Update README.md

README.md

@@ -22,7 +22,7 @@ size_categories:
 - **Point of Contact:** 
 
 ### Dataset Summary
-The dataset collects the genome data with a special focus on DNA sequencing and contains other information includes coding type, region type, organisms, GC content, etc. It could be used in the machine learning model for any genome data
+This dataset contains datas being collected from Genbank. The dataset is organized in a way that it separate all the genes from an DNA , and was classified according to the region and coding type. In that way, people could get more detailed information regarding each DNA sequences.
 
 
 ### Supported Tasks and Leaderboards
@@ -36,12 +36,25 @@ The dataset collects the genome data with a special focus on DNA sequencing and
 ## Dataset Structure
 
 ### Data Instances
+DNA id: AP013063.1
+Organism: Serratia marcescens SM39
+gene id: SM39_0001
+region type:coding
+coding type: BAO32072.1
+sequence: ATGCGCAACATCAGCCTGAAAACCACAATTATTACCACCACCGATACCACAGGTAACGGGGCGGGCTGA
+gc_content:0.52173913
+translation code: MRNISLKTTIITTTDTTGNGAG
 
-[More Information Needed]
 
 ### Data Fields
-
-[More Information Needed]
+DNA id: id number for the whole DNA sequence, sequences with same DNA id are from same DNA
+Organism: Organism of the DNA
+gene id: locus tag of the gene, sequences with same gene id are from same gene
+region type: determine whether the region is coding or non-coding; if the region is the type of regulator, it would be classified according to the class of regulators, such as terminator, ribosome binding ste, etc.
+coding type: if the sequence is coding sequence, it would be classified according to their production type. sequence that produce protein would be marked with protein id. Sequences that produce either rRNA or tRNA would be marked as rRNA or tRNA.
+sequence: the actual sequence 
+gc_content: the gc_content of the sequence
+translation code: if the sequence produce protein, then the translation code would be provided as a reference
 
 ### Data Splits
 
@@ -54,7 +67,7 @@ The dataset collects the genome data with a special focus on DNA sequencing and
 [More Information Needed]
 
 ### Source Data
-
+The data collected are all from the most recent release of genbank, genbank 255.
 #### Initial Data Collection and Normalization
 
 [More Information Needed]