI 제어기를 포함할 수 있다.","The feedback controller 15 can, for instance, comprise a suitable controller, known in the art, e.g. a PID-controller or PI-controller.",True,0.1080168336629867,0.9381403535938656,18,20,-2,73,135,-62
"명료함을 위해, 스탬핑 기계(1)는 도 2에 단순화된 방식으로 도시되어 있고, 그리고 가열 장치(7) 및 온도 센서(13)는 그리드의 교점으로서 도시되어 있으며, 여기서 이들은 가열 플레이트(2)의 제1 표면(A1)에 배치된다.","For the sake of clarity, the stamping machine 1 is shown in a simplified manner in Fig.2 and the heating devices 7 and the temperature sensors 13 are shown as nodes of a grid, in which they are arranged on the first surface A1 of the heating plate 2.",True,0.133700281381607,0.9312933368758032,27,49,-22,127,250,-123
"물론, 가열 장치(7)는 도시된 바와 같이 정확히 한 교점에서 가열 플레이트(2)를 가열할 필요는 없는 것이지만, 특정 영역에서 가열 플레이트(2)를 가열할 수는 있는 것이다.]","Of course, a heating device 7 does not necessarily need to heat the heating plate 2 exactly on a node as shown, but can rather heat the heating plate 2 on a certain area.",True,0.1211845278739929,0.932428246956951,23,34,-11,99,170,-71
"[바람직하게는, 제어 유닛(8)은 적어도 하나의 물리적 기반 분석 모델(17)에 기초한 스탬핑 계면 표면(ASI)의 미리 정의된 원하는 온도(T, Sub[attributes={}; value=[SI_D]], )로부터 피드포워드 제어 값을 계산하기 위한 피드포워드 제어기(16)를 더 포함한다.",Preferably the control unit 8 further comprises a feedforward controller 16 for calculating a feedforward control value from the predefined desired temperature TSI_D of the stamping interface surface ASI based on the at least one physics-based analytical model 17.,True,0.2511208653450012,0.8767612648409968,29,39,-10,163,264,-101
"특히, 피드포워드 제어 값은 스탬핑 기계(1)에 설치된, 스탬핑 플레이트(4)의 수의 스탬핑 플레이트 영역(들) 및 설치 위치(들)를 고려하여, 스탬핑 계면 표면(ASI)의 원하는 온도 분포에 대해 계산된다.","In particular, the feedforward control values are calculated for a desired temperature distribution on the stamping interface surface ASI, taking into account the stamping plate area(s) and installation position(s) of the number of stamping plates 4, installed in the stamping machine 1.",True,0.1769159287214279,0.913318832874528,25,42,-17,116,287,-171
피드포워드 제어 값은 물리적 기반 분석 모델(17)의 역해법(inverse solution)으로 계산된다.,The feedforward control values are calculated from an inverse solution of the physics-based analytical model 17.,True,0.2149224430322651,0.8593061726105485,10,16,-6,59,112,-53
"예를 들어, 가열 에너지를 줄이기 위해, 원하는 온도 분포는 하나 이상의 스탬핑 플레이트(4)의 스탬핑 계면 표면(들)의 영역(들)에 대한 특정한 원하는 온도(T, Sub[attributes={}; value=[SI_D]], )를 포함할 수 있고, 그리고 부가적으로 하나 이상의 스탬핑 플레이트(4)의 스탬핑 계면 표면(들)(ASI)의 영역 외부 영역(들)의 원하는 온도를 포함할 수 있다.]","For example, in order to reduce heating-energy, the desired temperature distribution can comprise a specific desired temperature TSI_D for the area(s) of stamping interface surface(s) ASI of the one or more stamping plates 4 and can further comprise a desired temperature of the region(s) outside of the area(s) of stamping interface surface(s) ASI of the one or more stamping plates 4.",False,0.1792231351137161,0.9130508317337656,44,61,-17,219,386,-167
"[피드백 제어기(15), 상태 관찰기(14) 및 피드포워드 제어기(16)가 도 2에 도시된 제어 구조에서 별도의 구성요소로 표시되어 있지만, 당업자에게는 이들이 물론 제어 유닛(8)에서 소프트웨어의 형태로로도 구현될 수 있음을 분명히 알 것이다.","Although the feedback controller 15, the state observer 14 and the feedforward controller 16 are indicated as separate components in the control structure shown in Fig.2, it is apparent for a person skilled in the art, that they could of course also be implemented in form of software in the control unit 8.",True,0.1276770979166031,0.923251721863191,29,53,-24,137,307,-170
"또한, 물리적 기반 분석 모델(17)은 도 2의 제어 회로의 물리적 구성요소(점선으로 표시)가 아니라, 상태 관찰기(14) 및 선택적인 피드포워드 제어기(16)의 설계에 대한 기초 역할을 하는 스탬핑 기계(1)의 열 거동(thermal behavior)에 관한 수학적 설명을 나타내는 것으로 이해되어야 한다.","Further it is to be understood that the physics-based analytical model 17 is not a physical component of the control circuit of Fig.2 (indicated with the dashed lines), but rather represents a mathematical description of the thermal behavior of the stamping machine 1 which serves as a basis for the design of the state observer 14 and the optional feedforward controller 16.",True,0.166426196694374,0.916437337994277,36,62,-26,172,375,-203
물리적 기반 분석 모델(17)은 예를 들어 상태 관찰기(14) 및 적절한 형태의 선택적 피드포워드 제어기(16)에서 구현될 수 있다.,"The physics-based analytical model 17 can, for example, be implemented in both, the state observer 14 and the optional feedforward controller 16 in a suitable form.",True,0.1927735358476638,0.8916550060648609,17,26,-9,74,164,-90
"따라서, 물리적 기반 분석 모델(17)을 나타내는 도 2에 도시된 블록은 단순히 명확한 도시를 위해 도시된 것으로 이해한다.]","Therefore, the block shown in Fig.2, which represents the physics-based analytical model 17, is merely shown for the sake of clarity.",True,0.2669765949249267,0.8313649281778551,17,21,-4,70,133,-63
"[스탬핑 기계(1)의 물리적 기반 분석 모델(17)로 인해, 직접적인 측정이 가능하지 않더라도, 스탬핑 플레이트(4)의 스탬핑 계면 표면(ASI)의 실제 온도(, I[attributes={}; value=[T]], I[attributes={}; value=[Sub[attributes={}; value=[SI_ACT]]]], )를 비교적 정확하게 추정하는 것이 가능하기 때문에 스탬핑 계면 온도(T, Sub[attributes={}; value=[SI]], )의 피드백 제어를 구현하는 것이 가능하다.]","Due to the physics-based analytical model 17 of the stamping machine 1, it is now possible to implement a feedback control of the stamping interface temperature TSI, because it is possible to relatively precisely estimate the actual temperature T̂SI_ ACT of the stamping interface surface ASI of the stamping plate 4, although no direct measurement is available.",False,0.2704933881759643,0.8693572314957817,41,57,-16,281,362,-81
"[스탬핑 플레이트(4)의 스탬핑 계면 표면(ASI)의 추정된 실제 온도(, I[attributes={}; value=[T]], I[attributes={}; value=[Sub[attributes={}; value=[SI_ACT]]]], )를 보정하기 위해, 관찰기 보상기(19)가 선택적으로 스탬핑 기계(1)에 제공될 수 있어서, 특히 상태 관찰기(14)에서 구현되며, 바람직하게는 PID-제어기 또는 기타 적절한 제어기의 형태로 구현될 수 있다.","In order to correct the estimated actual temperature T̂SI_ ACT of the stamping interface surface ASI of the stamping plate 4, an observer compensator 19 can optionally be provided in the stamping machine 1, in particular implemented in the state observer 14, preferably in the form of a PID-controller, or any other suitable controller.",False,0.2074148654937744,0.9034461551878736,38,54,-16,251,336,-85
"보정은 이용 가능한 온도 측정치(T, Sub[attributes={}; value=[i_ACT]], ), 바람직하게는 적어도 하나의 온도 센서(13)로 측정된 가열 플레이트(2)의 실제 온도(T, Sub[attributes={}; value=[H_ACT]], )에 기초한다.]","The correction is based on available temperature measurements Ti_ACT, preferably the actual temperature TH_ACT of the heating plate 2, measured with the at least one temperature sensor 13.",False,0.2486464381217956,0.8701465346221404,22,28,-6,154,188,-34
"[바람직하게는, 물리적 기반 분석 모델(17)은 도 3을 참조하여 추가로 설명되는 바와 같이 분산-매개변수 모델(DPM) 및 집중-매개변수 모델(LPM)을 포함하는 하이브리드 모델이다.","Preferably, the physics-based analytical model 17 is a hybrid model comprising a distributed-parameter model DPM and a lumped-parameter model LPM, as will be further described with reference to Fig.3.",True,0.1534717828035354,0.9135063899152782,20,29,-9,103,200,-97
"하이브리드 모델에서, 가열 플레이트(2), (선택적) 설치 플레이트(3) 및 스탬핑 플레이트(4)는 각각 주축을 따라 다중 레이어(LAi)로 분할된다.","In the hybrid model the heating plate 2, the (optional) installation plate 3 and the stamping plate 4 are each divided into multiple layers LAi along a principal axis.",True,0.1706062257289886,0.9038253545962668,16,29,-13,84,167,-83
"주축은 바람직하게는 예를 들어 도 1의 수직축인, 제1, 제2, 제3, 제4, 제5 표면(A1-A5) 또는 계면 표면(ASI) 중 적어도 하나에 대해 수직인 것이다.","The principal axis is preferably perpendicular to at least one of the first, second, third, fourth, fifth surface A1-A5 or interface surface ASI, e.g. a vertical axis in Fig.1.",True,0.1360728442668914,0.9202307707144032,22,29,-7,92,176,-84
"분산 매개변수 모델(DPM)의 도움으로, 다중 레이어(LAi) 각각의 온도 분포는 입력 레이어(LA, Sub[attributes={}; value=[IP]], )로의 열유속 입력(HFI)을 기반으로 계산될 수 있다.","With the aid of the distributed-parameter model DPM, a temperature distribution in each of the multiple layers LAi can be calculated based on a heat flux input HFI into an input layer LAIP.",False,0.2238793075084686,0.8796376688571536,20,33,-13,120,189,-69
"집중 매개변수 모델(LPM)의 도움으로, 주축을 따라 있는 다중 레이어(LAi) 사이의 열유속을 계산할 수 있다.","With the aid of the lumped-parameter model LPM, a heat flux between the multiple layers LAi along the principal axis can be calculated.",True,0.2128461301326751,0.8694215546711783,14,23,-9,63,135,-72
"도 3에 도시된 예에 따르면, 스탬핑 기계(1)는 입력 레이어(LA, Sub[attributes={}; value=[IP]], ), 2개의 중간 레이어(LAM) 및 출력 레이어(LA, Sub[attributes={}; value=[OP]], )로 분할되지만, 물론 더 많거나 더 적은 레이어로 다른 세분화를 선택하는 것이 가능하지만, 적어도 2개의 레이어는 필요하다(입력 레이어(LA, Sub[attributes={}; value=[IP]], ) 및 출력 레이어(LA, Sub[attributes={}; value=[OP]], )). 입력 레이어(LA, Sub[attributes={}; value=[IP]], )는 열유속 입력(HFI)을 제공하는, 가열 장치(7)가 배치된 가열 플레이트(2)의 제1 표면(A1)에 대응한다.","According to the example shown in Fig.3, the stamping machine 1 is divided into an input layer LAIP, two middle layers LAM, and an output layer LAOP, but it is of course possible to choose another subdivision with more or less layers, however, at least two layers are required (input layer LAIP and output layer LAOP).",False,0.3209177255630493,0.83558030139486,63,56,7,406,318,88
"출력 레이어(LA, Sub[attributes={}; value=[OP]], )는 실제 온도(, I[attributes={}; value=[T]], I[attributes={}; value=[Sub[attributes={}; value=[SI_ACT]]]], )가 추정될 스탬핑 플레이트(4)의 스탬핑 계면 표면(ASI)에 대응한다.",The output layer LAOP corresponds to the stamping interface surface ASI of the stamping plate 4 where the actual temperature T̂SI_ ACT is to be estimated.,False,0.3433583676815033,0.8149643148153387,20,26,-6,186,154,32
"가열 장치(들)(7)의 분할 가열 영역으로 인해, 열유속 입력(HFI)은 입력 레이어(LA, Sub[attributes={}; value=[IP]], )에 국부적으로 가해지고 그리고 스탬핑 플레이트(들)(4)의 유한한 작동 영역(들)으로 인해 교란이 출력 레이어(LA, Sub[attributes={}; value=[OP]], )에 불균일하게 분포된다.","Due to the segmental heating zones of the heating device(s) 7, the heat-flux inputs HFI are locally exerted on the input layer LAIP and due to the finite operating area(s) of the stamping plate(s) 4, the disturbances are non-uniformly distributed on the output layer LAOP.",False,0.2009710222482681,0.8941111369598924,30,45,-15,197,272,-75
"결과적으로 매우 불균일한 온도 분포에 대한 가열 영역 간의 국부 경계 조건 및 열 결합의 영향을 설명하기 위해서, 만약 집중 매개변수 모델만이 스탬핑 기계(1)의 열 전달에 대한 수학적 설명을 위한 단일 모델로 사용된다면, 매우 많은 수의 모델 요소(예: 저항(R), 정전용량(C) 등 - 아래 참조)가 필요할 것이다.","To account for the effects of local boundary conditions and thermal couplings among the heating zones on the resulting highly non-uniform temperature distribution, a very large number of model elements (such as resistances R, capacitances C etc. - see below) would be required, if only a lumped-parameter model would be used as single model for the mathematical description for the heat transfer of the stamping machine 1.",True,0.1927325278520584,0.8983359884893279,46,67,-21,178,422,-244
그러나 이것은 바람직한 실시간 온도 추정/제어 측면에서 바람직하지 않은 많은 계산 시간을 초래할 것이다.,"This would however lead to large computation time, which is undesired in terms of a preferred real-time temperature estimation/control.",True,0.1555570662021637,0.8973641740759155,14,19,-5,58,135,-77
"다른 한편으로, 분산 매개변수 모델만을 사용하여 과도 3차원 온도 필드(transient three-dimensional temperature field)를 해석적으로 해결하는 것도 매우 어려울 것이며, 수치 계산 기술(예: 유한 요소 방법)도 엄청난 계산 노력이 필요하다.","On the other hand, it would also be very difficult to analytically solve the transient three-dimensional temperature field using only a distributed-parameter model, while numerical calculation techniques (such as, the finite element method) would also require huge computation efforts.",True,0.1349425464868545,0.9261619384379934,29,39,-10,153,285,-132
"따라서 충분히 낮은 계산 노력을 달성하기 위해, 각각의 빠른 계산 시간과 동시에 충분한 계산 정확도를 제공하기 위해 본 발명에서는 집중 매개변수 모델과 분산 매개변수 모델을 조합한 하이브리드 모델 형태로 조합하여 사용한다.]","Therefore, in order to achieve sufficiently low computation efforts, fast calculation time respectively and at the same time sufficient calculation accuracy, a combination of a lumped-parameter model and a distributed-parameter model in the form of a hybrid-model is used in the present invention.",True,0.1770921945571899,0.8912360680688688,31,43,-12,125,297,-172
"[바람직한 실시예에서, 분산 매개변수 모델(DPM)은 고유 함수 전개 모델(eigen-function expansion model)이고 그리고 집중 매개변수 모델(LPM)은 열 임피던스 회로 모델이다.","In a preferred embodiment, the distributed-parameter model DPM is an eigen-function expansion model and the lumped-parameter model LPM is a thermal impedance circuit model.",True,0.1495500653982162,0.9103212865789018,19,24,-5,112,172,-60
"열 임피던스 회로 모델을 사용하여, 레이어 사이의 역학 관계가 모델링 되며, 여기서 각 레이어(LAi)는 회로 교점으로서 공식화되고(Kirchhoff의 노드 법칙이 충족됨) 그리고 인접 레이어(LAi) 사이의 열 역학 관계는 도 3에 도시된 바와 같이 열 저항(R) 및 열 커패시턴스(C)로 설명된다.","With the thermal impedance circuit model, the dynamic relationships among layers are modeled, where each layer LAi is formulated as a circuit node (Kirchhoff's node law is satisfied) and the thermal dynamics between adjacent layers LAi are described as thermal resistances R and thermal capacitances C, as shown in Fig.3.",True,0.1539756059646606,0.9146132158139344,38,50,-12,168,321,-153
"하이브리드 모델은 바람직하게는 포워드 경로 및 피드백 경로를 포함하는 폐루프 모델로 모델링되며, 여기서 포워드 경로는 입력 레이어(LA, Sub[attributes={}; value=[IP]], )에 대한 지정된 열유속 입력(HFI)을 기반으로 각 레이어(LAi)의 레이어 온도 분포를 설명하고, 반면 피드백 경로는 지정된 온도 분포에 대한 전도된 열유속(레이어(LAi) 사이)를 설명한다.","Local heat-flux disturbances on the output layer LAOP that corresponds to the stamping interface surface ASI of the stamping plate 4 are also modelled as local thermal resistance R. The hybrid model is preferably modeled as a closed-loop model comprising a forward path and a feedback path, wherein the forward path describes the layer temperature distribution in each layer LAi based on the given heat-flux input HFI to the input layer LAIP, while the feedback path accounts for the conducted heat-flux (between the layers LAi) for a given temperature distribution.",False,0.4334720969200134,0.7765814620861846,42,90,-48,218,566,-348
분산 매개변수 모델(DPM)은 도 3에 나타낸 바와 같이 포워드 경로에서 구현되고 그리고 집중 매개변수 모델(LPM)은 피드백 경로에서 구현된다.],"The distributed-parameter model DPM is implemented in the forward path and the lumped-parameter model LPM is implemented in the feedback path, as depicted in Fig.3.",True,0.1714304834604263,0.892654901090182,18,25,-7,82,164,-82
"[하이브리드 모델이 공식화되면, 식별 알고리즘(identification algorithm)을 사용하여 식별 실험을 수행하여 작업 조건(예: 처리 속도, 주변 온도, 분사 노즐 사용 등)의 함수로 열유속 교란(heat-flux disturbance)을 결정할 수 있다.","When the hybrid model is formulated, identification experiments can be conducted using an identification algorithm to determine heat-flux disturbance as a function of working conditions (e.g. processing speed, ambient temperature, use of blowing nozzles, etc.).",True,0.1818159371614456,0.8957405436873771,27,35,-8,150,261,-111
"이러한 식별 알고리즘은 예를 들어 OZISIK, M. Necati 등의, 2000. Inverse Heat Transfer: Fundamentals and Applications, ISBN 978-1560328384 인 책에서 당업계에 알려져 있다.","Such identification algorithms are known in the art, for example, from the book: OZISIK, M. Necati et al., 2000.",False,0.2794356346130371,0.8068518820929296,23,19,4,139,112,27
"도 2에 따른 제어 방식으로 하이브리드 모델을 구현하면, 가열 플레이트(2)는 온도 차이로 인해 스탬핑 플레이트(4)를 향한 열유속이 생성되는 방식으로 (가열 장치(7)에 제공된 계산된 조작 변수(u)에 기초하여) 가열되며, 이는 스탬핑 계면 표면(ASI)에서 다양한 열 유속 교란(다른 작업 조건 하에서 스탬핑에 의해 유발됨)에 대응하여 스탬핑 계면 온도(T, Sub[attributes={}; value=[SI]], )를 원하는 온도(T, Sub[attributes={}; value=[SI_D]], )로 유지한다.]","With the hybrid model implemented in the control scheme according to Fig.2, the heating plate 2 is heated (based on the calculated manipulated variables u provided to the heating devices 7) in such a way, that due to a temperature difference, a heat flux towards the stamping plate 4 is created, which counteracts to the varying heat flux disturbances at the stamping interface surface ASI (caused by stamping under different working conditions) and hence to maintain the stamping interface temperature TSI at a the desired temperature TSI_D.",False,0.2075696140527725,0.9050254361767832,54,87,-33,291,542,-251
[예시적인 물리적 기반 분석 모델(17)을 도 4를 참조하여 다음에 제시한다.,An exemplary physics-based analytical model 17 is presented in the following with reference to Fig.4.,True,0.127728059887886,0.920951522255522,10,15,-5,43,101,-58
"단순함을 기하기 위해, 물리적 기반 분석 모델(17)은 가열 플레이트(2)에 대해서만 도시했다.","For the sake of simplicity, the physics-based analytical model 17 is shown for the heating plate 2 only.",True,0.2552255690097809,0.8493791504482672,11,18,-7,53,104,-51
"좌측에는 수학적 설명에 사용되는 좌표계가 있는 가열 플레이트(2)가 도시되며, 좌측 상단 모서리에 원점(O)이 있다.","On the left side the heating plate 2 is shown with a coordinate system, which is used for the mathematical description, having the origin O in the top left corner.",True,0.207899734377861,0.8662681479295367,14,30,-16,65,163,-98
X-축 및 Y-축에 걸쳐 있는 XY-평면은 가열 플레이트(2)의 제1 표면(A1)에 해당한다.,The XY-plane spanned by the X-axis and Y-axis corresponds to the first surface A1 of the heating plate 2.,True,0.1658336520195007,0.8957907747377928,11,19,-8,52,105,-53
pDZ-△ ilvBNC벡터를 코리네박테리움 글루타미쿰 ATCC 13032 hom(R407H) ilvA(F383A) 균주에 전기펄스법으로 도입한 후 카나마이신(kanamycin) 25mg/L를 함유한 선별배지에서 형질전환 균주를 획득하였다.,"The pDZ-AilvBNC vector was introduced into the Corynebacterium glutamicum ATCC 13032 hom(R407H) ilvA(F383A) strain by an electric pulse method, and then a transformed strain was obtained in a selection medium containing 25 mg/L of kanamycin.",True,0.176641434431076,0.9059210394800042,19,35,-16,133,241,-108
2차 재조합과정(cross-over)으로 염색체상에 삽입된 DNA 단편에 의하여 ilvBNC유전자가 결손된 균주인 WT△ilvBNC를 획득하였다.,"WTAilvBNC, which is the ilvBNC gene-deleted strain resulting from insertion of the DNA fragment onto the chromosome by the secondary crossover process, was obtained.",True,0.2728004157543182,0.840646923032693,12,24,-12,81,165,-84
"아세토하이드록시산 신타제 (acetohydroxy acid synthase, AHAS) (ilvBNC)를 코딩하는 유전자를 증폭하기 위하여 코리네박테리움 글루타미쿰 ATCC 13032 hom(R407H) ilvA(F383A) 유래의 서열 (서열번호 7)에 근거하여 프로모터 부위 (개시코돈 상단 약 300bp)로부터 터미네이터 부위 (종결코돈 하단 약 100bp)까지 증폭하기 위한 프라이머(서열번호 8 및 9)의 양 말단에 BamHI (밑줄로 표시) 제한 효소 부위를 삽입하여 고안하였다.","-28Example 4: Construction of Wild-Type ilvBNC Plasmid Having Acetohydroxy Acid Synthase (AHAS) Activity In order to amplify a gene encoding acetohydroxy acid synthase (AHAS) (ilvBNC), the BamHI restriction site (underlined) was inserted at both ends of primers (SEQ ID NOS: 8 and 9) for amplifying from the promoter region (about 300 bp upstream from the initiation codon) to the terminator region (about 100 bp downstream from the termination codon), based on the sequence (SEQ ID NO: 7) derived from Corynebacterium glutamicum ATCC 13032 hom(R407H) ilvA(F383A).",False,0.2565819025039673,0.8667489044745675,50,85,-35,274,564,-290
해당 서열은 하기 표 3에 나타내었다.,The corresponding sequences are shown in Table 3 below.,True,0.2397982776165008,0.8319836519239764,6,9,-3,21,55,-34
"중합효소는 SolgTM Pfu-X DNA 폴리머라제 (SolGent co.,Ltd.)를 사용하였으며, PCR 증폭 조건은 95℃에서 10분간 변성 후, 95℃ 30초 변성, 56℃ 30초 어닐링, 72℃ 4분 중합을 30회 반복한 후, 72℃에서 7분간 중합반응을 수행하였다.","[Table 3] SEQ ID NO: Sequence (5'-3') 8 TCCGGATCCTGACACACCATGACCATTATTC 9 TCCGGATCCCTTATGTACAAAGTGCACAGC As a polymerase, SolgTM Pfu-X DNA polymerase (SolGent co., Ltd.) was used, and PCR conditions were as follows: denaturation at 95°C for 10 minutes; 30 cycles of denaturation at 95°C for 30 seconds, annealing at 56°C for 30 seconds, and polymerization at 72°C for 4 minutes; and polymerization at 72°C for 7 minutes.",False,0.37146657705307,0.8019296621323537,31,64,-33,154,420,-266
그 결과 ilvBNC 유전자의 코딩 부위 4010bp의 DNA 단편을 수득하였다.,"Asaresult,a4,010bp DNA fragment of the coding region of ilvBNC gene was obtained.",False,0.2904823720455169,0.8241134261424081,10,12,-2,45,81,-36
"pECCG117 (대한민국 등록특허 제10-0057684호) 벡터와 ilvBN DNA 단편을 제한 효소 BamHⅠ으로 처리하고, DNA 접합 효소를 이용하여 연결한 후, 클로닝함으로써 플라스미드를 획득하였고 이를 pECCG117- ilvBNCWT라 명명하였다.","The pECCG117 vector (Korean Patent No. 10-0057684) and the ilvBN DNA fragment were treated with restriction enzyme BamHI, and ligated using a DNA ligase, and then cloned to obtain a plasmid, which was designated as pECCG117-ilvBNC WT.",True,0.147486001253128,0.9221375662989564,25,37,-12,145,234,-89
"실시예 5: 아세토하이드록시산 신타제 (acetohydroxy acid synthase, AHAS) 활성을 갖는 변이형 ilvBNC 플라스미드 제작","Example 5: Construction of Mutant ilvBNC Plasmid Having Acetohydroxy Acid Synthase (AHAS) Activity - 29In order to compare activity of the mutant ilvB producing a large amount of L isoleucine, a pair of primers (SEQ ID NOS: 8 and 10) for amplifying the 5'-upstream region of the mutation site, and a pair of primers (SEQ ID NOS: 11 and 9) for amplifying the 3'-downstream region of the mutation site were designed to construct a mutant introduced vector with respect to Corynebacterium glutamicum ATCC 13032 hom(R407H) ilvA(F383A)-derived acetohydroxy acid synthase (HAS) (SEQ ID NO: 7) encoding ilvB gene.",False,0.7025013566017151,0.6144420897997709,14,97,-83,82,606,-524
"L-이소류신을 과량 생산하는 변이형 ilvB의 활성을 비교하기 위해 코리네박테리움 글루타미쿰 ATCC 13032 hom(R407H) ilvA(F383A) 유래의 아세토하이드록시산 신타제 (acetohydroxy acid synthase, AHAS) (서열번호 7)를 코딩하는 ilvB 유전자를 대상으로 변이 도입 벡터를 제작하기 위하여 변이 위치를 중심으로 5'상단 부위를 증폭하기 위한 프라이머 한쌍 (서열번호 8 및 10)과 3' 하단 부위를 증폭하기 위한 프라이머 한쌍 (서열번호 11 및 9)을 고안하였다.",BamHI restriction sites (underlined) were inserted at each end of primers of SEQ ID NOS: 8 and 9.,False,1.0524446964263916,0.388293338807256,57,18,39,287,97,190
"서열번호 8 및 9의 프라이머는 각 말단에 BamHⅠ 제한 효소 부위(밑줄로 표시)를 삽입하였고, 서열번호 10 및 11의 프라이머는 서로 교차되도록 고안한 부위에 뉴클레오티드 치환 변이(밑줄로 표시)가 위치하도록 하였다.",Primers of SEQ ID NOS: 10 and 11 were prepared such that the nucleotide substitution mutation (underlined) was located at a site designed to cross each other.,False,0.5079718828201294,0.6980932797334098,28,27,1,124,158,-34
"코리네박테리움 글루타미쿰 ATCC 13032 hom(R407H) ilvA(F383A)의 염색체를 주형으로 하여 서열번호 8 및 서열번호 10, 서열번호 11 및 서열번호 9의 프라이머를 이용하여 PCR을 수행하였다.","[Table 4] SEQ ID NO: Sequence (5'-3') 8 TCCGGATCCTGACACACCATGACCATTATTC CTTCgttGAAAGCGTCGGTACCCAG 11 CTTTCaacGAAGCCGATATCCGCGG 9 TCCGGATCCCTTATGTACAAAGTGCACAGC PCR was carried out using the chromosome of Corynebacterium glutamicum ATCC 13032 hom(R407H) ilvA(F383A) as a template and primers of SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 9.",False,0.2641605138778686,0.8497923090439975,23,51,-28,120,355,-235
"중합효소는 SolgTM Pfu-X DNA 폴리머라제 (SolGent co.,Ltd.)를 사용하였으며, PCR 조건은 95℃에서 10분간 변성 후, 95℃ 30초 변성, 56℃ 30초 어닐링, 72℃ 3분 중합을 30회 반복한 후, 72℃에서 5분간 중합반응을 수행하였다.","As a polymerase, Solg TM Pfu-X DNA polymerase (SolGent co., Ltd.) was used, and PCR conditions were as follows: denaturation at 95°C for 10 minutes; 30 cycles of denaturation at 95°C for 30 seconds, annealing at 56°C for 30 seconds, and polymerization at 72°C for 3 minutes; and polymerization at 72°C for 5 minutes.",True,0.1940705329179763,0.8951941445094584,30,54,-24,151,316,-165
그 결과 ilvB유전자의 변이를 중심으로 5'상단 부위의 712bp DNA 단편과 3'하단 부위의 3310bp의 DNA 단편을 수득하였다.,"As a result, a 712 bp DNA fragment of the 5' upstream region of the mutation of ilvBNC gene and a 3,310 bp DNA fragment of the 3' downstream region of the mutation of the ilvBNC gene were obtained.",True,0.2106288522481918,0.8868071080111162,16,39,-23,77,197,-120
"증폭된 두 가지의 DNA 절편을 주형으로 하여, 서열번호 8 및 서열번호 9의 프라이머로 PCR을 수행하였다.",- 30PCR was carried out using the amplified two DNA fragments as templates and primers of SEQ ID NO: 8 and SEQ ID NO: 9.,False,0.266754150390625,0.8449026533428767,15,25,-10,61,120,-59
"PCR 조건은 95℃에서 10분간 변성 후, 95℃ 30초 변성, 56℃ 30초 어닐링, 72℃ 4분 중합을 30회 반복한 후, 72℃에서 7분간 중합반응을 수행하였다.","PCR conditions were as follows: denaturation at 95°C for 10 minutes; 30 cycles of denaturation at 95°C for 30 seconds, annealing at 56°C for 30 seconds, and polymerization at 72°C for 4 minutes; and polymerization at 72°C for 7 minutes.",True,0.2088779956102371,0.8845780145962427,22,40,-18,94,236,-142
"그 결과, 136번째 글루타민이 아스파라긴으로 치환된 아세토하이드록시산 신타제 (acetohydroxy acid synthase, AHAS) 변이체 (서열번호 12)를 코딩하는 ilvB 유전자의 변이(서열번호 2)를 포함하는 4010bp의 DNA 단편이 증폭되었다.","As a result, a 4,010 bp DNA fragment was amplified, which includes the mutant ilvB gene (SEQ ID NO: 2) encoding the acetohydroxy acid synthase (AHAS) variant (SEQ ID NO: 12), in which glutamine at position 136 was substituted with asparagine.",True,0.1618886888027191,0.9184945612756024,25,41,-16,148,242,-94
"pECCG117 (대한민국 등록특허 제10-0057684호) 벡터와 ilvBN DNA 단편을 제한 효소 BamHⅠ으로 처리하고, DNA 접합 효소를 이용하여 연결한 후, 클로닝함으로서 플라스미드를 획득하였고 이를 pECCG117-ilvB(Q136N)NC라 명명하였다.","The pECCG117 vector (Korean Patent No. 10-0057684) and the ilvBN DNA fragment were treated with restriction enzyme BamHI and ligated using a DNA ligase, and then cloned to obtain a plasmid, which was designated as pECCG117-ilvB(Q136N)NC.",True,0.1215511187911033,0.9358405078112236,24,36,-12,149,237,-88
"상기의 실시예 4 및 5에서 제작된 pECCG117-ilvBNC WT,pECCG117-ilvB(Q136N)NC 벡터를 실시예 3에서 제작된 WT△ilvBNC 균주에 전기펄스법으로 도입한 후 카나마이신(kanamycin) 25mg/L를 함유한 선별배지에 도말하여 각각의 형질전환주를 획득하였다.","Example 6: Comparative Experiment of Activities of Wild-Type and Mutant ilvB Having Acetohydroxy Acid Synthase (AHAS) Activity The pECCG117-ilvBNC WT and pECCG117-ilvB(Q136N)NC vectors, each prepared in Examples 4 and 5, were introduced into the WTAilvBNC strain prepared in Example 3 by an electric pulse method, and then each was plated on a selection medium containing 25 mg/L of kanamycin to obtain a transformant.",False,0.2851682305335998,0.8614271031121099,25,63,-38,163,418,-255
상기에 제작된 균주의 L-이소류신 생산능을 비교하고자 아래와 같은 방법으로 배양하여 배양액 중 L-이소류신 농도를 분석하였다.,"In order to compare L-isoleucine productivities of the prepared strains as above, the strains were cultured by the following method, and the concentration of L-isoleucine in the culture medium was analyzed.",True,0.1964053809642791,0.879857427351168,15,31,-16,70,206,-136
"하기의 배지 25㎖을 함유하는 250㎖ 코너-바플 플라스크에 균주를 1백금이 접종하고, 32℃에서 50시간 동안, 200rpm으로 진탕 배양하였다.",One platinum loop of each strain was inoculated into a 250 mL corner-baffle flask containing 25 mL of the following medium and cultured in a shaking incubator at 200 rpm at 32°C for 50 hours.,True,0.2013419568538665,0.8691127634598038,16,35,-19,82,191,-109
"HPLC를 이용하여 L-이소류신 농도를 분석하였으며, 분석된 농도는 표 5와 같다.","The concentrations of L-isoleucine were analyzed by HPLC, and the analyzed concentrations are as shown in Table 5.",True,0.1926895529031753,0.8819810931280824,10,18,-8,46,114,-68
"포도당 100 g, (NH4)2SO4 40 g, 대두 단백질 2.5 g, 옥수수 침지 고형분(Corn Steep Solids) 5 g, 요소 3 g, KH2PO4 1 g, MgSO4·7H2O 0.5 g, 바이오틴 100 ㎍, 티아민 염산염 1000 ㎍, 칼슘-판토텐산 2000 ㎍, 니코틴아미드 3000 ㎍, CaCO3 30 g (증류수 1리터 기준).","<Medium composition (pH 7.0)> Glucose 100 g, (NH4 ) 2SO4 40 g, Soybean Protein 2.5 g, Corn Steep Solids 5 g, -31Urea 3 g, KH 2PO4 1 g, MgSO4-7H20 0.5 g, Biotin 100 pg, Thiamine HCl 1,000 pg, Calcium-Pantothenic Acid 2,000 pg, Nicotinamide 3,000 pg, CaCO3 30 g (based on 1 L of distilled water).",True,0.1378421783447265,0.91086066132975,45,55,-10,197,294,-97
"상기의 표 5를 참고하면, 대조군 ilvBNC WT 플라스미드가 도입된 균주 대비, ilvB(Q136N)변이 플라스미드가 도입된 균주의 경우 L-이소류신을 13배 이상 생산하는 것을 확인하였다.","[Table 5] L-Isoleucine (g/L) Strain Batch 1 Batch 2 Batch 3 ATCC 13032 hom(R407H) 0.21 0.19 0.22 ilvA(F383A) ATCC 13032 hom(R407H) 0 0 0 ilvA(F383A) AilvBNC ATCC 13032 hom(R407H) ilvA(F383A) AilvBNC/ pECCG117- 0.23 0.22 0.24 ilvBNCWT ATCC 13032 hom(R407H) ilvA(F383A) AiIvBNC/pECCGI J7- 3.12 3.24 3.21 ilvB(Q136N)NC Referring to Table 5 above, the strain introduced with the ilvB(Q136N) mutant plasmid showed an at least 13-fold increase in the L-isoleucine production, as compared with the strain introduced with the control ilvBNC WT plasmid.",False,0.4316207766532898,0.7640029268791575,22,81,-59,108,544,-436
"즉, 상기 변이가 도입된 균주는 결과적으로 아세토하이드록시산 신타제 (acetohydroxy acid synthase, AHAS)의 활성이 좋아져, L-이소류신을 고효율 및 고수율로 생산할 수 있음을 확인할 수 있었다.","That is, the mutant introduced strain had enhanced acetohydroxy acid synthase (AHAS) activity, thereby producing L-isoleucine with high efficiency and in high yield.",True,0.1750330030918121,0.8980178306752836,24,23,1,122,165,-43
상기 변이 Q136N이 도입된 균주를 CA10-3106이라 명명하였다.,The mutant Q136N intrdouced strain was designated as CA10-3106.,True,0.1202113926410675,0.9218787474361826,7,9,-2,39,63,-24
상기 CA10-3106은 부다페스트조약 하의 국제기탁기관인 한국미생물보존센터에 2018년 12월 3일자로 기탁하여 수탁번호 KCCM12415P를 부여받았다.,"The CA1O-3106 was deposited to the Korean Culture Center of Microorganisms, which is an international depository authority under the Budapest Treaty, on December 3, 2018, with Accession No.",True,0.2506830394268036,0.8126915428432693,13,28,-15,87,189,-102
"KCCM11248P 균주는 코리네박테리움 글루타미쿰 KFCC 11040 (Corynebacterium glutamicum KFCC 11040, 대한민국특허 공개번호 제2000-0002407호)에 L-쓰레오닌 유도체인 α-아미노-β-하이드록시노르발린 (α-amino-β-hydroxynorvaline)과 L-이소류신 유도체인 4-티아이소루신 (4-thiaisoleucine) 및 이소루신-하이드록사메이트 (isoleucine-hydroxamate)의 공통내성을 나타내는 변이주(Corynebacterium glutamicum KCJI-38, KCCM11248P, 대한민국특허 등록번호 10-1335789호)로 코리네박테리움 글루타미쿰 ATCC 13032 hom(R407H) ilvA(F383A)보다 높은 수율로 L-이소루신을 생산하는 것이 확인된 바 있다.","- 32The KCCM11248P strain is a mutant strain (Corynebacterium glutamicum KCJI 38, KCCM11248P; Korean Patent No. 10-1335789) showing common resistance to a amino-p-hydroxynorvaline, which is an L-threonine derivative, and 4-thiaisoleucine and isoleucine-hydroxamate, which are L-isoleucine derivatives, in Corynebacterium glutamicum KFCC 11040 (Korean Patent Publication No. 2000-0002407), and the strain was confirmed to produce L-isoleucine in high yield, as compared with Corynebacterium glutamicum ATCC 13032 hom(R407H) ilvA(F383A).",False,0.2728733718395233,0.8508525298561743,47,66,-19,422,535,-113
"보다 많은 양의 L-이소류신을 생산하는 균주에서의 ilvB 변이체의 효과를 확인하기 위하여, 상기의 실시예 3과 동일한 방법으로 제작하여 KCCM11248P ΔilvBNC균주를 제작하였다.","To examine the effect of the ilvB variant in the strain producing a larger amount of L-isoleucine, the KCCM11248P AilvBNC strain was prepared in the same manner as in Example 3.",True,0.1400025486946106,0.9268368853757422,20,31,-11,105,177,-72
"또한 상기의 실시예 4와 5에서 제작된 pECCG117-ilvBNC WT, pECCG117-ilvB(Q136N)NC 벡터를 이소류신 생산능이 증대된 균주인 코리네박테리움 글루타미컴 KCJI-38 (KCCM11248P)에 전기펄스법으로 도입한 후 카나마이신(kanamycin) 25mg/L를 함유한 선별배지에 도말하여 각각의 형질전환주를 획득하였다.","Further, the pECCG117-ilvBNC WT and pECCG117-ilvB(Q136N)NC vectors, prepared in Examples 4 and 5, respectively, were introduced into Corynebacterium glutamicum KCJI-38 (KCCM11248P), which is a strain having an enhanced ability to produce isoleucine, by an electric pulse method, and then each was plated on a selection medium containing 25 mg/L of kanamycin to obtain a transformant.",True,0.1176611632108688,0.943108163067559,29,55,-26,194,383,-189
"상기에 제작된 균주의 L-이소류신 생산능을 비교하고자 실시예 6과 동일한 방법으로 배양하여 배양액 중 L-이소류신 농도를 분석하였으며, 분석된 농도는 표 6과 같다.","To compare L-isoleucine productivities of the prepared strains as above, the strains were cultured in the same manner as in Example 6.",False,0.3098180294036865,0.8126622657554041,21,22,-1,92,134,-42
"상기의 표 6을 참고하면, 대조군 ilvBNC WT 플라스미드가 도입된 균주 대비, ilvB(Q136N)변이 플라스미드가 도입된 균주의 경우 L-이소류신을 약 6배 높게 생산하는 것을 확인하였다.","[Table 6] L-Isoleucine (g/L) Strain Batch 1 Batch 2 Batch 3 Corynebacterium glutamicum KC JI 0.92 0.87 0.84 38 (KCCM11248P) KCCMJ1248PAilvBNC 0 0 0 KCCM11248PAilvBNC/ 1.21 1.4 1.28 pECCG117-ilvBNC WT - 33KCCM] l248PAilvBNC/pECCG1 17- 74.677 ilvB(Q]36N)NC Referring to Table 6 above, the strain introduced with the ilvB(Q136N) mutant plasmid showed an about 6-fold increase in the L-isoleucine production as compared with the strain introduced with the control ilvBNC WT plasmid.",False,0.3940454721450805,0.7849101523859344,23,70,-47,109,478,-369
"즉, 상기 변이가 도입된 균주는 결과적으로 아세토하이드록시산 신타제 (acetohydroxy acid synthase, AHAS)의 활성이 좋아져, L-이소류신을 고효율 및 고수율로 생산할 수 있음을 확인할 수 있었다.","That is, the mutant introduced strain had enhanced acetohydroxy acid synthase (AHAS) activity, thereby producing L-isoleucine with high efficiency and in high yield.",True,0.1750330030918121,0.8980178306752836,24,23,1,122,165,-43
상기 실시예 6을 통해 L-이소류신 생산능이 높은 ilvB 변이 위치인 136번째 위치가 생산능 증가에 중요한 위치임을 확인하기 위하여 다른 아미노산이 치환된 변이형을 제작하여 그 효과를 확인하였다.,"Example 7: Construction of Mutant ilvBNC Plasmid Having Acetohydroxy Acid Synthase (AHAS) Activity In order to examine that position 136, which was confirmed in Example 6 as the ilvB mutation site with high L-isoleucine productivity, is an important position for increasing productivity, mutant types having different amino acid substitutions were prepared, and the effects thereof were confirmed.",False,0.2502780258655548,0.8668406389075349,26,57,-31,111,397,-286
"ilvB의 136번째 아미노산 위치에 다른 아미노산이 치환된 17종을 추가로 제작하였으며, 실시예 4에서 제작된 플라스미드를 주형으로 사용하였다.","17 mutants, each in which the amino acid at position 136 of ilvB was substituted with another amino acid, were additionally prepared, and the plasmid prepared in Example 4 was used as a template.",True,0.1717496961355209,0.905172832320854,16,34,-18,81,195,-114
"각각의 변이형, 치환된 아미노산 및 각 변이형에 사용된 프라이머 서열번호는 다음 표 7에 나타내었다.","Respective mutants, substituted amino acids, and primers used in each mutant are shown in Table 7 below.",True,0.1871660947799682,0.8811555382869173,14,17,-3,56,104,-48
"구체적으로, 상기 표 7에서 제시한 프라이머를 이용하여 PCR을 수행하였다.","[Table 7] Mutant plasmid Substituted amino acid SEQ ID NO of primer Q136R SEQ ID NO: 8, 13 /SEQ ID NO: 14, 9 Q136F SEQ ID NO: 8, 15 /SEQ ID NO: 16, 9 136 mutation Q136S SEQ ID NO: 8, 17 /SEQ ID NO: 18, 9 Q136Y SEQ ID NO: 8, 19 /SEQ ID NO: 20, 9 - 34Q136C SEQ ID NO: 8, 21 / SEQ ID NO: 22, 9 Q136P SEQ ID NO: 8, 23 / SEQ ID NO: 24, 9 Q136H SEQ ID NO: 8, 25 / SEQ ID NO: 26, 9 Q136L SEQ ID NO: 8, 27 / SEQ ID NO: 28, 9 Q1361 SEQ ID NO: 8, 29 / SEQ ID NO: 30, 9 Q136T SEQ ID NO: 8, 31 / SEQ ID NO: 32, 9 Q136K SEQ ID NO: 8, 33 / SEQ ID NO: 34, 9 Q136V SEQ ID NO: 8, 35 / SEQ ID NO: 36, 9 Q136A SEQ ID NO: 8, 37 / SEQ ID NO: 38, 9 Q136D SEQ ID NO: 8, 39 / SEQ ID NO: 40, 9 Q136E SEQ ID NO: 8, 41 / SEQ ID NO: 42, 9 Q136G SEQ ID NO: 8, 43 / SEQ ID NO: 44, 9 Q136W SEQ ID NO: 8, 45 / SEQ ID NO: 46, 9 Specifically, PCR was carried out using the primers in Table 7.",False,0.9822719097137452,0.3659005800320565,9,226,-217,42,858,-816
"중합효소는 SolgTM Pfu-X DNA 폴리머라제 (SolGent co.,Ltd.)를 사용하였으며, PCR 조건은 95℃에서 10분간 변성 후, 95℃ 30초 변성, 56℃ 30초 어닐링, 72℃ 3분 중합을 30회 반복한 후, 72℃에서 5분간 중합반응을 수행하였다.","As a polymerase, SolgTM Pfu-X DNA polymerase (SolGent co., Ltd.) was used, and PCR conditions were as follows: denaturation at 95°C for 10 minutes; 30 cycles of denaturation at 95°C for 30 seconds, annealing at 56°C for 30 seconds, and polymerization at 72°C for 3 minutes; and polymerization at 72°C for 5 minutes.",True,0.1924620866775512,0.8965821504874533,30,53,-23,151,315,-164
그 결과 ilvB유전자의 변이를 중심으로 5' 상단 부위의 712bp DNA 단편과 3' 하단 부위의 3310bp의 DNA 단편을 수득하였다.,"As a result, a 712 bp DNA fragment of the 5' upstream region of the ilvB gene and a 3,310 bp DNA fragment of the 3'-downstream region of the ilvB gene were obtained.",True,0.1786185503005981,0.9027245991073616,18,33,-15,79,165,-86
"증폭된 두 가지의 DNA 절편을 주형으로 하여, 서열번호 8 및 서열번호 9의 프라이머로 PCR을 수행하였다.",PCR was carried out using the amplified two DNA fragments as a template and primers of SEQ ID NO: 8 and SEQ ID NO: 9.,True,0.1488824039697647,0.9136293603650504,15,25,-10,61,117,-56
"PCR 조건은 95℃에서 10분간 변성 후, 95℃ 30초 변성, 56℃ 30초 어닐링, 72℃ 4분 중합을 30회 반복한 후, 72℃에서 7분간 중합반응을 수행하였다.","PCR conditions were as follows: denaturation at 95°C for 10 minutes; 30 cycles of denaturation at 95°C for 30 seconds, annealing at 56°C for 30 seconds, and polymerization at 72°C for 4 minutes; and polymerization at 72°C for 7 minutes.",True,0.2088779956102371,0.8845780145962427,22,40,-18,94,236,-142
"그 결과, 136번째 글루타민이 표 7의 각 아미노산으로 치환된 아세토하이드록시산 신타제 (acetohydroxy acid synthase, AHAS) 변이체를 코딩하는 ilvB 유전자의 변이를 포함하는 4010bp의 DNA 단편이 증폭되었다.","As a result, 4,010bp DNA fragments were - 35amplified, each including the mutant ilvB gene encoding the acetohydroxy acid synthase (AHAS) variant in which glutamine at position 136 was substituted with each amino acid of Table 7.",True,0.2267617136240005,0.8862906825518602,25,37,-12,136,229,-93
"pECCG117 (대한민국 등록특허 제10-0057684호) 벡터와 PCR을 통해 수득한 4010bp의 ilvBNC DNA 단편을 제한 효소 BamHⅠ으로 처리하고, DNA 접합 효소를 이용하여 연결한 후, 클로닝함으로써 플라스미드를 획득하였다.","The pECCG117 vector (Korean Patent No. 10-0057684) and each of the 4,010 bp ilvBNC DNA fragments obtained by PCR were treated with restriction enzyme BamHI and ligated using a DNA ligase, and then cloned to obtain each plasmid.",True,0.2387329638004303,0.8734042951708623,25,38,-13,137,227,-90
"이로써 136번째 글루타민이 표 7에 나타난 아미노산으로 치환된 17종의 ilvB 변이 벡터가 제작되었고, 표 8과 같이 명명하였다.","As a result, 17 ilvB mutant vectors were prepared, each having substitution of glutamine at position 136 with the amino acid of Table 7, and designated as in Table 8.",True,0.1889592111110687,0.8990187889314827,17,30,-13,74,166,-92
"실시예 8: 아세토하이드록시산 신타제 (acetohydroxy acid synthase, AHAS) 활성을 갖는 변이형 ilvB의 L-이소류신 생산능 평가","[Table 8] Mutation site Substituted amino acid SEQ ID NO of primer Q136R pECCG117-ilvB(Q136R)NC Q136F pECCG117-ilvB(Q136F)NC Q136S pECCG117-ilvB(Q136S)NC Q136Y pECCG117-ilvB(Q136Y)NC Q136C pECCG117-ilvB(Q136C)NC Q136P pECCG117-ilvB(Q136P)NC Q136H pECCG117-ilvB(Q136H)NC ilvB 136 mutation Q136L pECCG117-ilvB(Q136L)NC Q1361 pECCG117-ilvB(Q1361)NC Q136T pECCG117-ilvB(Q136T)NC Q136K pECCG117-ilvB(Q136K)NC Q136V pECCG117-ilvB(Q136V)NC Q136A pECCG117-ilvB(Q136A)NC Q136D pECCG117-ilvB(Q136D)NC Q136E pECCG117-ilvB(Q136E)NC - 36Q136G pECCG1I17-ilvB(Q 13 6G)NC Q136W pECCG1I17-ilvB(Q136W)NC Example 8: Evaluation of L-Isoleucine Productivity of Mutant ilvB Having Acetohydroxy Acid Synthase (AHAS) Activity Each of the 17 mutant plasmids prepared in Example 7 was introduced into the WTAilvBNC strain prepared in Example 3 by an electric pulse method, and then each was plated on a selection medium containing 25 mg/L of kanamycin to obtain a transformant.",False,0.9980742931365968,0.4019732426054054,15,110,-95,86,951,-865
"그 후, 실시예 6과 동일한 방법으로 플라스크 평가를 진행하였다.","Thereafter, a flask test was performed in the same manner as in Example 6.",True,0.1715462356805801,0.8846554100197901,9,14,-5,36,74,-38
그 결과는 다음 표 9과 같다.,The results are shown in Table 9 below.,True,0.1460362821817398,0.9023022536802596,6,8,-2,17,39,-22
"상기의 표 9에서 볼 수 있듯이, ilvB의 136번째 아미노산이 변이된 변이체를 포함하는 모든 변이주에서 각각 야생형 보다 높은 수준으로 L-이소류신을 생성하는 것을 확인하였다.","[Table 9] L-Isoleucine (g/L) Strain Batch 1 Batch 2 Batch 3 ATCC 13032 hom(R407H) 0.23 0.21 0.20 ilvA(F383A) ATCC 13032 hom(R407H) 0 0 0 ilvA(F383A) AilvBNC ATCC 13032 hom(R407H) ilvA(F383A) AilvBNC/pECCG117- 0.21 0.20 0.19 ilvBNC WT ATCC 13032 hom(R407H) ilvA(F383A) AilvBNC/pECCG117- 3.01 3.12 3.20 ilvB(Q136N)NC ATCC 13032 hom(R407H) 2.87 3.00 2.95 ilvA(F383A)AilvBNC/pECCG117 -37ilvB(Q136R)NC ATCC 13032 hom(R407H) ilvA(F383A) AilvBNC/pECCG117- 3.11 3.15 3.04 ilvB(Q136F)NC ATCC 13032 hom(R407H) ilvA(F383A) AilvBNC/pECCG117- 1.89 0.86 0.91 ilvB(Q136S)NC ATCC 13032 hom(R407H) ilvA(F383A) AilvBNC/pECCG117- 2.96 2.76 2.74 ilvB(Q136Y)NC ATCC 13032 hom(R407H) ilvA(F383A) AilvBNC/pECCG117- 2.56 2.48 2.61 ilvB(Q136C)NC ATCC 13032 hom(R407H) ilvA(F383A) AilvBNC/pECCG117- 1.45 1.23 1.34 ilvB(Q136P)NC ATCC 13032 hom(R407H) ilvA(F383A) AilvBNC/pECCG117- 2.99 2.96 2.98 ilvB(Q136H)NC ATCC 13032 hom(R407H) ilvA(F383A) AilvBNC/pECCG117- 3.02 3.10 3.06 ilvB(Q136L)NC ATCC 13032 hom(R407H) ilvA(F383A) AilvBNC/pECCG117- 2.45 2.41 2.39 ilvB(Q1361)NC - 38ATCC 13032 hom(R407H) ilvA(F383A) AilvBNC/pECCG117- 0.81 0.83 0.79 ilvB(Q136T)NC ATCC 13032 hom(R407H) ilvA(F383A) AilvBNC/pECCG117- 3.01 3.05 3.00 ilvB(Q136K)NC ATCC 13032 hom(R407H) ilvA(F383A) AilvBNC/pECCG117- 1.23 1.25 1.19 ilvB(Q136V)NC ATCC 13032 hom(R407H) ilvA(F383A) AilvBNC/pECCG117- 3.00 3.01 2.94 ilvB(Q136A)NC ATCC 13032 hom(R407H) ilvA(F383A) AilvBNC/pECCG117- 2.75 2.81 2.83 ilvB(Q136D)NC ATCC 13032 hom(R407H) ilvA(F383A) AilvBNC/pECCG117- 1.01 1.01 0.99 ilvB(Q136E)NC ATCC 13032 hom(R407H) ilvA(F383A) AilvBNC/pECCG117- 1.02 0.98 1.05 ilvB(Q136G)NC ATCC 13032 hom(R407H) ilvA(F383A) AilvBNC/pECCG117- 2.65 2.67 2.63 ilvB(Q136W)NC As shown in Table 9, it was confirmed that all mutant strains, each including the mutant amino acid at position 136 of ilvB, produced a high level of L-isoleucine as - 39compared with the wild-type.",False,0.9284583926200868,0.4471109100594538,23,233,-210,100,1895,-1795
이와 같은 결과로 ilvB의 136번째 위치가 다른 아미노산으로 치환할 경우 L-이소류신의 생산능을 증가시키는 중요 위치임을 확인할 수 있었다.,These results indicate that substitution of the amino acid at position 136 of ilvB with another amino acid is important for increasing L-isoleucine productivity.,True,0.192090556025505,0.8851973480537364,18,24,-6,80,161,-81
"상기의 결과를 볼 때, 본 출원의 변이체가 L-이소류신의 생산을 증가시킴을 확인할 수 있었다.",The above results suggest that the variants of the present disclosure increase L isoleucine production.,True,0.2755453586578369,0.8138986678161348,13,15,-2,52,103,-51
"이상의 설명으로부터, 본 출원이 속하는 기술분야의 당업자는 본 출원이 그 기술적 사상이나 필수적 특징을 변경하지 않고서 다른 구체적인 형태로 실시될 수 있다는 것을 이해할 수 있을 것이다.","From the foregoing, a skilled person in the art to which the present disclosure pertains will be able to understand that the present disclosure may be embodied in other specific forms without modifying the technical concepts or essential characteristics of the present disclosure.",True,0.1810133308172226,0.8673528426749922,27,43,-16,105,280,-175
"이와 관련하여, 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적인 것이 아닌 것으로 이해해야만 한다.","In this regard, the exemplary embodiments disclosed herein are only for illustrative purposes and should not be construed as limiting the scope of the present disclosure.",True,0.3949317634105682,0.7038645520112463,15,26,-11,64,170,-106
본 출원의 범위는 상기 상세한 설명보다는 후술하는 특허 청구범위의 의미 및 범위 그리고 그 등가 개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본 출원의 범위에 포함되는 것으로 해석되어야 한다.,"On the contrary, the present disclosure is intended to cover not only the exemplary embodiments but also various alternatives, modifications, equivalents, and other embodiments that may be included within the spirit and scope of the present disclosure as defined by the appended claims.",True,0.4861501455307007,0.6653877003496276,29,43,-14,111,286,-175
한국미생물보존센터KCCM12415P20200902,International Depositary Authority: Korean Culture Center of Microorganisms Accession No: KCCM12415P Date of deposit: 20181203 - 40,True,0.4749705493450165,0.5867378639124969,1,17,-16,27,131,-104
직기{LOOM},TECHNICAL FIELD,False,0.9359261393547058,0.1838965014004174,1,2,-1,8,15,-7
"[본 발명은, 한 쌍의 사이드 프레임을 포함하는 직기(織機) 프레임 및 각 사이드 프레임에 장착되어 종광 프레임의 상하 이동을 안내하는 종광 프레임 가이드를 구비하고, 양 사이드 프레임의 사이에 가설(架設)되는 로킹 축, 주축, 복권(服卷) 롤이 지지축을 통하여 각 사이드 프레임에 지지되어 있는 직기로서, 지지축이 적어도 사이드 프레임의 내측벽에 설치된 지지부에 끼워져 장착된 베어링을 통하여 지지되는 직기에 관한 것이다.]","The present invention relates to a loom including a loom frame including a pair of side frame and heddle frame guides each attached to each of the side frames and configured to guide up-and-down movement of a heddle frame, wherein a rocking shaft, a main shaft, and a cloth winding roll bridged between both the side frames are supported on each of the side frames via support shafts and the support shafts are supported via bearings fitted in support parts provided in at least inner walls of the side frames.",True,0.23964624106884,0.8883936263871821,56,90,-34,238,510,-272
"[일반적인 직기는, 예를 들면 특허문헌 1에 개시되어 있는 바와 같이, 직기 프레임에서의 한 쌍의 사이드 프레임의 사이에 가설된 로킹 축(로킹 샤프트) 및 주축(主軸)(구동축)을 가지고 있다.","As disclosed in PTL 1, for example, a general loom has a rocking shaft and a main shaft (drive shaft) bridged between a pair of side frames of a loom frame.",True,0.259593665599823,0.8612639922291137,25,31,-6,107,156,-49
"그리고, 그 로킹 축 및 주축은, 각 사이드 프레임에 있어서 그 사이드 프레임의 내측벽 및 외측벽의 각각에 대하여 베어링을 통하여 지지된 지지축에 연결됨으로써, 양 사이드 프레임 사이에 설치되어 있다.]",The rocking shaft and the main shaft are provided between both the side frames by being connected to support shafts supported via bearings with respect to each of an inner wall and an outer wall of each of the side frames.,True,0.2827490270137787,0.8545970053145686,29,41,-12,113,222,-109
"[또한, 직기는, 제직(製織)된 직포를 직포 밀도에 따른 속도로 권취빔 측에 보내는 권취 기구(機構)를 구비하고 있고, 그 권취 기구는, 한 쌍의 사이드 프레임의 사이에 가설된 복권 롤을 구비하고 있다.",The loom also has a winding mechanism configured to send the manufactured woven fabric toward a winding beam at a speed corresponding to a woven fabric density.,True,0.5181475281715393,0.6826321640459662,28,27,1,113,160,-47
"또한, 그 복권 롤도, 상기와 같은 형태로 각 사이드 프레임에 지지된 지지축에 연결됨으로써, 양 사이드 프레임 사이에 설치된 상태로 되어 있는 것이 일반적이다.]","For reference, the cloth winding roll is also generally provided between both the side frames by being connected to support shafts supported on each of the side frames in the above-described form.",False,0.3214739859104156,0.8466279475486761,23,32,-9,90,196,-106
"[나아가서는, 직기는, 개구 장치에서의 종광 프레임의 상하 이동을 안내하기 위한 한 쌍의 종광 프레임 가이드를 구비하고 있다.","In addition, the loom has a pair of heddle frame guides for guiding up-and-down movement of a heddle frame of an opening device.",True,0.3479866087436676,0.7826257052284348,17,23,-6,70,128,-58
"그리고, 그 종광 프레임 가이드는, 각 사이드 프레임에 지지되는 형태로 직기 상에 설치되어 있다.]",The heddle frame guides are each provided on the loom in a form of being supported on each of the side frames.,True,0.3447375893592834,0.7936064906033504,14,22,-8,55,110,-55
"[그리고, 직기는, 제직하는 직물의 짜는 폭(織幅)을 기준으로 하여 그 사양이 정해져 있다.","Note that, the specification of the loom is defined based on a weaving width of a fabric to be woven.",True,0.343149185180664,0.7562723946162162,12,20,-8,51,101,-50
"그리고, 직기에 탑재되는 종광 프레임은, 그 직기에 있어서 제직할 수 있는 최대의 짜는 폭에 따른 폭으로 되어 있다.",The heddle frame mounted on the loom has a width corresponding to the greatest weaving width that can be woven in the loom.,True,0.3492119312286377,0.7668060093796542,18,23,-5,65,123,-58
"또한, 그 직기에 있어서는, 종광 프레임은, 전술한 바와 같이 한 쌍의 종광 프레임 가이드에 의해 상하 이동을 안내하지만, 그 각 종광 프레임 가이드는, 대응하는 사이드 프레임에 장착된 브래킷(bracket) 등에 의해 지지되어 있다.]",The heddle frame guides are each supported by means of brackets and the like each attached to the corresponding side frame.,False,0.6388189196586609,0.6521079247358802,32,21,11,132,123,9
"[이 때문에, 그 한 쌍의 종광 프레임 가이드의 간격은, 직기의 폭 방향에서의 양쪽 브래킷의 위치에 의해 획정(劃定)된다.","For this reason, an interval between the pair of heddle frame guides is defined by positions of both the brackets in a width direction of the loom.",True,0.2628433406352997,0.84497741938899,17,27,-10,68,147,-79
"따라서, 그 브래킷이 장착되는 양 사이드 프레임의 간격은, 그 각 사이드 프레임에 대하여 브래킷를 통하여 지지되는 한 쌍의 종광 프레임 가이드가 종광 프레임을 전술한 바와 같이 안내할 수 있는 간격으로 배치된 상태가 되도록 설정된다.","Therefore, an interval between both the side frames to which the brackets are attached is set such that the pair of heddle frame guides supported on each of the side frames via the brackets is arranged at an interval at which they can guide the heddle frame as described above.",True,0.2145390808582306,0.8965164268665181,34,50,-16,130,277,-147
"즉, 직기 프레임에서의 한 쌍의 사이드 프레임의 간격은, 그 브래킷이 장착되는 위치(경사(warp threads) 방향에서의 종광 프레임 가이드를 지지하는 위치)의 간격이 상기와 같은 종광 프레임 가이드의 배치를 실현하도록 되어 있고, 종광 프레임의 폭을 고려한 그 브래킷이 장착되는 위치의 간격을 기준으로 하여 정해져 있다.]","Specifically, the interval between the pair of side frames of the loom frame is set such that the interval between positions in which the brackets are attached (positions in a warp direction, in which the heddle frame guides are supported) implements arrangement of the heddle frame guides as described above, and is determined based on the interval between the positions in which the brackets are attached taking into consideration a width of the heddle frame.",True,0.3285103440284738,0.8449092029657588,42,75,-33,183,461,-278
"[또한, 많은 직기에서는, 그 브래킷은, 사이드 프레임의 내측면에 대하여 장착되어 있다.","For reference, in most of the looms, the brackets are attached to the inner surfaces of the side frames.",True,0.4660160839557647,0.6899408959210918,11,19,-8,49,104,-55
"즉, 사이드 프레임에서의 브래킷이 장착되는 위치는, 그 내측면이 되어 있다.","Specifically, a position of the side frame in which the bracket is attached is on the inner surface.",True,0.3547358810901642,0.7784300243345778,10,18,-8,42,100,-58
"또한, 그 내측면은, 약간의 요철은 있지만, 대략 평면형으로 형성되어 있다.]","In addition, the inner surface is substantially planar although there is slight unevenness.",True,0.3032067120075226,0.7841153967383171,10,13,-3,43,91,-48
[PatentCitationText[attributes={}; value=[일본공개특허 평9―228193호 공보]]],[PTL 1] JPH09-228193A,False,0.5524430274963379,0.5394313458763115,4,3,1,65,21,44
"[이러한 직기에 있어서는, 양 사이드 프레임의 사이에 가설되어 있는 장척(長尺)의 축 부재인 상기한 로킹 축, 주축 및 복권 롤이 제직에 따라 진동하는 것이 알려져 있다.]","In the loom, it is known that the rocking shaft, the main shaft and the cloth winding roll, which are long shaft members bridged between both the side frames, are caused to vibrate in association with the weaving.",True,0.4634825587272644,0.7283081498144565,25,38,-13,96,213,-117
"[구체적으로는, 바디(reed)를 지지하는 로킹 축은, 그 제직 중의 바디치기 동작에 따라, 바디가 직포의 직전(織前; 직기의 운전자 위치 부근)을 치는 바디치기의 충격을 받고, 이에 의해 진동한다.","Specifically, the rocking shaft for supporting a reed is subj ected to an impact of beating resulting from reed's hitting a cloth fell of a woven fabric in association with a beating operation during weaving, and is thus caused to vibrate.",True,0.545276939868927,0.6807966725857558,25,41,-16,111,239,-128
"또한, 그 로킹 축은, 링크 기구 등의 운동 변환 기구를 통하여 주축과 연결되어 있고, 주축이 회전 구동되는 것에 의해 요동(搖動) 구동되는 것이다.","In addition, the rocking shaft is connected to the main shaft via a motion converting mechanism such as a link mechanism, and is caused to rock as the main shaft is rotated.",True,0.2965635061264038,0.8130885917476495,22,32,-10,83,173,-90
"따라서, 전술한 바와 같이 로킹 축이 바디치기 동작에 따라 진동함으로써, 그 로킹 축과 운동 변환 기구를 통하여 연결된 주축도 진동한다.]","Therefore, the rocking shaft vibrates in association with the beating operation, so that the main shaft connected to the rocking shaft via the motion converting mechanism is also caused to vibrate.",True,0.4377685487270355,0.7344995762567862,20,31,-11,77,197,-120
"[또한, 복권 롤은, 전술한 바와 같이 제직된 직포를 권취빔 측에 보내기 위하여, 직포가 권취되어 걸린 형태로 설치되어 있는 것이며, 또한 그 직포는, 직전에 있어서 경사 빔으로부터 송출된 경사와 연속되어 있다.","The cloth winding roll is provided in such a form that the woven fabric is wound, so as to send the woven fabric manufactured as described above toward the winding beam, and the woven fabric is continuous with a warp of the cloth fell delivered from a warp beam.",True,0.4322856366634369,0.7431161058840278,30,49,-19,118,262,-144
"그리고, 그 직포는, 전술한 바와 같이 바디가 직전을 치는 것에 의한 충격을 받고 또한, 제직에 따른 경사의 장력 변동에 의해 직전을 전후 방향으로 변위시키고자 하는 힘을 받는다.","The woven fabric is subjected to the impact resulting from reed's hitting the cloth fell, as described above, and is also applied with a force of displacing the cloth fell in a front and rear direction by tension variation of the warp in association with the weaving.",True,0.5219766497612,0.6786779788835536,27,47,-20,100,267,-167
"이에 따라, 주기적인 힘이 직포를 통하여 복권 롤에 대하여 작용하므로, 이에 따라 복권 롤도 진동한다.]","Accordingly, since the periodic force acts on the cloth winding roll via the woven fabric, the cloth winding roll is thus caused to vibrate.",True,0.3038646578788757,0.7990969841351064,15,24,-9,58,140,-82
"[그리고, 이들 축 부재는, 전술한 바와 같이 직기 프레임에서의 한 쌍의 사이드 프레임에 대하여 가설되는 형태로 설치되어 있다.","The shaft members are provided in a form of being bridged between the pair of side frames of the loom frame, as described above.",True,0.5052129030227661,0.6971782513964276,18,24,-6,71,128,-57
"따라서, 이들 축 부재가 전술한 바와 같이 진동함으로써, 양 사이드 프레임, 나아가서는 직기 프레임 전체가, 진동하게 된다.","Therefore, when the shaft members are caused to vibrate as described above, both the side frames, and the entire loom frame is caused to vibrate.",True,0.3757536411285418,0.780345764382523,17,25,-8,69,145,-76
"특히, 최근의 직기의 고속화에 따라, 그 진동은 보다 격렬해지고 있다.","Particularly, in recent years, as an operation of the loom tends to increase in speed, the vibrations become more severe.",True,0.305976390838623,0.7582114561793803,10,20,-10,39,121,-82
"그리고, 이렇게 직기 프레임이 격렬하게 진동함으로써, 소음의 문제나, 제직에 악영향을 미치는 문제가 발생하는 경우가 있다.]",The severe vibrations of the loom frame causes a noise problem and badly influences the weaving.,True,0.4446570575237274,0.6648918750085063,15,16,-1,69,96,-27
"[이상과 같은 종래의 직기를 감안하여, 본 발명은, 상기와 같은 양 사이드 프레임의 사이에 가설되는 로킹 축, 주축, 복권 롤이 지지축을 통하여 각 사이드 프레임에 지지되어 있는 직기에 있어서, 상기와 같은 문제의 발생을 가급적 억제할 수 있는 직기를 제공하는 것을 목적으로 한다.]","The present invention has been made in view of the above situations, and an object thereof is to provide a loom capable of suppressing the above-described problems as much as possible, where a rocking shaft, a main shaft, and a cloth winding roll bridged between both side frames are supported on each of the side frames via support shafts.",True,0.3781738579273224,0.7968301949266372,41,59,-18,158,340,-182
"[본 발명은, 한 쌍의 사이드 프레임을 포함하는 직기 프레임 및 각 사이드 프레임에 장착되어 종광 프레임의 상하 이동을 안내하는 종광 프레임 가이드를 구비하고, 양 사이드 프레임의 사이에 가설되는 로킹 축, 주축, 복권 롤이 지지축을 통하여 각 사이드 프레임에 지지되어 있는 직기이며, 지지축이 적어도 사이드 프레임의 내측벽에 설치된 지지부에 끼워져 장착된 베어링을 통하여 지지되는 직기를 전제로 한다.]","A preamble of the present invention is a loom including a loom frame including a pair of side frames and heddle frame guides each attached to each of the side frames and configured to guide up-and-down movement of a heddle frame, wherein a rocking shaft, a main shaft, and a cloth winding roll bridged between both the side frames are supported on each of the side frames via support shafts and the support shafts are supported via bearings fitted in support parts provided in at least inner walls of the side frames.",True,0.2774149179458618,0.8684587259284594,56,92,-36,226,517,-291
"[그리고, 본 발명은, 적어도 한쪽의 사이드 프레임의 내측벽은, 직기의 폭 방향에 관한 것이며, 내측벽에서의 내측면 중 경사 방향에서의 종광 프레임 가이드를 지지하는 부분의 위치를 기준 위치로 한 후에, 적어도 1개의 지지부가 베어링의 지지 위치의 내측단(內側端)을 기준 위치보다 직기 프레임에서의 내측에 위치시킨 오프셋 지지부가 되도록 형성되어 있는 것을 특징으로 한다.]","The present invention is characterized in that the inner wall of at least one side frame has, as a reference position, a position of a part, which supports the heddle frame guide in a warp direction, of an inner surface of the inner wall with respect to a width direction of the loom and at least one support part is formed to be an offset support part at which an inner end in a support position of the bearing is located on a more inner side of the loom frame than the reference position.",True,0.2434745281934738,0.8858377106024479,49,94,-45,209,490,-281
"[또한, 이러한 본 발명에 의한 직기에 있어서, 오프셋 지지부는, 베어링의 지지 위치가 기준 위치보다 직기 프레임에서의 내측에 위치하도록 구성된 것이라도 된다.","In the loom according to the present invention, the offset support part may be formed so that the support position of the bearing is located on a more inner side of the loom frame than the reference position.",True,0.2734590470790863,0.8650670771906004,21,38,-17,89,208,-119
"또한, 그 직기는, 로킹 축 및/또는 주축에 연결되는 지지축을 지지하는 지지부가 오프셋 지지부가 되도록 구성된 것이라도 된다.]","Further, the loom may be configured such that the support part configured to support the support shaft connected to the rocking shaft and/or the main shaft is to be the offset support part.",True,0.2633041739463806,0.8634342145390085,17,33,-16,71,189,-118
"[본 발명에 의하면, 상기와 같은 양 사이드 프레임의 사이에 가설되는 각각의 상기 축 부재가 지지축을 통하여 각 사이드 프레임의 내측벽에 설치된 지지부에 지지되는 직기에 있어서, 적어도 1개의 상기 지지부가, 그 상기 지지부에 끼워져 장착되는 베어링의 지지 위치의 내측단을 상기한 기준 위치보다 직기 프레임에서의 내측에 위치시킨 오프셋 지지부가 되도록 형성된 구성으로 된다.","According to the present invention, in the loom where each of the shaft members bridged between both the side frames is supported via the support shaft by the support part provided in the inner wall of each side frame, at least one support part is formed to be an offset support part at which an inner end of the support position of the bearing fitted to the support part is located on a more inner side of the loom frame than the reference position.",True,0.2111638486385345,0.9051455913957248,51,84,-33,209,450,-241
"그리고, 이와 같이 구성된 직기에 의하면, 제직에 따라 발생하는 직기 프레임 전체의 진동이 보다 억제되게 되므로, 소음이나 제직에 악영향을 미치는 문제의 발생을 가급적 억제할 수 있다.]","According to the loom configured in this way, the vibrations of the entire loom frame, which are caused in association with the weaving, are further suppressed, so that it is possible to suppress the noise problem and the bad influence on the weaving as much as possible.",True,0.3419190943241119,0.7956680921303101,26,47,-21,104,271,-167
"[보다 상세하게는, 직기에서의 한 쌍의 사이드 프레임의 간격은, 전술한 바와 같이 각 종광 프레임 가이드에 대응하는 브래킷이 장착되는 위치의 간격을 기준으로 하여 정해져 있다.","More specifically, an interval between the pair of side frames of the loom is determined based on an interval between positions in which brackets corresponding to each of the heddle frame guides are attached.",True,0.3710661828517914,0.7977806791793168,24,34,-10,98,208,-110
"그리고, 본 발명에 의하면, 그렇게 간격이 정해지는 한 쌍의 사이드 프레임 중 적어도 한쪽에 있어서, 적어도 1개의 상기 지지부가 상기한 오프셋 지지부가 되도록 형성된다.","Further, according to the present invention, as for at least one of the pair of side frames whose interval is determined in such a way, at least one of the support parts is formed to be the offset support part.",True,0.208781749010086,0.8949886760786452,24,40,-16,95,210,-115
"이로써, 그 상기 오프셋 지지부에서의 베어링의 지지 위치는, 상기 폭 방향에 있어서, 상기 지지부의 내측단이 상기 기준 위치와 대략 동일한 위치의 종래의 직기(사이드 프레임)의 구성(종래 구성)과 비교하여, 내측에 위치하게 된다.]","Thereby, the support position of the bearing at the offset support part is located on a more inner side in the width direction, as compared to the configuration (conventional configuration) of the loom (side frame) of the related art where an inner end of the support part is located in substantially the same position as the reference position.",True,0.237379178404808,0.8898463085878844,30,58,-28,129,345,-216
"[이로써, 그 오프셋 장착부에 있어서 지지되는 지지축의 상기 축 부재측의 단부(연결단)의 위치는, 상기 종래 구성과 비교하여, 보다 내측에 위치하게 된다.","Thereby, a position of an end portion (connecting end) on the shaft member-side of the support shaft supported in the offset support part is located on a more inner side, as compared to the conventional configuration.",True,0.2305338829755783,0.884435666576385,20,36,-16,86,217,-131
"따라서, 적어도 한쪽이 그와 같이 설치되는 한 쌍의 연결단의 간격은, 상기 종래 구성의 경우와 비교하여 작아지게 된다.","Therefore, an interval between a pair of connecting ends, at least one of the connecting ends being provided in this way, becomes smaller, as compared to the conventional configuration.",True,0.2433973848819732,0.8478060973691361,17,29,-12,66,185,-119
"그 결과, 그와 같이 설치되는 한 쌍의 지지축 사이에 가설되는 상기 축 부재는, 그 길이 치수(축선 방향의 치수)가 상기 종래 구성의 경우보다 작아지게 된다.","As a result, the shaft member bridged between the pair of support shafts provided in this way becomes smaller in length dimension (a dimension in an axis line direction), as compared to the conventional configuration.",True,0.2498419880867004,0.8635449234262036,24,35,-11,88,217,-129
"그리고, 그렇게 길이 치수가 작아지게 됨으로써, 그 상기 축 부재는, 보다 휘기 어렵게 되어, 전술한 바와 같은 바디치기 운동에 따른 충격이나 경사의 장력 변동에 따른 힘을 받아도, 이에 의해 발생하는 진동은, 상기 종래 구성과 비교하여 진폭이 작아지게 된다.]","The length dimension is reduced, so that the shaft member is more difficult to bend, and even when the impact caused due to the beating motion and the force caused due to the tension variation of the warp are applied, an amplitude of the vibrations accordingly caused is smaller, as compared to the conventional configuration.",True,0.3061313033103943,0.8263251832395279,38,55,-17,146,326,-180
"[또한, 상기 지지부가 상기 오프셋 지지부가 되도록 형성된 사이드 프레임은, 그 내측벽에서의 적어도 상기 오프셋 지지부가 되는 부분이 내측으로 돌출하도록 형성되게 된다.","Further, the side frame on which the support part is formed to be the offset support part is formed such that at least a part of the inner wall becoming the offset support part protrudes inward.",True,0.240177035331726,0.8808077940047747,22,36,-14,94,194,-100
"이로써, 그 사이드 프레임은, 내측벽이 대략 평면형으로 형성된 상기 종래 구성의 경우와 비교하여, 강성(剛性)이 증가하고, 내진성(耐震性)이 향상되게 된다.]","Thereby, the side frame is increased in stiffness and is improved in vibration-proof characteristic, as compared to the conventional configuration where the inner wall is formed substantially planar.",True,0.2154333293437957,0.878809499751803,18,28,-10,88,199,-111
"[이와 같이, 본 발명에 의하면, 사이드 프레임의 진동의 기진원(起震源)이 되는 로킹 축, 주축 및 복권 롤과 같은 상기 축 부재 중 적어도 1개가, 상기 종래 구성과 비교하여, 제직 중의 진동이 진폭이 작아지도록 구성되어 있고, 또한 사이드 프레임 자체가, 전술한 바와 같이 내진성이 향상되도록 되어 있다.","In this way, according to the present invention, at least one of the shaft members such as a rocking shaft, a main shaft and a cloth winding roll, which are vibration generating sources of the vibrations of the side frame, is configured such that an amplitude of the vibrations during weaving is smaller, as compared to the conventional configuration, and the vibration-proof characteristic of the side frame itself is improved.",True,0.3132129609584808,0.8354576195522206,45,70,-25,172,428,-256
"이로써, 제직 중의 양 사이드 프레임의 진동이, 상기 종래 구성과 비교하여 억제되게 된다.","Thereby, the vibrations of both the side frames during the weaving are suppressed, as compared to the conventional configuration.",True,0.2820889949798584,0.8345820097342503,13,19,-6,50,129,-79
"따라서, 직기 프레임 전체적으로 발생하는 진동이 보다 억제되게 되어, 소음이나 제직에 악영향을 미치는 문제의 발생이 가급적 억제된다.]","Therefore, the vibrations that occur on the entire loom frame are further suppressed, and the noise problem and the bad influence on the weaving are suppressed as much as possible.",True,0.3153662979602813,0.7971464417752521,17,30,-13,75,180,-105
"[또한, 본 발명의 직기에 있어서, 상기 지지부가 상기 오프셋 지지부로 되도록 형성된 사이드 프레임은, 상기 지지 위치가 상기 기준 위치보다 직기 프레임에서의 내측에 위치하도록 상기 오프셋 지지부가 형성되도록 함으로써, 보다 강성이 증가하고, 상기한 내진성의 향상울 보다 효과적으로 도모할 수 있게 된다.","Further, according to the loom of the present invention, the side frame on which the support part is formed to be the offset support part is further increased in stiffness and is more effectively improved in vibration-proof characteristic because the offset support part is formed so that the support position is located on the more inner side of the loom frame than the reference position.",True,0.2366834729909896,0.8878770558667621,41,65,-24,170,390,-220
"이로써, 직기 프레임 전체적으로 발생하는 진동이 보다 효과적으로 억제되고, 소음이나 제직에 악영향을 미치는 문제의 발생이 보다 효과적으로 억제된다.]","Thereby, the vibrations that occur on the entire loom frame are more effectively suppressed, and the noise problem and the bad influence on the weaving are more effectively suppressed.",True,0.265265017747879,0.8259301363022755,18,29,-11,83,184,-101
"[상세하게는, 전술한 바와 같이 사이드 프레임을 상기 오프셋 지지부가 형성되도록 함으로써, 그 사이드 프레임은, 강성이 증가하여 내진성이 향상되게 된다.","Specifically, the side frame is formed with the offset support part, as described above.",True,0.5818882584571838,0.6582810297478667,19,14,5,85,88,-3
"그리고, 그 돌출량이 보다 클수록, 사이드 프레임은, 그 내측벽에서의 상기 폭 방향으로 연장되는 벽 부분이 커지고, 강성이 보다 증가하여 내진성이 더욱 향상된다.","Thereby, the stiffness of the side frame is increased, so that the vibration-proof characteristic is improved.",True,0.6053622961044312,0.6294746166473734,22,16,6,90,110,-20
"이에, 그 돌출량을 크게 하는, 특히, 사이드 프레임에서의 상기 오프셋 지지부를, 상기 지지 위치가 상기 기준 위치보다 상기 내측에 위치하도록 형성함으로써, 상기 지지 위치의 내측단이 상기 기준 위치보다 내측에 위치하는 경우라도 상기 지지 위치가 상기 기준 위치와 중복하는 경우(내측벽에서의 오프셋 지지부가 되는 부분과 상기 기준 위치를 포함하는 부분이 중복하는 경우)와 비교하여, 그 사이드 프레임은, 보다 강성이 증가하게 되어 상기한 내진성의 향상을 보다 효과적으로 도모할 수 있게 된다.","Further, the larger a protruding amount thereof is, a wall part extending in the width direction of the inner wall of the side frame becomes larger, so that the stiffness is further increased and the vibration-proof characteristic is thus further improved.",True,0.570024847984314,0.7025170258328869,67,41,26,275,256,19
건설 기계,TECHNICAL FIELD,False,0.8351470828056335,0.3338744924983311,2,2,0,5,15,-10
"[본 발명은, 건설 기계에 관한 것이다.]",The present invention relates to a construction machine.,True,0.1905224174261093,0.874607704623472,6,8,-2,23,56,-33
"[백호 등의 건설 기계에서는, 하부 주행체와, 하부 주행체의 상방에서 선회 가능하게 형성된 상부 선회체와, 상부 선회체의 전부 (前部) 에 상하 회동 (回動) 가능하게 지지된 작업기를 구비하고 있다.]","A construction machine, such as a backhoe, includes a lower traveling body, an upper turning body provided capable of turning above the lower traveling body, and a work machine that is supported vertically rotatably at the front of the upper turning body.",True,0.3993187248706817,0.7695478677951624,27,42,-15,112,255,-143
"[특허문헌 1 에는, 건설 기계의 펌프 석션 배관 구조로서, 상부 선회체의 전후 방향으로 연장되는 좌우의 세로판을 관통시키고, 세로판을 구분하는 구분판을 따르게 하여 석션 호스를 배색 (配索) 하는 기술이 개시되어 있다.]","Patent Literature 1 discloses, as a pump suction piping structure of a construction machine, a technology for routing a suction hose by being passed through left and right vertical plates extending in a front-rear direction of the upper turning body and by being followed along a partition plate dividing the vertical plates.",True,0.1951567828655243,0.8872786447929392,30,52,-22,124,325,-201
"[또, 특허문헌 2 에는, 건설 기계의 펌프 석션 배관 구조로서, 상부 선회체의 전후 방향으로 연장되는 좌우의 세로판을 관통시키고, 추가로 세로판을 구분하는 구분판을 관통시켜 석션 호스를 배색하는 기술이 개시되어 있다.]","In addition, Patent Literature 2 discloses, as a pump suction piping structure of a construction machine, a technology for routing a suction hose by being passed through the left and right vertical plates extending in the front-rear directions of the upper turning body, and by further being passed through the partition plate dividing the vertical plates.",True,0.1957667022943496,0.8891384247591387,29,56,-27,123,356,-233
"[특허문헌 1 및 2 는, 모두 세로판을 구분하는 구분판이 판재인 점에서, 강성이 충분하다고는 할 수 없기 때문에, 세로판에 구멍을 뚫은 경우, 세로판의 두께를 두껍게 하거나 함으로써 강성을 확보할 필요가 있다.","In both Patent Literatures 1 and 2, since the partition plate dividing the vertical plates is a plate material, the rigidity is not sufficient and thus, when holes are drilled in the vertical plates, the rigidity needs to be ensured by increasing the thickness of the vertical plates or the like.",True,0.2190101444721222,0.8453372697466791,30,51,-21,118,296,-178
"또, 소형의 건설 기계에 있어서는, 보닛 내의 스페이스를 유효 활용하기 위해, 엔진 지지부를 세로판이나 구분판 상에 형성하고, 펌프 석션 배관을 엔진의 하방에 형성하려고 한 경우, 강도가 부족하다는 문제가 있다.]","In addition, in order to make effective use of a space in a bonnet of a small-sized construction machine, when an engine support part is to be provided on the vertical plate or the partition plate and the pump suction piping below an engine, there is a problem that strength of the engine will be insufficient.",True,0.2162577956914901,0.8651048278711001,29,56,-27,119,310,-191
"[PatentCitationText[attributes={}; value=[일본 공개특허공보 2001-90106호]], PatentCitationText[attributes={}; value=[일본 공개특허공보 2011-196046호]]]",CITATION LIST,False,0.8586671948432922,0.2497969311235142,8,2,6,133,13,120
"[본 발명은, 상기 사정을 감안하여 이루어진 것으로서, 그 목적은, 상부 선회체에 있어서의 선회 프레임의 강성을 확보하면서, 배관 레이아웃의 자유도를 높일 수 있는 건설 기계를 제공하는 것에 있다.]",Patent Literature Patent Document 1: Japanese Unexamined Patent Application Publication No. 2001-90106 Patent Literature 2: Japanese Unexamined Patent Application Publication No. 2011-196046,False,1.1460553407669067,0.2006523034726779,27,22,5,111,190,-79
"[본 발명의 건설 기계는, 하부 주행체와,]",DISCLOSURE OF INVENTION,False,0.9393392205238342,0.3124547842268815,6,3,3,24,23,1
"[상기 상부 선회체의 후부에 배치된 엔진과,]",PROBLEMS TO BE SOLVED BY THE INVENTION,False,1.1497013568878174,0.1076329135744329,6,7,-1,25,38,-13
"[상기 상부 선회체의 바닥부를 구성하고, 상기 엔진이 탑재되는 선회 프레임을 구비하고,]","The present invention was made in view of the above circumstances, an object of which is to provide a construction machine capable of increasing a degree of freedom of a piping layout while securing rigidity of a turning frame in the upper turning body.",False,0.8717865943908691,0.4540642557240245,11,44,-33,49,253,-204
"[상기 선회 프레임은, 바닥판과, 전후 방향으로 연장되도록 상기 바닥판에 세워져 형성된 좌우 1 쌍의 제 1 세로판 및 제 2 세로판과, 상기 제 1 세로판과 상기 제 2 세로판에 접속되고, 상기 제 1 세로판과 상기 제 2 세로판 사이의 공간을 구획하는 접속 부재를 구비하고,]",MEANS FOR SOLVING THE PROBLEMS,False,1.0749688148498535,0.1829387330953123,44,5,39,156,30,126
"[상기 접속 부재는, 적어도 천판과 상기 천판의 전후 방향 양 단부로부터 하방으로 연장되는 전후 1 쌍의 측판을 포함하고, 상기 제 1 세로판 및 상기 제 2 세로판과 함께 박스형 구조체를 형성하고,]","The construction machine of the present invention includes a lower traveling body, an upper turning body provided capable of turning above the lower traveling body, an engine disposed at a rear part of the upper turning body, and a turning frame that constitutes the bottom part of the upper turning body and on which the engine is mounted, in which the turning frame has a bottom plate, a left and right pair of a first vertical plate and a second vertical plate provided upright on the bottom plate so as to extend in the front-rear direction, and a coupling member connected to the first and second vertical plates and dividing a space between the first and second vertical plates, the coupling member includes at least a top plate and a pair of front and rear side plates extending downwardly from front and rear ends of the top plate, and forms a box shape structure together with the first vertical plate and the second vertical plate, and the box shape structure has a first opening formed through the first vertical plate, a second opening formed through the second vertical plate, and an engine support part formed in the top plate.",False,0.5618995428085327,0.6585637032915878,31,199,-168,112,1141,-1029
"[본 발명의 건설 기계에 있어서, 상기 박스형 구조체에는, 전방으로 개방되는 제 3 개구부가 형성되어 있는 것이어도 된다.]","In the construction machine of the present invention, a third opening open to the front may be formed through the box shape structure.",True,0.2208983600139618,0.8552689174320731,17,23,-6,69,134,-65
"[상기 제 2 세로판의 좌우 외측에 배치된 상기 유압 펌프의 흡인 포트와,]","In addition, the construction machine of the present invention has a hydraulic pump driven by the engine, a suction port of the hydraulic pump disposed on the left and right outer sides of the second vertical plate, and a hydraulic oil tank disposed on the left and right outer sides of the first vertical plate, and a suction hose connecting the suction port to the hydraulic oil tank may be inserted through the first and second openings.",False,0.5476760864257812,0.6627347256957706,12,77,-65,42,440,-398
"[상기 흡인 포트와 상기 작동유 탱크를 접속시키는 석션 호스는, 상기 제 1 개구부와 상기 제 2 개구부를 삽입 통과하고 있는 것이어도 된다.]","In addition, the construction machine of the present invention also has a grease nipple disposed on the left and right outer sides of the first vertical plate and a grease supply port for a turning bearing disposed on the left and right outer sides of the second vertical plate, and a grease hose connecting the grease nipple to the grease supply port may be inserted through the second opening and the third opening.",False,0.6547833681106567,0.58830070802894,22,73,-51,80,417,-337
"[본 발명에 의하면, 각종 호스 등의 배관을 박스형 구조체의 내부 공간을 이용하여 배색시킴으로써, 선회 프레임의 강성을 저하시키지 않고, 엔진의 하방을 통과하면서 선회 프레임을 좌우 방향으로 횡단하여 배관을 배색시킬 수 있다.","According to the present invention, pipes such as various hoses can be routed across the turning frame in the left-right direction while passing under the engine without reducing the rigidity of the turning frame by routing the pipes by using an internal space of the box shape structure.",True,0.3098732531070709,0.7969138048752665,30,48,-18,126,288,-162
"그 결과, 상부 선회체에 있어서의 선회 프레임의 강성을 확보하면서, 배관 레이아웃의 자유도를 높일 수 있다.]","As a result, a degree of freedom of the piping layout can be increased while securing the rigidity of the turning frame in the upper turning body.",True,0.3116441965103149,0.7772624640978819,15,27,-12,61,146,-85
"[도 1 은, 본 발명에 관련된 건설 기계의 일례를 나타내는 사시도이다.",FIG. 1 is a perspective view illustrating an example of a construction machine according to the present invention.,True,0.1920492351055145,0.8721356261660178,11,18,-7,40,114,-74
"도 2 는, 상부 선회체의 내부 구조를 나타내는 사시도이다.",FIG. 2 is a perspective view illustrating an internal structure of an upper turning body.,True,0.1798743903636932,0.8790058488923731,9,15,-6,33,89,-56
"도 3 은, 선회 프레임의 사시도이다.",FIG. 3 is a perspective view illustrating a turning frame.,True,0.2301064431667328,0.8358172227350352,6,10,-4,21,58,-37
"도 4 는, 석션 호스의 배색 구조를 나타내는 사시도이다.",FIG. 4 is a perspective view illustrating a routing structure of a suction hose.,True,0.3517130017280578,0.742395134924806,9,14,-5,32,80,-48
"도 5 는, 그리스 호스의 배색 구조를 나타내는 사시도이다.]",FIG. 5 is a perspective view illustrating a routing structure of a grease hose.,True,0.3737859427928924,0.7348796934464524,9,14,-5,34,79,-45
[본 발명의 실시형태에 대해 도면을 참조하면서 설명한다.],An embodiment of the present invention will be described with reference to the drawings.,True,0.2250812202692031,0.8415380164670784,7,14,-7,32,88,-56
[[건설 기계의 개요]],Outline of Construction Machine,True,0.3344462215900421,0.7524534845962143,3,4,-1,13,31,-18
"[도 1 에 나타내는 바와 같이, 건설 기계 (1) 는, 하부 주행체 (2) 와, 하부 주행체 (2) 의 상방에서 선회 가능하게 형성된 상부 선회체 (3) 와, 상부 선회체 (3) 에 수평 회동 가능하게 지지된 요동체인 붐 브래킷 (4) 과, 붐 브래킷 (4) 에 상하 회동 가능하게 지지된 작업기 (5) 를 구비한다.","As shown in FIG. 1, a construction machine 1 includes a lower traveling body 2, an upper turning body 3 provided capable of turning above the lower traveling body 2, a boom bracket 4 which is a swinging body supported horizontally rotatably by the upper turning body 3, and a work machine 5 which is supported vertically rotatably by the boom bracket 4.",True,0.1933698803186416,0.9007690015218828,51,63,-12,178,353,-175
"건설 기계 (1) 는, 붐 스윙 기능이 있는 셔블 (백호) 로서 구성되어 있다.",The construction machine 1 is configured as an excavator (backhoe) with a boom swing function.,True,0.241800382733345,0.8420396711649205,13,15,-2,44,94,-50
"일반적으로, 붐 스윙 기능은, 좁은 장소에서의 작업성이 요구되는 미니 셔블에 장비된다.]","In general, the boom swing function is provided in a compact excavator in which workability in a narrow space is required.",True,0.2944896221160888,0.7886930363757167,11,21,-10,49,122,-73
"[하부 주행체 (2) 는, 엔진 (60) (도 2 참조) 으로부터의 동력을 받아 구동되고, 건설 기계 (1) 를 주행시키거나 선회시키거나 한다.",The lower traveling body 2 is driven by power from an engine 60 (see FIG. 2 ) to travel and turn the construction machine 1.,True,0.1852424442768097,0.891465003989845,20,25,-5,80,124,-44
"하부 주행체 (2) 는, 좌우 1 쌍의 크롤러 (21, 21) 와, 그것들을 구동시키는 좌우 1 쌍의 주행 모터 (22, 22) 를 구비한다.","The lower traveling body 2 includes a left and right pair of crawlers 21 and 21, and a left and right pair of traveling motors 22 and 22 for driving the aforementioned crawlers 21 and 21.",True,0.2903442084789276,0.8233046598648963,22,36,-14,79,187,-108
"또, 하부 주행체 (2) 에는, 블레이드 (23) 가 형성되어 있다.]",The lower traveling body 2 also includes a blade 23.,True,0.3267734348773956,0.7819337322790072,10,10,0,39,52,-13
"[상부 선회체 (3) 는, 그 중앙부에서 상하 방향으로 연장되는 축선 둘레로 선회 동작 가능하게 구성되어 있다.",The upper turning body 3 is constituted capable of performing a turning operation around an axis extending in a vertical direction at a center part thereof.,True,0.2900101542472839,0.8178565887038552,16,26,-10,62,156,-94
"상부 선회체 (3) 에는, 엔진 (60), 선회 모터 (61) (도 2 참조), 조종부 (62) 등이 배치 형성되어 있다.","The upper turning body 3 has an engine 60, a turning motor 61 (see FIG. 2 ), a maneuvering unit 62 and the like disposed.",True,0.1449920386075973,0.915783361392926,18,25,-7,68,121,-53
"조종부 (62) 에는, 조종석이나 조작 장치 등이 장비되어 있다.]",The maneuvering unit 62 is equipped with a driver's seat and operating devices.,True,0.2083052098751068,0.8602442498708711,9,13,-4,37,79,-42
"[붐 브래킷 (4) 은, 상부 선회체 (3) 의 전단부에 장착부 (35) 를 개재하여 장착되어 있다.",The boom bracket 4 is mounted at a front end of the upper turning body 3 via a mounting portion 35.,True,0.2716792523860931,0.8329396107549856,15,21,-6,56,99,-43
"붐 브래킷 (4) 은, 장착부 (35) 에 자유롭게 수평 회동할 수 있도록 (즉, 좌우로 자유롭게 요동할 수 있도록) 지지되어 있다.","The boom bracket 4 is supported by the mounting portion 35 in a horizontally rotatably (that is, laterally swingable manner).",True,0.232106328010559,0.8642337438535532,20,20,0,74,125,-51
"상부 선회체 (3) 와 붐 브래킷 (4) 사이에는, 전후 방향으로 신축 작동하는 스윙 실린더 (도시하고 있지 않음) 가 형성되어 있다.","A swing cylinder (not shown), which performs an extending / contracting motion in a front-rear direction, is provided between the upper turning body 3 and the boom bracket 4.",True,0.2498039454221725,0.8534900827056499,20,29,-9,75,174,-99
"붐 브래킷 (4) 의 수평 회동은, 스윙 실린더의 신축에 따라 작동한다.]",The horizontal rotation of the boom bracket 4 is performed in accordance with the extension and contraction of the swing cylinder.,True,0.3455955684185028,0.7679587827756476,11,21,-10,41,130,-89
"[작업기 (5) 는, 엔진 (60) 으로부터의 동력을 받아 구동되고, 조종부 (62) 에서의 조작에 따라 토사의 굴착 작업 등을 실시한다.",The work machine 5 is driven by power from the engine 60 and performs an excavation work of earth and sand and the like in response to an operation at the maneuvering unit 62.,True,0.2747824192047119,0.8258155188027837,19,34,-15,77,175,-98
"작업기 (5) 는, 붐 브래킷 (4) 에 상하 회동 가능하게 지지되어 있다.",The work machine 5 is supported on the boom bracket 4 vertically rotatably.,True,0.2495844066143036,0.8481910370535081,12,13,-1,42,75,-33
"붐 브래킷 (4) 에는, 축선을 수평 방향을 향하게 한 추축 핀 (54) 이 형성되어 있다.",The boom bracket 4 has a pivot pin 54 with an axis directed toward the horizontal direction provided.,True,0.242944449186325,0.854069552299382,15,18,-3,51,101,-50
"작업기 (5) 의 기단부 (후술하는 붐 (51) 의 기단부) 는, 그 추축 핀 (54) 을 중심으로 하여 자유롭게 상하 회동할 수 있도록 지지되어 있다.",Abase end of the work machine 5 (base end of a boom 51 described later) is supported vertically rotatably around the pivot pin 54 thereof.,True,0.2688020169734955,0.8539078566712418,24,25,-1,85,138,-53
"또, 작업기 (5) 는, 붐 브래킷 (4) 의 수평 회동에 연동하여 스윙 동작을 실시할 수 있다.]","In addition, the work machine 5 is capable of performing a swing motion in conjunction with the horizontal rotation of the boom bracket 4.",True,0.1975195556879043,0.8794340417873021,16,24,-8,55,138,-83
"[작업기 (5) 는, 붐 (51) 과, 아암 (52) 과, 버킷 (53) 을 구비하고 있다.","The work machine 5 includes the boom 51, an arm 52, and a bucket 53.",True,0.1986177861690521,0.8754878489966775,14,15,-1,51,68,-17
"붐 (51) 은, 붐 브래킷 (4) 에 상하 회동 가능하게 장착되어 있다.",The boom 51 is mounted on the boom bracket 4 vertically rotatably.,True,0.2539311945438385,0.8496315090669642,12,12,0,41,66,-25
"붐 (51) 은, 붐 브래킷 (4) 에 지지된 기단부로부터 상하 방향으로 연장되고, 측면에서 봤을 때에 부메랑 형상을 이루며 굴곡되어 있다.","The boom 51 vertically extends in the vertical direction from the base end thereof supported by the boom bracket 4, and is curved in a boomerang shape in a side view.",True,0.2146949470043182,0.8756226586745675,20,31,-11,78,166,-88
"붐 브래킷 (4) 과 붐 (51) 의 중도부 사이에는, 자유롭게 신축할 수 있도록 가동되는 붐 실린더 (51a) 가 형성되어 있다.","A boom cylinder 51a, which is movable in an extensible and contractible manner, is provided between the boom bracket 4 and an intermediate portion of the boom 51.",True,0.269796758890152,0.844996418000419,20,28,-8,73,162,-89
"붐 브래킷 (4) 에 대한 붐 (51) 의 상하 회동은, 붐 실린더 (51a) 의 신축에 따라 작동한다.]",The vertical rotation of the boom 51 with respect to the boom bracket 4 is performed in accordance with the extension and contraction of the boom cylinder 51a.,True,0.3382948338985443,0.7971171545774086,17,28,-11,59,159,-100
"[아암 (52) 은, 붐 (51) 에 상하 회동 가능하게 장착되어 있다.",The arm 52 is mounted on the boom 51 vertically rotatably.,True,0.3300063610076904,0.7985823648081668,11,11,0,40,58,-18
"붐 (51) 의 선단부에는, 축선을 수평 방향을 향하게 한 추축 핀 (55) 이 형성되어 있다.",A pivot pin 55 having an axis directed toward the horizontal direction is provided at a distal end of the boom 51.,True,0.2894293069839477,0.8301549400172612,15,22,-7,53,114,-61
"아암 (52) 의 기단부는, 그 추축 핀 (55) 을 중심으로 하여 자유롭게 상하 회동 (전후 회동) 할 수 있도록 지지되어 있다.",A base end of the arm 52 is supported vertically rotatably (rotatably back and forth) around the pivot pin 55.,True,0.3340524435043335,0.8048335835750011,21,20,1,73,110,-37
"붐 (51) 의 중도부와 아암 (52) 의 기단부 사이에는, 자유롭게 신축할 수 있도록 가동되는 아암 실린더 (52a) 가 형성되어 있다.","An arm cylinder 52a, which is movable in an extensible and contractible manner, is provided between an intermediate portion of the boom 51 and the base end of the arm 52.",True,0.2736440598964691,0.8422335510185244,20,31,-11,77,170,-93
"붐 (51) 에 대한 아암 (52) 의 상하 회동은, 아암 실린더 (52a) 의 신축에 따라 작동한다.]",The vertical rotation of the arm 52 with respect to the boom 51 is performed in accordance with the extension and contraction of the arm cylinder 52a.,True,0.3742567002773285,0.7692310010560478,16,27,-11,58,150,-92
"[버킷 (53) 은, 아암 (52) 에 상하 회동 가능하게 장착되어 있다.",The bucket 53 is mounted on the arm 52 vertically rotatably.,True,0.3015340864658355,0.8129202238674549,11,11,0,41,60,-19
"아암 (52) 의 선단부에는, 축선을 수평 방향을 향하게 한 추축 핀 (56) 이 형성되어 있다.",A pivot pin 56 having an axis directed toward the horizontal direction is provided at a distal end of the arm 52.,True,0.3274122178554535,0.8007155439980388,15,22,-7,54,113,-59
"버킷 (53) 의 기단부는, 그 추축 핀 (56) 을 중심으로 하여 자유롭게 상하 회동 (전후 회동) 할 수 있도록 지지되어 있다.",Abase end of the bucket 53 is supported capable of vertical rotation (back and forth rotation) around the pivot pin 56.,True,0.2613809406757355,0.8464299153745061,21,21,0,73,119,-46
"아암 (52) 의 선단부와 버킷 (53) 사이에는, 버킷 링크 (57) 가 개재되어 있다.",A bucket link 57 is interposed between the distal end of the arm 52 and the bucket 53.,True,0.2247833013534546,0.8613402836143758,13,18,-5,50,86,-36
"버킷 링크 (57) 는, 버킷 (53) 에 구동력을 전달하는 링크로서 구성되어 있다.",The bucket link 57 is configured as a link for transmitting a driving force to the bucket 53.,True,0.2117517590522766,0.8699606428072726,12,18,-6,47,93,-46
"버킷 링크 (57) 와 아암 (52) 의 기단부 사이에는, 자유롭게 신축할 수 있도록 가동되는 버킷 실린더 (53a) 가 형성되어 있다.","A bucket cylinder 53a, which is movable in an extensible and contractible manner, is provided between the bucket link 57 and the base end of the arm 52.",True,0.3193033039569855,0.8155422997907996,20,28,-8,76,152,-76
"아암 (52) 에 대한 버킷 (53) 의 상하 회동은, 버킷 실린더 (53a) 의 신축에 따라 작동한다.]",The vertical rotation of the bucket 53 with respect to the arm 52 is performed in accordance with the extension and contraction of the bucket cylinder 53a.,True,0.3768290579319,0.7674662054096788,16,27,-11,59,155,-96
"[도 2 는, 상부 선회체 (3) 의 내부 구조를 나타내는 사시도이다.",FIG. 2 is a perspective view illustrating an internal structure of the upper turning body 3.,True,0.1787714660167694,0.8821341184415562,11,16,-5,39,92,-53
"상부 선회체 (3) 는, 선회 프레임 (30) 상에 엔진 (60) 이나 배터리나 연료 탱크 등을 재치 (載置) 하고, 이것들을 보닛 (66) 으로 피복하고, 그 전부에 조종부 (62) 를 배치하고 있다.","In the upper turning body 3, the engine 60, a battery, a fuel tank and the like are placed on a turning frame 30, these are covered by a bonnet 66, and the maneuvering unit 62 is disposed at the front thereof.",True,0.2056861072778701,0.8772034676686498,30,42,-12,113,209,-96
"엔진 (60) 에는 유압 펌프 (63) 가 접속되어 있고, 유압 펌프 (63) 는, 엔진 (60) 에 의해 구동되어, 작동유를 토출한다.]","A hydraulic pump 63 is connected to the engine 60, and the hydraulic pump 63 is driven by the engine 60 and discharges the hydraulic oil.",True,0.167426586151123,0.8983866243650337,20,26,-6,77,137,-60
"[유압 펌프 (63) 로부터 토출된 작동유는, 유압 호스나 컨트롤 유닛 등을 통하여, 스윙 실린더, 붐 실린더 (51a), 아암 실린더 (52a), 버킷 실린더 (53a), 블레이드 실린더, 주행 모터 (22, 22), 선회 모터 (61) 등에 공급된다.]","The hydraulic oil discharged from the hydraulic pump 63 is supplied to the swing cylinder, the boom cylinder 51a, the arm cylinder 52a, the bucket cylinder 53a, a blade cylinder, the traveling motors 22, 22, the turning motor 61 and the like via hydraulic hoses, the control unit and the like",True,0.2138780653476715,0.8702441108277627,34,51,-17,143,292,-149
스프링클러 시스템{Sprinkler system},[Technical Field],False,1.0103508234024048,0.2537646680409541,3,2,1,27,17,10
"본 발명은 스프링클러 시스템에 관한 것으로서, 더욱 상세하게는 무 용접 방식으로 조립할 수 있는 스프링클러 시스템 관한 것이다.","The present invention relates to a sprinkler system, and more particularly, to a sprinkler system that is can be assembled in a non-welding manner.",True,0.1692405045032501,0.8960258438144411,18,24,-6,71,147,-76
일반적으로 빌딩이나 공동주택 등의 건축물 각층에는 그 천정 주위에 화재 발생 시 화재를 감지하여 고압의 유체를 자동 살수함으로써 화재를 조기에 진압하기 위한 센서가 구비된 스프링클러가 설치된다.,"In general, sprinklers equipped with sensors for early extinguishing of a fire by automatically spraying a high-pressure fluid by detecting the fire when the fire occurs around ceilings are installed on each floor of buildings such as commercial buildings or apartment buildings.",True,0.2610213458538055,0.8116335575103858,26,42,-16,108,279,-171
"이를 위하여 외부로부터 유체를 공급하는 메인 파이프가 설치되고, 이러한 메인 파이프에 다수의 스프링클러가 설치되는 유입 파이프가 연통 설치되며, 유입 파이프에는 스프링클러로 유체를 공급하기 위한 분기 파이프가 설치된다.","To this end, a main pipe through which a fluid is supplied from an external source is installed, an inlet pipe in which a plurality of sprinklers are installed is installed in communication with the main pipe, and a branch pipe for supplying the fluid to the sprinklers is installed in the inlet pipe.",True,0.2159493714570999,0.8690978988541367,27,54,-27,122,301,-179
"다만, 종래의 경우 유입 파이프와 분기 파이프를 연통 설치하기 위해 유입 파이프에 형성된 분기홀에 분기 파이프를 용접하는 방식으로 설치하였으나, 이와 같은 방식은 용접 불량으로 인해 유체가 누설될 수 있고, 추후 유지 및 보수가 용이하지 않은 문제가 있었다.","However, in the related art, in order for the inlet pipe and the branch pipe to communicate with each other, the branch pipe is installed in a branch hole formed in the inlet pipe in a welding manner.",False,0.5588066577911377,0.6740954398156708,37,38,-1,144,200,-56
"또한, 조립 공수가 많이 소요되고, 부품수가 많아 시공 비용이 낭비되는 문제도 있었다.","Further, many assembly man hours are required, the number of components is large, and thus construction costs are wasted.",True,0.2636237144470215,0.7959129766272695,12,19,-7,48,121,-73
아울러 스프링클러로 공급되는 유체의 유량 증가를 위해 유입 파이프에 형성된 분기홀의 직경을 증가시킬 경우 유체가 누설되는 문제도 있었다.,"In addition, when the diameter of the branch hole formed in the inlet pipe is increased so as to increase the flow rate of a fluid supplied to the sprinkler, the fluid may leak.",True,0.3029728233814239,0.8086907346698203,18,34,-16,76,177,-101
따라서 상기한 문제에 대한 개선이 필요한 실정이다.,"Thus, reduction of the above problems is required.",True,0.2728956043720245,0.7962251360045516,7,8,-1,28,50,-22
"본 발명에서 해결하고자 하는 기술적 과제는 용접 방식을 사용하지 않고, 무 용접 방식으로 조립할 수 있는 스프링클러 시스템을 제공하는 것을 목적으로 한다.",The present invention is directed to providing a sprinkler system that is can be assembled in a non-welding manner without using a welding manner.,True,0.2531786859035492,0.8367538088381942,22,24,-2,86,146,-60
"또한, 조립 공수를 감소시킬 수 있고, 구성이 단순화되어 시공 비용을 절감할 수 있는 스프링클러 시스템을 제공하는 것을 목적으로 한다.",The present invention is also directed to providing a sprinkler system that allows assembly man hours to be reduced and construction costs to be reduced by simplifying a configuration thereof.,True,0.2468347251415252,0.835369979355583,19,30,-11,75,192,-117
아울러 스프링클러로 유체를 공급하는 분기 파이프에 형성된 분기홀의 직경이 증가하는 경우에도 분기되는 유체의 누설을 효과적으로 방지할 수 있는 스프링클러 시스템을 제공하는 것을 목적으로 한다.,The present invention is also directed to providing a sprinkler system capable of effectively preventing leakage of a branched fluid even when the diameter of a branch hole formed in a branch pipe through which the fluid is supplied to a sprinkler increases.,True,0.1977378278970718,0.8858280198531681,24,43,-19,106,258,-152
"상기한 기술적 과제를 해결하기 위한 본 발명에 따른 스프링클러 시스템은 외부로부터 유체가 공급되는 메인 파이프와, 상기 메인 파이프를 통해 공급되는 유체를 분기시키는 제1 분기 파이프와, 상기 제1 분기 파이프를 통해 공급되는 유체가 스프링클러에 공급되도록 분기시키는 제2 분기 파이프, 및 상기 메인 파이프, 상기 제1 분기 파이프 및 상기 제2 분기 파이프를 상호 연결하는 분리 가능한 제1 커플러를 포함한다.","One aspect of the present invention provides a sprinkler system including a main pipe through which a fluid is supplied from an external source, a first branch pipe through which the fluid supplied through the main pipe branches off, a second branch pipe through which the fluid supplied through the first branch pipe branches off so that the fluid is supplied to a sprinkler, and a detachable first coupler that interconnects the main pipe, the first branch pipe, and the second branch pipe.",True,0.2552585899829864,0.8687601552491374,58,83,-25,231,492,-261
"이때, 상기 제1 커플러는 상호 대향하는 한 쌍의 제1 바디부와, 한 쌍의 상기 제1 바디부를 상호 체결 고정하는 제1 체결부를 포함할 수 있다.",The first coupler may include a pair of first body parts facing each other and a first fastening part that fastens the pair of first body parts to each other.,True,0.1863094419240951,0.8945736190698259,23,30,-7,81,158,-77
"이때, 상기 제1 바디부의 폭 방향 양측에는 상호 대향하는 각각의 파이프에 형성된 체결홈에 삽입되는 걸림 돌기가 각각 형성될 수 있다.",Locking protrusions inserted into fastening grooves formed in the pipes facing each other may be formed on two sides of the first body parts in a width direction.,True,0.4118964970111847,0.743756055153632,20,28,-8,75,162,-87
"이때, 상기 메인 파이프와 상기 제1 분기 파이프는 상호 동일한 외경을 갖도록 형성되며, 한 쌍의 상기 걸림","The main pipe and the first branch pipe may be formed to have the same outer diameter, and the pair of locking protrusions may be formed to have the same radius of curvature.",False,0.418431669473648,0.7317098243100812,17,33,-16,60,174,-114
"이때, 상기 제1 분기 파이프와 상기 제2 분기 파이프는 상호 상이한 외경을 갖도록 형성되며, 한 쌍의 상기 걸림","The first branch pipe and the second branch pipe may be formed to have different outer diameters, and among the pair of locking protrusions, one locking protrusion may be formed to have a radius of curvature corresponding to the outer diameter of the first branch pipe, and the other locking protrusion may be formed to have a radius of curvature corresponding to the outer diameter of the second branch pipe.",False,0.5447533130645752,0.6901620627733998,18,70,-52,63,409,-346
"이때, 상기 제1 분기 파이프에는 상기 제2 분기 파이프의 단부에 인접하도록 일체로 연장되는 연장부가 형성될 수 있다.",An extension part integrally extending to be adjacent to an end of the second branch pipe may be formed in the first branch pipe.,False,0.3109350204467773,0.8262913725850093,17,24,-7,66,129,-63
"이때, 상기 제2 분기 파이프로 공급되는 유체가 상기 스프링클러로 분기되도록 상호 연결하는 제2 커플러를 더 포함할 수 있다.",The sprinkler system may further include a second coupler that interconnects the second branch pipe and the sprinkler so that the fluid supplied to the second branch pipe is branched off to flow to the sprinkler.,False,0.3987844586372375,0.7812746630391553,18,36,-18,70,212,-142
"이때, 상기 제2 커플러는 상기 제2 분기 파이프에 형성된 분기홀의 둘레를 감싸는 제2 바디부와, 상기 제2 분기 파이프를 중심으로 상기 제2 바디부와 대향 배치되며, 상기 제2 바디부를 상기 제2 분기 파이프에 고정하는 제2 고정부, 및 상기 제2 바디부와 상기 제2 분기 파이프의 외주면 사이에 배치되어 상기 제2 바디부에 의해 가압되면서 분기되는 유체의 누설을 방지하는 제2 가스켓부를 포함하되, 상기 제2 바디부에 의한 상기 제2 가스켓부의 가압 정도는 상기 분기홀에서 멀어질수록 증가하도록 구성될 수 있다.","The second coupler may include a second body part that surrounds a circumference of a branch hole formed in the second branch pipe, a second fixing part that is disposed to be opposite to the second body part with respect to the second branch pipe and fixes the second body part to the second branch pipe, and a second gasket part that is disposed between the second body part and an outer circumferential surface of the second branch pipe and prevents the leakage of the branched fluid while being pressed by the second body part, wherein a degree of pressing of the second gasket part by the second body part increases as a distance from the branch hole increases.",True,0.1706407219171524,0.9138896740211064,73,119,-46,288,666,-378
"이때, 상기 제2 바디부에는 상기 제2 고정부가 관통 결합되는 플랜지가 형성되되, 상기 플랜지에는 상기 플랜지의 하단이 상기 제2 분기 파이프의 중심보다 상측에 위치하도록 제1 절단면이 형성될 수 있다.","A flange through which the second fixing part is coupled may be formed in the second body part, and a first cut surface may be formed in the flange so that a lower end of the flange is located above a center of the second branch pipe.",True,0.2054811716079712,0.8958735488272649,28,47,-19,113,234,-121
"이때, 상기 플랜지에는 상기 제1 절단면보다 상측에 위치하도록 단차가 형성된 제2 절단면이 형성될 수 있다.",A second cut surface formed with a step difference to be located above the first cut surface may be formed in the flange.,True,0.2739232778549194,0.8342363293836013,15,23,-8,60,121,-61
"이때, 상기 제2 바디부에는 상기 제2 가스켓부를 가압하도록 상기 제2 분기 파이프의 외주면을 따라 연장되는 가압면이 형성되되, 상기 가스켓부와 상기 가압면은 상기 플랜지의 하단까지 연장 형성될 수 있다.","A pressing surface extending along the outer circumferential surface of the second branch pipe to press the second gasket part may be formed in the second body part, and the second gasket part and the pressing surface may extend to a lower end of the flange.",True,0.2186655551195144,0.8832666034711888,28,46,-18,114,258,-144
"이때, 상기 제2 바디부에는 상기 분기홀의 내주면으로 삽입되는 가이드 리브가 형성될 수 있다.",A guide rib inserted into an inner circumferential surface of the branch hole may be formed in the second body part.,True,0.2426455169916153,0.8439905380488184,13,21,-8,52,116,-64
"이때, 상기 제2 고정부는 상기 유입 파이프의 외주면에 지지된 상태에서 체결력을 인가하는 제2 고정 부재를 포함하고, 상기 제2 고정 부재는 상기 플랜지를 하향 이동시키는 동시에 반경 방향 내측으로 변형시키도록 구성될 수 있다.","The second fixing part may include a second fixing member that applies a fastening force while being supported on an outer circumferential surface of an inlet pipe, and the second fixing member may move the flange downward and, at the same time, deform the flange radially inward.",True,0.2138427644968032,0.8836199925596108,32,47,-15,127,280,-153
"이때, 상기 제2 분기 파이프와 상기 스프링클러의 외경은 상호 동일하게 형성될 수 있다.",The second branch pipe and the sprinkler may have the same outer diameter.,True,0.4538935422897339,0.7123957770994871,13,13,0,49,74,-25
"상기한 구성을 갖는 본 발명의 스프링클러 시스템은 메인 파이프와 제1 및 제2 분기 파이프가 분리 가능한 제1 커플러를 통해 상호 연결되므로 용접이 필요하지 않으며, 이를 통해 용접 불량으로 인한 누설 등의 문제를 예방할 수 있고, 추후 유지 및 보수하는 것이 용이하게 된다.","In a sprinkler system having the above-described configuration according to the present invention, since a main pipe and first and second branch pipes are interconnected through a detachable first coupler, welding is not required.",False,0.4358132779598236,0.7688916675246682,42,34,8,154,230,-76
"또한, 무 용접 방식으로 각각의 파이프 및 스프링클러를 연결하므로 조립 공수 감소 및 시공 비용이 절감된다.","Further, since pipes and a sprinkler are connected in a non-welding manner, assembly man hours are reduced and construction costs are reduced.",True,0.2749283909797668,0.8167803612882141,16,22,-6,60,142,-82
"또한, 제2 바디부에 의한 제2 가스켓부의 가압 정도가 분기홀에서 멀어질수록 증가하므로 제2 분기 파이프에 형성되는 분기홀의 직경이 증가하는 경우에도 분기되는 유체의 누설을 효과적으로 방지할 수 있게 된다.","Further, since the degree of pressing of a second gasket part by a second body part increases as a distance from a branch hole increases, the leakage of a fluid can be effectively prevented even when the diameter of the branch hole formed in the second branch pipe increases.",True,0.1674254834651947,0.9080903920447168,27,49,-22,115,275,-160
"아울러, 플랜지의 하단이 제2 분기 파이프의 중심보다 상측에 위치하도록 제1 절단면과 제2 절단면이 형성되므로 제2 커플러 체결 시 제2 고정부의 체결력에 의해 플랜지가 하향 이동함과 동시에 반경 방향 내측으로 이동하면서 제2 가스켓부를 가압하여 분기되는 유체의 누설을 더욱 효과적으로 방지할 수 있게 된다.","In addition, since a first cut surface and a second cut surface are formed so that a lower end of a flange is located above a center of the second branch pipe, when a second coupler is fastened, the flange is moved downward and, at the same time, is moved radially inward by a fastening force of a second fixing part to press a second gasket part, and thus the leakage of the branched fluid can be further effectively prevented.",True,0.1788662225008011,0.9073600977985768,42,80,-38,172,428,-256
도 1은 본 발명에 따른 스프링클러 시스템을 도시한 도면이다.,FIG. 1 is a view illustrating a sprinkler system according to the present invention.,True,0.1410492807626724,0.9103191898382316,9,14,-5,34,84,-50
도 2는 본 발명에 따른 각각의 파이프가 분리된 상태를 도시한 도면이다.,FIG. 2 is a view illustrating a state in which pipes are separated according to the present invention.,True,0.1734562516212463,0.8905550334286875,11,18,-7,40,102,-62
"도 3은 본 발명의 일 실시예에 따른 제1 커플러가 체결된 상태를 도시한 단면도이고, 도 4는 본 발명의 다른 실시예에 따른 제1 커플러가 체결된 상태를 도시한 단면도이다.","FIG. 3 is a cross-sectional view illustrating a fastened state of a first coupler according to one embodiment of the present invention, and FIG. 4 is a cross-sectional view illustrating a fastened state of a first coupler according to another embodiment of the present invention.",True,0.1380051225423813,0.9214263214846624,26,45,-19,96,279,-183
도 5는 본 발명에 따른 제2 커플러를 도시한 사시도이다.,FIG. 5 is a perspective view illustrating a second coupler according to the present invention.,True,0.1337766796350479,0.9159351114217776,9,15,-6,32,94,-62
도 6은 본 발명에 따른 제2 커플러가 체결되기 전의 상태를 도시한 도면이다.,FIG. 6 is a view illustrating an unfastened state of the second coupler according to the present invention.,True,0.2664109170436859,0.826320713024286,12,18,-6,43,107,-64
도 7은 본 발명에 따른 제2 커플러가 체결된 상태를 도시한 도면이다.,FIG. 7 is a view illustrating a fastened state of the second coupler according to the present invention.,True,0.1325348019599914,0.9168059883467028,11,18,-7,39,104,-65
도 8은 도 7의 A 부분을 확대 도시한 도면이다.,FIG. 8 is an enlarged view illustrating part A of FIG. 7.,True,0.0545396991074085,0.9595035313450316,9,12,-3,28,57,-29
"도 9는 본 발명에 따른 제2 커플러의 체결 과정에서 제2 가스켓부의 가압 상태를 도시한 도면으로, (a)는 체결되기 전의 상태를 도시한 도면이고, (b)는 체결된 상태를 도시한 도면이다.","FIG. 9 are views illustrating a state in which a second gasket part is compressed in a process of fastening the second coupler according to the present invention, wherein FIG. 9A is a view illustrating a state before fastening, and FIG. 9B is a view illustrating a fastened state.",True,0.2088282108306884,0.8801774557743096,26,49,-23,105,280,-175
"이하, 첨부한 도면을 참고로 하여 본 발명의 실시예에 대하여 본 발명이 속하는 기술분야에서 통상의 지식을 가진 자가 용이하게 실시할 수 있도록 상세히 설명한다.","Hereinafter, embodiments of the present invention will be described in detail with reference to the accompanying drawings so that those skilled in the art to which the present invention pertains may easily implement the present invention.",True,0.1862159073352813,0.8760633588599542,23,36,-13,89,238,-149
본 발명은 여러 가지 상이한 형태로 구현될 수 있으며 여기에서 설명하는 실시예에 한정되지 않는다.,The present invention may be implemented in various different forms and is not limited to the embodiments described herein.,True,0.0774749591946601,0.947170934917746,14,19,-5,54,123,-69
"도면에서 본 발명을 명확하게 설명하기 위해서 설명과 관계없는 부분은 생략하였으며, 명세서 전체를 통하여 동일 또는 유사한 구성요소에 대해서는 동일한 참조부호를 붙였다.","In the drawings, parts irrelevant to the description are omitted in order to clearly describe the present invention, and the same reference numerals are assigned to the same or similar components throughout the specification.",True,0.1332142055034637,0.9132893255893888,21,34,-13,93,225,-132
"본 명세서에서, ""포함하다"" 또는 ""가지다"" 등의 용어는 명세서상에 기재된 특징, 숫자, 단계, 동작, 구성 요소, 부품 또는 이들을 조합한 것이 존재함을 지정하려는 것이지, 하나 또는 그 이상의 다른 특징들이나 숫자, 단계, 동작, 구성 요소, 부분품 또는 이들을 조합한 것들의 존재 또는 부가 가능성을 미리 배제하지 않는 것으로 이해되어야 한다.","It should be understood in the present specification that the terms ""include"" or ""have"" are intended to indicate that there are features, numbers, steps, operations, components, parts, or combinations thereof that are described in the specification and do not exclude in advance the possibility of the presence or addition of one or more other features, numbers, steps, operations, components, parts, or combinations thereof.",True,0.1241919845342636,0.917494874074016,49,63,-14,195,425,-230
"도 1은 본 발명에 따른 스프링클러 시스템을 도시한 도면이고, 도 2는 본 발명에 따른 각각의 파이프가 분리된 상태를 도시한 도면이고, 도 3은 본 발명의 일 실시예에 따른 제1 커플러가 체결된 상태를 도시한 단면도이고, 도 4는 본 발명의 다른 실시예에 따른 제1 커플러가 체결된 상태를 도시한 단면도이며, 도 5는 본 발명에 따른 제2 커플러를 도시한 사시도이고, 도 6은 본 발명에 따른 제2 커플러가 체결되기 전의 상태를 도시한 도면이고, 도 7은 본 발명에 따른 제2 커플러가 체결된 상태를 도시한 도면이고, 도 8은 도 7의 A 부분을 확대 도시한 도면이며, 도 9는 본 발명에 따른 제2 커플러의 체결 과정에서 제2 가스켓부의 가압 상태를 도시한 도면으로, (a)는 체결되기 전의 상태를 도시한 도면이고, (b)는 체결된 상태를 도시한 도면이다.","FIG. 1 is a view illustrating a sprinkler system according to the present invention, FIG. 2 is a view illustrating a state in which pipes are separated according to the present invention, FIG. 3 is a cross-sectional view illustrating a fastened state of a first coupler according to one embodiment of the present invention, FIG. 4 is a cross-sectional view illustrating a fastened state of a first coupler according to another embodiment of the present invention, FIG. 5 is a perspective view illustrating a second coupler according to the present invention, FIG. 6 is a view illustrating an unfastened state of the second coupler according to the present invention, FIG. 7 is a view illustrating a fastened state of the second coupler according to the present invention, FIG. 8 is an enlarged view illustrating part A of FIG. 7, and FIG. 9 are views illustrating a state in which a second gasket part is compressed in a process of fastening the second coupler according to the present invention, wherein FIG. 9A is a view illustrating a state before fastening, and FIG. 9B is a view illustrating a fastened state.",True,0.1790008246898651,0.90798379519393,113,189,-76,424,1114,-690
"도 1 및 도 2에 도시된 바와 같이, 본 발명에 따른 스프링클러 시스템은 외부로부터 유체가 공급되는 메인 파이프(100)와, 메인 파이프(100)를 통해 공급되는 유체를 분기시키는 제1 분기 파이프(200)와, 제1 분기 파이프(200)를 통해 공급되는 유체가 스프링클러에 공급되도록 분기시키는 제2 분기 파이프(300), 및 메인 파이프(100), 제1 분기 파이프(200) 및 제2 분기 파이프(300)를 상호 연결하는 분리 가능한 제1 커플러(400)를 포함한다.","As illustrated in FIGS. 1 and 2, a sprinkler system according to the present invention includes a main pipe 100 through which a fluid is supplied from an external source, a first branch pipe 200 through which the fluid supplied through the main pipe 100 branches off, a second branch pipe 300 through which the fluid supplied through the first branch pipe 200 branches off so that the fluid is supplied to a sprinkler 10, and a detachable first coupler 400 that interconnects the main pipe 100, the first branch pipe 200, and the second branch pipe 300.",True,0.1156318858265876,0.9385584705942585,56,98,-42,263,553,-290
"앞서 살펴본 바와 같이, 종래의 경우 유입 파이프와 분기 파이프를 연통 설치하기 위해 유입 파이프에 형성된 분기홀에 분기 파이프를 용접하는 방식으로 설치하였으나, 이는 용접 불량으로 인한 유체 누설이나, 추후 유지 및 보수가 용이하지 않은 문제가 있었으나, 본 발명에 따른 스프링클러 시스템은 메인 파이프(100), 제1 분기 파이프(200) 및 제2 분기 파이프(300)를 분리 가능한 제1 커플러(400)를 이용해서 상호 연결하므로 용접 불량으로 인한 누설 등의 문제를 예방할 수 있고, 추후 유지 및 보수하는 것이 용이하게 되며, 무 용접 방식으로 각각의 파이프 및 스프링클러(10)를 연결하므로 조립 공수 감소 및 시공 비용이 절감된다.","As described above, in the related art, in order for an inlet pipe and a branch pipe to communicate with each other, the branch pipe is installed in a branch hole formed in the inlet pipe in a welding manner.",False,0.7195729613304138,0.6030226843243801,88,40,48,360,208,152
"이때, 제1 커플러(400)는 상호 대향하는 한 쌍의 제1 바디부(410)와, 한 쌍의 제1 바디부(410)를 상호 체결 고정하는 제1 체결부(420)를 포함할 수 있다.","However, in this way, the fluid may leak due to bad welding, and in the future, a maintenance/repair operation is not easy.",False,1.128056883811951,0.2476553695476382,21,22,-1,95,123,-28
"즉, 메인 파이프(100)와 제1 분기 파이프(200)의 단부가 상호 인접하도록 배치한 상태에서 한 쌍의 제1 바디부(410) 사이에 메인 파이프(100)와 제1 분기 파이프(200)의 단부가 위치하도록 배치한 후 제1 체결부(420)를 이용해서 한 쌍의 제1 바디부(410)를 체결하는 간단한 방식으로 고정하게 되므로 종래의 용접 방식과 비교할 때 조립 공수가 감소하고, 이를 통한 인건비 절감이 가능하게 된다.","However, in the sprinkler system according to the present invention, since the main pipe 100, the first branch pipe 200, and the second branch pipe 300 are interconnected using the detachable first coupler 400, leakage due to bad welding can be prevented, the maintenance/repair operation is easy in the future, and since the respective pipes and the sprinkler 10 are connected in a non-welding manner, assembly man hours and construction costs are reduced.",False,0.4565788805484772,0.7418955727624726,51,73,-22,231,457,-226
"또한, 제1 분기 파이프(200)와 제2 분기 파이프(300)의 경우도 제1 분기 파이프(200)와 제2 분기 파이프(300)의 단부가 상호 인접하도록 배치한 상태에서 한 쌍의 제1 바디부(410) 사이에 제1 분기 파이프(200)와 제2 분기 파이프(300)의 단부가 위치하도록 배치한 후 제1 체결부(420)를 이용해서 한 쌍의 제1 바디부(410)를 체결하는 간단한 방식으로 고정하게 된다.","In this case, the first coupler 400 may include a pair of first body parts 410 facing each other and a first fastening part 420 that fixedly fastens the pair of first body parts 410 to each other.",False,0.4523401856422424,0.7569486309010338,46,38,8,221,196,25
"즉, 제1 바디부(410)에는 일측 파이프에 형성된 체결홈(20)에 삽입되는 일측 걸림","That is, in a state in which an end of the main pipe 100 and an end of the first branch pipe 200 are arranged adjacent to each other, after the end of the main pipe 100 and the end of the first branch pipe 200 are located and arranged between the pair of first body parts 410, the pair of first body parts 410 are fixedly fastened in a simple manner using the first fastening part 420.",False,0.5872802734375,0.6568069604418335,10,78,-68,48,385,-337
"이들 지지 다리(105, 106)가, 가압 분석용 구조체(1)를 지지하기 위한 지지부를 구성하고 있다.]",These support legs 105 and 106 form a support portion for supporting the pressurization analysis structure 1.,True,0.1431882977485656,0.9067589355417864,12,17,-5,58,109,-51
"[또, 시료 수용 유닛(10)에 마련된 한쌍의 조작봉(52)은, 한쌍의 지지 홈(106a)에 배치하는 피지지부로서 기능하고 있다.","Further, the pair of operating rods 52 provided in the sample accommodating unit 10 function as supported portions placed on the pair of support grooves 106a.",True,0.2429009824991226,0.8488778718706672,14,26,-12,72,158,-86
"그리고, 도 10B에 도시하는 바와 같이, 가압 분석용 구조체(1)의 후단 부분(기밀 케이스 유닛(40) 부분)을 지지 홈(105a) 위에 배치함과 함께, X선 창(14)이 형성되는 시료 수납 유닛(10)의 2개의 조작봉(52)을, 각각 지지 홈(106a) 위에 배치함으로써, 시료 수용 유닛(10) 내에 수용 지지되어 있는 전고체 전지(S)의 중심축이 수평 배치된다.","As shown in FIG. 10B, a rear end portion of the pressurization analysis structure 1 (the portion corresponding to the airtight case unit 40) is placed on the support groove 105a, and the two operating rods 52 of the sample accommodating unit 10 in which the X-ray window 14 is formed are placed on the support grooves 106a respectively, whereby the central axis of the all-solid-state battery S accommodated and supported in the sample accommodating unit 10 is arranged horizontally.",True,0.1820721626281738,0.9079604079017328,44,80,-36,206,483,-277
"또, 시료 수용 유닛(10)에 마련된 한쌍의 조작봉(52)을, 한쌍의 지지 홈(106a)에 의해 지지함으로써, 시료 수용 유닛(10) 내에 수용 지지되어 있는 전고체 전지(S)의 중심축과 직교하는 축이 수평 배치된다.","Further, the pair of operating rods 52 provided in the sample accommodating unit 10 are supported by the pair of support grooves 106a, whereby an axis orthogonal to the central axis of all solid-state battery S accommodated and supported in the sample accommodating unit 10 is arranged horizontally.",True,0.1818049699068069,0.8960096162417992,26,48,-22,121,299,-178
"이 전고체 전지(S)의 중심축 및 그것과 직교하는 축을 포함하는 가상 평면이 측정 기준 평면으로 되고, 수평 배치된 이 측정 기준 평면에 대해서 θ－2θ의 관계를 갖고서 X선 회절 측정이 속행된다.]","A virtual plane including the central axis of the all-solid-state battery S and the axis orthogonal to the central axis serves as a measurement reference plane, and X-ray diffraction measurement is continued while keeping the relation of θ-2θ with the horizontally-arranged measurement reference plane.",True,0.2616533935070038,0.8423617721484776,29,44,-15,111,302,-191
"[시료 스테이지(103)는, 지지대(104)를 수평면 상의 두 방향(X-Y 방향)과 높이 방향(Z방향)으로 이동시키는 이동 조정 기구(107)를 탑재하고 있다.",The sample stage 103 is equipped with a movement adjusting mechanism 107 for moving the support stand 104 in two directions (X-direction and Y-direction) on the horizontal plane and a height direction (Z-direction).,True,0.1030735224485397,0.9353580161951148,16,33,-17,89,215,-126
"이 이동 조정 기구(107)에 의해, 가압 분석용 구조체(1) 내의 전고체 전지(S)가, X선원(101)으로부터의 X선의 조사 위치에 위치결정된다.]",The all-solid-state battery S in the pressurization analysis structure 1 is positioned at an irradiation position of X-rays from the X-ray source 101 by the movement adjusting mechanism 107.,True,0.3747515082359314,0.7783545244455327,16,29,-13,83,190,-107
"[가압 분석용 구조체(1)의 X선 창(14)은, 지지대(104) 상에서 상향으로 배치되고, X선원(101)으로부터의 X선이 이 X선 창(14)을 통해 전고체 전지(S)에 조사된다.","The X-ray window 14 of the pressurization analysis structure 1 is arranged to face upward above the support stand 104, and X-rays from the X-ray source 101 are applied to the all-solid-state battery S through the X-ray window 14.",True,0.2929001152515411,0.8334078036921424,18,39,-21,100,229,-129
"그리고, 전고체 전지(S)로부터 반사되어 온 회절 X선이, X선 창(14)을 통해 X선 검출기(102)로 검출된다.]",Diffracted X-rays reflected from the all-solid-state battery S are detected by the X-ray detector 102 through the X-ray window 14.,True,0.285333514213562,0.8171214338359696,13,20,-7,65,130,-65
"[다음에, 본 발명의 실시형태에 관계된 가압 분석 시스템에 대하여 설명한다.]","Next, a pressurization analysis system according to an embodiment of the present invention will be described.",True,0.2372407168149948,0.8492983672327553,10,16,-6,43,109,-66
[도 11은 본 실시형태에 관계된 가압 분석 시스템의 전체 구조를 모식적으로 도시하는 구성도이다.],FIG. 11 is a configuration diagram schematically showing the overall structure of the pressurization analysis system according to the present embodiment.,True,0.1910677403211593,0.8800328301521843,13,21,-8,55,153,-98
"[가압 분석 시스템은, 상술한 X선 회절 장치(2)와, 가압 분석용 구조체(1)를 수납해서 장기간 대기로부터 차단하는 기밀 장치(3)와, 가압 분석용 구조체(1)에 수용된 전고체 전지(S)(시료)의 압력 및 전기화학 특성을 기밀 장치(3)의 외부에서 계측하기 위한 계측 기기(4)를 구성요소에 포함하고 있다.]","The pressurization analysis system includes, as components, the above-mentioned X-ray diffraction apparatus 2, an airtight device 3 for shielding the pressurization analysis structure 1 from the atmosphere for a long period of time while accommodating the pressurization analysis structure 1 therein, and a measuring device 4 for measuring the pressure and electrochemical characteristics of an all-solid-state battery S (sample) accommodated in the pressurization analysis structure 1 at the outside of the airtight device 3.",True,0.2314288765192031,0.8793651650267198,36,74,-38,173,526,-353
"[기밀 장치(3)는, 가압 분석용 구조체(1)를 수납할 수 있는 내부 공간(3a)을 가지고 있다.",The airtight device 3 has an internal space 3a that can accommodate the pressurization analysis structure 1.,True,0.2479434162378311,0.8473753300624122,12,17,-5,54,108,-54
그 내부 공간(3a)은 대기를 차단하는 밀폐 공간을 형성하고 있다.,The internal space 3a forms a hermetically sealed space that blocks the atmosphere.,True,0.2291725873947143,0.8307290877361776,9,13,-4,37,83,-46
"내부 공간(3a)은, 배관(3b)을 거쳐 진공 펌프(도시하지 않음)에 연통되고, 진공 펌프의 가동에 의해 진공화되는 구성으로 되어 있다.","The internal space 3a is configured to communicate with a vacuum pump (not shown) via a pipe 3b, and be evacuated by the operation of the vacuum pump.",True,0.1702871471643448,0.8875176139577025,16,28,-12,76,150,-74
"기밀 장치(3)에는 진공계(3c)가 내장되고, 이 진공계(3c)에 의해, 내부 공간(3a) 내의 진공도를 상시 측정하고 있다.]","A vacuum gauge 3c is incorporated in the airtight device 3, and the degree of vacuum in the internal space 3a is constantly measured by the pressure gauge 3c.",True,0.2139922976493835,0.862531804703076,14,29,-15,71,158,-87
"[또한, 기밀 장치(3)는, 가압 분석용 구조체(1)에 설치되어 있는 전고체 전지(S)를 적어도 측정을 계속하고 있는 동안, 대기를 차단할 수 있을 정도의 진공도로 하는 기능이나, 고순도의 아르곤 가스(불활성 가스)를 충전하는 기능을 구비하고 있으면 된다.]",Note that the airtight device 3 may have a function of keeping a vacuum level at which the all-solid-state battery S placed in the pressurization analysis structure 1 can be shielded from the atmosphere or filling a high-purity argon gas (inert gas) at least while the measurement is continued.,True,0.2435343712568283,0.8608017246600417,32,49,-17,144,294,-150
"[계측 기기(4)는, 가압 분석용 구조체(1)가 구비하는 로드 셀(34)로부터의 신호를 입력해서, 전고체 전지(S)의 가압 상태를 계측하는 기능을 가지고 있다.","The measuring device 4 has a function of inputting a signal from the load cell 34 included in the pressurization analysis structure 1 to measure the pressurized state of the all-solid-state battery S. Further, the measuring device 4 is connected to the first electrode terminal 26 and the second electrode terminal 42 to be brought with a function of measuring a state in which the all-solid-state battery S is charged and discharged.",False,0.4032417833805084,0.7717674073274182,18,72,-54,89,434,-345
"또, 후술하는 온도 센서(202)에 접속되어, 전고체 전지(S)의 온도를 계측하는 기능을 마련하는 것도 가능하다.]","Further, the measuring device 4 is connected to a temperature sensor 202 described later to be brought with a function of measuring the temperature of the all-solid-state battery S.",True,0.3737492263317108,0.7855541853669616,13,29,-16,64,181,-117
"[가압 분석용 구조체(1)를 기밀 장치(3)의 내부 공간(3a)에 수납해서, 계측 기기(4)에 의해 전고체 전지(S)의 압력 및 전기화학 특성을 계측한다.","The pressurization analysis structure 1 is accommodated in the internal space 3a of the airtight device 3, and the pressure and electrochemical characteristics of the all-solid-state battery S are measured by the measuring device 4.",True,0.3062289953231811,0.8319323529961443,18,35,-17,86,232,-146
"그리고, 계측값에 변화가 나타났을 때에, 가압 분석용 구조체(1)를 기밀 장치(3)로부터 꺼내어(취출해서), X선 회절 장치(2)의 시료 스테이지(103)에 배치하고, X선 회절 측정을 실행한다.","When a change appears in the measured value, the pressurization analysis structure 1 is taken out from the airtight device 3, and placed on the sample stage 103 of the X-ray diffraction apparatus 2 to perform X-ray diffraction measurement.",True,0.2205612063407898,0.8720674183417906,21,39,-18,109,239,-130
"이와 같은 순서로 전고체 전지(S)를 분석함으로써, X선 회절 장치(2)를 장시간 점유할 필요가 없어져, 효율적으로 분석 평가를 진행시키는 것이 가능해진다.]","By analyzing the all-solid-state battery S according to the procedure as described above, it is not necessary to occupy the X-ray diffraction apparatus 2 for a long time, and it is possible to efficiently proceed with the analysis and evaluation.",True,0.3191414773464203,0.7837911221343467,19,40,-21,88,246,-158
"[다음에, 본 발명에 관계된 가압 분석용 구조체의 다른 실시형태에 대하여 설명한다.]","Next, another embodiment of the pressurization analysis structure according to the present invention will be described.",True,0.2537011504173279,0.8404528090448314,11,16,-5,47,119,-72
[도 12A 및 도 12B는 온도 조정·계측용 셀을 탑재한 시료 수용 유닛의 구성을 도시하는 도면이다.,FIGS. 12A and 12B are diagrams showing a configuration of a sample accommodating unit in which a temperature adjusting/measuring cell is installed.,True,0.1930821388959884,0.8860692545955955,15,22,-7,57,147,-90
"이들 도면에 도시하는 바와 같이, 시료 수용 유닛(10)에 온도 조정·계측용 셀(200)을 탑재해도 된다.","As shown in these figures, a temperature adjusting/measuring cell 200 may be installed in the sample accommodating unit 10.",True,0.1615932434797287,0.910282946433104,13,19,-6,59,123,-64
"온도 조정·계측용 셀(200)은, 히터(201)와 온도 센서(202)를 포함하고 있다.",The temperature adjusting/measuring cell 200 includes a heater 201 and a temperature sensor 202.,True,0.0910181105136871,0.9479539596588498,8,14,-6,48,96,-48
"히터(201)는, 시료 수용 유닛(10) 내에 수용된 전고체 전지(S)의 온도를 조정하기 위한 온도 조정 부재로서 기능하고, 온도 센서(202)는, 그 전고체 전지(S)의 온도를 측정하기 위한 온도 측정 부재로서 기능한다.]","The heater 201 functions as a temperature adjusting member for adjusting the temperature of the all-solid-state battery S accommodated in the sample accommodating unit 10, and the temperature sensor 202 functions as a temperature measuring member for measuring the temperature of the all-solid-state battery S.",True,0.1772881746292114,0.9058560207163142,27,45,-18,125,310,-185
"[이와 같이, 온도 조정 부재와 온도 측정 부재를 포함하는 구성으로 함으로써, 적당한 압력 및 온도 조건 하에서 시료를 분석 평가할 수가 있다.]","As described above, the pressurization analysis structure is configured to include the temperature adjusting member and the temperature measuring member, whereby it is possible to analyze and evaluate a sample under appropriate pressure and temperature conditions.",True,0.38321653008461,0.788771604445435,22,36,-14,81,264,-183
"[히터(201)는, 수용 유닛 본체(11)에 있어서의 외부에 노출되는 단면에 겹쳐서 배치하고, 그 표면을 단열재로 이루어지는 압력 부재(203)로 피복해서, 볼트 등의 체결구(50)에 의해 수용 유닛 본체(11)에 고정되어 있다.]","The heater 201 is arranged so as to be superimposed on an end surface of the accommodating unit main body 11 which is exposed to the outside, the surface of the heater 201 is covered with a pressing member 203 formed of a heat insulating material, and the heater 201 is fixed to the accommodating unit main body 11 by a fastener 50 such as a bolt.",True,0.1886034309864044,0.8954234062447853,26,67,-41,129,347,-218
"[또, 온도 센서(202)는, 수용 유닛 본체(11)의 중앙부에 마련된 축방향의 나사 홈(204)에 매립하고, 압력받이부(12) 근방에 선단이 배치되어 있다.","Further, the temperature sensor 202 is embedded in a screw groove 204 which is provided in the central portion of the accommodating unit main body 11 so as to extend in an axial direction, and the tip thereof is arranged in the vicinity of the pressure receiving portion 12.",True,0.1808761805295944,0.9025297642172292,17,49,-32,88,274,-186
"도 12B에서는, 압력받이 부재를 이용하지 않고, 압력받이부(12)를 중공부(23a)측으로 돌출시켜서, 이 압력받이부(12)에 전고체 전지(S)를 접촉시키고 있지만, 상술한 실시형태와 마찬가지로, 압력받이 부재(21)를 개재시켜도 된다.]","In FIG. 12B, the pressure receiving member is not used, and the pressure receiving portion 12 is protruded to the hollow portion 23a side to bring the all-solid-state battery S into contact with the pressure receiving portion 12.",False,0.3727292418479919,0.7935648689792656,22,38,-16,133,229,-96
"[히터(201)로부터의 열은, 수용 유닛 본체(11)의 압력받이부(12)를 경유해서, 전고체 전지(S)의 일단면에 전해져 간다.",The heat from the heater 201 is transferred to one end surface of the all-solid-state battery S via the pressure receiving portion 12 of the accommodating unit main body 11.,True,0.2291809767484665,0.8667475878258358,12,30,-18,71,173,-102
"실온에서 이온 도전율이 낮은 전고체 전지(S) 등은, 가압한 것만으로는 도전 패스를 확보할 수 없는 경우가 있다.","With respect to the all-solid-state battery S and the like which have low ionic conductivity at room temperature, a conductive path may not be secured only by pressurizing them.",True,0.3490467667579651,0.7619429869891293,16,29,-13,63,177,-114
"그 경우는, 히터(201)에 의해 전고체 전지(S)를 가열함으로써, 충방전에 수반하는 도전 패스를 확보할 수가 있다.","In that case, by heating the all-solid-state battery S with the heater 201, it is possible to secure a conductive path for charging and discharging.",True,0.3312883079051971,0.7828072120179997,14,25,-11,65,148,-83
"전고체 전지(S)의 온도는, 온도 센서(202)에 의해 계측되고, 그 계측값에 기초하여, 도시하지 않는 온도 제어 장치에 의해 히터(201)가 제어되어, 전고체 전지(S)를 원하는 온도로 조정한다.]","The temperature of the all-solid-state battery S is measured by the temperature sensor 202, and the heater 201 is controlled based on the measured value by a temperature control device (not shown) to adjust the all-solid-state battery S to a desired temperature.",True,0.1781922727823257,0.9031120744900796,23,42,-19,111,262,-151
"[또한, 본 발명은 상술한 실시형태에 한정되는 것은 아니고, 갖가지 변형 실시나 응용 실시가 가능한 것은 물론이다.]","The present invention is not limited to the above-described embodiments, and it goes without saying that various modifications and applications can be implemented.",True,0.2561075389385223,0.8271727677410298,16,23,-7,65,163,-98
"[예를 들면, 본 발명의 가압 분석용 구조체는, 전해질에 고체 혹은 겔상의 전해질을 이용한 각종 전지의 분석 평가에 적용할 수가 있다.","For example, the pressurization analysis structure of the present invention can be applied to analysis and evaluation on various types of batteries using a solid or gel-like electrolyte as the electrolyte.",True,0.2743034660816192,0.8387081565854423,20,31,-11,75,205,-130
"나아가서는, 앞서 기술한 대로, 각종 시료에 대한 가압된 상태에서의 분석 평가에 적용할 수가 있다.]","Furthermore, as described above, it can be applied to analysis and evaluation on various samples under a pressurized state.",True,0.2068181186914444,0.858586456898374,14,19,-5,56,123,-67
"[또, 본 발명의 가압 분석용 구조체를 구성하는 각 요소의 형상은, 상술한 실시형태에 나타낸 형상에 한정되는 것은 아니다.","Further, the shape of each of the components constituting the pressurization analysis structure of the present invention is not limited to the shape shown in the above-described embodiments.",True,0.154995322227478,0.9103717297177012,17,28,-11,68,190,-122
"예를 들면, 시료 수용 유닛(10)은 바닥 있는 원통형에 한정되지 않고, 가압 유닛(30)은 원통형에 한정되지 않고, 기밀 케이스 유닛(40)은 바닥 있는 원통형에 한정되는 것은 아니고, 각각 필요에 따라서 다른 형상으로 제작해도 된다.]","For example, the shape of the sample accommodating unit 10 is not limited to a bottomed cylindrical shape, the shape of the pressurizing unit 30 is not limited to a cylindrical shape, and the shape of the airtight case unit 40 is not limited to a bottomed cylindrical shape, and the components may be manufactured to have other shapes as necessary.",True,0.2438716441392898,0.8609388146125369,31,61,-30,133,348,-215
"[또, 상술한 실시형태에서는 압력받이 부재(21)를 구비하고 있었지만, 이것을 생략해서, 수용 유닛 본체(11)의 압력받이부(12)를 볼록 형상으로 형성하고, 상기 압력받이부(12)에 의해 전고체 전지(S)를 지지하는 구성으로 해도 된다.","However, these embodiments may be configured so that the pressure receiving member 21 is omitted, the pressure receiving portion 12 of the accommodating unit main body 11 is formed in a convex shape, and the all-solid-state battery S is supported by the pressure receiving portion 12.",False,0.2768251597881317,0.8570536929056545,25,46,-21,133,284,-151
"도 12B에 도시한 다른 실시형태에서는, 압력받이 부재(21)를 생략한 구조로 되어 있다.]",Another embodiment shown in FIG. 12B has a configuration in which the pressure receiving member 21 is omitted.,True,0.2024666965007782,0.8768634407283334,11,18,-7,51,110,-59
"[또, 본 발명에 관계된 가압 분석용 구조체의 조립에, 글로브 박스는 필수가 아니며, 전고체 전지의 종류에 따라서는 글로브 박스를 사용하지 않는 조립도 가능하다.]","Further, a glove box is not indispensable for assembling the pressurization analysis structure according to the present invention, and it is possible to perform an assembling work using no glove box according to the types of all-solid-state batteries.",True,0.3446224629878998,0.7883536790880649,22,38,-16,91,251,-160
"[시료 수용 유닛, 가압 유닛, 기밀 케이스 유닛이나, 그들의 구성요소는, 상술한 실시형태의 구성에 한정되는 것은 아니다.","The sample accommodating unit, the pressurizing unit, the airtight case unit, and the components thereof are not limited to the configurations of the above-described embodiments.",True,0.2350868284702301,0.8510621312486957,16,25,-9,68,178,-110
"예를 들면, 각 구성요소의 어느 부위를 도전성 또는 절연성을 가지는 재료로 구성할지는, 각 전극 단자의 설치 개소 등에 따라, 적당히 설계 변경할 수가 있다.]","For example, which part of each component is formed of a conductive material or insulating material can be changed in design as appropriate according to the installation location of each electrode terminal and the like.",True,0.1919588893651962,0.8786338615280831,24,35,-11,89,219,-130
"제1영역의 셀(cell)에 존재하는 문제를 모델링하여 N개의 에이전트(agent), 모델링 방법 및 훈련 방법을 얻는 단계; -여기서, 상기 제1영역에 포함된 셀에 존재하는 문제가 같은 유형에 속한 셀의 비율이 설정된 임계치보다 크거나 같고, 포함된 셀의 지리적 위치가 연속적이고, 제1영역의 윤곽이 외부로 돌출되는 모양이며, N이 1보다 크거나 같은 정수임-; 및각 에이전트에 대하여, 모델링 방법 및 훈련 방법에 따라 상기 에이전트의 초기 모델을 결정하고, 모델링 방법 및 훈련 방법에 따라 심화 학습 방법으로 에이전트의 초기 모델을 훈련시키거나, 또는 에이전트의 훈련된 모델에 따라 에이전트에 대응하는 셀에 대해 네트워크 최적화를 진행하거나, 또는 모델링 방법 및 훈련 방법에 따라 상기 에이전트의 초기 모델을 결정하고, 모델링 방법 및 훈련 방법에 따라 심화 학습 방법으로 에이전트의 초기 모델을 훈련시키고, 에이전트의 훈련된 모델에 따라 에이전트에 대응하는 셀에 대해 네트워크 최적화를 진행하는 단계;를 포함하는 네트워크 최적화 방법.","A network optimization method, comprising: modeling problems existing in cells in a first region to obtain N agents, a modeling method and a training method, wherein a proportion of cells in which existing problems belong to a same problem category among the cells contained in the first region is greater than or equal to a preset threshold, geographic locations of the cells contained are consecutive, and an outline of the first region is an outwardly convex figure, and N is an integer greater than or equal to 1; and for each of the agents, determining an initial model of the agent according to the modeling method and the training method, and training the initial model of the agent using a reinforcement learning method according to the modeling method and the training method; or performing network optimization on a cell corresponding to the agent according to the trained model of the agent; or determining an initial model of the agent according to the modeling method and the training method, training the initial model of the agent using a reinforcement learning method according to the modeling method and the training method, and performing network optimization on a cell corresponding to the agent according to the trained model of the agent.",True,0.3285689353942871,0.8891445464743548,125,208,-83,528,1259,-731
"청구항 1에 있어서,상기 제1영역의 셀에 존재하는 문제를 모델링하여 N개의 에이전트, 모델링 방법 및 훈련 방법을 얻는 단계는,미리 설정된 문제 유형, 모델링 방법 및 훈련 방법 사이의 대응 관계에서 상기 제1영역에 포함된 셀에 존재한 문제가 속한 문제 유형에 대응하는 모델링 방법 및 훈련 방법을 검색하는 단계, -여기서, 상기 모델링 방법은 상기 에이전트의 생성 방법, 상기 에이전트의 상태 정의 방법, 상기 에이전트의 동작 정의 방법, 상기 에이전트의 보상 함수(reward function)의 정의 방법 및 상기 에이전트의 동작 선택 초기 정책의 정의 방법을 포함하고, 상기 훈련 방법은, 심화 학습 방법을 이용하여 동작 선택 초기 정책을 조정하는 방법을 포함함;- 상기 에이전트의 생성 방법에 따라 N개의 상기 에이전트를 생성하는 단계;를 포함하는 네트워크 최적화 방법.","The method of claim 1, wherein modeling problems existing in cells in a first region to obtain N agents, a modeling method and a training method comprises: searching, in a preset correspondence between problem categories, modeling methods and training methods, for a modeling method and a training method corresponding to a problem category to which a problem existing in a cell contained in the first region belongs, wherein the modeling method comprises: a generation method for the agent, a definition method for a state of the agent, a definition method for an action of the agent, a definition method for a reward function of the agent, and a definition method for an initial policy of the agent for selecting an action; and the training method comprises: a method for adjusting, using a reinforcement learning method, an initial policy for selecting an action; and generating N agents according to the generation method for the agent.",True,0.3035915195941925,0.8959967529140868,108,154,-46,436,940,-504
"청구항 2에 있어서,상기 에이전트의 생성 방법에 따라 N개의 상기 에이전트를 생성하는 단계는,상기 제1영역의 셀에 존재하는 문제가 복수의 셀 사이의 협동 작업과 관련이 없는 경우, 상기 제1영역 중 하나의 상기 셀을 하나의 상기 에이전트로 하고, 상기 셀들은 각각 다른 상기 에이전트와 대응하는 것;상기 제1영역의 셀에 존재하는 문제가 복수의 셀 사이의 협동 작업과 관련이 있는 경우, 상기 제1영역 중 인접 관계가 있는 하나의 셀 페어(pair)를 하나의 상기 에이전트로 하고, 인접 관계가 있는 셀 페어(pair)들은 각각 다른 상기 에이전트와 대응하는 것; 중 어느 하나 또는 하나 이상을 포함하는 네트워크 최적화 방법.","The method of claim 2, wherein generating N agents according to the generation method for the agent comprises at least one of: when the problems existing in the cells in the first region do not involve collaboration between multiple cells, using one cell in the first region as one agent, wherein a respective cell correspond to a respective agent; or when the problems existing in the cells in the first region involve collaboration between multiple cells, using one cell pair with an adjacency relationship in the first region as one agent, wherein a respective cell pair with an adjacency relationship correspond to a respective agent.",True,0.4308353066444397,0.8251784215097743,88,105,-17,350,638,-288
"청구항 1에 있어서,상기 제1영역을 결정하는 단계는,네트워크 중의 모든 셀의 히스토리 성능 데이터를 획득하는 단계;각 상기 셀에 대하여, 상기 셀의 히스토리 성능 데이터에 따라 상기 셀이 정상 셀인지 아니면 문제 셀인지를 결정하는 단계;문제 셀에 존재하는 문제가 같은 문제 유형에 속한 셀을 동일한 제2영역으로 분류하는 단계;각각의 상기 제2영역에 대하여, 상기 제2영역에 포함된 셀의 지리적 위치관계 및 상기 제2영역의 윤곽에 따라 상기 제1영역을 결정하는 단계를 포함하는 네트워크 최적화 방법.","The method of claim 1, wherein the determination of the first region comprises: acquiring history performance data of all cells in a network; determining, for each of the cells, whether the cell is a normal cell or a problematic cell according to history performance data of the cell; dividing, into a same second region, cells in which existing problems belong to a same problem category among problematic cells; and determining, for each second region, the first region according to a geographic location relationship of cells contained in the second region and the outline of the second region.",True,0.2284506559371948,0.9100746159262452,66,97,-31,278,597,-319
"청구항 4에 있어서,상기 제2영역에 포함된 셀의 지리적 위치관계 및 상기 제2영역의 윤곽에 따라 상기 제1영역을 결정하는 단계는,상기 제2영역에 포함된 셀의 지리적 위치가 연속적이고 상기 제2영역의 윤곽이 외부로 돌출되는 모양인 경우, 상기 제2영역을 상기 제1영역로 하는 것과;상기 제2영역에 포함된 셀의 지리적 위치가 비 연속적이거나 상기 제2영역의 윤곽이 외부로 돌출되는 모양이 아닌 경우, 상기 제1영역에 포함된 셀의 지리적 위치가 연속적이고 상기 제1영역의 윤곽이 외부로 돌출되는 모양이 되도록 상기 제2영역 및 상기 제2영역에 포함된 셀을 제외한 최소 수량의 다른 셀을 상기 제1영역에 가입시키는 것; 중 어느 하나 또는 하나 이상을 포함하는 네트워크 최적화 방법.","The method of claim 4, wherein determining the first region according to a geographic location relationship of cells contained in the second region and the outline of the second region comprises at least one of: in response to the geographic locations of the cells contained in the second region being consecutive and the outline of the second region being an outwardly convex figure, using the second region as the first region; or in response to the geographic locations of the cells contained in the second region being non-consecutive, or in response to the outline of the second region being not an outwardly convex figure, adding the second region and a minimum number of cells other than the cells contained in the second region to the first region such that the geographic locations of the cells contained in the first region are consecutive and the outline of the first region is an outwardly convex figure.",True,0.2717755734920501,0.8886996256797629,91,154,-63,378,916,-538
"청구항 1에 있어서,상기 모델링 방법은 상기 에이전트의 생성 방법, 상기 에이전트의 상태 정의 방법, 상기 에이전트의 동작 정의 방법, 상기 에이전트의 보상 함수의 정의 방법 및 상기 에이전트의 동작 선택 초기 정책의 정의 방법을 포함하고; 상기 훈련 방법은 심화 학습 방법을 이용하여 동작 선택 정책을 조정하는 방법을 포함하고;상기 모델링 방법 및 훈련 방법에 따라 상기 에이전트의 초기 모델을 결정하는 단계는,상기 에이전트의 동작 선택 초기 정책의 정의 방법에 따라 상기 에이전트의 동작 선택 초기 정책을 결정하고, 상기 에이전트의 동작 선택 초기 정책을 상기 에이전트의 초기 모델로 하는 것을 포함하고;상기 심화 학습 방법을 이용하여 에이전트의 초기 모델을 훈련시키는 단계는,제i번째 반복에서 수렴조건을 만족하지 않은 경우, 제1확률에서 랜덤 동작을 선택하고 전송하여 상기 랜덤 동작이 상기 에이전트에 대응하는 셀에서 유효하도록 하며; 제2확률에서 상기 에이전트의 제i번째 반복에 대응하는 성능 데이터 및 상기 에이전트의 상태 정의 방법에 따라 상기 에이전트의 제i번째 반복에 대응하는 상태를 결정하고, 상기 에이전트의 제i-1번째 반복에 대응하는 상태, 제i번째 반복에 대응하는 상태 및 상기 훈련 방법에 따라 상기 에이전트의 제i-1번째 반복에서 조정된 정책을 조정하고, 상기 에이전트의 제i번째 반복에 대응하는 상태, 상기 에이전트의 제1데이터 및 상기 에이전트의 동작 정의 방법에 따라 에이전트의 제i번째 반복에 대응하는 최적화 동작을 계산하고 전송하여 상기 에이전트의 제i번째 반복에 대응하는 최적화 동작이 상기 에이전트에 대응하는 셀에서 유효하도록 하며; 여기서, 제1확률과 제2확률의 합은 1이고, i는 1보다 크거나 같은 정수 이고;여기서, 상기 에이전트의 제1데이터는,상기 에이전트의 제i번째 반복에서 조정된 정책; 또는상기 에이전트의 제i번째 반복에서 조정된 정책 및 인접한 에이전트의 평균 동작을 포함하는 네트워크 최적화 방법.","The method of claim 1, wherein the modeling method comprises: a generation method for the agent, a definition method for a state of the agent, a definition method for an action of the agent, a definition method for a reward function of the agent, and a definition method for a policy of the agent for selecting an action; and the training method comprises: a method for adjusting, using a reinforcement learning method, a policy for selecting an action; determining an initial model of the agent according to the modeling method and the training method comprises: determining, according to the definition method for an initial policy of the agent for selecting an action, an initial policy of the agent for selecting an action, and using the initial policy of the agent for selecting an action as the initial model of the agent; and training the initial model of the agent using a reinforcement learning method comprises, in an ith round of iteration, in response to a convergence condition being not satisfied: selecting a random action under a first probability and sending the random action, such that the random action takes effect in the cell corresponding to the agent; and determining a state of the agent corresponding to the ith round of iteration under a second probability according to performance data of the agent corresponding to the ith round of iteration and the definition method for the state of the agent; adjusting a policy of the agent adjusted in an (i-1)th round of iteration according to the state of the agent corresponding to the (i-1)th round of iteration, the state corresponding to the ith round of iteration, and the training method; calculating an optimal action of the agent corresponding to the ith round of iteration according to the state of the agent corresponding to the ith round of iteration, first data of the agent, and the definition method for an action of the agent; and sending the optimal action of the agent corresponding to the ith round of iteration such that the optimal action of the agent corresponding to the ith round of iteration takes effect in the cell corresponding to the agent, wherein a sum of the first probability and the second probability is 1, and i is an integer greater than or equal to 1; and wherein the first data of the agent comprises: a policy of the agent which is adjusted in the ith round of iteration; or a policy of the agent which is adjusted in the ith round of iteration and an average action of adjacent agents.",True,0.3888853192329407,0.8656325753960473,231,430,-199,981,2494,-1513
"청구항 6에 있어서,상기 제i-1번째 반복에 대응하는 상태, 제i번째 반복에 대응하는 상태 및 훈련 방법에 따라 상기 에이전트의 제i-1번째 반복에서 조정된 정책을 조정하는 단계는,제i-1번째 반복에 대응하는 상태, 제i번째 반복에 대응하는 상태 및 상기 에이전트의 보상 함수 값의 정의 방법에 따라 제i-1번째 반복에 대응하는 보상 함수 값을 계산하고, 제i-1번째 반복에 대응하는 보상 함수 값에 따라 상기 에이전트의 제i-1번째 반복에서 조정된 정책을 조정하는 단계를 포함하는 네트워크 최적화 방법.","The method of claim 6, wherein adjusting a policy of the agent adjusted in an (i-1)th round of iteration according to the state corresponding to the (i-1)th round of iteration, the state corresponding to the ith round of iteration, and the training method comprises: calculating a reward function value corresponding to the (i-1) round of iteration according to the state corresponding to the (i-1)th round of iteration, the state corresponding to the ith round of iteration, and the definition method for a reward function value of the agent; and adjusting the policy of the agent adjusted in the (i-1)th round of iteration according to the reward function value corresponding to the (i-1)th round of iteration.",True,0.3880006074905395,0.8480591584489855,65,115,-50,282,712,-430
"청구항 6에 있어서,상기 제i번째 반복에서, 상기 에이전트에 대응하는 셀의 제i번째 반복에 대응하는 성능 데이터가 제i-1번째 반복에 대응하는 성능 데이터에 비해 설정된 폭을 초과한 만큼 악화되지 않은 경우, 상기 제1확률에서 랜덤 동작을 상기 에이전트의 제i번째 반복에 대응하는 최적화 동작으로 선택하거나, 또는 제2확률에서 에이전트의 제i번째 반복에 대응하는 성능 데이터 및 상기 에이전트의 상태 정의 방법에 따라 에이전트의 제i번째 반복에 대응하는 상태를 결정하는 단계를 계속하여 수행하는 네트워크 최적화 방법.","The method of claim 6, further comprising: in the ith round of iteration, in response to the performance data of the cell corresponding to the agent corresponding to the ith round of iteration not having a deterioration beyond a preset magnitude relative to performance data corresponding to the (i-1)th round of iteration, continuing to perform: selecting a random action under the first probability as the optimal action of the agent corresponding to the ith round of iteration; or, determining the state of the agent corresponding to the ith round of iteration under the second probability according to the performance data of the agent corresponding to the ith round of iteration and the definition method for the state of the agent.",True,0.419564813375473,0.8551394201618515,66,120,-54,289,737,-448
"청구항 6에 있어서,제1번째 반복 전에, 상기 방법은 상기 에이전트에 대응하는 셀의 구성 파라미터를 저장하는 단계를 더 포함하고; 상기 방법은,상기 제i번째 반복에서 상기 에이전트의 제i번째 반복에 대응하는 성능 데이터가 제i-1번째 반복에 대응하는 성능 데이터에 비해 설정된 폭을 초과한 만큼 악화될 경우, 상기 에이전트에 대응하는 셀의 구성 파라미터를 저장된 구성 파라미터로 회복하는 단계를 더 포함하는 네트워크 최적화 방법.","The method of claim 6, further comprising: prior to a first round of iteration, storing a configuration parameter of the cell corresponding to the agent; and in the ith round of iteration, in response to the performance data of the agent corresponding to the ith round of iteration having a deterioration beyond a preset magnitude relative to performance data corresponding to the (i-1)th round of iteration, restoring the configuration parameter of the cell corresponding to the agent to the stored configuration parameter.",True,0.3846189379692077,0.8609511902457547,56,82,-26,240,524,-284
"청구항 1에 있어서,상기 에이전트의 훈련된 모델에 따라 에이전트에 대응하는 셀에 대해 네트워크 최적화를 진행하는 단계는,제j번째 반복에서, 상기 에이전트의 제j번째 반복에 대응하는 성능 데이터 및 상기 에이전트의 상태 정의 방법에 따라 상기 에이전트의 제j번째 반복에 대응하는 상태를 결정하고, 상기 에이전트의 제j번째 반복에 대응하는 상태, 상기 에이전트의 제2데이터 및 상기 에이전트의 동작 정의 방법에 따라 에이전트의 제j번째 반복에 대응하는 최적화 동작을 계산하고 전송하여 에이전트의 제j번째 반복에 대응하는 최적화 동작이 에이전트에 대응하는 셀에서 유효하도록 하는 것을 포함하고; 여기서, j는 1보다 크거나 같은 정수이고, M+1보다 크거나 같은 정수이고, M은 모델훈련을 수행하는 최대 반복 횟수이며; 여기서, 상기 에이전트의 제2데이터는,상기 에이전트의 훈련된 정책; 또는상기 에이전트의 훈련된 정책 및 인접한 에이전트의 평균 동작을 포함하는 네트워크 최적화 방법.","The method of claim 1, wherein performing network optimization on a cell corresponding to the agent according to the trained model of the agent comprises: in a jth round of iteration, determining a state of the agent corresponding to the jth round of iteration according to performance data of the agent corresponding to the jth round of iteration and the definition method for the state of the agent; calculating an optimal action of the agent corresponding to the jth round of iteration according to the state of the agent corresponding to the jth round of iteration, second data of the agent, and the definition method for an action of the agent; and sending the optimal action of the agent corresponding to the jth round of iteration such that the optimal action of the agent corresponding to the jth round of iteration takes effect in the cell corresponding to the agent, wherein j is an integer greater than or equal to 1 or an integer greater than or equal to (M+1), M being a maximum number of rounds of iteration for model training; and wherein the second data of the agent comprises: a trained policy of the agent; or a trained policy of the agent and an average action of adjacent agents.",True,0.4560030698776245,0.8485829417580829,110,211,-101,492,1199,-707
"청구항 10에 있어서,상기 제j번째 반복에서, 상기 에이전트에 대응하는 셀의 제j번째 반복에 대응하는 성능 데이터가 제j－1번째 반복에 대응하는 성능 데이터에 비해 설정된 폭을 초과한 만큼 악화되지 않은 경우, 상기 에이전트의 제j번째 반복에 대응하는 상태 및 상기 에이전트의 제2데이터에 따라 에이전트의 제j번째 반복에 대응하는 최적화 동작을 계산하는 단계를 계속하여 수행하는 네트워크 최적화 방법.","The method of claim 10, further comprising: in the jth round of iteration, in response to the performance data of the cell corresponding to the agent corresponding to the jth round of iteration not having a deterioration beyond a preset magnitude relative to performance data corresponding to a (j -1)th round of iteration, continuing to perform the calculation of the optimal action of the agent corresponding to the jth round of iteration according to the state of the agent corresponding to the jth round of iteration and the second data of the agent.",True,0.3865495026111603,0.8540347567082964,51,93,-42,224,554,-330
"청구항 10에 있어서,제1번째 반복 전에, 상기 방법은 상기 에이전트에 대응하는 셀의 구성 파라미터를 저장하는 단계를 더 포함하고;상기 방법은,상기 제j번째 반복에서, 상기 에이전트의 제j번째 반복에 대응하는 성능 데이터가 제j－1번째 반복에 대응하는 성능 데이터에 비해 설정된 폭을 초과한 만큼 악화될 경우, 상기 에이전트에 대응하는 셀의 구성 파라미터를 저장된 구성 파라미터로 회복하는 단계를 더 포함하는 네트워크 최적화 방법.","The method of claim 10, further comprising: prior to a first round of iteration, storing a configuration parameter of the cell corresponding to the agent; and in the jth round of iteration, in response to the performance data of the agent corresponding to the jth round of iteration having a deterioration beyond a preset magnitude relative to performance data corresponding to a (j-1)th round of iteration, restoring the configuration parameter of the cell corresponding to the agent to the stored configuration parameter.",True,0.3705397844314575,0.8698112603557446,55,82,-27,241,523,-282
"프로세서, 및상기 프로세서에 의해 실행될 때 청구항 1 내지 청구항 12 중 어느 한 항에 따른 네트워크 최적화 방법을 구현하는 명령어가 저장된 컴퓨터 판독 가능한 저장 매체;를 포함하는 네트워크 최적화 장치.","A network optimization device comprising a processor and a computer-readable storage medium storing instructions which, when executed by the processor, cause the processor to perform the network optimization method of any one of claims 1 to 12.",True,0.206443041563034,0.8985280395930951,31,37,-6,117,244,-127
프로세서에 의해 실행될 때 청구항 1 내지 청구항 12 중 어느 한 항에 따른 네트워크 최적화 방법의 단계를 구현하는 컴퓨터 프로그램이 저장된 컴퓨터 판독 가능한 저장 매체.,"A computer-readable storage medium storing a computer program which, when executed by a processor, cause the processor to perform the network optimization method of any one of claims 1 to 12.",True,0.20799121260643,0.8844274278109963,27,31,-4,97,191,-94
"제1영역의 셀에 존재하는 문제를 모델링하여 N개의 에이전트, 모델링 방법 및 훈련 방법을 얻는 모델링 모듈; -여기서, 상기 제1영역에 포함된 셀에 존재하는 문제가 같은 문제 유형에 속한 셀의 비율이 설정된 임계치보다 크거나 같고, 포함된 셀의 지리적 위치가 연속적이고 제1영역의 윤곽이 외부로 돌출되는 모양이며 N이 1보다 크거나 같은 정수임-; 및각 에이전트에 대하여, 모델링 방법 및 훈련 방법에 따라 상기 에이전트의 초기 모델을 결정하고, 모델링 방법 및 훈련 방법에 따라 심화 학습 방법으로 에이전트의 초기 모델을 훈련시키거나, 또는 에이전트의 훈련된 모델에 따라 에이전트에 대응하는 셀에 대해 네트워크 최적화를 진행하거나, 또는 모델링 방법 및 훈련 방법에 따라 상기 에이전트의 초기 모델을 결정하고, 모델링 방법 및 훈련 방법을 따라 심화 학습 방법으로 에이전트의 초기 모델을 훈련시키고, 에이전트의 훈련된 모델에 따라 에이전트에 대응하는 셀에 대해 네트워크 최적화를 진행하는 훈련 최적화 모듈을 포함하는 네트워크 최적화 장치.","A network optimization device, comprising: a modeling module configured to model problems existing in cells in a first region to obtain N agents, a modeling method and a training method, wherein a proportion of cells in which existing problems belong to a same problem category among the cells contained in a first region is greater than or equal to a preset threshold, geographic locations of the cells contained are consecutive, and an outline of the first region is an outwardly convex figure, and N is an integer greater than or equal to 1; and a training optimization module configured to, for each of the agents, determine an initial model of the agent according to the modeling method and the training method, and train the initial model of the agent using a reinforcement learning method according to the modeling method and the training method; or perform network optimization on a cell corresponding to the agent according to the trained model of the agent; or determine an initial model of the agent according to the modeling method and the training method, train the initial model of the agent using a reinforcement learning method according to the modeling method and the training method, and perform network optimization on a cell corresponding to the agent according to the trained model of the agent.",True,0.3178607225418091,0.8908933516914065,129,219,-90,526,1316,-790
"여성의 질 내에 삽입되며, 자궁에 접촉되는 일단에 투시공이 형성되고, 상기 투시공에 연결되는 촬영경로가 마련되는 삽입부;상기 촬영경로를 통해서 자궁경부를 촬영할 수 있도록 상기 삽입부에 설치되는 촬영부;상기 삽입부의 촬영경로 상에 설치되며, 상기 투시공을 통해서 자궁경부에 조명을 조사하는 조명부를 구비하고,상기 삽입부는 상기 촬영부에 김서림이 발생되는 것을 방지하기 위해, 상기 촬영경로 상에 공기가 외부로 순환되거나, 자궁경부를 검사시 검사용액을 주입하기 위해 상기 촬영경로에 연결되게 주입구가 형성되는자궁경부암 조기진단을 위한 모바일 질확대경 장치.","A mobile colposcopy device for early diagnosis of cervical cancer comprising: an insertion unit which is inserted into the vagina of a woman, has a penetrating hole formed in one end coming into contact with the uterus, and is provided with a capturing path communicating with the penetrating hole; a capturing unit which is provided in the insertion unit so as to capture the cervix through the capturing path; and a lighting unit which is provided on the capturing path of the insertion unit and irradiates a lighting to the cervix through the penetrating hole.",False,0.5690299868583679,0.7992142435688696,66,95,-29,310,563,-253
제1항에 있어서상기 조명부는 상기 삽입부에 설치되어 상기 촬영경로 상으로 조명을 조사하는 광원과;상기 광원에서 발생된 조명을 상기 투시공 방향으로 유도하는 라이트가이드부를 구비하는자궁경부암 조기진단을 위한 모바일 질확대경 장치.,"The mobile colposcopy device for early diagnosis of cervical cancer of claim 1, wherein the lighting unit includes a light source which is provided in the insertion unit to irradiate a lighting on the capturing path; and a light guide which induces the lighting generated in the light source in a direction of the penetrating hole.",True,0.3754760026931762,0.8688326209216953,26,56,-30,127,331,-204
"제1항에 있어서상기 촬영경로 상에 설치되어 자궁경부 조직 표면에서 반사되어 상기 투시공으로 유입되는 반사광은 차단하고, 상기 자궁경부 조직 표면을 투과하여 상기 자궁경부 조직 내부에서 상기 투시공으로 반사되는 조명만 통과시키는 광학부를 구비하는 자궁경부암 조기진단을 위한 모바일 질확대경 장치.","The mobile colposcopy device for early diagnosis of cervical cancer of claim 1, further comprising: an optical unit which is provided on the capturing path and blocks reflection light which is reflected on the surface of a cervical tissue to be introduced to the penetrating hole and transmits only a lighting which is reflected to the penetrating hole from an inside of the cervical tissue by passing through the surface of the cervical tissue.",True,0.4191939830780029,0.8588350105631356,36,74,-38,164,445,-281
"제1항에 있어서상기 촬영부는 촬영용 카메라가 마련된 스마트폰을 거치하는 것으로서, 상기 촬영용 카메라가 상기 투시공을 통해 상기 자궁경부를 촬영할 수 있도록 상기 촬영용 카메라가 상기 투시공에 대향되도록 상기 스마트폰을 지지하는자궁경부암 조기진단을 위한 모바일 질확대경 장치.","The mobile colposcopy device for early diagnosis of cervical cancer of claim 1, wherein the capturing unit holds a smartphone provided with a capturing camera, and supports the smartphone so that the capturing camera faces the penetrating hole so that the capturing camera captures the cervix through the penetrating hole.",True,0.3154369294643402,0.8886462995586936,34,50,-16,154,322,-168
"제5항에 있어서상기 삽입부의 타단부에 설치되며,상기 스마트폰이 인입될 수 있는 인입공간이 형성되되,상기 투시공에 대향되는 위치에 상기 촬영용 카메라의 촬영렌즈가 세팅될 수있는 세팅구가 형성된자궁경부암 조기진단을 위한 모바일 질확대경 장치.","The mobile colposcopy device for early diagnosis of cervical cancer of claim 5, wherein an insertion space is provided at the other end of the insertion unit and formed so that the smartphone is inserted, but formed with a setting port in which a capturing lens of the capturing camera is set at a position facing the penetrating hole.",True,0.2965652048587799,0.8936767105075144,27,59,-32,133,335,-202
제4항에 있어서상기 촬영부는내시경카메라 또는 초분광카메라 중 어느 하나인자궁경부암 조기진단을 위한 모바일 질확대경 장치.,"The mobile colposcopy device for early diagnosis of cervical cancer of claim 4, wherein the capturing unit is any one of an endoscope camera and a hyperspectral camera.",True,0.3548753261566162,0.8320948596640477,13,28,-15,67,168,-101
제1항에 있어서상기 투시공은상기 촬영경로의 길이방향 중심선을 기준으로 소정각도 경사지게 형성된자궁경부암 조기진단을 위한 모바일 질확대경 장치.,"The mobile colposcopy device for early diagnosis of cervical cancer of claim 1, wherein the penetrating hole is inclined at a predetermined angle based on a longitudinal center line of the capturing path.",True,0.4615115523338318,0.8053090710548155,15,33,-18,79,204,-125
"제1항에 있어서 상기 삽입부가 질 내로 삽입될 때, 질 내 공간을 확장하는 확장유닛을 더 구비하는자궁경부암 조기진단을 위한 모바일 질확대경 장치.","The mobile colposcopy device for early diagnosis of cervical cancer of claim 1, further comprising: an extension unit which extends a space in the vagina when the insertion unit is inserted into the vagina.",True,0.3766712546348572,0.842718796340356,20,34,-14,81,206,-125
"제9항에 있어서상기 확장유닛은상기 삽입부의 일단부가 삽입될 수 있도록 중공이 형성되되, 상기 중공의 중심을 기준으로 상호 멀어지는 방향으로 상호 회동 가능하게 설치된 제1확장부재 및 제2확장부재;작업자가 파지하여 상기 제1확장부재 및 제2확장부재를 회동시킬 수 있도록 상기 확장유닛에 형성된 복수의 손잡이부재를 구비하는자궁경부암 조기진단을 위한 모바일 질확대경 장치.","The mobile colposcopy device for early diagnosis of cervical cancer of claim 9, wherein the extension unit has a hollow so that an end of the insertion unit may be inserted, but includes a first extension member and a second extension member which are supported to each other to be rotatable with each other so that be far from the center of the hollow; and a plurality of handles which are formed in the extension unit and held by an operator to rotate the extension members.",True,0.3659063875675201,0.8626652827772403,43,86,-43,205,476,-271
"제10항에 있어서상기 삽입부는 상기 질에 대한 삽입방향을 따라 소정길이 연장된 가이드홈이 형성되고,상기 확장유닛은 상기 가이드홈에 인입될수 있도록 상기 제1확장부재 및 제2확장부재 중 어느 하나에 형성된 가이드돌기를 구비하는자궁경부암 조기진단을 위한 모바일 질확대경 장치.","The mobile colposcopy device for early diagnosis of cervical cancer of claim 10, wherein the insertion unit has a guide groove extended in a predetermined length along an insertion direction to the vagina, and the extension unit has a guide protrusion formed on any one of the first extension member and the second extension member so as to be inserted to the guide groove.",True,0.4306799173355102,0.8531862470532495,32,64,-32,152,373,-221
"제1항에 있어서,상기 삽입부는 상기 조명부에서 출력되어 내벽면에 의해 산란된 산란광이 자궁경부 조직으로 입사될 수 있도록 상기 투시공에 인접할수록 내경이 감소하게 형성된자궁경부암 조기진단을 위한 모바일 질확대경 장치.","The mobile colposcopy device for early diagnosis of cervical cancer of claim 1, wherein the insertion unit has an inner diameter which is tapered to be closer to the penetrating hole so that scattering light output from the light source and scattered by an inner wall surface is incident to the cervical tissue.",True,0.4355421364307403,0.8445413341872612,26,53,-27,121,311,-190
"제4항에 있어서,상기 광학부는 상기 촬영경로 상에 설치되며, 상기 조명부에서 출력되는 광의 평행 편광(P-Polarization)을 형성하는 선형편광판(Linear polarizer; LP)과,상기 촬영경로 상에 광의 출력방향을 기준으로 상기 선형편광판 후방에 설치되어, 상기 선형편광판을 통과한 광을 원형 편광(Circular polarization)으로 형성하는 사분파장판(1/4λ retarder; QWP)으로 이루어진 자궁경부암 조기진단을 위한 모바일 질확대경 장치.","The mobile colposcopy device for early diagnosis of cervical cancer of claim 4, wherein the optical unit consists of a linear polarizer (LP) which is provided on the capturing path and forms a parallel polarization (P-polarization) of light output from the light source and a 1/4λ retarder (QWP) which is provided behind the linear polarizer based on an output direction of the light on the capturing path to form light passing through the linear polarizer to a left circular polarization.",True,0.250249981880188,0.8934196100623499,44,80,-36,265,489,-224
"제1항에 있어서상기 삽입부는상기 주입구와 연결되고, 상기 삽입부의 내주면을 따라 원주방향으로 형성되는 연통부와;상기 연통부에서 상기 촬영경로를 따라 투시공 측으로 연장되며, 상기 투시공 단부에 상기 주입구를 통해 유입된 외기가 분출되거나, 검사용액이 상기 투시공 측으로 분출될 수 있도록 분출구가 형성된 적어도 하나의 분출관을 더 구비하는 자궁경부암 조기진단을 위한 모바일 질확대경 장치.","The mobile colposcopy device for early diagnosis of cervical cancer of claim 2, wherein the insertion unit further includes a communication unit which communicates with the inlet and is formed in a circumferential direction along an inner circumferential direction of the insertion unit, and at least one ejection pipe which is extended to the penetrating hole side along the capturing path from the communication unit and has an outlet so that external air introduced through the inlet is ejected to an end of the penetrating hole or a test solution is ejected to the penetrating hole side.",True,0.4453081786632538,0.8478538860525021,48,97,-49,217,591,-374
"가열 플레이트(2)가 주변 온도의 환경에 노출되면, 과도 온도 분포는 주어진 제어 입력에 의한 XY-평면 열확산에 의해 결정될 뿐만 아니라, 제2 표면(A2)을 향한 Z-축 방향으로 흐르는 열유속에 의해 영향을 받는다.","When the heating plate 2 is exposed to the environment with an ambient temperature, the transient temperature distribution is not only determined by the XY-plane heat diffusion with given control inputs, but also influenced by the heat-flux flowing in the direction of the Z-axis towards the second surface A2.",True,0.1756177842617035,0.9077108022639884,29,49,-20,122,310,-188
"열유속 입력(HFI)은 XY-평면의 온도를 높여 Z-축 방향의 열 전도에 대한 온도 차이를 제공하며, 이를 통해서, 열유속이 제2 표면(A2)쪽으로 제1 표면(A1)으로부터 흘러서, 제2 표면(A2)의 온도를 특정 수준(= 원하는 온도, 예를 들어 전체 스탬핑 기계(1)에서 스탬핑 계면 표면(ASI)의 원하는 온도(T, Sub[attributes={}; value=[SI_D]], )에 해당, 도 1 및 도 2 참조)으로 유지하기 위해 시변 대류 경계 조건에 대처한다.]","The heat-flux inputs HFI raise the temperature in the XY-plane to provide a temperature difference for a heat conduction in direction of the Z-axis, through which the heat-flux flows from the first surface A1 towards the second surface A2 to counteract time-varying convective boundary conditions in order to maintain the temperature of the second surface A2 at a certain level (=desired temperature, e.g. corresponding to the desired temperature TSI_D of the stamping interface surface ASI in the complete stamping machine 1 - see Fig.1 +2).",False,0.1278165727853775,0.936677582054214,55,85,-30,264,542,-278
"[온도 분포의 과도 거동(transient behaviors)에 대한 Z-축 열전도 및 XY-평면 열확산의 언급된 효과는, 도 3을 참조하여 위에서 설명한 바와 같이, 바람직하게는 폐쇄 루프 모델의 형태로 하이브리드 모델에 의해 완전히 특성화될 수 있다.","The mentioned effects of Z-axis heat conduction and XY-plane heat diffusion on the transient behaviors of the temperature distribution can be fully characterized by the hybrid model, preferably in form of a closed-loop model, as was described above with reference to Fig.3.",True,0.1671455204486851,0.9102599000398988,32,42,-10,142,273,-131
"다시, 포워드 경로는 알려진 열유속 입력(HFI)을 사용하여 XY-평면 열 확산에 의해 결정된 온도 분포를 설명하고, 반면에 음의 피드백은 주어진 온도 분포 및 대류 경계 조건에 대해 Z-축 열 전도를 통해 소산된 열유속을 설명한다.","Again, the forward path describes the temperature distribution determined by XY-plane heat diffusion with known heat-flux inputs HFI, while negative feedback accounts for the dissipated heat-flux through Z-axis heat conduction for a given temperature distribution and convective boundary conditions.",True,0.1654635518789291,0.9098051512301444,33,39,-6,130,299,-169
"XY-평면 열확산은 분산 매개변수 모델(DPM)로 설명하는 것이 바람직하고 그리고 Z-축 방향의 열전도는 집중 매개변수 모델(LPM), 특히 임피던스 회로(도 3 참고)로 설명하는 것이 바람직하다 도 3을 참조하여 전술한 바와 같이, 하이브리드 모델에서 가열 플레이트(2)는 다중 레이어(LAi)로 분할되며, 도 4에 도시된 예에서는 2개의 레이어(LAi)만이 사용되었다.","The XY-plane heat diffusion is preferably described as a distributed-parameter model DPM and the heat conduction in the direction of the Z-axis is preferably described as a lumped-parameter model LPM, in particular as an impedance-circuit (see Fig.3 ).",False,0.3010106980800628,0.8429358963735846,43,38,5,208,252,-44
"도 4의 우측에 도시된 바와 같이, 제1 레이어는 가열 플레이트(2)의 제1 표면(A1)에 대응하는 입력 레이어(LA, Sub[attributes={}; value=[IP]], )이고, 제2 레이어는 가열 플레이트(2)의 제1 표면(A1) 반대편의 제2 표면(A2)에 대응하는 출력 레이어(LA, Sub[attributes={}; value=[OP]], )이다.]","The first layer is the input layer LAIP corresponding to the first surface A1 of the heating plate 2 and the second layer is the output layer LAOP, corresponding to the second surface A2 of the heating plate 2, opposite the first surface A1, as is depicted on the right side of Fig.4.",False,0.2004881650209427,0.885359684653748,33,53,-20,203,284,-81
"[다음 예에서, 입력 레이어(LA, Sub[attributes={}; value=[IP]], )(XY-평면, z=0)의 온도 분포는 고유 함수 전개법(eigen-function expansion method)을 사용하여 먼저 해석적으로 해결한다.","In the following example, the temperature distribution in the input layer LAIP (XY-plane, z=0) is first solved analytically utilizing an eigen-function expansion method.",False,0.1802714765071869,0.9065275195834038,19,23,-4,137,169,-32
"그 후 Z-축 방향의 열전도 해석 모델 공식을 열 임피던스 회로로 설명하고(도 3 참조), 마지막으로 폐쇄 루프 모델 형태의 조합을 나타낸다.]",Thereafter the analytical model formulation of the heat conduction in the direction of the Z-axis is described as a thermal impedance-circuit (see Fig.3 ) and finally the combination in form of the closed-loop model is shown.,True,0.1676433235406875,0.8986234429472241,21,36,-15,80,225,-145
"[가열 플레이트(2) 내의 온도 필드(T, Sub[attributes={}; value=[he]], )(t, x, y, z)에 대한 지배 방정식은 방정식(1a)에 의해 도출될 수 있으며, 여기서 T, Sub[attributes={}; value=[he]], = T-T, Sub[attributes={}; value=[A]], 이고, T, Sub[attributes={}; value=[A]], 는 주변 온도이다.]","The governing equation for the temperature-field The( t, x, y, z) within the heating plate 2 can be derived by Equation (1a), wherein The= T- TA and TA is the ambient temperature. ∂ T he txyz ∂ t − α 2 ∇ 2 T he = 0",False,0.2770925760269165,0.8644550924424714,34,47,-13,231,214,17
"[방정식(1b)은 X, Y, Z-축에 대한 경계조건(BC)을 나타낸다.]","Equations (1b) show the boundary conditions BC for the X, Y and Z-axis.",True,0.152406707406044,0.9035357360445536,7,13,-6,40,71,-31
"[Image[attributes={}; value=[ImageFormatCategory[attributes={}; value=[JPEG]], ImageFileName[attributes={}; value=[pat00002.jpg]], HeightMeasure[attributes={measureUnitCode=Px}; value=[37]], WidthMeasure[attributes={measureUnitCode=Px}; value=[143]]]]]",BCs : { dT he txyz dx | x = 0 = − h n T he t 0 y z κ ; dT he txyz dx | x = X = − h n T he tXyz κ dT he txyz dx | y = 0 = − h n T he t x 0 z κ ; dT he txyz dx | y = Y = − h n T he txYz κ dT he txyz dz | z = 0 = g t x y 0 ; dT he txyz dz | z = Z = − h z T he txyZ κ,False,0.8849281668663025,0.4068786162331751,9,106,-97,252,263,-11
"[시간 t=0 에 대한 초기 조건은 방정식(1c, 1d)으로 나타낸 바와 같다.]","The initial condition for the time t=0 is shown in Equations (1c, 1d).",True,0.1688171625137329,0.9015581447000492,11,13,-2,45,70,-25
"[T, Sub[attributes={}; value=[he]], (0,x,y,z) = 0 α, Sup[attributes={}; value=[2]], = κ/ρc, Sub[attributes={}; value=[p ]], (1c, 1d)]",T he 0 x y z = 0 with α 2 = κ / ρc p,False,0.6453768014907837,0.5979987935771713,16,16,0,133,36,97
"[방정식(1c, 1d)에서 α는 열확산계수, h, Sub[attributes={}; value=[n]], 및 h, Sub[attributes={}; value=[z]], 는 각각 XY-평면 및 Z-축의 열전달계수, κ는 열전도율, ρ는 밀도, Cp는 가열 플레이트(2)의 비열 용량이다.","In Equations (1c, 1d), α is the thermal diffusion coefficient, hn and hz are the heat transfer coefficients in the XY-plane and Z-axis respectively, k is the heat conductivity, ρ is the density and cp is the specific heat capacity of the heating plate 2.",False,0.2815355062484741,0.8576765698944004,26,45,-19,160,254,-94
"X, Y, Z는 가열 플레이트(2)의 길이, 너비 및 높이이다(도 4 참조). 방정식(1b)에서 경계 입력(g)(t, x, y, 0)은 방정식(2a)과 같이 표현되며, 여기서 제어 입력 벡터(u(t))의 요소(ui)는 i번째 가열 영역에 적용되며(예를 들어, 도 4의 예에 제시되어 있는 12개의 교점의 경우 i=1, 2,...12 는 가열 장치(7)에 대응), 그 가열 영역(g, Sub[attributes={}; value=[i]], (x, y))은 길이(Li), 폭(Wi) 및 XY-평면(l, Sub[attributes={}; value=[i]], +L, Sub[attributes={}; value=[i]], /2, w, Sub[attributes={}; value=[i]], +W, Sub[attributes={}; value=[i]], /2)상의 설치위치로 특징지을 수 있다.]","X, Y, Z are the Length, Width and Height of the heating plate 2 (see Fig.4 ).",False,0.5003151297569275,0.7342913105162648,72,17,55,441,77,364
"[Image[attributes={}; value=[ImageFormatCategory[attributes={}; value=[JPEG]], ImageFileName[attributes={}; value=[pat00004.jpg]], HeightMeasure[attributes={measureUnitCode=Px}; value=[12]], WidthMeasure[attributes={measureUnitCode=Px}; value=[129]]]]]","The boundary input g(t, x, y, 0) in Equation (1b) is expressed as Equation (2a) wherein the element ui of control input vector u(t) is applied to the ith heating zone (e.g. i=1,2,...12 for the twelve nodes shown in the example according to Fig. 4, corresponding to the heating devices 7), with its heating area gi( x, y) characterized by length Li, width Wi and install position on the XY-plane Ii+ Li/2, wi+ Wi/2: g t x y = ∑ i = 1 12 u i t g i x y = g x y u t where u t = … u i t … T g x y = … g i x y … with g i x y = { 1 w i < x ≤ w i + W i ; l i < y ≤ l i + L i 0 others",False,0.9375434517860411,0.4290878464793514,9,148,-139,252,575,-323
"[XY-평면 온도 분포 및 Z-축 열 전도에 대한 분절 경계 제어 입력의 영향을 설명하기 위해, 지배 방정식(1a-1c)에 대한 해결은 방정식(3a)의 형식을 취하는 것으로 가정하고, 여기서 T, Sub[attributes={}; value=[hei]], 는 i번째 가열 구역에 의해 초래되는 z = 0 에서의 입력 레이어(LA, Sub[attributes={}; value=[IP]], )의 과도 온도 분포이며, T, Sub[attributes={}; value=[he]], (t, z)는 Z-축의 열 전도 역학을 특징 짓는다.]","To account for the effects of segmental boundary control inputs on the XY-plane temperature distribution and Z-axis heat conduction, the solutions to the governing Equations (1a-1c) are assumed to take the form of Equation (3a) where Thei is the transient temperature distribution of the input layer LAIP at z=0 contributed by the ith heating zone and The( t, z) characterizes the Z-axis heat conduction dynamics: T he txyz = f ∑ i = 1 12 T hei t x y 0, T he t z ∂ T hei t x y ∂ t − α 2 ∂ 2 T hei ∂ x 2 + ∂ 2 T hei ∂ y 2 = u i t g i x y BCs : { dT hei t x y dx | x = 0 = − h n T hei t 0 y κ ; dT hei t x y dx | x = X = − h n T hei t X y κ dT hei t x y dy | y = 0 = − h n T hei t x 0 κ ; dT hei t x y dx | y = Y = − h n T hei t x Y κ",False,0.277344286441803,0.8779395360778575,57,204,-147,297,732,-435
"[초기 조건 T, Sub[attributes={}; value=[hei]], (0, x, y) = 0 (3d)]",With the initial condition T hei 0 x y = 0,False,0.4459705948829651,0.7206611255138212,11,11,0,62,42,20
"[고유 함수 전개 모델을 사용하여, 레이어 온도 필드 지배 방정식(3b-3d)에 대한 해결이 방정식(4a)에 따른 시간-공간 분리 형태(time-space separation form )로 도출될 수 있다.]","Utilizing the eigen-function expansion model, the solutions to the layer temperature-field governing Equations (3b-3d) can be derived as a time-space separation form according to Equation (4a): θ t x y = ∑ m, n = 0 ∞ θ mn t ϕ mn x y = ∑ m, n = 0 ∞ θ mn ϕ m x ϕ n y with θ t x y = T hei t x y 0 with ϕ m x = { sin mπx / X − κmπ / Xh n cos mπx / X 1 + κmπ / Xh n 2 m ≠ 0 1 m = 0 and ϕ n y = { sin nπy / Y − κnπ / Yh n cos nπy / Y 1 + κnπ / Yh n 2 n ≠ 0 1 n = 0",True,0.3752610981464386,0.7989601916910521,23,137,-114,116,458,-342
"[방정식(4a-4c)에서, Φ, Sub[attributes={}; value=[mn]], (x, y)는 시간 종속 계수(T, Sup[attributes={}; value=[hei]], Sub[attributes={}; value=[mn]], )를 갖는 레이어 온도 분포의 공간 조화 커널 함수(spatial harmonic kernel function)이다.","In Equations (4a-4c), φmn( x, y) is the spatial harmonic kernel function of the layer temperature distribution with a time-dependent coefficient T mn hei.",False,0.2533722221851349,0.8616509481870759,25,24,1,200,154,46
"유사하게, 분절 제어 입력(segmental control input)은 방정식(5a-5e)에 따라 일련의 공간 조화 커널 함수로 공식화될 수도 있다.]","Similarly, the segmental control input can also be formulated as a series of spatial harmonic kernel functions according to Equations (5a-5e): g i t x y = ∑ m, n = 0 ∞ G mn i ϕ mn x y where where G 00 i = L i W i XY ; G mn i = 4 XY ∫ l i l i + L i ∫ w i w i + W i g i x y ϕ mn x y ⅆ x ⅆ y with m, n ≠ 0 G m 0 i = 2 L i XY ∫ w i w i + W i g i x y ϕ m x ⅆ x with m ≠ 0 ; G 0 n i = 2 W i XY ∫ l i l i + L i g i x y ϕ n y ⅆ y with n ≠ 0",True,0.503056526184082,0.687180566617721,16,152,-136,85,432,-347
"[방정식(4a) 및 (5a)를 방정식(3b)에 대입하면, T, Sub[attributes={}; value=[hei]], 는 다음과 같이 나타낼 수 있다.]","When Equations (4a) and (5a) are substituted into Equation (3b), Thei can be expressed by: dT mn hei t dt + T mn hei t τ mn = u i t G mn i where 1 τ mn = α 2 mπ / X 2 + nπ / Y 2 T hei t x y 0 = ∑ m, n = 0 ∞ ∫ 0 t u i τ exp − t − τ 1 τ mn ⅆ τ G mn i ϕ mn x y",False,0.4771863222122192,0.727024311681612,14,86,-72,87,257,-170
"[방정식(6b)에서, τ, Sub[attributes={}; value=[mn]], 은 (m,n)번째 공간 조화(spatial harmonics)의 열확산 시간 상수(heat-diffusion time constant)이다.","In Equation (6b), τmn is the heat-diffusion time constant of the ( m, n)th spatial harmonics.",False,0.2086069881916046,0.875948606696335,14,16,-2,125,93,32
"열확산 계수(α)가 증가하고, 조화 차수(m, n)가 증가하고, 윤곽 치수(X, Y)가 줄어들면, 감소한다.","It decreases with growing thermal diffusion coefficient α, harmonic orders ( m, n) and reduced contour dimensions (X, Y).",True,0.1915502995252609,0.8800654402790218,12,19,-7,60,121,-61
"방정식(6c)이 방정식(3a)과 결합하면, 모든 가열 구역이 기여하는 온도 분포는 방정식(7a, 7b)에 따라 설명되며, 여기서 u, Sub[attributes={}; value=[mn]], 은 경계 제어 입력의 과도 공간 분포를 특성화 한다.]","When Equation (6c) is combined with Equation (3a), the temperature distribution contributed by all the heating zones is described according to Equations (7a, 7b) where umn characterizes the transient spatial distribution of the boundary control inputs: T he t x y 0 = ∑ m, n = 0 ∞ T mn he t ϕ mn x y = ∑ m, n = 0 ∞ ∫ 0 t u mn τ exp − t − τ 1 τ mn ⅆ τ ϕ mn x y u mn t = ∑ i = 1 12 u i t G mn i T mn he s U mn s = 1 s + 1 / τ mn",False,0.3173516988754272,0.825117822951187,26,114,-88,137,426,-289
"[국소 열유속 입력(HFI) 및 입력 레이어(LA, Sub[attributes={}; value=[IP]], )의 결과적인 온도 분포를 각각 U, Sub[attributes={}; value=[mn]], (t) 및 T, Sup[attributes={}; value=[he]], Sub[attributes={}; value=[mn]], (t)으로 특성화하면, XY-평면 열 확산의 역학을 설명하는 포워드 경로 전달 함수(도 3 참조)는 방정식(7c)에 나타낸 바와 같이 방정식(7c)에서 도출할 수 있으며, 여기서, s 는 라플라스(Laplace) 연산자이다.]","With the local heat-flux inputs HFI and the resulting temperature distribution in the input layer LAIP characterized by umn( t) and T mn he t respectively, the forward path transfer function (see Fig.3 ) that describes the dynamics of XY-plane heat-diffusion can be derived from Equation (7a), as shown in Equation (7c), where s is the Laplace operator.",False,0.3421318233013153,0.832600766364639,49,58,-9,313,353,-40
"[도 3에 도시된 열 임피던스 회로를 사용하여, 알려진 온도 분포(T, Sup[attributes={}; value=[he]], Sub[attributes={}; value=[mn]], )를 갖는 소산 열유속(Q, Sup[attributes={}; value=[he]], Sub[attributes={}; value=[mn]], )의 전달 함수를 방정식(8a, 8b)에서 구할 수 있다.","Using the thermal impedance circuit shown in Fig.3, the transfer function of the dissipated heat-flux Q mn he with known temperature distribution T mn he can be obtained from Equations (8a, 8b).",False,0.2560856938362121,0.8563340640331527,30,32,-2,216,194,22
"제어 입력(U, Sub[attributes={}; value=[mn]], (s))에 대한 온도 분포(T, Sup[attributes={}; value=[he]], Sub[attributes={}; value=[mn]], )를 계산하는 폐루프 전달 함수는 방정식(8c, 8d)에 따라 정의할 수 있다.]","The closed-loop transfer function that computes the temperature distribution T mn he for the control input, Umn( s) can be defined according to Equations (8c, 8d).",False,0.3740324378013611,0.7662978454848479,23,26,-3,168,163,5
"[Image[attributes={}; value=[ImageFormatCategory[attributes={}; value=[JPEG]], ImageFileName[attributes={}; value=[pat00010.jpg]], HeightMeasure[attributes={measureUnitCode=Px}; value=[31]], WidthMeasure[attributes={measureUnitCode=Px}; value=[114]]]]]",Q mn he s T mn he s = τ he s + 1 τ he where τ he = C he R he + 1 / h z T mn he s U mn s = τ he_mn / 2 τ he_mn s + 1 where τ he_mn = 2 τ he 1 + τ he / τ mn,False,0.983961582183838,0.3250831027300621,9,60,-51,252,154,98
"[방정식(8a-8d)에서, C, Sub[attributes={}; value=[he]], 는 Z-축 열용량이고, R, Sub[attributes={}; value=[he]], 는 가열 플레이트(2)의 Z-축 내열성이다.","In Equations (8a-8d), Che is the Z-axis heat capacitance and Rhe is the Z-axis heat resistance of the heating plate 2. τhe_mn is the synthesized time constant accounting for the XY-plane heat-diffusion time constant τmn as well as Z-axis heat conduction time constant τhe.",False,0.4935060441493988,0.7288399807579188,15,44,-29,122,272,-150
"다른 시간 상수 비율(τ, Sub[attributes={}; value=[he]], /τ, Sub[attributes={}; value=[mn]], )에 대해, 방정식(8c, 8d)은 z=0 에서 입력 레이어(LA, Sub[attributes={}; value=[IP]], )에 온도 분포(T, Sup[attributes={}; value=[he]], Sub[attributes={}; value=[mn]], )의 역학 특성을 제공한다.","For different time constant ratios τhe/ τmn, Equations (8c, 8d) provide the dynamic characteristics of temperature distribution T mn he at the input layer LAIP at z=0.",False,0.3688819408416748,0.8032289462208503,30,27,3,244,167,77
기본적으로 다음 두 가지 경우를 고려할 수 있다.,Essentially the following two cases can be considered.,True,0.1126798316836357,0.9186381602350496,8,8,0,27,54,-27
"경우1(τ, Sub[attributes={}; value=[mn]], >> τ, Sub[attributes={}; value=[he]], 또는 τ, Sub[attributes={}; value=[he_mn]], Image[attributes={}; value=[ImageFormatCategory[attributes={}; value=[TIFF]], ImageFileName[attributes={}; value=[pat00011.tif]], HeightMeasure[attributes={measureUnitCode=Px}; value=[5]], WidthMeasure[attributes={measureUnitCode=Px}; value=[5]]]], 2τ, Sub[attributes={}; value=[he]], )에서, Z-축 열전도의 역학은 XY-평면의 열확산의 것에 비해 상대적으로 빠르므로, 제어 입력 에너지는 주로 시간 상수(2τ, Sub[attributes={}; value=[he]], )로 레이어 z=Z로 전달된다.",In case 1 (τmn >> τhe or τhe_mn≈ 2τhe) the dynamics of the Z-axis heat conduction is relatively fast compared to that of the heat diffusion in the XY-plane and the control input energy is therefore mainly transferred into the layer z=Z with the time constant 2τhe.,False,0.4303236603736877,0.774146718174163,45,47,-2,524,264,260
"경우2(τ, Sub[attributes={}; value=[mn]], << τ, Sub[attributes={}; value=[he]], 또는 τ, Sub[attributes={}; value=[he_mn]], Image[attributes={}; value=[ImageFormatCategory[attributes={}; value=[TIFF]], ImageFileName[attributes={}; value=[pat00012.tif]], HeightMeasure[attributes={measureUnitCode=Px}; value=[5]], WidthMeasure[attributes={measureUnitCode=Px}; value=[5]]]], 2τ, Sub[attributes={}; value=[mn]], )에서, Z-축 열전도의 역학은 XY-평면의 열확산의 것에 비해 상대적으로 느리고, 제어 입력 에너지가 주로 시간 상수(2τ, Sub[attributes={}; value=[mn]], )을 갖는 XY-평면 열확산에 사용된다.]",In case 2 ( τmn << τhe or τhe_mn≈ 2 τmn) the dynamics of the Z-axis heat conduction is relatively slow compared to that of the heat diffusion in the XY-plane and the control input energy is mainly used for XY-plane heat diffusion with the time constant 2 τmn.,False,0.4701969027519226,0.7461039542150673,46,49,-3,529,259,270
"[z=0 에서 입력 레이어(LA, Sub[attributes={}; value=[IP]], )에 과도(또는 시간-영역) 온도 분포 (T, Sub[attributes={}; value=[he]], (t,x,y,0))는 방정식(9)에 따라 도출될 수 있다.]","The transient (or time-domain) temperature distribution The(t,x,y,0) at the input layer LAIP at z=0 can be derived according to Equation (9): T he t x y 0 = 1 2 ∑ m, n = 0 ∞ ∫ 0 t u mn τ exp − t − τ 1 τ he_mn ⅆ τ ϕ mn x y",False,0.3007344305515289,0.8461542440402317,20,56,-36,142,221,-79
"[방정식(9)은 방정식(7a, 7b)과 동일한 형태를 갖지만, 음의 피드백 루프에 의해 일부 제어 입력 에너지가 소비된다는 사실로 인해, 다른 시간 상수와 더 작은 정상 상태 진폭을 가짐을 알 수 있다.","It can be seen that Equation (9) has the same form as Equations (7a, 7b), but with a different time constant and a smaller steady-state amplitude, due to the fact that some control input energy is consumed by the negative feedback loop.",True,0.2025226652622223,0.8656025541645678,29,42,-13,113,236,-123
"출력 레이어(LA, Sub[attributes={}; value=[OP]], )에 온도가 관심이 있는 경우, 방정식(8c)을 사용하여 해당 전달 함수를 구할 수 있으므로, 출력 레이어(LA, Sub[attributes={}; value=[OP]], )에서 과도 온도 분포를 구할 수 있다.","If the temperature at the output layer LAOP is of interest, Equation (8c) can be used to obtain the corresponding transfer function and thus the transient temperature distribution at the output layer LAOP.",False,0.3691146075725555,0.7908837148934638,28,33,-5,161,205,-44
"앞에 제시된 (다중 레이어) 하이브리드 모델에서는, Z-축 열전도 및 XY-평면 열확산의 역학성이 방정식(9)에 따라 최상부 레이어 온도 분포에 포함되고, 그리고 국소 경계 조건(BC)을 사용한 방정식(1a, b)-(2a, b)에 따른 과도 3D 온도 필드의 해석 모델이 공식화된다.]","With the (multi-layer) hybrid model shown previously, the dynamics of the Z-axis heat conduction and XY-plane heat diffusion are incorporated into the top layer temperature distribution according to Equation (9) and the analytical model of the transient 3D temperature field according to Equations (1a, b) - (2a, b) with local Boundary conditions BC is formulated.",True,0.1692075431346893,0.9170649853006086,35,55,-20,159,364,-205
"[위의 해석 모델은 직사각형 가열 플레이트(2)의 예를 사용하여 설명되었지만, 그 원리는 물론 가열 플레이트(2), 설치 플레이트(3), 및 하나 이상의 스탬핑 플레이트(4)(도 1 참조)가 있는 핫 포일 스탬핑 기계(1)에서와 같이, 적층된 플레이트가 있는 3차원 필드와 같은 더 복잡한 용도에도 적용될 수 있다.","Although the analytical model above was illustrated using the example of a rectangular heating plate 2, the principle can of course also be applied to more complex applications, such as three-dimensional fields with stacked plates, like in the hot foil stamping machine 1 with a heating plate 2, an installation plate 3 and one or more stamping plates 4 (see Fig.1 ).",True,0.1451938897371292,0.9173802134403302,41,62,-21,176,367,-191
"물론, 해석 모델은 롤러와 같은 원통형 또는 구형의 구성요소와 같은 직사각형이 아닌 구성요소에도 적용할 수 있다.","Of course, the analytical model can also be applied to non-rectangular components, such as components with a cylindrical or spherical shape, like a roller.",True,0.1820417195558548,0.8679104572240447,16,24,-8,63,155,-92
"분석 모델, 특히 설명된 폐쇄 루프 하이브리드 모델을 사용하여 표면의 측정 불가능한 온도를 추정(및 선택적으로 제어)하기 위한 본 발명에 따른 방법의 사용은, 물론 관심있는 표면 온도를 직접 측정할 수 없는 장소에서, 다양한 다른 기술 용도로 구현될 수 있다.","The use of the method according to the invention for estimating (and optionally controlling) a non-measurable temperature of a surface using the analytical model, in particular the described closed loop hybrid model, can of course be implemented in various other technical applications, where an interesting surface temperature cannot be directly measured.",True,0.106222815811634,0.9351458727610452,38,51,-13,145,356,-211
"예시적인 용도로는 열 밀봉 기계의 가열 장치에 대한 가열 표면의 표면 온도를 결정 및/또는 제어하거나, 반도체 생산에서 웨이퍼의 표면 온도를 결정 및/또는 제어하거나, 또는 전자 장치의 전자 부품에 대한 열 임계 표면의 표면 온도를 결정(예: 모니터링) 및/또는 제어하는 것이 있다.]","Exemplary applications are determining and/or controlling a surface temperature of a heating surface of a heating unit of a heat-sealing machine, determining and/or controlling a surface temperature of a wafer in semiconductor production or determining (e.g. monitoring) and/or controlling a surface temperature of a heat-critical surface of an electronic component of an electronic device.",True,0.1404597610235214,0.9147898717197568,40,54,-14,159,390,-231
[본 발명은 제로-갭 전해 셀의 하우징 또는 지지 구조와 전극 또는 전극의 하부구조 사이의 스페이서로서의 텍스타일의 용도에 관한 것이다.,"1 Description Use of a textile, zero-gap electrolytic cell and production method therefor The invention relates to the use of a textile as a spacer between a housing or supporting structure and an electrode or the substructure of an electrode of a zero gap electrolytic cell.",False,0.5105330944061279,0.7046673356961992,19,46,-27,76,275,-199
본 발명은 추가로 이러한 텍스타일을 구비한 제로-갭 전해 셀 및 이러한 제로-갭 전해 셀의 제조를 위한 방법에 관한 것이다. ],The invention further relates not only to a zero-gap electrolytic cell furnished with such a textile but also to a method for producing such a zero-gap electrolytic cell.,False,0.3388539552688598,0.781855770409755,20,28,-8,71,170,-99
"[CO, Sub[attributes={}; value=[2]], 의 절감들 (""에너지 전환"") 의 관점에서 야심찬 목표 및 강화된 환경인식의 시기에, 산소와 소위 ""그린"" 수소를 제공하기 위한 물의 전기분해는 바람, 수력, 태양 에너지와 같은 재생 가능한 에너지를 사용하는 무 CO, Sub[attributes={}; value=[2]], 에너지 소스의 제조를 위한 유망한 기술을 대표한다.","The electrolysis of water to give oxygen and so-called ""green"" hydrogen, in times of heightened environmental awareness and ambitious objectives in terms of C02 savings (""energy transition""), represents a promising technology for production of a C02-free energy source using renewable energies, such as wind, hydro and solar energy.",False,0.1820363253355026,0.8747496519736745,43,48,-5,218,332,-114
"이러한 ""그린"" 수소는, 예를 들면, 에너지 스토어로서, 차량을 위한 연료로서, 또는 화학제품의 제조를 위해 사용될 수 있다.","This ""green"" hydrogen can be used, for example, as an energy store, as a fuel for vehicles, or for production of chemicals.",True,0.2014519721269605,0.8527123783935048,17,22,-5,70,123,-53
전해 셀은 염소 및 수산화나트륨 전해 제조 (클로로 알칼리 전기분해) 의 경우에서와 같이 물의 전기분해에 기초한 '그린' 수소 제조 플랜트의 중심에 있다.,"At the heart of a ""green"" hydrogen production plant based on electrolysis of water, as in the case of the electrolytic production of chlorine and sodium hydroxide (chlor-alkali electrolysis), is the electrolytic cell.",True,0.2106989026069641,0.8552675936254973,22,33,-11,86,217,-131
"이는, 예를 들어, 효율을 최적화하는 것을 목적으로 하는 전기분해 기술의 지속적인 개발에 대한 이유 중 하나이다.]","This is one of the reasons for the continual ongoing development of the electrolysis technology with the aim, for example, of optimizing the efficiency.",True,0.22128227353096,0.8378927318008195,16,24,-8,64,152,-88
"[막 기술로 작동하는 전해 셀은 각각의 전극들 및 전해질을 포함하는 캐소드 챔버 및 애노드 챔버를 특징으로 하며, 전극들은 2개의 전극을 분리하는 이온 선택성 막으로부터 거리를 두어 배치된다.","Electrolytic cells operating with the membrane technology feature a cathode chamber and an anode chamber containing the respective electrodes and an electrolyte, with the electrodes disposed at a distance from an ion-selective membrane that separates the two electrodes.",True,0.2254894971847534,0.8606395006322829,27,38,-11,107,270,-163
"그러나, 이러한 셀 설계는 달성된 효율성들의 관점에서 차선책이다. ]","It has emerged, however, that this cell design is suboptimal in terms of the efficiencies achieved.",True,0.2529270946979522,0.7993386050013925,9,16,-7,38,99,-61
"[따라서, 개시된 특히 에너지 효율적인 전해 셀은 ""제로-갭 전해 셀"" 로 알려져 있다 (US 9,404,191 B2 또는 EP 2 436 804 A1 참조). 이러한 셀에서 -""제로-갭"" 이라는 용어로 나타낸 바와 같은 - 캐소드와 애노드는 막에 의해서만 분리되며 캐소드와 애노드 양쪽은 막에 대해 접촉식으로 놓인다.","A particularly energy-efficient electrolytic cell which has been disclosed, therefore, is that known as the ""zero-gap electrolytic cell"" (see US 9,404,191 B2 or EP 2 436 804 Al).",False,0.3898080289363861,0.7480946569061884,44,28,16,178,178,0
이는 상당한 동반되는 에너지 절감을 갖고서 셀 저항을 낮춘다.,"This lowers the cell resistance, with a 2 significant accompanying energy saving.",True,0.1841214001178741,0.8613134277450595,9,12,-3,34,81,-47
그것은 또한 막 수명을 연장시킨다. ],It also results in the membrane life being extended.,True,0.3327249586582184,0.7463873306780083,6,9,-3,21,52,-31
"[제로-갭 전해 셀에서, 알려진 바와 같이, 탄성 요소가 탱크로서 또한 지칭되는 후방 하우징 벽과 전극 사이에 배치어 막에 대해 평평하고 균일하게 가압되는 것이 일반적이다.","In a zero-gap electrolytic cell it is usual for an elastic element, as it is known, to be disposed between a rear housing wall, also referred to as the tank, and the electrode to be pressed flatly and uniformly against the membrane.",True,0.3460552394390106,0.7861048520880075,24,42,-18,96,232,-136
"상기 탄성 요소는, 예를 들어 니켈로 제조된 금속성 코일에 의해, 또는 미세하게 직조된 니켈 스레드들의 미세-메쉬 네트에 의해 형성될 수 있으며, 상기 니켈 스레드는 그것들의 특수한 구조로 인해 스프링과 같이 작용하고, 상기 요소는 전극과 후방 하우징 벽 사이에 클램핑되고, 따라서 막에 대한 전극의 요구되는 균질하고 양호하게-게이징된 표면 가압을 보장한다.","Said elastic element may be formed by a metallic coil, manufactured for example of nickel, or by a fine-mesh net of finely woven nickel threads, which on account of their special structure act like a spring, said element being clamped between electrode and rear housing wall and so ensuring the required homogeneous and well-gauged surface pressing of the electrode against the membrane.",True,0.2036380171775818,0.8897921455569281,49,62,-13,200,387,-187
"동시에, 공지된 탄성 요소는 전극으로부터 후방 하우징 벽으로 전류를 도통하는 (take off) 기능을 갖는다. ]",At the same time the known elastic element has the function of taking off the current from the electrode to the rear housing wall.,True,0.2560469806194305,0.8254374391494216,15,24,-9,64,130,-66
"[탄성 요소 뿐만 아니라, 이러한 종류의 제로-갭 전해 셀은 일반적으로 캐소드 측 상에, 하우징에 용접된 내부들 (예를 들어, 선형 핀), 및 캐소드 전극의 기계적 고정을 위해 사용되는 탄성 요소 (예를 들어, 팽창된 금속들) 를 위한 지지 구조를 갖는다. ]","As well as the elastic element, a zero-gap electrolytic cell of this kind generally possesses, on the cathode side, internals (e.g., linear fins) welded to the housing, and a supporting structure for the elastic element (e.g., expanded metals), which are used for mechanical fixing of the cathode electrode.",True,0.2623739540576935,0.8531496816560775,39,48,-9,145,307,-162
"[니켈로 형성된 탄성 요소로부터 기인한 기존의 제로-갭 전해 셀의 단점은 캐소드 전극을 고정하기 위한 목적으로, 니켈 재료의 상당한 레벨의 소비량 및, 용접 또는 제조에 대해 높은 레벨의 비용과 복잡성을 갖는다는 것이 증명되었다.]","Adverse features of the existing zero-gap electrolytic cells, resulting from the elastic element being formed of nickel, have proven to be a not inconsiderable level of consumption of nickel material, and also a high level of cost and complexity for welding or production, for the purpose of fixing the cathode electrode.",True,0.4063532054424286,0.7388385529594647,32,51,-19,129,321,-192
"[따라서, 이러한 전술한 종래 기술에 기초하여, 본 발명의 목적은 조립 및 재료들의 감소된 비용 및 복잡성과 함께 활성 전극의 신뢰성 있는 기계적 고정 및 전기적 접촉을 제공하는 것이다.]","On the basis of this above-discussed prior art, therefore, the object for the invention is that of providing reliable mechanical fixing and electrical contacting of the active electrode in conjunction with reduced cost and complexity of assembly and materials.",True,0.2050762772560119,0.8803511096510894,28,39,-11,105,260,-155
"[이러한 목적은 전해 셀의 전극과 하우징 사이의 스페이서로서의 텍스타일의 용도에 의해 본 발명에 따라 달성되며, 텍스타일은 탄성 폴리머 재료로 구성되는 기계적 연결 수단을 포함하고 기계적 연결 수단과 상이한 전기적 연결 수단을 포함한다. ]","This object is achieved in accordance with the invention by the use of a textile as a spacer between electrode and housing of the electrolytic cell, the textile comprising a mechanical connection means composed of an elastic polymeric material and comprising an electrical connection means different from the mechanical connection means.",True,0.3552553355693817,0.8082867439129697,33,51,-18,134,337,-203
[본 발명에서 사용되는 텍스타일은 후방 하우징 벽을 전극과 연결하거나 접촉시키기 위한 기계적 및 전기적 연결 수단을 갖는다.,3 The textile used in the invention has a mechanical and an electrical connection means for connecting or contacting the rear housing wall with the electrode.,True,0.2001941055059433,0.8867302309570699,17,26,-9,69,158,-89
"여기서, 기계적 연결 수단은 막에 대해 전극을 가압하도록 하나의 전극과 후방 하우징 벽 사이의 클램핑을 위해 사용된다.",The mechanical connection means here is used for clamping between one electrode and the rear housing wall in order to press the electrode against the membrane.,True,0.1925995200872421,0.8890645582714447,17,26,-9,66,159,-93
이는 텍스타일이 탄성적으로 변형가능하고 또한 전해 셀에서 우세한 매체에 대해 화학적 저항성을 가질 것을 요구한다.,This requires that the textile is elastically deformable and also is chemically resistant to the medium prevailing in the electrolytic cell.,True,0.2942110002040863,0.8039589403424773,15,21,-6,63,140,-77
"이러한 요건을 충족시키도록, 기계적 연결 수단은 예를 들어 PTFE, PFA 또는 PP 와 같은 탄성 폴리머 재료로 제조된다.","In order to meet these requirements, the mechanical connection means is manufactured of an elastic polymeric material, such as PTFE, PFA or PP, for example.",True,0.0600343458354473,0.9636936925141756,18,25,-7,70,156,-86
"탄성 폴리머 재료의 기계적 관련 특성은 그 탄성 계수이며, 이는 설치 시 텍스타일의 압축을 가능하게 하고 설치된 상태에서 막에 대한 전극의 매우 균일한 접촉 압력을 유지한다.","The mechanically relevant property of the elastic polymeric material is its modulus of elasticity, which enables compression of the textile on installation and maintains an extremely uniform contact pressure of the electrode against the membrane in the installed state.",True,0.1585475802421569,0.9010129651702016,26,39,-13,97,269,-172
"따라서, 전극을 막에 대해 가압하도록, 본 발명은 텍스타일이 임의의 상당한 소성 변형을 겪지 않고, 텍스타일의 탄성 변형을 이용한다. ]","To press the electrode against the membrane, therefore, the invention utilizes an elastic deformability of the textile, without that textile undergoing any significant plastic deformation.",True,0.2186392098665237,0.8642006037062656,19,25,-6,76,188,-112
"[텍스타일의 전기적 연결 수단에 관한 요건은, 전기분해 중에 유동하는 전류를 도통시킬 수 있도록 전극과 후방 하우징 벽 사이의 전기적인 접촉이 보장된다는 것이다.","The requirement regarding the electrical connection means of the textile is that an electrical contact between electrode and rear housing wall is ensured, in order to be able to take off the current which flows during electrolysis.",True,0.1893673837184906,0.8937575418663712,22,37,-15,90,231,-141
"도전성을 제공하기 위해, 전기 연결 수단은 일반적으로 금속 실시예를 가질 것이다.","To provide the electrical conductivity, the electrical connection means will as a general rule have a metallic embodiment.",True,0.1602948158979416,0.8978165157792745,11,18,-7,45,122,-77
흑연으로부터 금속 연결 수단의 제조도 마찬가지로 가능하다.],Manufacture of the metallic connection means from graphite is likewise possible.,True,0.2266959398984909,0.8460630257774252,7,11,-4,33,80,-47
"[제로-갭 전해 셀의 하우징과 전극 사이의 연결을 위해 본 발명의 텍스타일을 사용하는 주요 이점은 종래 기술에서 필수적인 탄성 요소, 본 발명에서 사용되는 텍스타일로 대체되고, 기계적 기능, 막에 대한 전극의 가압이 전기적 기능, 활성 전극의 접촉으로부터 디커플링된다는 것이다.","A key advantage of using the textile of the invention for connection between a housing and an electrode of a zero-gap electrolytic cell is that the elastic element necessary in the prior art is replaced by the textile used in the invention, with the mechanical function, the pressing of the electrode against the membrane, being decoupled from the electrical function, the contacting of the active electrode.",True,0.3426786363124847,0.8042771558089039,37,66,-29,155,408,-253
"이러한 디커플링은 니켈의 과도하고 값비싼 전개의 사용을 제거할 뿐만 아니라, 활성 전극을 지지하기 위해 사용되는 용접된 구성요소에 대한 필요성을 제거한다.",This decoupling not only does away with the use of an excessive and costly deployment of nickel but also removes the need for welded components used for supporting the active electrode.,True,0.1754180788993835,0.8806864018470213,20,31,-11,86,185,-99
"이러한 단순한 설계의 결과로서 그리고 본 발명의 제공의 결과로서, 재료들의 비용들을 감소시킬 뿐만 아니라 제로-갭 전해 셀의 제조 비용 및 복잡성을 감소시킬 수 있게 된다.","As a result of this simplified design and as a result of the provision of the invention, it is possible to reduce not only the costs of materials but also the cost and complexity of production of a zero-gap electrolytic cell.",True,0.3541829288005829,0.7445753927054699,25,41,-16,96,225,-129
"또한, 본 발명에 따른 텍스타일의 사용은 텍스타일 또는 탄성 요소의 동일한 탄성 특성들에 대해 상당히 더 큰 거리로 브리지될 수 있게 허용한다.","Furthermore, the use 4 of the textile in accordance with the invention allows a significantly greater distance to be bridged for the same elastic properties of the textile or elastic element.",True,0.2177436798810959,0.86259398154912,22,31,-9,80,191,-111
이는 니켈 지지 구조의 값비싼 하부구조에 대한 필요성을 제거한다. ],This does away with the need for the costly substructure of a nickel supporting structure.,True,0.193790391087532,0.8516058642845733,10,15,-5,38,90,-52
"[본 발명의 택스타일의 바람직한 일 실시예에서, 기계적 연결 요소는 폴리머 필라멘트들로 이루어진 직조된 폴리머 패브릭로 형성되고, 바람직하게는 직조된 상단 패브릭 및 바닥 패브릭을 가지며, 또한 상단 패브릭 및 바닥 패브릭을 연결하는 복수의 파일 스레드들을 갖는다.","In one preferred embodiment of the textile of the invention, the mechanical connection element is formed of a woven polymeric fabric, consisting of polymeric filaments, and has a preferably woven top fabric and bottom fabric and also has a multiplicity of pile threads connecting the top and bottom fabrics.",True,0.1869344860315323,0.8959164118559594,35,49,-14,148,307,-159
"상단 및 바닥 패브릭들 및 또한 파일 스레드들은, 여기서 막 수명을 최대화하기 위해, 압력이 바닥 패브릭 상에 압력이 가해지고, 매트리스-형 구조가 압축되고, 상단 패브릭이 차례로 막에 대해 전극을 가압한다는 점에서 접촉 압력의 매우 균일한 분배를 가능하게 하는 매트리스-형 구조를 형성한다.","The top and bottom fabrics and also the pile threads here form a mattress-like structure which, for the purpose of maximizing the membrane lifetime, enables an extremely uniform distribution of the contact pressure in that pressure is exerted on the bottom fabric, the mattress-like structure is compressed, and the top fabric in turn presses the electrode against the membrane.",True,0.2194315940141677,0.8714625743884522,40,59,-19,163,378,-215
"막의 다른 측으로부터, 막은 제 2 전극, 애노드 또는 캐소드에 의해 접촉되고, 따라서 설명된 배열은 제로-갭 전해 셀을 초래한다. ]","From the other side of the membrane, the membrane is contacted by a second electrode, anode or cathode, and so the arrangement described results in a zero-gap electrolytic cell.",True,0.3209672570228576,0.7972158274619645,20,29,-9,75,177,-102
[폴리머 필라멘트들은 유리하게는 0.1 내지 0.5 mm 의 직경을 갖는다.,The polymeric filaments advantageously have a diameter of 0.1 - 0.5 mm.,True,0.1141029596328735,0.919313979621559,10,12,-2,42,71,-29
"이러한 범위는 기계적 특성들 사이의 효과적인 절충, 개별적인 폴리머 필라멘트들 사이에서 너무 작은 거리를 갖지 않는 전체 직조된 패브릭의 충분한 유동 투과성, 및 시장 이용가능성을 나타낸다. ]","This range represents an effective tradeoff between mechanical properties, a sufficient flow permeability of the overall woven fabric with not too small a distance between the individual polymeric filaments, and the market availability.",True,0.1638593524694442,0.893779967543155,27,33,-6,108,236,-128
"[본 발명의 텍스타일의 이러한 바람직한 개선의 개선예에서, 전기적 연결 요소는 상단 및 바닥 패브릭들을 통해 통과하는 금속 와이어들에 의해 형성된다.","In a development of this preferred development of the textile of the invention, the electrical connection element is formed by metal wires passing through the top and bottom fabrics.",True,0.3470201194286346,0.7989540321815924,20,29,-9,83,182,-99
금속 와이어들이 상단 및 바닥 패브릭들을 관통하게 하는 이유는 이것이 상단 패브릭 상의 전극과 바닥 패브릭 상의 후방 하우징 벽 사이에서 전기 접촉이 달성될 수 있는 유일한 방법이기 때문이다.,The reason for causing the metal wires to pierce the top and bottom fabrics is that this is the only way in which electrical contact can be achieved between an electrode on the top fabric and a rear housing wall on the bottom fabric.,True,0.2362715452909469,0.8680385078574482,29,44,-15,107,233,-126
금속 와이어들이 상단 및 바닥 패브릭들의 내측 사이에만 연장되는 경우 원하는 전기 접촉은 그곳에서 존재하지 않을 것이다.],"If the metal wires only ran between the insides of the top and bottom fabrics, the desired electrical contact would not be there.",True,0.2385599911212921,0.8509215342930794,17,23,-6,68,129,-61
"[텍스타일의 2개 이상의 플라이들이 제조 현장에서 유리할 수 있는 바와 같이 하나 위에 다른 하나가 배치되는 경우 - 예를 들어, 이용가능한 유일한 기계가 소정 최대 높이를 갖는 텍스타일을 생산할 수 있거나 또는 소정 높이를 초과하는 텍스타일이 변형에 대한 충분한 복원력을 생성하지 못하는 경우 - 이때 상단 및 바닥 패브릭들을 관통하는 금속 와이어의 분배, 및 보다 구체적으로, 외부 측 - 즉, 전극 또는 후방 하우징 벽을 각각 향하는 측 - 상의 이들 와이어들의 경로는 2개 이상의 텍스타일들이 하나 위에 다른 하나가 놓일 때, 인접한 플라이들의 금속 와이어들의 복수의 전기 접촉 크로스오버 지점들이 형성되도록 선택되어야 한다.","Where two or more plies of the textile are to be disposed one above another, as may be advantageous on manufacturing grounds - if, for example, the only machine available is able to produce a textile having a certain maximum height or if the textile beyond a certain height fails to generate a sufficient restoring force on deformation then the distribution of the metal wires piercing the top and bottom fabrics, and more particularly the course of these wires on the outer sides - that is, the sides facing the electrode or rear housing wall, respectively - should be selected such that when two or more textiles are laid one atop another a multiplicity of electrically contacting crossover points of the metal wires of adjacent plies are formed.",True,0.1854011267423629,0.90333363153154,94,128,-34,354,748,-394
"본 발명에서 사용되는 텍스타일의 2개 이상의 파일들의 제공에 대한 추가적인 이유는, 변형에 대해 텍스타일의 이방성 특성들을 보상하기 위함일",An additional reason for the provision of two or more plies of the textile used in the invention may be that of compensating anisotropic properties of the textile on deformation.,False,0.2485131472349167,0.8307238467292436,18,30,-12,77,178,-101
"텍스타일이 로드 하에 하나의 방향으로 이동하면, 이는 오버레이된 플라이를 180°만큼 터닝함으로서 보상될 수 있다.","If the textile moves in one direction under load, this can be compensated by turning an overlying ply by 1800.",False,0.2342963367700576,0.8161232456659747,14,20,-6,64,110,-46
이는 표면에서의 측방향 시프팅을 효과적으로 방지한다.,This effectively prevents a lateral shifting at the surface.,True,0.1326730251312255,0.9008353269650708,6,9,-3,29,60,-31
"본 발명의 대안적인 개선예에서, 금속 와이어들은 복수의 플라이들 사이의 전기적 접촉을 보장할 수 있도록 오버레이된 텍스타일들의 복수의 플라이를 통과한다. ]","In an alternative development of the invention, the metal wires pass through a plurality of plies of overlaid textiles, to be able to ensure electrical contact between multiple plies.",True,0.1655448973178863,0.9059828505667264,20,29,-9,87,183,-96
"[매트리스-형 구조의 2개의 내측 사이로 연장되는 금속 와이어들, 보다 특히 니켈 와이어들이 매트리스-형 구조의 높이보다 큰 신장된 길이를 갖는 경우 특히 유리하다는 것이 추가로 밝혀졌다.","It has further been found to be particularly advantageous if the metal wires, more particularly nickel wires, running between the two insides of a mattress-like structure have a stretched length which is greater than the height of the mattress-like structure.",True,0.1517114490270614,0.9081752960863384,25,40,-15,105,259,-154
금속 와이어들의 그 결과로 인한 벌키 코스 (bulky course) 는 텍스타일의 기계적 변형성을 손상시키지 않고 신뢰성있는 전기 접촉을 생성한다.,"The resultant bulky course of the metal wires produces reliable electrical contacting, without detracting from the mechanical deformability of the textile.",True,0.1795829683542251,0.887405205135685,19,21,-2,83,155,-72
"전술한 매트리스-형 구조와 폴리머 필라멘트들의 탄성 특성들과의 상호작용에서, 매트리스-형 구조의 압축은, 특히 소성 변형의 결과로서, 금속 와이어들 또는 폴리머 필라멘트들이 손상을 입지 않고, 상단 및 바닥 패브릭들의 블로킹 플라이까지 심지어 발생할 수 있다. ]","In interaction with the above-described mattress-like structure and with the elastic properties of the polymeric filaments, the compression of the mattress-like structure may even occur up to the blocking ply of the top and bottom fabrics, without the metal wires or the polymeric filaments suffering damage, particularly as a result of plastic deformation.",True,0.1942948698997497,0.8932905161497982,34,53,-19,147,357,-210
"[로드 하에서 변형의 방향의 가능한 바람직한 사전결정에 대해, 더욱이, 휴지 위치에서의 금속 와이어들이 매트리스-형 구조의 간격보다 작은 거리에 있는 텍스타일을 사용하는 것이 유리할 수 있다. ]","With regard to the possibly desired predetermination of the direction of deformation under load, moreover, it may be advantageous to use a textile wherein the metal wires in the resting position are at a smaller distance than the spacing of the mattress-like structure.",True,0.2633101940155029,0.8352161307865391,26,43,-17,109,269,-160
"[전해 셀의 구역에 걸친 전체 전도 단면은 전기 연결 수단의 결과로서 전압의 상당한 강하가 없는 크기로 선택되는 것이 유리하다. 1 m, Sup[attributes={}; value=[2]], 의 활성 전극 면적에 대해, 350 내지 2100 mm, Sup[attributes={}; value=[2]], 의 전도 단면이 적합한 것으로 나타났다.]",For active electrode area of 1 m 2 a conduction cross section of 350-2100 mm2 has emerged as being suitable.,False,0.5368251204490662,0.657426380336941,40,20,20,194,108,86
"[보다 바람직하게는, 금속 와이어들은 0.05 내지 0.3 mm 의 직경을 갖는다.",More preferably the metal wires possess a diameter of 0.05 - 0.3 mm.,True,0.1027784943580627,0.9341935363502188,11,13,-2,46,68,-22
"이는 가능한 한 작은 전압 강하, 높은 탄성 변형, 및 통상적인 텍스타일 기계들에서 프로세싱될 와이어들에 대한 용량 사이의 효과적인 절충이 존재한다는 것으로 나타났다. ]","This has emerged has being an effective tradeoff between as small a voltage drop as possible, high elastic deformability, and capacity for the wires to be processed in customary textile machines.",True,0.2803141176700592,0.8186047039709317,24,31,-7,95,195,-100
"[전기 연결 수단이 상단 및 바닥 패브릭들을 통해 통과하는 금속 와이어들인 전술한 바람직한 실시예에 대한 대안으로서, 전기 연결 수단은 파일 스레드들의 도전성 코팅에 의해 실현될 수 있다.","As an alternative to the above-described preferred embodiment wherein the electrical connection means are metal wires passing through the top and bottom fabrics, the electrical connection means may be realized by an electrically conductive coating of the pile threads.",True,0.2115363776683807,0.8897481924574816,27,39,-12,105,268,-163
파일 스레드들은 매트리스-형 구조를 제조하는 작동 전 또는 후에 코팅될 수 있다.,The pile threads may be coated either before or after the operation of producing the mattress-like structure.,True,0.2420963644981384,0.8200762600556121,12,17,-5,45,109,-64
"그러나, 파일 스레드들의 기계적 특성들이 금속 코팅, 특히 그 두께에 의해 악영향을 받지 않게 보장하도록 주의를 기울여야 한다. ]","Care should be taken, however, to ensure that the mechanical properties of the pile threads are not adversely affected by the metallic coating, especially its thickness.",True,0.2206253856420517,0.8481460163439812,19,26,-7,73,169,-96
"[설명된 실시예들 양쪽에서, 상단 및 바닥 패브릭들은 도전성 접촉 지점들을 가지며, 이로써, 외부에서, 그것들을 통해 관통되고 그것들 내에 직조되는 금속 와이어들의 결과로서, 및/또는 외부에서 상단 및 바닥 패브릭들에 통합된 코팅된 파일 스레드에 의해, 전기 연결 수단으로서 그들의 기능을 효과적으로 충족시킨다.]","In both of the embodiments described, the top and bottom fabrics possess electrically conductive contact points, thereby effectively fulfilling their function as electrical connection means, as a result, externally, of metal wires which are pierced through them and woven into them and/or by means, externally, of the coated pile threads incorporated into the top and bottom fabrics.",True,0.2014744877815246,0.8987934031647097,40,57,-17,175,383,-208
"[본 발명에 따른 텍스타일의 사용 뿐만 아니라, 본 발명은 또한 애노드 전극, 캐소드 전극, 애노드 전극과 캐소드 전극 사이에 배치된 이온 교환 막, 및 애노드 탱크와 캐소드 탱크로 형성된 하우징을 포함하는 제로-갭 전해 셀에 관한 것이며, 전극들 중 적어도 하나와 탱크들 중 하나 사이에는, 각각의 전극과 각각의 탱크와 접촉하는 본 발명의 텍스타일의 적어도 하나의 플라이가 배치된다.","As well as the use of a textile in accordance with the invention, the invention also relates to a zero-gap electrolytic cell comprising an anode electrode, a cathode electrode, an ion exchange membrane disposed between an anode electrode and cathode electrode, and a housing formed of an anode tank and a cathode tank, there being, disposed between at least one of the electrodes and one of the tanks, at least one ply of a textile of the invention contacting the respective electrode and the respective tank.",True,0.2104118019342422,0.8825823652158518,56,86,-30,215,509,-294
"캐소드 측 상에 배치되는 본 발명의 텍스타일이 유리한 하나의 이유는 니켈이 금속성 캐소드 재료로서 규칙적으로 사용되고, 따라서 작동 전류의 전도가 순수한 물리적 접촉을 통해 달성될 수 있다는 것이다.",One reason in favor of the textile of the invention being disposed on the cathode side is that nickel is regularly employed as the metallic cathode material and the conduction of the operating current can therefore be accomplished via a pure physical contacting.,True,0.1741368174552917,0.8959001513913017,28,43,-15,111,262,-151
"니켈은 작동 환경에서 안정적이고, 양호한 도전성을 갖는다.",Nickel is stable in the operating environment and possesses a 7 good electrical conductivity.,True,0.2533504068851471,0.8049425865981676,7,14,-7,32,93,-61
"또한, 캐소드의 작동 매체에서 화학적으로 안정적인 복수의 플라스틱이 존재하고, 예는 폴리페닐렌 설파이드인 반면, 애노드 측에서는, 예를 들어, 염소알칼리 전기분해의 경우, 염소 가스가 형성되며, 이는 사용될 수 있는 재료들을 심각하게 제한한다. ]","There are also a multiplicity of plastics which are chemically stable in the operating medium of the cathode, an example being polyphenylene sulfide, whereas on the anode side, for example, in the case of chloralkali electrolysis, chlorine gas is formed, which severely limits the materials which can be used.",True,0.192166656255722,0.8778508152206417,31,49,-18,138,309,-171
"[본 발명은 추가로 본 발명의 제로-갭 전해 셀을 제조하기 위한 방법에 관한 것이며, 여기서, 본 발명의 텍스타일의 적어도 하나의 플라이가 애노드 탱크 또는 캐소드 탱크 내에 배치되고, 애노드 전극 또는 캐소드 전극이 텍스타일의 적어도 하나의 플라이 상에 배치되고, 이온 교환 막이 전극 상에 위치되고, 캐소드 탱크 또는 애노드 탱크에 각각 연결된 캐소드 전극 또는 애노드 전극이 이온 교환 막 상에 배치된다. ]","The invention additionally relates to a method for producing a zero-gap electrolytic cell of the invention, where at least one ply of a textile of the invention is placed into the anode tank or the cathode tank, an anode electrode or cathode electrode is disposed on the at least one ply of the textile, an ion exchange membrane is placed onto this electrode, and a cathode electrode or anode electrode connected to a cathode tank or anode tank, respectively, is disposed on the ion exchange membrane.",True,0.2641641795635223,0.8503104287150041,62,86,-24,231,501,-270
[본 발명의 방법의 특징은 특히 간단하고 비용 효율적인 방식으로 본 발명의 텍스타일에 의해 제로-갭 전해 셀의 제조를 가능하게 한다는 것이다. ],A feature of the method of the invention is that it enables the production of a zero gap electrolytic cell with the textile of the invention in a particularly simple and cost effective way.,True,0.3795488774776459,0.7432642848178207,21,34,-13,81,189,-108
"[본 발명의 텍스타일에 의한 전극 및 후방 하우징 벽의 전기적 접촉을 보장하기 위해, 텍스타일에 대해 전극과 탱크 사이에서, - 말하자면, 사전압축의 형태로서 - 접촉 압력으로 도입되는 이러한 제조 방법이 특히 바람직하다.","In order to ensure the electrical contacting of the electrode and rear housing wall by the textile of the invention, it is particularly preferable with this production method for the textile to be introduced with a contact pressure - as a form of precompression, so to speak - between electrode and tank.",True,0.1702551543712616,0.9100172714078693,31,52,-21,124,304,-180
"이 경우, 약 100 내지 150 mbar 의 접촉 압력이 특히 적합한 것으로 나타났다.",In this case a contact pressure of about 100 - 150 mbar has emerged as being particularly suitable.,True,0.0613903626799583,0.9585230747580396,14,18,-4,49,99,-50
"이러한 압력에 있어서, 상단 및 바닥 패브릭들의 전도성 구성요소들과 연결된 구성요소들, 후방 하우징 벽 및 전극 사이의 물리적 접촉이 충분히 전류를 전달할 수 있고, 따라서 과도한 전압 강하가 존재하지 않을 것으로 예상된다. ]","With this pressure it is anticipated that the physical contact between the conductive components of the top and bottom fabrics and the connected components, rear housing wall and electrode, is able to transmit current sufficiently, hence that there is no excessive drop in voltage.",True,0.2164624780416488,0.8774159664776511,33,44,-11,127,281,-154
"[도 1 은 언로딩된 상태 (전기적 연결 수단을 도시하는 것을 배제함) 에서 본 발명의 텍스타일의 사용의 개략적인 사시 측면도를 도시하고, 도 2 는 로딩된 상태로 도 1 에서와 같이 본 발명에 사용되는 텍스타일의 측면도를 도시하고, 도 3 은 기계적 및 전기적 연결 수단을 도시하는 것을 포함하는, 도 1 에서와 같이 본 발명에 사용되는 텍스타일의 측면도를 도시하고, 도 4 는 기계적 및 부가적으로 단면도로 도시된 전기적 연결 수단을 도시하는 것을 포함하는, 대안적인 실시예의 본 발명에 사용된 텍스타일의 측면도를 도시하고, 도 5 는 제로-갭 전해 셀을 제조하기 위한 본 발명의 방법을 도시한다.]","The invention is described below using exemplary embodiments, with reference to the appended figures, in which: 8 fig. 1 shows a schematized perspective side view of the use of a textile in the invention in the unloaded state (to the exclusion of representing the electrical connection means), fig. 2 shows a side view of the textile used in the invention as in fig. 1 in the loaded state, fig. 3 shows a side view of the textile used in the invention as in fig. 1, with the inclusion of showing the mechanical and electrical connection means, fig. 4 shows a side view of the textile used in the invention in an alternative embodiment, with the inclusion of showing the mechanical and, shown additionally in the cross section, electrical connection means, and fig. 5 shows the method of the invention for producing a zero-gap electrolytic cell.",False,0.2551880776882171,0.8578976544699957,90,145,-55,337,844,-507
"[다양한 도면들에서, 동일한 부분들에는 항상 동일한 도면부호들이 주어지고, 따라서 일반적으로 또한 각각의 경우에 한 번만 명명되거나 언급된다. ]","In the various figures, identical parts are always given the same reference symbols and are therefore in general also named or mentioned only once in each case.",True,0.1948682069778442,0.8514232168308151,18,27,-9,81,160,-79
[제로-갭 전해 셀의 하우징과 전극 사이의 연결을 위한 텍스타일 (1) 의 용도는 언로딩된 상태에서 예시적으로 도 1 에 도시된다.,The use of a textile 1 for connection between a housing and an electrode of a zero gap electrolytic cell is shown illustratively in fig. 1 in the unloaded state.,True,0.3801130056381225,0.7599093484502242,19,30,-11,73,161,-88
"여기서, 기계적 연결 수단은 배타적으로 도시되지만, 전기적 연결 수단은 명확성을 위해 도시되지 않는다.","The mechanical connection means exclusively is pictured here, whereas the electrical connection means is not shown, for reasons of clarity.",True,0.1731343865394592,0.882946254828479,13,20,-7,57,139,-82
"본 발명에서 사용되는 텍스타일 (1) 은 필라멘트들로 직조된 상단 및 바닥 패브릭들 (2, 3), 및 또한 상단 및 바닥 패브릭들 (2, 3) 을 연결하는 파일 스레드들 (4) 을 포함한다.","The textile 1 used in the invention comprises top and bottom fabrics 2, 3 woven from filaments, and also pile threads 4 connecting the top and bottom fabrics 2, 3.",True,0.1988588124513626,0.8808219153449681,29,30,-1,106,163,-57
"상단 및 바닥 패브릭들 (2, 3) 은 서로 평행하게 연장되는 평면형 설계를 갖는데, 왜냐하면 전해 하프 셀의 전극과 후방 하우징 벽 사이에 그 설치된 상태에서, 그것들은 후방 하우징 벽 상에 작용하고 전해 셀의 내부로 지향되는 힘의 매우 균일한 전달을 위한 역할을 하기 때문이다.","The top and bottom fabrics 2, 3 have a planar design running parallel to one another, because, in their installed state between electrode and rear housing wall of an electrolytic half-cell, they serve for the extremely uniform transmission of a force which acts on the rear housing wall and which is directed into the interior of the electrolytic cell.",True,0.1930734515190124,0.8883168445652087,43,59,-16,157,352,-195
"후방 하우징 벽이 전해 셀의 내부를 향해 힘을 받으면, 바닥 패브릭 (2) 은 하나의 전극과 접촉하는 상단 패브릭 (3) 에 힘의 전달 - 파일 스레드들 (4) 을 통해 매개됨 - 을 수행한다.","If the rear housing wall is subjected to a force toward the interior of the electrolytic cell, the bottom fabric 2 carries out transmission - mediated via the pile threads 4 - of the force to the top 9 fabric 3 which contacts one electrode.",True,0.2465314418077469,0.8568087035399824,32,45,-13,108,240,-132
"변형의 방향 의존성을 감소시키기 위해, 기계적 연결 수단이 서로 교차하는 텍스타일을 사용하여 우선적인 기계적 방향이 존재하지 않는 것이 또한 가능하다. ]","In order to reduce the directional dependence of the deformation, it is also possible to use a textile wherein the mechanical connection means cross one another, so that there is no preferential mechanical direction.",True,0.2154387533664703,0.8646240226458042,21,34,-13,86,216,-130
[이러한 힘의 전달은 로딩된 텍스타일을 도시하는 도 2 에서 개략적으로 재현된다.,"This transmission of force is reproduced schematically in fig. 2, which shows a loaded textile.",True,0.2124450355768203,0.8477092902994022,11,15,-4,45,95,-50
"여기서 하부 힘 화살표는 바닥 패브릭 (2) 상의 힘 (F) 으로 작용하는 후방 하우징 벽에 상응하고, 벽은 도시되지 않는다.","The lower force arrow here corresponds to a rear housing wall acting with the force F on the bottom fabric 2, the wall not being shown.",True,0.1597198247909546,0.8973268780914084,19,26,-7,70,135,-65
"힘 (F) 은, 힘에 대한 노출의 결과로서 탄성적으로 변형되는 파일 스레드들 (4) 을 통해 매개되며, 상단 패브릭 (3) 에 전달되고, 이는 마찬가지로 도시되지 않지만 상단 패브릭 (3) 과 접촉하는 전극에 힘 (F) 을 통과시켜, 전극을 균일하게 그리고 따라서 특히 막에 대해 부드럽게 가압하고 및/또는 추가적인 구성요소들, 특히 용접된 금속 플레이트들 또는 팽창된 금속들을 사용하지 않고 전극을 제위치에서 유지시킨다.","Mediated via the pile threads 4, which are elastically deformed as a result of exposure to the force, the force F is transmitted to the top fabric 3, which passes on the force F to an electrode which is likewise not shown but which contacts the top fabric 3, in order to press the electrode uniformly and therefore particularly gently against the membrane and/or to maintain the electrode in position without using additional components, especially welded metal plates or expanded metals.",True,0.1606639623641967,0.9106873437521312,58,81,-23,236,488,-252
"이와 관련하여, 기계적 연결 수단이 본 경우에 탄성 폴리머 재료, 폴리머 필라멘트들로 이루어지는 것이 특히 유리하다는 것이 입증되었는데, 왜냐하면 이는 소성 변형이 효과적으로 방지될 수 있게 하고, 따라서 본 발명의 텍스타일의 수명이 힘 (F) 에 대한 노출에 의해 악영향을 받지 않기 때문이다. ]","In this context it has proven particularly advantageous that the mechanical connection means consists of an elastic polymeric material, polymeric filaments in the present case, since this allows plastic deformations to be effectively prevented, and the lifetime of the textile of the invention is therefore not adversely effected by exposure to the force F.",True,0.1740969568490982,0.9027363837995296,43,54,-11,167,357,-190
"[도 3 은 도 1 과 동일한 예시적인 실시예에 관한 것이고, 상이한 로딩 상태에 대해 도 1 및 도 2 에 도시된 기계적 연결 수단 뿐만 아니라 전기적 연결 수단도 예시한다.","Fig. 3, which relates to the same exemplary embodiment as fig. 1, illustrates not only the mechanical connection means, which is shown in fig. 1 and fig. 2 for different states of loading, but also the electrical connection means.",True,0.1538075506687164,0.9036242614690424,31,39,-8,98,230,-132
"본 예시적인 실시예에서, 전기적 연결 수단은 상단 및 바닥 패브릭들 (2, 3) 을 통해 통과하는 금속 와이어들 (5) 에 의해 실현된다.","In this exemplary embodiment the electrical connection means is realized by metal wires 5 which pass through the top and bottom fabrics 2, 3.",True,0.1288563460111618,0.927172134111398,21,24,-3,77,141,-64
"여기서, 바닥 패브릭 (2) 으로부터 연장되는 금속 와이어 (5) 는, 상단 패브릭 (3) 의 하향을 향하는 측을 관통하고, 상단 패브릭 (3) 의 상향을 향하는 측 상에서 상단 패브릭 (3) 의 평면에 실질적으로 평행하게 진행한 후 상단 패브릭 (3) 의 상향을 향하는 측을 통해 다시 통과하고, 그후 유사하게 바닥 패브릭 (2) 을 통해 또한 통과한다는 것은 명백하다.","It is apparent here that a metal wire 5 extending from the bottom fabric 2 pierces through the downward-facing side of the top fabric 3 and runs substantially parallel to the plane of the top fabric 3, on the upward-facing side of the top fabric 3, before passing again through the upward facing side of the top fabric 3, and then being passed, similarly, through the bottom fabric 2 as well.",True,0.1768006980419159,0.899426254257106,56,71,-15,208,392,-184
"이러한 방식으로, 바닥 패브릭 (2) 의 하향을 향하는 측 및 또한 상단 패브릭 (3) 의 상향을 향하는 측에는 금속 와이어 (5) 가 제공됨으로써, 금속, 특히 니켈의 과도한 전개를 취할 필요 없이, 후방 하우징 벽 및 전극과 접촉하기 위한 신뢰성 있는 도전성 연결을 생성한다. ]","In this way, the downward-facing side of the bottom fabric 2 and also the upward-facing side of the top fabric 3 are provided with metal wire 5, thereby producing a reliable electrically conductive connection for contacting the rear housing wall and the electrode, without having to undertake excessive deployment of metal, especially nickel.",True,0.1783401668071746,0.908728675538882,44,53,-9,158,342,-184
"[도 4 는 기계적 및 전기적 연결 수단을 도시하는 것을 포함하는, 대안적인 실시예에 따른 본 발명에 사용되는 텍스타일의 측면도를 도시한다.","Fig. 4 shows a side view of the textile used in the invention according to an alternative embodiment, including showing the mechanical and electrical connection means.",True,0.1834291517734527,0.8906140893726188,20,26,-6,78,167,-89
"본 실시예에서, 기계적 연결 수단의 상단 및 바닥 패브릭 (2, 3) 은 코팅된 파일 스레드들 (6) 에 의해 서로 연결되며, 이러한 연결은 기계적 및 전기적 양쪽이다.","In this embodiment, the top and bottom fabrics 2, 3 of the mechanical connection means are connected to one another by coated pile threads 6, this connection being both mechanical and electrical.",True,0.1715045869350433,0.9050761026085526,26,32,-6,94,195,-101
"여기서 상단 및 바닥 패브릭들 (2, 3) 의 기계적 연결은, 탄성 폴리머 필라멘트들로 구성된 파일 스레드들 (4) 에 의해, 도 1 내지 도 3 의 전술한 바람직한 실시예에서와 같이 달성된다.","The mechanical connection of the top and bottom fabrics 2, 3 here is accomplished, as in the above-described preferred embodiment in figs. 1 to 3, by pile threads 4 composed of elastic polymeric filaments.",True,0.154101014137268,0.9098085227686168,30,34,-4,108,205,-97
"상단 및 바닥 패브릭들 (2, 3) 의 전기적 연결, 및 따라서 인접한 후방 하우징 벽 및 또한 전극의 전기적 연결은 - 코팅된 파일 스레드 (6) 의 단면도에 의해 예시된 바와 같이 - 파일 스레드들 (4) 의 도전성 코팅 (7) 을 통해 실현된다.","The electrical connection of the top and bottom fabrics 2, 3 and hence of the adjacent rear housing wall and also electrode is realized - as illustrated by the cross-sectional representation of a coated pile thread 6 - via an electrically conductive coating 7 of the pile threads 4.",True,0.2245678007602691,0.8794896461123631,42,49,-7,140,282,-142
"여기서, 코팅된 파일 스레드들 (6) 은 직조 절차 전 또는 후에 도전성 층, 바람직하게는 금속으로 파일 스레드들 (4) 을 코팅함으로써 제조될 수 있다. ]","The coated pile threads 6 here may have been produced by coating of the pile threads 4 with an electrically conductive layer, preferably a metal, either before or after the weaving procedure.",True,0.2302256971597671,0.8669573497250358,24,32,-8,88,191,-103
[본 발명의 제로-갭 전해 셀을 제조하기 위한 본 발명의 방법의 도면은 도 5 (상단으로부터 바닥으로) 에 도시된다.,A representation of the method of the invention for producing a zero-gap electrolytic cell of the invention is shown in fig. 5 (from top to bottom).,True,0.2823523879051208,0.8074377303142791,17,26,-9,65,148,-83
"제 1 단계에서, 텍스타일 (1) 의 적어도 하나의 플라이는 애노드 또는 캐소드 탱크 (8, 9) - 여기서 후방 하우징 벽으로도 지칭되는 캐소드 탱크 (8) 내에 위치된다.","In a first step, at least one ply of a textile 1 is placed into an anode or cathode tank 8, 9 - here the cathode tank 8, which is also referred to as the rear housing wall.",True,0.1601602286100387,0.8990548546247976,26,38,-12,97,172,-75
"후속하여, 애노드 또는 캐소드 전극 (10, 11) - 여기서 캐소드 전극 (10) - 은 이온 교환 막 (12) 이 이러한 전극 상에 배치되기 전에, 텍스타일 (1) 의 적어도 하나의 플라이 상에 배치된다.","Subsequently an anode or cathode electrode 10, 11 - here the cathode electrode 10 - is disposed on the at least one ply of the textile 1, before an ion exchange membrane 12 is placed onto this electrode.",True,0.1602081060409546,0.9089052736240923,32,38,-6,116,203,-87
"제로-갭 전해 셀 (13) 을 완성하기 위해, 마지막으로, 캐소드 또는 애노드 탱크 (8, 9) - 여기서 애노드 탱크 (9) 에 연결된 캐소드 또는 애노드 전극 (10, 11) - 여기서 애노드 전극 (11) - 이 이온 교환 막 (12) 상에 배치된다. ]","To complete the zero-gap electrolytic cell 13, lastly, a cathode or anode electrode 10, 11 - here the anode electrode 11 - connected to a cathode or anode tank 8, 9 - here the anode tank 9 - is disposed on the ion exchange membrane 12.",True,0.1767998933792114,0.8902268529062637,41,46,-5,145,235,-90
[1 텍스타일 2 바닥 패브릭 3 상단 패브릭 4 파일 스레드 5 금속 와이어 6 코팅된 파일 스레드 7 도전성 코팅 8 캐소드 탱크 9 애노드 탱크 10 캐소드 전극 11 애노드 전극 12 이온 교환 막 13 제로-갭 전해 셀 F 힘 ],11 List of reference symbols 1 textile 2 bottom fabric s 3 top fabric 4 pile thread metal wire 6 coated pile thread 7 electrically conductive coating 8 cathode tank 9 anode tank cathode electrode 11 anode electrode 12 ion exchange membrane 13 zero-gap electrolytic cell F force,True,0.3021490275859833,0.794081262426906,44,48,-4,133,277,-144
"[상세하게는, 전술한 바와 같이 양 사이드 프레임 사이에 가설된 각 축 부재는 제직 중에 진동하지만, 그 중에서도 로킹 축은, 바디치기 운동에 따른 충격을 받아 가장 심하게 진동한다.","Specifically, as described above, each of the shaft members bridged between both the side frames vibrates during the weaving.",False,0.4350795447826385,0.7413000052876982,27,19,8,102,125,-23
"이에, 로킹 축을 지지하는 지지축을 위한 상기 지지부, 및/또는 그 로킹 축에 대하여 운동 변환 기구에 의해 기계적으로 연결되는 주축를 지지하는 지지축을 위한 상기 지지부를 상기 오프셋 지지부로 함으로써, 이와 같이 기계적으로 연결된 2개의 축 부재 중 적어도 한쪽의 제직 중에서의 진동이 전술한 바와 같이 보다 억제되게 되고, 양 사이드 프레임의 진동이 보다 효과적으로 억제되게 된다.]","Therefore, the support part for the support shaft for supporting the rocking shaft and/or the support part for the support shaft for supporting the main shaft mechanically connected to the rocking shaft by a motion converting mechanism is formed as the offset support part, so that the vibrations of at least one of the two mechanically connected shaft members during the weaving are further suppressed and the vibrations of both the side frames are more effectively suppressed.",True,0.2067397087812419,0.8939558021825266,56,77,-21,217,478,-261
[도 1은 본 발명이 적용되는 직기의 프레임의 상면도이다.,FIG. 1 is a top view of a frame of a loom to which the present invention is applied.,True,0.2013903856277465,0.8573971121643944,8,19,-11,32,84,-52
도 2는 도 1의 A-A 단면도이다.,FIG. 2 is a sectional view taken along an A-A line in FIG. 1.,True,0.2486834824085235,0.8398477358310725,6,14,-8,20,61,-41
도 3은 도 1의 직기의 프레임의 부분 확대 사시도이다.,FIG. 3 is a partially enlarged perspective view of the frame of a loom shown in FIG. 1.,True,0.2412284016609192,0.834278091910986,9,18,-9,31,87,-56
도 4는 도 1의 직기의 프레임의 부분 확대 단면도이다.,FIG. 4 is a partially enlarged sectional view of the frame of a loom shown in FIG. 1.,True,0.2101233452558517,0.857709201207173,9,18,-9,31,85,-54
도 5는 도 1의 직기의 프레임의 부분 확대 단면도이다.],FIG. 5 is a partially enlarged sectional view of the frame of a loom shown in FIG. 1.,True,0.2262764573097229,0.8464362241004678,9,18,-9,32,85,-53
"[이하에서는, 도 1∼도 5에 기초하여, 본 발명이 적용된 직기의 프레임의 일실시형태(본 실시예)에 대하여 설명한다.]","Hereinafter, an embodiment (present embodiment) of a frame of a loom to which the present invention is applied will be described with reference to FIGS. 1 to 5.",True,0.1964204609394073,0.8725796425439427,14,28,-14,66,160,-94
"[직기에 있어서, 프레임(1)은, 한 쌍의 사이드 프레임(2, 2)을 주체로 하고, 그 양 사이드 프레임(2, 2)이 4개의 빔재(3a, 3b, 3c, 3d)로 연결된 구성이 되어 있다.","In a loom, a frame 1 has a pair of side frames 2 and 2 as a main body, and both the side frames 2 and 2 are connected by means of four beam members 3a, 3b, 3c and 3d.",True,0.3271591663360595,0.8357834152365704,24,40,-16,104,166,-62
"그리고, 각 사이드 프레임(2)은, 내부에 공간을 가지는 하우징 형상으로 형성되어 있다.","Note that, each of the side frames 2 has a housing shape having a space therein.",True,0.3548960983753204,0.792538397772242,11,16,-5,49,80,-31
"그리고, 양 사이드 프레임(2, 2)은, 그 폭 방향(두께 방향=직기의 폭 방향)에 있어서 대향한 상태로, 빔재(3a, 3b, 3c, 3d)에 의해 연결되어 있다.]","Both the side frames 2 and 2 are connected by means of the beam members 3a, 3b, 3c and 3d with facing each other in a width direction (thickness direction = a width direction of the loom).",True,0.1986380219459533,0.9040597763324868,21,37,-16,92,188,-96
"[또한, 직기에 있어서는, 그 전후 방향에서의 한쪽에 있어서, 양 사이드 프레임(2, 2)에 지지되는 형태로, 경사 T를 송출하기 위한 경사 빔(6)이 구비되어 있다.","In the loom, a warp beam 6 for delivering a warp T is provided on one side in a front and rear direction of the loom in a form of being supported on both the side frames 2 and 2.",True,0.3093489408493042,0.8387562183243661,22,40,-18,93,178,-85
"또한, 그 직기의 상기 전후 방향에서의 다른 쪽에는, 제직된 직포를 권취하기 위한 권취빔(8)이, 양 사이드 프레임(2, 2)에 지지되는 형태로 구비되어 있다.]","In addition, a winding beam 8 for winding a manufactured woven fabric is provided on the other side in the front and rear direction of the loom in a form of being supported on both the side frames 2 and 2.",True,0.3827299177646637,0.8103400738035854,21,41,-20,90,205,-115
"[나아가서는, 직기는, 개구 장치에서의 종광 프레임(11)의 상하 이동을 안내하기 위한 한 쌍의 종광 프레임 가이드(12, 12)를 구비하고 있다.","In addition, the loom has a pair of heddle frame guides 12 and 12 for guiding up-and-down movement of heddle frames 11 of an opening device.",True,0.3548088669776916,0.7961194911476356,18,26,-8,82,140,-58
"그 각 종광 프레임 가이드(12)는, 대응하는 사이드 프레임(2)에 장착된 브래킷(14)에 의해 지지되는 형태로 직기 상에 설치되어 있다.",The heddle frame guides 12 are each provided on the loom in a form of being supported by means of brackets 14 each attached to the corresponding side frame 2.,True,0.2432931810617447,0.8861780037700016,17,30,-13,77,158,-81
"그리고, 그 브래킷(14)은, 대응하는 사이드 프레임(2)에 대하여, 그 사이드 프레임(2)의 내측벽(27)에 고정되는 형태로 장착되어 있다.]",The brackets 14 are each fixed to the corresponding side frame 2 in a form of being fixed to an inner wall 27 of the side frame 2.,True,0.2507224380970001,0.87857032218827,15,28,-13,80,130,-50
"[그리고, 각 브래킷(14)은, 프레임에 대하여 장착되는 판형의 지지판(14a)과, 지지판(14a)의 한쪽의 단면으로부터 돌출하도록 지지판(14a)에 장착된 지지 샤프트(14b)로 이루어져 있다.","Note that, each of the brackets 14 is constituted by a plate-shaped support plate 14a attached to the frame and a support shaft 14b attached to the support plate 14a so as to protrude from one end face of the support plate 14a.",True,0.2948631644248962,0.8631737909348168,18,43,-25,109,227,-118
"그리고, 각 브래킷(14)은, 지지 샤프트(14b)가 사이드 프레임(2)의 상면보다 위쪽에 위치하고 또한, 지지 샤프트(14b)가 직기의 내측(이하, 간단히 「내측」이라고 함)을 향하도록 한 형태로, 전술한 바와 같이 사이드 프레임(2)의 내측벽(27)에 고정되어 있다.","Each of the brackets 14 is fixed to the inner wall 27 of the side frame 2 in such a form that the support shaft 14b is located above an upper surface of the side frame 2 and the support shaft 14b is faced toward an inner side of the loom (hereinafter, simply referred to as ""inner side"").",True,0.1885617524385452,0.9176382526029994,29,58,-29,151,288,-137
"다만, 그 장착 위치는, 상기 전후 방향에 관해서는, 지지 샤프트(14b)가 사이드 프레임(2)의 대략 중앙이 되어 있다.]","As for an attachment position, the support shaft 14b is located at a substantial center of the side frame 2 in the front and rear direction.",True,0.2812415063381195,0.8599663651095452,16,26,-10,69,140,-71
"[그리고, 각 종광 프레임 가이드(12)는, 그 브래킷(14)에서의 지지 샤프트(14b)의 선단부에 장착되는 형태로, 그 브래킷(14)을 통하여 대응하는 사이드 프레임(2)에 지지되어 있다.",Each of the heddle frame guides 12 is supported on the corresponding side frame 2 via the bracket 14 in a form of being attached to a tip end portion of the support shaft 14b of the bracket 14.,True,0.2841100096702575,0.8765225666900442,20,39,-19,106,193,-87
"따라서, 상기 폭 방향에서의 사이드 프레임(2)과 종광 프레임 가이드(12)의 위치 관계는, 사이드 프레임(2)의 내측벽(27)에서의 내측면(9)으로부터 대략 브래킷(14)분만큼 종광 프레임 가이드(12)가 이격하도록 되어 있다.]","Therefore, as for a positional relationship in the width direction between the side frame 2 and the heddle frame guide 12, the heddle frame guide 12 is spaced from an inner surface 9 of the inner wall 27 of the side frame 2 about by the bracket 14.",True,0.2519452571868896,0.8862315170902686,23,48,-25,129,248,-119
"[그 종광 프레임 가이드(12)는, 전술한 바와 같이 사이드 프레임(2)에 지지된 상태에 있어서, 상하 방향(연직(沿直) 방향)으로 간극을 두고 설치된 상태가 되는 2개의 안내부(12b)를 가지고 있다.",The heddle frame guide 12 has two guide portions 12b provided at an interval in an upper and lower direction (vertical direction) in a state where the heddle frame guide 12 is supported on the side frame 2 as described above.,True,0.2663897573947906,0.8777579305246522,24,41,-17,113,225,-112
"또한, 그 각 안내부(12b)는, 그 직기에 구비되는 복수 개의 종광 프레임(11)의 상하 이동을 안내하기 위한 복수의 안내홈을 가지고 있다.",Each of the guide portions 12b has a plurality of guide grooves for guiding up-and-down movement of a plurality of heddle frames 11 provided for the loom.,True,0.2661316394805908,0.8471589211114697,19,27,-8,79,154,-75
"그리고, 그 직기에 있어서는, 각 종광 프레임(11)은, 그 양 측부가 한 쌍의 종광 프레임 가이드(12, 12)의 안내홈에 안내되어 설치된 상태가 된다.]","In the loom, each of the heddle frames 11 is provided with both sides thereof being guided to the guide grooves of the pair of heddle frame guides 12 and 12.",True,0.3588043749332428,0.8174808460626194,21,31,-10,87,157,-70
"[이와 같이, 각 종광 프레임 가이드(12)에서의 안내홈의 위치가, 그 직기에서의 각 사이드 프레임(2) 측에 있어서, 종광 프레임(11)을 안내하는 위치가 된다.","In this way, a position of the guide groove of each of the heddle frame guides 12 is a position in which the heddle frame 11 is guided on a side of each of the side frames 2 of the loom.",True,0.2562536001205444,0.8809489640696166,20,41,-21,91,186,-95
"그리고, 그 안내 위치는, 상기와 같은 사이드 프레임(2)과 종광 프레임 가이드(12)의 위치 관계로부터, 사이드 프레임(2)(내측면(9))의 위치에 의해 획정된다.",The guide position is defined by a position of the side frame 2 (inner surface 9) due to the positional relationship between the side frame 2 and the heddle frame guide 12 as described above.,True,0.2904193103313446,0.8643722656417822,18,35,-17,92,191,-99
"따라서, 그 사이드 프레임(2)의 내측면(9)에서의 브래킷(14)을 장착하는 부분(면)이, 그 안내 위치를 구획하는 기준면(10)이 되어 있고, 그 기준면(10)의 상기 폭 방향에서의 위치가 상기 안내 위치를 구획하기 위한 기준이 되는 위치(기준 위치)가 된다.]","Therefore, a part (surface) of the inner surface 9 of the side frame 2, to which the bracket 14 is attached, is a reference surface 10 for defining the guide position, and a position of the reference surface 10 in the width direction becomes a position (reference position) becoming a reference for defining the guide position.",True,0.2021588385105133,0.9065434910061868,31,56,-25,147,327,-180
"[덧붙여서 말하면, 직기에 있어서는, 제직하는 직물(W)의 짜는 폭을 기준으로 하여 그 사양이 정해져 있다.","For reference, the specification of the loom is determined based on a weaving width of a fabric W to be woven.",True,0.2502603828907013,0.8214490047392285,14,21,-7,60,110,-50
"그리고, 그 직기에 탑재되는 종광 프레임(11)은, 그 직기의 사양(제직할 수 있는 최대의 짜는 폭)에 따른 폭으로 되어 있다.",The heddle frame 11 mounted on the loom has a width corresponding to the specification (the greatest weaving width that can be woven) of the loom.,True,0.2511846423149109,0.8406004728984288,18,26,-8,71,146,-75
"따라서, 이러한 종광 프레임(11)을 안내하기 위해 설치된 한 쌍의 종광 프레임 가이드(12, 12)를 지지하는 한 쌍의 사이드 프레임(2, 2)의 간격은, 그 종광 프레임(11)의 폭, 및 상기한 사이드 프레임(2)과 종광 프레임 가이드(12)의 위치 관계를 고려하여 설정된다.","Therefore, an interval between the pair of side frames 2 and 2 configured to support the pair of heddle frame guides 12 and 12 provided so as to guide the heddle frame 11 is set, taking into consideration a width of the heddle frame 11 and the positional relationship between the side frame 2 and the heddle frame guide 12.",True,0.212015762925148,0.9042016857128397,35,60,-25,156,323,-167
"그리고, 이와 같이 간격이 설정되는 한 쌍의 사이드 프레임(2, 2)에 포함되는 한 쌍의 상기한 기준면(10, 10)의 간격도, 그 사이드 프레임(2, 2)의 간격에 따라 획정된다.]",An interval between the pair of the reference surfaces 10 and 10 included in the pair of side frames 2 and 2 whose interval is set in such a way is also defined according to the interval between the side frames 2 and 2.,True,0.2830063700675964,0.8547337893107707,24,44,-20,102,219,-117
"[그리고, 그 한 쌍의 사이드 프레임(2, 2)을 연결하는 상기 4개의 빔재에 대하여, 그 중 2개의 빔재(3a, 3b)가 상기 전후 방향에서의 권취빔 측(8)에 배치되는 권취 측의 빔재(권취 측 빔재(3a, 3b))로서 형성되어 있고, 나머지 2개의 빔재(3c, 3d)가 상기 전후 방향에서의 경사 빔(6) 측에 배치되는 송출 측의 빔재(송출 측 빔재(3c, 3d))로서 설치되어 있다.","Further, as for the four beam members connecting the pair of side frames 2 and 2, the two beam members 3a and 3b are provided as beam members on the winding side (winding-side beam members 3a and 3b) arranged on the winding beam 8-side in the front and rear direction, and the two remaining beam members 3c and 3d are provided as beam members on the delivery side (delivery-side beam members 3c and 3d) arranged on the warp beam 6-side in the front and rear direction.",True,0.2616294920444488,0.8811284558604779,50,86,-36,217,468,-251
"권취 측 빔재(3a, 3b)는, 상하 방향으로 서로 위치를 상이하게 하여 배치되어 있고, 상측의 빔재(3a)가 소위 프론트 톱 스테이이며, 하측의 빔재(3b)가 소위 프론트 바텀 스테이이다.","The winding-side beam members 3a and 3b are arranged in different positions in the upper and lower direction, the upper beam member 3a is a so-called front top stay, and the lower beam member 3b is a so-called front bottom stay.",True,0.1783821880817413,0.9030138425107374,24,41,-17,106,228,-122
"또한, 송출 측 빔재(3c, 3d)도, 상하 방향으로 서로 위치를 상이하게 하여 배치되어 있고, 상측의 빔재(3c)가 소위 리어 톱 스테이이며, 하측의 빔재(3d)가 소위 리어 바텀 스테이이다.]","The delivery-side beam members 3c and 3d are also arranged in different positions in the upper and lower direction, the upper beam member 3c is a so-called rear top stay, and the lower beam member 3d is a so-called rear bottom stay.",True,0.2329207211732864,0.8732906170841792,25,42,-17,109,232,-123
"[그리고,프론트 톱 스테이(3a) 및 리어 톱 스테이(3c)는, 그 양 단부에 형성된 플랜지를 가지고 있다.","Note that, the front top stay 3a and the rear top stay 3c each have flanges formed at both end portions thereof.",True,0.3060705065727234,0.8330310376129044,14,22,-8,60,112,-52
"또한, 그 플랜지에는, 고정을 위한 볼트가 삽통(揷通)되는 관통공이 복수 형성되어 있다.",The flange is formed with a plurality of through-holes in which bolts for fixing are inserted.,True,0.4739359319210052,0.6684867070471799,11,16,-5,49,94,-45
"그리고, 프론트 톱 스테이(3a) 및 리어 톱 스테이(3c)는, 각 플랜지의 관통공에 삽통된 고정용 볼트가 대응하는 사이드 프레임(2)의 내측면(9)에 개구되도록 형성된 관통공에 삽통되고, 그 고정용 볼트에 너트가 나사 결합됨으로써, 각 사이드 프레임(2)(내측면(9))에 대하여 고정되어 있다.","The bolts for fixing inserted in the through-holes of each of the flanges are inserted into through-holes formed to open to the inner surface 9 of the corresponding side frame 2 and are screwed with nuts, so that the front top stay 3a and the rear top stay 3c are fixed to each of the side frames 2 (inner surfaces 9).",True,0.2604149580001831,0.8843694515301282,34,61,-27,165,318,-153
"이와 같이, 프론트 톱 스테이(3a) 및 리어 톱 스테이(3c)는, 각 사이드 프레임(2)의 내측면(9)에 고정됨으로써, 양 사이드 프레임(2, 2)을 연결하고 있다.]","In this way, the front top stay 3a and the rear top stay 3c are fixed to the inner surfaces 9 of each of the side frames 2, thereby connecting both the side frames 2 and 2.",True,0.1799292564392089,0.9203435958782104,20,37,-17,94,172,-78
"[또한, 프론트 바텀 스테이(3b) 및 리어 바텀 스테이(3d)는, 단면 형상이 대략 ""コ""자형의 빔재이며, 그 양 단부에 단부를 막도록 형성된 단벽(端壁)을 가지고 있다.",The front bottom stay 3b and the rear bottom stay 3d are each a beam member having a substantially U-shaped section and each have end walls formed at both end portions so as to close end portions.,True,0.4114018976688385,0.7857505094119995,22,37,-15,96,196,-100
"또한, 그 단벽에는, 고정을 위한 볼트가 삽입되는 관통공이 복수 형성되어 있다.",The end wall is formed with a plurality of through-holes in which bolts for fixing are inserted.,True,0.369338184595108,0.7373545835713815,11,17,-6,44,96,-52
"그리고, 프론트 바텀 스테이(3b) 및 리어 바텀 스테이(3d)는, 각 단벽의 관통공에 삽통된 고정용 볼트가 대응하는 사이드 프레임(2)의 내측면(9)에 개구되도록 형성된 관통공에 삽통되고, 그 고정용 볼트에 너트가 나사 결합됨으로써, 각 사이드 프레임(2)(내측면(9))에 대하여 고정되어 있다.","The bolts for fixing inserted in the through-holes of each of the end walls are inserted into through-holes formed to open to the inner surface 9 of the corresponding side frame 2 and are screwed with nuts, so that the front bottom stay 3b and the rear bottom stay 3d are fixed to each of the side frames 2 (inner surfaces 9).",True,0.2700588703155517,0.8790790878419301,34,62,-28,166,326,-160
"이와 같이, 프론트 바텀 스테이(3b) 및 리어 바텀 스테이(3d)는, 각 사이드 프레임(2)의 내측면(9)에 고정됨으로써, 양 사이드 프레임(2, 2)을 연결하고 있다.]","In this way, the front bottom stay 3b and the rear bottom stay 3d are fixed to the inner surfaces 9 of each of the side frames 2, thereby connecting both the side frames 2 and 2.",True,0.1979061067104339,0.9135882082003092,20,37,-17,96,178,-82
"[직기에서의 주축(16)은, 프론트 톱 스테이(3a)와 평행한 방향, 즉 직기의 폭 방향(이하, 간단히 「폭 방향」이라고 함)과 평행을 이루는 방향으로, 양 사이드 프레임(2, 2) 사이에 가설되는 형태로 설치되어 있다.","A main shaft 16 of the loom is provided in a form of being bridged between both the side frames 2 and 2 in a direction parallel to the front top stay 3a, i.e., a direction parallel to a width direction of the loom (hereinafter, simply referred to as ""width direction"").",True,0.2391776591539383,0.8912240731009373,27,51,-24,123,269,-146
"그리고, 그 주축(16)의 지지 위치는, 상기 전후 방향에 관해서는, 프론트 톱 스테이(3a)와 브래킷(14)(종광 프레임 가이드(12)) 사이의 위치로 되어 있고, 상하 방향에 관해서는, 그 상단(上端)(상부 에지)이 프론트 톱 스테이(3a)의 하면의 근방이 되는 위치로 되어 있다.]","Note that, a support position of the main shaft 16 is a position between the front top stay 3a and the bracket 14 (heddle frame guide 12) in the front and rear direction, and is a position in which an upper end (upper edge) thereof is located near a lower surface of the front top stay 3a, in the upper and lower direction.",True,0.256853312253952,0.8740100686324842,34,63,-29,160,323,-163
"[또한, 직기는, 바디(5)를 요동 구동하는 바디치기 기구를 구비하고 있다.",The loom also has a beating mechanism configured to rock a reed 5.,True,0.4507825076580047,0.6721228457168537,9,13,-4,42,66,-24
"그리고, 그 바디치기 기구에 있어서는, 바디(5)는, 복수의 슬레이 소드 등을 통하여 로킹 축(4)에 지지되어 있다.","In the beating mechanism, the reed 5 is supported on a rocking shaft 4 via a plurality of sley swords and the like.",True,0.2774010300636291,0.8235817765698501,15,23,-8,65,115,-50
"그리고, 그 로킹 축(4)은, 상기 폭 방향과 평행을 이루는 방향으로, 양 사이드 프레임(2, 2) 사이에 가설되는 형태로 설치되어 있다.","Further, the rocking shaft 4 is provided in a form of being bridged between both the side frames 2 and 2 in a direction parallel to the width direction.",True,0.2938412725925445,0.8615014735938042,19,29,-10,77,152,-75
"그리고, 그 로킹 축(4)의 지지 위치는, 상기 전후 방향에 관해서는, 전술한 주축(16)과 대략 동일한 위치로 되어 있고, 상하 방향에 관해서는, 주축(16)에 대한 상방으로서 프론트 톱 스테이(3a)와 중복되는 위치가 되어 있다.]","Note that, a support position of the rocking shaft 4 is substantially the same position as the main shaft 16 in the front and rear direction, and is a position above the main shaft 16 and overlapping the front top stay 3a in the upper and lower direction.",True,0.2942939698696136,0.8498460877678626,30,48,-18,131,255,-124
"[나아가서는, 그 직기는, 제직된 직포(W)를 직포 밀도에 따른 속도로 권취 빔(8) 측에 보내는 권취 기구를 구비하고 있다.",The loom also has a winding mechanism configured to send the manufactured woven fabric W toward the winding beam 8 at a speed corresponding to a woven fabric density.,True,0.3805919289588928,0.7421012583332699,17,29,-12,70,166,-96
"그리고, 그 권취 기구는, 복권 롤(15), 및 압압(押壓) 기구(도시하지 않음)에 의해 복권 롤(15)에 압압되도록 설치된 복수의 프레스 롤(35, 35)을 포함하고 있다.",The winding mechanism includes a cloth winding roll 15 and a plurality of press rolls 35 and 35 provided to be pressed against the cloth winding roll 15 by means of a pressing mechanism (not shown).,True,0.215991124510765,0.8695323738544527,21,36,-15,97,198,-101
"그리고, 그 복권 롤(15)은, 상기 폭 방향과 평행을 이루는 방향으로, 양 사이드 프레임(2, 2) 사이에 가설되는 형태로 설치되어 있다.","In addition, the cloth winding roll 15 is provided in a form of being bridged between both the side frames 2 and 2 in a direction parallel to the width direction.",True,0.3339806199073791,0.837640335452191,19,31,-12,78,162,-84
"그리고, 그 복권 롤(15)의 지지 위치는, 상기 전후 방향에 관해서는, 프론트 톱 스테이(3a)에 대하여 상기한 주축(16)과는 반대 측의 위치로 되어 있고, 상하 방향에 관해서는, 프론트 톱 스테이(3a)와 중복하는 위치로 되어 있다.]","Note that, a support position of the cloth winding roll 15 is a position on an opposite to the main shaft 16 with respect to the front top stay 3a in the front and rear direction, and is a position overlapping the front top stay 3a in the upper and lower direction.",True,0.270559161901474,0.8606294155282219,31,52,-21,134,265,-131
"[그리고, 전술한 바와 같이 양 사이드 프레임의 사이에 가설되는 주축(16), 로킹 축(4) 및 복권 롤(15)의 각 축 부재는, 지지축(16a, 4a, 15a)을 통하여 각 사이드 프레임(2, 2)에 지지되어 있다.","Each shaft member of the main shaft 16, the rocking shaft 4 and the cloth winding roll 15 bridged between both the side frames as described above is supported on each of the side frames 2 and 2 via each of support shafts 16a, 4a and 15a.",True,0.2705468833446502,0.8716629907713522,28,47,-19,121,237,-116
"[선회 프레임 (30) 은, 평판상의 바닥판 (31) 과, 전후 방향으로 연장되도록 바닥판 (31) 에 세워져 형성된 좌우 1 쌍의 제 1 세로판 (32) 및 제 2 세로판 (33) 과, 제 1 세로판 (32) 과 제 2 세로판 (33) 에 접속되고, 제 1 세로판 (32) 과 제 2 세로판 (33) 사이의 공간을 구획하는 접속 부재 (34) 를 구비하고 있다.]","The turning frame 30 includes a flat plate-shaped bottom plate 31, a left and right pair of a first vertical plate 32 and a second vertical plate 33 provided upright on the bottom plate 31 so as to extend in the front-rear direction, and a coupling member 34 connected to the first vertical plate 32 and the second vertical plate 33 and dividing a space between the first vertical plate 32 and the second vertical plate 33.",True,0.296347439289093,0.881054942471112,58,77,-19,204,423,-219
"[바닥판 (31) 은, 평면에서 봤을 때에 있어서 전단부가 좌우 방향으로 절취된 원형을 하고 있다.",The bottom plate 31 is circular with the front end cut out in the left-right direction on a plan view.,True,0.3218723833560943,0.8112647739103488,14,20,-6,55,102,-47
"제 1 세로판 (32) 및 제 2 세로판 (33) 은, 바닥판 (31) 상에 좌우로 간격을 두고 위치하며, 전후 방향으로 연장되도록 세워져 형성되어 있다.","The first vertical plate 32 and the second vertical plate 33 are located on the bottom plate 31 at an interval in the left-right direction, and are provided upright so as to extend in the front-rear direction.",True,0.2090965807437896,0.9078246476009906,23,37,-14,86,209,-123
"제 1 세로판 (32) 과 제 2 세로판 (33) 은, 후방으로 펼쳐지도록 배치되어 있다.",The first vertical plate 32 and the second vertical plate 33 are disposed to expand rearwardly.,True,0.1808764189481735,0.9142526307740556,14,16,-2,50,95,-45
"제 1 세로판 (32) 은, 선회 프레임 (30) 의 좌우 중앙보다 우측에 배치되고, 제 2 세로판 (33) 은, 선회 프레임 (30) 의 좌우 중앙보다 좌측에 배치되어 있다.","The first vertical plate 32 is disposed on the right side of the turning frame 30 from the center in the left-right direction, and the second vertical plate 33 is disposed on the left side of the turning frame 30 from the center in the left-right direction.",True,0.2101853042840957,0.91364116204922,27,47,-20,98,257,-159
"제 1 세로판 (32) 과 제 2 세로판 (33) 사이의 바닥판 (31) 에는, 스위블 조인트를 삽입하기 위한 조인트 개구부 (31a) 나 선회 모터 (61) 를 장착하기 위한 모터 장착부 (31b) 가 형성되어 있다.",The bottom plate 31 between the first vertical plate 32 and the second vertical plate 33 has a joint opening 31a into which a swivel joint is inserted and a motor mounting portion 31b for mounting the turning motor 61.,True,0.2098156213760376,0.9136391931074708,33,40,-7,122,218,-96
"또, 바닥판 (31) 에는, 배수용, 메인터넌스용의 그 밖의 복수의 개구가 형성되어 있다.]","In addition, a plurality of other openings for drainage and maintenance are formed through the bottom plate 31.",True,0.3264003098011017,0.7976932484115159,12,18,-6,51,111,-60
"[제 1 세로판 (32) 및 제 2 세로판 (33) 은, 그 하측 가장자리가 바닥판 (31) 의 상면에 용접되어 있다.",The first vertical plate 32 and the second vertical plate 33 have their lower edges welded to the upper surface of the bottom plate 31.,True,0.1695600599050521,0.9239345743864914,19,25,-6,66,135,-69
"제 1 세로판 (32) 의 전단부 (32a) 및 제 2 세로판 (33) 의 전단부 (33a) 는, 바닥판 (31) 보다 전방으로 돌출되고, 장착부 (35) 의 일부를 구성하고 있다.",A front end 32a of the first vertical plate 32 and a front end 33a of the second vertical plate 33 protrude forward from the bottom plate 31 and constitute a part of the mounting portion 35.,True,0.1648597121238708,0.9321507064933686,27,37,-10,101,190,-89
"제 1 세로판 (32) 의 후단부 (32b) 및 제 2 세로판 (33) 의 후단부 (33b) 는, 카운터 웨이트 장착부 (36) 에 접속되어 있다.",A rear end 32b of the first vertical plate 32 and a rear end 33b of the second vertical plate 33 are connected to a counterweight mounting portion 36.,True,0.1823312193155288,0.9233316600849008,23,29,-6,82,150,-68
"카운터 웨이트 장착부 (36) 는, 바닥판 (31) 의 후단부에 좌우 방향을 따라 형성되고, 카운터 웨이트 장착부 (36) 에는 카운터 웨이트 (67) 가 장착된다.]","The counterweight mounting portion 36 is provided on a rear end of the bottom plate 31 along the left-right direction, and a counterweight 67 is mounted on the counterweight mounting portion 36.",True,0.2612763345241546,0.8842310895521351,23,32,-9,93,194,-101
"[접속 부재 (34) 는, 조인트 개구부 (31a) 보다 후방에서 제 1 세로판 (32) 과 제 2 세로판 (33) 에 접속되어 있다.",The coupling member 34 is connected to the first vertical plate 32 and the second vertical plate 33 behind the joint opening 31a.,True,0.3049346208572387,0.8719795394480148,21,23,-2,75,129,-54
"접속 부재 (34) 는, 수평 방향을 따라 배치된 천판 (341) 과, 천판 (341) 의 전후 방향 양 단부로부터 하방으로 연장되는 전후 1 쌍의 전측판 (342) 및 후측판 (343) 을 갖는다.",The coupling member 34 has a top plate 341 disposed along the horizontal direction and a pair of a front side plate 342 and a rear side plate 343 extending downwardly from the both ends in the front-rear direction of the top plate 341.,True,0.2240881919860839,0.8970199252196139,30,44,-14,111,235,-124
"전측판 (342) 과 후측판 (343) 의 하단이 바닥판 (31) 에 고정되고, 전측판 (342) 과 후측판 (343) 은 바닥판 (31) 에 대하여 직립하고 있다.","The lower ends of the front side plate 342 and the rear side plate 343 are fixed to the bottom plate 31, and the front side plate 342 and the rear side plate 343 stand upright with respect to the bottom plate 31.",True,0.1206913739442825,0.9457245411436948,23,43,-20,92,212,-120
"즉, 하측이 개방된 단면 대략 U 자상의 접속 부재 (34) 는, 바닥판 (31) 과 제 1 세로판 (32) 과 제 2 세로판 (33) 과 함께, 박스형 구조체 (37) 를 형성한다.]","That is, the coupling member 34 having a substantially U-shaped cross section with the lower side open forms a box shape structure 37 together with the bottom plate 31, the first vertical plate 32, and the second vertical plate 33.",True,0.188169240951538,0.9125533787997318,30,40,-10,103,231,-128
"[제 1 세로판 (32) 에는, 제 1 개구부 (32c) 가 형성되어 있다.",A first opening 32c is formed in the first vertical plate 32.,True,0.3660354614257812,0.8145251323660682,12,12,0,42,61,-19
제 1 개구부 (32c) 는 제 1 세로판 (32) 의 하부에 절결 형성되어 있다.,The first opening 32c is formed by being notched on the lower part of the first vertical plate 32.,True,0.3146984279155731,0.8483918617233633,14,19,-5,46,98,-52
"제 1 개구부 (32c) 는, 접속 부재 (34) 의 우측에 형성되어 있고, 접속 부재 (34) 의 내부 공간과 연통되어 있다.]",The first opening 32c is formed on the right side of the coupling member 34 and is connected to an internal space of the coupling member 34.,True,0.1871374696493148,0.9162789604755882,20,27,-7,72,140,-68
"[제 2 세로판 (33) 에는, 제 2 개구부 (33c) 가 형성되어 있다.",A second opening 33c is formed through the second vertical plate 33.,True,0.3798940181732178,0.8076946520769841,12,12,0,42,68,-26
제 2 개구부 (33c) 는 제 2 세로판 (33) 의 하부에 절결 형성되어 있다.,The second opening 33c is formed by being notched on the lower part of the second vertical plate 33.,True,0.2686639726161957,0.8706785883488103,14,19,-5,46,100,-54
"제 2 개구부 (33c) 는, 접속 부재 (34) 의 좌측에 형성되어 있고, 접속 부재 (34) 의 내부 공간과 연통되어 있다.]",The second opening 33c is formed on the left side of the coupling member 34 and is connected to the internal space of the coupling member 34.,True,0.1782275438308715,0.9198437926511072,20,27,-7,72,141,-69
"[접속 부재 (34) 에는, 전방으로 개방되는 제 3 개구부 (34a) 가 형성되어 있다.",A third opening 34a open to the front is formed through the coupling member 34.,True,0.2689369618892669,0.8523399899800882,13,15,-2,50,79,-29
"제 3 개구부 (34a) 는, 전측판 (342) 에서 천판 (341) 에 걸쳐서 절결 형성되어 있다.]",The third opening 34a is formed by being notched from the front side plate 342 to the top plate 341.,True,0.269040435552597,0.8632747544638892,15,20,-5,57,100,-43
"[접속 부재 (34) 의 천판 (341) 은, 엔진 마운트 (601) (도 2 참조) 가 장착되는 프론트 엔진 지지부 (34b) 를 갖는다.",The top plate 341 of the coupling member 34 has a front engine support part 34b on which an engine mount 601 (see FIG. 2 ) is mounted.,True,0.1723415404558181,0.9178601556279512,21,28,-7,78,134,-56
"프론트 엔진 지지부 (34b) 는, 천판 (341) 의 좌우에 각각 형성되어 있다.","The front engine support parts 34b are formed on the right and left sides of the top plate 341, respectively.",True,0.1905447542667389,0.9045437579823395,12,20,-8,46,109,-63
"또, 바닥판 (31) 의 후부로서 카운터 웨이트 장착부 (36) 의 전방에는, 엔진 마운트 (601) 가 장착되는 1 쌍의 리어 엔진 지지부 (31c, 31c) 가 형성되어 있고, 엔진 (60) 은, 프론트 엔진 지지부 (34b) 와 리어 엔진 지지부 (31c) 에 의해 지지된다.]","In addition, at the rear part of the bottom plate 31 and in front of the counterweight mounting portion 36, a pair of rear engine support parts 31c and 31c on which the engine mount 601 is mounted are provided, and the engine 60 is supported by the front engine support part 34b and the rear engine support part 31c.",True,0.2046835273504257,0.9137025357194936,41,60,-19,158,316,-158
"[선회 프레임 (30) 의 전단부에는, 붐 브래킷 (4) 이 장착되는 장착부 (35) 가 전방으로 돌출되도록 형성되어 있다.","At the front end of the turning frame 30, a mounting portion 35 on which the boom bracket 4 is mounted is provided so as to protrude forward.",True,0.2154033482074737,0.8942116941528102,17,28,-11,69,141,-72
"장착부 (35) 는, 평면에서 봤을 때에 테이퍼상을 하고 있고, 그 전단부에, 도시가 생략된 추축 핀을 삽입하는 삽입공 (35a) 이 상하 방향으로 개구되어 있다.","The mounting portion 35 has a tapered shape on a plan view, and an insertion hole 35a through which a pivot pin, not shown, is inserted is opened in the vertical direction at the front end thereof.",True,0.2831389307975769,0.8465003424564584,23,37,-14,91,197,-106
"장착부 (35) 는, 서로 간격을 두고 배치된 상하 1 쌍의 스테이 (351, 352) 를 구비하고 있다.","The mounting portion 35 includes a pair of upper and lower stays 351, 352 spaced apart from each other.",True,0.2080359160900116,0.878028330035803,16,19,-3,59,103,-44
"1 쌍의 스테이 (351, 352) 는, 제 1 세로판 (32) 의 전단부 (32a) 와 제 2 세로판 (33) 의 전단부 (33a) 를 상하로부터 협지하고 있다.","The pair of stays 351, 352 sandwich the front end 32a of the first vertical plate 32 and the front end 33a of the second vertical plate 33 from above and below.",True,0.1932213753461837,0.9090771529719603,25,32,-7,91,160,-69
"하측의 스테이 (352) 는, 바닥판 (31) 의 전부 상면에 장착되고, 바닥판 (31) 의 전단부로부터 전방으로 돌출되어 있다.]",The lower stay 352 is attached to the front upper surface of the bottom plate 31 and protrudes forward from the front end of the bottom plate 31.,True,0.2788812220096588,0.8676213528765339,17,28,-11,73,145,-72
"[제 1 세로판 (32) 의 우측에는, 전후 방향을 따라 도시가 생략된 스윙 실린더가 배치된다.]","A swing cylinder, not shown, is disposed along the front-rear direction on the right side of the first vertical plate 32.",True,0.4532604515552521,0.7454042147022886,14,21,-7,54,121,-67
"[스윙 실린더는, 실린더 튜브가 선회 프레임 (30) 에 형성된 실린더 장착부 (38) 에 자유롭게 회동할 수 있도록 지지되고, 실린더 로드가 붐 브래킷 (4) 과 회동 가능하게 접속된다.","In the swing cylinder, a cylinder tube is rotatably supported by a cylinder mounting portion 38 formed in the turning frame 30, and a cylinder rod is rotatably connected to the boom bracket 4.",True,0.328340470790863,0.834558845393885,27,34,-7,105,192,-87
"실린더 로드를 신축시킴으로써, 붐 브래킷 (4) 을 좌우로 회동할 수 있다.","By extending and contracting the cylinder rod, the boom bracket 4 can be rotationally moved to the left and right.",True,0.3219111561775207,0.7785629192874846,11,20,-9,42,114,-72
"이것에 수반하여, 스윙 실린더는 실린더 장착부 (38) 를 중심으로 하여 좌우로 요동한다.]","Accordingly, the swing cylinder swings left and right around the cylinder mounting portion 38.",True,0.253972589969635,0.8486556424366384,12,14,-2,51,94,-43
"[제 2 세로판 (33) 의 좌측에는, 도시가 생략된 컨트롤 유닛이 배치된다.","A control unit, not shown, is disposed on the left side of the second vertical plate 33.",True,0.3467729985713959,0.7921285886513288,11,17,-6,43,88,-45
"컨트롤 유닛은, 유압 실린더 (스윙 실린더, 붐 실린더 (51a), 아암 실린더 (52a), 버킷 실린더 (53a), 블레이드 실린더) 와 유압 모터 (주행 모터 (22, 22), 선회 모터 (61)) 의 작동을 제어하는 각 컨트롤 밸브를 배치 형성한 것이다.]","The control unit has control valves that control operations of hydraulic cylinders (swing cylinder, boom cylinder 51a, arm cylinder 52a, bucket cylinder 53a, blade cylinder) and hydraulic motors (traveling motor 22, 22, turning motor 61) disposed.",True,0.1258424073457718,0.925028772729166,36,36,0,146,247,-101
"[제 1 세로판 (32) 의 우측에는, 도 4 에 나타내는 바와 같이, 작동유 탱크 (64) 가 배치된다.","As shown in FIG. 4, a hydraulic oil tank 64 is disposed on the right side of the first vertical plate 32.",True,0.2604893445968628,0.8693947633539886,17,22,-5,59,105,-46
"작동유 탱크 (64) 는, 유압 펌프 (63) 의 작동유를 저류하고 있고, 석션 호스 (65) 에 의해 유압 펌프 (63) 에 접속된다.",The hydraulic oil tank 64 stores the hydraulic oil of the hydraulic pump 63 and is connected to the hydraulic pump 63 by a suction hose 65.,True,0.1989538371562957,0.8953236204945063,21,27,-6,76,139,-63
"작동유 탱크 (64) 는, 선회 프레임 (30) 의 우단부의 전후 방향 중앙부에 배치된다.",The hydraulic oil tank 64 is disposed at the center part in the front-rear direction of the right end of the turning frame 30.,True,0.2707732319831848,0.8619939441512418,13,24,-11,50,126,-76
"작동유 탱크 (64) 의 하단부는, 바닥판 (31) 에 고정된다.]",The lower end of the hydraulic oil tank 64 is fixed to the bottom plate 31.,True,0.2704518437385559,0.8582791663091209,9,16,-7,37,75,-38
"[유압 펌프 (63) 는, 평면에서 봤을 때에 제 2 세로판 (33) 의 좌측에 흡인 포트 (63a) 를 구비한다.",The hydraulic pump 63 includes a suction port 63a on the left side of the second vertical plate 33 on a plan view.,True,0.2190296798944473,0.895738664773165,18,23,-5,64,114,-50
"석션 호스 (65) 의 일단부가 작동유 탱크 (64) 의 후면 하부에 접속되고, 석션 호스 (65) 의 타단부가 흡인 포트 (63a) 에 접속되어 있다.]","One end of the suction hose 65 is connected to the lower part of the rear surface of the hydraulic oil tank 64, and the other end of the suction hose 65 is connected to the suction port 63a.",True,0.2158201485872268,0.89557544817446,23,39,-16,86,190,-104
"[석션 호스 (65) 는, 엔진 (60) 의 하방에 배치된 박스형 구조체 (37) 의 내부를 통과하여 선회 프레임 (30) 을 좌우 방향으로 횡단하도록 배치되어 있다.",The suction hose 65 is disposed to cross the turning frame 30 in the left-right direction through the inside of the box shape structure 37 disposed below the engine 60.,True,0.2090474516153335,0.8933737777312879,24,30,-6,93,168,-75
"즉, 석션 호스 (65) 는, 작동유 탱크 (64) 로부터 박스형 구조체 (37) 를 통과하여 유압 펌프 (63) 에 이른다.]","In other words, the suction hose 65 runs from the hydraulic oil tank 64 through the box shape structure 37 to the hydraulic pump 63.",True,0.1915538161993026,0.894724853062806,19,25,-6,71,132,-61
"[이 때, 석션 호스 (65) 는, 제 1 개구부 (32c) 와 제 2 개구부 (33c) 를 삽입 통과한다.]","At this time, the suction hose 65 is inserted through the first opening 32c and the second opening 33c.",True,0.2647294402122497,0.8616683513689053,18,19,-1,61,103,-42
"[상부 선회체 (3) 는, 하부 주행체 (2) 에 대하여 선회 베어링 (39) (도 5 에 파선으로 나타낸다) 을 통하여 선회한다.",The upper turning body 3 turns with respect to the lower traveling body 2 via a turning bearing 39 (shown in dashed lines in FIG. 5 ).,True,0.2087142616510391,0.890133787811002,20,27,-7,73,134,-61
"선회 베어링 (39) 은, 선회 프레임 (30) 의 바닥면에 고정되어 있다.",The turning bearing 39 is fixed to the bottom surface of the turning frame 30.,True,0.1682610660791397,0.9095243910666332,11,15,-4,42,78,-36
"선회 프레임 (30) 의 바닥판 (31) 에는, 선회 베어링용의 그리스 공급구 (31d) 가 형성되어 있다.",A grease supply port 31d for the turning bearing is provided on the bottom plate 31 of the turning frame 30.,True,0.3304596245288849,0.8351829798002164,15,21,-6,60,108,-48
"그리스 공급구 (31d) 는, 제 2 세로판 (33) 의 좌측에 형성되어 있다.]",The grease supply port 31d is formed on the left side of the second vertical plate 33.,True,0.3027772605419159,0.8552166259007602,12,17,-5,45,86,-41
"[그리스 공급구 (31d) 에 그리스를 공급하기 위한 그리스 호스 (70) 는, 제 2 개구부 (33c) 와 제 3 개구부 (34a) 를 삽입 통과하여, 제 1 세로판 (32) 의 우측에 배치된 그리스 니플 (71) 에 이른다.",A grease hose 70 for supplying grease to the grease supply port 31d is inserted through the second opening 33c and the third opening 34a to a grease nipple 71 disposed on the right side of the first vertical plate 32.,True,0.3262142837047577,0.8626857233894566,35,41,-6,127,217,-90
"그리스 니플 (71) 로부터 주입된 그리스는, 그리스 호스 (70) 를 통하여 그리스 공급구 (31d) 에 도달하고, 선회 베어링 (39) 에 공급된다.]",The grease injected from the grease nipple 71 reaches the grease supply port 31d via the grease hose 70 and is supplied to the turning bearing 39.,True,0.3168422281742096,0.8307731197130054,21,27,-6,86,146,-60
"[이상과 같이 본 실시형태의 건설 기계 (1) 는, 하부 주행체 (2) 와, 하부 주행체 (2) 의 상방에서 선회 가능하게 형성된 상부 선회체 (3) 와, 상부 선회체 (3) 의 후부에 배치된 엔진 (60) 과, 상부 선회체 (3) 의 바닥부를 구성하고, 엔진 (60) 이 탑재되는 선회 프레임 (30) 을 구비하고,]","As described above, the construction machine body 1 of the present embodiment includes the lower traveling body 2, the upper turning body 3 provided capable of turning above the lower traveling body 2, the engine 60 disposed at the rear of the upper turning body 3, the turning frame 30 constituting the bottom part of the upper turning body 3 and on which the engine 60 is mounted, the turning frame 30 includes the bottom plate 31, the left and right pair of the first vertical plate 32 and the second vertical plate 33 provided upright on the bottom plate 31 so as to extend in the front-rear direction, and the coupling member 34 connected to the first vertical plate 32 and the second vertical plate 33 and dividing the space between the first vertical plate 32 and the second vertical plate 33, the coupling member 34 includes at least the top plate 341 and the front and rear pair of the front side plate 342 and the rear side plate 343 extending downwardly from the both ends in the front-rear direction of the top plate 341, and forms the box shape structure 37 together with the first vertical plate 32 and the second vertical plate 33, and the box shape structure 37 has the first opening 32c formed through the first vertical plate 32, the second opening 33c formed through the second vertical plate 33, and the front engine support part 34b formed in the top plate 341.",False,0.5673463940620422,0.7413097390925895,48,249,-201,178,1382,-1204
"[이 구성에 의하면, 선회 프레임 (30) 의 제 1 세로판 (32) 과 제 2 세로판 (33) 사이의 공간을 박스형 구조체 (37) 로 구획하게 되고, 각종 호스 등의 배관을 박스형 구조체 (37) 의 내부 공간을 이용하여 배색시킴으로써, 선회 프레임 (30) 의 강성을 저하시키지 않고, 엔진 (60) 의 하방을 통과하면서 선회 프레임 (30) 을 좌우 방향으로 횡단하여 배관을 배색시킬 수 있다.","According to this configuration, the space between the first vertical plate 32 and the second vertical plate 33 of the turning frame 30 is divided by the box shape structure 37, and the pipes can be routed across the turning frame 30 in the left-right direction while passing under the engine 60 without reducing the rigidity of the turning frame 30 by routing the pipes such as various hoses by using the internal space of the box shape structure 37.",True,0.264731764793396,0.880527826401065,59,80,-21,224,451,-227
"그 결과, 상부 선회체 (3) 에 있어서의 선회 프레임 (30) 의 강성을 확보하면서, 배관 레이아웃의 자유도를 높일 수 있다.","As a result, a degree of freedom of the piping layout can be increased while securing the rigidity of the turning frame 30 in the upper turning body 3.",True,0.266525387763977,0.8425691559066123,19,29,-10,71,151,-80
특히 보닛 (66) 의 내부가 좁은 소형의 건설 기계에 유용하다.],This is particularly useful for a small-sized construction machine with a narrow space inside the bonnet 66.,True,0.2471207380294799,0.8370118546273009,10,17,-7,37,108,-71
"[또, 박스형 구조체 (37) 에는, 전방으로 개방되는 제 3 개구부 (34a) 가 형성되어 있는 것이 바람직하다.]",The box shape structure 37 preferably has the third opening 34a which is open to the front formed.,True,0.242090031504631,0.871396997874438,16,18,-2,65,98,-33
"[박스형 구조체 (37) 의 전방에 제 3 개구부 (34a) 를 형성함으로써, 제 1 세로판 (32) 과 제 2 세로판 (33) 에 의해 격리된 기기를 보다 자유도를 높여 연결할 수 있다.]","By providing the third opening 34a in front of the box shape structure 37, devices isolated by the first vertical plate 32 and the second vertical plate 33 can be connected with a greater degree of freedom.",True,0.2514019906520843,0.8794387093597961,30,37,-7,106,206,-100
"[또, 건설 기계 (1) 는, 엔진 (60) 에 의해 구동되는 유압 펌프 (63) 와, 제 2 세로판 (33) 의 좌측에 배치된 유압 펌프 (63) 의 흡인 포트 (63a) 와, 제 1 세로판 (32) 의 우측에 배치된 작동유 탱크 (64) 를 구비하고, 흡인 포트 (63a) 와 작동유 탱크 (64) 를 접속시키는 석션 호스 (65) 는, 제 1 개구부 (32c) 와 제 2 개구부 (33c) 를 삽입 통과하고 있는 것이 바람직하다.]","The construction machine 1 also includes the hydraulic pump 63 driven by the engine 60, the suction port 63a of the hydraulic pump 63 disposed on the left side of the second vertical plate 33, and the hydraulic oil tank 64 disposed on the right side of the first vertical plate 32, and the suction hose 65 connecting the suction port 63a and the hydraulic oil tank 64 is preferably inserted through the first opening 32c and the second opening 33c.",True,0.193991869688034,0.9178983439772616,69,81,-12,244,448,-204
"[이 구성에 의하면, 엔진 (60) 의 하방을 통과하면서 선회 프레임 (30) 을 좌우 방향으로 횡단하여 석션 호스 (65) 등을 배색시킬 수 있기 때문에, 석션 호스 (65) 의 길이를 짧게 할 수 있고, 관로 저항 (흡인 저항) 을 줄일 수 있다.]","According to this configuration, the length of the suction hose 65 can be shortened and conduit resistance (suction resistance) can be reduced because the suction hose 65 and the like can be routed across the turning frame 30 in the left-right direction while passing under the engine 60.",True,0.2013705521821975,0.8868591837999735,40,48,-8,141,288,-147
"[또한, 종래의 석션 호스는, 작동유 탱크 (64) 로부터 엔진 (60) 의 후방을 통과하여 유압 펌프 (63) 까지 연장되어 있고, 엔진 (60) 의 오일 팬의 근처에 배치되어 있었다.",The conventional suction hose extends from the hydraulic oil tank 64 via the rear of the engine 60 to the hydraulic pump 63 and is located near an oil pan of the engine 60.,True,0.2182270288467407,0.8858786193311645,27,34,-7,104,172,-68
"본 실시형태의 건설 기계 (1) 에 의하면, 엔진 (60) 의 후방의 스페이스를 확대시킬 수 있기 때문에, 냉각풍의 통로를 확보할 수 있다.","According to the construction machine 1 of the present embodiment, the space behind the engine 60 can be expanded, so that a passage for cooling air can be secured.",True,0.1690298020839691,0.9001247519778754,21,29,-8,78,164,-86
"이로써, 냉각풍이 흐르기 쉬워져, 오일 팬을 식힐 수 있기 때문에, 엔진 (60) 의 히트 밸런스에도 공헌한다.]","As a result, a flow of cooling air can flow more easily and cool the oil pan, which contributes to the heat balance of the engine 60.",True,0.2488082200288772,0.826794417575727,16,27,-11,63,133,-70
"[또, 건설 기계 (1) 는, 제 1 세로판 (32) 의 우측에 배치된 그리스 니플 (71) 과, 제 2 세로판 (33) 의 좌측에 배치된 선회 베어링용의 그리스 공급구 (31d) 를 구비하고,]","The construction machine 1 also includes the grease nipple 71 disposed on the right side of the first vertical plate 32, the grease supply port 31d for the turning bearing disposed on the left side of the second vertical plate 33, and the grease hose 70 connecting the grease nipple 71 to the grease supply port 31d is preferably inserted through the second opening 33c and the third opening 34a.",True,0.382203459739685,0.8411836903114701,30,70,-40,109,396,-287
"[박스형 구조체 (37) 의 전방에 제 3 개구부 (34a) 를 형성함으로써, 제 1 세로판 (32) 과 제 2 세로판 (33) 에 의해 격리된 그리스 니플 (71) 과 그리스 공급구 (31d) 를 최적의 루트로 그리스 호스 (70) 로 연결할 수 있다.]","By providing the third opening 34a in front of the box shape structure 37, the grease hose 70 can be used to connect the grease nipple 71 and the grease supply port 31d isolated by the first vertical plate 32 and the second vertical plate 33 in an optimal route.",False,0.3438321650028229,0.8542027950026302,40,50,-10,143,262,-119
"[본 발명은, 상기 서술한 실시형태에 전혀 한정되는 것은 아니며, 본 발명의 취지를 일탈하지 않는 범위 내에서 다양한 개량 변경이 가능하다.]","The present invention is not limited to the above-described embodiment in any way, and various improvements and changes can be made within the scope not departing from the purpose of the present invention.",True,0.2711752951145172,0.7986367859444146,20,33,-13,79,205,-126
[1 : 건설 기계 2 : 하부 주행체 3 : 상부 선회체 4 : 붐 브래킷 5 : 작업기 30 : 선회 프레임 31 : 바닥판 31d : 그리스 공급구 32 : 제 1 세로판 32c : 제 1 개구부 33 : 제 2 세로판 33c : 제 2 개구부 34 : 접속 부재 34a : 제 3 개구부 341 : 천판 342 : 전측판 343 : 후측판 37 : 박스형 구조체 39 : 선회 베어링 60 : 엔진 63 : 유압 펌프 63a : 흡인 포트 64 : 작동유 탱크 65 : 석션 호스 70 : 그리스 호스 71 : 그리스 니플],1 Construction machine 2 Lower traveling body 3 Upper turning body 4 Boom bracket 5 Work machine 30 Turning frame 31 Bottom plate 31d Grease supply port 32 First vertical plate 32c First opening 33 Second vertical plate 33c Second opening 34 Coupling member 34a Third opening 341 Top plate 342 Front side plate 343 Rear side plate 37 Box shape structure 39 Turning bearing 60 Engine 63 Hydraulic pump 63a Suction port 64 Hydraulic oil tank 65 Suction hose 70 Grease hose 71 Grease nipple,True,0.3149579763412475,0.8508648906764907,103,86,17,297,487,-190
"돌기(411)와, 타측 파이프에 형성된 체결홈(20)에 삽입되는 타측 걸림","As illustrated in FIGS. 3 and 4, locking protrusions 411 inserted into fastening grooves 20 formed in the pipes facing each other may be formed on both sides of the first body part 410 in the width direction.",False,0.6728996038436887,0.6215440133218499,8,38,-30,41,208,-167
"돌기(411)가 형성되는 것이며, 이와 같이, 걸림","That is, the first body part 410 has one locking protrusion 411 inserted into the fastening groove 20 formed in one pipe and the other locking protrusion 411 inserted into the fastening groove 20 formed in the other pipe.",False,1.0145955085754397,0.3803829273782856,6,39,-33,28,221,-193
돌기(411)가 체결홈(20)에 삽입되면 이후 파이프 내부의 유체 압력에 의해 파이프가 축 방향으로 벌어지지 않도록 지지하게 된다.,"In this way, after the locking protrusions 411 are inserted into the fastening grooves 20, the pipe is supported so that the pipe is not widened in an axial direction due to the pressure of the fluid inside the pipe.",False,0.2680672407150268,0.8582922755289387,16,40,-24,73,216,-143
돌기(411)를 통해 형성되는 공간의 내부에는 파이프 내부를 흐르는 유체가 누설되는 것을 방지하도록 탄성을 갖는 제1 가스켓부(미도시)가 구비될 수 있다.,"Further, a first gasket part (not illustrated) having elasticity to prevent the fluid flowing inside the pipe from leaking may be provided inside a space defined by the first body part 410 and the locking protrusions 411.",False,0.3471632599830627,0.8123188005858629,19,37,-18,86,221,-135
"이때, 도 3에 도시된 바와 같이, 메인 파이프(100)와 제1 분기 파이프(200)는 상호 동일한 외경을 갖도록 형성되며, 한 쌍의 걸림","In this case, as illustrated in FIG. 3, the main pipe 100 and the first branch pipe 200 may be formed to have the same outer diameter, and the pair of locking protrusions 411 may be formed to have the same radius of curvature.",False,0.3193759620189667,0.8439659816758105,19,44,-25,77,226,-149
"즉, 본 발명의 일 실시예에 따른 제1 커플러(400)를 이용해서 동일한 외경을 갖는 메인 파이프(100)와 제1 분기 파이프(200)를 상호 연결할 수 있으며, 이러한 제1 커플러(400)에 형성된 걸림 돌기(411)는 메인 파이프(100)와 제1 분기 파이프(200)에 형성된 체결홈(20)의 외경에 대응되는 곡률 반경을 갖도록 형성됨으로써 간단한 방식으로 메인 파이프(100)와 제1 분기 파이프(200)를 상호 연결함과 동시에 유체 누설을 효과적으로 방지할 수 있게 된다.","That is, the main pipe 100 and the first branch pipe 200 may be interconnected using the first coupler 400 according to the embodiment of the present invention, the locking protrusions 411 formed in the first coupler 400 are formed to have the radius of curvature corresponding to the outer diameter of the fastening grooves 20 formed in the main pipe 100 and the first branch pipe 200, and thus the main pipe 100 and the first branch pipe 200 can be interconnected in a simple manner, and at the same time, the leakage of the fluid can be effectively prevented.",True,0.1899576634168625,0.9154611639116064,57,101,-44,268,562,-294
"또는, 도 4에 도시된 바와 같이, 제1 분기 파이프(200)와 제2 분기 파이프(300)는 상호 상이한 외경을 갖도록 형성되며, 한 쌍의 걸림","Alternatively, as illustrated in FIG. 4, the first branch pipe 200 and the second branch pipe 300 are formed to have different outer diameters, and among the pair of locking protrusions 411, one locking protrusion 411 may be formed to have the radius of curvature corresponding to the outer diameter of the first branch pipe 200, and the other locking protrusion 411 may be formed to have the radius of curvature corresponding to the outer diameter of the second branch pipe 300.",False,0.4444190859794616,0.7994104297145583,20,82,-62,80,479,-399
"즉, 본 발명의 다른 실시예에 따른 제1 커플러(400)를 이용해서 상이한 외경을 갖는 제1 분기 파이프(200)와 제2 분기 파이프(300)를 상호 연결할 수 있다.","That is, the first branch pipe 200 and the second branch pipe 300 having different outer diameters may be interconnected using the first coupler 400 according to another embodiment of the present invention.",False,0.1478971242904663,0.9323515863733411,22,33,-11,93,206,-113
"돌기(411)는 제1 분기 파이프(200)의 외경에 대응되는 곡률 반경을 갖도록 형성되고, 다른 하나의 걸림","In this case, the pair of locking protrusions 411 are formed on the first coupler 400, one locking protrusion 411 is formed to have the radius of curvature corresponding to the outer diameter of the first branch pipe 200, and the other one locking protrusion 411 is formed to have the radius of curvature corresponding to the outer diameter of the second branch pipe 300.",False,0.6154577136039734,0.6842459149258264,13,65,-52,60,371,-311
돌기(411)는 제2 분기 파이프(300)의 외경에 대응되는 곡률 반경을 갖도록 형성됨으로써 간단한 방식으로 제1 분기 파이프(200)와 제2 분기 파이프(300)를 상호 연결함과 동시에 유체 누설을 효과적으로 방지할 수 있게 된다.,"Thus, the first branch pipe 200 and the second branch pipe 300 may be interconnected in a simple manner and the leakage of the fluid can be prevented effectively.",False,0.4917329251766205,0.7600379505348261,28,29,-1,130,162,-32
"이때, 도 1 및 도 2에 도시된 바와 같이, 제1 분기 파이프(200)에는 제2 분기 파이프(300)의 단부에 인접하도록 일체로 연장되는 연장부(210)가 형성될 수 있다.","In this case, as illustrated in FIGS. 1 and 2, an extension part 210 integrally extending to be adjacent to the end of the second branch pipe 300 may be formed in the first branch pipe 200.",True,0.1501258909702301,0.9390104670404076,23,37,-14,97,189,-92
"만일 제1 분기 파이프(200)에 연장부(210)가 형성되지 않으면 제1 분기 파이프(200)와 제2 분기 파이프(300)를 연결하기 위해서 이들 사이에 복수의 다른 파이프가 구비되고, 이들 파이프를 모두 각각 연결해야 하는 번거로움이 있을 수 있으나, 이와 같이 제1 분기 파이프(200)에 연장부(210)가 형성되면 제1 커플러(400)를 이용해서 제1 분기 파이프(200)와 제2 분기 파이프(300)를 직접 연결할 수 있으므로 부품수가 감소하여 조립 공수 감소 및 시공 비용 절감이 가능하게 된다.","When the extension part 210 is not formed in the first branch pipe 200, a plurality of other pipes are provided between the first branch pipe 200 and the second branch pipe 300 to connect the first branch pipe 200 and the second branch pipe 300, and it is troublesome to connect all of these pipes.",False,0.3512777388095855,0.8508997764284009,62,56,6,282,298,-16
"이때, 제2 분기 파이프(300)로 공급되는 유체가 스프링클러(10)로 분기되도록 상호 연결하는 제2 커플러(500)를 더 포함할 수 있다.","In this case, the sprinkler system may further include a second coupler 500 that interconnects the second branch pipe 300 and the sprinkler 10 so that the fluid supplied to the second branch pipe 300 is branched off to flow to the sprinkler 10.",True,0.2954351603984833,0.8714294793761779,16,44,-28,78,244,-166
"즉, 제2 커플러(500)를 이용해서 제2 분기 파이프(300)에 스프링클러(10)를 간단한 방식으로 직접 고정하게 되므로 종래의 용접 방식과 비교할 때 조립 공수가 감소하고, 이를 통한 인건비 절감이 가능하게 된다.","That is, since the sprinkler 10 is directly fixed to the second branch pipe 300 using the second coupler 500 in a simple manner, the assembly man hours can be reduced, and labor costs can be reduced through this, as compared to the welding method according to the related art.",True,0.2652025818824768,0.8750598968961806,27,50,-23,121,276,-155
"도 5 내지 도 7에 도시된 바와 같이, 이러한 제2 커플러(500)는 제2 분기 파이프(300)에 형성된 분기홀(30)의 둘레를 감싸는 제2 바디부(510)와, 제2 분기 파이프(300)를 중심으로 제2 바디부(510)와 대향 배치되며, 제2 바디부(510)를 제2 분기 파이프(300)에 고정하는 제2 고정부(520), 및 제2 바디부(510)와 제2 분기 파이프(300)의 외주면 사이에 배치되어 제2 바디부(510)에 의해 가압되면서 분기되는 유체의 누설을 방지하는 제2 가스켓부(530)를 포함한다.","As illustrated in FIGS. 5 to 7, the second coupler 500 includes a second body part 510 that surrounds a circumference of the branch hole 30 formed in the second branch pipe 300, a second fixing part 520 that is disposed to be opposite to the second body part 510 with respect to the second branch pipe 300 and fixes the second body part 510 to the second branch pipe 300, and a second gasket part 530 that is disposed between the second body part 510 and an outer circumferential surface of the second branch pipe 300 and prevents the leakage of the fluid branched off while the fluid is pressed by the second body part 510.",True,0.1480747312307357,0.9480066127856792,56,117,-61,284,624,-340
"즉, 제2 고정부(520)를 이용해서 분기홀(30)의 둘레를 감싸는 제2 바디부(510)를 간단하게 고정하는 방식으로 설치하게 되므로 조립 공수가 감소하여 시공 비용이 절감되며, 제2 바디부(510)와 제2 분기 파이프(300)의 외주면 사이에 제2 가스켓부(530)가 구비되어 유체의 누설을 효과적으로 방지할 수 있게 된다.","That is, since the second body part 510 surrounding the circumference of the branch hole 30 is installed in a simple manner using the second fixing part 520, the assembly man hours can be reduced, and thus the construction cost can be reduced, and since the second gasket part 530 is provided between the second body part 510 and the outer circumferential surface of the second branch pipe 300, the leakage of the fluid can be effectively prevented.",True,0.1849968284368515,0.930481432425336,37,78,-41,182,449,-267
"이때, 스프링클러(10)로 공급되는 유체의 유량을 증가시키기 위해서는 제2 분기 파이프(300)에 형성된 분기홀(30)의 직경을 증가시킬 필요가 있으며, 이러한 경우에도 유체의 누설을 효과적으로 방지할 수 있도록 제2 바디부(510)에 의한 제2 가스켓부(530)의 가압 정도가 분기홀(30)에서 멀어질수록 증가하도록 구성된다.","In this case, in order to increase the flow rate of the fluid supplied to the sprinkler 10, an increase in the diameter of the branch hole 30 formed in the second branch pipe 300 is required, and even in this case, the degree of pressing of the second gasket part 530 by the second body part 510 increases as a distance from the branch hole 30 increases so as to effectively prevent the leakage of the fluid.",True,0.1991298496723175,0.9255090726508026,35,78,-43,183,408,-225
"이는 분기홀(30)의 직경이 증가하게 되면 유체의 누설 방지를 위한 제2 가스켓부(530)의 크기도 함께 증가하게 되는데, 제2 가스켓부(530)의 크기가 증가할 경우 제2 가스켓부(530)를 고르게 가압하는 것이 어려울 수 있다.","When the diameter of the branch hole 30 increases, the size of the second gasket part 530 for preventing the leakage of the fluid also increases.",True,0.337956041097641,0.8434861590618474,28,26,2,129,145,-16
"특히, 이러한 제2 가스켓부(530)의 둘레가 제2 분기 파이프(300)의 중심(c)에 인접하게 배치되는 정도까지 그 크기가 증가하는 경우에는 제2 가스켓부(530)를 고르게 가압하는 것이 더욱 어려울 수 있다.","In particular, when the size of the second gasket part 530 increases to the extent that a circumference of the second gasket part 530 is disposed adjacent to a center c of the second branch pipe 300, it may be more difficult to evenly press the second gasket part 530.",False,0.2035208940505981,0.9162470307340485,25,50,-25,118,268,-150
"이때, 제2 가스켓부(530)의 둘레가 제2 분기 파이프(300)의 중심(c)에 인접하게 배치되는 경우라는 것은, 도 6에 도시된 바와 같이, 제2 분기 파이프(300)의 분기홀(30)에 인접한 부분부터 제2 가스켓부(530)가 연장 형성되고, 제2 분기 파이프(300)의 둘레를 따라 하향 연장된 제2 가스켓부(530)의 둘레가 제2 분기 파이프(300)의 중심(c)을 관통하는 선에 인접하게 배치될 때까지 연장 형성되는 것을 의미한다.","In this case, a case in which the circumference of the second gasket part 530 is disposed adjacent to the center c of the second branch pipe 300 means that, as illustrated in FIG. 6, the second gasket part 530 extends starting from a portion adjacent to the branch hole 30 of the second branch pipe 300 and the circumference of the second gasket part 530 extending downward along a circumference of the second branch pipe 300 extends until the circumference of the second gasket part 530 is disposed adjacent to a line passing through the center c of the second branch pipe 300.",False,0.1767853498458844,0.9316113803557976,50,104,-54,245,578,-333
"즉, 이와 같은 경우에 제2 고정부(520)를 이용해서 제2 바디부(510)를 제2 분기 파이프(300)에 고정하게 되면 상하 방향으로 제2 고정부(520)의 체결력이 인가되므로 분기홀(30)에 인접하게 배치된 제2 가스켓부(530)는 상하 방향 체결력에 의해 분기홀(30) 둘레를 효과적으로 밀봉하게 되나, 제2 분기 파이프(300)의 중심(c)에 인접하게 배치되도록 하향 연장 형성된 제2 가스켓부(530)는 이러한 상하 방향 체결력이 인가되더라도 효과적으로 가압되지 않기 때문이다.","That is, in this case, when the second body part 510 is fixed to the second branch pipe 300 using the second fixing part 520, since a fastening force of the second fixing part 520 is applied vertically, the second gasket part 530 disposed adjacent to the branch hole 30 effectively seals the circumference of the branch hole 30 by the vertical fastening force, but the second gasket part 530 extending downward to be disposed adjacent to the center c of the second branch pipe 300 is not effectively pressed even when the vertical fastening force is applied.",False,0.1958672106266021,0.9325961062094776,54,98,-44,272,558,-286
"따라서 전술한 바와 같이, 제2 바디부(510)에 의한 제2 가스켓부(530)의 가압 정도가 분기홀(30)에서 멀어질수록 증가하도록 구성하게 되면 제2 가스켓부(530)의 둘레가 제2 분기 파이프(300)의 중심(c)에 인접하게 배치되는 정도까지 그 크기가 증가하는 경우에도 분기되는 유체의 누설을 효과적으로 방지할 수 있게 된다.","Thus, as described above, when the degree of the pressing of the second gasket part 530 by the second body part 510 increases as the distance from the branch hole 30 increases, even when the size of the second gasket part 530 increases to the extent that the circumference of the second gasket part 530 is disposed adjacent to the center c of the second branch pipe 300, the leakage of the branched fluid can be effectively prevented.",True,0.212733656167984,0.923703169227128,38,78,-40,185,434,-249
"이때, 도 5 내지 도 7에 도시된 바와 같이, 제2 바디부(510)에는 제2 고정부(520)가 관통 결합되는 플랜지(511)가 형성되되, 이러한 플랜지(511)에는 플랜지(511)의 하단이 제2 분기 파이프(300)의 중심(c)보다 상측에 위치하도록 제1 절단면(511a)이 형성될 수 있다.","In this case, as illustrated in FIGS. 5 to 7, a flange 511 through which the second fixing part 520 is coupled is formed in the second body part 510, and a first cut surface 511a may be formed on the flange 511 so that a lower end of the flange 511 is located above the center c of the second branch pipe 300.",True,0.1586956530809402,0.9443692987838862,32,64,-32,164,309,-145
"이와 같이, 플랜지(511)의 하단이 제2 분기 파이프(300)의 중심(c)보다 상측에 위치한다는 것은, 도 6에 도시된 바와 같이, 플랜지(511)의 하단이 제2 분기 파이프(300)의 중심(c)을 관통하는 선보다 일정 거리(d1)만큼 상측에 배치되는 것을 의미한다.","In this way, a state in which the lower end of the flange 511 is located above the center c of the second branch pipe 300 means that, as illustrated in FIG. 6, the lower end of the flange 511 is disposed above the line passing through the center c of the second branch pipe 300 by a predetermined distance d1.",True,0.2219726145267486,0.9107417693315872,30,61,-31,150,309,-159
"즉, 이와 같이 플랜지(511)에 제1 절단면(511a)이 형성되어 플랜지(511)의 하단이 제2 분기 파이프(300)의 중심(c)보다 상측에 위치하게 되면 제2 고정부(520)를 통한 체결력 인가","That is, in this way, when the first cut surface 511a is formed in the flange 511, and thus the lower end of the flange 511 is located above the center c of the second branch pipe 300, when the fastening force is applied through the second fixing part 520, the fastening force is applied so that the flange 511 moves downward, and at the same time, radially inward.",False,0.2839628756046295,0.8942997080536024,21,69,-48,110,365,-255
"시 이러한 플랜지(511)는 하향 이동하는 동시에 반경 방향 내측으로 이동하도록 체결력이 인가되며, 이를 통해 분기홀(30)에 인접 배치된 제2 가스켓부(530)는 상하 방향으로만 체결력이 인가되고, 제2 분기 파이프(300)의 중심(c)에 인접 배치되는 제2 가스켓부(530)는 상하 방향 체결력과 반경 방향 내측으로 체결력이 동시에 인가되는 것이다.","Thus, only the vertical fastening force is applied to a portion of the second gasket part 530 disposed adjacent to the branch hole 30, and the vertical fastening force and the radially inward fastening force are simultaneously applied to a portion of the second gasket part 530 disposed adjacent to the center c of the second branch pipe 300.",False,0.5598604083061218,0.7740522269902107,41,59,-18,197,342,-145
이러한 반경 내측 방향 체결력은 분기홀(30)에서 멀어질수록 증가하게 되므로 제2 바디부(510)에 의한 제2 가스켓부(530)의 가압 정도는 분기홀(30)에서 멀어질수록 증가하게 되어 제2 가스켓부(530)의 크기가 증가하는 경우에도 유체 누설을 효과적으로 방지할 수 있게 되는 것이다.,"Since the radially inward fastening force increases as the distance from the branch hole 30 increases, the degree of the pressing of the second gasket part 530 by the second body part 510 increases as the distance from the branch hole 30 increases, and thus even when the size of the second gasket part 530 increases, the leakage of the fluid can be effectively prevented.",True,0.2521422505378723,0.9005335090822667,33,65,-32,161,372,-211
"이때, 플랜지(511)에는 도 5 내지 도 7에 도시된 바와 같이, 제1 절단면(511a)보다 상측에 위치하도록 단차가 형성된 제2 절단면(511b)이 형성될 수 있다.","In this case, as illustrated in FIGS. 5 to 7, the flange 511 may have a second cut surface 511b formed with a step difference to be located above the first cut surface 511a.",True,0.1378196477890014,0.9333338315593088,21,34,-13,94,173,-79
"이와 같이, 제2 절단면(511b)이 제1 절단면(511a)보다 상측에 위치한다는 것은, 도 6에 도시된 바와 같이, 제1 절단면(511a)을 연결하는 선보다 일정 거리(d2)만큼 상측에 배치되는 것을 의미한다.","In this way, a state in which the second cut surface 511b is located above the first cut surface 511a means that, as illustrated in FIG. 6, the second cut surface 511b is located above a line connecting the first cut surface 511a by a predetermined distance d2.",True,0.179603174328804,0.9168478646901904,24,48,-24,118,261,-143
"이와 같이 제2 절단면(511b)을 형성하게 되면 플랜지(511)의 두께가 일부 감소하게 되어 도 7 및 도 8에 도시된 바와 같이, 플랜지(511)에 변형이 발생하기 쉽다.","In this way, when the second cut surface 511b is formed, the thickness of the flange 511 is partially reduced, and thus as illustrated in FIGS. 7 and 8, deformation of the flange 511 is likely to occur.",True,0.1017024740576744,0.9493959992301088,23,38,-15,97,202,-105
"이러한 플랜지(511)는 제2 고정부(520)를 통해 체결력 인가 전에는 최초 위치(ℓ1)에 배치되나, 이러한 상태에서 제2 고정부(520)를 통해 체결력을 인가하게 되면 일정 거리(△ℓ)만큼 플랜지(511)가 변형되면서 제2 가스켓부(530)를 하향 가압함과 동시에 일정 거리(△ℓ)만큼 반경 방향 내측으로 가압함으로써 제2 가스켓부(530)의 크기가 증가하는 경우에도 유체 누설을 효과적으로 방지할 수 있게 되는 것이다.","However, in this state, when the fastening force is applied through the second fixing part 520, as the flange 511 is deformed by a predetermined distance Δl, the second gasket part 530 is pressed downward and, at the same time, is pressed radially inward by the predetermined distance Δl.",False,0.5370897650718689,0.7882621577158268,47,49,-2,237,288,-51
"특히, 제2 절단면(511b)이 제1 절단면(511a)보다 상측에 위치함으로써 제2 고정부(520)의 체결력 인가 시 플랜지(511)를 통해 제2 가스켓부(530)를 반경 방향 내측으로 가압하는 것이 더욱 용이하게 된다.","In particular, since the second cut surface 511b is located above the first cut surface 511a, when the fastening force of the second fixing part 520 is applied, it becomes easier to press the second gasket part 530 radially inward through the flange 511.",True,0.2239642292261123,0.9121374894931824,24,44,-20,123,254,-131
"이때, 제2 바디부(510)에는 제2 가스켓부(530)를 가압하도록 제2 분기 파이프(300)의 외주면을 따라 연장되는 가압면(512)이 형성되되, 제2 가스켓부(530)와 가압면(512)은 플랜지(511)의 하단까지 연장 형성될 수 있다.","In this case, a pressing surface 512 extending along the outer circumferential surface of the second branch pipe 300 to press the second gasket part 530 may be formed in the second body part 510, and the second gasket part 530 and the pressing surface 512 may extend to the lower end of the flange 511.",True,0.201436772942543,0.9297656868558568,23,56,-33,134,302,-168
"전술한 바와 같이, 제2 고정부(520)의 체결력에 의해 플랜지(511)가 일부 변형되면서 제2 가스켓부(530)를 반경 방향 내측으로 가압하게 된다.","As described above, the flange 511 is partially deformed by the fastening force of the second fixing part 520 to press the second gasket part 530 radially inward.",True,0.194691002368927,0.9192369738958228,17,28,-11,84,162,-78
"즉, 제2 바디부(510)에는 제2 가스켓부(530)를 가압하는 가압면(512)을 형성하고, 제2 가스켓부(530)와 이러한 가압면(512)을 플랜지(511)의 하단까지 연장 형성하게 되면 플랜지(511)의 변형을 통한 가압력이 극대화 될 수 있고, 이를 통해 유체 누설을 효과적으로 방지할 수 있게 된다.","That is, when the pressing surface 512 pressing the second gasket part 530 is formed in the second body part 510, and the second gasket part 530 and the pressing surface 512 extend to the lower end of the flange 511, a pressing force through the deformation of the flange 511 can be maximized, and thus the leakage of the fluid can be effectively prevented.",True,0.2023540735244751,0.925303606973922,34,65,-31,171,357,-186
"이때, 제2 바디부(510)에는 분기홀(30)의 내주면으로 삽입되는 가이드 리브(513)가 형성될 수 있으며, 이를 통해 제2 바디부(510) 설치 시 위치가 안정적으로 고정될 수 있게 된다.","In this case, a guide rib 513 inserted into an inner circumferential surface of the branch hole 30 may be formed in the second body part 510, and thus when the second body part 510 is installed, the position of the second body part 510 can be stably fixed.",True,0.1953495591878891,0.9208030559229406,23,49,-26,107,256,-149
"즉, 제2 바디부(510)에 외력이 인가되더라도 제2 바디부(510)가 제2 분기 파이프(300)의 둘레를 따라 회전하는 것을 방지할 수 있게 되는 것이다.","That is, even when an external force is applied to the second body part 510, the second body part 510 can be prevented from rotating along the circumference of the second branch pipe 300.",True,0.2130874693393707,0.9137553950002036,19,34,-15,87,187,-100
"또한, 가이드 리브(513)가 형성됨으로써 제2 고정부(520)를 통한 체결 이후에는 분기되는 유체의 흐름을 효과적으로 안내하게 된다.","Further, since the guide rib 513 is formed, the flow of the branched fluid is effectively guided after the fastening through the second fixing part 520.",True,0.1729866117238998,0.913970617591258,15,26,-11,75,152,-77
"이때, 제2 고정부(520)는 제2 분기 파이프(300)의 외주면에 지지된 상태에서 체결력을 인가하는 제2 고정 부재(521)를 포함하고, 이러한 제2 고정 부재(521)는 제2 분기 파이프(300)의 외주면 일부를 감싸는 방식으로 지지되는 U 볼트를 사용할 수 있다.","In this case, the second fixing part 520 includes a second fixing member 521 that applies a fastening force while being supported on the outer circumferential surface of the second branch pipe 300, and the second fixing member 521 may adopt a U bolt supported in a manner that surrounds a portion of the outer circumferential surface of the second branch pipe 300.",True,0.134129136800766,0.9510889606839584,32,63,-31,150,364,-214
이와 같은 제2 고정 부재(521)를 제2 바디부(510)의 플랜지(511)에 관통 설치하여 체결력을 인가하게 되면 이러한 체결력에 의해 플랜지(511)는 하향 이동함과 동시에 반경 방향 내측으로 변형이 발생하게 된다.,"When the second fixing member 521 is installed to pass through the flange 511 of the second body part 510 and the fastening force is applied, the flange 511 is moved downward, and at the same time, is deformed radially inward by the fastening force.",True,0.2273277938365936,0.902638227984627,26,45,-19,122,249,-127
"즉, 도 9(a)에 도시된 바와 같이, 체결력이 인가되기 전에는 제2 가스켓부(530)의 전체 두께가 일정하게 형성되는데, 체결력이 인가된 이후에는 도 9(b)에 도시된 바와 같이, 제2 가스켓부(530)의 상단은 하향 가압되나, 제2 가스켓부(530)의 하단으로 갈수록 하향 가압됨과 동시에 반경 방향 내측으로도 가압되어 유체 누설을 효과적으로 방지할 수 있게 된다.","As illustrated in FIG. 9B, after the fastening force is applied, an upper end of the second gasket part 530 is pressed downward but the second gasket part 530 is pressed downward and, at the same time, is also pressed radially inward toward the lower end thereof.",False,0.4260061681270599,0.8137202453737123,46,47,-1,206,263,-57
"이때, 제2 분기 파이프(300)와 스프링클러(10)의 외경은 상호 동일하게 형성될 수 있다.","In this case, the outer diameter of the second branch pipe 300 and the outer diameter of the sprinkler 10 may be formed to be the same.",True,0.3277349174022674,0.8366232115327374,11,27,-16,52,135,-83
"즉, 분기되는 유체의 유량을 증가시킬 필요가 있는 경우 제2 분기 파이프(300)의 외경과 동일한 외경을 갖는 스프링클러(10)를 사용할 수 있으며, 이러한 경우 분기홀(30)의 직경도 함께 증가하게 되나, 전술한 바와 같이, 제2 고정부(520)의 체결력을 통한 플랜지(511)의 변형을 이용해서 제2 가스켓부(530)를 하향 가압함과 동시에 반경 방향 내측으로도 가압함으로써 유체 누설을 효과적으로 방지할 수 있게 된다.","That is, when an increase in the flow rate of the branched fluid is required, the sprinkler 10 having the same outer diameter as the outer diameter of the second branch pipe 300 may be used.",False,0.5399653315544128,0.7748457027021947,52,36,16,237,190,47
"본 발명의 일 실시예에 대하여 설명하였으나, 본 발명의 사상은 본 명세서에 제시되는 실시 예에 제한되지 아니하며, 본 발명의 사상을 이해하는 당업자는 동일한 사상의 범위 내에서, 구성요소의 부가, 변경, 삭제, 추가 등에 의해서 다른 실시 예를 용이하게 제안할 수 있을 것이나, 이 또한 본 발명의 사상범위 내에 든다고 할 것이다.","Although the embodiments of the present invention have been described above, the spirit of the present invention is not limited to the embodiments presented in the present specification.",False,0.7087213397026062,0.5054737934358613,49,28,21,185,186,-1
10 : 스프링클러 20 : 체결홈 30 : 분기홀 100 : 메인 파이프 200 : 제1 분기 파이프 210 : 연장부 300 : 제2 분기 파이프 400 : 제1 커플러 410 : 제1 바디부 411 : 걸림,"Those skilled in the art who understand the spirit of the present invention could easily propose other embodiments by adding, changing, omitting, adding, or the like of components within the same scope of the spirit.",False,1.2714204788208008,0.2323375786754276,37,35,2,118,216,-98
돌기 420 : 제1 체결부 500 : 제2 커플러 510 : 제2 바디부 511 : 플랜지 511a : 제1 절단면 511b : 제2 절단면 512 : 가압면 513 : 가이드 리브 520 : 제2 고정부 521 : 제2 고정 부재 530 : 제2 가스켓부,"Further, these other embodiments also belong to the scope of the spirit of the present invention.",False,1.240553379058838,0.2334570424619912,44,16,28,144,97,47
병렬 배터리 릴레이 진단 장치 및 방법{APPARATUS AND METHOD FOR DIAGNOSING PARALLEL BATTERY RELAY},[TECHNICAL FIELD],False,0.9734549522399902,0.298259409075064,14,2,12,81,17,64
본 발명은 병렬로 연결된 복수의 배터리 팩의 릴레이를 진단하기 위한 장치 및 방법에 관한 것이다.,The present disclosure relates to a device and method for diagnosing a relay of a plurality of battery packs connected in parallel.,True,0.1577098965644836,0.9070380776452548,15,22,-7,54,131,-77
최근 이차 전지에 대한 연구 개발이 활발히 이루어지고 있다.,"In recent years, research and development for secondary batteries have been actively conducted.",True,0.3204103112220764,0.7323932970477576,9,13,-4,33,95,-62
"여기서 이차 전지는 충방전이 가능한 전지로서, 종래의 Ni/Cd 전지, Ni/MH 전지 등과 최근의 리튬 이온 전지를 모두 포함하는 의미이다.","Here, the secondary battery is a battery capable of recharging and discharging, and in its meaning, includes all of the existing Ni/Cd battery, the Ni/MH battery, and the like and a recent lithium-ion battery.",True,0.2038828879594802,0.8723206038470288,19,34,-15,79,209,-130
"이차 전지 중 리튬 이온 전지는 종래의 Ni/Cd 전지, Ni/MH 전지 등에 비하여 에너지 밀도가 훨씬 높다는 장점이 있다, 또한, 리튬 이온 전지는 소형, 경량으로 제작할 수 있어서, 이동 기기의 전원으로 사용된다.","Among secondary batteries, lithium-ion batteries have the advantage of having much higher energy density than the existing Ni/Cd batteries and Ni/MH batteries.",False,0.3089556097984314,0.8082121851282014,32,22,10,122,159,-37
"또한, 리튬 이온 전지는 전기 자동차의 전원으로 사용 범위가 확장되어 차세대 에너지 저장 매체로 주목을 받고 있다.","In addition, the lithium-ion batteries have expanded their range of use to power sources for electric vehicles, making the batteries attract attention as a next-generation energy storage medium.",True,0.1789119839668274,0.8746816343799273,17,28,-11,64,194,-130
"또한, 이차 전지는 일반적으로 복수 개의 배터리 셀들이 직렬 및/또는 병렬로 연결된 배터리 모듈을 포함하는 배터리 팩으로 이용된다.","In addition, the secondary battery is generally used as a battery pack including a battery module in which a plurality of battery cells are connected in series and/or in parallel.",True,0.2127548605203628,0.8843065745908267,18,30,-12,73,179,-106
그리고 배터리 팩은 배터리 관리 시스템에 의하여 상태 및 동작이 관리 및 제어된다.,The state and operation of the battery pack are managed and controlled by a battery management system.,True,0.2576089203357696,0.8323070537026984,13,17,-4,46,102,-56
이러한 배터리 팩에는 포지티브 릴레이(positive relay)를 보호하기 위해 프리차지 릴레이(pre-charge relay)와 프리차지 저항(pre-charge resisor)을 포함하는 프리차지 회로를 사용한다.,The battery pack uses a pre-charge circuit that includes a pre-charge relay and a pre-charge resistor to protect a positive relay.,True,0.2143158167600631,0.8627663742907034,18,21,-3,122,130,-8
"그러나, 병렬로 연결된 배터리 팩 구조에서는 이러한 프리차지 회로가 중복되어 사용됨으로써 제조 비용의 상승과 불필요하게 복잡한 제어 로직이 적용되어야 하는 문제가 있었다.","However, in the parallel-connection battery pack structure, the pre-charge circuits are redundantly used, resulting in an increase in manufacturing cost and unnecessarily complex control logic to be applied.",True,0.2311646193265915,0.8472271719551675,22,28,-6,95,207,-112
"한편, 종래의 배터리 팩이 병렬로 연결된 구조에서는 하나의 배터리에 사용되는 릴레이 제어와 진단 로직을 사용하게 되면 병렬 팩 간에 간섭이 발생하게 되어 오진단이 발생하게 될 우려가 있다.","On the other hand, in the parallel-connection battery pack structure in the related art, if a relay control used for one battery and a diagnostic logic are used, interference may occur between packs connected in parallel, which may lead to misdiagnosis.",True,0.1755951195955276,0.8967162971494219,27,41,-14,105,253,-148
"본 발명은 상기와 같은 문제를 해결하기 위해 고안된 것으로서, 병렬로 연결되어 있는 배터리 팩의 프리차지 회로 구성을 최소화하여 비용을 절감하고 제어 로직을 단순화할 수 있으며, 병렬로 연결된 다른 배터리 팩의 간섭에 의한 영향을 고려하여 각 릴레이 상태에 따른 진단을 수행함으로써 오진단을 방지할 수 있는 배터리 릴레이 진단 장치 및 방법을 제공하는 것을 목적으로 한다.","The present disclosure has been made to solve the above-mentioned problems, and an object of the present disclosure is to provide a battery relay diagnostic device and method capable of reducing cost and simplifying a control logic by minimizing a configuration of a pre-charge circuit of battery packs connected in parallel, and preventing misdiagnosis by performing diagnosis according to a state of each relay in consideration of the effect of interference from other battery packs connected in parallel.",True,0.2062498927116394,0.8806024485622557,54,78,-24,208,507,-299
"본 발명의 일 실시 예에 따른 배터리 릴레이 진단 장치는 병렬로 연결된 복수의 배터리 팩과, 상기 복수의 배터리 팩과 부하 측 사이에 연결되어 상기 복수의 배터리 팩의 충방전을 제어하는 충방전 제어부를 포함하는 배터리 시스템을 진단하는 배터리 릴레이 진단 장치로서, 상기 배터리 팩은, 복수의 배터리 셀을 포함하는 배터리 셀 모듈; 및 상기 배터리 셀 모듈의 (+)단과 부하 측 사이에 구비된 제1 스위치와 상기 배터리 셀 모듈의 (-)단과 상기 부하 측 사이에 구비된 제2 스위치를 포함하는 스위칭부를 포함하고, 상기 배터리 릴레이 진단 장치는, 상기 스위칭부를 온/오프 제어함으로써 상기 배터리 셀 모듈에 인가되는 전류를 제어하는 스위칭 제어부를 포함하고, 상기 제1 스위치와 상기 제2 스위치의 온/오프 상태에 기초하여 상기 제1 스위치와 상기 제2 스위치에 대한 진단을 수행하는 진단부를 포함할 수 있다.","A battery relay diagnostic device according to an embodiment of the present disclosure is a battery relay diagnostic device for diagnosing a battery system including a plurality of battery packs connected in parallel, and a charge and discharge controller connected between the plurality of battery packs and a load part and controlling charge and discharge of the plurality of battery packs, the battery pack includes a battery cell module including a plurality of battery cells, and a switching unit including a first switch provided between a positive ((+)) terminal of the battery cell module and a load part and a second switch provided a negative ((-)) terminal of the battery cell module and the load part, and the battery relay diagnostic device includes a switching controller controlling a current applied to the battery cell module by controlling on/off of the switching unit and a diagnostic unit performing diagnosis on the first switch and the second switch based on an on/off state of the first switch and the second switch.",True,0.1455167084932327,0.926488418190015,117,169,-52,454,1039,-585
"본 발명의 일 실시 예에 따른 배터리 릴레이 진단 방법은 병렬로 연결된 복수의 배터리 팩과 부하 측 사이에 연결되어 상기 배터리 팩에 포함된 배터리 셀 모듈의 충방전을 제어하는 충방전 제어부와, 복수의 배터리 셀을 포함하는 배터리 셀 모듈과 상기 배터리 셀 모듈의 (+)단과 부하 측 사이에 구비된 제1 스위치와 상기 배터리 셀 모듈의 (-)단과 상기 부하 측 사이에 구비된 제2 스위치를 포함하는 스위칭부를 구비한 배터리 팩을 포함하는 배터리 시스템을 진단하기 위한 진단 방법으로서, 상기 제1 스위치와 상기 제2 스위치의 온/오프 상태에 기초하여 상기 제1 스위치와 상기 제2 스위치에 대한 진단을 수행하는 단계를 포함할 수 있다.","A battery relay diagnostic method according to an embodiment of the present disclosure is a diagnostic method for a battery system including a plurality of battery packs, the battery system including a charge and discharge controller connected between the battery packs connected in parallel and a load part and controlling charge and discharge of battery cell modules included in the battery packs, and the battery packs including the battery cell module including a plurality of battery cells and a switching unit including a first switch provided between a positive ((+)) terminal of the battery cell module and the load part and a second switch provided between a negative ((-)) terminal of the battery cell module and the load part, and the method includes performing diagnosis on the first switch and the second switch based on an on/off state of the first switch and the second switch.",True,0.1431500613689422,0.9272931137884292,94,146,-52,355,892,-537
"본 발명의 배터리 릴레이 진단 장치 및 방법에 의하면. 병렬로 연결되어 있는 배터리 팩의 프리차지 회로 구성을 최소화하여 비용을 절감하고 제어 로직을 단순화할 수 있으며, 병렬로 연결된 다른 배터리 팩의 간섭에 의한 영향을 고려하여 각 릴레이 상태에 따른 진단을 수행함으로써 오진단을 방지할 수 있다.","According to the battery relay diagnostic device and method, it is possible to reduce cost and simplify control logic by minimizing the configuration of the pre-charge circuit of battery packs connected in parallel, and to prevent misdiagnosis by performing diagnosis according to a state of each relay in consideration of the effect of interference from other battery packs connected in parallel.",True,0.1793601065874099,0.8956450447120737,44,61,-17,168,397,-229
도 1은 단일 배터리 제어 시스템의 구성을 나타내는 블록도이다.,FIG. 1 a block diagram illustrating a configuration of a single battery control system.,True,0.0878587886691093,0.9463148167154544,9,14,-5,35,87,-52
도 7은 본 발명의 일 실시 예에 따른 배터리 릴레이 진단 장치의 하드웨어 구성을 나타내는 도면이다.,FIG. 7 is a diagram illustrating a hardware configuration of a battery relay diagnostic device according to an embodiment of the present disclosure.,True,0.1190249919891357,0.9267636356192476,16,23,-7,56,148,-92
"이하, 첨부한 도면을 참조하여 본 발명의 다양한 실시 예들에 대해 상세히 설명하고자 한다.","Hereinafter, various embodiments of the present disclosure will be described in detail with reference to the accompanying drawings.",True,0.1198304742574691,0.9163794981937388,13,18,-5,50,131,-81
본 문서에서 도면상의 동일한 구성 요소에 대해서는 동일한 참조 부호를 사용하고 동일한 구성요소에 대해서 중복된 설명은 생략한다.,"In the present disclosure, the same reference numerals are used for the same elements in the drawings, and duplicate descriptions for the same elements are omitted.",True,0.2256087511777877,0.8393829964796645,17,26,-9,71,164,-93
"본 문서에 개시되어 있는 본 발명의 다양한 실시 예들에 대해서, 특정한 구조적 내지 기능적 설명들은 단지 본 발명의 실시 예를 설명하기 위한 목적으로 예시된 것으로, 본 발명의 다양한 실시 예들은 여러 가지 형태로 실시될 수 있으며 본 문서에 설명된 실시 예들에 한정되는 것으로 해석되어서는 아니 된다.","In various embodiments of the present disclosure disclosed herein, specific structural or functional descriptions are merely exemplary for the purpose of describing embodiments of the present disclosure, and various embodiments of the present disclosure may be implemented in various forms and should not be construed as being limited to the embodiments described herein.",True,0.1302800476551056,0.9141287819925848,46,53,-7,169,371,-202
"다양한 실시 예에서 사용된 ""제1"", ""제2"", ""첫째"", 또는 ""둘째"" 등의 표현들은 다양한 구성요소들을, 순서 및/또는 중요도에 상관없이 수식할 수 있고, 해당 구성 요소들을 한정하지 않는다.","As used in various embodiments, the terms such as ""first"", ""second"", ""the first"", or ""the second"" may modify various components, regardless of order and/or importance, but do not limit the components.",True,0.1562614738941192,0.8983531155890554,25,31,-6,109,200,-91
"예를 들면, 본 발명의 권리 범위를 벗어나지 않으면서 제1 구성 요소는 제2 구성 요소로 명명될 수 있고, 유사하게 제2 구성요소도 제1 구성 요소로 바꾸어 명명될 수 있다.","For example, without departing from the scope of the present disclosure, a first element could be termed a second element, and similarly, in reverse, a second element could be termed a first element.",True,0.1697090715169906,0.8904735827903933,27,33,-6,97,199,-102
"본 문서에서 사용된 용어들은 단지 특정한 실시 예를 설명하기 위해 사용된 것으로, 다른 실시 예의 범위를 한정하려는 의도가 아닐 수 있다.","The terms and phrases as used herein are merely provided to describe specific embodiments, and may not be intended to limit the scope of other embodiments.",True,0.19199800491333,0.8664880860252362,21,26,-5,77,155,-78
"단수의 표현은 문맥상 명백하게 다르게 뜻하지 않는 한, 복수의 표현을 포함할 수 있다.","A singular form is intended to include a plural form, unless the context clearly indicates otherwise.",True,0.2755769491195678,0.7825935790153266,13,16,-3,48,101,-53
기술적이거나 과학적인 용어를 포함해서 여기서 사용되는 모든 용어들은 본 발명의 기술 분야에서 통상의 지식을 가진 자에 의해 일반적으로 이해되는 것과 동일한 의미를 가질 수 있다.,"All terms, including technical or scientific terms, as used here, may have the same meaning as commonly understood by a person skilled in the art to which the present disclosure belongs.",True,0.1082633882761001,0.924171426522061,25,31,-6,99,186,-87
"일반적으로 사용되는 사전에 정의된 용어들은 관련 기술의 문맥 상 가지는 의미와 동일 또는 유사한 의미를 가지는 것으로 해석될 수 있으며, 본 문서에서 명백하게 정의되지 않는 한, 이상적이거나 과도하게 형식적인 의미로 해석되지 않는다.",Terms such as those defined in commonly-used dictionaries should be interpreted as having a meaning that is consistent with their meaning in the context of the relevant art and will not be interpreted in an idealized or overly formal sense unless expressly so defined here.,True,0.2266696840524673,0.8396275641296098,32,45,-13,130,273,-143
"경우에 따라서, 본 문서에서 정의된 용어일지라도 본 발명의 실시 예들을 배제하도록 해석될 수 없다.","In some cases, even terms defined here cannot be interpreted to exclude embodiments of the present disclosure.",True,0.2077989429235458,0.851583731536384,14,17,-3,55,110,-55
도 1은 단일 배터리 제어 시스템의 구성을 나타내는 블록도이다.,FIG. 1 is a block diagram illustrating a configuration of a single battery control system.,True,0.0790094435214996,0.9517267375050232,9,15,-6,35,90,-55
"도 1을 참조하면, 본 발명의 일 실시 예에 따른 배터리팩(1)과 상위 시스템에 포함되어 있는 상위 제어기(2)를 포함하는 배터리 제어 시스템을 개략적으로 나타낸다.","Referring to FIG. 1, a battery control system including a battery pack 1 according to an embodiment of the present disclosure and an upper-level controller 2 included in an upper-level system is schematically illustrated.",True,0.1413047015666961,0.9263627940453198,22,34,-12,92,221,-129
"도 1에 도시된 바와 같이, 배터리 팩(1)은 하나의 이상의 배터리 셀로 이루어지고, 충방전 가능한 배터리 모듈(10)과, 배터리 모듈(10)의 (+) 단자 측 또는 (-) 단자 측에 직렬로 연결되어 배터리 모듈(10)의 충방전 전류 흐름을 제어하기 위한 스위칭부(14)와, 배터리 팩(1)의 전압, 전류, 온도 등을 모니터링하여, 과충전 및 과방전 등을 방지하도록 제어 관리하는 배터리 관리 시스템(20)을 포함한다.","As illustrated in FIG. 1, the battery pack 1 may be made of one or more battery cells, and may include a rechargeable battery module 10, a switching unit 14 connected to a (+) terminal or a (-) terminal of the battery module 10 in series to control a charge and discharge current flow of the battery module 10, and a battery management system 20 for controlling and managing by monitoring voltage, current, temperature, or the like of the battery pack 1 to prevent over-charging, over-discharging, or the like.",True,0.1328063756227493,0.9309089419197156,53,89,-36,234,510,-276
"여기서, 스위칭부(14)는 배터리 모듈(10)의 충전 또는 방전에 대한 전류 흐름을 제어하기 위한 스위칭 소자로서, 대개는 릴레이를 사용하지만 반도체 스위칭 소자도 포함한다.","Here, the switching unit 14 is a switching element for controlling a current flow for charging or discharging of the battery module 10, and generally uses a relay, but may include a semiconductor switching element.",True,0.1755002290010452,0.8980351921130488,21,35,-14,97,214,-117
"예를 들면, 적어도 하나의 릴레이 또는 하나의 MOSFET이 사용될 수 있다.","For example, at least one relay or one metal-oxide-semiconductor field-effect transistor (MOSFET) may be used.",True,0.2388071417808532,0.8435167621452575,11,15,-4,43,110,-67
"또한, BMS(20)는, 배터리의 안전성을 확보하기 위해 배터리 팩(1)의 전압, 전류, 온도 등을 모니터링 할 수 있으며, 이를 위해 직접적으로 값을 받거나 센서(12)를 이용하여 배터리 팩의 전류, 전압, 온도 등을 측정할 수 있다.","In addition, the battery management system (BMS) 20 may monitor the voltage, current, temperature, or the like, of the battery pack 1 in order to ensure the safety of the battery, and to this end, may directly receive the values or use a sensor 12 to measure the current, voltage, temperature, or the like, of the battery pack.",True,0.1284725964069366,0.9270101364161656,32,58,-26,132,327,-195
"BMS(20)는 상술한 각종 파라미터를 측정한 값을 입력받는 인터페이스로서, 복수의 단자와, 이들 단자와 연결되어 입력받은 값들의 처리를 수행하는 회로 등을 포함할 수 있다.","The BMS 20 may be an interface for receiving values obtained by measuring the above-mentioned various parameters, and may include a plurality of terminals, a circuit connected to the terminals to process input values, or the like.",True,0.1847946345806121,0.8879968239938874,22,37,-15,97,230,-133
"또한, BMS(20)는, 스위칭 소자(14), 예를 들면, 릴레이 또는 MOSFET의 ON/OFF를 제어할 수도 있으며, 배터리 모듈(10)에 연결되어 배터리 모듈(10)의 상태를 감시할 수 있다.","In addition, the BMS 20 may control ON/OFF of the switching element 14, for example, a relay or a MOSFET, and may be connected to the battery module 10 to monitor the status of the battery module 10.",True,0.0873395875096321,0.9518891353291696,22,38,-16,110,199,-89
상위 제어기(2)는 BMS(20)로 배터리 모듈에 대한 제어 신호를 전송할 수 있다.,The upper-level controller 2 may transmit a control signal for the battery module to the BMS 20.,True,0.1196333393454551,0.9282214330199674,11,17,-6,47,96,-49
"이에 따라, BMS(20)는 상위 제어기로부터 인가되는 신호에 기초하여 동작이 제어될 수 있을 것이다.","Accordingly, the operation of the BMS 20 may be controlled based on the signal applied from the upper-level controller.",True,0.1308350712060928,0.9166630180398112,13,19,-6,57,119,-62
본 발명의 배터리 셀이 ESS(Energy Storage System) 또는 차량 등에 이용되는 배터리 팩에 포함된 구성일 수 있다.,"The battery cell described in the present disclosure may be included in a battery pack used in an energy storage system (ESS), a vehicle, or the like.",True,0.2292448431253433,0.866950531936583,17,27,-10,74,150,-76
"다만, 이러한 용도에 한정되는 것은 아니다.","However, it is not limited to the above-mentioned uses.",True,0.2846104800701141,0.7746748104810104,6,9,-3,24,55,-31
"이와 같은 배터리 팩(1)의 구성 및 BMS(20)의 구성은 공지된 구성이므로, 보다 구체적인 설명은 생략하기로 한다.","The configuration of the battery pack 1 and the configuration of the BMS 20 are known, and thus a more detailed description will be omitted.",True,0.1329234689474105,0.9200733661444926,15,25,-10,66,140,-74
도 2는 본 발명의 일 실시 예에 따른 배터리 릴레이 진단 장치를 포함하는 배터리 시스템의 구성을 나타내는 블록도이다.,FIG. 2 is a block diagram illustrating a configuration of a battery system including a battery relay diagnostic device according to an embodiment of the present disclosure.,True,0.1120634377002716,0.937818062606832,18,27,-9,66,172,-106
"도 2를 참조하면, 본 발명의 일 실시 예에 따른 배터리 시스템(200)은 복수의 배터리 팩(210), 충방전 제어부(220) 및 배터리 릴레이 진단 장치(230)를 포함할 수 있다.","Referring to FIG. 2, a battery system 200 according to an embodiment of the present disclosure may include a plurality of battery packs 210, a charge and discharge controller 220, and a battery relay diagnostic device 230.",True,0.0835505947470665,0.9567675444451904,24,37,-13,102,222,-120
"복수의 배터리 팩(210)은 병렬로 연결되고, 각각이 충방전 제어부(220)와 접속되어 있을 수 있다.","The plurality of battery packs 210 may be connected in parallel, and each may be connected to the charge and discharge controller 220.",True,0.133324310183525,0.9211978208964208,12,23,-11,57,134,-77
반도체 모듈{SEMICONDUCTOR MODULE},BACKGROUND,False,0.9466142654418944,0.2211034734676367,3,1,2,28,10,18
[전력 전자 애플리케이션에 사용되는 트랜지스터는 일반적으로 실리콘(Si) 반도체 재료로 제조된다.,Transistors used in power electronic applications are typically fabricated with silicon (Si) semiconductor materials.,True,0.1667697131633758,0.88177350129495,10,14,-4,54,117,-63
"전력 애플리케이션을 위한 일반적인 트랜지스터 소자는 Si CoolMOS®, Si Power MOSFET 및 Si 절연 게이트 바이폴라 트랜지스터(Insulated Gate Bipolar Transistor: IGBT)를 포함한다.","Common transistor devices for power applications include Si CoolMOS®, Si Power MOSFETs, and Si Insulated Gate Bipolar Transistors (IGBTs).",True,0.1315932720899582,0.9202776116364628,22,19,3,128,138,-10
이들 트랜지스터 소자는 함께 연결되어 회로 또는 회로부를 제공할 수 있다.,These transistor devices may be connected together to provide circuits or sections of circuits.,True,0.1931950896978378,0.8865488745968373,11,14,-3,41,95,-54
"예를 들어, 2개의 트랜지스터 소자가 전기적으로 연결되어 하프 브리지 회로(half-bridge circuit)를 형성할 수 있다.","For example, two transistor devices may be electrically connected to form a half-bridge circuit.",True,0.1814507693052292,0.901356428762866,14,14,0,73,96,-23
이러한 회로는 일반적으로 트랜지스터를 스위칭하는 데 사용될 수 있는 게이트 드라이버 회로를 포함하는 제어 회로를 필요로 한다.],Such circuits typically require control circuitry including gate driver circuitry which may be used to switch the transistors.,True,0.2123168110847473,0.870643035269484,17,18,-1,71,126,-55
[하프 브리지 회로를 형성하도록 결합된 2개의 트랜지스터 소자 및 제어 회로를 갖는 소자는 파워 스테이지로 지칭될 수 있는 단일 반도체 패키지 내에 수용될 수 있다.,Two transistor devices coupled to form a half-bridge circuit and a device with control circuitry may be accommodated within a single semiconductor package which may be referred to as a power stage.,True,0.3144188821315765,0.8379251875347822,25,32,-7,92,197,-105
패키지 또는 모듈에서 소자들 사이를 접속하는 데에는 패키지 내 사용 가능한 공간이 제한되어 있기 때문에 몇 가지 문제가 있다.,Providing the connections between the devices in a package or module has some challenges due to the limited space available space within the package.,True,0.1753411144018173,0.8863484960628969,19,24,-5,70,149,-79
EP 2 463 904 A2는 패키지의 리드프레임이 전기적 상호접속을 위해 활용되는 멀티칩 파워 쿼드 플랫 노-리드(Power Quad Flat No-lead) 패키지를 개시한다.,EP 2 463 904 A2 discloses a multi-chip Power Quad Flat No-lead package in which a leadframe of the package is utilized for electrical interconnections.,True,0.1731970161199569,0.8871147366427973,21,25,-4,100,151,-51
"그러나, 하나 이상의 반도체 소자를 포함하는 패키지에 대한 개선이 바람직하다.]","However, improvements to packages including more than one semiconductor device are desirable.",True,0.2967843413352966,0.7872463495517171,10,12,-2,44,93,-49
"[본 발명에 따르면, 반도체 모듈은 로우측 스위치, 하이측 스위치 및 제어 칩을 포함한다.","According to the invention, a semiconductor module is provided that comprises a low side switch, a high side switch and a control chip.",True,0.2846737504005432,0.8360694721965596,13,23,-10,50,135,-85
"로우측 스위치와 하이측 스위치는 횡방향으로 서로 인접하게 배열되고, 스위치 노드 커넥터에 의해 결합되어 하프 브리지 회로를 형성한다.",The low side switch and the high side switch are arranged laterally adjacent one another and coupled by a switch node connector to form a half bridge circuit.,True,0.2476973831653599,0.8669660466676156,17,28,-11,74,158,-84
"스위치 노드 커넥터는, 로우측 스위치 및 하이측 스위치에 대한 배열을 가지며 단면적을 각각 갖는 둘 이상의 브랜치를 포함한다.",The switch node connector comprises two or more branches that have an arrangement with respect to the low side switch and to the high side switch and that each have a cross-sectional area.,True,0.31191286444664,0.835730097269644,18,33,-15,70,188,-118
둘 이상의 브랜치의 배열 및 단면적은 스위치 노드 커넥터 내의 전류 밀도 분포를 균일화하도록 선택된다.],The arrangement and the cross-sectional area of the two or more branches are selected so as to homogenise the current density distribution within the switch node connector.,True,0.2681686878204345,0.8432169199019065,15,27,-12,58,172,-114
"[브랜치의 배열은 모듈 내에서의 횡방향 형상 및 라우팅, 예를 들어 브랜치가 로우측 스위치와 하이측 스위치 사이에 직접 경로 또는 간접 경로를 갖는지 여부를 포함하고, 결과적으로, 이들의 길이 및 로우측 스위치 및 하이측 스위치의 위치와 관련한 모듈 내에서의 이들의 위치, 예컨대 로우측 스위치 및 하이측 스위치에 대한 각 브랜치의 두 단부의 위치를 포함한다.]","The arrangement of the branches includes their lateral shape and routing within the module, for example whether a branch has a direct route or an indirect route between the low side switch and the high side switch and, consequently, their length, as well as their position within the module in relation to the position of the low side switch and high side switch, e.g. the position of the two ends of each branch with respect to the low side switch and high side switch.",True,0.2676392793655395,0.8586243681224283,52,84,-32,202,470,-268
"[이들 둘 이상의 브랜치의 사용으로, 반도체 모듈은 2개의 트랜지스터 소자 사이의 스위치 노드 접속에서 보다 균일한 전류 흐름을 갖는 파워 스테이지를 제공한다.","Due to the use of these two or more branches, the semiconductor module provides a power stage with a more homogeneous current flow in the switch node connection between the two transistor devices.",True,0.2854657471179962,0.8415731484743258,22,33,-11,89,196,-107
"또한, 이로 인해 전력 손실 및 패키지 저항이 감소될 수 있다.",This in turn can lead to a decrease of power losses and package resistance.,True,0.1477175652980804,0.8913753848603239,11,14,-3,35,75,-40
"전류 흐름을 균질화하고 보다 균일하게 하기 위해, 2개의 브랜치의 사용을 통해 스위치 노드 커넥터의 저 전류 밀도 영역이 추가적인 ""브리지"" 또는 2차 전류 경로에 의해 접속된다.","In order to homogenise current flow and make it more uniform, low current density areas of the switch node connector are connected by an additional a ""bridge"" or secondary current path through the use of the two branches.",True,0.1846431791782379,0.8990538592738588,26,38,-12,100,221,-121
"2개의 경로 및 브랜치는, 전류 흐름을 밸런싱하고 전력 손실 밀도 분포를 보다 균일하게 하기 위해, 스위치 노드 커넥터 내의 개구에 의해 분리될 수 있다.",The two paths and branches may be separated by an opening in the switch node connector to balance current flow and to make power loss density distribution more homogeneous.,True,0.2031629085540771,0.8810761737724909,24,29,-5,86,172,-86
트랜지스터 소자의 상이한 영역들 사이의 둘 이상의 브랜치 또는 전도성 경로는 하이측 스위치가 온으로 전환되고 로우측이 오프로 전환될 때 발행할 수 있는 스위치 노드 커넥터의 비균일 DC 전류 분포를 밸런싱하고 평활화하는 것과 DC 전력 손실 밀도 분포에서 핫스팟을 제거하는 것에 도움이 된다.,The two or more branches or conductive paths between different regions of the transistor devices assist in balancing and smoothing out non-homogeneous DC current distributions in the switch node connector which may occur as the high side switch is switched on and the low side is switched off and to remove hot spots in the DC power loss density distribution.,True,0.1788255274295807,0.9064211474765757,42,60,-18,163,359,-196
"전류 밀도 분포의 불균일성은 와전류의 발생으로 인해 스위칭 주파수의 증가에 따라 증가하는 경향이 있으므로, 반도체 모듈은 MHz 범위의 드라이버 주파수를 갖는 소자에 특히 유용할 수 있다.]","Since non-uniformities in the current density distribution tend to increase with an increase in switching frequency due to the generation of eddy currents, the semiconductor module may be useful for devices with a driver frequency in the MHz range.",True,0.2571832835674286,0.836491838946454,26,39,-13,106,248,-142
"[일부 실시예에서, 스위치 노드 커넥터는 로우측 스위치 상에 배열되는 제1 부분과, 하이측 스위치 상에 배열되는 제2 부분과, 제1 부분과 상기 제2 부분 사이에서 연장되는 둘 이상의 브랜치를 포함한다.","In some embodiments, the switch node connector comprises a first portion that is arranged on the low side switch, a second portion that is arranged on the high side switch and the two or more branches extend between the first portion and the second portion.",True,0.2318347990512848,0.8964634332075345,28,45,-17,113,257,-144
둘 이상의 브랜치는 서로 이격된다.,The two or more branches are spaced apart from one another.,True,0.5094059705734253,0.6443809274843197,5,11,-6,19,59,-40
"이 실시예에서, 제1 및 제2 브랜치는 공통의 제1 및 제2 부분 사이에서 연장되며, 이는 스위치 노드 커넥터의 반대편 말단부들을 제공하고, 제1 및 제2 부분 사이 및 로우측 스위치 및 하이측 스위치 사이에 상이한 경로를 갖는 2개의 개별 도체를 제공한다.]","In this embodiment, the first and second branches extend between the common first and second portions, which provide opposing distal portions of the switch node connector, and provide two separate conductors having different routes between the first and second portions and between the low side switch and the high side switch.",True,0.1604780107736587,0.9190306657880756,39,51,-12,145,327,-182
"[일부 실시예에서, 제2 브랜치가 제1 브랜치의 단면적보다 더 작은 단면적을 가지며/갖거나, 제2 브랜치가 제1 브랜치의 길이보다 더 긴 길이를 갖는다.","In some embodiments, the second branch has a cross-sectional area that is smaller than a cross-sectional area of the first branch and/or the second branch has a length that is greater than a length of the first branch.",True,0.210242822766304,0.8805970969090827,20,38,-18,85,218,-133
브랜치의 단면적 및 길이 중 하나는 스위치 노드 커넥터 내의 전류 밀도 분포를 균일화하도록 조정될 수 있다.],One of both of the cross-sectional area and the length of the branches may be adjusted so as to homogenise the current density distribution within the switch node connector.,True,0.2218149751424789,0.8704184076990543,17,29,-12,61,173,-112
[로우측 스위치 및 하이측 스위치는 각각 트랜지스터 소자에 의해 제공될 수 있다.,The low side switch and the high side switch may each be provided by a transistor device.,True,0.3313308954238891,0.7923298502572526,12,17,-5,45,89,-44
"일부 실시예에서, 로우측 스위치 및 하이측 스위치는 각각 수직형 트랜지스터 소자에 의해 제공된다.","In some embodiments, the low side switch and the high side switch are each provided by a vertical transistor device.",True,0.1967984586954116,0.8896648529975789,13,20,-7,54,116,-62
"일부 실시예에서, 스위치 노드 커넥터는 로우측 스위치의 드레인 패드와 하이측 스위치의 소스 패드 사이에서 연장되고, 둘 이상의 브랜치는 로우측 스위치의 드레인 패드와 하이측 스위치의 소스 패드 사이에 위치한다.","In some embodiments, the switch node connector extends between a drain pad of the low side switch and a source pad of the high side switch and the two or more branches are positioned between the drain pad of the low side switch and the source pad of the high side switch.",True,0.1950819641351699,0.9110604761546552,28,52,-24,117,271,-154
"따라서, 브랜치는 모듈 내에 위치하며, 로우측 스위치의 드레인 패드와 하이측 스위치의 소스 패드 사이에서 횡방향으로 연장된다.]","The branches are, therefore, positioned within the module and extend laterally between the drain pad of the low side switch and the source pad of the high side switch.",True,0.2667229771614074,0.8473008335432898,16,29,-13,71,167,-96
"[일부 실시예에서, 스위치 노드 커넥터는, 물리적으로 서로 이격된 제1 브랜치 및 제2 브랜치를 형성하는 적어도 하나의 개구를 포함하는 전도성 층의 형태를 갖는다.]","In some embodiments, the switch node connector has the form of a conductive layer that comprises at least one aperture to form a first branch and a second branch that are physically spaced apart from one another.",True,0.2561737596988678,0.8641671702860978,22,37,-15,92,212,-120
"[전도성 층은, 로우측 스위치, 하이측 스위치 및 제어 칩이 코어 절연층에 매립되게 하는, 임베디드 칩 기술에 기초한 반도체 모듈에 사용될 수 있다.","A conductive layer may be used for a semiconductor module based on embedded chip techniques, in which the low side switch, high side switch and control chip are embedded in a common insulating layer.",True,0.3589313626289367,0.8084903669940005,22,34,-12,83,199,-116
"전도성 층은 증착된 층일 수도 있고, 절연층 상에서 지지되는 금속 포일 층에 의해 제공될 수도 있는데, 예컨대 코어 층은 강화된 열경화성 수지를 포함한다.]","The conductive layer may be a deposited layer or be provided by a metallic foil layer that is supported on an insulating layer, for example a core layer comprises a reinforced thermosetting resin.",True,0.1656506061553955,0.897092597522734,23,33,-10,87,196,-109
"[일부 실시예에서, 스위치 노드 커넥터는, 물리적으로 서로 이격된 제1 브랜치 및 제2 브랜치를 형성하는 적어도 하나의 개구를 포함하는 접촉 클립의 형태를 갖는다.","In some embodiments, the switch node connector has the form of a contact clip that comprises at least one aperture to form a first branch and a second branch that are physically spaced apart from one another.",True,0.2010358721017837,0.8908721412338151,22,37,-15,91,208,-117
"접촉 클립은, 리드프레임 또는 재배선 기판을 포함하는 반도체 모듈에 사용될 수 있는데, 여기서 로우측 스위치, 하이측 스위치 및 제어 칩이 기판의 리드프레임 또는 재배선 구조의 일부분 상에 실장된다.]","A contact clip may be used for a semiconductor module including a leadframe or redistribution substrate in which the low side switch, high side switch and control chip are mounted on portions of the leadframe or redistribution structure of the substrate.",True,0.2243941724300384,0.8919821809867164,28,41,-13,112,254,-142
"[일부 실시예에서, 제어 칩 위에 적어도 부분적으로 개구가 위치한다.","In some embodiments, the aperture is positioned at least in part above the control chip.",True,0.2155451476573944,0.8748527757706194,9,15,-6,38,88,-50
"제어 칩의 전체 측면 영역이 개구 내에 위치할 수도 있고, 또는 스위치 노드 커넥터의 영역이 제어 칩 위에 위치해서 이와 중첩될 수 있다.",The entire lateral area of the control chip may be positioned within the aperture or regions of the switch node connector may be positioned above and overlap with the control chip.,True,0.2077428251504898,0.8937799532752753,23,31,-8,77,180,-103
"이 구성은, 예를 들어 제어 칩이 본딩 와이어에 의해 재배선 층에 접속되어 본딩 와이어의 추가 높이가 개구 내에 위치하는 경우 및/또는 제어 칩이 로우측 스위치 및 하이측 스위치보다 더 두꺼운 두께를 갖는 경우에 유용할 수 있다.]","This arrangement may be useful if, for example, the control chip is connected by bond wires to a redistribution layer so that the additional height of the bond wires can be positioned within the aperture, and/or if the control chip has a greater thickness than the low side switch and the high side switch.",True,0.1790442466735839,0.914653089571493,36,54,-18,129,306,-177
"[일부 실시예에서, 제1 및 제2 브랜치는 제어 칩의 반대편 측면들 주위로 연장된다.]","In some embodiments, the first and second branches extend around opposing lateral sides of the control chip.",True,0.2238151878118515,0.8748678561529672,12,17,-5,48,108,-60
"[일부 실시예에서, 로우측 스위치 및 하이측 스위치 각각은 실질적으로 직육면체 형태를 가지며 L자 형상으로 횡방향으로 서로 인접하게 배열된다.","In some embodiments, the low side switch and the high side switch each have a substantially cuboid form and are arranged laterally adjacent one another in a L-shape.",True,0.200797438621521,0.8861001196092554,18,28,-10,79,165,-86
"이 구성은 작은 횡방향 크기의 모듈을 제공하는 데 유용할 수 있는데, 이는 직육면체의 긴 쪽이 모듈의 두 인접하는 면을 따라 정렬될 수 있기 때문이다.",This arrangement may be useful in providing a module with a small lateral size since the long sides of the cuboids can be arranged along two adjoining sides of the module.,True,0.1586273461580276,0.9070897713239208,24,31,-7,84,171,-87
제어 칩은 나머지 코너에 배열될 수 있다.],The control chip can be arranged in the remaining corner.,True,0.262557715177536,0.8143351941303734,7,10,-3,24,57,-33
"[일부 실시예에서, 로우측 스위치, 하이측 스위치 및 제어 칩은 실질적으로 동일 평면에 위치하도록 횡방향으로 서로 인접하게 배열된다.]","In some embodiments, the low side switch, the high side switch and the control chip are arranged laterally adjacent to one another such that they are substantially coplanar.",True,0.3124636709690094,0.8359583462024406,17,28,-11,75,173,-98
"[일부 실시예에서, 로우측 스위치, 하이측 스위치 및 제어 칩은, 로우측 스위치, 하이측 스위치 및 제어 칩 각각의 주 표면이 실질적으로 동일 평면에 위치하도록 횡방향으로 서로 인접하게 배열된다.]","In some embodiments, the low side switch, the high side switch and the control chip are arranged laterally adjacent to one another such that a major surface of each of the low side switch, the high side switch and the control chip are substantially coplanar.",True,0.2841226756572723,0.8568134352533994,27,45,-18,110,258,-148
"[일부 실시예에서, 둘 이상의 브랜치는 하나 이상의 전도성 접속부에 의해 접속되는 적어도 두 개의 층 내에서 연장된다.","In some embodiments, the two or more branches are formed in a single layer, or the two or more branches extend in at least two layers that are connected by one or more conductive connections.",True,0.348736435174942,0.8130667360151338,17,35,-18,66,191,-125
"전도성 접속부는, 예를 들면 솔더 접속 또는 전도성 비아일 수 있다. 2개의 층이 사용되는 경우, 이들 2개의 층은 제어 칩의 반대편에 또는 제어 칩의 동일 면에, 즉 제어 칩 위 또는 아래에 배열될 수 있다.]","If two layers are used, the two layers may be arranged on opposing sides of the control chip or on the same side of the control chip, i.e. above or below the control chip.",False,0.2505115866661072,0.8734194855726191,35,34,1,118,171,-53
"[일부 실시예에서, 제어 칩은 게이트 드라이버 회로를 포함하며, 로우측 스위치의 게이트 및 하이측 스위치의 게이트에 결합된다.]","In some embodiments, the control chip comprises gate driver circuitry and is coupled to a gate of the low side switch and a gate of the high side switch.",False,0.2319664508104324,0.8841308242455856,16,29,-13,71,153,-82
"[일부 실시예에서, 반도체 모듈은 V, Sub[attributes={}; value=[high]], 패드, V, Sub[attributes={}; value=[low]], 패드, 스위치 노드 패드 및 하나 이상의 로직 패드를 포함하는 풋프린트를 포함하고, 스위치 노드 커넥터는 반도체 모듈의 스위치 노드 패드에 결합된다.]","In some embodiments, the semiconductor module comprises a footprint comprising a Vhigh pad, a Vlow pad, a switch node pad and one or more logic pads, wherein the switch node connector is coupled to the switch node pad of the semiconductor module.",False,0.3219272494316101,0.8425789377826962,32,42,-10,180,246,-66
"[일부 실시예에서, 로우측 스위치 및 하이측 스위치는 스위치 노드 커넥터에 의해 반도체 모듈의 V, Sub[attributes={}; value=[low]], 패드 및 V, Sub[attributes={}; value=[high]], 패드 사이에 직렬로 연결되고, 스위치 노드 커넥터는 모듈 내에 위치한다.]","In some embodiments, the low side switch and the high side switch are coupled in series between the Vlow pad and the Vhigh pad of the semiconductor module by the switch node connector, and the switch node connector is positioned within the module.",False,0.3435744345188141,0.8328879802460265,31,43,-12,172,247,-75
"[일부 실시예에서, 로우측 스위치 및 하이측 스위치는 각각 수직형 트랜지스터 소자에 의해 제공된다.","In some embodiments, the low side switch and the high side switch are each provided by a vertical transistor device.",True,0.2568707764148712,0.8559586768389154,13,20,-7,55,116,-61
위치고정튜브를 구비한 삼첨판막 역류증 시술용 기구{A device for the treatment of tricuspid regurgitation with position fixing tube },[Technical Field],False,1.073732614517212,0.2069111140607623,18,2,16,109,17,92
"본 발명은 일시적으로 삼첨판막 역류증을 시술하기 위한 위치고정튜브를 구비한 삼첨판막 역류증 시술용 기구에 관한 것으로서, 더욱 상세하게는 삼첨판막 역류증 환자에게 영구적인 방법으로 삼첨판막 역류증을 시술할 때 발생할 수 있는 우심실 부전의 발생여부를 확인하기 위해 일시적으로 삼첨판막의 빈공간(orifice)에 삽입되도록 시술하는 기구이며, 관상정맥에 삽입되는 위치고정튜브를 구비하여 삼첨판막의 빈공간을 차단하는 차단부가 삼첨판막의 판막엽과 유사한 평면으로 관통되며, 삼첨판막의 빈공간을 효율적으로 차단할 수 있게 하는 관통 각도를 지니게 하는 위치고정튜브를 구비한 삼첨판막 역류증 시술용 기구에 관한 것이다.","The present disclosure relates to a tricuspid regurgitation surgical instrument having a position-fixing tube that is for temporarily treating tricuspid regurgitation, and more particularly, to a tricuspid regurgitation surgical instrument having a position-fixing tube that is a surgical instrument temporarily inserted into an orifice of the tricuspid valve to check whether right-sided heart failure has occurred, which may occur when tricuspid regurgitation is treated using a permanent method in a patient with tricuspid regurgitation, and that has a position-fixing tube inserted into the coronary sinus so that a blocking part configured to block the orifice of the tricuspid valve penetrates a plane similar to a plane of leaflets of the tricuspid valve and has a penetration angle which allows the blocking part to efficiently block the orifice of the tricuspid valve.",True,0.2275209873914718,0.8762411680729888,72,131,-59,341,877,-536
삼첨판막 역류증(Tricuspid regurgitation)은 삼첨판막 폐쇄부전증이라고도 한다.,Tricuspid regurgitation is also referred to as tricuspid valve insufficiency.,True,0.182623490691185,0.8630141757832955,6,10,-4,53,77,-24
"삼첨판막 역류증은 삼첨판막의 병변으로 삼첨판막이 닫혀야 할 때 온전히 닫히지 않아 공간(orifice)이 발생하게 되고, 우심실 수축시 우심실에서 폐동맥으로 나가야하는 혈액 중 일부가 상기 공간(orifice)을 통해 우심방으로 역류하는 증상을 말한다.","Tricuspid regurgitation refers to a symptom in which, due to a lesion of the tricuspid valve, the tricuspid valve does not completely close when it should be closed, causing an orifice to be formed, and during contraction of the right ventricle, some of the blood that has to flow from the right ventricle to the pulmonary artery flows back into the right atrium through the orifice.",True,0.2761794924736023,0.8269331715910462,29,66,-37,141,383,-242
"종래에 삼첨판막 역류증의 치료 방식은 환자의 가슴을 열고 심장을 절개하여 수술적으로 교정하는 방법과, 미국등록특허 US 8486136 B2, 미국등록특허 US 7854762 B2 및 미국등록 특허 US 9474605 B2에 제안된 바와 같이 삼첨판막 역류증 시술 기구를 환자의 체내에 영구적으로 삽입하여 삼첨판막 역류증을 치료하는 방법이 있다. 하지만 상기 수술법이나 영구적인 시술방법 등으로 삼첨판막 역류증 치료시, 우심실에서 폐동맥으로 이동하는 혈류의 갑작스러운 증가로 인해 우심실의 과부하가 발생되고, 우심실 부전 증상이 나타나게 되는 문제가 발생하였다.","Conventional methods of treating tricuspid regurgitation include a method in which the patient's chest is opened and an incision is made in the heart to make a surgical correction and a method in which, as proposed in U.S. Patent No. 8,486,136 B2, U.S. Patent No. 7,854,762 B2, and U.S. Patent No. 9,474,605 B2, a tricuspid regurgitation surgical instrument is permanently inserted into the patient's body to treat tricuspid regurgitation.",False,0.3215110898017883,0.8021120116234218,69,69,0,313,439,-126
"이에 본 발명자는 상기 문제점을 해결하기 위해 일시적으로 삼첨판막의 빈공간을 차단하여 우심실 부전 여부를 확인할 수 있는 장치를 개발하였으며, 이를 한국등록특허 제10-1965637호(폐동맥 삽입용 삼첨판막 역류증 시술용 기구)에 게재하여 특허등록 받은 바 있다.","Thus, in order to address the above problems, the inventor of the present disclosure has developed a device capable of temporarily blocking an orifice of the tricuspid valve to check whether right-sided heart failure has occurred, has published the device in a patent application publication, and has been granted a patent ( Korean Patent Registration No. 10-1965637 (Title of Invention: A device for the treatment of tricuspid regurgitation in the pulmonary artery).",True,0.2351285368204116,0.8459739405523798,32,72,-40,147,467,-320
"상기 특허(한국등록특허 제 10-1965637호)에 게재된 폐동맥 삽입용 삼첨판막 역류증 시술용 기구는 삼첨판막의 빈 공간을 차단하는 차단부와 가이드와이어를 따라 이동 가능하도록 내부에 가이드와이어 안내용 루멘(lumen)이 형성된 삽입튜브와, 상기 차단부와 상기 삽입튜브를 삽입하는 루멘이 형성된 시스튜브를 포함한다.","The device for treatment of tricuspid regurgitation in the pulmonary artery that is published in the above patent ( Korean Patent Registration No. 10-1965637 ) includes a blocking part which is configured to block an orifice of the tricuspid valve, an insertion tube which has a guide wire guiding lumen formed therein to be movable along a guide wire, and a sheath tube which has a lumen formed to insert the blocking part and the insertion tube thereinto.",True,0.2988261282444,0.8404546690307598,35,78,-43,178,457,-279
"가이드와이어를 따라 하대정맥-삼첨판막-폐동맥으로 삽입튜브가 삽입되며, 삼첨판막의 빈 공간에 차단부가 관통되어 빈 공간을 일시적으로 차단하고 우심실 과부하 발생 여부를 판단한 후, 다시 체외로 제거하는 것이다.","The insertion tube is inserted into the inferior vena cava, tricuspid valve, and pulmonary artery along the guide wire, the blocking part penetrates the orifice of the tricuspid valve to temporarily block the orifice and determine whether right-sided heart failure has occurred, and then the device is removed from the body.",True,0.4731894731521606,0.7194108684959378,24,51,-27,116,324,-208
"하지만 하대정맥(Inferior vena cave, IVC)과 삼첨판막(Tricuspid Valve, TV)사이의 거리가 환자마다 다양하여 상기 장치로 시술 시 차단부가 삼첨판막의 빈공간을 정확히 차단하지 못하는 경우가 발생되었다.","However, since a distance between the inferior vena cava (IVC) and tricuspid valve (TV) varies for each patient, in some cases, the orifice of the TV is not accurately blocked during a surgical procedure using the device.",True,0.1853701174259185,0.8909719100566431,23,37,-14,129,221,-92
"예를 들면, 삼첨판막 역류증이 심해서 하대정맥과 삼첨판막 사이의 거리가 긴 환자의 경우 하대정맥-삼첨판막-폐동맥으로 이동하는 삽입튜브에 결합된 차단부의 삼첨판막 관통 각도가 변경되어 차단부가 삼첨판막의 빈공간을 정확히 차단할 수 없는 경우가 발생되었다.","For example, in the case of a patient with severe tricuspid regurgitation in which a distance between the IVC and TV is long, in some cases, a TV penetration angle of the blocking part coupled to the insertion tube moving to the IVC, TV, and pulmonary artery is changed, and thus the blocking part is not able to accurately block the orifice of the TV.",True,0.3018558025360107,0.8269534818144406,30,65,-35,141,352,-211
"또한, 삽입튜브가 좌우로 회전됨에 따라 차단부가 좌우방향 일측으로 기울어져 삼첨판막의 판막엽과 유사한 평면을 형성하지 못해 빈공간을 정확히 차단하지 못하는 경우가 발생되었다.","Also, in some cases, as the insertion tube is rotated to the left or right, the blocking part is tilted toward one side in the left-right direction and is not able to form a plane similar to a plane of leaflets of the TV, thus not being able to accurately block the orifice.",True,0.3455099165439605,0.7914537758784911,21,53,-32,97,274,-177
"따라서, 하대정맥과 삼첨판막 사이의 거리가 긴 삼첨판막 역류증 환자에게도 효율적으로 시술이 가능하며, 시술 후 회전되거나 이동되지 않아 삼첨판막의 빈공간을 차단하는 차단부의 움직임이 없는 삼첨판막 역류증 시술용 기구가 요구되는 실정이다.","Therefore, there is a need for a tricuspid regurgitation surgical instrument that allows efficient treatment also for tricuspid regurgitation patients with a long IVC-TV distance and that is not rotated or moved after being placed, thus not causing movement of a blocking part configured to block an orifice of the TV.",True,0.3415595889091491,0.7976383856034827,29,51,-22,132,318,-186
미국등록특허 US8486136 B2 (2013.07.16) 미국등록특허 US7854762 B2 (2010.12.21) 미국등록특허 US9474605 B2 (2016.10.25) 한국등록특허 제10-1965637호 (2019.03.29),[Technical Problem],False,1.037297010421753,0.1554695904216239,15,2,13,131,19,112
본 발명의 목적은 하대정맥과 삼첨판막 사이의 거리가 먼 환자에게도 삼첨판막의 빈 공간을 정확히 차단하도록 차단부가 삼첨판막의 빈 공간에 효율적으로 관통되는 관통 각도를 형성하는 위치고정튜브를 구비한 삼첨판막 역류증 시술용 기구를 제공하는 것이다.,The present disclosure is directed to providing a tricuspid regurgitation surgical instrument having a position-fixing tube that forms a penetration angle at which a blocking part efficiently penetrates an orifice of the tricuspid valve so that the blocking part accurately blocks the orifice of the tricuspid valve even for patients in which a distance between the inferior vena cava and tricuspid valve is long.,True,0.2969618737697601,0.8400963019204195,31,64,-33,137,413,-276
"본 발명의 다른 목적은 용이하게 삼첨판막의 판막엽의 평면과 유사한 평면상에 차단부가 위치되며, 시술 후에도 차단부가 좌우방향 일측으로 움직이는 것을 방지할 수 있어 효율적으로 삼첨판막의 빈 공간을 차단하는 위치고정튜브를 구비한 삼첨판막 역류증 시술용 기구를 제공하는 것이다.","The present disclosure is also directed to providing a tricuspid regurgitation surgical instrument having a position-fixing tube that allows a blocking part to be easily placed on a plane similar to a plane of leaflets of the tricuspid valve and, after the blocking part is placed, prevents the blocking part from moving toward one side in the left-right direction, thus efficiently blocking an orifice of the tricuspid valve.",True,0.316476821899414,0.8268298822961748,35,68,-33,153,426,-273
"본 발명의 목적들은 이상에서 언급한 목적으로 제한되지 않으며, 언급되지 않은 또 다른 목적들은 아래의 기재로부터 본 발명의 기술분야에서 통상의 지식을 지닌 자에게 명확하게 이해될 수 있을 것이다.","The objectives of the present disclosure are not limited to those mentioned above, and other unmentioned objectives should be clearly understood by those of ordinary skill in the art from the description below.",True,0.1864618360996246,0.8630240670932275,27,33,-6,109,210,-101
"상기 목적을 달성하기 위하여, 본 발명에 따른 위치고정튜브를 구비한 삼첨판막 역류증 시술용 기구는 가이드와이어를 따라 하대정맥 또는 상대정맥에서 폐동맥으로 이동가능하도록 내부에 상기 가이드와이어가 삽입되는 루멘(lumen)이 형성된 삽입튜브; 상기 삽입튜브의 외부 일측면에 결합되며 삼첨판막의 불완전한 닫힘현상으로 인해 발생되는 빈공간을 비스듬히 관통되고, 연성을 지니나 쉽게 찢어지지 않으며 인체 적합한 재질로 형성되는 멤브레인(membrane) 타입의 차단부; 상기 삽입튜브의 외부 타측면에 결합되고 내부에 가이드와이어가 삽입되는 루멘(lumen)이 형성되며, 근위부의 미리 정해진 길이까지는 상기 삽입튜브와 결합된 결합부와, 원위부에는 상기 삽입튜브와 분리된 분리부를 구비하는 위치고정튜브;를 포함하되, 상기 위치고정튜브의 원위부에 형성된 상기 분리부는 관상정맥에 삽입됨으로써 상기 삽입튜브 및 상기 차단부의 회전 또는 상하 이동을 방지하는 것을 특징으로 한다.","The present disclosure provides a tricuspid regurgitation surgical instrument having a position-fixing tube, the tricuspid regurgitation surgical instrument including: an insertion tube which has a lumen, into which a guide wire is inserted, formed therein to be movable from the inferior vena cava or superior vena cava to the pulmonary artery along the guide wire; a membrane-type blocking part which is coupled to one outer side surface of the insertion tube, obliquely penetrates an orifice formed due to incomplete closing of the tricuspid valve, and is made of a material which is suitable for the human body and is flexible but does not tear easily; and a position-fixing tube which is coupled to the other outer side surface of the insertion tube and has a lumen, into which a guide wire is inserted, formed therein, a coupling part disposed at a proximal part and coupled to the insertion tube to a predetermined length, and a separated part disposed at a distal part and separated from the insertion tube, wherein the separated part formed at the distal part of the position-fixing tube is inserted into the coronary sinus to prevent rotation or vertical movement of the insertion tube and the blocking part.",True,0.2340734750032425,0.8840793224806753,99,201,-102,485,1218,-733
"상기 위치고정튜브와 상기 차단부는, 상기 삽입튜브를 중심으로 서로 반대 방향에 위치되며, 동일 평면상에 위치되는 것을 특징으로 한다.",The position-fixing tube and the blocking part may be disposed at opposite directions from each other with respect to the insertion tube and may be disposed to be coplanar.,True,0.4006107747554779,0.7616039732577209,17,29,-12,74,172,-98
"이때, 위치고정튜브를 구비한 삼첨판막 역류증 시술용 기구는 일측이 상기 삽입튜브 및 상기 위치고정튜브의 근위부를 삽입하여 상기 삽입튜브 및 상기 위치고정튜브와 긴밀하게 밀착되며, 타측이 체외에 위치되어 체외에서 고정되어 시술 중 상기 삽입튜브 및 상기 위치고정튜브가 회전하거나 움직이는 것을 방지하는 결합튜브를 추가로 포함하는 것을 특징으로 한다.","Here, the tricuspid regurgitation surgical instrument may further include a coupling tube which has one side into which the insertion tube and the proximal part of the position-fixing tube are inserted so as to come into close contact with the insertion tube and the position-fixing tube and has the other side disposed outside the body and fixed outside the body to prevent rotation or movement of the insertion tube and the position-fixing tube during a surgical procedure.",True,0.2993161082267761,0.8509628583491213,44,77,-33,194,475,-281
"상기 삽입튜브는, 상기 차단부가 상기 빈공간에 보다 정확하게 삽입될 수 있도록 미리 정해진 각도로 굴곡되는 굴곡부가 형성되는 것을 특징으로 한다.",The insertion tube may have a curved part curved at a predetermined angle formed therein to allow the blocking part to be more accurately inserted into the orifice.,True,0.2445411533117294,0.853062859473836,20,28,-8,81,164,-83
"상기 차단부는 양단이 상기 삽입튜브에 결합되는 지지와이어와, 일측이 상기 삽입튜브에 고정되며 상기 지지와이어에 의해 지지되는 차단막(membrane)을 포함한다.",The blocking part may include a support wire which has both ends coupled to the insertion tube and a blocking membrane which has one side fixed to the insertion tube and is supported by the support wire.,True,0.228343978524208,0.8713050072950691,17,37,-20,90,203,-113
"다른 실시예에 따른 상기 차단부는 상기 삽입튜브가 관통되도록 설치되어 중심축이 상기 삽입튜브에 비스듬하게 형성된 링형와이어와, 상기 삽입튜브와 상기 링형와이어를 연결하는 차단막(membrane)을 포함한다.","According to another embodiment, the blocking part may include a ring-shaped wire which is installed to penetrate the insertion tube and has a central axis formed obliquely to the insertion tube and a blocking membrane which is configured to connect the insertion tube and the ring-shaped wire.",True,0.2234681993722915,0.8831163886633352,22,47,-25,115,294,-179
"본 발명에 따른 위치고정튜브를 구비한 삼첨판막 역류증 시술용 기구는 관상정맥에 삽입되는 위치고정튜브를 포함하여 하대정맥과 삼첨판막 사이의 길이에 상관없이 차단부가 삼첨판막의 빈 공간을 효과적으로 차단하는 삼첨판막 관통 각도를 형성하며, 항상 일정한 관통 각도를 유지할 수 있도록 하여 삼첨판막 역류증 시술을 보다 효과적이고 간편하게 하는 것이다.",A tricuspid regurgitation surgical instrument having a position-fixing tube according to the present disclosure includes a position-fixing tube inserted into the coronary sinus to form a tricuspid valve penetration angle at which a blocking part effectively blocks an orifice of the tricuspid valve regardless of a distance between the inferior vena cava and tricuspid valve.,False,0.3318804800510406,0.8299115345357788,44,55,-11,193,375,-182
"또한, 삽입튜브를 기준으로 차단부와 위치고정튜브가 서로 반대 방향으로 형성되어 위치고정튜브를 관상정맥에 삽입하면 자연스럽게 차단부가 삼첨판막의 판막엽과 유사한 평면으로 삼첨판막의 빈공간에 관통되며, 차단부가 좌우방향 일측으로 기울어지지 않아 삼첨판막의 빈 공간을 효과적으로 차단할 수 있는 것이다.","Also, the blocking part and the position-fixing tube are formed at opposite directions from each other with respect to an insertion tube such that, when the position-fixing tube is inserted into the coronary sinus, the blocking part naturally penetrates the orifice of the tricuspid valve on a plane similar to a plane of leaflets of the tricuspid valve, and the blocking part is not tilted toward one side in the left-right direction.",False,0.2551233768463135,0.8691106924670882,34,72,-38,166,435,-269
"또한, 위치고정튜브와 삽입튜브는 근위부가 서로 결합되고 원위부는 서로 분리되어 각각 체내에 미리 삽입된 가이드와이어를 삽입하며 가이드와이어를 따라 용이하게 체내로 이동하므로 시술이 간편한 것이다.","In addition, the position-fixing tube and the insertion tube have proximal parts coupled to each other and distal parts separated from each other, and a guide wire inserted into the body in advance is inserted into each of the position-fixing tube and the insertion tube so that the position-fixing tube and the insertion tube easily move into the body along the guide wire.",False,0.2735200226306915,0.8498079503313781,23,63,-40,109,374,-265
도 1은 본 발명의 바람직한 실시예에 따른 위치고정튜브를 구비한 삼첨판막 역류증 시술용 기구의 사시도이다.,FIG. 1 is a perspective view of a tricuspid regurgitation surgical instrument having a position-fixing tube according to an exemplary embodiment of the present disclosure.,True,0.2716148495674133,0.8188604198221352,14,25,-11,59,171,-112
도 2는 도 2는 본 발명의 다른 실시예에 따른 차단부의 확대 사시도이다.,FIG. 2 is an enlarged perspective view of a blocking part according to another embodiment of the present disclosure.,True,0.1429350972175598,0.8906129370128362,12,19,-7,41,116,-75
도 3은 본 발명의 바람직한 다른 실시예에 따른 위치고정튜브를 구비한 삼첨판막 역류증 시술용 기구의 사시도이다.,FIG. 3 is a perspective view of a tricuspid regurgitation surgical instrument having a position-fixing tube according to another exemplary embodiment of the present disclosure.,True,0.2495175004005432,0.8354630790047762,15,25,-10,62,176,-114
도 4는 본 발명의 바람직한 또다른 실시예에 따른 위치고정튜브를 구비한 삼첨판막 역류증 시술용 기구의 사시도이다.,FIG. 4 is a perspective view of a tricuspid regurgitation surgical instrument having a position-fixing tube according to still another exemplary embodiment of the present disclosure.,True,0.2481153011322021,0.8331744000451504,15,26,-11,63,182,-119
도 5는 바람직한 실시예에 따른 위치고정튜브를 구비한 삼첨판막 역류증 시술용 기구가 하대정맥-삼첨판막-폐동맥으로 삽입된 모습을 나타낸 단면도이다.,"FIG. 5 is a cross-sectional view illustrating a state in which a tricuspid regurgitation surgical instrument having a position-fixing tube according to an exemplary embodiment is inserted into the inferior vena cava, tricuspid valve, and pulmonary artery.",True,0.2894051373004913,0.8291478271690716,16,37,-21,81,255,-174
도 6은 바람직한 실시예에 따른 위치고정튜브를 구비한 삼첨판막 역류증 시술용 기구가 상대정맥-삼첨판막-폐동맥으로 삽입된 모습을 나타낸 단면도이다.,"FIG. 6 is a cross-sectional view illustrating a state in which the tricuspid regurgitation surgical instrument having a position-fixing tube according to an exemplary embodiment is inserted into the superior vena cava, tricuspid valve, and pulmonary artery.",True,0.3401644229888916,0.7993952596601341,16,37,-21,81,257,-176
"이하, 첨부된 도면을 참조하여 본 발명의 바람직한 실시예를 상세히 설명하기로 한다.","Hereinafter, exemplary embodiments of the present disclosure will be described in detail with reference to the accompanying drawings.",True,0.1773512363433838,0.8673019682717475,11,18,-7,46,133,-87
도 1은 본 발명의 바람직한 실시예에 따른 위치고정튜브를 구비한 삼첨판막 역류증 시술용 기구의 사시도이다.,FIG. 1 is a perspective view of a tricuspid regurgitation surgical instrument having a position-fixing tube according to an exemplary embodiment of the present disclosure.,True,0.2716148495674133,0.8188604198221352,14,25,-11,59,171,-112
"도 1을 참조하면, 본 발명의 바람직한 실시예에 따른 위치고정튜브를 구비한 삼첨판막 역류증 시술용 기구는 차단부(10), 삽입튜브(20), 위치고정튜브(30)를 포함한다.","Referring to FIG. 1, the tricuspid regurgitation surgical instrument having a position-fixing tube according to an exemplary embodiment of the present disclosure includes a blocking part 10, an insertion tube 20, and a position-fixing tube 30.",True,0.2155646383762359,0.8842232985852471,18,36,-18,95,243,-148
상기 차단부(10)는 상기 삽입튜브(20)의 외부 측면에 결합되는 것으로 차단막(12)과 지지와이어(14)를 포함한다.,The blocking part 10 is coupled to an outer side surface of the insertion tube 20 and includes a blocking membrane 12 and a support wire 14.,True,0.1339368373155594,0.92625320234766,11,27,-16,66,140,-74
"상기 지지와이어(14)는 상기 삽입튜브(20)에 양단이 고정되며, 상기 차단막(12)은 상기 삽입튜브(20)와 상기 지지와이어(14)를 연결하는 것이다.","The support wire 14 has both ends fixed to the insertion tube 20, and the blocking membrane 12 connects the insertion tube 20 and the support wire 14.",True,0.155798390507698,0.917211534352442,14,28,-14,85,150,-65
상기 지지와이어(14)는 양쪽 또는 한쪽이 상기 삽입튜브(20)에 고정되지 않는 경우도 가능함은 물론이다.,"Of course, in some cases, neither side or only one side of the support wire 14 may be fixed to the insertion tube 20.",True,0.2204523682594299,0.8734355736116306,12,24,-12,59,117,-58
"상기 차단막(12)은 연성을 지니나 쉽게 찢어지지 않으며 인체적합한 재질이 사용되며, 의료용 폴리우레탄, 폴리올레핀, 실리콘, e-PTFE, PTFE 등이 사용될 수 있다.","For example, medical grade polyurethane, polyolefin, silicone, e-polytetrafluoroethylene (e-PTFE), polytetrafluoroethylene (PTFE), etc. may be used.",False,0.3632317781448364,0.748118765042692,20,15,5,96,148,-52
"상기 지지와이어(14)는 상기 차단막(12)의 형태를 잡아 주기 위한 것으로 나일론 등의 합성수지 또는 금속제(스테인레스 스틸, 금속제에 나일론 코팅 등)와이어 등이 사용될 수 있다.","The support wire 14 is for holding the shape of the blocking membrane 12, and for the support wire 14, a wire made of a synthetic resin such as nylon or a wire made of metal (stainless steel, a metal coated with nylon, etc.) may be used.",True,0.1263730823993683,0.9231141282789324,23,47,-24,102,237,-135
"상기 지지와이어(14)는 하나의 와이어일 수도 있으며, 다수개의 가는 와이어를 꼬아서 만든 타입도 가능함은 물론이다.",The support wire 14 may be a single wire or may be a type of wire made by twisting a plurality of thin wires.,True,0.2030307352542877,0.8604447487371425,14,24,-10,65,109,-44
"또한, 상기 차단막(12)은 이중으로 형성되고, 상기 차단막(12)에 상기 지지와이어(14)가 삽입된 형태로 구성될 수도 있음은 물론이다.","Also, the blocking membrane 12 may be doubly formed, and the support wire 14 may be configured to be inserted into the blocking membrane 12.",True,0.164233386516571,0.903878078718039,15,25,-10,77,140,-63
도 2는 본 발명의 다른 실시예에 따른 차단부를 도시한 것이다.,FIG. 2 illustrates a blocking part according to another embodiment of the present disclosure.,True,0.1404080241918563,0.8957312526396459,10,14,-4,35,93,-58
"도 2를 참조하면, 본 발명의 다른 실시예에 따른 차단부(10)는 상기 삽입튜브(20)가 관통되도록 설치되어 중심축이 상기 삽입튜브(20)에 비스듬하게 형성된 링형와이어(16)와, 상기 링형와이어(16) 및 상기 삽입튜브(20)를 연결하는 차단막(membrane, 12)을 포함한다.","Referring to FIG. 2, a blocking part 10 according to another embodiment of the present disclosure includes a ring-shaped wire 16 which is installed to penetrate the insertion tube 20 and has a central axis formed obliquely to the insertion tube 20 and a blocking membrane 12 which is configured to connect the ring-shaped wire 16 and the insertion tube 20.",True,0.1723995208740234,0.9154816236729466,28,61,-33,158,356,-198
상기 링형와이어(16)는 상기 삽입튜브(20)에 소정의 각도로 기울어져 비스듬히 설치되므로 삼첨판막과 평행하게 위치하게 된다.,"Due to being tilted at a predetermined angle and obliquely installed at the insertion tube 20, the ring-shaped wire 16 is disposed to be parallel to the tricuspid valve.",True,0.3205752670764923,0.8171372234146475,13,29,-16,70,169,-99
"따라서, 삼첨판막의 빈 공간(orifice)을 효과적으로 차단할 수 있다.","Therefore, the ring-shaped wire 16 may effectively block an orifice of the tricuspid valve.",True,0.4632927477359772,0.6871203025608632,8,14,-6,41,91,-50
"다시 도 1을 참조하면, 상기 삽입튜브(20)는 내부에 가이드와이어(1)가 삽입되는 삽입튜브 루멘(lumen, 22)이 형성되며 고무재, 연성 플라스틱재 등의 재질로 형성되어 연성이 높고 심장의 박동에 따라 움직일 수 있는 유연성과 복원성이 우수한 것이다.","Referring back to FIG. 1, the insertion tube 20 has an insertion tube lumen 22, into which a guide wire 1 is inserted, formed therein and is made of a material such as rubber or flexible plastic such that the insertion tube 20 has high flexibility and restorability that allow the insertion tube 20 to move according to the beating of the heart.",True,0.1933907717466354,0.8895205008702264,31,63,-32,143,345,-202
상기 삽입튜브(20)는 상기 가이드와이어(1)를 따라 하대정맥-삼첨판막-폐동맥으로 삽입되어 상기 차단부(10)가 삼첨판막의 빈 공간(orifice)을 관통하여 삼첨판막의 빈 공간을 차단할 수 있도록 하는 것이다.,"The insertion tube 20 is inserted into the inferior vena cava, tricuspid valve, and pulmonary artery along the guide wire 1 so that the blocking part 10 penetrates the orifice of the tricuspid valve to block the orifice of the tricuspid valve.",True,0.3210337460041046,0.834776564876342,21,42,-21,118,243,-125
본 발명의 바람직한 실시예에 따른 상기 삽입튜브(20)는 일단이 폐동맥에 위치되고 타단이 체외에 위치되도록 길게 형성된다.,The insertion tube 20 according to an exemplary embodiment of the present disclosure is formed long so that one end is disposed in the pulmonary artery and the other end is disposed outside the body.,True,0.2500791549682617,0.8622903404914313,15,35,-20,68,199,-131
"이 때, 상기 가이드와이어(1)는 두 개의 가이드와이어(1)를 포함하며, 하나는 하대정맥 또는 상대정맥 ?? 삼첨판막 ?? 폐동맥으로 체내에 미리 삽입되어 상기 삽입튜브(20)의 체내 이동을 돕기 위해 삽입튜브 루멘(22)에 삽입되는 것이며, 다른 하나는 하대정맥 또는 상대정맥 ?? 관상정맥으로 체내에 미리 삽입되어 상기 위치고정튜브(30)의 체내 이동을 돕기 위해 상기 위치고정튜브(30)에 삽입되는 것이다.","Here, the guide wire 1 includes two guide wires 1, one of which is inserted into the body in advance along the inferior vena cava or superior vena cava, the tricuspid valve, and the pulmonary artery and inserted into the insertion tube lumen 22 to assist in movement of the insertion tube 20 inside the body, and the other one of which is inserted into the body in advance along the inferior vena cava or superior vena cava and the coronary sinus and inserted into the position-fixing tube 30 to assist in movement of the position-fixing tube 30 inside the body.",True,0.1930916607379913,0.9033246602204488,49,101,-52,230,562,-332
"상기 가이드와이어(1)는 나일론 등의 합성수지 또는 금속제(스테인레스 스틸, 금속제에 나일론 코팅 등)와이어 등이 사용될 수 있으며, 하나의 와이어일 수도 있고 다수개의 가는 와이어를 꼬아서 만든 타입도 가능함은 물론이다.","For the guide wire 1, a wire made of a synthetic resin such as nylon or a wire made of metal (stainless steel, a metal coated with nylon, etc.) may be used.",False,0.2103027254343032,0.8627939541939994,28,32,-4,124,156,-32
"상기 위치고정튜브(30)는 상기 삽입튜브(20)의 외부 측면에 결합되는 것으로, 내부에 가이드와이어(1)가 삽입되는 위치고정튜브 루멘(lumne, 36)이 형성된다.","The position-fixing tube 30 is coupled to an outer side surface of the insertion tube 20 and has a position-fixing tube lumen 36, into which the guide wire 1 is inserted, formed therein.",True,0.1757669448852539,0.9077550321135496,15,33,-18,92,186,-94
"상기 위치고정튜브(30)는 근위부에 미리 정해진 길이까지 상기 삽입튜브(20)와 결합된 결합부(32)와, 원위부에 상기 삽입튜브(20)와 분리된 분리부(34)를 구비한다.",The position-fixing tube 30 includes a coupling part 32 which is disposed at a proximal part and coupled to the insertion tube 20 to a predetermined length and a separated part 34 which is disposed at a distal part and separated from the insertion tube 20.,True,0.1866368353366851,0.9066421493121696,16,46,-30,95,256,-161
"상기 위치고정튜브(30)는 고무재, 연성플라스틱재 등이 될 수 있으며, 연성이 높고, 심장의 박동에 따라 움직일 수 있는 유연성과 복원성이 우수한 재질이 사용된다.",The position-fixing tube 30 may be made of a material such as rubber or flexible plastic.,False,0.399351954460144,0.7314216415452282,21,16,5,91,89,2
"이때, 상기 위치고정튜브(30)는 상기 삽입튜브(20)를 중심으로 상기 차단부(10)와 서로 다른 방향으로 결합되며, 바람직하게 상기 위치고정튜브(30)와 상기 차단부(10)는 상기 삽입튜브(20)를 중심으로 180도 반대 방향에 결합되어 서로 동일한 평면상에 위치되는 것이 바람직하다.","Preferably, the position-fixing tube 30 and the blocking part 10 may be coupled to the insertion tube 20 in directions 180° opposite each other and may be disposed to be coplanar.",False,0.2686448395252228,0.8655731293567321,30,31,-1,160,179,-19
"상기 위치고정튜브(30)는 하대정맥 또는 상대정맥에서 관상정맥으로 미리 삽입된 상기 가이드와이어(1)를 따라 체내로 이동되며, 상기 위치고정튜브(30)의 상기 분리부(34)가 관상정맥에 삽입된다.","The position-fixing tube 30 is moved inside the body along the guide wire 1 which is inserted in advance from the inferior vena cava or superior vena cava to the coronary sinus, and the separated part 34 of the position-fixing tube 30 is inserted into the coronary sinus.",True,0.2068262100219726,0.8924015586083655,19,48,-29,109,271,-162
"관상정맥은 삼첨판막의 판막엽과 인접한 위치에 형성되어 있으며, 관상정맥과 삼첨판막 사이의 거리는 모든 환자가 유사한 일정 거리를 가지고 있다.","The coronary sinus is formed at a position adjacent to leaflets of the tricuspid valve, and a distance between the coronary sinus and tricuspid valve is similar in all patients.",True,0.2223201692104339,0.8616088714550444,18,30,-12,79,177,-98
"즉, 하대정맥과 삼첨판막 사이의 거리와 같이 환자에 따라 크게 차이나는 것이 아니며, 모든 환자가 유사한 일정한 간격을 가지는 것이다.","That is, unlike a distance between the inferior vena cava and tricuspid valve, the distance between the coronary sinus and tricuspid valve does not vary greatly from patient to patient and is similar in all patients.",True,0.3013505637645721,0.8166587763810795,19,36,-17,75,216,-141
"따라서, 관상정맥에 상기 위치고정튜브(30)의 상기 분리부(34)가 삽입됨으로써, 상기 차단부(10)가 삼첨판막의 빈 공간을 관통하는 관통 각도가 모든 환자에게 일정하도록 시술 가능한 것이다.","Therefore, due to the separated part 34 of the position-fixing tube 30 being inserted into the coronary sinus, a penetration angle at which the blocking part 10 penetrates the orifice of the tricuspid valve may be constant for all patients during the surgical procedure.",True,0.258441299200058,0.8668037523073062,21,44,-23,107,270,-163
"또한, 상기 위치고정튜브(30)의 상기 분리부(34)가 관상정맥에 삽입됨으로써, 상기 삽입튜브(20)가 하대정맥 또는 상대정맥-관상정맥 입구-삼첨판막-폐동맥으로 이동되는 경로를 지니며, 이에 따라 상기 차단부(10)의 중앙부가 삼첨판막의 빈 공간에 위치되도록 하여 효율적으로 빈 공간을 차단할 수 있다.","Also, due to the separated part 34 of the position-fixing tube 30 being inserted into the coronary sinus, the insertion tube 20 has a path of being moved from the inferior vena cava or superior vena cava to the inlet of the coronary sinus, the tricuspid valve, and the pulmonary artery and, accordingly, allows a central portion of the blocking part 10 to be disposed in the orifice of the tricuspid valve, thus efficiently blocking the orifice.",True,0.2443218678236007,0.8857612206442335,32,77,-45,169,445,-276
"또한, 상기 분리부(34)가 관상정맥에 삽입됨으로써 상기 삽입튜브(20) 및 상기 차단부(10)의 회전 또는 상하 이동을 방지할 수 있다.","Also, due to the separated part 34 being inserted into the coronary sinus, rotation or vertical movement of the insertion tube 20 and the blocking part 10 may be prevented.",True,0.2153065800666809,0.8883235305079545,17,30,-13,77,172,-95
"이때, 상기 위치고정튜브(30)와 상기 차단부(10)는 상기 삽입튜브(20)를 중심으로 180도 반대 방향에 결합되어 서로 동일한 평면상에 위치되는 것이므로, 상기 위치고정튜브(30)의 분리부(34)를 관상정맥에 삽입하면 상기 차단부(10)의 차단막(12)은 좌우방향 일측으로 기울어지지 않고 삼첨판막의 판막엽과 유사한 평면을 유지하며 삼첨판막의 빈 공간에 관통되어 효율적으로 차단할 수 있다.","Here, since the position-fixing tube 30 and the blocking part 10 are coupled to the insertion tube 20 in directions 180° opposite each other and are disposed to be coplanar, when the separated part 34 of the position-fixing tube 30 is inserted into the coronary sinus, the blocking membrane 12 of the blocking part 10 may, without being tilted toward one side in the left-right direction, maintain a plane similar to a plane of leaflets of the tricuspid valve and penetrate the orifice of the tricuspid valve to efficiently block the orifice.",True,0.1676326990127563,0.9203661961545218,42,92,-50,220,542,-322
"본 발명의 바람직한 실시예에 따른 상기 위치고정튜브(30)는 원위부에 형성된 상기 분리부(34)가 관상정맥에 삽입되므로 상기 위치고정튜브(30)의 일단이 관상정맥에 위치되고, 타단은 체외에 위치되도록 길게 형성된다.","Due to having the separated part 34 formed at the distal part and inserted into the coronary sinus, the position-fixing tube 30 according to an exemplary embodiment of the present disclosure is formed long so that one end is disposed in the coronary sinus and the other end is disposed outside the body.",True,0.2601276338100433,0.86927844424013,23,53,-30,120,303,-183
"본 발명에 따른 위치고정튜브가 결합된 삼첨판막 역류증 시술용 기구는 결합튜브(40)를 추가로 포함하며, 상기 결합튜브(40)는 내부에 결합튜브 루멘(42)이 형성되어 상기 삽입튜브(20) 및 상기 위치고정튜브(30)의 근위부를 삽입하고 상기 삽입튜브(20) 및 상기 위치고정튜브(30)와 긴밀하게 밀착되어 상기 삽입튜브(20) 및 상기 위치고정튜브(30)를 고정한다.","The coupling tube 40 has a coupling tube lumen 42 formed therein, and the insertion tube 20 and the proximal part of the position-fixing tube 30 are inserted into the coupling tube lumen 42 so that the coupling tube 40 comes into close contact with the insertion tube 20 and the position-fixing tube 30 and fixes the insertion tube 20 and the position-fixing tube 30.",False,0.3208330273628235,0.8452196415723454,38,65,-27,205,367,-162
"상기 결합튜브(40)는 고무재, 연성 플라스틱재 등이 될 수 있으며, 연성이 높고, 심장의 박동에 따라 움직일 수 있는 유연성과 복원성이 우수한 재질이 사용되며, 상기 삽입튜브(20) 및 상기 위치고정튜브(30) 보다 큰 직경을 가지도록 형성되어 상기 삽입튜브(20)와 상기 위치고정튜브(30)를 삽입한다.",The coupling tube 40 may be made of a material such as rubber or flexible plastic.,False,0.5452881455421448,0.662372929704486,37,16,21,171,82,89
"상기 결합튜브(40)는 일측이 체내에 위치되고 타측이 체외에 위치되어 체외에 위치되는 상기 결합튜브(40)의 타측을 일시적으로 고정하여 상기 삽입튜브(20) 및 상기 위치고정튜브(30)가 체내에서 이동하거나 좌우로 회전하지 않도록 하고, 본 발명에 따른 위치고정튜브를 구비한 삼첨판막 역류증 시술용 기구가 일시적으로 체내에 삽입되어 고정되고 제거될 수 있도록 하는 것이다.","By temporarily fixing the other side of the coupling tube 40, the insertion tube 20 and the position-fixing tube 30 are prevented from moving or rotating leftward or rightward inside the body, and the tricuspid regurgitation surgical instrument having a position-fixing tube according to the present disclosure is able to be temporarily inserted into the body and fixed or removed therefrom.",False,0.2500240802764892,0.8782880061477081,44,61,-17,208,391,-183
도 3은 본 발명의 바람직한 다른 실시예에 따른 위치고정튜브를 구비한 삼첨판막 역류증 시술용 기구의 사시도이다.,FIG. 3 is a perspective view of a tricuspid regurgitation surgical instrument having a position-fixing tube according to another exemplary embodiment of the present disclosure.,True,0.2495175004005432,0.8354630790047762,15,25,-10,62,176,-114
"도 3을 참조하면, 본 발명의 바람직한 다른 실시예에 따른 위치고정튜브를 구비한 삼첨판막 역류증 시술용 기구는 도 1에 도시된 위치고정튜브(30)보다 길이가 짧은 위치고정튜브(30)를 포함한다.","Referring to FIG. 3, the tricuspid regurgitation surgical instrument having a position-fixing tube according to another exemplary embodiment of the present disclosure includes a position-fixing tube 30 having a shorter length than the position-fixing tube 30 illustrated in FIG. 1.",True,0.2167109102010727,0.8761245044758671,23,40,-17,108,281,-173
"보다 상세하게 본 발명의 바람직한 다른 실시예에 따른 상기 위치고정튜브(30)는 결합부(32), 분리부(34), 위치고정튜브 루멘(36)을 포함하며, 시술 시 원위부의 상기 분리부(34)가 관상정맥에 삽입되어 상기 위치고정튜브(30)의 일단이 관상정맥에 위치되고, 근위부의 상기 결합부(32)는 상기 삽입튜브(20)의 외측 측면에서 상기 삽입튜브(20) 결합되어 상기 위치고정튜브(30)의 타단이 체내에 위치된다.","More specifically, the position-fixing tube 30 according to another exemplary embodiment of the present disclosure includes a coupling part 32, a separated part 34, and a position-fixing tube lumen 36.",False,0.3571736514568329,0.8105405176248907,42,30,12,231,201,30
"따라서, 본 발명의 다른 실시예에 따른 위치고정튜브(30)는 도 1에 도시된 위치고정튜브(30)에 비하여 길이가 짧게 형성되는 것이 특징이며, 이외의 구성은 도 1에서 설명된 바와 동일하다.","Therefore, the position-fixing tube 30 according to another embodiment of the present disclosure has a characteristic of being formed to have a shorter length than the position-fixing tube 30 illustrated in FIG. 1, and all the other configurations are the same as those described above with reference to FIG. 1.",True,0.1410449594259262,0.919955792308358,24,50,-26,106,311,-205
도 4는 본 발명의 바람직한 또다른 실시예에 따른 위치고정튜브를 구비한 삼첨판막 역류증 시술용 기구의 사시도이다.,FIG. 4 is a perspective view of a tricuspid regurgitation surgical instrument having a position-fixing tube according to still another exemplary embodiment of the present disclosure.,True,0.2481153011322021,0.8331744000451504,15,26,-11,63,182,-119
본 발명의 바람직한 또다른 실시예에 따른 위치고정튜브를 구비한 삼첨판막 역류증 시술용 기구는 삽입튜브(20)가 굴곡부(24)를 포함한다.,"In the tricuspid regurgitation surgical instrument having a position-fixing tube according to still another exemplary embodiment of the present disclosure, an insertion tube 20 includes a curved part 24.",True,0.2574765980243683,0.8582950917696786,15,29,-14,76,203,-127
상기 삽입튜브(20)의 상기 굴곡부(24)는 미리 정해진 각도로 굴곡되어 차단부(10)가 삼첨판막의 빈 공간의 차단을 효과적으로 하는 삼첨판막 관통 각도를 형성하여 하대정맥과 삼첨판막 사이의 길이에 상관없이 항상 일정한 관통 각도를 유지할 수 있도록 한다.,The curved part 24 of the insertion tube 20 is curved at a predetermined angle to form a tricuspid valve penetration angle that allows a blocking part 10 to effectively block an orifice of the tricuspid valve.,False,0.35606449842453,0.8182384062727979,32,37,-5,143,209,-66
도 4에는 하나의 상기 굴곡부(24)가 도시되었으나 다수개의 상기 굴곡부(24)가 형성될 수도 있음은 물론이다.,"A single curved part 24 is illustrated in FIG. 4, but of course, a plurality of curved parts 24 may be formed.",True,0.1127732694149017,0.9253287225220724,13,22,-9,62,110,-48
상기 삽입튜브(20) 이외의 구성은 도 1에서 상술한 바와 동일하다.,Configurations other than the insertion tube 20 are the same as those described above with reference to FIG. 1.,True,0.1146832630038261,0.924861344699583,9,19,-10,38,111,-73
"도 5는 본 발명의 바람직한 실시예에 따른 위치고정튜브를 구비한 삼첨판막 역류증 시술용 기구가 하대정맥-삼첨판막-폐동맥으로 삽입된 모습을 나타낸 단면도이고, 도 6은 바람직한 실시예에 따른 위치고정튜브를 구비한 삼첨판막 역류증 시술용 기구가 상대정맥-삼첨판막-폐동맥으로 삽입된 모습을 나타낸 단면도이다.","FIG. 5 is a cross-sectional view illustrating a state in which a tricuspid regurgitation surgical instrument having a position-fixing tube according to an exemplary embodiment of the present disclosure is inserted into the inferior vena cava, tricuspid valve, and pulmonary artery, and FIG. 6 is a cross-sectional view illustrating a state in which the tricuspid regurgitation surgical instrument having a position-fixing tube according to an exemplary embodiment is inserted into the superior vena cava, tricuspid valve, and pulmonary artery.",True,0.2829406559467315,0.836516781846998,34,79,-45,169,543,-374
도 5 및 도 6을 참조하여 본 발명의 바람직한 실시예에 따른 위치고정튜브를 구비한 삼첨판막 역류를 시술용 기구를 체내에 삽입하는 과정을 설명하도록 한다.,A process of inserting the tricuspid regurgitation surgical instrument having a position-fixing tube according to an exemplary embodiment of the present disclosure into the body will be described with reference to FIGS. 5 and 6.,True,0.2368713617324829,0.8485149083650813,22,35,-13,86,228,-142
"먼저, 도 5와 같이 위치고정튜브를 구비한 삼첨판막 역류증 시술용 기구가 하대정맥-삼첨판막-폐동맥으로 삽입하기 위해 두 개의 가이드와이어(1)가 체내에 삽입되며, 하나의 가이드와이어(1)는 하대정맥(Inferior vena cave, IVC)에서 삼첨판막(Tricuspid Valve, TV), 폐동맥(Pulmonary artery, PA)으로 삽입되고, 나머지 하나의 가이드와이어(1)는 하대정맥(Inferior vena cave, IVC)에서 관상정맥(Coronary sinus, CS)로 삽입된다.","First, as in FIG. 5, for the tricuspid regurgitation surgical instrument having a position-fixing tube to be inserted into the inferior vena cava, tricuspid valve, and pulmonary artery, two guide wires 1 are inserted into the body.",False,0.3309638798236847,0.8181629794272769,42,37,5,281,231,50
체내에 먼저 삽입된 두 개의 상기 가이드와이어(1)를 따라 삽입튜브(20)와 위치고정튜브(30)가 체내로 이동된다.,The insertion tube 20 and the position-fixing tube 30 are moved into the body along the two guide wires 1 inserted into the body beforehand.,True,0.162953183054924,0.9072723521578944,12,25,-13,64,140,-76
"하대정맥-삼첨판막-폐동맥으로 삽입된 가이드와이어(1)를 따라 상기 삽입튜브(20)가 체내로 이동되며, 하대정맥-관상정맥으로 삽입된 가이드와이어(1)를 따라 상기 위치고정튜브(30)가 체내로 이동된다.","The insertion tube 20 is moved into the body along the guide wire 1 inserted into the inferior vena cava, tricuspid valve, and pulmonary artery, and the position-fixing tube 30 is moved into the body along the guide wire 1 inserted into the inferior vena cava and coronary sinus.",True,0.2794934809207916,0.8574305950321848,16,49,-33,111,279,-168
"도 6과 같이 위치고정튜브를 구비한 삼첨판막 역류증 시술용 기구가 상대정맥-삼첨판막-폐동맥으로 삽입하기 위해서는 먼저, 두 개의 가이드와이어(1)가 체내에 삽입되며, 하나의 가이드와이어(1)는 상대정맥(Superior vena cave, SVC)에서 삼첨판막(Tricuspid Valve, TV), 폐동맥(Pulmonary artery, PA)으로 삽입되고, 나머지 하나의 가이드와이어(1)는 상대정맥(Superior vena cave, SVC)에서 관상정맥(Coronary sinus, CS)로 삽입된다.","As in FIG. 6, for the tricuspid regurgitation surgical instrument having a position-fixing tube to be inserted into the superior vena cava, tricuspid valve, and pulmonary artery, first, two guide wires 1 are inserted into the body.",True,0.3239471912384033,0.8181592925678709,42,37,5,283,231,52
체내에 먼저 삽입된 두 개의 상기 가이드와이어(1)를 따라 삽입튜브(20)와 위치고정튜브(30)가 삽입된다.,The insertion tube 20 and the position-fixing tube 30 are inserted along the two guide wires 1 inserted into the body beforehand.,False,0.1491623073816299,0.9135312457557282,11,22,-11,60,129,-69
"상대정맥-삼첨판막-폐동맥으로 삽입된 가이드와이어(1)를 따라 상기 삽입튜브(20)가 삽입되며, 상대정맥-관상정맥으로 삽입된 가이드와이어(1)를 따라 상기 위치고정튜브(30)가 삽입된다.","The insertion tube 20 is inserted along the guide wire 1 inserted into the superior vena cava, tricuspid valve, and pulmonary artery, and the position-fixing tube 30 is inserted along the guide wire 1 inserted into the superior vena cava and coronary sinus.",False,0.328979343175888,0.8337521968574388,14,43,-29,103,257,-154
"이후 과정은 도 5 및 도 6이 동일하며, 차단부(10)는 상기 삽입튜브(20)의 외부 측면에 결합되어 상기 삽입튜브(20)를 따라 체내로 이동하여 삼첨판막의 빈 공간(orifice)을 관통한다.",The blocking part 10 is coupled to an outer side surface of the insertion tube 20 and is moved into the body along the insertion tube 20 to penetrate an orifice of the tricuspid valve.,False,0.3898834884166717,0.7961087261806356,23,35,-12,109,184,-75
차단부(10)는 상기 삽입튜브(20)의 외부 측면에 결합되어 상기 삽입튜브(20)를 따라 체내로 이동하여 삼첨판막의 빈 공간(orifice)을 관통한다.,The blocking part 10 is coupled to an outer side surface of the insertion tube 20 and is moved into the body along the insertion tube 20 to penetrate an orifice of the tricuspid valve.,True,0.1849858164787292,0.9032934561292268,15,35,-20,85,184,-99
"이때, 상기 삽입튜브(20)와 상기 위치고정튜브(30)는 체내에서 상기 가이드와이어(1)가 삽입된 경로에 따라 휘거나 굽어질 수 있는 연성의 재질인 것이 특징이다.","Here, the insertion tube 20 and the position-fixing tube 30 are made of a flexible material that is bendable along a path in which the guide wire 1 is inserted inside the body.",True,0.2909851968288421,0.8420696183857013,19,33,-14,91,176,-85
"또한, 상기 가이드와이어(1) 또는 상기 위치고정튜브를 구비한 삼첨판막 역류증 시술용 기구를 체내로 진입 시 시스튜브(미도시)를 추가로 포함하여 시스튜브(미도시) 내에 삽입하여 체내로 이동할 수 있으며, 이동 완료 후 시스튜브(미도시)는 체외로 제거된다.","Also, when making the tricuspid regurgitation surgical instrument having the guide wire 1 or the position-fixing tube enter the body, a sheath tube (not illustrated) may be further included so that the tricuspid regurgitation surgical instrument moves into the body while being inserted into the sheath tube (not illustrated), and the sheath tube (not illustrated) may be removed from the body after the movement is complete.",True,0.2632936239242553,0.8562828574819005,30,66,-36,142,425,-283
"상기 위치고정튜브(30)는 결합부(32)와 분리부(34)를 구비하며, 상기 결합부(32)는 상기 삽입튜브(20)와 결합되고 상기 분리부(34)가 관상정맥에 삽입되어 상기 차단부(10)가 효과적으로 삼첨판막의 빈 공간을 차단할 수 있는 관통 각도를 형성하도록 한다.","The coupling part 32 is coupled to the insertion tube 20, and the separated part 34 is inserted into the coronary sinus to form a penetration angle that allows the blocking part 10 to effectively block the orifice of the tricuspid valve.",False,0.225986897945404,0.8883210519419672,27,42,-15,147,237,-90
"또한, 상기 위치고정튜브(30)와 상기 차단부(10)는 상기 삽입튜브(20)를 중심으로 서로 반대 방향에 결합되어 상기 위치고정튜브(30)가 관상정맥에 삽입됨으로써 상기 차단부(10)의 차단막(12)이 좌우방향 일측으로 기울어지지 않고 삼첨판막의 판막엽과 유사한 평면으로 삼첨판막의 빈 공간에 관통될 수 있도록 한다.","Also, since the position-fixing tube 30 and the blocking part 10 are coupled to the insertion tube 20 in directions opposite from each other, when the position-fixing tube 30 is inserted into the coronary sinus, the blocking membrane 12 of the blocking part 10 may, without being tilted toward one side in the left-right direction, maintain a plane similar to a plane of leaflets of the tricuspid valve and penetrate the orifice of the tricuspid valve.",True,0.1822337210178375,0.9150197249844416,34,76,-42,177,452,-275
상기 차단부(10)가 삼첨판막의 빈 공간에 관통되면 상기 가이드와이어(1)를 체외로 제거하고 결합튜브(40)를 체내에 삽입한다.,"Once the blocking part 10 has penetrated the orifice of the tricuspid valve, the guide wire 1 is removed from the body, and the coupling tube 40 is inserted into the body.",True,0.2614258527755737,0.8487593462145965,13,32,-19,71,171,-100
"상기 결합튜브(40)는 내부에 형성된 결합튜브 루멘(42)에 상기 삽입튜브(20)와 상기 위치고정튜브(30)를 삽입하여 상기 삽입튜브(20) 및 상기 위치고정튜브(30)와 서로 긴밀하게 밀착되며, 끝단이 체외에 위치하여 고정된다.","The insertion tube 20 and the position-fixing tube 30 are inserted into the coupling tube lumen 42 formed inside the coupling tube 40 such that the coupling tube 40 comes into close contact with the insertion tube 20 and the position-fixing tube 30, and an end of the coupling tube 40 is placed outside the body and fixed.",True,0.1680110245943069,0.9173525383003986,23,58,-35,128,322,-194
"따라서, 상기 삽입튜브(20) 및 상기 위치고정튜브(30)가 체내에 삽입된 후 이동하거나 회전하지 않도록 고정하여 안정적으로 삼첨판막의 빈 공간을 차단할 수 있도록 한다.","Therefore, the insertion tube 20 and the position-fixing tube 30 are fixed so as not to move or rotate after being inserted into the body, and thus the orifice of the tricuspid valve may be stably blocked.",True,0.2259567379951477,0.882430207427236,21,37,-16,95,205,-110
본 발명에 따른 위치고정튜브를 구비한 삼첨판막 역류증 시술용 기구는 시술자가 상대정맥 또는 하대정맥으로 간편하게 일정시간 체내에 삽입하여 우심실 과부하 여부를 확인할 수 있다.,An operator may easily and conveniently insert the tricuspid regurgitation surgical instrument having a position-fixing tube according to the present disclosure into the body for a predetermined amount of time to check whether right-sided heart failure has occurred.,True,0.3620574474334717,0.7726624265253085,23,38,-15,98,266,-168
"또한, 위치고정튜브가 관상정맥에 삽입되어 하대정맥과 삼첨판막 사이의 거리가 먼 환자라도 차단부가 빈 공간을 효율적으로 차단할 수 있는 관통 각도를 형성하며, 차단부가 좌우방향 일측으로 기울어지지 않고 삼첨판막의 판막엽과 유사한 평면으로 삼첨판막의 빈 공간에 관통됨으로써 삼첨판막의 불완전한 닫힘 현상으로 인해 발생되는 빈 공간(orifice)을 효율적으로 차단하여 삼첨판막 역류증을 치료할 수 있는 것이다.","Also, since the position-fixing tube is inserted into the coronary sinus, even for a patient with a long distance between the inferior vena cava and tricuspid valve, it is possible to form a penetration angle that allows the blocking part to efficiently block the orifice.",False,0.3953697681427002,0.7879215216145179,49,45,4,227,272,-45
"이상과 첨부된 도면을 참조하여 본 발명의 실시예를 설명하였지만, 본 발명이 속하는 기술분야에서 통상의 지식을 가진 자는 본 발명이 그 기술적 사상이나 필수적인 특징을 변경하지 않고서 다른 구체적인 형태로 실시될 수 있다는 것을 이해할 수 있을 것이다.","The embodiments of the present disclosure have been described above with reference to the accompanying drawings, but those of ordinary skill in the art to which the present disclosure pertains should understand that the present disclosure may be embodied in other specific forms without changing the technical idea or essential features of the present disclosure.",True,0.1765754967927932,0.8783965949278486,36,55,-19,140,363,-223
그러므로 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적이 아닌 것으로 이해되어야 한다.,"Therefore, the embodiments described above should be understood as being illustrative, instead of limiting, in all aspects.",True,0.1731294095516204,0.8685190418635017,13,17,-4,57,123,-66
"소포 분류 시스템에 있어서,크로스 벨트 방식으로 구동되는 트랙(110);분류 대상이 되는 소포를 적재하여 상기 트랙(110) 측으로 이송하는 적재라인(120);상기 적재라인(120)에 의해 공급되는 소포를 상기 트랙(110)에 투입하는 적재라인 인덕션(125);상기 트랙(110)의 상측에 구비되어서, 투입된 소포를 적재한 상태로 상기 트랙(110)이 구동됨에 따라 함께 이동하는 캐리어(112);상기 트랙(110)을 따라서 복수 개가 구비되되, 상기 트랙(110) 상의 소포가 동일 목적지별로 방출되도록 하는 슈트(140);상기 트랙(110)의 일측에 구비되되, 소포의 상면 및 측면에 표시된 소포 정보를 판독하고 상기 트랙(110) 상의 소포의 위치를 감지하는 5면 영상처리부(150); 상기 5면 영상처리부(150)에 의해 판독되지 않은 소포를 상기 트랙(110)에 재투입하도록 하는 피드백라인(160); 및상기 5면 영상처리부(150)로부터 전달되는 상기 소포 정보를 이용하여 소포를 방출할 슈트(140)를 결정하는 제어부;를 포함하고,상기 트랙(110)은 제1, 2 트랙(110a, 110b)이 한 쌍으로 구비되어 각각 소포 집중지역의 소포와 그 외 지역의 소포를 처리하도록 하되, 해당 지역의 소포가 아닌데 잘못 투입된 소포가 해당되는 트랙(110)으로 이송될 수 있도록 상기 제1, 2 트랙(110a, 110b)을 서로 연결하는 숏컷라인(180); 및 상기 숏컷라인(180)에 의해 공급되는 소포를 상기 트랙(110)에 투입하도록 하는 숏컷라인 인덕션(185);을 더 포함하는 것을 특징으로 하는 소포 분류 시스템(100).","A parcel sorting system 100 comprising: a track 110 driven in a cross-belt type; a loading line 120 loading and conveying parcels to be sorted to the track 110; a loading line induction 125 putting parcels supplied by the loading line 120 to the track 110; carriers 112 disposed on the track 110 and moved by operation of the track 110 with the parcels thereon which have been put in; a plurality of chutes 140 disposed along the track 110 so that the parcels on the track 110 are discharged by the same destination groups; a 5-face image processor 150 disposed at a side of the track 110, reading out parcel information marked on the top and sides of parcels, and sensing the positions of parcels on the track 110; a feedback line 160 putting parcels not read out by the 5-face image processor 150 back to the track; and a controller determining chutes 140 for discharging parcels using the parcel information transmitted from the 5-face image processor 150, wherein the track 110 includes a pair of first and second tracks 110a, 110b, which handle parcels for parcel-dense areas and parcels for other areas, and the parcel sorting system further comprises: a shortcut line 180 connecting the first and second tracks 110a, 110b so that parcels, which are not parcels for a corresponding area and have been put in wrong, can be conveyed to a corresponding track 110; and a shortcut line induction 185 putting parcels supplied by the shortcut line to the track 110.",True,0.3854945302009582,0.8785098787626697,157,255,-98,804,1464,-660
"청구항 1에 있어서,상기 적재라인(120) 중 상기 적재라인 인덕션(125)에 진입 전의 일부에 복수 개의 미터링 컨베이어(122)가 연속적으로 이격 배치되도록 구성되고,상기 미터링 컨베이어(122) 사이의 하부에 설치되되 상기 미터링 컨베이어(122) 사이의 이격 공간을 통하여 상기 소포(10)의 바닥면에 표시된 상기 소포 정보를 판독한 후 상기 제어부로 전달하는 1면 영상처리부(124)가 구비되는 것을 특징으로 하는 소포 분류 시스템(100).","The parcel sorting system of claim 1, wherein a plurality of metering conveyors 122 is spaced apart from each other and sequentially disposed at a partial section before entering the loading line induction 125 of the loading line 120, and the parcel sorting system 100 comprises a 1-face image processor 124 installed under between the metering conveyors 122, reading out the parcel information marked on the bottom of the parcel 10 through the gap between the metering conveyors 122, and then transmitting the parcel information to the controller.",True,0.345302939414978,0.8801634852612796,52,88,-36,252,548,-296
"청구항 2에 있어서,상기 1면 영상처리부(124)의 판독과 함께 상기 적재라인(120)에 투입되는 소포들에 대해 소포고유번호가 순차적으로 부여되되,상기 미터링 컨베이어(122)들의 각 소포 도입부에는 상기 소포고유번호가 부여된 소포의 길이를 측정하여 상기 제어부로 전달하는 센서부(126)가 구비되는 것을 특징으로 하는 소포 분류 시스템(100).","The parcel sorting system 100 of claim 2, wherein simultaneously with reading-out by the 1-face image processor 124, a parcel identification number is sequentially given to the parcels that are put to the loading line 120, and a sensor unit 126 that measures and transmits lengths of parcels given the parcel identification numbers to the controller is disposed at each particle inlet of the metering conveyors 122.",True,0.2785618901252746,0.900806529864151,37,67,-30,194,415,-221
"청구항 3에 있어서,상기 제어부는 상기 미터링 컨베이어(122)를 따라 순차적으로 이송되는 소포의 상기 소포고유번호 및 상기 소포의 길이를 포함하는 트래킹 정보를 실시간으로 비교하여, 최초 측정된 길이값과 소정 차이가 있는 소포의 상기 소포고유번호를 삭제하도록 하고, 상기 소포고유번호가 삭제된 채로 상기 트랙(110)에 투입되는 소포에 대해서는, 상기 트랙(110)에 구비되는 상기 5면 영상처리부(150)와 연동하여 새롭게 분류되는 번호대로 시작하는 소포고유번호를 부여하도록 하는 것을 특징으로 하는 소포 분류 시스템(100).","The parcel sorting system 100 of claim 3, wherein the controller compares in real time tracking information including the parcel identification numbers of parcels sequentially conveyed along the metering conveyors 122 and lengths of the parcels, and deletes the parcel identification numbers of parcels having a predetermined difference from initially measured length values, and gives a parcel identification number starting with a newly classified number level to a parcel that is put to the track 110 with the parcel identification number deleted in cooperation with the 5-face image processor 150 provided for the track 110.",True,0.2457146048545837,0.9169516658297526,62,95,-33,297,628,-331
"청구항 1에 있어서,상기 숏컷라인(180) 중 상기 숏컷라인 인덕션(185)에 진입 전의 일부에 미터링 컨베이어(182)가 연속적으로 이격 배치되도록 구성되되,상기 미터링 컨베이어(182)의 일측에는 소포에 표시된 소포 정보를 판독하는 3면 영상처리부(184)가 구비되어, 소포를 상기 숏컷라인(180)으로 보내는 트랙(110)에서의 소포 정보와 상기 소포를 전달받은 숏컷라인(180)의 상기 미터링 컨베이어(182)에서 판독된 소포 정보가 일치하는지 판단하여, 서로 일치하지 않는 경우에는 해당 소포에 대하여 새롭게 분류되는 번호대로 시작하는 소포고유번호가 부여되도록 하는 것을 특징으로 하는 소포 분류 시스템(100).","The parcel sorting system 100 of claim 1, wherein metering conveyors 182 are spaced apart from each other and sequentially disposed at a partial section before entering the shortcut line induction 185 of the shortcut line 180, and a 3-face image processor 184 that reads out parcel information marked on parcels is disposed at a side of the metering conveyor 182, it is determined whether parcel information at the track 110 sending a parcel to the shortcut line 180 and parcel information read out by the metering conveyor 182 of the shortcut line 180 receiving the parcel coincide with each other, and when the items of information do not coincide with each other, the parcel is given a parcel identification number starting with a newly classified number level.",True,0.3346659541130066,0.8826704265826536,67,128,-61,348,764,-416
"청구항 5에 있어서,상기 미터링 컨베이어(182)들의 각 소포 도입부마다 소포고유번호가 부여된 소포의 길이를 측정하여 상기 제어부로 전달하는 센서부(186)가 구비되어,상기 제어부는 상기 미터링 컨베이어(182)를 따라 순차적으로 이송되는 소포의 상기 소포고유번호 및 상기 소포의 길이를 포함하는 트래킹 정보를 실시간으로 비교하여 최초 측정된 길이값과 소정 차이가 있는 소포의 상기 소포고유번호를 삭제하여 상기 트랙(110)에 투입되도록 한 후, 상기 트랙(110)에 구비되는 상기 5면 영상처리부(150)와 연동하여 새롭게 분류되는 번호대로 시작하는 소포고유번호가 부여되도록 하는 것을 특징으로 하는 소포 분류 시스템(100).","The parcel sorting system 100 of claim 5, wherein a sensor unit 126 that measures and transmits lengths of parcels given parcel identification numbers to the controller is disposed at each particle inlet of the metering conveyors 122, and the controller compares in real time tracking information including the parcel identification numbers of parcels sequentially conveyed along the metering conveyors 182 and lengths of the parcels, and puts parcels having a predetermined difference from initially measured length values to the track with the parcel identification numbers of the parcels deleted, and then gives parcel identification numbers starting from a newly classified number level in cooperation with the 5-face image processor 150 provided for the track 110.",True,0.3483226299285888,0.8878083705960736,72,116,-44,352,769,-417
"청구항 1 내지 6 중 어느 한 항에 있어서,상기 제1, 2 트랙(110a, 110b)으로 구성되는 상기 트랙(110)은 수직 프레임을 따라 상하로 복수 단으로 설비되며, 각 단마다 상기 제1, 2 트랙(110a, 110b)을 따라 구비되는 상기 슈트(140)는 각 단 마다 소포가 투입되는 투입구(141)를 가지면서 각 단을 연결하여 가장 아래 단의 하측에 구비되는 하나의 방출구(142)로 소포가 방출되도록 하는 것을 특징으로 하는 소포 분류 시스템(100).","The parcel sorting system 100 of any one of claims 1 to 6, wherein the track 110 composed of the first and second tracks 110a, 110b is installed in a plurality of stages up and down along a vertical frame, and the chute 140 provided along the first and second tracks 110a, 110b at each stage has an inlet 141 into which parcels are put at each stage and connects the stages such that parcels 142 are discharged to one outlet 142 provided under the lowermost stage.",True,0.2712914645671844,0.9009140913126312,60,87,-27,259,464,-205
"청구항 7에 있어서,상기 숏컷라인(180)은 각 단 마다 제1, 2 숏컷라인(180a, 180b)으로 구비되되, 상기 제1 숏컷라인(180a)은 상기 제2 트랙(110b)에서 상기 제1 트랙(110a)으로 소포를 전송하고, 상기 제2 숏컷라인(180b)은 상기 제1 트랙(110a)에서 상기 제2 트랙(110b)으로 소포를 전송하도록 하는 것을 특징으로 하는 소포 분류 시스템(100).","The parcel sorting system 100 of claim 7, wherein the shortcut line 180 is composed of first and second shortcut lines 180a, 180b at each stage, the first shortcut line 180a sends parcels from the second track 110b to the first track 110a, and the second shortcut line 180b sends parcels from the first track 110a to the second track 110b.",True,0.2039958387613296,0.9173699051593176,41,61,-20,216,339,-123
"청구항 7에 있어서,복수 단으로 구비되는 상기 트랙(110)들 가운데 상부 단의 트랙(110)에는 티퍼를 통해 소형 경량의 소포를 무인으로 대량 투입하도록 하는 것을 특징으로 하는 소포 분류 시스템(100).","The parcel sorting system 100 of claim 7, wherein small-size and light parcels are put to the upper track 110 of the tracks 110 provided in a plurality stages in a large quantity through a tipper without a worker.",True,0.3443803787231445,0.8484555494751712,26,39,-13,116,213,-97
"청구항 7에 있어서,복수 단으로 구비되는 상기 트랙(110)을 포함하고 컨베이어로 구성되는 상기 적재라인(120)과 상기 피드백라인(160, 170) 및 상기 숏컷라인(180)은, 시스템(100)을 설치하고자 하는 건물 천장의 가로 방향의 서브 빔으로부터 수직으로 연장되는 빔 서포터와 행어에 의해 연결되어 공중에 매달리는 상태로 구비되되, 서로 교차하거나 평행하게 작동되도록 구성되는 것을 특징으로 하는 소포 분류 시스템(100).","The parcel sorting system 100 of claim 7, wherein the loading line 120, the feedback line 160, 170, and the shortcut line 180 including the tracks 110, which are provided in a plurality of stage, and configured as conveyors are connected and hung in the air by beam supporters and hangers vertically extending from transverse sub-beams of the ceiling of a building in which the system 100 is installed, and are configured to operate across each other or in parallel with each other.",True,0.2516135275363922,0.9031817479393778,49,83,-34,242,482,-240
"제 1 항에 있어서,상기 단핵성 전이금속 복합체의 전이금속은 왜곡된 팔면체 구조로 6-배위된 것인, 단핵성 전이금속 복합체.","[Claim 5] The mononuclear transition metal complex of claim 1, wherein the transition metal of the mononuclear transition metal complex is 6-coordinated in a distorted octahedral structure.",False,0.2859393954277038,0.8411394350785042,16,27,-11,69,189,-120
"하기 화학식 1로서 표시되는 단핵성 전이금속 복합체를 포함하는, 이산화탄소 환원용 광촉매:[화학식 1] 상기 화학식 1에서, M은 Ni, Fe, Mn 또는 Co인 단핵성 전이금속이고,L1은 , , 또는 이고,L2는 이고, 상기 L1에서, X는 N 또는 P이고, Y는 -CH, -N-, -NH, -S- 또는 -O-이며;상기 L2에서, Z는 -O-, -S- 또는 -NH이고, W는 -P- 또는 -N-이며;상기 L1 또는 상기 L2에 포함되는 아릴기 및/또는 헤테로아릴기는 치환 또는 비치환된 것으로서, 상기 아릴기 및/또는 상기 헤테로아릴기가 치환된 경우에, 치환기는 선형 또는 분지형의 C1-C6 알킬기, C3-C6 시클로알킬기, C2-C6 헤테로시클로알킬기, 선형 또는 분지형의 C1-C6 알콕시기, 할로겐기, 아민기, 또는 선형 또는 분지형의 C1-C6 알킬아민기에서 선택되는 하나 이상이고,상기 파선은 단핵성 전이금속에 리간드가 배위되는 것을 의미함.","[Claim 6] A photocatalyst for carbon dioxide reduction, comprising a mononuclear transition metal complex represented by the following Formula 1: [Formula 1] L1 -M-(L2 )2 wherein M is a mononuclear transition metal of Ni, Fe, Mn, or Co, 7/ \ L' is,, -,or L 2 is in L', X is N or P, 50 Y is -CH, -N-, -NH, -S-, or -0-; in L 2, Z is -0-, -S-, or -NH, W is -P- or -N-; the aryl group and/or heteroaryl group included in L' or L 2 is substituted or unsubstituted, and when the aryl group and/or the heteroaryl group is substituted, the substituent is one or more selected from a linear or branched C-C alkyl group, a C3-C6 cycloalkyl group, a C2-C6 heterocycloalkyl group, a linear or branched Ci-C6 alkoxy group, a halogen group, an amine group, or a linear or branched Ci-C6 alkylamine group, and the broken line means that the ligand is coordinated to the mononuclear transition metal.",True,0.2619929313659668,0.8892193529157331,103,162,-59,478,884,-406
"제 6 항에 있어서,상기 이산화탄소 환원용 광촉매는 이산화탄소를 포름산으로 환원시키는 것인, 이산화탄소 환원용 광촉매.","[Claim 7] The photocatalyst for carbon dioxide reduction of claim 6, wherein the photocatalyst for carbon dioxide reduction is to reduce carbon dioxide to formic acid.",True,0.3484354019165039,0.8339963209530696,14,26,-12,66,167,-101
"제 6 항에 있어서, 상기 이산화탄소 환원용 광촉매는 조촉매를 추가 포함하는 것으로서,상기 조촉매는 에오신 Y(eosin Y), Ru(bpy)3, C3N4, CdS, CdSe 및 트리에탄올아민 (triethanolamine)에서 선택되는 하나 이상을 포함하는 것인, 이산화탄소 환원용 광촉매.","[Claim 8] The photocatalyst for carbon dioxide reduction of claim 6, further comprising a cocatalyst, wherein the cocatalyst includes one or more selected from eosin Y, Ru(bpy)3, C 3 N4, CdS, CdSe, and triethanolamine.",True,0.3340210318565368,0.8416395620894295,31,34,-3,163,218,-55
"제 6 항에 있어서,상기 L1은 또는 이고, 상기 Y는 -CH 또는 -N-인 것인, 이산화탄소 환원용 광촉매.","51 [Claim 9] The photocatalyst for carbon dioxide reduction of claim 6, wherein L' is or, and Y is -CH or -N-.",True,0.4440919160842895,0.7852593461124674,16,22,-6,61,110,-49
"제 6 항에 있어서,상기 L1은 또는 이고,상기 Y는 -NH, -S- 또는 -O-인 것인, 이산화탄소 환원용 광촉매.","[Claim 10] The photocatalyst for carbon dioxide reduction of claim / \ 6, wherein L' is or, and Y is NH, -S-, or -0-.",True,0.4805973172187805,0.7659523054703856,16,24,-8,65,117,-52
"제 6 항에 있어서,상기 단핵성 전이금속 복합체는 (2-(2-피리딜)벤조티아졸)Ni(피리딘-2-티올레이트)2, (2-(2-피리딜)벤즈이미다졸)Ni(피리딘-2-티올레이트)2,(2-(2-피리딜)벤조티아졸)Co(피리딘-2-티올레이트)2, (2-(2-피리딜)벤즈이미다졸)Co(피리딘-2-티올레이트)2, (2-(2-피리딜)벤조티아졸)Mn(피리딘-2-티올레이트)2, (2-(2-피리딜)벤즈이미다졸)Mn(피리딘-2-티올레이트)2, (2-(2-피리딜)벤조티아졸)Fe(피리딘-2-티올레이트)2, 및 (2-(2-피리딜)벤즈이미다졸)Fe(피리딘-2-티올레이트)2에서 선택되는 하나 이상인 것인, 이산화탄소 환원용 광촉매.","[Claim 11] The photocatalyst for carbon dioxide reduction of claim 6, wherein the mononuclear transition metal complex is one or more selected from (2-(2-pyridyl)benzothiazole)Ni(pyridine-2-thiolate)2, (2-(2 pyridyl)benzimidazole)Ni(pyridine-2-thiolate)2, (2-(2-pyridy l)benzothiazole)Co(pyridine-2-thiolate)2, (2-(2-pyridyl))ben zimidazole)Co(pyridine-2-thiolate)2, (2-(2-pyridyl)benzothia zole)Mn(pyridine-2-thiolate)2, (2-(2-pyridyl)benzimidazole)M n(pyridine-2-thiolate)2, (2-(2-pyridyl)benzothiazole)Fe (pyri dine-2-thiolate)2,and(2-(2-pyridyl)benzimidazole)Fe (pyridin e-2-thiolate).",True,0.2612850964069366,0.8889464050576625,22,39,-17,336,589,-253
"제 6 항 내지 제 11 항 중 어느 한 항에 따른 이산화탄소 환원용 광촉매를 이용하는 것을 포함하는, 이산화탄소를 포름산으로 환원시키는 방법.","52 [Claim 12] A method for reducing carbon dioxide to formic acid, the method comprising using the photocatalyst for carbon dioxide reduction of any one of claims 6 to.",True,0.4164307415485382,0.7978477864868435,22,29,-7,80,168,-88
"제 12 항에 있어서,상기 광촉매의 생성 속도는 2,000 TON·h-1 내지 5,000 TON·h-1인 것인, 이산화탄소를 포름산으로 환원시키는 방법.","[Claim 13] The method of claim 12, wherein a production rate of the photocatalyst is from about 2,000 TON-h-Ito 5,000 TON-h-.",True,0.3663205206394195,0.8160969157789548,17,21,-4,85,125,-40
"제 12 항에 있어서,상기 광촉매의 선택도는 90% 이상인 것인, 이산화탄소를 포름산으로 환원시키는 방법.","[Claim 14] The method of claim 12, wherein a selectivity of the photocatalyst is 90% or more.",True,0.3789018392562866,0.7929989256009221,13,17,-4,59,93,-34
"제 12 항에 있어서,상기 방법은 pH 8 내지 14 범위에서 수행되는 것인, 이산화탄소를 포름산으로 환원시키는 방법.","[Claim 15] The method of claim 12, wherein the method is carried out at a pH ranging from 8 to.",True,0.4172970056533813,0.7828716447571609,16,20,-4,66,95,-29
"제 12 항에 있어서,상기 이산화탄소 환원용 광촉매는 (2-(2-피리딜)벤조티아졸)Ni(피리딘-2-티올레이트)2, (2-(2-피리딜)벤즈이미다졸)Ni(피리딘-2-티올레이트)2,(2-(2-피리딜)벤조티아졸)Co(피리딘-2-티올레이트)2, (2-(2-피리딜)벤즈이미다졸)Co(피리딘-2-티올레이트)2, (2-(2-피리딜)벤조티아졸)Mn(피리딘-2-티올레이트)2, (2-(2-피리딜)벤즈이미다졸)Mn(피리딘-2-티올레이트)2, (2-(2-피리딜)벤조티아졸)Fe(피리딘-2-티올레이트)2, 및 (2-(2-피리딜)벤즈이미다졸)Fe(피리딘-2-티올레이트)2에서 선택되는 하나 이상의 상기 단핵성 전이금속 복합체를 포함하는 것인, 이산화탄소를 포름산으로 환원시키는 방법.","[Claim 16] The method of claim 12, wherein the photocatalyst for carbon dioxide reduction includes one or more mononuclear transition metal complexes selected from (2-(2-pyridyl)benzothiazole)Ni(pyridine-2-thiolate)2, (2-(2 pyridyl)benzimidazole)Ni(pyridine-2-thiolate)2, (2-(2-pyridy 1)benzothiazole)Co(pyridine-2-thiolate)2, (2-(2-pyridyl))ben zimidazole)Co(pyridine-2-thiolate)2, (2-(2-pyridyl)benzothia 53 zole)Mn(pyridine-2-thiolate)2, (2-(2-pyridyl)benzimidazole)M n(pyridine-2-thiolate)2, (2-(2-pyridyl)benzothiazole)Fe (pyri dine-2-thiolate)2,and(2-(2-pyridyl)benzimidazole)Fe (pyridin e-2-thiolate).",True,0.2988568246364593,0.8739051105219919,28,41,-13,368,608,-240
"제 12 항에 있어서,상기 방법은 용매 내에서 수행되는 것이고,상기 용매는 물과 알코올을 함유하는 혼합 용매인 것인, 이산화탄소를 포름산으로 환원시키는 방법.","[Claim 17] The method of claim 12, wherein the method is carried out in a solvent, and the solvent is a mixed solvent containing water and alcohol.",True,0.2391606420278549,0.8718188498969653,20,27,-7,88,147,-59
"제 12 항에 있어서,상기 방법은 실온에서 수행되는 것인, 이산화탄소를 포름산으로 환원시키는 방법.","[Claim 18] The method of claim 12, wherein the method is carried out at room temperature.",True,0.48462575674057,0.737712722972048,12,16,-4,55,89,-34
"그리고, 각 지지축(16a, 4a)은, 상기 폭 방향과 평행을 이루는 방향으로, 사이드 프레임(2)의 내측벽(27) 및 외측벽(28)에 대하여 베어링(22a, 22b, 22d, 22e)을 통하여 회전 가능하게 지지되어 있다.","Each of the support shafts 16a and 4a is rotatably supported via bearings 22a, 22b, 22d and 22e with respect to the inner wall 27 and an outer wall 28 of the side frame 2, in a direction parallel to the width direction.",True,0.1838961392641067,0.9224439338289264,25,43,-18,125,219,-94
"다만, 각 지지축(16a, 4a)은, 이와 같이 사이드 프레임(2)에 지지된 상태에 있어서, 그 일단 측의 단부를 내측벽(27)으로부터 상기 내측을 향하여 돌출시키는 형태로 설치되어 있다.]","Each of the support shafts 16a and 4a is provided in such a form that an end portion on one end-side protrudes from the inner wall 27 toward the inner side, in a state of being supported on the side frame 2 as described above.",True,0.3771215379238128,0.8443626988700633,23,45,-22,106,226,-120
"[그리고, 양 사이드 프레임(2, 2)의 각각에 설치된 한 쌍의 지지축(16a, 16a)의 상기 일단 측의 단부에 대하여 그 양 단부에 있어서 연결됨으로써, 주축(16)은, 양 사이드 프레임(2, 2) 사이에 가설된 형태로 되어 있다.","Further, the main shaft 16 is connected at both end portions thereof to an end portion on the one end-side of each of the pair of support shafts 16a and 16a provided for each of both the side frames 2 and 2, and is thus bridged between both the side frames 2 and 2.",True,0.3471665680408478,0.8607765246109358,31,54,-23,131,265,-134
"따라서, 각 지지축(16a)에서의 상기 일단 측의 단부가, 그 지지축(16a)에서의 주축(16)에 대한 연결단(16c)이 되어 있다.","Therefore, the end portion on the one end-side of the support shaft 16a is formed as a connecting end 16c of the support shaft 16a to the main shaft 16.",True,0.3049182593822479,0.870396749510313,14,30,-16,74,152,-78
"마찬가지로, 한 쌍의 지지축(4a, 4a)의 상기 일단 측의 단부(연결단(4c))에 대하여 그 양 단부에 있어서 연결됨으로써, 로킹 축(4)은, 양 사이드 프레임(2, 2) 사이에 가설된 형태로 되어 있다.]","Similarly, the rocking shaft 4 is connected at both end portions thereof to an end portion (connecting end 4c) on the one end-side of each of the pair of support shafts 4a and 4a and is thus bridged between both the side frames 2 and 2.",True,0.2182761877775192,0.9075982449719364,26,46,-20,116,236,-120
"[그리고, 직기에 있어서는, 로킹 축(4)은, 회전 구동되는 주축(16)(지지축(16a))에 의해 왕복 요동 구동되도록 되어 있다.","In the loom, the rocking shaft 4 is adapted to reciprocally rock by means of the main shaft 16 (support shaft 16a) that is rotationally driven.",True,0.3180762529373169,0.8310299665748703,14,26,-12,73,143,-70
"이에, 지지축(16a)은, 사이드 프레임(2) 내에 있어서, 회전 운동을 요동 운동으로 변환하는 운동 변환 기구(도시 생략)을 통하여, 지지축(4a)에 대하여 기계적으로 연결되어 있다.","Therefore, the support shaft 16a is mechanically connected to the support shaft 4a via a motion converting mechanism (not shown) configured to convert rotation motion into rocking motion, in the side frame 2.",True,0.215252012014389,0.8970876421624969,21,33,-12,103,208,-105
"즉, 로킹 축(4)을 지지하는 지지축(4a)과 주축(16)을 지지하는 지지축(16a)은, 운동 변환 기구에 의해 기계적으로 연결되어 있다.","Specifically, the support shaft 4a configured to support the rocking shaft 4 and the support shaft 16a configured to support the main shaft 16 are mechanically connected to each other by the motion converting mechanism.",True,0.2065152823925018,0.8924522190953547,15,35,-20,77,219,-142
"한편 그 운동 변환 기구는, 예를 들면, 크랭크 기구나 캠 기구이다.]","Note that, the motion converting mechanism is, for example, a crank mechanism or a cam mechanism.",True,0.3222420215606689,0.759230953341605,11,16,-5,39,97,-58
"[또한, 복권 롤(15)을 지지하기 위한 지지축(15a, 15a)은, 그 일단에 플랜지(15b)를 가지는 축 부재로서 형성되어 있다.",The support shafts 15a and 15a for supporting the cloth winding roll 15 are each formed as a shaft member having a flange 15b at one end thereof.,True,0.4327579140663147,0.7961812552014442,15,28,-13,74,145,-71
"그리고, 그 각 지지축(15a)은, 상기 폭 방향과 평행을 이루는 방향으로서 플랜지(15b)가 설치되어 있는 상기 일단이 상기 내측으로 되는 방향으로, 사이드 프레임(2)의 내측벽(27)에 대하여 베어링(22c)을 통하여 회전 가능하게 지지되어 있다.","Each of the support shafts 15a is rotatably supported via a bearing 22c with respect to the inner wall 27 of the side frame 2, in a direction parallel to the width direction, in which the one end at which the flange 15b is provided is the inner side.",True,0.2359744310379028,0.9076601912143322,29,49,-20,140,250,-110
"또한, 그 지지축(15a)에서의 플랜지(15b)에는, 복권 롤(15)을 연결하기 위한 고정용 볼트(15c)가 삽통되는 관통공이 복수 형성되어 있다.]",The flange 15b of the support shaft 15a is formed with a plurality of through-holes in which bolts 15c for fixing for connecting the cloth winding roll 15 are inserted.,True,0.2765327394008636,0.8667683480606863,15,30,-15,83,168,-85
"[그리고, 양 사이드 프레임(2, 2)의 각각에 설치된 한 쌍의 지지축(15a, 15a)에 대하여 그 양 단부에 있어서 연결됨으로써, 복권 롤(15)은, 양 사이드 프레임(2, 2) 사이에 가설된 형태로 되어 있다.","Further, the cloth winding roll 15 is connected at both end portions to the pair of support shafts 15a and 15a provided on each of both the side frames 2 and 2 and is thus bridged between both the side frames 2 and 2.",True,0.3418873846530914,0.8554817887004357,28,44,-16,120,217,-97
"그리고, 한 쌍의 지지축(15a, 15a)에 대한 복권 롤(15)의 연결은, 각 플랜지(15b)의 상기 관통공에 삽통된 고정용 볼트(15c)가 복권 롤(15)의 단면에 개구되도록 형성된 대응하는 암나사 구멍에 나사 장착됨으로써 행해지고 있다.","Note that, the cloth winding roll 15 is connected to the pair of support shafts 15a and 15a by screwing the bolts 15c for fixing inserted in the through-holes of each flange 15b into female screw holes formed to open to end faces of the cloth winding roll 15.",True,0.318348616361618,0.859176176331777,28,49,-21,135,259,-124
"따라서, 플랜지(15b)는, 그 지지축(15a)에서의 복권 롤(15)에 대한 연결단이 되어 있다.]","Therefore, the flange 15b serves as a connecting end of the support shaft 15a to the cloth winding roll 15.",True,0.3086745738983154,0.8505399194276971,10,20,-10,55,107,-52
"[이상과 같은 직기에 있어서, 본 발명에서는 한 쌍의 사이드 프레임의 양쪽 또는 한쪽에서의 상기한 각 지지축(16a, 4a, 15a)의 지지 위치가 되는 내측벽(27)의 부분인 지지부 중 적어도 1개가, 그 지지부에 대응하는 지지축을 지지하기 위해 배치되는 베어링의 지지 위치의 내측단을 전술한 기준 위치보다 상기 내측에 위치시킨 오프셋 지지부가 되도록 형성된다.","In the loom as described above, in the present invention, at least one of support parts, which are parts of the inner wall 27 becoming support positions of each of the support shafts 16a, 4a and 15a on one or both of the pair of side frames, is formed to be an offset support part at which an inner end of the support position of the bearing arranged so as to support the support shaft corresponding to the support part is located on the more inner side than the reference position.",True,0.2517642080783844,0.8949288258297854,48,91,-43,203,482,-279
"그리고, 본 실시예는, 양 사이드 프레임(2, 2)에서의 각 상기 지지부 전체를 오프셋 지지부(17)로 한 예이다.",The present embodiment is an example where all of the support parts of both the side frames 2 and 2 are formed as an offset support part 17.,True,0.2679650485515594,0.8758661770361578,15,28,-13,64,140,-76
"이러한 본 실시예의 직기에 대하여, 상세하게는, 이하와 같다.]",The loom of the present embodiment is specifically described as follows.,True,0.3366380333900451,0.7452666628132142,8,11,-3,35,72,-37
"[각 사이드 프레임(2)에 있어서는, 전술한 바와 같이 각 지지축(16a, 4a, 15a)이 상기 내측으로 돌출하는 형태로 지지되어 있다.","As described above, on each side frame 2, each of the support shafts 16a, 4a and 15a is supported in a form of protruding toward the inner side.",True,0.2227328568696975,0.8968672475868419,17,28,-11,77,144,-67
"따라서, 각 사이드 프레임(2)의 내측벽(27)에는, 그 각 지지축(16a, 4a, 15a)의 돌출을 허용하는 관통공(23a, 23b, 23c)이 형성되어 있다.","Therefore, the inner wall 27 of each side frame 2 is formed with through-holes 23a, 23b and 23c for enabling the support shafts 16a, 4a and 15a to protrude.",True,0.1847376078367233,0.9217524058271817,17,29,-12,90,156,-66
"그리고, 그 각 사이드 프레임(2)에서의 내측벽(27)은, 상기 폭 방향으로 보았을 때의 그 관통공(23a, 23b, 23c)을 포함하는 범위가, 기준면(10)을 포함하는 내측벽(27)의 부분에 대하여, 돌출하도록 형성되어 있다.","Further, the inner wall 27 of each side frame 2 is formed so that a range including the through-holes 23a, 23b and 23c, as seen in the width direction, protrudes with respect to a part of the inner wall 27 including the reference surface 10.",True,0.2280121892690658,0.9051182110800574,25,45,-20,128,241,-113
"즉, 사이드 프레임(2)은, 이와 같은 범위에 있어서 기준면(10)에 대하여 돌출하는 돌출부(17)를 가지고 있다.","Specifically, the side frame 2 has a protrusion part 17 that protrudes with respect to the reference surface 10 within the range.",True,0.3325808346271515,0.8300431811355364,13,22,-9,64,129,-65
"한편, 내측벽(27)의 두께 치수(두께)는 대략 균일하게 되어 있고, 기준면(10)을 포함하는 부분의 두께 치수와 돌출부(17)에서의 관통공(23a, 23b, 23c)이 형성된 부분의 두께 치수는 대략 동일하게 되어 있다.]","Note that, a thickness dimension of the inner wall 27 is substantially uniform, and a thickness dimension of the part including the reference surface 10 and a thickness dimension of the part of the protrusion part 17, in which the through-holes 23a, 23b and 23c are formed, are substantially the same.",True,0.2464230805635452,0.88954598117173,25,51,-26,125,301,-176
"[그리고, 주축(16), 로킹 축(4) 및 복권 롤(15)의 프론트 톱 스테이(3a)에 대한 지지 위치는, 전술한 바와 같은 위치로 되어 있다.","Note that, the support positions of the main shaft 16, the rocking shaft 4 and the cloth winding roll 15 with respect to the front top stay 3a are the above-described positions.",True,0.2352638244628906,0.878782127256239,19,32,-13,80,177,-97
"따라서, 상기 폭 방향으로 보았을 때의 지지축(16a, 4a, 15a)이 설치되는 위치(즉, 관통공(23a, 23b, 23c)이 형성되는 위치)를 포함하는 범위(돌출부(17)의 범위)는, 사이드 프레임(2)에 대한 프론트 톱 스테이(3a)가 장착되는 위치를 포함하고 있다.]","Therefore, a range (a range of the protrusion part 17) including the positions (i.e., the positions in which the through-holes 23a, 23b and 23c are formed) in which the support shafts 16a, 4a and 15a are provided as seen in the width direction includes a position in which the front top stay 3a is attached to the side frame 2.",True,0.1834882348775863,0.9272893035458176,29,60,-31,153,327,-174
"[또한, 그 돌출부(17)는, 그 기준면(10)(기준 위치)으로부터의 돌출량이 내측벽(27)의 두께 치수보다 큰 양이 되어 있다.","In addition, the protrusion part 17 is formed such that a protruding amount from the reference surface 10 (reference position) is greater than the thickness dimension of the inner wall 27.",True,0.2088541239500045,0.8948727291056616,14,31,-17,72,188,-116
"그리고, 돌출부(17)는, 상기 범위에서의 주위의 부분이 그 돌출량에 따른 크기이며 직기 프레임의 폭 방향으로 연장되는 벽부분(29)으로서 형성된 것으로 되어 있다.]",A peripheral part of the protrusion part 17 in the above range is formed as a wall part 29 that extends in the width direction of the loom in a size corresponding to the protruding amount.,True,0.3449722230434418,0.8254320502031575,20,36,-16,93,188,-95
"[그리고, 각 지지축(16a, 4a, 15a)을 지지하기 위한 베어링(22a, 22b, 22c)은, 베어링 홀더(19, 20, 21)를 통하여 각 사이드 프레임(2)에 대하여 장착되어 있다.","Further, the bearings 22a, 22b and 22c for supporting the support shafts 16a, 4a and 15a are attached to each side frame 2 via the bearing holders 19, 20 and 21.",True,0.2262212932109832,0.9083532460263412,21,31,-10,106,161,-55
"그리고, 그 각 베어링 홀더(19, 20, 21)에 대하여, 이들 구성은 모두 동일하므로, 이하에서는, 지지축(16a)을 지지하기 위한 베어링 홀더(19)를 예로 들어 설명한다.]","Therefore, the bearing holder 19 for the supporting the support shaft 16a is exemplarily described in the below.",False,0.4525065422058105,0.7976776730100168,21,18,3,100,112,-12
"[도 4에 나타낸 바와 같이, 그 베어링 홀더(19)는, 관통공(19c)을 가지는 원통 형상의 감삽부(嵌揷部)(19a)를 주체로 하여 구성되어 있다.","As shown in FIG. 4, the bearing holder 19 is constituted by a cylindrical fitting/insertion portion 19a having a through-hole 19c, as a main body.",True,0.1856347620487213,0.912795442611792,17,25,-8,83,146,-63
"또한, 그 베어링 홀더(19)는, 감삽부(19a)의 축선 방향에서의 일단 측에 형성된 플랜지부(19b)를 가지고 있다.",The bearing holder 19 has a flange portion 19b formed on one end-side of the fitting/insertion portion 19a in an axis line direction.,True,0.3597099483013153,0.8436767388664987,13,23,-10,66,133,-67
"그리고, 베어링(22a)은, 그 감삽부(19a)에서의 관통공(19c) 내에 수용되는 형태로, 베어링 홀더(19) 내에 설치된다.",The bearing 22a is provided in the bearing holder 19 in a form of being accommodated in the through-hole 19c of the fitting/insertion portion 19a.,True,0.2489957511425018,0.8944916280410566,12,25,-13,71,146,-75
"따라서, 그 감삽부(19a)에서의 관통공(19c)의 내경은, 베어링(22a)을 끼워서 장착한 상태로 수용할 수 있도록 한 크기로 되어 있다.","Therefore, an inner diameter of the through-hole 19c of the fitting/insertion portion 19a is sized to accommodate the bearing 22a in a fitted state.",True,0.2171147018671035,0.9082353811903552,16,24,-8,78,148,-70
"또한, 그 관통공(19c)의 상기 축선 방향에서의 치수는, 베어링(22a)의 폭 치수(두께 치수)보다 커지고 있다.]","In addition, a dimension of the through-hole 19c in the axis line direction is greater than a width dimension (thickness dimension) of the bearing 22a.",True,0.1360685378313064,0.9372509913817688,13,25,-12,65,151,-86
"[다만, 그 관통공(19c)은, 상기 일단 측의 단부에 있어서, 그 내경이 작아지도록 형성되어 있다.","However, the through-hole 19c is formed so that the inner diameter becomes smaller at an end portion on the one end-side.",True,0.290313720703125,0.841787747961391,13,21,-8,56,121,-65
"즉, 관통공(19c)은, 베어링(22a)을 수용하는 부분(수용 부분)과, 그 수용 부분에 대한 상기 일단 측의 소경(小徑)의 부분(소경 부분)으로 형성되어 있다.","Specifically, the through-hole 19c is formed by a portion (accommodation portion) configured to accommodate the bearing 22a and a small-diameter portion on the one end-side with respect to the accommodation portion.",True,0.3419322371482849,0.8584957489185394,18,31,-13,90,215,-125
"따라서, 감삽부(19a)는, 그 일단 측의 단부에, 그 관통공(19c)에서의 상기 소경 부분이 형성된 단부벽(19e)을 가지고 있다.","Therefore, the fitting/insertion portion 19a has an end wall 19e, in which the small-diameter portion of the through-hole 19c is formed, at an end portion on one end portion-side.",True,0.3047283291816711,0.8699784698570142,15,29,-14,74,179,-105
"그리고, 그 단부벽(19e)에 형성되는 관통공(19c)의 상기 소경 부분의 내경은, 지지축(16a)에서의 베어링(22a)에 지지되는 부분의 외경(外徑)과 대략 일치하는 크기로 되어 있다.","An inner diameter of the small-diameter portion of the through-hole 19c formed in the end wall 19e substantially coincides with an outer diameter of a portion of the support shaft 16a, which is supported by the bearing 22a.",True,0.2483007907867431,0.9057950633498376,19,38,-19,104,223,-119
"그리고, 관통공(19c)에서의 상기 수용 부분은, 그 상기 축선 방향에서의 길이 치수가 베어링(22a)의 두께 치수보다 크게 되어 있다.","Further, the accommodation portion of the through-hole 19c is formed so that a length dimension in the axis line direction is greater than a thickness dimension of the bearing 22a.",True,0.2606695890426636,0.8826326702055572,17,30,-13,76,180,-104
"그리고, 베어링(22a)은, 관통공(19c)에서의 상기 수용 부분에 감삽되고 또한, 그 한쪽의 단면을 단부벽(19e)과 맞닿게 한 상태로, 베어링 홀더(19) 내에 수용된다.]",The bearing 22a is accommodated in the bearing holder 19 in a state where it is fitted/inserted in the accommodation portion of the through-hole 19c and an end face on one side is in contact with the end wall 19e.,True,0.2350964099168777,0.9040622829771544,19,40,-21,98,213,-115
"[또한, 플랜지부(19b)는, 전술한 바와 같이 감삽부(19a)의 상기 일단 측에 형성되어 있고, 상기한 감삽부(19a)에서의 단부벽(19e)의 두께 치수보다 큰 두께 치수를 가지고 있다.","The flange portion 19b is formed on the one end-side of the fitting/insertion portion 19a, as described above, and is formed to be thicker than a thickness dimension of the end wall 19e of the fitting/insertion portion 19a.",True,0.2932179868221283,0.8685641923451627,21,38,-17,105,223,-118
"그리고, 그 플랜지부(19b)의 두께 치수는, 베어링 홀더(19)(감삽부(19a))의 축선 방향의 치수와의 차가 내측벽(27)의 두께 치수와 대략 동일하게 되는 치수로 되어 있다.",A thickness dimension of the flange portion 19b is set so that a difference from the dimension of the bearing holder 19 (fitting/insertion portion 19a) in the axis line direction is substantially the same as the thickness dimension of the inner wall 27.,True,0.3019413352012634,0.8828238619848228,20,43,-23,100,253,-153
"그리고, 그 플랜지부(19b)에는, 베어링 홀더(19)를 사이드 프레임(2)(돌출부(17))에 고정하기 위한 볼트(25)가 삽통되는 관통공이 복수 형성되어 있다.]",The flange portion 19b is formed with a plurality of through-holes in which the bolts 25 for fixing the bearing holder 19 to the side frame 2 (protrusion part 17) are inserted.,True,0.2324613481760025,0.9094617671790172,15,32,-17,91,176,-85
"[그리고, 베어링 홀더(19)는, 전술한 바와 같이 베어링(22a)을 수용한 상태로, 그 감삽부(19a)에 있어서 관통공(23a)에 감삽되는 형태로, 사이드 프레임(2)에 대하여 고정된다.","Further, the bearing holder 19 is fixed to the side frame 2 in such a form that the fitting/insertion portion 19a is fitted in the through-hole 23a in a state where the bearing 22a is accommodated as described above.",True,0.2652159333229065,0.8993828685992444,19,39,-20,105,216,-111
"따라서, 관통공(23a)은, 그 내경이 감삽부(19a)의 외경에 따른 크기가 되도록 형성되어 있다.","Therefore, the through-hole 23a is formed so that an inner diameter thereof is sized to correspond to an outer diameter of the fitting/insertion portion 19a.",True,0.2674723267555237,0.8757183432133904,11,25,-14,55,157,-102
"또한, 그 사이드 프레임(2)에 대한 베어링 홀더(19)의 고정은, 플랜지부(19b)의 상기 관통공에 삽통된 고정용 볼트(25)가 대응하는 돌출부(17)의 내측면(9)에 개구하도록 형성된 암나사 구멍에 나사 장착됨으로써 행해지고 있다.]","In addition, the bearing holder 19 is fixed to the side frame 2 by screwing the bolts 25 for fixing inserted in the through-holes of the flange portion 19b into female screw holes formed to open to the inner surface 9 of the corresponding protrusion part 17.",True,0.1964268982410431,0.9250239497811124,25,47,-22,132,258,-126
"[이와 같이, 본 실시예의 직기에 있어서는, 주축(16)이 각 지지축(16a)을 통하여 각 사이드 프레임(2)에 지지되어 있고, 그 각 지지축(16a)은, 관통공(23a)에 끼워져 장착되는 형태로 사이드 프레임(2)에 고정된 베어링 홀더(19) 및 그 베어링 홀더(19)에 수용된 베어링(22a)을 통하여 지지되어 있다.","As described above, in the loom of the present embodiment, the main shaft 16 is supported on each side frame 2 via each support shaft 16a, and each support shaft 16a is supported via the bearing holder 19 fixed to the side frame 2 in a form of being fitted in the through-hole 23a and the bearing 22a accommodated in the bearing holder 19.",True,0.2746932208538055,0.8964989668010095,36,64,-28,179,339,-160
"따라서, 그 직기에 있어서는, 그 관통공(23a)이 형성되어 있는 부분이, 사이드 프레임(2)의 내측벽(27)에서의 주축(16)을 위한 지지축(16a)의 지지부가 되어 있다.]","Therefore, in the loom, the part in which the through-hole 23a is formed is formed as a support part of the support shaft 16a for the main shaft 16, in the inner wall 27 of the side frame 2.",True,0.2867883145809173,0.8906915247269749,18,39,-21,98,190,-92
"[그리고, 내측벽(27)에 있어서는, 그 관통공(23a)이 돌출부(17)에 형성되어 있고, 또한, 전술한 바와 같이 구성된 베어링 홀더(19)에 있어서는, 수용되는 베어링(22a)의 내측단(베어링(22a)의 지지 위치의 내측단으로서 단부벽(19e)의 베어링(22a) 측의 단면)의 위치가, 돌출부(17)의 내측면(9)보다 상기 내측에 위치하도록 되어 있다.","Further, the through-hole 23a is formed in the protrusion part 17 of the inner wall 27, and in the bearing holder 19 configured as described above, a position of an inner end of the accommodated bearing 22a (which is an inner end of the support position of the bearing 22a and is also an end face of the end wall 19e on the bearing 22a-side) is located on the more inner side than the inner surface 9 of the protrusion part 17.",True,0.2807415723800659,0.8995191306301042,34,82,-48,199,427,-228
"따라서, 이와 같은 베어링 홀더(19)를 통하여 지지축(16a)을 지지하는 부분인 내측벽(27)에서의 상기 지지부는, 본 발명에서 일컫는 오프셋 지지부에 상당한다.]","Therefore, the support part in the inner wall 27, which is a part for supporting the support shaft 16a via the bearing holder 19, corresponds to the offset support part of the present invention.",True,0.2083918005228042,0.921488910143283,18,34,-16,92,194,-102
"[나아가서는, 본 실시예의 직기에 있어서는, 상기 기준 위치에 대한 돌출부(17)의 돌출량이 전술한 바와 같이 내측벽(27)의 두께 치수보다 큰 양이 되어 있다.","Further, in the loom of the present embodiment, as described above, the protruding amount of the protrusion part 17 with respect to the reference position is greater than the thickness dimension of the inner wall 27.",True,0.1774232536554336,0.9096747652319306,21,36,-15,90,216,-126
"따라서, 돌출부(17)에서의 양 측면 중 사이드 프레임(2)의 내측면을 향하는 측면의 위치는, 상기 폭 방향에 관하여, 상기 기준 위치보다 상기 내측으로 되어 있다.","Therefore, a position of a side surface, which faces toward the inner surface of the side frame 2, of both side surfaces of the protrusion part 17 is located on the more inner side than the reference position with respect to the width direction.",True,0.2459199875593185,0.8955070536620987,22,44,-22,92,245,-153
"그리고, 그 돌출부(17)에 장착되는 베어링 홀더(19)는, 그 플랜지부(19b)의 두께 치수와 베어링 홀더(19)의 축선 방향의 치수와의 차가 내측벽(27)의 두께 치수와 대략 동알하게 되도록 되어 있다.","Further, the bearing holder 19 that is attached to the protrusion part 17 is formed such that the difference between the thickness dimension of the flange portion 19b and the dimension of the bearing holder 19 in the axis line direction is substantially the same as the thickness dimension of the inner wall 27.",True,0.280778706073761,0.8969976235378108,24,54,-30,115,311,-196
"바꾸어 말하면, 베어링 홀더(19)에서의 플랜지부(19b)를 제외한 부분의 축선 방향에서의 치수는, 내측벽(27)의 두께 치수와 대략 동일하게 되어 있다.]","In other words, a dimension in the axis line direction of a part of the bearing holder 19 except the flange portion 19b is substantially the same as the thickness dimension of the inner wall 27.",True,0.1832972317934036,0.9249366559163048,17,36,-19,87,194,-107
"[이로써, 베어링 홀더(19)에서의 플랜지부(19b) 측과는 반대 측의 끝에지의 위치는, 상기 폭 방향에 관하여, 돌출부(17)에서의 상기한 내측을 향한 측면의 위치와 동일하게 되어 있다.","Thereby, a position of an end edge of the bearing holder 19 on an opposite side to the flange portion 19b is the same as the position of the side surface, which faces toward the inner side, of the protrusion part 17 with respect to the width direction.",True,0.2134847790002823,0.9193684751116686,22,48,-26,105,252,-147
건설 기계,Technical Field,False,0.8681192398071289,0.3155451187992458,2,2,0,5,15,-10
"[본 발명은, 차체와 주위의 장해물(사람·물건)과의 접촉의 가능성을 낮추기 위해, 차체 주위의 장해물을 검지하고, 장해물의 검지 상황에 따라 차체의 동작을 제한하는 기능을 구비한 건설 기계에 관한 것이다.]",The present invention relates to a construction machine having a function to detect an obstacle (a person or an object) in the periphery of the vehicle body thereof and to limit operation of the vehicle body depending on the detected obstacle in order to reduce the possibility that the vehicle body and the obstacle in the periphery thereof contact each other.,True,0.2542704343795776,0.8515381222729461,26,61,-35,115,361,-246
"[건설 기계에 의한 사고의 형태로서, 건설 기계와 주위 작업자의 접촉에 의한 것이 상정되고 있으며, 사고 발생을 회피하기 위한 수단으로서, 주위의 장해물(사람·물건)을 센서에 의해 검출하여 오퍼레이터에게 통지를 행하는 것이나, 검출 시에 차체의 동작 속도를 제한하거나 자동으로 정지시키거나 하는 건설 기계 및 그 제어 장치가 많이 제안되고 있다.]","As means for avoiding causing accidents, there have been proposed many systems for detecting an obstacle (a person or an object), in the periphery by sensors and indicating the obstacle to an operator and also many construction machines and controllers thereof for limiting the speed at which a vehicle body operates and automatically stopping the vehicle body when an obstacle is detected in the periphery.",False,0.291772186756134,0.824463684769869,46,65,-19,194,407,-213
"[그러나, 현실의 가동 현장의 상황으로서, 건설 기계의 주위에 어떠한 물체(예를 들면, 덤프로의 적입용의 토사산(土砂山)이나 방토를 위한 벽, 다른 건설 기계나 덤프 등)가 존재하는 환경에서의 가동이나, 오퍼레이터와 주위 작업자의 동의하에 주위 작업자를 둔 작업 등, 차체의 주위에 장해물(사람·물건)이 존재할 수 밖에 없는 상황에서의 가동이 발생한다.]","However, in actual situations where a construction machine is to operate, it may be unavoidable for the construction machine to operate with an obstacle (a person or an object), present in the periphery of the vehicle body thereof, such as when the construction machine should operate in environments where some kind of object (e.g., a gravel mound to be loaded onto a dump truck, an earth retaining wall, another construction machine, a dump truck, etc.) is present in the periphery of the construction machine, or when the construction machine should perform work with a worker placed in the periphery with the operator's and worker's consent.",True,0.2040720283985138,0.8798732989152183,44,105,-61,198,645,-447
"[또한, 상기와 같은 경우에 한정되지 않더라도, 건설 기계가 장해물을 검지하여 동작 제한이 작동한 경우에 있어서 장해물을 배제하는 것이 어려운 경우, 검지 상태 그대로 그 자리로부터 건설 기계를 이동시키는 것이 필요한 상황이 발생한다.]","Apart from the above situations, in a case where it is difficult to remove an obstacle away from a construction machine when the construction machine detects the obstacle and operation limitation is enabled, a need arises to move the construction machine from the site with the obstacle being detected.",True,0.348188191652298,0.7872074576731014,32,49,-17,132,302,-170
"[이와 같은 상황을 상정하여, 주위 장해물을 검지하였을 때에 차체의 동작을 제한하는 기능을 구비한 건설 기계에 있어서, 오퍼레이터가 동작 제한을 해제할 수 있는 수단을 탑재하고, 오퍼레이터가 해제 수단을 조작함으로써, 장해물 검지 상태 그대로 통상의 유압 셔블과 마찬가지로 차체를 움직이는 것을 가능하게 하고 있는 것이 있다.]","When the operator actuates the canceling means, the vehicle body can be moved as is the case with ordinary hydraulic excavators with the obstacle being detected.",False,0.49601611495018,0.6914037499375668,44,26,18,183,161,22
"[특허 문헌 1에는, 동작 제한의 해제 방법에 관한 발명으로서, 사람 검지 시의 동작 제한 작동 시에, 캐빈(운전실) 내에서의 소정 조작으로 동작 제한을 해제하고, 해제할 때의 검지 비검지 상황에 따라 동작 제한으로부터의 복귀의 완만함을 변경하는 건설 기계가 나타나 있다.]","Patent Document 1 discloses, as an invention relating to a method of canceling operation limitation, a construction machine that, when operation limitation is enabled upon detection of a person, allows predetermined operation in the cabin to cancel the limitation on operation and that changes the gradualness of returning from the limitation on operation depending on whether the obstacle is detected or not at the time the limitation on operation is to be canceled.",True,0.2875680029392242,0.8459089842136783,38,73,-35,153,467,-314
[PatentCitationText[attributes={}; value=[국제공개 공보 2018-105527호]]],Patent Document,False,0.6760368347167969,0.436249689353966,4,2,2,65,15,50
"[특허 문헌 1은, 오퍼레이터가 특정의 해제 조작에 의해 장해물 검지 시의 동작 제한을 해제하는 것을 허가하고 있으며, 그 해제 시에 급한 속도 변화가 되지 않도록 함으로써 보다 안전하게 해제하는 방법을 제안하고 있다.]","Patent Document 1 proposes a method that permits the operator to cancel operation limitation when an obstacle is detected, by making particular canceling operation, the method canceling the limitation on operation more safely by avoiding an abrupt velocity change upon cancelation.",True,0.2882929146289825,0.8292733343155357,32,41,-9,123,281,-158
"[그러나, 특허 문헌 1을 포함하는 종래 기술에 있어서, 동작 제한을 해제하는 기능에 대한 언급은 있지만, 기본적으로는 해제가 필요한 상황을 불규칙한 것으로서 취급하고 있어, 동작 제한을 해제한 상태에서 계속해서 사용하는 상황을 허가하는 사용 방법은 검토가 이뤄지고 있지 않다.]","According to the conventional art including Patent Document 1, although the function to cancel operation limitation is referred to, situations where cancelation is required are treated as irregular, and no consideration has been made with respect to a way of permitting the construction machine to be used continuously with the limitation on operation being canceled.",True,0.303522527217865,0.8230733471718532,37,55,-18,156,367,-211
"[또한, 특허 문헌 1에 있어서는, 동작 제한을 해제하는 방법에 대해서는 언급되어 있지만, 동작 제한이 해제된 상태로부터 통상 상태(사람 검지에 의해 차체 동작이 제한되는 상태)로의 복귀 방법에 대해서는 명확하게 언급되어 있지 않다.]","Furthermore, although Patent Document 1 refers to the method of canceling operation limitation, it does not clearly refer to a method of returning from a state where the limitation on operation is canceled to a normal state where vehicle body operation is limited upon detection of a person.",True,0.2452871650457382,0.8581557472968404,31,48,-17,131,291,-160
"[주위 장해물의 검지 기능이, 정말로 검지가 필요한 장해물(예를 들면, 갑자기 작업 범위 내에 진입해 오는 사람)만을 검출할 수 있는 성능이 있으면, 동작 제한을 해제하는 상황은 통상의 작업 시에는 거의 발생하지 않고, 동작 제한의 해제가 필요한 상황은 불규칙한 것이라고 하는 것도 가능하지만, 검지 기능의 능력이 발전 도상인 현재의 건설 기계에 있어서는, 차체의 주위에 무엇인가 물체가 존재하는 상황에서 작업하는 것은 충분히 상정되기 때문에, 안전성과 작업성의 양립을 위해서는, 동작 제한을 해제한 상태에서 건설 기계를 가동시키는 상황을 적극적으로 허가하는 사용 방법을 전제로 하여 운전자 지원 기능을 구축할 필요가 있다.]","However, since current construction machines where the ability of a detecting function is under development are sufficiently assumed to work in situations where some kind of object is present in the periphery of the vehicle body, it is necessary for achieving both safety and operability to construct a driver assisting function based on the premise of using a construction machine in a manner of positively permitting situations where the construction machine operates with operation limitation being canceled.",False,0.3983305096626282,0.7665379370269435,85,77,8,350,511,-161
"[차체의 주위에 무엇인가 물체가 존재하는 상황에서 작업하는 것이 상정되는 건설 기계에 있어서는, 통상의 작업 중에 작업에 필요한 물체(예를 들면, 덤프 적입을 위한 토사산)을 장해물로서 검지해버리는 것이 생각되지만, 이에 따라 차체 동작에 제한이 걸려버려 있으면, 건설 기계는 본래의 용도인 작업 기계로서의 성능을 발휘할 수 없어, 작업 성능의 현저한 저하라고 하는 문제를 발생시켜버린다.]","A construction machine that is assumed to work in situations where some kind of object is present in the periphery of the vehicle body may detect an object that is required for work (e.g., a gravel mound to be loaded onto a dump truck) during normal work.",False,0.3441316187381744,0.7966882812928451,51,47,4,218,255,-37
"[작업성을 저하시키지 않도록, 종래 기술에서 공개되어 있는 바와 같이, 오퍼레이터가 동작 제한을 해제하면, 건설 기계는 종래와 같이 주위에 장해물이 있어도 동작에 제한이 걸리지 않고 작업을 행하는 것이 가능해지지만, 당연히 건설 기계와 주위 작업자의 접촉에 의한 사고의 발생을 회피하기 위한 기능이 작동하지 않으므로, 본래 의도하고 있는 안전성의 향상이 이뤄지지 않게 된다고 하는 문제를 발생시켜버린다.]","When the operator cancels the limitation on operation in order not to lower operability, as disclosed in the background art, the construction machine is able to work, as in the past, with no limitation on operation even if there is an obstacle in the periphery.",False,0.4216115772724151,0.7451622855894892,53,45,8,226,261,-35
"[또한, 오퍼레이터가 동작 제한을 해제하여 필요한 작업을 행한 후에, 주위의 가동 환경의 상황에 따라 그때마다 동작 제한을 유효하게 되돌려 주면 되지만, 오퍼레이터가 되돌림","After the operator has canceled the limitation on operation and done necessary work, the operator should effectively reinstate the limitation on operation each time it is required, depending on the environment in which the construction machine operates.",False,0.3591649234294891,0.7459481118199114,23,37,-14,96,253,-157
"조작을 잊은 경우에, 오퍼레이터가 동작 제한이 작동하는 것이라고 믿어버려 주위 확인을 소홀히해버린다고 하는 새로운 문제가 발생할 우려가 있다.]","In the event that the operator forgets to take an operation to reinstate operation limitation, another problem tends to arise in that the operator may take it for granted that the limitation on operation is enabled and may overlook a check around the construction machine.",False,0.3300740420818329,0.7669019851659669,18,45,-27,80,272,-192
"[본 발명은, 상기의 과제를 해결하기 위해 고안한 것으로, 차체 주위에 작업에 필요한 물체가 존재하는 상황에서의 작업성을 확보하면서, 건설 기계와 주위 작업자의 접촉에 의한 사고 발생의 가능성을 낮출 수 있는, 안전성과 작업성을 양립시킨 건설 기계를 제공하는 것을 목적으로 한다.]",It is an object of the present invention to provide a construction machine that achieves both safety and operability by lowering the possibility of an accident due to contact between the construction machine and a worker in the periphery of the vehicle body while securing operability in situations where an object required for work is present in the periphery.,False,0.2489803582429886,0.8561609609283978,38,59,-21,157,361,-204
"[상기 목적을 달성하기 위해, 본 발명은, 액추에이터와, 주위의 장해물을 검출하는 장해물 검출 장치와, 상기 장해물 검출 장치가 장해물을 검출한 경우에 상기 액추에이터의 동작을 제한하는 동작 제한 제어를 행하는 컨트롤러와, 상기 동작 제한 제어의 해제를 지시하기 위한 제어 해제 장치를 구비한 건설 기계에 있어서, 상기 컨트롤러는, 상기 동작 제한 제어를 유효로 한 제어 모드인 통상 모드와, 상기 동작 제한 제어를 일시적으로 해제한 제어 모드인 일시 해제 모드를 가지고, 상기 통상 모드에 있어서, 상기 제어 해제 장치의 조작에 기인하여 상기 일시 해제 모드로 이행하고, 상기 일시 해제 모드에 있어서, 상기 제어 해제 장치의 조작에 기인하지 않는 소정의 조건이 성립한 경우에, 상기 통상 모드로 복귀하는 것으로 한다.]","In order to accomplish the above object, there is provided according to the present invention a construction machine including an actuator, an obstacle sensor for detecting an obstacle in a periphery of the construction machine, a controller for performing operation limiting control to limit operation of the actuator in a case where the obstacle sensor detects an obstacle, and a control canceling device for instructing the controller to cancel the operation limiting control.",True,0.3617293238639831,0.8004871980942871,104,73,31,404,479,-75
"[이상과 같이 구성한 본 발명에 의하면, 제어 해제 장치의 조작에 의해 동작 제한이 작동하는 통상 모드로부터 동작 제한이 작동하지 않는 일시 해제 모드로 이행하기 때문에, 차체 주위에 작업에 필요한 물체가 존재하는 상황에서의 작업성을 확보하는 것이 가능해진다.","According to the present invention, as described above, since the controller switches from the normal mode in which operation limitation is enabled to the temporary cancelation mode in which operation limitation is not enabled, in response to operation of the control canceling device, it is possible for the construction machine to secure operability in situations where an object required for work is present in the periphery of the vehicle body.",True,0.2449963837862014,0.8680691148443787,36,70,-34,145,448,-303
"또한, 일시 해제 모드에 있어서 제어 해제 장치의 조작에 기인하지 않는 소정의 조건이 성립함으로써, 제어 해제 장치의 조작에 관계없이 통상 모드로 복귀하기 때문에, 건설 기계와 주위 작업자의 접촉에 의한 사고 발생의 가능성을 낮추는 것이 가능해진다.]","In addition, when the predetermined condition not responsive to the operation of the control canceling device is satisfied while in the temporary cancelation mode, the controller returns to the normal mode independently of the operation of the control canceling device, making it possible to reduce the possibility of an accident due to contact between the construction machine and a worker in the periphery thereof.",True,0.2578781843185425,0.8457946126449688,35,64,-29,140,416,-276
"[본 발명과 관련된 건설 기계에 의하면, 차체 주위에 작업에 필요한 물체가 존재하는 상황에서의 작업성을 확보하면서, 건설 기계와 주위 작업자의 접촉에 의한 사고 발생의 가능성을 낮춤으로써, 안전성과 작업성을 양립시킬 수 있다.]",The construction machine according to the present invention achieves both safety and operability by lowering the possibility of an accident due to contact between the construction machine and a worker in the periphery of the vehicle body while securing operability in situations where an object required for work is present in the periphery.,True,0.2098170816898346,0.8777619580677758,30,53,-23,127,341,-214
[도 1은 본 발명의 제 1 실시예와 관련된 건설 기계의 일례로서 나타내는 유압 셔블의 외관도이다.,FIG. 1 is a view illustrating an appearance of a hydraulic excavator as an example of a construction machine according to a first embodiment of the present invention.,True,0.2157350480556488,0.8742481989603516,15,28,-13,55,166,-111
도 2는 본 발명의 제 1 실시예에 있어서의 장해물 검출 장치의 탑재 위치 및 검지 영역을 나타내는 도면이다.,FIG. 2 is a view illustrating positions where obstacle sensors are installed and detection areas according to the first embodiment of the present invention.,True,0.3028838336467743,0.8062686786576185,18,24,-6,61,156,-95
도 3은 본 발명의 제 1 실시예에 있어서의 시스템 구성을 나타내는 도면이다.,FIG. 3 is a diagram illustrating a system configuration according to the first embodiment of the present invention.,True,0.0761283487081527,0.952886133654726,12,18,-6,43,115,-72
"도 4는 본 발명의 제 1 실시예에 있어서의, 장해물 검출 시의 차체 동작 제한에 관한 컨트롤러의 구성을 나타내는 도면이다.",FIG. 4 is a diagram illustrating the makeup of a controller for limiting operation of a vehicle body upon detection of an obstacle according to the first embodiment of the present invention.,True,0.3020641803741455,0.8199812009577118,19,32,-13,69,190,-121
도 5는 본 발명의 제 1 실시예에 있어서의 검지 판정부의 처리 내용을 나타내는 플로우 차트이다.,FIG. 5 is a flowchart of a processing sequence of a detection determining section according to the first embodiment of the present invention.,True,0.3523922264575958,0.7711012224474821,15,23,-8,54,141,-87
"도 6은 본 발명의 제 1 실시예에 있어서의 조작 상태 판정부의 처리 내용 중, 각 조작에 대하여 조작 상태를 판정하는 부분을 나타내는 플로우 차트이다.","FIG. 6 is a flowchart of a portion for determining an operation state with respect to each event of operation, of a processing sequence of an operation state determining section according to the first embodiment of the present invention.",True,0.2209569811820984,0.8712419362391816,24,39,-15,85,237,-152
"도 7은 본 발명의 제 1 실시예에 있어서의 조작 상태 판정부의 처리 내용 중, 차체의 조작 상태를 판정하는 부분을 나타내는 플로우 차트이다.","FIG. 7 is a flowchart of a portion for determining an operated state with respect to the vehicle body, of the processing sequence of the operation state determining section according to the first embodiment of the present invention.",True,0.2512024343013763,0.8573879238049754,22,38,-16,79,232,-153
도 8은 본 발명의 제 1 실시예에 있어서의 제어 상태 전환 판정부의 처리 내용의 전체를 나타내는 플로우 차트이다.,FIG. 8 is a flowchart of an entire processing sequence of a controlled state switching determining section according to the first embodiment of the present invention.,True,0.2374685406684875,0.8495640489071942,18,26,-8,64,166,-102
도 9는 본 발명의 제 1 실시예에 있어서의 제어 상태 전환 판정부의 서브루틴인 통상 모드로부터의 전환 판정의 처리 내용을 나타내는 플로우 차트이다.,"FIG. 9 is a flowchart of a processing sequence of a process of determining switching from a normal mode, as a subroutine of the controlled state switching determining section according to the first embodiment of the present invention.",True,0.2726795375347137,0.8340135960295468,22,38,-16,83,234,-151
도 10은 본 발명의 제 1 실시예에 있어서의 제어 상태 전환 판정부의 서브루틴인 일시 해제 모드로부터의 전환 판정의 처리 내용을 나타내는 플로우 차트이다.,"FIG. 10 is a flowchart of a processing sequence of a process of determining switching from a temporary cancelation mode, as a subroutine of the controlled state switching determining section according to the first embodiment of the present invention.",True,0.2927906513214111,0.8218234367017806,23,39,-16,87,250,-163
도 11은 본 발명의 제 1 실시예에 있어서의 제어 상태 전환 판정부의 서브루틴인 상시 해제 모드로부터의 전환 판정의 처리 내용을 나타내는 플로우 차트이다.,"FIG. 11 is a flowchart of a processing sequence of a process of determining switching from a permanent cancelation mode, as a subroutine of the controlled state switching determining section according to the first embodiment of the present invention.",True,0.3215705752372741,0.8016757444995868,23,39,-16,87,250,-163
도 12는 본 발명의 제 1 실시예에 있어서의 동작 제한 지령부의 처리 내용을 나타내는 플로우 차트이다.,FIG. 12 is a flowchart of a processing sequence of an operation limiting commanding section according to the first embodiment of the present invention.,True,0.2138406187295913,0.8662097661094336,16,24,-8,58,151,-93
도 13은 본 발명의 제 1 실시예에 있어서의 전자 밸브 구동부의 처리 내용을 나타내는 플로우 차트이다.,FIG. 13 is a flowchart of a processing sequence of a solenoid valve actuating section according to the first embodiment of the present invention.,True,0.2473687678575515,0.8422590062785253,16,24,-8,58,145,-87
도 14는 본 발명의 제 1 실시예에 있어서의 엔진 회전 제어부의 처리 내용을 나타내는 플로우 차트이다.,FIG. 14 is a flowchart of a processing sequence of an engine rotation control section according to the first embodiment of the present invention.,True,0.1592538654804229,0.9040480862203012,16,24,-8,58,145,-87
도 15는 본 발명의 제 2 실시예에 있어서의 제어 상태 전환 판정부의 서브루틴인 통상 모드로부터의 전환 판정의 추가 처리 부분을 나타내는 플로우 차트이다.],"FIG. 15 is a flowchart of an additional processing sequence of a process of determining switching from a normal mode, as a subroutine of a controlled state switching determining section according to a second embodiment of the present invention.",True,0.2277596294879913,0.8536384886532066,23,39,-16,88,244,-156
"[이하, 본 발명의 실시 형태를 도면을 참조하여 설명한다.",Embodiments of the present invention will be described hereinbelow with reference to the drawings.,True,0.2318537533283233,0.838058080143826,8,14,-6,32,98,-66
"또한, 각 도면 중, 동등한 부재에는 동일한 부호를 부여하여, 중복된 설명은 적절히 생략한다.]","In the drawings, equivalent components are denoted by identical referenced characters throughout views, and redundant description thereof will be omitted.",True,0.4022416770458221,0.680791066504911,13,20,-7,53,154,-101
[B[attributes={}; value=[실시예 1]]],[First Embodiment],False,0.5792299509048462,0.6053415759501127,3,2,1,33,18,15
[(유압 셔블의 설명)],(Description of a hydraulic excavator),True,0.2304213643074035,0.8295532670698329,3,5,-2,13,38,-25
"[도 1은, 본 발명의 제 1 실시예와 관련된 건설 기계의 일례로서 나타내는 유압 셔블의 외관도이다.]",FIG. 1 is a view illustrating an appearance of a hydraulic excavator as an example of a construction machine according to a first embodiment of the present invention.,True,0.2305471748113632,0.8649539250749865,15,28,-13,57,166,-109
"[도 1에 있어서, 유압 셔블(건설 기계)은, 크롤러식의 하부 주행체(1)와, 하부 주행체(1)에 대하여 선회 가능하게 마련된 상부 선회체(2)와, 굴삭 작업 등을 행하기 위한 프론트 작업기(3)를 구비하고 있다.]","In FIG. 1, the hydraulic excavator (construction machine) includes a crawler-type lower track structure 1, an upper swing structure 2 swingably mounted on the lower track structure 1, and a front implement 3 for performing excavating work or the like.",True,0.1884682178497314,0.8924310875458956,26,40,-14,120,251,-131
"[하부 주행체(1)에는 좌우 한 쌍의 주행용 유압 모터(도시 생략)가 배치되고, 이 주행용 유압 모터 및 그 감속 기구 등에 의해 각 크롤러가 독립하여 회전 구동되며, 전방 또는 후방으로 주행한다.]","The lower track structure 1 includes a pair of left and right track hydraulic motors (not illustrated) and has crawlers independently rotatable to move forwardly and rearwardly by the track hydraulic motors and speed reducer mechanisms thereof, etc.",True,0.3327351212501526,0.7904983947163989,29,38,-9,111,249,-138
"[상부 선회체(2)에는, 유압 셔블의 각종 조작을 행하는 조작 장치나 오퍼레이터가 착석하는 운전석 등이 배치된 운전실(4), 엔진 등의 원동기, 유압 펌프 및 선회 모터(도시 생략) 등이 구비되어 있으며, 이 선회 모터에 의해 상부 선회체(2)가 하부 주행체(1)에 대하여 우측 방향 또는 좌측 방향으로 선회된다.","The upper swing structure 2 includes a cabin 4 housing therein operation devices for controlling the hydraulic excavator to operate in various ways, a prime mover such as an engine, a hydraulic pump and a swing motor (not illustrated), etc. The swing motor swings the upper swing structure 2 leftwardly or rightwardly with respect to the lower track structure 1.",True,0.2727275490760803,0.8351900565101432,42,60,-18,175,362,-187
"운전실(4)의 내부에는, 오퍼레이터가 유압 셔블(작업 기계)의 상황을 확인할 수 있도록 각종의 계기류나 기체 정보가 표시되는 표시 장치(5)(도 2에 나타냄)가 마련되어 있다.]",The cabin 4 houses therein a display device 5 (illustrated in FIG. 2 ) for displaying various instruments and machine body information that allow an operator to check the situation of the hydraulic excavator (work machine).,True,0.1459468901157379,0.9079879142741796,21,36,-15,99,223,-124
"[프론트 작업기(3)는, 붐(3a), 아암(3b) 및 버킷(3c)으로 구성되어 있으며, 붐(3a)은 붐 실린더(3d)에 의해 상하 이동되고, 아암(3b)은 아암 실린더(3e)에 의해 덤프측(개방측) 또는 크라우드측(긁어 넣음측)으로 조작되며, 버킷(3c)은 버킷 실린더(3f)에 의해 덤프측 또는 크라우드측으로 조작된다.]","The front implement 3 includes a boom 3a, an arm 3b, and a bucket 3c.",False,0.430808424949646,0.6973379045474911,31,15,16,180,69,111
"[유압 셔블의 후단, 좌단 및 우단의 차체 상에는, 주위 장해물을 검출하기 위한 장해물 검출 장치로서의 3D 센서(6, 7, 8, 9)가 탑재되어 있다.",The boom 3a is vertically moved by a boom cylinder 3d.,False,0.9653728604316713,0.2391953776706157,22,11,11,85,54,31
"[도 2는, 장해물 검출 장치(3D 센서(6~9))의 탑재 위치 및 검지 영역을 나타내는 도면이다.]",The arm 3b is operated toward a dumping side (opening side) or a crowding side (gathering side) by an arm cylinder 3e.,False,0.7722055912017822,0.4401347769709193,13,22,-9,56,118,-62
"[차체 후단 좌측에 3D 센서(6), 후단 우측에 3D 센서(7), 좌단에 3D 센서(8), 우단에 3D 센서(9)를 탑재하고 있다.",The bucket 3c is operated toward the dumping side or the crowding side by a bucket cylinder 3f.,False,0.9365035891532898,0.2944039179313333,17,18,-1,74,95,-21
"연료를 연소시키기 위한 실린더;상기 실린더의 상측에 구비되는 배기밸브;상기 실린더에서 하사점과 상사점 사이를 왕복 이동하는 피스톤;상기 피스톤이 하사점에서 상사점으로 이동하는 중간에 상기 실린더에 가스연료를 공급하기 위한 가스연료공급유닛;상기 실린더로 유입되는 소기가스가 경유하는 흡기라인;상기 실린더로부터 배출되는 배기가스가 경유하는 배기라인;상기 흡기라인에 연결되어 상기 소기가스를 압축하여 상기 실린더로 공급하는 압축기와, 상기 배기라인에 연결되어 상기 실린더로부터 배기가스를 공급받아 구동되며 회전력을 상기 압축기로 전달하는 터빈을 포함하는 터보차저;상기 배기라인 중 상기 터빈의 전단부와, 상기 흡기라인 중 상기 압축기의 전단부를 연통하는 EGR라인; 및상기 배기밸브의 개폐를 제어하는 제1 제어부를 포함하고,상기 제1 제어부는 상기 EGR라인을 통한 배기 재순환시 상기 배기밸브의 클로징 타이밍을 조절하는 것을 특징으로 하는 배기가스 재순환 시스템.","An exhaust gas recirculation (EGR) system comprising: a cylinder in which fuel is burned; an exhaust valve provided at an upper side of the cylinder; a piston reciprocating between a bottom dead point and a top dead point in the cylinder; a gas fuel supply unit supplying gas fuel to the cylinder in the middle while the piston moves from the bottom dead point to the top dead point; an intake line through which scavenging gas introduced to the cylinder passes; an exhaust line through which exhaust gas discharged from the cylinder passes; a turbo charger including a compressor and a turbine, wherein the compressor is connected to the intake line to compress the scavenging gas and then supply the compressed scavenging gas to the cylinder, and wherein the turbine is connected to the exhaust line to be driven by being supplied with the exhaust gas from the cylinder, and transfers rotary power to the compressor; an EGR line connecting a front end portion of the turbine on the exhaust line to a front end portion of the compressor on the intake line; and a first controller controlling opening/closing of the exhaust valve, wherein the first controller controls a closing timing of the exhaust valve in exhaust recirculation through the EGR line.",True,0.2867360711097717,0.9112173875693924,98,212,-114,481,1253,-772
"제 1 항에 있어서, 상기 제1 제어부는 상기 EGR라인을 통한 배기 재순환시 상기 배기밸브의 클로징 타이밍을 앞당기는 것을 특징으로 하는 배기가스 재순환 시스템.","The EGR system of claim 1, wherein the first controller advances the closing timing of the exhaust valve in the exhaust recirculation through the EGR line.",True,0.312978982925415,0.9098984311328764,23,26,-3,91,155,-64
"제 1 항에 있어서,상기 제1 제어부는 상기 EGR라인을 통한 배기 재순환시 상기 실린더의 유효 압축비를 조절하는 것을 특징으로 하는 배기가스 재순환 시스템.","The EGR system of claim 1, wherein the first controller controls an effective compression ratio of the cylinder in the exhaust recirculation through the EGR line.",True,0.3341986238956451,0.9083015517911416,22,26,-4,88,162,-74
"제 3 항에 있어서,상기 제1 제어부는 상기 EGR라인을 통한 배기 재순환시 상기 실린더의 유효 압축비를 유지 또는 증가시키는 것을 특징으로 하는 배기가스 재순환 시스템.","The EGR system of claim 3, wherein the first controller maintains or increases the effective compression ratio of the cylinder in the exhaust recirculation through the EGR line.",True,0.2779014110565185,0.923236989437347,24,28,-4,95,177,-82
"제 1 항에 있어서,상기 제1 제어부는 상기 EGR라인을 통한 배기 재순환시 상기 실린더 내의 압축 온도를 조절하는 것을 특징으로 하는 배기가스 재순환 시스템.","The EGR system of claim 1, wherein the first controller controls a compression temperature in the cylinder in the exhaust recirculation through the EGR line.",True,0.2766187489032745,0.9257756274258274,23,25,-2,89,157,-68
"제 5 항에 있어서,상기 제1 제어부는 상기 EGR라인을 통한 배기 재순환시 상기 실린더 내의 압축 온도를 상승시키는 것을 특징으로 하는 배기가스 재순환 시스템.","The EGR system of claim 5, wherein the first controller increases the compression temperature in the cylinder in the exhaust recirculation through the EGR line.",True,0.2678247690200805,0.9243267721906312,23,25,-2,90,160,-70
"제 1 항에 있어서,상기 제1 제어부는 액체연료 분사 타이밍을 제어하는 것을 특징으로 하는 배기가스 재순환 시스템.","The EGR system of claim 1, wherein the first controller controls an injection timing of liquid fuel.",True,0.3719663619995117,0.8613471733199655,16,17,-1,64,100,-36
"연료를 연소시키기 위한 실린더;상기 실린더의 상측에 구비되는 배기밸브;상기 실린더에서 하사점과 상사점 사이를 왕복 이동하는 피스톤;상기 피스톤이 하사점에서 상사점으로 이동하는 중간에 상기 실린더에 가스연료를 공급하기 위한 가스연료공급유닛;상기 실린더로 유입되는 소기가스가 경유하는 흡기라인;상기 실린더로부터 배출되는 배기가스가 경유하는 배기라인;상기 흡기라인에 연결되어 상기 소기가스를 압축하여 상기 실린더로 공급하는 압축기와, 상기 배기라인에 연결되어 상기 실린더로부터 배기가스를 공급받아 구동되며 회전력을 상기 압축기로 전달하는 터빈을 포함하는 터보차저;상기 배기라인 중 상기 터빈의 전단부와, 상기 흡기라인 중 상기 압축기의 전단부를 연통하는 EGR라인; 및상기 터빈으로 공급되는 배기가스의 유량을 제어하는 제2 제어부를 포함하고,상기 제2 제어부는 상기 EGR라인을 통한 배기 재순환시 상기 터빈으로 공급되는 배기가스의 유량을 조절하는 것을 특징으로 하는 배기가스 재순환 시스템.","An exhaust gas recirculation (EGR) system comprising: a cylinder in which fuel is burned; an exhaust valve provided at an upper side of the cylinder; a piston reciprocating between a bottom dead point and a top dead point in the cylinder; a gas fuel supply unit supplying gas fuel to the cylinder in the middle while the piston moves from the bottom dead point to the top dead point; an intake line through which scavenging gas introduced to the cylinder passes; an exhaust line through which exhaust gas discharged from the cylinder passes; a turbo charger including a compressor and a turbine, wherein the compressor is connected to the intake line to compress the scavenging gas and then supply the compressed scavenging gas to the cylinder, and wherein the turbine is connected to the exhaust line to be driven by being supplied with the exhaust gas from the cylinder, and transfers rotary power to the compressor; an EGR line connecting a front end portion of the turbine on the exhaust line to a front end portion of the compressor on the intake line; and a second controller controlling a flow rate of the exhaust gas supplied to the turbine, wherein the second controller controls the flow rate of the exhaust gas supplied to the turbine in exhaust recirculation through the EGR line.",True,0.3026189506053924,0.9055315922050848,101,222,-121,496,1292,-796
"제 8 항에 있어서,상기 제2 제어부는 상기 EGR라인을 통한 배기 재순환시 상기 터빈으로 공급되는 배기가스의 유량을 증가시키는 것을 특징으로 하는 배기가스 재순환 시스템.","The EGR system of claim 8, wherein the second controller increases the flow rate of the exhaust gas supplied to the turbine in the exhaust recirculation through the EGR line.",True,0.2297111898660659,0.9346091924043428,23,30,-7,96,174,-78
"제 8 항에 있어서,상기 터빈의 전단과 후단을 연결하며 개폐할 수 있는 바이패스라인을 더 포함하고,상기 제2 제어부는 상기 EGR라인을 통한 배기 재순환시 상기 바이패스라인을 조절하는 것을 특징으로 하는 배기가스 재순환 시스템.","The EGR system of claim 8, further comprising a bypass line connecting a front end and a rear end of the turbine, the bypass line being opened/closed, wherein the second controller controls the bypass line in the exhaust recirculation through the EGR line.",True,0.2846656739711761,0.9213178173680114,30,43,-13,127,256,-129
"제 8 항에 있어서,상기 압축기의 후단과 상기 터빈의 전단을 연결하며 개폐할 수 있는 바이패스라인을 더 포함하고,상기 제2 제어부는 상기 EGR라인을 통한 배기 재순환시 상기 바이패스라인을 조절하여 상기 압축기에서 배출되는 소기가스의 일부를 상기 터빈에 공급하는 것을 특징으로 하는 배기가스 재순환 시스템.","The EGR system of claim 8, further comprising a bypass line connecting a rear end of the compressor and a front end of the turbine, the bypass line being opened/closed, wherein the second controller controls the bypass line in the exhaust recirculation through the EGR line, thereby supplying a portion of the scavenging gas discharged from the compressor to the turbine.",True,0.2892956137657165,0.9254430672003484,40,61,-21,171,371,-200
"제 8 항에 있어서,상기 흡기라인은 쿨러를 더 구비하고,상기 쿨러의 후단과 상기 터빈의 전단을 연결하며 개폐할 수 있는 바이패스라인을 더 포함하고,상기 제2 제어부는 상기 EGR라인을 통한 배기 재순환시 상기 바이패스라인을 조절하여 상기 쿨러에서 배출되는 소기가스의 일부를 상기 터빈에 공급하는 것을 특징으로 하는 배기가스 재순환 시스템.","The EGR system of claim 8, wherein the intake line further includes a cooler, wherein the EGR system further comprises a bypass line connecting a rear end of the cooler and a front end of the turbine, the bypass line being opened/closed, and wherein the second controller controls the bypass line in the exhaust recirculation through the EGR line, thereby supplying a portion of the scavenging gas discharged from the cooler to the turbine.",True,0.2861255407333374,0.9241950311517264,44,74,-30,189,440,-251
"제 8 항에 있어서,상기 터빈은 구비되는 노즐 베인을 조절할 수 있는 가변형 터빈이고,상기 제2 제어부는 상기 EGR라인을 통한 배기 재순환시 상기 노즐 베인을 조절하여 터빈으로 공급되는 배기가스의 유속을 증가시키는 것을 특징으로 하는 배기가스 재순환 시스템.","The EGR system of claim 8, wherein the turbine is a variable turbine controlling a nozzle vane provided therein, and wherein the second controller increases a flow rate of the exhaust gas supplied to the turbine by controlling the nozzle vane in the exhaust recirculation through the EGR line.",True,0.2483242899179458,0.9349002717300264,35,49,-14,145,293,-148
"제 1 항 또는 제 8 항 중 어느 한 항에 있어서, 상기 실린더는 가스연료를 주연료로 이용하여 구동력을 발생시키는 가스모드와 디젤을 주연료로 이용하여 구동력을 발생시키는 디젤모드 중 하나로 운전하는 것을 특징으로 하는 배기가스 재순환 시스템.","The EGR system of claim 1, wherein the cylinder is operated in one of a gas mode in which driving power is generated by using gas fuel as a main fuel and a diesel mode in which driving power is generated by using diesel as a main fuel.",True,0.4414323568344116,0.8411728205068235,35,48,-13,136,235,-99
"제 1 항 또는 제 8 항 중 어느 한 항에 있어서,상기 실린더로부터 배출된 배기가스는 고압 상태로 상기 EGR라인을 통해 상기 압축기로 유입되는 것을 특징으로 하는 배기가스 재순환 시스템.","The EGR system of claim 1, wherein the exhaust gas discharged from the cylinder is introduced in a high pressure state to the compressor through the EGR line, and wherein an EGR blower pressurizing the exhaust gas is omitted in the EGR line.",True,0.5044688582420349,0.8408406228785336,29,43,-14,106,241,-135
"프리차지부(224)는 프리차지 저항과 프리차지 릴레이가 직렬로 연결된 프리차지 회로를 포함하고, 충방전 스위칭부(222)의 포지티브 릴레이에 병렬로 연결될 수 있다.","The pre-charge unit 224 may include a pre-charge circuit in which a pre-charge resistor and a pre-charge relay are connected in series, and may be connected in parallel to the positive relay of the charge/discharge switching unit 222.",True,0.2568161487579345,0.8584656966323084,18,38,-20,92,234,-142
프리차지부(224)는 배터리 팩(210)의 초기 충전시 속도를 제어하여 포지티브 릴레이를 보호할 수 있다.,The pre-charge unit 224 may protect the positive relay by controlling a speed during initial charging of the battery pack 210.,True,0.1718703359365472,0.8925697078474152,12,21,-9,59,126,-67
배터리 릴레이 진단 장치(230)는 배터리 팩(210)에 포함된 릴레이가 정상적으로 동작하는지 진단할 수 있다.,The battery relay diagnostic device 230 may diagnose the battery pack 210 included in the battery pack 210 about whether it operates normally.,True,0.136250153183937,0.9230686216748396,13,23,-10,62,142,-80
"이 때, 배터리 릴레이 진단 장치(230)는 스위칭 제어부(232), 진단부(234) 및 알람부(236)를 포함할 수 있다.","In this case, the battery relay diagnostic device 230 may include a switching controller 232, a diagnostic unit 234, and an alarm unit 236.",True,0.1098571941256523,0.9379912197718638,14,24,-10,69,139,-70
스위칭 제어부(232)는 배터리 팩(210)의 스위칭부(214) 및 충방전 스위칭부(222)를 온/오프 제어함으로써 배터리 셀 모듈(212)에 인가되는 전류를 제어할 수 있다.,The switching controller 232 may control the current applied to the battery cell module 212 by controlling on/off of the switching unit 214 and the charge/discharge switching unit 222 of the battery pack 210.,True,0.1494779884815216,0.92082910255092,18,34,-16,98,208,-110
"즉, 본 발명은 배터리 팩(210)의 스위칭부(214)를 진단하는 내용으로, 스위칭 제어부(232)는 배터리 셀 모듈(212)의 (+)단과 부하 측 사이에 구비된 제1 스위치와 배터리 셀 모듈의 (-)단과 부하 측 사이에 구비된 제2 스위치를 각각 온/오프 제어함으로써 배터리 셀 모듈(212)에 인가되는 전류를 제어하고, 또한 제1 스위치와 제2 스위치가 정상적으로 동작하는지 진단부(234)가 진단할 수 있도록 할 수 있다.","That is, according to the present disclosure, by diagnosing the switching unit 214 of the battery pack 210, the switching controller 232 may control on/off of the first switch provided between the (+) terminal of the battery cell module 212 and the load part and the second switch provided between the (-) terminal of the battery cell module and the load part, thereby controlling the current applied to the battery cell module 212, and the diagnostic unit 234 may diagnose the first switch and the second switch about whether they operate normally.",True,0.1506416350603103,0.9318720621989026,53,92,-39,239,549,-310
진단부(234)는 제1 스위치와 제2 스위치의 온/오프 상태에 기초하여 제1 스위치와 제2 스위치에 대한 진단을 수행할 수 있다.,The diagnostic unit 234 may perform diagnosis on the first switch and the second switch based on the on/off states of the first switch and the second switch.,True,0.1137452572584152,0.9343110527104964,17,28,-11,72,157,-85
"즉, 진단부(234)는 후술하는 바와 같이 병렬로 연결된 복수의 배터리 팩들(210) 사이의 간섭 여부를 고려하여 결정된 순서에 따라 제1 스위치와 상기 제2 스위치에 대한 진단을 수행할 수 있다.",The diagnostic unit 234 may perform diagnosis on the first switch and the second switch in an order determined in consideration of interference between the plurality of battery packs 210 connected in parallel as will be described later.,True,0.2237715721130371,0.886717538091463,27,38,-11,110,236,-126
"구체적으로, 진단부(234)는 제1 스위치와 제2 스위치가 모두 오프 상태인 경우, 제1 스위치 양단의 전압을 복수의 배터리 팩(210)에 대하여 동시에 측정함으로써 진단을 수행하고, 제1 스위치의 배터리 셀 모듈(212)의 (+)측 단이 제2 스위치의 부하 측 단에 연결된 전압을 복수의 배터리 팩(210) 각각에 대하여 순차적으로 측정함으로써 진단을 수행할 수 있다.","Specifically, the diagnostic unit 234 may perform diagnosis by simultaneously measuring a voltage across the first switch for the plurality of battery packs 210 when both the first switch and the second switch are in an off state, and may perform diagnosis by sequentially measuring a voltage across a terminal of the first switch close to a (+) side of the battery cell module 212 and a terminal of the second switch close to the load part for each of the plurality of battery packs 210.",True,0.1555537730455398,0.9291067287930146,47,86,-39,207,488,-281
"또한, 진단부(234)는 제1 스위치가 오프 상태이고, 제2 스위치가 온 상태인 경우, 제1 스위치의 배터리 셀 모듈(212)의 (+)측 단이 제2 스위치의 부하 측 단에 연결된 전압을 복수의 배터리 팩(210)에 대하여 동시에 측정함으로써 진단을 수행할 수 있다.","Furthermore, the diagnostic unit 234 may perform diagnosis by simultaneously measuring the voltage across the terminal of the first switch close to the (+) side of the battery cell module 212 and the terminal of the second switch close to the load part for the plurality of battery packs 210 when the first switch is in the off state and the second switch is in the on state.",True,0.1739212423563003,0.9180226265968596,35,68,-33,148,375,-227
"그리고, 진단부(234)는 제1 스위치와 제2 스위치가 모두 온 상태인 경우, 제1 스위치 양단의 전압을 복수의 배터리 팩 각각에 대하여 순차적으로 측정함으로써 진단을 수행할 수 있다.","In addition, the diagnostic unit 234 may perform diagnosis by sequentially measuring the voltage across the first switch for each of the plurality of battery packs when both the first switch and the second switch are in the on state.",True,0.1776040494441986,0.9121940131562656,25,40,-15,103,233,-130
알람부(236)는 진단부(234)에 의해 복수의 배터리 팩(210)의 제1 스위치와 제2 스위치 중 적어도 하나에 이상이 발생한 것으로 판단된 경우 경고 알림을 발생시킬 수 있다.,The alarm unit 236 may generate a warning notification when it is determined that an abnormality occurs in at least one of the first switch and the second switch of the plurality of battery packs 210 by the diagnostic unit 234.,True,0.1713515073060989,0.9052318286795064,23,41,-18,100,227,-127
"이와 같이, 본 발명의 일 실시 예에 따른 배터리 릴레이 진단 장치에 의하면. 병렬로 연결되어 있는 배터리 팩의 프리차지 회로 구성을 최소화하여 비용을 절감하고 제어 로직을 단순화할 수 있으며, 병렬로 연결된 다른 배터리 팩의 간섭에 의한 영향을 고려하여 각 릴레이 상태에 따른 진단을 수행함으로써 오진단을 방지할 수 있다.","As described above, with the battery relay diagnostic device of the present disclosure, it is possible to reduce cost and simplify control logic by minimizing the configuration of the pre-charge circuit of battery packs connected in parallel, and to prevent misdiagnosis by performing diagnosis depending on a state of each relay in consideration of the effect of interference from other battery packs connected in parallel.",True,0.239432618021965,0.8784534129193463,48,65,-17,181,424,-243
"도 3a는 종래의 배터리 시스템의 릴레이 구성을 나타내는 도면이고, 도 3b는 종래의 배터리 시스템의 릴레이 제어 방법을 나타내는 도면이다.","FIG. 3a is a diagram illustrating a relay configuration of a battery system in the related art, and FIG. 3b is a diagram illustrating a relay control method for the battery system in the related art.",True,0.2803203165531158,0.840501108478622,19,36,-17,78,199,-121
"도 3a에 나타낸 바와 같이 종래의 배터리 시스템은 일반적으로 단일 팩 구조를 포함하고 있으며, 프리차지 회로를 삭제함으로써 비용을 절감하였다.","As illustrated in FIG. 3a, the battery system in the related art generally includes a single pack structure and eliminates the pre-charge circuit to reduce costs.",True,0.1560519188642501,0.9052620758764064,19,26,-7,80,162,-82
"따라서, 도 3b에 나타낸 바와 같이 각각의 릴레이의 온/오프 상태와 상관없이 배터리 관리 시스템(Battery Management System, BMS)이 웨이크-업(wake-up)한 이후부터 A, B, C의 각 포인트별 전압을 측정하여 릴레이의 진단을 수행하고 있다.","Therefore, as illustrated in FIG. 3b, the battery management system (BMS) performs diagnosis on relays by measuring the voltages at each of points A, B, and C after waking up, regardless of the on/off state of each relay.",True,0.1522272229194641,0.9156053586549768,30,38,-8,151,221,-70
"그러나, 도 3a 및 3b에 나타낸 단일 팩들이 복수 개가 병렬로 연결되는 경우 각 릴레이가 서로 간섭을 일으켜 오진단이 발생할 가능성이 있다.","However, when a plurality of single packs illustrated in FIGS. 3a and 3b are connected in parallel, it is likely that misdiagnosis occurs since relays interfere with each other.",True,0.1767806410789489,0.8873762761441754,22,29,-7,80,177,-97
"따라서, 이러한 병렬 구조의 배터리 팩에서는 새로운 릴레이 제어 및 진단 방식이 필요하다.","Therefore, a new relay control and diagnosis method is required in battery packs having a parallel structure.",True,0.2330828011035919,0.8465741343741503,13,17,-4,50,109,-59
"도 4a는 본 발명의 일 실시 예에 따른 배터리 시스템의 릴레이 구성과 릴레이가 오프인 경우의 간섭 현상을 나타내는 도면이고, 도 4b는 제1 스위치와 제2 스위치가 오프인 경우 배터리 시스템의 릴레이 제어 방법을 나타내는 도면이다.","FIG. 4a is a diagram illustrating a relay configuration of a battery system according to an embodiment of the present disclosure and an interference when relays are off, and FIG. 4b is a diagram illustrating a relay control method for the battery system when the first switch and the second switch are off.",True,0.1674476265907287,0.914867580423355,34,53,-19,130,306,-176
"도 4a 및 4b를 참조하면, 본 발명의 일 실시 예에 따른 배터리 시스템에서는 병렬로 연결된 배터리 팩 간의 간섭이 발생할 수 있어, 각 배터리 팩의 릴레이의 온/오프 상태에 따라 진단을 구분하여 수행하여야 한다.","Referring to FIGS. 4a and 4b, in the battery system according to an embodiment of the present disclosure, interference may occur between battery packs connected in parallel, and diagnosis is performed by classifying each battery pack according to the on/off state of the relay.",True,0.1406916379928589,0.9314071599280036,33,44,-11,120,277,-157
"구체적으로, 도 4b를 참조하면, 배터리 팩의 제1 스위치와 제2 스위치가 모두 오프인 상태인 경우, 도 4a의 1번 팩과 2번 팩의 A 지점에는 배터리 팩 전압이 인가되고, B 전압은 OV로서 이들 배터리 팩 간의 서로 영향을 주지 않기 때문에 복수의 배터리 팩에 대해 B 전압의 측정은 동시에 수행될 수 있다.","Specifically, referring to FIG. 4b, when both the first switch and the second switch of the battery pack are in the off state, the battery pack voltage is applied to points A of a first pack and a second pack of FIG. 4a and a B voltage is OV, which does not affect both battery packs, and thus the measurement of the B voltage may be simultaneously performed for a plurality of battery packs.",True,0.1137069091200828,0.9466475983619674,49,74,-25,175,392,-217
"한편, 배터리 팩의 제1 스위치와 제2 스위치가 모두 오프인 상태에서 C 전압을 측정하는 경우에는 A 지점과 C 지점을 접속시켜 진단을 수행하는데, 이 때 도 4a에 화살표(실선)으로 나타낸 것과 같이 1번 팩과 2번 팩 간의 서로 간섭이 발생할 수 있다.","On the other hand, in the case of measuring a C voltage while both the first switch and the second switch of the battery pack are in the off state, diagnosis is performed by connecting points A and C, and in this case, as indicated by an arrow (solid line) in FIG. 4a, interference between the first pack and the second pack may occur.",True,0.1197092086076736,0.9395620641456772,39,64,-25,143,335,-192
"따라서, 도 4b에 나타낸 바와 같이 각각의 배터리 팩에 대하여 C 전압의 측정이 순차적으로 이루어져야 한다.","Therefore, as illustrated in FIG. 4b, the C voltage has to be sequentially measured for each battery pack.",True,0.0578203685581684,0.9665397918585708,16,18,-2,61,106,-45
"도 5a는 본 발명의 일 실시 예에 따른 배터리 시스템의 릴레이 구성과 릴레이 온인 경우의 간섭 현상을 나타내는 도면이고, 도 5b는 제1 스위치와 제2 스위치가 온인 경우 배터리 시스템의 릴레이 제어 방법을 나타내는 도면이다.","FIG. 5a is a diagram illustrating a relay configuration of a battery system according to an embodiment of the present disclosure and an interference when relays are on, and FIG. 5b is a diagram illustrating a relay control method for the battery system when the first switch and the second switch are on.",True,0.1796552389860153,0.9085302095331688,34,53,-19,127,304,-177
"도 5b를 참조하면, 배터리 팩의 제1 스위치가 오프 상태이고, 제2 스위치가 온인 상태인 경우, 도 5a의 1번 팩과 2번 팩의 C 전압과 D 전압은 그라운드 전압으로서 OV가 인가되므로, 이들 배터리 팩 간의 서로 영향을 주지 않기 때문에 복수의 배터리 팩에 대해 C 전압의 측정은 동시에 수행될 수 있다.","Referring to FIG. 5b, when the first switch of the battery pack is in the off state and the second switch is in the on state, a C voltage and a D voltage of a first pack and a second pack of FIG. 5a are ground voltages and OV is applied, which does not affect the battery packs, and thus the measurement of the C voltage may be simultaneously performed for a plurality of battery packs.",True,0.1382461488246917,0.932418561009951,48,76,-28,173,386,-213
"한편, 배터리 팩의 제1 스위치와 제2 스위치가 모두 온인 상태에서 B 전압을 측정하는 경우에는 A 전압과 B 전압 모두 배터리 팩 전압이 인가되는데, 이 때 도 5a에 화살표(실선)으로 나타낸 것과 같이 1번 팩과 2번 팩 간의 서로 간섭이 발생할 수 있다.","On the other hand, in the case of measuring the B voltage while both the first switch and the second switch of the battery pack are in the on state, a battery pack voltage are applied to both the A voltage and the B voltage, and, in this case, as indicated by an arrow (solid line) in FIG. 5a, interference between the first pack and the second pack may occur.",True,0.151550218462944,0.9276873682951144,41,70,-29,145,360,-215
"따라서, 도 5b에 나타낸 바와 같이 각각의 배터리 팩에 대하여 B 전압의 측정이 순차적으로 이루어져야 한다.","Therefore, as illustrated in FIG. 5b, the B voltage has to be sequentially measured for each battery pack.",True,0.0545095652341842,0.9689056572545862,16,18,-2,61,106,-45
"이처럼, 본 발명의 일 실시 예에 따른 배터리 릴레이 진단 장치에 의하면, 각 배터리 팩의 릴레이들의 온/오프 상태에 따른 간섭 여부를 고려하여 동시에 또는 순차적으로 진단을 수행함으로써, 배터리 팩 간의 영향으로 오진단이 발생하는 문제를 해결할 수 있다.","As described above, with the battery relay diagnostic device according to an embodiment of the present disclosure, it is possible to solve the problem of misdiagnosis by the influence between battery packs by performing diagnosis simultaneously or sequentially in consideration of interference by the on/off states of the relays of each battery pack.",True,0.2297578305006027,0.8871562547865985,37,53,-16,143,350,-207
도 6은 본 발명의 일 실시 예에 따른 배터리 릴레이 진단 방법을 나타내는 흐름도이다.,FIG. 6 is a flowchart illustrating a battery relay diagnostic method according to an embodiment of the present disclosure.,True,0.1634878069162368,0.8967083925072501,14,19,-5,48,122,-74
"도 6에 나타낸 본 발명의 일 실시 예에 따른 배터리 릴레이 진단 방법은 병렬로 연결된 복수의 배터리 팩과 부하 측 사이에 연결되어 배터리 팩에 포함된 배터리 셀 모듈의 충방전을 제어하는 충방전 제어부와, 복수의 배터리 셀을 포함하는 배터리 셀 모듈과 배터리 셀 모듈의 (+)단과 부하 측 사이에 구비된 제1 스위치와 배터리 셀 모듈의 (-)단과 부하 측 사이에 구비된 제2 스위치를 포함하는 스위칭부를 구비한 배터리 팩을 포함하는 배터리 시스템을 진단하기 위한 진단 방법이다.","A battery relay diagnostic method according to an embodiment of the present disclosure, which is illustrated in FIG. 6, is a diagnostic method for a battery system including a charge and discharge controller connected between a plurality of battery packs connected in parallel and a load part and controlling charge and discharge of battery cell modules included in the battery packs, and the battery packs including the battery cell module including a plurality of battery cells and a switching unit including a first switch provided between a positive (+) terminal of the battery cell module and the load part and a second switch provided between a negative (-) terminal of the battery cell module and the load part.",True,0.1797307580709457,0.917167446692148,71,118,-47,267,718,-451
"이 때, 충방전 제어부는 하나의 프리차지 회로만을 포함할 수 있다.","In this case, the charge and discharge controller may include only one pre-charge circuit.",True,0.3041899800300598,0.8031239326457037,10,14,-4,37,90,-53
"또한, 상기 배터리 릴레이 진단 방법은 배터리 팩에 포함된 릴레이의 온/오프 상태(예를 들면, 배터리 팩들의 간섭 여부)에 기초하여 진단을 수행하는 진단 방법일 수 있다.","In addition, the battery relay diagnostic method may be a diagnostic method of performing diagnosis based on the on/off state of relays included in the battery pack (e.g., whether or not there is interference between the battery packs).",True,0.1910926401615142,0.9031645665801612,24,38,-14,95,236,-141
"도 6을 참조하면, 먼저 제1 스위치와 제2 스위치가 모두 열려 오프 상태인 경우, 제1 스위치 양단의 전압을 복수의 배터리 팩에 대하여 동시에 측정한다(S610).","Referring to FIG. 6, a voltage across the first switch are simultaneously measured for the plurality of battery packs when both the first switch and the second switch are open and are in the off state (S610).",True,0.1290909200906753,0.9341520789553368,23,37,-14,92,208,-116
"그리고, 제1 스위치와 제2 스위치가 오프인 상태에서 제1 스위치의 배터리 셀 모듈의 (+)측 단이 제2 스위치의 부하 측 단과 연결된 전압을 복수의 배터리 팩 각각에 대하여 순차적으로 측정한다(S620).","Then, when the first switch and the second switch are in the off state, a voltage across a terminal of the first switch close to a (+) side of the battery cell module and a terminal of the second switch close to the load part is sequentially measured for each of the plurality of battery packs (S620).",True,0.1554263532161712,0.9235454446858702,28,57,-29,115,301,-186
"다음으로, 제1 스위치가 오프 상태이고, 제2 스위치가 닫혀 온 상태인 경우, 제1 스위치의 배터리 셀 모듈의 (+)측 단이 제2 스위치의 부하 측 단과 연결된 전압을 복수의 배터리 팩에 대하여 동시에 측정한다(S630).","Then, when the first switch is in the off state and the second switch is closed and is in the on state, the voltage across the terminal of the first switch close to the (+) side of the battery cell module and the terminal of the second switch close to the load part is simultaneously measured for the plurality of battery packs (S630).",True,0.1918385624885559,0.9028830930127408,31,63,-32,124,335,-211
"그리고, 제1 스위치와 상기 제2 스위치가 모두 닫혀 온 상태인 경우, 제1 스위치 양단의 전압을 복수의 배터리 팩 각각에 대하여 순차적으로 측정한다(S640).","Then, when both the first switch and the second switch are closed and are in the on state, the voltage across the first switch is sequentially measured for each of the plurality of battery packs (S640).",True,0.2224727272987365,0.8798285585358244,22,36,-14,90,202,-112
"한편, 도 6에는 나타내지 않았으나, 본 발명의 일 실시 예에 따른 배터리 릴레이 진단 방법은 복수의 배터리 팩의 제1 스위치와 제2 스위치 중 적어도 하나에 이상이 발생한 것으로 판단된 경우 경고 알림을 발생시키는 단계를 포함할 수 있다.","On the other hand, although not illustrated in FIG. 6, the battery relay diagnostic method according to an embodiment of the present disclosure may include generating a warning notification when the diagnostic unit determines that an abnormality occurs in at least one of the first switch and the second switch in the plurality of battery packs.",True,0.211812824010849,0.8932143992281738,37,56,-19,134,345,-211
"이와 같이, 본 발명의 일 실시 예에 따른 배터리 릴레이 진단 방법에 의하면. 병렬로 연결되어 있는 배터리 팩의 프리차지 회로 구성을 최소화하여 비용을 절감하고 제어 로직을 단순화할 수 있으며, 병렬로 연결된 다른 배터리 팩의 간섭에 의한 영향을 고려하여 각 릴레이 상태에 따른 진단을 수행함으로써 오진단을 방지할 수 있다.","As described above, with the battery relay diagnostic method of the present disclosure, it is possible to reduce cost and simplify control logic by minimizing the configuration of the pre-charge circuit of battery packs connected in parallel, and to prevent misdiagnosis by performing diagnosis according to a state of each relay in consideration of the effect of interference from other battery packs connected in parallel.",True,0.2259584963321685,0.8852021452012702,48,65,-17,181,424,-243
도 7은 본 발명의 일 실시 예에 따른 배터리 릴레이 진단 장치의 하드웨어 구성을 나타내는 도면이다.,FIG. 7 is a diagram illustrating a hardware configuration of a battery relay diagnostic device according to an embodiment of the present disclosure.,True,0.1168505623936653,0.9267635790663624,16,23,-7,56,148,-92
"도 7을 참조하면, 배터리 릴레이 진단 장치(700)는, 각종 처리 및 각 구성을 제어하는 마이크로컨트롤러(MCU; 710)와, 운영체제 프로그램 및 각종 프로그램(예로서, 제1, 2 스위치의 상태를 진단할 수 있는 배터리 릴레이 진단 알고리즘 프로그램, 배터리 팩 내 스위치를 제어할 수 있는 배터리 스위칭 제어 프로그램) 등이 기록되는 메모리(720)와, 배터리 셀 모듈 및/또는 스위칭 소자의 전압, 전류, 온도 등의 데이터가 오고 갈 수 있는 입력 인터페이스 및 출력 인터페이스를 제공하는 입출력 인터페이스(730)와, 유무선 통신망을 통해 외부와 통신 가능한 통신 인터페이스(740)를 구비할 수 있다.","Referring to FIG. 7, a battery relay diagnostic device 700 may include a microcontroller (MCU) 710 controlling various processes and configurations, a memory 720 in which operating system programs and various programs (e.g., a battery relay diagnostic algorithm program capable of diagnosing the state of the first switch and the second switch, and a battery switching control program capable of controlling a switch in the battery pack) are recorded, an input/output interface 730 for providing an input interface and an output interface through which data of the battery cell module and/or the switching element, such as voltage, current, and temperature, can flow, and a communication interface 740 capable of communicating with the outside through a wired or wireless communication network.",True,0.0835269913077354,0.955888892711556,80,120,-40,342,794,-452
"이와 같이, 본 발명에 따른 컴퓨터 프로그램은 메모리(720)에 기록되고, 마이크로 컨트롤러(710)에 의해 처리됨으로써 예를 들면 도 2에서 도시한 각 기능 블록들을 수행하는 모듈로서 구현될 수 있다.","As described above, the computer program according to the present disclosure may be recorded in the memory 720 and processed by the microcontroller 710, so that it may be implemented as a module that performs each functional block illustrated in FIG. 2.",True,0.159877136349678,0.8957648513835677,26,42,-16,113,253,-140
"이상에서는 본 발명이 배터리 팩 내 프리차지 회로가 없는 구조로 설명하였으나, 프리차지가 있는 배터리라 할지라도 본 발명에 적용된 원리는 동일하게 적용할 수 있다.","In the above, the present disclosure has been described as a structure without the pre-charge circuit in the battery pack; however, the principle applied to the present disclosure is to be applied in the same way even for a battery with a pre-charge.",True,0.1705961376428604,0.9004152346280356,23,43,-20,91,250,-159
"이상에서, 본 발명의 실시예를 구성하는 모든 구성 요소들이 하나로 결합하거나 결합하여 동작하는 것으로 설명되었다고 해서, 본 발명이 반드시 이러한 실시예에 한정되는 것은 아니다.","In the description above, although all components constituting the aspects of the present disclosure have been described as being combined into one unit or operated in combination, the present disclosure is not necessarily limited to such aspects.",True,0.2432824969291687,0.849278808131117,23,37,-14,99,247,-148
"즉, 본 발명의 목적 범위 안에서라면, 그 모든 구성 요소들이 하나 이상으로 선택적으로 결합하여 동작할 수도 있다.","That is, within the objective scope of the present disclosure, one or more components may be selectively and operatively combined in any number.",True,0.2612710297107696,0.8268410778781978,17,23,-6,64,144,-80
"또한, 이상에서 기재된 ""포함하다"", ""구성하다"" 또는 ""가지다"" 등의 용어는, 특별히 반대되는 기재가 없는 한, 해당 구성 요소가 내재할 수 있음을 의미하는 것이므로, 다른 구성 요소를 제외하는 것이 아니라 다른 구성 요소를 더 포함할 수 있는 것으로 해석되어야 한다.","In addition, terms such as ""include"", ""comprise"", or ""have"" described above mean that the corresponding component can be present unless otherwise stated, and thus it should be construed that other components may be further included rather than excluding other components.",True,0.1048258617520332,0.936947580057112,38,40,-2,151,271,-120
"기술적이거나 과학적인 용어를 포함한 모든 용어들은, 다르게 정의되지 않는 한, 본 발명이 속하는 기술 분야에서 통상의 지식을 가진 자에 의해 일반적으로 이해되는 것과 동일한 의미가 있다.","All terms including technical or scientific terms have the same meaning as commonly understood by those of ordinary skill in the art to which the embodiments of the present disclosure belong, unless otherwise defined.",True,0.1104339435696601,0.9283768708501828,26,34,-8,104,217,-113
"사전에 정의된 용어와 같이 일반적으로 사용되는 용어들은 관련 기술의 문맥상의 의미와 일치하는 것으로 해석되어야 하며, 본 발명에서 명백하게 정의하지 않는 한, 이상적이거나 과도하게 형식적인 의미로 해석되지 않는다.",Terms commonly used such as those defined in dictionaries should be interpreted as having a meaning that is consistent with their meaning in the context of the related art and will not be interpreted in an idealized or overly formal sense unless expressly so defined in the present disclosure.,True,0.2080501466989517,0.8615379486802618,27,49,-22,119,293,-174
"이상의 설명은 본 발명의 기술 사상을 예시적으로 설명한 것에 불과한 것으로서, 본 발명이 속하는 기술 분야에서 통상의 지식을 가진 자라면 본 발명의 본질적인 특성에서 벗어나지 않는 범위에서 다양한 수정 및 변형이 가능할 것이다.","The above description is merely illustrative of the technical idea of the present disclosure, and those of ordinary skill in the art to which the present disclosure pertains will be able to make various modifications and variations without departing from the essential characteristics of the present disclosure.",True,0.1731720715761184,0.8884857414694175,33,47,-14,127,311,-184
"따라서, 본 발명에 개시된 실시예들은 본 발명의 기술 사상을 한정하기 위한 것이 아니라 설명하기 위한 것이고, 이러한 실시예에 의하여 본 발명의 기술 사상의 범위가 한정되는 것은 아니다.","Accordingly, the embodiments disclosed in the present disclosure are not intended to limit the technical idea of the present disclosure, but to explain the technical idea, and the scope of the technical idea of the present disclosure is not limited by these embodiments.",True,0.2730660140514374,0.8147236686239233,27,43,-16,104,270,-166
"본 발명의 보호 범위는 아래의 청구 범위에 의하여 해석되어야 하며, 그와 동등한 범위 내에 있는 모든 기술 사상은 본 발명의 권리 범위에 포함되는 것으로 해석되어야 할 것이다.","The scope of protection of the present disclosure should be interpreted by the accompanying claims, and all technical ideas within the scope equivalent thereto should be construed as being included in the scope of the present disclosure.",True,0.2106056660413742,0.862662360635825,27,37,-10,98,237,-139
"하이측 스위치는 제1 면 상의 소스 패드 및 제1 면 반대편의 제2 면 상의 드레인 패드를 포함하고, 하이측 스위치의 드레인 패드는 V, Sub[attributes={}; value=[high]], 패드를 향하고, 소스 패드는 스위치 노드 커넥터에 접속된다.]","The high side switch comprises a source pad on a first side and a drain pad on a second side opposing the first side, wherein the drain pad of the high side switch faces towards the Vhigh pad and the source pad of the high side switch is connected to the switch mode connector.",False,0.2924805283546446,0.8158610981498582,32,54,-22,145,277,-132
"[V, Sub[attributes={}; value=[high]], 패드, V, Sub[attributes={}; value=[low]], 패드, 스위치 노드 패드 및 하나 이상의 로직 패드는 리드프레임의 부분에 의해 제공될 수 있다.","The Vhigh pad, the Vlow pad, the switch node pad and the one or more logic pads may be provided by portions of a leadframe.",False,0.3721114099025726,0.7582347797213163,22,25,-3,131,123,8
"이들 실시예에서, 로우측 스위치의 소스 패드는 V, Sub[attributes={}; value=[low]], 패드 상에 실장되고, 하이측 스위치의 드레인 패드는 리드프레임의 V, Sub[attributes={}; value=[high]], 패드 상에 실장된다.]","In these embodiments, the source pad of the low side switch is mounted on the Vlow pad and the drain pad of the high side switch is mounted on the Vhigh pad of the leadframe.",False,0.3066309988498688,0.8045702225914472,23,35,-12,147,174,-27
"[임베디드 칩 기술을 이용하여 제조된 반도체 모듈에서, V, Sub[attributes={}; value=[high]], 패드, V, Sub[attributes={}; value=[low]], 패드, 스위치 노드 패드 및 하나 이상의 로직 패드는 로우측 스위치, 하이측 스위치 및 제어 칩을 덮는 모듈의 절연층 상에 형성될 수 있다.","In a semiconductor module fabricated using embedded chip technology, the Vhigh pad, the Vlow pad, the switch node pad and the one or more logic pads may be formed on an insulating layer of the module that covers the low side switch, the high side switch and the control chip.",False,0.2009945511817932,0.8737829053468665,37,50,-13,186,275,-89
"로우측 스위치의 소스 패드는 하나 이상의 전도성 비아에 의해 V, Sub[attributes={}; value=[low]], 패드에 접속될 수 있고, 하이측 스위치의 드레인 패드는 하나 이상의 전도성 비아에 의해 V, Sub[attributes={}; value=[high]], 패드에 접속될 수 있다.]",The source pad of the low side switch may be connected to the Vlow pad by one or more conductive vias and the drain pad of the high side switch may be connected to the Vhigh pad by one or more conductive vias.,False,0.3208422064781189,0.7987351580541434,32,43,-11,170,209,-39
"[일부 실시예에서, 수직 트랜지스터 소자는 MOSFET(Metal Oxide Semiconductor Field Effect Transistor) 소자, IGBT(Insulated Gate Bipolar Transistor) 소자 또는 BJT(Bipolar Junction Transistor)일 수 있다.]","In some embodiments, the vertical transistor device is a MOSFET (Metal Oxide Semiconductor Field Effect Transistor) device, an insulated gate bipolar transistor (IGBT) device or a Bipolar Junction Transistor (BJT).",True,0.1497790217399597,0.914503944196972,23,30,-7,172,214,-42
"[트랜지스터 소자의 전극 또는 단자는 여기에서 소스, 드레인 및 게이트로 지칭된다.","The electrodes or terminals of the transistor device are referred to herein as source, drain and gate.",True,0.2228145450353622,0.8482742264912879,11,17,-6,46,102,-56
"본 명세서에 사용된 바와 같이, 이들 용어는 또한 절연 게이트 바이폴라 트랜지스터(IGBT)와 같은 다른 유형의 트랜지스터 소자의 기능적으로 등가인 단자를 포함한다.","As used herein, these terms also encompass the functionally equivalent terminals of other types of transistor devices, such as an insulated gate bipolar transistor (IGBT).",True,0.1750958859920501,0.8897779999953046,21,25,-4,92,171,-79
"예를 들어, 여기서 사용된 ""소스""란 용어는 MOSFET 소자 및 초접합 소자의 소스뿐만 아니라 절연 게이트 바이폴라 트랜지스터(IGBT) 소자의 에미터 및 바이폴라 접합 트랜지스터(BJT)의 에미터도 포함하고, ""드레인""이란 용어는 MOSFET 소자 또는 초접합 소자의 드레인뿐만 아니라 절연 게이트 바이폴라 트랜지스터(IGBT) 소자의 콜렉터 및 BJT 소자의 콜렉터도 포함하며, ""게이트""란 용어는 MOSFET 소자 또는 초접합 소자의 게이트뿐만 아니라 절연 게이트 바이폴라 트랜지스터(IGBT) 소자의 게이트와 BJT 소자의 베이스도 포함한다.]","For example, as used herein, the term ""source"" encompasses not only a source of a MOSFET device and of a superjunction device but also an emitter of an insulator gate bipolar transistor (IGBT) device and an emitter of a Bipolar Junction Transistor (BJT) device, the term ""drain"" encompasses not only a drain of a MOSFET device or of a superjunction device but also a collector of an insulator gate bipolar transistor (IGBT) device and a collector of a BJT device, and the term ""gate"" encompasses not only a gate of a MOSFET device or of a superjunction device but also a gate of an insulator gate bipolar transistor (IGBT) device and a base of a BJT device.",True,0.1788076758384704,0.8954175860179961,64,117,-53,309,657,-348
"[일부 실시예에서, 반도체 모듈은 인덕터를 더 포함한다.","In some embodiments, the semiconductor module further comprises an inductor.",True,0.233781635761261,0.8511926457222936,7,10,-3,31,76,-45
"일부 실시예에서, 인덕터는 스위치 노드 커넥터와 출력 패드(V, Sub[attributes={}; value=[out]], ) 사이에 전기적으로 연결되는 출력 인덕터이다.","In some embodiments, the inductor is an output inductor that is electrically coupled between the switch node connector and an output pad Vout.",False,0.1745469570159912,0.8933491486039452,16,23,-7,95,142,-47
"이들 실시예에서, 반도체 모듈은 V, Sub[attributes={}; value=[high]], 패드, V, Sub[attributes={}; value=[low]], 패드, V, Sub[attributes={}; value=[out]], 패드 및 하나 이상의 로직 패드를 포함하는 풋프린트를 포함한다.]","In these embodiments, the semiconductor module comprises a footprint comprising a Vhigh pad, a Vlow pad, a Vout pad and one or more logic pads.",False,0.3721573650836944,0.7724585653233877,24,25,-1,171,143,28
[당업자는 다음의 상세한 설명을 읽고 첨부 도면을 살펴보면 추가적인 특징 및 이점을 이해할 수 있을 것이다.],"Those skilled in the art will recognize additional features and advantages upon reading the following detailed description, and upon viewing the accompanying drawings.",True,0.2058362662792205,0.8449715970007624,16,23,-7,61,167,-106
[도면의 예들은 반드시 서로에 대해 축척되지는 않는다.,The elements of the drawings are not necessarily to scale relative to each other.,True,0.3942424952983856,0.7062081969092131,7,14,-7,30,81,-51
유사한 참조 번호는 상응하는 유사한 부분을 나타낸다.,Like reference numerals designate corresponding similar parts.,True,0.181915208697319,0.8661329146675613,7,7,0,29,62,-33
도시된 다양한 실시예의 특징들은 이들이 서로를 배제하지 않는 한 결합될 수 있다.,The features of the various illustrated embodiments can be combined unless they exclude each other.,True,0.1171348541975021,0.9167705345736038,12,15,-3,45,99,-54
"실시예들은 도면에 도시되고, 다음의 설명에서 상세하게 설명된다.",Exemplary embodiments are depicted in the drawings and are detailed in the description which follows.,True,0.1045304909348487,0.9248016554813188,7,15,-8,35,101,-66
도 1은 일 실시예에 따른 반도체 모듈의 개략적인 평면도이다.,Figure 1 illustrates a schematic plan view of a semiconductor module according to an embodiment.,True,0.2137136757373809,0.8585540818003915,9,15,-6,34,96,-62
도 2는 일 실시예에 따른 반도체 모듈의 개략적인 평면도이다.,Figure 2 illustrates a schematic plan view of a semiconductor module according to an embodiment.,True,0.2087710499763488,0.8625272161349749,9,15,-6,34,96,-62
"도 3은 도 3a 및 3b를 포함하며, 일 실시예에 따른 반도체 모듈의 평면도 및 단면도이다.","Figure 3, which includes figures 3A and 3B, illustrates a plan view and a cross-sectional view of a semiconductor module according to an embodiment.",True,0.2221191078424453,0.8554434851756668,15,24,-9,52,148,-96
도 4는 일 실시예에 따른 반도체 모듈의 개략적인 평면도이다.,Figure 4 illustrates a plan view of a semiconductor module according to an embodiment.,True,0.2273537218570709,0.847982801822817,9,14,-5,34,86,-52
"도 5은 도 5a 내지 5c를 포함하며, 일 실시예에 따른 반도체 모듈의 투시도, 단면도 및 투명한 평면도이다.","Figure 5, which includes figures 5A to 5C illustrates a perspective view, a side view and a partially transparent plan view of a semiconductor module according to an embodiment.",True,0.285874605178833,0.8168796664172353,17,29,-12,62,177,-115
도 6은 일 실시예에 따른 반도체 모듈의 투시도이다.],Figure 6 illustrates a perspective view of a semiconductor module according to an embodiment.,True,0.3078294098377228,0.7867140023483016,8,14,-6,30,93,-63
"[다음의 상세한 설명에서는, 본 명세서의 일부를 이루는 첨부 도면을 참조하며, 이들 도면은 본 발명을 실시하는데 이용될 수 있는 특정 실시예를 예시로서 보여준다.","In the following detailed description, reference is made to the accompanying drawings, which form a part hereof, and in which is shown by way of illustration specific embodiments in which the invention may be practiced.",True,0.1574830561876297,0.898501987685223,22,35,-13,90,219,-129
"이와 관련하여, ""상부"", ""하부"", ""전방"", ""후방"", ""선행"", ""후행"" 등과 같은 방향 용어는 도면(들)의 방향을 참조하여 사용된다.","In this regard, directional terminology, such as ""top"", ""bottom"", ""front"", ""back"", ""leading"", ""trailing"", etc., is used with reference to the orientation of the figure(s) being described.",True,0.1569041162729263,0.8982601989524063,16,26,-10,78,187,-109
"실시예의 구성요소들은 다수의 상이한 방향으로 위치할 수 있기 때문에, 방향 용어는 예시를 위해 사용되며 어떤 식으로든 제한하는 것은 아니다.","Because components of the embodiments can be positioned in a number of different orientations, the directional terminology is used for purposes of illustration and is in no way limiting.",True,0.1523260325193405,0.905749593940436,19,29,-10,78,186,-108
다른 실시예가 이용될 수 있고 본 발명의 범위를 벗어나지 않고 구조적 또는 논리적 변경이 이루어질 수 있음을 이해해야 한다.,It is to be understood that other embodiments may be utilized and structural or logical changes may be made without departing from the scope of the present invention.,True,0.1144712045788765,0.922166905703936,19,28,-9,69,166,-97
"다음의 상세한 설명은 제한적인 의미로 받아들여서는 안 되며, 본 발명의 범위는 첨부된 청구범위에 의해 정의된다.]","The following detailed description, thereof, is not to be taken in a limiting sense, and the scope of the present invention is defined by the appended claims.",True,0.1420888155698776,0.8972203662913932,15,27,-12,63,158,-95
[다수의 실시예가 아래에서 설명될 것이다.,A number of exemplary embodiments will be explained below.,True,0.1882098913192749,0.8716188297757836,5,9,-4,23,58,-35
"이 경우, 동일한 구조적 특징은 도면에서 동일 또는 유사한 참조 기호로 식별된다.","In this case, identical structural features are identified by identical or similar reference symbols in the figures.",True,0.1277639418840408,0.9147200626073873,12,17,-5,45,116,-71
"본 설명의 맥락에서, ""측면"" 또는 ""측면 방향""은 반도체 재료 또는 반도체 캐리어의 측 방향 범위에 일반적으로 평행한 방향 또는 범위를 의미하는 것으로 이해해야 한다.","In the context of the present description, ""lateral"" or ""lateral direction"" should be understood to mean a direction or extent that runs generally parallel to the lateral extent of a semiconductor material or semiconductor carrier.",True,0.2179271429777145,0.8727916871961157,24,35,-11,94,231,-137
"따라서, 측면 방향은 일반적으로 이들 표면 또는 측면에 평행하게 연장된다.",The lateral direction thus extends generally parallel to these surfaces or sides.,True,0.1626447290182113,0.8901025567126007,10,12,-2,41,81,-40
"반면에, ""수직"" 또는 ""수직 방향""이라는 용어는 일반적으로 이들 표면 또는 측면에, 즉 측면 방향에 직교하는 방향을 의미하는 것으로 이해된다.","In contrast thereto, the term ""vertical"" or ""vertical direction"" is understood to mean a direction that runs generally perpendicular to these surfaces or sides and thus to the lateral direction.",True,0.1556413024663925,0.9058838431969152,19,30,-11,80,194,-114
"따라서, 수직 방향은 반도체 재료 또는 반도체 캐리어의 두께 방향이다.]",The vertical direction therefore runs in the thickness direction of the semiconductor material or semiconductor carrier.,True,0.3175948858261108,0.7773202104365324,10,16,-6,40,120,-80
"[본 명세서에서, 층, 영역 또는 기판과 같은 요소가 다른 요소 ""위에"" 있거나 ""위로"" 연장되는 것으로 언급되는 경우, 그 요소가 다른 요소 바로 위에 위치하거나 또는 그 바로 위로 연장될 수도 있고, 또는 중간 요소들이 존재할 수도 있다.","As employed in this specification, when an element such as a layer, region or substrate is referred to as being ""on"" or extending ""onto"" another element, it can be directly on or extend directly onto the other element or intervening elements may also be present.",True,0.2532883286476135,0.857315080505789,37,45,-8,135,262,-127
"반면에, 요소가 다른 요소 ""바로 위에"" 있거나 또는 ""바로 위로"" 연장되는 것으로 언급될 경우에는, 중간 요소가 존재하지 않는다.]","In contrast, when an element is referred to as being ""directly on"" or extending ""directly onto"" another element, there are no intervening elements present.",True,0.2431589215993881,0.8553880195508412,18,24,-6,74,155,-81
"[본 명세서에서, 한 요소가 다른 요소에 ""연결된"" 또는 ""결합된"" 것으로 언급되는 경우, 다른 요소에 직접 연결되거나 결합될 수도 있고, 중간 요소가 존재할 수도 있다.","As employed in this specification, when an element is referred to as being ""connected"" or ""coupled"" to another element, it can be directly connected or coupled to the other element or intervening elements may be present.",True,0.1915743798017501,0.893718490640004,24,36,-12,95,220,-125
"반면에, 한 요소가 다른 요소에 ""직접 연결""되거나 또는 ""직접 결합""되는 것으로 언급될 경우에는, 중간 요소가 존재하지 않는다.]","In contrast, when an element is referred to as being ""directly connected"" or ""directly coupled"" to another element, there are no intervening elements present.",True,0.175716832280159,0.8965880312695642,17,24,-7,73,158,-85
"[본 발명은 전기적 성능의 개선을 위해, 통합 전력 변환기라고도 하는 통합 파워 스테이지에서 전류 흐름의 균형을 맞추는 문제를 해결한다.","The present invention addresses balancing current flow in integrated power stages, also referred to integrated power converters, for improvement of the electrical performance.",True,0.2001953721046447,0.8726750021944522,19,23,-4,76,175,-99
"통합 파워 스테이지는 일반적으로 로우측 스위치와 하이측 스위치를 포함하는 하프 브리지(half-bridge) 회로와, 일반적으로는 하이측 스위치와 로우측 스위치를 구동하기 위한 드라이버 회로를 갖는 제어 칩을 포함한다.","An integrated power stage typically includes a half-bridge circuit including a low side switch and a high side switch and a control chip, commonly with driver circuitry for driving the high side switch and the low side switch.",True,0.1320137232542038,0.9169455009927638,25,38,-13,122,226,-104
파워 스테이지는 일반적으로 반도체 모듈로 제공된다.],The power stage is commonly provided as a semiconductor module.,True,0.2631321549415588,0.8136996734716896,6,10,-4,29,63,-34
"[전력 반도체 기술의 지속적인 개발로 로우측 스위치와 하이측 스위치를 제공하는 트랜지스터 소자의 Rdson이 감소하였고, 이는 전반적인 효율을 향상시키기 위해 파워 스테이지 패키지의 저항을 더욱 감소시키려는 요구로 이어지는데, 이는 통합 파워 스테이지의 전기 저항은 전도 손실에 영향을 미치며, 따라서 파워 스테이지의 총 손실에 영향을 미치기 때문이다.","Continuous development of power semiconductor technologies resulting in the reduction of Rdson of the transistor devices providing the low side switch and the high side switch leads to the desire for further reduction of resistance of the power stage package in order to improve the overall efficiency, since the electrical resistance of the integrated power stage affects the conduction losses and, therefore, the total losses in the power stage.",True,0.1720750778913498,0.8889289805880292,45,69,-24,197,447,-250
"일부 파워 스테이지 모듈은, 예를 들어, 두 트랜지스터 소자 사이의 스위치 노드 접속에서 균일하지 않은 전류 흐름을 가지며, 이는 다시 전력 손실과 패키지 저항을 증가시킬 수 있다.","Some power stage modules have non-homogeneous current flow, for example in the switch node connection between the two transistor devices, which in turn can lead to an increase of power losses and package resistance.",True,0.1807876229286193,0.8896470989027827,27,34,-7,101,215,-114
일부 파워 스테이지 모듈은 두 트랜지스터 소자의 비대칭 상호 위치를 갖는다.,Some power stage modules have a non-symmetrical mutual position of the two transistor devices.,True,0.1707739531993866,0.8874029867850471,11,14,-3,42,94,-52
이러한 비대칭 상호 위치는 특히 두 트랜지스터 소자 사이의 스위치 노드 접속에서 비균질 전류 흐름을 유발할 수 있다.,"This non-symmetrical mutual position may lead to non-homogeneous current flow, in particular in the switch node connection between the two transistor devices.",True,0.1993813961744308,0.8726541254004331,18,22,-4,65,158,-93
"전류 밀도 분포의 불균일성은 와전류의 발생으로 인해 주파수가 증가함에 따라 증가하는 경향이 있으므로, 이러한 부정적인 영향은 MHz 범위의 드라이버 주파수를 갖는 소자에 특히 강하다.]",Non-uniformities in the current density distribution tend to increase with an increase in frequency due to generation of eddy currents so that this negative effect is especially strong for devices with a driver frequency in MHz range.,True,0.1968220472335815,0.8638447812153597,24,37,-13,103,234,-131
"[본 발명에 따르면, 전류 흐름을 균일하게 하고 파워 스테이지 내에서 보다 균일하게 만들기 위해, 1차 전류 경로 외에 ""브리지"" 또는 2차 전류 경로에 의해 트랜지스터 소자의 저전류 밀도 영역들을 접속하는 것이 제안된다.","According to the invention, in order to homogenise current flow and make it more uniform within the power stage, it is proposed to connect low current density areas of the transistor devices by a ""bridge"" or secondary current path in addition to the primary path.",True,0.1751887202262878,0.8961228222553366,32,45,-13,124,263,-139
1차 경로는 일반적으로 두 트랜지스터 사이의 최단 경로이다.,The primary path is typically the shortest path between the two transistors.,True,0.1467154324054718,0.8951538635961949,8,12,-4,33,76,-43
이것은 전류 흐름을 밸런싱하고 전력 손실 밀도 분포가 더 균일해질 수 있도록 스위치 노드 접속에 두 개의 경로를 생성한다.,This creates two paths in the switch node connection to balance current flow and to enable the power loss density distribution to become more homogeneous.,True,0.1645342409610748,0.8871268623323447,19,25,-6,68,154,-86
"활성성분으로 하기 화학식 1의 화합물, 또는 이의 약제학적으로 허용되는 염 또는 이성질체; 및 생체적합성 고분자를 포함하는 주사용 약제학적 조성물:[화학식 1] 상기 식에서,R1은 알킬, 사이클로알킬, 아릴 또는 -C(O)R2을 나타내고,R2는 알킬, 사이클로알킬, 아릴, 아릴알킬, 또는 N, O 및 S로부터 선택되는 하나 이상의 헤테로원자를 포함하는 헤테로아릴을 나타내며,상기 알킬, 사이클로알킬, 아릴알킬 및 헤테로아릴은 임의로 치환되며, 치환기는 알킬, 사이클로알킬, 하이드록시, 할로, 할로알킬, 아실, 아미노, 알콕시, 카보알콕시, 카복시, 카복시아미노, 시아노, 니트로, 티올, 아릴옥시, 설폭시 및 구아니도기로부터 선택되는 하나 이상이다.","A pharmaceutical composition for injection comprising a compound of the following Formula 1, or a pharmaceutically acceptable salt or isomer thereof as an active ingredient; and a biocompatible polymer: wherein R1 represents alkyl, cycloalkyl, aryl or -C(O)R2; R2 represents alkyl, cycloalkyl, aryl, arylalkyl, or heteroaryl including one or more heteroatoms selected from N, O and S; and the alkyl, cycloalkyl, arylalkyl and heteroaryl are optionally substituted, and the substituent may be one or more selected from alkyl, cycloalkyl, hydroxy, halo, haloalkyl, acyl, amino, alkoxy, carboalkoxy, carboxy, carboxyamino, cyano, nitro, thiol, aryloxy, sulfoxy and guanido group.",True,0.1593419313430786,0.9241970450180444,73,95,-22,365,676,-311
"제1항에 있어서, R1은 C1-C8 알킬 또는 -C(O)R2을 나타내며,R2는 C1-C20 알킬, C6-C10아릴 또는 C6-C10아릴-C1-C7알킬인 것을 특징으로 하는 주사용 약제학적 조성물.","The pharmaceutical composition for injection according to Claim 1, wherein R1 represents C1-C8 alkyl or -C(O)R2; and R2 represents C1-C20 alkyl, C6-C10 aryl or C6-C10 aryl-C1-C7 alkyl.",True,0.1604280769824981,0.9246218213879756,19,27,-8,109,184,-75
"제1항에 있어서, R1은 C1-C5알킬 또는 -C(O)R2을 나타내고,R2는 C1-C15 알킬, C6-C10아릴 또는 C6-C10아릴-C1-C5알킬을 나타내며,치환기는 알킬 또는 할로알킬인 것을 특징으로 하는 주사용 약제학적 조성물.","The pharmaceutical composition for injection according to Claim 1, wherein R1 represents C1-C5 alkyl or -C(O)R2; R2 represents C1-C15 alkyl, C6-C10 aryl or C6-C10 aryl-C1-C5 alkyl; and the substituent is alkyl or haloalkyl.",True,0.1435534358024597,0.9342956556868096,22,33,-11,130,223,-93
"제1항에 있어서, 상기 화학식 1의 화합물이 다음으로부터 선택되는 것을 특징으로 하는 주사용 약제학적 조성물:(2S,3S)-2-(플루오로메틸)-3-((R)-5-이소프로필-3-(이소퀴놀린-1-일)-4,5-디히드로이소옥사졸-5-카르복사미도)-5-옥소테트라히드로퓨란-2-일 아세테이트;(2S,3S)-2-(플루오로메틸)-3-((R)-5-이소프로필-3-(이소퀴놀린-1-일)-4,5-디히드로이소옥사졸-5-카르복사미도)-5-옥소테트라히드로퓨란-2-일 프로피오네이트;(2R,3S)-2-(플루오로메틸)-3-((R)-5-이소프로필-3-(이소퀴놀린-1-일)-4,5-디히드로이소옥사졸-5-카르복사미도)-5-옥소테트라히드로퓨란-2-일 이소부티레이트;(2R,3S)-2-(플루오로메틸)-3-((R)-5-이소프로필-3-(이소퀴놀린-1-일)-4,5-디히드로이소옥사졸-5-카르복사미도)-5-옥소테트라히드로퓨란-2-일 피발레이트;(2R,3S)-2-(플루오로메틸)-3-((R)-5-이소프로필-3-(이소퀴놀린-1-일)-4,5-디히드로이소옥사졸-5-카르복사미도)-5-옥소테트라히드로퓨란-2-일 3-메틸부타노에이트;(2R,3S)-2-(플루오로메틸)-3-((R)-5-이소프로필-3-(이소퀴놀린-1-일)-4,5-디히드로이소옥사졸-5-카르복사미도)-5-옥소테트라히드로퓨란-2-일 3,3-디메틸부타노에이트;(2S,3S)-2-(플루오로메틸)-3-((R)-5-이소프로필-3-(이소퀴놀린-1-일)-4,5-디히드로이소옥사졸-5-카르복사미도)-5-옥소테트라히드로퓨란-2-일 팔미테이트;(2S,3S)-2-(플루오로메틸)-3-((R)-5-이소프로필-3-(이소퀴놀린-1-일)-4,5-디히드로이소옥사졸-5-카르복사미도)-5-옥소테트라히드로퓨란-2-일 벤조에이트;(2S,3S)-2-(플루오로메틸)-3-((R)-5-이소프로필-3-(이소퀴놀린-1-일)-4,5-디히드로이소옥사졸-5-카르복사미도)-5-옥소테트라히드로퓨란-2-일 4-(트리플루오로메틸)벤조에이트;(2S,3S)-2-(플루오로메틸)-3-((R)-5-이소프로필-3-(이소퀴놀린-1-일)-4,5-디히드로이소옥사졸-5-카르복사미도)-5-옥소테트라히드로퓨란-2-일 2-페닐아세테이트;(5 R)-N-((3S)-2-에톡시-2-(플루오로메틸)-5-옥소테트라히드로퓨란-3-일)-5-아이소프로필-3-(아이소퀴놀린-1-일)-4,5-디히드로아이소옥사졸-5-카르복사마이드; 및(5 R)-N-((3S)-2-(플루오로메틸)-2-메톡시-5-옥소테트라하이드로퓨란-3-일)-5-아이소프로필-3-(아이소퀴놀린-1-일)-4,5-디히드로아이소옥사졸-5-카르복사마이드.","The pharmaceutical composition for injection according to Claim 1, wherein the compound of Formula 1 is selected from the following group: (2S,3S)-2-(fluoromethyl)-3 -((R)-5 -isopropyl-3 -(isoquinolin-1-yl)-4,5-dihydroisoxazole-5-carboxamido)-5-oxotetrahydrofuran-2-yl acetate; (2S,3S)-2-(fluoromethyl)-3 -((R)-5 -isopropyl-3 -(isoquinolin-1-yl)-4,5-dihydroisoxazole-5-carboxamido)-5-oxotetrahydrofuran-2-yl propionate; (2R,3S)-2-(fluoromethyl)-3-((R)-5-isopropyl-3-(isoquinolin-1-yl)-4,5-dihydroisoxazole-5-carboxamido)-5-oxotetrahydrofuran-2-yl isobutyrate; (2R,3S)-2-(fluoromethyl)-3-((R)-5-isopropyl-3-(isoquinolin-1-yl)-4,5-dihydroisoxazole-5-carboxamido)-5-oxotetrahydrofuran-2-yl pivalate; (2S,3S)-2-(fluoromethyl)-3 -((R)-5 -isopropyl-3 -(isoquinolin-1-yl)-4,5-dihydroisoxazole-5-carboxamido)-5-oxotetrahydrofuran-2-yl 3-methylbutanoate; (2S,3S)-2-(fluoromethyl)-3 -((R)-5 -isopropyl-3 -(isoquinolin-1-yl)-4,5-dihydroisoxazole-5-carboxamido)-5-oxotetrahydrofuran-2-yl 3,3-dimethylbutanoate; (2S,3S)-2-(fluoromethyl)-3 -((R)-5 -isopropyl-3 -(isoquinolin-1-yl)-4,5-dihydroisoxazole-5-carboxamido)-5-oxotetrahydrofuran-2-yl palmitate; (2S,3S)-2-(fluoromethyl)-3 -((R)-5 -isopropyl-3 -(isoquinolin-1-yl)-4,5-dihydroisoxazole-5-carboxamido)-5-oxotetrahydrofuran-2-yl benzoate; (2S,3S)-2-(fluoromethyl)-3 -((R)-5 -isopropyl-3 -(isoquinolin-1-yl)-4,5-dihydroisoxazole-5-carboxamido)-5-oxotetrahydrofuran-2-yl 4-(trifluoromethyl)benzoate; (2S,3S)-2-(fluoromethyl)-3 -((R)-5 -isopropyl-3 -(isoquinolin-1-yl)-4,5-dihydroisoxazole-5-carboxamido)-5-oxotetrahydrofuran-2-yl 2-phenylacetate; (5R)-N-((3S)-2-ethoxy-2-(fluoromethyl)-5-oxotetrahydrofuran-3-yl)-5-isopropyl-3-(isoquinolin-1-yl)-4,5-dihydroisoxazole-5-carboxamide; and (5R)-N-((3S)-2-(fluoromethyl)-2-methoxy-5-oxotetrahydrofuran-3-yl)-5-isopropyl-3-(isoquinolin-1-yl)-4,5-dihydroisoxazole-5-carboxamide.",True,0.1741991192102432,0.9164386135887396,27,68,-41,1243,1860,-617
"제1항에 있어서, 상기 생체적합성 고분자가 폴리락타이드, 폴리글리콜라이드 및 폴리(락타이드-코-글리콜라이드), 폴리카프로락톤, 폴리오르토에스테르 및 폴리포스파진으로 이루어진 그룹에서 선택되는 하나 이상인 것을 특징으로 하는 주사용 약제학적 조성물.","The pharmaceutical composition for injection according to Claim 1, wherein the biocompatible polymer is one or more selected from the group consisting of polylactide, polyglycolide, poly(lactide-co-glycolide), polycaprolactone, polyorthoester and polyphosphazine.",True,0.208290234208107,0.9139113067709208,24,30,-6,138,263,-125
"제5항에 있어서, 상기 생체적합성 고분자가 폴리(락타이드-코-글리콜라이드)인 것을 특징으로 하는 주사용 약제학적 조성물.","The pharmaceutical composition for injection according to Claim 5, wherein the biocompatible polymer is poly(lactide-co-glycolide).",True,0.2624095976352691,0.8840310189771554,12,15,-3,67,131,-64
"제6항에 있어서, 상기 폴리(락타이드-코-글리콜라이드)의 락타이드 대 글리콜라이드의 몰비가 90:10 내지 10:90인 것을 특징으로 하는 주사용 약제학적 조성물.","The pharmaceutical composition for injection according to Claim 6, wherein a molar ratio of lactide to glycolide of the poly(lactide-co-glycolide) is 90:10 to 10:90.",True,0.164370521903038,0.933234641648427,17,24,-7,91,165,-74
"제7항에 있어서, 상기 폴리(락타이드-코-글리콜라이드)의 락타이드 대 글리콜라이드의 몰비가 90:10 내지 40:60인 것을 특징으로 하는 주사용 약제학적 조성물.","The pharmaceutical composition for injection according to Claim 7, wherein a molar ratio of lactide to glycolide of the poly(lactide-co-glycolide) is 90:10 to 40:60.",True,0.1619359403848648,0.9340303263358544,17,24,-7,91,165,-74
"제8항에 있어서, 상기 폴리(락타이드-코-글리콜라이드)의 락타이드 대 글리콜라이드의 몰비가 85:15 내지 50:50인 것을 특징으로 하는 주사용 약제학적 조성물.","The pharmaceutical composition for injection according to Claim 8, wherein a molar ratio of lactide to glycolide of the poly(lactide-co-glycolide) is 85:15 to 50:50.",True,0.1443520784378051,0.94161879733959,17,24,-7,91,165,-74
"제1항에 있어서, 용매를 추가로 포함하는 것을 특징으로 하는 주사용 약제학적 조성물.","The pharmaceutical composition for injection according to Claim 1, which further comprises a solvent.",True,0.2578279078006744,0.8585386594973539,11,14,-3,47,101,-54
"제10항에 있어서, 상기 용매가 물, 생리 식염수 또는 인산 완충 식염수인 것을 특징으로 하는 주사용 약제학적 조성물.","The pharmaceutical composition for injection according to Claim 10, wherein the solvent is water, saline or phosphate-buffered saline.",True,0.2458524852991104,0.878349841894542,17,18,-1,66,134,-68
"제1항에 있어서, 세포사멸-매개 질환, 염증 질환, 골 관절염, 류마티스성 관절염, 퇴행성 관절염 및 파괴성 골 장애로부터 선택되는 질환의 예방 또는 치료를 위한 것을 특징으로 하는 주사용 약제학적 조성물.","The pharmaceutical composition for injection according to Claim 1, which is for the prevention or treatment of a disease selected from apoptosis-associated diseases, inflammatory diseases, osteoarthritis, rheumatoid arthritis, degenerative arthritis and destructive bone disorders.",True,0.2650140225887298,0.8663617238386264,28,34,-6,115,281,-166
"제12항에 있어서, 골 관절염의 예방, 치료 또는 통증 감소를 위한 것을 특징으로 하는 주사용 약제학적 조성물.","The pharmaceutical composition for injection according to Claim 12, which is for the prevention, treatment or pain relief of osteoarthritis.",True,0.2016977071762085,0.8922042452669836,16,20,-4,62,140,-78
용접 장치 및 방법,Field,False,1.106475830078125,0.1149619297196962,4,1,3,10,5,5
"[본 개시는, 협애부에 대한 용접을 행하는 용접 장치 및 용접 방법에 관한 것이다.]",The present disclosure relates to a welding apparatus and a welding method for welding to a narrow part.,True,0.3134213089942932,0.7968897710386538,13,18,-5,47,104,-57
"[예를 들어, 가압수형 원자로는, 경수를 원자로 냉각재 및 중성자 감속재로서 사용하여, 노심 전체에 걸쳐 비등하지 않는 고온 고압수로 하고, 고온 고압수를 증기 발생기로 보내 열교환에 의해 증기를 생성하는 것이다.]","For example, a pressurized water reactor uses light water as a reactor coolant and a neutron moderator to make high-temperature, high-pressure water that does not boil over the entire core, and sends the high-temperature, high-pressure water to a steam generator so as to produce steam through heat exchange.",True,0.2804779708385467,0.8079578861994168,29,48,-19,120,308,-188
"[가압수형 원자로는, 원자로 용기 내에 노심이 마련되고, 노심은, 다수의 연료봉에 의해 구성된다.","In the pressurized water reactor, a reactor core is provided inside of a reactor vessel, and the core includes a large number of fuel rods.",True,0.3998174369335174,0.7374221827528735,12,25,-13,54,139,-85
"원자로 용기는, 상부에 제어봉 구동 장치가 마련되고, 제어봉 구동 장치는, 다수의 연료봉에 대해 제어봉을 삽입함으로써 원자로의 출력을 제어 가능하다.","The reactor vessel includes a control rod driving unit at an upper part thereof, and the control rod driving unit can control the reactor power by inserting control rods into the many fuel rods.",True,0.2345583289861679,0.8553753975309873,19,34,-15,83,194,-111
"제어봉 구동 장치는, 원자로 용기 덮개의 상부에 배치되고, 제어봉 클러스터 구동축이 원자로 용기 덮개에 고정된 관대에 안내되어 원자로 용기 내에 삽입 관통되며, 선단부에 제어봉이 연결된다.]","The control rod driving unit is disposed at an upper part of a reactor vessel lid, control rod cluster drive shafts are guided by nozzles fixed to the reactor vessel lid and inserted into the reactor vessel, and tip ends of the control rod cluster drive shafts are connected to the control rods.",True,0.186546191573143,0.8924750077497668,25,53,-28,106,295,-189
"[원자로 용기 덮개는, 복수의 관대가 용접에 의해 고정되어 구성된다.",The reactor vessel lid includes the plurality of nozzles fixed together thereto by welding.,True,0.4054872691631317,0.7175814140280014,9,14,-5,38,91,-53
"관대를 원자로 용기 덮개에 고정하는 기술로서는, 예를 들어 하기 인용문헌 1에 기재된 것이 있다.","Examples of a technique for fixing the nozzles to the reactor vessel lid include a technique described in Patent Literature 1 below, for example.",True,0.2382963299751281,0.8448896472351738,14,24,-10,54,145,-91
"인용문헌 1에 기재된 용접 장치는, 용접 전극과, 용접 와이어와, 와이어 노즐 반전 기구를 구비하고, 와이어 노즐 반전 기구에 의해 용접 부분을 따라 이동하는 용접 전극에 대한 용접 와이어의 공급 위치를 변경하는 것이다.]","The welding apparatus described in Patent Literature 1 includes a welding electrode, a welding wire, and a wire nozzle reversing mechanism, and allows the wire nozzle reversing mechanism to change a supply position of the welding wire to the welding electrode that moves along a weld portion.",True,0.2328977584838867,0.8648462104097518,32,47,-15,124,292,-168
[PatentCitationText[attributes={}; value=[일본 특허 제5582790호 공보]]],Patent Literature 1: Japanese Patent No. 5582790,False,0.4772170782089233,0.6058509880608867,5,7,-2,63,48,15
"[상술한 종래의 용접 장치에서는, 관대를 원자로 용기 덮개에 고정하는 경우, 용접 장치를 소정의 위치로부터 우측 방향으로 반주시켜 용접함과 함께, 좌측 방향으로 반주시켜 용접함으로써 관대의 외주부를 전둘레 용접하고 있다.","In the above-described conventional welding apparatus, when the nozzle is fixed to the reactor vessel lid, the welding apparatus goes half around the nozzle clockwise for welding from a predetermined position and then goes half around the nozzle counterclockwise for welding from the predetermined position, thereby welding the entire circumference of the outer circumference of the nozzle.",True,0.3186208009719848,0.8135551143138378,28,57,-29,123,390,-267
"이때, 용접 전극보다 용접 와이어를 선행하여 이동할 필요가 있는 점에서, 와이어 노즐 반전 기구를 마련하고 있다.","Since it is necessary to move the welding wire ahead of the welding electrode, a wire nozzle reversing mechanism is provided.",True,0.3329308629035949,0.7745796329200808,16,21,-5,63,125,-62
"그 때문에, 용접 장치의 구성이 복잡화됨과 함께 대형화되어 버린다.","As a result, the configuration of the welding apparatus becomes more complicated and increases in size.",True,0.1970472037792205,0.8546605004844087,9,16,-7,37,103,-66
"원자로 용기 덮개는, 소정 간격을 두고 복수의 관대를 고정할 필요가 있으며, 용접 장치가 이동할 수 있는 공간은 좁다.","The reactor vessel lid needs to fix the nozzles thereto at predetermined intervals, and a space in which the welding apparatus can move is narrow.",True,0.2698097229003906,0.8154836873920606,18,25,-7,66,146,-80
"그 때문에, 용접 장치의 콤팩트화가 요망되고 있다.]","Accordingly, it is desirable to downsize the welding apparatus.",True,0.3714563548564911,0.7283244818878905,7,9,-2,29,63,-34
"[본 개시는, 상술한 과제를 해결하는 것이며, 장치의 소형화를 도모하는 용접 장치 및 방법을 제공하는 것을 목적으로 한다.]","The present disclosure is intended to solve the above-described problem, and an object of the present disclosure is to provide a welding apparatus and a method capable of achieving miniaturization of the apparatus.",True,0.3640885353088379,0.7592895173964477,17,33,-16,69,214,-145
"[상기한 목적을 달성하기 위한 본 개시의 용접 장치는, 용접 토치와, 와이어 노즐과, 상기 용접 토치와 상기 와이어 노즐을 소정 간격을 두고 지지하는 지지대와, 상기 지지대를 상기 용접 토치와 상기 와이어 노즐의 배열 방향을 따른 제1 지지축을 중심으로 하여 회동 가능하게 지지하는 제1 지지 기구를 구비한다.]","In order to achieve the above object, a welding apparatus according to the present disclosure includes a welding torch; a wire nozzle; a support stand that supports the welding torch and the wire nozzle with a predetermined interval therebetween; and a first support mechanism that supports the support stand so that the support stand is rotatable around a first support axis that is along a direction in which the welding torch and the wire nozzle are arranged.",True,0.1889184117317199,0.8943821039071956,45,77,-32,174,462,-288
"[또한, 본 개시의 용접 방법은, 용접 토치와, 와이어 노즐과, 상기 용접 토치와 상기 와이어 노즐을 지지하는 지지대를 구비하는 용접 장치에서, 상기 지지대를 상기 용접 토치와 상기 와이어 노즐의 배열 방향을 따른 제1 지지축을 중심으로 하여 기준 위치로부터 일방측으로 소정 각도만큼 회동시켜 용접을 행하는 공정과, 상기 지지대를 상기 제1 지지축을 중심으로 하여 기준 위치로부터 타방측으로 소정 각도만큼 경동하여 용접을 행하는 공정을 갖는다.]",The welding method includes the steps of: performing welding by rotating the support stand by a predetermined angle from a reference position to one side around the first support axis along a direction in which the welding torch and the wire nozzle are arranged; and performing welding by rotating the support stand by a predetermined angle from the reference position to the other side around the first support axis.,False,0.2285020798444748,0.8678692701852989,61,69,-8,249,417,-168
"[본 개시의 용접 장치 및 방법에 따르면, 장치의 소형화를 도모할 수 있다.]",The welding apparatus and the method of the present disclosure are capable of achieving the miniaturization of the apparatus.,True,0.3913180232048034,0.7132301792283281,12,19,-7,43,125,-82
[도 1은 본 실시 형태의 용접 장치를 도시하는 정면도이다.,FIG. 1 is a front view illustrating welding apparatus of the present embodiment.,True,0.1848777830600738,0.8819785325170193,9,13,-4,33,80,-47
도 2는 용접 장치를 도시하는 측면도이다.,FIG. 2 is a side view illustrating the welding apparatus.,True,0.0825629606842994,0.946732201101536,6,10,-4,23,57,-34
도 3은 도 1의 Ⅲ-Ⅲ 단면도이다.,FIG. 3 is a sectional view along line III-III of FIG. 1.,True,0.1547363400459289,0.8843169084416108,6,12,-6,20,56,-36
도 4는 용접 장치의 전체 구성을 도시하는 개략도이다.,FIG. 4 is a schematic diagram illustrating an overall configuration of the welding apparatus.,True,0.0842410326004028,0.9457280734840864,8,14,-6,30,93,-63
도 5는 용접 장치의 제어 블록이다.,FIG. 5 is a control block of the welding apparatus.,True,0.073098711669445,0.9518677834492788,6,10,-4,20,51,-31
도 6은 용접 장치에 의한 용접 방법을 설명하기 위한 평면도이다.,FIG. 6 is a plan view for explaining a welding method with the welding apparatus.,True,0.1076987013220787,0.931678130051863,10,15,-5,36,81,-45
도 7은 제1 지지 기구에 의한 용접 토치의 각도 조정 방법을 설명하기 위한 개략도이다.,FIG. 7 is a schematic diagram for explaining an angle adjustment method of a welding torch with a first support mechanism.,True,0.1669082194566726,0.8916727634492767,14,21,-7,49,122,-73
도 8은 제2 지지 기구에 의한 용접 토치의 각도 조정 방법을 설명하기 위한 개략도이다.,FIG. 8 is a schematic diagram for explaining the angle adjustment method of the welding torch with a second support mechanism.,True,0.1387314051389694,0.9075869838101188,14,21,-7,49,126,-77
도 9는 가압수형 원자로를 도시하는 종단면도이다.],FIG. 9 is a longitudinal sectional view illustrating a pressurized water reactor.,True,0.3275164067745209,0.7670487171167019,6,12,-6,28,81,-53
"[이하에 도면을 참조하여, 본 개시의 적합한 실시 형태를 상세하게 설명한다.",The following describes in detail a suitable embodiment of the present disclosure with reference to the drawings.,True,0.1963123381137848,0.8548746276731541,10,17,-7,42,113,-71
"또한, 이 실시 형태에 의해 본 개시가 한정되는 것은 아니며, 또한 실시 형태가 복수 있는 경우에는, 각 실시 형태를 조합하여 구성하는 것도 포함하는 것이다.","The present disclosure is not limited by the present embodiment, and when there are multiple embodiments, the embodiments include an embodiment configured by combining any of the embodiments.",True,0.207862377166748,0.8568676651667164,24,28,-4,88,191,-103
"또한, 실시 형태에 있어서의 구성 요소에는, 당업자가 용이하게 상정할 수 있는 것, 실질적으로 동일한 것, 이른바 균등의 범위인 것이 포함된다.]","Components in the embodiments include those that can be easily envisioned by those skilled in the art, those that are substantially identical, and those that are within what is called a scope of equality.",True,0.2718571424484253,0.7871097915599109,20,34,-14,81,204,-123
[[가압수형 원자로]],[Pressurized water reactor],True,0.267487108707428,0.7937028745398245,2,3,-1,12,27,-15
[도 9는 가압수형 원자로를 도시하는 종단면도이다.],FIG. 9 is a longitudinal sectional view illustrating a pressurized water reactor.,True,0.3376011848449707,0.7615895848639626,6,12,-6,29,81,-52
"[원자력 발전 플랜트는, 도시하지 않지만, 원자로 격납 용기 내에 배치되는 원자로 및 증기 발생기와, 증기 터빈 발전 설비를 갖는다.","Although not illustrated in the drawings, a nuclear power plant has a nuclear reactor and a steam generator that are disposed in a reactor containment vessel, and a steam turbine power generation system.",True,0.3260604739189148,0.7924629118750844,19,33,-14,74,203,-129
"본 실시 형태의 원자로는, 가압수형 원자로이다.]",A nuclear reactor of the present embodiment is a pressurized water reactor.,True,0.370064228773117,0.7386360743552005,6,12,-6,27,75,-48
"[도 9에 도시하는 바와 같이, 가압수형 원자로(10)에 있어서, 원자로 용기(11)는, 내부에 노내 구조물을 삽입할 수 있도록, 원자로 용기 본체(12)와 그 상부에 장착되는 원자로 용기 덮개(13)에 의해 구성되고, 원자로 용기 본체(12)에 대해 원자로 용기 덮개(13)가 복수의 스터드 볼트(14) 및 너트(15)에 의해 개폐 가능하게 고정된다.]","As illustrated in FIG. 9, in a pressurized water reactor 10, the reactor vessel 11 includes, so as to be able to have a reactor internal structure inserted thereinside, a reactor vessel body 12 and a reactor vessel lid 13 mounted on an upper part of the reactor vessel body 12, the reactor vessel lid 13 being fixed to the reactor vessel body 12 with a plurality of stud bolts 14 and nuts 15, in an openable manner.",True,0.2140073925256729,0.876981545851034,43,78,-35,198,415,-217
"[원자로 용기 본체(12)는, 상부가 개구되고, 하부가 반구 형상을 이루어 폐색된 원통 형상을 이루고, 상부에 1차 냉각재로서의 경수를 공급하는 입구 노즐(16)과, 경수를 배출하는 출구 노즐(17)이 형성된다.","The reactor vessel body 12 has a cylindrical shape having an upper part that is open and a lower part that has a hemispherical shape and is closed, and on the upper part, an inlet nozzle 16 for supplying light water serving as primary coolant and an outlet nozzle 17 for discharging the light water are formed.",True,0.2052249610424041,0.8686690411945334,25,57,-32,118,310,-192
"원자로 용기 본체(12)는, 내부에 노심조(18)가 배치되고, 상부가 원자로 용기 본체(12)의 내벽면에 지지된다.","The reactor vessel body 12 has a core barrel 18 disposed thereinside, and the core barrel 18 has an upper part that is supported by the inner wall of the reactor vessel body 12.",True,0.2151096612215042,0.8736734826598954,12,34,-22,64,177,-113
"상부 노심 지지판(19)은, 원자로 용기 본체(12)의 내부에 배치되고, 상부가 노심조(18)의 상부에 지지된다.","The reactor vessel body 12 has an upper core support plate 19 disposed thereinside, and the upper core support plate 19 has a top that is supported by the upper part of the core barrel 18.",True,0.2651249170303345,0.8446206845278043,12,36,-24,63,188,-125
"상부 노심판(20)은, 복수의 노심 지지 로드(21)에 의해 상부 노심 지지판(19)에 현수되어 지지된다.]",An upper core plate 20 is suspended from the upper core support plate 19 and supported with a plurality of core support rods 21.,True,0.2389908581972122,0.8424024696727058,12,24,-12,60,128,-68
"[노심조(18)는 하방에 하부 노심 지지판(22)이 지지되고, 하부 노심 지지판(22)은 외주부가 위치 결정 부재(23)에 의해 원자로 용기 본체(12)의 내벽면에 위치 결정되어 지지된다.","The core barrel 18 supports a lower core support plate 22 on the lower part thereof, and the lower core support plate 22 has an outer circumference positioned on an inner wall of the reactor vessel body 12 and supported by positioning members 23.",True,0.1803152412176132,0.8920638484445906,21,44,-23,105,246,-141
"노심조(18)는, 하부에 하부 노심판(24)이 지지되어 있다.",The reactor core barrel 18 supports a lower core plate 24 in the lower part thereof.,True,0.331318736076355,0.7688152902310299,6,16,-10,34,84,-50
"노심(25)은, 다수의 연료 집합체(26)가 배치되어 구성되고, 내부에 다수의 제어봉(27)이 배치되고, 이 제어봉(27)은 연료 집합체(26)에 삽입 가능하다.","A reactor core 25 includes a large number of fuel assemblies 26, and has a large number of control rods 27 disposed inside the reactor core 25, and the control rods 27 can be inserted into the fuel assemblies 26.",True,0.169481948018074,0.8981907666239378,16,40,-24,90,212,-122
"상부 노심 지지판(19)은, 다수의 제어봉 클러스터 안내관(28)이 고정되고, 내부에 제어봉(27)이 삽입 관통 가능하다.","The upper core support plate 19 has a large number of control rod cluster guide tubes 28 fixed thereto, and the control rods 27 can be inserted into the respective control rod cluster guide tubes 28.",True,0.1540842056274414,0.9030804867462932,13,36,-23,68,199,-131
"원자로 용기 덮개(13)는, 반구 형상을 이루고, 제어봉 구동 장치(29)가 배치되고, 복수의 제어봉 클러스터 구동축(30)이 제어봉 클러스터 안내관(28) 내에 삽입 관통되고, 하단부에 제어봉(27)이 연결된다.","The reactor vessel lid 13 has a hemispherical shape, on which a control rod driving unit 29 is disposed, a plurality of control rod cluster drive shafts 30 are inserted into the control rod cluster guide tubes 28, and the control rods 27 are connected to respective lower ends of the control rod cluster drive shafts 30.",True,0.1741427779197693,0.8972105621458015,23,57,-34,119,320,-201
"제어봉 구동 장치(29)는, 각 제어봉(27)을 노심(25)에 대해 인출 삽입함으로써 원자로 출력을 제어한다.]",The control rod driving unit 29 controls reactor power by pulling in and out each of the control rods 27 with respect to the reactor core 25.,True,0.2008704394102096,0.8679171139795808,12,27,-15,62,141,-79
[[용접 장치]],Welding apparatus,True,0.390500545501709,0.7122493657649084,2,2,0,9,17,-8
"[도 1은 본 실시 형태의 용접 장치를 도시하는 정면도, 도 2는 용접 장치를 도시하는 측면도, 도 3은 도 2의 Ⅲ-Ⅲ 단면도이다.]","FIG. 1 is a front view illustrating the welding apparatus, FIG. 2 is a side view illustrating the welding apparatus, and FIG. 3 is a sectional view along line III-III of FIG. 2.",True,0.1968130618333816,0.8785147092830212,21,33,-12,75,177,-102
"[본 실시 형태에 있어서, 도 1 내지 도 3에 도시하는 바와 같이, 용접 장치(50)는, 용접 토치(51)와, 와이어 노즐(52)과, 지지대(53)와, 제1 지지 기구(54)를 구비한다.","In the present embodiment, as illustrated in FIGS. 1 to 3, a welding apparatus 50 includes a welding torch 51, a wire nozzle 52, a support stand 53, and a first support mechanism 54.",True,0.1138131991028785,0.9320775868812772,23,34,-11,105,182,-77
"(a)우레탄(메타)아크릴레이트, (c)그 밖의 중합성 모노머를 함유하는 인쇄용 잉크로서, 잉크 점성값이 5.0 이상 18.0 이하, 및 35℃, 콘 플레이트형 회전 점토계로 측정한 회전수 20rpm에 있어서의 점도(C), 및 회전수 50rpm에 있어서의 점도(B)가 모두 5Pa·s 이상, 100Pa·s 이하이며, 또한 점도비 (B)/(C)가 0.60 이상, 1.00 이하인 것을 특징으로 하는 인쇄용 잉크.","A printing ink, comprising (a) a urethane (meth)acrylate and (c) another polymerizable monomer, wherein the printing ink has an ink tack value of 5.0 or more and 18.0 or less and a viscosity (C) and a viscosity (B) that are both 5 Pa·s or more and 100 Pa·s or less, as measured at a rotational speed of 20 rpm and a rotational speed of 50 rpm respectively at 35°C, using a cone-plate rotating viscometer, and wherein the viscosity ratio (B)/(C) is 0.60 or more and 1.00 or less.",True,0.1461983621120453,0.9327206351692507,47,88,-41,228,478,-250
"제 1 항에 있어서,수지를 더 포함하는 인쇄용 잉크.","The printing ink according to claim 1, further comprising a resin.",True,0.1735135465860366,0.9096972295781752,8,11,-3,29,66,-37
"제 1 항 또는 제 2 항에 있어서,잉크 100질량%에 대해서 상기 (a)우레탄(메타)아크릴레이트를 1∼30질량% 함유하는 인쇄용 잉크.","The printing ink according to claim 1 or 2, comprising said (a) urethane (meth)acrylate in an amount of 1 to 30 mass% with respect to 100 mass% of the ink.",True,0.142602801322937,0.9412470370471052,16,30,-14,76,155,-79
"제 1 항 내지 제 3 항 중 어느 한 항에 있어서,상기 (a)우레탄(메타)아크릴레이트의 중량 평균 분자량(Mw)이 500∼10,000인 인쇄용 잉크.","The printing ink according to any one of claims 1 to 3, wherein said (a) urethane (meth)acrylate has a weight-average molecular weight (Mw) of 500 to 10,000.",True,0.1223117932677269,0.9453506836593224,19,27,-8,84,157,-73
"제 1 항 내지 제 4 항 중 어느 한 항에 있어서,상기 (a)우레탄(메타)아크릴레이트는 우레탄 결합 분률이 5질량% 이상, 40질량% 이하인 인쇄용 잉크.","The printing ink according to any one of claims 1 to 4, wherein said (a) urethane (meth)acrylate has a urethane bond fraction of 5 mass% or more and 40 mass% or less.",True,0.2141309976577758,0.915825935174302,22,32,-10,87,166,-79
"제 1 항 내지 제 5 항 중 어느 한 항에 있어서,상기 (a)우레탄(메타)아크릴레이트가 폴리올 중에 적어도 에테르 구조를 갖는 인쇄용 잉크.","The printing ink according to any one of claims 1 to 5, wherein said (a) urethane (meth)acrylate has at least an ether structure in the polyol thereof.",True,0.1411131620407104,0.9430218732937892,21,27,-6,79,151,-72
"제 2 항 내지 제 6 항 중 어느 한 항에 있어서,상기 수지가 (b)에틸렌성 불포화기 및 친수성기를 갖는 수지인 인쇄용 잉크.","The printing ink according to any one of claims 2 to 6, wherein said resin is (b) a resin having an ethylenically unsaturated group and a hydrophilic group.",True,0.349925547838211,0.8343795576123727,21,28,-7,71,156,-85
"(a)우레탄(메타)아크릴레이트, (b)에틸렌성 불포화기 및 친수성기를 갖는 수지, 및 (c)그 밖의 중합성 모노머를 함유하는 것을 특징으로 하는 인쇄용 잉크.","A printing ink, comprising: (a) a urethane (meth)acrylate; (b) a resin having an ethylenically unsaturated group and a hydrophilic group; and (c) another polymerizable monomer.",True,0.2847901582717895,0.8655647485014096,18,25,-7,88,176,-88
"제 1 항 내지 제 8 항 중 어느 한 항에 있어서,상기 (c)그 밖의 중합성 모노머가 적어도 히드록실기 함유 다관능 (메타)아크릴레이트를 포함하는 인쇄용 잉크.","The printing ink according to any one of claims 1 to 8, wherein said (c) another polymerizable monomer contains at least a hydroxyl-group-containing polyfunctional (meth)acrylate.",True,0.2150685340166092,0.9108119475809848,24,25,-1,90,179,-89
"제 1 항 내지 제 9 항 중 어느 한 항에 있어서,상기 (a)우레탄(메타)아크릴레이트의 비율이 (c)그 밖의 중합성 모노머에 대해서 3질량% 이상, 40질량% 이하인 인쇄용 잉크.","The printing ink according to any one of claims 1 to 9, wherein the ratio of said (a) urethane (meth)acrylate is 3 mass% or more and 40 mass% or less with respect to said (c) another polymerizable monomer.",True,0.15951868891716,0.9330345798045908,25,38,-13,101,205,-104
"제 1 항 내지 제 10 항 중 어느 한 항에 있어서,활성 에너지선 경화형 평판에 사용하는 인쇄용 잉크.","A printing ink according to any one of claims 1 to 10, which is used for an active energy ray-curable lithography plate.",True,0.1670427173376083,0.9147733140813052,18,22,-4,58,120,-62
"제 1 항 내지 제 11 항 중 어느 한 항에 기재된 인쇄용 잉크를 이용하여 평판 인쇄하는 인쇄물의 제조 방법으로서, 인쇄되는 기재에 잉크를 전사한 후, 활성 에너지선을 조사하는 공정을 포함하는 것을 특징으로 하는 인쇄물의 제조 방법.","A method of producing a printed material by lithography using the printing ink according to any one of claims 1 to 11, the method comprising a step of transferring the ink to a substrate to be printed, followed by irradiating the resulting material with an active energy ray.",True,0.2531660497188568,0.8905185525140944,36,48,-12,131,275,-144
"제 12 항에 있어서,상기 기재가 폴리프로필렌, 폴리에틸렌, 폴리에스테르, 및 폴리아미드로 이루어지는 군으로부터 선택되는 적어도 1종을 포함하는 인쇄물의 제조 방법.","The method of producing a printed material according to claim 12, wherein said substrate comprises at least one selected from the group consisting of polypropylenes, polyethylenes, polyesters, and polyamides.",True,0.1418865621089935,0.9334149547069174,19,29,-10,92,208,-116
"제 12 항 또는 제 13 항에 있어서,상기 기재가 인쇄면측의 표면에 유기물을 포함하는 이접착층을 갖는 플라스틱 필름인 인쇄물의 제조 방법.","The method of producing a printed material according to claim 12 or 13, wherein the printing side surface of said substrate comprises a plastic film having an easily adhesive layer containing an organic material.",True,0.224710613489151,0.9033040350519204,20,34,-14,78,212,-134
"제 14 항에 있어서,상기 이접착층이 적어도 우레탄 구조를 갖는 인쇄물의 제조 방법.","The method of producing a printed material according to claim 14, wherein said easily adhesive layer has at least a urethane structure.",True,0.235953003168106,0.8908570786447607,12,22,-10,47,135,-88
"제 12 항 내지 제 15 항 중 어느 한 항에 있어서,상기 활성 에너지선이 전자선, 또는 LED-UV인 인쇄물의 제조 방법.","The method for producing a printed material according to any one of claims 12 to 15, wherein said active energy ray is an electron beam or LED-UV.",True,0.1443130820989608,0.930065490252169,20,27,-7,70,146,-76
"제 16 항에 있어서,상기 전자선의 조사량이 5kGy 이상 80kGy 이하인 인쇄물의 제조 방법.","The method of producing a printed material according to claim 16, wherein the irradiation amount of said electron beam is 5 kGy or more and 80 kGy or less.",True,0.2143535912036895,0.8956997330425913,13,29,-16,54,155,-101
"제 1 항 내지 제 11 항 중 어느 한 항에 기재된 인쇄용 잉크를 이용하여 평판 인쇄하는 인쇄물의 제조 방법으로서,평판으로서 무습수 평판을 사용하는 것을 특징으로 하는 인쇄물의 제조 방법.","A method of producing a printed material by lithography using the printing ink according to any one of claims 1 to 11, the method comprising using a waterless lithography plate as a lithography plate.",True,0.2136468738317489,0.9130375744370536,29,34,-5,106,200,-94
"제 18 항에 있어서,상기 무습수 평판의 실리콘층의 현상전의 형성량이 3.0∼8.0g/㎡인 인쇄물의 제조 방법.","The method of producing a printed material according to claim 18, wherein a silicone layer of said waterless lithography plate is formed in an amount of 3.0 to 8.0 g/m2 before development.",True,0.2013880908489227,0.9030148303383052,13,32,-19,62,188,-126
"제 1 항 내지 제 11 항 중 어느 한 항에 기재된 인쇄용 잉크를 이용하여, 기재에 평판 인쇄한 후에, 활성 에너지선을 조사하는 공정과, 인쇄한 기재에 적어도 실란트 필름을 적층시키는 공정과, 열수 처리하는 공정을 포함하는 것을 특징으로 하는 인쇄물의 제조 방법.","A method of producing a printed material, comprising the steps of: printing a substrate by lithography using said printing ink according to any one of claims 1 to 11, followed by irradiating the resulting material with an active energy ray; laminating at least a sealant film onto the printed substrate; and performing a hot-water treatment.",True,0.2338176518678665,0.9052305658461404,40,55,-15,148,341,-193
"적어도 기재, 제 1 항 내지 제 11 항 중 어느 한 항에 기재된 인쇄용 잉크, 접착제, 및 실란트 필름을 포함하는 것을 특징으로 하는 인쇄물.","A printed material comprising at least a substrate, said printing ink according to any one of claims 1 to 11, an adhesive, and a sealant film.",True,0.1667077541351318,0.929789092774616,25,26,-1,81,142,-61
"제 21 항에 있어서,기재와, 상기 인쇄용 잉크 사이의 밀착 강도가 1.5N/15mm 이상이거나 또는 기재 파단인 인쇄물.","A printed material according to claim 21, wherein an adhesive strength between said substrate and said printing ink is 1.5 N/15 mm or more, or results in substrate failure.",True,0.2090103030204773,0.896667402644535,16,29,-13,68,172,-104
"그리고, 베어링(22a)이 이와 같은 베어링 홀더(19)에 대하여 수용되는 형태로 지지되어 있으므로, 그 베어링(22a)의 지지 위치는, 그 전체가 상기 기준 위치보다 상기 내측으로 되어 있다.]","Since the bearing 22a is supported in a form of being accommodated in the bearing holder 19, a support position of the bearing 22a is entirely located on the more inner side than the reference position.",True,0.2264517992734909,0.8955017712029336,24,36,-12,109,202,-93
"[그리고, 이상에서는, 주축(16)을 위한 지지축(16a)의 지지에 대하여 설명하였으나, 본 실시예의 직기에 있어서는, 도 5에 나타낸 바와 같이, 로킹 축(4)을 위한 각 지지축(4a) 및 복권 롤(15)을 위한 각 지지축(15a)도, 전술한 바와 같이 베어링 홀더(19)와 동일한 구성의 베어링 홀더(20, 21)를 통하여 각 사이드 프레임(2)에 장착되어 있다.","However, in the loom of the present embodiment, as shown in FIG. 5, each of the support shafts 4a for the rocking shaft 4 and each of the support shafts 15a for the cloth winding roll 15 are also attached to each side frame 2 via each of the bearing holders 20 and 21 having the same configuration as the bearing holder 19, as described above.",False,0.2747393250465393,0.8901354028675011,44,66,-22,205,343,-138
"그리고, 그 각 베어링 홀더(20)는, 사이드 프레임(2)의 내측벽(27)에 형성된 관통공(23b)에 감삽되는 형태로 사이드 프레임(2)에 대하여 고정되어 있고, 각 베어링 홀더(21)는, 내측벽(27)에 형성된 관통공(23c)에 감삽되는 형태로 사이드 프레임(2)에 대하여 고정되어 있다.","Each of the bearing holders 20 is fixed to the side frame 2 in a form of being fitted/inserted in the through-hole 23b formed in the inner wall 27 of the side frame 2, and each of the bearing holders 21 is fixed to the side frame 2 in a form of being fitted/inserted in the through-hole 23c formed in the inner wall 27.",True,0.2002063691616058,0.9189547325229032,30,64,-34,162,319,-157
"따라서, 그 내측벽(27)에서의 관통공(23b)이 형성되어 있는 부분이 지지축(4a)을 위한 지지부로 되어 있고, 관통공(23c)이 형성되어 있는 부분이 지지축(15a)을 위한 지지부로 되어 있다.]","Therefore, a part of the inner wall 27 in which the through-hole 23b is formed is formed as a support part for the support shaft 4a, and a part in which the through-hole 23c is formed is formed as a support part for the support shaft 15a.",True,0.1913328021764755,0.9199669945581388,21,47,-26,111,238,-127
"[그리고, 그 관통공(23b) 및 관통공(23c)도, 관통공(23a)과 마찬가지로, 사이드 프레임(2)의 내측벽(27)에서의 돌출부(17)에 형성되어 있다.","Further, the through-hole 23b and the through-hole 23c are also formed in the protrusion part 17 of the inner wall 27 of the side frame 2, similar to the through-hole 23a.",True,0.2081860899925232,0.9057393322926328,13,31,-18,87,171,-84
"따라서, 상기한 내측벽(27)에서의 지지축(4a)을 위한 지지부 및 지지축(15a)을 위한 지지부도, 본 발명에서 일컫는 오프셋 지지부에 상당한다.","Therefore, the support part for the support shaft 4a and the support part for the support shaft 15a on the inner wall 27 also correspond to the offset support part of the present invention.",True,0.2162352800369262,0.902229358467996,16,34,-18,82,189,-107
"그리고, 지지축(4a)이 베어링 홀더(20)에 수용된 베어링(22b)에 지지되고, 지지축(15a)이 베어링 홀더(21)에 수용된 베어링(22c)에 지지되지만, 그 각 베어링(22b), 베어링(22c)의 지지 위치도, 전술한 베어링 홀더(19)에 수용되는 베어링(22a)의 경우와 마찬가지로, 그 전체가 상기 기준 위치보다 상기 내측으로 되어 있다.]","Although the support shaft 4a is supported in the bearing 22b accommodated in the bearing holder 20 and the support shaft 15a is supported in the bearing 22c accommodated in the bearing holder 21, the support positions of each of the bearing 22b and the bearing 22c are also entirely located on the more inner side than the reference position, similar to the bearing 22a accommodated in the bearing holder 19.",True,0.2059348672628402,0.9155128810455738,35,71,-36,195,409,-214
"[또한, 본 실시예의 직기에 있어서는, 주축(16)을 위한 지지축(16a) 및 로킹 축(4)을 위한 지지축(4a)은, 이상에서 설명한 형태로 사이드 프레임(2)의 내측벽(27)에 있어서 지지되어 있지만, 외측벽(28)에 있어서도 지지되어 있다.","Further, in the loom of the present embodiment, the support shaft 16a for the main shaft 16 and the support shaft 4a for the rocking shaft 4 are supported in the inner wall 27 of the side frame 2, as described above, but are also supported in the outer wall 28.",True,0.2318324446678161,0.9046815796667113,26,51,-25,136,261,-125
"이에, 각 사이드 프레임(2)에서의 외측벽(28)에는, 지지축(16a)을 지지하는 베어링(22d)을 배치하기 위한 관통공(23d) 및 지지축(4a)을 지지하는 베어링(22e)을 배치하기 위한 관통공(23e)이 형성되어 있다.]","Therefore, the outer wall 28 of each side frame 2 is formed with a through-hole 23d for arranging the bearing 22d configured to support the support shaft 16a and a through-hole 23e for arranging the bearing 22e configured to support the support shaft 4a.",True,0.2026422172784805,0.9206728234445286,20,44,-24,126,254,-128
"[그리고, 그 각각의 관통공(23d, 23e)에는, 그 베어링(22d, 22e)을 지지하기 위한 베어링 홀더(30, 31)가 장착되어 있다.",Bearing holders 30 and 31 for supporting the bearings 22d and 22e are each attached to each of the through-holes 23d and 23e.,True,0.2786814570426941,0.8558942117689365,15,23,-8,78,125,-47
"그리고, 그 각 베어링 홀더(30, 31)는, 전술한 베어링 홀더(19) 등과 동일한 구성의 것이며, 외측벽(28)(관통공(23d, 23e))에 대한 장착도, 베어링 홀더(19) 등과 동일하게 되어 있다.","Note that, each of the bearing holders 30 and 31 has the same configuration as the bearing holder 19 and the like, and is also attached to the outer wall 28 (through-hole 23d; 23e) in the same manner as the bearing holder 19 and the like.",True,0.2797221541404724,0.8731090663816509,23,46,-23,114,238,-124
"그리고, 베어링(22d)은, 베어링 홀더(30)에 수용되는 형태로 각 사이드 프레임(2)의 관통공(23d)에 장착되어 있고, 또한, 베어링(22e)은, 베어링 홀더(31)에 수용되는 형태로 각 사이드 프레임(2)의 관통공(23e)에 장착되어 있다.","Further, the bearing 22d is attached to the through-hole 23d of each side frame 2 in a form of being accommodated in the bearing holder 30, and the bearing 22e is attached to the through-hole 23e of each side frame 2 in a form of being accommodated in the bearing holder 31.",True,0.1691193133592605,0.9293406994694828,24,52,-28,138,274,-136
"그리고, 각 사이드 프레임(2)의 외측벽(28)에 있어서, 지지축(16a)이 베어링(22d)에 지지되어 있고, 지지축(4a)이 베어링(22e)에 지지되어 있다.]","In the outer wall 28 of each side frame 2, the support shaft 16a is supported in the bearing 22d, and the support shaft 4a is supported in the bearing 22e.",True,0.1649369001388549,0.9307884468340414,14,31,-17,90,155,-65
"[이상과 같이, 본 실시예의 직기에 있어서는, 양 사이드 프레임(2, 2)에서의 내측벽에 설치되는 각각의 상기 지지부 전부가 상기와 같은 오프셋 지지부가 되도록 형성되어 있고, 각각의 상기 지지부에 배치되어 있는 베어링(22a, 22b, 22c)의 내측단의 위치가, 상기 기준 위치보다 상기 내측으로 되어 있다.","As described above, in the loom of the present embodiment, all of the support parts provided in the inner walls of both the side frames 2 and 2 are formed to be the offset support parts, and the positions of the inner ends of the bearings 22a, 22b and 22c arranged in the support parts are located on the more inner side than the reference position.",True,0.3119197189807892,0.8787245301260797,40,66,-26,174,349,-175
"이로써, 각 지지축(16a, 4a, 15a)에서의 연결단(16c, 4c, 15b)의 위치는, 각각의 상기 지지부에서의 베어링의 내측단의 위치가 상기 기준 위치와 대략 동일한 위치인 종래의 직기의 구성(종래 구성)과 비교하여, 보다 상기 내측으로 되어 있다.","Thereby, the positions of the connecting ends 16c, 4c and 15b of the support shafts 16a, 4a and 15a are located on the more inner side, as compared to a configuration (conventional configuration) of the loom of the related art where the position of the inner end of the bearing in each of the support parts is substantially the same as the reference position.",True,0.2256286889314651,0.9050111596701348,31,64,-33,143,359,-216
"따라서, 각 한 쌍의 연결단(16c, 16c, 4c, 4c, 15b, 15b)의 간격은, 상기 종래 구성의 경우와 비교하여 작아져 있다.","Therefore, an interval between each of the pairs of connecting ends 16c and 16c, 4c and 4c and 15b and 15b is smaller, as compared to the conventional configuration.",True,0.1732063591480255,0.9013058495585248,18,29,-11,76,165,-89
"그 결과, 대응하는 한 쌍의 지지축 사이에 가설되는 각각의 축 부재(16, 4, 15)는, 그 길이 치수가 상기 종래 구성의 경우보다 작게 되어 있고, 보다 휘기 어렵게 되어 있다.","As a result, each of the shaft members 16, 4 and 15 bridged between the pair of corresponding support shafts is reduced in length dimension, as compared to the conventional configuration, and is thus more difficult to bend.",True,0.1945123821496963,0.897881765574774,28,38,-10,101,223,-122
"따라서, 제직 중에 각각의 축 부재(16, 4, 15)에 발생하는 진동은, 상기 종래 구성의 경우와 비교하여 진폭이 작아지게 된다.]","Therefore, an amplitude of vibrations that occur on each of the shaft members 16, 4 and 15 during weaving is smaller, as compared to the conventional configuration.",True,0.2282456904649734,0.8670585874076252,18,27,-9,74,164,-90
"[또한, 각 사이드 프레임(2)은, 그 내측벽(27)에서의 돌출부(17)가 되는 부분이 기준면(10)에 대하여 돌출하도록 형성되도록 되어 있고, 그 돌출부(17)에서의 주위의 부분이 상기 폭 방향의 벽부분(29)으로서 형성된 것이 되어 있다.","Further, each side frame 2 is formed so that a part of the inner wall 27 becoming the protrusion part 17 protrudes with respect to the reference surface 10, and a peripheral part of the protrusion part 17 is formed as the wall part 29 in the width direction.",True,0.2148211449384689,0.9104316121502596,27,49,-22,135,258,-123
"이로써, 각 사이드 프레임(2)은, 사이드 프레임의 내측벽이 대략 평면형으로 형성되어 있는 상기 종래 구성의 경우와 비교하여, 사이드 프레임(2) 자체의 내진성이 향상되어 있다.]","Thereby, the vibration-proof characteristic of each side frame 2 itself is improved, as compared to the conventional configuration where the inner wall of the side frame is formed substantially planar.",True,0.2460220903158188,0.8852374266650008,22,30,-8,100,201,-101
"[이와 같이, 본 실시예에서는, 사이드 프레임(2)의 진동의 기진원이 되는 각각의 축 부재(16, 4, 15) 전체가, 상기 종래 구성의 경우와 비교하여, 제직 중의 진동이 보다 진폭이 작아지도록 구성되고 또한, 각 사이드 프레임(2) 자체가 전술한 바와 같이 내진성을 향상된 것이 되어 있다.","In this way, in the present embodiment, all of the shaft members 16, 4 and 15, which are vibration generating sources of the vibrations of the side frame 2, are each configured such that an amplitude of the vibrations during weaving is smaller, as compared to the conventional configuration, and the vibration-proof characteristic of each side frame 2 itself is improved.",True,0.3545718491077423,0.8466779591326835,40,61,-21,164,371,-207
"따라서, 이러한 직기에 의하면, 상기 종래 구성의 경우와 비교하여, 제직 중의 직기 프레임 전체적으로 발생하는 진동이 보다 억제되게 되어 있고, 소음이나 제직에 악영향을 미치는 문제의 발생이 가급적 억제되어 있다.]","Therefore, according to such a loom, the vibrations that occur on the entire loom frame during the weaving are further suppressed, as compared to the conventional configuration, and the noise problem and the bad influence on the weaving are suppressed as much as possible.",True,0.2829375863075256,0.8284351816564853,29,44,-15,120,272,-152
"[특히, 그 직기는, 제직 중에 있어서 바디치기 운동의 영향으로 격렬하게 진동하는 로킹 축(4), 및 그 로킹 축(4)에 대하여 기계적으로 연결되어 있는 주축(16)에 대하여, 그 로킹 축(4)을 위한 지지축(4a), 및 주축(16)을 위한 지지축(16a)의 각각의 지지부가 전술한 바와 같이 오프셋 지지부가 되도록 형성되어 있으므로, 제직에 따른 직기 프레임 전체의 진동이 보다 효과적으로 억제되도록 되어 있다.]","Particularly, in the loom, for the rocking shaft 4 that vibrates violently due to an influence of a beating motion during the weaving and the main shaft 16 mechanically connected to the rocking shaft 4, each of the support parts of the support shaft 4a for the rocking shaft 4 and the support shaft 16a for the main shaft 16 is formed to be the offset support part, as described above.",False,0.3237574696540832,0.83915727525909,53,71,-18,232,385,-153
"[또한, 그 직기에 있어서는, 전술한 바와 같이, 각 오프셋 지지부에서의 베어링(22a, 22b, 22c)의 지지 위치는, 그 전체가 상기 기준 위치보다 상기 내측으로 되어 있다.","Further, in the loom, as described above, the support positions of the bearings 22a, 22b and 22c in each of the offset support parts are entirely located on the more inner side than the reference position.",True,0.2569372653961181,0.8853680210702799,24,36,-12,100,205,-105
"이로써, 각 사이드 프레임(2)은, 상기한 벽부분(29)이 보다 큰 것으로 되어 있고, 보다 강성이 증가하여 상기한 내진성의 향상을 보다 효과적으로 도모할 수 있게 되어 있다.]","Thereby, the wall part 29 is formed larger and the stiffness of each side frame 2 is further increased, so that the vibration-proof characteristic is more effectively improved.",True,0.2422371506690979,0.8758606411432144,24,28,-4,99,176,-77
"[이상에서는, 본 발명의 직기의 일실시예에 대하여 설명하였으나, 본 발명에 의한 직기는, 상기 실시예로 한정되지 않고, 이하와 같은 변형된 예라도 실시가 가능하다.]","Although one embodiment of the loom of the present invention has been described, the loom of the present invention is not limited to the above embodiment, and can be implemented in following modified embodiments.",True,0.3088428676128387,0.7989326954638064,21,34,-13,92,212,-120
"[(1) 오프셋 지지부에 대하여, 상기 실시예의 직기에서는, 오프셋 지지부가 되도록 형성된 각각의 상기 지지부에서의 베어링(22a, 22b, 22c)의 지지 위치는, 그 전체가 상기 기준 위치보다 상기 내측의 위치로 되어 있다.","(1) In the loom of the above embodiment, as for the offset support part, the support positions of the bearings 22a, 22b and 22c in each of the support parts formed to be the offset support parts are entirely located on the more inner side than the reference position.",True,0.1978310942649841,0.917010971314978,29,49,-20,127,267,-140
"그러나, 본 발명의 직기에 있어서는, 그 오프셋 지지부는, 적어도 상기 지지 위치의 내측단을 상기 기준 위치보다 상기 내측에 위치시키도록 형성되어 있으면 된다.","However, in the loom of the present invention, the offset support part may also be formed such that the inner end in at least the support position is located on the more inner side than the reference position.",True,0.2514437139034271,0.8738441836098144,22,38,-16,89,209,-120
"즉, 오프셋 지지부는, 그 베어링의 지지 위치가 상기 폭 방향에 있어서 기준면(10)(상기 기준 위치)과 중복하도록 형성된 것이라도 된다.]","Specifically, the offset support part may also be formed such that the support position of the bearing overlaps the reference surface 10 (reference position) in the width direction.",True,0.2802202403545379,0.8584495933505655,18,28,-10,78,181,-103
"[예를 들면, 상기 실시예와 같이 구성된 사이드 프레임에 있어서, 돌출부(17)를, 그 상기 기준 위치로부터의 돌출량이 내측벽(27)의 두께 치수보다 큰 양이 되도록 형성하는 대신, 상기 돌출량이 내측벽(27)의 두께 치수보다 작은 양이 되도록 형성하면 된다.","For example, as for the side frame configured as described above, instead of the configuration where the protrusion part 17 is formed so that the protruding amount from the reference position is greater than the thickness dimension of the inner wall 27, the protrusion part 17 may be formed so that the protruding amount is smaller than the thickness dimension of the inner wall 27.",True,0.2185521721839904,0.8991531712398153,33,65,-32,145,382,-237
"그 경우에, 각 베어링 홀더(19, 20, 21)가 상기 실시예와 동일한 구성의 것이면, 각 베어링(22a, 22b, 22c)의 지지 위치는, 상기 폭 방향에 있어서 상기 기준 위치와 중복하는 위치가 된다.]","In this case, when the bearing holders 19, 20 and 21 each have the same configuration as the above embodiment, the support position of each of the bearings 22a, 22b and 22c overlaps the reference position in the width direction.",True,0.1997820436954498,0.9093699626710192,28,40,-12,116,228,-112
"[또한, 상기 실시예에서는, 3개의 상기 지지부 전체가 오프셋 지지부가 되도록 각 사이드 프레임이 구성되어 있다.","Further, in the above embodiment, each side frame is configured such that all of the three support parts are to be the offset support parts.",True,0.2617355585098266,0.8786879590352665,15,25,-10,63,140,-77
"그리고, 그 각각의 상기 지지부가 설치되는 돌출부(17)는, 그 내측면(9)이 평탄면이 되도록, 그 전체에 걸쳐 상기 돌출량이 동일하도록 형성되어 있다.","Further, the protrusion part 17 provided with each of the support parts is formed so that the protruding amount is the same over the entire protrusion part so that the inner surface 9 is flat.",True,0.2480583935976028,0.8834408729721681,19,35,-16,85,192,-107
"이로써, 각각의 상기 지지부의 상기 폭 방향에서의 위치는, 모두 동일하게 되어 있다.","Thereby, the positions of each of the support parts in the width direction are the same.",True,0.2207951992750167,0.8767959589565797,12,16,-4,47,88,-41
"그리고, 그 결과, 각 지지부에 의한 각 베어링의 지지 위치도, 상기 폭 방향에 있어서 동일한 위치로 되어 있다.","As a result, the support positions of each of the bearings by each of the support parts are also the same in the width direction.",True,0.2847217619419098,0.8513771971827145,18,25,-7,63,129,-66
"그러나, 본 발명에 의한 직기에 있어서는, 복수의 상기 지지부가 오프셋 지지부가 되도록 설치되는 경우에, 그 일부의 상기 지지부(지지 위치)가 다른 상기 지지부(지지 위치)와 위치가 상이하도록 설치되어 있어도 된다.]","However, in the loom of the present invention, when the plurality of support parts is provided to be the offset support parts, the support parts may be provided so that the positions of some of the support parts (support positions) are different from the other support parts (support positions).",True,0.3467421233654022,0.8308062128420365,28,49,-21,121,295,-174
"[예를 들면, 상기 실시예와 같이 3개의 상기 지지부 전체가 오프셋 지지부인 경우에 있어서, 로킹 축(4)(지지축(4a))을 위한 상기 지지부가 되는 관통공(23b)이 형성되어 있는 부분을 포함하는 일부가 그 이외의 부분보다 상기 돌출량이 커지도록 돌출부가 형성된 것이라도 된다.","For example, in a case where all of the three support parts are the offset support parts, like the above embodiment, the protrusion part may be formed such that a part including the part, in which the through-hole 23b to be the support part for the rocking shaft 4 (support shaft 4a) is formed, more protrudes than the other part.",True,0.1942147016525268,0.9205973085920848,35,60,-25,156,330,-174
"그 경우에, 각 베어링 홀더(19, 20, 21)가 상기 실시예와 동일한 구성의 것이면, 로킹 축(4)(지지축(4a))을 위한 상기 지지부에서의 베어링(22b)의 지지 위치는, 다른 축 부재(16, 15)(지지축(16a, 15a))를 위한 상기 지지부에서의 베어링의 지지 위치와는 상이한 위치(상기 내측의 위치)가 된다.]","In this case, when each of the bearing holders 19, 20 and 21 has the same configuration as the above embodiment, the support position of the bearing 22b in the support part for the rocking shaft 4 (support shaft 4a) becomes a position (the position on the inner side) different from the support positions of the bearings in the support parts for the other shaft members 16 and 15 (support shafts 16a and 15a).",True,0.1562601774930954,0.939436693017924,36,74,-38,180,409,-229
"[(2) 또한, 상기 실시예에서는, 3개의 상기 지지부 전체가 오프셋 지지부가 되도록 각 사이드 프레임이 구성되어 있는 직기에 있어서, 각 사이드 프레임의 내측벽(27)에서의 돌출부(17)가 되는 부분이 각각의 상기 지지부가 되는 부분 전체를 포함하는 범위에 걸치도록 형성되어 있다.","(2) Further, in the above embodiment, in the loom where each side frame is configured such that all of the three support parts are to be the offset support parts, a part of the inner wall 27 of each side frame, which is to be the protrusion part 17, is formed over a range including all of the parts becoming the support parts.",True,0.1934279501438141,0.928758737904871,36,63,-27,158,327,-169
"즉, 상기 실시예의 직기에서는, 단일 돌출부(17)에 오프셋 지지부가 되도록 설치된 각각의 상기 지지부 전체가 포함되도록 각 사이드 프레임이 형성되어 있다.","Specifically, in the loom of the above embodiment, each side frame is formed such that all of the support parts formed to be the offset support parts are included in the single protrusion part 17.",True,0.2661913335323334,0.8846864412715345,20,35,-15,87,196,-109
"그러나, 본 발명의 직기에 있어서는, 복수의 상기 지지부가 오프셋 지지부가 되도록 설치되는 경우에 있어서, 그 일부의 상기 지지부가 다른 상기 지지부가 설치되는 돌출부와는 별도로 형성된 돌출부에 설치되어 있어도 되고, 각각의 상기 지지부(오프셋 지지부)가 각각에 대응시켜 형성된 별개의 돌출부에 설치되어 있어도 된다.]","However, in the loom of the present invention, when the plurality of support parts are provided to be the offset support parts, some of the support parts may be provided in a protrusion part formed separately from the protrusion part provided with the other support parts.",False,0.412959337234497,0.8068048501471446,41,46,-5,178,272,-94
"[예를 들면, 상기 실시예와 같이 3개의 상기 지지부 전체가 오프셋 지지부인 경우에 있어서, 프론트 톱 스테이(3a)보다 종광 프레임(11) 측에 위치하는 주축(16)(지지축(16a)) 및 로킹 축(4)(지지축(4a))을 위한 각각의 상기 지지부가 형성되는 돌출부와, 프론트 톱 스테이(3a)에 대하여 권취 측에 위치하는 복권 롤(15)(지지축(15a))을 위한 상기 지지부가 형성되는 돌출부를, 연속하지 않는 별개의 돌출부로서 형성해도 된다.]","For example, in a case where all of the three support parts are the offset support parts, like the above embodiment, a protrusion part in which each of the support parts for the main shaft 16 (support shaft16a) and the rocking shaft 4 (support shaft 4a) located closer to the heddle frame 11 than the front top stay 3a is formed and a protrusion part in which the support part for the cloth winding roll 15 (support shaft 15a) located on the winding-side with respect to the front top stay 3a is formed may be formed as separate protrusion parts that are not continuous.",True,0.2013012021780014,0.9183928804093708,50,104,-54,249,570,-321
"[(3) 상기 실시예에서는, 상기 지지부가 오프셋 지지부로 되는 축 부재(이하, 「대상 축 부재」라고 함)에 대하여, 3개의 축 부재 전체가 그 상기 대상 축 부재로 되어 있다.","(3) In the above embodiment, as for the shaft member (hereinafter, referred to as "" target shaft member"") for which the support part is formed as the offset support part, all of the three shaft members are the target shaft members.",True,0.2534934282302856,0.8776862361036567,26,41,-15,99,231,-132
"그리고, 각 사이드 프레임은, 3개의 상기 지지부 전체가 오프셋 지지부가 되도록 돌출부가 내측벽에 설치된 것으로 되어 있다.",Each side frame is provided on the inner wall with the protrusion part so that all of the three support parts are the offset support parts.,True,0.3450792133808136,0.8185655132092093,17,26,-9,69,139,-70
"그러나, 본 발명의 직기는, 3개의 축 부재 중 1개 또는 2개가 상기 대상 축 부재로 된 것이라도 되고, 그 경우에, 각 사이드 프레임은, 각각의 상기 대상 축 부재를 위한 상기 지지부가 오프셋 지지부로 되도록 구성되어도 된다.","However, the loom of the present invention may also be configured such that one or two of the three shaft members are the target shaft members.",False,0.5182474255561829,0.741458295692277,36,26,10,128,143,-15
"즉, 각 사이드 프레임은, 내측벽(27)에서의 3개의 상기 지지부가 되는 부분 중 상기 대상 축 부재를 위한 상기 지지부를 포함하는 범위의 부분이 돌출부로 되도록 형성되어 있어도 된다.]","Specifically, each side frame may be formed such that a part of a range, which includes the support part for the target shaft member, of the part of the inner wall 27 becoming the three support parts is to be the protrusion part.",True,0.2601256668567657,0.889574764233872,26,43,-17,104,229,-125
"[(4) 상기 실시예에서는, 3개의 축 부재 각각을 위한 양쪽의 상기 지지부가 오프셋 지지부로 되도록, 양 사이드 프레임(2, 2)은, 그 내측벽(27)에서의 각각의 상기 지지부를 포함하는 범위가 돌출부로 되도록 형성되어 있다.","(4) In the above embodiment, both the side frames 2 and 2 are formed such that the range on the inner wall 27 including each of the support parts is to be the protrusion part so that the support parts on both sides for each of the three shaft members are to be the offset support parts.",True,0.2068055719137191,0.9234095517885302,29,57,-28,127,286,-159
"즉, 양 사이드 프레임(2, 2)은, 상기 대상 축 부재를 위한 양쪽의 상기 지지부가 오프셋 지지부로 되도록, 그 내측벽에 돌출부가 형성된 것으로 되어 있다.","Specifically, both the side frames 2 and 2 are each formed on the inner wall with the protrusion part so that the support parts on both sides for each shaft member are to be the offset support parts.",True,0.4196069836616516,0.8208027002982476,23,38,-15,88,199,-111
"그러나, 본 발명의 직기에 있어서는, 상기 대상 축 부재를 위한 양쪽의 상기 지지부 중 한쪽만이 오프셋 지지부라도 종래의 직기와 비교하여 진동 억제의 효과가 얻어지므로, 사이드 프레임은, 상기 대상 축 부재를 위한 한쪽의 상기 지지부만이 오프셋 지지부로 되도록 한 형태로, 그 내측벽에 돌출부가 형성된 것이라도 된다.]","However, in the loom of the present invention, even when only one of the support parts on both sides for the target shaft member is the offset support part, the vibration suppression effect is obtained, as compared to the loom of the related art.",False,0.3900670707225799,0.8277055175840068,45,44,1,178,246,-68
"[다만, 복수의 축 부재를 상기 대상 축 부재로 하는 경우에 있어서는, 모든 상기 대상 축 부재를 위한 상기 지지부가 동일하게 형성되는 것으로는 한정되지 않는다.","However, in a case where the plurality of shaft members is formed as the target shaft members, the present invention is not limited to a configuration where the support parts for all of the target shaft members are formed to be the same.",True,0.3504534065723419,0.8248390893755683,24,43,-19,90,237,-147
"예를 들면, 2개의 축 부재를 상기 대상 축 부재로 하는 경우에 있어서, 한쪽의 상기 대상 축 부재에 대해서는, 이를 위한 상기 지지부가 양쪽 모두 오프셋 지지부이며, 다른 쪽의 상기 대상 축 부재에 대해서는, 이를 위한 상기 지지부의 한쪽만이 오프셋 지지부가 되도록 되어 있어도 된다.","For example, in a case where the two shaft members are formed as the target shaft members, both the support parts for one target shaft member may be formed as the offset support parts, and only one of the support parts for the other target beam member may be formed as the offset support part.",True,0.2499932199716568,0.8921758338314472,44,55,-11,160,293,-133
"또한, 복수의 상기 대상 축 부재를 위한 상기 지지부가 한쪽만에 있어서 오프셋 지지부가 되도록 되는 경우에도, 그 오프셋 지지부가 되는 상기 지지부는, 전체가 동일한 사이드 프레임에서의 상기 지지부인 것으로는 한정되지 않는다.]","Also in a case where the support parts for the plurality of target shaft members are formed to be the offset support parts only on one side, the support parts becoming the offset support parts are not limited to a configuration where all are the support parts of the same side frame.",True,0.2796399295330047,0.8740894896285055,31,52,-21,127,283,-156
"[그리고, 본 발명은, 이상에서 설명한 어느 실시형태로도 한정되지 않으며, 그 취지를 일탈하지 않는 한에 있어서 적절하게 변경 가능하다.]","Note that, the present invention is not limited to any embodiment described above, and can be changed as appropriate without departing from the gist thereof.",True,0.248793214559555,0.8311383238076931,18,25,-7,77,157,-80
"3D 센서에는 수직 방향 및 수평 방향으로 검지 가능한 넓이(각도)가 설정되어 있으며, 이 4개의 3D 센서의 검지 범위에서 차체 주위 후방의 공간을 커버하는 것이 가능하게 되어 있다.]",The detection ranges of these four 3D sensors cover a space behind the vehicle body in the periphery thereof.,False,0.3824653625488281,0.7471269394386862,27,19,8,104,109,-5
"[각각의 3D 센서의 검지 범위를 이용하여, 유압 셔블이 움직이기 시작하는 건설 기계와 주위 작업자의 접촉에 의한 사고 발생의 가능성을 낮추기 위한 검지 영역이 설정되어 있다.","Using the detection ranges of the 3D sensors, there are established detection areas for lowering the possibility of an accident caused by contact between the construction machine, i.e., the hydraulic excavator, that is about to move and a peripheral worker.",True,0.3062625527381897,0.8019310772842151,25,40,-15,98,257,-159
"즉, 유압 셔블의 선회·주행의 움직이기 시작하는 단시간에 상부 선회체(2)가 이동하는 범위에 존재하는 장해물을 검출할 수 있도록 검지 영역을 설정하고 있으며, 3D 센서(6)가 검출하는 범위를 검지 영역(10), 3D 센서(7)가 검출하는 범위를 검지 영역(11), 3D 센서(8)가 검출하는 범위를 검지 영역(12), 3D 센서(9)가 검출하는 범위를 검지 영역(13)으로 정하고 있다.]","The area detected by the 3D sensor 6 is defined as a detection area 10, the area detected by the 3D sensor 7 as a detection area 11, the area detected by the 3D sensor 8 as a detection area 12, and the area detected by the 3D sensor 9 as a detection area 13.",False,0.5474432706832886,0.6810586092837969,46,55,-9,218,258,-40
"[각 검지 영역(10~13)은, 하부 주행체(1)의 크롤러를 장해물로서 검출해버리지 않도록, 하부 주행체(1)보다 높은 위치로 설정되어 있다.]",The detection areas 10 through 13 are established in a position higher than the lower track structure 1 such that the crawlers of the lower track structure 1 is not detected as an obstacle.,True,0.2624461054801941,0.8325513631838403,15,34,-19,80,189,-109
[(장해물 검출로 간주되는 상태에 관한 설명)],(Description regarding a state regarded as obstacle detection),True,0.285438060760498,0.780235297406437,6,8,-2,26,62,-36
"[각 3D 센서(6~9)는, 각각의 검지 영역(10~13)에 장해물이 존재하는지 여부를 판정하고 있다.]",The 3D sensors 6 through 9 determine whether an obstacle is present in the respective detection areas 10 through 13 or not.,True,0.2694119811058044,0.8287125482753365,11,22,-11,58,123,-65
"[또한, 장해물 검출 장치인 3D 센서(6~9)에 의해 작성되는 검지 영역(10~13)의 영역 내에 1개 이상의 장해물(사람·물건)이 있다고 센서에 의해 판정되었을 때를 본 실시예에서는 장해물 검출 시로 간주한다.]","According to the present embodiment, the time at which the 3D sensors 6 through 9 detect one or more obstacles (persons or objects) that are present in the detection areas 10 through 13 provided by the 3D sensors 6 through 9 as the obstacle sensors is regarded as an obstacle detection time.",True,0.3188993036746979,0.8103179406947191,26,52,-26,120,291,-171
[(시스템 구성의 설명 통상의 유압 셔블로서의 구성 부분)],(Description of a system configuration; components of an ordinary hydraulic excavator),True,0.2220450192689895,0.8438863415537631,8,11,-3,33,86,-53
"[도 3은, 본 실시예에 있어서의 시스템 구성을 나타내는 도면이다.]",FIG. 3 is a diagram illustrating a system configuration according to the present embodiment.,True,0.0829362124204635,0.942355647133344,9,14,-5,38,92,-54
"[본 실시예의 유압 셔블의 운전실(4) 내에는, 기체 전체의 동작을 제어하는 차체 컨트롤러(14)와, 차체의 모든 동작 가부를 전환하는 동작 락 장치를 전환하기 위한 레버식 스위치인 락 스위치(15)와, 오퍼레이터가 유압 셔블의 상황을 확인할 수 있도록 각종의 계기류나 기체 정보가 표시되는 표시 장치(5)와, 엔진 회전수를 수동으로 변경하거나 표시 장치(5)를 조작하거나 하기 위한 스위치 박스(16)와, 스위치 박스(16)의 각종 스위치 입력을 접수하여, 표시 장치(5)의 표시 내용을 변경하는 모니터 컨트롤러(17)가 마련되어 있다.]","The cabin 4 of the hydraulic excavator according to the present embodiment houses therein a vehicle body controller 14 for controlling operation of the construction machine in whole, a lock switch 15 as a lever switch for operating an operation lock device that selectively locks and unlocks operation of the vehicle body in whole, the display device 5 for displaying various instruments and machine body information that allow the operator to check the situation of the hydraulic excavator, a switch box 16 for manually changing engine rotational speeds and operating the display device 5, and a monitor controller 17 for accepting various switch input signals from the switch box 16 and changing displayed contents of the display device 5.",True,0.1763949543237686,0.9156138683947715,66,119,-53,302,741,-439
"[또한, 유압 셔블의 운전실(4) 내에는, 유압 셔블의 각종 조작을 행하는 조작 장치가 마련되어 있다.",The cabin 4 of the hydraulic excavator also houses therein the operation devices for controlling the hydraulic excavator to operate in various ways.,True,0.2950937151908874,0.8201396265299966,14,23,-9,57,148,-91
"도 3에서는, 조작 장치를 나타내는 것으로서, 좌선회 조작, 우선회 조작중 하나를 나타내는 선회 조작 레버(19)와, 우전진 주행 조작, 우후진 주행 조작, 좌전진 주행 조작, 좌후진 주행 조작중 하나를 나타내는 주행 조작 레버(20)와, 붐 인상 조작, 붐 인하 조작, 아암 크라우드 조작, 아암 덤프 조작, 버킷 크라우드 조작, 버킷 덤프 조작중 하나를 나타내는 프론트 조작 레버(21)의 3개의 조작 레버를 대표하여 표시하고 있다.]","In FIG. 3, the operation devices are illustrated as three representative operation levers including a swing operation lever 19 for indicating either left swing operation or right swing operation, a travel operation lever 20 for indicating either right forward travel operation, right rearward travel operation, left forward travel operation, or left rearward travel operation, and a front implement operation lever 21 for indicating either boom raising operation, boom lowering operation, arm crowding operation, arm dumping operation, bucket crowding operation, or bucket dumping operation.",True,0.2509911358356476,0.8639857973255476,61,83,-22,245,591,-346
"[본 실시예의 유압 셔블은 원동기로서 엔진(22)을 탑재하고 있으며, 엔진(22)과 전기적으로 접속되어 있는 엔진 제어 장치(23)는, 엔진(22)에 조립되어 있는 온도 센서나 픽업의 신호로부터 엔진(22)의 상태를 파악하고, 밸브 등을 제어함으로써 회전수나 토크를 제어하고 있다.]","The engine controller 23 identifies the state of the engine 22 from signals from a temperature sensor and a pickup sensor that are incorporated in the engine 22, and controls valves and so on included in the engine 22, to control the rotational speed and torque of the engine 22.",False,0.3633816242218017,0.8315722515141136,32,50,-18,158,279,-121
"[차체 컨트롤러(14), 모니터 컨트롤러(17), 엔진 제어 장치(23)는 CAN 통신에 의해 접속되어 있으며, 각각 필요한 정보의 송수신을 행하고 있다.]","The vehicle body controller 14, the monitor controller 17, and the engine controller 23 are electrically connected to each other by CAN communication, and send and receive necessary information.",True,0.1890845000743866,0.896545946399718,18,29,-11,87,194,-107
"[예를 들면, 엔진 회전수 제어에 대해서는, 차체 컨트롤러(14)가, 엔진 컨트롤 다이얼 전압이나 조작 레버(19~21)의 조작 상태, 펌프 부하 상태나 온도 조건에 따라 엔진 목표 회전수를 정하고, 그 엔진 목표 회전수를 엔진 제어 장치(23)에 송신한다.","Regarding engine rotational speed control, for example, the vehicle body controller 14 determines a target engine rotational speed depending on an engine control dial voltage, operation states of the operation levers 19 through 21, a pump load state, and a temperature condition, and sends the determined target engine rotational speed to the engine controller 23.",True,0.1719293743371963,0.9218599370868312,34,55,-21,144,364,-220
"엔진 제어 장치(23)는, 엔진 목표 회전수가 되도록 엔진(22)을 제어하고, 엔진(22)에 내장되어 있는 픽업 센서의 신호로부터 엔진 실회전수를 연산하고, 그 엔진 실회전수를 차체 컨트롤러(14)에 송신한다.","The engine controller 23 controls the engine 22 to achieve the target engine rotational speed, calculates an actual engine rotational speed from the signal from the pickup sensor incorporated in the engine 22, and sends the calculated actual engine rotational speed to the vehicle body controller 14.",True,0.1687579452991485,0.920143301815034,24,47,-23,117,300,-183
"모니터 컨트롤러(17)에 있어서는, CAN 통신상에 있는 엔진 목표 회전수와 엔진 실회전수를 취득하는 것이 가능하므로, 표시 장치(5)에, 차체의 상태 표시의 하나로서 엔진 목표 회전수나 엔진 실회전수를 표시하는 것도 가능하다.]","As the monitor controller 17 can acquire the target engine rotational speed and the actual engine rotational speed that are present in the CAN communication, the monitor controller 17 can control the display device 5 to display the target engine rotational speed and the actual target engine rotational speed as one of displayed states of the vehicle body.",True,0.209880381822586,0.8902309374587294,28,58,-30,128,356,-228
"[엔진(22)에 의해 구동되는 가변 용량식 유압 펌프(24)로부터 토출되는 작동유는, 액추에이터로의 기름의 흐름을 제어하는 컨트롤 밸브(25)를 지나, 주행 모터(3h), 선회 모터(3g), 붐 실린더(3d), 아암 실린더(3e), 버킷 실린더(3f)에 공급된다.]","A hydraulic operating fluid delivered from a variable-displacement-type hydraulic pump 24 that is actuated by the engine 22 flows through a control valve 25 that controls a fluid flow toward hydraulic actuators and is supplied to a travel motor 3h, a swing motor 3g, the boom cylinder 3d, the arm cylinder 3e, and the bucket cylinder 3f as these hydraulic actuators.",True,0.2674647867679596,0.8658989994974224,27,61,-34,148,366,-218
"[또한, 통상 유압 셔블에는 복수의 액추에이터를 동시 조작하는 상황 등을 고려하여, 복수대의 유압 펌프가 탑재되어 있지만, 도 3에서는, 그 중 하나를 대표하여 표시하고 있다.]","Normally, the hydraulic excavator includes a plurality of hydraulic pumps for simultaneously operating a plurality of hydraulic actuators.",False,0.5058585405349731,0.6727341630940228,24,18,6,99,138,-39
"[조작 레버(19~21)는 수동의 감압 밸브인 파일럿 밸브로 구성되고, 레버 조작량에 따라 1차압을 감압하여, 파일럿 밸브 2차압을 생성한다.","Each of the operation levers 19 through 21 includes a pilot valve as a manual pressure reducing valve, and reduces a primary pressure depending on the lever operation amount to generate a pilot valve secondary pressure.",True,0.3540101647377014,0.8106402222373825,17,36,-19,79,219,-140
"생성된 2차압은 컨트롤 밸브(25) 내에 복수 있는 스풀(방향 전환 밸브)을 움직여, 그에 따라 펌프(24)로부터 토출되는 작동유의 흐름을 조정함으로써, 대응하는 액추에이터를 조작 가능하게 한다.]","The generated secondary pressures from the operation levers 19 through 21 move a plurality of spools (directional control valves) in the control valve 25, adjusting the flow of the hydraulic operating fluid delivered from the hydraulic pump 24 to operate the corresponding hydraulic actuators.",True,0.3122805058956146,0.8466696740066639,23,44,-21,110,293,-183
"[엔진(22)에 의해 구동되는 파일럿 펌프로부터의 유압원(26)은, 펌프 레귤레이터(27) 및, 동작 락 장치인 락 밸브(28)에 공급되고 있으며, 도면에 나타내지 않은 파일럿 릴리프 밸브에 의해 파일럿 1차압(4MPa)이 유지되고 있다.]",A hydraulic fluid source 26 supplied from a pilot pump actuated by the engine 22 supplies a hydraulic operating fluid to a pump regulator 27 and a lock valve 28 as the operation lock device.,True,0.4422683417797088,0.7876504076081726,27,35,-8,134,190,-56
"[펌프 레귤레이터(27) 중에는, 유압원(26)으로부터의 파일럿 1차압을 감압하여 사용하기 위한 전자 비례 밸브인 펌프 유량 제어 전자 밸브가 포함되어 있으며, 차체 컨트롤러(14)가 출력하는 전류(mA)에 따라 파일럿 1차압을 감압한다.",The pump regulator 27 includes a pump flow rate control solenoid valve as a solenoid proportional valve that reduces and uses the pilot valve primary pressure from the hydraulic fluid source 26.,False,0.3983355462551117,0.8062143448726269,27,32,-5,133,194,-61
"펌프 레귤레이터(27)는 펌프(24)의 틸팅(변위 용적(displacement volume)) 제어 기구를 내장하고 있으며, 펌프 유량 제어 전자 밸브의 출력(2차압)인 펌프 유량 제어압에 따라 펌프(24)의 용적(또는 토출 유량)을 제어한다.]","The pump regulator 27 incorporates a tilting (displacement volume) control mechanism for the pump 24, and controls the volume (or delivery flow rate) of the pump 24 depending on an output pressure (secondary pressure) from the pump flow rate control solenoid valve.",False,0.1664439886808395,0.9260565402154348,25,42,-17,137,265,-128
"[펌프 레귤레이터(27)는, 펌프 유량 제어압이 최소(0MPa)에서는 펌프 용적 최소이며, 펌프 유량 제어압이 최대(4MPa)에서는 펌프 용적 최대가 되는 특성을 가지고 있다.]",The pump regulator 27 has such characteristics that it makes the pump volume minimum under a minimum pump flow rate control pressure (0 MPa) and it makes the pump volume maximum under a maximum pump flow rate control pressure (4 MPa).,False,0.2147945463657379,0.8885315670837951,20,41,-21,99,234,-135
"[펌프 유량 제어 전자 밸브는, 비제어 상태(0mA)에서는 차단 위치(0MPa)로 되어 있으며, 차체 컨트롤러(14)가 지령 전류를 증가시킴에 따라 펌프 유량 제어압이 증가하는 특성을 가지고 있다.]","The pump flow rate control solenoid valve is in an interruption position (0 MPa) when in an uncontrolled state (0 mA), and has such characteristics that the pump flow rate control pressure increases as the vehicle body controller 14 increases a command electric current.",False,0.2313446551561355,0.8811128368487551,24,44,-20,111,270,-159
"[펌프 레귤레이터(27)에는, 펌프 유량 제어압을 검출하기 위한 펌프 유량 제어압 센서(33)가 마련되어 있다.]",The pump regulator 27 is combined with a pump flow rate control pressure sensor 33 that is used for detecting the pump flow rate control pressure.,False,0.3248439729213714,0.8366231572585198,13,26,-13,63,146,-83
"[펌프 유량 제어압 센서(33)의 신호는 차체 컨트롤러(14)에 입력되고, 차체 컨트롤러(14)는 펌프 유량 제어압에 대한 펌프 용적의 특성으로부터, 펌프 용적을 추정하고, 엔진 회전수를 곱함으로써 유압 펌프(24)의 토출 유량을 연산하고 있다.]","A signal from the pump flow rate control pressure sensor 33 is inputted to the vehicle body controller 14, which estimates a pump displacement from the characteristics of pump displacements with respect to pump flow rate control pressures and multiplies the estimated pump displacement by the engine rotational speed, thereby calculating a delivery flow rate of the hydraulic operating fluid delivered from the hydraulic pump 24.",False,0.2825038433074951,0.8707539783745346,29,66,-37,138,429,-291
"[락 밸브(28)는, 차체의 모든 동작 가부를 전환하는 동작 락 장치이다.",The lock valve 28 is the operation lock device that selectively locks and unlocks operation of the vehicle body in whole.,False,0.4007884263992309,0.7420067132346303,10,21,-11,41,121,-80
락 밸브(28)는 차체 컨트롤러(14)에 의해 구동되는 솔레노이드에 의해 차단 위치와 연통 위치로 전환할 수 있다.],The lock valve 28 is switched between an interruption position and a fluid communication position by a solenoid actuated by the vehicle body controller 14.,False,0.3603696823120117,0.7981292286850793,15,25,-10,65,155,-90
"[운전실(4) 내에 설치된 락 레버(도시 생략)가 락 위치에 있을 때, 락 스위치(15)는 OFF(단자간은 개방) 상태로 되어 있다.","When a lock lever (not illustrated) disposed in the cabin 4 is in a locked position, the lock switch 15 is OFF (its terminals are open or disconnected).",False,0.2846687734127044,0.8300533666832894,17,28,-11,74,152,-78
"차체 컨트롤러(14)는 락 스위치(15)의 상태를 감시하고, 락 스위치(15)가 OFF일 때에는 락 밸브(28)를 비여자 상태(차단 위치)로 한다.]","The vehicle body controller 14 monitors the state of the lock switch 15, and de-energizes the lock valve 28 (holds the lock valve 28 in the interruption position) when the lock switch 15 is OFF.",False,0.1425452679395675,0.9278113531616616,16,35,-19,83,194,-111
"[운전실(4) 내에 설치된 락 레버가 락 해제 위치에 있을 때, 락 스위치(15)는 ON(단자간은 도통) 상태로 되어 있다.","When the lock lever disposed in the cabin 4 is in an unlocked position, lock switch 15 is ON (its terminals are connected).",False,0.2095742374658584,0.8713974935355188,17,23,-6,69,123,-54
"차체 컨트롤러(14)는 락 스위치(15)의 상태를 감시하고, 락 스위치(15)가 ON일 때에는 락 밸브(28)에 24V를 인가하여 여자 상태(연통 위치)로 한다.]","The vehicle body controller 14 monitors the state of the lock switch 15, and energizes the lock valve 28 (holds the lock valve 28 in the fluid communication position) by applying 24 V to the lock valve 28 when the lock switch 15 is ON.",False,0.1743589490652084,0.9150683388034508,18,45,-27,91,235,-144
"[락 밸브(28)가 차단 위치일 때에는, 선회 조작 레버(19), 주행 조작 레버(20), 프론트 조작 레버(21)에 파일럿 1차압이 공급되지 않는다.","When the lock valve 28 is in the interruption position, the swing operation lever 19, the travel operation lever 20, and the front implement operation lever 21 are not supplied with the pilot valve primary pressure.",False,0.1605820804834365,0.9110078286701222,18,36,-18,84,215,-131
"이 때문에, 조작 레버(19~21)를 조작해도 파일럿 밸브 2차압이 상승하지 않아, 컨트롤 밸브(25) 내의 스풀을 전환할 수 없기 때문에, 차체의 모든 동작이 불가능해진다.]","Thus, even when the operation levers 19 through 21 are operated, since the pilot valve secondary pressure does not increase and is unable to shift the spools in the control valve 25, the vehicle body is operationally disabled in whole.",False,0.1953505575656891,0.8928305735255487,22,40,-18,98,235,-137
"[락 밸브(28)가 연통 위치일 때에는, 선회 조작 레버(19), 주행 조작 레버(20), 프론트 조작 레버(21)에 파일럿 1차압이 공급된다.","When the lock valve 28 is in the fluid communication position, the swing operation lever 19, the travel operation lever 20, and the front implement operation lever 21 are supplied with the pilot valve primary pressure.",False,0.2199646085500717,0.881610838780207,17,36,-19,80,218,-138
"이 때문에, 조작 레버(19~21)의 조작에 따라 파일럿 밸브 2차압이 증가하고, 컨트롤 밸브(25) 내의 스풀을 전환할 수 있도록 됨으로써 차체가 동작 가능해진다.]","Thus, depending on operation of the operation levers 19 through 21, the pilot valve secondary pressure increases and is able to shift the spools in the control valve 25, so that the vehicle body becomes operational.",False,0.175536572933197,0.9083954760379752,21,36,-15,93,215,-122
"[선회 조작 레버(19)와 컨트롤 밸브(25)의 사이의 파일럿 회로에는, 파일럿 밸브 2차압을 검출하기 위한 선회 조작압 센서(29)가 마련되어 있다.",A swing operation pressure sensor 29 for detecting the pilot valve secondary pressure is included in a pilot circuit between the swing operation lever 19 and the control valve 25.,False,0.2260922193527221,0.8955895606946979,18,30,-12,84,179,-95
"주행 조작 레버(20)와 컨트롤 밸브(25)의 사이의 파일럿 회로에는, 파일럿 밸브 2차압을 검출하기 위한 주행 조작압 센서(30)가 마련되어 있다.]",A travel operation pressure sensor 30 for detecting the pilot valve secondary pressure is included in a pilot circuit between the travel operation lever 20 and the control valve 25.,False,0.2001944333314895,0.9071553908512932,18,30,-12,84,181,-97
"[프론트 조작 레버(21)와 컨트롤 밸브(25)의 사이의 파일럿 회로에는, 파일럿 밸브 2차압을 검출하기 위한 프론트 조작압 센서(31)가 마련되어 있다.]",A front implement operation pressure sensor 31 for detecting the pilot valve secondary pressure is included in a pilot circuit between the front implement operation lever 21 and the control valve 25.,False,0.218337208032608,0.8945705120414382,18,32,-14,87,199,-112
"[선회 조작압 센서(29), 주행 조작압 센서(30), 프론트 조작압 센서(31)의 신호는 차체 컨트롤러(14)에 입력되고, 차체 컨트롤러(14)는 유압 셔블의 조작 상황을 파악하고 있다.]","Signals from the swing operation pressure sensor 29, the travel operation pressure sensor 30, and the front implement operation pressure sensor 31 are inputted to the vehicle body controller 14, which identifies the situation in which the hydraulic excavator is operated.",False,0.2416906952857971,0.8871536879905529,21,41,-20,106,271,-165
"[차체 컨트롤러(14)는, 조작압 센서(29~31)로부터의 입력에 의거하여 차체의 조작 유무를 판정한다.]",The vehicle body controller 14 determines whether the vehicle body is operated or not on the basis of the signals inputted from the operation pressure sensors 29 through 31.,False,0.2961382269859314,0.845260366896133,10,29,-19,59,173,-114
"[유압 펌프(24)와 컨트롤 밸브(25)의 사이의 딜리버리 회로에는, 펌프 토출압을 검출하기 위한 펌프 토출압 센서(32)가 마련되어 있다.]",A pump delivery pressure sensor 32 for detecting a pump delivery pressure is included in a delivery circuit between the hydraulic pump 24 and the control valve 25.,False,0.2364247441291809,0.8900115636196838,16,28,-12,79,163,-84
"[펌프 토출압 센서(32)의 신호는 차체 컨트롤러(14)에 입력되고, 차체 컨트롤러(14)는 유압 셔블의 펌프 부하를 파악하고 있다.]","A signal from the pump delivery pressure sensor 32 is inputted to the vehicle body controller 14, which identifies a pump load of the hydraulic excavator.",False,0.280576080083847,0.8630058516131337,15,26,-11,75,154,-79
"[차체 컨트롤러(14)는, 엔진 회전수나 조작압 센서(29~31)의 입력에 따라 조작에 의한 펌프 목표 유량을 산출한다.",The vehicle body controller 14 calculates an operation-based target pump flow rate depending on the engine rotational speed and the input signals from the operation pressure sensors 29 through 31.,False,0.2770578265190124,0.8585371989491627,14,30,-16,67,196,-129
"또한, 차체 컨트롤러(14)는, 엔진 회전수나 조작 상황이나 그 밖의 차체 상태(온도 등)에 따라 제한 마력(kW)을 연산하고, 펌프 토출압 센서(32)의 입력과 제한 마력으로부터, 마력 제한에 의한 펌프 상한 유량을 산출한다.","Further, the vehicle body controller 14 calculates a limited horsepower (kW) depending on the engine rotational speed, the operation situation, and other vehicle body states (temperature, etc.), and calculates an upper limit pump flow rate due to the limiting of the horsepower from the input signal from the pump delivery pressure sensor 32 and the limited horsepower.",False,0.1662887185811996,0.9199257697185692,29,57,-28,127,369,-242
"차체 컨트롤러(14)는, 조작에 의한 펌프 목표 유량과 마력 제한에 의한 펌프 상한 유량이 작은 쪽을 펌프 목표 유량으로서 선택하고, 그 유량이 되도록 펌프 유량 제어 전자 밸브를 구동한다.]","The vehicle body controller 14 selects a smaller one of the operation-based target pump flow rate and the upper limit pump flow rate due to the limiting of the horsepower, as a target pump flow rate, and actuates the pump flow rate control solenoid valve so as to achieve the target pump flow rate.",False,0.2901487946510315,0.8477290827215267,28,54,-26,107,298,-191
[(시스템 구성의 설명 전제로 하는 주위 검지 동작 제한 시스템으로서의 구성 부분)],(Description of a system configuration; part of the configuration as a peripheral detection and operation limiting system as a premise),False,0.2750448286533355,0.7951257174447812,12,20,-8,47,135,-88
"[유압 셔블의 운전실(4) 내에는, 3D 센서(6~9)의 검지 정보나 주위 검지에 의한 차체 동작 제한의 상태를 오퍼레이터에게 통지하기 위한 주위 검지 모니터(18)를 구비하고 있다.]",The cabin 4 of the hydraulic excavator houses therein a periphery detection monitor 18 for indicating to the operator information detected by the 3D sensors 6 through 9 and a state of vehicle body operation limitation based on peripheral detection.,False,0.3182731866836548,0.8340788024355575,23,40,-17,103,248,-145
"[3D 센서(6~9)와, 주위 검지 모니터(18)와, 차체 컨트롤러(14)는 CAN 통신에 의해 접속되어 있으며, 각각 필요한 정보의 송수신을 행하고 있다.]","The 3D sensors 6 through 9, the periphery detection monitor 18, and the vehicle body controller 14 are connected to each other by CAN communication, and send and receive necessary information.",False,0.1873285174369812,0.8898411843499578,18,31,-13,88,192,-104
"[이 CAN 통신에 의해, 차체 컨트롤러(14)나 주위 검지 모니터(18)는, 검지 영역(10~13) 각각에 대하여 장해물을 검지하고 있는지를 아는 것이 가능하게 되어 있으며, 또한, 차체 컨트롤러(14)는, 장해물 검출 장치인 3D 센서(6~9)에 의해 작성되는 검지 영역(10~13)의 1개 이상에 장해물(사람·물건)이 존재하는 경우에, 장해물 검지라고 판정하고, 검지 영역(10~13) 중 어디에도 장해물(사람·물건)이 존재하지 않는 경우에, 장해물 비검지라고 판정한다.]",The CAN communication makes it possible for the vehicle body controller 14 and the periphery detection monitor 18 to learn whether an obstacle has been detected in each of the detection areas 10 through 13.,False,0.4585280418395996,0.7413436682538701,52,35,17,267,206,61
냉난방 멀티 공기조화기{Multi-air conditioner for heating and cooling operations },1. Field of the invention,False,1.2189220190048218,0.1186436075373675,10,5,5,71,25,46
"[본 발명은 냉난방 멀티 공기조화기에 관한 것으로서, 보다 상세하게는 한랭지에서의 난방 시에 압축기의 오일 부족을 해소할 수 있는 냉난방 멀티 공기조화기에 관한 것이다.]","The present disclosure relates to a multi-air conditioner for heating/cooling operation, and more particularly, to a multi-air conditioner for heating/cooling operation capable of resolving a lack of oil in a compressor during heating in a cold region.",True,0.3076164722442627,0.8378406795573071,23,37,-14,95,252,-157
"[일반적으로 멀티형 공기조화기는 하나의 실외기에 복수개의 실내기들을 연결한 것으로, 실외기를 공용으로 사용하면서 복수개의 실내기들 각각을 냉방기 또는 난방기로 사용한다.]","In general, a multi-type air conditioner is an air conditioner that connects a plurality of indoor units to a single outdoor unit, and uses each of the plurality of indoor units as a cooler or a heater while using the outdoor unit in common.",True,0.2244675904512405,0.8627829925867351,19,44,-25,95,241,-146
[최근에는 실내기의 운전 대수에 따른 냉방 또는 난방 부하에 효과적으로 대응할 수 있도록 복수의 실외기들을 서로 병렬로 연결하여 사용하고 있다. ],"Recently, a plurality of outdoor units are connected in parallel to each other and used to effectively respond to a cooling or heating load according to the number of operating indoor units.",True,0.2753816843032837,0.8103094468056875,21,32,-11,82,190,-108
"[종래 기술에 따른 멀티 공기조화기는 복수개의 실외기들과, 복수개의 실내기들과, 상기 복수개의 실외기들과 실내기들을 연결하는 냉매배관을 포함하여 구성되고, 여기서 상기 복수의 실외기들은 메인 실외기와 복수의 서브 실외기로 구성된다. ]","A multi-air conditioner according to the related art includes a plurality of outdoor units, a plurality of indoor units, and a refrigerant pipe connecting the plurality of outdoor units and the plurality of indoor units.",False,0.3151207864284515,0.8101919432397804,28,35,-7,131,220,-89
"[상기 복수개의 실외기들 각각에는 저온 저압의 기체상태의 냉매를 고온 고압으로 압축시키는 압축기와, 순환되는 냉매를 실외 공기와 열교환시키는 실외 열교환기와, 냉방 또는 난방 작동에 따라 냉매 흐름을 절환시키는 사방밸브가 설치된다.","Each of the plurality of outdoor units includes a compressor that compresses a gaseous refrigerant of low temperature and low pressure to be a high temperature and high pressure refrigerant, an outdoor heat exchanger for heat-exchanging the circulated refrigerant with outdoor air, and a four-way valve that switches refrigerant flow according to cooling or heating operation.",True,0.2089159339666366,0.8835376545091699,29,56,-27,129,376,-247
"상기 복수개의 실내기들 각각에는 팽창기구와, 순환되는 냉매를 실내 공기와 열교환시키는 실내 열교환기가 각각 설치된다.]","Each of the plurality of indoor units includes an expansion device, and an indoor heat exchanger that heat-exchanges the circulated refrigerant with indoor air.",True,0.2272194772958755,0.8598567294059006,14,24,-10,66,160,-94
"[상기와 같이 구성된 종래 기술에 따른 멀티 공기조화기는 냉방 운전 시는 상기 메인 실외기와 서브 실외기의 압축기에서 압축된 냉매가 상기 사방밸브에 의해 상기 실외 열교환기로 보내지고, 상기 실외 열교환기를 통과하는 냉매는 주변공기와의 열교환으로 응축된 후, 상기 팽창기구로 보내진다.","In the multi-air conditioner according to the related art configured as described above, during the cooling operation, the refrigerant compressed by the compressor of the main outdoor unit and the sub outdoor unit is transferred to the outdoor heat exchanger by the four-way valve, the refrigerant passing through the outdoor heat exchanger is condensed by heat exchange with ambient air, and then transferred to the expansion device.",True,0.2672118544578552,0.849909458613324,38,67,-29,159,434,-275
"상기 팽창기구에서 팽창된 냉매는 상기 실내 열교환기로 유입되어, 실내 공기의 열을 흡수하면서 증발되어, 실내를 냉방한다.]","The refrigerant expanded by the expansion device flows into the indoor heat exchanger and evaporates while absorbing heat from the indoor air, thereby cooling the room.",True,0.2009776383638382,0.8780797515193169,15,26,-11,68,168,-100
"[한편, 난방 운전 시에는 상기 사방밸브에서 유로가 절환되어, 상기 압축기에서 토출된 냉매는 상기 사방밸브, 실내 열교환기, 실외 전자팽창밸브(LEV:linear expansion valve), 실외 열교환기를 차례로 통과하면서, 실내를 난방한다.]","Meanwhile, during the heating operation, a flow path is switched in the four-way valve, and the refrigerant discharged from the compressor sequentially passes through the four-way valve, an indoor heat exchanger, an outdoor linear expansion valve (LEV), and an outdoor heat exchanger, thereby heating the room.",True,0.2057882100343704,0.8779430641961952,26,46,-20,139,310,-171
"[일 예로, 한국공개특허 KR20140018536A에서는 냉난방 모드가 전환되거나, 비운전 실내기 대수가 변경되거나, 실내외 온도가 변화하는 등 운전 조건이 변경되더라도, 리시버를 활용하여 냉매 순환량을 최적화함으로써 시스템 효율이 최적인 상태로 운전될 수 있도록 한다.","KR20140018536A, even if a heating/cooling mode is switched, the number of non-operating indoor units is changed, or the operating condition is changed, e.g. the indoor/outdoor temperature is changed, a system efficiency can be optimized to operate by using a receiver to optimize the refrigerant circulation amount.",False,0.2505247294902801,0.8424372138363551,31,46,-15,151,315,-164
"그러나, 선행 문헌에서는 냉매의 순환량을 제어하는 것이 기재되어 있을 뿐 오일부족에 대하여는 전혀 언급되지 않는다. ]","However, the related art only describes the controlling of the circulation amount of the refrigerant, but does not mention the lack of oil at all.",True,0.2892205715179443,0.7906506174597049,16,25,-9,66,146,-80
"[또한, 한국공개특허 KR20010059700A 에서는 압축기에서 토출된 냉매와 오일을 분리하는 오일 분리기를 통해 오일은 압축기로 다시 순환시키고 냉매만 응축기로 보내주는 기술이 개시되어 있다.]",KR20010059700A discloses a technology for circulating oil back to the compressor and sending only the refrigerant to a condenser through an oil separator that separates the oil and the refrigerant discharged from the compressor.,False,0.252750813961029,0.857023125177219,22,34,-12,110,228,-118
"[그러나, 이와 같은 오일 분리 기술은 냉매와 오일을 분리하는 것일 뿐, 운전 초기에 오일과 냉매의 온도가 매우 낮은 때의 분리 불가능성에 대하여는 전혀 인지하고 있지 않다.]","However, such an oil separation technology only separates the refrigerant and the oil, and does not recognize at all the impossibility of separation when the temperature of the oil and the refrigerant is very low in an initial operation.",True,0.2429272979497909,0.8535089548105703,26,39,-13,98,237,-139
"[특히, 한랭지와 같이 외부 온도가 매우 낮은 경우, 도 1과 같이 저압 제안하는 난방 운전을 수행할 때, 일 예로 압축기 1개로 구동되며, 구동 주파수가 30Hz일 때, 오일 온도와 오일 과열도가 단시간에 상승하지 않고, 오일의 과열도가 확보되지 않으면 압축기 내부에서 적정 유면을 형성하여야 하는 오일이 초기 동작에서 냉매와 함께 쓸려 나가게 된다.","In particular, in a case where the external temperature is very low as in a cold region, when performing a heating operation that limits a low pressure as shown in FIG. 1, as an example, when it is driven by one compressor, and the driving frequency is 30Hz, if the oil temperature and oil superheat does not rise in a short time, and the superheat of the oil is not secured, the oil, which should form an appropriate oil level inside the compressor, is swept away together with the refrigerant in the initial operation.",True,0.1299702078104019,0.9258122933169604,51,94,-43,197,520,-323
"따라서 최저 유면이 확보되지 않고, 윤활 역할을 수행하는 오일의 부족으로 인해 압축기 소손이 발생할 우려가 있다.]","Therefore, the lowest oil level is not secured, and there is a risk that the compressor may be damaged by a fire due to the lack of oil performing a lubricating role.",True,0.2298348546028137,0.8365650258200583,16,32,-16,64,166,-102
"[PatentCitationText[attributes={}; value=[한국공개특허 KR20140018536A (공개일 : 2018년 06월 07일)]], PatentCitationText[attributes={}; value=[한국공개특허 KR20010059700A (공개일 : 2003년 04월 03일)]]]",SUMMARY OF THE INVENTION,False,0.8479254841804504,0.3482211006379526,16,4,12,176,24,152
[본 발명의 제1 과제는 리시버를 사용하는 냉난방 멀티 공기조화기의 어큐뮬레이터에서 오일을 저장할 수 있는 구조를 제공하는 것이다.],A first object of the present disclosure is to provide a structure capable of storing oil in an accumulator of a multi-air conditioner for heating/cooling operation using a receiver.,True,0.2666799426078796,0.8475998064282679,17,29,-12,74,182,-108
"[본 발명의 제2 과제는 저온 방치 상태에서 난방 운전 중에 오일 회수 운전을 진행함으로써, 부족할 수 있는 오일을 보충하여 리시버에 저장할 수 있는 냉난방 멀티 공기조화기를 제공하는 것이다.]",A second object of the present disclosure is to provide a multi-air conditioner for heating/cooling operation capable of replenishing oil that may be insufficient and storing the oil in a receiver by performing an oil recovery operation during a heating operation in a low temperature neglected state.,True,0.2440660446882248,0.8717412731258981,28,47,-19,108,301,-193
[본 발명의 제3 과제는 주기적으로 실외 온도 및 압축기 수위를 체크하여 그에 따라 오일 회수 운전을 수행함으로써 공기조화기의 현재 상태에 따라 능동적으로 회수 운전을 수행할 수 있는 냉난방 멀티 공기조화기를 제공하는 것이다.],A third object of the present disclosure is to provide a multi-air conditioner for heating/cooling operation capable of actively performing a recovery operation according to the current state of the air conditioner by periodically checking the outdoor temperature and the compressor water level and performing an oil recovery operation accordingly.,True,0.209033265709877,0.8852882600225638,32,50,-18,127,348,-221
"[본 발명의 과제인 오일 소손 현상을 방지하기 위하여, 본 발명은 각각 실내 열교환기를 포함하는 적어도 하나의 냉난방 겸용 실내기; 및 압축기, 실외 열교환기 및 상기 압축기의 토출측에 배치되어 냉매의 흐름을 절환하는 절환 유닛을 포함하는 냉난방 겸용 실외기; 를 포함하고, 상기 냉난방 겸용 실외기는 냉방 또는 난방 운전 모드에 따라 냉매 또는 오일을 선택적으로 저장하여 상기 압축기로 제공하는 리시버를 포함하는 냉난방 멀티 공기조화기를 제공한다.]","In accordance with an aspect of the present disclosure, a multi-air conditioner for heating/cooling operation includes: at least one of indoor units for heating/cooling operation including an indoor heat exchanger respectively; and an outdoor unit for heating/cooling operation including a compressor, an outdoor heat exchanger, and a switching unit configured to be disposed in a discharge side of the compressor to switch a flow of refrigerant, wherein the outdoor unit for heating/cooling operation includes a receiver which selectively stores refrigerant or oil according to a cooling or heating operation mode and provides the stored refrigerant or oil to the compressor.",True,0.237785130739212,0.8808310734183018,63,100,-37,252,676,-424
"[상기 리시버는 상기 냉방 운전 모드에서 상기 냉매를 저장하고, 상기 난방 운전 모드에서 오일을 저장할 수 있다.]","The receiver stores the refrigerant in the cooling operation mode, and stores the oil in the heating operation mode.",True,0.305200845003128,0.8079897600612324,17,19,-2,64,116,-52
[상기 냉난방 겸용 실외기는 상기 리시버와 상기 압축기의 출력단을 연결되어 있는 리시버 오일회수배관; 및 상기 리시버 오일회수배관 상에 배치되며 개폐에 의해 상기 압축기 내의 오일을 상기 리시버로 회수하는 오일 회수 밸브를 더 포함할 수 있다.],"The outdoor unit for heating/cooling operation further includes a receiver oil recovery pipe connecting the receiver and an output terminal of the compressor; and an oil recovery valve which is disposed on the receiver oil recovery pipe, and opened and closed to recover the oil in the compressor to the receiver.",True,0.2670714557170868,0.8581566542545594,35,51,-16,137,313,-176
[상기 오일 회수 밸브는 솔레노이드 밸브일 수 있다.],The oil recovery valve is a solenoid valve.,True,0.3688777685165405,0.727296584841056,8,8,0,30,43,-13
"[상기 냉난방 겸용 실외기는 상기 리시버와 연결되어 있으며, 상기 압축기로 상기 냉매 또는 오일을 전달하는 어큐뮬레이터를 더 포함할 수 있다.]",The outdoor unit for heating/cooling operation further includes an accumulator which is connected to the receiver and transfers the refrigerant or oil to the compressor.,True,0.3980122804641723,0.765897929378094,20,25,-5,80,169,-89
"[상기 리시버와 상기 어큐뮬레이터를 연결하는 리시버 출구 배관; 및 상기 리시버에 냉매를 전달하는 리시버 입구 배관을 더 포함하며, 상기 리시버 출구 배관에는 리시버 출구 밸브 및 상기 리시버 입구 배관에는 리시버 입구 밸브가 각각 형성되어 있을 수 있다.]","The multi-air conditioner further includes a receiver outlet pipe connecting the receiver and the accumulator; and a receiver inlet pipe for transferring the refrigerant to the receiver, wherein a receiver outlet valve is formed on the receiver outlet pipe and a receiver inlet valve is formed on the receiver inlet pipe, respectively.",True,0.3307811319828033,0.8054332528832276,38,52,-14,144,335,-191
[상기 리시버는 난방 운전이 종료된 후 오일 회수 운전에서 상기 압축기로부터 오일을 제공받아 저장할 수 있다.],The receiver receives and stores the oil from the compressor in an oil recovery operation after a heating operation is terminated.,True,0.3196183443069458,0.8005522470653316,16,21,-5,62,130,-68
[상기 오일 회수 운전은 상기 난방 운전이 종료된 후 실외 온도가 제1 임계값 미만에서만 진행될 수 있다.],The oil recovery operation is performed only when an outdoor temperature is less than a first threshold value after the heating operation is terminated.,True,0.2153418064117431,0.858922921040855,17,24,-7,60,152,-92
[상기 제1 임계값은 영하 20도보다 낮은 값일 수 있다.],The first threshold value is a value lower than minus 20 degrees.,True,0.2720536291599273,0.7873043353614833,9,12,-3,33,65,-32
"[상기 오일 회수 운전에서 상기 오일 회수 밸브가 개방되고, 상기 리시버 출구밸브 및 상기 리시버 입구 밸브가 폐쇄되어 상기 압축기의 오일을 상기 리시버로 제공할 수 있다.]","In the oil recovery operation, the oil recovery valve is opened, and the receiver outlet valve and the receiver inlet valve are closed to provide the oil of the compressor to the receiver.",True,0.3569638133049011,0.784134472566971,26,33,-7,97,188,-91
[상기 압축기 내에 상기 오일의 유면 레벨을 감지하는 오일 레벨 센서가 형성되어 있을 수 있다.],An oil level sensor for detecting a level of the oil is formed inside the compressor.,True,0.3020606637001037,0.8022048828319609,15,16,-1,54,85,-31
[상기 리시버 내에 상기 오일 또는 냉매의 레벨을 감지하는 레벨 센서가 형성되어 있을 수 있다.],The level sensor for detecting a level of the oil or refrigerant is formed in the receiver.,True,0.3009933829307556,0.7925021959622774,15,17,-2,54,91,-37
"[상기 난방 운전이 시작되면, 상기 압축기의 시동 시에 상기 리시버의 오일을 상기 압축기에 제공할 수 있다.]","When the heating operation starts, the oil of the receiver is provided to the compressor at a start of the compressor.",True,0.3786477446556091,0.7509910846216,16,21,-5,61,118,-57
"[한편, 본 발명은 난방 운전 시작 신호를 수신하는 단계; 실외 온도 및 압축기의 오일 레벨 값을 읽어들여 상기 압축기의 오일 부족 여부를 판단하는 단계; 상기 압축기의 오일이 부족하다고 판단되면, 리시버로부터 저장되어 있는 오일을 상기 압축기에 제공하여 상기 압축기의 오일 레벨을 상승시키는 단계; 및 상기 압축기의 오일 레벨 값이 임계값보다 크면 상기 리시버로부터의 오일 제공을 중단하고 난방 운전을 진행하는 단계를 포함하는 냉난방 멀티 공기조화기의 제어 방법을 제공한다.]","Meanwhile, in accordance with another aspect of the present disclosure, a method of controlling a multi-air conditioner for heating/cooling operation, includes: receiving a heating operation start signal; reading an outdoor temperature and an oil level value of a compressor and determining whether the compressor is short of oil; supplying stored oil from a receiver to the compressor to increase an oil level of the compressor, when it is determined that the oil in the compressor is insufficient; and stopping the supply of oil from the receiver and performing a heating operation, when the oil level value of the compressor is greater than a threshold value.",True,0.2345532029867172,0.8777703598637289,66,105,-39,267,662,-395
"[상기 난방 운전이 종료되면, 상기 실외 온도에 따라 상기 리시버에 오일을 회수하는 오일 회수 운전을 수행하는 단계를 더 포함할 수 있다.]","The method further includes performing an oil recovery operation of recovering the oil to the receiver according to the outdoor temperature, when the heating operation is terminated.",True,0.4127411246299743,0.7542105423844555,21,27,-6,78,182,-104
"[상기 오일 회수 운전은 난방 운전이 종료되고, 상기 실외 온도가 제1 임계값보다 낮은 경우 진행하는 것을 특징으로 할 수 있다.]",The oil recovery operation is performed when the heating operation is terminated and the outdoor temperature is lower than a first threshold value.,True,0.2932843267917633,0.8064941291437616,20,23,-3,73,147,-74
"[상기 실외 온도가 제1 임계값보다 낮고, 상기 압축기의 오일 레벨이 소정 레벨보다 낮으면 오일 부족으로 판단하여, 상기 리시버에 저장되어 있는 오일을 상기 압축기로 전달할 수 있다.]","When the outdoor temperature is lower than the first threshold value and the oil level of the compressor is lower than a certain level, it is determined that the oil is insufficient, and the oil stored in the receiver is transferred to the compressor.",True,0.3317796587944013,0.799562062843842,26,44,-18,103,251,-148
[도 1은 종래의 오일 소손을 나타내는 그래프이다.,BRIEF DESCRIPTION OF THE DRAWINGS,False,0.9557697772979736,0.2200459914868255,7,5,2,28,33,-5
도 3은 난방 운전 시 도 1의 냉난방 멀티 공기조화기의 동작 상태를 나타내는 동작도이다.,"The above and other objects, features and advantages of the present disclosure will be more apparent from the following detailed description in conjunction with the accompanying drawings, in which: FIG. 1 is a graph illustrating conventional oil burnout; FIG. 2 is a schematic configuration diagram of a multi-air conditioner for heating/cooling operation according to an embodiment of the present disclosure; FIG. 3 is an operation diagram illustrating an operating state of the multi-air conditioner for heating/cooling operation of FIG. 1 during a heating operation; FIG. 4 is a flowchart illustrating an oil recovery operation according to a condition of the multi-air conditioner for heating/cooling operation of FIG. 2 ; FIG. 5 is a flowchart illustrating a control during a heating operation after an oil recovery operation of the multi-air conditioner for heating/cooling operation of FIG. 4 ; and FIG. 6 is an operation diagram illustrating a heating operation after an oil recovery operation of the multi-air conditioner for heating/cooling operation of FIG. 5.",False,0.7293305397033691,0.5736816536995919,14,163,-149,50,1071,-1021
도 4는 도 2의 냉난방 멀티 공기조화기의 조건에 따른 오일회수 운전을 나타내기 위한 순서도이다.,DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS,False,1.0919243097305298,0.2105680229563387,14,6,8,54,49,5
"[본 발명의 이점 및 특징, 그리고 그것들을 달성하는 방법은 첨부되는 도면과 함께 상세하게 후술되어 있는 실시예들을 참조하면 명확해질 것이다.",Advantages and features of the present disclosure and methods of achieving them will become apparent with reference to the embodiments described below in detail in conjunction with the accompanying drawings.,True,0.1695661842823028,0.8721456397701123,19,30,-11,79,207,-128
"그러나 본 발명은 이하에서 개시되는 실시예들에 한정되는 것이 아니라 서로 다른 다양한 형태로 구현될 수 있으며, 단지 본 실시예들은 본 발명의 개시가 완전하도록 하고, 본 발명이 속하는 기술분야에서 통상의 지식을 가진 자에게 발명의 범주를 완전하게 알려주기 위해 제공되는 것이며, 본 발명은 청구항의 범주에 의해 정의될 뿐이다.","However, the present disclosure is not limited to the embodiments disclosed below, but may be implemented in various different forms, and these embodiments are provided only to allow the disclosure of the present disclosure to be complete, and to completely inform those of ordinary skill in the art to which the present disclosure belongs, the scope of the invention, and the present disclosure is only defined by the scope of the claims.",True,0.2218946665525436,0.8497928617299497,46,72,-26,183,439,-256
명세서 전체에 걸쳐 동일 참조 부호는 동일 구성 요소를 지칭한다.],Like reference numerals refer to like elements throughout.,True,0.3111658990383148,0.7440660969926746,10,8,2,37,58,-21
"[공간적으로 상대적인 용어인 ""아래(below)"", ""아래(beneath)"", ""하부(lower)"", ""위(above)"", ""상부(upper)"" 등은 도면에 도시되어 있는 바와 같이 하나의 구성 요소들과 다른 구성 요소들과의 상관관계를 용이하게 기술하기 위해 사용될 수 있다.","The terms spatially relative, ""below"", ""beneath"", ""lower"", ""above"" and ""upper"" and the like can be used to easily describe the correlation of elements with other elements.",True,0.2032065093517303,0.8534862538077301,27,26,1,154,171,-17
공간적으로 상대적인 용어는 도면에 도시되어 있는 방향에 더하여 사용시 또는 동작 시 구성요소의 서로 다른 방향을 포함하는 용어로 이해되어야 한다.,"Spatially relative terms should be understood in terms of the directions shown in the drawings, including the different directions of components at the time of use or operation.",True,0.2446341514587402,0.8129194869131756,20,28,-8,81,177,-96
"예를 들면, 도면에 도시되어 있는 구성요소를 뒤집을 경우, 다른 구성요소의 ""아래(below)""또는 ""아래(beneath)""로 기술된 구성요소는 다른 구성요소의 ""위(above)""에 놓여질 수 있다.","For example, when inverting an element shown in the drawings, an element described as ""below"" or ""beneath"" of another element may be placed ""above"" of another element.",True,0.1015342772006988,0.9314676312058718,20,27,-7,111,167,-56
"따라서, 예시적인 용어인 ""아래""는 아래와 위의 방향을 모두 포함할 수 있다.","Thus, the exemplary term ""below"" may include both downward and upward directions.",True,0.1358968913555145,0.8969368622258675,11,12,-1,43,81,-38
"전자 장치에 있어서,디스플레이;상기 디스플레이와 동작적으로 연결되는 프로세서;상기 디스플레이와 대향하며 적어도 일부가 광투과성 재질로 형성되는 커버;상기 커버와 마주보는 제1면과, 상기 제1면의 반대쪽 면에 해당하는 제2면을 갖는 유연 인쇄 회로 기판;상기 유연 인쇄 회로 기판을 감싸도록 배치되는 무선 충전용 코일;상기 유연 인쇄 회로 기판의 제1면에 실장되는 발광부 및 수광부를 포함하는 제1 생체 신호 감지부;상기 유연 인쇄 회로 기판과 마주보는 부분인 상기 커버의 안쪽에 형성되는 내부 전극과 상기 내부 전극과 전기적으로 연결되고 상기 커버의 바깥쪽에 형성되는 외부 전극을 포함하는 제2 생체 신호 감지부;한쪽 말단이 상기 유연 인쇄 회로 기판의 제1면에 실장되고 상기 커버로 연장되어 반대쪽 말단이 상기 제2 생체 신호 감지부의 내부 전극과 연결되는 컨택부; 및상기 제1 생체 신호 감지부가 감지한 제1 생체 신호 및 상기 제2 생체 신호 감지부가 감지한 제2 생체 신호를 처리하도록 상기 유연 인쇄 회로 기판의 제2면에 실장되는 신호 처리부;를 포함하는 웨어러블 전자 장치.","A wearable electronic device comprising: a display; a processor operatively connected to the display; a cover facing the display and having at least a portion formed of a light-transmitting material; a flexible printed circuit board having a first surface facing the cover, and a second surface corresponding to an opposite surface of the first surface; a wireless charging coil disposed so as to surround the flexible printed circuit board; a first bio-signal sensing unit comprising a light-receiving unit and a light-emitting unit mounted on the first surface of the flexible printed circuit board; a second bio-signal sensing unit comprising an internal electrode formed inside the cover, corresponding to a portion facing the flexible printed circuit board, and an external electrode electrically connected to the internal electrode and formed outside the cover; a contact unit having one end mounted on the first surface of the flexible printed circuit board, extending to the cover so that the opposite end thereof is connected to the internal electrode of the second bio-signal sensing unit; and a signal processing unit mounted on the second surface of the flexible printed circuit board to process a first bio-signal sensed by the first bio-signal sensing unit and a second bio-signal sensed by the second bio-signal sensing unit.",True,0.2392524033784866,0.9153361170341094,135,209,-74,551,1340,-789
"제1항에 있어서,상기 컨택부는,상기 유연 인쇄 회로 기판의 제1면과 수직하는 방향으로 연장되도록 형성되는 웨어러블 전자 장치.","The wearable electronic device of claim 1, wherein the contact unit is configured to extend in a direction perpendicular to the first surface of the flexible printed circuit board.",True,0.3451004922389984,0.8334728787876812,15,29,-14,70,180,-110
"제1항에 있어서,상기 유연 인쇄 회로 기판의 제1면에 배치되는 제1 자석;을 더 포함하는 웨어러블 전자 장치.","The wearable electronic device of claim 1, further comprising a first magnet disposed on the first surface of the flexible printed circuit board.",True,0.254508763551712,0.8875156484136184,15,23,-8,61,145,-84
"제4항에 있어서,상기 신호 처리부의 실장에 의해 상기 유연 인쇄 회로 기판의 제2면 상에 형성되는 공간에 배치되도록 상기 유연 인쇄 회로 기판의 제2면에 배치되는 제2 자석;을 더 포함하는 웨어러블 전자 장치.","The wearable electronic device of claim 3, further comprising a second magnet disposed on the second surface of the flexible printed circuit board to be positioned in a space formed on the second surface of the flexible printed circuit board by mounting of the signal processing unit.",True,0.2905986607074737,0.8796568600584743,30,47,-17,117,284,-167
"제5항에 있어서,상기 제1 자석과 상기 제2 자석은,상기 제1 자석의 중심축과 상기 제2 자석의 중심축이 동일하게 배치되는 웨어러블 전자 장치.","The wearable electronic device of claim 4, wherein the first magnet and the second magnet are disposed so that a central axis of the first magnet is aligned with a central axis of the second magnet.",True,0.3051325678825378,0.8617581109946293,19,36,-17,80,198,-118
"제4항에 있어서,상기 제1 자석은,상기 제1 생체 신호 감지부의 발광부가 그 중심에 배치되도록 링 형태로 형성되는 웨어러블 전자 장치.","The wearable electronic device of claim 3, wherein the first magnet is formed in a ring shape to have the light-emitting unit of the first bio-signal sensing unit disposed at the center thereof.",True,0.2806366682052612,0.8807161956168654,18,33,-15,75,194,-119
"제4항에 있어서,상기 제1 생체 신호 감지부의 발광부가 광 차폐되도록 상기 제1 자석과 상기 커버 사이에 배치되어 상기 제1 자석과 상기 커버 사이를 기밀하는 광 기밀 부재;를 더 포함하는 웨어러블 전자 장치.","The wearable electronic device of claim 3, further comprising an optically shielding member disposed between the first magnet and the cover such that the light-emitting unit of the first bio-signal sensing unit is optically shielded, thereby shielding between the first magnet and the cover.",True,0.3934350609779358,0.8482495160410415,31,44,-13,117,291,-174
"제4항에 있어서,상기 제1 생체 신호 감지부의 수광부는,복수 개 마련되어 상기 제1 자석의 외주를 따라 배열되는 웨어러블 전자 장치.","The wearable electronic device of claim 3, wherein multiple light-receiving units of the first bio-signal sensing unit are arranged along the outer circumference of the first magnet.",True,0.4281144142150879,0.8202799952593709,18,27,-9,74,182,-108
"제1항에 있어서,상기 제2 생체 신호 감지부의 외부 전극은,제1 외부 전극과 제2 외부 전극을 포함하고,상기 제2 생체 신호 감지부의 내부 전극은,상기 제1 외부 전극과 전기적으로 연결되는 제1 내부 전극과 상기 제2 외부 전극과 전기적으로 연결되는 제2 내부 전극을 포함하고,상기 컨택부는 두 개 마련되어 상기 제1 내부 전극 및 제2 내부 전극과 각각 접촉되는 웨어러블 전자 장치.","The wearable electronic device of claim 1, wherein the external electrode of the second bio-signal sensing unit comprises a first external electrode and a second external electrode, wherein the internal electrode of the second bio-signal sensing unit comprises a first internal electrode electrically connected to the first external electrode and a second internal electrode electrically connected to the second external electrode, and wherein two of the contact units are connected to the first internal electrode and the second internal electrode, respectively.",True,0.1995187401771545,0.9304969564718932,55,81,-26,215,563,-348
"제1항에 있어서,상기 제2 생체 신호 감지부의 내부 전극은,상기 커버의 외주에서 상기 커버의 중심 방향으로 연장되어 형성되는 웨어러블 전자 장치.","The wearable electronic device of claim 1, wherein the internal electrode of the second bio-signal sensing unit extends from the outer circumference of the cover toward the center of the cover.",True,0.2802086472511291,0.8852476051400449,19,31,-12,81,193,-112
"제12항에 있어서,상기 광학 필름은,원형으로 형성되되, 외주의 일부에서 중심 방향으로 연장된 복수의 홈을 갖고,상기 제2 생체 신호 감지부의 내부 전극의 제1 내부 전극과 제2 내부 전극은 상기 광학 필름에 형성된 복수의 홈에 각각 배치되는 웨어러블 전자 장치.","The wearable electronic device of claim 9, further comprising an optical film attached to the cover, wherein the optical film is formed in a circular shape and has multiple grooves extending from a portion of the outer circumference toward the center thereof, and wherein the first internal electrode and the second internal electrode of the internal electrode of the second bio-signal sensing unit are arranged in the multiple grooves formed on the optical film, respectively.",False,0.3249783813953399,0.8716360349865901,36,75,-39,146,477,-331
"제14항에 있어서,상기 프로세서는,상기 제1 생체 신호 감지부가 제1 생체 신호를 주기적으로 감지하도록 제어하고,상기 제1 생체 신호 감지부가 감지한 제1 생체 신호와 설정값의 차이를 확인하고, 그 차이가 범위값을 벗어나는 경우 상기 제2 생체 신호 감지부가 제2 생체 신호를 감지하도록 하는 웨어러블 전자 장치.","The wearable electronic device of claim 1, wherein the processor controls the first bio-signal sensing unit to periodically sense a first bio-signal, checks a difference between the first bio-signal sensed by the first bio-signal sensing unit and a predetermined value, and when the difference is out of a range value, causes the second bio-signal sensing unit to sense a second bio-signal.",True,0.2625043988227844,0.8921542804930831,42,61,-19,175,390,-215
"제14항에 있어서,상기 프로세서는,상기 디스플레이에 입력되는 터치 입력에 기반하여 상기 제1 생체 신호 감지부가 제1 생체 신호를 감지하도록 제어하고,상기 제1 생체 신호 감지부가 감지한 제1 생체 신호와 설정값의 차이를 확인하고, 그 차이가 범위값을 벗어나는 경우 상기 제2 생체 신호 감지부가 제2 생체 신호를 감지하도록 하는 웨어러블 전자 장치.","The wearable electronic device of claim 1, wherein the processor controls the first bio-signal sensing unit to sense a first bio-signal, based on a touch input input through the display, checks a difference between the first bio-signal sensed by the first bio-signal sensing unit and a predetermined value, and when the difference is out of a range value, causes the second bio-signal sensing unit to sense a second bio-signal.",True,0.2542941570281982,0.9005968571869553,47,69,-22,196,427,-231
"제14항에 있어서,상기 전자 장치는,외부 전자 장치와 통신을 수행하는 통신 모듈;을 더 포함하고,상기 프로세서는,상기 통신 모듈이 수신하는 외부 전자 장치로부터의 제1 생체 신호 감지 요청에 기반하여 상기 제1 생체 신호 감지부가 제1 생체 신호를 감지하도록 제어하고,상기 제1 생체 신호 감지부가 감지한 제1 생체 신호와 설정값의 차이를 확인하고, 그 차이가 범위값을 벗어나는 경우 상기 제2 생체 신호 감지부가 제2 생체 신호를 감지하도록 하는 웨어러블 전자 장치.","The wearable electronic device of claim 1, further comprising a communication module configured to perform communication with an external electronic device, wherein the processor controls the first bio-signal sensing unit to sense a first bio-signal, based on a request for sensing a first bio-signal, received by the communication module from an external electronic device, checks a difference between the first bio-signal sensed by the first bio-signal sensing unit and a predetermined value, and when the difference is out of a range value, causes the second bio-signal sensing unit to sense a second bio-signal.",True,0.2626419365406036,0.9005252850428058,64,93,-29,262,615,-353
"전자 장치를 조립하는 동작에 있어서,커버 상에 링 형태의 무선 충전용 코일을 배치하는 동작; 및상기 무선 충전용 코일의 내주에 유연 인쇄 회로 기판을 배치하는 동작;을 포함하고,상기 유연 인쇄 회로 기판을 배치하는 동작은,한쪽 말단이 상기 유연 인쇄 회로 기판에 실장되고 상기 커버로 연장되는 컨택부를 상기 커버에 형성된 내부 전극과 접촉되도록 하는 웨어러블 전자 장치의 조립 방법.","A method for assembling a wearable electronic device, the method comprising: disposing a wireless charging coil having a ring shape on a cover; and disposing a flexible printed circuit board on the inner circumference of the wireless charging coil, wherein in the disposing of the flexible printed circuit board, a contact unit is brought into contact with an internal electrode formed on the cover such that the contact unit extends to the cover with one end of the contact unit mounted on the flexible printed circuit board.",False,0.1957340240478515,0.9118517962296596,54,87,-33,214,526,-312
"또한, 제안된 설계 변경에서 루프 인덕턴스의 증가는 발견되지 않았다.]","Additionally, the proposed design change has not been found to have any increase in the loop inductance.",True,0.1811742186546325,0.8684314554421092,9,17,-8,39,104,-65
[이 접근 방식은 임베디드 칩 기술을 사용하여 제작된 모듈 및 PQFN 패키지와 같은 리드프레임 기반 기술에 적합하다.],This approach is suitable for modules fabricated using embedded chip technologies and for leadframe-based technologies such as PQFN like packages.,True,0.1764755696058273,0.8787789838320802,17,20,-3,67,146,-79
[추가적인 프로세스 단계나 모듈의 기본 구조에 대한 변경 없이 2차 전류 경로가 제공될 수 있다.,The secondary current path can be provided without any additional process steps or changes to the basic structure of the module.,True,0.1979450583457946,0.8564759368171602,15,21,-6,54,128,-74
"설계에 따라, 전류 흐름에 대한 2차 전류 경로가 다른 층에 형성될 수 있다.","Depending on the design, the secondary current path for the current flow can be formed in different layers.",True,0.2063688188791275,0.8609876025190213,13,18,-5,43,107,-64
한 가지 옵션은 1차 전류 경로와 동일한 층에서 2차 전류 경로를 라우팅하는 것이다.,One option is to route the secondary current path in same layer as the primary current path.,True,0.1931358277797699,0.8714508530922688,13,17,-4,47,92,-45
"동일한 층에서 두 경로 모두에 대한 라우팅을 제공하기에 공간이 충분하지 않은 경우, 라우팅은 1차 전류 경로 위의 층에서 또는 1차 전류 경로 아래의 층, 예컨대 임베디드 칩 패키지의 코어 층 또는 다이 반대편의 층에서 적어도 부분적으로 수행될 수도 있다.","If there is insufficient space to provide the routing for both paths in the same layer, the routing can also be done at least partially in the layer above the primary current path or in the layer under the primary current path, for example in core layer of an embedded chip package or on the layers on opposite sides of the die.",True,0.1814980953931808,0.8876695252250361,39,62,-23,143,328,-185
모듈 및 모듈을 사용하는 시스템의 성능과 신뢰성이 모두 향상된다.,Both performance and reliability of the module and the system is which it is used are improved.,True,0.2058264315128326,0.8419062877592104,9,17,-8,36,95,-59
"또한, 모듈 풋프린트를 변경할 필요가 없다.","Additionally, there is no need to change the module footprint.",True,0.1575886011123657,0.885619705536351,6,10,-4,24,62,-38
"파워 스테이지의 전기적 성능, 특히 전기 저항 감소로 인한 효율성 증가가 제공된다.]","The electrical performance of power stages, in particular an increase of efficiency as a result of reduction of electrical resistance, is provided.",True,0.1559564024209976,0.8837878131764934,12,22,-10,47,147,-100
[도 1은 일 실시예에 따른 반도체 모듈(10)의 개략적인 평면도이다.,Figure 1 illustrates a schematic plan view of a semiconductor module 10 according to an embodiment.,True,0.2466162592172622,0.8366748988053485,9,16,-7,39,99,-60
"반도체 모듈(10)은 Q2로도 표시되는 로우측 스위치(11), Q1으로도 표시되는 하이측 스위치(12), 및 DR로도 표시되는 제어 칩(13)을 포함한다.","The semiconductor module 10 comprises a low side switch 11, also indicated with Q2, a high side switch 12, also indicated as Q1, and a control chip 13, also indicated by DR. The low side switch 11 and the high side switch 12 are layer arranged laterally adjacent one another and are coupled by a switch node connector 14 to form a half bridge circuit.",False,0.3613958060741424,0.8156292702986175,16,65,-49,86,351,-265
로우측 스위치(11)와 하이측 스위치(12)는 횡방향으로 서로 인접하게 배열된 층이며 스위치 노드 커넥터(14)에 의해 결합되어 하프 브리지 회로를 형성한다.,"The switch node connector 14 comprises two branches 15, 16 that have an arrangement with respect the low side switch 11 and to the high side switch 12 and which each have a cross-sectional area A1, A2, respectively.",False,0.6289748549461365,0.6962718818525876,18,38,-20,88,215,-127
"스위치 노드 커넥터(14)는 2개의 브랜치(15, 16)를 포함하고, 이들 2개의 브랜치는 로우측 스위치(11) 및 하이측 스위치(12)에 대한 배열을 가지며 단면적 A1, A2를 각각 갖는다. 2개의 브랜치(15, 16)의 배열 및 단면적 A1, A2는 스위치 노드 커넥터(14) 내의 전류 밀도 분포를 균일화하도록 선택된다.","The arrangement and the cross-sectional area A1, A2 of the two branches 15, 16 are selected so as to homogenise the current density distribution within the switch node connector 14.",False,0.4264715313911438,0.7863398130944811,40,30,10,183,181,2
"스위치 노드 커넥터(14)는, 도 1에서 화살표(17)로 표시된 바와 같이 하이측 스위치(12)와 로우측 스위치(11) 사이에 전류를 운반하는데 사용된다.]","The switch node connector 14 is used to carry current between the high side switch 12 and the low side switch 11, as is indicated in figure 1 by the arrows 17.",True,0.1535979658365249,0.921134546236262,17,32,-15,87,159,-72
"[브랜치(15, 16)의 배열은 모듈(10) 내에서의 횡방향 형상 및 라우팅, 예를 들어 브랜치가 로우측 스위치(11)와 하이측 스위치(12) 사이에 직접 경로 또는 간접 경로를 갖는지 여부를 포함하고, 결과적으로, 이들의 길이 및 로우측 스위치(11) 및 하이측 스위치(12)의 위치와 관련한 모듈(10) 내에서의 이들의 위치, 예컨대 로우측 스위치(11) 및 하이측 스위치(12)에 대한 각 브랜치(15, 16)의 두 단부의 위치를 포함한다.]","The arrangement of the branches 15, 16 includes their lateral shape and routing within the module 10, for example whether a branch has a direct route or an indirect route between the low side switch 11 and the high side switch 12 and, consequently, their length, as well as their position within the module 10 in relation to the position of the low side switch 11 and high side switch 12, e.g. the position of the two ends of each branch 15, 16 with respect to the low side switch 11 and high side switch 12.",True,0.1894577145576477,0.9097906646005226,54,96,-42,250,508,-258
"[도 1에 도시된 반도체 모듈(10)에서, 로우측 스위치(11) 및 하이측 스위치(12)는 각각 대략 직육면체 형태를 가지며 횡방향으로 서로 인접하게 배열되고 서로 이격되어 L 형상을 이룬다.","In the semiconductor module 10 illustrated in figure 1, the low side switch 11 and the high side switch 12 each have a substantially cuboid form and are arranged laterally adjacent one another and spaced apart from one another to form an L-shape.",True,0.189792513847351,0.8991804206207601,24,43,-19,107,246,-139
"로우측 스위치(11)의 장변(28) 및 하이측 스위치의 장변(29)은, 서로에 대해 실질적으로 수직인 모듈(10)의 두 인접 변(18)에 대해 실질적으로 평행하다.",A long side 28 of the low side switch 11 and a long side 29 of the high side switch are substantially parallel to two adjoining sides 18 of the module 10 which are substantially perpendicular to one another.,True,0.230749249458313,0.8767619280705754,18,39,-21,91,207,-116
이 L 형상은 로우측 스위치(11)와 하이측 스위치(12)의 상호 비대칭 배열로 생각할 수 있다.,This L shape may be thought of as a mutually asymmetric arrangement of the low side switch 11 and high side switch 12.,True,0.201183408498764,0.8838600384186922,13,23,-10,54,118,-64
"추가 조치를 취하지 않으면, 서로 마주하는 로우측 스위치(11)와 하이측 스위치(12)의 측면(26, 26')에 바로 인접한 영역(19) 내의 스위치 노드 커넥터(14)의 전류 밀도는, 이 경계로부터 더 멀리, 예컨대, 도 1에서 타원(19, 20)으로 개략적으로 표시된 바와 같이, 로우측 스위치(11)의 반대 측면(27) 및 하이측 스위치(12)의 반대 측면(27')에 위치하는 스위치 노드 커넥터(14)의 영역(20)에서보다 훨씬 더 높을 것이다.]","Without taking further measures, the current density in the switch node connector 14 in the regions 19, which are directly adjacent the side faces 26, 26' of the low side switch 11 and high side switch 12 which face one another, would be much higher than in regions 20 of the switch node connector 14 which are positioned further from this border, for example, at the opposing side face 27 of the low side switch 11 and the opposing side face 27' of the high side switch 12, as is indicated schematically in figure 1 by the ellipses 19, 20.",True,0.1963802725076675,0.901328162226722,52,100,-48,254,540,-286
"[최대 전류 밀도 영역(19)과 최소 전류 밀도 영역(20) 사이의 차이가 감소되거나 심지어 제거되도록, 전류를 균일화하고 스위치 노드 커넥터(14) 내에 보다 균일한 전류 밀도 분포를 제공하기 위해, 스위치 노드 커넥터(14)에 물리적으로 서로 분리된 2개의 브랜치(15, 16)가 제공되며, 따라서 하이측 스위치(12)와 로우측 스위치(11) 사이에 전류를 운반하기 위한 2개의 개별 경로(17)를 제공한다.","In order to homogenise the current and provide a current density distribution within the switch node connector 14 which is more uniform such that the difference between the maximum current density regions 19 and minimum current density regions 20 is reduced or even eliminated, the switch node connector 14 is provided with two branches 15, 16 which are physically separate from one another and therefore provide two separate paths 17 for carrying the current between the high side switch 12 and the low side switch 11.",True,0.188164472579956,0.9090909740050576,49,86,-37,230,519,-289
"제1 브랜치(15)에 의해 제공되는 더 높은 전류 밀도 영역들(19) 사이의 경로(17)는 1차 경로로 표시될 수 있고, 제2 브랜치(16)에 의해 제공되는 경로(17)는 2차 경로로 표시될 수 있다.]",The path 17 between the higher current density regions 19 provided by the first branch 15 may be denoted the primary path and the path 17 provided by the second branch 16 may be denoted as the secondary path.,True,0.162831038236618,0.9116161976372574,26,39,-13,113,208,-95
"[도 1에 도시된 실시예에서, 제어 칩(13)은 로우측 스위치(11) 및 하이측 스위치(12)의 긴 변에 인접하지만 이격되게 위치하도록 로우측 스위치(11) 및 하이측 스위치(12)에 횡방향으로 인접하게 위치한다.","In the embodiment illustrated in figure 1, the control chip 13 is positioned laterally adjacent the low side switch 11 and high side switch 12 such that it is positioned adjacent and spaced apart from the long sides of the switching low side switch 11 and high side switch 12.",True,0.2175949811935424,0.8916861183289276,24,50,-26,119,276,-157
스위치 노드 커넥터(14)의 제1 브랜치(15)는 제어 칩(13)의 한 측면에 인접하게 연장되고 제2 브랜치(16)는 제어 칩(13)의 2개의 대향 측면 에지 둘레로 연장된다.],The first branch 15 of the switch node connector 14 extends adjacent one side of the control chip 13 and the second branch 16 extends around the two opposing side edges of the control chip 13.,True,0.1501430869102478,0.9285644812256342,21,36,-15,99,192,-93
"[스위치 노드 커넥터(14)는 로우측 스위치(11) 상에 배열된 제1 부분(21) 및 하이측 스위치(12) 상에 배열된 제2 부분(22)을 포함한다. 2개의 브랜치(15, 16)는 제1 부분(21)과 제2 부분(22) 사이에서 연장되며, 따라서 스위치 노드 커넥터(14)는 물리적으로 분리된 브랜치(15, 16)에 의해 제공된 별도의 경로에 의해 결합되는 말단부(21, 22)를 갖는다.","The two branches 15, 16 extend between the first portion 21 and the second portion 22 such that the switch node connector 14 has distal ends 21, 22 that are coupled by separate paths provided by the physically separate branches 15, 16.",False,0.3877727687358865,0.8167885420232974,43,42,1,216,235,-19
"이 실시예에서, 제1 브랜치(15) 및 제2 브랜치(16)는, 제어 칩(13)이 스위치 노드 커넥터(14)에 의해 덮이지 않도록 제어 칩(13) 둘레로 연장된다.]","In this embodiment, the first branch 15 and the second branch 16 extend around the periphery of the control chip 13 so that the control chip 13 is uncovered by the switch node connector 14.",True,0.1904034167528152,0.9068010201008664,19,35,-16,91,189,-98
[제1 브랜치(15)는 2개의 더 높은 전류 밀도 영역(19) 사이에서 연장되고 제2 브랜치(16)는 2개의 더 낮은 전류 밀도 영역(20) 사이에서 연장된다.,The first branch 15 extends between the two higher current density regions 19 and the second branch 16 extends between the two lower current density regions 20.,True,0.1449442207813263,0.9233654771761404,20,27,-7,89,160,-71
"이 실시예에서, 제2 브랜치(16)는 제1 브랜치(15)의 단면적(A1)보다 더 작은 단면적(A2)을 갖는다.","In this embodiment, the second branch 16 has a cross-sectional area A2 which is smaller than the cross-sectional area A1 of the first branch 15.",True,0.1729688197374344,0.9079876176964844,11,25,-14,61,144,-83
"두 브랜치(15, 16)의 단면적(A1, A2)과 각 브랜치(15, 16)의 단면적(A1/A2) 사이의 비율은, 로우측 스위치(11) 및 하이측 스위치(12) 바로 위에 위치하는 제1 및 제2 부분(21, 22)뿐만 아니라 2개의 브랜치(15, 16) 내의 전류 밀도를 균일화하도록 선택될 수 있다.","The cross-sectional area A1, A2 of the two branches 15, 16 and the ratio between the cross-sectional areas A1/A2 of each of branches 15, 16 may be selected so as to homogenise the current density within the two branches 15, 16 as well as in the first and second portions 21, 22 which are positioned directly on the low side switch 11 and high side switch 12.",True,0.1771640628576278,0.9126614628775634,35,67,-32,167,358,-191
"대안적으로 또는 추가로, 제2 브랜치(16)는 제1 브랜치(15)의 길이보다 긴 길이를 갖는다.]","Alternatively, or in addition, the second branch 16 has a length which is greater than a length of the first branch 15.",True,0.1493677198886871,0.9112995498209372,11,22,-11,54,119,-65
"[일부 실시예에서, 로우측 스위치(11) 및 하이측 스위치는 각각 수직 드리프트 경로를 갖는 수직 트랜지스터 소자인 트랜지스터 소자에 의해 제공된다.","In some embodiments, the low side switch 11 and the high side switch are each provided by a transistor device which is a vertical transistor device having a vertical drift path.",True,0.1945525407791137,0.8904130758885787,19,31,-12,83,177,-94
"수직 트랜지스터 소자에서, 드레인 전극은 후면의 드레인 영역에 의해 형성된다.","In a vertical transistor device, the drain electrode is formed by a drain region at the rear surface.",True,0.239306554198265,0.8314713281889186,10,18,-8,43,101,-58
소스 전극과 게이트 전극은 반대편 전면에 형성된다.,The source electrode and gate electrode are formed at the opposing front surface.,True,0.1748014092445373,0.8746794835157936,7,13,-6,28,81,-53
"트랜지스터 소자는 MOSFET(Metal Oxide Semiconductor Field Effect Transistor) 소자, IGBT(Insulated Gate Bipolar Transistor) 소자 또는 BJT(Bipolar Junction Transistor)일 수 있다.]","The transistor device may be a MOSFET (Metal Oxide Semiconductor Field Effect Transistor) device, an insulated gate bipolar transistor (IGBT) device or a Bipolar Junction Transistor (BJT).",True,0.0942533016204834,0.9424030431218212,20,27,-7,158,188,-30
"[트랜지스터 소자의 전극 또는 단자는 여기에서 소스, 드레인 및 게이트로 지칭된다.","The electrodes or terminals of the transistor device are referred to herein as source, drain and gate.",True,0.2182748764753341,0.8482742264912879,11,17,-6,46,102,-56
"본 명세서에 사용된 바와 같이, 이들 용어는 또한 절연 게이트 바이폴라 트랜지스터(IGBT)와 같은 다른 유형의 트랜지스터 소자의 기능적으로 등가인 단자를 포함한다.","As used herein, these terms also encompass the functionally equivalent terminals of other types of transistor devices, such as an insulated gate bipolar transistor (IGBT).",True,0.1774990856647491,0.8897779999953046,21,25,-4,92,171,-79
"예를 들어, 여기서 사용된 ""소스""란 용어는 MOSFET 소자 및 초접합 소자의 소스뿐만 아니라 절연 게이트 바이폴라 트랜지스터(IGBT) 소자의 에미터 및 바이폴라 접합 트랜지스터(BJT)의 에미터도 포함하고, ""드레인""이란 용어는 MOSFET 소자 또는 초접합 소자의 드레인뿐만 아니라 절연 게이트 바이폴라 트랜지스터(IGBT) 소자의 콜렉터 및 BJT 소자의 콜렉터도 포함하며, ""게이트""란 용어는 MOSFET 소자 또는 초접합 소자의 게이트뿐만 아니라 절연 게이트 바이폴라 트랜지스터(IGBT) 소자의 게이트와 BJT 소자의 베이스도 포함한다.]","For example, as used herein, the term ""source"" encompasses not only a source of a MOSFET device and of a superjunction device but also an emitter of an insulator gate bipolar transistor (IGBT) device and an emitter of a Bipolar Junction Transistor (BJT) device, the term ""drain"" encompasses not only a drain of a MOSFET device or of a superjunction device but also a collector of an insulator gate bipolar transistor (IGBT) device and a collector of a BJT device, and the term ""gate"" encompasses not only a gate of a MOSFET device or of a superjunction device but also a gate of an insulator gate bipolar transistor (IGBT) device and a base of a BJT device.",True,0.1763005852699279,0.8954175860179961,64,117,-53,309,657,-348
[스위치 노드 커넥터(14)는 로우측 스위치(11)의 드레인 패드(23)와 하이측 스위치(12)의 소스 패드(24) 사이에서 연장되어 로우측 스위치(11)와 하이측 스위치(12)를 직렬로 연결한다.,The switch node connector 14 extends between a drain pad 23 of the low side switch 11 and a source pad 24 of the high side switch 12 to connect the low side switch 11 and the high side switch 12 in series.,True,0.1935951262712478,0.9024129203067242,19,43,-24,110,205,-95
"결과적으로, 스위치 노드 커넥터(14)의 제1 부분(21)은 드레인 패드(23) 상에 위치하고, 제2 부분(22)은 소스 패드(24) 상에 위치하며, 2개의 브랜치(15, 14)는 모듈(10) 내에서 로우측 스위치(11)의 드레인 패드(23)와 하이측 스위치(12)의 소스 패드(24) 사이에서 연장된다.]","Consequently, the first portion 21 of the switch node connector 14 is positioned on the drain pad 23, the second portion 22 is positioned on the source pad 24 and the two branches 15, 14 extend between the drain pad 23 of the low side switch 11 and the source pad 24 of the high side switch 12 and within the module 10.",True,0.1425480395555496,0.933684801182317,31,63,-32,171,319,-148
"[일부 실시예에서, 스위치 노드 커넥터(14)는 제1 브랜치(15) 및 제2 브랜치(16)를 형성하는 적어도 하나의 개구(25)를 포함하는 전도성 층의 형태를 갖는다.","In some embodiments, the switch node connector 14 has the form of a conductive layer which comprises at least one aperture 25 in order to form the first branch 15 and the second branch 16.",True,0.1472012847661972,0.9267712937604984,19,35,-16,93,188,-95
"도 1에 도시된 실시예에서, 개구(25)는 횡방향 크기 및 형상을 가지며 제어 칩(13)이 개구(25) 내에 완전히 위치하도록 배치된다.","In the embodiment illustrated in figure 1, the aperture 25 has a lateral size and shape and is positioned such that the control chip 13 is positioned entirely within the aperture 25.",True,0.1562212407588958,0.9092883225295376,17,32,-15,76,182,-106
"전도성 층 형태의 스위치 노드 커넥터(14)는, 임베디드 칩 기술에 기반하며 로우측 스위치(11), 하이측 스위치(12) 및 제어 칩(13)이 절연층 내에 내장되고 횡방향으로 서로 인접한 공통 절연층 내에 배열된 적층 구조를 갖는 반도체 모듈에 유용하게 사용될 수 있다.]","A switch node connector 14 in the form of the conductive layer may be usefully used in semiconductor modules having based on embedded chip technology and having a laminated structure in which the low side switch 11, high side switch 12 and control chip 13 are embedded within an insulating layer and arranged within the common insulating layer laterally adjacent one another.",True,0.2267588376998901,0.8852318803660445,36,62,-26,152,375,-223
"[일부 실시예에서, 스위치 노드 커넥터(14)는, 물리적으로 서로 이격된 제1 브랜치(15) 및 제2 브랜치(16)를 형성하는 적어도 하나의 개구(25)를 포함하는 접촉 클립의 형태를 갖는다.","In some embodiments, the switch node connector 14 has the form of the contact clip which comprises at least one aperture 25 to form the first branch 15 and the second branch 16 that are physically spaced apart from one another.",True,0.1523387283086776,0.922797909194234,22,41,-19,107,227,-120
"접촉 클립 형태의 스위치 노드 커넥터(14)는, 예를 들어 리드프레임 기반 기술을 사용하는 반도체 모듈에 유용할 수 있다.]","A switch node connector 14 in the form of a contact clip may be useful for semiconductor modules using a leadframe-based technology, for example.",True,0.1706475764513015,0.9029280979939672,17,24,-7,69,145,-76
[도 2는 일 실시예에 따른 반도체 모듈(30)의 개략적인 평면도이다.,Figure 2 illustrates a schematic plan view of a semiconductor module 30 according to an embodiment.,True,0.220772311091423,0.8551472952396391,9,16,-7,39,99,-60
이 실시예는 제어 칩(13)의 위치와 관련하여 스위치 노드 커넥터(14)의 제2 브랜치(16)의 위치가 변한다.,This embodiment varies in the position of the second branch 16 of the switch node connector 14 in relation to the position of the control chip 13.,True,0.151781752705574,0.9219551770151336,13,27,-14,62,146,-84
"이 실시예에서, 도 1을 참조하여 설명된 실시예에서와 같이 모듈(20)의 대각으로 반대편의 코너에 위치하며 저밀도 영역(20)에 인접한 로우측 스위치(11) 및 하이측 스위치(12)의 측면들(27, 27') 사이에서 연장되는 L자형 제2 브랜치(16)가 제공된다.","In this embodiment, an L-shaped second branch 16 is provided that extends between the side faces 27, 27' of the low side switch 11 and high side switch 12 that are positioned in diagonally opposing corners of the module 20 and adjacent the low density regions 20 as in the embodiments described with reference to figure 1.",True,0.2343078106641769,0.8883629134060285,29,57,-28,147,322,-175
"제2 브랜치(16) 및 스위치 노드 커넥터(14)는, 제어 칩(13)의 코너만 제2 브랜치(16) 및 스위치 노드 커넥터(14)에 의해 덮이지 않은 채로 남고 스위치 노드 커넥터(14) 및 특히 제2 브랜치(16)는 제어 칩(13)과 부분적으로 겹치도록, 제어 칩(13)의 두 인접한 가장자리 위에 부분적으로 위치한다.","The second branch 16 and, therefore, the switch node connector 14 is positioned partly above two adjoining edges of the control chip 13 such that only a corner of the control chip 13 remains uncovered by the second branch 16 and the switch node connector 14 and such that the switch node connector 14 and, in particular, the second branch 16 partially overlaps with control chip 13.",True,0.198180079460144,0.9089349036916488,39,67,-28,178,382,-204
스위치 노드 커넥터(14) 내의 개구(25)는 제어 칩(13) 영역의 일부분 위에만 위치한다.,The aperture 25 in the switch node connector 14 is positioned above only a part of the area of the control chip 13.,True,0.1650760322809219,0.9070977943354558,11,23,-12,52,115,-63
"이 실시예에서, 제2 브랜치(16)는 도 1에 도시된 실시예에서보다 더 큰 단면적(A2)을 갖는 것으로 도시된다.","In this embodiment, the second branch 16 is illustrated as having a larger cross-sectional area A2 than in the embodiment illustrated in figure 1.",True,0.1678359657526016,0.9011603109345676,14,24,-10,63,146,-83
"CHP(사이클로-히스프로) 및 부갑상선 호르몬을 포함하는 골 손실 질환의 예방, 개선 또는 치료용 조성물 {COMPOSITION COMPRISING CHP (CYCLO-HIS PRO) AND PTH FOR PREVENTING, IMPROVING OR TREATING OF BONE LOSS RELATED DISEASE}","The present invention relates to a use of a composition including cyclo(hispro) (CHP) and parathyroid hormone (PTH) for preventing, improving or treating a bone loss-related disease.",False,0.4063589870929718,0.7947527722525667,30,26,4,178,182,-4
"본 발명은 CHP(사이클로-히스프로) 및 부갑상선 호르몬을 포함하는 골 손실 질환의 예방, 개선 또는 치료용 조성물에 관한 것으로, 보다 상세하게는 CHP 또는 이의 약학적으로 허용가능한 염; 및 부갑상선 호르몬을 포함하는 골 손실 질환의 예방 또는 치료용 약학적 조성물, CHP 또는 이의 식품학적으로 허용가능한 염; 및 부갑상선 호르몬을 포함하는 골 손실 질환의 예방 또는 개선용 건강기능식품 조성물, CHP 또는 이의 약학적으로 허용가능한 염을 포함하는 부갑상선 호르몬의 골 손실 질환의 치료 효과 증진용 약학적 조성물, 및 CHP 또는 이의 식품학적으로 허용가능한 염을 포함하는 부갑상선 호르몬의 골 손실 질환의 개선 효과 증진용 건강기능식품 조성물을 제공한다.",[Background Art],False,1.3014099597930908,0.1576163565126425,91,2,89,374,16,358
"뼈의 발생, 성장 및 대사과정에는 뼈의 형성(bone modeling)과 재형성(remodeling) 과정이 중요한 역할을 한다.","Bone modeling and remodeling play an important role in osteogenesis, and bone growth and metabolism.",True,0.2097130566835403,0.8613971280478792,13,15,-2,72,100,-28
뼈의 형성은 태생기부터 시작하여 이후 골격이 성숙되어 성장이 끝나는 청장년기까지 지속되어 20대에서 30대 초반까지 최대 골량을 형성하게 된다.,"Bone modeling starts from an embryonic stage and continues until adolescence and manhood, in which skeletal maturation occurs and thus its growth stops, and the maximum bone mass is formed between the twenties and early thirties.",True,0.2290809005498886,0.8382420600020518,18,36,-18,80,229,-149
이후 약 30년 동안은 뼈를 제거하고 다시 이를 보충하는 골재형성 과정을 반복하게 되는데 이때는 골형성과 골흡수가 서로 짝을 이루어 균형을 유지하게 된다.,"Afterward, for about 30 years, a bone remodeling process for removing bone and replenishing it is repeated, and at this time, bone formation and bone resorption work as a pair to maintain balance.",True,0.1251653581857681,0.9167729226002482,22,33,-11,86,196,-110
"이 시기가 지난 후에는 골 흡수에 따른 골소실을 골형성이 충분히 따라갈 수 없어 결국 연 0.3 ~ 0.5 % 정도의 골량 감소를 겪게 되며, 특히 여성의 경우에는 폐경 초기에 연 2 ~ 3 %의 상당한 골손실을 겪게 된다.","After this period, bone formation cannot sufficiently catch up with bone loss induced by bone resorption, resulting in a decrease in bone mass of about 0.3 to 0.5% per year, and specifically, women have a considerable bone loss of 2 to 3% per year in early menopause.",True,0.1268250346183776,0.9138410792212184,38,47,-9,125,267,-142
"골 조직은 연골과 골격계를 구성하며 기계적 기능으로 지지와 근 부착의 역할을 하고, 생체기관 및 골수를 보호하는 기능을 하며, 칼슘과 인 이온의 항상성 유지를 위해 이들을 보존하는 기능을 담당한다.","Bone tissue constitutes the cartilage and the skeletal system, and serves as support and muscle attachment as mechanical functions, functions to protect organs and bone marrow, and conserve calcium and phosphorous ions to maintain the homeostasis thereof.",True,0.1494892984628677,0.9072508949724022,28,37,-9,110,255,-145
"골 조직은 교원질, 당단백질과 같은 세포 기질과 조골세포(골아세포; osteoblast), 파골세포 및 골세포 등 여러 종류의 세포들로 이루어진다.","Bone tissue is composed of a cell matrix such as collagen and a glycoprotein, and several types of cells such as osteoblasts, osteoclasts and osteocytes.",True,0.1987295746803283,0.877762583681461,17,25,-8,82,153,-71
"또한, 골조직은 조골세포에 의해 형성되고 파골세포에 의해 파괴 흡수가 끊임없이 반복되는 동적인 조직으로, 골다공증은 조골세포와 파골세포의 평형이 무너져 골 흡수가 골 형성보다 항진됨으로서 유발되는 질병으로, 골조직의 석회가 감소되어 뼈의 치밀질이 엷어지고 그로 인해 골수강이 넓어지게 되며, 증세가 진전됨에 따라 뼈가 약해지기 때문에 작은 충격에도 골절되기 쉽다.","Osteoporosis is a disease caused by an increase in bone resorption compared to bone formation due to an imbalance of osteoblasts and osteoclasts, and as the calcification of bone tissue is reduced, the density of a bone is lowered and thus the bone marrow cavity is widened, and according to the progression of symptoms, the bone becomes weaker, so it is easy to fracture even with a small impact.",False,0.3796235024929046,0.777133077021261,46,69,-23,203,397,-194
"골다공증은 그 증세 자체보다는 골의 약화에 따라 용이하게 초래되는 각종 골절, 특히 대퇴골 골절 또는 척추골절 등이 장기간 활동을 제한하여 건강한 생활 을 영위할 수 없고, 결과적으로 노인층 사망의 15%에 대한 원인제공을 하는 것으로 알려져 있다.","For osteoporosis, various fractures, particularly, femoral fractures or vertebral fractures, easily caused by the weakening of bones, rather than the symptoms themselves restrict activities for a long time, making it impossible to have a healthy life, so it accounts for 15% of deaths of the elderly.",True,0.2884612083435058,0.822542011881637,36,46,-10,139,300,-161
"골량은 유전적 요인, 영양 섭취, 호르몬의 변화, 운동 및 생활 습관의 차이 등 여러 가지 요인들에 의해 영향을 받으며, 골다공증의 원인으로는 노령, 운동 부족, 저체중, 흡연, 저칼슘 식이, 폐경, 난소 절제 등이 알려져 있다.","Bone mass is affected by several factors such as genetic factors, nutritional intake, hormonal changes, differences in exercise and lifestyle, and as the cause of osteoporosis, aging, the lack of exercise, a low body weight, smoking, a low-calcium diet, menopause, and ovarian resection are known.",True,0.1726835519075393,0.8850342389990306,34,45,-11,128,297,-169
"특히 여성의 경우 30세 이후부터 골 감소가 지속적으로 진행되며, 폐경기에 이르면 호르몬 변화에 의해 골 감소가 급격히 진행된다.","Particularly, in women, bone loss consistently progresses after the age of 30, and dramatically progresses due to hormonal changes when women reach menopause.",True,0.1639316529035568,0.8877959391147343,18,23,-5,72,158,-86
"이와 같이 골다공증은 정도에 차이는 있으나 노년층, 특히 폐경기 이후의 여성에게 있어서는 피할 수 없는 증상으로, 선진국에서는 인구가 노령화됨에 따라 골다공증 및 그 치료제에 대한 관심이 점차 증가되고 있다.","As such, osteoporosis is an unavoidable symptom, although there is a difference in severity, shown in the elderly, especially postmenopausal women, and as populations are aging in developed countries, interest in osteoporosis and its therapeutic agents is gradually increasing.",True,0.2966936230659485,0.8000074723577649,29,39,-10,116,277,-161
"또한 전 세계적으로 골질환 치료와 관련되어 약 1300억 달러의 시장이 형성되어 있는 것으로 알려져 있으며 앞으로 더 증가할 것으로 예상되기 때문에, 세계적인 각 연구 기관과 제약회사에서는 골질환 치료제 개발에 많은 투자를 하고 있고 현재 골흡수 억제제의 개발이 활발히 진행되고 있다.","In addition, it is known that there is a global osteoporosis treatment-related market of about 130 billion dollars, and is expected to be bigger in the future, world-class research institutes and pharmaceutical companies are investing greatly in the development of therapeutic agents for osteoporosis, and the development of bone resorption inhibitors is being actively developed.",True,0.2337741553783416,0.8501929713756816,40,55,-15,159,380,-221
최근 부갑상선 호르몬(PTH)은 대중적인 골다공증 치료제로 부상하였다.,"Recently, parathyroid hormone (PTH) has emerged as a popular therapeutic agent for osteoporosis.",True,0.1816742569208145,0.8856261176652479,7,13,-6,39,96,-57
"골 흡수(bone resorption)를 감소시키는 다른 요법들과는 달리, PTH는 골 질량을 증가시켜, 골 밀도(bone mineral density: BMD)를 더 증가시킨다.","Unlike other therapies for reducing bone resorption, PTH increases bone mass, and further increases bone mineral density (BMD).",True,0.1191325336694717,0.9336626554991544,18,18,0,100,127,-27
PTH는 뼈에 직간접으로 다중 작용을 한다.,PTH has multiple direct and indirect effects on bones.,True,0.1801608353853225,0.8870805547402507,6,9,-3,24,54,-30
PTH는 뼈에서 혈액 내로 칼슘 방출율을 증가시킨다.,PTH increases the rate of calcium release from the bones into the blood.,True,0.1419067680835724,0.913166955501504,7,13,-6,29,72,-43
PTH의 만성 효과는 조골세포(osteoblast) 및 파골세포(osteoclast) 양쪽 모두의 골 세포들의 숫자를 증가시켜 재형성 골(remodeling bone)을 증가시키는 것이다.,The chronic effect of PTH is increasing bone remodeling by increasing the number of osteocytes including osteoblasts and osteoclasts.,True,0.2601662576198578,0.8578124108331809,17,19,-2,105,133,-28
"골다공증 환자들에게 투여된 PTH는 특히, 척추 및 고관절부 내의 지주골(trabecular bone) 내에서 골 형성의 망 자극(net stimulation)을 일으켜 골절을 상당히 감소시킨다.","PTH administered to osteoporotic patients significantly reduces fractures by net stimulation of bone formation, particularly, in the trabecular bone in the spine and hip joints.",True,0.171937808394432,0.9003321575025065,21,25,-4,109,177,-68
골 형성은 조골세포들이 PTH 수용체들을 가지듯이 PTH에 의한 조골세포들의 자극으로 발생하는 것으로 여겨진다.,"Bone formation is thought to occur by stimulation of osteoblasts by PTH, as osteoblasts have PTH receptors.",True,0.1371471881866455,0.9215047458474352,13,17,-4,62,107,-45
"이러한 배경 하에, 본 발명자들은 PTH와 함께 복합제로 사용 시 골 손실 질환에 대한 치료 효과를 증진시킬 수 있는 물질을 탐색하였으며, PTH를 CHP(사이클로-히스프로)와 함께 사용하는 경우 골아세포 분화와 골형성 촉진에 상승효과를 나타냄을 확인하고 본 발명을 완성하였다.","Under this background, the inventors have searched for a substance that can enhance the therapeutic effect on a bone loss disease when used in combination with PTH, and when PTH is used together with CHP, it was confirmed that it exhibits a synergistic effect on osteoblast differentiation and the promotion of bone formation, and thus the present invention was completed.",True,0.2108324617147445,0.8954215983155925,36,60,-24,155,372,-217
대한민국 공개특허 제10-2008-0059430호,(Patent Document 1) Korean Unexamined Patent Application No. 10-2008-0059430,True,0.3843904137611389,0.6717564004876344,3,9,-6,27,76,-49
본 발명의 목적은 사이클로-히스프로 또는 이의 약학적으로 허용가능한 염; 및 부갑상선 호르몬을 포함하는 골 손실 질환의 예방 또는 치료용 약학적 조성물을 제공하는 것이다.,"The present invention is directed to providing a pharmaceutical composition for preventing or treating a bone loss-related disease, which includes CHP or a pharmaceutically acceptable salt thereof; and PTH.",True,0.3987618684768677,0.7923356770524923,23,29,-6,95,206,-111
본 발명의 다른 목적은 사이클로-히스프로 또는 이의 식품학적으로 허용가능한 염; 및 부갑상선 호르몬을 포함하는 골 손실 질환의 예방 또는 개선용 건강기능식품 조성물을 제공하는 것이다.,"The present invention is also directed to providing a health functional food composition for preventing or improving a bone loss-related disease, which includes CHP or a pharmaceutically acceptable salt thereof; and PTH.",True,0.420414924621582,0.7837646446466918,24,32,-8,102,220,-118
본 발명의 또 다른 목적은 사이클로-히스프로 또는 이의 약학적으로 허용가능한 염을 포함하는 부갑상선 호르몬의 골 손실 질환의 치료 효과 증진용 약학적 조성물을 제공하는 것이다.,"The present invention is also directed to providing a pharmaceutical composition for improving the therapeutic effect of PTH on a bone loss-related disease, which includes CHP or a pharmaceutically acceptable salt thereof.",True,0.5066458582878113,0.737282787266112,24,32,-8,98,222,-124
본 발명의 또 다른 목적은 사이클로-히스프로 또는 이의 식품학적으로 허용가능한 염을 포함하는 부갑상선 호르몬의 골 손실 질환의 개선 효과 증진용 건강기능식품 조성물을 제공하는 것이다.,"The present invention is also directed to providing a health functional food composition for improving the effect of PTH for improving a bone loss-related disease, which includes CHP or a pharmaceutically acceptable salt thereof.",True,0.4698080420494079,0.7558336548591909,24,34,-10,102,229,-127
"상술한 과제를 해결하기 위해, 사이클로-히스프로 또는 이의 약학적으로 허용가능한 염; 및 부갑상선 호르몬을 포함하는 골 손실 질환의 예방 또는 치료용 약학적 조성물을 제공한다.","To solve the above-described problems, the present invention relates to a pharmaceutical composition for preventing or treating a bone loss-related disease, which includes CHP or a pharmaceutically acceptable salt thereof; and PTH.",False,0.4684723913669586,0.7434665755420068,23,32,-9,98,231,-133
"또한, 본 발명은 사이클로-히스프로 또는 이의 식품학적으로 허용가능한 염; 및 부갑상선 호르몬을 포함하는 골 손실 질환의 예방 또는 개선용 건강기능식품 조성물을 제공한다.","The present invention also provides a health functional food composition for preventing or improving a bone loss-related disease, which includes CHP or a pharmaceutically acceptable salt thereof; and PTH.",False,0.369618684053421,0.8105790604031129,22,29,-7,95,204,-109
"추가로, 본 발명은 사이클로-히스프로 또는 이의 약학적으로 허용가능한 염을 포함하는 부갑상선 호르몬의 골 손실 질환의 치료 효과 증진용 약학적 조성물을 제공한다.","The present invention also includes a pharmaceutical composition for improving the therapeutic effect of PTH on a bone loss-related disease, which includes CHP or a pharmaceutically acceptable salt thereof.",False,0.495615005493164,0.7456431165587769,21,29,-8,90,206,-116
"또한, 본 발명은 사이클로-히스프로 또는 이의 식품학적으로 허용가능한 염을 포함하는 부갑상선 호르몬의 골 손실 질환의 개선 효과 증진용 건강기능식품 조성물을 제공한다.","The present invention also includes a health functional food composition for improving the effect of PTH for improving a bone loss-related disease, which includes CHP or a pharmaceutically acceptable salt thereof.",False,0.4695879817008972,0.7587129967085655,21,31,-10,93,213,-120
"본 발명의 바람직한 일실시예에 따르면, 상기 부갑상선 호르몬은 부갑상선 호르몬1-34일 수 있다.","According to an exemplary embodiment of the present invention, the PTH may be PTH1-34.",True,0.2712790668010711,0.8225051005027281,12,14,-2,54,86,-32
"본 발명의 바람직한 다른 일실시예에 따르면, 상기 골 손실 질환은 골다공증, 파제트병(Paget's disease), 치조골 손실, 골연화증 및 신성골이영양증(renal osteodeystrophy)으로 이루어진 군으로부터 선택된 어느 하나 이상일 수 있다.","According to another exemplary embodiment of the present invention, the bone loss-related disease may be any one or more selected from the group consisting of osteoporosis, Paget's disease, alveolar bone loss, osteomalacia, and renal osteodystrophy.",True,0.1127184927463531,0.934533745407282,27,35,-8,144,249,-105
"본 발명의 바람직한 또 다른 일실시예에 따르면, 상기 골다공증은 여성 호르몬 감소, 골아세포의 파괴 또는 활성 억제로 발생하는 것일 수 있다.","According to still another exemplary embodiment of the present invention, the osteoporosis may be caused by a decrease in female hormone levels, or the destruction or inhibition of the activity of osteoblasts.",True,0.1998595744371414,0.8798170914686163,21,32,-11,79,209,-130
"본 발명의 사이클로-히스프로 및 부갑상선 호르몬을 포함하는 골 손실 질환의 예방, 개선 또는 치료용 조성물은 골아세포 분화 및 골형성 촉진에 상승효과를 나타내어 골 손실 질환의 치료에 효과적이며, 사이클로-히스프로는 부갑상선 호르몬의 골아세포 분화 및 골형성 촉진 작용을 증진시키므로, 골 손실 질환의 예방, 개선 또는 치료에 부갑상선 호르몬을 적용하는 경우, 사이클로-히스프로를 효과 증진 보조제로서 사용할 수 있다.","A composition for preventing, improving or treating a bone loss-related disease, which includes CHP and PTH according to the present invention exhibits a synergistic effect on osteoblast differentiation and promotion of bone formation and thus is effective in treatment of a bone loss-related disease.",False,0.5767533779144287,0.7140752564783514,55,44,11,234,301,-67
도 1은 CHP(사이클로-히스프로) 및 부갑상선 호르몬1-34의 복합 처리에 의한 ALP 활성 증가 효과를 나타낸 그래프이다.,FIGS. 1A and 1B are graphs showing an effect of increasing ALP activity by combined treatment of CHP and hPTH1-34 in differentiation of MC3T3-E1 osteoblasts.,True,0.2880450785160064,0.8226059340236654,15,25,-10,70,157,-87
"이하, 본 발명을 보다 상세히 설명한다.","Hereinafter, the present invention will be described in further detail.",True,0.0719913467764854,0.948180367263768,6,10,-4,22,71,-49
"상술한 바와 같이, 본 발명자들은 PTH와 함께 복합제로 사용 시 골 손실 질환에 대한 치료 효과를 증진시킬 수 있는 물질을 탐색하였으며, PTH를 CHP(사이클로-히스프로)와 함께 사용하는 경우 골아세포 분화와 골형성 촉진에 상승효과를 나타냄을 확인하고 본 발명을 완성하였다.","As described above, the inventors have searched for a substance that can enhance the therapeutic effect on a bone loss disease when used in combination with PTH, and when PTH is used together with CHP, it was confirmed that it exhibits a synergistic effect on osteoblast differentiation and the promotion of bone formation, and thus the present invention was completed.",True,0.2030925750732422,0.9003336899960829,36,60,-24,155,369,-214
"따라서, 본 발명은 사이클로-히스프로 또는 이의 약학적으로 허용가능한 염; 및 부갑상선 호르몬을 포함하는 골 손실 질환의 예방 또는 치료용 약학적 조성물을 제공한다.","Therefore, the present invention provides a pharmaceutical composition for preventing or treating a bone loss-related disease, which includes CHP or a pharmaceutically acceptable salt thereof; and PTH.",True,0.3503658175468445,0.8201708419945314,22,27,-5,92,201,-109
"또한, 본 발명은 사이클로-히스프로 또는 이의 식품학적으로 허용가능한 염; 및 부갑상선 호르몬을 포함하는 골 손실 질환의 예방 또는 개선용 건강기능식품 조성물을 제공한다.","The present invention also provides a health functional food composition for preventing or improving a bone loss-related disease, which includes CHP or a pharmaceutically acceptable salt thereof; and PTH.",True,0.369618684053421,0.8105790604031129,22,29,-7,95,204,-109
"추가로, 본 발명은 사이클로-히스프로 또는 이의 약학적으로 허용가능한 염을 포함하는 부갑상선 호르몬의 골 손실 질환의 치료 효과 증진용 약학적 조성물; 및 사이클로-히스프로 또는 이의 식품학적으로 허용가능한 염을 포함하는 부갑상선 호르몬의 골 손실 질환의 개선 효과 증진용 건강기능식품 조성물을 제공한다.","The present invention also provides a pharmaceutical composition for improving the therapeutic effect of PTH on a bone loss-related disease, which includes CHP or a pharmaceutically acceptable salt thereof; and a health functional food composition for improving the effect of PTH for improving a bone loss-related disease, which includes CHP or a pharmaceutically acceptable salt thereof.",True,0.3772402703762054,0.812105179990838,39,56,-17,170,388,-218
"본 발명에서 “사이클로-히스프로(Cyclo-HisPro; CHP)”는 갑상선 자극호르몬 방출호르몬 (thyrotropin-releasing hormone, TRH)의 대사산물인 히스티딘-프롤린(Histidine-Proline)으로 구성된 자연적으로 발생하는 원형 디펩티드(dipeptide) 또는 TRH 대사과정과 de novo로 체내에서 합성되기도 하는 생리활성 디펩티드로, 뇌 전반과 척수 및 위장관 등에 널리 분포하는 물질을 말한다.","The ""cyclo-HisPro (CHP"" used herein refers to a naturally-occurring circular dipeptide consisting of histidine-proline, which is a metabolite of thyrotropin-releasing hormone (TRH), or a physiologically active dipeptide which may be synthesized in the body through TRH metabolism and de novo synthesis, which is a material widely distributed throughout the brain, spinal cord and gastrointestinal tract.",True,0.1155957281589508,0.9354452077605264,37,55,-18,245,403,-158
"본 발명의 조성물에 있어서, 상기 CHP는 합성하여 사용하거나, 시판되는 것을 사용할 수 있다.","Int the composition of the present invention, the CHP may be synthesized, or purchased for use.",True,0.1722102612257003,0.8845663213833773,13,16,-3,53,95,-42
"또한, CHP가 함유된 물질, 예를 들어 전립선 추출물로부터 정제하여 사용할 수 있다.","In addition, a CHP-containing material, for example, may be used after purification from a prostate extract.",True,0.2008440196514129,0.8626866800476197,12,16,-4,48,108,-60
"용어 “정제된”의 사용으로, CHP가 전립선 추출물과 같은 천연 유래로 얻을 수 있는 형태에 비하여 농축된 형태임을 의미하고자 한다.","The ""purified"" used herein indicates that CHP is more concentrated than a form obtained from nature, such as a prostate extract.",True,0.2235599011182785,0.8508602958473769,18,21,-3,74,128,-54
"정제된 성분들은 이들의 천연원으로부터 농축시키거나, 또는 화학적 합성 방법을 통해 얻을 수 있다.","Purified ingredients may be obtained through concentration from natural sources thereof, or by a chemical synthesis method.",True,0.0884020626544952,0.9348724920566258,13,17,-4,54,123,-69
"상기 ""전립선 추출물 (prostate extract)""의 주요 구성성분은 아연, CHP, 프로스타글란딘 전구체 및 아라키돈산이며, CHP가 고농도로 함유되어 있어 CHP로 유도되는 골밀도 및 골 체적비 증가 효과와 골아세포 분화 및 골형성 촉진 효과를 합리적으로 예상할 수 있다.","The main components of the ""prostate extract"" are zinc, CHP, a prostaglandin precursor and arachidonic acid, and since it contains a high concentration of CHP, the effect of increasing BMD and a bone volume fraction, induced by CHP, and the effect of promoting osteoblast differentiation and bone formation may be reasonably predicted.",True,0.2085499465465545,0.8821128264544107,35,52,-17,157,335,-178
"본 발명의 조성물에 있어서, 상기 ""전립선 추출물""은 소 또는 돼지의 전립선 분말 등일 수 있고, 바람직하게는 CHP의 함량을 높이기 위해 지방이 제거된 형태로 사용할 수 있으나, 이로 제한되는 것은 아니다.","In the composition of the present invention, the ""prostate extract"" may be bovine or porcine prostate powder, and preferably, a form from which fat is eliminated to increase a CHP content, but the present invention is not limited thereto.",True,0.1507350504398346,0.9153229035328468,30,39,-9,116,238,-122
"본 발명의 조성물에 있어서, 상기 ""부갑상선 호르몬(PTH)""은 하기와 같은 아미노산 서열을 가지는 분비성 84개 아미노산 잔기의 폴리펩티드 또는 이의 단편일 수 있다: Ser-Val-Ser-Glu-Ile-Gln-Leu-Met-His-Asn-Leu-Gly-Lys-His-Leu-Asn-Ser-Met-Glu-Arg-Val-Glu-Trp-Leu-Arg-Lys-Lys-Leu-Gln-Asp-Val-His-Asn-Phe-Val-Ala-Leu-Gly-Ala-Pro-Leu-Ala-Pro-Arg-Asp-Ala-Gly-Ser-Gln-Arg-Pro-Arg-Lys-Lys-Glu-Asp-Asn-Val-Leu-Val-Glu-Ser-His-Glu-Lys-Ser-Leu-Gly-Glu-Ala-Asp-Lys-Ala-Asn-Val-Asp-Val-Leu-Thr-Lys-Ala-Lys-Ser-Gln (서열번호 1).","In the composition of the present invention, the ""parathyroid hormone (PTH)"" may be a secretory polypeptide of 84 amino acid residues with the following amino acid sequence, or a fragment thereof: Ser-Val-Ser-Glu-Ile-Gln-Leu-Met-His-Asn-Leu-Gly-Lys-His-Leu-Asn-Ser-Met-Glu-Arg-Val-Glu-Trp-Leu-Arg-Lys-Lys-Leu-Gln-Asp-Val-His-Asn-Phe-Val-Ala-Leu-Gly-Ala-Pro-Leu-Ala-Pro-Arg-Asp-Ala-Gly-Ser-Gln-Arg-Pro-Arg-Lys-Lys-Glu-Asp-Asn-Val-Leu-Val-Glu-Ser-His-Glu-Lys-Ser-Leu-Gly-Glu-Ala-Asp-Lys-Ala-Asn-Val-Asp-Val-Leu-Thr-Lys-Ala-Lys-Ser-Gln (SEQ ID NO: 1).",True,0.1138395443558693,0.9347435056684598,25,36,-11,440,548,-108
"본 발명의 바람직한 일실시예에 따르면, 상기 부갑상선 호르몬(PTH)은 소 또는 인간 호르몬의 하기 N-말단 34 개 아미노산들로 이루어진 PTH1-34일 수 있다: Ser-Val-Ser-Glu-Ile-Gln-Leu-Met-His-Asn-Leu-Gly-Lys-His-Leu-Asn-Ser-Met-Glu-Arg-Val-Glu-Trp-Leu-Arg-Lys-Lys-Leu-Gln-Asp-Val-His-Asn-Phe (서열번호 2).","According to one exemplary embodiment of the present invention, the PTH may be PTH1-34 consisting of 34 amino acids at the N-terminal of a bovine or human hormone: Ser-Val-Ser-Glu-Ile-Gln-Leu-Met-His-Asn-Leu-Gly-Lys-His-Leu-Asn-Ser-Met-Glu-Arg-Val-Glu-Trp-Leu-Arg-Lys-Lys-Leu-Gln-Asp-Val-His-Asn-Phe (SEQ ID NO: 2).",True,0.1139153689146041,0.9341820193840632,24,33,-9,238,315,-77
"테리파라타이드(teriparatide)라고도 불리는 PTH(1-34)는 고도의 골절 위험이 있는 골다공증을 앓고 있는 폐경 후 여성들의 치료를 위해, Indiana 주, Indianapolis 소재 Eli Lilly 사의 FORTEO 의 상표명으로 현재 시판중이다.","PTH(1-34) also called teriparatide is currently marketed under the trade name FORTEO by Eli Lilly, Indianapolis, Indiana, for the treatment of postmenopausal women with osteoporosis at a high risk of fracture.",True,0.0756125003099441,0.9521432469993194,27,31,-4,148,209,-61
"본 발명에서, 용어 “골 손실”은 파골세포와 조골세포의 불균형에 의하여 초래되는 뼈가 손실되는 증상을 의미하는 것으로, “골 손실 질환”은 상기 증상과 관련된 질환을 모두 포함하는 것을 의미한다.","The term ""bone loss"" used herein refers to a symptom of losing bone because of an imbalance of osteoclasts and osteoblasts, and the ""bone loss-related disease"" includes all of diseases relating to the symptom.",True,0.1702259927988052,0.9075293656936572,26,34,-8,109,209,-100
"따라서, 파골세포의 활성이 지나치게 높아져 뼈가 손실되어 골밀도가 낮아지거나, 조골세포의 활성이 저하되어 뼈의 생성이 원활하게 일어나지 않아 초래되는 질환을 모두 포함한다.","Accordingly, the bone loss includes all of diseases caused by a low BMD caused by losing bone due to excessively high activity of osteoclasts, or non-smooth bone formation caused by reduced activity of osteoblasts.",True,0.3467767834663391,0.807690328293202,21,34,-13,96,214,-118
"상기 골 손실 질환의 구체적인 예로는, 골다공증, 파제트병(Paget's disease), 치조골 손실, 골연화증 및 신성골이영양증(renal osteodeystrophy) 등이 있으나, 이로 제한되지 않는다.","Specific examples of the bone loss-related disease include osteoporosis, Paget's disease, alveolar bone loss, osteomalacia, and renal osteodystrophy, but the present invention is not limited thereto.",True,0.173040896654129,0.8865238649161672,20,26,-6,117,199,-82
"이때, 상기 골다공증은 갱년기 또는 폐경기 증상의 하나로서 여성 호르몬 감소로 인해 발생하거나, 골아세포의 파괴 또는 활성 억제로 인해 발생하는 것일 수 있다.","Here, the osteoporosis is one of the climacteric or menopausal symptoms, and may be caused by a decrease in female hormone levels, or the destruction or inhibition of the activity of osteoblasts.",True,0.3003093898296356,0.8166223332793073,23,32,-9,89,195,-106
"본 발명에서, 용어 “갱년기”는 일반적으로 생식 능력을 갖는 시기에서 생식능력이 사라지는 시기로 전환되는 시기를 의미한다.","The term ""climacterium"" used herein generally means a period of transition from a period of having reproductive ability to a period of disappearing reproductive ability.",True,0.3004624545574188,0.7943387196661651,15,25,-10,68,169,-101
"상기 갱년기는 여성의 갱년기를 언급하는데 주로 쓰이고 있지만, 여성의 갱년기는 폐경기(menopause)만이 아닌 폐경주변기(perimenopause) 전후의 시기를 모두 포함하는 범위로 일반적으로 40~60세의 연령층에 해당한다.","The climacterium is mainly used to refer to female climacterium, which corresponds to a range including all periods before and after perimenopause, as well as menopause, generally, in the age group of 40 to 60.",True,0.2572895288467407,0.8259225801250106,22,35,-13,129,210,-81
"본 발명의 CHP 또는 이의 염 및 부갑상선 호르몬을 포함하는 조성물은 골아세포의 분화를 촉진하여 골형성을 촉진함으로써 골 손실 질환을 예방, 개선 또는 치료할 수 있다.","The composition including CHP or a salt thereof and PTH according to the present invention may prevent, improve or treat a bone loss-related disease by promoting bone formation by promotion of osteoblast differentiation.",True,0.2812119722366333,0.8674191461669735,25,33,-8,95,220,-125
"도 1A 및 1B에 나타난 바와 같이, CHP와 hPTH1-34가 병용 투여될 때 나타나는 ALP 활성 증가 효과는 각각 단독으로 투여될 때 나타나는 ALP 활성 증가 효과의 합보다 더 높은 수준으로 증가하여, CHP 및 부갑상선 호르몬의 병용 투여에 따른 골아세포 분화 촉진 상승 효과를 확인할 수 있었다.","As shown in FIGS. 1A and 1B, the effect of increasing ALP activity occurring when CHP and hPTH1-34 are administered in combination increased to a higher level than the sum of the effects of increasing ALP activity shown in single administration, confirming the synergistic effect of promoting osteoblast differentiation according to the combined administration of CHP and PTH.",True,0.1071333065629005,0.9387413102607238,46,58,-12,172,376,-204
"ALP(alkaline phosphatase)는 골아세포(조골세포)의 초기 분화 마커로, ALP 활성이 증가되는 경우 골아세포의 분화가 촉진되어 골 형성이 촉진된다.","Alkaline phosphatase (ALP) is an early differentiation marker of osteoblasts, and when ALP activity increases, osteoblast differentiation is promoted, thereby promoting bone formation.",True,0.1565185040235519,0.9004648846366273,16,23,-7,92,184,-92
"용접 토치(51)는, 용접 헤드(61)와, 용접 노즐(62)과, 용접 전극(63)을 갖는다.","The welding torch 51 includes a welding head 61, a welding nozzle 62, and a welding electrode 63.",True,0.1767226308584213,0.9166743266929744,9,18,-9,51,97,-46
"용접 헤드(61)는, 지지대(53)에 고정된다.",The welding head 61 is fixed to the support stand 53.,True,0.1800876557826995,0.9114682051816002,4,11,-7,26,53,-27
"용접 노즐(62)은, 용접 헤드(61) 내를 축 방향으로 관통하여 배치된다.",The welding nozzle 62 is disposed axially through inside of the welding head 61.,True,0.2360797971487045,0.8787245111568585,9,14,-5,42,80,-38
"용접 노즐(62)은, 내부가 실드 가스로 채워진다.",Inside of the welding nozzle 62 is filled with shielding gas.,True,0.2647906541824341,0.8261482967962273,6,11,-5,28,61,-33
"용접 전극(63)은, 용접 노즐(62)의 내부에 배치되고, 선단부(도 1에서, 하단부)가 용접 헤드(61)로부터 돌출된다.","The welding electrode 63 is disposed inside the welding nozzle 62, and has a tip end (lower end in FIG. 1 ) protruding from the welding head 61.",True,0.2082873433828345,0.9024381555836836,12,28,-16,68,144,-76
"용접 전극(63)은, 텅스텐 등에 의해 구성된다.]",The welding electrode 63 contains tungsten and other elements.,True,0.4473898410797119,0.7129844519087368,6,9,-3,28,62,-34
"[또한, 지지대(53)는, 토치 회전용 모터(64)가 고정되고, 출력축에 구동 기어(65)가 고정된다.","The support stand 53 has a motor 64 for torch rotation fixed thereto, and a drive gear 65 is fixed to an output shaft.",True,0.2795506417751312,0.8771152365033409,10,24,-14,57,118,-61
"한편, 용접 노즐(62)은, 상부에 종동 기어(66)가 고정되고, 구동 기어(65)가 종동 기어(66)와 맞물린다.","The welding nozzle 62 has a driven gear 66 fixed to the upper part thereof, and the drive gear 65 meshes with the driven gear 66.",True,0.298719048500061,0.8665501725881771,12,26,-14,64,129,-65
"그 때문에, 토치 회전용 모터(64)를 구동하면, 회전력이 구동 기어(65) 및 종동 기어(66)를 통해 용접 노즐(62)에 전달된다.","Thus, when the motor 64 for torch rotation is driven, a rotational force is transmitted to the welding nozzle 62 through the drive gear 65 and the driven gear 66.",True,0.1153431087732315,0.9437386957591783,16,30,-14,75,162,-87
"그러면, 용접 노즐(62)이 중심축(O1)을 중심으로 하여 회동하고, 용접 전극(63)은 중심축(O1)을 중심으로 하여 회동하여, 그 방향을 변경할 수 있다.]","Then, the welding nozzle 62 rotates around the central axis O1, and the welding electrode 63 rotates around the central axis O1 and can therefore change its orientation.",True,0.1815708875656128,0.9162739117284904,18,28,-10,89,169,-80
"[와이어 노즐(52)은, 중심축(O1)에 평행한 중심축(O2)의 축 방향을 따라 배치된다.","The wire nozzle 52 is disposed along the axial direction of a central axis O2, which is parallel to the central axis O1.",True,0.2255530208349228,0.8872572006956512,9,23,-14,50,120,-70
"와이어 노즐(52)은, 와이어 송급관(71)과, 노즐부(72)를 갖는다.",The wire nozzle 52 includes a wire feed tube 71 and a nozzle part 72.,True,0.169209748506546,0.9190805929662416,6,15,-9,40,69,-29
"와이어 송급관(71)은, 중심축(O2)을 따라 배치되고, 노즐부(72)는 선단부(도 1에서, 하단부)측이 중심축(O1)측으로 만곡되어, 선단부가 용접 전극(63)의 선단부의 근방에 위치한다.","The wire feed tube 71 is disposed along the central axis O2, and the nozzle part 72 is curved toward the central axis O1 at the tip end (lower end in FIG. 1 ) thereof, with the tip end being near a tip end of the welding electrode 63.",True,0.1586257219314575,0.9310620491350252,17,49,-32,106,234,-128
"와이어 노즐(52)은, 와이어 릴(도시 생략)로부터 공급된 용접 와이어(W)를 용접 전극(63)측을 향해 안내한다.]",The wire nozzle 52 guides a welding wire W supplied from a wire reel (not illustrated) toward the welding electrode 63.,True,0.2262026369571685,0.8873607335726057,12,21,-9,65,119,-54
"[또한, 지지대(53)는, 승강대(73)가 중심축(O2)의 축 방향을 따라 이동 가능하게 지지된다.",The support stand 53 supports an elevator 73 in a freely movable manner along the axial direction of the central axis O2.,True,0.2807130813598633,0.8657497438099353,10,22,-12,55,121,-66
"와이어 송급관(71)은, 승강대(73)에 중심축(O2)을 중심으로 회동 가능하게 지지된다.",The elevator 73 supports the wire feed tube 71 in a freely rotatable manner around the central axis O2.,True,0.2991965413093567,0.8465706024205011,8,19,-11,50,103,-53
"승강대(73)는, 와이어 노즐 회전용 모터(74)가 고정되고, 출력축에 볼록부를 갖는 구동 캠(75)이 고정된다.","The elevator 73 has a motor 74 for wire nozzle rotation fixed thereto, and a drive cam 75 with a convex part is fixed to the output shaft of the motor 74.",True,0.2477998733520507,0.8890066792496675,12,32,-20,63,154,-91
"한편, 와이어 송급관(71)은, 하부에 오목부를 갖는 종동 캠(76)이 고정되고, 구동 캠(75)이 종동 캠(76)에 걸림","On the other hand, the wire feed tube 71 has a driven cam 76 with a recess fixed to the lower part thereof, and the drive cam 75 engages in the driven cam 76.",False,0.293706327676773,0.8638622817052533,14,34,-20,68,158,-90
"그 때문에, 와이어 노즐 회전용 모터(74)를 구동하면, 회전력이 구동 캠(75) 및 종동 캠(76)을 통해 와이어 송급관(71)으로 전달된다.","Thus, when the motor 74 for wire nozzle rotation is driven, a rotational force is transmitted to the wire feed tube 71 through the drive cam 75 and the driven cam 76.",True,0.1357617378234863,0.9350366801437316,17,32,-15,80,166,-86
"그러면, 와이어 송급관(71)이 중심축(O2)을 중심으로 하여 회동하고, 노즐부(72)는 중심축(O2)을 중심으로 하여 회동하여, 그 방향을 변경할 수 있다.]","Then, the wire feed tube 71 rotates around the central axis O2, and the nozzle part 72 rotates around the central axis O2 and can therefore change its orientation.",True,0.1839263439178466,0.912279633490482,17,29,-12,89,163,-74
"[지지대(53)는, 중심축(O1)에 평행한 중심축(O3)의 축 방향을 따라 와이어 노즐 이동용 모터(77)가 고정되고, 출력축에 나사축(78)이 고정된다.","The support stand 53 has a motor 77 for moving the wire nozzle fixed thereto along the axial direction of a central axis 03, which is parallel to the central axis O1, and a threaded shaft 78 is fixed to the output shaft of the motor 77.",True,0.2659145891666412,0.8883509495750244,15,47,-32,86,236,-150
"한편, 승강대(73)는, 상부에 너트(79)가 고정되고, 나사축(78)이 볼(도시 생략)을 통해 너트(79)에 나사 결합된다.","On the other hand, the elevator 73 has a nut 79 fixed to the upper part thereof, and the threaded shaft 78 screws into the nut 79 via balls (not illustrated).",True,0.2444707751274109,0.880723312508921,12,31,-19,70,158,-88
"그 때문에, 와이어 노즐 이동용 모터(77)를 구동하면, 회전력이 나사축(78) 및 너트(79)에 의해 직선 이동력으로 변환되어 승강대(73)로 전달된다.","Thus, when the motor 77 for moving the wire nozzle is driven, a rotational force is converted into a linear moving force by the threaded shaft 78 and nut 79 and transmitted to the elevator 73.",True,0.1496815532445907,0.9258486065804442,17,36,-19,86,192,-106
"그러면, 승강대(73)가 중심축(O2)을 따라 이동하고, 와이어 노즐(52)은 중심축(O2)을 따라 이동 회동하여, 그 축 방향 위치를 변경할 수 있다.]","Then the elevator 73 moves along the central axis O2, and the wire nozzle 52 moves along and rotates around the central axis O2 and can therefore change its axial position.",True,0.1697819232940673,0.9227182517429204,18,31,-13,86,172,-86
"[지지대(53)는, 용접 토치(51)와 와이어 노즐(52) 사이에 아크 감시 카메라(81)와 미러(82)가 배치된다.",The support stand 53 has an arc monitoring camera 81 and a mirror 82 disposed between the welding torch 51 and the wire nozzle 52.,True,0.2052613794803619,0.8984272173120204,11,25,-14,65,130,-65
"아크 감시 카메라(81)는, 미러(82)를 통해 용접 토치(51) 및 와이어 노즐(52)의 선단부의 용접 화상을 촬영할 수 있다.]",The arc monitoring camera 81 can capture weld images of the welding torch 51 and a tip end of the wire nozzle 52 through the mirror 82.,True,0.1528099477291107,0.9188581876041028,16,27,-11,73,135,-62
"[안내부(91)는, 제2 지지 기구(55)에 의해 제2 지지 부재(92)가 회동 가능하게 지지된다.","On a guide part 91, the second support mechanism 55 supports a second support member 92 in a freely rotatable manner.",True,0.3309691548347473,0.8254108282933963,11,21,-10,55,117,-62
"제2 지지 기구(55)는, 용접 토치(51)와 와이어 노즐(52)의 배열 방향에 직교함과 함께 용접 토치(51)의 축 방향(중심축(O1))에 직교하는 방향을 따른 제2 지지축(O12)을 갖는다.",The second support mechanism 55 has a second support axis O12 along a direction that is orthogonal to a direction in which the welding torch 51 and the wire nozzle 52 are arranged and is orthogonal to the axial direction (central axis O1) of the welding torch 51.,True,0.1704044342041015,0.9321722758006332,21,48,-27,108,263,-155
"또한, 제2 지지 기구(55)는, 제2 모터(도시 생략)를 갖는다.",The second support mechanism 55 has a second motor (not illustrated).,True,0.319532573223114,0.8345639183051924,8,11,-3,37,69,-32
"제2 모터는, 안내부(91)에 고정되고, 출력축에 제2 지지 부재(92)가 연결된다.",The second motor is fixed to the guide part 91 and the second support member 92 is connected to the output shaft of the second motor.,True,0.1337282508611679,0.9399702678886503,9,26,-17,47,133,-86
"그 때문에, 제2 모터를 구동하면, 안내부(91)에 대해 제2 지지 부재(92)를 제2 지지축(O12)을 중심으로 하여 회동시킬 수 있다.","Thus, when the second motor is driven, the second support member 92 can be rotated around the second support axis O12 with respect to the guide part 91.",True,0.172977477312088,0.9169579309927514,17,28,-11,77,152,-75
"제2 지지 부재(92)가 제2 지지축(O12)을 중심으로 회동하면, 지지대(53)에 장착된 용접 토치(51) 및 와이어 노즐(52)을, 도 1에서, X1 방향 및 X2 방향으로 경동할 수 있다.]",Rotating the second support member 92 around the second support axis O12 allows the welding torch 51 and wire nozzle 52 that are mounted on the support stand 53 to incline in X1 and X2 directions in FIG. 1.,True,0.2133458256721496,0.9051498365951436,24,39,-15,109,206,-97
"[제2 지지 부재(92)는, 제1 지지 기구(54)에 의해 제1 지지 부재(93)가 회동 가능하게 지지된다.","On the second support member 92, the first support mechanism 54 supports a first support member 93 in a freely rotatable manner.",True,0.3016071319580078,0.8426676943553822,13,22,-9,60,128,-68
"제1 지지 기구(54)는, 용접 토치(51)와 와이어 노즐(52)의 배열 방향을 따름과 함께 용접 토치(51)의 축 방향(중심축(O1))에 직교하는 방향을 따른 제1 지지축(O11)을 갖는다.",The first support mechanism 54 has a first support axis O11 along a direction that is along the direction in which the welding torch 51 and the wire nozzle 52 are arranged and is orthogonal to the axial direction (central axis O1) of the welding torch 51.,True,0.1550062149763107,0.9368122626659972,21,47,-26,107,255,-148
"또한, 제1 지지 기구(54)는, 제1 모터(94)를 갖는다.",The first support mechanism 54 includes a first motor 94.,True,0.229968249797821,0.8822346342108048,7,10,-3,34,57,-23
"제1 모터(94)는, 제2 지지 부재(92)에 고정되고, 출력축에 제1 지지 부재(93)가 연결된다.","The first motor 94 is fixed to the second support member 92, and the first support member 93 is connected to the output shaft of the first motor 94.",True,0.1323978900909423,0.9414149257525832,11,29,-18,56,148,-92
"그 때문에, 제1 모터(94)를 구동하면, 제2 지지 부재(92)에 대해 제1 지지 부재(93)를 제1 지지축(O11)을 중심으로 하여 회동시킬 수 있다.","Thus, when the first motor 94 drives, the first support member 93 can be rotated around the first support axis O11 with respect to the second support member 92.",True,0.1922778934240323,0.908353999399102,19,29,-10,86,160,-74
"제1 지지 부재(93)가 제1 지지축(O11)을 중심으로 회동하면, 지지대(53)에 장착된 용접 토치(51) 및 와이어 노즐(52)을, 도 2에서, Y1 방향 및 Y2 방향으로 경동할 수 있다.]",Rotating the first support member 93 around the first support axis O11 allows the welding torch 51 and wire nozzle 52 that are mounted on the support stand 53 to incline in Y1 and Y2 directions as illustrated in FIG. 2.,True,0.2649385035037994,0.8816780072063208,24,41,-17,109,219,-110
"[제1 지지 부재(93)는, 제3 지지 기구(56)에 의해 지지대(53)가 이동 가능하게 지지된다.","On the first support member 93, the support stand 53 supports the third support mechanism 56 in a freely movable manner.",True,0.275692343711853,0.8590895042377733,11,21,-10,55,120,-65
"제3 지지 기구(56)는, 제1 지지 기구(54)와 지지대(53)의 상단부 사이에 배치된다.",The third support mechanism 56 is disposed between the first support mechanism 54 and the upper end of the support stand 53.,True,0.1697064489126205,0.915097810557328,10,22,-12,51,124,-73
"제3 지지 기구(56)는, 용접 토치(51)의 축 방향(중심축(O1))을 따른 제3 지지축(O13a, O13b)을 갖는다.","The third support mechanism 56 has third support axes O13a, O13b along the axial direction (central axis O1) of the welding torch 51.",True,0.1900479197502136,0.914885530140924,12,23,-11,68,133,-65
"또한, 제3 지지 기구(56)는, 제3 모터(95)와, 나사축(96)과, 전달 기구(97)를 갖는다.","The third support mechanism 56 includes a third motor 95, a threaded shaft 96, and a transmission mechanism 97.",True,0.2205057740211486,0.89384678258497,10,19,-9,56,111,-55
"제3 모터(95)는, 용접 토치(51)의 축 방향을 따라 배치된다.",The third motor 95 is disposed along the axial direction of the welding torch 51.,True,0.2042607516050338,0.9029061858420718,8,15,-7,37,81,-44
"나사축(96)은, 용접 토치의 축 방향을 따라 배치된다.",The threaded shaft 96 is disposed along the axial direction of the welding torch.,True,0.1832474619150161,0.8975180371004273,7,14,-7,31,81,-50
"제3 모터(95)와 나사축(96)은, 서로 평행을 이루고, 소정 간격을 두고 인접하여 배치된다.",The third motor 95 and the threaded shaft 96 are parallel to each other and are disposed adjacent to each other with a predetermined distance therebetween.,True,0.1987007111310959,0.8941745697892974,11,26,-15,53,155,-102
"제3 모터(95)와 나사축(96)은, 전달 기구(97)에 의해 연결되고, 제3 모터(95)의 회전력이 전달 기구(97)에 의해 나사축(96)에 전달된다.]","The third motor 95 and the threaded shaft 96 are connected by a transmission mechanism 97, and the rotational force of the third motor 95 is transmitted to the threaded shaft 96 by the transmission mechanism 97.",True,0.1644628942012787,0.9238250326399172,15,37,-22,86,211,-125
"[즉, 제1 지지 부재(93)는, 일단부가 제1 모터(94)의 출력축에 연결되고, 타단부에 연결 부재(101)를 통해 슬라이더(102)가 고정되고, 슬라이더(102)에 너트부(103)가 마련된다.","That is, the first support member 93 has one end connected to the output shaft of the first motor 94, and the other end fixed to a slider 102 via a connecting member 101, the slider 102 having a nut part 103 provided therefor.",True,0.2067597508430481,0.9122275521914764,18,44,-26,109,226,-117
"한편, 지지대(53)는 타방측에 연결부(104)가 일체로 마련된다.","On the other hand, the support stand 53 has a connecting part 104 integrally disposed on the other side thereof.",True,0.2353191375732422,0.8776209630694892,6,20,-14,37,112,-75
"연결부(104)는, 일방측(도 3에서 우방측)이 개방된 상자 형상을 이룬다.",The connecting part 104 has a box shape having one side (right side in FIG. 3 ) open.,True,0.1279157549142837,0.9203537598049758,8,18,-10,42,85,-43
"연결부(104)는, 내부에 제3 모터(95)와 나사축(96)이 소정 간격을 두고, 평행을 이루어 배치된다.","In the connecting part 104, the third motor 95 and the threaded shaft 96 are disposed with a predetermined distance and in parallel to each other.",True,0.2473302185535431,0.8751856059112381,11,26,-15,59,146,-87
"제3 모터(95)는, 제3 지지축(O13a)을 따라 배치되고, 연결부(104)에 고정되고, 하방으로 연장되는 출력축에 구동 기어(105)가 고정된다.","The third motor 95 is along the third support axis O13a and is fixed to the connecting part 104, and a drive gear 105 is fixed to the output shaft of the third motor 95 that extends downward.",True,0.1601492166519165,0.9265779170819748,14,38,-24,83,191,-108
철도차량 연결기용 합금강{Alloy steel composition for railway vehicle coupler},Technical Field,False,1.1593366861343384,0.0983549792390373,9,2,7,66,15,51
"[본 발명은 철도차량 연결기용 합금강에 관한 것으로, 보다 상세하게는 한국과 중국에서 주로 사용되는 AAR 연결기에 대해서 요구되는 기계적 성질과, 러시아 등에서 주로 사용되는 CA-3 연결기에 대해서 요구되는 기계적 성질을 모두 충족시킬 수 있도록 함으로써 동북아시아와 러시아를 연결하는 철도시스템에서 안전하게 사용할 수 있도록 하는 철도차량 연결기용 합금강에 관한 것이다.]","The present disclosure relates to an alloy steel for a railway vehicle coupler and, more particularly, to an alloy steel for a railway vehicle coupler, the alloy steel being able to meet all mechanical properties required for AAR couplers mainly used in Korea (i.e., the Republic of Korea) and China (i.e., the People's Republic of China) and mechanical properties required for CA-3 couplers mainly used in Russia (i.e., the Russian Federation) and the like, thereby enabling the railway vehicle coupler to be safely used in the railway system connecting Russia and the other Northeast Asian countries.",True,0.2365395724773407,0.8711470625759379,48,96,-48,211,602,-391
"[철도차량의 연결기는 추진력 및 제동력을 차량 간에 전달하는 기능을 하는 안전상 매우 중요한 구성품으로, 최근 들어 화차를 포함하는 철도차량의 장대화 필요성으로 인하여 그 구조적 안정성이 더욱 중요해지고 있다.]",A coupler for a railway vehicle is a very important safety component serving to transmit driving force and braking force to railroad cars.,False,0.363518625497818,0.7358125775414658,28,23,5,118,138,-20
"[그리고, 최근 러시아를 포한한 동북아 경제의 중요성이 커지고 있고, 동북 아시아의 운송, 물류 및 연결성 향상은 미래 성장 동력 과제 중 하나로 부상하고 있다.]","Recently, the importance of the economy of Northeast Asia including Russia is increasing, and the improvement of the transportation, logistics, and connectivity of Northeast Asia is emerging as one of future growth engines.",True,0.2511500120162964,0.8175160552708266,24,33,-9,91,223,-132
"[그에 따라, 한반도와 중국, 중앙아시아, 러시아, 유럽의 연결을 목표로 하는 대륙철도에 대한 연구가 활발히 진행되고 있는데, 특히 화차의 경우 한반도와 중국에서는 AAR 타입 연결기를 사용하고, 러시아를 포함한 CIS 국가와 몽골에서는 CA-3 타입 연결기를 사용하여 연결기의 헤드 형상이 서로 상이하여 상호간 연결이 불가능할 뿐만 아니라, 요구하고 있는 연결기 재료의 기계적 성질 또한 상이하다.]","Thus, research to the continental railway intended to connect the Korean Peninsula, China, Central Asia, Russia, and Europe is actively underway.",False,0.4601808190345764,0.6944805941653358,52,21,31,224,145,79
"[이와 관련하여 헤드 형상이 서로 상이한 AAR 타입 연결기와 CA-3 타입 연결기를 상호 연결할 수 있도록 하는 가변형 연결기 및 연결기 어댑터와 관련된 기술은 활발히 개발되고 있지만, 두 종류의 연결기에 대하여 요구되는 기계적 성질을 만족하는 재질과 관련된 개발은 미흡한 실정이다.]","In this regard, technologies related to a variable coupler and a coupler adapter able to connect an AAR coupler and a CA-3 coupler having different head shapes to each other are being actively developed.",False,0.2990622520446777,0.813120391313298,40,34,6,160,203,-43
"[이와 같은 문제점을 해결하기 위한 종래기술로 대한민국 등록특허공보 제10-1931494호에는 철도차량 연결기용 합금강이 게재되어 있는데, 그 주요 기술적 구성은 필수성분으로서 탄소(C), 망간(Mn), 실리콘(Si), 크롬(Cr), 니켈(Ni), 구리(Cu), 몰리브덴(Mo), 알루미늄(Al), 인(P) 및 황(S)을 함유하고, 잔부가 철(Fe) 및 불순물로 이루어진 것에 그 특징이 있다.]","The major technical composition of this ally steel are characterized by including, as essential ingredients, carbon (C), manganese (Mn), silicon (Si), chromium (Cr), nickel (Ni), copper (Cu), molybdenum (Mo), aluminum (Al), phosphorus (P), and sulfur (S), with the balance being iron (F) and unavoidable impurities.",False,0.3935682773590088,0.7894709951887673,40,45,-5,221,315,-94
"[즉, 상기 종래기술은 위와 같은 조성으로 인해 기후변화가 심한 대륙횡단 열차에 적용할 수 있는 기계적 성질을 갖으므로 기후변화와 철도차량 연결기 간의 마찰로 인해 마모되는 것을 절감함으로써 내구성이 증진될 수 있도록 한 것에 기술적 특징이 있으나, AAR 타입 연결기에 대한 기계적 성질 규정인 'AAR M201, Gr.E'(이하, 'AAR M201'이라 한다) 기준의 충족 여부만을 고려하고 있어 CA-3 타입 연결기에 대한 기계적 성질 규정인 러시아 국가표준 'GOST 22703, 20 GL'(이하, 'GOST 22703'이라 한다) 기준의 충족 여부에 대해서는 확인할 수 없는 단점이 있다.]","Thus, it is impossible to determine whether or not criteria for Russian national standard ""GOST 22703, 20 GL"" (hereinafter, referred to as ""GOST 22703""), i.e., the specification for the mechanical properties of CA-3 couplers, are met.",False,0.5204517841339111,0.7129051415038904,78,36,42,336,234,102
"[또한, 기후변화가 심한 대륙철도의 경우 깨짐이나 마모 등과 관련하여 연결기의 기계적 성질 중 경도(hardness)가 상당히 중요한데, 상기 종래기술은 기계적 성질 중 경도 조건에 대한 기준을 충족하는지 여부 또한 확인할 수 없는 문제점이 있다.]","In addition, for the continental railway exposed to severe climate changes, hardness from among the mechanical properties of couplers is significantly important in relation to cracking, wear, or the like.",False,0.4548997282981872,0.6909489640103764,33,30,3,139,204,-65
"[따라서, AAR 타입 연결기에 대한 기계적 성질 규정인 'AAR M201'과, CA-3 타입 연결기에 대한 기계적 성질 규정인 'GOST 22703'의 기준을 동시에 충족할 수 있는 연결기용 합금강의 개발이 시급한 실정이다.]","Accordingly, there is urgent demand for the development of an alloy steel for a coupler, the alloy steel being able to meet AAR M201, i.e., the specification for the mechanical properties of AAR couplers, and GOST 22703, i.e., the specification for the mechanical properties of CA-3 couplers.",True,0.1764890402555465,0.9053850296840544,29,47,-18,127,292,-165
[PatentCitationText[attributes={}; value=[1. 대한민국 등록특허공보 제10-1931494호(2018. 12. 21. 공고)]]],Technical Problem,False,1.016426920890808,0.2308292731228764,8,2,6,90,17,73
"[본 발명은 상기와 같은 종래기술의 문제점들을 해결하기 위하여 안출된 것으로, 본 발명의 목적은 AAR 타입 연결기에 대한 기계적 성질 규정인 'AAR M201'과, CA-3 타입 연결기에 대한 기계적 성질 규정인 'GOST 22703'의 기준을 동시에 충족시킬 수 있도록 함으로써 동북아시아와 러시아를 연결하는 철도시스템에서 안전하게 사용할 수 있도록 하는 철도차량 연결기용 합금강을 제공함에 있다.]","Accordingly, the present disclosure has been made keeping in mind the above problems occurring in the prior art, and an objective of the present disclosure is to provide an alloy steel for a railway vehicle coupler, the alloy steel being able to meet both AAR M201, i.e., the specification for the mechanical properties of AAR couplers, and GOST 22703, i.e., the specification for the mechanical properties of CA-3 couplers, thereby enabling the railway vehicle coupler to be safely used in the railway system connecting Russia and the other Northeast Asian countries.",True,0.1837175488471985,0.9027357053297196,51,91,-40,225,568,-343
"[상기와 같은 목적들을 달성하기 위한 본 발명은,]","In order to accomplish the above objective, the present disclosure provides an alloy steel for a railway vehicle coupler.",False,0.7967399954795837,0.4449012333527394,7,19,-12,28,121,-93
"[탄소(C), 규소(Si), 망간(Mn), 인(P), 황(S), 크롬(Cr), 니켈(Ni) 및 구리(Cu)를 필수 성분으로 포함하여 이루어지는 철도차량 연결기용 합금강에 있어서, 질화티탄(TiN), 입방정 질화붕소(cBN), 산화알루미늄(Al, Sub[attributes={}; value=[2]], O, Sub[attributes={}; value=[3]], ) 및 산화지르코늄(ZrO, Sub[attributes={}; value=[2]], ) 중 어느 하나로 이루어지는 나노입자(nanopaticle)를 더 포함하여 이루어진 것을 특징으로 한다.]","The alloy steel for a railway vehicle coupler may include carbon (C), silicon (Si), manganese (Mn), phosphorus (P), sulfur (S), chromium (Cr), nickel (Ni), and copper (Cu) as essential ingredients, and may further include nanoparticles made from one of titanium nitride (TiN), cubic boron nitride (cBN), aluminum oxide (Al2O3), and zirconium dioxide (ZrO2).",False,0.2284871339797973,0.8803436740230572,43,53,-10,309,357,-48
"[이때, 상기 필수 성분으로 몰리브덴(Mo), 바나듐(V) 및 알루미늄(Al)을 더 포함하여 이루어진 것을 특징으로 한다.]","The alloy steel may further include molybdenum (Mo), vanadium (V), and aluminum (Al) as the essential ingredients.",True,0.2318198233842849,0.8603271403424176,14,17,-3,69,114,-45
"[또한, 상기 필수 성분은 탄소(C) 0.240중량%, 규소(Si) 0.380중량%, 망간(Mn) 1.160중량%, 인(P) 0.014중량%, 황(S) 0.006중량%, 크롬(Cr) 0.250중량%, 니켈(Ni) 0.250중량%, 구리(Cu) 0.030중량%, 몰리브덴(Mo) 0.180중량%, 바나듐(V) 0.020중량% 및 알루미늄(Al) 0.020중량%로 이루어지고, 잔부는 철과 불순물 및 상기 나노입자로 이루어진 것을 특징으로 한다.]","In addition, the essential ingredients may include, by weight, 0.240% of C, 0.380% of Si, 1.160% of Mn, 0.014% of P, 0.006% of S, 0.250% of Cr, 0.250% of Ni, 0.030% of Cu, 0.180% of Mo, 0.020% of V, and 0.020% of Al, with the balance being iron (Fe) and impurities.",True,0.2352019548416137,0.875510182181499,38,51,-13,248,265,-17
"[그리고, 상기 필수 성분들과 나노입자를 포함하는 합금강을 870℃에서 4시간 동안 1차 열처리한 후 공랭시키고, 870℃에서 4시간 동안 2차 열처리한 후 수랭시키며, 570℃에서 4시간 동안 3차 열처리한 후 공랭시킨 것을 특징으로 한다.]","In addition, the alloy steel including the essential ingredients and the nanoparticles may be first heat-treated at 870°C for 4 hours, followed by air cooling, be second heat-treated at 870°C for 4 hours, followed by water cooling, and be third heat-treated at 570°C for 4 hours, followed by air cooling.",True,0.2664840519428253,0.8440129488381855,31,50,-19,136,304,-168
"[또한, 상기 필수 성분 중 니켈(Ni)의 함량은 0.25 ~ 0.30 중량%이고, 몰리브덴(Mo)의 함량은 0.15 ~ 0.25 중량%이며, 바나듐(V)의 함량은 0.01 ~ 0.02 중량%인 것을 특징으로 한다.]","In addition, from among the essential ingredients, Ni may have a content ranging from 0.25% to 0.30% by weight, Mo may have a content ranging from 0.15% to 0.25% by weight, and V may have a content ranging from 0.01% to 0.02% by weight.",True,0.3505055010318756,0.7950930327875604,26,44,-18,121,236,-115
"[이때, 상기 필수 성분은 탄소(C) 0.233중량%, 규소(Si) 0.427중량%, 망간(Mn) 1.222중량%, 인(P) 0.006중량%, 황(S) 0.012중량%, 크롬(Cr) 0.261중량%, 니켈(Ni) 0.260중량%, 구리(Cu) 0.042중량%, 몰리브덴(Mo) 0.175중량%, 바나듐(V) 0.019중량% 및 알루미늄(Al) 0.022중량%로 이루어지고, 잔부는 철과 불순물 및 상기 나노입자로 이루어진 것을 특징으로 한다.]","The essential ingredients may include, by weight, 0.233% of C, 0.427% of Si, 1.222% of Mn, 0.006% of P, 0.012% of S, 0.261% of Cr, 0.260% of Ni, 0.042% of Cu, 0.175% of Mo, 0.019% of V, and 0.022% of Al, with the balance being Fe, impurities, and the nanoparticles.",True,0.2882508933544159,0.8393405896775252,38,50,-12,248,265,-17
"[한편, 본 발명의 다른 실시예는,]","According to another embodiment, provided is an alloy steel for a railway vehicle coupler.",False,0.720410168170929,0.5027237073475648,5,14,-9,20,90,-70
"[탄소(C), 규소(Si), 망간(Mn), 인(P), 황(S), 크롬(Cr), 니켈(Ni) 및 구리(Cu)를 필수 성분으로 포함하여 이루어지는 철도차량 연결기용 합금강에 있어서, 산화마그네슘(MgO) 또는 99중량%의 산화규소(SiO, Sub[attributes={}; value=[2]], )와 1중량%의 탄화규소(SiC)의 조합으로 이루어진 물질 중 어느 하나의 나노입자(nanopaticle)를 더 포함하여 이루어진 것을 특징으로 한다.]","The alloy steel may include carbon (C), silicon (Si), manganese (Mn), phosphorus (P), sulfur (S), chromium (Cr), nickel (Ni), and copper (Cu) as essential ingredients, and may further include nanoparticles made from one of magnesium oxide (MgO) or a material combination of, by weight, 99% of silicon oxide (SiO2) and 1% of silicon carbide (SiC).",True,0.2675614953041076,0.8578197389173602,39,55,-16,248,346,-98
"[이때, 상기 필수 성분으로 몰리브덴(Mo), 바나듐(V) 및 알루미늄(Al)을 더 포함하여 이루어진 것을 특징으로 한다.]","The alloy steel may further include molybdenum (Mo), vanadium (V), and aluminum (Al) as the essential ingredients.",True,0.2318198233842849,0.8603271403424176,14,17,-3,69,114,-45
"[그리고, 상기 필수 성분은 탄소(C) 0.240중량%, 규소(Si) 0.380중량%, 망간(Mn) 1.160중량%, 인(P) 0.014중량%, 황(S) 0.006중량%, 크롬(Cr) 0.250중량%, 니켈(Ni) 0.250중량%, 구리(Cu) 0.030중량%, 몰리브덴(Mo) 0.180중량%, 바나듐(V) 0.020중량% 및 알루미늄(Al) 0.020중량%로 이루어지고, 잔부는 철과 불순물 및 상기 나노입자로 이루어진 것을 특징으로 한다.]","In addition, the essential ingredients may include, by weight, 0.240% of C, 0.380% of Si, 1.160% of Mn, 0.014% of P, 0.006% of S, 0.250% of Cr, 0.250% of Ni, 0.030% of Cu, 0.180% of Mo, 0.020% of V, and 0.020% of Al, with the balance being iron (Fe), impurities, and the nanoparticles.",True,0.2539879381656647,0.8660605960617139,38,53,-15,249,285,-36
"[또한, 상기 필수 성분들과 나노입자를 포함하는 합금강을 870℃에서 4시간 동안 1차 열처리한 후 공랭시키고, 870℃에서 4시간 동안 2차 열처리한 후 수랭시키며, 580℃에서 4시간 동안 3차 열처리한 후 공랭시킨 것을 특징으로 한다.]","In addition, the alloy steel including the essential ingredients and the nanoparticles may be first heat-treated at 870°C for 4 hours, followed by air cooling, be second heat-treated at 870°C for 4 hours, followed by water cooling, and be third heat-treated at 580°C for 4 hours, followed by air cooling.",True,0.2542479634284973,0.8520541847832146,31,50,-19,135,304,-169
"[그리고, 상기 필수 성분은 탄소(C) 0.220중량%, 규소(Si) 0.430중량%, 망간(Mn) 1.200중량%, 인(P) 0.016중량%, 황(S) 0.006중량%, 크롬(Cr) 0.260중량%, 니켈(Ni) 0.250중량%, 구리(Cu) 0.030중량%, 몰리브덴(Mo) 0.150중량%, 바나듐(V) 0.020중량% 및 알루미늄(Al) 0.030중량%로 이루어지고, 잔부는 철과 불순물 및 상기 나노입자로 이루어진 것을 특징으로 한다.]","In addition, the essential ingredients may include, by weight, 0.220% of C, 0.430% of Si, 1.200% of Mn, 0.016% of P, 0.006% of S, 0.260% of Cr, 0.250% of Ni, 0.030% of Cu, 0.150% of Mo, 0.020% of V, and 0.030% of Al, with the balance being iron (Fe), impurities, and the nanoparticles.",True,0.2566080391407013,0.86389750110919,38,53,-15,249,285,-36
"[또한, 상기 필수 성분과 나노입자를 포함하는 합금강을 580℃에서 4시간 동안 열처리한 후 공랭시킨 것을 특징으로 한다.]","In addition, the alloy steel including the essential ingredients and the nanoparticles may be heat-treated at 580°C for 4 hours, followed by air cooling.",True,0.2145835757255554,0.8595765354271857,16,24,-8,69,153,-84
"[본 발명에 따르면, 철도차량 연결기용 합금강에 AAR 타입 연결기와 CA-3 타입 연결기에 대한 기계적 성질 규정에 필수 성분으로 포함되어 있는 성분들 외에 합금강의 경도를 감소시킬 수 있도록 하는 나노입자 또는 합금강의 강도를 향상시킬 수 있도록 하는 나노입자를 선택적으로 첨가시킴으로써 AAR 타입 연결기의 기계적 성질에 대한 기준과 CA-3 타입 연결기에 대한 기계적 성질에 대한 기준을 동시에 충족시킬 수 있는 뛰어난 효과를 갖는다.]","According to the present disclosure, the nanoparticles able to reduce the hardness of the alloy steel and the nanoparticles able to improve the strength of the alloy steel to the alloy steel for a railway vehicle coupler are selectively added to the alloy steel for a railway vehicle coupler according to the present disclosure as described above includes, in addition to the ingredients included as essential ingredients in AAR couplers and CA-3 couplers, thereby having an excellent effect in that both the specification for the mechanical properties of AAR couplers and the specification for the mechanical properties of CA-3 couplers may be meet.",True,0.2680336236953735,0.8626902037555292,61,103,-42,248,650,-402
"[또한, 본 발명에 따르면 전세계적으로 가장 널리 사용되는 두 가지 연결기에 대한 기계적 성질 기준을 모두 충족시킬 수 있게 되어 전세계 대부분의 국가에서 범용적으로 사용될 수 있을 뿐만 아니라, 현재 추진 중에 있는 동북아시아와 러시아를 연결하는 철도시스템에서 안전하게 사용될 수 있는 효과를 추가로 갖는다.]","Advantageously, the alloy steel according to the present disclosure may be compatibly used in most countries in the world and be safely used in the railway system currently in progress to connect Russia and the other Northeast Asian countries.",False,0.3982894718647003,0.7414950812574245,44,39,5,174,243,-69
"[이하, 본 발명에 따른 철도차량 연결기용 합금강의 바람직한 실시예들을 상세히 설명하기로 한다.]","Hereinafter, exemplary embodiments of an alloy steel for a railway vehicle coupler according to the present disclosure will be described in detail.",True,0.1947825849056244,0.8672298321606596,12,22,-10,54,147,-93
"[본 발명은 한국과 중국에서 주로 사용되는 AAR 연결기에 대해서 요구되는 기계적 성질과, 러시아 등에서 주로 사용되는 CA-3 연결기에 대해서 요구되는 기계적 성질을 모두 충족시킬 수 있도록 함으로써 동북아시아와 러시아를 연결하는 철도시스템에서 안전하게 사용할 수 있도록 하는 철도차량 연결기용 합금강에 관한 것으로, 먼저 AAR 연결기에 대해서 요구되는 기계적 성질에 대한 규정인 'AAR M201'과, CA-3 타입 연결기에 대한 기계적 성질 규정인 'GOST 22703'의 내용은 아래의 (표 1)과 같다.","The present disclosure relates to an alloy steel for a railway vehicle coupler and, more particularly, to an alloy steel for a railway vehicle coupler, the alloy steel enabling a railway vehicle coupler to meet all mechanical properties required for AAR couplers mainly used in Korea (i.e., the Republic of Korea) and China (i.e., the People's Republic of China) and mechanical properties required for CA-3 couplers mainly used in Russia (i.e., the Russian Federation) and the like, thereby enabling railway vehicle couplers made from the alloy steel to be safely used in railway systems connecting Russia and the other Northeast Asian countries.",False,0.3168509304523468,0.8345561514383888,66,102,-36,287,646,-359
아래의 (표 1)에서 화학성분들의 함량은 중량%를 의미한다.],The contents of chemical ingredients in Table 1 below are indicated in weight percent.,True,0.1788286864757537,0.8736522367602698,7,14,-7,34,86,-52
"[Table[attributes={}; value=[TableImage[attributes={tableNumber=1}; value=[ImageFormatCategory[attributes={}; value=[JPEG]], ImageFileName[attributes={}; value=[pat00001.jpg]], HeightMeasure[attributes={measureUnitCode=Px}; value=[117]], WidthMeasure[attributes={measureUnitCode=Px}; value=[144]]]]]]]","As illustrated in Table 1 above, it may be found that the AAR M201 standard regarding the chemical composition of the coupler is not strict and only specifies maximum values of carbon (C), silicon (Si), manganese (Mn), phosphorus (P), and sulfur (S).",False,1.06780743598938,0.3381945782685117,10,42,-32,301,250,51
"[상기 (표 1)에서 확인할 수 있는 바와 같이, AAR M201 규격의 경우 연결기의 화학적 조성과 관련하여 C(탄소), Si(규소), Mn(망간), P(인), S(황)의 최대치 만을 규정하여 규제가 심하지 않은 반면, GOST 22703 규격은 AAR M201 규격에 비해 Cr(크롬), 니켈(Ni) 및 구리(Cu)의 최대치가 추가적으로 규정되고, C(탄소), Si(규소), Mn(망간)은 함량 범위를 한정하여 상대적으로 화학적 조성에 대한 규제가 엄격한 것을 알 수 있다.]","In contrast, the GOST 22703 standard regarding the chemical composition of the coupler is relatively strict to further specify the maximum values of chromium (Cr), nickel (Ni), and copper (Cu) and define the content ranges of C, Si, and Mn.",False,0.4243022203445434,0.7759820257155916,58,40,18,268,240,28
"[AAR M201 규격과 GOST 22703 규격은 기계적 성질에 대한 규정에서도 서로 차이를 보이는데, GOST 22703 규격이 적용되는 러시아의 경우 상대적으로 기온이 낮은 환경에서 철도차량의 운행이 가능해야 하므로, 항복강도(Y/P), 인장강도(T/S) 및 경도(HB) 조건이 상대적으로 낮고, 내한성을 위하여 -60℃에서의 충격강도(Impact strength)를 추가적으로 요구하고 있는 것을 확인할 수 있다.]",The AAR M201 standard and the GOST 22703 standard also have different specifications about mechanical properties.,False,0.4213887751102447,0.7623312315737243,46,16,30,236,113,123
"[본 발명은 AAR M201 규격과 GOST 22703 규격에서 요구하는 화학성분, 즉 화학적 조성과 기계적 성질을 모두 만족시킬 수 있도록 하는 것에 기술적 과제가 있으므로 상기 (표 1)의 최우측에 나타낸 화학적 조성 및 기계적 성질을 충족시킬 수 있도록 구성되어 있다.]","Since the objective of the present disclosure is to meet the chemical ingredients, i.e., the chemical composition, and the mechanical properties required by the AAR M201 standard and the GOST 22703 standard, the present disclosure may meet the chemical composition and the mechanical properties illustrated in the rightmost column of Table 1 above.",True,0.2317138612270355,0.8777037477878109,39,53,-14,154,348,-194
"[보다 상세히 설명하면, 본 발명에 따른 철도차량 연결기용 합금강은 AAR M201 규격과 GOST 22703 규격에서 요구하는 화학성분 즉, 탄소(C), 규소(Si), 망간(Mn), 인(P), 황(S), 크롬(Cr), 니켈(Ni) 및 구리(Cu)를 필수 성분으로 포함하는 합금강으로 이루어지는데, 여기에 질화티탄(TiN), 입방정 질화붕소(cBN), 산화알루미늄(Al, Sub[attributes={}; value=[2]], O, Sub[attributes={}; value=[3]], ) 및 산화지르코늄(ZrO, Sub[attributes={}; value=[2]], ) 중 어느 하나로 이루어지는 나노입자(nanopaticle)를 더 포함하여 이루어진 것에 그 특징이 있다.]","Described in more detail, the alloy steel for a railway vehicle coupler according to the present disclosure is provided as an alloy steel including the chemical ingredients required by the AAR M201 standard and the GOST 22703 standard, i.e., carbon (C), silicon (Si), manganese (Mn), phosphorus (P), sulfur (S), chromium (Cr), nickel (Ni), and copper (Cu) as essential ingredients.",False,0.2786344587802887,0.8640784032343702,60,59,1,381,381,0
"[이때, 상기 질화티탄(TiN), 입방정 질화붕소(cBN), 산화알루미늄(Al, Sub[attributes={}; value=[2]], O, Sub[attributes={}; value=[3]], ) 및 산화지르코늄(ZrO, Sub[attributes={}; value=[2]], )은 합금강에 포함되어 경도를 낮추는 역할을 하는 것으로, 나노입자의 형태로 합금강에 포함되어 극소량으로도 경도 저하의 효과를 얻을 수 있게 된다.]","TiN, cBN, Al2O3, and ZrO2 described above may be included in the alloy steel to reduce the hardness thereof, and may be included in the alloy steel as nanoparticles to obtain a hardness reduction effect even if in a minute amount.",False,0.4766018688678741,0.728429687389832,36,41,-5,240,230,10
"[즉, 테스트 결과 상기 (표 1)의 최우측에 표시된 기계적 성질의 목표 조건 중 연신율(El), 단면수축율(R/A), 충격강도(impact strength)는 필수 성분으로 포함되는 탄소(C), 규소(Si), 망간(Mn), 인(P), 황(S), 크롬(Cr), 니켈(Ni) 및 구리(Cu)의 함량 조절을 통해 비교적 용이하게 목표 조건을 충족시킬 수 있었지만, 나머지 기계적 성질인 항복강도(Y/P), 인장강도(T/S) 및 경도(HB) 조건은 상기 필수 성분들의 함량 조절을 통해 목표 조건을 충족시키는 것에 한계가 있었다.]","That is, according to test results, it was possible to easily meet target conditions for some mechanical properties, such as the elongation El, the reduction of area R/A, and impact strength, from among the target conditions for the mechanical properties illustrated in the rightmost column of Table 1 above by adjusting the contents of C, Si, Mn, P, S, Cr, Ni, and Cu.",False,0.353557676076889,0.8181992673698614,59,63,-4,294,369,-75
"[보다 상세히 설명하면, 합금강의 항복강도(Y/P)와 인장강도(T/S)에 대한 목표 조건을 충족시키는 경우 경도(HB)가 목표 조건을 초과하게 되고, 합금강의 경도(HB)에 대한 목표 조건을 충족시키는 경우에는 항복강도(Y/P)와 인장강도(T/S)가 목표 조건에 미치지 못하게 되는 문제가 발생되었다.]","Described in more detail, there has been a problem in that, when the target conditions for the yield strength Y/P and the tensile strength T/S of the alloy steel were met, the hardness HB exceeded the target condition, and when the target condition for the hardness HB of the alloy steel was met, either the target condition for the yield strength Y/P or the target condition for the tensile strength T/S was met.",True,0.2231746613979339,0.8683133105994754,32,73,-41,169,413,-244
"[따라서, 상기 질화티탄(TiN), 입방정 질화붕소(cBN), 산화알루미늄(Al, Sub[attributes={}; value=[2]], O, Sub[attributes={}; value=[3]], ) 및 산화지르코늄(ZrO, Sub[attributes={}; value=[2]], ) 중 어느 하나를 나노입자의 형태로 합금강에 포함시킴으로써 합금강의 항복강도(Y/P)와 인장강도(T/S)의 변화를 최소화하면서 경도(HB)를 낮출 수 있도록 한 것이다.]","Thus, nanoparticles made of one from among TiN, cBN, Al2O3, and ZrO2 may be included in the alloy steel so as to reduce the hardness HB of the alloy steel while minimizing changes in the yield strength Y/P and the tensile strength T/S of the alloy steel.",False,0.3171979486942291,0.8334041870893922,35,47,-12,254,254,0
"[아래의 (표 2)는 경도(HB)가 203인 합금강에 질화티탄(TiN) 나노입자와 질화붕소(cBN) 나노입자를 각각 첨가하였을 때 나타나는 경도(HB) 변화를 테스트한 결과를 나타낸 것으로, 질화티탄(TiN) 나노입자와 질화붕소(cBN) 나노입자의 첨가에 의해 경도(HB)가 각각 3.94% 및 6.4% 감소한 것을 확인할 수 있다.]",Table 2 below illustrates test results regarding hardness changes in the alloy steel with the hardness HB of 203 when TiN nanoparticles and cBN nanoparticles were added to the alloy steel.,False,0.3172118067741394,0.8162887480882346,36,31,5,187,188,-1
"[Table[attributes={}; value=[TableGroup[attributes={cols=4}; value=[colspec[attributes={align=center, colname=col1, colnum=1, colwidth=2670}; value=[]], colspec[attributes={align=center, colname=col2, colnum=2, colwidth=2670}; value=[]], colspec[attributes={align=center, colname=col3, colnum=3, colwidth=2670}; value=[]], colspec[attributes={align=center, colname=col4, colnum=4, colwidth=2670}; value=[]], TableBody[attributes={}; value=[Row[attributes={}; value=[Entry[attributes={align=center, colname=col1}; value=[나노입자 첨가물]], Entry[attributes={align=center, colname=col2}; value=[첨가안함]], Entry[attributes={align=center, colname=col3}; value=[질화티탄(TiN)]], Entry[attributes={align=center, colname=col4}; value=[질화붕소(cBN)]]]], Row[attributes={}; value=[Entry[attributes={align=center, colname=col1}; value=[경도(HB)]], Entry[attributes={align=center, colname=col2}; value=[203]], Entry[attributes={align=center, colname=col3}; value=[195]], Entry[attributes={align=center, colname=col4}; value=[190]]]]]]]]]]]","It may be found that the hardness HB was reduced by 3.94% and 6.4%, respectively, in response to the addition of the TiN nanoparticles and the cBN nanoparticles.Table 2",False,1.1406300067901611,0.2287042555554911,50,29,21,1010,168,842
"[그리고, 마찬가지 실험에서 산화알루미늄(Al, Sub[attributes={}; value=[2]], O, Sub[attributes={}; value=[3]], ) 나노입자와 산화지르코늄(ZrO, Sub[attributes={}; value=[2]], ) 나노입자는 각각 최대 27% 및 38%의 경도 감소 효과를 보일 수 있는 것으로 확인되었다.]","In addition, in a similar test, it was found that the Al2O3 nanoparticles and the ZrO2 nanoparticles were able to reduce the hardness by 27% and 38%, respectively.",False,0.371119737625122,0.7700777747825913,29,28,1,197,163,34
"[그러므로, 감소시키고자 하는 합금강의 경도 크기에 따라 질화티탄(TiN), 입방정 질화붕소(cBN), 산화알루미늄(Al, Sub[attributes={}; value=[2]], O, Sub[attributes={}; value=[3]], ) 및 산화지르코늄(ZrO, Sub[attributes={}; value=[2]], ) 중 어느 하나를 선택하여 나노입자의 형태로 합금강에 포함시킬 수 있다.]","Thus, according to the magnitude of the hardness of the alloy steel to be reduced, one from among TiN, cBN, Al2O3, and ZrO2 may be selected so as to be included in the alloy steel as nanoparticles.",False,0.3096925616264343,0.8246377831077101,32,37,-5,223,197,26
"[다음, 본 발명에 따른 철도차량 연결기용 합금강의 다른 실시예에 따르면 필수 성분들을 포함하는 합금강에 포함되는 나노입자가 산화마그네슘(MgO), 또는 99중량%의 산화규소(SiO, Sub[attributes={}; value=[2]], )와 1중량%의 탄화규소(SiC)의 조합으로 이루어진 물질 중의 어느 하나일 수 있는데, 상기 두 가지 물질들은 합금강의 경도(HB)에 대한 목표 조건을 충족시키면서, 항복강도(Y/P)와 인장강도(T/S)가 목표 조건에 미치지 못하게 되는 경우에 사용된다.]","In addition, in an alloy steel for a railway vehicle coupler according to another embodiment of the present disclosure, nanoparticles included in the alloy steel including essential ingredients may be made from one of magnesium oxide (MgO) or a material combination of, by weight, 99% of silicon oxide (SiO2) and 1% of silicon carbide (SiC).",False,0.3599543869495392,0.8196547246279545,52,55,-3,278,341,-63
"[즉, 상기 산화마그네슘(MgO)과, 99중량%의 산화규소(SiO, Sub[attributes={}; value=[2]], )와 1중량%의 탄화규소(SiC)의 조합으로 이루어진 물질은 합금강의 강도를 향상시키기 위한 목적으로 사용되는 것으로, 마찬가지로 나노입자의 형태로 합금강에 포함되어 극소량으로도 강도 향상의 효과를 얻을 수 있다.]","That is, MgO and the material combination of, by weight, 99% of SiO2 and 1% of SiC is used in order to improve the strength of the alloy steel.",False,0.3086610734462738,0.8257874339790354,32,29,3,189,143,46
"[보다 상세히 설명하면, 탄소강에 산화마그네슘(MgO) 나노입자를 첨가시키는 경우 아래의 (표 3)에서 확인할 수 있는 바와 같이, 투입되는 나노입자의 양에 따라 최대 약 22.4%의 항복강도(Y/P) 향상 효과와, 약 53.1%의 인장강도(T/S) 향상 효과를 보일 수 있는 것으로 나타났다.]","Described in more detail, when MgO nanoparticles are added to a carbon steel, it an improvement effect of the yield strength Y/P by about 22.4% and an improvement effect of the tensile strength T/S by about 53.1% may be obtained according to the amount of nanoparticles input, as may be found from Table 3 below.Table 3",True,0.2412930727005005,0.8588452371805632,36,56,-20,165,319,-154
"[Table[attributes={}; value=[TableGroup[attributes={cols=6}; value=[colspec[attributes={align=center, colname=col1, colnum=1, colwidth=3050}; value=[]], colspec[attributes={align=center, colname=col2, colnum=2, colwidth=1525}; value=[]], colspec[attributes={align=center, colname=col3, colnum=3, colwidth=1525}; value=[]], colspec[attributes={align=center, colname=col4, colnum=4, colwidth=1525}; value=[]], colspec[attributes={align=center, colname=col5, colnum=5, colwidth=1525}; value=[]], colspec[attributes={align=center, colname=col6, colnum=6, colwidth=1525}; value=[]], TableBody[attributes={}; value=[Row[attributes={}; value=[Entry[attributes={align=center, colname=col1}; value=[산화마그네슘 나노입자의 질량분율(%)]], Entry[attributes={align=center, colname=col2}; value=[0]], Entry[attributes={align=center, colname=col3}; value=[0.01]], Entry[attributes={align=center, colname=col4}; value=[0.03]], Entry[attributes={align=center, colname=col5}; value=[0.05]], Entry[attributes={align=center, colname=col6}; value=[0.07]]]], Row[attributes={}; value=[Entry[attributes={align=center, colname=col1}; value=[항복강도(MPa)]], Entry[attributes={align=center, colname=col2}; value=[232]], Entry[attributes={align=center, colname=col3}; value=[233]], Entry[attributes={align=center, colname=col4}; value=[264]], Entry[attributes={align=center, colname=col5}; value=[294]], Entry[attributes={align=center, colname=col6}; value=[284]]]], Row[attributes={}; value=[Entry[attributes={align=center, colname=col1}; value=[인장강도(MPa)]], Entry[attributes={align=center, colname=col2}; value=[293]], Entry[attributes={align=center, colname=col3}; value=[425]], Entry[attributes={align=center, colname=col4}; value=[427]], Entry[attributes={align=center, colname=col5}; value=[448]], Entry[attributes={align=center, colname=col6}; value=[441]]]]]]]]]]]","In addition, when nanoparticles made from the material combination of, by weight, 99% of SiO2 and 1% of SiC are added to the carbon steel, a strength improvement effect of up to about 60% may be obtained without a significant change in the hardness HB, as may be found from Table 4 below.Table 4",False,1.063484787940979,0.3360324586850322,92,54,38,1828,295,1533
"[또한, 탄소강에 99중량%의 산화규소(SiO, Sub[attributes={}; value=[2]], )와 1중량%의 탄화규소(SiC)의 조합으로 이루어진 물질의 나노입자를 첨가시키는 경우, 아래의 (표 4)에서 확인할 수 있는 바와 같이, 경도(HB)가 크게 변화되지 않도록 하면서도 최대 약 60%의 강도 향상 효과를 보일 수 있는 것으로 나타났다.]","As described above, in the present disclosure, it is possible to reduce the hardness HB of the alloy steel including C, Si, Mn, P, S, Cr, Ni, and Cu or improve the strength, i.e., the yield strength Y/P and the tensile strength T/S, of the alloy steel by adding nanoparticles to the steel alloy.",False,0.6980597972869873,0.6314963132768482,39,54,-15,199,295,-96
"[Table[attributes={}; value=[TableGroup[attributes={cols=5}; value=[colspec[attributes={align=center, colname=col1, colnum=1, colwidth=3560}; value=[]], colspec[attributes={align=center, colname=col2, colnum=2, colwidth=1780}; value=[]], colspec[attributes={align=center, colname=col3, colnum=3, colwidth=1780}; value=[]], colspec[attributes={align=center, colname=col4, colnum=4, colwidth=1780}; value=[]], colspec[attributes={align=center, colname=col5, colnum=5, colwidth=1780}; value=[]], TableBody[attributes={}; value=[Row[attributes={}; value=[Entry[attributes={align=center, colname=col1}; value=[Modifier weight(g)]], Entry[attributes={align=center, colname=col2}; value=[0]], Entry[attributes={align=center, colname=col3}; value=[77]], Entry[attributes={align=center, colname=col4}; value=[120]], Entry[attributes={align=center, colname=col5}; value=[460]]]], Row[attributes={}; value=[Entry[attributes={align=center, colname=col1}; value=[경도(HB)]], Entry[attributes={align=center, colname=col2}; value=[185 - 210]], Entry[attributes={align=center, colname=col3}; value=[210]], Entry[attributes={align=center, colname=col4}; value=[220]], Entry[attributes={align=center, colname=col5}; value=[190]]]], Row[attributes={}; value=[Entry[attributes={align=center, colname=col1}; value=[강도(MPa)]], Entry[attributes={align=center, colname=col2}; value=[168 - 180]], Entry[attributes={align=center, colname=col3}; value=[270]], Entry[attributes={align=center, colname=col4}; value=[240]], Entry[attributes={align=center, colname=col5}; value=[200]]]]]]]]]]]","When intended to reduce the hardness HB, nanoparticles made from one from among TiN, cBN, Al2O3, and ZrO2 are added to the alloy steel.",False,1.1710155010223389,0.2453606056994419,81,24,57,1560,135,1425
"[전술한 바와 같이, 본 발명에서는 필수 성분, 즉 탄소(C), 규소(Si), 망간(Mn), 인(P), 황(S), 크롬(Cr), 니켈(Ni) 및 구리(Cu)를 포함하는 합금강에 나노입자들을 포함시킴으로써 경도(HB)를 감소시키거나, 강도(strength), 즉 항복강도(Y/P)와 인장강도(T/S)를 향상시킬 수 있는데, 경도(HB)를 감소시키고자 하는 경우에는 질화티탄(TiN), 입방정 질화붕소(cBN), 산화알루미늄(Al, Sub[attributes={}; value=[2]], O, Sub[attributes={}; value=[3]], ) 및 산화지르코늄(ZrO, Sub[attributes={}; value=[2]], ) 중 어느 하나로 이루어지는 나노입자(nanopaticle)를 합금강에 포함시키고, 강도를 향상시키기 위해서는 산화마그네슘(MgO)이나, 99중량%의 산화규소(SiO, Sub[attributes={}; value=[2]], )와 1중량%의 탄화규소(SiC)의 조합으로 이루어진 물질 중 어느 하나의 나노입자를 합금강에 포함시킨다.]","When intended to improve the strength, nanoparticles made from one of MgO and the material combination of, by weight, 99% of SiO2 and 1% of SiC are added to the alloy steel.",False,0.6969178915023804,0.6271639725261893,76,32,44,538,173,365
"[한편, 전술한 AAR M201 규격과 GOST 22703 규격을 동시에 만족하는 화학성분으로 주조한 제1시편을 열처리 조건을 서로 달리하여 열처리한 후 기계적성질을 테스트한 결과를 아래의 (표 5)에 나타내었다.]","In addition, first specimens cast from a material including chemical ingredients meeting both the AAR M201 standard and the GOST 22703 standard described above were heat-treated in different heat treatment conditions, and then, the mechanical properties thereof were tested.",False,0.2578799724578857,0.8533831678755953,26,39,-13,120,274,-154
"[Table[attributes={}; value=[TableImage[attributes={tableNumber=5}; value=[ImageFormatCategory[attributes={}; value=[JPEG]], ImageFileName[attributes={}; value=[pat00002.jpg]], HeightMeasure[attributes={measureUnitCode=Px}; value=[133]], WidthMeasure[attributes={measureUnitCode=Px}; value=[138]]]]]]]",The results of the test are illustrated in Table 5 below.,False,0.8905932903289795,0.3908616318670525,10,11,-1,301,57,244
"[열처리를 통해 인장강도(T/S), 연신율(El), 단면수축률(R/A) 및 경도(HB)는 목표로 하는 기계적성질 조건을 충족하도록 향상시킬 수 있었으나, 항복강도(Y/P)와 충격강도 부분에서 목표치에 미달되는 결과를 얻은 것을 확인할 수 있다.]","Although the tensile strength T/S, the elongation (El), the reduction of area R/A, and the hardness HB were improved to meet target conditions for mechanical properties, it may be found that the yield strength Y/P and the impact strength were less than the target values.",True,0.2244847416877746,0.8720152115426847,26,45,-19,137,271,-134
"[한편, 본 발명에 따른 철도차량 연결기용 합금강은 전술한 필수 성분들 이외에도 몰리브덴(Mo), 바나듐(V) 및 알루미늄(Al)을 필수 성분으로 더 포함할 수 있는데, 먼저 상기 알루미늄(Al)은 합금강에 통상적으로 포함되는 것으로 합금강의 연성을 향상시키기 위한 목적으로 사용된다.]","In addition, the alloy steel for a railway vehicle coupler according to the present disclosure may further include molybdenum (Mo), vanadium (V), and aluminum (Al), in addition to the above-described essential ingredients.",False,0.2296730875968933,0.8792180509426587,34,32,2,160,222,-62
"[다음, 상기 몰리브덴(Mo)은 합금강의 충격강도(Impact strength), 즉 충격흡수율을 향상시키기 위한 목적으로 첨가된 것으로, 이는 아래의 (표 6)을 통해 확인할 수 있다.]","Next, Mo is added to improve the impact strength, i.e., sock absorption rate, of the alloy steel.",False,0.3725422322750091,0.7523769137111774,21,17,4,105,97,8
"[즉, 아래의 (표 6)은 AAR M201 규격과 GOST 22703 규격을 동시에 만족하는 화학성분에 몰리브덴(Mo)을 첨가하여 주조한 제2시편을 열처리 조건을 서로 달리하여 열처리한 후 기계적성질을 테스트한 결과를 나타낸 것으로, 열처리를 통해 경도(HB)를 목표범위에 포함되도록 한 결과, 대부분의 기계적 성질이 목표범위를 충족하는 것으로 나타났다.]","That is, Table 6 below illustrates results obtained by heat-treating second specimens cast from a material further including Mo, in addition to the chemical ingredients meeting both the AAR M201 standard and the GOST 22703 standard, in different heat treatment conditions, and then, testing the mechanical properties of the second specimens.",False,0.2692369222640991,0.856772571243996,42,51,-9,199,341,-142
"[특히, 충격강도(Impact strength)는 몰리브덴(Mo)의 첨가에 의해 두 배 이상 향상되었으나, 항복강도(Y/P)와 인장강도(T/S)가 저하되어 그 중 인장강도(T/S)는 목표치에 미달되는 결과를 보이는 것을 확인할 수 있다.]","In particular, it may be found that, while the impact strength was improved twice or more by the addition of Mo, the yield strength Y/P and the tensile strength T/S were reduced so that the tensile strength T/S did not meet the target value.",True,0.2335180789232254,0.858616592816711,24,44,-20,133,241,-108
"[다음, 상기 바나듐(V)은 합금강의 강도 향상을 목적으로 첨가되는 것으로, 이는 아래의 (표 7)을 통해 확인할 수 있다.]","Next, V is added to improve the strength of the alloy steel, and this feature may be found from Table 7 below.",True,0.2563616335391998,0.8324930163808842,17,22,-5,70,110,-40
"[즉, 아래의 (표 7)은 AAR M201 규격과 GOST 22703 규격을 동시에 만족하는 화학성분에 몰리브덴(Mo)과 바나듐(V)을 함께 첨가하여 주조한 제3시편을 열처리 조건을 서로 달리하여 열처리한 후 기계적성질을 테스트한 결과를 나타낸 것으로, 바나듐(V)의 첨가로 인해 항복강도(Y/P)와 인장강도(T/S)가 향상되어 목표치를 충족하는 것으로 나타났으나, 그에 비례하여 경도(HB) 또한 향상되어 목표치를 초과하는 것으로 나타났고, 충격강도는 저하되어 마찬가지로 목표치에 미달되는 것을 확인할 수 있다.]","That is, Table 7 below illustrates results obtained by heat-treating third specimens cast from a material further including Mo and V, in addition to the chemical ingredients meeting both the AAR M201 standard and the GOST 22703 standard, in different heat treatment conditions, and then, testing the mechanical properties of the second specimens.",True,0.3648499548435211,0.8104020372432723,58,53,5,288,346,-58
"[Table[attributes={}; value=[TableImage[attributes={tableNumber=7}; value=[ImageFormatCategory[attributes={}; value=[JPEG]], ImageFileName[attributes={}; value=[pat00004.jpg]], HeightMeasure[attributes={measureUnitCode=Px}; value=[128]], WidthMeasure[attributes={measureUnitCode=Px}; value=[135]]]]]]]","It may be found that, while the yield strength Y/P and the tensile strength T/S were improved to meet the target values by the addition of V, the hardness HB was also improved proportionally to exceed the target value and the impact strength was reduced, thereby failing to meet the target value.",False,1.0323615074157717,0.3305484392712045,10,52,-42,301,296,5
"[상기한 테스트들의 결과를 통해 합금강으로 규정된 필수성분들에 몰리브덴(Mo)을 첨가할 경우 충격강도를 향상시킬 수 있고, 바나듐(V)의 첨가를 통해 항복강도(Y/P)와 인장강도(T/S)를 향상시킬 수 있는 것을 확인할 수 있었다.]","According to the results of the tests described above, it may be found that the impact strength was improved by adding Mo to the specified essential ingredients of the alloy steel and the yield strength Y/P and the tensile strength T/S were improved by adding V to the essential ingredients.",True,0.2965096533298492,0.8358432137512455,26,50,-24,130,291,-161
"[하지만, 몰리브덴(Mo)의 경우 경도(HB) 범위를 충족시키기 위한 열처리에 의해 항복강도(Y/P)와 인장강도(T/S)가 저하되고, 이를 해소하기 위해 바나듐(V)을 첨가하는 경우 충격강도가 다시 저하되는 결과를 보여, 이러한 문제해결을 위해 몰리브덴(Mo)과 바나듐(V)의 함량을 제한할 필요가 있다.]","However, in the case of Mo, the yield strength Y/P and the tensile strength T/S were reduced by the heat treatment intended to meet the range of the hardness HB.",False,0.4716763198375702,0.7121134013406788,32,30,2,171,161,10
"[그에 따라 몰리브덴(Mo)과 바나듐(V)의 함량을 각각 전체 합금강의 0.15 ~ 0.25 중량%와, 0.01 ~ 0.02 중량%로 제한하고, 이에 더하여 AAR M201 규격과 GOST 22703 규격에 규정되어 있는 필수 성분 중 충격강도가 우수한 니켈의 함량을 0.25 ~ 0.30 중량%이 되도록 하여 주조한 제4시편 및 제5시편을 각각 열처리한 후 기계적성질을 테스트한 결과를 아래의 (표 8)에 나타내었다.]","Accordingly, fourth and fifth specimens cast by limiting the contents of Mo and V to, by weight, 0.15% to 0.25% and 0.01% to 0.02% and setting the content of Ni having superior impact strength, from among the essential ingredients specified in the AAR M201 standard and the GOST 22703 standard, to 0.25% to 0.30% by weight were heat-treated in different heat treatment conditions, and then, mechanical properties thereof were tested.",False,0.2941543161869049,0.8515631387371922,54,70,-16,235,433,-198
"[Table[attributes={}; value=[TableImage[attributes={tableNumber=8}; value=[ImageFormatCategory[attributes={}; value=[JPEG]], ImageFileName[attributes={}; value=[pat00005.jpg]], HeightMeasure[attributes={measureUnitCode=Px}; value=[124]], WidthMeasure[attributes={measureUnitCode=Px}; value=[142]]]]]]]",The results of the test are illustrated in Table 8 below.,False,0.877816915512085,0.3944301815176683,10,11,-1,301,57,244
"[먼저, 제4시편은 AAR M201 규격과 GOST 22703 규격에 규정되어 있는 필수 성분들의 함량을 만족시키면서, 니켈(Ni), 몰리브덴(Mo), 바나듐(V)의 함량을 각각 0.25 중량%, 0.18 중량% 및 0.02 중량%로 한정하여 주조한 후 열처리 한 것으로, 경도(HB)를 제외한 모든 기계적 성질에 대한 목표치들을 충족시키는 것을 확인할 수 있다.]","First, the fourth specimen was cast by limiting the contents of Ni, Mo, and V to 0.25%, 0.18%, 0.02% by weight, respectively, while meeting the contents of the essential ingredients specified in the AAR M201 standard and the GOST 22703 standard, followed by heat treatment.",False,0.271592229604721,0.8586317333476851,44,45,-1,204,273,-69
"[다음, 제5시편 또한 AAR M201 규격과 GOST 22703 규격에 규정되어 있는 필수 성분들의 함량을 만족시키면서, 니켈(Ni), 몰리브덴(Mo), 바나듐(V)의 함량을 각각 0.260 중량%, 0.175 중량% 및 0.019 중량%로 한정하여 주조한 후 열처리 한 것으로, 마찬가지로 경도(HB)를 제외한 모든 기계적 성질에 대한 목표치들을 충족시키는 것을 확인할 수 있다.]","Next, the fifth specimen was cast by limiting the contents of Ni, Mo, and V to 0.260%, 0.175%, and 0.019% by weight, while meeting the contents of the essential ingredients specified in the AAR M201 standard and the GOST 22703 standard, followed by heat treatment.",False,0.3177676796913147,0.8346294033054176,46,45,1,215,264,-49
"[즉, 상기 제4시편 및 제5시편 모두 경도(HB)를 제외한 모든 기계적 성질, 즉 항복강도(Y/P), 인장강도(T/S), 연신율(El), 단면수축률(R/A) 및 충격강도에 대한 목표조건들을 충족시키는 것으로 확인되었는데, 경도(HB)는 전술한 바와 같이, 질화티탄(TiN), 입방정 질화붕소(cBN), 산화알루미늄(Al, Sub[attributes={}; value=[2]], O, Sub[attributes={}; value=[3]], ) 및 산화지르코늄(ZrO, Sub[attributes={}; value=[2]], ) 중 어느 하나로 이루어지는 나노입자(nanopaticle)의 첨가를 통해 낮출 수 있으므로, 상기 나노입자의 첨가에 의해 AAR M201 규격과 GOST 22703 규격을 동시에 만족시키는 기계적 성질을 갖는 탄소강을 제조할 수 있게 된다.]","That is, it was found that both the fourth specimen and the fifth specimen met the target conditions for all mechanical properties, i.e., the yield strength Y/P, the tensile strength T/S, the elongation (El), the reduction of area R/A, and the impact strength, except for the hardness HB.",False,0.4760992228984833,0.7510910547775889,72,48,24,430,288,142
"[한편, 상기한 바와 같은 본 발명에 따른 철도차량 연결기용 합금강은 열처리 조건에 의해서도 기계적 성질이 변화될 수 있는데, 아래의 (표 9)는 상기 (표 8)에 기재된 제4시편과 동일한 조성으로 이루어진 합금강 시편에 대해 한국화학융합시험연구원(KTR)과 한국철도기술연구원(KRRI)에서 각각 2차례씩 기계적 성질을 테스트 한 결과와, 새로운 조성 즉, 탄소(C) 0.220중량%, 규소(Si) 0.430중량%, 망간(Mn) 1.200중량%, 인(P) 0.016중량%, 황(S) 0.006중량%, 크롬(Cr) 0.260중량%, 니켈(Ni) 0.250중량%, 구리(Cu) 0.030중량%, 몰리브덴(Mo) 0.150중량%, 바나듐(V) 0.020중량% 및 알루미늄(Al) 0.030중량%을 포함하여 이루어진 합금강 시편에 대한 한국화학융합시험연구원(KTR)에서의 기계적 성질 테스트 결과를 열처리 조건과 함께 나타낸 것이다.]","In addition, the mechanical properties of the above-described alloy steel for a railway vehicle coupler according to the present disclosure may be changed according to heat treatment conditions.",False,0.692398190498352,0.6251238986682658,82,28,54,463,194,269
"[Table[attributes={}; value=[TableImage[attributes={tableNumber=9}; value=[ImageFormatCategory[attributes={}; value=[JPEG]], ImageFileName[attributes={}; value=[pat00006.jpg]], HeightMeasure[attributes={measureUnitCode=Px}; value=[158]], WidthMeasure[attributes={measureUnitCode=Px}; value=[160]]]]]]]","Table 9 below illustrates test results for the mechanical properties of alloy steel specimens having the same composition as the fourth specimen illustrated in Table 8, tested two times by the Korea Testing and Research Institute (KTR) and the Korea Railroad Research Institute (KRRI), and test results for the mechanical properties of alloy steel specimens respectively having a new composition of, by weight, 0.220% of C, 0.430% of Si, 1.200% of Mn, 0.016% of P, 0.006% of S, 0.260% of Cr, 0.250% of Ni, 0.030% of Cu, 0.150% of Mo, 0.020% of V, and 0.030% of Al, tested by the KTR, together with heat treatment conditions.",False,1.120363712310791,0.3213671493059296,10,106,-96,301,624,-323
"[먼저, 상기 제4시편과 동일한 조성, 즉 탄소(C) 0.240중량%, 규소(Si) 0.380중량%, 망간(Mn) 1.160중량%, 인(P) 0.014중량%, 황(S) 0.006중량%, 크롬(Cr) 0.250중량%, 니켈(Ni) 0.250중량%, 구리(Cu) 0.030중량%, 몰리브덴(Mo) 0.180중량%, 바나듐(V) 0.020중량% 및 알루미늄(Al) 0.020중량%을 포함하여 이루어진 합금강 시편의 경우, 총 3차에 걸친 열처리를 수행하였는데, 한국화학융합시험연구원(KTR)에서의 1차 테스트와, 한국철도기술연구원(KRRI) 1,2차 테스트에서는 동일한 조건으로 열처리를 수행하였고, 한국화학융합시험연구원(KTR)에서의 2차 테스트에서는 3차 열처리의 온도 조건을 변화시켜 열처리를 수행하였다.]","First, in alloy steel specimens having the same composition as the fourth specimen, i.e., the composition including, by weight, 0.240% of C, 0.380% of Si, 1.160% of Mn, 0.014% of P, 0.006% of S, 0.250% of Cr, 0.250% of Ni, 0.030% of Cu, 0.180% of Mo, 0.020% of V, and 0.020% of Al, a total of three heat treatments was performed.",False,0.3032690286636352,0.8401175046459244,59,61,-2,395,329,66
"[보다 상세히 설명하면, 한국화학융합시험연구원(KTR)에서의 1차 테스트와, 한국철도기술연구원(KRRI) 1,2차 테스트에서는 노멀라이징(Normalizing)에 해당되는 1차 열처리시 870℃ 온도에서 4시간 동안 1차 열처리한 후 공랭하였고, 담금질(Quenching)에 해당되는 2차 열처리시에는 마찬가지로 870℃의 온도에서 4시간 동안 열처리한 후 수랭시켰으며, 템퍼링(Tempering)에 해당되는 3차 열처리시에는 570℃의 온도에서 4시간 동안 열처리한 후 공랭시키는 열처리 작업을 수행한 후 기계적 성질들을 측정하였다.]","Described in more detail, in the first test by the KTR and the first and second tests by the KRRI, the first heat treatment corresponding to normalizing was performed at 870°C for 4 hours, followed by air cooling.",False,0.270109623670578,0.8335686848023329,51,38,13,300,213,87
"[그 결과, 세 번의 테스트에서 모두 경도(HB)를 제외한 모든 기계적 성질들, 즉 항복강도(Y/P), 인장강도(T/S), 연신율(El), 단면수축률(R/A) 및 충격강도에 대한 목표조건들을 충족시키는 것으로 확인되었는데, 한국화학융합시험연구원(KTR)에서의 1차 테스트에서는 경도(HB)가 목표범위에서 약 3.4% 정도 초과되는 것으로 측정되었고, 한국철도기술연구원(KRRI)에서의 1,2차 테스트에서는 경도(HB)가 각각 목표범위에서, 약 2.7% 및 약 5.0% 정도 초과되는 것으로 측정되었다.]","As a result, it was found that all mechanical properties except for the hardness HB, i.e., the yield strength Y/P, the tensile strength T/S, the elongation (El), the reduction of area R/A, and the impact strength, were met in the three tests.",False,0.3376433253288269,0.8149182831126265,49,42,7,281,242,39
"[전술한 (표 2)에서 질화티탄(TiN) 나노입자와 질화붕소(cBN) 나노입자의 첨가에 의해 경도(HB)를 각각 3.94% 및 6.4% 감소시킬 수 있는 것을 확인하였으므로, 탄소(C) 0.240중량%, 규소(Si) 0.380중량%, 망간(Mn) 1.160중량%, 인(P) 0.014중량%, 황(S) 0.006중량%, 크롬(Cr) 0.250중량%, 니켈(Ni) 0.250중량%, 구리(Cu) 0.030중량%, 몰리브덴(Mo) 0.180중량%, 바나듐(V) 0.020중량% 및 알루미늄(Al) 0.020중량%을 포함하여 이루어진 합금강에 질화티탄(TiN) 나노입자와 질화붕소(cBN) 나노입자 중 어느 하나를 선택하여 첨가시킬 경우 경도(HB) 조건을 포함하는 모든 기계적 성질들의 목표조건들을 충족시킬 수 있는 철도차량 연결기용 합금강을 제조할 수 있게 된다.]","Thus, when one of the TiN nanoparticles and the boron nitride (cBN) nanoparticles is selectively added to the alloy steel including, by weight, 0.240% of C, 0.380% of Si, 1.160% of Mn, 0.014% of P, 0.006% of S, 0.250% of Cr, 0.250% of Ni, 0.030% of Cu, 0.180% of Mo, 0.020% of V, and 0.020% of Al, an alloy steel for a railway vehicle coupler able to meet the target conditions for all mechanical properties including the hardness HB condition may be manufactured.",False,0.3154138922691345,0.8495196116796783,72,83,-11,426,464,-38
"[그리고, 상기와 동일한 조성으로 이루어진 합금강에 대한 한국화학융합시험연구원(KTR)에서의 2차 테스트에서는 템퍼링(Tempering)에 해당하는 3차 열처리 온도만 580℃로 달리하여 전술한 세 차례의 열처리와 동일한 조건으로 열처리 작업을 수행한 후 기계적 성질들을 측정하였다.]","In addition, in the second test by the KTR for the alloy steel having the same composition as above, the heat treatment was performed in the same conditions as the foregoing three heat treatments, except for varying the temperature of the third heat treatment corresponding to tempering to be 580°C, and then, the mechanical properties thereof were measured.",True,0.1872331351041793,0.8891821075245909,30,58,-28,159,358,-199
"[그 결과, 항복강도(Y/P)를 제외한 모든 기계적 성질들에 대한 목표조건들을 충족시키는 것으로 확인되었는데, 항복강도(Y/P)는 목표치에서 약 3.2% 정도 미달되는 것으로 확인되었다.]","As a result, it was found that the target conditions for all mechanical properties except for the yield strength Y/P were met.",False,0.4158923625946045,0.727415774273667,20,22,-2,105,126,-21
"[전술한 (표 3) 및 (표 4)에서 산화마그네슘(MgO) 나노입자 또는 99중량%의 산화규소(SiO, Sub[attributes={}; value=[2]], )와 1중량%의 탄화규소(SiC)의 조합으로 이루어진 물질의 나노입자(nanopaticle) 첨가에 의해 항복강도(Y/P)를 향상시킬 수 있는 것을 확인하였으므로, 3차 열처리 온도를 580℃로 하는 경우에는 합금강에 산화마그네슘(MgO) 나노입자와 9중량%의 산화규소(SiO, Sub[attributes={}; value=[2]], )와 1중량%의 탄화규소(SiC)의 조합으로 이루어진 물질의 나노입자 중 어느 하나를 선택하여 첨가시킬 경우 항복강도(Y/P)를 포함하는 모든 기계적 성질들의 목표조건들을 충족시킬 수 있는 철도차량 연결기용 합금강을 제조할 수 있게 된다.]","In a situation in which the temperature of the third heat treatment is 580°C, when one of the MgO nanoparticles and the nanoparticles made from the material combination of, by weight, 99% of SiO2 and 1% of SiC is selectively added to the alloy steel, an alloy steel for a railway vehicle coupler able to meet the target conditions for all mechanical properties except for the yield strength Y/P may be manufactured.",False,0.372239887714386,0.8081842880895747,70,72,-2,410,415,-5
"[다음, 탄소(C) 0.220중량%, 규소(Si) 0.430중량%, 망간(Mn) 1.200중량%, 인(P) 0.016중량%, 황(S) 0.006중량%, 크롬(Cr) 0.260중량%, 니켈(Ni) 0.250중량%, 구리(Cu) 0.030중량%, 몰리브덴(Mo) 0.150중량%, 바나듐(V) 0.020중량% 및 알루미늄(Al) 0.030중량%을 포함하여 이루어진 합금강의 경우 열처리 시간의 단축시킴과 동시에 경도(HB)가 목표범위를 초과하는 것을 방지하기 위해 템퍼링(Tempering)에 해당되는 열처리만을 수행한 후 기계적 성질들을 측정하였는데, 열처리는 580℃의 온도에서 4시간 동안 수행한 후 공랭시켰다.]","Next, in the alloy steel including, by weight, 0.220% of C, 0.430% of Si, 1.200% of Mn, 0.016% of P, 0.006% of S, 0.260% of Cr, 0.250% of Ni, 0.030% of Cu, 0.150% of Mo, 0.020% of V, and 0.030% of Al, the mechanical properties thereof were measured after the heat treatment corresponding to tempering was performed in order to reduce a heat treatment time and prevent the hardness HB from exceeding the target range.",False,0.2681970596313476,0.8612698984268342,54,75,-21,344,416,-72
"[그 결과, 항복강도(Y/P)와 인장강도(T/S)를 제외한 다른 기계적 성질들에 대한 목표조건들을 충족시키는 것으로 확인되었으며, 항복강도(Y/P)와 인장강도(T/S)는 각각 목표치에서 약 6.2%와 약 4.1% 만큼 미달되는 것으로 확인되었다.]","As a result, it was found that the target conditions for the mechanical properties except for the yield strength Y/P and the tensile strength T/S were met.",False,0.4362372756004333,0.7276317974875796,25,27,-2,138,155,-17
"[전술한 바와 같이, 산화마그네슘(MgO) 나노입자 또는 99중량%의 산화규소(SiO, Sub[attributes={}; value=[2]], )와 1중량%의 탄화규소(SiC)의 조합으로 이루어진 물질의 나노입자를 합금강에 첨가하는 경우, 경도(HB)에 큰 변화없이 항복강도(Y/P)와 인장강도(T/S)를 향상시킬 수 있으므로, 탄소(C) 0.220중량%, 규소(Si) 0.430중량%, 망간(Mn) 1.200중량%, 인(P) 0.016중량%, 황(S) 0.006중량%, 크롬(Cr) 0.260중량%, 니켈(Ni) 0.250중량%, 구리(Cu) 0.030중량%, 몰리브덴(Mo) 0.150중량%, 바나듐(V) 0.020중량% 및 알루미늄(Al) 0.030중량%을 포함하여 이루어진 합금강에 산화마그네슘(MgO) 나노입자 또는 99중량%의 산화규소(SiO, Sub[attributes={}; value=[2]], )와 1중량%의 탄화규소(SiC)의 조합으로 이루어진 물질의 나노입자를 첨가하여 580℃의 온도에서 4시간 동안 열처리하게 되면 항복강도(Y/P)와 인장강도(T/S)를 포함하는 모든 기계적 성질들의 목표조건들을 충족시킬 수 있는 철도차량 연결기용 합금강을 제조할 수 있게 된다.]","As described above, when the MgO nanoparticles or the nanoparticles made from the material combination of, by weight, 99% of SiO2 and 1% of SiC are added to the alloy steel, the yield strength Y/P and the tensile strength T/S may be improved without a significant change in the hardness HB.",False,0.3804943561553955,0.8074115430397963,92,51,41,610,290,320
"[따라서, 전술한 바와 같은 본 발명에 따른 철도차량 연결기용 합금강에 의하면 철도차량 연결기용 합금강에 AAR 타입 연결기와 CA-3 타입 연결기에 대한 기계적 성질 규정에 필수 성분으로 포함되어 있는 성분들 외에 합금강의 경도를 감소시킬 수 있도록 하는 나노입자 또는 합금강의 강도를 향상시킬 수 있도록 하는 나노입자를 선택적으로 첨가시킴으로써 AAR 타입 연결기의 기계적 성질에 대한 기준과 CA-3 타입 연결기에 대한 기계적 성질에 대한 기준을 동시에 충족시킬 수 있을 뿐만 아니라, 전세계적으로 가장 널리 사용되는 두 가지 연결기에 대한 기계적 성질 기준을 모두 충족시킬 수 있게 되어 전세계 대부분의 국가에서 범용적으로 사용될 수 있음과 동시에 현재 추진 중에 있는 동북아시아와 러시아를 연결하는 철도시스템에서 안전하게 사용될 수 있는 등의 다양한 장점을 갖는 것이다.]","Accordingly, since the nanoparticles able to reduce the hardness of the alloy steel and the nanoparticles able to improve the strength of the alloy steel to the alloy steel for a railway vehicle coupler are selectively added to the alloy steel for a railway vehicle coupler according to the present disclosure as described above, in addition to the ingredients included as essential ingredients in AAR couplers and CA-3 couplers, both the specification for the mechanical properties of AAR couplers and the specification for the mechanical properties of CA-3 couplers may be meet.",False,0.280861347913742,0.8601430619935552,109,92,17,437,580,-143
"[전술한 실시예들은 본 발명의 가장 바람직한 예에 대하여 설명한 것이지만, 상기 실시예에만 한정되는 것은 아니며, 본 발명의 기술적 사상을 벗어나지 않는 범위 내에서 다양한 변형이 가능하다는 것은 당업자에게 있어서 명백한 것이다.]","Although the foregoing embodiments have been described with respect to most exemplary examples of the present disclosure, it will be apparent to those skilled in the art that the present disclosure is not limited thereto and a variety of modifications is possible without departing from the technical principle of the present disclosure.",True,0.2991637587547302,0.7967186730453164,31,52,-21,129,337,-208
"[본 발명은 철도차량 연결기용 합금강에 관한 것으로, 보다 상세하게는 한국과 중국에서 주로 사용되는 AAR 연결기에 대해서 요구되는 기계적 성질과, 러시아 등에서 주로 사용되는 CA-3 연결기에 대해서 요구되는 기계적 성질을 모두 충족시킬 수 있도록 함으로써 동북아시아와 러시아를 연결하는 철도시스템에서 안전하게 사용할 수 있도록 하는 철도차량 연결기용 합금강에 관한 것이다.]",The present disclosure relates to an alloy steel for a railway vehicle coupler.,False,0.669350802898407,0.5665462313523864,48,13,35,211,79,132
[내용없음],"More particularly, the present disclosure relates to an alloy steel for a railway vehicle coupler, the alloy steel being able to meet all mechanical properties required for AAR couplers mainly used in Korea (i.e., the Republic of Korea) and China (i.e., the People's Republic of China) and mechanical properties required for CA-3 couplers mainly used in Russia (i.e., the Russian Federation) and the like, thereby enabling the railway vehicle coupler to be safely used in the railway system connecting Russia and the other Northeast Asian countries.",False,1.1835933923721311,0.1845215087831023,1,86,-85,6,549,-543
횡편기{FLATBED KNITTING MACHINE},[Technical Field],False,0.8763605952262878,0.3264114631372343,3,2,1,29,17,12
"[본 발명은, 니들베드(needle bed)의 길이방향으로 왕복이동하는 캐리지(carriage)에 탑재되어, 편성동작을 하게 하는 편침(編針)을 선택하기 위한 선침기구(選針機構)를 구비하는 횡편기에 관한 것이다.]","The present invention relates to a flatbed knitting machine including a needle selection mechanism mounted on a carriage configured to reciprocate along a longitudinal direction of needle beds, for selecting knitting needles to perform knitting operation.",True,0.2567194104194641,0.854895927983764,19,36,-17,119,255,-136
"[종래부터, 니들베드의 길이방향으로 왕복이동하는 캐리지는, 편침을 구동하여 편성동작을 하게 하는 캠시스템(cam system)과 함께, 구동의 대상이 되는 편침을 선택하기 위한 선침기구를 탑재하고 있다.","Conventionally, the carriage which reciprocates along the longitudinal direction of the needle beds is equipped with the cam system which drives knitting needles to perform knitting operation, and a needle selection mechanism for selecting the knitting needles to be driven.",True,0.3009521961212158,0.8167340393446115,22,40,-18,113,274,-161
"니들베드는, 니들베드갭(needle bed gap)을 사이에 두고 대향(對向)하도록 적어도 전후 한 쌍 설치된다.",At least one pair of front and rear needle beds are disposed so as to face each other across a needle bed gap.,True,0.2272923290729522,0.8289070365697427,12,23,-11,63,110,-47
"편침은, 니들베드의 길이방향을 따라 일정한 피치(pitch)로 나란하게 형성되는 복수의 니들홈(needle groove)에 각각 수용되고, 니들홈 내를 슬라이딩하여, 니들베드갭에 대하여 진퇴하는 방향으로 구동된다.","The knitting needles are housed in a plurality of needle grooves arranged in parallel at a constant pitch along the longitudinal direction of the needle beds so as to slide in the needle grooves, and are driven in the direction of advancing to and retracting from the needle bed gap.",True,0.2596858441829681,0.8306500039875443,21,50,-29,119,283,-164
"편침의 선택은, 편침에 형성되는 버트(butt)의 니들홈으로부터의 돌출상태로 반영된다.","The selection of the knitting needle is reflected in protruding states of butts from the needle groove, each butt disposed in the knitting needle.",True,0.4074061810970306,0.7105535654203848,8,24,-16,48,146,-98
"편침의 기본적인 편성동작은, 니트(knit), 턱(tuck) 및 미스(miss)의 3종이고, 선침기구는 이 3종을 구별하여 대상이 되는 편침을 캠시스템의 입구측에서 선택하는 것을 기본으로 하고 있다(예를 들면, 특허문헌1, 2, 3을 참조).]","The basic knitting operations of the knitting needle includes three types: knit, tuck and miss, and the needle selection mechanism is configured to basically select a target knitting needle according to the selection out of the three types in the entry side of the cam system (refer to, for example, Patent Citations 1, 2, 3).",True,0.1951546967029571,0.8763428732747788,27,55,-28,136,326,-190
"[편침은, 니들베드갭측의 선단(先端)에 스티치 형성을 위한 훅(hook)을 구비함과 아울러, 니들베드갭으로부터 떨어져 있는 꼬리부측에, 선침기구에 의한 선택을 받기 위한 실렉터(selector) 및 실렉트잭(select jack)을 구비한다.","Each of the knitting needle has a hook for forming a knitted loop on the tip thereof in the needle bed gap side, and a selector and a select jack for receiving the selection made in the needle selection mechanism on the tail part side apart from the needle bed gap.",True,0.316854327917099,0.8184437815809683,23,51,-28,135,265,-130
"실렉터는, 2회의 선택을 받아서 실렉트잭을 3종의 포지션, 예를 들면 B포지션, H포지션 및 A포지션으로 안내하도록 구동된다.","The selector is driven to guide the select jack to one of three positions, for example, a B-position, an H-position, and an A-position, in response to receive two times selection.",True,0.2349323034286499,0.8392914630379686,15,30,-15,70,179,-109
"특허문헌1은, 실렉터의 선택을, 실렉터에 형성되는 선택버트(選擇butt)에 대한 가압의 유무에 의하여 한다.",Patent Citation 1 discloses the selection for the selector according to whether or not a selection butt disposed in the selector is pressed.,True,0.2608904540538788,0.8379361155322195,11,23,-12,60,140,-80
"특허문헌2, 3은, 실렉터의 선택을, 실렉터를 자기적(磁氣的)으로 흡착하고 있는 상태로부터의 해방(解放)의 유무에 의하여 한다.","Patent Citations 2, 3 disclose the selection for the selector according to whether or not the selector is released from the state of being attracted magnetically.",True,0.2022181153297424,0.856469242440833,13,26,-13,71,162,-91
"특허문헌1, 2는, 선택된 실렉터에 의하여 실렉트잭을, 1회째의 비선택(非選擇)에 의하여 B포지션, 1회째의 선택 및 2회째의 비선택에 의하여 H포지션, 2회째에도 선택에 의하여 A포지션으로 안내한다.","Patent Citations 1, 2 disclose that the selector after the selection guides the select jack to the B-position according to the non-selection in the first time, to the H-position according to the selection in the first time and the non-selection in the second time, or to the A-position according to the selection both in the first time and the second time.",True,0.2423292249441146,0.850974879633513,22,61,-39,112,356,-244
"특허문헌3은, 1단째의 선택에 의하여 A포지션, 1단째의 비선택 및 2단째의 선택에 의하여 H포지션, 2단째에도 비선택에 의하여 B포지션으로 안내한다.","Patent Citation 3 discloses the guiding to the A-position according to the selection in the first stage, to the H-position according to the non-selection in the first stage and the selection in the second stage, to the B-position according to the non-selection both in the first stage and the second stage.",True,0.1773212552070617,0.8861548290441928,17,51,-34,84,306,-222
"안내를 받은 실렉트잭은, 각 궤도에 배치되는 프레서(presser)로부터의 가압을 버트에서 받는다.",The guided select jack receives at the butt thereof press from a presser disposed in each path.,True,0.259463906288147,0.8064223252987744,10,17,-7,55,95,-40
"프레서는, 니트, 턱 및 미스에 대응하는 것을, A포지션, H포지션 및 B포지션에 대응하는 버트의 궤도에 각각 배치하는 것을 기본으로 한다.","The pressers corresponding to the knit, the tuck and the miss are basically disposed in the paths corresponding to the A-position, the H-position and the B-position, respectively.",True,0.2355765849351883,0.8268843308407712,19,27,-8,78,179,-101
"편침을 안내하는 새로운 구동경로를 캠시스템에 형성하여, 프레서의 일부 또는 전부를 가동식(可動式)으로 하거나, 버트에 대한 작용을 중간단계에서 멈추거나 함으로써, 편침은 기본적인 편성동작과는 다른 동작이 되도록 구동하는 것도 가능하다.]","The cam system may be provided additionally with a new drive path for guiding a knitting needle, and some or all of the pressers may be made movable or may act on the butt to an intermediate position, so that it is possible for the knitting needle to be driven differently from the basic knitting operation.",True,0.2499983608722686,0.8413316024041804,27,56,-29,132,307,-175
"[PatentCitationText[attributes={}; value=[: 국제공개2007-074944호 공보]], PatentCitationText[attributes={}; value=[: 일본국 공개특허 특개평09―241952호 공보]], PatentCitationText[attributes={}; value=[: 일본국 공개특허 특개2013―64207호 공보]]]",[Patent Literature],False,0.4834358394145965,0.6249356124128316,16,2,14,210,19,191
"[종래의 선침기구에 의하여 편침을 3개의 포지션으로 선택하는 것만으로는, 혼재시킬 수 있는 편성동작에 수적인 한계가 발생한다.","In the conventional needle selection mechanisms only three positions are allowed to select for knitting needles, and the number of types of knitting operation in a mixed manner is restricted.",True,0.4288301467895508,0.7010257788766547,15,30,-15,70,191,-121
"예를 들면 캠시스템에 있어서 편침을 니들베드갭으로부터 퇴출시키도록 인입하는 스티치캠(stitch cam)의 인입캠면(引入cam面)에 후반(後半)에서 낮아지는 고저차(高低差)를 형성하여 두고, 편침에 형성되는 버트의 돌출량을 고저차에 따라 절체(切替)하면, 니들베드갭에 있어서 훅에서 급사(給絲)를 받는 편침에 대한 인입량을 절체하여 형성되는 스티치의 크기를 절체하는 스티치값이 서로 다른 동작이 가능하다.","For example, if the stitch cam disposed in the cam system so as to draw and retract a knitting needle from the needle bed gap is formed with difference in height on its drawing cam face so as to be lower in posterior half, and the butt disposed on the knitting needle is made to protrude with a different protruding amount according to the height, it is possible to perform a second stitch operation to change drawing amount of the knitting needle drawing a yarn fed to the hook thereof in the needle bed gap so as to form a knitted loop in different sizes, that is the stitch density is changed.",True,0.2740705609321594,0.8353231721051684,41,112,-71,226,596,-370
"스티치(widening stitch)를 형성하는 스플릿 편성(split knitting)의 동작도, 캠시스템이나 프레서의 부분적인 변경에 의하여 가능하게 된다.","In addition, partial change of the cam system or the pressers enables the split knit operation of forming a split stitch by transferring an old loop to the hook of a knitting needle of the facing needle bed instead of knocking-over, during the formation of a knitted loop.",False,0.4401363432407379,0.7138881469932833,14,48,-34,89,272,-183
"그러나 이들 동작 중 어느 하나를 3종의 기본동작과 혼재시키는 것은, 선택할 수 있는 포지션이 부족하여 불가능하게 된다.]","However, it is impossible to mix either type of these operations with the three types of basic operation, due to a lack of selectable positions.",False,0.1618258506059646,0.878663200633667,17,25,-8,68,144,-76
"[선침기구에 의하여 4개의 포지션 이상의 선택을 가능하게 하면, 3종의 기본동작과는 다른 동작을 혼재시킬 수 있다.","If four or more positions could be allowed to select in the needle selection mechanism, another type of operation might be additionally mixed with the three types of basic operation.",False,0.2764945328235626,0.8043080807669122,15,30,-15,64,182,-118
"그러나 그러한 선침기구는, 캐리지의 주행방향인 좌우방향이나, 편침의 진퇴방향인 전후방향으로 대형화되어 버린다.","However, such a needle selection mechanism increases in size in the left-and-right direction in which the carriage moves and in the back-and-forth direction in which the knitting needles advance and retract.",True,0.3841956853866577,0.7262895910919269,11,31,-20,61,207,-146
"선침기구가 대형화되면, 탑재되는 캐리지도 대형화되어, 니들베드의 길이방향의 주행 스트로크(走行 stroke)도 커져 버린다.","As the needle selection mechanism increases in size, the carriage to be mounted increases in size, and the moving stroke becomes longer in the longitudinal direction of the needle bed.",True,0.3403259217739105,0.7569409006081008,12,30,-18,69,184,-115
"캐리지의 주행 스트로크가 커지면, 주행속도가 동일하다면 주행에 시간이 걸리게 되어, 편성효율이 저하되어 버린다.","As the moving stroke of the carriage becomes longer, the moving takes longer time when moving at the same speed, resulting in reduction in the knitting efficiency.",True,0.2185603678226471,0.8319843094034565,13,27,-14,62,163,-101
"선침기구에 의한 선택 수를 늘리지 않고, 캠시스템이나 프레서의 절체에 의하여 많은 종류의 동작을 선택할 수 있도록 하더라도, 절체 전후에서 캐리지의 주행을 일단 정지하고 역방향으로 아무것도 하지 않는 공주행(空走行)을 한 후에 반전되는 반환이 필요하게 된다.","Even if a greater number of types of operation are made selectable by switching of the cam system or the pressers without the increase of the number of times of selection in the needle selection mechanism, the moving of the carriage needs to be interrupted before and after the switching, and the kick back of direction change after moving in an idle manner in the reverse direction.",True,0.2718803584575653,0.8257150371999521,34,67,-33,144,383,-239
캐리지의 반환도 편성효율을 저하시켜 버린다.],The kick back of the carriage also reduces the knitting efficiency.,True,0.2611903846263885,0.7724763354221283,5,11,-6,25,67,-42
"[본 발명의 목적은, 선택할 수 있는 편성동작의 수를 늘려서, 편성동작 혼재 시의 편성효율을 개선할 수 있는 횡편기를 제공하는 것이다.]",The object of the present invention is to provide a flatbed knitting machine which provides a larger number of types of selectable knitting operation and is improved in knitting efficiency at the time of knitting operation in a mixed manner.,True,0.4437066316604614,0.7133504144080761,19,40,-21,76,241,-165
"[본 발명은, 니들베드갭을 사이에 두고 대향하도록 설치되는 적어도 전후 한 쌍의 니들베드,]",[Technical Solution],False,0.9326207637786864,0.3064575733413537,12,2,10,51,20,31
"[니들베드의 길이방향을 따라 일정한 피치로 나란하게 형성되는 복수의 니들홈에 각각 수용되는 복수의 편침,]","The present invention is a flatbed knitting machine provided with: at least a pair of front and rear needle beds disposed so as to face each other across a needle bed gap; a plurality of knitting needles respectively housed in a plurality of needle grooves arranged in parallel at a constant pitch along a longitudinal direction of the needle beds; a carriage configured to reciprocate along the longitudinal direction of the needle beds; a cam system mounted on the carriage and configured to make the knitting needles perform knitting operation by driving the knitting needles in a direction of advancing to and retracting from the needle bed gap; and a needle selection mechanism mounted on the carriage and configured to select the knitting needle for the knitting operation, wherein each of the knitting needles including: a select jack having a selection butt configured to receive action from the cam system, and being guided to various positions including a B-position corresponding to a base-state position, an H-position corresponding to an intermediate position and being arranged closer to the needle bed gap in a direction of advancing to the needle bed gap than the B-position, and an A-position corresponding to an advancing position, thereby various types of knitting operation being allowed in a selectable manner to be performed by the cam system with the knitting needles, according to difference in press received by the selection butt from the cam system in each of the positions; and a selector driven to pass through one of a base path in a case of the knitting needle not selected, an intermediate path in a case of the knitting needle selected and an advancing path, corresponding to a selection state of the knitting needle by the needle selection mechanism, the selector configured to guide the select jack to the H-position or the A-position by engagement with the select jack at a time of the selector passing through the intermediate path or the advancing path respectively, and the needle selection mechanism including a selector drive cam configured to move the selector along the previously set path so as to guide the select jack by the engagement with the selector, characterized in that the flatbed knitting machine further comprising: an entry-side needle selection mechanism configured to select the knitting needle for a first half of the knitting operation with the knitting needle advancing to the needle bed gap, in an entry side of the cam system; an intermediate needle selection mechanism configured to select the knitting needle for a second half of the knitting operation with the knitting needle retracting from the needle bed gap, in an intermediate position of the cam system; and a pressing cam configured to press the select jack or the selector in a direction to sink into the needle groove, wherein the engagement of the select jack with the selector being switched by the press applied by the pressing cam, in between a first stage of the select jack in the B-position engages with the selector and a second stage of the select jack in the H-position or the A-position engages with the selector, and the intermediate needle selection mechanism is provided with a front position arranged closer to the needle bed gap in the direction of advancing to the needle bed gap than the A-position as a position for the select jack to be guided in the engagement in the second stage.",False,0.9315253496170044,0.3853113975271854,13,570,-557,59,3428,-3369
"[니들베드의 길이방향으로 왕복이동하는 캐리지,]","In the present invention said pressing cam is disposed in said entry-side needle selection mechanism so as to press said selection butt of said select jack, the select jack has an overhang part on a root part of the selection butt in a rear end side corresponding to a direction of retracting from said needle bed gap, and the overhang part is formed to overhang in the rear end side, and a tip part of said selector in the direction of advancing to the needle bed gap is configured to be engaged with a rear end of the selection butt of the select jack sunk into the needle groove by the pressure applied by the pressing cam in said first stage, and to be engaged with a rear end of the overhang part in said second stage.",False,1.101887822151184,0.242686650970366,4,137,-133,26,723,-697
"[캐리지에 탑재되어, 편침을 니들베드갭으로 진퇴하는 방향으로 구동하여 편성동작을 하게 하는 캠시스템, 및]","In the present invention said pressing cam is disposed in said intermediate needle selection mechanism so as to press a tail part disposed in said selector in a direction of retracting from said needle bed gap, said select jack has, on a rear end, a protrusion protruding in a shallow direction in said needle groove, said selector has, on a rear end in the direction of retracting from the needle bed gap, a protrusion protruding in a deep direction in the needle groove, and a tip part of the selector in the direction of advancing to the needle bed gap is configured to be engaged with a rear end of said selection butt of the select jack in said first stage, and the protrusion sunk into the needle groove by the press applied by the pressing cam is configured to be engaged with the protrusion of the select jack in said second stage.",False,0.981492817401886,0.3615063752827827,12,153,-141,59,839,-780
"[ 캠시스템의 작용을 받는 선택용 버트를 구비하고, 기저위치의 B포지션, B포지션보다 니들베드갭으로 진출하는 방향으로 설정되는 중간위치의 H포지션 및 진출위치의 A포지션을 포함하는 다른 위치로 안내되고, 각 위치에서 선택용 버트가 받는 캠시스템으로부터의 가압의 차이에 의하여, 캠시스템이 편침에 하는 편성동작을 다르게 할 수 있는 실렉트잭과,]","In the present invention each of said entry-side needle selection mechanism and said intermediate needle selection mechanism includes an attraction actuator capable of releasing said selector from being attracted by magnetic force, at a plurality of positions in response to said selecting, and said selector drive cam is configured to drive and guide the selector selectively to various paths according to the positions of releasing from attraction by the attraction actuator.",False,0.546899139881134,0.6982625004193685,41,71,-30,192,477,-285
"[ 선침기구에 의한 편침의 선택상태에 대응하여, 편침이 비선택인 경우의 기저경로, 편침이 선택되는 경우의 중간경로, 또는 진출경로 중 어느 하나를 통과하도록 구동되고, 중간경로 또는 진출경로 중 어느 하나를 통과하면, 실렉트잭과 결합하여 실렉트잭을 H포지션 또는 A포지션으로 각각 안내할 수 있는 실렉터를]",In the present invention said second half of said knitting operation includes a second stitch operation to change drawing amount by a stitch cam disposed in said cam system to make said knitting needle retract from said needle bed gap.,False,1.143548607826233,0.3274145866071211,39,40,-1,171,235,-64
"[포함하고,]",[Advantageous Effects of Invention],False,0.7901492118835449,0.384001472463055,1,4,-3,7,35,-28
"[선침기구는, 실렉터를 미리 설정되는 경로를 따라 이동시켜서, 결합을 통하여 실렉트잭을 안내하도록 구동되는 실렉터 구동캠을 포함하는]","According to the present invention, the needle selection is done by use of a selector and a select jack, thereby enabling to utilize a basic combination having been used with actual performance.",False,0.9711684584617616,0.3523062570718124,15,32,-17,74,194,-120
"[ 캠시스템에 대한 입구측에서, 편침이 니들베드갭으로 진출하는 편성동작의 전반부분에 관하여 편침을 선택하는 입구측 선침기구와,]","In an intermediate needle selection mechanism disposed in the intermediate position of a cam system, the engagement point of the selector with the select jack of the knitting needle selected by an entry-side needle selection mechanism so as to be driven by the cam system is switched from the first-stage engagement in the entry-side needle selection mechanism to the second-stage engagement, so that another type of knitting operation becomes selectable additionally.",False,0.7919279932975769,0.5107047275297055,14,71,-57,71,468,-397
"[ 캠시스템의 중간에서, 편침이 니들베드갭으로부터 퇴출하는 편성동작의 후반부분에 관하여 편침을 선택하는 중간측 선침기구와,]","The entry-side needle selection mechanism and the intermediate needle selection mechanism achieves to increase the number of types of selectable knitting operation in one run of a carriage, and are improved in knitting efficiency such as in the knitting operation in a mixed manner of basic knitting operation with another type of knitting operation.",False,0.997188925743103,0.335148820061307,13,54,-41,69,350,-281
[ 실렉트잭 또는 실렉터를 니들홈에 가라앉히는 방향으로 가압 할 수 있는 가압캠을],"Further according to the present invention, two-stage switching is possible in the engagement between the selector and the select jack with the press by the pressing cam to the select jack.",False,0.9814282059669496,0.3056784372478673,12,31,-19,46,189,-143
"[ 실렉터와 실렉트잭의 결합은, B포지션의 실렉트잭과 실렉터가 결합하는 제1단계와, H포지션 또는 A포지션의 실렉트잭과 실렉터가 결합하는 제2단계를, 가압캠에 의한 가압에 의하여 절체하고,]","The tip part of the selector is engaged with the rear end of the selection butt of the select jack in the first stage, and engaged with the rear end of the overhang part in the second stage, and thus the engaging part of the selector is used commonly.",False,0.5829880833625793,0.6426476218418682,21,49,-28,106,251,-145
"[ 중간측 선침기구에, 제2단계의 결합에 의하여 실렉트잭이 안내되는 위치로서 A포지션보다 니들베드갭으로 진출하는 방향의 전진위치가 형성되는 것을]","Further according to the present invention, two-stage switching is possible in the engagement between the selector and the select jack with the press by the pressing cam to the selector.",False,0.9101841449737548,0.427821179587971,16,30,-14,81,186,-105
"[또한 본 발명에서 상기 가압캠은, 상기 입구측 선침기구에 형성되어 상기 실렉트잭의 상기 선택용 버트를 가압하고,]",The combination of engaging points between the selector and the select jack are switchable in the first stage or in the second stage.,False,0.947129726409912,0.3647789321876461,15,23,-8,64,133,-69
"[실렉트잭은, 선택용 버트에 의하여 상기 니들베드갭으로부터 퇴출되는 방향이 되는 후단의 베이스 부분에, 후단측으로 돌출되는 돌출부를 구비하고,]","Further according to the present invention, the entry-side needle selection mechanism and the intermediate needle selection mechanism achieve to avoid size from increase in the left-and-right direction.",False,0.9182770848274232,0.4037802434375135,16,27,-11,80,202,-122
"[상기 실렉터는, 니들베드갭으로 진출하는 방향의 선단부가, 상기 제1단계에서 가압캠에 의한 가압에 의하여 니들홈에 가라앉는 실렉트잭의 선택용 버트의 후단과 결합하고, 상기 제2단계에서 돌출부의 후단과 결합하는 것을]","Further according to the present invention, the intermediate needle selection mechanism achieves to perform the second stitch operation in a mixed manner in the operation of drawing a knitting needle by a stitch cam.",False,0.96865314245224,0.4037977921466149,25,34,-9,120,216,-96
[특징으로 한다.],[Brief Description of Drawings],False,0.6845720410346985,0.4437541962819037,2,4,-2,10,31,-21
"[또한 본 발명에서 상기 가압캠은, 상기 중간측 선침기구에 형성되어 상기 실렉터에 의하여 상기 니들베드갭으로부터 퇴출되는 방향이 되는 꼬리부를 가압하고,]","[ Fig.1] Fig. 1 is a simplified cam layout showing a schematic configuration of a flatbed knitting machine 1 provided with a cam system 2 and a needle selection mechanism 10, and a partial side view of a knitting needle 3 to be controlled, as an example 1 according to the present invention.",False,0.9854955077171326,0.3641173042340807,19,53,-34,86,291,-205
"[상기 실렉트잭은, 후단에 상기 니들홈 내에서 얕아지는 방향으로 돌출되는 돌기를 구비하고,]",[ Fig.2] Fig. 2 is a partial cam layout of the cam system 2 including the configurations of an entry-side needle selection mechanism 11 and an intermediate needle selection mechanism 12 shown in Fig. 1.,False,1.01067316532135,0.2759691482395018,11,35,-24,51,202,-151
"[상기 실렉터는, 니들베드갭으로부터 퇴출되는 방향이 되는 후단에, 니들홈 내에서 깊어지는 방향으로 돌출되는 돌기를 구비하고, 니들베드갭으로 진출하는 방향의 선단부가, 상기 제1단계에서 실렉트잭의 상기 선택용 버트의 후단과 결합하고, 상기 제2단계에서, 가압캠에 의한 가압에 의하여 니들홈에 가라앉는 돌기가 실렉트잭의 돌기와 결합하는 것을]",[ Fig.3] Fig. 3 is partial side views showing engagement points which are switched by a pressing cam 15 shown in Fig. 1 and at which a select jack 6 is moved by a selector 7.,False,0.9953121542930604,0.3912015692747194,39,36,3,189,174,15
[특징으로 한다.],[ Fig.4] Fig. 4 is partial side views showing positional relations between the selector 7 and the select jack 6 in the entry-side needle selection mechanism 11.,False,1.0240294933319092,0.2551548273774526,2,27,-25,10,160,-150
"[또한 본 발명에서 상기 입구측 선침기구 및 상기 중간측 선침기구는, 상기 실렉터를 자력에 의하여 흡인하는 상태를, 상기 선택을 받아서 복수의 위치에서 해제할 수 있는 흡인 액추에이터를 포함하고,]",[ Fig.5] Fig. 5 is partial side views showing positional relations between the selector 7 and the select jack 6 in the intermediate needle selection mechanism 12.,False,0.8401728272438049,0.4875531539993916,27,27,0,110,162,-52
"[상기 실렉터 구동캠은, 흡인 액추에이터에 의한 흡인이 해제된 위치에 따라 다른 경로로 안내하도록 실렉터를 구동하는 것을]",[ Fig.6] Fig. 6 is partial side views showing engagement points which are switched in an example 2 according to the present invention and at which a select jack 46 is moved by a selector 47.,False,0.9003341794013977,0.4028170453653642,16,36,-20,68,190,-122
"[또한 본 발명에서 상기 편성동작의 상기 후반부분은, 상기 편침을 상기 니들베드갭으로부터 퇴출시키기 위하여 상기 캠시스템에 형성되는 스티치캠에 의한 인입량을 다르게 하는, 스티치값이 다른 편성동작을 포함하는 것을]","[ Fig.7] Fig. 7 is partial side views showing positional relations between the selector 47 and the select jack 46, including switching in two stages of the engagement points.",False,1.028088927268982,0.3490901021576182,26,29,-3,119,174,-55
[특징으로 한다.],[Description of Embodiments],False,0.4939736723899841,0.6076047339226329,2,3,-1,10,28,-18
"[본 발명에 의하면, 선침은 실렉터와 실렉트잭을 사용하여 이루어지기 때문에, 사용실적이 있는 기본적인 조합을 이용할 수 있다.",Fig. 1 to Fig. 5 relate to the configuration of the needle selection mechanism 10 of the flatbed knitting machine 1 as an example 1 according to the present invention.,False,0.917385995388031,0.3735720958147049,16,30,-14,70,167,-97
"입구측 선침기구와 중간측 선침기구는, 1회의 캐리지 주행에 의하여 선택할 수 있는 편성동작의 수를 늘려서, 기본적인 편성동작과는 다른 편성동작 혼재 시 등의 편성효율을 개선할 수 있다.]","In Fig. 1 and Fig. 2, the areas with diagonals crossing each other correspond to inclined surfaces.",False,1.1049871444702148,0.2017036675287468,25,17,8,104,99,5
"[또한 본 발명에 의하면, 가압캠에 의한 실렉트잭에 대한 가압에 의하여, 실렉터와 실렉트잭의 결합에 대하여 2단계의 절체를 할 수 있다.",Fig. 6 and Fig. 7 schematically show the guiding operation by the selector 47 to the select jack 46 in the example 2 according to the present invention.,False,0.832632839679718,0.4643742595002647,19,28,-9,76,152,-76
"[선회 조작 레버(19)와 컨트롤 밸브(25)의 사이의 파일럿 회로에는, 차체 동작 제한 장치의 하나로서 선회 파일럿압 차단 전자 밸브(34)가 마련되어 있다.]",A swing pilot pressure interruption solenoid valve 34 is included as a vehicle body operation limiting device in the pilot circuit between the swing operation lever 19 and the control valve 25.,True,0.2687592506408691,0.8531827534437914,20,32,-12,90,193,-103
"[선회 파일럿압 차단 전자 밸브(34)는, 비제어 시(0mA)에는 회로 연통 상태이며, 차체 컨트롤러(14)가 출력하는 전류(mA)가 커짐으로써 회로 차단 상태가 되어, 선회 동작이 불가능해진다.]",The swing pilot pressure interruption solenoid valve 34 is in a circuit fluid communication state when not controlled (0 mA).,False,0.4041236340999601,0.7753796200071231,22,20,2,110,125,-15
"[또한, 주행 조작 레버(20)와 컨트롤 밸브(25)의 사이의 파일럿 회로에는, 차체 동작 제한 장치의 하나로서 주행 파일럿압 차단 전자 밸브(35)가 마련되어 있다.]","Moreover, a travel pilot pressure interruption solenoid valve 35 is included as a vehicle body operation limiting device in the pilot circuit between the travel operation lever 20 and the control valve 25.",True,0.2210322171449661,0.8821549039509258,21,33,-12,94,205,-111
"[주행 파일럿압 차단 전자 밸브(35)는, 비제어 시(0mA)에는 회로 연통 상태이며, 차체 컨트롤러(14)가 출력하는 전류(mA)가 커짐으로써 회로 차단 상태가 되어, 주행 동작이 불가능해진다.]",The travel pilot pressure interruption solenoid valve 35 is in a circuit fluid communication state when not controlled (0 mA).,False,0.4321183264255523,0.7645550771509032,22,20,2,110,126,-16
[(시스템 구성의 설명 본 발명에서의 추가 부분)],(Description of a system configuration; additional aspect according to the present invention),True,0.1581788957118988,0.8929303961807881,7,12,-5,28,93,-65
"[본 실시예에서는, 운전실(4) 내에 제어 해제 장치로서 모멘터리형의 누름 버튼 스위치인 제어 해제 스위치(36)를 구비하고 있다.]","According to the present embodiment, the cabin 4 houses therein a control canceling switch 36 including a momentary pushbutton switch as a control canceling device.",True,0.3039181232452392,0.8373344533599332,16,25,-9,74,164,-90
"[제어 해제 스위치(36)가 눌려져 있지 않을 때, 제어 해제 스위치(36)는 OFF(단자간은 개방) 상태로 되어 있으며, 제어 해제 스위치(36)가 눌려져 있을 때, 제어 해제 스위치(36)는 ON(단자간은 도통) 상태로 되어 있다.","When the control canceling switch 36 is not pressed, the control canceling switch 36 is OFF (its terminals are open or disconnected).",False,0.2361688911914825,0.8783082641510174,29,22,7,131,133,-2
"차체 컨트롤러(14)는 제어 해제 스위치(36)의 ON/OFF 상태를 감시하고, 제어 해제 스위치(36)가 눌려져 있는지 여부를 인식한다.]",The vehicle body controller 14 monitors an ON/OFF state of the control canceling switch 36 to recognize whether the control canceling switch 36 is pressed or not.,True,0.1569383889436721,0.9240360529222847,15,27,-12,78,162,-84
"[제어 해제 스위치(36)는 조작 레버(19~21)의 그립 스위치의 하나로서 마련해도 되고, 조작 레버(19~21)와는 다른 장소에 있는 개별 스위치로서 형성해도 된다.]",The control canceling switch 36 may be provided as one of grip switches on the operation levers 19 through 21 or may be provided as an individual switch positioned in a location different from that of the operation levers 19 through 21.,True,0.1692550331354141,0.907115231161631,19,42,-23,95,236,-141
"[개별 스위치로서 설치한 경우, 제어 해제 스위치(36)를 누르기 위해서는 조작 레버로부터 손을 뗄 필요가 있고, 차체 동작 중에 제어 해제 스위치(36)를 누르는 상황이 된 경우에는, 오퍼레이터는 작업을 일시 중단할 필요가 있지만, 제어 해제 스위치(36)를 누르기 전에 오퍼레이터에게 주위 확인의 실시를 촉구한다고 하는 점에 있어서는, 개별 스위치의 쪽이 효과적이다.]","If the control canceling switch 36 is provided as an individual switch, then the operator is required to take his/her hands off the operation levers to press the control canceling switch 36.",False,0.4518284201622009,0.7529765575174998,48,32,16,208,190,18
[(제어부의 구성의 설명)],(Description of a controller makeup),True,0.4061653316020965,0.7176525576446995,3,5,-2,15,36,-21
"[도 4는, 본 실시예에 있어서의, 장해물 검출 시의 차체 동작 제한에 관한 컨트롤러(14)의 구성을 나타내는 도면이다.]",FIG. 4 is a diagram illustrating the makeup of the controller 14 for limiting operation of the vehicle body upon detection of an obstacle.,True,0.3412742912769317,0.7959596533527332,16,24,-8,68,138,-70
"[차체 컨트롤러(14)는, 장해물 검출 시에 차체 동작을 제한하기 위한 제어부로서, 동작 제한 제어부(37)를 가지고 있다.]",The vehicle body controller 14 has an operation limiting control section 37 as a control section for limiting operation of the vehicle body upon detection of an obstacle.,True,0.3082675337791443,0.8363317652160018,15,28,-13,70,170,-100
"[동작 제한 제어부(37)는, 차체의 제어 모드 상태가 통상 상태인지 일시 해제 상태인지 상시 해제 상태인지를 판정하기 위한 제어부로서, 제어 상태 전환 판정부(38)를 포함하고 있다.]","The operation limiting control section 37 includes a controlled state switching determining section 38 as a control section for determining whether a control mode state of the vehicle body is a normal state, a temporary cancelation state, or a permanent cancelation state.",True,0.2108619958162307,0.9003347177811211,24,42,-18,104,272,-168
"[또한, 동작 제한 제어부(37)는, 동작 제한 장치의 작동을 지령하는 제어부로서, 동작 제한 지령부(39)를 포함하고 있다.]",The operation limiting control section 37 also includes an operation limiting command section 39 as a control section for commanding the operation limiting device to work.,True,0.207395389676094,0.8917800863506877,15,26,-11,71,171,-100
"[차체 컨트롤러(14)는, 동작 제한 제어부(37) 외에, 각 검지 영역(10~13)의 검지 상태로부터 차체의 주위에 장해물이 있는지 여부를 판정하기 위한 검지 판정부(40)와, 각 조작압 센서(29~31)로부터의 입력 전압에 따라 차체 컨트롤러(14) 내에서 압력값(MPa)으로 변환된 각 조작압의 크기로부터 차체가 조작/비조작 상태인지 여부를 판정하기 위한 조작 상태 판정부(41)와, 동작 제한 지령부(39)의 선회 정지 지령 또는 주행 정지 지령을 받아 선회 파일럿압 차단 전자 밸브(34) 또는 주행 파일럿압 차단 전자 밸브(35)를 구동하는 전류값을 연산하기 위한 전자 밸브 구동부(42)와, 동작 제한 지령부(39)의 회전수 지령을 받아 엔진 제어 장치(23)에 지시하는 엔진 목표 회전수를 제한하기 위한 엔진 회전 제어부(43)를 가지고 있다.]","The vehicle body controller 14 has, other than the operation limiting control section 37, a detection determining section 40 for determining whether there is an obstacle in the periphery of the vehicle body or not from detected states of the detection areas 10 through 13, an operation state determining section 41 for determining whether the vehicle body is in an operation/non-operation state from the magnitudes of operation pressures converted into pressure values (MPa) depending on input voltages from the operation pressure sensors 29 through 31 in the vehicle body controller 14, a solenoid valve actuating section 42 for calculating an electric current value for actuating the swing pilot pressure interruption solenoid valve 34 or the travel pilot pressure interruption solenoid valve 35 in response to a swing stop command or a travel stop command from the operation limiting command section 39, and an engine rotation control section 43 for limiting a target engine rotational speed to be given to the engine controller 23 in response to a rotational speed command from the operation limiting command section 39.",True,0.1587392836809158,0.9197189856243464,92,177,-85,425,1124,-699
"[이들 제어부의 처리는, 엔진 시동 및 주위 검지 시스템 시동 후(가동 중)에는 차체 컨트롤러(14)의 제어 주기마다 항상 실행되고 있다.]",Processing sequences of these control sections are executed at all times in each of control periods of the vehicle body controller 14 after the engine has started and a periphery detection system has started (while the periphery detection system is in operation).,True,0.257841020822525,0.8580874451166633,19,42,-23,78,263,-185
[(각 제어부의 상세 설명)],(Description of details of the control sections),True,0.2622345983982086,0.8243544754535628,4,7,-3,16,48,-32
"[도 5~도 14를 통해, 도 4에서 나타낸 각 제어부의 상세를 설명한다.]",Details of the control sections illustrated in FIG. 4 will be described below with reference to FIGS. 5 through 14.,True,0.2031922936439514,0.864713169721026,11,20,-9,42,115,-73
[(각 제어부의 상세 설명 검지 판정부)],(Description of details of the control sections; the detection determining section),True,0.3986501097679138,0.7244115608659424,6,11,-5,23,83,-60
"[도 5는, 검지 판정부(40)의 처리 내용을 나타내는 플로우 차트이다.]",FIG. 5 is a flowchart of a processing sequence of the detection determining section 40.,True,0.4202313125133514,0.7226196052949836,9,15,-6,41,87,-46
"[우선 처음으로 3D 센서(6)가 검지 영역(10)에서 물체(사람·물건)를 검지하고 있는지 여부를 판정한다(단계 S1). 검지 영역(10)에서 검지하고 있으면, 차체가 검지 상태에 있다고 판정하여, 변수인 장해물 검지 상태 v1을 「검지」로 한다(단계 S6).]","First, the detection determining section 40 determines whether the 3D sensor 6 has detected an item (a person or an object) in the detection area 10 or not (step S1).",False,0.305988609790802,0.8313210991159539,29,30,-1,146,166,-20
"[검지 영역(10)에서 검지하고 있지 않으면, 3D 센서(7)가 검지 영역(11)에서 물체를 검지하고 있는지 여부를 판정한다(단계 S2). 검지 영역(11)에서 검지하고 있으면, 차체가 검지 상태에 있다고 판정하여, 변수인 장해물 검지 상태 v1을 「검지」로 한다(단계 S6).]","If the 3D sensor 6 has not detected an item in the detection area 10, then the detection determining section 40 determines whether the 3D sensor 7 has detected an item in the detection area 11 or not (step S2).",False,0.3007257580757141,0.8380693819522071,32,40,-8,156,210,-54
"[검지 영역(11)에서 검지하고 있지 않으면, 3D 센서(8)가 검지 영역(12)에서 물체를 검지하고 있는지 여부를 판정한다(단계 S3). 검지 영역(12)에서 검지하고 있으면, 차체가 검지 상태에 있다고 판정하여, 변수인 장해물 검지 상태 v1을 「검지」로 한다(단계 S6).]","If the 3D sensor 7 has not detected an item in the detection area 11, then the detection determining section 40 determines whether the 3D sensor 8 has detected an item in the detection area 12 or not (step S3).",False,0.3193711042404175,0.8281131191197529,32,40,-8,156,210,-54
"[검지 영역(12)에서 검지하고 있지 않으면, 3D 센서(9)가 검지 영역(13)에서 물체를 검지하고 있는지 여부를 판정한다(단계 S4). 검지 영역(13)에서 검지하고 있으면, 차체가 검지 상태에 있다고 판정하여, 변수인 장해물 검지 상태 v1을 「검지」로 한다(단계 S6).]","If the 3D sensor 8 has not detected an item in the detection area 12, then the detection determining section 40 determines whether the 3D sensor 9 has detected an item in the detection area 13 or not (step S4).",False,0.3168643116950989,0.8315656410012445,32,40,-8,156,210,-54
"[검지 영역(10~13) 중 어느 것에서도 물체를 검지하지 않으면, 차체가 비검지 상태에 있다고 판정하여, 변수인 장해물 검지 상태 v1을 「비검지」로 한다(단계 S5).]","If an item has not been detected in any of the detection areas 10 through 13, then the detection determining section 40 determines that the vehicle body is in a non-detection state, and sets the obstacle detection state v1 that is a variable to ""non-detection"" (step S5).",True,0.2640497088432312,0.8597688507674046,21,47,-26,96,271,-175
[(각 제어부의 상세 설명 조작 상태 판정부)],(Description of details of the control sections; the operation state determining section),True,0.2911376357078552,0.8193608448710831,7,12,-5,26,89,-63
"[도 6은, 조작 상태 판정부(41)의 처리 내용 중, 각 조작에 대하여 조작 상태를 판정하는 부분을 나타내는 플로우 차트이다.]","FIG. 6 is a flowchart of a portion for determining an operation state with respect to each event of operation, of a processing sequence of the operation state determining section 41.",True,0.2295707911252975,0.8718065625103109,18,31,-13,72,182,-110
"[우선 처음으로 선회 조작압이 조작 ON 문턱값 C1(예를 들면 0.5MPa) 이상인지 여부를 판정한다(단계 S33). 조작 ON 문턱값 C1 이상이면, 선회가 조작되고 있는 상태라고 판정하여, 변수인 선회 조작 상태 v10을 「조작중」으로 한다(단계 S34). 조작 ON 문턱값 C1 미만이면, 선회가 조작되고 있지 않은 상태라고 판정하여, 변수인 선회 조작 상태 v10을 「비조작」으로 한다(단계 S35).]","If the swing operation pressure is lower than the operation ON threshold value C1, then the operation state determining section 41 determines that a swing operation is not performed, and sets the swing operation state v10 that is a variable to ""non-operation"" (step S35).",False,0.4343310594558716,0.7823896396216533,51,44,7,230,271,-41
"[계속해서, 주행 조작압이 조작 ON 문턱값 C1(예를 들면 0.5MPa) 이상인지 여부를 판정한다(단계 S36). 조작 ON 문턱값 C1 이상이면, 주행이 조작되고 있는 상태라고 판정하여, 변수인 주행 조작 상태 v11을 「조작중」으로 한다(단계 S37). 조작 ON 문턱값 C1 미만이면, 주행이 조작되고 있지 않은 상태라고 판정하여, 변수인 주행 조작 상태 v11을 「비조작」으로 한다(단계 S38).]","If the travel operation pressure is lower than the operation ON threshold value C1, then the operation state determining section 41 determines that the travel operation is not performed, and sets the travel operation state v11 that is a variable to ""non-operation"" (step S38).",False,0.4523559212684631,0.7809590375621903,50,44,6,228,276,-48
"[계속해서, 프론트 조작압이 조작 ON 문턱값 C1(예를 들면 0.5MPa) 이상인지 여부를 판정한다(단계 S39). 조작 ON 문턱값 C1 이상이면, 프론트가 조작되고 있는 상태라고 판정하여, 변수인 프론트 조작 상태 v12를 「조작중」으로 한다(단계 S40). 조작 ON 문턱값 C1 미만이면, 프론트가 조작되고 있지 않은 상태라고 판정하여, 변수인 프론트 조작 상태 v12를 「비조작」으로 한다(단계 S41).]","If the front implement operation pressure is lower than the operation ON threshold value C1, then the operation state determining section 41 determines that the front implement is not operated, and sets the front implement operation state v12 that is a variable to ""non-operation"" (step S41).",False,0.3739400804042816,0.8167785980887864,50,46,4,233,292,-59
"[도 7은, 조작 상태 판정부(41)의 처리 내용 중, 차체의 조작 상태를 판정하는 부분을 나타내는 플로우 차트이다.]","FIG. 7 is a flowchart of a portion for determining an operation state with respect to the vehicle body, of the processing sequence of the operation state determining section 41.",True,0.2622928023338318,0.8589927608768475,16,30,-14,66,177,-111
"[우선 처음으로, 선회 조작 상태 v10이 「조작중」인지 여부를 판정한다(단계 S7). 「조작중」이면, 차체가 조작 상태에 있다고 판정하여, 변수인 차체 조작 상태 v2를 「조작중」으로 한다(단계 S11).]","First, the operation state determining section 41 determines whether the swing operation state v10 represents ""during operation"" or not (step S7).",False,0.4013921022415161,0.8054460410608887,24,21,3,116,146,-30
"[선회 조작 상태 v10이 「조작중」이 아니면(「비조작」이면), 주행 조작 상태 v11이 「조작중」인지 여부를 판정한다(단계 S8). 「조작중」이면, 차체가 조작 상태에 있다고 판정하여, 변수인 차체 조작 상태 v2를 「조작중」으로 한다(단계 S11).]","If the swing operation state v10 does not represent ""during operation"" (if the swing operation state v10 represents ""non-operation""), then the operation state determining section 41 determines whether the travel operation state v11 represents ""during operation"" or not (step S8).",False,0.2657302916049957,0.8789223269269957,28,40,-12,142,279,-137
"[주행 조작 상태 v11이 「조작중」이 아니면(「비조작」이면), 프론트 조작 상태 v12가 「조작중」인지 여부를 판정한다(단계 S9). 「조작중」이면, 차체로서 조작 상태라고 판정하여, 변수인 차체 조작 상태 v2를 「조작중」으로 한다(단계 S11).]","If the travel operation state v11 does not represent ""during operation"" (if the travel operation state v11 represents ""non-operation""), then the operation state determining section 41 determines whether the front implement operation state v12 represents ""during operation"" or not (step S9).",False,0.2645837962627411,0.8730646450053647,27,41,-14,141,290,-149
"[선회 조작 상태 v10, 주행 조작 상태 v11, 프론트 조작 상태 v12 모두가 「조작중」이 아니면(「비조작」이면), 차체가 비조작 상태에 있다고 판정하여, 변수인 차체 조작 상태 v2를 「비조작」으로 한다(단계 S10).]","If all of the swing operation state v10, the travel operation state v11, and the front implement operation state v12 do not represent ""during operation"" (if all of the swing operation state v10, the travel operation state v11, and the front implement operation state v12 represent ""non-operation""), then the operation state determining section 41 determines that the vehicle body is in a non-operation state, and sets the vehicle body operation state v2 that is a variable to ""non-operation"" (step S10).",True,0.2389090955257415,0.882938781060533,28,80,-52,127,503,-376
[(각 제어부의 상세 설명 제어 상태 전환 판정부)],(Description of details of the control sections; the controlled state switching determining section),True,0.2908030450344085,0.8194823070271245,8,13,-5,29,100,-71
"[도 8은, 제어 상태 전환 판정부(38)의 처리 내용의 전체를 나타내는 플로우 차트이다.]",FIG. 8 is a flowchart of an entire processing sequence of the controlled state switching determining section 38.,True,0.2485273033380508,0.8502931043962432,12,18,-6,51,112,-61
"[현재(제어 상은 1단계 전)의 제어 모드 상태 v3이 「통상」, 「일시 해제」, 「상시 해제」 중 어느 것인지에 따라 행하는 처리 내용을 선택한다(단계 S12).]","The controlled state switching determining section 38 selects a processing sequence to be carried out depending on whether a control mode state v3 at present (in a preceding step of the control sequence) represents ""normal,"" ""temporary cancelation,"" or ""permanent cancelation"" (step S12).",True,0.3166320919990539,0.8377826543209621,22,42,-20,92,288,-196
"[현재의 제어 모드 상태 v3이 「통상」일 때, 통상 모드로부터의 전환 판정(단계 S13)을 실행한다.","If the control mode state v3 at present represents ""normal,"" then the controlled state switching determining section 38 carries out a process of determining switching from a normal mode (step S13).",True,0.2709344625473022,0.8643451696586302,13,31,-18,57,197,-140
"현재의 제어 모드 상태 v3이 「일시 해제」일 때, 일시 해제 모드로부터의 전환 판정(단계 S14)을 실행한다.","If the control mode state v3 at present represents ""temporary cancelation,"" then the controlled state switching determining section 38 carries out a process of determining switching from a temporary cancelation mode (step S14).",True,0.3200962543487549,0.8473346979204802,15,33,-18,62,227,-165
"현재의 제어 모드 상태 v3이 「상시 해제」일 때, 상시 해제 모드로부터의 전환 판정(단계 S15)을 실행한다.]","If the control mode state v3 at present represents ""permanent cancelation,"" then the controlled state switching determining section 38 carries out a process of determining switching from a permanent cancelation mode (step S15).",True,0.3224502801895141,0.842467869027302,15,33,-18,63,227,-164
"[또한, 제어 모드 상태 v3의 초기값은 「통상」으로 하고, 한번 키 OFF하고 나서 다음의 엔진 시동 시에는 반드시 제어 모드 상태 v3을 「통상」으로 하여 처리를 개시한다.]","When the engine is started next time after the key has once been turned off, the processing sequence always begins with the control mode state v3 representing ""normal.""",False,0.3968004584312439,0.7743565833586582,25,28,-3,99,168,-69
"[도 9는, 제어 상태 전환 판정부(38)의 서브루틴인 통상 모드로부터의 전환 판정(단계 S13)의 처리 내용을 나타내는 플로우 차트이다.]","FIG. 9 is a flowchart of a processing sequence of the process of determining switching from the normal mode (step S13), as a subroutine of the controlled state switching determining section 38.",True,0.272706001996994,0.8519941114746519,17,32,-15,78,193,-115
"[차체 컨트롤러(14)는, 제어 해제 스위치(36)의 단자의 개방/도통에 의해 제어 해제 스위치(36)가 눌려져 있는지 여부의 상태를 판정하고 있다.",The vehicle body controller 14 determines whether the control canceling switch 36 is pressed or not by checking whether the terminals of the control canceling switch 36 are disconnected or connected.,True,0.229076012969017,0.8831434492393354,17,31,-14,83,199,-116
"본 실시예에서는, 제어 해제 스위치(36)가 눌려져 있을 때를 제어 해제 스위치 상태 「ON」, 제어 해제 스위치(36)가 눌려져 있지 않을 때를 제어 해제 스위치 상태 「OFF」로서 취급한다.]","According to the present embodiment, if the control canceling switch 36 is pressed, then the vehicle body controller 14 determines that a control canceling switch state is ""ON,"" and if the control canceling switch 36 is not pressed, then the vehicle body controller 14 determines that the control canceling switch state is ""OFF.""",True,0.4232968688011169,0.7964600016952305,26,53,-27,109,329,-220
[본 명세서에서 사용된 용어는 실시예들을 설명하기 위한 것이며 본 발명을 제한하고자 하는 것은 아니다.,The terminology used herein is for the purpose of illustrating embodiments and is not intended to restrict the invention.,True,0.1749707609415054,0.8722712238853603,14,19,-5,57,121,-64
"본 명세서에서, 단수형은 문구에서 특별히 언급하지 않는 한 복수형도 포함한다.","In this specification, singular forms include plural forms unless the context clearly dictates otherwise.",True,0.2259508371353149,0.8245408058088424,10,14,-4,43,105,-62
"명세서에서 사용되는 ""포함한다(comprises)"" 및/또는 ""포함하는(comprising)""은 언급된 구성요소, 단계 및/또는 동작은 하나 이상의 다른 구성요소, 단계 및/또는 동작의 존재 또는 추가를 배제하지 않는다.]","It is noted that the terms ""comprises"" and/or ""comprising"" used in the specification mean that mentioned elements, steps, and/or operations do not exclude the presence or addition of one or more of other elements, steps, and/or operations.",True,0.1347501575946808,0.9102365127123242,22,37,-15,124,239,-115
"[다른 정의가 없다면, 본 명세서에서 사용되는 모든 용어(기술 및 과학적 용어를 포함)는 본 발명이 속하는 기술분야에서 통상의 지식을 가진 자에게 공통적으로 이해될 수 있는 의미로 사용될 수 있을 것이다.","Unless defined otherwise, all terms (including technical and scientific terms) used herein may be used in a sense commonly understood by a person having ordinary skill in the art to which the claimed invention pertains.",True,0.104213148355484,0.926938729856996,29,35,-6,114,219,-105
또 일반적으로 사용되는 사전에 정의되어 있는 용어들은 명백하게 특별히 정의되어 있지 않은 한 이상적으로 또는 과도하게 해석되지 않는다.],"In addition, commonly used predefined terms are not ideally or excessively interpreted unless explicitly defined otherwise.",True,0.1373723894357681,0.893968681829984,18,16,2,76,123,-47
[도면에서 각 구성요소의 두께나 크기는 설명의 편의 및 명확성을 위하여 과장되거나 생략되거나 또는 개략적으로 도시되었다.,"In the drawings, the thicknesses and sizes of respective elements are exaggerated, omitted, or schematically shown for convenience and clarity of explanation.",True,0.1866582185029983,0.8594614357865613,15,22,-7,67,158,-91
또한 각 구성요소의 크기와 면적은 실제크기나 면적을 전적으로 반영하는 것은 아니다. ],"In addition, the size and area of each element do not entirely reflect actual size or area.",True,0.1202064976096153,0.909023358162092,12,17,-5,48,91,-43
"[이하, 첨부도면은 참조하여, 본 발명의 바람직한 실시예를 설명하면 다름과 같다.]","Hereinafter, a preferred embodiment of the present disclosure will be described with reference to the accompanying drawings.",True,0.3021536767482755,0.759782979088269,10,17,-7,46,124,-78
[도 2은 본 발명의 일 실시예에 따른 냉난방 멀티 공기조화기의 개략적인 구성도이다.],FIG. 2 is a schematic configuration diagram of a multi-air conditioner for heating/cooling operation according to an embodiment of the present disclosure.,True,0.246985912322998,0.8354841808901419,12,22,-10,48,154,-106
"[도 2를 참조하면, 본 발명의 일 실시예에 따른 냉난방 멀티 공기조화기(100)가 도시되어 있다.","Referring to FIG. 2, a multi-air conditioner for heating/cooling operation 100 according to an embodiment of the present disclosure is illustrated.",True,0.1770806759595871,0.886102279094161,13,21,-8,55,147,-92
냉난방 멀티 공기조화기(100)는 적어도 하나의 냉난방 겸용 실내기들(B) 및 냉난방 겸용 실외기(A)를 포함한다.],The multi-air conditioner for heating/cooling operation 100 includes at least one of indoor units B for heating/cooling operation and an outdoor unit A for heating/cooling operation.,True,0.2217402905225753,0.871659317154187,13,26,-13,65,182,-117
"[냉난방 겸용 실외기(A)는 적어도 하나의 압축기들(53), 실외 열교환기(A1, A2), 실외 열교환기 팬(61), 핫가스유닛(73, 75), 과냉각유닛(66) 및 절환유닛을 포함한다.","The outdoor unit A for heating/cooling operation includes at least one of compressors 53, an outdoor heat exchanger A1, A2, an outdoor heat exchanger fan 61, a hot gas unit 73, 75, a supercooling unit 66, and a switching unit.",True,0.2249645292758941,0.8871993593524079,18,40,-22,104,226,-122
여기에서 절환유닛은 사방밸브(62)를 포함한다.,"Here, the switching unit includes a four-way valve 62.",True,0.2435571700334549,0.8449371110241983,4,9,-5,26,54,-28
적어도 하나의 압축기들(53)의 흡입부는 어큐뮬레이터(52)에 의해 연결되어 있다.,A suction portion of the at least one of compressors 53 is connected by an accumulator 52.,True,0.1550860702991485,0.9078051714112382,8,17,-9,46,90,-44
압축기(53)는 운전주파수를 조절하여 냉매량 및 냉매의 토출압력을 제어할 수 있는 인버터 압축기일 수 있다.,The compressor 53 may be an inverter compressor capable of controlling the amount of refrigerant and the discharge pressure of the refrigerant by adjusting the operating frequency.,True,0.1515701413154602,0.9155049866342247,14,27,-13,60,180,-120
"이 외에 정속 압축기를 더 포함할 수 있으나, 이에 한정되지 않는다.]","In addition, it may further include a constant speed compressor, but is not limited thereto.",True,0.1819654405117035,0.8725743366057599,11,15,-4,39,92,-53
"[압축기(53)의 토출부에는 토출배관(55)이 연결되고, 토출배관(55)은 압축기(53)에서 토출된 냉매 중 오일을 회수하도록 오일분리기(58)가 각각 설치되어 있다.","A discharge pipe 55 is connected to a discharge portion of the compressor 53, and an oil separator 58 is installed in the discharge pipe 55 so as to recover oil from the refrigerant discharged from the compressor 53.",True,0.1807008981704712,0.9125181517440988,15,39,-24,93,216,-123
"오일 분리기(58)에는, 오일분리기(58)로부터 분리된 오일을 압축기(53)의 흡입부로 안내하는, 오일 회수관(30)이 연결되어 있다. ]","An oil recovery pipe 30 is connected to the oil separator 58, and guides the oil separated from the oil separator 58 to the suction portion of the compressor 53.",True,0.158555120229721,0.9170579490993302,13,30,-17,77,161,-84
[압축기(53) 내부에는 상기 압축기(53) 내의 오일의 유면 높이를 감지하여 이에 해당하는 감지 신호를 제어부로 전송하기 위한 오일 레벨 센서(94)가 형성될 수 있다.],An oil level sensor 94 for detecting the level of the oil in the compressor 53 and transmitting a corresponding detection signal to the control unit may be formed inside the compressor 53.,True,0.1472901552915573,0.9172099810576066,22,33,-11,96,188,-92
"[토출배관(55)에는 압축기(53)에서 토출된 냉매가 사방밸브(62)를 거치지 않고 바이패스시키는 핫가스 유닛(73, 75) 연결된다.","The hot gas unit 73, 75 for bypassing the refrigerant discharged from the compressor 53 without passing through the four-way valve 62 are connected to the discharge pipe 55.",True,0.2868895530700683,0.8546916731591543,12,29,-17,75,173,-98
"또한, 토출배관(55)는 사방밸브(62)와 제3토출배관(68)으로 연결되어 있다.]","In addition, the discharge pipe 55 is connected to the four-way valve 62 by a third discharge pipe 68.",True,0.2599945664405823,0.8599262857444463,6,19,-13,46,102,-56
[어큐뮬레이터(52)에도 압축기(53)로 오일을 회수시킬 수 있는 오일회수구조가 배치될 수 있다.,An oil recovery structure capable of recovering oil to the compressor 53 may be disposed in the accumulator 52.,True,0.2051286250352859,0.8865014576569539,10,19,-9,54,111,-57
"어큐뮬레이터(52)의 하측과 어큐뮬레이터 토출배관(56)을 연결하는 오일회수배관(87)과, 오일회수배관(87)에 배치되어 오일의 유동을 제어하는 오일리턴밸브(88)가 배치될 수 있다.]","An oil recovery pipe 87 connecting the lower side of the accumulator 52 and an accumulator discharge pipe 56, and an oil return valve 88 which is disposed in the oil recovery pipe 87 to control the flow of oil may be disposed.",True,0.2206534594297409,0.8839963703349202,15,43,-28,103,226,-123
"[실외 열교환기(A1, A2)는 제1연결배관(71)에 의하여 사방밸브(62)와 연결되어 있다.","The outdoor heat exchanger A1, A2 is connected to the four-way valve 62 by a first connection pipe 71.",True,0.238442838191986,0.8718742121180578,8,19,-11,52,102,-50
"실외 열교환기(A1, A2)에서는 외기와의 열교환에 의하여 냉매가 응축되거나 증발된다.","In the outdoor heat exchanger A1, A2, the refrigerant is condensed or evaporated by heat exchange with the outside air.",True,0.1714039891958236,0.8987341058724833,9,20,-11,48,119,-71
"이 때, 열교환을 보다 원활하게 하기 위하여, 실외기 팬(61)은 실외 열교환기(A1, A2)로 공기를 유입한다.","At this time, in order to easily perform heat exchange, the outdoor fan 61 introduces air into the outdoor heat exchanger A1, A2.",True,0.2066929340362548,0.8866497357754678,14,23,-9,63,129,-66
"냉난방 멀티 공기조화기(100)에서는, 냉방 운전 중에는 실외 열교환기(A1, A2)가 응축기로 이용되고, 난방 운전 중에는 실외 열교환기(A1, A2)가 증발기로 이용된다.]","In the multi-air conditioner for heating/cooling operation 100, the outdoor heat exchanger A1, A2 is used as a condenser during the cooling operation, and the outdoor heat exchanger A1, A2 is used as an evaporator during the heating operation.",True,0.2001103013753891,0.8859046974810174,19,39,-20,98,243,-145
"[실외열교환기(A1, A2)에는 사방밸브(62)와 사이에서 냉매를 유동시키는 실외열교환기- 사방밸브 연결배관(71)이 연결된다.","The outdoor heat exchanger A1, A2 is connected to an outdoor heat exchanger-four-way valve connection pipe 71 for flowing the refrigerant between the four-way valve 62 and the outdoor heat exchanger A1, A2.",True,0.2704682946205139,0.870010056397931,10,33,-23,71,206,-135
"실외열교환기- 사방밸브 연결배관(71)은 제1실외열교환기(A1)와 사방밸브(62)를 연결하는 제1실외열교환기- 사방밸브 연결배관(28)과, 제2실외열교환기(A2)와 사방밸브(62)를 연결하는 제2실외열교환기- 사방밸브 연결배관(29)을 포함한다.","The outdoor heat exchanger-four-way valve connection pipe 71 includes a first outdoor heat exchanger-four-way valve connection pipe 28 connecting the first outdoor heat exchanger A1 and the four-way valve 62, and a second outdoor heat exchanger-four-way valve connection pipe 29 connecting the second outdoor heat exchanger A2 and the four-way valve 62.",True,0.2165885865688324,0.8939721541140104,16,52,-36,137,353,-216
사방밸브(62)에서 연결되는 실외열교환기- 사방밸브 연결배관(71)은 제1실외열교환기- 사방밸브 연결배관(28)과 제2실외열교환기- 사방밸브 연결배관(29)로 분지된다.],The outdoor heat exchanger-four-way valve connection pipe 71 connected from the four-way valve 62 is branched into the first outdoor heat exchanger-four-way valve connection pipe 28 and the second outdoor heat exchanger-four-way valve connection pipe 29.,True,0.2483815997838974,0.8707637473539217,12,36,-24,95,254,-159
"[제2실외열교환기- 사방밸브 연결배관(29)에 체크밸브가 배치되고, 상기 체크밸브는 상기 실외열교환기- 사방밸브 연결배관(71)에서 공급된 냉매가 상기 제2실외열교환기-사방밸브 연결배관(29)로 유입되는 것을 차단한다.]","A check valve is disposed in the second outdoor heat exchanger-four-way valve connection pipe 29, and the check valve blocks the inflow of the refrigerant supplied from the outdoor heat exchanger-four-way valve connection pipe 71 from flowing into the second outdoor heat exchanger-four-way valve connection pipe 29.",True,0.2209096252918243,0.8828711748308457,19,47,-28,123,316,-193
"[제1실외열교환기 배관(76) 및 제2실외열교환기- 사방밸브 연결배관(29)을 연결하는 가변패스배관이 더 배치되고, 상기 가변패스배관에 가변패스밸브(82)이 더 배치될 수 있다.]","A variable pass pipe connecting a first outdoor heat exchanger pipe 76 and a second outdoor heat exchanger-four-way valve connection pipe 29 may be further disposed, and a variable pass valve 82 may be further disposed in the variable pass pipe.",True,0.2677325010299682,0.8631801665972838,17,41,-24,100,245,-145
[상기 가변패스밸브(82)는 선택적으로 작동될 수 있다.,The variable pass valve 82 may be selectively operated.,True,0.1887831389904022,0.8763004035020231,6,9,-3,31,55,-24
"상기 가변패스밸브(82)가 개방될 경우, 상기 제1실외열교환기 배관(76)을 따라 유동되는 냉매는 상기 가변패스배관 및 가변패스밸브(82)를 통과하고, 상기 사방밸브(62)로 안내될 수 있다.]","When the variable pass valve 82 is opened, the refrigerant flowing along the first outdoor heat exchanger pipe 76 may pass through the variable-pass pipe and the variable-pass valve 82, and may be guided to the four-way valve 62.",True,0.1894135624170303,0.9072197673414572,20,39,-19,108,229,-121
"[상기 가변패스밸브(82)가 닫힌 경우, 난방운전 시, 제1실외열교환기 배관(76)을 통해 공급된 냉매는 상기 제1실외열교환기(A1)로 유동된다.]","When the variable pass valve 82 is closed, the refrigerant supplied through the first outdoor heat exchanger pipe 76 flows to the first outdoor heat exchanger A1, during the heating operation.",True,0.2112295776605606,0.8883726055879115,14,31,-17,82,192,-110
"[상기 가변패스밸브(82)가 닫힌 경우, 냉방운전 시, 제1 실외열교환기(A1)를 통과한 냉매는 제1실외열교환기 배관(76)을 통해 액체연결배관(72)으로 유동된다.]","When the variable pass valve 82 is closed, the refrigerant that passed through the first outdoor heat exchanger A1 flows to a liquid connection pipe 72 through the first outdoor heat exchanger pipe 76, during the cooling operation.",True,0.1927529126405716,0.9019549888299072,15,38,-23,93,231,-138
"[실외팽창밸브(65, 67)는 난방운전 시, 실외열교환기(A1, A2)로 유동되는 냉매를 팽창시킨다.","The outdoor expansion valve 65, 67 expands the refrigerant flowing into the outdoor heat exchanger A1, A2 during the heating operation.",True,0.2299440056085586,0.8791566560691917,9,21,-12,56,135,-79
"냉방운전 시, 실외팽창밸브(65, 67)는 냉매를 팽창시키지 않고 통과시킨다.","During the cooling operation, the outdoor expansion valve 65, 67 pass through the refrigerant while not expanding it.",True,0.2067149877548217,0.8763042145685217,8,18,-10,43,117,-74
"실외팽창밸브(65, 67)는 입력된 신호에 따라 개도값을 조절할 수 있는 전자팽창밸브(EEV)가 사용될 수 있다.]","An electronic expansion valve (EEV) capable of adjusting an opening value according to an input signal may be used as the outdoor expansion valve 65, 67.",True,0.2199833989143371,0.8623631235294087,13,26,-13,64,153,-89
"[실외팽창밸브(65, 67)는 제1실외열교환기(A1)로 유동되는 냉매를 팽창시키는 제1실외팽창밸브(65)와, 제2실외열교환기(A2)로 유동되는 냉매를 팽창시키는 제2실외팽창밸브(67)를 포함한다.]","The outdoor expansion valve 65, 67 includes a first outdoor expansion valve 65 that expands the refrigerant flowing into the first outdoor heat exchanger A1, and a second outdoor expansion valve 67 that expands the refrigerant flowing into the second outdoor heat exchanger A2.",True,0.2615395486354828,0.8786588899243906,13,44,-31,110,277,-167
[제1실외팽창밸브(65) 및 제2실외팽창밸브(67)는 액관연결배관(72)과 연결된다.,The first outdoor expansion valve 65 and the second outdoor expansion valve 67 are connected to the liquid pipe connection pipe 72.,True,0.2362208515405655,0.8782166930780448,5,22,-17,47,131,-84
"난방운전 시, 실내기(B)에 응축된 냉매가 제1실외팽창밸브(65) 및 제2실외팽창밸브(67)에 공급된다.]","During the heating operation, the refrigerant condensed in the indoor unit B is supplied to the first outdoor expansion valve 65 and the second outdoor expansion valve 67.",True,0.1862732470035553,0.903065754566618,9,28,-19,59,171,-112
"[제1실외팽창밸브(65) 및 제2실외팽창밸브(67)와 연결되기 위해, 액관연결배관(72)은 분지되고, 제1실외팽창밸브(65) 및 제2실외팽창밸브(67)에 각각 연결된다.","In order to be connected to the first outdoor expansion valve 65 and the second outdoor expansion valve 67, the liquid pipe connection pipe 72 is branched, and is connected to each of the first outdoor expansion valve 65 and the second outdoor expansion valve 67.",True,0.1889066249132156,0.9062109389145856,12,46,-34,94,263,-169
제1실외팽창밸브(65) 및 제2실외팽창밸브(67)는 병렬배치된다.],The first outdoor expansion valve 65 and the second outdoor expansion valve 67 are disposed in parallel.,True,0.2296046912670135,0.8728601292087657,4,17,-13,37,104,-67
[제1실외팽창밸브(65) 및 제1실외열교환기(A1)를 연결하는 배관을 제1실외열교환기 배관(76)으로 정의한다.,A pipe connecting the first outdoor expansion valve 65 and the first outdoor heat exchanger A1 is defined as a first outdoor heat exchanger pipe 76.,True,0.2273861169815063,0.8844843276980678,8,26,-18,62,148,-86
제2실외팽창밸브(66) 및 제2실외열교환기(A2)를 연결하는 배관을 제2실외열교환기 배관(77)으로 정의한다.],A pipe connecting the second outdoor expansion valve 66 and the second outdoor heat exchanger A2 is defined as a second outdoor heat exchanger pipe 77.,True,0.2157564759254455,0.8923504222114642,8,26,-18,62,151,-89
[어큐뮬레이터(52)는 상기 압축기(53)에 냉매를 제공한다.,The accumulator 52 provides refrigerant to the compressor 53.,True,0.1724007129669189,0.9044635616929068,5,9,-4,34,61,-27
"어큐뮬레이터(52)는 압축기(53)의 흡입 측에 배치되고, 사방밸브(62)와 연결된다.]",The accumulator 52 is disposed in the suction side of the compressor 53 and is connected to the four-way valve 62.,True,0.2571842968463897,0.8608128873505752,7,21,-14,49,114,-65
[본 실시예에 따른 실외기(A)는 리시버(54)를 더 포함할 수 있다.,The outdoor unit A according to the present embodiment may further include a receiver 54.,True,0.2626548707485199,0.8483739514583782,9,15,-6,39,89,-50
리시버(54)는 순환되는 냉매의 양을 조절하기 위해 액냉매를 저장할 수 있다.,The receiver 54 may store liquid refrigerant to control the amount of circulated refrigerant.,True,0.1824967265129089,0.8902217390706388,10,14,-4,43,93,-50
리시버(54)는 어큐뮬레이터(52)에서 액냉매를 저장하는 것과 별도로 액냉매를 저장한다.],The receiver 54 stores liquid refrigerant separately from storing liquid refrigerant in the accumulator 52.,True,0.2533478736877441,0.8528583476363472,8,15,-7,50,107,-57
"디스플레이 디바이스의 제어 방법에 있어서,제 1입력 주파수를 제 1구동 주파수로 변환하는 단계;상기 제 1구동 주파수에 기초하여 구동하는 경우, 시점과 관계 없이 상기 제 1구동 주파수에 설정된 제 1수직 블랭크 구간의 값에 따라 신호를 제어하는 단계;상기 제 1입력 주파수와 다른 제 2입력 주파수를 제 2구동 주파수로 변환하는 단계;상기 제 2구동 주파수에 기초하여 구동하는 경우, 제 1시점에는 상기 제 1구동 주파수에 설정된 제 1수직 블랭크 구간의 값 및 상기 제 2구동 주파수에 설정된 제 2수직 블랭크 구간의 값과는 다른 제 3수직 블랭크 구간의 값에 따라 신호를 제어하는 단계;상기 제 1시점 이후 제 2시점에는, 상기 제 2구동 주파수에 설정된 제 2수직 블랭크 구간의 값에 따라 신호를 제어하는 단계를 포함하는 디스플레이 디바이스의 제어방법.","A method for controlling a display device, the method comprising: converting a first input frequency to a first driving frequency; when the device operates at the first driving frequency, controlling a signal based on a value of a first vertical blank interval set for the first driving frequency regardless of a time point; converting a second input frequency different from the first input frequency into a second driving frequency; when the device operates at the second driving frequency, controlling, at a first time point, the signal based on a value of a third vertical blank interval different from the value of the first vertical blank interval set for the first driving frequency and a value of a second vertical blank interval set for the second driving frequency; and at a second time point after the first time point, controlling the signal based on the value of the second vertical blank interval set for the second driving frequency.",True,0.2819724082946777,0.8947131702775106,109,157,-48,425,948,-523
"제 1항에 있어서,상기 제 1구동 주파수 및 상기 제 2구동 주파수에 기초하여 구동하는 경우, 한 프레임 구간 내에 기 설정된 듀티비로 발광 신호를 제어하는 단계를 포함하는 디스플레이 디바이스의 제어방법.","The method of claim 1, wherein the method comprises, when the device operates at the first driving frequency and the second driving frequency, controlling a light emission signal based on a preset duty ratio within one frame interval.",True,0.3064779639244079,0.8773872737105473,29,38,-9,114,234,-120
"제 1항에 있어서,상기 제 3수직 블랭크 구간의 값에 따라 신호를 제어하는 단계는,상기 제 3수직 블랭크 구간의 값이 점진적으로 변화하는 단계를 포함하는 디스플레이 디바이스의 제어방법.","The method of claim 1, wherein controlling the signal based on the value of the third vertical blank interval includes gradually changing the value of the third vertical blank interval.",True,0.3485021889209747,0.8517738068002786,24,30,-6,103,185,-82
"제 3항에 있어서,상기 제 3수직 블랭크 구간의 값이 점진적으로 변화하는 단계는,상기 제 3수직 블랭크 구간의 값이, 상기 제 1구동 주파수에 설정된 제 1수직 블랭크 구간의 값과 상기 제 2구동 주파수에 설정된 제 2수직 블랭크 구간의 값 사이에서, 일정한 간격을 가지고 순차적으로 변화하는 단계를 포함하는 디스플레이 디바이스의 제어 방법.","The method of claim 3, wherein gradually changing the value of the third vertical blank interval includes sequentially changing the value of the third vertical blank interval by a constant amount and between the value of the first vertical blank interval set for the first driving frequency and the value of the second vertical blank interval set for the second driving frequency.",True,0.3626040518283844,0.8587866729650165,48,62,-14,191,380,-189
"제 4항에 있어서,상기 제 2입력 주파수를 상기 제 2구동 주파수로 변환할 때, 상기 제 2입력 주파수와 상기 제 2구동 주파수의 차이에 상응하여 상기 일정한 간격을 결정하는 단계를 포함하는 디스플레이 디바이스의 제어 방법.","The method of claim 4, wherein the method comprises, when converting the second input frequency to the second driving frequency, determining the constant amount based on a difference between the second input frequency and the second driving frequency.",True,0.468309074640274,0.808917727664571,32,38,-6,125,251,-126
"제 1항에 있어서,상기 제 1구동 주파수 및 상기 제 2구동 주파수 중 하나는 100 헤르쯔이고 다른 하나는 120 헤르쯔인 것을 특징으로 하는 디스플레이 디바이스의 제어 방법.","The method of claim 1, wherein one of the first driving frequency and the second driving frequency is 100 Hz and the other thereof is 120 Hz.",True,0.2689113318920135,0.8743099920624022,26,27,-1,99,141,-42
"프로세서;복수 개의 픽셀들로 이루어진 디스플레이부;상기 디스플레이부가 구동되도록 구동 주파수를 시간적으로 제어하는 타이밍 컨트롤러;를 포함하고,상기 타이밍 컨트롤러는,한 프레임 구간 내에 기 설정된 듀티비로 발광신호를 제어하고,상기 디스플레이부가 제 1입력 주파수의 영상을 디스플레이 하고, 이어서 제 2입력 주파수의 영상을 디스플레이 할 때, 프레임 구간 별로 수직 블랭크 구간의 값이 점진적으로 변화하는 것을 특징으로 하는 디스플레이 디바이스.","A display device comprising: a processor; a display including a plurality of pixels; and a timing controller configured to temporally control a driving frequency to operate the display, wherein the timing controller is configured to: control a light emission signal based on a preset duty ratio within one frame interval; and when the display displays an image of a first input frequency and then an image of a second input frequency, gradually change a value of a vertical blank interval for each frame interval.",True,0.200892761349678,0.9205771946764932,53,84,-31,250,513,-263
"제 7항에 있어서,상기 프로세서는,상기 제 1입력 주파수의 영상을 제 1구동 주파수의 영상으로 변환시키고, 상기 제 2입력 주파수의 영상을 제 2구동 주파수의 영상으로 변환시키는 것을 특징으로 하는 디스플레이 디바이스.","The device of claim 7, wherein the processor is configured to convert the image of the first input frequency into the image of a first driving frequency, and convert the image of the second input frequency into an image of a second driving frequency.",True,0.3146989941596985,0.8610985588692713,28,44,-16,122,250,-128
"제 8항에 있어서,상기 타이밍 컨트롤러는, 상기 수직 블랭크 구간의 값이, 상기 제 1구동 주파수에 설정된 제 1수직 블랭크 구간의 값과 상기 제 2구동 주파수에 설정된 제 2수직 블랭크 구간의 값 사이에서, 일정한 간격을 가지고 순차적으로 변화하도록 제어하는 디스플레이 디바이스.","The device of claim 8, wherein the timing controller is configured to change sequentially the value of the vertical blank interval by a constant amount and between a value of a first vertical blank interval set for the first driving frequency and a value of a second vertical blank interval set for the second driving frequency.",True,0.2984592318534851,0.8890300229187414,39,56,-17,157,328,-171
"제 9항에 있어서,상기 타이밍 컨트롤러는, 상기 제 2입력 주파수를 상기 제 2구동 주파수로 변환할 때, 상기 제 2입력 주파수와 상기 제 2구동 주파수의 차이에 상응하여 상기 일정한 간격을 결정하는 디스플레이 디바이스.","The device of claim 9, wherein when converting the second input frequency to the second driving frequency, the timing controller is configured to determine the constant amount based on a difference between the second input frequency and the second driving frequency.",True,0.3022311627864837,0.8800268536767722,31,41,-10,123,266,-143
"제 8항에 있어서,상기 제 1구동 주파수 또는 상기 제 2구동 주파수는 100헤르쯔 또는 120헤르쯔인 것을 특징으로 하는 디스플레이 디바이스.","The device of claim 8, wherein the first driving frequency or the second driving frequency is 100 Hz or 120 Hz.",True,0.2027653306722641,0.9054358784841462,19,21,-2,80,111,-31
"제 7항에 있어서,상기 복수 개의 픽셀들은 발광다이오드 또는 유기발광다이오드를 포함하는 디스플레이 디바이스.","The device of claim 7, wherein each of the plurality of pixels includes a light emitting diode or an organic light emitting diode.",True,0.2104787826538086,0.8682079044231538,12,23,-11,60,130,-70
"[도 3은 도 3a 및 3b를 포함하며, 이들 도면은 제각기 일 실시예에 따른 반도체 모듈(40)의 평면도 및 단면도이다.","Figure 3, which includes figures 3A and 3B, illustrates a plan view and a cross-sectional view, respectively, of a semiconductor module 40 according to an embodiment.",True,0.2399088144302368,0.8647254067967033,18,26,-8,68,166,-98
"반도체 모듈(40)은 로우측 스위치(11), 하이측 스위치(12) 및 제어 칩(13)을 포함한다.","The semiconductor module 40 includes a low side switch 11, a high side switch 12 and a control chip 13.",True,0.1870521157979965,0.914494655786317,10,20,-10,54,103,-49
"로우측 스위치(11), 하이측 스위치(12) 및 제어 칩(13)은 횡방향으로 서로 인접하게 배열된다.","The low side switch 11, the high side switch 12 and the control chip 13 are arranged laterally adjacent to one another.",True,0.1840251982212066,0.9104631029593356,11,22,-11,56,119,-63
"로우측 스위치(11) 및 하이측 스위치(12)는 각각 실질적으로 직육면체 형태를 가지며, 로우측 스위치(11)의 긴 변(28)과 하이측 스위치(12)의 긴 변(29)이 모듈(18)의 인접 변(18)과 실질적으로 평행하게 위치하고 하이측 스위치(12)의 짧은 변(26')이 로우측 스위치(11)의 긴 변(28')과 실질적으로 평행하도록 배치되어, 평면에서 볼 때 L자형이 형성된다.]",The low side switch 11 and the high side switch 12 each have a substantially cuboid form and are arranged such that the long side 28 of the low side switch 11 and the long side 29 of the high side switch 12 are positioned substantially parallel to adjoining sides 18 of the module 18 and such that the short side 26' of the high side switch 12 is substantially parallel to the long side 28' of the low side switch 11 such that an L shape is formed in plan view.,True,0.1597425937652588,0.9151398891340038,40,92,-52,213,461,-248
[로우측 스위치(11) 및 하이측 스위치(12)는 각각 수직형 트랜지스터 소자에 의해 형성된다.,The low side switch 11 and the high side switch 12 are each formed by a vertical transistor device.,True,0.2433571815490722,0.8713451284607732,11,19,-8,53,99,-46
"로우측 스위치(11)는 그 하부면(42)에 소스 패드(41)를 포함하고, 또한 그 하부면(42)에 도 3b의 단면도에서는 볼 수 없는 게이트 패드를 포함하며, 그 상부면(44)의 드레인 패드(43)를 포함한다.","The low side switch 11 includes a source pad 41 on its lower side 42 and also a gate pad on its lower side 42 which cannot be seen in the cross-sectional view of figure 3B, and a drain pad 43 on its upper side 44.",True,0.1853328794240951,0.9138735474233984,24,46,-22,117,213,-96
"하이측 스위치(12)는 그 하부면(46)에 드레인 패드(45)를 포함하고, 그 상부면(48)에 소스 패드(47) 및 단면도에서는 볼 수 없는 게이트 패드를 포함한다.","The high side switch 12 includes a drain pad 45 on its lower side 46 and a source pad 47 and a gate pad, which cannot be seen in the cross-sectional view, on its upper side 48.",True,0.2087279856204986,0.8997369046255789,19,37,-18,92,176,-84
"로우측 스위치(11) 및 하이측 스위치(12)는 하부면들(42, 46)이 반도체 모듈(40)의 하부면(70)을 향하도록 서로 실질적으로 동일 평면에 배열된다.","The low side switch 11 and the high side switch 12 are arranged substantially coplanar to one another such that the lower surfaces 42, 40 face towards the lower surface 70 of the semiconductor module 40.",True,0.3234533667564392,0.8587733624304057,16,36,-20,88,203,-115
하부면(70)은 반도체 모듈(40)의 외부 접촉 표면(49)을 포함하는 풋프린트를 제공한다.],The lower surface 70 provides the footprint including the outer contact surfaces 49 of the semiconductor module 40.,True,0.1601732969284057,0.9158540166724112,9,18,-9,52,115,-63
"[반도체 모듈(40)은, 로우측 스위치(11), 하이측 스위치(12) 및 제어 칩(13)이 코어 절연층(50)에 매립되도록 하는 임베디드 칩 기술을 사용하여 제조된 적층 구조를 갖는다.","The semiconductor module 40 has a laminated structure fabricated using embedded chip technology such that the low side switch 11, the high side switch 12 and the control chip 13 are embedded in a core insulating layer 50.",True,0.2518995702266693,0.8818800238648401,21,38,-17,103,221,-118
"반도체 모듈(40)은, 절연 코어층(50)의 하부면(52)에 위치하는 제1 재배선층(51)을 포함한다.",The semiconductor module 40 includes a first redistribution layer 51 which is positioned on the lower surface 52 of the insulating core layer 50.,True,0.201508074998856,0.9050930416210368,9,24,-15,57,145,-88
"제1 재배선층(51)은 절연층, 측면 도전층(49) 및 절연층을 통해 연장되는 전도성 비아(53)를 포함한다.","The first redistribution layer 51 includes an insulating layer, a lateral conductive layer 49 and conductive vias 53 that extend through the insulating layer.",True,0.1776610314846038,0.9136731639930752,12,24,-12,61,158,-97
전도성 층은 외부 접촉 표면(49)을 제공한다.,The conductive layer provides the outer contact surfaces 49.,True,0.1779485791921615,0.8908563378354022,6,9,-3,26,60,-34
"제1 재배선 층은, 전도성 비아(53)를 포함하고 반도체 모듈(40)의 드레인 패드(45)와 V, Sub[attributes={}; value=[high]], 패드(54) 사이에서 연장되는 제1 전도성 재배선 구조(52)를 포함한다.",The first redistribution layer comprises a first conductive redistribution structure 52 including conductive vias 53 and which extends between the drain pad 45 and the Vhigh pad 54 of the semiconductor module 40.,False,0.3031496703624725,0.8611672400188182,21,33,-12,130,212,-82
"제1 재배선층(51)은 또한, 전도성 비아(53)를 포함하고 제1 재배선층(51)의 하부면 상의 V, Sub[attributes={}; value=[low]], 접촉 패드(56)와 소스 패드(42) 사이에서 연장되는 제2 재배선 구조(55)를 포함한다.",The first redistribution layer 51 also includes a second redistribution structure 55 which includes conductive vias 53 and which extends between the source pad 42 and the Vlow contact pad 56 on the lower surface of the first redistribution layer 51.,False,0.2614926397800445,0.8895353853046173,23,41,-18,141,249,-108
"제1 재배선층(51)은 또한 각각의 게이트 패드를 위한 추가적인 전도성 재배선 구조와, 제어 칩(13)과 모듈(40)의 로직 패드(63) 사이에 추가적인 전도성 재배선 구조를 포함한다.]",The first redistribution layer 51 also includes a further conductive redistribution structure for each of the gate pads and a further conductive redistribution structure between the control chip 13 and the logic pads 63 of the module 40.,True,0.2037577629089355,0.9127180703076364,22,38,-16,104,237,-133
"[반도체 모듈(40)은 또한 절연 코어 층(50)의 상부면(58)에 위치하는 제2 재배선 층(57)을 포함하며, 이는 하이측 스위치(12)의 소스 패드(47)와 로우측 스위치(11)의 드레인 패드(43) 사이에서 연장되는 스위치 노드 커넥터(14)를 형성하는 데 사용된다.",The semiconductor module 40 also includes a second redistribution layer 57 positioned on an upper surface 58 of the insulating core layer 50 which is used to form the switch node connector 14 which extends between the source pad 47 of the high side switch 12 and the drain pad 43 of the low side switch 11.,True,0.2039222866296768,0.9216558400965336,29,57,-28,152,306,-154
"제2 재배선층(57)은 절연층, 측면 전도성 층(60) 및 절연층을 통해 연장되는 전도성 비아(59)를 포함한다.","The second redistribution layer 57 includes an insulating layer, a lateral conductive layer 60 and conductive vias 59 that extend through the insulating layer.",True,0.166544571518898,0.9204594144867102,13,24,-11,63,159,-96
"이 실시예에서, 스위치 노드 커넥터(14)는 또한 하이측 스위치(12)의 소스 패드(47)와 로우측 스위치(11)의 드레인 패드(43)를 전기적으로 결합하기 위해 제2 재배선층(57)을 통해 그리고 실질적으로 평면인 전도성 층(60) 사이에서 연장되는 전도성 비아(59)를 포함한다.","In this embodiment, the switch node connector 14 also includes the conductive vias 59 which extend through the second redistribution layer 57 and between the substantially planar conductive layer 60 to electrically couple the source pad 47 of the high side switch 12 and the drain pad 43 of the low side switch 11.",True,0.2119266539812088,0.9187244880831044,30,54,-24,158,314,-156
"스위치 노드 커넥터(14)는 또한, 제1 및 제2 재배선층(51, 57) 및 절연 코어층(50)을 통해 전도성 층들(60) 사이에서 연장되는 하나 이상의 전도성 비아에 의해 반도체 모듈(40)의 하부면(70)에 위치하는 스위치 노드 패드(V, Sub[attributes={}; value=[sw]], )(61)에 접속된다.]","The switch node connector 14 is also connected to a switch node pad Vsw 61 positioned on the lower surface 70 of the semiconductor module 40 by one or more conductive vias which extend between the conductive layer 60 through the first and second redistribution layers 51, 57 and the insulating core layer 50.",False,0.2479898333549499,0.8995256257135709,33,54,-21,181,308,-127
[반도체 모듈(40)은 또한 모듈(40)의 하부면에 위치하며 제어 칩(13)에 전기적으로 접속되는 복수의 로직 패드(63)를 포함한다.,The semiconductor module 40 also includes a plurality of logic pads 63 which are positioned on the lower surface of the module 40 and which are electrically connected to the control chip 13.,True,0.157706469297409,0.9274463294408988,14,33,-19,75,190,-115
로직 패드(63) 중 일부는 또한 로우측 스위치(11) 및/또는 하이측 스위치(12)를 위한 감지 기능을 제공할 수 있다.],Some of the logic pads 63 may also provide sense function is for the low side switch 11 and/or high side switch 12.,True,0.2268614470958709,0.8829927130867642,16,23,-7,69,115,-46
"[일부 실시예에서, 제1 및 제2 재배선층(51, 57) 중 하나 또는 둘 모두는 하나보다 많은 수평 측면 전도성 층을 포함하는 다층 재배선 구조를 갖는다.]","In some embodiments, one or both of the first and second redistribution layers 51, 57 has a multilayer redistribution structure including more than one horizontal lateral conductive layer.",True,0.1779314875602722,0.9063631740688198,23,28,-5,88,188,-100
"[도 3a의 평면도에서 볼 수 있는 바와 같이, 스위치 노드 커넥터(14)의 평면 전도성 층(60)은, 제어 칩(13) 위에 위치하는 개구(25)의 양쪽 주위로 연장되는 2개의 브랜치(15, 16)를 포함한다.","As can be seen in the plan view of figure 3A, the planar conductive layer 60 of the switch node connector 14 includes two branches 15, 16 which extend around opposing sides of an aperture 25 which is positioned above the control chip 13.",True,0.2130361497402191,0.9084573649361596,26,44,-18,117,237,-120
제어 칩(13)은 이 실시예에서 스위치 노드 커넥터(14)에 의해 부분적으로 노출된다.,The control chip 13 is partially uncovered by the switch node connector 14 in this embodiment.,True,0.1790143847465515,0.9030062739907736,10,16,-6,48,94,-46
"제1 및 제2 브랜치(15, 16)는 하이측 스위치(12) 상에 위치하는 공통 제2 부분(22)과 로우측 스위치(11)에 접속된 공통 제1 부분(21) 사이에서 연장된다.","The first and second branches 15, 16 extend between a common second portion 22 which is positioned on the high side switch 12 and a common first portion 21 which is connected on the low side switch 11.",True,0.1615596562623977,0.9258393874004772,20,38,-18,95,201,-106
제2 브랜치(16)의 폭 및 단면적은 제1 브랜치(15)의 폭 및 단면적보다 더 작다.,The width and the cross-sectional area of the second branch 16 is smaller than the width and consequently cross-sectional area of the first branch 15.,True,0.2259645909070968,0.8652067668778854,12,25,-13,48,150,-102
"이 실시예에서, 스위치 노드 커넥터(14) 및 전도성 층(60)은 또한 인덕터가 배치될 수 있는 추가 개구(64)를 포함한다.]","In this embodiment, the switch node connector 14 and conducive layer 60 also includes a further aperture 64 in which an inductor may be positioned.",True,0.1747392863035202,0.9175520071153824,16,25,-9,71,147,-76
"[일부 실시예에서, 외부 접촉 패드(49)와 로우측 스위치(11), 하이측 스위치(12) 및 스위치 노드 커넥터(14) 사이의 재배선 구조의 일부는 절연 코어 층(50) 상에 형성된다.","In some embodiments, a portion of the rewiring structure between the outer contact pads 49 and the low side switch 11, the high side switch 12 and the switch node connector 14 is formed on the insulating core layer 50.",True,0.1661565154790878,0.9290453478561498,22,40,-18,103,218,-115
"절연 코어층(50)은 인쇄 회로 기판의 코어층에 일반적으로 사용되는 강화된 열경화성 수지에 의해 제공될 수 있으며, 이는 두 개의 대향 표면(52, 58) 상에 위치하는 금속 포일로 형성된 전도성 층(65, 66)을 포함한다.","For example, the insulating core layer 50 may be provided by a reinforced thermosetting resin, as is commonly used for the core layer of a printed circuit board and which includes conductive layers 65, 66 formed of metallic foil positioned on the two opposing surfaces, 52, 58.",True,0.252251386642456,0.8600463575832805,30,47,-17,126,277,-151
"이들 전도성 층(65, 66)은, 예를 들어 로우측 스위치(11)의 소스 패드(41)와 V, Sub[attributes={}; value=[low]], 패드(56) 사이 및 하이측 스위치(12)의 드레인 패드(45)와 V, Sub[attributes={}; value=[high]], 패드(54) 사이에 재배선 구조의 일부를 형성하도록 패터닝될 수 있다.","These conductive layers 65, 66 can be patterned to form part of the redistribution structure, for example between the source pad 41 of the low side switch 11 and the Vlow pad 56 and between the drain pad 45 of the high side switch 12 and the Vhigh pad 54.",False,0.2868398129940033,0.8665537791714,32,50,-18,198,255,-57
"추가적인 전도성 비아(67)는 이 전도성 층(65)과 로우측 스위치(11) 및 하이측 스위치(12)의 제각기의 패드(41, 45) 사이에 위치한다.","Further conductive vias 67 are positioned between this conductive layer 65 and the respective pad 41, 45of the low side switch 11 and high side switch 12.",True,0.274175763130188,0.8814667617028397,16,27,-11,82,154,-72
"마찬가지로, 절연 코어 층(50)의 반대 표면(58) 상에 위치하는 전도성 층(66)은 스위치 노드 커넥터(14)의 전도성 재배선 구조의 일부를 형성할 수 있고, 추가 전도성 비아(68)가 이 측면 전도성 층(66)과 하이측 스위치(12)의 소스 패드(47) 사이에 그리고 전도성 층(66)과 로우측 스위치(11)의 드레인 패드(43) 사이에 위치할 수 있다.]","Similarly, the conductive layer 66positioned on the opposing surface 58 of insulating core layer 50 may form part of the conductive redistribution structure of the switch node connector 14 with further conductive vias 68 being positioned between this lateral conductive layer 66 and the source pad 47 of the high side switch 12 and between the conductive layer 66 and the drain pad 43 of the low side switch 11.",True,0.2335960119962692,0.9039270501048304,43,70,-27,202,411,-209
"[2개의 브랜치(15, 16)는 소스 패드(47)와 드레인 패드(43) 사이에서 전류를 운반하기 위한 2개의 경로를 제공한다.","The two branches 15, 16 provide two routes for carrying current between the source pad 47 and the drain pad 43.",True,0.2001872211694717,0.8988059923155256,14,21,-7,70,111,-41
"제1 경로는 서로 마주하는 하이측 스위치(12)와 로우측 스위치(11)의 측면들(26, 26') 사이에서 직접 연장되는 제1 브랜치(15)에 의해 제공된다.","The first route is provided by the first branch 15 which extends directly between the side faces 26, 26' of the high side switch 12 and the low side switch 11 that face one another.",True,0.224591314792633,0.8931796481404298,17,35,-18,87,181,-94
"제2 브랜치(16)는, 처음에는 하이측 스위치(12)로부터 로우측 스위치(11)로부터 멀어지는 방향으로 연장되고, 제어 칩(13)의 주변 둘레에 루프를 형성하여 하이측 스위치(12)와 로우측 스위치(11)의 두 대각으로 반대편 단부 사이에 전도성 접속을 제공하는 제2 경로를 제공한다. 2개의 브랜치(15, 16)의 이러한 배열은 스위치 노드 커넥터(14) 내의 전류 분포를 균일화하는 데 사용된다.]",The second branch 16 provides a second route which initially extends from the high side switch 12 in a direction away from the low side switch 11 and which forms a loop around the periphery of the control chip 13 to provide a conductive connection between the two diagonally opposing ends of the high side switch 12 and the low side switch 11.,False,0.257914125919342,0.8929468124839594,45,63,-18,224,343,-119
"[스위치 노드 패드(61)와 V, Sub[attributes={}; value=[high]], 패드(54) 사이의 제2 브랜치(16)에 의해 제공되는 2차 전류 경로는 전류 밀도 분포를 밸런싱하고 소자의 전도 손실 및 전체 저항을 감소시키는 데 사용된다.","The secondary current path provided by the second branch 16 between the switch node pad 61 and the Vhigh pad 54 is used to balance current density distributions, reduce conduction and overall resistance of the device.",False,0.2950260937213897,0.8544527149114082,28,36,-8,142,217,-75
"이러한 유형의 모듈(40)에 대해, 시뮬레이션은 2MHz 드라이버 주파수 및 15% 듀티 사이클에서의 전도 손실이, 제2 브랜치(16)가 없고 제1 브랜치(15)에 의해 제공되는 단일 전류 경로만 갖는 배열에 비해 2.3% 및 3.4% 감소될 수 있음을 나타낸다.]","For this type of module 40, simulations indicate that conduction losses at a 2MHz driver frequency and 15% duty cycle may be reduced by 2.3% and 3.4% over an arrangement without the second branch 16 and having only a single current path provided by the first branch 15.",True,0.136659562587738,0.9265104618064084,34,48,-14,148,269,-121
[인덕터용 개구(64)는 로우측 스위치(11)와 제어 칩(13) 사이에 횡방향으로 위치할 수 있고 제어 칩(13) 위에 위치하는 개구(25)로부터 이격된다.,The aperture 64 for the inductor may be positioned laterally between the low side switch 11 and the control chip 13 and is spaced apart from the aperture 25 positioned above the control chip 13.,True,0.2748616635799408,0.8722100411623092,17,35,-18,87,194,-107
"따라서, 이 실시예에서 스위치 노드 커넥터(14)는, 세 개의 브랜치(15, 16, 69) 모두에 공통이며 하이측 스위치(12) 상에 위치하는 제2 부분(21)과 세 개의 브랜치(15, 16, 69) 모두에 공통인 로우측 스위치(11) 상에 위치하는 제1 부분(21) 사이에서 연장되는 제3 브랜치(69)를 포함하는 것으로 고려될 수 있다.","Therefore, in this embodiment, switch node connector 14 can be considered to include a third branch 69 which extends between the second portion 21, which is common to all three branches 15, 16, 69 and positioned on the high side switch 12, and the first portion 21 positioned on the low side switch 11, which is common to all three branches 15, 16, 69.",True,0.1721430122852325,0.924947988065144,41,64,-23,190,352,-162
하이측 스위치(12)의 소스 패드(47)와 로우측 스위치(11)의 드레인 패드(43) 사이에 서로 다른 방향으로 연장되는 3개의 전도성 경로(17)가 제공된다.],Three conductive paths 17 which are extend in differing directions are provided between the source pad 47 of the high side switch 12 and the drain pad 43 of the low side switch 11.,True,0.1983861178159713,0.9098058432373296,17,34,-17,90,180,-90
[도 4는 일 실시예에 따른 반도체 모듈(80)의 개략적인 평면도이다.,Figure 4 illustrates a plan view of a semiconductor module 80 according to an embodiment.,True,0.2266799360513687,0.8527171905607269,9,15,-6,39,89,-50
"이 실시예에서, 스위치 노드 커넥터(14)는, 하이측 스위치(12) 및 로우측 스위치(11)에 횡방향으로 인접하게 위치하며 각각 커패시터용 접촉 패드를 노출시키는 2개의 개구(81, 82)을 포함한다.","In this embodiment, the switch node connector 14 includes two apertures 81, 82 which are positioned laterally adjacent the high side switch 12 and the low side switch 11 and which each reveal a contact pad for a capacitor.",True,0.2064047157764434,0.914181783345253,22,39,-17,112,222,-110
"이 실시예에서, 스위치 노드 커넥터(14), 특히 측면 전도성 층(60)은, 제어 칩(13)의 일부 또는 전부가 스위치 노드 커넥터(14)의 주변부(84)에 측면으로 인접하게 위치하도록, 측면 형태를 갖는다.]","In this embodiment, the switch node connector 14 and, in particular, the lateral conductive layer 60 has a lateral form such that a part or all of the control chip 13 is positioned laterally adjacent the periphery 84 of the switch node connector 14.",True,0.1814289987087249,0.9215997105445496,24,44,-20,117,249,-132
[제2 브랜치(16)는 제2 개구(82)와 전도성 층(60)의 주변부(84) 사이에 형성된다.,The second branch 16 is formed between the second aperture 82 and the periphery 84 of the conductive layer 60.,True,0.1876469701528549,0.9048891364693512,9,20,-11,52,110,-58
제2 브랜치(16)는 제어 칩(13) 위에 그리고 제어 칩(13)과 로우측 스위치(11) 및 하이측 스위치(12) 사이에 부분적으로 위치한다.,The second branch 16 is positioned partially above the control chip 13 and between the control chip 13 and the low side switch 11 and high side switch 12.,True,0.1906158328056335,0.9180460165786218,16,29,-13,79,154,-75
제2 브랜치(16)는 도 1 내지 3에 도시된 실시예에서와 같이 제어 칩(13)의 반대편에 위치하는 것이 아니라 하이측 스위치(12) 및 로우측 스위치(11)와 제어 칩(13)의 동일한 쪽에 위치한다.],The second branch 16 is position on the same side of the control chip 13 as the high side switch 12 and low side switch 11 rather than being positioned on the opposing side of the control chip 13 as in the embodiments illustrated in figures 1 to 3.,True,0.1836620569229126,0.9151702493211452,25,49,-24,113,248,-135
"[스위치 노드 커넥터(14)는 하이측 스위치(12)의 소스 패드(47)에 위치한 제2 부분(22)과 로우측 스위치(11)의 드레인 패드(43)에 위치한 제1 부분(21) 사이에 3개의 브랜치(15, 16, 83)를 포함한다.","The switch node connector 14 includes three branches 15, 16, 83 between the second portion 22 positioned on the source pad 47 of the high side switch 12 and the first portion 21 positioned on the drain pad 43 of the low side switch 11.",True,0.2101843655109405,0.9118493823171376,23,45,-22,125,235,-110
"제2 브랜치(16)는 하이측 스위치(12)와 로우측 스위치(11)의 2개의 대각선 가장 바깥쪽 부분들, 즉 측면들(27, 27') 사이에서 연장되고, 따라서, 서로 마주보는 하이측 스위치(12)와 로우측 스위치(11)의 측면들(26, 26') 사이에서 직접 연장되는 제1 브랜치(15)의 최단 경로(17)에 더하여 추가 경로(17)를 제공한다.","The second branch 16 extends between the two diagonal outermost portions, i.e. the side faces 27, 27', of the high side switch 12 and low side switch 11 and, therefore, provides a further path 17 in addition to the shortest path 17 of the first branch 15 which extends directly between the side faces 26, 26'of the high side switch 12 and low side switch 11 that face one another.",True,0.1602290868759155,0.9306713505951184,36,70,-34,192,380,-188
"본 발명에 있어서는 골아세포의 분화를 촉진하여, 골 손실 질환의 발병 시기를 지연시키거나, 발병을 억제하는 것을 의미한다.","In the present invention, the prevention means that the delay or inhibition of the onset of a bone loss-related disease by promoting osteoblast differentiation.",True,0.2823272347450256,0.8066018388476505,16,24,-8,68,160,-92
"본 발명의 골 손실 질환의 예방, 개선 또는 치료용 조성물에 있어서, 용어 “개선”은 질병 또는 병증 상태를 호전 또는 이롭게 변경하는 모든 행위를 의미하는 것으로, 본 발명에 있어서는 골아세포의 분화를 촉진하는 작용을 통해서 골다공증의 증상 또는 치조골 손실과 같은 증상을 호전시키는 것을 의미한다.","In the composition for preventing, improving or treating a bone loss-related disease according to the present invention, the term ""improvement"" refers to all actions involved in improving or beneficially changing a disease or its symptom, and in the present invention, means alleviation of symptoms of osteoporosis or symptoms such as alveolar bone loss, through the action of promoting osteoblast differentiation.",True,0.1318199038505554,0.9269775315535692,43,60,-17,168,414,-246
"본 발명의 골 손실 질환의 예방, 개선 또는 치료용 조성물에 있어서, 용어 “치료”는 질병 또는 병증의 진행을 지연, 중단 또는 역전시키는 모든 행위를 의미하는 것으로, 본 발명에 있어서는 골아세포의 분화를 촉진하는 작용을 통해서 치조골 또는 뼈 등의 손실을 중단, 경감, 완화 또는 없애거나, 역전시키는 것을 의미한다.","In the composition for preventing, improving or treating a bone loss-related disease according to the present invention, the term ""treatment"" refers to all actions of delaying, stopping or changing the progression of a disease or symptom, and in the present invention, means stopping, reducing, alleviating or eliminating, or changing the loss of alveolar bone or bone through an action of promoting osteoblast differentiation.",True,0.1277575939893722,0.9296776969967946,46,63,-17,179,427,-248
"용어 ""상승 효과(synergy effect)""는 각 성분이 병용(조합) 투여될 때 발생되는 효과가, 단일 성분으로서 단독으로 투여될 때 발생되는 효과의 합보다 더 큰 것을 말한다[Chou and Talalay, Adv. Enzyme. Regul., 22:27-55, 1984]. 본 발명의 CHP 또는 이의 염 및 부갑상선 호르몬은 병용 투여함으로써 골 손실 질환에 대한 예방, 개선 또는 치료효과를 상승시킨다.","The term ""synergistic effect"" means that the effect generated when components are administered in combination is greater than the sum of effects generated when the components are independently administered, respectively [ Chou and Talalay, Adv. Enzyme.",False,0.3231667578220367,0.8005401472332069,50,36,14,231,252,-21
"용어 ""병용 투여(administered in combination)""는 화합물 또는 성분이 환자에게 함께 투여되는 것을 의미한다.","The term ""administered in combination"" means administration of a compound or ingredient in combination into a patient.",True,0.1152808293700218,0.9285557809336884,13,17,-4,73,118,-45
"각 화합물 또는 성분이 함께 투여된다는 것은 원하는 치료 효과를 얻기 위해서, 각 성분을 동일한 시간에 또는 임의의 순서로 또는 상이한 시간에 순차적으로 투여될 수 있음을 의미한다.",The administration of each compound or ingredient in combination can be randomly administered at the same time or sequentially administered at different times to obtain a desired therapeutic effect.,True,0.2803295254707341,0.8319772775505461,27,29,-2,101,198,-97
"용어 ""환자""는 인간, 소, 개, 기니아 피그, 토끼, 닭, 곤충 등을 포함하여 치료가 요구되는 임의의 단일 개체를 의미한다.","The term ""patient"" refers to any individual in need of treatment, including humans, cattle, dogs, guinea pigs, rabbits, chickens, and insects.",True,0.208073616027832,0.8613345630028684,18,21,-3,70,142,-72
"또한, 임의의 질병 임상 소견을 보이지 않는 임상 연구 시험에 참여한 임의의 대상 또는 역학 연구에 참여한 대상 또는 대조군으로 사용된 대상이 대상에 포함된다.","In addition, subjects include any subject participating in a clinical trial without any clinical finding of a disease, a subject participating in a clinical trial, or a subject used as a control.",True,0.2676379382610321,0.8285546414619116,24,32,-8,89,195,-106
"본원에서, 용어 “약학적으로 허용가능한”은 생리학적으로 허용되고 인간에게 투여될 때, 통상적으로 알레르기 반응 또는 이와 유사한 반응을 일으키지 않는 것을 말하며, 상기 염으로는 약제학적으로 허용가능한 유리산(free acid)에 의하여 형성된 산 부가산염이 바람직하다.","The term ""pharmaceutically acceptable"" used herein means, when a salt is physiologically acceptable and administered to a human, it typically does not cause an allergic reaction or a similar reaction thereto, and the salt is preferably an acid addition salt formed by a pharmaceutically acceptable free acid.",False,0.1584827899932861,0.9110274071892792,31,47,-16,151,308,-157
"상기 약학적으로 허용 가능한 염은 유기산 또는 무기산을 이용하여 형성된 산 부가염일 수 있으며, 상기 유기산은 예를 들면 포름산, 아세트산, 프로피온산, 락트산, 부티르산, 이소부티르산, 트리플루오로아세트산, 말산, 말레산, 말론산, 푸마르산, 숙신산, 숙신산 모노아미드, 글루탐산, 타르타르산, 옥살산, 시트르산, 글리콜산, 글루쿠론산, 아스코르브산, 벤조산, 프탈산, 살리실산, 안트라닐산, 디클로로아세트산, 아미노옥시 아세트산, 벤젠술폰산, p-톨루엔술폰산 또는 메탄술폰산을 포함한다.","The organic acid may be, for example, formic acid, acetic acid, propionic acid, lactic acid, butyric acid, isobutyric acid, trifluoroacetic acid, malic acid, maleic acid, malonic acid, fumaric acid, succinic acid, succinic acid monoamide, glutamic acid, tartaric acid, oxalic acid, citric acid, glycolic acid, glucuronic acid, ascorbic acid, benzoic acid, phthalic acid, salicylic acid, anthranilic acid, dichloroacetic acid, aminooxyaceitc acid, benzenesulfonic acid, p-toluenesulfonic acid or methanesulfonic acid.",True,0.3748078644275665,0.8018597660888565,51,67,-16,274,516,-242
"무기산은 예를 들면 염산, 브롬산, 황산, 인산, 질산, 탄산 또는 붕산을 포함한다.","The inorganic acid may be, for example, hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, nitric acid, carbonic acid or boric acid.",True,0.4009926617145538,0.7636023806930766,12,22,-10,47,150,-103
"산 부가염은 바람직하게는 염산염 또는 아세트산염 형태일 수 있으며, 보다 바람직하게는 염산염 형태일 수 있다.","The acid addition salt is preferably a hydrochloride or acetate, and more preferably a hydrochloride.",True,0.2896195352077484,0.8218149911814426,15,15,0,61,101,-40
"이외에도 추가적으로 염이 가능한 형태는 가바염, 가바펜틴염, 프레가발린염, 니코틴산염, 아디페이트염, 헤미말론산염, 시스테인염, 아세틸시스테인염, 메티오닌염, 아르기닌염, 라이신염, 오르니틴염 또는 아스파르트산염 등이 있다.","In addition, a form that can be a salt may be a GABA salt, a gabapentin salt, a pregabalin salt, a nicotinate salt, an adipate salt, a hemimalonate salt, a cysteine salt, an acetylcysteine salt, a methionine salt, an arginine salt, a lysine salt, an ornithine salt or an aspartate salt.",True,0.2813509702682495,0.8323404428581863,21,51,-30,125,286,-161
"또한, 본 발명의 약학적 조성물은 약학적으로 허용가능한 담체를 더 포함할 수 있다.","In addition, the pharmaceutical composition of the present invention may further include a pharmaceutically acceptable carrier.",True,0.1989330053329467,0.8816499074690524,12,16,-4,46,127,-81
"약학적으로 허용되는 담체로는 예컨대, 경구 투여용 담체 또는 비경구 투여용 담체를 추가로 포함할 수 있다.","The pharmaceutically acceptable carrier may further include, for example, a carrier for oral administration or a carrier for parenteral administration.",True,0.3373419940471649,0.8027536527407497,15,20,-5,59,151,-92
"경구 투여용 담체는 락토스, 전분, 셀룰로스 유도체, 마그네슘 스테아레이트, 스테아르산 등을 포함할 수 있다.","The carrier for oral administration may be lactose, starch, a cellulose derivative, magnesium stearate, or stearic acid.",True,0.3170254528522491,0.8001650993987435,14,17,-3,61,120,-59
"비경구 투여용 담체는 물, 적합한 오일, 식염수, 수성 글루코스 및 글리콜 등을 포함할 수 있다.","The carrier for parenteral administration may be water, a suitable oil, physiological saline, aqueous glucose and glycol.",True,0.1945330202579498,0.8757539654239201,15,17,-2,54,121,-67
"또한, 안정화제 및 보존제를 추가로 포함할 수 있다.","In addition, a stabilizer and a preservative may be included.",True,0.1397638320922851,0.910295325166196,8,10,-2,29,61,-32
"적합한 안정화제로는 아황산수소나트륨, 아황산나트륨 또는 아스코르브산과 같은 항산화제가 있다.","A suitable stabilizer is sodium bisulfite, sodium sulfite, or an antioxidant such as ascorbic acid.",True,0.2697013318538666,0.8283440598910076,9,15,-6,51,99,-48
"적합한 보존제로는 벤즈알코늄 클로라이드, 메틸- 또는 프로필-파라벤 및 클로로부탄올이 있다.","A suitable preservative is benzalkonium chloride, methyl-or propyl-paraben, or chlorobutanol.",True,0.1421025395393371,0.9116693971078562,10,10,0,51,93,-42
"그 밖의 약학적으로 허용되는 담체로는 다음의 문헌에 기재되어 있는 것을 참고로 할 수 있다 (Remington's Pharmaceutical Sciences, 19th ed., Mack Publishing Company, Easton, PA, 1995).","For other pharmaceutically acceptable carriers, reference may be made to those disclosed in the following document ( Remington's Pharmaceutical Sciences, 19th ed., Mack Publishing Company, Easton, PA, 1995 ).",True,0.1239559426903724,0.9123766621251228,25,29,-4,142,208,-66
본 발명의 약학적 조성물은 인간을 비롯한 포유동물에 어떠한 방법으로도 투여할 수 있다.,The pharmaceutical composition of the present invention may be administered into mammals including a human by any method.,True,0.1115218847990036,0.9319980501214352,12,18,-6,48,121,-73
"예를 들어, 경구 또는 비경구로 투여할 수 있으며, 비경구적인 투여방법으로는 이에 제한되는 것은 아니나, 정맥내, 근육내, 동맥내, 골수내, 경막내, 심장내, 경피, 피하, 복강내, 비강내, 장관, 국소, 설하 또는 직장 내 투여일 수 있다.","For example, the pharmaceutical composition of the present invention may be administered orally or parenterally, and a parenteral administration method may be, but is not limited to, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intracardiac, transdermal, subcutaneous, intraperitoneal, intranasal, enteral, local, sublingual or rectal administration.",True,0.3741719722747803,0.7904385210995991,33,43,-10,135,377,-242
본 발명의 약학적 조성물은 상술한 바와 같은 투여 경로에 따라 경구 투여용 또는 비경구 투여용 제제로 제형화할 수 있다.,The pharmaceutical composition of the present invention may be formulated as a preparation for oral or parenteral administration according to an administration route described above.,True,0.2179459631443023,0.8787059953140521,19,25,-6,67,182,-115
"제형화할 경우에는 하나 이상의 완충제(예를 들어, 식염수 또는 PBS), 카보하이드레이트(예를 들어, 글루코스, 만노스, 수크로스, 또는 덱스트란 등), 항산화제, 정균제, 킬레이트화제(예를 들어, EDTA 또는 글루타치온), 충진제, 증량제, 결합제, 아쥬반트(예를 들어, 알루미늄 하이드록사이드), 현탁제, 농후제, 습윤제, 붕해제 또는 계면활성제, 희석제 또는 부형제를 사용하여 조제될 수 있다.","For the formulation of the composition, the oral formulation may be prepared using one or more buffers (e.g., saline or PBS), an antioxidant, an antibacterial agent, a chelating agent (e.g., EDTA or glutathione), a filler, an expander, a binder, an adjuvant (e.g., aluminum hydroxide), a suspending agent, a thickening agent, a wetting agent, a disintegrant, a surfactant, a diluent or an excipient.",True,0.2219888418912887,0.887021802756311,44,62,-18,224,399,-175
"경구투여를 위한 고형제제에는 정제, 환제, 산제, 과립제, 액제, 겔제, 시럽제, 슬러리제, 현탁액 또는 캡슐제 등이 포함되며, 이러한 고형제제는 본 발명의 약학 조성물에 적어도 하나 이상의 부형제 예를 들면, 전분(옥수수 전분, 밀 전분, 쌀 전분, 감자 전분 등 포함), 칼슘카보네이트(Calcium carbonate), 수크로스(Sucrose), 락토오스(Lactose), 덱스트로오스, 솔비톨, 만니톨, 자일리톨, 에리스리톨 말티톨, 셀룰로즈, 메틸 셀룰로즈, 나트륨 카르복시메틸셀룰로오즈 및 하이드록시프로필메틸-셀룰로즈 또는 젤라틴 등을 섞어 조제될 수 있다.","Solid preparations for oral administration may include tablets, pills, powders, gels, slurries, suspension, and capsules, and these solid preparations may be prepared by mixing the pharmaceutical composition of the present invention with at least one or more excipients, for example, starch (including corn starch, wheat starch, rice starch, potato starch, etc.), calcium carbonate, sucrose, lactose, dextrose, sorbitol, mannitol, xylitol, erythritol, maltitol, cellulose, methyl cellulose, sodium carboxymethylcellulose, hydroxyproxymethyl-cellulose or gelatin.",True,0.1471368968486786,0.9256424839340748,62,69,-7,318,562,-244
"예컨대, 활성성분을 고체 부형제와 배합한 다음 이를 분쇄하고 적합한 보조제를 첨가한 후 과립 혼합물로 가공함으로써 정제 또는 당의정제를 수득할 수 있다.","For example, tablets or sugar-coated tablets may be obtained by combining an active ingredient with solid excipients, grinding the mixture, adding a suitable adjuvant and processing the resulting product into a granular mixture.",True,0.1993069648742675,0.8878369711159421,21,33,-12,85,228,-143
단순한 부형제 이외에 마그네슘 스티레이트 탈크 같은 윤활제들도 사용된다.,"Other than simple excipients, lubricants such as magnesium stearate, talc, etc. are also used.",True,0.1984131187200546,0.854486955705882,9,14,-5,40,94,-54
"경구를 위한 액상 제제로는 현탁제, 내용액제, 유제 또는 시럽제 등이 해당되는데 흔히 사용되는 단순 희석제인 물 또는 리퀴드 파라핀 이외에 여러 가지 부형제, 예를 들면 습윤제, 감미제, 방향제 또는 보존제 등이 포함될 수 있다.","As a liquid preparation for oral administration, a suspending agent, a liquid for internal use, an emulsion or a syrup is used, and other than a commonly used simple diluent such as water or a liquid paraffin, various excipients, for example, a wetting agent, a sweetening agent, a fragrance and a preservative may be included.",True,0.2685418128967285,0.8533792518164193,34,55,-21,128,327,-199
"또한, 경우에 따라 가교결합 폴리비닐피롤리돈, 한천, 알긴산 또는 나트륨 알기네이트 등을 붕해제로 첨가할 수 있으며, 항응집제, 윤활제, 습윤제, 향료, 유화제 및 방부제 등을 추가로 포함할 수 있다.","In addition, in some cases, crosslinked polyvinylpyrrolidone, agar, alginic acid or sodium alginate may be added as a disintegrant, and an anticoagulant, an aromatic, an emulsifier, a solubilizer, a dispersant, a flavoring agent, an antioxidant, a packaging agent, a pigment and a preservative may be further included.",True,0.272754967212677,0.8512134221044128,27,47,-20,112,318,-206
"비경구적으로 투여하는 경우 본 발명의 약학 조성물은 적합한 비경구용 담체와 함께 주사제, 경피 투여제 및 비강 흡입제의 형태로 당 업계에 공지된 방법에 따라 제형화 될 수 있다.","For parenteral administration, the pharmaceutical composition of the present invention may be formulated in the form of an injection, an agent for transdermal administration and a nasal inhalant together with a suitable parenteral carrier by a method known in the art.",True,0.2968365848064422,0.8370641738321632,27,41,-14,99,268,-169
상기 주사제의 경우에는 반드시 멸균되어야 하며 박테리아 및 진균과 같은 미생물의 오염으로부터 보호되어야 한다.,The injection needs to be sterilized and protected from contamination by microorganisms such as bacteria and fungi.,True,0.186065673828125,0.8620431692348588,14,17,-3,61,115,-54
"주사제의 경우 적합한 담체의 예로는 이에 한정되지는 않으나, 물, 에탄올, 폴리올(예를 들어, 글리세롤, 프로필렌 글리콜 및 액체 폴리에틸렌 글리콜 등), 이들의 혼합물 및/또는 식물유를 포함하는 용매 또는 분산매질일 수 있다.","In the case of injection, examples of suitable carriers may be, but are not limited to, water, ethanol, polyols (e.g., glycerol, propylene glycol and liquid polyethylene glycol), a mixture thereof and/or a solvent or dispersion medium containing vegetable oil.",True,0.1335126459598541,0.9281751712782002,30,39,-9,127,260,-133
"보다 바람직하게는, 적합한 담체로는 행크스 용액, 링거 용액, 트리에탄올 아민이 함유된 PBS(phosphate buffered saline) 또는 주사용 멸균수, 10% 에탄올, 40% 프로필렌 글리콜 및 5% 덱스트로즈와 같은 등장 용액 등을 사용할 수 있다.","More preferably, as a suitable carrier, an isotonic solution such as Hank's solution, Ringer's solution, triethanol amine-containing phosphate buffered saline (PBS) or injectable sterile water, 10% ethanol, 40% propylene glycol and 5% dextrose may be used.",True,0.1101469546556472,0.9404236171490116,32,36,-4,147,256,-109
"상기 주사제를 미생물 오염으로부터 보호하기 위해서는 파라벤, 클로로부탄올, 페놀, 소르빈산, 티메로살 등과 같은 다양한 항균제 및 항진균제를 추가로 포함할 수 있다.","To protect the injection from microbial contamination, various antibacterial agents and antifungal agents such as paraben, chlorobutanol, phenol, sorbic acid and thimerosal may be further included.",True,0.1678811311721801,0.9027740749559376,21,26,-5,92,197,-105
"또한, 상기 주사제는 대부분의 경우 당 또는 나트륨 클로라이드와 같은 등장화제를 추가로 포함할 수 있다.","In addition, the injection may further include, in most cases, an isotonic agent such as a sugar or sodium chloride.",True,0.2275685220956802,0.8620675092926062,15,20,-5,58,116,-58
"경피 투여제의 경우 연고제, 크림제, 로션제, 겔제, 외용액제, 파스타제, 리니멘트제, 에어롤제 등의 형태가 포함된다.","The agent for transdermal administration is prepared in an ointment, a cream, a lotion, a gel, a liquid for external use, a pasta, a liniment or an aerosol.",True,0.4348245859146118,0.7080130153934099,14,28,-14,66,156,-90
상기에서 '경피 투여'는 약학적 조성물을 국소적으로 피부에 투여하여 약학적 조성물에 함유된 유효한 양의 활성성분이 피부 내로 전달되는 것을 의미한다.,"The ""transdermal administration"" means that an effective amount of active ingredient contained in a pharmaceutical composition is delivered into the skin by topically administering the pharmaceutical composition to the skin.",True,0.2248570919036865,0.8500759293738683,19,30,-11,83,224,-141
"흡입 투여제의 경우, 본 발명에 따라 사용되는 화합물은 적합한 추진제, 예를 들면, 디클로로플루오로메탄, 트리클로로플루오로메탄, 디클로로테트라플루오로에탄, 이산화탄소 또는 다른 적합한 기체를 사용하여, 가압 팩 또는 연무기로부터 에어로졸 스프레이 형태로 편리하게 전달할 수 있다.","In the case of an agent administered by inhalation, the compound used according to the present invention may be conveniently delivered in the form of an aerosol spray from a pressurized pack or nebulizer, using a suitable propellant, for example, dichlorofluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or another suitable gas.",True,0.1417439579963684,0.9255524812281516,32,49,-17,156,360,-204
"가압 에어로졸의 경우, 투약 단위는 계량된 양을 전달하는 밸브를 제공하여 결정할 수 있다.","In the case of a pressurized aerosol, a dosage unit may be determined by providing a valve for delivering a measured amount.",True,0.1507179588079452,0.8854791736330441,13,22,-9,50,124,-74
"예를 들면, 흡입기 또는 취입기에 사용되는 젤라틴 캡슐 및 카트리지는 화합물, 및 락토오스 또는 전분과 같은 적합한 분말 기제의 분말 혼합물을 함유하도록 제형화할 수 있다.","For example, a gelatin capsule and a cartridge used in an inhaler or insufflator may be formulated to contain a powder mixture of a compound, and a suitable powder base such as lactose or starch.",True,0.2322508245706558,0.8742930362303396,25,35,-10,96,195,-99
"비경구 투여용 제형은 모든 제약 화학에 일반적으로 공지된 처방서인 문헌(Remington's Pharmaceutical Science, 15th Edition, 1975. Mack Publishing Company, Easton, Pennsylvania 18042, Chapter 87: Blaug, Seymour)에 기재되어 있다.","Formulations for parenteral administration are disclosed in prescriptions generally known in all of pharmaceutical chemistry ( Remington's Pharmaceutical Science, 15th Edition, 1975.",False,0.2144309729337692,0.8446901726357993,27,22,5,186,182,4
"본 발명의 약학적 조성물은 사이클로-히스프로 또는 이의 염 및 부갑상선 호르몬을 유효량으로 포함할 때 바람직한 골 손실 질환 예방, 개선 또는 치료 효과를 제공할 수 있다.","The pharmaceutical composition of the present invention may provide a preferable effect of preventing, improving or treating a bone loss-related disease when CHP or a salt thereof and PTH are contained at effective amounts.",True,0.4649689495563507,0.7486527148572436,26,34,-8,96,223,-127
"본원에서, 용어 “유효량”은 음성 대조군에 비해 그 이상의 반응을 나타내는 양을 말하며, 바람직하게는 골 손실 질환을 예방, 개선 또는 치료하기에 충분한 양을 말한다.","The term ""effective amount"" used herein refers to an amount that shows a greater response than a negative control, and preferably, an amount sufficient for preventing, improving or treating a bone loss-related disease.",True,0.2095672786235809,0.8735466645290041,23,33,-10,93,218,-125
"본 발명의 약학적 조성물에 사이클로-히스프로 또는 이의 염 및 부갑상선 호르몬은 0.01 내지 99.9% 포함될 수 있으며, 잔량은 약학적으로 허용가능한 담체가 차지할 수 있다.","The CHP or a salt thereof and PTH may be contained at 0.01 to 99.9% in the pharmaceutical composition of the present invention, and the remainder may be occupied by a pharmaceutically acceptable carrier.",True,0.2874314188957214,0.8338675189185214,24,34,-10,99,203,-104
본 발명의 약학적 조성물에 포함되는 사이클로-히스프로 또는 이의 염 및 부갑상선 호르몬의 유효량은 조성물이 제품화되는 형태 등에 따라 달라질 것이다.,An effective amount of the CHP or a salt thereof and PTH included in the pharmaceutical composition of the present invention may vary according to a commercialized form of the composition.,True,0.4417583346366882,0.7450908746999876,20,31,-11,83,188,-105
"본 발명의 약학적 조성물의 총 유효량은 단일 투여량(single dose)으로 환자에게 투여될 수 있으며, 다중 투여량(multiple dose)으로 장기간 투여되는 분할 치료 방법(fractionated treatment protocol)에 의해 투여될 수 있다.","The total effective amount of the pharmaceutical composition of the present invention may be administered to a patient in a single dose, or administered by a fractionated treatment protocol for administration for a long time in multiple doses.",True,0.2240550965070724,0.8705372553909295,27,38,-11,148,243,-95
본 발명의 약학 조성물은 질환의 정도에 따라 유효성분의 함량을 달리할 수 있다.,An effective amount of the active ingredient in the pharmaceutical composition of the present invention may vary according to the degree of disease.,True,0.2261707633733749,0.8573626466922181,12,23,-11,44,148,-104
"예를 들어, 사이클로-히스프로를 기준으로 하루에 체중 1 kg당 바람직하게 0.001 내지 100 mg, 더 바람직하게는 0.01 내지 10 mg의 양으로 투여되도록 1 내지 수회에 나누어 투여할 수 있다.","For example, the CHP of the pharmaceutical composition of the present invention may be administered daily once or several times to be administered at preferably 0.001 to 100 mg, and more preferably 0.01 to 10 mg per kg of body weight.",True,0.2582426965236664,0.8441147979738937,28,41,-13,115,234,-119
"그러나 상기 사이클로-히스프로 또는 이의 염 및 부갑상선 호르몬의 용량은 약학적 조성물의 투여 경로 및 치료 횟수뿐만 아니라 환자의 연령, 체중, 건강 상태, 성별, 질환의 중증도, 식이 및 배설율 등 다양한 요인들을 고려하여 환자에 대한 유효 투여량이 결정되는 것이므로, 이러한 점을 고려할 때 당 분야의 통상적인 지식을 가진 자라면 상기 사이클로-히스프로 또는 이의 염 및 부갑상선 호르몬을 골 손실 질환의 예방, 치료 또는 개선을 위한 특정한 용도에 따른 적절한 유효 투여량을 결정할 수 있을 것이다.","However, since an effective dosage of the CHP or a salt thereof and PTH for a patient may be determined by considering various factors such as a patient's age, body weight, health condition and gender, the severity of a disease, a diet and an excretion rate, as well as the administration route of the pharmaceutical composition and the number of treatments by one of ordinary skill in the art, a suitably effective dosage of the CHP or a salt thereof and PTH may be determined according to a specific use for preventing, treating or improving a bone loss-related disease.",True,0.3351528942584991,0.8105052210634085,75,99,-24,283,572,-289
"본 발명에 따른 약학적 조성물은 본 발명의 효과를 보이는 한 그 제형, 투여 경로 및 투여 방법에 특별히 제한되지 아니한다.","The pharmaceutical composition according to the present invention is not particularly limited in its formulation, administration route and administration method as long as the effect of the present invention is exhibited.",True,0.0884433686733245,0.9465365756029352,20,31,-11,69,221,-152
"본 발명의 골 손실 질환 예방 또는 치료용 약학적 조성물은 단독으로, 또는 수술, 방사선 치료, 호르몬 치료, 화학 치료 또는 생물학적 반응조절제를 사용하는 방법들과 병용하여 사용할 수 있다.","The pharmaceutical composition for preventing or treating a bone loss-related disease according to the present invention may be used independently, or in combination with surgery, radiotherapy, hormonal therapy, chemotherapy or methods using a biological reaction modifier.",True,0.1414778679609298,0.9255010402040236,28,36,-8,107,273,-166
본 발명의 골 손실 질환 예방 또는 치료용 약학적 조성물은 또한 사이클로-히스프로 또는 이의 염 및 부갑상선 호르몬을 포함하는 외용제의 제형으로 제공할 수 있다.,"The pharmaceutical composition for preventing or treating a bone loss-related disease according to the present invention may also be provided in a formulation for external use, including CHP or a salt thereof and PTH.",True,0.5024887323379517,0.7313460359805554,24,34,-10,90,217,-127
"이러한 측면에서, 본 발명의 조성물은 골 손실 질환 예방 또는 개선용 의약외품 조성물 및 상기 조성물을 포함하는 의약외품 일 수 있다.","In this aspect, the composition of the present invention may be a quasi-drug composition for preventing or improving a bone loss-related disease and a quasi-drug including the composition.",True,0.1855839937925338,0.8986345369473325,21,28,-7,75,188,-113
상기 외용제는 피부 또는 구강 내에 직접 적용될 수 있다.,Ther preparation for external use may be directly applied to the skin or mouth.,True,0.330182671546936,0.7566842125432107,10,14,-4,32,79,-47
"본 발명의 골 손실 질환 예방 또는 치료용 약학 조성물을 외용제로 사용하는 경우, 추가로 지방 물질, 유기 용매, 용해제, 농축제 및 겔화제, 연화제, 항산화제, 현탁화제, 안정화제, 발포제(foaming agent), 방향제, 계면활성제, 물, 이온형 유화제, 비이온형 유화제, 충전제, 금속이온봉쇄제, 킬레이트화제, 보존제, 비타민, 차단제, 습윤화제, 필수 오일, 염료, 안료, 친수성 활성제, 친유성 활성제 또는 지질 소낭 등 피부 외용제에 통상적으로 사용되는 임의의 다른 성분과 같은 피부과학 분야에서 통상적으로 사용되는 보조제를 함유할 수 있다.","When the pharmaceutical composition for preventing or treating a bone loss-related disease according to the present invention is used in the preparation for external use, an adjuvant commonly used in the field of dermatology, which is the same as any other ingredient conventionally used for a preparation for topical use, such as a lipid material, an organic solvent, a solubilizer, a thickening agent and a gelling agent, an emollient, an antioxidant, a suspending agent, a stabilizer, a foaming agent, a fragrance, a surfactant, water, an ionic emulsifier, a non-ionic emulsifier, a filler, a metal sequestering agent, a chelating agent, a preservative, a vitamin, a blocking agent, a wetting agent, an essential oil, a dye, a pigment, a hydrophilic activator, a lipophilic activator or a lipid vesicle, may be further contained.",True,0.1458865702152252,0.9255811648699054,70,130,-60,311,832,-521
"또한, 상기 성분들은 피부 과학 분야에서 일반적으로 사용되는 양으로 도입될 수 있다.","In addition, the ingredients may be introduced at an amount generally used in the field of dermatology.",True,0.2616074681282043,0.820072339148823,12,17,-5,47,103,-56
"본 발명의 조성물이 외용제로 제공될 경우, 이에 제한되는 것은 아니나, 액제, 연고, 패취, 겔, 크림 또는 분무제 등의 제형일 수 있다.","When the composition of the present invention is provided as a preparation for external use, it may be prepared in the form of a liquid, an ointment, a patch, a gel, a cream or a spray, but the present invention is not limited thereto.",True,0.2961023151874542,0.823864370527899,21,44,-23,77,235,-158
"본 발명의 일 구현예에 따르면, 본 발명의 외약외품은 치약, 양치액 및 마우스 스프레이를 포함하는 구강관리 제품, 연고제, 마스크, 습포제, 첩부제 및 경피흡수제 등을 포함할 수 있다.","According to one embodiment of the present invention, the quasi-drug of the present invention may include oral care products including a tooth paste, a mouthwash and a mouth spray, an ointment, a mask, a poultice, a plaster, and a patch.",True,0.2627862989902496,0.8528689114643525,26,40,-14,103,237,-134
"또한, 연결부(104)는, 제3 모터(95)에 인접하여 위치 검출부(108)가 마련된다.",The connecting part 104 includes a position detection unit 108 adjacent to the third motor 95.,True,0.2191406190395355,0.8800350011461431,8,16,-8,49,94,-45
"위치 검출부(108)는, 구동 기어(105)와 맞물리는 종동 기어(109)를 갖고, 구동 기어(105)에 연동되는 종동 기어(109)의 회전수를 검출하여, 너트부(103)와 나사축(96)의 상대 위치를 검출한다.]","The position detection unit 108 has a driven gear 109 that meshes with the drive gear 105, and detects the number of rotations of the driven gear 109 linked to the drive gear 105 so as to detect a relative position of the nut part 103 and the threaded shaft 96.",True,0.1403962969779968,0.9274294629542132,20,51,-31,119,261,-142
"[그 때문에, 제3 모터(95)를 구동하면, 회전력이 전달 기구(97)(구동 기어(105) 및 종동 기어(106))를 통해 나사축(96)에 전달된다.","Thus, when the third motor 95 is driven, the rotational force is transmitted to the threaded shaft 96 through the transmission mechanism 97 (drive gear 105 and driven gear 106).",True,0.0851366519927978,0.9557100661151308,15,30,-15,83,177,-94
"그러면, 나사축(96)이 제3 지지축(O13b)을 중심으로 하여 회동하고, 나사축(96)과 나사축(96)에 나사 결합되는 너트부(103)는 제3 지지축(O13b)의 방향으로 상대 이동한다.","Then, the threaded shaft 96 rotates around the third support axis O13b, and the threaded shaft 96 and the nut part 103 into which the threaded shaft 96 is screwed move relative to each other in the direction of the third support axis O13b.",True,0.1582433432340622,0.9223211358980196,17,44,-27,105,239,-134
"너트부(103)는, 슬라이더(102)에 마련되고, 슬라이더(102)는 연결 부재(101)를 통해 제1 지지 부재(93)에 고정되어 있는 점에서, 제3 지지 기구(56)(제3 모터(95)와 나사축(96)과 전달 기구(97))가 지지된 지지대(53)는, 제1 지지 부재(93)에 대해 제3 지지축(O13a, O13b)의 방향으로 이동할 수 있다.]","Since the nut part 103 is provided on the slider 102 and the slider 102 is fixed to the first support member 93 via the connecting member 101, the support stand 53, on which the third support mechanism 56 (third motor 95, threaded shaft 96, and transmission mechanism 97) is supported, can move in the direction of the third support axes O13a, O13b with respective to the first support member 93.",True,0.1603074967861175,0.9318340914052884,33,71,-38,192,396,-204
"[또한, 용접 토치(51)와 와이어 노즐(52)과 지지대(53)와 제1 지지 기구(54)는, 제1 지지축(O11) 및 용접 토치(51)의 중심축(O1)을 따른 면에 대해 면 대칭이다.","The welding torch 51, the wire nozzle 52, the support stand 53, and the first support mechanism 54 are plane symmetric with respect to a plane along the first support axis O11 and the central axis O1 of the welding torch 51.",True,0.2309240251779556,0.899687235860996,20,42,-22,102,224,-122
"즉, 도 2에서, 용접 토치(51)와 와이어 노즐(52)과 지지대(53)와 제1 지지 기구(54)는, 중심축(O1)에 대해 선 대칭이 되는 구조이다.]","In other words, in FIG. 2, the welding torch 51, the wire nozzle 52, the support stand 53, and the first support mechanism 54 are line symmetric with respect to the central axis O1.",True,0.1653835922479629,0.9248666265843376,17,34,-17,84,181,-97
[[용접 장치의 전체 구성]],[Overall configuration of the welding apparatus],True,0.1262146234512329,0.9139160871095529,4,6,-2,16,48,-32
[도 4는 용접 장치의 전체 구성을 도시하는 개략도이다.],FIG. 4 is a schematic diagram illustrating an overall configuration of the welding apparatus.,True,0.1292158663272857,0.9171756446104968,8,14,-6,32,93,-61
"[용접 장치(50)에서, 도 4에 도시하는 바와 같이, 안내부(91)는, 제4 지지 기구(57)와, 제5 지지 기구(58)를 구비한다.","In the welding apparatus 50, as illustrated in FIG. 4, the guide part 91 includes a fourth support mechanism 57 and a fifth support mechanism 58.",True,0.1716753542423248,0.9204029161783496,15,26,-11,75,145,-70
"제4 지지 기구(57)는, 지지대(53)를 연직 방향을 따른 제4 지지축(O14)을 중심으로 하여 회동 가능하게 지지한다.",The support stand 53 is supported to be rotatable around the fourth support axis O14 along the vertical direction by the fourth support mechanism 57.,True,0.2265704870223999,0.8917333814346502,14,25,-11,68,149,-81
"제5 지지 기구(58)는, 지지대(53)를 적어도 직교하는 3축 방향(X 방향, Y 방향, Z 방향)을 따른 제5 지지축(O15X, O15Y, O15Z)의 축 방향으로 이동 가능하다.","The fifth support mechanism 58 can move the support stand 53 in the axial directions of the fifth support axes O15X, O15Y, O15Z along at least three orthogonal axial directions (X, Y, and Z directions).",True,0.1272653341293335,0.9395361523877628,22,35,-13,102,202,-100
"여기서, 제4 지지축(O14)과 제5 지지축(O15Z)은 동일축이다.]","Here, the fourth support axis 014 and the fifth support axis O15Z are coaxial.",True,0.2813254296779632,0.8419595313728684,6,14,-8,39,78,-39
"[용접 장치(50)는, 도시하지 않은 용접 로봇의 암의 선단부에 지지된다.","The welding apparatus 50 is supported on a tip end of an arm of a welding robot, which is not illustrated.",True,0.2921657562255859,0.8314644673522477,9,21,-12,41,106,-65
"Z 방향 지지 부재(112)는, 제4 지지축(O14)의 축 방향을 따라 배치되고, 용접 로봇의 암에 지지된다.",The Z-direction support member 112 is along the axial direction of the fourth support axis O14 and is supported by the arm of the welding robot.,True,0.2474436461925506,0.8795151983526012,14,26,-12,61,144,-83
"지지 암(111)은, Z축 지지 기구(58Z)에 의해 Z 방향 지지 부재(112)에 대해 제4 지지축(O14) 및 제5 지지축(O15Z)을 따라 이동 가능하게 지지된다.",A support arm 111 is supported to be movable along the fourth support axis O14 and the fifth support axis O15Z with respect to the Z-direction support member 112 by a Z-axis support mechanism 58Z.,True,0.2212875485420227,0.903813004059824,20,35,-15,94,196,-102
"Z축 지지 기구(58Z)는, 도시하지 않은 모터를 갖는다.","The Z-axis support mechanism 58Z has a motor, which is not illustrated.",True,0.2149779647588729,0.8630021965206519,7,12,-5,32,71,-39
"제4 지지 부재(113)는, 제4 지지 기구(57)에 의해 지지 암(111)에 대해 제4 지지축(O14) 및 제5 지지축(O15Z)을 중심으로 하여 회동 가능하게 지지된다.",A fourth support member 113 is supported to be rotatable around the fourth support axis O14 and the fifth support axis O15Z with respect to the support arm 111 by the fourth support mechanism 57.,True,0.2158130854368209,0.905646691831438,20,35,-15,96,195,-99
"제4 지지 기구(57)는, 도시하지 않은 모터를 갖는다.]","The fourth support mechanism 57 has a motor, which is not illustrated.",True,0.2122454047203055,0.870182725657774,7,12,-5,32,70,-38
"[X 방향 지지 부재(114)는, X축 지지 기구(58X)에 의해 제4 지지 부재(113)에 대해 제5 지지축(O15X)을 따라 이동 가능하게 지지된다.",A X-direction support member 114 is supported to be movable along the fifth support axis O15X with respect to the fourth support member 113 by an X-axis support mechanism 58X.,True,0.1902180910110473,0.9143670246026716,18,30,-12,85,175,-90
"X축 지지 기구(58X)는, 도시하지 않은 모터를 갖는다.","The X-axis support mechanism 58X has a motor, which is not illustrated.",True,0.211080715060234,0.8629635475104137,7,12,-5,32,71,-39
"Y 방향 지지 부재(115)는, Y축 지지 기구(58Y)에 의해 X 방향 지지 부재(114)에 대해 제5 지지축(O15Y)을 따라 이동 가능하게 지지된다.",A Y-direction support member 115 is supported to be movable along the fifth support axis O15Y with respect to the X-direction support member 114 by a Y-axis support mechanism 58Y.,True,0.1624221056699752,0.9249656657011024,19,30,-11,86,179,-93
"Y축 지지 기구(58Y)는, 도시하지 않은 모터를 갖는다.","The Y-axis support mechanism 58Y has a motor, which is not illustrated.",True,0.20612533390522,0.8654318079918497,7,12,-5,32,71,-39
"Y 방향 지지 부재(115)는, 하단부에 제2 지지 기구(55)에 의해 제2 지지 부재(92)가 회동 가능하게 지지된다.","On the lower end of the Y-direction support member 115, the second support mechanism 55 supports the second support member 92 in a freely rotatable manner.",True,0.2474366277456283,0.8696570507118578,15,26,-11,67,155,-88
"또한, 제5 지지 기구(58)는, X축 지지 기구(58X)와 Y축 지지 기구(58Y)와 Z축 지지 기구(58Z)에 의해 구성된다.]","The fifth support mechanism 58 includes the X-axis support mechanism 58X, the Y-axis support mechanism 58Y, and the Z-axis support mechanism 58Z.",True,0.2901211678981781,0.8548491975219972,15,22,-7,73,145,-72
"[그 때문에, 제4 지지 기구(57)를 작동시키면, 지지대(53)에 장착된 용접 토치(51) 및 와이어 노즐(52)을, 제4 지지축(O14)(제5 지지축(O15Z))을 중심으로 하여 회동시킬 수 있다.","Thus, activating the fourth support mechanism 57 allows the welding torch 51 and the wire nozzle 52 that are mounted on the support stand 53 to rotate around the fourth support axis 014 (fifth support axis O15Z).",True,0.2769660651683807,0.8839106502144002,21,37,-16,112,212,-100
"또한, 제5 지지 기구(58)를 작동시키면, 지지대(53)에 장착된 용접 토치(51) 및 와이어 노즐(52)을, 제5 지지축(O15X, O15Y, O15Z)을 따라 3축 방향(X 방향, Y 방향, Z 방향)으로 이동시킬 수 있다.]","Activating the fifth support mechanism 58 allows the welding torch 51 and wire nozzle 52 that are mounted on the support stand 53 to move in the three axial directions (X, Y, and Z directions) along the fifth support axes O15X, O15Y, O15Z.",True,0.2270319759845733,0.9014869951940933,27,43,-16,129,239,-110
[[용접 장치의 제어 구성]],[Control configuration of the welding apparatus],True,0.1171943098306655,0.921190558904682,4,6,-2,16,48,-32
[도 5는 용접 장치의 제어 블록이다.],FIG. 5 is a control block of the welding apparatus.,True,0.1554540395736694,0.9077778604262784,6,10,-4,22,51,-29
"[도 5에 도시하는 바와 같이, 제어 장치(120)는, 입력부(121)와, 기록부(122)와, 검출부(123)가 접속된다.","As illustrated in FIG. 5, a control device 120 is connected to an input unit 121, a storage unit 122, and a detection unit 123.",True,0.1432862430810928,0.9234598221063414,11,25,-14,68,127,-59
"또한, 제어 장치(120)는, 제1 지지 기구(54)와, 제2 지지 기구(55)와, 제3 지지 기구(56)와, 제4 지지 기구(57)와, 제5 지지 기구(58)(X축 지지 기구(58X), Y축 지지 기구(58Y), Z축 지지 기구(58Z))가 접속된다.]","The control device 120 is also connected to the first support mechanism 54, the second support mechanism 55, the third support mechanism 56, the fourth support mechanism 57, and the fifth support mechanism 58 (X-axis support mechanism 58X, Y-axis support mechanism 58Y, Z-axis support mechanism 58Z).",True,0.1413321495056152,0.935310313985115,27,46,-19,142,300,-158
"[입력부(121)는, 예를 들어 키보드이고, 작업자가 각종 용접 정보를 입력 가능하다.","The input unit 121 is, for example, a keyboard, which allows an operator to input various kinds of welding information.",True,0.1719737201929092,0.8811607356056828,10,20,-10,48,119,-71
"기록부(122)는, 예를 들어 메모리이고, 용접을 실시하기 위한 프로그램 등이 저장된다.","The storage unit 122 is, for example, a memory, in which a computer program for implementing welding, and the like, are stored.",True,0.2230886816978454,0.8408312244384226,10,22,-12,49,127,-78
"검출부(123)는, 용접 장치(50)에 의한 용접 상태를 검출하는 것이다.",The detection unit 123 detects a welding state by the welding apparatus 50.,True,0.1829304546117782,0.8966194623000275,8,13,-5,41,75,-34
"여기서, 용접 상태란, 예를 들어 용접면에 대한 용접 전극(63)이나 노즐부(72)의 거리, 용접 전류값, 용접 전압값 등이다.","Here, the welding state is, for example, a distance from the welding electrode 63 or the nozzle part 72 to a welding surface, a welding current value, and a welding voltage value, and the like.",True,0.210723340511322,0.8810416078425192,16,35,-19,71,193,-122
"제어 장치(120)는, 입력부(121)로부터 입력되는 정보, 기록부(122)에 저장된 정보, 검출부(123)가 검출한 정보 등에 기초하여 제1 지지 기구(54), 제2 지지 기구(55), 제3 지지 기구(56), 제4 지지 기구(57), 제5 지지 기구(58)의 작동을 제어한다.]","The control device 120 controls operation of the first support mechanism 54, the second support mechanism 55, the third support mechanism 56, the fourth support mechanism 57, and the fifth support mechanism 58 based on information input from the input unit 121, information stored in the storage unit 122, and information detected by the detection unit 123.",True,0.1543648391962051,0.916961430865804,30,57,-27,157,357,-200
"[본 실시 형태에서, 제어 장치(120)는, 제1 지지 기구(54), 제2 지지 기구(55), 제3 지지 기구(56), 제4 지지 기구(57), 제5 지지 기구(58)를 독립적으로 제어한다.","In the present embodiment, the control device 120 independently controls the first support mechanism 54, the second support mechanism 55, the third support mechanism 56, the fourth support mechanism 57, and the fifth support mechanism 58.",True,0.1011286079883575,0.9469781188293211,22,36,-14,106,238,-132
"이에 의해, 용접 토치(51)와 와이어 노즐(52)의 위치나 자세를 최적 위치나 최적 자세로 제어한다.]","Accordingly, a position and a posture of the welding torch 51 and the wire nozzle 52 are controlled to an optimum position and an optimum posture.",True,0.1923534274101257,0.8967162576823764,13,26,-13,58,146,-88
[[용접 장치에 의한 용접 방법]],[Welding method using the welding apparatus],True,0.182339996099472,0.8798269298497347,5,6,-1,19,44,-25
"[도 6은 용접 장치에 의한 용접 방법을 설명하기 위한 평면도, 도 7은 제1 지지 기구에 의한 용접 토치의 각도 조정 방법을 설명하기 위한 개략도, 도 8은 제2 지지 기구에 의한 용접 토치의 각도 조정 방법을 설명하기 위한 개략도이다.]","FIG. 6 is a plan view for explaining the welding method using the welding apparatus, FIG. 7 is a schematic diagram for explaining the angle adjustment method of the welding torch with the first support mechanism, and FIG. 8 is a schematic diagram for explaining the angle adjustment method of the welding torch with the second support mechanism.",True,0.1764247268438339,0.9048511328280776,38,58,-20,134,345,-211
"[본 실시 형태의 용접 장치(50)에 의한 용접 방법은, 도 1에 도시하는 바와 같이, 지지대(53)를 용접 토치(51)와 와이어 노즐(52)의 배열 방향을 따른 제1 지지축(O11)을 중심으로 하여 기준 위치로부터 일방측으로 소정 각도만큼 회동시켜 용접을 행하는 공정과, 지지대(53)를 제1 지지축(O11)을 중심으로 하여 기준 위치로부터 타방측으로 소정 각도만큼 회동시켜 용접을 행하는 공정을 갖는다.]","The welding method using the welding apparatus 50 of the present embodiment includes, as illustrated in FIG. 1, a step of performing welding by rotating the support stand 53 by a predetermined angle from a reference position to the one side around the first support axis O11 along the direction in which the welding torch 51 and the wire nozzle 52 are arranged, and a step of performing welding by moving the support stand 53 for a predetermined angle from the reference position to the other side around the first support axis O11.",True,0.1494629979133606,0.9347623313610884,49,93,-44,228,532,-304
"[도 6에 도시하는 바와 같이, 여기서는, 본 실시 형태의 용접 장치(50)에 의해 원자로 용기 덮개(13)에 관대(31)를 용접하기 위한 작업에 대해 설명한다.","As illustrated in FIG. 6, the following describes work to weld the nozzle 31 to the reactor vessel lid 13 by the welding apparatus 50 of the present embodiment.",True,0.2002606987953186,0.8965100887553424,21,29,-8,90,160,-70
"원자로 용기 덮개(13)는, 소정의 위치에 관통 구멍(13a)이 형성되어 있고, 관대(31)는 관통 구멍(13a)에 삽입 관통되어 위치 결정된다.","The reactor vessel lid 13 has a through hole 13a at a predetermined position, and the nozzle 31 is inserted into the through hole 13a so as to be positioned.",True,0.2322771251201629,0.8712515967468792,16,30,-14,81,157,-76
"원자로 용기 덮개(13)는, 관통 구멍(13a)에 있어서의 내주면(13b)(도 7 참조)측에 개선부가 마련된다.",The reactor vessel lid 13 has a grooved portion on a side of an inner surface 13b in the through hole 13a (see FIG. 7 ).,True,0.2617377340793609,0.8481400672193812,11,26,-15,62,120,-58
"용접 장치(50)는, 관통 구멍(13a)에 있어서의 내주면(13b)(도 7 참조)의 개선부와 관대(31)의 외주면(31a)(도 7 참조) 사이를 개선 용접한다.]",The welding apparatus 50 performs a grooving weld between the grooved portion of the inner surface 13b in the through hole 13a (see FIG. 7 ) and an outer surface 31a of the nozzle 31 (see FIG. 7 ).,True,0.1681906729936599,0.9173073474769852,16,39,-23,90,197,-107
"[용접 장치(50)에 의해 원자로 용기 덮개(13)의 관통 구멍(13a)과 관대(31)의 외주면(31a) 사이를 개선 용접할 때, 먼저 용접 토치(51)와 와이어 노즐(52)이 장착된 지지대(53)를 개시 위치 R1로부터 용접 경로 RA를 통해 종료 위치 R2까지 반주 이동하여 용접을 행한다.","When the grooving weld between the through hole 13a of the reactor vessel lid 13 and the outer surface 31a of the nozzle 31 is performed by the welding apparatus 50, first, welding is performed with the support stand 53, on which the welding torch 51 and wire nozzle 52 are mounted, moving half around the nozzle 31 from a start position R1 to an end position R2 through a welding path RA.",True,0.1413394063711166,0.9335211099183588,35,73,-38,164,389,-225
"다음으로, 용접 토치(51)와 와이어 노즐(52)이 장착된 지지대(53)를 개시 위치 R1로 복귀시키고, 개시 위치 R1로부터 용접 경로 RB를 통해 종료 위치 R2까지 반주 이동하여 용접을 행한다.]","Next, the support stand 53, on which the welding torch 51 and wire nozzle 52 are mounted, is returned to the start position R1, and welding is performed with the support stand 53 moving half around the nozzle 31 from the start position R1 to the end position R2 through a welding path RB.",True,0.1483749747276306,0.9328293847225964,25,54,-29,112,288,-176
"[용접 장치(50)는, 관대(31)에 대해 용접 경로 RA를 통해 용접을 행할 때와 용접 경로 RB를 통해 용접을 행할 때는, 용접 토치(51)와 와이어 노즐(52)이 장착된 지지대(53)의 이동 방향이 반대가 된다.","When the welding apparatus 50 performs welding, the support stand 53, on which the welding torch 51 and wire nozzle 52 are mounted, moves in opposite moving directions between the welding through the welding path RA and the welding through the welding path RB, with respect to the nozzle 31.",True,0.1792416125535965,0.9217981872016118,28,50,-22,121,291,-170
"즉, 도 6에서, 용접 경로 RA에서의 이동 방향은 반시계 방향이고, 용접 경로 RB에서의 이동 방향은 시계 방향이다.","In other words, in FIG. 6, the moving direction of the welding path RA is counterclockwise, and the moving direction of the welding path RB is clockwise.",True,0.100517950952053,0.9444852421598328,17,27,-10,66,153,-87
"또한, 원자로 용기 덮개(13)의 내주면(13b)이 원호 형상을 이루고, 관대(31)가 연직 방향을 따라 위치 결정된다.","The inner surface 13b of the reactor vessel lid 13 has an arc shape, and the nozzle 31 is positioned along the vertical direction.",True,0.3474733829498291,0.8013165273725154,14,24,-10,67,130,-63
"그 때문에, 용접 장치(50)는, 지지대(53)에 장착된 용접 토치(51) 및 와이어 노즐(52)이 관대(31)에 접촉하지 않도록, 제1 지지 기구(54)에 의해 지지대(53)를 제1 지지축(O11)을 중심으로 소정 각도만큼 경사지게 한 상태에서 용접을 행할 필요가 있다.","Thus, the welding apparatus 50 needs to perform welding with the support stand 53 tilted by a predetermined angle around the first support axis O11 by the first support mechanism 54 so that the welding torch 51 and the wire nozzle 52 mounted on the support stand 53 do not come into contact with the nozzle 31.",True,0.1697892099618911,0.9272475960679724,31,57,-26,152,310,-158
"또한, 용접 경로 RA 및 용접 경로 RB에서, 지지대(53)가 이동할 때, 용접 토치(51)보다 와이어 노즐(52)을 선행시킬 필요가 있다.]","Furthermore, when the support stand 53 moves in the welding paths RA and RB, the wire nozzle 52 needs to precede the welding torch 51.",True,0.1955787241458892,0.9074028075385336,18,25,-7,80,134,-54
"[먼저, 용접 장치(50)에 의해 용접 토치(51)와 와이어 노즐(52)이 장착된 지지대(53)를 용접 경로 RA를 따라 이동시켜 용접을 행한다.","First, the welding apparatus 50 moves the support stand 53, on which the welding torch 51 and wire nozzle 52 are mounted, along the welding path RA to perform welding.",True,0.226361334323883,0.902025598004735,17,30,-13,81,167,-86
"도 6 및 도 7에 도시하는 바와 같이, 먼저 제1 지지 기구(54)에 의해 지지대(53)를 제1 지지축(O11)을 중심으로 회동시킨다.","As illustrated in FIGS. 6 and 7, first, the first support mechanism 54 rotates the support stand 53 around the first support axis O11.",True,0.204293668270111,0.9068789631292824,18,24,-6,76,134,-58
"탄소(C), 규소(Si), 망간(Mn), 인(P), 황(S), 크롬(Cr), 니켈(Ni) 및 구리(Cu)를 필수 성분으로 포함하여 이루어지는 철도차량 연결기용 합금강에 있어서,질화티탄(TiN), 입방정 질화붕소(cBN), 산화알루미늄(Al2O3) 및 산화지르코늄(ZrO2) 중 어느 하나로 이루어지는 나노입자(nanopaticle)를 더 포함하여 이루어진 것을 특징으로 하는 철도차량 연결기용 합금강.","An alloy steel for a railway vehicle coupler, the alloy steel comprising carbon (C), silicon (Si), manganese (Mn), phosphorus (P), sulfur (S), chromium (Cr), nickel (Ni), and copper (Cu) as essential ingredients, the alloy steel further comprising nanoparticles made from one of titanium nitride (TiN), cubic boron nitride (cBN), aluminum oxide (Al2O3), and zirconium dioxide (ZrO2).",True,0.1351834386587143,0.9547745013514312,36,56,-20,224,383,-159
"제 1항에 있어서,상기 필수 성분으로 몰리브덴(Mo), 바나듐(V) 및 알루미늄(Al)을 더 포함하여 이루어진 것을 특징으로 하는 철도차량 연결기용 합금강.","The alloy steel according to claim 1, further comprising molybdenum (Mo), vanadium (V), and aluminum (Al) as the essential ingredients.",True,0.2825762629508972,0.8802776100265205,18,20,-2,87,135,-48
"제 2항에 있어서,상기 필수 성분은 탄소(C) 0.240중량%, 규소(Si) 0.380중량%, 망간(Mn) 1.160중량%, 인(P) 0.014중량%, 황(S) 0.006중량%, 크롬(Cr) 0.250중량%, 니켈(Ni) 0.250중량%, 구리(Cu) 0.030중량%, 몰리브덴(Mo) 0.180중량%, 바나듐(V) 0.020중량% 및 알루미늄(Al) 0.020중량%로 이루어지고, 잔부는 철과 불순물 및 상기 나노입자로 이루어진 것을 특징으로 하는 철도차량 연결기용 합금강.","The alloy steel according to claim 2, wherein the essential ingredients include, by weight, 0.240% of C, 0.380% of Si, 1.160% of Mn, 0.014% of P, 0.006% of S, 0.250% of Cr, 0.250% of Ni, 0.030% of Cu, 0.180% of Mo, 0.020% of V, and 0.020% of Al, with the balance being iron (Fe) and impurities.",True,0.48944091796875,0.855719296154541,42,56,-14,266,294,-28
"제 3항에 있어서,상기 필수 성분들과 나노입자를 포함하는 합금강을 870℃에서 4시간 동안 1차 열처리한 후 공랭시키고, 870℃에서 4시간 동안 2차 열처리한 후 수랭시키며, 570℃에서 4시간 동안 3차 열처리한 후 공랭시킨 것을 특징으로 하는 철도차량 연결기용 합금강.","The alloy steel according to claim 3, wherein the alloy steel comprising the essential ingredients and the nanoparticles is first heat-treated at 870°C for 4 hours, followed by air cooling, is second heat-treated at 870°C for 4 hours, followed by water cooling, and is third heat-treated at 570°C for 4 hours, followed by air cooling.",True,0.2906069755554199,0.8723208709632979,35,55,-20,153,334,-181
"제 2항에 있어서,상기 필수 성분 중 니켈(Ni)의 함량은 0.25 ~ 0.30 중량%이고, 몰리브덴(Mo)의 함량은 0.15 ~ 0.25 중량%이며, 바나듐(V)의 함량은 0.01 ~ 0.02 중량%인 것을 특징으로 하는 철도차량 연결기용 합금강.","The alloy steel according to claim 2, wherein, from among the essential ingredients, Ni has a content ranging from 0.25% to 0.30% by weight, Mo has a content ranging from 0.15% to 0.25% by weight, and V has a content ranging from 0.01% to 0.02% by weight.",True,0.393505334854126,0.8530309877141423,30,47,-17,139,255,-116
"제 5항에 있어서,상기 필수 성분은 탄소(C) 0.233중량%, 규소(Si) 0.427중량%, 망간(Mn) 1.222중량%, 인(P) 0.006중량%, 황(S) 0.012중량%, 크롬(Cr) 0.261중량%, 니켈(Ni) 0.260중량%, 구리(Cu) 0.042중량%, 몰리브덴(Mo) 0.175중량%, 바나듐(V) 0.019중량% 및 알루미늄(Al) 0.022중량%로 이루어지고, 잔부는 철과 불순물 및 상기 나노입자로 이루어진 것을 특징으로 하는 철도차량 연결기용 합금강.","The alloy steel according to claim 5, wherein the essential ingredients include, by weight, 0.233% of C, 0.427% of Si, 1.222% of Mn, 0.006% of P, 0.012% of S, 0.261% of Cr, 0.260% of Ni, 0.042% of Cu, 0.175% of Mo, 0.019% of V, and 0.022% of Al, with the balance being Fe, impurities, and the nanoparticles.",True,0.4745645821094513,0.8479719221261658,42,57,-15,266,307,-41
"탄소(C), 규소(Si), 망간(Mn), 인(P), 황(S), 크롬(Cr), 니켈(Ni) 및 구리(Cu)를 필수 성분으로 포함하여 이루어지는 철도차량 연결기용 합금강에 있어서,산화마그네슘(MgO) 또는 99중량%의 산화규소(SiO2)와 1중량%의 탄화규소(SiC)의 조합으로 이루어진 물질 중 어느 하나의 나노입자(nanopaticle)를 더 포함하여 이루어진 것을 특징으로 하는 철도차량 연결기용 합금강.","An alloy steel for a railway vehicle coupler, the alloy steel comprising carbon (C), silicon (Si), manganese (Mn), phosphorus (P), sulfur (S), chromium (Cr), nickel (Ni), and copper (Cu) as essential ingredients, the alloy steel further comprising nanoparticles made from one of magnesium oxide (MgO) or a material combination of, by weight, 99% of silicon oxide (SiO2) and 1% of silicon carbide (SiC).",True,0.1278340816497802,0.9556884475010026,38,63,-25,227,402,-175
"제 7항에 있어서,상기 필수 성분으로 몰리브덴(Mo), 바나듐(V) 및 알루미늄(Al)을 더 포함하여 이루어진 것을 특징으로 하는 철도차량 연결기용 합금강.","The alloy steel according to claim 7, further comprising molybdenum (Mo), vanadium (V), and aluminum (Al) as the essential ingredients.",True,0.2732761800289154,0.881809444027655,18,20,-2,87,135,-48
"제 8항에 있어서,상기 필수 성분은 탄소(C) 0.240중량%, 규소(Si) 0.380중량%, 망간(Mn) 1.160중량%, 인(P) 0.014중량%, 황(S) 0.006중량%, 크롬(Cr) 0.250중량%, 니켈(Ni) 0.250중량%, 구리(Cu) 0.030중량%, 몰리브덴(Mo) 0.180중량%, 바나듐(V) 0.020중량% 및 알루미늄(Al) 0.020중량%로 이루어지고, 잔부는 철과 불순물 및 상기 나노입자로 이루어진 것을 특징으로 하는 철도차량 연결기용 합금강.","The alloy steel according to claim 8, wherein the essential ingredients include, by weight, 0.240% of C, 0.380% of Si, 1.160% of Mn, 0.014% of P, 0.006% of S, 0.250% of Cr, 0.250% of Ni, 0.030% of Cu, 0.180% of Mo, 0.020% of V, and 0.020% of Al, with the balance being iron (Fe), impurities, and the nanoparticles.",True,0.4453655183315277,0.8701113292267977,42,58,-16,266,314,-48
"제 9항에 있어서,상기 필수 성분과 나노입자를 포함하는 합금강을 870℃에서 4시간 동안 1차 열처리한 후 공랭시키고, 870℃에서 4시간 동안 2차 열처리한 후 수랭시키며, 580℃에서 4시간 동안 3차 열처리한 후 공랭시킨 것을 특징으로 하는 철도차량 연결기용 합금강.","The alloy steel according to claim 9, wherein the alloy steel comprising the essential ingredients and the nanoparticles is first heat-treated at 870°C for 4 hours, followed by air cooling, is second heat-treated at 870°C for 4 hours, followed by water cooling, and is third heat-treated at 580°C for 4 hours, followed by air cooling.",True,0.2882718741893768,0.8768088362788885,35,55,-20,152,334,-182
"제 8항에 있어서,상기 필수 성분은 탄소(C) 0.220중량%, 규소(Si) 0.430중량%, 망간(Mn) 1.200중량%, 인(P) 0.016중량%, 황(S) 0.006중량%, 크롬(Cr) 0.260중량%, 니켈(Ni) 0.250중량%, 구리(Cu) 0.030중량%, 몰리브덴(Mo) 0.150중량%, 바나듐(V) 0.020중량% 및 알루미늄(Al) 0.030중량%로 이루어지고, 잔부는 철과 불순물 및 상기 나노입자로 이루어진 것을 특징으로 하는 철도차량 연결기용 합금강.","The alloy steel according to claim 8, wherein the essential ingredients include, by weight, 0.220% of C, 0.430% of Si, 1.200% of Mn, 0.016% of P, 0.006% of S, 0.260% of Cr, 0.250% of Ni, 0.030% of Cu, 0.150% of Mo, 0.020% of V, and 0.030% of Al, with the balance being iron (Fe), impurities, and the nanoparticles.",True,0.4515335857868194,0.8688101324034693,42,58,-16,266,314,-48
"제 11항에 있어서,상기 필수 성분들과 나노입자를 포함하는 합금강을 580℃에서 4시간 동안 열처리한 후 공랭시킨 것을 특징으로 하는 철도차량 연결기용 합금강.","The alloy steel according to claim 11, wherein the alloy steel comprising the essential ingredients and the nanoparticles is heat-treated at 580°C for 4 hours, followed by air cooling.",True,0.2645979523658752,0.8628006482679025,20,29,-9,89,184,-95
"각 도면에 있어서 대응하는 부분은, 동일한 참조부호를 붙여서 나타내고, 중복되는 설명을 생략하는 경우가 있다.","The corresponding parts in the respective drawings are denoted by the same reference sign, and duplicate descriptions thereof may be omitted.",True,0.2118391394615173,0.8377118257159637,14,21,-7,61,141,-80
"또 설명의 편의상, 설명대상인 도면에는 기재되어 있지 않은 부분에 대하여, 다른 도면에 기재되는 참조부호를 붙여서 언급하는 경우가 있다.]","For convenience of explanation, a part not shown in a target drawing for description may be described with a reference sign used in another drawing.",True,0.2552703022956848,0.8154858415491072,18,25,-7,77,148,-71
[(실시예1)],[Example 1],True,0.079661913216114,0.9409888780597334,1,2,-1,8,11,-3
"[도1은 본 발명의 실시예1로서, 캠시스템(cam system)(2) 및 선침기구(10)를 구비하는 횡편기(1)의 개략적인 구성을 나타낸다.","Fig. 1 shows the schematic configuration of the flatbed knitting machine 1 provided with the cam system 2 and the needle selection mechanism 10, as an example 1 according to the present invention.",True,0.2978032529354095,0.7978118184813832,13,33,-20,78,196,-118
"이하의 설명은, 간략화를 하기 위하여 도시를 생략하고 있는 것도 언급한다.","Hereinafter, some parts not shown may also be referred for simplicity.",True,0.5494149923324585,0.5457257148152093,10,11,-1,41,70,-29
"캠시스템(2)은, 횡편기의 니들베드(needle bed)의 길이방향을 따라 왕복주행하는 캐리지(carriage)에 탑재된다.",The cam system 2 is mounted on the carriage which reciprocates along the longitudinal direction of the needle beds of the flatbed knitting machine.,True,0.2159183025360107,0.8514506719910511,9,24,-15,69,147,-78
"니들베드는, 니들베드갭(needle bed gap)을 사이에 두고 대향(對向)하도록 적어도 한 쌍 설치된다.",At least a pair of needle beds is provided so as to face each other across a needle bed gap.,True,0.2268056124448776,0.8235296082108597,11,20,-9,60,92,-32
"각 니들베드는, 니들베드갭으로 진퇴하는 전후방향으로 연장되는 니들홈(needle groove)을 구비한다.",Each of the needle beds has needle grooves which extend in the back-and-forth direction of advancing to and retracting from the needle bed gap.,True,0.3006009459495544,0.7918384653683809,9,24,-15,59,143,-84
"니들홈은, 니들베드의 길이방향인 좌우방향으로 나란하게 형성된다.",The needle grooves are arranged in parallel in the left-and-right direction corresponding to the longitudinal direction of the needle beds.,True,0.401224285364151,0.6821288258758204,6,20,-14,35,139,-104
"편침(編針)(3)은, 전후방향으로의 슬라이딩(sliding)이 가능한 상태로 각 니들홈에 수용되고, 니들잭(needle jack)(4), 슬라이더(slider)(5), 실렉트잭(select jack)(6) 및 실렉터(selector)(7)를 포함한다.","The knitting needle 3 is housed in each of the needle grooves so as to be slidable in the back-and-forth direction, and includes a needle jack 4, a slider 5, the select jack 6, and the selector 7.",True,0.2201709002256393,0.8850387453274071,16,38,-22,140,196,-56
"이 편침(3)은 복합바늘(compound needle)로서, 니들잭(4)에 있어서 도시를 생략하고 있는 전단(前端) 측에서, 선단(先端)에 훅(hook)을 형성하는 바늘본체에 접속되어 있다.","The knitting needle 3 is a compound needle, and is connected by the needle jack 4 to the needle body including a hook on the tip thereof of the front-end side, which is omitted to show.",True,0.3395074903964996,0.7830559284434757,17,36,-19,106,185,-79
"니들잭(4), 슬라이더(5) 및 실렉트잭(6)은, 기계적인 작용에 의한 제어를 받기 위한 버트(butt)(4b, 5b) 및 선택용 버트(選擇用 butt)(6b)를 각각 구비한다.","Further in the front-end side omitted to show, the slider 5 has blades, which open and close the hook, and are needle jack 4, the slider 5 and the select jack 6 have a butt 4b, a butt 5b, and a selection butt 6b to be controlled by mechanical actions, respectively.",False,0.3857660591602325,0.7861062278050848,18,51,-33,99,265,-166
"실렉터(7)는, 자기적(磁氣的)인 작용에 의한 제어를 받기 위한 접극자(接極子)(7a)를 구비하고, 선단부(先端部)(7b)에서 실렉트잭(6)과 결합한다.","The selector 7 has an armature 7a to be controlled by magnetic actions, and a tip part 7b to be engaged with the select jack 6.",True,0.3722288310527801,0.7910317717733291,12,26,-14,85,127,-42
"실렉터(7)는, 후술하는 바와 같은 구동버트(驅動butt)(7c) 및 인하버트(引下butt)(7d)도 구비한다.]",The selector 7 further has a drive butt 7c and a push-down butt 7d which will be described later.,True,0.282576322555542,0.8340077420809592,8,19,-11,63,97,-34
"[선침기구(10) 및 캠시스템(2)은, 캐리지가 좌우로 왕복주행하는 경우에도 동일한 동작이 대칭적으로 가능하도록 쌍방향성을 구비하고 있다.",The needle selection mechanism 10 and the cam system 2 have bidirectionality allowing the carriage to reciprocate in the left-and-right direction symmetrically in the same manner.,True,0.273990273475647,0.8195203120555536,14,26,-12,77,179,-102
"이하의 설명은, 캐리지가 니들베드에 대하여 도면의 좌방(左方)으로 이동하는 경우를 상정하여 한다.",The following description is based on the case where the carriage moves to the left in the drawing against the needle bed.,True,0.2931783497333526,0.7669815212762149,11,22,-11,54,122,-68
"선침기구(10)는, 캠시스템(2)에 대하여 입구측 선침기구(11), 중간측 선침기구(12) 및 출구측 선침기구(13)를 구비한다.","The needle selection mechanism 10 has the entry-side needle selection mechanism 11, the intermediate needle selection mechanism 12, and an exit-side needle selection mechanism 13, to the cam system 2.",True,0.2503368854522705,0.8520671379650517,11,30,-19,72,200,-128
"캐리지의 주행방향이 우방(右方)이 되면, 출구측 선침기구(13)가 입구측이 되고, 입구측 선침기구(11)가 출구측이 된다.","In the case where the carriage moves to the right, the exit-side needle selection mechanism 13 turns to the entry-side one, and the entry-side needle selection mechanism 11 turns to the exit-side one.",True,0.2811015844345093,0.8271495390837231,12,33,-21,68,200,-132
"입구측 선침기구(11)는, 편침(3)의 실렉터(7)에 작용하여 경로(7A, 7H, 7B) 중 어느 하나를 선택한다.","The entry-side needle selection mechanism 11 makes the selector 7 of the knitting needle 3 select one out of paths 7A, 7H, 7B.",True,0.2685461044311523,0.8525995332720013,12,23,-11,64,126,-62
"경로(7A, 7H)가 선택되면, 실렉터(7)에는 니들베드갭측으로의 이동 스트로크(移動 stroke)가 발생한다.","When the path 7A or 7H is selected, the moving stroke to the needle bed gap side occurs in the selector 7.",True,0.245375320315361,0.8606901894621163,9,22,-13,62,106,-44
"실렉트잭(6)은, 결합장소에서 실렉터(7)로부터 이동 스트로크를 받아서 니들베드갭측의 포지션으로 옮겨진다.","The select jack 6 receives the moving stroke from the selector 7 at the engagement point, and moves to a position in the needle bed gap side.",True,0.2567725777626037,0.8558891962875981,9,27,-18,59,141,-82
"캠시스템(2)의 작용을 입구측으로부터 받는 대상이 되는 편침(3)은, 경로(7A) 또는 경로(7H)로 선택시키는 실렉터(7)에 의하여, 실렉트잭(6)의 선택용 버트(6b)가 A포지션(6bA) 또는 H포지션(6bH)이 되도록 각각 안내된다.","The knitting needle 3 acted on by the cam system 2 from the entry side is guided so that the selection butt 6b of the select jack 6 is moved to an A-position 6bA or an H-position 6bH by the selector 7 for which the path 7A or the path 7H is selected, correspondingly.",True,0.2448980659246444,0.8795195822403022,22,54,-32,133,267,-134
"단, 입구측 선침기구(11)는 가압캠(加壓cam)(15)을 구비한다.",The entry-side needle selection mechanism 11 is however provided with the pressing cam 15.,True,0.3633370697498321,0.7559658455448962,5,14,-9,38,90,-52
"가압캠(15)은, 선택용 버트(6b)를 가압하여 실렉트잭(6)을 니들홈에 반 정도 가라앉히기 때문에, 실렉터(7)의 선단부(7b)는, 반 정도 가라앉은 상태의 실렉트잭(6)에 있어서 선택용 버트(6b)의 후단(後端)에 결합된다.","The pressing cam 15 presses the selection butt 6b to sink the select jack 6 by approximately half height into the needle groove, and thus the tip part 7b of the selector 7 is engaged to the rear end of the selection butt 6b of the select jack 6 having been sunk by approximately half height.",True,0.2527606189250946,0.8688112339485599,22,56,-34,127,291,-164
"중간측 선침기구(12)는, 편침(3)의 실렉터(7)에 작용하여, 경로(7A, 7H, 7B) 중 어느 하나를 선택시키는 것은 입구측 선침기구(11)와 동일하다.","The intermediate needle selection mechanism 12 makes the selector 7 of the knitting needle 3 select one out of the paths 7A, 7H, 7B, as with the entry-side needle selection mechanism 11.",True,0.2713277339935303,0.8601433257607632,16,32,-16,88,186,-98
"단, 가압캠(15)은 형성되지 않고, 후행 A프레서(後行 A presser)(31b)나 후행 H프레서(32b)가 없거나 또는 있더라도 비작용(非作用)의 상태에서 실렉트잭(6)은 부상(浮上)하여, 실렉트잭(6)에 있어서 실렉터(7)의 선단부(7b)의 결합장소는, 돌출부(6c)의 후단으로 절체된다.","In the intermediate needle selection mechanism 12 provided without the pressing cam 15, and provided without a succeeding A-presser 31b nor a succeeding H-presser 32b, or alternatively with the succeeding A-presser 31b in non-acting state and the succeeding H-presser 32b in non-acting state, the select jack 6 is raised, and the engagement point of the select jack 6 with the tip part 7b of the selector 7 is switched to the rear end of an overhang part 6c.",True,0.4124399423599243,0.7847224713019925,25,78,-53,165,458,-293
"결합장소의 절체에 의하여, 캠시스템(2)의 작용을 받고 있는 편침(3)의 실렉트잭(6)을, 입구측 선침기구(11)에서의 안내보다 니들베드갭측의 포지션으로 옮기도록 안내할 수 있고, 특히 A포지션보다 니들베드갭측으로 전진위치로서 형성되는 새로운 F포지션(6bF)으로 안내할 수도 있다.","The switching of the engagement points allows to guide the select jack 6 of the knitting needle 3 on which the cam system 2 acts, to a position closer to the needle bed gap than the position guided in the entry-side needle selection mechanism 11, in particular to guide the select jack 6 to an F-position 6bF which is newly arranged as a front position closer to the needle bed gap than the A-position.",True,0.4081520140171051,0.7889474198952143,28,74,-46,158,402,-244
"출구측 선침기구(13)는, 캠시스템(2)의 작용을 받기 위한 선침동작을 하지 않는다.",The exit-side needle selection mechanism 13 does not perform the needle selection operation of receiving the action of the cam system 2.,True,0.3037870228290558,0.789324156850793,9,22,-13,47,136,-89
"입구측 선침기구(11) 및 중간측 선침기구(12)에 관하여 부호 a, b 및 c, d를 붙인 세로선은, 도4 및 도5에서 설명하는 위치관계에 대응하는 위상을 각각 나타낸다.","The vertical lines with reference signs a, b, c, d in the entry-side needle selection mechanism 11 and the intermediate needle selection mechanism 12 indicate the phases corresponding to the positional relations described in Fig. 4 and Fig. 5, respectively.",True,0.2629300951957702,0.8450990151321988,23,40,-17,96,257,-161
"선침기구(10)는, 실렉트잭(6)을 B포지션으로 되돌리는 되돌림부(16), 및 실렉터(7)를 경로(7B)로 되돌리는 리턴캠(return cam)(17)도 구비하고 있다.]","The needle selection mechanism 10 further has a returning part 16 which returns the select jack 6 to the B-position, and a returning cam 17 which returns the selector 7 to the path 7B.",True,0.2661159336566925,0.8628249063655478,13,34,-21,95,184,-89
"[캠시스템(2)은, 니들 레이징캠(needle raising cam)(20), 스티치캠(stitch cam)(21) 및 브리지캠(bridge cam)(22)을 포함한다.","The cam system 2 includes a needle raising cam 20, a stitch cam 21, and a bridge cam 22.",True,0.1672627180814743,0.8951075040354466,11,19,-8,94,88,6
"니들 레이징캠(20)과 브리지캠(22)의 사이에는, 니들잭(4)의 버트(4b)를 니트의 편성동작에 대응시키는 경로(4bA)가 형성된다.","Between the needle raising cam 20 and the bridge cam 22, a path 4bA corresponding to the knit operation for the butt 4b of the needle jack 4 is disposed.",True,0.2131463438272476,0.877931831131446,11,30,-19,75,153,-78
"캠시스템(2)은, 브리지캠(22)보다 니들베드갭측에, 슬라이더(5)의 버트(5b)에 작용하는 슬라이더캠(slider cam)도 구비하지만 도시를 생략한다.","The cam system 2 further has a slider cam, which is omitted to show, acting on the butt 5b of the slider 5, at a position closer to the needle bed gap than the bridge cam 22, Paths 4bH, 4bB extending across lower positions than the top of the needle raising cam 20 correspond to the knitting operation for the tuck and the miss, respectively.",False,0.559420645236969,0.6835937653144472,11,65,-54,86,342,-256
"스티치캠(21)은, 인입캠면(引入cam面)의 후반(後半)에, 캠 높이가 높은 상태에서 인입량이 작은 스티치 크기 결정캠면(2lb)과, 캠 높이가 낮아져서 인입량이 큰 스티치 크기 결정캠면(21a)을 구비하여, 버트(4b)의 돌출량을 서로 다르게 하면, 스티치값이 서로 다른 편성의 동작이 가능하다.","The stitch cam 21 has, in the posterior half of the drawing cam face, a stitch deciding cam face 21b where the cam height is high and a drawing amount is small, and a stitch deciding cam face 21a where the cam height is low and a drawing amount is large, and enables the second stitch knitting operation by changing the butt 4b with the protrude amount.",True,0.3336847126483917,0.8061436267657577,32,67,-35,166,353,-187
"중간측 선침기구(12)는, 실렉트잭(6)이 A포지션을 계속 유지할지, A포지션으로부터 F포지션으로 이행할지의 선택에 의하여, 버트(4b)에 대하여 상대적으로 스티치가 가는 편성의 경로(4ba)와 굵은 편성의 경로(4bA)를 절체할 수 있다.","The intermediate needle selection mechanism 12 allows the selection as to whether to keep the select jack 6 in the A-position or move the select jack 6 from the A-position to the F-position, by path switching for the butt 4b between the path 4ba for relatively tight loop knitting and the path 4bA for loose loop knitting.",True,0.2972671389579773,0.8464122851995574,24,57,-33,134,322,-188
"이러한 편성경로의 절체는, 실렉트잭(6)의 선택용 버트(6b)에 작용하는 프레서군(presser群)(30)에 의하여 이루어진다.",Such path switching for knitting is performed by a presser group 30 acting on the selection butt 6b of the select jack 6.,True,0.2518117427825928,0.8490667892715885,10,23,-13,71,121,-50
"입구측 선침기구(11)는, 실렉트잭(6)에 대하여 B포지션을 계속 유지시킬지, H 또는 A포지션으로 이행시킬지를 선택할 수 있기 때문에, 중간측 선침기구(12)도 B포지션의 실렉트잭(6)에 대하여 마찬가지로 B, H 또는 A포지션을 선택할 수 있다.",The entry-side needle selection mechanism 11 allows the selection as to whether to keep the select jack 6 in the B-position or move the select jack 6 to the H-position or the A-position.,False,0.3595859706401825,0.8154362790828033,28,33,-5,139,186,-47
"입구측 선침기구(11)에 의하여 H포지션이 선택되어 있으면, 중간측 선침기구(12)에서는 H, A 또는 F포지션을 선택할 수 있다.","When the H-position is selected in the entry-side needle selection mechanism 11, the intermediate needle selection mechanism 12 allows the selection out of the H-, A- and F-positions.",True,0.2223765552043914,0.8721071098559884,15,28,-13,73,183,-110
"입구측 선침기구(11)에 의하여 A포지션이 선택되어 있으면, 중간측 선침기구(12)에서는 A 또는 F포지션을 선택할 수 있다.","When the A-position is selected in the entry-side needle selection mechanism 11, the intermediate needle selection mechanism 12 allows the selection out of the A- and F-positions.",True,0.2624363303184509,0.8511548409137709,14,27,-13,70,179,-109
"단, B포지션에, 후술하는 바와 같은 선택용 버트(6b)를 가압하여 실렉트잭(6)이 니들홈에 깊게 가라앉도록 작용하는 고정의 B프레서(33)를 형성하고 있다.","In the B-position, a fixed B-presser 33 is disposed, which presses the selection butt 6b to deeply sink the select jack 6 into the needle groove, as described later.",True,0.2888501584529876,0.8417426519443999,17,29,-12,88,165,-77
"B프레서(33)에서의 가압의 도중에 포지션을 바꾸는 것은 바람직하지 않지만, 돌출량을 저감시키면 좋다.]","Position change under the press applied by the B-presser 33 is not preferable, but may be performed when the protruding amount is reduced.",True,0.3085938692092895,0.7853919144058074,11,23,-12,58,138,-80
"[도2는, 도1의 입구측 선침기구(11) 및 중간측 선침기구(12)의 구성을 포함하는 캠시스템(2)의 부분적인 구성을 나타낸다.",Fig. 2 shows a partial configuration of the cam system 2 including the configurations of the entry-side needle selection mechanism 11 and the intermediate needle selection mechanism 12 shown in Fig. 1.,True,0.2447731345891952,0.8439588029110872,13,32,-19,71,201,-130
"도1의 입구측 선침기구(11) 및 중간측 선침기구(12)는, 흡인 액추에이터(吸引 actuator)(11a, 12a) 및 실렉터 구동캠(selector 驅動cam)(11b, 12b)을 각각 포함한다.","The entry-side needle selection mechanism 11 and the intermediate needle selection mechanism 12 of Fig. 1 include attraction actuators 11a, 12a and selector drive cams 11b, 12b, respectively.",True,0.2243190705776214,0.8724466295437523,17,28,-11,111,191,-80
"흡인 액추에이터(11a, 12a)는, 위상(a, c)의 전후에 형성되는 해방위치(解放位置)(α, β)에서, 특허문헌2와 마찬가지로 실렉터(7)의 접극자(7a)를 자력(磁力)에 의하여 흡인하는 상태와, 선택을 받아서 흡인을 해제하는 상태를 절체할 수 있다.","As with Patent Citation 2, the attraction actuators 11a, 12a allow switching between the state of attracting the armature 7a of the selector 7 by magnetic force and the state of releasing the armature 7a from the attraction upon selection, at release positions α, β arranged in front of and behind phases a, c. As with Patent Citation 3, the selector drive cam 11b of the entry-side needle selection mechanism 11 moves the drive butt 7c of the selector 7 in the state of being released from the attraction by the attraction actuator 11a along the pre-set path 7A, 7H, or 7B, so as to move the select jack 6 to one of three positions through an engagement point.",False,0.3722001314163208,0.804358537696513,25,119,-94,142,661,-519
"경로(7B)는 기저위치(基底位置)에 대응하고, 경로(7H, 7A)는 선택위치에 대응한다.","The path 7B corresponds to a base-state position, and the paths 7H, 7A correspond to selection positions.",True,0.1024063229560852,0.9438977039342666,7,17,-10,49,105,-56
"중간측 선침기구(12)의 실렉터 구동캠(12b)도, 흡인 액추에이터(12a)에 의한 흡인이 해제된 상태의 구동버트(7c)를 경로(7A, 7H, 7B)를 따라 이동시키지만, 실렉트잭(6)의 이동은, 결합장소의 절체에 의하여 입구측 선침기구(11)에서의 이동에 추가되도록 할 수 있다.","The selector drive cam 12b of the intermediate needle selection mechanism 12 also moves the drive butt 7c in the state of being released from the attraction by the attraction actuator 12a along the path 7A, 7H, or 7B, so as to move the select jack 6 to one of not only the positions in the entry-side needle selection mechanism 11 but also an additional position made available by switching the engagement point.",True,0.3400033712387085,0.8368432150664469,28,73,-45,157,412,-255
이 때문에 실렉트잭(6)에는 전술한 F포지션을 형성할 수 있다.,"Accordingly, the F-position described above is able to be arranged for the select jack 6.",True,0.4082377552986145,0.7136434629007571,8,15,-7,35,89,-54
"리턴캠(17)은, 각 실렉터 구동캠(11b, 12b)의 출구측에, 실렉터(7)의 인하버트(7d)에 작용하여 경로(7B)로 되돌리는 캠면(17a)을 구비한다.]","The returning cam 17 has a cam face 17a which acts on the push-down butt 7d of the selector 7 to return to the path 7B in the exit sides of the selector drive cams 11b, 12b.",True,0.2108286172151565,0.8922594268852934,13,37,-24,88,173,-85
"[프레서군(30)은, 실렉트잭(6)의 선택용 버트(6b)에 작용하여 선택용 버트(6b)를 가압함으로써, 니들잭(4)의 버트(4b) 및 슬라이더(5)의 버트(5b)를 니들홈으로부터 돌출되지 않도록 가라앉힐지 아닌지의 제어를 한다.","The presser group 30 acts on the selection butt 6b of the select jack 6, and controls whether to sink the butt 4b of the needle jack 4 and the butt 5b of the slider 5 so as not to protrude from the needle groove, by pressing the selection butt 6b.",True,0.2413750141859054,0.8672481790755834,20,51,-31,127,247,-120
"F포지션에는, 프레서가 형성되어 있지 않다.","In the F-position, any presser is not provided.",True,0.356223464012146,0.7129249216097009,5,8,-3,24,47,-23
"A포지션 및 H포지션에는, 중간에 간격을 두고 선행 A프레서(先行 A presser)(31a) 및 선행 H프레서(32a)와, 후행 A프레서(31b) 및 후행 H프레서(32b)가 각각 형성된다.","In the A-position and the H-position, a preceding A-presser 31a and a preceding H-presser 32a, and the succeeding A-presser 31b and the succeeding H-presser 32b are disposed via spaces therebetween, respectively.",True,0.2051344513893127,0.8800096359702633,20,31,-11,107,212,-105
"이들 프레서는, 개별적으로 작용과 비작용을 절체할 수 있다.","These pressers are switchable between acting state and non-acting state, individually.",True,0.4491794109344482,0.6223155938536976,8,11,-3,33,86,-53
"B포지션은 기저상태로서, B포지션에는 선택용 버트(6b)를 가압하는 작용상태로 고정된 B프레서(33)가 형성된다.]","The B-position corresponds to the base state, and the B-presser 33 fixed to the acting state to press the selection butt 6b is provided in the B-position.",True,0.3057911694049835,0.8220414643179462,10,27,-17,64,154,-90
"[단계 S20 또는 단계 S21에 의해 제어 모드 상태 v3을 「통상」으로부터 전환한 뒤에는, 제어 해제 스위치 ON 시간 t1의 카운트를 정지하고, 초기값(0)으로 리셋한다(단계 S22).]","After having switched the control mode state v3 from ""normal"" in step S20 or step S21, the controlled state switching determining section 38 stops counting the control canceling switch ON time t1 and resets the control canceling switch ON time t1 to a default value (0) (step S22).",True,0.257955938577652,0.877446405754579,24,48,-24,107,281,-174
"[도 10은, 제어 상태 전환 판정부(38)의 서브루틴인 일시 해제 모드로부터의 전환 판정(단계 S14)의 처리 내용을 나타내는 플로우 차트이다.]","FIG. 10 is a flowchart of a processing sequence of the process of determining switching from the temporary cancelation mode (step S14), as a subroutine of the controlled state switching determining section 38.",True,0.2774616479873657,0.8534696527143282,18,33,-15,82,209,-127
"[차체 컨트롤러(14)는, 락 스위치(15)의 단자의 개방/도통에 의해 락 스위치(15)가 눌려져 있는지 여부의 상태를 판정하고 있다.]",The vehicle body controller 14 determines whether the lock switch 15 is pressed or not by checking whether the terminals of the lock switch 15 are disconnected or connected.,True,0.2600098550319671,0.8550310300242571,15,29,-14,76,173,-97
"[본 실시예에서는, 운전실(4) 내에 설치된 락 레버가 락 위치에 있어 락 스위치(15)가 눌려져 있지 않을 때를 락 스위치 상태 「OFF」로서 취급한다.","According to the present embodiment, when the lock lever disposed in the cabin 4 is in the locked position and the lock switch 15 is not pressed, a lock switch state is ""OFF.""",True,0.2509376108646393,0.874121680953666,21,33,-12,86,175,-89
"차체 컨트롤러(14)는, 락 스위치 상태가 OFF일 때에는 락 밸브(28)를 비여자 상태의 차단 위치로 하고, 차체의 모든 동작을 불가능하게 하고 있다.]","When the lock switch state is OFF, the vehicle body controller 14 de-energizes the lock valve 28 into the interruption position, disabling the vehicle body operationally in whole.",True,0.2481376379728317,0.8732534839415909,20,28,-8,86,179,-93
"[또한, 본 실시예에서는, 운전실(4) 내에 설치된 락 레버가 락 해제 위치에 있어 락 스위치(15)가 눌려져 있을 때를 락 스위치 상태 「ON」으로서 취급한다.","According to the present embodiment, further, when the lock lever disposed in the cabin 4 is in the unlocked position and the lock switch 15 is pressed, the lock switch state is ""ON.""",True,0.2768677473068237,0.8596847194517183,22,33,-11,90,183,-93
"차체 컨트롤러(14)는, 락 스위치 상태가 ON일 때에는 락 밸브(28)에 24V를 인가하여 여자 상태(연통 위치)로 하여, 차체의 동작을 가능하게 하고 있다.]","When the lock switch state is ON, the vehicle body controller 14 applies 24 V to the lock valve 28 to energize the lock valve 28 into the fluid communication position, enabling the vehicle body to be operational.",True,0.2264987528324127,0.8824248678695511,20,38,-18,90,212,-122
"[일시 해제 모드로부터의 전환 판정(단계 S14)에서는, 먼저 처음으로, 비검지 시간 t2의 카운트를 개시한다(단계 S23).]","In the process of determining switching from the temporary cancelation mode (step S14), first, the controlled state switching determining section 38 starts counting a non-detection time t2 (step S23).",True,0.3200530111789703,0.8252249840976897,14,29,-15,71,200,-129
"[계속해서, 제어 해제 스위치 상태가 OFF에서부터 ON으로 변화되었는지 여부(스위치가 눌려져 있지 않은 상태로부터 눌려져 있는 상태로 변화되었는지 여부)를 판정한다(단계 S24).]","Then, the controlled state switching determining section 38 determines whether the control canceling switch state has changed from OFF to ON or not (whether the switch has changed from a non-pressed state to a pressed state or not) (step S24).",True,0.3221709430217743,0.8483137799933892,20,40,-20,102,243,-141
"[단계 S24에서 YES라고 판정된 경우, 제어 모드 상태 v3을 「통상」으로 전환한다(단계 S25). 그 후, 비검지 시간 t2의 카운트를 정지하고, 초기값(0)으로 리셋하여(단계 S26), 처리를 종료한다.]","Thereafter, the controlled state switching determining section 38 stops counting the non-detection time t2 and resets the non-detection time t2 to a default value (0) (step S26), after which the processing sequence is ended.",False,0.4662762284278869,0.7655113356652623,24,34,-10,118,224,-106
"[제어 해제 스위치(36)가 눌려지지 않아 제어 해제 스위치 상태가 OFF인 채의 경우, 이어서, 락 스위치 상태가 ON으로부터 OFF로 변화되었는지 여부(락 레버가 락 해제 위치로부터 락 위치로 변화되었는지 여부)를 판정한다(단계 S27).]","If the control canceling switch 36 is not pressed and the control canceling switch state remains to be OFF, then the controlled state switching determining section 38 determines whether the lock switch state has changed from ON to OFF or not (whether the lock lever has shifted from the unlocked position to the locked position or not) (step S27).",True,0.2830527722835541,0.8689640395093513,30,59,-29,136,347,-211
"[단계 S27에서 YES라고 판정된 경우, 제어 모드 상태 v3을 「통상」으로 전환한다(단계 S25). 그 후, 비검지 시간 t2의 카운트를 정지함과 함께 비검지 시간 t2를 초기값(0)으로 리셋하여(단계 S26), 처리를 종료한다.]","Thereafter, the controlled state switching determining section 38 stops counting the non-detection time t2 and resets the non-detection time t2 to the default value (0) (step S26), after which the processing sequence is ended.",False,0.4610583484172821,0.769167470537114,28,34,-6,131,226,-95
"[락 스위치(15)가 락 위치가 되지 않고 락 스위치 상태가 ON인 채의 경우, 이어서, 장해물 검지 상태 v1이 「비검지」인지 여부를 판정한다(단계 S28). 장해물 검지 상태 v1이 「비검지」가 아닌 경우, 즉, 3D 센서(6~9)가 차체 주위의 장해물을 1개 이상 검출하고 있는 「검지」인 경우에는, 제어 모드 상태 v3을 「일시 해제」로부터 전환하지 않고, 비검지 시간 t2를 초기값(0)으로 리셋하여(단계 S29), 단계 S24로 되돌아가 판정 처리를 계속한다.]","If the obstacle detection state v1 does not represent ""non-detection,"" i.e., if the obstacle detection state v1 represents ""detection"" where the 3D sensors 6 through 9 have detected one or more obstacles, then the controlled state switching determining section 38 does not switch the control mode state v3 from ""temporary cancelation,"" and resets the non-detection time t2 to the default value (0) (step S29).",False,0.3168862462043762,0.8550914127977993,60,64,-4,264,409,-145
"[단계 S28에 있어서, 장해물 검지 상태 v1이 「비검지」인 경우, 비검지 시간 t2가 제어 모드 복귀 시간 T2(예를 들면 30초) 이상인지 여부를 판정한다(단계 S30). 비검지 시간 t2가 제어 모드 복귀 시간 T2 미만인 경우, 단계 S24로 되돌아가 처리를 반복한다.]","If the obstacle detection state v1 represents ""non-detection"" in step S28, then the controlled state switching determining section 38 determines whether or not the non-detection time t2 is equal to or longer than a control mode return time T2 (e.g., 30 seconds) (step S30).",False,0.3350496888160705,0.8425361894378732,38,44,-6,156,273,-117
"[장해물 비검지인 채 비검지 시간 t2가 제어 모드 복귀 시간 T2 이상이 된 경우에는, 제어 모드 상태 v3을 「통상」으로 전환한다(단계 S25). 그 후, 비검지 시간 t2의 카운트를 정지하고 또한 초기값(0)으로 리셋하여(단계 S26), 처리를 종료한다.]","Thereafter, the controlled state switching determining section 38 stops counting the non-detection time t2 and resets the non-detection time t2 to the default value (0) (step S26), after which the processing sequence is ended.",False,0.4751857817173004,0.7592679328126797,34,34,0,146,226,-80
"[도 11은, 제어 상태 전환 판정부(38)의 서브루틴인 상시 해제 모드로부터의 전환 판정(단계 S15)의 처리 내용을 나타내는 플로우 차트이다.]","FIG. 11 is a flowchart of a processing sequence of a process of determining switching from the permanent cancelation mode (step S15), as a subroutine of the controlled state switching determining section 38.",True,0.297850489616394,0.8401433967768077,18,33,-15,82,207,-125
"[단계 S15에서는, 제어 해제 스위치 상태가 OFF로부터 ON으로 변화되었는지 여부(제어 해제 스위치(36)가 눌려져 있지 않은 상태로부터 눌려져 있는 상태로 변화되었는지 여부)를 판정한다(단계 S31).]","In step S15, the controlled state switching determining section 38 determines whether the control canceling switch state has changed from OFF to ON or not (whether the control canceling switch 36 has changed from the non-pressed state to the pressed state or not) (step S31).",True,0.209260955452919,0.9002568201940554,23,45,-22,116,275,-159
"[단계 S31에서 YES라고 판정된 경우, 제어 모드 상태 v3을 「통상」으로 전환하고(단계 S32), 처리를 종료한다.","If the controlled state switching determining section 38 determines that the answer to step S31 is YES, then the controlled state switching determining section 38 switches the control mode state v3 to ""normal"" (step S32), after which the processing sequence is ended.",True,0.311394065618515,0.8451191654704822,14,42,-28,67,267,-200
"제어 해제 스위치(36)가 눌려지지 않고, 제어 해제 스위치 상태가 OFF인 채이면, 제어 모드 상태 v3을 「상시 해제」로부터 전환하지 않고, 처리를 종료한다.]","If the control canceling switch 36 is not pressed and the control canceling switch state remains to be OFF, then the controlled state switching determining section 38 does not switch the control mode state v3 from ""permanent cancelation,"" after which the processing sequence is ended.",True,0.3139313757419586,0.848175608905315,21,45,-24,91,284,-193
[(각 제어부의 상세 설명 동작 제한 지령부)],(Description of details of the control sections; the operation limiting command section),True,0.2387845069169998,0.8384441518290244,7,12,-5,26,88,-62
"[도 12는, 동작 제한 지령부(39)의 처리 내용을 나타내는 플로우 차트이다.]",FIG. 12 is a flowchart of a processing sequence of the operation limiting command section 39.,True,0.2308205962181091,0.8558568581015327,10,16,-6,45,93,-48
"[우선 처음으로, 제어 모드 상태 v3이 「통상」인지 여부를 판정한다(단계 S42). 제어 모드 상태 v3이 「통상」일 때 (「일시 해제」 또는 「상시 해제」가 아닐 때), 계속해서, 장해물 검지 상태 v1이 「검지」인지 여부를 판정한다(단계 S43). 차체 주위에 물체(사람·물건)가 있어 장해물 검지 상태 v1이 「검지」일 때, 동작 제한 지령부(39)는 회전수 지령 v6을 「제한 회전수」(예를 들면 800rpm)로 한다(단계 S44).]","If the control mode state v3 represents ""normal"" (if the control mode state v3 does not represent ""temporary cancelation"" or ""permanent cancelation""), then the operation limiting command section 39 determines whether the obstacle detection state v1 represents ""detection"" or not (step S43).",False,0.4283885657787323,0.8083046447198522,54,42,12,248,290,-42
"[이에 따라, 후술하는 엔진 회전 제어부(43)의 처리를 통하여, 차체의 엔진 회전수가 낮게 제한된다.","In this manner, the engine rotational speed of the vehicle body is limited to a low value through the processing of the engine rotation control section 43 to be described later.",True,0.2407547831535339,0.8575143957845036,13,31,-18,57,177,-120
"통상 작업 시에서, 엔진 회전수 고회전(예를 들면 1800rpm)으로 가동되고 있는 경우, 장해물 검지 시에 엔진 회전수가 떨어짐으로써, 오퍼레이터는 경보나 표시에 더해 체감으로서도 검지를 알아차릴 수 있기 때문에, 보다 안전성을 높일 수 있다.]","When the vehicle body has been operating at a high engine rotational speed (e.g., 1800 rpm) during normal work, as the engine rotational speed is lowered upon obstacle detection, the operator can notice the detection through a bodily sensation in addition to a warning or display, so that higher safety can be achieved.",True,0.1981907039880752,0.8757617874705319,32,53,-21,138,319,-181
"[또한, 장해물을 검지하고 있는 상태에서는 엔진 회전수가 제한되어, 장해물 검지를 무시하고 그대로 동일한 작업을 계속할 수는 없게 되기 때문에, 오퍼레이터에 대하여, 작업을 일단 멈추고 주위의 안전 확인을 행하는 것을 촉구할 수도 있다.]","Further, while an obstacle is being detected, since the engine rotational speed is limited and the same work cannot be continued as it is by ignoring the obstacle detection, the operator is prompted to stop the work and check safety in the periphery.",True,0.3178006112575531,0.8095923531543402,32,43,-11,133,250,-117
"[계속해서, 선회 조작 상태 v10이 「비조작」인지 여부를 판정한다(단계 S45). 장해물을 검지하고 있는 상태에 있어서, 선회 조작을 행하고 있지 않은 「비조작」인 경우, 선회 정지 지령 v4를 「차단 압력」(예를 들면 0MPa)으로 한다(단계 S46).]","If the swing operation state v10 represents ""non-operation"" where no swing operation is performed while an obstacle is being detected, the operation limiting command section 39 sets a swing stop command v4 to ""interruption pressure"" (e.g., 0 MPa) (step S46).",False,0.3676897287368774,0.8325007818486496,31,40,-9,144,258,-114
"[이에 따라, 후술하는 전자 밸브 구동부(42)의 처리를 통하여, 선회 조작이 불능한 상태로 한다.","In this fashion, swing operation is made impossible through the processing of the solenoid valve actuating section 42 to be described later.",True,0.3228159546852112,0.8191617443134409,13,22,-9,55,140,-85
"장해물이 차체의 주위에 존재하는 상태에서 선회의 시동 정지를 행함으로써, 유압 셔블이 움직이기 시작함에 있어서의 차체와 주위 작업자의 접촉에 의한 사고의 발생의 가능성을 낮출 수 있다.]","By stopping a swinging start while an obstacle is present in the periphery of the vehicle body, it is possible to lower the possibility of an accident due to contact between the vehicle body and a peripheral worker when the hydraulic excavator is about to move.",True,0.2562144100666046,0.8262920010986973,25,46,-21,104,261,-157
"[계속해서, 주행 조작 상태 v11이 「비조작」인지 여부를 판정한다(단계 S47). 장해물을 검지하고 있는 상태에 있어서, 주행 조작을 행하고 있지 않은 「비조작」인 경우, 주행 정지 지령 v5를 「차단 압력」(예를 들면 0MPa)으로 한다(단계 S48).]","If the travel operation state v11 represents ""non-operation"" where no travel operation is performed while an obstacle is being detected, the operation limiting command section 39 sets a travel stop command v5 to ""interruption pressure"" (e.g., 0 MPa) (step S48).",False,0.3985042572021484,0.8231510008040546,31,40,-9,144,261,-117
"[이에 따라, 후술하는 전자 밸브 구동부(42)의 처리를 통하여, 주행 조작이 불능한 상태로 한다.","In this fashion, travel operation is made impossible through the processing of the solenoid valve actuating section 42 to be described later.",True,0.3195223808288574,0.8197425265611383,13,22,-9,55,141,-86
"장해물이 차체의 주위에 존재하는 상태에서 주행의 시동 정지를 행함으로써, 유압 셔블이 움직이기 시작함에 있어서의 차체와 주위 작업자의 접촉에 의한 사고의 발생의 가능성을 낮출 수 있다.]","By stopping a traveling start while an obstacle is present in the periphery of the vehicle body, it is possible to lower the possibility of an accident due to contact between the vehicle body and a peripheral worker when the hydraulic excavator is about to move.",True,0.256203144788742,0.826014759240549,25,46,-21,104,262,-158
"[이상과 같이, 장해물 검출 시에는, 차체 동작을 제한하는 차체 동작 제한을 작동시킨다.]","As described above, upon obstacle detection, vehicle body operation limitation for limiting vehicle body operation is enabled.",True,0.4239706695079803,0.7123460637404185,12,17,-5,50,126,-76
"[이어서, 차체 동작 제한의 해제에 관한 판정 및 제어 처리에 대하여 설명한다.]","Next, a process of determining cancelation of the vehicle body operation limitation and a control process will be described below.",True,0.305521696805954,0.8110048863471543,12,20,-8,45,130,-85
"[단계 S43에 있어서, 차체 주위에 물체(사람·물건)를 검출하지 않게 되어 장해물 검지 상태 v1이 「검지」가 아니게 된 경우(「비검지」가 된 경우), 락 스위치 상태가 OFF인지 여부를 판정한다(단계 S49). 장해물을 검지하지 않게 된 상태에 있어서, 락 레버가 락 위치에 있어 락 스위치 상태가 OFF인 경우에, 회전수 지령 v6을 「최대 회전수」(예를 들면 2000rpm)로 하고(단계 S50), 선회 정지 지령 v4를 「개방 압력」(예를 들면 4MPa)으로 하고(단계 S51), 주행 정지 지령 v5를 「개방 압력」(예를 들면 4MPa)으로 한다(단계 S52).]","If the lock lever is in the locked position and the lock switch state is OFF while no obstacle is being detected, the operation limiting command section 39 sets the rotational speed command v6 to ""maximum rotational speed"" (e.g., 2000 rpm) (step S50), sets the swing stop command v4 to ""open pressure"" (e.g., 4 MPa) (step S51), and sets the travel stop command v5 to ""open pressure"" (e.g., 4 MPa) (step S52).",False,0.3652844130992889,0.8335063482498147,71,72,-1,321,408,-87
"[락 레버가 락 해제 위치에 있어 락 스위치 상태가 ON인 경우(OFF가 아닌 경우)에는, 장해물 검지 상태 v1이 「검지」가 아니게 되었다고 해도 차체 동작 제한은 작동시킨 채로 한다.]","If the lock lever is in the unlocked position and the lock switch state is ON (the lock switch state is not OFF), the vehicle body operation limitation remains enabled even if the obstacle detection state v1 no longer represents ""detection.""",True,0.3200829029083252,0.8349909545417208,27,41,-14,105,241,-136
"[락 레버가 락 위치에 있는 상태에서는, 락 밸브(28)가 차단 위치에 있기 때문에, 차체의 모든 동작이 불가능하게 되어 있다.","Since the lock valve 28 is in the interruption position while the lock lever is in the locked position, the vehicle body is operationally disabled in whole.",True,0.332064151763916,0.8108949996368164,18,27,-9,71,156,-85
"이 상태에서만 차체 동작 제한을 해제하는 것을 허가함으로써, 예를 들면, 오퍼레이터가 조작 레버(19, 20)를 의도하지 않게 쓰러뜨리고 있던 상태에 있어서 장해물 비검지가 되었을 때에 선회/주행의 동작 제한이 해제되어, 차체가 갑자기 움직이기 시작해버리는 상황이 발생하지 않도록 할 수 있어, 보다 안전성을 향상시킬 수 있다.]","By permitting the vehicle body operation limitation to be canceled only in this state, it is possible to avoid a situation where swinging/traveling operation is canceled and the vehicle body is allowed to move abruptly when no obstacle is detected while the operator has unintentionally moved down the operation levers 19 and 20, for example, resulting in higher safety.",True,0.2255546301603317,0.8774111516524534,43,59,-16,184,370,-186
[(각 제어부의 상세 설명 전자 밸브 구동부)],(Description of details of the control sections; the solenoid valve actuating section),True,0.2607592046260834,0.8299319316735067,7,12,-5,26,86,-60
"[도 13은, 전자 밸브 구동부(42)의 처리 내용을 나타내는 플로우 차트이다.]",FIG. 13 is a flowchart of a processing sequence of the solenoid valve actuating section 42.,True,0.2565421760082245,0.850087668731094,10,16,-6,45,91,-46
"[전자 밸브 구동부(42)는, 동작 제한 지령부(39)에서의 연산 결과인 선회 정지 지령 v4와 주행 정지 지령 v5의 전자 밸브 압력에 따라 실제로 차체 동작 제한 장치인 선회 파일럿압 차단 전자 밸브(34)와 주행 파일럿압 차단 전자 밸브(35)를 구동하는 제어부이다.]",The solenoid valve actuating section 42 is a control section for actually actuating the swing pilot pressure interruption solenoid valve 34 and the travel pilot pressure interruption solenoid valve 35 as the vehicle body operation limiting devices according to solenoid valve pressures represented by the swing stop command v4 and the travel stop command v5 as calculated results from the operation limiting command section 39.,True,0.2386501580476761,0.8799817265361278,37,65,-28,153,427,-274
"[우선 처음으로, 선회 정지 지령 v4가 「차단 압력」인지 여부를 판정한다(단계 S53). 「차단 압력」인 경우에는, 선회 파일럿압 차단 전자 밸브 전류 v7을 「차단 전류」(예를 들면 600mA)로 한다(단계 S54). 「차단 압력」이 아닌 경우(「개방 압력」의 경우)에는, 선회 파일럿압 차단 전자 밸브 전류 v7을 「개방 전류」(예를 들면 0mA)로 한다(단계 S55).]","First, the solenoid valve actuating section 42 determines whether the swing stop command v4 represents ""interruption pressure"" or not (step S53).",False,0.603039026260376,0.7053275245655801,46,21,25,211,145,66
"[계속해서, 주행 정지 지령 v5가 「차단 압력」인지 여부를 판정한다(단계 S56). 「차단 압력」인 경우에는, 주행 파일럿압 차단 전자 밸브 전류 v8을 「차단 전류」(예를 들면 600mA)로 한다(단계 S57). 「차단 압력」이 아닌 경우(「개방 압력」인 경우)에는, 주행 파일럿압 차단 전자 밸브 전류 v8을 「개방 전류」(예를 들면 0mA)로 한다(단계 S58).]","If the swing stop command v4 represents ""interruption pressure,"" then the solenoid valve actuating section 42 sets a swing pilot pressure interruption solenoid valve current v7 to ""interruption current"" (e.g., 600 mA) (step S54).",False,0.4868302345275879,0.7758698184311015,45,34,11,208,229,-21
"[차체 컨트롤러(14)에는 비례 전자 밸브의 솔레노이드를 구동하기 위한 아날로그 출력 회로인 전자 밸브 드라이버가 내장되어 있으며, 선회 파일럿압 차단 전자 밸브 전류 v7과 주행 파일럿압 차단 전자 밸브 전류 v8이 되도록 회로에 전류를 흘리고, 선회 파일럿압 차단 전자 밸브(34) 및 주행 파일럿압 차단 전자 밸브(35)를 구동한다(단계 S59).]","If the swing stop command v4 does not represent ""interruption pressure"" (if the swing stop command v4 represents ""open pressure""), then the solenoid valve actuating section 42 sets the swing pilot pressure interruption solenoid valve current v7 to ""open current"" (e.g., 0 mA) (step S55).",False,0.6582695841789246,0.689148537835028,47,45,2,198,287,-89
"[엔진 회전 제어부(43)에서는, 기준 요구 회전수 v13의 연산 처리(단계 S60)에 계속해서, 동작 제한 지령부(39)로부터 보내지는 회전수 지령 v6이 기준 요구 회전수 v13보다 큰지를 판정한다(단계 S61).]","Then, the solenoid valve actuating section 42 determines whether the travel stop command v5 represents ""interruption pressure"" or not (step S56).",False,0.8747903108596802,0.5563134698100272,25,21,4,122,145,-23
"[차체 동작 제한이 작동하고 있지 않을 때에는, 회전수 지령 v6은 기준 요구 회전수 v13보다 큰 「최대 회전수」(예를 들면 2000rpm)로 되어 있기 때문에, 그 경우에는, 엔진 목표 회전수 v9를 「기준 요구 회전수 v13」으로 함으로써, 통상의 유압 셔블로서 사용 가능하게 한다(단계 S62).]","If the travel stop command v5 represents ""interruption pressure,"" then the solenoid valve actuating section 42 sets a travel pilot pressure interruption solenoid valve current v8 to ""interruption current"" (e.g., 600 mA) (step S57).",False,0.7244604229927063,0.6343923974220688,40,34,6,170,231,-61
"[차체 동작 제한이 작동하고 있을 때에는, 회전수 지령 v6은 기준 요구 회전수 v13 이하의 「제한 회전수」(예를 들면 800rpm)로 되어 있기 때문에, 그 경우에는, 엔진 목표 회전수 v9를 「회전수 지령 v6」으로 함으로써, 엔진 회전수를 강제적으로 제한하여, 차체의 동작을 제한한다(단계 S63).]","If the travel stop command v5 does not represent ""interruption pressure"" (if the travel stop command v5 represents ""open pressure""), then the solenoid valve actuating section 42 sets the travel pilot pressure interruption solenoid valve current v8 to ""open current"" (e.g., 0 mA) (step S58).",False,0.7770706415176392,0.6287738716643212,39,45,-6,172,290,-118
[(제 1 실시예의 효과)],The vehicle body controller 14 incorporates therein a solenoid valve driver as an analog output circuit for actuating the solenoid of a proportional solenoid valve.,False,1.1550250053405762,0.2595634646486714,4,25,-21,15,164,-149
"[또한, 본 발명의 실시예에 따른 실외기(A)의 리시버(54)는 압축기(53)에 제공되는 오일의 양을 조절하기 위해 오일을 저장할 수 있다.",The receiver 54 may provide the stored oil to the compressor 53 through the accumulator 52.,False,0.565270721912384,0.7338842068702432,17,16,1,78,91,-13
리시버(54)는 저장된 오일을 어큐뮬레이터(52)를 통해 압축기(53)로 제공할 수 있다.],"That is, the receiver 54 supplies oil to the accumulator 52 when the amount of oil in the compressor 53 is insufficient.",False,0.5183801651000977,0.7330058203187839,9,22,-13,51,120,-69
"[즉, 리시버(54)는 압축기(53)의 오일의 양이 부족한 경우 상기 어큐뮬레이터(52)에 오일을 공급하고, 상기 압축기가 동작하지 않을 때, 즉 공기조화기(100)가 운전하지 않을 때, 오일회수운전을 수행하여 압축기(53) 내의 오일을 리시버(54) 내로 회수하여 저장한다. ]","Further, when the compressor does not operate, that is, when the air conditioner 100 does not operate, the receiver 54 performs an oil recovery operation, so that the oil in the compressor 53 is recovered and stored into the receiver 54.",False,0.3211521804332731,0.8496784410619561,31,41,-10,156,237,-81
"[따라서, 실외 공기가 소정 온도 이하의 한랭 지역에서 대부분의 운전 모드가난방 운전으로 진행될 경우, 리시버(54)에 냉매가 저장되는 경우가 거의 발생하지 않아 리시버(54)가 냉매 저장 탱크로서 기능을 수행하지 않는다.","Therefore, when most of the operation mode is a heating operation in a cold region where the outdoor air is a certain temperature or less, the refrigerant is hardly stored in the receiver 54, so that the receiver 54 does not serve as a refrigerant storage tank.",True,0.2484003752470016,0.8691098159617099,28,47,-19,124,261,-137
"이때, 리시버(54)를 오일 저장탱크로 활용함으로써 종래 설치되어 있는 탱크를 오일 회수 탱크로서 전용할 수 있다. ]","At this time, the existing installed tank can be diverted as an oil recovery tank by utilizing the receiver 54 as an oil storage tank.",True,0.2287951409816742,0.8760798238095787,16,25,-9,66,134,-68
"[한편, 액관연결배관(72) 중 실외팽창밸브(65, 67)들 및 과냉각유닛(66)을 연결하는 배관을 과냉각액관연결배관으로 구분하여 정의할 수 있다.]","Meanwhile, a pipe connecting the outdoor expansion valve 65,67 and the supercooling unit 66 among the liquid pipe connection pipe 72 may be classified and defined as a supercooling liquid pipe connection pipe.",True,0.268619954586029,0.8659089087918702,14,33,-19,83,209,-126
사방밸브(62)는 상기 공기 조화기(100)의 냉난방 운전에 맞춰 상기 압축기(53)에서 토출된 냉매의 유로를 적절히 전환한다.],The four-way valve 62 is provided in the outlet side of the compressor 53 and switches the flow path of the refrigerant flowing in the outdoor unit A. The four-way valve 62 appropriately switches the flow path of the refrigerant discharged from the compressor 53 in accordance with the cooling/heating operation of the air conditioner 100.,False,0.3829651772975921,0.8202369680358882,14,56,-42,72,339,-267
"[본 실시예에 따른 사방밸브(62)는 압축기(53)에서 토출된 냉매를 실외열교환기(A1, A2)로 보내거나, 실외열교환기(A1, A2)에서 유동하는 냉매를 어큐뮬레이터(52)를 거쳐 압축기(53)로 보내거나, 압축기(53)에서 토출된 냉매를 기관(75)으로 보내거나, 기관연결배관(75)으로부터 유입된 냉매를 어큐뮬레이터(52)를 거쳐 압축기(53)로 내보낸다.]","The four-way valve 62 according to this embodiment sends the refrigerant discharged from the compressor 53 to the outdoor heat exchanger A1,A2, sends the refrigerant flowing in the outdoor heat exchanger A1,A2, to the compressor 53 through the accumulator 52, sends the refrigerant discharged from the compressor 53 to a gas pipe 75, or sends the refrigerant introduced from the gas pipe connection pipe 75 to the compressor 53 through the accumulator 52.",True,0.2303480803966522,0.9034734206990248,30,73,-43,203,455,-252
"[또한, 난방운전의 작동 시, 난방운전하는 실외기측의 사방밸브(62)는 실외열교환기(A1, A2)로 유입된 냉매를 압축기(53)로 보낸다. ]","In addition, during the heating operation, the four-way valve 62 in the side of the outdoor unit for heating operation sends the refrigerant introduced into the outdoor heat exchanger A1,A2 to the compressor 53.",True,0.2773633301258087,0.8703977792396006,14,34,-20,79,211,-132
"[본 실시예에 따른 공기조화기(100)는 압축기(53)에서 압축된 냉매의 일부가 유동하는 핫가스유닛(73, 79)을 포함할 수 있다.","The air conditioner 100 according to the present embodiment may include a hot gas unit 73, 79 in which a portion of the refrigerant compressed in the compressor 53 flows.",True,0.168742299079895,0.9252663249830576,14,30,-16,74,170,-96
"압축기(53)에서 압축된 고온고압의 냉매의 일부는 핫가스바이패스배관(73, 79)을 통과하여 실외열교환기(A1, A2)로 유입될 수 있다. ]","A portion of the high-temperature high-pressure refrigerant compressed in the compressor 53 may be introduced into the outdoor heat exchanger A1,A2 through the hot gas bypass pipe 73, 79.",True,0.2298211306333542,0.892957081001901,14,29,-15,79,187,-108
"[핫가스유닛(73, 79)은 냉매를 바이패스시키기 위한 핫가스바이패스배관(73, 79) 및 핫가스밸브(63, 69)를 포함한다.]","The hot gas unit 73, 79 includes a hot gas valve 63, 69 and a hot gas bypass pipe 73 and 79 for bypassing the refrigerant.",True,0.2766723334789276,0.8700421141349439,11,26,-15,72,122,-50
[본 실시예에서는 상기 제1실외열교환기 배관(76) 및 압축기토출배관(55)를 연결하는 제1핫가스바이패스배관(73)이 배치된다.,"In the present embodiment, a first hot gas bypass pipe 73 connecting the first outdoor heat exchanger pipe 76 and the discharge pipe 55 of compressor is disposed.",True,0.1903492957353592,0.9138056765119263,10,28,-18,71,162,-91
"제1핫가스바이패스배관(73)의 일단은 제1실외열교환기 배관(76)에 연결되고, 타단은 압축기토출배관(55)에 연결된다.","One end of the first hot gas bypass pipe 73 is connected to the first outdoor heat exchanger pipe 76, and the other end is connected to the compressor discharge pipe 55.",True,0.1764396578073501,0.9199416227863352,8,32,-24,66,169,-103
제2실외열교환기 배관(77) 및 압축기토출배관(55)을 연결하는 제2핫가스바이패스배관(79)이 배치된다.,A second hot gas bypass pipe 79 connecting the second outdoor heat exchanger pipe 77 and the discharge pipe 55 of compressor is disposed.,True,0.1728753745555877,0.9216064898021282,7,24,-17,58,137,-79
"제2핫가스바이패스배관(79)의 일단은 제1실외열교환기배관(77)에 연결되고, 타단은 압축기토출배관(55)에 연결된다.]","One end of the second hot gas bypass pipe 79 is connected to the first outdoor heat exchanger pipe 77, and the other end is connected to the discharge pipe 55 of compressor.",True,0.1958452463150024,0.9070699848879794,7,33,-26,66,173,-107
"[제1핫가스바이패스배관(73)에는 제1핫가스밸브(63)가 배치되고, 제2핫가스바이패스배관(79)에는 제2핫가스밸브(69)가 배치된다.","A first hot gas valve 63 is disposed in the first hot gas bypass pipe 73, and a second hot gas valve 69 is disposed in the second hot gas bypass pipe 79.",True,0.2275171130895614,0.8883849796192368,6,33,-27,74,153,-79
"핫가스밸브(63,69)는 개도량을 조절할 수 있는 솔레노이드밸브가 사용되고, 개폐밸브가 사용되어도 무방하다.]","A solenoid valve capable of adjusting the opening degree is used as the hot gas valve 63, 69, or an opening/closing valve may be used as well.",True,0.3724796772003174,0.7949897485702607,10,27,-17,61,142,-81
"[제1핫가스바이패스배관(73) 및 제2핫가스바이패스배관(79)이 각각 압축기토출배관(55)에 연결되어도 무방하나, 본 실시예에서는 합지된 후, 1개의 배관으로 상기 압축기토출배관(55)에 연결된다.]","The first hot gas bypass pipe 73 and the second hot gas bypass pipe 79 may be connected to the discharge pipe 55 of compressor respectively, but in the present embodiment, after converging, may be connected to the discharge pipe 55 of compressor through a single pipe.",True,0.2273507416248321,0.8987323730652366,16,47,-31,111,268,-157
[액관연결배관(72)에는 과냉각유닛(66)이 배치될 수 있다.],The supercooling unit 66 may be disposed in the liquid pipe connection pipe 72.,True,0.3383458256721496,0.8259826112933932,5,14,-9,35,79,-44
"[과냉각유닛(66)은 과냉각열교환기(66a)와, 액관연결배관(72)에서 바이패스되고, 상기 과냉각열교환기(66a)와 연결되는 과냉각바이패스배관(66b)과, 상기 과냉각바이패스배관(66b)에 배치되고 유동되는 냉매를 선택적으로 팽창시키는 과냉각팽창밸브(66c)와, 상기 과냉각열교환기(66a) 및 압축기(53)를 연결하는 과냉각-압축기연결배관(89)과, 과냉각-압축기 연결배관(89)에 배치되고, 유동되는 냉매를 선택적으로 팽창시키는 과냉각-압축기팽창밸브(91)를 포함한다.]","The supercooling unit 66 includes a supercooling heat exchanger 66a, a supercooling bypass pipe 66b that is bypassed in the liquid pipe connection pipe 72 and is connected to the supercooling heat exchanger 66a, a supercooling expansion valve 66c that is disposed in the supercooling bypass pipe 66b and selectively expands the flowing refrigerant, a supercooling-compressor connection pipe 89 connecting the supercooling heat exchanger 66a and the compressor 53, and a supercooling-compressor expansion valve 91 that is disposed in the supercooling-compressor connection pipe 89 and selectively expands the flowing refrigerant.",True,0.2347916215658188,0.8974981250690509,31,90,-59,265,628,-363
"[본 실시예에 따른 과냉각유닛(66)은 상기 어큐뮬레이터(52) 및 상기 과냉각-압축기 연결배관을 연결시키는 어큐뮬레이터 바이패스배관을 더 포함하고, 상기 어큐뮬레이터 바이패스배관은 상기 어큐뮬레이터(52)의 냉매를 상기 과냉각-압축기연결배관(89)에 제공한다. ]","The supercooling unit 66 according to the present embodiment further includes an accumulator bypass pipe connecting the accumulator 52 and the supercooling-compressor connection pipe, and the accumulator bypass pipe provides the refrigerant of the accumulator 52 to the supercooling-compressor connection pipe 89.",True,0.2052839398384094,0.9136198307420412,25,42,-17,148,313,-165
[어큐뮬레이터 바이패스배관에는 과냉각 바이패스밸브(90)가 더 배치된다.],A supercooling bypass valve 90 is further disposed in the accumulator bypass pipe.,True,0.4481273591518402,0.7300866698465186,6,13,-7,41,82,-41
"[과냉각 팽창밸브(66c)는, 액체 냉매를 팽창시켜 과냉각열교환기(66a)에 제공하고, 팽창된 냉매가 상기 과냉각열교환기(66a)에서 증발되어 상기 과냉각열교환기(66a)를 냉각시킨다.","The supercooling expansion valve 66c expands the liquid refrigerant and provides to the supercooling heat exchanger 66a, and the expanded refrigerant is evaporated in the supercooling heat exchanger 66a to cool the supercooling heat exchanger 66a.",True,0.2124686241149902,0.8987177955081573,15,36,-21,103,247,-144
"액관연결배관(72)을 통해 실외열교환기(A1, A2)로 유동되는 액체냉매는 과냉각열교환기(66a)를 통과하면서 냉각될 수 있다.","The liquid refrigerant flowing to the outdoor heat exchanger A1,A2 through the liquid pipe connection pipe 72 may be cooled while passing through the supercooling heat exchanger 66a.",True,0.1857597827911377,0.9128618905540916,11,28,-17,71,182,-111
과냉각팽창밸브(66c)는 선택적으로 작동되고 상기 액체냉매의 온도를 제어할 수 있다.],The supercooling expansion valve 66c is selectively operated and may control the temperature of the liquid refrigerant.,True,0.138878047466278,0.9217325606159806,9,17,-8,48,119,-71
"[과냉각팽창밸브(66c)의 작동 시, 과냉각-압축기팽창밸브(91)가 개방되고 냉매는 상기 압축기(53)로 유동된다.]","When the supercooling expansion valve 66c is operated, the supercooling-compressor expansion valve 91 is opened and the refrigerant flows to the compressor 53.",True,0.2495888322591781,0.8853607384303184,9,23,-14,65,159,-94
"[과냉각 팽창밸브(66c)는 선택적으로 작동되고, 어큐뮬레이터(52)의 액냉매를 과냉각-압축기팽창밸브(91)에 제공할 수 있다.]","The subcooling expansion valve 66c is selectively operated, and may provide the liquid refrigerant of the accumulator 52 to the subcooling-compressor expansion valve 91.",True,0.2758099436759949,0.8718777630248113,10,24,-14,72,169,-97
"[과냉각-압축기팽창밸브(91)는 선택적으로 작동되고, 냉매를 팽창시켜 압축기(53)에 공급되는 냉매의 온도를 낮출 수 있다.","The supercooling-compressor expansion valve 91 is selectively operated, and expands the refrigerant to lower the temperature of the refrigerant supplied to the compressor 53.",True,0.2210386842489242,0.8953428191730304,12,24,-12,69,174,-105
"압축기(53)가 정상 작동 온도범위를 초과하는 경우, 과냉각-압축기팽창밸브(91)에서 팽창된 냉매가 압축기(53)에서 증발될 수 있고, 이를 통해 압축기(53)의 온도를 낮출 수 있다.]","When the compressor 53 exceeds a normal operating temperature range, the refrigerant expanded by the supercooling-compressor expansion valve 91 may be evaporated in the compressor 53, thereby lowering the temperature of the compressor 53.",True,0.1787113547325134,0.9180938773778072,20,34,-14,104,238,-134
"[본 실시예에 따른 과냉각유닛(66)은 상기 리시버(54) 및 상기 액관연결배관(72)을 연결시키는 리시버 입구배관(81)을 더 포함하고, 상기 리시버 입구배관(81)은 상기 리시버(54)의 냉매를 상기 액관연결배관(72)에 제공하기 위한 리시버입구밸브(82)를 더 포함한다. ]","The supercooling unit 66 according to the present embodiment further includes a receiver inlet pipe 81 connecting the receiver 54 and the liquid pipe connection pipe 72, and the receiver inlet pipe 81 further includes a receiver inlet valve 82 for providing the refrigerant of the receiver 54 to the liquid pipe connection pipe 72.",True,0.1852111518383026,0.9217606555623752,28,55,-27,156,331,-175
"[한편, 리시버(54)의 출구배관(83)은 어큐뮬레이터(52)에 연결되어 있으며, 상기 어큐뮬레이터(52)로 냉매 및/또는 오일을 제공하기 위한 리시버 출구밸브(84)가 리시버 출구배관(83) 상에 형성되어 있다.]","Meanwhile, an outlet pipe 83 of the receiver 54 is connected to the accumulator 52, and a receiver outlet valve 84 for providing refrigerant and/or oil to the accumulator 52 is formed on the receiver outlet pipe 83.",True,0.1918697357177734,0.9183323428296676,20,38,-18,120,215,-95
"[이러한 리시버(54)는 압축기(53)의 오일회수를 위하여, 오일회수관(30)과 리시버(54) 사이에 리시버오일회수배관(85)을 더 포함한다.]",The receiver 54 further includes a receiver oil recovery pipe 85 in between the oil recovery pipe 30 and the receiver 54 so as to recover oil of the compressor 53.,True,0.3040693998336792,0.8620142830308467,11,31,-20,80,163,-83
[상기 리시버오일회수배관(85)은 오일회수운전 시에 상기 압축기(53) 및 오일분리기(58)에 존재하는 오일을 모두 회수하여 리시버(54)에 저장하도록 오일회수밸브(86)가 형성되어 있다.],"In the receiver oil recovery pipe 85, an oil recovery valve 86 is formed to recover all the oil existing in the compressor 53 and the oil separator 58 during the oil recovery operation and store the recovered oil in the receiver 54.",True,0.21488057076931,0.8985431705052624,17,43,-26,106,232,-126
"[상기 오일회수밸브(86)는 솔레노이드 밸브일 수 있으나, 이에 한정되는 것은 아니다.]","The oil recovery valve 86 may be a solenoid valve, but is not limited thereto.",True,0.182957112789154,0.8903385604867106,10,15,-5,49,78,-29
"[본 실시예에 따른 공기조화기(100)는 냉매의 압력을 측정하는 압력센서, 냉매의 온도를 측정하는 온도센서 및 냉매관을 유동하는 냉매 등에 존재하는 이물질을 제거하는 스트레이너를 더 포함할 수 있다.]","The air conditioner 100 according to the present embodiment may further include a pressure sensor for measuring the pressure of the refrigerant, a temperature sensor for measuring the temperature of the refrigerant, and a strainer for removing foreign substances existing in the refrigerant flowing through the refrigerant pipe.",True,0.2109750062227249,0.8963551219350621,25,48,-23,112,328,-216
"[한편, 냉난방 겸용 실내기들(B)은 각각 실내 열교환기(11), 실내 전자팽창밸브(12) 및 실내기 팬들(15)을 포함한다.","Meanwhile, each of the indoor units B for heating/cooling operation includes an indoor heat exchanger 11, an indoor electronic expansion valve 12, and indoor unit fans 15.",True,0.2298483848571777,0.8766718482562321,13,27,-14,70,171,-101
실내 전자팽창밸브(12)은 실내 열교환기(11)과 기관연결배관 또는 액관연결배관을 연결하는 실내 연결 배관 상에 설치되어 있다.],The indoor electronic expansion valve 12 is installed on the indoor connection pipe connecting the indoor heat exchanger 11 and the gas pipe connection pipe or the liquid pipe connection pipe.,True,0.1986933946609497,0.8889193688138289,14,31,-17,72,192,-120
"[또한, 냉난방 겸용 실내기들(B)에서 토출되는 냉매의 온도를 감지하기 위하여, 온도센서들이 설치될 수 있다.","In addition, temperature sensors may be installed to detect the temperature of the refrigerant discharged from the indoor units B for heating/cooling operation.",True,0.2355703562498092,0.8673008716471702,13,23,-10,61,160,-99
"또한, 실내 열교환기(11)에도 실내 온도를 측정하기 위한 온도센서(미도시)가 설치될 수 있다.]","In addition, a temperature sensor (not shown) for measuring the indoor temperature may be installed in the indoor heat exchanger 11.",True,0.2217290699481964,0.870931504101942,11,21,-10,54,132,-78
[이러한 냉난방 멀티 공기조화기는 도 2의 실외기와 실내기 사이에 분배기를 더 포함할 수 있다. ],The multi-air conditioner for heating/cooling operation may further include a distributor in between the outdoor unit and indoor unit of FIG. 2.,True,0.324943333864212,0.8252419958581207,15,22,-7,55,144,-89
"[분배기가 포함되는 경우, 복수개의 실외기와 복수개의 실내기의 동시 운전 또는 개별 운전이 가능하다.]","When a distributor is included, simultaneous operation or individual operation of a plurality of outdoor units and a plurality of indoor units is possible.",True,0.3063746988773346,0.7854068237352045,13,24,-11,57,155,-98
"[이하, 도 3을 참조하여, 도 1에 도시된 냉난방 멀티 공기조화기의 동작 및 이에 따른 냉매의 유동을 설명한다.]","Hereinafter, with reference to FIG. 3, an operation of the multi-air conditioner for heating/cooling operation shown in FIG. 1 and the flow of the refrigerant according to the operation will be described.",True,0.2294810712337494,0.8613780854606434,17,32,-15,64,204,-140
[도 3은 난방 운전 시 냉난방 멀티 공기조화기(100)의 동작 및 이에 따른 냉매의 유동을 나타낸다.,FIG. 3 shows operation of the multi-air conditioner for heating/cooling operation 100 and the flow of the refrigerant during the heating operation.,True,0.1822584271430969,0.8956440587202873,15,22,-7,57,147,-90
"압축기(53)에서 토출된 고압 기체의 냉매는, 토출배관(55)을 흐르다가 사방밸브(62)로 유입되어 고압기체배관(63)을 지나 실내기(B)로 유입된다.","The high-pressure gas refrigerant discharged from the compressor 53 flows through the discharge pipe 55, flows into the four-way valve 62, passes through the high-pressure gas pipe 63, and flows into the indoor unit B. The high-pressure gas refrigerant heats a room while being condensed in the indoor heat exchangers 11.",False,0.295943021774292,0.8661571975923289,13,51,-38,84,321,-237
"그 후, 응축된 냉매는 액관연결배관(72)을 통하여 배출되어 실외 전자팽창밸브(65, 67)에서 팽창된 후, 실외 열교환기(A1, A2)에서 증발된다.","Thereafter, the condensed refrigerant is discharged through the liquid pipe connection pipe 72, expanded in the outdoor electronic expansion valve 65, 67, and then evaporated in the outdoor heat exchanger A1,A2.",True,0.177934780716896,0.9101629808167055,16,31,-15,84,211,-127
"저온 저압 기체 냉매는 사방밸브(62)를 거쳐 흡입배관(64)으로 유입된 후, 어큐뮬레이터(52)를 거쳐 압축기(53)로 흡입된다.]","The low-temperature low-pressure gas refrigerant flows into the suction pipe 64 through the four-way valve 62, and then is sucked into the compressor 53 through the accumulator 52.",True,0.3012528419494629,0.852187791606708,13,28,-15,74,180,-106
"[한편, 냉방 운전의 경우, 도시하지 않았으나, 압축기(53)에서 토출된 고압 고온기체의 냉매는, 토출배관(55)을 흐르다가 사방밸브(62)를 거쳐, 제1 연결 배관(28)을 지나 실외기(A)의 제1 열교환기(A1)로 유입된다.","Meanwhile, in the case of cooling operation, although not shown, the refrigerant of the high-pressure high-temperature gas discharged from the compressor 53 flows through the discharge pipe 55, passes through the four-way valve 62, passes through the first connection pipe 28, and flows into the first heat exchanger A1 of the outdoor unit A. At this time, a variable pass valve 27 is opened so that the first heat exchanger A1 and the second heat exchanger A2 are connected in series with each other so that the refrigerant flowing through the first heat exchanger A1 performs heat exchange again in the second heat exchanger A2 and is further condensed.",False,0.3463911116123199,0.8428075857647587,23,109,-86,127,655,-528
"이때, 가변패스밸브(27)가 오픈되어 제1 열교환기(A1)와 제2 열교환기(A2)가 서로 직렬 연결되어 제1 열교환기(A1)를 흐르는 냉매가 제2 열교환기(A2)에서 다시 열교환을 수행하며 더욱 응축된다.","The condensed high-pressure liquid refrigerant flows into the indoor unit B through the supercooling unit 66, the refrigerant discharged through the liquid pipe connection pipe 72 is expanded in the indoor electronic expansion valve 12, and then is evaporated in indoor heat exchangers 11, flows into the outdoor unit A as a low-temperature low-pressure gas state, and then is sucked into the compressor 53 through the accumulator 52.",False,0.9711788296699524,0.5218712206421832,21,68,-47,114,434,-320
"인공 신경망을 이용한 추론을 위한 트레이닝 방법, 인공 신경망을 이용한 추론 방법, 및 추론 장치{TRAINING METHOD FOR INFERENCE USING ARTIFICIAL NEURAL NETWORK, INFERENCE METHOD USING ARTIFICIAL NEURAL NETWORK, AND INFERENCE APPARATUS THEREOF}",The following description relates to a method and apparatus with neural network training and inference.,True,0.5409936904907227,0.6197025904844796,32,15,17,200,103,97
"[아래의 실시예들은 인공 신경망을 이용한 추론을 위한 트레이닝 방법, 인공 신경망을 이용한 추론 방법, 및 추론 장치에 관한 것이다.]",A neural network-based method through training may be used in a field for high performance.,True,0.8411812782287598,0.4030234323813795,19,15,4,75,91,-16
"[높은 성능을 위해 다양한 분야에서 트레이닝을 통한 신경망 기반의 방법을 사용하는 것이 일반적이다. 하지만, 신경망 기반의 알고리즘 적용 시에 트레이닝의 범용성(generality)을 향상시키는 것은 중요한 문제이다.","However, it is important to enhance generality of training when a neural network-based algorithm is applied.",True,0.4014674425125122,0.7106786897439423,25,16,9,121,108,13
"특히, 입력 데이터(training data)에 과적합(overfitting)된 신경망 모델은 일반적인 통계치 트레이닝에 실패할 수 있다.","In particular, a neural network model overfitted to input data or training data may fail to learn general statistics.",True,0.2303360402584076,0.8494051339209194,13,19,-6,77,117,-40
"따라서, 제한된 입력 데이터로부터 범용성을 기대할 수 있는 트레이닝 방법이 요구된다. ]","Thus, the overfitted neural network may not enhance generality of training from limited input data.",True,0.5859283804893494,0.5990555383021493,12,15,-3,49,99,-50
"[전술한 배경기술은 발명자가 본원의 개시 내용을 도출하는 과정에서 보유하거나 습득한 것으로서, 반드시 본 출원 전에 일반 공중에 공개된 공지기술이라고 할 수는 없다.]","This Summary is not intended to identify key features or essential features of the claimed subject matter, nor is it intended to be used as an aid in determining the scope of the claimed subject matter.",False,0.7742640972137451,0.4587575491125921,22,36,-14,93,202,-109
"[일 실시예에 따르면, 인공 신경망을 이용한 추론 방법은 입력 데이터를 수신하는 단계; 및 상기 입력 데이터에 반응하여 상기 인공 신경망이 활성화(activation)되는 상태 정보에 기초하여, 상기 입력 데이터로부터 추론된 정보를 제공하는 단계를 포함하고, 상기 인공 신경망의 적어도 일부를 이용하여 상기 입력 데이터를 인코딩(encoding) 함으로써 생성되는 임베딩 벡터(embedding vector)는 상기 입력 데이터 내의 제1 부분 영역을 제1 정확도로 복원(reconstruction)하고, 상기 입력 데이터 내의 제2 부분 영역을 제2 정확도로 복원하는 정보를 포함하며, 상기 제1 부분 영역은 상기 추론된 정보 및 상기 임베딩 벡터 중 적어도 하나에 대응하여 적응적으로 결정된다. ]","In one general aspect, a processor-implemented method using a neural network (NN) includes: receiving input data; and determining information inferred from the input data based on state information about a state in which the NN is activated in response to the input data, wherein an embedding vector generated by encoding the input data using at least a portion of the NN comprises information used to reconstruct a first partial region of the input data with a first accuracy and to reconstruct a second partial region of the input data with a second accuracy, and wherein the first partial region is adaptively determined based on either one or both of the inferred information and the embedding vector.",True,0.1983507126569748,0.8914087807922997,87,116,-29,392,705,-313
"[상기 입력 데이터로부터 상기 추론된 정보를 제공하는 단계는 상기 상태 정보에 기초하여, 상기 입력 데이터에 포함된 픽셀 별로 픽셀 와이즈 정보(pixel-wise information)를 제공하는 단계; 상기 상태 정보에 기초하여, 상기 입력 데이터에서 검출된 영역을 검출 윈도우(detection window)의 형태로 제공하는 단계; 및 상기 상태 정보에 기초하여, 상기 입력 데이터로부터 분류된 클래스(class)를 제공하는 단계 중 어느 하나를 포함할 수 있다. ]",The determining of the inferred information may include any one of: determining pixel-wise information for each pixel included in the input data based on the state information; determining a region detected in the input data in a form of a detection window based on the state information; and determining a class classified from the input data based on the state information.,True,0.2820638120174408,0.8412678554493283,58,61,-3,265,375,-110
[상기 입력 데이터는 영상 데이터 및 음성 데이터 중 어느 하나를 포함할 수 있다. ],The input data may include either one of image data and voice data.,True,0.224807783961296,0.8558586054289918,15,13,2,48,67,-19
"[상기 입력 데이터가 영상 데이터인 경우, 상기 제1 부분 영역은 상기 영상 데이터 내 상기 추론된 정보에 대응하는 관심 공간 영역을 포함할 수 있다. ]","The input data may be image data, and the first partial region may include a region of interest (ROI) corresponding to the inferred information in the image data.",True,0.3065405786037445,0.8260701307731785,25,28,-3,86,162,-76
"[상기 입력 데이터가 음성 데이터인 경우, 상기 제1 부분 영역은 상기 음성 데이터 내 상기 추론된 정보에 대응하는 관심 시간 구간을 포함할 수 있다. ]","The input data may be voice data, and the first partial region may include a time interval of interest corresponding to the inferred information in the voice data.",True,0.2640195488929748,0.8435172572920202,25,28,-3,86,163,-77
"[상기 인공 신경망이 픽셀 와이즈 정보 또는 검출 윈도우를 추론하도록 설계된 경우, 상기 제1 부분 영역은 상기 추론된 정보에 대응하는 부분 영역으로 적응적으로 결정될 수 있다. ]","The NN may be configured to infer either one of pixel-wise information and a detection window, and the first partial region may be adaptively determined as a partial region corresponding to the inferred information.",True,0.342109739780426,0.8028886197016278,27,34,-7,101,215,-114
"[상기 인공 신경망이 클래스를 추론하도록 설계된 경우, 상기 제1 부분 영역은 상기 임베딩 벡터에 대응하는 부분 영역으로 적응적으로 결정될 수 있다. ]","The NN may be configured to infer a class, and the first partial region may be adaptively determined as a partial region corresponding to the embedding vector.",True,0.3269864022731781,0.804273169278172,22,27,-5,85,159,-74
[상기 제1 정확도는 상기 제2 정확도 보다 높은 값을 가질 수 있다. ],The first accuracy may be greater than the second accuracy.,True,0.2294394373893737,0.8416706334166303,13,10,3,41,59,-18
"[일 실시예에 따르면, 인공 신경망의 트레이닝 방법은 정답 레이블을 포함하는 트레이닝 데이터를 수신하는 단계; 상기 트레이닝 데이터를 인코딩함으로써 상기 트레이닝 데이터에 대응하는 임베딩 벡터를 추출하는 단계; 상기 인공 신경망의 추론 정보를 생성하는 제1 디코더를 이용하여 상기 임베딩 벡터를 디코딩하는 단계; 상기 트레이닝 데이터의 복원 정보를 생성하는 제2 디코더를 이용하여 상기 임베딩 벡터를 디코딩하는 단계; 상기 추론 정보와 상기 정답 레이블 간의 차이에 기초하여 제1 로스를 계산하는 단계; 상기 트레이닝 데이터 내, 상기 정답 레이블 및 상기 임베딩 벡터 중 적어도 하나에 대응하는 제1 부분 영역을 결정하는 단계; 상기 제1 부분 영역에 따른 상기 복원 정보와 상기 트레이닝 데이터 간의 차이에 기초하여 제2 로스를 계산하는 단계; 및 상기 제1 로스 및 상기 제2 로스에 기초하여 상기 인공 신경망을 트레이닝하는 단계를 포함한다. ]","In another general aspect, a processor-implemented method using a neural network (NN) includes: receiving training data and a true label corresponding to the training data; extracting an embedding vector corresponding to the training data by encoding the training data; generating inference information of the NN by decoding the embedding vector using a first decoder; generating reconstruction information of the training data by decoding the embedding vector using a second decoder; determining a first loss based on a difference between the inference information and the true label; determining a first partial region in the training data corresponding to either one or both of the true label and the embedding vector; determining a second loss based on a difference between the training data and the reconstruction information based on the first partial region; and training the NN based on the first loss and the second loss.",False,0.3259662687778473,0.8185444537465981,121,144,-23,476,930,-454
"[상기 인공 신경망을 트레이닝하는 단계는 상기 제1 로스 및 상기 제2 로스에 기초하여, 상기 제1 부분 영역을 제1 정확도로 복원하고, 상기 트레이닝 데이터 내의 제2 부분 영역을 제2 정확도로 복원하도록 상기 인공 신경망을 트레이닝하는 단계를 포함할 수 있다. ]","The training of the NN may include training the NN to reconstruct the first partial region with a first accuracy and to reconstruct a second partial region in the training data with a second accuracy, based on the first loss and the second loss.",True,0.444577693939209,0.7279958034924016,39,44,-5,149,245,-96
[상기 제1 정확도는 상기 제2 정확도 보다 높은 값을 가질 수 있다. ],The first accuracy may be greater than the second accuracy.,True,0.2294394373893737,0.8416706334166303,13,10,3,41,59,-18
"[상기 제1 부분 영역을 결정하는 단계는 상기 인공 신경망이 픽셀 와이즈 정보 또는 검출 윈도우를 추론하도록 상기 트레이닝 데이터 내, 상기 정답 레이블에 대응하는 부분 영역을 상기 제1 부분 영역을 결정하는 단계를 포함할 수 있다. ]","The determining of the first partial region may include determining, as the first partial region, a partial region in the training data corresponding to the true label so that the NN is trained to infer either one of pixel-wise information and a detection window.",True,0.3831877112388611,0.7872159738879778,36,44,-8,132,263,-131
[상기 제1 부분 영역을 결정하는 단계는 상기 인공 신경망이 클래스를 추론하도록 상기 임베딩 벡터에 대응하는 부분 영역을 상기 제1 부분 영역으로 결정하는 단계를 포함할 수 있다. ],"The determining of the first partial region may include determining, as the first partial region, a partial region corresponding to the embedding vector so that the NN is trained to infer a class.",True,0.3284903168678283,0.8098837005404058,27,33,-6,102,196,-94
"[상기 인공 신경망을 트레이닝하는 단계는 상기 제1 로스 및 상기 제2 로스에 기초하여, 상기 트레이닝 데이터에 포함된 픽셀 별로 픽셀 와이즈 정보(pixel-wise information)를 제공하도록 상기 인공 신경망을 트레이닝하는 단계를 포함할 수 있다. ]","The training of the NN may include training the NN to determine pixel-wise information for each pixel included in the training data, based on the first loss and the second loss.",True,0.4791587591171264,0.720295654834104,33,31,2,147,177,-30
"[상기 인공 신경망을 트레이닝하는 단계는 상기 제1 로스 및 상기 제2 로스에 기초하여, 상기 트레이닝 데이터에서 검출된 영역을 검출 윈도우 형태로 제공하도록 상기 인공 신경망을 트레이닝하는 단계를 포함할 수 있다. ]","The training of the NN may include training the NN to determine a region detected in the training data in a form of a detection window, based on the first loss and the second loss.",True,0.542191743850708,0.6725715424623979,31,35,-4,122,180,-58
"[상기 인공 신경망을 트레이닝하는 단계는 상기 제1 로스 및 상기 제2 로스에 기초하여, 상기 트레이닝 데이터로부터 분류된 클래스(class)를 제공하도록 상기 인공 신경망을 트레이닝하는 단계를 포함할 수 있다. ]","The training of the NN may include training the NN to determine a class classified from the training data, based on the first loss and the second loss.",True,0.5135968923568726,0.6859339834468872,28,28,0,120,151,-31
[상기 트레이닝 데이터는 영상 데이터 및 음성 데이터 중 어느 하나를 포함할 수 있다. ],The training data may include either one of image data and voice data.,True,0.2701197564601898,0.8287177504193783,15,13,2,50,70,-20
"[상기 트레이닝 데이터가 영상 데이터인 경우, 상기 제1 부분 영역은 상기 트레이닝 데이터 내에서 복원된 관심 공간 영역을 포함할 수 있다. ]","The determining of the first partial region may include determining the first partial region to comprise a region of interest (ROI) reconstructed in the training data, in response to the training data being image data.",True,0.4263680577278137,0.7578141582458904,22,35,-13,80,218,-138
"[상기 트레이닝 데이터가 음성 데이터인 경우, 상기 제1 부분 영역은 상기 트레이닝 데이터 내에서 복원된 관심 시간 구간을 포함할 수 있다. ]","The determining of the first partial region may include determining the first partial region to comprise a time interval of interest reconstructed in the training data, in response to the training data being voice data.",True,0.4414135217666626,0.7433507603722121,22,35,-13,80,219,-139
"[일 실시예에 따르면, 인공 신경망을 이용한 추론 장치는 입력 데이터를 수신하는 통신 인터페이스; 및 상기 입력 데이터에 반응하여 상기 인공 신경망이 활성화되는 상태 정보에 기초하여, 상기 입력 데이터로부터 추론된 정보를 제공하는 프로세서를 포함하고, 상기 인공 신경망의 적어도 일부를 이용하여 상기 입력 데이터를 인코딩 함으로써 생성되는 임베딩 벡터는 상기 입력 데이터 내의 제1 부분 영역을 제1 정확도로 복원하고, 상기 입력 데이터 내의 제2 부분 영역을 제2 정확도로 복원하는 정보를 포함하며, 상기 제1 부분 영역은 상기 추론된 정보 및 상기 임베딩 벡터 중 적어도 하나에 대응하여 적응적으로 결정된다. ]","In another general aspect, an apparatus using a neural network (NN) includes: a communication interface configured to receive input data; and a processor configured to determine information inferred from the input data based on state information about a state in which the NN is activated in response to the input data, wherein an embedding vector generated by encoding the input data using at least a portion of the NN may include information used to reconstruct a first partial region of the input data with a first accuracy and to reconstruct a second partial region of the input data with a second accuracy, and wherein the first partial region is adaptively determined based on either one or both of the inferred information and the embedding vector.",False,0.2211283892393112,0.8782264683135752,87,125,-38,344,755,-411
"[상기 프로세서는 상기 상태 정보에 기초하여, 상기 입력 데이터에 포함된 픽셀 별로 픽셀 와이즈 정보를 제공하거나, 상기 상태 정보에 기초하여, 상기 입력 데이터에서 검출된 영역을 검출 윈도우의 형태로 제공하거나, 또는 상기 상태 정보에 기초하여, 상기 입력 데이터로부터 분류된 클래스를 제공할 수 있다. ]","For the determining of the inferred information, the processor may be configured to: determine pixel-wise information for each pixel included in the input data based on the state information; determine a region detected in the input data in a form of a detection window based on the state information; or determine a class classified from the input data based on the state information.",True,0.3607348799705505,0.7929022958070261,43,63,-20,172,385,-213
[상기 입력 데이터는 영상 데이터 및 음성 데이터 중 어느 하나를 포함할 수 있다. ],The input data may include either one of image data and voice data.,True,0.224807783961296,0.8558586054289918,15,13,2,48,67,-19
"[상기 입력 데이터가 영상 데이터인 경우, 상기 제1 부분 영역은 상기 영상 데이터 내 상기 추론된 정보에 대응하는 관심 공간 영역을 포함할 수 있다. ]","The input data may be image data, and the first partial region may include a region of interest (ROI) corresponding to the inferred information in the image data.",True,0.3065405786037445,0.8260701307731785,25,28,-3,86,162,-76
"[상기 입력 데이터가 음성 데이터인 경우, 상기 제1 부분 영역은 상기 음성 데이터 내 상기 추론된 정보에 대응하는 관심 시간 구간을 포함할 수 있다. ]","The input data may be voice data, and the first partial region may include a time interval of interest corresponding to the inferred information in the voice data.",True,0.2640195488929748,0.8435172572920202,25,28,-3,86,163,-77
"[상기 인공 신경망이 픽셀 와이즈 정보 또는 검출 윈도우를 추론하도록 설계된 경우, 상기 제1 부분 영역은 상기 추론된 정보에 대응하는 부분 영역으로 적응적으로 결정될 수 있다. ]","The NN may be configured to infer either one of pixel-wise information and a detection window, and the first partial region may be adaptively determined as a partial region corresponding to the inferred information.",True,0.342109739780426,0.8028886197016278,27,34,-7,101,215,-114
"[상기 인공 신경망이 클래스를 추론하도록 설계된 경우, 상기 제1 부분 영역은 상기 임베딩 벡터에 대응하는 부분 영역으로 적응적으로 결정될 수 있다. ]","The NN may be configured to infer a class, and the first partial region may be adaptively determined as a partial region corresponding to the embedding vector.",True,0.3269864022731781,0.804273169278172,22,27,-5,85,159,-74
[상기 제1 정확도는 상기 제2 정확도 보다 높은 값을 가질 수 있다.],The first accuracy may be greater than the second accuracy.,True,0.2294394373893737,0.8416706334166303,12,10,2,40,59,-19
"[상기 추론 장치는 HUD(Head Up Display) 장치, 3D 디지털 정보 디스플레이(Digital Information Display, DID), 내비게이션 장치, 3D 모바일 기기, 및 스마트 차량 중 적어도 하나를 포함할 수 있다. ]","The inference apparatus may include any one or any combination of a head-up display (HUD), a three-dimensional (3D) digital information display (DID), a navigation apparatus, a 3D mobile apparatus, and a smart vehicle.",True,0.1670678704977035,0.8963394398017347,29,33,-4,138,218,-80
[도 1은 일 실시예에 따른 트레이닝 장치에서 범용성을 높이는 방법을 설명하기 위한 도면. 도 2는 일 실시예에 따른 추론 방법을 나타낸 흐름도. 도 3은 일 실시예에 따른 트레이닝 방법을 나타낸 흐름도. 도 4는 일 실시예에 따른 트레이닝 장치의 구성을 도시한 도면. 도 5는 도 4에 도시된 트레이닝 장치의 트레이닝 과정을 나타낸 흐름도. 도 6은 다른 실시예에 따른 트레이닝 장치의 구성을 도시한 도면. 도 7은 도 6에 도시된 트레이닝 장치의 트레이닝 과정을 나타내 흐름도. 도 8은 또 다른 실시예에 따른 트레이닝 장치의 구성을 도시한 도면. 도 9는 도 8에 도시된 트레이닝 장치의 트레이닝 과정을 나타낸 흐름도. 도 10은 일 실시예에 따른 추론 장치의 블록도.],FIG. 1 illustrates an example of a method of increasing generality in a training apparatus.,False,0.5845469236373901,0.6253332742353819,103,15,88,378,91,287
"[이하에서, 첨부된 도면을 참조하여 실시예들을 상세하게 설명한다.",FIG. 2 illustrates an example of an inference method.,False,0.7872973084449768,0.4501343456527752,7,9,-2,36,53,-17
"그러나, 실시예들에는 다양한 변경이 가해질 수 있어서 특허출원의 권리 범위가 이러한 실시예들에 의해 제한되거나 한정되는 것은 아니다.",FIG. 6 illustrates another example of a configuration of a training apparatus.,False,1.007049560546875,0.3168174541640677,17,12,5,74,78,-4
"실시예들에 대한 모든 변경, 균등물 내지 대체물이 권리 범위에 포함되는 것으로 이해되어야 한다.]",FIG. 8 illustrates another example of a configuration of a training apparatus.,False,1.0067745447158811,0.3166544706892806,13,12,1,54,78,-24
"[실시예에서 사용한 용어는 단지 설명을 목적으로 사용된 것으로, 한정하려는 의도로 해석되어서는 안된다.",FIG. 10 illustrates an example of an inference apparatus.,False,0.9405882954597472,0.3752684004322792,12,9,3,57,57,0
"단수의 표현은 문맥상 명백하게 다르게 뜻하지 않는 한, 복수의 표현을 포함한다.","Throughout the drawings and the detailed description, unless otherwise described or provided, the same drawing reference numerals will be understood to refer to the same elements, features, and structures.",False,0.8694922924041748,0.3821780033254759,11,29,-18,44,205,-161
"본 명세서에서, ""포함하다"" 또는 ""가지다"" 등의 용어는 명세서 상에 기재된 특징, 숫자, 단계, 동작, 구성요소, 부품 또는 이들을 조합한 것이 존재함을 지정하려는 것이지, 하나 또는 그 이상의 다른 특징들이나 숫자, 단계, 동작, 구성요소, 부품 또는 이들을 조합한 것들의 존재 또는 부가 가능성을 미리 배제하지 않는 것으로 이해되어야 한다.]","The drawings may not be to scale, and the relative size, proportions, and depiction of elements in the drawings may be exaggerated for clarity, illustration, and convenience.",False,0.8470354676246643,0.437454491871611,48,27,21,194,174,20
"[다르게 정의되지 않는 한, 기술적이거나 과학적인 용어를 포함해서 여기서 사용되는 모든 용어들은 실시예가 속하는 기술 분야에서 통상의 지식을 가진 자에 의해 일반적으로 이해되는 것과 동일한 의미를 가지고 있다.","The following detailed description is provided to assist the reader in gaining a comprehensive understanding of the methods, apparatuses, and/or systems described herein.",False,0.7829217910766602,0.5040551145271672,28,23,5,117,170,-53
"일반적으로 사용되는 사전에 정의되어 있는 것과 같은 용어들은 관련 기술의 문맥 상 가지는 의미와 일치하는 의미를 가지는 것으로 해석되어야 하며, 본 출원에서 명백하게 정의하지 않는 한, 이상적이거나 과도하게 형식적인 의미로 해석되지 않는다.]","However, various changes, modifications, and equivalents of the methods, apparatuses, and/or systems described herein will be apparent after an understanding of the disclosure of this application.",False,0.7785463333129883,0.5044328140343363,32,26,6,135,196,-61
"[또한, 첨부 도면을 참조하여 설명함에 있어, 도면 부호에 관계없이 동일한 구성 요소는 동일한 참조부호를 부여하고 이에 대한 중복되는 설명은 생략하기로 한다.","For example, the sequences of operations described herein are merely examples, and are not limited to those set forth herein, but may be changed as will be apparent after an understanding of the disclosure of this application, with the exception of operations necessarily occurring in a certain order.",False,0.9030088186264038,0.4300700708440356,21,48,-27,88,301,-213
실시예를 설명함에 있어서 관련된 공지 기술에 대한 구체적인 설명이 실시예의 요지를 불필요하게 흐릴 수 있다고 판단되는 경우 그 상세한 설명을 생략한다.],"Also, descriptions of features that are known in the art, after an understanding of the disclosure of this application, may be omitted for increased clarity and conciseness.",False,0.6794822216033936,0.5401309488321654,21,27,-6,85,173,-88
"[또한, 실시 예의 구성 요소를 설명하는 데 있어서, 제 1, 제 2, A, B, (a), (b) 등의 용어를 사용할 수 있다.","The features described herein may be embodied in different forms, and are not to be construed as being limited to the examples described herein.",False,0.8500393629074097,0.445698399759962,21,24,-3,71,144,-73
"이러한 용어는 그 구성 요소를 다른 구성 요소와 구별하기 위한 것일 뿐, 그 용어에 의해 해당 구성 요소의 본질이나 차례 또는 순서 등이 한정되지 않는다.","Rather, the examples described herein have been provided merely to illustrate some of the many possible ways of implementing the methods, apparatuses, and/or systems described herein that will be apparent after an understanding of the disclosure of this application.",False,0.7934564352035522,0.4957591043081754,25,39,-14,86,266,-180
"어떤 구성 요소가 다른 구성요소에 ""연결"", ""결합"" 또는 ""접속""된다고 기재된 경우, 그 구성 요소는 그 다른 구성요소에 직접적으로 연결되거나 접속될 수 있지만, 각 구성 요소 사이에 또 다른 구성 요소가 ""연결"", ""결합"" 또는 ""접속""될 수도 있다고 이해되어야 할 것이다. ]",Various modifications may be made to the examples.,False,0.98279470205307,0.3141659439796306,40,8,32,157,50,107
"[어느 하나의 실시 예에 포함된 구성요소와, 공통적인 기능을 포함하는 구성요소는, 다른 실시 예에서 동일한 명칭을 사용하여 설명하기로 한다.",The terminology used herein is for the purpose of describing particular examples only and is not to be limiting of the present disclosure.,False,0.8587896823883057,0.4386206448411128,18,23,-5,78,138,-60
"반대되는 기재가 없는 이상, 어느 하나의 실시 예에 기재한 설명은 다른 실시 예에도 적용될 수 있으며, 중복되는 범위에서 구체적인 설명은 생략하기로 한다.. ]","As used herein, the singular forms ""a"", ""an"", and ""the"" are intended to include the plural forms as well, unless the context clearly indicates otherwise.",False,0.7361931204795837,0.5090330413224736,23,25,-2,89,153,-64
[도 1은 일 실시예에 따른 트레이닝 장치에서 범용성을 높이는 방법을 설명하기 위한 도면이다.,"As used herein, the term ""and/or"" includes any one and any combination of any two or more of the associated listed items.",False,1.0317541360855105,0.3367371748320298,13,22,-9,52,121,-69
"도 1을 참조하면, 일 실시예에 따른 인공 신경망을 이용한 추론을 위한 트레이닝 장치(100)의 구성의 일 예시가 도시된다. ]","It will be further understood that the terms ""comprises/comprising"" and/or ""includes/including"" when used herein, specify the presence of stated features, integers, steps, operations, elements, and/or components, but do not preclude the presence or addition of one or more other features, integers, steps, operations, elements, components and/or groups thereof.",False,1.1619479656219482,0.2753016607032232,18,48,-30,71,361,-290
"[일 실시예에 따른 트레이닝 장치(100)는 예를 들어, 인코더(Encoder; E)(110)를 통해 특징(Feature)(또는 코드(Code))를 생성하고, 제1 디코더(Decoder)(D, Sub[attributes={}; value=[1]], )(120)를 통해 인코딩된 특징에 대한 추론을 수행하도록 구성된 신경망(130)에 적응적 오토 인코딩을 위한 제2 디코더(D, Sub[attributes={}; value=[2]], )(140)를 더 포함하는 형태로 구성될 수 있다.]","The use of the term ""may"" herein with respect to an example or embodiment (for example, as to what an example or embodiment may include or implement) means that at least one example or embodiment exists where such a feature is included or implemented, while all examples are not limited thereto.",False,0.9451407194137572,0.4477791010434875,41,51,-10,271,295,-24
[인코더(E)(110)는 트레이닝 데이터(X)에 대응하는 특징 벡터(feature vector) 또는 코드(code)를 생성할 수 있다.,"Unless otherwise defined, all terms including technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure pertains consistent with and after an understanding of the present disclosure.",False,1.1068381071090698,0.3011072009728784,12,42,-30,76,273,-197
"제1 디코더(D, Sub[attributes={}; value=[1]], )(120)는 인코더(E)(110)에 의해 생성된 특징 벡터 또는 코드를 디코딩 함으로써 트레이닝 데이터의 레이블을 추론할 수 있다.","When describing the examples with reference to the accompanying drawings, like reference numerals refer to like constituent elements and a repeated description related thereto will be omitted.",False,1.0365623235702517,0.3252472016621609,20,27,-7,115,192,-77
"[도 5는 도 5a 내지 5c를 포함하며, 일 실시예에 따른 반도체 모듈(80)의 투시도, 단면도 및 부분적으로 투명한 평면도이다.]","Figure 5, which includes figures 5A to 5C illustrates a perspective view, a side view and a partially transparent plan view of a semiconductor module 80 according to an embodiment.",True,0.2414164245128631,0.8440053615739359,18,30,-12,74,180,-106
"[반도체 모듈(90)은 횡방향으로 서로 인접하게 배열된 로우측 스위치(11), 하이측 스위치(12) 및 제어 칩(13)과, 하이측 스위치(12)와 로우측 스위치(11) 사이에서 연장되는 스위치 노드 커넥터(14)를 포함한다.]","The semiconductor module 90 includes a low side switch 11, a high side switch 12 and a control chip 13 arranged laterally adjacent to one another and a switch node connector 14 which extends between the high side switch 12 and the low side switch 11.",True,0.2096492946147918,0.8921048475433934,23,46,-23,126,250,-124
"[일부 실시예에서, 2개 이상의 브랜치를 갖는 스위치 노드 커넥터(14)를 포함하는 반도체 모듈은 로우측 스위치(11), 하이측 스위치(12) 및 제어 칩(13)을 패키징하기 위한 임베딩 기법을 사용하여 제조된다.","In some embodiments, the semiconductor module including a switch node connector 14 with two or more branches is fabricated using embedding techniques for packaging the low side switch 11, the high side switch 12 and the control chip 13.",True,0.1620019525289535,0.9115205734412376,25,39,-14,119,236,-117
"그러나, 반도체 모듈은 또한 리드프레임 기반 기법과 같은 다른 패키징 기법을 사용하여 제작될 수도 있다.]","However, the semiconductor module may also be fabricated using other packaging techniques such as leadframe-based techniques.",True,0.1883669346570968,0.870314895654887,15,16,-1,59,125,-66
"[도 5에 도시된 반도체 모듈(90)은 리드프레임(97) 설계를 기반으로 하며, 리드프레임(97)의 일부는 V, Sub[attributes={}; value=[high]], 패드(54), V, Sub[attributes={}; value=[low]], 패드(56), 스위치 노드 패드(61) 및 하나 이상의 로직 패드(63)를 제공한다.","The semiconductor module 90 illustrated in figure 5 is based on a leadframe 97 design, whereby portions of the leadframe 97 provide the Vhigh pad 54, the Vlow pad 56, the switch node pad 61 and one or more logic pads 63.",False,0.2575635015964508,0.8555505036603608,28,42,-14,188,220,-32
"로우측 스위치(11)의 소스는, 예를 들어 솔더 또는 전기 전도성 접착제를 사용하여, V, Sub[attributes={}; value=[low]], 패드(56) 상에 실장되어 전기 접속되고, 하이측 스위치(12)의 드레인은 V, Sub[attributes={}; value=[high]], 패드(54) 상에 실장되어 전기 접속된다.","The source of the low side switch 11 is mounted on and electrically connected to the Vlow pad 56 and the drain of the high side switch 12 is mounted on and electrically connected to the Vhigh pad 54, for example using solder or electrically conductive adhesive.",False,0.2660169303417206,0.8473166206496929,30,47,-17,186,261,-75
"제어 스위치(13)는, 모듈의 외부 패드를 제공하거나 모듈 내에 위치할 수 있는 다이 패드에 실장된다.]",The control switch 13 is mounted on a die pad which may provide an outer pad of the module or may be positioned within the module.,True,0.1631998419761657,0.9054267999722228,14,26,-12,58,130,-72
"[이 실시예에서, 반도체 모듈(90)은 접촉 클립(91)에 의해 제공되는 스위치 노드 커넥터(14)를 포함한다.","In this embodiment, the semiconductor module 90 includes a switch node connector 14 that is provided by a contact clip 91.",True,0.1611180007457733,0.9124059617618884,12,21,-9,62,122,-60
"접촉 클립(91)은 금속 또는 합금, 통상적으로는 구리 또는 구리 기반 합금으로 형성된 독립 부재로 형성된다.","The contact clip 91 is formed of freestanding member formed from a metal or alloy, typically copper or copper-based alloy.",True,0.1335894912481308,0.9183842160046822,15,20,-5,61,122,-61
"접촉 클립(91) 형태의 스위치 노드 커넥터(14)는, 모듈(90)에 실장될 때 개구(92)가 제어 칩(13) 위에 적어도 부분적으로 위치하도록 배치된 개구(92)를 포함하고, 하이측 스위치(12)와 로우측 스위치(11) 사이에서 연장되는 2개의 브랜치(15, 16)를 제공한다.","The switch node connector 14 in the form of the contact clip 91 includes an aperture 92 which is positioned so that when mounted in the module 90 the aperture 92 is at least partially positioned above the control chip 13 and provides two branches 15, 16 which extend between the high side switch 12 and the low side switch 11.",True,0.1810232698917389,0.9102110226171102,29,61,-32,156,326,-170
"제1 브랜치(15)는 하이측 스위치(12)와 로우측 스위치(11)의 측면들(26, 26') 사이에서 직접 연장되고, 제2 브랜치(16)는 모듈(90)의 대각으로 반대측 코너에 배열된 대향 측면들(27, 27') 사이의 개구(92)의 대향면 상의 개구(92) 주위로 연장된다.]","A first branch 15 extends directly between the side faces 26, 26' of the high side switch 12 and the low side switch 11 and a second branch 16 extends around the aperture 92 on the opposing sides of the aperture 92 between the opposing side faces 27, 27' that are arranged in diagonally opposing corners of the module 90.",True,0.1666387170553207,0.9147280155883948,28,60,-32,154,321,-167
"[이 실시예에서, 제어 칩(13)에 대한 접속부(93)는 스위치 노드 커넥터(14)의 개구 내에 위치한다.","In this embodiment, the connections 93 to the control chip 13 are positioned within the aperture of the switch node connector 14.",True,0.1595555245876316,0.9124164386487243,12,22,-10,59,129,-70
"전도성 클립(91)은 또한 연장부(94)를 포함하는데, 이 연장부의 반대편은 제2 브랜치(16)의 일부분이 반도체 모듈(90)의 다른 구성요소 위에 위치할 수 있도록, 돌출된 레그를 갖는다.",The conductive clip 91 also includes an extension 94 that its opposing side which has a raised leg such that the portion of the second branch 16 may be positioned above other components of the semiconductor module 90.,True,0.1880044639110565,0.9026575971438292,22,38,-16,106,217,-111
"일부 실시예에서, 스위치 노드 커넥터(14)는 스위치 노드 패드에 접속된다.","In some embodiments, the switch node connector 14 is connected to a switch node pad.",True,0.1051123812794685,0.94103338324762,9,15,-6,42,84,-42
"일부 실시예에서, 모듈(90)은 또한 스위치 노드 커넥터(14)와 V, Sub[attributes={}; value=[out]], 패드 사이에 결합되는 출력 인덕터를 포함한다.]","In some embodiments, the module 90 also includes an output inductor that is coupled between the switch node connector 14 and a Vout pad.",False,0.204761803150177,0.8853187523209528,16,24,-8,99,136,-37
"[반도체 모듈(90)은 도 5에 도시되지 않은 출력 인덕터가 실장될 수 있는 패드(95, 96)를 더 포함한다.","The semiconductor module 90 further includes pads 95, 96 onto which the output inductor, not illustrated in figure 5, can be mounted.",True,0.133790373802185,0.9214150221077598,15,22,-7,62,133,-71
패드(95)는 스위치 노드 커넥터(14)를 제공하는 접촉 클립(91)의 상부면 상에 위치하고 연장부(94) 상에 위치한다.,The pad 95 is positioned on the upper surface of the contact clip 91 providing the switch node connector 14 and is positioned on the extension 94.,True,0.1396293044090271,0.9253201432656404,13,27,-14,68,146,-78
패드(96)는 로우측 스위치(11)의 바깥쪽을 향한 긴 측면에 인접하게 배열된 받침대(99) 상에 위치한다.,The pad 96 is positioned on a pedestal 99 arranged adjacent the outwardly facing long side of the low side switch 11.,True,0.1777626723051071,0.8945161514560784,12,22,-10,60,117,-57
"받침대(99)는 V, Sub[attributes={}; value=[out]], 패드(98) 상에 배열된다.",The pedestal 99 is arranged on the Vout pad 98.,False,0.449479877948761,0.6852892721368565,7,10,-3,60,47,13
"실장 위치에서, 출력 인덕터의 한 단부는 스위치 노드 커넥터(14) 상의 패드(95)에 접속되고 다른 단부는 V, Sub[attributes={}; value=[out]], 패드(98)에 접속된다.","In the mounted position, one end of the output inductor is connected to the pad 95 on the switch node connector 14 and the other end is connected to the Vout pad 98.",False,0.2479042410850525,0.8660944642774409,19,33,-14,110,165,-55
"V, Sub[attributes={}; value=[out]], 패드(98)는 반도체 모듈(90)로부터 전력을 수신하는 부하에 접속될 수 있다.",The Vout pad 98 may in turn be connected to a load which receives power from the semiconductor module 90.,False,0.3027759194374084,0.8066303260407679,12,20,-8,80,105,-25
"받침대(99) 및 연장부(94)는 출력 인덕터가 하이측 스위치(12), 로우측 스위치(11) 및 제어 칩(11) 위체 실장될 수 있게 한다.]","The pedestal 99 and extension 94 enable the output inductor to be mounted above the high side switch 12, the low side switch 11 and the control chip 11.",True,0.1643886566162109,0.90817776352092,17,29,-12,79,152,-73
[도 6은 일 실시예에 따른 반도체 모듈(100)의 투시도이다.,Figure 6 illustrates a perspective view of a semiconductor module 100 according to an embodiment.,True,0.2746387422084808,0.8096075549917526,8,15,-7,35,97,-62
"반도체 모듈(100)은 도 1 및 2에 도시된 것과 유사한 로우측 스위치(11), 하이측 스위치(12) 및 제어 칩(13)의 배열을 갖는다.","The semiconductor module 100 has an arrangement of the low side switch 11, high side switch 12 and control chip 13 that is similar to that illustrated in figures 1 and 2.",True,0.1817614436149597,0.896579014523049,18,32,-14,78,170,-92
"이 실시예에서, 스위치 노드 커넥터(14)는, 별도의 개별 요소에 의해 제공되며 두 개의 서로 다른 층으로 연장되는 2개의 브랜치(15, 16)를 구비한다.","In this embodiment, the switch node connector 14 has two branches 15, 16 that are provided by separate discrete elements and that extend in two different layers.",True,0.1541050523519516,0.9185856143044128,20,27,-7,87,161,-74
이들 층은 리드프레임(97)의 주 표면으로부터 상이한 수직 거리에 배열된다.,These layers are arranged at different vertical distances from the major surface of the leadframe 97.,True,0.1614677309989929,0.8878685426863661,9,16,-7,42,101,-59
"각각의 브랜치(15, 16)는, 예를 들어, 전도성 층 또는 금속 포일에 의해 제공될 수 있다.]","Each of the branches 15, 16 may be, for example, provided by a conductive layer or metal foil.",True,0.197853609919548,0.8754885306817446,14,18,-4,54,94,-40
[제1 브랜치(15)는 L자 형태를 가지며 2개의 층 중 아래에 위치한다.,The first branch 15 has a L-form and is positioned in the lower of the two layers.,True,0.22483791410923,0.8535153840276114,10,17,-7,41,82,-41
"제1 브랜치(15)는 제1 말단부(distal end)에서 하이측 칩(12)의 소스 상에 위치하여 전기접속되고, 제2 말단부에서 로우측 스위치의 드레인에 전기적으로 접속된다.",The first branch 15 is positioned on and electrically connected to the source of the high side chip 12 at a first distal end and to the drain of the low side switch at a second distal end.,True,0.1614503860473632,0.9118049896877576,18,38,-20,97,188,-91
"제2 브랜치(16)는 또한 L 형상을 갖고 제1 브랜치(15)에 대해 횡방향으로 위치하여, 제어 칩(13) 위에 적어도 부분적으로 위치하는 2개의 L 형상 사이에 개구(25)가 형성된다.",The second branch 16 also has a L shape and is laterally positioned with respect to the first branch 15 such that an aperture 25 is formed between the two L-shapes that is positioned at least partly above the control chip 13.,True,0.1640006154775619,0.91402574092973,23,42,-19,104,225,-121
제 2 브랜치(16)는 제 1 브랜치(15) 위에 위치한다.,The second branch 16 is positioned on and above the first branch 15.,True,0.20424185693264,0.8824119499389707,8,13,-5,33,68,-35
"제 2 브랜치(16)의 제 1 말단부는 하이측 스위치(12) 위의 제 1 브랜치(15) 상에 위치하고, 제 2 브랜치(16)의 제 2 말단부는 로우측 스위치(11) 위의 제1 브랜치(15) 상에 위치한다.]",A first distal end of the second branch 16 is positioned on the first branch 15 above the high side switch 12 and a second distal end of the second branch 16 is positioned on the first branch 15 above the low side switch 11.,True,0.1547063738107681,0.91976729062813,27,45,-18,115,224,-109
"[따라서, 제2 브랜치(16)는 제1 브랜치(15) 위에 위치하여, 제1 브랜치(15)가 스위치와 제2 브랜치(16) 사이에 위치하도록 스택을 형성한다.",The second branch 16 is therefore positioned above the first branch 15 to form a stack so that the first branch 15 is positioned between the switches and the second branch 16.,True,0.169260486960411,0.9119520480771454,16,32,-16,85,175,-90
"다른 실시예에서 브랜치(15, 16)의 수직 배열은 역전되어 제2 브랜치(16)가 스위치와 제1 브랜치(15) 사이에 배열될 수도 있다.","In other embodiments, the vertical arrangement of the branches 15, 16 may be reversed so that the second branch 16 is arranged between the switches and the first branch 15.",True,0.1865915805101394,0.9023988322407166,16,30,-14,76,172,-96
스위치 노드 커넥터(14)의 브랜치(15 및 6) 모두는 제어 칩(13)의 동일한 쪽에 배열되지만 제어 칩(13)의 수직 위 상이한 평면에 있다.,Both of the branches 15 and 6 of the switch node connector 14 are arranged on the same side of the control chip 13 but in different planes vertically above the control chip 13.,True,0.1421493738889694,0.9244893286134062,19,34,-15,81,176,-95
"도시되지 않은 다른 실시예에서, 2개의 브랜치(15, 16)는 제어 칩(13)의 반대편, 즉, 제어 칩(13)의 위아래에 위치하는 평면에 배열될 수 있다.]","In other non-illustrated embodiments, the two branches 15, 16 may be arranged in planes that are positioned on opposing sides of, i.e. above and below, the control chip 13.",True,0.2000785917043686,0.8927244960952235,19,29,-10,87,172,-85
"[2개의 브랜치(15, 16)는 2개의 층 사이에서 수직으로 연장되는 전도성 접속부(101, 102)에 의해 접속된다.","The two branches 15, 16 are connected by conductive connections 101, 102 that extend vertically between the two layers.",True,0.1773129850625991,0.8968446329455928,13,19,-6,66,119,-53
"전도성 접속부(101, 102)는, 예를 들면 솔더 또는 하나 이상의 전도성 비아에 의해 형성될 수 있다.","The conductive connections 101, 102 may be formed by solder or one or more conductive vias, for example.",True,0.1485255360603332,0.9116620012987362,15,18,-3,59,104,-45
"리드프레임 기반 패키징 기술을 사용하여 제조된 반도체 모듈에 솔더 접속이 사용될 수 있고, 임베딩 패키징 기술을 사용하여 제조된 반도체 모듈에 전도성 비아가 사용될 수 있다.",A solder connection may be used for semiconductor modules fabricated using leadframe-based packaging techniques and a conductive via may be used for semiconductor modules fabricated using embedding packaging techniques.,True,0.2090719640254974,0.8659958711366135,25,29,-4,97,219,-122
"L자형 제2 브랜치(16)의 암은 L자형 제1 브랜치(17)의 암보다 폭이 작아서, 제2 브랜치(16)는 제2 전류 전달 경로(17')를 제공하고 제1 브랜치(15)는 스위치 노드 커넥터(14) 내에 1차 전류 전달 경로(17)를 제공한다.]",The arms of the L-shaped second branch 16 have a smaller width than the arms of the L-shaped first branch 17 so that the second branch 16 provides a second current carrying path 17' and the first branch 15 provides the primary current carrying path 17 within the switch node connector 14.,True,0.157507985830307,0.9129569963332006,28,52,-24,135,288,-153
"[""하"", ""아래"", ""하부"", ""위"", ""상부"" 등과 같이 공간과 관련된 용어는, 다른 요소에 대한 한 요소의 위치를 설명하기 쉽게 하기 위해 사용된다.","Spatially relative terms such as ""under"", ""below"", ""lower"", ""over"", ""upper"" and the like are used for ease of description to explain the positioning of one element relative to a second element.",True,0.201507031917572,0.8677773221457785,21,31,-10,86,193,-107
이들 용어는 도면에 도시된 것과 다른 방향들 외에 장치의 다른 방향들을 포함하도록 의도된다.,These terms are intended to encompass different orientations of the device in addition to different orientations than those depicted in the figures.,True,0.1802418231964111,0.8753513426749479,13,22,-9,51,148,-97
"또한, ""제1"", ""제2"" 등과 같은 용어는 다양한 요소, 영역, 섹션 등을 설명하기 위해 사용되며 또한 제한하고자 하는 것은 아니다.","Further, terms such as ""first"", ""second"", and the like, are also used to describe various elements, regions, sections, etc. and are also not intended to be limiting.",True,0.1220036074519157,0.9208979332525608,19,27,-8,75,165,-90
유사한 용어들은 설명 전체에서 유사한 요소를 나타낸다.],Like terms refer to like elements throughout the description.,True,0.2193764597177505,0.8293272096157785,7,9,-2,31,61,-30
"[본 명세서에서 사용된 바와 같이, ""갖는"", ""구비하는"", ""포함하는"" 등의 용어는 언급된 요소 또는 특징의 존재를 나타내지만 추가 요소 또는 특징을 배제하지 않는 개방 종결형 용어(open ended terms)이다.","As used herein, the terms ""having"", ""containing"", ""including"", ""comprising"" and the like are open ended terms that indicate the presence of stated elements or features, but do not preclude additional elements or features.",True,0.143559381365776,0.9075420307317076,27,33,-6,123,221,-98
"단수형 용어는 문맥에서 명확하게 달리 지시하지 않는 한, 복수형을 포함하고자 한다.","The articles ""a"", ""an"" and ""the"" are intended to include the plural as well as the singular, unless the context clearly indicates otherwise.",True,0.4944998025894165,0.6116579632064559,11,23,-12,46,140,-94
본 명세서에 설명된 다양한 실시예의 특징들은 특별히 달리 언급하지 않는 한 서로 결합될 수 있음을 이해해야 한다.],"It is to be understood that the features of the various embodiments described herein may be combined with each other, unless specifically noted otherwise.",True,0.1228840947151184,0.9149033007252926,17,24,-7,64,154,-90
"[본 명세서에서 특정 실시예가 예시되고 설명되었지만, 당업자는 다양한 다른 및/또는 등가의 구현이 본 발명의 범위를 벗어나지 않으면서 도시되고 설명된 특정 실시예에 대해 대체될 수 있다는 것을 이해할 수 있을 것이다.","Although specific embodiments have been illustrated and described herein, it will be appreciated by those of ordinary skill in the art that a variety of alternate and/or equivalent implementations may be substituted for the specific embodiments shown and described without departing from the scope of the present invention.",True,0.1832659095525741,0.8823968061450096,30,48,-18,121,323,-202
본 출원은 본 명세서에서 논의된 특정 실시예의 임의의 수정 또는 변형을 포함하고자 한다.,This application is intended to cover any adaptations or variations of the specific embodiments discussed herein.,True,0.1805091053247451,0.8761468766518202,13,16,-3,49,113,-64
"따라서, 본 발명은 청구범위 및 그 균등물에 의해서만 제한하고자 한다.]","Therefore, it is intended that this invention be limited only by the claims and the equivalents thereof.",True,0.1912760138511657,0.8499628928422723,10,17,-7,40,104,-64
"본 발명의 조성물을 의약외품 조성물로 사용하는 경우, 사이클로-히스프로 또는 이의 염 및 부갑상선 호르몬을 그대로 첨가하거나 다른 의약외품 성분과 함께 통상적인 방법에 따라 적절하게 사용될 수 있다.","As the sweeteners, natural sweeteners such as thaumatin and stevia extract, and synthetic sweeteners such as saccharin and aspartame may be used.",False,0.7216287255287173,0.5195191695092329,27,22,5,111,145,-34
"유효성분의 혼합량은 사용 목적(예방, 건강 또는 치료적 처치)에 따라 적합하게 결정될 수 있다.","The proportion of the natural carbohydrate may be generally about 0.01 to 0.04 g, and preferably, about 0.02 to 0.03 g per 100 mL of the composition of the present invention.",False,0.9555845260620116,0.3633376218092654,13,31,-18,53,174,-121
본 발명의 의약외품 조성물 및 의약외품에 대하여 본 발명의 약학적 조성물 및 건강기능식품 조성물의 내용이 준용될 수 있다.,"The CHP or a salt thereof and PTH may be contained as an active ingredient of a food composition for preventing or improving a bone loss-related disease, and the amount thereof is an amount effective to obtain the preventive or improving effect, and is preferably, for example, 0.01 to 100 wt% with respect to the total weight of the entire composition, but the present invention is not particularly limited thereto.",False,0.7386990189552307,0.5343431131316563,18,70,-52,68,416,-348
"본 발명의 건강기능식품 조성물에 있어서, ""식품학적으로 허용가능한 염""은 본 발명의 식품학적으로 허용가능한 염은 식품학적으로 허용가능한 유리산(free acid)에 의해 형성되는 산부가염 또는 염기에 의해 형성되는 금속염이 유용하다.",The food composition of the present invention may be prepared by mixing the CHP or a salt thereof and PTH with another active ingredient known to have an effect of preventing or improving a bone loss-related disease.,False,0.6669467091560364,0.5704096642987256,26,37,-11,130,216,-86
"무기산으로는 염산, 황산, 브롬산, 아황산 또는 인산 등을 사용할 수 있고, 유기산으로는 구연산, 초산, 말레인산, 푸마산, 글루콘산, 메탄술폰산 등을 사용할 수 있다.","In addition, the health functional food of the present invention may contain various nutrients, vitamins, electrolytes, flavoring agents, pectic acid and a salt thereof, alginic acid and a salt thereof, organic acids, protective colloidal thickening agents, pH adjustors, stabilizers, preservatives, glycerin, alcohols, or carbonizing agents.",False,0.6515704989433289,0.5565845841915701,22,45,-23,94,342,-248
"또한, 금속염으로는 알칼리 금속염 또는 알칼리 토금속염, 나트륨, 칼륨 또는 칼슘염을 사용할 수 있다.","Other than these, the composition of the present invention may contain fruit pulp for producing natural fruit juices, fruit drinks and vegetable drinks.",False,0.8005518913269043,0.44581857895967,14,23,-9,57,152,-95
그러나 반드시 이로 제한되지는 않는다.,These ingredients may be used independently or in combination.,False,0.9697842001914978,0.2829654525243657,5,9,-4,21,62,-41
"본 발명에서, 용어 “건강기능식품”은 “기능성 식품”및 “건강 식품”의 의미를 모두 포함한다.","The proportion of such an additive, while not particularly important, is generally selected from 0.01 to 0.1 parts by weight per 100 parts by weight of the composition of the present invention.",False,0.8165493607521057,0.4588479004756992,11,32,-21,52,193,-141
"본 발명에서, 용어 “기능성 식품(functional food)”은 특정보건용 식품(food for special health use, FoSHU)와 동일한 용어로, 영양 공급 외에도 생체조절기능이 효율적으로 나타나도록 가공된 의학, 의료효과가 높은 식품을 의미한다.","The present invention also provides a method of preventing or treating a bone loss-related disease, which includes administering an effective amount of a composition including CHP or a pharmaceutically acceptable salt thereof and PTH to a subject in need thereof.",False,0.7830107808113098,0.4827637361230226,27,40,-13,149,263,-114
"본 발명에서 용어, “건강 식품(health food)”은 일반식품에 비해 적극적인 건강유지나 증진 효과를 가지는 식품을 의미하고, 건강보조식품(health supplement food)는 건강 보조 목적의 식품을 의미한다.","The present invention also provides a method of improving a therapeutic effect of PTH on a bone loss-related disease, which includes administering CHP or a pharmaceutically acceptable salt thereof and PTH into a subject in need thereof.",False,0.7595033049583435,0.4987544529026061,23,37,-14,125,236,-111
"상기 식품은 골 손실 질환의 개선 또는 회복에 유용한 효과를 얻기 위하여 정제, 캅셀, 분말, 과립, 액상, 환 등의 다양한 형태로 제조될 수 있다.","The term ""subject"" used herein includes any kinds of animals (e.g., humans, horses, pigs, rabbits, dogs, sheep, goats, non-human primates, cattle, cats, guinea pigs and rodents), but the present invention is not limited thereto.",False,0.9106642603874208,0.362769198571116,24,34,-10,83,228,-145
"이러한 기능성 식품의 구체적인 예로, 상기 조성물을 이용하여 농산물, 축산물 또는 수산물의 특성을 살려 변형시키는 동시에 저장성을 좋게 한 가공식품을 제조할 수 있다.",This term does not infer a specific age or gender.,False,1.0091465711593628,0.2516306901563039,23,10,13,93,50,43
"본 발명의 건강기능식품 조성물은 또한, 영양 보조제 (nutritional supplement), 식품 첨가제 (food additives) 및 사료 등의 형태로 제조될 수 있으며, 인간 또는 가축을 비록한 동물을 취식 대상으로 한다.","Thus, the subject is intended to include an adult, a neonatal subject regardless of a female or male, as well as a fetus.",False,0.802647590637207,0.4125623985506907,28,23,5,131,121,10
상기 유형의 식품 조성물은 당업계에 공지된 통상적인 방법에 따라 다양한 형태로 제조할 수 있다.,A patient refers to a subject with a disease or disorder.,False,1.052621364593506,0.2010452068822202,14,11,3,53,57,-4
"일반 식품으로는 이에 한정되지 않지만 음료(알콜성 음료 포함), 과실 및 그의 가공식품(예: 과일통조림, 병조림, 잼, 마아말레이드 등), 어류, 육류 및 그 가공식품(예: 햄, 소시지 콘비이프 등), 빵류 및 면류(예: 우동, 메밀국수, 라면, 스파게이트, 마카로니 등), 과즙, 각종 드링크, 쿠키, 엿, 유제품(예: 버터, 치이즈 등), 식용식물 유지, 마아가린, 식물성 단백질, 레토르트 식품, 냉동식품, 각종 조미료(예: 된장, 간장, 소스 등) 등에 사이클로-히스프로 또는 이의 염 및 부갑상선 호르몬을 첨가하여 제조할 수 있다.","The term ""patient"" includes a human and a veterinary subject.",False,1.0637376308441162,0.226316139212779,70,10,60,302,61,241
"또한, 영양보조제로는 이에 한정되지 않지만 캡슐, 타블렛, 환 등에 사이클로-히스프로 또는 이의 염 및 부갑상선 호르몬을 첨가하여 제조할 수 있다.","In the method of the present invention, the descriptions of the effects of CHP and PTH and an administration route thereof, the number of administrations, and a dosage are the same as above, and will be omitted.",False,0.918303608894348,0.3633173614398146,20,37,-17,82,211,-129
"또한, 건강기능식품으로는 이에 한정되지 않지만 예를 들면, 상기 사이클로-히스프로 또는 이의 염 및 부갑상선 호르몬을 차, 쥬스 및 드링크의 형태로 제조하여 음용(건강음료)할 수 있도록 액상화, 과립화, 캡슐화 및 분말화하여 섭취할 수 있다.","In the method of the present invention, the CHP or a pharmaceutically acceptable salt; and PTH may be administered simultaneously, separately or sequentially.",False,0.8116462230682373,0.4769685703349263,32,23,9,135,158,-23
"또한, 상기 사이클로-히스프로 또는 이의 염 및 부갑상선 호르몬을 식품 첨가제의 형태로 사용하기 위해서는 분말 또는 농축액 형태로 제조하여 사용할 수 있다.","For example, the CHP or a pharmaceutically acceptable salt and PTH may be co-formulated to be simultaneously administered as a unit dose preparation, or simultaneously or sequentially administered as separate preparations.",False,0.6209801435470581,0.6133378596203933,22,31,-9,87,222,-135
"본 발명의 식품 조성물이 건강음료 조성물로 이용되는 경우, 상기 건강음료 조성물은 통상의 음료와 같이 여러 가지 향미제 또는 천연 탄수화물 등을 추가 성분으로 함유할 수 있다.","When sequentially administered, each active ingredient may be administered at regular intervals, and the order of administrations may be determined by a physician or one of ordinary skill in the art.",False,0.8695876002311707,0.3800462900587709,26,31,-5,98,199,-101
"사이클로-히스프로 또는 이의 염 및 부갑상선 호르몬은 골 손실 질환의 예방 또는 개선용 식품 조성물의 유효성분으로 함유될 수 있는데, 그 양은 상기 예방 또는 개선 효과를 얻기에 유효한 양으로, 예를 들어 전체 조성물 총 중량에 대하여 0.01 내지 100 중량%인 것이 바람직하나, 이에 특별히 한정되는 것은 아니다.",The present invention also provides a use of a composition including CHP or a pharmaceutically acceptable salt and PTH in the preparation of a drug for preventing or treating a bone loss-related disease.,False,0.6978964805603027,0.5603101213636512,47,33,14,178,203,-25
본 발명의 식품 조성물은 사이클로-히스프로 또는 이의 염 및 부갑상선 호르몬과 함께 골 손실 질환의 예방 또는 개선에 효과가 있는 것으로 알려진 다른 활성성분과 함께 혼합하여 제조될 수 있다.,The present invention also provides a use of a composition including CHP or a pharmaceutically acceptable salt thereof in the preparation of a drug for improving a preventive or therapeutic effect of PTH on a bone loss-related disease.,False,0.5622637271881104,0.6429607083849359,29,38,-9,107,235,-128
이하 본 발명을 실시예를 통해 보다 상세하게 설명한다.,"Hereinafter, the present invention will be described in further detail with reference to examples.",True,0.1683476865291595,0.8756851904397833,8,14,-6,30,98,-68
"단, 본 발명은 다양한 변경을 가할 수 있고 여러 가지 형태를 가질 수 있는바, 이하에서 기술하는 특정 실시예 및 설명은 본 발명의 이해를 돕기 위한 것일 뿐, 본 발 명을 특정한 개시 형태에 대해 한정하려는 것이 아니다.","However, the present invention may have various modifications and various examples, and thus specific examples are illustrated in the drawings and described in detail in the detailed description.",True,0.3894981443881988,0.7347333527755745,37,28,9,124,195,-71
"본 발명의 범위는 본 발명의 사상 및 기술 범위에 포함되는 모든 변경, 균등물 내지 대체물을 포함하는 것으로 이해되어야 한다.","However, it should be understood that the present invention is not limited to specific embodiments, and includes all modifications, equivalents or alternatives within the idea and technical scope of the present.",True,0.2756034433841705,0.8127969090227135,19,31,-12,70,211,-141
[ 준비예 ],[Examples],False,0.3847320675849914,0.7006893611190181,3,1,2,7,10,-3
"하기 실시예에서 사용한 CHP(사이클로-히스프로)는 바켐(Bachem)에서 구입하여 사용하였고, hPTH1-34(인간 부갑상선호르몬1-34)는 토크리스(Tocris)에서 구입하였다.","CHP used in the following examples was purchased from Bachem, and human parathyroid hormone 1-34 (hPTH1-34) was purchased from Tocris.",True,0.1300670057535171,0.9162310573597644,11,20,-9,101,134,-33
"MC3T3-E1 골아세포 (preosteoblast) 배양에는 깁코(Gibco) 사의 MEMα, 아스코르브산 무첨가(no ascorbic acid) 배지와 하이클론의 FBS를 구입하여 사용하였고, 분화에 사용된 β-글리세로포스페이트(β-glycerophosphate)와 아스코르브산은 시그마알드리치(Sigma-Aldrich)에서 구입하여였다.","For MC3T3-E1 preosteoblast culture, MEMα (Gibco), an ascorbic acid-free medium and FBS (Hyclone) were used, and β-glycerophosphate and ascorbic acid, which are used in differentiation, were purchased from Sigma-Aldrich.",True,0.105694979429245,0.9333343768329568,22,29,-7,191,219,-28
세포 용해 (lysis)는 써모(Thermo)의 RIPA 용해 버퍼를 사용하였다.,"For cell lysis, a RIPA lysis buffer (Thermo) was used.",True,0.1703657507896423,0.8759445605292774,8,10,-2,45,54,-9
"ALP(알칼리 인산분해효소) 활성 측정을 위해서는 시그마알드리치의 pNPP 기질 용액을 사용하였고, 단백질 정량은 써모의 BCA 정량 키트를 사용하였다.","For measurement of alkaline phosphatase (ALP) activity, a pNPP substrate solution (Sigma-Aldrich) was used, and for protein quantification, a BCA quantification kit (Thermo) was used.",True,0.1386062353849411,0.9125035377727624,17,25,-8,85,183,-98
CHP와 hPTH 1 -34 복합투여에 따른 MC3T3 -E1 골아세포 분화 촉진 및 골형성 촉진 효능 측정,Measurement of efficacy of promotion of MC3T3-E1 osteoblast differentiation and bone formation according to combined administration of CHP and hPTH1-34,False,0.166700467467308,0.8845054008166503,16,20,-4,60,151,-91
1-1. MC3T3 -E1 골아세포 배양 조건,1-1. Conditions for MC3T3-E1 osteoblast culture,False,0.1336273252964019,0.8898508053951384,6,6,0,25,47,-22
"10% FBS와 1% 페니실린/스트렙토마이신이 함유된 MEMα, 아스코르브산 무첨가(no ascorbic acid) 배지를 이용하여 MC3T3-E1 세포를 37℃, 5% CO2 조건의 인큐베이터에서 배양하였다.","Using a MEMα medium containing 10% FBS and 1% penicillin/streptomycin and an ascorbic acid-free medium, MC3T3-E1 cells were incubated in an incubator with 5% CO2 at 37 °C. For differentiation into osteoblasts, when the cells were grown to confluency, 10 mM β-glycerophosphate and 50 µg/µL ascorbic acid were added to the composition of the above basal medium composition.",False,0.2008371949195861,0.8755647368717764,20,58,-38,117,371,-254
"1-2. CHP, hPTH 1 -34 단독처리와 복합처리에 의한 MC3T3 -E1 골아세포의 분화 유도 촉진",1-2. Promotion of induction of MC3T3-E1 osteoblast differentiation by single and combined treatment with CHP and hPTH1-34,False,0.2096722871065139,0.8480364512492709,14,17,-3,60,121,-61
12 웰 플레이트에 2.5x105 개의 MC3T3-E1 세포를 1ml로 파종(seeding)하고 세포가 가득 찰 때까지 48시간 동안 배양하였다.,"2.5×105 MC3T3-E1 cells were seeded at 1 mL in 12-well plates, and grown to confluency for 48 hours.",False,0.149551048874855,0.8984004513989768,16,18,-2,81,99,-18
조골세포로 분화시키기 위해 분화배지로 배지를 교체하고 표 1과 같이 각 군별로 CHP와 hPTH1-34를 해당 농도로 처리하였다.,"For differentiation to osteoblasts, the medium was replaced with a differentiation medium, and treated with CHP and hPTH1-34 at corresponding concentrations for each group as shown in Table 2.",False,0.2126333564519882,0.8702906552959763,16,29,-13,72,192,-120
"이때, 분화에 대한 음성 대조군인 미분화군에는 분화배지가 아닌 기본배지를 이용하였다.","Here, for an undifferentiated group, which is a negative control for differentiation, a basal medium, not a differentiation medium, was used.",False,0.2893889844417572,0.7676670198061034,10,21,-11,47,141,-94
모든 군은 처리 6시간 후 배지를 제거하고 PBS로 1회 씻어낸 후 분화배지로 교체하였다.,"The medium was removed from all groups after six hours of treatment, and replaced with a differentiation medium after washing with PBS once.",False,0.1871558278799057,0.8679941328681837,13,23,-10,50,140,-90
72시간 마다 배지를 교체하면서 각 농도의 CHP와 hPTH1-34를 처리하며 총 14일 동안 배양하였다.,"Each concentration of CHP and hPTH1-34 was treated while replacing the medium every 72 hours, and cultured for a total of 14 days.[Table 2]",False,0.1785905212163925,0.8852209848665804,13,24,-11,59,139,-80
"2-3. ALP(Alkaline phosphatase, 알칼리 인산분해효소) 활성 측정",1-3. Measurement of ALP activity,False,0.319232165813446,0.7567897800681513,7,5,2,48,32,16
"분화 14일 째, 배지를 제거하고 PBS로 1회 세척한 후 RIPA 용해 버퍼 100㎕를 각 웰에 넣고 세포 스크랩퍼(scraper)를 이용하여 세포를 떼어냈다.","On day 14 of differentiation, the medium was removed, the cells were washed with PBS once, 100 µL of a RIPA lysis buffer was added to each well, followed by detaching the cells using a cell scraper.",False,0.2091999948024749,0.8603576465013303,21,37,-16,90,198,-108
"파이펫을 이용해 1.5ml 튜브로 옮긴 후 초음파 분쇄기를 이용하여(Sonicator, 진폭 10, 0.5초 펄스, 10회) 분쇄하였다.","The cells were transferred into a 1.5 mL tube using a pipette, and disrupted using a sonicator (amplitude of 10, 0.5 sec pulse, 10 times).",False,0.1929463893175125,0.864292064864535,15,25,-10,76,138,-62
"4℃, 15,000rpm에서 10분간 원심분리 후 상층액만 분리하였다.","After centrifugation at 4 °C and 15,000 rpm for 10 minutes, only a supernatant was isolated.",False,0.1732132881879806,0.874756541504034,7,16,-9,39,92,-53
"분리한 각 용해물 샘플을 10㎕씩 96 웰 플레이트에 먼저 넣고, pNPP 기질 용액을 200㎕ 넣어 상온에서 1시간 반응시키고, 405nm에서 흡광도를 측정하였다.","10 µL of the isolated lysate sample was added first to a 96-well plate, and 200 µL of a pNPP substrate solution was added to allow a reaction at room temperature for 1 hour, followed by measuring absorbance at 405 nm.",False,0.2687979638576507,0.825720724375334,21,41,-20,92,217,-125
"ALP 활성값을 용해물의 단백질 농도로 보정하기 위해, 각 용해물을 BCA 정량법으로 정량하여 405nm에서의 ALP 활성 흡광도 값을 들어간 총 단백질 양으로 나누었다. [Abs. OD450nm/ug of analyzed]","To calibrate the ALP activity level to the protein concentrations of the lysates, each lysate was quantified by a BCA quantification method, and thus the ALP activity absorbance value at 405 nm was divided by a total amount of proteins added [Abs.",False,0.1384447962045669,0.9101654299801942,26,42,-16,125,247,-122
"실험 결과, 도 1A 및 1B에 나타낸 바와 같이, hPTH1-34와 CHP를 복합으로 처리한 군의 ALP 활성이 hPTH1-34 단독 처리군에 비해 증가하는 것을 확인하였다.","As a result of the experiment, as shown in FIGS. 1A and 1B, it was confirmed that the ALP activity in a group treated with hPTH1-34 and CHP in combination was higher than that of a hPTH1-34 only-treated group.",False,0.1052102893590927,0.93795479441046,23,39,-16,98,209,-111
이 결과는 hPTH1-34 에 의한 골아세포 분화와 골형성 촉진 작용이 복합 투여된 CHP에 의해 더욱 상승된 것으로 해석할 수 있다.,This result can be interpreted as that the action of promoting osteoblasts differentiation and bone formation by hPTH1-34 is more increased by combined administration of CHP.,False,0.1482473015785217,0.9082299440305576,20,26,-6,75,174,-99
이를 통해 hPTH1-34 와 CHP의 복합 투여가 뼈 건강과 골다공증 치료에 상승효과를 나타냄을 확인하였다.,"According to this, it was confirmed that the combined administration of hPTH1-34 and CHP exhibits a synergistic effect on bone health and osteoporosis treatment.",False,0.128672257065773,0.920191579465194,14,24,-10,61,161,-100
"그리고 용접 토치(51) 및 와이어 노즐(52)을 개시 위치 R1에 위치시킴과 함께, 지지대(53)를 용접 경로 RA를 따르게 한다.","Then, the welding torch 51 and the wire nozzle 52 are positioned at the start position R1 and the support stand 53 is made along the welding path RA.",True,0.1722519993782043,0.930487391939318,17,29,-12,74,149,-75
"이때, 용접 토치(51)보다 와이어 노즐(52)을 이동 방향의 전방측에 위치시킨다.]","At this time, the wire nozzle 52 is made closer to the front side in the movement direction than the welding torch 51 is.",True,0.2822619378566742,0.8621064601299928,9,24,-15,47,121,-74
"[이 상태에서, 제4 지지 기구(57) 및 제5 지지 기구(58)(모두 도 4 참조)를 작동 제어함으로써, 지지대(53)를 용접 경로 RA를 따라 이동시켜, 원자로 용기 덮개(13)와 관대(31)의 용접을 행한다.","In this state, operating and controlling the fourth support mechanism 57 and the fifth support mechanism 58 (see FIG. 4 for all) allows the support stand 53 to move along the welding path RA to weld the reactor vessel lid 13 and the nozzle 31.",True,0.2260043770074844,0.9144729304018258,26,45,-19,119,243,-124
"이때, 검출부(123)의 검출 결과에 기초하여 제3 지지 기구(56)를 작동 제어한다.","At this time, the third support mechanism 56 is operated and controlled based on the detection results of the detection unit 123.",True,0.1729244887828827,0.8952704993522848,10,22,-12,48,129,-81
"즉, 용접 토치(51)의 용접 전극(63)의 선단부와 용접 위치의 거리가 적정 위치로 유지되도록, 제3 지지 기구(56)에 의해 지지대(53)를 제3 지지축(O13)의 축 방향을 따라 이동시켜, 용접 토치(51) 및 와이어 노즐(52)의 위치를 조정한다.]","In other words, the third support mechanism 56 moves the support stand 53 along the axial direction of the third support axis O13 to adjust the positions of the welding torch 51 and the wire nozzle 52 so that the distance between the tip end of the welding electrode 63 of the welding torch 51 and the welding position can be maintained at a proper position.",True,0.2401720285415649,0.9187032333018716,30,66,-36,143,358,-215
"[또한, 원자로 용기 덮개(13)의 내주면(13b)의 경사 각도가 변화되어 간다는 점에서, 제1 지지 기구(54)를 작동 제어함으로써, 지지대(53)와 함께 용접 토치(51) 및 와이어 노즐(52)의 경사 각도를 조정한다.","As the tilt angle of the inner surface 13b of the reactor vessel lid 13 changes, the tilt angle of the welding torch 51 and the wire nozzle 52 together with the support stand 53 is adjusted by operating and controlling the first support mechanism 54.",True,0.2552247047424316,0.900851336226968,25,46,-21,124,250,-126
"또한, 도 8에 도시하는 바와 같이, 용접 토치(51)의 용접 전극(63)은, 관대(31)의 외주면(31a)과 원자로 용기 덮개(13)의 내주면(13b) 사이의 용접면에 대해, 가능한 한 직교하는 방향에 위치시키는 것이 바람직하다.","Furthermore, as illustrated in FIG. 8, it is desirable that the welding electrode 63 of the welding torch 51 be positioned in a direction of being orthogonal to the welding surface between the outer surface 31a of the nozzle 31 and the inner surface 13b of the reactor vessel lid 13, as much as possible.",True,0.1148317456245422,0.9476587534834596,26,55,-29,129,304,-175
"그 때문에, 제2 지지 기구(55)에 의해 지지대(53)를 제2 지지축(O12)을 중심으로 회동시킨다.","Thus, the second support mechanism 55 rotates the support stand 53 around the second support axis O12.",True,0.3035983145236969,0.8709266439460231,11,17,-6,57,102,-45
"그리고 지지대(53)와 함께 용접 토치(51) 및 와이어 노즐(52)을, 예를 들어 경사 방향 X1로 소정 각도만큼 경사지게 한다.]","Then, the welding torch 51 and wire nozzle 52 together with the support stand 53 are tilted by a predetermined angle, for example, in the inclined direction X1.",True,0.2207310050725937,0.9087536211438506,17,28,-11,74,160,-86
"[도 6 및 도 7에 도시하는 바와 같이, 용접 토치(51)와 와이어 노즐(52)이 개시 위치 R1로부터 용접 경로 RA를 통해 종료 위치 R2까지 이동함으로써, 원자로 용기 덮개(13)와 관대(31)의 반주만큼 용접이 완료되면, 다음으로 용접 장치(50)에 의해 용접 토치(51)와 와이어 노즐(52)이 장착된 지지대(53)를 용접 경로 RB를 따라 이동시켜 용접을 행한다.","As illustrated in FIGS. 6 and 7, when the welding torch 51 and the wire nozzle 52 move from the start position R1 through the welding path RA to the end position R2 and complete the welding of the reactor vessel lid 13 and the nozzle 31 by half the circumference of the nozzle 31, the welding apparatus 50 then moves the support stand 53, on which the welding torch 51 and the wire nozzle 52 are mounted, along the welding path RB to perform welding.",True,0.154589831829071,0.9407790443226836,47,86,-39,210,450,-240
"먼저, 제1 지지 기구(54)에 의해 지지대(53)를 제1 지지축(O11)을 중심으로 회동시킨다.","First, the first support mechanism 54 rotates the support stand 53 around the first support axis O11.",True,0.2708724439144134,0.8808667695148698,10,17,-7,54,101,-47
"그리고 지지대(53)와 함께 용접 토치(51) 및 와이어 노즐(52)을 연직 방향을 따른 기준 위치로부터 소정 각도만큼 경사지게 함으로써, 도 7에 용접 장치(50B)로서 나타낸 상태로 한다.]","Then, the welding torch 51 and the wire nozzle 52 together with the support stand 53 are tilted by a predetermined angle from the reference position along the vertical direction, so as to be in a state represented as a welding apparatus 50B in FIG. 7.",True,0.2162492722272873,0.913544348032218,24,46,-22,108,251,-143
"[다음으로, 지지대(53)를 제4 지지 기구(57)에 의해 제4 지지축(O14)(모두 도 4 참조)을 중심으로 회동시킴과 함께, 제5 지지 기구(58)에 의해 제5 지지축(O15X, O15Y, O15Z)(모두 도 4 참조)의 방향으로 이동시킨다.","Next, the support stand 53 is rotated around the fourth support axis 014 (see FIG. 4 for all) by the fourth support mechanism 57 and moved in the directions of the fifth support axes O15X, O15Y, O15Z (see FIG. 4 for all) by the fifth support mechanism 58.",True,0.1663467437028885,0.9303705970417396,27,48,-21,137,255,-118
"그리고 용접 토치(51) 및 와이어 노즐(52)을 개시 위치 R1에 위치시킴과 함께, 지지대(53)를 용접 경로 RB를 따르게 한다.","Then, the welding torch 51 and the wire nozzle 52 are positioned at the start position R1 and the support stand 53 is made along the welding path RB.",True,0.1622482985258102,0.9344861151409308,17,29,-12,74,149,-75
"이때, 용접 토치(51)보다 와이어 노즐(52)을 이동 방향의 전방측에 위치시킨다.]","At this time, the wire nozzle 52 is made closer to the front side in the movement direction than the welding torch 51 is.",True,0.2822619378566742,0.8621064601299928,9,24,-15,47,121,-74
"[이 상태에서, 제4 지지 기구(57) 및 제5 지지 기구(58)(모두 도 4 참조)를 작동 제어함으로써, 지지대(53)를 용접 경로 RB를 따라 이동시켜, 원자로 용기 덮개(13)와 관대(31)의 용접을 행한다.","In this state, operating and controlling the fourth support mechanism 57 and the fifth support mechanism 58 (see FIG. 4 for all) allows the support stand 53 to move along the welding path RB to weld the reactor vessel lid 13 and the nozzle 31.",True,0.2215233594179153,0.9163299233331856,26,45,-19,119,243,-124
"이때, 검출부(123)의 검출 결과에 기초하여 제3 지지 기구(56)를 작동 제어한다.","At this time, the third support mechanism 56 is operated and controlled based on the detection results of the detection unit 123.",True,0.1729244887828827,0.8952704993522848,10,22,-12,48,129,-81
"즉, 용접 토치(51)의 용접 전극(63)의 선단부와 용접 위치의 거리가 적정 위치로 유지되도록, 제3 지지 기구(56)에 의해 지지대(53)를 제3 지지축(O13)의 축 방향을 따라 이동시켜, 용접 토치(51) 및 와이어 노즐(52)의 위치를 조정한다.]","In other words, the third support mechanism 56 moves the support stand 53 along the axial direction of the third support axis O13 to adjust the positions of the welding torch 51 and the wire nozzle 52 so that the distance between the tip end of the welding electrode 63 of the welding torch 51 and the welding position can be maintained at the proper position.",True,0.2393829673528671,0.918972066063638,30,66,-36,143,360,-217
"[이와 같이 본 실시 형태의 용접 장치(50)는, 먼저 용접 토치(51)와 와이어 노즐(52)을 용접 경로 RA를 따라 반주 이동시켜 용접을 행한다.","In this way, the welding apparatus 50 of the present embodiment first moves the welding torch 51 and the wire nozzle 52 half around the nozzle 31 along the welding path RA to perform welding.",True,0.2350805252790451,0.9082704673420066,20,35,-15,83,191,-108
"다음으로, 용접 토치(51)와 와이어 노즐(52)을 용접 경로 RB를 따라 반주 이동시켜 용접을 행한다.","Next, the welding apparatus 50 moves the welding torch 51 and the wire nozzle 52 half around the nozzle 31 along the welding path RB to perform welding.",True,0.3207161128520965,0.8647573919415967,13,28,-15,58,152,-94
"그 결과, 원자로 용기 덮개(13)와 관대(31)는, 전둘레 용접이 실시된다.]","As a result, the reactor vessel lid 13 and the nozzle 31 are welded all around the circumference.",True,0.3045540750026703,0.8239847660418874,9,18,-9,44,97,-53
[[본 실시 형태의 작용 효과]],[Effect of the present embodiment],True,0.1139829754829406,0.9177747420346046,5,5,0,18,34,-16
"[제1 양태에 관한 용접 장치는, 용접 토치(51)와, 와이어 노즐(52)과, 용접 토치(51)와 와이어 노즐(52)을 소정 간격을 두고 지지하는 지지대(53)와, 지지대(53)를 용접 토치(51)와 와이어 노즐(52)의 배열 방향을 따른 제1 지지축(O11)을 중심으로 하여 회동 가능하게 지지하는 제1 지지 기구(54)를 구비한다.]","A welding apparatus according to a first aspect includes a welding torch 51, a wire nozzle 52, a support stand 53 that supports the welding torch 51 and the wire nozzle 52 with a predetermined distance therebetween, and a first support mechanism 54 that supports the support stand 53 in a rotatable manner around the first support axis O11 that is along the direction in which the welding torch 51 and the wire nozzle 52 are arranged.",True,0.2779867351055145,0.9040102376939436,37,77,-40,188,434,-246
"[제1 양태에 관한 용접 장치는, 제1 지지 기구(54)에 의해, 용접 토치(51)와 와이어 노즐(52)이 지지된 지지대(53)를 제1 지지축(O11)을 중심으로 하여 회동시킬 수 있다.","The welding apparatus according to the first aspect allows the first support mechanism 54 to rotate the support stand 53, on which the welding torch 51 and the wire nozzle 52 are supported, around the first support axis O11.",True,0.3611840307712555,0.8710590405549257,22,39,-17,104,224,-120
"예를 들어, 원자로 용기 덮개(13)에 대해 관대(31)를 고정하는 용접 작업을 실시할 때, 원자로 용기 덮개(13)와 관대(31)의 용접면에 대해, 용접 토치(51) 및 와이어 노즐(52)이 관대(31)에 접촉하지 않도록 용접 토치(51) 및 와이어 노즐(52)의 각도를 조정할 수 있다.","For example, when carrying out welding work to fix the nozzle 31 to the reactor vessel lid 13, it is possible to adjust the angle of the welding torch 51 and the wire nozzle 52 with respect to the welding surface between the reactor vessel lid 13 and the nozzle 31 so that the welding torch 51 and the wire nozzle 52 do not come into contact with the nozzle 31.",True,0.221364676952362,0.9088998333172128,35,71,-36,162,361,-199
"그 결과, 종래의 와이어 노즐 반전 기구를 사용하는 일 없이 용접 토치(51) 및 와이어 노즐(52)의 이동 방향을 변경할 수 있어, 장치의 소형화를 도모할 수 있다.","As a result, it is possible to change the movement directions of the welding torch 51 and wire nozzle 52 without using a conventional wire nozzle reversing mechanism, and thereby the apparatus can be miniaturized.",True,0.1791823804378509,0.919949388216201,25,35,-10,93,213,-120
"또한, 방향 변경의 동작에 있어서, 중심축(O2)을 따라, 와이어 노즐(52)의 상류로부터 공급하는 용접 와이어(W)의 루트의 움직임도 적어지게 되어, 용접 와이어(W)의 구부러지려는 경향에 기인하는 노즐부(72)로부터의 와이어 공급 위치의 변동을 억제하여, 안정 공급으로 이어진다.]","In the operation of the direction change, the amount of movement of the route of the welding wire W to be supplied from the upstream of the wire nozzle 52 along the central axis 02 is small, thereby suppressing fluctuations in a wire supply position from the nozzle part 72 caused by bending of the welding wire W, leading to stable supply of the welding wire W.",True,0.2884087264537811,0.8546165131667941,31,67,-36,159,362,-203
"[제2 양태에 관한 용접 장치는, 제1 지지축(O11)을 용접 토치(51)의 축 방향에 직교하는 방향을 따라 배치한다.",A welding apparatus according to a second aspect arranges the first support axis O11 in a direction of being orthogonal to the axial direction of the welding torch 51.,True,0.2215547710657111,0.9059770098566496,15,29,-14,66,167,-101
"이에 의해, 지지대(53)를 용접 토치(51)와 와이어 노즐(52)의 배열 방향을 따름과 함께 용접 토치(51)의 축 방향에 직교하는 방향을 따른 제1 지지축(O11)을 중심으로 하여 회동 가능하게 지지함으로써, 용접 토치(51) 및 와이어 노즐(52)을 원하는 각도로 조정할 수 있다.]","Thus, the support stand 53 is supported to be rotatable around the first support axis O11 that is along the direction in which the welding torch 51 and the wire nozzle 52 are arranged and is also along the direction orthogonal to the axial direction of the welding torch 51, so that the welding torch 51 and the wire nozzle 52 can be adjusted to any desired angle.",True,0.2999286651611328,0.9021578079608472,35,68,-33,161,364,-203
"[제3 양태에 관한 용접 장치는, 제1 지지축(O11)에 직교함과 함께 용접 토치(51)의 축 방향에 직교하는 방향을 따른 제2 지지축(O12)을 중심으로 하여 지지대(53)가 회동하도록 제1 지지 기구(54)를 회동 가능하게 지지하는 제2 지지 기구(55)를 마련한다.",A welding apparatus according to a third aspect includes a second support mechanism 55 that supports the first support mechanism 54 so that the support stand 53 rotates around the second support axis 012 that is orthogonal to the first support axis O11 and is along the direction of being orthogonal to the axial direction of the welding torch 51.,True,0.2863286435604095,0.9019042225563172,32,60,-28,151,347,-196
"이에 의해, 제2 지지 기구(55)에 의해 제1 지지 기구(54)를 제1 지지축(O11)에 직교하는 제2 지지축(O12)을 중심으로 하여 회동시킴으로써, 지지대(53)를 회동시킬 수 있어, 용접면이 변동되어도, 용접 토치(51)를 원하는 각도로 적정하게 조정할 수 있다.]","Thus, the second support mechanism 55 allows the first support mechanism 54 to rotate around the second support axis 012 that is orthogonal to the first support axis O11, so that the support stand 53 can be rotated, and the welding torch 51 can be properly adjusted to a desired angle even if the welding surface fluctuates.",True,0.2639537453651428,0.9079386486767134,31,57,-26,152,324,-172
"[제4 양태에 관한 용접 장치는, 지지대(53)를 용접 토치(51)의 축 방향을 따른 제3 지지축(O13)의 축 방향으로 이동 가능하게 지지하는 제3 지지 기구(56)를 마련한다.",A welding apparatus according to a fourth aspect includes the third support mechanism 56 that supports the support stand 53 so that the support stand 53 is movable in the axial direction of the third support axis O13 that is along the axial direction of the welding torch 51.,True,0.2643358707427978,0.9015292406423596,22,49,-27,100,275,-175
"이에 의해, 제3 지지 기구(56)에 의해 지지대(53)를 용접 토치(51)의 축 방향을 따른 제3 지지축(O13)을 따라 이동시킬 수 있어, 용접면이 변동되어도, 용접 토치(51)를 원하는 위치로 적정하게 조정할 수 있다.]","Thus, the third support mechanism 56 allows the support stand 53 to move along the third support axis O13 that is along the axial direction of the welding torch 51, so that the welding torch 51 can be properly adjusted to a desired position even if the welding surface fluctuates.",True,0.250638484954834,0.9090151959480792,28,50,-22,126,280,-154
"[제5 양태에 관한 용접 장치는, 제3 지지 기구(56)를 제1 지지 기구(54)와 지지대(53)의 상단부 사이에 배치한다.",A welding apparatus according to a fifth aspect has the third support mechanism 56 to be disposed between the first support mechanism 54 and the upper end of the support stand 53.,True,0.2618626952171325,0.8861410147295455,15,32,-17,69,179,-110
"이에 의해, 제3 지지 기구(56)가 용접 대상부에 접촉하는 것이 억제되어, 안정된 용접 작업을 실시할 수 있다.]","This configuration prevents the third support mechanism 56 from coming into contact with a welding object, thereby providing stable welding work.",True,0.2853849828243255,0.8524453220201648,16,21,-5,64,145,-81
"[제6 양태에 관한 용접 장치는, 제3 지지 기구(56)로서, 용접 토치(51)의 축 방향을 따라 배치되는 제3 모터(95)와, 용접 토치(51)의 축 방향을 따름과 함께 제3 모터(95)에 인접하여 배치되는 나사축(96)과, 제3 모터(95)의 회전력을 나사축(96)에 전달하는 전달 기구(97)를 마련한다.","A welding apparatus according to a sixth aspect includes, as the third support mechanism 56, the third motor 95 disposed along the axial direction of the welding torch 51, the threaded shaft 96 disposed along the axial direction of the welding torch 51 and adjacent to the third motor 95, and the transmission mechanism 97 configured to transmit the rotational force of the third motor 95 to the threaded shaft 96.",True,0.2303874492645263,0.907711901478518,35,71,-36,173,414,-241
"이에 의해, 제3 모터(95)와 나사축(96)을 평행하게 인접하여 배치함으로써 제3 지지 기구(56)를 콤팩트화할 수 있고, 제3 지지 기구(56)가 용접 대상부에 접촉하는 것이 억제되어 안정된 용접 작업을 실시할 수 있다.","Thus, disposing the third motor 95 and the threaded shaft 96 in parallel and adjacent to each other can downsize the third support mechanism 56 and prevents the third support mechanism 56 from coming into contact with the welding object, thereby providing stable welding work.",True,0.2267111390829086,0.8977281985875528,28,45,-17,125,276,-151
"또한, 이 제3 지지 기구(56)는, AVC(Arc Voltage Control)로 해도 된다.",This third support mechanism 56 may be of an arc voltage control (AVC).,True,0.1745095402002334,0.8999232393797295,10,13,-3,53,71,-18
그것에 의해 자동적으로 조정할 수 있다.],"With this configuration, the third support mechanism 56 can automatically perform adjustment.",True,0.7354996204376221,0.4897489628536583,6,12,-6,23,93,-70
"[제7 양태에 관한 용접 장치는, 안내부(91)에, 지지대(53)를 용접 토치(51)의 축 방향을 따른 제4 지지축(O14)을 중심으로 하여 회동 가능하게 지지하는 제4 지지 기구(57)를 마련한다.","In a welding apparatus according to a seventh aspect, the fourth support mechanism 57 that supports the support stand 53 so that the support stand 53 is rotatable around the fourth support axis O14 that is along the axial direction of the welding torch 51 is provided to the guide part 91.",True,0.2831588685512543,0.8858468426342956,23,52,-29,111,289,-178
"이에 의해, 제4 지지 기구(57)에 의해 지지대(53)를 제4 지지축(O14)을 중심으로 하여 회동시킬 수 있어, 용접 토치(51) 및 와이어 노즐(52)의 방향을 적정하게 조정할 수 있다.]","This allows the fourth support mechanism 57 to rotate the support stand 53 around the fourth support axis O14, so that the orientations of the welding torch 51 and the wire nozzle 52 can be properly adjusted.",True,0.2672840058803558,0.9002014564993198,24,37,-13,108,208,-100
"[제8 양태에 관한 용접 장치는, 안내부(91)에, 지지대(53)를 적어도 직교하는 3축 방향으로 이동 가능한 제5 지지 기구(58)를 마련한다.","In a welding apparatus according to an eighth aspect, the fifth support mechanism 58 that is capable of moving the support stand 53 in at least the three orthogonal axial directions is provided to the guide part 91.",True,0.2159149646759033,0.8985732437218078,17,38,-21,81,215,-134
"이에 의해, 제5 지지 기구(58)에 의해 지지대(53)를 제5 지지축(O15X, O15Y, O15Z)의 축 방향을 따라 이동시킬 수 있어, 용접 토치(51) 및 와이어 노즐(52)의 위치를 적정하게 조정할 수 있다.]","This allows the fifth support mechanism 58 to move the support stand 53 along the axial directions of the fifth support axes O15X, O15Y, O15Z, so that the positions of the welding torch 51 and the wire nozzle 52 can be adjusted properly.",True,0.2470409572124481,0.909481332183974,27,43,-16,122,237,-115
"[제9 양태에 관한 용접 장치는, 용접 토치(51)와 와이어 노즐(52)과 지지대(53)와 제1 지지 기구(54)를 제1 지지축(O11)의 축 방향 및 용접 토치(51)의 축 방향을 따른 면에 대해 면 대칭으로 한다.","In a welding apparatus according to a ninth aspect, the welding torch 51, the wire nozzle 52, the support stand 53 and the first support mechanism 54 are plane symmetric with respect to the plane along the axial direction of the first support axis O11 and the axial direction of the welding torch 51.",True,0.2953229248523712,0.8935749854532228,28,54,-26,121,300,-179
"이에 의해, 구조의 간소화를 도모할 수 있다.]",This configuration simplifies the structure.,True,0.4565922617912292,0.6545250961322581,7,5,2,26,44,-18
"[제10 양태에 관한 용접 장치는, 제1 지지 기구(54)와 제2 지지 기구(55)를 독립적으로 제어하는 제어 장치(120)를 마련한다.",A welding apparatus according to a tenth aspect includes the control device 120 configured to independently control the first support mechanism 54 and the second support mechanism 55.,True,0.2131189703941345,0.8957242214661739,16,28,-12,76,183,-107
"이에 의해, 제어 장치(120)가 제1 지지 기구(54)와 제2 지지 기구(55)를 독립적으로 제어함으로써, 용접 토치(51) 및 와이어 노즐(52)을 최적 각도 및 최적 위치로 이동시킬 수 있어, 안정된 용접 작업을 실시할 수 있다.]","Thus, the control device 120 independently controlling the first support mechanism 54 and the second support mechanism 55 can move the welding torch 51 and the wire nozzle 52 to the optimum angle and the optimum position, thereby providing stable welding work.",True,0.18007193505764,0.931836040359495,31,42,-11,132,260,-128
"[제11 양태에 관한 용접 방법은, 지지대(53)를 용접 토치(51)와 와이어 노즐(52)의 배열 방향을 따른 제1 지지축(O11)을 중심으로 하여 기준 위치로부터 일방측으로 소정 각도만큼 회동시켜 용접을 행하는 공정과, 지지대(53)를 제1 지지축(O11)을 중심으로 하여 기준 위치로부터 타방측으로 소정 각도만큼 회동시켜 용접을 행하는 공정을 갖는다.","A welding method according to an eleventh aspect includes a step of performing welding by rotating the support stand 53 by a predetermined angle from a reference position to one side around the first support axis O11 along the direction in which the welding torch 51 and the wire nozzle 52 are arranged, and a step of performing welding by moving the support stand 53 for a predetermined angle from the reference position to the other side around the first support axis O11.",True,0.2375308722257614,0.9159572777262832,41,83,-42,198,474,-276
"이에 의해, 예를 들어 원자로 용기 덮개(13)에 대해 관대(31)를 고정하는 용접 작업을 실시할 때, 원자로 용기 덮개(13)와 관대(31)의 용접면에 대해, 용접 토치(51) 및 와이어 노즐(52)이 관대(31)에 접촉하지 않도록 용접 토치(51) 및 와이어 노즐(52)의 각도를 조정할 수 있다.","With this configuration, for example, when carrying out welding work to fix the nozzle 31 to the reactor vessel lid 13, it is possible to adjust the angle of the welding torch 51 and the wire nozzle 52 with respect to the welding surface between the reactor vessel lid 13 and the nozzle 31 so that the welding torch 51 and the wire nozzle 52 do not come into contact with the nozzle 31.",True,0.2574232220649719,0.8954562857369007,37,74,-37,168,386,-218
"그 결과, 종래의 와이어 노즐 반전 기구를 사용하는 일 없이 용접 토치(51) 및 와이어 노즐(52)의 이동 방향을 변경할 수 있어, 장치의 소형화를 도모할 수 있다.","As a result, it is possible to change the movement directions of the welding torch 51 and wire nozzle 52 without using a conventional wire nozzle reversing mechanism, and thereby the apparatus can be miniaturized.",True,0.1791823804378509,0.919949388216201,25,35,-10,93,213,-120
"또한, 용접 와이어(W)의 구부러지려는 경향의 방지로도 이어진다.]",This also helps to prevent bending of the welding wire W.,True,0.3056876063346863,0.7862648705250469,7,11,-4,37,57,-20
"[또한, 상술한 실시 형태에서는, 연직 방향의 상방으로부터 제2 지지 기구(55), 제1 지지 기구(54), 제3 지지 기구(56)를 배치하였지만, 이 위치 관계에 한정되는 것은 아니다.","In the embodiment described above, the second support mechanism 55, the first support mechanism 54, and the third support mechanism 56 are disposed from above in the vertical direction, but are not limited to this positional relation.",True,0.2163614183664322,0.8986203605939908,23,37,-14,104,234,-130
"예를 들어, 제1 지지 기구(54)와 제2 지지 기구(55)를 반대로 하거나, 제3 지지 기구(56)를 최상위측에 배치하거나 해도 된다.]","For example, the first support mechanism 54 and the second support mechanism 55 may be reversed, or the third support mechanism 56 may be disposed at the topmost side.",True,0.1907219886779785,0.912255598724912,17,29,-12,77,167,-90
"[또한, 상술한 실시 형태에서는, 용접 장치(50)에 의해 원자로 용기 덮개(13)에 관대(31)를 용접하는 것으로 하였지만, 이 작업에 한정되는 것은 아니며, 협애한 공간부에 사용하기에 적합하다.]","In the above-described embodiment, the welding apparatus 50 is an apparatus that welds the nozzle 31 to the reactor vessel lid 13, but is not limited to this work and is suitable for use in narrow space areas.",True,0.2383574098348617,0.8814710974681926,23,38,-15,111,209,-98
"[또한, 상술한 실시 형태에서, 용접 토치(51)의 길이를 조정함으로써, 각 지지 기구(54, 55, 56)를 용접 대상물에 대해 간섭하지 않는 위치에 배치할 수 있어, 협애부에서의 용접을 적정하게 실시할 수 있다.]","In the above-described embodiments, adjusting a length of the welding torch 51 allows each of the support mechanisms 54, 55, 56 to be disposed in a position of being free from interference with a welding object, and makes it possible to properly perform welding in a narrow area.",True,0.3403676450252533,0.8637038610081185,28,48,-20,121,279,-158
"[10: 가압수형 원자로 11: 원자로 용기 12: 원자로 용기 본체 13: 원자로 용기 덮개 25: 노심 26: 연료 집합체 27: 제어봉 29: 제어봉 구동 장치 30: 제어봉 클러스터 구동축 31: 관대 50: 용접 장치 51: 용접 토치 52: 와이어 노즐 53: 지지대 54: 제1 지지 기구 55: 제2 지지 기구 56: 제3 지지 기구 57: 제4 지지 기구 58: 제5 지지 기구 58X: X축 지지 기구 58Y: Y축 지지 기구 58Z: Z축 지지 기구 61: 용접 헤드 62: 용접 노즐 63: 용접 전극 64: 토치 회전용 모터 65: 구동 기어 66: 종동 기어 71: 와이어 송급관 72: 노즐부 73: 승강대 74: 와이어 노즐 회전용 모터 75: 구동 캠 76: 종동 캠 77: 와이어 노즐 이동용 모터 78: 나사축 79: 너트 81: 아크 감시 카메라 82: 미러 91: 안내부 92: 제2 지지 부재 93: 제1 지지 부재 94: 제1 모터 95: 제3 모터 96: 나사축 97: 전달 기구 101: 연결 부재 102: 슬라이더 103: 너트부 104: 연결부 105: 구동 기어 106: 종동 기어 107: 가이드 부재 108: 위치 검출부 109: 종동 기어 111: 지지 암 112: Z 방향 지지 부재 113: 제4 지지 부재 114: X 방향 지지 부재 115: Y 방향 지지 부재 120: 제어 장치 121: 입력부 122: 기록부 123: 검출부 O1, O2, O3: 중심축 O11: 제1 지지축 O12: 제2 지지축 O13a, O13b: 제3 지지축 O14: 제4 지지축 O15X, O15Y, O15Z: 제5 지지축]","10 Pressurized water reactor 11 Reactor vessel 12 Reactor vessel body 13 Reactor vessel lid 25 Reactor core 26 Fuel assembly 27 Control rod 29 Control rod driving unit 30 Control rod cluster drive shaft 31 Nozzle stand 50 Welding apparatus 51 Welding torch 52 Wire nozzle 53 Support stand 54 First support mechanism 55 Second support mechanism 56 Third support mechanism 57 Fourth support mechanism 58 Fifth support mechanism 58X X-axis support mechanism 58Y Y-axis support mechanism 58Z Z-axis support mechanism 61 Welding head 62 Welding nozzle 63 Welding electrode 64 Motor for torch rotation 65 Drive gear 66 Driven gear 71 Wire feed tube 72 Nozzle part 73 Elevator 74 Motor for wire nozzle rotation 75 Drive cam 76 Driven cam 77 Motor for moving wire nozzle 78 Threaded shaft 79 Nut 81 Arc monitoring camera 82 Mirror 91 Guide part 92 Second support member 93 First support member 94 First motor 95 Third motor 96 Threaded shaft 97 Transmission mechanism 101 Connecting member 102 Slider 103 Nut part 104 Connecting part 105 Drive gear 106 Driven gear 107 Guide member 108 Position detection unit 109 Driven gear 111 Support arm 112 Z-direction support member 113 Fourth support member 114 X-direction support member 115 Y-direction support member 120 Control device 121 Input unit 122 Storage unit 123 Detection unit O1, O2, O3 Central axis O11 First support axis O12 Second support axis O13a, O13b Third support axis O14 Fourth support axis O15X, O15Y, O15Z Fifth support axis",True,0.3096387088298797,0.8397444162084465,224,249,-25,819,1483,-664
살리실아민 아세테이트 제조방법,FIELD OF DISCLOSURE,False,1.198463797569275,0.0814767418896518,3,3,0,16,19,-3
"[본 개시는 화학 합성 분야에 속하고, 상세하게는, 살리실아민 아세테이트를 제조하는 방법에 관한 것이다.]",The disclosure belongs to the field of chemical synthesis; and specifically relates to a method for preparing salicylamine acetate.,True,0.223506286740303,0.870442786021492,13,19,-6,59,131,-72
"[살리실알데하이드를 아미노 기로 보호함으로써 얻어진 화합물은 살리실아민 아세테이트를 얻기 위해 강산에 의해 가수분해되고 탈보호되고 이후에, 아세트산과 반응되어야 한다.",The compounds obtained by protecting salicylaldehyde with amino groups need to be hydrolyzed and deprotected by strong acid and then reacted with acetic acid to obtain salicylamine acetate.,True,0.1998598426580429,0.8835261444511653,18,28,-10,93,189,-96
"그러나, 이러한 방법의 상업적 가치는 제한적이다.","However, the commercial value of this method is limited.",True,0.122438408434391,0.9135360975963048,6,9,-3,27,56,-29
"이에 따라, 당해 분야에서는 저비용 및 우수한 상업적 효과를 갖는 살리실아민 아세테이트를 제조하는 방법을 제공하는 것이 시급히 요구되고 있다.]","Therefore, there is an urgent need in the art to provide a method for preparing salicylamine acetate with low cost and excellent commercial effect.",True,0.2065386027097702,0.8751670015465387,19,24,-5,80,147,-67
[본 개시의 목적은 살리실아민 아세테이트를 제조하는 신규한 방법을 제공하는 것이다.],The purpose of the present disclosure is to provide a new method for preparing salicylamine acetate.,True,0.2095693200826645,0.870575231383542,10,16,-6,47,100,-53
[본 개시는 살리실아민 아세테이트를 제조하는 방법을 제공한다.,The present disclosure provides a method for preparing salicylamine acetate.,True,0.2172831892967224,0.8710568822854999,7,10,-3,34,76,-42
[(1) 하기 화학식 1로 나타낸 구조를 갖는 살리실알데하이드를 아미노 기로 보호하여 하기 화학식 2로 나타낸 구조를 갖는 화합물을 수득하는 단계; 및],"The method includes the following steps: (1) protecting a salicylaldehyde having a structure shown in Formula 1 with an amino group to obtain a compound having a structure shown in Formula 2; and (2) reacting the compound having the structure shown in Formula 2 with acetic acid to obtain salicylamine acetate; wherein, X=Cbz or Boc.",False,0.337128609418869,0.829306810323774,21,55,-34,85,333,-248
"[다른 바람직한 구체예에서, 단계 (1)에서 아미노 기 보호의 반응 온도는 0 내지 50℃이다.]","In another preferred embodiment, the reaction temperature of amino group protection in step (1) is 0-50°C.",True,0.1399697214365005,0.9182914241472948,13,16,-3,54,106,-52
"[다른 바람직한 구체예에서, 단계 (1)에서 아미노 기 보호의 반응 시간은 3 내지 18시간이다.]","In another preferred embodiment, the reaction time of amino group protection in step (1) is 3-18 hours.",True,0.1324028223752975,0.9183779537069708,13,17,-4,55,103,-48
"[다른 바람직한 구체예에서, 단계 (1)에서 3차-부틸 카바메이트 대 살리실알데하이드의 당량비는 1.0 내지 3.0:1이다.]","In another preferred embodiment, the equivalent ratio of tert-butyl carbamate to salicylaldehyde in step (1) is 1.0-3.0:1.",True,0.2077736258506775,0.8806010013994049,13,17,-4,70,122,-52
"[다른 바람직한 구체예에서, 단계 (1)에서 반응 용매는 테트라하이드로푸란, 2-메틸테트라하이드로푸란, 아세토니트릴 및 1,4-디옥산으로 구성되는 군으로부터 선택된다.]","In another preferred embodiment, the reaction solvent in step (1) is selected from the group consisting of tetrahydrofuran, 2-methyltetrahydrofuran, acetonitrile and 1,4-dioxane.",True,0.1642346680164337,0.9050915462113,15,22,-7,94,178,-84
"[다른 바람직한 구체예에서, 단계 (2)에서 아세트산과 반응하는 온도는 50℃ 내지 아세트산의 환류 온도, 더욱 바람직하게는, 70℃ 내지 아세트산의 환류 온도이다.]","In another preferred embodiment, the temperature of reacting with acetic acid in step (2) is from 50°C to the reflux temperature of acetic acid; and more preferably from 70°C to the reflux temperature of acetic acid.",True,0.13591830432415,0.9227558505254988,20,36,-16,93,216,-123
"[다른 바람직한 구체예에서, 단계 (2)에서 아세트산과 반응하는 시간은 5 내지 70시간; 더욱 바람직하게는, 5 내지 60시간이다.]","In another preferred embodiment, the time of reacting with acetic acid in step (2) is 5-70 hours; more preferably 5-60 hours.",True,0.1098523885011673,0.9361162948024496,16,21,-5,75,125,-50
"[다른 바람직한 구체예에서, 단계 (2)에서, 화학식 2의 화합물 대 아세트산의 비는 1:0.1 내지 20(g/mL); 바람직하게는, 1:1 내지 15(g/mL); 및 더욱 바람직하게는, 1:3 내지 10(g/mL)이다.]","In another preferred embodiment, in step (2), the ratio of the compound of Formula 2 to acetic acid is 1:0.1-20 (g/mL); preferably 1:1-15 (g/mL); and more preferably, 1:3-10 (g/mL).",True,0.1779778152704239,0.9023856101677826,24,29,-5,124,181,-57
"[(3) 수득된 미정제 살리실아민 아세테이트를 유기 용매와 혼합하고, 결정화하여 순수한 살리실아민 아세테이트를 수득하는 단계로서, 유기 용매는 에틸 아세테이트, 이소프로필 에테르, 무수 에탄올 및 메틸 3차-부틸 에테르로 구성되는 군으로부터 선택되는 단계.]","In another preferred embodiment, the method includes the following steps: (1) protecting the salicylaldehyde having the structure shown in Formula 1 with an amino group to obtain the compound having the structure shown in Formula 2; (2) reacting the compound having the structure shown in Formula 2 with acetic acid, and lowering the temperature to room temperature after the reaction is complete, to obtain crude salicylamine acetate; and (3) mixing the obtained crude salicylamine acetate with an organic solvent and crystallizing to obtain pure salicylamine acetate; wherein the organic solvent is selected from the group consisting of ethyl acetate, isopropyl ether, absolute ethanol and methyl tert-butyl ether.",False,0.4847321510314941,0.7333471371314642,30,107,-77,144,716,-572
"[다른 바람직한 구체예에서, 화학식 2의 화합물의 양을 기준으로, 유기 용매의 양은 1 내지 50배; 바람직하게는, 1 내지 20배; 및 더욱 바람직하게는, 1 내지 10배이다.]","In another preferred embodiment, based on the amount of the compound of Formula 2, the amount of the organic solvent is 1-50 times; preferably 1-20 times; and more preferably 1-10 times.",True,0.1752150207757949,0.8964185707296461,24,31,-7,100,186,-86
"[이에 따라, 본 개시는 저비용 및 우수한 상업적 효과를 갖는 살리실아민 아세테이트를 제조하는 방법을 제공한다.]","Accordingly, the present disclosure provides a method for preparing salicylamine acetate with low cost and excellent commercial effect.",True,0.1525136530399322,0.9130550168596552,15,18,-3,63,135,-72
[도 1은 본 개시에서 수득된 살리실아민 아세테이트의 NMR 스펙트럼을 도시한 것이다.,Figure 1 shows a NMR spectrum of the salicylamine acetate obtained in the present disclosure.,True,0.1015374213457107,0.9390534781926198,11,15,-4,48,93,-45
도 2는 본 개시에서 수득된 살리실아민 아세테이트의 HPLC 스펙트럼을 도시한 것이다.],Figure 2 shows a HPLC spectrum of the salicylamine acetate obtained in the present disclosure.,True,0.0930868089199066,0.9459624449813568,11,15,-4,49,94,-45
"[아미노 보호기는 일반적으로, 강산 가수분해에 의해 제거되며, 아세트산과 같은 약산은 일반적으로 제거를 달성할 수 없다.","Amino protecting groups are generally removed by strong acid hydrolysis, and weak acids such as acetic acid generally cannot achieve the removal.",True,0.2547626793384552,0.8299054235297982,15,22,-7,67,145,-78
"예를 들어, 하기 반응을 위한 일련의 실험이 수행된다:]","For example, a series of experiments for the following reactions areperformed: Table 1 shows the reaction conditions and results.",False,0.3969968855381012,0.735805939646465,8,19,-11,31,129,-98
"[상기 반응은, 아미노 기를 탈보호하기 위한 아세트산의 사용 효과가 벤젠 고리 및 다른 강성 구조 상의 아미노 보호기에 대해 양호하지 않음을 나타낸다.",The above reactions show that the effect of using acetic acid to deprotect the amino group is not good for the amino protecting groups on the benzene ring and other rigid structures.,True,0.2420482784509658,0.8399818344443082,22,32,-10,84,182,-98
"상이한 기질의 물질이 원하는 생성물을 형성할 수 있음을 나타내는 것으로 LCMS에 의해 검출될 수 있지만, 생성된 불순물의 양은 특히, 반응 a 및 반응 b의 경우에, 비교적 크다. 3가지 반응의 후-처리에서, 메틸 3차-부틸 에테르가 첨가되었을 때에도 고형물이 침전되지 않았다.","Although the material of different substrates can be detected by LCMS to show that the desired product can be formed, the amount of impurities produced is relatively large, especially for reactions a and b.",False,0.3316427767276764,0.7840583653301015,38,34,4,156,206,-50
"원하는 생성물을 수득하기 위해, 정제 공정은 매우 번거로울 것이다.]","In order to obtain the desired product, the purification process will be very cumbersome.",True,0.1810272336006164,0.8689177841375663,9,14,-5,38,89,-51
"[반대로, 본 개시의 원하는 생성물은 살리실아민 아세테이트이다.","On the contrary, the desired product of the present disclosure is salicylamine acetate.",True,0.200391948223114,0.8742073253440046,7,13,-6,35,87,-52
"아세트산이 사용되는 경우에, 탈보호 공정 및 염 형성은 하나의 단계에서 완료될 수 있다.","If acetic acid is used, the deprotection process and salt formation can be completed in one step.",True,0.1942871510982513,0.8679155763231992,13,17,-4,49,97,-48
"선행 기술에 따르면, 이러한 반응은 수율이 낮거나, 후처리가 복잡한데, 이는 산업적 생산에 도움이 되지 않는다.","According to the prior arts, these reactions are either low in yield or complicated in post-treatment, which are not conducive to industrial production.",True,0.1303115934133529,0.9085532957560376,15,23,-8,62,152,-90
"본 발명자는 광범위하고 심도 있는 연구를 수행하였고, 몇 가지 핵심 인자들이 복잡한 반응 환경에서 잘 제어되는 경우에, 살리실알데하이드의 아미노-보호된 화합물이 아세트산과 직접 반응하여 살리실아민 아세테이트를 수득할 수 있으며, 고순도 생성물이 후속 처리에서 유기 용매로의 단순 결정화에 의해 수득될 수 있다는 것을 예상치 못하게 발견하였다.]","The present inventor has conducted extensive and in-depth research and unexpectedly discovered that if some key factors are well controlled in the complex reaction environment, the amino-protected compound of salicylaldehyde can directly react with acetic acid to obtain salicylamine acetate, and high-purity products can be obtained by simple crystallization with organic solvents in subsequent treatment.",True,0.164832204580307,0.9050220165146512,44,55,-11,192,406,-214
"[상기 핵심 인자는 반응 기질과 아세트산 간의 비, 반응 온도 및 시간, 및 후속 결정화 공정을 위한 유기 용매의 선택을 포함한다.","Said key factors include the ratio between the reaction substrate and acetic acid, the reaction temperature and time, and the choice of organic solvent for the subsequent crystallization process.",True,0.2264301478862762,0.8559680904993867,21,29,-8,73,195,-122
"이를 기초로 하여, 본 개시가 완성되었다.]","On these basis, the present disclosure has been completed.",True,0.2976808845996856,0.7669544527923927,6,9,-3,24,58,-34
"[본 개시에서 사용되는 ""화학식 1의 화합물"" 또는 ""화학식 1로 나타낸 구조를 갖는 화합물""은 상호 교환적으로 사용될 수 있으며, 둘 모두는 살리실알데하이드를 지칭한다.","As used in the present disclosure, ""the compound of Formula 1"" or ""the compound having the structure shown in Formula 1"" can be used interchangeably, and both refer to salicylaldehyde.",True,0.1729051172733307,0.90388513962744,22,30,-8,95,184,-89
"그리고, 다른 용어들이 유사한 의미를 갖는다.]",And other terms have similar meanings.,True,0.2070260047912597,0.8479208870074465,6,6,0,26,38,-12
"[본 개시에서 사용되는 ""실온""은 15 내지 35℃, 예를 들어, 15 내지 20℃, 15 내지 25℃, 18 내지 20℃, 15 내지 30℃, 22 내지 28℃, 24 내지 30℃, 32 내지 35℃ 등을 지칭하지만, 이로 제한되지 않는다.]","As used in the present disclosure, ""room temperature"" refers to 15-35 °C, such as, but not limited to, 15-20°C, 15-25°C, 18-20°C, 15-30°C, 22-28°C, 24-30°C, 32-35°C and so on.Table 2 shows the compounds of the present disclosure:",False,0.223978653550148,0.8556857484820496,35,36,-1,136,229,-93
[표 2는 본 개시의 화합물을 나타낸다:],"Specifically, the method for preparing salicylamine acetate having the structure shown in Formula 3 provided by the present disclosure includes the following steps: Step 1, mixing the salicylaldehyde having the structure shown in Formula 1 with the amino protecting agent to obtain the compound having the structure shown in Formula 2; Step 2, mixing and reacting the compound having the structure shown in Formula 2 with acetic acid, to obtain the salicylamine acetate of Formula 3.",False,0.8612675666809082,0.5131756875496906,6,76,-70,23,483,-460
"[Image[attributes={}; value=[ImageFormatCategory[attributes={}; value=[JPEG]], ImageFileName[attributes={}; value=[pct00004.jpg]], HeightMeasure[attributes={measureUnitCode=Px}; value=[55]], WidthMeasure[attributes={measureUnitCode=Px}; value=[149]]]]]","In an embodiment of the present disclosure, the solvent contained in the mixture of salicylaldehyde having the structure shown in Formula 1 and amino protecting agent in step 1 is selected from the group consisting of tetrahydrofuran, 2-methyltetrahydrofuran, acetonitrile and 1,4-dioxane.",False,1.0063968896865845,0.3482832150949323,9,41,-32,252,289,-37
"[상세하게는, 본 개시에 의해 제공된 화학식 3으로 나타낸 구조를 갖는 살리실아민 아세테이트를 제조하는 방법은 하기 단계를 포함한다:]","In an embodiment of the present disclosure, the mixture of salicylaldehyde having the structure shown in Formula 1 and amino protecting agent in step 1 further comprises triethylsilane.",False,0.6721019744873047,0.6389901594669208,17,28,-11,75,185,-110
"[단계 1, 화학식 1로 나타낸 구조를 갖는 살리실알데하이드를 아미노 보호제와 혼합하여 화학식 2로 나타낸 구조를 갖는 화합물을 수득하는 단계;]","In an embodiment of the present disclosure, the mixture of salicylaldehyde having the structure shown in Formula 1 and amino protecting agent in step 1 further comprises trifluoroacetic acid.",False,0.50340336561203,0.7325878790474387,19,29,-10,81,191,-110
"[단계 2, 화학식 2로 나타낸 구조를 갖는 화합물을 아세트산과 혼합 및 반응하여 화학식 3의 살리실아민 아세테이트를 수득하는 단계.]","In an embodiment of the present disclosure, the mixing temperature in step 1 is 0-50°C, and preferably 10-50°C.",False,1.2167350053787231,0.3011891221721022,18,18,0,75,111,-36
"[본 개시의 일 구체예에서, 단계 1에서 화학식 1로 나타낸 구조를 갖는 살리실알데하이드와 아미노 보호제의 혼합물에 함유되는 용매는 테트라하이드로푸란, 2-메틸테트라하이드로푸란, 아세토니트릴 및 1,4-디옥산으로 구성되는 군으로부터 선택된다.]","In an embodiment of the present disclosure, the mixing time in step 1 is 3-18 hours, and preferably 8-18 hours.",False,0.9023727178573608,0.4792678218996211,25,20,5,136,111,25
"입구측 선침기구(11)에 의하여 실렉터(7)가 경로(7A, 7H)로 선택되면, 실렉터(7)의 선단부(7b)가 선택용 버트(6b)의 후단을 전방으로 제1단계의 밀어올리기를 하여, 실렉트잭(6)을 A포지션 또는 H포지션으로 이동시킬 수 있다.","With regard to such engagement state, as with the entry-side needle selection mechanism 11, the intermediate needle selection mechanism 12 also allows the selection out of the A-, H- and B-positions of in the engagement state of the first stage.",False,0.7954103946685791,0.6084346379465829,23,40,-17,133,245,-112
"이러한 절체는, 제1단계의 결합에서는 선단부(7b)보다 돌출부(6c)의 후단이 후방이 되고, 중간측 선침기구(12)의 실렉터 구동캠(12b)의 입구측에서 기저상태의 경로(7B)로 실렉터(7)가 되돌려지면, 선단부(7b)가 돌출부(6c)의 후단보다 후방이 되도록 하여 두면 좋다.","With regard to the switching in two stages of the engagement points of the selector with the select jack, the engagement point to the tip part of the selector is switched from the rear end of the selection butt to the rear end of the overhang part.",False,0.8734347820281982,0.4994119963402795,26,47,-21,155,248,-93
"실렉터와 실렉트잭의 결합장소에 관한 2단계의 절체는, 실렉터의 선단부에 대한 결합장소를, 선택용 버트의 후단으로부터 돌출부의 후단으로 교체하는 것으로서, 본건 출원인은 선출원(先出願)인 일본국 특허출원 특원2019―073176호 공보에 개시되어 있다.",The present applicant discloses the present contents in the prior Japanese application of No. 2019-073176.,False,0.8397843241691589,0.407940447215623,26,15,11,140,106,34
"이 선출원에서는, 결합장소의 교체에 대하여 다른 예도 개시하고 있으며, 그러한 예를 본건 출원의 발명에 적용할 수도 있다.]","The prior application further discloses another example of switching of the engagement points, and such an example is applicable to the present invention.",True,0.3709835410118094,0.7393226486572706,17,23,-6,69,154,-85
"[도4는, 입구측 선침기구(11)에 관하여 도1에 나타내는 위상(a, b)에서의 실렉터(7)의 선택과 실렉트잭(6)의 위치관계를 도4(a―A), 도4(b―H), 도4(b―A)에 각각 나타낸다.","Fig. 4 shows the entry-side needle selection mechanism 11, and specifically Fig.4 (a-A), Fig. 4 (b-H), and Fig. 4 (b-A) show the positional relations between the selection for the selector 7 and the select jack 6 in the phases a, b shown in Fig. 1, respectively.",True,0.2360275983810424,0.88604374035856,17,46,-29,107,262,-155
"위상(a)에서는, 가압캠(15)에 의한 선택용 버트(6b)에 대한 가압에 의하여, 실렉트잭(6)은 니들베드(8)의 니들홈(8a)에 약 반 정도 가라앉혀져서, 실렉터(7)는 실렉트잭(6)을 도3(a)에 나타내는 결합장소에서 제1단계의 밀어올리기가 가능한 상태가 된다.","In the phase a, the select jack 6 is sunk by approximately. half height into the needle groove 8a of the needle bed 8 in response to the press applied by the pressing cam 15 to the selection butt 6b, so that the selector 7 is made to press the select jack 6 in the first stage at the engagement point shown in Fig. 3(a).",True,0.2965194582939148,0.8518229195310631,25,65,-40,148,320,-172
"도4(a―A)에 나타내는 실렉터(7)는 기저위치이지만, 도2에 나타내는 해방위치(α)에서 실렉트잭(6)을 A포지션으로 설정하는 선택을 받아서, 접극자(7a)에 대한 흡인 액추에이터(11a)로부터의 흡인은 해제되어 있다.","The selector 7 shown in Fig. 4 (a-A) is set to the base-state position, but is released from the attraction to the armature 7a by the attraction actuator 11a in response to the selection of setting the select jack 6 to the A-position, made at the release position α shown in Fig. 2.",True,0.2085410207509994,0.8988780569793356,19,53,-34,122,282,-160
"실렉트잭(6)을 H포지션으로 설정하는 선택에 대응하여 해방위치(β)에서 해방되거나, 실렉트잭(6)을 B포지션에 멈추게 하는 비선택에 대응하여 양 해방위치(α, β)에서 해방되지 않는 경우에, 위상(a)에서는 접극자(7a)가 흡인 액추에이터(11a)에 흡착되어 있는 상태가 된다.","In the case where the selector 7 is released at the release position β in response to the selection of setting the select jack 6 to the H-position, or in the case where the selector 7 is not released at the release position α nor β in response to the non-selection of keeping the select jack 6 in the B-position, the armature 7a is in the state of being attracted by the attraction actuator 11a in the phase a.",True,0.2477351278066635,0.8809351287402081,27,79,-52,155,410,-255
"B포지션에서는, 위상(a)의 가압캠(15)에 계속하여, 위상(b)의 이후에는 B프레서(33)가 선택용 버트(6b)를 가압한다.","In the B-position, as with the pressing cam 15 in the phase a, the B-presser 33 presses the selection butt 6b after the phase b.",True,0.3029481172561645,0.8389211776726571,10,25,-15,70,128,-58
"도4(b―H) 및 도4(b―A)는, 해방위치(β, α)에서 H, A포지션으로 각각 선택한 후의 위상(b)에서의 위치관계를 나타낸다.","Fig. 4 (b-H) and Fig. 4 (b-A) show the positional relations in the phase b after the H-position and the A-position are selected at the release positions β, α, respectively.",True,0.1252330094575882,0.932975971599404,13,30,-17,73,172,-99
"선택용 버트(6b)의 H, A포지션에는, 위상(b)보다 후행측에 선행 H프레서(32a) 및 선행 A프레서(31a)가 각각 형성되어 있다.","In the H- and A-positions for the selection butt 6b, the preceding H-presser 32a and the preceding A-presser 31a are provided in the succeeding side of the phase b, respectively.",True,0.2440627813339233,0.8754974726362948,14,30,-16,76,178,-102
"도4(b―H)는, 참고로서 선행 H프레서(32a)가 출몰식(出沒式)의 프레서인 것을 나타내며, 파선으로 비작용의 상태, 실선으로 작용의 상태를 나타낸다.","Fig. 4 (b-H) shows, for reference, the preceding H-presser 32a serving as a protruding/retracting type presser, specifically the non-acting state thereof with a dashed line and the acting state thereof with a solid line.",True,0.2796948850154876,0.8386929392067374,15,34,-19,85,220,-135
"또한 선행 A프레서(31a)에 관해서도 스윙식(swing式)의 프레서로서, 실선의 작용상태와 파선의 비작용상태를 나타낸다.","Fig. 4 (b-H) further shows the preceding A-presser 31a serving as a swing type presser, specifically the acting state thereof with a solid line and the non-acting state thereof with a dashed line.",True,0.4551005065441131,0.721050519673141,11,33,-22,68,196,-128
"선행 A프레서(31a) 및 선행 H프레서(32a)를 포함하여, A포지션이나 B포지션에 형성되는 프레서나 전술한 가압캠(15)은, 작용상태에서의 높이를 B프레서(33)의 높이보다 낮게 하여, 실렉트잭(6)의 선택용 버트(6b)가 니들홈으로부터 반 정도 돌출되도록 하여 둔다.]","The pressers disposed in the A-position and the B-position and the pressing cam 15 described above including the preceding A-presser 31a and the preceding H-presser 32a in the acting states are set to have lower heights than the B-presser 33, so that the selection butt 6b of the select jack 6 protrudes by approximately half height from the needle groove.",True,0.2942644953727722,0.8465701092995315,27,60,-33,153,356,-203
"[도5는 중간측 선침기구(12)에 관하여, 도1에 나타내는 위상(c, d)에서의 실렉터(7)와 실렉트잭(6)의 위치관계의 일부를 도5(c―H→F), 도5(d―A), 도5(d―F)에 각각 나타낸다.","Fig. 5 shows the intermediate needle selection mechanism12, and specifically Fig. 5 (c-H to F), Fig. 5 (d-A), and Fig. 5 (d-F) partially show the positional relations between the selector 7 and the select jack 6 in the phases c, d shown in Fig. 1, respectively.",True,0.2834829986095428,0.8537078282092303,17,46,-29,109,261,-152
"위상(c)에서는 가압캠(15)에 의한 선택용 버트(6b)에 대한 가압이 없고, H, A포지션에서는 프레서로부터의 가압도 없기 때문에, 실렉트잭(6)은 니들베드(8)의 니들홈(8a)에 가라앉혀지지 않아서, 실렉터(7)는 실렉트잭(6)을 도3(b)에 나타내는 것과 같은 제2단계의 결합장소로 밀어올리는 것이 가능하게 된다.","Thus, the select jack 6 is not sunk in the needle groove 8a of the needle bed 8, and the selector 7 is able to push up the select jack 6 at the engagement point in the second stage as shown in Fig. 3(b).",False,0.4038660228252411,0.8010628411052269,31,44,-13,178,203,-25
"도5(c―H→F)에 나타내는 실렉터(7)는 기저상태로서, 실렉트잭(6)은 H포지션이다.","The selector 7 shown in Fig. 5 (c-H to F) is in the base state, and the select jack 6 is in the H-position.",True,0.2228789627552032,0.8839279756835338,6,24,-18,48,107,-59
"실렉터(7)는, 위상(c)에 선행하는 해방위치(α)에서 선택을 받아서, 접극자(7a)는 흡인 액추에이터(12a)로부터 해방되어 있다.","In the selector 7, the armature 7a is released from the attraction actuator 12a in response to the selection made at the release position α preceding the phase c. This selection allows the select jack 6 to guide from the H-position to the F-position.",False,0.3957694172859192,0.7958603506446301,11,44,-33,74,250,-176
"또 해방위치(α)에서의 실렉터(7)의 선택은, A포지션의 실렉트잭(6)에 대해서도 F포지션까지 안내할 수 있다.",It is noted that the selection for the selector 7 at the release position α allows the select jack 6 to guide from the A-position to the F-position.,True,0.3557464480400085,0.8131688482772367,11,28,-17,62,148,-86
"도5(d―A) 및 도5(d―F)는, 위상(d)에서 실렉트잭(6)을 A, F포지션으로 안내한 상태를 각각 나타낸다.","Fig. 5 (d-A) and Fig. 5 (d-F) show the select jack 6 having been guided in the A- and F-positions in the phase d, respectively.",True,0.1658317893743515,0.9095532506508608,11,25,-14,63,127,-64
"제2단계의 밀어올리기는, H포지션으로부터 A포지션, H포지션 또는 A포지션으로부터 F포지션으로 각각 이행시킨다.]","The push-up in the second stage moves the select jack 6 to the A-position from the H-position, and to the F-position from the H-position or the A-position, respectively.",True,0.4307091236114502,0.7513192089204767,10,28,-18,63,169,-106
"[프레서군(30)은, 선행 A프레서(31a)를 비작용, 후행 A프레서(31b)를 작용, 선행 H프레서(32a)를 작용, 후행 H프레서(32b)를 비작용으로 설정함으로써, 다음과 같은 편성동작이 선택 가능하게 된다.","The presser group 30 allows the selection for the following knitting operation, by setting the preceding A-presser 31a to be in non-acting state, the succeeding A-presser 31b to be in acting state, the preceding H-presser 32a to be in acting state, and the succeeding H-presser 32b to be in non-acting state.",True,0.2627458870410919,0.8519252507051909,20,51,-31,119,308,-189
"입구측 선침기구(11)에서의 H포지션 또는 A포지션의 선택은, 턱 또는 니트의 편성동작의 종별 선택을 전반부분에서 하는 것에 각각 대응한다.",The selection of the H-position or the A-position in the entry-side needle selection mechanism 11 corresponds to the selection of a type of knitting operation of the tuck or the knit in the first half portion.,True,0.2984381020069122,0.8310859789643414,17,36,-19,78,209,-131
"이러한 H포지션을 선택하면, 니들잭(4)의 버트(4b)는 도1에 나타내는 턱의 경로(4bH)로 안내된다.",Such selection of the H-position allows the butt 4b of the needle jack 4 to be guided to the path 4bH for the tuck shown in Fig. 1.,True,0.2845357358455658,0.838772346113603,10,28,-18,58,131,-73
"입구측 선침기구(11)에 의하여 턱에 대응하는 H포지션을 선택하고 있으면, 중간측 선침기구(12)에서는, H포지션 또는 A포지션을 선택할 수 있어, 형성되는 턱의 스티치를 상대적으로 굵거나 또는 가늘게 하는 것과 같은 스티치값이 서로 다른 것을 각각 선택할 수 있다.","In the case where the H-position corresponding to the tuck is selected in the entry-side needle selection mechanism 11, the intermediate needle selection mechanism 12 allows the selection of the H-position or the A-position so as to form a knitted loop of the tuck in second stitch such as to be relatively loose or tight.",True,0.3979761898517608,0.7862485489756035,34,55,-21,149,322,-173
"입구측 선침기구(11)에 의하여 니트에 대응하는 A포지션을 선택하고 있으면, 중간측 선침기구(12)에서는, A포지션 또는 F포지션을 선택할 수 있어, 형성되는 니트의 스티치를 상대적으로 가늘거나 또는 굵게 하는 것과 같은 스티치값이 서로 다른 것을 각각 선택할 수 있다.","In the case where the A-position corresponding to the knit is selected in the entry-side needle selection mechanism 11, the intermediate needle selection mechanism 12 allows the selection of the A-position or the F-position so as to form a knitted loop of the knit in second stitch such as to be relatively tight or loose.",True,0.3375586569309234,0.8179654409652988,34,55,-21,151,322,-171
"본건 출원인은, 기본적인 스티치값이 서로 다른 동작에 대하여, 예를 들면 일본국 공개특허 특개평08―60499호 공보에 개시하고 있다.","The present applicant discloses basic second stitch operation, for example, in the Japanese Patent publication JPH08-60499A.",True,0.3252806961536407,0.7640444343600666,16,16,0,75,124,-49
"본 실시예는, 니트와 턱에 의하여 스티치값이 서로 다른 편성이 가능하기 때문에, B포지션의 미스를 포함하여 5종의 편성동작을 선택할 수 있도록 할 수 있다.]","The present example achieves second stitch knitting in the knit and the tuck, and thus enables the selection out of five types of knitting operation including a miss in the B-position.",True,0.4521956741809845,0.7309496534326866,22,31,-9,88,184,-96
"[본 실시예1에서는, 편침(3)으로서 슬라이더(5)의 선단측의 블레이드에 의하여 훅을 개폐하는 복합바늘을 사용하기 때문에, 본건 출원인이 일본국 특허 제5330249호 공보에 개시하고 있는 것과 같은 스플릿 편성(split knitting)의 편성동작을, 턱의 스티치값이 서로 다르고 또한 니트와 혼재시키는 것도 가능하다.","In the present example 1, the compound needle in which the blades disposed on the tip side of the slider 5 open and close the hook serves as the knitting needle 3.",False,0.3972093760967254,0.7639350028629324,35,32,3,180,163,17
"캠시스템(2)에 있어서 슬라이더(5)의 버트(5b)에 작용하는 슬라이더캠에 스티치를 형성할 때에, 블레이드가 니들베드갭으로 진출하고 있는 상태를 유지하는 안내경로를 형성하여 둔다.","In the cam system 2, the slider cam acting on the butt 5b of the slider 5 is provided with a guide path for keeping the blades in the state of reaching to the needle bed gap during forming of a knitted loop.",True,0.2194496542215347,0.8697161374032265,18,43,-25,100,207,-107
"슬라이더캠에는, F포지션에서 슬라이더(5)의 버트(5b)의 전방에 형성되는 보조버트를 가압하는 니트 프레서(knit presser)를 형성하여 둔다.",The slider cam is provided with a knit presser which presses the auxiliary butt provided in front of the butt 5b of the slider 5 in the F-position.,True,0.34495410323143,0.7945290388531692,13,28,-15,83,147,-64
"F포지션에서 니트 프레서를 작용시키면, 니들잭(4)을 스티치캠(21)에 의하여 인입할 때에, 슬라이더는 녹오버(knock over)되는 구루프(舊loop)를 지지하여 니들베드갭으로 진출하는 상태를 유지한다.","When the knit presser is made to act in the F-position, the slider keeps the state of reaching to the needle bed gap while holding the old loop to be knocked over, during when the stitch cam 21 draws the needle jack 4.",True,0.3695245087146759,0.7736251436102869,18,43,-25,115,218,-103
"이러한 스플릿 편성의 동작은, 입구측 선침기구(11)에 의하여 H포지션 또는 A포지션을 선택하고, 중간측 선침기구(12)에 의하여 F포지션을 선택함으로써 가능하게 된다.]",Such split knit operation is made possible by selecting the H-position or the A-position in the entry-side needle selection mechanism 11 and selecting the F-position in the intermediate needle selection mechanism 12.,True,0.2506230175495147,0.8682835196151955,18,32,-14,95,216,-121
[(실시예2)],[Example 2],True,0.0807447209954261,0.9439021811703476,1,2,-1,8,11,-3
"[도6은, 본 발명의 실시예2에서, 도1의 입구측 선침기구(11) 및 중간측 선침기구(12)에 각각 대응하는 입구측 선침기구(41) 및 중간측 선침기구(42)에 의하여 절체되는 실렉트잭(46)을 실렉터(47)로 이동시키기 위한 결합장소를 나타낸다.","Fig. 6 shows the engagement points in the example 2 according to the present invention, which are switched in an entry-side needle selection mechanism 41 and an intermediate needle selection mechanism 42 respectively corresponding to the entry-side needle selection mechanism 11 and the intermediate needle selection mechanism 12 shown in Fig. 1, and at which the select jack 46 is moved by the selector 47.",True,0.3385104835033417,0.8261350357693159,25,65,-40,138,407,-269
"본 실시예2에서는, 입구측 선침기구(41)에 가압캠(15)이 형성되지 않고, 중간측 선침기구(42)에 가압캠(45)이 형성된다.","In the present example 2, the entry-side needle selection mechanism 41 is provided without the pressing cam 15, while the intermediate needle selection mechanism 42 is provided with a pressing cam 45.",True,0.30536550283432,0.8191508513710276,11,32,-21,71,200,-129
"실렉트잭(46)과 실렉터(47)는, 가압캠(45)에 의한 결합장소의 절체에 관한 차이를 제외하고, 실시예1의 실렉트잭(6)과 실렉터(7)와 각각 동일하여, 캠시스템(2)도 실시예1과 동일하게 사용된다.","The select jack 46 and the selector 47 are the same as the select jack 6 and the selector 7 in the example 1, respectively, except for the difference in the switching of the engagement points by the pressing cam 45, and the cam system 2 is also used in the same way as in the example 1.",True,0.2545361518859863,0.8577981599023546,18,58,-40,112,286,-174
"실렉터(47)는, 니들베드갭으로부터 퇴출되는 방향이 되는 후단에, 니들홈 내에서 깊어지는 방향으로 돌출되는 돌기(47e)를 구비한다.","The selector 47 has a protrusion 47e protruding in the direction of deepening in a needle groove, on the rear end in the direction of retracting from a needle bed gap.",True,0.2207538783550262,0.8593880195546523,13,31,-18,74,167,-93
"실렉터(47)는, 실렉터(7)의 구동버트(7c) 및 인하버트(7d)와 동일한 구동버트(47c) 및 인하버트(47d)를 구비함과 아울러, 돌기(47e) 및 꼬리부(47f)도 구비한다.","The selector 47 has a drive butt 47c and a push-down butt 47d which are the same as the drive butt 7c and the push-down butt 7d of the selector 7, and further has the protrusion 47e and a tail part 47f.",True,0.1734978705644607,0.9034899729509028,15,42,-27,101,202,-101
"본 실시예2에서의 제1단계의 결합은, 도6(a)에 나타내는 바와 같이 실렉트잭(46)에 있어서 선택용 버트(46b)의 후단과 실렉터(47)의 선단부(47b)의 사이에서 이루어진다.","In the present example 2, with regard to the engagement in the first stage, as shown in Fig. 6(a), the rear end of the selection butt 46b of the select jack 46 is engaged with a tip part 47b of the selector 47.",True,0.2047850787639618,0.9011117499087712,17,43,-26,100,210,-110
"제2단계의 결합은, 도6(b)에 나타내는 바와 같이 실렉터(47)에 있어서 후단의 접극자(47a) 부근에 형성되는 돌기(47e)와 실렉트잭(46)의 돌기(46c) 사이에서 이루어진다.","With regard to the engagement in the second stage, as shown in Fig. 6(b), the protrusion 47e provided in the vicinity of an armature 47a provided on the rear end of the selector 47 is engaged with a protrusion 46c of the select jack 46.",True,0.2636186182498932,0.8660797165404912,17,45,-28,102,236,-134
"이러한 절체는, 도6(b)에서 실렉터(47)의 꼬리부(47f)가 니들홈 내에서 약간만 가라앉도록 가압함으로써 이루어진다.",Such switching is performed in response to the press applied so that the tail part 47f of the selector 47 is slightly sunk into the needle groove as shown in Fig. 6(b).,True,0.3712141811847687,0.7816073548237382,11,32,-21,67,168,-101
"결합장소의 절체는, 제1단계의 결합에서는 돌기(47e)보다 돌기(46c)가 후방으로, 입구측 선침기구(41)에 있어서 실렉터 구동캠(4lb)의 출구측에서 기저상태의 경로(7B)로 실렉터(47)가 되돌려지면, 돌기(47e)가 돌기(46c)보다 후방이 되도록 하여 두면 좋다.]","With regard to the switching of the engagement points, protrusion 46c is positioned behind the protrusion 47e in the engagement in the first stage, while when the selector 47 is returned to the path 7B of the base state in the exit side of a selector drive cam 41b of the entry-side needle selection mechanism 41, the protrusion 47e may be positioned behind the protrusion 46c.",True,0.2890233993530273,0.8552573421895967,24,66,-42,153,377,-224
"[도7은, 결합장소에 대한 2단계의 절체를 포함하는 실렉터(47)와 실렉트잭(46)의 위치관계를 나타낸다.","Fig. 7 shows the positional relations between the selector 47 and the select jack 46, including the switching in two stages of the engagement points.",True,0.233106717467308,0.8689324493442823,10,25,-15,59,149,-90
"위상(a, b, c, d)은 도1에 대응한다.","The phases a, b, c and d correspond to those shown in Fig. 1.",True,0.1810332387685775,0.8782585819712763,6,14,-8,25,61,-36
"도7(a―A)는, 실렉터(47)가 기저상태에서 실렉트잭(46)이 A포지션으로 선택되어 있는 위상(a)에서의 위치관계를 나타낸다.",Fig. 7 (a-A) shows the positional relation in the phase a where the selector 47 is in the base state and the A-position is selected for the select jack 46.,True,0.1901399344205856,0.9056239222122812,10,30,-20,71,155,-84
"도7(b―A)는, 입구측 선침기구(41)에 의하여 실렉트잭(46)이 A포지션이 되도록 이동하고 있는 위상(b)에서의 위치관계를 나타낸다.",Fig. 7 (b-A) shows the positional relation in the phase b where the select jack 46 is moved to the A-position in the entry-side needle selection mechanism 41.,True,0.2831190526485443,0.8574773269643093,12,28,-16,76,158,-82
이 상태는 도4(b―A)에 대응한다.,This state corresponds to the state shown in Fig. 4 (b-A).,True,0.1195890828967094,0.9260575888812962,4,11,-7,20,58,-38
도4(b―H)에 대응하도록 실렉트잭(46)을 H포지션으로 진행시킬 수도 있다.,"The select jack 46 may be moved to the H-position, as with the state shown in Fig. 4 (b-H).",True,0.2572331428527832,0.8546263302520138,7,19,-12,43,91,-48
"도7(c―A→F)는, 도7(b―A)에 계속하여 위상(c)에서 F포지션의 선침을 받고 있는 상태를 나타낸다.",Fig. 7 (c-A to F) shows the state in the phase c where the F-position is selected after the state shown in Fig. 7 (b-A).,True,0.2918044924736023,0.8362409967065502,10,25,-15,59,120,-61
"도7(d―F)는, 위상(d)에서 실렉트잭(46)을 A포지션으로부터 F포지션으로 이행시키는 도중의 상태를 나타낸다.]",Fig. 7 (d-F) shows the state in the phase d where the select jack 46 is moving from the A-position to the F-position.,True,0.1647950708866119,0.9100845130012108,9,23,-14,64,117,-53
"[실시예1, 2에서는, 입구측 선침기구(11, 41) 및 중간측 선침기구(12, 42)에 자력을 이용하는 흡인 액추에이터(11a, 12a ; 41a, 42a)를 사용하고 있지만, 특허문헌1과 같은 선침기구를 사용할 수 있다.","In the examples 1, 2, the entry-side needle selection mechanisms 11, 41 and the intermediate needle selection mechanisms 12, 42 are provided respectively with the attraction actuators 11a, 12a and the attraction actuators 41a, 42a, which utilize magnetic force, alternatively, the needle selection mechanism as disclosed in Patent Citation 1 may be used.",True,0.3090840578079223,0.823213202776702,25,53,-28,125,354,-229
"흡인 액추에이터(11a, 12a ; 41a, 42a)를 사용하면, 좌우방향의 대형화를 피할 수 있어, 중간측 선침기구(12, 42)를 기존의 캠시스템(2)의 중간에 형성할 수도 있다.","The use of the attraction actuators 11a, 12a or the attraction actuators 41a, 42a avoids size increase in the left-and-right direction, and further allows the arrangement of the intermediate needle selection mechanism 12 or 42 in the intermediate position of the existing cam system 2.",True,0.3043138682842254,0.8109511781412656,21,45,-24,102,285,-183
"또 편침(3)으로서 복합바늘을 사용하고 있지만, 래치니들(latch needle)을 사용할 수도 있다.","The compound needle serves as the knitting needle 3, or alternatively the latch needle may be used.",True,0.2723328173160553,0.8119073791212175,10,17,-7,57,99,-42
"본건 출원인은, 래치니들을 사용하는 스플릿 편성을, 예를 들면 일본국 특허 제5913427호 공보에 개시하고 있기 때문에, 그러한 동작을 중간측 선침기구(12)에 의하여 선택할 수 있도록 추가하면 좋다.","The present applicant discloses the split knit by use of the latch needle, for example, in the Japanese Patent Gazette JP5913427, and thus such operation may be added so as to be selectable in the intermediate needle selection mechanism 12.",True,0.2642099261283874,0.8407899813133834,25,40,-15,113,240,-127
"또한 본 발명은, 선침의 대상으로서 실렉터(7, 47)와 실렉트잭(6, 46)의 조합 이외의 것도 적용할 수 있다.]","Furthermore, in the present invention, any combination other than the selector 7 and the select jack 6 and the selector 47 and the select jack 46 is also available for needle selection.",True,0.3856923282146454,0.7739851284114677,15,32,-17,65,185,-120
"[1 : 횡편기 2 : 캠시스템 3 : 편침 4 : 니들잭 4b, 5b : 버트 5 : 슬라이더 6, 46 : 실렉트잭 6b, 46b : 선택용 버트 6c : 돌출부 7, 47 : 실렉터 7a, 47a : 접극자 7b, 47b : 선단부 8 : 니들베드 8a : 니들홈 10 : 선침기구 11 : 입구측 선침기구 11a, 12a : 흡인 액추에이터 1lb, 12b : 실렉터 구동캠 15, 45 : 가압캠 21 : 스티치캠 31 : 니트 프레서 31a : 선행 A프레서 3lb : 후행 A프레서 32a : 선행 H프레서 32b : 후행 H프레서 33 : B프레서 46c, 47e : 돌기 47f : 꼬리부]","1 Flatbed knitting machine 2 Cam system 3 Knitting needle 4 Needle jack 4b, 5b Butt 5 Slider 6, 46 Select jack 6b, 46b Selection butt 6c Overhang part 7, 47 Selector 7a, 47a Armature 7b, 47b Tip part 8 Needle bed 8a Needle groove 10 Needle selection mechanism 11 Entry-side needle selection mechanism 11a, 12a Attraction actuator 11b, 12b Selector drive cam 15, 45 Pressing cam 21 Stitch cam 31a Preceding A-presser 31b Succeeding A-presser 32a Preceding H-presser 32b Succeeding H-presser 33 B-presser 46c, 47e Protrusion 47f Tail part",True,0.4034731388092041,0.7761566551827875,103,90,13,339,536,-197
"[본 실시예에서는, 액추에이터(3d~3h)와, 액추에이터(3d~3h)의 동작을 지시하기 위한 조작 장치(조작 레버(19~21))와, 주위의 장해물을 검출하는 장해물 검출 장치(3D 센서(6~9)), 장해물 검출 장치(3D 센서(6~9))가 장해물을 검출한 경우에 액추에이터(3d~3h)의 동작을 제한하는 동작 제한 제어를 행하는 컨트롤러(14)와, 상기 동작 제한 제어의 해제를 지시하기 위한 제어 해제 장치(제어 해제 스위치(36))를 구비한 유압 셔블에 있어서, 컨트롤러(14)는, 상기 동작 제한 제어를 유효로 한 제어 모드인 통상 모드와, 동작 제한 제어를 일시적으로 해제한 제어 모드인 일시 해제 모드를 가지고, 통상 모드에 있어서, 제어 해제 장치(제어 해제 스위치(36))의 조작에 기인하여 일시 해제 모드로 이행하고, 일시 해제 모드에 있어서, 제어 해제 장치(제어 해제 스위치(36))의 조작에 기인하지 않는 소정의 조건이 성립한 경우에, 통상 모드로 복귀한다.]","According to the present embodiment, a hydraulic excavator includes actuators 3d through 3h, operation devices (operation levers 19 through 21) for instructing the actuators 3d through 3h to operate, obstacle sensors (3D sensors 6 through 9) for detecting an obstacle in the periphery, a controller 14 for performing operation limiting control to limit operation of the actuators 3d through 3h in a case where the obstacle sensors (3D sensors 6 through 9) detect an obstacle, and a control canceling device (control canceling switch 36) for instructing the controller 14 to cancel the operation limiting control, in which the controller 14 is configured to have a normal mode as a control mode for making the operation limiting control effective and a temporary cancelation mode as a control mode for temporarily canceling the operation limiting control, switch to the temporary cancelation mode in response to operation of the control canceling device (control canceling switch 36) while in the normal mode, and switch back to the normal mode in a case where a predetermined condition not responsive to operation of the control canceling device (control canceling switch 36) is satisfied while in the temporary cancelation mode.",True,0.1817492395639419,0.9146581240705476,103,193,-90,492,1229,-737
"[본 실시예에 의하면, 작업 시의 차체가 움직이기 시작함에 있어서, 오퍼레이터가 주위의 안전 확인을 실시한 후에는, 오퍼레이터는 제어 해제 스위치(36)를 조작함으로써, 동작 제한이 작동하는 통상 모드로부터 동작 제한이 작동하지 않는 일시 해제 모드로 이행하기 때문에, 차체 주위에 작업에 필요한 물체가 존재하고 있어도, 통상의 유압 셔블로서 작업을 행하는 것이 가능해진다.","According to the present embodiment, when the vehicle body is about to start moving at work, after the operator has checked safety in the periphery, the operator operates the control canceling switch 36 to switch from the normal mode in which operation limitation is enabled to the temporary cancelation mode in which operation limitation is not enabled.",False,0.3420121073722839,0.8341062232607879,48,57,-9,209,354,-145
"또한, 일시 해제 모드에 있어서 제어 해제 스위치(36)의 조작에 관계없이 소정의 조건이 성립함으로써, 제어 해제 스위치(36)의 조작에 의하지 않고 통상 모드로 복귀하기 때문에, 건설 기계와 주위 작업자의 접촉에 의한 사고 발생의 가능성을 낮추는 것이 가능해진다.]","In addition, when the predetermined condition not responsive to operation of the control canceling switch 36 is satisfied in the temporary cancelation mode, the controller 14 returns to the normal mode independently of operation of the control canceling switch 36, making it possible to reduce the possibility of an accident due to contact between the construction machine and a worker in the periphery thereof.",True,0.3433869481086731,0.8306071642886883,35,64,-29,149,411,-262
"[또한, 본 실시예와 관련된 유압 셔블은, 액추에이터(3d~3h)의 동작을 금지하는 락 위치(차단 위치)와 액추에이터(3d~3h)의 동작을 허가하는 락 해제 위치(연통 위치)로 전환 조작 가능한 동작 락 장치(락 밸브(28))를 더 구비하고, 상기 소정의 조건에는, 동작 락 장치(락 밸브(28))가 락 해제 위치(연통 위치)로부터 락 위치(차단 위치)로 전환된 것이 포함된다.]","Further, the hydraulic excavator according to the present embodiment further includes an operation lock device (lock valve 28) switchable between a locked position (interruption position) for inhibiting operation of the actuators 3d through 3h and an unlocked position (fluid communication position) for permitting operation of the actuators 3d through 3h, in which the predetermined condition includes switching of the operation lock device (lock valve 28) from the unlocked position (fluid communication position) to the locked position (interruption position).",True,0.2024272680282592,0.902241793159327,45,78,-33,212,563,-351
"[이에 따라, 작업을 중단하여 락 레버를 락 상태로 한 단계(락 스위치(15)가 OFF가 된 단계)에서 일시 해제 모드로부터 통상 모드로 복귀하기 때문에, 그 다음 차체가 움직이기 시작할 때에는, 다시 장해물 검지에 의한 차체 동작 제한 장치가 작동하여, 안전성을 향상시킨다.","With the above arrangement, inasmuch as the controller 14 returns from the temporary cancelation mode to the normal mode in a stage where work is interrupted and the lock lever is locked (the lock switch 15 is OFF), when the vehicle body is about to move next, a vehicle body operation limiting device works again due to obstacle detection, thereby increasing safety.",True,0.4009791910648346,0.805537477639525,38,62,-24,154,367,-213
"또한, 종래의 건설 기계에서도 행하고 있던 락 밸브(28)(동작 락 장치)의 조작에 의해 일시 해제 모드로부터 통상 모드로 복귀하기 때문에, 오퍼레이터가 일시 해제 모드로부터의 되돌림","Moreover, as the controller 14 returns from the temporary cancelation mode to the normal mode by operating the lock valve 28 (operation lock device) as performed on conventional construction machines, the controller 14 can return to the normal mode even if the operator forgets to take an operation action to return from the temporary cancelation mode, resulting in increased safety to lower the possibility of an accident due to contact between the construction machine that is about to move and a worker in the periphery.",False,0.4491781294345855,0.7665264827255349,24,85,-61,102,523,-421
"[또한, 본 실시예에 있어서, 상기 소정의 조건에는, 장해물 검출 장치(3D 센서(6~9))가 장해물을 검출하지 않는 상태가 소정 시간(제어 모드 복귀 시간 T2) 계속된 것이 포함된다.]","According to the present embodiment, further, the predetermined condition includes the continuation of a state in which the obstacle sensors (3D sensors 6 through 9) do not detect an obstacle over a predetermined period of time (control mode return time T2).",True,0.1989069879055023,0.8977558943468064,24,41,-17,105,258,-153
"[이에 따라, 락 밸브(28)(동작 락 장치)를 조작하고 있지 않아도, 장해물 검지 상태 v1이 「비검지」의 상태에서 제어 모드 복귀 시간 T2(예를 들면 30초) 경과한 시점에서 일시 해제 모드로부터 통상 모드로 복귀하기 때문에, 이것에 의해서도, 오퍼레이터가 일시 해제 모드로부터의 되돌림","With the above arrangement, since the controller 14 returns from the temporary cancelation mode to the normal mode when the control mode return time T2 (e.g., 30 seconds) has elapsed while the obstacle detection state v1 is representing ""non-detection"" even if the lock valve 28 (operation lock device) is not operated, the controller 14 can return to the normal mode even if the operator forgets to take an operation action to return from the temporary cancelation mode, resulting in increased safety to lower the possibility of an accident due to contact between the construction machine that is about to move and a worker in the periphery.",False,0.4153125882148742,0.8054251297169344,38,106,-68,163,642,-479
"[또한, 제어 모드 복귀 시간 T2는, 작업성과 안전성을 미리 충분히 고려하여 설정된다.",The control mode return time T2 is established taking into account operability and safety sufficiently in advance.,True,0.179777517914772,0.8905065886120096,12,17,-5,49,114,-65
"안전성을 향상시키기 위해서는 가능한 한 단시간에 일시 해제 상태로부터 통상 상태로 복귀시킨 쪽이 좋지만, 그에 따라 작업성을 저하시킬 가능성이 있다.]","For increased safety, the controller 14 should return from the temporary cancelation state to the normal state in as short a period of time as possible, which however may possibly reduce operability.",True,0.3429408073425293,0.7881659600289527,20,32,-12,84,199,-115
"[예를 들면, 유압 셔블이, 굴삭, 90° 선회, 방토, 되돌림이라고 하는 동작을 반복하는 덤프 적입 작업을 실시중에 있어서, 방토 시에만 주위 장해물로서 작업 대상의 토사산을 검지하는 경우를 생각한다.","For example, while the hydraulic excavator is carrying out dump truck loading work including repeated actions of excavating, 90° swinging, soil dropping, and returning, it is assumed that a gravel mound to work on is to be detected as a peripheral obstacle only upon soil dropping.",True,0.264711856842041,0.8318201482207288,27,46,-19,113,281,-168
"이 때, 장해물의 검지 상황으로서는 「검지」와 「비검지」가 유압 셔블의 동작에 연동하여 번갈아 발생하는 것이 된다.","At this time, ""detection"" and ""non-detection"" alternately occur with respect to the obstacle in ganged relation to operation of the hydraulic excavator.",True,0.3884222507476806,0.7268404757470954,15,22,-7,64,152,-88
"제어 모드 복귀 시간 T2를, 되돌림, 굴삭, 90° 선회의 합계 시간보다 짧게 설정한 경우, 오퍼레이터가 차체 동작 제한을 일시 해제하여 작업하고 있었다고 해도, 1사이클의 동안에, 「비검지」의 상태에서 “제어 모드 복귀 시간 T2가 경과한다”라고 하는 상황이 발생하여 일시 해제 모드로부터 통상 모드로 복귀해버린다.","In a case where the operator sets the control mode return time T2 to a value shorter than the total time used for returning, excavating, and 90° swinging, even if the operator has temporarily canceled vehicle body operation limitation and worked, a situation arises where ""the control mode return time T2 elapses"" in the state of ""non-detection"" during one cycle, allowing the controller 14 to return from the temporary cancelation mode to the normal mode.",True,0.1782106906175613,0.9139658369093866,42,75,-33,178,456,-278
"이 경우, 오퍼레이터는 1사이클마다 제어 해제 스위치(36)를 누를 필요가 있어, 작업성을 현저하게 저하시켜버린다.","In this case, the operator needs to press the control canceling switch 36 per cycle, resulting in significantly reduced operability.",True,0.1648470908403396,0.8997347800083866,13,20,-7,64,132,-68
"오퍼레이터는 작업성을 확보하기 위해, 통상 모드로 자동으로 복귀하지 않는 상시 해제 모드에서 사용하는 것이 예상되고, 그렇게 되면 본래 의도하고 있는 안전성의 향상의 효과가 얻어지지 않는다.]","In order to secure operability, the operator is expected to use the hydraulic excavator in the permanent cancelation mode where the controller 14 does not automatically return to the normal mode.",True,0.5947943925857526,0.6403429042458084,25,31,-6,107,195,-88
"[또한, 예를 들면 반대로, 작업 중에 자동 복귀하지 않는 것을 지나치게 우선하여 제어 모드 복귀 시간 T2를 필요 이상으로 길게(예를 들면 10분) 설정한 경우에는, 주위에 물체가 없어진 후에도 제어 해제 상태로 가동하는 시간이 길어지기 때문에, 이 경우에도 본래 의도하고 있는 안전성의 향상의 효과가 얻어지지 않는다.]","Conversely, in a case where the operator sets the control mode return time T2 to an unnecessarily long value (e.g., 10 minutes) by placing too much priority on preventing the controller 14 from automatically returning to the normal mode during work, since the hydraulic excavator operates in a control canceled state for a long period of time even after the periphery has been cleared of the item, increased safety as originally intended cannot be achieved.",False,0.3520067930221557,0.8250440906278524,45,75,-30,180,457,-277
"[따라서, 제어 모드 복귀 시간 T2는, 작업성과 안전성을 미리 충분히 고려하여 설정될 필요가 있다.]","Consequently, the control mode return time T2 is established taking into account operability and safety sufficiently in advance.",True,0.196016252040863,0.8830450829232094,14,18,-4,57,128,-71
"[또한, 본 실시예에 있어서, 컨트롤러(14)는, 동작 제한 제어를 상시 해제한 제어 모드인 상시 해제 모드를 더 가지고, 통상 모드에 있어서, 제어 해제 장치(제어 해제 스위치(36))의 조작 방법에 따라, 일시 해제 모드로 이행할지 상시 해제 모드로 이행할지를 결정하고, 상시 해제 모드에 있어서, 제어 해제 장치(제어 해제 스위치(36))의 조작에 기인하여 통상 모드로 복귀한다.","The controller 14 determines in the normal mode whether the controller 14 is to shift to the temporary cancelation mode or the permanent cancelation mode depending on how the control canceling device (control canceling switch 36) is operated, and the controller 14 shifts, in the permanent cancelation mode, to the normal mode in response to operation of the control canceling device (control canceling switch 36).",False,0.3058154582977295,0.8515851861434566,51,65,-14,215,414,-199
"본 실시예에서는, 제어 해제 장치(제어 해제 스위치(36))는, 모멘터리형의 누름 버튼 스위치로 구성되고, 컨트롤러(14)는, 통상 모드에 있어서, 제어 해제 스위치(36)의 압하 계속 시간(제어 해제 스위치 ON 시간 t1)이 소정 시간(해제 모드 판별 시간 T1) 미만인 경우에, 일시 해제 모드로 이행하고, 통상 모드에 있어서, 제어 해제 스위치(36)의 압하 계속 시간(제어 해제 스위치 ON 시간 t1)이 소정 시간(해제 모드 판별 시간 T1) 이상인 경우에, 상시 해제 모드로 이행한다.]","The controller 14 shifts to the temporary cancelation mode in a case where a continuously pressed time (control canceling switch ON time t1) of the control canceling switch 36 is shorter than a predetermined period of time (cancelation mode determining time T1) in the normal mode, and shifts to the permanent cancelation mode in a case where the continuously pressed time (control canceling switch ON time t1) of the control canceling switch 36 is equal to or longer than the predetermined period of time (cancelation mode determining time T1) in the normal mode.",False,0.2097129374742508,0.8979021668422267,65,93,-28,279,564,-285
"[이에 따라, 단일의 제어 해제 스위치(36)의 조작을 통하여, 일시 해제 모드로 이행할지 상시 해제 모드로 이행할지를 선택하는 것이 가능해진다.]",It is thus possible for the controller to select shifting to the temporary cancelation mode or shifting to the permanent cancelation mode through operation of the single control canceling switch 36.,True,0.2623179852962494,0.8478930960369171,19,31,-12,82,198,-116
"[이상과 같이 구성한 본 실시예에 의하면, 차체 주위에 작업에 필요한 물체가 존재하는 상황에서의 작업성을 확보하면서, 건설 기계와 주위 작업자의 접촉에 의한 사고 발생의 가능성을 낮출 수 있는, 안전성과 작업성을 양립시킨 건설 기계를 제공할 수 있다.]","According to the present embodiment arranged as described above, it is possible to provide a construction machine that achieves both safety and operability by lowering the possibility of an accident due to contact between the construction machine and a worker in the periphery of the vehicle body while securing operability in situations where an item required for work is present in the periphery.",True,0.1925695687532425,0.8881471120959726,35,63,-28,141,398,-257
[B[attributes={}; value=[실시예 2]]],[Second Embodiment],False,0.535836398601532,0.643480230085794,3,2,1,33,19,14
[본 발명의 제 2 실시예에 대하여 도 15를 이용하여 설명한다.,A second embodiment of the present invention will be described below with reference to FIG. 15.,True,0.169756680727005,0.8835796543777684,10,16,-6,36,95,-59
"본 실시예는, 제어 해제 스위치(36)의 조작에 관계없이 통상 모드로부터 일시 해제 모드로의 이행을 가능하게 한 것이다.",The present embodiment allows the controller 14 to shift from the normal mode to the temporary cancelation mode independently of operation of the control canceling switch 36.,True,0.2963933646678924,0.842745115528438,16,27,-11,67,174,-107
"이하, 제 1 실시예와의 상이점을 중심으로 설명한다.]",Differences from the first embodiment will mainly be described below.,True,0.2319049686193466,0.8285930269511725,7,10,-3,30,69,-39
"[도 15는, 본 실시예에 있어서의 제어 상태 전환 판정부(38)의 서브루틴인 통상 모드로부터의 전환 판정(단계 S13)의 추가 처리 부분을 나타낸 플로우 차트이다.","FIG. 15 is a flowchart of an additional processing sequence of a process of determining switching from a normal mode (step S13), as a subroutine of a controlled state switching determining section 38 according to the present embodiment.",True,0.1831525266170501,0.8937118079000311,21,38,-17,92,236,-144
"즉, 본 실시예에 있어서의 제어 상태 전환 판정부(38)는, 통상 모드로부터의 전환 판정(단계 S13)으로서, 도 9의 처리와 병행하여 도 15의 처리를 실행한다.]","Specifically, the controlled state switching determining section 38 according to the present embodiment carries out the processing sequence illustrated in FIG. 15 concurrent with the processing sequence illustrated in FIG. 9, as the process of determining switching from the normal mode (step S13).",True,0.2216942906379699,0.8757952052832353,21,43,-22,92,298,-206
"[우선, 검지중 조작 시간 t3의 카운트를 개시한다(단계 S64).]","First, the controlled state switching determining section 38 starts counting a during-detection operation time t3 (step S64).",True,0.3337826728820801,0.786764548237537,8,17,-9,38,125,-87
"[계속해서, 장해물 검지 상태 v1이 「검지」인지 여부를 판정하고(단계 S65), 「검지」가 아닌 경우(「비검지」인 경우)에는, 검지중 조작 시간 t3의 카운트를 정지하고 또한 초기값(0)으로 리셋하여(단계 S69), 처리를 종료한다.]","If the obstacle detection state v1 does not represent ""detection"" (if the obstacle detection state v1 represents ""nondetection""), then the controlled state switching determining section 38 stops counting the during-detection operation time t3, and resets the during-detection operation time t3 to a default value (0) (step S69), after which the processing sequence is ended.",False,0.3905349969863891,0.7864303195092619,25,54,-29,132,374,-242
"[장해물 검지 상태 v1이 「검지」인 경우에는, 차체 조작 상태 v2가 「조작중」인지 여부를 판정하고(단계 S66), 「조작중」이 아닌 경우(「비조작」인 경우)에는, 검지중 조작 시간 t3의 카운트를 정지하고 또한 초기값(0)으로 리셋하여(단계 S69), 처리를 종료한다.]","If the vehicle body operation state v2 does not represent ""during operation"" (if the vehicle body operation state v2 represents ""non-operation""), then the controlled state switching determining section 38 stops counting the during-detection operation time t3, and resets the during-detection operation time t3 to a default value (0) (step S69), after which the processing sequence is ended.",False,0.373257040977478,0.8080575731787191,30,57,-27,153,390,-237
"[차체 조작 상태 v2가 「조작중」인 경우에는, 검지중 조작 시간 t3이 일시 해제 자동 이행 시간 T3(예를 들면 5초) 이상이 되었는지 여부를 판정한다(단계 S67).]","If the vehicle body operation state v2 represents ""during-operation,"" then the controlled state switching determining section 38 determines whether or not the during-detection operation time t3 is equal to or longer than an automatic temporary cancelation shifting time T3 (e.g., 5 seconds) (step S67).",True,0.2730784118175506,0.8606437405822874,23,44,-21,96,302,-206
"[검지중 조작 시간 t3이 일시 해제 자동 이행 시간 T3에 도달하면, 제어 모드 상태 v3을 「일시 해제」로 하고(단계 S68), 검지중 조작 시간 t3의 카운트를 정지함과 함께 검지중 조작 시간 t3을 초기값(0)으로 리셋하여(단계 S69), 처리를 종료한다.]","If the during-detection operation time t3 has reached the automatic temporary cancelation shifting time T3, then the controlled state switching determining section 38 sets the control mode state v3 to ""temporary cancelation"" (step S68), stops counting the during-detection operation time t3, and resets the during-detection operation time t3 to a default value (0) (step S69), after which the processing sequence is ended.",True,0.1951820850372314,0.8975630504471416,35,62,-27,148,422,-274
"[검지중 조작 시간 t3이 일시 해제 자동 이행 시간 T3 미만인 경우에는, 단계 S65로 되돌아가고, 장해물 검지 상태 v1에 대한 판정 및 차체 조작 상태 v2에 대한 판정을 반복한다.]","If the during-detection operation time t3 is shorter than the automatic temporary cancelation shifting time T3, then the processing sequence goes back to step S65 and repeats the process of determining the obstacle detection state v1 and the process of determining the vehicle body operation state v2.",True,0.2534941732883453,0.863709820630031,29,47,-18,106,301,-195
"[도 15에 나타낸 통상 모드로부터의 교체 판정의 추가 처리 부분은, 통상 모드에서 작업중에, 장해물을 검지하여 차체 동작 제한이 작동하고 있는 상태에 있어서, 오퍼레이터가 차체의 조작을 계속함으로써, 제어 해제 스위치(36)를 누르지 않아도 자동으로 일시 해제 모드로 이행하는 것을 가능하게 하고 있다.]","The additional processing sequence of the process of determining switching from the normal mode, as illustrated in FIG. 15, makes it possible for the controller 14 to shift automatically to the temporary cancelation mode with the operator continuously operating the vehicle body without pressing the control canceling switch 36 while vehicle body operation limitation is being enabled with an obstacle detected during work in the normal mode.",True,0.3189508616924286,0.8480201784277573,40,67,-27,171,442,-271
[(제 2 실시예의 효과)],(Advantages of the second embodiment),False,0.3035552501678467,0.8009415522527736,4,5,-1,15,37,-22
"[본 실시예와 관련된 유압 셔블은, 조작 장치(조작 레버(19~21))의 조작의 유무를 검출하는 조작 검출 장치(조작압 센서(29~31))를 더 구비하고, 컨트롤러(14)는, 통상 모드에 있어서, 제어 해제 장치(제어 해제 스위치(36))의 조작에 기인하는 경우 외, 장해물 검출 장치(3D 센서(6~9))가 장해물을 검출한 상태에서 조작 검출 장치(조작압 센서(29~31))가 조작 장치(조작 레버(19~21))의 조작을 소정 시간(일시 해제 자동 이행 시간 T3) 이상 계속해서 검출한 경우에, 일시 해제 모드로 이행한다.]","According to the present embodiment, the hydraulic excavator further includes operation sensors (operation pressure sensors 29 through 31) for detecting whether the operation devices (operation levers 19 through 21) are operated or not, in which the controller 14 shifts to the temporary cancelation mode if the operation sensors (operation pressure sensors 29 through 31) have detected operation of the operation devices (operation levers 19 through 21) continuously over a predetermined period of time (automatic temporary cancelation shifting time T3) or longer while the obstacle sensors (3D sensors 6 through 9) are detecting an obstacle, other than in response to operation of the control canceling device (control canceling switch 36), in the normal mode.",True,0.2360052168369293,0.8907767709536156,60,113,-53,295,762,-467
"[장해물을 검출하면, 차체 동작 제한이 작동하여, 엔진 회전수가 제한됨으로써 차체의 동작이 느려져, 선회 파일럿압 차단 전자 밸브(34)와 주행 파일럿압 차단 전자 밸브(35)가 차단 위치로 전환됨으로써 선회/주행이 불능해진다.","When an obstacle is detected, vehicle body operation limitation is enabled, limiting the engine rotational speed to make operation of the vehicle body slower, and the swing pilot pressure interruption solenoid valve 34 and the travel pilot pressure interruption solenoid valve 35 are switched to the interruption position, making the vehicle body impossible to swing and travel.",True,0.2207444459199905,0.8778226521100204,27,57,-30,127,378,-251
"그러나, 장해물을 검출했다고 해도, 장해물로부터 멀어지거나, 주위의 안전 확인 후에 주위 장해물이 있는 상태에서 작업을 계속하거나 하기 위해서는, 차체 동작 제한의 작동을 해제할 필요가 있다.]","However, even though the obstacle is detected, it is necessary to cancel vehicle body operation limitation in order to move away from the obstacle and to continue work in the presence of the obstacle in the periphery after having checked safety in the periphery.",True,0.318164199590683,0.7995027237271725,25,44,-19,108,262,-154
"[본 발명의 제 1 실시예에서는, 그것을 위한 방법으로서 제어 해제 스위치(36)에 의한 차체 동작 제한의 해제를 가능하게 하고 있다.]","According to the first embodiment of the present invention, the control canceling switch 36 can cancel vehicle body operation limitation as a way of meeting such a need.",True,0.3043966591358185,0.8203007083718648,19,28,-9,76,169,-93
"[다만, 제어 해제 스위치(36)에 의한 차체 동작 제한의 해제를 행하는 경우에, 제어 해제 스위치(36)가 조작 레버(19~21)와는 다른 장소에 설치되어 있는 경우에는, 오퍼레이터는 조작 레버(19~21)로부터 한번 손을 떼고 나서 제어 해제 스위치(36)를 누를 필요가 있다.]","However, in a case where the control canceling switch 36 for canceling vehicle body operation limitation is located in a position different from that of the operation levers 19 through 21, the operator is required to take his/her hands off the operation levers 19 through 21 and then press the control canceling switch 36.",True,0.232476457953453,0.8691635416777882,34,54,-20,158,322,-164
"[장해물 검지 시에 오퍼레이터에게 주위의 안전 확인의 실시를 촉구한다고 하는 점에서는, 제어 해제 스위치(36)를 누르기 위해 조작 레버(19~21)로부터 손을 뗄 필요가 있는 것은 효과적이다.]","From the standpoint of prompting the operator to check safety in the periphery upon obstacle detection, it is effective for the operator to take his/her hands off the operation levers 19 through 21 in order to press the control canceling switch 36.",True,0.2980085015296936,0.8173279621262712,24,42,-18,109,248,-139
"[그러나, 특히 경사지나 진창이나 요철이 있는 지면의 갓길 부근에서의 가동 등, 차체를 금방 정지시키지 않고 어느 정도(장해물로부터 멀어지는 쪽으로) 이동하고 나서 정지시킨 쪽이, 전도나 전락, 미끄러짐에 의한 새로운 리스크의 발생을 억제할 수 있다고 하는 상황도 예견된다.]","However, there may be predictable situations where, especially while working on sloped terrain or a road shoulder of muddy or irregular terrain, the vehicle body should not be stopped immediately, but should be moved a certain distance away from an obstacle and then stopped, thereby avoiding a new risk due to falling over, falling down, or slippage.",True,0.2776449024677276,0.8285963057326501,36,57,-21,154,351,-197
"[이 경우, 특정의 한정된 상황에 따라서는, 제어 해제 스위치(36)를 누르기 위해 조작 레버(19~21)로부터 손을 떼고 차체를 한번 정지시키는 것보다 차체를 계속해서 움직여 확실히 안전하게 정지할 수 있는 상황까지 차체를 계속해서 움직이는 쪽이 좋다고 하는 경우가 있을 지도 모른다.]","In certain limited situations, it may be better for the operator to keep moving the vehicle body until it can be stopped reliably in safety, rather than taking his/her hands off the operation levers 19 through 21 to press the control canceling switch 36 and stopping the vehicle body.",True,0.2942796945571899,0.8408056833155011,38,49,-11,161,284,-123
"[본 실시예에 의하면, 장해물 검지 상태에 있어서도, 일정 시간 조작 레버(19~21)를 계속해서 조작한 단계에서 일시 해제 모드로 이행하여 차체 동작 제한이 해제되므로, 차체를 정지시키지 않고, 안전하게 정지할 수 있는 장소로의 이동이나 자세의 변경을 실시하는 것이 가능해진다.]","According to the present embodiment, even when an obstacle is detected, since the controller 14 shifts to the temporary cancelation mode to cancel vehicle body operation limitation when the operator has continuously operated the operation levers 19 through 21 for a certain period of time, it is possible to move the vehicle body to a place where it can be stopped in safety and change the posture of the vehicle body, without stopping the vehicle body.",True,0.3047738373279571,0.8529575360194818,36,76,-40,157,453,-296
"[물론, 원칙적으로는 장해물 검지 시에는, 가능한 한 조속히 안전하게 차체를 정지하고, 주위의 안전 확인을 행한 후에 제어 해제 스위치(36)를 눌러 일시 해제 모드로 이행하는 것이 바람직하기 때문에, 본 실시예에서 추가하고 있는 기능은, 어디까지나 긴급적인 기능으로서 운용하도록 사용자에게의 주의 환기가 별도 필요하다.]","Of course, inasmuch as when an obstacle is detected, it is desirable, in principle, for the operator to press the control canceling switch 36 to shift to the temporary cancelation mode after having stopped the vehicle body in safety as quickly as possible and checked safety in the vicinity, it is separately necessary to prompt the operator to pay attention to the fact that the function added according to the present embodiment is to be used as an emergency function.",True,0.2755680084228515,0.8581352662389223,41,80,-39,180,470,-290
"[이상, 본 발명의 실시예에 대하여 상세하게 설명했지만, 본 발명은, 상기한 실시예에 한정되는 것은 아니고, 다양한 변형예가 포함된다.","While the embodiments of the present invention have been described hereinbefore, the present invention is not limited to the above embodiments and covers various modifications.",True,0.2048909217119217,0.8542247753013018,17,25,-8,75,176,-101
"예를 들면, 상기한 실시예는, 본 발명을 이해하기 쉽게 설명하기 위해 상세하게 설명한 것이며, 반드시 설명한 모든 구성을 구비하는 것에 한정되는 것은 아니다.","For example, the above embodiments have been described in detail for easier understanding of the present invention; the present invention may not necessarily be limited to those including all the details described above.",True,0.2248511761426925,0.8365901290511161,22,33,-11,88,220,-132
"또한, 어느 실시예의 구성에 다른 실시예의 구성의 일부를 첨가하는 것도 가능하고, 어느 실시예의 구성의 일부를 삭제하거나, 혹은, 다른 실시예의 일부와 치환하는 것도 가능하다.]","It is possible to add parts of some embodiments to those of other embodiments, and also to delete parts of some embodiments or replace them with parts of other embodiments.",True,0.1899002939462661,0.8732550639425309,23,30,-7,99,172,-73
"[1…하부 주행체, 2…상부 선회체, 3…프론트 작업기, 3a…붐, 3b…아암, 3c…버킷, 3d…붐 실린더(액추에이터), 3e…아암 실린더(액추에이터), 3f…버킷 실린더(액추에이터), 3g…선회 모터(액추에이터), 3h…주행 모터(액추에이터), 4…운전실, 5…표시 장치, 6…3D 센서(장해물 검출 장치), 7…3D 센서(장해물 검출 장치), 8…3D 센서(장해물 검출 장치), 9…3D 센서(장해물 검출 장치), 10…검지 영역, 11…검지 영역, 12…검지 영역, 13…검지 영역, 14…차체 컨트롤러(컨트롤러), 15…락 스위치, 16…스위치 박스, 17…모니터 컨트롤러, 18…주위 검지 모니터, 19…선회 조작 레버(조작 장치), 20…주행 조작 레버(조작 장치), 21…프론트 조작 레버(조작 장치), 22…엔진, 23…엔진 제어 장치, 24…유압 펌프, 25…컨트롤 밸브, 26…유압원, 27…펌프 레귤레이터, 28…락 밸브(동작 락 장치), 29…선회 조작압 센서(조작 검출 장치), 30…주행 조작압 센서(조작 검출 장치), 31…프론트 조작압 센서(조작 검출 장치), 32…펌프 토출압 센서, 33…펌프 유량 제어압 센서, 34…선회 파일럿압 차단 전자 밸브, 35…주행 파일럿압 차단 전자 밸브, 36…제어 해제 스위치(제어 해제 장치), 37…동작 제한 제어부, 38…제어 상태 전환 판정부, 39…동작 제한 지령부, 40…검지 판정부, 41…조작 상태 판정부, 42…전자 밸브 구동부, 43…엔진 회전 제어부.]",1: Lower track structure 2: Upper swing structure 3: Front implement 3a: Boom 3b: Arm 3c: Bucket 3d: Boom cylinder (actuator) 3e: Arm cylinder (actuator) 3f: Bucket cylinder (actuator) 3g: Swing motor (actuator) 3h: Travel motor (actuator) 4: Cabin 5: Display device 6: 3D sensor (obstacle sensor) 7: 3D sensor (obstacle sensor) 8: 3D sensor (obstacle sensor) 9: 3D sensor (obstacle sensor) 10: Detection area 11: Detection area 12: Detection area 13: Detection area 14: Vehicle body controller (controller) 15: Lock switch 16: Switch box 17: Monitor controller 18: Periphery detection monitor 19: Swing operation lever (operation device) 20: Travel operation lever (operation device) 21: Front implement operation lever (operation device) 22: Engine 23: Engine controller 24: Hydraulic pump 25: Control valve 26: Hydraulic fluid source 27: Pump regulator 28: Lock valve (operation lock device) 29: Swing operation pressure sensor (operation sensor) 30: Travel operation pressure sensor (operation sensor) 31: Front implement operation pressure sensor (operation sensor) 32: Pump delivery pressure sensor 33: Pump flow rate control pressure sensor 34: Swing pilot pressure interruption solenoid valve 35: Travel pilot pressure interruption solenoid valve 36: Control canceling switch (control canceling device) 37: Operation limiting control section 38: Controlled state switching determining section 39: Operation limiting command section 40: Detection determining section 41: Operation state determining section 42: Solenoid valve actuating section 43: Engine rotation control section,True,0.2537521123886108,0.8538529895753116,142,225,-83,750,1586,-836
"[즉, 난방 운전일 때에는 리시버 내에 냉매가 잔여하지 않고 리시버의 냉매 탱크로서의 기능이 배제된다.]","That is, during the heating operation, the refrigerant does not remain in the receiver, and the function of the receiver as a refrigerant tank is excluded.",True,0.3198718428611755,0.8047683790997509,14,26,-12,58,155,-97
"[한편, 한랭지와 같이 외부의 온도가 영하 20도 이하를 유지하는 저온 지역에서의 냉난방 멀티 공기조화기의 운전은 대부분 난방 운전에 의존하게 된다.]","Meanwhile, the operation of the multi-air conditioner for heating/cooling operation in a low-temperature area where the outside temperature is maintained at minus 20 degrees Celsius or less, such as a cold region, is mostly dependent on the heating operation.",True,0.3000088334083552,0.8224789882000331,20,39,-19,84,259,-175
"[실외기는 저온의 외부에 방치되며, 이에 의해 오일 과열도가 확보되지 않아, 난방 운전의 초기 시동 시에 압축기 내부에서의 오일 유면이 최저 유면보다 낮아지는 현상이 발생할 수 있다.]","The outdoor unit is left outside at a low temperature, and thus the oil superheat is not secured, so that the oil level inside the compressor becomes lower than the lowest oil level at the initial start of the heating operation.",True,0.3141800761222839,0.828647673475385,26,41,-15,103,228,-125
"[따라서, 이를 방지하기 위하여 본 발명의 공기조화기는 난방 운전이 종료된 시점에서 오일 회수 운전을 수행하여 리시버에 압축기와 오일분리기 내의 오일을 회수하여 저장하기 위한 운전을 수행한다.]","Accordingly, in order to prevent this, the air conditioner of the present disclosure performs an oil recovery operation at the time when the heating operation is terminated, thereby performing an operation for recovering and storing the oil in the compressor and the oil separator in the receiver.",True,0.2522835433483124,0.8765707224491663,25,47,-22,108,297,-189
[이하에서는 도 4를 참고하여 오일 회수 운전을 설명한다.],"Hereinafter, an oil recovery operation will be described with reference to FIG. 4.",True,0.2181730419397354,0.8553327685979214,8,13,-5,33,82,-49
"[도 4를 참고하면, 본 발명의 냉난방 멀티 공기조화기의 초저온 지역, 즉 한랭지 지역에서의 난방 운전 시의 오일 회수 운전은 실외 상태, 즉, 실외의 온도에 따라, 사용자가 특정 모드를 선택하여 운전을 수행한 뒤 해당 운전의 종료된 시점에 사용자의 명령에 관계없이 능동적으로 구동된다.]","Referring to FIG. 4, the oil recovery operation during the heating operation in an ultralow temperature region, i.e., a cold region, of the multi-air conditioner for heating/cooling operation of the present disclosure is actively driven regardless of user's command at the end of a corresponding operation after a user selects a specific mode to perform operation according to the outdoor state, i.e., the outdoor temperature.",True,0.2441742569208145,0.8797487810828292,41,65,-24,161,426,-265
"[이와 같은 세부적인 운전을 수행하기 위해, 본 발명의 실시예에 따른 냉난방 멀티 공기조화기(100)는 제어부(도시하지 않음)을 포함할 수 있다.]","In order to perform such detailed operation, the multi-air conditioner 100 for heating/cooling operation according to the embodiment of the present disclosure may include a control unit (not shown).",True,0.1497626453638076,0.9126767396161308,18,29,-11,82,198,-116
"[제어부는 실내기(B) 내부의 온도, 실외기(A)의 외부 온도와 압축기(53)의 오일 유면 높이 정보를 주기적으로 읽어들이고, 사용자의 운전 모드 등의 입력 정보를 수신하여 그에 따라 실내기(B) 및 실외기(A)의 각 밸브 및 압축기(53)의 인버터 구동을 수행할 수 있다.]","The control unit periodically reads the internal temperature of the indoor unit B, the external temperature of the outdoor unit A, and the oil level information of the compressor 53, receives input information such as the user's operation mode, and accordingly may perform each valve of the indoor unit B the outdoor unit A and the inverter driving of the compressor 53.",True,0.1985500156879425,0.9024932754707118,35,62,-27,154,370,-216
"[제어부는 실외기(A) 내에 설치되어 있을 수 있으나, 이와 달리 관리자 관리 시스템 내에 프로세서로서 구현되어 있을 수 있다.","The control unit may be installed in the outdoor unit A, but, dissimilarly to this, may be implemented as a processor in a manager management system.",True,0.1796978712081909,0.8807002281499299,18,26,-8,71,149,-78
"또는, 실외기(A) 내에 선택되는 세부적인 모드에 따른 운전을 수행하기 위한 컨트롤러가 배치되어 있으며, 이와 송수신하는 메인 제어부가 관리자 관리 시스템에 설치되어 있을 수 있다.]","Alternatively, a controller for performing operation according to a selected detailed mode is disposed in the outdoor unit A and a main control unit that performs a transmission/reception with the controller may be installed in a manager management system.",True,0.1766336858272552,0.8892922028192629,24,39,-15,102,256,-154
[제어부의 다양한 변형에 대하여는 구체적인 설명은 생략한다. ],A detailed description of various modifications of the control unit will be omitted.,True,0.2548963725566864,0.799591441539549,8,13,-5,35,84,-49
"[제어부는 단순 사용자의 운전 선택 명령을 수신하고, 실내기(B) 및 실외기(A)에 배치되어 있는 온도 센서로부터 현재 실내 온도 및 실외 온도에 대한 정보를 수신한다. ]","The control unit receives a simple user's operation selection command, and receives information on the current indoor temperature and outdoor temperature from the temperature sensor disposed in the indoor unit B and the outdoor unit A.",True,0.2116256207227707,0.8751901772043967,24,36,-12,96,235,-139
[상기 제어부는 수신된 실내 온도 및 실외 온도와 사용자의 운전 선택 정보에 기초하여 각 밸브 및 압축기(53)의 인버터를 구동하여 난방 모드의 운전을 수행한다.],The control unit drives the inverters of each valve and compressor 53 to perform the operation of heating mode based on the received indoor and outdoor temperatures and user's operation selection information.,True,0.2839391827583313,0.851134792710111,23,32,-9,91,208,-117
"[이때, 사용자가 운전 종료 명령을 입력하거나, 운전 선택 명령의 예약 시간이 종료되면, 제어부는 실내기(B)와 실외기(A)의 동작을 모두 정지하며 난방 운전을 종료한다(S10).]","At this time, when the user inputs an operation termination command or a reserved time of the operation selection command is terminated, the control unit terminates both the indoor unit B and the outdoor unit A and terminates the heating operation (S10).",True,0.1907694786787033,0.8900140879964064,21,42,-21,101,254,-153
"[난방 운전이 종료되면, 제어부는 실외기(A)의 외기 온도, 즉 외부 온도를 감지하여 읽어들인다(S20).]","When the heating operation is terminated, the control unit detects and reads the outdoor air temperature of the outdoor unit A, i.e., the external temperature (S20).",True,0.1484615057706833,0.915854183762874,12,26,-14,60,165,-105
"[실외기(A)의 외기 온도가 제1 임계값보다 낮은 경우, 오일회수 운전을 시작한다(S30).]","When the outdoor air temperature of the outdoor unit A is lower than a first threshold value, an oil recovery operation is started (S30).",True,0.1760550737380981,0.8955884364725599,10,24,-14,52,137,-85
"[이때, 제1 임계값은 -20, Image[attributes={}; value=[ImageFormatCategory[attributes={}; value=[TIFF]], ImageFileName[attributes={}; value=[pat00001.tif]], HeightMeasure[attributes={measureUnitCode=Px}; value=[6]], WidthMeasure[attributes={measureUnitCode=Px}; value=[3]]]], 일 수 있으나, 이에 한정되는 것은 아니다.]","At this time, the first threshold value may be -20 °C, but is not limited thereto.",False,0.5489714741706848,0.6102937016381934,20,16,4,292,82,210
"[오일 회수 운전이 시작되면, 제어부는 오일 회수 밸브(86)를 개방하면서, 리시버 출구밸브(84)와 리시버 입구 밸브(82)를 모두 폐쇄한다(S40).]","When the oil recovery operation starts, the control unit closes both the receiver outlet valve 84 and the receiver inlet valve 82 while opening the oil recovery valve 86 (S40).",False,0.1585628986358642,0.9172771476916632,16,30,-14,86,176,-90
"[따라서, 리시버(54)는 오일 탱크로서 기능한다.","Accordingly, the receiver 54 serves as an oil tank.",True,0.2944470643997192,0.8292623645293926,5,9,-4,28,51,-23
"즉, 난방 모드일 때, 리시버(54) 내에 잔여하는 냉매가 없어 비어 있는 상태를 유지함으로써 저압으로 설정되어 있으며, 오일 회수 밸브(86)의 개방에 의해 상대적으로 고압인 오일분리기(58)와 압축기(53)로부터 저장되어 있던 오일이 모두 리시버(54) 내부로 회수된다.]","That is, when in heating mode, it is set to a low pressure by maintaining an empty state where there is no refrigerant remaining in the receiver 54, and the oil stored in the oil separator 58 and the compressor 53 that have a relatively high pressure is all recovered into the receiver 54 by opening the oil recovery valve 86.",True,0.1673697382211685,0.923832653826541,32,61,-29,154,326,-172
"[따라서, 리시버(54) 내에 오일이 저장되며, 이와 같은 동작은 리시버(54) 내의 수위 센서(93)로부터의 수위값을 주기적으로 읽어들여, 해당 수위값이 제2 임계값보다 크면 오일 회수 운전을 종료한다(S50).]","Therefore, oil is stored in the receiver 54, and such an operation periodically reads a water level value from a water level sensor 93 in the receiver 54(S50), and if the water level value is greater than a second threshold value, the oil recovery operation is terminated (S60).",True,0.2385618537664413,0.8869022759883411,24,48,-24,120,278,-158
"[또는 수위값의 변화량을 연산하여 현재 수위값이 이전 수위값과 차이가 없는 경우, 즉 리시버(54) 내의 압력과 압축기(53) 내의 압력이 동일해지는 경우 오일 회수 운전을 종료한다.]","Alternatively, when a current water level value is not different from a previous water level value after calculating the change amount of the water level value, i.e., when the pressure in the receiver 54 and the pressure in the compressor 53 become the same, the oil recovery operation is terminated.",True,0.3452827036380768,0.8295494355304799,24,50,-26,103,300,-197
"[이와 같이, 난방 운전의 종료 이후에 외부의 온도에 따라 자동으로 오일 회수 운전을 수행함으로써 한랭지에서의 압축기(53) 오일 소손에 의한 오류를 방지할 수 있도록 오일을 저장할 수 있다.]","Thus, oil can be stored to prevent an error due to oil burnout of the compressor 53 in a cold region, by automatically performing an oil recovery operation according to an external temperature after the heating operation is terminated.",True,0.363676369190216,0.8222921448109762,27,39,-12,108,235,-127
[이하에서는 오일 회수 운전을 완료한 이후의 난방 운전에 대하여 설명한다.],"Hereinafter, the heating operation after the oil recovery operation is completed will be described.",True,0.2393672615289688,0.84769605723436,10,14,-4,42,99,-57
"[도 5는 도 4의 냉난방 멀티 공기조화기의 오일회수 운전 후 난방 운전 시의 제어를 나타내는 순서도이고, 도 6은 도 5의 냉난방 멀티 공기조화기의 오일회수 운전 후 난방 운전을 나타내는 동작도이다.]","FIG. 5 is a flowchart illustrating a control during a heating operation after an oil recovery operation of the multi-air conditioner for heating/cooling operation of FIG. 4, and FIG. 6 is an operation diagram illustrating a heating operation after an oil recovery operation of the multi-air conditioner for heating/cooling operation of FIG. 5.",True,0.2406452447175979,0.8730217760027822,30,53,-23,113,343,-230
"[도 5 및 도 6을 참고하면, 제어부는 단순 사용자의 운전 선택 명령을 수신하고, 실내기(B) 및 실외기(A)에 배치되어 있는 온도 센서로부터 현재 실내 온도 및 실외 온도에 대한 정보를 수신한다(S100).]","FIGS. 5 and 6, the control unit receives a simple user's operation selection command, and receives information on the current indoor temperature and outdoor temperature from the temperature sensor disposed in the indoor unit B and the outdoor unit A (S100).",True,0.1458836048841476,0.9172743165528288,29,41,-12,118,257,-139
[상기 제어부는 수신된 실내 온도 및 실외 온도와 사용자의 운전 선택 정보에 기초하여 각 밸브 및 압축기(53)의 인버터를 구동하여 난방 모드의 운전을 시작한다.],The control unit drives the inverters of each valve and compressor 53 to perform the operation of heating mode based on the received indoor and outdoor temperatures and user's operation selection information.,True,0.308397114276886,0.8388480031897457,23,32,-9,91,208,-117
"[이때, 난방 운전 이전에 오일 회수 운전이 진행되어 리시버(54) 내에는 냉매가 아닌 오일이 저장되어 있는 상태이다.]","At this time, the oil recovery operation is performed before the heating operation, so that oil, not the refrigerant, is stored in the receiver 54.",True,0.3372870683670044,0.823532908389711,16,25,-9,67,147,-80
[난방 운전을 시작하기 위해 압축기(53)의 인버터를 시동하면서 제어부는 실외기(A)의 외부 온도와 압축기(53)의 오일레벨센서(94)로부터 오일 유면 높이 정보를 읽어들인다(S110).],"While starting the inverter of the compressor 53 to start the heating operation, the control unit reads the external temperature of the outdoor unit A and the oil level height information from the oil level sensor 94 of the compressor 53 (S110).",True,0.1973308622837066,0.9107382206253404,18,42,-24,105,245,-140
"[이때, 실외기(A)의 외기 온도가 제1 임계값보다 낮고, 압축기(53)의 오일의 유면 높이가 제3 임계값보다 낮은 경우, 압축기(53)의 오일이 부족한 것으로 판단하고, 리시버(54)로부터 오일을 압축기(53)로 공급한다(S120).]","At this time, when the outdoor air temperature of the outdoor unit A is lower than the first threshold value, and the level of the oil in the compressor 53 is lower than a third threshold value, it is determined that the oil in the compressor 53 is insufficient, and the receiver 54 supplies the oil to the compressor 53 (S120).",True,0.2104640156030655,0.8982573486422608,24,61,-37,132,328,-196
"[이때, 제1 임계값은 영하 20, Image[attributes={}; value=[ImageFormatCategory[attributes={}; value=[TIFF]], ImageFileName[attributes={}; value=[pat00002.tif]], HeightMeasure[attributes={measureUnitCode=Px}; value=[6]], WidthMeasure[attributes={measureUnitCode=Px}; value=[3]]]], 일 수 있으나, 이에 한정되는 것은 아니다.]","At this time, the first threshold value may be -20 °C, but is not limited thereto.",False,0.5843977332115173,0.5835109042904171,21,16,5,294,82,212
"[제3 임계값은 압축기(53)의 설계에 따라 다양하게 설정될 수 있으나, 압축기(53)의 모터가 운전 불가능한 임계값으로 정의될 수 있다. ]","The third threshold value may be variously set according to the design of the compressor 53, but may be defined as a threshold value in which the motor of the compressor 53 cannot be operated.",True,0.1803196370601654,0.8928370290925558,18,35,-17,79,192,-113
"[제어부는 오일리턴밸브(88)와 리시버 출구밸브(84)를 개방하면서, 리시버 입구 밸브(82)를 폐쇄한다.]",The control unit closes the receiver inlet valve 82 while opening the oil return valve 88 and the receiver outlet valve 84.,True,0.191412091255188,0.892225300423653,9,22,-13,60,123,-63
[리시버 출구밸브(84) 및 오일리턴밸브(88)의 개방에 의해 리시버(54) 내의 오일이 어큐뮬레이터(52)를 통해 오일리턴밸브(88)를 경유하여 압축기(53)에 제공된다.],"By opening the receiver outlet valve 84 and the oil return valve 88, the oil in the receiver 54 is provided to the compressor 53 via the oil return valve 88 through the accumulator 52.",True,0.2290035188198089,0.8831057387436136,15,35,-20,97,184,-87
"[따라서, 압축기(53) 내의 오일 유면이 상승한다.]","Accordingly, the oil level in the compressor 53 rises.",True,0.3248104155063629,0.8053862095608263,6,9,-3,30,54,-24
"[제어부는 압축기(53)의 오일 레벨 센서(94)로부터 오일 유면 레벨 정보를 주기적으로 읽어들여, 유면 레벨 정보가 제4 임계값보다 크면(S130), 리시버(54)의 입출구 밸브(82, 84)를 모두 폐쇄하고, 오일 리턴 밸브(88)도 폐쇄한다(S140).]","The control unit periodically reads oil level information from the oil level sensor 94 of the compressor 53, and when the oil level information is greater than a fourth threshold value (S130), closes all of the inlet and outlet valves 82 and 84 of the receiver 54, and closes also the oil return valve 88 (S140).",True,0.154855191707611,0.9257704122489708,27,56,-29,145,312,-167
[이에 의해 정상적인 난방 운전을 수행한다(S150).],"Accordingly, a normal heating operation is performed (S150).",True,0.2710027694702148,0.8224693605852346,6,8,-2,31,60,-29
"[이때, 제4 임계값은 압축기(53)의 모터 및 기어가 동작 가능한 정도의 레벨로서, 일 예로 오일 레벨 센서(94)는 제4 임계값보다 클 때 턴온되어 온 신호를 발송하고, 제4 임계값 이하에서는 턴오프되어 오프 신호를 발송하는 온오프 신호 발생기일 수 있다.]","For example, the oil level sensor 94 may be an on/off signal generator that is turned on and transmits an on-signal when it is greater than the fourth threshold value, and is turned off and transmits an off-signal when it is equal to or less than the fourth threshold value.",False,0.4221909344196319,0.7844192920487886,36,50,-14,146,274,-128
"[따라서, 오일 레벨 센서(94)로부터 턴온된 신호를 수신하면, 정상 난방 모드로의 전환이 가능하다.]","Therefore, when receiving the turn-on signal from the oil level sensor 94, it is possible to convert to the normal heating mode.",True,0.2824001908302307,0.8355953606140614,12,22,-10,57,128,-71
"[정상 난방 모드에서는 도 3과 같이 입출구밸브(82, 84)를 모두 폐쇄하고, 오일 리턴 밸브(88)도 폐쇄하며, 어큐뮬레이터(52)로부터 냉매를 전달받아 압축기(53)에서 냉매의 압축이 이루어진다. ]","In the normal heating mode, as shown in FIG. 3, both the inlet and outlet valves 82 and 84 are closed, the oil return valve 88 is also closed, and the refrigerant is received from the accumulator 52 and the refrigerant is compressed in the compressor 53.",True,0.2254769653081894,0.8854536689897335,22,47,-25,114,254,-140
"[이와 같이, 한랭지에서의 난방 운전을 진행할 때, 압축기(53) 내의 오일 소손을 보상하기 위해 리시버(54) 내에 오일을 저장하기 위한 오일 회수 운전을 수행하는 한편, 난방 운전의 시동 시에 압축기(53)의 오일 레벨을 읽어들여, 압축기(53) 내의 오일이 소손된 경우, 리시버(54)로부터 오일을 제공받는다.]","Thus, when performing a heating operation in a cold region, an oil recovery operation for storing oil in the receiver 54 is performed to compensate for oil loss in the compressor 53.",False,0.3897432088851928,0.8209667399158544,39,32,7,177,182,-5
"[따라서, 리시버(54)는 냉방 운전에서는 냉매 탱크로서, 난방 운전에서는 오일 탱크로서 기능할 수 있으며, 한랭지에서 실외기(A)의 저온 방치 운전에 의한 압축기(53)의 오일 소손을 보상할 수 있다.]","Accordingly, the receiver 54 may serve as a refrigerant tank in the cooling operation, and serve as an oil tank in the heating operation, and may compensate the oil loss of the compressor 53 due to the low-temperature neglected operation of the outdoor unit A in a cold region.",True,0.2535303831100464,0.8819778296550792,25,49,-24,114,277,-163
"[즉, 오일로 채워져 있는 고압의 리시버(54)로부터 순간적으로 오일을 제공받음으로써 전체 시스템의 저압을 소폭으로 상승시켜 압축기(53)의 시동 시 저압에 의한 운전 방해를 방지할 수 있다.]","That is, the low pressure of the entire system is slightly increased by instantaneously receiving oil from the high-pressure receiver 54 filled with oil, thereby preventing the operation interruption due to the low pressure at the start of the compressor 53.",True,0.2809124588966369,0.8553913422240798,24,41,-17,108,258,-150
[난방 운전의 시동 시에 압축기(53)에 순간적으로 오일을 제공함으로써 압축기(53)의 오일 과열도가 10도 이상 형성되면 시스템의 오일의 회수는 정상 운전만으로 충분히 이루어질 수 있다.,"When the oil superheat of the compressor 53 is formed by 10 degrees or more by instantaneously providing oil to the compressor 53 at the start of the heating operation, the system's oil recovery can be sufficiently achieved only by the normal operation.",True,0.2044044286012649,0.8984001650058256,23,43,-20,105,253,-148
"따라서, 리시버(54)에 의한 오일 제공은 시동 시에 압축기(53)의 오일 레벨 센서(94)의 턴 온 이후에는 진행하지 않아도 무방하나, 주기적으로 오일 레벨 센서(94)로부터의 신호를 받아 난방 운전 중에도 진행될 수 있다.]","Therefore, the receiver 54 does not need to perform the oil supply after the oil level sensor 94 of the compressor 53 is turned on at the time of starting, but may perform the oil supply even during a heating operation by periodically receiving a signal from the oil level sensor 94.",True,0.2018255889415741,0.910246648025448,29,52,-23,127,283,-156
"[이에 따라, 큰 구조 변경 없이 난방 운전 후에 오일 회수 운전을 진행함으로써 압축기(53)의 신뢰성을 향상시켜 한랭지에서도 에러 없이 동작 가능하여 공기조화기의 운전 보증 온도가 확대될 수 있다.]","Accordingly, the reliability of the compressor 53 is improved by performing the oil recovery operation after the heating operation without a major structural change, so that the compressor 53 can be operated without errors even in cold regions, thereby increasing the operation guarantee temperature of the air conditioner.",True,0.2872850596904754,0.8562992358366692,28,48,-20,112,323,-211
"[이상에서는 본 발명의 바람직한 실시예에 대하여 도시하고 설명하였지만, 본 발명은 상술한 특정의 실시예에 한정되지 아니하며, 특허청구범위에서 청구하는 본 발명의 요지를 벗어남이 없이 당해 발명이 속하는 기술분야에서 통상의 지식을 가진 자에 의해 다양한 변형실시가 가능한 것은 물론이고, 이러한 변형실시들은 본 발명의 기술적 사상이나 전망으로부터 개별적으로 이해되어서는 안될 것이다.]","As described above, the present disclosure can prevent oil burnout without adding a structure by changing the usage of the receiver not used in the heating mode so as to be used as an oil storage component in the accumulator of the multi-air conditioner for heating/cooling operation using a receiver.",False,0.9338282942771912,0.4011585712094845,47,50,-3,214,301,-87
"[100 : 냉난방 멀티 공기조화기 A: 실외기 열교환기 B: 실내기 54: 리시버 53: 압축기 52: 어큐뮬레이터 65, 67 : 전자팽창밸브 62: 사방밸브 ]","In addition, the recovery operation may be actively performed according to the current state of the air conditioner by periodically checking the outdoor temperature and the compressor water level and accordingly performing the oil recovery operation.",False,1.0466420650482178,0.3891400599742129,23,36,-13,92,250,-158
"이때, 인코더(110)와 제1 디코더(120)는 제1 디코더(D, Sub[attributes={}; value=[1]], )(120)에 의해 추론된 트레이닝 데이터의 레이블(D, Sub[attributes={}; value=[1]], (E(X))과 정답 데이터(y) 간의 차이를 최소화하도록 하는 제1 손실(loss)에 의해 트레이닝될 수 있다.]",The encoder E 110 and the first decoder D1 120 may be trained by a first loss that minimizes a difference between a label D1(E(x)) of the training data inferred by the first decoder D1 120 and ground truth data y.,False,0.2877704501152038,0.8424512379343209,29,41,-12,194,213,-19
"[또한, 제2 디코더(D, Sub[attributes={}; value=[2]], )(140)는 인코더(E)(110)에 의해 생성된 특징 벡터 또는 코드를 디코딩 함으로써 트레이닝 데이터를 복원할 수 있다.","Also, the second decoder D2 140 may restore training data by decoding the feature vector or code generated by the encoder E 110.",False,0.2060291320085525,0.8852983166458788,20,23,-3,115,128,-13
"인코더(110)와 제2 디코더(140)는 제2 디코더(D, Sub[attributes={}; value=[2]], )(140)에 의해 복원된 트레이닝 데이터(D, Sub[attributes={}; value=[2]], (E(x))와 트레이닝 데이터(x) 간의 차이를 최소화하도록 하는 제2 손실에 의해 트레이닝될 수 있다.]",The encoder E 110 and the second decoder D2 140 may be trained by a second loss that minimizes a difference between training data D2(E(x)) reconstructed by the second decoder D2 140 and the training data x.,False,0.2143296897411346,0.880034179138939,27,37,-10,181,206,-25
"[제2 디코더(D, Sub[attributes={}; value=[2]], )(140)는 트레이닝 데이터(X)에 대응하는 전체 영역이 아닌, 트레이닝 데이터(X)의 일부 영역(예를 들어, 중요 부분 r(y))을 복원하도록 적응적으로 가이드 또는 제한될 수 있다.","The second decoder D2 140 may be adaptively guided or restricted to reconstruct a portion, for example, an important portion r(y), of the training data x, instead of all portions corresponding to the training data x.",False,0.257565438747406,0.8700003267820284,26,36,-10,146,216,-70
"이 경우, 트레이닝 장치(100)는 제2 디코더(D, Sub[attributes={}; value=[2]], )(140)에 의해 복원된 중요 영역과 트레이닝 데이터(x) 간의 차이를 최소화하도록 정의되는 제2 손실에 의해 트레이닝될 수 있다.","In this example, the training apparatus 100 may be trained by a second loss defined to minimize a difference between the training data x and an important region reconstructed by the second decoder D2 140.",False,0.217813491821289,0.8858744108775796,25,35,-10,135,204,-69
"이로 인하여 제2 디코더(D, Sub[attributes={}; value=[2]], )(140)는 입력 데이터 내 중요 영역에 해당하지 않는 부분 대비 중요 영역에 해당하는 부분에 대하여 높은 정확도로 복원을 할 수 있다.","Accordingly, the second decoder D2 140 may reconstruct a portion corresponding to an important region of input data with a high accuracy, in comparison to a portion that does not correspond to the important region.",False,0.2734676301479339,0.8476431962682363,27,35,-8,125,214,-89
"여기서, 정확도는 복원 정확도를 의미하며, '유사도'라고도 표현할 수 있다.]","The term ""accuracy"" used herein may refer to a reconstruction accuracy and may also be represented as a ""similarity"".",True,0.2617828249931335,0.8171752150169637,9,19,-10,43,117,-74
"[여기서, 중요 부분은 트레이닝 데이터(X)의 지역적 중요도(Local Importance)에 따라 적응적으로 결정될 수 있다.",The important portion r(y) may be adaptively determined based on a local importance of the training data x.,True,0.3163440525531769,0.8173113588399824,13,18,-5,71,107,-36
중요 부분은 트레이닝 데이터(X) 전체 중 일부에 해당하는 중요 부분을 마스킹(masking)하는 역할을 수행할 수 있다.],The important portion r(y) may perform a function of masking to distinguish an important portion corresponding to a portion of the training data x.,True,0.3956618607044238,0.7599667556125098,15,24,-9,69,147,-78
"[예를 들어, 트레이닝 데이터가 영상 데이터인 경우, 중요 부분은 공간적 중요도(Spatial Importance)에 따라 결정될 수 있다.","For example, when training data is image data, an important portion may be determined based on a spatial importance.",True,0.2749300003051758,0.8515395027186496,16,19,-3,78,116,-38
"트레이닝 데이터가 영상 데이터인 경우, 중요 부분은 예를 들어, 해당 영상 데이터에서 사용자의 관심 영역(Region Of Interest; ROI)에 해당할 수 있다.","In an example, when training data is image data, an important portion may correspond to a region of interest (ROI) of a user in the image data.",True,0.2674747407436371,0.863619846830738,21,27,-6,94,143,-49
"또는, 예를 들어, 트레이닝 데이터가 음성 데이터인 경우, 중요 부분은 시간적 중요도(Temporal Importance)에 따라 결정될 수 있다.","In another example, when training data is audio data such as voice data, an important portion may be determined based on a temporal importance.",True,0.2896972894668579,0.8429967146673438,17,24,-7,82,143,-61
"트레이닝 데이터가 음성 데이터인 경우, 중요 부분은 예를 들어, 해당 음성 데이터에서 주 화자가 발화하는 시간 구간인 관심 시간 구간에 해당할 수 있다. ]","When training data is voice data, an important portion may correspond to a time interval of interest in the voice data in which a main speaker utters.",True,0.2677912712097168,0.8448300308448973,24,27,-3,87,150,-63
"[일 실시예에서 중요 부분(예를 들어, 관심 영역)은 다음과 같은 방법들을 통해 정의(또는 설정)될 수 있다.","Hereinafter, methods of defining or setting an important portion (for example, an ROI) are described.",True,0.4106696546077728,0.7540591524280525,15,15,0,61,101,-40
"관심 영역은 예를 들어, 픽셀 와이즈 정보(Pixel-Wise Information)에 기초한 타겟 영상(Target image)의 각 픽셀 값에 의해 정의될 수 있으며, r(y)로 표기될 수 있다.","In an example, the ROI may be defined by each pixel value of a target image based on pixel-wise information and may be denoted by r(y).",True,0.268194705247879,0.8560440747405531,23,26,-3,111,135,-24
"여기서, 타겟 영상은 '정답 영상(Ground truth image)'이라고도 부를 수 있다.","In this example, the target image may be referred to as a ""ground truth image"".",True,0.2310811728239059,0.8526133589426024,10,15,-5,52,79,-27
"관심 영역은 예를 들어, 검출 윈도우(detection window)를 이용하여 검출되는 타겟 영상의 위치 정보에 의해 정의될 수 있다. ]",The ROI may be defined by location information of a target image detected using a detection window.,True,0.4253538846969604,0.7501175692760471,18,17,1,78,99,-21
"[또는, 다른 실시예에서, 관심 영역은 예를 들어, 후술하는 특징 활성화(feature activation) 영역의 분류(Classification)를 통해 정의될 수 있다.","In another example, the ROI may be defined through a classification of a feature activation region.",True,0.4336592853069305,0.7477933917381405,17,16,1,97,99,-2
"이 경우, 관심 영역은 r(E(x))라고 표기될 수 있다.]","In this example, the ROI may be indicated as r(E(x)).",True,0.304766982793808,0.8211115420036675,8,10,-2,33,53,-20
"[일 실시예에서는 제2 디코더(D, Sub[attributes={}; value=[2]], )(140)에 의해 추가적으로 정의되는 제2 손실 값에 의해, 트레이닝 데이터(X) 전체를 복원하는 것에 비해 인공 신경망에 주어지는 부하를 상대적으로 감소시키는 한편, 트레이닝 데이터(X)의 중요 영역에서의 보편성(generality)을 향상시킬 수 있다.","In an example, by a second loss value additionally defined by the second decoder D2 140, the training apparatus 100 of one or more embodiments may reduce a load provided to the ANN in comparison to a typical training apparatus that may reconstruct the entire training data x, and the training apparatus 100 of one or more embodiments may enhance generality in the important region of the training data x.",False,0.3196548521518707,0.8339133551247776,35,70,-35,195,404,-209
"또한, 일 실시예에서는 제2 디코더(D, Sub[attributes={}; value=[2]], )(140)에 의한 복원 영역을 제한함으로써 신경망의 추가적인 오버 헤드(overhead)를 최소화하여 학습 성능 하락을 방지할 수 있다.","Also, by restricting a reconstruction region by the second decoder D2 140, the training apparatus 100 of one or more embodiments may minimize an additional overhead of a neural network of the second decoder D2, to prevent a decrease in training performance.",False,0.327358603477478,0.8130803630199543,23,42,-19,131,257,-126
"그 결과, 일 실시예에 따르면, 다량의 입력 데이터를 이용하지 않고도 인공 신경망의 과적합(Overfitting)을 방지하고, 인공 신경망의 전반적인 성능을 향상시킬 수 있다.]","As a result, the training apparatus 100 of one or more embodiments may enhance the overall performance of the ANN and prevent overfitting of the ANN even though a large quantity of input data is not used.",True,0.3881389200687408,0.7617081256990131,21,37,-16,99,204,-105
"[일 실시예에 따른 트레이닝 장치(100)는 트레이닝 데이터(x)에 비해 차원(Dimension)이 줄어든 특징 또는 코드를 생성한 후, 이를 다시 복원하는 과정을 통해 데이터의 차원을 축소하고(Dimension Reduction), 노이즈(Noise) 등과 같은 아티팩트(Artifact)의 발생을 감소시킬 수 있다.","The training apparatus 100 of one or more embodiments may generate a feature or code with a dimension reduced in comparison to the training data x, may reduce a dimension of data through a process of reconstructing the feature, and may prevent an occurrence of artefacts such as noise.",True,0.2303643375635147,0.8677668264634308,32,49,-17,178,285,-107
"또한, 인코더(110)와 제2 디코더(140)로 구성되는 오토 인코더는 일반적으로 의미 있는 특징을 생성할 뿐만 아니라, 지도 학습(Supervised Learning)에 해당하면서도 트레이닝하고자 하는 대상(Target)에 해당하는 결과 데이터가 트레이닝 데이터와 동일하기 때문에 이를 획득하기 위한 추가 노력을 필요로 하지 않으며, 트레이닝되는 특징의 범용성(generality)을 향상시킬 수 있다. ]","Since result data corresponding to a target to be trained and supervised learning is identical to training data, the auto encoder of one or more embodiments may not need to make an extra effort to obtain the result data, and may enhance generality of a feature to be trained.",False,0.4735679626464844,0.7334092446734135,43,49,-6,228,275,-47
[도 2는 일 실시예에 따른 추론 방법을 나타낸 흐름도이다.,FIG. 2 illustrates an example of an inference method.,True,0.3482197225093841,0.7591868964692803,9,9,0,33,53,-20
"도 2를 참조하면, 일 실시예에 따른 추론 장치는 입력 데이터를 수신한다(210). 입력 데이터는 예를 들어, 영상 데이터 및 음성 데이터 등을 포함할 수 있으며, 반드시 이에 한정되지는 않는다.","The input data may include, for example, image data or voice data, but is not limited thereto.",False,0.4961692094802856,0.7143853296427869,28,17,11,109,94,15
"추론 장치는 예를 들어, 통신 인터페이스(도 10의 1010 참조)를 통해 입력 데이터를 수신할 수 있다. ]","The inference apparatus may receive input data using, for example, a communication interface 1010 of FIG. 10.",True,0.1555635631084442,0.9076110201399876,16,17,-1,61,109,-48
"[추론 장치는 단계(210)에서 수신한 입력 데이터에 반응하여 인공 신경망이 활성화(activation)되는 상태 정보에 기초하여, 입력 데이터로부터 추론된 정보를 제공한다(220). ]","In operation 220, the inference apparatus may provide or determine information inferred from the input data based on state information about a state in which an ANN is activated in response to the input data received in operation 210.",True,0.3500761687755584,0.7983737791807183,19,39,-20,104,234,-130
"[여기서, '상태 정보'는 예를 들어, 인공 신경망을 구성하는 노드들의 내부 상태를 나타내는 정보에 해당할 수 있다.","The state information may correspond to, for example, information indicating an internal state of nodes constituting the ANN.",True,0.3643419742584228,0.7936528376297566,16,18,-2,65,125,-60
"이때, 노드들의 내부 상태에는 신경망의 피드백 구조에 의해 이전 시점에서 처리된 정보들이 축적된 정보(예를 들어, 공간 정보(spatial information) 및/또는 시간 정보(temporal information))가 내제될 수 있다.","The internal state of the nodes may include information (for example, spatial information and/or temporal information) obtained by accumulating information processed in a previous time by a feedback structure of a neural network.",True,0.1850532740354538,0.9002034614229077,25,33,-8,135,229,-94
"상태 정보는 예를 들어, 히든 스테이트 벡터와 같은 벡터 형태의 정보일 수 있다.","The state information may be information in a form of a vector (for example, a hidden state vector).",True,0.3369567096233368,0.8101771526899486,13,18,-5,45,100,-55
상태 정보는 '히든 스테이트 정보(hidden state information)'라고도 부를 수 있다. ],"The state information may also be referred to as ""hidden state information.""",True,0.176465094089508,0.8842545295913493,11,12,-1,59,76,-17
"[상태 정보는 예를 들어, 특징 활성화(Feature Activation) 영역들의 조합에 해당할 수 있다.","The state information may correspond to, for example, a combination of feature activation regions.",True,0.3119561672210693,0.8102249494029877,12,14,-2,60,98,-38
"예를 들어, 컨볼루션 신경망(Convolutional Neural Network; CNN)에 영상이 입력된 경우, 차선, 차량, 보행자 등을 필터링하는 여러 개의 필터들을 거쳐 특징 맵(feature map)이 생성될 수 있다. ]","For example, when an image is input to a convolutional neural network (CNN), a feature map may be generated through a plurality of filters that perform filtering of a lane, a vehicle, and/or a pedestrian, as non-limiting examples.",True,0.2013653963804245,0.8845251507476763,26,38,-12,129,230,-101
"[일 실시예에 따른 추론 장치에서 인공 신경망의 적어도 일부를 이용하여 입력 데이터를 인코딩(encoding) 함으로써 생성된 임베딩 벡터(embedding vector)는 입력 데이터 내의 제1 부분 영역을 제1 정확도로 복원(reconstruction)하고, 입력 데이터 내의 제2 부분 영역을 제2 정확도로 복원하는 정보를 포함한다.",An embedding vector generated by encoding input data using at least a portion of the ANN in the inference apparatus may include information that is used to reconstruct a first partial region in the input data with a first accuracy and reconstruct a second partial region in the input data with a second accuracy.,True,0.2710231244564056,0.8594812633630239,38,54,-16,189,312,-123
"예를 들어, 제1 정확도는 제2 정확도 보다 높은 값을 가질 수 있다.","For example, the first accuracy may be greater than the second accuracy.",True,0.1783982664346695,0.89017313740578,12,12,0,39,72,-33
"이때, 인공 신경망의 적어도 일부는 예를 들어, 인공 신경망에서 인코더로 동작하는 일부 레이어에 해당할 수 있다. ]","In this example, at least a portion of the ANN may correspond to a portion of layers that operates as an encoder in the ANN.",True,0.3676442205905914,0.7792744017215709,17,25,-8,65,124,-59
"[입력 데이터 내의 제1 부분 영역은 인공 신경망에 의해 입력 데이터로부터 출력되는 추론된 정보, 추론 과정에서 인공 신경망의 내부에서 생성되는 상태 정보, 또는 이들의 조합에 대응하여 적응적으로 결정된다. ]","The first partial region may be adaptively determined based on information inferred from the input data and output by the ANN, state information generated in the ANN, or a combination thereof.",True,0.3934982717037201,0.7855226635731889,29,31,-2,117,192,-75
"[인공 신경망이 픽셀 와이즈 정보 또는 검출 윈도우를 추론하도록 설계된 경우, 입력 데이터 내의 제1 부분 영역은 인공 신경망에 의해 추론된 정보에 따라 적응적으로 결정될 수 있다.","In an example, when the ANN is designed to infer pixel-wise information or a detection window, the first partial region of the input data may be adaptively determined based on information inferred by the ANN.",True,0.3003464639186859,0.850172560769261,27,35,-8,101,208,-107
"예를 들어, 인공 신경망이 픽셀 와이즈 정보 또는 검출 윈도우를 추론하도록 설계된 경우, 입력 데이터 내의 제1 부분 영역은 인공 신경망에서 추론된 정보(예를 들어, 픽셀 와이즈 정보 또는 검출 윈도우)에 대응하는 부분 영역으로 적응적으로 결정될 수 있다.]","For example, when the ANN is designed to infer pixel-wise information or a detection window, the first partial region of the input data may be adaptively determined as a partial region corresponding to information (for example, the pixel-wise information or the detection window) inferred by the ANN.",True,0.1977115720510482,0.9078458920665344,37,47,-10,144,300,-156
"[또는 인공 신경망이 클래스를 추론하도록 설계된 경우, 입력 데이터 내의 제1 부분 영역은 인공 신경망의 인코더에 의해 생성된 임베딩 벡터에 따라 적응적으로 결정될 수 있다.","In another example, when the ANN is designed to infer a class, the first partial region of the input data may be adaptively determined based on an embedding vector generated by an encoder of the ANN.",True,0.3492029905319214,0.8250917985253758,25,36,-11,97,199,-102
"예를 들어, 인공 신경망이 클래스를 추론하도록 설계된 경우, 입력 데이터 내의 제1 부분 영역은 인코더에 의해 생성된 임베딩 벡터에 대응하는 부분 영역으로 적응적으로 결정될 수 있다.","When the ANN is designed to infer a class, the first partial region of the input data may be adaptively determined as a partial region corresponding to the embedding vector generated by the encoder.",True,0.3027491271495819,0.8456085655330859,26,34,-8,102,198,-96
"보다 구체적으로, 여러 개의 필터들을 사용함으로써 채널 또한 여러 개가 생성되고, 인공 신경망은 각 채널마다 큰 값이 나오는 영역들(다시 말해, 특징이 활성화되는 특징 활성화 영역들)을 선택할 수 있다.","For example, a plurality of filters may be used to generate a plurality of channels and the ANN may select regions (for example, feature activation regions in which features are activated) from which relatively high values are output for each of the channels.",True,0.3189765810966491,0.8133698120310914,28,43,-15,113,259,-146
인공 신경망은 각 채널마다 큰 값이 나오는 영역들 중 중첩되는 영역들을 조합하여 관심 영역으로 설정할 수 있다.,The ANN may set an ROI by combining overlapping regions among the regions from which relatively high values are output for each of the channels.,True,0.3980135023593902,0.7302219951501445,17,25,-8,62,144,-82
"상태 정보는 예를 들어, 후술하는 관심 영역(ROI)을 반영한 픽셀-와이즈 맵(Pixel-Wise Map) r(E(x))에 대응될 수 있다. ]","The state information may correspond to, for example, a pixel-wise map r(E(x)) that reflects the ROI that will be described below.",True,0.2181362807750702,0.8754745224121285,16,21,-5,80,130,-50
"[제1 부분 영역은 입력 데이터 내의 관심 영역에 해당하고, 제2 부분 영역은 입력 데이터 내에서 관심 영역을 제외한 나머지 영역에 해당할 수 있다.","The first partial region may correspond to an ROI in the input data, and the second partial region may correspond to regions other than the ROI in the input data.",True,0.2914788722991943,0.8436158287460519,23,30,-7,83,162,-79
"예를 들어, 입력 데이터가 영상 데이터인 경우, 제1 부분 영역은 영상 데이터 내 추론된 정보에 대응하는 관심 공간 영역을 포함할 수 있다.","In an example, when the input data is image data, the first partial region may include an ROI corresponding to the inferred information in the image data.",True,0.259784072637558,0.8755239912029739,22,27,-5,78,154,-76
"또는 입력 데이터가 음성 데이터인 경우, 제1 부분 영역은 음성 데이터 내 추론된 정보에 대응하는 관심 시간 구간을 포함할 수 있다. ]","In another example, when the input data is voice data, the first partial region may include a time interval of interest corresponding to the inferred information in the voice data.",True,0.2415702939033508,0.8763901075873002,22,30,-8,76,180,-104
"[추론 과정에서 이용되는 구성은 아니지만, 임베딩 벡터에 내재된 정보는 학습 과정에서 이용되는 제2 디코더를 이용하여 확인될 수 있다.",Information included in the embedding vector may be verified using a second decoder that is used in a training process and is not used in an inference process.,True,0.3282941579818725,0.7921505036567585,18,28,-10,75,159,-84
제2 디코더는 임베딩 벡터로부터 제1 부분 영역에 대응하여 제2 부분 영역 대비 높은 정확도로 입력 데이터를 복원할 수 있다.],The second decoder may reconstruct the input data from the embedding vector with a high accuracy corresponding to the first partial region in comparison to the second partial region.,True,0.1815898120403289,0.8942064167129994,19,29,-10,71,182,-111
"[단계(220)에서, 추론 장치는 예를 들어, 인공 신경망이 활성화 되는 상태 정보에 기초하여, 입력 데이터에 포함된 픽셀 별로 픽셀 와이즈 정보(pixel-wise information)를 제공하거나, 입력 데이터에서 검출된 영역을 검출 윈도우(detection window)의 형태로 제공하거나, 입력 데이터로부터 분류된 클래스(class)를 제공할 수 있다.","In operation 220, the inference apparatus may provide, based on the state information, pixel-wise information for each pixel included in the input data, provide a region detected in the input data in a form of a detection window, and/or provide a class classified from the input data.",True,0.2257244735956192,0.886171627589206,38,47,-9,203,284,-81
"단계(220)에서, 입력 데이터로부터 추론된 정보는 예를 들어, 차선, 차량 보행자 등과 같이 관심 영역에 해당하는 영역, 및/또는 관심 화자의 음성 구간 등에 해당할 수 있다.]","In operation 220, the information inferred from the input data may correspond to, for example, an ROI such as a lane, a vehicle, or a pedestrian, and/or a voice section of a speaker of interest.",True,0.2624662518501282,0.8659671613520623,25,35,-10,100,194,-94
"[일 실시예에 따른 추론 장치는 예를 들어, HUD(Head Up Display) 장치, 3D 디지털 정보 디스플레이(Digital Information Display, DID), 내비게이션 장치, 3D 모바일 기기, 및 스마트 차량 등을 포함할 수 있으며, 반드시 이에 한정되지는 않는다. ]","The inference apparatus may include, but is not limited to, for example, a head-up display (HUD), a three-dimensional (3D) digital information display (DID), a navigation apparatus, a 3D mobile apparatus, and/or a smart vehicle.",True,0.163529098033905,0.908487132347974,35,34,1,164,228,-64
[도 3은 일 실시예에 따른 트레이닝 방법을 나타낸 흐름도이다.,FIG. 3 illustrates an example of a training method.,True,0.2690682411193847,0.8130836152866117,9,9,0,35,51,-16
"방법으로서,사용자 장비(UE)에 의해, 제1 리던던시 버전(RV)에 기초하여 상기 UE의 순환 버퍼(circular buffer)로부터 선택된 코딩된 비트들의 세트를 포함하는 제1 물리적 업링크 공유 채널(PUSCH) 전송을 제1 슬롯에서 전송하는 단계;상기 UE에 의해, 상기 제1 슬롯 바로 다음의 슬롯보다 늦은 제2 슬롯이 상기 제1 PUSCH 전송의 가장 빠른 반복을 위해 이용가능하다고 결정하는 단계;상기 UE에 의해, 상기 제2 슬롯에 기초하여 제2 리던던시 버전을 결정하는 단계; 및상기 UE에 의해, 상기 제2 리던던시 버전에 기초하여 UE의 순환 버퍼로부터 선택된 코딩된 비트들의 세트를 포함하는 제2 PUSCH 전송을 상기 제2 슬롯에서 전송하는 단계를 포함하고, 상기 제2 PUSCH 전송은 상기 제1 PUSCH 전송의 반복인, 방법.","A method, comprising: transmitting, by a User Equipment (UE), in a first slot, a first Physical Uplink Shared Channel (PUSCH) transmission comprising a set of coded bits selected from a circular buffer of the UE based on a first redundancy version (RV); determining, by the UE, that a second slot is available for an earliest repetition of the first PUSCH transmission, the second slot being later than the slot immediately following the first slot; determining, by the UE, based on the second slot, a second redundancy version; and transmitting, by the UE, in the second slot, a second PUSCH transmission comprising a set of coded bits selected from the circular buffer of the UE based on the second redundancy version, the second PUSCH transmission being a repetition of the first PUSCH transmission.",True,0.232440173625946,0.9366628351555806,95,132,-37,422,802,-380
"제1항에 있어서,상기 제2 PUSCH 전송은 상기 제1 PUSCH 전송의 타입 A 반복인, 방법.","The method of claim 1, wherein the second PUSCH transmission is a Type A repetition of the first PUSCH transmission.",True,0.100863330066204,0.9630577111912968,13,20,-7,54,116,-62
"제1항에 있어서,상기 제2 슬롯이 상기 제1 PUSCH 전송의 가장 빠른 반복을 위해 이용가능하다고 결정하는 단계는, 슬롯 포맷 표시자(SFI)를 수신하는 단계; 및상기 제2 슬롯이 상기 SFI에 의해 업링크 슬롯으로서 식별된 슬롯이라고 결정하는 단계를 포함하는, 방법.","The method of claim 1, wherein the determining that the second slot is available for an earliest repetition of the first PUSCH transmission comprises: receiving a slot format indicator (SFI); and determining that the second slot is a slot identified, by the SFI, as an uplink slot.",True,0.2516636550426483,0.9209467414731112,34,47,-13,151,281,-130
"제1항에 있어서,상기 제2 슬롯이 상기 제1 PUSCH 전송의 가장 빠른 반복을 위해 이용가능하다고 결정하는 단계는,시작 및 끝을 갖고 복수의 슬롯을 포함하는 적용가능 영역을 갖는 슬롯 포맷 표시자를 누락하는 단계; 및 상기 제2 슬롯이 상기 적용가능 영역의 끝보다 늦게 발생한다고 결정하는 단계를 포함하는, 방법.","The method of claim 1, wherein the determining that the second slot is available for an earliest repetition of the first PUSCH transmission comprises: missing a slot format indicator having a region of applicability having a beginning and an end and comprising a plurality of slots; and determining that the second slot occurs later than the end of the region of applicability.",True,0.3055721521377563,0.9096697171090328,43,62,-19,176,377,-201
"제1항에 있어서, 마지막의 스케줄링된 PUSCH 반복 후 및 최대 PUSCH 전송 지속기간 간격의 종료 전에 이용가능한 슬롯이 없다고 결정하는 단계, 및상기 마지막의 스케줄링된 PUSCH 반복 후에 PUSCH 반복을 전송하지 않는 단계를 더 포함하는, 방법.","The method of claim 1, further comprising: determining that no slots are available after a last scheduled PUSCH repetition and before an end of a maximum PUSCH transmission duration interval, and not transmitting a PUSCH repetition after the last scheduled PUSCH repetition.",True,0.1914996355772018,0.9377759214592822,34,42,-8,144,274,-130
"제1항에 있어서,제3 슬롯이 PUSCH 반복을 위해 이용가능하다는 표시를 네트워크 노드(gNB)로부터 수신하는 단계;제3 슬롯이 PUSCH 반복에 이용가능하지 않다는 표시를 gNB로부터 수신하는 단계; 및 제3 슬롯이 PUSCH 반복을 위해 이용가능하지 않다고 결정하는 단계를 더 포함하는, 방법.","The method of claim 1, further comprising: receiving an indication from a network node (gNB) that a third slot is available for a PUSCH repetition; receiving an indication from the gNB that the third slot is not available for a PUSCH repetition; and determining that the third slot is not available for a PUSCH repetition.",True,0.202267900109291,0.9334155085970268,34,55,-21,166,322,-156
"제1항에 있어서,상기 UE에 의해 제1 PUSCH 전송을 전송하는 단계는, 제1 프리코딩 매트릭스(precoding matrix)를 사용하여 비-코드북(non-codebook) 기반 전송으로서 제1 PUSCH 전송을 전송하는 것을 포함하고; 상기 UE에 의해 제2 PUSCH 전송을 전송하는 단계는, 제1 프리코딩 매트릭스와 상이한 제2 프리코딩 매트릭스를 사용하여 비-코드북 기반 전송으로서 제2 PUSCH 전송을 전송하는 것을 포함하는, 방법.","The method of claim 1, wherein: the transmitting, by the UE, of the first PUSCH transmission comprises transmitting the first PUSCH transmission as a non-codebook based transmission using a first precoding matrix; and the transmitting, by the UE, of the second PUSCH transmission comprises transmitting the second PUSCH transmission as a non-codebook based transmission using a second precoding matrix, different from the first precoding matrix.",True,0.2248082160949707,0.9314860285247646,49,65,-16,250,445,-195
"제7항에 있어서,상기 UE에 의해 제1 비-코드북 기반 사운딩 기준 신호(SRS) 인스턴스(instance)를 사용하여 제1 프리코딩 매트릭스를 표시하는 단계; 및 상기 UE에 의해 제2 비-코드북 기반 사운딩 기준 신호 인스턴스를 사용하여 제2 프리코딩 매트릭스를 표시하는 단계를 더 포함하는, 방법.","The method of claim 7, further comprising: indicating, by the UE, using a first non-codebook based Sounding Reference Signal (SRS) instance, the first precoding matrix; and indicating, by the UE, using a second non-codebook based Sounding Reference Signal instance, the second precoding matrix.",True,0.1994727551937103,0.9235707063218356,37,43,-6,169,294,-125
"제1항에 있어서,제1 랜덤 액세스 채널 오케이션(RO)에서 물리적 랜덤 액세스 채널(PRACH) 프리앰블(preamble)을 전송하는 단계; 및 제2 RO에서 PRACH 프리앰블을 전송하는 단계를 더 포함하는, 방법.","The method of claim 1, further comprising: sending a Physical Random Access Channel (PRACH) preamble in a first Random Access Channel (RACH) Occasion (RO); and sending the PRACH preamble in a second RO.",True,0.2169210165739059,0.919263358303988,23,33,-10,121,202,-81
"제9항에 있어서,상기 UE는 상기 제1 RO에서 상기 PRACH 프리앰블을 전송한 후 및 상기 제2 RO에서 상기 PRACH 프리앰블을 전송하기 전에 랜덤 액세스 응답(RAR) 모니터링 창을 개시하지 않는, 방법.","The method of claim 9, wherein the UE does not initiate a Random Access Response (RAR) monitoring window after sending the PRACH preamble in the first RO and before sending the PRACH preamble in the second RO.",True,0.1515189111232757,0.9410102454601026,28,37,-9,119,209,-90
"처리 회로; 및 라디오(radio)를 포함하는 사용자 장비(UE)로서, 상기 처리 회로는,제1 슬롯에서, 제1 리던던시 버전(RV)에 기초하여 UE의 순환 버퍼로부터 선택된 코딩된 비트들의 세트를 포함하는 제1 물리적 업링크 공유 채널(PUSCH) 전송을 전송하고, 상기 제1 슬롯 바로 다음의 슬롯보다 늦은 제2 슬롯이 상기 제1 PUSCH 전송의 가장 빠른 반복을 위해 이용가능하다고 결정하고,상기 제2 슬롯에 기초하여 제2 리던던시 버전을 결정하고, 상기 제2 슬롯에서, 제2 리던던시 버전에 기초하여 상기 UE의 순환 버퍼로부터 선택된 코딩된 비트들의 세트를 포함하는 제2 PUSCH 전송을 전송하도록 구성되고,상기 제2 PUSCH 전송은 상기 제1 PUSCH 전송의 반복인, 사용자 장비(UE).","A User Equipment (UE), comprising: a processing circuit; and a radio, the processing circuit being configured to: transmit, in a first slot, a first Physical Uplink Shared Channel (PUSCH) transmission comprising a set of coded bits selected from a circular buffer of the UE based on a first redundancy version (RV); determine that a second slot is available for an earliest repetition of the first PUSCH transmission, the second slot being later than the slot immediately following the first slot; determine, based on the second slot, a second redundancy version; and transmit, in the second slot, a second PUSCH transmission comprising a set of coded bits selected from the circular buffer of the UE based on the second redundancy version, the second PUSCH transmission being a repetition of the first PUSCH transmission.",True,0.2463569194078445,0.9303488534128368,87,132,-45,394,822,-428
"제11항에 있어서,상기 제2 PUSCH 전송은 상기 제1 PUSCH 전송의 타입 A 반복인, 사용자 장비(UE).","The UE of claim 11, wherein the second PUSCH transmission is a Type A repetition of the first PUSCH transmission.",True,0.2723932564258575,0.8916080976349764,14,20,-6,63,113,-50
"제11항에 있어서,상기 제2 슬롯이 상기 제1 PUSCH 전송의 가장 빠른 반복을 위해 이용가능하다고 결정하는 것은,슬롯 포맷 표시자(SFI)를 수신하는 것과, 상기 제2 슬롯이 상기 SFI에 의해 업링크 슬롯으로서 식별된 슬롯이라고 결정하는 것을 포함하는, 사용자 장비(UE).","The UE of claim 11, wherein the determining that the second slot is available for an earliest repetition of the first PUSCH transmission comprises: receiving a slot format indicator (SFI); and determining that the second slot is a slot identified, by the SFI, as an uplink slot.",True,0.3301971554756164,0.8931106468138925,34,47,-13,156,278,-122
"제11항에 있어서,상기 제2 슬롯이 상기 제1 PUSCH 전송의 가장 빠른 반복을 위해 이용가능하다고 결정하는 것은, 시작 및 끝을 갖는 적용가능 영역을 갖고 복수의 슬롯을 포함하는 슬롯 포맷 표시자를 누락하는 것과, 상기 제2 슬롯이 상기 적용가능 영역의 끝보다 늦게 발생한다고 결정하는 것을 포함하는, 사용자 장비(UE).","The UE of claim 11, wherein the determining that the second slot is available for an earliest repetition of the first PUSCH transmission comprises: missing a slot format indicator having a region of applicability having a beginning and an end and comprising a plurality of slots; and determining that the second slot occurs later than the end of the region of applicability.",True,0.3653027713298797,0.8901546019745972,44,62,-18,182,374,-192
"제11항에 있어서,상기 처리 회로는,마지막의 스케줄링된 PUSCH 반복 이후 및 최대 PUSCH 전송 지속기간 간격의 종료 전에 이용가능한 슬롯이 없다고 결정하고, 상기 마지막의 스케줄링된 PUSCH 반복 이후 PUSCH 반복을 전송하지 않도록 더욱 구성되는, 사용자 장비(UE).","The UE of claim 11, wherein the processing circuit is further configured to: determine that no slots are available after a last scheduled PUSCH repetition and before an end of a maximum PUSCH transmission duration interval, and not transmit a PUSCH repetition after the last scheduled PUSCH repetition.",True,0.2886460125446319,0.8996705858988293,34,48,-14,157,302,-145
열전도성 물질을 포함하는 에어로졸 생성 물품{AEROSOL GENERATING ARTICLE CONTAINING THERMALLY CONDUCTIVE MATERIALS},TECHNICAL FIELD,False,1.040148138999939,0.2472385922862243,12,2,10,94,15,79
[본 개시는 열전도성 물질을 포함하는 에어로졸 생성 물품에 관한 것이다.],The present disclosure relates to an aerosol-generating article including a thermally conductive material.,True,0.2671992480754852,0.8362702924869332,10,13,-3,41,106,-65
[근래에 일반적인 궐련의 단점들을 극복하는 대체 방법에 관한 수요가 증가하고 있다.,"Recently, the demand for alternative methods to overcome the disadvantages of traditional cigarettes has increased.",True,0.273616760969162,0.767665138728459,11,15,-4,46,115,-69
"예를 들어, 궐련을 연소시켜 에어로졸을 생성하는 방법이 아닌, 에어로졸 생성 장치를 이용하여 궐련 또는 에어로졸 생성 물질을 가열함으로써 에어로졸을 생성하는 시스템에 관한 수요가 증가하고 있다. ]","For example, there is growing demand for an aerosol generating system which generates aerosol by heating an aerosol generating material or a cigarette, rather than by combusting cigarettes.",True,0.2027210891246795,0.8762429483520136,26,28,-2,110,189,-79
"[한편, 궐련을 가열하여 에어로졸을 생성하는 시스템에 있어서, 사용자에게 풍부한 양의 에어로졸을 제공하고, 최적의 흡연 경험을 제공하기 위해서는 궐련을 가열하는 과정에서의 열 전달 효율을 증가시킬 필요가 있다.]","On the other hand, in a system for generating an aerosol by heating a cigarette, it is necessary to increase the heat transfer efficiency in the process of heating the cigarette, in order to provide a user with an abundant amount of aerosol and to provide an optimal smoking experience.",True,0.2230459749698639,0.8617213948420345,26,50,-24,118,286,-168
[다양한 실시예들은 열전도성 물질을 포함하는 에어로졸 생성 물품을 제공하는데 있다.,Various embodiments are directed to providing an aerosol-generating article including a thermally conductive material.,True,0.266997754573822,0.8417764956559999,10,14,-4,46,118,-72
"본 개시가 이루고자 하는 기술적 과제는 상기된 바와 같은 기술적 과제들로 한정되지 않으며, 이하의 실시예들로부터 또 다른 기술적 과제들이 유추될 수 있다.]","The technical problems to be achieved by the present disclosure are not limited to the technical problems as described above, and other technical problems may be inferred from the following embodiments.",True,0.2072705030441284,0.8573401018083231,22,31,-9,87,202,-115
"[상술한 기술적 과제를 달성하기 위한 기술적 수단으로서, 에어로졸 생성 물품은, 담배 분말 및 열전도성 분말을 포함하는 혼합물로부터 제조되는 담배 매질부를 포함하고, 상기 혼합물은 건조 중량 기준으로 20 중량% 미만의 열전도성 분말을 포함할 수 있다.]","Various embodiments provide an aerosol-generating article including a tobacco medium section prepared from a mixture including a tobacco powder and a thermally conductive powder, and the mixture may include, based on dry weight, less than 20 wt% of the thermally conductive powder.",True,0.336034208536148,0.8082359275429731,34,42,-8,142,281,-139
[본 개시는 열전도성 물질을 포함하는 에어로졸 생성 물품을 제공할 수 있다.,The present disclosure may provide an aerosol-generating article including a thermally conductive material.,True,0.2346049845218658,0.8579985742773965,11,13,-2,42,107,-65
"구체적으로, 본 개시에 따른 에어로졸 생성 물품은 담배 분말 및 열전도성 분말을 포함하는 혼합물로부터 제조되는 담배 매질부를 포함할 수 있다.","In detail, an aerosol-generating article according to the present disclosure may include a tobacco medium section prepared from a mixture including a tobacco powder and a thermally conductive powder.",True,0.2416007965803146,0.8669399487924843,20,29,-9,79,199,-120
담배 매질부에 열전도성 물질이 포함됨에 따라 에어로졸 생성 물품이 가열되는 과정에서의 열 전달 효율이 증가될 수 있다.,"By including a thermally conductive material in the tobacco medium section, the heat transfer efficiency in the process in which the aerosol-generating article is heated may be increased.",True,0.2077763527631759,0.8707556966354656,17,28,-11,66,187,-121
"이에 따라, 풍부한 양의 에어로졸이 사용자에게 제공될 수 있고, 예열을 위해 필요한 시간 및 배터리의 전력 소모가 감소될 수 있다.]","Accordingly, an abundant amount of aerosol may be provided to a user, and the time required for preheating and power consumption of the battery may be reduced.",True,0.2034792304038992,0.8612238553128564,20,27,-7,74,159,-85
"[다만, 담배 매질부에 너무 많은 양의 열전도성 물질이 포함되는 경우, 에어로졸 생성 물품이 가열되는 과정에서 담배 매질부의 온도가 기 설정된 온도 프로파일에 의해 의도된 수준보다 높게 상승됨에 따라, 사용자에게 지나친 열감이 전달될 수 있다.","However, when the tobacco medium section includes too much of a thermally conductive material, as the temperature of the tobacco medium section rises greater than the intended level by the preset temperature profile while the aerosol-generating article is heated, an excessive sense of heat may be transmitted to the user.",True,0.1738094389438629,0.8964081352418755,34,50,-16,136,322,-186
"도 6 내지 도 8을 참조하여 후술할 실험 결과에 따르면, 혼합물에 포함되는 열전도성 분말이 건조 중량 기준으로 20 중량% 이상인 경우, 초기 퍼프 구간에서 사용자에게 지나친 열감이 전달된다는 사실이 확인되었다.","According to the experimental results to be described later with reference to FIGS. 6 to 8, when the thermally conductive powder included in a mixture is 20 wt% or more based on dry weight, it was confirmed that excessive sense of heat is transmitted to the user in the initial puff section.",True,0.1190539672970771,0.922961795287804,30,52,-22,119,291,-172
"이에 따라, 본 개시에 따른 에어로졸 생성 물품의 담배 매질부를 제조하기 위한 혼합물은 건조 중량 기준으로 20 중량% 미만의 열전도성 분말을 포함할 수 있다.","Accordingly, the mixture for preparing the tobacco medium section of an aerosol-generating article according to the present disclosure may include, based on dry weight, less than 20 wt% of the thermally conductive powder.",True,0.1405681073665619,0.9196959126189076,24,33,-9,89,221,-132
"따라서, 에어로졸 생성 물품이 가열되는 과정에서의 열 전달 효율이 증가되면서도, 기 설정된 온도 프로파일에 의해 의도된 수준으로 담배 매질부의 온도가 제어될 수 있다.]","Accordingly, the temperature of the tobacco medium section may be controlled to an intended level by the preset temperature profile while the heat transfer efficiency in the process of heating the aerosol-generating article is increased.",True,0.193606436252594,0.8783100006058631,23,35,-12,94,237,-143
[도 1 내지 도 4는 에어로졸 생성 장치에 에어로졸 생성 물품이 삽입된 예들을 도시한 도면들이다.,FIGS. 1 through 4 are diagrams showing examples in which an aerosol-generating article is inserted into an aerosol generating device.,True,0.1717070490121841,0.8975637627139336,15,20,-5,55,133,-78
도 5는 예시적인 실시예에 따른 에어로졸 생성 물품을 도시한 도면이다.,FIG. 5 is a diagram illustrating an aerosol-generating article according to an example embodiment.,True,0.1532937735319137,0.9045181793586164,10,14,-4,39,98,-59
도 6 내지 도 8은 열전도성 분말의 적절한 함량을 결정하기 위한 실험과 관련된 도면들이다.,FIGS. 6 to 8 are diagrams related to an experiment for determining an appropriate content of the thermally conductive powder.,True,0.1112881824374198,0.9225827954861512,14,20,-6,51,125,-74
도 9 및 도 10은 예시적인 실시예들에 따른 담배 매질부 내 열전도성 분말의 분포를 설명하기 위한 단면도이다.],FIGS. 9 and 10 are cross-sectional views for explaining the distribution of a thermally conductive powder in a tobacco medium section according to example embodiments.,True,0.155719593167305,0.895347326093117,17,25,-8,63,167,-104
"[실시예들에서 사용되는 용어는 본 발명에서의 기능을 고려하면서 가능한 현재 널리 사용되는 일반적인 용어들을 선택하였으나, 이는 당 분야에 종사하는 기술자의 의도 또는 판례, 새로운 기술의 출현 등에 따라 달라질 수 있다.","With respect to the terms used to describe the various embodiments, general terms which are currently and widely used are selected in consideration of functions of structural elements in the various embodiments of the present disclosure.",False,0.4302816092967987,0.716454128427382,30,36,-6,123,237,-114
"또한, 특정한 경우는 출원인이 임의로 선정한 용어도 있으며, 이 경우 해당되는 발명의 설명 부분에서 상세히 그 의미를 기재할 것이다.","In such a case, the meaning of the term will be described in detail at the corresponding portion in the description of the present disclosure.",True,0.4555291533470154,0.679616614601405,19,25,-6,74,142,-68
"따라서 본 발명에서 사용되는 용어는 단순한 용어의 명칭이 아닌, 그 용어가 가지는 의미와 본 발명의 전반에 걸친 내용을 토대로 정의되어야 한다.]","Therefore, the terms used in the various embodiments of the present disclosure should be defined based on the meanings of the terms and the descriptions provided herein.",True,0.359811007976532,0.7681422005803494,21,27,-6,81,169,-88
"[명세서 전체에서 어떤 부분이 어떤 구성요소를 ""포함""한다고 할 때, 이는 특별히 반대되는 기재가 없는 한 다른 구성요소를 제외하는 것이 아니라 다른 구성요소를 더 포함할 수 있음을 의미한다.","In addition, unless explicitly described to the contrary, the word ""comprise"" and variations such as ""comprises"" or ""comprising"" will be understood to imply the inclusion of stated elements but not the exclusion of any other elements.",True,0.4216207861900329,0.7182508637826018,27,36,-9,107,234,-127
"또한, 명세서에 기재된 ""...부"", ""...모듈"" 등의 용어는 적어도 하나의 기능이나 동작을 처리하는 단위를 의미하며, 이는 하드웨어 또는 소프트웨어로 구현되거나 하드웨어와 소프트웨어의 결합으로 구현될 수 있다.]","In addition, the terms ""-er"", ""-or"", and ""module"" described in the specification mean units for processing at least one function and operation and can be implemented by hardware components or software components and combinations thereof.",True,0.2220839262008667,0.8578861186701627,25,35,-10,120,237,-117
"[명세서 전체에서 ""상류"" 및 ""하류""는 사용자가 에어로졸 생성 물품을 이용하여 흡연할 때 공기가 흐르는 방향에 기초하여 결정될 수 있다.","Throughout the specification, ""upstream"" and ""downstream"" may be determined based on the direction in which air flows when a user smokes using an aerosol-generating article.",True,0.1748777478933334,0.8900361909582908,19,25,-6,77,173,-96
"예를 들어, 사용자가 도 5에 도시된 에어로졸 생성 물품을 이용하여 흡연하는 경우 에어로졸 생성부(210) 또는 담배 매질부(220)로부터 생성된 에어로졸이 외부에서 유입된 공기를 따라 필터부(240)로 이동하고, 필터부(240)를 통해 사용자에게 전달되므로, 에어로졸 생성부(210) 또는 담배 매질부(220)는 필터부(240)의 ""상류""에 위치하는 것이다.","For example, when a user smokes using the aerosol-generating article shown in FIG. 5, the aerosol generated by an aerosol generating section 210 or a tobacco medium section 220 moves to a filter section 240 along the air introduced from the outside, and is delivered to the user through the filter section 240, and thus, the aerosol generating section 210 or the tobacco medium section 220 is located ""upstream"" of the filter section 240.",True,0.0841808393597602,0.9524505827978182,38,74,-36,201,438,-237
"한편, 해당 기술분야의 통상의 기술자라면 ""상류"" 및 ""하류""가 구성요소들의 관계에 따라 상대적일 수 있음을 쉽게 이해할 것이다.]","On the other hand, those skilled in the art will easily understand that ""upstream"" and ""downstream"" may be relative depending on the relationship of the components.",True,0.2614211738109588,0.810832323638864,17,26,-9,73,164,-91
"[또한, 명세서 전체에서 ""길이 방향""이란 에어로졸 생성 물품의 상류 말단에서 하류 말단으로 향하는 방향 또는 그 반대 방향을 의미할 수 있다.","Also, throughout the specification, ""longitudinal direction"" may refer to a direction from an upstream end to a downstream end of the aerosol-generating article or vice versa.",True,0.147813931107521,0.9044171939421776,21,26,-5,80,175,-95
"예를 들어, 에어로졸 생성 물품이 에어로졸 생성부(210), 담배 매질부(220), 냉각부(230) 및 필터부(240)를 나열된 순서대로 포함한다고 가정할 때, 길이 방향은 에어로졸 생성부(210)에서 필터부(240)를 향하는 방향 또는 그 반대 방향일 수 있다. ]","For example, assuming that the aerosol-generating article includes the aerosol generating section 210, the tobacco medium section 220, a cooling section 230 and the filter section 240 in the listed order, the longitudinal direction may be a direction from the aerosol generating section 210 toward the filter section 240 or vice versa.",True,0.1369384527206421,0.9187035082991876,31,52,-21,149,335,-186
[아래에서는 첨부한 도면을 참고하여 본 발명의 실시예에 대하여 본 발명이 속하는 기술 분야에서 통상의 지식을 가진 자가 용이하게 실시할 수 있도록 상세히 설명한다.,"Hereinafter, the present disclosure will now be described more fully with reference to the accompanying drawings, in which exemplary embodiments of the present disclosure are shown such that one of ordinary skill in the art may easily work the present disclosure.",True,0.312096893787384,0.790766935755948,23,41,-18,91,263,-172
그러나 본 발명은 여러 가지 상이한 형태로 구현될 수 있으며 여기에서 설명하는 실시예에 한정되지 않는다.],"The disclosure may, however, be embodied in many different forms and should not be construed as being limited to the embodiments set forth herein.",True,0.1883292198181152,0.8736209501433622,15,24,-9,59,146,-87
[이하에서는 도면을 참조하여 본 발명의 실시예들을 상세히 설명한다.],"Hereinafter, embodiments of the present disclosure will be described in detail with reference to the drawings.",True,0.2082073390483856,0.8542002108424045,8,16,-8,38,110,-72
[도 1 내지 도 4는 에어로졸 생성 장치에 에어로졸 생성 물품이 삽입된 예들을 도시한 도면들이다.],FIGS. 1 through 4 are diagrams showing examples in which an aerosol-generating article is inserted into an aerosol generating device.,True,0.2010167390108108,0.8793520739210668,15,20,-5,56,133,-77
"[도 1을 참조하면, 에어로졸 생성 장치(10000)는 배터리(11000), 제어부(12000) 및 히터(13000)를 포함한다.","Referring to FIG. 1, the aerosol generating device 10000 may include a battery 11000, a controller 12000, and a heater 13000.",True,0.1360658407211303,0.9227996866605414,11,21,-10,72,125,-53
"도 2 및 도 3을 참조하면, 에어로졸 생성 장치(10000)는 증기화기(14000)를 더 포함한다.","Referring to FIGS. 2 and 3, the aerosol generating device 10000 may further include a vaporizer 14000.",True,0.1256416738033294,0.9282818490663954,12,17,-5,56,102,-46
"도 4를 참조하면, 에어로졸 생성 장치(10000)는 유도 코일(13500)을 더 포함한다.","Referring to FIG. 4, an aerosol generating device 10000 further includes an induction coil 13500.",True,0.1352679580450058,0.920473524171859,10,15,-5,51,97,-46
"또한, 에어로졸 생성 장치(10000)의 내부 공간에는 에어로졸 생성 물품(20000)이 삽입될 수 있다.","Also, the aerosol-generating article 20000 may be inserted into an inner space of the aerosol generating device 10000.",True,0.1473328173160553,0.9182435217885296,12,18,-6,59,118,-59
에어로졸 생성 장치(10000) 및 에어로졸 생성 물품(20000)은 에어로졸 생성 시스템을 구성할 수 있다.],The aerosol generating device 10000 and the aerosol-generating article 20000 may constitute an aerosol generating system.,True,0.2074964195489883,0.8807144429643068,13,16,-3,62,121,-59
[도 1 내지 도 4에 도시된 에어로졸 생성 장치(10000)에는 본 실시예와 관련된 구성요소들이 도시되어 있다.,"FIGS. 1 through 4 illustrate components of the aerosol generating device 10000, which are related to the present embodiment.",True,0.2211609780788421,0.8740015368111412,15,19,-4,63,124,-61
"따라서, 도 1 내지 도 4에 도시된 구성요소들 외에 다른 범용적인 구성요소들이 에어로졸 생성 장치(10000)에 더 포함될 수 있음을 본 실시예와 관련된 기술분야에서 통상의 지식을 가진 자라면 이해할 수 있다.]","Therefore, it will be understood by one of ordinary skill in the art related to the present embodiment that other components may be further included in the aerosol generating device 10000, in addition to the components illustrated in FIGS. 1 through 4.",True,0.1874425411224365,0.8945939775077215,30,42,-12,119,252,-133
워크 서포트,Technical Field,False,0.8182791471481323,0.3570424384292922,2,2,0,6,15,-9
"[이 발명은, 콜릿(collet)을 축경(縮徑)시켜 서포트 로드(support rod)를 로크(lock)하는 형식의 워크 서포트(work support)에 관한 것이다.]",The present invention relates to a work support configured so that its support rod is locked by contraction of a collet.,True,0.261703759431839,0.8207799878175167,14,21,-7,95,120,-25
"[워크 서포트는, 워크(workpiece)를 지지하는 장치이다.",Work supports are devices configured to support workpieces.,True,0.3952661752700808,0.7150846515953103,5,8,-3,35,59,-24
"이 종류의 워크 서포트에는, 종래에는, 특허문헌 1(일본국·특개2003-307205호 공보)에 기재된 것이 있다.","Such a known work support is, for example, described in Patent Literature 1 ( Japanese Unexamined Patent Publication No. 2003-307205 ).",True,0.2067656368017196,0.847661556544555,11,21,-10,63,135,-72
"그 종래 기술은, 다음과 같이 구성되어 있다.]",The known device is structured as follows.,True,0.4537128508090973,0.6252369085167798,7,7,0,26,42,-16
[고정대(固定臺)로서의 테이블에 형성된 장착 구멍에 워크 서포트의 하우징이 고정되어 있다.,A housing of a work support is fixed to an attachment hole provided in a table functioning as a stationary stand.,True,0.2284474372863769,0.850338361369006,10,21,-11,50,113,-63
하우징 내에서 상하방향으로 이동 가능하게 되는 서포트 로드가 해당 하우징의 상단벽(上端壁)에 삽입된다.,A support rod which is movable in an up-down direction in the housing is inserted through an upper end wall of the housing.,True,0.2970563769340515,0.8021232995143622,12,23,-11,57,123,-66
"서포트 로드의 외주(外周)에 콜릿이 바깥으로 끼워진다(外嵌). 작동실(作動室)에 공급되는 압축에어에 의해 제1 피스톤이 하우징 내에서 하방(下方, 아래쪽)으로 이동되고, 그 제1 피스톤이 콜릿을 통해 서포트 로드를 로크한다.","A first piston is moved downward in the housing by compressed air supplied to an actuation chamber, and the first piston locks the support rod via the collet.",False,0.3374109268188476,0.8036153388838077,25,28,-3,125,158,-33
하우징의 실린더 구멍에 출력 부재가 상하방향으로 이동 가능하게 삽입된다.,An output member is inserted in a cylinder hole of the housing so as to be movable in the up-down direction.,True,0.2822790741920471,0.8206859736785398,9,21,-12,40,108,-68
"그 출력 부재는, 하측에서부터 차례로 형성되는 제2 피스톤과 피스톤 로드를 가진다.","The output member includes a second piston and a piston rod, which are provided from bottom to top in this order.",True,0.3855599761009216,0.736173621019782,11,21,-10,46,113,-67
"그 피스톤 로드의 선단(先端)에 피스톤 로드의 본체 부분보다 대경(大徑, 큰 지름)의 플랜지부가 형성된다.","The piston rod has, at its leading end, a flange portion having a diameter larger than that of a main body portion of the piston rod.",True,0.2176032364368438,0.8535860701916718,13,26,-13,59,133,-74
"서포트 로드와 플랜지부를 이간(離間)시키도록 스프링이 부세(付勢, bias)된다.",A spring biases the support rod and the flange portion so that they recede from each other.,True,0.3530969619750976,0.7308576096378623,7,17,-10,45,91,-46
"그 실린더 구멍 내로서, 제2 피스톤의 하측에 입구실(入口室)이 마련되고, 그 입구실에, 테이블에 형성되는 급배로(給排路)가 연통된다.","An inlet chamber is provided in the cylinder hole, below the second piston.",False,0.4874997437000274,0.7047241067601122,15,13,2,75,75,0
"또한, 제2 피스톤의 상측에 출구실(出口室)이 마련된다.",An outlet chamber is provided above the second piston.,True,0.3081870377063751,0.7995916389804767,6,9,-3,31,54,-23
"실린더 구멍의 주벽면(周壁面, 둘레벽면)에 연통 구멍이 개구된다.",A communication hole opens onto a peripheral wall surface of the cylinder hole.,True,0.2922790944576263,0.8034199514262045,7,13,-6,36,79,-43
연통 구멍과 출력 부재의 외주면에 의해 전환 수단(switching means)이 구성된다.,The communication hole and an outer peripheral surface of the output member structure a switching means.,True,0.3501656651496887,0.7657964280892903,10,16,-6,51,104,-53
"그 전환 수단의 개구부(開口部)를 출력 부재의 외주면이 넘어 이동함으로써, 작동실이 연통 구멍을 통해 입구실에 연통되는 상태와 작동실이 연통 구멍을 통해 출구실에 연통되는 상태로 전환한다.","Through the movement of the outer peripheral surface of the output member across the opening of the switching means, the switching means switches between a state in which the actuation chamber is communicatively connected to the inlet chamber via the communication hole and a state in which the actuation chamber is communicatively connected to the outlet chamber via the communication hole.",True,0.2323774397373199,0.8707550966479498,24,61,-37,105,391,-286
"그리고 제2 피스톤이 상승되어 갈 때에, 출구실 내의 압축에어가, 서포트 로드의 하측에 형성되는 수용실(收容室)에 공급된다.","When the second piston is raised, compressed air in the outlet chamber is supplied to an accommodation chamber provided below the support rod.",True,0.2340656220912933,0.8577094731420748,15,23,-8,69,142,-73
"이때, 출구실로부터의 에어 배출량에 대하여 수용실의 증가 용량(容量)쪽이 많으면, 테이블 내에 형성되는 통로 및 하우징의 하벽(下壁)에 형성된 호흡(呼吸) 구멍으로부터 외기(外氣)가 하우징 내에 공급된다.","If the increase in the capacity of the accommodation chamber is larger than the amount of air discharged from the outlet chamber, outside air is supplied into the housing through a passage provided in the table and through a ventilation hole provided in a lower wall of the housing.",True,0.2409989982843399,0.8607923145710715,23,49,-26,114,282,-168
"또한, 출구실로부터의 에어 배출량에 대하여 수용실의 증가 용량쪽이 적으면, 테이블 내의 통로 및 호흡로(呼吸路)를 통해 외부로 배출된다.","Meanwhile, if the increase in the capacity of the accommodation chamber is smaller than the amount of air discharged from the outlet chamber, air is discharged to the outside through the passage in the table and through a ventilation passage.",True,0.1823814809322357,0.8904291893744009,17,40,-23,76,242,-166
"또한, 제2 피스톤이 하강되어 감과 아울러, 제1 피스톤이 하강되어 갈 때에, 제1 피스톤에 의해 작동실의 압축에어는 출구실과 호흡로를 통해 외부로 배출된다.]","When the second piston is lowered and the first piston is also lowered, compressed air in the actuation chamber is discharged by the first piston through the outlet chamber and through the ventilation passage.",True,0.2315964698791504,0.8580812321852934,21,34,-13,89,209,-120
[PatentCitationText[attributes={}; value=[특허문헌 1 : 일본 특개2003-307205호 공보]]],Patent Literature 1: Japanese Unexamined Patent Publication No. 2003-307205,False,0.4019876718521118,0.6725221710197987,7,9,-2,74,75,-1
"[종래의 워크 서포트에서는, 테이블 내에 급배로(給排路)와 배출로(排出路)를 마련할 필요가 있으므로, 복잡한 구조로 되어 있다.",The above-described known work support has a complicated structure because the supply and discharge passage and the discharge passage have to be provided in the table.,True,0.3738224804401397,0.7400594019253386,14,26,-12,71,167,-96
"또한, 하우징의 하벽 내에 호흡로가 마련되므로, 하우징의 지름방향의 치수가 그 배출로의 치수만큼 커져 있다.]","Furthermore, the ventilation passage is provided in the lower wall of the housing, and therefore the size of the housing has been increased in its radial direction by the size of the discharge passage.",True,0.3239263594150543,0.7951556184340864,14,34,-20,61,201,-140
"[본 발명의 목적은, 간소한 구조로 소형의 워크 서포트를 제공하는 것에 있다.]",An object of the present invention is to provide a compact work support having a mechanically simple structure.,True,0.2704889476299286,0.799856374868593,11,18,-7,44,111,-67
"[상기 목적을 달성하기 위해, 본 발명은, 예를 들면, 도 1 내지 도 3, 도 4, 도 5, 및 도 6에 나타내는 바와 같이, 워크 서포트를 다음과 같이 구성하였다.]","In order to achieve the above object, in an aspect of the present invention, a work support is structured as follows, as shown in FIG. 1 to FIG. 3, FIG. 4, FIG. 5 and FIG. 6, for example.",True,0.2758868634700775,0.8084557963552014,28,38,-10,94,187,-93
"[하우징(1)의 선단부(先端部)에 형성되는 삽통(揷通, 삽입통과) 구멍(2)에, 서포트 로드(3)가 삽입된다.",A support rod 3 is inserted in an insertion hole 2 provided through a leading end portion of a housing 1.,True,0.3499955534934997,0.7999690612239918,9,21,-12,61,105,-44
상기 하우징(1) 내에서 서포트 로드(3)가 해당 서포트 로드(3)의 축방향의 선단측(先端側) 및 기단측(基端側)으로 이동 가능하게 되어 있다.,The support rod 3 is configured to be movable in the housing 1 toward a leading end side and toward a base end side in an axial direction of the support rod 3.,True,0.2416297197341919,0.8550444624567778,16,33,-17,80,159,-79
상기 서포트 로드(3)의 외주벽(外周壁)에 콜릿(collet)(5)이 바깥으로 끼워진다(外嵌). 상기 하우징(1) 내에 피스톤(12)이 상기 축방향으로 이동 가능하게 삽입된다.,A collet 5 is fitted over an outer peripheral wall of the support rod 3.,False,0.4922430515289306,0.693909390276378,16,15,1,98,72,26
작동실(13)에 공급되는 압축가스에 의해 피스톤(12)이 상기 콜릿(5)을 통해 상기 서포트 로드(3)를 로크 구동한다.,The piston 12 is configured to be actuated by compressed gas supplied to an actuation chamber 13 to drive the support rod 3 for locking via the collet 5.,True,0.2862752079963684,0.8171512585687216,13,29,-16,67,153,-86
상기 하우징(1)의 기단부(基端部)에 형성되는 실린더 구멍(22)에 출력 부재(24)가 상기 축방향으로 이동 가능하게 되도록 삽입된다.,An output member 24 is inserted in a cylinder hole 22 provided in a base end portion of the housing 1 so as to be movable in the axial direction.,True,0.1657191067934036,0.9107692290770129,14,30,-16,75,145,-70
상기 서포트 로드(3)와 상기 출력 부재(24)를 이간시키도록 부세 수단이 부세한다.,A biasing means is configured to bias the support rod 3 and the output member 24 so that the support rod 3 and the output member 24 recede from each other.,True,0.3508262038230896,0.7868081578821207,10,31,-21,47,155,-108
"상기 실린더 구멍(22) 내로서, 상기 출력 부재(24)의 상기 축방향의 기단측에 입구실(29)이 형성된다.",An inlet chamber 29 is provided in the cylinder hole 22 and on the base end side in the axial direction relative to the output member 24.,True,0.2631479203701019,0.8578040352479106,12,27,-15,60,137,-77
"상기 실린더 구멍(22) 내로서, 상기 출력 부재(24)의 상기 축방향의 선단측에 출구실(32)이 형성된다.",An outlet chamber 32 is provided in the cylinder hole 22 and on the leading end side in the axial direction relative to the output member 24.,True,0.2501451969146728,0.8664236491985332,12,27,-15,60,141,-81
상기 실린더 구멍(22)의 주벽면(周壁面)에 개구되는 연통 구멍(41)과 상기 출력 부재(24)의 외주면에 의해 전환 수단(40)이 구성된다.,A switching means 40 is structured by a communication hole 41 opening onto a peripheral wall surface of the cylinder hole 22 and by an outer peripheral surface of the output member 24.,True,0.1844521760940551,0.9025509899639168,15,33,-18,79,184,-105
"상기 출력 부재(24)의 외주면이 상기 연통 구멍(41)을 넘어서 이동함으로써, 상기 작동실(13)이 상기 연통 구멍(41)을 통해 상기 입구실(29)에 연통되는 상태와 상기 작동실(13)이 상기 연통 구멍(41)을 통해서 상기 출구실(32)에 연통되는 상태가 전환 수단(40)에 의해 전환된다.","The switching means 40 is configured to switch, through movement of the outer peripheral surface of the output member 24 across the communication hole 41, between a state in which the actuation chamber 13 is communicatively connected to the inlet chamber 29 via the communication hole 41 and a state in which the actuation chamber 13 is communicatively connected to the outlet chamber 32 via the communication hole 41.",True,0.2293256372213363,0.871005035534664,33,69,-36,165,418,-253
"상기 삽통 구멍(2)과 상기 서포트 로드(3) 사이에 형성되는 환상(環狀) 공간(2a), 및, 상기 하우징(1)의 선단부에 형성되는 배출구(42a)를 배출로(42)가 가진다.",A discharge passage 42 includes: an annular space 2a created between the insertion hole 2 and the support rod 3; and a discharge port 42a provided at the leading end portion of the housing 1.,True,0.1626540422439575,0.9162450112041826,18,35,-17,97,191,-94
상기 출구실(32)의 압축가스를 상기 배출로(42)의 상기 환상 공간(2a)을 통해 상기 배출로(42)의 상기 배출구(42a)로부터 상기 하우징(1)의 외부로 배출한다.,Compressed gas in the outlet chamber 32 is discharged through the annular space 2a of the discharge passage 42 to an outside of the housing 1 from the discharge port 42a of the discharge passage 42.,True,0.1218267604708671,0.9345127139376926,17,36,-19,94,198,-104
"상기 출력 부재(24)가 상기 축방향의 기단측 한계 위치로부터 선단측 한계 위치까지 이동할 때에, 해당 출력 부재(24)가 상기 출구실(32)로부터 압출(押出)하는 가스의 배출량이, 상기 서포트 로드(3)가 기단측 한계 위치로부터 선단측 위치로 이동됨으로써 해당 서포트 로드(3)의 기단측에 형성되는 수용실(收容室)(45)의 용적보다도 많아지도록 설정된다.]",The work support is designed so that an amount of gas pushed out of the outlet chamber 32 by the output member 24 when the output member 24 moves from its base-end-side limit position to its leading-end-side limit position in the axial direction is larger than a capacity of an accommodation chamber 45 created on the base end side relative to the support rod 3 due to movement of the support rod 3 from its base-end-side limit position to a leading-end-side position.,True,0.2132127285003662,0.8863312743852158,39,82,-43,200,468,-268
[상기 발명은 다음의 작용효과를 나타낸다.],"In the above aspect of the present invention, the following functions and effects are provided.",True,0.5269374251365662,0.6022746990210256,5,15,-10,24,95,-71
"[본 발명의 워크 서포트에서는, 배출로가, 하우징의 선단부에 형성되는 삽통 구멍과 서포트 로드 사이에 형성되는 환상 공간과, 하우징의 선단부에 형성되는 배출구를 가진다.","In the work support of the above aspect, the discharge passage includes: the annular space created between the insertion hole provided at the leading end portion of the housing and the support rod; and the discharge port provided at the leading end portion of the housing.",True,0.3412868678569793,0.8238168899196465,21,46,-25,94,272,-178
"이 때문에, 워크 서포트를 로크 구동시켜 출력 부재를 기단측 한계 위치로부터 선단측 한계 위치로 이동시켜 갈 때에, 그 출력 부재가 출구실의 가스를 압출하고, 압출한 가스를 서포트 로드의 기단측에 형성되는 수용실에 공급해 간다.","When the work support is driven for locking to cause the output member to move from its base-end-side limit position to its leading-end-side limit position, the output member pushes gas out of the outlet chamber and the pushed out gas is supplied to the accommodation chamber provided on the base end side relative to the support rod.",True,0.2973382472991943,0.8404234971854968,32,57,-25,127,334,-207
"서포트 로드는 워크의 기단면(基端面)에 당접(當接, 접촉)되어 정지되지만, 출력 부재는 계속해서 선단측 한계 위치까지 이동된다.","While the support rod is stopped when contacting a base end surface of a workpiece, the output member is continuously moved to its leading-end-side limit position.",True,0.2978167831897735,0.8054499021961423,14,26,-12,71,163,-92
"그러면, 출구실로부터 압출된 가스가 수용실의 용적(容積)을 초과하여 공급되므로, 그 과잉 공급분의 가스가 배출로의 환상 공간을 통해서 배출로의 배출구로부터 하우징의 외부로 배출된다.",The excess amount of gas is therefore discharged through the annular space of the discharge passage to the outside of the housing from the discharge port of the discharge passage.,False,0.3123557865619659,0.8112447645418467,21,30,-9,101,179,-78
"또한, 워크 서포트를 릴리스(release) 구동시켜 피스톤을 기단측으로 이동시켜 갈 때에, 피스톤이 작동실의 가스를 출구실과 환상 공간을 통해 배출구로부터 하우징의 외부로 배출한다.","Meanwhile, when the work support is driven for releasing to cause the piston to move the base end side, the piston discharges gas in the actuation chamber through the outlet chamber and through the annular space to the outside of the housing from the discharge port.",True,0.211202785372734,0.8816021346327546,21,46,-25,102,266,-164
"이 때문에, 본 발명의 워크 서포트에서는, 상기 종래 기술과 같이 하우징 외부의 가스를 하우징 안으로 취입하거나, 또는, 배출하는 호흡 구멍을 기단벽(基端壁)에 마련할 필요가 없고, 또한, 그 호흡 구멍에 이어지는 통로를 테이블 내에 마련할 필요가 없다.","Due to this, the work support of this aspect needs neither the ventilation hole in the base end wall, through which gas is taken from the outside into the housing or discharged to the outside, nor the passage connected to the ventilation hole and provided in the table, which are provided in the above-described known device.",True,0.2900997698307037,0.8388010190607939,35,56,-21,142,325,-183
"따라서, 본 발명에서는, 워크 서포트를 간소한 구조로 작게 만들 수 있다.]","Accordingly, in this aspect of the invention, it is possible to provide a downsized work support with a mechanically simple structure.",True,0.3435799181461334,0.7458066128379217,11,21,-10,42,134,-92
"[상기 본 발명은, 하기(下記) (1) 내지 (3)의 구성을 포함하는 것이 바람직하다.]",It is preferable to incorporate the following features (1) to (3) into the above aspect of the present invention.,True,0.3064278960227966,0.7719523365186484,11,19,-8,49,113,-64
"[(1) 예를 들면, 도 1 내지 도 3에 나타내는 바와 같이, 상기 배출로(42)에 개폐 밸브(44)가 설치된다.","(1) As shown in FIG. 1 to FIG. 3, an opening/closing valve 44 is provided to the discharge passage 42.",True,0.2190009951591491,0.8739598051902713,16,20,-4,64,102,-38
"상기 개폐 밸브(44)가, 상기 삽통 구멍(2)의 내주벽(內周壁)에 장착되는 더스트 씰(dust seal)(43)과 그 더스트 씰(43)의 립부(lip portion)(43a)가 접동(摺動, 슬라이드) 가능하게 밀착되는 상기 서포트 로드(3)의 외주면(外周面)에 의해 구성된다.]","The opening/closing valve 44 is structured by: a dust seal 43 attached to an inner peripheral wall of the insertion hole 2; and an outer peripheral surface of the support rod 3, with which a lip portion 43a of the dust seal 43 is in close contact in a slidable manner.",True,0.1572978496551513,0.9134575287628024,26,51,-25,156,268,-112
"[이 경우, 출구실의 가스가 환상 공간과, 립부와 서포트 로드 사이에 형성되는 밸브 개방 간극(clearance)을 통해 하우징의 외부로 배출됨으로써, 더스트 씰과 서포트 로드 사이에 퇴적(堆積)하는 칩(chip) 등의 이물질을, 배출가스가 날려 버려 립부 위를 크리닝할 수 있다.]","In this arrangement, gas in the outlet chamber is discharged to the outside of the housing through the annular space and through a valve-opening clearance created between the lip portion and the support rod.",False,0.4283367991447449,0.758675039662876,35,34,1,158,207,-49
"[(2) 예를 들면, 도 4 및 도 5에 나타내는 바와 같이, 상기 환상 공간(2a)과 상기 하우징(1)의 외부를 연통시키는 통로(47, 52)가 상기 하우징(1)의 선단부에 형성된다.","(2) As shown in FIG. 4 and FIG. 5, for example, a passage 47, 52, which communicatively connects the annular space 2a to the outside of the housing 1, is provided at the leading end portion of the housing 1.",True,0.205589935183525,0.8826061748740973,24,40,-16,103,207,-104
"그 통로(47, 52)가 상기 배출로(42)의 일부를 구성한다.","The passage 47, 52 structures a part of the discharge passage 42.",True,0.2060312032699585,0.8658173540567016,7,12,-5,35,65,-30
"상기 통로(47, 52)에 개폐 밸브(48, 53)가 설치된다.","An opening/closing valve 48, 53 is provided to the passage 47, 52.",True,0.1976403295993805,0.8729487841176616,7,12,-5,35,66,-31
"상기 개폐 밸브(48, 53)는, 상기 환상 공간(2a)으로부터 상기 하우징(1)의 외부로의 압축가스의 흐름을 허용함과 함께 그 역류(逆流)를 제한한다.]","The opening/closing valve 48, 53 is configured to allow a flow of compressed gas from the annular space 2a to the outside of the housing 1 and to block the reverse flow.",True,0.2284787893295288,0.867105367419678,17,32,-15,86,169,-83
"[이 경우, 배출로로부터의 가스가 필요한 개소(箇所)를 향해 배출되도록, 하우징의 선단부의 원하는 장소에 배출구가 마련된다.","In this arrangement, it is possible to provide the discharge port at a desired position in the leading end portion of the housing so that gas from the discharge passage is discharged toward a target point which needs the gas.",True,0.27134969830513,0.843569065609024,14,40,-26,69,225,-156
"또는, 배출로로부터의 가스가 불필요한 개소를 피해서 배출되도록, 하우징에 배출구가 마련된다.]","Alternatively, the discharge port may be provided to the housing so that a specific point or area is not exposed to the gas discharged from the discharge passage.",True,0.4180613756179809,0.73060861526928,10,28,-18,52,162,-110
"[본 개시의 일 예에서, 단계 1에서, 화학식 1로 나타낸 구조를 갖는 살리실알데하이드, 아미노 보호제, 트리에틸실란 및 트리플루오로아세트산은 0 내지 50℃(바람직하게는, 10 내지 50℃)에서 3 내지 18시간(바람직하게는, 8 내지 18시간) 동안 혼합 및 유지되어, 화학식 2로 나타낸 구조를 갖는 화합물을 수득하며; 여기서, 아미노 보호제는 벤질 카바메이트 또는 3차-부틸 카바메이트로부터 선택되며; 아미노 보호제와 살리실알데하이드 간의 비는 1.0 내지 3.0 당량:1 당량이며; 트리에틸실란과 살리실알데하이드 간의 비는 1.0 내지 3.0 당량:1 당량이다.]","In an example of the present disclosure, in step 1, salicylaldehyde having the structure shown in Formula 1, amino protecting agent, triethylsilane and trifluoroacetic acid are mixed and kept at 0-50°C (preferably 10- 50°C) for 3-18 hours (preferably 8-18 hours), to obtain the compound having the structure shown in Formula 2; wherein the amino protecting agent is selected from benzyl carbamate or tert-butyl carbamate; wherein the ratio between the amino protecting agent and salicylaldehyde is 1.0-3.0 equivalents: 1 equivalent; and wherein the ratio between triethylsilane and salicylaldehyde is 1.0-3.0 equivalents:1 equivalent.",True,0.1477866619825363,0.9260702534380048,68,91,-23,320,634,-314
"[본 개시의 바람직한 예에서, 혼합물은 온도를 유지하면서 교반된다.]","In a preferred example of the present disclosure, the mixture is stirred while keeping the temperature.",True,0.2108443528413772,0.8636875500939918,8,16,-8,38,103,-65
"[단계 1에서, 3차-부틸 카바메이트가 사용될 때, 혼합은 테트라하이드로푸란, 2-메틸테트라하이드로푸란, 아세토니트릴 및 1,4-디옥산으로 구성되는 군으로부터 선택된 유기 용매 중에서 수행된다.]","In step 1, when tert-butyl carbamate is used, mixing is carried out in an organic solvent selected from the group consisting of tetrahydrofuran, 2-methyltetrahydrofuran, acetonitrile and 1,4-dioxane.",True,0.2025641351938247,0.8813191774257711,19,27,-8,109,199,-90
"[본 개시의 바람직한 예에서, 단계 1에서, 무기 알칼리 포화용액은 반응을 켄칭시키기 위해 사용되어 화학식 2의 화합물을 수득한다.","In a preferred example of the present disclosure, in step 1, a saturated inorganic alkali solution is used to quench the reaction to obtain the compound of Formula 2.",True,0.2234086245298385,0.8754501405431404,17,29,-12,73,166,-93
"상기 무기 알칼리는 소듐 바이카보네이트, 칼륨 바이카보네이트, 칼륨 카보네이트, 소듐 카보네이트, 소듐 하이드록사이드, 리튬 하이드록사이드 등을 포함한다.","Said inorganic alkali includes sodium bicarbonate, potassium bicarbonate, potassium carbonate, sodium carbonate, sodium hydroxide, lithium hydroxide, etc. The inorganic alkali solution can be used in any amount as long as the reaction can be quenched.",True,0.4245633780956268,0.7154839460127508,17,35,-18,86,251,-165
"바람직하게는, 무기 알칼리 용액은 혼합물을 예를 들어, 7 내지 9, 7 내지 8.5, 7 내지 8, 7.5 내지 8.5, 7.5 내지 9 등의 pH를 갖는 것과 같이 약알칼리성으로 만들 수 있다.]","Preferably, the inorganic alkali solution can make the mixture weakly alkaline, such as having a pH of 7-9, 7-8.5, 7-8, 7.5-8.5, 7.5-9 etc.",False,0.2485337853431701,0.8424574823755596,31,23,8,111,139,-28
"[본 개시의 다른 구체예에서, 단계 2에서, 화학식 2의 화합물 대 아세트산의 비는 1:0.1 내지 20(g/mL); 바람직하게는, 1:1 내지 15(g/mL); 및 더욱 바람직하게는, 1:3 내지 10(g/mL)이다.]","In another embodiment of the present disclosure, in step 2, the ratio of the compound of Formula 2 to acetic acid is 1:0.1-20 (g/mL); preferably 1:1-15 (g/mL); and more preferably, 1:3-10 (g/mL).",False,0.1894713640213012,0.8988817453913373,25,32,-7,123,195,-72
"[본 개시의 일 구체예에서, 단계 2에서, 아세트산과 반응하기 위한 온도는 50℃ 내지 아세트산의 환류 온도; 바람직하게는, 70℃ 내지 아세트산의 환류 온도이다.]","In an embodiment of the present disclosure, in step 2, the temperature for reacting with acetic acid is from 50°C to the reflux temperature of acetic acid; preferably from 70°C to the reflux temperature of acetic acid.",False,0.1489553153514862,0.915608564947163,21,37,-16,92,218,-126
"[본 개시의 일 구체예에서, 단계 2에서, 아세트산과 반응하기 위한 시간은 5 내지 70시간, 및 바람직하게는, 5 내지 60시간이다.]","In an embodiment of the present disclosure, in step 2, the time for reacting with acetic acid is 5-70 hours, and preferably 5-60 hours.",False,0.1337821930646896,0.9211533222192196,18,24,-6,76,135,-59
"[반응 효과를 고려하여, 단계 2에서, 반응 온도는 반응 시간과 밀접하게 관련이 있다.","Considering the reaction effect, in step 2, the reaction temperature is closely related to the reaction time.",False,0.1675028353929519,0.8867822390512524,12,17,-5,48,109,-61
"반응 온도가 높을수록, 요구되는 반응 시간이 짧아지며, 그 반대도 마찬가지이다.","The higher the reaction temperature, the shorter the reaction time required, and vice versa.",False,0.0938496366143226,0.9319243137705882,10,14,-4,44,92,-48
"예를 들어, 70℃보다 낮은 반응 온도에서, 반응은 35시간 이상 동안 수행될 수 있으며, 100℃보다 높은 반응 온도에서, 반응 시간은 15시간 미만일 수 있다.]","For example, but not limited to, at a reaction temperature lower than 70°C, the reaction can be carried out for more than 35 hours; and at a reaction temperature higher than 100°C, the reaction time can be less than 15 hours.",True,0.0982906594872474,0.9415521676553308,23,41,-18,92,225,-133
"[본 개시의 바람직한 구체예에서, 유기 용매는 결정화시키기 위해 아세트산을 함유한 혼합물에 첨가될 수 있으며, 비교적 고순도를 갖는 살리실아민 아세테이트는 여과 후에 수득될 수 있다.","In a preferred embodiment of the present disclosure, an organic solvent can be added into the mixture containing acetic acid to crystallize, and salicylamine acetate having a relative high purity can be obtained after filtration.",True,0.1987822651863098,0.889870497358854,24,35,-11,102,229,-127
"화학식 2의 화합물의 양을 기준으로 하여, 유기 용매의 양은 1 내지 50배; 바람직하게는, 1 내지 20배; 및 더욱 바람직하게는, 1 내지 10배이다.","Based on the amount of the compound of Formula 2, the amount of organic solvent is 1-50 times; preferably 1-20 times; and more preferably 1-10 times.",True,0.148702785372734,0.9136728208211894,22,26,-4,86,149,-63
"유기 용매는 에틸 아세테이트, 이소프로필 에테르, 무수 에탄올, 및 메틸 3차-부틸 에테르(MTBE)로 구성되는 군으로부터 선택될 수 있다.]","The organic solvent can be selected from the group consisting of ethyl acetate, isopropyl ether, absolute ethanol, and methyl tert-butyl ether (MTBE).",True,0.1064617037773132,0.9329341378857082,17,22,-5,79,150,-71
"[단계 2, 화학식 2로 나타낸 구조를 갖는 화합물을 아세트산과 혼합 및 반응하고, 반응을 완료한 후에 온도를 실온으로 낮추어서 미정제 살리실아민 아세테이트를 수득하는 단계;]","In a preferred embodiment of the present disclosure, the method for preparing salicylamine acetate having a structure shown in Formula 3 provided by the present disclosure includes the following steps: Step 1, mixing the salicylaldehyde having the structure shown in Formula 1 with the amino protecting agent to obtain the compound having the structure shown in Formula 2; Step 2, mixing and reacting the compound having the structure shown in Formula 2 with acetic acid, and lowering the temperature to room temperature after the reaction is completed, to obtain crude salicylamine acetate; Step 3, mixing the crude salicylamine acetate with an organic solvent, and crystallizing to obtain salicylamine acetate having the structure shown in Formula 3 with a high purity.",False,0.4133338034152984,0.7644152288824815,23,120,-97,98,771,-673
"[본 개시의 일 구체예에서, 단계 3에서 사용되는 유기 용매의 양은 단계 2에서 사용되는 아세트산의 양의 2 내지 5배(v/v), 바람직하게는, 2 내지 4배이다.]","In an embodiment of the present disclosure, the amount of organic solvent used in step 3 is 2-5 times (v/v), preferably 2-4 times of the amount of acetic acid used in step 2.",True,0.1565348505973816,0.9143488562609614,22,33,-11,92,174,-82
[본 개시에서 언급된 특징들 또는 구체예에서 언급된 특징들은 임의로 조합될 수 있다.,The features mentioned in the present disclosure or the features mentioned in the embodiments can be combined arbitrarily.,True,0.1920327097177505,0.8674294244055505,12,18,-6,47,122,-75
"명세서에 개시된 모든 특징은 임의의 조성물 형태와 조합하여 사용될 수 있으며, 명세서에 개시된 각 특징은 동일한, 동등한 또는 유사한 목적을 제공할 수 있는 임의의 대안적인 특징에 의해 대체될 수 있다.","All the features disclosed in the specification can be used in combination with any composition form, and each feature disclosed in the specification can be replaced by any alternative feature that can provide the same, equal or similar purpose.",True,0.2685211598873138,0.8291923639605946,30,39,-9,113,245,-132
"이에 따라, 달리 기술하지 않는 한, 개시된 특징은 단지 동일한 또는 유사한 특징의 일반적인 예이다.]","Therefore, unless otherwise specified, the disclosed features are only general examples of equal or similar features.",True,0.1511690765619278,0.8943295342754365,15,16,-1,57,117,-60
[본 개시의 주요 장점은 하기와 같다:],The main advantages of the present disclosure are: 1.,False,0.2950563430786133,0.7816812431358795,6,9,-3,22,53,-31
"[1. 본 개시에 의해 제공된 살리실아민 아세테이트를 제조하는 방법은 적은 원료를 사용하고, 경로가 짧고, 비용이 저렴하다.]","The method for preparing salicylamine acetate provided by the present disclosure uses few raw materials, short route and low cost.",False,0.1566126346588134,0.8992377929823794,16,20,-4,70,130,-60
[2. 본 개시에 의해 제공된 살리실아민 아세테이트를 제조하는 방법은 상업적 적용에 적합하다.],2. The method for preparing salicylamine acetate provided by the present disclosure is suitable for commercial application.,True,0.1280363798141479,0.9190773061771204,12,17,-5,53,123,-70
[3. 본 개시의 방법에 의해 수득된 살리실아민 아세테이트는 양호한 외관을 갖는다.],3. The salicylamine acetate obtained by the method of the present disclosure has a good appearance.,True,0.1599084436893463,0.8959624312182293,11,16,-5,47,99,-52
[본 개시는 특정 구체예와 함께 하기에서 추가로 설명될 것이다.,The present disclosure will be further explained below in conjunction with specific embodiments.,True,0.2531560659408569,0.8079221826425748,9,13,-4,35,96,-61
"이러한 구체예는 단지 본 개시를 예시하기 위해 사용되는 것으로서, 본 개시의 범위를 제한하는 것은 아닌 것으로 이해되어야 한다.",It should be understood that these embodiments are only used to illustrate the present disclosure and not to limit the scope of the present disclosure.,True,0.1925574094057083,0.8548551210458053,18,25,-7,71,151,-80
하기 실시예에서 특정 조건을 명시하지 않은 실험 방법은 대개 기존 조건에 따르거나 제조업체에 의해 제안된 조건에 따른 것이다.,The experimental methods that do not indicate specific conditions in the following examples are usually in accordance with conventional conditions or in accordance with the conditions recommended by the manufacturer.,True,0.2303500324487686,0.8412908957882315,18,30,-12,70,216,-146
"달리 기술하지 않는 경우, 모든 백분율, 비율, 비 또는 부(part)는 중량 기준이다.","Unless otherwise stated, all percentages, ratios, ratios, or parts are by weight.",True,0.2524201273918152,0.7974425107367206,12,12,0,49,81,-32
"본 개시에서 중량-부피 백분율의 단위는 당업자에게 널리 공지되어 있고, 예를 들어, 100 ml 용액 중 용질의 중량을 지칭한다.","The unit of weight-volume percentage in the present disclosure is well-known to those skilled in the art, for example, refers to the weight of the solute in a 100 ml solution.",True,0.124249517917633,0.922732484114757,18,31,-13,72,175,-103
"달리 정의하지 않는 경우, 본 개시에서 사용되는 모든 전문 용어 및 과학 용어는 당업자에게 잘 알려진 의미와 동일한 의미를 갖는다.","Unless otherwise defined, all professional and scientific terms used in the disclosure have the same meaning as those familiar to those skilled in the art.",True,0.134660854935646,0.9047194660830616,20,25,-5,73,155,-82
"또한, 기술된 내용과 유사하거나 균등한 임의의 방법 및 물질은 본 개시의 방법에 적용될 수 있다.","In addition, any method and material similar or equivalent to the content described can be applied to the method of the present disclosure.",True,0.1253987103700637,0.9214413503948096,15,23,-8,54,139,-85
본 개시에 기술된 바람직한 구현 방법 및 물질은 단지 예시 목적을 위한 것이다.],The preferred implementation methods and materials described in the disclosure are for illustration purposes only.,True,0.1752430200576782,0.8815539918010552,13,15,-2,45,114,-69
"[하기 실시예에서, 화학식 3의 화합물의 순도는 고성능 액체 크로마토그래피에 의해 결정된다. 고성능 액체 크로마토그래피의 정지상은 C18이며, 이동상은 트리플루오로아세트산 아세토니트릴의 수용액이며, 검출 파장은 220 nm이다.","The stationary phase of high performance liquid chromatography is C18, the mobile phase is an aqueous solution of trifluoroacetic acid acetonitrile, and the detection wavelength is 220nm.",False,0.3079616725444793,0.8076492082516016,24,27,-3,127,187,-60
순도는 각 피크의 합에 대한 화학식 3의 화합물의 피크 면적의 백분율이다.],The purity is the percentage of the peak area of the compound of Formula 3 to the sum of the area of each peak.,True,0.2157119959592819,0.8359497038177793,11,24,-13,42,111,-69
[B[attributes={}; value=[실시예 1]]],Example 1,False,0.7278757691383362,0.5061714809989011,3,2,1,33,9,24
"[아세토니트릴(168.0 g) 및 주요 물질 살리실알데하이드(70.4 g, 1.00 eq)를 1L 반응 플라스크에 첨가하였다.","Acetonitrile (168.0 g) and the primarly material salicylaldehyde (70.4 g, 1.00 eq) were added into a 1L reaction flask.",True,0.0833056345582008,0.9480363834066768,13,19,-6,70,119,-49
"3차-부틸 카바메이트(74.0 g, 1.10 eq) 및 트리에틸실란(79.0 g, 1.20 eq)을 1L 반응 플라스크에 첨가하였다.","Tert-butyl carbamate (74.0 g, 1.10 eq) and triethylsilane (79.0 g, 1.20 eq) were added into the 1L reaction flask.",True,0.1307607740163803,0.9165211905738402,14,19,-5,74,114,-40
"트리플루오로아세트산(65.4 g, 1.00 eq)을 15℃ 내지 40℃의 온도 하에서 반응 시스템에 적가하였다.","Trifluoroacetic acid (65.4 g, 1.00 eq) was added dropwise to the reaction system under a temperature of 15°C-40°C. After the addition was complete, the mixture was kept at 15-40°C and stirred for 12-16 hours.",False,0.3066589832305908,0.8067965546487239,12,34,-22,62,208,-146
"이후에, 샘플링을 2 내지 4시간 마다 수행하였다.","Then, sampling was performed every 2-4 hours.",True,0.1193995401263237,0.9142578066216894,7,7,0,28,45,-17
"HPLC 검출에서 출발 물질의 함량이 5% 미만이거나 2개의 연속 샘플의 변화가 1% 미만인 것으로 나타났을 때, 525 g의 소듐 바이카보네이트 포화용액(490 g 물 + 35 g 소듐 바이카보네이트)을 15 내지 30℃의 온도 하에서 시스템에 첨가하여, 반응을 켄칭시켰다(특정 첨가 양은 pH, pH=7 내지 8에 따름). 이후에, 시스템을 매번 에틸 아세테이트 252 g으로 2회 추출하였다.","When the HPLC detection showed that the content of the starting material was less than 5% or the change of two consecutive samples was less than 1%, 525 g of saturated sodium bicarbonate solution (490 g water + 35 g sodium bicarbonate) was added to the system under the temperature of 15-30°C, to quench the reaction (the specific addition amount is subject to pH, pH=7-8).",True,0.1939742118120193,0.8886567487996196,53,65,-12,222,373,-151
의류처리장치{LAUNDARY TREATING APPARATUS},BACKGROUND OF THE DISCLOSURE,False,0.9380475282669068,0.227359048963344,3,4,-1,35,28,7
[본 발명은 소량의 세탁물을 세탁할 수 있는 탑로드 타입의 의류처리장치에 관한 것이다.],The present disclosure relates to a top-load type laundry treating apparatus capable of washing a small quantity of laundry.,True,0.2693081200122833,0.8231080186649639,12,19,-7,49,124,-75
"[일반적으로, 의류처리장치라 함은 의류 등의 세탁, 건조 또는 세탁이나 건조를 수행할 수 있는 장치를 말한다.","Generally, a laundry treatment device means a device capable of washing, drying, or washing & drying laundry and the like.",True,0.2340257316827774,0.8511047858138648,15,20,-5,61,122,-61
"여기서 의류처리장치는 세탁이나 건조 기능만을 수행하거나, 세탁이나 건조를 모두 수행할 수 있다.","Herein, the laundry treatment device may perform a wash or dry function only, or may perform both of the washing function and the drying function.",True,0.1385424882173538,0.9089871003341808,12,25,-13,53,146,-93
"또한, 최근에는 스팀 공급 장치가 구비되어 의류 등의 구김 제거, 냄새 제거, 정전기 제거 등 프레쉬(refresh) 기능을 구비한 세탁기가 보급되고 있다.]","Recently, a steam supplier equipped washer having a refresh function (e.g., wrinkle press-out, deodorization, static electricity removal, etc.) for laundry tends to come into wide use.",True,0.2607177793979645,0.8127936327761968,21,26,-5,88,184,-96
[이러한 의류처리장치들은 최근 사용자의 수용에 부응하여 점차 대형화 되어가는 추세이다.,These laundry treatment devices are becoming increasingly large in response to user's demands recently.,True,0.222804918885231,0.8190357585378459,10,14,-4,48,103,-55
"즉, 가정용으로 사용되는 세탁기들의 외형 사이즈도 점차 대형화 되어가고 있다. ]","In other words, the appearance sizes of washing machines used for home use are also gradually becoming larger.",True,0.1608589738607406,0.8742296321073703,11,18,-7,45,110,-65
[일반적으로 각 가정에는 하나의 대용량 의류처리장치를 구비하여 사용한다.,"Generally, each household is equipped with a large-capacity laundry treatment device to use.",True,0.3169994950294494,0.7589060177571951,8,13,-5,40,92,-52
"따라서, 세탁물의 종류에 따라 구분하여 세탁하고자 하는 경우 의류처리장치를 여러 번 사용하게 된다.","Accordingly, the laundry treatment device shall be used several times when washing is performed by classifying laundry according to the types of the laundry.",True,0.2582149803638458,0.818740896966465,13,24,-11,55,157,-102
"예컨대, 성인용 의류와 같은 세탁물과 속옷류나 아기옷 등과 같은 세탁물을 나누어 세탁하고자 하는 경우 전자의 세탁이 완료된 후 후자의 세탁을 위해 다시 의류처리장치를 사용하게 된다.]","For example, if you want to separate laundry such as adult clothing and laundry such as underwear or baby clothes, the laundry treatment device will be used again for the latter laundry after the former laundry has been completed.",True,0.1473713666200637,0.9025195438430988,25,39,-14,102,230,-128
"[ 이로 인해, 세탁시간이 많이 소요되고, 또한 소비되는 에너지도 많아지게 되는 문제점이 있었다.","As a result, there was a problem that led to a lot of washing time and a lot of energy consumption.",True,0.2333894670009613,0.7984655710842296,13,21,-8,54,99,-45
"또한, 소량의 의류를 세탁함에 있어 종래와 같은 대형 의류처리장치를 사용하는 것은 에너지 절약 측면에서 바람직하지 않을 수 있다]","Also, the use of the conventional large laundry treatment device in washing a small quantity of laundry may not be desirable in terms of energy conservation.",True,0.1617295145988464,0.8837499195400631,18,26,-8,72,157,-85
"[이와 같은 이유로, 종래 대형 의류처리장치보다는 그 용량이 훨씬 작은 소형의 의류처리장치가 필요성이 점차 대두되었다.","For this reason, the need for a smaller laundry treatment device with a much smaller capacity than a conventional large laundry treatment device has emerged.",True,0.2864146828651428,0.7986535038751919,15,25,-10,66,157,-91
"근자에는 상기 문제를 해결하기 위해, 프론트 로드 타입 의류처리장치의 상부 또는 하부에 보조적으로 구비될 수도 있고, 독립적으로 구비될 수도 있는 소형 탑로드 타입 의류처리장치가 등장하였다.]","To solve the above problem, a small top-load type laundry treatment device was introduced, which could be subsidiarily provided to the top or bottom of a front-load type laundry treatment device, or independently provided.",True,0.2207300364971161,0.8706324491329812,25,34,-9,107,222,-115
"[상기 탑로드 타입의 의류처리장치는 필요에 따라 상기 프론트 로드 타입 의류처리장치의 상부에 구비되거나 또는 드로워로 구비되어 상기 프론트 로드 타입 의류처리장치의 하부에 구비될 수 있어, 소량의 세탁물을 세탁할 수 있으면서 공간활용도를 도모할 뿐만 아니라, 물 또는 에너지를 절약하고 소량의 세탁물을 수시로 세탁할 수 있는 효과를 도출하였다.]","The top-load type laundry treatment device may be installed at the top of the front-load type laundry treatment device or at the bottom of the front-load type laundry treatment device as a drawer as needed, thereby washing a small quantity of laundry, making better use of a space, saving water or energy, and washing a small quantity of laundry frequently.",True,0.2493656575679779,0.8641696639528464,46,60,-14,193,357,-164
"[한편, 보조의류처리장치에 포함된 터브는 높이가 상대적으로 너비에 비해 낮게 구비되므로 상기 터브에 공급되는 물, 의류, 또는 세제가 상기 터브의 상부에 구비된 터브투입구로 토출될 수 있는 가능성이 있으며, 이를 방지하기 위해, 상기 보조의류처리장치는 상기 터브투입구를 개폐할 수 있는 도어를 더 포함할 수 있다.]","On the other hand, since a tub included in an auxiliary laundry treatment device is relatively low in width, there is a possibility that the water, laundry, or detergent supplied to the tub may be discharged into a tub entrance.",False,0.4420046806335449,0.7594853505804483,42,40,2,176,228,-52
"[일반적으로, 대한민국 공개특허공보 2019-0120654호(공개일: 2019.10.28)에 개시된 종래 보조의류처리장치는 터브의 상부면에 회전 가능하게 힌지식 결합되어 터브투입구를 개폐할 수 있도록 구비된 도어를 포함하고 있다.]","In general, the conventional auxiliary garment processing device, disclosed in Korean Publication of Unexamined Patent Applications, No. 2019-0120654 (Open Date: 2019.10.28 ), includes a door rotatably hinge-coupled to a top side of a tub to open/close a tub entrance.",True,0.2600969970226288,0.8486172731148582,22,39,-17,129,268,-139
"[하지만, 상기 종래 보조의류처리장치의 상부에 구비된 메인의류처리장치가 프론트 로드 타입으로 구비되는 경우, 상기 종래 보조의류처리장치에 포함된 상기 힌지식 도어는 상기 메인의류처리장치의 프론트 도어와 충돌할 우려가 있다.]","However, if a main laundry treatment device provided to a top side of the auxiliary laundry treatment device of the related art is provided as a front-load type, the hinge-type door included in the auxiliary laundry treatment device may possibly collide with a front door of the main laundry treatment device.",True,0.3474344313144684,0.8101652381614776,26,51,-25,125,309,-184
"[또한, 상기 종래 보조의류처리장치의 상기 힌지식 도어는 드로워가 캐비닛으로부터 완전히 인출되지 않은 경우 제대로 열릴 수 없다는 단점도 있다.]","Moreover, it is disadvantageous in that the hinge-type door of the related art laundry treatment device is not correctly open if a drawer fails to be fully withdrawn from a cabinet.",True,0.4103823900222778,0.7460608337606611,19,31,-12,81,181,-100
"[또한, 상기 종래 보조의류처리장치의 내부에 의류를 투입하거나 상기 종래 보조의류처리장치의 내부에 수용된 의류를 반출할 때, 상기 종래 보조의류처리장치의 도어가 완전히 열린 상태를 유지할 필요가 있는데, 상기 힌지식 도어는 완전히 열린 상태를 유지하기 위해 고정부재가 추가로 필요하다는 단점도 있다.]","Moreover, when laundry is put into the related art auxiliary laundry treatment device or the laundry received in the related art laundry treatment device is taken out, the door of the related art laundry treatment device needs to keep a fully-open state.",False,0.4963663518428802,0.7270790419486998,38,42,-4,168,254,-86
"[또한, 상기 종래 보조의류처리장치는 세탁이 완료된 후 상기 터브 내부에 잔류하는 물을 제거할 때, 상기 드로워를 상기 캐비닛으로부터 반드시 인출한 후 상기 힌지식 도어를 열린 상태로 유지하여야 한다.","Moreover, when water remaining in the tub is discharged after completion of washing, the related art auxiliary laundry treatment device should keep the hinge-type door in an open state after the drawer has been withdrawn.",True,0.2990105450153351,0.8250795557652667,28,35,-7,112,221,-109
"따라서, 상기 종래 보조의류처리장치는 상기 터브를 건조시킬 때 상기 드로워를 상기 캐비닛으로부터 인출하기 위한 추가적인 공간이 필요하다는 단점도 있다.]","Thus, when the tub is dried, the related art auxiliary laundry treatment device disadvantageously requires an additional space for withdrawing the drawer from the cabinet.",True,0.3616090714931488,0.7617303260277911,19,25,-6,85,171,-86
"[또한, 상기 보조의류처리장치는 상기 터브를 건조시킬 때, 사용자가 상기 캐비닛으로부터 인출된 상기 드로워로 인해 이동이 방해되어 불편함을 초래하거나, 나아가 사용자가 상기 캐비닛으로부터 인출된 상기 드로워에 걸려 넘어짐에 따라 부상의 위험성이 발생할 가능성도 있다.]","Furthermore, when the tub of the auxiliary laundry treatment device is dried, the drawer withdrawn from the cabinet interrupts a user's motion to cause inconvenience, and there is a possibility that there will be a risk of injury as the user trips over the drawer withdrawn from the cabinet.",True,0.3255229592323303,0.8033198740185307,33,49,-16,150,291,-141
"[본 발명의 다양한 과제 중 하나는, 터브의 상부면을 따라 슬라이딩 가능한 도어를 포함하는 의류처리장치를 제공하는 것이다.]",One technical task of the present disclosure is to provide a laundry treatment apparatus including a door slidable along a top side of a tub.,True,0.3775789141654968,0.7731365832585464,16,25,-9,69,141,-72
"[본 발명의 다양한 과제 중 하나는, 상기 터브의 상부면에 구비되며 상기 도어의 열림과 닫힘을 감지하기 위한 도어 열림 감지센서를 포함하는 의류처리장치를 제공하는 것이다.]",Another technical task of the present disclosure is to provide a laundry treatment apparatus including a door opening detection sensor provided to a top side of a tub to detect opening or closing of a door.,True,0.333239883184433,0.8302386896731927,23,36,-13,96,206,-110
"[본 발명의 다양한 과제 중 하나는, 상기 도어가 상기 터브의 상부면에 구비된 터브투입구를 완전히 차폐하는 경우에만 도어의 닫힘을 감지하고, 상기 터브투입구를 완전히 차폐하지 않는 경우에는 도어의 열림을 감지하는 도어 열림 감지센서를 포함하는 의류처리장치를 제공하는 것이다.]",Another technical task of the present disclosure is to provide a laundry treatment apparatus including a door opening detection sensor configured to detect a closing of a door only if the door completely covers a tub entrance provided to a top side of a tub or an opening of the door if the door fails to completely cover the tub entrance.,True,0.2861120700836181,0.8622781425663285,35,61,-26,154,339,-185
"[본 발명의 다양한 과제 중 하나는, 상부에 프론트 로드 타입의 메인의류처리장치가 구비되는 경우에도, 상기 메인의류처리장치의 프론트 도어와 충돌할 우려가 없는 슬라이딩 타입의 도어를 포함하는 의류처리장치를 제공하는 것이다.]",Another technical task of the present disclosure is to provide a laundry treatment apparatus including a sliding-type door free from colliding with a front door of a main laundry treatment device of a front-load type even if the main laundry treatment device is provided above the laundry treatment apparatus.,True,0.380232959985733,0.7997059941314083,27,49,-22,125,309,-184
"[본 발명의 다양한 과제 중 하나는, 드로워가 캐비닛으로부터 완전히 인출되지 않은 경우에도 제대로 열릴 수 있는 도어를 포함하는 의류처리장치를 제공하는 것이다.]",Another technical task of the present disclosure is to provide a laundry treatment apparatus including a door that can be correctly open despite that a drawer fails to be fully withdrawn from a cabinet.,True,0.3035577833652496,0.8219460289765064,21,34,-13,90,202,-112
"[본 발명의 다양한 과제 중 하나는, 터브의 내부로 의류를 투입하거나 상기 터브의 내부에 수용된 의류를 반출할 때, 추가 고정부재가 필요없이 완전히 열린 상태를 유지할 수 있는 도어를 포함하는 의류처리장치를 제공하는 것이다.]",Another technical task of the present disclosure is to provide a laundry treatment apparatus including a door capable of keeping a fully-open state without an additional fixing member when laundry is put into or withdrawn from a tub.,True,0.3713956177234649,0.7942288250358664,31,38,-7,126,233,-107
"[본 발명의 다양한 과제 중 하나는, 터브 내부에 잔류하는 물을 제거할 때, 드로워를 캐비닛으로부터 인출할 필요가 없는 의류처리장치를 제공하는 것이다.]",Further technical task of the present disclosure is to provide a laundry treatment apparatus unnecessary to withdraw a drawer from a cabinet in removing water remaining in a tub.,True,0.3261252045631408,0.7988068193578819,20,29,-9,85,178,-93
"[본 발명의 예시적인 실시예들에 따른 의류처리장치는 터브의 상부에 구비된 도어가 상기 터브의 상부면을 따라 슬라이딩 가능하도록 구비될 수 있고, 상기 도어는 상기 터브의 상부면에 구비되어 상기 도어와 선택적으로 접촉하는 도어 열림 감지센서를 통해 열림과 닫힘이 감지되도록 구비될 수 있다.]","A laundry treatment apparats according to exemplary embodiments of the present disclosure may include a door provided over a top side of a tub so as to be slidable along the top side of the tub, and the door may be configured to detect an opening or closing via a door opening detection sensor provided to the top side of the tub to selectively contact with the door.",True,0.2788020372390747,0.8727043238826658,39,68,-29,162,367,-205
"[본 발명의 예시적인 실시예들에 따른 의류처리장치는, 전방에 개구부가 마련된 캐비닛; 상기 개구부에 삽입되어 인출 가능하도록 구비되는 드로워 바디; 상기 드로워 바디의 내부에 구비되어 물이 저장되는 공간을 제공하는 터브 바디와, 상기 터브 바디의 상부에 결합되며 의류가 투입 가능한 터브투입구가 마련된 터브 커버를 포함하는 터브; 상기 터브 바디의 내부에 회전 가능하게 구비되어 의류가 저장되는 공간을 제공하며, 상기 터브투입구와 연통하여 의류가 투입 가능한 드럼투입구를 포함하는 드럼; 상기 터브 바디의 하부에 구비되어 상기 드럼을 회전시키는 동력을 제공하는 구동부; 상기 터브 커버의 상부에 슬라이딩 가능하도록 구비되어 상기 터브투입구를 개폐하는 도어; 및 상기 터브 커버의 상기 일면에 구비되며, 상기 도어의 슬라이딩으로 인해 상기 도어에 선택적으로 접촉하여 상기 도어의 열림과 닫힘을 감지하는 도어 열림 감지센서;를 포함할 수 있다.]","To achieve these objects and other advantages and in accordance with the purpose of the disclosure, as embodied and broadly described herein, an apparatus for treating laundry according to one embodiment of the present disclosure may include a cabinet having an opening portion provided to a front side, a drawer body configured withdrawable by being inserted in the opening portion, a tub including a tub body configured within the drawer body to provide a space for storing water therein and a tub cover coupled to a top side of the tub body and having a tub entrance for putting the laundry, a drum rotatably configured within the tub body to provide a space for storing the laundry therein and having a drum entrance for putting the laundry by communicating with the tub entrance, a drive part configured under a bottom side of the tub body to provide a power for rotating the drum, a door configured slidable on a top side of the tub cover to open/close the tub entrance, and a door opening detection sensor configured on the one side of the tub cover to detect an opening/closing of the door by contacting with the door selectively owing to a sliding of the door.",True,0.3345170319080353,0.8430183563801519,111,205,-94,471,1169,-698
"[상기 터브 커버는, 상기 터브 커버의 일면 상에서 상기 터브 투입구의 양측 중 적어도 일측에 구비되어 상기 도어가 상기 터브투입구를 차폐하도록 슬라이딩되는 것을 가이드하는 제1가이드레일을 포함할 수 있고, 상기 도어 열림 감지센서는 상기 도어가 상기 제1가이드레일의 일단까지 슬라이딩되면 상기 도어와 접촉 가능하도록 구비되는 의류처리장치. ]",The tub cover may include a first guide rail provided to at least one of both sides of the tub entrance on the one side of the tub cover to guide the door to slide to cover the tub entrance and the door opening detection sensor may be configured capable of contacting with the door if the door slides to one end of the first guide rail.,True,0.2015604674816131,0.9060514243903872,45,67,-22,192,336,-144
"[상기 제1가이드레일은, 상기 제1가이드레일의 일단에 구비되어 상기 도어가 닫힐 때 소정 높이만큼 하강하도록 가이드하는 제1절곡부를 포함할 수 있고, 상기 도어 열림 감지센서는 상기 도어가 상기 제1절곡부로 슬라이딩되면 상기 도어와 접촉 가능하도록 구비될 수 있다.]",The first guide rail may include a first bent portion configured on one end of the first guide rail to guide the door to ascend by a prescribed height when closed and the door opening detection sensor may be configured to contact with the door if the door slides to the first bent portion.,True,0.214955449104309,0.8938602197239294,34,54,-20,149,289,-140
"[상기 제1가이드레일은 상기 터브 커버의 일면에 대해 평행하게 연장되다가, 상기 제1절곡부를 지나면서 아래로 경사지게 연장될 수 있다.]",The first guide rail may be extended side by side with the one side of the tub cover and then inclined to extend downward on passing the first bent portion.,True,0.2758807241916656,0.8313779171793437,17,30,-13,76,156,-80
"[상기 도어는, 상기 도어의 하부면에서 상기 제1가이드레일에 대응되는 위치에 결합되어 상기 제1가이드레일에 접촉하면서 이동 가능하도록 구비되는 제1가이드 돌출부를 포함할 수 있고, 상기 도어 열림 감지센서는 상기 제1가이드 돌출부가 상기 제1가이드레일의 일단에 위치할 때 상기 도어에 접촉함으로써 상기 도어의 닫힘을 감지할 수 있으며, 상기 도어 열림 감지센서는 상기 제1가이드 돌출부가 상기 제1가이드레일의 일단 이외의 나머지 부분에 위치할 때 상기 도어에 접촉하지 않음으로써 상기 도어의 열림을 감지할 수 있다.]",The door may include a first guide projection part coupled to a position corresponding to the first guide rail on a bottom side of the door and configured to be movable while contacting with the first guide rail.,False,0.5212686061859131,0.7326981976196861,67,38,29,289,212,77
"[상기 터브 커버는, 상기 터브 커버의 일면 상에서 상기 터브 투입구의 후방에 구비되어 상기 도어가 상기 터브투입구를 차폐하도록 슬라이딩되는 것을 가이드하는 제2가이드레일을 더 포함할 수 있고, 상기 도어 열림 감지센서는 상기 도어가 상기 제2가이드레일의 일단까지 슬라이딩되면 상기 도어와 접촉 가능하도록 구비될 수 있다.]","When the first guide projection part is located at one end of the first guide rail, the door opening detection sensor may detect the closing of the door by contacting with the door.",False,0.6103469133377075,0.6787963050075992,43,33,10,181,181,0
"[상기 제2가이드레일은, 상기 제2가이드레일의 일단에 구비되어 상기 도어가 닫힐 때 소정 높이만큼 하강하도록 가이드하는 제2절곡부를 포함할 수 있고, 상기 도어 열림 감지센서는 상기 도어가 상기 제2절곡부로 슬라이딩되면 상기 도어와 접촉 가능하도록 구비될 수 있다.]","When the first guide projection part is located at a rest portion except the one end of the first guide rail, the door opening detection sensor may detect the opening of the door by not contacting with the door.",False,0.6633172035217285,0.6492077847174348,34,39,-5,149,211,-62
"[상기 도어는, 상기 도어의 하부면에서 상기 제2가이드레일에 대응되는 위치에 결합되어 상기 제2가이드레일에 접촉하면서 이동 가능하도록 구비되는 제2가이드 돌출부를 더 포함할 수 있고, 상기 도어 열림 감지센서는 상기 제2가이드 돌출부가 상기 제2절곡부에 위치할 때 상기 도어에 접촉함으로써 상기 도어의 닫힘을 감지할 수 있으며, 상기 도어 열림 감지센서는 상기 제2가이드 돌출부가 상기 제2절곡부 이외의 나머지 부분에 위치할 때 상기 도어에 접촉하지 않음으로써 상기 도어의 열림을 감지할 수 있다.]",The tub cover may further include a second guide rail configured in rear of the tub entrance on the one side of the tub cover to guide the door to slide to cover the tub entrance and the door opening detection sensor may be configured to be capable of contacting with the door if the door slides up to one end of the second guide rail.,False,0.4592384696006775,0.77931178571447,66,66,0,279,335,-56
"[상기 터브 커버는 상기 터브 커버의 일면 상에 구비되어 상기 도어 열림 감지센서가 결합되는 센서 결합부를 포함할 수 있고, 상기 센서 결합부는 상기 터브 커버의 일면 상에서 상기 터브 투입구의 후방에 배치될 수 있다.]",The second guide rail may include a second bent portion configured at one end of the second guide rail to guide the door to descend by a prescribed height when closed.,False,0.8588110208511353,0.5328657361586349,34,31,3,123,167,-44
[상기 도어 열림 감지센서의 일부는 상기 센서 결합부에 결합된 상태에서 상기 센서 노출부를 통해 상기 도어 안착부의 상부로 노출될 수 있다.],The door opening detection sensor may be configured to be capable of contacting with the door if the door slides to the second bent portion.,False,0.7340283989906311,0.5756212180050578,21,25,-4,79,140,-61
"[상기 도어는 상기 도어의 하부면에서 상기 센서 노출부에 대응되는 위치에 결합되는 감지 돌출부를 더 포함할 수 있고, 상기 감지 돌출부는 상기 센서 노출부를 통해 상기 도어 안착부를 관통하여 상기 도어 열림 감지센서의 일부에 접촉 가능하도록 구비될 수 있다.]",The door may further include a second guide projection part coupled to a position corresponding to the second guide rail on the bottom side of the door and configured to be movable while contacting with the second guide rail.,False,0.6051074862480164,0.676246230005943,38,39,-1,145,225,-80
"[상기 도어 열림 감지센서는, 상기 터브 커버의 일면에 안착되는 센서 바디 및 상기 센서 바디의 일측에 구비된 스위치부를 포함할 수 있고, 상기 스위치부는 상기 센서 바디로부터 연장되어 상기 도어와 접촉 가능하도록 구비되는 도어 접촉부, 및 상기 센서 바디와 상기 도어 접촉부 사이에 구비되어 상기 센서 바디의 내부로 인입 가능하도록 구비되는 이동 부재를 포함할 수 있다.]",The door opening detection sensor may detect the closing of the door by contacting with the door when the second guide projection part is located at the second bent portion.,False,0.7303804755210876,0.5962097106195813,55,30,25,209,173,36
"[상기 도어 열림 감지센서는, 상기 도어가 닫힐 때 상기 도어 접촉부가 상기 도어에 접촉하여 상기 이동 부재를 상기 센서 바디의 내부로 밀어냄에 따라 상기 도어의 닫힘을 감지할 수 있다.]",The door opening detection sensor may detect the opening of the door by not contacting with the door when the second projection part is located at a rest portion except the second bent portion.,False,0.5913743376731873,0.6668669588737212,29,34,-5,105,193,-88
"[상기 터브 커버는, 상기 터브 커버의 일면 상에서 상기 터브 투입구의 양측 중 적어도 일측에 구비되어 상기 도어가 슬라이딩되는 것을 가이드하는 제1가이드레일, 및 상기 터브 커버의 일면 상에서 상기 터브 투입구의 후방에 구비되어 상기 도어가 슬라이딩되는 것을 가이드하는 제2가이드레일을 포함할 수 있고, 상기 터브 커버는 상기 터브 커버의 일면 상에 구비되어 상기 도어 열림 감지센서가 결합되는 센서 결합부를 더 포함할 수 있으며, 상기 센서 결합부는 상기 제2가이드레일로부터 이격되도록 배치될 수 있다.]",The tub cover may include a sensor coupling part configured on the one side of the tub cover to have the door opening detection sensor coupled thereto and the sensor coupling part may be disposed in rear of the tub entrance on the one side of the tub cover.,False,0.3906798958778381,0.8169760731848498,71,49,22,284,257,27
"[상기 도어 열림 감지센서는, 상기 터브 커버의 일면에 안착되는 센서 바디 및 상기 센서 바디의 일측에 구비된 스위치부를 포함할 수 있고, 상기 감지 돌출부는 상부에서 보았을 때 상기 스위치부의 적어도 일부와 정렬되도록 배치될 수 있다.]",The tub cover may further include a door seat part covering at least one portion of a top side of the tub cover and having the door seated thereon and the door seat part may include a sensor exposing part configured at a position corresponding to the sensor coupling part.,False,0.3839798271656036,0.8100144460249801,35,50,-15,133,272,-139
"[상기 감지 돌출부는 상기 도어가 닫힐 때 소정 높이만큼 하강하여 상기 스위치부에 접촉하도록 구비될 수 있고, 상기 도어가 열릴 때 소정 높이만큼 상승하여 상기 스위치부에 접촉하지 않도록 구비될 수 있다.",A portion of the door opening detection sensor may be exposed above the door seat part through the sensor exposing part while coupled to the sensor coupling part.,False,0.6383442282676697,0.6605510423763459,30,28,2,114,162,-48
"이때, 상기 도어 열림 감지센서는 상기 감지 돌출부와 상기 스위치부의 접촉 여부에 의해 상기 도어의 열림과 닫힘을 감지할 수 있다.]",The door may further include a detection projection part coupled to a position corresponding to the sensor exposing part on the bottom side of the door and the detection projection part may be configured to be capable of contacting with a portion of the door opening detection sensor by passing the door seat part through the sensor exposing part.,False,0.7081092000007629,0.6261564175725991,20,59,-39,74,347,-273
"[본 발명의 예시적인 실시예들에 따른 의류처리장치는, 전방에 개구부가 마련된 캐비닛; 상기 개구부에 삽입되어 인출 가능하도록 구비되는 드로워 바디; 상기 드로워 바디의 내부에 구비되어 물이 저장되는 공간을 제공하는 터브 바디와, 상기 터브 바디의 상부에 결합되며 의류가 투입 가능한 터브투입구가 마련된 터브 커버를 포함하는 터브; 상기 터브 내부에 회전 가능하게 구비되어 의류가 저장되는 공간을 제공하며, 상기 터브투입구와 연통하여 의류가 투입 가능한 드럼투입구를 포함하는 드럼; 상기 터브의 하부에 구비되어 상기 드럼을 회전시키는 동력을 제공하는 구동부; 상기 터브의 상부에 결합되어 상기 터브투입구를 덮으며, 상기 터브 커버의 일면을 따라 슬라이딩 가능하도록 구비되는 도어; 및 상기 터브 커버의 상기 일면 상에 구비되어 상기 도어의 열림과 닫힘을 감지하는 도어 열림 감지센서를 포함할 수 있다.",The door opening detection sensor may include a sensor body seated on the one side of the tub cover and a switch part configured on one side of the sensor body and n the switch part may include a door contact part extended from the sensor body to be capable of contacting with the door and a moving member configured between the sensor body and the door contact part to be retractable into the sensor body.,False,0.579118549823761,0.730159562397245,107,76,31,447,406,41
작업 기계,Technical Field,False,0.8097749948501587,0.3773057957983476,2,2,0,5,15,-10
[본 발명은 작업 기계에 관한 것이다.],The present invention relates to a work machine.,True,0.2254021614789962,0.8601603988076529,6,8,-2,22,48,-26
"[유압 액추에이터로 구동되는 작업 장치(예를 들어, 붐, 암, 및 작업구(어태치먼트) 등의 복수의 프론트 부재를 갖는 다관절형의 프론트 작업 장치)를 구비하는 작업 기계(예를 들어, 유압 셔블)의 작업 효율을 향상시키는 기술로서 머신 컨트롤(Machine Control: MC)이 있다.","As a technology that enhances the work efficiency of a work machine (e.g. a hydraulic excavator) including a work implement (e.g. an articulated front work implement having a plurality of front implement members such as a boom, an arm, and a work tool (attachment)) driven by hydraulic actuators, there is machine control (Machine Control: MC).",True,0.1656775474548339,0.9068382876055036,34,55,-21,160,344,-184
"MC는, 조작 장치가 오퍼레이터에게 조작된 경우에, 미리 정한 조건에 따라 작업 장치를 동작시키는 반자동 제어를 실행함으로써 오퍼레이터의 조작 지원을 행하는 기술이다.]",MC is a technology that assists operation performed by an operator by executing semi-automatic control of operating a work implement according to predetermined conditions when operation devices are operated by the operator.,True,0.1816883236169815,0.8861279508708804,21,32,-11,94,223,-129
"[MC의 예로서, 오퍼레이터가 현황 지형을 원하는 형상으로 정형하는 것을 지원하는 기술이 있다.",Examples of MC include a technology of assisting an operator to form a current terrain profile into a desired profile.,True,0.2661947309970855,0.8126348019661483,12,20,-8,53,118,-65
"이 기술에 관하여, 특허문헌 1에는, 버킷의 날끝이 설계면의 외측(상방)에 위치하고 있을 때의 거리를 양의 값으로 하고, 설계면(이하에는, 「목표 굴삭면」이라고도 칭함)의 내측(하방)으로부터 외측(상방)을 향하는 방향의 속도를 양의 값으로 하여, 작업 장치 전체의 제한 속도와 암 목표 속도와 버킷 목표 속도로부터 붐의 제한 속도를 결정하고, 붐의 제한 속도가 붐 목표 속도보다도 큰 것을 포함하는 제1 제한 조건이 충족되어 있을 때는, 붐의 제한 속도로 붐을 제어함과 함께, 암 목표 속도로 암을 제어하는, 건설 기계의 제어 장치가 개시되어 있다.]","Regarding this technology, Patent Document 1 discloses a controller of a construction machine that determines a limited velocity of a boom from a limited velocity of an entire work implement, an arm target velocity, and a bucket target velocity while defining a distance of the blade tip of a bucket when it is positioned outside (above) a design surface as a positive value, and a velocity in a direction from the inner side (lower side) to the outer side (upper side) of the design surface (hereinafter, referred to also as a ""target excavation surface"") as a positive value, and controls the boom at the limited velocity of the boom and controls an arm at the arm target velocity when a first limitation condition including that the limited velocity of the boom is higher than a boom target velocity is satisfied.",True,0.1504543721675872,0.9227211204118896,75,140,-65,308,816,-508
"[또한, 다른 MC의 예로서, 미리 설정된 영역(이하에는 「작업 영역」이라고도 칭함)으로부터, 셔블의 일탈을 방지하는 기술이 있다.","In addition, as a different example of MC, there is a technology of preventing deviation of an excavator from a preset area (hereinafter, referred to also as a ""work area"").",True,0.2033213376998901,0.8785953195374929,15,30,-15,73,173,-100
"이 기술에 관련하여, 특허문헌 2에는, 작업 장치(프론트 작업 장치)의 동작 범위 공간에 위험역(이하에는, 「침입 금지 영역」이라고도 칭함)을 마련하여, 그 위험역의 앞에서 작업 장치의 속도를 감속시켜, 위험역의 직전에서 작업 장치를 정지시키는 기술이 개시되어 있다.]","In relation to this technology, Patent Document 2 discloses a technology of providing a dangerous area (hereinafter, referred to also as an ""entry prohibited area"") in an operation area space of a work implement (front work implement), decelerating a velocity of the work implement before the dangerous area, and stopping the work implement just before the dangerous area.",True,0.1273817121982574,0.9333650089453271,33,58,-25,150,372,-222
"[PatentCitationText[attributes={}; value=[국제 공개 제2014/167718호 공보 ]], PatentCitationText[attributes={}; value=[일본 특허 공개 평05-321290호 공보]]]",Patent Documents,False,0.6295388340950012,0.472059960107656,12,2,10,136,16,120
"[특허문헌 1에서는, 오퍼레이터의 위화감을 작게 억제하면서 버킷이 설계면을 침식하는 것을 방지하기 위해, 붐의 제한 속도가 산출된다.","In Patent Document 1, in order to prevent a bucket from moving into a design surface while a sense of discomfort felt by an operator is kept low, a limited velocity of a boom is calculated.",True,0.3317265212535858,0.795685887865051,16,36,-20,74,189,-115
"구체적으로는, 모든 프론트 부재의 동작에 의해 발생하는 수직 방향 속도가, 설계면과 버킷 날끝의 거리에 따라 정해지는 수직 방향의 제한 속도를 초과하지 않도록, 붐의 제한 속도를 산출한다.","Specifically, the limited velocity of the boom is calculated such that a vertical velocity generated by operation of all front implement members does not exceed a vertical limited velocity determined by a distance between the design surface and the bucket blade tip.",True,0.2481292337179184,0.8469591614874403,26,42,-16,105,266,-161
"이때 암과 버킷의 수직 방향 속도는, 오퍼레이터의 조작에 의해 발생하는 속도로 하고 있다.","At this time, vertical velocities of the arm and the bucket are velocities generated by operation by the operator.",True,0.2704270482063293,0.7930574620226222,13,19,-6,50,114,-64
"그 결과, 오퍼레이터의 굴삭 시의 조작의 위화감을 억제할 수 있다.]","As a result, a sense of discomfort felt by the operator regarding operation at the time of excavation can be suppressed.",True,0.3737138211727142,0.7233475135033987,10,21,-11,38,120,-82
"[특허문헌 2에서는, 위험역의 앞쪽에 감속역을 마련하여, 오퍼레이터 조작에 의해 발생하는 작업 장치 속도가 감속역 내에 정의되는 상한값을 초과하지 않도록 제어된다.","In Patent Document 2, a deceleration area is provided before the dangerous area, and control is performed such that a work implement velocity generated by operator operation does not exceed an upper limit value defined in the deceleration area.",True,0.2326714247465133,0.8655413224786461,20,39,-19,91,244,-153
"그 때문에, 오퍼레이터는 굴삭 작업에 전념할 수 있으므로, 셔블 조작 시의 오퍼레이터의 부담을 경감시킬 수 있다.]","Accordingly, an operator can concentrate on excavation work, and thus the burden on the operator at the time of excavator operation can be reduced.",True,0.2469750046730041,0.8306337138022644,16,24,-8,64,147,-83
"[한편, 실제의 현장에 있어서는, 설계면과 위험역의 양쪽이 설정되어 있는 상황이 있다.","On the other hand, at an actual site, there is a situation where both a design surface and a dangerous area are set.",True,0.2184509187936782,0.8415265284427861,11,23,-12,48,116,-68
"예를 들어, 설계면의 하방에 위험역이 있는 상황에 있어서, 특허문헌 1과 특허문헌 2에 개시된 기술을 사용하여 굴삭을 행한 때, 설계면을 따른 굴삭을 행할 수 없을 가능성이 있다.","For example, when excavation is performed by using the technologies disclosed in Patent Document 1 and Patent Document 2 in a situation where there is a dangerous area below a design surface, there is a possibility that excavation along the design surface cannot be performed.",True,0.1173210069537162,0.9304670856254548,26,45,-19,100,276,-176
"예를 들어, 직선 형상의 설계면을 따른 굴삭을 행하는 경우에는, 암의 클라우드 동작과 붐의 인상 동작을 조합하여, 버킷의 선단에 발생하는 속도 벡터를 설계면을 따르도록 할 필요가 있다.","For example, when excavation along a linear design surface is to be performed, it is necessary to cause a velocity vector generated at the tip of a bucket by the combination of arm crowding operation and boom raising operation to point to a direction along the design surface.",True,0.2971452176570892,0.8132795407481962,26,48,-22,103,276,-173
"이때, 특허문헌 1의 제어(본고에서는 「굴삭 지원 제어」라고 칭함)에 의하면, 오퍼레이터 조작에 의한 암 크라우드 동작에 대하여, 버킷 선단을 설계면을 따라 이동시키기 위한 붐의 제한 속도가 산출된다.","At this time, according to the control of Patent Document 1 (referred to as ""excavation assistance control"" in this document), a limited velocity of a boom for moving the bucket tip along the design surface is calculated with respect to the arm crowding operation according to operator operation.",True,0.2722967565059662,0.8493295328251668,26,48,-22,112,296,-184
"그러나, 버킷 선단이 감속역에 들어간 경우에는, 특허문헌 2의 제어(본고에서는 「일탈 방지 제어」라고 칭하는 경우가 있음)가 발동하여, 실제로 발생하는 암 크라우드 동작이 굴삭 지원 제어에서 상정하고 있던 것보다도 감속되기 때문에, 붐 상승 동작이 과잉으로 된다.","However, when the bucket tip enters a deceleration area, the control of Patent Document 2 (referred to as ""deviation prevention control"" in this document in some cases) is activated, and arm crowding operation actually generated is decelerated more than expected in the excavation assistance control, and thus the boom raising operation becomes excessive.",True,0.2074704468250274,0.8766215671042172,34,53,-19,147,355,-208
"그 때문에, 설계면에 대하여 버킷 선단은 부상하게 되어, 설계면을 따른 굴삭 동작을 행할 수 없을 우려가 있다.]","Accordingly, the bucket tip floats above the design surface, and there is a fear that excavation operation along the design surface cannot be performed.",True,0.3506460785865783,0.7617891404592203,17,24,-7,63,152,-89
"[또한, 설계면의 상방에 위험역(예를 들어, 구조물 등)이 있고, 설계면과 위험역 사이에 작업 장치가 위치하는 상황도 있다.","In addition, in some cases, there is also a situation where there is a dangerous area (e.g. a structure) above a design surface, and a work implement is positioned between the design surface and the dangerous area.",True,0.193400964140892,0.8818129778679287,16,37,-21,69,214,-145
"그러한 상황에 있어서, 특허문헌 1과 특허문헌 2에 개시된 기술을 사용하여 굴삭을 행한 때는, 설계면에 버킷이 침입할 가능성이 있다.","When excavation is performed by using the technologies disclosed in Patent Document 1 and Patent Document 2 in such a situation, there is a possibility that a bucket enters the design surface.",True,0.1523810476064682,0.9001034144211533,18,32,-14,74,192,-118
"예를 들어, 특허문헌 1의 굴삭 지원 제어에 의해 암의 클라우드 동작과 붐의 인상 동작에 의해 설계면을 따른 직선 형상의 굴삭을 행하고 있을 때, 암의 후단부가 상방의 위험역에 가까워졌기 때문에 특허문헌 2의 일탈 방지 제어가 발동하여 붐 상승이 감속 또는 정지되면, 굴삭 지원 제어에서 상정한 양보다도 붐 상승이 부족해, 설계면에 대하여 버킷 선단이 침입하여, 설계면을 따른 굴삭 동작을 행할 수 없을 우려가 있다.]","For example, if the deviation prevention control of Patent Document 2 is activated, and boom raising is decelerated or stopped because a rear end section of an arm approaches a dangerous area above the rear end section when linear excavation along a design surface is being performed by arm crowding operation and the boom raising operation according to the excavation assistance control of Patent Document 1, there is a fear that the boom raising is insufficient for an amount expected in the excavation assistance control, a bucket tip enters the design surface, and excavation operation along the design surface cannot be performed.",True,0.237697422504425,0.8656757581840294,62,102,-40,234,635,-401
"[이와 같이, 설계면(목표 굴삭면)과 위험역(작업 영역, 침입 금지 영역)의 양쪽이 설정되어 있는 상황에서는, 특허문헌 1의 굴삭 지원 제어와 특허문헌 2의 일탈 방지 제어의 기능이 간섭할 우려가 있다.]","As in these cases, in a situation where both a design surface (target excavation surface) and a dangerous area (a work area, an entry prohibited area) are set, there is a fear that the functionalities of the excavation assistance control of Patent Document 1, and the deviation prevention control of Patent Document 2 interfere with each other.",True,0.1911933571100235,0.8891084912840189,27,57,-30,114,344,-230
"[그래서 본 발명의 목적은, 굴삭 지원 제어에 의한 목표 굴삭면의 굴삭 중에 작업 장치가 작업 영역과 위험역(침입 금지 영역)의 경계인 작업 영역 경계에 근접하는 상황에 있어서도, 목표 굴삭면을 따른 굴삭이 가능하게 되는 작업 기계를 제공하는 데 있다.","In view of this, an object of the present invention is to provide a work machine that enables excavation along a target excavation surface even in a situation where a work implement is proximate to a work area boundary which is the boundary between a work area and a dangerous area (entry prohibited area) during excavation of the target excavation surface according to excavation assistance control.",True,0.1856058090925216,0.8988456564175951,37,66,-29,141,400,-259
"또한, 상술한 바와 같이, 일탈 방지 제어란, 침입 금지 영역으로의 침입을 방지하는 제어, 환언하면, 작업 영역으로부터의 일탈을 방지하는 제어이다.","Note that, as mentioned above, deviation prevention control is control by which entry into the entry prohibited area is prevented, in other words, control by which deviation from the work area is prevented.",True,0.1917248219251632,0.8782947778440882,19,33,-14,82,206,-124
"또한, 굴삭 지원 제어란, 원하는 목표 굴삭면이 규정하는 형상으로 되도록 현황 지형을 정형하는 제어이다.]","In addition, the excavation assistance control is control by which a current terrain profile is formed into a profile defined by the desired target excavation surface.",True,0.2794479429721832,0.8117784640492941,14,26,-12,59,167,-108
"[본원은 상기 과제를 해결하는 수단을 복수 포함하고 있지만, 그 일례를 들면, 기계 본체에 설치되어 작업구를 포함하는 복수의 프론트 부재를 갖는 작업 장치와, 상기 기계 본체 및 상기 복수의 프론트 부재를 구동하는 복수의 액추에이터와, 상기 복수의 액추에이터를 조작하는 조작 장치와, 상기 기계 본체 및 상기 작업 장치의 자세 정보를 검출하는 자세 센서와, 상기 조작 장치의 조작 정보를 검출하는 조작 센서와, 소정의 목표 굴삭면을 따라 상기 작업구가 이동하도록 상기 작업 장치를 제어하는 굴삭 지원 제어 및 상기 복수의 프론트 부재 중 상기 작업 장치를 소정의 작업 영역으로부터 일탈시킬 수 있는 대상의 프론트 부재의 동작을 감속 또는 정지하여 상기 작업 영역으로부터의 상기 작업 장치의 일탈을 방지하는 일탈 방지 제어를 이용하여 상기 작업 장치를 제어 가능한 컨트롤러를 구비하고, 상기 컨트롤러는, 상기 굴삭 지원 제어와 상기 일탈 방지 제어의 양쪽에서 상기 작업 장치를 제어하는 경우에는, 상기 작업구의 동작 방향이, 상기 굴삭 지원 제어만을 이용하여 상기 작업 장치를 제어한 경우의 상기 작업구의 동작 방향에 근접하도록 상기 작업 장치를 제어하는 것으로 한다.]","The present application includes a plurality of means for solving the problems described above, and an example thereof is a work machine including: a work implement that is attached to a machine body, and has a plurality of front implement members including a work tool; a plurality of actuators that drive the machine body and the plurality of front implement members; an operation device that operates the plurality of actuators; a posture sensor that senses postural data about the machine body and the work implement; an operation sensor that senses operation data about the operation device; and a controller that is capable of controlling the work implement by using excavation assistance control of controlling the work implement such that the work tool moves along a predetermined target excavation surface and deviation prevention control of preventing deviation of the work implement from a predetermined work area by decelerating or stopping operation of a subject front implement member that is included in the plurality of front implement members and that can deviate the work implement from the work area, in which the controller is configured to control the work implement such that when the controller controls the work implement by using both the excavation assistance control and the deviation prevention control, an operation direction of the work tool approximates to an operation direction of the work tool that is to be generated when the work implement is controlled by using only the excavation assistance control.",True,0.1946131289005279,0.8957269907641431,155,243,-88,598,1538,-940
"[본 발명에 따르면, 작업 기계가 작업 영역 경계에 근접하는 상황에 있어서, 목표 굴삭면을 따른 굴삭이 가능하게 된다.]","According to the present invention, excavation along a target excavation surface becomes possible in a situation where a work machine is proximate to a work area boundary.",True,0.1772469282150268,0.8982678611643574,17,27,-10,67,171,-104
"[도 1은 본 발명의 실시 형태에 관한 유압 셔블의 구성도. 도 2는 도 1의 유압 셔블의 컨트롤러를 유압 구동 장치와 함께 도시하는 도면. 도 3은 유압 셔블에 있어서의 좌표계(셔블 기준 좌표계)를 도시하는 도면. 도 4는 컨트롤러의 기능 블록도. 도 5는 굴삭 지원 제어에 의한 수평 굴삭 동작의 일례를 도시하는 도면. 도 6은 일탈 방지 제어에 의해 작업 영역으로부터의 일탈을 방지하는 일례를 도시하는 도면. 도 7은 목표 굴삭면과 작업 영역 경계가 근접하는 상황에서의 굴삭 동작을 도시하는 도면. 도 8은 목표 굴삭면과 작업 영역 경계가 근접하는 상황에서의 굴삭 동작을 도시하는 도면. 도 9는 굴삭 지원 제어에 의한 제어의 흐름도의 일례를 도시하는 도면. 도 10은 흐름도의 보조도. 도 11은 일탈 방지 제어에 의한 제어의 흐름도의 일례를 도시하는 도면. 도 12는 정지 부위의 산출의 일례를 도시하는 도면. 도 13은 일탈 방지 제어에 의한 제어의 흐름도의 일례를 도시하는 도면. 도 14는 목표 정지 각도와 프론트 부재의 회동 각도의 차와, 감속 계수와의 관계를 도시하는 도면.]",Brief Description of the Drawings,False,1.202880859375,0.1709410778175525,149,5,144,556,33,523
"[이하, 본 발명의 실시 형태에 대하여 도면을 사용하여 설명한다.",Fig. 1 is a configuration diagram of a hydraulic excavator according to embodiments of the present invention.,False,0.7664332985877991,0.4883371650594399,9,17,-8,36,109,-73
"또한, 이하에는, 작업 기계로서, 작업 장치(프론트 작업 장치)의 선단의 작업구(어태치먼트)로서 버킷을 구비하는 유압 셔블을 예시하지만, 버킷 이외의 어태치먼트를 구비하는 작업 기계에 본 발명을 적용해도 된다.",Fig. 2 is a figure depicting a controller of the hydraulic excavator in Fig. 1 along with a hydraulic drive system.,False,0.8996326923370361,0.4618725819887046,25,21,4,117,115,2
"또한, 선회 가능한 구조물 상에, 복수의 프론트 부재(작업구, 붐, 암 등)를 연결하여 구성되는 다관절형의 작업 장치를 갖는 것이라면, 유압 셔블 이외의 작업 기계에의 적용도 가능하다.]",Fig. 3 is a figure depicting a coordinate system (excavator reference coordinate system) of the hydraulic excavator.,False,0.9269471764564514,0.3839206968483903,25,17,8,104,116,-12
"[또한, 이하의 설명에서는, 동일한 구성 요소가 복수 존재하는 경우, 부호의 말미에 알파벳의 소문자를 붙이는 경우가 있지만, 당해 알파벳의 소문자를 생략하고 당해 복수의 구성 요소를 통합하여 표기하는 경우가 있다.",Fig. 4 is a functional block diagram of the controller.,False,1.0684274435043335,0.229391178442784,28,10,18,119,55,64
"예를 들어, 동일한 3개의 펌프(190a, 190b, 190c)가 존재할 때, 이것들을 통합하여 펌프(190)라고 표기하는 경우가 있다.]",Fig. 5 is a figure depicting an example of horizontal excavation operation according to excavation assistance control.,False,1.1440242528915403,0.1455433549912373,15,17,-2,77,118,-41
"[또한, 미리 설정된, 셔블이 작업 가능한 영역을 작업 영역, 작업 영역을 정의하는 경계 부분을, 작업 영역 경계라고 칭한다.]",Fig. 6 is a figure depicting an example of prevention of deviation from a work area by deviation prevention control.,False,0.9406311511993408,0.3608541897830806,18,20,-2,71,116,-45
"[또한, 이하에 나타내는 실시 형태에 있어서는, 상술한 굴삭 지원 제어나 일탈 방지 제어와 같은, 조작 장치가 오퍼레이터에게 조작된 경우에 미리 정한 조건에 따라 작업 장치를 동작시키는 반자동 제어를, 「MC」라고 총칭한다.]",Fig. 7 is a figure depicting excavation operation in a situation where a target excavation surface and a work area boundary are proximate to each other.,False,1.0539311170578003,0.3465406917876324,30,26,4,126,152,-26
[<제1 실시 형태>],Fig. 8 is a figure depicting excavation operation in a situation where a target excavation surface and a work area boundary are proximate to each other.,False,1.0735632181167605,0.2678127189467387,3,26,-23,12,152,-140
"[도 1은 본 발명의 실시 형태에 관한 유압 셔블의 구성도이고, 도 2는 본 발명의 실시 형태에 관한 유압 셔블의 컨트롤러(제어 장치)(40)를 유압 구동 장치와 함께 도시하는 도면이다.]",Fig. 9 is a figure depicting an example of a flowchart of control according to the excavation assistance control.,False,0.9002244472503662,0.4021895328611712,27,19,8,105,113,-8
"[도 1에 있어서, 유압 셔블(1)은, 다관절형의 프론트 작업 장치(작업 장치)(1A)와, 차체(기계 본체)(1B)로 구성되어 있다.",Fig. 10 is an auxiliary figure of the flowchart.,False,1.0659642219543457,0.277804507769992,14,9,5,74,48,26
"차체(기계 본체)(1B)는, 좌우의 주행 유압 모터(3a, 3b)에 의해 주행하는 하부 주행체(11)와, 하부 주행체(11) 상에 설치되어, 선회 유압 모터(4)에 의해 구동되어 좌우 방향으로 선회 가능한 상부 선회체(12)로 이루어진다.]",Fig. 11 is a figure depicting an example of a flowchart of control according to the deviation prevention control.,False,1.0137346982955933,0.3097992539039889,27,19,8,134,113,21
"[프론트 작업 장치(1A)는, 수직 방향으로 각각 회동하는 복수의 프론트 부재(붐(8), 암(9) 및 버킷(작업구)(10))를 연결하여 구성되어 있고, 상부 선회체(12)(기계 본체(1B))에 설치되어 있다.",Fig. 12 is a figure depicting an example of a calculation of a stopped portion.,False,0.9938565492630004,0.3018296200579189,21,15,6,116,79,37
붐(8)의 기단은 상부 선회체(12)의 전방부에 있어서 붐 핀(8a)(도 3 참조)을 통해 회동 가능하게 지지되어 있다.,Fig. 13 is a figure depicting an example of a flowchart of control according to the deviation prevention control.,False,0.9493978023529052,0.3204568350182765,15,19,-4,67,113,-46
"붐(8)의 선단에는 암 핀(9a)을 통해 암(9)이 회동 가능하게 연결되어 있고, 암(9)의 선단에는 버킷 핀(10a)을 통해 버킷(10)이 회동 가능하게 연결되어 있다.",Fig. 14 is a figure depicting the relation between a deceleration coefficient and a difference between a target stop angle and a pivot angle of a front implement member.,False,0.924612522125244,0.3568496005090703,20,29,-9,95,169,-74
"붐(8)은 붐 실린더(5)에 의해 구동되고, 암(9)은 암 실린더(6)에 의해 구동되고, 버킷(10)은 버킷 실린더(7)에 의해 구동된다.]",Modes for Carrying Out the Invention,False,1.1346160173416138,0.1069236900971056,15,6,9,78,36,42
"[붐(8), 암(9), 버킷(10)의 회동 각도 α, β, γ(도 3 참조)를 측정 가능하도록, 붐 핀(8a)에 붐 각도 센서(30), 암 핀(9a)에 암 각도 센서(31), 버킷 링크(14)에 버킷 각도 센서(32)가 설치되고, 상부 선회체(12)에는 기준면(예를 들어, 수평면)에 대한 상부 선회체(12)(차체(1B))의 경사각 θ(도 3 참조)를 검출하는 차체 경사각 센서(33)가 설치되어 있다.","Hereinafter, embodiments of the present invention are explained by using the figures.",False,1.032390594482422,0.2849255495238355,46,12,34,225,85,140
"또한, 각도 센서(30, 31, 32)는 각각 기준면(예를 들어, 수평면)에 대한 각도를 검출하는 각도 센서(예를 들어, 관성 계측 장치(IMU: Inertial Measurement Unit))로 대체 가능하다.","Note that whereas the following illustrates, as a work machine, a hydraulic excavator including a bucket as a work tool (attachment) at the tip of a work implement (front work implement), the present invention may be applied to a work machine including an attachment other than a bucket.",False,0.9971836209297144,0.3866083574319049,23,48,-25,119,287,-168
"또는 각 유압 실린더(5, 6, 7)의 스트로크를 검출하는 실린더 스트로크 센서로 대체하여, 얻어진 실린더 스트로크를 각도로 환산해도 된다.","In addition, the present invention can also be applied to a work machine other than a hydraulic excavator as long as the work machine has an articulated work implement including a plurality of front implement members (a work tool, a boom, an arm, etc.) that are coupled with each other on a swingable structure.",False,0.9606285095214844,0.3865774354359583,18,54,-36,78,311,-233
"또한, 상부 선회체(12)와 하부 주행체(11)의 회전 중심 근방에, 상부 선회체(12)와 하부 주행체(11)의 상대 각도(선회 각도 θsw)를 검출 가능한 선회 각도 센서(17)가 설치되어 있다.","In addition, in the following explanation, when there are a plurality of identical constituent elements, lowercase letters of the alphabet are given at the ends of reference characters in some cases, but the plurality of constituent elements are denoted collectively by omitting the lowercase letters of the alphabet in some cases.",False,0.9433190226554872,0.3370802212426308,23,51,-28,110,331,-221
"또한, 선회의 각속도를 검출 가능한 선회 각속도 센서(19)가 상부 선회체(12)에 설치되어 있다.]","For example, when there are three identical pumps 190a, 190b, and 190c, these are denoted collectively as pumps 190 in some cases.",False,0.9343615770339966,0.3375645983180226,12,22,-10,56,130,-74
"[5개의 각도 센서(30, 31, 32, 33, 17)를 상부 선회체(기계 본체)(12) 및 프론트 작업 장치(1A)의 자세 정보를 검출하는 자세 센서(53)(도 4 참조)라고 총칭하는 경우가 있다.]","In addition, a preset area where an excavator can work is referred to as a work area, and a boundary portion defining the work area is referred to as a work area boundary.",False,0.9190949201583862,0.4177215348091411,24,33,-9,112,171,-59
"구체적으로는 조작 장치로서, 주행 우측 유압 모터(3a)(하부 주행체(11))를 조작하기 위한 주행 우측 레버(23a)와, 주행 좌측 유압 모터(3b)(하부 주행체(11))를 조작하기 위한 주행 좌측 레버(23b)와, 붐 실린더(5)(붐(8)) 및 버킷 실린더(7)(버킷(10))를 조작하기 위한 조작 우측 레버(22a)와, 암 실린더(6)(암(9)) 및 선회 유압 모터(4)(상부 선회체(12))를 조작하기 위한 조작 좌측 레버(22b)가 설치되어 있다.","Note that in the embodiments depicted below, semi-automatic control, like the excavation assistance control and the deviation prevention control mentioned earlier, that operates a work implement according to predetermined conditions when operation devices are operated by an operator is collectively referred to as ""MC.""",False,0.8817858099937439,0.4682388411212586,47,44,3,255,320,-65
"[상부 선회체(12)에 탑재된 원동기인 엔진(18)은, 유압 펌프(2)와 파일럿 펌프(48)를 구동한다.",<First Embodiment>,False,1.0022460222244265,0.28250544551258,10,2,8,58,18,40
"유압 펌프(2)는 가변 용량형 펌프이고, 파일럿 펌프(48)는 고정 용량형 펌프이다.]","Fig. 1 is a configuration diagram of a hydraulic excavator according to embodiments of the present invention, and Fig. 2 is a figure depicting a controller (controller) 40 of the hydraulic excavator according to the embodiments of the present invention along with a hydraulic drive system.",False,0.7955188751220703,0.4696757991504016,10,46,-36,48,289,-241
"[본 실시 형태에 있어서는, 도 2에 도시한 바와 같이, 조작 레버(22, 23)는 전기 레버 방식이다.","In Fig. 1, a hydraulic excavator 1 includes an articulated front work implement (work implement) 1A and a body (machine body) 1B.",False,0.8778244853019714,0.4525715049427663,15,22,-7,58,129,-71
[관련 출원의 상호 참조],Cross Reference to Related Applications,True,0.5285320878028869,0.5504653984172899,4,5,-1,14,39,-25
"[본원 발명은 2019년 6월 5일 자로 제출된 중국 특허 출원 201910488336.X, 2019년 8월 8일 자로 제출된 중국 특허 출원 201910730411.9 및 2019년 8월 22일 자로 제출된 중국 특허 출원 201910780214.8의 우선권을 주장하는바, 상기 3개 출원의 내용들은 참조로서 본원 발명에 통합된다.]","The present application claims the benefits of Chinese patent application 201910488336.X, filed on June 5, 2019, Chinese patent application 201910730411.9, filed on August 8, 2019, and Chinese patent application 201910780214.8, filed on August 22, 2019, and the contents of the three applications are incorporated by reference into the present application.",True,0.1756167262792587,0.8656404010451114,40,50,-10,187,356,-169
"[본 발명은 차량용 램프에 관한 것으로, 구체적으로는 차량용 램프 광학 소자에 관한 것이다.","The present invention relates to a vehicle lamp, in particular to a vehicle lamp optical element.",True,0.1802556365728378,0.9121499468557775,13,16,-3,51,97,-46
"이 밖에, 본 발명은 또한 차량용 램프 모듈, 차량용 헤드램프 및 차량에 관한 것이다.]","In addition, the present invention further relates to a vehicle lamp module, a vehicle headlamp and a vehicle.",True,0.1244173347949981,0.9322556038659962,14,18,-4,49,110,-61
"[차량 기술의 발전에 따라 차량용 램프의 조형이 갈수록 다양해지고 있는바, 차량용 램프의 조형을 보다 원활하게 설계하기 위해 차량용 램프 조명을 복수의 차량용 램프 조명 모듈로 분산 설치하여 복수의 조명 영역을 생성하고, 차량용 램프의 조형에 대한 상이한 차량의 요구 사항에 따라 차량용 램프 조명 모듈의 출광부를 특정 직선 형태에 따른 배열, 굽힘선 형태에 따른 배열 또는 곡선 형태에 따른 배열과 같은 일정한 배열 형태로 설치할 수 있다.","With the development of a vehicle technology, modeling of vehicle lamps is increasingly diversified, and in order to make the design of modeling of the vehicle lamps more flexible, by dispersing vehicle lamp illumination into a plurality of vehicle lamp illumination modules, a plurality of illumination areas are generated, and the light exiting parts of the vehicle lamp illumination modules are arranged in a certain arrangement, such as in a straight line, in a bent line, and in a curved line, according to the requirements of different vehicles for modeling of vehicle lamps.",True,0.220903992652893,0.8787162806611293,66,93,-27,247,581,-334
"구체적으로, 도 1에 도시된 바와 같이, 차량용 램프는 6 개의 차량용 램프 조명 모듈(M)을 포함하되, 그 중 일부는 로우빔 차량용 램프 모듈이고, 다른 일부는 하이빔 차량용 램프 모듈이며, 이러한 차량용 램프 조명 모듈(M)의 출광 렌즈는 고유한 조형을 나타내기 위해 일정한 형태로 배열된다.","Specifically, as shown in Fig. 1, a vehicle lamp includes six vehicle lamp illumination modules M, one part of the six vehicle lamp illumination modules M are low beam vehicle lamp modules while the other part of the six vehicle lamp illumination modules M are high beam vehicle lamp modules, and the light exiting lenses of these vehicle lamp illumination modules M are arranged in a certain arrangement to show its characteristic modeling.",True,0.216896191239357,0.8907695337642606,42,73,-31,165,441,-276
"그러나, 로우빔 조명 모드에서 로우빔 차량용 램프 모듈의 렌즈만 점등하고 하이빔 차량용 램프 모듈의 렌즈를 점등하지 않을 경우, 멀티 렌즈의 조형 효과를 부각시킬 수 없어 전체 차량의 미관에 영향을 미치게 된다.","However, if the lenses of the low beam vehicle lamp modules are lightened only in a low beam illumination mode, and the lenses of the high beam vehicle lamp modules are not lightened, the modeling effect of the multiple lenses cannot be emphasized, and thus, the aesthetic appearance of the overall vehicle is influenced.",True,0.2148508578538894,0.872363567267043,31,54,-23,118,321,-203
"따라서, 로우빔 조명 모드에서 하이빔을 켜지 않으면서 하이빔 차량용 램프 모듈의 렌즈도 점등시켜 모든 렌즈가 점등되는 효과를 구현하여야 한다. ]","Therefore, it is required that the lenses of the high beam vehicle lamp modules are also lightened in the low beam illumination mode, but a high beam is not turned on to achieve an effect that all the lenses are lightened.",True,0.2917137742042541,0.813367929695401,20,41,-21,81,222,-141
[공고번호가 CN209893297U인 중국 실용 신안 특허에는 차량용 하이빔 램프 모듈이 개시되어 있다.,"The Chinese utility model patent with the publication number of CN209893297U discloses a vehicle high beam module, which can realize that the high beam module also has auxiliary light ray emission in a low beam illumination mode, and a lens of the high beam module also emits light in the low beam illumination mode, so that the overall modeling beautiful degree of a vehicle lamp is improved.",False,0.5321159362792969,0.6746264837201358,12,67,-55,58,393,-335
그러나 상기 하이빔 램프 모듈의 각 광학 부재가 독립적으로 설치되어 별도로 위치 결정 및 장착을 수행해야 하므로 광학 부재 간의 위치 결정 및 장착 오차를 방지하기 어려워 전체 광학 시스템의 정밀도에 영향을 미친다. ],"However, the optical components of the high beam module are independently arranged and need to be positioned and installed respectively, so that positioning and installation errors among the optical components are difficult to avoid, and the precision of the whole optical system is affected.",True,0.2069175690412521,0.8618383183823328,34,44,-10,122,292,-170
[종래 기술의 상술한 흠결을 고려하여 신규 차량용 램프 광학 소자를 설계할 필요가 있다.],"In view of the above-mentioned drawbacks in the prior art, there is a need to design a novel vehicle lamp optical element.",True,0.331342488527298,0.7868134683121625,13,22,-9,50,122,-72
[PatentCitationText[attributes={}; value=[중국 실용 신안 CN209893297U 차량용 하이빔 램프 모듈]]],Summary of the Invention,False,1.0138128995895386,0.218564287108613,9,4,5,80,24,56
[본 발명이 해결하고자 하는 기본 기술적 과제는 부피가 작을 뿐만 아니라 광학 정밀도가 높고 광 패턴이 정확하며 장착이 편리한 차량용 램프 광학 소자를 제공하는 것이다. ],"The basic technical problem to be solved by the present invention is to provide a vehicle lamp optical element, and the vehicle lamp optical element is not only small in terms of size, but also high in optical precision, accurate in a light shape and easy to mount.",True,0.2777771055698395,0.8470345248895826,26,48,-22,96,265,-169
"[나아가, 본 발명이 해결하고자 하는 기술적 과제는 부피가 작고 광학 정밀도가 높으며 구성 부품이 적고 위치 결정 및 장착 오차가 작은 차량용 램프 모듈을 제공하는 것이다. ]","Further, the technical problem to be solved by the present invention is to provide a vehicle lamp module, and the vehicle lamp module is small in size, high in optical precision, few in constituent parts and low in positioning and mounting error.",True,0.2093955874443054,0.8847035030774922,27,42,-15,98,246,-148
"[이 밖에, 본 발명이 해결하고자 하는 또 다른 기술적 과제는 부피가 작고 광학 정밀도가 높으며 장착이 편리하고 비용이 저렴한 차량용 헤드램프를 제공하는 것이다. ]","In addition, the technical problem to be further solved by the present invention is to provide a vehicle headlamp, and the vehicle headlamp is small in size, high in optical precision, convenient to install and low in cost.",True,0.260219544172287,0.8486467173266026,24,38,-14,92,223,-131
"[마지막으로, 본 발명이 해결하고자 하는 기술적 과제는 부피가 작은 차량용 헤드램프를 구비하고 광학 정밀도가 높으며 장착이 편리하고 비용이 저렴한 차량을 제공하는 것이다. ]","Finally, the technical problem to be solved by the present invention is to provide a vehicle, and the vehicle is provided with a small size vehicle headlamp, and is high in optical precision, convenient to install and low in cost.",True,0.2700793445110321,0.8378050692185183,23,40,-17,97,230,-133
"[상술한 기술적 과제를 해결하기 위해 본 발명의 일 양태는, 순차적으로 설치되는 입광부, 전송부 및 출광부를 포함하는 차량용 램프 광학 소자를 제공하되, 상기 입광부에는 적어도 하나의 입광 구조가 설치되며, 상기 전송부에서 출광 방향을 따른 후단 및 선단은 각각 전송부 입광단 및 전송부 출광단이고, 상기 출광부에서 상기 전송부 출광단을 등진 일단은 출광면을 형성하며, 상기 출광면은 전방으로 돌출된 곡면이고; 상기 전송부의 적어도 한 세트의 대향되는 측면 사이의 거리는 상기 전송부 입광단에 근접되는 일단으로부터 상기 전송부 출광단에 근접되는 일단으로 점차 증가된다. ]","In order to solve the technical problems, on one hand, the present invention provides a vehicle lamp optical element, comprising a light incoming part, a transmission part and a light exiting part which are sequentially arranged, wherein the light incoming part is provided with at least one light incoming structure, the rear end and the front end, in a light exiting direction, of the transmission part are respectively a light incoming end and a light exiting end of the transmission part; one end, facing away from the light exiting end of the transmission part, of the light exiting part forms a light exiting face, and the light exiting face is a curved face protruding forwards; wherein the distance between at least one set of opposite side faces of the transmission part gradually increases from the end approaching the light incoming end of the transmission part to the end approaching the light exiting end of the transmission part.",True,0.2298291325569152,0.8909236488757208,78,157,-79,320,943,-623
"[본 발명의 바람직한 일 실시형태로서, 상기 입광부는 상기 입광부의 일측에 위치한 렌즈 점등 구조를 더 포함하고, 상기 렌즈 점등 구조는 상기 렌즈 점등 구조에 입사된 광선을 적어도 1회 반사시켜 상기 전송부에 전송하고 또한 상기 전송부를 통해 상기 출광부에 전송할 수 있다. ]","As a preferred embodiment of the present invention, the light incoming part further comprises a lens lightening structure located on one side of the light incoming part, and the lens lightening structure is capable of transmitting light rays entering the lens lightening structure to the transmission part by at least one-time reflection and then the light rays transmit to the light exiting part through the transmission part.",True,0.2041043490171432,0.908205322928571,42,67,-25,156,427,-271
"[본 발명의 구체적인 구조 형태로서, 상기 렌즈 점등 구조는 제1 반사면 및 제2 반사면을 포함하고, 상기 제1 반사면은 상기 제1 반사면에 입사된 광선을 상기 제2 반사면에 반사할 수 있으며, 상기 제2 반사면은 상기 제1 반사면의 출사 광선을 상기 전송부에 반사할 수 있다. ]","As a specific structural form of the present invention, the lens lightening structure comprises a first reflecting surface and a second reflecting surface, the first reflecting surface is capable of reflecting light rays entering the first reflecting surface to the second reflecting surface, and the second reflecting surface is capable of reflecting emergent light rays of the first reflecting surface to the transmission part.",True,0.2109788656234741,0.9037898075190552,43,64,-21,157,429,-272
"[바람직하게는, 상기 렌즈 점등 구조는 상기 제1 반사면과 대응되게 설치된 렌즈 점등 입광면, 제1 광 채널 및 제2 광 채널을 더 포함하고, 상기 제1 반사면은 상기 렌즈 점등 입광면의 입사광선을 반사한 후 상기 제1 광 채널을 통해 상기 제2 반사면으로 전송하며, 상기 제2 반사면의 출사 광선은 상기 제2 광 채널을 통해 상기 전송부로 전송된다. ]","Preferably, the lens lightening structure further comprises a lens lightening light incoming surface, a first light channel and a second light channel, the lens lightening light incoming surface corresponds to the first reflecting surface, the first reflecting surface reflects incident light rays of the lens lightening light incoming surface and then the reflected incident light rays transmit to the second reflecting surface through the first light channel, and emergent light rays of the second reflecting surface are transmitted to the transmission part through the second light channel.",True,0.2221967726945877,0.8993497477914676,55,87,-32,198,593,-395
"[보다 바람직하게는, 상기 제1 광 채널의 일단은 상기 제1 반사면에 연결되고, 타단은 상기 제2 반사면에 연결되며, 상기 제1 광 채널의 횡단면적은 상기 제1 반사면에 근접되는 일단으로부터 상기 제2 반사면에 근접되는 일단으로 점차 증가된다. ]","More preferably, one end of the first light channel is connected to the first reflecting surface whilethe other end of the first light channel is connected to the second reflecting surface, and the cross sectional area of the first light channel gradually increases from the end approaching the first reflecting surface to the end approaching the second reflecting surface.",True,0.2078344225883484,0.8990466964761112,34,59,-25,138,373,-235
"[보다 더 바람직하게는, 상기 제1 반사면은 상기 제2 반사면의 상부에 위치하고, 상기 제1 광 채널의 좌측면과 우측면 사이의 거리는 상기 제1 반사면에 근접되는 일단으로부터 상기 제2 반사면에 근접되는 일단으로 점차 증가된다. ]","Further preferably, the first reflecting surface is located above the second reflecting surface, and the distance between the left side surface and the right side surface of the first light channel gradually increases from the end approaching the first reflecting surface to the end approaching the second reflecting surface.",True,0.1797417104244232,0.9094120118341414,32,49,-17,129,325,-196
"[구체적으로, 상기 제1 반사면은 상기 렌즈 점등 입광면으로 돌출된 호면이다. ]","Specifically, the first reflecting surface is a cambered surface protruding towards the lens lightening light incoming surface.",True,0.284164547920227,0.8504627235815301,11,17,-6,45,127,-82
"[보다 구체적으로, 상기 제2 반사면은 상기 제1 반사면에서 멀어지는 방향으로 돌출된 호면이다. ]","More specifically, the second reflecting surface is a cambered surface protruding towards a direction away from the first reflecting surface.",True,0.2212073653936386,0.8782642905371243,13,20,-7,55,141,-86
"[보다 더 구체적으로, 상기 제1 반사면에는 반사 강화층이 설치된다. ]","Further specifically, a reflection increasing layer is arranged on the first reflecting surface.",True,0.2391645759344101,0.8600545606196247,10,13,-3,40,96,-56
"[보다 더 구체적으로, 상기 제1 반사면에는 피문(skin textures) 또는 소광(extinction) 치아가 설치된다. ]","Still further specifically, the first reflecting surface is provided with skin textures or extinction teeth.",True,0.2701164186000824,0.822305324460654,13,15,-2,72,108,-36
"[대표적으로, 상기 렌즈 점등 입광면은 평면 또는 볼록 곡면이다. ]","Typically, the lens lightening light incoming surface is a plane or a convex curved surface.",True,0.3569313287734985,0.7925935573697457,10,15,-5,38,92,-54
"[보다 대표적으로, 상기 렌즈 점등 입광면에는 집광 구조가 설치된다. ]","More typically, the lens lightening light incoming surface is provided with a light condensing structure.",True,0.4888644814491272,0.7250156519942214,10,15,-5,40,105,-65
"[본 발명의 다른 바람직한 실시형태로서, 상기 전송부는 상기 전송부 입광단에 근접되어서부터 상기 전송부 출광단에 근접되어서까지 횡단면적이 점차 증가된다. ]","As another preferred embodiment of the present invention, the cross sectional area of the transmission part gradually increases from a position approaching the light incoming end of the transmission part to a position approaching the light exiting end of the transmission part.",True,0.2436722218990326,0.872979301719245,19,42,-23,87,277,-190
"[바람직하게는, 상기 전송부의 상측면과 하측면 사이의 거리는 상기 전송부 입광단에 근접되는 일단으로부터 상기 전송부 출광단에 근접되는 일단으로 점차 증가된다. ]","Preferably, the distance between the upper side surface and the lower side surface of the transmission part gradually increases from the end approaching the light incoming end of the transmission part to the end approaching the light exiting end of the transmission part.",True,0.2095062732696533,0.8854138227679251,20,43,-23,90,271,-181
"[보다 바람직하게는, 상기 전송부의 좌측면과 우측면 사이의 거리는 상기 전송부 입광단에 근접되는 일단으로부터 상기 전송부 출광단에 근접되는 일단으로 점차 증가된다. ]","More preferably, the distance between the left side surface and the right side surface of the transmission part gradually increases from the end approaching the light incoming end of the transmission part to the end approaching the light exiting end of the transmission part.",True,0.2120577692985534,0.8847609968568979,21,44,-23,93,275,-182
"[본 발명의 다른 구체적인 구조 형태로서, 상기 입광 구조는 매트릭스로 배열되고, 상기 입광 구조는 적어도 1열로 설치된다.","As another specific structural form of the present invention, the light incoming structures are arranged in a matrix manner, and the light incoming structures are arranged in at least one row.",True,0.2984971404075622,0.8320929233607764,17,31,-14,69,192,-123
"[바람직하게는,상기 입광구조 상기 전송부를 등진 일단은 입광면을 형성하고, 상기 입광면은 후방으로 돌출된 곡면 또는 테이퍼면이다. ]","Preferably, the ends, facing away from the transmission part, of the light incoming structures form light incoming surfaces, and the light incoming surfaces are curved surfaces or conical surfaces protruding backwards.",True,0.4444749653339386,0.7663540290501394,16,31,-15,74,218,-144
"[보다 바람직하게는, 상기 입광 구조는 광선을 수렴하도록 구성된다. ]","More preferably, the light incoming structures are configured to condense light rays.",True,0.3009841740131378,0.8259702953694207,9,12,-3,39,85,-46
"[본 발명의 또 다른 바람직한 실시형태로서, 상기 입광 구조는 복수 개이고, 상기 입광 구조는 좌우 방향을 따라 순차적으로 연결되며, 상기 입광 구조에서 상기 전송부를 등진 일단은 입광면을 형성하고, 상기 입광면은 후방으로 돌출된 곡면이다. ]","As another preferred embodiment of the present invention, multiple light incoming structures are arranged, the light incoming structures are sequentially connected in a left-right direction, the ends, facing away from the transmission part, of the light incoming structures form light incoming surfaces, and the light incoming surfaces are curved surfaces protruding backwards.",True,0.384019523859024,0.8075348634764518,34,52,-18,136,377,-241
"[바람직하게는, 상기 전송부의 좌측면과 우측면은 상기 전송부 입광단에 근접되는 일단으로부터 전방으로 연장된 후, 상기 전송부에 근접되는 중심축 방향으로 점차 접근한다. ]","Preferably, the left side surface and the right side surface of the transmission part extend forwards from the end approaching the light incoming end of the transmission part and then gradually draw close to a direction approaching the central axis of the transmission part.",True,0.2011833041906356,0.8896391748332854,21,44,-23,95,274,-179
"[보다 바람직하게는, 상기 전송부의 폭은 상기 출광부의 폭보다 작고, 상기 전송부의 높이는 상기 출광부의 높이보다 작다. ]","More preferably, the width of the transmission part is smaller than that of the light exiting part, and the height of the transmission part is smaller than that of the light exiting part.",True,0.2611808776855469,0.8523413171833202,17,33,-16,69,187,-118
"[구체적으로, 상기 출광부의 횡단면적은 상기 전송부에 근접되는 일단으로부터 상기 전송부로부터 멀어지는 일단으로 점차 감소된다. ]","Specifically, the cross sectional area of the light exiting part gradually decreases from the end approaching the transmission part to the end away from the transmission part.",True,0.2671627104282379,0.845320485276989,15,27,-12,72,175,-103
"[보다 더 바람직하게는, 상기 전송부의 적어도 하나의 측면에는 소광(extinction) 구조가 설치된다. ]","Further preferably, at least one side surface of the transmission part is provided with an extinction structure.",True,0.2601392567157745,0.8517093414153266,12,17,-5,61,112,-51
"[구체적으로, 상기 입광부, 상기 전송부 및 상기 출광부는 일체로 성형된다. ]","Specifically, the light incoming part, the transmission part and the light exiting part are integrally formed.",True,0.3574201166629791,0.7689533516131923,11,16,-5,44,110,-66
"[대표적으로, 상기 출광면의 외면에는 격자형 무늬 또는 스트립형 무늬가 설치된다. ]","Typically, the outer surface of the light exiting face is provided with grid patterns or strip-shaped patterns.",True,0.3881845474243146,0.7567263162919755,11,17,-6,47,111,-64
"[본 발명의 제2 양태는, 회로기판 및 상술한 기술적 해결수단 중 어느 한 항에 따른 차량용 램프 광학 소자를 포함하는 차량용 램프 모듈을 제공하되, 상기 회로기판은 상기 차량용 램프 광학 소자의 입광부 후방에 설치되며, 상기 회로기판에는 상기 입광 구조에 대응되는 하이빔 광원이 설치된다. ]","A second aspect of the present invention provides a vehicle lamp module comprising a circuit board and the vehicle lamp optical element according to any one of the foregoing technical solutions, the circuit board is arranged behind the light incoming part of the vehicle lamp optical element, and high beam light sources corresponding to the light incoming structures are arranged on the circuit board.",True,0.2193854302167892,0.9012549410133864,43,64,-21,164,402,-238
"[바람직하게는, 상기 차량용 램프 광학 소자는 상술한 기술적 해결수단 중 어느 한 항에 따른 상기 렌즈 점등 구조를 포함하는 차량용 램프 광학 소자이고, 상기 회로기판에는 상기 렌즈 점등 구조에 대응되는 렌즈 점등 광원이 설치되며, 상기 하이빔 광원 및 상기 렌즈 점등 광원은 독립적으로 온 또는 오프되도록 제어 가능하다. ]","Preferably, the vehicle lamp optical element is the vehicle lamp optical element including the lens lightening structure in any one of the foregoing technical solutions, the circuit board is provided with a lens lightening light source corresponding to the lens lightening structure, the high beam light sources and the lens lightening light source can be independently controlled to be turned on or off.",True,0.2902126908302307,0.8667289037485588,49,63,-14,182,404,-222
"[보다 바람직하게는, 상기 입광 구조는 복수 개이고, 상기 하이빔 광원은 상기 입광 구조와 일대일로 대응되며, 각각의 상기 하이빔 광원은 독립적으로 온 또는 오프되도록 제어 가능하다. ]","More preferably, multiple light incoming structures are arranged, the high beam light sources are in one-to-one correspondence with the light incoming structures, and each high beam light source can be independently controlled to be turned on or off.",True,0.3273703455924988,0.8122853136261186,26,38,-12,104,250,-146
"[본 발명의 제3 양태는, 상술한 기술적 해결수단 중 어느 한 항에 따른 차량용 램프 모듈을 포함하는 차량용 헤드램프를 제공한다. ]",A third aspect of the present invention provides a vehicle headlamp comprising the vehicle lamp module in any one of the foregoing technical solutions.,True,0.1470395028591156,0.9224622239303756,20,24,-4,74,151,-77
"[본 발명의 제4 양태는, 상술한 기술적 해결수단에 따른 차량용 헤드램프를 포함하는 차량을 제공한다.]",A fourth aspect of the present invention provides a vehicle comprising the vehicle headlamp according to the foregoing technical solution.,True,0.1768646836280822,0.8954204019059971,13,20,-7,57,138,-81
"[본 발명의 상술한 기본 기술적 해결수단을 통해, 본 발명에 따른 차량용 램프 광학 소자는 입광부, 전송부 및 출광부를 일체로 집적하므로 집적화 정도가 높고, 분리된 1차 광학 소자 및 렌즈를 설치할 필요가 없으며 기타 불필요한 지지 장치도 장착할 필요가 없어 조립 관계가 간단할 뿐만 아니라 또한 차량용 램프 광학 소자의 부품 제조 정밀도 및 광학 시스템 정밀도를 향상시키며, 아울러 상기 차량용 램프 광학 소자의 부피는 배광 요구 조건이 충족되면 적응적으로 축소될 수 있어 집적화 연구에 유리하다. ]","Through the basic technical solution of the present invention, the light incoming part, the transmission part and the light exiting part of the vehicle lamp optical element provided by the present invention are integrated, the integration degree is high, a primary optical element and a lens which are separated are not needed to be arranged, other unnecessary supporting devices do not need to be installed, the assembly relation is simple, furthermore, part manufacturing precision and optical system precision of the vehicle lamp optical element are improved, meanwhile, the size of the vehicle lamp optical element can be adaptively reduced when meeting the light distribution requirement condition, and integrated research is facilitated.",True,0.1983733028173446,0.8951389307308418,76,111,-35,282,743,-461
"[본 발명의 바람직한 형태에서, 상기 차량용 램프 광학 소자가 차량용 램프에 응용될 경우, 렌즈 점등 구조는 로우빔 조명 모드에서 출광부의 출광면도 점등되도록 하고, 또한 로우빔 조명 모드에서는 렌즈 점등 광원에서 방출된 광선이 확산되도록 하여 출광면이 점등되는 우수한 시각적 효과를 형성하며, 아울러 출광면의 점등 휘도 및 범위가 차량용 램프의 로우빔 조명에 영향을 미치지 않도록 한다. ]","In a preferred mode of the present invention, when the vehicle lamp optical element is applied to a vehicle lamp, the lens lightening structure enables the light exiting face of the light exiting part to be lightened in a low beam illumination mode, and enables light rays emitted by the lens lightening light source to be diffused in the low beam illumination mode, so that a good visual effect of lightening the light exiting face is achieved, and meanwhile, the lightening brightness and range of the light exiting face do not affect low beam illumination of the vehicle lamp.",True,0.2619258761405945,0.8771465112715515,55,99,-44,219,579,-360
"도 3을 참조하면, 일 실시예에 따른 트레이닝 장치는 정답 레이블을 포함하는 트레이닝 데이터를 수신한다(310). 트레이닝 데이터는 예를 들어, 영상 데이터 및 음성 데이터 중 어느 하나를 포함할 수 있으며, 반드시 이에 한정되지는 않는다.]","The training data may include, but is not limited to, for example, either image data or voice data.",False,0.5962458848953247,0.659665035036928,33,18,15,135,99,36
[트레이닝 장치는 단계(310)에서 수신한 트레이닝 데이터를 인코딩함으로써 트레이닝 데이터에 대응하는 임베딩 벡터를 추출한다(320).],"In operation 320, the training apparatus may extract an embedding vector (a feature vector, for example) corresponding to the training data received in operation 310, by encoding the training data (using an encoder, for example).",True,0.3784233033657074,0.8202544889671891,13,35,-22,76,229,-153
[트레이닝 장치는 인공 신경망의 추론 정보를 생성하는 제1 디코더를 이용하여 단계(320)에서 추출한 임베딩 벡터를 디코딩한다(330). 트레이닝 장치는 제1 디코더를 이용하여 임베딩 벡터를 디코딩함으로써 추론 정보를 생성할 수 있다.,"In operation 330, the training apparatus may decode the embedding vector extracted in operation 320 using a first decoder that generates inference information (a label D1(E(x)), for example) of an ANN.",False,0.5168758034706116,0.7587159493901625,28,31,-3,131,201,-70
트레이닝 장치는 인공 신경망의 추론 정보와 트레이닝 데이터에 포함된 정답 레이블 간의 차이에 기초하여 제1 로스를 계산한다(350).],"In operation 350, the training apparatus may calculate a first loss based on a difference between the inference information of the ANN and the true label included in the training data.",True,0.4857941567897796,0.7309593515766941,17,31,-14,75,184,-109
[트레이닝 장치는 단계(310)에서 수신한 트레이닝 데이터의 복원 정보를 생성하는 제2 디코더를 이용하여 단계(320)에서 추출한 임베딩 벡터를 디코딩한다(340). 트레이닝 장치는 제2 디코더를 이용하여 임베딩 벡터를 디코딩함으로써 트레이닝 데이터의 복원 정보를 생성할 수 있다. ],"In operation 340, the training apparatus may decode the embedding vector extracted in operation 320 using a second decoder that generates reconstruction information (reconstructed training data D2(E(x)), for example) of the training data received in operation 310.",False,0.3655561506748199,0.8390660946903719,33,37,-4,159,264,-105
"[트레이닝 장치는 트레이닝 데이터 내 정답 레이블에 대응하는 제1 부분 영역을 결정하거나, 트레이닝 데이터로 인하여 생성되는 임베딩 벡터에 대응하는 제1 부분 영역을 결정한다(360). 트레이닝 데이터가 영상 데이터인 경우, 제1 부분 영역은 트레이닝 데이터 내에서 복원된 관심 공간 영역을 포함할 수 있다.","In operation 360, the training apparatus may determine a first partial region in the training data corresponding to the true label, or a first partial region corresponding to an embedding vector generated due to the training data (for example, the embedding vector extracted in operation 320).",False,0.4028782546520233,0.8278205960403002,41,46,-5,172,293,-121
"또는, 트레이닝 데이터가 음성 데이터인 경우, 제1 부분 영역은 트레이닝 데이터 내에서 복원된 관심 시간 구간을 포함할 수 있다.]","In another example, when the training data is voice data, the first partial region may include a time interval of interest reconstructed in the training data.",True,0.2740815579891205,0.8552645034669214,19,26,-7,73,158,-85
"[일 실시예에 따르면, 트레이닝 데이터가 영상 데이터인 경우, 트레이닝 장치는 인공 신경망이 픽셀 와이즈 정보 또는 검출 윈도우를 추론하도록, 트레이닝 데이터 내 정답 레이블에 대응하는 부분 영역을 제1 부분 영역으로 결정할 수 있다.","In an example, when the training data is image data, the training apparatus may determine a partial region in the training data corresponding to the true label as the first partial region so that the ANN may infer pixel-wise information or a detection window.",True,0.3245629072189331,0.8481540211692967,33,44,-11,131,259,-128
"또는, 인공 신경망이 클래스를 추론하도록 설계된 경우, 트레이닝 영상에 대응하는 타겟 레이블을 이용하여 트레이닝이 수행될 수 있다.","In another example, when the ANN is designed to infer a class, training may be performed using a target label corresponding to a training image.",True,0.3958824872970581,0.7770006468113551,17,25,-8,73,144,-71
"이 경우, 트레이닝 영상에 대응하는 타겟 영상이 존재하지 않으므로 타겟 영상에 대응하는 픽셀 와이즈 정보를 획득할 수 없다.","In this example, when a target image corresponding to the training image is absent, a typical training apparatus may not obtain pixel-wise information corresponding to such target image.",True,0.3420681059360504,0.8053206254144725,18,28,-10,69,186,-117
"따라서, 트레이닝 장치는 인코더를 통해 추출한 특징의 활성 정보(예를 들어, 임베딩 벡터)를 이용하여 인공 신경망이 관심 영역에 대응하는 클래스를 추론하도록 트레이닝할 수 있다.]","In contrast, the training apparatus of one or more embodiments may perform training so that the ANN may infer a class corresponding to an ROI using activation information (for example, an embedding vector) of a feature extracted using the encoder.",True,0.5190909504890442,0.7467015083409076,23,40,-17,100,247,-147
"[단계(360)에서, 트레이닝 장치는 트레이닝 데이터 내의 제1 부분 영역을 복원할 수 있다.","In operation 360, the training apparatus may reconstruct the first partial region in the training data.",True,0.2313867062330246,0.8749168073088498,12,16,-4,52,103,-51
"트레이닝 장치는 예를 들어, 트레이닝 데이터에서 픽셀 별로 추출된 픽셀 와이즈 정보에 기초하여 특징 벡터를 적응적으로 디코딩함으로써 트레이닝 데이터 내의 제1 부분 영역을 복원할 수 있다.","For example, the training apparatus may reconstruct the first partial region in the training data by adaptively decoding a feature vector based on pixel-wise information extracted for each pixel from the training data.",True,0.2507220506668091,0.8890756654717834,26,33,-7,105,218,-113
"트레이닝 장치가 픽셀 별로 추출된 픽셀 와이즈 정보에 기초하여 트레이닝 데이터 내의 제1 부분 영역을 복원하는 방법은 예를 들어, 아래의 도 4 내지 도 7을 참조할 수 있다.]",Non-limiting examples in which the training apparatus reconstructs the first partial region in the training data based on pixel-wise information extracted for each pixel will be further described below with reference to FIGS. 4 through 7.,True,0.3905835151672363,0.7945027575632421,28,36,-8,99,238,-139
"[트레이닝 장치는 예를 들어, 트레이닝 데이터에서, 검출 윈도우에 의해 검출된 영역에 기초하여 임베딩 벡터를 적응적으로 디코딩함으로써 트레이닝 데이터 내의 제1 부분 영역을 복원할 수 있다.","For example, the training apparatus may reconstruct the first partial region in the training data by adaptively decoding an embedding vector (for example, the embedding vector extracted in operation 320) based on a region detected in the training data by a detection window.",True,0.2601927518844604,0.8909180430274668,25,43,-18,106,274,-168
"트레이닝 장치가 검출 윈도우에 의해 검출된 영역에 기초하여 트레이닝 데이터 내의 제1 부분 영역을 복원하는 방법은 예를 들어, 아래의 도 4 내지 도 7을 참조할 수 있다. ]",Non-limiting examples in which the training apparatus reconstructs the first partial region in the training data based on the region detected by the detection window will be further described below with reference to FIGS. 4 through 7.,True,0.3652464747428894,0.80799944785541,28,37,-9,98,234,-136
[일 실시예에서 픽셀 와이즈 정보나 검출 윈도우 기반 방법 모두 관심 영역을 바로 정의하여 제1 부분 영역을 결정할 수 있다는 점에서 도 4 내지 도 7은 모두 픽셀 와이즈 정보 또는 검출 윈도우 기반 방법에 사용될 수 있다.,"Since an ROI may be directly defined and the first partial region may be determined in both the above pixel-wise information-based method and the above detection window-based method, all examples of FIGS. 4 through 7 may be used in the pixel-wise information-based method or the detection window-based method.",True,0.2664969265460968,0.8506501454619506,38,48,-10,126,309,-183
"다만, 도 4 내지 도 5와 도 6 내지 도 7은 두 디코딩 네트워크들이 적어도 일부의 디코딩 레이어를 공유하는지 여부에 있어서 차이점이 있을 뿐 다른 부분은 동일하게 적용될 수 있다. ]","Although examples of FIGS. 4 and 5 differ from examples of FIGS. 6 and 7 in whether two decoding networks share at least a portion of decoding layers, the other parts may equally be applicable to the examples of FIGS. 4 through 7.",True,0.2091207802295684,0.8591402553052839,31,43,-12,105,230,-125
"[또는 트레이닝 장치는 분류기에 의해, 트레이닝 데이터로부터 분류된 클래스에 대응하는 특징 맵에 기초하여 특징 벡터를 적응적으로 디코딩함으로써 트레이닝 데이터 내의 제1 부분 영역을 복원할 수 있다.",The training apparatus may reconstruct the first partial region in the training data by adaptively decoding a feature vector based on a feature map corresponding to a class classified from the training data by a classifier.,True,0.2706007063388824,0.8731509077396181,26,36,-10,111,223,-112
트레이닝 장치가 트레이닝 데이터로부터 분류된 클래스에 대응하는 특징 맵에 기초하여 트레이닝 데이터 내의 제1 부분 영역을 복원하는 방법은 아래의 도 6 내지 도 9를 참조할 수 있다. ],Non-limiting examples in which the training apparatus reconstructs the first partial region in the training data based on a feature map corresponding to a class classified from the training data will be further described below with reference to FIGS. 6 through 9.,True,0.3228743970394134,0.828096617935613,28,42,-14,104,263,-159
"[트레이닝 장치는 단계(360)에서 결정된 제1 부분 영역에 따른 복원 정보와 트레이닝 데이터 간의 차이에 기초하여 제2 로스를 계산한다(370). 전술한 것과 같이, 제1 부분 영역에 따른 복원 정보는 예를 들어, 인공 신경망이 추론한 픽셀 와이즈 정보 또는 검출 윈도우에 대응한 것일수도 있고, 또는 인공 신경망이 추론한 클래스에 대응한 것일 수도 있다. ]","In operation 370, the training apparatus may calculate a second loss based on a difference between the training data and reconstruction information (for example, the reconstruction information generated in operation 340) based on the first partial region determined in operation 360.",False,0.3933395445346832,0.8209225767339249,51,41,10,202,283,-81
"[트레이닝 장치는 단계(350)에서 계산된 제1 로스 및 단계(370)에서 계산된 제2 로스에 기초하여 인공 신경망을 트레이닝한다(380). 트레이닝 장치는 예를 들어, 제1 로스에 기초하여 제1 디코더와 인코더를 트레이닝하고, 제2 로스에 기초하여 제2 디코더와 인코더를 트레이닝할 수 있다.","In operation 380, the training apparatus may train the ANN based on the first loss calculated in operation 350 and the second loss calculated in operation 370.",False,0.463151216506958,0.7513724761131695,35,27,8,164,159,5
"이로 인하여, 인코더는 제1 부분 영역을 제1 정확도로 복원하고, 트레이닝 데이터 내의 제2 부분 영역을 제2 정확도로 복원 가능한 정보를 내재하는 임베딩 벡터를 생성하도록 트레이닝될 수 있다.","Thus, the encoder may be trained to generate an embedding vector that includes information used to reconstruct the first partial region with a first accuracy and reconstruct a second partial region in the training data with a second accuracy.",True,0.242834597826004,0.8829931853664238,27,39,-12,108,242,-134
"이때, 제1 정확도는 제2 정확도 보다 높은 값을 가질 수 있다.]","In this example, the first accuracy may be greater than the second accuracy.",True,0.2259715795516967,0.8470117716529165,11,13,-2,37,76,-39
"[일 실시예에 따른 트레이닝 방법은 예를 들어, 트레이닝 기반의 검출(Detection), 위치 추정(Localization), 의미론적 분할(Semantic Segmentation) 등을 위한 알고리즘 또는 소프트웨어를 전술한 추론 장치에 탑재 시에, 차후 다양한 환경에서도 범용성이 보장되도록 인공 신경망을 사전 트레이닝시키는 데에 적용될 수 있다.","For example, when software or an algorithm for training-based detection, localization or semantic segmentation is included in the above-described inference apparatus, the training method may be used to train the ANN in advance so that generality may be guaranteed even when implemented in various environments later.",True,0.2923702895641327,0.8395877311586089,38,46,-8,197,316,-119
"또한, 일 실시예에 따른 트레이닝 방법은 온-디바이스(On-Device) 트레이닝 시에 최소한의 디바이스 데이터(Device Data)에 의해서도 과적합(Overfitting) 없이 범용성이 보장되도록 트레이닝을 수행할 수 있다. ]","Also, the training method may be used to perform training so that generality may be guaranteed without overfitting even with a minimum quantity of device data during on-device training.",True,0.227552130818367,0.8638883096507929,23,29,-6,130,185,-55
"[이하, 설명의 편의를 위하여, 트레이닝 데이터가 영상 데이터인 경우를 예로 들어 설명하지만, 반드시 이에 한정되는 것은 아니다. ]","Hereinafter, for convenience of description, an example in which training data is image data will be described, but is not limited thereto.",True,0.2761626243591308,0.8281405737842381,18,22,-4,74,139,-65
"[도 4는 일 실시예에 따른 트레이닝 장치의 구성을 도시한 도면이고, 도 5는 도 4에 도시된 트레이닝 장치의 트레이닝 과정을 나타낸 흐름도이다.","FIG. 4 illustrates an example of a configuration of a training apparatus 400, and FIG. 5 illustrates an example of a training process of a training apparatus (for example, the training apparatus 400 of FIG. 4 ).",True,0.3595331311225891,0.7911008903804467,21,37,-16,81,211,-130
"도 4를 참조하면, 일 실시예에 따른 트레이닝 장치(400)는 인코더(E)(410), 제1 디코더(D, Sub[attributes={}; value=[1]], )(420), 및 제2 디코더(D, Sub[attributes={}; value=[1]], )(430)를 포함할 수 있다.]","Referring to FIG. 4, the training apparatus 400 may include an encoder E 410, a first decoder D1 420, and a second decoder D2 430.",False,0.241021916270256,0.8813487263525469,23,25,-2,158,130,28
"[일 실시예에 따른 트레이닝 장치(400)는 트레이닝 영상(x)에 대해 픽셀-와이즈(Pixel-Wise)로 값을 출력하여 타겟 영상(Target Image)을 생성하는 인코더(E)(410)와 제1 디코더(D, Sub[attributes={}; value=[1]], )(420)로 구성된 네트워크 구조의 인공 신경망에, 제2 디코더(D, Sub[attributes={}; value=[2]], )(430)를 추가하여 범용성을 향상시킬 수 있다.]","The training apparatus 400 may add the second decoder D2 430 to an ANN with a network structure including the encoder E 410 and the first decoder D1 420, to enhance generality.",False,0.605656623840332,0.7066763530691931,36,32,4,248,176,72
"[제1 디코더(D, Sub[attributes={}; value=[1]], )(420)는 인코더에 의해 생성된 임베딩 벡터에 대응하는 특정 정보(예를 들어, 트레이닝 데이터에 대응하는 레이블 등)를 추론할 수 있다.","The first decoder D1 420 may infer predetermined information (for example, a label corresponding to training data) corresponding to an embedding vector generated by the encoder E 410.",False,0.3227826952934265,0.849560633268886,22,28,-6,120,183,-63
"제2 디코더(D, Sub[attributes={}; value=[2]], )(430)는 트레이닝 데이터 중 일부 영역에 대응하는 정보를 복원할 수 있다.]","The second decoder D2 430 may reconstruct information corresponding to a portion of training data (for example, the training image x).",False,0.3972929418087005,0.8086873147113651,15,21,-6,86,134,-48
"[트레이닝 장치(400)는 예를 들어, 트레이닝 영상(x)으로부터 픽셀-와이즈 정보를 추출하거나 또는 픽셀 와이즈 정보를 검출하도록 인공 신경망을 트레이닝할 수 있다.]",The training apparatus 400 may train the ANN to extract pixel-wise information from the training image x or to detect the pixel-wise information.,True,0.4127391874790191,0.7997508622922219,19,23,-4,94,145,-51
"[일반적인 픽셀-와이즈 정보의 추출은 인코더-디코더로 구성된 신경망의 구조를 기본으로 하며, 트레이닝 영상을 인코더에 통과시켜 생성된 특징(feature)을 디코더에 통과시켜 최종적인 결과 영상(Result image)을 생성할 수 있다. ]","Extraction of general pixel-wise information may be based on a structure of a neural network including an encoder and a decoder, and a feature generated by a training image passing through the encoder may pass through the decoder, to generate a final result image.",True,0.3734458982944488,0.7832254759679901,26,44,-18,135,264,-129
"[이하에서는, 예를 들어, 트레이닝 영상을 x, 트레이닝 영상에 대응하는 타겟 영상(또는 정답 영상)을 y, 인코더(Encoder)를 E, 제1 디코더(Decoder)를 D, Sub[attributes={}; value=[1, ]], 제2 인코더를 D, Sub[attributes={}; value=[2 ]], 라고 표시하기로 하자.]","In the following description, a training image may be denoted by x, a target image or a ground truth image corresponding to the training image may be denoted by y, an encoder may be denoted by E, a first decoder may be denoted by D1, and a second encoder may be denoted by D2.",False,0.4543830752372741,0.768501074806974,31,54,-23,187,276,-89
"[트레이닝 장치(400)는 예를 들어, 트레이닝 영상(x)과 트레이닝 영상(x)에 대응하는 타겟 영상(또는 정답 영상)(y)으로 구성된 {Input x, Target y}의 페어를 수신할 수 있다(510). 트레이닝 장치(400)는 트레이닝 영상(x)을 인코더(E)(410)에 인가함으로써 트레이닝 영상(x)에 대응하는 임베딩 벡터 E(x)을 추출할 수 있다(520). ]","In operation 520, the training apparatus 400 may extract an embedding vector E(x) corresponding to the training image x by applying the training image x to the encoder E 410.",False,0.3919428288936615,0.822899272894559,38,30,8,208,174,34
"[트레이닝 장치(400)는 임베딩 벡터 E(x)을 제1 디코더(D, Sub[attributes={}; value=[1]], )(420)에 인가(530)함으로써 결과 영상(Result image) D, Sub[attributes={}; value=[1]], (E(x))을 생성할 수 있다(540). 실시예에 따라서, 제1 디코더(D, Sub[attributes={}; value=[1]], )(420)는 검출기(Detector)로 대체될 수도 있다.]","The training apparatus 400 may apply the embedding vector E(x) to the first decoder D1 420 in operation 530, and may thereby generate a result image D1(E(x)) in operation 540.",False,0.3944770693778991,0.8205893983154896,32,30,2,251,175,76
"[트레이닝 장치(400)는 제1 디코더(420)를 통과한 결과 영상 D, Sub[attributes={}; value=[1]], (E(x))과 타겟 영상(y)(560) 간의 차이(예를 들어, Diff(D, Sub[attributes={}; value=[1]], (E(x)), y))에 해당하는 타겟 손실(Target Loss)을 산출할 수 있다(550).]","In operation 550, the training apparatus 400 may calculate a target loss corresponding to a difference (for example, Diff(D1(E(x)), y)) between the result image D1(E(x)) passing through the first decoder D1 420 and the target image y 560.",False,0.3041010499000549,0.8579115401406787,28,38,-10,199,238,-39
"[일 실시예에서는 타겟 손실에 더하여, 적응적 복원 디코더(Adaptive Reconstruction Decoder)인 제2 디코더(D, Sub[attributes={}; value=[2]], )(430)를 추가적으로 포함할 수 있다.","In addition to the target loss, the second decoder D2 430 that is an adaptive reconstruction decoder may be further included.",False,0.3049653470516205,0.825037172994994,19,21,-2,131,125,6
"트레이닝 장치(400)는 인코더(E)(410)에 의해 생성된 임베딩 벡터 E(x)을 제2 디코더(D, Sub[attributes={}; value=[2]], )(430)에 통과(535)시켜 복원 영상(Reconstruction Image) D, Sub[attributes={}; value=[2]], (E(x))을 생성할 수 있다(545). 이 때, 복원 영상 D, Sub[attributes={}; value=[2]], (E(x))에 타겟 영상(y)로부터 정의된 각 픽셀(Pixel)의 적응적 가중치(Adaptive Weight) r(y)를 곱하면, 타겟 영상(y)에서 활성화되는 중요한 정보에 대응하는 가중치를 복원 영상 D, Sub[attributes={}; value=[2]], (E(x))에 부여하는 것과 같은 효과를 가질 수 있다.","The training apparatus 400 may pass the embedding vector E(x) generated by the encoder E 410 through the second decoder D2 430 in operation 535, and may thereby generate a reconstruction image D2(E(x)) in operation 545.",False,0.3921926617622375,0.8200420901315537,62,36,26,415,219,196
"여기서, r(y)는 예를 들어, 트레이닝 영상 중 관심 영역(Region of Interest; ROI)을 반영한 픽셀 와이즈 맵(Pixel-Wise Map)에 해당할 수 있다.","In this example, the adaptive weight r(y) may correspond to, for example, a pixel-wise map reflecting an ROI in the training image.",True,0.4184116721153259,0.7765921957779182,20,22,-2,99,131,-32
"r(y)는 예를 들어, 0 또는 1의 값을 갖는 이진 마스크 일 수도 있고, 또는 관심 영역의 경계 부분에서는 점진적으로 변화되는 실수 값을 갖는 가중치(또는 중요도) 일 수도 있다.]","For example, the adaptive weight r(y) may be a binary mask with a value of ""0"" or ""1"", or a weight or importance with a real number value that gradually changes in a boundary portion of an ROI.",True,0.3014300763607025,0.8238859191880125,28,38,-10,103,193,-90
"[트레이닝 장치(400)는 가중치 r(y)에 의해 적응적으로 복원된 영상 D, Sub[attributes={}; value=[2]], (E(x))·r(y)과 트레이닝 영상(x) 간의 차이(예를 들어, Diff(D, Sub[attributes={}; value=[2]], (E(x))·r(y), x))로 정의된 복원 손실(Reconstruction Loss)을 산출할 수 있다(570). 여기서, 복원 영상 D, Sub[attributes={}; value=[2]], (E(x))·r(y)은 트레이닝 영상(x)의 관심(ROI) 영역과 같이 트레이닝 영상(x)의 부분 영역('제1 부분 영역)에 해당할 수 있다.]","In operation 570, the training apparatus 400 may calculate a reconstruction loss defined as a difference (for example, Diff(D2(E(x))·r(y), x)) between the training image x and an image D2(E(x))·r(y) adaptively reconstructed by the adaptive weight r(y).",False,0.3398550450801849,0.8455886897266737,50,36,14,341,252,89
"[트레이닝 장치(400)는 전술한 타겟 손실과 함께 복원 손실이 최소화되도록 인공 신경망을 트레이닝할 수 있다(580). 트레이닝 장치(400)는 예를 들어, 트레이닝 데이터의 전체 집합에 대한 타겟 손실과 복원 손실의 합(예를 들어, 가중합(Weighted Sum))이 최소화되도록 인공 신경망을 트레이닝할 수 있다. ]","For example, the training apparatus 400 may train the ANN to minimize a sum (for example, a weighted sum) of a reconstruction loss and a target loss for a full set of training data.",False,0.3407108187675476,0.8348013300330086,38,34,4,180,181,-1
"[도 6은 다른 실시예에 따른 트레이닝 장치의 구성을 도시한 도면이고, 도 7은 도 6에 도시된 트레이닝 장치의 트레이닝 과정을 나타내 흐름도이다.","FIG. 6 illustrates an example of a configuration of a training apparatus 600, and FIG. 7 illustrates an example of a training process of a training apparatus (for example, the training apparatus 600 of FIG. 6 ).",True,0.4262423515319824,0.7475705574672207,21,37,-16,82,211,-129
"도 6을 참조하면, 일 실시예에 따른 트레이닝 장치(600)는 인코더(E)(610), 및 디코더(D, Sub[attributes={}; value=[1]], )(630)를 포함할 수 있다.]","Referring to FIG. 6, the training apparatus 600 may include an encoder E 610, and a decoder D1 630.",False,0.2704536318778991,0.8578806696371614,17,19,-2,106,99,7
[도 6의 실시예에 따른 디코더(630)는 도 4에서 전술한 두 개의 분리된 디코더들(제1 디코더(420) 및 제2 디코더(430)) 간에 서로 공유되는 적어도 일부 레이어일 수 있다.,"The decoder D1 630 may be at least a portion of layers shared between two separated decoders, that is, the first decoder D1 420 and the second decoder D2 430 of FIG. 4.",True,0.3141790628433227,0.8192711130012861,24,33,-9,103,168,-65
"트레이닝 장치(600)는 디코더(630)에 연결되는, 분류기(Classifier)(C)(633) 및 적응적 복원 디코더(Adaptive Reconstruction Decoder)(R)(636)를 더 포함할 수 있다.","The training apparatus 600 may further include a classifier C 633 connected to the decoder D1 630, and an adaptive reconstruction decoder R 636.",True,0.1616536825895309,0.9100859137374104,15,24,-9,120,144,-24
"예를 들어, 디코더(630)는 분류기(Classifier)(C)(633)와 연동하면서, 동시에 적응적 복원 디코더(Adaptive Reconstruction Decoder)(R)(636)와 연동할 수 있다.","For example, the decoder D1 630 may simultaneously operate in conjunction with the classifier C 633 and the adaptive reconstruction decoder R 636.",True,0.1754035055637359,0.9001881986379661,14,23,-9,115,146,-31
"실시예에 따라, 분류기(C)(633)는 도 4의 검출기로 동작할 수도 있다.","Depending on examples, the classifier C 633 may also operate as a detector.",True,0.2083711177110672,0.868872647255225,9,13,-4,42,75,-33
"이하 설명의 편의를 위하여 분류 동작을 예를 들어 설명하나, 실시예들은 분류기(C)(633)가 검출기로 동작하는 경우에도 적용될 수 있다.]","Hereinafter, for convenience of description, a classification operation will be described, and may also be applied to an example when the classifier C 633 operates as a detector.",True,0.170840784907341,0.8919562329843362,17,28,-11,78,178,-100
"[트레이닝 장치(600)는 예를 들어, 트레이닝 영상(x)과 트레이닝 영상(x)에 대응하는 타겟 레이블(또는 정답 레이블)(y)으로 구성된 {Input x, Target y}의 페어를 수신할 수 있다(710). 트레이닝 장치(600)는 트레이닝 영상(x)을 인코더(E)(610)에 인가함으로써 트레이닝 영상(x)에 대응하는 임베딩 벡터 E(x)을 추출할 수 있다(720). ]","In operation 710, the training apparatus 600 may receive a pair {Input x, Target y} of a training image x and a target label or a true label y corresponding to the training image x.",False,0.4013786017894745,0.8071724716684754,38,35,3,210,181,29
"[트레이닝 장치(600)는 디코더(630)를 통해 임베딩 벡터 E(x)을 디코딩 (730)함으로써 결과 영상(Result image) D, Sub[attributes={}; value=[1]], (E(x))을 생성할 수 있다(740). 이때, 트레이닝 장치(600)는 디코더(630)를 통과한 결과 영상 D, Sub[attributes={}; value=[1]], (E(x))을 분류기(C)(633)에 통과시켜 분류된 클래스 C(D, Sub[attributes={}; value=[1]], (E(x))를 획득할 수 있다.","The training apparatus 600 may decode the embedding vector E(x) using the decoder D1 630 in operation 730, and may thereby generate a result image D1(E(x)) in operation 740.",False,0.2974336743354797,0.8577854507925717,41,29,12,291,173,118
"트레이닝 장치(600)는 클래스 C(D, Sub[attributes={}; value=[1]], (E(x)))와 타겟 레이블(y)(760) 간의 차이(예를 들어, Diff(C(D, Sub[attributes={}; value=[1]], (E(x))), y)에 해당하는 타겟 손실을 산출할 수 있다(750).]","In operation 750, the training apparatus 600 may calculate a target loss corresponding to a difference (for example, Diff(C(D1(E(x))), y)) between the class C(D1(E(x))) and a target label y 760.",False,0.259480744600296,0.8690350046515269,23,30,-7,172,194,-22
"정보 관리 방법, 세컨더리 노드 변경 방법, 노드 및 저장 매체",CROSS-REFERENCE TO RELATED APPLICATION,False,1.2654064893722534,-0.0113759446344998,11,4,7,35,38,-3
"[본 출원은 2019년 6월 24일자로 중국에 출원한 특허 출원번호 제201910550193.0호에 대한 우선권을 주장하고, 그 모든 내용은 참조로 본 출원에 포함된다.]","The present application claims the benefit of priority to Chinese Patent Application No. 201910550193.0 filed to China Patent Office on June 24, 2019, the disclosure of which is incorporated herein by reference in its entirety.",True,0.181534007191658,0.8604227991854538,20,35,-15,95,227,-132
"[본 출원은 정보 관리 방법, 세컨더리 노드 변경 방법， 노드 및 저장 매체에 관한 것이다.]","The present disclosure relates to an information management method, a secondary node changing method, a node, and a storage medium.",True,0.2756807506084442,0.8200258004754366,15,20,-5,52,131,-79
"[5세대 이동통신 기술(5th Generation; 5G)에서 네트워크를 구축하는 초기에, 롱 텀 에볼루션(Long Term Evolution; LTE) 네트워크 기초 상에 5G Hotspot를 배치하여 5G 기지국만 구축하여 5G 무선 시스템을 관련 기술인 LTE 네트워크에 연결함으로써 5G 시스템을 신속하게 배치할 수 있다.","At the early stage of network construction of the 5th Generation (5G) mobile communication technology, when deploying 5G hotspots on the basis of Long Term Evolution (LTE) networks, it is possible to build only 5G base stations and then connect 5G radio systems to LTE networks in the existing technology, which enables rapid deployment of 5G systems.",True,0.1530653834342956,0.9009490397154328,37,57,-20,184,351,-167
이중 연결 기술(Dual Connectivity technology)을 통해 LTE와 5G 시스템 사이의 협업 서비스를 구현하므로 사용자 속도를 향상하는데 유리하다.,"The dual connectivity technology enables collaboration between LTE and 5G systems, which is helpful to improve the user speed.",True,0.1299412846565246,0.9084814435107358,17,19,-2,92,126,-34
"표준 프로토콜은 LTE 시스템 내의 이중 연결(Dual Connectivity; DC)을 구별하기 위하여, 4세대 이동 통신 기술(4th Generation; 4G) 및 5G의 이중 연결 기술을 멀티 무선 이중 연결(Multi-Radio Dual Connectivity; MR-DC)이라고 하고, 뉴 무선(New Radio; NR) 내의 이중 연결도 포함한다.","In order to distinguish dual connectivity (DC) in LTE systems, in standard protocols, dual connectivity technologies of the 4th Generation (4G) and 5G mobile communication technology are called Multi-Radio Dual Connectivity (MR-DC), which also includes dual connectivity in New Radio (NR).",True,0.1691793501377105,0.8942632775583557,38,41,-3,201,289,-88
"본 발명에서 MR-DC, 즉 멀티 무선 이중 연결은 특히 4G 및 5G 이중 연결 기술을 의미한다.","Herein, MR-DC, that is, Multi-Radio Dual Connectivity, refers to 4G and 5G dual connectivity technology.",True,0.1460722833871841,0.906408402073119,16,15,1,55,104,-49
MR-DC 프로토콜은 2 종류의 아키텍처를 정의하고 있다.],The MR-DC protocol defines two architectures.,True,0.1720736920833587,0.8800405852179352,7,6,1,33,45,-12
"[MR-DC with EPC, 즉 진화형 UMTS 지상 RAN 및 뉴 무선 이중 연결(E-UTRA-NR Dual Connectivity; EN-DC)은, eNB를 마스터 노드로 하고 gNB를 세컨더리 노드로 하는 방식으로서, NSA(Non-Standalone) 단말기에게 서비스를 제공한다.]","MR-DC with EPC, that is, E-UTRA-NR Dual Connectivity (EN-DC), provides services for Non-Standalone (NSA) terminals with an eNB as a master node and a gNB as a secondary node.",True,0.2103844732046127,0.8690745587177492,29,29,0,163,174,-11
"[MR-DC with 5GC는 차세대 무선 액세스와 E-UTRA-NR 이중 연결(NG-RAN E-UTRA-NR Dual Connectivity, NGEN-DC) 및 NR-E-UTRA 이중 연결(NR-E-UTRA Dual Connectivity, NE-DC)을 포함하며, 5세대 코어 망(5G Core,5GC)에 연결할 때, 주로 어느 네트워크 요소가 마스터 노드의 역할을 하는지, 어느 네트워크 요소가 세컨더리 노드의 역할을 하는지에 따라 구별된다.]","MR-DC with 5GC includes NG-RAN E-UTRA-NR Dual Connectivity (NGEN-DC) and NR-E-UTRA Dual Connectivity (NE-DC), and the main differences are as follows: being connected to the 5G Core (5GC), which network element is the master node and which network element is the secondary node.",True,0.1606209427118301,0.9007730512439248,44,43,1,252,278,-26
"[관련된 기술에서, 이중 연결 시나리오에서 세컨더리 노드(Secondary Node; SN)에 의해 개시하는 SN 변경(SN Change)은, 마스터 노드(Master Node; MN)가 목표 SN로의 SN 추가(SN Add) 동작을 수행할 것을 통지한다.","In the existing technology, an SN Change initiated by a secondary node (SN) in a dual connectivity scenario notifies a master node (MN) to perform an SN Add operation to a target SN.",True,0.2468060404062271,0.863429576460248,27,33,-6,143,182,-39
SN가 SN Change를 개시하는 의사결정은 신호 품질 등 관련 요소들만을 참조하므로 개선할 필요가 있다.],"When the SN decides to initiate the SN Change, reference is made only to the relevant factors such as signal quality, which necessitates improvement.",True,0.1950014382600784,0.8551327247860726,14,24,-10,61,149,-88
"[본 출원의 적어도 일 실시예는 정보 관리 방법, 세컨더리 노드 변경 방법, 노드 및 저장 매체를 제공한다.]","At least one of the embodiments of the present disclosure provides an information management method, a secondary node changing method, a node, and a storage medium.",True,0.2530555427074432,0.8479859659013882,17,26,-9,61,164,-103
"[본 출원의 적어도 일 실시예는, 사용자 장치에서 세컨더리 노드를 추가한 이후, 상기 세컨더리 노드가 상기 사용자 장치의 히스토리 정보를 기록하는 단계를 포함하는 정보 관리 방법을 제공한다.]","At least one of the embodiments of the present disclosure provides an information management method, including: recording, after a secondary node is added to user equipment, history information for the user equipment by the secondary node.",True,0.265578031539917,0.8587193875305579,26,36,-10,107,239,-132
"[본 출원의 적어도 일 실시예는, 마스터 노드가 세컨더리 노드 변경 또는 수정 과정에 사용자 장치의 히스토리 정보를 세컨더리 노드로 발송하는 단계를 포함하는 정보 관리 방법을 제공한다.]","At least one of the embodiments of the present disclosure provides an information management method, including: sending, by a master node, history information for user equipment to a secondary node, in a secondary node change or modify process.",True,0.2723738849163055,0.8541977491102504,26,38,-12,104,244,-140
"[본 출원의 적어도 일 실시예는, 세컨더리 노드가 세컨더리 노드 변경을 개시할 때, 사용자 장치의 히스토리 정보에 의해 목표 세컨더리 노드를 선택하는 단계를 포함하는 세컨더리 노드 변경 방법을 제공한다.]","At least one of the embodiments of the present disclosure provides a secondary node changing method, including: selecting, in response to a secondary node initiating secondary node change, a target secondary node according to history information for user equipment.",True,0.3241139650344848,0.8207870474560832,28,39,-11,114,265,-151
"[본 출원의 적어도 일 실시예는, 메모리 및 프로세서를 포함하고, 상기 메모리에는 상기 프로세서에 의해 판독되어 실행될 때, 임의의 일 실시예에 따른 정보 관리 방법을 구현하는 프로그램이 저장되는 노드를 제공한다.]","At least one of the embodiments of the present disclosure provides a node including a memory and a processor, where the memory stores a program which, when read and executed by the processor, causes the processor to perform an information management method according to any of the embodiments.",True,0.2095818519592285,0.8805772244337646,29,48,-19,120,293,-173
"[본 출원의 적어도 일 실시예는, 임의의 일 실시예에 따른 정보 관리 방법을 구현하도록 하나 또는 복수의 프로세서에 의해 실행 가능한 하나 또는 복수의 프로그램이 저장되는 컴퓨터 판독 가능한 저장 매체를 제공한다.]","At least one of the embodiments of the present disclosure provides a computer-readable storage medium, where the computer-readable storage medium stores one or more programs which are executable by one or more processors to implement an information management method according to any of the embodiments.",True,0.2086523324251175,0.8787390781645761,31,45,-14,120,303,-183
"[본 출원의 적어도 일 실시예는, 메모리 및 프로세서를 포함하고, 상기 메모리에는 상기 프로세서에 의해 판독되어 실행될 때, 임의의 일 실시예에 따른 세컨더리 노드 변경 방법을 구현하는 프로그램이 저장되는 노드를 제공한다.]","At least one of the embodiments of the present disclosure provides a node including a memory and a processor, where the memory stores a program which, when read and executed by the processor, causes the processor to perform a secondary node changing method according to any of the embodiments.",True,0.2421307265758514,0.8625658510409729,30,49,-19,125,293,-168
"[본 출원의 적어도 일 실시예는, 임의의 일 실시예에 따른 세컨더리 노드 변경 방법을 구현하도록 하나 또는 복수의 프로세서에 의해 실행 가능한 하나 또는 복수의 프로그램이 저장되는 컴퓨터 판독 가능한 저장 매체를 제공한다.]","At least one of the embodiments of the present disclosure provides a computer-readable storage medium, where the computer-readable storage medium stores one or more programs which are executable by one or more processors to implement a secondary node changing method according to any of the embodiments.",True,0.2273097336292266,0.8687613415465812,32,46,-14,125,303,-178
도 5a는 본 출원의 일 실시예에 제공된 EN-DC 시나리오에서의 제어면 아키텍처의 개략도이다.,BRIEF DESCRIPTION OF DRAWINGS,False,0.9964878559112548,0.2237854070372154,12,4,8,53,29,24
"도 8은 본 출원의 일 실시예에 제공된 EN-DC 시나리오에서 MN가 SN를 포함하여 핸드오버하되, SN가 변하는 플로우 차트이다.",Fig. 1 is a flowchart (SN side) of an information management method provided by an embodiment of the present disclosure; Fig. 2 is a flowchart (MN side) of an information management method provided by an embodiment of the present disclosure; Fig. 3 is a flowchart of a secondary node changing method provided by an embodiment of the present disclosure; Fig. 4 is a block diagram of a node provided by an embodiment of the present disclosure; Fig. 5a is a schematic diagram of a control plane architecture in an EN-DC scenario provided by an embodiment of the present disclosure; Fig. 5b is a flowchart of the triggering of SN Change by an SN in an EN-DC scenario provided by an embodiment of the present disclosure; Fig. 6 is a flowchart of the triggering of SN Change by an SN in an MR-DC scenario connected with 5GC provided by an embodiment of the present disclosure; Fig. 7 is a flowchart of an MN handover with SN (SN unchanged) in an EN-DC scenario provided by an embodiment of the present disclosure; Fig. 8 is a flowchart of an MN handover with SN (SN changed) in an EN-DC scenario provided by an embodiment of the present disclosure; Fig. 9 is a block diagram of a node provided by an embodiment of the present disclosure; Fig. 10 is a block diagram of a computer-readable storage medium provided by an embodiment of the present disclosure; Fig. 11 is a block diagram of a node provided by another embodiment of the present disclosure; and Fig. 12 is a block diagram of a computer-readable storage medium provided by another embodiment of the present disclosure.,False,0.6717918515205383,0.6142467409224386,17,277,-260,73,1571,-1498
도 11은 본 출원의 다른 실시예에 제공된 노드의 블록도이다.,DETAILED DESCRIPTION,False,1.0382468700408936,0.1821595714801817,9,2,7,34,20,14
[이하 첨부된 도면을 결합하여 본 출원의 실시예를 설명한다.,The embodiments of the present disclosure will be described below in combination with the accompanying drawings.,True,0.2708784937858581,0.7985643481524635,8,16,-8,33,112,-79
"충돌하지 않은 한, 본 출원의 실시예 및 실시예의 특징은 임의로 조합 가능하다.]",Any combinations of embodiments and features of the embodiments of the present disclosure without conflict are possible.,True,0.3105076849460602,0.750526974802514,12,17,-5,45,120,-75
"[첨부된 도면의 플로우 차트에 예시된 단계들은 예를 들어, 컴퓨터 시스템에서 컴퓨터-실행가능 명령어들의 세트에 의해 실행될 수 있다.","The steps shown in the flowcharts of the drawings may be performed in a computer system, such as with a set of computer-executable instructions.",True,0.376404345035553,0.7203861203968647,17,24,-7,74,144,-70
"비록 플로우 차트에 논리적 순서를 도시하였으나, 일부 경우에 본원에서 예시되거나 설명된 것과는 상이한 단계로 실행될 수 있다.]","Moreover, although a logical order is shown in the flowcharts, the steps shown or described may be performed, in some cases, in a different order from that shown or described herein.",True,0.2513420283794403,0.8152474533490079,17,31,-14,71,182,-111
"[본 출원의 일 실시예는 이중 연결 시스템에 사용 가능한 정보 관리 방법을 제공하며, 사용자 장치가 SN측 마스터 및 세컨더리 셀(cell)(SpCell of a secondary cell group; PScell)에서의 히스토리 정보를 기록 및 전달하여, SN Change의 의사결정을 보조적으로 도와줌으로써 더욱 최적화된 목표 SN를 선택하여 시스템의 강건성을 증가시킨다.]","In an embodiment of the present disclosure, there is provided an information management method applicable to dual connectivity systems, where the method is used to record and transmit history information for user equipment in an SpCell of a secondary cell group (PScell) on the SN side to assist in SN Change decision-making, so as to select a better target SN and enhance the robustness of the system.",True,0.2045640647411346,0.88814703242144,44,67,-23,211,402,-191
"이는 SN에서 MN로부터 전송된 히스토리 정보를 저장하는 것과, 현재 SN에서의 히스토리 정보를 기록하는 것과, SN의 히스토리 정보를 MN로 전달하는 것과, SN가 히스토리 정보를 참조하여 목표 SN를 선택하고 SN Change 과정을 트리거하는 단계를 포함한다.]","An embodiment of the present disclosure provides a managing method for history information for user equipment in a dual connectivity system, including the following steps: storing, by an SN, history information carried from an MN; recording history information in the current SN; bringing the history information in the SN to the MN; and selecting, by the SN, a target SN with reference to the history information to trigger an SN Change process.",False,0.3984093368053436,0.7927318719226086,33,72,-39,149,446,-297
"[도 1에 도시된 바와 같이, 본 출원의 일 실시예는, 다음 단계를 포함하는 정보 관리 방법을 제공한다.]","As shown in Fig. 1, an embodiment of the present disclosure provides an information management method, including the following step.",True,0.1948787122964859,0.8819001155539481,16,20,-4,59,132,-73
[단계101: 사용자 장치(User Equipment; UE)에 SN를 추가한 후 상기 SN가 상기 사용자 장치의 히스토리 정보를 기록한다.],"At step 101, after an SN is added to user equipment (UE), the SN records history information for the user equipment.",True,0.1732763200998306,0.8954148295620707,16,21,-5,79,116,-37
"[본 출원의 적어도 일 실시예는 사용자 장치가 세컨더리 노드를 추가한 후, 상기 세컨더리 노드가 상기 사용자 장치 현재의 히스토리 정보를 기록하는 단계를 포함하는 정보 관리 방법을 제공한다.","At least one of the embodiments of the present disclosure provides an information management method, including the following step: after a secondary node is added to user equipment, the secondary node records the current history information for the user equipment.",True,0.2218609303236007,0.8831707238767962,27,40,-13,106,264,-158
본 실시예에 제공된 솔루션은 사용자 장치의 히스토리 정보를 기록하므로 추후 상기 히스토리 정보를 사용하기 편리하다.],"According to the scheme provided in this embodiment, the history information for the user equipment is recorded so as to facilitate subsequent use of the history information.",True,0.2742834985256195,0.8302903793040144,15,27,-12,65,174,-109
"[UE가 SN을 성공적으로 추가한 후, SN가 PScell에서의 히스토리 정보를 기록하는데, 상기 정보는 이러한 과정에서 PScell 변경에 따른 PScell 변경 후의 히스토리 정보를 포함하며 SN가 변경되거나 삭제되기 전의 정보를 포함한다.]","Upon successful addition of the SN to the UE, the history information in a PScell is recorded by the SN, including history information after a PScell change due to PScellChange in this process, until the SN is changed or deleted.",True,0.1823654472827911,0.8941257602265882,29,40,-11,137,229,-92
"[일 실시예에서, 상기 SN는 Secondary gNodeB(SgNB) 및 Secondary eNodeB(SeNB)를 포함하나 이에 한정되지 않는다.]","In an embodiment, the SN includes, but is not limited to, a Secondary gNodeB (SgNB) and a Secondary eNodeB (SeNB).",True,0.0949799492955207,0.9431192382995583,13,20,-7,84,114,-30
"[일 실시예에서, 상기 히스토리 정보에 포함된 내용은 현재 프로토콜의 정의와 일치하고 히스토리 방문 셀(visit cell) 정보를 포함하며, 상기 히스토리 방문 셀(visit cell) 정보는 셀(cell) 시스템, 셀(cell) 식별자, 셀(cell) 유형 및 현재 셀(cell)의 캠핑 시간 등 정보를 포함한다.","In an embodiment, the content contained in the history information is consistent with that defined in the current protocol, including historical access cell information, which includes information such as cell system, cell identification, cell type, and residence time in the current cell.",True,0.2102750986814499,0.8799041920505907,37,42,-5,177,289,-112
상기 사용자 장치의 현재 히스토리 정보는 사용자 장치가 현재 SN에서의 캠핑 셀(cell)의 정보를 의미한다.],The current history information for the user equipment refers to the information for the user equipment in a residence cell under the current SN.,True,0.2181919664144516,0.8700315824241972,14,24,-10,62,145,-83
"[일 실시예에서, 상기 방법은 상기 SN에서 MN으로부터 발송된 기타 SN에서의 상기 사용자 장치의 히스토리 정보를 수신할 경우, 기타 SN에서의 상기 사용자 장치의 히스토리 정보를 저장하는 단계를 더 포함한다.","In an embodiment, the method further includes the following step: in response to the SN receiving history information for the user equipment under other SNs sent by an MN, the history information for the user equipment under the other SNs is stored.",True,0.2211827784776687,0.8845504362863409,28,42,-14,118,249,-131
"일 실시예에서, 상기 SN는 목표 SN이고, 상기 MN에서 SN 추가(Add) 프로세스를 개시하는데, 이때 MN는 SN 추가 요청(SN Addition Request) 메시지를 통해 히스토리 정보를 목표 SN에 전송한다.]","In an embodiment, the SN is a target SN, and the MN initiates an SN Add process, at which time the MN carries the history information to the target SN through an SN Addition Request message.",True,0.0993591323494911,0.9476620033711146,26,36,-10,124,190,-66
"[일 실시예에서, 상기 방법은 SN의 변경 또는 수정 과정에 상기 SN가 상기 사용자 장치의 히스토리 정보를 MN로 발송하는 단계를 더 포함한다.","In an embodiment, the method further includes the following step: the SN sends the history information for the user equipment to the MN in an SN change or modify process.",True,0.1611351519823074,0.9172868010168506,21,30,-9,81,170,-89
"일 실시예에서, SN 변경(SN Change) 또는 SN 수정(SN Modify)과정에 소스 SN가 히스토리 정보를 MN로 전송한다.","In an embodiment, the source SN carries the history information to the MN in an SN Change or SN Modify process, where in the SN Change process, the history information may be carried by an SN Change Required message; and in the SN Modify process, the history information may be carried by an SN Modification Request Acknowledge message.",True,0.2729656994342804,0.8560565426224969,15,58,-43,74,336,-262
"또한, 제어부(12000)는 에어로졸 생성 장치(10000)의 구성들 각각의 상태를 확인하여, 에어로졸 생성 장치(10000)가 동작 가능한 상태인지 여부를 판단할 수도 있다.]","Also, the controller 12000 may check a state of each of the components of the aerosol generating device 10000 to determine whether or not the aerosol generating device 10000 is able to operate.",True,0.1151700094342231,0.9397085425688548,19,33,-14,99,193,-94
[제어부(12000)는 적어도 하나의 프로세서를 포함한다.,The controller 12000 may include at least one processor.,True,0.2313362061977386,0.8660619339817366,5,9,-4,32,56,-24
"프로세서는 다수의 논리 게이트들의 어레이로 구현될 수도 있고, 범용적인 마이크로 프로세서와 이 마이크로 프로세서에서 실행될 수 있는 프로그램이 저장된 메모리의 조합으로 구현될 수도 있다.",A processor can be implemented as an array of a plurality of logic gates or can be implemented as a combination of a microprocessor and a memory in which a program executable in the microprocessor is stored.,True,0.2385670691728592,0.8415456460433653,24,37,-13,104,207,-103
"또한, 제어부(12000)가 다른 형태의 하드웨어로 구현될 수도 있음을 본 실시예가 속하는 기술분야에서 통상의 지식을 가진 자라면 이해할 수 있다.]",It will be understood by one of ordinary skill in the art that the controller 12000 can be implemented in other forms of hardware.,True,0.2991000115871429,0.818284496106939,19,24,-5,83,130,-47
[히터(13000)는 배터리(11000)로부터 공급된 전력에 의하여 가열될 수 있다.,The heater 13000 may be heated by the power supplied from the battery 11000.,True,0.184608057141304,0.910136163611348,8,14,-6,47,76,-29
"다만, 이에 반드시 제한되는 것은 아니다.",The heater 13000 is not limited thereto.,True,0.7653714418411255,0.4820395264447179,6,7,-1,23,40,-17
히터(13000)는 유도 코일(13500)로부터 생성된 가변 자기장에 의해 가열될 수도 있다.,The heater 13000 may be heated by a variable magnetic field generated from the induction coil 13500.,True,0.2153139859437924,0.8927540016630382,10,17,-7,52,100,-48
이 경우 유도 코일(13500)이 배터리(11000)로부터 공급된 전력에 의하여 가변 자기장을 발생시킬 수 있다.],"In this case, the induction coil 13500 may generate the variable magnetic field with the power supplied from the battery 11000.",True,0.1593881547451019,0.9147770647666128,13,21,-8,64,127,-63
"[일 예에서, 도 1에 도시된 바와 같이, 에어로졸 생성 물품(20000)이 에어로졸 생성 장치(10000)에 삽입되면, 히터(13000)는 에어로졸 생성 물품(20000)의 내부에 위치할 수 있다.","In one example, as shown in FIG. 1, when the aerosol-generating article 20000 is inserted into the aerosol generating device 10000, the heater 13000 may be located inside the aerosol-generating article 20000.",True,0.1303711533546447,0.9481722001370296,22,32,-10,111,208,-97
"따라서, 가열된 히터(13000)는 에어로졸 생성 물품(20000) 내의 에어로졸 생성 물질과 직접 접촉할 수 있고, 에어로졸 생성 물질의 온도를 상승시킬 수 있다.]","Thus, the heated heater 13000 may be in direct contact with an aerosol generating material in the aerosol-generating article 20000 and increase a temperature of the aerosol generating material.",True,0.1946469694375991,0.9114211015446448,21,29,-8,93,193,-100
"[다른 예에서, 도 2 내지 도 4에 도시된 바와 같이, 에어로졸 생성 물품(20000)이 에어로졸 생성 장치(10000)에 삽입되면, 히터(13000)는 에어로졸 생성 물품(20000)의 외부에 위치할 수 있다.","In another example, as shown in FIGS. 2 to 4, when the aerosol-generating article 20000 is inserted into the aerosol generating device 10000, the heater 13000 may be located outside the aerosol-generating article 20000.",True,0.1539950966835022,0.9376906138144814,25,34,-9,119,219,-100
"따라서, 히터(13000)로부터 발생된 열이 에어로졸 생성 물품(20000)의 외부로부터 내부의 에어로졸 생성 물질로 전달될 수 있다.]","Thus, heat generated from the heater 13000 may be transferred from the outside of the aerosol-generating article 20000 to the aerosol generating material therein",True,0.2573103606700897,0.8844222985468833,15,24,-9,76,161,-85
"[일 예에서, 도 1 내지 도 3에 도시된 바와 같이, 히터(13000)는 전기 저항성 히터일 수 있다.","In one example, as shown in FIGS. 1 to 3, the heater 13000 may include an electro-resistive heater.",True,0.1968541592359542,0.9070856418289096,16,18,-2,58,99,-41
"예를 들어, 히터(13000)는 전기 전도성 트랙(track)을 포함하고, 전기 전도성 트랙에 전류가 흐름에 따라 히터(13000)가 가열될 수 있다.","For example, the heater 13000 may include an electrically conductive track, and the heater 13000 may be heated when currents flow through the electrically conductive track.",True,0.1755530089139938,0.9214692934210634,17,26,-9,84,172,-88
"그러나, 히터(13000)는 상술한 예에 한정되지 않으며, 희망 온도까지 가열될 수 있는 것이라면 제한 없이 해당될 수 있다.","However, the heater 13000 is not limited to the example described above and may include all heaters which may be heated to a desired temperature.",True,0.2685295939445495,0.8712095158196818,17,25,-8,70,145,-75
"여기에서, 희망 온도는 에어로졸 생성 장치(10000)에 기 설정되어 있을 수도 있고, 사용자에 의하여 원하는 온도로 설정될 수도 있다.]","Here, the desired temperature may be pre-set in the aerosol generating device 10000 or may be set by a user.",True,0.1597135215997696,0.9123389352211084,18,20,-2,77,108,-31
"[다른 예로, 도 4에 도시된 바와 같이, 히터(13000)는 유도 가열식 히터일 수 있다.","As another example, as shown in FIG. 4, the heater 13000 may be an induction heating type heater.",True,0.1760040521621704,0.91900711975952,13,18,-5,51,97,-46
에어로졸 생성 장치(13000)는 에어로졸 생성 물품(20000)을 유도 가열 방식으로 가열하기 위한 유도 코일(13500)을 더 포함할 수 있다.,The aerosol generating device 13000 may further include an induction coil 13500 for heating the aerosol-generating article 20000 in an induction heating manner.,True,0.1826418042182922,0.9231083312263718,17,23,-6,82,160,-78
"유도 코일(13500)은 배터리(11000)로부터 전력이 공급됨에 따라 가변 자기장을 발생시킬 수 있고, 히터(13000)는 가변 자기장이 관통됨에 따라 가열되는 서셉터를 포함할 수 있다. 서셉터는 금속 또는 탄소를 포함할 수 있다.","The induction coil 13500 may generate a variable magnetic field as power is supplied from the battery 11000, and the heater 13000 may include a susceptor that is heated as the variable magnetic field passes through.",False,0.2963740825653076,0.8598721958393439,28,36,-8,130,215,-85
"예를 들어, 서셉터는 페라이트(ferrite), 강자성 합금(ferromagnetic alloy), 스테인리스강(stainless steel) 및 알루미늄(Aluminum) 중 적어도 하나를 포함할 수 있다.]","For example, the susceptor may include at least one of ferrite, a ferromagnetic alloy, stainless steel, and aluminum.",True,0.15554079413414,0.9035685075306498,17,18,-1,117,117,0
"[또한, 서셉터는 흑연(graphite), 몰리브덴(molybdenum), 실리콘 카바이드(silicon carbide), 니오븀(niobium), 니켈 합금(nickel alloy), 금속 필름(metal film), 지르코니아(zirconia) 등과 같은 세라믹, 니켈(Ni)이나 코발트(Co) 등과 같은 전이 금속 및 붕소(B)나 인(P)과 같은 준금속 중 적어도 하나를 포함할 수도 있다.","In addition, the susceptor may include at least one of graphite, molybdenum, silicon carbide, niobium, a nickel alloy, a metal film, a ceramic such as zirconia, a transition metal such as nickel (Ni) or cobalt (Co), and a metalloid such as boron (B) or phosphorus (P).",True,0.1018269807100296,0.9380924127468192,35,46,-11,221,268,-47
"그러나, 히터(13000)에 포함되는 서셉터는 상술한 예에 한정되지 않으며, 가변 자기장이 인가됨에 따라 희망 온도까지 가열될 수 있는 것이라면 제한 없이 해당될 수 있다. ]","However, the susceptor included in the heater 13000 is not limited to the above-described example, and may be used without limitation as long as it may be heated to a desired temperature by applying a variable magnetic field.",True,0.2891545295715332,0.8539437244074647,24,38,-14,98,225,-127
"[히터(13000)는 관 형 가열 요소, 판 형 가열 요소, 침 형 가열 요소 또는 봉 형의 가열 요소를 포함할 수 있으며, 가열 요소의 모양에 따라 에어로졸 생성 물품(20000)의 내부 또는 외부를 가열할 수 있다.]","The heater 13000 may include a tube-type heating element, a plate-type heating element, a needle-type heating element, or a rod-type heating element, and may heat the inside or the outside of the aerosol-generating article 20000, according to the shape of the heating element.",True,0.2514203488826751,0.8875274227251606,34,43,-9,123,276,-153
"[또한, 에어로졸 생성 장치(10000)에는 히터(13000)가 복수 개 배치될 수도 있다.","Also, the aerosol generating device 10000 may include a plurality of heaters 13000.",True,0.2036445587873459,0.9160132183859604,10,13,-3,51,83,-32
"이때, 복수 개의 히터(13000)들은 에어로졸 생성 물품(20000)의 내부에 삽입되도록 배치될 수도 있고, 에어로졸 생성 물품(20000)의 외부에 배치될 수도 있다.","Here, the plurality of heaters 13000 may be inserted into the aerosol-generating article 20000 or may be arranged outside the aerosol-generating article 20000.",True,0.2262657135725021,0.9068231413992568,19,23,-4,95,159,-64
"또한, 복수 개의 히터(13000)들 중 일부는 에어로졸 생성 물품(20000)의 내부에 삽입되도록 배치되고, 나머지는 에어로졸 생성 물품(20000)의 외부에 배치될 수 있다.","Also, some of the plurality of heaters 13000 may be inserted into the aerosol-generating article 20000 and the others may be arranged outside the aerosol-generating article 20000.",True,0.1911845356225967,0.9203389071626824,20,27,-7,99,179,-80
"또한, 히터(13000)의 형상은 도 1 내지 도 4에 도시된 형상에 한정되지 않고, 다양한 형상으로 제작될 수 있다.]","In addition, the shape of the heater 13000 is not limited to the shapes illustrated in FIGS. 1 through 4 and may include various shapes.",True,0.1499160677194595,0.9259594923545604,17,25,-8,67,136,-69
"[증기화기(14000)는 액상 조성물을 가열하여 에어로졸을 생성할 수 있으며, 생성된 에어로졸은 에어로졸 생성 물품(20000)을 통과하여 사용자에게 전달될 수 있다.",The vaporizer 14000 may generate aerosol by heating a liquid composition and the generated aerosol may pass through the aerosol-generating article 20000 to be delivered to a user.,True,0.1999413073062896,0.907153231958256,18,28,-10,93,179,-86
"다시 말해, 증기화기(14000)에 의하여 생성된 에어로졸은 에어로졸 생성 장치(10000)의 기류 통로를 따라 이동할 수 있고, 기류 통로는 증기화기(14000)에 의하여 생성된 에어로졸이 에어로졸 생성 물품을 통과하여 사용자에게 전달될 수 있도록 구성될 수 있다.]","In other words, the aerosol generated via the vaporizer 14000 may move along an air flow passage of the aerosol generating device 10000 and the air flow passage may be configured such that the aerosol generated via the vaporizer 14000 passes through the aerosol-generating article 20000 to be delivered to the user.",True,0.1754217743873596,0.9205045744450556,32,52,-20,150,315,-165
"[예를 들어, 증기화기(14000)는 액체 저장부, 액체 전달 수단 및 가열 요소를 포함할 수 있으나, 이에 한정되지 않는다.","For example, the vaporizer 14000 may include a liquid storage, a liquid delivery element, and a heating element, but it is not limited thereto.",True,0.238954558968544,0.8889022251872758,17,24,-7,70,143,-73
"예를 들어, 액체 저장부, 액체 전달 수단 및 가열 요소는 독립적인 모듈로서 에어로졸 생성 장치(10000)에 포함될 수도 있다.]","For example, the liquid storage, the liquid delivery element, and the heating element may be included in the aerosol generating device 10000 as independent modules.",True,0.2170843631029129,0.8984373983647931,18,25,-7,73,164,-91
[액체 저장부는 액상 조성물을 저장할 수 있다.,The liquid storage may store a liquid composition.,True,0.2229389250278473,0.8485936994488298,7,8,-1,26,50,-24
"예를 들어, 액상 조성물은 휘발성 담배 향 성분을 포함하는 담배 함유 물질을 포함하는 액체일 수 있고, 비 담배 물질을 포함하는 액체일 수도 있다.","For example, the liquid composition may be a liquid including a tobacco-containing material having a volatile tobacco flavor component, or a liquid including a non-tobacco material.",True,0.144810751080513,0.9186238315414552,23,26,-3,82,181,-99
"액체 저장부는 증기화기(14000)로부터 탈/부착될 수 있도록 제작될 수도 있고, 증기화기(14000)와 일체로서 제작될 수도 있다.]",The liquid storage may be formed to be detachable from the vaporizer 14000 or may be formed integrally with the vaporizer 14000.,True,0.1980041116476059,0.897434987461647,14,22,-8,75,128,-53
"[예를 들어, 액상 조성물은 물, 솔벤트, 에탄올, 식물 추출물, 향료, 향미제, 또는 비타민 혼합물을 포함할 수 있다.","For example, the liquid composition may include water, a solvent, ethanol, plant extract, spices, flavorings, or a vitamin mixture.",True,0.1583180576562881,0.9048454642632812,17,19,-2,67,131,-64
"향료는 멘솔, 페퍼민트, 스피아민트 오일, 각종 과일향 성분 등을 포함할 수 있으나, 이에 제한되지 않는다.","The spices may include menthol, peppermint, spearmint oil, and various fruit-flavored ingredients, but are not limited thereto.",True,0.119993507862091,0.9172892936216052,15,17,-2,60,127,-67
향미제는 사용자에게 다양한 향미 또는 풍미를 제공할 수 있는 성분을 포함할 수 있다.,The flavorings may include ingredients capable of providing various flavors or tastes to a user.,True,0.1361365616321563,0.9114607057762946,13,15,-2,47,96,-49
"비타민 혼합물은 비타민 A, 비타민 B, 비타민 C 및 비타민 E 중 적어도 하나가 혼합된 것일 수 있으나, 이에 제한되지 않는다.","Vitamin mixtures may be a mixture of at least one of vitamin A, vitamin B, vitamin C, and vitamin E, but are not limited thereto.",True,0.1446220725774765,0.9052556765281504,21,25,-4,73,129,-56
"또한, 액상 조성물은 글리세린 및 프로필렌 글리콜과 같은 에어로졸 형성제를 포함할 수 있다.]","Also, the liquid composition may include an aerosol forming substance, such as glycerin and propylene glycol.",True,0.1056264266371727,0.9376683517015172,13,16,-3,52,109,-57
[액체 전달 수단은 액체 저장부의 액상 조성물을 가열 요소로 전달할 수 있다.,The liquid delivery element may deliver the liquid composition of the liquid storage to the heating element.,True,0.2909860610961914,0.8256605384963237,12,17,-5,43,108,-65
"예를 들어, 액체 전달 수단은 면 섬유, 세라믹 섬유, 유리 섬유, 다공성 세라믹과 같은 심지(wick)가 될 수 있으나, 이에 한정되지 않는다.]","For example, the liquid delivery element may be a wick such as cotton fiber, ceramic fiber, glass fiber, or porous ceramic, but is not limited thereto.",True,0.2126909494400024,0.8636562428429087,21,26,-5,82,151,-69
[가열 요소는 액체 전달 수단에 의해 전달되는 액상 조성물을 가열하기 위한 요소이다.,The heating element is an element for heating the liquid composition delivered by the liquid delivery element.,True,0.2200053632259369,0.8618736388330015,12,17,-5,47,110,-63
"예를 들어, 가열 요소는 금속 열선, 금속 열판, 세라믹 히터 등이 될 수 있으나, 이에 한정되지 않는다.","For example, the heating element may be a metal heating wire, a metal hot plate, a ceramic heater, or the like, but is not limited thereto.",True,0.1584337651729583,0.9109290564662472,17,26,-9,59,139,-80
"또한, 가열 요소는 니크롬선과 같은 전도성 필라멘트로 구성될 수 있고, 액체 전달 수단에 감기는 구조로 배치될 수 있다.","In addition, the heating element may include a conductive filament such as nichrome wire and may be positioned as being wound around the liquid delivery element.",True,0.2531052827835083,0.8604579751375133,18,26,-8,67,161,-94
"[(3) 예를 들면, 도 6에 나타내는 바와 같이, 상기 서포트 로드(3)에 형성된 통공(筒孔)(3c)과 상기 서포트 로드(3)의 선단부에서의 외부를 연통시키는 입구로(入口路)(66)가 상기 서포트 로드(3)의 선단부에 형성된다.","(3) As shown in FIG. 6, for example, an inlet passage 66, which communicatively connects a tubular hole 3c of the support rod 3 to an outside of a leading end portion of the support rod 3, is provided in the leading end portion of the support rod 3.",True,0.2031472027301788,0.9026781641787964,25,49,-24,128,249,-121
그 입구로(66) 및 상기 통공(3c)이 상기 배출로(42)의 일부를 구성한다.,The inlet passage 66 and the tubular hole 3c each structures a part of the discharge passage 42.,True,0.2236929833889007,0.8745081445056695,9,18,-9,44,96,-52
상기 입구로(66)에 개폐 밸브(61)가 설치된다.,An opening/closing valve 61 is provided to the inlet passage 66.,True,0.2038815319538116,0.8783244647308908,5,11,-6,28,64,-36
"상기 개폐 밸브(61)는, 상기 통공(3c)으로부터 상기 서포트 로드(3)의 선단부에서의 외부로의 압축가스의 흐름을 허용함과 아울러 그 역류를 제한한다.]",The opening/closing valve 61 is configured to allow a flow of compressed gas from the tubular hole 3c to the outside of the leading end portion of the support rod 3 and to block the reverse flow.,True,0.2200748175382614,0.8790845811069096,17,37,-20,86,195,-109
"[이 경우, 배출로로부터의 가스가 필요한 개소를 향해 배출되도록, 서포트 로드의 선단부의 원하는 장소에 배출구가 마련된다.]","In this arrangement, it is possible to provide the discharge port at a desired position of the leading end portion of the support rod so that gas from the discharge passage is ejected toward a target point which needs the gas.",True,0.2852000296115875,0.8307462508587211,15,41,-26,69,226,-157
"[본 발명에 따르면, 간소한 구조로 소형의 워크 서포트를 제공할 수 있다.]","According to embodiments of the present invention, it is possible to provide a compact work support having a mechanically simple structure.",True,0.3458136916160583,0.7568961163050751,11,21,-10,42,139,-97
"[[도 1] 도 1은, 본 발명의 제1 실시형태를 나타내며, 워크 서포트의 릴리스 상태를 나타내는 입면시(立面視)의 단면도이다. [도 2] 도 2는, 상기 워크 서포트의 동작을 설명하기 위한 입면시의 단면도로서, 상기 도 1에 유사한 도면이다. [도 3] 도 3은, 상기 워크 서포트의 로크 상태를 나타내는 입면시의 단면도로서, 상기 도 1에 유사한 도면이다. [도 4] 도 4는, 상기 제1 실시형태의 변형예를 나타내며, 도 3에 유사한 도면이다. [도 5] 도 5는, 본 발명의 제2 실시형태를 나타내며, 도 3에 유사한 도면이다. [도 6] 도 6은, 본 발명의 제3 실시형태를 나타내며, 도 3에 유사한 도면이다.]","[ FIG. 1] FIG. 1 shows a first embodiment of the present invention, and is an elevational view in section of a work support in a release state.",False,0.5385394096374512,0.6750233992016377,89,28,61,348,143,205
"[도 1 내지 도 3은, 본 발명의 제1 실시형태를 나타내고 있다.",FIG. 1 to FIG. 3 show a first embodiment of the present invention.,True,0.0694833546876907,0.9565583344196824,11,13,-2,37,66,-29
"이 실시형태에서는, 공압식(空壓式) 워크 서포트에 본 발명을 적용한 경우를 예시하고 있다.","This embodiment deals with a case in which the present invention is applied to a pneumatic work support, by way of example.",True,0.1869170665740966,0.8700573090439666,11,22,-11,50,123,-73
"우선, 상기 워크 서포트의 구조를 설명한다.]","First of all, the structure of the work support will be described.",True,0.1947358846664428,0.8622605622025888,6,12,-6,25,66,-41
"[고정대(固定臺)로서의 테이블(T)에 수용 구멍이 형성되고, 수용 구멍의 내주벽에 암나사부가 형성된다.","An accommodation hole is bored in a table T functioning as a stationary stand, and an internal thread portion is provided on an inner peripheral wall of the accommodation hole.",True,0.3261795341968536,0.8021750934821821,10,30,-20,57,176,-119
"그 암나사부에, 하우징(1)의 외주벽에 형성되는 수나사 부가 나사 결합되어 해당 하우징(1)이 수용 구멍에 고정된다.","An external thread portion provided on an outer peripheral wall of a housing 1 is screwed onto the internal thread portion, so that the housing 1 is fixed to the accommodation hole.",True,0.3693840503692627,0.804086272025981,14,32,-18,65,181,-116
"그 하우징(1)은, 상벽(선단부)(1a)과 통 모양(筒狀)의 몸통부(胴部)(1b)와 지지 부재(1c)와 하부 블록(1d)을 가진다.",The housing 1 includes: an upper wall (leading end portion) 1a; a tubular barrel portion 1b; a support member 1c; and a lower block 1d.,True,0.1983942985534668,0.8989777098252387,11,25,-14,73,135,-62
그 몸통부(1b)의 통공의 하부에 통 모양의 지지 부재(1c)가 고정된다.,The support member 1c has a tubular shape and is fixed to a lower portion of a tubular hole of the barrel portion 1b.,True,0.3640812933444977,0.8024900626438601,9,24,-15,41,117,-76
그 지지 부재(1c)의 통공에 하부 블록(기단부)(1d)이 고정된다.,The lower block (base end portion) 1d is fixed to a tubular hole of the support member 1c.,True,0.2074621319770813,0.8909509849770081,7,18,-11,38,90,-52
"그 하우징(1)의 상벽(1a)에 삽통 구멍(2)이 상하방향으로 형성되고, 그 삽통 구멍(2)에 서포트 로드(3)가 상하방향(해당 서포트 로드(3)의 축방향의 선단측 및 기단측)으로 이동 가능하게 삽입된다.",A support rod 3 is inserted in the insertion hole 2 so as to be movable in the up-down direction (toward a leading end side and toward a base end side in an axial direction of the support rod 3).,False,0.3368380069732666,0.8415147093915409,22,40,-18,114,195,-81
"그 서포트 로드(3)는, 통 모양의 로드 본체(3a)와 그 로드 본체(3a)의 상단부에 나합(螺合, 나사 결합)되는 누름 볼트(3b)를 가진다.",The support rod 3 includes: a tubular rod main body 3a; and a push bolt 3b screwed in an upper end portion of the rod main body 3a.,True,0.3306744396686554,0.8335925924358056,17,28,-11,80,131,-51
"로드 본체(3a)는, 상하방향으로 형성되는 통공(3c)을 구비한다.",The rod main body 3a has a tubular hole 3c extending in the up-down direction.,True,0.4130138456821441,0.7476978778227144,6,15,-9,37,78,-41
"또한, 본 실시형태에서, 상벽(1a), 몸통부(1b), 지지 부재(1c), 하부 블록(1d)은 각각의 부재로 설치되는 것 대신에, 그들 부재 중 2개 또는 3개의 부재를 일체로 형성하도록 해도 된다.]","While in this embodiment, the upper wall 1a, the barrel portion 1b, the support member 1c, and the lower block 1d are respectively separable elements, two or three of these elements may be unitary with one another.",True,0.3071761429309845,0.8271943647560471,25,37,-12,112,214,-102
"[상기 서포트 로드(3)의 외주면의 하반(下半) 부분에 협지(grip) 고정 영역(R)이 마련되고, 그 협지 고정 영역(R)에 통 모양의 콜릿(5)이 바깥으로 끼워진다.","A region R to be gripped and held is provided on a lower half portion of an outer peripheral surface of the support rod 3, and a tubular collet 5 is fitted over the region R. The collet 5 includes: a tapered outer peripheral surface 5a tapering down upward; and a slit 5b extending in the up-down direction.",True,0.3289117813110351,0.830350809480111,19,58,-39,94,307,-213
"그 콜릿(5)은, 위가 오므라진 테이퍼 외주면(5a)을 구비하며, 상하방향으로 연장되는 하나의 슬릿(slit)(5b)에 의해 탄성적으로 축경(縮徑, 지름 축소)되도록 되어 있다.",An annular transmission member 6 is disposed on an outer peripheral side of the collet 5.,False,0.7155683040618896,0.5666873949162711,18,16,2,99,89,10
"그 콜릿(5)의 외주측에 환상의 전동구(transmission member)(6)가 배치되고, 그 전동구(6)의 테이퍼 내주면(6a)이 콜릿(5)의 테이퍼 외주면(5a)에 상측으로부터 대면(對面)된다.",A tapered inner peripheral surface 6a of the transmission member 6 is opposed from above to the tapered outer peripheral surface 5a of the collet 5.,True,0.3078200817108154,0.8247006675869872,16,26,-10,112,148,-36
그 테이퍼 외주면(5a)과 테이퍼 내주면(6a) 사이에 형성한 환상 테이퍼 간극(7)에는 다수의 볼(8)이 삽입되어 있다.,A plurality of balls 8 are inserted in an annular tapered gap 7 created between the tapered outer peripheral surface 5a and the tapered inner peripheral surface 6a.,True,0.1767763942480087,0.8928168828212306,14,28,-14,68,164,-96
"또한, 본 실시형태에서는, 전동구(6)와 후술(後述)하는 제1 피스톤(피스톤)(12)이 따로따로 설치되어 있지만, 이러한 구성에 한하지 않고, 전동구(6)와 제1 피스톤(12)을 일체로 형성해도 된다.]","Although the transmission member 6 and a first piston (piston) 12 are provided as separate elements in this embodiment, the invention is not limited to this.",False,0.4308962821960431,0.733992850928257,20,26,-6,113,157,-44
"[작동용의 제1 실린더(10)는, 하우징(1)의 몸통부(1b) 내에 형성된 제1 실린더 구멍(실린더 구멍)(11)과, 그 제1 실린더 구멍(11)과 전동구(6) 사이에 삽입된 환상의 제1 피스톤(피스톤)(12)과, 그 제1 피스톤(12)을 하강시키는 작동실(13)과, 그 제1 피스톤(12)을 상승시키는 제1 스프링(14)을 구비한다.",A first cylinder 10 for actuation includes: a first cylinder hole (cylinder hole) 11 provided in the barrel portion 1b of the housing 1; the annular first piston (piston) 12 inserted between the first cylinder hole 11 and the transmission member 6; an actuation chamber 13 configured to lower the first piston 12; and a first spring 14 configured to raise the first piston 12.,True,0.1633460968732834,0.9179334269849398,33,65,-32,187,376,-189
"그 제1 스프링(14)은, 전동구(6)의 하측에 형성되는 스프링실(15)에 장착되어 있다.]",The first spring 14 is attached in a spring chamber 15 provided below the transmission member 6.,True,0.2737318277359009,0.8466660254408541,9,17,-8,51,96,-45
"[더 상세하게 말하면, 상기 제1 피스톤(12)의 상부가 봉지(封止, sealing) 부재(16)에 의해 상벽(1a)에 보밀상(保密狀, 밀폐 상태)으로 안내됨과 함께, 제1 피스톤(12)의 하부가 다른 봉지 부재(17)에 의해 지지 부재(1c)에 보밀상으로 안내되고 있다.","To be more specific, an upper portion of the first piston 12 is hermetically guided to the upper wall 1a by a sealing member 16, while a lower portion of the first piston 12 is hermetically guided to the support member 1c by a sealing member 17.",True,0.261323869228363,0.8617647150656168,29,47,-18,152,245,-93
"그리고 작동실(13)로 압축에어(압축가스)를 공급함으로써, 제1 피스톤(12)의 상단부에 형성한 큰 면적의 환상 수압면(受壓面)에 하향력(下向力)이 작용함과 함께, 제1 피스톤(12)의 하단부에 형성한 작은 면적의 환상 수압면에 상향력(上向力)이 작용하여, 이들 상하의 차력(差力)에 의해 제1 피스톤(12)이 하강한다(기단측으로 이동한다).]","When compressed air (compressed gas) is supplied to the actuation chamber 13, a downward force is applied to a large annular pressure-receiving surface provided on an upper end portion of the first piston 12, while an upward force is applied to a small annular pressure-receiving surface provided on a lower end portion of the first piston 12.",False,0.2276246547698974,0.8777037408798434,33,57,-24,192,343,-151
"[상기 제1 스프링(14)은, 여기서는 압축 코일 스프링으로 이루어지며, 전동구(6)의 하면에 장착한 상부 스프링받이(19)와 콜릿(5)의 하단부에 장착한 하부 스프링받이(20) 사이에 장착되어 있다.",The first spring 14 is attached between: an upper spring receiver 19 attached to an under surface of the transmission member 6; and a lower spring receiver 20 attached to a lower end portion of the collet 5.,False,0.3260373473167419,0.8323061395995653,21,38,-17,112,207,-95
"또한, 상부 스프링받이(19)가 다수의 볼(8)을 수용하고 있다.",The upper spring receiver 19 receives the balls 8.,True,0.4203697144985199,0.7140201189561334,7,9,-2,36,50,-14
"또한, 제1 스프링(14)이 하부 스프링받이(20)를 통해 콜릿(5)의 하단면을 지지 부재(1c)에 당접시키고 있다.]","Furthermore, the first spring 14 brings a lower end surface of the collet 5 into contact with the support member 1c via the lower spring receiver 20.",True,0.2430829852819442,0.8724370784467593,12,27,-15,66,149,-83
[상기 지지 부재(1c)의 통공 내 및 하부 블록(1d)의 통공 내에 진퇴용의 제2 실린더(21)가 설치된다.,A second cylinder 21 for up-down movement is provided in the tubular hole of the support member 1c and in a tubular hole of the lower block 1d.,True,0.2846986055374145,0.8565374137657498,14,28,-14,61,143,-82
"그 제2 실린더(21)는, 다음과 같이 구성되어 있다.",The second cylinder 21 is structured as follows.,True,0.1346855461597442,0.9119767915357148,7,8,-1,30,48,-18
"하부 블록(1d)의 통공에 대경(大徑, 큰 지름)의 제2 실린더 구멍(실린더 구멍)(22)과, 지지 부재(1c)의 통공 내에 제2 실린더 구멍(22)보다도 소경(小徑, 작은 지름)의 로드 구멍(23)이 형성된다.",A second cylinder hole (cylinder hole) 22 having a large diameter is provided in the tubular hole of the lower block 1d.,False,0.3195992708206177,0.8356337627740912,23,22,1,118,120,-2
"그 제2 실린더 구멍(22)에 출력 부재(24)의 제2 피스톤(25)이 봉지 부재(25a)를 통해 보밀상으로 상하방향(서포트 로드(3)의 축방향)의 하한(下限) 위치(기단측 한계 위치)와 상한(上限) 위치(선단측 한계 위치) 사이에서 이동 가능하게 되도록 삽입됨과 아울러, 로드 구멍(23)에 출력 부재(24)의 피스톤 로드(26)가 삽입된다.",A second piston 25 of an output member 24 is hermetically inserted in the second cylinder hole 22 via a sealing member 25a so as to be movable between its lower limit position (base-end-side limit position) and its upper limit position (leading-end-side limit position) in the up-down direction (in the axial direction of the support rod 3).,False,0.2050924599170684,0.897993988890737,36,57,-21,192,341,-149
"출력 부재(24)는, 하우징(1)의 기단부에 형성되는 상기 제2 실린더 구멍(22)에 상하방향(서포트 로드(3)의 축방향)으로 이동 가능하게 되도록 삽입된다.",The output member 24 is inserted in the second cylinder hole 22 provided in a base end portion of the housing 1 so as to be movable in the up-down direction (in the axial direction of the support rod 3).,True,0.1708127111196518,0.9180950532408748,16,40,-24,88,203,-115
"출력 부재(24)는, 제2 피스톤(25)과 피스톤 로드(26)로 구성된다.]",The output member 24 is structured by the second piston 25 and the piston rod 26.,True,0.2202018499374389,0.8691391881316277,7,16,-9,42,81,-39
"[상기 제2 실린더 구멍(22) 내로서, 출력 부재(24)의 축방향(서포트 로드(3)의 축방향)의 기단측에 입구실(29)이 형성된다.","In the second cylinder hole 22, an inlet chamber 29 is provided on the base end side in the axial direction of the output member 24 (in the axial direction of the support rod 3).",True,0.1766433715820312,0.9148027583134368,13,35,-22,74,178,-104
그 입구실(29)에 압축에어의 급배구(給排口)(30)가 연통된다.,A supply and discharge port 30 for compressed air is communicatively connected to the inlet chamber 29.,True,0.2883754074573517,0.8194780489877286,5,17,-12,36,103,-67
"또한, 제2 실린더 구멍(22) 내로서, 출력 부재(24)의 축방향(서포트 로드(3)의 축방향)의 선단측에 출구실(32)이 형성된다.","In the second cylinder hole 22, an outlet chamber 32 is provided on the leading end side in the axial direction of the output member 24 (in the axial direction of the support rod 3).",True,0.1768990457057953,0.914044810249268,13,35,-22,74,182,-108
제2 피스톤(25)을 하향으로 후퇴시키는 제2 스프링(33)이 로드 구멍(23)의 상벽(31)과 제2 피스톤(25)의 상면 사이에 장착된다.,A second spring 33 configured to move the second piston 25 downward is attached between an upper wall 31 of the rod hole 23 and the second piston 25.,True,0.1729532331228256,0.9160397031486356,14,29,-15,78,149,-71
"본 실시형태에서, 제2 스프링(33)은, 압축 코일 스프링으로 구성되어 있다.]","In this embodiment, the second spring 33 is structured by a compression coil spring.",True,0.1943100243806839,0.8882834887025151,9,14,-5,44,84,-40
[상기 피스톤 로드(26)의 선단부가 서포트 로드(3)의 통공(3c)에 삽입되어 있다.,A leading end portion of the piston rod 26 is inserted in the tubular hole 3c of the support rod 3.,True,0.3184933960437774,0.8392448766587505,9,21,-12,48,99,-51
그 피스톤 로드(26)의 선단측의 외주벽에 안내홈(35)이 상하방향으로 형성된다.,A guide groove 35 is provided on an outer peripheral wall of a leading-end-side portion of the piston rod 26 so as to extend in the up-down direction.,True,0.3026644885540008,0.8284275594961333,8,28,-20,45,150,-105
"서포트 로드(3)의 통벽(筒壁)에 형성되는 관통 구멍에 핀(36)이 장착되며, 그 핀(36)이 안내홈(35)에 삽입된다.","A pin 36 is attached in a through hole provided through a tubular wall of the support rod 3, and the pin 36 is inserted in the guide groove 35.",True,0.1721367537975311,0.9119303685444572,12,30,-18,67,143,-76
"그 안내홈(35)의 상단벽에 상부 계합부(係合部, 결합부)(35a)가 형성되고, 그 하단벽에 하부 계합부(35b)가 형성된다.","An upper engaging portion 35a is provided on an upper end wall of the guide groove 35, while a lower engaging portion 35b is provided on a lower end wall of the groove 35.",True,0.2544595003128052,0.8652572270956287,12,34,-22,70,171,-101
"또한, 상부 계합부(35a)에 계합 가능한 상부 계지부(係止部, engaged portion)(36a)가 핀(36)의 상측 벽면에 형성되고, 하부 계합부(35b)에 계합 가능한 하부 계지부(36b)가 핀(36)의 하측 벽면에 형성된다.",A lower engaged portion 36b configured to be engageable with the lower engaging portion 35b is provided on a lower wall surface of the pin 36.,False,0.3498886227607727,0.8121164134225045,23,26,-3,131,142,-11
"그 피스톤 로드(26)의 선단면과 누름 볼트(3b)의 하단면 사이에, 서포트 로드(3)와 피스톤 로드(26)를 이간시키는 방향으로 부세하는 진출 스프링(부세 수단)(38)이 장착된다.",An advance spring (biasing means) 38 configured to bias the support rod 3 and the piston rod 26 in respective directions so that they recede from each other is attached between a leading end surface of the piston rod 26 and a lower end surface of the push bolt 3b.,True,0.2513246834278106,0.8760625576466465,19,50,-31,102,264,-162
"본 실시형태의 진출 스프링(38)은, 압축 코일 스프링으로 구성되어 있다.",The advance spring 38 of this embodiment is structured by a compression coil spring.,True,0.2238882035017013,0.8604650504991525,9,14,-5,41,84,-43
"여기서, 본 실시형태에서, 서포트 로드(3)의 외경(外徑) 치수와 제2 피스톤(25)의 외경 치수는, 대략 동일하게 되도록 형성되어 있다.","In this embodiment, the device is designed so that the size of the outer diameter of the support rod 3 is substantially equal to the size of the outer diameter of the second piston 25.",True,0.3350734710693359,0.816966679200252,16,35,-19,77,184,-107
"또한, 피스톤 로드(26)의 외경 치수와 서포트 로드(3)의 통공(3c)의 내경(內徑) 치수는, 대략 동일하게 되도록 형성되어 있다.]",The device is further designed so that the size of the outer diameter of the piston rod 26 is substantially equal to the size of the inner diameter of the tubular hole 3c of the support rod 3.,True,0.3816779553890228,0.7943229688393534,15,38,-23,75,192,-117
"[또한, 입구실(29)과 출구실(32) 중 한쪽을 작동실(13)에 연통시키는 전환 수단(40)이 워크 서포트의 기단측 부분에 설치된다.","Furthermore, a switching means 40, through which one of the inlet chamber 29 and the outlet chamber 32 is communicatively connected to the actuation chamber 13, is provided at a base-end-side portion of the work support.",True,0.2182548642158508,0.8812338135716851,14,36,-22,75,220,-145
"필터 케이크를 임시 저장하고, 여액을 다음 단계(실시예 2)를 위해 합하였다.]","The filter cake was temporarily stored, and the filtrate was combined for the next step (Example 2).",True,0.1474865972995758,0.9019228367826324,10,17,-7,44,100,-56
[B[attributes={}; value=[실시예 2 내지 9]]],Examples 2-9,False,0.6188304424285889,0.5611987456537479,5,2,3,38,12,26
"[Sup[attributes={}; value=[1]], H NMR (400MHz, DMSO-d, Sub[attributes={}; value=[6]], ) δ=7.14 - 7.04 (m, 2H), 6.78 - 6.68 (m, 2H), 3.85 (s, 2H), 1.82 (s, 3H)]","The spectrum data of the obtained product are: 1H NMR: DPC0126-31-P1A 400 MHz DMSO-d6 1H NMR (400MHz, DMSO-d6) δ=7.14 - 7.04 (m, 2H), 6.78 - 6.68 (m, 2H), 3.85 (s, 2H), 1.82 (s, 3H) MS 124.1:M+1, 107.1:M-16",False,0.3246720135211944,0.7574516645303745,25,37,-12,159,206,-47
[하기는 제조 공정의 설명이다.],The following is a description of the preparation process.,True,0.3115850687026977,0.7747832855166134,4,9,-5,18,58,-40
[B[attributes={}; value=[실시예 2]]],Example 2,False,0.6655027270317078,0.5441961222066808,3,2,1,33,9,24
[화학식 2의 화합물(2.0 g) 및 빙초산(2.0 mL)을 반응 플라스크에 첨가하였다.,The compound of Formula 2 (2.0 g) and glacial acetic acid (2.0 mL) were added into a reaction flask.,True,0.1518085300922393,0.919523287431671,10,19,-9,49,100,-51
혼합물을 70 내지 80℃에서 50 내지 55시간 동안 교반 및 반응시켰다.,The mixture was stirred and reacted at 70-80°C for 50-55h.,True,0.1059778034687042,0.9466793907205848,11,10,1,42,58,-16
"반응을 완료한 후, 혼합물을 실온으로 냉각시키고, MTBE(6 mL)를 서서히 첨가하여 결정화하였다.","After the reaction was complete, the mixture was cooled to room temperature, and MTBE (6 mL) was added slowly to crystallize.",True,0.0971696227788925,0.9454806731305516,11,21,-10,56,125,-69
"혼합물을 10 내지 20℃에서 0.5시간 동안 교반하고, 여과하고, 40℃에서 일정한 중량까지 진공 건조시켰다.","The mixture was stirred at 10-20°C for 0.5h, filtered, and vacuum dried at 40°C to constant weight.",True,0.222231775522232,0.8860151738193626,13,17,-4,62,99,-37
중량: 0.75 g; 수율: 45.73%; 순도: 98.43%.],Weight: 0.75 g; yield: 45.73%; purity: 98.43%.,True,0.1215534433722496,0.9213103812114248,7,7,0,36,46,-10
[B[attributes={}; value=[실시예 3 ]]],Example 3,False,0.6887310147285461,0.5117185919253935,4,2,2,34,9,25
[화학식 2의 화합물(2.0 g) 및 빙초산(8.0 mL)을 반응 플라스크에 첨가하였다.,The compound of Formula 2 (2.0 g) and glacial acetic acid (8.0 mL) were added into a reaction flask.,True,0.1427699625492096,0.9252148714140036,10,19,-9,49,100,-51
혼합물을 70 내지 80℃에서 50 내지 55시간 동안 교반 및 반응시켰다.,The mixture was stirred and reacted at 70-80°C for 50-55h.,True,0.1059778034687042,0.9466793907205848,11,10,1,42,58,-16
"반응을 완료한 후, 혼합물을 실온으로 냉각시키고, MTBE(24 mL)를 서서히 첨가하여 결정화하였다.","After the reaction was complete, the mixture was cooled to room temperature, and MTBE (24 mL) was added slowly to crystallize.",True,0.1013972759246826,0.9435261874817366,11,21,-10,57,126,-69
"혼합물을 10 내지 20℃에서 0.5시간 동안 교반하고, 여과하고, 40℃에서 일정한 중량까지 진공 건조시켰다.","The mixture was stirred at 10-20°C for 0.5h, filtered, and vacuum dried at 40°C to constant weight.",True,0.222231775522232,0.8860151738193626,13,17,-4,62,99,-37
중량: 0.81 g; 수율: 49.39%; 순도: 100.00%.],Weight: 0.81 g; yield: 49.39%; purity: 100.00%.,True,0.129390999674797,0.9168689623826576,7,7,0,37,47,-10
[B[attributes={}; value=[실시예 4]]],Example 4,False,0.6342310309410095,0.5499497014699523,3,2,1,33,9,24
[화학식 2의 화합물(2.0 g) 및 빙초산(12.0 mL)을 반응 플라스크에 첨가하였다.,The compound of Formula 2 (2.0 g) and glacial acetic acid (12.0 mL) were added into a reaction flask.,True,0.1372987329959869,0.9268120806046676,10,19,-9,50,101,-51
혼합물을 70 내지 80℃에서 50 내지 55시간 동안 교반 및 반응시켰다.,The mixture was stirred and reacted at 70-80°C for 50-55h.,True,0.1059778034687042,0.9466793907205848,11,10,1,42,58,-16
"반응을 완료한 후, 혼합물을 실온으로 냉각시키고, MTBE(36 mL)를 서서히 첨가하여 결정화하였다.","After the reaction was complete, the mixture was cooled to room temperature, and MTBE (36 mL) was added slowly to crystallize.",True,0.1002436503767967,0.944061344074094,11,21,-10,57,126,-69
"혼합물을 10 내지 20℃에서 0.5시간 동안 교반하고, 여과하고, 40℃에서 일정한 중량까지 진공 건조시켰다.","The mixture was stirred at 10-20°C for 0.5h, filtered, and vacuum dried at 40°C to constant weight.",True,0.222231775522232,0.8860151738193626,13,17,-4,62,99,-37
중량: 0.79 g; 수율: 48.17%; 순도: 99.93%.],Weight: 0.79 g; yield: 48.17%; purity: 99.93%.,True,0.1263729482889175,0.9167400252219264,7,7,0,36,46,-10
[B[attributes={}; value=[실시예 5]]],Example 5,False,0.6638174057006836,0.5434233670947396,3,2,1,33,9,24
[화학식 2의 화합물(2.0 g) 및 빙초산(20.0 mL)을 반응 플라스크에 첨가하였다.,The compound of Formula 2 (2.0 g) and glacial acetic acid (20.0 mL) were added into a reaction flask.,True,0.1471175551414489,0.922518981688539,10,19,-9,50,101,-51
혼합물을 70 내지 80℃에서 50 내지 55시간 동안 교반 및 반응시켰다.,The mixture was stirred and reacted at 70-80°C for 50-55h.,True,0.1059778034687042,0.9466793907205848,11,10,1,42,58,-16
"반응을 완료한 후, 혼합물을 실온으로 냉각시키고, MTBE(60 mL)를 서서히 첨가하여 결정화하였다.","After the reaction was complete, the mixture was cooled to room temperature, and MTBE (60 mL) was added slowly to crystallize.",True,0.1028148457407951,0.944355849135164,11,21,-10,57,126,-69
"혼합물을 10 내지 20℃에서 0.5시간 동안 교반하고, 여과하고, 40℃에서 일정한 중량까지 진공 건조시켰다.","The mixture was stirred at 10-20°C for 0.5h, filtered, and vacuum dried at 40°C to constant weight.",True,0.222231775522232,0.8860151738193626,13,17,-4,62,99,-37
중량: 0.95 g; 수율: 57.93%; 순도: 100.00.],Weight: 0.95 g; yield: 57.93%; purity: 100.00.,True,0.1321027725934982,0.9142081194790792,7,7,0,36,46,-10
[B[attributes={}; value=[실시예 6]]],Example 6,False,0.6537313461303711,0.5418907647779551,3,2,1,33,9,24
[화학식 2의 화합물(10.0 g) 및 빙초산(50.0 mL)을 반응 플라스크에 첨가하였다.,The compound of Formula 2 (10.0 g) and glacial acetic acid (50.0 mL) were added into a reaction flask.,True,0.1428873091936111,0.92733212288143,10,19,-9,51,102,-51
혼합물을 60℃에서 48시간 동안 교반 및 반응시켰다.,The mixture was stirred and reacted at 60°C for 48h.,True,0.2104474306106567,0.8871276183502196,7,10,-3,30,52,-22
"반응을 완료한 후, 혼합물을 실온으로 냉각시키고, MTBE(60 mL)를 서서히 첨가하여 결정화하였다.","After the reaction was complete, the mixture was cooled to room temperature, and MTBE (60 mL) was added slowly to crystallize.",True,0.1028148457407951,0.944355849135164,11,21,-10,57,126,-69
"혼합물을 10 내지 20℃에서 0.5시간 동안 교반하고, 여과하고, 40℃에서 일정한 중량까지 진공 건조시켰다.","The mixture was stirred at 10-20°C for 0.5h, filtered, and vacuum dried at 40°C to constant weight.",True,0.222231775522232,0.8860151738193626,13,17,-4,62,99,-37
중량: 1.00 g; 수율: 12.20%. ],Weight: 1.00 g; yield: 12.20%.,True,0.1587883383035659,0.8938853539541657,6,5,1,25,30,-5
[B[attributes={}; value=[실시예 7]]],Example 7,False,0.6687902808189392,0.528184195452288,3,2,1,33,9,24
[화학식 2의 화합물(10.0 g) 및 빙초산(50.0 mL)을 반응 플라스크에 첨가하였다.,The compound of Formula 2 (10.0 g) and glacial acetic acid (50.0 mL) were added into a reaction flask.,True,0.1428873091936111,0.92733212288143,10,19,-9,51,102,-51
혼합물을 80 내지 90℃에서 17 내지 18시간 동안 교반 및 반응시켰다.,The mixture was stirred and reacted at 80-90°C for 17-18h.,True,0.1770757883787155,0.9040583974548944,11,10,1,42,58,-16
"반응을 완료한 후, 혼합물을 실온으로 냉각시키고, MTBE(150 mL)를 서서히 첨가하여 결정화하였다.","After the reaction was complete, the mixture was cooled to room temperature, and MTBE (150 mL) was added slowly to crystallize.",True,0.1031205058097839,0.94228092047053,11,21,-10,58,127,-69
"혼합물을 10 내지 20℃에서 0.5시간 동안 교반하고, 여과하고, 40℃에서 일정한 중량까지 진공 건조시켰다.","The mixture was stirred at 10-20°C for 0.5h, filtered, and vacuum dried at 40°C to constant weight.",True,0.222231775522232,0.8860151738193626,13,17,-4,62,99,-37
중량: 4.20 g; 수율: 51.22%; 순도: 97.19%.],Weight: 4.20 g; yield: 51.22%; purity: 97.19%.,True,0.1338775604963302,0.913023947885382,7,7,0,36,46,-10
[B[attributes={}; value=[실시예 8]]],Example 8,False,0.6460309028625488,0.5444988758141573,3,2,1,33,9,24
[화학식 2의 화합물(10.0 g) 및 빙초산(50.0 mL)을 반응 플라스크에 첨가하였다.,The compound of Formula 2 (10.0 g) and glacial acetic acid (50.0 mL) were added into a reaction flask.,True,0.1428873091936111,0.92733212288143,10,19,-9,51,102,-51
혼합물을 90 내지 100℃에서 13 내지 14시간 동안 교반 및 반응시켰다.,The mixture was stirred and reacted at 90-100°C for 13-14h.,True,0.1564197838306427,0.911970848437064,11,10,1,43,59,-16
"이때, 상기 도어 열림 감지센서는, 상기 터브 커버의 일면에 안착되는 센서 바디; 및 상기 센서 바디의 일측에 구비된 스위치부를 포함할 수 있다.",The door opening detection sensor may include a sensor body seated on the one side of the tub cover and a switch part configured on one side of the sensor body and the detection projection part may be disposed in a manner of being aligned with at least one portion of the switch part when viewed above.,False,0.3110629022121429,0.8221218830232002,22,57,-35,81,302,-221
"상기 도어 열림 감지센서는, 상기 도어가 상기 스위치부에 접촉한 상태를 상기 도어가 닫힌 것으로 감지할 수 있으며, 상기 도어가 상기 스위치부에 접촉하지 않은 상태를 상기 도어가 열린 것으로 감지할 수 있다.]",The detection projection part may be configured to contact with the switch part by descending by a prescribed height on closing the door or not to contact with the switch part by ascending by a prescribed height on opening the door and the door opening detection sensor may detect the opening or closing of the door based on a presence or non-presence of a contact between the detection projection part and the switch part.,False,0.3349844217300415,0.7916238924201467,31,74,-43,117,423,-306
"[상기 스위치부는 상기 센서 바디로부터 연장되어 상기 도어와 접촉 가능하도록 구비되는 도어 접촉부, 및 상기 센서 바디와 상기 도어 접촉부 사이에 구비되어 상기 센서 바디의 내부로 인입 가능하도록 구비되는 이동 부재를 포함할 수 있고, 상기 도어 열림 감지센서는, 상기 도어 접촉부에 의해 상기 이동 부재가 상기 센서 바디의 내부로 인입된 상태를 상기 도어가 닫힌 것으로 감지할 수 있으며, 상기 이동 부재가 상기 센서 바디의 내부로 인입되지 않은 상태를 상기 도어가 열린 것으로 감지할 수 있다.]","The switch part may include a door contact part extended from the sensor body to be capable of contacting with the door and a moving member configured between the sensor body and the door contact part to be retractable into the sensor body, the door opening detection sensor may detect a state that the moving member is retracted into the sensor body by the door contact part as the closing of the door, and the door opening detection sensor may detect a state that the moving member is not retracted into the sensor body as the opening of the door.",True,0.2074102908372879,0.879521530001906,75,100,-25,279,549,-270
"[상기 도어는 상기 도어의 하부면에서 도어 접촉부의 일단에 대응되는 위치에 결합되는 감지 돌출부를 더 포함할 수 있고, 상기 감지 돌출부는, 상기 도어가 닫힌 상태에서 상기 도어 열림 감지센서에 접촉하도록 구비될 수 있으며, 상기 도어가 열린 상태에서 상기 도어 열림 감지센서에 접촉하지 않도록 구비될 수 있다.]","The door may further include a detection projection part coupled to a position corresponding to one end of the door contact part on the bottom side of the door, the detection projection part may be configured to contact with the door opening detection sensor in a closed state of the door, and the detection projection part may be configured not to contact with the door opening detection sensor in an open state of the door.",True,0.1900250166654586,0.8922942595015878,45,75,-30,175,425,-250
"[상기 도어는 열린 상태에서 닫힌 상태로 전환될 때 소정 높이만큼 하강하도록 구비될 수 있고, 상기 감지 돌출부도 상기 도어와 함께 상기 소정 높이만큼 하강하도록 구비될 수 있으며, 상기 도어 열림 감지센서는 상기 감지 돌출부가 하강하면서 상기 도어 접촉부를 밀어내어 상기 이동 부재를 상기 센서 바디의 내부로 인입시킴에 따라 상기 도어의 열림과 닫힘을 감지할 수 있다.]","The door may be configured to descend by a prescribed height when the open state is switched to the closed state, the detection projection part may be configured to descend by a prescribed height together with the door, and the door opening detection sensor may detect the opening/closing of the door based on retracting the moving member into the sensor body as the detection projection part descends to push out the door contact part.",True,0.2011055201292038,0.880968588711799,55,74,-19,208,436,-228
[본 발명의 예시적인 실시예들에 따른 의류처리장치는 터브의 상부면을 따라 슬라이딩 가능한 도어를 포함할 수 있다.],A laundry treatment apparatus according to exemplary embodiments of the present disclosure may include a door slidable along a top side of a tub.,True,0.3471665680408478,0.7938606341810244,15,24,-9,64,145,-81
"[따라서, 상기 의류처리장치의 상부에 프론트 로드 타입의 메인의류처리장치가 구비되는 경우에도, 상기 의류처리장치에 포함된 도어는 상기 메인의류처리장치의 프론트 도어와 충돌할 우려가 없게 될 수 있다.]",The door included in the laundry treatment apparatus may be free from colliding with a front door of a main laundry treatment device of a front-load type even if the main laundry treatment device is provided above the laundry treatment apparatus.,True,0.3816641271114349,0.7678515293180977,24,41,-17,112,246,-134
"[또한, 상기 의류처리장치의 도어는 드로워가 캐비닛으로부터 완전히 인출되지 않은 경우 제대로 열릴 수 있다.]",The door of the laundry treatment apparatus may be correctly open despite that a drawer fails to be fully withdrawn from a cabinet.,True,0.3569715023040771,0.7661485442804572,14,23,-9,61,131,-70
"[또한, 상기 의류처리장치의 내부에 의류를 투입하거나 상기 의류처리장치의 내부에 수용된 의류를 반출할 때, 상기 의류처리장치의 도어는 완전히 열린 상태를 유지하기 위해 추가 고정부재가 필요하지 않을 수 있다.]",The door of the laundry treatment apparatus may not need an additional fixing member to keep a fully-open state when laundry is put into or withdrawn from the laundry treatment apparatus.,True,0.3876944184303283,0.7710486856024152,27,31,-4,117,187,-70
"[또한, 상기 의류처리장치는 세탁이 완료된 후 상기 터브 내부에 잔류하는 물을 제거할 때, 상기 드로워의 인출 여부와 관계없이 상기 도어를 슬라이딩하여 열린 상태를 유지할 수 있으므로, 상기 터브의 건조를 위해 상기 드로워를 상기 캐비닛으로부터 인출할 필요가 없으며, 이에 따라 상기 터브를 건조시킬 때 상기 드로워를 상기 캐비닛으로부터 인출하기 위한 추가적인 공간이 필요하지 않을 수 있다.]","When water remaining in the tube is removed after completion of washing, the laundry treatment apparatus can keep the open state by enabling the door to slide irrespective of a presence or non-presence of withdrawal of the drawer.",False,0.4226416051387787,0.7392663405810191,55,38,17,220,230,-10
"[또한, 상기 의류처리장치는 상기 터브를 건조시킬 때, 상기 드로워를 상기 캐비닛으로부터 인출할 필요가 없으므로, 사용자가 상기 캐비닛으로부터 인출된 상기 드로워로 인해 이동이 방해되어 불편함이 초래되지 않을 수 있으며, 나아가 사용자가 상기 캐비닛으로부터 인출된 상기 드로워에 걸려 넘어짐에 따라 발생 가능한 부상의 위험성을 감소시킬 수 있다.]","Hence, the laundry treatment apparatus may avoid the inconvenience caused by the drawer withdrawn from the cabinet to interrupt a user's motion and further lower a possibility that there will be a risk of injury as the user trips over the drawer withdrawn from the cabinet.",True,0.3390088081359863,0.7893108985423276,45,46,-1,194,273,-79
"[한편, 본 발명의 예시적인 실시예들에 따른 의류처리장치는 상기 도어가 슬라이딩 함에 따라 상기 도어에 선택적으로 접촉하여 상기 도어의 열림과 닫힘을 감지하는 도어 열림 감지센서를 더 포함할 수 있다.]",The laundry treatment apparatus according to exemplary embodiments of the present disclosure may include a door opening detection sensor configured to detect opening or closing of the door in a manner of selectively contacting with the door as the door slides.,True,0.3331338167190552,0.814752961725935,28,41,-13,113,260,-147
"[따라서, 상기 도어가 터브의 상부면에 회전 가능하게 힌지식 결합되지 않은 경우에도 상기 도어의 열림과 닫힘을 효과적으로 감지할 수 있다.]","Therefore, although the door fails to be rotatably hinge-coupled to the top side of the tub, the opening/closing of the door can be detected effectively.",True,0.3151164352893829,0.7979208998660287,19,25,-6,78,153,-75
[도1은 본 발명 의류처리장치의 외관을 도시한 것이다.,FIG. 1 shows an exterior of a laundry treatment apparatus according to the present disclosure.,True,0.3741161823272687,0.7611493843125395,7,15,-8,30,94,-64
도2는 본 발명 의류처리장치의 내부 구조를 도시한 것이다.,FIG. 2 shows an inner structure of a laundry treatment apparatus according to the present disclosure.,True,0.2477191537618637,0.8418006339669653,8,16,-8,32,101,-69
도3은 본 발명 의류처리장치의 구성을 도시한 분해사시도이다.,FIG. 3 is an exploded perspective diagram showing a configuration of a laundry treatment apparatus according to the present disclosure.,True,0.29372438788414,0.7976134969759382,7,20,-13,33,135,-102
도4 및 도5는 각각 본 발명 터브 커버 및 도어를 도시한 분해사시도이다.,"FIG. 4 and FIG. 5 are exploded perspective diagrams of a tub cover and a door of the present disclosure, respectively.",True,0.2284267544746399,0.8423774729199732,12,21,-9,41,118,-77
도6은 본 발명 도어 안착부 및 센서 안착부를 도시한 분해사시도이다.,FIG. 6 is an exploded perspective diagram of a door seat part and a sensor seat part of the present disclosure.,True,0.3144356608390808,0.7886130290795061,10,21,-11,38,111,-73
도7 및 도8은 각각 본 발명 도어의 하부에 결합되는 가이드 돌출부 및 감지 돌출부를 도시한 것이다.,7A to 8 show a guide projection and a detection projection coupled to a bottom side of a door of the present disclosure.,False,0.2525228559970855,0.8295682472077907,16,23,-7,56,120,-64
도9는 본 발명 도어가 완전히 닫힌 상태를 도시한 것이다.,FIG. 9 shows a state that a door of the present disclosure is fully closed.,True,0.1454585790634155,0.9039706604286468,9,15,-6,32,75,-43
도10은 본 발명 도어가 완전히 닫히지 않은 상태를 도시한 것이다.,FIG. 10A and FIG. 10B show a state that a door of the present disclosure is not fully closed.,True,0.2295963764190673,0.8499076355055191,10,19,-9,37,93,-56
도11은 본 발명 도어가 완전히 열린 상태를 도시한 것이다.,FIG. 11A and FIG. 11B show a state that a door of the present disclosure is fully open.,True,0.2518898248672485,0.8360199519843168,9,18,-9,33,87,-54
도12는 본 발명 도어 열림 감지센서의 동작을 도시한 것이다.],FIG. 12A and FIG. 12B show an operation of a door opening detection sensor of the present disclosure.,True,0.2351477146148681,0.8462972050531278,9,18,-9,35,101,-66
"[이하, 도면을 참조하여 본 발명의 구체적인 실시형태를 설명하기로 한다.","Reference will now be made in detail to the preferred embodiments of the present disclosure, examples of which are illustrated in the accompanying drawings.",True,0.3871683776378631,0.7275307502715347,9,24,-15,40,156,-116
"이하의 상세한 설명은 본 명세서에서 기술된 방법, 장치 및/또는 시스템에 대한 포괄적인 이해를 돕기 위해 제공된다.","A detailed description below is provided to assist in a comprehensive understanding of the methods, devices, and/or systems described in this specification.",True,0.0907275825738906,0.9417513733495162,16,22,-6,64,156,-92
그러나 이는 예시에 불과하며 본 발명은 이에 제한되지 않는다.],"However, this is just an example, by which the idea of the present disclosure is non-limited.",True,0.4050889611244201,0.6913583066534467,9,16,-7,35,93,-58
"[본 발명의 실시예들을 설명함에 있어서, 본 발명과 관련된 공지기술에 대한 구체적인 설명이 본 발명의 요지를 불필요하게 흐릴 수 있다고 판단되는 경우에는 그 상세한 설명을 생략하기로 한다.","In explaining embodiments of the present disclosure, if it is deemed that a specific description of the prior art related to the present disclosure may unnecessarily blur the gist of the present disclosure, the detailed description shall be omitted.",True,0.2251555025577545,0.8620991068031998,26,39,-13,105,249,-144
"그리고, 후술되는 용어들은 본 발명에서의 기능을 고려하여 정의된 용어들로서 이는 사용자, 운용자의 의도 또는 관례 등에 따라 달라질 수 있다.","Furthermore, the terms described below are those defined in consideration of their functions in the present disclosure, which may depend on the intentions or practices of the user, operator, etc. The definition will therefore have to be based on the full text of the present specification.",False,0.2565126121044159,0.827919162066902,20,46,-26,79,289,-210
"상세한 설명에서 사용되는 용어는 단지 본 발명의 실시예들을 기술하기 위한 것이며, 결코 제한적이어서는 안 된다.",The terms used in the detailed description are simply to describe embodiments of the present disclosure and should never be limited.,True,0.1369446516036987,0.9094638264502656,15,21,-6,62,132,-70
"명확하게 달리 사용되지 않는 한, 단수 형태의 표현은 복수 형태의 의미를 포함한다.","Unless clearly used differently, singular forms of expression contain multiple forms of meaning.",True,0.152490884065628,0.8786381304347419,12,13,-1,46,96,-50
"본 설명에서, ""포함"" 또는 ""구비""와 같은 표현은 어떤 특성들, 숫자들, 단계들, 동작들, 요소들, 이들의 일부 또는 조합을 가리키기 위한 것이며, 기술된 것 이외에 하나 또는 그 이상의 다른 특성, 숫자, 단계, 동작, 요소, 이들의 일부 또는 조합의 존재 또는 가능성을 배제하도록 해석되어서는 안 된다.]","In this description, an expression such as ""include"" or ""provide"" is intended to refer to some characteristics, numbers, steps, operations, elements, or combinations thereof, and should not be interpreted to exclude the existence or possibility of one or more other characteristics, numbers, steps, operations, elements, or combinations thereof.",True,0.1066694483160972,0.9363778053083976,44,48,-4,173,345,-172
"[또한, 본 발명의 실시예의 구성 요소를 설명하는 데 있어서, 제 1, 제 2, A, B, (a), (b) 등의 용어를 사용할 수 있다.","In addition, terms such as first, second, A, B, (a) and (b) may be used to describe the components of the embodiments of the present disclosure.",True,0.15906523168087,0.8965719474888929,22,26,-4,76,144,-68
"이러한 용어는 그 구성 요소를 다른 구성 요소와 구별하기 위한 것일 뿐, 그 용어에 의해 해당 구성 요소의 본질이나 차례 또는 순서 등이 한정되지 않는다.]","These terms are intended to distinguish the component from other components, but non-limit the nature, turn, order or the like of the component.",True,0.2759829759597778,0.7957091724454142,25,23,2,87,144,-57
"[도1은 본 발명 의류처리장치의 외관을 도시한 것이며, 도2는 본 발명 의류처리장치의 내부 구조를 도시한 것이다.]","FIG. 1 shows an exterior of a laundry treatment apparatus according to the present disclosure, and FIG. 2 shows an inner structure of the laundry treatment apparatus according to the present disclosure.",True,0.2858963012695312,0.8327533571776475,15,32,-17,64,202,-138
"[도1은 본 발명 의류처리장치의 기본구성을 도시한 것이며, 도2는 본 발명 의류처리장치의 내부구조를 단면으로 도시한 것이다. ]","FIG. 1 shows a basic configuration of a laundry treatment apparatus according to the present disclosure, and FIG. 2 shows a cross-sectional view of an inner structure of the laundry treatment apparatus according to the present disclosure.",True,0.3140607476234436,0.8115503429713129,16,37,-21,71,238,-167
"[도1 및 도 2를 참조하면, 본 발명 의류처리장치(1)는 물을 저장하는 터브(120)와, 상기 터브(120) 내부에 회전 가능하게 구비되어 의류를 수용하는 드럼(130)과, 상기 터브(120) 하부에 결합되어 상기 드럼(130)을 회전시키는 구동부(150)를 포함할 수 있다.]","Referring to FIG. 1 and FIG. 2, a laundry treatment apparatus 100 according to the present disclosure may include a tub 120 storing water therein, a drum rotatably provided within the tub 120 to receive laundry therein, and a drive part 150 coupled to a bottom of the tub 120 to rotate the drum 130.",True,0.1809720396995544,0.9011493980015204,31,55,-24,156,299,-143
"[이때, 본 발명 의류처리장치는 상기 터브(120)를 구비하는 하우징(110,120)을 구비할 수 있다.","Here, the laundry treatment apparatus 100 according to the present disclosure may include a housing 110 and 120 provided with the tub 120.",True,0.2950391769409179,0.829979265789328,11,23,-12,58,138,-80
"상기 하우징(110,120)은 높이가 너비보다 작게 구비되는 박스형상으로 구비될 수 있다. ]",The housing 110 and 120 may be configured in a box shape having a height smaller than a width.,True,0.1461356431245803,0.9059312453204068,11,19,-8,52,94,-42
"[상기 하우징(110,120)은 상기 터브(120)를 수용하는 캐비닛(110)으로 구비될 수 있다.]",The housing 110 and 120 may include a cabinet 110 configured to receive the tub 120 therein.,True,0.2289393246173858,0.8626075395467675,9,17,-8,56,92,-36
[상기 캐비닛(110)은 높이가 너비보다 짧게 구비되는 박스형상으로 구비될 수 있다.],The cabinet 110 may be configured in a box shape having a height smaller than a width.,True,0.1717487573623657,0.88928997106313,10,17,-7,48,86,-38
"[한편, 상기 하우징(110,120)은 상기 터브(120)를 수용하며 상기 캐비닛(110)에 인출가능 하게 구비되는 드로워(120)로 구비될 수 있다.]","In some implementations, the housing 110 and 120 may include a drawer 120 configured to receive the tub 120 therein and provided to the cabinet 110 to be withdrawable therefrom.",True,0.3036651015281677,0.8279710019914474,15,30,-15,85,177,-92
"[다시말해, 본 발명 의류처리장치(100)는 도1 및 도 2에 도시된 바와 같이 드로워 타입으로 구비될 수 있다.","In other words, as shown in FIG. 1 and FIG. 2, the laundry treatment apparatus 100 according to the present disclosure may be a drawer type, by which the idea of the present disclosure is non-limited.",True,0.4315167963504791,0.7380599447088224,16,36,-20,63,200,-137
"그러나, 이는 일 실시예일 뿐, 본 발명의류처리장치(100)는 드로워를 배제하고 일반적인 캐비닛을 구비할 수도 있다.]","Alternatively, the laundry treatment apparatus 100 according to the present disclosure may include a general cabinet by excluding a drawer.",True,0.4854911565780639,0.7030933003651292,14,20,-6,66,139,-73
"[이하에서는, 본 발명 의류처리장치(100)가 캐비닛(110)에 인출 가능한 드로워(120)로 구비된 의류처리장치(100)로 이루어진 것을 기초로 하여 설명하기로 한다.",The following description will be made based on that the laundry treatment apparatus 100 according to the present disclosure includes a laundry treatment apparatus 100 having the cabinet 110 provided with the withdrawable drawer 120.,True,0.2825064957141876,0.8417669801303033,16,35,-19,94,233,-139
"기계 본체에 설치되어 작업구를 포함하는 복수의 프론트 부재를 갖는 작업 장치와,상기 기계 본체 및 상기 복수의 프론트 부재를 구동하는 복수의 액추에이터와,상기 복수의 액추에이터를 조작하는 조작 장치와,상기 기계 본체 및 상기 작업 장치의 자세 정보를 검출하는 자세 센서와,상기 조작 장치의 조작 정보를 검출하는 조작 센서와,소정의 목표 굴삭면을 따라 상기 작업구가 이동하도록 상기 작업 장치를 제어하는 굴삭 지원 제어 및 상기 복수의 프론트 부재 중 상기 작업 장치를 소정의 작업 영역으로부터 일탈시킬 수 있는 대상의 프론트 부재의 동작을 감속 또는 정지하여 상기 작업 영역으로부터의 상기 작업 장치의 일탈을 방지하는 일탈 방지 제어를 이용하여 상기 작업 장치를 제어 가능한 컨트롤러를 구비하고,상기 컨트롤러는, 상기 굴삭 지원 제어와 상기 일탈 방지 제어의 양쪽에서 상기 작업 장치를 제어하는 경우에는, 상기 작업구의 동작 방향이, 상기 굴삭 지원 제어만을 이용하여 상기 작업 장치를 제어한 경우의 상기 작업구의 동작 방향에 근접하도록 상기 작업 장치를 제어하는 것을 특징으로 하는 작업 기계.","A work machine comprising: a work implement that is attached to a machine body, and has a plurality of front implement members including a work tool; a plurality of actuators that drive the machine body and the plurality of front implement members; an operation device that operates the plurality of actuators; a posture sensor that senses postural data about the machine body and the work implement; an operation sensor that senses operation data about the operation device; and a controller that is capable of controlling the work implement by using excavation assistance control of controlling the work implement such that the work tool moves along a predetermined target excavation surface and deviation prevention control of preventing deviation of the work implement from a predetermined work area by decelerating or stopping operation of a subject front implement member that is included in the plurality of front implement members and that can deviate the work implement from the work area, wherein the controller is configured to control the work implement such that when the controller controls the work implement by using both the excavation assistance control and the deviation prevention control, an operation direction of the work tool approximates to an operation direction of the work tool that is to be generated when the work implement is controlled by using only the excavation assistance control.",True,0.2912855744361877,0.9004464427046421,141,223,-82,557,1416,-859
"제1항에 있어서, 상기 컨트롤러는, 상기 굴삭 지원 제어를 이용할 때, 상기 작업구가 상기 목표 굴삭면을 따라 동작하도록 상기 복수의 프론트 부재 중 적어도 2개의 프론트 부재에 관한 목표 속도를 상기 자세 정보 및 상기 조작 정보에 기초하여 연산하고,상기 일탈 방지 제어를 이용할 때, 상기 작업 장치가 상기 작업 영역으로부터 일탈하지 않도록 상기 대상의 프론트 부재에 관한 제한 속도를 상기 자세 정보에 기초하여 연산하고,상기 목표 속도가 연산된 상기 적어도 2개의 프론트 부재에 상기 대상의 프론트 부재가 포함되어 있고, 또한 상기 대상의 프론트 부재에 관한 목표 속도가 상기 대상의 프론트 부재에 관한 제한 속도를 초과할 때, 상기 목표 속도가 연산된 상기 적어도 2개의 프론트 부재로부터 상기 대상의 프론트 부재를 제외한 나머지의 프론트 부재에 관한 제한 속도를 상기 대상의 프론트 부재에 관한 제한 속도에 기초하여 연산하고,상기 대상의 프론트 부재에 관한 제한 속도와 상기 나머지의 프론트 부재에 관한 제한 속도에 기초하여 상기 적어도 2개의 프론트 부재의 동작을 제어하는 것을 특징으로 하는 작업 기계.","The work machine according to claim 1, wherein the controller is configured to compute, when the excavation assistance control is used, a target velocity related to at least two front implement members in the plurality of front implement members on a basis of the postural data and the operation data such that the work tool operates along the target excavation surface, compute, when the deviation prevention control is used, a limited velocity related to the subject front implement member on a basis of the postural data such that the work implement does not deviate from the work area, compute, when the at least two front implement members for which the target velocities have been computed include the subject front implement member and when a target velocity related to the subject front implement member exceeds the limited velocity related to the subject front implement member, a limited velocity related to a remaining front implement member that is included in the at least two front implement members for which the target velocities have been computed and that is not the subject front implement member on a basis of the limited velocity related to the subject front implement member, and control operation of the at least two front implement members on a basis of the limited velocity related to the subject front implement member and the limited velocity related to the remaining front implement member.",True,0.398745983839035,0.8923033862987354,149,232,-83,568,1418,-850
"제2항에 있어서, 상기 나머지의 프론트 부재에 관한 제한 속도는, 상기 대상의 프론트 부재에 관한 제한 속도와 상기 나머지의 프론트 부재에 관한 제한 속도에 의해 규정되는 상기 작업구의 동작 방향이, 상기 적어도 2개의 프론트 부재에 관한 목표 속도에 의해 규정되는 상기 작업구의 동작 방향에 근접하도록 연산되는 것을 특징으로 하는 작업 기계.","The work machine according to claim 2, wherein the limited velocity related to the remaining front implement member is computed such that an operation direction of the work tool defined by the limited velocity related to the subject front implement member and the limited velocity related to the remaining front implement member approximates to an operation direction of the work tool defined by the target velocities related to the at least two front implement members.",True,0.3028067052364349,0.9157749708046022,50,75,-25,192,470,-278
"제2항에 있어서, 상기 나머지의 프론트 부재에 관한 제한 속도는, 상기 대상의 프론트 부재에 관한 제한 속도와 상기 나머지의 프론트 부재에 관한 제한 속도에 의해 규정되는 상기 작업구의 동작 방향이, 상기 적어도 2개의 프론트 부재에 관한 목표 속도에 의해 규정되는 상기 작업구의 동작 방향과 일치하도록 연산되는 것을 특징으로 하는 작업 기계.","The work machine according to claim 2, wherein the limited velocity related to the remaining front implement member is computed such that an operation direction of the work tool defined by the limited velocity related to the subject front implement member and the limited velocity related to the remaining front implement member matches an operation direction of the work tool defined by the target velocities related to the at least two front implement members.",True,0.2915981709957123,0.9180576162025882,50,74,-24,192,462,-270
"제2항에 있어서, 상기 컨트롤러는, 상기 대상의 프론트 부재에 관한 목표 속도에 대한 상기 대상의 프론트 부재에 관한 제한 속도의 속도 비율인 기준 속도 비율을 연산하고,상기 목표 속도가 연산된 상기 적어도 2개의 프론트 부재로부터 상기 대상의 프론트 부재를 제외한 나머지의 프론트 부재에 관한 제한 속도를, 상기 나머지의 프론트 부재에 관한 목표 속도에 대한 상기 나머지의 프론트 부재에 관한 제한 속도의 속도 비율이 상기 기준 속도 비율에 일치하도록 연산하고,상기 대상의 프론트 부재에 관한 제한 속도와 상기 나머지의 프론트 부재에 관한 제한 속도에 기초하여 상기 적어도 2개의 프론트 부재의 동작을 제어하는 것을 특징으로 하는 작업 기계.","The work machine according to claim 2, wherein the controller is configured to compute a reference velocity ratio that is a velocity ratio of the limited velocity related to the subject front implement member to the target velocity related to the subject front implement member, compute the limited velocity related to the remaining front implement member that is included in the at least two front implement members for which the target velocities have been computed and that is not the subject front implement member such that a velocity ratio of the limited velocity related to the remaining front implement member to the target velocity related to the remaining front implement member matches the reference velocity ratio, and control operation of the at least two front implement members on a basis of the limited velocity related to the subject front implement member and the limited velocity related to the remaining front implement member.",True,0.4629709422588348,0.8794869127540866,93,152,-59,360,947,-587
"제5항에 있어서, 상기 컨트롤러는,상기 대상의 프론트 부재가 2개 이상인 경우, 그 2개 이상의 대상의 프론트 부재마다 속도 비율을 산출하고, 산출한 복수의 속도 비율 중에서 최소의 속도 비율을 상기 기준 속도 비율로 하는 것을 특징으로 하는 작업 기계.","The work machine according to claim 5, wherein the controller is configured to calculate a velocity ratio of each of two or more subject front implement members when there are two or more subject front implement members, and treat, as the reference velocity ratio, a velocity ratio that is smallest in a plurality of calculated velocity ratios.",True,0.4312019646167755,0.8536074095117255,37,57,-20,142,344,-202
"제2항에 있어서, 상기 컨트롤러가 상기 나머지의 프론트 부재에 관한 제한 속도를 상기 대상의 프론트 부재에 관한 제한 속도에 기초하여 연산한 때, 상기 대상의 프론트 부재 및 상기 나머지의 프론트 부재에 관한 속도가 상기 목표 속도로부터 저감되어 있는 것을 오퍼레이터에게 통보하는 통보 장치를 구비하는 것을 특징으로 하는 작업 기계.","The work machine according to claim 2, comprising: a notification device that notifies an operator that velocities related to the subject front implement member and the remaining front implement member are reduced from the target velocities when the controller has computed the limited velocity related to the remaining front implement member on a basis of the limited velocity related to the subject front implement member.",True,0.3853446841239929,0.8858679037470789,48,65,-17,186,424,-238
"제7항에 있어서, 상기 통보 장치는, 상기 나머지의 프론트 부재에 관한 제한 속도를 상기 대상의 프론트 부재에 관한 제한 속도에 기초하여 연산한 때, 상기 대상의 프론트 부재 및 상기 나머지의 프론트 부재를 오퍼레이터에게 통보하는 것을 특징으로 하는 작업 기계.","The work machine according to claim 7, wherein the notification device notifies an operator of the subject front implement member and the remaining front implement member when the limited velocity related to the remaining front implement member is computed on a basis of the limited velocity related to the subject front implement member.",True,0.314516544342041,0.8928076628750772,38,53,-15,146,338,-192
"제7항에 있어서, 상기 통보 장치는, 상기 컨트롤러가 상기 대상의 프론트 부재에 관한 제한 속도로서 제로를 산출하여 상기 대상의 프론트 부재의 동작이 정지한 때, 상기 대상의 프론트 부재의 동작이 정지하고 있는 것을 오퍼레이터에게 통보하는 것을 특징으로 하는 작업 기계.","The work machine according to claim 7, wherein the notification device notifies an operator that operation of the subject front implement member has been stopped when the controller has calculated zero as the limited velocity related to the subject front implement member and stopped operation of the subject front implement member.",True,0.3976294696331024,0.8466775438612565,38,51,-13,151,332,-181
"제2항에 있어서, 상기 컨트롤러는, 상기 대상의 프론트 부재에 관한 제한 속도를, 상기 대상의 프론트 부재에 설정된 감속도에 기초하여 산출하고 있고,상기 감속도는 변경 가능한 것을 특징으로 하는 작업 기계.","The work machine according to claim 2, wherein the controller calculates the limited velocity related to the subject front implement member on a basis of a degree of deceleration set for the subject front implement member, and the degree of deceleration is changeable.",True,0.3422823846340179,0.8788484964050837,28,43,-15,115,268,-153
"제1항에 있어서, 상기 컨트롤러가 상기 굴삭 지원 제어와 상기 일탈 방지 제어의 양쪽에서 상기 작업 장치를 제어하는 경우, 그 취지를 통보하는 통보 장치를 구비하는 것을 특징으로 하는 작업 기계.","The work machine according to claim 1, comprising: a notification device that notifies that the controller controls the work implement by using both the excavation assistance control and the deviation prevention control when such a situation occurs.",True,0.3681486248970032,0.8336163336823941,29,37,-8,109,249,-140
"제2항에 있어서, 상기 적어도 2개의 프론트 부재에 관한 목표 속도는, 상기 적어도 2개의 프론트 부재를 구동하는 적어도 2개의 액추에이터의 목표 속도이고,상기 대상의 프론트 부재에 관한 제한 속도는, 상기 대상의 프론트 부재를 구동하는 액추에이터의 제한 속도이고,상기 나머지의 프론트 부재에 관한 제한 속도는, 상기 나머지의 프론트 부재를 구동하는 액추에이터의 제한 속도이고,상기 컨트롤러는, 상기 대상의 프론트 부재를 구동하는 액추에이터의 제한 속도와 상기 나머지의 프론트 부재를 구동하는 액추에이터의 제한 속도에 기초하여, 상기 적어도 2개의 액추에이터의 속도를 제어하는 것을 특징으로 하는 작업 기계.","The work machine according to claim 2, wherein the target velocities related to the at least two front implement members are target velocities of at least two actuators that drive the at least two front implement members, the limited velocity related to the subject front implement member is a limited velocity of an actuator that drives the subject front implement member, the limited velocity related to the remaining front implement member is a limited velocity of an actuator that drives the remaining front implement member, and the controller is configured to control velocities of the at least two actuators on a basis of the limited velocity of the actuator that drives the subject front implement member and the limited velocity of the actuator that drives the remaining front implement member.",True,0.3367431461811065,0.9118789253198812,78,130,-52,340,803,-463
"제2항에 있어서, 상기 적어도 2개의 프론트 부재에 관한 목표 속도는, 상기 적어도 2개의 프론트 부재의 목표 속도이고,상기 대상의 프론트 부재에 관한 제한 속도는, 상기 대상의 프론트 부재의 제한 속도이고,상기 나머지의 프론트 부재에 관한 제한 속도는, 상기 나머지의 프론트 부재의 제한 속도이고,상기 컨트롤러는, 상기 대상의 프론트 부재의 제한 속도와 상기 나머지의 프론트 부재의 제한 속도에 기초하여, 상기 적어도 2개의 프론트 부재의 속도를 제어하는 것을 특징으로 하는 작업 기계.","The work machine according to claim 2, wherein the target velocities related to the at least two front implement members are target velocities of the at least two front implement members, the limited velocity related to the subject front implement member is a limited velocity of the subject front implement member, the limited velocity related to the remaining front implement member is a limited velocity of the remaining front implement member, and the controller is configured to control velocities of the at least two front implement members on a basis of the limited velocity of the subject front implement member and the limited velocity of the remaining front implement member.",True,0.3806208670139313,0.8979397480820485,67,110,-43,273,685,-412
도 11은 도 10에 도시된 차량용 램프 모듈 중 렌즈 점등 구조와 회로기판의 구조 모식도이다.,Further advantages as well as technical effects of preferred embodiments of the present invention will be further explained in the detailed description below.,False,1.0407503843307495,0.3386532828846966,15,23,-8,53,158,-105
도 15는 도 14의 A-A 단면도이다.,Brief Description of the Drawings,False,0.9451197385787968,0.2911074776201556,6,5,1,22,33,-11
도 17은 도 16의 a 부위의 부분 확대도이다.,"The following drawings, which serve to provide a further understanding of the present invention and constitute a part of this description, together with the detailed description below, serve to explain the present invention, but the scope of protection of the present invention is not limited to the following drawings and detailed description.",False,0.9730359315872192,0.2935525131338791,8,52,-44,27,344,-317
도 23은 본 발명의 네 번째 구체적 실시형태의 차량용 램프 광학 소자의 구조 모식도 2이다.,"In the drawings: Fig. 1 is a structural schematic diagram of one embodiment of an arrangement mode of vehicle lamp illumination modules in the prior art; Fig. 2 is a structural schematic diagram of a vehicle lamp optical element according to a first specific embodiment of the present invention; Fig. 3 is a structural schematic diagram of one specific embodiment of an assembly orientation of the vehicle lamp optical element shown in Fig. 2 and a circuit board; Fig. 4 is a light path diagram of a lens lightening structure shown in Fig. 3 formed in a longitudinal section of the vehicle lamp optical element; Fig. 5 is a light path diagram of the lens lightening structure shown in Fig. 3 formed in a transverse section of the vehicle lamp optical element; Fig. 6 is a first structural schematic diagram of a vehicle lamp optical element according to a second specific embodiment of the present invention; Fig. 7 is a second structural schematic diagram of the vehicle lamp optical element according to the second specific embodiment of the present invention; Fig. 8 is a structural schematic diagram of a first specific embodiment of a lens lightening light incoming surface in the vehicle lamp optical element shown in Fig. 7 ; Fig. 9 is a structural schematic diagram of a second specific embodiment of the lens lightening light incoming surface in the vehicle lamp optical element shown in Fig. 7 ; Fig. 10 is a structural schematic diagram of one specific embodiment of assembling the vehicle lamp optical element shown in Fig. 7 in a vehicle lamp module; Fig. 11 is a structural schematic diagram of the lens lightening structure and the circuit board in the vehicle lamp module shown in Fig. 10 ; Fig. 12 is a first structural schematic diagram of the vehicle lamp optical element, high beam light sources and a lens lightening light source in the vehicle lamp module shown in Fig. 10 ; Fig. 13 is a second structural schematic diagram of the vehicle lamp optical element, the high beam light sources and the lens lightening light source in the vehicle lamp module shown in Fig. 10 ; Fig. 14 is a top view of the vehicle lamp optical element, the high beam light sources and the lens lightening light source in the vehicle lamp module shown in Fig. 13 ; Fig. 15 is a cross sectional view taken along a line A-A in Fig. 14 ; Fig. 16 is a light path diagram of the vehicle lamp optical element shown in Fig. 7 ; Fig. 17 is an enlarged partial view of a part a in Fig. 16 ; Fig. 18 is a first structural schematic diagram of a vehicle lamp optical element according to a third specific embodiment of the present invention; Fig. 19 is a second structural schematic diagram of the vehicle lamp optical element according to the third specific embodiment of the present invention; Fig. 20 is a schematic diagram of a projected light shape of the lens lightening light source formed by the vehicle lamp optical element shown in Fig. 2 ; Fig. 21 is a schematic diagram of a projected light shape of the lens lightening light source formed by the vehicle lamp optical element shown in Fig. 18 ; Fig. 22 is a first structural schematic diagram of a vehicle lamp optical element according to a fourth specific embodiment of the present invention; Fig. 23 is a second structural schematic diagram of the vehicle lamp optical element according to the fourth specific embodiment of the present invention; Fig. 24 is a light path diagram of the vehicle lamp optical element according to the fourth specific embodiment of the present invention; Fig. 25 is a first structural schematic diagram of a vehicle lamp optical element according to a fifth specific embodiment of the present invention; Fig. 26 is a second structural schematic diagram of the vehicle lamp optical element according to the fifth specific embodiment of the present invention; Fig. 27 is a light path diagram of the vehicle lamp optical element according to the fifth specific embodiment of the present invention; Fig. 28 is a first structural schematic diagram of a vehicle lamp optical element according to a sixth specific embodiment of the present invention; Fig. 29 is a second structural schematic diagram of the vehicle lamp optical element according to the sixth specific embodiment of the present invention; Fig. 30 is a light path diagram of a transverse section of the vehicle lamp optical element according to the sixth specific embodiment of the present invention; Fig. 31 is a light path diagram of a longitudinal section of the vehicle lamp optical element according to the sixth specific embodiment of the present invention; and Fig. 32 is a light shape diagram of one specific embodiment of a vehicle headlamp of the present invention.",False,0.7038819193840027,0.6469182693120378,15,814,-799,52,4716,-4664
도 25는 본 발명의 다섯 번째 구체적 실시형태의 차량용 램프 광학 소자의 구조 모식도 1이다.,Description of reference signs: 1-light incoming part; 11-light incoming structure; 111-fight incoming surface; 12-lens lightening structure; 121-lens lightening light incoming surface; 122-first reflecting surface; 123-second reflecting surface; 124-first light channel; 125-second light channel; 2-transmission part; 21-light incoming end of transmission part; 22-light exiting end of transmission part; 3-light exiting part; 31-light exiting face; 4-light condensing structure; 5-circuit board; 51-high beam light source; 52-lens lightening light source; and M-vehicle lamp illumination module.,False,1.0212234258651731,0.4438030679829262,15,71,-56,53,597,-544
도 32는 본 발명의 차량용 헤드램프의 구체적 실시형태의 광 패턴도이다.],Detailed Description of the Embodiments,False,0.8528213500976562,0.4060216774121686,10,5,5,41,39,2
"[이하, 첨부된 도면과 함께 본 발명의 구체적인 실시형태를 상세히 설명한다.",Specific embodiments of the present invention are described in detail below with reference to the accompanying drawings.,True,0.1800888329744339,0.8772596370378585,10,17,-7,42,120,-78
여기에 설명된 구체적인 실시형태는 본 발명을 설명하고 해석하기 위한 것일 뿐 본 발명을 한정하기 위해 사용되지 않는다는 것을 이해해야 한다. ],"It should be understood that the specific embodiments described herein are for the purpose of illustrating and explaining the present invention only, and are not intended to limit the present invention.",True,0.2128017544746399,0.8452590096299422,21,31,-10,80,202,-122
"예를 들어, 차량용 램프 광학 소자를 예로 들면, 차량용 램프 광학 소자에서 하이빔 광원(51)에 근접되는 일단이 후방이고, 하이빔 광원(51)에서 멀어지는 일단이 전방이며; 또한 차량용 램프 광학 소자의 입광부(1)가 위치하는 일단이 후방이고, 출광부(3)가 위치하는 일단이 전방이며, 차량용 램프 광학 소자의 전후 방향에 대해, 차량용 램프 광학 소자의 좌우 양측으로 표현되는 방향이 좌우 방향이고, 차량용 램프 광학 소자의 상하 양측으로 표현되는 방향이 상하 방향인 것으로 이해할 수도 있다. ]","Firstly, it should be noted that, in the following description, for clarity of explanation of the technical solution of the present invention, some directional terms, such as ""front"", ""rear"", ""left"", ""right"", ""up"", ""down"", and the like, have meanings by analogy with the direction indicated by the light transmission direction, for example, with an example of a vehicle lamp optical element, the end, close to high beam light sources 51, of the vehicle lamp optical element is a rear end, and the end, away from the high beam light sources 51, of the vehicle lamp optical element is a front end; it can also be understood that the end where the light incoming part 1 of the vehicle lamp optical element is located is the rear end, the end where the light exiting part 3 of the vehicle lamp optical element is located is the front end, and relative to the front-back direction of the vehicle lamp optical element, the direction represented by the left side and the right side of the vehicle lamp optical element is a left-right direction, and the direction represented by the upper side and the lower side of the vehicle lamp optical element is an up-down direction.",False,0.4403154850006103,0.796027347358123,67,201,-134,280,1165,-885
"[본 발명의 설명에 있어서, 별도로 명확하게 규정 또는 한정하지 않는 한 용어 ""장착"", ""연결""은 넓은 의미로 이해하여야 하는 바, 예를 들어 고정 연결될 수도 있고, 착탈 가능하게 연결될 수도 있거나 일체로 연결될 수도 있으며, 직접적으로 연결될 수도 있고, 중간 매체를 통해 간접적으로 연결될 수도 있으며, 두 개의 소자 내부에서 연통되거나 두 개의 소자 간의 상호 작용 관계일 수도 있음에 유의해야 한다.","In the description of the present invention, it should be noted that, unless otherwise expressly stated or limited, the terms ""installation"" and ""connection"" are to be understood broadly, and for example, ""connection"" may be a fixed connection, a removable connection, or an integral connection; and may be a direct connection or an indirect connection through intermediary media, and may be an internal communication between two elements or an interaction between two elements.",True,0.1788805425167083,0.8870203230923153,61,72,-11,230,478,-248
당업자는 구체적인 상황에 따라 본 발명에서 상기 용어의 구체적인 의미를 이해할 수 있다.,The specific meanings of the foregoing terms in the present invention can be understood according to specific situations by those of ordinary skill in the art.,True,0.2038947641849517,0.8431887683929399,13,26,-13,49,159,-110
"이 밖에, 용어 ""제1"" 및 ""제2""는 설명의 목적으로만 사용될 뿐 상대적인 중요성을 지시 또는 암시하거나 지시된 기술적 특징의 수를 암시적으로 나타내는 것으로 이해해서는 안된다.","Moreover, the terms ""first"" and ""second"" are used for descriptive purposes only and are not to be construed as indicating or implying relative importance or implicitly indicating the number of technical features indicated, and therefore, a feature defined as ""first"" or ""second"" may expressly or implicitly include one or more of the described features.",False,0.1868760138750076,0.8782328401087856,24,54,-30,100,353,-253
"[또한 대향되는 측면 사이의 거리는 두 면 사이의 직선 거리를 의미하고; 중심축은 차량용 램프 광학 소자의 전후 방향을 따라 연장되어 출광부(3)의 초점을 통과하는 가상의 직선을 의미하며, 이는 광축으로도 지칭되고; 광 전송 방향은 중심축을 따라 입광부(1)에서 출광부(3)로 향하는 방향으로 정의된다.","It should also be noted that the distance between opposite side faces refers to the linear distance between two faces; a central axis is a virtual straight line which extends in the front-back direction of the vehicle lamp optical element and passes through the focal point of the light exiting part 3, and is also called an optical axis; and the light transmission direction is defined as the direction along the central axis and pointing from the light incoming part 1 to the light exiting part 3.",True,0.2590468525886535,0.8675719546223422,39,87,-48,169,499,-330
"차량용 램프 광학 소자의 횡단면은 중심축에 수직인 평면에 의해 절취된 차량용 램프 광학 소자의 단면으로 정의되고, 차량용 램프 광학 소자의 세로 단면은 중심축을 통과하는 수직 평면에 의해 절취된 차량용 램프 광학 소자의 단면으로 정의되며, 차량용 램프 광학 소자의 가로 단면은 중심축을 통과하는 수평 평면에 의해 절취된 차량용 램프 광학 소자의 단면으로 정의되고; 제1 광 채널(124)의 횡단면적은 제1 반사면(122)으로부터 제2 반사면(123)으로 연장되는 방향에 수직인 평면에 의해 절취된 제1 광 채널(124)의 단면 면적으로 정의됨에 유의해야 한다. ]","The cross section of the vehicle lamp optical element is defined as the section obtained by cutting the vehicle lamp optical element by a plane perpendicular to the central axis, the longitudinal section of the vehicle lamp optical element is defined as the section obtained by cutting the vehicle lamp optical element by a vertical plane passing through the center axis, and the transverse section of the vehicle lamp optical element is defined as the section obtained by cutting the vehicle lamp optical element by a horizontal plane passing through the central axis; and the cross sectional area of the first light channel 124 is defined as the cross sectional area obtained by cutting the first light channel 124 by a plane perpendicular to the direction extending from the first reflecting surface 122 to the second reflecting surface 123.",True,0.2041973918676376,0.9088296805375472,75,139,-64,315,844,-529
"[도 2, 도 6 내지 도 9, 도 18 및 도 19, 도 22 및 도 23, 도 25 및 도 26, 도 28 및 도 29에 도시된 바와 같이, 본 발명에 따른 차량용 램프 광학 소자는 순차적으로 설치되는 입광부(1), 전송부(2) 및 출광부(3)를 포함하고, 입광부(1)에는 적어도 하나의 입광 구조(11)가 설치되며, 전송부(2)에서 출광 방향을 따른 후단 및 선단은 각각 전송부 입광단(21) 및 전송부 출광단(22)이고, 출광부(3)에서 전송부 출광단(22)을 등진 일단은 출광면(31)을 형성하며, 출광면(31)은 전방으로 돌출된 곡면이고; 전송부(2)의 적어도 한 세트의 대향되는 측면 사이의 거리는 전송부 입광단(21)에 근접되는 일단으로부터 전송부 출광단(22)에 근접되는 일단으로 점차 증가된다. ]","The vehicle lamp optical element provided by the present invention, as shown in Fig. 2, Fig. 6 to Fig. 9, Fig. 18 and Fig. 19, Fig. 22 and Fig. 23, Fig. 25 and Fig. 26 as well as Fig. 28 and Fig. 29, includes a light incoming part 1, a transmission part 2 and a light exiting part 3 which are sequentially arranged, wherein the light incoming part 1 is provided with at least one light incoming structure 11, the rear end and the front end, in a light exiting direction, of the transmission part 2 are respectively a light incoming end 21 and a light exiting end 22 of the transmission part, one end, facing away from the light exiting end 22 of the transmission part, of the light exiting part 3 forms a light exiting face 31, and the light exiting face 31 is a curved face protruding forwards; and the distance between at least one set of opposite side faces of the transmission part 2 gradually increases from the end approaching the light incoming end 21 of the transmission part to the end approaching the light exiting end 22 of the transmission part.",True,0.2054980099201202,0.9058270748928832,93,196,-103,400,1057,-657
"[상술한 기본 기술적 해결수단의 차량용 램프 광학 소자는 입광부(1), 전송부(2) 및 출광부(3)를 일체로 집적하므로 집적화 정도가 높고, 분리된 1차 광학 소자 및 2차 광학 소자를 설치할 필요가 없으며 기타 불필요한 지지 장치도 장착할 필요가 없어 조립 관계가 간단할 뿐만 아니라 위치 결정 및 장착 오차도 크게 감소되어 차량용 램프 광학 소자의 부품 제조 정밀도 및 광학 시스템 정밀도를 향상시키고; 전송부(2)의 적어도 한 세트의 대향되는 측면은 후방으로부터 전방으로 점차 확대되는 사다리꼴 형상으로 이루어져 광선의 수집이 용이하며; 출광면(31)은 전방으로 돌출된 곡면으로 설정되고, 출광부(3)는 상기 출광면(31)을 통해 광선을 굴절시켜 하이빔을 형성한다. ]","According to the vehicle lamp optical element in the basic technical solution, the light incoming part 1, the transmission part 2 and the light exiting part 3 are integrated, the integration degree is high, a primary optical element and a secondary optical element which are separated are not needed to be arranged, other unnecessary supporting devices do not need to be installed, the assembly relation is simple, positioning and installation errors are greatly reduced, and the part manufacturing precision and the optical system precision of the vehicle lamp optical element are improved; at least one set of opposite side faces of the transmission part 2 is of the shape of a trapezoid which is gradually enlarged from back to front, so that light rays are convenient to collect; and the light exiting face 31 is arranged to be a curved face protruding forwards, and the light exiting part 3 refracts light rays through the light exiting face 31 to form high beam.",True,0.214203655719757,0.8997604570111871,89,162,-73,377,968,-591
"[하이빔 조명 모드에서 상술한 차량용 램프 광학 소자 중 입광 구조(11)는 이에 대응되게 설치된 광원 즉 후술되는 하이빔 광원(51)의 광선을 입광부(1)로 입사시키고 전송부(2)를 통해 출광부(3)에 전송하며, 출광부(3)는 출광면(31)을 통해 광선을 굴절시킨 후 하이빔을 형성하도록 방출한다.","When the vehicle lamp optical element is in a high beam illumination mode, light rays of light sources corresponding to the light incoming structures 11, namely high beam light sources 51 below, enter the light incoming part 1 through the light incoming structures 11, and are transmitted to the light exiting part 3 through the transmission part 2, and the light exiting part 3 refracts the light rays through the light exiting face 31 and then emits the light rays to form high beam.",True,0.3407602906227112,0.8422159838847488,35,84,-49,167,485,-318
"여기서, 출광부(3)는 종래 기술에서 하이빔 차량용 램프 모듈의 렌즈 부분이고, 대응되게, 로우빔 조명 모드에서 입광 구조(11)에 대응되는 하이빔 광원(51)은 오프되는데, 이때 상기 차량용 램프 광학 소자는 꺼진 상태이므로 차량용 램프의 조형 효과 및 미관에 영향을 미친다.","Wherein, the light exiting part 3 is a lens part of a high beam vehicle lamp module in the prior art, and correspondingly, in a low beam illumination mode, the high beam light sources 51 corresponding to the light incoming structures 11 are turned off, and at the moment, the vehicle lamp optical element is in a turned-off state, so that the modeling effect and the aesthetic degree of the vehicle lamp are influenced.",True,0.2723441421985626,0.8718444663386484,36,74,-38,155,419,-264
"따라서, 상술한 기본 기술적 해결수단의 첫 번째 바람직한 구조 형태로서, 도 2 내지 도 19에 도시된 바와 같이, 입광부(1)는 입광부(1)의 일측에 위치한 렌즈 점등 구조(12)를 더 포함하고, 렌즈 점등 구조(12)는 상기 렌즈 점등 구조(12)에 입사된 광선을 적어도 1회 반사시켜 전송부(2)에 전송하고 또한 전송부(2)를 통해 출광부(3)에 전송할 수 있다.","Therefore, as a first preferred structural form of the basic technical solution, as shown in Fig. 2 to Fig. 19, the light incoming part 1 further includes a lens lightening structure 12 located on one side of the light incoming part 1, and the lens lightening structure 12 is capable of transmitting light rays entering the lens lightening structure 12 to the transmission part 2 by at least one-time reflection and then the light rays transmit to the light exiting part 3 through the transmission part 2.",True,0.172166109085083,0.931054628580423,48,87,-39,206,505,-299
"렌즈 점등 구조(12)와 입광부(1)는 전송부(2) 및 출광부(3)를 공유하고, 도 3 내지 도 5, 도 16 및 도 17에 도시된 바와 같이, 로우빔 조명 모드에서, 렌즈 점등 구조(12)에 대응되는 광원, 즉 후술되는 렌즈 점등 광원(52)은 온 상태이며, 렌즈 점등 구조(12)는 상기 렌즈 점등 구조(12)에 입사된 광선을 반사한 후 전송부(2)를 통해 출광부(3)에 전달하여 로우빔 차량용 램프 모듈의 렌즈가 로우빔 광원에 의해 점등되는 동시에 하이빔 차량용 램프 모듈의 렌즈, 즉 출광부(3) 역시 점등된다.","The lens lightening structure 12 and the light incoming part 1 share the transmission part 2 and the light exiting part 3, as shown in Fig. 3 to Fig. 5 as well as Fig. 16 and Fig. 17, in the low beam illumination mode, a light source corresponding to the lens lightening structure 12, namely a lens lightening light source 52 below, is in a turned-on state, and the lens lightening structure 12 reflects light rays entering the lens lightening structure 12 and the reflected light rays transmit to the light exiting part 3 through the transmission part 2.",True,0.2632226049900055,0.8870941522785297,70,99,-29,290,555,-265
"이 밖에, 렌즈 점등 구조(12)는 하이빔 차량용 램프 모듈의 렌즈가 점등되는 시각적 효과만 형성할 뿐 하이빔 차량용 램프 모듈의 렌즈의 점등 휘도 및 범위가 로우빔의 광 패턴에 영향을 미치지 않도록 하여 차량용 램프 외형의 미관성을 향상시킨다.","While the lens of the low beam vehicle lamp module is lightened by the low beam light source, the lens, namely the light exiting part 3, of the high beam vehicle lamp module is also lightened, in addition, the lens lightening structure 12 enables the lightening brightness and range of the lens of the high beam vehicle lamp module not to affect a low beam shape, only the visual effect that the lens of the high beam vehicle lamp module is lightened is achieved, and the appearance attractiveness of the vehicle lamp is improved.",True,0.4429951608181,0.7894146397980699,36,94,-58,137,530,-393
"하이빔 조명 모드에서, 렌즈 점등 구조(12)에 대응되는 렌즈 점등 광원(52)은 온 상태이거나 오프 상태일 수 있다. ]","In the high beam illumination mode, the lens lightening light source 52 corresponding to the lens lightening structure 12 may be in a turned-on state or a turned-off state.",True,0.2132832556962967,0.8782811662196416,17,29,-12,68,172,-104
"[상술한 렌즈 점등 구조(12)의 기본 구조 형태로서, 도 2에 도시된 바와 같이, 렌즈 점등 구조(12)는 제1 반사면(122) 및 제2 반사면(123)을 포함하고, 제1 반사면(122)은 상기 제1 반사면(122)에 입사된 광선을 제2 반사면(123)에 반사할 수 있으며, 제2 반사면(123)은 제1 반사면(122)의 출사 광선을 전송부(2)에 반사할 수 있다.","As a basic structural form of the foregoing lens lightening structure 12, as shown in Fig. 2, the lens lightening structure 12 includes a first reflecting surface 122 and a second reflecting surface 123, the first reflecting surface 122 is capable of reflecting light rays entering the first reflecting surface 122 to the second reflecting surface 123, and the second reflecting surface 123 is capable of reflecting emergent light rays of the first reflecting surface 122 to the transmission part 2.",True,0.1425495147705078,0.9427956412010434,43,81,-38,205,499,-294
"제1 반사면(122)과 제2 반사면(123)은 일체로 형성되거나 별도로 독립적으로 설치될 수도 있으며, 제2 반사면(123)은 입광부(1)와 일체로 형성되어 제1 반사면(122)의 출사 광선을 보다 효율적으로 전송부(2)에 전송함과 동시에 차량용 램프 광학 소자의 구조를 보다 안정화하는 것이 바람직하다.","The first reflecting surface 122 and the second reflecting surface 123 may be integrally formed or separately and independently arranged, and the second reflecting surface 123 is preferably integrally formed with the light incoming part 1, so that the emergent light rays of the first reflecting surface 122 are transmitted to the transmission part 2 more efficiently, and meanwhile, the structure of the vehicle lamp optical element is more stable.",True,0.1717377603054046,0.9274419780584304,34,70,-36,170,449,-279
"이 경우, 렌즈 점등 구조(12)에 대응되는 광원은 점등된 후 출광부(3)를 통해 투사되어 도 20에 도시된 광 패턴을 형성할 수 있다. ]","At the moment, the light source corresponding to the lens lightening structure 12 is turned on and then projected by the light exiting part 3 to form a light shape as shown in Fig. 20.",True,0.3381163775920868,0.827730547337479,21,35,-14,78,184,-106
"[상술한 렌즈 점등 구조(12)의 구체적 구조 형태로서, 도 6 및 도 7에 도시된 바와 같이, 렌즈 점등 구조(12)는 제1 반사면(122)과 대응되게 설치된 렌즈 점등 입광면(121), 제1 광 채널(124) 및 제2 광 채널(125)을 더 포함하고, 제1 반사면(122)은 렌즈 점등 입광면(121)의 입사 광선을 반사한 후 제1 광 채널(124)을 통해 제2 반사면(123)으로 전송하며, 제2 반사면(123)의 출사 광선은 제2 광 채널(125)을 통해 전송부(2)로 전송된다.","As a specific structural form of the lens lightening structure 12, as shown in Fig. 6 and Fig. 7, the lens lightening structure 12 further includes a lens lightening light incoming surface 121, a first light channel 124 and a second light channel 125, the lens lightening light incoming surface 121 corresponds to the first reflecting surface 122, the first reflecting surface 122 reflects incident light rays of the lens lightening light incoming surface 121 and then the reflected incident light rays transmit to the second reflecting surface 123 through the first light channel 124, and emergent light rays of the second reflecting surface 123 are transmitted to the transmission part 2 through the second light channel 125.",True,0.1633659303188324,0.9337424246553084,60,118,-58,272,727,-455
"제1 광 채널(124) 및 제2 광 채널(125)을 설치함으로써 렌즈 점등 구조(12)의 광선 수집에 보다 이롭고, 렌즈 점등 입광면(121)에 의해 도입된 광선은 전송부(2)로 더 잘 안내된다. ]","Due to arrangement of the first light channel 124 and the second light channel 125, the lens lightening structure 12 is more beneficial to collecting light rays, and the light rays imported by the lens lightening light incoming surface 121 are better guided to the transmission part 2.",True,0.163982093334198,0.9266729471311552,26,48,-22,111,285,-174
"[바람직하게는, 제1 광 채널(124)의 일단은 제1 반사면(122)에 연결되고, 타단은 제2 반사면(123)에 연결되며, 제1 광 채널(124)의 횡단면적은 제1 반사면(122)에 근접되는 일단으로부터 제2 반사면(123)에 근접되는 일단으로 점차 증가된다.","Preferably, one end of the first light channel 124 is connected to the first reflecting surface 122 while the other end of the first light channel 124 is connected to the second reflecting surface 123, and the cross sectional area of the first light channel 124 gradually increases from the end approaching the first reflecting surface 122 to the end approaching the second reflecting surface 123.",True,0.1711375564336776,0.9219678876315436,26,66,-40,145,397,-252
"제2 반사면(123)의 면적이 제1 반사면(122)의 면적보다 크므로 이때 제1 광 채널(124)은 제1 반사면(122)에서 제2 반사면(123)으로 원활하게 과도할 수 있으며, 나아가 렌즈 점등 입광면(121)에 의해 도입된 광선에 대한 제1 광 채널(124)의 수집 효율을 향상시킨다. ]","Based on the fact that the area of the second reflecting surface 123 is larger than that of the first reflecting surface 122, the first light channel 124 can be smoothly transitioned from the first reflecting surface 122 to the second reflecting surface 123 at the moment, and the collection efficiency of the first light channel 124 on light rays imported by the lens lightening light incoming surface 121 is further improved.",True,0.1842368096113205,0.912414845567068,34,72,-38,163,427,-264
"[구체적으로, 도 6 및 도 7, 도 18 및 도 19에 도시된 바와 같이, 제1 반사면(122)은 제2 반사면(123)의 상부에 위치하고, 제1 광 채널(124)의 좌측면과 우측면 사이의 거리는 제1 반사면(122)에 근접되는 일단으로부터 제2 반사면(123)에 근접되는 일단으로 점차 증가된다.","Specifically, as shown in Fig. 6 and Fig 7 as well as Fig. 18 and Fig. 19, the first reflecting surface 122 is located above the second reflecting surface 123, and the distance between the left side surface and the right side surface of the first light channel 124 gradually increases from the end approaching the first reflecting surface 122 to the end approaching the second reflecting surface 123.",True,0.14543516933918,0.9290208074154008,37,69,-32,166,400,-234
"이 경우, 렌즈 점등 광원(52)의 광선은 렌즈 점등 입광면(121)을 통해 제1 반사면(122)으로 입사되고, 제1 반사면(122)을 통해 반사된 후 제1 광 채널(124)에 진입되어 제2 반사면(123)으로 전송되며, 다시 제2 반사면(123)을 통해 반사된 후 제2 광 채널(125)에 진입되어 전송부(2)로 전송되고, 마지막으로 전송부(2)를 통해 출광부(3)로 전송된 후 출광면(31)으로부터 방출되어 하이빔 차량용 램프 모듈의 렌즈, 즉 출광부(3)가 발광되도록 한다. ]","At the moment, the light rays of the lens lightening light source 52 enter the first reflecting surface 122 through the lens lightening light incoming surface 121, enter the first light channel 124 to be transmitted to the second reflecting surface 123 after being reflected by the first reflecting surface 122, then enter the second light channel 125 to be transmitted to the transmission part 2 after being reflected by the second reflecting surface 123, and finally are transmitted to the light exiting part 3 through the transmission part 2 to be emitted from the light exiting face 31.",False,0.1886304765939712,0.9190009997156938,55,99,-44,270,590,-320
"[렌즈 점등 입광면(121)은 구조가 간단하고 제조성이 우수한 평면으로 설정하는 것이 바람직하며, 이 밖에, 도 8에 도시된 바와 같이, 렌즈 점등 입광면(121)은 볼록 곡면일 수도 있다.","The lens lightening light incoming surface 121 is preferably arranged as a plane, and has a simple structure and good manufacturability, and in addition, the lens lightening light incoming surface 121 may also be a convex curved surface as shown in Fig. 8.",True,0.1585546880960464,0.9214286958223978,25,43,-18,106,256,-150
"선택 가능하게, 도 9에 도시된 바와 같이, 렌즈 점등 입광면(121)에는 집광 구조(4)가 설치되고, 상기 집광 구조(4)는 도 8에 도시된 바와 같이 볼록 곡면을 이루는 입광면(121)에 오목 캐비티를 개설하여 입사 광선이 상기 집광 구조(4)를 통해 제1 반사면(122)에 더 많이 입사될 수 있도록 함으로써 렌즈 점등 구조(12)의 광선 이용률을 향상시킨다. ]","Optionally, as shown in Fig. 9, a light condensing structure 4 is arranged at the lens lightening light incoming surface 121, and the light condensing structure 4 is provided with a concave cavity in the light incoming surface 121 which is in a convex curved surface as shown in Fig. 8, so that more incident light rays can be emitted to the first reflecting surface 122 through the light condensing structure 4, and the utilization rate of the light rays by the lens lightening structure 12 is improved.",True,0.1406878530979156,0.9366986776716694,49,88,-39,206,504,-298
"제1 반사면(122)과 제2 반사면(123)을 보다 잘 매칭시키기 위해, 상술한 렌즈 점등 구조(12)의 구체적 구조의 바람직한 형태로서, 제1 반사면(122)은 렌즈 점등 입광면(121)으로 돌출된 호면으로, 제1 반사면(122)의 반사 광선이 좌우 양측으로 확산될 수 있어 제2 반사면(123)을 통해 반사된 후 출광부(3)를 통해 투사된 출사 광 패턴이 보다 균일해진다.","The first reflecting surface 122 may be a plane or a cambered surface, or a combination of the plane and the cambered surface, and in order to make the first reflecting surface 122 and the second reflecting surface 123 be better matched, the first reflecting surface 122 is a cambered surface protruding towards the lens lightening light incoming surface 121 as a preferred form of the specific structure of the lens lightening structure 12, so that the reflected light rays of the first reflecting surface 122 can be diffused to the left side and the right side, and the shape of the emergent light reflected by the second reflecting surface 123 and projected by the light exiting part 3 is more uniform.",False,0.2807789146900177,0.8843386306481522,45,122,-77,210,705,-495
"이 경우, 제1 반사면(122)의 호면 구조를 이용하여 제1 반사면(122)의 반사 광선을 좌우 양측으로 더 잘 확산시킬 수 있도록, 제1 반사면(122)과 렌즈 점등 입광면(121)에 의해 형성된 협각은 바람직하게는 90° 미만이다.","At the moment, the included angle formed between the first reflecting surface 122 and the lens lightening light incoming surface 121 is preferably less than 90 degrees, so that the reflected light rays of the first reflecting surface 122 can be better diffused to the left side and the right side by utilizing the cambered surface structure of the first reflecting surface 122.",True,0.2190689742565155,0.8993928892403567,29,63,-34,131,377,-246
"보다 바람직하게는, 제1 반사면(122)에는 또한 피문(skin textures) 또는 소광 치아가 설치됨으로써 제1 반사면(122)의 표면이 거칠거나 고르지 않게 되어 제1 반사면(122)의 반사 광선이 더 발산되어 출광부(3)를 통해 투사된 광 패턴이 보다 균일해진다.","Further preferably, skin textures or extinction teeth are further arranged on the first reflecting surface 122, so that the surface of the first reflecting surface 122 is rough or uneven, reflected light rays of the first reflecting surface 122 are more divergent, and the light shape of the reflected light rays projected by the light exiting part 3 is more uniform.",True,0.178044706583023,0.9175767838524952,31,61,-30,152,367,-215
"여기서, 소광 치아는 제1 반사면(122)에서 오목부와 볼록부가 교대로 형성된 치아형 구조이다. ]","Wherein, the extinction teeth are of tooth-shaped structures which are arranged on the first reflecting surface 122 and are concave and convex alternately.",True,0.2998395264148712,0.798527724316253,12,23,-11,55,155,-100
"[렌즈 점등 구조(12)의 광선 반사 효율을 향상시키기 위해서는 제1 반사면(122)에 반사 강화층을 설치하여 렌즈 점등 구조(12)의 광학 효율을 향상시키는 것이 보다 바람직하며, 여기서 반사 강화층은 알루미늄 도금, 반사 강화 필름 또는 반사 강화 코팅 등으로 설정할 수 있다.","In order to improve the light ray reflection efficiency of the lens lightening structure 12, more preferably, a reflection increasing layer is arranged on the first reflecting surface 122 to improve the optical efficiency of the lens lightening structure 12, wherein the reflection increasing layer may be an aluminized layer, reflection increasing film or reflection increasing coating or the like.",True,0.09975466132164,0.9554102093446952,38,60,-22,157,399,-242
"보다 더 바람직하게는, 제2 반사면(123)은 제1 반사면(122)으로부터 멀어지는 방향으로 돌출된 호면으로, 이에 의해 반사된 광선은 제2 광 채널(125)을 통해 전송부(2)에 진입된 후 최대한 많이 출광부(3)로 진입될 수 있어 제2 반사면(123)에 의해 광선이 출광부(3) 이외의 영역으로 반사되는 것을 방지함으로써 출광부(3)의 점등 효과를 향상시키고, 아울러 반사 광선이 출광부(3) 내로 적당히 반사되도록 제2 반사면(123)의 폭을 합리적으로 설정하여 출광부(3) 가장자리 영역의 광속을 확보하고, 출광 효과 및 출사된 광 패턴의 균일성에도 유리하다.","Further preferably, the second reflecting surface 123 is a cambered surface protruding towards the direction away from the first reflecting surface 122, so that the reflected light rays can enter the light exiting part 3 as much as possible after entering the transmission part 2 through the second light channel 125, the second reflecting surface 123 is prevented from reflecting the light rays to the area outside the light exiting part 3, the lightening effect of the light exiting part 3 is improved, and meanwhile, the width of the second reflecting surface 123 is reasonably set, so that the reflected light rays can be just reflected into the light exiting part 3, the luminous flux of the edge area of the light exiting part 3 is ensured, and the light exiting effect and the uniformity of the light shape of emergent light are also facilitated.",True,0.1608434915542602,0.9296389203363012,67,145,-78,317,853,-536
"이 경우, 렌즈 점등 구조(12)에 대응되는 광원은 점등된 후 출광부(3)를 통해 투사되어 도 21에 도시된 광 패턴을 형성할 수 있으며, 이는 도 20에 도시된 렌즈 점등 구조(12)의 기본 구조 형태에 비해 광 패턴의 균일성이 크게 향상된다.","At the moment, the light source corresponding to the lens lightening structure 12 is turned on and projected by the light exiting part 3 to form a light shape shown in Fig. 21, and the uniformity of the light shape is obviously improved compared with the basic structural form of the lens lightening structure 12 shown in Fig. 20.",True,0.3453817665576935,0.8399673647665775,36,59,-23,137,330,-193
"제2 반사면(123)은 평면, 볼록면 또는 다른 형태의 오목면 구조로 설정될 수 있음에 유의해야 한다. ]","It should be noted that the second reflecting surface 123 may be arranged as a plane, a convex surface, or a concave surface structure in other form.",True,0.1671647876501083,0.8974478699148064,15,27,-12,59,149,-90
"[상술한 차량용 램프 광학 소자의 기본 기술적 해결수단의 두 번째 바람직한 구조 형태로서, 전송부(2)는 전송부 입광단(21)에 근접되어서부터 전송부 출광단(22)에 근접되어서까지 횡단면적이 점차 증가된다.","As a second preferred structural form of the basic technical solution of the vehicle lamp optical element, the cross sectional area of the transmission part 2 gradually increases from the position approaching the light incoming end 21 of the transmission part to the position approaching the light exiting end 22 of the transmission part.",True,0.2229808419942855,0.8949194463776035,23,54,-31,115,338,-223
"이 경우, 차량용 램프 광학 소자는 후단이 작고 선단이 크며, 후단은 입광부(1)로 설정되고, 선단에서 전방으로 돌출된 곡면은 출광면(31)이므로, 입광부(1)를 통해 도입된 광은 전송부(2)에 의해 더 잘 수집되어 출광면(31)에 투사되며, 아울러 출광면(31)의 출광 요구를 충족시키는 전제 하에 차량용 램프 광학 소자의 부피는 적응적으로 축소될 수 있다.]","At the moment, the rear end of the vehicle lamp optical element is smaller while the front end of the vehicle lamp optical element is larger, the rear end of the vehicle lamp optical element is arranged to be the light incoming part 1, and the front end of the vehicle lamp optical element protrudes forwards to form a curved surface which is the light exiting face 31, so that light guided in through the light incoming part 1 can be better collected by the transmission part 2 and projected to the light exiting face 31; and meanwhile, under the premise of meeting the light exiting requirement of the light exiting face 31, the size of the vehicle lamp optical element may be adaptively reduced.",True,0.260036438703537,0.8820846018984129,45,125,-80,202,698,-496
"여기서, 각 픽셀의 적응적 가중치 r(y)는 전술한 것과 같이 관심 영역(ROI)을 반영한 픽셀 와이즈 맵에 해당할 수도 있고, 또는 0 또는 1의 값을 갖는 이진 마스크, 혹은 관심 영역의 경계 부분에서는 점진적으로 변화되는 실수 값을 갖는 가중치일 수도 있다.]","The reconstructed image R(D1(E(x)))·r(y) may correspond to a partial region (first partial region) of the training image x, for example, an ROI of the training image x.",False,0.5606856942176819,0.6725491956827725,39,27,12,148,168,-20
"[트레이닝 장치(600)는 가중치 r(y)에 의해 적응적으로 복원된 영상 R(D, Sub[attributes={}; value=[1]], (E(x)))·r(y)과 트레이닝 영상(x) 간의 차이(예를 들어, Diff(R(D, Sub[attributes={}; value=[1]], (E(x)))·r(y), x))로 정의된 복원 손실(Reconstruction Loss)을 산출할 수 있다(770). 여기서, 복원 영상 R(D, Sub[attributes={}; value=[1]], (E(x)))·r(y)은 트레이닝 영상(x)의 관심(ROI) 영역과 같이 트레이닝 영상(x)의 부분 영역('제1 부분 영역')에 해당할 수 있다.]","In operation 780, the training apparatus 600 may train an ANN to minimize the reconstruction loss together with the above-described target loss.",False,0.7186852097511292,0.5744742824286603,50,22,28,351,144,207
"[트레이닝 장치(600)는 전술한 타겟 손실과 함께 복원 손실이 최소화되도록 인공 신경망을 트레이닝할 수 있다(780). 트레이닝 장치(600)는 예를 들어, 전체 트레이닝 데이터 전체 집합에 대한 타겟 손실과 복원 손실의 합(예를 들어, 가중합(Weighted Sum))이 최소화되도록 인공 신경망을 트레이닝할 수 있다. ]","For example, the training apparatus 600 may train the ANN to minimize a sum (for example, a weighted sum) of a reconstruction loss and a target loss for a full set of training data.",False,0.3278900682926178,0.8250938233394548,39,34,5,182,181,1
"[도 6의 실시예에 따른 트레이닝 장치(600)는 동일한 디코더(630)를 공유하고, 마지막 결과(예를 들어, C(D, Sub[attributes={}; value=[1]], (E(x))) 및 R(D, Sub[attributes={}; value=[1]], (E(x))))만을 두 가지로 나누어 생성하기 때문에 트레이닝해야 할 인공 신경망의 가중치의 수가 증가하지 않으므로 인공 신경망의 부하를 줄일 수 있다.]","Since the training apparatus 600 uses the same decoder D1 630 and separately generates two last results (for example, the classified class C(D1(E(x))) and the reconstruction image R(D1(E(x)))), a number of weights of the ANN that are trained is less than a training apparatus that uses an additional second decoder, for example.",False,0.3656280040740967,0.7977395683248469,40,52,-12,230,328,-98
"[도 8은 또다른 실시예에 따른 트레이닝 장치의 구성을 도시한 도면이고, 도 9는 도 8에 도시된 트레이닝 장치의 트레이닝 과정을 나타낸 흐름도이다. ]","FIG. 8 illustrates an example of a configuration of a training apparatus 800, and FIG. 9 illustrates an example of a training process of a training apparatus (for example, the training apparatus 800 of FIG. 8 ).",True,0.3826578259468078,0.7722089429235809,22,37,-15,85,211,-126
"[도 8을 참조하면, 일 실시예에 따른 트레이닝 장치(800)는 인코더(810) 및 디코더(D, Sub[attributes={}; value=[2]], )(830)를 포함할 수 있다.","Referring to FIG. 8, the training apparatus 800 may include an encoder E 810 and a decoder D2 830.",False,0.2468297481536865,0.866001336437968,17,19,-2,102,98,4
"이때, 인코더(810)의 적어도 일부 레이어는 분류기(Classifier)(C)(820)로 동작할 수 있다.]",At least a portion of layers of the encoder E 810 may operate as a classifier C 820.,True,0.2381810247898101,0.8525279007322002,9,18,-9,61,84,-23
"[트레이닝 장치(800)는 예를 들어, 트레이닝 영상(x)과 트레이닝영상(x)에 대응하는 타겟 레이블(또는 정답 레이블)(y)으로 구성된 {Input x, Target y}의 페어를 수신할 수 있다(910). 트레이닝 장치(800)는 트레이닝 영상(x)을 인코더(E)(810)에 통과시켜 트레이닝 영상(x)에 대응하는 임베딩 벡터 E(x)을 추출할 수 있다(920). ]","In operation 910, the training apparatus 800 may receive a pair {Input x, Target y} of a training image x and a target label or a true label y corresponding to the training image x.",False,0.3550289571285248,0.8017955671144719,37,35,2,207,181,26
[트레이닝 장치(800)는 임베딩 벡터 E(x)을 분류기(C)(820)에 통과시킴으로써 임베딩 벡터 E(x)에 대응하는 클래스 C(E(x))을 분류(classification)할 수 있다(930). ],"In operation 930, the training apparatus 800 may classify a class C(E(x)) corresponding to the embedding vector E(x) by allowing the embedding vector E(x) to pass through the classifier C 820.",True,0.1896554976701736,0.8897237697596837,17,31,-14,112,192,-80
"[트레이닝 장치(800)는 분류된 클래스 C(E(x))와 트레이닝 영상(x)에 대응하는 타겟 레이블(또는 정답 레이블)(y)(960) 간의 차이(예를 들어, Diff(C(E(x)), y))에 해당하는 타겟 손실을 산출할 수 있다(950).]","In operation 950, the training apparatus 800 may calculate a target loss corresponding to a difference (for example, Diff(C(E(x)), y)) between the classified class C(E(x)) and a target label or a true label y 960 corresponding to the training image x.",True,0.2161004245281219,0.8795703621093686,23,41,-18,134,251,-117
"[트레이닝 장치(800)는 인코더(E)(810)에서 추출된 임베딩 벡터 E(x)을 디코더(D, Sub[attributes={}; value=[2]], )(830)에 통과(940)시켜 복원 영상 D, Sub[attributes={}; value=[2]], (E(x))을 생성할 수 있다(945). 디코더(D, Sub[attributes={}; value=[2]], )(830)는 예를 들어, 도 4를 통해 전술한 적응적 복원 디코더(D, Sub[attributes={}; value=[2]], )(430)와 같이 동작할 수 있다.","The training apparatus 800 may allow the embedding vector E(x) extracted from the encoder E 810 to pass through the decoder D2 830 in operation 940, and may thereby generate a reconstruction image D2(E(x)) in operation 945.",False,0.2642383277416229,0.8544702816512564,41,37,4,295,223,72
"이때, 트레이닝 장치(800)는 임베딩 벡터 E(x)로부터, 픽셀 와이즈 맵 r(E(x))을 정의하여 복원 영상 D, Sub[attributes={}; value=[2]], (E(x))에 곱함으로써 관심 영역과 같은 중요한 정보에 가중치가 부여되는 것과 같은 효과를 나타낼 수 있다.","In this example, the training apparatus 800 may multiply the reconstruction image D2(E(x)) by a pixel-wise map r(E(x)) defined from the embedding vector E(x), to obtain the same effect as if a weight is assigned to important information, for example, an ROI.",False,0.2403087466955185,0.8659981892001536,31,42,-11,158,258,-100
"이때, 픽셀 와이즈 맵 r(E(x))은 특징 활성화 영역들의 조합에 해당하며, 관심 영역(ROI)을 반영한 것일 수 있다.]","Also, the pixel-wise map r(E(x)) may correspond to a combination of feature activation regions, and may reflect an ROI.",True,0.2100290358066558,0.8654023685171041,16,19,-3,69,119,-50
[도 8 및 도 9에 따른 실시예에서는 트레이닝 영상(x)에 대응하는 타겟 레이블(또는 정답 레이블)(y)(960)을 이용하므로 타겟 영상이 존재하지 않으므로 픽셀 와이즈 정보에 기초한 가중치를 바로 정의할 수 없다.,"Since the target label or the true label y 960 corresponding to the training image x is used in the examples of FIGS. 8 and 9, a target image may be absent.",True,0.3023349046707153,0.8102333479156529,28,32,-4,121,156,-35
"때문에, 도 8 및 도 9의 실시예에서는 분류를 위해 추출된 특징의 활성 정보(예를 들어, 특징 활성화 영역들)를 활용하여 가중치에 해당하는 픽셀 와이즈 맵 r(E(x))를 정의할 수 있다. ]","However, even when a weight based on pixel-wise information is not directly defined because target image is absent, the training apparatus 800 may define the pixel-wise map r(E(x)) based on activation information (for example, feature activation regions) of features extracted for classification in the examples of FIGS. 8 and 9.",True,0.3805534243583679,0.7751707502467469,28,50,-22,108,329,-221
"[트레이닝 장치(800)는 관심 영역(ROI)을 반영한 픽셀 와이즈 맵 r(E(x))에 의해 적응적으로 복원된 영상 D, Sub[attributes={}; value=[2]], (E(x))r(E(x))과 트레이닝 영상(x) 간의 차이(예를 들어, Diff(D, Sub[attributes={}; value=[2]], (E(x))r(E(x)), x)로 정의된 복원 손실(Reconstruction Loss)을 산출할 수 있다(970). 여기서, 적응적으로 복원된 영상 D, Sub[attributes={}; value=[2]], (E(x))r(E(x)은 트레이닝 영상(x)의 관심(ROI) 영역과 같이 트레이닝 영상(x)의 부분 영역('제1 부분 영역')에 해당할 수 있다.]","In operation 970, the training apparatus 800 may calculate a reconstruction loss defined as a difference (for example, Diff(D2(E(x))·r(E(x)), x)) between the training image x and an image D2(E(x))·r(E(x)) that is adaptively reconstructed by the pixel-wise map r(E(x)) reflecting the ROI.",False,0.2727942168712616,0.8485983382555413,56,41,15,377,287,90
"[트레이닝 장치(800)는 전술한 타겟 손실과 함께 복원 손실이 최소화되도록 인공 신경망을 트레이닝할 수 있다(980). 트레이닝 장치(800)는 예를 들어, 트레이닝 데이터의 전체 집합에 대한 타겟 손실과 복원 손실의 합(예를 들어, 가중합(Weighted Sum))이 최소화되도록 인공 신경망을 트레이닝할 수 있다. ]","For example, the training apparatus 800 may train the ANN to minimize a sum (for example, a weighted sum) of a reconstruction loss and a target loss for a full set of training data.",False,0.2876280844211578,0.8483553057868747,38,34,4,180,181,-1
[도 10은 일 실시예에 따른 추론 장치의 블록도이다.,FIG. 10 illustrates an example of an inference apparatus 1000.,True,0.5623688697814941,0.6423650703039775,8,10,-2,30,62,-32
"도 10을 참조하면, 일 실시예에 따른 추론 장치(1000)는 통신 인터페이스(1010), 프로세서(1030), 및 메모리(1050)를 포함한다.","Referring to FIG. 10, the inference apparatus 1000 includes the communication interface 1010, a processor 1030 (for example, one or more processors), and a memory 1050 (for example, one or more memories).",True,0.196796104311943,0.898247313579609,14,32,-18,81,204,-123
"통신 인터페이스(1010), 프로세서(1030), 및 메모리(1050)는 통신 버스(1005)를 통해 서로 통신할 수 있다.","The communication interface 1010, the processor 1030, and the memory 1050 may be connected to each other via a communication bus 1005.",True,0.0910146161913871,0.9480925813787048,12,22,-10,69,134,-65
"추론 장치(1000)는 예를 들어, HUD(Head Up Display) 장치, 3D 디지털 정보 디스플레이(Digital Information Display, DID), 내비게이션 장치, 3D 모바일 기기, 및 스마트 차량 등에 해당할 수 있다. ]","The inference apparatus 1000 may correspond to, for example, a HUD, a 3D DID, a navigation apparatus, a 3D mobile apparatus or a smart vehicle.",True,0.1902205348014831,0.8927760392236042,28,25,3,140,143,-3
[통신 인터페이스(1010)는 입력 데이터를 수신한다.,The communication interface 1010 may receive an input image.,True,0.3255310952663421,0.7769899491692313,5,9,-4,30,60,-30
"입력 데이터는 예를 들어, 영상 데이터일 수도 있고, 또는 음성 데이터일 수도 있다.","The input data may be, for example, image data or voice data.",True,0.1429686546325683,0.912682961887214,13,12,1,47,61,-14
"영상 데이터는 예를 들어, 차량의 주행 중에 전방 및/또는 좌우를 촬영한 주행 영상 등을 포함할 수 있으며, 반드시 이에 한정되지는 않는다.","The image data may include, but is not limited to, for example, a traveling image acquired by capturing front, rear, left and/or right sides of a vehicle while the vehicle is traveling.",True,0.2359791249036789,0.8624837269015299,21,32,-11,78,185,-107
"음성 데이터는 예를 들어, 일정 시간 구간 동안 발화된 화자의 음성 등을 포함할 수 있으며, 반드시 이에 한정되지는 않는다. ]","The voice data may include, but is not limited to, for example, voice of a speaker uttered during a predetermined period of time.",True,0.1697564274072647,0.8890461773489294,20,23,-3,71,129,-58
"[프로세서(1030)는 통신 인터페이스(1010)를 통해 수신한 입력 데이터에 반응하여 인공 신경망이 활성화되는 상태 정보에 기초하여, 입력 데이터로부터 추론된 정보를 제공한다.","The processor 1030 may provide information inferred from the input data based on state information about a state in which an ANN is activated, in response to the input data received by the communication interface 1010.",True,0.200315922498703,0.880896816048299,19,36,-17,99,218,-119
"이때, 추론된 정보는 예를 들어, 관심 영역에 해당하는 객체를 포함하는 영상, 관심 대상에 해당하는 화자의 음성 등을 포함할 수 있다.]","The inferred information may include, for example, an image including an object corresponding to an ROI, or voice of a speaker corresponding to a target of interest.",True,0.3238262832164764,0.8069807972386109,20,27,-7,76,165,-89
"[이때, 인공 신경망의 적어도 일부를 이용하여 입력 데이터를 인코딩 함으로써 생성되는 임베딩 벡터는 입력 데이터 내의 제1 부분 영역을 제1 정확도 로 복원하고, 입력 데이터 내의 제2 부분 영역을 제2 정확도로 복원하는 정보를 포함한다.",An embedding vector generated by encoding input data using at least a portion of the ANN may include information that is used to reconstruct a first partial region in the input data with a first accuracy and reconstruct a second partial region in the input data with a second accuracy.,True,0.2507947087287903,0.8511658045093777,34,50,-16,133,285,-152
"또한, 제1 부분 영역은 프로세서(1030)에 의해 추론된 정보 및 인공 신경망에서 활성화되는 상태 정보 중 적어도 하나에 대응하여 적응적으로 결정된다. ]",The first partial region may be adaptively determined based on at least one of the state information and the inferred information by the processor 1030.,True,0.3699069023132324,0.7731444907462026,21,25,-4,87,152,-65
"[메모리(1050)는 예를 들어, 통신 인터페이스(1010)를 통해 수신한 입력 데이터 및/또는 프로세서(1030)에 의해 입력 데이터로부터 추론된 정보를 저장할 수 있다.","The memory 1050 may store the input data received by the communication interface 1010, and/or the information inferred from the input data by the processor 1030.",True,0.1701817959547042,0.9111395921934516,19,26,-7,96,161,-65
"또한, 메모리(1050)는 입력 데이터에 반응하여 인공 신경망이 활성화되는 상태 정보 및/또는 프로세서(1030)가 입력 데이터를 인코딩 함으로써 생성되는 임베딩 벡터를 저장할 수 있다. ]","Also, the memory 1050 may store the state information about the state in which the ANN is activated in response to the input data and/or the embedding vector generated by encoding the input data by the processor 1030.",True,0.1807546317577362,0.9020263662580502,23,38,-15,106,217,-111
"[또한, 메모리(1050)는 상술한 프로세서(1030)의 처리 과정에서 생성되는 다양한 정보들을 저장할 수 있다.","Also, the memory 1050 may store a variety of information generated in a processing process of the processor 1030.",True,0.1005651205778122,0.9433612886719088,12,19,-7,63,113,-50
"이 밖에도, 메모리(1050)는 각종 데이터와 프로그램 등을 저장할 수 있다.","In addition, the memory 1050 may store a variety of data and programs.",True,0.1456400901079177,0.9103338532870738,10,13,-3,43,70,-27
메모리(1050)는 휘발성 메모리 또는 비휘발성 메모리를 포함할 수 있다.,"The memory 1050 may include, for example, a volatile memory or a non-volatile memory.",True,0.1884049624204635,0.8862816902709507,9,14,-5,41,85,-44
메모리(1050)는 하드 디스크 등과 같은 대용량 저장 매체를 구비하여 각종 데이터를 저장할 수 있다.],The memory 1050 may include a large-capacity storage medium such as a hard disk to store a variety of data.,True,0.1619459837675094,0.9032603960576902,14,20,-6,58,107,-49
"[또한, 프로세서(1030)는 도 1 내지 도 9를 통해 전술한 적어도 하나의 방법 또는 적어도 하나의 방법에 대응되는 알고리즘을 수행할 수 있다.","Also, the processor 1030 may perform any one or any combination of the methods described above with reference to FIGS. 1 through 9 or an algorithm corresponding to at least one of the methods.",True,0.1433119475841522,0.9218274706819116,21,34,-13,82,192,-110
프로세서(1030)는 목적하는 동작들(desired operations)을 실행시키기 위한 물리적인 구조를 갖는 회로를 가지는 하드웨어로 구현된 데이터 처리 장치일 수 있다.,The processor 1030 may be a hardware-implemented data processing device having a circuit that is physically structured to execute desired operations.,True,0.0965111851692199,0.9462519915186678,18,21,-3,97,149,-52
"예를 들어, 목적하는 동작들은 프로그램에 포함된 코드(code) 또는 인스트럭션들(instructions)을 포함할 수 있다.","For example, the desired operations may include code or instructions included in a program.",True,0.1809379011392593,0.8935771956284698,12,14,-2,70,91,-21
"예를 들어, 하드웨어로 구현된 데이터 처리 장치는 마이크로프로세서(microprocessor), 중앙 처리 장치(central processing unit), 프로세서 코어(processor core), 멀티-코어 프로세서(multi-core processor), 멀티프로세서(multiprocessor), ASIC(Application-Specific Integrated Circuit), FPGA(Field Programmable Gate Array)를 포함할 수 있다.]","The hardware-implemented data processing device may include, for example, a microprocessor, a central processing unit (CPU), a processor core, a multi-core processor, a multiprocessor, an application-specific integrated circuit (ASIC), and a field-programmable gate array (FPGA).",True,0.1192059516906738,0.9395498237707336,30,35,-5,266,279,-13
[실시예에 따른 방법은 다양한 컴퓨터 수단을 통하여 수행될 수 있는 프로그램 명령 형태로 구현되어 컴퓨터 판독 가능 매체에 기록될 수 있다.,"In other examples, one or more of the hardware components that perform the operations described in this application are implemented by computing hardware, for example, by one or more processors or computers.",False,0.8451052308082581,0.4852526580128585,21,32,-11,78,207,-129
"상기 컴퓨터 판독 가능 매체는 프로그램 명령, 데이터 파일, 데이터 구조 등을 단독으로 또는 조합하여 포함할 수 있다.","In one example, a processor or computer includes, or is connected to, one or more memories storing instructions or software that are executed by the processor or computer.",False,0.7085085511207581,0.5912290388838018,18,28,-10,66,171,-105
상기 매체에 기록되는 프로그램 명령은 실시예를 위하여 특별히 설계되고 구성된 것들이거나 컴퓨터 소프트웨어 당업자에게 공지되어 사용 가능한 것일 수도 있다.,"The hardware components may also access, manipulate, process, create, and store data in response to execution of the instructions or software.",False,0.7124003171920776,0.5551295080248843,20,21,-1,86,142,-56
"컴퓨터 판독 가능 기록 매체의 예에는 하드 디스크, 플로피 디스크 및 자기 테이프와 같은 자기 매체(magnetic media), CD-ROM, DVD와 같은 광기록 매체(optical media), 플롭티컬 디스크(floptical disk)와 같은 자기-광 매체(magneto-optical media), 및 롬(ROM), 램(RAM), 플래시 메모리 등과 같은 프로그램 명령을 저장하고 수행하도록 특별히 구성된 하드웨어 장치가 포함된다.","A hardware component may have any one or more of different processing configurations, examples of which include a single processor, independent processors, parallel processors, single-instruction single-data (SISD) multiprocessing, single-instruction multiple-data (SIMD) multiprocessing, multiple-instruction single-data (MISD) multiprocessing, and multiple-instruction multiple-data (MIMD) multiprocessing.",False,0.8538801074028015,0.5025352974227933,46,41,5,247,408,-161
프로그램 명령의 예에는 컴파일러에 의해 만들어지는 것과 같은 기계어 코드뿐만 아니라 인터프리터 등을 사용해서 컴퓨터에 의해서 실행될 수 있는 고급 언어 코드를 포함한다.,"The methods illustrated in FIGS. 1-10 that perform the operations described in this application are performed by computing hardware, for example, by one or more processors or computers, implemented as described above executing instructions or software to perform the operations described in this application that are performed by the methods.",False,0.5929048657417297,0.6613034164423222,23,50,-27,94,342,-248
"상기된 하드웨어 장치는 실시예의 동작을 수행하기 위해 하나 이상의 소프트웨어 모듈로서 작동하도록 구성될 수 있으며, 그 역도 마찬가지이다.]","One or more processors, or a processor and a controller, may perform a single operation, or two or more operations.",False,0.8332849740982056,0.4578927429539834,18,20,-2,78,115,-37
"[소프트웨어는 컴퓨터 프로그램(computer program), 코드(code), 명령(instruction), 또는 이들 중 하나 이상의 조합을 포함할 수 있으며, 원하는 대로 동작하도록 처리 장치를 구성하거나 독립적으로 또는 결합적으로(collectively) 처리 장치를 명령할 수 있다.","Instructions or software to control computing hardware, for example, one or more processors or computers, to implement the hardware components and perform the methods as described above may be written as computer programs, code segments, instructions or any combination thereof, for individually or collectively instructing or configuring the one or more processors or computers to operate as a machine or special-purpose computer to perform the operations that are performed by the hardware components and the methods as described above.",False,0.4695917665958404,0.7366666481781967,29,79,-50,164,538,-374
"소프트웨어 및/또는 데이터는, 처리 장치에 의하여 해석되거나 처리 장치에 명령 또는 데이터를 제공하기 위하여, 어떤 유형의 기계, 구성요소(component), 물리적 장치, 가상 장치(virtual equipment), 컴퓨터 저장 매체 또는 장치, 또는 전송되는 신호 파(signal wave)에 영구적으로, 또는 일시적으로 구체화(embody)될 수 있다.","In one example, the instructions or software include machine code that is directly executed by the one or more processors or computers, such as machine code produced by a compiler.",False,0.8139855265617371,0.5333322595463597,39,30,9,202,180,22
"소프트웨어는 네트워크로 연결된 컴퓨터 시스템 상에 분산되어서, 분산된 방법으로 저장되거나 실행될 수도 있다.","The instructions or software to control computing software, for example, one or more processors or computers, to implement the hardware components and perform the methods as described above, and any associated data, data files, and data structures, may be recorded, stored, or fixed in or on one or more non-transitory computer-readable storage media.",False,0.752066314220432,0.5436205593124607,13,53,-40,60,351,-291
소프트웨어 및 데이터는 하나 이상의 컴퓨터 판독 가능 기록 매체에 저장될 수 있다.],"In one example, the instructions or software and any associated data, data files, and data structures are distributed over network-coupled computer systems so that the instructions and software and any associated data, data files, and data structures are stored, accessed, and executed in a distributed fashion by the one or more processors or computers.",False,0.7290653586387634,0.5502423889091811,13,54,-41,47,354,-307
"[이상과 같이 실시예들이 비록 한정된 도면에 의해 설명되었으나, 해당 기술분야에서 통상의 지식을 가진 자라면 상기를 기초로 다양한 기술적 수정 및 변형을 적용할 수 있다.","While this disclosure includes specific examples, it will be apparent after an understanding of the disclosure of this application that various changes in form and details may be made in these examples without departing from the scope of the claims.",False,0.5298992991447449,0.6352782868089476,24,40,-16,95,249,-154
"예를 들어, 설명된 기술들이 설명된 방법과 다른 순서로 수행되거나, 및/또는 설명된 시스템, 구조, 장치, 회로 등의 구성요소들이 설명된 방법과 다른 형태로 결합 또는 조합되거나, 다른 구성요소 또는 균등물에 의하여 대치되거나 치환되더라도 적절한 결과가 달성될 수 있다.]","Suitable results may be achieved if the described techniques are performed in a different order, and/or if components in a described system, architecture, device, or circuit are combined in a different manner, and/or replaced or supplemented by other components or their equivalents.",False,0.1906706392765045,0.8921902892636122,36,42,-6,152,283,-131
"[그러므로, 다른 구현들, 다른 실시예들 및 특허청구범위와 균등한 것들도 후술하는 청구범위의 범위에 속한다.]","Therefore, the scope of the disclosure is defined not by the detailed description, but by the claims, and all variations within the scope of the claims are to be construed as being included in the disclosure.",False,0.7697890996932983,0.4726085707459719,13,36,-23,61,208,-147
"사용자 장치에서 세컨더리 노드를 추가한 이후, 상기 세컨더리 노드(secondary node)가 상기 사용자 장치의 히스토리 정보를 기록하는 단계를 포함하는 정보 관리 방법.","An information management method, comprising: recording, after a secondary node is added to user equipment, history information for the user equipment by the secondary node.",True,0.3319481909275055,0.8631820015423951,21,25,-4,97,173,-76
"청구항 1에 있어서,상기 세컨더리 노드가 마스터 노드(Master node)로부터 발송되는 기타 세컨더리 노드에서의 상기 사용자 장치의 히스토리 정보를 수신할 경우 상기 기타 세컨더리 노드에서의 상기 사용자 장치의 히스토리 정보를 저장하는 단계를 더 포함하는 정보 관리 방법.","The information management method of claim 1, further comprising: storing, in response to the secondary node receiving history information for the user equipment under other secondary nodes sent by a master node, the history information for the user equipment under the other secondary nodes.",True,0.3494481444358825,0.8774315985803326,35,44,-9,154,292,-138
"청구항 1에 있어서, 상기 세컨더리 노드는 세컨더리 노드 변경 또는 수정 과정에 상기 사용자 장치의 히스토리 정보를 마스터 노드로 발송하는 단계를 더 포함하는 정보 관리 방법.","The information management method of claim 1, further comprising: sending, by the secondary node, the history information for the user equipment to a master node, in a secondary node change or modify process.",True,0.3384097218513489,0.887552414062994,26,33,-7,98,208,-110
"청구항 3에 있어서, 상기 세컨더리 노드에서 상기 마스터 노드로 발송된 히스토리 정보는, 상기 세컨더리 노드가 자체 기록한 상기 사용자 장치의 히스토리 정보를 포함하거나, 또는 상기 세컨더리 노드가 자체 기록한 상기 세컨더리 노드에서의 상기 사용자 장치의 히스토리 정보 및 상기 세컨더리 노드가 수신한 상기 기타 세컨더리 노드에서의 상기 사용자 장치의 히스토리 정보를 포함하는 정보 관리 방법.","The information management method of claim 3, wherein the history information sent by the secondary node to the master node comprises: the history information for the user equipment, which is recorded by the secondary node; or the history information for the user equipment under the secondary node, which is recorded by the secondary node; and the history information for the user equipment under the other secondary nodes, which is received by the secondary node.",True,0.3779627680778503,0.8654757117294997,55,74,-19,220,465,-245
마스터 노드가 세컨더리 노드 변경 또는 수정 과정에 사용자 장치의 히스토리 정보를 세컨더리 노드로 발송하는 단계를 포함하는 정보 관리 방법.,"An information management method, comprising: sending, by a master node, history information for user equipment to a secondary node, in a secondary node change or modify process.",True,0.4112401306629181,0.8412158626787752,20,27,-7,78,178,-100
"청구항 5에 있어서, 상기 마스터 노드가 소스 세컨더리 노드（source secondary node）로부터 상기 사용자 장치의 히스토리 정보를 획득하는 단계를 더 포함하는 정보 관리 방법.","The information management method of claim 5, further comprising: acquiring, by the master node, the history information for the user equipment, from a source secondary node.",True,0.220220148563385,0.9163145635588212,23,26,-3,105,174,-69
"청구항 5 또는 청구항 6에 있어서,상기 마스터 노드가 세컨더리 노드 변경 또는 수정 과정에 사용자 장치의 히스토리 정보를 세컨더리 노드로 발송하는 단계는, 상기 마스터 노드가 세컨더리 노드 변경 또는 수정 과정에 상기 사용자 장치의 히스토리 정보를 목표 세컨더리 노드로 발송하는 단계를 포함하는 정보 관리 방법.","The information management method of claim 5 or claim 6, wherein sending, by the master node, the history information for the user equipment to the secondary node in the secondary node change or modify process comprises: sending, by the master node, the history information for the user equipment to a target secondary node, in the secondary node change or modify process.",True,0.3093908429145813,0.9011839307472672,45,61,-16,175,372,-197
"청구항 5 또는 청구항 6에 있어서,상기 마스터 노드가 세컨더리 노드 변경 또는 수정 과정에 사용자 장치의 히스토리 정보를 세컨더리 노드로 발송하는 단계는,상기 마스터 노드가 소스 마스터 노드이고, 상기 소스 마스터 노드가 세컨더리 노드 변경 또는 수정 과정에 상기 사용자 장치의 히스토리 정보를 목표 마스터 노드로 발송하고, 상기 목표 마스터 노드가 상기 사용자 장치의 히스토리 정보를 목표 세컨더리 노드로 발송하는 단계를 포함하는 정보 관리 방법.","The information management method of claim 5 or claim 6, wherein, the master node is a source master node; and sending, by the master node, the history information for the user equipment to the secondary node in the secondary node change or modify process comprises: sending, by the source master node, the history information for the user equipment to a target master node, in the secondary node change or modify process, and sending, by the target master node, the history information for the user equipment to a target secondary node.",True,0.2775135040283203,0.9095197570150138,64,90,-26,252,537,-285
"세컨더리 노드가 세컨더리 노드 변경을 개시할 경우, 사용자 장치의 히스토리 정보에 따라 목표 세컨더리 노드를 선택하는 단계를 포함하는 세컨더리 노드 변경 방법.","A secondary node changing method, comprising: selecting, in response to a secondary node initiating secondary node change, a target secondary node according to history information for user equipment.",True,0.4374155700206756,0.7927403537361958,22,28,-6,89,199,-110
"청구항 9에 있어서, 상기 세컨더리 노드가 마스터 노드로부터 상기 사용자 장치의 히스토리 정보를 획득하는 단계를 더 포함하는 세컨더리 노드 변경 방법.","The secondary node changing method of claim 9, further comprising: acquiring, by the secondary node, the history information for the user equipment from a master node.",True,0.3086268603801727,0.8833063241923622,21,26,-5,84,167,-83
"메모리 및 프로세서를 포함하고,상기 메모리에는 상기 프로세서에 의해 판독되어 실행될 때, 청구항 1 내지 청구항 8 중 어느 한 항에 따른 정보 관리 방법을 구현하는 프로그램이 저장되는 노드.","Anode comprising a memory and a processor, wherein the memory stores a program which, when read and executed by the processor, causes the processor to perform an information management method of any one of claims 1 to 8.",True,0.1897412091493606,0.9129100132786706,28,38,-10,107,220,-113
청구항 1 내지 청구항 8 중 어느 한 항에 따른 정보 관리 방법을 구현하도록 하나 또는 복수의 프로세서에 의해 실행 가능한 하나 또는 복수의 프로그램이 저장되는 컴퓨터 판독 가능한 저장 매체.,"A computer-readable storage medium, wherein the computer-readable storage medium stores one or more programs which are executable by one or more processors to implement an information management method of any one of claims 1 to 8.",True,0.1251643002033233,0.9424054071205662,31,36,-5,108,230,-122
"메모리 및 프로세서를 포함하고, 상기 메모리에는 상기 프로세서에 의해 판독되어 실행될 때, 청구항 9 또는 청구항 10에 따른 세컨더리 노드 변경 방법을 구현하는 프로그램이 저장되는 노드.","A node comprising a memory and a processor, wherein the memory stores a program which, when read and executed by the processor, causes the processor to perform a secondary node changing method of claim 9 or claim 10.",True,0.2598309814929962,0.881692235515504,26,38,-12,105,216,-111
청구항 9 또는 청구항 10에 따른 세컨더리 노드 변경 방법을 구현하도록 하나 또는 복수의 프로세서에 의해 실행 가능한 하나 또는 복수의 프로그램이 저장되는 컴퓨터 판독 가능한 저장 매체.,"A computer-readable storage medium, wherein the computer-readable storage medium stores one or more programs which are executable by one or more processors to implement a secondary node changing method of claim 9 or claim 10.",True,0.1933581978082656,0.9151068656267164,28,35,-7,105,225,-120
"또는, 에어로졸 생성 물품(20000)의 제 2 부분에도 에어로졸 생성 물질이 포함될 수도 있다.","For example, the aerosol-generating article 20000 may be divided into a first portion including an aerosol generating material and a second portion including a filter, etc. Alternatively, the second portion of the aerosol generating article 20000 may also include an aerosol generating material.",True,0.5146557092666626,0.7449243502744062,13,43,-30,54,295,-241
"예를 들어, 과립 또는 캡슐의 형태로 만들어진 에어로졸 생성 물질이 제 2 부분에 삽입될 수도 있다.]","For example, an aerosol generating material made in the form of granules or capsules may be inserted into the second portion.",True,0.156427726149559,0.9100344796959192,16,21,-5,57,125,-68
"[에어로졸 생성 장치(10000)의 내부에는 제 1 부분의 전체가 삽입되고, 제 2 부분은 외부에 노출될 수 있다.","The entire first portion may be inserted into the aerosol generating device 10000, and the second portion may be exposed to the outside.",True,0.1742683798074722,0.8980415283767513,16,23,-7,64,136,-72
"또는, 에어로졸 생성 장치(10000)의 내부에 제 1 부분의 일부만 삽입될 수도 있고, 제 1 부분의 전체 및 제 2 부분의 일부가 삽입될 수도 있다.","Alternatively, only a portion of the first portion may be inserted into the aerosol generating device 10000, or the entire first portion and a portion of the second portion may be inserted into the aerosol generating device 10000.",True,0.1628361642360687,0.9148812862929376,24,38,-14,85,230,-145
사용자는 제 2 부분을 입으로 문 상태에서 에어로졸을 흡입할 수 있다.,The user may puff aerosol while holding the second portion by the mouth of the user.,True,0.1970176547765731,0.8610618570197952,11,16,-5,39,84,-45
"이때, 에어로졸은 외부 공기가 제 1 부분을 통과함으로써 생성되고, 생성된 에어로졸은 제 2 부분을 통과하여 사용자의 입으로 전달된다. ]","In this case, the aerosol is generated by the external air passing through the first portion, and the generated aerosol passes through the second portion and is delivered to the user's mouth.",True,0.1641967147588729,0.8991570540389971,19,32,-13,77,191,-114
"[일 예로서, 외부 공기는 에어로졸 생성 장치(10000)에 형성된 적어도 하나의 공기 통로를 통하여 유입될 수 있다.","For example, the external air may flow into at least one air passage formed in the aerosol generating device 10000.",True,0.1717721372842788,0.9075719806252384,16,20,-4,66,115,-49
"예를 들어, 에어로졸 생성 장치(10000)에 형성된 공기 통로의 개폐 및/또는 공기 통로의 크기는 사용자에 의하여 조절될 수 있다.","For example, opening and closing of the air passage and/or a size of the air passage formed in the aerosol generating device 10000 may be adjusted by the user.",True,0.1179157197475433,0.936150035782045,18,29,-11,74,159,-85
"이에 따라, 무화량, 끽연감 등이 사용자에 의하여 조절될 수 있다.","Accordingly, the amount of smoke and a smoking impression may be adjusted by the user.",True,0.2417469173669815,0.8247500740738705,10,15,-5,37,86,-49
"다른 예로서, 외부 공기는 에어로졸 생성 물품(20000)의 표면에 형성된 적어도 하나의 구멍(hole)을 통하여 에어로졸 생성 물품(20000)의 내부로 유입될 수도 있다.]","As another example, the external air may flow into the aerosol-generating article 20000 through at least one hole formed in a surface of the aerosol-generating article 20000.",True,0.1117344200611114,0.9415997379231784,20,27,-7,98,174,-76
[도 5는 예시적인 실시예에 따른 에어로졸 생성 물품을 도시한 도면이다.],FIG. 5 is a diagram illustrating an aerosol-generating article according to an example embodiment.,True,0.2193976789712906,0.865214578572372,10,14,-4,41,98,-57
"[도 5를 참조하면, 에어로졸 생성 물품(20000)은 에어로졸 생성부(210), 담배 매질부(220), 냉각부(230), 필터부(240) 및 래퍼(250)를 포함할 수 있다.","Referring to FIG. 5, an aerosol-generating article 20000 may include an aerosol generating section 210, a tobacco medium section 220, a cooling section 230, a filter section 240, and a wrapper 250.",True,0.1710813045501709,0.915969342576328,17,32,-15,98,197,-99
"전술한 제 1 부분은 에어로졸 생성부(210) 및 담배 매질부(220)를 포함하고, 제 2 부분은 냉각부(230) 및 필터부(240)를 포함할 수 있다.]","The first portion described above may include the aerosol generating section 210 and the tobacco medium section 220, and the second portion may include the cooling section 230 and the filter section 240.",True,0.1405306905508041,0.9265697488803302,19,33,-14,86,203,-117
"[에어로졸 생성부(210)는 담배 매질부(220)의 상류에 배치되고, 보습제가 도포된 비담배 물질의 시트를 포함할 수 있다.",The aerosol generating section 210 is located upstream of the tobacco medium section 220 and may include a sheet of non-tobacco material to which a moisturizer is applied.,True,0.2521552443504333,0.8680080171246034,14,28,-14,69,171,-102
보습제는 에어로졸 생성 물질에 대응될 수 있다.,The moisturizer may correspond to an aerosol generating material.,True,0.2378684431314468,0.8433189326103976,7,9,-2,26,65,-39
"예를 들어, 보습제는 글리세린, 프로필렌 글리콜, 에틸렌 글리콜, 디프로필렌 글리콜, 디에틸렌 글리콜, 트리에틸렌 글리콜, 테트라에틸렌 글리콜 및 올레일 알코올 중 적어도 하나를 포함할 수 있으나, 이에 한정되지 않는다.","For example, the moisturizer may include, but is not limited to, at least one of glycerin, propylene glycol, ethylene glycol, dipropylene glycol, diethylene glycol, triethylene glycol, tetraethylene glycol, and oleyl alcohol.",True,0.1513863056898117,0.9065523646825864,28,31,-3,123,225,-102
"비담배 물질은 담배 물질이 아닌 물질로서, 보습제를 흡수할 수 있는 고분자 소재 또는 셀룰로오스 물질일 수 있다.","The non-tobacco material is a material that is not a tobacco material, and may be a polymer material or a cellulosic material capable of absorbing a moisturizer.",True,0.2376254349946975,0.8439962509551542,17,27,-10,63,161,-98
"예를 들어, 비담배 물질의 시트는 고온으로 가열되더라도 열에 의한 이취가 발생되지 않는 종이 시트일 수 있다.","For example, the sheet of non-tobacco material may be a paper sheet that does not generate off-flavor due to heat even when heated to a high temperature.",True,0.2567293643951416,0.8388251987731509,16,27,-11,61,153,-92
"다만, 이에 제한되는 것은 아니다.]","However, the sheet of non-tobacco material is not limited thereto.",True,0.5238450169563293,0.5844818150411456,5,10,-5,20,66,-46
"[한편, 에어로졸 생성부(210)는 권축되거나 압착됨에 따라 주름진 시트를 포함할 수 있고, 권축되지 않은 채로 말려진 시트를 포함할 수도 있다.","On the other hand, the aerosol generating section 210 may include a wrinkled sheet as the sheet is crimped or compressed, or may include a sheet rolled without crimping.",True,0.2120100557804107,0.8822319832047111,19,29,-10,81,169,-88
"다만, 이에 제한되는 것은 아니며, 에어로졸 생성부(210)는 임의의 적절한 형태를 갖는 비담배 물질의 시트를 포함할 수 있다.","However, the aerosol generating section 210 is not limited thereto, and the aerosol generating section 210 may include a sheet of non-tobacco material having any suitable shape.",True,0.2304431945085525,0.8794610631515152,17,27,-10,71,177,-106
"에어로졸 생성부(210)는 풍미제, 습윤제 등과 같은 다른 첨가 물질을 함유할 수 있다.","The aerosol generating section 210 may include other additive substances such as flavoring agents, wetting agents, and the like.",True,0.1271584331989288,0.9303845092433326,12,19,-7,49,128,-79
"예를 들어, 멘솔 또는 보습제 등의 가향액이 에어로졸 생성부(210)에 분사됨으로써 첨가될 수 있다.]","For example, a flavoring liquid such as menthol or a moisturizer may be added by being sprayed onto the aerosol generating section 210.",True,0.1554062962532043,0.9137998573250278,13,23,-10,57,135,-78
[담배 매질부(220)는 담배 분말 및 열전도성 분말을 포함하는 혼합물로부터 제조될 수 있다.,The tobacco medium section 220 may be manufactured from a mixture including tobacco powder and thermally conductive powder.,True,0.2343673557043075,0.8647422097585638,12,18,-6,52,123,-71
"혼합물은 첨가제, 바인더 및 보습제 중 적어도 하나를 더 포함하고, 담배 매질부(220)는 혼합물에 물을 첨가하여 배합함에 따라 생성되는 슬러리를 시트 형태로 건조한 뒤, 성형하는 방식으로 제조될 수 있다.","The mixture may further include at least one of an additive, a binder, and a moisturizer, and the tobacco medium section 220 may be manufactured in a manner that a slurry, which is produced by adding water to a mixture and mixing the water with the mixture, is dried in a sheet form and then shaped.",True,0.2630828320980072,0.8454228850680892,28,56,-28,115,299,-184
"예를 들어, 혼합물은 담배 분말, 열전도성 금속 분말(예를 들어, 알루미늄), 비담배 섬유 첨가제(예를 들어, 펄프) 및 외인성 바인더(예를 들어, 구아검)를 고형분으로 포함하고, 보습제(예를 들어, 글리세린)를 더 포함할 수 있다. ]","For example, the mixture may include the tobacco powder, the thermally conductive metal powder (e.g., aluminum), a non-tobacco fiber additive (e.g., pulp) and an exogenous binder (e.g., guar gum) as solids, and further include moisturizer (e.g., glycerin).",True,0.1554367691278457,0.9118337889754348,30,37,-7,132,256,-124
[담배 매질부(220)는 다양하게 성형될 수 있다.,The tobacco medium section 220 may be shaped in various ways.,True,0.275669664144516,0.8105215441095514,6,11,-5,28,61,-33
"예를 들어, 담배 매질부(220)는 시트(sheet) 자체로 제작될 수도 있다.","For example, the tobacco medium section 220 may be manufactured as a sheet itself.",True,0.1822640895843488,0.8946171620279111,9,14,-5,44,82,-38
"이 경우 담배 매질부(220)는 권축되거나 압착됨에 따라 주름진 시트로 제작될 수 있고, 권축되지 않은 채로 말려질(rolled) 수도 있다.","In this case, the tobacco medium section 220 may be made of a wrinkled sheet as it is crimped or compressed, and may be rolled without being crimped.",True,0.2412931621074676,0.8461514014503992,18,28,-10,79,149,-70
"담배 매질부(220)는 시트가 절단된 가닥(strand)으로 제작될 수 있고, 시트가 잘게 잘린 각초로 제작될 수도 있다. ]","The tobacco medium section 220 may be made of a strand produced by cutting a sheet, or may be made of cut filler produced by cutting the sheet into small pieces.",True,0.2626945972442627,0.8357165246499545,16,31,-15,70,161,-91
"[한편, 담배 매질부(220)에 열전도성 물질(예를 들어, 열전도성 분말)이 포함됨에 따라 에어로졸 생성 물품(20000)이 가열되는 과정에서의 열 전달 효율이 증가될 수 있다.","On the other hand, as the tobacco medium section 220 includes a thermally conductive material (e.g., thermally conductive powder), heat transfer efficiency in the process of heating the aerosol-generating article 20000 may be increased.",True,0.1343370378017425,0.935895500840218,21,34,-13,99,236,-137
"이에 따라, 풍부한 양의 에어로졸이 사용자에게 제공될 수 있고, 예열을 위해 필요한 시간 및 배터리의 전력 소모가 감소될 수 있다.]","Accordingly, an abundant amount of aerosol may be provided to the user, and the time required for preheating and power consumption of the battery may be reduced.",True,0.2124532610177993,0.8583944382306877,20,27,-7,74,161,-87
"[다만, 담배 매질부(220)에 너무 많은 양의 열전도성 물질이 포함되는 경우, 에어로졸 생성 물품(20000)이 가열되는 과정에서 담배 매질부(220)의 온도가 기 설정된 온도 프로파일에 의해 의도된 수준보다 높게 상승됨에 따라, 사용자에게 지나친 열감이 전달될 수 있다.","However, when the tobacco medium section 220 includes too much of a thermally conductive material, as the temperature of the tobacco medium section 220 rises greater than the intended level by the preset temperature profile while the aerosol-generating article 20000 is heated, an excessive sense of heat may be transmitted to the user.",True,0.1403204947710037,0.9280612687333007,34,53,-19,153,336,-183
"따라서, 담배 매질부(220)에는 너무 많지 않은 양의 열전도성 물질이 포함될 필요가 있다.","Accordingly, the tobacco medium section 220 needs to contain a not too large amount of thermally conductive material.",True,0.1815235465764999,0.8904959055274909,12,18,-6,51,117,-66
이하 도 6 내지 도 8을 참조하여 열전도성 분말의 적절한 함량에 대해 설명한다.],"Hereinafter, an appropriate content of the thermally conductive powder will be described with reference to FIGS. 6 to 8.",True,0.1808330118656158,0.869325642224152,13,19,-6,46,120,-74
[도 6 내지 도 8은 열전도성 분말의 적절한 함량을 결정하기 위한 실험과 관련된 도면들이다. ],FIGS. 6 to 8 are diagrams related to an experiment for determining an appropriate content of the thermally conductive powder.,True,0.134776622056961,0.902166477258806,15,20,-5,54,125,-71
"[도 6의 표를 참조하면, 실험에 사용된 에어로졸 생성 물품들 각각에 대응되는 혼합물의 배합비가 기재되어 있다.","Referring to the table of FIG. 6, a mixing ratio of a mixture corresponding to each of the aerosol-generating articles used in the experiment is described.",True,0.198478952050209,0.8699115478405464,15,26,-11,62,155,-93
"해당 실험에서 열전도성 분말로는 알루미늄(AL) 분말이 사용되고, 첨가제로는 펄프가 사용되었으며, 바인더로는 구아검이 사용되고, 보습제로는 글리세린이 사용되었다. ]","In this experiment, aluminum (AL) powder is used as a thermally conductive powder, pulp is used as an additive, guar gum is used as a binder, and glycerin is used as a moisturizing agent.",True,0.2007737904787063,0.8731298607230313,17,34,-17,92,187,-95
"[에어로졸 생성 물품 C는 건조 중량 기준으로 80 중량%의 담배 원료, 5 중량%의 펄프, 8 중량%의 구아검 및 7 중량%의 글리세린으로 구성되는 혼합물로부터 제조되는 담배 물질부를 포함한다.","Aerosol-generating article C includes, based on dry weight, a tobacco material section prepared from a mixture consisting of 80 wt% of tobacco raw material, 5 wt% of pulp, 8 wt% of guar gum and 7 wt% of glycerin.",True,0.153421401977539,0.9153907337867034,27,38,-11,109,212,-103
에어로졸 생성 물품 C는 열전도성 분말을 포함하지 않는 대조군에 해당한다.],The aerosol-generating article C corresponds to a control group that does not include the thermally conductive powder.,True,0.31647989153862,0.7841015188124828,10,17,-7,42,118,-76
"[에어로졸 생성 물품 A5는 건조 중량 기준으로 75 중량%의 담배 원료, 5 중량%의 알루미늄 분말, 5 중량%의 펄프, 8 중량%의 구아검 및 7 중량%의 글리세린으로 구성되는 혼합물로부터 제조되는 담배 물질부를 포함한다.]","Aerosol-generating article A5 includes, based on dry weight, a tobacco material section prepared from a mixture consisting of 75 wt% of tobacco raw material, 5 wt% of aluminum powder, 5 wt% of pulp, 8 wt% of guar gum and 7 wt% of glycerin.",True,0.1744902580976486,0.9022046846070144,31,43,-12,127,239,-112
"[에어로졸 생성 물품 A10은 건조 중량 기준으로 70 중량%의 담배 원료, 10 중량%의 알루미늄 분말, 5 중량%의 펄프, 8 중량%의 구아검 및 7 중량%의 글리세린으로 구성되는 혼합물로부터 제조되는 담배 물질부를 포함한다.]","Aerosol-generating article A10 includes, based on dry weight, a tobacco material section prepared from a mixture consisting of 70 wt% of tobacco raw material, 10 wt% of aluminum powder, 5 wt% of pulp, 8 wt% of guar gum and 7 wt% of glycerin.",True,0.1878409534692764,0.8994749901786738,31,43,-12,129,241,-112
"[에어로졸 생성 물품 A15는 건조 중량 기준으로 65 중량%의 담배 원료, 15 중량%의 알루미늄 분말, 5 중량%의 펄프, 8 중량%의 구아검 및 7 중량%의 글리세린으로 구성되는 혼합물로부터 제조되는 담배 물질부를 포함한다.]","Aerosol-generating article A15 includes, based on dry weight, a tobacco material section produced from a mixture consisting of 65 wt% of tobacco raw material, 15 wt% of aluminum powder, 5 wt% of pulp, 8 wt% of guar gum and 7 wt% of glycerin.",True,0.1771887391805648,0.9006799201345245,31,43,-12,129,241,-112
"[에어로졸 생성 물품 A20은 건조 중량 기준으로 60 중량%의 담배 원료, 20 중량%의 알루미늄 분말, 5 중량%의 펄프, 8 중량%의 구아검 및 7 중량%의 글리세린으로 구성되는 혼합물로부터 제조되는 담배 물질부를 포함한다.]","Aerosol-generating article A20 includes, based on dry weight, a tobacco material section produced from a mixture consisting of 60 wt% of tobacco raw material, 20 wt% of aluminum powder, 5 wt% of pulp, 8 wt% of guar gum, and 7 wt% of glycerin.",True,0.1983173638582229,0.896629760595852,31,43,-12,129,242,-113
"[에어로졸 생성 물품 C, 에어로졸 생성 물품 A5, 에어로졸 생성 물품 A10, 에어로졸 생성 물품 A15 및 에어로졸 생성 물품 A20 각각은 혼합물의 중량을 100이라고 할 때, 500에 대응되는 중량을 갖는 물과 혼합됨에 따라 생성되는 슬러리로부터 제조되는 담배 매질부를 포함한다.]","Each of the aerosol-generating article C, the aerosol-generating article A5, the aerosol-generating article A10, the aerosol-generating article A15, and the aerosol-generating article A20 includes a tobacco medium section produced from a slurry generated by mixing with water having a weight corresponding to 500 when the weight of the mixture (i.e., the tobacco material section) is 100.",True,0.1967522799968719,0.900744308081577,40,56,-16,162,388,-226
"[도 7의 표를 참조하면, 전술한 에어로졸 생성 물품들을 가열하는 경우, 각각의 에어로졸 생성 물품으로부터 생성되는 에어로졸의 성분 분석 결과가 도시되어 있다.]","Referring to the table of FIG. 7, when the aforementioned aerosol-generating articles are heated, results of component analysis of aerosols generated from each aerosol-generating article are shown.",True,0.1697052717208862,0.898740258635019,21,27,-6,90,197,-107
"[도 7을 참조하면, 에어로졸 생성 물품에 포함되는 알루미늄 분말의 함량이 증가함에 따라 TPM(Total Particulate Matter), 니코틴, 글리세린 등과 같은 연기 성분의 이행량이 증가됨을 알 수 있다.","Referring to FIG. 7, it may be seen that as the content of aluminum powder included in the aerosol-generating article increases, an amount of transfer of smoke components such as total particulate matter (TPM), nicotine, and glycerin is increased.",True,0.1251221299171447,0.9273888377800328,26,39,-13,121,247,-126
"다시 말해, 에어로졸 생성 물품에 포함되는 알루미늄 분말의 함량이 증가함에 따라 보다 풍부한 양의 에어로졸이 사용자에게 제공될 수 있고, 예열을 위해 필요한 시간 및 배터리의 전력 소모가 감소될 수 있음을 알 수 있다.","In other words, it may be seen that as the content of aluminum powder included in the aerosol-generating article increases, a more abundant amount of aerosol may be provided to a user, and a time required for preheating and power consumption of the battery may be reduced.",True,0.2501760721206665,0.8557486798204309,33,47,-14,122,272,-150
"다만, 이하 도 8을 참조하여 후술할 바와 같이, 알루미늄 분말의 함량이 더 많은 것이 반드시 바람직한 것은 아닐 수 있다.]","However, as will be described later with reference to FIG. 8, a greater content of aluminum powder may not necessarily be desirable.",True,0.1037665456533432,0.9317798874191212,20,22,-2,70,132,-62
"[도 8의 그래프를 참조하면, 히터가 기 설정된 온도 프로파일에 따라 가열되는 경우, 전술한 에어로졸 생성 물품들 각각에 포함되는 담배 매질부의 온도를 측정한 결과가 도시되어 있다.]","Referring to the graph of FIG. 8, when the heater is heated according to a preset temperature profile, a result of measuring the temperature of the tobacco medium section included in each of the aforementioned aerosol-generating articles is shown.",True,0.1671634465456009,0.8982025554015676,25,39,-14,102,247,-145
"또한, 본 실시형태의 배출로(42)는, 피스톤 로드(26)와 지지 부재(1c)의 통공 사이에 형성되는 환상 공간과, 서포트 로드(3)의 하단부에 형성되는 연통홈(3d)과, 콜릿(5)의 슬릿(5b)과, 상벽(1a)의 삽통 구멍(2)과 서포트 로드(3) 사이에 형성되는 환상 공간(2a) 등과, 하우징(1)의 선단부에 형성되는 배출구(42a)를 가진다.","The discharge passage 42 of this embodiment includes: an annular space created between the piston rod 26 and the tubular hole of the support member 1c; a communication groove 3d provided on a lower end portion of the support rod 3; the slit 5b of the collet 5; an annular space 2a provided between the insertion hole 2 of the upper wall 1a and the support rod 3, and the like; and a discharge port 42a provided at a leading end portion of the housing 1.",True,0.238836333155632,0.8896923822578205,35,86,-51,195,453,-258
"그 배출로(42)의 상단부(선단부)로서, 상벽(1a)의 삽통 구멍(2)의 내주벽에 더스트 씰(43)이 장착되고, 그 더스트 씰(43)의 립부(43a)가 서포트 로드(3)의 외주면에 밀착해 있다.","A dust seal 43 is attached to an inner peripheral wall of the insertion hole 2 of the upper wall 1a, that is, at an upper end portion (leading end portion) of the discharge passage 42.",False,0.3236644566059112,0.841428365779056,19,36,-17,108,184,-76
"본 실시형태에서는, 상기 더스트 씰(43)과, 더스트 씰(43)의 립부(43a)가 접동 가능하게 밀착되는 서포트 로드(3)의 외주면에 의해 개폐 밸브(44)가 구성된다.","In this embodiment, an opening/closing valve 44 is structured by: the dust seal 43; and a portion of the outer peripheral surface of the support rod 3 with which the lip portion 43a of the dust seal 43 is in close contact in a slidable manner.",True,0.2360288351774215,0.8798362542587241,18,46,-28,94,243,-149
"그리고 배출로(42) 내의 압축에어의 압력이 소정 압력을 웃돌았을(上回) 때에, 그 배출로(42)의 압축에어가 서포트 로드(3)의 외주면으로부터 립부(43a)를 이간시킨다.","When the pressure of compressed air in the discharge passage 42 exceeds a predetermined pressure, the compressed air in the discharge passage 42 causes the lip portion 43a to separate from the outer peripheral surface of the support rod 3.",True,0.2505669295787811,0.8826676458011733,17,40,-23,96,239,-143
"이에 따라, 개폐 밸브(44)는 밸브 개방되고, 배출로(42) 내의 압축에어가 배출구(42a)로부터 하우징(1)의 외부로 배출된다.]","This opens the opening/closing valve 44, and thereby the compressed air in the discharge passage 42 is discharged through the discharge port 42a to the outside of the housing 1.",True,0.2382586449384689,0.8855669950362884,13,30,-17,74,177,-103
[상기 워크 서포트의 작동을 도 1 내지 도 3을 참조하여 설명한다.,Operations of the work support will be described with reference to FIG. 1 and FIG. 3.,True,0.191398024559021,0.8666829025686541,11,16,-5,38,85,-47
"도 1에 나타내는 릴리스 상태에서는, 제1 피스톤(12) 및 전동구(6)가 제1 스프링(14)에 의해 상승되고 있음으로써, 콜릿(5)이 해당 콜릿(5)의 탄성 복원력에 의해 확경(擴徑, 지름 확장)되어 있다.","In a release state shown in FIG. 1, the first piston 12 and the transmission member 6 have been raised by the first spring 14, and this allows the collet 5 to expand due to the elastic restoring force of the collet 5.",True,0.2001535445451736,0.89111357424214,24,43,-19,116,217,-101
"또한, 제2 피스톤(25) 및 피스톤 로드(26)가 제2 스프링(33)에 의해 하강되고 있다.","Furthermore, the second piston 25 and the piston rod 26 have been lowered by the second spring 33.",True,0.1982949674129486,0.8956392222747435,11,18,-7,52,98,-46
"이에 따라, 피스톤 로드(26)가 진출 스프링(38)에 대항하여 상부 계합부(35a)와 상부 계지부(36a)를 통해 서포트 로드(3)를 하한 위치로 하강시키고 있다.]","Due to this, the piston rod 26 has lowered the support rod 3 to its lower limit position against the advance spring 38, via the upper engaging portion 35a and the upper engaged portion 36a.",True,0.2749633193016052,0.8596292397009625,18,35,-17,93,189,-96
"[상기 릴리스 상태에서, 워크(W)를 누름 볼트(3b)의 상방(上方, 위쪽) 위치에 수평방향으로 반입(搬入)한다.]",A workpiece W is brought horizontally to a position above the push bolt 3b in the above-described release state.,True,0.3870859146118164,0.7576290777477055,11,19,-8,64,112,-48
"[그리고 상기 워크 서포트를 도 1의 릴리스 상태로부터 도 3의 로크 상태로 구동시킬 때에, 압축에어를 급배구(30)로부터 입구실(29)로 공급한다.","To cause the work support to transition from the release state of FIG. 1 to a lock state of FIG. 3, compressed air is supplied from the supply and discharge port 30 to the inlet chamber 29.",True,0.2993540465831756,0.8449715425746,18,37,-19,83,189,-106
"그러면, 우선, 입구실(29)의 압축에어가 제2 피스톤(25) 및 피스톤 로드(26)를 제2 스프링(33)에 대항하여 상승시켜 간다.","As a result, compressed air in the inlet chamber 29 at first raises the second piston 25 and the piston rod 26 against the second spring 33.",True,0.2308524698019027,0.8887495656134645,14,27,-13,74,140,-66
"이어서, 피스톤 로드(26)가 진출 스프링(38)을 통해 서포트 로드(3)를 상승시켜 간다.","Then, the piston rod 26 raises the support rod 3 via the advance spring 38.",True,0.2564123272895813,0.8598248340716774,10,15,-5,51,75,-24
"이때, 출구실(32) 내의 에어가 제2 피스톤(25)에 의해 해당 출구실(32)의 외부로 압출되어 간다.","At this time, air in the outlet chamber 32 is pushed out of the outlet chamber 32 by the second piston 25.",True,0.1462880074977874,0.9319898096868608,12,22,-10,58,106,-48
"여기서, 본 실시형태에서는, 제2 피스톤(25)이 출구실(32)로부터 후술하는 수용실(45)로 압출하는 에어의 배출량은, 서포트 로드(3)가 기단측 한계 위치로부터 선단측 위치로 상승됨으로써 해당 서포트 로드(3)의 기단측에 형성되는 수용실(45)의 용량보다도 많아지도록 설정되어 있다.","In this embodiment, the device is designed so that the amount of air pushed out of the outlet chamber 32 to an accommodation chamber 45, which will be described later, by the second piston 25 is larger than the capacity of the accommodation chamber 45, which is created on the base end side relative to the support rod 3 when the support rod 3 is raised from the base-end-side limit position to a leading-end-side position.",True,0.2649672627449035,0.8836610461329818,29,75,-46,160,423,-263
"따라서, 출구실(32)로부터 압출된 에어가, 서포트 로드(3)의 하단면과 지지 부재(1c)의 상단면 사이에 형성되는 수용실(45)로 흘러들어감과 함께, 수용실(45)의 용량을 초과한 에어는, 배출로(42)를 통해 하우징(1)의 외부로 배출된다.","Due to this, the air pushed out of the outlet chamber 32 firstly flows into the accommodation chamber 45, created between a lower end surface of the support rod 3 and an upper end surface of the support member 1c, and then the amount of air exceeding the capacity of the accommodation chamber 45 is discharged to the outside of the housing 1 through the discharge passage 42.",True,0.2290973365306854,0.9000167037859893,24,68,-44,136,375,-239
"그 후, 도 2에 나타내는 바와 같이, 누름 볼트(3b)의 상단면이 워크(W)에 당접한다.]","Thereafter, an upper end surface of the push bolt 3b is brought into contact with the workpiece W, as shown in FIG. 2.",True,0.2103811353445053,0.8777216866456089,12,23,-11,51,118,-67
"[상기 제2 피스톤(25)이 상한 위치로 이동함으로써, 제2 피스톤(25)의 봉지 부재(25a)가 연통 구멍(41)의 개구부를 통과한다.","As the second piston 25 moves to its upper limit position, the sealing member 25a of the second piston 25 passes over an opening of the communication hole 41.",True,0.2244084924459457,0.8852075214117897,14,29,-15,76,158,-82
"그러면, 급배구(30)의 압축에어가 입구실(29)과 연통 구멍(41)을 차례로 통과하여 작동실(13)로 공급된다.","As a result, compressed air at the supply and discharge port 30 passes through the inlet chamber 29 and the communication hole 41 in this order and is supplied to the actuation chamber 13.",True,0.2381264269351959,0.8768566736708372,10,34,-24,63,188,-125
"그리고 그 작동실(13)의 압력이 소정의 설정 압력(제1 스프링(14)의 상방으로의 부세력(付勢力)에 상당하는 압압력(押壓力))을 초과하면, 그 작동실(13)로부터 제1 피스톤(12)으로 작용하는 공압력(空壓力)의 상하방향의 차력(差力)이 전동구(6)에 작용한다.","When the pressure in the actuation chamber 13 exceeds a predetermined set pressure (i.e., a pushing force corresponding to the upward biasing force of the first spring 14), a force corresponding to the difference between upward and downward pneumatic pressure forces applied from the actuation chamber 13 to the first piston 12 acts to the transmission member 6.",True,0.1720494627952575,0.9120180587659952,23,58,-35,147,362,-215
"그 하향(下向)의 차력이 전동구(6)를 하방(下方, 아래쪽)으로 이동시키면, 그 전동구(6)의 테이퍼 내주면(6a)이 볼(8)을 하방으로 전동(轉動)시키면서 콜릿(5)의 테이퍼 외주면(5a)에 스무스하게 계합해 가서, 그 콜릿(5)을 축경시킨다.","As the downward force of the difference moves the transmission member 6 downward, the tapered inner peripheral surface 6a of the transmission member 6 is smoothly engaged with the tapered outer peripheral surface 5a of the collet 5 while rolling the balls 8 downward, with the result that the collet 5 contracts.",True,0.353001981973648,0.7870352473742737,23,52,-29,137,312,-175
"이에 따라, 그 축경된 콜릿(5)이 서포트 로드(3)의 협지 고정 영역(R)을 해당 서포트 로드(3)의 축심(軸心)을 향해서 압압(押壓)하고, 그 서포트 로드(3)를 도 3에 나타내는 높이 위치에서 협지 고정한다.","Because of this, the collet 5 with the decreased diameter pushes the region R of the support rod 3 toward the axis of the support rod 3, and thereby grips and holds the support rod 3 at a height level shown in FIG 3.",True,0.2698089778423309,0.8546042515227689,26,44,-18,119,216,-97
"로크 상태에서 워크(W)의 상면을 기계 가공하고, 그 가공시의 압하력(押下力)을 서포트 로드(3)의 서포트력에 의해 하방으로부터 강력하게 수용하는 것이다.]",A top surface of the workpiece W is machined in this lock state and a downward pushing force exerted at the machining process is reliably received from below by virtue of a supporting force of the support rod 3.,True,0.2374688982963562,0.8561367382534443,17,39,-22,87,211,-124
"[상기 기계 가공이 종료한 후, 입구실(29)의 압축에어가 급배구(30)를 통해 배출된다.","After the machining process is completed, compressed air in the inlet chamber 29 is discharged through the supply and discharge port 30.",True,0.2223376035690307,0.876359175306575,10,22,-12,50,136,-86
"그러면, 우선, 제2 피스톤(25) 및 피스톤 로드(26)가 하강해 간다.","As a result, the second piston 25 and the piston rod 26 descend at first.",True,0.2379515469074249,0.8656518778453933,9,15,-6,41,73,-32
"그 후, 서포트 로드(3)의 로크 상태가 해제된다.","Thereafter, the locked support rod 3 is released.",True,0.3146815896034241,0.7964162461909081,7,8,-1,28,49,-21
"더 상세히 말하면, 다음과 같다.]",A more detailed description will be given below.,True,0.5419554114341736,0.586025060658672,5,8,-3,19,48,-29
"[상기 압축에어의 배출에 따라, 우선, 제2 스프링(33)에 의해 제2 피스톤(25)과 피스톤 로드(26)가 하강해 가고, 제2 피스톤(25)의 봉지 부재(25a)가 연통 구멍(41)의 개구부를 통과한다.","As the compressed air is discharged, first of all, the second piston 25 and the piston rod 26 are lowered by the second spring 33, and the sealing member 25a of the second piston 25 passes over the opening of the communication hole 41.",True,0.2546193301677704,0.8845205756376447,22,44,-22,114,235,-121
"이때, 작동실(13)의 압축에어가, 상기 연통 구멍(41)과, 출구실(32)과, 상기 배출로(42)를 통해 외부로 배출되어 간다.","As a result, compressed air in the actuation chamber 13 is discharged to the outside through the communication hole 41, the outlet chamber 32, and the discharge passage 42.",True,0.1873695999383926,0.9086454266559092,13,29,-16,72,172,-100
"그리고 작동실(13)의 압력이 소정의 설정 압력을 밑돌면(下回), 제1 피스톤(12) 및 전동구(6)가 제1 스프링(14)에 의해 상측으로 압압되며, 그 전동구(6)가 테이퍼 내주면(6a)을 통해 볼(8)을 전동시키면서 스무스하게 상방으로 이동한다.","When the pressure in the actuation chamber 13 becomes lower than the predetermined set pressure, the first piston 12 and the transmission member 6 are pushed upward by the first spring 14, and the transmission member 6 moves upward smoothly while rolling the balls 8 on the tapered inner peripheral surface 6a.",True,0.2295650988817215,0.8801014654986004,26,52,-26,139,310,-171
"이에 따라, 콜릿(5)이 자기의 탄성 복원력에 의해 확경하여, 서포트 로드(3)의 로크 상태가 해제된다.","Consequently, the collet 5 expands due to its elastic restoring force, to release the locked support rod 3.",True,0.2814104855060577,0.8239940710576413,13,18,-5,58,107,-49
"이 때문에, 제2 피스톤(25) 및 피스톤 로드(26)가 더 하강하고, 그 피스톤 로드(26)가 상부 계합부(35a)와 상부 계지부(36a)를 통해 서포트 로드(3)를 도 1의 하한 위치로 복귀시킨다.]","Due to this, the second piston 25 and the piston rod 26 descend further, and the piston rod 26 causes the support rod 3 to return to its lower limit position shown in FIG. 1 via the upper engaging portion 35a and the upper engaged portion 36a.",True,0.200469821691513,0.9026467914511046,24,47,-23,113,243,-130
[상기 실시형태는 다음의 작용효과를 나타낸다.],"In the above-described embodiment, the following functions and effects are provided.",True,0.4562170207500458,0.6779022994954541,5,11,-6,26,84,-58
"[상기 실시형태에 나타내는 워크 서포트에서는, 배출로(42)가, 서포트 로드(3)의 외주면과 하우징(1)의 삽통 구멍(2)의 내주면과의 사이에 형성되는 환상 공간(2a)과, 그 하우징(1)의 선단부에 형성되는 배출구(42a)를 가진다.","In the work support of the above-described embodiment, the discharge passage 42 includes: the annular space 2a created between the outer peripheral surface of the support rod 3 and the inner peripheral surface of the insertion hole 2 of the housing 1; and the discharge port 42a provided at the leading end portion of the housing 1.",True,0.1789870411157608,0.9190447287150744,23,57,-34,131,332,-201
"그 워크 서포트(3)를 로크 구동시켜 제2 피스톤(25)을 상승시켜 갈 때에, 그 제2 피스톤(25)이 출구실(32)의 에어를 압출하고, 압출한 에어를 서포트 로드(3)의 하측에 형성되는 수용실(45)에 공급해 간다.","When the work support is driven for locking to raise the second piston 25, the second piston 25 pushes air out of the outlet chamber 32, and the pushed-out air is supplied to the accommodation chamber 45 provided below the support rod 3.",True,0.2007628828287124,0.9142013595564786,25,43,-18,121,237,-116
"서포트 로드(3)는, 워크(W)의 이면(裏面, 뒷면)에 당접되어 정지되지만, 제2 피스톤(25)은 계속해서 상한 위치까지 상승된다.","While the support rod 3 is stopped when brought into contact with a lower surface of a workpiece W, the second piston 25 is still raised to its upper limit position.",True,0.4256762266159057,0.7589297263340015,13,31,-18,73,165,-92
"그러면, 출구실(32)로부터 압출된 에어가 수용실(45)의 용적(容積)을 초과하여 공급되므로, 그 과잉 공급분의 에어가 배출로(42)의 환상 공간(2a)과 개폐 밸브(44)의 밸브 개방 간극을 통해 배출구(42a)로부터 하우징(1)의 외부로 배출된다.","The excess amount of gas is therefore discharged, through the annular space 2a of the discharge passage 42 and through a valve-opening clearance of the opening/closing valve 44, to the outside of the housing 1 from the discharge port 42a.",False,0.2672430574893951,0.8746151729143209,25,40,-15,140,238,-98
"또한, 워크 서포트(3)를 릴리스 구동시켜 제1 피스톤(12)을 하강시켜 갈 때에, 제1 피스톤(12)이 작동실(13)의 에어를 출구실(32)과 환상 공간(2a)과 개폐 밸브(44)의 밸브 개방 간극을 통해 배출구(42a)로부터 하우징(1)의 외부로 배출한다.","Meanwhile, when the work support is driven for releasing to lower the first piston 12, the first piston 12 discharges air in the actuation chamber 13, through the outlet chamber 32, the annular space 2a, and the valve-opening clearance of the opening/closing valve 44, to the outside of the housing 1 from the discharge port 42a.",True,0.1939737051725405,0.9140564536635146,27,56,-29,145,329,-184
"이 때문에, 본 실시형태의 워크 서포트에서는, 상기 종래 기술과 같이 하우징 외부의 에어를 하우징 내에 취입하거나, 또는, 배출하는 호흡 구멍을 기단벽에 마련할 필요가 없고, 또한, 그 호흡 구멍에 이어지는 통로를 테이블 내에 마련할 필요가 없다.","Due to this, the work support of this embodiment needs neither the ventilation hole in the base end wall, through which air is taken from the outside into the housing or discharged to the outside, nor the passage connected to the ventilation hole and provided in the table, which are provided in the above-described known device.",True,0.2582186162471771,0.8665580920677987,35,56,-21,138,329,-191
"따라서, 본 실시형태에서는, 워크 서포트를 간소한 구조로 작게 만들 수 있다.]","Accordingly, in this embodiment, it is possible to provide a downsized work support with a mechanically simple structure.",True,0.3439041674137115,0.7583652946815729,11,18,-7,44,121,-77
"[또한, 본 실시형태의 워크 서포트는, 전술한 바와 같이, 종래 기술의 호흡로(呼吸路)를 생략하고 있으며, 그 호흡로 분량만큼 하우징(1)의 하부 블록(1d) 및 지지 부재(1c)의 직경 치수를 작게 하는 것에 더해, 워크 서포트를 더 작게 하기 위해, 다음과 같이 구성된다.]","Due to this, the size of the diameter of the lower block 1d and the support member 1c of the housing 1 can be reduced by its length.",False,0.6260745525360107,0.6398078666237934,37,28,9,155,132,23
"[본 실시형태의 피스톤 로드(26)는, 원기둥 모양으로 형성되어 있고, 종래 기술의 피스톤 로드와 같은 피스톤 로드 본체부보다 큰 지름으로 형성되는 플랜지부를 피스톤 로드의 선단부에 가지고 있지 않다.","The piston rod 26 of this embodiment has a cylindrical shape, and has, at a leading end portion thereof, no flange portion which has a diameter larger than that of the piston rod main body and is provided to the piston rod of the known device.",True,0.2932496666908264,0.8290204620140147,26,46,-20,112,243,-131
"이 때문에, 피스톤 로드(26) 및 서포트 로드(3)의 반경방향의 치수를 작게 만들 수 있다.",This makes it possible to reduce the sizes of the piston rod 26 and the support rod 3 in the radial direction.,True,0.2293772399425506,0.8658859665542668,13,22,-9,52,110,-58
"서포트 로드(3)가 작아짐으로써 해당 서포트 로드(3)의 자중(自重, 자체 중량)도 저감되므로, 서포트 로드(3)와 출력 부재(24)를 하강시키는 제2 스프링(33)을 가늘게(약하게) 또는/및 짧게 할 수 있다.","This allows the second spring 33, configured to lower the support rod 3 and the output member 24, to have a smaller width (a less biasing force) and/or a shorter length.",False,0.3179359436035156,0.8380799420682935,23,31,-8,118,169,-51
"이에 따라, 제2 피스톤(25)의 상면으로부터 지지 부재(1c)의 상단부까지의 거리를 작게 할 수 있다.]",This makes it possible to reduce the distance from a top surface of the second piston 25 to an upper end portion of the support member 1c.,True,0.2364859879016876,0.8706145055763926,13,27,-14,59,138,-79
"[또한, 본 실시형태에서는, 작아진 서포트 로드(3)에 대해 제2 피스톤(25)은 거의 종래와 같은 크기이다.","In this embodiment, the size of the second piston 25 is substantially the same as that of the known device, while the support rod 3 is downsized.",True,0.2999224066734314,0.8349750148281699,13,27,-14,61,145,-84
"전술한 바와 같이, 피스톤(25)의 직경 치수와 서포트 로드(3)의 외경 치수는 대략 동일하게 형성됨과 아울러, 피스톤(25)의 최대 스트로크(stroke)와 서포트 로드(3)의 최대 스트로크가 동일하게 되도록 설정하고 있다.","As described above, the work support of this embodiment is designed so that: the size of the piston 25 is substantially equal to the size of the outer diameter of the support rod 3; and the maximum stroke of the piston 25 is equal to the maximum stroke of the support rod 3.",True,0.3812833428382873,0.8114223097701826,25,53,-28,126,274,-148
"또한, 로크 구동시에는, 서포트 로드(3)는 워크(W)에 당접되어, 스트로크의 도중(途中)에 정지되지만(최대 스트로크만큼 이동되지 않는다.), 제2 피스톤(25)은 전체 스트로크 이동하므로, 제2 피스톤(25)이 출구실(32)의 에어를 압출하는 배출량은, 서포트 로드(3)의 하측에 형성되는 수용실(45)의 용량을 웃돈다.","Furthermore, when the work support is driven for locking, the support rod 3 is stopped during the stroke (i.e., does not move its maximum stroke) because it comes into contact with the workpiece W. The second piston 25 moves however its full stroke.",False,0.4362281560897827,0.7840227482973999,31,43,-12,180,249,-69
"이 때문에, 로크 구동시의 배출로(42) 내의 압력은, 릴리스 상태의 정지시에 비해 상승되게 된다.","Due to this, the pressure in the discharge passage 42 during the locking drive becomes higher than that in the release state.",True,0.1995763182640075,0.8946375912584786,13,22,-9,55,125,-70
"그리고 배출로(42) 내의 상승 압력이 소정 압력을 웃돌면, 배출로(42)의 압축에어가 개폐 밸브(44)를 구성하는 더스트 씰(43)의 립부(43a)를 서포트 로드(3)의 외주면으로부터 이간시켜 하우징(1)의 외부로 배출된다.","When the increasing pressure in the discharge passage 42 exceeds the predetermined pressure, compressed air in the discharge passage 42 causes the lip portion 43a of the dust seal 43 of the opening/closing valve 44 to separate from the outer peripheral surface of the support rod 3, and the air is discharged to the outside of the housing 1.",True,0.2330824434757232,0.8936210109502023,23,59,-36,126,341,-215
"또한, 본 실시형태에서는, 제2 피스톤(25)의 직경 치수와 서포트 로드(3)의 외경 치수를 거의 동일하게 설정하고 있지만, 제2 피스톤(25)의 직경 치수가 서포트 로드(3)의 외경 치수보다도 크게 되도록 설정해도 된다.","Although in this embodiment the size of the diameter of the second piston 25 is designed to be substantially equal to the size of the outer diameter of the support rod 3, the size of the diameter of the second piston 25 may be designed to be larger than the size of the outer diameter of the support rod 3.",True,0.2805112898349762,0.8609514683477387,27,60,-33,124,306,-182
"또한, 제2 피스톤(25)의 직경 치수가 서포트 로드(3)의 외경 치수보다도 작게 되도록 설정해도 된다.","Alternatively, the size of the diameter of the second piston 25 may be designed to be smaller than the size of the outer diameter of the support rod 3.",True,0.2573356628417969,0.8604576361261926,13,29,-16,58,151,-93
"이 경우, 제2 피스톤(25)의 전체 스트로크를 서포트 로드(3)의 스트로크보다 길게 함으로써, 로크 구동시에 제2 피스톤(25)이 출구실(32)의 에어를 압출하는 배출량이, 서포트 로드(3)의 하측에 형성되는 수용실(45)의 증가 용량에 대해 웃돌면 된다.]","In this case, the full stroke of the second piston 25 is designed to be longer than the stroke of the support rod 3, so that the amount of air pushed out of the outlet chamber 32 by the second piston 25 during a locking drive is larger than the increased capacity of the accommodation chamber 45 created below the support rod 3.",True,0.2373202592134475,0.8969939155034674,29,63,-34,145,328,-183
"[도 4 및 도 5는, 상기 제1 실시형태의 변형예 및 본 발명의 제2 실시형태를 나타내고 있다.",FIG. 4 and FIG. 5 respectively show a modification of the first embodiment and a second embodiment of the present invention.,True,0.1149171143770217,0.9287128049196838,16,21,-5,54,124,-70
"이 제1 실시형태의 변형예 및 제2 실시형태에서는, 상기 제1 실시형태와 동일한 구성의 부재에는 원칙적으로 동일한 참조 부호를 붙이고 있으며, 그 제1 실시형태와 상이한 구성에 관하여 설명한다.]","In the modification of the first embodiment and in the second embodiment, components the same as or similar to the components in the first embodiment are given the same reference numerals, in principle.",False,0.3427821397781372,0.780025698786985,26,33,-7,109,202,-93
[도 4에 나타내는 제1 실시형태의 변형예가 상기 제1 실시형태와 상이한 점은 다음과 같다.],The following description deals with features different from those in the first embodiment.,False,0.506708562374115,0.6596041515739692,13,13,0,52,91,-39
"[도 4의 워크 서포트에서는, 하우징(1)의 상벽(1a)에 형성된 삽통 구멍(2)에 더스트 씰(51)이 장착된다.",The modification of the first embodiment shown in FIG. 4 is different from the first embodiment in the following points.,False,0.9104056358337402,0.4556779854465245,12,20,-8,63,120,-57