Datasets:

wasifis

/

long_context_summarization

like 1

tardive dystonia ( td ) , a rarer side effect after longer exposure to antipsychotics , is characterized by local or general , sustained , involuntary contraction of a muscle or muscle group , with twisting movements , generally slow , which may affect the limbs , trunk , neck , or face . td has been shown to develop in about 3% of patients who have had long - term exposure to antipsychotics . . the low risk of td for atypical antipsychotics is thought to result from their weak affinity for dopamine receptors . compared with typical , atypical antipsychotic agents have a greater affinity for serotonin 5-ht2a than dopamine d2 receptors , with a low propensity to induce td . among this olanzapine is thought to have preferential action at mesolimbic over nigrostriatal dopaminergic pathways and is , therefore , associated with a very low incidence of extrapyramidal symptom ( eps ) . furthermore , a retrospective analysis of controlled multicentric trials suggested that olanzapine also improves preexisting symptoms of tardive movements . we report a case of 20-year - old male , belonging to lower socioeconomic class , educated up to 2 standard , presented with severe unilateral dystonic left sided neck movements [ figure 1 ] . careful history exploration revealed he was taking risperidone 2 mg irregularly for 2 months and then olanzapine 5 mg for another 4 months . picture of neck dystonia of patient at 19 years , the patient presented with occasional anger outbursts , getting provoked on small matters and beating family members , running away from home , screaming episodes occasionally , fearfulness , sleep disturbance for 2 days ; which was precipitated after fever . according to the mother , one friend might have threatened / made fun of him actually and after that patient stopped going out of house , and displayed above mentioned symptoms . this was interpreted as psychosis with persecutory ideas , and he was treated with risperidone 2 mg / day for 2 months and then with olanzapine 5 mg / day for 4 months . in last two follow - ups patient did not present himself , and mother reported unusual neck movements , which were taken as a part of his overall psychopathology and not taken seriously , slight intermittent neck movements reported were missed as part of adolescent behavior problems mimicking some hero in movies . as neck dystonia increased , the patient had a severe disability as patient had to keep his hands behind his head for the support . the movement would decrease when the patient was lying down and was absent during sleep . he even stopped taking food due to severe neck movements making chewing and swallowing difficult . his birth and early developmental milestones were normal . during 210 years of age patient was inattentive and mildly hyperactive . other siblings were educated with master 's degree , and patient was also sent to school , but due to inattention and restlessness , he did not pass 2 standard after three attempts . he left the schooling . with average executive functioning and life skills , he worked as an unskilled laborer in the neighborhood shops as a helping hand . , he was found to be getting over familiar , cheerful , moody , and short tempered . sometimes , the patient had inappropriate social judgment ; for which his friends made fun of him , and teased him . on mental status assessment , routine investigations , thyroid function tests , electroencephalogram , fundus examination , cervical x - ray , magnetic resonance imaging brain were normal . after consulting neurophysician , wilson 's disease and other secondary causes of dystonia were ruled out . the patient was treated with clonazepam 1 mg total dissolved solid ( tds ) , tetrabenazine 25 mg tds , trihexiphenidyl 2 mg bipolar disorder ( bd ) . after 2 months , there was some improvement of around 30% . baclofen 10 mg was added ; increased up to 20 mg , trihexyphenidyl reduced to 2 mg . with little improvement after 4 months of treatment for dystonia , levodopa + carbidopa ( 100 + 25 ) was added by neurophysician and increased up to tablet tds and baclofen omitted . after 12 months of treatment , patient has improved around 90% with tetrabenazine 75 mg , levodopa + carbidopa ( 100 + 25 ) - tablet bd , and clonazepam 1 mg bd . earlier case reports reported td developing with high - dose atypical antipsychotics such as olanzapine 20 mg or aripiprazole 15 mg with longer duration of exposure of around 1215 months in established psychiatric illness like schizophrenia or any other psychotic illness . eps in general and tardive dyskinesia , in particular , have been extensively studied in schizophrenia . even though a number of studies suggest that bipolar patients experience higher rates of eps ( parkinsonism , dystonia , akathisia ) and td compared to patients with a diagnosis of schizophrenia , research within the bd population has been limited . the risk is found to be 3 to 5 times higher in elderly patients compared to young patients . in addition to age , the risk is directly proportional to : female gender , daily and total dose of the antipsychotic drug , presence of mood disorder , the use of anticholinergics with neuroleptics , previous physical therapies ( electroconvulsive therapy ) , the presence of other physical illness such as diabetes or an organic disorder , younger age of exposure , and the presence of extrapyramidal symptoms early in treatment . this patient 's severe dystonic neck movements developed within short period of 6 months of exposure to atypical antipsychotics risperidone 2 mg and then olanzapine 5 mg only , which can cause minimal extrapyramidal side effects . in this case , risk factors for developing serious disabling td were neuroleptic exposure , borderline intellectual functioning , externalizing behavior , probable misdiagnosis , and overlooking early indicators of side effects . this case highlights dangers of casually prescribing low dose second generation antipsychotics in patient with hyperthymic temperament and borderline intellectual functioning with vague short lasting presenting complaints ; probably misdiagnosed as psychosis ; leading to such severe adverse effects because patients with organic brain damage are more prone to develop adverse effects like td . thus , judicious use of antipsychotics , with detailed and frequent assessments is important , and emergent stereotyped behavior or unexplained movements must be examined carefully and taken seriously . the authors certify that they have obtained all appropriate patient consent forms . in the form the patient(s ) has / have given his / her / their consent for his / her / their images and other clinical information to be reported in the journal . the patients understand that their names and initials will not be published and due efforts will be made to conceal their identity , but anonymity can not be guaranteed . the authors certify that they have obtained all appropriate patient consent forms . in the form the patient(s ) has / have given his / her / their consent for his / her / their images and other clinical information to be reported in the journal . the patients understand that their names and initials will not be published and due efforts will be made to conceal their identity , but anonymity can not be guaranteed . syncope is caused by transient diffuse cerebral hypoperfusion and is characterized by transient loss of consciousness with a rapid onset followed by spontaneous and complete recovery . clinical features of syncope may include myoclonic jerks which are often multifocal and asynchronous , convulsions , and urinary incontinence , making it difficult to differentiate from epileptic seizure by clinical features alone . significant fluctuations in cerebral perfusion pressure are prevented by autoregulation of cerebral circulation , but there may be conditions where such mechanism may not compensate adequately . cough syncope , a rare form of syncope , may be a result of transient failure of the cerebral autoregulatory mechanism to cope with sudden decrease in cerebral blood flow . we present an unusual case of recurrent cough syncope , which was initially diagnosed and treated as seizures , in the context of a left - sided glomus jugulare tumor , a benign paraganglioma . a 43-year - old right - handed woman with history of glomus jugulare tumor in the left jugular fossa with intracranial extension into the posterior cranial fossa was transferred from another hospital for recurrent seizure - like spells . she had a 90% surgical resection of the tumor done in 2011 followed by radiation therapy in september 2012 . her episodes occurred multiple times a day ( 7 per day on average ) during wakeful state . they were triggered by coughing ( usually a bout of cough ) and were characterized by staring and unresponsiveness as well as stiffening of the body with mild shaking of both upper extremities . she was diagnosed with epileptic seizures but continued to have episodes during treatment with the antiepileptic drugs ( aeds ) phenytoin , levetiracetam , and lamotrigine . escalation of aed therapy made her increasingly drowsy , and she was on all three aforementioned aeds at the time of presentation . her physical examination was remarkable for excessive drowsiness , mild dysarthria , right sixth cranial nerve palsy , mild hypertonia with hyperreflexia in the lower extremities ( left more than right ) , and bilateral ( left more than right ) ankle clonus . she had a lumbar puncture done at the outside hospital , and the opening cerebrospinal fluid ( csf ) pressure was reported to be 25 cm . blood work was also unremarkable except for mild anemia ( hemoglobin : 9.4 g / dl ) , mild hyponatremia ( 132 meq / l ) , and mild hypokalemia ( 3.1 meq / l ) . antiepileptic drug levels were within therapeutic range ( free phenytoin : 1.3 g / ml , levetiracetam : 5.9 g / ml , and lamotrigine : 2.3 g / ml ) . all started with a bout of cough when the patient was lying in bed ( in supine or in lateral position ) which was followed by brief ( less than a minute ) distal upper extremity tremor and subtle proximal upper extremity myoclonic jerks and prolonged unresponsiveness for up to 10 min . all of these episodes were associated with hypotension ( 7278/3147 mm of hg as revealed by continuous arterial pressure monitoring ) and bradycardia ( 5459 bpm ) . the eeg during the spells was characterized by generalized synchronous and asynchronous high amplitude 1- to 2-hz delta activity which progressed to generalized attenuation and then transitioned to generalized delta activity again with recovery ( fig . 1 ) . a head ct showed recurrence of the glomus jugulare tumor and communicating hydrocephalus . an external ventricular drain ( evd ) after placement of the evd , her drowsiness gradually started to improve , and episodes decreased in frequency to one per day . 3 showed an enhancing t2 hyperintense left skull base mass in the region of the left jugular foramen with extension into the posterior cranial fossa and below the base of the skull . brain imaging showed evidence of hydrocephalus that had increased compared with her previous brain imaging done 2 months back . her mental status continued to improve , and she had only one mild episode triggered by cough during the next two days before her discharge . repeat surgical resection of the tumor was recommended by the otolaryngology team , which the patient declined . based on the clinical features and eeg findings , the episodes observed in our patient are most consistent with cough syncope . the mechanism underlying cough syncope is not definitively established , but it is postulated that coughing increases intrathoracic and intraabdominal pressures leading to a transient increase in icp . increased icp , in turn , causes a decrease in cerebral perfusion pressure which , if it drops below a critical level , may result in global cerebral hypoperfusion leading to syncope . transient cerebral circulatory arrest has been demonstrated by transcranial doppler measurements during cough syncope . our patient also had a drop in blood pressure and heart rate but probably not sufficient to cause syncope by itself . cough syncope has been associated with posterior fossa mass lesions or tonsillar herniation and with hydrocephalus . it may be speculated that bouts of cough caused transient herniation of cerebellar tonsils obstructing csf flow that further contributed to the increase in icp during coughing . decrease in frequency of events following placement of evd to relieve icp lends support to this notion . paragangliomas are rare tumors of extraadrenal chromaffin cell origin that most commonly occur in the head and neck region . catecholamine - hypersecreting paraganglionomas are uncommon in the head and neck region , and most patients ( 95% ) with hypersecreting paraganglionomas have hypertension . hypotension accompanying syncope observed in our patient was not orthostasis - related ( the patient was always supine during spells ) and was most likely related to cough . identified a subset of patients with cough syncope who lacked a blood pressure overshoot ( expected response ) after the relief of straining during valsalva maneuver . the authors postulate that cough syncope in these patients might be the result of delayed recovery from hypotension that follows a paroxysm of cough , and this was likely contributing to global cerebral hypoperfusion in our patient . this case highlights the fact that cough syncope , a rare form of syncope , may be associated with intracranial mass lesions that indirectly exaggerate the increase in icp in response to cough . glomus caroticum tumor presenting as recurrent unexplained syncope and posterior fossa meningioma presenting as recurrent cough syncope have been described . recurrent cough syncope should trigger search for factors , including brain tumors , with the potential to cause transient elevation in icp . this case also illustrates an important role for ceeg monitoring with video in distinguishing syncope from seizures in cough syncope cases .

tardive dystonia ( td ) is a serious side effect of antipsychotic medications , more with typical antipsychotics , that is potentially irreversible in affected patients . studies show that newer atypical antipsychotics have a lower risk of td . as a result , many clinicians may have developed a false sense of security when prescribing these medications . we report a case of 20-year - old male with hyperthymic temperament and borderline intellectual functioning , who developed severe td after low dose short duration exposure to atypical antipsychotic risperidone and then olanzapine . the goal of this paper is to alert the reader to be judicious and cautious before using casual low dose second generation antipsychotics in patient with no core psychotic features , hyperthymic temperament , or borderline intellectual functioning suggestive of organic brain damage , who are more prone to develop adverse effects such as td and monitor the onset of td in patients taking atypical antipsychotics .

please summarize the articles given below

agenesis of the inferior vena cava ( ivc ) as a cause of recurrent deep vein thrombosis ( dvt ) is uncommon . a 33-year - old male with no family history of thrombophilia , who had experienced multiple recurrent episodes of dvt over a 15-year period of unknown cause , was admitted into our hospital because of cellulitis in the right leg . congenital absence of the ivc could be a rare risk factor for idiopathic dvt , especially in young individuals . venous thromboembolism ( vte ) , which includes deep vein thrombosis ( dvt ) and pulmonary embolism , has an incidence of 1 to 3 per 1000 individuals per year in western populations.1 congenital anomalies of the inferior vena cava ( ivc ) are uncommon , and have been associated with the development of venous thrombosis of the lower limbs.2 congenital anomalies of the ivc has been reported as a risk factor for dvt , especially in individuals < 30 years old , and a concomitant thrombophilic disorder has been found in such individuals.3 we report a case of recurrent dvt in a 33-year - old man with agenesis of the ivc . the patient had experienced recurring episodes of idiopathic dvt in the right leg for 15 years . a 33-year - old man was admitted to the internal medicine department , holy family hospital , nazareth , israel , because of cellulitis in the right leg . one week prior to his admission , he complained about pain and increased local heat in the left ankle and thumb of the right leg . the patient had no history of previous trauma , surgery , insect bites , dysuria , or joint symptoms , and no family history of thrombophilia . he reported that he had ( a ) rheumatic fever without any complications when he was 19 years old , which was treated with penicillin , ( b ) been hospitalized when he was 23 years old because of infected skin ulcers on the right calf , for which he was treated by parenteral antibiotics , and ( c ) recurrent episodes of idiopathic dvt for the last 15 years . he also reported that he had not been treated with warfarin , but he had been on prophylactic enoxaparin therapy for dvt some years ago which has since been stopped and that he had been recently treated with allopurinol and colchicine for a presumed diagnosis of gout . he had been investigated several times for a primary hypercoagulability state , and the results were negative . on examination , the most outstanding clinical findings were swelling of ankles , mild edema , redness , and increased temperature of the right ankle and calf with trophic skin changes ( skin discoloration with ulcers ) , and superficial varicose veins in the lower abdomen ( figure 1 ) . the clinical laboratory findings ( erythrocyte sedimentation rate , leukocyte and platelet counts , and plasma hemoglobulin , plasma protein c , plasma protein s , fibrinogen , and antithrombin iii levels ) , the results of the kidney and liver function tests , and resistance to activated protein c were all normal . polymorphisms of the genes that encode for methylenetetrahydrofolate reductase were not detected , and the factor v leiden and prothrombin mutations g20210a were absent . the results of the clinical immunological studies for complement c3 and c4 and rheumatoid factor were negative , and no circulating titers for antinuclear antibody , antineutrophil cytoplasmic antibody , and cardiolipin antibody were found . cultures from the infected skin ulcers of the right leg were positive for methicillin - resistant staphylococcus aureus ( mrsa ) . ultrasound imaging of the leg veins showed a previous dvt in the right common femoral vein , and dilated superficial inguinal veins . computer tomography with contrast of the abdomen showed agenesis of the infrarenal segment of the ivc ( figure 2 ) with dilated azygos and hemiazygos veins ( figure 3 ) . there were also varicose veins in the abdominal wall and right groin , which were associated with dilated superficial and collateral veins ( figure 4 ) . transthoracic echocardiography of the patient s heart revealed mild atrial enlargement and good systolic function of the left ventricle , and no pathological valvular flows . the patient was diagnosed as having agenesis of the infrarenal segment of the ivc and dvt of the right leg without concomitant risk factors for vte . since we attributed the agenesis of the ivc to be the underlying cause of the recurrent episodes of the dvts , the patient was started on anticoagulant therapy ( subcutaneous enoxaparin 160 mg / day ) for dvt , antibiotic therapy ( intravenous vancomycin 1.5 g / day for mrsa skin infection ) , and referred to a vascular surgeon specialist but the patient refused . at follow - up in the internal medicine clinic , the most outstanding clinical findings were swelling of left ankle , redness , with trophic skin changes , and a mild improvement of the skin ulcers . despite several phone calls for follow - up the normal ivc is composed of 4 segments : hepatic , suprarenal , renal , and infrarenal . since many transformations can occur during the formation of the ivc such anomalies occur in 0.3% of otherwise healthy individuals , and in 0.6% to 2% of patients with other cardiovascular anomalies.4 ruggeri et al reported 10 years ago 4 cases of congenital absence of the ivc in 75 young patients with idiopathic dvt over a 5-year period , and estimated that 5% of young patients with dvt had an anomaly of the ivc.5 venous thrombosis is caused by the presence of isolated or combined risk factors . almost 150 years ago , the nineteenth century pathologist rudolf virchow described 3 critically important causes of venous thrombosis : venous damage , coagulation defect(s ) , and venous stasis.6 individuals with a congenital anomaly of the ivc are typically asymptomatic , and the anomaly is usually detected incidentally during radiological or abdominal procedures . congenital absence of the ivc is infrequently associated with thromboembolic events.5 patients who suffer from congenital anomalies of the ivc usually develop a compensatory circulation through the azygos veins or collateral abdominal veins in order to keep the venous return near normal levels.7 most reported cases of congenital anomalies of ivc cases have been linked to thrombophilia disorders.3,5,7 however , the true prevalence of thrombophilia in congenital anomalies of the ivc is unknown because the screening for thrombophilia in patients with an ivc anomaly was usually incomplete.3 anticoagulants , but not thrombolytic therapy , are usually prescribed for venous thrombosis , but the duration of the anticoagulant therapy is not well established . hence , anticoagulant therapy for an indefinite duration will probably be prescribed , unless vascular reconstructive surgery is done on the anomalous ivc . such surgery has been rarely reported , and its long - term outcome is undetermined.8 congenital anomalies of the ivc may cause recurrent dvt , especially in young individuals .

background : agenesis of the inferior vena cava ( ivc ) as a cause of recurrent deep vein thrombosis ( dvt ) is uncommon.case:a 33-year - old male with no family history of thrombophilia , who had experienced multiple recurrent episodes of dvt over a 15-year period of unknown cause , was admitted into our hospital because of cellulitis in the right leg . computer tomography with contrast of the abdomen showed an absence of ivc.conclusion:congenital absence of the ivc could be a rare risk factor for idiopathic dvt , especially in young individuals .

please summarize the articles given below

a review of the literature and an extensive medline search revealed that this is the first case report of the use of guaifenesin to increase sperm motility . he reported an inability to conceive with his wife after 18 months of unprotected intercourse . a semen analysis was performed that included spermatozoa count , liquefaction , morphology , motility , viscosity and volume . two months after guaifenesin therapy the semen analysis was repeated that demonstrated marked improvement in both total sperm count and motility . evidence for the effectiveness of guaifenesin is almost entirely anecdotal . given the mechanism of action of guaifenesin , it is not clear from this case why the patient demonstrated such a large improvement in both sperm count and motility . additional studies of the effects of guaifenesin on male fertility could yield information of the medication s effect on men with normal or decreased total sperm counts . there are currently anecdotal reports and popular news media stories on the use of guaifenesin , particularly the brand name product robitussin ( pfizer , inc . , new york , ny ) , for use in treating both male and female infertility.14 guaifenesin is an expectorant medication sold over the counter and usually taken by mouth to assist expectoration of phlegm from the airways in acute respiratory tract infections . its mode of action in treating infertility is not well understood , but it appears to decrease mucus viscosity . a 32-year - old male patient presented to his primary care provider for an infertility evaluation . the patient is a nonsmoker , who consumes little or no alcohol with no known allergies . a recent screening exam for pulmonary tuberculosis was negative and the patient had recently undergone a required military service physical exam . he reported an inability to conceive with his wife after 18 months of unprotected , regular intercourse . as part of a routine infertility evaluation a semen analysis was performed that included spermatozoa count , liquefaction , morphology , motility , viscosity and volume ( cpt code 89320 ) . initial results of the semen analysis demonstrated low sperm count and motility ( table 1 ) . this sample , as well as the follow - up sample , were obtained through masturbation and provided to the lab within 30 minutes of collection . the patient s primary care provider offered treatment with guaifenesin 600 mg extended release tablets twice daily . the repeat semen analysis demonstrated marked improvement in both total sperm count and motility ( table 1 ) . the patient made no other significant lifestyle changes during the treatment course with guaifenesin . at the time of writing this case report describes the semen analysis laboratory results in a male patient who was given guaifenesin . guaifenesin is a mucolytic agent usually taken orally to assist the expectoration of phlegm from the airways in acute respiratory tract infections . scientific evidence for the effectiveness of guaifenesin is almost entirely anecdotal ; a review of medical literature revealed very limited data on use of guaifenesin for infertility.5,6 there appeared to be some improvement in a small study without controls of female infertility related to hostile cervical mucus.5 check regards guaifenesin as the simplest but least effective method of improving cervical mucus.7 given the proposed mechanism of action of guaifenesin , it is not clear from this case why the patient demonstrated such a large improvement in both sperm count and motility . additional study of the effects of guaifenesin on male fertility suggests the need to conduct a more rigorous placebo - controlled clinical trial that could yield information of the medication s effects on men with normal or decreased total sperm counts . primary diffuse leptomeningeal gliomatosis ( pdlg ) is a rare neoplasm with a short survival time of a few months . we report on a 53-year - old male patient who presented with epileptic seizures , gait disturbance , paraparesis and sensory deficits in the dermatomes t8 - 10 . magnetic resonance imaging ( mri ) revealing numerous spinal and cranial gadolinium - enhancing nodules in the meninges and histopathology led us to diagnose primary diffuse leptomeningeal gliomatosis with who grade iii astrocytic cells . consecutively , the patient underwent craniospinal radiotherapy ( 30 gy ) and 11 sequential cycles of temozolomide . thirteen months later , spinal mri revealed tumor progression . second - line chemotherapy with 5 cycles of irinotecan and bevacizumab did not prevent further clinical deterioration . the patient died twenty - two months after diagnosis , being the longest survival time described thus far with respect to pdlg consisting of astrocytic tumor cells . radiochemotherapy including temozolomide , as established standard therapy for brain malignant astrocytomas , might be valid as a basic therapeutic strategy for this pdlg subtype . primary diffuse leptomeningeal gliomatosis ( pdlg ) is diagnosed when a glioma is located in the subarachnoid space , while intraparenchymal tumor lesions are absent . pdlg must be distinguished from secondary meningeal gliomatosis resulting from a primary gliomatous cns tumor . pdlg , especially when caused by malignant astrocytic cells , is associated with very poor survival . we describe a patient with pdlg consisting of malignant astrocytic cells who underwent combined radio- and chemotherapy leading to the longest survival time described in the literature thus far . a 53-year - old man was referred to the dept . of neurology due to a generalized epileptic seizure and five months later he presented with bilateral sensory deficits at dermatome levels t8 - 10 , paraparesis and gait disturbance . cerebrospinal fluid ( csf ) analysis revealed a high cell count ( 300/3 cells/l ; reference range : 5/3 cells/l ) with atypical cells that could not be further characterized . t1-weighted images ( t1-wi ) revealed spinal and cranial gd - enhancing nodules in the leptomeninges ( figures 1a - e ) and on t2-weighted images ( t2-wi ) an intramedullary edema ( figure 1c ) . note gd - enhanced supra- and in - fratentorial meningeal thickenings of the brain in sagittal t1-w image ( a ) . prior to ra - diochemotherapy , t1-wi reveals lep - tomeningeal gd - enhancement ( b ) and t2-wi shows edema of the myelon on levels c7 , t1 - 2 and t5 - 6 due to minor tumor extensions in the adjacent spinal cord ( c ) . following radiochemotherapy , t1-wi displays reduced leptomeningeal gd - enhancement ( d ) while t2-wi shows less myelon spinal edema on those levels ( e ) . three weeks later , intradural biopsy from a gd - enhancing nodule at l2 - 3 level revealed fibrously - thickened meninges infiltrated by malignant astrocytic tumor cells ( figures 2a - c ) . the tumor was categorized as primary diffuse leptomeningeal gliomatosis ( pdlg ) confirmed by the reference center for brain tumors in dsseldorf , germany . intradural lumbar biopsy displays fibrously - thickened lep - tomeninges infiltrated by pleomorphic neoplastic astrocytic cells ( a ) . the astrocytic tumor cells reveal intensive intracytoplasmic staining with anti - glial fibrillary astrocytic protein . ki67 ( mib-1 ) staining reveals a high proliferation index of up to 20% ( c ) . prior to radiotherapy of the craniospinal axis ( 4 2.5 gy / week , total dose : 30 gy ) , the patient underwent 3 cycles of temozolomide ( tmz ) ( cycle 1 : 150 - 200 mg / mtzm , d1 - 5 , q28d ) . on re - staging , spinal t1-weighted images showed tumor - lesion regression on l5 and spinal t2-wi images demonstrated spinal - edema regression ( compare figures 1c - d with figures 1a - b ) . three weeks after the completion of radiotherapy the patient received eight additional cycles of tmz ( 200 mg / mtzm , d1 - 5 , q28d ) , during which meningeal thickening of the brain regressed . however , spinal mri thirteen months after starting tmz therapy revealed meningeal tumor progression at the lesions on spinal levels c1 - 2 , c7-t2 and t5 - 8 . five cycles of second - line chemotherapy with irinotecan and bevacizumab failed to halt further clinical deterioration . the patient died twenty - two months after the diagnosis of pdlg and exhibited until dead an encouraging karnovsky performance status of 60% . the diagnosis of pdlg is usually established by autopsy but rarely diagnosed prior to death . pdlg of the oligodendroglial and that of the well - differentiated astrocytic tumor type are associated with a considerably longer median survival time than that of the malignant astrocytic tumor type . pdlg was diagnosed in the aforementioned case , as we observed on histopathology leptomeningeally - encapsulated malignant astrocytic cells without primary attachment to the spinal cord or brain parenchyma and gd - enhancing leptomeningeal thickening at the base of the brain and spinal level in mri . various treatment modalities were used for 14 patients suffering from pdlg with malignant astrocytic cells reported in the literature so far ( cf . table 1 ) , demonstrating the lack of a standardized treatment regimen of pdlg with malignant astrocytic cells . although the number of cases is small , the data on their survival times ( cf . table 2 ) might suggest that radiotherapy and temozolomide ( tmz ) as established treatment for newly diagnosed recurrent anaplastic astrocytomas also seem to be valid for pdlg with malignant astrocytic cells . this concept is supported by the observation that radiotherapy alone can prolong the median survival time of five months for patients without any specific therapy to a median survival of 12 months and that integration of tmz in the chemotherapy alone may lead to a prolonged median survival of 15 months . the importance of tmz in the chemotherapy treatment of pdlg is supported by the observation that the median survival time fell to 3 months when the integration of tmz was omitted . clinico - pathological characteristics and treatment of adult patients suffering from pdlg with malignant astrocytic cells including our case 5-fu = 5-fluouracil , adr = adriamycin , auc 5 = carboplatine , bcnu = carmustine , brs = brainstem , bvz = bevacizumab , c = cycle , ca = cytarabine , ccnu = lomustine , cr = cranial , cyc = cyclophosphamide , ddp = cisplatin , eto = etoposide , inn = topotecan , int = irinotecan , irp = raised intracranial pressure , it = intrathecally , mcnu = ramustine , mtx = methotrexate , sc = spinal cord , tmz = temozolomide , top = thiotepa , vincristine , prednison summary of the literature : pdlg with malignant astrocytic cells the prolonged survival of our patient may be due to the addition of tmz to radiation therapy as it resulted in an extent of the median survival time for high grade glioma patients . in addition , the hypofractionated radiotherapy regimen used is supposed to be more effective than conventional fractionated irradiation . additionally , the patient 's good karnofsky performance status may have contributed to our patient 's prolonged survival . in conclusion , we report on partial regression and long survival in a patient with pdlg of the malignant astrocytic type following hypofractionated radiotherapy and tmz . an immediate radiochemotherapy seems crucial for a prolonged survival of pdlg patients in good general condition . the authors disclose no or potential conflict of interest including any financial , personal or other relationships with other people or organizations within the three years of beginning the submitted work that could inappropriately influence or be perceived to influence their work .

backgrounda review of the literature and an extensive medline search revealed that this is the first case report of the use of guaifenesin to increase sperm motility.casea 32-year - old male presented for an infertility evaluation . he reported an inability to conceive with his wife after 18 months of unprotected intercourse . a semen analysis was performed that included spermatozoa count , liquefaction , morphology , motility , viscosity and volume . initial results of the semen analysis demonstrated low sperm count and motility . the provider offered treatment with guaifenesin 600 mg extended release tablets twice daily . two months after guaifenesin therapy the semen analysis was repeated that demonstrated marked improvement in both total sperm count and motility.conclusionevidence for the effectiveness of guaifenesin is almost entirely anecdotal . given the mechanism of action of guaifenesin , it is not clear from this case why the patient demonstrated such a large improvement in both sperm count and motility . additional studies of the effects of guaifenesin on male fertility could yield information of the medication s effect on men with normal or decreased total sperm counts .

please summarize the articles given below

a 60-year - old woman ( height , 162 cm ; weight , 61 kg ) visited pain clinic with tactile allodynia and electric shock - like pain in the left dorsal scapular area around the t3 dermatome , which had been diagnosed as phn about 1 month previously and attack of the herpes zoster was 1 year ago . the 100-mm visual analogue scale ( vas ) of allodynia and electric shock - like pain was rated between 70 and 80 mm on a scale from 0 ( no pain ) to 100 ( worst pain imaginable ) . the interlaminar epidural block was performed at the t3 - 4 space by the paramedian approach with 5 ml of 0.2% ropivacaine and 20 mg of triamcinolone acetate . pregabalin and morphine at doses of 150 mg and 10 mg , respectively , twice a day , amitriptyline at a dose of 10 mg before sleep and topical lidocaine patches were prescribed . dosages of all drugs were adjusted depending on the side effects during the follow - up period . epidural blocks were repeated twice with a 1-week interval and the continuous intravenous infusion of ketamine ( 60 mg ) was performed over a period of 1 hour twice a week under careful monitoring . after 1 month elapsed , electric shock - like pain was reduced to a vas score of 30/100 , but allodynia was not diminished ( vas score of 70/100 ) . after 4 months elapsed , we decided to administer magnesium sulfate via the intravenous route . and it was done with continuous intravenous infusion of 1,000 mg of magnesium sulfate in 50 ml of normal saline for 1 hour . before and after infusion , the serum magnesium levels were checked . after magnesium therapy , she felt very good about her pain and the vas of allodynia was reduced to 40 - 50 . at 1-week follow - up , she was very satisfied with the treatment and reported the reduction of allodynia on the dorsal scapular area of up to 50% ( vas 25 - 30/100 ) . however , the serum magnesium level had increased above normal range ( 2.3 meq / l to 2.9 although it was below the serum level reveals of the adverse effect , we decided to stop intravenous infusion of magnesium sulfate . for more accurate and safe delivery of magnesium to the target site , we applied magnesium using the transforaminal epidural injection technique . with the patient 's informed consent , left t3 tfemi identification of the t3 nerve root sheath and epidural space was performed using contrast media ( fig . 1 ) . then , 100 mg of magnesium sulphate and 1 ml of 0.2% ropivacaine ( total volume , 2 ml ) was carefully injected . tfemi was repeated twice with a 1-week interval ( total of three times ) and the degree of pain decreased gradually during the follow - up period . one week after the last procedure , the vas score of allodynia decreased to 15/100 and all medications except pregabalin were discontinued . the vas was 10/100 throughout 1-month follow - up , and pregabalin had also been tapered . to our knowledge , no previous report has described about the magnesium administration by the transforaminal epidural route in patients with neuropathic pain . here , in our report of phn patient , this treatment resulted in effective pain relief . previous studies have demonstrated the anti - allodynic effects of nmda receptor antagonists in neuropathic pain disorders . among the currently available nmda receptor antagonists , ketamine is the most widely used one for the treatment of neuropathic pain . however , ketamine is not always effective and psychomimetic side effects are frequent . magnesium can antagonize nmda receptor channels by blocking calcium influx in a voltage - gated manner . intravenous administration of magnesium is efficacious in the management of various conditions associated with neuropathic pain , including phn . demirkaya and colleagues revealed 1 g i.v . mg sulfate is effective in the treatment of migraine attacks and collins and colleagues reported that 70 mg / kg magnesium sulphate infusions in 4 hours for 5 days reduced pain in patients with complex regional pain syndrome . whether intravenous administration of magnesium can achieve a sufficient concentration in the cerebrospinal fluid to block nmda receptors is unclear and studies have reported on the limited efficacy of magnesium when administered via the intravenous route . furthermore , even if the dose of intravenously administered magnesium is not sufficient to present toxicity , patients are still at risk of magnesium overdose . neuraxial administration of magnesium is an " off - label " use , and the safety of this technique in human subjects is still undetermined . however , animal studies showed that intrathecally administered magnesium was free of neurotoxicity , and recent studies have demonstrated the safety of magnesium administration via the epidural or intrathecal route in humans . in fact , the exact site of action of epidurally administered magnesium ( i.e. , spinal or supraspinal ) remains unclear . however , comparison with previous reports regarding intravenous magnesium administration suggested that the low dose epidural magnesium used in our patient was unlikely to result in systemic effects . in conclusion , tfemi showed a favourable result in the treatment of intractable allodynia associated with phn . this study was performed in only a single case , and further investigations are required to determine the efficacy of tfemi in the management of allodynia in patients with phn .

because of rampant concern that estrogenic chemicals in the environment may be adversely affecting the health of humans and wildlife , reliable methods for detecting and characterizing estrogenic chemicals are needed . it is important that general agreement be reached on which tests to use and that these tests then be applied to the testing of both man - made and naturally occurring chemicals . as a step toward developing a comprehensive approach to screening chemicals for estrogenic activity , three assays for detecting estrogenicity were conducted on 10 chemicals with known or suspected estrogenic activity . the assays were 1 ) competitive binding with the mouse uterine estrogen receptor , 2 ) transcriptional activation in hela cells transfected with plasmids containing an estrogen receptor and a response element , and 3 ) the uterotropic assay in mice . the chemicals studied were 17 beta - estradiol , diethylstilbestrol , tamoxifen , 4-hydroxytamoxifen , methoxychlor , the methoxychlor metabolite 2,2-bis(p - hydroxyphenyl)-1,1,1-trichloroethane ( hpte ) , endosulfan , nonylphenol , o , p'-ddt , and kepone . these studies were conducted to assess the utility of this three - assay combination in the routine screening of chemicals , or combinations of chemicals , for estrogenic activity . results were consistent among the three assays with respect to what is known about the estrogenic activities of the chemicals tested and their requirements for metabolic activation . by providing information on three levels of hormonal activity ( receptor binding , transcriptional activation , and an in vivo effect in an estrogen - responsive tissue ) , an informative profile of estrogenic activity is obtained with a reasonable investment of resources.imagesp1296-afigure 1.figure 2.figure 3.figure 4.figure 5 .

please summarize the articles given below

the following section describes the treatment procedure for patients with deep infection following tka using modified static spacers . the original prosthesis was removed , followed by intensive irrigation and wide debridement of the infected soft tissue . a 36 fr - diameter straight thoracic catheter ( mallinckrodt medical , athlone , ireland ) and a steinmann pin measuring 3.0 mm in diameter and 22 cm in length vancomycin ( 2 g ) was then added to the gentamicin bone cement ( depuy , warsaw , in , usa ) . at the late liquid stage of the cement , the steinmann pin was inserted into the tube , and the prepared cement was delivered through the tube . during this procedure , the tube was removed from the cement rod using a surgical knife . finally , a cement rod measuring 9 mm in diameter and 22 cm in length was formed ( fig . an entry hole was created at the center of the distal femur and proximal tibia for the insertion of the cement rod . the rod was then inserted into the femur and tibia through this hole . during insertion , it was important to place the center of the cement rod on an imaginary joint line . the proximal medullary canal of the tibia was filled with antibiotic - impregnated cement up to the surface of the proximal tibia , while the surgical assistant maintained proper anatomic alignment and joint space . the space between the cement of the distal femur and the proximal tibia was filled with more antibiotic - impregnated cement . finally , the suprapatellar pouch and medial and lateral gutter space were filled with antibiotic - impregnated cement to reduce soft tissue adhesion ( fig . cylinder splint immobilization was required for three days after the operation , after which a fixed - angle knee brace was used and toe - touching ambulation was allowed until the reimplantation surgery . from april to november 2007 , the authors performed the static technique in four patients using the novel antibiotic - impregnated cement rod for the treatment of infected tka ( culture : staphylococcus in three cases and no bacteria in one case ) . follow - up laboratory studies , including erythrocyte sedimentation rate and c - reactive protein , culture study via knee aspiration and a frozen biopsy from the second - stage operation ( < 5 polymorpho - leukocytes / high power field ) were performed to confirm successful eradication of the infection . the second - stage reimplantation was performed when all the criteria for the validation of infection control were met ( fig . the second - stage reimplantation was performed using the rectus snipping approach , and more than 90 of flexion was obtained intra - operatively . in all four patients , no re - infection was evident after two and a half years of follow - up . the range of motion of the knee joints were respectively improved from 50 to 80 , 95 , and 100 , and the knee society scores were 70 , 86 , 65 , and 84 , respectively , in the last follow - up evaluation . fehring et al.8 ) emphasized the importance of resting the joint in septic joint conditions . others also reported that the static spacer technique provides more stability than the mobile spacer technique in patients with severe bone loss.5,8 ) the main advantage of this technique is the maintenance of a normally aligned lower limb during the interval period . this maintains knee stability in combination with early muscle strengthening exercises , including quadriceps setting exercise , and enables the patient to comfortably dress and manage him / herself during the intervening period . the cement rod and static spacer provide a stable gap between the femur and tibia , thereby minimizing soft tissue contracture and shortening of the lower limb . in addition , symmetric maintenance of the soft tissue of both medial and lateral gutters requires no additional soft tissue balancing at the second - stage reimplantation . the additional cost of a metal nail , however , and the difficulty in infection control due to biofilm formation around the metal nail can be troublesome . in addition , a metal nail can not be removed easily at the second stage reimplantation due to its hardness , and soft tissue adhesion of the femoral or tibial medullary canals . on the other hand , an antibiotic - impregnated cement rod enjoys advantages , such as inexpensive antibiotic delivery to the marrow spaces and easy removal by using a hercules cutter . in addition , a static spacer is anchored to the cement rod , which can prevent spacer migration and bone erosion . this feature is believed to generate less cement wear debris than with the conventional static spacer or mobile articulating spacer technique . during the conduct of the antibiotic - impregnated cement rod technique , antibiotic - impregnated cement was applied to the proximal tibia , distal femur , joint gap space , suprapatellar pouch , and both gutters in a stepwise manner . this technique enables easy removal of the cement and reduced soft tissue adhesion at second - stage reimplantation . ankle dorsiflexion passive range of motion ( df prom ) measurements are performed in the field of physical therapy to estimate ankle motion during functional activities1 and to prevent lower extremity injuries2 . although in the clinical setting , ankle df prom is frequently measured under non - weight - bearing ( non - wb ) conditions1 , 3 , 4 , many researchers have stated that the wb position is more appropriate for estimating the amount of ankle df motion during functional activities5 , 6 . therefore , wb ankle df prom should be measured during interventions focused on increasing ankle df prom . limited ankle df prom with knee extended may result from gastrocnemius tightness and insufficient posterior talar glide7 . thus , gastrocnemius stretching and talocrural joint mobilization have been performed as intervention strategies to increase ankle df prom3 , 8 , 9 . previous studies have reported a significant increase in ankle df prom after these interventions3 , 8 , 9 ; however , to our knowledge , no study has demonstrated the combined effect of both interventions on wb ankle df prom . therefore , the aim of the present study was to examine the influence of gastrocnemius stretching combined with joint mobilization on wb ankle df prom . in total , 11 male subjects with bilateral limited non - wb ankle df prom with knee extended ( mean age , 22.82 3.09 years ; mean height , 175.91 3.39 cm ; mean weight , 69.55 3.78 kg ; mean non - wb ankle df prom , 4.17 2.48 ) participated in this study . inclusion criteria were 1 ) ankle df prom with knee extension < 10 ; 2 ) ankle df prom with knee flexion > 10 ; and 3 ) > 5 difference in ankle df prom between knee extension and knee flexion conditions on bilateral sides in non - wb positions3 . subjects with a history of surgery on the lower extremity , fracture , or neurological diseases were excluded from this study . all participants signed an informed consent form approved by the institutional research review committee of inje university prior to participation in this study . the study protocol of this study complies with the ethical standard of the declaration of helsinki . wb ankle df prom with knee extended was measured following the procedures suggested by munteanu et al10 . subjects stood in front of a wall and placed the leg being tested behind the contralateral leg in a lunge posture . subjects were asked to place both hands on the wall and then lean forward without heel - off and knee flexion until maximum stretch was felt in the gastrocnemius on the tested leg . the force applied to the tested leg was maintained at 60 5% of the subject s weight using scales11 . an examiner determined the maximum tibial inclination using an inclinometer to measure the wb ankle df prom with knee extended . measurements of wb ankle df prom were repeated 3 times for each ankle under pre- and post - intervention conditions . the mean value of 3 trials was used for data analysis . for gastrocnemius stretching combined with joint mobilization , subjects leaned forward against the wall in the same lunge posture as that during measurement of wb ankle df prom with knee extended until the maximum gastrocnemius stretch was felt . subjects held the end - range posture while an examiner provided the talus of the tested leg with sustained anterior - to - posterior gliding force . an intervention trial was performed for 30 s , and 10 trials were repeated with 30-s rest periods for each ankle . the difference in wb ankle df prom with knee extended between pre- and post - intervention conditions was analyzed using a paired t - test . wb ankle df prom with knee extended was significantly increased in post - intervention compared with pre - intervention conditions ( 42.60 5.49 versus 38.24 4.69 , p < 0.001 ) . our findings demonstrate that gastrocnemius stretching combined with joint mobilization significantly increases wb ankle df prom with knee extended . stretching exercises increase tolerance , resulting in increased rom12 . additionally , increased displacement of the myotendinous junction ( mtj ) after gastrocnemius stretching for 5 min was found in a previous study13 . therefore , the change in tolerance and/or increase in mtj displacement might have influenced our findings . the addition of talocrural joint mobilization to gastrocnemius stretching is another possible explanation for our findings . previous research by dinh et al.3 showed a 4.25 increase in wb ankle df prom with knee extended after gastrocnemius stretching alone for 3 weeks . although gastrocnemius stretching combined with joint mobilization was applied for 5 min in the present study , the amount of increase in wb ankle df prom after intervention ( i.e. , 4.36 ) was similar to that found previously . considering this outcome , despite the relatively short period of intervention in the present study , it may be inferred that the addition of talocrural joint mobilization might maximize the effects of general gastrocnemius stretching . thus , we conclude that gastrocnemius stretching combined with joint mobilization might decrease gastrocnemius tightness and increase posterior talar gliding movement , which effectively increases wb ankle df prom with the knee extended . first , although non - wb ankle df prom was used as an inclusion criterion , changes in non - wb ankle df prom after intervention were not measured . however , we believe that wb ankle df prom is clinically more important because most functional activities are performed under the wb condition . second , our study included only male subjects , and the results can not be generalized to women .

the two - stage exchange arthroplasty ( one- or two - stage ) is believed to be the gold standard for the management of infections following total knee arthroplasty . we herein report a novel two - stage exchange arthroplasty technique using an antibiotic - impregnated cement intramedullary nail , which can be easily prepared during surgery using a straight thoracic tube and a steinmann pin , and may provide additional stability to the knee to maintain normal mechanical axis . in addition , there is less pain between the period of prosthesis removal and subsequent reimplantation . less soft tissue contracture , less scar adhesion , easy removal of the cement intramedullary nail , and successful infection control are the advantages of this technique .

please summarize the articles given below

an estimated 170 million people worldwide have hepatitis c virus ( hcv ) infection and over 20,000 new cases emerge every year . hcv infection frequently persists and may cause cirrhosis and hepatocellular carcinoma . in the us and most developed nations , where the prevalence of infection is 1%2% , hcv is the leading cause of chronic liver disease.1 hcv infection is a serious public health problem in egypt , and is the country with the highest hcv prevalence , where 10%20% of the general population is infected.2 interferons are a group of glycoproteins that modulate the activity of the immune system . recombinant alpha - interferon ( ifn ) has recently been approved as a therapy for chronic hepatitis c , for its antiviral effects and inhibition of cell proliferation.3 although interferon - based therapy is widely used for the treatment of chronic hcv , it is not without its disadvantages . treatment duration lasts for months , and is often fraught with potentially dangerous side effects . some of these side effects , such as influenza - like illness , myalgias , depression , and cytopenias can be intolerable resulting in premature treatment cessation , but have no lasting effects . ocular complications are among the complications of interferon therapy and include retinal hemorrhages , cotton wool spots , loss of color vision , cataracts , glaucoma , and occasionally retinal artery or vein obstruction . although the incidence of ophthalmological disorders while on interferon therapy is low , this can result in loss of vision.411 in this prospective case series study , one hundred patients with chronic hepatitis - c under interferon ( inf ) therapy were consecutively recruited from patients attending the outpatient ophthalmic clinic at the university hospital , faculty of medicine , al - azhar university , assuit . the study protocol was approved by the ethics committee at al - azhar university hospital . written informed consent was obtained from all patients included in the study , and then in addition to the medical and laboratory examination , all patients were subjected to full ophthalmological assessment to evaluate the retinopathy associated interferon therapy . inclusion criteria were : ( 1 ) seropositivity for anti - hcv antibodies determined using elisa ; ( 2 ) first use of interferon therapy . exclusion criteria were : ( 1 ) previous interferon therapy ; ( 2 ) patients with hepatitis b ; ( 3 ) patients with decompensated liver ; ( 4 ) patients with renal failure ; ( 5 ) patients with cardiovascular disorders such as coronary insufficiency , congestive heart failure , and ischemic stroke ; ( 6 ) patients with a dense cataract , visual field abnormality , glaucoma , or any other ocular abnormalities . evaluation before treatment : history of visual loss , hazy vision , and ocular disease or ocular surgeries ophthalmological examination : ( 1 ) best corrected visual acuity ( bcva ) measured using landolt s broken rings ; ( 2 ) pupillary reaction ( direct and consensual ) and if there is afferent pupillary defect ; ( 3 ) full slit - lamp examination ; ( 4 ) intraocular pressure ( iop ) measured by goldmann s applanation tonometer ; ( 5 ) fundus biomicroscopy ( carried out after maximum pupillary dilation by a combination of tropicamide 1% eye drops and phenylephrine 2.5% eye drops using both slit - lamp biomicroscopy with noncontact + 90 d volk lens and/or goldmann contact lens ) ; ( 6 ) examination of the retinal periphery using an indirect ophthalmoscope . medical examinations and abdominal ultrasonography investigations : ( 1 ) ocular , both colored fundus photography and fundus fluorescein angiography ( ffa ) ; ( 2 ) laboratory ( including enzyme - linked immunosorbent assay ( ellsa ) test for hepatitis surface ag and ab ; polymerase chain reaction ( pcr ) for hepatitis c virus rna ; full blood count ; prothrombin time ; direct and indirect bilirubin ; fasting blood sugar ; serum creatinine ; liver enzymes ( serum glutamic oxaloacetic transaminase and serum glutamic pyruvic transaminase ) ; alanine aminotransferase . patients were treated with pegylated interferon -2a at a dose of 180 mcg injected subcutaneously once weekly for 48 weeks . all patients underwent clinical and laboratory assessments , ophthalmic examination , at 15 days , 1 month , 2 months , 3 months , 6 months , 8 months , and 9 months after the start of ifn treatment . patients were treated with pegylated interferon -2a at a dose of 180 mcg injected subcutaneously once weekly for 48 weeks . all patients underwent clinical and laboratory assessments , ophthalmic examination , at 15 days , 1 month , 2 months , 3 months , 6 months , 8 months , and 9 months after the start of ifn treatment . initially , 120 patients fulfilled the criteria for ifn therapy , but 20 of them were excluded due to non - compliance with the follow - up visits and due to the presence of diabetic or hypertensive retinopathy . also , two patients died during the study time , due to a disease not related to hepatitis , so these patients are not included . therefore , a total of 100 patients ( 68 male and 32 female ) , with chronic hcv were selected . after the start of interferon therapy , 16 out of 100 patients ( 16% ) developed retinopathy which was bilateral in 12 ( 75% ) patients and unilateral in 4 ( 25% ) patients . retinopathy was initially diagnosed by the appearance of a cotton wool spot in 14 patients . in four of the 14 patients , retinal hemorrhage two of the 16 patients who developed retinopathy were diagnosed by retinal hemorrhage without cotton wool spots . one patient ( not diabetic or hypertensive ) had cystoid macular edema , this was the only patient who complained of the visual disturbance due to interferon . all patients had bcva of ( 6/6 ) during ifn treatment except for three patients : the one who had cystoid macular edema ( bcva was 6/12 and returned to 6/6 after cessation of treatment ) and two patients with ametropic amblyopia . in addition , we confirmed that all patients with hypertension had no retinopathy using the standard classification . to exclude the possibility of the development of diabetic or hypertension retinopathy after ifn treatment , we deleted the data obtained from patients who had diabetes or hypertension and any retinopathy 2 months after the cessation of ifn treatment . retinopathy was first diagnosed 214 weeks after the start of treatment and disappeared in 11 of the 16 patients despite the continuation of therapy . a few cotton wool spots , retinal hemorrhages , or both were observed in the remaining five patients at the end of treatment but resolved within 1 month after treatment was stopped . no other ocular complications ( ie , cataracts , glaucoma , retinal artery , or vein obstruction ) were observed . the mean hemoglobin values , white blood cell , red blood cell , and platelet counts decreased significantly ( p < 0.0001 ) during ifn treatment . the clinical profiles and laboratory data of the patients are shown in tables 1 and 2 , respectively . interferon - associated retinopathy was first recognized in 1990 when ikebe and associates reported a 39-year - old patient who developed retinal hemorrhages and cotton wool spots following intravenous administration of interferon.12 the underlying mechanisms of interferon - induced retinopathy are not completely understood . guyer et al13 had proposed an immune complex deposition causing occlusion of retinal capillaries leading to cotton wool spot formation . on the other hand , an ischemic insult , similar to that seen in hypertensive and diabetic patients could be another potential mechanism by which these changes develop.14 some studies15,16 have shown a relatively higher incidence of retinopathy ( symptomatic or asymptomatic ) ranging from 19% to 64% during treatment with interferon . panetta and gilani17 and cuthbertson et al14 show relatively lower incidences of retinopathy ( 3.8% and 6.25% , respectively ) . similar to other studies,4,5,9 our study also shows that retinal changes usually develop within the first 3 months of interferon treatment , a fact that may favor an immune etiology rather than a cumulative effect of interferon leading to the development of retinopathy . retinopathy developed by week 14 in most of the patients ( 13/16 , 81.25% ) after the start of therapy and disappeared in the majority of the patients ( 11/16 , 68.75% ) during the 48 week period in which the patients were receiving the treatment . this suggests that treatment can be continued despite the development of retinopathy in many patients . however , two patients who developed cotton wool spots early in the therapy ( 2 weeks ) thereafter suffered from retinal hemorrhage in a prolonged manner . therefore , patients who develop cotton wool spots early on during therapy should be carefully monitored . however , as reported in previous studies,4,13,14 most of the patients with retinopathy in this study were asymptomatic . this study confirms previous reports that retinopathy is a temporary and asymptomatic complication of interferon therapy . therefore there is no rule for suspending the use of interferon in patients who develop retinopathy or any other ocular side effects . it s commonly agreed among authors that careful monitoring should be performed in the presence of any ocular sign , even without symptoms.18

we have prepared two new diastereoisomeric 2-aza-5-phosphabicyclo[2.2.1]heptanes from naturally occurring trans-4-hydroxy - l - proline in six chemical operations . these syntheses are concise and highly efficient , with straightforward purification . when we used these chiral phosphines as catalysts for reactions of -substituted allenoates with imines , we obtained enantiomerically enriched pyrrolines in good yields with excellent enantioselectivities . these two diastereoisomeric phosphines functioned as pseudoenantiomers , providing their chiral pyrrolines with opposite absolute configurations .

please summarize the articles given below

nathan , as an oncology fellow , knew well that white blood cells fought infections . this was an experiment repeated in front of us all the time , he says : chemotherapy lowered his patients ' white blood cells and increased their risk of infections . mackaness had shown that macrophage activation did not depend on direct contact with t cells ( 1 ) , suggesting the possibility of a secreted factor . when nathan tested the supernatant from activated t cells , he saw that it did indeed induce macrophage activation ( 2 ) . nathan got a rough idea of the molecular weight ( 3 ) , but that was the best anyone could do , he says . protein separation methods were primitive , and cloned proteins and monoclonal antibodies would only become available a decade later . henry murray , one of nathan 's collaborators , sums up the feeling of frustration : we were all nibbling at the edges of the same problem . nathan therefore changed tack to take a closer look at the activated macrophages . short - lived neutrophils were known to produce hydrogen peroxide , and nathan found the same was true of longer - lived activated macrophages ( 4 ) . unlike previous signs of macrophage activation increased spreading , phagocytosis , and glucose metabolism this so - called respiratory burst ifn had been on the cover of time magazine , and recombinant murine ifn was found to induce macrophages to kill tumor cells ( 5 ) . nathan , now a faculty member in zanvil cohn 's macrophage factory at rockefeller university ( new york , ny ) , thought ifn might also activate macrophages to kill intracellular parasites . consistent with this idea , ifn was made by antigen - stimulated t cells and was associated with defense from infection . now the respiratory burst gave nathan an assay , berish rubin ( down the street at the new york blood center ) supplied an ifn monoclonal antibody , and a phone call to genentech yielded recombinant ifn. in a seminal paper published in the journal of experimental medicine in 1983 , nathan was thus able to show that depleting ifn from unpurified t cell supernatants decreased the respiratory burst activity and the killing of intracellular protozoa in human macrophages . adding back recombinant ifn into this mix restored macrophage activation ( 6 ) . i had an assay , a hunch , a history of purifying proteins that did this , and the serendipity of meeting with people nearby who had the antibody . nathan next showed that ifn worked in people . injecting recombinant ifn directly into cutaneous lesions of lepromatous leprosy patients induced macrophage infiltration , hydrogen peroxide production , and killing of the causative pathogen , mycobacterium leprae ( 7 ) . in the 1990s , the macrophages of children with ifn receptor deficiencies were shown to be defective in killing mycobacteria ( 8) . tracing the pathway from t cells to macrophages to bacteria started , for nathan , in 1967 , and he says we still haven't finished making the molecular links . a glomangioma is a benign vascular tumor derived from the glomus body , a specialized neuromyoarterial structure involved in thermal regulation . it is a subtype of the more generalized category of glomus tumors and should not be confused with the head and neck paragangliomas , such as the glomus tympanicum or glomus jugulare . it should also be distinguished from the glomangiopericytoma , the sinonasal type hemangiopericytoma , which displays different ultrastructural and histochemical characteristics.1 glomangiomas are most commonly found subungually and are exceedingly rare in the head and neck.2 they account for only 0.6% of all nonepithelial tumors of the nasal cavity , nasopharynx , and paranasal sinuses.3 glomangiomas that induce paraneoplastic osteomalacia are even more uncommon , with only one case reported to date.4 while there are several documented cases of oncogenic osteomalacia ( oo ) caused by glomangiopericytomas,5 we present the second reported case of glomangioma - induced osteomalacia and the first case documented in english . a 42-year - old man with a history of unexplained hip , rib , scapula , and metatarsal fractures ; left foot pain with exercise ; and weakness presented to our clinic for evaluation of a paranasal sinus tumor . the endocrinology service initially diagnosed him with tumor - induced osteomalacia caused by fibroblast growth factor 23 ( fgf23 ) , which prompted an octreotide scan revealing a questionable area of enhancement in the pituitary . a subsequent magnetic resonance imaging ( mri ) showed an ethmoid mass extending through the cribriform intracranially , measuring 3.9 1.9 2.4 cm at its largest dimensions ( fig . the patient reported occasional sinus congestion , decreased sense of smell during the preceding 2 to 3 years and occasional blurry vision in the morning . his laboratory workup revealed a significantly decreased 1,25-vitamin d level of less than 8 ng / ml , a decreased phosphate level to 1.6 mg / dl , a low to normal calcium level of 8.7 mg / dl , and a significantly elevated alkaline phosphatase level at 65.3 g / l . preoperative mri , t1 with contrast , showing an ethmoid mass extending through the cribriform intracranially . the patient underwent a combined endoscopic endonasal approach to the anterior skull base with tumor resection . the cribriform defect and intraoperative cerebrospinal fluid ( csf ) leak pathology revealed a vascular neoplasm with a uniform cluster of ovoid cells arranged around the vessels and moderate focal nuclear enlargement ( fig . tumor cells stained positive for cd31 and smooth muscle actin ( sma ) but negative for cd34 , s100 , and pan - cytokeratin on immunohistochemistry ( fig . the patient reported near - complete resolution of bone pain and improvement in smell , and he had normalization of phosphate , alkaline phosphatase , vitamin d , and other laboratory values . repeat mri showed gross total resection of the mass and no detectable recurrence ( fig . 4 ) . postoperative mri , t1 with contrast , showing gross total resection of the mass with nasoseptal flap reconstruction of the skull base . osteomalacia is a disease of the bone characterized by defective mineralization of osteoid from decreased levels of available phosphate and calcium or increased bone resorption . it often presents with diffuse joint and bone pain , easy fracturing , difficulty walking , weakness , and other nonspecific symptoms . oo is a rare , disabling , and curable form of osteomalacia that affects both sexes equally and usually presents around 40 years of age.6 it is not well described in glomangiomas but has been detailed several times in relation to glomangiopericytomas and other soft tissue and bone tumors , with more than 300 reported cases7 since its debut in 1947.8 it predominantly occurs in the context of mesenchymal tumors and is thought to be due to neoplastic overexpression of fgf23 . this protein inactivates the sodium - phosphate pump in the proximal tubule ( prohibiting phosphate reabsorption and inducing renal phosphate wasting ) and reduces 1-hydroxylation of 25-hydroxy vitamin d.9 accordingly , common oo laboratory abnormalities include hypophosphatemia , normal or decreased calcium , decreased 1,25-dihydroxy vitamin d3 with resistance to vitamin d supplementation , and elevated alkaline phosphatase , which our patient exhibited . tumors causing oo tend to be small , occult , and slow growing , making diagnosis remarkably difficult . when other causes of osteomalacia have been ruled out and oo is suspected , clinicians should consider measuring a serum fgf23 level . elevated fgf23 in this setting should then prompt full body imaging ( including hands and feet ) to expose the lesion . the current imaging standard for investigation of oo is whole - body mri short tau inversion recovery ( stir).10 another commonly used modality is octreotide scintigraphy ( octreoscan ) , which utilizes a radiotracer that binds to somatostatin receptors overexpressed on the causative tumor.11 once the neoplasm is localized , surgical resection with wide margins is the definitive treatment . it is curative in essentially all cases and typically leads to rapid normalization of laboratory values and reversal of most clinical symptoms . the nonspecific presentation of osteomalacia , the obscure nature of the tumors that cause oo , and the rarity of glomangiomas in the head and neck make this patient 's diagnosis challenging . we believe this to be the second reported case of paranasal sinus glomangioma - induced osteomalacia and the first reported in english . many head and neck surgeons may not be aware of its existence or consider it in their differential diagnoses of sinus tumors . this report serves to increase the awareness of this uncommon pathology so that it may be considered and treated in future cases .

t cells tell macrophages when to start making the toxic soup of lysosomal enzymes , reactive oxygen species , and nitric oxide that destroys intracellular pathogens . in 1983 , carl nathan proved that this start signal comes in the form of the secreted cytokine ifn.

please summarize the articles given below

gestational trophoblastic disease describes a number of gynecologic tumors that originate in trophoblastic layer including hydatidiform mole ( complete or partial ) , invasive mole , choriocarcinoma , placental site trophoblastic tumor and epitheloid trophoblastic tumor . invasive mole may arise from any pregnancy event although in most cases is diagnosed after molar pregnancy . overall cure rate in low risk patients is nearly 100% and in high - risk patient 90% . in rare cases , molar tissue traverses thickness of myometrium and leads to perforation and acute abdomen and invasive mole infrequently metastasis . the best treatment option is chemotherapy ( according to stage and score with single or multiple agent ) and in patients that fertility is not the matter , hysterectomy can be done . a 41 years old g3p2ab1 woman referred to firouzgar hospital 2 months after curettage of molar pregnancy with vaginal bleeding and acute abdomen . in workup , hcg 224000 miu / ml and evidence of metastasis was detected . chemotherapy due to stage 3 and score 9 and surgery due to acute abdomen was done . this case reported about ovarian metastasis and uterine rupture with acute abdomen and involvement of omentum in metastatic invasive mole . management of this patient was successful . in follow up , she was free of disease without sequel of any kind for five years now . invasive mole is penetration of molar tissue ( complete or partial mole ) into myometrium or uterine vasculature ( 1 , 16 , 19 ) . pathologists mention the existence of villi in trophoblastic tissue ( 8 , 12 ) . locally invasive gestational trophoblastic neoplasia develops in 15% of patients and metastatic form in 4% of patients after evacuation of complete mole and infrequently after partial mole ( 2 ) . hcg level ( > 100000 miu / ml ) , excessive uterine enlargement , theca lutein cyst size 6 cm are considered as high risks for developing post molar tumors ( high risk mole ) ( 3 ) . the most common symptom of invasive mole is persistent vaginal bleeding after evacuation of molar pregnancy ( sub involution of uterus and persistent theca lutein cyst is another symptom ) . the rise in hcg titer is a laboratory test for diagnosis of invasive mole in follow up of molar pregnancy . although definite diagnosis of invasive mole is based on pathology ( 8) , with hcg or radiologic diagnosis ( 9 ) , invasive mole is diagnosed as well . in rare cases , metastasis occurred and the most common sites were lungs ( 80% ) ( 4 ) , vagina ( 30% ) , pelvis ( 20% ) , liver ( 10% ) , brain ( 10% ) , bowel and kidney and spleen ( < 5% ) were other metastatic sites . metastasis can occur from direct extension of another pelvic neoplasm or by hematogenous or lymphatic spread or by transcelomic dissemination . possibility of metastasis to ovary is extremely rare which is even much lower than that of nongestational primary ovary choriocarcinoma with an incidence of 1 in 3.710 ( 5 ) . invasive mole is curable with chemotherapy but hysterectomy decreases the need for multiple courses of chemotherapy and in patients with heavy bleeding or sepsis for control of complication and stabilization , chemotherapy is needed ( 6 , 11 ) . here a case with invasive mole after evacuation of molar pregnancy , presented with acute abdomen and in surgery metastasis to ovary and omentum and parametrium was detected . a 41- year- old housewife woman , gravid 3 para 2 live child 2 ( all nvd ) with a last 10 years old child referred to firouzgar hospital on 24 august 2010 with a history of a dilation and curettage and 2 months of cough . on examination , she was febrile ( 38c . , tachycardia , leukocytosis ( 16000 ) and uterus was tender and enlarged . vaginal bleeding persisted and second curettage was done in another hospital . at that time , chest x - ray was normal . in our hospital , report of sample pathology given from first and second curettage was complete mole . after molar evacuation , the patient was not monitored for weekly determination of hcg level . she received antibiotics ( due to fever ) and work up for malignant trophoblastic disease or persistent gtn was done because of high hcg level ( 224000 miu / ml ) and much too enlarged uterus and involvement of the whole uterine parenchyma , which was detected on sonography ( largest tumor size in uterus was 6 cm ) . thyroid function test demonstrated hyperthyroidism . in the metastatic work up , ct scan of chest and abdomen and brain was carried out . ct scan of the abdomen and pelvis showed involvement of the left adnexa and pelvic lymphadenopathy . the patient s chest ct scan showed multiple bilateral round pulmonary metastatic lesions that were 2 cm in diameter , illustrated in figure 1 . pulmonary metastasis in invasive mole once the disease was diagnosed , the patient chemotherapy with ema started ( table 1 ) . because of acute abdomen and severe abdominal pain and unstable vital signs with diagnosis of perforative peritonitis , the patient was taken up for emergency laparotomy . due to hyperthyroid state , in induction of anesthesia , blocker agent was administered . in this patient , subtotal hysterectomy and left salpingo oophorectomy and resection of omentum were done . in gross uterus , uterine wall was perforated by tumoral invasion on the left side of posterior wall ( figure 2 ) . enlarged uterus , ovarian metastasis , perforation of uterus , and myometrium invasion the patient was iii:9 according to figo staging and who scoring ( 7 ) the bilateral uterine parameters , the external surface of the endocervical canal and the omentum were invaded by tumors . villous formation in myometrium villosity with necrosis in invasive mole this patient was treated with 4 courses of chemotherapy with ema - co . after negative hcg ( < 5 ) , she received an additional 3 courses of chemotherapy to reduce the relapse . hcg titer was later tested monthly for1 year . when the first year of testing hcg terminated , hcg testing on a bimonthly basis for 2 years was done . the patient was followed up to 5 years and after that the patient was free of tumor and the hcg was negative . invasive mole with rupture of uterus and metastasis to ovary and omentum and manifestation of acute abdomen was rare ( 5 ) . according to epidemiological retrospective survey , invasive mole secondary to hydatidiform mole occurred in six months after evacuation ( 5 , 3 ) . partial and complete hydatidiform mole are distinct disease processes with characteristic cytogenetic , histologic , and clinical features ( 8) . ( 13 ) reported a case of invasive mole presenting as acute hemoperitoneum that was similar to the present case . molar tissue can penetrate myometrium ( 9 ) and lead to uterine perforation ( 13 ) and cause vaginal bleeding due to erosion of uterine vessels ( 14 , 15 ) . similar to atala et al.s case report in 1991(14 ) , in our case , uterine perforation with acute intra peritoneal hemorrhage was seen . due to ease of entry of molar tissue into large venous lake present in myometrium and pelvis in pregnancy or trophoblastic disease metastasis of invasive mole commonly in lungs and after lungs in vagina , cervix , broad ligament ( 16 , 19 ) , in our case metastasis to lung and ovary and omentum although theca lutein cysts in high - risk mole due to high serum hcg level are seen normally , they regress spontaneously within 24 months ( 17 ) . non gestational choriocarcinoma of ovary is differential diagnosis ( 5 ) but due to occurrence of metastasis to ovary in our case after molar pregnancy , this differential diagnosis was not a matter . as in a report of invasive mole in fallopian tube ( 21 ) , the first misdiagnosis of our case in another hospital , repeat curettage was done , although the first diagnosis could be persistent gtn . in another case report ( 15 ) from bruner , similarity with our case was seen . combination chemotherapy should be continued in such cases as far as toxicity permits until the patient achieves 3 consecutive normal hcg levels ( 9 , 18 ) . as normal hcg levels are attained , 3 additional courses of chemotherapy are administered to reduce the risk of relapse . in low risk patients , one or two courses are adequate ( 19 ) . in our case , 3 courses of chemotherapy after normalization of hcg were done . hysterectomy may be required in invasive mole in order to control vaginal bleeding and in unstable patient or in sepsis ( 6 , 20 ) . hysterectomy is a reasonable option for patients who do not wish to preserve their fertility , but it does not prevent metastasis ( 20 ) . furthermore , in patients with extensive uterine tumor , hysterectomy may substantially reduce the trophoblastic tumor burden ( 20 ) and thereby limit the need for multiple courses of chemotherapy . in our case , due to unstable and uterine rupture , hysterectomy was done but the need for chemotherapy courses was not removed and after several courses of chemotherapy with ema - co courses , it was cured . however , final diagnosis of our patient was invasive mole with metastasis to ovary and omentum and lung ( stage 3 ) and uterine rupture . the patient responded to the treatment well and in follow up this patient was still fine for 5 years after definite care for metastasis invasive mole with surgery and chemotherapy . an invasive mole in uterus with ovarian and omental metastasis was diagnosed and the patient was successfully treated by hysterectomy and chemotherapy and she was fine for 5 years in follow up . temporary henna tattoos or pseudotattoo have become increasingly widespread among children and adolescent , as a safe and economic alternative to permanent tattoos . it is well - known that allergic skin reactions to natural henna are rare , due to its extremely low rate of sensitization . in india , north of africa , china , and egypt , it is used in weddings and religious ceremonies ; in occident , it is used to dye hair and cosmetics . paraphenylenediamine ( ppd ) , a powerful allergen , is added to the henna tattoo mixtures ( black henna tattoo ) to decrease application time and intensify the color . we describe the case of a 7-year - old boy who reported erythematous papular bulls - eye shaped lesions and consolidated edema primarily in the upper and lower extremities [ figure 1 ] . he also showed an erythematous - eczematous lesion on his leg , shaped like a dolphin [ figure 2 ] , and lesions compatible with erythema multiforme - like reaction . erythematous papular lesions contact eczema in the tattoo area dolphin shaped patch tests were performed , and we observed a high sensitivity after 48 h and moderate after 96 h. we reported a positive reaction to ppd . henna has been used to paint the skin for adornment and religious reasons for 9000 years and in over 60 countries . christians , jews , muslims , hindus , and buddhists have used henna as part of their religious customs . the henna is a flowering plant native to northern africa , western and southern asia in semi - arid zones , used since antiquity to dye skin . it has a great affinity for keratinocytes , and it is used to create temporary tattoos , without it being necessary to puncture the skin . black henna contains an ingredient in addition to pure henna to achieve its ebony color . in most cases , this added ingredient is ppd , a powerful sensitizer that should not be directly applied to the skin as it may cause mild contact dermatitis . one of the most dangerous applications of this chemical is when it is added to henna because the dye is applied while the ppd is in its oxidation process , and its potential as allergen is increased . when added to henna , the concentration of ppd is often much higher than what is approved for use in hair dyes . the cause of the sensitivity to ppd is unknown ; it is believed that the mechanism involved in the pathogenesis may be a reaction mediated by type iii immune complexes and associated with type iv retarded hypersensitivity . various topicals allergens cause erythema multiforme , including topical drugs such as corticosteroids , nonsteroidal anti - inflammatory drugs , iodine povidone , imiquimod ; rubber gloves ; nickel and herbicides . three possible causes of the residual hypopigmentation have been described : a reduction in melanin synthesis , selective destruction of the melanocytes , or photoleukomelanodermitis due to pigment blocking . as henna tattoos are becoming increasingly popular , prevention requires the provision of information to consumers , especially young people and their parents . it is important for the population to be aware of this circumstance and the risk entailed by sensitization to ppd . to conclude , we believe that temporary black henna tattooing should be controlled by health authority legislation to minimize the appearance of new cases of reaction to ppd and the serious and permanent consequences we have presented . it is important for the population to be aware of the risk entailed by sensitization to ppd due to popular henna tattoos .

background : invasive mole is responsible for most cases of localized gestational trophoblastic neoplasia . gestational trophoblastic disease describes a number of gynecologic tumors that originate in trophoblastic layer including hydatidiform mole ( complete or partial ) , invasive mole , choriocarcinoma , placental site trophoblastic tumor and epitheloid trophoblastic tumor . invasive mole may arise from any pregnancy event although in most cases is diagnosed after molar pregnancy . overall cure rate in low risk patients is nearly 100% and in high - risk patient 90% . in rare cases , molar tissue traverses thickness of myometrium and leads to perforation and acute abdomen and invasive mole infrequently metastasis . the best treatment option is chemotherapy ( according to stage and score with single or multiple agent ) and in patients that fertility is not the matter , hysterectomy can be done.case presentation : a 41 years old g3p2ab1 woman referred to firouzgar hospital 2 months after curettage of molar pregnancy with vaginal bleeding and acute abdomen . in workup , hcg 224000 miu / ml and evidence of metastasis was detected . chemotherapy due to stage 3 and score 9 and surgery due to acute abdomen was done . this case was reported for its rarity.discussion:this case reported about ovarian metastasis and uterine rupture with acute abdomen and involvement of omentum in metastatic invasive mole . lack of surveillance led to extensive morbidity . management of this patient was successful . in follow up , she was free of disease without sequel of any kind for five years now .

please summarize the articles given below

a 55 year - old man visited our emergency department because of increasing frequency of chest pain . he had undergone off - pump coronary artery bypass grafting ( cabg ) 10 years ago because of unstable angina associated with three vessel coronary artery disease . at the initial operation , the in situ right internal thoracic artery ( ita ) , in situ left ita and in situ right gastroepiploic artery ( rgea ) grafts were used to revascularize the left anterior descending coronary artery , two obtuse marginal coronary branches , and posterior descending coronary artery , respectively . an excess segment of the distal right ita was connected to the side of left ita as a y - composite graft and anastomosed to the first diagonal coronary artery . coronary angiography and myocardial single photon emission computed tomography ( spect ) were performed at 5 years after surgery as a follow - up study . the 5-year angiography showed all patent grafts and the myocardial spect demonstrated no perfusion decrease . exertional chest pain recurred at 7 years after surgery , and a repeated coronary angiography showed patent previous grafts including faint visualization of the in situ rgea graft associated with significant stenosis at the os of the celiac axis . the computed tomographic angiogram also demonstrated a 90% stenosis at the celiac os , which had been without stenosis on abdominal angiography taken before the surgery ( fig . redo off - pump cabg was performed 10 years after the initial surgery because of an increasing frequency of angina and an aggravated finding of the follow - up myocardial spect , which was a newly developed reversible perfusion decrease in the inferior wall ( fig . , the great saphenous vein was harvested from the lower leg and interposed between the middle part of in situ right ita and distal part of in situ rgea grafts used previously , to supply blood flow from the right ita graft to the posterior descending coronary artery . one year after redo surgery , the patient had no symptoms of angina and coronary angiogram was performed and revealed patent grafts , including an interposed saphenous vein graft ( fig . 3a ) . the myocardial spect test was also performed and demonstrated that there was no perfusion decrease including the inferior wall ( fig . reoperations for coronary artery disease have been increased due to the increased number of isolated cabg . the society of thoracic surgeons statistics indicated that nearly 5% of the current cabg procedures done in the us were repeat surgical revascularization . angiographic indications for reoperation are progression of native coronary atherosclerosis , previous graft failure or a combination of both . one previous study demonstrated that 4 out of 400 patients who underwent cabg using the rgea graft needed percutaneous interventions due to the rgea graft failure during postoperative follow - up of 2211 months . one of those 4 patients required an angioplasty for a newly developed stenosis of the celiac trunk . in the present case , an indication for reoperation the patient had been free of angina , and the angiographic and myocardial spect follow - up studies revealed no abnormal findings at postoperative 5 years . when the patient suffered from recurred angina at postoperative 7 years , coronary angiography showed a faint visualization of the in situ rgea graft associated with significant stenosis at the os of the celiac axis . the 10-year follow - up myocardial spect test demonstrated a newly developed reversible perfusion decrease in the inferior wall . the prevalence of celiac axis stenosis was 7.3% in a korean population although it was lower than the previously reported incidence of celiac axis stenosis in western populations ranged from 12.5% to 24% . in the present case , celiac artery stenting could be an alternative option in such a case . however , we performed a redo operation because celiac axis stenting was associated with a high incidence of late restenosis . the aorta or another in situ arterial graft could be chosen as a blood source . alternatively , patent in situ grafts used previously may be re - used as an inflow conduit . with regards to our patient , the 3 in situ arterial grafts had already been used . the saphenous vein graft was interposed between the middle part of right ita and distal part of in situ rgea grafts used previously . autosomal - dominant polycystic kidney disease ( adpkd ) is characterized by cyst formation and occurs primarily in the kidneys . due to the replacement of the normal renal parenchyma , adpkd results in end - stage renal failure in 45% of patients . approximately 711% of patients receiving renal replacement therapy in the western world are doing so due to adpkd . the underlying cause of adpkd is a mutation in the polycystin-1 and -2 plasma proteins , located in the primary cilia . this mutation leads to abnormal function of renal tubular epithelia and inadequate calcium influx followed by cyst formation . cardiovascular disease is the most frequent cause ( 36% ) of mortality in patients with adpkd . patients with adpkd often develop hypertension at an earlier age than the general population before any impairment of kidney function . it is hypothesized that the renin - aldosterone system and endothelial dysfunction caused by impaired nitric oxide release are the important factors in the development of hypertension in adpkd patients . we describe an uncommon case of a middle - aged man with a spontaneous coronary artery dissection ( cad ) and adpkd . a 41-year - old caucasian man presented at an emergency department with acute chest pain . the chest pain began 2 h before presentation . medical history recorded a subdural haematoma , as a result of trauma . according to the family history , our patient was a non - smoker , with no history of hypertension , diabetes mellitus or hypercholesterolaemia . on physical examination , the blood pressure was 155/102 mmhg and the pulse 72 beats / minute ; other vital parameters were normal . electrocardiography showed a sinus rhythm of 65 beats / minute and st elevation in the precordial leads ( figure 1 ) . / l , creatine kinase mb was 17.4 u / l and troponin t was 0.21 ng / ml . the other laboratory test results were normal . echocardiography revealed a hypokinetic septum and a slightly impaired left ventricular function with an ejection fraction of 4560% . electrocardiography on presentation shows a sinus rhythm of 65 beats / minute and st elevation in v3 , ii and iii . based on these results , a presumptive diagnosis of acute septal myocardial infarction was made . coronary artery angiography ( cag ) revealed a transient occlusion of the left anterior descending ( lad ) coronary artery , most probably as a result of myocardial bridging ( figure 2a ) . the cag ( a ) shows the compression of the lad coronary artery during the systole resulting in narrowing and ( b ) performed after the second chest pain attack demonstrating a dissection in the distal left anterior descending coronary artery . however , the chest pain returned 3 days after the presentation . a second electrocardiography showed persistent inverted t waves in the precordial leads without st elevation . it disclosed an open lad with a dissection in the distal part and a double lumen , which was not observed during the first angiography ( figure 2b ) . the definitive diagnosis of non - q - wave anterior infarct as a result of a spontaneous lad dissection was made . based on the cysts in both kidneys combined with a family history of adpkd , the diagnosis of adpkd was made ( ravine s criteria ) . since cerebral aneurysms are one of the extrarenal manifestations of adpkd , a computerized tomography angiography of the brain was performed , with a negative result for vascular anomalies . an exercise stress test , performed 16 days after the onset of chest pain , was normal . the lad was patent without a significant infarction , but still with a double lumen appearance . at 2-year follow - up by a nephrologist , our patient , a relatively young man with a negative cardiovascular profile and a history of subdural haematoma , developed a myocardial infarction secondary to dissection of the lad . the cad was not recognized during the first cag because the relevant coronary artery can obturate the dissection in the acute phase . this condition is found when the segmental coronary artery has an intramyocardial course , being compressed during systole and restored during diastole . therefore , one would require a difference in coronary artery contraction in the systolic and diastolic phase which was not observed on the first cag . four cases were reported on the occurrence of a spontaneous cad in middle - aged adpkd patients . predisposing factors for cad in adpkd patients are still undetermined , especially in the absence of traditional cardiovascular risk factors . furthermore , it is not known if arterial dissection is an extrarenal manifestation of adpkd or if is just secondary to hypertension . the estimated prevalence of spontaneous cad is 0.7% , and it is in 2% of cases , the cause of acute coronary syndrome . the lad is affected in 80% of the patients with cad [ 8 , 9 ] . the majority of patients with a cad often lack classical risk factors for cardiovascular disease and are female . de maio et al . identified three groups of patients with cad : ( i ) patients with atherosclerotic cardiovascular disease , ( ii ) women in the postpartum period and ( iii ) an idiopathic group . several underlying conditions in the idiopathic group are suggested , such as polyarteritis nodosa , lupus erythematosus , marfan s syndrome , ehlers danlos syndrome , intense physical exercise , the use of cocaine , cyclosporin and oral contraceptives . the tunica media , the middle layer of elastic arteries , include smooth muscles with interposing layers of elastic lamellae . the connection between the intracellular contractile filaments and extracellular elastic fibres is provided by dense plaque sites . localization in the dense plaques assigns a significant function to polycystins in maintaining vascular integrity . furthermore , qian et al . suggested that abnormal intracellular calcium concentration in the vascular smooth muscle cells is linked to vascular phenotype in the case of inactivation of polycystin-2 protein . literature also confirms the observation of intracranial aneurysms and myocardial infarction secondary to coronary aneurysms in certain families and the occurrence of vascular rupture and haemorrhage in homozygous polycystic kidney disease ( pkd)-1 knockout mice [ 4 , 11 ] . considering these results , and the high plasma renin activity and impaired nitric oxide release in adpkd patients , we speculate that the vascular abnormalities are most likely a direct result of pkd mutations rather than a secondary cause of hypertension . in conclusion , polycystins seem to play a main role in the stability of the arterial vasculature . therefore , a spontaneous cad should be considered as an extrarenal manifestation of adpkd . the clinician should be aware of cad if adpkd patients present with chest pain or discomfort . cag can be inconclusive in respect to the mechanism of coronary occlusion in the acute phase and should be repeated , especially when the complaints persist .

we report a redo coronary artery bypass grafting ( cabg ) in a 55-year - old man . angina recurred 7 years after the initial surgery . coronary angiography showed all patent grafts except a faint visualization of the in situ right gastroepiploic artery ( rgea ) graft , which was anastomosed to the posterior descending coronary artery , associated with celiac axis stenosis . redo - cabg was performed at postoperative 10 years because of aggravated angina and decreased perfusion of the inferior wall in the myocardial single photon emission computed tomography . the saphenous vein graft was interposed between the 2 in situ grafts used previously ; the right internal thoracic artery and rgea grafts . angina was relieved and myocardial perfusion was improved .

please summarize the articles given below

optimal treatment of cancers in children often requires combined - modality therapy , including : chemotherapy , surgery , and/or radiotherapy . chemotherapy is not always sufficient to achieve the cure of solid tumors in children ; either resection or radiation may be needed for local tumor control as well ( 1 ) . children with radiosensitive malignant tumors typically require radiation therapy for a number of sessions over a period of several weeks . although the procedure is painless , young children need to be sedated or anesthetised in order to provide a motionless state during the procedure . a short period of sedation , analgesia or general anaesthesia the patient and anaesthesia equipment are observed continuously by closed - circuit television , and monitors are mirrored to the remote observation site outside the treatment room . different anesthesia methods and anesthetics have been recommended to provide a safe and optimal situation of motionless with a short recovery period in children undergoing general anaesthesia or sedation for external beam irradiation ( 37 ) . this report describes the accidental detection of a missed complication by the anesthetist at the time of radiotherapy , from the previous chemotherapy , which was preliminarily and unduly attributed to anesthesia . a 2.5 year - old , 13-kg boy , asa ( american society of anesthesiologists ) class ii , with acute lymphoblastic leukaemia ( all ) , was scheduled for radiotherapy . anesthesia was planned by the anesthetist , and the physical examination was normal before radiotherapy . routine monitoring was established , and for peripheral pulse monitoring , the distal portion of the right upper limb of the child was rested out of the covers . after about 5 minutes , when the anesthetic effect of ketamine began , we noticed a lack of right radial pulse . anesthesia - related hemodynamic instability was expected , however no other manifestation of hypoxia or hypo - perfusion was detected . furthermore , carotid pulsation was normal , and examination of the left radial pulse and other peripheral pulses showed normal pulsation . the patient showed a scar and swelling on the right antecubital area . a more detailed history taken from the child s parents showed his history of chemotherapy during which extravasation of the chemotherapy drug had resulted in severe inflammation and edema at the site of injection . a colour doppler ultrasound of the antecubital area showed deep edema and chronic compression on the antecubital tissue and confirmed the diagnosis . permission was obtained from the patient s parents to use the patient s reports , however the patient s information was to remain confidential . the incidence range of extravasations of cytostatic drugs in cancer patients has been reported from 0.2 to 1.4% in a five - year study ( 8) . extravasations in cytostatic treatment may cause a wide range of symptoms , from patients discomfort to severe complications such as necrosis and amputation . ( 9 ) eccrine squamous syringometaplasia , while rare , has also occurred in patients who have received chemotherapy treatment ( 10 ) . yeung et al described a case of metastatic ovarian carcinoma with repeated thrombosis of the femoral arteries following intravenous carboplatin - based combination chemotherapy . persistent withdrawal occlusion ( pwo ) is frequently caused by fibrin sheath formation around venous access devices . small doses of thrombolytic drugs ( such as urokinase ) could manage pwo , but could also serious complicate chemotherapy drug extravasation ( 12 ) . keratolytic ointment was applied for old lesions , whereas in new lesions , multiple subcutaneous injections of hydrocortisone solution were used before the application of betamethasone ointment . application of conservative agents in radiotherapy - induced extravasation areas may avoid tissue necrosis and consequently , reconstructive surgery ( 13 ) . management of cytotoxic drug extravasation in humans is based on the experimental evidences and available case reports because of lack of randomized trials . for instance , topical dimethylsulfoxide ( dmso ) and cooling for extravasation of anthracyclines or mitomycin , local injection of hyaluronidase for extravasation of vinca alkaloids , and local injection of sodium thiosulfate ( sodium hyposulfite ) for extravasation of chlormethine ( mechlorethamine ; mustine ) should be empirically recommended . in the case of failed conservative treatment , history and physical examination before injection of anesthetic agents could be useful in preventing patient mismanagement . a weak pulse in a child can be a significant problem for the anesthesiologist and in this case , it was shown to be a critically misleading factor . increased emphasis is on clinical evaluation and pulse checking is necessary , especially in children with a history of chemotherapy . providing thorough pulse evaluation when we work on children and avoiding immediate aggressive intervention before being certain about the cause of weak pulse are additional issues of importance shown by this case report . care coordination is an important aspect of nursing care especially for elderly patients admitted to an acute care setting . in singapore care coordination and transitional care nursing is a new concept of care nevertheless important but unexplored . the objective of this paper is to explore the characteristics of elderly patients receiving care coordination , determine care gaps and intervention during home visit and telephonic review . a designed questionnaire was used to collect information on the patient s demography , social and clinical profile and determine post discharge activities using eric coleman s four pillars tool . the retrospective data from the patient s index admission from the last six months ( nov 08april 09 ) was analyzed using spss version 16 . majority , 69% were above 70 years old of which 57% female and 76% lives with their children . clinical information demonstrates that 53% had 36 co - morbidities and 58% were taking more than five medications . the abbreviated mental test score were 6.2 , 6% were depressed and delirium was present in 14% of patients . only 65 patients ( 0.1% ) had home visits and telephonic review done whilst 97% of the remaining had only telephonic review done . those who had both telephonic and home visit review , medications advice and compliance were checked only in 0.8% ( at one week ) and 1.6% ( at one month ) whilst during home visit this was done in 12.2% of patients as medication discrepancy were apparent at home . as for appointment compliance and compilation were done in 0.8% at one week and 51% at four weeks of telephonic review compared to during home visit only 4.8% . caregivers education was emphasized in 14% of patients at home visit , 2% at one week and 4% at one month of telephonic review . the result showed that home visit is effective in exploring medication compliance , advice and emphasizing caregiver education , managing appointments can be effectively done through telephone review . this study demonstrates the vital role of home visit for elderly patient to safely transit between hospitals to home .

treatment of cancer in children often requires a combination of chemotherapy , surgery , and/or radiotherapy . radiotherapy and chemotherapy are not painful processes , but children undergoing these procedures must be made motionless through anesthesia or sedation . there are a few reports of complications during these procedures in relation to the procedures themselves or to the anesthesia given . this report describes an unexpected pulseless radial artery which was preliminarily and unduly attributed to anesthesia . a 2.5 year - old male pediatric patient with an acute lymphoblastic leukaemia was scheduled for radiotherapy . anesthesia with intramuscular ketamine was induced before starting radiotherapy . about 5 minutes after injection of ketamine we found the right radial pulse undetectable . there was no other manifestation of hypoxia or hypo - perfusion . carotid pulsation was normal . examination of the left radial pulse and other peripheral pulses showed normal pulsation . the procedure was continued uneventfully . the next follow - up after radiotherapy , showed a scar and swelling on the right antecubital area , caused by extravasation of chemotherapeutic agent in the prior period of chemotherapy . doppler ultrasonography of the antecubital vein confirmed the diagnosis . this case study therefore demonstrates that proper intravenous cannula establishment before chemotherapy is of great importance . furthermore , accurate history and physical examination before induction of anesthesia or sedation may be useful in preventing mismanagement in pediatric cancer procedures .

please summarize the articles given below

since the introduction of extra - oral implants in reconstruction of craniofacial defects , achieving proper prosthesis retention has become more promising . these problems include ulceration of hard and/or soft tissues used for retention , lack of retention due to prosthesis movement , and tissue irritation caused by adhesives . the ideal position and number of implants for restoring orbital defects would be three non - linear implants in lateral , supraorbital , and infra - orbital rims . however , such implant arrangement is not always conceivable considering the extension of the defect , and bone quality and quantity of defect s walls . two of the most common retention systems used in reconstruction of orbital defects include freestanding abutments with magnetic retention and bar - clip retention . magnetic abutments are more common because they resolve the potential problems associated with bar - clip attachment including difficulty in insertion and removal of prosthesis by the patient , difficulty in regular hygiene measurements , and rigidity of the attachment resulting in implant overloading . however , magnetic attachment might not provide sufficient retention if implants have been placed adjacently . the presence of implant in the defective area might complicate the usual impression - taking procedures used in fabrication of conventional craniofacial prostheses . accuracy of the impression is affected by defect shape , retention system , number , and divergence of the implants . moreover , anatomical undercuts in the defect , and proximity or remoteness of the implants could complicate the impression - taking procedure . use of multiple trays , elastomeric impression materials , and dual impression technique have been suggested to overcome such problems [ 2,1214 ] . the purpose of this article was to present a case treated with an implant - supported prosthesis to reconstruct a relatively large orbital defect using three adjacent implants in the lateral orbital rim . a 60-year - old woman with a left orbital defect due to removal of periocular basal cell tumor was referred to the implant department of tehran university of medical sciences , school of dentistry , for prosthetic reconstruction of the eye . three implants ( superline , dentium , seoul , south korea ) , 8 mm in length and 3.6 mm in diameter were placed in the lateral rim of the orbit . although the most suitable sites for orbital implants are the superior and lateral rims , in the present case the implants have been placed adjacently , due to insufficient bone thickness in superior and inferior orbital rims . the defect was relatively deep with undercuts in the medial wall which could complicate impression making . the preferred prosthesis design was an implant - supported prosthesis with a custom bar containing properly distributed magnetic components . the healing abutments were unscrewed and three hexed direct - casting abutments ( implantium , dentium , seoul , south korea ) with 4.5 mm diameter were directly secured to the implants . the medial undercuts were blocked out , using a gauze pack to avoid the penetration of acrylic resin . an auto - polymerizing acrylic resin ( pattern resin , gc , tokyo , japan ) pattern was formed directly on the abutments in a manner that cobalt samarium ( co5sm ) magnets ( implantium , dentium , seoul , south korea ) , with 5.5 mm diameter and retention force of 700 gram could be placed at proper distances in the superior , inferior and lateral segments of the acrylic bar ( fig . the acrylic resin bar was casted using base metal alloy ( aalba dent inc . ; cordelia , c.a , usa ) and the magnet keepers were cemented in corresponding sites with panavia f 2.0 resin cement ( kurary medical inc , japan ) . acrylic resin pattern of bar containing indentations for magnets ( a ) , try - in of metal bar on the implants with magnet keepers in place ( b ) . the space beneath the superstructure and also the undercuts in defect walls were blocked out with gauze packs . the final impression was made in order to pick up the magnets and simultaneously record the rest of the orbital defect . light viscosity addition silicone ( panasil , kettenbach , germany ) was used as the first layer to cover the entire defect as well as the intact side of the midface . afterwards , regular viscosity addition silicone ( panasil , kettenbach , germany ) was used over the light viscosity material to create mechanical retention projections for the gypsum layer ( herostone vigodent inc . the wax pattern of the orbit was formed containing an ocular prosthesis which simulated the properties of a healthy eye . the pattern was tried on the patient and some modifications were made to improve its esthetic and adaptation . the prosthesis was made of a combination of heat - cured acrylic resin for holding the magnets , and high - temperature vulcanizing silicone with internal / external staining and other characterizations of the skin , such as wrinkles , eye brow and eye lashes . the final prosthesis was delivered to the patient and necessary home care instructions were provided such as removing the prosthesis during night , cleaning the eye defect with damp gauze , and the need for regular biannual follow - ups [ 69 ] . tissue side of the prosthesis with three magnets ( a ) , delivery of the prosthesis ( b ) the patient presented here has been treated with an implant - supported orbital prosthesis with bar - magnetic attachment . this retention mechanism might minimize the risk of mechanical overload on the implants compared to a conventional bar - clip attachment with cantilever arms . despite the proximity of implants , the mentioned distribution of magnetic attachments has increased the retention through creating a tripod . furthermore , since the acrylic resin pattern of the bar was made directly in the defective area , no implant or abutment analogues were used in final impression procedure . prolonged chair - side time is a disadvantage of the stated method which could be justified considering the mentioned advantages . the national tb prevalence survey in eritrea was conducted from february through october 2005 ( 6 ) . in 40 selected villages , a census ( which included information about sex and age ) was taken of 875 persons in each village . all persons > 15 years of age were asked to provide a morning and a spot sputum sample . persons who had 2 positive sputum samples were informed about the test results and referred for treatment . those who had 1 positive sputum sample were referred to a nearby healthcare facility for further smear examination . if results of smear examination were negative , thoracic radiographs were taken and evaluated by 2 experienced radiologists . the case definition for a sputum smear positive case was at least 2 sputum specimens positive for acid - fast bacilli by ziehl - neelsen staining and microscopy or at least 1 sputum specimen positive for acid - fast bacilli and radiographic abnormalities consistent with active pulmonary tb ( classification of the national tuberculosis control program in eritrea ) . using the prevalence estimate obtained from the survey and 2 different models , we calculated the cdr for 2004 . in model 1 , described by styblo , cdr = ( notification rate / prevalence rate ) / ( 0.5 + 0.83 [ notification rate / prevalence rate ] ) ( 7,8 ) . in model 2 , described by dye et al . , cdr = ( notification rate / prevalence rate ) / ( [ notification rate / prevalence rate ] + 0.5 ) ( 9,10 ) . we then compared the calculated cdr with the cdr estimated by the world health organization ( who ) to evaluate whether comparable conclusions about tb case detection would be obtained . a total of 38,047 persons were included in the prevalence survey . of those > 15 years of age , 18,152 ( 94.6% ) provided at least 1 sputum sample ( figure ) . the prevalence of new smear - positive tb was estimated at 90/100,000 ( 95% confidence interval [ ci ] 35145/100,000 ) in persons > 15 years of age . in 2005 , 44.7% of the eritrean population was < 15 years of age ( 11 ) , which resulted in an overall new smear - positive tb prevalence of 50/100,000 ( 95% ci 1980/100,000 ) under the assumption of no cases in persons < 15 years of age . summary of tuberculosis prevalence survey in eritrea , 2005 . in 2004 , 17/100,000 new smear - positive cases were reported ( 2 ) . for eritrea , the cdr provided by who is considerably lower than that calculated from the results of the national tb prevalence survey . both estimates indicate that eritrea has not reached the 70% target for case detection . however , the who estimate suggests that the program needs to improve case detection by a factor of 5 , whereas the survey estimate suggests that case detection needs to be improved by a factor of 1.6 . two explanations may account for the large difference : 1 ) the cdr derived from the tb prevalence survey is too high because of an underestimation of the prevalence of smear - positive tb , or 2 ) the cdr estimate published by who is too low because of an overestimation of the incidence of smear - positive tb . in the national tb prevalence survey , measures were taken to ensure high quality of the results ; e.g. , training of data collectors , repeat census taking , reexamination of all slides found positive on fluorescence microscopy , and reexamination of a 5% random sample of the negative slides . persons who had smear - positive tb may have been missed because they did not provide a specimen ; however , because only 5% of eligible persons did not provide a specimen , this can explain only a slight underestimation . furthermore , recorded reasons for not providing a specimen seem to be unrelated to a higher chance of having tb . the quality of the provided specimens may have been suboptimal because instructing and motivating persons to provide a sputum sample is challenging . for diagnosis of tb , microscopic examination of saliva is less sensitive than examination of sputum ; however , in 50% of saliva samples from patients with a positive sputum sample , bacilli can be demonstrated ( 12,13 ) . for 27,647 samples that appeared to be saliva , smear assuming that only 50% were detected , a maximum of 12 smear - positive tb patients may have been undetected . taking this into account results in a prevalence of 87/100,000 . using this estimate , model 1 provides a cdr of 30% and model 2 a cdr of 28% the possibility that persons who provided a saliva sample were not able to produce a sputum sample because they did not have pathologic pulmonary changes should also be taken into consideration . estimation of the incidence of smear - positive tb in eritrea is complicated by the fact that no data from tuberculin or prevalence surveys were available . the only data available for eritrea were reporting data , which experts assessed as being of low quality ( 14 ) . use of this limited information will result in an uncertain incidence estimate , which may result in an unreliable cdr . for most countries in africa , little information is available for estimating the prevalence of disease and progress towards the millennium development goals ( http://unstats.un.org/unsd/mi/mi_goals.asp , accessed 2006 aug 30 ) . on the basis of case reporting , tb was rightly declared an emergency by african health ministers at the who africa regional committee in maputo in 2005 ( 15 ) . to be able to fight this emergency , more reliable information about the prevalence of tb in africa is needed . furthermore , for global tb control , reliable information about the tb epidemic in africa is needed because 28% of the incident smear - positive cases occurred in the who african region in 2004 ( 2 ) . in conclusion , the example of eritrea shows that a large gap may exist between available estimates of tb prevalence and actual tb prevalence in africa . national tb prevalence surveys in africa would help provide better information on tb prevalence and case detection .

implant - supported craniofacial prostheses are made to restore defective areas in the face and cranium . this clinical report describes a technique for fabrication of an orbital prosthesis with three adjacent implants in the left lateral orbital rim of a 60-year - old woman . selection of appropriate attachment system ( individual magnetic abutments versus bar - clip attachment ) for implant - supported orbital prostheses depends upon the position of implants . bar - magnetic attachment has been selected as the retention mechanism in the present case .

please summarize the articles given below

student perception of their dental school experience is an essential measure of the success of dental education . undergraduates ' feedback and suggestions are very important for improving the curriculum and learning process . this information also helps determine the students ' preferences regarding different elements of their educational experience . endodontics teaching can be considered complex , difficult , and stressful because of the complex anatomy of the root canal system , responsibility toward patients , and low self - confidence . however , teaching endodontics in recent years has improved as a result of the development of knowledge , techniques , and materials . dental students at taibah university , saudi arabia , take a preclinical full - year endodontic course in the 3 year of their 6-year bachelor of dental surgery degree . the course consists of 28 h of theoretical lectures and 28 3-h laboratory sessions , during which they perform technical aspects of root canal treatment on extracted single- and multi - rooted teeth . there is a one - semester clinical endodontic course in the 4 year that consists of 14 theoretical lectures and fourteen 3-h clinical sessions during which students treat single- and multi - rooted teeth . in the 5 year , endodontic treatments are performed as part of a comprehensive dentistry care course under the supervision of specialists . this study examined the endodontic experiences , perceptions of endodontic practice , and self - rated confidence of dental students enrolled in taibah university , saudi arabia . study approval was obtained from the research ethics committee of the college of dentistry , taibah university ( reference number : tucdrec/20160107/alrahabi ) . this study enrolled 41 undergraduate dental students registered in endodontic courses in the 2015 academic year at the college of dentistry , taibah university , saudi arabia . participation was voluntary , and students were informed that they could refuse participation . a questionnaire was distributed to 19 4-year and 25 5-year students in the final month of the academic year after they had had the maximum amount of training . the questions evaluated self - confidence at performing nonsurgical root canal treatment and experiences in this discipline . the level of confidence was classified using a 5-point scale as very confident , confident , neutral , not very confident , or not at all confident . to compare results , the chi - square test and mann whitney u - test were used . statistical analyses were carried out using spss version 20.0 ( spss , chicago , il , usa ) . statistical significance was set at p < 0.05 . the overall response rate was 93% , with 18 of the 19 4-year students and 23 of the 25 final - year students returning questionnaires . table 1 shows the results for the first three questions ( first endodontic case treated , level of case difficulty , and number of endodontic treatments performed by the student ) . first endodontic case treated , level of case difficulty , and number of endodontic treatments performed self - confidence of 4th- and 5th - year dental students regarding the steps of nonsurgical root canal treatment levels of confidence in the different steps of root canal treatment confidence levels differed significantly between 4- and 5-year students in the following steps of root canal treatment : determining the working length , taking and interpreting radiographs during root canal treatment , evaluating the quality of root canal obturation , and recalling the patients periodically in the correct manner . table 3 summarizes the results of the last question regarding suggestions to improve the teaching of endodontic courses . in dentistry , evaluating competence is an important step toward validating the quality of graduating dentists , although the relationship between the self - confidence and clinical competence of medical students is not fully understood . increasing the confidence of medical students should increase their competence in clinical practice . one way to standardize education is to poll students using questionnaires to help in the assessment , evaluation , and improvement of education . this study obtained information about the confidence of undergraduate dental students at taibah university , saudi arabia regarding endodontics . it revealed that an upper incisor 78% was the most common tooth first treated by students . upper incisor root canal treatment is relatively easy , and this should encourage students . in another study , most of our students described the experience with the first case as okay 78% , while 7.4% described it as easy and 14.6% described the first case as difficult , possibly because the first case for those students involved a molar or premolar . in other studies , students considered molars to be the most difficult tooth to treat . in our study , the maximum number of teeth treated in the 4 year was four cases , by 66.7% of the students , while the maximum number of teeth treated in 5 year was 11 cases , by 8.8% of the students . the number of teeth treated by students in the 4 and 5 year did not meet the recommendations of the european society of endodontology 2001 guidelines , which advised that for adequate competency a student should complete root canal treatments in 20 teeth . although the european society of endodontology published new undergraduate curriculum guidelines for endodontology in 2013 , these focused on the quality and consistency of student performance more than simply the quantity of clinical exposure . however , one study reported that 81% of the students in 48 dental schools in the european union achieved the minimum number of root canal treatments required for their graduation : the number of treated cases ranged between 3 and 80 canals , and the average was 17 canals . in our study , we observed that confidence varied according to both the year the student was in and the practical steps of nonsurgical root canal treatment . both groups reported relatively good confidence , although there were significant differences between 4 and 5 year students regarding some steps . fourth - year students were more confident than 5-year students in the following : determining the working length , dealing with x - rays during root canal treatment , evaluating root canal obturation , and recalling patient at the correct time . this might be because there were fewer 4-year students in the sample , there are fewer requirements in 4 year , and strict supervision by supervisors helped 4-year students more than 5-year students . confidence regarding working length determination was low in both 4- and 5-year students . this might be the result of the root canal anatomy , which many dental students find difficult to learn because of its variation among individuals . the reduction in confidence regarding endodontic radiology , the evaluation of root canal obturation , and determining the correct recall period probably results from insufficient clinical exposure . murray et al . wrote that a lack of clinical exposure in the undergraduate curriculum reduces the confidence that develops with clinical practice . students ' suggestions for improving the teaching of endodontics focused on two major issues : using rotary nickel - titanium ( niti ) files during treatment and increasing credit hours for the endodontic course . introducing advances in endodontics into undergraduate training , such as niti rotary instruments , may improve the clinical experience of students and their self - confidence because it will help increase the numbers of cases treated . believe that introducing niti rotary instruments into the undergraduate dental curriculum would be safe and improve endodontics teaching because inexperienced operators can learn to use rotary instruments adequately with brief training . nevertheless , another study found that intensive preclinical training is a prerequisite for using niti rotary instruments . changing the methods of teaching endodontics so that students can complete root canal treatment more easily and quickly , with minimal procedural accidents , will improve clinical outcomes . low self - confidence can be ameliorated by increasing clinical exposure , which will help students to obtain the necessary skills through experience . fourth- and fifth - year dental students at taibah university , saudi arabia , are confident regarding root canal treatment , although they report lower confidence in some steps of the root canal treatment process . endodontics education should be improved by increasing preclinical and clinical sessions and using new teaching methods that introduce recent advances in endodontics in the undergraduate curriculum . a 36-year - old woman complained of an insidious onset of generalized myoclonus that first became apparent at age 27 years . she had no perinatal problems and her development was normal in childhood and juvenile periods . adult - onset myoclonus had worsened progressively from right hand to four extremities , tremulous voice and gait disturbance developed after 3 years from disease onset , and she could not continue working as a nurse . she had no history of febrile convulsions or seizure , infectious disease in the central nervous system , exposure to toxic materials , or intake of herbal drugs . her younger brother aged 40 years old also had progressive generalized myoclonus , which was detected 6 years ago at age 34 years ( figure 1 ) . the patient was alert and oriented , and her mini - mental state examination score was 30 . she did not have gaze palsy , and her vision and hearing were normal ; however , her voice was tremulous and generalized positive myoclonus was observed at four extremities and body . negative myoclonus , dystonia , tremor , and rigidity were not detected , and both motor and sensory functions were intact . there was no evidence of cerebellar dysfunction , and she did not have an ataxic or parkinsonian gait , although she staggered slightly because of myoclonus . examination of the eyes revealed cherry - red spots ( figure 2 ) , but her electroencephalogram was normal . no white matter lesion or cerebellar atrophy was detected in an mri of her brain ( figure 3 ) . neuraminidase , hexosaminidase a , and -galactosidase activities in the leukocytes and cultured fibroblasts in patient and younger brother were normal . the cherry - red spot is a pale perifoveal ring that develops when large deposits of lipid , sphingolipid , or oligosaccharide material accumulate in the ganglionic cells at the macula.2 this is a characteristic finding in storage diseases , including the sialidoses , gm1 and gm2 gangliosidoses , neuronal ceroid lipofuscinosis , niemann - pick disease ( groups a through d ) , farber s lipogranulomatosis , and metachromatic leukodystrophy . interestingly , niemann - pick disease , farber s lipogranulomatosis , and metachromatic leukodystrophy are not associated with myoclonus . moreover , the patient in this report did not have typical findings of these 3 diseases such as the organomegaly , cognitive impairment , and gaze palsy seen in niemann - pick disease4 ; the hoarseness , arthritis , and subcutaneous nodules seen in farber s lipogranulomatosis ; or the abnormal brain mri findings in metachromatic leukodystrophy . in ceroid lipofuscinosis , sialidosis , gm1 and gm2 gangliosidoses , myoclonus , and maculopathy ( e.g. a cherry - red spot ) may coexist . although they are quite similar in appearance , the macular abnormality seen in patients with neuronal ceroid lipofuscinosis ( which has been described as bulls - eye maculopathy ) can be distinguished from the cherry - red spot by color and shape , as well as by the decreased visual acuity and visual - field restriction that are common in neuronal ceroid lipofuscinosis.5 moreover , adult - onset lipofuscinosis has an autosomal dominant inheritance , rather than the autosomal recessive pattern seen in this patient.6 gm1 gangliosidosis results from a deficiency of -galatosidase ; the adult form ( type 3 ) presents as a slowly progressive dementia with prominent parkinsonian features and extra - pyramidal dysfunction , particularly dystonia.7 gm2 gangliosidosis results from a deficiency of hexosaminidase a ; the late form ( with an onset during adolescence and young adulthood ) may be characterized by cognitive dysfunction , cerebellar dysfunction , upper and lower motor neuron involvement , and extrapyramidal dysfunction.8 because -galatosidase and hexosaminidase activity was normal in this patient , because she has a normal level of intelligence , and because no other prominent pyramidal or extrapyramidal dysfunction was detected , we might not diagnose this patient as gm1 and gm2 gangliosidoses . sialidosis is an inherited , autosomal recessive disease associated with a neuraminidase deficiency.9 it has 2 major clinical manifestations : type i ( late , adult onset ) and type ii ( early , infantile onset ) . type i sialidosis is typically found in patients aged 8 to 25 years and is characterized by cherry - red spot myoclonus , seizure , neuropathy , corneal clouding , and difficulty walking , but with normal vision and intelligence ( obrien , 1978 ) . type ii sialidosis is characterized by dysmorphism , myoclonus , mental retardation , ocular cherry - red spots , and hepatosplenomegaly . the patient in this report may present clinical evidence of type i sialidosis , but her laboratory findings do not support this diagnosis ; activities of the neuraminidase were normal . a similar case of progressive myoclonic epilepsy has been reported.10 differences from the previous report which described a patient with progressive myoclonic epilepsy , cherry - red spots and negative enzyme deficiency were theses ; 1 ) the onset - age was older than the previous report ( 27 versus 13 years , adult versus juvenile - onset ) ; 2 ) the patient had a sibling with same disease , which indicated she had inherited disease , but the patient in previous report did not have familial history ; 3 ) the patient in our report did not have a history of seizure , and it is different from the patient with myoclonic epilepsy . although the cause of cherry - red spot myoclonus is not clear , to our knowledge , this is the first report of adult - onset familial cherry - red spot myoclonus caused by an unknown type of lysosomal storage disease in korea .

objective : this study examined the endodontic experience , perceptions of endodontic practice , and self - rated confidence of dental students enrolled in taibah university , saudi arabia.materials and methods : a questionnaire was distributed to 41 undergraduate dental students registered in endodontic courses in the 2015 academic year . the questionnaire evaluated their confidence performing nonsurgical root canal treatment . the level of confidence was classified using a 5-point scale as very confident , confident , neutral , not very confident , or not at all confident . the data were analyzed using spss version 20.0 ( spss , chicago , il , usa).results : the participation rate was 93% . the maxillary incisor was the most common first tooth treated . the students were relatively confident , but their confidence levels were lower regarding endodontic radiology , evaluation of root canal obturation , and determining the correct recall period for the patient.conclusion:the confidence of undergraduates in endodontics must be enhanced to increase their clinical competence when performing root canal treatment .

please summarize the articles given below

septic internal jugular vein - sigmoid sinus thrombosis is a rare condition that complicates local and regional infectious inflammatory processes occurring in the head and neck . these include deep neck infections , lemierre syndrome , and central venous catheterization ( cvc ) or cannulation17 ) . this is a life - threatening condition and prompt management is essential to decrease the potential for thrombosis - related morbidity and mortality . we report a case of internal jugular vein - sigmoid sinus thrombosis due to a misplaced central venous catheter . a 52-year - old woman presented with a severe bursting headache , vomiting , and a drowsy mentality . brain computed tomography ( ct ) scan revealed subarachnoid hemorrhage in the basal cistern with a small amount of hematoma at the left sylvian fissure ( fig . we identified an aneurysmal rupture of the middle cerebral artery on the left side by cerebral catheter angiography ( fig . postoperative chest x - ray was normal except for malposition of the central venous catheter in the right internal jugular vein ( fig . ten days later , the patient developed a fever , elevated white blood cell count to 227000 , and elevated c - reactive protein to 33.6 . the central venous catheter was removed , and antibiotics were administrated through a different intravenous route . despite these managements , the patient was stupor the next day . brain ct scan revealed cerebral infarction with hemorrhagic transformation in the right temporal lobe , and ct angiography did not identify vasospasm ( fig . retrospective analysis of the contrast - enhanced ct scan and ct angiography showed an " empty delta sign " and absence of venous flow within the right internal jugular vein - sigmoid sinus that was sufficient for diagnosis of sinus thrombosis ( fig . results of central venous catheter tip and blood culture was reported staphylococcus epidermidis and methicillin - resistant staphylococcus aureus , respectively . we could not start systemic heparinization due to hemorrhagic transformation of the cerebral infarction in the right temporal lobe . we administrated mannitol and steroids to manage increased intracranial pressure ; however , the patient died from severe pneumonia due to septic emboli after one week ( fig . 2c ) . indications for a cvc are the intravenous administration of drugs , parenteral nutrition , hemodialysis , and hemodynamic monitoring13 ) . at many institutions , cvc is routinely inserted before undergoing major surgery or treating patients with critical illnesses or cancer . the most frequently available anatomical sites for cvc are the subclavian and internal jugular veins . these procedures carry a substantial risk of mechanical lesions , such as arterial puncture , pneumothorax , cardiac tamponade , nerve lesions , or thrombotic or septic complications13 ) . malpositioning of the catheter tip may happen more often in the subclavian vein than the internal jugular vein . the reported incidence of primary misplacement of the catheter tip after infraclavicular subclavian vein catheterization varies from 5% to 24% even when inserted by experienced clinicians7 ) . inadvertent catheterization of the ipsilateral internal jugular vein is one of the most common misplacements , with a reported incidence of around 7%15 ) . the positioning of catheter tips within the cardiac silhouette is associated with increased risk of cardiac tamponade6 ) . also , positioning of the catheter tip in the subclavian vein is associated with a high risk of thrombus formation and vessel occlusion2 ) . the risk of thrombosis may increase when hyperosmolar parenteral nutrition fluid is administered through a misplaced central venous catheter into a internal jugular vein3,15 ) . moreover , malpositioned catheter tips can damage the endothelium and precipitate the formation of thrombi17 ) . when a cvc causes thrombosis , the risk of catheter - related sepsis may increase . in patients with a cvc , the risk of catheter - related infection was reported to range between 1% and 10%1 ) . contamination of a thrombus from the skin puncture site may result in septic endophlebitis , and occasional blood - borne infections may also contaminate the thrombus . embolic septic thrombi may involve the lungs and , less frequently , the joints , viscera , and brain17 ) . subclavian or internal jugular vein thrombosis associated with indwelling catheters will propagate into other vessels , but extension into the intracranial sinuses and veins is rare . three reports describe an association between cerebral venous sinus thrombosis and central venous hyperalimentation due to placement of the catheter tip in the internal jugular vein3,15,16 ) . the authors warn of the potential for thrombosis due to retrograde infusion into the valveless internal jugular - dural sinus system but also suggest that the small caliber of the vein may predispose to thrombosis . in our case , we found the malpositioned catheter tip in the internal jugular vein on follow - up chest x - ray , but it was ignored . all intravenous fluids ( e.g. , total parenteral nutrition , mannitol , antibiotics ) were administered through the misplaced catheter . the patient 's condition worsened , leading to thrombosis of the internal jugular vein secondary to sigmoid sinus thrombosis . since the advent of antibiotics fever , chills , otalgia , tenderness to percussion over the mastoid emissary vein , headache and vomiting are common but not pathognomonic features8,18 ) . occasionally , neurologic symptoms are related to increased intracranial pressure or infarct and present as deteriorating mental status , lethargy , seizures , hemiplegia , and coma , and may lead to death . rarely , remote septic conditions such as pneumonia are the presenting symptoms9 ) . because of the nonspecific signs and symptoms of disease and the masking effects of antibiotics , diagnosis is difficult . the diagnosis of sigmoid sinus thrombosis can be confirmed by ct , magnetic resonance imaging , or angiography . contrast - enhanced ct scans demonstrate multiple intraluminal filling defects and nonvisualization of the sinus18 ) . in addition , low density lumen , sharply defined dense vessel wall , or distension of the thrombosed vein , such as the " empty delta sign " , are positive signs for sinus thrombosis19 ) . vascular imaging with cerebral angiography is highly specific for the recognition of sinus thrombosis because it can detect the lack of blood flow in thrombosed cerebral veins and dural sinuses . chest x - rays may also demonstrate septic embolic pleura - pulmonary complications , which are often bilateral , by revealing nodular infiltrates with pleural effusion17 ) . retrospectively , we confirmed that contrast - enhanced brain ct scans revealed a low density lumen surrounding a sharply enhanced dense vessel wall at the sigmoid sinus on the right side . also , the right internal jugular vein and sigmoid sinus were not visualized on ct angiography . treatment consists of aggressive antimicrobial therapy , heparinization , anticoagulation , and decreasing intracranial pressure . antibiotic selections is directed toward the causative pathogen cultured at the initial site of infection . recent studies have shown heparinization to be safe and beneficial , despite the possibility of an increased risk of hemorrhage4,10,16 ) . currently , heparin is recommended as the initial drug of choice for cerebral venous sinus thrombosis followed by long - term anticoagulation with warfarin5,10,12 ) . although these procedures allow for rapid clot removal and reduction of venous hypertension , hemorrhagic complications can occur , leading to be high morbidity and mortality14 ) . occlusion of the cerebral veins due to thrombosis may induce localized brain edema and venous infarction resulting in elevated intracranial pressure . finally , death frequently results from increased intracranial pressure caused by obstruction of venous and cerebrospinal outflow11 ) . in our case culture results of the subclavian catheter tip and blood were confirmed as staphylococcus epidermidis and methicillin - resistant staphylococcus aureus , respectively , and we switched from broad - spectrum antibiotics to vancomycin . unfortunately , we could not start heparinization due to concurrent cerebral hemorrhage of being transformed from cerebral infarction . severe pneumonia due to septic emboli eventually developed in both lung fields , and the patient died . diagnosis of internal jugular vein - sigmoid sinus thrombosis is challenging due to vague clinical features . therefore , if patients with malpositioned cvcs present with symptoms of fever , chills , headache , vomiting , increased intracranial pressure , mental deterioration , and focal neurologic deficits , intracranial sinus thrombosis should be considered . even vague symptoms may need to be investigated radiologically to discover a thrombosis early , when it can be treated . supported by nci 2p50 ca09825806 , nci u01 ca168394 , stand up to cancer / aacr dream team translational cancer research grant su2c - aacr - dt0209 , tcga gdac grant ( nih / nci u24 ca143883 ) to gbm ; mdacc uterine spore career development award ( nci p50ca098258 ) to lwt .

septic internal jugular vein - sigmoid sinus thrombosis ( ijv - sst ) associated with a malpositioned central venous catheter is a rare condition . it is potentially life - threatening and necessitates early diagnosis and rapid administration of appropriate medications . unfortunately , it is difficult to diagnose due to vague clinical presentations . several studies such as ct , mri , and cerebral angiography should be performed and carefully examined to help make the diagnosis . we report a case of septic ijv - sst due to a malpositioned central venous catheter .

please summarize the articles given below

the function of sensory receptors ( nrec ) in the movement control , muscle coordination and perception of the space position of temporo - mandibular joint ( tmj ) is fundamental although the presence of nrec in the tmj is still debated : some authors have reported on the lack of nervous fibers in the articular disk 1,2 , while florid innervation of tmj has been reported in several studies on animal models and in human 3 - 6 which suggested that 6 the concentration of sensory receptors within tmj is higher in the areas supporting higher strong tensions during articular movements ( chewing , biting , speaking ) . in discordance , other authors disclosed the presence of mechanical nrec in the articular disk of human tmj 7,8 also distinguishing receptors in capsulated and uncapsulated on the bases of morphological features . the aim of this study is to ascertain the presence and the distribution of nrec in human tmj by using of immunohistochemical investigations in healthy and pathological tmj such as arthritis and arthrosis . the study was approved by the bioethics committee of the department of odontology and surgery of university of bari . 10 samples of capsular and pericapsular soft tissues with the disk were obtained from healthy patients ( six men and four women with a mean age of 39 years ) who suffered surgery of tmj because of accidental trauma of the temporo - mandibular region ; the remaining 7 cases ( four men and three women with a mean age of 57 years ) were patients surgically treated for severe degenerative lesions of tmj ( chronic arthritis and arthrosis ) . all specimens were immediately fixed in neutral buffered formalin and embedded in paraffin ; 5 micron thick sections were cut and stained with haematoxylin - eosin , pas , gomori 's reticulin and azan - mallory trichrome ; consecutive sections were used for the immunohistochemical detection of the antigens listed in table 1 . all the antibodies used are commercially avalaible from dako italia spa , milan , italy ( glial fibrillary acidic protein = gfap ; myelin basic protein = mbp ; neurofilaments = nf ; neuron specific enolase = nse ; synaptophysin ; s-100 protein = s-100 ) and from becton dickinson , burlingame , usa ( leu-7 ) . in all cases the immunohistochemical alkaline phosphatase - anti - alkaline phosphatase ( apaap ) method was performed 9 while some sections for anti - neurofilaments antibodies were treated for 10 minutes with 1% saponin in phosphate buffered saline ( pbs ) , ph 7.2 , before the application of primary antibodies . with histochemical techniques and h&e stain , nrec were not easily detectable ( figures 1 - 8 ) ; however , these were used to identify the corresponding tissue in immunostained slides . in all specimens , such types of nrec have been detected by immmunohistochemistry ( table 2 ) : a ) globular receptors with a thin capsule closely resembling ruffini 's ones ; they exhibited strong immunoreactivity in their core for s-100 , nse and leu-7 and were abundant in the superficial peri - articular muscles and in the peri - articular fibrous capsule ; b ) elongated , onion - like receptors with a thick capsule mimicking pacini 's receptors , positive for mbp , s-100 , nse and leu-7 , particularly abundant in deep muscle fibres and in peri - articular dense fibrous tissues ; c ) fusiform capsulated receptors , morphologically similar to golgi 's receptors , located within peri - articular fibrous tissues and ligament and fibromuscolar resections , strongly positive for s-100 , mbp and leu-7 and weaker gfap reactivity . in all these types of nrec ( a+b+c ) and especially in the core , punctate reactivity for synaptophysin and for neurofilaments was also evident ; d ) free and thin nervous endings in high density within subsynovial connective tissues , in intra- and periarticular fibrous tissues and along the perimisial , endomisial sarcolemma of striated muscle fibres were detected , showing immunoreactive for neurofilaments , nse , synaptophysin and to s-100 antibodies . in the articular fibrous cartilage ( articular disk ) any previously described nrec was identified ; only s-100 protein seemed to react with chondrocytes both in normal and diseased tissues . furthermore , chondrocytes of healthy individuals appeared round - shaped , with distinct cell borders and central nuclei with an evident s-100 reactivity both in nucleus and in cytoplasm . in diseased tmj , instead , chondrocytes showed a different morphoology , especially after s-100 immunostaining : they had an elongated cytoplasm with one or more thick dendritiform processes of variable length but with a strong reactivity only for s-100 protein . the number of dendritiform chondrocytes was higher in specimens of diseased patients than in healthy patients and seems undergo a reactive reparative proliferation of discal and peridiscal tissues . few studies are reported in literature on the precise identification and distribution of nrec in articular and peri - articular tissues of tmj . in the past , some authors 3 - 6 identified ruffini's - like , pacini 's like and golgi 's like receptors both in articular and periarticular tissues , using conventional or histochemical methods usually performed to identify nerve fibres and receptors 7,8 . by using immunofluorescent techniques , other authors 3 demonstrated the presence of nervous fibers in the periarticular fibrous tissues , which seemed to run along the blood vessels reaching the fibrous cartilage of tmj and ending to the inside . our study confirmed the results of other preceding reports on the presence of several different types of nrec in periarticular soft tissues of tmj , allowing additionally a precise immunohistochemical identification of ruffini's - like , pacini's- like and golgi's - like receptors in skeletal muscles and tendons , in periartcular dense fibrous connective tissues and in subsynovial tissues . in fact , nrec appeared nse , s-100 and mbp immunoreactive showing gfap and and leu-7 immunoreactivity to lower degrees . free nervous endings , immunohistochemically positive for neurofilaments , nse , and s100 protein , have been detected only in periarticular soft tissues ( higher density in muscles and in the vascular venous plexus in the posterior part of discal ligaments and in the trilaminar zone ) and not in cartilagineous disk . the latter , besides , appeared constituted by s100 immunoreactive chondrocytes both in healthy individuals and in patients with chronic degenerative tmj lesions . in pathological patients with severe disk damage number and morphology of chondrocytes were severely different in comparison to normal tissues 11 ; chondrocytes , in fact , were more numerous with a rough and thick elongated cytoplasmic processes conferring a dendritic - like appearance . in some instances , dendritic processes were extremely long and consequently their cytoplasm of origin could not be detected in a single section but only on consecutive sections of the same specimen . in no instances this cellular component and their prolongments in cartilagineous disks showed neurofilaments , nse or synaptophysin immunoreactivity . morphological changes of chondrocytes in patients with chronic arthritic disease of tmj we observed , conferring them the appearance of neural cells and their axons , have been previously described in literature 10 . this misleading feature is further emphasized by the occurence of s-100 immunoreactivity in dendritic chondrocytes , as well as in normal chondrocytes . nevertheless , s-100 positive cells in the articular cartilage of tmj bear rare , thick and coarse cytoplasmic processes in which no one of the antigens commonly found in peripheral nerve fibres ( e.g. leu-7 , mbp , neurofilaments , nse and synaptophysin ) , except for s-100 , could be detected . in contrast , peripheral nerve fibres usually exhibit long , thin and varicose cytoplamic prolongments in which a variable combination of the above mentioned antigens is usually detectable in conjunction with s-100 reactivity . the results of our study indicate that free nervous endings described by other authors 3 - 8 are definitely proven to be nrec , and it appears likely to stress that , especially in pathological conditions , chondrocytes and their prolongments might morphologically resemble nrec in the articular disk , although their immunophenotype is rather different with the lack of expression of typical neural antigens . although immunochemistry can be easily used to study distribution and location of nrec in articular tissues , we also suggest that ultrastuctural and immuno - ultrastructural studies should be performed in order to definitely assess if chondrocytes is the exclusive cell type of articular cartilage or if also nrec could be present in tmj . brown - squard syndrome ( bss ) , which occurs due to dysfunction of the spinothalamic tract , typically reflects the hemisection of the spinal cord at the cervical or thoracic level . the syndrome mainly occurs as a result of penetrating trauma , syringomyelia , hematomyelia , tumor , severe discs , or blunt trauma . among the multiple etiologies , the most common cause is penetrating trauma , such as a gunshot7,8 ) . therefore , most management guidelines focus on penetrating cervical injuries and/or vertebral artery ( va ) injury12 ) . non - missile penetrating spinal cord and va injuries are rare because of the bony structures that protect the spinal cord and va14 ) . thus , the treatment approach for wounds caused in non - missile penetrating spinal injuries such as a knife , a power drill bit , or even a pen could be different from common missile penetrating injuries5,6,13,17).to our knowledge , there are few reports in the literature of complete obstruction of the va due to penetration of a foreign body through the neural foramen into the spinal canal . herein , the authors report on va dissection and bss caused by penetration of an electric screw driver bit . a 25-year - old machine operator was involved in a violent episode and was stabbed in his right neck with an electric screw driver bit that was thrown by the opponent . on arrival at the emergency department , the electric screw driver bit was placed in the right lateral aspect of the neck at zone i ( fig . the tip of the electric screw driver bit was located at the center of the vertebral canal of c3 ( fig . he was given high - dose methylprednisolone ( bolus dose of 30mg / kg followed by 5.4mg / kg / hour for 23 hours ) according to the protocol for spinal cord injury . an immediate interventional angiography was undertaken without general anesthesia due to the nature of the emergency . the angiography revealed a total occlusion with dissection of the right va at the level of c3 . immediate coil embolization at both proximal and distal ends of the injury site was performed ( fig . an attempt at manual extraction of the electric screw driver bit failed with great resistance . after the patient was moved to the operating room , the electric screw driver bit was removed manually with muscle dissection under general anesthesia . venous blood spilled out and was controlled easily by application of several pieces of gelatin sponge . no postoperative complications such as wound dehiscence , cerebrospinal fluid ( csf ) leakage , or infection were observed . the neurological motor function of the right upper and lower extremities recovered to 3/5 and 4/5 , respectively , with persistent decreased sensory function after one year . fortunately , the patient experienced no neck swelling , auscultation of a neck bruit , or delayed ischemic complications . penetrating injury is the third most frequent cause of spinal cord injury in adults , surpassed only by traffic accidents and falls3,18 ) . stab wounds are associated with lesser surrounding tissue injury than gunshot wounds because the former delivers less energy than missile injuries9 ) . although vascular injury is the most common sequel of penetrating neck trauma , va injury is rare because it is well protected by the transverse foramen4,10 ) . therefore , penetrating injury of the va is mostly caused by gunshot wounds which deliver large kinetic energy , depending upon the bullet 's mass and speed12 ) . in this article , we report a rare case of va penetration by an electric screw driver bit with spinal cord insult , consequently presenting as bss . moreover , surgical exploration of the va can cause additional damage to the spine and surrounding tissues . therefore , it may be reasonable to embolize an occluded artery , because the unilateral ligation of the va rarely results in brainstem ischemia11,16 ) . there are a few reports regarding the treatment of traumatic va injury such as the arteriovenous fistulas and pseudoaneurysms2 ) . emergent surgical exploration is necessary for patients with hard signs of vascular injury , such as hemodynamic instability , hemorrhage exsanguinations , or expanding hematoma15 ) . patients that are hemodynamically stable and who are without respiratory compromise should undergo further diagnostic imaging evaluation15 ) . as presented in this case , endovascular techniques were a safe and effective method of treatment and were not associated with significant morbidity or mortality1 ) . airway management , intubation methods , and surgical positions can be points of debate between anesthesiologists and surgeons9 ) . if a lacerated va can be successfully obliterated , a penetrating electric screw driver bit may be extracted without general anesthesia . nevertheless , the authors recommend that surgeons should be prepared for conversion to open surgery and extraction should be performed with the support of a surgical team . we initially tried to extract the electric screw driver bit manually without general anesthesia in the intervention theater after va embolization . however , the electric screw driver bit was positioned firmly in the neural foramen , and the patient complained of severe pain when the electric screw driver bit was being pulled out . in addition , there was more important rationale that justified surgical exploration for extraction of the electric screw driver bit . on extraction of the electric screw driver bit , the authors describe a rare case of penetrating cervical injury caused by an electric screw driver bit with accompanying va penetration and bss .

aim : a study was performed on the articular disk and periarticular tissues of the temporo - mandibular joint ( tmj ) with immunohistochemical techniques to give evidence to the presence of neuroreceptors ( nrec ) in these sites . methods : the study was carried out on tissue samples obtained from 10 subjects without tmj disease and from 7 patients with severe tmj arthritis and arthrosis . we use antibodies directed against following antigens : gliofibrillary acidic protein ( gfap ) , leu-7 , myelin basic protein ( mbp ) , neurofilaments 68 kd ( nf ) , neuron specific enolase ( nse ) , s-100 protein ( s-100 ) and synaptophysin ( syn ) . results : this study revealed that ruffini's - like , pacini's - like and golgi's - like receptors can be demonstrated in tmj periarticular tissues and that free nervous endings are present in the subsynovial tissues but not within the articular disk . we observed elongated cytoplamic processes of chondrocytes that demonstrated strong s-100 immunoreactivity but they were unreactive with all other antibodies . these cytoplamic processes were more abundant and thicker in the samples obtained from patients with disease tmj . conclusion : the results of this study confirm that different nrec are detectable in tmj periarticular tissues but they are absent within the articular disk . in the latter site , only condrocytic processes are evident , especially in diseased tmj , and they might have been confused with nervous endings in previous morphological studies . nevertheless the absence of immunoreactivity for nf , nse and syn proves that they are not of neural origin .

please summarize the articles given below

primary intracystic squamous cell carcinoma ( scc ) in the breast is an extremely rare neoplasm . primary sccs in the breast are quite rare , although scc mixed with ductal carcinoma is more common . it can arise from metaplastic epithelium associated with other primary malignancy of the breast , metastasis from primary elsewhere in the body or an extension of malignancy from the skin covering . a 45-year - old female presented with a lump in the right breast , which she had noticed since three weeks . her menstrual cycles were regular and she had two children . clinical examination revealed a firm cystic lump of 12 10 cm in the upper inner and central quadrant of the right breast . the skin over the right breast appeared stretched , with a slight retraction of the nipple . pre - operatively , the patient was relegated to clinical stage iii ( t3n0m0 ) . ultrasonographic examination of the right breast showed an irregular - shaped hypoechoic lesion measuring 12 6 cm with an internal anechoic area measuring 6 3 cm , suggesting a cystic malignant tumor . fine needle aspiration from the lump in the right breast yielded 10 ml of pale yellow serous fluid . wet - fixed and air - dried smears were prepared from the centrifuged aspirated fluid and were stained with papanicolaou ( pap ) stain and may - grnwald - giemsa ( mgg ) stain , respectively . the smears studied were cellular and showed malignant squamous cells predominantly in singles and occasional syncytial groups , and some cells were spindle shaped . the malignant squamous cells had rounded borders with hyperchromatic enlarged nucleus and coarse irregular granular chromatin . cytoplasm of the squamous cells showed a variable degree of keratinisation [ figure 2 ] . cytology smears showing malignant squamous cells in singles with numerous cyst macrophages ( mgg , 400 ) cytology smear showing malignant squamous cells in singles , demonstrating cytoplasmic keratinisation ( pap , 400 ) to exclude metastatic scc , a search for remote primary scc included chest radiograph , cystoscopy , colposcopy , oesophagogastroscopy , laryngoscopy and cervical pap smear , which did not reveal any extramammary cancer . the criteria include : ( 1 ) no other neoplastic element , such as ductal or mesenchymal ones , are present in the tumor , ( 2 ) the tumor is independent of adjacent cutaneous structures and ( 3 ) no other distant epidermoid tumor exists in the patient . later , simple mastectomy with axillary clearance was performed and the specimen was sent for histological examination . the cut - section of the mastectomy specimen showed a large cystic tumor measuring 8 3 cm , containing yellow serous fluid . the cystic cavity was lined by dysplastic squamous epithelium with an infiltrating tumor , showing malignant squamous cells in broad sheets , groups and whorls , with keratin - pearl formation and intercellular bridges . immunostaining for estrogen / progesterone receptor and her-2/neu oncoprotein were negative and that for cytokeratin was positive . the smears studied were cellular and showed malignant squamous cells predominantly in singles and occasional syncytial groups , and some cells were spindle shaped . the malignant squamous cells had rounded borders with hyperchromatic enlarged nucleus and coarse irregular granular chromatin . cytoplasm of the squamous cells showed a variable degree of keratinisation [ figure 2 ] . cytology smears showing malignant squamous cells in singles with numerous cyst macrophages ( mgg , 400 ) cytology smear showing malignant squamous cells in singles , demonstrating cytoplasmic keratinisation ( pap , 400 ) to exclude metastatic scc , a search for remote primary scc included chest radiograph , cystoscopy , colposcopy , oesophagogastroscopy , laryngoscopy and cervical pap smear , which did not reveal any extramammary cancer . the criteria include : ( 1 ) no other neoplastic element , such as ductal or mesenchymal ones , are present in the tumor , ( 2 ) the tumor is independent of adjacent cutaneous structures and ( 3 ) no other distant epidermoid tumor exists in the patient . later , simple mastectomy with axillary clearance was performed and the specimen was sent for histological examination . the cut - section of the mastectomy specimen showed a large cystic tumor measuring 8 3 cm , containing yellow serous fluid . multiple sections studied showed cystic breast tumor . the cystic cavity was lined by dysplastic squamous epithelium with an infiltrating tumor , showing malignant squamous cells in broad sheets , groups and whorls , with keratin - pearl formation and intercellular bridges . immunostaining for estrogen / progesterone receptor and her-2/neu oncoprotein were negative and that for cytokeratin was positive . pure scc and adenosquamous carcinoma have been listed under metaplastic breast carcinomas in the world health organization classification . the japanese breast cancer society has defined scc of the breast as a special type of cancer , in which malignant cells are arranged in broad sheets and whorls with keratin formation or intercellular bridge . the incidence of scc reported in the western countries is 0.13.6% and in japan , it is 0.17% . the age group affected is between 32 and 65 years , with an increased tendency of left - sided involvement . the characteristics of scc of the breast generally reported are a large - sized tumor , rapidly growing with a central cyst formed by necrosis . this is unlikely in our case because there was little necrosis elsewhere in the tumor . the possible mode of origin of scc is epidermoid cyst of the breast , chronic abscess and complete metaplasia of glandular breast tissue . lymph node involvement is reported to be less frequent than might be expected , given the larger tumor size . the tumor cells are negative for vimentin , estrogen and progesterone and are diffusely positive for high molecular weight cytokeratin and c - erbb-2 . squamous cells in fine needle aspiration cytology ( fnac ) of breast lesions can be found in various benign lesions , like epidermoid cyst , subareolar abscess , fibroadenoma , infracted papillomas , spindle cell metaplasia , cystic sarcoma phyllodes , pseudosarcoma and malignant breast tumors or metastatic malignancy . the benign breast conditions with abundant squamous cells may sometimes mimic malignant squamous lesion and vice versa . in general benign squamous cells are bland looking and are often associated with anucleated squames , and no tumor , cell cannibalism . the malignant squamous cells are more pleomorphic , mitotically active and dyskeratotic and , sometimes , bizarre - shaped cells can be seen . the differential diagnosis of malignant squamous cells in fnac of the breast includes primary scc and metastatic scc of the breast . careful assessment of cytological features of squamous cells and the background appearance appears to be critical for arriving at a correct diagnosis . however , in the case of intracystic scc , numerous foamy macrophages coexist with malignant squamous cells . hormonal therapy is not indicated as most cases of scc are negative for hormonal receptors . scc of the breast is reported to be resistant to both radiotherapy and standard chemotherapy performed for invasive ductal carcinoma . in our case , radical mastectomy with axillary clearance was performed with postoperative adjuvant therapy , as given for common types of breast cancers . there was no evidence of recurrence of the tumor after four years of treatment . in conclusion , the presence of malignant squamous cells in fine needle aspiration of the breast suggests primary scc or metastatic scc . the finding of a pure scc necessitates more accurate work - up to exclude skin lesion or metastasis . the primary scc should not be confused with a much more largely manifested metaplastic change in other usual breast cancers . although the presence of numerous cyst macrophages in the background of breast fnac smears suggests a benign lesion , when present with malignant squamous cells , they suggest intracystic scc . despite advancements in modern medical science and the health management industry , the incidence of cerebral palsy ( cp ) continues to rise1 . the most common features of cp are decreased muscle strength and abnormal muscle tone2 . cp sufferers lack theability to generate enough force to maintain antigravity postural control , which result in abnormal postures3 . the development of movement and posture may be altered by non - progressive damage to the brain and subsequent neurological impairments ( spasticity , muscle weakness , co - contractions and visual impairment)5 . studies indicate that children and adults with both mild and severe forms of cp have postural impairments6,7,8 . the emergence of sitting postural control in early infancy changes the way infants interact with the world . from the sitting position , looking , reaching , and interacting become functional and allow exploration that supports learning and further development of motor skills . therefore , independent sitting , defined as not needing support from a caregiver or pillow while sitting , is one of the first developmental goals for every child . individual differences are present between children , and characteristic signs of developmental disorders during infancy are relatively unspecific . therefore , why a specific child is not able to achieve sitting postural control is not always clear . one method of examining postural control in adults and children is to measure the center of pressure ( cop ) at the base of support using a force platform during the task of remaining upright . cop has frequently been used to investigate postural control during standing by young children who are healthy or have cp9 , 10 . the purpose of this study was to investigate the differences of the pressure distributions of the sitting postures of typical developmental ( td ) children and children with cp . twelve cp childrens were recruited from an outpatient rehabilitation clinic . they were hemiparetic , had an mmse - k score above 2411 , could maintain an independent sitting posture without support . two of the cp children were subsequently excluded because they refused to participate in this experiment . all parents of the enrolled participants provided their written informed consent to their children s participation prior to this experiment , in accordance with the ethical principles established in the declaration of helsinki . as a result of the exclusion , this study used two school chairs mounted on a force platform to assess the quiet - sitting pressure distribution of the subjects . fsa seating assessment ( canada ) the acquisition frequency was set at 5 hz . the stated working range of the device is 0200 mmhg , with a resolution of 1 mmhg . the system was also calibrated to assign absolute pressure values to the digital output from an a / d converter connected to the sensing pad . this was done by applying a pressure distribution as similar to actual conditions as possible . then thus subjects sat on one of two school chairs according to their height . the chairs were those generally used in school . for research purposes , this study used two basic school chair because students spend a long time of day - to - day sitting on them . one chair had a 40 cm floor to seat height , a 35 cm seat depth , and a 32 cm seat width and is designed for 122.4133.5 cm height of subjects . the another had a 35 cm floor to seat height , a 38 cm seat depth , and a 35 cm seat width , and is designed for 133.6152.7 cm height of subjects . it has been used for the posture symmetry in other study13 statistical analyses were performed using pasw 18.0 . descriptive statistics were calculated ( frequency , mean , standard deviation , range ) . the mann - whitney u - tests and wilcoxon s signed rank tests were used to analyze differences between the groups and differences in lesion side , respectively . the si of the age matched td group was employed as the normal criteria . table 1table 1.general characteristics of the subjectscerebral palsygroup ( n=10)typicaldevelopmentalgroup ( n=10)age ( years)8.040.827.840.94gender ( male / female)5/54/6lesion side ( right / left)4/6symmetry index ( meansd)5.041.342.302.76 shows the general characteristics of the participants . the si of the td group was significantly closer to zero than that of the cp group of children . cp and right hemiparetic cp were respectively 4.96 ( 2.24 ) and 5.12 ( 0.83 ) with no significant difference between the hemiparetic sides . the purpose of the present study was to investigate the differences in sitting posture of children with cp while they sat on school chairs . it is known that dynamic postural control during sitting can be reliably assessed using cop data of infants who are developing typically or infants with or at risk of cp14 . the principal finding of this study is that cp children s sitting posture is asymmetrical , leaning to the less - paretic side . we thought that infants who are developing typically develop the ability to sit by exhibiting an optimal range of movement variability , whereas cp may present either too much or too little variability leading to a very rigid and narrow or unpredictable set of movement solutions to achieve independent sitting . the finding of this study is agreement with previous studies that have the dissimilarities of the cop patterns of infants with cp and td have been obviously demonstrated14 . the results can not be generalized to all cp children because the sample was limited to ten children and they were at the one stage of the developmental process . future studies should assess the relationship between symmetry of sitting posture and functional activities .

primary intracystic squamous cell carcinoma ( scc ) of the breast is an extremely rare entity and has a low incidence in comparison with other breast cancers . we report a rare case of primary intracystic scc in a 45-year - old woman who presented with a cystic lump in the right breast . cytological smears of the fluid aspirated from the breast tumor revealed malignant squamous cells dispersed in single and occasional groups along with numerous cyst macrophages , suggesting cystic scc . histological study of the mastectomy specimen confirmed the diagnosis of primary intracystic scc . although the presence of abundant foamy macrophages in the background of fine needle aspiration cytology smears of the breast suggest benign breast lesion , when associated with malignant squamous cells , these suggest cystic primary scc or metastatic scc . the primary scc should not be confused with metaplastic change in other breast carcinomas .

please summarize the articles given below

ectopic kidney is a relatively rare renal anomaly however , an endourologist does encounter stone disease in an ectopic kidney occasionally . factors such as anomalous blood vessels and tortuous ureter with high insertion can lead to poor drainage and predisposition to the formation of renal calculi in these patients . the common management option for such stones is laparoscopy or ultrasound guided percutaneous nephrolithotomy ( pcnl ) . we report our experience with the use the recently described micro - pcnl or microperc for two such cases . two male patients , aged 57 and 60 years respectively , presented to us with calculi in ectopic pelvic kidneys . the first patient had undergone a flexible ureterorenoscopy elsewhere during which the stone could not be reached due to difficult angulation and inflamed tissue leading to poor vision . computed tomography urogram revealed an ectopic malrotated left kidney lying over the sacrum . there was a 13 mm 11 mm sized calculus in the renal pelvis [ figure 1a and b ] . in the second patient , computed tomography urogram revealed a normal right kidney and an ectopic malrotated left kidney lying over the sacrum . there was an 18 mm 17 mm sized calculus ( 1232 hu ) in the pelvis and a 5 mm 4 mm sized calculus ( 423 hu ) in the lower calyx of the ectopic kidney [ figure 1c and d ] . ( a ) x - ray kub showing renal calculus in pelvis of pelvic ectopic kidney with double j stent in situ , ( b ) computed tomography urogram showing the pelvicalyceal system anatomy , ( c ) x - ray kub showing renal calculus ( yellow arrow ) in ectopic kidney , ( d ) computed tomography urogram showing the pelvicalyceal system anatomy ( location of pelvic stone - yellow arrow ; location of lower calyceal stone - red arrow ) both procedures were performed under general anesthesia . in lithotomy position , ureteric catheterization was carried out under cystoscopic guidance using 7 fr ureteric catheters over a 0.035 inch glidewire ( terumo , tokyo , japan ) . the position was changed to supine - oblique with a sandbag under the ipsilateral hemipelvis to move the overlying bowel away from the kidney . an ultrasound probe was pressed against the anterior abdominal wall to displace the bowel away from the line of access . further , colour doppler was used to rule out any significant blood vessel in the path of needle puncture . three - way connector was attached to the needle , allowing saline irrigation , passage of a 0.9 mm flexible microperc telescope , and a 272 m holmium : yttrium aluminum garnet ( ho : yag ) laser fiber [ figure 2 ] . the stones were completely fragmented to dust with the laser . an x - ray and ultrasound was obtained on the first post - operative day to document stone clearance and to rule out any fluid collection . the urethral catheter was removed on the first post - operative day and the patient was discharged . ( a ) surface view of patient position and ultrasound guided percutaneous renal access , ( b ) intraoperative ultrasonography picture showing entry of puncture needle ( yellow arrows ) into lower calyx containing calculus ( red arrow ) , ( c ) confirmation of access into lower calyx by antegrade contrast study to delineate pelvicalyceal system , ( d ) intraoperative surface view showing microperc instruments , ( e ) puncture site at the end of the procedure ( yellow arrow ) , ( f ) post - operative x - ray kub showing complete clearance operating times were 30 and 35 min respectively . in the first patient , ureteric catheter was left in situ for 1 day . in the second patient , ureteric catheter was replaced by a double - j stent at the end of the procedure . visual analog pain scores ( 1 - 10 scale ) on first post - operative day were two and three respectively . first post - operative day and 1 month follow - up x - ray and ultrasound kub revealed complete stone clearance and no evidence of fluid collection in the abdomen . options for managing small renal calculi in pelvic ectopic kidney are shock wave lithotripsy ( swl ) , retrograde intrarenal surgery ( rirs ) , ultrasound or laparoscopy guided pcnl . since these kidneys are surrounded by bowel and bone , moreover , the clearance of fragmented stones is also impaired due to high insertion of ureter and impaired pyeloureteral motility due to surrounding fibrous bands . rirs can be technically demanding due to abnormal and tortuous course of the ureter of a pelvic kidney . this was exemplified by our first patient in whom the stone could not be reached with flexible ureteroscope and the procedure had to be abandoned . the potential hazards in percutaneous access in an ectopic kidney are : ( 1 ) risk of injury to surrounding bowel , particularly if track dilatation is carried out through the bowel , ( 2 ) abnormal vasculature resulting in bleeding from tract dilatation and ( 3 ) spillage of fluid into peritoneal cavity . microperc is a minimally invasive form of pcnl in which percutaneous renal access and stone fragmentation are achieved in a single - step using a 16 g needle . since dilatation is not performed , potential hazards associated with it are avoided . fluid collection is less likely during puncture and at the end of the procedure since the needle puncture site closes quickly . both our patients had rapid post - operative recovery , probably due to lack of fluid spillage and hence no paralytic ileus . though laparoscopic guidance has been advocated for percutaneous access of an ectopic kidney , in experienced hands , ultrasound guidance can provide a safe entry into the appropriate calyx . appropriate patient positioning to move bowel away from the kidney , placing a sand bag to push the kidney towards the anterior abdominal wall and compression with the ultrasound transducer allow safe access into the kidney . further , the use of colour doppler rules out any significant blood vessel along the path of needle puncture . the hemoglobin drop in both of our patients was minimal , supporting the safety of this procedure . in laparoscopy guided pcnl , an abdominal drain may need to be left in situ for a prolonged period because of persistent urinary leakage . the average hospital stay in a series of 15 patients who underwent laparoscopy guided pcnl was 4.8 days ( 4 - 11 days ) . the patients in that series had sequential removal of nephrostomy tube , urethral catheter and abdominal drain , which lead to the prolonged post - operative stay . thus , ultrasound guided microperc is a safe and efficient technique in the management of small renal calculi in ectopic kidneys and it is a minimally invasive procedure with short hospital stay . the laparoscopic removal of a cervical stump following a supra cervical ( subtotal ) hysterectomy was first described by nezhat et al , and they concluded that the cervical stump could be removed laparoscopically by an experienced surgeon . the advantages of the laparoscopic approach included possible stump adhesiolysis , providing adequate postoperative vault support , and assessment of the pelvic lymph nodes . the 43-year - old , presented with a history of persistent p v discharge and occasional post - coital bleeding . she had undergone subtotal hysterectomy in 1994 , due to postpartum hemorrhage following a normal delivery . a colposcopic biopsy done in january 2009 , reported severe dysplasia of the cervix , with a human papillomavirus ( hpv ) effect and crypt extension . there was a strong family history of cancer of the cervix , as her mother had succumbed to the disease . on general examination she was in fair general condition , well - built and well - nourished , with adequate hydration . the hemoglobin was 13.3 g / dl , blood sugar was 5.3 mmols / l , urea and electrolytes were normal . an initial diagnosis of abnormal pap smear was entertained and the patient opted for a laparoscopic trachelectomy , with the option of a laparotomy , after discussing all her options . there were dense adhesions in the pouch of douglas involving the bowel and the cervical stump . the pelvic lymph nodes were clearly visualized ( after intracervical methylene blue injection ) and did not appear to be enlarged . gentle adhesiolysis was undertaken using sharp dissection , bipolar cautery , and a harmonic scalpel . the vaginal vault was subsequently opened over the ceramic cup of a clermont ferrand elevator . a cystoscopy with retrograde ureteral catheterization , to confirm the integrity of the bladder and ureters , was undertaken . the cervical stump after laparoscopic trachelectomy at one week of follow - up the patient was well . a postoperative intravenous urogram ( ivu ) confirmed that both the ureters and bladder were intact . subtotal hysterectomy was developed as a procedure in the 1990s , and is regarded as a safe option to total abdominal hysterectomy in the management of benign uterine conditions and in obstetrics , due to severe postpartum hemorrhage . okaro et al , in an assessment of the long - term outcomes of laparoscopic supracervical hysterectomy analyzed the case records of 70 consecutive women undergoing the procedure . of these , 24.3% ( 17 cases ) reported symptoms related to the cervical stump , within 14 months of the original surgery . in his series 14 of these patients underwent laparoscopic trachelectomy , one had only laparoscopic adhesiolysis and two underwent a laparotomy with trachelectomy due to dense bowel adhesions on the cervical stump . histologically the stumps showed endometriosis ( 23.5% ) and mild dysplasia in 7.6% of the patients . in this case our patient presented with persistent p v discharge and occasional post - coital bleeding . the subsequent pap smears were abnormal . in a retrospective of 41 patients undergoing laparoscopic subtotal hysterectomy , van der stege et al , noted that 98% of the patients were satisfied with their procedure , with 10% of them having monthly spotting . they concluded that although laparoscopic hysterectomy for benign diseases was a satisfactory procedure , special attention should be paid to careful management of the cervical stump . hilger et al , reviewed the indications of 310 trachelectomies performed at the mayo clinic from 1974 to 2003 . they included stump prolapse ( 4% ) , fibroid mass ( 1% ) , cervical dysplasia ( 6% ) , carcinoma in situ ( 5% ) , irregular bleeding ( 2% ) , and cervicitis ( 53% ) . the complications following vaginal trachelectomies were encountered in 80% of the procedures against 37% in the abdominal procedure . in our report the cervical stump confirmed carcinoma in situ .

management of stone disease in an ectopic kidney is challenging . laparoscopy or ultrasound guided percutaneous nephrolithotomy and retrograde intra - renal surgery are the preferred techniques for these stones . we performed ultrasound guided microperc using a 16 g needle for the management of renal calculi in pelvic ectopic kidneys in two patients . there was no intraoperative or post - operative complication . both patients had complete stone clearance and were discharged on the first post - operative day . ultrasound guided microperc is a safe and effective option for the management of small renal calculi in pelvic ectopic kidneys .

please summarize the articles given below

established in 2003 , erste foundation has a history stretching back 190 years to the year 1819 when it was founded as the erste sterreichische spar casse in vienna . rooted in our history as a social enterprise and financial service provider , erste foundation recognises that contemporary society faces huge challenges and that for a new and united europe to work , integration is crucial and that means uniting the economic , cultural and social capital of our region . we develop ideas and concepts to increase social participation and to ensure that no - one is left out , whatever their circumstances which in turn creates stable , effective and fairer societies . we want to work against prejudice and nationalism , to integrate thinking and living across borders , and make these experiences accessible , particularly to the young generation . we intend to play an active role in giving people opportunities to increase their understanding of each other . therefore , erste foundation has supported research projects that concern themselves with the effects of societal transformation processes : in particular we have been looking at the effects that demographic changes will have on the long - term care needs of elderly people in central and eastern europe . from this , we intend to develop policy recommendations for decision makers in civil society , economy and politics . acute generalized exanthematous pustulosis ( agep ) is a rare acute reaction that is drug - induced in 90% of the cases , characterized by a widespread , sterile pustular rash . cefepime is a fourth generation cephalosporin antibiotic used to treat febrile neutropenia , severe infections related to the urinary tract , skin , nosocomial pneumonia , brain abscess , and intra - abdominal and septic lateral / cavernous sinus thrombosis . a 67-year - old man with renal failure who had been on dialysis during the last 2 years and with an 8-year history of cardiac insufficiency was admitted to the hospital complaining of 6 days of diarrhea . the patient was taken to the semi - intensive care unit and treated with ciprofloxacin . as a consequence , his long - term medications had not been changed and consisted of acetylsalicylic acid , furosemide , captopril , carvedilol and clonazepam . on the seventh day , the patient became dyspneic and his chest radiograph showed a left lower lobe opacity . treatment for nosocomial pneumonia was promptly initiated with cefepime ( 1 g / day ) . five days later , he presented with a pruritic , erythematous , maculopapular eruption affecting the abdomen , neck and skin folds . one day later , he developed disseminated pustular lesions ( fig . 1 ) and his temperature was 37c . laboratory exams evidenced c - reactive protein 136 mg / l , white blood cells 14,700 cells/l ( normal 3,50010,500 cells/l ) with 11,995 cells/l neutrophils ( normal 1,7008,000 cells/l ) . histology showed a toxic pustuloderma with spongiform subcorneal pustules , edema in the papillary dermis and perivascular inflammatory infiltrate consisting of neutrophils ( fig . after withdrawal of cefepime and introduction of imipenem , the disseminated skin nonfollicular pustules cleared within 4 days following a desquamation . the patient denied previous adverse reaction to other drugs and no personal or family history of psoriasis was evident . agep is a disease characterized by the rapid onset of many sterile , nonfollicular pustules usually arising on an edematous erythema and frequently accompanied by leukocytosis and fever . skin symptoms usually arise rapidly after an insult and resolve spontaneously ( within a few days ) . agep often starts predominantly in intertriginous areas or on the face , spreading rapidly to the trunk and lower limbs . the mean duration of the pustules is 9.7 days , and an annular desquamation typically follows for a few days . complications are rare [ 1 , 3 ] . the agep validation score of the euroscar study group has been used to establish the diagnosis . a score between 8 and 12 for agep is a definitive diagnosis ( table 1 ) . the case score was 11 , according to the validation score of the euroscar study group ( table 2 ) . the main differential diagnosis of agep is pustular psoriasis . because the pustules clinically and histologically resemble the lesions of pustular psoriasis and because in a number of reports patients had a history of plaque psoriasis , some authors assume that agep is nothing more than an acute exacerbation of psoriasis caused by a variety of exogenous triggers however , many studies strongly suggest that agep is not associated with psoriasis [ 1 , 5 ] . up to now agep has been attributed to a variety of causes such as viral infections , chlamydia pneumoniae infection or hypersensitivity to mercury , but the skin reaction is primarily an adverse response to drugs . antibiotics , other than cefepime , have been implicated as the causative agents in 80% of individuals . in this group , the present case of agep has well defined criteria , and because correct diagnosis generally leads to spontaneous resolution once the causative drug is withdrawn , clinicians should keep the possibility of this cutaneous drug reaction in mind .

introductionestablished in 2003 , erste foundation has a history stretching back 190 years to the year 1819 when it was founded as the erste sterreichische spar casse in vienna . rooted in our history as a social enterprise and financial service provider , erste foundation recognises that contemporary society faces huge challenges and that for a new and united europe to work , integration is crucial and that means uniting the economic , cultural and social capital of our region.descriptionwe develop ideas and concepts to increase social participation and to ensure that no - one is left out , whatever their circumstances which in turn creates stable , effective and fairer societies.european integration is important to us . we want to work against prejudice and nationalism , to integrate thinking and living across borders , and make these experiences accessible , particularly to the young generation.projectswe intend to play an active role in giving people opportunities to increase their understanding of each other . therefore , erste foundation has supported research projects that concern themselves with the effects of societal transformation processes : in particular we have been looking at the effects that demographic changes will have on the long - term care needs of elderly people in central and eastern europe . from this , we intend to develop policy recommendations for decision makers in civil society , economy and politics .

please summarize the articles given below

cluster headache is a form of primary neurovascular headache , which consists of unilateral head pain that occurs in association with cranial autonomic features and , in most patients , has a striking circannual and circadian periodicity . excruciating painful attacks are accompanied by restlessness or agitation , usually last less than 3 h , and occur in bouts for a few months during which the patient has one or more crisis per day . the international headache society defines cluster headache as attacks of severe , strictly unilateral pain which is orbital , supraorbital and temporal or in any combination of these sites , lasting for 15180 min and occurring from once every other day to 8 times a day . the attacks are associated with one or more of the following , all of which are ipsilateral : conjunctival injection , lacrimation , nasal congestion , rhinorrhoea , forehead and facial sweating , miosis , ptosis , eyelid oedema . epidemiological data for the general population are scarce ; only five studies have been carried out until now on cluster headache prevalence in the general population , with conflicting results ( prevalence rates vary between 56 and 326 cases in every 100,000 inhabitants ) . a recent study on a sample representative of the italian general population aged over 14 years , reported an estimated prevalence rate of 279/100,000 ( 95% ci : 173427 ) , 227/100,000 ( 95% ci : 104431 ) in women and 338/100,000 ( 95% ci : 175592 ) in men . cataract is clouding ( opacity ) of the lens of the eye that causes a progressive , painless loss of vision . the first symptom of cataract is usually blurred vision . other symptoms that may progressively appear are : glare , halos , double vision and perception of colours as more yellow and less vibrant . three different types of cataract can be identified on a histological basis : nuclear , cortical and posterior subcapsular . investigations [ 58 ] on possible risk factors for the development of cataract , showed positive correlation with myopia , diabetes , smoking [ 911 ] , use of systemic corticosteroids , exposition to uv - b , and other environmental factors , to which has to be added genetic predisposition . however , it should be underlined that different degrees of correlation between distinct risk factors and the three types of cataract have been reported [ 6 , 15 ] . prevalence studies of age - related cataracts are hampered by the absence of a uniform grading system for cataract opacities , by differing definitions of visual impairment , and by additional coexisting ocular pathologies causing loss of vision . nonetheless , the framingham eye study in 1977 reported that the proportion of people with age - related cataracts causing loss of vision of 20/30 ( 6/9 ) or worse was 15.5% for all ages and 45.9% for those older than 75 years . in the beaver dam eye study in 1992 , using a similar definition of loss of vision reported proportions were 38.8% for men and 45.9% for women older than 74 years . however , it is not clear if variations in frequency reflect methodological diversity or true differences between populations . interestingly , most of the cited studies analyzed the cataract prevalence in age groups which are substantially different from those of our two cases . one single study reported the prevalence of cataract at a younger age ( 40 years and older ) with identified risk factors for the three different histological types of cataract . this study showed age - specific rates of the different histological cataract type , by stratifying the population sample by age . prevalence of 1% ( cortical type ) , of 0.2% ( nuclear type ) and of 2.0% ( posterior subcapsular ) was reported in individuals between 40 and 49 years and a prevalence of 3.9% ( cortical type ) of 0.2% ( nuclear type ) and of 2.6% ( posterior subcapsular ) was reported in individuals between 50 and 59 years . here , we report two cases that both developed cataract before the age of 50 years on the side affected from the cluster headache and reviewed published similar cases and potential mechanisms for comorbidity . we present a 44-year - old man with a history of cluster headache , diagnosed in accordance with ihs guidelines , since he was 21 years old . daily pain attacks , lasting about 90 min , were localized to the left periorbital area with ipsilateral lacrimation and rinorrhea . the cluster headache that initially occurred sporadically , from the age of 43 years became chronic . at the age of 39 , the patient was diagnosed of cataract on the left eye that was in the same year treated by surgery . the sole risk factor for developing cataract at anamnesis was smoking habit ( 30 cigarettes / day ) . a detailed pharmacological anamnesis excluded any kind of exposure to prolonged treatment with steroid drugs . the second case was a 53-year - old man who experienced his first cluster headache episode when he was 44 years old . cluster periods were characterized by 34 attack / day of severe right - sided pain localized to the periorbital region , lasting about 45 min and associated to ipsilateral lacrimation . the reported risk factor for developing cataract was smoking habit ( 10 cigarettes / day ) . also in this case , there was no report of chronic treatment with steroid drugs . references were identified by searches of pubmed from 1966 until october 2007 with the terms cluster headache and cataract . our search in pubmed shows only one report of a patient with cluster - like headache , which began after surgical removal of the crystalline for cataract and intraocular lens implant . therefore , to our knowledge , this is the first report of cataract occurring in cluster headache patients and , interestingly , on the same eye affected by the pain attack . it is of interest that both patients developed cataract in a young age , after suffering for years from chronic cluster headache attacks and in the absence of main risk factors for the development of early onset cataract , including prolonged steroid drugs exposure . it is noteworthy that the two patients , although not relative , had the same , rather uncommon , last name that we found to be specifically represented in a defined area of north - eastern italy . however , because we could not investigate the pedigree of one patient , any hypothetical genetic link between the uncommon occurrence of early onset cataract and cluster headache can not be proposed . in addition , it was not possible to perform in either of the two patients any investigation on ocular inflammation . thus , no speculation can be made on a possible causal relationship between repeated episodes of pain , inflammation and autonomic abnormalities that are considered to contribute to the cluster headache attack , and the precocious occurrence of the cataract . however , this first evidence of the occurrence of cataract in relatively young adult men with a history of chronic cluster headache is of importance , because underlining this uncommon type of comorbidity may favour the report of additional similar cases . hepatitis b virus ( hbv ) is an important risk factor for developing hepatocellular carcinoma ( hcc ) ( 1 ) . hcc is the fifth most common cancer worldwide , and it causes significant public health problems , especially in association with chronic hepatitis b ( 2 ) . morphologic lesions during hepatocarcinogenesis include dysplastic lesions ( dysplastic foci ( df ) and dysplastic nodules ( dns ) ) with low- and high - grade dysplasia and small cancerous lesions ( 2 cm in diameter ; early hcc ) ( 4 - 7 ) . the most common cause of cirrhosis in shiraz transplant center , which is the largest liver transplant center in the country , is hbv related , and majority of patients with hcc in this center are also hbv related ( 1 ) . therefore , we attempted to determine the incidence of hcc and its precursors in this group of cirrhotic patients through a thorough examination of explanted hbv - related cirrhotic livers . a two - year cross - sectional study was performed on 103 explanted hbv - related cirrhotic livers from the pathology department of shiraz university of medical sciences . during the study period ( 2014 - 2015 ) , explanted cirrhotic hbv - related livers ( recipient cirrhotic liver after liver transplantation ) received in the department of pathology were fixed in formalin for 24 - 48 hours . histologic sections from any hepatic nodule larger than 1 cm in diameter or those with any kind of difference with background parenchyma , such as color or consistency , were studied ( figures 1 and 2 ) . sections were stained with hematoxylin and eosin method , and slides were examined under a double - headed microscope by two pathologists . df were classified into having either small cell changes ( scc ) , formerly called small cell dysplasia , or large cell changes ( lcc ) , formerly called large cell dysplasia . nodules were studied and classified as low - grade dysplastic nodules ( lgdn ) , high - grade dysplastic nodules ( hgdn ) , and hepatocellular carcinoma ( hcc ) ( 5 ) . the following criteria were used to classify the different nodules in cirrhotic livers : cellularity , thickness of hepatocellular plates , nuclear atypia ( either pleomorphism or irregular contour ) , nucleocytoplasmatic ratio , cytoplasmic staining ( eosinophilic , basophilic , amphophilic , and clear ) , pseudoacinar pattern , stromal invasion , portal tracts , biliary pigment , lipid vacuoles , and iron status of nodules ( 8) . in lgdn , hepatocytes are not completely abnormal . that is , they show normal or slightly increased nucleocytoplasmic ( n / c ) ratio , minimal nuclear atypia , and no mitotic activity , but portal tracts are still present . compared with lgdn , hgdn have all of their features except the n / c ratio is higher , nuclear atypia is more obvious , cytoplasmic basophilia is more significant , and liver plates ( more than two cells thick ) are thickened with mitotic figures . in hcc , cell size is usually decreased , nuclear density is at least twice that of normal , nuclear atypia is definite , mitotic figures are present , and pseudoacinar formation may be present ( 9 ) . the term early hcc mean hcc in an early stage that are small in size ( usually < 2 cm ) . histologically , hcc are well differentiated and lack prominent cellular and structural atypia ( 10 - 13 ) . for convenience , we used the term advanced hcc ( ahcc ) for hccs that are greater than 2 cm in size in this article . the chi - square test was used to evaluate the significance of the relation between the nodules and their categorical variables . a total of 103 patients were included in the study . among the patients , 14 ( 13.16% ) were women , 89 ( 86.4% ) were men , age ranged from 20 to 73 , and mean age was 51.4 10.5 . among all explanted cirrhotic livers , 92 ( 89.3% ) had df with lcc , 57 ( 55.3% ) of which showed scc as well . out of these 103 explanted livers , 39 ( 37.9% ) had lgdn , 38 ( 36.9% ) had hgdn , 19 ( 18.4% ) had early hepatocellular carcinoma ( ehcc ) , and 21 ( 20.4% ) had ahcc ( figures 3 - 6 ) . note that all the cases with ehcc and ahcc also had scc , lcc , hgdn , and lgdn . thirteen cases of ehcc were accompanied with ahcc , and 6 cases of ehcc did not show any ahcc ( size larger than 2 cm ) . all of the 21 ahcc cases were transplanted with the preoperative diagnosis of malignancy and hepatitis b - related cirrhosis . however , among livers with ehcc , 6 were not accompanied with ahcc , 2 of which were unsuspected before surgery and diagnosed on the explanted liver . the two ahcc cases were smaller than 2 cm in diameter ( table 1 ) . our results showed that the presence of scc , lgdn , and hgdn has a statistically significant association with ehcc ( p < 0.05 ) and hcc ( p < 0.05 ) . moreover , the presence of ehcc is associated with ahcc ( p < 0.05 ) . hcc is a poor prognostic cancer , and it is one of the most common causes of cancer death around the globe . hcc is also common in countries with high incidence of hbv - related cirrhosis ( 1 ) . despite the improvements in treatment modalities for hcc , the survival rate remains low even after liver transplantation because hcc can not be easily diagnosed before the advanced stage ( 14 ) . therefore , studies on the incidence and diagnosis of precancerous lesions of hcc are important , especially for patients who develop hcc secondary to hbv infection and cirrhosis . therefore , pathologists and clinicians should be able to diagnose ahccs and ehccs from their precursor lesions using various techniques preoperatively ( 10 ) . hepatic precancerous lesions are currently divided into two categories depending on cytological and histological changes : microscopic df and macroscopic dns ( 11 ) . df can be recognized only in microscopic examination as they are smaller than 1 mm . dns are recognizable both in gross examination of hepatic specimens and in microscopic examination as well - defined nodule lesions that are different from the background cirrhotic liver tissue in size , color , texture , or degree of bulging on the cut surface . hccs can be either ehcc ( less than 2 cm ) or ahcc ( larger than 2 cm ) ( 8 , 9 ) . globally , hbv is the most common cause of cirrhosis and hcc in iran ( 12 ) . in this study , we attempted to identify the true prevalence of hcc and its precursors in 103 explanted livers through thorough sectioning of at least 15 sections for each liver after precise inspection of the gross specimens . among all 103 explanted cirrhotic livers in our study , 92 ( 89.3% ) had df with lcc . according to this result , lcc is a common finding in cirrhotic livers of patients with chronic hepatitis b , but it does not seem to be associated with any malignant lesion , thus confirming the lack of premalignant potential in theses lesions . that is , some studies similar to our own found that lcc ( formerly called lcd ) had no histogenetic association with hcc ( 13 ) . others concluded that lcc in relation to hbv might not only be an innocent bystander but might be closely related to hepatocarcinogenesis ( 15 ) . it can be diagnosed by the presence of clusters of hepatocytes with a small size , minimal nuclear atypia , high n / c ratio , and high nuclear crowding . the report by plentz et al . indicated that severely decreased expression of p16 and p21 , telomere shortening , and accumulation of dna damage in scc and hcc compared with lcc and cirrhotic nodules were all suggestive of the malignant potential of scc compared with lcc ( 17 ) . in our study of 103 patients with hepatitis b - associated liver cirrhosis , 57 ( 55.3% ) had scc . out of these 57 livers with scc , 19 ( 70.4% ) had ehcc and 21 ( 36.8% ) had hcc . our results showed that the presence of scc is associated with ehcc ( p < 0.05 ) and hcc ( p < 0.05).therefore , scc may be associated with the presence of ehcc or hcc . according to our results , a thorough sampling is advised for every patient with scc to detect any malignant lesion . for example , in one study , scc was proved to be associated with aneuploidy and elevated dna index , and it was found to be a moderate - to - high risk for progression to hcc ( 18 ) . among the 103 explanted livers , 39 ( 37.9% ) had lgn , 38 ( 36.9% ) had hgdn , 19 ( 18.4% ) had ehcc , and 21 ( 20.4% ) had ahcc . thus , 70% and 53% of the cases with lgdn and 50% and 55% of the cases with hgdn showed ehcc and hcc , respectively . this association was statistically significant ( p value < 0.05 ) . according to previous studies , lgdn and hgdn are indicators of increased risk of hcc in cirrhotic livers . hcc nodules are commonly seen within dns ( i.e. , nodule - within - nodule pattern ) ( 14 ) . in conclusion , scc , lgdn , and hgdn seem to be common associated findings and precursors of hcc in livers infected with hepatitis b. a strict follow - up and a precise and thorough sampling and sectioning of livers with scc and any abnormal dns , especially those larger than 1 cm , are highly recommended because of their association with malignancy .

cluster headache ( ch ) consists of attacks of severe , unilateral orbital / supraorbital / temporal pain , lasting for 15180 min , occurring once or more times a day , and associated with ipsilateral conjunctival injection , lacrimation and other symptoms . cataract is clouding of the lens of the eye causing a progressive and painless loss of vision . we describe the cases of two men ( not relative , but with the same last name , which originates from north - eastern italy ) that in young adult age , after years of suffering from chronic ch , developed cataract on the same side of the pain attacks . patient 1 was diagnosed as having cataract 18 years after the onset of episodic ( and subsequently chronic ) ch . patient 2 began suffering from chronic ch at the age of 44 years and after 8 years he developed cataract . this is the first report of cataract in patient suffering of ch and occurring in the eye affected by the pain attack .

please summarize the articles given below

the incidence of splenic abscess is a clinically uncommon disease with current literature reporting a 0.140.7% occurrence rate [ 1 , 2 ] . although splenic abscesses are a clinical rarity , they have the potential to be fatal . the presentation of this disease is often vague and insidious including left upper quadrant abdominal pain , fever and chills . additionally , these patients may present with leukocytosis , left upper quadrant mass and pleural effusion on chest x - ray . splenic abscesses generally occur in patients with underlying comorbidities , which commonly include neoplasia , immunodeficiency , trauma , metastatic infection , splenic infarct or diabetes . the best management of splenic abscesses is still debatable with the various modalities including antibiotics , percutaneous drainage or splenectomy . the current literature supports a 67100% success rate with percutaneous drainage ; however , tung et al . states that the most optimal treatment for splenic abscess is splenectomy . of the 600 cases of splenic abscess documented in the current literature , most have been described as air confined to the left upper quadrant on chest x - ray . we report a young patient with a ruptured splenic abscess resulting in an acute abdomen and pneumoperitoneum . to our knowledge , there have only been four other reported cases of ruptured splenic abscess causing pneumoperitoneum [ 3 , 4 ] . a 48-year - old female with the past medical history of diabetes , coronary artery disease and psoriasis , presented with acute onset of diffuse abdominal pain 2 days prior to admission to the hospital . upon presentation , she was tachycardic with a heart rate of 130 and hypotensive with a blood pressure of 78/45 . she was resuscitated in the emergency department with intravenous fluids and her blood pressure and heart rate responded appropriately . her initial labs showed a normal wbc level of 8.3 thou / mcl ; however , the patient was acidotic with a ph of 7.29 and a lactic acid level of 3.5 mmol / l . an acute abdominal series was obtained demonstrating free air below the right hemidiaphragm ( fig . 1 ) . the patient was subsequently boarded for an exploratory laparotomy with repair of perforated viscus , as that is the usual cause of pneumoperitoneum , especially under the right hemidiaphragm . because the patient 's vital signs stabilized after being resuscitated , the decision was made to obtain a ct scan to better assess the location of the perforated viscus . much to our surprise , the patient did not have a perforated viscus , but a splenic abscess that had ruptured causing the pneumoperitoneum ( fig . 2 ) . figure 2:ct scan demonstrating gas - forming splenic abscess and free air in the peritoneal cavity . ct scan demonstrating gas - forming splenic abscess and free air in the peritoneal cavity . the patient then became increasingly confused and her vital signs again deteriorated demonstrating worsening sepsis . the patient was taken to the operating room where a laparoscopic splenectomy was attempted but was quickly converted to laparotomy with splenectomy due to the gross contamination of the abdomen . the patient was continued on antibiotics and taken to the intensive care unit for post - operative care . the splenic abscess grew prevotella intermedia , a bacterium commonly found in the oral flora . the patient underwent a full work - up looking for the source of the splenic abscess . a transesophageal echocardiogram was performed but was negative for any masses , thrombus or vegetation . furthermore , a panorex was performed and was negative as the patient had reported tooth pain 1 week prior to her admission . she returned to the clinic on post - operative day 14 to receive her splenectomy vaccinations . although a rare disease , splenic abscess should be included on the differential diagnosis of a patient presenting to the hospital with peritonitis or pneumoperitoneum . this is especially true for patients who are immunocompromised or have underlying comorbidities including neoplasia , diabetes , trauma or history of splenic infarct or embolization . in our case , ct scan provided important information about the cause of our patient 's pneumoperitoneum , as we had assumed it was due to a perforated ulcer or diverticulitis . this did change our operative management , as we attempted to perform a less invasive surgery on our patient by starting with a laparoscopic technique . however , we had to convert to an open splenectomy due to the gross contamination and adhesions from the splenic abscess . in retrospect , an open laparotomy was the best approach to this patient 's care as it allowed for better visualization and irrigation of the abdominal cavity . it is unknown if we had successfully performed the splenectomy laparoscopically if it would have decreased recovery time . the current literature supports the laparoscopic splenectomy as a safe and effective procedure in patients with splenic abscess demonstrating an average length of stay of 14 days . in our case , the patient remained in the hospital for only 10 days after converting to the open procedure . the current literature reports that the most common organisms found in splenic abscesses are aerobic microbes , particularly streptococci and escherichia coli . this microbe is commonly found in the oral flora and is associated with periodontal disease . although our transesophageal echocardiogram and panorex were both negative , we believe this splenic abscess developed as a result of translocation of the oral flora as the patient was complaining of a tooth ache 1 week prior to her presentation . in summary , we have presented a case of ruptured splenic abscess as a cause of pneumoperitoneum and peritonitis . although rare , we encourage splenic abscess be included on the differential diagnosis of patients presenting with peritonitis and pneumoperitoneum . although there is still controversy in the current literature when managing splenic abscesses , our recommendation is splenectomy , especially in the case of ruptured splenic abscess resulting in hemodynamic instability . whether it is better to perform the splenectomy laparoscopically or open is still debatable , the important thing is to obtain source control . furthermore , a full work - up is required for patients presenting with a splenic abscess as the underlying cause could cause more serious illnesses for the patient in the future . there are no conflicts of interests or financial funding to disclose for any of the contributing authors . polycystic liver disease is a condition characterized by the presence of multiple cysts in the liver , which may be inherited or sporadic , and most cases of adult polycystic liver disease ( apld ) are related to autosomal dominant polycystic kidney disease ( adpkd ) . in 1964 , there have been some reports , till date , that describe the association of malignant neoplasms with potter type iii cystic disease of the liver and kidney [ 2 , 3 , 4 , 5 , 6 , 7 , 8 ] ; however , most of these describe pancreatic and hepatobiliary neoplasms arising in patients with polycystic liver and kidney diseases including adpkd , and no report has described the association of gastric carcinoma with potter type iii cystic disease of the liver and kidney . this is the first case report of multiple gastric carcinomas associated with potter type iii cystic disease of the liver , mesenterium and kidney . although it is unclear whether the development of multiple gastric carcinomas is directly associated with the pathogenesis of multiple cysts in the liver , mesenterium and kidney , this case provides a perspective for etiology of gastric carcinoma with polycystic disease . he had been receiving hemodialysis treatment 3 times a week for 2 years because of chronic renal failure due to polycystic kidneys . he stated that his sister had suffered from polycystic kidney disease . physical examination on admission revealed distended abdomen due to polycystic disease . the patient had high serum levels of carcinoembryonic antigen ( 7.9 ng / ml ) and carbohydrate antigen 19 - 9 ( 202 mg / dl ) . an abdominal computed tomography scan showed multiple cysts in the liver and cystic lesions on both sides in the kidney and mesenterium ( fig . gastrointestinal fiberscopy showed the presence of two ulcerated lesions in the lesser curvature in the middle and lower portions of the stomach . histopathological analysis of the gastric tumor biopsy specimens revealed papillary adenocarcinoma in one tumor and poorly differentiated adenocarcinoma in another . distal gastrectomy with lymph node dissection was performed , and the gastric tumors were surgically diagnosed to be t2n1m0 , stage ii , according to the tnm classification for gastric carcinoma . macroscopic examination showed that two tumors of type ii were present in the middle and lower portions of the stomach ( fig . the distal lesion was diagnosed as a poorly differentiated adenocarcinoma ( 38 39 6 mm ) within the muscularis propria , with marked lymphatic invasion ( ly2 ) and vascular invasion ( v2 ) ( fig . 3b ) ; the lesion on the proximal side was diagnosed as a papillary adenocarcinoma ( 58 47 6 mm ) within the submucosal layer , with marked lymphatic invasion ( ly2 ) and vascular invasion ( v1 ) ( fig . adpkd is the most common of all inherited renal cystic diseases and has various external manifestations , including cysts in the pancreas , seminal vesicles , arachnoid membrane , and liver . the most accepted among them is the osathanondh and potter system that was established in 1964 , according to which polycystic kidneys are classified into three types . the cysts may be present in any portion of the nephron or tubule , but they are most commonly found in bowman 's space and the angle of the loop of henle . in the older classification , potter type iii cystic disease was considered to represent adult - type polycystic disease of the kidney . in 1972 , they also observed cysts in the liver and/or pancreas in 58 of these patients ; hence , they described this condition as potter type iii polycystic disease . in the present case , computed tomography and ultrasonography scans showed multiple renal and hepatic cysts in addition to multiple cysts in the mesenterium . therefore , according to hatfield and pfister 's criteria , we considered that this case of association of apld with multiple renal cysts could be classified as potter type iii cystic disease . the patient stated that his sister had suffered from polycystic kidney disease ; however , we could not confirm the presence of a family history of polycystic kidney disease because his sister had been out of contact for long . in the absence of a family history of adpkd , bilateral multiple renal cysts with hepatic cysts , together with the absence of other manifestations suggesting a different renal cystic disease , provide evidence for diagnosis . in these instances , a family history , however , may be absent in 2040% of new patients in whom the diagnosis of adpkd first is suspected from imaging studies , which can be due to a de novo mutation of pkd-1 or pkd-2 genes . although we could not confirm the mutation of pkd-1 or pkd-2 in this case , family history , clinical findings and imaging studies suggested that the patient suffered from adpkd . reports on the association of malignant neoplasm with apld and adpkd ( potter type iii cystic disease ) are extremely rare . to our knowledge , only 8 such cases have been reported in the english language literature ( table 1 ) [ 2 , 3 , 4 , 5 , 6 , 7 , 8 ] . till date , most cases of neoplasms associated with polycystic disease of the liver and kidney have been reported as either pancreatic or hepatobiliary neoplasms , namely 5 cases of pancreatic neoplasms and 3 cases of cholangiocarcinoma . since 5 of these cases were pancreatic neoplasms , we think that adpkd has some genetic influence on the development of pancreatic neoplasms . aziz et al . reported 2 patients from the same family ( a brother and a sister ) with adpkd who developed adenocarcinoma of the gastroesophageal junction ; however , these patients did not have cysts in the liver or other organs except for the kidney . in the present case , although a detailed family history could not be obtained , multiple cysts were observed in the liver , both kidneys , and mesenterium . these genes encode a member of the polycystin protein family , which is an integral membrane protein that functions as a regulator of calcium - permeable cation channels and intracellular calcium homoeostasis . some studies have described an association between the pkd genes and cancer cells ; polycystin-1 , encoded by pkd-1 , was reported to induce apoptosis and cell cycle arrest in the g0/g1 phase in cancer cells . moreover , pkd-1 inhibits cancer cell migration and invasion and may be considered a new member of the tumor suppressor family of genes . therefore , adpkd , which is caused by defective pkd-1 and pkd-2 , may be a carcinogenic condition . in addition , mutations in two genes , namely prksch ( which codes for hepatocystin ) and sec63 , have been found to cause apld . however , as mutations in these genes have not been found in all families , undiscovered genes responsible for causing apld probably still exist . although it is unclear whether the development of multiple gastric carcinomas is directly associated with the pathogenesis of cysts in the liver , mesenterium and kidney , the present case demonstrates that gastric carcinoma can be an external complication in patients with polycystic disease .

we encountered a case of ruptured splenic abscess presenting as peritonitis and pneumoperitoneum . our patient did not have an underlying neoplasm nor was she immunosuppressed . in our case , splenectomy was the treatment of choice in combination with antibiotics , which proved to be a good outcome for the patient . work - up for the cause of the abscess was negative , although bacteria predominately found in the oral flora were isolated from the abscess . we strongly encourage that splenic abscess be considered on the differential diagnosis of patients presenting with pneumoperitoneum and peritonitis , although a clinical rarity .

please summarize the articles given below

canaliculitis is a common encounter in ophthalmic practice but supernumerary puncta and canaliculi ( spc ) are rare congenital disorders . in a large series a 59-year - old gentleman presented with painful swelling of the left lower lid for a week , which was associated with epiphora . the swelling was confined to the nasal aspect of the left lower lid ( 0.50.5 mm ) with inflamed overlying skin ( figure 1a ) . eversion of the lower eyelid revealed two puncta , 0.5 mm apart ( figure 1b ) . the outer punctum was situated at the normal anatomical position ; whereas the inner punctum in the caruncle . gentle pressure did not result in any regurgitation from the both puncta . the patient was treated with oral cloxacillin 500 mg , 6 hourly for 5 days . the outer punctum had a soft stop with regurgitation of fluid from the same punctum . the outer punctum - canaliculus system was a cul - de - sac ( figure 1c ) . c ) dacryocystography showed pooling of dye in the cul - de - sac ( white arrow ) . c ) dacryocystography showed pooling of dye in the cul - de - sac ( white arrow ) . most spcs ( 78% ) present with epiphora . among the 23 patients reported by satchi et al . , none presented with canaliculitis . sequestration of tear and debris in the cul - de - sac served as nidus for infection . the resultant canaliculitis with its surrounding edema caused obstruction of the lacrimal drainage ; hence epiphora . epiphora however , may develop despite patent lacrimal drainage system . the 2-compartment model for lacrimal canalicular drainage of kakizaki et al . , suggested that the muscle of duverney - horner may deviate normal flow within the accessory canaliculus and thence transport tears back to the lacrimal tear lake , leading to epiphora . a solid epithelial cord forms in the region of the medial lower eyelid ( figure 2a ) and sends projections to form the canaliculi and the nasolacrimal duct ( figure 2b ) . spc is due to extra out - budding of the solid epithelial cord ( figure 2c ) . canalization begins at 4 months of gestation with disintegration of the central ectodermal core , forming lacrimal drainage outflow system . in this case , the extra inner canalicular epithelial bud ( nearer to the main epithelial cord ) underwent complete canalization and remained connected to the main epithelial cord . the outer canalicular epithelial bud , although its punctum is located at the normal anatomical position , was separated from the main epithelial cord ; forming a cul - de - sac ( figure 2d ) . c ) extra out - budding of the solid epithelial cord in supernumerary puncta and canaliculi . d ) the outer canalicular epithelial cord was separated from the main epithelial cord , forming a cul - de - sac . c ) extra out - budding of the solid epithelial cord in supernumerary puncta and canaliculi . d ) the outer canalicular epithelial cord was separated from the main epithelial cord , forming a cul - de - sac .

we report the first case of supernumerary puncta and canaliculi presented with canaliculitis . a-59 year - old gentleman presented with painful swelling of the left lower lid for a week , which was associated with epiphora . the swelling was confined to the nasal aspect of the left lower lid ( 0.50.5 mm ) with inflamed overlying skin . two puncta ( 0.5 mm apart ) were noted . the outer punctum at the normal anatomical position was a cul - de - sac while the inner punctum it the caruncle was patent . we described the embryology leading to supernumerary puncta and canaliculi to explain the paradoxical patency of the abnormally located punctum as well as the pathomechanism leading to canaliculitis . the patient was treated with oral cloxacillin 500 mg , 6 hourly for 5 days ; the cellulitis subsided after three days .

please summarize the articles given below

we are grateful for financial support from the industrial source technology development program of the ministry of knowledge economy ( 10044909 ) , the next - generation biogreen 21 program ( ssac grant # pj01111803 ) , rda , and the kribb initiative program of south korea . surgical intervention for corneal perforation is indicated when the anterior chamber does not reform within a short period of time . herein , we report the successful management of a small paracentral corneal perforation using autologous iris incarceration and tissue adhesive . a 41-year - old man developed a small paracentral corneal perforation ( 0.5 mm in size ) in the right eye , while the treating physician attempted to remove the residual rust ring after removal of a piece of metallic foreign body . the eye was initially managed with a bandage soft contact lens to ameliorate the aqueous leakage ; however , without success . iatrogenic iris incarceration of the wound was first induced , followed by application of cyanoacrylate tissue adhesive to the perforated site . as a result , the anterior chamber was immediately reformed and maintained . cyanoacrylate tissue adhesive with iatrogenic incarceration of the autologous iris was effective in treating this type of small corneal perforation . this technique is simple and potentially useful for small paracentral corneal perforations outside the visual axis and without good apposition . corneal perforation caused by small corneal punctures can sometimes be managed with a bandage soft contact lens , patching , and/or tissue adhesive [ 2 , 3 , 4 ] . however , surgical intervention is usually indicated when the anterior chamber does not reform within a short period of time . herein , we report the successful experience of managing a small paracentral corneal perforation without good apposition , which could not be tamponaded by a soft bandage lens only , with iatrogenic iris incarceration followed by cyanoacrylate tissue adhesive . a 41-year - old man noted irritation in the right eye and was diagnosed to have a piece of metallic foreign body in his right cornea . iatrogenic corneal perforation was encountered , while the attending physician attempted to remove the residual rust ring with a corneal burr . slit - lamp examination revealed a paracentral corneal penetration with a diameter of approximately 0.5 mm ( fig . the anterior chamber was flat , and active aqueous leakage was confirmed by a positive seidel test with fluorescein . intravenous antibiotics with cefozopran hydrochloride were initiated , in conjunction with prophylactic topical antibiotic with 0.5% levofloxacin three times daily . after 48 h of treatment , there was no significant improvement in the right eye . concerns were raised about possible complications such as secondary angle closure glaucoma and prolonged hypotony . since the puncture was located paracentrally near the visual axis , simple primary closure of the wound or corneal patch graft was deemed undesirable . as the wound was completely punched out , injected viscoelastic materials in the anterior chamber came out from the wound , which made it quite difficult to dry the surface of the cornea for application of tissue adhesive . therefore , to provide a necessary support for the gluing , amniotic membrane plugging was tried , but it was too slippery to be fixed on the wound . a paracentesis port was created . a blunt 27-gauge needle ( with a 2-mm bent tip ) attached to a viscoelastic injecter was gently inserted into the anterior chamber through the paracentesis . using the bent tip , a small tug of iris care was taken not to touch or injure the corneal endothelium or anterior capsule of the lens . meticulous drying of the wound and incarcerated iris was performed and a tiny amount of ethyl-2-cyanoacrylate adhesive ( aron alpha a ; sankyo co. ltd . , attention was paid to ensure that the glue did not spread on to the surrounding cornea . the corneal puncture was thus successfully closed without any sutures , and the anterior chamber remained well formed . postoperatively , the patient was treated with topical 0.1% fluorometholone and 0.5% levofloxacin three times daily . pupillary distortion was observed when the iris was dilated ; however , the patient felt no visual disturbance . herein , we reported a case of iatrogenic paracentral corneal perforation without good apposition successfully treated with autologous iris incarceration and cyanoacrylate adhesive . conventionally , small corneal perforations were treated with stitches with or without corneal patch graft , tissue adhesives [ 2 , 3 , 4 ] , and recently with amniotic membrane and fibrin glue . the indications for the use of a bandage soft contact lens to treat a corneal laceration include small wounds with good apposition , good alignment of the wound edges , and no incarceration or prolapse of the uvea or lens . corneal puncture wounds of less than 2.0 mm in size can usually heal without being sutured . in this case , the wound was relatively small ( less than 1 mm ) , but the apposition of the wound was not optimal due to a sharply demarcated punch , which made restoring the anterior chamber extremely difficult using a bandage soft contact lens only . in cases with good apposition , a small amount of viscoelastic materials through the perforation site is often enough to allow safe application of tissue adhesive without gluing intraocular contents . the technique described in this case appears useful secondary to the minimal residual scarring and related astigmatism . a second advantage of this technique is that the iris is introduced to the perforation site from inside the eye in a controlled manner to prevent excessive iris prolapse and provide a stable support for the tissue adhesive . this is more adequate than the use of an amniotic membrane , which is very slippery and difficult to be fixed on the wound . furthermore , this technique requires no foreign tissue , thereby eliminating the risk of immunological tissue reactions . the tissue adhesive may also theoretically circumvent the potential risks of epithelial down - growth by preventing corneal epithelium from growing directly over the iris . this technique is safe and effective for paracentrally located corneal perforation ; however , significant synechiae involving the angle could prove to be problematic when the perforation is more peripheral . very small descemet 's membrane transplantation instead of iris incarceration may be the other option for this situation . in conclusion , application of cyanoacrylate adhesive following iatrogenic incarceration of the iris seems to be simple and effective in managing small paracentral corneal perforations without good apposition .

abstractbacterial volatiles protect plants either by directly inhibiting a pathogenic fungus or by improving the defense capabilities of plants . the effect of bacterial volatiles on fungal growth was dose - dependent . a low dosage did not have a noticeable effect on botrytis cinerea growth and development , but was sufficient to elicit induced resistance in arabidopsis thaliana . bacterial volatiles displayed negative effects on biofilm formation on a polystyrene surface and in in planta leaf colonization of b. cinerea . however , bacterial volatile - mediated induced resistance was the major mechanism mediating protection of plants from b. cinerea . it was responsible for more than 90% of plant protection in comparison with direct fungal inhibition . our results broaden our knowledge of the role of bacterial volatiles in plant protection .

please summarize the articles given below

fever is a common reason for seeking medical attention and accounts for more than 20% of emergency department visits.1 many mothers and caregivers have perceived phobia associated with their child 's fever for reasons that include serious infection , seizure , brain damage and death.2 paediatricians have regularly advised parents to seek immediate medical attention if their children developed a fever because fever is of great diagnostic importance especially in developing countries where infectious diseases such as malaria and pneumonia are very prevalent.3 in developing countries , because of the relatively low level of literacy and financial constraint of procuring reliable thermometers , many parents rely on palpation to assess if their children have fever.4 the objective use of the thermometer to detect the presence of fever is often limited to health care settings in most resource - poor settings . an accurate determination of the absence of fever in a child assures parents and saves cost by preventing unnecessary investigations and medication . ownership of thermometer seems poor , although no study in our environment was found to support that . in a study in new york , usa , of the 78% of caregivers that owned thermometers , nearly half ( 48% ) still utilised tactile method to assess fever.4 in another study , in india in contrast , only 15% owned thermometer with 23.8% of them not knowing how to use it.5 this underscores the fact that the use of palpation as a means of assessing fever by mothers is common and universal . majority of mothers and care givers in our environment still utilise tactile assessment to determine if their children have fever . controversies over the reliability of tactile assessment of fever have been variously reported ; while a study found it accurate enough , at least in younger infants,4 others reported that it overestimates the presence of fever.67 the reliability of the use of palpation to detect fever still remains uncertain . this study was carried out to determine the reliability of tactile assessment of fever by nigerian mothers in under-5 children and also to determine if the surface of the hand used influence the accuracy . the study further ascertained if palpation of a single or multiple anatomical sites influence the accuracy of tactile assessment of fever . children under the age of 5 years presenting for care with their mothers were recruited for the study . ethical approval was obtained from the research and ethics committee of federal medical centre owerri , imo state nigeria before commencement of the study . the subjects were recruited from the children outpatient clinic and children emergency room of the hospital . information such as age and sex of the child , mother 's age and highest educational qualification ( heq ) were captured using a profoma . thereafter , each eligible child had a tactile assessment of fever by the mother . the response of the mother as regard presence or absence of fever was documented following which the child 's axillary temperature was measured and documented . the axillary temperature was measured using mercury in glass thermometer , which was left in the axilla for 5 minutes before reading . frequencies , percentages and mean were analysed where appropriate . the sensitivity , specificity , positive predictive values ( ppvs ) and negative predictive values ( npvs ) of tactile assessment was calculated using axillary temperature of 37.5c as cut - off for fever . the different hand surfaces used for palpation , as well single versus multiple sites of palpation were also compared . there were 60 males and 53 females giving a male : female ratio of 1.1:1 . seven ( 6.2% ) of the mothers had only primary school education , while 38 ( 33.6% ) and 68 ( 60.2% ) had secondary and tertiary education , respectively . fever detected by touch was reported in 81 ( 71.6% ) children by mothers while , only 65 ( 57.5% ) mothers were able to correctly predict the presence of fever in their children . there was no statistical significant difference in the ability of the mothers to correctly predict fever with respect to their heq ( = 2.66 , p = 0.265 ) . comparison of fever detection by palpation with the mothers highest educational qualification ( heq ) irrespective of the part of hand used for palpation , the sensitivity of detection of fever by palpation was 82.4% , while the specificity was 37.1% . the use of the palmer surface of the hand had a better sensitivity ( 95.2% ) than the dorsum of the hand ( 69.2% ) . table 2 shows the sensitivity , specificity , ppv and npv of the part of hand used for palpation . sensitivity , specificity , positive predictive value ( ppv ) and negative predictive value ( npv ) of the part of hand used for palpation a total of 71 ( 62.8% ) of the mothers palpated at more than one site while the remaining 42 ( 37.2% ) used only single site . table 3 shows the different sites used by the mothers in palpation , while table 4 compares the sensitivity , specificity , ppv and npv of use of single site versus multiple sites in palpation . the use of multiple sites had better sensitivity ( 86.7% ) than the use of single site ( 76.2% ) . sites used by the mothers to palpate for fever palpation of single site versus multiple sites the present study shows that mothers can be trusted to a good extent to assess for the presence of fever in children by palpation . a sensitivity of 82.4% obtained in this study is similar to those reported by okposio and abhulimhen - iyoha in benin , nigeria as well as graneto and soglin in chicago , usa , who documented sensitivity of 89.2% and 84% , respectively.89 some studies in nigeria have reported a higher sensitivity value of 96.3% and 94.6% , respectively.610 a specificity of 37.1% obtained in the present study is quite poor and is lower than the specificities reported by other workers ranging from 64.3% to 82%.489 it is , however , higher than 23% reported by akinbami et al.6 the heterogeneity in the methodology of these studies may have been responsible for the differences obtained between the present study and some of the earlier studies . for instance , akinbami et al.,6 used rectal temperature of 38c as the cut - off of fever , wammanda and onazi10 adopted axillary temperature of 37.2c as the cut - off for fever , while the present study and that of okposio and abhulimhen - iyoha8 used axillary temperature of 37.5c as the definition of fever . although the specificity in the present study was poor , the relatively high sensitivities obtained in all the studies still make maternal palpation for the presence of fever a considerably useful method of assessment of childhood fever . although , palpation overestimates fever , the elicitation of fever by mothers would encourage early presentation as it has been documented that the concern for fever is a strong motivational factor for seeking medical care.2 the educational qualification of a mother did not influence the accuracy of palpation for the presence of fever . it is therefore expected that any mother , irrespective of her educational background should be able to appreciate fever by palpation . with a npv of 71.9% , if a mother says her child does not have fever , her history of subjective assessment of fever without the use of a thermometer is about 72% reliable . the likelihood of a child adjudged to be febrile by a mother to be truly febrile measured by the ppv in the present study is 51.9% . this is higher than 39% reported by wheybrew and co - workers.7 this higher ppv reported in this study may have been influenced by the prevalence of fever in the present study . in the present study , 57.5% of the study subjects had fever , while in the study of wheybrew et al.,7 27% of children had fever . the palmer surface of the hand was the most commonly used hand surface by mothers to palpate for fever . the sensitivity , specificity , npv and ppv of palmer surface was higher than that of the dorsal surface or the use of both surfaces . this may be attributed to the fact that receptors for detection of heat and temperature are more concentrated on the palmer surface and finger tips.11 the use of both surfaces may confuse the mother as the sensation obtained from both are likely to vary , hence the reduced sensitivity obtained in this study when compared with palmer surface alone . the forehead was the most common site used for tactile assessment of fever in this study . this corroborates reports from previous studies , which also found the forehead to be the most common anatomical site used for tactile assessment of fever.4 this may possibly be explained by the fact that the head is easily accessible compared with the other parts of the body . it was observed that palpation of multiple sites was more sensitive than use of single site . this is in agreement with an earlier report by okposio and abhulimhen - iyoha as well as singhi and sood.812 this implies that if fever is to be assessed by palpation without the use of a thermometer , palpation of multiple body sites should be utilised . palpation with the palmer surface of the hand using multiple sites improves the reliability of tactile assessment of fever . clinicians should not discountenance mothers complaint of fever in their children detected by palpation without the use of a thermometer . mothers should be taught to palpate at multiple sites with the palmer surface when palpating for the presence of fever in their children to improve the accuracy . the possible presence of infection in cervical smear tests is usually reported by the cytologists based on cytological criteria . therefore , non - specific cervicitis or inflammatory changes in a smear report are common . these findings are usually unclear for clinical approaches and there is not an appropriate guideline for management of such patients . it is not known if these women should be recalled for cultures and treatment or inflammatory change should be considered as minor . changes in balance of normal vaginal flora can cause an overgrowth of pathogens that lead to discharge . although it is a common complain among sexually active women , there are still gaps in our knowledge about it . bacterial vaginosis ( bv ) , vaginal candidiasis ( vc ) and trichomoniasis are the three infections most commonly associated with vaginal discharge ( 1 ) . a number of studies have indicated the association of bv with postoperative complications after gynecologic surgery as well as pregnancy complications ( 25 ) . trichomonas vaginalis ( tv ) is also another common cause of vaginal discharge , but some studies have not found its association with pregnancy complications ( 3 ) or some other indicated that tv during pregnancy was a predisposing factor for preterm delivery and delivering low - birth weight infants ( 6 ) . the pap smear test for detection of bv has showed a sensitivity of 88.2% , a specificity of 98.6% , and a positive predictive value ( ppv ) of 96.8% ( 7 ) . the sensitivity , specificity , and ppv of pap test for tv diagnosis has been reported 98% , 96% , and 88% , respectively ( 8) . also , some recent studies have demonstrated the co - infection of vaginal pathogenic organisms in pap tests ( 2 , 9 , 10 ) . this study aimed to investigate the prevalence of pathogenic vaginal microorganisms and the presence of inflammation in pap smear among an iranian women sample and to evaluate the possible co - infection of these organisms . this cross - sectional study was carried out on pap smear samples of women referred to gynecological clinic of taleghani hospital in tehran , iran , between october 2008 and march 2009 . exclusion criteria were pregnancy , smoking , use of oral contraception and/or corticosteroids , regular use of vaginal douche , and women with chronic systemic diseases or systemic immunosuppression . prior to data collection , the objectives of the study were explained in community meetings . all women received their laboratory results in written form , and results were explained during a consultation . the study protocol was also approved by the institutional review boards of department of gynecology and obstetrics . data were obtained in privacy using an information form applied by one investigator , followed by gynecological examination and specimen collection all done by one gynecologist . cervical smear samples , based on the conventional method , were prepared with a spatula and fixed on glass slides and were stained with the papanicolaou technique . tv was defined as the presence of trophozoites in pap smears ; vc was diagnosed if fungal hyphae or budding yeasts were present in pap smears . the presence of inflammation in the smears was divided into mild , moderate , and severe categories . mild inflammation was defined as less than 30 inflammatory cells / high - power field ; moderate inflammation was defined as 30 to 100 inflammatory cells / high - power field ; and severe inflammation was defined as more than 100 inflammatory cells / high - power field . the frequency of pathogenic microorganism included bv , tv , and vc were determined in specimens . statistical significance was analyzed using statistical package for social sciences ( spss software version 17 ) . the comparison between data was performed with the pearson 's chi square or fisher 's exact test . mild inflammation was noted in 136 ( 26.1% ) , moderate in 155 ( 29.4% ) and severe in 117 ( 22.2% ) of them ( table 1 ) . the frequency of pathogenic vaginal microorganisms and inflammation among pap smear samples among all samples , bv ( the presence of clue cells ) was the most common pathogenic microorganism which was seen in 91 samples ( 17.2% ) , followed by vc ( n = 56 ; 10.6% ) . tv ( n = 2 ; 0.4% ) was shown to have a low prevalence among our patients ( table 1 ) . the overall prevalence of pathogenic microorganisms was greater among reproductive age participants , meanwhile the prevalence of bv as well as vc was significantly different ( p = 0.042 and p = 0.006 , respectively ) between non- and post- menopausal women . inflammation was detected in 76% ( n = 402 ) of pap smears , in which 80.1% ( n = 322 ) were reported among reproductive age women . however , the severity of inflammation was not significantly different between non- and post- menopausal women . overall , the presence of inflammation was significantly associated with vc ( p = 0.002 ) , but its severity was not correlated to the infection . although , there was no significant relation between the presence of inflammation and bv , the severity of inflammation in specimen was significantly increased in association with bv ( p < 0.001 ) . in our study , the prevalence of bv among pap smear specimens of women living in tehran was 17% which is similar to azargoon 's study ( 16% ) on a population in semnan ( another city in center of iran ) ( 3 ) , but it had a higher rate in hamadan ( a western city of iran ) and has been reported 28.5% ( 11 ) . in comparison with other asian countries , in india , but it was 38% in an african study in botswana on 703 pregnant women ( 13 ) . some predisposing factors for bv include having sexual relationship with more than one partner , early onset of sexual activity , orogenital sexual contacts , coitus during menstruation , use of iud , and smoking ( 2 , 14 ) . differences in sexual behavior and risk factors in different societies can justify the differences in bv prevalence of mentioned studies . reproductive age women indicated that the prevalence of bv in muslim women was lower than non - muslims . although the prevalence of tv in pap samples of our study was much less than several studies , similar reports demonstrated by depuydt et al in flanders detected by real - time pcr ( 0.37% ) ( 15 ) . however , this rate was 18% in the study in hamedan ( 11 ) , 8.5% among indian women ( 16 ) , and 19% in the african study ( 13 ) . a probable reason for these variations could be differences in pap sampling quality and cytologists skill . several studies show an increased vaginal ph ( 5 ) in both bv and tv infection ( 3 , 5 , 17 ) . demirezen et al in turkey on 600 pap tests detected tv in 6% of women and bv in 44% of tv cases . they also found a significant relationship between tv and bv infection , which might be due to this hypothesis that tv by phagocytosis the vaginal lactobacilli increases the vaginal ph and generates an anaerobic environment , providing an appropriate condition for the growth of anaerobic microorganisms ( 18 , 19 ) . also , it was confirmed by heller 's study on 400 pap samples which concluded that bv diagnosis should be considered at the presence of tv in pap smears ( 2 ) . in our study , we found no significant association between bv and tv in conventional pap smear sampling , which might be because of low prevalence of tv in our samples . the effect of habits and behaviors on vaginal flora among different population can be evaluated in further assessments . in our study , only the presence of candida in pap smear samples was associated with the report of inflammation . therefore , reporting inflammation in pap smear test might be considered for candidiasis evaluation and treatment . several studies investigated the association between infection and existence of inflammation in cervical smears ( 2023 ) . some of them found that inflammation on pap smear had a relatively low predictive value for the presence of infection ( 21 ) . they stated that the inflammation was not exactly a consequence of infection and other causes might be responsible for this appearance ( 20 ) . in contrast , others indicated a significant association between inflammatory smear and reproductive tract infections ( 22 , 24 ) . as burke et al ( 22 ) in their study on 256 women found an evidence of inflammation in 9.7% of smears and genital tract infection in 29.2% of their participants overall . they found infection in 48% of women having inflammatory changes on smear test vs. 27.3% of women whose smear tests showed no evidence of inflammation . they discovered that the prevalence of infection with chlamydia trachomatis , candida , bacteroides and gardnerella vaginalis was higher in the inflammatory smear group . they concluded that women with an inflammatory smear were more likely to mask the infection than women whose smear shows no evidence of inflammation ( 22 ) . prevalence of bv infection ( 17% ) in this study was similar to most other studies , which was not true for tv ( < 1% ) . the use of other diagnostic methods may be probably more valuable than conventional pap smear for evaluation of tv among iranian women and it needs further investigations . as the report of inflammation in our samples was very high , use the newer pap smear techniques such as thinprep ( liquid base preparation ) in the further studies is recommended . based on our results , inflammation reported in the pap smears demands the evaluation for vc and its proper treatment .

background : many mothers still rely on palpation to determine if their children have fever at home before deciding to seek medical attention or administer self - medications . this study was carried out to determine the accuracy of subjective assessment of fever by nigerian mothers in under-5 children.patients and methods : each eligible child had a tactile assessment of fever by the mother after which the axillary temperature was measured . statistical analysis was done using spss version 19 ( ibm inc . chicago illinois , usa , 2010).result : a total of 113 mother / child pairs participated in the study . palpation overestimates fever by 24.6% . irrespective of the surface of the hand used for palpation , the sensitivity , specificity , positive predictive value ( ppv ) and negative predictive value ( npv ) of tactile assessment were 82.4% , 37.1% , 51.9% and 71.9% , respectively . the use of the palmer surface of the hand had a better sensitivity ( 95.2% ) than the dorsum of the hand ( 69.2% ) . the use of multiple sites had better sensitivity ( 86.7% ) than the use of single site ( 76.2%).conclusion : tactile assessment of childhood fevers by mothers is still a relevant screening tool for the presence or absence fever . palpation with the palmer surface of the hand using multiple sites improves the reliability of tactile assessment of fever .

please summarize the articles given below

behet 's disease ( bd ) is a chronic inflammatory disease that is characterized by recurrent oral and genital ulceration and uveitis1 ) , the other clinical manifestations include skin lesions , arthritis , thrombosis , neurologic symptoms and intestinal ulceration . polychondritis is known as a rare complication of bd and no case of bd combined with polychondritis had been reported on until firestein et al . reported on five patients with both bd and relapsing polychondritis ( rp ) in 19852 ) . we recently experienced a case of a 40-year - old male patient with both bd and polychondritis , and we report herein on this unusual case along with a review of the literature . a 40-year - old man was referred to our hospital for further evaluation of his fever , oral ulcers and skin rashes that had lasted for 10 days . he had previously suffered from intermittent oral ulceration and uveitis that had been treated with oral prednisolone and intraocular injections of triamcinolone at another hospital 1 year prior to this admission . on the physical examination , his blood pressure was 130/80 mmhg , the pulse rate was 80 per minute and the body temperature was 38.4. he had conjunctival injections in both eyes and several aphthous ulcers on the tongue ( figure 1a ) and buccal mucosa . a small round ulcer with tenderness was found on the penile root ( figure 1b ) . several round erythematous skin lesions were present on the chest and thigh ( figure 2a ) . his left knee joint was swollen ( figure 2b ) and tender , and needle aspiration revealed turbid inflammatory synovial fluid . the laboratory findings were as follows : hemoglobin 14.8 g / dl , white blood cell count 10,400/l , platelet count 291,000/l , erythrocyte sedimentation rate 104 mm / hr and c - reactive protein 205 mg / l ( normal range , 0~3.4 mg / l ) . the renal and liver function tests were normal and the tests for rheumatoid factor and antinuclear antibody were negative . the urinalysis was normal and no microorganisms were grown on both the blood and urine cultures . his chest radiography showed no abnormal findings and mild splenomegaly was observed on abdominal sonography . skin biopsy was performed and the histologic examination showed perivascular mononuclear cell infiltrations , extravasation of the red blood cells and fibrinoid necrosis of the blood vessel walls ; all of these findings were compatible with cutaneous vasculitis combined with bd ( figure 3 ) . on the 5th day of admission , both ear auricles became swollen , red and tender ( figure 4 ) . he remembered having a similar auricular inflammation 2 years ago that had improved after taking non - steroidal anti - inflammatory drugs . after he was administered with colchicine 1.2 mg / day and prednisolone 30 mg / day , his clinical symptoms improved and he was discharged on the tenth day of admission . polychondritis is an inflammation of the various catilagenous structures such as the auricle , nose and trachea , and it has also been known to involve the eye and the joints . when polychondritis is relapsing , it is called relapsing polychondritis ( rp)8 ) . in rp , various cutaneous manifestations are also seen , including palpable purura , erythema nodosum , panniculitis , livedo reticularis and urticaria . there have been case reports on polychondritis combined with other rheumatologic diseases such as systemic lupus erythematosus ( sle ) , rheumatoid arthritis ( ra ) and systemic vasculitis9 - 11 ) . however , there have been no reports of polychondritis combined with bd until firestein et al . first reported on five patients who had the features characteristic of both bd and rp , and those authors termed this as mouth and genital ulcers with inflamed cartilage ( magic ) syndrome2 ) . polychondritis is still known as a rare complication of bd and only five more cases of bd combined with polychondritis have been reported on since firestein 's report3 - 7 ) . in our patient , bd was diagnosed based upon the recurrent oral and genital ulcers , the skin vasculitis , the arthritis and the past history of uveitis . the chondritis developed at the bilateral auricles , eye and the joints during the acute exacerbation period of bd , and this resolved with the improvement of the symptoms of bd . this suggests that the development of polychondritis may have been associated with bd in our case . as for treatment for the combined cases of bd and rp , colchicine , steroid and dapsone skin involvement in bd includes various lesions such as erythema nodosum , pustules , papules , pseudofolliculitis , acneiform folliculits , sweet 's syndrome , or pyoderma gangrenosum12 ) . the histopathology of the papulopustular lesions usually shows vasculopathy that is characterized by the perivascular infiltration of mononuclear cells , and this infiltrate is mainly composed of lymphocytes . the erythema nodosum - like lesion is known to be characterized by extravascular neutrophilic infiltration and panniculitis , and this can be followed by lymphocyte infiltration during the evolution of the skin lesions14 ) . in our case , the main histopathylogic finding of the skin lesions was perivascular mononuclear cell infiltration and fibrinoid necrosis of the vessel walls , which are the characteristic findings of vasculopathy . although cases of bd combined with polychondritis have rarely been reported , bd and polychondritis do not seem to be separate entities . compared the frequency of the various clinical features in bd and rp ( table 1 ) , and they showed that some of the manifestations that are considered unique for one disease could be found in the other disease2 ) . these similarities between the clinical manifestations of bd and rp imply that there seems to be something in common for the pathogenesis of bd and polychondritis . the pathogenesis of both bd and rp are associated with autoimmunity . in patients with rp , the antibodies to collagen type ii , ix and xi are elevated in the sera15 , 16 ) and the frequency of human leukocyte antigen ( hla)-dr4 is increased17 ) . additionally , rp has been associated with other autoimmune diseases such as ra and sle9 , 10 ) . in patients with bd , autoantibodies such as antiendothelial cell antibody and antibody to -tropomyosin have been found18 - 20 ) and it has been postulated that cross - reactivity and molecular mimicry between the peptides from the streptococcal proteins or the viral heat shock proteins ( hsps ) , which are homologues of human hsps , and the mucosal antigens result in the selection of autoreactive t cells21 ) . have proposed that autoimmunity to components of the cartilage other than type ii collagen , such as proteoglycans or elastic tissue , could be the common mechanism of bd and rp2 ) . in particular , elastic tissue is ubiquitous in the human mucosa that is mainly involved in bd , and in the cartilage too , which is the major target of rp . however , because of the rarity of the combined cases , there have not yet been any investigations about the common pathogenesis of the two diseases , and so additional research is clearly needed . although there have been only a few reports about polychondritis combined with bd , we think this combination of diseases might have been overlooked so far and closer scrutiny would reveal more cases . disability prevalence increases with advanced age , and disability in the elderly population is a major public health problem . this is especially crucial for chinese : there are 88 million persons aged 65 and above in china alone , and the number is projected to increase to 341 million in 2050 ; importantly , disability prevalence in chinese elderly population has been increasing [ 35 ] in contrast to a declining trend in the developed countries [ 6 , 7 ] . there is a big gap between the scale of the problem and the quantity and quality of available information . the first population - based report from china was published 16 years ago , and countable number of publications [ 35 , 812 ] exist in the literature . in this study , with large population - based data from shanghai ( the biggest city in china ) and singapore ( a city country in southeast asia , with majority of the residents being descendents of immigrants from south china ) , we aimed to examine the independent contributions of physical and cognitive health to disability in chinese older adults and explore the potential influences of environment . participants of the present study were identified from two big population - based studies : the shanghai survey of alzheimer 's disease and dementia ( ssadd ) and the singapore longitudinal ageing study ( slas ) . the ssadd was conducted in 1987 based on a probability sample of 5055 community - dwelling chinese older adults from jing'an district of shanghai city . the slas was conducted among a total population sample of 2808 older adults from south east region of singapore . baseline assessments of the slas were completed from september 2003 to december 2005 . details of the ssadd [ 8 , 13 ] and , we selected 4639 participants from the ssadd sample and 2397 participants from the slas cohort . all participants had complete data on demographic information , physical health , and cognitive function and obtained a mini - mental state examination ( mmse ) total score of at least 21 points . face - to - face interviews were conducted by psychiatrists / psychiatric nurses ( in shanghai ) or trained research nurses ( in singapore ) , and data were collected for a wide range of variables . for the present analysis , we extracted the following variables from the databases : age , sex , functional status , chronic diseases , self - rated health status , and mmse total score . functional status was assessed by the participant 's level of dependency in performing 8 activities of daily living ( adl ) : eating , grooming , dressing , transferring , walking , toileting , bathing , and climbing stairs . the participants were asked do you have or not have any of the following illnesses or conditions at the present time ? " in the slas , a list of 14 medical conditions was covered in the interview . the participants were asked do you have a history of this medical problem ? medical conditions that were not included in the list were recorded under any other problems . we selected ten chronic diseases on which data were available from both samples : hypertension , diabetes , heart diseases ( in singapore : defined as any of heart attack , heart failure , or atrial fibrillation ) , stroke ( in shanghai : effects of stroke ) , kidney disorder ( in singapore : kidney failure ) , chronic obstructive lung disease ( in shanghai : emphysema / bronchitis ) , asthma , arthritis ( in shanghai : arthritis or rheumatism ) , mental illness , and cancer ( in singapore , identified from any other problems ) . in statistical analysis , the number of chronic diseases was used as an objective measure of physical health . in singapore , self - rated health status was assessed using a single question : in general , would you say your health is : excellent , very good , good , fair , or poor ? in shanghai , the same question was asked but there were four choices : excellent , good , fair , poor . excellent and very good together and created a new variable self - rated health status : 1 = excellent or very good , 2 = good , 3 = fair , and 4 = poor . this was used as a continuous variable in multivariate analyses ( score ranged from 1 to 4 , with higher value representing poorer health status ) . the test has been validated in shanghai and singapore , respectively . summed scores of mmse range from 0 to 30 , higher values denoting better cognitive functioning . chi - square test ( for dichotomous variables ) or independent sample t test ( for continuous variables ) was used to compare the difference regarding various characteristics between the two study samples . multiple logistic regressions were used to examine the relationship between health factors and disability , and the influence from environment . in analysis based on the combined sample , age , sex , number of chronic diseases , self - rated health status , mmse total score , and environment ( singapore versus shanghai ) were included in the regression model . the same set of variables ( except environment ) was used in the stratified analysis . the prevalence of disability was much higher in shanghai sample ( 5.0% ) than that in the singapore sample ( 1.8% ) . however , the shanghai participants were also older , had more chronic diseases , had poorer self - rated health status , and obtained lower mmse total score as compared to their singapore counterparts ( table 1 ) . a scrutiny of the eight adl items revealed that the difference was only significant for bathing ( 3.5% versus 0.4% ) and climbing stairs ( 3.1% versus 1.2% ) . in multiple logistic model based on the combined sample , number of chronic diseases , self - rated health status , mmse total score , and environment the odds ratio was 1.35 ( 95% ci 1.221.50 ) for number of chronic diseases , 2.85 ( 95% ci 2.363.43 ) for self - rated health status ( continuous ) , 0.89 ( 95% ci 0.850.94 ) for mmse total score , and 0.68 ( 95% ci 0.480.96 ) for environment ( singapore versus shanghai ) , respectively . results from stratified analysis showed that the strength of associations between health variables and disability differed between the two samples ( table 3 ) . for example , in the shanghai sample , one point increase on the 4-point self - rated health status scale was associated with 3.13 times ( 95% ci 2.553.85 ) higher odds of having disability while the odds ratio was only 1.73 ( 95% ci 1.072.81 ) in the singapore sample . for mmse total score , the corresponding odds ratio was 0.91 ( 95% ci 0.860.96 ) in the shanghai sample and 0.83 ( 95% ci 0.730.94 ) in the singapore sample . based on data from two population - based studies , we found that the number of chronic diseases , self - rated health status , cognitive function , and unmeasured environment factors represented by study sample were significantly associated with functional disability among chinese older adults . the contributions of physical health [ 8 , 18 ] and cognitive function [ 19 , 20 ] to functional disability have been documented and were well replicated in our analysis . with large population - based data , we firstly quantified the strength of differential contributions of each of self - reported physical health , self - rated health status , and cognitive function to disability in chinese elderly population . the findings are relevant and important for policymakers , medical practitioners , and academics . participants in the singapore sample were 32% less likely to have disability compared with participants in the shanghai sample . participants from both studies were chinese older adults living in big city , and a number of important covariates were adjusted in multiple regression models . it is less likely that the observed difference was caused by unmeasured factors at individual level . however , a careful examination of the two most difficult adl tasks ( bathing and climbing stairs ) provided us with plausible explanations . in 1987 , most families in shanghai had no bathroom and shower , and bathing was considered as a complicated task . in contrast , the majority of slas participants lived in public houses that have standard bathroom and shower and easy - to - climb stairs . our study provided fresh evidence on the role of environmental factors in disablement process [ 2123 ] . as pointed out by verbrugge and jette : disability is not a personal characteristic , but is instead a gap between personal capability and environmental demand disability can be diminished swiftly and markedly if the physical or mental demands of a given task are reduced . our findings suggest that environment not only affects the prevalence of disability , but also modifies the strength of associations between disability and health variables . strengths of our study include concurrent measuring of various health factors and simultaneous inclusion of those factors in multivariate model . however , no causal relationship could be drawn given cross - sectional nature of the study design . in conclusion , physical health and cognitive function were significantly associated with disability among chinese older adults living in asian metropolises . all the authors contributed substantially to the design , analysis and interpretation of the data and participated in drafting or revising the paper .

polychondritis is an inflammatory disorder that affects various catilagenous structures , and the clinical features include auricular , nasal and respiratory tract chondritis . it also involves the eyes , audiovestibular apparatus , joints and vascular structures . polychondritis can be associated with several rheumatologic diseases such as systemic lupus erythematosus , rheumatoid arthritis and systemic vasculitis . however , polychondritis is a rare complication of behet 's disease ( bd ) and only ten cases with combined bd and polychondritis have been reported on around the world . in this report , we describe a 40-year - old korean man with bd who suffered from polychondritis that manifested as bilateral auricular chondritis , conjunctivitis and arthritis .

please summarize the articles given below

often , a new physics faculty member is faced with the duty of renovating the introductory physics labs . we will provide a list of experiments and equipment needed to convert about half of the traditional labs on a 1-year introductory physics lab into microcomputer - based laboratories ( mbls ) . our student body consists mostly of science majors that take the algebra - based course . but , the lab renovation described here could be used for the calculus - based group as well . we would suggest adjusting the lab manuals . nowadays , mbls are usually the choice when thinking of a renovation . they have effectively demonstrated an advantage to the learning process over the years.[14 ] moreover , for our science students , the labs are important in reinforcing the concepts learned in class . it is very common to hear , during the lab sections , students commenting on their grasp of the concept learned in class due to the experiment being performed . the overall 1-year lab experience follows the guidelines provided by the american association of physics teachers . it contains a brief theoretical description and the procedures to be followed on the day of the lab . on the lab day , the students should come prepared and ready to start without additional instructions . the instructor circles around the stations to guide and answer appropriate questions if needed . on the lab day , the students are handed the lab report . it contains a data analysis part , some discovery questions , and ends with a summary and conclusion part . the report is completed by the student during the session . we did not find an appropriate version for the other half to meet our overall goal . therefore , we kept a few traditional labs . the list of experiments is chosen based on the lecture material . one of the concerns was to always be able to cover the theory before the lab was performed by the student . one - year introductory microcomputer - based laboratory experiment list understanding motion , free fall , projectile motion , atwood 's machine , boyle 's law , electrical equivalent of heat , heat transfer , electrostatic charge , ohm 's law , rc circuit , and magnetic induction . a suggestion for the beginner is to try all the experiments before hand until you get really familiar with the sensors and software and how they work . most of the time , it is a lack of understanding of the use of the apparatus , assuming it is not defective of course . we will list here the total equipment needed per station to implement the 1-year lab described above . it is expected that the laboratory will have a printer that can be shared among all groups . each station consists of a laptop and the science workshop 750 interface ( ci-7650 ) with the datastudio software ( ci-6870 g ) . lab station : science workshop interface , laptop and motion sensor sensors to be used with the interface for data measurement : motion sensor ( ci-6742a ) , photogate and pulley system ( me-6838 ) , accessory photogate ( me-9204b ) , time - of - flight accessory ( me-6810 ) , pressure sensor ( ci-6532a ) , temperature sensor ( ci6605a ) , power amplifier ( ci-6552a ) , charge sensor ( ci-6555 ) , voltage sensor ( ci-6503 ) , photogate head ( me-9498a ) . figure 2 displays a few sensors . from left to right : pressure sensor , charge sensor , and photogate head the datastudio software collects and analyzes the data . it has an easy - to - use interface , allowing the students to explore the data . for instance , the left screenshot in ure 3 displays a graph of voltage versus time . the data are collected using a voltage sensor when a magnet is dropped through a coil . the students can select a region on the graph and the software calculates the area under the curve . the screenshot on the right in figure 3 displays the curve - fitting feature of datastudio . left screenshot : induction lab using graph and area under the curve calculation . the pressure column will be filled as the measurements are taken using the pressure sensor . boyle 's law lab using a table display the additional equipment needed from pasco to perform the experiments are : picket fence ( me-9377a ) , projectile mini launcher ( me-6825a ) , photogate mounting bracket ( me-6821a ) , extension cable ( pi-8117 ) , thermodynamics kit ( ci-6514a ) , charge producers ( ci-6555 ) , faraday ice pail ( es-9057b ) , ac / dc electronics lab ( em-8656 ) , and bar magnet ( em-8620 ) . general lab supplies needed include a pair of scissors and goggles , one digital balance ohaus ( sp-601 ) , one meterstick , one thermometer , tongs ( handling hot bottles ) , gloves ( handle hot containers ) , braided physics string ( se-8050 ) , 500 ml glass container ( 90c water ) , banana plug cord red and black ( 5 on set ) ( se-9750 ) or ( se-975 ) , masses and hanger set ( me-8979 ) , universal table clamp ( me-9376b ) , calorimetry cups ( td-8825a ) , and hot plates ( se-8830 ) . oftentimes , this task is hard to accomplish for a solo faculty in a small institution . we provided here a list of the experiments and equipments needed to upgrade about half the experiments to mbls on a 1-year introductory physics lab . we would like to add that although we used pasco , there are other comparable systems in the market . the intention of this paper is to help others with their own lab renovation . in order to better fulfill this purpose ,

nowadays , data acquisition software and sensors are being widely used in introductory physics laboratories . this allows the student to spend more time exploring the data that is collected by the computer hence focusing more on the physical concept . very often , a faculty is faced with the challenge of updating or introducing a microcomputer - based laboratory ( mbl ) at his or her institution . this article will provide a list of experiments and equipment needed to convert about half of the traditional labs on a 1-year introductory physics lab into mbls .

please summarize the articles given below

joseph disease , is the most common subtype of sca world - wide , and is caused by a pathologic cag trinucleotide repeat expansion in the atxn3 gene located on chromosome 14q32.12 . the cardinal clinical characteristics of sca3 include gait and stance unsteadiness , limb ataxia , dysarthria , oculomotor dysfunction , sensory disorder , pyramidal and extrapyramidal dysfunction , and so on . sca3 is a slowly progressive and unremitting disease , in which patients generally will become wheelchair - bound and bedridden in the end stage , and the median survival time after disease onset is approximately 21 years . the resulting loss of working ability and reduced survival confer significant disease burden to the patients , their families , and the society . thus , it is of vital importance to explore effective therapeutic options in order to alleviate the symptoms or retard the disease progression in sca3 . nerve growth factor ( ngf ) is the founding member of the neurotrophin family , and is essential for the proper development , patterning , and maintenance of the mammalian nervous system . previous studies have revealed that ngf specifically targets sensory and sympathetic neurons in the peripheral nervous system , as well as basal forebrain cholinergic neurons in the central nervous system . there is also growing evidence to support the role of ngf in the development , differentiation , and maintenance of the human cerebellar connectivity . in this context , ngf and its high - affinity receptor tachykinin receptor antagonist ( tkra ) these data imply that ngf may have neuroprotective effects on cerebellar neurons and hence might serve as a therapeutic candidate of sca3 . therefore , this clinical pilot study was set forth to examine the efficacy of ngf in patients with sca3 . this study was an open - label clinical trial assessing the efficacy of ngf in patients with sca3 ; it was conducted at the first affiliated hospital of zhengzhou university from november 2011 to november 2012 . this study was approved by the ethics committee of first affiliated hospital of zhengzhou university and registered at the chinese clinical trial registry ( www.chictr.org ; chictr - onc-11001954 ) . all study procedures were in accordance with the declaration of helsinki and all recruited subjects have provided written informed consents . ataxia patients with family history were screened at the department of neurology , first affiliated hospital of zhengzhou university and referred for genetic testing at the department of genetic diagnosis . patients who fulfilled the following inclusion criteria : ( 1 ) ataxia patients with family history were checked and diagnosed by two independent doctors , then the genotype sca3 was confirmed by genetic test ; ( 2 ) older than 18 years ; and ( 3 ) willing to give informed consent , will be recruited . the exclusion criteria were as follows : ( 1 ) allergy to neurotrophin ; ( 2 ) with concomitant severe systematic diseases or psychiatric disorders ; ( 3 ) unable to finish the scale for assessment and rating of ataxia ( sara ) score ; ( 4 ) refuse to attend the study , and ( 5 ) ataxias attributed to secondary causes ( such as alcohol or drug abuse and toxic exposure ) . all enrolled patients underwent standard neurological , electrophysiological and neuroimaging examinations , and the sca3 subtype was classified according to these clinical findings . china ) used in this study was extracted and purified from the submandibular gland of the male mouse and has high homology in the amino acid sequence with human ngf . the mngf has been safely used in a series of clinical studies . , and has been approved by china food and drug administration . mngf was administered peripherally by intramuscular injection at the dose of 18 g once daily for 4 weeks consecutively . it has been proven to have good reliability and validity among chinese patients with degenerative cerebellar . the sara evaluates axial ( gait , stance , sitting ) , speech , and appendicular ( finger chase , nose - finger test , fast alternating hand movements ( fahms ) , and heel - shin slide ) functions . the sara sum score ranges from 0 to 40 with 0 indicating no ataxia and 40 the most severe ataxia , thus deterioration or improvement of disease severity is , respectively , represented by an increase or decrease of the sara score . for each patient , chinese version of sara was performed at the baseline , 2 weeks ( midpoint ) and 4 weeks ( endpoint ) after treatment . these sara evaluations were all videotaped and reviewed independently by two other investigators who did not attend the original assessment in a random order . the average of score rated by these two evaluators was denoted as the final sara score . the primary outcome measure was the change of sara score after treatment compared with that at baseline . continuous variables were expressed as mean standard deviation ( sd ) , and categorical variables were expressed as frequencies or proportions where appropriate . the observed changes of sara score after treatment from baseline were analyzed with nonparametric wilcoxon signed - rank test . continuous variables were expressed as mean standard deviation ( sd ) , and categorical variables were expressed as frequencies or proportions where appropriate . the observed changes of sara score after treatment from baseline were analyzed with nonparametric wilcoxon signed - rank test . the mean age was 39.14 7.81 years , the mean age of onset was 35.00 6.53 years , the mean disease duration was 4.14 1.90 years , and the mean cag repeats number was 77.57 2.27 . the mean sara score dropped from 8.48 2.40 to 6.94 2.34 ( p < 0.001 ) and 6.30 1.87 ( p < 0.001 ) after 2 and 4 weeks of treatment , respectively [ table 2 ] . significant decrease in subsections sara scores was also observed in stance ( p = 0.008 and 0.003 ) , speech ( p = 0.046 and 0.023 ) , finger - chase ( p = 0.026 and 0.015 ) , fahms ( 0.015 and 0.009 ) , and heel - shin slide ( p = 0.006 and 0.001 ) at 2 and 4 weeks after therapy , respectively . the mean improvement in total sara score was 2.18 1.30 ( ranging from 0 to 5.75 ) in our study . scores of sara and its subsections at baseline , 2 and 4 weeks after ngf therapy * comparisons between midpoint of therapy and baseline ; comparisons between endpoint of therapy and baseline . sara : scale of the assessment of rating of ataxia ; fahm : fast alternating hand movements ; ngf : nerve growth factor . one previous study has shown that insulin - like growth factor-1 , one of the neurotrophic factors , may be effective in reducing the disease progression of sca3 . previous studies have reported that ngf can improve cognitive decline in patients with alzheimer 's disease and may also have potential therapeutic roles in other neurodegenerative diseases . postmortem histopathological study in patients with sca3 has revealed considerable neuronal loss at the cerebellar purkinje cell layer and the four deep cerebellar nuclei . ngf can prevent neuronal death or age - related atrophy in the adult brain by inhibiting apoptosis of cholinergic neurons in the basal forebrain , and it would be reasonable to postulate that it may also inhibit the apoptosis in the cerebellum neurons expressing tyrosine kinase a ( trka ) and serve as a potential therapy for sca3 . such treatment effect is observed as early as 2 weeks after therapy and sustained after 4 weeks . to our knowledge , this study is the first to investigate the efficacy of ngf in sca3 . postmortem study has shown that ngf and its high - affinity receptor tkra are distributed in the neurons of the human cerebellum cortex and its deep nuclei throughout life . these findings support the involvement of ngf in the development , differentiation and maintenance of the cerebellar connectivity . although the blood - brain barrier ( bbb ) has low permeability to large proteins , some autoradiography studies suggested ed that blood - borne ngf and its subunit -ngf can cross the bbb of mice and arrive at the brain parenchyma by direct permeation . second , the therapeutic effect of ngf might also be mediated via the proprioceptive sensation system . it has been reported that most ( 87% ) of the sca3 patients had somatosensory evoked potential abnormalities , especially in the lower limbs , which was due to degenerative lesions in the dorsal column of the spinal cord . hence , ngf therapy may improve stance and heel - knee - shin slide due to improved proprioception . these two proposed mechanisms may explain the observed improvement after therapy and substantiate the use ngf to treat a patient with sca3 . first , it was an open - label study , in which the observed therapeutic efficacy might be contributed by placebo effects . however , in one randomized , double - blind , and placebo - controlled study to evaluate the efficacy of varenicline in sca3 patients , the mean improvements of sara score in the therapeutic group , and the placebo group were 1.97 and 0.86 , respectively . the sara score improvement of 2.18 in our current study is unlikely to be accounted for by placebo effect alone . furthermore , sara is a reliable and valid scale to linearly assess the ataxia symptoms , and changes of sara scores exceeding 1.1 points are considered clinically relevant . nevertheless , our pilot data suggest that ngf may be a promising treatment for patients with sca3 . a large - scale randomized , double - blind placebo - controlled trial would be worthwhile to evaluate the efficacy and tolerability of ngf in sca3 patients . the need to advance saliva research is strongly recognized by the strategic plan of the national institute of dental and craniofacial research . the ability to monitor health status , disease onset , progression , recurrence and treatment outcome through non - invasive means is highly important to advancing health care management . saliva ( oral fluid ) is a perfect medium to be explored , offering the potential for a non - invasive , easy to obtain means for detecting and monitoring disease . the adoption of saliva testing would allow a patient to collect their own specimens at home , yielding savings in health costs , convenience for the patient and facilitating multiple sampling . specimen collection is less objectionable to patients than in the case of other bodily fluids and easier in children and older individuals . the analysis of saliva can thus provide a cost - effective approach for the screening of large populations . due to these significant advantages , developing biomarkers in saliva for the detection of serious illnesses such as oral and systemic cancers has been on the national healthcare agenda for several years ( government performance & results act 2008 ) . one mandate formulated in the government performance & results act report is that by the year 2013 proof of principle will be obtained for the ability of saliva to monitor health and diagnose for one systemic disease . a vast amount of saliva omics data has been generated by recent studies using high throughput technologies . however , there are still barriers which researchers must overcome before such data can be exploited , such as lack of computationally accessible salivary data and information , and inability to cross - reference the salivaomics data that could potentially be made available through different proteomics , transcriptomics , genomics and metabolomics studies . for these reasons , there is an urgent need to create the salivaomics knowledge base ( skb ) , a data management system and web resource constructed to support saliva diagnostics research , and we present below the informatics advances brought about through the skb and through the associated tools and resources . ontologies are controlled structured vocabularies designed to provide consensus - based means to ensure consistent description of data by scientists working in disparate domains . as applied in the biomedical domain , ontology plays a key role in providing consensus - based controlled vocabularies serving the consistent annotation of biological and medical data and information , most conspicuously within the framework of the gene ontology and now of its sister ontologies within the open biomedical ontologies foundry ( http://obofoundry.org ) . the basic formal ontology ( bfo ) is a formal ontological framework developed by barry smith , pierre grenon and others , which serves as the starting point for some 100 ontology projects primarily in the biomedical domain ( http://www.ifomis.uni-saarland.de/bfo/ ) . the bfo framework can be readily extended to the treatment of families of ontologies of other types , above all to the treatment of relations between ontologies of different levels of granularity , from genes to species and from a single patient to epidemics at a geographical scale ( combining applications of bfo to the medical and to the geographical domain ) . the framework may also be used as a tool for dealing with the relations between distinct perspectives on the biomedical domain , including culturally generated perspectives of the sort which are studied by linguists and anthropologists . two bfo - based ontologies of special significance for our work here are the ontology for biomedical investigations ( obi ) and the ontology for general medical sciences . the obi is an ontology designed to serve the coordinated representation of designs , protocols , instrumentation , materials , processes , data and types of analysis in all areas of biological and biomedical investigation . ontology for general medical science is an ontology of the entities involved in the clinical encounter . thus , it includes very general terms that are used across medical disciplines , including : disease ' , disorder ' , disease course ' , diagnosis ' , patient ' and healthcare provider ' . to advance the consistency of data in the dental research community , smith et al . propose an approach to building a consensus - based ontology to support dental research ( odr ) . in analogy to efforts in other fields , a consortium of research groups specializing in different areas of study would undertake such an effort , each building different components of ontology to support dental research . initial efforts in this direction , by scientists in dental research and biomedical ontology at university at buffalo and university of california , include work on the ontology of oral pathology , oral maxillofacial anatomy , dental disease and dental procedures , and as we discuss below , the saliva ontology . integral to his work is a plan to allow a seamless connection between the use of ontology to support dental research in the dental domain and the use of existing ontology resources developed in other areas of biology and medicine , by reusing elements and strategies from them . the work on dental diseases is carried out in conjunction with the development of ontology for general medical science . the saliva ontology ( salo ) ( figure 1 ) is a detailed ontology of this bodily fluid that is optimized to meet the needs of both the clinical diagnostic community and the cross - disciplinary community of omics researchers . the salo is created through cross - disciplinary interaction with saliva experts , protein experts , diagnosticians and ontologists . to aid development and testing of salo , we develop a corpus of saliva - relevant literature in skb to assist in characterizing core terms and synonyms within the ontology and to provide links between salo content and relevant items in pubmed . skb will also incorporate the results of experiments in data and text mining using the ontology . salo will incorporate links to existing ontologies and terminology resources involving treatment of saliva - relevant phenomena . we will also identify and represent within salo relationships to saliva - relevant types represented in ontologies such as the gene ontology , the protein ontology and the chemical entities of biological interest ontology , and also provide links to corresponding snomed ct terms where available . each term in the ontology has its own url which points to a webpage providing definitions , pubmed sources , references to annotations to skb and to external databases . it is cross - platform and supports many popular relational database managements systems , including mysql , oracle , postgresql , sql server and db2 . the software is data - agnostic , and can therefore be easily adapted to existing data sets . it is expandable and customizable through a plug - in system , and is open - source so the community can participate in deeper development . furthermore , biomart can seamlessly connect geographically disparate databases , facilitating collaboration between different groups . these features have catalyzed the creation of biomart central portal , a first of its kind community - supported effort to create a single access point integrating many different , independently administered biological databases . anybody can contribute an independently maintained resource to the central portal , allowing it to be exposed to and shared with the research community , and linking it with the other resources in the portal . users can take advantage of the common interface to quickly utilize different sources without learning a new system for each . the system also simplifies cross - database searches that might otherwise require several complicated steps . several integrated tools streamline common tasks , such as converting between i d formats and retrieving sequences . the combination of a wide variety of databases , an easy - to - use interface , robust programmatic access and the array of tools make central portal a one - stop shop for biological data querying . sdxmart is a biomart data portal that hosts salivary proteomic , transcriptomic , metabolomic and microrna data and offers access to the data by using the biomart interface and querying environment . the sdxmart is designed to provide a variety of queries to facilitate saliva biomarker discovery including complex queries that integrate genomic , clinical and functional information . the sdxmart holds data from projects of oral diseases and systemic diseases including oral cancer , sjgren 's syndrome , pancreatic cancer and breast cancer . the types of datasets are : ( i ) proteomics ; ( ii ) transcriptomics ; ( iii ) microrna ; and ( iv ) metabolomics . in addition , the sdxmart is imported with several public databases including ensembl genome database ( ensembl release 37 ) , and the number of resources is continuously growing . it is being built in tandem with the salo and sdxmart which will allow the skb to interoperate with other omics databases as part of a general strategy to facilitate integration of heterogeneous and disparate data sources that enable system biology approaches . either salo or sdxmart is a first and only resource of its kind in the field of dentistry .

background : spinocerebellar ataxia type 3 ( sca3 ) is the most common subtype of sca worldwide , and runs a slowly progressive and unremitting disease course . there is currently no curable treatment available . growing evidence has suggested that nerve growth factor ( ngf ) may have therapeutic effects in neurodegenerative diseases , and possibly also in sca3 . the objective of this study was to test the efficacy of ngf in sca3 patients.methods:we performed an open - label prospective study in genetically confirmed adult ( > 18 years old ) sca3 patients . ngf was administered by intramuscular injection ( 18 g once daily ) for 28 days consecutively . all the patients were evaluated at baseline and 2 and 4 weeks after treatment using the chinese version of the scale for assessment and rating of ataxia ( sara).results : twenty - one sca3 patients ( 10 men and 11 women , mean age 39.14 7.81 years , mean disease duration 4.14 1.90 years , mean cag repeats number 77.57 2.27 ) were enrolled . after 28 days of ngf treatment , the mean total sara score decreased significantly from a baseline of 8.48 2.40 to 6.30 1.87 ( p < 0.001 ) . subsections sara scores also showed significant improvements in stance ( p = 0.003 ) , speech ( p = 0.023 ) , finger chase ( p = 0.015 ) , fast alternating hand movements ( p = 0.009 ) , and heel - shin slide ( p = 0.001).conclusions : our preliminary data suggest that ngf may be effective in treating patients with sca3 .

please summarize the articles given below

we will introduce recent advances on the study of post - translational processing , modification , and targeting of cathepsins and cystatins . almost all the intracellular proteins are passed through principally similar processes from the synthesis to their degradation in general . therefore , i would like to introduce the general fate of intracellular proteins , from the post - translational processing , modification , and targeting to the ordered particles . as figure 1 shows , the intracellular proteins are synthesized as pre - promature complex in polysomes and prepart is removed cotranslationally , and then the promature parts are translocated into golgi - apparatus , and then glycosylated by mannose - rich sugar . the glycosylated mature part is translocated into target organelles and the degradation was started by the splitting from the ordered nicked bonds to make hydrophobic peptides . these hydrophobic peptides are secreted to cytoplasm and are incorporated into the phagosomes or proteosomes after ubiquitination . biological merit of post - translational processing and modifications of proteins are possible considerations . the capability to take variable forms on the way of biosynthesis is important to keep adaptability to the changing of biological requirements and intracellular translocation during the maturation must be regulated . pro - parts or bound sugar are the targeting signals in some cases . in the cases of carbamoyl phosphate synthetase ( cps ) and ornithine transcarbamylase ( otc ) , their pro - parts play the role of signals to be recognized by their receptors located on target organella membrane , such as lysosomes , as shown in figure 4 . the glycosylated cathepsins are targeted into lysosomes mediated by mannose-6 phosphate receptors which are located on the lysosomal . as figures 4(a ) and 4(b ) show , the lysosomes in which cathepsin h or b is located are attached to the cell - membrane . on the contrary , cathepsin l is located in the lysosomes which are distributed diffusely in liver cells . as figure 4(a ) shows , using immunodouble gold - particle staining , cathepsin b ( small gold particle ) and cathepsin h ( large gold particle ) are located clearly in different lysosomes . cathepsin l is translated as 17 amino acids of prepart , 96 amino acids of pro - part and 221 amino acids of mature - part [ 9 , 10 ] . the prepart is removed cotranslationally and formed procathepsin is translocated into golgi - apparatus , and then the 108-asn and the 155-asn in mature parts are glycosylated by high - mannose - type sugar , as shown in figure 2(a ) . the initiation of the degradation is started from the nicking bond ( 178 bond ) cleavage by some cysteine protease . cathepsin b is translated as 17 amino acids of prepart , 62 amino acids of pro - part , and 252 amino acids of mature part [ 12 , 13 ] . the prepart is also removed cotranslationally and the formed procathepsins are translocated into golgi - apparatus and then the 38th - asn in pro part and the 111th - asn in the mature - part are glycosylated by high - mannose - type sugar . then the mannose-6-phosphate - moities play a role as the targeting marker to the lysosomes . cathepsin h is translated as 21 amino acids of prepart , 114 amino acids of pro - part , and 217 amino acids of mature part . the pro - part has two carbohydrate chains at the 70th - asn and the 90th - asn and the mature part consisted of 217 amino acids , and one carbohydrate chain is bound at the 99th - asn [ 8 , 15 ] . the initiation of degradation is started from the 177th nicking bond by cysteine protease . intracellular protein degradation (= autophagosome formation ) is regulated by nutritional and hormonal conditions . fasting or insulin enrichment caused stimulation of the phagosome formation and cathepsin l amount are increased ; on the contrary , refeeding and glucagon enrichment resulted in the suppression of phagosome formation and decreasing of cathepsin l amount . as you see in figure 2 , cathepsins b , l , and h have individual ordered nicking bond as the initiation of their degradations ; these bonds are cleaved by cysteine protease , therefore as table 1 shows , the half - lives ( t1/2 ) of cathepsins and the contents in lysosomes clearly increased by treatment by e-64 ( inhibitor for all cysteine proteases ) . the initiations of degradation of cathepsins are started from the ordered limited proteolysis by cysteine protease in the lysosomes , as figure 2 shows . the formed hydrophobic products were translocated into autophagosome or proteasome ( after ubiquitinated ) to degrade to amino acids . procathepsins or mature cathepsins are secreted from the various cells and play individual physiological , or pathological roles . as figure 5 shows , bone metabolism is consisted of functional balances between osteoblastic cell function and osteoclastic cell function . bone collagen is degraded mainly by cathepsin l and k , therefore they are called collagenolytic cathepsins . the secretion of these cathepsins from osteoclasts is stimulated by pht ( parathyroid hormone ) and suppressed by vitamin d3 , e-64 , ca-148 eta . therefore , bone metastasis of cancers is inhibited by cathepsin inhibitors , such as by e-64 or clik-148 . as pit formation test in table 4 shows , bone - matrix degradation is catalyzed by cathepsin l , but not by cathepsin b. endogenous low - molecular weight cathepsin inhibitors are consisted of two big groups , one is only located in skin and the other is ubiquitously located in all organs . cystatin ( a ) is only located in epidermis , cystatin ( b ) is located ubiquitously in all cells ( organs ) . the secretary formed cystatins are cystatin c in eggwhite and cystatin s in the saliva . another secretary group having high - molecular weight ( repeated low molecular cystatins ) is kininogen family in serum . each cystatin shows different inhibitory specificity for individual cathepsins , for example , cystatin does not inhibit cathepsin b activity but strongly inhibit cathepsin l activity and cathepsin h activities [ 7 , 19 ] . the amino - acid sequences of low - molecular weight cystatin family have strong homology , however , their post - translational processing are quite different . because their localizations and biological functions is quite different . when skin was stained by immunohistochemistry using anticystatin antibody , only the cornified - envelope of skin was stained . the sphingosine treatment to new born skin resulted in the strong suppression of the targeting of cystatin into the cornified envelope . the sphingosine is a powerful inhibitor for protein kinase c. as shown in figures 7(a ) and 7(b ) , threonine residue in near c - terminus ( the 92th threonine in figure 9 shows ) of cystatin is phosphorylated by protein kinase c , and the phosphorglated cystatin is incorporated into cornified envelope . the participation of protein kinase c in the phosphorylation of cystatin was also confirmed using specific inhibitor of protein kinase c , ( hidaka h-7 ) inhibited the incorporation of p into cystatin . the phosphorylated cystatin was incorporated into skin cornified envelop . in the envelop , the phosphorylated cystatin was conjugated with filaggrin - linker sediment peptide which is rich in glutamine residues , mediated by epidermal transglutaminase in the presence of calcium , and yield a high - molecular weight protein ( skin fiber ) , as shown in figure 10 . the phosphorylated cystatin showed strong inhibition to cathepsin l , but not to the cathepsin b and h , it also showed strong inhibition to the bacterial cysteine proteases and virus cathepsins . therefore , cystatin and phosphorylated cystatin showed strong protection from infections of bacteria or viruses in skin . post - translational covalent modification of cystatin and the changing of their inhibitory activities . the third position of the n - termius - cysteine residue of cystatin reacts with glutathione to form a mixed disulfate complex and also is able to make dimmer by the disulfate bond . as figure 8 shows , n - terminus of cystatins was inserted into the substrate binding pocket of cathepsins , the glutathionated or the dimmer form were unable to insert into the binding pocket of cathepsins . the coefficient of oxidized or reduced forms of glutathiones regulates the inhibitory activity of cystatin . therefore , the activities of cathepsins are regulated by the intracellular redox potentials in spite of the changes of the inhibitory activities of cystatin . as figure 7(b ) shows , using -cell of pancreas , the cystatin is located in insulin secretion particles , therefore , cystatin is secreted with insulin in the pancreas . endocrine disorders may complicate , cause or mimic otolaryngologic disorders , some of which may be anatomical , due to an enlargement of the thyroid gland , while others are physiological , resulting from increased or decreased glandular activity.1 hypothyroidism is characterized by the slowing of mental and motor activity , depression , constipation , cold intolerance menorrhagia , stiff muscles , carpal tunnel syndrome , sleep apnea , dry hair and skin , weight gain , snoring and a hoarse voice.1 less common symptoms involve the heart , muscles , joints , and blood.2 dysarthria as the presenting symptom of hypothyroidism has only been reported once before.3 here , we present an unusual case of hypo - thyroidism presenting with dysarthria . a 39-year - old female presented to the clinic with dysarthria of six months duration . , it was revealed that there had been episodes of dysphonea , snoring , sleep apnea , dysphagia and choking during eating or drinking . her past medical history was normal apart from one occasion of delayed recovery from anaesthesia during surgery for a fractured femur the year before . clinical examination , including the central nervous system , was normal apart from a slightly puffy face . there was no abnormality in the movement of the tongue or pharygeal / palate muscles . pmol / l ( normal 9.2 - 23.9 pmol / l ) , a thyroid stimulating hormone of 82.7 miu / l ( normal 0.32 - 5.00 miu / l ) , antithyroglobulin antibodies were 1:320 u / ml ( normal 1:40 u / ml ) , antiperoxidase autoantibodies of 1:1600 u / ml ( normal 1:40 u / ml ) . a complete blood count film was consistent with iron deficiency , a haemoglobin of 7grams ( normal 11 - 16 grams ) , low serum iron of 2 umol / l ( normal 10 - 28 umol / l ) , increased red cell distribution width ( rdw ) of 17.2 ( normal 11.6 - 13.7% ) . other biochemical abnormalities were high serum cholesterol of 6.9 mmol / l ( normal 3.6 - 6.8 , hypo - thyroidism was diagnosed . in the light of the patient 's diagnosis , a second history was taken which showed that she suffered from other symptoms of hypothyroidism such as , dry skin , generalised weakness , excessive sleeping , hoarse voice , and menorrhagia . two months after the initiation of therapy , the patient had no more dysarthria or other associated symptoms . dysarthria is a disturbance of articulation that may be caused by a neuromuscular lesion , or an abnormality of the vocal cords . the first may result from damage to the central or peripheral nervous system such as head trauma , brain stem infarction , bulbar palsy , motor neuron disease , peripheral neuropathy , huntington 's chorea , parkinson 's disease , multiple sclerosis , myasthenia gravis , or muscle disease.4 the second may be attributable to congenital , traumatic , inflammatory , tumors , or post - operative lesions of the vocal cords . these causes were unlikely in this patient , because she showed no associated clinical features of these diseases besides the normal neurological examination and investigations . other causes such as congenital or aquired storage disorders such as amyloidosis , and such endocrine disorders as acromegaly or hypo - thyroidism,3 as in the presented case , may lead to an enlargement of one or more of the components of the vocal cords.56 the most likely cause for the dysarthria in this patient was hypothyroidism . this was supported by the abnormal thyroid functions and the response of the dysarthria to thyroxin . dysarthria due to hypothyroidism had been reported only once previous to this case.3 the pathophysiology of dysarthria in hypothyroidism can be explained by edematous swelling of laryngeal and hypopharyngeal structures in combination with macroglossia.3 it has been shown that macroglossia in hypothyroidism is caused by a thickening of the epithelial tissue.6 these changes can also explain the choking and the dysphagia which this patient experienced . there have been a few reports of hypothyroidism responsible for secondary dysphagia.1012 her sleep apnea may also be a manifestation of hypothyroidism , most likely caused by edema and myopathy.7 sleep apnea attributable to hypothyroidism is reversible with thyroxin replacement therapy.8 the episodic hoarseness of voice can also be explained by hypothyroidism,1 as well as the delayed recovery from anaethesia the year before , most probably the result of undiagnosed hypothyroidism.91314 unfortunately , thyroid function tests had not been performed on our patient at that time . iron deficiency anemia in this patient was due to menorrhagia , which is one of the characteristic features of the disease.1 hyperlipidaemia may also be due to hypothyroidism , a known association.1 clinical implication of the presented patient was that dysarthria may be the presenting symptom of hypothyroidism , even if other symptoms had been present for a long time . hypothyroidism as the cause of dysarthria was confirmed with the discovery of additional symptoms in the patient 's history . otolaryngeal symptoms should therefore be considered possible symptoms of hypothyroidism.15 prompt recovery of dysarthria is expected after hormone replacement therapy .

cathepsins are an essential protease family in all living cells . the cathepsins play an essential roles such as protein catabolism and protein synthesis . to targeting to various organella and to regulate their activity , the post translational - processing and modification play an important role cathepsins are translated in polysome as the pre - pro - mature forms . the pre - peptide is removed cotranslationally and then translocated to golgi - apparatus and the pro - part is removed and the mature - part is glycosylated , and the mature - part is targeted into the lysosome mediated by mannose-6-phosphate signal and the mature - part is bound with their coenzymes . the degradation of the mature - part is started by the limited proteolysis of the ordered nicked bonds to make hydrophobic peptides . the peptides are incorporated into phagosome or proteasome after ubiquitinated and are degrade into amino - acids . cystatins are endogenous inhibitors of cathepsins . cystatin which is only located in skin is phosphorylated at the near c - terminus by protein kinase - c , and the phosphorylate - cystatin is incorporated into cornified envelope and conjugated with filaggrin - fiber by transglutaminase to form the linker - fiber of skin . the cystatin is modified by glutathione or make their dimmer , and they are inactive . those modifications are regulated by the redox - potential by the glutathione .

please summarize the articles given below

the diagnosis and extent of resection in the management of hd depend on the sensitive and specific identification of ganglion cells.[13 ] however , documenting aganglionosis is often difficult and tedious on routine hematoxylin - eosin ( h and e ) stained sections . acetylcholinesterase ( ache ) has evolved as the gold standard in diagnosing hd ; however , this histochemical analysis is technically challenging , and to date , has not gained worldwide utilization and applicability . the aim of this study was to evaluate the efficacy of calretinin immunostaining in the ganglionic and aganglionic hd colon biopsy specimens and correlate with the h and e , thereby exploring its utility in suspicious cases of hd . our standard protocol of care for a child presenting with hd is barium enema study at presentation followed by a laparotomy where multiple biopsies are taken from the spastic aganglionic segment , transition zone , and the normal colon . a colostomy is sited at the level of the junction between the normal colon and the transition zone . the definitive surgery of choice is duhamel 's pull - through after 6 months of age . thirty - six were full - thickness rectal biopsies ( for suspected hd ) and 24 were bowel segments resected during the definitive pull - through surgery . calretinin ( monoclonal mouse antihuman antibody ( dako ) , ( clone : dak calret 1 , code : ir627 ) immunohistochemistry ( ihc ) staining was done on all paraffin - embedded blocks after routine h and e examination . the age of patients ranged from 1 day to 14 years ( mean 8.2 months ) , and there were 46 boys and 14 girls ( m : f = 3.2 - 3.3:1 ; normal ratio 3:1 - 4:1 ) . twenty - three patients ( 63.8% ) presented at less than 1 month of age . five ( 8.3% ) had long segment disease , 6 ( 10% ) had total colonic aganglionosis . during the analysis of 36 initial full - thickness colon biopsy specimens , h and e staining revealed absence of ganglion cells ( negative ) in 19 cases ( 52.7% ) , presence of ganglion cells ( positive ) in 2 cases ( 0.05% ) , and suspected presence of ganglion cells in 15 cases ( 41.6% ) . of the 19 cases reported negative through h and e staining , 17 ( 47.22% ) were reported negative , and 2 ( 0.05% ) positive for calretinin histochemistry for the ganglion cells and nerve fibers [ table 1 ] . hematoxylin and eosin staining versus calretinin in rectal biopsies in 15 patients , the h and e sections were suspicious of a presence of ganglion cell . calretinin ihc showed immunopositivity in 3 slides , whereas 5 slides showed immunopositivity in nerve fibers . among the 5 slides positive for nerve fibers , in 2 of the cases ( 2/60 ) , calretinin gave a slight positive staining of nerve fibers , but with no staining of other areas . the slight calretinin positivity in the 2 specimens was observed in some large bundles with no staining in other areas , and thus indicating the beginning of transition zone . in the 24 patients where resected specimens from the definitive surgery were sent , serial biopsies were taken from the aganglionic segment , transition zone , and the ganglionic segment [ table 2 ] . calretinin was not expressed in the ganglion cells and nerve fibers of submucosal and myenteric plexus of 24 aganglionic ( spastic ) segments . in the transition zone , calretinin staining was positive in the ganglion cells in 20 cases ( 83.3% ) and was focally positive in the nerve fibers of 22 cases ( 91.6% ) , both in the submucosal and myenteric plexus . in ganglionic bowel segments of hd , calretinin showed immunopositivity in > 90% of ganglion cells and nerve fibers of submucosal and myenteric plexus . the histological diagnosis of hd is challenging , requiring the expertise of a senior pathologist and access to specialized techniques for handling frozen specimens for ache staining . this makes the diagnosis of hd difficult in centers where cases are infrequent , causing a delay in the treatment of the child . calretinin is proven to be highly sensitive for the presence of ganglion cells and nerve fibers . this protein is involved in calcium transport ; and its absence allows accumulation of cytoplasmic calcium , causing excess neuroexcitability and ultimate neurodegeneration . barshack , et al . , procured the colons of 10 patients with proven hd . calretinin ihc was performed on sections from the aganglionic zone , ganglionic zone , and transition zone of these colons . they identified calretinin staining in interstitial nerve fibres ( inf ) and ganglion cells in normal colon [ figures 1 and 2 ] and focal inf staining in 92% of transition zones . in contrast , there was no inf or ganglion cell staining in the aganglionic zone . it can be interpreted as positive or negative for immune reactivity reducing the ambiguity in diagnosis . in our study , in the rectal biopsy specimens , diagnosis was ambiguous in 15 patients on h and e examination . by using calretinin , immune positivity was demonstrated in 3 patients ( 3 for ganglion cells and 5 for nerve fibers ) ; thereby , ruling out hd in these patients . hematoxylin and eosin section with ganglion cell ( arrow ) ( h and e , 10 ) calretinin staining of ganglion cells ( h and e , 40 ) guinard - samuel , et al . , have studied the largest number of suction biopsies using calretinin . they have concluded that calretinin is accurate in proving the absence of ganglion cells , it is easy to interpret , and can replace ache to diagnose hd . they , however , recommend that it should be used as an aid along with h and e examination , especially in ultrashort segment disease and transition zone specimens . in our study , we found that calretinin correlated with h and e examination in both rectal biopsies and the resected bowel specimens . in the rectal biopsy specimens , calretinin also aided in the diagnosis of 15 patients with ambiguous findings . calretinin ihc is accurate in detecting the presence or absence of ganglion cells and holds several advantages such as follows : ( 1 ) it can be carried out on paraffin - embedded tissue sections ; ( 2 ) staining pattern is simple ; ( 3 ) binary pattern of interpretation ( negative or positive ) ; ( 4 ) it is cost effective . in the present study it can serve as a valuable cost - effective diagnostic aid in the centers where ache enzyme histochemistry is not available . q fever is a zoonotic disease that is caused by coxiella burnetii , a microorganism that frequently infects domestic ungulates , as well as wild mammals in many genera ( 1 ) . in animals , the disease is transmitted to humans incidentally by inhalation of aerosols from infected cattle and sheep ( 1 , 2 ) . in humans , c. burnetii infection may be asymptomatic , acute , or chronic . chronic q fever is rare , with endocarditis presenting as the most common complication ( 1 , 3 ) . q fever has been reported in almost every country , except new zealand ( 4 ) . in canada , burnetii antibodies ( 5 ) . in japan , 60 to 84% of cattle with reproductive disorders are seropositive ( 6 ) . a study conducted in southern france showed that 5 to 8% of endocarditis cases in humans were due to c. burnetii , and the prevalence of acute q fever was 50 cases per 100,000 inhabitants ( 7 ) . researchers have suggested that the incidence of q fever is chronically underestimated because clinical manifestations of the disease are often nonspecific or even absent . therefore , concerns with the disease focus on the importance of detection ( 1 , 3 , 8) . in korea , there is a little information concerning the epidemiology of c. burnetii infection in either animals or humans . a few cases of acute q fever in humans have been reported ( 9 , 10 ) . we examined the prevalence of antibodies to c. burnetii in dairy cattle nationwide and in people for health screening in a rural area of korea , and used the data to evaluate the impact of q fever in both animals and humans in korea . upon agreement with dairy owners , serum samples from 414 dairy cattle were collected on 31 farms from march to june , 2001 . serum was collected from people who visited kangwon national university hospital for health examinations between april and december 2002 . the subjects were interviewed to confirm the absence of symptoms of respiratory tract infection during the preceding two weeks . informed consent was obtained from all people for health screening and the animals are treated by the ethical guidelines of kangwon national univesity . coxiella burnetii phase ii antigen ( nine mile whole - cell antigen ) was prepared as previously described at the national institute of infectious diseases ( niid ) in tokyo , japan ( 12 ) , and dotted onto teflon - printed glass slides . each serum sample was diluted 1:16 with phosphate - buffered saline ( pbs ) , overlaid on the antigen dots , and incubated for 45 min at 37 in a moist chamber . the slides were subsequently washed twice for 5 min in pbs plus 0.05% tween-20 and then incubated with a 1:1,400 dilution of fluorescein isothiocyanate ( fitc)-conjugated rabbit anti - bovine igg ( sigma - aldrich , st . louis , mo , u.s.a . ) or fitc - conjugated rabbit anti - human igg ( dakocytomation , glostrup , denmark ) for 45 min at 37 in a moist chamber . the slides were again washed twice using the same method and examined using fluorescence microscopy ( axioskop 2 , zeiss , germany ) at 200 magnification . all sera that produced positive or equivocal reactions at 1:32 were further analyzed using 2-fold serial dilutions up to 1:4,096 . approximately 10% of the sera were divided and tested concurrently at kangwon national university and at the niid for quality control of test reproducibility ; there was greater than 95% concordance between the results from the two laboratories . upon agreement with dairy owners , serum samples from 414 dairy cattle were collected on 31 farms from march to june , 2001 . serum was collected from people who visited kangwon national university hospital for health examinations between april and december 2002 . the subjects were interviewed to confirm the absence of symptoms of respiratory tract infection during the preceding two weeks . informed consent was obtained from all people for health screening and the animals are treated by the ethical guidelines of kangwon national univesity . coxiella burnetii phase ii antigen ( nine mile whole - cell antigen ) was prepared as previously described at the national institute of infectious diseases ( niid ) in tokyo , japan ( 12 ) , and dotted onto teflon - printed glass slides . each serum sample was diluted 1:16 with phosphate - buffered saline ( pbs ) , overlaid on the antigen dots , and incubated for 45 min at 37 in a moist chamber . the slides were subsequently washed twice for 5 min in pbs plus 0.05% tween-20 and then incubated with a 1:1,400 dilution of fluorescein isothiocyanate ( fitc)-conjugated rabbit anti - bovine igg ( sigma - aldrich , st . louis , mo , u.s.a . ) or fitc - conjugated rabbit anti - human igg ( dakocytomation , glostrup , denmark ) for 45 min at 37 in a moist chamber . the slides were again washed twice using the same method and examined using fluorescence microscopy ( axioskop 2 , zeiss , germany ) at 200 magnification . all sera that produced positive or equivocal reactions at 1:32 were further analyzed using 2-fold serial dilutions up to 1:4,096 . approximately 10% of the sera were divided and tested concurrently at kangwon national university and at the niid for quality control of test reproducibility ; there was greater than 95% concordance between the results from the two laboratories . each province had a relatively high prevalence , ranging from 8.9 to 59.3% ; the overall national prevalence was 25.6% . of the positive sera ( n=106 ) , 80 ( 75.5% ) had high antibody titers ( 1:256 ) . the mean age of the subjects was 43.7 yr ( standard deviation 15.9 , range 19 - 82 ) , and the male - to - female ratio was 1:0.86 ( n=110:95 ) . of these , one had a serum sample with a high antibody titer ( 1:512 ) , and two had samples with low antibody titers ( 1:64 ) ( table 2 ) . this study examined the seroprevalence of c. burnetii infection in cattle and people for health screening in korea . the sera of cattle showed a high prevalence ( 25.6% ) of anti - c . burnetii antibodies , with 75.5% of the positive sera having high titers ( 1:256 ) . by contrast , the sera of healthy people showed a relatively low prevalence ( 1.5% ) of anti - c . the sera of dairy cattle were collected regardless of the disease status of each animal , which is a limitation of this study . since we could not find an association between a history of reproductive failure and seropositivity of the cows because of the absence of the data on the disease status , no prediction concerning seropositive status and reproductive problems can be made . however , c. burnetii infection is prevalent in all areas of korea ; every region had a seroprevalence above 8% , and the national prevalence was 25.6% . moreover , the high prevalence of high - titer sera provides evidence that the disease might be very active in this country . in neighboring japan , the seroprevalence of c. burnetii in healthy cattle ranges from 2 to 46% ; in cattle with reproductive disorders , the range was 60 to 84% ( 6 ) . reported that bovine placentitis was highly associated with the presence of c. burnetti ( 13 ) . in addition , 9% of abortions in goats are reported to be caused by this microorganism ( 14 ) . this is the first report to provide data that suggest that c. burnetii infection might be one of the important causes of reproductive problems in cattle in korea . further studies based on the isolation of c. burnetii are needed to elucidate the etiologic role of this microorganism in the reproductive problems of cattle in this country . furthermore , the high seroprevalence of c. burnetii among cattle suggests the possibility of contamination of the environment around farms . since c. burnetii is widely distributed in wild animals and ticks and causes q fever to humans ( 1 , 3 ) , it is necessary to evaluate the environmental hazards associated with c. burnetii infection that may threaten public health in the near future . in addition , the survey on the high - risk group such as farmers and butchers is strongly needed . the finding that people in a rural area demonstrated a relatively low seroprevalence of c. burnetii , as well as lower titers , suggests that infection with this microorganism seems to be relatively low in the rural area of korea . in a previously published report ( 11 ) , less than 1% of both healthy people and patients with fever of unknown origin tested positive for anti - c . another report showed none of the sera from 70 healthy people was reactive for c. burnetii antigen ( 15 ) . recent data showed that 11 out of 448 healthy people were reactive ( 16 ) . on the other hand , our group previously reported that only one of 88 patients with community - acquired pneumonia was diagnosed with q fever with an ifa assay using both phase i and ii antigens ( 18 ) . despite the low seroprevalence of c. burnetii in humans , we can not exclude the risk of q fever to individuals with high - risk occupations , such as farmers , veterinarians , and meat - processing workers , considering the high rate of infection observed in cattle in this study . previous korean report showed two of 46 stock breeders had an antibody titer of 1:20 ( 15 ) , and 5 sera from 202 abattoir workers reacted with phase ii antigen ( 16 ) . in conclusion , c. burnetii appears to be a highly prevalent pathogen in cattle in korea and , accordingly , the studies on the high - risk groups are needed to evaluate the seroprevalence for this organism in korea .

aim : to evaluate the efficacy of calretinin immunostaining in diagnosing hirschsprung 's disease ( hd).materials and methods : sixty cases were studied over a period of 1 year ( july 2010-june 2011 ) . there were 36 full - thickness biopsies and 24 resected specimens . calretinin processing was done on the paraffin - embedded blocks after routine histopathological examination.results:of the 36 biopsy specimens , in 19 cases hd was diagnosed by hematoxylin and eosin ( h and e ) staining earlier . in 2 patients , ganglion cells were seen and hd was ruled out . in 15 cases , there was a diagnostic dilemma and calretinin was used . ganglion cells were found in 3 specimens and nerve fibers in 5 . in all 24 resected specimens , calretinin correlated with the findings on h and e staining.conclusions:calretinin was extremely useful in solving the suspicious and indeterminate cases of hd . it can serve as a valuable cost - effective diagnostic aid in the centers where acetylcholinesterase enzyme histochemistry is not available .

please summarize the articles given below

conversion disorder has one or more symptoms that affect voluntary motor or sensory function suggesting a neurological or other medical condition , but they are inconsistent with known neurological or musculoskeletal pathologies . instead , the symptoms are due to an unconscious expression of a psychological conflict or need . the symptoms are often reinforced by social support from family and friends or by avoiding underlying emotional stress . the symptoms of patients with conversion disorder can be debilitating and include paralysis of one or more limbs , ataxia , tremors , tics , and dystonia . many other names are used to describe this disorder are functional gait disorder , hysterical paralysis , psychosomatic disorder , conversion reaction , and chronic neurosis . the disorder is more common in adolescence than in childhood . despite conversion disorders long - documented history , it is often confused with other psychological disorders conversion disorder , remain diagnostic challenges for the clinicians . a 17-year - old female coming from mses who was premorbidly maintaining well came with complaints of asymmetrical repetitive flickering like movement of the right hand which started on the day of her 12 grade board exams . she was observed to have reduced sleep since 1 week before her exams and had relatively less communication with family members . on the day of her exams , by the time she got the question paper her whole of her right arm started having repetitive flickering movement vigorously , and she had to support her right arm with the left to write the exam and had come out of exam hall without completing the exam . within a few days , the abnormal movements had progressed to her right leg . informant said that she use to have crying spells and appear sad most of the time as she had not given the exams . she was treated with promethazine and trihexyphenidyl neuroimaging was done which was found to be normal . she showed some improvement after 20 days , but she was not completely resolved , on the day before the day of admission , she developed shivering over her whole body and was admitted to the intensive care unit . it was not associated with loss of consciousness , no urine or fecal incontinence , no frothing from the mouth , no tongue biting , and no up rolling of eyeball . electroencephalogram computed tomography and magnetic resonance imaging brain were done and were found to be normal . , it was found that she was an above average student in her class and that her family had too much expectation from her . she also said that her younger sister was always given more attention by her mother . her episodes were provoked when asked to write or hold a pen with her right hand , also when she was asked to walk without assistance . she was also observed to flex her right toe while walking and during stay in the hospital she was observed to be having a sudden onset of asymmetrical repetitive jerky movements of bilateral legs . routine hemogram , renal function test , liver function test blood sugar , lipid profile , and thyroid function were found to be normal . the patient was prescribed diazepam 4 mg per days and after 2 days it was increased to 6 mg per day , she showed gradual improvement . on the initial days of sessions , her symptoms got aggravated during the sessions and session had to be stopped in between . after few attempts , the patient had ventilated to us how her mother gives less importance to her when compared to her younger sister who is 6 years younger to her . the patient had also said that from her toddler stage till 10 standard she was living with her paternal grandmother and father , and now she moved to a different house along with her parents . her parents were also included in the sessions and her issues with her mother were discussed . the patient had gradually started walking without difficulty and frequency of abnormal movements had reduced . diazepam was tapered and stopped within a week and had been stable at the time of discharge . patient came for a follow - up after 2 weeks , and she had been maintaining well . the clinical picture is indicative of dissociative motor disorder f44.4 according to icd 10 . after taking a detailed history , it was clear that her parents were giving her more pressure to attain high marks in board exam . during interview whenever a patient was asked to hold a pen or to write her symptoms increased . patient was started on therapy sessions as well as low - dose diazepam . in the sessions , possible causes of these symptoms were discussed , and she was encouraged to hold the pen and write . her parents were also psychoeducated about the psychosomatic nature of the symptoms and advised to encourage her for a symptom - free lifestyle . they were also given an instruction not to pay attention to her complaints of physical nature . , patient was explained to her that if there is any problem in her nerves , it will be recorded in that study , along with that dose of diazepam was also increased to 6 from 4 mg . after the study , patient showed a dramatic improvement in her symptoms . failure of treatment in dissociative disorders occurs mostly when we can not identify the primary stressor or gain . by taking proper history and early identification of the stressor there are case reports where dissociative disorders are managed alone with therapy sessions , and the patient is taught to how to deal with stressful situations . nerve conduction study is a diagnostic test to evaluate the function , i.e. the electrical conduction of motor or sensory nerve of the human body . it can also be done along with needle electromyography to measure both nerve and muscle function . in this , the study is performed by electrical stimulation of a peripheral nerve and recording of a muscle supplied by this nerve . the time taken for electrical impulses to travel from the stimulation to the recording site is measured . in this patient , this procedure was well explained to the patient , and she showed marked improvement . conversion disorder , somatoform disorder , and malingering always remain a diagnostic challenges for the clinicians . the prompt history taking , identification of stressors , use of appropriate and validated physical examination manoeuvres , and coordination of care and information exchange between all family members and medical team may facilitate the expeditious care of these patients in a cost - effective manner . the existing literature supports a multidisciplinary treatment approach , with specific interventions , such as cognitive behavior therapy for cognitive restructuring and psychodynamic therapy for addressing symptom connections to trauma and dissociation . progressive nodular histiocytosis ( pnh ) is a rare normolipemic macrophage disorder first described by taunton et al . , in 1978 . it belongs to a subgroup of non - langerhans cell histiocytosis ( lchs ) , the juvenile xanthogranuloma ( jxg ) family , which includes xanthoma disseminatum ( xd ) , benign cephalic histiocytosis ( bch ) , multiple adult xanthogranuloma ( maxg ) and generalized eruptive histiocytosis ( geh ) . according to weitzman and jaffee , they present positive reaction to factor xiiia , cd68 , cd14 and negative reactions to cd1a and s-100 proteins . these disorders are difficult to categorize , primarily because of the diverse pathological findings and due to overlapping clinical and microscopic features . a 30-year - old gentleman presented to us with complaints of asymptomatic nodular skin lesions all over the body of 10 years duration . at the age of 20 years , he started developing few small skin - colored lesions on the bilateral peri - orbital areas . these lesions continued to increase in size over time and few lesions became pedunculated especially over the calves . along with the appearance of the cutaneous lesions , he also noticed a gradually progressive , bilateral painless loss of vision . he did not complain of itching , watering , photophobia or discharge from the eyes . he was diagnosed to have eale 's disease and underwent laser photocoagulation for the same . he developed premature cataracts of the eyes and was treated with phacoemulsification and posterior capsular intraocular lens implantation in both eyes . prior to presentation to us , he underwent intra - lesional steroid therapy using triamcinolone acetonide in the peri - orbital lesions with good response seen in smaller lesions but no effect on the larger lesions . the lesions at other sites were removed using various modalities like cryotherapy , radiosurgery and surgical excision of the larger , troublesome lesions . cutaneous examination revealed multiple , approximately 30 to 40 , yellowish to skin - colored , firm , non - tender papules and nodules ranging in diameter from 5 to 40 mm , over the face [ figure 1 ] , trunk , extremities , elbows , hands , palms and soles [ figure 2 ] in decreasing order of frequency . these lesions were located almost symmetrically over the peri - orbital area , mostly over the outer canthi , but also over the lower eyelids , leading to ectropion . the smaller lesions on the face were mounted on the skin , while the larger lesions on the calf area were pedunculated . papular and nodular lesions on the face and eyelid large nodules seen over the elbows , hand and sole visual acuity at the time of presentation was 6/18(r ) and 6/60(l ) . the clinical differential diagnoses considered at the time of presentation to us were multiple eruptive dermatofibromas , xanthoma disseminatum and pnh . blood examination revealed hemoglobin of 10.5 gm / dl with a microcytic hypochromic blood picture , total leukocyte count of 7200/mm and a normal differential leukocyte count . fasting lipid profile , renal , total serum proteins and albumin were normal with no reversal of the a : g ratio . a cellular tumor was seen centered in the dermis , composed of sheets of oval to spindle - shaped cells arranged haphazardly , in short fascicles and in a storiform pattern at places [ figures 3a - c ] . the spindle cells had oval to elongated benign looking nuclei with vesicular chromatin and small nucleoli . on immunohistochemistry the cells were positive for cd68 [ figure 4 ] but negative for s-100 , cd34 , cd21 , cd35 and hmb45 supporting a diagnosis of spindle cell histiocytic tumor . dab chromogen 100 based on the history , clinical examination and histopathological correlation , his dermatological disorder was diagnosed as pnh . he was started on tab imatinib 400 mg od and some of the lesions developed encrustation but it was stopped after 5 months as he continued to develop new lesions while on this drug . second - line treatment with pazopanib ( 800 mg od ) was started after stopping tab imatinib , in lines of soft tissue sarcoma . based at the age of the onset of the lesions , areas of the body involved , progression of disease , lab abnormality ( serum lipids ) , it is possible to differentiate pnh from other forms in the jxg family . benign cephalic histiocytosis and jxg usually occur in early childhood , but jxg has also been reported in adults and the lesions have a tendency to resolve spontaneously over a period of time . multiple adult xanthogranuloma is another important differential diagnosis of pnh which has similar features to jxg but occurs in adults . xanthoma disseminatum was ruled out based on the absence of mucosal and systemic involvement and with normal lipid profile as it usually presents with hyperchylomicronemia and hypertriglyceridemia and diabetes insipidus . since the accurate diagnosis of a specific disorder within the jxg subgroup is quite difficult , we made the diagnosis of pnh based on the history , presence of the typical skin lesions , progressive course and histopathological demonstration of spindle cells that were positive on immunohistochemistry for histiocyte marker , cd68 , but negative for s-100 . non - langerhan 's cell histiocytosis disorders are difficult to diagnose and our case presents another clinical expression of this variable and confusing disorder . to our knowledge this is the first case report of progressive nodular histiocytosis associated with eale 's disease .

conversion disorders are more prevalent in childhood and adolescence , especially in females . they are usually associated with stressors and symptoms usually reflect a means to avoid the stressor , or also with a primary and secondary gain . this case report involves a similar situation where a young girl was treated successfully with diazepam , therapeutic nerve conduction study , and behavioral psychotherapy .

please summarize the articles given below

desmoplastic fibroma ( df ) , a benign locally aggressive lesion of the bone is recognized as an intra - osseous counterpart of soft tissue fibromatosis and is usually seen affecting the long bones , pelvis and only occasionally presents itself as a jaw lesion . mandible is most commonly affected when compared to the maxilla and the cranium in the head and neck region . a systematic literature search of the pubmed database of national library of medicine using df and mandible as keywords revealed a total of 57 published cases occurring in the mandible alone from the year 19692014 . the cause for df is unknown and is stipulated to have a varied pathogenesis ranging from genetic , endocrine and traumatic factors to an exuberant reactive proliferation . when differentiating it from other neoplasms that behave aggressively , a history of expansion or perforation of the cortical plates along with the histopathological confirmation would be a pointer in the right direction . a 35-year - old female patient visited the department of oral medicine and radiology , with the chief complaint of slowly growing painless swelling in the left lower back tooth region since 3 years [ figure 1 ] . clinical extra - oral examination revealed expansion of the left inferior border of the mandible and intra - oral examination revealed a solitary bony hard swelling measuring about 4.0 cm 5.0 cm in size with obliteration of the left buccal vestibule in relation to 37 and 38 [ figure 2 ] . clinical image showing swelling of left side of lower jaw intra - oral photograph showing obliteration of the left buccal vestibule in relation to 37 , 38 a left lateral oblique view of radiograph showed multilocular radiolucencies with fine trabeculations leading to a soap bubble appearance extending from the left angle of the mandible to the mesial root of the mandibular left first molar . no displacement of teeth or resorption of the root was seen [ figure 3 ] . left lateral oblique view of radiograph showing multilocular radiolucencies a computerized tomography ( ct ) scan demonstrated buccal and lingual cortical plate expansion and a soap bubble appearance [ figure 4 ] . computed tomography scan showing buccal and lingual cortical plate expansion surgical excision of the lesion the hematoxylin and eosin stained tissue section showed hypo and hyper - cellular areas with proliferation of plump fibroblasts arranged in interlacing fascicles and dense collagen . focal areas of the section also revealed dense collagenous stroma with foci of hyalinization [ figure 8 ] . photomicrograph showing hypo - cellular and hyper - cellular areas with spindle cells arranged in interlacing fascicles ( h&e stain , 10 ) photomicrograph showing hyper - cellular area with proliferating plump fibroblasts , ( h&e stain , 20 ) photomicrograph showing proliferating plump , spindle - shaped fibroblasts in a collagenous stroma ( h&e stain , 40 ) photomicrograph showing a focus of dense collagenous stroma with focal areas of hyalinization ( h&e stain , 10 ) a final diagnosis of df was arrived at after histopathological examination . df is a rare , locally aggressive myofibroblastic benign tumor of connective tissue origin . as an intra - osseous lesion df was first described by jaffe in 1958 and named as df . in 1965 , the first report about a df of the jaw was presented by griffith und irby . the histologic criteria for df as defined by the world health organization is a rare benign bone tumor composed of spindle - shaped cells with minimal cytological atypia and abundant collagen production . desmoid tumor also called as aggressive fibromatosis , was described before df . about 69% of desmoid tumors are abdominal ; the extra - abdominal variety occurring in the bone is the df . although df can affect any age group , most patients are affected in the first three decades of life . in our case , the average age of patients at the time of the final diagnosis is 15.1 years . metaphysis of long bones especially tibia , scapula and femur are the most frequent sites of involvement . mandible is the fourth most common site of involvement and sex predilection remains unclear . in the mandible , the lesions tend to occur posteriorly at the ramus - angle region . this is similar to our case report , where the lesional tissue is in relation to the second and third molars . the symptoms are nonspecific including diffuse , moderate pain in the region of the tumor , both at rest and on movement or when bone bears any weight . in the maxillofacial region , dfs usually are painless , slow - growing firm masses . a similar history of a painless radiographic appearance may vary from uni - locular to multi - locular , with or without expansion or perforation of cortical plates according to frick et al . radiographs showed osteolytic lesions with coarsened ridge - like trabeculae in 63% of cases , osteolytic lesions in 24% of cases and mixed lytic and mildly sclerotic lesions in 13% cases . ct revealed radiolucent ( 65% ) or mixed radiolucent and mildly sclerotic ( 35% ) matrix patterns . the ct in our case clearly showed cortical expansion without any resorption or displacement of adjacent teeth . t1-weighted sequences in mri showed that the signal intensities within the lesions were isointense or hypointense to adjacent normal muscle . the hypocellular areas of the tumors with abundant collagen are responsible for the areas of t2-shortening while hyper - cellular parts filled with fibroblasts or necrotic areas are responsible for the higher intensity parts within the lesions . on gross examination , the desmoid tumor appears as firm , rubbery , white , nonencapsulated fibrous growth . histologically , the df contains mature fibrous connective tissue , low to variable cellularity and spindle - shaped fibroblasts / myofibroblasts with uniform long nuclei in an abundant stroma of collagenous matrix lacking cellular pleomorphism , nuclear hyperchromatism or mitoses . the differential diagnosis to be considered histologically would be spindle cell tumors of which low - grade fibrosarcoma is the most important . tumors such as fibrous histiocytoma , fibrous dysplasia , or a low - grade intra - osseous osteosarcoma ; tumor - like lesions such as aneurysmal bone cyst and the juvenile bone cyst can also present with a similar clinical picture . though fibrosarcoma exhibits a highly cellular stroma along with high grades of polymorphism and mitosis , the low - grade variant shows a collagen rich tissue with low cell count and no mitotic activity . this is very similar to the histopathological picture of the df and a definitive diagnosis is possible only with postoperative clinical development . found that df has no immunoreactivity of cd117 , estrogen and progesterone receptors ; and 50% cases showed positivity for muscle - specific markers and the -catenin pathway does not seem to have the same essential role in the tumorigenesis of df , as it has in desmoid type fibromatosis . found that the majority of the tumor cells express the mesenchymal marker vimentin and no immunoreactivity for antidesmin and anti - s-100 protein . df of maxilla or mandible with extra - osseous extensions is treated with complete excision including a margin of uninvolved soft tissue . the recurrence rate of about 40 - 47% is seen in lesions treated by curettage or intra - lesional resection making follow - up a necessity . nasopharyngeal carcinoma ( npc ) is an endemic disease within specific regions in the world . the highest incidence is found among southern chinese people , especially those of cantonese origin , whereas among caucasians from north american and other western countries it is sporadic . radiation therapy ( rt ) , alone or combined with chemotherapy , is a paramount approach as initial treatment option for npc . distant metastasis , however , remains one of the major problems after radical treatment in patients with locally advanced disease . we report a case of a 68-year - old patient with advanced npc who developed intrathoracic endotracheal metastasis after rt . we believe this to be the first reported case of intrathoracic endotracheal metastasis in an npc patient . a 68-year - old man presented at our in - patient department on september 21 , 2004 , with a 3-month history of headache and hearing loss . computed tomography ( ct ) revealed a nasopharyngeal mass extending into the left parapharyngeal space , left carotid sheath , and skull base . an enlarged cervical lymph node , about 2 2 cm , was found in the left level ii . pathology showed nasopharyngeal undifferentiated nonkeratinizing carcinoma . according to the 2002 american joint committee on cancer staging system , the patient received an initial dose of 66 gy by conventional rt and a boost dose of 10 gy by three - dimensional conformal radiation therapy ( 3d - crt ) to the primary site . prophylactic radiation was given to his bilateral neck with doses of 63.3 gy to the upper neck and 50 gy to the lower neck . however , 2 months later , a metastatic nodule about 1.5 1.1 cm was found in the left lower lobe of the lung . he received 4 cycles of chemotherapy with vinorelbine and cisplatin , 2 cycles of chemotherapy with docetaxel and cisplatin , and a 3d - crt dose of 66 gy to the nodule in 33 fractions over 6.5 weeks . thirty - four months after the initial rt , the patient presented with a cough and hemoptysis . ct showed the presence of an enlarged lymph node measuring approximately 1.5 1.5 cm in the para - aortic arch . 2 ) . immunohistochemical analysis found ck ( + + ) , ck7 ( - ) , ck20 ( - ) , ttf-1 ( - ) , and eber ( + + + ) , confirming the tumor 's nasopharyngeal origin . he was treated with conventional rt with anterior - posterior / posterior - anterior fields to 40 gy to his mediastinum . the patient tolerated the treatment well with no significant acute side effects and no treatment interruption . he died of nonmalignant disease with no signs of tumor recurrence in august 2008 , 2 years after treatment completion . metastatic tracheal tumors are extremely rare ; they usually arise from direct invasion by neighboring primary lesions such as carcinomas of the bronchus , larynx , thyroid , or mid - esophagus . similarly , tracheal metastasis from a very distant site has also been poorly documented and the upper trachea is the most frequently involved site . to the best of our knowledge , there is no report on intrathoracic endotracheal metastasis with nasopharyngeal origin . distant metastasis after treatment is the main problem in npc patients with advanced disease . in a large cohort study by lee et al . , 2,687 consecutive patients were irradiated with 6-mv photons , and the median total dose was 66 gy . after a median follow - up of 3.4 years , 732 patients ( 27% ) were found with progressive disease , 16% of whom had distant failure a predominant pattern of treatment failure . however , the specific sites of distant failure in that study were not given . yi et al . found the bone to be the most common site of distant metastasis , followed by the liver and the lung . the patient we presented here developed solitary metastasis both in the lung and in the para - aortic arch prior to the presence of an intrathoracic endotracheal lesion . it is not certain whether the secondary tracheal tumor is the consequence of the lung metastasis . anatomically , lung malignancies may spread to the mediastinum and result in mediastinal lymph node involvement through intrapulmonary and hilar lymphatic drainage . the enlarged tracheal nodule in this patient was not likely to be caused by direct invasion of the mediastinal lymph nodes since they were separated anatomically . the presence of endophytic tumor growth and the intact outer layer of the trachea found on ct images suggest that it was most likely a separate metastatic deposit . hemoptysis with coughing is the most common symptom in patients with endotracheal or endobronchial metastasis , with an incidence of 41 - 62% . although ct provides valuable information about the tumor location and its effect on the distal lung parenchyma , lymph node status and other metastatic lesions , and helps us to plan further management , bronchoscopy remains the gold standard for quickly establishing the diagnosis and management [ 8 , 9 ] . the appropriate management of patients with endotracheal metastases depends on tumor stage , tumor location , histopathology , patient 's performance , and coexisting disease(s ) . since these patients usually present with advanced disease , surgery should not be routinely performed unless the patient is in an emergency situation that needs prompt symptom relief . bronchoscopic treatment can be considered as an alternative to surgery to avoid excessive morbidity and mortality associated with the procedure . however , if the treatment is not emergent , other modalities such as brachytherapy , external beam radiotherapy and chemotherapy can be considered . in our case , long - term complete tumor control was achieved by conventional rt plus 3d - crt , suggesting external beam rt may be an appropriate management approach to achieve long - term tumor control for this disease .

desmoplastic fibroma ( df ) is a benign intra - osseous neoplasm , that is , recognized as the intra - osseous counterpart of soft tissue fibromatosis in both gnathic and extra - gnathic sites . it has a propensity for locally aggressive behavior and local recurrence . an occurrence of intra - osseous lesion other than that of odontogenic origin is rare in the jaws . in this case report , we define the clinico - pathological and radiographic features of df of the mandible in a 35-year - old female , who presented to the outpatient department with a 3-year history of a slowly expanding painless mass in the left mandibular posterior region . thus , we present a classic case of df exhibiting characteristic features along with a review of the literature .

please summarize the articles given below

disc herniation protrudes mediolaterally into the spinal canal , the migration of the lumbar intervertebral disc fragment to the posterior epidural space is a rare event . rapid advances in neurosurgical knowledge and technology are putting increased pressure on neurosurgeons to process huge quantities of information , with requirements for continuous learning and updating scientific knowledge and skills which are time - consuming but essential , and significant advances occurred in investigative methods such as magnetic resonance imaging and computerized tomography ( ct ) heralded a revolution in noninvasive imaging of the spinal disorder , this revolution leaded to increase the preoperative diagnosis of posterior epidural migrated lumbar disc , and 61 cases have been reported to date . we report the case of a 46-year - old woman presented with perforation of her ligamentum flavum ( lf ) by sequestrated posterior epidural lumbar intervertebral disc . to the best of our knowledge , there are no previously reported cases of perforation lf by a posterior epidural migrated sequester disc . a 46-year - old woman presented with left side radiculopathy started 2 weeks before admission . clinical examination revealed steppage gait and a strength score of three - fifth on dorsiflexion of feet . patellar reflex was depressed , and there were no sphincter dysfunction or no saddle anesthesia . magnetic resonance imaging showed a sequestrated disc fragment in the posterior epidural space of the left l4l5 level that compressed the dural sac [ figures 1 and 2 ] . axial magnetic resonance imaging sequestrated posterior epidural lumbar disc sagittal images of the case the patient underwent surgery using posterior approach before performing left l4 hemipartial laminectomy , perforation of lf by posterior epidural migrated lumbar disc was noted [ figure 3 ] . when the sequestered fragment was followed downward , it was clearly seen that the disc fragment was posteriorly and laterally compressing the l5 root from the axilla . the extruded disk fragment was gently removed without incising lf and l4l5 interspace was explored . operative picture shows the perforated ligamentum flavum by sequestrated posterior lumbar disc fragment postoperative computed tomography images of patient the patient underwent surgery using posterior approach before performing left l4 hemipartial laminectomy , perforation of lf by posterior epidural migrated lumbar disc was noted [ figure 3 ] . when the sequestered fragment was followed downward , it was clearly seen that the disc fragment was posteriorly and laterally compressing the l5 root from the axilla . the extruded disk fragment was gently removed without incising lf and l4l5 interspace was explored . operative picture shows the perforated ligamentum flavum by sequestrated posterior lumbar disc fragment postoperative computed tomography images of patient one of its causes is lumbar disc which may migrate superiorly , inferiorly , or laterally . posterior migration of sequestered disc fragment is very uncommon , but we first time report the perforation of lf by such a disc fragment . our case should not be surprised because the intervertebral disc is the larger of two types of weight - bearing joints that make up the repeating vertebral motion segments in the spine . . one of this structures is lf from the axis to sacrum extending downward from the lamina of the respective anatomic segment . the lf is thick and short and is symmetrical on both the left and right sides . on each side the upper attachment of the medial portion is to the lower half of the ventral surface of the lamina , and the attachment of the lateral portion is to the inferior aspect of the pedicle . the medial portion passes to the back of the next lower lamina and attaches to the upper quarter or so of the dorsal surface of that lamina . the lateral portion passes in front of the zygapophysial joint formed by the two vertebrae that the ligament connects . the most lateral fibers extend along the root of the superior articular process as far as the next lower pedicle to which they are attached . this part of the lateral portion of the lf has continuous fibrous connections with the synovium . this two layer anatomy of ligamentum flavum may have for its perforation . for entering the epidural space , surgeon should remove the superficial layer of the lf , and dissect the deep layer from its attachment to the anterosuperior portion of the caudal lamina , which can best be accomplished with the use of a small angled curette alone or with a kerrison rongeur . at each level however , our present case indicates that lateral part of flavum may not be as strong as medial part . to the best of our knowledge , this is the first case characterizing the perforation of lf by a lumbar disc fragment . this degenerative process is multifactorial , irreversible and may be associated with a mechanical dysfunction . our case is 46 years old , has no degenerative , spinal stenosis or age - related changes of her spine . in this case , the lf was perforated by sequestrated disc at the left side . in literature , this point for epidural disc migration is interesting ; we agree that this point should be investigated . human body , which appears symmetrical along the midline grossly , is , in fact , asymmetrical both morphologically and physiologically . low back pain has long been connected to postural and structural asymmetries . while externally there is a difference in bilateral dimensions of various body parts and musculature , internally , it is due to asymmetrical positioning of viscera as well as variations in bilateral skeletal dimensions . more stress and strain on the dominant side may cause differences between the sides , often referred to as directional asymmetry . wolff 's law says bone formation occurs along lines of stress the bones and muscles respond by growing more vigorously and increasing in density on exposure to repeated high levels of mechanical loading . left - sided epidural disc herniations in reported human studies may be explained by this way . asymmetric features of epidural disc migration , and should be investigated , because treatment of spine pathologies should consider anatomic rule . posterior epidural migrated lumbar disc fragments are an extremely rare disorder . to the best of our knowledge , there are no previously reported cases of perforation lf by a posterior epidural migrated sequester disc . our case is important if indeed one is the first to report something and that something is of value . a 65-year - old man with intermittent , colicky periumbilical pain which first occurred two months earlier was admitted to hospital . he had an eight - year history of congestive heart failure caused by mitral valvular regurgitation and atrial fibrillation . he was nonalcoholic , and there was no history of diarrhea , hematochezia , or melena . vital signs at admission were stable , and laboratory findings including white blood cell count , a liver function test and electrolytic balance were within the normal ranges . electrocardiography revealed atrial fibrillation , and chest radiography demonstrated cardiomegaly ( not shown ) . to exclude acute appendicitis , initial ultrasonography ( us ) was performed , and this demonstrated diffuse , segmental , concentric wall thickening of the terminal ileum just proximal to the ileocecal valve . nonspecific ileitis , crohn 's disease , intestinal tuberculosis or ischemic enteritis were suggested as possible causes of the bowel wall thickening , and in order to evaluate the terminal ileum , colonoscopic examination was performed . the ascending colon was found to be completely obstructed by a circumferential mass lesion , and the colonoscopic fiber could not be advanced further . subsequent ct scanning showed a markedly dilated small bowel and ascending colon , with concentric , hyperattenuating , focal wall thickening in the hepatic flexure of the ascending colon ( fig . in addition , the terminal ileum was dilated and showed diffuse , concentric wall thickening of its long segments with heterogeneous contrast enhancement . in the thickened wall , there appeared to be several possible diagnoses , including ischemic enterocolitis caused by thromboembolism of mesenteric vessels arising from atrial fibrillation , inflammatory bowel disease involving the ascending colon and terminal ileum , and ischemic or infectious enteritis associated with colon cancer . stool culture yielded lactose - fermenting gram - negative bacillus , urine culture yielded citrobacter freundii , and gram staining of urine revealed the presence of gram - negative rods ; no organisms were isolated from blood cultures . in addition to conservative management of congestive heart failure , the patient underwent antibiotic therapy with amoxacillin , tobramycin or aztreonam for two weeks and ciprofloxacin for several days . symptoms such as abdominal pain ameliorated , the level of bowel sound decreased , and laboratory findings continued to be within normal ranges . vital signs were stable , except for intermittent fever of up to 38.2 until 30 days after admission . at this time , , the hepatic flexure of the ascending colon was found to be completely obstructed by a hard concentric mass , and about 15 cm of the terminal ileum , just proximal to the ileocecal valve , was markedly dilated and diffusely thickened . a cut section of the thickened terminal ileum revealed marked submucosal edema to a depth of approximately 10 mm , though there was no evidence of mucosal lesion . microscopic examination also showed that the mucosal folds of thickened ileal loop were blunted by submucosal edema and there was extensive inflammatory reaction , with infiltrations of neutrophils . in some areas of the thickened bowel wall neutrophil infiltration extended into the subjacent muscular layer and even to the serosa ( fig . 1d ) . the inflammatory reactions provided no evidence of granuloma formation , and the histologic findings were consistent with phlegmonous enteritis phlegmonous enterocolitis is a rare inflammatory bowel disease with a high mortality rate of at least 60% . the association between this disease entity and a variety of liver diseases has been well documented ( 1 - 3 ) , though cases associated with lobar pneumonia , pharyngitis , infected peritoneojugular venous shunt and septicemia have been reported , and it has also occurred in healthy individuals ( 1 , 4 - 6 ) . several kinds of pathognomic bacteria have been demonstrated in culture or histologically ( 1 - 6 ) : gram staining of intestinal lesions has revealed a variety of entities such as streptococci , gram - positive cocci , and gram - negative or -positive rods . the mortality rate associated with this disease continues to be high due to delayed diagnosis ( 1 - 5 ) . thus , most cases reported in the literature were discovered at autopsy or after the examination of surgical specimens following surgery ( 1 - 6 ) . some reports have suggested that earlier diagnosis and surgical resection of diseased bowel , together with the use of broad- spectrum antibiotics , has led to a good outcome ( 1 , 6 ) . the pathogenesis of this disease entity is not clear : ito et al . first , the direct toxic effect of alcohol may affect the gastrointestinal tract , and prolonged alcohol ingestion leading to changes in the intestinal mucosa , with increased intestinal permeability ; subsequent penetration of the lamina propria by antigens ( organisms ) from the intestinal lumen results in a local antibody response . second , in chronic alcoholism , the systemic and mucosal immune mechanisms are impaired , and this may exacerbate bacterial infection . it is not known why the organisms involved in phlegmonous enteritis are confined to the submucosa . bowel wall edema associated with portal hypertension has been described in liver cirrhosis , and the loose connective tissue in the submucosa can be excellent soil for the rapid and diffuse spread of the organisms involved in an episode of bacteremia ( 5 ) . first , the patient was not alcoholic and had no evidence of liver disease or septicemia . second , his clinical course was silent for a long period , being discovered only at surgery ; previously reported cases , on the other hand , manifested an acute and serious clinical course , one which led even to sudden death . in our case , the early use of broad - spectrum antibiotics might have helped his condition to persist . the literature in english includes only one case report dealing with the radiologic findings pertaining to this disease . mooney et al . ( 6 ) reported the ct findings in one case , in which only nonspecific small bowel wall thickening with a small amount of ascites was noted . in our case , the terminal ileum showed marked wall thickening , and thumbprinting and blunted mucosal folds were revealed by ultrasonography . the hypoattenuating focal areas in this thickened wall , shown at microscopic examination to be submucosal abscesses , are , in our case , thought to provide a clue to the diagnosis of phelgmonous enteritis .

disc fragments are well known to migrate to superior , inferior , or lateral sites in the anterior epidural space , posterior epidural migrated lumbar disc fragments is an extremely rare disorder , 61 cases have been reported to date . however , there were no cases with perforated ligamentum flavum ( lf ) . we report a different case with perforation of ligamentum ligamentum by disc fragment . to the best of our knowledge , this is the first report of perforation lf by a posterior epidural migrated sequester disc .

please summarize the articles given below

neuroblastoma is the most common extracranial solid tumor in childhood and accounts for 7% of malignancies in patients younger than 15 years . it originates from the sympathetic nervous system , and in particular from a developing and incompletely committed precursor cell derived from neural - crest tissues . neuroblastoma occurs sporadically in 98% of cases ; a genetic defect is involved in the rare familial neuroblastoma . in the subset of cases of neuroblastoma presenting in the context of other congenital abnormalities of the neural crest , the association with a germline loss - of - function mutation of homeobox gene phox2b has been demonstrated ; on the other hand , familial neuroblastoma not associated with other congenital disorders of the neural crest arises from activating mutations of the anaplastic lymphoma kinase ( alk ) oncogene , whose somatic mutations are , however , observed in sporadic cases of the disease . due to the widespread presence of the sympathetic nervous tissue in various body organs and apparatus , the presenting features of neuroblastoma may be variable , depending not only on the location of the primary tumor but also on the frequent metastases . furthermore , in young children , neuroblastoma exceptionally manifests with paraneoplastic opsoclonus - myoclonus - ataxia ( poma ) due to antineuronal nuclear ( anti - hu ) antibodies which have also been associated with gastrointestinal disturbances , such as constipation , gut dismotility and paralytic ileus . on the contrary , watery diarrhea due to aberrant vasoactive intestinal peptide secretion proteinuria is not part of the presenting features of childhood cancer . in patients with neuroblastoma we report a case where proteinuria was the initial reason for medical evaluation in a child with neuroblastoma . a 10-month - old girl was admitted to our hospital for investigations for nephrotic - range proteinuria . she was born to unrelated , italian , healthy parents , by spontaneous delivery at the 38th week of an uncomplicated pregnancy ; her birth weight was 3,110 g. her growth and development were normal until the age of nine months , when she began vomiting , feeding poorly , sweating copiously , and losing weight . on admission , her weight was 7,220 g ( < 3th percentile ) , reduced from having previously reached 8,450 g ; her length was 68 cm ; her body temperature was 37.5c with a heart rate of 150 beats / min and respiratory rate of 46 breaths / min ; blood pressure was normal on repeated measurements ( 82/43 mm hg ) . complete blood cell count showed leukocytes 12,800/mm , red cell count 7,160,000/mm , hemoglobin 15.7 g / dl , platelets 501,000/mm . blood urea nitrogen was 28 mg / dl ( 10.23 mmol / l ) , creatinine 1.5 mg / dl ( 132.60 mol / l ) , glucose 92 mg / dl ( 5.1 mmol / l ) , ast 25 iu / l , alt 42 iu / l ; total plasma protein level was 7.9 g / dl , with albumin 56.9% ( 4.2 g / dl ) , a1 7.3% , a2 21.3% , 1 6.3% , 2 3.4% , 4.8% ; uric acid was 8.5 mg / dl , sodium 138 mmol / l , potassium 3.2 mmol / l , chloride 88 mmol / l , venous ph 7.55 with a partial pressure of carbon dioxide of 29.2 mm hg ( probably due to crying and hyperventilation ) , bicarbonate 27.8 mmol / l and be + 4 . the at iii activity was 100% , prothrombin activity 100% and aptt 29 s , serum lactate dehydrogenase was 376 iu / l and ferritin 5.9 mol / l ( normal value for age 7140 mol / l ) . she had polyuria and hypostenuria ( diuresis 125 ml / kg/24 h ) ; urinalysis revealed nephrotic - range proteinuria ( 6,100 mg/24 h ) with albuminuria 4,540 mg/24 h , urinary loss of igg 107 mg/24 h , and a1 microglobulin 29.4 mg/24 h ; mild glucosuria ( 39 mg / dl ) and aminoaciduria were also found , without hematuria or casts ; urinary ph was 7.5 and urinary density 1,005 . electrocardiogram revealed sinus tachycardia 180 beats / min ; echocardiogram showed very mild concentric left ventricular hypertrophy , however , without pathological features . an endocrinologic evaluation revealed increased plasma renin ( 8 g / l / h ; reference range 1.0 - 4.5 g / l / h ) and aldosterone ( 4.83 nmol / l ; reference range 0.1 - 0.8 nmol / l ) levels , while cortisol and thyroid hormones were within the normal range ; plasma erythropoietin was 42.6 mu / ml ( reference range 3.7 - 37.5 mu / ml ) . urinary excretion of vanillylmandelic acid was increased to 11 mg/24 h ( 1.57 mg / kg/24 h ; reference range 0.1 - 0.18 mg / kg/24 h ) , while catecholamines were in the normal range , except for the normetanephrine and noradrenaline , which were also elevated ( normetanephrine 1,537 g/24 h , reference range 88 - 440 g/24 h ; noradrenaline 120 g/24 h , reference range 010 g/24 h ) . the ultrasound abdomen examination revealed a solid , suprarenal mass on the left side , sized 2 2 cm ; the right kidney showed slightly increased echogenicity on the upper side . high - resolution ct showed an abdominal mass sized 5 5.8 10.7 cm , localized between the vertebral bodies d9 and l3 and the aorta , enveloping the celiac tripod , the superior mesenteric artery and bilaterally the renal vessels . the upper half of the right kidney showed an area of reduced perfusion , while the left kidney showed abnormal tissue density . adrenal glands were not identifiable in the context of the tumor mass , in which some calcifications were recognizable . histopathology showed a tumor with a low grade of neuroblastic differentiation , with mitosis - karyorrhexis index ( < 2% ) and elevated mitotic activity . in this patient , the presenting signs and symptoms of neuroblastoma included severe dehydration , polyglobulia , tubulointerstitial damage with acute kidney injury and renal insufficiency , electrolyte and acid - base unbalancing and heavy glomerular proteinuria . although diarrhea and dehydration may be observed at presentation of neuroblastoma , tubular alterations are definitely unusual . we have been able to identify only one case previously : a 4-year - old boy affected by neuroblastoma presenting with nephrotic syndrome has been described in 1979 and renal histology demonstrated membranous glomerulonephritis due to immune complex . on the other hand , poma syndrome and gastrointestinal disturbances are associated with anti - hu antibodies , and furthermore , the development of immune complex has been demonstrated in mice with c1300 neuroblastoma tumors confirming the tendency of neuroblastoma to produce immunologic paraneoplastic diseases . nevertheless , in a recent study performed on a broad series of adults with solid tumors , the prevalence of rheumatic syndromes was only 2.65% , and none of them manifested nephropathy , which shows the exceptionality of those manifestations also in adult patients . in our opinion , the physiopathology of the complex clinical picture of the case we describe herein is not ascribable to autoimmune pathogenesis , but rather to a hemodynamic mechanism , subsequently complicated by a series of other physiopathologic phenomena . the initial event was the development of the tumor mass from the adrenal glands and its extension upwards to envelope the great abdominal blood vessels and bilaterally the renal vessels . the meaningful feature is that the disruption of renal blood supply and the hemodynamic consequences have been different in the various areas of renal tissue , as revealed by sonography and ct findings . so , local increased intraglomerular pressure could prime the development of the hyponatremic - hypertensive syndrome , characterized by glomerular hyperfiltration with proteinuria , polyuria , acid - base and electrolyte unbalancing , as rarely described in children with renovascular systemic hypertension [ 9 , 10 , 11 ] . although in those circumstances , as expected , the consequence of the proteinuria is the development of nephrotic syndrome , in other cases the plasma albumin inexplicably remains at a normal level , even in case of lasting and massive albuminuria , as in our patient [ 11 , 12 , 13 , 14 ] . we could speculate that the severe dehydration , following copious sweating , vomiting and polyuria , caused such hypovolemia with hemoconcentration that plasma albumin concentration persisted beyond the threshold of edema . also the polyglobulia could be explained by the same mechanism , even if another factor could have been the increased production of erythropoietin , probably stimulated by local renal parenchyma hypoxia . hypovolemia was also responsible for the mild activation of the renin - angiotensin - aldosterone system and perhaps for metabolic alkalosis with hypochloremia and hypokalemia , but the loss of chloride through sweating was likely the most important cause of this phenomenon . hypovolemia and the disruption of local renal blood circulation caused acute kidney injury and the signs and symptoms of proximal tubular damage , as glucosuria and aminoaciduria . on the other hand , the profound hypochloremia was the cause of the metabolic alkalosis , instead of metabolic acidosis typically associated with proximal tubular damage . increased vasoactive amine secretion from neuroblastoma is not infrequent , and may cause elevated , although usually not severe , hypertension . in conclusion , in our 10-month - old child , alteration of the renal function , at both the glomerular and tubular levels , were the presenting features of neuroblastoma , resulting from multiple pathogenic mechanisms . our report furthermore emphasizes the high variability and various facets of the clinical manifestations of neuroblastoma . a 57-year - old woman was admitted to our hospital for further evaluation of a mass located in the upper abdomen , and this mass was incidentally detected by an abdominal ultrasound exam during a medical checkup . the patient presented with recurrent abdominal distension without any other complaints . her medical history was unremarkable except for cholecystolithiasis and a fatty liver that were diagnosed two years previously . on admission , the laboratory tests showed an extremely high level of -fetoprotein ( afp ) > 35,350 ng / ml ( reference : < 20 ng / ml ) . the carbohydrate antigen ( ca ) 19 - 9 , ca125 , blood amylase , aspartate transferase ( ast ) , alanine transferase ( alt ) and bilirubin levels were within the normal ranges . pre - contrast and contrast - enhanced spiral ct of the abdomen was performed , including the arterial phase , portal venous phase and equilibrium phase following bolus injection of intravenous contrast material . the pre - contrast ct scan revealed a 4.5 cm in diameter , smooth - marginated , solitary , heterogeneous mass occupying the pancreatic neck and body ( fig . two hypodense lesions were discovered in the liver and they measured 4.7 4.3 cm and 7.0 6.8 cm , respectively , displaying minimal diffuse heterogeneous enhancement ( fig . the high density within the large mass in the left hepatic lobe indicated central hemorrhage . since pancreatic cancer is sometimes associated with an elevated afp level ( although not so high as in this patient ) and more often the hepatic metastases , an initial diagnosis of conventional pancreatic adenocarcinoma was made . the patient underwent neoadjuvant chemotherapy that consisted of fluorouracil , tetrahydrofolate and cisplatin , yet this had little effect and the serum afp level did not decrease . an encapsulated mass measuring about 4 cm in diameter was discovered in the pancreatic neck and body . in addition , two metastatic lesions 5.0 4.0 cm and 4.0 3.0 cm in size , were found in the iii , iv and vii hepatic segments . tumor resection that included the primary pancreatic neoplasm and the right hepatic metastatic mass was carried out . for the left hepatic mass , hepatic segmentectomy ( segments ii and iii and part of segment iv ) was performed . the immunohistochemical examination demonstrated that the tumor cells were diffusely positive for afp , placental alkaline phosphatase ( plap ) and carcino - embryonic antigen ( cea ) , but they were negative for ca19 - 9 . the afp level was notably decreased after surgery ( 2,097 , > 1,200 , > 500 ng / ml on the postoperative 3rd , 9th and 25th day , respectively ) . to exclude the existence of primary gonadal germ cell tumor , further clinical and ultrasound examinations were conducted on the genital system of this patient , but no abnormality was found . a month after the operation , the patient received systematic chemotherapy with the bep regimen ( bleomycin , etoposide and cisplatin ) . a total of three cycles of therapy were performed with an interval of three weeks between cycles . during chemotherapy , the ct examination was repeated and it revealed no tumor recurrence in the pancreas . of all the genital tumors , yolk sac tumors are relatively uncommon and they are mostly discovered in infants and adolescents ( median age , 19 years ) ( 3 ) . although they typically arise from the gonads , ysts have already been reported in many extragonadal sites . generally , the mediastinum , the sacrococcygeal region , the brain , the retroperitoneal space and the female reproductive tract are relatively common locations . exceedingly rare sites such as liver , kidney , omentum , stomach , spinal cord , etc have also been previously reported ( 4 - 6 ) . to the best of our knowledge , there has been no report about primary yst arising in the pancreas , and especially occurring in a 57-year - old woman . because of their rarity , there has been no systematic study on the ct features of extragonadal ysts with a large number of cases . in a previous case report , this tumor was usually described as a large , multi - lobulated , solid heterogeneous , hypodense mass that showed moderate and heterogeneous enhancement ( 7 ) . central necrotic and/or cystic changes were observed on the ct images by wong et al . choi et al . ( 9 ) evaluated the ct findings of ysts of the ovary in ten patients , and they characterized these tumors as large , smooth - marginated , well enhancing , solid masses with a cystic , hemorrhagic or necrotic portion . in the present case , the non - contrast ct scan showed an oval - shaped , heterogeneous soft - tissue mass with a central hypodense area , and the mass displayed moderate inhomogeneous enhancement . the imaging findings were verified by the morphological observations of an encapsulated tumor with focal necrosis . central hemorrhage was detected in the hepatic metastatic lesion , which might be attributed to the notable proliferative and vascularization activities of the tumor cells . in some studies , ysts have shown infiltrative growth into the adjacent soft tissues , and higher magnification revealed a microcystic growth pattern of tumor cells that formed reticular or glandular structures , which contributed to the cystic or necrotic changes seen on the ct images . since ysts usually show high malignancy , the duration from the onset of symptoms to the admission is always short and metastasis may already exist at the time of the patient 's admission , like the case presented here . an extremely high afp level may be a clue for making the diagnosis of ysts . because of the extreme rarity of primary yst of the pancreas , metastatic germ cell tumor from the gonads or other primary or metastatic pancreatic neoplasms should be excluded . , we present here the first case of primary yst arising in the pancreas with hepatic metastasis in an adult woman . this unique case is of value for reminding radiologists and oncologists to be aware of the diagnosis of yst when a patient presents with an extremely high level of afp and an oval - shaped or multilobulated , heterogeneous , soft tissue mass is discovered in the pancreas displaying moderate and inhomogeneous enhancement on ct images . making a careful differential diagnosis

neuroblastoma is the most common extracranial solid tumor in childhood . its presenting signs and symptoms may be highly variable , depending on the location of the primary tumor and its local or metastatic diffusion and , rarely , with paraneoplastic syndrome such as opsoclonus - myoclonus - ataxia syndrome and gastrointestinal disturbances , due to autoantibodies or to aberrant secretion of vasoactive intestinal peptide . herein we describe a 10-month - old child with neuroblastoma presenting with a complex clinical picture characterized by acute kidney injury manifested by renal insufficiency and signs and symptoms of tubulointerstitial damage , with polyuria , polydipsia , glucosuria , aminoaciduria and hypochloremic metabolic alkalosis , and of glomerular damage with heavy proteinuria . imaging study documented a suprarenal mass enveloping the aorta and its abdominal and renal ramifications and bilaterally renal veins . this clinical picture shows some analogies with the hyponatremic - hypertensive syndrome concerning the renovascular disease ; however , in absence of systemic arterial hypertension , the heavy proteinuria and the polyuria could be explained by sectional increased intraglomerular pressure , due to local renal blood vessels constriction . hypochloremic metabolic alkalosis probably developed because of local production of renin , responsible of renin - angiotensin - aldosterone system activation , but above all because of chloride loss through sweating . the long lasting dehydration , due to vomiting , sweating and polyuria , caused prolonged prerenal failure evolving in proximal tubular damage manifestations .

please summarize the articles given below

the potential relevance of endothelial activation biomarkers to sepsis has been raised in both this journal and others [ 1 - 3 ] . biomarkers for sepsis associated with the endothelial glycocalyx remain relatively unknown , however , and this commentary attempts to reverse this omission . the term glycocalyx ( sweet husk ) was introduced 50 years ago to describe an extracellular polysaccharide coating of cells . whilst electron microscopy revealed that the luminal surface of the endothelium expressed this structure , it was thought to be of little consequence or functional significance . what has become increasingly evident , however , is that the glycocalyx - now estimated to extend up to 1 m from the endothelial cell membrane - represents a substantial intravascular compartment contributing significantly to vascular wall homeostasis . specifically , roles of the glycocalyx include maintenance of the vascular permeability barrier , mediation of shear - stress - dependent nitric oxide production , and housing vascular protective enzymes ( for example , superoxide dismutase ) and a wide array of coagulation inhibition factors such as antithrombin , the protein c system and tissue factor pathway inhibitor . the glycocalyx also modulates the inflammatory response by preventing leukocyte adhesion and binding numerous ligands , including chemokines , cytokines and growth factors [ 4 - 6 ] . negatively charged and with a mesh - like structure , the endothelial glycocalyx is comprised of glycoproteins , proteoglycans , glycosaminoglycans ( gags ) and associated plasma proteins including albumin . proteoglycans consisting of a core membrane - bound protein of the syndecan or glypican families with attached heparan or chondroitin sulphate gag side chains are a prominent feature . hyaluronan - a nonsulphated , uncharged gag with water - retaining properties - is attached or adsorbed onto other cell - surface anchored proteins ( for example , cd44 ) and helps to stabilise the glycocalyx structure . alteration in the composition of the glycocalyx following exposure to an inflammatory insult is one of the earliest features of endothelial activation . it is now accepted that tnf , oxidised lipoproteins , lipopolysaccharide , thrombin , ischaemia / reperfusion , hyperglycaemia and growth factors all cause glycocalyx disruption via the action of proteases - leading either to partial degradation with release of gag side chains , or to more severe damage characterised by shedding of core proteins . several studies have evaluated circulating levels of syndecan-1 and gags in patients with sepsis [ 10 - 13 ] . plasma gag levels were higher in patients with septic shock than in matched controls , and were significantly higher in nonsurvivors . in the same study , syndecan-1 levels were also increased and correlated with the sequential organ failure assessment score . in an additional study of 150 patients either with severe sepsis or septic shock or post - abdominal surgery without the systemic inflammatory response syndrome and healthy volunteers , significant increases in plasma syndecan-1 and heparan sulphate were observed in the sepsis and surgery groups . the highest syndecan-1 levels were detected in patients with sepsis and correlated with those of il-6 . a further study showed greater syndecan-1 levels in patients with septic shock compared with healthy controls , together with a positive correlation with vascular adhesion protein-1 and with day 1 sequential organ failure assessment scores . finally , hyaluronan levels , in addition to those of syndecan-1 and heparan sulphate , have been shown to increase with severity of sepsis . whilst the care of patients with sepsis has improved over the last decade the failure of two promising drugs , eritoran tetrasodium and drotrecogin alfa , to confer significant reduction in mortality suggests that novel approaches to sepsis research are required . given the fundamental , but perhaps relatively overlooked , role of the endothelial glycocalyx in regulating vascular integrity and functions central to the pathophysiology of sepsis , identifying interventions aimed at protecting or repairing it might prove a promising therapeutic target . some clinically established therapies used for the treatment of sepsis ( such as glucose control and steroid administration ) and also approaches used in experimental studies ( such as tnf inhibition , antithrombin iii , infusion of albumin and avoidance of natriuretic peptide release ) are known to reduce glycocalyx disruption . however , drugs that might specifically increase the synthesis of glycocalyx components , refurbish the glycocalyx or selectively prevent protease degradation are not currently available . future endeavours in the field of sepsis research , which are urgently required , should not only include components of the endothelial glycocalyx in the list of biomarkers , but also consider their potential as therapeutic targets for the development of new therapies . idiopathic intracranial hypertension ( iih ) , previously termed pseudotumor cerebri and benign intracranial hypertension , is a syndrome of increased intracranial pressure ( icp ) of unknown etiology , without clinical , laboratory or radiological evidence of intracranial pathology . while the exact pathogenesis remains unclear , the chronic increased icp in this condition may lead to morphological intracranial changes . though traditionally performed to exclude lesions that produce intracranial hypertension , imaging in recent years has been shown to detect changes involving the orbit , sella and sinovenous system , providing important clues to the diagnosis . we describe the case of a lady with chronic headache , where magnetic resonance imaging ( mri ) showed features suggestive of iih , and in addition , highlight the dramatic reversal of these findings following csf drainage , allowing diagnosis to be made with certainty . a 45-year - old housewife presented to the neurology outpatient department with chronic headache for 10 years and recent aggravation for 1 month . though she ignored these symptoms for long , they now hampered her daily household activities . ophthalmological examination showed 6/6 vision in both the eyes , a normal fundus and no visual field defect on perimetry . saggital oblique images through the optic nerve revealed distended perioptic subarachnoid space as well as buckling of the orbital portion of the optic nerve [ figure 1a ] . a partial empty sella with postero - inferiorly compressed pituitary having a concave superior border and posteriorly displaced infundibulum was also noted [ figure 2a ] . tof venography showed paucity of the cortical veins and non - visualization of the right transverse sinus ( ts ) [ figure 3a ] . lumbar puncture ( lp ) done following the mr study showed raised opening pressure of csf of 28 cm of water . twenty milliliters of csf fluid was removed and sent for biochemical and microbiological examination , which was normal . following csf withdrawal , significant improvement in symptoms was noted . repeat mri done 3 days later showed straightening of the intraorbital optic nerve and reduction in perioptic subarachnoid space [ figure 1b ] . in addition , restoration of the infundibular position with a normal appearing pituitary having a flat superior margin was seen [ figure 2b ] . mr tof showed improved visualization of the cortical veins and right ts [ figure 3b ] . the patient was discharged on acetazolamide , and on follow - up at 2 and 6 months , was asymptomatic . t2 fat saturated oblique saggital image through the optic nerve ( a , b ) shows the optic nerve buckling with prominent perioptic subarachnoid space ( a ) . post - lp , the optic nerve straightens with some reduction in the perioptic fluid ( b ) saggital images of the sella show " partial empty sella " ( a ) , which , following csf drainage , is normalized ( b ) paucity of the cortical veins and non visualized right transverse sinus ( a ) is reversed following csf drainage with distension of the sinuses and better visualization of the cortical veins ( b ) in this tof venogram . possible explanations suggest a lesion of the hematoencephalic barrier with increased interstitial fluid . increased movement of the interstitial fluid into the ventricles with equivalent resorption of csf and subsequent rapid venous efflux maintains the flow of intracranial fluids , allowing for the raised icp . changes observed in the orbit in iih are a consequence of the direct transmission of the raised csf pressure . these may be appreciated on mr imaging as prominent perioptic subarachnoid space and vertical orbital optic nerve tortuousity . additional orbital findings include intraocular protrusion of the prelaminar optic nerve and posterior scleral flattening . with severe or chronic pressure , permanent degeneration of varying degrees similarly , owing to the progressive rise of pressures in patients with iih , sellar changes may be seen . results from arachnocele herniation through a defect in the diaphragma sella with subsequent pituitary compression and posterior infundibular stalk displacement . acetazolamide and other diuretics including furesemide have been used in the medical management of iih . lumboperitoneal shunting may be required in cases unresponsive to medication , while patients with deteriorating vision may need optic nerve sheath fenestration . both the orbital and pituitary changes have shown reversibility following csf drainage . this dramatic flip - flop with straightening of the optic nerve , normalization of the pituitary appearance and restoration of the pituitary stalk position was similarly observed in our patient following the lp.cc mr imaging in iih may additionally show bilateral ts narrowing which may cause venous outflow obstruction . whether the ts narrowing is the cause or effect is still uncertain . theories have implicated congenital stenosis as the occasional primary cause of iih . as an effect of iih , stenosis may present either as a long , smooth , tapered narrowing attributed to cerebral baedema , or as an fd raised csf pressures . venography in our patient showed paucity of the cortical veins in the pre - lp mr with improved visualization post - lp . rohr et al , proposed mrv pre- and post - csf diversion in suspected iih patients to distinguish reversible and fixed transverse sinuses stenosis . in conclusion , mr imaging has an important role in evaluation and follow - up of patients with iih , avoiding repeated lumbar punctures to monitor pressures . signs in iih involving the optic nerve , posterior sclera , pituitary , and sinovenous system are a direct consequence of the longstanding raised icps in this disease . the reversibility of these signs on mr and tof venogram following csf drainage not only confirms the diagnosis of iih but also suggests a decrease in csf pressure indicating a positive response to therapy . in addition , it also aids in differentiating venous sinus thrombosis from reversible stenosis in iih .

sepsis is the third largest cause of death in industrialised countries , but treatment remains largely supportive and effective therapeutic interventions are urgently needed . disruption and dysfunction of the microvascular endothelium leading directly or indirectly to multiple organ failure are now recognised to underpin the pathophysiology of sepsis . biomarkers of endothelial activation may therefore assume an important role in guiding future research efforts . we suggest that integral to this approach is the investigation and evaluation of endothelial glycocalyx biomarkers , not only as indicators of the pathogenic process but also to inform the development of pharmacological and other therapies .

please summarize the articles given below

the term mucosa - associated lymphoid tissue ( malt ) lymphoma was first coined by isaacson and wright1 in 1983 . malt lymphomas can occur in many locations , including the gastrointestinal tract , salivary glands , thyroid , lung , and breast . it is histologically characterized by lymphoepithelial lesions and lymphoplasmic epithelial invasion.1,2 lymphomas that occur in the colon account for 10% to 20% of lymphomas of the gastrointestinal tract , 2.5% of all lymphomas , and 0.2% to 0.6% of colorectal malignant tumors , and thus , are rare.2,3 most of the colonic malt lymphomas present as a nonpedunculated protruding polypoid mass and/or ulceration . cases of primary colonic malt lymphoma reported in korea have presented as multiple submucosal tumors ( one case),4 a nonpedunculated protruding polypoid mass ( four cases),5,6,7,8 obstructive lesions of the colon caused by mucosal edema or a tumor ( two cases),9,10 or mucosal discoloration ( one case).11 here , we report the case of a colonic malt lymphoma presenting as a semipedunculated polyp that was removed by endoscopic mucosal resection ( emr ) . a 54-year - old man visited daegu catholic university hospital after a screening colonoscopy that revealed a sigmoid colon polyp that was diagnosed pathologically as a tubular adenoma . he denied other symptoms such as abdominal pain , weight loss , fever , general weakness , loss of appetite , or hematochezia . his blood pressure was 106/64 mm hg , pulse rate 73 beats per minute , respiratory rate 20 breaths per minute , and body temperature 36.7. his consciousness was clear , and no lymphadenopathy was evident in the head and neck , axillary , or inguinal region . the laboratory findings were as follows : white blood cells , 11,400/mm ( neutrophils 81.8% , eosinophils 0.4% , lymphocytes 12.4% ) ; hemoglobin , 13.4 g / dl ; and platelet count , 202,000/mm . the blood chemistry test showed the following results : aspartate aminotransferase , 16 iu / l ; alanine aminotransferase , 21 iu / l ; total bilirubin , 0.6 mg / dl ; alkaline phosphatase , 129 iu / l ; total protein , 6.5 g / dl ; albumin , 4.4 g / dl ; blood urea nitrogen , 12.2 mg / dl ; creatinine , 0.9 , mg / dl ; na , 139 meq / l ; k , 3.4 meq / l ; and cl , 98 meq / l . the serum carcinoembryonic antigen level was 2.69 ng / ml , which was within the reference range . colonoscopy revealed a semipedunculated polyp , approximately 2 cm in size , in the sigmoid colon . in private clinics , the tumor was diagnosed as a tubular adenoma ; however , a diagnosis of submucosal tumor was not completely ruled out . we performed emr by en bloc resection of the polyp with a flex knife and a snare after injecting a glycerin solution into the submucosa ( fig . resected specimens histologically showed lymphoepithelial lesions with diffuse proliferation of atypical lymphocytes , which immunohistochemically stained positively for cd20 , cd5 , and bcl-6 , but negatively for cd3 , bcl-2 , and cyclin d1 . these findings were compatible with low - grade b - cell malt lymphoma ( fig . 2 ) . there was no evidence of lymph node metastasis or involvement of any other organ , except for a gallstone , in the thoracic and abdominal computed tomography performed for staging . according to the ann arbor staging system , the resected lesion was replaced with normal mucosa on sigmoidoscopy 2 months after the emr ( fig . malt lymphoma , a subtype of non - hodgkin lymphoma , is classified as an extranodal marginal zone b - cell lymphoma and is a lymphoepithelial lesion characterized by epithelial infiltration by lymphoplasma cells.1,2 malt lymphoma of the stomach is known to be associated with helicobacter pylori infection,11 whereas nongastric malt lymphomas have been associated with borrelia burgdorferi , chlamydia psittaci , hepatitis c virus , campylobacter jejuni , and autoimmune disease.12 colonic malt lymphoma occurs at an average age of 59.8 years and shows no sex preference . clinically , it is usually asymptomatic or present with nonspecific symptoms such as bloody diarrhea and/or abdominal pain . however , in some rare cases , intestinal obstruction or intussusception can appear.9,10,13,14 systemic symptoms such as fever and weight loss are rare because most malt lymphomas are well localized and slow growing.12 according to endoscopic findings , a malt lymphoma of the colon usually appears as a sessile protruding lesion or ulcerative lesion , and the former is approximately 10 times more common than the latter.14,15 sites of tumor growth have been reported to be the cecum ( 71.5% ) , rectum ( 16.9% ) , and ascending colon ( 6.2% ) ; however , the sigmoid colon is only rarely affected.16 eight cases have been reported in korea , and these are summarized in table 1 . these cases manifested as polypoid lesions , neoplastic lesions , and protruding lesions in the form of submucosal tumors,4,5,6,7,8,10 but only rarely in the form of luminal stenosis caused by thickening of the large intestine wall or a color change of the mucosa.9,11 both neoplastic and polypoid lesions are sessile and accompanied by ulcers or nodularities in the mucosal lesion.5,6,7,8,10 in terms of regions of occurrence , five cases have been reported in the rectum,4,5,6,7,11 five cases in the appendix or ileocecal valve,5,6,8,9,11 and two cases in the ascending colon.6,9 accordingly , a malt lymphoma presenting as a semipedunculated polyp in the sigmoid colon is extremely rare . a malt lymphoma can be diagnosed during surgery or endoscopic biopsy . in the case of endoscopic biopsy , the submucosa must be collected because lymphomas can be limited to this region.4 in the present case , the tumor was diagnosed as a malt lymphoma by emr , which included the submucosal tissue , whereas it had been diagnosed as a tubular adenoma at private clinics . the specific histological findings of malt lymphoma include lymphoepithelial lesions by lymphoplasmic epithelial invasion , centrocyte - like cells , and reactive lymphoid follicles . plasma cell differentiation is observed in one - third of all malt lymphomas.17 however , it is difficult to differentiate malt lymphoma and follicular lymphoma in the presence of multiple lymphoid follicles.14 moreover , malt lymphoma is often confused with mantle cell lymphoma because of their histologic similarities . however , malt lymphoma usually presents as a single lesion , whereas mantle cell lymphoma presents as multiple lymphomatous polyposis in the gastrointestinal tract and without lymphoepithelial lesions.18 immunohistochemically , these two types can be differentiated by the cyclin d1 status because malt lymphomas and mantle cell lymphomas are immunonegative and immunopositive for cyclin d1 , respectively.14 in our case , histological findings showed that lymphoepithelial lesions were caused by the invasion of the mucosa by atypical lymphocytes , and that they were cyclin d1 negative with a ki-67 labeling index of 10% to 20% , which indicated a diagnosis of low - grade malt lymphoma . because of the lack of an accepted etiology and the limited number of cases , no guideline has been issued for the treatment of colonic malt lymphomas . locally extended low - grade malt lymphomas are currently treated by endoscopic or surgical excision , whereas high - grade malt lymphomas and malt lymphomas with multiple organ involvement may be treated using different modalities such as surgery , radiotherapy , chemotherapy , and , more recently , rituximab therapy.5 however , there is no standard treatment . some have reported that antibiotic treatment against h. pylori is effective for colonic malt lymphoma , and that this treatment influences even h. pylori - negative patients,19 which suggests that some strains sensitive to antibiotics for h. pylori eradication contribute to malt lymphoma development in these patients . grunberger et al.20 reported that the administration of antibiotics against h. pylori was ineffective in h. pylori - positive malt lymphoma patients with extragastric involvement . some case reports published in korea have addressed the efficacy of h. pylori treatment in malt lymphoma . however , the results in these cases were inconclusive as the presence of h. pylori infection was uncertain and the patients had undergone radiotherapy.7 therefore , the efficacy of h. pylori treatment in malt lymphoma requires further study . our patient was not tested for h. pylori , and because malt lymphoma was localized to the sigmoid colon , no measures other than endoscopic mucosal excision were performed . in the described case , malt lymphoma presented as a semipedunculated polyp during colonoscopy , and diagnosis and treatment planning were performed on the basis of the results of emr . more case reports and studies about colonic malt lymphoma presenting with variable morphology are needed to establish guidelines for the treatment of colonic malt lymphomas in the near future . the bacterium escherichia coli is widely used as indicator of the bacteriological condition of food and environments due to its almost exclusively fecal origin . the presence of e. coli in fresh - marketed seafood indicates recent contamination and is usually attributed to infected handlers or storage on contaminated ice . the intensification of production and the consequent increase in stocking density have made fish farming more vulnerable to disease [ 3 , 4 ] . the indiscriminate use of antibiotics to treat infections and promote growth has been shown to be inefficient in the long run and to put selective pressure on bacterial populations favoring the development of resistant strains potentially hazardous to public health [ 57 ] . in fact , bacterial strains resistant to different families of antibiotics have been isolated from environmental samples by a number of researchers [ 810 ] . foodborne strains resistant to antibiotics pose a risk to consumers ' health and favor the transference of the phenotype to humans through the food chain [ 1113 ] . there are no reports of illnesses caused by e. coli in farmed fish , but resistant strains may be selected due to the presence of antibiotics in the culture environment , leading to the dissemination by mobile genetic elements of resistance to potentially pathogenic bacteria [ 1417 ] . due to the importance of tilapia farming in northeastern brazil , the aim of the present study was to ( a ) investigate the presence of e. coli in fresh - marketed nile tilapia obtained from supermarkets in fortaleza , brazil , ( b ) establish the antibiotic susceptibility profile of e. coli strains isolated from nile tilapia samples , ( c ) determine whether resistance was potentially chromosomal or plasmidial , and ( d ) determine the multiple antibiotic resistance index of strains isolated from gills , muscle , and body surface . thirty - six specimens of nile tilapia ( oreochromis niloticus ) were collected from twelve supermarkets in fortaleza ( cear , brazil ) . the specimens were wrapped individually in plastic film and transported in ice - cooled isothermal boxes to the laboratory of seafood and environmental microbiology of the marine sciences institute ( federal university of cear ) for immediate bacteriological analysis . the e. coli investigation followed the guidelines of the fourth edition of the compendium of methods for the microbiological examination of foods released by the american public health association . presumptive tests were performed separately for gills , muscle , and body surface . to sample the body surface , an area measuring 10 10 cm was stroked with a sterile cotton swab previously soaked in difco brain heart infusion ( bhi ) broth and subsequently immersed in 9 ml 0.85% nacl solution ( vetec ) diluted serially to 10 . to sample the gills , a 25 g aliquot was homogenized in 225 ml 0.85% nacl solution , shaken in a magnetic stirrer for 30 min , and diluted serially to 10 . to sample the muscle , a 25 g aliquot was ground and homogenized in 225 ml 0.85% nacl solution and diluted serially to 10 . a 1 ml aliquot was retrieved from each saline dilution and seeded with three repetitions in a test tube containing 10 ml lauryl sulfate tryptose ( lst , difco ) . aliquots from positive lst tubes were seeded in 4 ml tubes containing ec broth and incubated in a water bath at 45c for 48 hours . e. coli was isolated using eosin - methylene blue agar plates ( difco ) , from which 35 colonies suspected of e. coli were selectedand submitted to imvic testing . colonies were considered to be e. coli when positive in the indole and methyl - red test , negative in the voges - proskauer and citrate test , and gram - negative with short rods in the gram staining test . the antibiogram was done with the disk diffusion method using mueller - hinton agar ( difco ) . initially , an emulsion of sample in saline solution was prepared by adjustment to the 0.5 mcfarland turbidity standard , equivalent to 1 10 cfuml ( clsi 2010 ) . the susceptibility of the e. coli strains was tested in relation to several families of antibiotics , including the aminoglycoside family : amikacin ( ami ; 30 g ) and gentamicin ( gen ; 10 g ) ; the carbapenem family : imipenem ( imp ; 30 g ) ; the cephalosporin family : cephalothin ( cet ; 30 g ) and cefotaxime ( ctx ; 30 g ) ; the fluoroquinolone family : ciprofloxacin ( cip ; 5 g ) ; the monobactam family : aztreonam ( atm ; 30 g ) ; the penicillin family : ampicillin ( amp ; 30 g ) ; the quinolone family : nalidixic acid ( nal ; 30 g ) ; the sulfonamide family : sulfametoxazol - trimetoprim ( sut ; 25 g ) ; and the tetracycline family : tetracycline ( tc ; 30 g ) . using sterile tweezers , commercially available antibiotic disks ( laborclin ) were placed individually on the surface of mueller - hinton agar . after 24 hours of incubation at 35c , the strains were scored as susceptible , intermediate , or resistant to each antibiotic based on the measurement of the inhibition halo , as recommended by clsi . the multiple antibiotic resistance ( mar ) index was determined for the total number of e. coli strains from each type of tissue sampled ( gills , muscle , and body surface ) using the formula a/(b c ) , where a is the total resistance score of the strains , b is the total number of families of antibiotics tested , and c is the number of strains from each type of tissue sampled . resistant e. coli strains were submitted to plasmid curing using acridine orange dye at 100 gml ( sigma ) . following exposure to the mutagen , the strains were rechallenged with the antibiotics to which they were initially resistant . forty - four of the isolates were confirmed to be e. coli , 25 ( 56.82% ) of which were isolated from gills , 15 ( 34.09% ) from the body surface , and 4 ( 9.09% ) from muscle . eleven e. coli strains isolated from gills and body surface were resistant to amp , sut , and tc , especially to last of these ( gills n = 4 ; surface n = 3 ) . on the other hand , strains isolated from muscle samples were susceptible to all the antibiotics tested ( table 1 ) . all strains isolated from gills , muscle , and body surface were susceptible to ami , atm , cet , ctx , cip , gen , and imp . according to some authors , the gills have a more diversified microbiota , qualitatively and quantitatively , due to their direct contact with the water , especially in plankton feeders such as the nile tilapia [ 2326 ] . also detected e. coli in nile tilapia muscle samples , but many authors believe that the muscle is a relatively innocuous tissue [ 2830 ] . nevertheless , the muscle may be contaminated during harvesting , a stressful process which often causes injury to the body surface , and/or during storage on contaminated ice [ 31 , 32 ] . molinari et al . add that e. coli is commonly found in the gut of the tilapia ; thus , to these authors , its presence in the muscle is an indication of poor handling practices . four resistance profiles were observed in this study : resistance to tc ( n = 5 ) , resistance to amp ( n = 4 ) , resistance to sut+tc ( n = 1 ) , and resistance to amp+sut+tc ( n = 1 ) ( table 2 ) . the profiles sut+tc and amp+sut+tc involved more than one family of drugs and were therefore considered profiles of multiple antibiotic resistance . the mar indexes for strains isolated from body surface and gills were 0.037 and 0.026 , respectively . in a study by jiao et al . on the occurrence of e. coli in the gut of farmed nile tilapia , the isolated strains were susceptible to ami , atm , ctx , and gen , matching our own findings and supporting the notion that these antibiotics are little used in aquaculture . e. coli strains resistant to amp , sut , and tc were also reported by ryu et al . . likewise , resistant strains of e. coli to tc were found by wang et al . . the authors suggest that improperly handled seafood is a critical reservoir for the dissemination of bacterial genes of multiple resistance . acridine orange curing of the 11 e. coli strains resistant to amp , sut , and tc revealed resistance to be plasmid - mediated in 4 cases and potentially chromosomal in 7 . thus , residues may be detected up to 10 days after administration , suggesting the possibility of detecting bacteria resistant to sut for a relatively long period . the presence of mobile genetic elements of resistance , especially plasmids and integrons , poses a risk to public health , as evidenced by koo and woo . not surprisingly , tendencia and dela pea observed that the indiscriminate use of antibiotics in aquaculture has been paralleled by a significant increase in the number of reports of resistant bacteria isolated from aquaculture stock . the overall high antibiotic susceptibility of e. coli strains isolated from fresh - marketed nile tilapia was satisfactory , although the occasional finding of plasmid - mediated resistance points to the need for close microbiological surveillance of the farming , handling , and marketing conditions of aquaculture products . nevertheless , it is necessary to note the origin of marketed fish in order to evaluate the potential risk to the consumer .

mucosa - associated lymphoid tissue ( malt ) lymphomas are characterized by lymphoepithelial lesions pathologically . colonic malt lymphomas are relatively rarer than lymphomas of the stomach or small intestine . endoscopically , colonic malt lymphoma frequently appears as a nonpedunculated protruding polypoid mass and/or an ulceration in the cecum and/or rectum . we report a unique case of a colonic malt lymphoma presenting as a semipedunculated polyp . a 54-year - old man was found to have a 2-cm semipedunculated polyp in the sigmoid colon during screening colonoscopy . the polyp was removed by endoscopic mucosal resection . histologic examination of the resected polyp revealed diffuse epithelial infiltration by discrete aggregates of lymphoma cells . we diagnosed the tumor as low - grade b - cell malt lymphoma by immunohistochemical staining .

please summarize the articles given below

the tumor produces catecholamines , such as norepinephrine and epinephrine , and leads to well - known clinical symptoms , such as hypertension , headache , sweating , palpitation , and orthostatic hypertension . it is usually found at extra - adrenal sites and is diagnosed as a subtype of paraganglioma . the high dopamine level in this tumor is caused by a deficiency in dopamine - beta - hydroxylase , which converts dopamine to norepinephrine . for this reason , this tumor differs from classic pheochromocytomas in many respects , not only in its clinical features but also in its oncologic aspect . only two original articles and five case reports have reported the occurrence of dopamine secreting paragangliomas in the retroperitoneum around the adrenal glands [ 2 - 8 ] . we report this interesting case and establish clinical concepts for this rare tumor by reviewing the related literature . a 26-year - old korean woman was referred after the accidental detection of an adrenal mass in her right side . she had no hypertension , palpitation , sweating , headache , flank pain , or mass upon palpation of her abdomen . on physical examination , her blood pressure was 110/90 mmhg and her heart rate was 90 beats / min . the results of laboratory tests , including a complete blood count and liver and renal function tests , were all unremarkable . serum norepinephrine and epinephrine levels were normal but the dopamine level was high ( 425 ng / l ) . analysis of a 24-hour urine sample revealed marked elevation of the urinary dopamine level ( 1,565.3 g / day ) but normal levels of vanillylmandelic acid ( vma ) , norepinephrine , epinephrine , metanephrine and normetanephrine . computed tomography results showed a 4.3 3.2 cm hypervascular mass on the right adrenal gland with an early washout enhancement pattern . 1 ) . magnetic resonance imaging revealed a 2.8 cm sized tumor that was located in the right periadrenal area and that abutted against the adrenal gland laterally and ivc medially ( fig . 2 ) . our preoperative diagnosis was a dopamine producing paraganglioma in the right retroperitoneum . hand - assisted laparoscopic right adrenalectomy was performed because of the firm attachment of the tumor to adjacent structures . her blood pressure was continuously normal and there were no fluctuations in vital signs during the operation . it was well encapsulated , homogenous and had a yellowish cut - surface with some internal hemorrhagic spots . microscopic diagnosis was a neuroendocrine tumor whose clinical manifestations were consistent with those of a paraganglioma . an immunohistochemical study showed that the tumor was positive for neuroendocrine markers such as cd-56 , synaptophysin and chromogranin . the tumor had a ki-67 index of less than 1 percent and was negative for s-100 ( fig . her 24-hour urine dopamine level returned to normal ( 388.4 g / day ) after the operation . her general condition was good and there was no recurrence during a 10-month follow - up . among the many types of paraganglioma , an exclusively dopamine producing type is extremely rare . only seven cases are listed in the worldwide database and no case has ever before been reported in south korea [ 2 - 8 ] . the exclusive production of dopamine can be ascribed to a deficiency in dopamine -hydroxylase which converts dopamine to norepinephrine in the catecholamine biosynthesis pathway beginning with tyrosine . because of the abnormal catecholamine synthesis pathway , the levels of dopamine and its end product , homovanillic acid ( hva ) , are increased , whereas the levels of norepinephrine , epinephrine and their end product , vma , are decreased . in consequence , the clinical presentation of this tumor is different from that of a classical pheochromocytoma that secretes norepinephrine and epinephrine . there is an absence of hemodynamic changes or so - called paroxysmal symptoms that are usually found in patients with catecholamine secreting pheochromocytoma . as a result , the patients with exclusively dopamine producing paraganglioma are mostly asymptomatic at initial diagnosis . some constitutional symptoms such as fever , malaise , weight loss or diarrhea may occur as a result of the increased circulating dopamine level . because paragangliomas tend to grow larger than adrenal pheochromocytomas , some patients experience vague abdominal pain or experience a palpable abdominal mass [ 4 - 8 ] . the asymptomatic features make it difficult for clinicians to detect the tumor at an early stage . detection is even more challenging to physicians working in institutes without routine screening procedures for the detection of catecholamine and dopamine . differential diagnosis can be achieved by measuring the dopamine levels in serum and 24-hour urine samples . clinicians should not rule out the possibility of this rare tumor when evaluating adrenal masses with normal serum norepinephrine , epinephrine and urinary vma levels , even if the radiologic images strongly suggest a pheochromocytoma . hand - assisted laparoscopic surgery has been adapted for the removal of large tumors and for the rescue of operative procedures in complicated cases of laparoscopic surgery . to minimize surgical mortality caused by hypertensive crisis during the manipulation of the tumor , preoperative administration of a -blocker is essential for norepinephrine and epinephrine producing pheochromocytomas . however , -blocker treatment is contraindicated for exclusively dopamine secreting paraganglioma because it can cause profound cardiovascular collapse after surgery , and can even result in death following a hypotensive crisis . there are two subtypes of dopamine receptors ; the d1 receptor , which relaxes smooth muscles in blood vessels , and the d2 receptor , which inhibits noradrenaline release from postganglionic sympathetic neurons . these two effects could explain the pre - operative hypotension in dopamine secreting tumor patients . blood pressure is sometimes elevated after the removal of this tumor presumably because of the same mechanism . dopamine secreting paragangliomas are more likely to present malignant features than classic catecholamine secreting type paragangliomas or pheochromocytomas . this rare tumor tends to be diagnosed in patients who are asymptomatic , and the tumor is detected later than tumors that secrete norepinepnrine , epinephrine or both . concerning the biochemical features , one report suggests that the decreased activity of dopamine -hydroxylase results in poor differentiation of this tumor , which may explain why the dopamine - secreting type shows advanced malignant features . elevated dopamine or hva levels in 24-hour urine ( > 120 nmol / g ) is correlated with large tumor size and malignant potential . extra - adrenal location , a tumor weight of more than 80 g , dna aneuploidy or triploidy and persistent postoperative hypertension have also been reported as risk factors for malignant pheochromocytoma . because of the rarity of this tumor , there are no definite criteria for evaluating its malignant potential . in conclusion , lack of clinical symptoms and the rarity of this tumor can lead to the lack of , or a delay in diagnosis . in addition to radiologic imaging , dopamine assays in serum and 24-hour urine collection are useful diagnostic tests . venous thromboembolism ( vte ) is a term that encompasses deep vein thrombosis ( dvt ) and pulmonary embolism ( pe ) . an evaluation of the national hospital discharge survey and census date for vte in the united states reported an annual incidence of 0.49 per 10,000 , with peak rates in the neonatal period and adolescence.1)2 ) the majority of children with vte have multiple risk factors for thromboembolic disease at presentation , such as catheter - related thrombosis , infection , and congenital prothrombotic disorders.3 ) a pe is a very rare event in children , but the mortality rate is reported to be approximately 10%.4 ) hypereosinophilia is rarely associated with a pe in adults ; however , this condition has not been reported in children . a 12-year - old boy was admitted to the hospital 10 days after the onset of cough , blood - tinged sputum , fever , right flank pain , and non - specific bilateral knee pain . two weeks prior to admission , the patient went on a 10 hour automobile trip and ate raw fish . , he had leukocytosis with eosinophilia ( peak ratio , 35% ) , thrombocytopenia ( minimum , 33,000/mm ) , and an elevated c - reactive protein concentration ( 15.5 mg / dl ) . he was treated with antibiotics at a local hospital , but the symptoms did not remit . he was transferred to our institute for persistent symptoms and newly found signs of pulmonary hypertension on echocardiogram { trivial tricuspid valve regurgitation ( tr ) with a velocity of 3.2 m / sec}. on admission , he had a persistent cough and blood - tinged sputum . on physical examination , he had tachycardia ( 100 beats per minute ) , tachypnea ( 39 breaths per minute ) , and rales in the right lung field . the biochemical profile on admission was as follows : hemoglobin , 9.9 g / dl ; white blood cell ( wbc ) count , 19,080/mm with 32.8% eosinophils ; platelet count , 64,000/mm ; erythrocyte sedimentation rate , 6 mm / hr ; and c - reactive protein , 9.2 mg / dl . a coagulation assay revealed a slightly prolonged prothrombin time and activated partial thromboplastin time and elevated fibrinogen ( pt inr , 1.33 ; aptt , 46.5 sec ; and fibrinogen , 585 mg / dl ) . an echocardiogram showed probable mild pulmonary hypertension with trivial tr ( velocity , 3 m / sec ) , but there were no other abnormal findings . the myocardial thickness and a chest computerized tomography ( ct ) scan showed pe in the right upper and lower lobar pulmonary arteries and the left lower lobar pulmonary artery . a pulmonary infarction was demonstrated in the right lower lobe on the chest ct scan ( fig . a ct angiography showed a dvt in the left mid - femoral - to - popliteal and posterior tibial veins ( fig . 2c ) . a diffuse decrease in perfusion in the right lung and a focal decrease in perfusion in the superior segment of the left lower lung the patient showed no evidence of allergic disease and parasitic infection for the elevated eosinophil count in the peripheral blood and bone marrow . these data led us to diagnose primary hypereosinophlia . however , there was no other end organ dysfunction which might be associated with hypereosinophlic syndrome . we also failed to find any other specific cause of hypercoagulation ( antithrombin iii activity , 91% ; protein c , 75% ; protein s , 82% ; and homocysteine , 6.5 mol / l ) . antinuclear antibody , anticardiolipin antibody , and lupus anticoagulant levels were all either negative or within the normal range . after diagnosis of a pe , he was initially treated with heparin ( 50 u / kg bolus followed by 17 u / kg / hr ) , then low - molecular - weight heparin ( 1 mg / kg / dose q 12 hours ) for 1 month . one week after admission , the platelet count dropped to 38,000/mm . on the 14th day after admission , the peripheral eosinophil count increased to 53.4% of the wbc ( 17,250/mm ; total eosinophil count , 9,210/l ) . in 1 month , the eosinophilia and thrombocytopenia resolved spontaneously . his general condition gradually improved with the concomitant resolution of the pulmonary thromboembolism and pulmonary hypertension . the patient was discharged 1 month after admission on warfarin , which was adjusted to a pt inr of 2.0 . based on doppler sonography , the thrombus in the lower extremity had resolved by 3 months . he took warfarin for 9 months and an anti - platelet medication ( aspirin ) for > 1 year without any other complications . fifteen months after admission , the peripheral blood examination revealed the following findings : hemoglobin , 14.8 g / dl ; wbc count , 5,920/mm with 4.2% eosinophils ; and platelet count , 230,000/mm . while remaining on aspirin , he had no specific symptoms on evaluation in the outpatient clinic ( fig . a pe occurs when a segment of a thrombus within the deep venous system detaches from the vessel , goes to the lungs , and lodges in the pulmonary arteries . the pelvic and deep veins of the lower extremities are a common source of pe.5 ) in 1856 , rudolf virchow identified predisposing thrombotic factors , which include blood stasis , endothelial injury of the vein , and alteration in blood coagulability . mutations in the genes for anticoagulant proteins , such as antithrombin , protein c , and protein s are important risk factors . circumstantial factors include increasing age , immobilization , surgery , pregnancy , oral contraceptives , hormone replacement , and inflammatory conditions.1)3)6 ) the thrombotic events occur when one or more of the circumstantial risk factors occur together . , the patient had a high percentage of eosinophils at the onset of the thromboembolism . hypercoagulation as a result of hypereosinophilia has previously been reported,7)8 ) but the mechanism remains poorly understood . previous studies have demonstrated that eosinophils release toxic cationic proteins , which include eosinophil cationic protein , eosinophil - derived neurotoxin , major basic protein , eosinophil peroxidase , and platelet - activating factor.8 ) these granular proteins may promote platelet activation and coagulation , which inhibit the anticoagulation activity of thrombomodulin.7 - 9 ) in the patient presenting with peripheral blood eosinophilia , reactive causes should be investigated first , including parasitic infections , allergic disorders , malignancies , and collagen vascular disease . the patient in this report had a history of eating raw fish , but we did not find evidence of a parasitic infection ; all the other conditions were excluded . if eosinophilia persists with an unknown etiology , the diagnosis of hypereosinophilic syndrome should be considered . hypereosinophilic syndrome is defined as an eosinophil count > 1,500/l that is sustained for > 6 months without any other clear cause.10 ) this patient had transient eosinophilia and recovered spontaneously , although the actual onset of eosinophilia was not identified a pe may show non - specific signs and symptoms or no symptoms , although it can be fatal . especially in the pediatric age group , the diagnosis of a pe may be delayed longer than in the adult age group . pulmonary angiography has been the gold standard for diagnosing a pe , but it is more invasive and time - consuming than a ct . the treatment of a vte in hemodynamically stable patients is anticoagulation , while thrombolytic therapy is indicated in massive iliofemoral dvt and pe with hemodynamic instability . the echocardiographic evidence of right ventricular dysfunction can be helpful in determining whether or not a patient needs thrombolytic therapy.11 ) the duration of therapy should be decided by causes and underlying conditions . in conclusion , we have presented a case of a pulmonary thromboembolism which was accompanied by idiopathic hypereosinophila in a child .

exclusively dopamine producing retroperitoneal paragangliomas are extremely rare . we have experienced the first korean case managed successfully based on the proper evaluation . a 26-year - old female patient came to our attention after the accidental detection of an adrenal mass . she had no symptoms and denied any family history . laboratory evaluations were normal but serum dopamine ( 425 ng / l ) and 24-hour urine dopamine levels ( 1,565.3 g / day ) were elevated . she underwent laparoscopic right adrenalectomy . histopathological diagnosis was a paraganglioma . after operation , dopamine levels in serum and 24-hour urine dropped to 0.09 ng / l and 388.4 g / day . dopamine producing paraganglioma elicit no clinical symptoms . only the dopamine level is elevated in serum and 24-hour urine samples . surgical resection without using preoperative alpha blockage is the treatment of choice . the prognosis for patients with this tumor tends to be poor because the diagnosis is usually delayed due to lack of symptoms .

please summarize the articles given below

esophageal achalasia is a rare motility disorder of the esophagus involving the smooth muscle layer and the lower esophagus sphincter ( les ) , with its incomplete relaxation and increased tone . this pathology is characterized by difficulty in swallowing , regurgitation , and sometimes chest pain . specific tests for diagnosis of esophageal achalasia are barium swallow and esophageal manometry . esophago - gastro - duodenoscopy with or without endoscopic ultrasound can be also performed to rule out the probability of cancer . for management , dilation or stretching of the esophagus , surgery and injection of muscle relaxing substances ( botulin toxin ) in the esophagus were foreseen . we present a case of esophagus achalasia diagnosed for intense rest and effort dyspnea , persistent cough , arterial hypotension , and chest discomfort . 12-leads ecg showed sinus rhythm with pulse rate at 95 beats / min . left axial deviation and diffuse disorders of repolarization were also seen . chest x - ray revealed massively dilated esophagus along the right cardiac border [ figure 1 ] . ct of the chest showed esophageal body dilatation filled with food remaining that compressed the left atrium [ figure 2 ] . the esophageal manometry evidenced body esophageal a - peristalsis , with low amplitude of esophageal body contraction and failed relaxation of les after water swallow . left atrial compression induced by an extrinsic structure was seen at two - dimensional - trans - thoracic echocardiography ( 2d - tte ) . this structure has an elongate form and was filled of liquid drinking to differentiate esophagus from any cardiac formation [ figure 3 ] . diastolic mitral inflow pattern showed an e / a waves ratio = 1.1 ; dt measured 210 msec . ; ivrt was 87 msec . three dimensional echocardiography ( 3d - tte ) pointed out the extracardiac roundish esophageal cavity compressing left atrium , clearly separated from the heart structures [ figure 4 ] . the same evaluation performed in parasternal approach ( at level of aortic root ) consented to identify the pulmonary trunk and its subdivision in right and left pulmonary arteries [ figure 5 ] . antero - posterior chest x - ray that shows poorly defined borders at the median and lower right lobe and at the lung base ct of the chest pointed out extrinsic compression at level of the left atrium by dilated esophagus ( arrow ) two - dimensional echocardiography recorded in apical 4 chambers view showing an extrinsic compression on the left atrium due to a dilated and lengthened formation evidenced after drinking a liquid ( arrow ) ( a ) three - dimensional echocardiography performed in apical 2-chambers view . evidence of a round structure ( arrow ) compressing left atrium ; ( b ) three - dimensional echocardiography in the same approach . more evident dilated esophagus ( arrow ) located below to the cardiac plane and separated from the cardiac structures three - dimensional echocardiography performed from the parasternal approach intermediate between the long and short - axis view , at level of aortic root . clear evidence of dilated esophagus ( arrow ) compressing the lower segment of the pulmonary trunk the symptoms are a consequence of the left atrial compression that reduces its volume causing an impairment of left ventricular diastolic filling . in addition , as a consequence of increased left atrial pressure , pulmonary pressure also rises causing an intense dyspnea leading to pulmonary edema . esophageal achalasia is usually diagnosed by chest x - ray , ct , mri , and esophageal manometry . functional magnetic resonance imaging ( fmri ) has been recently proposed for the evaluation of the esophagus motility . but , the test of choice for diagnosing its extrinsic compression of left atrium by esophageal achalasia is two - dimensional echocardiography ( 2d - tte ) . at 2d - tte , the achalasia moves asynchronously with the atria in contrast to intrinsic atrial structures . in our case , 2d - echocardiography performed in apical long - axis view evidenced the compression of left atrium by an extracardiac structure corresponding to the dilated esophagus evidenced by the liquid drink . nevertheless , 2d - tte is limited to the cases with acceptable sonographic window . in the presence of a poor sonographic space , trans - esophageal echocardiography three - dimensional trans - thoracic echocardiography ( 3d - tte ) was also performed in our patient . this was firstly carried out in an individual with esophageal achalasia . in our patient , 3d - tte records consented to better appreciate the esophagus compressing the left atrium and the lower part of the pulmonary trunk . even though 3d - tte is not explanatory than 2d - tte , it consented to better evaluate the dilated esophagus separated from the left atrium and compressing this same and some neighboring structures without the liquid drink too symptomatic trigeminal neuralgia ( tn ) is caused by a demonstrable structural lesion other than vascular compression , typically posterior fossa tumors or multiple sclerosis [ 1 , 2 ] . this pain may be either persistent or intermittent , sometimes occurring in brief attacks that may reproduce tn features . here , we report the case of a patient with wallenberg s syndrome who started having shock - like painful paroxysms in the first division of the trigeminal nerve ( v1 ) . a 41-year - old man visited our hospital reporting a 48-h lasting pain localized on the right side of his neck . three hours before entering the emergency room , the patient felt sudden dizziness with gait instability and clumsiness of his right limbs . his past medical history was remarkable for non - controlled hypertension as well as frequent alcohol and occasional cocaine intake . the patient denied any drug intake in the past few days . on a general physical examination , the only relevant the neurologic examination revealed moderate dysarthria , a right horner syndrome , vertical nystagmus in all extreme gaze positions , an absent right gag reflex , right facial and left two limb hypoalgesia and thermoanesthesia , mild paresis of the right limbs , and severe right limb ataxia . an early brain computed tomography ( ct ) scan did not detect any significant abnormalities , but magnetic resonance imaging ( mri ) showed a recent infarction in the right lateral medulla ( fig . in addition , complete occlusion of the right vertebral artery was demonstrated on magnetic resonance angiography ( mra ; fig . 2 ) . there was no evidence of a vascular contact at the root entry zone of the right trigeminal nerve.fig . a axial t2-weighted flair mri shows slight hyperintensities in the right lateral medulla and right cerebellum . b diffusion - weighted mri demonstrates restricted water motion in the lesion shown in a , indicating recent infarctionfig . coronal maximum intensity projection from mra reveals occlusion of the right vertebral artery , which is likely due to artery dissection magnetic resonance imaging ( mri ) . a axial t2-weighted flair mri shows slight hyperintensities in the right lateral medulla and right cerebellum . b diffusion - weighted mri demonstrates restricted water motion in the lesion shown in a , indicating recent infarction magnetic resonance angiography ( mra ) . coronal maximum intensity projection from mra reveals occlusion of the right vertebral artery , which is likely due to artery dissection forty - eight hours after admission , the patient suffered from aspiration pneumonia with breathing compromise and required intubation at the intensive care unit ( icu ) . after several lung complications , he was eventually extubated and returned to our hospital ward 1 month after the stroke . at this moment we found the same neurologic signs he presented at onset , though milder , including some sensory impairment on the right side of his face . two days after leaving the icu , our patient started having brief electric shock - like pains in the whole distribution of the first division ( v1 ) of the right trigeminal nerve . pain attacks fulfilled diagnostic criteria for symptomatic tn , according to the international classification of headache disorders , 2nd edition ( ichd - ii ) . they lasted for 35 s , occurred at least 10 times per hour , and were given a score of 8 out of 10 on a visual analogue pain intensity scale . treatment with gabapentin was initiated . while being on a dose of 300 mg t.i.d . , the patient experienced a decrease in both pain frequency and intensity plus a restriction of the pain to a more circumscribed periocular area . when gabapentin was titrated up to 600 mg t.i.d , the pain was finally controlled . at discharge he maintained this dose and had no recurrences of the pain through a 2-month follow - up . it is widely accepted that the commonest cause of tn is compression of the trigeminal root entry zone by a blood vessel . the term classical tn is applied to those cases with potential vascular compression or unknown etiology . when a causative lesion other than vascular compression is demonstrated , a diagnosis of symptomatic tn is made . overall , symptomatic tn accounts for 15% of cases of nt , and the majority of these are caused by cerebellopontine angle tumors or multiple sclerosis . although a brainstem infarction had been previously suggested as a possible cause of tn , it was balestrino and leandri who reported the first well - documented case in 1997 . these authors discovered a small ischemic lacune at the right lateral part of the pons in a patient with a 4-year history of ipsilateral second division ( v2 ) tn and slight sensory loss . in 1998 golby et al . described a patient who started having lancinating pain in v1 and v2 distributions on the left side . he had experienced sudden hemifacial numbness 1 year before , and mri demonstrated an old ischemic lesion at the root entry zone of the trigeminal nerve . in 2004 peker et al . reported a female patient who suddenly developed a neuralgic pain in her left chin and cheek . a slight hypoesthesia was found in v2 and v3 territories , and mri showed a chronic infarction transecting the central trigeminal pathways within the pons . in 2006 , warren et al . described a female patient who presented with concurrent left trigeminal and glossopharyngeal neuralgia . katsuno and teramoto have recently reported a patient with sudden onset of facial numbness and tn in the right v2 dermatome . mri showed an acute pontine infarction , just at the root entry zone of the right trigeminal nerve . the pathogenesis of tn secondary to a brainstem ischemic lesion is uncertain . the main hypothesis states that demyelination in the central trigeminal pathways would cause ephaptic transmission and thereby abnormal electric impulses , as it happens in multiple sclerosis . other theories postulate that irritation of trigeminal structures in a bed made from the scar would be the base of excessive reactivity in an epileptic - like manner . facial pain may be a feature of wallenberg s lateral medullary syndrome , along with a decrease of pain and temperature sensation of the face . other clinical features include vertigo , eye movement disorders , an ipsilateral horner s syndrome , ipsilateral limb ataxia , and contralateral sensory deficit . in reviewing the literature , pain incidence rates following a lateral medullary infarction vary largely , with higher rates in follow - up observations . the pain may start just at the stroke onset , but most patients have a latency between 2 weeks and 6 months . some patients feel a constant , boring , pain , while others describe short pain attacks that occur either spontaneously or related to an innocuous stimulus . therefore , wallenberg syndrome is a typical cause of central post - stroke pain , and this pain may occasionally take the attributes of a symptomatic tn . among 12 patients with wallenberg s syndrome , fitzek et al . found 6 patients with facial pain . the latency between the stroke and pain onset ranged between 1 month and 2 years . facial pain was always ipsilateral to the infarction , and was mostly localized in the periorbital region . these patients reported short pain attacks lasting seconds to minutes , and three of them also had persistent pain . although a diagnosis of tn was not made , the shortest pain attacks i.e . , those lasting just a few seconds apparently had typical tn features . our patient also had neuralgiform pain attacks in association with a wallenberg s syndrome . the painful paroxysms were brief and intense , fulfilling ichd - ii diagnostic criteria for symptomatic tn . they started with a latency of 1 month after the stroke onset , which was in line with fitzek s series . while the hypoesthesia extended through the territory of the three trigeminal branches , the pain occurred in a v1 distribution . this was also in accordance with fitzek s cases , whose pain was mostly centered in the periorbital region . in contrast , classical tn usually starts in v2 or v3 , and only very rarely affects v1 [ 1 , 11 ] . the somatotopic arrangement of trigeminal fibers may possibly account for these topographical differences between tn due to nerve root compression and tn due to a lateral medullary infarction . lesions of the dorso - lateral medulla involve both the trigeminal descending tract and the trigeminal spinal nucleus , and this may lead to sensory impairment and pain in the ipsilateral face . in fitzek s clinical series of wallenberg s syndrome , patients with facial pain had lesions covering the trigeminal spinal tract and nucleus at the lower medulla , as demonstrated by mri . in addition , the r2 blink reflex component was abnormal only in patients with facial pain . likewise , sensory thresholds in the ipsilateral face were specifically elevated in those patients presenting with facial pain [ 3 , 10 ] . the existing studies all deal with tn associated with multiple sclerosis and are small open - label trials . three trials including a total of 19 patients with multiple sclerosis have reported an effect of gabapentin alone or associated with carbamazepine . in fact , gabapentin , pregabalin or amitriptyline are currently recommended for first line treatment in central neuropathic pain . indeed , he experienced significant improvement when the drug was initiated , and had complete relief with further titration . in conclusion ischemic lesions covering the trigeminal spinal tract and nucleus at the lower levels of the medulla seem to be involved in the pathogenesis of the pain . gabapentin might be an effective drug for symptomatic tn related to a lateral medullary infarction .

esophageal achalasia is a motility disorder characterized by impaired relaxation of the lower esophageal sphincter and dilatation of the distal two - thirds of the esophagus . this condition may be a non - frequent reason of extrinsic compression of left atrium . in turn , this can be a cause of some hemodynamic changes such as chest discomfort , dyspnea or reduced exercise tolerance , systemic hypotension and tachycardia . we describe a case of a patient with esophagus achalasia compressing the left atrium and inducing hemodynamic compromise . the diagnostic methods , as chest x - ray , computed tomography ( ct ) , manometry , and 2d - trans - thoracic echocardiography ( tte ) demonstrated the esophagus dilation , the impaired relaxation of the lower esophageal sphincter , and its compression on the left atrium . three - d trans - thoracic echocardiography ( 3d - tte ) was firstly performed also . this last examination pointed out better than 2d - tte the extrinsic compression of the left atrium due to the esophagus dilatation . therefore , 3d - tte is a true improvement for the echocardiographic diagnosis of the left atrial compression induced by esophageal achalasia .

please summarize the articles given below

whereas the incidence has increased from 1 in 10,000 - 50,000 spontaneous pregnancies , with assisted reproductive technology procedures , the incidence is up to 1% , a 70-fold increased risk . there are several approaches for heterotopic cervical pregnancy management , and generally the purpose of conservative management is fertility preservation : surgical treatments including uterine artery ligation and embolization , foley catheter insertion , and cervical curettage with or without cerclage , while medical treatments include transvaginal potassium chloride ( kcl ) or methotrexate ( mtx ) injection . in 1994 , frates et al . reported the first live birth of a heterotopic cervical pregnancy , which was managed with transvaginal ultrasound - guided selective reduction with kcl . since then , a few more live births from heterotopic cervical pregnancy have been reported . we present the case of a rare event of a heterotopic pregnancy in which it was possible to maintain the intrauterine pregnancy ( iup ) to term without complications and reviewed the literature to suggest the best treatment for a successful pregnancy outcome . a 36-year - old woman visited our medical center to seek treatment for primary infertility . at her first visit , dilatation and curettage was performed due to a missed abortion that was conceived by the first cycle of ivf - et . in this cycle , a total of seven oocytes were retrieved , five oocytes were fertilized by intracytoplasmic sperm injection , and two embryos were transferred . the initial serum b - hcg level was 191.44 miu / ml 11 days after embryo transfer , and follow - up levels were 1,540 miu / ml and 7,970 miu / ml at 15 days and 18 days after et , respectively . at 4 weeks and 5 days of gestation , an 8 mm gestational sac with a yolk sac was seen in the intrauterine cavity and a 3 mm gestational sac - like shadow was seen in the cervical canal in the first tvs ( figure 1a ) . the patient was hemodynamically stable at the time of presentation ( hemoglobin 11.5 g / dl ) . at 5 weeks+2 days of gestation , follow - up sonography confirmed a heterotopic cervical pregnancy ( figure 1b - d ) . after explaining the treatment options to the patient , she wanted to try to conserve the iup . she decided on transvaginal pregnancy reduction of the cervical pregnancy , accepting the risk of severe bleeding and a potential need for emergency hysterectomy . selective reduction of the cervically located gestational sac was planned , with readiness for hysterectomy . careful intracervical gestational sac reduction without harming the endometrial area was carried out with ovum forceps under abdominal ultrasound guidance . the postoperative course was uneventful with a postoperative hemoglobin level of 11.3 g / dl . the patient was discharged on the seventh postoperative day in good health , with an intact iup ( figure 2 ) . with regular check - ups , the iup followed without any complications , and an emergency cesarean section was performed at 40 weeks+5 days of gestation due to failure to progress . an uncomplicated birth of a live newborn weighing 3,360 g occurred ; the apgar scores were 8 and 9 at 1 and 5 minutes , respectively . written informed consent was obtained from the patient for publication of this case report and the accompanying images , and this report was approved by the institutional review board of cha gangnam medical center . heterotopic cervical pregnancy is extremely rare and most cases are associated with assisted reproductive technology . early diagnosis of heterotopic cervical pregnancy can provide the opportunity for successful conservative management . in general , the aims of a conservative approach are the protection of a coexisting iup , the minimization of blood loss , and fertility preservation . however , there are no specific recommendations for the best treatment of heterotopic cervical pregnancy , and there is no universally accepted treatment modality . therefore , we reviewed the literature to identify the best treatment of heterotopic cervical pregnancy for a successful pregnancy outcome . up to the present , a total of 37 cases of heterotopic cervical pregnancy , including the one described here , have been reported in the english language literature . only four cases of heterotopic cervical pregnancy had been conceived spontaneously and naturally [ 4 - 7 ] : the other patients had received infertility treatment . in the 30 cases in which preserving the iup was attempted , the attempt was successful in 25 cases : 24 were live births , but one case was followed up to 12 weeks of gestational age and in 5 cases , intrauterine fetal demise occurred . among the 24 live births , the cases are classified according to the absence or presence of major obstetric complications in tables 1 and 2 , respectively . in 16 cases , the iup was preserved and followed up until birth without any complications ( table 1 ) . on the other hand , the iup was preserved with major obstetric complications including placenta accreta , severe bleeding , and subsequent hysterectomy in eight cases ( table 2 ) . different techniques were attempted to eliminate the cervical embryo . among them , the following factors should be considered . mtx is an agonist of folic acid that participates in dna synthesis and has the capacity to stop proliferative cell activity . transvaginal ultrasound - guided intra - amniotic injection of mtx can be successfully used for cervical pregnancy treatment , but the risk of systemic adverse effects , such as thrombocytopenia , leukopenia , elevated serum liver enzymes , and especially the teratogenic effect , should be taken into consideration . however , this technique may result in the radiation of the viable iup , and influence on endometrial receptivity , which could decrease future fertility . although several cases have been managed by kcl injection , there is a possibility of major bleeding because of the remaining products of conception . if chorionic tissue remains in the cervix , bleeding , cervical mass infection that could cause intrauterine infection , premature rupture of the membrane , and postpartum bleeding can sometimes occur , and placenta accreta remains a risk because of the possibility of chorionic infiltration to the cervix . in this literature review , 58.3% ( 7 out of 12 ) of the cases developed serious complications when evacuation was not performed , regardless of the initial procedure , while 91.7% ( 11 out of 12 ) whose treatment included complete evacuation of the cervical pregnancy had no major complications . in fact , the complication of the other one case was placenta abruption , which might not have been associated with remnant chorionic tissue in the cervix . we described a case of heterotopic cervical pregnancy that was successfully treated and reviewed the literature . although a general treatment strategy can not be suggested because of the small number of cases , complete removal of the cervical conception should be considered for a successful pregnancy outcome . the main structures related to human memory are the papez circuit , the basolateral limbic circuit , and the basal forebrain , which communicate with each other through white - matter tracts . damage to these structures ( including the communication tracts ) from hemorrhages , infarctions , and tumors can result in memory disturbances.1,2 in addition to these structures , valenstein et al . suggested that the retrosplenium could be a supplementary pathway of the limbic system connecting the anterior thalamus and medial temporal lobe structures.3 the retrosplenium is located in the posterior cingulate cortex surrounding the splenium , and is a cytoarchitecturally distinct structure forming brodmann areas 29 and 304 ( fig . we report on a patient who developed both verbal and visual memory deficits after an acute infarction of the retrosplenial cortex . a 57-year - old right - handed man who had suffered from diabetes mellitus for 10 years was admitted to an emergency room due to acute memory loss . one month prior to admission he was diagnosed with syphilis and began treatment with penicillin g. on the day of his symptom onset , his daughter noted that he asked repeatedly over the phone about an appointment time for a clinic visit . after the conversation , he asked his daughter what day of the week it was . two days later , accompanied by his daughter , he went to the hospital in order to receive treatment for syphilis , but he did not know why he was there or where he was . therefore , he was transferred to the emergency room for further evaluation . on initial evaluation at the emergency room , his blood pressure was 103/63 mmhg and his heart rate was 75 beats / min and regular . his score on the initial mini - mental state examination ( mmse ) was 22/30 ( memory registration , 3/3 ; memory recall , 0/3 ; orientation to time , 4/5 ; orientation to place , 3/5 ; calculation and concentration , 4/5 ; and reading , 0/1 ) . the visual fields of both eyes were constricted due to a previous panretinal photocoagulation procedure for diabetic retinopathy , but all the other cranial nerve examinations were normal . a cerebrospinal fluid ( csf ) analysis showed a normal wbc count ( 2 /ml ) and mild elevated protein ( 81.5 mg / ml ) . in addition , the csf / serum glucose ratio was 0.474 and the csf vdrl test was negative . the memory of the patient began to improve on the second day of hospitalization , but he could not remember his home address and phone number . he underwent a formal neuropsychological test four days after the onset of symptoms ( table 1 ) , at which time the score on the mmse was 27/30 ( memory registration , 3/3 ; memory recall , 1/3 ; and calculation and concentration , 4/5 ) . on the rey auditory verbal learning test ( avlt ) , the score for free recall was 13 ( 3.75%ile of age - matched control subjects ) and that for 20 min delayed recalls was 0 ( 0.04%ile ) . the scores for immediate and delayed recalls were 2/36 ( 3.07%ile ) and 3/36 ( 1.07%ile ) , respectively . on recognition of the rey copying test , there were four true positives and one false positive . five days later , his memory appeared to have recovered considerably , but he still could not remember his home address . brain mri ( 3.0-tesla device , philips ) was performed two days after the onset of symptoms . diffusion - weighted and sagittal t2-weighted mri images ( fig . 2-a and 2-b ) revealed a high - signal - intensity lesion in the left splenium and retrosplenium that appeared as a low - intensity signal on the apparent diffusion coefficient ( adc ) map of b 1000 values . in addition , there was a point lesion in the center of the thalamus and small scattered lesions in the area supplied by the left posterior cerebral artery ( pca ) ( fig . 3 ) . on magnetic resonance angiography ( mra ) images , there was an occlusion in the p2 portion of the left pca ( fig . the blood flow to the pca region was delayed slightly based on the images of the time - to - peak ( ttp ) maps ( fig . after discharge , the patient demonstrated a marked improvement in both his visual and verbal memory impairments and did not complain of any cognitive dysfunctions . repeated neuropsychological tests - which demonstrated impairment at the time of admission - at two months after symptom onset demonstrated improvement on the rey avlt and a near - normal recall score on the rey - osterrieth complex figure test ( table 1 ) . figure 2-a shows that the cerebral infarction was restricted to the left splenium with a little area of the retrosplenium . we considered that the amnesia of our patient was due to the retrosplenial lesion , because memory - related structures other than the retrosplenium were intact . although the mild perfusion delay to the left pca territory might have contributed to his amnesia , there were no significant changes in the relative cerebral blood volume and cerebral blood flow compared with the corresponding contralateral regions ( fig . however , we could not exclude the possibility of other small infarctions being present in the areas related to the memory function because we did observe point lesions in the left central thalamus and left pca territory . in contrast , there are reported cases of a single right retrosplenial lesion causing both visual and verbal memory deficits.5 there is strong evidence that the right medial temporal lobe is involved in navigation , and it now appears that input of the hippocampus and related structures receive from and convey to the right retrosplenial cortex has a similar spatial preference , while the left medial temporal and left retrosplenial cortices appear primarily concerned with more - general aspects of episodic memory.3,4,6 however , there are recent studies that can explain the presence of both visual and verbal amnesias in our case . most functional neuroimaging studies have shown that navigation or orientation in a large - scale space activate the retrosplenial cortex , usually bilaterally.4 in addition , some functional mri studies have shown that during episodic memory , bilateral retrosplenial areas were activated.7 although there is a tendency for predominance , each retrosplenium must be involved in both visual and verbal memories . although bilateral retrosplenial lesions tend to have a poor prognosis , retrosplenial amnesia generally recovers rapidly.4,8 each retrosplenium receives major inputs from the contralateral retrosplenium , the orbital and dorsolateral prefrontal cortex , the anterior cingulate cortex , parahippocampal cortex , superior temporal sulcus , precuneus , claustrum , and the anterior and lateral thalamic nuclei.9 therefore , a good prognosis may be partly due to functional substitution of the counterpart retrosplenium or other parts of the cerebrum . in addition , the prognosis may be influenced by the location of the retrosplenial lesion . saito , et al.1 reported a case of transient global amnesia ( tga ) resulting from a retrosplenial infarction at a similar location to that in our case . however , in the case of yasuda , et al.,5 which showed a poor prognosis , the lesion encroached the retrosplenium more posteriorly , although the size and location of the cerebral infarction were similar to those in our case . in contrast , takahashi , et al.6 reported three cases of retrosplenial lesions that extended even to the inferior precuneus , all of which showed a good prognosis . therefore , specific areas in the retrosplenium may critically affect the prognosis , and these could be elucidated by further functional neuroimaging , which would improve our understanding of the function of the retrosplenium .

heterotopic pregnancy is rare event and the risk is increased with assisted reproductive technology procedures . heterotopic cervical pregnancy is even more unusual . we report a rare case of heterotopic cervical pregnancy that was managed successfully . a 36-year - old women who conceived by ivf - icsi was diagnosed with heterotopic cervical pregnancy . she visited the emergency room with vaginal bleeding at 5 weeks of gestation and underwent careful intracervical gestational sac reduction with forceps under abdominal guidance the next day . the postoperative course was uneventful and with regular check - ups , the intrauterine pregnancy ( iup ) progressed unremarkably through 41 weeks with delivery of a healthy newborn . we reviewed a total of 37 cases of heterotopic pregnancy that have been reported in the english language literature . there have been many attempts to eliminate the cervical embryo while preserving the iup , and complete cervical evacuation is important in order to avoid infection , bleeding , and premature birth .

please summarize the articles given below

wegener s granulomatosis ( wg ) is an uncommon necrotizing vasculitis that most commonly affects the upper airways , lungs and kidneys , but can involve any other organ . the disease presents with varying symptoms and signs and early recognition and initiation of adequate immunomodulatory therapy are essential in limiting the potentially life - threatening aspects of the disorder . we report a case illustrating that wg may present with localized , cutaneous manifestations preceding systemic disease . an 18-year old caucasian man presented with a painful rash on the truncus that had developed over the course of a few weeks . the patient was known to have type-1 diabetes mellitus since the age of 8 , but was otherwise healthy and reported no recent travel activity or antecedent trauma to the affected area . objective examination of the skin revealed inflamed cystic and nodular lesions confined to the chest and left shoulder , but there was no significant suppuration or other apparent signs of infection . the condition resembled a case of severe acne , and initial histopathological examination of a skin biopsy supported this preliminary clinical diagnosis . a few weeks later the patient developed a sore throat and signs of upper respiratory tract infection including cough , dyspnoea and mild chest pain . the skin changes remained limited to the chest and shoulder but had clearly progressed and now appeared as deep vasculitic ulcerations , including multiple elements more than 0.5 cm deep ( figure 1 ) . these findings and symptoms were accompanied by several weeks of fever ( up to 39.6c ) , malaise and substantial unilateral facial pain , and the patient was admitted to a department of nephrology for further investigation and treatment . figure 1cystic and nodular lesions on the chest , notice necrotic wounds with element size ranging from a few millimeters up to 2 cm . in consistence with vasculitis the elements are inflamed and do not blanch on pressure . cystic and nodular lesions on the chest , notice necrotic wounds with element size ranging from a few millimeters up to 2 cm . the blood leukocyte and thrombocyte counts were normal as were liver and renal function tests , but c - reactive protein ( crp ) was 300 mg / l ( normal range , less than 10 mg / l ) and anti - neutrophil cytoplasmic antibodies including specific identification of proteinase 3 ( c - anca / pr3-anca ) was 223 ku / l ( normal range , less than 7 the patient s kidney function was continually assessed and monitored , but levels of creatinine and urea remained within normal ranges and examination of urine including microbiological analysis revealed no abnormalities . chest x - ray examination was performed and several lung infiltrates with caverns were noted . a subsequent ct guided lung biopsy demonstrated no sign of infection , but significant inflammation of the tissue was observed , and a diagnosis of wg with concomitant mononeuritis multiplex involving the trigeminal nerve was established . the patient received systemic methylprednisolone and cyclofosfamide pulse therapy , which resulted in prompt improvement of the clinical condition and skin lesions as well as a decrease in the crp and anca titers . shortly after , however , the patient developed fever and renewed elevation of the c - anca / pr3-anca , and treatment was supplemented with rituximab leading to immediate resolution of symptoms and no residual pulmonary or cutaneous sequelae on recent follow - up . our patient initially presented with a localized rash on the truncus , but his condition was insidiously complicated by malaise , fever and progression of the cutaneous lesions , and ultimately a diagnosis of systemic wg was established . the etiology of the disease remains unknown , however , several studies suggest that infectious antigens and especially s. aureus may contribute to the pathogenesis of vasculitis in susceptible hosts . the clinical presentation of wg is complex and found to be dependent on the number of organs affected and the duration of the disease . as in our case , the clinical course of wg is characterized by an initial or localized phase which may affect any organ followed by a generalized or systemic phase in approximately 80% of cases . however , in most patients specific cutaneous findings develop concurrently or after the onset of systemic involvement and affect the head or extremities , but in our case they were confined to the truncus and preceded systemic symptoms and signs , which has only seldomly been described . in wg specific cutaneous lesions are seen in approximately 15% of cases , and are usually associated with renal disease and musculoskeletal affection , but this was not noted in our patient . patients may develop more than one type of cutaneous lesion and these may change over time or with treatment , but several studies have identified palpable purpura as the most characteristic cutaneous lesion , and nodules , papules , ulcerations and deep erythema nodusum - like subcutaneous nodules complete the clinical spectrum . oral involvement is not uncommon in wg , but this was not observed in our patient during the course of the disease . in this present case the level of c - a nca / pr3-anca was markedly elevated , and anca positivity has been found to occur in 9095% of cases with active wg . however , as levels correlate with disease activity and relapses in the absence of anca are rare , repeat testing and evaluation of blood biochemistry in order to follow the course of the disease is highly recommended . as illustrated by our case the diagnosis of wg represents a challenge and is based on anamnestic information closely correlated with clinical features , pathologic findings and anca testing . relevant differential diagnoses are numerous and include leukocytoclastic vasculitis , henoch - schnlein purpura , pyoderma gangrenosum , lymphoma , erythema nodosum , rheumatoid arthritis , drug reactions , and a variety of infectious conditions . however , like wg , these conditions often present with varying and uncharacteristic symptoms and signs and , as in our case , dermatological evaluation may provide valuable diagnostic information . if untreated , systemic wg leads to more than 90% mortality in the first two years , hence early recognition and initiation of adequate immunomodulatory treatment are essential and associated with significantly decreased morbidity and mortality . high dose corticosteoroids and pulsed intravenous cyclofosfamide remain the mainstay of initial therapy , but relapse and refractory wg still represent therapeutic challenges . however , data from recent studies evaluating biological therapies , including tnf- blockers ( infliximab ) and monoclonal antibodies ( rituximab ) are promising and future treatment regimes will hopefully further improve the outcome of this patient group . we report a case illustrating that patients with wg may initially present with localized cutaneous symptoms and signs preceding serious systemic disease . prompt recognition of the condition and initiation of early and adequate immunomodulatory therapy is crucial in order to reduce mortality and morbidity . dermatologists therefore need to be aware of wg as a possible differential diagnosis , especially in patients presenting with characteristic skin manifestations and accompanying systemic symptoms and signs . primary spontaneous pneumothorax ( psp ) is a benign disease , usually occurring in young patients without known underlying lung disorder . the occurrence rate is reported to be about 9 individuals per 100 000 each year . depending on the individual severity , the therapeutic options include simple observation , needle aspiration , tube thoracostomy and definite operation . if surgery is indicated , video - assisted thoracoscopic surgery ( vats ) using an endoscopic linear cutter to resect the involved blebs is currently the most popular treatment . nevertheless , we try to avoid using the endoscopic staple device at our hospital because payment for the device is excluded by the national health insurance system in taiwan . thanks to the increased experience with therapeutic thoracoscopy that we have gained in recent years , we used the technique of thoracoscopic suturing to imbricate the blebs , without resection , to treat the air leakage in psp patients , and report here our early results . from january 2001 to april 2002 , we had 50 episodes of primary spontaneous pneumothorax in 49 patients referred for the operation . among them , 26 patients with 26 episodes received transaxillary thoracotomy with or without assisted - thoracoscopy inspection . twenty - one patients with 22 episodes of psp received vats wedge closure by suturing . in this study , we dealt solely with the vats group . study patients included 2 female and 19 male patients , with a mean age of 25 years , ranging from 16 to 52 years . these 2 female patients were much older than the other patients , being 52 and 45 years of age , respectively . because of no abnormal pulmonary disease except for the attack of pneumothorax the surgical indications included recurrences in 11 episodes ( 10 patients ) , prolonged air leakage for more than 5 days in 4 episodes ( 4 patients ) , and apical blebs seen on radiography in 2 episodes ( 2 patients ) . five patients in 5 episodes underwent the operation owing to fear of recurrence , thus not fitting the above indications . the patients were kept in the lateral decubitus position after anesthesia was administered with single - lung ventilation . the first 10-mm port was created in the 7th intercostal space ( ics ) , mid - axillary line . the second 5-mm and third 10-mm ports were created in the 5th ics , anterior - axillary , and posterior - axillary line , respectively . after the full exploration of the lung surface , the involved blebs were sutured with an absorbable ( 3 - 0 ) vicryl polyglactin suture ( ethicon endo - surgery , inc , cincinatti , oh ) . the curved needle had to be straightened before it could be put into the trocar port . if no bleb was found , the apical scar area was sutured in the same way . coagulation of parietal pleura by the endo - instrument was routinely performed in all patients to achieve pleurodesis . the mean disease duration from attack to operation was 5 days , ranging from 1 to 30 days . the mean operation time was 133 minutes , ranging from 80 minutes to 270 minutes . the mean hospital stay after the operation was 4 days , ranging from 3 to 8 days . three patients complained of prolonged intermittent intercostal neuralgia during the follow - up period , and 1 patient suffered dehiscence at the chest tube port . during the mean 6-month follow - up , ranging from 1 to 16 months , most patients recovered well , except 2 patients who experienced recurrences . vats endo - suturing of the leaking area was performed again , with apical pleurectomy for this patient . the suture - puncture of the leaking blebs , instead of the normal tissue , in the prior operation was condemned . no bleb was found in her prior vats . a relationship between the attack and her menstruation no matter what surgical approach is executed , the goal of treatment is to find the offending bleb , remove it , and perform some manipulations to encourage adhesion formation . recently , video - assisted thoracoscopic surgery ( vats ) has been shown to produce results comparable to those obtained following open thoracotomy , yet with a reduction of postoperative pain , respiratory dysfunction and catabolic response to trauma , and decrease in wound - related complications . we believe that for psp vats is the best treatment , as abdala et al recommend , because it allows us to treat the ruptured bleb radically avoiding any recurrence . however , it is not the treatment of choice for all physicians due to the high cost of the equipment and the stapling devices needed for the wedge resection of the involved blebs . in taiwan due to the financial policy of the national health system , the charge of the high price of the endo - stapling instruments to the patient always concerns us , which is just the same as that in yim 's report . finding a way to replace the endo - stapling method endo - suturing is not a new skill , and it is widely applied in laparoscopic surgery . nevertheless , using the endosuturing method to treat spontaneous pneumothorax was only reported by yim in 1995 in the english literature . because the incurred blebs are always idiopathic in patients with primary spontaneous pneumothorax , we think that it is not necessary to remove them . furthermore , the preserved bleb tissues are of help in wound healing and prevent air leakage from the wound , which can shorten the duration of the chest tube insertion . therefore , the length of suturing is not a problem , and in 1 case a 10-cm suturing - line was performed without prolonged air - leakage . without adequate treatment , the recurrence rate after the first pneumothorax on the same side is about 25% , and after the second episode , more than 50% . although no general agreement exists about the best time for surgical intervention ( ie , after the first or second episode ) , vats therapy is now accepted as a definite treatment even in the first episode . in this study they were all well informed about the conventional indication of the surgery before being included in this study . ventilation of 1 lung is mandatory in this procedure because complete lung collapse promotes the effect of suturing . the suture tension becomes tight enough to stop any air leaks after the lung fully expands . in addition , the tissue of the bleb itself can be used as a buttress to enforce the suturing area . the recurrence rate after the vats operation is reported to be high , between 13.7% and 20% , due to newly formed blebs or bullae unidentified during operation . recently , a favorable 2.1% recurrence rate by vats has been reported by maier et al who use a rotating brush as a supplement . , the cause of recurrence is thought to be improper suturing with direct puncture of the blebs during the operation and thus the leakage area is not repaired well . during reoperation by vats , the air leak was found near the previous sutured area , which adhered intensively to the parietal pleura . step - by - step dissection has to be carefully executed to prevent tissue damage during the second - look operation . therefore , we have an 9.1% ( 2/22 ) recurrence rate , which is acceptable compared with that of the other vats reports . the coagulation pleurodesis seems ineffective if the definite treatment of the ruptured blebs is not accurately executed . it is thought that the limited pleura being applied via the 3 small ports during vats renders coagulation pleurodesis ineffective . the incidence of chronic postoperative complaints after minimally invasive procedures for spontaneous pneumothorax is relatively high . in the majority of the patients , two of our patients complained of intermittent anterior chest pain in the ipsilateral side , which may have been due to concurrent injury to the intercostal nerve at the trocar site . the vats wedge closure of the blebs by suturing , without resection of the involved blebs , is a feasible and effective alternative treatment for primary spontaneous pneumothorax if cost of the endo - stapler is regarded as a major problem .

wegener s granulomatosis ( wg ) is a rare , systemic vasculitis involving multiple organs . the clinical presentation is highly diverse , and there is considerable risk of mortality if diagnosis and treatment are delayed . we present a case illustrating that patients with wg may initially present with localized cutaneous symptoms and signs .

please summarize the articles given below

the adenoma is solitary in 8590% of patients , while others have multiple adenomas or parathyroid hyperplasia . accurate preoperative localization is essential for good surgical outcome , and inability to locate the adenoma in an ectopic gland may delay the diagnosis . nuclear imaging accurately localizes the tumor in more than 90% of cases , obviating the need for advanced imaging modalities . rarely , patients present with localization failure posing a great challenge to the treating endocrinologist and operating surgeon . we report the use of a novel imaging method leading to successful outcome in a patient of primary hyperparathyroidism with failed first surgery . a 54-year - old lady presented with body pains and muscle aches for 1-year duration to a peripheral hospital . investigations revealed high serum calcium ( 11.6 mg / dl ) , low phosphorus ( 2.6 mg / dl ) , elevated alkaline phosphatase ( 677 u / l ) and intact parathyroid hormone ( ipth ) of 116 pg / ml ( normal 10 - 65 pg / ml ) . sestamibi scan revealed right inferior parathyroid adenoma , and she was diagnosed as a case of primary hyperparathyroidism . she underwent adenomectomy along with thyroidectomy and showed no features of hungry bone syndrome postoperatively . there was no confirmation of parathyroid adenomectomy by using intraoperative pth levels or by frozen section of the removed tissue . her clinical symptoms persisted after surgery and histopathological examination of the specimen removed showed thyroid tissue with no evidence of parathyroid adenoma . she reported to us after 6 months of initial surgery with persisting complaints of body aches and myalgia . her clinical examination was unremarkable , with a normotensive blood pressure , and well - healed scar in the neck . serum biochemistry revealed elevated calcium ( 10.8 mg / dl ) , low phosphorus ( 2.8 mg / dl ) and elevated alkaline phosphatase ( 280 bone mineral density estimation revealed a t - score of -2.2 at hip joint and z - score of -2.3 . serum 25 hydroxy vitamin d level was 22 ng / l and parathyroid hormone was elevated ( ipth-140 pg / ml ) . localization with sestamibi scan revealed right inferior parathyroid adenoma with no tracer uptake in thyroid bed [ figure 1 ] . abdominal sonography showed normal renal parenchyma and ultrasonography neck and plain ct neck did not show parathyroid adenoma . tc 99 m sestamibi scan showing right inferior parathyroid adenoma in view of past history of failed surgery , tc 99 m sestamibi single photon emission computed tomography ct ( spect ) was done for precise localization of the adenoma prior to re - exploration . it revealed an ectopic parathyroid adenoma , located suprasternally in the pretracheal region on right side [ figure 2 ] . histopathological examination of the specimen confirmed the parathyroid adenoma . during last follow - up , 1 year after second surgery the patient is free of all symptoms and had normal serum calcium , phosphorus and alkaline phosphatase values . sestamibi emission computed tomography ct showing parathyroid adenoma pretracheal in location ( coronal and sagittal views ) the disease is detected during asymptomatic stage in developed countries , while we encounter the advanced spectrum of the disease with severe metabolic bone disease . precise localization is important to prevent further delay in definitive therapy after biochemical confirmation of the diagnosis . parathyroid glands are derived from pharyngeal pouches ( superior parathyroid glands from 4 and inferior from 3 pouch ) with subsequent caudal migration . the modalities available for precise localization of a parathyroid adenoma are palpation , ultrasonography ( usg ) , ct , mri , nuclear scintigraphy , and combination of these tests . ultrasonography is useful for its wide availability , convenience , cost and a guiding tool for the surgeon before surgery . however , the sensitivity and specificity of usg reported was 73% and 100% , respectively . ct and mri scans provide excellent spatial resolution but often miss a small parathyroid adenoma . this is recommended mostly in cases of failed surgery , recurrent disease and when planned for a limited surgical exploration . immediate imaging reveals the tracer uptake in both thyroid and parathyroid gland along with adenoma but the adenomatous tissue shows retention of the tracer in delayed images . spect scan is an advance in radionuclide studies with a three - dimensional ( 3-d ) reconstruction , further increasing the sensitivity for adenoma localization . spect scan , with its 3-d capability , combined with ct images , is very helpful in directing the surgeon particularly in recurrent or residual hyperparathyroidism . recent reports suggest that spect / ct is superior to spect scan alone for localization of parathyroid adenoma with nodular goiter , distorted neck anatomy and those with ectopic parathyroid glands . to conclude , our patient had an ectopic parathyroid adenoma resulting in failed initial surgery . use of a novel imaging modality like spect helped in accurate localization of the adenoma prior to repeat surgical exploration . acute hemorrhagic leukoencephalitis ( ahle ) is a rare fatal disease presenting with an acute onset of neurological abnormalities . it is categorized in a group of diseases called acute disseminated encephalomyelitis ( adem ) . in this disease , an acute rapidly progressive hemorrhage in the white matter leads to a fulminant clinical course . the first presentations are fever and a rapid deterioration of consciousness , but it may finally lead to death within a few days . the acute onset of a rapidly progressive neurological disorder with asymmetric involvement of the brain , polymorphonuclear predominant peripheral leukocytosis , cerebrospinal fluid ( csf ) pleocytosis , and specific findings in the serial computed tomography scans or magnetic resonance imaging ( mri ) are the main criteria for the diagnosis . the areas involved in the majority of the cases are the parietal lobes , but the lesions can be seen in the subcortical white matter , mid brain , pons , corpus callosum , basal ganglia , medulla , cerebellum , and even spinal cord . the imaging techniques may also complicate the diagnosis as computed tomography and mri might show nonspecific findings such as hematoma in the basal ganglia and ventricles . in addition , symmetrical low density areas in the bilateral white matter might result in a false preliminary diagnosis of hemorrhagic cerebrovascular disease . in this case report , we present a case of ahle in children . a 13-year - old girl with loss of consciousness and right - sided parotiditis was referred to our center , imam reza hospital , mashhad university of medical sciences , from a hospital in herat ( northern afghanistan ) . she had been admitted to that center 4 days previously because of fever and loss of consciousness . according to the girl s mother , the right side of her face was swollen on the evening of the first admission . the loss of consciousness had begun with drowsiness , which had progressed to unresponsiveness to the verbal stimuli and poor response to painful stimuli by midnight . eventually , the patient had become completely unresponsive to any stimuli in the hospital in herat . after the initiation of supportive measures and performance of lumbar puncture , intravenous ceftriaxone , vancomycin , and acyclovir ( 30 mg / kg / d ) was commenced for the patient . after she was admitted to our center , an informed consent was obtained from her parents . her consciousness deteriorated even more , and she became completely unresponsive to verbal stimuli . within 2 days , she developed respiratory failure and a decerebrated posture and subsequently spasticity of the four limbs and rigidity of the left leg . her initial mri revealed multifocal hemorrhages without edema in the right temporal white matter ( figure 1 ) . in complete blood count lumbar puncture performed in the hospital in afghanistan , the csf showed an elevated white blood cell count ( 3 - 4 cells / mm ) and an increased protein level ( 69 mg / dl ) . the culture of the csf regarding bacterial and viral infections was negative , although there were some limitations to serological tests , including deficit of technical instrumentations in our hospital . the result of immunological and microbiological studies , comprising hepatitis b surface antigen , anti - hepatitis a virus and hepatitis b virus , and polymerase chain reaction for herpes simplex virus , were all negative . the laboratory tests for mycoplasma and tuberculosis as well as the csf culture were also negative . coagulation tests such as bleeding time , prothrombin time , partial thromboplastin time , and platelet count were normal . no abnormality was found in electrolyte analysis and biochemical studies such as blood sugar and liver function tests . a second mri ( 20 days later ) showed multiple hemorrhagic lesions in the pons and thalamus of both sides ( figure 2 ) . our diagnosis was according to clinical , radiological , and laboratory findings , and there were no pathological examinations to confirm it . there are multiple hemorrhagic lesions in the pons and thalamus of both sides . with a diagnosis of ahle , our patient was treated with methylprednisolone ( 20 mg / kg pulse therapy ) , intravenous immunoglobulin ( ivig ) , acyclovir ( 30 mg / kg / d ) , and plasmapheresis ( 3-hour sessions for 3 times ) . after 29 days stay in the pediatric intensive care unit and under supervision of pediatric toxicologists and neurologists , she was extubated and attained a remarkable healing . her mri demonstrated improvement ( figure 3 ) . at one year s follow - up , the treatment was completely successful and neurological examinations , comprised of mental status , motor skills , sensory skills , balance and coordination , reflexes , and functioning of the nerves , were all normal . ahle is a rare demyelinating disease characterized by an acute rapidly progressive fulminant inflammation of the white matter . it is a more severe form of adem and is characterized by a fulminant clinical course . it is usually preceded by an infectious illness such as measles , mumps , rubella , and respiratory infections . nevertheless , no virus or other infectious agent has been isolated from the csf or brain in case of adem . considering clinical and imaging findings , the differential diagnosis of this disease are hemorrhagic cerebrovascular disease , infectious encephalitis , meningitis , vasculitis , fulminant multiple sclerosis , other causes of adem , and venous sinus thrombosis . most of the patients experience a viral , bacterial , or parasitical infection and usually have fever at the time of admission . however , infectious encephalitis and meningitis are similar to ahle as they are both usually preceded by an infectious disease such as measles , mumps , and respiratory tract infections . our patient had parotiditis on admission , which is in favor of a viral infection . in two different reports , befort and francisci presented cases of ahle after epstein - barr virus infection in adults . nonetheless , as can be observed in our patient , besides differences in the clinical presentations and course of the disease , vasculitis usually manifests on mri as smaller multiple lesions that are both in the cortex and in the white matter . moreover , serological tests for collagen diseases , which are used for the diagnosis of vasculitides , were negative in our patient . fever , leukocytosis , and csf features , which were seen in our patient , are not compatible with the diagnosis of acute fulminant multiple sclerosis . the absence of oligoclonal bands is another characteristic for the exclusion of acute fulminant multiple sclerosis . it is very difficult to distinguish other causes of adem from ahle based on clinical and mri findings , and diagnosis is basically made via biopsy . however , there are certain epidemiological , clinical , laboratory , and pathological distinctions between them . for instance , adem is mainly a disease of children , whereas ahle is more common in young adults . in addition , ahle presents more acutely and has larger and more edematous lesions with features of hemorrhage . in our patient , several findings , including acute fulminant course of the disease , a history of parotiditis , csf profiles , indicative immunological and bacteriological tests , and mri results , strongly supported the diagnosis of ahle . previous studies have shown that treatment with iv methylprednisolone , ivig , acyclovir , and plasmapheresis are helpful and can be life - saving . following the same protocol , our patient recovered and was extubated . still , as there is evidence that ahle might have a biphasic presentation , our patient should be followed up for a longer time period with several mris . ahle is a rare and severe demyelinating disease , the mortality and morbidity of which can be lessened by early detection and treatment with steroid therapy , ivig , acyclovir , and plasmapheresis .

primary hyperparathyroidism often presents with protean manifestations , resulting in delayed diagnosis . at times , aberrant development and migration of the gland leads to ectopic location leading to problems in localization . judicious use of combination methods of localization is recommended in treatment failure or recurrent disease . we report the use of single photon emission computed tomography - ct in precise localization of parathyroid adenoma in a patient with failed initial surgery .

please summarize the articles given below

ala - al - din abu al - hassan ali ibn abi - hazm al - qarshi al - dimashqi , known as ibn al - nafis ( 1210 - 1288 ad ) , was a muslim syrian physician primarily famous for being the first to describe the pulmonary circulation of the blood . the most voluminous of his books is alshamel fi sanaat tebbiat , which is a comprehensive medical encyclopedia . the aim of this review article , as a tribute to ibn al - nafis , was to introduce his valuable but neglected encyclopedia of materia medica . ibn al - nafis traditional approach in his alshamel fi sanaat tebbiat book is studied in the present article . alshamel fi sanaat tebbiat covers three branches of knowledge . the first category is devoted to theoretical traditional medicine . the third category is on materia medica covering the aspect of unani medicine , from which only 28 volumes of the comprehensive book on the traditional medicine have been found so far . the latter , introduces mono - ingredient medications in alphabetical order . each chapter , in several parts , is dedicated to the botanical characteristics and nature of each mono - ingredient medication . in addition , this book explains traditional pharmacokinetic of every single medication for each human body organs . based on pharmaco - mechanistic perspective on alshamel fi sanaat tebbiat , it could be considered as the main reference book on traditional medicine and pharmacy , worthy of revival . fondaparinux sodium is a new synthetic , sulfated pentasaccharide , selective coagulation factor xa inhibitor , a safe and effective antithrombotic agent , which is indicated for preventing thrombus formation in patients with acute coronary syndromes , including those with st - segment elevation myocardial infarction ( stemi ) , non - stemi ( nstemi ) , or unstable angina . it is a pure , unique chemical entity consisting of five saccharide units ( pentasaccharide ) obtained entirely by chemical synthesis . however , inhibition of factor xa results in effective and linear dose dependent inhibition of thrombin generation , whether triggered by intrinsic or extrinsic pathways . unlike conventional antithrombotics such as lmwhs ( enoxaparin ) , which act on multiple targets within a coagulation cascade thereby , increasing the propensity of causing more bleeding complications . thus fondaparinux has a favorable tolerability profile , particularly with regard to the risk of major bleeding . in the oasis-5 trial , fondaparinux has been shown to reduce major bleeding with similar short - term efficacy as enoxaparin and lowers death and stroke during long - term follow - up in patients with acute coronary syndromes undergoing percutaneous coronary intervention . similarly , it has been shown superior to enoxaparin in reducing death or ischemic events at 9 days maintaining the efficacy up to 6 months in patients with unstable angina or nstemi with major bleeding occurring in fewer fondaparinux than enoxaparin recipients . on comparison with a heparin - based therapy , fondaparinux reduce mortality , ischemic events and major bleeding across the full spectrum of acute coronary syndromes . thus , it is assumed and projected from the existing knowledge that fondaparinux being more selective in its action may prove safe and efficacious . there are few reports of heparin - induced thrombocytopenia ( hit ) related to fondaparinux in a patient previously exposed to unfractionated heparin ( ufh ) and delayed - onset hit caused during its prophylaxis . in contrast , it is used sometimes off label in the management of hit with thrombosis . major bleeding is known to exist with the use of fondaparinux in previously exposed heparin user but to best of our knowledge there exist no isolated case report presenting with fondaparinux - induced major bleeding in elderly postmenopausal women prescribed for recently diagnosed nstemi . we hereby report a rare case of fondaparinux - induced major bleeding in a 58-year - old postmenopausal woman , a known hypertensive and type 2 diabetes mellitus ( t2 dm ) patient prescribed for nstemi reported in our adrm centre . the patient presented in the emergency with complaints of chest pain not relieved by sublingual nitrate . on examination pulse rate was 94/min , regular , normal volume , no radio - femoral delay , and vessel wall not palpable . blood pressure ( bp ) measured in both limbs was 160/90 mmhg . laboratory investigations revealed hb 11g% , tlc 8400/cmm , platelet count 2.4 lacs / cmm , rbs 194 mg% , blood urea 29 mg , serum creatinine 0.9 mg , hba1c 7.8% , serum cholesterol 245 mg% , serum triglyceride 185 mg% , hdl 35 mg% . ecg was done immediately , which showed nstemi and a positive 10 hour troponin - t assay . patient was treated with oxygen , morphine , beta blocker , ace inhibitor , statins , aspirin , and clopidogrel , fondaparinux 2.5 mg once daily by subcutaneous route . third day patient developed purpura and extensive ecchymosis in right arm and forearm [ figures 1 and 2 ] . the patient also developed epistaxis lasting > 10 min , which required ent intervention as well as macroscopic hematuria lasting for 3 days . there were no signs of deep venous thrombosis , pulmonary embolism , gangrene , retroperitoneal , intracranial , or intraocular hemorrhage in the patients as suggested by usg abdomen and mri brain . based on clinical and laboratory findings , a diagnosis of fondaparinux - induced major bleeding was established . after which platelet count and hb rapidly reestablished to 1.5 l / cmm and 8.9 g% . she was discharged in a satisfactory condition after 15 days of hospitalization and is now regular follow up and prophylaxis treatment of mi . since the adr was serious and most likely thought to be associated with fondaparinux because of its previous known few reports . extensive ecchymoses in right arm and forearm of a patient extensive ecchymoses in right arm and forearm of a patient ( closer view ) de - challenge of drug and blood / platelet transfusion caused adr to ameliorate . further re - challenge was not done with the fear of reappearance of adr and due to ethical constrains . thus , the appearance of major bleeding could not be explained by a concurrent disease as such , drug or chemicals and de - challenge improved the condition . probable / likely as per causality assessment with the score 6 . since this adr was not studied for dose dependent response and was unpredictable / unusual as per mechanism of action is known , hence it could not be clearly labeled as type - a or b class of adr . anticoagulation , traditionally with ufh is a cornerstone of therapy for patients of unstable coronary artery disease ( cad ) . however ufh exhibits unpredictable anticoagulant effect , which requires frequent monitoring and has low bioavailability due to high protein binding and induced thrombocytopenia . an effort to avoid this inherent limitation of ufh has led to introduction of low molecular weight heparin ( lmwh ) . enoxaparin , dalteparin , nadoparin , reviparin , and latest addition in the armamentarium in countering the thrombotic events in unstable cad is fondaparinux . it is a synthetic pentasaccharide that acts as a selective inhibitor of activated factor x. the mechanism of action of fondaparinux involves high affinity ( but reversible ) binding to antithrombin iii and a resultant conformational change in the serpin 's reactive loop that greatly enhances antithrombin iii 's basal rate of factor xa inactivation . fondaparinux acts as an antithrombin iii catalyst , with one molecule of fondaparinux leading to inhibition of many factors xa molecules . because of its selectively , it is proposed to be devoid of major bleedings , unlike current report . as longevity is constantly increasing , the numbers of elderly patients who require anticoagulation are also rising steadily . managing elderly patients receiving anticoagulants is challenging because those patients are at high risk of both thrombosis and bleeding . moreover , older patients are commonly frail ; they have substantial chronic comorbid conditions including renal impairment and frequent acute illnesses and are often on many medicines . there remains a clear need to optimize the use of anticoagulant drugs in these patients as suggested by current case report . the current case report highlights , a need for clinicians to have a sound understanding of anticoagulant pharmacology , dosing , toxicity , individualized approach , and predicting the risk of bleeding before they are prescribed to advancing age persons .

background : ala - al - din abu al - hassan ali ibn abi - hazm al - qarshi al - dimashqi , known as ibn al - nafis ( 1210 - 1288 ad ) , was a muslim syrian physician primarily famous for being the first to describe the pulmonary circulation of the blood . the most voluminous of his books is alshamel fi sanaat tebbiat , which is a comprehensive medical encyclopedia . it comprised 300 volumes of notes , from which only 80 volumes are published . his writings are cataloged in many libraries around the world . the aim of this review article , as a tribute to ibn al - nafis , was to introduce his valuable but neglected encyclopedia of materia medica.methods:ibn al - nafis traditional approach in his alshamel fi sanaat tebbiat book is studied in the present article.results:alshamel fi sanaat tebbiat covers three branches of knowledge . the first category is devoted to theoretical traditional medicine . the second is in four sections where much of it is not available yet . the third category is on materia medica covering the aspect of unani medicine , from which only 28 volumes of the comprehensive book on the traditional medicine have been found so far . the latter , introduces mono - ingredient medications in alphabetical order . each chapter , in several parts , is dedicated to the botanical characteristics and nature of each mono - ingredient medication . in addition , this book explains traditional pharmacokinetic of every single medication for each human body organs.conclusion:based on pharmaco - mechanistic perspective on alshamel fi sanaat tebbiat , it could be considered as the main reference book on traditional medicine and pharmacy , worthy of revival .

please summarize the articles given below

fixed drug eruption ( fde ) is a distinctive variant of drug induced dermatoses characterized by sharply demarcated , erythematous patches with / without blistering that develop within hours of administration of the causative drug and heals with postinflammatory residual hyperpigmentation . it usually recurs at the same site of the skin or mucous membrane upon subsequent exposure to the same / similar group of drugs . fluoroquinolones are widely used antimicrobials , which cause cutaneous adverse drug reactions in about 1 - 2% of patients . however , bullous fde is rarely reported . herein we report a rare case of fde induced by ciprofloxacin followed by ofloxacin administration . a 37-year - old male presented to the outpatient dermatology department of our hospital , puducherry with a history of multiple fluid filled blisters over both hands and feet [ figures 1 and 2 ] . he stated that the lesions appeared within 5 h of taking a single dose of oral ofloxacin , which was obtained as over the counter drug for fever from a local private medical shop . history of itching over both hands and feet followed by a burning sensation and the subsequent development of multiple fluid filled lesions were present . there was no previous history of any medical conditions such as allergy or atopic dermatitis . on further inquiry , he recalled a history of a similar episode about 1 year back for ciprofloxacin , which has been prescribed for fever . at that time physical examination revealed multiple flaccid bullous lesions with intact roof of the blister in an erythematous base were seen over proximal metacarpophalangeal joint of left thumb , left instep of sole , right dorsal big toe and little toe of left foot . diagnosis of fde caused by ofloxacin was made taking into account of previous history of fde induced by ciprofloxacin and clinical signs . patch test was not done as the patient did not give consent for the same . the causative drug ofloxacin was discontinued and the patient was treated with antihistaminics and topical emollients . the lesions and symptoms improved gradually within a week leaving behind residual hyperpigmentation and the patient was advised not to take fluoroquinolones in future . well - defined bullous lesion in the instep of left foot bullous lesions in the right dorsal toe fluoroquinolones are commonly used antimicrobials ( effective for both gram negative and gram positive bacteria ) in the treatment of various bacterial infections and are generally well tolerated . common side - effects include gastrointestinal effects ( nausea , vomiting and diarrhea ) and neuropsychiatric symptoms ( headache and insomnia ) . photosensitivity and morbilliform rash have been reported with fluoroquinolones , but fde is quite uncommon . a large number of drugs have been reported to elicit fdes such as trimethoprim - sulfamethoxazole , tetracyclines , penicillin , erythromycin , nonsteroidal antiinflammatory drugs , barbiturates , valproate , phenytoin , phenolphthalein , and nitroimidazoles . even though , the pathogenesis of fde is not known , certain serum factors , antibodies , and cell mediated immunity have been attributed as causative factors . localized tissue damage results when intra - epidermal cd t - cells are activated to kill surrounding keratinocytes and release cytokines such as interferon - gamma into the microenvironment . quinolones can cause both delayed type and ige - mediated hypersensitivity reactions . in this case , the following criteria were considered : there were previous conclusion reports on this reaction ( + 1 ) ; the adverse event appeared after ofloxacin was administered ( + 2 ) ; adverse event improved when ofloxacin was discontinued ( + 1 ) ; adverse event reappeared when ofloxacin was re - administered ( 0 ) ; alternate causes that could solely have caused the reaction ( + 2 ) ; the reaction reappeared when a placebo was given ( 0 ) ; drug detected in the blood ( or other fluids ) in a concentration known to be toxic ( 0 ) ; the reaction was more severe when the dose was increased or less severe when the dose was decreased ( 0 ) ; the patient had a similar reaction to ciprofloxacin in the previous exposure ( + 1 ) ; the adverse event confirmed by objective evidence ( + 1 ) . probable reaction to ofloxacin administration . according to who - uppsala monitoring centre causality assessment system patient had fde to ciprofloxacin 1 year back followed by similar reaction to ofloxacin in the current admission . cross - reaction between quinolone families , clinically manifested as fde , has been rarely reported in the literature . to the best of our knowledge , only one case of cross reactivity between ciprofloxacin and ofloxacin has been reported so far which proposed the probable mechanism would be a complex of quinolone and piperazine residue as the antigenic determinant for both ciprofloxacin and ofloxacin . bullous fde due to fluoroquinolones should be included in the differential diagnosis when fde is suspected . our case described the cross sensitivity between two fluoroquinolones ciprofloxacin and ofloxacin used within 1 year interval time . hence , health care providers should be aware of the diagnosis and proper management of fde . patients should be warned against the use of anti - microbials without the physician 's advice . fierce competition for better mating partners has been a driving force for evolution of diverse forms and behaviors in sex - related traits . during fertilization , sperms from multiple males this natural experimentation in every single fertilization has selected sperms that work best in their fertilization environment , leading to diversification of sperm morphology as a result of sperm competition . although tadpole - like sperm morphology in mammals represents a remarkable perfection as swimming cell machinery , extensive diversification of sperm morphology and physiology has been observed across other species , serving as a resource for resolving species phylogenies . evolution of sperm tail in insects and other arthropods is particularly rapid and diverse , ranging from aflagellate to multi - flagellate , and in some cases develops extraordinary long tails . during sperm competition , any advantageous traits of sperm to outdo its competitors ( better swimmer , longer survival , blocking competitors , dimorphism , etc . ) will directly contribute to fertilization and reproductive success in his descendant . females are also under a strong evolutionary pressure to gain control over the fertilization process to pick sperms from a particular male of their choice . among taxa as wide as birds , reptiles and insects , females have sperm storage organs specially adapted for sperm selection . thus , co - evolution of sperm and the female sperm storage organ has been reported in many species , sometimes leading them to develop bizarre morphology of these organs . the co - evolution of male and female reproductive traits in drosophila makes it a unique and powerful model for exploring the evolutionary consequences of post - copulatory sexual selection ( fig . the drosophilidae has great variation in sperm length , ranging from 300 m to 6 cm . the female has two storage organs , seminal receptacle and spermathecae , in which sperms stay in a fertile state waiting for ovulation . it has been shown that the length of the primary storage organ , seminal receptacle , positively correlates with sperm length across 46 drosophilidae species . the length of seminal receptacle range from 400 m to 8 cm , and in most of the cases is slightly longer than the sperm length . it was suggested that inside the thin tubular seminal receptacle , sperm from different males are mixed and compete with each other for a chance to reach the ovulated egg , and that a longer tail is helpful to position the sperm head closer to the exit from the seminal receptacle . indeed , it is empirically demonstrated that a longer sperm tail is advantageous for reproduction . it was hypothesized that the length of seminal receptacle and sperm tail have co - evolved , and the length incompatibility suppresses fertilization efficiency , thereby promoting reproductive isolation . in order to understand the genetic basis for sperm competition in drosophila , knowledge of the cellular basis for sperm tail elongation is necessary . we have undertaken a cell biological approach to identify the mechanism of sperm tail elongation in drosophila . two giant mitochondria elongate together with microtubules and push cell membrane of elongating sperm tail . study of sperm morphogenesis has been slow due to lack of both genetic tool and in vitro culture system for detailed observation of spermatogenesis . noguchi and miller have previously shown that carefully dissected spermatids ( 64 cell cyst ) from model animal drosophila melanogaster testes can be cultured in vitro and elongated spermatids separated into single sperms through individualization . axoneme , a major structure of sperm tail which propels the swimming motion , is dispensable for tail elongation because spermatids of axoneme - less mutants ( dsas-4 ) elongated reasonably well in vitro , consistent with the previous observation of immobile but well - elongated sperms in testes of the mutants . however , microtubule inhibitor experiments demonstrated that yet another microtubule - based structure is essential for sperm tail elongation . fluorescent microscopy and electron microscopic analyses revealed that cytoplasmic microtubules are located in the vicinity of mitochondria , arranged in parallel to the longitudinal axis of the sperm tail . based on live imaging and local drug treatment data , we found that microtubules at the tail tip region with particularly fast turn - over rate and active sliding motion are essential for sperm tail elongation . through genetic perturbation of mitochondrial functions , we discovered that mitochondria play an essential role in sperm tail elongation . in postmeiotic spermatids , a testis - specific mitofusin , fuzzy onions , promotes massive fusion of mitochondria to form two large pieces of mitochondrial derivatives called nebenkern . during spermatid elongation , giant mitochondrial lobes elongate in parallel to the axoneme to fill the entire length of sperm tail ( fig . when final mitochondrial length was reduced by mutations of fuzzy onions or no mitochondrial derivative , sperm tails failed to elongate to the maximum length . similar defect in elongation was observed in mutants of milton - dmiro complex , an adaptor linking mitochondria to microtubule motor protein kinesin . in addition , we found that the surface of spermatid mitochondria serves as a microtubule - organizing center ( mtoc ) , promoting assembly of microtubule array around themselves . we propose that double membrane architecture of mitochondria combined with cytoplasmic microtubules can serve as structural support for sustainable elongation of the sperm tail . elongation and sliding of microtubules in the growth zone would stretch folded mitochondria to expose open surface for new microtubule assembly . by repetition of this stretch cycle , giant mitochondria can be a self - promoted structural scaffold , in addition to its original role as energy sources needed for flagellar motion . first , it demonstrated that mitochondria play a novel role in cell morphogenesis acting as an inner skeleton of sperm tail . in other words , mitochondria , a double membrane organelle with mtoc activity , can actually determine the extracellular morphology of sperm . another double membrane organelle nucleus showing similar morphological diversification in sperm across species is also likely serving as an alternative shaping tool for sperm morphogenesis . second , this is a detailed cell biological study on tissue specific mitochondrial morphogenesis , which is poorly understood in the field of mitochondria biogenesis . typical mitochondria in somatic cells are 34 m in length and 1 m in diameter moving along microtubules and undergo fusion and fission process . however , in cells of many specialized tissues , great variations of mitochondrial number , size , and morphology have been reported . many of which are suggested to be related to their tissue specific functions . in the case of drosophila sperm morphogenesis , motor complex ( milton / dmiro / kinesin ) used for mitochondrial trafficking in neuronal cells are converted into an elongation machinery of much larger mitochondria . intriguing questions are whether the conversion of microtubule motor complex from mitochondrial trafficking and mitochondria dependent microtubule nucleation are general mechanisms required for morphogenesis of mitochondria in other type of cells , such as the ordered arrays within muscle fibers of muscle cells and the elongated forms in photoreceptor cells of human retina . having outlined the process of sperm tail elongation , we are in the position of starting a comparative analysis of spermatid elongation in drosophila melanogaster strains with long and short sperm . since sperm length variation appears to occur rapidly during regional separation , it should be possible to search for rapidly evolving genes among genes involved in key steps of spermatid elongation . in addition , gigantic sperms in drosophilidae appear to have multiple evolutional origins ; it will be of interest to search for the crucial process that may have permitted the appearance of long sperm by asking which step of sperm elongation differs most between closely related species of long and short sperm . measurement of the size of spermatocyte and nebenkern , speed of elongation , time required to reach full length and requirement of microtubules and mitochondria should clarify whether the mitochondria - driven elongation mechanism is used in other drosophilidae species with extremely long sperms . one of the main questions in speciation is the identification of mechanism for reproductive isolation , reducing gene exchange between two populations and enhancing the chance of speciation genes to fix among them giant sperm are reported from a range of taxa including the coleopterans divales bipustulatus , ptinella patella , hemipteran notonecta glauca and the lepidopteran xenosoma geometrina . also , large mitochondria are the most frequent feature of sperms among insects and arthropods . thus , the sperm - elongation mechanism described in this report might be a general system for facilitating sperm - size variation among insects with giant mitochondria , thereby enhancing sexual selection and reproductive isolation . moreover , recent advance in transgenesis and gene knockout technologies has made genetic analysis in non - model insects more feasible . therefore , cell biological analyses we performed on drosophila melanogaster may be applied to other species . taken together , our study revealed a novel mechanism of cell elongation and set a road map for future study to address the genetic basis for sperm competition and reproductive isolation .

fixed drug eruptions ( fde ) are the common dermatological adverse drug reaction accounts for 1621% of all cutaneous drug reactions in india . drugs most frequently implicated in fde are antimicrobials , anticonvulsants , and nonsteroidal antiinflammatory drugs . here , we report a rare case of bullous fde due to ciprofloxacin followed by ofloxacin administration .

please summarize the articles given below

though both minor and major spontaneous or post - operative bleeding is the most common presentation of this rare disorder , there are several case reports of thrombotic complications also . there are few reports of myocardial infarction ( mi ) in the literature in patients of afibrinogenemia . a 33-year - old man , who was a confirmed case of congenital afibrinogenemia and was diagnosed six years back when he had excessive bleeding following trauma over face and persisted even after suturing that area , presenting to us with severe retro sternal chest pain of 10 h duration . he had a past history of myocardial infarction ( mi ) two years back and was advised dual antiplatelet therapy . he was born of second degree consanguineous marriage with history of sibling death after birth . on admission , electrocardiogram showed 2 mm st segment elevation in leads ii , iii , avf and st depression in leads i and avl [ figure 1 ] . troponin t obtained at admission was strongly positive with 1.24 ng / ml ( normal- < 0.1 ng / ml ) . coagulation profile was sent after admission and tests revealed absent fibrinogen using the clauss method , markedly reduced fibrinogen antigen level , normal platelet count and bleeding time , infinitely prolonged activated partial thromboplastin time ( aptt ) , prothrombin time ( pt ) and thrombin time . prominent q wave , st segment elevation and t wave inversion in lead ii , iii and avf with st segment depression seen in lead i and avl . right sided chest leads ( v4r - v6r ) showed < 1 mm st segment elevation as this patient had high risk for bleeding , thrombolysis or primary percutaneous transluminal coronary angioplasty ( ptca ) was not advised though he had ongoing chest pain . he was treated with dual antiplatelet therapy ( aspirin plus clopidogrel ) , statins , betablocker , angiotensin converting enzyme inhibitors and injection nitroglycerin ( ntg ) . after few hours of treatment , the chest pain subsided and st segment showed evolving changes . his admission lipid profile was normal ( low density lipoprotein 112 mg / dl , triglyceride 128 mg / dl , high density lipoprotein 40 mg / dl ) . the patient did not experience a recurrence of angina and was discharged three days after admission with dual antiplatelet therapy . fibrinogen is the major coagulation protein in blood by mass : normal fibrinogen levels vary between 1.5 and 3.5 bleeding , which usually manifests already in the neonatal period ( 85% of cases presenting umbilical cord bleeding ) , is the main complication of afibrinogenemia . paradoxically , both arterial and venous thromboembolic complications have also been reported in afibrinogenemic patients . these complications can occur in the presence of concomitant risk factors such as a co - inherited thrombophilic risk factor or after replacement therapy . first , even in the absence of fibrinogen , platelet aggregation is possible due to the action of von willebrand factor and , in contrast to patients with hemophilia , afibrinogenemic patients are able to generate thrombin , both in the initial phase of limited production and also in the secondary burst of thrombin generation . second , the increase of prothrombin activation fragments or thrombin - antithrombin complexes have been observed , reflecting enhanced thrombin generation . so , antithrombin role has also been attributed to fibrinogen because in its absence , clearance of thrombin is impaired . though there are several reports of both arterial and venous thrombosis in afibrinogenemia , only a few cases have been reported where these patients developed mi . with recurrent mi , treatment of mi in the presence of a bleeding disorder like afibrinogenemia is difficult as administration of thrombolysis and anticoagulant will increase bleeding . so , we treated with both aspirin and clopidogrel in our case . as patient stopped taking dual antiplatelet therapy he had recurrence of mi . chest pain subsided after starting injection of ntg and the area of myocardial involvement was also small , we managed the patient conservatively , and discharged him on dual antiplatelet therapy . further study is needed on this aspect to determine the best treatment that we can provide to them . until then dual antiplatelet therapyshould be recommended to all these patient with hereditary bleeding disorder with close supervision of bleeding diathesis since without this treatment they may have recurrences . mesenteric pseudocyst is a term used to describe abdominal cystic mass without the origin of abdominal organ.(1 ) this has been classified according to embryologic , ehiologic , histologic , and ther data , causing considerable confusion . it was considered the term mesenteric cyst as merely descriptive , and apply a histologic classification such as lymphangioma , pseudocyst , enteric duplication cyst , enteric cyst , and mesothelial cyst.(2 ) we presented a case of mesenteric pseudocyst of the small bowel in a 70-year - old man . a 70-year - old man was referred to our hospital for operation of gastric cancer with a 1-month history of progressively worsening epigastric and intermittent peri - umbilical discomfort . he had no specific previous medical or surgical history including cancer . on physical examination , esophago - gastro - duodenoscopy ( egd ) showed a 3.5 cm sized excavated lesion on the posterior wall of angle . endocopic biopsy confirmed a histologic diagnosis of poorly differentiated adenocarcinoma including signet ring cell component . endoscopic ultrasonography revealed invasion of caner to the proper muscle layer . abdominal computed tomography ( ct ) scan showed a focal mucosal enhancement in posterior wall of angle of stomach , a 2.4 cm sized enhancing mass on distal small bowel loop without distant metastases or ascites in rectovesical pouch , and multiple gallbladder stones ( fig . 1 ) . these physical , laboratory , and radiological findings prompted us to diagnose early gastric cancer , and gastrointestinal stromal tumor of small bowel . laboratory testing revealed alfa - fetoprotein level of 2.88 ( normal range , 0 to 9 ng / ml ) , carcino - embryonic antigen level of 1.45 ng / ml ( normal range , 0 to 5 ng / ml ) , carbohydrate antigen ( ca ) 19 - 9 level of 6.5 u / ml ( normal range , 1 to 35 u / ml ) , and ca 72 - 4 level of 4.8 u / ml ( normal range , 0 to 4 u / ml ) . other laboratory test results were within normal limit . the patient underwent subtotal gastrectomy with gastroduodenostomy , segmental resection of small bowel , and cholecystectomy . mesenteric mass was adhered severely with greater omentum at the mesenteric side of small bowel , and mesenteric fat tissues . small bowel , mesentery , and mesenteric mass were resected en - bloc methods , and end to end anastomosis was performed . after fixation of the surgical specimen , macroscopic examination revealed a uni - locular cyst measuring 332 cm in size . pathological examination revealed 3 cm sized fibrous cystic wall without endothelial or epithelial lining and foam cell collection ( fig . 2 , 3 ) . pathologic stage of gastric cancer was t1bn1m0 ( 6th international union against cancer tnm staging system ) ; invasion to submusosa , metastases to 4 perigastric lymph nodes out of 16 retrieved nodes , and negative resection margin . mesenteric pseudocysts are very rare intraabdominal mass with an incidence of about 1 case per 100,000 hospital admissions.(3 ) ros et al.(2 ) first used the term " pseudocyst " in the classification of mesenteric cyst . mesenteric pseudocyst could be located in the small bowel , large bowel mesentery and even retroperitoneum.(1,4 ) most reports were pseudocyst of large bowel or retroperitoneum.(1 ) although most mesenteric pseudocysts are asymptomatic , symptomatic mesenteric cysts could be associated with cyst size , cyst location , and complications , including infection , rupture , hemorrhage , and intestinal obstruction.(5 ) in our patient , there was no specific symptom associated with mesenteric pseudocyst except for intermittent vague periumbilical discomfort . if egd and ct scan were not performed in this patient presenting non - specific abdominal pain , the diagnosis of mesenteric pseudocyst would be delayed . to the best of our knowledge , this is the first case report describing incidentally detected mesenteric pseudocyst of small bowel in gastric cancer patients . when clinician performed staging work up for gastric cancer , should be aware the possibility of associated intraabdominal lesions .

afibrinogenemia is a rare autosomal recessive bleeding disorder with an estimated prevalence of 1:1,000,000 . usual presentation of this disorder is spontaneous bleeding , bleeding after minor trauma and excessive bleeding during interventional procedures . paradoxically , few patients with afibrinogenemia may also suffer from severe thromboembolic complications . the management of these patients is particularly challenging because they are not only at risk of thrombosis but also of bleeding . we are presenting a case of 33-year - old male patient of congenital afibrinogenemia who had two episodes myocardial infarction in a span of two years . the patient was managed conservatively with antiplatelet therapy and thrombolytic therapy was not given due to high risk for bleeding .

please summarize the articles given below

we used the lrn as a conduit to maintain the confidentiality and anonymity of the variola testing sites . a convenience sample of 45 laboratory workers completed an online survey developed by researchers at the university of nebraska medical center ( omaha , ne , usa ) . nonidentifying demographic information was collected , in addition to any adverse effects after vaccination and perceived barriers to revaccination . to determine a significant difference existed regarding the success ( presence or absence of a take after vaccination ) of the vaccine based on intervals between vaccines , we measured the mean interval ( in years ) between vaccinations . respondents mean age was 46 years ; they had worked a mean of 20.5 years in the laboratory setting . eighty - four percent of respondents reported that the only adverse events from vaccination were related to the skin irritation caused by the occlusive dressings worn over the vaccination lesion . sixty - seven percent listed a medical condition in themselves or a close household contact as the barrier to revaccination . the mean interval from first to second vaccination was 4.8 years for vaccinees who had a successful vaccine and 6.0 for those who did not . statistical analysis demonstrated no significant difference ( p = 0.149 ) between the number of years between first and second vaccinations and the take rates . sixty - two percent of respondents indicated they did not work with non highly attenuated orthopoxviruses . ( i.e. , developed lesions ) regardless of number of years since previous vaccination , suggesting that immunity might have waned . therefore , our data do not provide evidence to suggest that the acip recommended interval for revaccination be prolonged . although most respondents reported having no adverse effects from the vaccine , for some this vaccination caused discomfort . many reported symptoms related to the occlusive dressing worn as a precautionary measure to ensure that the lesion site was properly covered during work hours . other measures to ensure the lesion is covered appropriately , such as nonocclusive dressings and long sleeves , may be considered given that laboratory workers do not have direct contact with patients . although the lrn asks this small group of laboratory workers to comply with the acip recommendations , the question remains whether this requirement should include laboratory workers who do not handle orthopoxviruses . revaccination of most laboratory workers at variola testing sites every 3 years would be expected to be sufficient to provide an initial immunologic response , whereas laboratory workers who do not handle orthopoxviruses could be vaccinated in the same fashion as other health care and public health workers who have at least 1 recent ( since 2003 ) documented successful vaccination ( 5 ) . this recommendation is based on the same premise as using the vaccine as prophylaxis for documented exposure to a smallpox - infected person . this practice was used regularly during the smallpox eradication program . because the average incubation period for vaccinia is 34 days shorter than the incubation period for smallpox , a person exposed to smallpox would have a 34 day window in which to be vaccinated with and immunologically respond to vaccinia , which also confers immunity to smallpox ( 6 ) compromised immune systems or cardiac risk factors that make vaccinees ineligible for vaccination are more likely to develop as they age ( 7 ) . most barriers to revaccination were related to medical conditions ( compromised immunity and/or exfoliative skin disorders ) that place vaccinees at high risk for adverse events to the currently licensed smallpox vaccine . the conditions are an added challenge for the aging pool of laboratory workers assigned to national variola testing sites ( 8) . currently unlicensed third - generation smallpox vaccines may be considered ( pending licensure ) as replacements to acam2000 ( sanofi pasteur biologics , lyon , france ) , the currently licensed vaccinia vaccine , for laboratory workers at national variola testing sites or perhaps an even broader population of laboratory workers throughout the united states . third - generation vaccines are nonreplicating and safer in populations that might have contraindications to traditional vaccines ( 911 ) . the risk to the us population from a release of smallpox this reduced risk stems not from a lower threat from terrorism but from the existence of a stockpile of the new acam2000 smallpox vaccine , in addition to a cadre of health care and public health professionals who could be revaccinated quickly and mobilized accordingly ( 12 ) . more research on the immunogenicity of smallpox vaccine is needed but is challenged by the absence of smallpox disease to test the efficacy of vaccination . researchers now appreciate that the complex mechanism of the immune response to vaccinia and/or smallpox infection might lead to better treatment options for infectious and autoimmune diseases ( 7 ) . future opportunities may arise to challenge the vaccine with the actual virus to measure vaccine efficacy and provide sound recommendations to protect all public health and health care responders against smallpox ( 13 ) . in the meantime , ensuring that recommendations created to protect some populations are properly interpreted and applied is important to protecting the most vulnerable persons without exposing others to unnecessary harm . a 57yearold woman who had initially been implanted with a double chamber pacemaker for complete atrioventricular block was upgraded to crtp at another center after a year due to left ventricular dysfunction and dyspnea . she was referred to us 3 months after the upgrade due to wound infection by pseudomonas sp caused by gossybypoma ( retained compress ) . preoperative transthoracic ( tte ) and transesophageal ( toe ) echocardiography did not reveal any signs of endocarditis , and the patient was afebrile with negative blood cultures . a patent foramen ovale ( pfo ) with a small left to right shunt traction with locking stylets allowed complete extraction of the activefixation right atrial and right ventricular leads , and the coronary sinus lead was explanted by simple traction . the following morning she developed sudden dysarthria and left facial palsy , and emergent cerebral angiography revealed an occlusion of the right frontal branch of the middle cerebral artery ( fig . mechanical thrombectomy with a solitaire fr revascularization device ( covidien , plymouth , mn , usa ) retrieved a thrombus attached to dense fibrinous tissue ( fig . normal vessel flow was recovered ( fig . 2c and d ) , and neurological recovery was complete within 60 min of symptom onset . oral antibiotics were continued for a further 2 weeks , and followup at 6 months was uneventful . transesophageal echocardiography of the bicaval view in 2 dimensions ( a ) and using color doppler ( b ) , showing a mobile interatrial septum ( asterisk ) with a patent foramen ovale ( solid arrow ) . ( a and b ) occlusion of frontal branch of right middle cerebral artery ( arrow ) with hypoperfusion of a large territory ( asterisk ) . ( c and d ) restored flow after mechanical thrombectomy . ( a ) the solitaire fr revascularization device ( covidien ) used for mechanical thrombectomy . herein , we describe the case of a patient suffering acute ischemic stroke due to paradoxical embolization of dense fibrous material through a pfo following transvenous lead extraction ( tle ) . endocardial pacemaker leads cause fibrin deposits on their surface which may form sheaths in over 85% of patients 1 or adhere with the vessel walls , tricuspid valves , and endocardium . thrombi can be detected on the leads in around 30% of patients by toe and intracardiac ultrasound 2 , 3 , and findings of asymptomatic pulmonary emboli in up to 15% of patients as well as increased pulmonary pressure point toward a high rate of subclinical embolism in patients with cardiovascular implantable electronic devices ( cieds ) 1 , 3 , 4 . one particular concern is the risk of systemic thromboembolism in patients with intracardiac shunts and cieds ; in all shunts other than pfos , the risk of systemic thromboembolism is doubled 5 and such conditions are at present considered a contraindication for endocardial lead placement 6 . in the case of pfos , the risk is less well documented , but retrospective data points toward a hazard ratio of > 3 for stroke 7 , although study bias may have exaggerated this figure . tle is a valuable technique for management of device infection and lead failure , and its safety has improved thanks to technological advances and increasing experience . preliminary data from the electra registry 8 , the only prospective european registry of tle , show a relatively low rate of major complications ( 2.53.9% depending on the procedural volume of centers ) . one complication of particular concern when extracting leads is the risk of systemic embolism . indeed , residual fibrous deposits persisting after tle have been described 9 , sometimes large enough as to be described as our case illustrates that these residual deposits may not always be visible with toe , probably because they may be confined to the vessels ( e.g. , innominate or subclavian vein ) but may embolize later . although the rate of stroke seems to be low ( 0.1% ) during tle , our case highlights the potentially dramatic consequences of systemic embolization , even in the absence of visible vegetations on the leads . moreover , current guidelines offer no clear recommendations to help lower the risk of embolization during tle 10 . routine anticoagulation , used by some centers mainly to lower the rate of venous occlusion , is probably of little use due to the fibrinous nature of the tissue . the use of distal embolization protection devices during tle in patients with vegetations has been reported in several cases , whether in the pulmonary 11 or systemic circulation 12 . however , the efficacy of these devices seems limited by the risk of delayed embolism as demonstrated in our case , and because residual dense fibrinous tissue probably persists for several days or weeks . based on our case and these considerations , we believe paradoxical embolism causing stroke is a real concern in patients with pfos undergoing tle . although its incidence seems to be low , the consequences can be catastrophic and the costs linked with the morbidity of stroke are important . although this may raise the concern of additional cost , most patients undergoing tle have a preoperative echocardiographic examination , either tte or toe , in order to evaluate preoperative tricuspid valve regurgitation or presence of vegetations . the additional cost and time linked to evaluate for a pfo is negligible . in case of pfos with large shunts , we suggest considering percutaneous pfoclosure before extraction in noninfected patients or surgical extraction and pfoclosure in patients with endocarditis . in cases with small pfos , we recommend strict avoidance of maneuvres increasing righttoleft shunting ( e.g. , coughing , valsalva ) and 2448 h neurological surveillance . the effectiveness of mechanical thrombectomy in cases of embolization after lead extraction is also highlighted in this case . because of the dense fibrous nature of embolus ( or in cases where the embolus is of foreign body material ) , pharmacological thrombolysis is likely to be ineffective , as well as increasing the bleeding risk considerably in the postoperative period . therefore , we strongly suggest performing tle in centers with neuroradiological standby , as rapid action may prevent irreversible sequellae .

to evaluate the need to revaccinate laboratory workers against smallpox , we assessed regular revaccination at the us laboratory response network s variola testing sites by examining barriers to revaccination and the potential for persistence of immunity . our data do not provide evidence to suggest prolonging the recommended interval for revaccination .

please summarize the articles given below

with the announcement on 26 october 2011 that eli lilly and company ( indianapolis , in , usa ) was withdrawing drotrecogin alfa ( activated ) from the worldwide market , we witnessed the end of the only drug specifically approved for sepsis . the move was prompted by the failure of prowess - shock , a large international study , to confirm the benefit reported from the original trial , prowess ( protein c worldwide evaluation in severe sepsis ) , 10 years ago . in the aftermath , many questions will be raised . here , , i should declare that i led the long - term follow - up and cost - effectiveness studies accompanying prowess and served on the data safety and monitoring board of prowess - shock ( see acknowledgments for full disclosure ) . drotrecogin was approved largely on the basis of a single phase 3 trial , which was stopped early for efficacy . most drugs are approved after two positive phase 3 trials , but exceptions are made when there are impressive supporting data , there is a compelling unmet clinical need , or the trial results are particularly impressive . although an external us food and drug administration ( fda ) advisory panel was split on whether to approve , the fda nevertheless felt that these conditions were met . it seems , therefore , that the decision to approve , though based on only one phase 3 trial , was consistent with the procedures and habits of regulatory bodies around the world . for all new drugs typically , the drug has been administered to only a few thousand patients , in highly controlled situations , with limited long - term follow - up . second , a longer time to generate more evidence raises the drug development costs for pharmaceutical companies while shortening the post - approval patent life ( when a company recoups its investment ) , thus worsening the risk - reward ratio and potentially choking overall investment in drug development . because approval occurs while uncertainty persists , a variety of post - approval surveillance activities are performed in case the decision must be reversed . in the five years leading up to drotrecogin 's approval in 2001 , the fda approved 597 new therapies . in other words , there is a low , but non - zero , rate of drug withdrawal . a lower rate would be preferable , but without major changes to patent laws or to the science and costs of drug development , the chilling effect of a more stringent approval process on dwindling drug pipelines would likely be considered intolerable . so , while we might lament that a sepsis drug was one of the unlucky ones , the fundamental drug approval process that led to drotrecogin approval does not seem too lenient , wrong , or unreasonable . that said , it is a shame that prowess was stopped early , something outside the control of the fda , as early stopping biases toward an overestimate of treatment effect . and it is a shame that the costs and logistics of running two concurrent phase 3 trials in critical care seem to be insurmountable obstacles in the drug development process . cheaper and easier trials could allow us to generate greater certainty without compromising drug pipeline . the usual reason for withdrawal is determination of a previously unknown yet highly undesired side effect . these studies generally reported mortality benefits similar to that seen in prowess [ 6 - 12 ] . the studies also provided greater information about bleeding risks , which led to further label restrictions . however , somewhat unusually , the withdrawal in this instance was a voluntary decision based not on safety but on failure to confirm efficacy . numerous human and animal studies suggest that it modulates coagulation and inflammatory pathways and interacts with endothelial function in the midst of intense innate immune responses to challenges such as sepsis . a previous simulation exercise of theoretical anti - tumor necrosis factor ( anti - tnf ) anti - body trials in sepsis demonstrated that modest differences in the distribution of unmeasured variables such as host genotype and pathogen characteristics could lead to trials in which the same drug produces opposing results , even when patients meet the same clinical criteria . prowess - shock attempted to enroll patients ideally suited for drotrecogin . in the original prowess study , the largest reduction in absolute mortality was noted in patients who appeared to be sicker ( for example , those presenting with septic shock ) . a subsequent trial - administration of drotrecogin alfa ( activated ) in early stage severe sepsis , or address - targeted patients with lower severity of illness and could not demonstrate efficacy . thus , we now have an original trial suggesting benefit in both low and high severity risk , with a constant relative risk reduction but variable absolute reduction , and two subsequent trials mimicking the low and high ends of the original trial but failed to repeat the positive findings . provided that all trials were conducted well , the results of prowess - shock and address raise doubt about the prowess results , but , equally , the prowess results raise doubt about those of prowess - shock and address . when data from multiple trials are synthesized , such as in a meta - analysis , a negative study does not trump a positive study of similar quality . rather , the results from both trials are combined to give an overall estimate of treatment effect . given the potential for differences in important but unmeasured variables at baseline in sepsis to change the result , such an approach seems wise . however , it seems possible that the result will be a point estimate in favor of drotrecogin over placebo but of a magnitude far smaller than in the original trial and probably no longer statistically significant . if the combined estimate from the literature is , say , a non - significant 2% to 3% reduction in mortality , would we be interested in confirming whether such an effect was significant ? that would normally depend on the cost of one more ( much larger ) confirmatory trial , our desire to tolerate non - fatal bleeding side effects , and the resulting financial impact ( both per - patient cost - effectiveness and global increase in spending ) of adopting the drug should the benefit be confirmed . such quandaries could be formally estimated in a value - of - information analysis - how valuable is it to know the answer with greater certainty ? however , the decision was taken out of our hands . eli lilly and company no doubt considered the potentially very large cost of another trial , the fact that regulatory agencies and the field of critical care might be so skeptical as to threaten the ability to conduct another trial or adopt its results into practice or both , and the likelihood that the trial would be negative . taking these factors together , the company presumably decided that to go forward was just too risky . whether the action of eli lilly and company has left a drug that could cut sepsis mortality by 2% to 3% ' on the table ' is something we will now likely never know . we will all see the details of prowess -shock published in the coming weeks or months . first , should this story reinvigorate our drive to complement clinical enrollment criteria with biomarkers that better select patients likely to benefit from a given immunomodulating agent ? second , should we ask of ourselves what we as a community might have done differently ? certainly , greater engagement in clinical trials would seem to be an obvious first step - a huge part of the costs of clinical trials is that they take a long time and enroll only a tiny fraction of all patients with severe sepsis . our ability to make wiser choices about drugs would be enhanced if we could conduct larger trials more rapidly . much time , energy , and emotion were devoted to forming opinions about prowess and about drotrecogin , often with strongly voiced opinions about both the drug and eli lilly and company . one can hope that decisions about future drugs will be made in environments richer in data and poorer in opinion . if we believe that there is a role for pharmacomanipulation of critical illness , our partnership with the pharmaceutical industry is a prerequisite . thus , we must think about whether the partnership works properly in terms of open , efficient , rapid , and rigorous science for the optimal benefit of all concerned , especially our patients . address : administration of drotrecogin alfa ( activated ) in early stage severe sepsis ; fda : us food and drug administration ; prowess : protein c worldwide evaluation in severe sepsis . the author declares that he was principal investigator on grants received by the university of pittsburgh from eli lilly and company for the conduct of the long - term follow - up and cost - effectiveness studies accompanying prowess . he also received consulting fees and speaking honoraria from eli lilly and company between 1996 and 2004 . he received compensation from eli lilly and company for serving on the data safety and monitoring board for prowess - shock . ( salt lake city , ut , usa ) , which are also engaged in sepsis research . the author gratefully acknowledges shamly austin for her assistance generating data on fda approval and withdrawal rates discussed in this article . transorbital intracranial injury is rare and may cause serious brain damage and is associated with a high mortality rate . this type of injury , accounting for 4.5% of all orbital pathology,[35 ] represents 0.04% of all head trauma , 24% of penetrating head trauma in adults , and 45% in children . penetrating orbital injury may lead to severe brain injury when the foreign object enters the cranium , leading to both orbital and cerebral complications . a foreign body can penetrate the brain through the orbit in 3 ways : via the orbital roof , the superior orbital fissure , and the optic canal . the diagnosis is confirmed if an entire or partial foreign object is found in the wound , and is difficult to make in the case of trivial trauma . we report a case of a transorbital injury caused by penetration of a metal bar which entered the cerebrum through the orbit . a 13-year - old male sustained an injury to his right orbit , resulting from falling while holding a metal bar . an iron bar [ 3 cm 18 cm ] penetrated his right orbit via the medial canthus and right infraorbital region and was driven into the skull . on admission , he was unconscious , but with normal vital signs . his right eye protruded outside the orbital cavity and was severely swollen and bruised . on neurological examination , he was in a deep coma with a glasgow coma score of 4/15 ( e1m2v1 ) . plain skull radiographs confirmed that the bar crossed the skull from the right orbit to the left occipital bone [ figure 1 ] . computed tomography ( ct ) demonstrated the bar passing through the right orbit and superior orbital fissure and emerging from the left occipital bone , which was fractured by direct compaction . in association with the bar , there was a trajectory of intracerebral hemorrhage , specifically subarachnoid hemorrhage in the basal cisterns with severe cerebral edema [ figure 2 ] . the bar penetrated the third ventricle and suprasellar cistern ; adjacent to the right carotid artery and branches , the dense hemorrhage observed within the suprasellar cistern was likely the result of injury to the right internal carotid artery . angiography could not be performed because the patient rapidly worsened neurologically ( gcs 3 : e1m1v1 ) . lateral skull radiograph shows the bar penetrating the orbit and emerging from the occipital bone . computed tomography demonstrates the bar 's trajectory into the sellar and suprasellar region via the superior orbital fissure . the right internal carotid artery was found to be lacerated , and the right optic nerve and optic chiasm transected near the superior orbital fissure . the bar penetrated the superior orbital fissure , anterior clinoid process , suprasellar cistern , third ventricle , and cerebrum . incidentally , if a metal bar is fixed at the superior orbital fissure , it can usually be mobilized and removed , retracting it carefully from the entry site under direct visualization and avoiding resistance or leverage . severe bleeding from the right internal carotid artery occurred despite this maneuver ; the carotid artery required ligation . the patient died 10 days postoperatively due to ischemic brain injury , diencephalic injury , and intractable increased intracranial pressure with brainstem herniation . . most reports are by pens , knives , or chopsticks . due to its thin wall , the orbit is the most vulnerable structure in the cranium ; penetrating orbital injuries are often associated with traumatic brain injury . the cranium can be violated via the transorbital route through the superior orbital fissure and optic canal . the degree of neurologic damage is related to orbital bone anatomy , as well as the size , shape , and trajectory of the object . intracranial penetration may occur through the orbital roof , superior orbital fissure or optic canal . therefore , medial or canthal injuries , associated with severe visual loss , strongly suggest optic canal damage . the most frequent site of penetration is through the orbital roof because the superior orbital plate of the frontal bone is thin and fragile . this frequently leads to frontal lobe contusion , the prognosis of which is fairly good . objects passing through the superior orbital fissure tend to follow a trajectory , close to the internal carotid artery and are generally associated with optic nerve and other orbital injuries . the orbit is pyramid - like in volume , and as a result , penetrating objects are directed towards the apex , most of which pass through the superior orbital fissure and through optic canal . our case is an example of this type of injury . penetrating injuries through the superior orbital fissure may affect cranial nerves iii , iv , v , vi , the arteries of the circle of willis and the carotid artery . penetrating injuries caused by high speed objects , following a trajectory perpendicular to the orbital wall , result in direct bone fractures . vertically directed objects may pierce the orbital roof and cause damage in the frontal lobe . horizontally penetrating objects may cause ethmoid bone or posterior orbital wall fractures . with sufficient force , the midline may be violated and can damage contralateral structures . penetrating objects , directed medially through the superior orbital fissure , the optic canal , and / or sphenoid wing , may damage the temporal lobe , cavernous sinus , and brain stem . the most frequent pattern of injury ( 68% ) involves the cavernous sinus , temporal lobe , and brainstem . in low velocity injuries , when the penetrating object hits the orbit at a small angle , the object follows a path along the wall of the orbit . penetrating objects , entering the orbit close to the horizontal plane , tend to follow the orbital funnel towards the apex . this mechanism differs from that seen in orbital roof penetration , in which objects traverse the superior orbital fissure and pass laterally along the cavernous sinus toward the temporal lobe . in our case , the iron bar penetrated the orbit at the medial canthus and followed a posterior , medial , and superior trajectory . objects directed superiomedially within the orbit usually affect the superior orbital fissure and / or optic canal , sphenoid wing , and sella turcica , passing across the midline ; then , they enter the suprasellar cistern and third ventricle , causing serious damage to neurovascular structures . these types of injuries are associated with the most severe brain damage , due to laceration of central diencephalic neural structures and major vessels ; therefore , they are associated with the highest morbidity and mortality rates . the injury described in this report usually has a fatal prognosis . in penetrating orbitocranial injuries , the severity of brain damage and outcome depends on the velocity , trajectory , and shape of the object , rather than the type of material . however , porous objects that are prone to fragmentation provide a good medium for infection . immediate complications of transorbital penetrating trauma include intracerebral hematoma , cerebral contusion , intraventricular hemorrhage , pneumocephalus , cranial nerve damage , severe permanent neurological damage , brain stem injury and cerebrovascular injury . delayed complications include cerebrospinal fluid fistula , pneumocephalus , orbital cellulitis , carotid - cavernous sinus fistula , central nervous system infections , traumatic aneurysm and delayed intracranial hemorrhage . retained foreign objects cause severe infections , such as meningitis or brain abscess ( 50% ) . the prognosis is good in absence of direct injury to the brainstem or laceration of major intradural vessels . in our patient , ct is necessary to evaluate the trajectory of the object , the intracranial structures involved and to predict possible complications . however , wooden objects are not always detectable on plain radiographs , making accurate evaluation more difficult . if the injury is caused by a chopstick , and if chopstick is removed before the patient is evaluated by a physician , potentially fatal complications can occur . magnetic resonance imaging ( mri ) is superior to ct for detection of small fragments of wooden foreign bodies . therefore , cerebral angiography should be performed 2 - 3 weeks after an insult to rule out traumatic aneurysms and to identify major vascular injury in a timely fashion . the transorbital or transcranial approach can be chosen depending on the location of the foreign body . removal of the foreign object , debridement and resection of all involved skull bones , hematoma evacuation , careful hemostasis along the trajectory , and meticulous dural closure to reduce cerebrospinal fluid leak are mandatory to prevent potentially fatal infectious complications . vigorous debridement is not necessary and is associated with an increased disability and mortality without clear advantage . antiepileptic medications are recommended in the early stages after injury to prevent seizures . in conclusion , transorbital penetrating cranial injury by a metal bar is rare and may result in potentially life - threatening complications . failure to detect intracranial complications may lead to serious neurological morbidity and is associated with a high mortality rate .

following the failure of prowess - shock to demonstrate efficacy , eli lilly and company withdrew drotrecogin alfa ( activated ) from the worldwide market . drotrecogin was initially approved after the original trial , prowess , was stopped early for overwhelming efficacy . these events prompt consideration of both the initial approval decision and the later decision to withdraw . it is regrettable that the initial decision was made largely on a single trial that was stopped early . however , the decision to approve was within the bounds of normal regulatory practice and was made by many approval bodies around the world . furthermore , the overall withdrawal rate of approved drugs remains very low . the decision to withdraw was a voluntary decision by eli lilly and company and likely reflected key business considerations . drotrecogin does have important biologic effects , and it is probable that we do not know how best to select patients who would benefit . overall , there may still be a small advantage to drotrecogin alfa , even used non - selectively , but the costs of determining such an effect with adequate certainty are likely prohibitive , and the point is now moot . in the future , we should consider ways to make clinical trials easier and quicker so that more information can be available in a timely manner when considering regulatory approval . at the same time , more sophisticated selection of patients seems key if we are to most wisely test agents designed to manipulate the septic host response .

please summarize the articles given below

compromised renal functions and previous central nervous system ( cns ) disease have been shown to predispose to this neurotoxicity . we describe a case of acute transient encephalopathy in a patient treated with ceftriaxonefor enteric fever infection . the present case illustrates the diagnostic challenges and management of this rare but potentially severe side effect of one of the most commonly prescribed parenteral antibiotics . an eight - year - old male child presented with a history of diarrhea and high - grade fever . the child was conscious , cooperative , well oriented to time , place and persons . the patient was hospitalized and started on ceftriaxone ( 1 g iv daily ) and intravenous fluids . after three days of treatment with iv ceftriaxone , child became afebrile but showed altered mental status with progressive apathy and somnolence . the patient was referred to the dyanand medical college , ludhiana ( punjab ) . in the emergency department , the patient was not in acute distress , had no fever , was hemodynamically stable , but dehydrated . hb 12 g / dl [ normal range 12 to 15 g / dl ] , hct 38% [ normal range 35.0 to 49.0% ] , tlc 6 10/l l [ normal range 5 to 12 10/l l ] , dlc - n 62 [ normal range 6070% ] , l 27% [ normal range 2040% ] , plt 274 10/l l [ normal range 100 to 300 10/l ] , urea 14 mg / dl [ normal range 825 mg / dl ] , cr 0.6 mg / dl [ normal range 0.51.7 mg / dl ] , na / k 139/4 [ normal range 135147/ 3.55 meq / dl ] , urinalysis revealed no bacteriuria and pyuria , tsb / dsb 0.77/0 [ normal range 0.11.0/ < 0.2 mg / dl ] , sgot / pt 44/23 [ normal range 1147/ 753 iu / l ] , stoolr / e , 2d mri scan of brain did not reveal acute stroke . the patient 's neurological status improved and three days later he was again alert and oriented . the proposed mechanisms include a decrease in -amino butyric acid ( gaba)-mediated inhibition and cephalosporin - mediated release of cytokines . in fact , cephalosporins may decrease gaba release from nerve terminals , increase excitatory amino acid release , and exert a competitive antagonism with gaba . alternatively , cephalosporin treatment has been proposed to induce endotoxin release , which generates cytokines liberation , such as tumor necrosis factor- , a proinflammatory cytokine implicated in septic encephalopathy . pre - existing cns abnormalities have been indicated as a risk factor for -lactams encephalopathy . in this was not the case in our patient , who presented with enteric fever and dehydration corrected with intravenous fluids . in fact , the temporal association of the encephalopathy induction and resolution with ceftriaxone administration and withdrawal makes this antibiotic highly likely to be responsible for the encephalopathy . moreover , the temporal pattern is in accordance with previous publications reporting cephalosporin neurotoxicity , with a latency of one to ten days after drug initiation and regression of all neurological symptoms within two to seven days following ceftriaxone treatment suspension . we could establish a probable causal relationship between ceftriaxone and the encephalopathy ( naranjo score 6 ) . the severity assessment revealed the adr to be moderate , suggesting that required therapeutic intervention and hospitalization prolonged by 1 day but resolved in 24 h or change in drug therapy or specific treatment to prevent a further outcome . since this patient did not have a history of any such reaction due to ceftriaxone , this adverse drug reaction was unpreventable . we describe a case of ceftriaxone - induced acute reversible encephalopathy in a patient treated for enteric fever infection . early recognition of this complication is particularly relevant as discontinuation of ceftriaxone reverts the neurological syndrome . in the field of medicine , stress is one of the most common complaints among patients1 . stress may negatively influence the affective state of an individual , which in turn may exert direct adverse effects on biological processes or behavioral patterns , thereby increasing the individual s disease risk and pathogenesis of a disease2 . psychosocial stress is believed to contribute to musculoskeletal disorders of the neck , shoulders , and other areas . previous studies have shown that mental stress induces a significant increase in muscle tension3 . recently , it has been demonstrated that the same motor units are activated by mental stress as by physical stress , which means that mental stress may also result in low - threshold motor units remaining active during breaks at work and outside of work3 . thus , numerous therapeutic approaches have been used to treat musculoskeletal diseases caused by psychological stress4,5,6 . the utilization of alternative medicine has been increasing in recent years , with massage documented as being one of the most frequently treatments for musculoskeletal disease7 . manual lymph drainage ( mld ) is a procedure that consists of several techniques derived from traditional massage8 . mld has become increasingly popular in recent years , not least because of the enormous amount of publicity it has recieved8,9,10,11,12 . moreover , the spread of information about edema among doctors , physical therapists , and patients , and the efforts for managing its cosmetic aspects have also resulted in its popularity10,11,12 . the frontal region of the brain has been associated with affective states , and different affective states have been associated with different eeg patterns in this region13 . normal subjects experience positively valenced emotions , such as happiness and joy , together with greater relative left frontal eeg activation . in contrast , the experience of negative emotions , including depression , is associated with greater relative right frontal eeg activation14 , 15 . there are some studies that have investigated the effects of different manual techniques on frontal eeg activation4 , 5 , 16 , 17 ; however , mld is not one of the techniques that have been investigated . therefore , the present preliminary study investigated the effects of mld in subjects with psychological stress and greater relative right frontal eeg activation , with mld expected to shift eeg patterns toward symmetry . the subjects included 52 university students , chosen according to the following criteria : ( 1 ) no history of mental illness , ( 2 ) not currently taking any medication known to affect eeg signals , and ( 3 ) no known heart- or muscle - related disease . they were all free of pulmonary , cardiac , and metabolic disease , as well as other disease states , which may cause brain dysfunction . all subjects responded to the stress response questionnaire ( sri)18 and returned it to the authors . according to the results of the questionnaire , 13 female subjects aged 19 to 23 years with an sri score > 80 and informed , written consent was obtained from each subject after the experimental procedures had been explained . all test protocols were approved by the ethics committee of the physical therapy faculty of kangwon national university . all interventions were completed in a supine position on a massage table with a pillow placed under the knees to relax the lower back muscles . data acquisition and mld were performed in a quiet , temperature - controlled environment ( 2224 c ) . stimuli such as conversation , phone calls , and noise that could increase the activity of sentinel nodes were minimized , and the subject s body was covered with a soft and thin sheet to avoid discomfort from body exposure . mld was conducted by a well - trained certified mld therapist , and applied twice to the neck area . the protocol was standardized , in that , the massage stroke category ( type ) and time was the same for all participants . subjects were allowed to rest comfortably for at least 5 min prior to the baseline recording procedure . eeg data were acquired for 5 min before , and immediately following , mld . a total of 6 channels of eeg were recorded : inclusive of fp1fp2 , f3f4 , and f7f8 . there were two other electrodes , a ground electrode and reference electrode , which were placed on both zygomatic bones . participants were then asked to close their eyes and refrain from talking , falling asleep , or making exaggerated body movements , in order to observe the cortical electrical activity without any external stimuli , minimizing possible visual artifacts during eeg measurement . the eeg signal was acquired over a 5-min period , followed by computerized fourier analysis of the eeg waves using the telescan software package ( laxtha , daejeon , south korea ) . the signal was sampled at a rate of 256 hz and was digitally filtered using a 150-hz band - pass filter . after data acquisition and storage , all statistics were computed to extract asymmetry values for the alpha frequency band in the frontal area of the cerebral cortex19,20,21 . the asymmetry index was calculated by subtracting the log - transformed absolute alpha power of the left hemisphere from the analogous log - transformed right hemisphere alpha power ( log right log left ) . as alpha power is inversely associated with cortical activation , a negative asymmetry score , which denotes greater alpha activity on the left and less alpha power on the right , would suggest greater right - sided activation . on the other hand , the asymmetry index was compared prior to , and after , mld application using a paired t - test , and the collected data were analyzed using a statistical package program ( spss v. 19.0 ) . mld generally caused an activation shift from the right hemisphere to the left hemisphere in all frontal electrode pairs analyzed in this study . statistical analysis comparing pre- and post - mld asymmetry values in channels f7f8 showed a statistically significant increase in hemispheric asymmetry : fp1fp2 , p = 0.082 ; f3f4 , p = 0.065 ; and f7f8 , p = 0.032 . alpha asymmetry scores for each regionareabefore- mldafter- mldfp1fp20.130.060.030.18f3f40.150.050.020.16f7f80.120.040.090.25 * all variables are means sd , mld : manual lymph drainage , * p<0.05 . in this preliminary study , frontal lobe eeg activity patterns in response to mld of the neck were examined to better understand alpha wave processing in subjects with psychological stress . many studies have shown that eeg asymmetry can be attenuated by massage , relaxation techniques , and musical therapies22,23,24 . however , to date , there are no studies investigating the effects of mld on frontal asymmetry . mld application acts as a very light stimulator against psychological stress ; we predicted that mld would be associated with frontal eeg asymmetry and state , and specifically result in greater left frontal hemisphere activation in the alpha frequency band . in this study , the alpha band ( typically in the range of 813 hz ) was chosen as an electrophysiological marker because , as previously discussed , it is relatively stable21 , 25 and inversely related to activation26,27,28 . the measurement of alpha asymmetry has been shown to be effective and reliable in discriminating positive and negative emotions23 , 29 . since previous investigations have demonstrated a relationship between brain electrophysiology in the frontal area and measures of affective states19 , 20 , 30 , 31 , we have also focused our analysis on the three anterior electrode pairs , fp1fp2 , f3f4 , and f7f8 . recent studies have suggested that greater left - sided anterior activation , indexed by decreased alpha activity in the left hemisphere , is associated with a higher degree of positive affectivity , a feeling of well - being , and a reduction in anxiety28 , 32 . our results indicate that mld is associated with a significant increase in left - sided anterior activation , thus supporting our hypothesis that mld can attenuate frontal eeg asymmetry . these results are also in line with findings from previous studies that have demonstrated the therapeutic effects of massage4 , 5 , 20 . although this study showed demonstrable effects of mld , there are several limitations and suggestions for future research . firstly , this study only examined the acute electrophysiological changes produced after mld in subjects with psychological stress . in addition to replicating the present findings with a bigger sample size , further studies are needed to investigate the effects of mld on other clinical populations across different conditions and diseases under a more controlled experimental design . in conclusion , our preliminary study showed that mld can significantly increase left - sided anterior activation . these results provide evidence to support the hypothesis that mld gives rise to positive affectivity .

ceftriaxone is a commonly used , third - generation cephalosporin . encephalopathy is a rare side effect of third- and fourth - generation cephalosporins . renal failure and previous disease of the central nervous system predispose to this neurotoxicity . we describe a case of acute transient encephalopathy in a patient treated with ceftriaxone for enteric fever infection . early detection of this complication is relevant given that stopping the drug usually reverts the neurological syndrome .

please summarize the articles given below

tumors of the nail apparatus often present a challenge to diagnosis as well as treatment due to the specialized nail anatomy . the nail plate may conceal the tumor as well as alter the tumor growth pattern . however , alterations in the color , thickness , curvature of the nail plate may often provide a clue . a 40-year - old male presented with yellowish discoloration , thickening and altered curvature of the right great toe nail for the past 2 years . there was history of mild pain on walking and application of pressure for the past 2 weeks . , there was a markedly thickened nail plate , increased proximal transverse curvature and yellowish band - like discoloration of medial two thirds of the nail ( xanthonychia ) [ figure 1 ] . however , there was no friability of the nail plate . there was swelling and brownish discoloration of medial two thirds of the proximal nail fold . there was minimal pain on applying pressure on medial part of nail and nail fold . markedly thickened nail plate , increased proximal transverse curvature and yellowish band like discoloration ( xanthonychia ) of medial two thirds of the right great toe nail . also , note swelling of medial two thirds of proximal nail fold the patient underwent a total nail avulsion which revealed a well - defined tumor extruding from below the proximal nail fold toward the distal end of the nail bed [ figure 2a ] . the proximal nail fold was everted and the tumor was excised in entirety . the excised tumor ( 3 cm 2 cm 0.5 cm ) was firm in consistency with parallel ridges corresponding to the ridges on the nail plate [ figures 2b d ] . a differential diagnosis of onychomatricoma , fibrokeratoma of the nail matrix , superficial acral fibromyxoma , fibroma and glomus tumor was considered . histopathology of proximal transverse section [ figure 3 ] revealed a polypoid fibroepithelial tumor with a foliated pattern , acanthosis , papillomatosis and deep epithelial invaginations of multilayered basal and suprabasal cells with elongated nuclei oriented perpendicular to the basement membrane , absent granular layer with clear v - shaped clefts . at places , the stroma had a superficial cellular , fibrillary and vascular layer and a deep , relatively , acellular layer with denser collagen . a distal longitudinal section [ figure 4a and b ] showed a different pattern of the tumor : glove finger - like / monodigitate pattern with marked papillomatosis and multiple thick and deep epithelial ridges . on immunohistochemical analysis , the fibrous stroma showed diffuse staining for cd34 and negative staining for cd99 [ figures 5a and b ] . ( a ) post nail avulsion ; a well - defined tumor extruding from below the proximal nail fold toward the distal end of the nail bed . ( b ) the excised tumor showing parallel ridges ( r ) corresponding to the ridges on the nail plate . ( c ) dorsal view of the avulsed nail plate showing thin proximal portion and thickened yellowish distal portion ( d ) ventral view showing ridges on the nail corresponding to the tumor histopathology : proximal transverse section h and e ( 10 and 40 ) ( a ) a polypoid fibroepithelial tumor with a foliated pattern ; acanthotic , papillo matous epithelium with v - shaped clefts ( v ) corresponding to the avulsed nail . the stroma had a superficial cellular , fibrillary and vascular layer and a deep relatively acellular layer with denser collagen . ( b ) the tumor was lined by mature malpighian epithelium resembling normal matriceal epithelium ; absent stratum granulosum with multilayered basal and suprabasal cells with elongated nuclei oriented perpendicular to the basement membrane . at places , ( c ) numerous mast cells ( m ) in the stroma immunohistochemistry : ( 10 ) fibrous stroma showing diffuse staining for cd34 ( a ) and negative staining for cd99 ( b ) histopathology ( h and e ) a ( 10 ) , b ( 40 ) . a distal longitudinal section showing a glove finger - like / monodigitate pattern with marked papillomatosis and multiple thick and deep epithelial ridges onychomatricoma ( om ) is a rare onychogenic tumor of the nail matrix , described mostly in caucasians . the usual clinical presentation is a thickened nail with xanthonychia , increased transverse curvature and proximal splinter hemorrhages ( due to vascular stroma ) . perrin et al . have defined two types of om based on tumor and nail characteristics : ( 1 ) onychomatricoma of ventral matrix ( om type i ) : characterized by a single large fibroepithelial tumor . the nail plate is thinned out proximally and thick distally giving the appearance of a porch roof . ( 2 ) onychomatricoma of the proximal nail fold ( om type ii ) : characterized by a tumor with multiple fibroepithelial projections . om type ii often presents with unusual clinical features such as pterygium , fibrokeratoma like om , total onychodystrophy and verrucous band - like pattern ( suggesting wart or bowen 's disease ) . histopathologically , om type i shows two different architectural patterns in transverse and longitudinal sections . on proximal transverse sections , a lobulated / foliated pattern is observed while a glove finger monodigitate pattern is observed on longitudinal distal sections . awareness of these different patterns is important when only fragmented specimens are available for histological analysis . a three - dimensional model using proximal and distal transverse and longitudinal sections helps in better understanding and visualization of the morphology of this rare tumor . om is characterized by deep epithelial invaginations with a thick v - shaped keratogenous zone overlying the prekeratogenous zone . on avulsion of the nail plate , this is seen as an optically empty v - shaped zone . the epithelium corresponds to the matriceal epithelium with absent granular layer , basal cells with thin elongated nuclei and multi - layered suprabasal cells with oval nuclei . keratin markers , k5 and 17 , are positive through the epithelium ( indicative of matriceal differentiation ) , while k 85 stains the prekeratogenous zone . the stroma contains several mast cells and is arranged in two layers : a superficial cellular , vascular layer with fibrillary collagen and a deeper relatively less cellular layer with dense collagen bundles . the two - layered stroma is more frequently observed in the proximal portion than in the distal zone of the tumor . based on the proportion of epithelial and mesenchymal components and presence / absence of atypia in the stroma , ko et al . have proposed a different nomenclature with three categories : ( 1 ) unguioblastoma ( predominant epithelial component ) ( 2 ) unguioblastic fibroma ( predominant stromal component ) , and ( 3 ) atypical unguioblastic fibroma ( nuclear pleomorphism , atypia in the stroma ) . differential diagnosis of om includes fibrokeratoma , fibroma , superficial acral fibromyxoma ( saf ) , onycholemmal horn , malignant proliferating onycholemmal cyst , subungual warts , subungual keratoacanthoma , subungual squamous cell carcinoma and bowen 's disease . all of these are easily distinguishable by histopathology except fibrokeratoma , fibroma and saf , which need more careful differentiation . in distal longitudinal sections , the structure of om tends to resemble a fibrokeratoma . however , absence of a horny corn , multiple fibroepithelial digitations and two layered stroma ( on transverse section ) rules out fibrokeratoma . the stroma of om may resemble a fibroma , which can however be excluded by the hyperplastic and onychogenic epithelium of om . saf has a close resemblance to om due to highly vascular collagenous stroma , presence of mast cells and epidermal hyperplasia with papillomatosis . also , a single case of om with myxocollagenous stroma ( superficial acral fibromyxoma like om ) has been reported . saf shows diffuse cd34 , cd99 expression , while om shows diffuse expression of cd34 , but is cd99 negative . treatment of om is complete surgical excision . despite the atypical nature of stroma reported in some cases , no frank malignant variant has been described to date . in conclusion , onychomatricoma is a rare fibroepithelial tumor mostly arising from the nail matrix . it needs to be distinguished from other subungual / periungual tumors ; immunohistochemical markers cd34 and cd99 are useful adjuncts in the diagnosis of om . a three - dimensional spatial reconstitution of om helps in better understanding of its variable morphological characteristics . histopathological patterns of onychomatricoma vary in proximal and distal sections ; foliated pattern on proximal transverse sections and a glove finger - like pattern on the distal longitudinal section.study of onychomatricoma in multiple sections and planes is important for a three - dimensional spatial reconstitution of the tumor and differentiation from other subungual / periungual tumors.patterns of stromal immunohistochemical markers , cd34 and cd99 are especially useful in differentiating onychomatricoma from superficial acral fibromyxoma , a subungual tumor with several similar histological features as onychomatricoma . histopathological patterns of onychomatricoma vary in proximal and distal sections ; foliated pattern on proximal transverse sections and a glove finger - like pattern on the distal longitudinal section . study of onychomatricoma in multiple sections and planes is important for a three - dimensional spatial reconstitution of the tumor and differentiation from other subungual / periungual tumors . patterns of stromal immunohistochemical markers , cd34 and cd99 are especially useful in differentiating onychomatricoma from superficial acral fibromyxoma , a subungual tumor with several similar histological features as onychomatricoma . to report a rare presentation of unifocal langerhans cell histiocytosis ( lch ) simulating a limbal papilloma . a 24-year - old man presented with a limbal mass in his left eye which had initially been suspected to be a papilloma based on clinical findings . the mass was excised and a histopathological diagnosis of acute bullous inflammation with granulation tissue was made . the lesion relapsed 10 months later which necessitated repeat resection along with corneoscleral patch grafting . to the best of our knowledge , this is the second report of a rare presentation of lch in the limbus which recurred after excision of the primary mass . langerhans cell histiocytosis ( lch ) is a relatively rare disorder characterized by monoclonal proliferation of histiocytes . the condition can be unifocal with involvement of a single organ , or multifocal presenting as disseminated disease . unifocal involvement is the most common presentation of lch and the bone is the most frequently affected tissue.1 ocular involvement can be observed in 1% to 20% of lch cases.2 the condition may primarily involve the orbit , eyelid , epibulbar conjunctiva , cornea , iris , vitreous , choroid and optic nerve , or secondarily infiltrate ocular tissues from surrounding structures.3,4 intraocular involvement by lch has rarely been reported in letterer - siwe disease.5 the orbit is usually involved with unifocal lch , which has a distinct tendency for the superotemporal bone at the rim of the orbit.6 the limbus can rarely be involved in unifocal lch presenting clinically as an infiltrative solitary limbal nodule which may be misdiagnosed as amyloidosis , fibrous histiocytoma , lymphoma , and juvenile xanthogranuloma.2,7 the diagnosis of lch is based on characteristic histopathological features . electron microscopy may also assist the diagnosis by demonstrating intracytoplasmic inclusions named birbeck granules.1 the natural course of untreated lch varies from progressive and fatal systemic disease to localized self - limited lesions.8 local resection for unifocal involvement and systemic chemotherapy for extensive multifocal lesions have been proposed as treatment modalities in lch,9 however spontaneous regression has been reported in some unifocal lch cases.1 herein , we report a case of unifocal lch presenting as an unusual limbal lesion which recurred after primary excision . a 24-year - old man was referred to our center for a recurrent and painless limbocorneal lesion in his left eye . the primary lesion had been removed 10 months earlier with a clinical impression of limbal papilloma at another eye care center . the histopathological diagnosis had been acute bullous inflammation with granulation tissue composed of scattered single- and multi - nucleated histiocytes . uncorrected visual acuity was 20/20 in the right eye and 20/80 in the involved left eye . on slit lamp biomicroscopy , there was an elevated vascular mass extending from the temporal limbus to the central cornea in the left eye . intraocular pressure was within normal limits and fundus examination was unremarkable . with a clinical diagnosis of a recurrent limbocorneal papillomatous / dermoid - like lesion , the patient underwent mass resection together with corneoscleral patch grafting and lateral tarsorrhaphy . slit lamp photography was overlooked preoperatively since the lesion was thought to be a simple recurrent limbal papilloma . after surgery the patient received topical betamethasone 0.1% and chloramphenicol 0.5% eye drops along with non - preserved lubrication four times a day for four weeks . on gross histopathological examination , light microscopy disclosed non - keratinized stratified squamous epithelium overlying a diffuse inflammatory background composed of nests and clusters of large histiocytes with indented and grooved nuclei intermixed with lymphocytes , plasma cells and eosinophils ( figures 1a and 1b ) . the histopathological features were characteristic of lch with incomplete surgical excision . during follow - up and after four months , no signs indicative of recurrence lch results from proliferation of langerhans cells normally present in the epidermis.10 the condition is characterized by a wide clinical spectrum varying from spontaneous regression to rapid progression , recurrence and long - lasting sequelae.11 lch encompasses three main clinical subtypes ; unifocal lch ( eosinophilic granuloma ) , multifocal lch ( hand - schuller - christian disease ) and systemic lch ( abt - letterer - siwe disease).1 younger patients with lch , have a predisposition for multifocal involvement.12 the etiology of lch remains unclear but immune dysregulation with different cytokines has been postulated.1 the orbit is the most common site of involvement in the eye which often includes the orbital diploe . mononuclear histiocytes and multinucleated giant cells are intermixed with eosinophils , lymphocytes , plasma cells and neutrophil polymorphs.10 langerhans cells are immune reactive for s-100 protein and cd1a.1 electron microscopy demonstrates tennis racket shaped cytoplasmic inclusions named birbeck granules in histiocytes which are the gold standard for a diagnosis of lch.1,12 treatment options for unifocal lesions include observation , partial or complete resection , combined resection and low dose radiation , and intralesional corticosteroids . systemic chemotherapy may be indicated for extensive multifocal and systemic lesions.1,9 to the best of our knowledge , after the report by saxena et al2 , our patient is the second case of unifocal limbal lch presenting as a recurrent solitary vascularized nodule . despite the presence of mono- and multi - nucleated histiocytes amongst the intrastromal inflammatory cell infiltrates on histopathological examination of the primary lesion , lch was not diagnosed initially which might be due to the very rare presentation of this condition in the limbocorneal area . differential diagnoses for limbocorneal lch include dermoid , amyloidosis , fibrous histiocytoma and juvenile xanthogranuloma.2 in our case , a limbal papilloma was the initial clinical diagnosis which should be added to this list . there is only a single case report of limbal lch in which the patient remained asymptomatic for a while after complete excision of the primary lesion , but the tumor recurred 15 months afterwards.2,7 based on clinical and histopathological evaluations , the recurrent tumor partially responded to combination chemotherapy and the patient was clinically stable for 5.5 years.7 in our case , recurrence developed 10 months after resection of the primary lesion for which repeat resection together with corneoscleral patch grafting were performed and the patient has been tumor - free up to 4 months . although bakhshi et al7 stated that surgery or radiotherapy for unifocal ocular involvement improves function or cosmesis , the functional and cosmetic outcomes of surgical intervention alone were also favorable in our patient . the other treatment option for limbal lch is chemotherapy . theoretically due to poor penetration of chemotherapeutic agents into the corneal side of the tumor , such treatment may be associated with a partial response.7 whether surgical therapy , in the form of resection of the recurrent lesion along with a limbocorneal patch grafting , is associated with a low risk of recurrence or not requires longer follow - up . in summary , herein we report the second case of recurrent limbocorneal lch which had missed correct diagnosis on initial histopathological studies . the recurrent lesion was managed surgically which included mass resection and a limbocorneal patch grafting , with satisfying cosmetic and functional results .

onychomatricoma is a tumor of the nail matrix which often presents with alterations in the nail plate while the tumor itself is concealed beneath the nail plate . it is a benign , biphasic fibroepithelial tumor which has to be differentiated from other subungual and periungual tumors . we report a rare case of onychomatricoma and describe a three - dimensional histopathological analysis and immunohistochemical patterns of onychomatricoma .

please summarize the articles given below

a 2-year - old asian indian female presented to us with mild fever and swelling of the right upper lid of 10 days duration . there was no history of preceding viral illness or significant medical history necessitating treatment with antibiotics . cutaneous anthrax was unlikely as there was no history of unexplained cattle death in her environment . on examination , the child had low - grade fever and there were no other skin lesions . ophthalmological examination revealed right upper lid edema with a large black necrotic area of the lid which was adherent to the underlying tissues . the child was examined by a pediatrician to rule out any other focus of infection . microscopic examination of the skin biopsy revealed staphylococci and hence cutaneous anthrax was ruled out . the child was started on intravenous cefotaxime for a week with resolution of fever and the necrotic area turned to a well - defined eschar with no edema and induration . after 2 weeks , the child underwent escharotomy with wound debridement and full thickness skin graft from the groin [ fig . 2 ] . under general anesthesia , the groin area was cleaned and draped . the eschar on the lid was found to be partial thickness , was excised in toto , and the wound margins were debrided . the harvested skin was placed over the lid defect and sutured with 6 - 0 prolene . clinical photograph of the child showing large black necrotic area of the right upper lid adherent to the underlying tissues with surrounding erythema and edema and no discharge immediate postoperative clinical photograph showing full thickness skin graft from the groin postoperative photograph at 1 week showing healthy well - taken graft bacterial invasion of the arteries in the dermis and subcutaneous tissues produces a necrotizing vasculitis . the characteristic clinical appearance of eg is a red macule that progresses to a nodular or ulcerative lesion with central area of necrosis surrounded by erythema . bullae develop subsequently and become filled with mucopurulent or serosanguinous fluid . in the end stage , the lesions become hemorrhagic and slough off , leading to a necrotic eschar . progression through these stages is rapid , typically occurring within 1224 h. there are few reports of this condition developing in healthy individuals without any predisposing factors . usually , eg is associated with bacteremia , but can also occur in the absence of it . classic eg rarely involves the periocular tissues and to our knowledge , only a few such cases have been described in the literature . maccheron et al . presented a case of eg that led to orbital cellulitis and panophthalmitis . inamadar et al . described a diabetic individual who developed severe periorbital eg after suffering a laceration to the forehead . ghosheh and kathuria reported a case of bilateral periorbital eg in a diabetic male with renal failure . the mortality rate in nonsepticemic cases varies between 0% and 15% compared with 2096% for those associated with septicemia . the closest differential diagnosis in our case was necrotizing fasciitis , but on the basis of clinical features and negative blood cultures , a diagnosis of eg was entertained in this case . the diagnosis of necrotizing fasciitis depends on clinical features , blood cultures , and gram stain to identify causative organisms and these patients usually have septicemia with positive blood cultures . the eschar formed following antibiotic administration was a full thickness eschar adherent to surrounding tissues and the lesion caused ectropion and mechanical ptosis , which blocked the pupil . considering the possible complications of scarring including entropion or ectropion , trichiasis , corneal exposure , and amblyopia in the child , surgical intervention was indicated . to the best of our knowledge , there are no reports of skin grafting being done as a treatment modality for eg . our patient was atypical in that eg was due to methicillin - resistant staphylococcal infection in contrast to all the four reports where there was pseudomonas infection . the case also highlights the need of early surgical intervention in such circumstances so as the probable sequelae of scarring of upper eye lid , resulting in mechanical ptosis which can result in stimulus deprivation amblyopia can be prevented . the authors certify that they have obtained all appropriate patient consent forms . in the form the patient(s ) has / have given his / her / their consent for his / her / their images and other clinical information to be reported in the journal . the patients understand that their names and initials will not be published and due efforts will be made to conceal their identity , but anonymity can not be guaranteed . the authors certify that they have obtained all appropriate patient consent forms . in the form the patient(s ) has / have given his / her / their consent for his / her / their images and other clinical information to be reported in the journal . the patients understand that their names and initials will not be published and due efforts will be made to conceal their identity , but anonymity can not be guaranteed . recent times have witnessed much turmoil regarding the ' life is sacred at any cost ' maxim . current technology is capable of indiscriminately maintaining some of the vital functions of the body , but the same technology does not necessarily allow us to heal underlying disease processes . an unintended side effect of modern technological advances has been the plausibility of maintaining moribund patients in a state of suspended animation for prolonged and sometimes indefinite periods . also , advanced resuscitation techniques make it possible to convert death into life - in - death . patients may be stalled in suspended animation ; they are not alive in the sense the we enjoy life but neither are they able to die as long as nutrition , hydration , ventilation , and perfusion are assured . in many cases reanimation of such patients this conundrum is created because we must be prepared to apply life - sustaining technology to patients when the benefit appears to outweigh the risk and when there is a reasonable chance for an outcome that the patient would desire . it frequently seems reasonable to buy sufficient time to see whether the disease will respond to aggressive treatment by instituting the most invasive life support technology . however , if organ system failure is not reversible , then the reasoning behind life support technology becomes moot . we must then be prepared to remove supportive technology when it appears that inevitable death is being delayed , rather than meaningful life prolonged . the courts have repeatedly affirmed competent a patient 's authority to regulate their medical treatment , regardless of their reasoning . however , when the patient becomes incapacitated , family surrogates are granted authority to make decisions regarding treatment options because of their proximate knowledge of what the patient would have wanted before they became incompetent . this position is based on the postulate that any attempt to interject physician paternalism into the surrogate decision - making equation is ethically unacceptable . most rational surrogates are unwilling to continue life support after a reasonable trial has demonstrated that its benefit has passed the point of diminishing returns . however , there is a continuing trend of surrogates demanding that moribund patients be kept on life support after prevailing medical opinions concur that there is no meaningful chance of reanimation . some reasons why this occurs are as follows : 1 . physicians tell surrogates that they can make any decision they want as an open - ended ideal . this puts them in the position of being buyers in a consumer 's market . by asking them to make a choice an observer 's primal reaction to the vibrant external appearance of a body supported in an intensive care unit ( icu ) is radically different from that to a corpse on a morgue slab . as long as the patient ' looks viable , it is emotionally easier to accept the pie in the sky bye and bye long shot cure ' . if the patient can just be maintained comfortably for long enough , then a cure may eventually become possible . 3 . surrogates dislike being in a position of making decisions that directly result in the death of a loved one . once life - supporting care is instituted , the patient has options for ' survival ' that they did not have before , even though they are dependent on ' life support ' . there are now variables that decision makers control , and it is much easier to avoid decisions that may hasten death . instead of yielding to inevitable death , the potential now exists to manipulate it . physicians do not have an exceptional track record in explaining end - of - life issues to patients and their families . it is not uncommon for physicians to ask loaded questions in their quest for end - of - life decisions . for example , ' this is your grandmother 's 17th transfer from a skilled nursing facility in 3 months for sepsis and respiratory failure , and now she 's in kidney failure as well . what do you want to do : everything or let her die ? ' given that choice , most surrogates would opt for doing something rather than nothing , even if ' something ' perpetuated open - ended pain and discomfort . the popular media , especially the tabloids , frequently feature anecdotal articles describing patients who have awakened after years of coma . most if not all of these patients ' conditions have been embellished to generate public interest , and frequently subsequent investigators can not find these patients . accordingly , some families feel that if life support systems can maintain vital signs for a day or a week , then ' suspended animation ' should be possible indefinitely , until a cure is found . the notion of ' medical futility ' as an end - stage process in which vital signs can not be supported further is poorly understood by both physicians and surrogates . in fact , any medical treatment capable of sustaining hemodynamics , ventilation , and metabolism is not technically futile if it achieves that limited goal . therefore , if a patient in a progressive , inevitable death spiral is placed on mechanical ventilation , it is not technically futile if vital signs are sustained , however briefly . it is medically inappropriate but not technically futile . under the current rules , the only test of futility is that embodied by the question , ' will this treatment result in sustained life ? ' if the answer is ' yes ' , then virtually any treatment is fair game , even if it will do nothing to revitalize the patient . perhaps the most effective way of dealing with strong familial incentives to tread the path of least resistance in end - of - life care is twofold . first , in end - of - life issue discussions , we must strive for ' consensus without consent ' . discussions with surrogates should strive for concordance and understanding but not extend to soliciting their consent for medically inappropriate care . second , we should strive to emphasize what streat and coworkers termed , ' the large risk of unacceptable badness ' , rather than a vanishingly small potential for benefit . there are far worse things than death , and many of them occur in icus when futility maxims are circumvented . there is a population of icu patients who will die no matter what treatment is rendered them . medically inappropriate care causes pain , suffering , and discomfort . the fundamental maxim for these patients should be comfort .

ecthyma gangrenosum ( eg ) is a cutaneous infection which usually occurs in immunocompromised patients . we report a case of eg of the eyelid treated with escharotomy and skin grafting , highlighting the importance of surgical management . a 2-year - old asian indian female presented to us with right upper lid edema with a large necrotic area . the child received intravenous cefotaxime for a week and the necrotic area turned to a well - defined eschar . escharotomy with wound debridement and skin grafting was done . the present case highlights the importance of surgical intervention to prevent the sequelae of scarring of upper lid .

please summarize the articles given below

adult onset still s disease ( aosd ) is a chronic systemic inflammatory disorder in which high spiking fever , typical skin rash , and polyarthritis occur . the main biological features are neutrophilic leukocytosis , hyperferritinemia , and negative rheumatoid factor ( rf ) or antinuclear antibodies ( ana ) . others may include splenomegaly , pleuritis , pericarditis , and hepatic abnormalities . even though functional prognosis essentially depends on articular involvement , life - threatening prognosis depends on serious complications , such as hepatic failure , disseminated intravascular coagulopathy , hemophagocytosis , infections , amyloidosis , and cardiomyopathy . in this article we suggest a successful combined therapy of prednisolone ( pd ) , colchicine ( col ) , and cyclophosphamide ( ctx ) and review the literature . a 25-year - old korean woman was diagnosed with aosd four years ago after experiencing a high spiking fever , maculopapular rash , and polyarthritis in her hands , elbows and knees . in laboratory findings , the leukocyte count was 19,900/ l , the serum ferritin level was 719.3 ng / ml ( 10240 ) , and rf and ana were negative . during a follow - up , typical skin rash had disappeared after administration of pd , sulfasalazine or hydroxychloroquine and methotraxate ( mtx ) , but either high fever or polyarthitis was wax and wane , and occasionally , intra - articular injections of corticosteroid were administered . in july 1998 , she was admitted to our hospital because of slowly increasing proteinuria over a 7 month period without pitting edema or hypertension . she was single and had no family history of any rheumatic disease or drug history , such as gold or d - penicilliamine . the results of laboratory data showed that the white - cell count ( wbc ) was 12,800 / l , hemoglobin ( hb ) was 10.6 g / dl , platelet was 610,000 / l , esr was 61 mm / hr , and c - reactive protein ( crp ) was 9.50 mg / dl ( < 0.8 ) . the serum protein and albumin had decreased to 4.5 g / dl ( 6.48.5 ) and 2.1 g / dl ( 3.25.5 ) , respectively . twenty - four hour urine protein excretion was 6.9 g / day , and urine creatine clearance was 93.3 ml / min . in radiographic findings , chest pa was normal and bony erosions were detected in both wrist joints . in the sonography , the sizes of both kidneys were 11.5 cm on the right and 11 cm on the left side with increased renal parenchymal echogenicity . renal biopsy showed amorphous deposits in the mesangial areas , some glomerular capillary walls and in the vascular poles ( figure 1 ) . the amyloid deposit stained with congored displayed apple - green birefringence under the polarizing light . immunofluorescence study for igg , igm , iga , c3 , c1 , c4 , fibrinogen , albumin , and light chains showed segmental positive staining for igm and c3 in the mesangium and trace ( ) positive staining for light chain . electron microscopic examination confirmed amyloid deposits in the mesangial areas , which were characterized by non - branching fibrils arranged in a random array ( figure 2a , 2b ) . serum protein electrophoresis showed a decrease in both total protein and total albumin without a monoclonal spike . urine protein electrophoresis showed an elevated total protein level and an elevated total albumin level . we maintained a high oral daily dose of pd ( 45 mg / day , 1 mg / kg ) , ctx ( 100 mg / day ) , and col ( 1.2 mg / day ) . a follow - up 15 months later , laboratory tests showed that the wbc was 6,000 /ul , hb 13.2 g / dl , platelet 297,000 / l , esr 11 mm / hr , crp 0.11 mg / dl , and the serum protein and albumin had increased to 6.2 g / dl and 4.2 g / dl , respectively . the serum ferritin was 24.3 ng / ml . the urine protein clearance was decreased from 6.9 g / day to 92 mg / day . currently , she is taking pd 7.5 mg , ctx 50 mg , and col 1.2 gm orally . the association of amyloid deposits and aosd is rather unusual and should be considered a serious complication . the development of amyloidosis often occurs in patients with longstanding persistent inflammatory diseases . according to previous histopathologic reports on aosd we have experienced 45 patients with aosd in our hospital and so far , found one case ( 2.2% ) associated with renal amyloidosis , which had developed four years after the onset of aosd . when this complication occurs , amyloid material is preferentially deposited in the glomeruli , and proteinuria and nephrotic syndrome are the most common initial manifestations . helin et al . demonstrated in a retrospective study of nephropathy in rheumatoid arthritis ( ra ) that the most common histopathologic finding was mesangial glomerulonephritis ( gn ) , followed by amyloidosis . amyloidosis was the most common finding in nephrotic syndrome . in a patient with isolated proteinuria , amyloidosis , membranous gn , and mesangial gn were almost equally common . membranous gn was closely related to gold or d - penicillamine therapies , whereas mesangial gn probably was related to ra itself . biopsy is thus a valuable tool in differential diagnosis , assessment of prognosis , and decision - making with regard to treatment . although either nsaid or an oral steroid is usually effective in aosd , some patients with complications of the renal amyloidosis may require sustained therapy with corticosteroid and a cytotoxic agent . the col was also effective in a patient with severe ankylosing spondylitis and nephrotic syndrome due to amyloidosis . in review of 10 cases with aosd complicated by renal amyloidosis , combined drug therapy with pd , col , ctx , azathioprine , and mtx were used . in two of those cases , they were treated with steroids and dialysis due to renal failure . in our experience , it has persistently decreased proteinuria as well as recovered polyarthritis or fever , without any severe complications , during the combined therapy of pd , col , and ctx ( table 1 ) . in conclusion although the mechanism of renal amyloid deposition is unknown , early diagnosis and treatment with pd , col , ctx may produce excellent results . epilepsy is associated with a two- to three - fold increase in mortality among patients compared with the general population . sudden unexpected death in epilepsy ( sudep ) is one of the most frequent causes of death among patients with epilepsy . there is strong evidence suggesting that sudden unexpected death in epilepsy ( sudep ) is a seizure - related phenomenon , , , . the first description of this phenomenon was introduced by russell in 1906 . since then , several cases have been reported in the literature presenting with a drop in heart rate or asystole during the seizure . bradycardia and asystole resulted from increased parasympathetic flow through the vagus nerve , which originates in the nucleus ambiguous and dorsal nucleus of the vagus in the medulla . on the basis of one study , the incidence of sudep ranges from 1:1000 and 1:2000 person - years to 1:200 person - years , . according to a recent revised definition , sudep consists of sudden , unexpected , witnessed or unwitnessed , nontraumatic and nondrowning death in patients with epilepsy , with or without evidence of a seizure , excluding documented status epilepticus ( seizure duration > 30 min or seizures without recovery in between ) and asphyxia ; if postmortem examination does not reveal a cause of death , the diagnosis is definite sudep , and if there is a preexisting condition before or after autopsy , which could have contributed to the death , it is classified as sudep plus . strong risk factors for sudep include young age , early onset of seizures , the presence of generalized tonic clonic seizures , male sex , and bedtime occurrence . less significant risk factors for sudep include the prone position , one or more subtherapeutic blood levels , sleep occurrence , and a structural brain lesion . the underlying pathophysiologic mechanisms for sudep are not completely understood , but autonomic dysfunction ; ictal arrhythmias , ictal bradyarrhythmia , and asystole , ; neurogenic pulmonary edema ; and ictal central or obstructive apnea , , were introduced in the literature . in this report , we describe two patients with seizure - associated asystole monitored by simultaneous video electroencephalography electrocardiography . a thirteen - year - old right - handed male with seizure disorder was admitted for a presurgical assessment . there was a history of neonatal hypoglycemia during an apparently normal vaginal delivery . he was started on antiepileptic drugs , but the second seizure appeared six months later . the seizures typically consisted of blurred vision and upward gaze followed by a loss of consciousness . his mri showed near symmetrical signal abnormality at parietooccipital regions bilaterally ( parasagittal aspect ) accompanied by mild gliosis and volume loss ( fig . , there was bilateral rhythmic activity maximum to the left associated with right - side clonic jerk and head and eye deviation to the right that secondarily generalized and was followed by 16 s of asystole at the end of the seizure ( fig . 1 , fig . 2 , fig . 3 ) . interictal abnormality consisted of bilateral spike - and - wave and bilateral slow activity maximum in the right posterior head region . at the end of monitoring , an anticonvulsant drug regimen of valproic acid and levetiracetam was started , and cardiology consultation was suggested . a 42-year - old right - handed male with seizure disorder was admitted for presurgical assessment . his epilepsy was due to penetrating head trauma in the left frontal lobe from a shell injury . since then , he had been experiencing episodes of intense fear followed by generalized tonic clonic movements . neurologic examination included mild paresis in the right upper extremity and in the distal part of the right lower extremity in the range of 12/5 . the very first clinical manifestation was after the initial eeg changes and consisted of a generalized tonic afterwards , the sa arrest took place and lasted about 1 min ( see fig . 5 , fig . 6 , the very first eeg change started with 5-hz spike slow waves over the left parasagittal area with the maximum amplitude on c3 and f3 . the interictal abnormality consisted of delta waves seen at p3 , c3 , and f3 . considering his cardiac arrest during the seizure , a cardiac consultation was done , and a pacemaker was implanted . during 24 months of antiepileptic regimen , the frequency of seizures was reduced remarkably . theoretically , these asystoles could have a role in the incidence of sudep , meaning that the presence of ictal bradycardia is a risk factor for sudep . furthermore , in cases of epileptic cardiac dysrhythmia , isolated eeg or ecg recording may prove insufficient , and prolonged simultaneous eeg / ecg monitoring may be required . only simultaneous eeg and ecg recording will reveal a possible cerebral origin of arrhythmias in these patients who are , typically , young . attaining the correct diagnosis is essential because appropriate treatment may prevent cardiogenic sudep , which is thought to be related to potentially lethal arrhythmias , such as asystole induced by epileptic seizures , and to prevent the cardiac side effects of specific antiepileptic drugs . in conclusion , cardiological investigation should be included in epilepsy management to search for abnormalities of hr or ischemic events . in addition , it can provide an appropriate guideline in pharmacotherapy since certain types of drugs including carbamazepine , phenytoin , benzodiazepine , and barbiturates should only be used with caution by patients with epilepsy who have cardiac dysfunction . increasing knowledge about sudep risk factors can have a significant preventive role . moreover , strategies such as taking a detailed cardiovascular history to get the comprehensive clinical picture including a detailed history of symptoms , risk factors , and prior cardiac findings should be undertaken .

we report a 25-year - old korean woman with adult onset still s disease ( aosd ) presented with renal amyloidosis , which had developed four years after disease onset . we successfully treated her with prednisolone , colchicine and cyclophosphamide . a review of the literature uncovered about 10 cases , most of which were treated by various regimens that resulted in poor outcomes . renal amyloidosis should be suspected in patients with aosd who have unexplained proteinuria . although the mechanism of renal amyloid deposition is not well known , earlier histopathologic diagnosis and choice of regimen may affect prognosis .

please summarize the articles given below

oral infections of geotrichum candidum are clinically similar to candidiasis and commonly associated with diabetes mellitus and hiv infection , . cases of dissemination and fungemia are reported in patients with chronic and acute myeloid leukemia , , , , , , . old women post - partum with isolated renal calculi and renal fungal bezoar attributed to geotrichum candidum and to illustrate the diagnostic dilemmas . old women presented with history of left flank pain and intermittent fever since 15 days . she was evaluated elsewhere with contrast enhanced computerized tomography ( ct ) scan which revealed contracted left kidney with 2 calculi in the lower and middle calyx of 89 mm each with intrapelvic mass and multiple air pockets in the renal pelvis ( fig . 2 ) . she had undergone cytoscopy and left dj stenting elsewhere but continued to have fever and flank pain when she was presented to us . after routine investigation , patient was started on 3rd generation cephalosporin and she underwent left percutaneous nephrolithotripsy ( pcnl ) which revealed brownish gray material with 2 calculi . gross specimen consists of multiple irregular gray brown tissue bits , largest measuring 0.5 cm0.5 cm and cut portion showed gray brown areas . section showed fungal ball containing aggregates of macerated , distorted fungal hyphae with some showing acute angle branching surrounded by cell debris and neutrophils . both urine and biopsy material sent to mycology laboratory for culture investigation were inoculated on sabourauds dextrose agar ( hi - media laboratories ltd . , mumbai ) and incubated at 37 c and 28 c which grew a rapidly growing fungus with flat , white to creamy having a smooth texture later becoming hairy consistent with geotrichum candidum ( fig . geotrichum candidum was morphologically identified by the presence of true hyphae , hyaline smooth , one - celled , subglobose to cylindrical , slimy arthroconidia and the lack of blastoconidia . the arthroconidia vary in size and germinate at one end giving a hockey stick appearance ( fig . 4 ) . biochemical identification was carried out in the mycology laboratory , kasturba medical college , manipal using both conventional and api 20c yeast identification system ( biomerieux inc . ) . it was further differentiated from trichosporon by the absence of urea utilization and inability to assimilate carbohydrate ; maltose , sucrose , lactose , cellobiose , inositol raffinose and trehalose . antifungal susceptibility testing for the isolate was performed according to the clinical and laboratory standards institute ( clsi ) document m38-a2 . the mic90 ( minimum inhibitory concentration ) for amphotericin , fluconazole , itraconazole and voriconazole were found to be 0.125 g / ml , 16 g / ml , 4 g / ml and 0.25 g / ml respectively . patient continued to have fever in the post - operative period and responded only after starting intravenous itraconazole 200 mg bd for 2 days followed by oral itraconazole 200 mg bd and continued for 6 weeks . during the follow up , a repeat ct done showed complete clearance of the fungal material from the left kidney . the saprophytic colonization of a preformed cavity by conglomerate of fungal mycelia without invasion of adjacent tissue is termed as fungal ball or fungal bezoar . renal colic can be caused by passage of fungal ball that obstruct the collecting system . genitourinary tract is rarely a site of primary fungal infection with exception of candida species , however it may be involved as a result or part of systemic infection . candidal infection can cause pyelonephritis , abscess , papillary necrosis and obstruction with fever and flank pain , . genitourinary fungal infections are usually encountered as a part of disseminated disease in immunocompromised host ( aids , corticosteroids , malignancy , neutropenia ) , , , , , , . fungal balls also called and fungal bezoars or accretions are known to cause ureteral and uretro - pelvic junction obstruction . diagnosis is established by identification the of fungi in urine and imaging studies using ( computerized tomography , ultra sonography , intravenous urography ) that document obstructive uropathy and soft tissue density with in renal collecting system . have successfully managed the removal of bilateral renal pelvis mycotic bezoars using a mechanical thrombectomy device followed by antifungal renal pelvis irrigation . percutaneous nephrostomy , tract dilation and fluoroscopically guided extraction of renal fungal ball under epidural anesthesia is described by doemeny et al . . the outcome of geotrichum infections depend on the degree of tissue invasion by the organism and the immune status of the host . sheehy et al . suggested that geotrichum lack virulence and ability to colonize renal tubules based on the rarity of disseminated disease , lack of tissue invasion and their rapid clearance in most of the case reported . its incidence may be under reported since it can be misdiagnosed histopathologically as candida , aspergillus or trichosporon . this possibility of misinterpretation highlights the importance of obtaining repeated fungal cultures in addition to histopathological examination . we hereby reiterate the pathogenic potential of geotrichum candidum and report its role in causing renal fungal ball . many different chemotherapy regimens were therefore developed.13 however , little is known on the feasibility and efficiency of chemotherapy for these cancer types in patients with severe renal failure.46 only case reports on the pharmacology of irinotecan in patients with colon or rectal cancer are available at present.711 we present the first case of combination chemotherapy in metastatic gastroesophageal cancer in a dialysis patient . a 73-year - old patient with a longstanding history of ischemic heart disease had been on dialysis for two years for vascular renal insufficiency . in september 2004 he was admitted for gastrointestinal blood loss . ca 19.9 was very high : 24925 u / ml ( nl < 37 u / ml ) . the patient was started on chemotherapy , the regimen consisting of l - leukovorin 250 mg / m , irinotecan 50 mg / m followed by 5-fluorouracil ( 5 fu ) 2 g / m/24 h , six weeks out of eight.1213 there was neither significant nausea nor diarrhea . dialysis was continued three times a week , ( the patient was on a monday wednesday friday schedule of dialysis ) and chemotherapy was given on the monday , just after dialysis . after four weeks of chemotherapy he also underwent a right carotid endarterectomy for an intercurrent transient ischemic attack in the right carotid region . six months after starting chemotherapy the ct scan of the liver showed a complete response of the numerous metastases . ( table 1 ) nine months after initiation of treatment , however , the liver metastasis and tumor marker were progressive again . doses of chemotherapy were based on a number of case reports on paclitaxel for ovarian cancer in dialysis patients.14,15 ct scan after two months showed further progressive disease . the increase in solid tumors in a patient undergoing dialysis poses specific problems,16 especially in the choice and pharmacology of anticancer drugs , bearing in mind that all of these drugs were developed in patients with normal liver and kidney function . for gastric cancer , 5fu has always been the backbone of treatment.1,2 in chronic hemodialysis , there are some data on dose reductions with 5fu weekly.17,18 for gastric cancer , combination chemotherapy is , however , necessary to obtain prolonged disease control and even for prolonging overall survival.1,2 combinations of 5fu + cisplatin and either docetaxel or epirubicin have therefore become standard chemotherapy regimens in gastric cancer.19,20 besides the aforementioned regimens , irinotecan - based combinations were shown to be active in first21 and second line gastric cancer.22 its equivalence ( in combination with 5fu ) in first - line metastatic gastric cancer was recently established in two studies , both comparing this regimen with a combination chemotherapy with cisplatin and 5fu.23,24 irinotecan is metabolized in the liver to its active metabolite sn-38 , followed by biliary excretion.6 there is no significant renal elimination . the drug was evaluated in patients with serum creatinin between 1.6 and 5 mg / dl and no unexpected toxicities were seen.25 there are a number of case reports on the use of irinotecan during hemodialysis , all of which are on patients with metastatic colon cancer . a first report mentions the use of irinotecan at a dose of 50 mg / m without significant toxicity.7 in two other case reports on dialysis patients , both patients were started with irinotecan at 50 mg / m . both reports mention that by increasing the dose , prohibitive diarrhea was the consequence.8,11 the worst outcome in higher irinotecan doses ( above 125 mg / m ) was demonstrated in two other dialysis patients , where these dosages led to extreme gi toxicities and even death.9 it can be concluded that irinotecan in terminal renal insufficiency should not be given at a dose above 50 mg / m . korean authors have made pharmacologic evaluations on the use of irinotecan in small - cell lung cancer patients during dialysis . they noted however that these doses were only feasible in patients of korean descent.26 there is a very recent case report on the combination of irinotecan at a dose of 50 mg / m weekly combined with fu1600 mg / m/24 h / week , leading to disease stabilization at six months in a dialysis patients with diffuse bone , cerebral and liver metastases of colon cancer.10 our case report builds on this knowledge of the use of irinotecan in metastatic colorectal cancer during dialysis . this case report discusses both the weekly dose of irinotecan and the 24-hour administration of 5fu in a gastroesophageal cancer patient . this is the first report on the efficacy of irinotecan- and fluorouracil - based chemotherapy in a dialysis patient with liver metastases of a gastroesophageal carcinoma . combination chemotherapy of irinotecan and fu was extremely well tolerated , without significant delays in administration . it produced radiographically complete remission of the liver metastases , and a normalization of ca 19 - 9 tumor marker , leading to a remarkable overall survival .

geotrichum candidum is yeast like fungi that cause infections in immunocompromised patients . we report a case of renal fungal ball with geotrichum candidum in a 27 yr . old women post - partum . this case to our knowledge is the first case of renal fungal bezoar due to geotrichum candidum reported in india .

please summarize the articles given below

giant cell tumor ( gct ) is a tumor found most often in the ends of long bones and is essentially located in the epiphyseal or metaphyseal or epiphyseal equivalent portions of bone . it is a locally aggressive neoplasm , generally arising in adults between the ages of 20 and 40 years , clinically possessing metastatic potential . the rib is a rare site with a reported incidence of less than one percent . even in the cases involving the rib , most were located in the posterior arc , i.e. , the head and tubercle of ribs . rare multicentric forms have been reported.[13 ] in this article , we report a case of gct originating from the anterior arc of the rib which was diagnosed on fine needle aspiration cytology ( fnac ) . a 23-year - old female presented with a six - month history of a progressively growing mass in the right anterior chest wall associated with slight pain . cytological smears were cellular and comprising aggregates of uniform appearing spindled stromal cells and innumerable osteoclast type giant cells , having variable number of nuclei . the nuclei of the stromal cells resembled those observed in the osteoclast type giant cells . the stromal cells showed high nuclear to cytoplasmic ratio , with evenly distributed chromatin and inconspicuous to small nucleoli . no significant nuclear atypia was observed either in the giant cells or the background stromal cells . mitotic figures were noted frequently [ figure 1 ] . in correlation with radiographic findings of an eccentric expanded lytic lesion with cortical erosion of anterior arc of fourth rib [ figure 2 ] , a diagnosis of aggressive giant cell tumor of rib was offered cytologically . in our case , the musculoskeletal radiologist had opined an aneurysmal bone cyst and askin tumor of anterior chest wall . aggregates of uniform appearing spindled stromal cells and innumerable osteoclast type giant cells ( h and e , 400 ) . inset showing histomorphology of the resected giant cell tumor ( h and e , 400 ) large expansile tumor mass with thinned out cortex in the anterior end of fourth rib noted on computed tomography scan in view of the cytomorphological diagnosis and radiological cortical destruction of anterior arc of fourth rib , patient was referred to a surgical oncology centre with a possibility of soft tissue extension being also considered . at the higher centre , complete resection of the tumor patient remained asymptomatic without evidence of recurrence at the end of one year following surgical intervention . at the last follow up gct of bone is an uncommon neoplasm accounting for about 45% of all primary bone tumors . in fact , they may represent stromal precursor cells that have lost some of the detectable macrophage associated antigens or mononuclear phagocyte antigens seen in the more mature cells . gct are generally considered benign but malignant cells can arise de novo or via transformation from a benign neoplastic giant cell lesion.[13 ] interestingly , gct 's are more common in females . although the role of steroid metabolism in these lesions is unclear , estrogen and progesterone receptors have been identified in the cells of this lesion . the metaphyseal or epiphyseal zones of long bones are the most common sites , with 60% arising around the knee joint . isolated cases have been reported in the scapula , sternum , patella , vertebra , skull and talus . only few cases of gct involving the ribs have been reported in the literature with most of them involving the posterior aspect . due to its rarity , gct arising from the chest wall is difficult to diagnose , especially when the tumor is located in the anterior arc of the ribs . it is also compounded by the fact that soft tissue counterpart of gct is also known.[135 ] pain and an increase in local volume are the principal forms of presentation . some patients present with pathological fracture resulting from weakening of the cortical bone . on a routine radiograph , gct presents as an initially eccentric expanded lytic lesion , without a surrounding sclerotic halo , representing the cortical bone . as the lesion grows , it can encompass the entire circumference of the bone , causing rupture of the cortical bone , but a periosteal reaction is rarely seen . roentgenographic classification schemes have been used to characterize the tumor in any given case and attempt to predict the clinical outcome . histological features : benign , aggressive and malignant , the latter having clearly pleomorphic features with abundant mitotic figures and ( ii ) . , although there were no overt anaplastic features in the tumor cells , mitotic activity was frequently detectable . with the clinical symptomatic presentation of a rapidly growing mass and radiological evidence of bone destruction and expansion , a cytomorphological diagnosis of an aggressive gct was offered in this case . a wide array of lesions may histologically mimic , depending on the quality and size of the biopsy . while examining lesions rich in these cells , if particular attention is paid to the background stromal cells and the clinico radiological data are correlated , then establishing the diagnosis becomes easier . a differential diagnosis of aneurysmal bone cyst ( abc ) , brown tumor , chondroblastoma , chondromyxoid fibroma ( cmf ) , non - ossifying fibroma ( nof ) , giant cell rich osteosarcoma and malignant fibrous histiocytoma can be considered on cytology . in gct , the giant cells are numerous in number and they are attached at the periphery of the clustered spindle cells . aspirates from an abc are generally hemorrhagic with sparse cellular yield comprised of scattered osteoclastic giant cells , spindle shaped fibroblastic cells and hemosiderin laden macrophages . in chondroblastoma , chondroid matrix and plump , spindle - shaped mononuclear cell component along with occasional osteoclastic giant cells are present . in cmf , aspirates show chondroid fragments , spindle - shaped fibroblastic cells and scattered osteoclastic giant cells in a myxoid background . nof yields groups and clusters of spindle cells , histiocytic cells with vacuolated cytoplasm and occasional osteoclastic giant cells . the cytology of brown tumor is similar to nof with characteristic spindly mononuclear cells , osteoclasts and macrophages . giant cell rich osteosarcoma and mfh are characterized by nuclear anaplasia and abnormal mitotic figures and in the gct there is no neoplastic osteoid formation which is the most pathognomonic finding of a giant cell rich osteosarcoma . except for the lack of bony involvement , primary giant cell tumor of soft tissue resembles in all its cyto - histomorphological features its osseous counterpart.[24 ] in general , all gct 's should be considered potentially aggressive and wide excision is recommended . fine needle aspiration cytology has been useful in diagnosing similar lesions at rare sites like distal fibula . a primary malignant gct of sacrum could be identified in a middle aged female as also a multifocal gct in a skeletally immature patient . serum acid phosphatase values are suggested to be a useful marker for diagnosis of gct of the bone and for evaluation of the efficacy of treatment of the tumor . the values were high in 56% of gct patients and later decreased to normal values after resection as seen in our case . to conclude , our case illustrates the fact that giant cell tumors of anterior chest wall can be mistaken for abc and other malignant tumors of bone and soft tissues . the fine needle or image - guided biopsy would be diagnostic if adequate specimen is obtained .

the fully differentiated cells of the rat mammary parenchyma , the ductal epithelial , alveolar , and myoepithelial cells , are distinguished by their ultrastructure and by their accumulation of immunocytochemically detectable marker proteins . the different cell types probably develop from primative ductal structures called terminal end buds , which are present in the developing rat mammary glands , and these structures contain relatively undifferentiated cells . clonal epithelial stem cell lines , obtained from normal rat mammary glands or benign mammary tumors , differentiate under appropriate conditions along a pathway to droplet - cell / doming cultures of primative alveolarlike cells . under different culture conditions , the epithelial stem cells differentiate along a separate pathway to myoepitheliallike cells . they accumulate some of the specific marker proteins of myoepithelial cells in vivo , including type iv collagen , laminin , and thy-1 antigen . in addition , these myoepitheliallike cells in culture contain an abundance of a potential calcium - binding protein , p9ka , which also occurs in myoepithelial cells of histological sections from mammary glands . the accumulation of type iv collagen , laminin , thy-1 , and p9ka occurs asynchronously along the pathway to the myoepitheliallike cells in vitro . furthermore , the steady - state levels of these different marker proteins arise by alterations in the controls at the transcriptional , the posttranscriptional processing , and the translational stages of their production . these results suggest a stepwise control of synthesis of myoepithelial cell marker proteins , and in the case of p9ka and thy-1 antigen , this altered control may arise through their possession of novel transcriptional promoters.imagesfigure 1 .

please summarize the articles given below

lymphoepithelioma is a term used to designate an undifferentiated malignant epithelial tumor of the nasopharynx that is histologically distinctive because of a markedly prominent lymphoid infiltrate ( 1 ) . carcinomas with similar histological features arising outside the nasopharynx are called lymphoepithelioma - like carcinoma ( lelca ) . lelca occurs in organs such as salivary glands , the uterine cervix , the thymus , the lung , the skin , the stomach , the bladder , the prostate , and the breast ( 2 ) . it is very rare that lelca occurs in the urinary system , there is one case where it occurred in the renal pelvis , and one case where it occurred in the ureter and the kidney simultaneously , but has not been reported so far in urinary bladder in korea . the author et al . have lately experienced lelca that occurred in the urinary bladder , and thus have reported the case along with philological considerations . a 78-yr - old woman presented with gross hematuria for 2 weeks on november 23 , 2009 . the patient was a non - smoker and had not been exposed to carcinogen . physical examination and vital sign were normal at the time when the patient was admitted to this hospital , numerous rbc were observed on urinalysis . there were no notable findings on blood test and chest radiography . on cystoscopy , a frond - like mass was observed at the bladder trigone , which measured about 1 cm ( fig . 1 ) . since hematuria continued , foley catheterization was performed . on computerized tomography ( ct ) of the abdomen and pelvis , the findings of enhancement and a small - sized mass were observed on the inner surface between posterior walls in the bladder trigone . the findings of perivesical infiltration and lymph node metastasis were not observed . on the authority of above findings , the authors suspected the case to be carcinoma in situ of the urinary bladder or transitional cell carcinoma , and thus transurethral resection of bladder tumor ( turbt ) on histopathological examination , it was found that 90% of lesions were lelca and a few lesions were non - invasive transitional cell carcinoma . on microscopy , syncytial growth pattern and indistinct cytoplasmic borders were observed with the severe infiltration of lymphoid cells . tumor cells were positive for cytokeratin 7 but were negative for cytokeratin 20 ( fig . the infiltrated lymphocytes were composed of abundant cd3 positive t cells and cd20 positive b cells . for leukocyte common antigen ( lca ) , the patient has been without recurrence and metastasis for 3 months after the operation , and currently is on a follow - up . ( 3 ) in 1991 , is uncommon with a reported incidence between 0.4 and 1.3% of all bladder carcinoma ( 4 ) . in the urinary tract , they typically arise in the urinary bladder , although isolated cases have been reported in the renal pelvis , ureter , and urethra ( 5 , 6 ) . as suggested by amin et al . ( 7 ) , lelca was categorized as pure ( 100% ) , predominantly ( more than 50% ) , or focal ( less than 50% ) . if other classification is applied , lelca was classified as pure when 100% of the tumor showed lymphoepithelioma - like carcinoma pattern , and mixed when associated with usual infiltrating urothelial carcinoma , adenocarcinoma , or squamous carcinoma ( 2 ) . it has been suggested that pure / predominant lelca responds to chemotherapy and may best be treated with bladder preservation therapy ( 1 , 13 ) . according to previous reports , pure and predominant lelca is more favorable than focal lelca in prognosis ( 2 , 3 , 7 ) . this case was the predominant type that lelca accounted for over 90% of lesions and was fractionally accompanied with non - invasive transitional cell carcinoma . the differential diagnosis is usually malignant lymphoma , invasive transitional cell carcinoma , squamous cell carcinoma and small cell carcinoma . ( 5 ) note that it is imperative to distinguish between lelca and malignant lymphoma , as primary bladder lymphoma is extremely rare . therefore , immunochemical staining , such as lca and keratin , may be used for differentiation . ( 8) maintained that immunochemical staining techniques were helpful to distinguish bladder lymphoma from undifferentiated carcinoma . pooly differentiated transitional cell carcinoma ( tcc ) with a lymphoid linfiltrate should be distinguishable from lelca in that the latter is characterizied by syncytia of tumor cell , vesicular nuclei and prominent nuclei ( 7 ) . the microscopic findings of lelca are characterized by the indistinct cytoplasmic border and the syncytial growth pattern with the prominent lymphocytic infiltrate . it is important to check cytokeratin in tumor cells on immunochemical staining , in order to ascertain that cells are originated from epithelial cells ( 1 ) . the principal symptoms of lelca were mostly gross hematuria , solitary mass , and tumors measured 1 to 5 cm ( 10 , 12 ) . the epstein - barr virus is regarded as one of factors of the lelca that occurred in the thymus gland ( 9 ) . however , it has not been elucidated that lelca of the urinary system is related with ebv ( 10 ) , gulley et al . ( 11 ) reported that ebv , detected from nasophayneal carcinoma , was not detected in 9 out of 11 cases of lelca . also in 9 cases of lelca reported by holmang et al . for lelca treatment , surgical therapy and chemotherapy can be applied . in the case of small tumors that measure 5 cm and less , turbt is applied , but in the case of big or invasive tumors , radical cystectomy may be applied . as nasopharyngeal lymphoepithelioma is well reacted to chemotherapy , methotrexate , vinblastine , doxorubicin and cisplatin may be applied to chemotherapy ( 7 ) . 13 ) reported that primary chemotherapy was performed on 3 patients with muscle invasive lymphoepithelioma of the bladder and as a result their bladder functions were salvaged . it is presumed that bladder lymphoepithelioma may be well reacted to radiotherapy , like nasopharyngeal lymphoepithelioma ( 14 ) . ( 12 ) applied radiotherapy to 4 patients , but could not evaluate whether the patients got cured successfully . lelca is a rare tumor , and it is important to differentiate it from other tumors .

in exposure or risk assessments , both environmental and biological measurements are often used . environmental measurements are an excellent means for evaluating regulatory compliance , but the models used to estimate body burden from these measurements are complex . unless all possible routes of exposure ( i.e. , inhalation , dermal absorption , ingestion ) are evaluated , exposure to a toxicant can be underestimated . to circumvent this problem , measurements of the internal dose of a toxicant in blood , serum , urine , or tissues can be used singularly or in combination with environmental data for exposure assessment . in three separate laboratories , carbaryl or its primary metabolite , 1-naphthol , was measured in personal air , dermal samples , blood serum , and urine from farmer applicators and their families . the usefulness of both environmental and biological data has been demonstrated . for the farmer applicator , the environmental levels of carbaryl would have been sufficient to determine that an exposure had occurred . however , biological measurements were necessary to determine the absorbed dose of each member of the applicator 's family . in addition , a correlation between serum and urinary 1-naphthol measurements has been shown ; therefore , either matrix can be used to accurately evaluate occupational carbaryl exposure.imagesfigure 1.figure 2.figure 3.figure 4.figure 5 . afigure 5 . b

please summarize the articles given below

it is a major social and economic scourge in tropics and subtropics of africa , asia , western pacific and parts of america affecting over 120 million people in 80 countries . the disease is endemic all over india especially in uttar pradesh , bihar , jharkhand , andhra pradesh , orissa , tamil nadu , kerala and gujarat . there are at least six million attacks of acute filarial disease per year and 45 million persons are currently having one or more chronic filarial lesions . . conventional mode of diagnosis of filariasis is by demonstration of microfilaria in peripheral blood smear . despite high incidence , it is infrequent to find microfilariae in fine needle aspiration cytology ( fnac ) smears and body fluids . the literature contains a few reports of microfilariae found in various locations including thyroid nodule , skin and soft tissue swelling , epididymis , breast,[268 ] salivary gland , cervicovaginal smear , ovarian cyst , urine , lymph node , and effusion fluids . the aim of present study was to assess the role of fnac in diagnosis of filariasis in asymptomatic patients having superficial lumps . the study was conducted at the department of pathology in collaboration with the departments of medicine and surgery at b.r.d . medical college , gorakhpur during a period of two years i.e. 2006 - 2007 . a total of 250 cases , with age ranging from 15 - 80 years , having swellings at various sites were included in the present study . aspiration was made by technique of martin and ellis . in case of cystic lesions , cyst content was aspirated and smears prepared from cyst fluid after cytocentrifugation were studied along with the aspiration performed from cyst wall . these smears were wet fixed immediately in 95% alcohol and stained by hematoxylin and eosin and papanicolaou stain . this study was conducted on 24 cases of filariasis diagnosed on routine fnac material from various sites . out of these 24 cases , maximum cases of filariasis were reported in breast swelling ( eight cases ) , followed by lymph nodes ( six cases ) , scrotal swellings ( four cases ) , thyroid swellings ( three cases ) , soft tissue swellings ( two cases ) and ascitic fluid ( one case ) . clinical presentations of these cases were variable which included swelling , pain , fever and erythema [ table 1 ] . showing clinical profile , cytological findings and associated conditions of 24 cases smears revealed sheathed microfilariae , tails of which were free from nuclei and many had graceful curves . thick and thin blood smear examination of nocturnal venous blood revealed microfilariae of wuchereria bancrofti in three out of 24 cases . microscopic examination of breast swellings showed sheathed microfilaria along with few groups of benign ductal epithelial cells , myoepithelial cells , bare nuclei , few fragments of fibrofatty tissue and inflammatory cells comprising of eosinophils and neutrophils [ figure 1 ] . two cases of breast lumps showed epithelioid non - necrotising granuloma without giant cells and plasma cells . fnac smear of breast swelling showing sheathed microfilaria along with inflammatory cells thyroid aspirates revealed few groups of follicular cells in the background of colloid . in between follicular groups , aspirate from scrotal swelling showed numerous coiled and uncoiled sheathed microfilariae along with neutrophils , eosinophils and few lymphocytes [ figure 2 ] . fnac smear of scrotal swelling showing sheathed microfilariae along with polymorphs , macrophages and eosinophils lymph node aspirates showed sheathed microfilariae in the background of mixed population of lymphoid cells comprising of mature lymphocytes , centrocytes , centroblasts , dendritic cells and few eosinophils . cytological findings of soft tissue swellings showed microfilariae along with neutrophils , eosinophils and granular debris . cell adherence of inflammatory cells and macrophages to microfilariae was seen in three out of 24 cases . filariasis is a major public health problem in tropical countries , including india . in endemic areas like eastern part of uttar pradesh , a majority of infected individuals in filarial endemic communities were asymptomatic . in the present study maximum cases ( eight out of 24 cases ) many authors have reported microfilariae in breast lumps by fnac smears.[2468 ] aspirates from lymph nodes ( five out of 24 ) , demonstrated microfilariae in a background of reactive lymphoid cells . the lymphatic vessels of spermatic cord appear to be common and perhaps the principal site of adult wuchereria bancrofti in men with asymptomatic microfilaremia . occurrence of living w bancrofti in scrotal area of men was demonstrated by noroes et al . two cases of soft tissue swellings and one case of ascitic fluid showed microfilaria along with inflammatory cell including eosinophils , lymphocytes and macrophages . out of 24 cases showing microfilariae in fnac smear examination , blood eosinophilia was present in eight cases , of which microfilaremia in nocturnal venous blood smear examination was observed in three cases only . findings are consistent with observation made by others , who reported that filariasis can exist without microfilaremia . significant adherence of inflammatory cells and macrophages to microfilariae was present in three out of 24 cases . despite high incidence of filariasis , microfilaria in fine needle aspiration cytology is not a very common finding . careful screening of fnac smears undoubtedly the demonstration of parasite , in aspirate , play a significant role in recognition of disease and institution of specific treatment , thus obviate the severe manifestations of lymphatic filariasis . patients with symptomatic sciatic hernias commonly present with flank , abdominal , pelvic , lower back or thigh pain . most asymptomatic patients have been treated conservatively , while surgery has been reserved for symptomatic patients . we describe a case revealed by left hydronephrosis with severe left back pain in a 72-year - old female . this case shows that minimally invasive endourological techniques may provide a novel method for relieving this cause of obstruction . a 72-year - old female accidentally struck her left forechest 2 months before she was referred to our hospital , and lower left rib fracture was observed on x - ray examination . she was suffering from severe left - sided back pain , which was thought to be apart from the rib fracture site , and the pain was intermittent . the ultrasound sonography demonstrated left hydronephrosis and a simple renal cyst on the lower pole of the left kidney , and urinalysis showed microhematuria . routine blood tests were not remarkable except for a slightly elevated serum glucose level of 179 mg / dl . intravenous ureterography ( ivu ) showed findings compatible with a left sciatic ureter , a dilated ureter with a fixed kinking , which is known as the abdominal ct showed marked hydronephrosis and hydroureter on the level of the pelvic inlet and revealed the presence of a sciatic herniation of the ureter ( fig . 2 ) . the ureter was seen to course behind the left hip and through the greater sciatic foramen , anterior to the piriformis muscle . no evidence of inflammatory lesions , compressive tumor or herniation of another pelvic organ with the ureter was seen . subsequently , the placement of ureteral stent was performed to decompress the dilated upper urinary tract . interestingly , the ureterosciatic hernia was relieved with the passage of a flexible guide wire and a double - pigtail stent ( fig . however , the patient refused continuing to have an indwelling stent and the stent was removed . ivu obtained 3 months after the removal of the ureteral stent revealed the recurrence of the ureterosciatic hernia ; however , there was no evident recurrence of hydroureter , hydronephrosis or ureteral obstruction . since then six years after ureteral stenting , the patient continues to be without hydronephrosis , symptoms or the usage of the indwelling ureteral stent . most ureteral herniations occur in the inguinal area but they have also been noted in femoral , sciatic , thoracic , and parailiac locations . among them , ureterosciatic herniation is extremely uncommon ; only 31 cases have been reported since 1947 [ 1 , 2 , 3 , 4 , 5 , 6 , 7 , 8 , 9 , 10 , 11 , 12 , 13 , 14 , 15 ] . the clinical symptoms are nonspecific , consisting of ill - defined abdominal pain . patients may have nonurologic complaints including vague abdominal pain or symptoms more typical of small - bowel obstruction . when obstructive uropathy develops , patients with ureterosciatic hernias may or may not experience symptoms of renal colic . the diagnosis is difficult to establish by physical examination because ureterosciatic hernias are deep to the gluteal muscles . however , these hernias may be detected as a palpable mass located underneath the gluteal muscles in a thin patient [ 4 , 9 ] . anatomically , most ureteral herniations such as ureteroinguinal and ureterofemoral hernias are paraperitoneal , since they are adherent to the posterior parietal peritoneum and hence associated with a herniating peritoneal sac . in contrast , ureterosciatic hernias are always extraperitoneal . structures such as small intestine , meckel 's diverticulum , omentum , colon , ovary , fallopian tube , bladder , and ureter may be found in sciatic hernia sacs [ 3 , 4 , 5 , 6 ] . in ureterosciatic herniation , prolapse of the ureter occurs through the sciatic notch , which is divided by the sacrospinous ligament into the greater and lesser sciatic foramina . the greater sciatic foramen is considered a potential space , as the piriformis muscle completely occupies the greater sciatic foramen . the greater sciatic foramen is bound by the ilium laterally , the sacrum and sacrotuberous ligament medially , and the sacrospinous ligament inferiorly . the greater sciatic foramen is further subdivided into the suprapiriformis and infrapiriformis compartments by the piriformis muscle . ureterosciatic herniations usually occur through the suprapiriformis compartment of the greater sciatic foramen [ 5 , 10 ] . previous reports have suggested that atrophy of the piriformis muscle is the predisposing factor for the development of ureterosciatic herniation , creating a potential space through which the ureter could migrate . it has been speculated that the main predisposing factor could be piriformis muscle atrophy , related to hip joint disease , neuromuscular disorders or other locomotor disturbances of the lower extremities [ 4 , 5 , 6 , 7 , 9 ] . although most hernias occur through the greater sciatic foramen , several ones have been reported to herniate through the lesser sciatic foramen [ 2 , 5 , 8 , 9 ] . these cases are usually undiagnosed clinically because the gluteus maximus muscle overlies the sciatic foramen . sciatic ureter has a characteristic radiologic appearance in which a loop of ureter is displaced laterally , inferiorly , and posteriorly through the sciatic notch on ivu and retrograde urography . the diagnosis was confirmed by this image , known as the curlicue sign , which is considered pathognomonic for ureterosciatic herniation . ct may be helpful in diagnosis with the appearance of an ectopically positioned ureter posterior and lateral to the ischial spine , it can demonstrate an ureter with more anatomic information , and it may be useful in detecting the involvement of other structures [ 6 , 12 ] . moreover , ct with three - dimensional reconstruction might be useful for defining the exact location and extent of the herniation . in previous reports , treatments for symptomatic patients included relief of the hernia by excision and reimplantation , ureteroureterostomy or stent placement and observation [ 2 , 8 ] . in our patient , conservative endourological correction was performed . after the spontaneous removal of the ureteral stent , recurrent ureterosciatic hernia occurred . placement of an internal stent possibly provides the rigidity to the ureter , thereby recovering the hernia and urinary obstruction . observation should be used judiciously because the consequences of long - term obstruction can be devastating . indeed , ureterosciatic hernia causing intermittent ureteral obstruction and producing significant morbidity should be repaired . furthermore , when the ureter shows signs of inflammation or trophic disturbances , ureterolysis , reimplantation , and hernioplasty should be carried out [ 1 , 2 , 3 , 4 , 8 , 10 ] . surgical options include excision of the hernia with reimplantation of the remaining ureter , reduction of the ureter length , and transabdominal or transgluteal surgical reduction of the hernia plus fixation of the ureter [ 2 , 4 , 8 ] . recently , laparoscopic and robotic repair surgery has also been reported [ 10 , 15 ] . however , surgical repair should not be performed in asymptomatic patients . for the patient who is elderly or a poor surgical candidate sugimoto et al . also reported a case successfully treated by ureteral stent placement . it is advisable to place a stent for few months and then remove it to see whether the obstruction recurs . this approach provides a minimally invasive means for the treatment of what can be a devastating problem .

background : filariasis is a major health problem in tropical countries including india . fine needle aspiration cytology plays an important role in prompt recognition of disease.aim:to assess the role of fine needle aspiration cytology ( fnac ) in diagnosis of filariasis at all possible sites.materials and methods : total 250 cases of superficial swellings at various sites were subjected to fine needle aspiration cytology.results:out of 250 cases , 24 cases of filariasis were detected which include breast lumps ( 8 cases ) , lymph nodes ( 6 cases ) , scrotal swellings ( 4 cases ) , thyroid swellings ( 3 cases ) , soft tissue swellings ( 2 cases ) and ascitic fluid ( 1 case ) . eosinophilia was present in 8 out of 24 cases with a percentage ranging from 12 - 24% . significant adherence of inflammatory cells and macrophages to microfilariae was present in 3 out of 24 cases.conclusions:in endemic areas , it should be considered one of the differential diagnoses of a superficial swelling . careful screening of fnac smears help in detecting microfilaria even in asymptomatic patients and thus plays a significant role in recognition of the disease and institution of specific treatment .

please summarize the articles given below

tuberculosis ( tb ) is one of the main reasons of mortality and morbidity globally and it kills about two million people annually . there are different diagnostic methods but they have some drawbacks . to prepare mycobacterium culture , which is the golden standard for tb diagnosis , it may take 8 weeks . finding acid - fast bacilli is the quick screening method for pulmonary tb diagnosis ; nevertheless , its sensitivity is low . the polymerase chain reaction ( pcr ) test for tb diagnosis is expensive and it requires skilled personnel and lot of equipments . therefore , in recent years , there has been a great demand for finding new microbiological , genetic , immunological , and biomedical diagnostic methods to diagnosis tb quickly and accurately . ada is essential for proliferation and differentiation of lymphoid cells , especially t cells , and helps in the maturation of monocytes to macrophages . it seems ada is an index for cellular immunity and previous studies have proved its value in tb diagnosis , even for assessing tb effusions . , the level of ada in sputum and serum was used for diagnosis of tb , and it was monitored during tb treatment . however , previous studies used effusion fluids and a very limited number of studies used patients serum . it is not always possible to access effusion liquids everywhere in pulmonary and extra - pulmonary tb ; therefore , it would be helpful to take advantage of serum levels . the goal of this study is to assess the diagnostic value and cut - off point of serum ada levels in pulmonary tb patients . it was a cross - sectional study ( 2011 ) , which is conducted in tohid hospital ( university referral hospital ) in sanandaj in iran . in our study , case group included 40 sputum smear - positive tb patients who were admitted in infectious disease ward of the hospital . inclusion criteria for tb patients were : having 2 or 3 sputum positive smears , or one sputum positive smear and one positive sputum culture , or one positive tb microbe smear sputum and suspected chest radiography . in addition , 40 non - tb patients , referred to tohid hospital in sannandaj for surgeries , were selected as the control group . inclusion criteria for control group were : not having any tb patient in their family , not having history of close contact with tb patients , not having any infectious disease ( according to the interview and their records ) , not having fever or any symptom of illness or of being toxic , normal cell blood count , and normal chest radiography . after diagnosis of tb ( before initiation of treatment ) , blood samples and patients approval of consent form ( research project number : 1387/87 ) were taken from tb group ( at 7 am ) . then samples were centrifuged and serum ada levels were measured by ada kit manufactured by diazyme laboratories company . in the first step , adenosine was affected by ada and it becomes de - ammonized and shifted to inosine and then ammoniac was released . in the second reaction , because of glometat , released nh3 had become dehydrogenized and when it got close to allosteric activators , it combined with nicotinamide adenine dinucleotide phosphate hydrogen ( nadph ) and released nicotinamide adenine dinucleotide phosphate ( nadp ) . consequently , there was a direct relationship between activity ( density ) of ada enzyme and speed reduction of radiation absorption in 340 nanometer wavelength ( as nadph changed to nadp+ ) ; it was measured by diazyme adenosine deaminase assay kitt ( diazyme laboratory ; usa ) . then , data were analyzed using statistical package for the social sciences ( spss ) 11.5 ( chicago , usa ) software and roc curve was plotted . from all 40 tb patients who participated in this study , 16 were males and 24 were females . from 42 participants in control group , 22 were males and 20 were females . the most common age group for tb patients was 50s and for control group , it was 40s . age average was 59 ( 13.5 ) in tb patients and it was 49 ( 15.6 ) for non - tb patients . the average of serum ada in tb patients group and control group was 20.88 ( 5.97 ) and 10.69 ( 2.98 ) , respectively . u / l in which sensitivity and specificity were 92.7% ( 95% ci , 84.7 - 100 ) and 88.1% ( 95% ci , 78.3 - 97.8 ) , respectively . the positive and negative predicative values were 88.4% ( 95% ci , 75 - 95.1 ) and 92.5% ( 95% ci , 79.6 - 98.4 ) , respectively [ figure 1 ] . the calculated area under the roc curve was 0.955 ( 95% ci , 0.914 - 0.995 ) ( p < 0.001 ) . in this study , serum ada level was an appropriate index for diagnosing smear - positive tb . therefore , serum ada could be also used for diagnosis of pulmonary tb . moreover , in this study , all tb patients had a serum level of more than 22.5 u / l . hence , for suspicious cases of tb , increased levels of ada could facilitate diagnosis . diagnostic value of serum ada in pulmonary tb has been assessed only in few numbers of studies . pairs et al . reported an increase in ada level in tb pleural effusion ; other studies have also confirmed such an increase in tb pericardial effusions , peritoneum , and central nervous system ( cns ) . the main reason for the increased ada levels in pleural effusion is the movement of t lymphocytes toward this area . increase in ada level is the result of a tropical inflammatory reaction caused by monocytes and macrophages . when alveolar macrophages are infected by mycobacterium , this enzyme could be found in serum during active pulmonary disease . when tb infection is controlled , growth - markers of lymphocytes decrease ; leucocytes will decrease in serum ada levels concurrent with the decrease in lymphocytes . because of this , serum ada level could be utilized as a treatment response index . in agarwal 's study , ada level was 15.3 ( 0.23 ) in healthy people , 19 ( 0.68 ) in non - pulmonary tb cases , and 38.48 ( 1.56 ) in pulmonary tb patients . in jhamaria et al . 's study , the average of serum ada level was 19.9 u / l ( 2.99 ) in control group , 43.95 u / l ( 2.48 ) in sputum smear - positive people with typical or progressive disease , and 42.09 u / l ( 1.46 ) and 40.02 u / l ( 2.58 ) in negative sputum patients with mild or typical disease . in their study , in the cut - off point of 33 it seems that as the disease progresses , ada levels increase ; this subject was not considered in our study . in another study with an ada level of 26.2 u / l , sensitivity , specificity , and positive predictive value were 95% , 83.3% , and 79.2% , respectively . in gupta 's study , sensitivity , specificity , positive predictive value , and negative predictive value were 92.8% , 90% , 92.8% , and 90% , respectively , for diagnosis of tb in pleural effusion with an ada level of more than 40 . in conde 's study , ada level of 14 u / l was chosen as cut - off point . stevanovic et al . assessed serums of extra - pulmonary tb patients and in a cut - off point of 24 , sensitivity and specificity were 94.3% and 92.2% , respectively ; in their study , serum ada level decreased as treatment started . in dilmac 's study , serum ada level in pulmonary tb patients was reported as 27.5 ( 11 ) and it was 23.9 ( 24 ) in chronic obstructive pulmonary disease ( copd ) patients . in rasolinejad 's study , serum ada level was 21.51 in pulmonary tb patients and 11.47 in healthy people ; in cut - off point of 14.5 u / u / l in negative smear and negative tuberculin patients , 33.52 ( 15.22 ) in smear - positive and purified protein derivative ( ppd ) positive patients , and 16.5 ( 3.18 ) in volunteer healthy people . such differences may be due to tb severity , age groups , genetic differences , and dissimilarities in control groups . therefore , further studies for identifying normal ada levels in different societies may be useful . fortunately , in some autoimmune patients like rheumatoid arthritis , synovial ada level is normal and it is similar to control group . thus , in autoimmune diseases that involve lung , ada level could be used for tb differentiation . in some studies , ada2 was also considered a useful tool for diagnosis ; it needs further studies . according to this study , serum ada level is proposed as a proper index for tb diagnosis ; in a cut - off point of 14 , its sensitivity and specificity are calculated as 92.7% and 88.1% , respectively . anti--tubulin mouse monoclonal antibody ( sigma - aldrich corp ) , anti - arf6 mouse monoclonal antibody ( santa cruz biotechnology , inc ) , anti - rab11 rabbit polyclonal antibody , anti - tfr mouse monoclonal antibody ( invitrogen corp ) , anti - eea-1 mouse monoclonal antibody and anti - gm130 mouse monoclonal antibody ( bd biosciences ) were obtained commercially . s2 was performed with a fluorophore - conjugated anti - tfr antibody that was generated by using the zenon antibody labeling kit ( invitrogen corp ) . using this antibody slightly enhanced the tfr signals at the plasma membrane ( figs . s1 and s2 ) . all of the procedures used to perform cell culture , immunoblotting and the immunofluorescence analyses have been described elsewhere . anti--tubulin mouse monoclonal antibody ( sigma - aldrich corp ) , anti - arf6 mouse monoclonal antibody ( santa cruz biotechnology , inc ) , anti - rab11 rabbit polyclonal antibody , anti - tfr mouse monoclonal antibody ( invitrogen corp ) , anti - eea-1 mouse monoclonal antibody and anti - gm130 mouse monoclonal antibody ( bd biosciences ) were obtained commercially . s2 was performed with a fluorophore - conjugated anti - tfr antibody that was generated by using the zenon antibody labeling kit ( invitrogen corp ) . using this antibody slightly enhanced the tfr signals at the plasma membrane ( figs . s1 and s2 ) . all of the procedures used to perform cell culture , immunoblotting and the immunofluorescence analyses have been described elsewhere .

background : in some studies , the level of adenosine deaminase ( ada ) in sputum and effusion liquids was used for the diagnosis of tuberculosis ( tb ) . but it is not always possible to access these materials . the goal of this study is to assess the diagnostic value of serum ada levels in pulmonary tb patients.materials and methods : in this study , 40 sputum smear - positive tb patients who were hospitalized and 40 non - tb patients who referred for surgeries were selected . a serum sample was collected and serum ada level was measured by ada kit.results:the average ( sd ) of serum ada in tb and non - tb patients were 20.88 ( 5.97 ) and 10.69 ( 2.98 ) u / l , respectively ( p value < 0.05 ) . the best cut - off point was 14 u / l . the calculated area under the receiver operating characteristic ( roc ) curve was 0.955 ( 95% ci , 0.914 - 0.995 ) ; sensitivity was 92.7% ( 95% ci , 84.7 - 100 ) and specificity was 88.1% ( 95% ci , 78.3 - 97.8 ) ( p < 0.001).conclusion : serum ada level may be proposed as a proper index for tb diagnosis .

please summarize the articles given below

a stool sample was obtained from a healthy 2-year - old boy living in senegal . the stool was sent to and frozen in marseille at 80c until laboratory culture isolation . strain sit12 was isolated in may 2015 by cultivation on marine medium in anaerobic atmosphere after 21 days incubation . growth of the strain was tested under anaerobic and microaerophilic conditions using genbag anaer and genbag microaer systems respectively ( biomrieux , marcy ltoile , france ) , and in the presence of air , with or without 5% co2 , but growth was achieved only under anaerobic conditions . m. massiliensis grew at mesophilic temperatures between 25 and 42c after 48 hours incubation on columbia agar with 5% sheep s blood , chocolate agar and mller - hinton agar . growth occurred at ph 6 , 6.5 , 7 and 8.5 and exhibited tolerance for nacl until a concentration of 5 gram staining and electron microscopy of m. massiliensis were performed using a technaig cryo ( fei company , limeil - brevannes , france ) at an operating voltage of 200 kev . the cells were of coccus morphology , 0.5 m in diameter and occurred in pairs and short chains ( fig . 2 ) . the sporulation test was performed using a thermic shock ( 80c during 30 minutes ) , but no free spores were observed and no viable cells could be recovered from sporulating cultures . api zym and api 50 ch ( biomrieux ) gallery systems were used to perform biochemical assays . distinguishing results from biochemical tests between m. massiliensis sit 12 and murdochiella asaccharolitica are listed in table 1 . the antibiotic susceptibility was studied using antibiotics discs ( i2a , montpellier , france ) . murdochiella massiliensis sit12 was resistant to fosfomycin , tobramycin , naxidic acid and colistin but was susceptible to gentamicin , ciprofloxacin , trimethoprim sulfamethoxazole , teicoplanin , rifampicin , ceftazidime , erythromycin , imipenem , tazocillin and aztreonam . using 16s rrna phylogeny analyses , we demonstrated that strain sit12 exhibited a 97% 16s rrna sequence identity with murdochiella asaccharolytica ( eu483153 ) and levyella massiliensis ( hm587324 ) species ( fig . investigation of the most closely related described species revealed that the novel species strain was member of the phylum firmicutes . the major fatty acids for strain sit12 are mainly composed of 16 or 18 carbons : 16:0 ( 34% ) , 18:1n9 ( 28% ) , 18:2n6 ( 19% ) and 18:0 ( 12% ) . moreover , several fatty acids are described with unusual longer chains such as 20:4n6 , 20:5n3 and 22:6n3 ( < 1% ) ( table 2 ) . the sit12 spectra were imported into maldi biotyper 3.0 software ( bruker daltonics , leipzig , germany ) and analysed by standard pattern matching ( with default parameter settings ) against 7765 spectra of bacteria . a maximum of 100 peaks were compared with spectra in the database for every spectrum . the resulting score enabled the identification ( or not ) of tested species : a score of 2 with a validly published species enabled identification at the species level , a score of 1.7 but < 2 enabled identification at the genus level and a score of < 1.7 did not enable any identification . no significant maldi - tof ms score was obtained for strain sit12 against the bruker database , suggesting that our isolate was not a member of a known species . genomic dna of m. massiliensis was sequenced on the miseq technology ( illumina , san diego , ca , usa ) with the mate - pair strategy . automated cluster generation and sequencing run were performed in a single 39-hour run at a 2 151 bp read length . total information of 2.9 gb was obtained from a 297k / mm cluster density , with a cluster passing quality control filters of 97% ( 5 808 000 passing filter paired reads ) . within this run , the 440 495 paired reads were trimmed , then assembled in two scaffolds using the spades assembler . open reading frames ( orfs ) were predicted using prodigal with default parameters , but the predicted orfs were excluded if they spanned a sequencing gap region . the trnascanse tool was used to find trna genes , whereas ribosomal rnas were found by using rnammer . of the 1478 predicted genes , 1426 were protein - coding genes and 52 were rnas ( two genes were 5s rrna , two 16s rrna , one 23s rrna and 47 trna ) . a total of 1002 genes ( 70.27% ) were assigned as putative function ( by cogs or by nr blast ) . the resistome was analysed with the argannot ( antibiotic resistance gene - annotation ) database . the exhaustive bacteriocin database available in our laboratories ( bacteriocins from the urmite database ) was performed by collecting all currently available sequences from the databases and from the national center for biotechnology information . protein sequences from this database allowed putative bacteriocins from human gut microbiota to be identified using blastp methodology . analysis of presence of polyketide synthases nonribosomal peptide synthetases ( pks / nrps ) was performed by discriminating the gene with large size using a database realized in our laboratory ; predicted proteins were compared against nonredundant genbank database using blastp and then examined using antismash . murdochiella massiliensis did not contain bacteriocins or nrps , and the analysis of the resistome showed no resistance genes . the results indicated the presence of an incomplete phage with 48.2% g+c content and a complete phage with 49.5% g+c content ( fig . the draft gene sequence of m. massiliensis is smaller than those of anaerococcus hydrogenalis , peptoniphilus indolicus , parvimonas micra and helcococcus kunzii ( 1642 , 1889 , 2238 , 1704 and 2096 mb respectively ) , but larger than those of helcococcus sueciensis ( 1574 mb ) . the g+c content of m. massiliensis is larger than those of a. hydrogenalis , p. indolicus , h. sueciensis , p. micra and h. kunzii ( 48.97 , 29.64 , 31.69 , 28.4 , 28.66 and 29.35% respectively ) . the gene content of m. massiliensis is smaller than those of a. hydrogenalis , h. sueciensis , p. micra and h. kunzii ( 1.426 , 2.069 , 2.269 , 1.445 , 1.678 and 1.882 respectively ) . on the basis of taxonogenomic analyses , we formally propose the creation of murdochiella massiliensis sp . nov . that contains the strain sit12 . the murdochiella massiliensis name come from massilia , the ancient roman name for marseille , france , where the type strain was isolated . the strain was anaerobic , gram positive , non endospore forming , nonmotile and coccus shaped . the genome is 1 642 295 bp long , and g+c content is 48.9% . the 16s rrna gene sequence and whole - genome shotgun sequence of m. massiliensis strain sit12 are deposited in genbank under accession numbers ln866998 and fizw00000000.1 respectively . the type strain sit12 (= csur p1987 = dsm 29078 ) was isolated from the stool of a healthy 2-year - old senegalese boy . laparoscopic pyelolithotomy was successfully performed in a pelvic kidney with an operative time of 310 minutes . the use of intraoperative fluoroscopy and a semi - automatic suturing device greatly facilitated the procedure . the patient 's operative pain was managed with 3 doses of ketorolac ; she resumed a regular diet the day after surgery , and was discharged on the first postoperative day . for patients with a large stone in the renal pelvis of an ectopic kidney , laparoscopic pyelolithotomy provides an effective approach . pelvic kidneys are typically incidental findings , but may pre - sent due to underlying obstructive or calculous disease . the anatomical characteristics of the ectopic kidney can pose a significant challenge to the treatment of calculous disease . treatment of larger renal calculi in these kidneys had been uniformly by open surgery until laparoscopically guided percutaneous nephrostolithotomy ( pcnl ) was described , initially , by esghi , et al . , and later by toth , et al . recently , 2 cases of laparoscopic pyelolithotomy have been reported in a pelvic kidney . in one , due to urine leakage , an indwelling stent and urethral catheter were maintained for 8 days . hospitalization lasted 6 days . in the second case report , intraoperative fluoroscopy and laparoscopic suturing were used to perform the procedure , but the pyelotomy closure was not tested for watertightness and the patient experienced peritoneal leakage of urine after the foley catheter was removed . this necessitated replacement of the foley catheter for an unspecified length of time and the length of hospitalization was not reported . herein we report the third case of a laparoscopic pyelolithotomy in a pelvic kidney ; in this case , use of the carterthomason needle - point suture passer ( inlet medical inc . , eden prairie , mn ) and laparoscopic suturing of the pyelotomy with an endostitch device ( auto suture , norwalk , ct ) resulted in a waterproof closure . a 63-year old woman was referred for endourological treatment of a symptomatic 2.5-cm - x-1.5 cm renal pelvis stone in her left pelvic kidney . intravenous urography ( ivu ) and abdominal / pelvic computed tomography defined the pelvic kidney 's location relative to other structures ; there was mild pyelocaliectasis noted ( figures 1 & 2 ) . ivu demonstrating ectopic right kidney and left pelvic kidney with laminated 2.5 cm stone at the ureteropelvic junction . the patient was turned to a 30-degree lateral , left side up position and a 15 mm hg co2 pneumoperitoneum was initiated with the veress needle using a lateral inflation technique . three 12 mm laparoscopic ports were placed : left lower quadrant in the midclavicular line , umbilicus , and right lower quadrant in the pararectus area . holding sutures were placed inferiorly and superiorly on the anterior surface of the renal pelvis using intracorporeal suturing ; suture delivery through the skin was accomplished via a carter - thomason needle - point suture passer ( inlet medical inc . , eden prairie , mn ) . a 3 cm long pyelotomy was made and a 10 mm biopsy forceps was used to grasp the stone , which was removed intact after the 12 mm cannula was withdrawn from the port site . a running closure of the renal pelvis was accomplished using the endostitch device with a 2 - 0 polysorb suture ( auto suture , norwalk , ct ) . the occlusion balloon catheter was changed to an indwelling 7 f double pigtail stent and a bladder catheter was left in place overnight . the total operative time was 310 minutes ( including pre- and postoperative stent placement ) . abdominal/ pelvic ct scan demonstrating left pelvic kidney with mild pyelocaliectasis and the stone at the ureteropelvic junction ( arrow at stone ) . after initiating general anesthesia , a 7 f/ 11.5 mm balloon occlusion catheter was then passed over the guidewire into the renal pelvis of the left pelvic kidney . the balloon was inflated with 1 cc of contrast material and was then snugged down at the ureteropelvic junction . postoperatively , the patient 's discomfort was managed by a total of 45 mg of intravenous ketorolac ( 3 doses ) followed by 2 doses of an oral narcotic . a follow - up ivu , one week later , revealed the left pelvic kidney to be functional , stone - free , and without extravasation . our experience ( table 1 ) is similar to the prior reports of successful laparoscopic pyelolithotomy for a large renal calculus in a pelvic kidney . placement of a retrograde ureteral catheter was instrumental in allowing expeditious localization of the renal pelvis at laparoscopy and for testing the closure of the pyelotomy . closure of the renal pelvis was facilitated by the use of holding sutures and the endostitch device . comparison of laparoscopic pyelolithotomy and pcnl for renal pelvis stones > 1.5 - 2 cm . mac= monitored anesthesia care , pcnu= percutaneous nephroureteral stent the patient experienced minimal pain and a brief hospitalization , findings consistent with previous reports of laparoscopic pyelolithotomy for a normally positioned kidney . in these reports , the operative time has averaged 2 - 5 hours using a 3- or 4-port approach . the renal pelvis was sutured closed in only one case and all patients had a surgical drain placed prior to fascial closure . while a stone - free rate of 100% was recorded among 9 patients , it is of note that 3 of those 9 patients required conversion to an open procedure . while these reports concluded that laparoscopic pyelolithotomy in a eutopic kidney was of value in a situation where shock wave lithotripsy ( swl ) or pcnl had failed or could not be done , we believe this represents a rare situation . indeed , despite a vast experience at washington university with laparoscopic renal surgery and a large surgical stone population ( e.g. an approximate annual urolithiasis case load of 500 to 600 swl , 100 to 150 ureteroscopies , and 50 to 100 pcnl ) this is the singular case of a laparoscopic pyelolithotomy at our institution . with regard to stone treatment in an ectopic or pelvic kidney , we believe the treatment strategy should be similar to that used for stones in a eutopic kidney . hence , swl or ureteroscopy remain first line therapy for smaller calculi ( less than 2 cm ) , while laparoscopic - assisted percutaneous , pure laparoscopic , or open procedures are reserved for larger calculi . from this standpoint , it is of note that 2 cases of laparoscopically guided pcnl have been reported in pelvic kidneys . the operative time was not reported for these cases and the length of hospital stay was 6 days in one report . we believe that given advances in laparoscopic equipment it may be just as simple to handle the stone removal entirely laparoscopically . the benefits of this approach would potentially include a shorter hospital stay and less postoperative morbidity as occurred in the present case . for urologists interested in laparoscopic pyelolithotomy in this situation , the use of intraoperative fluoroscopy to identify the renal pelvis , the placement of holding sutures , the use of the carter - thomason needle - point suture passer , and intracorporeal suturing with the endostitch device are recommended .

murdochiella massiliensis strain sit12 (= csur p1987 = dsm 29078 ) is the type strain of m. massiliensis sp . nov . this bacterium was isolated from the stool of a healthy 2-year - old senegalese boy . m. massiliensis is an anaerobic , gram - positive coccus . the genome size of m. massiliensis strain sit12 is 1 642 295 bp with 48.9% g+c content and assembled into two scaffolds .

please summarize the articles given below

bspp : bisulfite padlock probe ; charm : comprehensive high - throughput arrays for relative methylation ; cimp : cpg island methylator phenotype ; esc : embryonic stem cell ; fda : food and drug administration ; help : hpaii tiny fragment enrichment by ligation - mediated pcr ; mca : methylated cpg island amplification ; mcam : methylated cpg island amplification microarray ; medip : methylated dna immunoprecipitation ; mira : methylated - cpg island recovery assay ; mscc : methyl - sensitive cut counting ; pcr : polymerase chain reaction ; rrbs : reduced representation bisulfite sequencing . the authors are supported by the leukemia specialized program of research excellence grant p50 ca100632 . aripiprazole is the third generation atypical antipsychotic and a dopamine serotonin system stabilizer ( dss ) that is effective against positive and negative symptoms of schizophrenia . it has a low propensity for extrapyramidal side effects , causes minimal weight gain or sedation , produces no elevation in serum prolactin levels and does not cause prolongation of qtc interval . it is partial agonist at d2 and 5ht1a and blocks 5ht2a receptors.[13 ] the most common adverse reactions in adult patients reported in clinical trials with dosage of 1015 mg per day were fatigue , insomnia , headache , nausea , vomiting , tremors , rigidity , akathisia , and constipation . overall incidence of acute dystonic reactions with antipsychotic medications is 2.55% , majority of which are due to typical and high potency antipsychotics . the following case report is of aripiprazole - induced oculogyric crisis ( acute dystonia ) . a 28-year - old single female was brought by her relatives to the psychiatry outpatient clinic . for last 89 months , she was interacting less with family . as per history , she was suspicious towards family members that they would poison her and also feared that few strangers would come and kill her . in addition , she was talking to herself , was occasionally irritable and had sleep disturbance . after psychiatric evaluation , her mental status examination revealed delusion of persecution which was primary , well systematized , complete , and intermittent and associated with intense fear of being harmed palpitations and irritability . she also had auditory hallucinations of an unknown male , commenting on her day - to - day work and occasionally criticizing her ; associated with the patient replying to the voice . her weight was 70 kg , and she had a family history ( mother ) of diabetes mellitus . her baseline investigations of hemogram , liver function and renal function tests , chest x - ray , and electrocardiogram were within the normal range . she was prescribed aripiprazole 10 mg orally in two divided dosages per day , eszopiclone 2 mg orally at nighttime dosage and was advised follow - up after 2 weeks . during her first follow - up visit , she showed improvement in sleep . for improvement in psychotic symptoms , aripiprazole was increased to 20 mg orally in two divided dosages and was advised follow - up after 2 weeks . after 5 days of dose increment , she was brought with complaints of upward rolling of eye balls suddenly , unexpected , occurring five to seven times a day , which were difficult to bring back to original position by the patient . after evaluation for conversion disorder , tardive dystonia , epileptic encephalopathy , anti epileptic drug intake , she was diagnosed of having oculogyric crisis ( acute dystonia ) . the patient was admitted in psychiatry ward . aripiprazole was withdrawn and immediately injection promethazine 50 mg intramuscularly was given , which was repeated after half an hour . her symptoms improved in next 1 hour and the patient was prescribed 25 mg promethazine orally in night time dosage . within 3 days of admission , she was put on aripiprazole 10 mg orally in two divided dosages for her psychotic symptoms , while continuing eszopiclone with promethazine 25 mg nocte . the patient was advised to follow up after a week . the repeat challenge with aripiprazole 20 mg orally in two divided dosages resulted into oculogyric crisis within 4 days . the patient was advised cap ziprasidone 20 mg orally in two divided doses per day ( i.e. , 40 mg per day ) with food and was asked to follow up 2 weeks later with electrocardiogram done . later uptitration of cap ziprasidone to 20 mg orally in three divided doses per day ( i.e. , 60 mg per day ) with food was done . she improved in her psychotic symptoms over 2 months with no extrapyramidal symptoms , normal electrocardiogram , and other baseline investigations . various case reports of aripiprazole - induced acute dystonia report symptoms of neck extension , torticollis , rigidity , and tongue movements.[810 ] in addition , various studies describe medications causing acute dystonic reactions and their management which are described in the table 1 . case reports of acute dystonic reactions in patients on medications such as antimalarials ( chloroquinone , hydroxychloroquine , and amodiaquine , antivertigo agents ( cinnarizine , and flunarizine ) , cocaine , buspirone , diazepam , sumatriptan , phenylpropanolamine , and ecstasy ( 3,4-methylenedioxymethamphetamine ) have also been reported . drugs causing acute dystonia and its management in this case , oculogyric crisis is the symptom of attention . this case , a female patient on third generation antipsychotic medicine ( aripiprazole ) has least propensity for dystonia.[13 ] the risk factor for developing acute dystonia in this case is history of acute dystonia . acute dystonia occurred after 5 days on increasing aripiprazole from 10 mg to 20 mg per day orally in two divided dosage . it regressed completely with stopping of aripiprazole and administration of promethazine . on repeat challenge it reappeared with the same severity . hence , on causality assessment scale by naranjo et al . , the score is 7 . numerous studies report mechanisms of acute dystonia being dopamine hypofunction resulting in a relative overactivity of cholinergic mechanisms . since aripiprazole lacks protective anticholinergic action , it can have a potential to precipitate dystonia . this was supported by the fact that , in this case , dystonia resolved with promethazine ( an antihistaminic with anticholinergic property ) . in addition , aripiprazole 's action on the d3 receptor and antagonism of 5-ht6 and 5-ht7 receptors is still unknown and hence it may play a role in oculogyric crisis . preclinical studies found that inhibitory action of aripiprazole on the serotonin transporter , which may have a potential to alter the dopamine balance in the basal ganglia region . studies mention paradoxical dopaminergic hyperfunction by either preferentially blocking presynaptic receptors or exposing the postsynaptic receptors to the natural release of dopamine from the presynaptic terminals as the dba levels drop which may result in dystonia . this justifies the judicious use of medications for treatment and prophylaxis of acute dystonia due to antipsychotics . this case outlines a significant side effect of aripiprazole , which a practitioner should be vigilant about before initiating the medication .

dna methylation of promoter cpg islands is strongly associated with gene silencing and is known as a frequent cause of loss of expression of tumor suppressor genes , as well as other genes involved in tumor formation . dna methylation of driver genes is very likely outnumbered by the number of methylated passenger genes , though these can be useful as tumor markers . much of what is known about the importance of dna methylation in cancer was gained through small- and moderate - scale analysis of gene promoters and tumor samples . a much better understanding of the role of dna methylation in cancer , either as a marker of disease or as an active driver of tumorigenesis , will likely be gained from genome - wide studies of this modification in normal and malignant cells . this goal has become more attainable with the recent introduction of large - scale genome analysis methodologies and these have been modified to allow for investigation of dna methylation . several research groups have been formed to coordinate efforts and apply these methodologies to decipher the methylome of healthy and diseased tissues . in this article we review technological advances in genome - wide methylation profiling .

please summarize the articles given below

venous thromboembolism ( vte ) occurs to be one of the most serious complications after undergoing total joint arthroplasty.1 ) generally , pulmonary thromboembolism is generated as the secondary by - product from deep vein thrombosis ( dvt ) while its emergence may possibly trigger the chronic thromboembolic pulmonary hypertension as well as post - thrombotic syndrome.2 ) patent foramen ovale ( pfo ) , a residue of fetal circulation , is found approximately about 25 - 30% among adults ; and , it is also known that thrombus from the venous circulation rarely causes arterial thromboembolism through right - to - left shunt.3 ) in this case , the authors experienced a patient with pfo and several thrombotic disease such as pulmonary thromboembolism , dvt , and right atrial thrombus along with cryptogenic ischemic stroke after total knee arthroplasty ( tka ) . a 64-year - old female presented to the emergency room for the shortness of breath . she had been taking antiplatelet drugs ( aspirin 100 mg / day , clopidogrel 75 mg / day ) for the treatment of the right posterior temporal lobe infarction detected in brain magnetic resonance imaging for the disorientation on the third day after the operation ( fig . 1 ) . carotid and brain computed tomography ( ct ) angiography showed no evidence of atherosclerosis . afterwards , she experienced dyspnea in the second week after the operation and was performed the transthoracic echocardiography ( tte ) , which showed right atrial thrombi and was treated with the low molecular weight heparin ( lmwh ) . the symptoms , nonetheless , remained so that she had been transferred to our hospital . in the medical history her blood pressure was 127/79 mm hg while her heart rate was 89 bpm . on physical , pitting edema in her left lower leg was noted and neurologic examination was unremarkable . the chest x - rays did not show any signs of cardiomegaly as well as pulmonary edema . both d - dimer and n - terminal pro - brain natriuretic peptide were increased respectively at 2686 ng / ml , and 3310 pg / ml and on the other hand , cardiac enzymes , such as creatinine kinase - mb and troponin - i were within a normal range . tte demonstrated normal left ventricular systolic function ( ejection fraction of 63% ) , but in the right atrium two highly mobile masses ( 1.67 2.18 cm , 0.69 0.80 cm ) suggesting possible thrombi were observed . the echocardiogram also revealed right atrium and right ventricle enlargement , severe pulmonary hypertension ( pulmonary artery systolic pressure 102 mm hg ) , and d - shaped left ventricle ( fig . her chest ct showed that pulmonary thromboembolism was found in both main pulmonary arteries while dvt was observed in left femoral vein ( fig . holter ecg did not reveal arrhythmia except rare atrial premature complex and ventricle premature complex . the patient was administered to warfarin ( target inr 2 - 3 ) after using lmwh . in follow - up tte 3 weeks later , the two previous thrombi in right atrium ( ra ) disappeared . along with the improvement in ra , there was also a positive change on the extent of pulmonary hypertension . the follow up ct taken 4 weeks after the hospitalization did not reveal pulmonary thromboembolism and dvt ( fig . 3 ) . since the cause of the cerebral infarction was unclear , additional evaluation were needed . in order to examine the intracardiac shunt , the results confirmed the transference of microbubble from right atrium to left atrium without showing atrial septal defect ; and therefore , we diagnosed the patient with pfo ( fig . currently , the patient is taking warfarin continuously without any signs of abnormalities in outpatient clinic . we recommended further treatment for pfo including device closure but patient refused because of poor general condition . as vte is one of the fatal complications after undergoing tka , dvt , and pulmonary embolism ( pe ) are known to occur approximately around 13% and 3% , respectively.4 ) the occurrence period of vte after tka is reported to be 3 to 9 days after the operatio5 ) and , there are mostly cases that accompany dvt and pe and occasionally thrombi observed on several organs . particularly , it was reported that the patients with pfo even might develop arterial thromboembolism with cryptogenic stroke.3)6 ) in the present case , the authors suspected that cryptogenic stroke 3 days after the operation might possibly have been caused by the vte changed into arterial thromboembolism through pfo . pfo , one of the congenital heart diseases that can be observed even in adulthood , typically have no symptom . nonetheless , it can affect as the risk factor for several conditions including ischemic stroke , platypnea - orthodeoxia syndrome , and decompression sickness.7 ) pfo as the cause of cryptogenic stroke is not uncommon ; hence , the occurrence of ischemic stroke with either pe or dvt can be considered as the possible example of paradoxical embolism through right - to - left shunt.8 ) among the treatments on the prevention of frequent strokes within a patient who has pfo , there are medical options and invasive methods.9 ) the medical options include the use of antiplatelet agents as well as the prescription of warfarin in the patients with hypercoagulable state or venous thrombosis . in terms of invasive methods , it was used to have an operation in the past while the application of device closure is being used recently.10 ) in this case , cryptogenic stroke took place within 3 days after tka while right atrial thrombus , dvt , and pe were present in a way that the passage through right to left shunt was speculated and the result of subsequent echocardiography led to the diagnosis of a positive reaction from the agitated saline test for pfo . the patient was treated with lmwh and then administered warfarin ; and the patient discharged with the recovered conditions . in conclusion , the occurrence of pulmonary thromboembolism or dvt in a patient with pfo can trigger the development of cryptogenic stroke through right to left shunt . therefore , further evaluation of cause are essential in patients with the occurrence of cryptogenic stroke who are associated with a high risk of vte after total joint arthroplasty . also , anticoagulation treatment is necessary if a patient has a right to left shunt , such as pfo . a 2-year - old boy was transferred to the emergency department approximately 4 hours after having severe head trauma with loss of consciousness . on physical examination , he had a right temporoparietal scalp laceration and subgaleal hematoma ; the child had a status of decerebrate rigidity . brain ct showed intraventricular hemorrhage and subarachnoid hemorrhage ( figure 1a ) . a , head computed tomography ( ct ) illustrating the intraventricular hemorrhage . b , postoperative intraventricular external drainage resulted in a significant decrease in the intraventricular hemorrhage . c , enlargement of both the lateral ventricles with surrounding white matter edema is consistent with communicating hydrocephalus . f - i , axial and sagittal ct images showing severe , bilateral thickening of the inner table of the frontal bone with cortex compression . i , the outer table of the frontal bone was intact . an external ventricular drain was performed . one week after surgery , cranial ct revealed that the ventricle hemorrhage had disappeared ( figure 1b ) , and the drain tube was removed . one month later , repeat head ct showed dilation of the entire ventricular system associated with communicating hydrocephalus ( figure 1c ) . his consciousness was gradually recovered , and he was awakened 2 months later . the patient was discharged . at 2-year follow - up , he showed hypophrenia and dysphasia , which was diagnosed according to the diagnosis criterion of mental retardation established by the world health organization in 1985 and the s - s checkup list of dysphasia . the neuroimaging findings revealed that the lateral ventricles were smaller than before ( figure 1e ) . five years after surgery , the child was readmitted to our department due to headache , vomiting , imbalance , inappropriate behavior , and loss of interest . the patient had not developed a frontal extra - axial hemorrhage in the past 5 years . there was bilateral optic disc swelling , with hemorrhages of the optic nerve head and surrounding retina ( figure 2a ) . serum cortisol , prolactin , progesterone , estradiol , t3 , t4 , thyroid - stimulating hormone , and glucose tolerance test were within the normal limits . brain ct showed severe , bilateral thickening of the inner table of the frontal bone with cortex compression ( figure 1f - i ) . the inner table was honeycombed and red ( figure 2b and c ) , and the intracranial pressure was elevated . to achieve the decompression , a complete resection of the mass was performed , and the dura was opened in a star fashion . three - dimensional image formation was used to shape the titanium mesh for the skull neoplasty . the mass was immersed in formalin for study of the histological appearance of the mass with mineralized lamellar bone . the forehead had a good contour , and postoperative radiographs demonstrated that the bone grafts remained intact and no evidence of recurrence of the mass . baseline radiography of the skeletal system was performed and showed no additional foci of hyperostosis ( figure 3a - c ) . a - c , postoperative brain computed tomography ( ct ) demonstrating that the frontal bone was removed and replaced with titanium mesh to relieve the brain compression . hyperostosis frontalis interna is an overgrowth of bony tissue in the inner plate of the frontal bone and has been documented in the medical literature for over 300 years . the estimated incidence of hyperostosis frontalis interna in the general population is 5% to 12% . hyperostosis frontalis interna has not been reported in an asymptomatic patient younger than 10 years of age ; hence , the present patient is the first case in the medline database . the most acceptable hypothesis regarding hyperostosis frontalis interna etiology is hormonal influence on bone growth . for example , estrogen stimulation could play a part in the emergence of hyperostosis frontalis interna and explain its predominance among females . in our case , the hormone levels were normal , and interestingly , the hyperostosis frontalis interna was found after severe trauma . with the existing findings , it is difficult to address whether the trauma was related to hyperostosis frontalis interna . to the best of our knowledge , there have been no previous reports in the literature associating hyperostosis frontalis interna with brain trauma . the associated signs and symptoms are generally nonspecific and benign , but they can cluster together in some cases , giving rise to various syndromes . the most frequently presented complaints were morgagni syndrome ( headache , obesity , virilism , and hypertrichosis ) , stewart - morel syndrome ( obesity and neuropsychiatric symptoms ) , and troell - junet syndrome ( acromegaly , toxic goiter , and diabetes mellitus ) . our patient had imbalance which , to our knowledge , has not been mentioned previously . in some severe cases , hyperostosis frontalis interna leads to compression of soft tissue , dural irritation , and brain atrophy because of the thickening of the skull and decrease in the intracranial volume . it has been established that hyperostosis frontalis interna can cause diverse psychiatric disturbances such as aggressiveness , paranoia , or depression . our case tends to confirm that due to extensive hyperostosis frontalis interna , frontal lobe compression can lead to cognitive impairment and psychiatric disorders . the clinical symptoms and signs indicated the elevated intracranial pressure , which was not described in all the previous reports . hyperostosis frontalis interna is commonly an incidental finding in x - ray , ct , and mri studies . computed tomography scans , which provide the radiologist with enough information to distinguish hyperostosis frontalis interna from other bony growth , are better diagnostic tools for hyperostosis frontalis interna . in our case , the authors found bilateral frontal inner tables with diffuse uneven thickening . histologically , the process of hyperostosis frontalis interna is thought to be a deposition of new bone primarily on the inner table and a progressive development of diploe . hyperostosis frontalis interna is characterized by remodeling of the inner table of the frontal bone into a cancellous phenotype . hyperostosis frontalis interna is a benign process , and the majority of patients appear to be asymptomatic ; thus , conservative observation can be used in these cases . if hyperostosis frontalis interna leads to headaches , neurologic symptoms , psychiatric disorders , and cognitive impairment , the surgical excision of the thickened portion of the bone is the only method of treatment to relieve the symptoms . postoperatively , the patient had an uneventful recovery , and the cognitive impairment was improved . hyperostosis frontalis interna is currently regarded as an independent entity and starts to appear at a much younger age . the authors described a case in a 7-year - old boy , presenting imbalance , cognitive impairment , headache , vomiting , and papilledema with hemorrhages ; this is the first such case reported in the literature . the etiology , however , remains unclear , and it is difficult to prove the correlation between hyperostosis frontalis interna and brain injury . if present , the surgical decompression can be an effective treatment method . our case confirms that the clinical presentation was elicited due to compression of the involved cortex area .

patients undergoing total joint arthroplasty frequently develop post - operative complication , such as deep vein thrombosis and pulmonary thromboembolism . however , it is not common coexisting deep vein thrombosis , pulmonary thromboembolisms , right atrial thrombus and acute cerebral infarction raised by thrombus through patent foramen ovale . we reported the patient who had multiple thrombi which were accompanied with a cryptogenic ischemic stroke and associated with patent foramen ovale after operation .

please summarize the articles given below

as a service to our authors and readers , this journal provides supporting information supplied by the authors . such materials are peer reviewed and may be reorganized for online delivery , but are not copyedited or typeset . technical support issues arising from supporting information ( other than missing files ) should be addressed to the authors . in 2009 , a 52-year - old woman presented with a single lesion on her nose , which started as a papule , referred to sedighe tahereh clinic , isfahan , iran . the lesion had existed for a period of 14 months and was slowly increasing in size , enlarging to a plaque . the diagnosis of leishmaniasis was confirmed with a positive smear of the lesion showing leishmania bodies about 1 year before . all five members of her family had had a history of proven leishmaniasis . in the past medical history , the patient was a renal failure case since 11 years before and received a renal transplant 4 years after the diagnosis of renal failure . she was receiving oral mycophenolate mofetil ( 2 g daily ) and cyclosporine ( 100 mg daily ) . a 33 cm indurated ulcer with elevated borders was present on the tip of her nose ( figure 1 ) . her therapeutic plan was intralesional glucantime injection ( approximately 1 ml of 1.5 g vial per week , intralesional injection ) . after completing a therapeutic course of 20 sessions receiving intralesional glucantime injections , she was considered as glucantime therapy resistant . the occurrence of malignant neoplasms in sites of scars is an infrequent but well - known phenomenon.5 although the coexistence of cutaneous leishmaniasis and bcc may have been coincidental , some studies suggest that an association between these two entities does exist.6 leishmaniasis can directly or indirectly alter the diagnosis and course of different malignancies.7 there are reports of bcc in chronic leg ulcers.8 cases of bcc developing in a leishmania scar have also been documented,9 but to our knowledge , cases of both leishmaniasis and bcc in the same site and the same lesion are rare.10 however , in this case , solid organ transplantation and long term immuno suppressive therapy should be considered as risk factors for malignancy . advances in effective immuno suppression after organ transplantation have led to increased risk of malignancies , particularly skin cancers11 including squamous cell carcinoma , basal bcc and malignant melanoma.12 thus , malignancies should be considered in the differential diagnosis of leishmaniasis lesions difficult to treat . the possible role of cutaneous leishmaniasis , as a predisposing factor for skin cancer , should also be kept in mind . aa was the main therapeutic physician and helped write the manuscript . i m and pk contributed in writing the manuscript .

abstractmacrocyclization can be used to constrain peptides in their bioactive conformations , thereby supporting target affinity and bioactivity . in particular , for the targeting of challenging protein protein interactions , macrocyclic peptides have proven to be very useful . available approaches focus on the stabilization of helices , which limits their general applicability . here we report for the first time on the use of ringclosing alkyne metathesis for the stabilization of an irregular peptide secondary structure . a small library of alkynecrosslinked peptides provided a number of derivatives with improved target affinity relative to the linear parent peptide . in addition , we report the crystal structure of the highestaffinity derivative in a complex with its protein target 1433. it can be expected that the alkynebased macrocyclization of irregular binding epitopes should give rise to new scaffolds suitable for targeting of currently intractable proteins .

please summarize the articles given below

a 60-year - old man was admitted because of visual disturbances and ocular pain following penetrating keratoplasty in the right eye for a corneal chemical burn . on slit lamp examination , we observed a feather - like corneal opacity , corneal infiltrations , and epithelial defects . subconjuctival amphotericin b ( 1 mg ) , topical amphotericin b 0.125% , and levofloxaxin 0.5% were subsequently administered every hour for 16 weeks . the patient was restarted on and maintained on a topical amphotericin b treatment ( 0.125% twice daily ) for 1 year . in addition , levofloxaxin 0.5% ( three times daily ) and fluorometholone 0.1% ( twice daily ) were administered for 1 year . the lesion did not progress , but there was no change in corneal infiltration . on examination one year later , an elevated corneal lesion and increased corneal infiltration with a yellow color were observed despite the topical amphotericin b treatment . seven days later anterior chamber hypopyon and vitreous opacity on a b - scan were observed ( fig . we immediately performed an intravitreal injection of amphotericin b 5 g/0.1ml and vancomycin 1 mg/0.1ml . intravitreal voriconazole 80 g/0.1ml and ceftazidime 2 mg/0.1ml were injected and topical voriconazole 1% was administered every 2 hours . the patient discontinued the oral voriconazole because of abdominal pain , dry mouth , and scaling of the oral mucosa . the patient was treated topically for 6 weeks , after which the corneal lesion and endophthalmitis had improved . the patient subsequently underwent another penetrating keratoplasty and demonstrated a visual acuity of 0.1 at 10 months follow - up with no signs of recurrence . a 60-year - old man was referred to us because of a lack of improvement after a month of empiric treatment with topical amphotericin b for fungal keratitis . on our initial examination after 10 days the culture revealed no growth and the corneal epithelium appeared healed ; however , there was no change in corneal infiltration ( fig . because of a lack of improvement in the corneal lesion a month later , a new treatment regimen was initiated with topical voriconazole 1% administered every hour . six weeks later we observed a decreasing density of the infiltrate and healing of the corneal epithelium ; the topical voriconazole was decreased to twice daily . following completion of the therapy , complete healing of the corneal epithelium and resolution of the corneal infiltrate were observed ; however , the corneal opacity persisted ( fig . 2c ) voriconazole , a derivative of fluconazole , is a new triazole antifungal agent.4 like other triazoles , this voriconazole inhibits cytochrome p450 demethylase , which is essential for the synthesis of ergosterol . it is hypothesized that this adversely affects the permeability of the fungal cell membrane.7 voriconazole has excellent oral bioavailability and a broad spectrum of activity . therapeutic aqueous and vitreous levels are achieved after oral administration of voriconazole.8 voriconazole showed lower mics compared to other antifungal agents when tested against five corneal isolates of scedosporium apiospermum,2 and it had the best in vitro susceptibility profile for 34 common fungal pathogens compared to other antifungal agents.9 gao et al.10 reported that direct intravitreal voriconazole injections of 25 g / ml ( equivalent to 100 mg per injection in a human eye ) caused no electroretinographic or histopathologic abnormalities in rodent retinas . kramer et al.11 reported that intravitreal injection of voriconazole ( 100 g/0.1ml ) with pars plana vitrectomy was an effective therapy for aspergillus endophthalmitis . lee et al.7 reported a case of drug - resistant penicillium endophthalmitis that was treated with intravitreal voriconazole injection ( 50 g/ 0.1ml ) . in these cases , voriconazole has been shown to be highly effective against filamentous organisms and is more potent in invasive aspergillosis than amphotericin b.12,13 according to a report by jang et al.,5 voriconazole is also effective against candida chorioretinitis . ozbek et al.14 reported one case of alternaria keratitis that showed improvement with 1% topical voriconazole . in contrast , giaconi et al.15 reported two cases of fungal keratitis caused by fusarium oxysporum and colletotrichum dematium that did not respond to treatment with 1% topical voriconazole . our report indicates that 1% voriconazole is an effective treatment for candida spp . and unknown fungal keratitis . in conclusion , voriconazole is a new , promising therapy for fungal keratitis refractory to standard antifungal agents . nevertheless , more clinical trials will be necessary to investigate the effectiveness of systemic voriconazole and corneal transplantation . there are many published reports of malfunction of the inner tube of the bain co - axial circuit , with potentially lethal complications for the patient . the following case report describes a case where profound hypercapnia occurred consequent to avulsion of the inner tube of the co - axial circuit at the machine end of the circuit , which was neither apparent nor visible to the anaesthesiologist . this report therefore emphasizes the need for testing the co - axial circuit for any circuit malfunction before each use . a 30 year - old male presented as an emergency for repair of a crush injury of the left hand . induction was done with thiopentone sodium 5 mg / kg and fentanyl citrate 1.5 mg / kg . after achieving muscle relaxation with succinylcholine 1 mg / kg , anaesthesia was maintained with oxygen , nitrous oxide , isoflurane , and intermittent doses of vecuronium bromide . the vital signs monitored were blood pressure , oxygen saturation , electrocardiogram , temperature , and end - tidal carbon dioxide ( etco2 ) . the gas flows , airway pressure , temperature , chest expansion and bilateral air entry in to lungs were all checked and found to be normal . we changed the d - fend of our side - stream capnograph for a new one but the etco2 continued to rise . the heart rate rose from the baseline of 80 per minute to 110 per minute and blood pressure rose from a baseline of 110/70 mmhg to 140/94 mmhg ; however , the oxygen saturation was 100% . not finding any cause for the rise of etco2 , we decided to change the circuit . following this , the etco2 curve began to fall and reached the normal value of 40 mmhg over the next couple of minutes and the inspiratory carbon dioxide baseline returned to zero . close examination of the original circuit revealed that the inner tubing of the co - axial tube had become disconnected from its seat at the machine end of the circuit [ figure 1 ] . this was a previously unused bain circuit and we had not checked the integrity of the inner tubing before inducing the patient . the inner coloured tube carries the inspiratory gases . if this tube should become disconnected or develop any breach in its integrity there will be a huge increase in dead space , with consequent hypercapnia and its complications . four main causes for development of hypercapnia during anaesthesia have been described : ( 1)reduced alveolar ventilation , with rise in partial pressure of co2(2)inhalation of exhaled co2 ( as has been noted in association with a defective fresh gas flow tube of a bain circuit)(3)inhalation of exogenous co2(4)increased metabolic rate ( as in malignant hyperthermia ) reduced alveolar ventilation , with rise in partial pressure of co2 inhalation of exhaled co2 ( as has been noted in association with a defective fresh gas flow tube of a bain circuit ) inhalation of exogenous co2 increased metabolic rate ( as in malignant hyperthermia ) hypercapnia leads to sympathetic system stimulation , with tachycardia , hypertension , arrhythmias , excessive sweating , and peripheral vasodilatation , which may lead to excessive intraoperative blood loss . our patient had significant increase in heart rate and blood pressure , which was initially erroneously attributed to the light plane of anaesthesia . a number of tests have been described to assess any co - axial circuit malfunction ; these include : ( 1)visual inspection of tubing for any obvious disruption or obstruction.(2)pethick test : this tests the low - pressure system and the integrity of the inner tube . collapse of the reservoir bag due to the creation of venturi effect in the outer tube is an indication that the inner tube is intact . this test will not detect a system in which inner tube is omitted or does not extend to the patient port or one that has holes at the patient end of the inner tube.(3)foex - crampton - smith manoeuvre : this manoeuvre assesses the gas flow line from the flowmeters of the machine to the patient end of the circuit . with an oxygen flow at 2 litres / minute , the patient end of the inner tube is occluded briefly for 23 seconds using the forefinger . a positive test is indicated by descent of the rotameter bobbin due to back pressure ; with removal of finger , the bobbin ascends to its original position . ghani suggested the use of the plunger of a 3-ml syringe to occlude the inner tube more precisely . pethick test : this tests the low - pressure system and the integrity of the inner tube . collapse of the reservoir bag due to the creation of venturi effect in the outer tube is an indication that the inner tube is intact . this test will not detect a system in which inner tube is omitted or does not extend to the patient port or one that has holes at the patient end of the inner tube . foex - crampton - smith manoeuvre : this manoeuvre assesses the gas flow line from the flowmeters of the machine to the patient end of the circuit . with an oxygen flow at 2 litres / minute , the patient end of the inner tube is occluded briefly for 23 seconds using the forefinger . a positive test is indicated by descent of the rotameter bobbin due to back pressure ; with removal of finger , the bobbin ascends to its original position . ghani suggested the use of the plunger of a 3-ml syringe to occlude the inner tube more precisely . this case report highlights the possibility of severe hypercapnia due to dead - space rebreathing as a result of disconnection of the inner tube of the co - axial circuit . we present this as a warning and reminder that the integrity of the co - axial circuit must be always checked visually as well as mechanically . in this regard , the foex - crampton - smith manoeuvre with the ghani modification appears to be most satisfactory method of assessing the integrity of the gas line from the flowmeter up to the patient end of the bain circuit .

we describe two patients with fungal keratitis refractory to standard antifungal therapy whose conditions were managed with voriconazole.the first case is a patient with endophthalmitis and corneal ulcer due to candida parapsilosis after receiving a corneal transplant . the patient was treated with amphotericin but showed no signs of improvement . topical voriconazole , oral voriconazole , and intravitreal voriconazole yielded signs of improvement . the second case is a 63-year - old male who underwent a month of empiric treatment with 0.2% topical amphotericin for fungal keratitis but showed no signs of improvement . treatment was then provided with 1% voriconazole . both cases showed effective treatment with voriconazole.voriconazole may be considered as a new method to treat fungal keratitis refractory to standard antifungal therapy .

please summarize the articles given below

we attempted to estimate the perceived degree of urgency of the visit and to identify reasons for seeking non - urgent care in the ped by patients and parents . a prospective survey was completed by parents ( for children 17 and younger ) and patients ( 18 - 21 ) presenting to a suburban academic ped that sees approximately 15,000 patients per year . three hundred and five of 334 surveys were completed ( 91% response rate ) over a 3-month period . twenty - four percent of the chief complaints were perceived by those surveyed as emergent or possibly life - threatening , 23% were felt to be very urgent , and 52% were deemed somewhat urgent or minor . twenty - five percent of those with minor or somewhat urgent complaints arrived by ambulance . overall , 79% of those surveyed identified a primary care provider ( pcp ) for themselves or their child . of those , 54% had attempted to contact the pcp prior to coming to the ped . six percent of those who attempted to reach their primary care providers were able to contact them and 52% were told to come to the ped . more than half of patients and parents presenting to the ped believed they had minor or somewhat urgent complaints . while the majority of patients have a regular provider , limited access to timely primary care and convenience may make the ped a more attractive care option than primary care for many parents and patients . achalasia is a primary esophageal motor disorder of unknown etiology characterized by selective loss of inhibitory neurons in the esophageal wall , resulting in insufficient relaxation of the lower esophageal sphincter and loss of esophageal peristalsis.1,2 jackhammer esophagus is a newly introduced term to describe patients with at least 20% of the swallows with distal contractile integral ( dci ) 8000 mmhg.sec.cm.3 several reports have described patients with diffuse esophageal spasm ( des ) , non - specific esophageal motor disorder ( nsemd ) , nutcracker esophagus , and gastroesophageal reflux disease ( gerd ) progressing to achalasia.49 although no causal relationship has been identified , these reports suggest that the different esophageal motor disorders represent a spectrum rather than unique and stable disorders . we describe , for the first time , a case of a patient who progressed from jackhammer esophagus to type ii achalasia . a 66 year - old woman with a history of atrial fibrillation , hypertension , gastritis , and hypothyroidism presented to our clinic in july 2014 with progressive dysphagia for solids and liquids over 18 months . her symptoms occurred daily and resulted in an 11-kg weight loss over this period of time . she denied heartburn , regurgitation , choking or coughing during eating , chest pain , vomiting , abdominal pain , or change in bowel habits . the barium swallow showed a mildly dilated esophagus with tertiary contractions , delayed emptying of the esophagus , and a narrowed gastroesophageal junction ( fig . 1 ) . the upper endoscopy demonstrated mild - moderate antral gastritis , normal appearing esophageal mucosa , and it was noted that the patient might have a tight gastroesophageal junction . unfortunately , after completing these tests she missed 3 follow - up appointments and was seen in our clinic only one year later . given her progressive dysphagia symptoms and weight loss , a high resolution esophageal manometry ( hrem ) was performed ( fig . the study showed a normal median integrated residual pressure of 8 mmhg , normal mean resting pressure of 21 mmhg , normal mean residual pressure of 7 mmhg , and mean dci of 10 770 mmhg sec cm . of the 10 swallows , 30% were hypercontractile ( > 8000 mmhg sec cm ) , 50% were normal and 20% simultaneous . overall , the findings were consistent with jackhammer esophagus based on the chicago classification of motility disorders.3 pantoprazole was increased to 40 mg twice daily with plan to add a pain modulator if her symptoms recurred . unfortunately , she was lost to follow - up again until she was seen in our clinic a year later in june 2015 . she continued to have worsening dysphagia , lost an additional 7 kg , and reported new onset of occasional post - prandial chest tightness . at this point , 3 ) . this study demonstrated diffuse esophageal dilatation with retained secretions and barium with only 020% change in esophageal volume after 5 minutes . in addition , tertiary peristaltic waves within the distal esophagus , limited emptying of the contrast into the stomach and an air - fluid level were also noted . 4 ) revealing a median integrated residual pressure of 71.5 mmhg , mean resting pressure of 97 mmhg , and mean residual pressure of 90 mmhg . there was panesophageal pressurization with every swallow and 80% of the swallows demonstrated prolonged pan - pressurization , all consistent with type ii achalasia . therapeutic options were discussed with the patient , and she elected to undergo heller myotomy . the patient was referred to general surgery but presented urgently to gi clinic 2 weeks later for worsening dysphagia , dehydration , weakness , inability to tolerate oral intake , and an additional 7-kg weight loss . the patient was admitted to the hospital and was noted to develop acute kidney injury . in addition , a nasogastric tube was placed and she was started on tube feeds to optimize her nutritional status . a week after discharge the patient underwent heller myotomy with dor fundoplication . on a follow - up visit with her general surgeon , she reported that she was tolerating liquids without any difficulties . to our knowledge , this is the first case that describes progression of jackhammer esophagus to achalasia over a period of about one year . smart et al5 reported 5 patients with gerd who subsequently developed achalasia over a period of 210 years . robson et al4 reported a patient with gerd who developed des one year after initial diagnosis and achalasia one year later . several reports describe the progression of des to achalasia.68 khatami et al10 conducted the first prospective cohort study with 12 patients . they observed the progression of des to achalasia in only one patient after 10.6 years . they also noted that low esophageal body amplitude contractions was a predictor of this progression . fontes et al11 conducted the largest prospective study to date to assess the progression of des to achalasia . patients with gerd confirmed by ph monitoring or systemic diseases that may affect the esophagus were excluded . five ( 14% ) of the patients progressed to achalasia at a mean follow - up of 2.1 years . although demographic characteristics were not predictive of the transition to achalasia , the authors observed that amplitude contractions of less than 50 mmhg was a predictive factor ( p = 0.002 ) . anggianash et al9 described the progression of nutcracker esophagus to achalasia in one patient after 3 years . vantrappen et al13 described six patients with nsemd who progressed to achalasia . while our patient presented with symptoms that could be considered classic for achalasia , her initial conventional manometry was consistent with nsemd . only the second hrem as well as the timed barium esophagram were consistent with achalasia . this progression within one year of an esophageal motor disorder was faster than what has been documented in previous reports . however , this case suggests that all esophageal motility disorders represent a spectrum of disorders , where patients may progress over time from one to another . this case also demonstrates the importance of following patients who were diagnosed with non - achalasia motility disorders with a repeat hrem in one year to assess for progression or a shift to a different esophageal motility disorder . because most of the studies documenting progression of a motility disorder to achalasia were case reports using conventional manometry , long - term studies evaluating this progression with hrem are needed . perhaps with the current availability of hrem , researchers may be able to identify predictive factors associated with progression of certain esophageal motility disorders to achalasia .

objectives : pediatric emergency department ( ped ) patients often present with non - urgent complaints . we attempted to estimate the perceived degree of urgency of the visit and to identify reasons for seeking non - urgent care in the ped by patients and parents.methods:a prospective survey was completed by parents ( for children 17 and younger ) and patients ( 18 - 21 ) presenting to a suburban academic ped that sees approximately 15,000 patients per year . a convenience sample of participants was enrolled.results:three hundred and five of 334 surveys were completed ( 91% response rate ) over a 3-month period . twenty - four percent of the chief complaints were perceived by those surveyed as emergent or possibly life - threatening , 23% were felt to be very urgent , and 52% were deemed somewhat urgent or minor . twenty - five percent of those with minor or somewhat urgent complaints arrived by ambulance . weekend visits and minority race correlated with a lower degree of perceived urgency . overall , 79% of those surveyed identified a primary care provider ( pcp ) for themselves or their child . of those , 54% had attempted to contact the pcp prior to coming to the ped . six percent of those who attempted to reach their primary care providers were able to contact them and 52% were told to come to the ped.conclusions:more than half of patients and parents presenting to the ped believed they had minor or somewhat urgent complaints . while the majority of patients have a regular provider , limited access to timely primary care and convenience may make the ped a more attractive care option than primary care for many parents and patients .

please summarize the articles given below

rectal varices are not an uncommon manifestation in cirrhosis with portal hypertension . however , serious bleeding from rectal varices is uncommon . because of its rarity , several authors have reported the utility of transjugular intrahepatic portosystemic shunt ( tips ) placement to control such bleeding when local therapy , such as endoscopic sclerotherapy or banding , fails [ 2 , 3 , 4 , 5 ] . however , we experienced a case of massive bleeding from large rectal varices that could not be controlled by tips placement , despite normalization of the portosystemic pressure gradient . furthermore , we observed rapid decompensation of the cirrhosis that led to severe encephalopathy and death after the tips placement . we report this case to highlight and discuss potential pitfalls of tips placement when using this technique to treat rectal variceal bleeding . a 59-year - old man with a history of alcoholic cirrhosis was hospitalized at an outside facility for massive hematochezia and fainting . he underwent upper endoscopy and tagged red blood cell scan , both of which were negative for active bleeding . a computed tomography of the abdomen was performed and did not reveal the source of the gastrointestinal bleeding ; a nodular liver with splenomegaly consistent with liver cirrhosis was seen , and a markedly dilated inferior mesenteric vein was also noted . during his 5-day hospitalization , he had approximately 1015 bloody bowel movements and received a total of 6 units of packed red blood cells and 2 units of fresh frozen plasma . the patient was then transferred to our institution for further management of his persistent hematochezia . his admission laboratory tests showed a hemoglobin level of 8.3 g / dl , a serum ammonia level of 45 g / dl , a total bilirubin level of 2.8 mg / dl and a model for end - stage liver disease ( meld ) score of 18 . however , he had another episode of massive hematochezia on the following day , with a decrease in hemoglobin level to 5.0 g / dl . therefore , the decision was made to proceed with emergent tips placement . a tips was successfully created with a 10 90 mm viatorr stent - graft ( gore & associates , flagstaff , ariz . this resulted in a decrease in the portosystemic pressure gradient from 12 to 6 mm hg . after the tips placement , brisk hepatopetal flow through the tips was seen on the portogram . despite the successful normalization of the portosystemic pressure gradient , he had another episode of massive bleeding on the following day . an angiogram of the superior rectal vein was performed , which showed tortuous large rectal varices with brisk hepatofugal flow ( fig . 2 ) . flow into the internal iliac vein branches was observed , confirming portosystemic shunting . embolization of the rectal varices was then performed , which necessitated multiple coils , 1 ml of n - butyl cyanoacrylate glue , 5,000 units of thrombin and several sheets of gelfoam ( fig . 3 ) . after the procedure , the patient did not have any further bleeding episodes , and the serial hemoglobin levels remained stable . the remaining hospital course was significant for rapid decompensation of cirrhosis , with an increase in the total bilirubin level to 8.7 mg / dl , the ammonia level to 121 g / dl and the meld score to 28 . he developed acute hypoxic respiratory failure secondary to multiple causes , including progressive liver failure . this case highlights two potential pitfalls of tips placement when using this technique in the treatment of rectal variceal bleeding . first , tipss may not be always successful in controlling serious bleeding from rectal varices , despite optimal portosystemic pressure reduction . we observed rebleeding after the tips placement despite a 50% reduction in the pressure gradient , with a final pressure gradient of 6 mm hg . some authors have also reported that a tips failed to control bleeding from rectal varices [ 6 , 7 ] . recurrent bleeding from rectal varices after tips placement may be related to the large size of the varices . rectal varices , unlike esophageal varices , are true veins and are likely to have larger diameters . according to laplace 's equation , the tension in the varix wall is proportional to the radius of the vessel for any given transmural pressure . , it is recommended to decrease the portosystemic pressure gradient to < 12 mm hg in esophageal variceal bleeding . however , this targeted pressure gradient may not be adequate for controlling bleeding from rectal varices . some authors advocate embolization of the rectal varices at the time of tips placement , even if normalization of portal hypertension is achieved [ 7 , 10 ] . given the successful control of bleeding following embolization in our case , concomitant variceal embolization at the time of tips placement may be necessary to control massive bleeding , especially when the rectal varices are large . second , tipss can be associated with life - threatening complications that can possibly lead to early mortality . since the first application of a tips in the treatment of recurrent bleeding from anorectal varices in 1993 , a tips alone or a tips combined with variceal embolization has been reported to be useful in controlling such bleeding without significant morbidity or mortality [ 2 , 3 , 4 , 5 , 10 ] . however , tipss are inherently associated with risks of procedure - related complications , hepatic encephalopathy and progressive liver failure . godil and mccracken reported a case of rapid liver function decompensation and encephalopathy following tips placement in a 73-year - old woman with rectal variceal bleeding . although no recurrent bleeding was seen , the patient died 4 weeks after the tips procedure . according to the american association for the study of liver diseases practice guidelines , tips is recommended only in the absence of other options for patients with 30-day predicted mortality ( meld > 1518 or serum bilirubin > 4.0 mg / dl ) . although emergent tips placement can be the last resort to control massive bleeding from rectal varices , even in high - risk patients it must be used cautiously because it can lead to life - threatening complications , as seen in our case . despite its minimally invasive nature , tips placement has been associated with a 30-day mortality rate as high as 36% when it is used to control acute gastroesophageal variceal bleeding . one alternative to tips placement in high - risk patients may be the percutaneous embolization of rectal varices via a transhepatic approach . although reports on the use of this technique for bleeding rectal varices are limited , it could be useful in controlling an initial acute bleeding and in stabilizing a patient without affecting liver function . however , collaterals can redevelop after embolization , and recurrent bleeding requiring repeated intervention has been reported . some authors have reported several cases of obliteration of bleeding large rectal varices with the use of balloon - occluded antegrade transvenous sclerotherapy with or without coil embolization [ 14 , 15 ] . in this technique , a sclerosing agent , such as ethanolamine oleate , was injected into the varices while the superior rectal vein was occluded using a balloon catheter . further research is needed to determine its efficacy . in conclusion , although tipss have been reported to be useful in controlling bleeding from rectal varices , there are potential pitfalls in using this technique to treat rectal variceal bleeding . a tips may not always be successful in controlling massive bleeding from large rectal varices even after normalization of portal hypertension , and concomitant variceal embolization may be necessary . furthermore , tipss can be associated with life - threatening complications that may lead to early mortality .

in patients with portal hypertension , bleeding from rectal varices is rare . however , it can be life - threatening . we report a case of massive bleeding from large rectal varices in a 59-year - old man with alcoholic cirrhosis . emergent transjugular intrahepatic portosystemic shunt ( tips ) placement was performed following failed local endoscopic therapy . despite normalization of the portosystemic pressure gradient , the patient had another episode of massive bleeding on the following day . embolization of the rectal varices via tips successfully stopped the bleeding . after the procedure , rapid decompensation of the cirrhosis led to severe encephalopathy , and death was observed . although tipss have been reported to be useful in controlling bleeding from rectal varices , our case illustrates the potential pitfalls in using this technique in the treatment of rectal variceal bleeding . tipss may not be always successful in controlling massive bleeding from large rectal varices , even after normalization of portal hypertension . tipss can also be associated with life - threatening complications that may lead to early mortality .

please summarize the articles given below

in this dataview , we look at the sponsors of health care , providing statistics on business , household and government health spending . the companion article , national health expenditures , 1995 ( levit et al . , 1996 ) presents health care expenditure data in an accounting structure that describes the size , current growth and historical trends of health care by service , matched against the sources that pay the health care bill , such as private health insurance ( phi ) and government programs like medicaid and medicare . the national health expenditures ( nhe ) structure provides policymakers , researchers , and the public with valuable health care expenditure statistics . however , it does not provide information on the size and impact of rising health costs on the sponsors of health care . the accounting structure used in this dataview breaks apart the nhe to examine the effects of health care expenditures on the sponsoring sectors . business , households and government finance health care bill payers through taxes , premium payments ( for both private and public health insurance ) , and general revenues ; these sectors also make direct payments to providers . for 1990 through 1995 , we will present statistics on how much each sponsor spent on health care and the impact of these expenditures on their ability to pay . since 1993 , a combination of slower health care cost growth and an upswing in the economy has stabilized or eased the burden that business , households and government faced in financing health care . business , especially , is benefiting from the changing health care cost environment . during the same period , spending for health services and supplies ( hss ) ( a subset of nhe ) reached $ 957.8 billion in 1995 . business paid for 26 percent of hss , households paid for 34 percent , and the public sector paid for 38 percent . another component , non - patient revenues , made up the remaining 2 percent . over time , this relationship among the sponsors has changed . in 1965 , households were the primary sponsors of health care . since then households have been gradually paying for a smaller proportion of hss and business and the public sector has been paying for a larger proportion . however , by aggressively controlling their health care expenses , business decreased its share of hss during the 1990s . actions by the public sector were less dramatic with the result that the pubic sector share of health care costs increased significantly during this period after nearly 20 years of relative stability . by 1991 , business spent $ 249.4 billion on health care in 1995 , including $ 183.8 billion for employer - sponsored health insurance . the 1993 to 1995 average annual growth of 4.3 percent was the slowest since we began to measure business health spending in 1965 . the burden placed on business eased over the years 1993 through 1995 . during this time overall health care costs grew at a slow rate . also , enrollment in managed care plans grew . these plans generally charged lower premiums than traditional fee - for - service plans . in highly competitive markets , managed care plans also kept premiums low to increase enrollment and boost market share . this in turn forced traditional indemnity insurance companies competing with managed care plans to develop new low cost products or lose market share . these marketplace changes contributed to health care costs consuming less of the business 's compensation costs and profits . according the bureau of labor statistics ' employment cost index ( eci ) for civilian workers , the primary driver of the slowdown in benefits growth was the decline in the cost of health benefits . although a separate health insurance benefit index is not available , the eci program does publish employer compensation cost levels using current employment weights . based on that eci measure , average civilian employer health insurance costs fell 6.2 percent ( $ 1.29 to $ 1.21 per hour worked ) between march 1994 and 1995 . during the same period , wages and salary costs grew 0.5 percent , from $ 13.06 to $ 13.12 per hour worked . private health insurance is obtained primarily through employer - sponsored health plans and health plans purchased separately by individuals . in 1995 , private health insurance premiums continued to grow at a slow rate , increasing just 2.6 percent from the previous year . however , the employee share of employer - sponsored health insurance increased 8.1 percent from 1994more than twice the growth rate of employer contribution to premiums with the result that the share of health plan premium costs paid by employers inched further downward . in recent years , many employers shifted more of the premium burden to their employees by either requiring workers to contribute to their own health insurance premiums or by raising the required employee premium more rapidly than overall premium cost growth . one factor contributing to the premium cost shift from employers to employees was the migration of covered workers into lower cost managed care plans , such as health maintenance organizations , preferred provider organizations , and point of service plans . although employees generally incurred both reduced out - of - pocket costs and expanded services under a managed care plan , employers typically paid a smaller portion of the total premium for these plans than for traditional indemnity ( fee - for - service ) plans . therefore , it is likely that the rapid expansion of managed care enrollment in the 1990s had the effect of boosting the employee share of total premiums . the majority of spending ( $ 182.6 billion ) was for out - of - pocket health care expenses not covered by insurance and for copayments and deductibles . the remainder was spent on phi premiums ( $ 68.5 billion ) and premiums and contributions to the medicare trust funds ( $ 72.2 billion ) . the switch to managed care affected the level of household out - of - pocket payments . starting with the late 1980s , the growth in out - of - pocket expenses for health care has been the lowest since 1970 . this coincides with the increased enrollment in managed care plans that have lower deductibles and copayments than traditional fee - for - service plans . households have paid approximately 5.5 percent of their income after taxes for health care ( u.s . bureau of labor statistics , 1990 - 95 ) . according to consumer expenditure survey data , elderly households ( households with reference persons 65 years of age or over ) spend three times as much of their income after taxes on health care as non - elderly households . in 1995 , the public sector paid 38 percent , or $ 360.4 billion , of hss . the federal government paid $ 203.4 billion , while state and local government paid $ 157.0 billion . the portion of federal government revenues financing health care costs declined slightly in 1994 and 1995 after several years of significant growth . the decrease from 24.0 percent in 1993 to 22.8 percent in 1995 was primarily due to an increase in the federal revenues rather than a slowdown in federal health spending . medicare incurred expenditures of $ 187.0 billion in 1995 , up 11.6 percent from the previous year . the medicare program is funded through 3 sources : ( 1 ) payroll taxes paid by employers and households ; ( 2 ) premiums and income taxes on social security benefits paid by households ; and ( 3 ) income from the federal government . in this accounting scheme , federal government contributions to the medicare program include trust fund interest income , net changes in the trust fund balances and transfers from the general fund of the treasury ( board of trustees of the federal hospital insurance trust fund , 1996 and board of trustees of the federal supplemental insurance trust fund , 1996 ) . in 1995 , medicare hospital insurance ( hi ) benefit payments and administrative expenses exceeded income by $ 2.6 billion . this financing shortfall was met by redeeming $ 2.6 billion in treasury securities held by the hi trust fund . this necessity contributed to the increase in the government 's share of total expenditures in 1995 . the disparity between income and expenses is expected to grow rapidly , with the assets of the hi trust fund becoming exhausted about 2001 in the absence of corrective legislation .

for the period 1990 - 95 , we will present data on health care spending by business , households , and government . in addition , we will measure the relative impact of these expenditures on each sector 's ability to pay . in 1994 and 1995 , health care costs experienced the slowest growth in 3 decades . combined with healthy revenue growth , slow cost growth helped ease or stabilize the financing burden faced by business , households and government .

please summarize the articles given below

it can be developmental or acquired and rarely may be associated with temporomandibular joint ( tmj ) ankylosis . it has been only occasionally reported since then , probably due to its usually asymptomatic nature . in 1941 , hrdlicka reported the first cases of bmc in 21 specimens from an unspecified number of dried skulls , and in 1948 , sicher first reported this anomaly in a living person . honee and bloem described a case of bifid condyle in the cadaver of a 71-year - old patient . although this type of morphologic change is generally associated with trauma , conditions such as teratogenic drug use , genetic inheritance , infection and exposure to radiation can also cause the development of this anomaly . the first patient was a 14-year - old female with a history of extraction of lower decayed and painful left first molar done about 3 months earlier . the patient continued to have pain and recurrent swelling on and off after extraction and was managed by her treating dentist with medications . the patient presented to the department with dull pain and facial swelling in relation to lower left molar region extending to the angle of mandible . axial and coronal computed tomography ( ct ) images of bilateral tmj and mandible with multiplanar reformatting ( mpr ) were done for evaluating any pathologic fracture and tmj pathosis . these findings are best seen on the axial and sagittal images [ figure 1 ] . coronal and axial ct images demonstrate left bmc oriented anteroposteriorly with articular surface irregularity the second patient was a 12-year - old female patient , referred for ct examination for evaluation of mild facial asymmetry and suspected tmj ankylosis . she had a reduced degree of jaw opening since childhood , and subsequently developed midline deviation to the left along with difficulty in mastication . these images demonstrated sagittal splitting of the left mandibular condyle into medial and lateral condylar head . the first patient was a 14-year - old female with a history of extraction of lower decayed and painful left first molar done about 3 months earlier . the patient continued to have pain and recurrent swelling on and off after extraction and was managed by her treating dentist with medications . the patient presented to the department with dull pain and facial swelling in relation to lower left molar region extending to the angle of mandible . axial and coronal computed tomography ( ct ) images of bilateral tmj and mandible with multiplanar reformatting ( mpr ) were done for evaluating any pathologic fracture and tmj pathosis . these findings are best seen on the axial and sagittal images [ figure 1 ] . the second patient was a 12-year - old female patient , referred for ct examination for evaluation of mild facial asymmetry and suspected tmj ankylosis . she had a reduced degree of jaw opening since childhood , and subsequently developed midline deviation to the left along with difficulty in mastication . these images demonstrated sagittal splitting of the left mandibular condyle into medial and lateral condylar head . szentpetery et al , in their study of 1882 cadaveric skulls , found the incidence of bmc to be 0.48% . a report of four cases of bifid condyles presented by loh and yeo included one involving an edentulous cadaver . in a literature review of reported cases in living patients , subsequently , four cases by stefanou et al and two other cases have been reported . recently , artvinli and kansu ( 2003 ) and antoniades et al ( 2004 ) have reported the first two cases of trifid condyle in patients who also had bifid condyles on the other side . described the first case of bilateral bifid condyles in a living patient . since then 10 more cases have been reported . current literature review in living patients revealed a total of 45 cases of bifid condyle , out of which 11 cases are bilateral , giving a ratio of approximately 3:1 . however , if the survey of the dry skulls and cadaveric reports are included , then the total number is 84 cases , of which 15 are bilateral . they appear to be more common on the left side in unilateral cases by a ratio of 2:1 . most cases ( 67% ) are asymptomatic and are found on routine dental radiographic examination . however , some have been reported in patients presenting with tmj symptoms , swelling , trauma , or ankylosis . the embryologic theory suggests that it is due to the obstruction of the blood supply to the condyle or the persistence of the vascularized fibrous septa . another theory postulates trauma as the cause with disruption or dislocation of joint integrity due to birth trauma , condylar fractures or surgical condylectomy in separate studies conducted by loh and yeo and antoniades et al , it was found that most cases of bifid condyle were asymptomatic and not associated with any history of trauma .. the site of fracture of the mandibular condyle and its relation to the insertion of the lateral pterygoid muscles are factors determining the future development of bifid condyle . other causes that have been proposed include genetics , endocrine disturbances , infection , radiation , nutritional deficiencies , and exposure to teratogenic substances . support for the latter suggestion comes from the work of gundlach et al who experimentally induced bifid condyles in rats by injecting teratogenic substances such as n - methyl - n - nitrosourea and formhydroxamic acid in different concentrations , at various stages of pregnancy . the extent of bifid condyle may range from a shallow groove to discrete condylar heads and the orientation may be anteroposterior or mediolateral . it has been postulated that anteroposterior splitting usually occurs in patients with identifiable antecedent trauma , while mediolateral splitting is usually developmental in origin . but here in our patient we have seen that there was a history of trauma for the mediolaterally splitted condyle and the anteroposterior splitting was because of osteomyelitis and the patient denied any previous trauma in all her life . szentpetery et al . have suggested that when two condylar parts lie in the sagittal plane , trauma is indicated as the cause , and when the parts lie in the coronal plane , the persistence of the fibrous septa at the condylar cartilage is likely to be the cause . while this may be true for the majority of cases , some mediolateral bifid condyles have been reported following sagittal fracture through the condylar head . according to blackwood , two articulating surfaces of the bmc were divided by a groove and could be orientated mediolaterally or anteroposteriorly , characterizing a specific entity . in this case report , as postulated above , groove formation and presence of medial and lateral head of both condyles clearly demonstrated the formation of the bmc . majority of the cases are detected during routine radiographic examination . in most of the cases , however , bmc is reported to be associated with pain , swelling , restricted mouth opening and most commonly tmj clicking . in our case due to the lack of clinical symptoms , diagnosis is made by radiographic findings . ct scan is the best radiograph for detection of bmc because it allows for detailed evaluation of condylar morphology . however , bmc can also be seen on opg , but sometimes the overlapping of the anatomic structures can hide the bifidity . in summary , bmc , an anatomic variation of condyle is a rare anomaly whose etiology is unknown . in the present case , literature says that it is most commonly due to facial trauma in the early stages of development . patients with internal articular derangement should be treated with occlusal splints and arthroscopic surgery , while patients with associated articular ankylosis may need surgical condylectomy or arthroplasty . awareness of this abnormality will help to avoid mistaking it for a fracture or a tumor . our first case also illustrates the point that bmc may be associated with tmj ankylosis . such a case requires detailed clinical examination and evaluation by ct for further management and for prognosticating the outcome . focal and diffuse mesangial proliferative glomerulonephritis reveal the most common histologic lesions observed on renal biopsies from patients with iga nephropathy ( igan ) . however , histologic variability is also observed in this disease , which is the same as with lupus nephritis . in some cases , endocapillary hypercellularity is accompanied by segmental duplication of the glomerular basement membrane , and there is rarely diffuse endocapillary proliferation with lobular accentuation and multiple double contours , resembling type i membranoproliferative glomerulonephritis ( mpgn ) . tanaka and waga have reported a biopsied patient with acute igan following the formation of keloid scars due to a burn injury . however , further reports regarding the correlation between igan and burn injury are rare . a 46-year - old male patient with scrotal and pedal edema was admitted to our department in august 2012 . laboratory examination showed proteinuria ( 4 + ) and more than 775 red blood cells in the urine without casts . this patient had been treated for his 2nd- to 3rd - degree burn injuries in a local burn center . he had no inhalation injury or sepsis during the whole treatment process . at the admission time , he had a body temperature of 36.6c , a pulse rate of 75 beats / min , a respiratory rate of 16/min , and a blood pressure of 118/80 mm hg . physical examination revealed cutaneous convalescence after full - thickness burns of both hands , the coronal plane of the body and both legs . the skin showed fuscous , slight exudation , bleeding cracks , mild scaling and itch during the treatment process ( fig . the laboratory test results of the urine and blood for this patient are listed in table 1 . he was diagnosed as having nephrotic syndrome on the basis of a diminished serum albumin level of 23 g / l and an increased proteinuria excretion of 10.0 g/24 h. during the treatment course , microbiological examination of wound secretion was performed twice a week and no infection was observed . a percutaneous renal biopsy was performed on september 11 , 2012 ( day 57 after burn injury ) to explore the cause of proteinuria . the examination under light microscopy revealed a diffuse and moderate proliferation of mesangial cells and endothelial cells without observable crescents in 20 glomeruli . arterioles presented as normal status . neither tubular atrophy nor interstitial fibrosis was found , as shown in figure 2a c . immunofluorescence revealed iga ( 3 + ) , trace igm , c3 ( 3 + ) , igg ( ) , c4 ( ) and c1q ( ) in a coarse granular pattern with mesangial and capillary distribution ( fig . 2d , e ) , and inconspicuous staining for igm along the glomerular capillary walls in a granular pattern . in addition , this patient showed negative staining of hbsag and hbcag . the mesangial hypercellularity and increased mesangial matrix were present between the glomerular basement membrane and glomerular endothelium . the thickened capillary wall was composed of basement membrane - like materials , interposed mesangial cells , and electron - dense immune - type deposits ( fig . based on the proliferative properties of glomerular lesions , the patient was started on therapy with oral prednisone at a dose of 1 mg / kg / day . after treatment , the excretion of urinary protein revealed a significant decrease from 10.0 to 5.20 g/24 h in 2 weeks . the patient had been followed up to date and showed normal renal function and mild proteinuria . the glomerular filtration rate is increased after burn injuries , which is accompanied by vascular dysfunction and increased cardiac output . renal disease and acute kidney injury remains prevalent and is associated with the increased mortality of patients with severe burn injuries . this case shows the pattern of diffuse proliferative type i mpgn - like symptoms with mesangial interposition and double contours of the glomerular basement membrane present on periodic acid - schiff and silver stains ( fig . the following reasons are considered as a close correlation between burn injury and the onset of igan . first , this patient did not have any urinary abnormalities or chronic kidney diseases before and at the early stage of burn injury . second , nephrotic syndrome was observed at the 2nd week after the injury , and the patient did not have a history of infection such as inflammation of the respiratory tract although concurrent nephrotic syndrome in convalescence was observed . in addition , the patient suffered from skin problems with slight exudation , bleeding cracks , mild scaling and itch during the treatment process ( fig . although a causal relationship between igan and burn injury has not been established , an association of cutaneous lesions after burn injury with igan has been reported in a few patients [ 2 , 4 ] . tanaka and waga mentioned a biopsied patient with acute igan following the formation of keloid scars due to burn injury . the patient revealed a rapid recovery after complete removal of the scars without any medication . wang et al . have reported that acute igan is closely related to high - voltage electrical burn injury . in this study , all those case reports revealed a close relationship between igan and burn injury . because of trauma , infection , tissue necrosis , allogeneic plasma transfusion , increased concentrations of circulating immune complexes were observed . this situation is similar to the immune dysfunction of igan . both have inherent genetic predisposition and external infections , which may induce igan . if the pathogenesis of igan is not correlated with the concurrent burn injury , what is the cause of the nephrotic sydrome ? we hypothesize that an autoimmune dysregulation due to a sequestered antigen induced by skin infection and pruritus after burn injury may have an important role in the pathogenesis of igan . the persistent skin lesions with dry , itch and crusting properties can trigger iga deposition and promote the depositions in the mesangium and subendothelium of the patient . after serious burns , the immune system is disordered , the immune complex is increased in the circulation , and macrophages are excessively activated . numerous studies have provided evidence that burns upregulate inflammatory cytokines such as tnf- and il-1 . those cytokines can interfere with the hemodynamics of intraglomerular microcirculation , the coagulation - fibrinolysis system and the infiltration of inflammatory cells after burns . nephritis is a rare complication of burn injury , and once this happens , it will affect the recovery and prognosis of the patient . regular urine analysis will contribute to the early detection and diagnosis of glomerular diseases while treating burn injury . it is difficult to measure the blood pressure of burned patients , but blood pressure should be monitored as early as possible . because of wound exudation , infection and other reasons , the patients with large burned areas often have some degree of hypoalbuminemia . once persistent hypoalbuminemia exist , the burned patients need further examination to diagnose whether they have chronic glomerulonephritis or nephrotic syndrome . if the burned patient has nephrotic syndrome , enough glucocorticoid should be administered in order to alleviate proteinuria effectively and for the recovery of burn wounds . the casual relationship between the onset of igan and burn injury remains speculative and needs to be explored further .

bifid condyle is a rare anatomic variation of mandibular condyle . it can be symptomatic or diagnosed incidentally on routine radiographic examination . no definite etiologic factor has been identified . it is suggested that bifid condyle could be a developmental anomaly or secondary to trauma . we are reporting two cases of bifid mandibular condyle . both were diagnosed using computed tomography scan , which additionally revealed the associated pathosis in the angle of the mandible in first patient and the ankylosis of temporomandibular joint in the second patient .

please summarize the articles given below

ocular cicatricial pemphigoid ( ocp ) is an uncommon , chronic autoimmune disease that affects mucous membranes , particularly the conjunctiva.1 the disease typically results in chronic conjunctivitis and causes conjunctival and corneal scarring , which can result in limbal stem cell deficiency and blindness.2 adequate control of ocular inflammation usually requires systemic as well as topical immunosuppressants . commonly used systemic medications include prednisone , methotrexate , mycophenolate mofetil ( mmf ) , and cyclophosphamide.3 the porphyrias are metabolic disorders caused by defective enzymes within the heme synthetic pathway.4 these defective enzymes cause an accumulation of intermediates from the heme synthetic pathway that results in various clinical manifestations.4,5 porphyria cutanea tarda is the most common of the porphyrias and results from a deficiency in uroporphyrin decarboxylase , which is the fifth enzyme in the heme synthetic pathway.6 this deficiency results in the accumulation of porphyrins in the liver and plasma . on exposure to light with a wavelength near 400 nm , the porphyrins enter an excited state that can lead to the damage of proteins , lipids , and basement membranes.6 this process results in blisters , fibrosis , and scarring of the skin in areas of the body exposed to sunlight.6 park et al7 have reported a case of a 31-year - old with cicatricial conjunctivitis who was biopsy negative for ocp and was later diagnosed with porphyria cutanea tarda ; in this case the patient s clinical symptoms significantly improved after initiating phlebotomy treatments . the present authors report a similar case , in which pathology and direct immunofluorescence confirmed a diagnosis of ocp and where the patient s clinical condition also improved significantly upon the diagnosis and treatment of porphyria cutanea tarda . a 64-year - old caucasian male complaining of redness and tearing for 3 years in both eyes was referred for evaluation of cicatricial conjunctivitis . he had been treated with tobramycin and dexamethasone ophthalmic ointment in both eyes as needed and doxycycline 100 mg by mouth daily with no improvement in his symptoms . on slit lamp examination the patient had subconjunctival fibrosis , symblepharon , forniceal foreshortening , and trichiasis in both eyes ( figure 1 ) . examination of the corneas revealed multiple punctate epithelial erosions . a schirmer s test was performed without anesthesia , showing 22 mm of wetting in the right eye and 13 mm in the left after 5 minutes . direct immunofluorescence studies of the conjunctival biopsy specimen revealed immunoglobulin g4 deposits in the basement membrane zone of the junctional area ( figure 2 ) , consistent with ocp . given the findings of subconjunctival fibrosis and symblepharon formation in both eyes , the patient was diagnosed with bilateral stage iii pemphigoid . the patient was started on methotrexate 15 mg by mouth weekly and prednisone 20 mg by mouth daily . the patient demonstrated gradual improvement in the conjunctival inflammation after starting the methotrexate and prednisone . the patient was subsequently tapered off the prednisone , while the methotrexate 15 mg by mouth weekly was continued . after 4 months of treatment with the methotrexate , the patient s conjunctival inflammation began to worsen and his regimen was subsequently changed from methotrexate to mmf 1000 mg by mouth twice daily . approximately 3 months after initiating mmf treatment , the patient was diagnosed with porphyria cutanea tarda . the patient s conjunctival inflammation appeared stable following initiation of the phlebotomy treatments and the mmf was subsequently discontinued . approximately 6 weeks following discontinuation of the mmf , the patient returned with mildly increased conjunctival injection and trichiasis in both eyes . epilation was performed and the patient was started on 1% prednisolone acetate ( one drop in both eyes twice daily ) . the patient s conjunctival inflammation stabilized and he was tapered down to one drop of 1% prednisolone acetate in both eyes once daily . since initiation of the phlebotomy treatments , the patient s conjunctival inflammation and subconjunctival fibrosis has remained quiescent for 4 months without requiring mmf ( figure 3 ) . ocp is believed to be an autoimmune disease of genetic predisposition , and it is likely that a second - hit environmental trigger is required to initiate onset of the disease.1 it has been thought this could include chemical exposure or microbial environmental triggers . the present case suggests that the patient s porphyria could be a causal factor associated with the ocp and could even have been the environmental trigger that stimulated the disease to occur . the porphyrins are present in plasma and therefore they would be present in the ocular surface vasculature.5 the ocular surface is constantly exposed to light . exposure to ultraviolet light would lead the porphyrins to enter into an excited state , resulting in inflammation and damage to the ocular surface . this process could be the trigger to either initiate or exacerbate ocp . in the present case , the patient s conjunctival inflammation was observed to significantly improve following initiation of treatment for his porphyria . a similar response was observed in the aforementioned case reported by park et al,7 although that particular patient was biopsy negative for ocp and was positive for hepatitis c virus infection ; in addition , the patient remained on methotrexate . the patient in the present case was unique in that he was biopsy positive for ocp and his clinical improvement was significant enough after starting phlebotomy treatments that his mmf was discontinued . the authors consider that this case , as well as the case reported by park et al,7 sheds new light on the search for the etiology of ocp and the subsequent treatment options for patients with this disease .

a 64-year - old caucasian male complaining of redness and tearing for 3 years in both eyes was referred for evaluation of cicatricial conjunctivitis . ocular cicatricial pemphigoid was suspected and this diagnosis was confirmed through biopsy . the patient s condition showed moderate improvement following treatment with methotrexate and mycophenolate mofetil . the patient was later diagnosed with porphyria cutanea tarda and phlebotomy treatments were subsequently initiated . the patient s ocular symptoms improved further after he began receiving these phlebotomy treatments , and conventional treatment was discontinued . the authors hypothesize that circulating porphyrins activated by ultraviolet light could be the cause of the ocular cicatricial pemphigoid in this patient .

please summarize the articles given below

a colony was established from soybean and cowpea field collections of n. viridula in stoneville , ms , during the spring and the summer of 2010 . this colony has been maintained in culture for 5 years at the usda - ars national biological control laboratory . after approximately 40 generations in culture , three orange morph adult males were detected in the colony . the orange morph males were paired with green females at a two females per male sex ratio to represent a parent population ( f0 ) , and allowed to reproduce using the rearing methods described by rojas and morales - ramos ( 2014 ) . cages constructed from clear plastic boxes ( l 320 w 260 h 100 mm , part no . 048-c , pioneer packing , dixon , ky ) were modified with ten windows ( 27 mm dia . ) on the sides and four windows ( 65 mm dia . ) on the top all covered with nylon screen ( mesh 500 m ) . all adults in this study were reared in an environmentally controlled room at 26 1 c , 50 5% rh , and 14 h photophase and provisioned with peanuts , broccoli , a diet supplement , and fresh bean pods and a diet supplement that was replaced at 3 days intervals . eggs were collected daily and hatching nymphs ( f1 ) were allowed to develop under same conditions . the number of males and females of each coloration type was recorded for each generation in this study . resulting f1 adults were paired and reared at the same conditions to obtain the f2 generation . resulting f2 adults consisted of green females and green and orange males . only f2 orange males ( app . 25% of the total numbers ) were retained to mate with f2 females ( at two females per male sex ratio ) to produce the f3 . eggs were collected daily and enclosing nymphs were reared to the adult stage under the same conditions described above . because the f3 colony had become considerably larger , only resulting f3 adults from the first three emerging dates were counted and sexed . phenotype and sex frequencies observed in each generation were compared with frequencies expected , assuming that the orange color phenotype was determined by a single sex - linked recessive allele as reported by follett et al . the test was used to compare observed versus expected frequencies within each generation cross . resulting f3 adults were divided to form two different colonies : orange type and green type . the pure orange - type colony was established using solely f3 orange - type adults . the f4 pure orange - type colony was used to generate a pure orange - type f5 . the reproductive potential of the f5 pure orange colony was compared with that of the pure green stock ( parental ) colony . newly emerging f5 orange - type adults were collected and grouped in cohorts of the same emerging date . a total of three cohorts were obtained from the green - type stock colony ( 209 adults total ) and four cohorts from the f5 orange type ( 168 adults total ) . adults were reared as described above and were monitored for oviposition and mortality , which were recorded daily . egg masses collected each day were recorded , labeled , and allowed to develop for 3 days before counting the eggs . embryos in developing eggs at 3 days old showed noticeable red eye coloration , which made them visible and allowed discrimination between fertilized and unfertilized eggs . the fertility ratio was calculated as fertile eggs / total eggs and fertility ratio was compared between color types using the z test . the mean number of eggs per mass was compared between treatments using anova and the student s t test . fertility tables were produced for each type using the methods reported by portilla et al . the f1 generation resulted in only green morphs ( 590 and 684 ) as expected from a recessive orange allele of single gene character . however , the f2 generation produced 672 green females , 351 green males , 298 orange males , and no orange females . these ratios were not significantly different to those expected for a recessive allele of a sex - linked gene ( table 1 ) and were consistent with follett et al . the first three cohorts of the f3 generation consisted of 345 green females , 346 green males , 100 orange females , and 85 orange males . the difference between observed and expected ratios were significant ( =8.067 , df = 3 , p = 0.046 ) ( table 1 ) , but this difference could be explained by significant deviations from the expected sex ratio of the f3 orange types ( |z| = 2.38 , p = 0.0087 ) resulting in a slight bias of 1.17 females per male . a similar female bias sex ratio was observed by follett et al . ( 2007 ) and this bias was explained as higher mortality in males occurring during their development . table 1.expected progeny ratios and observed frequencies in resulting f1 , f2 , and f3 generations after cross of orange males and green females in parent generation ( f0).expected phenotype ratios in progenyobserved phenotype frequencies in progenygeneration : parent and ( progeny)assumed genotypesg g o o g g o o f0 ( f1)xx x xy0.50.500590684006.936f1 ( f2)xx x xy0.50.2500.2567235102984.653f2 ( f3)0.5 xx x xy + 0.5 xx x xy0.3750.3750.1250.125345346100858.067*degrees of freedom ( df ) = 3 ; values with * show significant deviation from expected ratios.f2 green males were removed leaving only orange males to cross with green females . expected progeny ratios and observed frequencies in resulting f1 , f2 , and f3 generations after cross of orange males and green females in parent generation ( f0 ) . degrees of freedom ( df ) = 3 ; values with * show significant deviation from expected ratios . mean oviposition rate ( sem ) measured as eggs per female per day was significantly higher in green - type stock colony females ( 2.76 0.29 ) as compared with f5 orange - type females ( 1.17 0.27 ) ( |t| = 2.456 ; df = 222 ; p = 0.0148 ) . there was no significant difference in the number of eggs per egg mass between the parental stock green ( 27.14 1.26 ) and f5 orange ( 26.39 1.62 ) types . also , the proportion of fertile eggs was not significantly different between green ( 0.718 0.0094 ) and orange ( 0.726 0.0058 ) types . however , green - type females produced significantly higher number of egg masses per day ( 2.09 0.16 ) than orange type females ( 0.71 0.15 ) ( |t| = 6.14 ; df = 222 ; p < 0.0001 ) . the reproductive output of green - type females was higher as measured by the ro value ( 20.67 ) compared with orange - type females ( 13.71 ) ( fig . in addition to the reduced expected phenotypic ratio in natural populations ( consisting mostly of males due to the sex linked and recessive nature of the orange allele ) , the lower reproductive output by orange types may be an explanation for their rarity in natural populations . 1.cumulative lxmx ( reproductive output ) from fertility tables of green and pure orange types of nezara viridula . cumulative lxmx ( reproductive output ) from fertility tables of green and pure orange types of nezara viridula . peritoneal dialysis ( pd ) therapy has increased in popularity since the end of the 1970s . the method was developed as an alternative to hemodialysis ( hd ) presenting a patient survival rate equivalent to hd and better preservation of residual renal function . currently , the two principal causes of technique failure in order of importance are ( a ) peritonitis , this important medical problem can also represent nearly 16% of the causes of death ; ( b ) ultrafiltration failure , a multifactorial complication that can affect up to 40% of patients after 3 years of therapy . these proinflammatory stimuli can induce lymphokine secretion by macrophages , which in turn , activate fibroblasts . fibroblast activation has been associated with structural alterations in the peritoneal membrane of varying intensity . these alterations can be seen in figure 1 which was extracted from a submitted study of our group . in this prospective controlled study in 20 nonuremic wistar rats , peritoneal fibrosis occurs after exposure to glucose - based pd solutions and regardless the use of simvastatin . eps is a clinical syndrome that leads to persistent or recurrent intestinal obstruction , with or without inflammatory parameters of peritoneal thickening , sclerosis , calcification , and encapsulation , and can be inferred by clinical symptoms and radiology , but confirmed only by direct visualization with laparotomy [ 2 , 3 ] . incidence of eps is heterogenous and has been reported to vary from 6 to 20% in eight years depending on the region . causes of inflammation in peritoneal dialysis range from traditional factors to those related to chronic kidney disease per se as well as from the peritoneal dialysis treatment itself . uremia is a factor present in all pd patients and generates an inflammatory state causing stress on the peritoneum due to the formation of carbonyl products . it accelerates the formation of advanced glycation end products ( ages ) that induces an upregulation of the receptors of advanced glycation end products ( rage ) . the peritoneal dialysis catheter is the first proinflammatory factor associated to pd with which the patient comes into contact . after implantation in the peritoneum , the catheter can induce an inflammatory reaction as was demonstrated by flessner et al . . in addition , the catheter can occasionally be the site of bacterial biofilm formation . several pd solutions are available on the market today , and all are , to varying degrees , associated with peritoneal inflammation . such inflammation is generated by several characteristics of these solutions , varying from low ph , presence of lactate , hyperosmolality , increased glucose concentration , presence of glucose degradation products ( gdp ) and advanced glycation end products ( ages ) , and icodextrin metabolites , among others [ 6 , 7 ] . currently available glucose - based pd solutions the glucose load offered daily by a traditional pd prescription usually ranges from 120 g to 400 g. the majority of pd solutions prescribed today markedly acidify ph to nearly 5.7 in approximately 2 to 3 minutes . this ph decreases viability of neutrophils and mesothelial cells , thus decreasing cytokine production and phagocytosis capacity . its bioincompatibility with the peritoneal membrane is well known as well as its capacity to stimulate the production of fibroblast growth factors contributing to peritoneal fibrosis . some studies have associated the osmotic agent with eps development , while others have shown it to be distinct , confirming its safety even with long - term utilization . even experimental studies with rats addressing this question are compromised by the increased -amylase activity in these animals . the presence of this enzyme in plasma and in the peritoneal cavity provokes a rapid drop in peritoneal icodextrin concentration . chronic exposure to high glucose load in traditional pd solution induces significant inflammation of the peritoneal membrane . these solutions induce several proinflammatory factors such as pga , vascular endothelial growth factors ( vegfs ) , fibroblast growth factor ( tgf-1 ) , ages , and upregulation of rages . glucose degradation products ( gdps ) , such as methylglyoxal , glyoxal , and 3-deoxyglucosone generated during the heat sterilization process , increase inflammation by inducing oxidative stress , which thus causes damage to mesothelial cells and leads to apoptosis and mesothelial denudation . substituting traditional solutions for more biocompatible solutions it has been suggested for some years that the pathway of transforming growth factor 1/smad plays a part in the development of peritoneal fibrosis . the latter is recognized as playing a role in angiogenesis , a histological characteristic that allows for differentiation from simple peritoneal fibrosis to eps . the endothelial system is another known factor with potent profibrotic characteristics and plays a role in the development of peritoneal fibrosis . this system can be activated by two receptors , endothelial receptors a and b. however , endothelial receptor b apparently does not play a role in peritoneal membrane thickening in experimental studies inducing deficiency of endothelial receptor b. finally , and of extreme importance , infectious peritonitis is an obvious cause of peritoneal inflammation and is associated with eps development . gram - positive organisms remain as the more prevalent peritonitis agents over the past decades representing up to 60% of cases followed by gram - negative organisms . however , the prevalence of peritonitis due gram - negative organisms is growing fast with the development of efficient strategies to control gram - positive infections . despite all efforts made over the past decades , all the above - mentioned factors contribute to the release of proinflammatory cytokines such as interleukin 1 ( il 1 ) , tumor necrosis factor ( tnf- ) , il-6 , and il-18 . thickening and cubic transformation of mesothelial cells occurs and is more accentuated in the parietal peritoneum . human peritoneal mesothelial cells ( hpmcs ) also suffer structural alterations and prominent transdifferentiation of hpmc to myofibroblasts occurs . histological alterations of the peritoneal membrane observed in eps cases are nonspecific and are masked by the alterations commonly observed in patients with ultrafiltration failure and infectious peritonitis over the long term . the most common findings are fibrin deposition , fibrous capsule formation , perivascular bleeding , interstitial fibrosis , and the presence of tissue granulation with vascular proliferation . submesothelial tissue thickening also occurs with an increase in deposition of mesothelial conjunctive tissue [ 19 , 20 ] . fibrosis is characterized by the accumulation of extracellular matrix ( ecm ) , resulting in disequilibrium between synthesis and degradation . expression of collagen types 1 and 3 is significantly increased as well as collagen type 4 . one of these clinical manifestations is ultrafiltration ( uf ) failure and can occur in up to 30% of patients on pd after five years of treatment . one of the presentations of uf failure occurs due to the increase in pores in the peritoneal membrane , which in turn accelerates small - solute transport dissipating the osmotic gradient necessary to maintain adequate fluid balance . this increase in vascular surface is observed in conjunction with an increase in density of interstitial fibers . these findings help justify the increase in transport of small molecules , while the alterations in the uf coefficient are only moderate . in addition to uf failure , clinical manifestations such as severe malnutrition , subocclusion or intestinal occlusion , and ascites suggest the presence of eps even after discontinuation of pd . prescribing more hypertonic glucose solutions is a common strategy to counter this drop in uf , primarily where there is no available icodextrin . this intensifies and perpetuates inflammatory disturbances , with a direct impact on dialysis adequacy and fluid balance . the final consequence is the inevitable transfer to hd . despite all damage to the peritoneal membrane with therapies performed today , large observational studies have shown an important evolution in pd patient survival when compared to hd over the past years . pd initiation increases inflammatory stimuli for the chronic kidney patient such as the presence of the peritoneal catheter , use of bioincompatible solutions , and possible infectious peritonitis . these manifestations are frequently observed and can range from difficulties in obtaining an adequate fluid balance until the dreaded encapsulant peritoneal sclerosis . an understanding of the mechanisms involved in peritoneal inflammation is fundamental for the development of new strategies . this knowledge can provide not only a better technique survival , but also improvements in patient survival and a better quality of life .

nezara viridula adult coloration can vary , including a rare orange - colored type ( i.e. , n. viridula f. aurantiaca ) . in november 2015 , three nezara viridula males displaying orange coloration were found in an established colony in stoneville , ms . the objectives of this study were to determine if alleles of these orange types conformed to the allele characteristics previously reported for n. viridula f. aurantiaca and to determine if there were any differences in reproductive output compared with the green - colored type . the three orange - type males were crossed with green - type females to produce a hybrid f1 . the f1 progeny was allowed us to cross to produce an f2 . the f2 progeny consisted of 672 green females , 351 green males , 298 orange males , and 0 orange females . these ratios did not differ significantly from the expected 50:25:25:0 ratios for a single recessive sex linked allele for color phenotype . the f2 cross of green females and orange males produced an f3 consisting of 345 green females , 346 green males , 100 orange females , and 85 orange males . these ratios also conformed to the expected ratios ( 0.375:0.375:0.125:0.125 ) with the exception of orange males , which numbers were slightly lower than expected . the pure orange type n. viridula produced significantly less egg masses ( 0.71 0.15 ) per day than green types ( 2.09 0.16 ) and their reproductive output , measured as net reproductive rate ( ro ) , was lower in orange ( 13.71 ) compared with green ( 20.67 ) types .

please summarize the articles given below

spinal dural arteriovenous fistula ( sdavf ) is a rare neurological disease with an estimated frequency of 510 cases per million per year . it is caused by a subdural shunt between a radiculomeningeal artery and a radicular vein , leading to impaired venous drainage from the spinal cord and the arterialization of the vein due to increased venous pressure . the time to diagnosis is often delayed due to unspecific neurological complaints to as long as 1015 years after the onset of symptoms . therefore , 40% of patients are severely disabled at the time of diagnosis . the most common location of an sdavf is in the lower thoracic and lumbar region and it is accompanied by complaints in the lower extremities . sdavf at cervical level ( c - sdavf ) is extremely rare , accounting for approximately 2% of the sdavf patients and can lead to quadriplegia and respiratory insufficiency . early clinical features are nonspecific and include gait claudication , worsened by exercise . by the time of the diagnosis , the triad consisting of ( 1 ) motor deficits ( leg / arm weakness , muscle cramps ) , ( 2 ) sensory disturbances ( paresthesia , numbness , pins and needles sensation , back pain ) , and ( 3 ) cauda syndrome ( micturition problems , erectile dysfunction , anal sphincter disturbances ) are present in 70% of the patients . characteristic mri features include ( 1 ) engorged perimedullary veins , ( 2 ) central medullary edema , and ( 3 ) swelling of the caudal segments of the spinal cord . in the absence of the findings , diagnosis is difficult to make solely based on clinical symptoms and is usually erroneous . differential diagnoses may include medullary pathology ( myelitis , medullary tumors , disc herniation ) or peripheral pathology ( sensory polyneuropathy , chronic inflammatory demyelinating polyneuropathy ) ( table 1 ) . evidence of bladder or bowel dysfunction which share no evident relation with the site of medullary pathology could be very useful in suggesting the diagnosis . the association of cauda symptoms should be considered a red flag in sdavf and can guide the physician toward the correct diagnosis . the treatment involves either superselective catheterization with endovascular embolization of the fistula or neurosurgical occlusion of the arterialized vein . if successful , the treatment usually stops the progression of symptoms or leads to an improvement of neurological deficits . therefore , it is of utmost importance that the diagnosis is established as soon as possible in order to avoid permanent handicap . a 56-year - old man complained of sensory symptoms ( pins and needles sensation ) and pain in both legs and the right arm , which progressively worsened in about 4 months . the patient had difficulty performing his daily work as a bus driver and noticed impaired foot sensation and arm weakness during changing gears and pressing the pedals . the patient 's past medical history was unremarkable except for hypertension and hypercholesterolemia , both treated with statins and oral antihypertensive drugs . neurological examination showed generalized weakness in both lower limbs and the right arm ( medical research council grade 4 ) with hyperreflexia and bilateral plantar reflexes . sensory exam showed generalized sensation loss ( involving both dorsal columns and the spinothalamic tract ) and subjective pins and needles sensations in both feet and the right arm . given the association of both lower and upper limb involvement and hyperreflexia , a cervical lesion was suspected . the patient underwent diagnostic brain and spinal cord mri , which showed an elongated intramedullary hyperintensity from the foramen magnum to c4 on t2-weighted images ( fig 1 ) with a small contrast enhancement at the junction between the brainstem and the cervical spinal cord . transverse myelitis was suspected and the patient was treated with a high intravenous corticosteroid dose [ 7 , 8 , 9 , 10 ] . the patient developed quadriplegia with severe generalized weakness and sensation loss in both legs and both arms , inspiratory muscle weakness , dysphonia , and high urinary retention . an allergic reaction was excluded and the patient was transferred to an intensive care unit for assisted breathing . a cervical mri was performed showing varicose dilatations , irregular cervical veins , and central medullary edema ( fig 2 ) characteristic of a cervical sdavf [ 4 , 5 , 6 ] . superselective angiography confirmed the presence of an sdavf and the patient successfully underwent open spine surgery with ligation and coagulation of the arterialized communicating vein . ten days after the surgical treatment , he almost completely regained neurological functions and was further referred to an intensive rehabilitation program in a specialized clinic . by the time of discharge from the neurology ward 2 weeks after surgery , he could walk more than 30 m with rollator support and only had mild numbness in the feet and some difficulty voiding . sdavf may present with a wide range of clinical features such as motor and sensory deficits often associated with a cauda equina syndrome . neurological deficits are due to perimedullary venous congestion leading to intramedullary edema or ischemia in severe cases or direct compression of the nerve roots at the level of the fistula . abnormal communication between a radiculomeningeal artery and a radicular vein leads to increased venous pressure in the dural sleeve , impairing normal venous return from the intramedullary capillaries from and below the level of the fistula , causing medullary edema . furthermore , decreased pressure gradient at capillary level accounts for decreased gas exchange and medullary hypoxia . an acute increase in venous hypertension due to sudden volume or pressure overload may exacerbate neurological deficits by hampering the already decreased venous drainage at the level of the sdavf causing transitory medullary ischemia . previous publications report clinical worsening related to an acute increase in intrathoracic and venous pressure such as during singing , valsalva maneuvers , or abdominal muscle compression during exercise . in addition to the current paper , several publications report rapid worsening of symptoms in patients receiving corticosteroids intravenously for other presumed diagnoses ( most commonly myelitis ) [ 12 , 13 , 14 , 15 , 16 ] . although the exact mechanism which leads to worsening of spinal cord dysfunction is not yet understood , it is possible that both corticosteroid and intravenous saline in which these are administered could play a role . in addition to anti - inflammatory effects , corticosteroids can also play a role in regulating water and mineral metabolism through their mineralocorticoid effects , causing fluid retention . this can compromise the already fragile venous return into the dural sac , leading to medullary hypoxia and further worsening the sdavf symptoms . furthermore , steroids administered via an intravenous line placed in the upper extremity eventually drain via the cephalic veins into the brachiocephalic veins . the azygos and semiazygos veins , which collect venous blood from the spinal cord , are also tributaries of the brachiocephalic veins . therefore , a rapid rise in venous return from the upper extremities into the brachiocephalic vein could also directly diminish the venous return from the medullary level and exacerbate symptoms . this theory is supported by the mri findings before and after corticoid treatment in our patient . the cervical mri before intravenous treatment shows no evident perimedullary venous abnormalities , whereas after treatment , engorged veins can clearly be identified in the subdural space , as evidence of acute venous hypertension in the subdural sac ( fig 3 ) . we would like to conclude this study by stressing out the importance of early diagnosis and treatment in patients with sdavf . therefore , the presence of red flags can be extremely useful in guiding the physician toward the correct diagnosis . acute neurological worsening after intravenous steroid administration for any presumed diagnosis should be considered such a red flag and raise the suspicion of an sdavf . in october 2011 , the u.s . national science advisory board for biosecurity ( nsabb ) was asked to review two papers for their potential as dual - use research of concern ( durc ) . these papers contained results on the adaptation of the highly pathogenic avian influenza a / h5n1 virus to mammalian hosts such that it could be transmitted via respiratory droplets from animal to animal . we found that this work had great potential for harm or misuse and recommended that the general conclusions highlighting the novel outcome be published , but that the manuscripts not include the methodological and other details that could enable replication of the experiments by those who would seek to do harm the recommendation not to publish scientific results was highly unusual and the first such recommendation by the nsabb membership . we are primarily a group of actively practicing basic research scientists , and we have consistently advocated for open publication practices . as per our advisory nature to the u.s . there was agreement by nsabb voting members for these recommendations , though the rationale of individual members as they arrived at the same conclusions varied . we had to judge the beneficial attributes of these research results against their potential to cause harm . over the last 7 years , nsabb has studied the issues associated with dual - use research , including risk / benefit assessments , and developed principles and tools to guide the deliberative process . much of this has been formalized in a series of reports and recommendations that are available at a public website ( http://oba.od.nih.gov/biosecurity/biosecurity.html ) . despite this experience and carefully crafted guidance , there are points in the deliberations where uncertainties and even contradictory information necessitate subjective decisions . is there a clear and bright line to be crossed or is this a more nebulous and fuzzy region of yes or no for this research ? i will present only my personal rationale and how i came to the strong conclusion that this work had the potential to be very dangerous and that its communication should be restricted at this time . i heard from members of the influenza research community and reviewed the world health organization ( who ) data indicating that this avian virus had a very high mortality rate in humans . while the influenza a / h5n1 virus rarely infects humans , when it does it causes catastrophic disease . we are all aware of the rapid global spread of human - adapted influenza both on a yearly basis and during less common pandemics . the documented devastation of the 1918 influenza pandemic , even with its lower mortality rate , was a testament to the powerful potential of influenza . the thought of combining the high human mortality of influenza a / h5n1 with a highly transmissible human - adapted phenotype was sobering . a pandemic by such a pathogen could reasonably be concluded to cause such devastation that it should be prevented at all costs . i carefully considered how restricting the information would compromise scientific research progress and even how it would hinder public health efforts to prevent such a horrific pandemic . i know from firsthand experience that the free flow of information is part of the best and most productive research endeavors and that any restrictions burden the progress . the conclusion that this virus could be adapted to mammal - to - mammal respiratory transmission was , in my mind , the foremost beneficial part of the research . with this firm conclusion in hand , policy makers , granting agencies , public health officials , and vaccine and drug developers should have both the motivation and a compelling argument to move forward to improve our influenza - fighting infrastructure . the details of the research , on the other hand , would add little to this short - term effort and could enable someone to replicate the work in a short period of time . the short - term negative consequences of restricting experimental details seemed small in contrast to the large consequences of facilitating the replication of these experiments by someone with nefarious intent . current public health surveillance and public health responses would be enhanced little by these details . this comes not only from my own professional experience in globally tracking dangerous pathogens but also from personally watching the 2009 h1n1 influenza pandemic spread globally . it was impossible to contain , and i believe that the same would be true for an h5n1 influenza pandemic . we were lucky in that the h1n1 virus has low virulence , but the best current data suggest that this would not be the case for the h5n1 virus . publishing a detailed experimental protocol on how to produce a highly transmissible h5n1 virus in a highly regarded scientific journal is a very bad idea . since our recommendations were announced in mid - december , there has been considerable response from scientists , policy makers , funding agencies , and global health organizations . there have been criticisms that restriction of the publications was insufficient and that even performing such experiments should be restricted . the debate has touched upon both biosafety and biosecurity aspects , with some calling for the destruction of the virus or for moving all such research to the highest safety level , biosafety level 4 ( bsl-4 ) . the nsabb has not yet offered specific recommendations concerning these statements , and my personal opinions are relatively unimportant . what is gratifying and essential is that the debate is occurring ; it is occurring on an international stage , and it is occurring rapidly . in the midst of nsabb deliberations and formulation of our recommendations , the need for a global debate to develop policy has always been in our discussions . why should the nsabb be telling the world what to do ? why has not the world already had these discussions and debates ? how could the nsabb stimulate the process such that global leaders in science , policy , and public health engage in a broad - based conversation on these issues ? the specific nsabb recommendations seem to have been accepted and are being implemented by two research groups and two scientific journals ; more importantly , the research issue of adapting an avian virus to mammals , potentially humans , is a topic that is being widely discussed . the who has agreed to participate and facilitate in policy development . and the u.s . research and public policy will be developed from this global engagement process , a process that should increase the public s confidence in the scientific endeavor , in scientists ethical behavior , and in the transparency that a free research environment embraces .

subdural arteriovenous fistula ( sdavf ) is a rare condition characterized by clinical manifestations ranging from mild bilateral sensory deficits to quadriplegia . the diagnosis is often delayed due to unspecific neurological symptoms , initially diagnosed as polyneuropathy or myelopathy . the diagnosis can be delayed for as long as 115 years . the following report describes a cervical sdavf case initially misdiagnosed as myelitis transversa and treated with intravenous steroids . a 56-year - old male presented with sensory deficits and mild leg and right arm weakness . cervical mri showed a central medullary hyperintense lesion with contrast enhancement . after metabolic , infectious , and malignant causes were excluded , myelitis transversa was presumed and the patient was treated intravenously with methylprednisolone . shortly after that , he developed quadriplegia . cervical mri imaging showed engorged cervical perimedullary vessels , which were not visible on the initial mri . the diagnosis was revised and a sdavf identified . prompt surgical treatment led to a complete recovery . the effect of intravenous steroids in sdavf is controversial . acute clinical worsening after steroid administration is previously reported in several publications ; however , due to the paucity of clinical studies on sdavf , this effect remains mostly overlooked or unknown . the findings in this patient support the causative relation between sdavf clinical worsening and steroid administration . we propose that acute clinical worsening under steroids in patients initially diagnosed with myelitis should raise suspicion of an sdavf .

please summarize the articles given below

to identify the possible barriers to the implementation of pharmaceutical care among community and hospital pharmacists in enugu state using nsukka and enugu metropolis as a case study . the questionnaires were distributed to community and hospital pharmacists from designated areas during one of their quarterly meeting and their practice sites in 2009 . eighty completed questionnaires were collected with 22.8% from community pharmacists , and 77.2% from hospital pharmacists . the important barriers identified were lack of space , enough personnel in pharmacy to handle routine technical tasks , time , need for too much effort , and need for payment for services . the opinions on barriers to pharmaceutical care of pharmacists from community and hospital practice areas in these two metropolises of enugu state are majorly lack of time , space and routine technical task personnel . in the previous issue of critical care , chase and coworkers reported on their implementation into clinical practice and evaluation of the specialized relative insulin nutrition table ( sprint ) . this is an improved protocol in the form of a wheel - based system to control blood glucose levels and nutritional intakes in intensive care patients , which was developed a few years ago . blood glucose has become a key biological parameter in critical care since publication of the study conducted by van den berghe and colleagues , who demonstrated decreased mortality in surgical intensive care patients in association with tight glycaemic control ( tgc ) , based on intensive insulin therapy . however , two negative studies were recently reported , which were interrupted early because of high rates of severe hypoglycaemia , namely the visep study and the as yet unpublished glucontrol trial . hence , there is currently much debate regarding the actual benefits of such a strategy in intensive care patients in terms of outcomes . it is also uncertain whether the results of the ongoing multicentre , open label , randomized controlled trial nice sugar of the effects of blood glucose management on 90-day all - cause mortality in a heterogeneous population of intensive care unit ( icu ) patients will resolve remaining concerns about tgc in the icu . included among these concerns is the key issue of what is the most appropriate algorithm to achieve the desired blood glucose range . the major focus of the study conducted by chase and colleagues was on the method to achieve a predetermined blood glucose range by modulating both insulin infusion rate and nutritional inputs . as with the other reported studies comparing protocols , efficacy was evaluated by comparison with historical control patients . however , although the study reported by chase and coworkers was conducted with great care and rigour , it is but another case - control retrospective comparative study . nevertheless , there is a clear need to introduce efficient tools that will help clinicians and nursing staff to control blood glucose levels in icu patients , because hyperglycaemia superior to 10 mmol studies are required to provide clinicians with recommendations on the evaluation and comparison of the various protocols currently in use or that are soon to become available . benchmarking of tgc protocols must take in account all the dimensions of efficiency : performance , risk for severe hypoglycaemia , practical aspects ( ease of use , training time and required materials prior to implementation , error rate ) , integrated continuous monitoring , nursing workload ( evaluated on the mean time between controls ) . furthermore the best way to compare performance is controversial : is it the time with glucose within a common target range , the hyperglycaemia index , the recently described glycaemic penalty index , or the variability that would be associated with outcome ? this raises the question of whether the efficacy results from instructions regarding nutritional intake , allowing insulin infusion rates to be limited to a level lower than usual , or from the intrinsic quality of the algorithm used , which is based on the glucose - insulin regulatory system model ( capturing insulin utilization rate , insulin losses and saturation dynamics ) . also , sprint is apparently associated with few severe hypoglycemia events , which contrasts with the high rate of severe hypoglycaemic episodes reported in the second leuven study . finally , sprint should be relatively simple to implement in numerous icus as a paper - based protocol , presented in an original form using a wheel , without need for computational resources . weaknesses of sprint rest in its inability to monitor parameters related to the quality of glucose control as sprint is a paper - based protocol . most importantly , despite the favourable subjective opinions of care givers , sprint may not reduce workload because it requires measurements every hour or 2 hours . ultimately , evaluation of any tgc protocol must also include an assessment of its ability to be implemented easily and safely in another icu that did not participate in its development . the monocentric study of chase and coworkers may not ensure the ' exportability ' of their tgc protocol . the debate continues about the real benefits of tgc , with numerous questions being asked . what is the optimal target range ? which patients will benefit the most ? when during the icu stay should tgc be applied and to derive which benefits ? which is the best method to control glucose level intensive insulin therapy , and/or limitation of nutritional intakes during acute phase , and/or antidiabetic drugs ? however , the competition to develop the ideal tool with which to control blood glucose levels in the icu and perhaps throughout the hospital stay has begun , involving multidisciplinary teams of physicians and engineers who have specialized in control systems ( feedback control or model predictive control ) . icu = intensive care unit ; sprint = specialized relative insulin nutrition table ; tgc = tight glycaemic control . pk declares that he holds shares of lk2 ( saint - avertin , france ) .

objective : to identify the possible barriers to the implementation of pharmaceutical care among community and hospital pharmacists in enugu state using nsukka and enugu metropolis as a case study.method:a semi structured questionnaire was designed to carry out a cross sectional descriptive study . the questionnaires were distributed to community and hospital pharmacists from designated areas during one of their quarterly meeting and their practice sites in 2009.results:eighty completed questionnaires were collected with 22.8% from community pharmacists , and 77.2% from hospital pharmacists . the important barriers identified were lack of space , enough personnel in pharmacy to handle routine technical tasks , time , need for too much effort , and need for payment for services.conclusion:the opinions on barriers to pharmaceutical care of pharmacists from community and hospital practice areas in these two metropolises of enugu state are majorly lack of time , space and routine technical task personnel .

please summarize the articles given below

foot and mouth disease ( fmd ) is one of the highly contagious diseases of domestic animals , caused by foot - and - mouth disease virus ( fmdv ) , a member of the family picornaviridae , which has a colossal global impact , due to the huge number of animals affected . the fmd endemic countries collectively contain three - quarters of the world 's population ( robinson et al . , 2011 ) , indicating the global economic significance of the disease . at the national level in india , annual total economic loss due to fmd ranges from rs 12,000 crore to rs 14,000 crore ( singh et al . , 2013 ) . in spite of all the control measures taken , fmd continues to be an economically important disease in india due to poor surveillance and inadequate control programs . understanding of the mechanism of foot - and - mouth disease virus ( fmdv ) infection and replication of this virus is important to the control of this worldwide menace ( alexandersen et al . , 2003 , longjam et al . , 2011 ) . a vital question that has yet to be addressed concerns the role of viral receptors in the pathogenesis of fmd . integrins are the biologically important set of proteins used by the cells to bind and respond to the extracellular matrix which belong to a large family of integral membrane receptors that is required for cell adhesion . functionally active integrins consist of two noncovalently bound transmembrane glycoprotein subunits viz , alpha ( ) and beta ( ) ( springer , 2002 ) . evidence suggested that virus binding and infection of the integrin 6 ( itgb6 ) transfected cells are mediated through an rgd - dependent interaction ( baxt and becker , 1990 , jackson et al . , 2000 , mason et al . , 1994 ) . considering the role of host itgb6 receptor gene , the aim of the present study was to screen genetic variation within a snp ( rs136500299 ) at exon 14 region among different indigenous cattle . the polymorphism t / c is located at position 2145 of the reference itgb6 mrna and produces a missense change phe / ser in the position 667 of the polypeptide . previously , this polymorphism has been reported at least ten times : ss250661448 , ss263658018 , ss415630763 , ss420604742 , ss422472086 , ss679762826 , ss752601716 , ss828200981 , ss907724252 , and ss942564461 . in this study , we describe an accurate method on the basis of competitive polymerase chain reaction ( pcr ) so called tetraplex arms pcr , for identification of the snp among different animals . for analyzing the scenario of targeted snp among different zebu cattle , a total of 148 animals of different indigenous breeds of cattle { sahiwal ( 51 ) , kankrej ( 48 ) , ongole ( 38 ) and gir ( 11 ) } from different agricultural zones were used in the study . blood samples were collected from all the animals by jugular vein puncture using sodium heparin ( 10 iu / ml ) as an anticoagulant . immediately after collection , blood samples were stored in a portable refrigerator at 4 c , transported to the laboratory , and stored at 80 c until dna extraction . chloroform extraction method ( sambrook and russell , 2001 ) and the purity of genomic dna was assessed spectrophotometrically . the tetra - primer pcr procedure ( ye et al . , 2001 ) was used for genotyping the snp ( rs136500299 ) at exon 14 region of itgb6 receptor gene . the method employs four primers to amplify a fragment from dna containing the snp and amplicons representing each of the two allelic forms . primers can be designed to amplify fragments of differing sizes for each allele band in order for them to be easily resolved using agarose gel electrophoresis . details of the primer used for the present study and the amplicon size for different genotypes were shown in table 1 . pcr was performed in a total volume of 25 l containing approximately 50 ng dna , 2.5 l of 10x buffer , 2.0 mm mgcl2 , 0.2 mm dntps , 5 pmol of each outer primers , 10 pmol of each inner primers and 1 u of taq polymerase ( sigma aldrich , usa ) . the polymerase chain reaction ( pcr ) protocol was 94 c for 5 min , followed by 35 cycles of 94 c for 30 s , annealing at 55 c for 30 s and 72 c for 30 s , and a final extension at 72 c for 10 min . the pcr products were separated on 1.0% agarose gel ( sigma aldrich , usa ) including 0.5 g / ml of ethidium bromide and photographed under gel documentation system ( alpha imager ep ) . validation of the three different genotypes was analyzed by cloning and sequencing the 433 bp pcr products for each genotype . gene ( allele ) and genotype frequencies of itgb6 receptor gene were calculated by direct counting method . the four populations were tested for hardy weinberg equilibrium using proc allele ( sas inst . cary , nc ) . the chi - square ( ) test was used to find the difference in genotype frequencies in different breeds . the present study was aimed to develop a single tube tetraplex pcr based genotyping assay for snp ( rs13650029 ) at exonic region of bovine itgb6 receptor gene . snp genotyping techniques depend on amplification of the target dna using pcr technique , but differ in the means of discerning between the different alleles , which involves significant post - amplification manipulations . for instance , the restriction fragment length polymorphism typing method based on digestion of amplified pcr products with suitable restriction endonuclease . another extensively used snp typing technique allele specific oligonucleotide ( aso ) melting involves lengthy blotting and hybridization techniques . tetra - primer arms pcr method described in the present context circumvents the limitations of the earlier mentioned techniques . the technique used in the present study involves a single step pcr protocol with two sets of primers to detect the different banding pattern , without the downstream processing like re digestion or hybridization . the primers were designed in such a way to amplify fragments of differing sizes for each allele , in order to resolve differentially in agarose gel electrophoresis . the method described in the present study is a simple , swift and cost - effective method for snp genotyping in large number of individuals ( ye et al . , 2001 ) . correspondence between arms pcr and sequencing confirmed three genotype pattern of the targeted snp at exon 14 region of bovine itgb6 gene among different zebu cattle breeds ( fig . 1 ) . genotyping revealed that , the genotype tt is widely distributed among the targeted zebu cattle breeds . the study revealed that the frequency of t allele was higher in indigenous populations compared to the c allele . this trend was mostly seen in all the breeds except sahiwal where the heterozygotic frequency was comparatively higher , even though the difference is not statistically significant ( table 2 ) . the test for hw equilibrium among different populations showed that all the breeds were under equilibrium with respect to the itgb6 receptor gene indicating the absence of aggressive selection i.e. selection primarily based on this gene ( p > 0.05 ) . the frequency of animals having cc genotype was lowest in all the four breeds . in order to study the variation in the genotype frequencies among different indigenous breeds of cattle , the result showed in table 3 indicates that the genotype frequencies were not statistically different ( = 7.900 , p = 0.2455 ) among the breeds indicating that all the populations are having similar genetic constitution with regard to the itgb6 receptor gene . the snp ( rs136500299 ) t / c located at position 2145 of the reference itgb6 mrna produces a missense change phe / ser . serine is a polar amino acid with its smaller size , whereas phenylalanine is an aromatic amino acid with complex structure . thus it may be presumed that changes of amino acid may alter the conformational changes of the itgb6 receptor coding polypeptide , which however , needs to be confirmed through further studies . the results of the present study suggest that t allele is widely distributed among the indigenous breeds of cattle which can be associated with the resistance to fmd virus , as the susceptibility to fmd virus is lower than the tauras breeds . however , studies with larger sample sets and wide range of cattle breeds are still needed to confirm the exact genetic distribution pattern of the snp . in early december 2013 , during the zikv outbreak , a 44-year - old man in tahiti had symptoms of zikv infection : asthenia , low grade fever ( temperature from 37.5c to 38c ) and arthralgia . eight weeks later , he described a second episode of symptoms compatible with zikv infection : temperature from 37.5c to 38c , headache on days 13 , and wrist arthralgia on days 57 . the patient did not seek treatment , thus biological samples were not collected during the first 2 periods of illness . the patient fully recovered from the second episode , but 2 weeks later he noted signs of hematospermia and sought treatment . because the patient had experienced symptoms of zikv infection some weeks before , he was referred to our laboratory in the institut louis malard , papeete , tahiti for zikv infection diagnostic testing . the medical questionnaire revealed no signs of urinary tract infection , prostatitis , urethritis , or cystitis , and the patient stated that he did not had any recent physical contact with persons who had acute zikv infection . we extracted rna using the nuclisens easymag system ( biomrieux , marcy letoile , france ) from 200 l of blood and from 500 l of semen and urine ; both were eluted by 50 l of elution buffer . we tested blood and semen rna extracts using real - time reverse transcription pcr ( rrt - pcr ) as described using 2 primers / probe amplification sets specific for zikv ( 3 ) . the rrt - pcr results were positive for zikv in semen and negative in blood , and confirmed by sequencing of the genomic position 8581138 encompassing the prm / e protein coding regions of zikv . the generated sequence ( genbank accession no . km014700 ) was identical to those previously reported at the beginning of the zikv outbreak ( 3 ) . three days later , we collected a urine sample , then a second set of blood and semen samples . semen and urine from this second collection were not found to contain traces of blood by both direct and macroscopic examinations . rrt - pcr detected zikv rna in the semen and urine , but not in the blood sample . we quantified zikv rna loads using an rna synthetic transcript standard that covers the region targeted by the 2 primers / probe sets . rna loads were : 2.9 10 copies / ml and 1.1 10 copies / ml in the first and second semen samples , respectively , and 3.8 10 copies / ml in the urine sample . we cultured semen and urine as described for dengue virus cultured from urine ( 6 ) . briefly , 200 l of each sample diluted in 200 l of 1% fetal calf serum ( fcs ) minimum essential medium ( mem ) were inoculated onto vero cells and incubated for 1 h at 37c ; inoculum was then removed and replaced by 1 ml of culture medium . we also inoculated a negative control ( 200 l of 1% fcs - mem ) and a positive control ( 5 l of a zikv - positive serum diluted in 200 l of 1% fcs - mem ) . the presence of zikv in the culture fluids was detected by rrt - pcr as described . replicative zikv particles were found in the 2 semen samples but none were detected in the urine sample . ( 7 ) , but perinatal transmission ( 8) and potential risk for transfusion - transmitted zikv infections has also been demonstrated ( 9 ) . ( 10 ) , who described a patient who was infected with zikv in southeastern senegal in 2008 . after returning to his home in colorado , united states , he experienced common symptoms of zikv infection and symptoms of prostatitis . four days later , he observed signs of hematospermia , and on the same day , his wife had symptoms of zikv infection . because the wife of the patient had not traveled out of the united states during the previous year and had sexual intercourse with him 1 day after he returned home , transmission by semen was suggested . zikv infection of the patient and his wife was confirmed by serologic testing , but the presence of zikv in the semen of the patient was not investigated . infectious organisms , especially sexually transmitted microorganisms including viruses ( human papillomavirus or herpes simplex virus ) , are known to be etiologic agents of hematospermia ( 11 ) . to our knowledge , before the report of foy et al . ( 10 ) and this study , arbovirus infections in humans had not been reported to be associated with hematospermia , and no arboviruses had been isolated from human semen . we detected a high zikv rna load and replicative zikv in semen samples , but zikv remained undetectable by rrt - pcr in the blood sample collected at the same time . these results suggest that viral replication may have occurred in the genital tract , but we do not know when this replication started and how long it lasted . the fact that the patient had no common symptoms of zikv acute infection concomitantly to hematospermia suggests that the viremic phase occurred upstream , probably during the first or second episode of mild fever , headache , and arthralgia . the detection of zikv in both urine and semen is consistent with the results obtained in a study of effects of japanese encephalitis virus , another flavivirus , on boars . the virus was isolated from urine and semen of experimentally infected animals , and viremia developed in female boars that artificially inseminated with the infectious semen ( 12 ) . flaviviruses have also been detected in urine of persons infected with west nile virus ( wnv ) . wnv rna was detected in urine for a longer time and with higher rna load than in plasma ( 13 ) . wnv antigens were detected in renal tubular epithelial cells , vascular endothelial cells , and macrophages of kidneys from infected hamsters ( 14 ) , suggesting that persistent shedding of wnv in urine was caused by viral replication in renal tissue . dengue virus ( denv ) rna and denv nonstructural protein 1 antigen were also detected in urine samples for a longer time than in blood , but infectious denv has not been isolated in culture . concluded that the detection of denv by rrt - pcr was useful to confirm denv infections after the viremic phase ( 6 ) . also , yellow fever virus rna was isolated from the urine of vaccinated persons ( 15 ) , and saint louis encephalitis viral antigens , but not infective virus , have been detected in urine samples from infected patients ( 10 ) . furthermore , the observation that zikv rna was detectable in urine after viremia clearance in blood suggests that , as found for denv and wnv infections , urine samples can yield evidence ofzikv for late diagnosis , but more investigation is needed .

the present study was aimed to screen genetic variation within a snp ( rs136500299 ) located at exon 14 region of bovine itgb6 gene among different zebu cattle breeds . the genotyping method describe in the present study is a tetraplex arms pcr , which offers extremely fast , economical , and simple detection tool . the distribution of the itgb6 genotypes among the different breeds studied suggested that the populations were under hardy weinberg equilibrium . our findings revealed that tt genotypes are widely distributed among different zebu cattle breeds , which can be associated with the resistance to fmd virus , as the bos indicus are more resistant to fmd virus in comparison to bos taurus .

please summarize the articles given below

repair of anorectal malformation ( arm ) with rectourethral ( ru ) fistula involves the separation of two systems . this involves risk of injury to the urethra , ureters , seminal vesicles , bladder , and important nerves responsible for urinary control and sexual function . group a included patients of arm with ru fistula who had undergone posterior sagittal anorectoplasty ( psarp ) without closure of ru fistula , from february 2006 to january 2010 . the rest of the psarp procedure was the same as conventionally done , the only difference being that we did not close the ru fistula after separating it from the rectum . we just separated the rectum from the urethra and left the urethral fistula as it is without closing it . group b included 34 previous successive patients who had undergone psarp before january 2006 in whom the ru fistula was closed using interrupted sutures . all the patients in both the groups had undergone staged repair of arm and not primary psarp . micturating cystourethrogram ( mcu ) and distal colostogram was done in all these patients prior to psarp . all the patients were evaluated during follow - up both clinically and with investigations like mcu and cystoscopy . the patients were studied for parameters like urinary stream , urinary dribbling , urinary tract infections , and recurrent ru fistula . moreover , all patients had undergone urethrocystoscopy three months after psarp to check for the status of the urethra and bladder . patients who had sacral agenesis were excluded from the study group because such congenital sacral defects can lead to a neurogenic bladder . the following were the observations in group a ( a ) in the immediate postoperative period , there was no urinary leakage , urinary retention , or any other complication ; thus all these patients had an uneventful recovery . ( b ) urinary stream was normal ; there was no evidence of urinary dribbling or retention , urinary tract infection , and recurrent rectourinary fistula during follow - up . mcu showed normal urethra , without any evidence of stenosis or stricture , urethro - ejaculatory duct / vasal reflux , or diverticulum in any of the cases . however , in group b , complications like urethral stenosis , urethral diverticulum , and neurogenic dysfunction were seen . a comparative analysis of the two groups was done and overall complications were listed [ table 1 ] . during psarp , urological injuries in male patients are known complications.[13 ] excessive traction on the urethra during dissection leads to transection or injury to the urethra . it is extremely important for the surgeon to bear in mind that in arm with ru fistula , the rectum is intimately attached to the urethra and that meticulous dissection and separation are necessary . urethral stenosis can occur due to traction on the ru fistula , that is , indirect traction on the urethra during separation and closure of fistula . urethral stenosis can be avoided by applying less traction on the fistula during separation and avoiding the closure of fistula ; we have seen in our series that urethral stenosis was not seen in any of the cases of group a , where the ru fistula was not closed . closing another point to note is that if we separate the rectum from the urethra very near the urethral wall and use interrupted sutures for its closure , it also increases the chances for urethral stenosis . urethral stenosis due to ligation or closure of the ru fistula may result in recurrent epididymo - orchitis . urethral diverticulum is the result of a segment of the rectum left attached to the urethra and the separated end closed . such patients usually present with recurrent urinary tract infections , stone formations in diverticulum again leading to dysuria , urinary tract infections , and so on . this complication can be avoided by separating the rectum away from the urethra without leaving any segment of the rectum attached and leaving the fistula as it is without closing it , so that nothing like a pouch / diverticulum is formed . neurogenic dysfunction after psarp has been reported in the form of neurogenic bladder , impotence , or loss of ejaculation . postoperatively , a neurogenic bladder may reflect a poor surgical technique with denervation of bladder and bladder neck during repair . by avoiding the closure of the ru fistula , we can avoid excessive traction on the fistula and hence on the urethra , and also prevent the excessive dissection during fistula closure and minimize the chance of neurogenic dysfunction . damage to the external vesical sphincter has also been reported during ligation or closure of the fistula . thus by avoiding closure of the fistula , we avoid this complication also and , hence , neurovesical dysfunction . thus we have seen that by not doing something , that is , by not closing the ru fistula during psarp , we can avoid many complications ; so , not doing something is preferable here .

aim : to study the effect of nonclosure of rectourethral ( ru ) fistula and to do a comparative analysis of the complications with and without nonclosure of ru fistula during posterior sagittal anorectoplasty ( psarp ) in anorectal malformation cases ( arm).materials and methods : a total of 68 cases of arm were included in the study group , of which 34 cases were those in whom ru fistula was not closed ( group a ) during psarp . another 34 successive cases were included in study group b in whom the ru fistula was closed as is conventionally done by using interrupted sutures.results:comparatively , group a had none or minimum urological complications as compared to group b.conclusion:ru fistula closure is not mandatory during psarp and nonclosure avoids urological complications . it especially avoids urethral complications , which are 100% preventable .

please summarize the articles given below

allogeneic bone marrow transplantation ( bmt ) is widely used in the treatment of various hematologic disorders , such as leukemia and aplastic anemia , and the major complication of bmt is graft - versus - host disease ( gvhd ) . we discuss whether autologous melanocyte transplantation is an appropriate way as a treatment of the vitiligo after allogeneic bmt . in this report we describe a patient with hodgkin 's lymphoma who developed universal vitiligo after allogeneic bmt from his sister . he underwent four times melanocyte - keratinocyte transplantation ( mkt ) for the treatment of vitiligo ; all treated depigmented patches had a significant repigmentation . an 18-year - old patient was diagnosed with epstein - barr virus - related hodgkin - like lymphoma in 2003 , and antivirotic had been used to control his lymphoma , but the treatment was ineffective . then in march 2009 , he received the histocompatibility leukocyte antigen ( hla)-matched allogeneic bmt from his sister . cyclosporine and methotrexate were used as a prophylaxis strategy to prevent gvhd for 6 months after the allogeneic bmt . during the 6-month recovering period , the patient developed a small erythematous rash , which was consistent with the clinical features of graft - versus - host disease ( gvhd ) of the skin . no external agents were used and the rash dissipated in a short period of time . small depigmented macules started to appear on his cheek 11 months after allogeneic bmt in february 2010 , and followed by rapid progression to the whole body from the face to hands within 1 month . we indicated it to be a typical universal vitiligo by the reason that the depigmentation macules had a chalky white appearance under wood 's light . moreover , leukotrichia appeared at the same time associated with his vitiligo , affecting back and arms [ figure 1 ] . the patient with extensive vitiligo of the back and arms the depigmentation macules did not expanded any more after he received whole - body nb - uvb therapy twice a week for 2 months . simultaneously , following the doctor 's advice , 0.1% tacrolimus was used and traditional chinese medicine was orally taken . the patient underwent the therapies mentioned above for 8 months in total , but with poor repigmentation . then he discontinued medical therapies and performed non - cultured mkt on january 17 , 2011 , including left forehead and temple [ figure 2 ] . almost complete repigmentation was shown after 8 months since the first transplantation [ figure 3a ] . then he received mkt on his right face on september 29 , 2011 . and 8 months after the second mkt , 28 months after the first - time transplantation , all of the transplanted areas had almost completely repigmented and the color of the repigmented area matched with the normal surrounding skin excellently [ figure 3c ] . then the patient underwent the third and the fourth mkt procedure on the right and the left side of his neck respectively on may 28 , 2012 and january 22 , 2013 [ figure 4a ] . significant improvement was shown in the area around the left side of his neck while there 's also a majority repigmentation on the right side [ figure 4b and c ] . no hyperpigmentation , scar , infection and any other adverse effects on both recipient and donor sites by now were noticed . leukasmus involving the face symmetrical , around the nose , eyes and mouth repigmentation of vitiligo by mkt on his face . ( c ) 28 months after the first time transplantation , significant repigmentation obtained and normal skin achieved mkt performed on his neck . ( b ) 12 months after the surgery of right neck showing nearly 100% repigmentation . vitiligo is a most common depigmentation disorder and affects 0.5 - 2.0% of the world population . the etiology of vitiligo remains obscure , the most prevalent hypothesis today considers vitiligo as an autoimmune disease and focuses on a melanocyte - specific cytotoxic t - cell immune reaction in the destruction of melanocytes . supported that there perhaps be four explanations for the development of vitiligo after bmt , such as the destruction of melanocytes stimulated by pretransplantation chemotherapy and radiotherapy , chronic gvhd , infusion of a larger number of lymphocytes and adoptive passive transfer from the donor to the recipient . in the case of our patient , vitiligo might be a result of an immune response directed against the melanocyte destruction initiated by gvhd . there are reported cases about allogeneic posted - bmt vitiligo . but most of the pre - bmt diagnosis were chronic myelogenous leukemia , none of them were diagnosed with hodgkin 's lymphoma as our report . in terms of treatment during those cases , just partial of them accepted therapies , but none of them performed with transplantation . in the bmt context , the extensive and relentless vitiligo progression indicated an aggressive alloimmune process , so the destruction of melanocyte is alloimmune in nature . there was no report to make discriminate of melanocyte destruction between alloimmune and autoimmune , but au et al . proposed the success of melanocyte autografts for autoimmune vitiligo could be used in an alloimmune setting . therefore , we came up with the idea of vitiligo melanocyte transplantation while other treatment was invalid for the patient . melanocyte grafting technique include cultured autologous melanocyte suspension transplantation and autologous noncultured melanocyte - keratinocyte . in our report , the patient obtained universal vitiligo after allogeneic bone marrow transplantation for hodgkin 's lymphoma . in the condition of vitiligo failed to respond to non - surgical treatment , the patient underwent four times of mkt during 2 years . the largest area of treated lesions was 50 cm ; repigmentation rate achieved more than 95% after each transplantation without any adverse effects or koebner 's phenomenon . the pattern of the repigmentation was uniform in the first three times mkt but diffuse in the last one ; whatever , more follow - up time is needed in the future . after 2 years of follow - up , graft sites still repigmented obviously , and the color was similar to the surrounding normal skin which illustrated mkt can treat allogeneic vitiligo successfully . this is the first time to report about treating vitiligo after allogeneic bone marrow transplantation by mkt . we suggest that autotransplantation especially autologous grafting with noncultured melanocyte is simple , safe , and inexpensive for remedying the loss of melanocyte after bmt in the case of depigmented macules is stable . but whether the melanocyte transplantation used in alloimmune vitiligo is effective as in autoimmune , we need more follow - ups . this is the first time to report about treating vitiligo after allogeneic bone marrow transplantation for hodgkin 's lymphoma by non - cultured melanocyte - keratinocyte transplantation without koebner 's phenomenon and adverse effects but all successful . it probably suggests that therapy of transplantation can be used in the treatment of vitiligo after allogeneic bone marrow transplantation .

defining alterations in signalling pathways in normal and malignant cells is becoming a major field in proteomics . a number of different approaches have been established to isolate , identify and quantify phosphorylated proteins and peptides . in the current report , a comparison between scx prefractionation versus an antibody based approach , both coupled to tio2 enrichment and applied to tmt labelled cellular lysates , is described . the antibody strategy was more complete for enriching phosphopeptides and allowed the identification of a large set of proteins known to be phosphorylated ( 715 protein groups ) with a minimum number of not previously known phosphorylated proteins ( 2 ) .

please summarize the articles given below

spondylolisthesis is defined as an anterior migration of a vertebral body in relation to the vertebra located immediately caudal . in 1930 junghanns was the first to describe anterior translation of a lumbar vertebra without any defect in the neural arch following this the term degenerative spondylolisthesis ( ds ) was introduced by newman in 1955 . five types of spondylolisthesis have been described including dysplastic , isthmic , traumatic , pathologic , and degenerative . there are many predisposing factors like sagittally - placed facet joint , a high iliac crest [ 4 - 6 ] , etc . ds which is characterized by an intact vertebral ring is presumed to result from degeneration of facet joints and intervertebral discs with aging and thus has traditionally been considered to represent instability of the vertebral segment . a 66-year - old gentleman , farmer by occupation , came with complaints of lower backache for 2 years which was insidious in onset , gradually progressive and non - radiating . he also complained of acute retention of urine since 15 days for which he was catheterized . he also had a history of neurogenic claudication at a distance of 100 m. there was no history of any trauma . a detailed systemic and neurological examination revealed power of flexor hallucis longus(fhl ) and flexor digitalis longus(fdl ) as 4/5 , ankle jerks were absent , sensory deficits in s1-s2 dermatome and per - rectal examination revealed decreased perianal sensations and anal tone with absent anal wink . plain radiographs of lumbo - sacral spine revealed spondylolisthesis of s1-s2 ( meyerding s grade 1 ) ( fig.1 ) . magnetic resonance imaging and computed tomography scan of the spine revealed lumbarization of s1 with spondylolisthesis of s1 over s2 , facetal hypertrophy at l5-s1 and canal stenosis at s1-s2 ( figs . 2 , and 3 ) . anteroposterior ( a ) and lateral ( b ) radiographs showing grade 1 spondylolisthesis ats1-s2b . the patient underwent posterior spine surgery where decompression was done with laminotomy of s1 bilaterally and then pedicular screw fixation was done bilaterally at l5 , s1 , and s2 ( fig.4 ) . s1 and post - operative radiographs - anteroposterior ( a ) and lateral ( b ) view . the bladder symptoms disappeared after 3 weeks and the power of fhl / fdl improved from 4/5 to 5/5 . the patient underwent posterior spine surgery where decompression was done with laminotomy of s1 bilaterally and then pedicular screw fixation was done bilaterally at l5 , s1 , and s2 ( fig.4 ) . s1 and post - operative radiographs - anteroposterior ( a ) and lateral ( b ) view . the bladder symptoms disappeared after 3 weeks and the power of fhl / fdl improved from 4/5 to 5/5 . the patient underwent posterior spine surgery where decompression was done with laminotomy of s1 bilaterally and then pedicular screw fixation was done bilaterally at l5 , s1 , and s2 ( fig.4 ) . s1 and post - operative radiographs - anteroposterior ( a ) and lateral ( b ) view . the bladder symptoms disappeared after 3 weeks and the power of fhl / fdl improved from 4/5 to 5/5 . the deformity occurs at l4 - 5 6 times more often than at other lumbar levels and four times more often above a sacralized l5 . the lumbosacral junction and middle lumbar spine are most often involved , but the lesion is also found in cervical or rarely the thoracic vertebra . to the best of our knowledge , ds of sacral vertebrae has not been reported in the available english literature till now . the prevalence of complete lumbarization is 1.8% and to get a spondylolisthesis is even rarer . there have been many publications in the literature mentioning incidence of spondylolisthesis with sacralization but hardly any on spondylolisthesis with lumbarization . further case series or longitudinal studies of such cases may help understand better the pathomechanics related to spondylolisthesis at this level . ds of s1-s2 is a very rare entity and further case reports will help us to explore the biomechanics at this level . organic foreign bodies are generally associated with severe inflammatory reaction and infection , while the nature of reaction elicited by inorganic foreign bodies depends on the material of the foreign body . graphite , which is the major constituent of pencil lead , has been reported to remain inert in the eye for a long time . however , it has also been reported to cause severe endophthalmitis - like reaction in the eye . we report a rare case of retained graphite pencil tip in the anterior chamber of a six - year - old girl . a six - year - old girl presented to us with history of mild pain in the left eye of two days duration . the child s mother gave a history of trauma with a graphite lead pencil about four months ago at school when she was accidentally poked in the left eye by another child . the child had not been examined by an ophthalmologist after the incident as she was apparently asymptomatic at the time . on examination , the best corrected visual acuity was 20/20 in the right eye and 20/40 in the left eye . there was a full thickness corneal scar ( figure 1 ) in the left eye . a small area of iris atrophy with a sphincter tear was noted at the edge of the pupil at the 6 o clock position . there was a black foreign body resembling a graphite pencil lead tip , measuring about 1.5 mm in size , on the iris at the 7 o clock position ( figure 1 ) . ocular ultrasonography of the left eye did not reveal any abnormality in the posterior segment . figure 1slit lamp photograph of the left eye showing the corneal scar and the graphite pencil lead tip on the iris . slit lamp photograph of the left eye showing the corneal scar and the graphite pencil lead tip on the iris . a corneal incision was made at 5 o clock position with a 2.8 mm keratome . the anterior chamber was filled with 2% methyl cellulose and the foreign body ( figure 2 ) was removed in toto with a bechert - mcpherson forceps . the remaining graphite particles were aspirated out with a simcoe cortex aspiration cannula using an anterior chamber maintainer . post - operatively , the patient was put on tapering doses of topical steroids and cycloplegics . on follow up , one month later , the best corrected visual acuity in the left eye was 20/40 . there was no inflammation ; the lens was clear and the fundus was normal . the reaction of the eye to a retained intraocular foreign body varies depending on its composition . foreign bodies comprised of materials like gold , silver and platinum have been reported to remain inert in the intraocular environment . there are only a few reports of ocular trauma with retention of graphite pencil lead in the eye . retained graphite has been described in the conjunctiva , cornea , angle of the anterior chamber and the posterior segment . a case of pencil - tip injury to the orbit with retained graphite foreign body associated with delayed orbital infection has also been described . however , the potential toxicity of the other constituents of pencil lead like animal fats and clay is not clearly known . there has been a report of severe endophthalmitis - like reaction incited by retained graphite foreign bodies in the vitreous . in this case , it is unclear whether the reaction was induced by the other constituents of pencil lead like the aluminium in the kaolinite or if there was an associated infection . in our case , we decided to surgically remove the intraocular foreign body in spite of the fact that it had obviously remained in the eye for some time ( as evidenced by the healed corneal scar and presence of iris atrophy ) without inciting an inflammatory response or causing much damage to the intraocular structures . there was a distinct possibility of causing damage to the lens and inciting an inflammatory reaction during surgical removal of the foreign body . this risk had to be weighed against that of the damage the foreign body might cause if it was left in the eye . there was a chance that the foreign body would get dislodged into the angle at a later stage and cause progressive damage to the angle structures and the cornea as in the case reported by han et al . honda et al . have reported a case of a five - year - old child with a graphite foreign body lodged in the peripheral retina , whom they followed up for six years with serial electroretinograms , fundus photographs and fundus fluorescein angiography . there was no evidence of any damage to the eye caused by the foreign body at the end of their follow up . however , in our case , such meticulous follow - up would have been quite impossible as the child s family belonged to a poor socio - economic background and the parents would not have been able to afford the cost of repeated hospital visits and investigations . our case also differed from honda et al.s case in that the foreign body was in the anterior segment and therefore , was at a more accessible site . there was a higher chance of removal of the foreign body without causing damage to the intraocular structures in our case . in conclusion , graphite foreign bodies may be retained in the eye without causing any inflammation or damage to the intraocular structures . on the other hand , there is also the possibility of progressive damage to intraocular structures by these foreign bodies due to various mechanisms . therefore , the decision about surgical removal of the foreign body has to be made on an individual basis after taking multiple factors into consideration and estimating the risk - benefit ratio in each patient .

introduction : degenerative spondylolisthesis ( ds ) is usually seen at l4-l5 level and less frequently at l5-s1 level . this is a rare case report of spondylolisthesis of s1 over s2 with lumbarization of s1 . lumbarization of s1 is seen in just 1 - 2% of the population and to have spondylolisthesis in this segment is even rarer . the purpose is to report a rare case of ds at s1-s2 level.case report : this is a single case report of a 66-year - old gentleman who presented with complains of lower backache for 2 years and acute retention of urine to the emergency department . detailed clinical and radiological evaluation of the spine was done which revealed lumbarization of s1 with spondylolisthesis at s1-s2 and facetal hypertrophy at l5 , s1 , and s2 . he underwent decompression and stabilization at l5 , s1 , and s2 along with placement of autologous bone graft . the bladder symptoms disappeared after 3 weeks . at 1-year follow - up , patient s clinical symptoms were relieved , and he improved clinically.conclusion:to the best of our knowledge , this is probably the first case of ds of sacral vertebrae to be reported in english literature . the prevalence of complete lumbarization is around 1.8% and to get spondylolisthesis in this segment is even rarer , hence the lack of literature in this regard . since this is the first of its kind of case , further case series or longitudinal studies of such cases may help understand better the pathomechanics related to spondylolisthesis at this level .

please summarize the articles given below

an individual , as a consumer researcher , wants to buy a refrigerator . with appliances of most sorts , people regard best practice decision making as consulting trustworthy comparison websites and magazines , ones that go beyond expressing opinions , or recording likes , to numerically rate the alternative products on a set of attributes or criteria . they want these decision support tools to give them ratings that can be trusted because they are produced free of any conflict of interest or other biases the consumer does not know , and does not want to know , why this refrigerator is given a 4*/80% rating on reliability , and a 3*/60% rating on environmental impact , and another one the opposite ratings . feeling justified in assuming a common sense , lay understanding of the terms reliability and environmental impact , they do not have neither the time nor motivation to find out more about what these concepts mean , in terms of the mechanical functioning of the refrigerator , the quality of its components , the emissions it produces or whatever else contributes to these ratings made by the expert assessors some may wish to establish whether consumers have made an informed decision by seeing how well they score on a test of refrigerator knowledge . giving considerable and fixed weight to knowledge in their measures of decision quality , consumers decisions might be regarded as poor quality , because their knowledge sub - score is low . in contrast , consumers may regard themselves as having made good decisions , indeed the best possible decisions they could make , given the time and cognitive effort they are willing to devote to research into the decision - making process including accessing and accumulating knowledge deemed important , even essential , by others . but surely health care decisions are different from buying refrigerators ? choosing between surgery and medical options for newly - diagnosed cancer , or pain management for chronic osteoarthritis , is not like buying a household appliance , is it ? in fact , nothing really changes for the individual , whom we now conceptualize as a researcher conducting a continuing , informal n - of-1 study into his / her health . the affective and emotional differences between the two situations may well produce differences in the decision - making process , but the patient accepts that this will not necessarily enhance the quality of the decision as he / she defines it . patients may become interested in finding out more about their medical condition than they would about refrigerators , and actually do so . but unless it leads to a change in a performance rating for an available option on one of their criteria especially the bean for a criterion they weigh heavily the additional information they now possess is decision - neutral . people - as - researchers may feel better informed in some sense , but they realize they will not necessarily be in a position to make a better decision and therefore have not ended up more decisionally empowered . they may even simply have become more anxious and regretful about the opportunity costs of acquiring the information , in the form of the foregone benefits from other activities in which they could have engaged . informed decision ? according to themselves and us , absolutely , since they have consulted a transparent set of option performance ratings on relevant criteria , originating from a source that they have decided is the most trustworthy . their decision quality score may well be low according to an instrument that weights highly the knowledge that they are assumed by others to need to make an the growing number of condition - specific decision quality instruments being developed , notably by karen sepucha and colleagues , all give very heavy weight to a knowledge subcomponent . there could be no clearer confirmation of the issue at stake here than the title of one of the background papers to these projects : how does feeling informed relate to being informed? trust is crucial here . in either shared or unshared decision making , trust relates to the inputs into decision making , since we have left behind the notion of an agency relationship , previously dominant in conceptualising medical practice . trust is always a matter of degree , rather than a binary all or nothing , whether it relates to the beans provided by the clinician , or by a decision support tool . even if there is only one , dubious , source , it will be the most trustworthy . unless , that is , the person rates his / her own estimates as more trustworthy than the best source , since so we envisage an individual regarding the respected consumer magazine s beans on refrigerators as the most trustworthy in relation to that purchase decision . people s task in health care decisions , given a restricted willingness to devote time and energy to processing information , is to assess the trustworthiness of the available sources of beans for the outcomes and other criteria important to them . they would expect a clinician , or a team developing the ratings for a decision aid , to be highly trustworthy and to be provided with evidence for this , especially in the case of an aid . the key information the person - as - researcher requires is labelling that ensures he / she will get what it says on the tin when they open an aid . with this meta - information , they can make an informed choice about which tins of what size to open . the other major problem with any imposed information requirement is that it condemns many on the continuum of health literacy , and especially health numeracy , to receiving little or no help . we fully support attempts to reduce health illiteracy and innumeracy , especially their decision - focused forms . however , it is too much to expect of a decision support tool or a clinician to overcome the limitations of previous education and socialization in these respects . moreover , it is important to accept that even if aid users are able to register and report the relative numbers of sad and smiley faces in frequency diagrams , or repeat back 1 in x statements about which there is considerable doubt this does not in any way ensure that they can meaningfully incorporate the numerical probabilities they have correctly registered ( say 10% and .05% , or 1 in 10 and 1 in 2000 ) , into their decisions . this is not to say that a decision aid should not contain help in this respect , including guidance on how the person can best avail themselves of what it offers , and information on the bases of that offering . it is to suggest that much of this should be provided on an opt - in basis . nothing in what we have said is intended to imply that the community is not entitled to apply community - level criteria and weights to what it provides , or allows to be provided , to whom , under what conditions , and at what cost , in the pursuit of goals such as efficiency , equity and justice . formal laws and regulations ( including those on informed consent and clinician liability ) and resource allocation policies ( including reimbursement decisions ) will be the context in which the individual decision is made , and they will frequently be in conflict with what an individual sees as best for him / herself , given personal criteria and weights . external consequences for others may trump individuals preferences , as in the case of infectious diseases . trickier are the issues of social responsibility or morality which are not dealt with formally . apart from issues of environmental and social impact ( such as those arising from hormonal treatments and opioids ) , there are all those that arise in resource - constrained and interdependent systems simply as a result of those constraints and interdependencies . in these cases , we say two things . first , it is not the function of individual decision support tools to mandate the inclusion or exclusion of social criteria in an individual s set , such as concern for others health , or insist that these be given specific weights . second , that in order to be regarded as having made a high - quality decision , the individual should not be required to be informed about the social criteria they do select , other than having the processed beans available to them from a trustworthy source . normative checklists for decision support tools , such as those constructed in accordance with the guidelines of the ipdasi collaboration , are clearly intended to promote person - as - patient empowerment . but most decision aids that comply with these guidelines are designed for use only within the context of shared decision making , in which the person is assigned the status of patient . in many cases , the support can be accessed only within the clinical encounter , or with provider permission . they all perpetuate the idea that only a decision informed in a particular way and to a particular extent can be a good decision . we do not need the concept of an informed decision , only that of a good , better or best possible decision . for none of these will there be a definition that is not multi - dimensional and therefore preference - sensitive . there can only be one answer : the patient s or the person s if they are not a patient . pancreatic intraepithelial neoplasia ( panin ) is a nomenclature for microscopic proliferative epithelial lesions of the pancreas which was proposed in 2001 by hruban et al . . panin is assumed to be a precursor lesion of invasive ductal carcinoma ( idc ) . precursor lesions of idc also include intraductal papillary mucinous neoplasm ( ipmn ) and mucinous cystic neoplasm . panin is divided into three grades , panin-1 , -2 , and -3 , according to the cytological and architectural atypia . panin-1 is further subdivided into flat ( panin-1a ) and papillary types ( panin-1b ) . this hypothesis has arisen from the observation of the resected specimens , in which synchronous or metachronous occurrence of panin and idc were seen . panin had been reported to be more common in the pancreas with idc than without [ 2 , 3 ] . it has also been reported that idc occurred in the remnant pancreas several years after partial pancreatectomy for high - grade panin had been performed [ 4 , 5 ] . several studies have demonstrated higher frequencies of genetic alterations such as k - ras mutation or dpc4 inactivation in higher - grade panin lesions [ 6 7 8 9 ] . thus , it is hypothesized that pancreatic ductal lesions may progress from a histologically normal duct through flat lesion ( panin-1a ) , papillary lesion ( panin-1b ) , atypical lesion ( panin-2 ) to severely atypical lesion ( panin-3 ) . panin-3 is likely to develop eventually into idc because panin-3 and idc share critical genetic abnormalities . however , the histological evidence that panin-3 invades beyond the basement membrane of pancreatic ductal epithelium , that is , the moment panin-3 becomes idc , has not been captured yet . as defined by the consensus guideline , panin is a microscopic papillary or flat , non - invasive epithelial neoplasia that is usually < 5 mm in diameter . , panin-3 obstructed several branch pancreatic ducts and subsequently caused pancreatitis which developed clinical symptom and was detectable as a pancreatic mass on imaging studies . since pancreatic cancer was suspected , further examinations were performed . histological examination of the resected specimens showed panin-3 slightly invading beyond the basement membrane of the ductal epithelia accompanied by fibrotic changes caused by occlusion of branch ducts . a 65-year - old woman had been admitted to a former hospital for acute pancreatitis , which recurred 2 months thereafter . she was referred to our center for further examination of her pancreas after the second pancreatitis had been relieved . she was slightly thin , showing a body mass index of 20.2 , and had neither smoking nor drinking habits . laboratory data showed no abnormalities including serum levels of amylase and tumor markers related to pancreatic diseases . abdominal ultrasound revealed a low echoic mass of 13 mm in diameter in the pancreatic body without upstream dilatation of the main pancreatic duct ( mpd ) ( fig . endoscopic ultrasound showed a low echoic mass of 20 mm in diameter in the pancreatic body ( fig . since pancreatic cancer was suspected in the pancreatic body , she underwent endoscopic retrograde pancreatography , which showed a strictured segment of 2 mm in length in the mpd at the pancreatic body ( fig . cytological examination of the pancreatic juice obtained during endoscopic retrograde pancreatography revealed adenocarcinoma ( fig . 1 g ) . the patient was diagnosed with pancreatic body cancer without obvious vascular involvement ( t3 , n0 , m0 , stage iia , according to the uicc classification ) and underwent distal pancreatectomy . the resected specimens were fixed in formalin and cut at a slice thickness of 5 mm as shown in fig . histological examination revealed papillary growth of intraductal epithelia with significant nuclear atypia which was classified as panin-3 according to the definition of the consensus guideline mainly in the branch ducts ( fig . panin-3s were located separately in branch ducts with normal epithelia in the mpd between them ( fig . 2b , h , i ) , indicating that they originated from different sites of the branch ducts . histologically , this case was diagnosed as idc of the pancreatic body ( t1 , n0 , m0 , stage i ) . high - grade panin ( panin-3 ) is recognized as a best - defined precursor lesion of idc based on genetic as well as histological observations . panin-3 has been reported to share some genetic alterations with idc [ 6 7 8 9 ] and to be found usually in the pancreas with idc [ 2 3 4 5 ] . however , the direct evidence of the moment when panin-3 invades beyond the basement membrane to become idc has not been captured yet . this is the first case report in which microinvasion of panin-3 was histologically confirmed in the resected pancreatic specimens . considerable ambiguities had existed in the distinction between panin and ipmn , therefore the definitions of these two lesions were revised at the consensus meeting held at johns hopkins hospital in 2003 . according to the revised definitions , panin is a microscopic , papillary or flat epithelial neoplasm arising in the pancreatic duct and differs from ipmn , which is defined as a grossly visible , mucin - producing , predominantly papillary epithelial neoplasm . in this case , pancreatic epithelial neoplasm itself was not identified in any radiological examinations , and mucin production was not evident in pancreatic ductal epithelia by microscopic observation . a few reports had suggested that minimally invasive carcinoma should be distinguished from invasive ipmn because this subgroup of ipmn showed apparently better prognosis [ 11 , 12 13 ] . however , the precise definition of minimally invasive carcinoma has not been established [ 14 , 15 ] and has been recently proposed by some studies [ 16 , 17 ] . in this case , the patient has been alive without any signs of recurrence for more than 3 years . since there has been no concept of minimally invasive panin to date , this case is classified as idc in spite of excellent outcome . a new notion that minimally invasive panin should be distinguished from idc might be widely accepted in the future . in this case , panin-3 lesions were located separately in several branch ducts without involving the epithelia of the main duct between them . this fact indicates that panin does not arise from one small portion of pancreatic ductal epithelium and spread creeping along the epithelia , but arises multicentric . it is well known that ipmn , another precursor lesion of idc , occurs multicentric . as the whole pancreas may be involved in the genetic alteration which is related to carcinogenesis , it is not difficult to understand that panin occurs independently in different sites of the pancreas . several cases dealing with multiple occurrence of idc have been reported as rare clinical manifestation [ 18 , 19 ] . this observation could explain the rapid growth of pancreatic ductal carcinoma as follows : microinvasion initially occurs in several pancreatic ducts ; each invasion independently progresses and eventually makes a fusion mass . this observation could also explain the multiple occurrence of idc when microinvasions occur independently distinct from each other . unlike ipmn , panin-3 is hardly detected in clinical practice because panin-3 itself is not visible on imaging examination . in this case , panin-3 was successfully detected due to pancreatitis caused by the intraductal growth of panin-3 and subsequent occlusion of the pancreatic ducts . pancreatitis might be a candidate for the diagnostic clues to the early detection of pancreatic ductal carcinoma within the preinvasive stage . there are other known diagnostic clues to early detection , such as pancreatic cysts or dilatation of the mpd . in this case , however , neither pancreatic cyst nor dilatation of the mpd was observed . the detection of pancreatic ductal carcinoma in the preinvasive stage is the most promising way of improving patient survival . we hope that our report will contribute to the further understanding of early development of pancreatic ductal carcinoma .

most guidelines for clinical practice , and especially those for the construction of decision support tools , assume that the individual person ( the patient ) needs to be in possession of information of particular sorts and amount in order to qualify as having made an informed decision. this often implicitly segues into the patient having made a good decision. in person - centred health care , whether , in what form , and with what weight , information is included as a criterion of decision quality is a matter for the person involved , to decide in the light of their own values , preferences , and time and resource constraints .

please summarize the articles given below

ductal adenocarcinoma of the prostate was first reported by melicow and pachter in 1967 as an endometrial carcinoma prostatic utricle . since then , ductal adenocarcinoma of the prostate has been found to account for 0.27.5% of all prostate carcinomas . a 73-year - old man was referred to our hospital due to an elevated prostate - specific antigen ( psa ) level of 23.4 ng / ml . he had no remarkable medical history . the hematological and biochemical data showed no abnormal findings aside from the elevated psa levels . in february 2016 , a prostate needle biopsy detected gleason score 4 + 4 adenocarcinoma in his left prostate . computed tomography ( ct ) and magnetic resonance imaging ( mri ) showed a higher density on his left peripheral zone ( fig 1a , b ) . in may 2016 , radical prostatectomy with lymph node resection histologically , there were many large , clear - edged cells and cancer cells with low differentiation forming a circular shape . based on these findings , ductal adenocarcinoma and gleason score 4 + 4 = 8 acinar adenocarcinoma with positive surgical margin were diagnosed . the patient has not experienced recurrence or biochemical recurrence in the 10 months since radical prostatectomy . histologically , there were many large , clear - edged cells and cancer cells with low differentiation forming a circular shape . based on these findings , ductal adenocarcinoma and gleason score 4 + 4 = 8 acinar adenocarcinoma with positive surgical margin were diagnosed . no adverse perioperative events were observed . the patient has not experienced recurrence or biochemical recurrence in the 10 months since radical prostatectomy . ductal adenocarcinoma of the prostate was first reported as endometrial carcinoma of the prostatic utricle in 1967 . recent studies have suggested that ductal adenocarcinoma of the prostate developed from the ductal epithelium , based on findings from immunohistochemical and electron microscope analyses . histologically , ductal adenocarcinoma of the prostate is characterized by high cylindrical epithelium collate papillary or etat cribriform . the histological differences between ductal adenocarcinoma and acinar adenocarcinoma are thought to be clear . in this case , although the prostate needle biopsy showed acinar adenocarcinoma , the surgical specimens showed ductal adenocarcinoma . the first is a mixed type with acinar adenocarcinoma and accounts for < 75% of ductal prostate specimens . mixed - type ductal prostate adenocarcinomas account for 5.06.6% of all prostate cancer cases , and pure - type ductal prostate adenocarcinomas account for 0.40.8% of all prostate cancer cases . because ductal carcinomas account for 90% of all prostatic carcinoma cases , our case was assumed to be pure type . because of its extension toward the urethra , the tumor was not palpable on a digital rectal examination and showed a low psa level . ductal adenocarcinoma of the prostate usually extends toward the urethra and shows macrohematuria and urinary symptoms at an early stage . reported that ductal adenocarcinoma of the prostate showed a significantly poorer prognosis than acinar prostate adenocarcinoma in nonmetastatic cases . however , in metastatic cases , there were no prognostic differences between these 2 groups . other reports have found no marked differences in the 5-year survival rate between ductal adenocarcinoma and gleason score 810 acinar adenocarcinoma . reported therapies of ductal adenocarcinoma of the prostate are also the same as for acinar adenocarcinoma , including radical prostatectomy , androgen deprivation therapy , and radiation therapy or a combination of these therapies . reported that pure ductal adenocarcinoma tended to extend into the submucosal urethra ; as such , pure ductal adenocarcinoma carries a higher risk of a positive surgical margin in the urethra . although we are not performing adjuvant therapy in this patient at present , careful observation including ct , mri , or positron emission tomography - ct should be performed , as psa does not always accurately represent cancer progression . patients treated with salvage chemotherapy had a response rate of only 9% and a median time to tumor progression ( ttp ) of 9 weeks . although bevacizumab can offer a significantly higher response rate of 55% and a period of clinical stabilization with a median ttp of 26 weeks , the tumor remains in the brain and continues to proliferate despite clinical and radiological appearances of improvement . as a result , bevacizumab has a questionable impact on the overall survival of patients [ 3 , 4 ] . therefore , new and novel treatments are needed for patients with recurrent glioblastoma who failed initial treatment with radiotherapy and temozolomide . the novottf-100a device is a new treatment approved by the united states food and drug administration ( fda ) for recurrent glioblastoma . the device emits alternating tumor treating electric fields ( ttfields ) via 2 pairs of transducer arrays placed orthogonally on the scalp . the ttfields work by interrupting tumor cells during mitosis , resulting in violent blebbing during cytokinesis , asymmetric chromosome segregation , and aneuploidy [ 5 , 6 ] . these cell biology effects ultimately result in apoptosis or slippage into a g0 state of the tumor cell , while simultaneously making it susceptible to immunogenic cell death . in the pivotal phase iii clinical trial , the novottf-100a device had a similar efficacy when compared to salvage chemotherapy , but without the toxicities associated with systemic chemotherapies [ 7 , 8 ] . here , we report a patient who had failed bevacizumab therapy for a recurrent cystic glioblastoma and , at the time of bevacizumab continuation , received add - on ttfields therapy by using the novottf-100a device . this treatment combination eventually resulted in the disappearance of cystic enhancement together with a marked reduction of the cyst size and the cerebral edema in the surrounding brain . the patient is a 76-year - old right - handed woman who came to the brain tumor center for an evaluation of her recurrent glioblastoma after bevacizumab failure . her initial neurological problems occurred 9 months prior to presentation and consisted of mental confusion and comprehension problems manifesting as a fluent aphasia . a gadolinium - enhanced head mri at an outside hospital showed a cystic enhancing mass in the left temporal lobe of the brain . she then received 6 weeks of external beam fractionated radiotherapy to 6,000 cgy ( 200 cgy in 30 fractions ) with concomitant daily temozolomide at 75 mg / m , followed by adjuvant temozolomide 200 mg / m for 5 days on a monthly basis . after 5 cycles of adjuvant temozolomide , new cystic enhancement was discovered while performing a head mri ( fig . 1a , b ) , and she was placed on 4 mg of dexamethasone 4 times / day . bevacizumab was subsequently started at a dose of 10 mg / kg every 2 weeks . after 2 cycles of bevacizumab , there was only a partial decrease in the gadolinium enhancement and the size of the cystic tumor ( fig . additional pathology testing revealed a negative idh1 immunohistochemical labeling but a positive olig2 , egfr amplification and methylated mgmt promotor status . because ttfields interrupt tumor cells during mitosis and have no appreciable overlapping toxicity with bevacizumab , we proceeded to add to her bevacizumab treatment ttfields therapy using the novottf-100a device . the treatment compliance was recorded by sensors , embedded within the transducer arrays and can be downloaded by computer for review in clinic visits . after a total of 6 cycles of bevacizumab plus ttfields therapy , with a respective mean and median compliance of 17.6 hours ( 73% of the day ) and 18.4 hours ( 77% of the day ) ( range 3.6 to 22.8 h ) , there was a near complete resolution of gadolinium enhancement and a 65% reduction in the size of the cystic tumor ( fig . 1e , f ) . however , there were also recurrent tumors detected in the left internal capsule and the medial left frontal brain ( fig . 2a , b ) , which were located outside of the prior radiation treatment fields . therefore , the recurrent tumors were treated with fractionated cyberknife radiosurgery to 2,100 cgy ( 700 cgy in 3 fractions ) . despite this radiosurgery intervention , the patient continued to deteriorate neurologically and her deterioration was most likely caused by the microscopic invasive glioblastoma . she eventually died 15 months after her first recurrence and 22 months after initial diagnosis . the addition of novottf-100a to bevacizumab therapy in our patient appears to be safe and may provide added efficacy after initial incomplete response to bevacizumab alone . the rationales to combine ttfields therapy with bevacizumab are threefold . first , there is no overlapping side effect and , therefore , this combination does not appear to cause synergistic or additive toxicities . in patients with glioblastoma , we retrospectively analyzed 20 patients treated with this combination and found no instance of intracranial hemorrhage . other treatment side effects are minor in severity and they include the expected scalp rash , electric shock sensation from poorly applied transducer arrays and vivid dreams , all of which resolved upon the application of corticosteroid cream and adjustment of the arrays . second , ttfields therapy mimics the effects of chemotherapy by interference with tumor cell mitosis while not having the conventional side effects of chemotherapy [ 5 , 7 ] . when first approved by the fda , bevacizumab was combined with various cytotoxic agents , including carboplatin and irinotecan , carboplatin and etoposide as well as lomustine or carmustine , but the side effects do not warrant the routine clinical use of bevacizumab combined with cytotoxic chemotherapy . third , both bevacizumab and novottf-100a are listed in the national comprehensive cancer network practice guideline for recurrent glioblastoma . therefore , there appear to be strong rationales to combine novottf-100a with bevacizumab for recurrent glioblastoma . the resolution of our patient 's cystic tumor is a notable response to novottf-100a and bevacizumab after initial bevacizumab failure . although the response assessment in neuro - oncology criteria deem it as nonmeasurable , cystic tumors can not be measured in a traditional bidimensional fashion for response assessment , unless there is an associated solid nodule measuring 10 mm or greater in diameter . however , the disappearance of enhancement in the cystic tumor is still remarkable . in their retrospective series of 51 recurrent high - grade gliomas treated with bevacizumab and irinotecan , zuniga et al . reported only 8% of patients with a complete response while the majority had either a partial response ( 63% ) or no response ( 29% ) . similarly , when bevacizumab was used as a single agent , kreisl et al . and friedman et al . these data indicate that bevacizumab alone rarely results in a complete radiographic response , and the partial response seen in a majority of patients suggests that there are probably multiple proangiogenic pathways activated in the glioblastoma . a prior post hoc analysis of the response characteristics from the pivotal phase iii trial indicates that secondary glioblastomas as well as low or no dexamethasone usage are potentially important predictors of response in patients treated with the novottf-100a device alone [ 7 , 17 ] . first , secondary glioblastomas may have a different genetic composition that makes the tumor cells more susceptible to ttfields . indeed , verhaak et al . have shown that most of the secondary glioblastomas fall in the proneural genotype with amplification of pdgfra and olig2 as well as mutations in idh1 and tp53 . although our patient 's tumor appears to be a primary glioblastoma by the lack of idh1 immunohistochemical labeling , there could still be unidentified genetic mutations that make her tumor susceptible to ttfields therapy . indeed , 9 out of 14 responders in the phase iii trial did not have prior low - grade histologies , and they could have genetic mutations or epigenetic alterations that make them susceptible to novottf-100a monotherapy . second , the slower growth rate of our patient 's tumor may have helped to allow sufficient time for the ttfields to effect a treatment response . this is because the median time to response for ttfields therapy is longer than that for chemotherapies , 8.4 versus 5.8 months , respectively , as noted in the prior post hoc response analysis . last , our patient 's dexamethasone was completely discontinued 2 months after initiation of combination ttfields and bevacizumab therapy , but a near complete resolution of gadolinium enhancement and a significant reduction of the cystic tumor were not detectable until 6 months into treatment . consistent with this observation , the inverse relationship between response and dexamethasone dosage is probably a consequence of removing the immunosuppressive effect of dexamethasone , which would allow for better control of the glioblastoma by the patient 's immune system . therefore , allowing sufficient treatment time and removing dexamethasone are key parameters to maximize the probability of a response from ttfields . the pattern of relapse from combination ttfields and bevacizumab therapy is unknown . at the time of tumor recurrence , this type of distant recurrence of glioblastoma could be the consequence of progressive development of the invasive phenotype , intracranial inhomogeneity of the ttfields , or incomplete coverage of certain parts of the brain by ttfields . these hypothesis - generating observations would be important for future studies to correlate the location of the relapsed disease and the distribution of the electric fields within the brain .

ductal adenocarcinoma is an unusual variant of adenocarcinoma of the prostate . a 73-year - old male was referred to our hospital for the further examination of an elevated prostate - specific antigen level of 23.4 ng / ml . radical prostatectomy ( rp ) was performed based on the diagnosis obtained by a prostate needle biopsy . the rp specimen revealed ductal adenocarcinoma of the prostate with positive capsular penetration . we herein report a rare case of ductal adenocarcinoma of the prostate .

please summarize the articles given below

there have been sporadic cases reported since it was first described by lennox et al . , in 1952 . we report an additional case of pmc of the skin in a 70-year - old male presenting with a swelling in the lateral canthal region of his left eye , and review the pertinent literature . a 70-year - old male noticed a swelling near the the left canthus since one - and - a - half years . a raised , freely mobile , firm skin mass of approximately 3.0 2.5 cm was present on the lateral canthal region on the left eye . gross examination revealed a well - circumscribed , spherical soft tissue mass , partially skin covered , measuring 2 cm in diameter . the cut surface of the tumor had a gray - brown gelatinous appearance [ figure 1 ] . microscopically , the sections revealed a tumor in the dermis composed of tumor cells arranged in nests , glands , and cribriform patterns [ figure 2 ] . the cells were seen floating in large pools of mucin separated by thin fibrovascular septa [ figure 3 ] . [ figure 4 ] further investigations , including a colonoscopy , ultrasonographic examination of the abdomen , and computerized tomography ( ct ) scans of the chest , abdomen , and pelvis were found to be normal . thus , the lesion in the skin was reported to be pmc of the skin . gross specimen revealing a spherical , well - circumscribed tumor with a gelatinous cut surface . tumor in the dermis composed of cells arranged in nests , glands , and cribriform patterns , floating in mucin lakes ( h and e , 20 ) small nests of adenocarcinoma lying in pools of extracellular mucin that were separated by fibrocollagenous septae ( h and e , 40 ) photomicrograph showing pools of pas positive , diastase - resistant mucin between the tumor nests ( pas stain , 20 ) primary mucinous carcinoma of the skin ( pmcs ) is a rare adnexal neoplasm with sweat gland differentiation . this tumor was first described by lennox et al . , in 1952 , and later designated by mendoza and helwig , in 1971 . . recently studied approximately 200 cases of pmcs documented in the literature and found that the mean annual age standardized incidence of pmcs during the period 1978 to 2003 was 0.07 per million person - years . although some debate exists as to the apocrine or eccrine origin of this tumor , most authors favor the eccrine differentiation based on the evidence obtained from the immunohistochemical studies and electron microscopic ultra structural analysis . it has been suggested that pmcs may develop as a progression from abnormal apocrine or eccrine ducts , analogous to the progression seen in the mucinous carcinoma of the breast . a ductal in - situ component can occasionally be seen ranging from ductal hyperplasia to frank carcinoma in - situ . rosai originally suggested that the ductal proliferation continues until the overproduction of mucin results in islands of tumor cells breaking off and floating in the mucinous pools . primary mucinous carcinoma of the skin is slightly more common in men than women and typically affects people in the age range of 50 to 70 years . the large majority of specimens of pmcs arise on the face , especially on the eyelids and scalp . the primary lesion of mesenchymal chondrosarcoma ( mcs ) is often solitary , and the history is often of a small cutaneous lesion that grows slowly for many months or years and suddenly enlarges . by the time it is first brought to medical attention , the neoplasm is a nodule that varies in diameter from about 0.7 8.0 cm . mucinous carcinoma rarely originates in the skin ; the majority of examples in the skin are actually metastatic to it . common sites of origin of mucinous carcinomas are the breast , gastrointestinal tract , salivary glands , lacrimal glands , nose , paranasal sinuses , bronchi , renal pelvis , and ovary . metastatic lesions from the breast or colon are most likely to mimic mucinous carcinoma of the skin . differentiating primary mucinous carcinoma from metastatic tumors , particularly from these sites , the absence of expression of ck20 by immunohistochemical staining may exclude the diagnosis of metastatic colorectal mucinous carcinoma . it is important to recognize , however , that the likelihood of mucinous carcinoma from the breast , metastasizing to the skin ( much less on the face or eyelid ) is exceedingly low . cases of pmcs have been found to be estrogen receptor , progesterone receptor , and gcdfp-15 positive . qureshi et al . , suggest that finding an in - situ component of a tumor that stains for myoepithelial cells ( positive stains for p63 and ck5/6 among others ) can help to exclude metastatic mucinous breast carcinoma . the distinction of mcs from a mucinous carcinoma metastatic to the skin is important because the prognosis of mucinous carcinoma metastatic to the skin is poorer than that of mcs . primary lesions can be differentiated from metastatic lesions by their more organized epithelial cells , less hyperchromasia , and fewer mitoses in individual cells . in addition , in the case of metastatic carcinoma , tumor cells invade between the collagen bundles at the margin of the nodule . due to the difficulty in distinguishing these histologically , a thorough workup for metastatic lesions no primary tumor was detected in the breast , digestive tract , salivary glands , lacrimal glands , paranasal sinuses , lungs or kidneys . primary mucinous carcinoma of the skin is a slow - growing benign tumor with a high local recurrence rate . treatment of mucinous carcinoma entails local excision . on account of the high rate of recurrence , adequate excision with generous margins other treatments , such as chemotherapy and radiation , are generally not employed in the management of these tumors . patients should be counseled about the importance of frequent follow - ups for evaluation of local tumor recurrence or development of regional lymphadenopathy . incidental detection of small renal masses is increasing . this has led to an increase in biopsy of small renal masses , a proportion of which needle biopsy of small renal masses is controversial owing to the risk of seeding malignant cells along the needle tract . needle tract seeding is a rare event ; the incidence is estimated to be less than 1 in 10,000 cases of all biopsies . eight other cases of needle tract seeding in a renal mass biopsy have been described in the medical literature , two as recently as 2013 ( table 1 ) . we report our experience of a man with renal cell carcinoma ( rcc ) seeding along a biopsy tract and compare the circumstances and biopsy techniques with reported cases in the literature . a 66-year - old man was incidentally found to have a 32-mm right lower pole renal mass on a computed tomography ( ct ) scan ( fig . two samples were obtained by use of a 16-gauge temno core biopsy needle ( carefusion , san diego , ca , usa ) and a 22-gauge francine needle . histopathology revealed a well - circumscribed 30-mm clear cell rcc , predominantly fuhrman grade 2 with focal areas of grade 3 . there was an area where the capsule was interrupted that corresponded to a hemorrhagic area on the cortical surface ( fig . a tumor deposit was also noted in the perinephric fat . these features suggested that the tumor deposit in the fat was likely due to tumor seeding rather than a metastasis and that the tumor seeding could have resulted from the needle biopsy . his tnm staging was pt3a nx mx , at least stage 3 disease ( american joint committee on cancer , 7th edition , 2010 ) and his leibovich score was 5 ( intermediate risk ) . six months after the operation , there was no radiological evidence of tumour recurrence on a ct scan . aside from the potential for false - negative results , a key risk of renal mass biopsy is seeding of the biopsy tract with malignant cells . several factors in theory could affect the risk of biopsy tract seeding , such as needle size , the number of needle passes , and the use of a coaxial needle . biopsy tract seeding has been reported in renal mass biopsies using needles as fine as 23-gauge and as large as 14-gauge . theoretically , a larger - bore needle would increase the risk of seeding owing to an increased area of defect on the surface of the tumor and an increased circumference or surface area of the needle . however , because of the scarcity of cases , it is difficult at this stage to accurately determine a relationship between needle size and the risk of seeding . it is also difficult because of underreporting to associate the risk of needle tract seeding with the number of needle passes through a tumor . use of a coaxial needle allows multiple passes through the renal mass with only one pass through the surrounding normal tissue . this theoretically reduces the risk of needle tract seeding into normal tissue and potentially reduces patient discomfort as well . although it is interesting to note that a coaxial needle was not used in any of the currently reported cases of needle tract seeding after renal mass biopsy ( table 1 ) , there are just too few cases to establish a firm relationship between the risk of biopsy tract seeding and the use of a coaxial needle . visualization of larger coaxial needles on ultrasound or ct may be easier than with smaller biopsy needles , and this may improve accuracy . histological evidence of biopsy tract seeding may not always be found after definitive surgery to remove the renal mass . seeding into excised perinephric tissues can be found soon after surgery but seeding into surrounding muscle , fascia , and skin may only be apparent months , or even years , after surgery . as was seen with this case , the biopsy needle traversed skin , subcutaneous tissue , multiple muscle and fascia layers , and perinephric fat before reaching the renal lesion ( fig . thus , the tumor could theoretically seed into one or more of these tissues ; seeding as superficial as the subcutaneous tissue has been reported ( table 1 ) . this delayed presentation may increase the risk of adverse outcomes such as further metastasis and poorer prognosis . time to presentation or diagnosis of tumor seeding after renal mass biopsy has ranged from 24 days to 84 months in previously reported cases where tumor seeding was not found on the initial histopathological analysis ( table 1 ) . in conclusion , a common feature in all reported cases of needle tract seeding from a renal mass biopsy is that a coaxial needle was not used . however , because of the paucity of cases , there is currently no satisfactory association between the risk of needle tract seeding and needle size or the number of needle passes . it is important to consider that histopathological evidence of needle tract seeding may not be apparent in all cases , especially if seeding occurred beyond the excised tissues .

primary mucinous carcinoma of the skin is a rare adnexal tumor of sweat gland origin . a case report is presented of a 70-year - old male , who presented with a slow growing mass near the lateral canthus of his left eye . the case was clinically diagnosed as a fibroma . an excisional biopsy of the lesion revealed mucinous carcinoma of the skin . investigations excluded the possibility of metastatic mucinous carcinoma . thus , the lesion in the lateral canthus region was diagnosed as primary mucinous carcinoma of the skin , a rare site of occurrence .

please summarize the articles given below

the syndrome is named after french neurosurgeon octave crouzon , who described this rare genetic disorder first time in 1912 . although it is encountered rarely , crouzon syndrome constitutes almost 5% of all craniosynostoses with an approximate birth prevalance of 1/25,000 - 1/50,000 . the syndrome is characterized by abnormal head shape , midfacial hypoplasia , maxillary hypoplasia , mandibular prognathism , ocular hypertelorism , proptosis , and airway obstruction due to premature fusion of multiple calvarial and skull base sutures within the first year of life . however , the clinical picture may vary greatly from mild to severe midfacial and orbital anomalies . the relationship between craniosynostosis and chiari malformation type i ( cm - i ) has been well - documented . cm - i has a tendency to accompany syndromic craniosynostosis more commonly than sporadic synostosis . the incidence of cm - i in crouzon syndrome is about 70% . herein , we present a 16-year - old boy who admitted with symptoms related to cm - i and underwent suboccipital decompression . however , on physical examination his cruzonoid features drawed attention . a 16-year - old , formerly healthy boy admitted to the outpatient clinic with occasional headache and neck pain . on physical examination it was remarked that he had characteristic features of syndromic craniosynostoses : hypertelorism , proptosis , midfacial hypoplasia , and abnormal head shape [ figures 1a and b ] . however , the patient and his family did not admit to a hospital for this reason before , despite prominent cruzonoid features . the patients neurological examination revealed no abnormalities including pinprick , touch , pain , and temperature sensations in both upper extremities . anteroposterior ( ap ) and lateral plain radiographs of head and a cranial computed tomography ( ct ) demonstrated midfacial and orbital hypoplasia , the fusion of bilateral coronal and lambdoid sutures and sagittal suture , alongside with the increase of ap diameter of the head [ figures 2a and b ] . cranial and spinal magnetic resonance imaging ( mri ) studies were obtained and it showed a 18 mm cerebellar tonsil herniation into the foramen magnum with accompanying syringomyelia between th 4 and th 7 [ figure 3 ] . surgery was planned in order to decompress the posterior cranial fossa . using a median incision , the dura was opened in y - form and after arachnoid dissection duraplasty was performed . there were no significant events in the postoperative course and the patient was discharged from the hospital with no neurological deficits . the patient was then referred to the genetics department for the further evaluation of the craniosynostosis . phenotypical features like the typical dismorphic facies , ocular proptozis and hypertelorism , parrot - like nose , and frontal bossing alongside with the patients mothers history of four recurrent intrauterine fetal losses supported the diagnosis of crouzon syndrome in our patient . regular follow - up examinations were scheduled for the observation of orbital deformities and vision . control mri showed complete resolution of the tonsillar herniation and significant reducement of the syringomyelia both in length and thickness [ figures 4a and b ] . four years after the operation the patient is still doing well with no neurological or ocular deficits and with the relief of his symptoms at the admission . ( a and b ) photographs show characteristic features of syndromic craniosynostoses in our patient : hypertelorism , proptosis , midfacial hypoplasia , and abnormal head shape . ( published with permission and informed consent of the patient ) ( a ) anteroposterior ( ap ) and lateral plain radiographs of head shows increase of ap diameter of the head and midfacial - orbital hypoplasia . fusion of multiple calvarial sutures is also remerkable , ( b ) axial cranial computed tomography scan demonstrated the abnormal head shape and the fusion of bilateral coronal and lambdoid sutures alongside with sagittal suture sagittal t2-weighted magnetic resonance imaging shows a 18 mm cerebellar tonsil herniation into the foramen magnum with accompanying syringomyelia between th 4 and th 7 with the largest thickness of 11 mm ( a ) sagittal t2-weighted mri of the craniocervical junction showed complete resolution of 18 mm cerebellar tonsil herniation , ( b ) sagittal t2-weighted thoracal mri showed relative resolution of the accompanying syringomyelia between th 4 and th 7 with the largest thickness of 7 mm the premature fusion of cerebral sutures has been postulated as the mechanism leading to the development of cm - i in patients with syndromic craniosynostosis . especially premature fusion of the lambdoid suture has been accepted as a crucial developmental anomaly , which results in a relatively small posterior fossa . cinalli et al . , have reported that cm - i is present in 70% of patients with crouzon syndrome . on contrary , they have proposed , that this relationship is due to earlier closure of sagittal and lambdoid sutures in crouzon syndrome compared to apert syndrome . hydrocephalus , jugular venous stenosis leads to venous hypertension and associated brain malformations have been postulated as the other mechanisms leading to cm - i development . mutations in three of four fibroblast growth factor receptor ( fgfr ) genes have been demonstrated to be responsible for various types of syndromic craniosynostoses including crouzon syndrome . fujisawa et al . , have demonstrated that a missense mutation in fgfr2 gene ( tyr281cys ) is responsible for the development of cm - i in patients with crouzon syndrome . , the patient or his family was never attempted to seek for professional medical help . the syndrome was only diagnosed when the patient was admitted to our department with symptoms of cm - i . strahle et al . , presented a series of patients with cm - i associated with craniosynostosis . in their series of 29 patients , however , the mean age of the whole patient group was 1.8 years ( range 2 months-9 years ) . this data shows that both craniosynostosis or craniosynostosis related cm - i are expected to be diagnosed in early childhood . cm - i could be diagnosed before the craniosynostosis in some instances , but the age of our patient at diagnosis was 16 . to our knowledge , this is the only case report indicating a late adolescent diagnosis of crouzon syndrome through clinical symptoms of an associated cm - i . surgical approach to craniosynostosis related cm - i may include cranial vault remodeling with an adequate posterior fossa decompression . however , most neurosurgeons agree with the conservative follow - up of patients with cm - i unless it is not symptomatic or associated with spinal syringomyelia . strahle et al . , reported some of his patients cm - i was resolved or regressed with cranial vault remodeling only , without posterior fossa decompression . , we do not consider cranial vault remodeling as an option , instead we applied a classical posterior fossa decompression for cm - i . strahle et al . , underlined the risk of venous bleeding due to abnormal venous sinuses and increased venous hypertension , therefore suggested a posterior fossa decompression without dural opening and c1 arcusectomy . we did not encounter any venous bleeding during the surgery , where we opened dura and performed a duraplasty . pediatric patients with cm - i should be carefully examined for the clinical signs and features of crouzon syndrome or other syndromic craniosynostosis . in mild clinical forms or in case of a late diagnosis , posterior fossa decompression without cranial remodeling should be kept in mind as a treatment option . chest pa showed superior mediastinal widening and bulging of the right paraspinal interface ( fig . 1 ) . increased opacity of the infrahilar window and thickening of the posterior wall of the bronchus intermedius were seen on the lateral chest x - ray . an oval - shaped mass measuring 9.73.86.0 cm was seen in the left superior mediastinum . a bizarre - shaped vascular structure that was connected to left innominate vein was seen in central area of the mass ( fig . the mass showed insinuating appearance without significant compression of adjacent structures . only the thymus was slightly compressed by the mass . another similarly natured mass was seen in the right paraspinal area , which measured about 4.23.06.6 cm . this mass also contained a bizarre - shaped vascular structure that communicated with the left atrium directly through an anomalous vascular structure ( fig . 2 ) . multiplanar reconstruction ( mpr ) and 3d reformation showed that the contrast directly entered the vascular components of the masses via an abnormal vein originating from the left innominate vein ( fig . the mediastinal window setting of contrast - enhanced ct showed additional multiple small cystic lesions in the middle mediastinum . a two - stage operation was planned due to the fact that the tumors were located bilaterally . first , for the left side tumor resection , posterolateral thoracotomy was performed and a large cystic mass was found in the anterosuperior mediastinum . the content of the cyst was bloody and a large communicating vein to left innominate vein and few small communicating veins to left intercostal veins were found , which were then ligated and divided . the second operation was performed for the right mediastinal mass 45 days after the first surgery . the right paraspinal mass was successfully resected and an anomalous communicating vein to left atrium was identified and divided . the patient recovered completely without any complications such as chylothorax or hemothorax . on gross pathologic examination , the cut surface of the tumor revealed numerous cystic spaces and a cavernous sinus containing bloody contents ( fig . histology of the mass showed combined proliferation of venous vascular channels ( ve ) and lymphatic channels ( ly ) that exhibited infiltration into mediastinal fat pad ( fig . mediastinal lymphangiohemangioma is a very rare venolymphatic malformation containing both vascular and lymphatic elements . direct vascular communication between the lesion and the vena cava system ct images of the mediastinal lymphangiohemangioma are very rarely found in the english literature [ 1 - 4 ] . moreover , neither a case with multiple masses and more than one vascular communication nor a case directly connected to the heart chamber through an anomalous vessel was found in the literature . we report a case of surgicopathologically confirmed mediastinal lymphangiohemangioma that communicated with the left innominate vein and left atrium directly via anomalous vascular structures ( fig . vascular malformations are subcategorized as lymphatic , capillary , venous , arteriovenous , and mixed malformations on the basis of their histologic nature . . therefore , our case can be categorized as low - flow vascular malformations with mixed lymphatic and venous components . slow - flowing blood appears as high signal intensity on t2-weighted images and as intermediate signal intensity on t1-weighted images . most lesions present early in childhood and the most common locations for lymphatic malformations are the neck and axilla . a less common location is the mediastinum , and the anterior mediastinum is the most commonly found mediastinal site . ct scan , the mass showed diffuse low attenuation without calcification , although previous reports showed scattered phleboliths in the mass , which represent calcified emboli in the venous channels . the anomalous vascular structures were enhanced at the same intensity as the systemic venous system and was connected directly to the left innominate vein and left atrium . the peripheral portion of the lesion was not enhanced on all phases of dynamic ct scan , which may be related to the lymphatic components or fibroconnective tissues of the mass . a previous report postulated that the anomalous vein acts not only as a draining vessel but also as a feeding vessel . in our case , only the proximal part of the vascular structure was enhanced on the pulmonary arterial phase , whereas all of the large bizarre - shaped vascular spaces were enhanced on the systemic venous phase ( fig . 2 ) . a delayed ct scan may show delayed clearance of contrast within the anomalous venous channels because of the lack of smooth muscle in these channels . lymphangiohemangiomas are not considered an congenital anomaly but are frequently associated with other vascular malformations , most commonly in the left superior vena cava . in our case , the anomalous vessels connected to the left innominate vein may be considered a left superior vena cava remnant . a lymphangiohemangioma should be included in the list of differential diagnoses of an incidentally found low - attenuating mediastinal mass , especially in young patients . another therapeutic option is percutaneous sclerotherapy using agents such as absolute ethanol , bleomycin , cyclophosphamide , doxycycline , alcohol solution of zein , or ok-432 . recognizing that the lesion is a low - flow vascular malformation is more important than determining whether the lesion is predominantly venous or lymphatic when making treatment decisions . we planned surgical excision of the lesions and successfully excised them without any complications such as hemothorax or chylothorax . for successful surgery , the anomalous vascular pedicle of the mass communicating with the systemic vein or heart chamber should be carefully identified and divided to prevent massive hemothorax .

chiari malformation type i ( cm - i ) related to syndromic craniosynostosis in pediatric patients has been well - studied . the surgical management consists of cranial vault remodeling with or without posterior fossa decompression . there were also cases , in whom cm - i was diagnosed prior to the craniosynostosis in early childhood . we present a 16-year - old boy who admitted with symptoms related to cm - i . with careful examination and further genetic investigations , a diagnosis of crouzon syndrome was made , of which the patient and his family was unaware before . the patient underwent surgery for posterior fossa decompression and followed - up for crouzon 's syndrome . to our knowledge , this is the only case report indicating a late adolescent diagnosis of crouzon syndrome through clinical symptoms of an associated cm - i .

please summarize the articles given below

a male neonate born to g2 p1l1 mother at term by spontaneous vaginal delivery to iii degree consanguineous marriage was found to have proximal shortening of both upper and lower limbs [ figure 1 ] . the antenatal period was uneventful and antenatal ultrasound was reportedly not done during pregnancy and the mother was referred to our hospital after the onset of labor . apart from rhizomelic shortening , the neonate also had coronal clefts of thoracic vertebrae and stippled epiphysis of femur tibia and humerus on skeletal survey radiograph [ figure 2 ] . based on the above features a provisional diagnosis of rhizomelic chondro - dysplasia punctata ( rcdp ) was made and the prognosis was explained to the parents . the baby developed progressively severe respiratory distress and was discharged at request on day 3 of life as the parents were unable to come to terms with the diagnosis . rhizomelic shortening of upper limb punctate calcification and epiphyseal abnormalities chondrodysplasia punctata is a radiological diagnosis characterized by punctate or stippled calcifications in epiphyseal cartilage and seen in peroxisomal disorders such as zellweger syndrome , neonatal adrenoleukodystrophy , and infantile refsum disease . it may also be inherited as x - linked dominant , x - linked recessive , and autosomal recessive forms . it is classically associated with pex7 gene ( peroxin family of genes ) mutation and has been reported in indian patients too . rcdp is characterized by proximal shortening of the humerus and to a lesser degree the femur , punctate calcifications in cartilage with epiphyseal and metaphyseal abnormalities , radiolucent defects ( coronal clefts ) of the vertebral bodies which represents cartilage that are not ossified , cataracts , contractures , microcephaly , characteristic skin changes of icthyosis , facial dysmorphism ( depressed nasal bridge , hypertelorism , hypoplastic midface , anteverted nostrils , full cheeks ) , and developmental impairment . this condition is considered to be lethal and most of the affected fetuses die in utero or soon after birth . only few of them survive beyond infancy with severe physical disability and profound mental retardation in whom , death usually occurs in the first decade of life . diagnosis of rcdp is based on clinical findings and confirmed by clinically available biochemical or molecular genetic testing which includes biochemical tests of peroxisomal function like red cell plasmologen concentration , plasma phytanic acid , and very long chain fatty acid estimation . this case is presented due to its rarity and failure to detect such an abnormality in utero resulting in a wasted pregnancy . the lack of resources ( both money and manpower ) is probably responsible for this tragedy to the parents which could have been prevented by early diagnosis and appropriate counseling . establishing regional genetic labs which are connected with district level hospitals can be of immense help in reducing the burden of genetic diseases by appropriate prenatal diagnosis and counseling . radioactive iodine thyroid ablation has been shown to be an inexpensive , safe , and effective treatment for hyperthyroidism . it is the most commonly used method for treating adult patients with graves ' disease . special precautions must be used in women of child - bearing age because of the possible detrimental side effects of fetal exposure . the american college of radiology ( acr ) practice guideline for the performance of therapy with unsealed radiopharmaceutical sources states that pregnancy should be ruled out using one of the following four criteria : ( 1 ) a negative hcg test obtained within 72 hours prior to administration of the radiopharmaceutical , ( 2 ) documented history of hysterectomy , ( 3 ) a postmenopausal state with absence of menstrual bleeding for two years , and ( 4 ) premenarche in a child age of 10 years or younger . the society of nuclear medicine ( snm ) procedure guideline for therapy of thyroid disease with i-131 states that females of child - bearing age should routinely be tested for pregnancy within 72 hours or less before i-131 treatment . when the patient 's history clearly indicates that pregnancy is impossible , the treating physician may omit the pregnancy test . tj ( not the patient 's initials ) is an adult female diagnosed with graves ' disease , which was treated with i-131 therapy in december 2004 . she had been doing well until june 2006 when she presented to the pediatric endocrinology clinic with reoccurrence of her disease . her thyroid function tests showed tsh < 0.03 ( normal 0.325.0 munit / ml ) , free t4 2.80 ( normal 0.711.85 ng / dl ) , and t4 19.1 ( normal 5.012.0 mcg / dl ) . tj was scheduled for a radioactive iodine uptake and scan with subsequent ablation with i-131 . a qualitative urine pregnancy test was performed 24 hours prior to ablation and was negative . a radioiodine uptake and scan revealed a 24-hour uptake of 100% ( normal 10%30% ) . informed consent for i-131 therapy was obtained . tj verified that she was not pregnant and was given an activity of 19.8 mci of i-131 . approximately four months later , after slipping and falling at work , tj presented to her physician with a complaint of low back pain . magnetic resonance imaging ( mri ) of her lumbar spine revealed an intrauterine pregnancy . it was estimated that the fetus was eight to ten days old at the time of i-131 treatment . neonatal thyroid function tests revealed suppressed tsh ( < 0.02 , normal 0.325.0 munit / ml ) , elevated t4 ( 24.4 , normal 5.012.0 mcg / dl ) , and free t4 ( 4.54 , normal 0.581.64 ng / dl ) . in addition , the infant had an elevated thyroid receptor antibody ( trab ) titer of 82% ( negative < 10% , intermediate 10%15% , positive > 15% ) . based on the laboratory evaluation , because he was asymptomatic , a decision was made not to treat but to monitor him closely . over the next six months his thyroid function tests normalized with tsh 0.73 munit / ml , t4 10.3 mcg / dl , free t4 1.11 ng / dl , and trab < 15% . thyroid embryogenesis is largely completed by 1012-week gestation . at 10-week gestation , the thyroid gland is able to trap and concentrate iodine and synthesize thyroid hormones thyroxine and triiodothyronine . after 10-week gestation , significant exposure to the fetal thyroid can occur from therapeutic doses to the mother , resulting in hypothyroidism and cretinism . there have been no reports of birth defects or childhood malignancy in children born to the mothers who received radioactive iodine for graves ' disease before the 10th week of pregnancy . we believe the infant 's thyroid gland was not affected by the i-131 therapy because he was exposed prior to 10-week gestation . quantifying the exact absorbed dose by the embryo in this case is difficult and depends on many variables . this calculation likely overstates the actual absorbed dose , as the model assumes that i-131 crosses the placenta . in this case , due to the placenta being in the early stages of development during the second week of gestation it is estimated that the embryo absorbed dose with i-131 treatment in early pregnancy is 0.072 mgy / mbq . our patient received a dose of 19.8 mci ( 732.6 mbq ) , which corresponds to an absorbed dose of approximately 5.3 rads after converting from gy to rads . deterministic effects are those that are known to occur at a given radiation threshold . for example , if a patient were to receive an acute dose of 2 gy to the lens of the eye , the patient will develop a cataract . stochastic effects are those that can theoretically occur at any radiation dose . for example , any radiation dose could potentially induce a cancer in the future . the probability of a stochastic effect increases as dose increases , but there is no radiation threshold dose below which one can say a stochastic effect will not occur . therefore , stochastic effects can theoretically occur with any radiation dose . the only known deterministic effect of radiation at an absorbed dose of less than 10 rads is possible spontaneous abortion at 114 days postconception . based on the data above , this dose level ( 10 rads ) was not reached in this patient . on the other hand , thus , the radiation dose to any developing embryo should be minimized , and it is reasonable to ascertain an accurate pregnancy test prior to the use of i-131 therapy . studies have demonstrated that the risk of congenital effects have been negligible at doses of 5 rads or less when compared to other risks of pregnancy . in addition , the risk of malformation only significantly increases at doses above 15 rads . mental retardation has been shown to occur in the offspring of pregnant mothers ; however , it is at doses greater than 20 rads and generally after the eighth week of gestation . a screening study of thyroid cancer among individuals exposed to in utero i-131 from the chernobyl fallout , however , did demonstrate an increased risk of thyroid carcinoma approximately 20 years after the accident . thus , our estimation that the infant was exposed to approximately 5 rads supports that no deterministic effects should have occurred , but one can not exclude the future potential for stochastic effects . as previously stated , the acr practice guideline for the performance of therapy with unsealed radiopharmaceutical sources states that pregnancy should be ruled out using one of the following four criteria : ( 1 ) a negative hcg test obtained within 72 hours prior to administration of the radiopharmaceutical , ( 2 ) documented history of hysterectomy , ( 3 ) a postmenopausal state with absence of menstrual bleeding for two years , and ( 4 ) premenarche in a child age 10 or younger . the snm procedure guideline for therapy of thyroid disease with i-131 states that females of child - bearing age should routinely be tested for pregnancy within 72 hours or less before i-131 treatment . when the patient 's history clearly indicates that pregnancy is impossible , the treating physician may omit the pregnancy test . neither of the above guidelines specifies whether the pregnancy tests should be quantitative or qualitative . typically , serum pregnancy tests are more sensitive than standard urine pregnancy tests because the serum concentration of hcg is significantly higher than its urine concentration . detection of hcg in maternal serum is evident only after implantation and vascular communication has been established with the decidua by the syncytiotrophoblast , which occurs 810 days following conception . serum hcg can be detected in about 5% of patients eight days after conception and about 98% of patients by 11 days postconception . in contrast , urine pregnancy tests will be positive 1517 days after conception in 98% of patients [ 14 , 16 ] . this rule suggests that radioactive iodine therapy only be administered during the 10 days after the onset of the menstrual period . however , this protocol may not be effective if the patient has irregular menstrual cycles . one possible suggestion is to incorporate the ten day rule protocol into the current guidelines for patients who have regular 28-day menstrual cycles . for patients with irregular cycles or who require immediate ablation , quantitative serum hcg pregnancy tests on the day of the treatment should be considered . because serum hcg is detected in 98% of pregnant patients by day 11 , recommending the patients to abstain from sexual activity for at least two weeks prior to i-131 therapy may be suggested . this abstinence would cover the gap from the time of conception to the time the serum hcg test becoming positive . however , the physician would have to rely on the patient for providing an accurate menstrual cycle and sexual history . it is imperative to rule out pregnancy prior to the administration of radioactive iodine therapy due to the potential detrimental side effects of fetal exposure . the dose of i-131 in this particular case would be unlikely to result in any deterministic events . however , under the premise that any unnecessary exposure to radiation is important in preventing any potential stochastic events , an accurate pregnancy screening protocol may be warranted in preventing inadvertent i-131 treatment in early pregnancies of women with graves ' disease . the current acr and snm guidelines only mandate a hcg test being obtained within 72 hours prior to the treatment . this approach may miss a small number of pregnancies as a serum or urine pregnancy test does not become positive until implantation occurs , which happens 810 days postconception . though we recommend re - evaluating the acr and snm guidelines for future clarifications , it is possible that despite combining the patient 's history , the ten day rule and the hcg screening , an unsuspected pregnancy may be missed .

a male neonate was born with rhizomelic shortening of limbs . skeletal radiograph showed punctate calcification of epiphysis of humerus , femur , and tibia . the diagnosis and a brief review of literature pertaining to the condition with emphasis on antenatal diagnosis and counseling are being reported .

please summarize the articles given below

a 56-year - old female presented with best corrected visual acuity ( bcva ) of 20/120 and nuclear sclerosis ( nuclear opacity 3 , nuclear color 2 using lens opacification classification system iii ) in the left eye ( le ) . the surgery was performed using proparacaine drops ( paracain ophthalmic solution 0.5% , sunways pvt . ltd . , a foldable iol of + 22.5 d of the sensar ar40e variety [ abbott medical optics inc ( amo ) , 1700 e. st . andrew place , santa ana , ca 92705 usa ] was loaded into the emerald c cartridge ( lot ch00841 of amo inc . , usa ) by the first assistant outside the field of the operating microscope to save the surgical time . the cartridge was inserted in the injector and the loaded injector was handed to the surgeon . the tip of the cartridge was just inserted snugly by slight rotatory motion into the anterior chamber through the 2.8-mm incision . however , while removing the injector system , it was noticed that there was a gross downward beaking of the bevelled anterior end of the cartridge [ fig . immediately , the incision site was inspected under the operating microscope and a descemet 's tear was detected with a rolled out flap of about 2 mm in length . the viscoelastic was meticulously washed out and the main incision wound and the two side port entries were carefully hydrated and an air bubble was injected into the anterior chamber . downward beaking of the beveled anterior end of the emerald c cartridge ( lot ch00841 of advanced medical optics , inc . , usa ) on the first postoperative day , the patient 's le had an uncorrected va of 20/60 with a small rolled out descemet 's flap and adjacent descemet 's striae at the site of the main clear corneal incision ( temporally ) [ fig . a corneal opacity remained at the deeper corneal layers with mild surrounding edema , even at the time of last check - up at 4 weeks post - op , with a bcva of 20/30 [ fig . a small rolled out descemet 's flap and adjacent descemet 's striae ( left eye of the reported case on the first postoperative day ) corneal opacity at the deeper corneal layers with mild surrounding edema ( left eye of the reported case at 4 weeks post - op ) damage to iols as a consequence of passage through various injector systems includes marks or scratches , stress fractures , cracks and tear lines . damage to descemet 's membrane can occur due to various factors during cataract surgery , including engaging of descemet 's membrane by the leading haptic during iol implantation or with the irrigation / aspiration device ( when mistaken as an anterior capsular remnant ) or due to inadvertent injection of viscoelastic between descemet 's membrane and corneal stroma . repair techniques include manual repositioning , repositioning with viscoelastic or air , suturing of descemet 's membrane to the peripheral cornea or use of sf6 or c3f8 . our case report describes injury to the corneal endothelium and descemet 's membrane intraoperatively due to frayed and beaked tip of the amo emerald c cartridge . the case has been followed up for a period of about 4 weeks as on the day of reporting , and as the visual axis was not completely involved , the vision is maintained , although the descemet 's stria and mild surrounding edema remains . we have reported only a single case ; however , a damaged amo emerald c cartridge has been found in a few subsequent cases in our institute . in cases where a back - up cartridge was not available , the size of the clear corneal incision was increased to 3.2 mm at least to protect the entry wound architecture and the corneal endothelium , while injecting the iol using the damaged cartridge . the cause of the damaged nature of the amo emerald c cartridges appears to be a manufacturer 's oversight which has been duly informed to the concerned authorities , who have assured speedy correction of the defect . these cartridges are delivered in sterile transparent cases and the tip can be easily examined under the slit lamp beforehand without opening the casing . this should be made a routine practice as this will allow any damaged cartridge to be replaced before starting the surgery by ordering a fresh one from the manufacturer . we suggest loading of the foldable iol should be done by the surgeon himself under the operating microscope . the speed of the surgery should never compromise the quality of the surgery and/or the final visual outcome . with the advent of newer techniques like the microincision cataract surgery ( mics ) , surgeons also can not compromise on the incision size or wound integrity and architecture . the onus is on the various manufacturing companies to provide surgeons with precision instruments that are both safe and durable for the patient 's eyes . and more importantly , every instrument entering the patient 's eye should undergo careful preoperative microscopic inspection by the operating surgeon himself so that a microscopic manufacturing defect can be identified and immediate rectification of the situation can be done . when the gallbladder is not visualized in its normal location , the possibility of its ectopic location should be considered . a case of incidentally detected anomalous position of gall bladder causing confounding problem in interpretation of pet - ct is described . a 70-year - old man , with h / o chronic liver disease and suspected of hepatocellular carcinoma [ serum alpha - fetoprotein ( afp ) 5024 ng / ml ] was subjected to fluorine-18 fluorodeoxyglucose positron emission tomography ( f-18 fdg pet)/computed tomography ( ct ) imaging . rest of the liver revealed non - fdg avid lesions in segments iii and viii . on viewing the fused pet / ct images , the radiotracer accumulation was localized to the anomalously placed suprahepatic gallbladder . magnetic resonance ( mr ) images of the same patient confirmed the presence of the suprahepatic gallbladder [ figure 1 ] . ( a ) transaxial view of pet image showing suprahepatic subdiaphragmatic gallbladder with tracer uptake ; ( b ) coronal view of pet image ; ( c ) sagittal view of pet image ; ( d ) transaxial view of ct image ; ( e ) coronal view of ct image ; ( f ) sagittal view of ct image ; ( g ) transaxial view of post - contrast t1-weighted mri image ; ( h ) coronal view of post - contrast t1-weighted mri image ; ( i ) transaxial view of t2 fat saturated mri image shows gallbladder as a bright structure routine imaging of the gallbladder demonstrates a wide array of imaging variants , including anomalies in location , number , and configuration . an awareness of these normal variants would prevent misdiagnosis and aid in the assessment of differential diagnostic possibilities . normally , the gallbladder is situated adjacent to the inferior surface of the liver , in the plane of the interlobar fissure , with the gallbladder neck maintaining a constant relationship to porta hepatis . the gallbladder is generally found in the right upper quadrant , but may be seen in other parts of the abdomen . while anomalous positions are rare , the most common of these are ( 1 ) under the left hepatic lobe , ( 2 ) intrahepatic , ( 3 ) transverse , and ( 4 ) retroplaced ( retrohepatic or retroperitoneal ) . the lesser common of these are ( 1 ) supradiaphragmatic and ( 2 ) suprahepatic . gallbladder is intrahepatic during the embryonic period and becomes extrahepatic only later . an intrahepatic gallbladder ( usually a congenital anomaly ) this poses a problem for scintigraphy , as an intrahepatic gallbladder can cause a focal defect ( pseudo space - occupying lesion ) ; ultrasonography can be helpful in these cases . the suprahepatic region is among the rarest sites , and very few reports have appeared in either the surgical or radiological literature.[35 ] of the very few reports on the suprahepatic gallbladder , one refers to a normally inserted organ that rotated 180 upward to an intrathoracic position after eventration of the diaphragm . in two other cases , an abnormally mobile gallbladder was found trapped between the chest wall and the upper border of the liver ; this became symptomatic and caught the attention of the clinician and the imageologist . faintuch et al . reported three cases of suprahepatic gallbladder with hypoplasia of the right hepatic lobe and upward migration of the gallbladder . gansbeke reported a case of suprahepatic gallbladder which was associated with hepatomegaly due to macronodular cirrhosis complicating existing hepatitis . kabaroudis reported a case of floating gallbladder associated with hypoplasia of the right hepatic lobe , whereas maeda had reported a similar case associated with hypoplasia of left hepatic lobe . pet - ct is found to be useful in diagnosing this rare anatomical variant of ectopically located gall bladder and predicting its functional implication .

foldable intraocular lens ( iol ) implantation using an injector system through 2.8-mm clear corneal incision following phacoemulsification provides excellent speedy postoperative recovery . in our reported case , a sensar ar40e iol ( abbott medical optics , usa ) was loaded into emerald c cartridge , outside the view of the operating microscope , by the first assistant . the surgeon proceeded with the iol injection through a 2.8-mm clear corneal incision after uneventful phacoemulsification , immediately following which he noted a descemet 's tear with a rolled out flap of about 2 mm near the incision site . gross downward beaking of the bevelled anterior end of the cartridge was subsequently noticed upon examination under the microscope . we suggest careful preoperative microscopic inspection of all instruments and devices entering the patient 's eyes to ensure maximum safety to the patient .

please summarize the articles given below

lipoma is the most common soft tissue mesenchymal neoplasm in adults , which is located in any part of the body . the majority occurs in the upper - half of the body , particularly the trunk , head , and neck region , and it is rarely described in the oral cavity . conventional lipoma has been divided into three forms according to the origin of the localization : superficial lipoma ( arise within subcutaneous tissue ) , deep lipoma ( arise within deep soft tissue ) and parosteal lipoma ( arise within the surfaces of bone ) . the histological characteristics and types vary , which include angiolipoma , angiomyolipoma , myolipoma , osteolipoma and chondrolipoma . both osteolipomas and chondrolipomas are rare entities.[24 ] however , occurrence of osteolipomas or in other term lipomas with oseous and cartilagenous metaplasia are less common than other subtypes of lipomas . the term of osteochondrolipoma has been used for the lipomas containing both cartilage and bone which , are very rarely seen and generally associated with a paraosteal localization . to our knowledge , a 64 year old male patient with painless mass on his mandibulary symphysis region , was referred to the department of oral and maxillofacial surgery , faculty of dentistry on september , 2007 . the lesion had been first noticed 2 months prior of the presentation to the clinic with no significant enlargement . clinical examination of the oral cavity revealed a well demarcated , firm , round and exophitic lesion of approximately 2 cm in diameter at the symphysis region of the left mandible . the lesion was firmly attached to the bone in the clinical examination and the overlying mucosa was intact and of normal color . radiographically , at the site of the lesion some degree of radioopacity was observed [ figure 1 ] . under local anesthesia , the patient was taken to the operating room and the lesion was completely excised with an intraoral approach . during the surgical intervention , the encapsulated lesion was not adherent to the underlying periosteum and overlying mucosa , thus the lesion was dissected and removed easily [ figure 2 ] . the surgical specimen was histopathologically evaluated for final diagnosis at department of oral pathology , faculty of dentistry , gazi universitys . the 6-month postoperative follow - up showed healing of the oral mucosa without any recurrency . preoperative panoromic radigoraph exhibiting the dense radioopacity ( arrow ) in the symphysis region of the mandible intraoperative view of the lesion with encapsulation macroscopically , the gross specimen was a 2.7 1.8 1.4 cm encapsulated mass mostly comprising of adipose tissue with a few number of encapsulated nodular structures . on section , focal areas of hyaline chondroid structures and lamellar bone with fatty marrow were seen throughout the lesion . both islands of bone and cartilage were surrounded with well defined fibrous tissue [ figure 3 ] . there was no histological evidence of malignancy , such as mitosis , cellular atypia , necrosis , and hemorrhage . histochemistry with alcian blue periodic acid - schiff stain showed acid mucopolysaccaride presence in chondroid tissue ; hence , this was hyaline chondroid . on immunohistochemistry , adipocytes were positively stained with vimentin antibody , while both adipocytes and chondrocytes were positive for s-100 protein [ figure 4 ] . histopathological features of osteochondrolipoma showing mature adipose tissue containing cartilage islands and lamellar bone trabecules ( h and e , 40 ) chondrocytes and adipocytes demonstrating positivity for s 100 protein ( immunoperoxidase , 40 ) however , they are relatively uncommon in the oral cavity with incidence of 14% . variants of lipoma especially osteolipoma and chondrolipoma are very rare lesions which are located in the oral cavity . furthermore , intaoral lipoma with both osteoid and cartilaginous metaplasia has been reported just in two cases . we presented an osteochondrolipoma case that differed from the typical arrangement by two rare alterations . first , the lesion showed well - defined cartilaginous and osseous areas within lipoma that is also considered as osseous and cartilaginous metaplasia . in the a study of fregnani et al . , fibrolipoma was reported as the dominant subtype in 46 lipoma cases , in which neither osteolipoma nor chondrolipoma was found . two lipomas with cartilaginous or osseous metaplasia was reported out of 125 lipoma cases in another study , whereas none of the cases represented osteochondrolipoma . although , any case in the name of oral osteochondrolipoma has not been reported , lipoma with osteoid and cartilaginous metaplasia has been represented by two cases in the oral region . the osteochondrolipoma is the specific term of the lipoma with mature cartilaginous and osseous differentiation ; thus , both terms represents the same entity . some authors consider such type of lipoma as a benign mesenchymoma due to consisting of two or more mesenchymal elements such as lipocytes , chondrocytes , osteocytes , and fibroblasts . jones et al . stated that the term of benign mesenchymoma should be used strictly to describe an unencapsulated neoplasm composed of two or more mature mesenchymal tissues not ordinarily associated with each other , excluding fibrous connective tissue . in the present case , as the tumor is well demarcated and partially encapsulated and moreover the prominent component is mature adipose tissue , the tumor is considered as osteochondrolipoma . second alteration that took part in this case , was the parosteal localization of the lesion . the parosteal lipoma which is defined as lipoma exhibits a conguous relationship with the periosteum , usually demonstrating some form of attachment to periosteum with an underlying osseous reaction , is rarely seen in the oral cavity . various types of osseous cortical responses from a reactive overproduction of bone to cortical erosion can be seen underlying bone . the radiopacity in our case may reflect either the reactive bone production of underlying bone or the density of cartilagenous and ossous component of the tumor . multipotent cells of mesenchyme , different cell lines and metaplastic differentiation of the adipose tissue are three hypothesis regarding the origin of the tumor . however , considering its parosteal location , histological findings of well - formed cartilage and bone tissue within the adipose tissue neoplasm , it is decided to be a true neoplasm of mesenchymal tissue stem cells showing characteristics of three different tissues originating from the mesenchyme . anterior cervical spine fusion and stabilization is a well established procedure for cervical myelopathy , radiculopathy , neoplasms , and cervical trauma2 ) . although injuries to the pharynx and esophagus are known complications of anterior cervical spine surgery , delayed pharyngeal or esophageal perforation is rare7,9,10 ) . here , we describe a rare but potentially life - threatening complication after anterior cervical spine fusion and plating . the authors highlight this issue by presenting this case , which had no associated morbidity , and include a review of the relevant literature . a 43-year - old man was admitted to our institute with a 3-month history of dysphagia and neck pain with swelling . he was paraplegic due to a c6 - 7 fracture and dislocation and has been operated on 8 years previously . initial surgical treatment included anterior corpectomy of c7 and anterior iliac crest graft placement using a plate and screws . hematological studies including erythrocyte sedimentation rate ( esr ) and c - reactive protein ( crp ) were normal . a simple lateral radiograph and a computed tomography scan showed partial anterior migration of the lower screw . a hydro - soluble contrast swallow image confirmed esophageal perforation ( fig . the loose screw was removed and esophageal perforation was found during surgery and repaired directly by a cardiovascular team(fig . the patient was fed using a nasogastric tube for 3 weeks and subsequently oral feeding was gradually resumed . further progress was favorable , and a contrast study performed at 3 weeks postoperatively showed no evidence of fistula . anterior cervical fusion and plate fixation is an effective procedure for the treatment of cervical myelopathy or radiculopathy and cervical spine trauma . plating has been reported to achieve a fusion rate of up 98% , and to result in early mobilization , reduced graft - related complications ( especially for multilevel fusion ) , and to avoid late deterioration of the cervical spine alignment obtained at surgery1,4 ) . the complication rate after anterior cervical plating is generally low and decreases with surgeon 's experience . according to zeidmann14 ) , the overall complication rate associated with anterior cervical spinal fusion is approximately 5% , and pharyngo - esophageal perforation is uncommon , but nevertheless of the utmost importance because of the possibility of graft infection leading to osteomyelitis , mediastinitis , sepsis , and death6 ) . acute injury can be caused iatrogenically during surgical approach due to inappropriate placement or dislodgement of sharp - toothed retractor blades in the esophagus . retraction is particularly dangerous when a nasogastric tube is positioned because the wall of the hypopharynx or esophagus may be " trapped " by a high - pressure claw between the retractor and the tube , causing ischemic injury and secondary perforation8 ) . delayed esophageal injuries are due to chronic compression or contact and subsequent necrosis , abscess formation , and perforation due to graft dislodgement or screw migration with or without plate failure4,7 ) . screw dislodgement often follows a benign course and is completely asymptomatic , due to the small diameters of the screws used and slow migration from the external to the internal mucosa , which permits spontaneous tissue repair of the defect caused repetitive friction between the retropharyngo - esophageal wall and the plating system(normally positioned with adhesion ) , traction - type pseudodiverticulum , and perforation are other causes of delayed injury11 ) . the complications of esophageal perforation range from asymptomatic with local infection to mediastinitis and death . the clinical course depends on the etiology , location , and timing of the perforation . asymptomatic perforation has as well been reported as incidental oral extrusion of screw even years after anterior cervical spine stabilization5 ) . patients generally present with swallowing difficulty , regional swelling , neck pain , dysphagia , weight loss , dysphonia , subcutaneous emphysema , and fever ; our patient presented with dysphagia and neck pain with regional swelling12,13 ) . conservative treatment may be preferred for small , contained defects of less than 1 cm , and consists of the elimination of oral feeding , tube feeding to restore fluid and nutritional balance , and intravenous antibiotics . some cases need surgical repair , such as , perforation closure with a primary suture or sternocleidomastoid or pectoralis major flap repair13 ) . we operated on our patient to remove the offending screw due to evident fistula confirmed by esophagography and esophagoscopy . direct repair was effective in achieving a successful perforation repair of the esophageal perforation with an early return to oral feeding . we report a rare case of delayed esophageal perforation caused by screw displacement after anterior cervical spine plating . careful periodic follow - up is necessary , and when encountered , early surgical closure following removal of the offending screw is mandatory .

osteochondrolipoma is a rare benign soft tissue neoplasm . it is occasionally considered to be a variant of adipose tissue neoplasm lipoma showing multiple differentiation pathways of pluripotent stem cells . as with the lipomas they can be seen at any location and show cartilagenous and osteoid differentiation when located parosteally . we present a case of osteochondrolipoma located at the symphysis of the mandible . to our knowledge , this is the first reported case of an oral osteochondrolipoma associated with parosteal localization .

please summarize the articles given below

this work was supported , in whole or in part , by the one hundred person project of sun yat - sen university ( xz ) , national natural science foundation 81302262 ( xz ) , the basser research center for brca ( lz ) , the national institutes of health r01ca142776 , r01ca190415 , p50ca083638 ( lz ) , the ovarian cancer research fund ( lz and xh ) , the breast cancer alliance ( lz ) , department of defense ( lz ) , and the marsha rivkin center for ovarian cancer research ( lz ) . the indications for our approach were as follows : ( 1 ) isolated pcl avulsion fracture ; and ( 2 ) posterior tibial sag present at 90 of knee flexion . intra - articular lesions except pcl avulsion fracture were excluded using preoperative magnetic resonance image because of posteromedial approach and the consequential prone position . a c - arm device was used to avoid the penetration of growth plate by the anchors in pediatric or adolescent patients . patients were placed in the prone position , with the knee flexed 20 to 30. an oblique incision of < 10 cm was made between semitendinosus tendon and medial head of the gastrocnemius ( fig . the medial head of the gastrocnemius was held laterally to expose the posterior capsule of the knee joint . capsulotomy with an l - shaped incision was made longitudinally and then extended laterally to expose the fracture site ( fig . after debridement of fracture site , 2 suture based anchors ( 3.5 mm ; biomet sports medicine , warsaw , in , usa ) were inserted into the superomedial and superolateral region of the fracture site . each suture limb from the proximal row was placed through the hole at the end of the push - lock device ( 3.5 mm ; bio - pushlock , arthrex inc . , naples , fl , usa ) . pilot holes for the push - lock device were created using a punch just inferior to the distal edge of the fracture site . after the device was fully engaged in the pilot hole , the sutures were cut . the use of a knotless anchor provides a compressive force and consequently fixes the reduced avulsion fragment strongly to the fracture bed ( fig . if the patients were children , the anchors were inserted so as not to penetrate a physeal plate . a well - padded plaster splint was applied to the knee at 5 to 10 of flexion . on the first day , after surgery , the drain was removed and patients were encouraged to start quadriceps muscle strengthening exercise and begin non - weight bearing walking using crutches . after 2 weeks , protected range of motion exercise was started and partial weight bearing ambulation using crutches was permitted with locked brace in full extension . six weeks later , the brace was unlocked and the patients began full weight bearing ambulation . at 8 weeks , the brace was removed and patients were encouraged to increase activity gradually . a 20-year - old man presented with a right knee injury resulting from a motor vehicle accident . clinical examination revealed a swollen knee , limited range of motion and posterior tibial sag at 90 on knee flexion . the knee range of motion was 135 with a flexion 135 and flexion contracture 0 after 2 weeks postoperatively . the patient was able to return to his usual daily activities after postoperative 6 months ( fig . 2 ) . a 13-year - old boy presented with left knee injury resulting from a fall . clinical examination revealed hemarthrosis of the knee , limited range of motion , and posterior tibial sag . the knee range of motion was 140 with flexion 140 and flexion contracture 0 after 4 weeks postoperative . a well - padded plaster splint was applied to the knee at 5 to 10 of flexion . on the first day , after surgery , the drain was removed and patients were encouraged to start quadriceps muscle strengthening exercise and begin non - weight bearing walking using crutches . after 2 weeks , protected range of motion exercise was started and partial weight bearing ambulation using crutches was permitted with locked brace in full extension . six weeks later , the brace was unlocked and the patients began full weight bearing ambulation . at 8 weeks , the brace was removed and patients were encouraged to increase activity gradually . a 20-year - old man presented with a right knee injury resulting from a motor vehicle accident . clinical examination revealed a swollen knee , limited range of motion and posterior tibial sag at 90 on knee flexion . the knee range of motion was 135 with a flexion 135 and flexion contracture 0 after 2 weeks postoperatively . the patient was able to return to his usual daily activities after postoperative 6 months ( fig . a 13-year - old boy presented with left knee injury resulting from a fall . clinical examination revealed hemarthrosis of the knee , limited range of motion , and posterior tibial sag . the knee range of motion was 140 with flexion 140 and flexion contracture 0 after 4 weeks postoperative . currently , open reduction or arthroscopic fixation is more commonly used in treatment of displaced pcl tibial bony avulsion.3456 ) the latter has both advantages and disadvantages . since the site of attachment of the pcl to the tibia is located deep within the posterior tibial plateau , multiple arthroscopic sutures and tunnels are required , making the procedure more challenging and difficult . furthermore , some authors reported that arthroscopic fixation using suspensory device needs a sizeable drill hole that may break thinner bone fragments.9 ) open reduction can be performed with a traditional s - shaped approach , but this incision is associated with injury to adjacent neurovascular structures . in contrast , we used a less invasive posteromedial approach , which had several advantages , including exposure of the posterior capsule through the gap between the medial head of the gastrocnemius and the semitendinosus muscle . with the approach in this study , it is possible to minimize risks of damage to vessels and nerves , as well as providing satisfactory exposure of the fracture site . similar methods using posteromedial approach with suture anchors are previously reported.6 ) these studies used 2 suture anchors and fixed bony fragment by knotting with the sutures of 2 suture anchors . the most important advantage of the present suture bridge fixation technique with posteromedial incision , is its indication for use regardless of the thickness , size , and comminution of bony fragment . this technique is similar to the double - row , trans - osseous equivalent or suture bridge techniques for rotator cuff repair or internal reduction and fixation of greater tubercle fractures of the humerus . it allows for a simple reproducible anatomic reduction and compression of the fracture fragment , even though the fragment is small or comminuted . furthermore , suture anchor is relatively small , as compared to other fixation devices , such as cannulated screws , wires , sutures , and absorbable screws . the anchor also offers strong purchase , and the attached suture can resist strong tension , resulting in reliable fixation . previous study on anterior cruciate ligament avulsion fracture , reported that suture bridge construct provides superior fixation with regard to ultimate load , as compared with standard screw fixation and suture fixation in biomechanical analysis of suture bridge fixation for tibial eminence fractures.10 ) similarly , the suture bridge mattress fixation in this study may provide enough ultimate load and compressive force to the avulsed fragment and thus maximize the surface area for bony healing . furthermore , there is no risk of causing comminution . in conclusion , the results of the study indicated that the posteromedial approach , combined with suture anchors , is a suitable treatment for isolated tibial avulsion fractures of the pcl .

long non - coding rnas ( lncrnas ) are defined as rna transcripts larger than 200 nucleotides that do not appear to have protein - coding potential . accumulating evidence indicates that lncrnas are involved in tumorigenesis . our work reveals that lncrna fal1 ( focally amplified lncrna on chromosome 1 ) is frequently and focally amplified in human cancers and mediates oncogenic functions .

please summarize the articles given below

maca ( lepidium meyenii walp . ) is an endemic highland crop of the central andes which is grown from central peru to bolivia and northwestern argentina [ 1 , 2 ] . this plant has great potential as an adaptogen and appears to be promising as a nutraceutical in the prevention of several diseases . maca roots have been traditionally used to increase the rate of fertility in both humans and livestock . over the past 20 years , commercial maca products have gained popularity as dietary supplements for aphrodisiac purposes and for increasing fertility and stamina . recently , maca industry develops fast in yunnan province , china . in yunnan , until the end of 2010 , maca growing and promotion areas reached 175 hm and maca yield achieved 780 t , taking up to 90% and 93% , nationwide . mineral elements in food are very important because the quality of many functional foods and medicines depends on the content and type of minerals . in the us , national surveys show that micronutrient inadequacies are widespread and mineral supplement helps fulfill micronutrient requirements in adults and children . up to now , only limited studies on selected elements in maca from different origins have been carried out [ 10 , 11 ] . moreover , in some studies , no reference material had been certified for elemental analysis , so there has been doubt about accuracy of the determination . in the present study , inductively coupled plasma optical emission spectroscopy ( icp - oes ) was used to determine the contents of eight elements ( b , co , cr , cu , li , na , ni , and zn ) in maca samples , and a comparison was made between the samples from china and peru . standard sample solutions of b , co , cr , cu , li , na , ni , and zn obtained from standard material center of china were used to make a mixed calibration curve in the range of 0400 g ml . ten maca samples were collected from four places of yunnan , china , and four samples were from peru . these samples were washed with deionized water thoroughly , dried to a constant weight , grounded into powder using an agate mortar , passed through a 60-mesh sieve , and stored in the plastic bags . 500 mg of each maca sample was weighed into an acid washed teflon digestion tube . 8 ml of hno3 , 2 ml of h2o2 , and 1 ml ultrapure water were added to the vessel . samples were digested in a microwave dissolver ( ethos one , milestone , italy ) equipped with ptfe vessels . the extract was transferred into a cuvette and made up to 25 ml with ultrapure water . simultaneous multielement detection of b , co , cr , cu , li , na , ni , and zn was performed with icp - oes ( icpe-9000 , shimazu , japan ) . the optimal instrumental conditions for icp - oes are shown in table 2 . blank experiments were prepared in the same way . to ensure the precision of the experiment , the certified reference material gbw10028 ( dried herb powder astragalus membranaceus ) was used for validation of the method ( table 4 ) . the relative standard deviation ( rsd ) was found to be below 8% , and the recoveries range from 92% to 109% , which proved that this method was accurate and precise . contents of b , co , cr , cu , li , na , ni , and zn in maca samples are shown in table 5 . boron affects fat and lipid metabolism , minerals and mineral metabolism , vitamin d , and bone development . our b values in maca from china and peru were 8.121 mg kg dw and 6.612 mg kg dw , respectively , which were in agreement with that reported in the literature ( 8.8 mg kg dw ) . cobalt is an essential micronutrient in the form of vitamin b12 , but cobalt is toxic in larger doses or long - term exposure at a low level . the adverse effects of cobalt relate to various organs and tissues and may include a possible carcinogenic potential . the contents ( mg kg dw ) of co , cr , and li were , respectively , < 0.023 , < 1.13.5 , and 0.0200.17 for the samples from china and < 0.023 , < 1.12.3 , and 0.0350.063 from peru . up to now , there was no other report on the contents of co , cr , and li in maca . its compounds show vast array of biological actions , such as anti - inflammatory , antiproliferative , and biocidal activities . cu contents in the samples from china ( 2.531 mg kg dw ) were higher than the samples from peru ( < 2.1 mg kg dw ) . published data available on cu in maca from china were 4.032 mg kg dw [ 10 , 11 , 13 , 18 ] , while those from peru were 1.562 mg kg dw [ 10 , 11 , 1922 ] . 302600 mg kg dw which is similar to the value ( 672400 mg kg dw ) in maca from china in literatures [ 11 , 13 , 18 ] . however , our data on na in the samples from peru ( < 3041 mg kg dw ) are lower than the values reported ( 110190 mg kg dw ) in the literatures [ 11 , 1922 ] . the contents of ni in the samples were 0.0854.5 mg kg dw from china and 0.681.7 mg kg dw from peru . however , higher value ( 11.3 mg kg dw ) was found in the literature on the maca from china . zinc is essential for a number of physiological functions and plays a significant role in many enzyme actions in the living systems . zn contents in samples were found to be 1939 mg kg dw from china and 2739 mg kg dw from peru , which were in accordance with the values for maca in literature available ( 2589 mg kg dw from china and 1658 mg kg dw from peru ) [ 10 , 11 , 13 , 1822 ] . cu contents in all of the maca samples from china , as well as na contents in two samples from china , were remarkably higher than those values in other samples . myrtle ( myrtus communis l. ) is an evergreen shrub belonging to the family of mirtaceae that grows spontaneously throughout the mediterranean area . in italy it grows along the coast and in the inner hills , and it is spread especially in the islands , where it is one of the most characteristic species . myrtus communis had history in the popular and traditional medicine : the essential oil obtained from leaves and , sometimes , flowers and berries has been used for its tonic and balsamic properties , and it is used in flavour and fragrance industries . in sardinia natural formations are still the main source for the production of a traditional liqueur , that every year reaches 3 million bottles . essential oils are gaining remarkable interest for their potential multipurpose use as antioxidant , antibacterial , and antiseptic agent [ 14 ] ; the essential oil obtained from the leaves was used in the past for the treatment of lung disorders . the isolation of essential oils from myrtus communis leaves is usually obtained by hydrodistillation method with a clevenger - type apparatus , according to the italian official pharmacopoeia . the chemical composition of the essential oils , analysed by gas / cromatography ( g / c ) , generally exhibits -pinene , 11% ; 1,8-cineole , 16% ; linalool , 12% ; -terpineol , 7% ; and limonene , 5% . the sardinian myrtle oil is characterized by the lack of myrtenyl acetate and by a higher content of limonene . . showed the biological activities of tannins , including anticancer and antioxidant . in our previous studies ( data not published ) the antimicrobial properties of myrtus essential oil against several clinical strains and in particular against helicobacter pylori were studied , and we obtained encouraging results . considering these results , in this study , we have used this essential oil towards strains of m. tuberculosis and strains of mycobacterium avium subsp . in this study we investigated the antimicrobial properties of the essential oil of myrtus communis against two reference strains : m. tuberculosis h37rv ( virulent strain ) and m. tuberculosis h37ra ( avirulent strain ) and 8 clinical isolates of m. tuberculosis resistant to one or more drugs , collected in the department of biomedical sciences , microbiology of the university of sassari , italy . we also studied the antimicrobial properties of the essential oil towards two human strains of mycobacterium avium subsp . the antibacterial activity of the oil was assessed by the proportional method used for mycobacterium tuberculosis as described in nccls - national committee for clinical laboratory standards . briefly , isolate suspensions of m. tuberculosis in 7h9 broth were adjusted to an optical density of 1 mcfarland , and two dilutions , 10 and 10 , were plated onto 7h10 agar with a different concentration of essential oil ( 16% , 14% , 12% , 10% , 8% , 4% , 2% , 1% , and 0.17% v / v ) . we also investigated the antimicrobial properties of some components of m. communis and , in particular , limonene , 1 - 8 cineole and -pinene , using the proportional method . in table 1 we report the data obtained with the essential oil in toto . towards all the strains of m. tuberculosis , including the extensively drug - resistant ( xdr ) , the oil of m. communis tested showed an mic of 0.17% ( v / v ) , whereas against the two m. paratuberculosis strains showed an mic of 2% ( v / v ) . subsequently we tested each different compound ( limonene , 1 - 8 cineole , -pinene ) to see if it had different antimicrobial properties . as far as limonene concerned , it showed towards all the strains an mic of 2% ( v / v ) ; about 1 - 8 cineole , for 4 strains , including h37rv , the mic was of 2% ( v / v ) , while the mic shown for other 4 strains was of 16% ( v / v ) ; -pinene showed an mic of 1% ( v / v ) for 3 strains , and for one strain an mic of 2% ( v / v ) , for 3 others an mic of 8% ( v / v ) , and for only one mic was of 16% ( v / v ) ( table 2 ) . limonene and -pinene are monoterpenic that , according to the literature , are used as expectorant , antalgic , revulsive , antitussive , mucolitic , and decongestant ; about 1 - 8 cineole it is an oxide used as expectorant , mucolitic , and decongestant . we compared the activity of our essential oil with four standard antitubercular drugs : streptomycin , isoniazid , rifampin , and ethambutol , performing according to international protocols . two clinical strains were rifampicin resistant , three strains were resistant to 2 drugs ( one streptomicin and rifampicin resistant , one streptomicin and isoniazid resistant , and one isoniazid and rifampicin resistant ) , one was resistant to 3 drugs ( streptomicin , isoniazid , and ethambutol ) . the essential oils screened in toto have a better antimicrobial activity than each single compound against all mycobacteria tested . the results presented here may contribute to the knowledge of the antimicrobial properties of myrtle and our aim is to carry on further studies . the chemical composition of the essential oil of m. communis exhibited qualitative differences that depended on different geographical areas and from the season in which the leaves were picked up . the essential oil that we used for antimicrobical in vitro assay contained a high quantity of monoterpenic and oxide that , according to literature , do not have antimicrobical activity . from our studies emerged that the essential oil in toto might have a good activity towards m. tuberculosis , although the individual compounds ( except -pinene ) showed in all the strains a higher mic . the results from the myrtle oil in toto showed a good activity towards m. tuberculosis but not toward m. paratuberculosis . the mic registered against m. tuberculosis was 0.17% ( v / v ) in comparison with an mic of 2% ( v / v ) observed toward m. paratuberculosis . a limit of our study is the small amount of the essential oil that did not allow to perform the mic towards all the strains used . testing and large clinical studies are necessary to verify the potential use of the essential oils of myrtle as antitubercular drug . given the excellent results that we obtained in this study , we would expand the research with further studies , to value the possible cytotoxic effects , and eventually to perform tests using in vivo mouse model .

contents of eight mineral elements in maca ( lepidium meyenii walp . ) from china and peru were determined by inductively coupled plasma optical emission spectroscopy . cu contents in maca samples from china ( 2.531 mg kg1 dry weight , dw ) were higher than the samples from peru ( < 2.1 mg kg1 dw ) . na in two samples from china was found to be significantly of high content ( 2400 and 2600 mg kg1 dw ) . the contents ( mg kg1 dw ) of b , co , cr , li , ni , and zn were , respectively , 8.121 , < 0.023 , < 1.1~3.5 , 0.0200.17 , 0.0854.5 , and 1039 for the samples from china , while being 6.612 , < 0.023 , < 1.1~2.3 , 0.0350.063 , 0.681.7 , and 2739 for the samples from peru .

please summarize the articles given below

additional supporting information may be found in the online version of this article at the publisher 's web site . a dna sequence contains six potential open reading frames ( orfs ) , three on one strand and three on the reverse strand . however , typically only one of the six is actually expressed because it is associated with appropriate genetic signals that specify the dna strand and the reading frame to be transcribed and translate . exceptions occur in which more than one open reading frame is translated into a protein , as has long been observed in the case of viral genes , where it was suggested that this property permitted a high packing density of information ( 1 ) . however , analysis of the coding potential of 481 prokaryotic genomes revealed the surprisingly high frequency of alternate orfs of annotated genes especially in high g + c rich genomes , where almost every annotated orf exhibits an alternative orf that could potentially encode a protein of 100 amino acids or more ( 2 ) . the frequency of alternate open reading frames in high g + c genomes gives rise to the possibility that this property could be exploited to evolve novel genetic information and it is important to be able to detect this potential . however , this high frequency also provokes serious problems of gene annotation , where the incorrect orf may inadvertently be mis - annotated as the coding sequence . this potential for error is especially problematic when automatic gene prediction programs are used to annotate genomes , but errors can also slip by human annotators . the problem is exacerbated if an alternative orf is mis - annotated and the error is propagated in subsequent genome annotations . alterorf provides a searchable database of all possible alternative orfs in sequenced prokaryotic genomes that are potentially capable of encoding proteins of 100 amino acids or more . the objectives are 2-fold : to improve genome annotation by indicating possible errors in orf identification and , perhaps more important in the long term , to predict instances of genes that potentially could give rise to more than one protein . annotated protein coding genes were extracted from completely sequenced prokaryotic genomes in the genome database of ncbi . all alternative orfs , potentially encoding 100 amino acids or more , were extracted from each gene sequence using perl scripts and the bioperl application programming interface ( api ) ( 3 ) . using the standard genetic code , the in silico translated amino acid sequence of each alternative orf was searched for similarity in completely sequenced prokaryotic genomes ( 4 ) and for conserved domains and motifs using cdd ( 5 ) , pfam ( 6 ) , cog ( 7 ) , kog ( 8) , smart ( 9 ) and uniprot . ( 10 ) . hierarchical clustering using the software hcluster_sg developed as part of the treefam project ( 11 ) was used to build sequence families with the alternate orfs . blast e - values were normalized from 0 to 100 ( with 100 corresponding to e - value 0.0 ) . the resulting information was stored in a relational database built with microsoft sql server 2005 . release 1.0 ( september 2007 ) contains approximately 1.5 million annotated genes from 481 organisms and about 3 million alternate orfs . of these 942 856 ( 33% ) occur in frame 1 , 621 306 ( 21% ) in frame 2 , 322 284 ( 11% ) in frame 3 , 350 805 ( 12% ) in frame + 2 and 675 525 ( 23% ) in frame + 3 . the following are provided for each alternate orf sequence : ( i ) conserved domains and motifs including cdd ( 5 ) , pfam ( 6 ) , cog ( 7 ) , kog ( 8) , smart ( 9 ) and uniprot . ( 10 ) and ( ii ) blast results with annotated sequences in completely sequenced prokaryotic genomes and alternate orfs identified in alterorf . the cross genera conservation of some alternate orfs suggests that they might represent new protein families or domains and hierarchical clustering ( 11 ) was used to build sequence families from conserved alternate orfs . the alterorf database can be accessed through a simple and easy to use web interface at www.alterorf.cl . the database can be searched by protein i d ( derived from ncbi ) , by organism and by sequence using a sequence search service . in addition , an option is provided to analyze complete genome sequences not present in the database . searching by protein i d : a protein i d can be used to recover the original annotated gene that appeared in the database ( e.g. genbank ) , and also any alternate orf(s ) associated with that gene . if alternate orfs are detected , tables providing information regarding domains , motifs and protein family are displayed with links to further information . searching by organism : the user can select an organism from a pulldown menu or index for a pre - analyzed list of annotated protein coding genes with alternate orfs . searching by protein sequence : a search using a protein sequence can be carried out against all sequences stored in alterorf using wu - blast ( blast.wustl.edu/ ) . downloading data : all data in the alterorf database can be freely downloaded by ftp . additional information on the use of alterorf can be found in the faqs and tutorial sections .

this report describes that a regular positive electrospray ionization mass spectrometry ( ms ) analysis of terpendoles often causes unexpected oxygen additions to form [ m + h + o]+ and [ m + h + 2o]+ , which might be a troublesome in the characterization of new natural analogues . the intensities of [ m + h + o]+ and [ m + h + 2o]+ among terpendoles were unpredictable and fluctuated largely . simple electrochemical oxidation in electrospray ionization was insufficient to explain the phenomenon . so we studied factors to form [ m + h + o]+ and [ m + h + 2o]+ using terpendole e and natural terpendoles together with some model indole alkaloids . similar oxygen addition was observed for 1,2,3,4-tetrahydrocyclopent[b]indole , which is corresponding to the substructure of terpendole e. in tandem ms experiments , a major fragment ion at m / z 130 from protonated terpendole e was assigned to the substructure containing indole . when the [ m + h + o]+ was selected as a precursor ion , the ion shifted to m / z 146 . the same 16 da shift of fragments was also observed for 1,2,3,4-tetrahydrocyclopent[b]indole , indicating that the oxygen addition of terpendole e took place at the indole portion . however , the oxygen addition was absent for some terpendoles , even whose structure resembles terpendole e. the breakdown curves characterized the tandem ms features of terpendoles . preferential dissociation into m / z 130 suggested the protonation tendency at the indole site . terpendoles that are preferentially protonated at indole tend to form oxygen addition peaks , suggesting that the protonation feature contributes to the oxygen additions in some degrees . 2014 the authors . journal of mass spectrometry published by john wiley & sons , ltd .

please summarize the articles given below

with the development of chemotherapy , control of metastatic colorectal cancer has increased in recent years . aggressive resection of distant metastases , local recurrence , or peritoneal dissemination has been performed , and good results have been reported [ 1 , 2 ] . particularly , aggressive resection has been recommended for hematogenous metastasis ; however , in pulmonary resection , the presence of mediastinal lymph node recurrence has been reported as a poor prognostic factor . recommendations for the resection of distant lymph node metastasis are lacking , but it is thought that solitary metastatic lesions should be resected . the development of various diagnostic imaging such as pet / ct has contributed enormously to performing preoperative staging and detecting postoperative recurrence . here , we present the case of a patient who had a solitary swollen mediastinal lymph node with high accumulation on pet / ct after primary resection of rectal cancer . however , histopathological results showed no metastasis , and he was diagnosed with reactive lymphadenitis . we report 1 case study of false - positive diagnosis on pet / ct and compare our findings with previous literature . a 60-year - old patient presented with positive fecal occult blood and was subsequently diagnosed with rectal cancer ( rs ) . histopathological examination revealed moderately differentiated adenocarcinoma , and the pathological stage was pt3n1m0 , pstage iiia ( fig . the oral fluoropyrimidine agent s-1 ( 80 mg / m per day , administered for 4 weeks with a 2-week resting period ) was administered for adjuvant chemotherapy . on postoperative day 239 , a ct scan revealed a solitary swollen mediastinal lymph node ( fig . 2a ) . the patient reported no symptoms of common cold , no palpable lymph nodes , and no murmur in the chest . laboratory data , including blood count , biochemical findings , and c - reactive protein , were within normal range . the serum cea level was also normal ( 1.8 ng / ml ; normal value , < 5.0 ng / ml ) ; before primary surgical treatment , it was 5.8 ng / ml . t2-weighted mri showed iso - high intensity , and diffusion - weighted mri showed a high signal at the tracheal bifurcation ( fig . pet / ct was performed , and abnormal f - fdg uptake appeared in the tracheal bifurcation . thoracoscopic mediastinal lymph node resection was performed in the prone position on postoperative day 281 . the surgical procedure was as follows : ( 1 ) a 12-mm port was inserted into the fifth intercostal space on the posterior axillary line with an 8-mm hg pneumothorax ; ( 2 ) a 12-mm camera port was inserted into the ninth intercostal space on the lower scapula line ; ( 3 ) a 5-mm port was inserted into the seventh intercostal space on the posterior axillary line . on histopathological examination , the resected specimen measuring 33 22 mm in diameter showed enlarged germinal centers without an epithelial component . immunostaining was performed to detect follicular lymphoma ; bcl-2 was negative , and the patient was diagnosed with reactive lymphadenitis ( fig . oral capecitabine ( xeloda , 3,600 mg per day , administered for 2 weeks with a 1-week resting period ) was administered for 6 months . imaging follow - up was performed 2 months after thoracoscopic lymph node resection by ct scan . we confirmed that the suspicious lymph node was resected and other recurrent lesions did not appear . the patient is alive at more than 15 months after his second surgery and is being followed up closely . since the publication of colorectal cancer treatment guidelines in japan , providing appropriate treatment for these patients has become mandatory . therefore , accurate preoperative diagnosis is important , and postoperative recurrence must be evaluated accurately by various methods of diagnostic imaging . given the advent of fdg- pet and pet / ct in recent years , pet imaging has become essential for improving the detection rate . studies have reported that pet imaging is more useful than mri or multidetector - row ct ( mdct ) [ 4 , 5 ] . however , in colorectal cancer , the diagnostic capability for lymph node metastasis ( reported as 2951% sensitivity , 85100% specificity , and 6775% diagnostic accuracy ) is insufficient compared to that for the primary tumor [ 6 , 7 , 9 ] . especially for sensitivity , diffusion - weighted mri is more useful than fdg - pet . in our hospital , the diagnosis rate of lymph node metastases using preoperative pet / ct for 42 patients with colorectal cancer tended to be lower in specificity ( 77% sensitivity , 71% specificity , and 74% accuracy ) . generally , local inflammation , abscess formation , inflammatory diseases , and lymphomas may be considered as the causes of false - positive lymph nodes on pet . although false - positive para - aortic lymph nodes are occasionally identified on pet , to our knowledge , pet false - positive cases associated with colorectal cancer in mediastinal lymph nodes have not been found . the use of pet / ct for identification of mediastinal lymph nodes has been reported . physiological accumulation is often observed in hilar lymph nodes and has the following features : ( 1 ) nearly equal accumulation intensity on both sides , and ( 2 ) no swollen lymph nodes in the mediastinum on ct . on the other hand , solitary mediastinal lymph node metastases of cases of colorectal cancer the present case did not meet the features of physiological accumulation in hilar lymph nodes and showed a solitary enlarged lymph node , high suvs , and high intensity on diffusion - weighted mri . therefore , we diagnosed the patient with mediastinal lymph node metastasis of colorectal cancer and performed surgical treatment . on the other hand , less invasive surgery is desirable for surgical treatment , and advances in video - assisted surgery have been remarkable in recent years . thoracoscopic esophagectomy has become widespread because it provides a magnified view and an easier approach to the mediastinum . the biggest advantage of the prone position is a good view of the surgical field without displacing the heart and right lung because of gravity and artificial pneumothorax . our case maximized the benefits of the prone position , and the patient had a good postoperative course . even though histopathological findings showed lymphadenitis , the patient had no distinct physical findings and inflammatory response . the possibility of viral infection can not be ruled out , although it was difficult to diagnose correctly before surgical treatment . in cancer treatment , it is necessary to decide the appropriate strategy on a case - by - case basis with due consideration of the limits of various methods of diagnostic imaging . moreover , evaluations of pre- and postoperative colorectal cancer recurrence and metastasis using integrated fdg pet / contrast - enhanced ct have been reported . kitajima et al . reported 170 postoperative cases , with 93.2% sensitivity , 95.8% specificity , and 94.7% accuracy . there is no consistent strategy for appropriate treatment of solitary lymph node metastasis in colorectal cancer patients . especially for pet - positive lesions , both sensitivity and specificity may be insufficient . mediastinoscopy and needle biopsy with bronchoscopy are useful methods ; however , the possibility of disseminated cancer cells remains . in conclusion , our case report suggests that it is necessary to understand the limits of the diagnostic accuracy of pet / ct in determining the indication for surgical treatment . additionally , the thoracoscopic approach in the prone position is one of the easy - to - use approaches to the mediastinum . colistin belongs to the polymyxin class of antibiotics which is a group of cationic polypeptides . however , the popularity rapidly faded in 1970s because of significant renal and neurological toxicity and was replaced with less toxic antibiotics with a comparable or broader antibacterial spectrum such as aminoglycosides . with the recent emergence of multi drug - resistant ( mdr ) gram - negative organisms , in particular pseudomonas aeruginosa , acinetobacter baumannii , and klebsiella pneumonia , colistin has been reconsidered as a potential therapeutic agent for the past 10 - 15 years . this has not only increased the clinical usage of this ancient drug , but has also increased the prevalence of all the toxicities related to colistin . neurotoxicity is the second most common toxicity after nephrotoxicity following colistin therapy . among the various manifestations of its neurotoxicity , several cases of respiratory failure due to colistin were reported in the previous era . however , a 31-year - old white female with history of spina bifida , paraplegia , hydrocephalus status post ventriculo - peritoneal shunt , osteomyelitis of the left hip status post left leg amputation , and chronic sacral decubitus ulcer presented with foul smelling discharge from her sacral wound for 2 weeks . the culture from the wound grew two biotypes of pseudomonas aeruginosa : one was resistant to all antibiotics except for colistin while the other was resistant to all antibiotics except for colistin and imipenem . in addition , methicillin - resistant staphylococcus aureus ( mrsa ) grew from the intraoperative bone culture . she was started on colistimethate sodium ( cms ) 200 mg intravenously every 12 hours for her mdr p. aeruginosa . she was then discharged to a sub - acute rehabilitation center on cms and vancomycin . after three days , she was noted to have sudden respiratory distress in the sub - acute rehabilitation center for which emergency medical service ( ems ) was called . on arrival she was immediately started on bag - valve mask ventilation ( bvm ) and was taken to the emergency room ( er ) . in the er , she was noted to have oxygen saturation at 80s on bvm and was emergently intubated . shortly after resuscitation , her arterial blood gas analysis revealed ph of 7.45 , paco2 of 25 , and pao2 of 280 mmhg ( on fio2 of 100% ) . her labs were significant for leukocytosis with white cell count of 20,000/mm and an acutely elevated creatinine of 2.2 mg / dl ( baseline creatinine was 0.9 mg / dl at the time of discharge ) with metabolic acidosis with bicarbonate of 18 mmol / l secondary to her renal failure . on further inquiry , there was no exposure to any narcotics or muscle relaxants that might have contributed to her respiratory depression . she was in a supervised unit prior to the presentation , which deterred the possibility of any toxic exposure to the patient . two sets of blood cultures were negative while the wound culture revealed the same biotypes of mdr p. aeruginosa . neurological workup was unrevealing and ventilation / perfusion scan ( v / q scan ) for pulmonary embolism was low probability . colistin was stopped as it was thought to be the cause of renal failure and respiratory failure and the patient was started on imipenem . her respiratory and neurological status remained stable during hospitalization and tolerated imipenem and vancomycin for her osteomyelitis and chronic decubitus ulcer infection . our patient developed acute respiratory failure requiring intubation and mechanical ventilation 6 days after initiation of colistin . respiratory muscle paralysis , as depicted , is one of the manifestations of the neurotoxic effect of colistin . we applied the naranjo adverse drug reaction probability scale to our case , which indicated a probable relationship . the case is limited with the unavailability of arterial blood gas prior to the event as she was emergently intubated on presentation . also , since colistin is reserved for severely ill patients with multiple co - morbidities , it may be difficult to establish direct causal relationship for acute respiratory failure and colistin . colistin was most likely to be the culprit of her respiratory failure from the timing of apnea as well as rapid recovery after stopping colistin . acute renal failure leading to presumed high concentration of serum colistin may be another contributory factor for her respiratory failure . she had a chronic deep vein thrombus which is unlikely to cause acute respiratory failure since low probability for pulmonary embolism by v / q scan and she recovered within 24 hours without any intervention . reported cases of respiratory paralysis associated with polymyxin / colistin use since 1960 to present colistin is also called polymyxin e and is a part of polymyxin family which is a group of polypeptide antibiotics . it exerts its bactericidal effect by displacing the divalent cations magnesium and calcium , which stabilize anionic lipopolysaccharide molecules in the outer membrane of gram - negative bacteria . however , they were gradually abandoned in most parts of the world because of nephrotoxicity and neurotoxicity . the emergence of mdr gram negative bacteria led to the revival of polymyxins in more recent era as a valuable therapeutic option . in the last decade , intravenous polymyxins , particularly in the form of cms , have been used to treat serious p. aeruginosa and a. baumannii infections of various types , including pneumonia , bacteremia , and urinary tract infections . the major manifestations of colistin induced neurotoxicity include dizziness , weakness , facial and peripheral paresthesias , vertigo , visual disturbances , confusion , ataxia , and neuromuscular blockade . koch - weser et al . , reported the incidence of the neurotoxic manifestations to be about 7% , paresthesias being the most common . the proposed mechanism is a non - competitive myoneuronal presynaptic blockade of acetylcholine release , in contrast to the competitive blockade by most other antibiotics like neomycin , kanamycin , and streptomycin . a total of 32 cases of colistin / polymyxin - induced respiratory failure were found in the literature . recent studies have depicted the toxicities associated with colistin use to be less frequent than previously described . the most important risk factor known to be associated with respiratory failure with polymyxin use is the renal disease , which was present in 24 out of 29 patients reported . patients with preexisting renal insufficiency had a greater likelihood of developing nephrotoxicity during colistin therapy , compared to patients with normal baseline renal function . concomitant drug therapies also play a major role in potentiating the effect of neuromuscular blockade , which was noted in 11 out of 29 patients . this includes use of other neurotoxic drugs ( anesthetics , aminoglycosides , and paralytics ) , corticosteroids , narcotics and/or muscle relaxants . most of the cases had other neuromuscular symptoms like circumoral tingling , paresthesias , and restlessness prior to the development of respiratory failure . the duration of apnea lasted from few hours up to several days , maximum noted to be 11 days and 20 out of 29 patients recovered , indicating reversibility of the blockade . the number of doses prior to the respiratory failure seems to be variable and range from a single dose to 45 doses [ table 1 ] . the management of patient with respiratory failure induced by colistin involves discontinuation of the drug and respiratory support . intermittent monitoring of unassisted tidal volumes and forced vital capacity using a bedside spirometer will help determine recovery . monitoring arterial blood gas more importantly , one should be alert for the possibility of respiratory paralysis in any patients receiving this antibiotic and particularly in those patients with renal abnormality and with concomitant neurotoxic drug use . careful observation , regular neurological monitoring , and early appreciation of the symptoms of neuromuscular toxicity especially of dyspnea and restlessness may prevent respiratory arrest . neostigmine is not indicated in polymyxin or colistin - induced neurotoxicity and may be contraindicated as seen in earlier experiments that the blocking action of polymyxin b was shown to be neostigmine resistant . animal studies have noted the ability of polymyxin b to discharge histamine from tissue mast cells , which lead to deposition of chelated calcium along the nerve sheaths , leading to toxicity . higginbotham also reported use of heparin prevents death from respiratory arrest in mice receiving colistin . the use of antihistamines and heparin in polymyxin induced respiratory failure has not been studied in human subjects . as the use of colistin increased in recent years for treatment of life - threatening mdr infections , there are more reports of associated toxicities . clinicians should be aware of colistin - related adverse reactions , especially nephrotoxicity and neurotoxicity . since the formulation of the drug itself has changed , it has necessitated new data with the new formulation . regular monitoring of renal function as well as development of a tool to monitor neurological toxicity is essential to prevent and manage the toxicities associated with colistin use .

18f - fluorodeoxyglucose ( fdg ) positron emission tomography and computed tomography ( integrated fdg pet / ct ) has been used to diagnose recurrence and differentiate postoperative changes from lymph node metastasis in colorectal cancer , although its accuracy is questionable . we report a prone thoracoscopic surgery for a rectal cancer patient in which false - positive mediastinal lymph nodes were found on fdg - pet / ct . a 60-year - old man underwent a laparoscopic high anterior resection and d3 lymph node dissection for rectal cancer . the histopathological diagnosis was moderately differentiated adenocarcinoma of the rectum , stage iiib ( pt3n1m0 ) , necessitating oral fluoropyrimidine agent s-1 . after the primary surgery , a solitary mediastinal lymph node measuring 30 mm in diameter was detected , and abnormal accumulation was confirmed by fdg - pet / ct ( suvmax , 11.7 ) . thoracoscopic resection was performed in the prone position , but histopathological results showed no metastasis . he was subsequently diagnosed with reactive lymphadenitis . the patient was discharged on postoperative day 4 in good condition and is alive without recurrence 12 months after surgery . pet / ct is useful for the detection of colorectal cancer recurrence ; however , it does have a high false - positive rate for mediastinal lymph nodes . there is a limit to its diagnostic accuracy , and one must determine the indication for surgical treatment carefully . surgery in the prone position is a useful and minimally invasive approach to the mediastinum and allows aggressive resection to be performed .

please summarize the articles given below

variations in time , temperature , concentration , ph , and relative humidity may affect the sporicidal activity of various agents . accordingly , and especially for real - world situations , attention must be paid simultaneously to more than one controllable or uncontrollable factor . in tables 1 and 2 and in the discussion , we address some of the key ancillary factors . spores in liquid suspension exposed to flowing steam at 100c . rh , relative humidity ; conversions : 1 ppm = 1 mg / l ; mol / l = gram molecular weight / l ; 1 rad = 100 ergs / g ; and 1 watt = 10 ergs / s . boiling water for > 10 minutes , for example , can reduce b. anthracis spore counts by at least 10 ( table 1 ) . variations in time and temperature conditions required to reduce spore counts listed in table 1 can be attributed to differences in experimental conditions , strains of b. anthracis tested , or inoculum size . the u.s . environmental protection agency indicates that use of sodium hypochlorite as a sporicide is applicable under an emergency exemption ( section 18 : crisis exemption ; federal insecticide , fungicide , and rodenticide act ) ; as such , sodium hypochlorite may be used under the conditions specified ( 32 ) . given these conditions , the sporicidal effectiveness of hypochlorite solutions depends on the concentration of free available chlorine and ph . common household bleach ( sodium hypochlorite ) has a ph of 12 to prolong its shelf life . to achieve effective sporicidal activity , bleach must be diluted with water to increase the free available chlorine and acetic acid to change the ph of the solution to 7 ( 11 ) . ethylene oxide penetrates into porous material ( absorbed strongly by rubber and many plastics ) ; thus vapors are not readily eliminated by brief aeration . residual spores were not completely killed after a 30-minute exposure to chlorine dioxide at a relative humidity of 20% to 40% , whereas all spores were killed after a 15-minute exposure to chlorine dioxide with the addition of prehumidification at a relative humidity of 70% to 75% ( 21 ) . the amount of contamination , level of cleanliness of surfaces , and relative humidity will contribute to peracetic acid vapor s effectiveness as a sporicide ( 24 ) . the sporicidal property of ozone is affected by relative humidity : as relative humidity decreases , the time required for killing organisms increases ( 27 ) . decontamination of buildings from intentional release of b. anthracis is a new problem , and no accumulated scientific knowledge exists on the subject . two areas of prior scientific research may be relevant : food processing and laboratory decontamination . with modification based on further study , direct information on killing b. anthracis spores in foods by cooking is scarce , and the complexity of food matrices precludes easy extrapolation of the laboratory data into nonfood matrices . however , information on inactivating spores of bacterial species more resistant to environmental conditions than b. anthracis can provide guidance . the spores of clostridium botulinum are more resistant to heat inactivation than are b. anthracis spores ( 4 ) . the commercial retort process of canning achieves a 12-log reduction of c. botulinum spores , and by extension , should achieve a similar killing rate for b. anthracis spores . further research in this area is needed . historically , formaldehyde solution or gas has been used both as a disinfectant and chemical sterilant . formaldehyde was used to disinfect as early as the late 1880s and is still used to reprocess hemodialyzers for reuse on the same patient and to decontaminate biologic safety cabinets and laboratories ( 3537 ) . formaldehyde gas has been used for fumigation in the poultry industry and for disinfection of biologic safety cabinets and laboratories ( 38,39 ) . data from controlled experiments with b. globigii nctc 10073 spores have demonstrated the effect of humidity on formaldehyde concentration ( mg / m ) to obtain a > 8-log reduction in viable spores ( 15 ) . / l ) has also been used to treat a textile mill contaminated with b . gamma radiation was used in the 1960s and 1970s to disinfect b. anthracis contaminated imported bailed goat hair . a study by horne et al . suggested that a dose of 1.5 megarads from a 200,000-rad / hour cobalt source was sufficient to kill most resistant spores when mixed with goat hair ; after the intentional release of b. anthracis through the postal system in 2001 , pursuing a decontamination method for the undelivered mail was essential . gamma radiation was used to decontaminate all mail from contaminated facilities on the basis of these data . multiple technologies may be needed to decontaminate buildings and their contents . as in a laboratory , where some items are wiped , some items are autoclaved , and some spaces are treated with gas , more than one method may be required for decontamination . also , for certain decontamination tasks , e.g. , cleaning small heat - proof and water - proof objects , more than one option will be available . further , even within the context of one type of application ( e.g. , walls ; ducts for heating , ventilating , air conditioning , and refrigeration ; carpet ; and small objects ) , potentially conflicting priorities exist between bioefficacy , logistics , and safety . although transferring the methods used to decontaminate or sterilize laboratory or food industry settings to decontaminating buildings may be useful , this transfer of methods has not been scientifically tested . also , much of the data available is based on other bacillus species ; more testing with or correlation to b. anthracis contamination is suggested . second , choosing between technologies is a complex issue , and a formal decision process would be useful . various parties in the public and private sector have suggested numerous , sometimes disparate , methods for the inactivation of b. anthracis spores in contaminated environments . further research is needed regarding improved methods for remediation of environments contaminated with b. anthracis spores , and the literature summarized here provides a basis for that effort . deep brain stimulators ( dbs ) are increasingly used to treat carefully selected cases of movement disorders , pain , and psychiatric disorders that respond poorly to medical therapy . anaesthesiologist may be involved in the implantation procedure or more frequently when these patients present for non - related medical or surgical illnesses . patients with long standing parkinson disease ( pd ) with dbs for surgery pose significant challenges to the anaesthesiologist in view of primary pathology , multisystem involvement , potential drug interactions , and risk of dbs malfunction by interference with monitoring and therapeutic electromagnetic devices . on reviewing the literature , we did not find any published report of shoulder arthroscopic surgery in a patient of pd with dbs and report the same . fifty - nine - year - old female presented to our hospital for arthroscopic repair of rotator cuff tear of right shoulder caused by a fall . she was a known case of pd since last 20 years with the history of slowing of movements , stiffness , speech disturbance , and tremors controlled only after the implantation of dbs 8 years back . she gave the past history of snoring , mild gastro - oesophageal reflux , depression , laparoscopic cholecystectomy , and three surgeries related to dbs . her medical therapy included tablet l - dopa plus carbidopa , bromocriptine , clonazepam , escitalopram , and trihexyphenidyl . patient weighed 80 kg , 155 cm tall ( body mass index 32 kg / m ) with a mouth opening of 4.5 cm , removable complete artificial denture , mallampati grade 3 , limited neck extension , and a thyromental distance of 6.2 cm . her pulse rate was 96/min , noninvasive blood pressure ( nibp ) 135/84 mmhg , breath holding time 20s , and chest auscultation was normal . examination of central nervous system revealed cog - wheel rigidity , short shuffling gait , and mild tremors . chest radiograph showed ipg with leads of dbs on the left side , which was otherwise normal [ figure 1 ] . she was assessed by a neurologist , dbs was interrogated , a procedure where battery life and device settings are evaluated and manipulated noninvasively . she was taken up for shoulder arthroscopy with informed high risk consent in view of long standing pd and dbs , kept nil per oral after midnight , and advised to continue all her medications till the morning of surgery along with tablet ranitidine 150 mg . operation room ( or ) and drugs were prepared ; difficult airway cart was kept ready . after placing standard monitors we gave iv midazolam 1 mg and oxygen by facemask . right - sided brachial plexus block by the interscalene approach using a peripheral nerve stimulator ( pns ) was given using 21 g , 50 mm insulated pns needle with 25 ml of 0.25% bupivacaine after eliciting contraction of muscles at and below shoulder at a current of 0.4 ma . after observing for 10 min , she was placed in ramp position ; general anaesthesia was induced with iv fentanyl 100 g , propofol 100 mg , vecuronium 8 mg and trachea was intubated . patient was placed in left lateral position taking care to pad all the pressure points including dbs skin site , eye , and breast care . anaesthesia was maintained with nitrous oxide ( 50% ) and isoflurane ( 0.6 - 0.8% ) in oxygen , iv fentanyl and vecuronium . her baseline heart rate was 80 beats per minute ( bpm ) and remained between 68 - 80 bpm throughout the procedure . baseline bp was 140/80 mm hg , sbp was maintained between 110 - 140 mm hg , dbp was maintained between 66 - 84 mm hg intraoperatively . thirty minutes after the onset of surgical procedure , patient 's bp rose to 190/90 mm hg which was controlled with nitroglycerine infusion ( 0.7 - 1 g / kg / min ) after ensuring adequate analgesia and muscle relaxation . postinduction iv dexamethasone 8 mg for prophylaxis of ponv and diclofenac sodium 75 mg was administered towards the end of surgery . surgeons used 26 1 ( litres ) of normal saline for irrigation of shoulder joint using arthroscopic infusion pump at a pressure of 70 mm hg . arthroscopic repair and subacromial decompression lasted 1.5 h. before closure of arthroscopic ports , fluid was vented out . after turning the patient supine , neck circumference was measured and was same as preoperatively . dbs was turned on by the trained personnel , reprogrammed to its original setting was functional . at return of spontaneous respiratory efforts , patient was conscious , haemodynamically stable and followed verbal commands with a visual analog score of 4 for pain . fifty - nine - year - old lady with pd with dbs in situ with complete rotator cuff tear was successfully managed using general anaesthesia with interscalene approach of brachial plexus block for arthroscopic repair . in contrast to the neurodestructive procedures practiced earlier like thalamotomy and palladotomy , the dbs offers the advantages of reversibility , adjustability , nondestructive nature , and long - term treatment . the high suppressive frequency ( 130 - 180 hz ) of dbs suppresses the overactivity in the pallidum , subthalamic nuclei or thalamus in pd patients . when these patients present for coincidental surgery , functionality of dbs should always be assessed in the preoperative period , precautions should be taken to prevent dbs malfunction intraoperatively and its function should be reassessed postoperatively . technical problems such as wire breakage , migration after insertion , twiddler syndrome ( malfunction of a device due to manipulation of either implantable generator or pacing leads ) should be ruled out . shoulder arthroscopy for the rotator cuff tear requires expansion of glenohumeral and subacromial area by irrigating large amounts of fluids for good visualization . as the subacromial area is uncapsulated , it communicates well via various anatomical planes to the soft tissues of the neck and chest with the risk of fluid extravasation into these areas . it can even cause external compression on the larynx and trachea with life - threatening airway obstruction . in our patient , dbs battery with its leads was located in close vicinity of the operative site . in the absence of the published literature , as an added precaution to prevent dbs malfunction we decided to switch off the dbs after inducing the patient to sleep as she had disabling tremor that was physically and psychologically distressing in the absence of dbs . , pns can be used safely for neuromuscular block assessment and for peripheral nerve blocks . an alternative is ultrasound - guided nerve block , but this modality was not available to us . interscalene block probably contributed to reduction of general anaesthetics as our patient required no vecurinium top - ups and minimal isoflurane . it also contributes to good surgical field with use of lesser amounts of irrigating fluids at a lower pressure , quick emergence from anaesthesia , and good postoperative analgesia . continuous delivery of antiparkinsonian medications during perioperative period is desirable to avoid off symptoms and increased peri- and postoperative complications . alternative routes of administration for continuous drug delivery such as nasogastric or intraduodenal levodopa , iv amantadine , subcutaneous apomorphine , transdermal rotigotine patch may be resorted to in situations where patients are not going to be started orally in the immediate postoperative period . drugs with extrapyramidal side effects such as metoclopramide , phenothiazines , and butyrophenones should be avoided . autonomic dysfunction in our patient with longstanding pd probably contributed to intraoperative rise of blood pressure in our patient . in the view of the presence of dbs , preoperative shoulder injury evaluation of our patient was done by ultrasound rather than mri that is the usual practice . powerful electromagnetic fields of mri can produce heating effects , movement of neurostimulator , induced stimulation , or dbs malfunction . ct scans , fluoroscopy , and plain x - rays can be performed as usual . defibrillator paddles and ground plate of unipolar diathermy should be placed as far from the neurostimulator as possible and perpendicular to it with use of lowest clinically appropriate energy output . after use of diathermy and external defibrillator , adequate function of neurostimulator should be confirmed . in our patient , radiofrequency ablation ( bipolar device ) was used for surgical haemostasis . as the number of patients with dbs are increasing , they can present even for emergency surgery when there is limited time and resources available for assessing the dbs . successful management of a patient of pd with dbs requires meticulous preoperative assessment , planning , continuation of antiparkinsonian drugs , avoidance of drugs precipitating parkinsonian symptoms , and adherence to precautions to avoid dbs malfunction . combination of general anaesthesia with interscalene approach brachial plexus block provides ideal conditions for these patients undergoing shoulder arthroscopy .

after the intentional release of bacillus anthracis through the u.s . postal service in the fall of 2001 , many environments were contaminated with b. anthracis spores , and frequent inquiries were made regarding the science of destroying these spores . we conducted a survey of the literature that had potential application to the inactivation of b. anthracis spores . this article provides a tabular summary of the results .

please summarize the articles given below

the epidermal growth factor receptor ( egfr ) is over expressed in various solid malignancies including non small cell lung cancer ( nsclc ) . however , they are associated with a dermatologic side effects , which can occasionally be responsible for discontinuation of the egfr inhibitors . hence , we report a case of metastatic adenocarcinoma of lung who developed skin ulceration with gefitinib and responded to interruption of the drug and early intervention . the present case report is about a 50-year - old female patient who had been diagnosed as having lung adenocarcinoma with multiple bone metastases was initiated on gefitinib therapy at an oral dose of 250 mg / d . after 2 weeks of initiating therapy , the patient presented with ulcer over the palm [ figure 1 ] . the ulcers improved with stopping gefitinib for 2 weeks and also with the addition of topical steroids and antibiotics . non - small - cell lung cancer ( nsclc ) with sensitive mutations of the egfr is highly responsive to gefitinib . gefitinib is a small molecule tyrosine kinase inhibitor ( tki ) of egfr . since 2004 , it was clear that a substantial proportion of nsclc obtaining objective response when treated with gefitinib harboring activating mutations in the egfr gene . the occurrence of skin disorders ( dry skin and acneiform rash ) is explained by the fact that egfr is also expressed in the basal layer of the skin ; inhibition of the receptor will disturb normal biology and result in skin rash . skin rash is notorious as an adverse event of egfr - tki and is noted in up to two - thirds of patients receiving any of these agents although severe in only 5 - 10% who can develop pyogenic granuloma like lesions . very rarely the cutaneous inflammation is so pronounced that skin necrosis with black eschar formation and ulceration is seen . the cutaneous side - effects are treated with topical steroids and antibiotics with interruption of treatment for 2 - 4 weeks as in our case . crohn 's disease ( cd ) is an autoimmune inflammatory disorder that may involve different sites along the gastrointestinal tract . the disease tends to be more severe and widespread in children and young adults [ 1 , 2 ] . during the last 2 decades , the incidence of cd in childhood has considerably increased [ 2 , 3 ] . pulmonary involvement in cd is well described , and though it is rarely reported in pediatric patients , it may be more common than previously reported . pulmonary cd can be latent or symptomatic , with symptoms manifesting before , during or after the diagnosis of cd . down syndrome ( ds ) has been associated with increased frequency of malignancies , autoimmune diseases and infections . it has been hypothesized that this is due to abnormal precocious aging . however , recent evidence suggests that it is more likely that the immune system in ds is deficient from the very beginning , with immune dysregulation causing a tendency towards autoimmune diseases . in addition to other congenital defects , individuals with ds are also more likely to have structural and functional disorders of the gastrointestinal tract . associations between cd and ds have been reported , though very rarely [ 9 , 10 , 11 , 12 , 13 ] . in our search of the literature , we did not find any reported case of ds with pulmonary cd to date . a 5-year - old girl with known ds and a history of chronic intermittent abdominal pain presented to the emergency department with worsening symptoms . her abdominal pain has previously been attributed to underlying chronic constipation and possible irritable bowel syndrome . workup for her abdominal pain included serologic testing for celiac disease , which showed increased anti - gliadin iga and igg but normal tissue transglutaminase iga . on presentation to the emergency department , an abdominal x - ray was done due to suspicion of constipation , and a chest x - ray confirmed left lower lobe pneumonia . she then returned to the hospital due to persistent fevers and abdominal pain and was admitted for 5 days for intravenous antibiotics . on serial chest x - rays during the hospitalization and after discharge , she seemed to have persistent left - sided and perhilar infiltrates that remained essentially unchanged in appearance . a pediatric pulmonologist was consulted , who felt that she had no symptoms suggestive of asthma , aspirated foreign body , cystic fibrosis , primary ciliary dyskinesia or immunodeficiency . a chest computed tomography ( ct ) scan was done that showed multiple noncalcified pulmonary nodules bilaterally , mainly peripheral in location . the largest nodule measured 8.0 mm and was in the posterior medial aspect of the superior segment of the left lower lobe adjacent to the pleura . the second largest was 7.0 mm in the right pulmonary apex , and another 2 nodules measuring 4.0 mm were seen in the right upper lobe ( fig . 1 ) . two additional 4.0-mm nodular densities were seen in the posterior periphery of the superior segment of the left lower lobe just caudal to the dominant lesion . there were localized patchy reticular nodular infiltrates in an extreme superior aspect of the superior segment of the left lower lobe and similar extensive infiltrates extending from the suprahilar region on the right side into the right pulmonary apex . lymphocyte subsets , immunoglobulin levels and vaccine responses to tetanus and pneumococcus were done , as well as a neutrophil oxidative burst assay for chronic granulomatous disease . neutrophil function showed 74% activity at 48 h , which was considered a normal response and not compatible with a diagnosis of chronic granulomatous disease . her immunoglobulin assay showed an igg level of 1,130 mg / dl ( range 2261,870 ) , an iga level of 218 mg / dl ( range 3155 ) and an igm level of 45 mg / dl ( range 12219 ) . her tetanus antibody level was 0.97 iu / ml , which was considered a normal immunization response . results showed a cd19 b - cell count of 127 cells/l , a cd3 t - cell count of 1,033 cells/l , a cd4 cell count of 605 cells/l , a cd8 cell count of 395 cells/l , and a cd56/16 natural killer cell count of 99 cells/l ; the cd4/cd8 ratio was normal at 1.5 . after a relatively extensive infectious workup , she underwent a bronchoscopy and ct - guided needle biopsy of the lung nodules . the branching pattern also was normal ; however , the right upper lobe bronchus gave only 2 branches compared with the usual 3 branches . broncheoalveolar lavage ( bal ) analysis was performed , and specimens were sent for bacterial , fungal and mycobacterial culture analysis as well as for cytology . no acid - fast bacilli were seen on fluorochrome stain , and culture results showed no organisms even after 56 days of incubation . ct - guided core lung biopsies showed extensive necrosis with surrounding palisading histiocytes , fibrosis and chronic inflammation ( fig . 2 ) . acid - fast bacillus and grocott 's methenamine silver stains were negative for any organisms . these findings , along with the history of chronic abdominal pain , raised concern for primary cd with secondary involvement of the lungs . the esophagogastroduodenoscopy showed localized mild mucosal abnormality characterized by congestion , erosion and inflammation in the 3rd part of the duodenum . a benign - appearing diffuse , severe mucosal abnormality characterized by congestion , discoloration , erythema , erosion , friability , granularity , inflammation and nodularity was found in the entire examined stomach . on colonoscopy , patchy , mild inflammation characterized by congestion ( edema ) , erythema and aphthous ulceration was found in the cecum , ascending colon , transverse colon and descending colon . normal mucosa was seen in the rectum . the gastric biopsy exhibited moderate to focally marked expansion of the lamina propria by a mixed leukocytic population . also present were scattered areas of neutrophils , some of which were present in the surface epithelium . a giemsa stain was performed and demonstrated the presence of bacteria ( these bacteria , however , did not have the usual morphological features of helicobacter ) . both the cecum and ascending colon biopsies exhibited cryptitis as well as eosinophilia of the lamina propria . also present were focal aggregates of histiocytes ( although well - formed epithelioid granulomas were not observed ) . in contrast , the transverse colon and descending colon biopsies showed similar cryptitis and eosinophilia and , in addition , there were scattered epithelioid granulomas . acid - fast bacillus and grocott 's methenamine silver stains were performed on these specimens , and no organisms were seen . she was then started on mesalamine and later on infliximab and methotrexate . with the start of therapy , to our knowledge , this is the first reported case of pulmonary cd in a child with ds . the natural history of pulmonary cd in the pediatric population is not very well studied . furthermore , since ds has been well known to be associated with increased frequency of malignancies and autoimmune conditions due to immune dysregulation , it is difficult to predict the severity and possible complications in this patient .

we report a case of gefitinib - induced skin ulceration in a 50-year - old female with metastatic adenocarcinoma of lung who developed this adverse effect 2 weeks following initiation of gefitinib at a dose of 250 mg / day . the ulcer improved with stopping gefitinib for 2 weeks and also addition of topical steroids and antibiotics . we are reporting this case to create awareness among treating oncologists of this adverse effect and also prompt interruption of therapy and topical steroids / antibiotics is useful to treat this adverse event .

please summarize the articles given below

a 28-year - old man who was known to have fhi in the right eye was referred for secondary iol implantation . six years before referral , his right eye had undergone cataract surgery which was complicated by the capsular rupture and vitreous prolapse , for which the patient received complete anterior vitrectomy with removal of all capsular remnants . the patient was left aphakic and was prescribed with aphakic contact lens ; however , he developed contact lens intolerance over time . on presentation , his uncorrected visual acuity was 20/20 in the left eye and counting finger in the right eye which could be corrected to 20/20 with aphakic correction . slit - lamp examination of the right eye revealed diffuse fine keratic precipitates over the entire corneal endothelium and mild iris stromal atrophy with notable heterochromia . advantages and unknown risks of the surgery were thoroughly explained for the patient and he consented to have secondary iol implantation . under general anesthesia , an iris - claw iol ( artisan , ophtec , groningen , the netherlands ) was implanted in right eye through a limbal incision followed by a superior peripheral iridectomy . enclavation of the iol haptics was easily performed ; no intraoperative complication including hyphema was noted . the latter was prescribed as 0.1% betamethasone every 2 hours while awake for 1 week and then four times a day which was tapered within 6 weeks . postoperative follow - up examinations were performed at 1 , 2 , 3 , 5 , and 7 days , then weekly for 1 month , monthly for 3 months , and every 23 months thereafter until 1 year . postoperative course was uneventful with no significant anterior chamber inflammation ( more than 1 + cellular reaction ) or fibrin formation . on the first postoperative day , the examination showed 1 + cellular reaction and pigments in the anterior chamber which disappeared within 2 weeks . no subsequent exacerbation of the intraocular inflammation was observed during 12 months of postoperative follow - up ; therefore , no additional course of steroid was required . occasional cells in the anterior chamber were seen at some visits which were left untreated . one month after surgery , the patient achieved a best - corrected visual acuity of 20/20 in the right eye which was maintained for 12 months of follow - up . the iol remained stable with no subsequent iris atrophy at the enclavation sites , subluxation , or pupil ovalization . furthermore , the patient did not develop any anterior or posterior segment complication including glaucoma , vitreous inflammation , or clinical cystoid macular edema . secondary implantation of iris - claw artisan intraocular lens ( iol ) in an eye with fuchs heterochromic iridocyclitis . during 12 months of postoperative follow - up , no remarkable anterior chamber inflammation was observed in the right eye ( a ) and there were only few deposits on the iol surface ( b ) . the heterochromia in the involved eye is most obvious compared with the normal left eye ( c ) although secondary iol implantation in the ciliary sulcus has been reported to be safe in fhi , angle- and iris - supported iols have been feared because of the possible risk of postoperative uveitis , glaucoma , and hyphema . to the best of our knowledge , there has been no previous report of implantation of iris - claw artisan iols in eyes with fhi . even though our patient only received topical steroids , he did not show any significant postoperative inflammation or fibrinous reaction neither at the early postoperative period nor during 12 months of follow - up . therefore , it may suggest that in eyes with fhi the uveal irritation by iris - claw artisan iols is less than expected and the iol is more tolerable , even though recurrent or chronic anterior chamber inflammations has previously been reported in some eyes with these iols without preexisting uveitis . however , this lack of exacerbated postoperative inflammation in fhi may not be extrapolated to eyes with other more severe forms of uveitis . on the other hand , although fhi - associated iris atrophy in severe cases may theoretically make enclavation more difficult or compromise the long - term stability of an iris - claw iol , neither did develop in our case . therefore , it seems iris - claw iols , which have been shown to be safe in aphakic eyes without uveitis , may be an option in aphakic patients with fhi who do not have capsular support . however , studies on large number of patients with long - term follow up are required to determine the safety of these iols in eyes with uveitis including fhi . all forms of mercury viz . , organic , elemental , and mercury salts are toxic and manifestations depend on nature , intensity and the chemical form of mercury . most human exposure results from fish consumption ( organic mercury ) or dental amalgam ( metallic mercury ) . kidneys are the prime target of mercury toxicity as it is primarily excreted through them . here , we describe a patient who consumed mercuric chloride with suicidal intent , and presented with typical manifestation such as acute kidney injury ( aki ) and gastrointestinal erosion . in addition , he had disseminated intravascular coagulation ( dic ) , a rare complication of mercury poisoning . a 36-year - old male was admitted with 2 days history of oliguria progressing to anuria , facial puffiness , edema legs , bleeding gums , hematochezia , and fever . he gave a history of consumption of unknown substance ( around 500 mg ) a week back used for folk remedies and rituals . his heart rate was 92/min , respiratory rate was 15/min , and blood pressure was 130/90 mm of hg . laboratory investigations showed hemoglobin 11.2 g / dl ; total count 6000/mm ; platelet count 100,000/mm ; blood urea 124 mg / dl ; serum creatinine 6.7 mg / dl ; sodium 135 meq / l ; and potassium 6.1 meq / l ; arterial blood gas analysis showed high anion gap metabolic acidosis . his coagulation profile showed prothrombin time 18 s , inr 1.6 ; activated partial thromboplastin time 60 s ; fibrin degradation products 10 mg / ml ; d - dimer levels 1 mg / ml ; and serum fibrinogen 250 mg / dl . diagnosis of overt dic was made as per criteria proposed by the international society of thrombosis and hemostasis with total score of five at admission . he received eight sessions of hemodialysis over 2 weeks after which his urine output started improving . renal biopsy done 2 weeks after admission showed markedly dilated tubules with sloughed off epithelium and cell debris within lumen [ figure 1 ] , interstitial edema , and mild inflammatory infiltrate in the interstitium consistent with acute tubular necrosis . consumed substance brought by the patient 3 weeks later was white colored powder , called . toxicological analysis of the compound revealed it to be mercuric chloride . at the end of 2 months , there are three classes of mercury : metallic elemental mercury , inorganic mercurial salts ( mercurous and mercuric salts ) , and organic mercurials . acute poisoning of this leads to corrosive bronchitis , pulmonary edema / fibrosis , diarrhea , renal dysfunction , visual and neuropsychiatric disturbances , and in severe cases , death due to respiratory failure . organic mercury compounds are absorbed completely from the intestine , converted to inorganic forms , and possess similar toxic properties . mercuric chloride is still used as wood preservative , photographic intensifier , disinfectants and also in indigenous drug formulation , and folk remedies in asian countries . once ingested , mechanism of mercury toxicity include ( a ) mercuric ions precipitate proteins that cause direct necrosis of tissues . about 8590% of mercury in the body accumulate in the kidneys causing acute renal failure due to necrosis of the proximal tubular epithelium . ( b ) inorganic mercury complexes sulfhydryl groups and causes metabolic acidosis , vasodilatation , and shock . though acute tubular necrosis is the most common lesion , tubulointerstitial nephritis and immune - mediated glomerular damage can also occur . rarely , it can present as hypertensive encephalopathy especially in children , nephrotic syndrome , chronic tubulointerstitial nephritis , or with isolated tubular dysfunction . our patient consumed mercuric chloride with suicidal intention and developed gastrointestinal erosion , anuric renal failure , and dic . franco et al . reported one patient with mercuric chloride poisoning who developed two consecutive episodes of acute renal failure by two different mechanisms , one toxic and the other immunological . renal biopsy done in that patient , showed acute tubular necrosis initially and granulomatous interstitial nephritis in the second biopsy . the international society of thrombosis and hemostasis criteria , which has 91% sensitivity and 97% specificity , was used for the diagnosis of overt dic . a score of five or higher is compatible with dic while a score below five is suggestive of dic . the possible explanation for dic was the lowered fibrinolytic activity due to inhibition of plasma plasminogen activator or the inhibition of plasminogen activation reaction catalyzed by this enzyme as demonstrated in experimental rat models . measurement of mercury levels in blood ( > 3.6 mg / dl ) and urine ( > 15 mg / dl ) may be helpful in diagnosis . chelation therapy should be considered for any symptomatic patient with a history of acute elemental mercury exposure . chelating agents include dimercaprol ( bal ) , 2,3-dimercaptopropane-1-sulfonate ( dmps ) , dimercaptosuccinic acid , and penicillamine . hemodialysis is not effective in removing mercury , but can enhance the removal of the dimercaprol - mercury complexes . the outcome depends on the form of the mercury compound and severity of the exposure . we did not do urine mercury levels , and the patient had not received any chelating agents as toxicological analysis was done much later . we conclude that mercury poisoning should be considered in case of aki and dic though it is a rare complication . prompt treatment with chelating agents guided by measurement of mercury levels will have an impact on the favorable clinical outcome .

implantation of iris - claw artisan intraocular lens ( iol ) is a surgical option for correction of aphakia ; however , these iols have not been used in eyes with uveitis including fuchs heterochromic iridocyclitis ( fhi ) due to possible risk of severe postoperative intraocular inflammation . in the case reported here , we secondarily implanted an artisan iol in a 28-year - old man with fhi who had aphakia with no capsular support due to a previous complicated cataract surgery . enclavation was easily performed and no intraoperative complication was noted . postoperative course was uneventful with no significant anterior chamber inflammation during 12 months of follow - up . although there were few deposits on the iol surface , the patient achieved a best - corrected visual acuity of 20/20 without developing glaucoma or other complications . therefore , artisan iol may be considered for correction of aphakia in patients with fhi . however , studies on large number of patients are required to evaluate safety of the procedure .

please summarize the articles given below

eosinophilic granuloma ( eg ) , a benign local bone disease , is classified as the mildest form of langerhans ' cell histiocytosis ( lch ) . eg predominantly affects children , adolescents , and young adults , and the skull is the most common site of involvement.5 ) the pathologic diagnosis of eg can be confirmed by positive stains of cd1a antigen and protein s-100 or when intracytoplasmic organelles ( birbeck granules ) are detected using electron microscopy.11 ) the most common symptom of eg is a tender , growing scalp mass , but it can be asymptomatic and incidentally found on skull x - rays . the clinical course is benign with a tendency to spontaneous regress ; however , eg may also recur . it is common to prove the antecedent of a mild head trauma preceding clinical symptoms . a-6-year - old boy was referred to our hospital with a soft mass on the midline of his forehead . he had undergone surgery for eg in the vertex 19 months ago ( figure 1 ) . one month prior to minor head trauma , a follow - up computed tomography ( ct ) ( figure 2 ) was performed to check for recurrence , and none was found . one week before his arrival at the hospital , he had hit his head , and the resulting mass grew rapidly after the trauma . the findings of the neurological examination were unremarkable , except for a non - tender , soft , and immobile mass . the three - dimensional ( 3d ) ct showed a lytic bony defect on the frontal bone without hemorrhage ( figure 3a and b ) and the enhanced magnetic resonance imaging ( mri ) revealed a 1.4 cm - sized growing mass on the midline of the forehead ( figure 3c and d ) . the level of erythrocyte sedimentation rate ( esr ) and c - reactive protein ( crp ) was within normal limits . the protruding mass extended from the scalp through the defect in the frontal bone , and was visualized when the scalp flap was reflected ( figure 4a ) . after removal of the bone flap and tumor , it was noted that there was no hematoma and the dura mater was intact without invasion ( figure 4b ) . the tumor was removed completely and the bony defect was replaced with bone cement ( figure 4c ) . the histopathological examination revealed numerous oval langerhans ' cells and eosinophils ( figure 5a and b ) . the langerhans ' cells were stained for cd1a and s-100 ( figure 5c and d ) . the patient was followed - up six months after the operation and had a normal neurologic examination at that point . lch is a unifocal or multifocal disorder of the bone or soft tissue , most often appearing as a lytic lesion of the skull . eg is the mildest form of lch.5 ) the exact incidence of eg is not well known but vandenberg and coley12 ) found that it accounted for only 2.4% of benign skull tumors . in the series of cases studied by jelsma and ross,4 ) the most common symptom of eg is a tender , enlarged scalp mass on the parietal and frontal bones . eg may be asymptomatic and only discovered on a skull x - ray by chance . the x - ray radiologic findings consist of a punched - out , skull lesion with sharply defined margins . as the clinical and radiologic findings are not specific enough to determine the diagnosis , cytology is very helpful in diagnosing eg . the key feature is the identification of characteristic langerhans cells in a background of eosinophils and red blood cells.5 ) there is no definite disease etiology for eg . however , autoimmune diseases , inflammatory processes , and uncontrolled langerhans cell replication can be considered to be etiological factors.3 ) also , minor trauma is considered an etiologic factors . there have been six reported cases of eg associated with epidural hematoma ( table 1).1678910 ) the possible mechanisms of epidural hematomas in the six cases consisted of a rupture of the tumor cyst , communicating with the epidural vein and the sinus pericranii , or a head trauma - related intratumoral hemorrhage , which subsequently penetrated into the epidural space . all six cases were associated with epidural hemorrhages , while our case was not . in our case , no hematoma or hemorrhage was found in the ct / mri image , or in intraoperative and pathologic findings . the patient in our case regularly visited the clinic for follow - up appointments due to his history of eg . the ct scan taken one month prior to the trauma showed no definite recurrence ; however , a newly developed eg lesion was found one week after the trauma . this indicates that the development of eg may be associated with trauma . in this case , it is thought that eg developed through a local inflammatory response due to a minor trauma . trauma may be a trigger factor of the inflammatory response instead of the etiology of the disease . the elevated levels of esr and crp are found in some , but not all , cases of eg . this is because eg lesions are limited to local level and the time between diagnosis and trauma varies . in the present case , the author finds the period between the trauma and diagnosis to be relatively long . factors related to hematoma formation may include the trauma 's intensity and the time interval after the trauma . for example , in one case , a patient with an epidural hematoma had a two - week time interval , with a fluid level confirmed four weeks later . in the management of solitary eg , surgical excision is recommended and radiotherapy can be considered as an adjuvant therapy if necessary . some authors advocate surgical excision followed by postoperative treatment that includes low - dose radiotherapy , intralesional application of corticosteroids , or a combination of chemotherapy and radiotherapy.11 ) other studies found that solitary calvarial eg in skeletally immature patients 14 years of age or younger resolved fully without any recurrence.2 ) eg is responsive to steroid treatment and this indicates that the etiology of eg is associated with local inflammatory processes . to avoid surgical procedures , the prognosis depends on the age of the patient at the time of diagnosis and the number of lesions . the local recurrence rate is 6% , and new lesions appear in about 22% of patients , therefore , long - term follow - up is recommended.311 ) our case suggests that minor trauma may be an aggravating factor for the progression of eg , based on the radiological findings before and after the trauma . thus , careful observation with regular follow - up is needed for patients with eg after trauma . the tsc lines used in this study were b6ts4 and egfp - ts3.5 , which were derived from a blastocyst of the c57bl/6 and icr mouse strain , respectively . tscs were cultured as described previously . in brief , cells were cultured on mitomycin - c ( sigma - aldrich , st . louis , mo , usa)-treated primary mouse embryonic fibroblasts in rpmi1640 medium ( thermo fisher scientific , san jose , ca , usa ) with 20% fetal bovine serum ( thermo fisher scientific ) , 25 ng / ml human recombinant fgf4 ( wako pure chemicals , osaka , japan ) , 1 g / ml heparin ( sigma - aldrich ) , 100 m 2-mercaptoethanol ( sigma - aldrich ) , 1% glutamax ( thermo fisher scientific ) , and 1 mm sodium pyruvate ( thermo fisher scientific ) . representative colony morphologies are shown in fig . 1 , together with descriptions of their morphological characters . there was an additional type ( type 5 ) , but this was not analyzed here because it rarely emerged under normal tsc culture conditions . at 96 h after passaging , colonies were picked up using a glass capillary pipette under a dissecting microscope and used for rt - qpcr analysis . total rna for rt - qpcr was extracted with rneasy micro kits ( qiagen , venlo , netherlands ) from tsc colonies . following extraction , the first strand cdna was synthesized with a superscript iii reverse transcriptase reagent set ( thermo fisher scientific ) . gene expression was assessed by qpcr on a steponeplus instrument ( thermo fisher scientific ) using quantitect sybr green pcr kits ( qiagen ) according to the manufacturer s instructions . samples were denatured at 95c for 10 min , followed by 40 amplification cycles consisting of denaturation at 95c for 15 sec , and an annealing and extension step at 60c for 1 min . raw cq ( ct ) values ( pcr cycles at which the fluorescence signal crosses threshold ) were calculated using stepone software ( v. 2.1 ; thermo fisher scientific ) setting baseline and appropriate threshold values . all runs were performed in triplicate and an identical sample was used in each different runs as an inter - run calibration sample to correct for the technical variance between the runs and thus compare results from different plates [ 4 , 6 ] . the primer sets used for tsc marker genes were the following : cdx2 , 5gcagtccctaggaagccaag3 and 5gcagccagctcacttttcct3 ; elf5 , 5gtggcatcctggaatgggaa3 and 5cactaacctccggtcaaccc3. for quantification of reference genes ( atp5b , canx , cyc1 , gapdh , ubc , rn18s ) , the primer sets from the mouse genorm kit ( primerdesign ltd . , southampton , uk ) were used . actb was analyzed as an additional reference gene using the primer set 5ctgtcgagtcgcgtcca3 and 5acccattcccaccatcacac3. the baseline cycles and cycle thresholds were established manually for each gene . to assess the stability of the reference genes , the raw cq values of each reference gene were analyzed with the genorm algorithmic tool using qbase software ( biogazelle ) . these values were converted into normalized relative quantities ( nrqs ) with multiple reference genes based on the modified classic --ct method or a single reference gene . nrqs were scaled in relation to the mean across all samples for each target or to reference genes . we ranked the stability of the reference genes based on the mean expression stability ( genorm m value ) provided by the genorm program . to determine the optimal number of reference genes across different colony types , qbase was also used to calculate pairwise variation ( v value ) . normalization of the expression levels of tsc marker genes ( cdx2 and elf5 ) was performed by qbase software using reference gene(s ) ranked as described above . to compare the gene expression levels between colony types within the tsc lines , normalized relative mrna levels were analyzed with kruskal - wallis tests followed by dunnett s multiple comparison tests ; p < 0.05 was considered statistically significant . the tsc lines used in this study were b6ts4 and egfp - ts3.5 , which were derived from a blastocyst of the c57bl/6 and icr mouse strain , respectively . tscs were cultured as described previously . in brief , cells were cultured on mitomycin - c ( sigma - aldrich , st . louis , mo , usa)-treated primary mouse embryonic fibroblasts in rpmi1640 medium ( thermo fisher scientific , san jose , ca , usa ) with 20% fetal bovine serum ( thermo fisher scientific ) , 25 ng / ml human recombinant fgf4 ( wako pure chemicals , osaka , japan ) , 1 g / ml heparin ( sigma - aldrich ) , 100 m 2-mercaptoethanol ( sigma - aldrich ) , 1% glutamax ( thermo fisher scientific ) , and 1 mm sodium pyruvate ( thermo fisher scientific ) . representative colony morphologies are shown in fig . 1 , together with descriptions of their morphological characters . there was an additional type ( type 5 ) , but this was not analyzed here because it rarely emerged under normal tsc culture conditions . at 96 h after passaging , colonies were picked up using a glass capillary pipette under a dissecting microscope and used for rt - qpcr analysis . total rna for rt - qpcr was extracted with rneasy micro kits ( qiagen , venlo , netherlands ) from tsc colonies . following extraction , the first strand cdna was synthesized with a superscript iii reverse transcriptase reagent set ( thermo fisher scientific ) . gene expression was assessed by qpcr on a steponeplus instrument ( thermo fisher scientific ) using quantitect sybr green pcr kits ( qiagen ) according to the manufacturer s instructions . samples were denatured at 95c for 10 min , followed by 40 amplification cycles consisting of denaturation at 95c for 15 sec , and an annealing and extension step at 60c for 1 min . raw cq ( ct ) values ( pcr cycles at which the fluorescence signal crosses threshold ) were calculated using stepone software ( v. 2.1 ; thermo fisher scientific ) setting baseline and appropriate threshold values . all runs were performed in triplicate and an identical sample was used in each different runs as an inter - run calibration sample to correct for the technical variance between the runs and thus compare results from different plates [ 4 , 6 ] . the primer sets used for tsc marker genes were the following : cdx2 , 5gcagtccctaggaagccaag3 and 5gcagccagctcacttttcct3 ; elf5 , 5gtggcatcctggaatgggaa3 and 5cactaacctccggtcaaccc3. for quantification of reference genes ( atp5b , canx , cyc1 , gapdh , ubc , rn18s ) , the primer sets from the mouse genorm kit ( primerdesign ltd . , southampton , uk ) were used . actb was analyzed as an additional reference gene using the primer set 5ctgtcgagtcgcgtcca3 and 5acccattcccaccatcacac3. the baseline cycles and cycle thresholds were established manually for each gene . to assess the stability of the reference genes , the raw cq values of each reference gene were analyzed with the genorm algorithmic tool using qbase software ( biogazelle ) . these values were converted into normalized relative quantities ( nrqs ) with multiple reference genes based on the modified classic --ct method or a single reference gene . nrqs were scaled in relation to the mean across all samples for each target or to reference genes . we ranked the stability of the reference genes based on the mean expression stability ( genorm m value ) provided by the genorm program . to determine the optimal number of reference genes across different colony types , qbase was also used to calculate pairwise variation ( v value ) . normalization of the expression levels of tsc marker genes ( cdx2 and elf5 ) was performed by qbase software using reference gene(s ) ranked as described above . to compare the gene expression levels between colony types within the tsc lines , normalized relative mrna levels were analyzed with kruskal - wallis tests followed by dunnett s multiple comparison tests ; p < 0.05 was considered statistically significant .

the authors present a case of rapidly progressing eosinophilic granuloma ( eg ) of the skull without hemorrhage after minor trauma . a 6-year - old boy presented with a soft mass on the midline of his forehead . he had a surgery for eg 19 months ago . one month earlier , computed tomography ( ct ) and bone scans were performed to evaluate the possible recurrence of eg , and there was no evidence of recurrence in ct . however , a slightly increased uptake in the bone scan was noted on the midline of the forehead . a rapid growing mass developed in a new spot after a minor trauma 7 days before the patient arrived at the clinic . his physical examination was unremarkable , except for a non - tender , soft , and immobile mass . a plain skull x - ray and ct showed a lytic bony defect on the midline of the frontal bone . magnetic resonance imaging showed a 1.4 cm sized enhancing mass . surgical resection and cranioplasty were done . the role of trauma in the development of eg is unclear . however , our case suggests that minor trauma is an aggravating factor for eg formation . careful observation with regular follow - up is necessary in patients with eg after minor trauma .

please summarize the articles given below

neglected bilateral anterior shoulder dislocation is a very rare condition , often related to seizures or major trauma . open reduction is recommended whenever hill - sachs lesion is > 25% of the joint and the dislocation is elder than 3 weeks . we describe a case report of a 28-year - old man left handed jehovah s witness laborer assessed 12 weeks after bilateral anterior shoulder dislocation . the patient was evaluated with clinical examination , and it was observed an asymptomatic intrarotation of both shoulders with a mild left circumflex nerve deficit . he was able to perform flexion and abduction of both arms up to 60 and 10 of extrarotation . pre - operative constant scores were 49 in left and 55 in right shoulder , pre - operative disabilities of the arm , shoulder , and hand ( dash ) scores were 57 in left and 53 in right shoulder , and visual analogue scales ( vas ) was 2 . the surgeon treated both shoulder ( not simultaneously ) by open reduction and bristow - latarjet coracoids transfer procedure . a 1 year after operations , left flexion was 180 while right was 160 , bilateral abduction was 180 . he was able to return to his pre - injury activities , the constant score was 89 left and 83 right , dash score was 17 left and 13 right and vas was 0 . atraumatic bilateral neglected anterior shoulder dislocation can be treated with open bristow - latarjet procedure to provide a stable glenohumeral joint in laborer patient and permit a return to the pre - injury activities , to create a greater extension of the glenoid arc and to avoid future dislocation . bilateral anterior shoulder dislocation is rare , because almost always one extremity takes the brunt of the impact during trauma incidence . usually happen almost always secondary to major trauma ( 50% ) , affect mainly young men ( 70% ) and it is associated with other injuries ( greater tuberosity fractures in 15% , rotator cuff tears , neurological associated lesions ) . muscle contractions due to neurological or psychiatric spasm or electrocution were identified like alternative cause . neglected bilateral anterior shoulder dislocation is very rare condition , often related to seizures or major trauma . for anterior dislocation , open reconstructive options include infraspinatus tendon transfer , disimpaction grafting or allograft repair , bankart repair and shoulder replacement . the goal of surgical treatment is repair of articular defects and maintenance of shoulder stability to allow an early rehabilitation . a 28-year - old male jehovah s witness laborer , affected by iron - deficiency anemia , was evaluated in orthopedic office for restricted mobility and pain ( during daily activities ) in both shoulders from about 12 weeks . he reported that previously these inabilities were interpreted as paraspinal cervical muscle contracture and treated only with muscle relaxant drugs . at the time of evaluation , patient showed mild pain and inabilities in shoulders external rotation and abduction . physical examination revealed : bilateral normal internal rotation ; bilateral 10 external rotation , abduction and flexion about 60 and axillary nerve numbness . anteriorposterior x - ray images evidenced bilateral anterior shoulder dislocation and computer tomography - scan showed bilateral hill - sachs lesion ( < 25% ) ( fig . 1 ) . the surgeon suggested a step - by - step surgical treatment conscious about patient s medical history and refusal of whatever blood transfusion for religious reasons . the first step was surgical treatment of dominant limb and then right side after 1 month . surgical procedures were both performed under general anesthesia , beach chair position and fluoroscan aid . the deltopectoral approach was used and for both cases were evidenced a glenoid fossa deficiency with hypoplasia of scapular neck and glenoid . bleeding was controlled and intraoperative blood salvage was used to accommodate wishes of the patient to refuse homologous and autologous transfusions , as required his confession of faith . through post - operatively management , shoulders were supported by a sling with 15 of abduction and maintained for 3 weeks . a 4 weeks later , clinical and radiographic evaluation were performed , and the patient was introduced to passive shoulder motion , while 2 weeks later he started an active controlled shoulder motion . he was followed for next 6 months by upper extremities therapist team . the 1 year after last operations , the patient was clinical and radiographical evaluated and he was able to perform left flexion up to 180 and 160 in right , bilateral abduction was 180 ( fig . the constant score was 89 left and 83 right , disabilities of the arm , shoulder and hand ( dash ) score was 17 left and 13 right and visual analogue scales were 0 . anterioposterior and axillary x - ray images evidenced bilateral anterior shoulder dislocation and computer tomography - scan showed bilateral hill - sachs lesion . clinical evaluation and x - ray images 1-year as expressed by other authors , this type of lesion can be present in 4% of all shoulder dislocation , even if the most of cases were related to medical conditions including myasthenia gravis , cerebral palsy and scapular myopathy . neglected anterior shoulder dislocation is an exceptional condition whose treatment has not guidelines mutually agreed . in our opinion , treatment of this type of lesion depends on many factors : time of dislocation , age of patient , functional limitation , success of reduction , presence and amount of the hill - sachs lesion and glenoid fossa defect and surgeon s experience . conservative treatment should be considered in patient without shoulder pain or low functional demands and in case of surgical or anesthesiological contraindications . however , in young , active , high demands patients , conservative choice without stabilization should be not the proper procedure due to possible concurrent hill - sachs lesion , to possible concurrent glenoid defect and resulting high risk of instability . solomon et al . suggested closed reduction only up to 6 weeks post - injury due to high risk of iatrogenic fracture or neurovascular damage . open reduction is the recommended procedure with hill - sachs lesion more than 25% of articular surface and after 3 weeks . for anterior dislocation , open reconstructive options include infraspinatus tendon transfer , disimpaction grafting or allograft repair , bankart repair and shoulder replacement . the goal of surgical treatment is repair of articular defects and maintenance of shoulder stability to allow an early rehabilitation . many surgical solutions were proposed like eden - hybinette , arthroscopical bristow - latarjet procedure but recently , longo et al . showed how eden - hybinette procedure has clinical outcomes very similar to the bristow - latarjet with a higher rate of post - operative osteoarthritis and recurrence . authors treated the young patient with an open bristow - latarjet procedure primarily to repair the old dislocation and remedy the glenoid fossa defect . hill - sachs lesions were not treated during surgery because involved < 25% and intraoperatively glenohumeral joint was stable after reduction . author s opinion is to refer surgical treatment of hill - sachs lesion in case of lesion involving over 25% of articular surface to maintain glenohumeral stability by open remplissage with the infraspinatus tendon ( in this technique the head defect was filled with the infraspinatus tendon , by tying the sutures from the anchor , so bringing the tendon down to the defect ) or shoulder arthroplasty if the lesion is over 50% of humeral head . currently , however , literature reports only few studies about results of operative treatment of chronic anterior shoulder dislocation with arthroplasty and this type of surgery should be considered in selected cases : elderly patients ; intraoperatively instability due to severe humeral head cortical depression and/or glenoid defect and degenerative arthropathy . gavriilidis recommended this surgical procedure with large head defects and experienced good mid - term results with benefits for a range of motion , pain and patient satisfaction . this case report showed that anterior shoulder dislocation could also occur without a trauma mechanism due to glenoid fossa dysplasia . despite ethical and religious positions of patient about blood transfusions , open bristow - latarjet procedure may be performed with recovery of good upper extremity function ( constant score and dash score ) , low of recurrence and good clinical outcomes . atraumatic bilateral neglected anterior shoulder dislocation can be treated with an open bristow - latarjet procedure to provide a stable glenohumeral joint in laborer patient . this open surgical procedure is reliable , secure and burdened with fewer complications over time , especially even in special cases ( jehovah s witness ) to create a greater extension of the glenoid arc and to avoid future dislocation . though very rare , atraumatic bilateral neglected anterior shoulder dislocation does occur and may present to orthopedic evaluation . transthyretin familial amyloid polyneuropathy ( ttrfap ) is an autosomaldominant , adultonset disorder associated with over 100 different mutations in the transthyretin ( ttr ) gene that cause transthyretin protein to deposit as amyloid in peripheral and autonomic nerves , heart , gastrointestinal ( gi ) tract , kidneys , eyes , and connective tissue of the transversal carpal ligament ( ando et al . , 2013 ; rowczenio et al . , 2014 ; sekijima , 2015 ) . this results in progressive organ dysfunction and death within an average of 10 years ( ando et al . , 2013 ) . ttrfap is a highly heterogeneous disease associated with a wide range of clinical manifestations that may present in varying degrees and combinations ( ando et al . , 2013 ; sekijima , 2015 ) . the disease can be difficult to recognize due to its variable clinical presentation and nonspecific symptoms . the age of onset ranges from the second to ninth decade of life ( ando et al . , 2013 ) , and incomplete penetrance of clinical disease can lead to sporadic cases without known affected relatives . accurate diagnosis of ttrfap is often delayed for years ( plantbordeneuve et al . , 2007 ; koike et al . , 2011 ; an accurate diagnosis is important to permit effective disease management , as tissue damage is largely irreversible , and available treatment options are most beneficial in early disease stages ( coelho et al . , 2013 ; plantbordeneuve , 2014 ; ericzon et al . , 2015 a particular challenge in making a diagnosis is that clinical manifestations are not necessarily uniform among carriers of the same ttr mutation and can vary even within the same family ( ando et al . , 2013 ) . the clinical phenotype is also influenced by genetic , epigenetic , or environmental factors other than the ttr mutation ( see table 1 ) . gi , gastrointestinal ; ttrfap , transthyretin familial amyloid polyneuropathy ; sd , standard deviation . urinary retention might be underdiagnosed as patients are usually not aware or cognisant of symptoms . lengthdependent peripheral sensorymotor neuropathy is a hallmark feature of ttrfap . in classical earlyonset ( < 50 years of age ) val30met ttrfap ( andrade , 1952 ) , distal small myelinated and unmyelinated nerve fibers associated with pain and temperature sensation become damaged first , which may manifest as paresthesia , dysesthesia , allodynia , hyperalgesia , or spontaneous pain in the feet . axonal degeneration then progresses relentlessly in a distal to proximal pattern reaching upper limbs usually 4 to 5 years after first symptoms . within a few years , larger myelinated sensory and motor nerve fibers become affected and impairment of light touch , vibration , and position sensation , and motor deficit appear in the distal lower limbs . lateonset cases are characterized by relative preservation of unmyelinated nerve fibers and conspicuous presence of axonal sprouting ( koike et al . , 2004 ) . these characteristics are responsible for impaired superficial and deep sensation , severe neuropathic pain , early distal motor involvement , and relatively mild autonomic symptoms ( conceio and de carvalho , 2007 ; koike et al . , the lengthdependent pattern of symmetric sensorymotor and autonomic polyneuropathy in ttrfap is not unique , and similar neurologic impairments can be observed in many conditions , all of which can mislead clinical diagnosis . the most common neuropathic misdiagnosis for sporadic ttrfap is chronic inflammatory demyelinating polyneuropathy ( cidp ) ( plantbordeneuve , 2014 ) . for instance , 20% of 90 french patients without a family history of ttrfap ( plantbordeneuve et al . , 2007 ) and 53% of 15 japanese patients with sporadic v30 m ttrfap ( koike et al . , 2011 ) although cidp is generally characterized by a demyelinating sensorymotor neuropathy , once extensive axonal lengthdependent damage is present , electrophysiological characteristics of ttrfap can resemble those of cidp due to secondary demyelination . furthermore , protein levels in cerebrospinal fluid can be elevated in patients with ttrfap , albeit less markedly than in cidp . in some cases , given the frequent misdiagnosis , there should be a high suspicion index for ttrfap in patients diagnosed with cidp that do not respond to immunomodulatory treatment . there have been numerous cases where ttrrelated amyloidosis was initially misdiagnosed as amyloid lightchain ( al ) amyloidosis ( cowan et al . , 2011 ; briani et al . , misdiagnosis can be due to occurrence of monoclonal gammopathy in elderly patients or false immunolabeling of amyloid deposits , leading to inappropriate , potentially harmful chemotherapeutic treatment . ttrfap is unlikely to be mistaken for other forms of hereditary amyloid neuropathy caused by mutation of the apolipoprotein ai , gelsolin , or 2microglobulin genes . however , although very rare and less rapidly progressive , hereditary neuropathy due to truncation mutations of the prion protein can closely mimic ttrfap ( mead and reilly , 2015 ) and should be considered in the differential diagnosis . consequently , it is important to obtain a complete clinical history with details of symptoms of systemic disease and a complete and detailed family history ( ando et al . , 2013 ; plantbordeneuve , 2014 ) . the occurrence of progressive peripheral sensorymotor polyneuropathy and at least one of the following is suggestive of ttrfap : family history of neuropathy , early autonomic dysfunction , cardiac involvement , diarrhea , constipation , alternating episodes of constipation and diarrhea , inexplicable weight loss , carpal tunnel syndrome , renal impairment , or vitreous opacity ( fig . symptom clusters that may warn of a diagnosis of transthyretin familial amyloid polyneuropathy ( ttrfap ) . of these combinations , peripheral neuropathy with early autonomic signs , such as erectile dysfunction or gi symptoms , and peripheral neuropathy with cardiac manifestations are the most common and important combinations in sporadic patients . rapid disease progression ( dohrn et al . , 2013 ) and failure to respond to immunomodulatory treatment are additional signs . the clusters of clinical symptoms mentioned above should raise suspicion of ttrfap , particularly if there is a positive family history . in patients with suspected ttrfap , the entire coding region of the ttr gene , that is all four exons , should be sequenced . tissue biopsy analysis and neurologic , cardiac , autonomic , and ophthalmologic evaluation can lend further credence to the correct diagnosis .

introduction : neglected bilateral anterior shoulder dislocation is a very rare condition , often related to seizures or major trauma . open reduction is recommended whenever hill - sachs lesion is > 25% of the joint and the dislocation is elder than 3 weeks.case report : we describe a case report of a 28-year - old man left handed jehovah s witness laborer assessed 12 weeks after bilateral anterior shoulder dislocation . the patient was evaluated with clinical examination , and it was observed an asymptomatic intrarotation of both shoulders with a mild left circumflex nerve deficit . he was able to perform flexion and abduction of both arms up to 60 and 10 of extrarotation . pre - operative constant scores were 49 in left and 55 in right shoulder , pre - operative disabilities of the arm , shoulder , and hand ( dash ) scores were 57 in left and 53 in right shoulder , and visual analogue scales ( vas ) was 2 . radiological examination were bilateral anteroposterior shoulder x - rays and computer tomography scan . the surgeon treated both shoulder ( not simultaneously ) by open reduction and bristow - latarjet coracoids transfer procedure . a 1 year after operations , left flexion was 180 while right was 160 , bilateral abduction was 180 . he was able to return to his pre - injury activities , the constant score was 89 left and 83 right , dash score was 17 left and 13 right and vas was 0.conclusion:atraumatic bilateral neglected anterior shoulder dislocation can be treated with open bristow - latarjet procedure to provide a stable glenohumeral joint in laborer patient and permit a return to the pre - injury activities , to create a greater extension of the glenoid arc and to avoid future dislocation .

please summarize the articles given below

a cataract increases lens opacity and reduces visual acuity ( va ) , thus impairing the patient 's quality of life . various techniques for cataract surgery have been developed since h. ridley introduced intraocular lenses ( iols ) composed of polymethylmethacrylate in 1949 . the stability of iols allows cataract surgery to be commonly performed worldwide , and technological advancements such as multifocal and toric iols have increased the procedure 's popularity [ 6 , 7 ] . to improve quality of life , cataract surgery postoperative va , contrast sensitivity , and optical aberrations were measured as objective indices of surgical success [ 1116 ] . after cataract surgery , improvement in va is typically tested with a high - contrast ( 100% ) chart under photopic and mesopic conditions . for example , visual inspection of human faces of the utmost importance in daily life involves a target of large size and low contrast . the change in va after cataract surgery has not been studied under various levels of contrast . the aim of this study was to assess the visual performance of pseudophakic eyes after cataract surgery at different contrast levels by using the oqas ( optical quality analysis system , visiometrics , terrassa , spain ) . this research was approved by the institutional review board of the catholic medical center at the catholic university of korea and conducted in accordance with ethical research guidelines . the present study adhered to the declaration of helsinki and was approved by the institutional review board of the catholic medical center at the catholic university of korea ( approval number : kc12risi0023 ) . patients completed an informed consent form approved by the institutional review board after the purpose of the study was explained to them . no patients had a history of ocular surgery , ocular disease , or general disorders affecting vision ( e.g. , diabetic retinopathy ) . vision of patients greater than 0.1 logmar was measured using the snellen test and classified as age - matched ( 50s , 60s , and 70s ) between normal and pseudophakic eyes . the patients with pseudophakic eyes had undergone phacoemulsification and received one of five iol types in the posterior chamber 26 months before the study . patients were stratified into the following age groups : 5059 years , 6069 years , and 7079 years . patients with failed iol implantation into the lens capsule , severe posterior lens capsule opacification or history of laser capsulotomy due to opacification , or any other eye complication were excluded . those with poor cooperation were also excluded . to prevent uncorrected refractive error from limiting contrast sensitivity or va [ 20 , 21 ] , va was measured using a snellen chart at 6 m. altered contrast sensitivity was simulated with the oqas by using the double - pass technique . with this approach , the retinal image , degree of haze inside the eye , and condition of visual function are analyzed in terms of objective scattering index ( osi ) , modulation transfer function ( mtf ) cut - off value , and strehl ratio , respectively [ 2225 ] . simulated va by oqas was evaluated at contrast of 100% , 20% , and 9% . testing at each contrast level was performed for all five types of iols : hoya pc-60ad ( hoya , corp , tokyo , japan ) , ec-1pal ( aaren scientific , ontario , canada ) , akreos mi-60 ( bausch & lomb , rochester , ny , usa ) , ny-60 ( hoya , corp , tokyo , japan ) , and xl stabi zo ( carl zeiss meditec , jena , germany ) . analysis of variance ( anova ) and independent - sample t - tests were performed using spss version 18.0 software ( ibm corporation , armonk , ny ) . the subjects ' characteristics are shown in table 1 . mean visual acuities for the normal eyes were 0.16 0.18 logmar , 0.30 0.18 logmar , and 0.52 0.17 logmar at 100% , 20% , and 9% contrast , respectively ( table 2 ) . in normal eyes from all age groups , simulated va decreased significantly when contrast was reduced ( 5059 , p = 0.000 ; 6069 , p = 0.000 ; 7079 , p = 0.020 ) . however , simulated va was highest among those aged 5059 and lowest among those aged 7079 . simulated va at 100% and 9% contrast decreased with increasing age ( 100% , p = 0.045 ; 9% , p = 0.010 ) . no significant differences were noted among the age groups at 20% contrast ( p = 0.070 ) . for pseudophakic eyes , mean visual acuities were 0.16 0.12 logmar , 0.33 0.20 logmar , and 0.56 0.21 logmar at 100% , 20% , and 9% contrast , respectively ( table 3 ) . as in the normal eyes , va decreased significantly when contrast was reduced ( p = 0.000 ) . however , nova was similar in all age groups ( p > 0.05 ) . figure 1 shows simulated va for the normal and pseudophakic eyes in each age group at all contrast levels . however , among those aged 7079 , the pseudophakic eyes exhibited significantly higher va ( p = 0.000 ) . table 4 shows the simulated mean visual acuities of the pseudophakic eyes according to iol type . subjects implanted with ec-1pal and ny-60 iols showed the lowest and the highest va , respectively , although no significant differences were noted among iols at any contrast level . regardless of iol type , va decreased significantly when contrast was reduced ( p = 0.000 ) . osi value , mtf cut - off value , and strehl ratio values are presented in table 5 . the mean values were 2.21 1.38 , 23.29 10.72 , and 0.18 0.47 , respectively , in the pseudophakic group and 1.99 1.41 , 23.41 9.72 , and 0.13 0.07 , respectively , in the normal group . the only significant finding was elevated osi values in normal eyes from the 7079 age group ( p = 0.008 ) . figure 2 shows representative oqas results obtained from a 69-year - old patient with normal eyes and a 72-year - old patient with pseudophakic eyes . in addition to questionnaires , va and contrast sensitivity assessments are used to evaluate ocular health after cataract surgery . recent technological advancements have allowed for the measurement of higher - order aberrations including spherical aberration and coma aberration as well as the optical analysis of light spread within the eye ( point spread function ) [ 2729 ] . however , such tests are useful only in characterizing symptoms . . used the oqas to measure the osi , mtf cut - off value , and strehl ratio after cataract and refractive surgeries and to assess visual function objectively . , we investigated vision at three contrast levels simulated using the oqas and stratified subjects with normal and pseudophakic eyes by age . among patients in their 50s and 60s , normal eyes exhibited sim va superior or similar to that of pseudophakic eyes however , among those in their 70s , pseudophakic eyes had significantly superior va ( p = 0.000 ) . alternatively , the normal eyes in this age group may have been free of any lens opacity that could be detected by slit - lamp examination but may have had fine opacities in the lens and/or vitreous chamber that scattered light , thereby reducing va . another significant finding was the lower osi value of the pseudophakic eyes in this group ( p = 0.008 ) , which is in line with the report by saad et al . that osi values increase with age in normal eyes . in both the normal and pseudophakic groups , va was directly related to contrast level regardless of age . furthermore , va decreased as age increased ; as reported by mathai et al . sim va was similar in normal and pseudophakic eyes of subjects aged 5069 but superior in the pseudophakic eyes of subjects aged 7079 years . therefore , visual function must have returned to normal levels in all patients with iols at 26 months after cataract surgery . the ny-60 and ec-1pal iols were associated with the highest and lowest visual acuities , respectively , regardless of contrast level . interestingly , use of the ny-60 iol is reportedly associated with fewer capsular folds than use of a three - piece iol . ny-60 iol users also report the absence of entoptic phenomena 1 year after surgery . in an eye with an iol , the presence of entoptic phenomena correlates directly with the osi value . this relationship may explain the superior va of the ny-60 group , although this improvement in va was associated with use of the acrysof sn60wf and tecnis zcb00 iols in previous reports . in this study , reduced contrast was associated with decreased acuity across groups , but no significant difference in simulated va among iol types was noted at any contrast level ( p = 0.413 ) . a possible limitation of our study is that the oqas 's he - ne diode laser may have introduced error to the osi readings , for example , in patients with dry eye symptoms or cloudy vitreous , which scatters light . in summary , va at 26 months after cataract surgery in pseudophakic eyes is similar to that of normal eyes and older patients with pseudophakic eyes have superior simulated va to age - matched controls , contrary to previous reports that the level of contrast and age affect visual function . these findings suggest that iols ensure simulated va similar to that of the normal eye even in very low - contrast conditions , as encountered when driving at night . therefore , iol implantation should have a beneficial impact on the patient 's quality of life . the oqas seems to be a useful instrument for the objective evaluation of visual quality under contrast after various surgeries such as cataract surgery , laser - assisted in situ keratomileusis ( lasik ) , laser - assisted subepithelial keratectomy ( lasek ) , and keratoconus surgery . current techniques in acl surgery have been associated with satisfactory long - term results in the majority of patients . however , there remains a considerable subset , up to 30% of patients , with unsatisfactory outcomes [ 2 , 7 ] . specifically , patients report problems relating to rotational instability and return to previous level of activity [ 3 , 10 ] . it has been suggested that a more anatomical approach to restore the original acl anatomy may benefit these patients [ 4 , 17 ] . some authors have advocated placing a single graft in a position closer to the oblique femoral attachment of the acl [ 14 , 15 ] . however , it is not possible to fully restore normal knee kinematics with a single graft , regardless of the position [ 13 , 16 ] . the double bundle reconstruction technique ( dbt ) for acl reconstruction aims at restoring the acl anatomy with its two bundles and is gaining popularity [ 11 , 17 ] . anatomic studies have demonstrated the presence of two functional bundles within the acl , the anteromedial ( am ) and the posterolateral ( pl ) bundle [ 1 , 8 ] . although it is somewhat of a simplification , the double bundle description of the acl is generally accepted as an anatomic model for understanding the complex structure and function of the ligament [ 6 , 9 ] . the am bundle often obscures the pl bundle , and it may appear that only one bundle is present without careful inspection . the goal of this study was to describe the presence of the double bundle structure from an arthroscopic point of view , and to evaluate the value of different portals in knee arthroscopy . we prospectively examined 60 knees during standard arthroscopy . in each knee , the double bundle acl structure was evaluated , along with the usefulnes of different portals for visualization . all knees that were included in the study had a previous x - ray and mri in order to rule out any significant changes to the bone , and to ensure that the acl was intact . all patients were less than 60 years and had no history of acl injury . surgical indications for the 60 total subjects examined included 31 cases treated for meniscal findings alone , 21 treated for articular cartilage findings alone , and 8 cases of a combined repair of meniscus and cartilage . there were 25 female and 35 male knees , 29 right knees , and 31 left knees included in the study . age distribution ranged between 16 and 60 , with an average age of 40.2 years . arthroscopy started with an anterolateral portal ( alp ) located just lateral to the patellar tendon using the inferior pole of the patella as a vertical landmark , and an anteromedial portal ( amp ) approximately 0.5 cm medial to the edge of the patella tendon , 1 cm superior to the joint line , and 1 cm inferior to the tip of the patella . for each knee , the acl anatomy and the visibility of the pl bundle through the alp and amp were evaluated with and without retraction of the am bundle according to the description of the two bundles by girgis et al . and arnoczky . gross biomechanics of the two bundles using a probe were also assessed . for statistical analysis with the arthroscope in the alp , we were able to distinguish the am and pl bundle in 17 cases ( 28.3% ) ( fig . 1 ) . in the remaining cases ( n = 43 , 71.7% ) , the pl bundle was obscured by the am bundle , and visualization was only possible with retraction of the am bundle with a probe ( fig . 2 ) . switching the arthroscope to the amp , differentiation of the am and pl bundle without using a probe to retract am was possible in 40 cases ( 66.7% ) ( fig . 3 ) . in the remaining cases ( n = 20 , 33.3% ) , visualization of the pl bundle was possible only after retraction of the am bundle ( table 1 ) . there was a statistically significant better visibility of the pl bundle using the amp ( p < 0.05).fig . 2anterolateral portal : pl bundle with retraction of am bundle , pl bundle loose with knee flexionfig . bundlepl bundleanterolateral portaln = 17 ( 28.3%)anteromedial portaln = 40 ( 66.7% ) * * p < 0.05 anterolateral portal : pl bundle without retraction of am bundle anterolateral portal : pl bundle with retraction of am bundle , pl bundle loose with knee flexion anteromedial portal : pl bundle without retraction of am bundle visualization of the pl bundle the femoral insertion site of the acl was semilunar at the inner surface of the lateral condyle . the centre of the pl bundle visualized more shallow than the centre of the am bundle with the knee held in 90 flexion , while both insertion sites were oriented horizontally ( fig . 4 ) . the pl bundle insertion was located at the posterolateral aspect of the tibial attachment with a close approximation of the pl bundle to the posterior root of the lateral meniscus . gross assessment using a probe while applying a flexion - extension motion pattern to the knee demonstrated a taut am bundle throughout the range of motion and a tightening of the pl bundle with knee - extension ( figs . 2 , 5 ) . pl bundle tight with knee extension anteromedial portal : pl bundle without retraction of am bundle anteromedial portal : pl bundle tight with knee extension the principal finding of the present study was that it is possible to distinguish the double bundle structure in acl anatomy as described by girgis et al . and arnoczky by applying a two portal knee arthroscopy technique . the visualization of the acl anatomy seems to be improved through the use of a medial portal . the anteromedial portal not only helps in visualization of the double bundle structure but also in distinguishing the am and pl portions of the femoral attachment sites . consistent with the literature , we found the pl bundle tightening when the knee is extended [ 6 , 12 ] . this study is limited by the fact that we observed only acl intact knees and did not consider cases with a torn acl , where the anatomic position of the attachment sites is sometimes obscured by the knee injury and bony changes that occur between injury and reconstruction . therefore , we stress the need for further arthroscopic evaluation of different portals in acl reconstruction . the clinical relevance of this study is that it can be beneficial to establish an additional medial working portal . the amp can be used for the arthroscope and a better visualization of the femoral insertion site of the acl at the inner surface of the lateral condyle and a precise femoral tunnel placement can be achieved . reported the use of an additional medial portal without any increase in morbidity to patients for acl surgery .

purpose . to assess visual function using optical quality analysis system ( oqas ) at varying levels of contrast in pseudophakic eyes . methods . the study included patients admitted to seoul st . mary 's hospital between january and february 2012 : 143 pseudophakic eyes with one of five intraocular lens types , examined 26 months after cataract surgery , and 93 normal eyes ( enhanced visual acuity ( va ) < 0.1 logmar ) in age - matched controls . subjects were examined at three contrast levels using the oqas . results . at 100% , 20% , and 9% contrast , simulated mean va was 0.16 0.18 logmar , 0.30 0.18 logmar , and 0.52 0.17 logmar , in normal eyes , and 0.16 0.12 logmar , 0.33 0.20 logmar , and 0.56 0.21 logmar , respectively , in pseudophakic eyes . simulated va decreased significantly when contrast was reduced , regardless of ocular status , age group , and lens type ( p < 0.05 ) . there were no significant differences between normal and pseudophakic eyes among subjects aged 5069 ( p > 0.05 ) . among subjects aged 7079 , pseudophakic eyes showed improved simulated va ( p = 0.000 ) and objective scattering index values ( p = 0.008 ) . conclusions . patients with intraocular lenses have similar or superior visual function when compared to those with normal eyes at 26 months after cataract surgery , even under low - contrast conditions .

please summarize the articles given below

the head and neck regions are common sites where intra - dermal or subcutaneous firm nodules of 0.5 - 3 cm are found . although its histological findings are well - described , the radiological features of chondroid syringoma have been reported in only few cases . a 59-year - old man presented with a painless mass on the anterior aspect of the upper thigh with a slow enlargement over the past 5 years [ figure 1 ] . dermatological examination showed a relatively firm , mobile 5 3 cm nodule covered by normal skin . laboratory studies including complete blood count , erythrocyte sedimentation rate ( esr ) , urine analysis , aspartate aminotransferase ( ast ) , alanine aminotransferase ( alt ) , blood urea , creatinine were normal . sonographic examination revealed mixed , echogenic solid mass measuring approximately 4.5 3 2 cm . on doppler ultrasound , magnetic resonance images ( mri ) revealed a 4.7 2.9 2.2 cm , well - circumscribed , lobular mass that showed heterogeneous enhancement predominantly in the peripheral portion of the mass after intravenous contrast administration [ figure 2 ] . diffusion - weighted imaging ( dwi ) showed areas of increased signal intensity that were indicative of a highly cellular tumor [ figure 3 ] . according to the mri findings , we considered benign subcutaneous lipomatous tumors with cystic and solid components such as angiolipoma or fibrolipoma or well - circumscribed low - grade soft tissue liposarcoma without surrounding tissue extension in our differential diagnosis . because the vascularity of the lesion and heterogeneous pattern with contrast enhancement on mri examination , we excluded lipoma . relatively firm , 5 3 cm , lipoma - like mass covered by normal skin post - contrast axial fat - saturated t1-weighted images show well - circumscribed , lobular mass with heterogeneous enhancement diffusion - weighted imaging ( b : 800 ) signs of increased restriction in diffusion , a finding indicative of a highly cellular tumor we decided to perform trucut biopsy . histopathological examination revealed a group of cells , which have eosinophilic cytoplasm and regular small nuclei , exhibited epithelial - like pattern in the myxoid stroma . however , as adipocytes were variable in size and focally showed a lipoblast - like appearance , some tumor areas were reminiscent of a well - differentiated lipoma - like liposarcoma [ figure 4 ] . microscopic examination shows a focal area of lipoblast - like appearance in the myxoid background ( h and e , 10 ) the patient underwent surgical excision of the mass . there were foreign body reactions against the epidermoid cysts within the tumor and surrounding tissue . epidermoid cysts were seen ( h and e , 5 ) epithelial nests and tubuloalveolar structures in a chondromyxoid stroma . the head and neck regions are common sites ; less commonly , axillary region , hand , foot , abdomen , penis , vulva , scrotum can be involved . chondroid syringoma usually presents as a solitary , asymptomatic , intracutaneous or subcutaneous nodule , mainly seen in middle - aged or older males . the size is usually between 0.5 and 3 cm , but it may be very large . most chondroid syringomas are benign with a slow progression over years . in our case , malignant lesions are usually larger than 3 cm , but benign one measuring 10 cm is also reported . histologically , a wide variety of structures may be found in chondroid syringoma of skin . eccrine types have multiple small syringoid elements and are rich in mucin . in the apocrine type , in our case , there was abundant lipomatous stroma that made diagnostic difficulty in radiological imaging and histopathological examination . previous case reports have described the mr imaging findings of benign and malignant chondroid syringomas.[79 ] although the mr imaging appearance of chondroid syringoma is relatively non - specific , mr imaging generally may allow characterization of the origin of tissue components in the tumor and depiction of the extent and relationships of the lesion to adjacent structures . in our case , the signal intensity characteristics of the lesion ( heterogeneous lesion of mixed fat and fluid - like intensity ) , while not specific for chondroid syringoma , allowed for some analysis of the consistency of the tumor . the benign neoplasms of the subcutaneous tissue that may have similar appearances with our case include superficial lipoma and variants of lipoma ( angiolipoma , myolipoma , spindle - cell and pleomorphic lipoma , chondroid lipoma , and hibernoma ) . although subcutaneous in location , superficial lipoma consists entirely of fat , unlike our lesion . variants of lipoma are commonly heterogeneous and include more than one type of tissue , which may be fat , muscle , chondroid matrix , vascular elements , or myxoid tissue with calcification and hemorrhage . due to the presence of vascular channels on doppler examination , the malignant tumors that may bear similar characteristics with mixed tumor of the skin include well - differentiated liposarcoma , myxoid liposarcoma , extraskeletal myxoid chondrosarcoma , myxofibrosarcoma , and malignant peripheral nerve sheath tumors . after tru - cut biopsy , we considered many of the above entities in the differential diagnosis . there were no cytologic atypia , increased mitotic figures , tumor necrosis , or infiltrative margins , thus excluding malignant chondroid syringoma . the mixed fat and fluid - like signal intensity lesion of skin is somewhat of a diagnostic enigma due to its non - specific imaging and histologic presentation . clearly a soft tissue lesion of mixed fat and fluid - like signal intensity , as in this case , while not pathognomonic for chondroid syringoma , allows for a limited differential diagnosis . as this case shows , chondroid syringoma should be included in the differential diagnosis of a slowly growing , nodular heterogeneous mass in the skin or subcutaneous tissue . 1 . diffusion - weighted imaging , which showed signal intensity changes indicative of a highly cellular tumor in this case , is not routinely done in chondroid syringoma . to our knowledge , this is the first case of chondroid syringoma mimicking low - grade liposarcoma reported in the literature . frontometaphyseal dysplasia ( fmd ) , also called gorlin cohen syndrome , is a hereditary x - linked dominant syndrome described in 1969 with less than 30 cases described in the literature . this case report of a child with fmd is presented owing to the rarity of the syndrome and the anticipated difficult airway , which was successfully managed by using a combination of dexmedetomidine and ketamine while preserving spontaneous ventilation . a 2-year - old female child , a known case of fmd , presented for open reduction of the left hip with osteotomy of femur . physical examination revealed a slender undernourished girl of 8 kg with prominent supraorbital ridges , ocular hypertelorism , low set ears and a wide bridge nose with prominent eyes . airway examination revealed a mallampatti score of iii with significant retrognathia , high arched palate with malocclusion of teeth . in addition , she had dorsolumbar scoliosis , pectus carinatum , bowing of long bones with distal phalangeal hypoplasia and multiple joint dislocations [ figure 1 ] . pre - operative blood investigations , echocardiography and chest x - ray were within physiological limits . on arrival to the operation theatre , monitors were connected and child pre - oxygenated for 5 minutes . injection dexmedetomidine 1 g / kg was administered for 10 min and then a continuous infusion at 1 g / kg / h was set for the duration of the remaining procedure . ketamine was administered in increments of 5 mg up to 12 mg until there was no response to jaw thrust while ensuring spontaneous respiration . just before direct laryngoscopy intravenous lignocaine rigid laryngoscopy with miller 1 straight blade offered a grade iv cormack and lehane view . after optimal external laryngeal manipulation , the visible glottic chink was sprayed with topical lignocaine and tracheal intubation was successfully performed using an uncuffed 4 sized endotracheal tube . anesthesia was continued with n2o in 40% o2 along with a continuous dexmedetomidine and atracurium infusion . adequate padding was provided at pressure points and extreme caution was exercised during positioning . at the end of fmd belongs to the otopalatodigital spectrum syndromes that includes four phenotypically related conditions , otopalatodigital syndrome types 1 and 2 , fmd and melnick - needles syndrome . the most common manifestations include supraorbital hyperostosis , hypertelorism , down - slanting palpebral fissures , broad nasal bridge and micrognathia with anomalies of teeth and generalized skeletal dysplasia . congenital heart disease , subglottic tracheal narrowing and genitourinary anomalies , muscular hypotonia . micrognathia , microstomia and malocclusion of teeth may make direct laryngoscopy impossible ; therefore , a well - planned airway strategy is mandatory . ketamine was preferred in our case of anticipated difficult airway due to it 's inherent sympathomimetic actions devoid of respiratory depression alongwith provision of excellent analgesia and amnesia . dexmedetomidine a specific and selective 2-adrenoceptor agonist known for its sedative , anxiolytic , analgesic properties was used to complement ketamine . at the same time dexmedetomidine offsets the sympathomimetic effects of ketamine , this unique pharmacological combination in the present case preserved the respiratory drive , allowed maintenance of a patent airway and provided sufficient sedation , analgesia and anesthesia to allow successful airway control . in addition , topical lignocaine was used as per recommendation of aroni et al . which states that ketamine does not depress coughing or swallowing reflexes . available literature describes the use of combination of both these drugs in children during procedural anesthesia and not as a complete anesthesia protocol in a challenging case . the present experience of using this combination successfully paves the way to emerging new solutions for management of a difficult pediatric airway . hence safety profile , rapid onset of action with adequate sedation and analgesia provided by the ketamine and dexmedetomidine make them a distinctive drug combination in the pediatric difficult airway situation in a child with fmd .

chondroid syringoma , or mixed tumor of skin , is a relatively rare , usually benign sweat gland tumor , most often seen in the head - and - neck region . rare malignant examples have been reported , commonly involving the extremities . we report here a case radiologically mimicking a malignant neoplasm , but histologically - proven benign subcutaneous chondroid syringoma , arising in the anterior aspect of the upper thigh of a 59-year - old male .

please summarize the articles given below

multiple sclerosis ( ms ) is a chronic , autoimmune , demyelinating disease of the central nervous system ( cns ) . presenting symptoms can vary greatly , but most commonly involve weakness , paresthesia , gait difficulty , or visual deficits . virtually any area of the cns white matter can be involved , though this most classically involves the periventricular white matter . brain stem involvement is common , though isolated cranial nerve palsies are rare signs in ms . previous studies have suggested that isolated cranial nerve palsies in ms are more commonly found as presenting symptoms than as relapsing symptoms . among isolated cranial nerve palsies in ms , the fifth nerve is most commonly involved ( 4.8% ) , followed by the seventh nerve ( 3.7% ) , and the sixth nerve ( 1.0% ) . thus , abducens palsy is a rare isolated ms finding , either as a presenting sign or during disease exacerbation . patients with abducens palsy typically present with diplopia upon horizontal gaze , and examination can reveal a slow ipsilateral lateral rectus movement [ 4 , 5 ] . ms has been implicated as the cause of unilateral abducens palsy in 49% of cases , though mri may not detect brain stem lesions in all cases . one 2002 study investigating nontraumatic causes of sixth nerve palsies in patients 2050 years of age found ms to be the cause in 24% of cases . in addition to ms , the differential diagnosis for an abducens nerve palsy includes mass lesions , lyme disease , viral infection , syphilis , sarcoidosis , and vascular disease . here , we report a patient who presented with a unilateral isolated abducens palsy as the initial sign of ms . a 28-year - old man with a past medical history of hypertension and obesity presented to the emergency department with a 1-day history of double vision , most prominent upon left lateral gaze . the double vision resolved with covering either eye . in addition , he had a 12-week history of paresthesia of the distal right hand and forearm , and the fifth digit of the right foot . initial laboratory findings revealed only a mild leukocytosis ( 11.3 10/l ) and no other hematologic or electrolyte abnormalities . several focal areas of increased t2 signal intensity were noted within the periventricular white matter of the frontal and parietal lobes , subcortical white matter of the left temporal lobe , and the left pons . these findings likely represented multiple lesions distributed in both time and space , and , along with the patient 's clinical history and examination , were suggestive of a diagnosis of ms . the patient was admitted and started on intravenous methylprednisolone . further workup to rule out other etiological causes of illness revealed an elevated esr of 25 mm / h , negative viral and lyme serologies , nmo igg negative and a negative ana . he was treated with methylprednisolone 500 mg intravenously for 3 days and then discharged home . he was re - evaluated in the office 2 days after hospital discharge and had complete resolution of the cn vi palsy . isolated nerve palsies occur in only 10.4% of patients with ms , with abducens palsy as the third most common isolated nerve palsy , occurring in 1.0% of patients with ms , behind trigeminal ( 4.8% ) and facial ( 3.7% ) . these palsies occur most commonly at disease onset , though they can also occur during the course of the disease . the lesion in the medial pons was enhancing and thus consistent with an active lesion , and the location was consistent with his cn vi palsy . the sixth nerve nucleus is located in the pontine tegmentum , and a compact fiber tract bundle containing motor neurons from this nucleus runs medially towards the ventral region , where the cranial nerve exits the pons [ 3 , 8 ] . our patient 's pontine lesion appeared to be located along the fiber tract emerging from the sixth nerve nucleus , and correlates with his diplopia . while an mri lesion was detected clearly in this case , it should be noted that previous authors have found that mri does not always detect brain stem lesions accounting for these palsies in ms patients [ 4 , 6 ] . in any patient presenting with isolated cranial nerve palsies , ms must be considered within the differential diagnosis . in patients younger than 50 years of age ( as with our patient ) , infectious causes ( lyme disease , viral infections , syphilis ) , sarcoidosis , and autoimmune vasculitis should also be considered on the differential diagnosis , whereas for older patients small vessel vascular disease should be considered as well [ 7 , 8 ] . the presence of multiple presenting neurological deficits including cranial nerve palsies is suspicious for ms and should be investigated with mri . though mri may not always detect brain stem lesions responsible for cranial nerve palsies , it can reveal other white matter lesions of the cns that can aid in the diagnosis of ms , as was the case with our patient .

for a prospective study of lead exposure and early development , we recruited pregnant women from a lead smelter town and from an unexposed town in yugoslavia and followed their children through 7 years of age . in this paper we consider associations between lifetime lead exposure , estimated by the area under the blood lead ( bpb ) versus time curve ( auc7 ) , and intelligence , with particular concern for identifying lead 's behavioral signature . the wechsler intelligence scales for children - version iii ( wisc - iii ) was administered to 309 7-year - old children , 261 of whom had complete data on intelligence , blood lead , and relevant sociodemographic covariates ( i.e. , home observation for the measurement of the environment ( home ) , birth weight , gender , sibship size , and maternal age , ethnicity , intelligence , and education ) . these showed anticipated associations with 7-year intelligence , explaining 41 - 4% of the variance in full scale , performance , and verbal iq . before covariate adjustment , auc7 was unrelated to intelligence ; after adjustment , auc7 explained a significant 2.8%-4.2% of the variance in iq . after adjustment , a change in lifetime bpb from 10 to 30 micro / dl related to an estimated decrease of 4.3 full scale iq points ; estimated decreases for verbal and performance iq were 3.4 and 4.5 points , respectively . auc7 was significantly and negatively related to three wisc - iii factor scores : freedom from distractibility , perceptual organization , and verbal comprehension ; the association with perceptual organization was the strongest . consistent with previous studies , the iq / lead association is small relative to more powerful social factors . findings offer support for lead 's behavioral signature ; perceptual - motor skills are significantly more sensitive to lead exposure than are the language - related aspects of intelligence.imagesfigure 1 . afigure 1 . bfigure 1 . cfigure 1 . dfigure 2 .

please summarize the articles given below

according to the world health organization ( who ) , a maternal death is defined as death of a woman while pregnant or within 42 days of termination of pregnancy , irrespective of the duration and site of pregnancy , from any cause related to or aggravated by pregnancy or its management ( icd-10 ) . about 99% of these women are from developing world with over 90% concentrated in africa and asia . the risk of a woman dying as a result of pregnancy and childbirth during her lifetime is about 1 in 6 in afghanistan compared with 1 in 30,000 in northern europe . united nation ( un ) report card on millennium development goal-5 concluded that little progress had been made in sub - saharan africa where half of all maternal deaths take place . the progress shown by the south asian countries including india which accounts for 25% of all maternal deaths is also not impressive . most of the evidence for maternal mortality is obtained through hospital data and community based reports , which are situated mostly in urban areas , whereas most of the maternal deaths are from rural areas . this study was done to assess maternal mortality in a tertiary medical college hospital situated in semi urban part of western maharashtra where large numbers of patients are referred from rural parts of western maharashtra and north karnataka . this study was done to assess the local causes of maternal mortality and suggest remedial measures to reduce the same . to calculate the maternal mortality rate in our hospital.to assess the epidemiological aspects of maternal mortality.to assess the causes of maternal mortality.to suggest ways to reduce the mmr . to calculate the maternal mortality rate in our hospital . to assess the epidemiological aspects of maternal mortality . to assess the causes of maternal mortality . to suggest ways to reduce the mmr . to calculate the maternal mortality rate in our hospital.to assess the epidemiological aspects of maternal mortality.to assess the causes of maternal mortality.to suggest ways to reduce the mmr . to calculate the maternal mortality rate in our hospital . to assess the epidemiological aspects of maternal mortality . to assess the causes of maternal mortality . to suggest ways to reduce the mmr our hospital is a semi - urban , tertiary care center ; situated in the southernmost part of western maharashtra . it gets a large number of referrals from maternity homes , primary health centers from rural parts of western maharashtra , and also from north karnataka . the present study was a retrospective study , conducted in the department of obstetrics and gynecology of this hospital . data regarding maternal mortality was collected from maternal mortality register after obtaining permission from the medical superintendent of the hospital . the details of maternal deaths from january 2001 to december 2010 were collected and analyzed with respect to following epidemiological parameters . locality wise distribution of maternal deaths.literacy wise distribution of maternal deaths.gravidity wise distribution of maternal deaths.maternal deaths according to receipt of antenatal care.distribution of maternal deaths according to socioeconomic status.causes of maternal deaths . the details of number of live births from january 2001 to december 2010 were collected from labor ward register . maternal mortality rate for the study period was calculated by using the formula- mean maternal mortality ratio for the study period was calculated by calculating the mean of yearly mmr of the entire study period . during the study period , january 2001 to december 2010 , there were a total of 39704 live births and 120 maternal deaths . maximum maternal deaths ( 49.16% ) were reported in the age group of 20 to 24 years . ( 43.33% ) , more maternal deaths were reported in women from rural areas ( 69.16% ) as compared to women from urban areas ( 30.83%).maximum maternal deaths were reported in unbooked patients ( 83.33% ) as compared to booked patients ( 16.66% ) . epidemiological characteristics of maternal deaths ( n = 120 ) in the study period , 72.5% of maternal deaths were due to direct causes . year - wise distribution of direct causes of maternal deaths is shown in table 2 . the classical triad of hemorrhage ( 26.66% ) , eclampsia ( 26.66% ) , and sepsis ( 18.33% ) was the major direct causes of maternal deaths , whereas only one maternal death ( 0.83% ) was due to obstructed labor . in the study period , anemia , jaundice , and heart disease accounted for 10% , 9.16% , and 3.33% of maternal deaths respectively and miscellaneous cause like acute gastroenteritis accounted for 5% of maternal deaths as shown in table 3 . high incidence of maternal deaths reflects poor quality of maternal services , late referral and low socioeconomic status of the community . various studies done in india in the last 15 years have shown wide variation in mmr ranging from 47/100000 to 625/100000 births.[49 ] madhu jain has reported a very high mmr of 2270/100000 . this study has comparatively high mmr , which could be due to the fact , that our hospital is a tertiary care hospital and receives a lot of complicated referrals from rural areas of southern maharashtra and also from north karnataka at a very late stage . in our study , 70% of maternal deaths were in the age group of 20 to 29 years , as highest numbers of births are reported in this age group . more maternal deaths were reported in women from rural areas ( 69.16% ) , unbooked patients ( 83.33% ) , illiterate women ( 65% ) , and women belonging to low socioeconomic status . ( 83.33% ) all our findings were similar to studies by jain , jadhav , pal , onakewhor . in our study , hemorrhage ( 26.66% ) , eclampsia ( 26.66% ) , and sepsis ( 18.33% ) were the major direct causes of maternal deaths . our findings were consistent with studies by jain , jadhav , pal , onakewhor , and shah . even today large number of maternal deaths is due to the classical triad of hemorrhage , sepsis , and eclampsia . all these are preventable causes of maternal mortality provided the treatment is instituted in time . unfortunately , in many cases , patients were referred very late , in critical condition , unaccompanied by health care worker . many patients had to travel a distance of 70 to 80 kilometers in a private vehicle to reach our tertiary center . most of these deaths are preventable if patients are given appropriate treatment at periphery and timely referred to higher centers . training of medical officers and staff nurses working in rural areas by programs like basic emergency obstetrics care ( bemoc ) and skilled attendant at birth ( sab ) training gives a ray of hope of reducing maternal mortality . anemia , jaundice , and heart disease were responsible for 10% , 9.16% , and 3.33% of maternal deaths , respectively . these findings were consistent with studies by jain , jadhav , pal , and onakewhor . maternal deaths can be prevented by improving the health care facilities in rural areas by ensuring round the clock availability of certain basic drugs like injection magnesium sulfate , tablet misoprostol as most maternal deaths in rural areas are still due to eclampsia and post partum hemorrhage . early detection of high risk pregnancies and referring them to a tertiary center at the earliest can reduce the complications of high risk pregnancies . national rural health mission ( nrhm ) can play a major role in reducing maternal mortality by advocating institutional deliveries and timely referral of high risk cases . although we have not actually evaluated the impact of aforementioned educational programs on maternal mortality , it would be interesting to direct future studies in this regard . even today most maternal deaths are seen in patients from rural areas , unbooked , illiterate patients and patients from low socioeconomic status . hemorrhage , eclampsia and sepsis are the major causes of maternal deaths . improvement in primary health care in rural areas and proper implementation of nrhm programs and up gradation of hospitals in rural areas can definitely bring down the number of maternal deaths . non - hodgkin lymphomas ( nhls ) account for approximately 60% of all lymphomas in children and adolescents . childhood nhls are subdivided into burkitt 's lymphoma , diffuse large b - cell lymphoma ( dlbcl ) , lymphoblastic lymphoma , and anaplastic large - cell lymphoma . dlbcl is characterized by relatively more frequent extranodal presentation , seen in upto 40% of the cases . primary involvement of the lymphoma of the middle ear is rare , with only about 18 cases being reported in literature so far . here , we report a case of dlbcl , presented with features of facial palsy and otitis , who received initial symptomatic treatment and later chemotherapy after diagnosing dlbcl . a 2 years 8 months old boy visited our tertiary care hospital with complaints of ear ache ( left side ) and left facial palsy of 4 weeks duration . after initial 2 weeks of these symptoms , there was whitish serous discharge from the left ear . before referral to our hospital , he was treated for otitis media with antibiotics , details of which were not available . his complete blood picture and biochemistry investigations done in our hospital were within normal limits . as the symptoms persisted for 4 weeks , computed tomography of head and neck was done which was suggestive of solid mass lesion of 2 cm 2 cm size in the left mastoid with destruction of mastoid bone [ figure 1 ] . the disease was in stage 1 ( as per murphy 's staging ) and was completely resected . histopathological examination showed large cells of lymphoid cell proliferation immune histochemistry was positive for cd20 , bcl-2 and negative for cd3 , with low mib-1 , which confirmed dlbcl . his positron emission tomography for staging , bone marrow and cerebrospinal fluid revealed no abnormality . computed tomography head and neck suggestive of solid mass lesion of 2 cm 2 cm size in the left mastoid with destruction of mastoid bone computed tomography head and neck of right side showing no abnormality his initial clinical symptoms of earache and facial nerve palsy followed by ear discharge resolved after starting chemotherapy as per b - cell lymphoma protocol for 6 months . currently , he is 37 months off treatment , and no disease recurrence is seen clinically as well as radiologically . it is an aggressive form of lymphoma , usually curable with appropriate treatment and has high survival rate . rapid disease progression of dlbcl calls for an early , accurate diagnosis and appropriate treatment . however , unusual presentation can mislead the physician resulting in wrong diagnosis , which delays the treatment , thus promoting disease progression . extranodal presentations of childhood dlbcl are relatively uncommon in clinical practice , and much rarer are those primarily involving middle ear and mastoid . involvement of middle ear and mastoid can resemble the features of otitis media and unusual facial palsy mimicking mastoiditis . although these initial symptoms were suggestive of middle ear infection , the distinguishing factor was unresponsiveness to antibiotics . there have been very few reports of nhl with facial nerve involvement ; ogawa et al . mccabe et al . , reported a case of 2-year - old , an immunocompetent boy with spontaneous regression of an epstein - barr - virus - associated monoclonal lymphoid proliferation who presented with acute otitis media and facial palsy . have described a case of dlbcl with features of otitis media , mastoiditis , and facial palsy . as symptoms persisted even after 4 weeks of treatment , the patient was started on chemotherapy , to which he promptly responded . extranodal nhls of middle ear which is not a common clinical presentation may present as facial palsy , and misdiagnosed as otomastoiditis . there should be a high index of suspicion for primary neoplasms of the middle ear in patients with chronic otomastoiditis refractory to appropriate initial antibiotic therapy ; early diagnosis and appropriate treatment results in good therapeutic outcome and minimizes further complications .

background : epidemiological data pertaining to maternal mortality is valuable in each set up to design interventional programs to favourably reduce the ratio . this study was done to evaluate the maternal mortality rate in our hospital , to assess the epidemiological aspects and causes of maternal mortality , and to suggest recommendations for improvement.methods:this was a 10 year retrospective study . epidemiological data was collected from the hospital register and maternal mortality ratio , epidemiological factors and causes affecting maternal mortality were assessed.results:a total of 120 maternal deaths occurred . most maternal deaths occurred in the age group of 2024 years , multiparous women ( 56.66% ) , women from rural areas ( 69.16% ) , illiterate women ( 65% ) , unbooked patients ( 83.33% ) , and patients of low socioeconomic status ( 83.33% ) . direct causes accounted for 72.5% of maternal deaths where as 27.5% of maternal deaths were due to indirect causes.conclusion:there is a wide scope for improvement as a large proportion of the observed deaths are preventable .

please summarize the articles given below

in 2008 , a 30-year - old primigravida physician experienced intrauterine fetal demise ( iufd ) at 20 weeks gestation , as established by last menstrual period and confirmed by ultrasound at 8 weeks . the patient spent most of her pregnancy providing direct patient care . in october 2007 , during gestational weeks 26 , she was exposed to at least 2 patients with presumed influenza . she reported symptoms of fever , myalgia , headache , and cough during gestational week 4 . she had no testing for influenza , did not receive antiviral therapy , and took acetaminophen ; her symptoms resolved . an ultrasound at 18 weeks demonstrated early growth restriction and oligohydramnios with normal appearing fetal kidneys and head . the patient had an unremarkable medical history , did not smoke , and was normotensive throughout pregnancy . microscopically , histiocytes were abundant in the maternal space ( chronic intervillositis ) and were noted within the fetal chorionic villi ( hofbauer cells ; figure 1 , panel a ) . histologic analysis of fetal autopsy specimens showed scattered luminal histiocytes of the lung and gut . no other inflammatory changes or viral inclusions were identified in the placenta or fetal organs . tissue sample from 30-year - old primigravida patient exposed to seasonal influenza ( h1n1 ) . a ) intervillous ( maternal ) spaces with clusters / sheets of histiocytes ( chronic intervillositis ) and fibrotic fetal chorionic villi with hofbauer cells histiocytic inflammation ( hematoxylin and eosin stain , original magnification 200 ) . b ) dual - stained immunofluorescent assay showing antibodies to influenza a virus ( h1n1 ) ( tetramethylrhodamine isothiocyanate , red ) and cytokeratin ( fluorescein isothiocyanate , green ) in intravillous ( fetal ) and intervillous ( maternal ) space . chronic intervillositis was evident in the placental histology and has been previously described with nonspecific changes in miscarriage and recurrent pregnancy loss ( 4 ) . histiocytes identified from the maternal intervillous space and fetal chorionic villi demonstrated characteristics of viral production ( figure 2 ) . several well - formed viral capsids were noted within the cytoplasm , each containing regularly spaced projections along the surface of the virion corresponding to the hemagglutinin and neuraminidase spikes . tissue sample from 30-year - old primigravida patient exposed to seasonal influenza ( h1n1 ) . electron microscopy ( original magnification 70,000 ) of maternal intervillous space and fetal chorionic villi , showing intranuclear viral transcription aligning along the nuclear envelope electron hypodensities ( asterisks ) , and intracytoplasmic viral production in varying stages shown by numerous electron densities ( v and ^ ) . pcr for m1 capsid protein confirmed influenza a. immunohistochemical testing was performed on tissue from the placenta and on a sampling of fetal organs by using influenza a virus ( h1n1)specific antibody . in the placenta , stippled immunofluorescence ( figure 1 , panel b ) was noted in the histiocytes of the intervillous space ( maternal ) and fetal intravillous histiocytes . in the fetal organs , immunofluorescence for subtype h1n1 was notable in the surface epithelial cells and scattered luminal histiocytes of the fetal respiratory and gastrointestinal tracts . no immunofluorescence was noted within the fetal organs , which implied transamnionic passage of virus ( amnionic fluid infection ) . y - specific immunofluorescent stain with histiocyte counterstaining was performed . because only the intravillous ( fetal ) histiocytes stained positively , maternal and fetal inflammatory responses were confirmed . harris reported higher rates of miscarriage after exposure and infection in the earliest months of pregnancy in the spanish influenza outbreak of 1918 ( subtype h1n1 ) ( 5 ) . hardy et al . reported a similar observation following the asian influenza outbreak of 195758 ( 6 ) , as did investigators in the united kingdom during the 198586 influenza season ( 7 ) . yawn et al . documented influenza a transplacental transfer from the mother to amniotic fluid and fetal heart ( 8) . . summarized placental findings associated with influenza infections in publications from 1987 and 1994 , describing perivillous and villous inflammation with concurrent amniotic fluid immunofluorescence for influenza virus ( 9 ) . in another study ( 10 ) , researchers from beijing , people s republic of china , reported autopsy findings for 2 patients ( 1 of whom was 4 months pregnant ) who died of avian influenza a ( h5n1 ) . viral antigens were present in the maternal pulmonary system , and virus was detected in placental hofbauer cells ( histiocytes ) , cytotrophoblast , fetal lung , circulating mononuclear cells , and liver macrophages ( 10 ) . their documentation of tropism of the influenza virus to placental tissue is similar to the histopathologic features in our report . our unexpected discovery of viral production in placental , maternal , and fetal histiocytes is another example of transplacental passage of influenza . adverse fetal outcomes have reportedly included congenital malformation and schizophrenia , but factors that determine these effects remain unclear ( 11,12 ) . fetal consequences of influenza exposure may be an effect of systemic inflammatory response to the infection , which could represent direct action of the virus on the placenta , the maternal fetal interface , or the fetus . reported the inflammatory response of decidual and fetal tissue in the presence of influenza virus infection and demonstrated expression of mrna for a set of proinflammatory cytokines such as interleukin-6 , tumor necrosis factor- , and granulocyte macrophage colony - stimulating factor , secreted in substantial amounts in response to exposure to influenza virus in vitro ( 13 ) . as our case suggests , a complex interaction of maternal and fetal responses at the interface is a more likely explanation . a total of 15%20% of pregnancies end in spontaneous miscarriage , most before gestational week 12 ( 3 ) . approximately 50% of miscarriages are associated with chromosomal defects , which leaves many other miscarriages unexplained ( 14 ) . examined first trimester miscarriages not associated with chromosomal abnormality , observing histologic changes of chronic intervillositis and increased perivillous fibrin ( 15 ) . the mechanism of loss was thought to be related to a maternal inflammatory response to infectious antigen or an autoimmune phenomenon . whether these findings can be extrapolated to second trimester losses histopathologic features of these early second trimester miscarriages are not well studied , and descriptions are usually included in reports of fetal losses during 1427 weeks , which include iufd ( > 20 weeks ) and miscarriage . consequently , a direct causal relationship between influenza a and fetal demise has not been well established . in our report , a retrospective investigation of the patient s products of conception with ultrastructural , immunohistochemical , and molecular methods that identified subtype h1n1 implies an exposure during her first trimester . type - specific serologic analysis was not possible because she received influenza vaccine several weeks after presumed exposure . the maternal and fetal inflammatory responses ( chronic intervillositis ) after placental infection may have reduced villous surface area for oxygen and nutrient transport , resulting in growth restriction and ultimately second trimester loss . investigation of the effects of influenza in early pregnancy is needed to evaluate potential pathophysiological relationships between maternal exposure , infection , and fetal loss or adverse outcome . during the 200910 influenza pandemic , the centers for disease control and prevention ( atlanta , ga , usa ) collected information from populations exposed to and infected with pandemic ( h1n1 ) 2009 virus . we recommend that future influenza outbreak evaluations of women exposed to influenza with first or early second trimester pregnancy loss include collections of placental and fetal tissue samples . acute pancreatitis due to antipsychotic treatment is rare but sometimes causes a fatal adverse effect . some atypical antipsychotic agents , including clozapine , olanzapine , quetiapine , and risperidone , are associated with acute pancreatitis.1,2 ) among them , acute pancreatitis caused by risperidone is the rarest.3,4 ) although most cases of acute pancreatitis due to atypical antipsychotic agents occur within 6 months of starting antipsychotic administration,1 ) we experienced a schizophrenic patient suffering from pancreatitis after more than 6 months of risperidone therapy . a 69-year - old japanese woman was diagnosed with schizophrenia at the age of 30 years and received outpatient care at another mental hospital . her positive symptoms were not prominent , but her cognitive level was so impaired that she could not regulate her appetite and consumed about 2,000 kcal / day in addition to three ordinary meals . she had never smoked , did not drink alcohol , and did not take any illegal drugs . blood tests ( table 1 ) , abdominal ultrasonography , and a computed tomography ( ct ) scan were performed . clinical features were accompanied by laboratory findings of hyperamylasemia ( amylase , 1,191 u / l ) , hyperlipasemia ( lipase , 1,514 u / l ) , and mild liver enzyme elevations . results of the abdominal ultrasonography were positive for gallstones in the gallbladder and distention of the common bile duct . subsequently , the amylase and lipase titers remained high ( 461 u / l and 804 u / l , respectively ) , although alanine and aspartate aminotransferases decreased gradually to normal levels . at this point , we felt that it was safe for her to start taking the risperidone again . two days after starting the risperidone , serum lipase and amylase increased again to 1,275 u / l and 745 u / l , respectively , and ck also increased ( 766 u / l ) . we decided to suspend the risperidone and introduced 10 mg intravenous haloperidol injections once per day . two days after discontinuing the risperidone , the serum amylase decreased ( 605 u / l ) , but the serum lipase level remained elevated ( 1,654 u / l ) . one week after discontinuing the risperidone , the levels of amylase and lipase decreased gradually ( 309 u / l and 542 u / l , respectively ) , and ck dropped to the normal range . as her general clinical condition and biochemical markers were stable , we changed the haloperidol injection to an oral solution of 6 mg / day aripiprazole because her mental condition worsened after stopping the risperidone treatment . her mental status improved with the aripiprazole treatment , and she was discharged without positive laboratory findings . the patient 's monthly blood tests continue to be normal , including amylase , lipase , and blood cell counts . although atypical antipsychotic - induced pancreatitis has been reported in conjunction with hyperglycemia,5 ) the pathophysiological mechanism of these adverse events remains unclear . most antipsychotic - induced pancreatitis occurs within 6 months after administration1 ) ; however , our case developed pancreatitis more than 6 months after the start of risperidone treatment . risperidone is a 5-ht2a antagonist and ameliorates diet - induced necrotic pancreatitis in mice,6 ) and reduced serum pancreatic amylase levels is observed after endoscopic retrograde cholangiopancreatography.7 ) however , there is no evidence of an association between risperidone treatment and acute pancreatitis . a thorough evaluation for pancreatitis , such as alcohol , tumor , and autoimmune causes , gallstones were present , which were due to an adverse effect of risperidone because the two separate risperidone administrations elevated serum amylase and lipase independently . aripiprazole is currently used in such cases , as aripiprazole is thought to have fewer effects on metabolism , including saccharometabolism , than other atypical antipsychotic agents . lifestyle was also a risk factor in this case . thus , it is necessary to monitor pancreatic function in addition to hyperglycemia in such cases .

a second trimester fetal demise followed influenza - like illness in early pregnancy . influenza a virus ( h1n1 ) was identified in maternal and fetal tissue , confirming transplacental passage . these findings suggested a causal relationship between early exposure and fetal demise . management of future influenza outbreaks should include evaluation of products of conception associated with fetal loss .

please summarize the articles given below

primary cysts have a lined epithelium and secondary cyst could be secondary to trauma . epidermoid splenic cysts are example of primary congenital cysts that contain an epithelial lining , unlike secondary cysts , which are composed of fibrous tissues , when the cyst is large they have nonspecific abdominal symptoms like pain , nausea , or a palpable mass usually in the left upper quadrant . epidermoid cysts and parasitic cysts are examples of primary cysts and usually have a classic presentation on imaging . despite imaging modalities and the patient s history , it can be difficult to diagnose an epidermoid cyst without a histological examination . the purpose of this paper is to discuss variable and atypical radiological presentation of primary splenic cysts including epidermoid cysts . a 51-year - old female presented to the ed using private transportation with complaints of left upper quadrant abdominal pain , nausea and vomiting for a couple days . she had significant medical history of hypertension , gerd , and hyperlipidemia with a bmi of 37.5 and no previous surgical history . patient had quit smoking cigarettes two years prior , does not drink alcohol or use any illicit drugs . physical exam was significant to being mildly tender to palpation over her left upper quadrant . vitals , complete blood count , basic metabolic panel , liver function tests , and urine analysis were all within normal limits . abdominal ultrasound ( fig . 1 ) visualized a 7.7 cm complex mass in the medial aspect of the spleen . 2 ) revealed a hypodense cystic mass in the medial aspect of the spleen measuring 10.4 cm 8.2 cm with a hounsfield attenuation of 15 ; containing multiple foci of fat with hounsfield attenuation of 102 . patient was assumed to have a confined cystic tumor of unknown etiology without any acute complications at this point . after long discussion with the patient with this large cystic mass of the spleen of unknown pathology , splenectomy was offered to the patient . she underwent uneventful laparoscopic hand - assisted splenectomy 6 weeks after presentation to the ed . she continued to have an uneventful recovery on follow - up with no recurrence of painful symptoms . 4 ) , it weighed 404 g , and was 17 11 5 cm in dimensions and was partially cystic . 11 10 7 cm smooth walled yellow tan cyst was present . on microscopic examination , sections demonstrated unremarkable splenic parenchyma and cyst walls lined by stratified squamous epithelium . immunohistochemical stains demonstrated an adequate distribution of cd20 + b - lymphocytes and cd3 + t - lymphocytes . . examples of primary benign neoplasms involving the spleen include haemangiomas , lymphangiomas , angiomas and splenic mesenchymal tumors such as lipomas , angiomyolipomas , fibromas , fibrosarcomas , and leiomyosarcomas . . they could be a pseudocyst secondary to trauma or a true cyst , which might be infectious or congenital such as an epidermoid cyst . epidermoid splenic cysts are primary congenital cysts that contain an epithelial lining , unlike secondary cysts which are composed of fibrous tissues , . patients usually do not present with specific symptoms if the cyst is small , and when the cyst is large , they have nonspecific abdominal symptoms like pain , nausea , or a palpable mass usually in the left upper quadrant . on imaging , epidermoid and parasitic cysts , which are also primary cysts , can be similar in appearance showing up as well - defined solitary lesions with septations . on computed tomography , septations , calcifications and internal debris . when findings are consistent with multiple neighboring cysts or daughter cysts , parasitic cysts are in favor as a diagnosis . epidermoid cysts of the spleen usually have a thin - walled anechoic appearance on ultrasound with no evidence of calcification on computed tomography . on t2-weighted magnetic resonance imaging , the cyst is hyper - intense , and on t1-weighted imaging , it is hypo - intense but can be increased depending on cyst contents . we used computed tomography to accurately identify the location , size , and adjacent structures of the cyst with an understanding that a definitive diagnosis would only be made by histopathological examination . we identified a complex mass on ultrasound and a hypodense lesion on computed tomography with multiple foci of fat , which were very different demonstrations from what is expected of a classic epidermoid or parasitic cyst on imaging . when examined , an epidermoid cyst usually has a white or grey smooth internal wall with fibrous trabeculations . under microscopic examination , an epithelium is visualized that is stratified squamous , which was consistent with our findings , and the contents can be serous , turbid , or thick and vary in color . surgical treatment is recommended for a symptomatic splenic cyst and for cysts larger than 5 cm , , . marsupialization or fenestration as treatments are indicated for superficial cysts , but they have a high recurrence rate , . in our case a large cyst , greater than 5 cm was identified and extended behind the stomach and into the medial aspect of the spleen . a total splenectomy was our indicated diagnostic and treatment of choice due to size of the cyst , presentation with symptoms , and also as a preventative intervention against future rupture , hemorrhage , infection , or recurrence . it is important to recognize that epidermoid splenic cysts may not always present in a classic fashion on imaging so it is trivial to include them as a differential diagnosis when warranted . the exact nature of a cyst will not be known prior to histological examination as in our case when imaging is not accurate or definitive in differentiation . therefore , the cyst was treated based on symptomology , size , and location and a total splenectomy which was indicated , was performed . bilal kharbutli , md and sharmilee vuyyuru , do have contributed in the study concept and writing . fungal infections are well - recognized life threatening problems in solid organ transplant ( sot ) , namely in liver transplant recipients . host and environmental factors are critical and important determinants regarding the epidemiology of fungal infections in transplantation . the incidence and aetiology of fungal infections differ dramatically between hematopoietic stem cell transplantation and sot . in the last group , those receiving lung grafts have the highest incidence ( 7.9% ) followed by heart ( 3.4% ) , liver ( 3.1% ) , kidney ( 1.1% ) , and pancreas ( 0.7% ) . in liver transplanted patients , the incidence of invasive fungal infections ranges from 4 to 50% and candida spp . and aspergillus spp fungal cutaneous and subcutaneous infections are frequently associated with people with professional activities related to agriculture or forestry work and the entry of the fungus is facilitated by penetrating injuries caused by thorns , splinters , nails , etc . the limbs are the most affected , but other body parts can also be involved . alternaria general characteristics include the production of dark - coloured phaeodictyospores in chains , and a beak of tapering apical cells [ 6 , 7 ] . some species are recognized to cause cutaneous phaeohyphomycoses and are described as emerging pathogens in immunocompromised patients , being transplantation the most common risk factor and also associated to the use of prednisone . a 65-year - old male caucasian was observed in a dermatology consultation of a central hospital in lisbon on 16th april 2014 . the patient presented with two painless , fast - growing nodules which had developed within 4-months . one of the nodules was located on the right leg and the other one on the dorsum of the left hand ( figs . 1 and 2 ) . he had a clinical history of 6-months liver transplantation and at the time of observation was under immunosuppressive therapy with tacrolimus 8 mg once a day , mycophenolate mofetil 500 mg twice a day and prednisone 20 mg once a day . the patient referred a previous history ( previous to the transplantation ) of agricultural activities with frequent skin injuries . physical examination revealed a well - defined erythematous nodule with 1.4 cm of maximum diameter , with central haematic crusts and a peripheral scali collarette on the dorsum of the left hand and a violaceous nodule with 1.5 cm with central haematic crusts and serous exudate on the right leg . skin biopsies were collected on that day from both nodules using a 4 mm biopsy punch and sent for histological and mycological examination . histological sections of the biopsy were stained with periodic acid - schiff and results retrieved on day + 13 revealed an inflammatory infiltration of the dermis and the presence of multiple fungal spores and hyphae . the mycological analysis of the biopsy material was performed using with calcofluor - white staining , followed by observation under fluorescence microscopy . clinical specimens were cultured on sabouraud 's dextrose agar containing chloramphenicol at 30 c and 35 c . cultures yielded a grey velvety fungus , with a dark - brown reverse on day + 14 . when sub - cultured both on malt extract agar for identification , the microscopic examination of the moulds performed by teased mount and lacto - phenol cotton blue preparation , showed different macroscopic features : green ( leg biopsy ) to grey ( hand biopsy ) colonies both with dark reverse . microscopic examination showed chains of brown conidia with rounded base and beaked apex , with transverse and oblique septation . there were a slight difference between microscopy from leg and hand biopsy , in the first one , conidial chains were more branched than in the second one , and conidia were less tubular ( figs . 3 and 4 ) . from the above microscopic and macroscopic features , the isolates were identified as alternaria spp . on day + 20 and sequenced for speciation . the lesions were excised on day + 34 and the patient started antifungal therapy on the same day with oral itraconazole ( 100 mg daily ) for 3 months with adjustment of immunossupressive therapy . total genomic dna was extracted from purified colonies and the internal transcribed spacer ( its ) region of ribosomal dna ( rdna ) of these isolates was amplified using primer set its1 ( 5tccgtaggtgaacctgcgg3 ) and its4 ( 5tcctccgcttattgatatgc3 ) . sequencing of both strands was performed and nucleotide sequences were edited using the programme chromas2 and aligned using the programme clustal x2 . the sequences obtained were compared with sequences deposited in the genbank and cbs - knaw fungal biodiversity centre databases . molecular sequencing resulted in the identification of alternaria infectoria from the culture obtained from the patient 's hand and alternaria alternata from the culture obtained from the patient 's leg . the sequencing coverage was high ( 99100% ) , as well as the homologies with reference strains ( 98% ) , which is the value considered as an acceptable identification to species level . in fact , we obtained a sequence with a homology of 98% and 99.5% with alternaria infectoria and alternaria alternata , respectively . nucleotide sequences of the isolates were deposited in the genbank database under the accession numbers kp171632 ( alternaria infectoria ) and kp171633 ( alternaria alternata ) . phaeohyphomycosis can be caused by different species , being a. alternata and a. infectoria the most commonly isolated . dematiaceous fungi have melanin in their cell walls , which represent a virulence factor for several pathogenic fungi . the raise of patients under immunosuppressive drug therapy has increased and so the risk of fungal infections is likely to increase . the patient of this case report lives in a rural area , but did not refer trauma after transplantation . however , after a detailed questionnaire , the patient referred that before the transplantation he carried out different agricultural activities and had skin injuries . cutaneous fragility induced by hypercorticism could be an important co - factor permitting direct inoculation from the environment . nevertheless , several fungi can also remain latent for long periods of time and the clinical symptoms of fungal infection may appear several years after the inoculation of the etiological agent . there are currently no standardised treatments for cutaneous infections caused by alternaria spp . in those cases and when it is possible , the reduction of the immunosuppression level can be enough to resolve the lesions , although the long - term use of systemic itraconazole is often recommended . co - existent fungal infections associated with alternaria spp are sometimes referred [ 1723 ] , despite infrequently . furthermore , most of the published cutaneous fungal infection cases refer infection due to only one species as etiological agent . to our knowledge , this is the first case described of a cutaneous co - infection with two different species of alternaria . infection with different species can be under diagnosed , since when multiple lesions are observed , biopsy material is normally taken from only one of them . early detection and appropriate antifungal therapy are essential in the treatment of this emergent infection , molecular identification is a useful tool to distinguish mixed fungal infection .

highlightssplenic tumors are not common , many can have minimal to no symptoms , and they can be found incidentally.splenic tumors can be primary or metastatic . they can be benign or malignant.splenic cysts can be infectious , traumatic or congenital.epidermoid splenic cysts may not always present in a classic fashion on imaging , making diagnosis challenging.many splenic masses and complex cysts would require surgical pathological diagnosis .

please summarize the articles given below

prospective studies have shown the superiority of laparoscopic appendectomy in the treatment of acute appendicitis . however , this technique has not yet gained widespread acceptance because of its longer operative time and lower cost effectiveness when compared with the open approach . moreover , although recent retrospective studies have shown that laparoscopic appendectomy is associated with a significantly shorter hospital stay , other reports demonstrate no significant difference in hospital stay when the laparoscopic and the open approach were compared . the minilaparoscopic approach is associated with less abdominal wall trauma , a lower infection rate at the trocar site and abdominal wall hernia , and produces excellent cosmetic results . in this study , our goal was to confirm the safety and show the feasibility of the minilaparoscopic approach for the treatment of acute appendicitis . between may 1999 and june 2001 , a minilaparoscopic appendectomy was attempted in 37 patients with a preoperative diagnosis of acute appendicitis and without a previous history of abdominal surgeries . the pneumoperitoneum was created by insertion of a veress needle through a small incision in the umbilicus . a 2.2-mm trocar was placed laterally to the left rectus abdominis muscle and served to manipulate a 2.2-mm , 0-degree laparoscope . another 5-mm trocar was placed just below the umbilical crease and was used for the ultrasonic scalpel . a third 2.2-mm trocar was placed suprapubically in the midline and was used for grasper access . exploration of the right lower abdominal cavity identified either an inflamed appendix or ruled out appendicial pathology . in the presence of appendicial pathology , the appendix was held with an atraumatic grasper and dissected with a 5-mm ultrasonic scalpel . an endoloop was positioned at the base of the appendix and tied 1 cm distally to its base . the appendix was then dissected by using an ultrasonic scalpel and placed in a sterile 8 and 1/2-size glove finger used as a specimen bag and removed through the 5-mm trocar site . all specimens were sent to the pathology laboratory for analysis . at the end of the procedure , all trocars were removed and the fascial defect at the 5-mm trocar site was repaired with absorbable sutures . all skin wounds were closed with steri - strips , and sterile dressings were applied . all patients were discharged with written instructions regarding diet , physical activity , use of oral nonsteroidal anti - inflammatory drugs ( nsaids ) for pain control , and follow - up clinic visits were scheduled for 1 week , 1 month , and 6 months postoperatively . the study population consisted of 37 patients , of which 7 were males and 30 were females . the average age of the patients was 26 years ( range , 7 to 48 ) . minilaparoscopic appendectomy was initially attempted in 37 patients ; however , it was only completed in 31 ( 84% ) . in 2 patients ( 5.3% ) , the procedure was completed with the conventional laparoscopic approach , because both patients had a perforated appendix . both patients were operated on with larger trocars and instruments because this made it safer to manipulate and resect the appendix and to wash the abdominal cavity . in 1 patient ( 2.7% ) , the procedure was converted to an open approach through a midline incision due to diffuse fecal peritonitis as a consequence of a ruptured appendix . in 3 patients ( 8% ) , an appendectomy was not performed because of pathology confined to the ovary . one wound infection occurred at the umbilical trocar site , which was treated conservatively . during the extraction of the specimen through the 2.2-mm umbilical trocar , the specimen bag ruptured and the inflamed appendix contaminated the abdominal wall . of the 31 patients , four patients ( 13% ) had a normal appendix , 26 patients ( 84% ) had acute appendicitis , and 1 patient ( 3% ) had a perforated appendix . the average operating time was 34 minutes ( range , 15 to 80 ) , and the median length of stay was 1.2 days ( range , 1 to 5 ) . postoperative pain management consisted of 2 doses of 10 mg of ketorolac tromethamine given intravenously . in all patients , wounds resulting from trocar placement healed well . previous studies have confirmed the superiority of laparoscopic appendectomy in the treatment of acute appendicitis . it is associated with decreased postoperative pain , a shorter length of hospitalization , a faster return to normal activity , an early resumption of dietary intake , and fast resolution of postoperative ileus . however , this technique has not yet gained widespread acceptance because of its longer operative time and higher cost compared with the open approach . in a prospective , randomized study of 50 patients , minn et al showed that the laparoscopic approach did not offer any improved benefits compared with the open approach for the routine patient with acute appendicitis . nevertheless , we believe that the laparoscopic approach allows good exploration of the abdominal cavity and may be helpful in ruling out different pathological states . in our experience , minilaparoscopic exploration of the abdominal cavity diagnosed pathology of the ovary in 8% of patients . it has been shown that 80% of women who underwent an open appendectomy , compared with 10% of women treated with laparoscopic appendectomy , may develop adhesions that in fact may be responsible for the infertility or chronic abdominal pain , or both . based on our experience , the procedure was completed with the conventional laparoscopic approach in 2 patients ( 5.3% ) because of a perforated appendix . we have learned that it was safer to insert bigger trocars and instruments to manipulate and resect the appendix , and also wash the abdominal cavity . we believe that converting to conventional laparoscopy was not a technical regression because the outcome did not differ from the outcome in those who underwent the minilaparoscopic appendectomy . it is generally true that the cost of laparoscopic appendectomy is higher than that of open appendectomy . although shorter hospitalization , less pain medications , and better patient compliance are well - established benefits associated with laparoscopic treatment , the financial burden associated with it in the long - term is also well established . sterile use of finger cut gloves instead of sterile specimen containers and use of nondisposable trocars and instruments may contribute greatly to the reduction in cost . it can be used multiple times ; it is versatile and can be used for other minimally invasive procedures , thus lowering its overall cost . the benefits of the laparoscopic approach in terms of better diagnostic accuracy and safety , especially for women of childbearing age , outweighs the disadvantage of a longer average operative time of about 17 minutes . in terms of advantages associated with the use of the minilaparoscopic approach , a reduction in abdominal wall trauma and a decrease in the number of complications , such as infection of the trocar site and abdominal wall hernia have been reported elsewhere . moreover , the smaller dimension of the trocars accounts for approximately a 70% reduction in postoperative pain , compared with that for the conventional laparoscopic approach . one patient , however , developed a wound infection at the umbilical trocar site that resulted from direct contact of the inflamed appendix with the abdominal wall after rupture of the finger bag . to avoid such a complication in the future , we modified the technique by extracting the bag though the 5-mm suprapubic incision , and since then no similar complications have occurred . the wounds from trocar placement healed well , and the general condition of all patients was excellent at 6-month follow - up . this study shows that the minilaparoscopic approach has the same advantages as the conventional approach in terms of better diagnostic accuracy and safety , especially for women of childbearing age . in recent years , drug - eluting stents ( des ) have been demonstrated to dramatically reduce the rate of restenosis and the need for repeat revascularization.1 - 3 ) despite these promising results , stent thrombosis seems to occur more frequently with des and often seems to be associated with clopidogrel resistance.4 ) we report a case of recurrent stent thrombosis associated with clopidogrel resistance in a patient with acute myocardial infarction . a 63-year - old female was transferred to the emergency department complaining of squeezing chest pain that had increased over the past twelve hours . she underwent emergent coronary angiography ( cag ) , which revealed critical stenosis in the proximal and middle left anterior descending coronary artery ( lad ) . she was successfully treated with two paclitaxeleluting stents ( 3.012 mm and 2.528 mm taxus stents , boston scientific , reading , pa , usa ) in the proximal and middle lad ( fig . she was treated with triple antiplatelet therapy ( aspirin 100 mg , clopidogrel 75 mg , and cilostazol 200 mg daily ) because she was found to be hyporesponsive to clopidogrel when tested for adenosine diphosphase ( adp)-induced platelet aggregation utilizing the verifynow p2y12 point - of - care assay ( 181/0 p2y12 reaction unit/% ) . three days after discharge , she again developed chest pain and presented to the emergency department with mental confusion associated with acute pulmonary edema . kinase - mb 34.0 u / l , troponin - i 67.01 ng / ml , troponin - t 5.5 ng / ml ) . emergency cag , after intubation due to hypoxemia , showed total occlusion of the mid - lad due to stent thrombosis ( fig . 4 ) . after intravenous administration of a glycoprotein iib / iiia receptor blocker ( reopro ) , balloon angioplasty was carried out multiple times using a 3.0 mm balloon at 10 - 12 atm because of recurrent , immediate thrombus formation and coronary occlusion . the next day , however , she complained of severe chest pain again , and the ecg showed marked st - segment elevation in v1-v6 , i , and avl ; and new - onset complete right bundle branch block with left anterior fascicular block ( fig . she was successfully treated with balloon angioplasty and a final angiogram revealed improved flow over stented lad without intraluminal filling defect . despite the cilostazol medication , adp - induced platelet aggregation showed that she was still hyporesponsive to clopidogrel ( 171/0 p2y12 reaction unit/% ) . she was discharged after uneventful recovery with triple anti - platelet therapy using an increased dose of aspirin ( aspirin 200 mg , clopidogrel 75 mg , cilostazol 200 mg daily ) . we report this case to draw more attention to stent thrombosis associated with clopidogrel resistance after des implantation . this case shows that a des patient with clopidogrel resistance can be vulnerable to stent thrombosis even if treated with triple anti - platelet therapy , which in recent studies has been shown to be more effective in preventing stent thrombosis than conventional dual anti - platelet therapy . stent thrombosis is an uncommon but serious complication of coronary artery stents that often presents as myocardial infarction ( mi ) or death . over several trials , the incidence of stent thrombosis was 0.58 - 1.3% in des.5)6 ) several factors have been associated with stent thrombosis , including older age , black race , diabetes mellitus , bifurcation lesion , in - stent restenosis lesion , procedure - related factors such as stent malposition , greater stent length , postprocedure acute renal failure , non - compliance to anti - platelet agent and anti - platelet resistance.7 - 9 ) anti - platelet resistance as an independent predictor of stent thrombosis , even several years after implantation of des , increases the risk of stent thrombosis . in this patient , stent thrombosis may have been caused by several risk factors , especially anti - platelet resistance . several therapeutic approaches ( the addition of cilostazol or a glycoprotein iib / iiia inhibitor , increased dosage of clopidogrel and aspirin ) might be taken for a patient with anti - platelet resistance . in our patient , although cilostazol ( 200 mg daily ) was added to conventional dual anti - platelet therapy , recurrent stent thrombosis occurred . subsequently , the daily dose of aspirin was increased from 100 mg to 200 mg . in the des era , stent thrombosis is a fatal complication and anti - platelet therapy has been shown to be very important in preventing stent thrombosis . thus , assessment of the patient 's responsiveness to anti - platelet agents may be a crucial factor in monitoring these drugs ' therapeutic efficacy and improving clinical outcomes after implantation of des . recent studies have shown that adequate anti - platelet effects are not achieved in 5% to 45% of the patients taking aspirin and in 4% to 30% of patients taking clopidogrel10)11 ) and therefore suggest that many patients are resistant or only partially responsive to the anti - platelet agents . currently , however , routine screening for anti - platelet resistance remains a persistent , unresolved issue and further evidence is necessary before it will be possible to recommend this testing as part of standard assessment of pci candidates . in addition , further prospective studies are needed to set guidelines for optimal treatment of patients with antiplatelet resistance who are at increased risk of stent thrombosis , a catastrophic complication of des implantation .

background : minilaparoscopic appendectomy for appendicitis is not a well - established procedure . this approach provides less abdominal wall trauma , fewer complications , and excellent cosmetic results . our aim was to show the feasibility and safety of the minilaparoscopic approach.methods:minilaparoscopic appendectomy was performed in 37 patients . two 2.2-mm trocars were used to manipulate a 2.2-mm , 0-degree laparoscope and for grasper access . a 5-mm trocar was used for the ultrasonic scalpel.results:no deaths occurred . in 3 patients ( 8% ) , appendectomy was aborted due to pathology of the ovary . conversion to the open approach occurred in 2.7% of patients . the average operating time was 34 minutes ( range , 15 to 80 ) , and the median length of hospital stay was 1.2 day ( range , 1 to 5).conclusions : the minilaparoscopic approach a ) has the same advantages as the conventional laparoscopic approach in terms of better diagnostic accuracy and safety ; b ) a low incidence of complications ; and c ) yields excellent cosmetic results .

please summarize the articles given below

thrombocytosis is commonly seen in clinical practice and often the cases reported are incidental . the differential diagnosis for thrombocytosis is broad and the diagnostic process can be challenging . in general , causes of thrombocytosis can be described as spurious , reactive , or clonal in nature . a number of population studies have examined the degree of thrombocytosis as well as the frequency of various etiologies of thrombocytosis when it occurs . reactive causes are by far the most common etiology of thrombocytosis in these population studies , comprising 8897% of cases in adults in two large case series and 100% of pediatric cases in a single case series . extreme thrombocytosis , defined as a platelet count > 1,000 10/l is quite rare , as only 25.8% of patients demonstrate this degree of thrombocytosis upon presentation . although often thought to be more common in clonal processes , extreme thrombocytosis can also be due to reactive causes , with 82% of cases of extreme thrombocytosis in one series being reactive in nature . a 26-year - old male patient was scheduled for surgery of right indirect inguinal hernia with right sided encysted hydrocele of the cord . the preoperative laboratory tests reported normal coagulation and biochemical parameters , haemoglobin values of 15.1 g% , no leukocytosis and a platelet count of 2.60 lakhs / cumm . patient was operated , right sided mesh hernioplasty with excision of hydrocele of the cord was done . there were no adverse incidents during surgery , the patient was smoothly extubated in the surgery room and transferred to the post anaesthesia care unit . a routine postoperative analytical blood control was performed , showing high platelets count ( 1,100,000/cumm ) , hemoglobin 11.6 mg / dl and leukocytes 18,400/cumm , with normal values of coagulation and biochemistry tests . another blood analysis was extracted to verify these data , which again returned a high platelet count ( 1,300,000/cumm ) . we suggested monitoring platelet count throughout the postoperative period by serial analytical , with introduction of thromboembolic prophylaxis and control of bleeding in the face of the probability of some degree of platelet dysfunction . the immediate period after surgery was uneventful and the patient was discharged to the ward with hemodynamic stability . later , on the next postoperative day , patient developed huge scrotal haematoma with ecchymosis around the incision line . scrotal haematoma was explored , clots were drained , but no obvious bleeder could be identified . postoperative antithrombotic prophylaxis and bleeding monitoring were maintained until the patient was discharged after 2 weeks of admission , to follow up with outpatient treatment . analytical blood controls showed that the platelet count was down to normal in 20 days . thrombocytosis is an incidental finding in 3550% of cases and determination of the cause creates a diagnostic challenge . the causes of thrombocytosis can be described as spurious , reactive , or clonal in nature as shown in table 1 . causes of thrombocytosis the reactive thrombocytosis , also called secondary thrombocytosis is the most common type and appears after acute inflammatory , infectious , neoplastic and stress processes . in these scenarios the levels of thrombopoietin , interleukin-6 and catecholamines are very high , and are thought to be responsible for the increased number of platelets . it is always necessary to distinguish between clonal ( also known as primary or essential thrombocytosis ) and reactive ( or secondary ) thrombocytosis , because their treatment and prognosis differ . distinguishing clinical features for primary and secondary thrombocytosis although the diagnostic tests to differentiate essential and reactive thrombocytosis are not easy to perform , laboratory tests that show increased acute phase reactants such as c - reactive protein , fibrinogen , erythrocyte sedimentation rate and interleukin-6 may be useful in the diagnosis of reactive thrombocytosis . it is accepted that upto 1,000,000 l platelets level are a benign condition , although it remains unclear if these findings are associated with an increased postoperative thromboembolic or haemorrhagic risk . prophylactic treatment with platelet inhibitors in these situations is controversial , although some authors do consider management of low - dose acetylsalicylic acid appropriate . reactive thrombocytosis is generally felt thought to be a self - limited process which resolves with resolution of the underlying disorder when possible . the risk of thrombotic complications with reactive thrombocytosis is felt to be low , as 1.6% of patients with reactive thrombocytosis had thrombotic complications in one large case series . all of these thrombotic events were venous in location and occurred in patients with other risk factors ( postoperative setting or underlying malignancy ) . even in cases of extreme reactive thrombocytosis the appearance of thrombocytosis after surgery needs to be diagnosed to establish the type of thrombocytosis ( clonal or reactive ) , as treatment and prognosis are quite different between them . and at all times , the surgeon must remain vigilant due to the possible risk of bleeding or thromboembolic complications . the work described in this paper was supported jointly by department of pathology and department of surgery , himsr , new delhi . the authors would like to thank hamdard institute of medical sciences for the administrative support . the authors also thank the editor and the reviewers for their valuable comments and suggestions that have led to the substantial improvement of the paper . the work described in this paper was supported jointly by department of pathology and department of surgery , himsr , new delhi . the authors would like to thank hamdard institute of medical sciences for the administrative support . the authors also thank the editor and the reviewers for their valuable comments and suggestions that have led to the substantial improvement of the paper . mucormycosis , also known as zygomycosis , is an opportunistic and lethal mycological infection caused by a fungus of the order mucorales . it is mostly observed in immunocompromised patients such as those with hematological malignancy or those who have solid organ transplantation ( sot ) or bone marrow transplants . the infection usually starts in the middle nasal meatus and spreads to the paranasal sinuses , the orbit and the intracranial structures by direct extension or through blood vessels . early diagnosis , initiating prompt surgical and medical therapy and correcting the underlying conditions play a vital role in eliminating this infection , but mortality remains high . mucormycosis is uncommon in sot recipients and most cases have been reported after liver or renal transplantation . a 52-year - old male patient was transferred to our department from another center for retroorbital pain , headache and decreased vision accuracy in the left eye for the past 36 h. five months earlier , he had undergone orthotopic heart transplantation under the bicaval technique due to ischemic heart failure . his medical history was significant for type ii diabetes mellitus , poorly controlled by insulin . he also had hypertension and dyslipidemia ( both under treatment ) and nondialysis - dependent chronic kidney disease . his baseline immunosuppressive regimen consisted of prednisone , tacrolimus and mycophenolic acid and he was also taking prophylactic antibiotics : cotrimoxazole , valganciclovir and isoniazid with pyridoxine . physical examination on admission showed that the patient was alert , orientated , afebrile and his vital signs were stable . anterior rhinoscopy , endoscopy with 0 rigid endoscope and examination of the oral cavity were unremarkable . although the nasal exploration was normal , in view of the symptoms and the previous transplant , two samples endoscopically directed , one of the nasal fossa by swabbing and the second of the middle meatus were collected . blood tests showed glucose levels of 248 mg / dl ( 13.8 mmol / l ) and creatinine of 3.63 mg / dl . computed tomography ( ct ) scan revealed soft tissue opacification of left anterior ethmoid sinus and inflammatory changes in the apex of the left orbit [ figure 1a ] . ( a ) computed tomography scan showed soft tissue opacification of left ethmoid sinus ( white arrows ) and inflammatory changes in the apex of the left orbit ( black arrows ) . ( b ) fundus of the left eye with edema and papillary pallor ( * ) , posterior pole retinal edema ( white arrows ) and arteriolar sclerosis ( black arrows ) . ( c ) left nasal endoscopy with 0 rigid endoscope , showing black necrotic eschar ( white arrows ) through the left middle meatus and the middle turbinate ( black arrows ) . nasal septum ( * ) , ( d ) lactophenol cotton blue culture showing rhizopus fungus . sporangiophore ( black arrow ) ( lactophenol cotton blue stain , x1000 ) the metabolic derangement was treated , intravenous antibiotics ( piperacillin / tazobactam 2000/250 mg 8 hourly ) was started and insulin was administered on a sliding scale . on the second day of hospitalization , the patient 's clinical status worsened dramatically . left eye movements were limited in all directions ( frozen eye ) and the left pupil was mydriatic . signs of central retinal artery occlusion were found on the left fundoscopy : edema and papillary pallor , posterior pole retinal edema and arteriolar sclerosis [ figure 1b ] . a second nasal 0 rigid endoscope showed necrotic tissue in the left middle meatus and the middle turbinate [ figure 1c ] . the lactophenol cotton blue preparation revealed a sporangium located on the columella at the apical end of the sporangiophore [ figure 1d ] . following the confirmation of rm , intravenous liposomal amphotericin b the magnetic resonance imaging showed that infection had progressed in the apex of the left orbit , involving the cavernous sinus . we proposed extensive surgical treatment via left paralateral rhinotomy with orbital exenteration and total ethmoidectomy . its incidence has increased over the last 20 years due to increasing use of immunosuppressive drugs . it appears most frequently in the first 6 months after transplantation due to the higher immunosuppression . the incidence ranges from 0.4% to 16% depending on the sot type and is 0%0.6% in heart transplant recipients . other significant predisposing conditions to mucormycosis in sot recipients are poorly controlled diabetes mellitus and renal failure . the fungus spreads quickly in a medium of elevated glucose and acid ph and it is unusual in patients with metabolically controlled diabetes . the main protection against hyphae is neutrophils , but low serum ph decreases their pathogenic and chemotactic capacity . our patient had three predisposing conditions : immunosuppression for sot , poorly controlled diabetes mellitus and renal failure . three main ways of transmission of mucormycosis in transplant recipients have been reported : inhalation in approximately 70% , ingestion in 2% and percutaneous introduction in 13% . it then extends to the orbit and periorbital area where it can produce the orbital apex syndrome with ophthalmoplegia , ptosis , mydriasis and decreased visual accuracy . finally , it disseminates to the cavernous sinus and then to the meninges and brain . clinical presentation of the disease usually involves symptoms of sinusitis and periorbital cellulitis with facial pain and decreased vision . a nasal endoscopy and a biopsy or a culture of the infected area are essential for the definitive diagnosis . a culture gives us more information about the species of mucorales , but it has a higher rate of false negatives than the biopsy . yohai et al . reported nasal ulceration or necrosis in 48% and 78% respectively in rm . in our case , the initial nasal endoscopy was unremarkable , but we performed a middle meatus culture in view of the high suspicion of rm and the culture revealed a fungus of the order mucorales . the contrast - enhanced sinus ct is helpful to delimit the extension of rm and reveal signs of invasion . magnetic resonance is more sensitive than ct to evaluate intradural and intracranial involvement , the cavernous sinus thrombosis and thrombosis of the cavernous portions of the internal carotid artery . radical resection removing all necrotic tissue should be done and various debridements are usually required . lateral rhinotomy , orbital exenteration and occasionally intracranial surgery are performed depending on the extension of rm . orbital exenteration is necessary when the orbit is infected with limited eye movements in all directions ( frozen eye ) and loss of vision . the surgery that we proposed to our patient was a left paralateral rhinotomy with orbital exenteration and total ethmoidectomy removing all the unviable tissue . amphotericin b is the drug of selection , but it is limited because of its renal and systemic toxic effect . this lipid formulation improves circulation time and concentration in the infected area of the associated amphotericin b. the duration of the treatment is not explicitly established . survival rates in diabetic patients with rm are higher than those in patients with other predisposing factors such as renal failure , hematologic malignancies or autoimmune diseases . a delay in diagnosis and treatment , brain involvement , hemiparesis , bilateral sinus involvement and facial necrosis is also associated with poor survival . rm is a rare and aggressive fungal infection in heart transplant recipients and carries a high mortality rate .

thrombocytosis is often an incidental finding seen in 3550% of cases and the cause determination creates a diagnostic challenge . extreme thrombocytosis is rare and seen in 25.8% patients only . among the various causes of increased platelet count , surgical procedures have attracted much attention in both experimental and clinical domain . the appearance of thrombocytosis after surgery needs to be diagnosed to establish the type of thrombocytosis ( clonal or reactive ) , as treatment and prognosis are quite different between them . this case report is vital because of two reasons : first , the increase in platelet count is difficult to rationalize than many of the other thrombocytoses , such as those related to primary augmentation of the function of the bone marrow ; second , the association of platelets with the clotting process has led to the belief that their increase after a surgical procedure is connected with the occurrence of postoperative thrombosis . this case presents an interesting finding from a patient who has undergone major abdominal surgery and has shown an unexpected perpetual increase in platelet count .

please summarize the articles given below

vitamin a deficiency is the leading cause of preventable childhood blindness in the developing world . although rare in the united states , vitamin a deficiency has been known to occur as a result of poor dietary intake , liver diseases , and gastrointestinal malabsorption [ 2 , 3 , 4 , 5 ] . vitamin a is a fat - soluble vitamin ingested in the diet in two forms : as retinol itself from animal sources , such as milk , meat , fish , liver , and eggs , or as the provitamin carotene from plant sources , such as green leafy vegetables , yellow fruits , and red palm oil . on the ocular surface , vitamin a deficiency has a wide range of ocular manifestations including conjunctival and corneal xerosis , keratomalacia , retinopathy , visual loss , and nyctalopia , also called night blindness , which is the earliest and most common symptom . we report a case of bilateral sequential corneal ulceration in a patient with severe vitamin a deficiency in the context of eosinophilic gastroenteropathy . a 29-year - old man was referred to our cornea unit with a left corneal ulcer of 6 weeks ' duration . he was previously diagnosed with eosinophilic gastroenteropathy ( biopsy proven ) , skin atopy and atopic keratoconjunctivitis . he had been treated with peroral steroids 15 mg / day and methotrexate 6 mg / week since the age of 11 years for his gastroenteropathy . he had surgery for steroid - induced cataracts with toric intraocular lens implantation at the age of 27 years . in addition , he had a number of food intolerances and subsisted mostly on a diet of potatoes . prior to his presentation , he had noted irritation , itchiness , and a decrease in vision in his left eye for 6 weeks and was treated with topical anti - allergic and topical steroid drops ; however , no improvement could be observed . polymerase chain reaction testing for herpes simplex virus was negative , and the cultures did not show any growth . acuity without correction was 20/80 od , improved by pinhole to 20/50 , and 20/150 os with a manifest refraction of 0.25/-2.5/5 , not improved by pinhole . the intraocular pressure was 19 mm hg od and 21 mm hg os by tonopen . slit - lamp examination showed temporal wrinkling of the conjunctiva in both eyes , with a dry granular pattern and loss of transparency ( fig . the left temporal cornea showed an epithelial defect overlying a partial - thickness ulcer with approximately 50% thinning and adjacent limbitis . in both eyes , the anterior chambers were quiet and there were well - centered posterior chamber iols . our patient was initially diagnosed with peripheral ulcerative keratitis in the left eye in the presence of atopic keratoconjunctivitis . his steroids were increased to 50 mg / day and tapered every 3 days by 10 mg / day . he was put on preservative - free artificial tears . a vasculitic workup ( c - reactive protein , erythrocyte sedimentation rate , antinuclear antibody , antineutrophil cytoplasmic antibody , rheumatoid factor , syphilis serology ) was unremarkable . serum was sent for analysis of vitamin a and retinol - binding protein ( rbp ) levels , with a processing time of several weeks at our location . the ulcer in the left eye epithelialized over the following 2 weeks and subsequently vascularized from the temporal conjunctiva . two weeks later , the patient presented to our clinic again with significant right eye pain . he had a corneal ulcer in his right eye , complicated by a small corneal perforation , with the iris plugging the wound ( fig . serendipitously , at that time , the results of his serum vitamin a levels were available , revealing that the levels were significantly decreased to 0.2 mol / l ( normal range 0.9 - 2.5 ) . the rbp level was also reduced to 12 mg / l ( normal 30 - 92 ) . the patient was treated with iv multivitamin ( containing 10,000 iu vitamin a , c , d , e and b complex ) for 5 consecutive days while in hospital , and then with oral vitamin a 200,000 iu once a week for 2 weeks . 2b ) and the corneal keratinization in both eyes resolved over the following 6 weeks ( fig . we present a rare case of vitamin a deficiency secondary to a malnutrition syndrome leading to bilateral xerosis and sequential corneal ulceration . similar reports from developed populations are rare , but have been described in association with disorders such as chronic alcoholism , cystic fibrosis , and anorexia nervosa . the initial treatment with an increase of systemic steroids improved the ulceration and seemed to suggest an immunogenic process . however , the involvement of the second eye while on steroid treatment forced consideration of other causes . clinical suspicion of xerophthalmia at the time of presentation prompted testing for vitamin a and serum rbp . it was unfortunate in our case that the progression of the disease occurred in the time taken for results to be reported . the earliest ocular symptom of vitamin a deficiency is nyctalopia , secondary to depletion of photopigments . unfortunately , we were not able to obtain an electroretinogram ( erg ) before the treatment . an abnormal erg at presentation in association with the anterior segment findings would have helped to establish a diagnosis of vitamin a deficiency before serum levels were available . it has been shown that eosinophilic gastroenteropathy can cause malabsorption or protein - losing enteropathy [ 11 , 12 ] , but in our case , a gastroenterology consult confirmed inactive disease and showed no other signs of malabsorption ( normal albumin levels and international normalized ratio ) . the most likely reason was felt to be malnutrition due to lack of vitamin a uptake secondary to the patient 's multiple food intolerances that accompany eosinophilic gastroenteropathy . the long - lasting success of oral vitamin a supplementation further favors previous malnutrition over malabsorption . the oral dosage regimen is 200,000 iu vitamin a in oil , followed the next day with an additional dose of 200,000 iu . if patients have severe corneal disease or malabsorption , the preferred dose is 100,000 iu water - miscible vitamin a administered intramuscularly . it is important to note that if vitamin a deficiency is associated with a protein - energy malnutrition syndrome , protein levels must be corrected at the same time as vitamin supplementation . our case serves as a reminder to corneal specialists in developed populations of the potentially devastating effects of vitamin a deficiency on the eye . vitamin a deficiency should be suspected in any practice in the presence of corneal ulceration in combination with malabsorption and malnutrition syndromes . abdominal pregnancies ( both primary and secondary ) have a reported incidence of 1 in 10,000 . worldwide , the incidence of ectopic pregnancies is increasing , with significant contribution from assisted reproductive technologies ( art ) . however , the incidence of abdominal pregnancies have remained constant or reduced , and maternal mortality reduced from 20% to less than 5% in last 20 years due to early diagnosis and management . early diagnosis has enabled laparoscopic management in many of these cases . in this study , we report a case of primary abdominal pregnancy following intra - uterine insemination ( iui ) managed laparoscopically . y.p , a 31-year - old female , attended our opd on 22 august 2010 , with chief complaints of amenorrhea of 2 months , following an iui cycle . she had primary infertility of 3 years , and was undergoing iui for mild - to - moderate male factor coupled with mild pelvic endometriosis . this was her first iui cycle ( cc1 00 mg d2-d6 , hcg trigger , and dydrogestrone as luteal support ) . the undisturbed ectopic gestation sac seen on the anterior surface of the uterus and anterior leaf of broad ligament the ectopic pregnancy site which started to bleed , on manipulation of the uterus bleeding ectopic sac separating from peritoneal surface protruding gestational sac bleeding from the implantation site after gestational sac was sucked out implantation site after removal of ectopic sac and hemostasis her previous menstrual cycles were regular . on transvaginal sonography , the uterus was bulky , very thick regular echogenic endometrium , and no gestational sac in cavity [ figure 7 ] . both ovaries were normal with a corpus luteum in the left ovary [ figures 8 and 9 ] . there was a 1.6 cm mass with strongly echogenic rim , close to the uterus , in the left side suggestive of an ectopic pregnancy sac . serum b - hcg in the same day was 9470 miu / ml [ figures 10 and 11 ] . uterus with empty endometrial cavity transvaginal scan showing left ovary with a corpus luteum image of the normal right ovary transvaginal sonography showing ectopic gestational sac in the region of the left adnexa transvaginal sonography picture showing both the empty uterus and adjacent ectopic sac laparoscopy was offered to the patient , who however , desperately requested for the conservative approach ( she had undergone diagnostic hystero - laparoscopy 2 months back during her infertility workup , and also did not want to loose a fallopian tube ) . she was given one intramascular injection of methotrexate ( 50 mg ) on 22.08.2010 following routine blood tests . however , follow - up of serial b - hcg on 26.08.2010 showed persisting levels of 9300 miu / ml and transvaginal sonography showed a size of the mass increased to 2 cm . was bulky , deviated to the right side with a few old and new endometriotic deposits on the antero - superior surface . the pregnancy sac was implanted on the peritoneal surface of the broad ligament , between the round ligament and the utero - vesical fold . initial appearance was a mound - like elevation , with yellowish brown margins [ figures 1 and 2 ] . there was significant bleeding from the base [ figure 5 ] , which was controlled with bipolar coagulation and superficial infiltration of pitressin [ figure 6 ] . -hcg fell to 203 iu within 4 days , and subsequently declined to non - pregnant levels . incidence has been reported as approximately 1 in 10,000 live births , and 9.2 per 1000 ectopic pregnancies . most of these are secondary abdominal pregnancies , which means the embryo had primarily implanted in the fallopian tube , extruded , or expelled and then secondarily implanted itself on another intra - abdominal surface . in primary abdominal pregnancy , which is the rarest type of ectopic gestation , the conceptus implants on the peritoneal surface . studdiford 's criteria used to diagnose primary abdominal pregnancy are described as : the presence of normal bilateral tubes and ovaries with no evidence of recent or past pregnancy.no evidence of a uteroperitoneal fistula.the presence of pregnancy related exclusively to the peritoneal surface , early enough to eliminate the possibility of secondary implantation after primary tubal nidation . the presence of normal bilateral tubes and ovaries with no evidence of recent or past pregnancy . the presence of pregnancy related exclusively to the peritoneal surface , early enough to eliminate the possibility of secondary implantation after primary tubal nidation . alternatively , a classification relevant from diagnosis and treatment defines early peritoneal pregnancy ( 20 weeks of gestation ) or advanced ( 20 weeks of gestation ) . primary abdominal pregnancies have been reported from omentum , sigmoid colon , posterior peritoneum of pelvis , spleen , liver , diaphragm , obturator foramen , posterior surface of uterus , retroperitoneum , and pancreas.[721 ] primary peritoneal pregnancy has been reported in relation to foci of endometriosis . rare and new varieties of ectopics such as heterotopic pregnancies , cervical , cesarean scar pregnancies have surfaced . however , the incidence of abdominal pregnancies has not changed , may be reduced due to early diagnosis . presentation of patents with primary abdominal pregnancy varies greatly , however , with early diagnosis like our case , patients may be totally asymptomatic . in earlier literature abdominal pregnancies were typically diagnosed late . now with serial b - hcg , excellent ultrasonography , and mri facilities , these pregnancies are diagnosed much earlier . our case is unique in some aspects . to our knowledge , this is the only case reported of primary peritoneal pregnancy in the anterior peritoneal leaf of the broad ligament following intrauterine insemination . the presence of uterine surface endometriosis was documented by a routine diagnosis laparoscopy only 2 months earlier . prognosis for future fertility also appears good following early diagnosis , as the tubes , ovaries are not directly involved in pregnancy , nor removed during the operative procedure and are not involved in postoperative adhesion formation .

purpose : vitamin a deficiency is a very rare condition in the developed world and can lead to a variety of ocular changes from xerosis and xerophthalmia to corneal ulcer and perforation . the treatment of this devastating disease is simple and inexpensive . it is therefore important to recognize and treat accordingly , especially in the event of ulcers unresponsive to treatment or in the presence of severe malnutrition / malabsorption syndromes . the purpose of this case report is to remind physicians of the potentially devastating effects of vitamin a deficiency on the eyes and to demonstrate outcomes after vitamin a treatment . methods : single observational case report . results : a 29-year - old male with known eosinophilic gastroenteropathy was treated with oral steroids for peripheral ulcerative keratitis . two weeks after resolution , the patient suffered from peripheral ulcerative keratitis in his other eye , with a self - sealing perforation . vitamin a deficiency was confirmed and successfully treated , leading to subsequent resolution of signs and symptoms . conclusions : vitamin a deficiency can be present in patients with malabsorption and malnutrition syndromes and should be considered as cause of corneal ulceration .

please summarize the articles given below

a case report of a 56-year - old male farmer who sought medical attention after a month - long evolution of irritative symptoms in his right eye , accompanied by visual acuity ( va ) impairment . the patient received topical and oral broad - spectrum antibiotic treatment with no improvement before being referred to a cornea specialist , where he was found to have va of 20/150 and was noted on biomicroscopy to have endothelial feathery coalescent lesions . the patient was admitted to the hospital for an aqueous humor sample and intravenous voriconazole . however , clinical evidence of improvement was confirmed after 5 days of antimycotic intravenous therapy . complete clinical resolution was achieved at 1 month after treatment completion with oral voriconazole , as evidenced by va of 20/20 and disappearance of endothelial lesions . endothelial involvement by fungi is a rare condition . in this case , no microbes were isolated , but the characteristic morphology of the lesions , the history of onychomycosis , and the spectacular response to voriconazole turn this case into a valid presumptive diagnosis . the cornea is the ocular structure most commonly affected by fungi . most often , the source of infection is exogenous , such as vegetal trauma , among others . in addition , it is associated with any disease affecting the eye s normal surface , such as persistent epithelial defects , neurotrophic ulcers , use of contact lenses , and secondary attenuation of cell defense mechanisms after topical steroids.15 infectious endothelial involvement of the cornea has been mainly attributed to different viral species.6 however , herein we present the case of a patient with a clear endothelial infectious involvement that successfully responded to systemic antifungal therapy with voriconazole . a 56-year - old male banana grower sought medical attention after a month - long evolution of irritative symptoms in his right eye accompanied by visual acuity ( va ) impairment . his medical history confirmed excision of bilateral pterygium 15 years earlier , but no recent ocular trauma was related by the patient . the general medical practitioner ( nonophthalologist ) initiated treatment with topical prednisolone acetate 1% and gentamicin sulfate 0.3% every 6 hours for 1 week for a presumed bacterial conjunctivitis , but the patient was referred to the ophthalmologist after lack of success with this therapy . an initial diagnosis of infectious keratitis ( with unaffected epithelium but endothelial involvement ) was made , and treatment with topical moxifloxacin chlorhydrate 0.5% four times per day and gentamicin sulfate 0.3% three times per day plus oral ciprofoxacin 750 mg every 12 hours was prescribed . after 6 days on this therapeutic regimen and with lack of clinical improvement , the patient was referred to a cornea specialist . he was found with right eye va of 20/150 and normal va in his left eye . the biomicroscopy performed on the affected eye confirmed the integrity of the epithelium with an unruptured bulla over the pupillary area , presence of folds on descemet s membrane , anterior chamber cells 2+(standardization of uveitis nomenclature working group),7 and multiple coalescent circular lesions of feathery and whitish appearance on the endothelium ( figure 1a ) . fundoscopic examination with an indirect ophthalmoscope under midriasis was normal . based on these findings , therefore , the patient was admitted to hospital to further explore the etiology of the lesion . for this , an aqueous humor sample was examined for fungi detection by culture and polymerase chain reaction ( pcr ) , and systemic antimycotic therapy was initiated immediately after sample taking . by recommendation of the infectologist , the patient was empirically treated with voriconazole 200 mg intravenously ( iv ) every 12 hours ( diluted in 250 ml of 0.9% saline solution administrated over 2 hours ) and topical gatifloxacin 0.3% every 6 hours for 1 week ( as post puncture antibacterial prophylaxis ) . after 3 days on iv therapy with voriconazole , the patient showed significant clinical improvement , evidenced by an important decline in the number of cells within the anterior chamber and some reduction on the feathery endothelial lesions described previously . aqueous humor microbiologic study was negative ( gram , potassium hydroxide staining , aerobic , anaerobic , and fungal cultures ) . pcr , venereal disease research laboratory , herpes simplex , and hiv testing were also negative . after 5 days on this regimen , the patient was discharged with voriconazole 200 mg orally every 12 hours . after a week , the patient was found to have va of 20/30 , considerable improvement of endothelial lesions , and faint residual corneal edema . the same treatment regimen was administered for a further week , and fluorometholone 0.1% every 12 hours was added to therapy for edema . examination 2 weeks after discharge confirmed further edema reduction and almost complete resolution of endothelial lesions . after 4 weeks of antifungal treatment ( 3 weeks of those were as an outpatient ) , the patient showed full edema resolution , the presence of a few small endothelial scars , and 20/20 va ( figure 1c ) . fluorometholone was then withheld and oral voriconazole was continued until completion of 2 months with antifungal therapy . infectious endothelial involvement of the cornea has been mainly attributed to different viral species.6 however , we report an interesting case of a patient whose endothelial lesions suggest mycotic etiology that successfully responded to systemic antifungal therapy with voriconazole . usual manifestations of fungal keratitis include epithelial and stromal ulceration , abscessing with stromal necrosis , epithelial or stromal edema and , rarely , cell reaction in the anterior chamber , hypopyon , and fibrin deposits within the anterior chamber and endothelial plates.1,5 nevertheless , the most striking finding in this case was the confinement of damage to endothelial plates with subsequent central corneal edema , bulla formation , folds on descemet s membrane , and cell reaction in the anterior chamber . therefore , we propose an endogenous source of infection , and postulate the presence of recurrent onychomycosis as a risk factor in the absence of prior trauma or epithelial disruption . however , microbiological isolates turned out to be negative both in blood and in aqueous humor . a characteristic clinical sign of fungal keratitis is the irregular nature of infiltrates , traditionally described as feathery or cotton wool.1,4,8 this feature prompted the suspicion of fungal origin in our patient , as this pattern was observed on the endothelium . although gram and potassium hydroxide staining , as well as pcr , were negative , our diagnosis was established on clinical grounds and confirmed by the success of empirical therapy with voriconazole . it is important to point out that laboratory diagnosis in this case has been limited by the low volume of sample taken , which was destined for multiple studies ( stains , cultures , pcr ) . in addition , experience with these tests and available primers in our country are also limited . some authors have reported on the good efficacy of intracameral injection with amphotericin b and voriconazole in cases of endophthalmitis secondary to keratitis.911 although this is an adequate therapeutic alternative , it was not required , as the patient showed an excellent response to systemic therapy with oral voriconazole . an interesting case of a presumed endogenous mycotic endotheliitis is herein reported in a patient with a history of recurrent onychomycosis who develops endothelial lesions of mycotic morphology . the patient responds to a systemic iv and oral scheme with voriconazole , and thus an endogenous and mycotic etiology is presumed . however , this could not be confirmed by microbiological studies , due to the limitations that we have cited . 1 . he had a history of bilateral brow suspension surgery 10 years ago at another institution . the patient had a 30 cm 20 cm pelvic mass located in the presacral area with boundaries between both parailiac regions displacing the rectum and bladder . it was completely excised with a pathology report of myelolipoma . in physical examination , he had hypertrichosis , finger clubbing , and radiologically cortical thickening of the bones fig . the patient presented with bilateral blepharoptosis with coarse skin folds the patient had cortical thickening of the bones and clubbing his best - corrected visual acuity was 7/10 in the right eye ( re ) and 5/10 in the left eye ( le ) . horizontal length of the upper lids of re and le was 46 mm and 41 mm , respectively . vertical fissure heights were 6 mm and 4 mm with margin - reflex distances of 0.5 mm and 0.5 mm , respectively . vertical eyelid contour of the re showed an inverse v shape for the re and a smooth curve for the le . the eyelids were floppy and easily everted . to correct these clinical findings , a surgery which combines vertical tarsal shortening accompanied with horizontal whole eyelid wedge resection and brown suspension 10 mg/0.25 ml triamcinolone acetate was injected into each supratarsal space to decrease the thickness of the tarsus . horizontal wedge resection which is not a part of routine ptosis surgery was performed in this operation with the aim of normalizing the obvious horizontal length of the lids . pathological evaluation revealed epidermal hyperplasia , severe inflammatory changes in subepidermal level , hyperplastic sebaceous glands , and collagen tissue derangement fig . reconstruction of each eyelid was achieved by vertical tarsectomy , horizontal full thickness lid resection , and supratarsal steroid injection . ptosis was assessed with silicone rod frontalis suspension , and resection of excessive skin was performed as in blepharoplasty skin biopsy showing thickening of the dermis with increased collagen content and lymphocytic infiltration ( h and e , 10 ) the postoperative course was uneventful and patient satisfaction is good within the 1 year of follow - up fig . it is characterized by skin thickening , clubbing , hyperhidrosis , and periosteal reaction in the long bones . primary hoa is predominantly a male disease that at least 90% of patients are men . although symptoms may be seen in childhood , it manifests mostly during the fifth decade of life . described the largest number of primary hoa series in the literature that the authors reported that family history was positive in all studied patients . the pathogenesis of hoa is unclear and some studies explained the role of several growth factors in the evolution of the disease . although clinical findings are similar , secondary hoa differs from primary hoa with absence of family history . secondary hoa is an acquired form that is associated with usually lung disease but also heart , liver , and intestines . the presented patient had a huge pelvic mass which was completely excised with a pathology report of myelolipoma . hence , our diagnosis was secondary hoa due to the paraneoplastic manifestations of pelvic malignancy which causes secretion of many growth factors . blepharoptosis may develop secondary to sebaceous gland hyperplasia , thickening of the dermis with increased collagen content , mucin deposition , and lymphocytic infiltration or due to additionally marked scarring . our patient was a 52-years - old man with negative family history which let us exclude the diagnosis of primary hoa . the differential diagnosis includes several diseases as acromegaly , syphilitic periostitis , and thyroid acropachy . acromegaly is characterized by enlargement of facial bones that are not present in our case . serology , radiology , and clinical findings did not support a diagnosis of syphilis or thyroid disease . hoa may develop secondary to pulmonary or congenital cyanotic cardiac diseases those were not present in our patient . the remaining possible etiological factor for secondary hoa in our case was the huge pelvic malignancy which was excised previously . the surgery for these kinds of pathologies may be planned as single or staged procedures . blepharoplasty with excessive skin excision is usually required both for better cosmesis and to reduce the tissue bulk . no complications were encountered during surgery , but bleeding was more than any other lid surgery . the profound inflammatory reaction in the tissue might be the cause of this excessive bleeding . hoa may not be always primary , particularly in patients with negative family history . in cases of findings with abnormal fibroproliferative and inflammatory changes , detailed systemic examination and investigations both using serologic and imaging modalities the authors certify that they have obtained all appropriate patient consent forms . in the form the patient(s ) has / have given his / her / their consent for his / her / their images and other clinical information to be reported in the journal . the patients understand that their names and initials will not be published and due efforts will be made to conceal their identity , but anonymity can not be guaranteed . the authors certify that they have obtained all appropriate patient consent forms . in the form the patient(s ) has / have given his / her / their consent for his / her / their images and other clinical information to be reported in the journal . the patients understand that their names and initials will not be published and due efforts will be made to conceal their identity , but anonymity can not be guaranteed .

purposeto report an interesting case of infectious endotheliitis of presumed mycotic origin.methodsa case report of a 56-year - old male farmer who sought medical attention after a month - long evolution of irritative symptoms in his right eye , accompanied by visual acuity ( va ) impairment . the patient received topical and oral broad - spectrum antibiotic treatment with no improvement before being referred to a cornea specialist , where he was found to have va of 20/150 and was noted on biomicroscopy to have endothelial feathery coalescent lesions . the patient was admitted to the hospital for an aqueous humor sample and intravenous voriconazole.resultsthe microbiological studies did not isolate any micro - organisms . however , clinical evidence of improvement was confirmed after 5 days of antimycotic intravenous therapy . complete clinical resolution was achieved at 1 month after treatment completion with oral voriconazole , as evidenced by va of 20/20 and disappearance of endothelial lesions.conclusionendothelial involvement by fungi is a rare condition . in this case , no microbes were isolated , but the characteristic morphology of the lesions , the history of onychomycosis , and the spectacular response to voriconazole turn this case into a valid presumptive diagnosis .

please summarize the articles given below

a 46-year - old married saudi woman presented at a primary health care center with left upper abdominal pain , with no other associated symptoms . five months later , she presented to the surgery clinic because of increased abdominal pain with no response to medication ; her physical examination showed fullness of the left upper abdomen . her routine laboratory investigation as well as chest and abdominal x - rays were not remarkable . ultrasound of the abdomen showed a solid mass at the left hypochondrium separated from the spleen and just below the left hemidiaphragm . computed tomography ( ct ) scan of the abdomen ( figure 1 ) showed encapsulated hypodense mass at the left upper abdomen which was interposed but clearly separated from left liver lobe , spleen , stomach and left hemidiaphragm . magnetic resonance imaging ( mri ) of the abdomen ( figure 2 ) confirmed the location of the mass and attachment to the inner aspect of the anterior abdominal wall but separated from internal abdominal organs . the mass was isosignal intensity to muscles in t1- weighted images and heterogeneous hyperintense signal in t2 weighted images . in post ( a ) axial non - enhanced ct scan of the abdomen showing a well defined hypodense mass at the left hypchondrium , interposed between left liver lobe , left hemidiaphragm and stomach . ( a ) axial t1w1 : an oval shape mass with signal intensity parallel to the muscle . ( c ) axial post contrast t1w1 showing avid contrast enhancement of the mass . at surgery , a firm , rounded mass apparently encapsulated at the left sub - diaphragmatic area was found attached to the extra - peritoneal fascia of the anterior abdominal wall . histopathology showed a biphasic tumor composed of spindle cell and epithelial cell elements , with mild anaplasia & infrequent mitosis . the final diagnosis was low grade synovial sarcoma involving the fascial aponeurosis of the anterior abdominal wall . synovial sarcoma ( ss ) is an uncommon soft - tissue malignant tumor that is common in the extremities of middle - aged patients , close to large joints particularly the knee in the popliteal fossa.12 despite its name , the lesion does not commonly arise in an intraarticular location but usually near joints . the tumor arises from pleuripotential mesenchyme , in close association with joint capsules , tendon sheaths , bursae and fascial structures . it is generally accepted that synovial sarcoma is derived from primitive mesenchymal cells , not synovial cells.2 synovial sarcoma is the fourth most common type of soft tissue sarcoma following malignant fibrous histiocytoma , liposarcoma and rhabdomyosarcoma . synovial sarcoma accounts for 5 - 10% of all soft tissue sarcomas.3 about 85 - 90% of ss occur in the extremities.4 reported examples arising in the anterior abdominal wall are rare . synovial sarcoma in the abdominal wall tends to occur with a much greater frequency in females in contrast to such tumors in the extremities or the neck which tend to occur with a much greater frequency in males.5 radiological findings of ss are not pathognomonic . however , findings of a soft - tissue mass , particularly if calcified ( 30% ) , near but not in a joint of a young patient , are very suggestive of the diagnosis . cross - sectional imaging features are essential for staging extent of the tumor and the planning of surgical resection.6 the most common ct appearance of ss is that of a heterogeneous soft - tissue mass with attenuation similar to or slightly lower than that of muscle areas of lower attenuation representing necrosis or hemorrhage are also common with heterogeneous contrast enhancement.7 on mri , ss typically appears as a prominently heterogeneous multilobulated soft - tissue mass with signal intensity similar to or slightly higher than that of muscle on t1-weighted mr images . prominent heterogeneity with predominant high signal intensity is also a feature of ss on t2-weighted mr images . the presence of multilobulation and marked heterogeneity are highly suggestive of a diagnosis of ss . ct and mri are useful in defining the extent of the disease and in follow up response to chemotherapy.7 the presence of extensive calcification suggests a more favorable prognosis.8 similar ct and mri appearances are seen in our case . despite its name there are three main histologic subtypes of ss : biphasic , monophasic , and poorly differentiated types . poorly differentiated ss is generally epithelioid in morphology and has high mitotic activity.78 in the present case , histopathology showed a biphasic pattern of ss , the coexistence of spindle cells in a wavy pattern , and the pseudoglandular formation . both biphasic and monophasic synovial sarcomas are usually intermediate grade ( grade 2/3 ) ; however , both types can be high grade ( grade 3/3 ) . poorly differentiated synovial sarcomas are high - grade tumors.7 the specific chromosomal aberration in synovial sarcoma has recently been reported . the hallmarks for synovial sarcoma are the ( x ; 18 ) translocation and syt - ssx gene fusion products . is the molecular diagnosis in synovial sarcoma , as well as immunohistochemical study , especially in cases in which histological diagnosis is difficult.79 surgical excision is the treatment of choice , and the recurrence rate range from 28% to 36% even with adequate surgical and adjunctive therapies.4 however , the multimodality treatment approach has improved the prognosis of synovial sarcomas . tumor invasiveness , histologic grade and tumor size significantly correlate with the survival period , with a more preferable prognosis of synovial sarcomas encountered in childhood . chemotherapy has been used to treat metastatic or residual disease.710 primary synovial sarcoma of the anterior abdominal wall is a rare extra - articular tumor site . in cases of anterior abdominal wall masses , a 15-year - old male , who was diagnosed with prs , was scheduled for repair of a pectus excavatum under general anesthesia . he had a history of tracheostomy at birth , a cleft palate operation at 1 month of age , and tracheostomy closure 1.5 years later . according to the consulting otolaryngologist , there was no pathological condition except sleep apnea . at the physical examination of his airway , the boy had the typical appearance of prs . he also had a mouth opening limitation and the maximum distance between incisors was 2.8 cm . his mallampati class was grade 3 , but he had no limited neck movement . because his parents disagreed with a conscious fiber - optic intubation for fear that their son would have a hard time during the procedure , we planned to induce anesthesia with propofol and succinylcholine and then intubate with the mcgrath mac video laryngoscope and a malleable stylet . we also prepared a laryngeal mask airway ( lma ) in case of difficult mask ventilation , according to the difficult airway guidelines . finally , if all of these methods failed , we planned to wake him because his parents wanted to cancel the surgery if the intubation failed . anesthesia was induced in the operating room with 2 mg / kg propofol and 1 mg / kg succinylcholine after preoxygenation with 100% oxygen . after full muscular relaxation , the mcgrath mac video laryngoscope was inserted into the oropharynx and was placed posterior to the epiglottis because the epiglottis obscured the glottis and provided a half view of the glottis ( cormack - lehane grade 2 ) . however , insertion of the 60 angled malleable styletted ett failed because the tube tip could be seen posterior to the arytenoids despite the external laryngeal maneuver . the tube tip reached the glottis , but there was considerable resistance advancing the ett through the vocal cords even though the stylet was withdrawn . finally , the frova intubating introducer with its tip modified as much as a 60 angle , similar to the mcgrath mac video laryngoscope , was inserted through the vocal cords ( figs . 1 and 2 ) . the frova intubating introducer was used as a railroad for the ett , and there was no difficulty advancing the ett under vision with the video laryngoscope ( fig . correct placement of the ett was further confirmed by auscultation and end - tidal co2 detection . we applied the mcgrath mac video laryngoscope and frova intubating introducer for endotracheal intubation in this case of a difficult airway and showed that the strategy was effective and successful . fiber - optic intubation is currently the gold standard for elective difficult airway management , but alternatives are described in the literature . the intubation techniques described include : airtraq optical laryngoscopy ( prodol meditec sa , vizcaya , spain ) , video laryngoscopy , non - fiber - optic intubation via lma , fiber - optic intubation via lma , and a paraglossal approach with tube advancement over a gum - elastic bougie . we chose a mcgrath mac video laryngoscope and malleable stylet because the mcgrath mac video laryngoscope provides a good view of the glottis , and a malleable stylet helps direct the ett to the glottis . as a precaution for a failed intubation , we also prepared a frova intubating introducer and fiber - optic bronchoscope for combined use , and an lma in case of a difficult mask ventilation according to the difficult airway guidelines . it is important to have backup airway management plans because it takes less than 10 min for patients with a difficult airway to become hypoxic . at our first attempt , insertion of the 60 angled malleable styletted ett failed because the tube tip could be seen posterior to the arytenoids . external laryngeal pressure and withdrawal of the blade to lessen tilting of the laryngeal axis and to reduce the introducing angle may have been helpful . however , these maneuvers did not work in our case . the tube tip reached the glottis , but there was considerable resistance advancing the ett through the vocal cords . this occurs from time to time , as the tube tip may strike the anterior tracheal wall because of the angle of the stylet . in this case , the operator withdraws the stylet approximately 4 cm , withdraws the video laryngoscope by 1 - 2 cm and rotates the ett slightly to facilitate passage into the trachea . we withdrew the stylet and rotated the ett to pass it into the trachea but failed . finally , the frova intubating introducer with its tip modified as much as a 60 angle like the mcgrath mac video laryngoscope was attempted , and it was inserted through the vocal cords with no difficulty . this was a remarkable result because the tip of the 60 angled malleable styletted ett , which had the same curvature as the frova intubating introducer , could be seen posterior to the arytenoids even though the external laryngeal maneuver was applied . unlike the macintosh laryngoscope , video laryngoscopes require a tilting force rather than a lifting force , and this force makes mouth opening too small to handle the ett . because the frova intubating introducer has a smaller outer diameter than that of an ett ( 4.6 mm for the frova intubating introducer vs. 8.9 mm for a # 6.5 ett ) , it is easy to handle in a narrow space , as shown in this case . thus , the frova intubating introducer with its tip modified as much as 60 reached the glottis , whereas the same 60 angled malleable styletted ett could not . although the frova intubating introducer was designed for use with a macintosh laryngoscope in the line of sight , and its tip should not be modified during macintosh laryngoscopy , modifying its tip and combined use with a video laryngoscope provides some advantages . first , the frova intubating introducer allows for easy handling in the narrow space under a video laryngoscope . second , it creates less trauma than a styletted ett . less resistance advancing the 60 angled frova intubating introducer through the vocal cords than that of a 90 angled malleable finally , preparing the frova intubating introducer is less time consuming than a fiber - optic bronchoscope , so it can be used for an unanticipated difficult intubation . the use of a video laryngoscope combined with a fiber - optic bronchoscope has been reported previously . fiber - optic bronchoscopy is a method of inserting an ett with a video laryngoscope . however , this technique has some disadvantages ; it needs more than two experienced anesthesiologists and one anesthesiologist should be familiar with the fiber - optic bronchoscope . in addition , the maintenance and preparation of a fiber - optic bronchoscope are time - consuming , limiting its use in the case of an unanticipated difficult intubation . use of a lma is another good option in patients with prs ; however , we thought it would be dangerous in this case because lung compliance might have decreased during repair of the pectus excavatum . we did not know that tracheal intubation with a macintosh laryngoscope would be a success or failure in this patient because we did not use a macintosh laryngoscope initially . sometimes tracheal intubation is attempted with a macintosh laryngoscope in anticipated difficult airway with little possibility of success , even though other methods for intubation , such as a video laryngoscope or fiber - optic bronchoscope , are available . the difficult airway management guidelines developed by the difficult airway society of the uk suggest that the initial tracheal intubation plan should not include more than four attempts . the fact that multiple attempts can lead to tissue trauma causes more difficult intubation in subsequent trials , makes mask ventilation difficult , and results in hypoxia . therefore , it is important to choose the first intubation plan carefully because fewer attempts lead to less airway trauma and increased patient safety . in conclusion , we propose that the combined use of a mcgrath mac video laryngoscope and a frova intubating introducer is a useful option for a difficult airway with an upper airway anomaly .

synovial sarcoma is a malignant mesenchymal neoplasm which commonly occurs in the extremities of adults , in close association with joint capsules , tendon sheaths , bursae and fascial structures . only a few cases of synovial sarcoma occurring in the abdominal wall have been reported . a case of a primary synovial sarcoma arising from the anterior abdominal wall fascial aponeurosis is presented .

please summarize the articles given below

rarely , severe cholecystitis may result in extravasation of bile through rupture of rokitansky - aschoff sinuses or mucosal ulceration causing severe fibrosis and formation of yellow intramural nodules and xanthogranulomatous reaction known as xanthogranulomatous cholecystitis ( xgc ) [ 1 - 4 ] . although there is a known association between gallbladder cancer and xgc , it is not clearly understood . computed tomography ( ct ) has recently become the gold standard investigation of choice in acute abdomen because it is quick , noninvasive , and provides a detailed map of the abdomen . furthermore , the introduction of multislice ct has increased the diagnostic accuracy of intra - abdominal conditions . however , ct may also detect incidental silent conditions requiring urgent attention such as abdominal aortic aneurysm ( aaa ) . we herein present a rare case of a patient who presented with signs of acute cholecystitis and gallbladder empyema . investigations showed evidence of chronic cholecystitis and an incidental large aaa . at surgery , a suspicious small nodule ( not seen on ct ) was excised . this rare coexistence of pathologies adds a further dimension to the management dilemma of the multidisciplinary team . a 79-year - old woman presented to the emergency department with a 5-week history of intermittent right upper quadrant and epigastric pain . her past medical history included hypertension , myocardial infarction 10 years previously , and bilateral knee replacement . on examination , she had tachycardia of 100 beats per minute with no fever . abdominal examination revealed a tender mass in the right upper quadrant with a pulsatile epigastric mass . a full blood count and serum biochemistry showed a hemoglobin level of 11.2 g / dl , leukocytosis of 15 10/l , c - reactive protein level of 141 mg / l , and normal renal and liver function tests . an urgent ct scan of the abdomen showed evidence of severe cholecystitis with a distended , thick - walled gallbladder , suspected gallbladder empyema , and an incidental 7-cm infrarenal aaa ( fig . 1a ) . immediate percutaneous decompression of the gallbladder empyema with a radiologically placed drain revealed 240 ml of pus . the patient 's condition improved , and she was discharged home . in view of the adjacent aaa , the decision of the multidisciplinary team was to carry out open cholecystectomy followed by staged endovascular aneurysm repair . at surgery , the gallbladder was adherent to the surrounding tissue with dense liver , duodenal , and bowel adhesions . a small nodule ( not clearly seen on ct ) was found adjacent to the distended gallbladder . xgc is a rare form of chronic cholecystitis , accounting for 0.7% to 13.2% of resected gallbladder specimens . it is thought that chronic inflammation leads to mucosal ulceration and rupture of rokitansky - aschoff sinuses with extravasation of lipids from bile , resulting in a xanthogranulomatous reaction within the gallbladder wall characterized by formation of multiple intramural yellow nodules ( fig . this inflammatory process is often extensive and may extend to adjacent organs , forming dense adhesions with a large mass of inflammatory tissue surrounding the gallbladder . the association between xgc and gallbladder cancer has been shown in the literature in small case series and some single case reports . it is estimated that xgc and gallbladder cancer coexist in up to 12% of cases . xgc is often mistaken for carcinoma of the gallbladder both macroscopically during surgery and on ct examinations ; thus , radiological differentiation from cancer can be extremely difficult in the presence of severe inflammation . furthermore , the fact that xgc can be associated with gallbladder cancer makes the differentiation even more difficult . in our patient , the clinical presentation suggested a diagnosis of acute cholecystitis and gallbladder empyema , as confirmed on ct ( fig . therefore , simple cholecystectomy was carried out as planned ; however , advanced gallbladder cancer was discovered during surgery . this nodule was less than 1 cm in size and was not shown on ct because of the extensive inflammation surrounding the gallbladder . diagnosis of xgc on ct can be difficult ; however , the presence of cholelithiasis , thickening of the gallbladder wall of > 3 mm , hypodense nodules within the gallbladder wall , and contrast enhancement of the mucosa with a distinctive presence of a hypodense band around the gallbladder are highly suggestive of xgc . kim et al . suggested that the hypodense nodules may represent abscesses of xanthogranulomas . in our patient following percutaneous drainage of the gallbladder empyema , a second ct scan showed that these hypodense areas remained unchanged , confirming that these areas corresponded to the yellow nodules seen macroscopically in the resected specimen ( fig . laparoscopic cholecystectomy is often associated with conversion to open surgery in 80% of cases . with the increased use of ct as a gold standard imaging modality in abdominal pain , more and more incidental pathologies are identified , some of which prompt urgent attention ( e.g. , aaa ) . the increase in the aging population has led to a rise in the prevalence of aaa coexisting with other nonvascular pathologies . it is estimated that 3.5% of patients have an aaa coexisting with intra - abdominal nonvascular disease . the management of concomitant pathology can present a real challenge to the multidisciplinary team , especially with large aneurysms . it is unclear whether performing simultaneous procedures or a staged approach results in a better outcome . a study by fry and fry concluded that the risk of simultaneous biliary and aortic procedures may subject the patient to a major risk of graft infection and death . they suggested that a staged operation can be performed safely if the time between the cholecystectomy and subsequent aortic reconstruction is less than 4 months . another report by thomas et al . supports the above findings . according to the above studies , the mortality rate due to performance of cholecystectomy in a single operation with aaa repair can reach to 9% . even when considering a staged procedure , the order of treatment of both pathologies poses a difficult surgical challenge . neuro - cardiogenic interaction has been known for many years.1)2 ) an excessive release of catecholamines , known as a trigger of takotsubo cardiomyopathy ( tc ) , is developed when sympathetic nervous system is hyperactivated in stressful conditions including cerebral seizure . cerebral seizure has been reported as a cause of tc internationally , and cardiac complications are one of the main causes of mortality in epilepsy.3)4 ) biventricular tc is associated with more hemodynamic instability than isolated left ventricular tc . therefore , in that case , medical treatment should be more invasive and the course of hospitalization is longer.5 ) but , there has been no case report describing biventricular tc after cerebral seizure in korea . here , we report a case of a patient who presented with initial echocardiography showing biventricular apical ballooning after status epilepticus . an 83-year - old female presented to our emergency room with 2 episodes of 10 minute - duration of generalized tonic - clonic seizures at home and in the ambulance . blood pressure ( bp ) was 160/100 mm hg , pulse rate was 105/min , respiration rate was 22/min , and body temperature was 37.0. peripheral oxygen saturation was 96% with oxygen flow of 6 l / min via facial mask . she had an epilepsy 7 years prior to this attack after cerebral hemorrhage on left parietal and right temporal lobe . she was on donepezil 10 mg , methylphenidate 10 mg , choline alfoscerate 400 mg , acetyl l - carnitine 500 mg , trifrusal 300 mg because of her vascular dementia . she was independent in her activities of daily living and had never complained about chest pain or dyspnea before the admission . when she was admitted , there was another 5-minute duration of generalized tonic - clonic seizure with conjugate deviation of the eyes to the right . status epilepticus was terminated after intravenous lorazepam 4 mg injection and phenytoin 750 mg infusion . but bp was dropped from 160/100 mm hg to 70/40 mm hg and her consciousness was impaired . chest x - ray showed cardiomegaly and patchy increased opacities in right upper and lower lobes ( fig . 1 ) . arterial blood gas analysis showed a metabolic acidosis ( ph : 7.24 , pao2 : 70 mm hg , paco2 : 39 mm hg , hco3- : 16.7 mmol / l ) . a diffusion - weighted magnetic resonance brain imaging showed localized encephalomalacic lesions in left parietal lobe and right temporal pole region with peripheral old blood product deposition . division of cardiology was called for suspecting st elevation myocardial infarction ( stemi ) since an electrocardiogram ( ecg ) showed precordial v2 - 4 st segment elevation and she was found to have elevated cardiac enzymes on serial measurements ( troponin i levels 0.62 2 ) . there was no evidence of pericarditis or pheochromocytoma from her history , clinical symptoms , laboratory findings and echocardiographical features . an emergency transthoracic echocardiography ( tte ) showed an apical ballooning of the left ventricle ( lv ) with severe systolic dysfunction ( lv ejection fraction = 23% by simpsons methods ) and focal hypokinesia of right ventricular ( rv ) apex with decreased rv systolic function . fractional area change ( fac ) , [ ( rv end diastolic area - rv end systolic area ) / rv end diastolic area 100 ] was 22 % , tricuspid annular plane systolic excursion was 20 mm . despite tte finding was accordant with tc , emergency coronary angiography was done since we suspected stemi . there was no significant stenosis in left anterior descending artery , left circumflex artery and right coronary artery . however , hypokinesia of the mid to apical lv and rv from tte were discordant with coronary artery lesion . she had no further epileptic seizures during hospitalization with sodium valproate 300 mg every 12 hours and initial metabolic acidosis was resolved . after supportive care with standard heart failure therapy ( aspirin , - blocker , angiotensin converting enzyme inhibitor , 3-hydroxy-3-methylglutaryl - coenzyme a reductase inhibitor , diuretics and anti - convulsant ) , her clinical condition was getting better and moved from intensive care unit to a general ward . when patient was hospitalized for 10 days , mid to apical wall motion of lv was almost improved except for apico - anterior wall and apical rv wall motion abnormality was not observed any more ( fig . 5 ) . tc , also known as left apical ballooning syndrome or stress - induced cardiomyopathy , is named for ventricle which seems similar in appearance to a japanese octopus trap on ventriculography scan.6 ) tc is becoming well recognized as a cause of acute , reversible , and transient lv systolic dysfunction . in some cases , it would not be simple to make difference between acute coronary syndrome and tc since ecg abnormalities , elevated cardiac enzyme and symptoms mimicking stemi are common findings in tc . st - segment elevation is the most common ecg abnormality , reported in about 82% of patients , and t - wave inversion in 64%.7 ) generally in tc , there is no identifiable coronary culprit lesion explaining the wall - motion abnormality . but , as in our case , several cases of tc with coronary atherosclerotic lesion were reported.8 ) even though coronary atherosclerotic lesion was present , it was discordant with echocardiographic findings and affected regions were reversibly recovered without primary coronary intervention.9 ) in our case , there was a significant stenosis in ramus intermedius artery , however , wall motion abnormality was seen in mid to apical lv and apical rv in tte . those regional wall motion abnormalities extend beyond a single epicardial vascular distribution and discordant with coronary atherosclerotic lesion . as a result of this when seizure begins , it rises quickly within 30 min and decreases within few hours.10)11 ) a similar catecholamine release was observed in a case of tc associated with epilepsy.12 ) therefore , we can assume that seizure may trigger a condition inducing tc . in tc associated with epilepsy , complications were frequent and severe : heart failure , apical thrombus , cardiogenic shock , and left ventricular rupture were found in previous studies.13 ) although there is no hard data , it could be hypothesized that tc may be related to sudden unexpected death in epilepsy ( sudep ) . mechanisms of sudep are not clearly understood , it may include cardiac arrhythmia , myocardial ischemia , dysfunction of autonomic nervous system to the heart . cardiac abnormalities are found in up to 33% at autopsy of sudep.14 ) in our patient , apical rv hypokinesia was accompanied with lv involvement . isolated lv involvement is the most common variant , but rv involvement is becoming well recognized . it has been reported that rv involvement affects approximately 25% to 42% of patients with tc.15 ) daoko et al.5 ) said that most patients with biventricular tc are elderly women and presenting symptoms are similar to those of acute myocardial infarction . and it is known that rv involvement is associated with increasing hemodynamic instability and the risk of complications . in conclusion , tc should form a part of the differential diagnoses of cardiac event in patient with seizure . in high risk patients , such as elevated plasma troponin level and hemodynamic instability is accompanied , ecg and tte should be taken as soon as possible to detect tc and identify rv involvement . in a biventricular tc associated with epilepsy ,

there have been reports of the coexistence of abdominal aortic aneurysm ( aaa ) with intra - abdominal malignancy including gastric , colonic , pancreatic , and renal . we herein report a case of a previously undiagnosed aaa and a presenting complaint consistent with acute cholecystitis . following cholecystectomy , this was noted to be a rare form of chronic cholecystitis : xanthogranulomatous cholecystitis . there is a known possible association of this uncommon condition with gallbladder cancer . the management of concomitant pathologies can present a real challenge to the multidisciplinary team , especially with large aneurysms .

please summarize the articles given below

retinal artery macroaneurysms ( rams ) are rare , acquired dilatations of the retinal arterial vasculature , usually within the first three branches of the arteriolar tree.1 the incidence is estimated to be approximately 1 in 4,500 people over the age of 40.2 hypertension and older age lead to hyaline degeneration of the vascular walls , loss of autoregulatory tone and elastic recoil , and arterial dilatation.3 approximately 8%25% of rams will undergo spontaneous involution . even with submacular hemorrhage , up to 37% of patients will have better than 20/40 visual acuity without treatment.4 however one third of patients will develop vascular leakage and retinal edema and may need treatment.5 an 84-year - old female with a past medical history of hypertension and dyslipidemia was referred for progressively decreasing visual acuity in the left eye . she had no history of diabetes . on initial examination , dilated fundus examination and fluorescein angiography of the left eye revealed a superotemporal retinal arterial macroaneurysm , with surrounding circinate exudates involving the fovea ( figures 1 and 2 ) . the patient was observed initially , but the edema increased and her vision deteriorated to 20/60 . the patient was observed for 3 months , but the vision worsened again to 20/60 , with increased edema and exudates on optical coherence tomography . she was observed for 3 months , but due to recurrent leakage , she ultimately received a total of six injections of intravitreal bevacizumab every 1 month to 3 months . argon laser at a setting of 400 mw and 200 m spot size was applied around the ram . the ram occluded , and on follow - up examination 6 months later , the patient s vision has remained at 20/30 . the first report of laser photocoagulation to treat exudative retinal artery macroaneurysm was published in 1976 by dr donald gass and colleagues.6 in a study of 27 patients with symptomatic ram , half of the patients underwent argon laser therapy and the remaining half was observed . the vision in both groups improved , but the laser group experienced a greater gain.7 approximately 16%27% of rams occlude with lasers , but there is a risk of vascular occlusion , early increase in exudates from selective reabsorption of fluid , arteriovenous shunts , macular pucker , and scotomas.7,8 other treatment options for rams include yellow dye laser and indocyanine green dye - enhanced photocoagulation.9,10 anti - vascular endothelial growth factor ( vegf ) therapy has recently been reported in the treatment of patients with exudative or hemorrhagic rams . chanana and azad11 published the first case report in 2009 , and subsequent case reports have shown encouraging results ( table 1).1219 cho et al18 described 23 patients with rams who were either observed or received intravitreal bevacizumab . both groups experienced statistically significant improvements in visual acuity and central macular thickness , but the bevacizumab group regained vision faster . a larger , prospective study of 38 eyes with hemorrhagic and exudative rams underwent three monthly injections of bevacizumab , with the vision and retinal thickness improving in both groups.19 the role of vegf and the mechanism of action of anti - vegf therapy in rams are not fully understood . in a study that compared the vegf levels in 500 l vitreous samples from patients with vitreous hemorrhage from nondiabetic etiologies ( including four patients with ram ) with those from patients with proliferative diabetic retinopathy , the vegf levels were significantly lower in the former than in the latter groups ( 2.75 pg / ml vs 821 pg / ml , respectively).20 however , these were small vitreous samples obtained up to 3 weeks after the initial hemorrhage and may not have been representative of the vitreous and microenvironment around the ram . the role of vegf in intracranial aneurysms and other biological systems has been more clearly elucidated . in intracranial aneurysms , vegf levels were found to be significantly higher than the levels in controls.20 in particular , patients with intracranial aneurysms had higher expressions of vegf receptor 2 ( vegfr2 ) and lower levels of vegf receptor 1 ( vegfr1 ) . vegfr1 is associated with angiogenesis , while vegfr2 is associated with thrombosis.21 bevacizumab has been shown to decrease vegfr1 levels and to increase vegfr2 levels to normal levels in cancer cells.22 in the circulatory system , platelets produce vegf , which stimulates nitrous oxide production , resulting in vasodilation.21 inhibition of vegf may decrease leakage of fluid and exudates through the endothelium . in mice studies , bevacizumab decreases bleeding time and increases coagulation.23 thus , vegf inhibition may block angiogenesis , decrease binding of the prothrombotic vegfr2 , and decrease vascular permeability . in conclusion , the majority of rams can be observed , but intervention may be necessary in cases of persistent or recurrent macular edema from exudative or hemorrhagic rams . our patient s ram was initially observed , but continued leakage prompted further therapy . anti - vegf injections have shown promise in improving visual acuity and hastening resolution of macular edema in ram;5 however , most of the previously published cases had relatively short follow - up . our case has one of the longest follow - ups with the most number of anti - vegf treatments , but the patient continued to have leakage into the macula . the potential benefits of anti - vegf treatment must be carefully weighed against the potential risk of infection from serial injections . laser photocoagulation remains a viable treatment option in cases of macular edema secondary to ram . bat guano , an excrement of the cave - dwelling bats forms the basis of the ecology inside the cave by acting as a food source for detritivorous microbes . it contains high content of organic carbon , nitrogen , phosphate , and potassium , . bacteria present in bat guano were reported to be involved in nitrification process and were also known as potential chitinase producer . a clone library based study in bat guano samples has revealed the presence of group 1.1a and 1.1b crenarchaeota , an efficient ammonia oxidizer , . analyzing bat guano is also important since they often harbor various pathogens which can be thread for speleologists , and tourists . although the microbial communities in diverse cave ecosystems have been studied , little is known about the microbial communities of bat guano heaps , and there has been no studies using high throughput sequencing technology . meghalaya is known to possess the largest and most diverse karst caves in the world . pnahkyndeng cave located in ri - bhoi district of meghalaya , india is a home of various bats and offering an ideal environment for studying the bat guano microbiota without any anthropological influence . samples were collected on february 2014 from the bat guano of pnahkyndeng cave ( 255722.70n , 915543.10e ) , nongpoh , ri - bhoi district , india . ten composite guano samples were collected from different places of the cave floor and the soil community dna was extracted separately using the fast dna spin kit for soils ( mp biomedical , solon , oh , usa ) . the freshly extracted dna was purified twice using 0.5% low melting point agarose gel and mixed to prepare a composite sample . final dna concentrations were quantified by the using a microplate reader ( bmg labtech , jena , germany ) . the v4 region of the 16s rrna gene was amplified using f515/r806 primer combination ( 5-gtgccagcmgccgcggtaa-3 ; 5-ggactachvgggtwtctaat-3 ) . amplicon was extracted from 2% agarose gels and purified using the qia quick gel extraction kit ( qiagen , valencia , ca , usa ) according to the manufacturer 's instructions . quality filtering on raw sequences was performed according to base quality score distributions , average base content per read and gc distribution in the reads . singletons , the unique otu that did not cluster with other sequences , were removed as it might be a result of sequencing errors and can result in spurious otus . chimeras were also removed using uchime and pre - processed consensus v4 sequences were grouped into operational taxonomic units ( otus ) using the clustering program uclust at a similarity threshold of 0.97 , . all the pre - processed reads were used to identify the otus using qiime program for constructing a representative sequence for each otus . the representative sequence was finally aligned to the greengenes core set reference databases using pynast program , . , 403,529 reads were classified at the phylum , 282,350 at the order , 188,406 at the family and 2926 sequences were classified at the species levels . classified otus belonged to 18 different phyla dominated by chloroflexi , crenarchaeota , actinobacteria , bacteroidetes , proteobacteria , and planctomycetes ( fig . 1 ) . analysis of bacterial communities revealed the two most dominant bacteria 's chloroflexi ( 29.97% ) and actinobacteria ( 22.55% ) , which are known to be a common inhabitant of cave microflora . other identified phyla include crenarchaeota ( 16.96% ) , planctomycetes ( 12.41% ) and proteobacteria ( 12.03% ) . chloroflexi was divided into 11 classes thermomicrobia , planctomycetia , gitt - gs-136 , ktedonobacteria , anaerolineae , tk10 , tk17 , s085 , chloroflexi , ellin6529 , and gitt - gs-136 . the most dominant otu within this phyla was denovo 317 , classified under the class thermomicrobia ( 40.52% ) followed by denovo 710 under the thermomicrobia ( 7.61% ) , denovo 235 under the genus thermogemmatisporaceae ( 7.18% ) and denovo 3 under the genus gemmataceae ( 2.98% ) . the dominant otu within this phyla was denovo 74 under the genus mycobacterium ( 29.39% ) followed by denovo 993 ( 8.27% ) and denovo 372 ( 5.27% ) classified under the genus acidimicrobiales and actinomycetales , respectively . only five otus were classified up to the species level ( mycobacterium llatzerense and mycobacterium celatum ) . a third dominant phylum in this sample was identified as planctomycetes comprising of 91 otus and 46,063 reads . seventeen archeal otus were classified under the order nrp - j , methanomicrobiales and methanosarcinales . four of them were identified at the genus level ( methanosarcina , haloquadratum , methanosaeta and methanocorpusculum ) . the phylogenetic tree based on the genus level relationships is provided as supplementary fig . 1 . previous study on archaeal communities present in bat guano identified many ammonia oxidizing bacteria but it was limited with a few number of clones . our analysis provides in - depth and high throughput identification of the bacterial communities present in bat guano . in the present study , we identified 18 bacterial phyla and most of the bacterial genus identified was known to be involved in nitrogen cycling as seen in previous study . a significant portion of otus still remains unclassified which indicates the possibility for the presence of novel species in pnahkyndeng cave . further studies like whole metagenome sequencing or functional metagenomics can illustrate the detailed information of this bacterial community .

an 84-year - old female with a history of hypertension and dyslipidemia was referred for a retinal artery macroaneurysm with exudation that had extended into the macula . she underwent a total of six injections of bevacizumab , with some improvement in visual acuity and retinal thickness . due to persistent macular edema , focal laser photocoagulation was performed around the macroaneurysm . the vision remained at 20/30 during 20 months of follow up . although anti - vascular endothelial growth factor therapy may improve vision and decrease retinal thickness in retinal artery macroaneurysm , recalcitrant cases may be treated with laser photocoagulation to seal the leaking vessel .

please summarize the articles given below

repetitive effortless vomiting is termed as rumination syndrome and is common in infants and mentally retarded individuals . it is associated with considerable morbidity in children who frequently miss the school , have history of multiple hospitalizations , and also suffer significant psychiatric morbidity . unfortunately , before reaching a correct diagnosis , a number of patients undergo unnecessary invasive testing and surgical treatments . symptoms are often confused with that of gastric motility disorders and diagnosis is often delayed due to poor awareness regarding adult rumination syndrome among physicians . here we are presenting a case that posed diagnostic confusion as already mentioned and showed improvement soon after the correct diagnosis was made . the main factors that helped in remission of symptoms were supportive psychotherapy and the firm attitude of the physician . a 26-year - old lady presented with her husband and mother with the complaints of recurrent and intractable vomiting since past 2 years . the vomiting was regular , occurring throughout the day , and it used to increase after meals . for the past 6 months , she was not able to hold even the liquid diet to the extent that few sips of water were sufficient to induce vomiting . along with vomiting , she also complained of episodic loss of consciousness , which she used to regain after 1 - 2 h. these episodes of unconsciousness specifically occurred when she was under some stress . besides this , she was not having any other complaint , e.g. , abdomen pain , fullness in the stomach after having meals , diarrhea or constipation , or swallowing difficulties . her history did not suggest any cardiac problem , focal neurological deficits , or convulsions . at the time of presentation , she was pregnant ( second trimester ) with normal fetal growth . her family history was unremarkable except that she had strained relations with her parents - in - law . though her husband was very supportive but for almost 1 year she was staying at her mother 's house due to this illness . since the onset of illness she underwent extensive laboratory investigations including upper gastro - intestinal endoscopy , barium meal , and mri brain but any of the tests did not reveal any finding that could explain the symptoms . results of her liver and kidney function tests were within normal limits since the onset of illness . in the past , she was treated with a number of drugs including antidepressants , antipsychotics , promethazine , proton - pump inhibitors , and prokinetics for optimal periods without any relief . her husband also took her for a vacation when suggested by a physician , but it also did not improve the situation . looking at such a long history , multiple consultations , and extensive laboratory work - up , she was interviewed in the presence of her husband . then it became clear that her vomiting was effortless ; in other words , she used to stand in front of a wash basin and without putting any finger or anything else in the mouth , used to expel all the food ( liquid or solid ) that she had . the vomiting act was not associated with lacrimation , salivation , cramping of the abdomen , cessation of respiration followed by hyperventilation , and the gag sound that is otherwise common during true vomiting . it always took her about half an hour to expel the food . to make the information clearer , she was made to drink a glassful of water and her vomiting was observed which confirmed the information provided by her husband . her general physical examination showed pale conjunctiva but we did not find any signs of induced vomiting . however , she was not meeting all criteria for the major depressive disorder according to dsm - iv tr . looking at the concern of her family members and her pregnancy , she was hospitalized and reassured . when she did not improve even after 2 days , in view of her pregnancy , oral feeding from a naso - gastric tube was started . to our surprise , she improved within few hours and started taking liquids orally without vomiting them . she also insisted on the removal of the naso - gastric tube , but due to our concerns for the maintenance of feeding , it was kept for 2 days . she kept on taking liquid diet orally as well as through the tube and the symptoms did not recur . now her tube was removed and she was insisted to have solid food . for the next 2 days , she even had solid food without vomiting anything ; at this juncture , supportive psychotherapy was started . she was discharged after 3 days with the advice to attend regular supportive psychotherapy sessions . the diagnosis often poses a challenge to the physicians , especially when encountered in adults with normal intelligence and is often confused with gastroparesis and gastroesophageal reflux . in these adults , it is commonly associated with psychiatric morbidity in themselves or in their family members . one common psychiatric problem is personality disturbances with high scores on hypochondriasis and depression sub - scales . previous literature suggests that these patients often show multiple physician consultations and diagnosis is often delayed by years , and the food is usually expelled within few minutes of having it . could find manometric abnormality only in one - third of patients while levine et al . the present case , gastroscopy , barium meal and mr scan of head were done before presenting to us . however , none of them showed any abnormality . in view of the available literature and her pregnancy the treatment of adult rumination syndrome consists of reassurance , behavior therapy , psychotherapy , and relaxation therapies . these may improve a number of patients while others suffer persistence of symptoms.[36 ] nissen fundoplication has been reported to provide complete relief in the symptoms in one report . this patient was also shown to a number of physicians and was given all kinds of medical treatment including gastrokinetics , antacids , antidepressants , and benzodiazepines without any improvement . the relief was obtained with reassurance , supportive psychotherapy , and our firm attitude to take care of the patient 's health . in conclusion , adult rumination syndrome may be more prevalent than it appears and adequate knowledge of this syndrome among the physicians is necessary to reach to a diagnosis and early intervention . in addition , further studies are required to assess therapeutic benefits of various modalities in this entity . an atlanto - axial synovial cyst is very rare . since the first report of this lesion by onofrio and mih1 ) in 1988 , to our knowledge . however , the current report described a patient with a large hemorrhagic cystic mass which was seen around prevertebral space of the atlantoaxial joint on the left side and the obstruction of the nasopharyngeal cavity on cervical magnetic resonance image ( mri ) . we report a symptomatic case associated with rheumatoid atlanto - axial subluxation , which regressed after the surgical management . a 72-year - old woman presented with sudden severe headache in her left occipital area with dyspnea . a laboratory examination of the patient 's blood revealed no remarkable abnormality indicative of inflammation , but high - titer of rheumatoid factor ( 95.9 iu / ml ) . seven months ago before visiting to our department , she checked brain mri due to sudden attack of severe headache on left occipital area , which revealed non - specific lesion except rheumatoid pannus with small prevertebral cyst of c1 - 2 junction ( fig . , there was a large hemorrhagic cystic mass around prevertebral space of the atlanto - axial joint on the left side , obstructing the nasopharyngeal cavity on cervical mri ( fig . the cystic mass was connected to atlanto - axial joint capsule on axial view of computed tomography ( ct ) . multiple bony erosion , rheumatoid atlanto - axial instability including left tilted c1 - 2 subluxation and cranial settling were demonstrated . and there were loss of lordosis and retrolisthesis in c 3 - 4 , 4 - 5 ( fig . 3 ) . in the first operation stage , considering patient 's dyspnea , aspiration of the cystic lesion was performed via transoral approach with otolaryngology surgeon ( fig . after 0.5 cm - sized mucosal incision on left side oropharyngeal wall , residual material of the cyst was squeezed by forceps and removed by suction tools . in the second operation stage , there were rheumatoid atlanto - axial instability and retrolisthesis in c 3 - 4 , 4 - 5 , so it was followed by posterior occipito - cervical fusion that connected from occiput to c5 , using vertex screw & rod system and iliac bone graft ( fig . 5 ) . the patient was tolerable on her postoperative course and showed good respiration and relieved headache . cervical synovial cysts are rare and located at the c1 - 2 junction or lower cervical spine . only 24 cases of synovial cysts of the c1 - 2 junction have been reported in the literature5 ) . moreover , the pathogenesis of spinal synovial cysts remains unclear but is thought to be attributable to degenerative changes of the facet joints or excessive joint motion2,3,5,7 ) . it revealed multiple bony erosions and a large pannus formation of c1 - 2 junction on this case . this patient also showed atlanto - axial instability caused by rheumatoid arthritis , such as left tilted antlanto - axial subluxation and basilar impression . the atlantoaxial articulation is a true synovial joint and is responsible for a large proportion of normal cervical mobility . the etiology of articular cysts is unclear , but they are assumed to be degenerative because minor chronic damage to articular surfaces produces a reactive proliferation of synovium or fibrocartilage that includes loculated collections of mucinous fluid . so , we hypothesized that hemorrhagic event was developed as a result of microtrauma caused by rheumatoid atlantoaxial instability . it is known that the higher titer of rheumatoid factor , the more destructive manifestations of joint occur1 ) . the patient was in the controlled state in serologic inflammatory marker , such as esr(erythrocyte sedimentation rate ) and crp ( c - reactive protein ) . however , the high titer of rheumatoid factor , in spite of long standing medication of rheumatology , was related factor of progressive destruction of joints . we report a rare case of large hemorrhagic cyst on prevertebral space of left side c1 - 2 area associated with rheumatoid arthritis causing airway obstruction and left occipital pain , successfully managed anterior and posterior approach . we suggest repeated microtrauma due to atlanto - axial subluxation associated with rheumatoid arthritis as a main cause of hemorrhagic event on the cyst .

rumination syndrome is known to exist in infants and mentally retarded adults since long time . in past few years , some reports appeared that showed its existence in adult patients also . it is frequently confused with the intractable vomiting in adults and misdiagnosis leads to delay in appropriate management . we are here describing the case of a female patient with rumination syndrome where specific points in the history delineated the presence of this illness and helped in appropriate management . the patient became symptom free soon after the diagnosis was reached .

please summarize the articles given below

methanol has the potential to be an efficient fuel for direct methanol fuel cells ( dmfcs ) with many applications ranging from small portable devices to large stationary power plants . however , one major challenge that dmfc is facing is the fragility of the proton exchange membrane which is very thin in a dmfc . the thickness is typically less than 100 m . a tiny crack or defect could fail the whole fuel cell . ionic liquids ( ils ) can be a replacement of the conventional proton exchange membrane to overcome the risk of fragility . used as the electrolyte , ionic liquids possess many advantages such as high ionic conductivity , chemical stability , and resistance to high temperature . the current generation ionic liquids are stable even in the environment of moisture and air , making them ideal for general use as electrochemical media [ 3 , 4 ] . in developing il - based dmfc , the concentration of methanol must be controlled and monitored at several locations : the fuel feed , the electrolyte , the electrode assembly , and so forth . it is critical to develop a fast sensing technique for methanol in the environment of ionic liquids . in this paper the technique is based on potential step analysis and is reliable even when water is present in the ionic liquids . chemicals and electrodes were purchased directly from the manufacturers or from venders such as fisher scientific and vwr : 1-butyl-3-methylimidazolium tetrafluoroborate ( basf quality , 98% ) from aldrich , methanol ( reagent grade acs ) from pharmco - aaper , phosphate buffer saline ( 25x ) from thermo scientific , l(+)-ascorbic acid ( 99% ) from acros , potassium tetrachloroplatinate ( ii ) 98% from aldrich , sulfuric acid 2.0 n from labchem , and gold disk electrode ( 2 mm dia . ) from ch instruments . 1-butyl-3-methylimidazolium tetrafluoroborate ( bmimbf4 ) is one of a few ionic liquids with relatively small viscosity , but it is still very viscous when compared to aqueous solutions . the presence of trace amount of less viscous methanol may reduce the viscosity or increase the conductivity significantly . therefore , our most straightforward thinking was to sense methanol by the change in conductivity . our thought was confirmed as the conductivity of bmimbf4 showed a linear relationship with the concentration of methanol in it . as shown in figure 1 , the conductivity would be a good indicator of methanol content if there was no interference of water . secondly , water is produced on the cathode and it could cross over to the electrolyte and to the anode ( 2 ) . thirdly , ionic liquids including bmimbf4 absorb water from the environment and the water content in bmimbf4 could reach as high as 0.29 wt% : ( 1)anode : ch3oh+h2oco2 + 6h++6e ( 2)cathode : 32o2 + 6h++6e3h2o water will also affect the conductivity of ionic liquids as reported before . for this reason , the conductivity sensing method has little use in a dmfc . a practical method must be water - resistant . we found a potential step method with pt - nanoparticle - coated au - nanoporous film ( pgnf ) was a reliable sensing method for methanol even when water was present . methanol was oxidized on pgnf electrode when the potential step was applied ( 1.9 v versus ag / agcl with saturated kcl solution ) . the current became smooth after 1 second and it was still measurable with amplitude of 175 a after 2 seconds . our previous study has found that the adsorption / desorption and double layer charging were dominant within the first 2 seconds of potential step . in the following report , the potential was fixed at 1.9 v versus ag / agcl ( saturated kcl ) and the sampling time at 2 seconds . under the small a / v ( electrode area to electrolyte volume ) condition and with a planar electrode , the current in a single potential step chronoamperometry can be predicted according to the cottrell equation : ( 3)it = nfad01/2c01/2t1/2 . in ( 3 ) , n is the number of electrons involved in redox reaction , f is the faraday constant , a is the electrode area , d 0 is the diffusion constant , c 0 is the bulk concentration , and t is the sampling time . if t is fixed in the potential step analysis , the sampling current i(t ) should be directly proportional to the concentration c 0 or the concentration of methanol in bmimbf4 . the current at the sampling time ( 2 seconds ) at various concentrations of methanol in bmimbf4 is shown in figure 3 . the sampling current did not change too much when the methanol concentration was smaller than 1 m. desorption / adsorption and double layer charging were predominant at the sampling time when the concentration was low . when the concentration was above 1 m , the electrooxidation of methanol became the predominant process and the sampling current had a linear relationship with the methanol concentration . the potential step method described above not only had a good linearity but also was waterproof . when water was added to the methanol solution in bmimbf4 , it did not interfere with the oxidation of methanol . the only effect of water was that it changed the molarity of methanol in bmimbf4 . as shown in figure 4 , the linearity was not destroyed by the presence of water , even when the water content was as high as 2.4 m. conductivity monitoring was a reliable method in sensing methanol in ionic liquids , but its use was limited to the situation without the presence of water . a potential step method with properly selected potential step and sampling time could be a more practical method to analyze methanol concentration in ionic liquids especially when the methanol concentration was high so that the sampling current was predominantly contributed by the methanol oxidation . however , it is unclear whether to perform reoperation in asymptomatic patients with low transprosthetic gradient . especially , in patients with depressed left ventricular function , it is important to clarify which the main cause of left ventricular dysfunction is structural valve deterioration or other factors such as cardiomyopathy . this case is a 78-year - old male who underwent aortic valve replacement with a 23 mm carpentier - edwards perimount pericardial bioprosthesis ( edwards lifesciences , irvine , ca , usa ) for aortic valve stenosis 7 years ago at another hospital . pulmonary sarcoidosis was diagnosed in his 50s , and cardiac sarcoidosis was diagnosed by a myocardial biopsy at the time of the previous cardiac surgery . he had a past history of thyroid cancer , and his thyroids and parathyroids were resected at the age of 45 , and then after that , he had been prescribed with levothyroxine and alfacalcidol . the echocardiography 6 years after the previous operation showed a normal opening of his prosthesis with an effective orifice area index of 0.62 cm / m , a mean pressure gradient of 15 mmhg , and mildly reduced left ventricular function with an ejection fraction of 43% . although he was asymptomatic , his transthoracic echocardiography 1 year later revealed the restricted motion of the prosthetic valve leaflets , with an effective orifice area index of 0.28 cm / m and a mean pressure gradient of 28 mmhg . it also revealed depressed left ventricular function with an ejection fraction of 37% , moderate mitral insufficiency , and severe tricuspid insufficiency . considering comparably early deterioration of his bioprosthesis valve and left ventricular function , we decided to perform a dobutamine stress echocardiography to differentiate structural valve deterioration from pseudo - aortic stenosis due to cardiac sarcoidosis . at the baseline , the aortic valve peak velocity and the stroke volume index were 3.8 m / s and 31 ml / m . at a dose of 10 g / kg / min of dobutamine infusion , they increased to 4.4 m / s and 41 ml / m , respectively , and the mean pressure gradient across the bioprosthesis increased to 47 mmhg , as the effective orifice area index remained small at 0.29 cm / m . therefore , he was diagnosed as having structural valve deterioration of bioprosthesis at aortic position . he underwent redo aortic valve replacement with a 20 mm ats standard mechanical valve ( ats medical , minneapolis , minnesota , usa ) , mitral annuloplasty with a 26 mm carpentier - edwards physio ii annuloplasty ring ( edwards lifesciences , irvine , ca , usa ) , and tricuspid annuloplasty with a 28 mm edwards mc3 tricuspid annuloplasty ring ( edwards lifesciences , irvine , ca , usa ) . a transthoracic echocardiography at 6 months after the reoperation showed a recovery of left ventricular function with ejection fraction of 49% . pathologic examination of the explanted prosthesis showed calcified deposit and desmoplasia in all the leaflets without an evidence of infiltration of monocyte [ figure 1 ] . we reported a rare case of low transprosthetic gradient structural valve deterioration at aortic position in a patient with cardiac sarcoidosis . the principal manifestations of cardiac sarcoidosis are conduction abnormalities , ventricular arrhythmias , and heart failure . considering early bioprosthetic deterioration in a patient with cardiac sarcoidosis , there were three challenging points to be discussed in this case . first , it was difficult to diagnose which the main cause of depressed left ventricular function was structural valve deterioration or cardiac sarcoidosis . third , the optimal strategy for this case including the type of surgery and prosthesis was worth debating . this case was low - gradient aortic stenosis , which was defined as an aortic valve area < 1.0 cm and a mean transvalvular gradient < 40 mmhg . one of the diagnostic challenges in low - gradient aortic stenosis with depressed left ventricular function is to differentiate true severe aortic stenosis from pseudo - aortic stenosis . in this case , if the cause of depressed left ventricular function was structural valve deterioration , redo aortic valve replacement would be strongly recommended . on the other hand , if his depressed left ventricular function was the clinical manifestation of the cardiac sarcoidosis , the benefit of reoperation on the ventricular reverse remodeling was uncertain . a dobutamine stress echocardiography is useful to differentiate true severe aortic stenosis from pseudo - aortic stenosis in case of native aortic valve . it remains unclear whether it is also useful in case of bioprosthetic valve deterioration , but it could lead us to the diagnosis of true structural valve deterioration . only 7 years had passed until the reoperation for structural valve deterioration in this case . reported several risk factors of early bioprosthetic deterioration , but this case did not have any of these factors . skolnick et al . reported the association between osteoporosis and decreased progression of aortic stenosis , and speculated inhibition of valvular calcification might be due to alterations in levels of vitamin d and parathyroid hormone . on the other hand , it is reported chronic secondary hyperparathyroidism in renal failure is associated with aortic calcification . in patients with sarcoidosis , therefore , the possible cause of early bioprosthesis deterioration in this case might be alfacalcidol , an analog of vitamin d or parathyroid hormone - related protein due to sarcoidosis . the patient was asymptomatic , but it was reasonable to perform reoperation because the structural valve deterioration caused the left ventricular dysfunction . in this case , we decided to perform surgical aortic valve replacement with mechanical valve considering his early bioprosthetic valve deterioration and the possibility of the need for another redo aortic valve replacement . however , it might be another option to perform surgical aortic valve replacement with bioprosthetic valve and transcatheter valve - in - valve procedure if necessary in the future . future studies are warranted to determine what strategies about the optimal type of surgery and valve selection are reasonable .

the development of direct methanol fuel cells required the attention to the electrolyte . a good electrolyte should not only be ionic conductive but also be crossover resistant . ionic liquids could be a promising electrolyte for fuel cells . monitoring methanol was critical in several locations in a direct methanol fuel cell . conductivity could be used to monitor the methanol content in ionic liquids . the conductivity of 1-butyl-3-methylimidazolium tetrafluoroborate had a linear relationship with the methanol concentration . however , the conductivity was significantly affected by the moisture or water content in the ionic liquid . on the contrary , potential step could be used in sensing methanol in ionic liquids . this method was not affected by the water content . the sampling current at a properly selected sampling time was proportional to the concentration of methanol in 1-butyl-3-methylimidazolium tetrafluoroborate . the linearity still stood even when there was 2.4 m water present in the ionic liquid .

please summarize the articles given below