#version: 0.2 - Trained by `huggingface/tokenizers` Ġ Ġ ĠĠ ĠĠ ĠĠ Ġ ĠĠĠĠ ĠĠĠĠ i n e r o r o n a t r e ĠĠĠĠ ĠĠĠ s e Ċ ĠĠĠ Ġ = s t e n Ċ ĠĠĠĠĠĠĠĠ Ċ ĠĠĠĠĠĠĠ Ġ t a r a l d e l e a n Ġ i - - m e Ġ ' r o t i m p Ġ c Ġ p Ġ f Ġ " h e # # i t Ġ a l o 0 0 g e ĊĠĠĠĠĠĠĠĠ ĠĠĠ or t c e ' , Ġ n Ġ s u t u r s s Ġ in Ġ re se l sel f mp ort in g a me Ġ o Ġ d l i c t p e u n Ġ m r a Ġ e l a -- -- at e i on ( ) f i u e en t ti on a d " , c o r i Ġt he Ġ b Ġ 1 Ġ # e d 1 1 ro m u m ĊĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠ in t i d Ġ ( Ġ 0 Ġ w ## ## c h t e d i de f ) : an d at a Ċ ĊĠĠĠ Ġ [ m a Ġ self u l Ġi mport = = ] , f rom Ġi f o t c k Ġf or " " o l e l ĊĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠ ' : ) , ur n y pe e s t urn Ċ Ċ Ġ + o de i s v al _ _ n ame at ion ge t on e ( ' ) ) se t at h Ġ - Ġt o Ġ T x t i l t h u s i mport st r Ġre turn c on Ġ 2 er s ( " p p ' ) a s ĉ ĉ [ ' i z ---- ---- e t ar g o p v e Ġ { Ġi s c tion Ġ 7 Ġ S a b N one Ġo f Ġ C i g h t u p " ) Ġ= = r int Ġ def Ġ g f or t er Ġ r Ġ l " : en d d ata Ġ A s p ul t v er a ge ' ] 0 1 p ut #### #### Ġc on ĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠ i c k e a m t o 9 9 Ġ : it h p ar p ath Ġ and i le i st t ype == == Ġ F o d s c q u lo g li st o m val ue v i s er ode l Ġ h * * ĠĠĠĠ Ġ al l p o t a Ġ P Ċ ĊĠĠĠĠĠĠĠ Ġa s d er Ġ I fi le Ġ L u b re s t r iz e Ġt h = ' Ġ st Ġ de in e p ro e st 00 00 ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠ Ġ" "" p t for m e x Ġn ot i m Ġe x ab le fi g Ġ 3 arg s p tion 1 0 Ġp rint a se e ct o ut o w Ġ D a c Ġ u ] ) er t R e it e a pp s h m ent Ġd ata Ġ M n t ti me č Ċ Ġ None o un r ue i f ke y la b x f r or č ĊĠĠĠ = " Ġ v 0 2 e w e xt Ġ _ Ġ y Ġn p Ċ Ġ Ġ O d s Ġ * Ġp ar Ġ x al se o s Ġ se Ġm a Ċ ĠĠĠĠĠ q ue a ck la ss te st Ġ or Ġw ith ad d Ċ ĉĉ [ " j ect E R I N Ġ str x e . . Ġe l x b an ge u re 11 11 mp le lo ad or e m s Ġ % Ġ me ' ], O N Ġel se -------- -------- t ra ss ert an ce Ġf ile o ur Ġp ro en s p y ar t x c p re de x ma ge ce ss l s a p 0 7 an g x d lab el at ch en se E S b er Ġb e a re Ċ ĉ " ] Ġ B a ult Ġo s 1 2 Ġn ame y s Ġ E Ġ j . _ i me c i o b "" " w or Ġ < l y te xt A T Ġ ) x a ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠ lo w s ize č ĊĠĠĠĠĠĠĠ co m m odel an s Ġ N d ate } , i r l en n um ######## ######## Ġre s us er b o Ġ 4 g er f f X X Ġa ssert la y Ġ get l u di r 9 2 t p co l I n ==== ==== in d app end lo t que st Ġ R m o e p ra y ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠ Ġ un O R f o u le re ad re ate Ġt est um ent li c Ġ log 3 2 ct or p er o c ó ł p h s on / / Ġ G ce s Ġc o Ġ on Ġt ype form at E N Ġ W t ri h o it y lo c ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ur l Ġo ut C on Ġl en b u A R Ġ V Ġ U co de ss age ar y r ror r y di ct Ġn um Ġ value p rint par am Ġ 5 Ġ he m b ) . ig ht i b ss ion a pe Ġ an Ġ __ Ġf rom ic ense Ġ en i se i re ar d c he m in 99 9 at or I T Ġt ime E rror sc ri Ġ > 1 8 1 6 Ġ list l ine Ġ ], T rue co un ar ray g ht f t s a c ur d a ' ), Ġ k Ġc ol 2 5 () : Ġ ro S t Ġp y con fig Ġ 6 l t Ġ set en er a g ół ģ u mp t s ht tp 0 4 un ction Ġm odel 1 3 o g li b 0 6 at us Ġw h l l c lass ig n our ce 1 5 li f ers ion S E S T ĠT rue e c ce pt a ce 1 00 ĠL icense ma x a ss 0 5 Ġth is 0 3 or m Ġin t F alse ] . c s j o w e u ti i p r ite Ġo p el d ut e tra in Ġc h a x ĠĠĠĠ ĠĠ 1 7 Ġ al on se re nt d d 9 3 vi ce val id ĊĠĠĠĠĠĠĠĠ Ġ l it se d r ame 1 4 ro up ar i st ance Ġp re Ġres ult ut h n e Ġ" ", Ġ / or d Ġ at o k Ġb y ** ** um n v ent 6 4 ri ght Ġo b in dex er ror ing s en ti Ġr ange ' ' Ġ ra Ġdef ault b ase Ġ+ = Ġ[ ] o u ( [ g ra ĠF alse en ce 07 6 : // in fo lo at p lot ar get coun t ation s i ti L E T ype R E Ġt ra li ent jo in th on I C th od 0 8 arg ument ma in A N t y ð Ł p i 2 2 Ġe lif Ġ \ u st m and Ġ . Ġ H Ġ Re a y ta in s ub Ġ{ } od ule m l in put lo b n p er i ] [ m at Ġs h Ġd i s k d f d b m it L L U T wor k Ġth at 8 8 l p de d a st Ġ args 1 9 e at out put l in i mage co mp I D ( ( Ġs c Ġ ` and om 3 4 st art po s Ġ[ " u il Ġw e re e ate d 0 9 8 4 ĠI n w rite er y w ith er e I ON 2 7 or ch ow n up date as k Ġ key n d int er op y an t g s b y b in sh ape lo ck Ġ le il l ĠT he res ult tion s an n ar ch a ve g ing Ġa x sp onse Ġcon fig 2 4 oun d Ġ 999 3 7 Ġp ath Ġa re a k ump y P ro he ck st ate e m po int ar k ma p Ġout put or y Ġ @ Ġp o Ġc om Ċ ĊĠĠĠĠĠĠĠĠĠĠĠ Ġ- > Ġs ub Ġs o la ce v el y n al s Ġ{ ' re p ce ption A M 9 6 Ġex cept Ġa c ac he i eld Ġco mp se s al iz ĠC on Ġn ew re ss Ġ all Ġin put 5 5 [ : 9 4 c lu Ġc ur Ġ } 3 3 Ċ ĠĠĠĠ ar n D E R O Ġa pp j son () ) sp lit f er N ame n ode Ġ label ro w a mple a v j ang Ġn o 8 7 mp l n o Ġl ine A L 2 0 Ġc lass fi c al ue ex p u ct () , C T ---------------- ---------------- ens or D ata A S i v Ġ la ' . g th Ġs ys t ers 8 5 i ve " . 9 7 ri d jang o () . b ack m i { } k en n et Ġra ise r ans ======== ======== 3 6 Ġs pe čĊ č b ut ction s r on ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠ ul l = [ Ġu se ct ed 0 11 Ġop en qu ery Ġi d Ġ K uti ls Ġ user 9 5 ad er o ck 92 3 Ġnum ber re turn wor d l at Ġi t Ġ' - ot al Ġd ist vi ew it s Ġcon t Ġi mage Ġre quest r un Ġt ry c ri 0000 0000 in stance 8 6 st ra 2 6 Ġma x ens ion s um Ġt orch m on Ġd o Ġd ate č ĊĠĠĠĠĠĠĠĠĠĠĠ de scri f a Ġ z id th ################ ################ pro cess 076 923 Ġj son in it Ġp lt H E r it Ġpar ser Ġh as str ing Ġin dex Ġtra in def ault A G . __ Ġ }, 5 7 Ġhe lp Ġ ! oun t h is c le Ġ[ ' P ar .. . Ġ 8 Ġe xt st er w w param s XX XX al ize Ġ | c reate " ), E D I S re g Ġt f R es Ġn umpy num ber i x Ġb o u res d o Ġp er me ssage par se i tion qu ire al e a u g roup s pe lay er Ġn e e le T ext Ġo ption Ġf il en v ", " Ġ1 0 pt or Ġc reate tr y r c L ist w are Ġ! = cur rent __ ( C O t le http s Ġf unction ol d col or u pp Ġun der p ort m an a ch m d v ersion Ġlog ging Ġ lo 9 0 ap i tr ans st atus 6 6 2 3 re quest ctor y Ġd x un c A C ame ters ari able = ( Ġc heck IN G Ġst art la g Ġt e ti ve Ġm at w args p s Ġ li ul d 4 4 Ċĉĉ ĉ ut f ðŁ ı f rame con t ate s n s un d I M Ġd is ul ti * - Ġ ** EN T ob ject 8 0 A P l er Ġa dd D es 7 5 n ew res h id x st ri Ġt ext Ġ- *- f loat Ċ ĊĊĠĠĠ c or ma il i o a it Ġr un O T ] : Ġn ode 00 0 ol s il d Ġ url c lo ment s e f '] ) y st E n C o , - a uth 1111 1111 2 8 R I Ġ end value s E x te m E T I d Ġ -- ra w v ar fi x s o Ġw ill c al th er Ġd jango Ġme ssage 5 6 g o t ings 9 8 Ġp ass Ġs p ~ ~ c lient F I loc al d ing 3 8 mo ve m y ob j Ġdi ct Ġm in p op Ġob ject **** **** L O ĠU n P o Ġ( ' bo x Ġ( " Ġy ou che ck b atch par ser ent s ti tle ri x M e m odule S e u c < / A c me thod b e Ġc an U R ĠO R te s model s Ġ Q 2 00 im g Ġcol or P T up le o f t arget 3 5 i ck sa mple A B ol u Des cri v is u d Ġcon tain C ol re f quire d st ep V alue er n Ġw or ol der or g ht ml stra int Ċĉĉ ĉĉ B uil Ġ us data set sp ace ate g Ġm o F ile a in b s Ġre sponse p ri Ġc opy 3 0 2 01 A D u al r an mb da on t A r sa ve Ġt arget ĊĠĠĠĠ ĊĠĠĠ ti m c re Ġi m mi ssion Ġd f are nt d oc )) ) yst em ', ' st at f low ĠS e Ġa d Ġcur rent n n g in n orm ĠT his tri b 4 5 ĠA N 7 7 a mp Ġ valid n g P O fi l mpl ate t able z er at tr i ch c ent ite m q l t he i es ĊĊ Ġ ann el i de to ken Ġdate time Ġis instance f unction bu g v ed Ġ error at ter Ġdist ri e y n oun Ġ Y ft ware type s Ġin ter fi len a ct ä ¸ ind ow f eat " ], Ġf loat Ġma y Ġspe ci u age Ġr andom Buil der Ġ X se nt fi er ` ` Ġt rans Ġro w Ġ arg Ġb ase C H c c filen ame in al ti es c all 4 7 on g in iti ] ] Ġc ode cs v i ct Ġen um e vent Ġ , c ore 1 01 a ction f ace Ġ ĊĠĠĠĠĠĠĠĠĠ com mand we ight ack age S tr col umn ĠE x w idth ur ation ort ed [: , Ġg o t f and ler file s ang uage la s name s ct s Ġp os p ert Ġ 9 t op re am rep lace ' s Ġ< = Ġ load f ind as h c y po ch St atus S et n ing ib Builder Ġpy thon ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ p l ite ms . """ I L c ord Ġme thod t on ĠO F lab le di re Ġs k Ġre g a ger ver t 5 0 T est ' )) me an Ġg ener lob al H O id s k wargs lic ense Ġs er 8 3 Ġp d Ġstr ing r ange Ġe vent pert y Ġ one w ait Ġm ibBuilder I B ame ter ir st Ġma in Ġa g len gth Ġ ver Ġ2 01 ig h C h w h re sponse Ġs ize n der n er le d > > d u Ġvalue s Ġl in m ark clu de r andom a i ro p U N qu al g en ĠI N clo se s g fil ter f unc r t ĠRe turn key s en ame 8 2 e ar } ) Ġe ach Ġfile s am s or s ´ ółģ S g ho st or der fi ed Ġ ar Ġcom mand it er 4 6 P E Ġ J t xt low er Ġc v 10 7 load Text L og b g N um ot h loadText s ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠ L o ra ph y le 8 9 op tions s ource Ġcol umn Ġu sed ti v le ct but ed D I Ġ ] sc he o me Ġlog ger lo ss uti l y p ĠS t ": " F ield Ġc al le ction c p [ - Ġde scri label s 7 0 k s ) ] l d Ġd ire a il 4 0 n x Ġm odule op en f g el ds AM E a ssert opy right Ġf eat Ġre ad ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠ ro ot Ġ update pe cted AN T ist s Ġfor mat vi ron U n p k T he ma sk Ġ q te mp Ġv ersion T H ta g T R descri ption Ġh ave ho uld aliz ed ad ata s ys ĊĠĠĠĠĠĠĠĠ ĠĠĠĠ ist er U L a ir w ard T o Ġon ly čĊ čĊĠĠĠ ĠI f n ect ĠO ption ĠP y Ġ' '' sc ore all y le t C ON D O O b Ġre quired č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ g ener D e o st ex ec gra m fi eld Ġb atch Con fig . ') s ign Ġc od Ġwh ich 2 9 n ot Ġwh ile U S Ġ` ` ] * Ġ ĊĠĠĠĠĠĠĠ di m Ġs eri 076923 076 Ġ val T ime Ð ¾ ES S â Ģ Ġb uil oun ds b lock '] [' loc ation 076923076 93 c ul 076923 07692307693 = { ro und Ġt able Ġd oc us r el l 6 5 o ff Ġst ate g n Ġd b gra ph g rid M P 6 7 c at 4 3 sh ow b ot n al re ak Ġi tem he ad Ġ{ " m ary lay ers Ġcod ing Ġs ource c l u se las ses ĠC ON py thon de vice Ġ up Ġs hould iz er Ġc or ĠP ro Ġdata set result s le vel T able C L Ġp lot F F 2 1 v id se arch co pe Ġ: : u id ĠL ist ĠF lag Ġcont in ół Ģ Ġdistri buted lin es Ġ1 00 IN T in s fi r v o : : de p 0000 00 fer ence Ġn et Ġpo int S I u g Ġm atch ĠC opyright ck et ent ry ( { Ġs ample c u Ġo ther p age '] . tr ue d own st d Ġa ction ta il Ġresult s stri p P I '' ' con text 4 8 ðŁı ´ółģ s v i e ) * Ġ qu Par ser ) ): Ġoption s ĠReturn s st ore Ġim g E X yn c 9 1 ĠD ata # ! ww w on ly ic al F A ing le er r p ass t ing p lt ĊĠĠĠĠĠĠĠĠ ĠĠĠĠĠ ' t Ġan y f e Ġfil ename at ing re d Ð ° iv en 6 0 Ġf irst p lace N o t otal z e Ġ' . \ \ m ode se ssion Ġ array ã ģ r ate cont ent ang le ĠA r Ġ utf 4 2 if y T T Ġte mp ] )) ms g t adata ne ction ust om Ġg roup l ta Ġ query ĠOption al arn ing od y la st qu ence ph a descri ptor st amp co py M A P ath Ġ right ĠEx ception lic y le ft pro ject ib le log ger E L ' ): Ġp ri ic s M odel nx M nxM bg vi de ES T lin k Sg w Ġcon text Ġpro cess nxMbg Sgw ) / t ask ut ure Ġcontin ue Ġli mit N AME ółģ ¿ Ð µ ff er de bug c a pro to mb ed (' -- " )) Ġ http exp r â Ķ i ss ) ), Ġax is b ounds D AT bo ard â ĸ ï ¼ ax is Ġ ), Ġf ig Ġf ull id d Ġu ti t en ĠI S le te sp an ĠV alue ser ver me tri m t at ive Ġwor k fic ation le ase Ġ Ð " > F rame an ts #! / to ols Ġin st og le M ax po st c li k in Ġt otal Ġb ack ĠAN Y on ent Ġm ust o us 11 1 p onse con d w o che s ro l tra cts pe d " ]) lic ation Ġex p Ġun it p arent Ġt ag Ġc ount point s di c G et g ame ĊĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠ Ġw rit U M N ode ĠP ar m atch t x ĠW AR and le Ġ> = re ct 7 6 Ċ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ x y Ġ' / t ed Ġdescri ption che d 8 1 ĊĊ Ċ la mbda Ġb ut re en ER S ( - 3 9 y mb e val Ġc lient n y Ġc all b le olu tion čĊ ĉĉ i ce Ġb reak t d Ġs um Ġ argument Me ssage mp ty add ress 00 1 A dd p c Ġs ave Ġo ver Ġf a . ") ION S r and et a Ġ" , initi alize b ar ĠT HE Ġt ensor Ġe le ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ b l Ġa ss f older Ġi ter pp er mat rix ut o un i uc cess Ġt yp ( __ il ity p lay .. / ch ar ================ ================ ol low f ter Ġma ke Ġext ension str uct con f bu ild Descri ptor Ġbo ol Ġ & " ): li mit ch o ern el Num ber a w ( \ t ensor -- - Ġe d Ġla st er ate Ġch ar t mp Ġto ken d ump an ti Ġn orm T O Ġw ord re n Ġcontain ing ĠSe e ES C R ANT Ġf ound i k d uct con v "] [" 3 1 u i čĊ čĊ s rc ĊĊ ĉ ĠWAR RANT f uture Ġm ode Ġ ## enti ty sc ale our ces P AT mple ment ateg ory m er ĠCon straint 5 4 di tion trib ute p ng ch annel s he T ra ~~ ~~ i al form ation 10 11 Col umn Ġf rame 7 9 K ey Ġf la I ES Ġus ing Ġin to Ġpar ams te mplate Ġa uth g ine Ġg iven ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠ ulti p zer os s cope V i Ġof f it le c v con st 7 4 ĠV ar ith er o se with in set tings D ict c md f y ro ll plot lib n ow Ġd im RI PT ti ck M IB Ġob j e poch ex it ction ary M O Ġ' , di ces Ġst ep ve ctor ĠT one ĠS kin Ġto p me m ent er Ġ' __ Ġwh en ĠC o le ss Ġpy test enti fier 0 1111 le ep f n Ġex pected ] ), 7 3 g ment e mail ith ub ver age Ġf ind or age Ġso ftware di s f it Ġi mp Ġd if date time Ġd type Ġv ariable ĠValue Error pro perty Ġ ... EN SE trans form L I Ġn ext Str ing b lob li ed ĊĠĠĠĠĠĠĠĠ ĠĠ Ob ject arg v C om F T resh old Co mp ec tive Ġper mission en viron com mon Ġ https l ation Ġor der c ache te ger Ġde vice Descri ption B o st ack lu gin da y se nd IC ENSE us h ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ Ġun i ann ot f ul ad j ĠĠĠĠĠĠĠĠ ĠĠĠĠ 01 01 Ġenum erate Ġtyp ing pre d object s ri ver un k Ġfil ter Ġspeci fic v ariable Ġrequest s n ext ĠT O Ġsh ape F orm Res ponse ver se im um ĠM ib a ke Ġmodel s i um fir st view s de v k er ] [' L e el se Ġe val at s UL T le an O L o ver C lass Ġ> >> ro le vis ion co ding ******** ******** In put P P t ree Ġin iti Ġbuil d ed ge Ġa b Ġs upp Ġm ath ĠY ou 5 8 or es for e pt s St ate AR T Ġin stance ĠW IT Ġf ield w er ile d ðŁ ij c lasses ac cess tri but p r S er g r and as ex ists Ġ1 2 di st ai lable Con t le arn 7 8 O P O ut Ġset tings ĠT est man ager Re g re q . ", c ase Ð ¸ Ġ local . , Ġs ign LL LL ã Ĥ Ġde st " \ Ġ1 6 Ġlo ss DI R Ġ .. (" \ p ol ĠN o bo se ESC RIPT str u Ġb in Ġwe ight Ġb ot j ob Ġa wait ch ange U ser Ġm an Ġe ither et ch feat ures s ystem ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠ li m 5 9 Ġex pre ') . PAT H en ces id get âĢ į ra ise Ġpar se Ġro ot XXXX XXXX up er se q Ġp ort Ġal low Ġarg parse S S ator s Ġhe ad que ue Ġl anguage ĠD e IT Y p en s w Ġpro ject C A st yle Ġset up Ġex ec spe c 5 3 s i Vi ew Re als ti cle r ule li ance Ġfor m s or de lta Ġ2 00 he ight g ithub Ġlen gth it or Ġ lib Ġf ollow lat form Ġde p čĊ ĉ Ex ception å ı 6 8 AT ION ĠR es set Status ĠWARRANT IES "] . ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠ Ġst atus Ġext ra T Y co der Ġb u net work T rans stat ic ab s ĠG ener OR T p ache IN D op tion Ġmat plotlib C E qu i Ġpar ameters ã ĥ ct x con nect Ġg lobal per im n umpy Ġa v weight s L icense at er Ac cess Ġdire ctory ç ļ xf f y m Ġlabel s p ackage Ġp age ser vice T h oun ter p b __ ': et we Ġse ssion In dex par ms i a auth or Ġst d ac c x x par ameters Ġseri alized Ġ' -- Ġ2 0 Ġw idth çļ Ħ Ġne ed ĠPy thon etwe en A t P L p ack Ġb lock Ġla mbda K E Ġpar ameter l ate in ser rit er = _ f s i an ord in un it ( _ M an Ġch ange en cy Ġob tain 5 2 et s end s Ġ" / ce ll sche ma ĠU ser O f pos ition Q U AT E ers on s q I f 6 2 U p an k lu ster W AR ĠC reate Ġfeat ures ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠ Ċ ĠĠĠĠĠĠ n ap ext ension ) [ Ġm sg column s Ċ ĠĠ Ñ Ĥ ) ; Ġh ere S h re move Ġ2 55 op t Ġy our Ġre nder ub lic G H x ml Ġ1 1 Ġc ase Ġex ist Ġt itle pre sent b a pre fix Ġa bs I mage at ure ex ception pp ing atter n ok en license s f ra ĊĊ ĊĊ I nt iz ation I P um i xe c d ot ĠS o ESCRIPT OR li p di sp ver y Ġdo es : ] AG E Ġt mp 4 9 R ES p u ra di Ġw as olu me bo ok Ñ Ģ Ġp ackage Ġma p ĠP ath HO UT wor ds D B Ġ3 00 UR L he ader D ef Ġt uple Ġm ask 01 00 01 2 Ġg raph xa f In fo -------------------------------- -------------------------------- en e Ġ" . L oc inter nal B U + ' par t ar ds ex ample Ġme tri E M Ġt er Ġ2 02 de code S C ti c Ġm ore log ging s u g ument ĠV ersion ĠA pache Ġs orted ĠS et P RO ab el Con text о Ð s im Ġ" " Ġ" \ to m 2 02 con ds Ġoff set Ġ -------- Ġf i } \ vi ces Ġor ig 6 3 Re quest Ġop tim T his ĠW e st ream Ġ1 5 pass word âĸ Ī Ġser ver se ed bin ary tail s C C In ter Ġg l Ġf ont ul umi sample s ser v ĠG et op s * ( pe line le cted ymb ol 7 2 ĠWIT HOUT con trib pe c fi elds clu ster de lete ĠA ll } ") A A a ded I O Ġth en node s as ure n a ist ory ac y 3 00 : \ ĠI D ( * sh ot w d perim ent D IT k ens do main it ch A SE å Ī N ot __ ) ext ra Ġt ask C K me d set up in ed C reate Ġm y re sp pro t 4 1 i as Ġ" __ B ase Ġt ri me tadata ver b Ġcont ent Ġdoc ument Ġlin es T x Ġs im Ġex ample Ġk wargs Ġp h Ġa pi Log ger Ġs a h andler ro ss Ġle vel H andler g it Ġnet work f la AP I t orch Ġj nxMbgSgw m c Ġg rid A Y xf e u de Ġcon st input s Ġle ft Ġuti ls f ont en u '] [ ĠK IND ar s A l re ed ") ; Ġse nt D ESCRIPTOR ma ke y ear Ġ' ' exec ute âĶ Ģ Ġen v g g Q u aliz er au se vide o ke ep = - Ġs ame B y du ce O ption Ġpar ms ĠF or Ġhe ight Ġid x ################################ ################################ Ġtrain ing w indow f p g round Ġse arch Ġtrans form Ġ entry am ma 100 0 de c Ġs rc Q L C lient ' \ Ġsc ri 6 9 pe ct m od Ġw rite A pp in k ul ar : ` me di Ð ½ Ġp andas on ents able d d t " { Z E bo ol Ġfollow ing T E iti ve Ġwith out G tp " }, % ( (' \ Ġwh ere ex cept ad min Ġo per Ġ' \ Ġs u Ġso me Ġ" -- Ġd own as ic f ull R x li ce h as xf b L ICENSE st op di ff tribut es ĊĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠ = [' 25 6 er a b ody Ġgo ver set s is ion ultip le F a ĠC h ay load p atch le ctions am l ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ image s ĠN OT Ġapp lic Ġimp lied s leep u ff reg ister r ary ĠM ed Ġsh ow head ers n own Ġm ark op tim ci es ĠLicense d ĠMib Table sc al Ġmat rix oth er a a te x Ġpermission s by tes Ġcon vert A d ra p ĠI mage ho me Ñ ģ data base v en P y in st ï¼ Į ĠA ny test s Ġme an res ource Ġ3 70 Ġargument s set Description add ing Ġhe ader la ck s ing ") . a z per ties l an he d ap ache w ise or ig Ġ[ [ ĠT h che ma ': ' Ġc sv Ġra w F or h ash TY PE čĊ čĊĠĠĠĠĠĠĠ Ġv is ä º xe f tra ck ĠT ype ul ation ĠS im xf c are d p g S ize load er di v xf a '] : xb c user name me ta cle an ĠD ict ' }, à © er o ge st s ort č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ ĊĠĠĠ de s ĠSo ftware ur ls S p ce l dire ctory Ġunit test Ġwrit ing set Max Ġm ock Ġin formation Ġm on Ġn on vid er Ġoption al p air ta gs cul ate s m Ġin fo Ġh ost ne ss KE Y . \ li sh Gtp V Ġ loc Ġc lo Ġed ge ## # w in Ġp i ta x dir name Data Frame / { i tions he lp CO L setMax Access se lect Ġmo di Ġ ): Ġre f igh b c ls æ ķ b est le s Ġsub process F L tr an s in on es po ol ĠL o ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠ feat ure AB LE v m cu da a ys Ġname s b it g y i str he l P R Ġa fter ĠD ef ĠM e scri pt G roup x ed Ġre t __ ": if t _ { ac tive F O in es ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ v es ĠD E en code Ġfi elds or ds Ġin clude __ __ step s e e d rop Ġch annel Ġapplic able V E ä » ar r Ġa ct Ġexpre ss a ctions resh ape Ġ ge and ard bu tion N et P re D S Ġdata base rep ort read y Ġpo st P U c ry i ent G R we b Ġb etween sq rt à § ion s Ġth an ] ]) ock et tiv ity + + ---- --- V ER Ġf in c ast ol ute l r m ath al id Ġgener ate S ub ĠA PI xc f aliz ation Ġr and xd f Res ult } " r at metri cs s ide ele ment Ġ< / FA ULT Ġme m M L u int Ġcomp liance )) . xb e AS IS Ġ $ ĠAr gs DIT IONS co mple Ġla w doc s Ġbo x x ce go ogle row s s ql A uth S ER il y s ig a f d m d at LO G g ress off set d type DAT A Ġsc ore Ġ Z adj ective , ' Ġtensor flow g or ra m N O Ġj ob ĠB ASIS G ener Ġth ere ĠB ase Ġ5 0 Ġp arent Ġ // ĠCON DITIONS ĠE n i fier Ġc li Ġth read U P n on Ġ ì r s Ġno ti Ġsk learn Ġgover ning 6 1 Ġc fg read only xd b ĠMed ium (' / æ ľ W S in dices Ġc md vi ous IC s upp er to col d jango di tions Ġs ql di o xb f P os coun ts li ght f in ER R g b Ġt wo idd en G B A LL iz ed En try Ġc ell () ). Ġag reed Ġc luster u x qui res GH T start s se ction Ġre move xe b čĊ čĊč cur acy { " xa e Ġsp lit Ġpoint s Ġin it con tain > \ ti ty g lobal à £ Ġ ans TH ER ge d IN E al pha Ġv ar ĠM an CT ION e qual ra pper Ġlimit ations F P le g train ing Ġz ip stat s : % Ġpar t - % } . he x Ġb est 00000000 00000000 ĠS tr ĠS O mplement ed D is n b c an am era ] + N E z ip on s ra in T ensor Ġd ir ab ility Ġscri pt e lif t t Ġc ho R un ran k h a M E ol ve Ġdi ctionary se n ĊĊ ĉĉ re al C heck e mbed x de Ġcolumn s i mple ĠF ile time stamp ĠPar ameters P ort U D pre dict IL ITY gra d fa ctor p x FI LE fi ll ] ): Ġ1 90 Ġw indow H e Ġe poch EN D Ġte mplate lay out o id ĠA dd c fg g t in clude di stance us ers Re turn enti al Ġ{} ". ĠMibTable Column T oken s upp xf d ow er ci p AC K Ġp ack R L ã o R ule ĠTO DO Q t Ġpos ition å ħ Ġj o eri es Ġ' % Ġk ernel 5 1 an y ĠUn less cent er inser t pri ce âĶĢ âĶĢ b ound re cord th reshold Ġpar ti lo y vi ded en gine Ġ6 6 d raw al og Ġco mple op er ĠC al end ing Ġ" - u uid Ġ1 3 Ġ1 4 ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠ sum mary Ġse e Ġal pha Con straint Ġhead ers ) \ ĠR el ac count ys is T e m ount te ms idd le load s gor ith á ĥ Ġn n get Logger der r 1 0000 Ġi gn ur i ĊĊ ĊĠĠĠĠĠĠĠ tra ct Ġst at path s U B Po int SI ZE b r F unction s d Ġ layer ĠAN D ĠC heck OR M Ġex it . ', c ut Ġg ame Ġtest s Ġcol lections / ' re l ĠĠĠĠĠĠĠĠ Ġ L ib Ġstr uct disp lay Ġ[ ], Ar gument di ction im al xc b cp u Ġi ts ra ys WAR E h er Ġp ick Ġele ment G S en gth Ġy ield v ate ro t ' } M ode Ġ license ĠĠĠĠĠĠĠĠ ĠĠĠ tran sp ĠA pp ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠ Ġme ta starts with var s V AL f lag Ġt ree è ¯ Ġn ow Ġauth or ext end 25 5 Ġc ustom Ġde te RO M Ġimage s P er ign ment Col or O r (" -- xb d x ad co ls e ff x el 00 11 Ġs w xc c zer o . " e ed yn tax d x Ġspe c ; \ . * Ġ vi app ing G ET c m à ¡ Ġfla sk P e xb a al le xc d Ġinst all E vent TT P ra d I tem ve c log in ĠK ey metri c G I Ġc tx c ard xe a b ers (' - ĠL e tiv ation Ġspeci fied nap shot e k ci al sub plot ĠCon fig ve lo Ġver bose L abel Ġs ci Ġre sp Ġlin k âĸĪ âĸĪ de st ĠCo mp Ġ-------- -- Ġst ri Ġse nd process ing pos it x ab Ġdist ance id entifier Ġ( ( dire ct dump s i mp Ġb lob , " ch ild L ine Ġsc ale a pt W e Ġm er Ġ1 8 Ġreturn s M S xd d ateg or 7 1 f alse u ation Ġc ache int e as on h and Ġbe fore " } t tp å IJ ce iv Ġfunction s C ode | \ dep th D ate P UT S ON xb b v ing ti l oc ab Ġav ailable ix el Lo ad č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ c f le x call back m m ad o ast ype N A yn am 11 0 ser ved c ap Ġs ingle c ision app lication ] [" ar m Ġo pt Ġconfig uration Ar ray th read Re f um my Ġadd ress Ġpass word ĠUn ion Ġfeat ure se quence Ġf unc ma g Ġme tadata æķ ° mo te ut ton Ġre st la p id a di ms pro b xe e group s Ġse cond ble m Ġpar am arn ings C I ri es Ġst op S im . / co s ĠC ol Ġp e ĠR un roll er st orage in ation Ġlo op F il o o Ċĉĉĉĉ ĉ ' { O UT ã Ģ Ġ err Ġpro vided M at Ġ" ) Ġl ong ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠ St art Ġwe b AB ILITY mo ck ern al Ġ location xd a it ude Ġe st ĠF OR AS S ######## #### FT WARE B L Ġ3 0 li ke 10 8 Ġpro gram color s Ġ' _ : . M C j nxMbgSgw S D f c .. .. r l } ') ur face j e o te Ġre present p layer fi lt ta ct m ulti n one pre ssion comp ile b x doc ument Ġ4 0 Ġac cess Ġm c ERR OR i er coun ter W OR Ġh andle ug h Ġs uper po licy =[ ], C ount but ton ix ed li ties Ġin clu Pro cess s ingle Ġe mail Se ssion PO ST l ong ĠĠĠĠĠĠĠĠ ĠĠ v ers ĠP RO XX X ĠRel ation ĠN ot Ġc pp , \ con nection se c : ", ĠT ime py plot N N d river Ġat tr i fication bo ve ser i ĠO r å ¤ av g h x Ġg en ĠI mport c la m k Ġs uccess Ġo ld pro file ordin ates Po inter Ġ[ - Ġst yle ran ch ! ! end er mo di EX T ch ain ari es raise s c d re qu ĠD T Ġbe en an el ĠP o âĢį ðŁij P ri ma ster ath er xd c com mit $ \ l ing () )) FI G Ġcontain s di ctions sche d ĠC om ut es ST R Ġdif fer ĠT e ĠSO FTWARE norm al + " co st C D re ssion re nder h andle Ġ vector Ġinput s A ll x ac re t Bo x n an are a Ġli ke w s al y а Ð o ci Ġf inal Ġe mpty B O Ġp ub Ġdim ension Ġ" % Ġa bove al ance ut er to ur Ġright s Ġst ream T EST w ay Ġs m wh ere lo op p ad c er p lugin ĠL og 1111 11 Ġen coding S o m ing r al Ġsci py d r } ' Ġ keep Ċĉĉĉĉ ĉĉ v ari Ġallow ed AG S frame work IM E M o -------- ---- ta ck p ub l on re set O n Com mand Ġs ystem Ġtype s å ® Ġc ls Value s error s ~~~~ ~~~~ se g to kens Ġchar act a uto bu ffer Ġtra ck Out put stru ction r m bu il Ġdis play Ġkey s Ġal ready S c in ition viron ment = \ E qual ter m Ġcon n OR S ĠL I xa a L ay c ustom Ġ% ( xa mple nd array inter val / ( s ite A CT Ġ views lu x ĠUn it q a Ġre cord Ġ6 0 Ġbin ary exception s std out di stri ol y par ti Man ager "] [ Field Descriptor stra ct N orm R o ge x o uld output s spe ct ro ugh ĠM odel ĠE X Ġp layer ä ½ in f Ġin d time out 100 11 r b ĠH ttp æ ĸ () [ Ġcomp ute E d Le vel ç Ķ sp ath Ġch ild e mpty rid ge cli ck ceiv ed C RE t c t uple Ġpick le posit ory t k 99 02 lo aded ĠN ame UT H BU G he ther ta ch Ġcon f Ġsc al y label ar ange ro py Ġser vice Ġiniti al ss ible Ġweight s T P Ġcon nection enti c Ġw ait ne g ] ], pro p е Ð Ġcreate d IM IT è ¿ ĠC ounter j s u tion U RE Ġb l Ġj s Ġnode s so le Ġ" _ M ap )/ ( ` . Ġt x A IN th is con cat ome try gener ate gorith m s uccess en ded ul er Ġe mbed Ġg lob IN FO z one Ġm ulti DE FAULT S V Ġ ---------------------------------------------------------------- cur ity M M M et O K Ġ{} '. w riter fa il æ ĺ am ily sc ores event s G L B e D o ^ \ ub e static method Ġex ception E le à ¤ mp t Ġthe m T ag Ġ html Ġw ant fla gs s ers er as ker as variable s ens ity Res ource time s Ġal so Ġign ore ( [' O per Ġres ource Ġvariable s S pec P S y per G G Ġp ad Ġdo main f name v ol xc a Ġf older { ' Ġy ear x F Ġmo ve u sed Ġ1 000 bu cket p attern Ġ_ , ĠSim Type ? \ f lat Ġt rue I s J o Ġp adding IC E Ġbase d Ġpro duct ag ent $ ', U E ĠU RL O S Ġoutput s dition al ti cal po se ({ " iss ue clo ud _ \ q dm or ed to ol x label ĠA c Ġobject s in ary ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠ Ġuni que sk ip D R ol ver 100 1 comp onents uff le f etch cre t Ġa ut un its mon th Ġorig inal ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠ (" - sh ip 12 8 P ORT Ġ2 6 re quired ĠI t Ġlo ok an e Ġc ard Ġby tes Ġne g C ore D F E xt v s in ner Ġro t qu are pro duct valid ate Ġsupp ort â ķ com m Option s E nd en ch Ġj ust ` \ th ing Ġpy game F ound l ang á » Ġdis able D ir F R L C sh ort ĠN um sub type reg ion er ature Ġd raw ĠA uth edge s node type Ġabs olute Me thod ( ** E num Ġr ule ĠF ROM filt ers P h Ġmetri cs F ORM Ġs chema Ġas ync Ġtag s add r man tic Ġg r Ġcor rect c r ĠDef ault Ġ' ../ fig ure ĠT o de te ĠL anguage z y is hed ĠO THER S H Ġi tems 00 01 iss ing Ġ[ ( Ġ3 2 g h ent ries Ġre port ex periment uni que tick s g re Ġc ore ĠQ t Ġp air con vert G E Ġ' ) ti le ex pected "] : module s al ysis ss ue (" % Ġde l comp at Ġs ig lat ive = [" V alid c ategory h at ĠA t H ER b n 11 5 T otal / " P AR p latform Ġde tails bu f p df LE CT se conds k nown Ġc ms om an Ġpre dict Ġ view 03 3 C ase ] \ Ġde lete app ly resp on t ab col lection iz es Ġpre fix CON FIG Ġh igh > < Ġd on I R Ġ ------- ĠT uple eri al Pro tocol Ġsh util Ġreg ion T ree W indow u ate line ar âĶ Į S O ces sed my func Ċ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ g a est im Ġsk ip f fix name d cor ds Ġnoti ce Ġhas h state s M in Ġcon nect valid ation s ocket čĊ Ġ B utton : , A V T ER re st Ġt r he s is h Ġse quence Ġhas attr Ser ver il ar Ġurl lib A n Ġ- = Ġgener ated Ġreg ister V ID Ġs he tra ce Ġreturn ed ĠU p p us Ġex ists US ER x s ist ri Ġerror s Ch ar D i g pu Ġo w Ġde bug du ction ={ ' m u al low ic ro est ed Str uct am ount Ġtime out no ti : - Ġ ve se mantic al o ateg y up lic rat io Ġe very ĠB o Lo ader Ġ## # r ation ro po 01 0 Ġrun ning Ġro le Ġcom mon dep end ! \ a ut Ġp ixel ma c cur sor Qu ery Ġcli ck à ® val s ub le I p T ask Ġcon ditions 0000 0 test ing mem ory Ġf un Ġget attr / ', ĠA l quest ion k ernel 99 99 au ss D X st ers [: - Ġdiffer ent v a { \ Ġs in fi ci h our à ° Pro gram train ed Ġac count f inal é Ģ Ġa st fi d h ist Ġp erson Ġpre vious MO DE E E G N S ource l int AC E p ulumi v olume Ġp ulumi Ġd at Ġse lected Ġf ra Ġr ate ob s per i Ser vice e ded co me Ġrow s e ad se cond i i Ġac c mem ber Ġs ort H el Ġt qdm cho ice h istory Ġpo ol Ġso cket ì Ŀ Ġc ap ĠO b comp onent Ġf it f l ock er Ġcommand s Add ress al k Ġc lasses Ġh ow Argument Parser G raph _ , f r Ġ1 80 sc reen C HE Ġre q Ġre place ele ct Ġmetri c iddle ware C ur Ġpro b Ġoptim izer or k ti ces ist ic Ġv ari di a Ġass ign Ġ' ', ĠP re assert Equal l anguage ĠS h Ġan not L ength Ġf ail __ , ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠ Ġus ers Ġevent s leg end Ġde lta ĠW oman ' + * \ p a Ġc ir 12 5 package s Ġst ack Ġcomp onent ns or o lean Ġ queue Ġb ound Ġf ast ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Se arch Ġcopy right Ġ: , ched ule rule s W N u me ĠP er ynam ic Ġfa ctor å Ĭ channel s Ġd t Ġb ody Ġ202 0 9902 84 ter min Ġse ction b i æ Ī Ġc t Ġat tribute b its Ġre verse Ġ1 7 ( [" ) + ĠStr ing im er com ment atter ns ä¸ Ģ down load rand int g an å Ń Po licy Ġuni code m ut Data set requ ency ex c ari o DE BUG cont rol Ġwor ds ire d ) ** v v ], [ pro perties PO INT å ° che my Ġt k at ches fo o [ \ h s } '. Ġvalid ation log y ĠP lot sum er ) ]) } ". me sh p ayload w ays de tails k ed ri ft Ġk eras ) } B ASE Ġ' { Ġf ree Ġin dices Ġst ore f req is ode ) ', Con v Ġag ent velo p M odule Y X te ch ver bose Ġvalid ate = % W idget d uration Ġro und st age Ġin dic Ġun its 96 27 ro s Ġthe se D own V ar le ar ran sp R ow b ind è ¡ Ġa verage ĠA d re ference istr y b b ĠF unction Ġpath lib L A at om Ġmessage s initi al ropo ut p id Ġi p cle ar alle l M B V ersion Ġc lean op ts mb ers Ġre served l and it ed g amma y aml ĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠ M IN and id ĉĉ ĉĉ ĠO ut we et p d t n ST AT sign ed MA X v as Ã Ń el ls ap ter ci o ĠR E âĶĮ âĶĮ k g Ġa mount IT E C al Ġ' + Ġp as ri c : ', Ġ ë Ġpre d ik i ĠĠĠĠĠĠĠĠ ĠĠĠĠĠ Ġf lag AN D Ġcur sor const ants ) - O ff S P De vice epoch s + \ V ENT b eta bl ue c ar z z "" ", res ources 02 5 {} '. OL D C R db p Ġfa iled supp ort ' ^ / \ j pg Ġ{ }, b asic Ġ ĊĠĠĠĠĠĠĠĠĠĠĠ urn al Ġ2 5 Ġth rough ĠE rror Ġsp ace æĺ ¯ S cri @ \ un ch ĠS er ab spath Ġsample s for ce ir d ST ART Tra in M ENT le ctor ĠA n Ġse lect G EN le v Ġp op Ġname space Ġtra ce ĠIn put s ync Ġc oun exp and Ġre al _ % Ġre ference Ġcor respon m enu s orted en cies st derr co ords Ġl at ĠIn c back end Ġass oci I Z b ed ser ies pi peline < < H as Ñ ĥ Ġc l comp ute Ġse conds / % Ġ201 9 ({ ' Ġfont size Ġthe y St ream message s O B p ublic Ġm od ax es T C ĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠ Ġp latform en um D oc Ġ" + // // Ġpo licy ab c Ġra di 011 011 re lu ĊĠĠĠĠĠĠĠĠ ĊĠĠĠ 92 5 84 0 Par ams gener ator **************** **************** O p c ause Ġal ign ad s In valid w arning Ġ sel Ġse q or iz 00 2 dataset s O ver mo ved Ġad ded Ġ2 60 Ġno qa form s Ġin teger Ġd one ) ') U SE Ġde c s ses Ġd ay 11111111 11111111 Id entifier lo ur ĠIn teger & \ B lock cor rect Ġuti l Ġsign al a fter Ġgo ogle st ock so ft Ġs av Ġcon s Ġ arch ot o wh ite sign al co ver ĠM IT Ġen tity save fig d uc ma pping eri od h igh Ġdef ined ure d box es ĊĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠ Ġextra ct } / in ds g ree l ers Ġt ick ight s N UM enti als check point N ew Ġ video Ġo ur Ġm ultiple Ġthe ir < \ it es Ġa uto ĠT rans ç ão s ymbol Ġm ig Q ue g u Ġse c R ange p la at tribute Ġ1 20 ac ity Ġmer ge F rom b lack Up date n i Ġp lace Ġax es Ġ XXXX re quires fa ct frame s M sg de sc Ġf ill ect or P RE s ym qu anti RI GHT ud ent Ġ' # Ġf p e v Ob j modi fied peri od B r b us w ards at ic B inary Ð » Ġi o Ġf eed () ] ĠL O pi ck Ġdif f Fil ter ï ¸ ) ( j a Ġcon v fe ed ( "" e q av a Ġcal culate U U s lice re a CON T Cont rol id er (" / Ġbe cause 92 18 fa ctory 990284 09 read er Ġsum mary Ġact ual pre v {} ". Ġuser name ART IC ï¸ ı u la Ġc enter j ust Ġ æ Ġc m 00 4 Ġre l Ġpro p ! ") Ġd a Pe er ] - o ols ĠS ub ~ \ å Ľ bo ot j or s r Ġ2 4 Ġse ed ut or as ync ron t N U S L al f pro xy 12 6 ho ok Ġpre v V ERS ex pression ĠD is Ġdep th P Y Ġl ang Ġh and lit er Ġ} ) bot tom Ġ1 9 čĊ ĠĠĠĠ 02 2 ele te Ġapp ro T IME 1111 1 ĠQ u âĸ ij Ġab out D ire CL UD 99028409 012 ĠN O 06 57 Z YX ul ate Ġth reshold mpl ing å º ĠL oc ymb ols J E M ET R ed ĠF la py test 99028409012 25 4 012 Ġi prot 12 3 4 04 G O Ġ" { 12 7 s n v ocab gra de Ġclo se I SE M T AT A Ġsh ort C S ĠO pen ie ce CLUD ING ĠO n Ġnum bers mpl ates wh ile ZYX EL e a Ġin ser di git par ameter ir s s uper Ġw arnings ch unk FI L ighb or g al Ġp atch Ġstd out m ar ĠR ed Ġ201 8 G T I F t w il er con n ĠI P S U Ġ ? S QL re po Re ad da ys Ġch unk h idden ch ine Ġfor ce end or 8 90 Ġ um end ar Ġx ml ĠW h Ġtime stamp Class ifier 202 0 ĠHttp Response S cal ul ator ag g Ġcont rol ... ") 5 00 Ġb it ab i lu g Ġpy lint Ġle t M AP i ces In teger G ui g lob Ġc ategory mo st av ailable Ġdown load Ġp r Ġupdate d Ġmon th ma ss ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠ res sed Ġse par ak es auss ian sh ift Ġmodi fy f ast Ġf ace pi xel ĠIn ter C M Ġ Ċ per cent čĊĉĉ ĉ f un ç » al th ĠU se b all âĢį â re ward cur s Ġ202 1 f time OT A 0657 840 m is } : Ġ low Ġf n Ġs ide pro vider Ġ< < pk g create d Ġag ain s lot Ġst ats N C W ith p n Ġre direct const ant inst all I mplemented N B ]) . Ġdistri bution Ġw hether B u Ġ lower ĠT ensor Ġpar sed d ash Ġdi vision D U E G St ats Ġwor ld ĠNum ber s napshot (' % Def ault P ER 02 4 module Name p are w t Ġsub ject c b å ĩ Con st Ġcol lection Ġpo ssible Ġad min Ġinter face u ally task s } ', Ġ: ] ase s fer ences Ġ XXXXXXXX Ġpath s 9218 108 Ġre ceived Ġbe gin Program ming 9627 75 à ³ Ġs imple ut ed Ġ2 20 HER E i ma Ġc op Ġo prot Ġz ero Ġter ms ĠLo ad f d Ä ± ur ing Ġmethod s Cont ent æ Ĺ Ġ angle Ġin te ĠD o Ġ6 4 jo int . ' å į al g ĠE N mpl er S A å ľ target s Ġcall back M em å ¼ ar ge RO OT Ġc re Ġare a Pro perty mi ss Ġcal led Ġest im ( (" E C L ight w b å ¾ Ġd s ĠT H Ġapp ly uni form Ġdocument ation B ack S a Ġw in Ġexist ing n ull Ġp lugin ĠA R Ġen vironment AG ES 1 92 ist ics ĠF ield Ġde sc - \ or n Ġs ure ') [ Ġu uid SE T Ġmo st Ġc ut I ST Y ou g ger Ġ layers Ġg ra cl one si mple D et V er g l ([ [ sched ule > = Ġv olume Ġpro perty exp ort cre d ked irs S um Ġ mp Ġback end A UTH at tributes the ta ro id 00 5 di vid Ġ[ (' log s Ġac tive Ele ment u dio ro ute Ġto kens -------------------------------- ---------------- function s Ġjo in G o Ø § se lected Ġde v Ġco ordinates RE CT Ġassoci ated re lation ac curacy ticle s é ĩ al t co gn RE AD ĠRe quest contain er Lay er P H [ ... ser vices ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠ w rap te p bin s no te spe ci Ġn b as is ĠRelation Field ĠOr der B UT vo id N ING ol ds ĠD jango Ġwh at Ġac tivation u ch ĠL IMIT ĠH TTP Ġper form Ġcolor s cel ls 1 99 V ariable fi ers ĠI MP yn cio E O O pen o v Ġc at Ġm issing ä¸ ª optim izer Ġthread ing Ġc ounter AR Y je ction > Ġ' {} Return s ategor ies Ġp ayload Ġmax imum ³ ółģ ign ore top ic Ġ" < M AN d ings () ): \ "\ re lease Ġwith in Ġpackage s inte ger c rit re duce Ġw ho ĠC O all back Ġele ments OP Y ] } b and cur r N S O ne e ve con tour Ġr ank im show let ed No ti Ġsupp orted y cle Ġat tributes ĠRe g Po ol Implemented Error ( ? A s B R sh a radi us FL AGS transp ose F LO or ity ct ools ======== ==== sa fe SE LECT Ġs leep ma kedirs eat ure DE F G e M on Ġi mplement ĠC OPY Ġpar a ĠG o ator y aw s ) " k w DAT E Loc al O PT for ward proto buf D D [ ( Ġp a ad ded wor ld ends with Ed it quee ze # \ d c d y Ġa p Py thon Ġpas sed S FP ut able ĠM y rep r Ġmem ory Ġ' ') 0000 000 Ċĉ Ċ cli p char ge scal ar T op Ġp ower lo ok ) ", comple te 4 00 Ġt ile radi ent P i r r Ġex c ty p Ġac cept Ġexec ute B ar r ations Ġd river ĠS T Ġg amma row ser serv ation cry pt en coding ĠL ICENSE au dio Ġinst ead struct ure she et W E h i r f Ġne eded PO SE A nd C ategory V als a o in valid re c se gment de l Ġb oth Ġfla gs çĶ ¨ hex rays ench mark fa ces è ® ur al mo oth loc ity pl an range s LI ED G rid Ġtime s % \ ] = g reen sc atter Ġ> > asure ment VERS ION L S k es Comp onent unit test N ESS a ces h ot JE CT B B D A in v Ġgroup s 9 16 D IS dir s Ġbot tom s ame ar ti name space Ġco st sub ject p atterns Ñ Į Ġp attern work ers b ig f lo di g ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġy aml UL AR dim ension > ', T A c amera Ġse gment '] )) Ċĉĉ Ċĉ DE V CO MP block s Ġstep s Ġin valid end point if est Ġman y fid ence P age en ate per mission ak er ĠGener ated duc er T RI ul lable Ġar r f lux Ġ 90 B atch a ctor á º se p Ġconst ants b alance d l pol y Fa ctory } } om ent ĠJ SON ={ " Ġback ground ĠFla sk li er HO ST R U c ert f old ro uter Ġde s OR E A ction ĠE xt base name late st ordin ate 6 00 K EN c wd Ġ201 7 entic ation ĠOb ject : " S ystem as array A g ci pe N OT g z Ġapp lication hel lo ro ad as ci ĠM o bu tions pri vate > , Ġs cope ĠB UT d ense Ġc ent Ġe ps ER CH lib rary lin ks Trans form f ound ext ernal internal Type % % m ul help ers FORM AT ERCH ANT ad a ri de app s Ġpro vide ################################ ################ UR POSE ĠCol umn b ute me s di sk get ter Ġ2 2 ĠD es Ġno te Ġexpre ssion ) ' R Y Ġm s us ion Ġ) . 201 9 P C Ġf low Ġ1 28 201 8 Ġpi peline Ġmeta var Ġp l co ur Ġwrit er ____ ____ s y Ġ )) al an par ts 10 1111 mk dir un e '] ] g ray de tail ĠF IT Ġpre dictions Ġiter tools Ġcom mit H TTP s queeze ĠP ublic lev ant Ġc annot for med 17 85 Ġle arning S eri li she age ment 01 011 pro c Ġind ent ERCHANT ABILITY D ist F irst S N m ultiple sp y Ġv m Ġbu f Ġcharact er d ummy Ġ ]) Ġf etch 00 6 et te Form at str ument ĠL ight ĠO UT ep s ä ¿ Ġc lear Ġd rop te am Ġl on ĠD AM lic it T arget æ į Ġh andler by te LLLL LLLL Ġfun ctools f ree h ic se lection ĠC lass 10 11111111 OR Y Ġlist ener og ram Ġ8 0 CHE CK ^ ^ al led ce i so me ĠType Error O M s ources er gy ss l di sc ĠT ext ĠP URPOSE ĠD i ac ing RE QU ed it ĠI ter scri ption Ġmodule s ĠÐ ¿ Ġlib rary Ġ26 36 er m it ter to list I A P ass w idget 01 0000 ten tion flat ten M ix ĠS ystem time Error ON E In stance Ġhe l gen e medi a C V at ient ch or Ġ2 30 ff ect inser tion Ġshe ll * . N e t age Ġs chedule sel ine ---- - Ġb eta Ġl r sc an ĠP ARTIC Ġex periment 88 8 Ġextension s ĠIMP LIED Ġi mplemented Ġc ar Ġsu ch ĠLIMIT ED 2 05 re verse Ġby te ĠPARTIC ULAR W h Ġh ist Ġas yncio Ġv ol ib ility WOR D ort h Ġn ested Ġnorm al Net work K e at ial Ġcontain er Ġother wise ĠCal lable Ġi ssue Ġ( _ ĊĊ ĊĊĠĠĠ ółĢ ± ĠOut put U C Ġ ri '] ), Ġdata frame pre t argument s ĠNot ImplementedError d om p ast æ ł ĠM ERCHANTABILITY ĠN ode config uration Ġnorm alize orig in ãĢ Ĥ + = S k Ġp or Ġme ans limit er s yntax Ġto ol Re q Ġbu ffer Ġparti al _ ( c n í ķ Ġs olution ful ly at o Ġcur r d p } ", Ġm apping Ġe qual Ġ1 50 Ġex pect num er ä¸ į pair s a h m g pe at ĠS H ING S Enum Value liter als asci i 5 12 c ing } { } /{ re quire Ġre ward un ks __ . Ġl ater Ġinter val ĠPo int \ " t wo se mb Ġse g Ġid enti extra ct Ġans wer ar is Ġp eriod ĠN e clean er hand lers > " č ĊĠĠĠĠĠĠĠĠ set ter Ġcon tract ĠN ew LI ST Ġsent ence a j z en at io id entity h older Not Found EnumValue Descriptor . ) Ġb order as c Ġend point 9218108 1785 > . _ . g ate con straint Ġstr ings "> ", M ark Ġ( - ser ial Ġpro perties Ġpro blem plugin s B ACK V ector b d n py Ġt urn de lay Ġf ixed un der Ġw idget ma jor sp h =[ ] a verage Ġpos itive velop ment er ved par sed Ġdefault dict sub mit mark down CL ASS čĊčĊ čĊčĊ d h l c log its ef fici Th read Doc ument 0 11111111 f ri se nsor Ġd ot pro gram pre ss pre dictions ep isode ĠG roup AC C Ġad ditional Ġneg ative miss ing e ms Ġs yntax Ġ2 10 10 24 Ġma ster en abled Ġre po iti es [... , A X F ixed P N re at Ġs q ĠT ra pi e HE AD ĠSt art ï¼ ļ stru ctions C ell R mt Ġo c all close EN G AN G Ġsm all R ate Ġw ere ĠC or Ġsh uffle Pro file Ġper mit MODE L d q Ð ² Ġ 00 Ġc red Ġu pper Ġexec ution ĠRes ponse DX GI ä ¹ te l ĠE VENT char act ĠDe vice Ġsetup tools M ock Ġp print li s ĠPro ject ren cy andid ate H istory w all in i de ps {} . 2 16 u it Ġre stri un ic xt ure bu y Ġnum er clu sters MESS AGE " + u ses Ġf o pro cessed Ġpro gress pos itions Ġline ar E xec Ġ" ") Ġn x ent ropy riter ion Ġradi us dig its E crit Ġf alse fig size PR ESS D elete S urface g ui w i pro blem Ġ3 10 gener ic ĠPro cess Te mp g i Ġst ates Ġlist s trans late cry ption ĠCom mand S ample é Ļ ib ration U LL f fic 00 100 Ġn args ver ter out h buil t 9 17 B l C md F older c ity t l de vices (' _ )) ). Type s dep loy concat enate M D V al Ġ è 10 2 12 0 20 11 CO UNT 201 7 Ġver tex Ġtop ic seri alize Ġtrace back T S e th S ingle w arn y y di ffer ä¸ º A rea æ Ń ĠG e eff ect c ss r strip ê ° Ġp ol ĠM on fic ations Ġoper ation Fa iled S ign å ½ re mote an aly is o gra di cont ents 2 94 ot ype Ġx y ĠR ights do uble lan e ++ ++ h ip y l Ġnum s pos itive state ment vo te MA IN Ġdest ination 2 14 c enti g p Ġpri vate a res __ )) Ġ% . ho od ĠH OLD æľ ī 1 93 x is 00 3 ge ometry ĠL abel ĠD ate Ġedge s ĠMe ssage M ulti p adding s quare Ġf ix ĠR andom ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠ ðŁ ĩ Ġmin imum P lease P ASS V c W ork r type v l v endor y lim ç İ re cords en g um an con s con sole Ch ange h y al let ct sp ann er Ġbo ok transform s We b x lim Ġtemp file ĠTH IS E A T uple w ave pro mpt Ġ{} ) 33 33 function al ail s ĠRes erved xx xx subtype Spec M y Ġre quires ĠL ine ĠG NU Ġset ting Ġver ify neg ative lishe d Ecrit ure 2 000 D ER G D d en Ġe v ed Dict op le Ġstruct ure ółĢ° ółĢ L U N AM W riter ra g Ġ2 7 ĠO f ĠE nd Con tain LE D cont in ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠ Ġf c Ġtarget s Ġframe s CIS CO B A R A b c w rapper lo sses Ġg ene Ġ* = os ition arch ive stra p CD OTA 2 34 Ġ XXX Ġc ause Ġre lease ĠA nd 10 4 pre vious MP L Ġchange s V S W R i ed p tr æ ŀ en c di an Ġ2 56 Ġcon straint list s Ġpro mpt config s IC T Ġiniti alize s l Ġe ven ĠI s trans lation Ġwork ing è¡ Į STAT US C P M apping m n o logy en ario al i Ġc p Ġe qu con dition ap er Ġac tivity ĠIN CLUDING ategor ical ------------ -- ĠPROVID ED M ain t an z on æ Ŀ in cip Ġb r es h il la ĠC ode Ġme sh sub process back ground Ġcurrent ly Gener ator âĸij âĸij p erson st im ĠD et dic ator Ġ ~ str ings Ġv o ne ctions annot ation At tribute Ġter min B F d one Ġp ublic scri pts sche me ĠSt ate Ġepoch s A v O W y es in a Ġre main ad os Ġ2 8 ci r In struction L INE Ġf req Ġe s co ord MA IL Ġcho ices TRI BUT æį ® Ñ ĩ Ġp ut Ġ1 70 ĠM at ys ql ph i Ġob s {} / CO DE Ġchange d Ġinser t Journal Lib C F R S j i are st Ġcom m AS K Ġte am proto col Ro le Ġc amera ra ft Ecriture Lib ' " É Ļ Ġ entries an o et ter ver tex cont roller Test s ĠDE FAULT Ġd ump Ġno ise Ġstat ic om ial 22 4 Ġstart ing c pp ci rc Seri alizer I t or ph Ġc os Ġp t am b EN S cul ar Dire ctory B al w alk def ined ], " 01 000000 ĠB SD St at ĠSe quence Ġinter nal ~~~~~~~~ ~~~~~~~~ ! ') ( ', 9 15 L V ĠT oken Ġle ast CO MM ĠDAM AGES 87300 948 6 025 R C j ava k ind Ġs n ĠM ulti Ġpro xy org an aris on B I e mp Ġf lat ter n project s Ad min m iddleware ff ff Ġen able abi lities âĢįâ Ļ ) ") 2 18 er ance pro bs Ġen ti 09 6 cal c 200 6 host name Ġchannel s uplic ate ransp ort _ ) u ck Ġc ells li der sp arse class method Ġcal c Ġtk inter F ail P A Ġ ensure ĠP IL lin alg Ġsc an ĠWh en / < W H 15 0 Ġline width IS ING environ ment adj ust At tr Ġdimension s fl ush Ġ" $ Ġn a Ġre moved 16 4 Pro ducer 200 5 Ġmatch ing Ġeval uate case s u di Ġb s ĠB Y yst ems File s Ġ201 6 ĠEX PRESS 2 64 è ¦ in x te mplates res id our se Ġdefault s Po st Ġexp and Ġt ab Ġp kg ĠI d ex e mo ves Con f back ends CRE T le c Ġc map Ġp s Ġp la ph er ĠG L annot ations ä» ¶ lap sed Scal ar flo or P l å Į Ġc er res ses 12 34 read lines HE THER version s Ġinter pol äº º ient ation Piece Ref C an Ġre mote AT T Ġan aly comple x hour s M IT Ġt z Ġthe ta il ls port s Ġcomple x Ke ys T EXT ¡ ółģ el low Ġdef inition cess ary ise d Ġ@ @ A nal ti cs ce d Ġ2 40 16 3 ĠCON TRACT Ġneed s Ġrot ation G ER U rl \ ' ç ½ Ġs lice ĠD ATA uti ful trans action 201 0 pl us ĠLI ABLE E xecution W ISE or ary re pository Ġ' " IN PUT Ġres ources Ġco ords ĠData set F in F loat f x h ub Ġc dbp == " ver tices Ġpre cision fix ed Ġbuil t Ġbuil der ĠNo ti font size WOR K ĠSH ALL C opyright [ [ se e he m ing er Ġ: " Ġan alysis Ġro spy E xample U G me mbers Ġs ymbol Ġre ader Ġl ate ĠA s Set tings Ġdoc s Trans action medi an Be gin PAR AM C re T ri ue st Ġb ig ĠW HETHER Ġeval uation vari ance Ġpair s ĠAR ISING 2 06 d ocker p as æ İ Ġin ner Re ader Ġro bot Name d ref resh Ġad just ä¸ Ń Ġup load serv ations pub lish A ny ar c Ġp p 00 101 00 0101 Ġo pts Ġb asic Lo op Cur rent 2 08 b ri Ġf requency pe t 13 7 av ing go od tim er page s ĠWARRANT Y åľ ¨ d z ot er Ġpar ts quest ions ak age Ġgo od Ġwrit ten ched uler Rule Context Scri pt Ġimplement ation n ed ro zen Ġp lease ĠT ORT con ditions ist ant ĠI O ... ') åı ĸ 2 17 C N u k  ł se nder Ġe tc Ġb ranch 11 7 ĠSt atus 2 32 a e m q y g Ġm enu ĠO N Ġan other we ek Ġcomp onents Ġbot o FLO AT aise s 2 97 D Q re lative int s all en Ġ4 00 Ġal ong cy cle Ġar ti S ec s olution Ġto o Ġcomp are 56 7 ick ness XXXXXXXX XXXXXXXX parti tion : ], = "" D T Ġde limiter Re al pre ds mo ving ele m Y PE k m n r Ġm is app ro sh uffle Ġk now LO AD Constraint s ] ]: w arnings Ġd uring () ; Ġdef s ĠD O cu it оР² t b Ġc la Ġb n ĠM ax Ar g Ġconst ant ĠQt Gui 5 01 b ert g ri de t ĊĊ ĠĠĠĠĠ ĠS olution ĠP h Ġu ses ĠOTHER WISE 3 115 A I c ards ra se Ġ[ { Ġfor ward Ġma g 19 7 200 9 Result s B ER D ep M enu d og f amily p ush Ġm d str ategy Ġg re Ġde cor Ġor d Ġcol s ant ed Ġdis k LO CK 200 1 3 01 Y Y å Ĩ ë ĭ log ical ĠG raph fa ke Load Bal Sc ale ĠRed istri $ $ O EO pro ps ys ical Ġapp end Ġwor ks Ġexample s istr ation L ast w atch ', '. Ġs yn one y Ġh ref `` . Node s 1 32 Ġc lip qu ot 12 4 St op 200 7 Ġus age proto c b ranch d n t ot w ers Ġ XX Ġ" "], ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠ Ġv ocab ax y Ġper cent option al Ġmodi fied Que ue a ur à ¯ Ġre gex 11 4 11 8 -------- -- ĠP rint Ġout file 16 5 Ġle ss Ext ra curs ive ĠGo ogle g ers Ġp ur he el Ġ2 50 Ġg rad Ġde leted Ġpro tocol 13 3 we ep pi pe Ġli ght 9 06 ge o Ġde al ĠM odule loc ations Ġ-- - exec ution åĩ º Ġs ol Ġst ored pos al Ġscal ar alo ader look up , )) 0 32 b p h ang å İ Ġs y Ġe m AT TR com bin [: ] Sp ace Scri pts havi or B ot G en S Y Ġf e Ġs napshot Ġin side Re cord sh are plot s INT ER Ġtask s ier arch Ġannot ations ĠDes cri e mb re es Ġn s Ġm u add le Ġcont ents table s 101 0 æķ° æį® f mt de g Ġre d arg max 14 7 Ġiter ation change d sin h rot ation J ob S tep l f ur ations co ordinates Ġw rap Ġfor ms qu ote mat ches vel y 202 1 He ader S ymbol b order m en p in ¬ ółģ st it un ity 11 3 get env ense mb process or initi alizer и Ð Ġcoun ts ame tri ri o qu ential 14 6 ast er čĊč ĊĠĠĠĠĠĠĠĠĠĠĠ of s Ġtrans action last ic Ġprocess ing ĠLoc ation 9 05 m ultip ut ation IM AGE Ġman ager æĸ ĩ ("" ) ] ( c am c dbp s ur us age back ward instance s 201 5 ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ Ġblob s r p Ġ' )) get cwd vi e 16 7 AD DR PI PE ĠLe akage Ġchild ren Ġs ur ĠW ith contain s ĠSer vice ĠFL AGS C luster d id h w s qu } _{ set ting sp aces ver ts ire ct LE TE Ġext ernal be gin Ġgener ator >> > TR AIN æĪ IJ B ind Ġb ins ĠM in Ġ[" ", reg istry 66 66 dis able Ġtransform s ĠHOLD ERS D ig R M f lip Ġi r Ġd ays Ġcon dition qu ic read line ĠV AL By tes ĠAuth or 8 00 A K u ator Ġ Ñģ Ġ layout al ity ss h Ġ1 10 set Level Ġen ergy UT C ĠPy Qt C AR H ost S chema Ġf l ĠF amily em on Ġver tices cl us ĠPar ameter hic le F eature P art V M m icro s yn â ŀ Ġcon sole ĠM O format ter vent ory new s :: :: incip al W rapper z o ed u is dir ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ to day 13 6 19 8 Ġso up Se quence UR CE ãģ ® Gener ated oper ator cour se H W S tack b re Ġf id Ġ( % (' < (" [ Ġg round Ġg radient Ġse nsor scri be ĠIn valid fa cts Ġag g Le ft g m i os l ite s b à º ĠĠĠĠ ĊĠĠĠ se par Ġ{ : ac cept ph one comp are comp any 200 4 qual ity DI RECT sv g App lication Ġpack ets Ġaut omatic m itive in itions ri s ind ent find all Ġele m ĠWe b can vas speci fic A E C ache E val h d ur a Ġin spect set default ") ), Ġth ree 10 6 ID TH Ġarg v Test Case vo ice Ġchar ge äº Ĩ NE CTION issue s M iddleware en ium ro i (' [ ĠF ind config ure base d ([ ]) 200 2 ug gest Ġpri or ../ ../ RES ULT f b à ¼ Ġa udio Ġ1 024 (" < sc i Ġun til 13 4 Fa ctor tific ate h ar Ø ± re main (" . ĠS imple eri um Value Error extension s A b h n č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ def ine ĠC ur ĠP ri if f En coder ä¸ Ĭ abs olute EM ENT ĠAuth ors 2 07 2 03 l b con tract ĠS ave Ġres id IT S we ets dest ination , ( N ET ç ī Ġ4 5 In d AC HE Ex ist 200 3 200 8 uni code Ġblock s jnxMbgSgw PP road cast 2 95 D P Ġ= ================================================================ me t Ġf d 11 9 def inition ĠF il Ġth ose Ġ3 5 13 5 En v Ġstri de ĠOrder edDict Ġre duce Ġb ridge um en as y =' ', form ance key word Ġpro vider mo id Ġsh ift Pro p iv ers vis ible ĠWIT H jnxMbgSgw If ĠPer mission 2 99 f ollow w Vc st anti ro u Ġc ast 11 6 th resh Ġ\ " (). __ Col lection So up 3 15 V ideo l V st udent Ġm ac Ġse ss Ġma de per m ref lection re tri he st lo se Ġre c ĠC an Ġr atio ĠF I Ġ""" """, SE CRET Ġbo olean man y G RO H A e ver s urface Ù ħ ç ¬ 11 100 Ġw rong Ġ{ :. om erium ĠM ock In iti class ification Co uld go al pri me blob s ĠRelation ship 9 04 L P L AB al ert Ġc apt Ġre ct ver ify Ġh istory Ġme asure St orage cor es Ġtemp erature Ġcase s 9 84 W arning g res n u Ġ" [ Ġ1 40 ma chine ĠT Type age s Ġde code sa ved RE D Ġar rays Un i temp t Ġlook up ! = D K c um à ¤ ta u ĠI tem pro j sh ould 17 6 85 7 Par ameters ors ion C AP D IM O C lo pe il li Ġk ind е н Ġpredict ed = {} L im x A Ġ č he at sel l li o co very Re ference AR G Ġro ute ag in cal culate mark et .... .... decor ators B Y U Int at tach ac le 93 4 19 5 lin ux pri mary gener al Ġrepresent ation term ine G PU P K f lu estim ator Off set //// //// Ġhel per ĠNet work / ", 3 06 M ask P ower c ube e g g c g ence Ġ ._ or ies ce il 0000 0100 ĠD oc AT ED Ġpre pare Ġline style fa iled ud y Ġpos itions Ġdete ct PASS WORD g rate i fied r st ä ¼ ch an th rift com ments ĠW indow ress or fer red vis it host s let ter ĠTe mplate ĠSimType Int ĠOn ly REQU EST 2 25 b t k o me ans ti les Ġb a Ġg ot ac tivation Ġv s ject ory Un known pk l Ġinst alled åħ ¥ ĠAt tribute 3 05 F la ^ { u ous z ed as set OR IENT ĠCon vert 011 0 Config uration utiful Soup F low R ender d w r aries à ª Ġf s ser ve tri p St yle ĠGener ate Valid ation 2 12 AR CH ĠTest Case depend encies Ġcons ider 8 96 M esh n av y e Ù Ħ ĠP erson Ġco ver eri als update d thread s OUT PUT ĠFound ation Ġ 99 Ġin place co ef Ġ1 0000 01 6 tr uth Ġy et ĠB e work flow ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠ ĠData Frame L R Ġp ot Ġf h ak s run ner Trans lation Pass word F S Ġs quare ') ] ": {' ĠB ea com b Ġkey words ENT RY cor r fra c Ġvis u sd k cut s Contain er 2 96 P rint Ġ ut Ġb ad ĠT ask us ing Ġh yper Ġma ss bo olean eval uate Ġsw itch ------------ - NAM ES 9 08 b len c map £ ółģ Ġb and ex cel ]) ] AN S ĠRe move 34 7 spe cial cal led pri or "> < 01111 1 Ġge o SER VER basic Config 4 56 S UB d ropout p ot q s Ġd ue -------- --- coun try Ġpre trained with out ref s role s Ġcho ice 87300948 126 Named Values M Y h yper 00 1111 Ġw ell ĠT able par allel ex pect =" ", ĠB l ĠE ng Ġon ce Ġuse ful ðŁı´ółģ ³ółģ STR ING âĶĮâĶĮ âĶĮâĶĮ : { L T N T c ategories st e fi es Ġimport s 32 7 Ġwh ite {} _ Ġadd r Ġwork er Ġab c f ront (' .') Ġto ols ID ENT map s Ġar ticle Inter val C ap E P E mail T wo U K b on l ar é ģ Ġn one Ġm id Ġb ias pro te 15 7 011 1 ĠComp ute Line ar å® ļ Ġrule s depend ent ORIENT ATION h it p layers p anel t orsion an ks li cies di alog as sets ") [ Ġse p 34 5 De te extend able Constraints Union R est U se an cy Ġpro c SE C cal endar Ġiter ations ]]) ] SER V cei ver C or C all W IDTH s lug x FF ti ght Ġn d ma s ') ), Ġg it ne ighbor Value Constraint Ġgener al vari ant GEN E 3 08 D C b etween Ġc rop Ġre ason Ġe t ĠS P ĠW rite 19 6 Ġkey word cord ing ĊĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠ aw ay ial og schema s Ġstri p 3 04 s up t cp st andard ch dir ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠ date s mon itor Ġar ound xy z âŀ ĸ I mport P r X Y x ticks 10 9 max imum 14 4 14 8 )* ( sm all Ġow n DEF INE W IT ] ', Ġ lock Ġn u Ġd p co in ĠS V hes is R ot p ur ri ces Ġb ul method s ä¸ ĭ Dis play Pri ce gre es Ġhash lib dash board à µ st o Ġt akes Ġa ir Ġin line 13 8 temp erature Ġsu ffix ĠTime stamp [ _ f w æ Į Ġre cords ĠA CTION Ġcon tact IN ST text s trans fer Tra p Ag ent >, < G lobal b enchmark de m de mo ro ject Ġp k ent e ad v (" { par sers ĠI nt ff t ctor ies 18 6 St andard Ġjson ify medi ate Widget s Ġsel l 4 24 n ick ĠA UTH Ġme t ant um Sg t iter ations sched uler ' }) 3 97 U ID ç ® st ick Ġs imp (" {} Ġ3 6 oun ts ĠO p De bug Ġfilter ed . ". B ody E Y R et m x num bers Ch ild Ġlin ks filter ed Ġve locity 5 37 I GN h alf on y Ġs ym and atory ĠS um Ġcon struct =' ') act ual Ġ201 5 Ġdec imal oment um > ' T itle c lock u do Ġre fer tra de Ġid entity е ÑĢ allow ed 2 86 F i Ġ #### se ns Ġre lation co eff ĠT EST cur ve 19 4 Ġapp lied MS G B ATCH W A d ensity it ing it ation Con nect 17 7 Ġdis cip level s oper ation distri bution Ġlate st yg us F Q R ight S to Ġc c Ġ" ' Ġ" * ab y Ġtorch vision ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠ åĪ ° Fixed Surface ensemb le ĠBea utifulSoup Ġdiscip line i fiers p od de gree Ġd en Ġd ash ph ab sa mpling Ġ/ = Sg acl ble ms Ġparameter Number Ġparameter Category åĪ Ĩ WS MAN Hel per Bu ffer ygus Parser E MAIL L IN in c se lector ce ive un pack time delta ĠN orm DE X Ġtrain ed Window s Ġappro x ĠDescri ption ( ", f tp ¢ ółģ æ ³ ro ls Ġs v ĠC ustom Ġde termine 0000 1111 ĠM et Ġcont roller AP P Ġ-- > Ch annel Cont roller dt uple Op tim D iv e cho n z Ġ question Ġsh are ðŁı´ółģ Ńółģ Te mplate V EL g w st ation Ġt weet Ġ' * Ġa z Ġ( { ma ker )) ] ĠS pe ig en ĠE d AN CE sent ences Ġfa ke gr ation Sh ape è¡ ¨ OPT IONS - { C ells h r v or é Ĺ Ġ é pe dia Ġl st Ġcon tribut ine ss ĠD ynamic sa y Ġset s rep ly Ġcheck s DAT AB So ftware 9 64 Ġ Ċĉĉ Ġ ---------------- ĥ ½ Ġa m Ġn or Ġ[ ]) ĊĊ ĊĠ us ic able s Ġse cret 15 6 ĠData Loader ðŁij ¨ðŁı ðŁij ©ðŁı alan cer p db Ġd ummy __ .__ ĉĉ ĉ sp ark ĠP ost be am Ġvalid ator sg Parser Ġlocal ctx ################################################################ ################ Met adata âķ IJ ĠNoti fication 4 03 = ', A pi P ES V K b undle d ark n l Ġf ri co d ig hest 15 5 ĠSt d angle s Ñģ ÑĤ Ġsql ite Uti ls 2 87 M eta P ON re peat 00 7 ss o Ġan n 18 7 ĠÐ ² Ġsim ulation Ġindic ator READ ME Ġsq rt t weet v in di gest Ġde termin Re move ĠB lock ry pt Ġz one std in L in O FF U sage h ref Ġ ĉ Ġt xt Ġd id (' ') ĠM ark cor pus Ex pression Ġpi pe 9 07 H I O O S AM k i se ct ut ron Ġne cessary Ġdistri bute ey e Ġinstance s Ġph ase M R [ ] li ces Ġ3 1 ĠB uild 16 9 100 1111 17 4 011 10000 Ġ"/ " ãĢ ģ - > H D é Ŀ Ġf lux ce ed li ck ad or Ġ1 05 ĠI F Ġst ock Ġex act 02 3 Ġma chine pre processing ass ignment Ġne ighbor Ġrel ated ĠQu ery Ġdes ired esc ape C Y a vel p th Ġb g Ġ1 60 ĠA nal ĠP lease 18 5 Single ValueConstraint cir cle S elect b asis Ġo cc Ġe c ul ated par ametri im gs Ġsh ared Res p Ac lV cl f Ġ'/ ' оР» andid ates Ġrestri ction centi le P oly h old Ġ Ø st s Ġ1 30 Ġg uess Ġsub mission Se gment Ġtable s err Handler 10011 1011 ĠDefault s uplic ates Ġlet ter P lugin S cre _ ' Ġ í de coder ce ler () } con cept Ac tive ĠMib Scalar Ġinv ok SimType Char A uto F UN W or n lp Û Į å ¹ Ġ Ċĉ re name 02 7 Ġac cording Buil d Ġreg ular Message Type Com mon Ġvis itor Ġfin ished Ġgr anted A li Q P b old å · Ġa void Ġst ill run time 201 6 ( """ . ': 2 84 3 07 C ho D ense f fi Ġf uture Ġb lack vi ation Ġload er session s eval uation 2 33 4 27 T AG à ¥ re vision ro ved ist o Ġx range pre trained 37 5 sign als âĢ Ļ Ġsign ature ĠjnxMbgSgw GtpV ĠEn tity Ġcir cuit ĠjnxMbgSgwPP GtpV ############################################################################ ### _ " i li Ġ â in dicator re et Ġ" : he alth Ġa sc ue s ), ( Ġr gb res olve Ġname d tiv ate tick labels ãĤ Ĵ sin ce Ġdete cted PRE FIX a ção k y r ing ver sed ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠ par k par ty ub i Ġor gan Ġpro cessed 16 6 Pro vider Ġformat ter mask s To ol ĠCal culate Process ing rup t 2 36 a is e ach µ ółģ re cv ĠS U In st ĠCon v DE L wh en 01111 00 ĠRes ource Ġstri des Ġexception s permission s abstract method ç½ ® + ', 4 06 C B G C æ Ľ Ġp in Ġf bx Ġre pository Ġm andatory ve y Ġstr ategy ass istant sub mission Ġsc ra UN K Ġdep loy ighb our 8 08 D ialog P air p ic le tion Ġb all ĠS c qu eries min or 14 5 19 0 Ġclass ification En tity FI EL ĠStr uct !! !! 2 92 O pt T k è ¾ ct ype um b ch i sc ra ER Y St ore ag ic work space inter pol а ÑĤ ĠMib Identifier soft max Ġarch ive NotFound Error ĠjnxMbgSgwIf GtpV ' % O F U til b ridge n f x l Ġt ak Ġf lo is ik Ġfile path lu sters ec ast Ġpre ds ółĢ ² Lay out Train ing note book Top ic semb ly ierarch y isik let b rain Ġ ------------------------------------------------ re wards ver gence load ing Ġtype Of ([ - 85 4 Ex pr yp ot ĠCON TRIBUT ĠAr ray LOG GER Ġmulti processing 2 09 pe ar ri st Ġ1 01 ile s sc ene im read valid ator sub net ĠSe arch Ġgo al Ġstate ment Oper ation FIL ES >. < âŀĸ âŀĸ ) }, L i L en U RI a wait b rowser Ð ´ qu it ĠN ON comp liance man ifest mark s He ad parti al # ---------------------------------------------------------------- A WS C ard D rop p ay Ġ âĢ er ing Ġc ycle Ġm ultip ĠF etch ord ers Ġsh all PE CI ĠJ o 1011 1011 Ġge ometry cogn ition Ġautomatic ally ? ", S K U ES u z æ Ģ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ -------- - Ġpro to ĠV i Ġk nown lit ude sub set Ġrun s En abled Ġproduct s gradi ent D raw E mbed S ymbols ® ółģ è ĩ Ġ' ': 01 7 am ing ĠL ay Ġde coder ĠM ain ls o ĠE num Ġco ordinate class ifier 14 0 Ġhelp ers Id entity length s gener ated rand n Option al 2 88 o auth x es Ġ ĊĠĠĠĠĠ qu ad app er Ġse lection 12 1 ðŁ Ĵ Ġdi ag Co mple mark er Ġup grade =\ " ĠExt ra 3 34 M BL ` ", l or m ig p andas s ock an ded Ġs lot fi cial ON T ob o Ġop s ĠH el Mo di Protocol MessageType cred entials Register Message charact er Generated ProtocolMessageType ' m H ub _ [ f h z ation Ð ¿ å ± Ġt ol me try Ġ' $ Ġ2 9 ĠO ther min imum +' / UP DATE $ ", 4 22 C ounter C ACHE G ame e very u ro æ ¯ se udo Ġs ync Ġd ic Ġw ave ĠA b '] = ĠP i Ġ3 4 "] )) ip ment 64 7 cat alog vo ke PI O Ġwork flow tick er PRO TO b one r v in her 00 8 sp read 01 3 time zone os m reg ions fra ction P layer V ec s olver ç § é ¡ Ġe q ĠS ER ig ure ĠF irst 32 5 RE F top ics supp orted Peer Stats F lip M I O D b tn e ch re try Ġ' '. Ġa ug Ġin her data frame Ġen abled 14 2 cri pt DO MAIN Ġtoken izer rel ated FR ING M ed R ect ² ółģ re nd Ġre lay __ ), ĠB atch ci pi Ġdis cla Ġspeci al User Msg hist ogram Hel lo ĠString IO First FixedSurface LAB EL A verage F Y L B å ij me asure Ġs ources ue l ĠC HE up y lif e mat plotlib Ġread ing ĠOption s tensor flow Point s õ es 3 94 s z t v Ġde vices 12 2 process ors PT ION ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠ Un able su ite Ġconvert ed ĠTh read ìĿ ´ ĠPlot Scripts Pl us FRING EMENT d os r ust v c Ġ ent po inter os ite ap on ho use we bs 17 8 Data base Ġtrans lation Ġload ing Ġone ofs Ġseri al Ġbox es Ġbl ue Ġbound ary æ Ķ it ers Ġb i is m Ġcon fidence po le Ġ* , com ing EN V ip s ax s local ctx Ġupdate s su do rou ped 4 36 9 87 n or à ł Ġd ensity and o ĠC LI res net pro d ms gs ir th ĠG iven mon go Ġad dition unk nown connect ed embed dings named Values pie ce f fici i inter v d å ¸ res olution Ġv el 17 2 LE VEL ĠUn i ĠCON NECTION Ġ'. / ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠ sim ulation Mem ber ĠIter able Ġdiscla imer N R i fic m argin Ù Ī ti p Ġf mt ri ch )) )) ĠT YPE Ġy y amp a Ġconnect ed Ġcm ds gal axy æĹ ¶ ĠCor p 9 03 V IS { : Ġ" ": def s ĠT R ab br Ġex clude mo use lt k ST ATE stri de Ġad j Ġdim s vector s sql ite Pe ak Binary Protocol allen ge parametri ze ' d Ġt i me th Ġs izes Ġm ight Ġh alf tra st nn ot DO WN ĠÐ ½ On ly Ġsel enium Const ant asc time PON SE - ', 3 88 A U N G Ġ er Ġ' [ ur on ad apt int ain ch rom '] ): 0000 01 =" / ĠB ack reg ular CH AN âĸĪâĸĪ âĸĪâĸĪ å¤ § 87300948126 07 ĠCONTRIBUT ORS 2 37 m ore er tion de tach Ġp ending Ġf ront Ġb its Ġ7 5 ######## ## Ġ4 4 Me an Ġdirect ly D river N ext g uess n dim æ ĭ Ġ lab at ype ar ly la m Ġb alance Ġ3 3 ir ror ĠV d 18 4 Ġtrain er ren gth ĊĊĊĊ ĊĊĊĊ H B L ines V EN W rite y a Ġt b Ġp df Ġs ns sp acing IN CLUDING mat mul Ġcomp at Par am spe cies TH RES exec utable copy right change s Qt Gui bound ary Ġstat istics V o r nn ti f Ġa ctor ot s ol ved ĠS ign Ġg ive vi rtual Ġde epcopy xa xis Ġle x WAR NING ĠDec imal N V Q K U sing d jang x path Ġ ur in ja or a re call Ġs s Ġre try un ion () ]) ul se ic a ĠN ULL gra ms wh ich Ġhere by Sp lit Ġcre ating ĠStd Method = (' r x å ī Ġm ar Ġe lect fi ler Ġ1 09 id ity Ġh it Ġclo ud noti fication noti fy k t r h r se Ġb ra ist ent ac counts ci a ĠR out ĠG ame 18 8 pi x disp atch ĠTh ere Ġdete ction Ġrepresent ing 010 11111111 mac ro 4 26 z illa at tack an te Ġc u Ġs olver Ġre levant un til ĠF ree ĠO ne tri gger Ġen coder Ch ain iter items cho ol AA AA short cuts Ġprob ability RU LE Ġep isode 2 93 3 03 T un h p Ċ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ri gin um bn Ġname dtuple 32 6 27 7 Ġsub set Ġclass ifier VAL UE åŃ Ĺ Ġagg reg A lt ] ))) b oth ł ģ on ical Ġf type Ġs che Ġb py set Label Ġr c ĠE ach Ġ5 12 update s 201 3 Ġow ner Ġpor tions ĠIniti alize P D T X h df Ġ 96 Ġe ffect ĠS ample ĠL ib čĊ ĠĠĠĠĠ IN FRINGEMENT Ġres olution ax on eat ures inter p ĠQ ue ĠSt andard Ġplot s ĠRes ult Ċĉĉĉĉĉĉ ĉ Ġperson s avel ength H R S ite s fp z h ar ticle al most 11 01 ch er ĠS ource 10 111111 Ġme mbers pre process Ġ4 2 url patterns Con vert ðŁı » Ġadd ing Ac cept level name Ġlimit ation ca pt ĠÐ º limit s ĠCh ange dest roy åĢ ¼ + / . % 3 85 9 00 B S y ellow on al se ctions Ġc a Ġc y Ġf old ad verb and roid key patch ap s Ġlog its ag ents Ġwh om IC ATION descri be ðŁı ½ ðŁı ¿ Se e CL IENT place ment Ġallow s Ġobtain ing Red irect ^^ ^^ 8 95 on ce al gorithm Ġc andidate Ġf our Ġin di ch ron 01 4 log o Ġ5 5 au x place holder tmp dir anti c UD A seg ments å° ı kp nt F ont S imple b right d ns s mooth Ġre pe li hood Ġ1 33 as ing Ġl arge ĠF rame qu is Ġpar allel Ġ4 8 loc ale Ġtime zone ump tion 13 1 Ġdi v Ġclass ifiers ðŁı ¼ ðŁı ¾ scal ed ĊĊĉĉ ĉ ĠFile s CRE ATE c nn k k m ysql o lo q V à ± er min (" # om in 02 6 ache d čĊč ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠDef ine ("" ). Mem ory c g d rift s at t m w n w ater li g Ġm l Ġw i der iv ĠW ork Ġid entifier IB LE ãĤ ĭ mut ation : ') re dis re levant Ġc nt Ġc wd iter al iter ator Ġscal ed Ġagain st čĊĠĠĠĠĠĠĠĠ čĊĠĠĠĠĠĠĠ GRO UP ) +' a N h its Ġt en Ġp ush fi ce Ġb b 11 2 int o UT E pl ane serv ers COL UM ('/ ') gorith ms dete ct lec ule 3 95 9 14 : / C red C ustom D Y E mpty K ind b ank i co n ative Ġt imer 00 04 op roject ĠS tep ĠF ace Ġpro per col lect cor re TH ON exist ing differ ence Ġconstraint s ĠRedistri butions M IS M EM m al Ġa ge Ġs age ur ther Ġin strument Ġd y ĠD IS ir l ĠR aises 17 3 eri or Ġapp s Ġrequest ed Ġ201 4 а н Ġtuple s non zero Load ing åŃ IJ Ġprovide s CDOTA UserMsg C annot G ate H H I FI P ack R UN i j § ółģ Ð ¼ Ġ= > Ġt ransp Ġp c la re ĠC A ĠB ar AR D ĠCon struct Ġrun time Ġmin utes Ġcho ose Ġpixel s Ġsepar ate ĠConst ant djang oproject 3 92 i mpl æ µ ĠC H Ġse nder ĠH TML AS H cre te ðŁı´ółģ ´ółģ Ġab stract F D S core e b w m se quences Ġp id ĠC LA Ġh old Ġpy plot {} ) Ġoper ations Qt Core dete ction 3 96 4 57 M ac f requency h pp s olve at ar Ġin dividual Ġd r 11 101 pro jection ĠD elete Re lease Ġme dia cur rency write Field iv o Ġbo ot HO ME Ġsent ences ĠDE AL Ġembed ding ĠSer ver Ġperform ance crypt ed Ġleg end clus ive 8 97 A mount H z J son M N ] ') l arge y axis ³ ółģ¿ Ł ¥ Ġs mooth urn ished Ġ% % bo ost uti lities ĠH ow Ġstart s sign ature aw n gr pc ĠAttribute Error ĠCLA IM 3 37 3 87 h am Ù Ĩ in p Ġt ar al es la unch list en ĠV er ry pto au c obj ective Se q ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠ char s Ġfla sh :` ~ еР¼ agg reg è¦ ģ 4 37 ? ', D one V ol Z Z h um h dr s ure v r Ð · re ason un ds Ġb etter id ent 99 6 Ġde t Ġpro duce ĠR O Ġ5 1 Ġch unks ne ighbors Ġsub mit ĊĠĠĠĠ ĊĠĠĠĠĠĠĠ DE LETE Ġsome thing Norm al ĠValid ation DATAB ASE ĠNON INFRINGEMENT F OR L F b at en a me ter Ġin f Ġ1 27 th at Ġv ars IN DEX 12 9 ). __ Ġsub license Ġmo ving SER T vol tage Ġannot ation Ver tex Sum mary require ments å¯ ¹ ĠDEAL INGS ! " = ", I tems M dq U V n m Ġ 84 ro ve id enti ') ( ĠA uto Re port Ġco effici ĠH O vis u ç ões eps ilon constraint s ":[ {" P open h ow Ġs urface Ġo k Ġd Mdq Ġw atch ch unks (' # th ickness ĠO ver 15 8 Ġat t Pro duct Ġsub stanti rep lic Ġpage s ĠTh at Ġref resh real path velop ers Ġindic ates ĠLoc al Dist ance prec ated ĠFil ter ] { c art n el å ¦ Ġc ri Ġc ube Ġc ourse Ġe scape ĊĊ ĊĊĊ Ġg reen Ġas set Ġv a ob servation min utes Ġtra de [: :- Ġcheck out Ġ** * Ġtrans fer Add r Reg ression ãĥ ¼ PL AY Ġmer ged åIJ į Ġsuccess fully Ġregister ed Ġvari ant " ' " }) B ranch E r P W S W V lan j ar è § ì Ħ Ġt ot ut down Ġg u '] } Ġor g ob ile Ġhe x feat s TY PES Th ere CC ESS rot ate F lag H igh c x o tes re direct "" ") (' ../ 01 001 Ġh app Ġ3 7 ĠM em IT ION Type Error ðŁı´ółģ ¬ółģ ca de Ġdif ference Sub threshold Ġcred entials Ġremain ing phab et ( ': M a c ategorical f m ¥ ółģ à ¸ å Ĵ Ġ 88 al ty it ect co ok Ġw arning ch a el y get attr Ġg ate ĠP ort [" __ py torch Ġlog s sa mpler RE EN split s back up 23 5 ĠMe asure callback s Ġcl f ( % 3 86 9 88 < = L ong l g Ñ ħ Ġ" )) Ġre cipe Ġw s sp atial pro g ĠM icro Ġ6 5 Ġexp r dis abled perim ents 0000000000000000 0000000 ĠConfig uration feed back pixel s æĹ ¥ LOC AL 4 25 D uration H C M K S uccess W ord k ill Ġ () Ġ' @ co verage )) )). con fidence '] ], Ġde lay 13 0 ĠThe se ĊĠĠĠĠ ĊĠĠĠĠ ele d fil led Ġlevel s Ġact ually distri bute bul k ĠDoc ument Ġsubstanti al 4 55 d ynamic f its y b al ignment ti d Ġp db Ġp layers Ġe th la zy ion e fi sh xt ures ĠF eature sc yl Re quired Re pository ext ent oc c Con s man ual ĠSe ssion cent ral Set ting qui val fra gment fail ure quanti ty Ġhour s scyl la " ', E l S end b id d ri s weep Ġt p an chor Ġs olve Ġb ounds Ġr v ĠM ap Ġen code 93 6 PP ORT Image s part ment extra ctor ĠCol or Ġnote book 9 55 P G R F b atches d j d as k l t ty è ½ re cipe de epcopy ti tem Ġs parse ** * Ġex pl Ġma il ho le ne arest group by ĠData base pack et fetch all named number Ġfra g second ary Ġassign ed dh cp ' > / * C la t un Ġc riterion pe er ri cs ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠ vi a Ġde gree Ġpar sing 27 6 IL D Ġformat ted Ġpri mary cv t 0000000000000000 000000 "} ]," Mon itor Del ta ĠArgument s ëĭ ¤ $ { E VENT S B w ar in crement ul ary ĠS ci ĠS ET ĠC ar age d form ula ap is Ġal i 14 3 man agement ĠSt orage ĠNOT E FL AG Ġvector s ä¿ ¡ Ġcombin ed ĠBl ue umbn ail ) == ? ? C allback H TML S u c df s ound en cryption ot a Ġ2 000 Ġx s ĠG PU 13 9 34 8 09 7 Ar r Ġqu bits Ġloc ations CONT RO 3 32 C at D ay M ON S m b z b ro p time ar row ra ps Ġb ro Ġh ard ĠD istri pre pare ĠN ow AR GET 06 5 Ġsh a Ġ201 3 dic ate Ġcall s PRO JECT Ġtri gger gg le Sa mpler ACC ESS FIEL D # %% C OR H Y T ransport Ġf g Ġb rowser iz ers ĠL in Con n 34 6 Ġcomp iler olu tions exec utor Ġfilename s ba seline Ġph i cry pto He ight Ġshe et Ġcoun try ĠDis play éĿ ¢ 5 000 E rr s uc à ¶ Ġ ; Ġa i ur b ra vel Ġimport lib ot ing (' {} ĠT ag il ing (" ./ Ġst ar ĠO per 25 0 93 7 Ġwe ek ĠSt ore Ġcal endar Ġversion s window s rel ations âĸĪâĸĪ âķ Ġpop ulation Rout e / + 9 18 i pping p dist Ŀ ¤ Ġp lane pe g ch r and s Ġg s ĠG rid tri es lat itude ET H Ġcode s dat aloader æĸ ¹ è¿ Ļ ä¸Ģ 个 Anal ysis åĴ Į E stim F o W T s il z M Ġc b Ġc am import s ĠC loud ĠA lso 99 7 ST M 93 5 94 7 Ġdo uble pri ate Ġver y Ġnorm alized track ed Ro ot Range Constraint / ') F ore Q os ] ; b m Ġ ----- re view Ġt ele Ġ5 4 av es Des c idx s gn itude ĠPar se Sh ow ä» ¥ ĠAUTH ORS P ACE W ait g ap i ou l n æ ¬ ç Ĥ Ġi con Ġa ws ad ing ext ended mo us no tes Ġdate s Me asurement UR N pri ority NO DE âĢįâ Ŀ¤ mis c Ġdepend encies âĢįâĿ¤ ï¸ı 9 86 B IN R T v et Å Ł le y co okie el f ĠT ree as ures ve st Ġcon sumer Ċĉ ĠĠĠ Ġsc ene rep are no st Ġad v ĠIN T Ġover ride Ġ... , Ġform ula TE MPL Ġthread s mag ic distri buted Ġeps ilon Ġoc cur ĠCorp oration , :] 9 32 B GR s un u f Ġ ^ ti t ti ment Ġre tain Ġ1 92 ck pt )) [ ĠT op tr l ang er 64 4 LE X spe cs Ġsp atial ĠJ son mt ree D b L ock L IB N EL V A m f m se q q ë ¡ in h Ġf lex __ () ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠ ĠP ass line width lif y Ġ\ \ Ġ'- ', AC L track er dimension s ĠDi ctionary Ġbr ush Scre en agic Mock M er W i Y E Ġ 85 Ġc um ĊĊ ĠĠ str ptime tr on out file ly ph Ġso ft run c HE IGHT Ġover write ĠCo mple è¯ ģ á rio çĶ Ł Ass ignment ĠQue ue cvt Color = (" I mp L IC V e ç ¤ ç ± Ġ ê ut ter con struct Ġcon cat ĠR et ĠV m we ather Ġstart ed cl ar Ġqu ote tensor s PRO C Ġsa mpling Ġjo int Valid ator éĩ ı Pi peline 4 08 D J F unc X ML j wt p ace v n v ity re pe Ġs pi fi re Ġw ire #### ## as m ver ti ver ity ĠB utton Ġle arn row n Ac c о ÑĢ Ġcor pus over flow åı ¯ SC HE ) > A Z B asic V olume V oid Ä ĥ ĠB aby ĠR ES ĠV M Ġlist a Ġconfig ure au d temp ts FA IL Ġwork space Ġsign ed ĠTh en sig moid cap acity Fil ename document s PROTO COL ampa ign C UR ] " a co p v w ire ¤ ółģ se ason Ġc ity ct l ĠA ction po w Ġu int Ġdata classes pre ad col lections ag raph Ġat tach Ġass ume Out er Ġpe er Ġrepresent s ĠTe mp ĠSh ow SN MP ółĢ± ółĢ Ġderi ved inger print m r Ġ mpl Ġw all ĠD ire Ġat tack right s Ġob servations IC S UT F Ġsub net 94 6 File Name [:, :, CL A Ġword List åĪ Ĺ Ġappro priate TIME OUT fast a under lying 8 92 E u K p Q A d T Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ de ep ad i co lour Ġb ind pro f ER T "] ] Ġen coded run s ... " Ġreg ions Ġcal lable ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠ 01111 11 æĸ ° aut og Ġп ÑĢ Ġhome assistant ' [ R sp o pp p atient Ġ -------------------------------- st and me l )) * Ġ2 70 Ġst udent ]) [ Ġco ord ĠW or dict s ET ER pop ulation ESS ION Ġass ignment over lap Run ner Ġparti tion ENG TH 4 05 6 87 L IMIT e mo h u n ment s ymbols µ ółģ¿ Ñ Ĩ è · in ches Ġc i Ġc lusters Ġre pr () [' import Symbols Ġ2 24 ĠC SV In v bu ff AR K 04 8 Ġax s åı Ĥ sm art Ġjob s /' + Di ctionary Over hang Ġenti ties agin ator C G C m M ED N on W q å ¿ Ġa da Ġre dis un squeeze Ġm ol 10 111 16 2 Type d ]] ): Ġcomple ted Met ric ' /> / # C ar E nt R AN g d Ġ 888 de leted Ġc lock Ġre pro Ġd pi ra ck Ġ[ {' ĠS TR čĊ čĊčĊĠĠĠ Ġon es List ener Ġinter p 000000 11 Ġfa ces percent age å¾ Ĺ Ø§ Ø Ġwho le ENG INE æĸĩ 件 ' ( ' ll 3 55 B ad c ancel w x  · Ġ ang at tention Ġt t Ġp ast Ġf ire Ġl s sc enario ]) ), AT H Ġan chor sk y Ġreg ist 0101 011 +' _ Ġans ible circ uit Ġdocs LoadBal SERV ICE å¦ Ĥ > ") A ng L AN M F U sed f v h orizontal w p er os ĠT ry ve locity Ġth ird Ġpro jection ĠW hether Ġal ias Ġurl parse ĠX ML Time out present ation appro x nick name 4 07 9 12 B N Q Q r ho x ls ç ķ č ĊĠĠĠĠĠĠĠĠĠ Ġ 86 İ · Ġa ux ur tle Ġe mp ĠT F Ġl w 16 0 Ġro ll 17 1 Ġcomp uted ĠCon text row se 26 7 Ġz o ĠUn ivers Ġgener ation Ġpack et Ġatom s contin ue Ġgre ater Ġdecor ator b alancer y ticks é ¢ in line al ive ing State Ġb us con verter ĠA LL vi sed fo lio Ġcol lect Res ources DEV ICE ________ ________ ĠVi ew & & F eatures T ED p w æ Ĭ Ġt vm Ġc s Ġb on is ation Ġcon tour 99 8 Ġ5 6 work load RES PONSE experiment al MET HO widget s utc now ypot hesis _ : Ġp m et c Ġg pu Ġr hs po licies 02 1 '' '' split lines Ġresponse s AD D norm alization Ġdocument s Ġsim ilar We ight writer ow boot strap Noti f rag ma 3 64 V N w c « ółģ re m Ġm i Ġw ater set Objects con ti con structor (" _ Ġv Column ĠU sing Ġac ross ĠCon nection token izer ĠPro perty ãģ « sw ap distance s Ġfra ction åĬ ¨ Ġcut off Ġinterpol ation IFI ER 3 14 t or v port Ġ urls Ġc ategories Ġ1 23 ul ative Ġg ain to s ]) ): pre p ĠR GB Ġen ough ´ółģ ¿ roll ers Ġsign als QU E oper ations Ġign ored Lib rary ĠBo y Det ail Batch Norm ADDR ESS ĠSP DX B AL E PS m aries p le v t Ġ' : Ġs r Ġis n ") ]), ĠM apping os ity Ġme dian train er index es base s Ġraise s 00000000 0000000 Ġmark et az ard Ġmon itor Ġdir s seri alizers estim ate wi res D N D im F ROM P attern æ ģ on line Ġt ail Ġf oo Ġn ltk ur istic Ġ{ { ĠC all Ġde tail args ort Ġpro te son g tri als ĠU sed Ġch art 17 9 sub scribe work ing Ġcur ve Ex it Ġcontext lib оР´ Ġsa fe æľ ¬ custom er dete ctor Ġtr uth åĬ ł ama zon Lim it ĠLay er F OLD S yn d g w ik Ġs i ad ow get her ĠD own per f ĠG irl Pro perties Ġcom ments Ġ`` ' ESCRIPT ION comple ted Per cent Hel p ĠCHE MBL + '. D ele D istri F ull S R U A [ @ e gg p ending in verse Ġt m le m Ġp addle Ġf lu ol l ĠM AX Ġma ps ject ed lib s ST RE 03 5 ĠK e au gment ENT IAL âĢ Ķ ĠGener ator ãĥ ³ sim ilarity Ġdete ctor atom s udi ence èĩ ª CLA IM 3 09 O URCE P od P RI S ygusParser i or k n r g me ga Ġc pu Ġp od is nan sc Mod im ize Ġor ientation ph ere ðŁ ¤ ĠRe ference ID X Ġlo sses HO LD Ġar c Ġqu at ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠ Pre fix Ref resh éĢ ² Back end Ġ================================================================= ============ O w P M h b h q h ere x i ç º Ģ ï¸ı in ct in ity or er Ġp ip Ġa mp Ġw ar th ird ĠS upp ance s Ġk w Ġwe bs ann ing gen es Ġfig size Ġmock er Ġattr s Ġfast binary Noti fication Transform er frag One âĢįâĻ Ģï¸ı B ound F ind P itch Q q b lit h alo m ime ç ´ se ek st one Ġf urnished Ġre call ct rl #### # di f ĠT otal Ġr l ist ed Ġ_ ( Ġget s ph p 36 5 env s SS L Ġscri pts н о Auth entication ĠTe ch æİ ¥ PECI AL L EN P k S ING f j h g p ca ç łģ é ħ Ġ 95 or tion Ġp g Ġm en ĠS pec Ġr ho ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠ ĠP Y =' / AT URE ign ed over ride Ad am ida de Mat erial Ġ'_ ' ä½ ľ Ġast ropy Ġfail ure Supp ort Ġba seline / $', 3 57 C fg b ian z A ì ŀ lo s Ġs at la sh ĊĊ ĊĊĊĠĠĠ th ree Ġde grees Ġv tk 1111 111 Ġpro j ĠB oo Ġun known Ġco lour Ġpy g ag ate Ġpre process mat erial yn omial trans l En vironment To ols Class ification Ġtri al SER IAL Ġcache d Oper ator ú mer u als v ile x p de sign Ġre ferences ad apter Ġl l tr ust Ġse en ĠU N Ġ{} \ 34 4 Data Loader she lf Ġobj ective Ġcustom er Parse Tree 2 85 X L ] ") g ain n v u u é Ĥ at al de letion ro duction un g Ġm x Ġ1 06 get Typed Ġse quences IT EM cre ts predict ed Ġdistance s inte grate åŃ ĺ pla in ĠLO G ĠSE LECT Ġwidget s Ġaug ment g as h ard p ull ç Ļ ë Ĭ Ġ ################ Ĥ ï¸ı lo pen Ġd ynamic =" % ĠB u AT OR Ġ5 7 RE PL pri ces Ġqu eries parent s Reg ion Run time long itude IZ ER cover ed åº ¦ Exec ute ++++ ++++ âĢįâĻ Ĥï¸ı ௠į lite xt ' %( P ub Q y V cs d ue g uid o sed x min at ched Ġa io Ġin correct Ġd ocker Ġm ix fi xture Ġb asis ĠS w ĠS chema ĠA T 99 5 EN AME 05 5 22 7 comp iler 36 0 ĠÐ ´ Ġexp licit Ġeval u clean up âĢįðŁij ¦ âĢįðŁij § Sc ene Ġsupport s Ġseg ments Fla gs ' `` . """, / ") 9 02 A ST f bx h op k ale on to Ġt un Ġre size co co ck s (' { arg parse ex change py game OR DER read s Ġco verage ec tivity CT OR Ġbuil ding Ġcall ing Ġiter able gr al Ġvi rtual âĢįðŁij ¶ Ġacc um Ġinte gers Ġcre ation Ġdig its çĤ ¹ ç¤ º scMod Vcs ' ", + ') C ent S F S he b ag h c j j r ng ì Ĺ Ġr g po ses Ġu id Ġres olve 18 3 33 5 Ġdis abled iter ation \\ \\ style s Ġpub lished Do main åī į Ġsche me ' ))) D est H andle L ENGTH W C \ "> ° ółģ re ferences ar ing ed itor Ġ( [ Ġh ighest sh o Ġma kes are f ĠE val mb ic 05 7 ne ed 96 5 33 6 reg ression Co st Ġsample d post gres SC RIPT ĠID s Ġsim ilarity ĠAdd ress SP ACE Ġho ok numer ic ĠLine ar Ġnd array ĠNotification Type Ġinvok ingState D AY E poch M ake P ick Q i S ensor V ars p ip Î ± ç IJ Ġc k ra b con nections ĠS UB ĠP e Ġst ation 0000 11 =" # ĠO SI In te Ġ5 2 Ġal ert Ġpre ss IC K 22 9 Ġcom b ran ches Ġsk y cp wVc Ġplot ting ie q post s chain s ä½ ¿ Ġ'+ ', ĠHttpResponse Redirect Ġestim ate assign ments numer ical âĶĢâĶĢâĶĢâĶĢ âĶĢâĶĢâĶĢâĶĢ ä¾ Ĩ Fail ure ĠWindow s æ³ ķ / ? E CO S ave ] ' g ent m ult s f y ml z i Ġi de ro ke Ġre v ĠS elect Ġg ui '] ). ** ( ta ke out er ĠD I if ar Ġpro cesses Ġon to 18 1 03 7 Ġ} ], RO I check out ĠBoo lean L ANG d ra m iddle r mtree t EX w a it o Ġb enchmark ') ], ĠS top ir ation Ġal t En able the me ai lab ins ide ba z ĠAt tributes 1111111111111111 1 cei pt çİ ĭ ) ? A gg G Y M ib i am p f or se se en Ġt ex Ġd ropout ata ble ĠC Y ") ] Ġl b pro be pro cesses ON G tra j ari a 26 5 Ġcreate s Ġmat ched Ġcor re е ÑĤ Trans fer Def inition BU ILD ĠApp roved jnxMbgSgw GtpV ĠTrain ing æŀ ľ Ġtermin al jnxMbgSgwPP GtpV C PU P ixel ] ", h stack i ke j mp r n u fact un used Ġm m co ordinate end ants to c par ticle om y 07 7 ĠE T sub scription inter faces Ġle d Ġmat rices cal ib ðŁı´ółģ £ółģ ĠÐ ¸ TO DO fla sh Event s entic ated Ġyear s Ġderi v LIN K éĹ ´ drift s itect ure getTyped RuleContext 8 99 F c G P H ash S IM T imer a ffer c isco f our Ñ Ī è ĥ½ an im Ġc hem Ġp ersist Ġs cheduler Ġd uplicate ĠA udience ######## # ĠI M ĠD ep app lic IN SERT Ġhe at 64 6 Ġpo se CT F Ġli g 56 5 Ġfa ctory Ġ", " è¯ · estim ators sph ere 4 09 R aw m z y u © ółģ in ference or ientation ma y ĊĊ ĠĠĠĠ ĠT ri ĠB inary AT IONS EN ABLE ts v SE QU ip pet iti ves 87 5 97 7 Ġdo ing cal cul SI G Parser RuleContext ãģ Ļ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ xaf J ĠMe thod Ġparti cip Oper ating CHECK POINT D ICT P omerium S lider T CL w ind Ù Ĭ Ġ 92 in ce Ġin crease ĠT ABLE Ġg ray Ġg ym 01 8 od b Ġh ar im ing Ġ3 40 ĠM ac 07 5 15 3 Ġsp aces ĠCON F Ġwork ers tx n CA SE ĠSet up scal ing Ġinclude s cut off ĠApp ly Per mission Ġpe ople åĽ ŀ Ġcat alog Ġcalcul ated ĠExample s Ġretri eve jnxMbgSgwIf GtpV * ', 2 98 I ZE L a O G P ress b log z s å ¥ ç « ì § in place al loc ti fy Ġp atterns Ġn av Ġb undle ab ly Ġg d ĠL ink ph ys ĠG aussian valid ators Ġob servation RE M ill ing 95 7 ach er Ġmat erials clo sed Ġcan vas Ġexec uted Ġwindow s DU LE gate way Ġrep ly ament o sph inx Ġcontribut ors 3 02 p ly de serialize Ġp aper Ġs an un ct __ ' Ġth ings Ġde mo 04 5 Co lour pl ate Ġ] ), ular ity Ġmark down âĢįðŁij ¨ðŁı âĢįðŁij ©ðŁı Ġcorrect ly Ġevery thing lis ion 9 13 S ocket U ns t ls é Ľ Ġ ray ar rays Ġin ference Ġre cursive ': [ __ _ ######## ### os a IN VALID ĠE mail ll ite ĠIn st 37 6 ĠEx p Ġpri ority Reg istry Sh ader ASE T CK ET nb tc product s STAT IC lst m CHECK ING ffi li ç± » FOLD ER " %( ' $ E qu N F S te W IN h h h l u aliz à ¨ Ġ ĊĠ re store le ts ti tion ig ation Ġr s 01 5 Ġh a ans wers 18 9 au g Int ended Inter rupt rap pe äº İ USE D Ġum a âķIJ âķIJ B ig K B R R S erial j sgParser p run y ou č ĊĠĠĠĠĠĠĠĠĠĠĠĠ it a Ġm argin ra c (' " ĠA le list ener Ġde ep text ure 92 7 ĠH ome Ġad der norm alized cat ing cache d acc um For est ĠPre dictor çĽ ® C enter S PE c raft m ust v k at ives en ing Ġt au Ġp v ma pper sp litext Ġcon d ic ally 15 2 Ġpre p IC AL 88 7 AM P Ġcomp any AC COUNT ps i Ġqu it ĠWAR NING Ġrand int Ġgen es åĽ ¾ hook s tEX t v x è Ģ Ġ čĊĠĠĠ Ġp lan ge om Ġin p ') ): ĠC ount Ġdef ines par ticles ĠF a list a ĠE xec Ġ4 6 bu d eri a 19 1 Ġunder lying 23 9 Ġrun ner so up 35 0 Ġcode cs Ġ201 2 order ed Log in build ing Ġed itor Ġmon keypatch Token izer Process or Mo ve Ġbound ing ê° Ģ > & C opy N D S nap g old s ites Ġ vec on gs re pos ar th Ġre view (' ', ĠC re ĠP R 0000 1 Ġ3 8 ir t Ġro ut 14 1 ok up Ġcomp ile clu ded AL CAR cal ibration 77 6 ĠJ ob о ÑĤ Ġover lap optim ize Ġmodi fication Ġgen ome NUM BER }: { Author ization Ġquanti ty ĠEng ine ĠSER V quival ent ĠBlue print ALCAR ECO 4 66 9 09 = . C osm I J S q T ARGET i py se ctor Ġp ts ri sk ĠC er ĠA pi ver tical Ġth resh Ġst and Ġget ting Ġch r 33 3 exp l 00000000 000000 86 7 LO W Me asure ud it Ġinter vals Ġval s ĠSet tings aa aa ĠLo op NO WN Label s expand user Obj Pointer SU CCESS Ġcapt ure kpnt Trap İ· åıĸ ailab ility 4 32 A W L ane O VER P a S G U CT n ested } $ å » å ŀ le ment Ġi i Ġs ymbols Ġm k co sh ab orn ist ance ON LY Ġ4 04 16 1 Ġmat erial Ġadd resses Ġuni form ĠEN D Ġrequire ments Ġcer tain Real m = """ C amera h ing y r ar gest ĠS ome Ġj ax In ser 03 4 Ġch at Ġla unch 36 8 cre ation token ize Set up Ġsk image TR UST ALL OW modi fy built in ë¡ ľ 5 66 E B M ER P V P DF p ause r er ç Ń Ġp ragma 00 02 Ġs ong Ġ3 9 Ġse curity comp arison Ġlo st Ġtrans late filename s mark ers gn ore SI GN ĠData Field ï¼ ī Ġmap ped Ġtr ust Ġcalcul ation fold ers tol erance HEAD ER ffici ent ) [' 3 12 Q C d ry p atches w u á Ħ Ġ 97 in strument ch ase il ation Ġcon nections im s Ġout er da de 22 6 Ġconfig s Ġconfig urations 87 6 color bar ach ine go ing cre asing PO LIC Ġreg ard Ġge om Do es blue print FIL TER REQU I âĢĶ âĢĶ ĠSpec ify ëĬ Ķ B T B in B its D ESC g aussian g uild s lim w rong å § æ ¨ é Ķ Ġb el ĠA P log out Ġse ns label size ans ion Ġ4 1 ĠU UID 03 6 Value RangeConstraint ï¼ Ī ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠ ================================ ================ LLLL LL Ġhost name ĠDE BUG prob ability Ġ? , Ġcent ral Ġdig it Ġenti re Cosm ics POLIC Y K A K I L ow b io f type p ersist re me st em Ġp ull Ġs d Ġre peat Ġ1 04 ') ; ĠA RE ĠF ore tr unc =' \ ance d Ġbe havior ph ot ph rase 25 7 og raph 17 0 Ġat tempt Ġdist utils Ġindex es check s ern ion CH AR Ġval or Ġph one encode d web driver Ġsuccess ful ******************************** ******************************** ĠXXXX XXX ISE D ĠMicro soft / . 9 11 A ns D iff L M T ABLE a G m M x C in fer Ġn ative Ġm uch ma pp __ ). [' _ Ġl and ĠA WS 99 999 Ġde ps 08 6 ach ing Se curity FF ER Ġiter ate čĊčĊ ĉ Ġ', ' By te App s ĠType Var Ġembed dings GG ER ĠCur rent ertion Error A UT M ULT P B b ash k E u ce ç ľ in y in vert en es Ġm ouse () [" -------- ------- ta ched pre ter ĠB ig ep ic EN CE bu st Ġ5 9 64 5 22 2 AM L Ġte mplates Ġser vices az ure fin ished еР» vv vv DEV ICES Ġhel lo çIJ Ĩ " % B ridge P lace h params v ation å Ŀ ì ł in ing al ect mp y Ġf ew Ġf rappe Ġa ffili Ġs il Ġ0 1 Ġw on Ġg c ta cts Ġnot hing ĠM ay da ily Ġal tern 93 8 pi res mand atory comp osition 96 6 av or ale Parser spe ction En ergy ĠPro duct ten ant connect or tt l 0011 100 comm unic Ġcir cle ################################################ ############ · · ' / O rigin R a b eat u j × ķ æ ° č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ re v Ġt runc Ġ2 90 (" ../ ĠS PECIAL ĠF loat ĠF ail sc r oc s 18 2 Ġ6 7 Ġtra ffic ĠRe port 87 7 Ġcheck ing stat istics ðŁı´ółģ ¢ółģ Ġpri ces Ġcho sen Ġhigh er ó n cid ent ĠReg ister Cre ating Ġpercent age CAP S Sto ck 9 85 > | C ES Q S f ew g yp ss er ch ip Ġ7 2 ĠA ut Ġ5 8 Ġresult ing Ġat ol ou cher ay es ann ed Ġconfig ured Pro gress ĠK EY Ġit self cent ers Ġtrans l ĠIN TO fe e Th reshold year s Ġnoti fication }. { Ġsuper visor ĠLog ger entic ate ĠQt Widgets Ġvari ance PARAM S A IL [ { m Z v stack Ġ' ( Ġs qu Ġs low li ef la ve ri ds ri des oc us ĠV ector da g Ġ. / work s shape s Ġnew line 97 5 trans actions No te transform er seq s ĠKey board Ġgr pc ìĿ ĺ gu ide Back ground (', ') C SS D en V q o y Ġc d Ġre cent Ġw allet ck o ĠA ns ĠF in ta int ĠP age Ġv max per centile ĠV is 14 9 37 7 000 1111 Ġar m Bo ol pol l af ka ĠEn vironment Ġscal ing USER MSG ĠTrans form Br ush Ġlet ters Ge ometry wiki pedia ĠArgument Parser ĠCont rol reat ment CDOTA USERMSG gri ds Optim izer 8 94 K J O X R ATE S ur W F e pe o ct } ), ¡ ółģ¿ æ ı lo sing Ġin structions Ġre vision ri er et le qu at ĠL E pro posal ĠD ESCRIPTOR start ed ĊĠĠĠĠ Ċ DE D 95 6 ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠ Ġorder ed Ġdown loaded Run ning Start ing Ext ension ĠIndex Error built ins ĠIO Error C ir C NN F N L et N P N t d rive se m Ġf lip Ġ" ". 00 2019 ĠT arget et y ĠD ense 92 14 05 6 37 4 55 5 sample d IB i oth ing Ġdire ctories PI m Ġqu ick Ġany thing 111 0000 ÑĢ Ð°Ð æľ Ģ seri alizer ĠAc count ółĢ± ółģ¿ ĠOS Error Ġflat ten æ¬ ¡ åıĤ æķ° ĠUnivers ity tEXt date bud get åŀ ĭ M ut T erm X FP p ayment Ġ ################################ an i li very ĠS ymbol Ġr ng Ġh orizontal ĠL LC ment e ĠG it Ġ5 205 we e Ġal ignment 08 7 Ġsh if Ġconfig parser mon ic weight ed Set s Ġq t ĠÐ · rect angle čĊĉĉ ĉĉĉĉ Comp onents STR UCT URE MENT ship s PY THON ĠInter face Iter ation zo om ç¬ ¬ éģ ĵ intain er 5 09 B LOCK C lock E I E p F ire M issing Y ear e j è µ at trib ar di Ġp ayment Ġre comm Ġre distribute li ers __ } )) ; om dog ci se tri al Ġtrans formed >> >> cho ices 0101 01111 ĠCreate d Ġvis ited fri ends lastic search Ġfl ush æģ ¯ , , B it B and Y our c ms e o j ump t weets ¯ ółģ Ġc f Ġs ch Ġre versed pe ak pe ople Ġe ff Ġw t th an ĠS ingle Ġdata class tra ction 22 0 clu ir Ġz eros rc Params 23 8 Ġver tical iter able Ġcal ibration xy gen и ÑĤ ĠLe vel gan ization æł ĩ charact ers ĠtypeOf FirstFixedSurface TEMPL ATE 2 10 L anguage Q d c riterion w r x max Ù ĩ Ġ uri or acle re cover ti ce Ġl argest ĠP oly ac ion ac tivate 92 4 ĠG affer Ġro i aliz ing new axis Ġtext s Ġpri me View Set ĊĠĠ ĊĠ Ġmark ers hic les å½ ķ ĠDet ails Ġconsider ed Ġtak en PROC ESS METHO D STRE AM ĠAle mbic B M C AL L at T i h uman p wd u ds re stri he ap Ġto day et ing ĠS k res ume Ġde sign ac cent 32 8 Ġhe ap St age 24 8 act er Ġreg istry assert True Ġab ort ĠSim Struct Ġfra gment čĊčĊčĊčĊ čĊčĊčĊčĊ : < J J M AC P latform S ide e mit g pus w arp ¨ ółģ Ġ 94 re start en et Ġp alette Ġo pp li ve ĊĊ ĊĊĠĠĠĠĠĠĠ is instance ĠP art Ġpro be Ġco ok loc ator AR B Ġen c df s ID s 24 7 57 6 Ġext ent `` ` gen et ail y De velopment ca ption Ġsu do Ġclo sed ĠComp onent åIJ İ ĠPo ol SU PPORT [... ] Sele ction mn ist combin ed heat map ðŁı´ółģ³ółģ © ( . = < B D W K d antic h int æ ® ut ures ate llite Ġ# -------------------------------- to o Ġh ad ta pe Ġde m IN IT ff f Ġ6 8 ag ger ud ge ĠSe quential 101 0000 Ġgo ing Ġman ifest shot s .* ? Ġbl ank Spe ed Dep loy multip ly = __ A nnot C EL E MPL O H k b l umen Ġ 98 st al le ton ur er Ġe as get text ĠC OL Ġr x Ġl arg to wer key words loc s 05 8 uc lide Ġmay be mask ed enter Outer lip se RES OURCE ĠXXXX XX Ġwho se Req Tx Req Rx ĠExtra ct cipi ent Ġaio http enterOuter Alt ( (' C lick K it S UM T Z k v q n u y w g Ġc e Ġp iece Ġ1 11 con firm ĠO K Ġx x ang ing ec ycle ID E lock ed Ġspeci es Ġq ml sv c Ġtemp orary Ġsu ite lap se Mo zilla distri butions Ed ge åį ķ Det ails ĠMon go åĮ ĸ Dig ite QP alette : [ D ESCRIPTION X C b la w est Ø ª ê ³ ar a he t ge titem Ġn ão Ġin fer )) / ĠC a Ġ: ], Ġh ass ĠP I ĠB asic ĠN EG Ġ4 7 ĠR est 96 7 go v ðŁı´ółģ ¡ółģ Frame s Ġtensor s Ġweight ed network s Al chemy áĥ Ķ ĠTe am /( ? oriz on Scal er Sele ctor writ el Av g amb da squ ared retri eve xls x úmer o ĠDI RECT G AT K Z P eriod S pect c rs k c l x m orph o sp w arm Ġ" ( he ss Ġd ns li ct Ġm ut ra sh la in ad ir co pi Ġto gether Ġ7 13 ĠA v ĠA verage ke leton am i Ġh s Ġj np Ġlog ic min ute SE TT jo urnal ([ ( LE FT Ġ{} : lin eno comp ress Ġsc r dis count State ment ram id inf os fri end : ]: C loud D Z N a S ta V V d ating f z q r ´ ółĢ Ġ 87 Ġc el Ġp anel he uristic 00 1011 Ġs lim Ġs lope li z Ġw av Ġfor e ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠ Ġu i que s np z Ġso ck Ġauth entication Comp liance ĠDe velopers UB LE 0011 101 ĠPRO C ĠAc cess past e Ġpot ential ' $\ 8 18 C lose D L F B F ITS M ag T ON T orch T URN ] }, b um c mp d types g ather s co Ġ ĊĊĠĠĠ Ġp rom lo od Ġn r ra ms Ġe cho id o ĠS eries ĠC AR sp dy vi rt Ġy s 92 9 ðŁ § comp ressed wait Key ĠPro gram Ġlimit s MO DULE PL ES 0100 011 medi um ĠEn try CONT AIN Ġ'{} ' Ġtol erance ĠDIS CLAIM ĠTech no 2 19 R ob ] == f ab m J Ġt d ti al Ġ" ` li a Ġg ap Ġr cl data class Ġh y Ġh uman =' % Ġ3 600 Re mote add Handler AR R Ġhe alth Ġ6 3 06 7 Par ticle Ġag ree learn er LLLL L Tx Params =- =- docs LoadBal Jo int FR AME Row Status Ġhand ling Ġho pe WH ITE Inst all C ENT D ump P op S ort S ESSION h m h z in file st able Ġc ards Ġf rozen Ġs al Ġs alt li min Ġ1 08 ĊĊ Ċĉ 99 4 Ġst ick pro blems ang o Ġbe am ĠG OO start ing Ġ'- ' reg istration client s ĠIN PUT ={ }, game s mer ged WAR N Ġtransform ers ĠApp lication Ġweb driver ĠAl low CONT ENT ĠId enti stick er IGN ORE CHAN NEL Ġaffili ates : ]. B G F ONT W ave ] ][ Ġ ################################################################ Ġ ERROR į ç½® Ġ' \\ ch ors ve ster ĠC PU Ġg aussian Ġst uff Ġpro duction Ġj ump ID D Pro xy ĠCon tain 36 7 au ge ud get ran ks annot ate ĠLo ss GR AM еР´ è¿ Ľ come s Ġsepar ated å¼ ı ĠAD V Ġpermit ted WIT H M apper b roadcast h ide · ółģ¿ Å ¼ É ¤ Ġt ran an imation ro utes Ġp en ct est Ġm ount la ps ĠT w ac i Re c Ġ4 3 ĠW ord ĠU ti 15 9 right ness ĠH ere Ġsh own 27 5 24 4 96 8 Ġcomp arison 97 6 Str ategy IB ILITY Ġiniti alization ĠDe te track s fin ite NE CT Ġ---------------------------------------------------------------- -------------- Met rics /" + ĠLO SS Bu cket arti st čĊĉĉĉĉ ĉ ĠMat rix uggest ions ĠLin ux Ġrepro duce H yper N Z Q CTF S ome W rit ¶ ółģ¿ Ġ ]: se cs ar ity ti ssue Ġa ble ad ditional sp o ub ic ĠD on Con tact mit ted inter section 97 8 ull er au sed Ġend s call s iss on Ġnorm alization Bo ok Gener ate åIJ ¦ TER N upy ter ×ķ × , [ ; "> = ") C l H w I UM L AY M J P ART T ASK V ari p ing é ł Ġ čĊĠĠĠĠĠĠĠ Ġp si Ġs uc ct r ma zon et une ke w Ġh is Ġpar ticles ap tive ang ular ph inx 15 1 100 11111111 AM ETER {} \ 86 5 26 6 Ġne ighbors Ġte ch ear er Time stamp ĠPro file she s Ġstd in Ad apter Ġì Ŀ contain ing sec ure Down loaded enum s ĠMo di 4 35 = / > / C LO G AM W L c url j Y s ch u med y our º ółģ in structions 00 101111 Ġd c set Text Ġdef initions Ġg al Ġro uter ign Key 03 8 spe aker Ġinter est ]] ), ãģ Ĺ link ed match ing fy ing Ġexec utable Ġtri angle clean ed áĥ ĺ Ġpe ak termin al Pool ing íķ ĺ Mark er Ang le " / H RESULT W in a de b j c andidates d ut k M u um } }, à ī è ª ar o le af ul ly et ree ĠS m Ġl it to k ase d ĠV e ader board ')) . Ġag ents graph s Ġlength s Ġlicense d ARTIC LE Ġestim ator Ġspect rum ="" ) COLUM NS tit ude SNMP v A xes P F R X T HE T ick V I b ow e u f k m usic w allet in formation Ġ= ================ Ġc isco Ġs un Ġs ho to do ĠD raw Ġpro bs 92 6 In f ĠG lobal Ġco okie format s ag ation 04 7 88 6 57 7 upp orted 66 6 ns ure ome ga vo xel Ġproject s dot env fla sk initial ised ites pace slot s orn ado Ġtw isted ĠForm at Ġnumer ic tan h Cla use 2 13 4 28 > [ I con e ven f em } -{ æ Ļ Ġf allback ur ons Ġb ri )) ), iz ing for ecast Ġma king tra jectory ĠB uil 88 88 AM PLE ran ty win ning Ġparti cular ĠRE AD effect s CONTRO L SCHE MA , :, . '. N ONE Y A d X k top at las Ġt a Ġn y Ġin crement Ġd pg Ġ# ---------------------------------------------------------------- Ġ( ` ath s up ancy ance st pre view In cluir ph en da emon 84 6 Ġcomp utation 55 6 av y 86 6 mon g ĠIN C Ġread s let ters Ġlocal param ãĥ Ī GR AY åħ ³ Function s OB JECT Ġdec ay Ġissue s ĠHe art åİ » ĠOther wise 3 98 A FT B OT C lean U LE U AL ] ]. ` ) e ast f path j peg p omerium q c u lo Ñ Ħ é ĸ Ġ åĪ de ad Ġd cc Ġm ul fi xtures def initions ĠC ache for d Ġcon version Ġcon structor Ġst o Ġde que ĠR ow per formance ĠU ns AG C led ge ãģ Ħ vide os Ġwait ing bind ing Ġutil ity Ġfeed back NU LL Ġsmall er deploy ment ĠVAL UES Ali gn Fc st # ================================================================ 4 38 B a F ace P ackage R ENT T W Ä Ļ at ural Ġt weets Ġp atient ch ord th ers (" .") ĠS a im write ĠM er ĠM ar ĠE l ĠN UM ir m Ġ4 9 Ġset attr mat ched 24 0 24 5 00000000 00 ... ", Ġne ver 000 111111 Ġsp an Se es Ġgener ic gn u ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Input Tag BU FFER dec imal ven tion Met er ìĿ Ħ Ġcap acity fun cs Ġtile s resid ual Ġarti fact SEQU ENTIAL M is N L Y S c ern l lo t ro w heel æ Ł¥ in ning ar ticles Ġf urther Ġm icro Ġe asy Ġ# : ed er is y ') ]) Ġl ua out ube 32 0 ag o Pro to CO M 77 7 ĠIN DIRECT CON NECT Ġ202 2 Ġì ł fin ish ãĢ Ģ æĪ · SP FA 01011 101 Ġ:" ", " ; . ], 3 93 4 34 L AT T r c ion g f m ic p an p ressed v iz x E Ä Ł ç ¨ č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ re moved Ġp b ction aries Ġ7 3 ĠC at Ġh p ĠL a Ġde crease ĠD NA lab eled Ġpro d Ġ4 03 fo od ph ysical 03 0 Ġch rom **** * 88 5 DE P Ġne ighbour Ġmo lecule initi alized 89 03 ell ar Ġqu ad EX P Message s Key board Ġoptim ization Ġvari ous pn ic Ho ok ufact urer ipy nb ĠKeyboard Interrupt > ` D ot Q m W W b N b et c andidate d I d ater e z f D j k m w n nodes } ; ¶ ółģ Î ¹ ì ĭ Ġ 93 Ġ ठpe aks Ġw inner ĠA B Ġde viation Ġpar ticle ĠE VEN mo vie ĠG PIO da mage Ġ6 1 08 5 ĠRe f 84 5 RO P cor relation Ġarg parser gen ome ĠSt ream ĠCON SEQUENTIAL Bo ard stack overflow Ġsupp ress Ġport s Ġlib raries ordin ator Ġcl one Rout er ĠRo le ĠGe cko 567 89 stit ute remain ing //////// //////// mig rate - ') 8 93 > ( C AN C lasses E V R W r ating s an å Ļ ê ¸ Ġ  re dd Ġ' '). Ġp x Ġf ar ri eve ch kpntTrap Ġ7 6 ab out ĠC ho ĠC ategory Ġr tol end points ĠP ins Ġas k =" \ Ġ_ (' Ġse ason ĠN on lu a Ġun pack ĠU P 25 4 ne uron Ġdi alog sk ill ak y Ġraise d Text ure new line CH AT pl ant sg i tiv es Ġ'. ' ĠGener ic scal es END POINT apt ure Cal cul GEN CE ĠLO GGER Open Sees 1011111111 1111 BACK END Ġbuilt ins Ġfri end Ġabstract method Ġada pt Does Not æ¨ ¡ áĥĶ áĥ ) }) D M F G F ree K ernel M ost P ACK d ro g ca p al é « ro gram ti er Ġc are Ġe tree Ġb atches te le Ġ[ [' is digit con da ĠC L Ġl umen list ed out dir ĠM eta ĠB ot Ġon line scri ber 64 8 Ġcomp ression Ġnew s Ġdis patch ENT S vid ers Ġsupp lied Ġbu ff PRO P sim ulator include s ĠLog in << < quanti le Sk ip ('_ ') è¾ ĵ ĠAb stract ĠPi peline '`` : + ': d uplicates f ac r w Ä ħ è ¨ er k ro c Ġs f Ġs sh Ġs ay int ent ĠS to Ġg ithub ta iled Ġst e fig ures 06 6 Ġz y Ġ8 1 obj s Ġread y 000000 10000 common s ãĥ « QU ERY EM PT math rm Ġlink ed 011011 011 Ġangle s COMP LEX disc ard gradi ents ĠMax imum 4 85 4 75 F ill H ttp M ultiple O IN Q R h id t rees Ġ" @ Ġin struction Ġo u Ġd u Ġe lapsed ĠF ire ĠP V sh m 92 8 In it Ġpre vent 24 6 Ġext end 66 5 AP E OT E check box AD MIN ]] )) ĠCON FIG mplement ation æľ Ł Sim Struct BL ACK like lihood ĠPRO FITS compat ible Ġcallback s AUTH OR Mon th Ġvisu alize celer ated ä¿¡ æģ¯ ĠNEG LI 3 99 I X K L M X M Z M aster b K b w b as c as d up e lapsed h f l U s lices s aref è ´ Ġ ÑĤ ro ids Ġd d Ġm omentum ra ce um in as n Ġ7 7 ĠS hould par s po ssible Ġas sembly sh op ph oto iti ze 37 8 Name space 36 6 si mp hel f ĠTrans l Ġap pear organ ization ĠFI LE ony mous Ġlex er ĠValidation Error ĠNEGLI GENCE G u N ORM S i S chedule T L b al i ra w ell ë ¥ Ġf act ame l li day pe p Ġm otor ad am Ġw arn Ġ+ \ __ ): up grade Ġx r Ġun less ph y format ted Ġ5 3 Ġpy torch og ene ST ER ari al Ex port Se ction Ġus b pri m `` , âĢ Ŀ context s Ġframe work Ġmask ed Ġzip file NE W ĠKey word аР» 111111 100 ĠQt Core åĬ Ł FIL ENAME ç» ĵ km uller men tion Ġwar ranty C SV H P _ = b v c are g ot p C y min | '\ ar ter Ġb ug get value ab e ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠ Ġ3 60 Ġthis Component ĠH and iv y lat ten Ġ| | AP H io us Ex ists Ġinter action top k Un its Ġseri alizer nap s track ing Ġhost s sen ger xF C Down load Ġplace d Ġpr incipal Ġlow est 011111111 111111 Ġmag ic pipe lines Validation Error mapp ings DoesNot Exist é« ĺ / {}/ 7 27 C W G UI H ow H ome P ARTICLE b isiklet c ro d on n es r q x FA y max É ¯ Î µ Ġp run Ġn uage Ġre start Ġre cogn Ġ1 15 11 1011 op ens ĠC allback Ġl hs if e 02 8 ĠB isiklet loc als St mt ĠCon tact 94 5 av atar Ġne utron Ġsp acing Ac tivity Ġtrans formation čĊčĊ čĊč ãĤ ¹ Ġextra cted scal er áĥ IJ cer tificate parti cip UU ID Ġri sk ĠBy tes frag Two Ġequ ation Fi elds å§ ĭ epe y N ow S lot V IE d ms j u j et Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ er g Ġp ic Ġf lt ĠI E out s Ġse ver Ġse lector ag tail ass is RE E pos ix ĠIn tel 011 00100 cri tical Ċĉĉĉ Ċĉĉ 45 4 Ġformat s Ġcor ner CE PT Ġ". / Al arm ERR U hex digest yntax Error Ġdisplay ed EG IN ĠSpe ci VIS IBLE irt ual ) '), H K M ar O v P J S ys T N T IM V endor b ench m time n op o ser s lope Ñ ĸ ro is Ġf x li ms Ġe arly Ġ1 18 Ġ1 13 Ġw alk Ġ[ % from timestamp qu bits Ġme asurement ĠE mbed state Mut 57 8 Ġ8 00 do or DI AMETER Ġuti lities MO D PL UG Ġoptim al TE MP ĠBo x 005 02 ĠIniti al Uti lities PN G (", ") capt ure Ġgate way ĠJson Response taint y uclide an åĻ ¨ stateMut ability C lear F igure K ER T I ` : l ens m oney v an or ient Ġ# ( 11 00 0000 011 ĠM a Ġ* / Ġx i Ġma jor ject ories Ġres pec bo lic OR D Ġat tention ĠH E ][ - 84 8 33 8 85 6 return code so cial ud ents CH AIN Ġver b DO UBLE DAT ASET roll ing Ġshape s ĠCal cul ĠCom mon è¿ Ķ MET A éĩ į MAN AG FFFF FFFF ĠPO SS episode s Sign al Ġvo xel multip lier IDENT IFIER æµ ĭ ì§ Ģ ĠDISCLAIM ED + ) 9 01 9 19 F IN G aussian O ID P omdog T ok b ranches i ro k U l w m om n w s nap or ange Ġt ax Ġ' {" Ġc r id en el come Ġg ram Re view app le sh utdown ĠO Data IN ESS pre dictor ap ers ag ination ST IT em y Ġfunction ality auth ors title s Ġmo tion Ġad apter fil ing gener ation ĠDe velopment FL Z report s åº ı Ġinte gr 011100 11111111 curr ing Ġlon ger ç® Ĺ Ġsimp ly A CTION h ave j it s ystems } ) | B Box G REEN N I P erson h al l bl r ubi t ang w f Ī ĺ Ġre wards li ding Ġm n pp ath Ġh aving ub er res olver Ġst s ĠD ummy oun try Ġos lo Ġpre tty eri o 34 3 27 4 Ġsub parsers 26 3 vis a ateg ies AD ATA cre ator ĠSe curity 101 01000000 Ġdb c cluster ing dec rypt Ġloc ale Ġ"_ " Ġglob als éĢ ļ Ġfra c Search CV Ġhand lers tw itter ĠOUT PUT ĠDAM AGE 1011111111 11 Spe ci COMM AND THRES HOLD Snap List ĠPOSS IBILITY ĠINCIDENT AL ! ' + ", M AT R aises Z ero b rand c amp f out s mo t Session w G y t ĠĠ ĊĠĠĠ in spection st rength un tracked th umbnail con struction ab o 10 11111111111111111 lab s SE D index ed Ġne arest 44 7 Ac celerated stat uses Ġcontin uous MO VE Ġvis it alle st ynam ics noti fications CR Y Ġlat itude Ġsav ing joint s Ġnumer ical cons istent ('.') [ adapt ation ĠINT ERRU MED IA ParseTree Listener Ġgd al TRUST SEC SETT INGS ĠADV ISED 7 00 A fter H U L ES M ARK S ig _ | g iven Å Ĥ č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ on ential re cursive me as Ġp ys Ġp ay ce eded un a Ġ1 03 ul us Ġr ubi }, { ĠU sage Ġ6 9 back bone Ġspe aker Ex periment Ar ch cent roid Ch g wh at ren ce Ġiniti alizer âĢį ðŁĴ Ġexec utor xx x Up load Ġtri m vers al month s trace back ĠAd min Ġtick er analy ze Ġresid ual ĠSU CH interpol ate Modi fied ĠSTR ICT å» º + - G radient T BinaryProtocol ] | u zz v V à ´ æ ± in ventory or i me mo ort ho Ġre ally () - ri cal Ġg as Ġg ating pro files app ings add resses ĠB ad ĠB USINESS ĠN eed read Field read Struct url lib Ġ/ > ðŁ ļ write Struct 27 8 24 3 Ġno va 00000000 0 Ġmo vie Ġad ds Ġ& & she ets Tra de Tra ce åı ª Inter nal Al gorithm Ġcluster ing leg al æĪ ij ĠTensor Flow Const ants Ġbutton s Ġ"{} " WE VER ament e mq tt ĠHO WEVER LANG U Ġregard ing communic ate CONTAIN ER ARR AY ĠINTERRU PTION TBinaryProtocol Accelerated B alance F e F old G IT P atient X R [ [' f ort g oto } % } )) Ġ aria Ġt gt an on Ġc art Ġf amily Ġs atellite un t Ġimport ed Ġfor ecast ĠS DK ĠC ent ĠF ast log ic ĠP AR Ġde precated time steps ĊĠ ĉ are as In formation Ġkey board ĠCon s 95 4 ... , TR ANS ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠ database s Token Kind cla use ĠEX EMPL USER NAME stock s Ġclose st ============ == sal es ENS OR Ġpur poses Ġindi cating ('/') [- ĠSUB STITUTE Ġlarg er ĠPROC UREMENT ĠGOO DS ĠEXEMPL ARY , )), D OTA F un G iven T D X y \ . c ite d uplicate h ierarchy r df é ĺ Ġ ht Ġ licenses in voke at tle de ck us b con j ĠS ent sp ot vi ties ĠP ack Ġse aborn Ġma gnitude AT TRIBUT min i Ġpy mongo db s 84 7 List Response File Path Ġseri alize ĠTHE ORY ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠ PAT CH Com ment pr incipal ĠNo tes ĠCreate s BU CKET AA A ret ch Graph ics arti fact å½ ĵ flu id A udio B W B us F ra M achine O ct R PC T issue U AV b ing m omentum s low å ĵ é ľ en tion Ġt c ro unds Ġa u ra cle '] ]) ĠP ATH ĠD ocker IN ET Ċĉ Ċĉ ĠN E fo x St ar AN Y 22 8 comp ose (( ( AS ES 97 4 26 8 23 0 Ġmin ute PO CH Sp an drop na Gener ating velo pe tuple s Ip Address 9999 9999 æĺ¯ åIJ¦ ima genet ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġhist ogram Sele cted ############################################################################ ## Exec utor Ġcomm unic Ġcer tificate sci py Ġfri ends ĠCA USED shm allow ) # C ross I ds M V b k d D e ved g ates h cp r V s and æ ¸ re ceived ti con Ġo l Ġd er Ġ1 25 el t Ġreturn ing con version ĠC ir ĠF igure od o sc roll ĠP ower =' # Ġst udy im ate ac s min us ml in Ġcur rency 44 8 Se cond 35 3 Ġsk ills Ġar row over write gr p CE LL ĠCh rome ĠMe an Qt Widgets POS ITION 1234 56 Fin ished Bot tom cdbp PeerStats webs ocket ĠSERV ICES 6 04 @ @ N ull d pi d ust d na f ers h an p z p itch w ins ¸ ółģ¿ al go () ( ri a Ġw heel (' // Ġto do Ġ7 8 ĠS ize ") ( ") }, Ġas pect ĠL i key board Ġy es "] / ir ing Ġout side Ġpo ss Ġno me Ġdis p Ġtrans ition top ology Th ing Ġtmp dir domain s ĠMibTable Row Ġhandle s Ġconf usion Ġdat aloader sn mp pn m Ġcop ied è® ¾ ĠExt ension VAR I iso format WR ITE ENS ION ĠSum mary Ġamp litude . ''' B IT J Z N v c ros d nn m h w k y an Ġ qual ĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠ on ic re ceiver st ub al ter Ġo thers fi df di ce ĠT EXT con trast ĠS ensor ht ag Ġg zip Re vision Ġget opt 32 3 Con tour 37 9 Ġcom ma av ed iv ot Ġz order Ex pected response s DI ST ĠÐ ¼ ERS ON dist s и Ñģ Ġloc ated Ġ$ { sql alchemy factor s ĠApp le Ġlong itude Ġtick s pla ces ĠCO MM OPT ION æł ¼ king dom Ġcomm unity Ġcdbp PeerStats ĠUni code Ġadj ac Ġali ases Ġck pt G W G AN l h m irror s am å Ł re di se x Ġt or al hes ti vely Ġc x Ġc id Ġc as Ġc nn Ġc andidates Ġn lp Ġs po Ġin file Ġre ceive Ġd uplicates li ver Ġm iddle Ġe igen Ġb p Ġb roadcast Ġ1 12 Ġ( : set attr ĠA M ĠA SC list ing Re LU Ġv min ens ive 07 4 ĠB O dir path ĠV n St d Ġ8 2 Ġne ar Ġlo s trans ition Ġli ve Ac tivation Ġload s TR AP Message Route rand range åı · inte gration Ġtrack er mut ations Que st éĩ Į ĠMo ve ners hip press ure Temp erature ~~~~~~~~~~~~~~~~ ~~~~~~~~~~~~~~~~ Ġinterpol ate Ġaz ure ółĢ² ółģ¿ Realm MessageRoute opens ource è¿Ķ åĽŀ MANAG ER 6 26 B P P ol U Y ] }) c L f lex m v å ģ ti ca Ġp ants Ġs z Ġd l ot hed Ġ+ ' (' * )) ( pp ers Ġg ives Ġr t ==== === log ies ĠL td oc ê ĠG UI Ġk ivy Ġ6 2 gra ma 08 8 22 1 95 8 Ġ8 3 66 7 CH O 46 5 Get s part ner å¤ ļ render er interval s End point Ġreplace ment IZ ED Ġdepend ency ĠSQL Alchemy CLASS ES Temp orary éĻ ¤ æŃ £ âĸijâĸij âĸijâĸij dem isto Cho ice çĶŁ æĪIJ ĠFail ure ! ", A p B lob C er D CC D ummy E lect G reen G PIO M G M ass R ON S aving W hat b ur i als k ely v f v cf v tk ² ółģ¿ Ú © é ļ in str Ġre ceiver Ġm ime Ġ1 34 arg min '] ]. Ġh um Ġh ypothesis Ġde ck Ġse ctions ĠRe cord Ġno se 56 8 pri v ä¸ ī cp us Ġiter ator na ive Ġdir name spect ra exc iting Ġclean up Ġmonth s Ġsepar ator Ġbegin ning disc ord Ġvol tage íķ ľ Ġsen se åĨ ħ ĠRedistri bution Connect or A sync B H B RO D g O h P ING X q c ampaign Ġ life re ach Ġt tk le ars Ġi ms Ġc rit Ġs up Ġd ry ': {' str y con tra ĠS end ĠS ec ĠC S od d po sed ĠP layer ĠP lugin tri m ho ver 25 8 ax ies Ġal gorithms Ġpre processing Ġ/ * Ġ[] : comp ression ID GE 27 3 Ġac tiv Ġac counts row th Ġmin i Ac curacy 35 8 Ġim gs Ġ201 0 vid ing dic ion dic ates 1011 0011 Ġnetwork s gre y SO URCE ĠXXXX X л и super visor è® ¡ erm ine UNK NOWN Ġten ant Ow ner ç¨ ĭ redd it ) +" / %( C ut D ES E Q O ther T ab W ER p aper v y Ñ İ ç © Ġt ransport mp eg Ġf requ ĊĊ ĊĠĠĠĠĠĠĠĠĠĠĠ ction al ĠS uccess Ġr ather ĠF rom ac p load txt ĠE lement loc ate da o we apon Ġdi e Ġ` `` Ġmin or UR ES pri mitive Tra ined Th ings оР± Group s ä» ĸ Dis k BO OL ä½ ł Ġpad y elect ron Wh ite Ġmis c aur ant Ġmac ro inher ited ĠFrame work Ġzo om B SD C r D NA R i T ry V y d v d ers p res u tions Ġ lot Ġi ss Ġs ing is er Ġ7 1 ĠC lean ĠC luster ke mon ĠE qu ĠE DIT ĠR ender 04 6 ST OR Ġra ster 22 3 sk top ĠK iss view er 26 0 Ġfunction al ET ERS LO BAL ĠPro duction Ġstri ct fr uit Row s REG EX Ġspecify ing bra cket Initi al Ġdeploy ment ĠPass word emo ji Tok ens G g O U O UR T K T urn U DE Y es ] > _ {}'. _ {}. h ack r ms t gt w W z Z ¦ ¬ Ø Ń č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ in der on nx st udy en n um ing #### ### Ġ7 4 ĠS M Ġth ickness ex pires Ġy min [" _ ĠB io col lector ĠU RI SE CON cs rf LE ASE RE GI ĠRe quired {} > AG G Ġcheck ed 44 5 Ac comp Ġcan onical vis ual Ar ti Ġspeci fies dire cted Ġauth ors Ġtop ics оР³ Ġoptim ize н Ñĭ inst alled Ġvis ual ä» £ 10000 0 åIJ Ī fetch one depend ency éĢ ī Ġprob ably mis match ĠAss ertionError HEAD ERS ĠIs land Role Assignment ĠHow ever BIN ARY Ġsever al + ] 4 16 9 10 P ur b ol b idden f P n di p key z W } ` å ķ re load de mand le e le ave me ss Ġd ense Ġe quivalent la x Ġw b ch rome ch allenge ĠS ur ĠC lose Ġr f 01 00000000 ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠ ĠI Python sh p Ġse m Ġco v RE DIS Ġwe apon Ġsub scription 57 5 Ġ[' -- IM G AP PS check points of ficial Test ing ear th Lo okup block ed fir med čĊčĊ ĠĠ Ġeval uator äº Į ĠEn ter Ġnoti fications ĠMan agement ĠPo licy uplic ated Ġfast er OB J Ġplace holder ("/ ") Dire ction ĠXXXXXXXX XXXXXXXXXXXXXXXX pret ty bul let Cre ation Ans wer æ® µ naps ack : # H AL S Z U uid W AY b or f an g id g rouped j d p seudo s lack v ot Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ se crets al phabet Ġp sy Ġf ully Ġa ffect Ġn om Ġs ound Ġin verse Ġre name Ġd ark un ded Ġm ne ri ent and a ul ations is kit data store ult y qu ent ect ed ĠB it min ator Ġk ill 64 0 AN GO net s Ġ8 9 trans itions ud nn ng r Ġfeat ur CA LE can onical Ġ---------------------------------------------------------------- ------------- Min imum MET ADATA ĠEN G poly gon lishe s ĠCont ent Main Window ĠAnal y pay able suc c ĠRES ULT PLUG IN 7 85 ; " B AD C Z F bx G i H g L ONG Q a S rc T ail U i i et u ario on omy en k ar ound de limiter ti vities Ġ" \\ Ġ" ../ Ġin coming )) /( th rough Ġg p ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠ am er to ggle ĠD IR čĊ ĠĠ model ing fo oter ĠU I ĠU TF sa vet lt as 84 4 24 2 AG IC Ġtext wrap so ftware ({ }, ĠCo uple Sh ort RES ET Request s Ġph oto For ce PR ITE af ari fill na Ġ"- " spect rum termin ate к а ĠIter ator çĽ ¸ LOC ATION Document s ĠTra ck Ġanaly ze TEXT URE Dep th 00001111 00001111 ĠSign al ^^^^ ^^^^ Ġcum ulative ĠAns ible éľ Ģ ĠENG INE + ". 1 000000 E F F eed H ot M i O k P arent b link c w c bar f X g uest n os s chool t re x B x iv Ġ ES in dividual re cogn st ress Ġi ma Ġc ategorical lo ve Ġo ct Ġd ag Ġm or Ġm se Ġm scModVcs Ġw arm di vision and b ĠS chedule Ġdef er Ġg rids ĠA gent vi er =' ?', ex er Ġy label ER ATION ĠB etween Ġres olved Ġun ion ĠW ait Con dition Ġrange s Ġsc oring 55 8 Ġindex ing dire ctories Ġup loaded Ġcor relation ðŁı´ółģ ®ółģ ie ve bl ank PAT TERN fit ness Ġhead ing =_ (" radi ents 202 2 Qu anti Check point Norm alize Ġfast api Ġfactor s Ġplugin s free ze ä¾ ĭ æŃ ¤ ali ases separ ator Util ity Ġinher it 277 47 # @ E LL J P S ql S ync d raft e h v ic w ill x D z m ç ħ Ġt ape Ġm orph Ġ# ------------------------------------------------ Ġ( ? "" . __ [ set ta Ġ2 05 as pect om aly čĊ ĠĠĠĠĠĠ ci ties AT OM sa mp 25 3 ĠRe cognition 09 4 Ġno inspection Par allel ... ) De code ðŁı´ółģ ²ółģ String IO User name Ġman agement QU EST Ġoffset s dat atype gre di ĠBo ok period s Ġrep lic ĠSp lit Can vas Ġasc ending Ġdem isto A ctions B V C a F requency H DR I ssue R t b es f olds j x y i  ² Ð ³ Ġ ub at ures st pid Ġi b Ġi l Ġ" ), Ġre ach ", ' co pg Ġb old Ġr d qu ick Ġh its ĠM IN ĠM agicMock Ġv oucher ĠN v ind x ĠG ET Ġclass Name reg ressor 44 4 vis ibility 47 6 order ing vid ence Ġback up dic ators Ġdep ending Ġkeep dims click ed ĠName d Read ing IST S ółĢ° ółģ¿ plan es Ġcombin ation Sample s ĠEng lish ĠNorm alize Ġexact ly Head ers aggreg ate autog rad ' ") E POCH G rp H ist M s M ngr N x X V _ '+ c us c rt f esc n ct s x Ø ¨ er ry re ceive Ġ= ', st pnm Ġp atches Ġn cols ut ral Ġo sp is a il ton ĠP DF Re set Ġy max mple ments ĠB ASE train able ne ar Ġle af iv ing cal lable pop up ĠOR DER norm alizer cent ration ãģ Ł Path s Ġback ward ãĤ ¤ Ġobtain ed Ġabs l Ġsa mpler Ġnetwork x Te am åIJ Į Ġpad x à® ķ Ġfree ze Ġpoly gon Av ailable Ġsy mpy Wor ld dri vers ĠBytes IO ' ve ' +' B eta F etch H UB M W e ma f ar k h m or n ft p or w sgi Ġ ens ľ ë er al ti cket Ġd os ra s ri al Ġb rightness arg types Ġh f all ery Ġex change ĠD ropout os ome ap se Ġj sgParser ĠR ule ĠR ULE Ġlog ged Ġco me Ġch ord Ġsh ader ĠCon tract lat ent 00000000 000 Ġext ended Ġper formed ĠQ uest norm als vo tes Cont rols Ġman ually author ization dat al contain ers sen timent Per f cap s +" / Ġ---------------------------------------------------------------- ---------------- Ġlook ing å¼ ł BUT TON Ġidenti fy čĊĠĠĠĠĠĠĠĠ čĊĠĠĠ effici ent Stat istics pas sed Arg Mngr sb j ........ ........ ĠOp ArgMngr Su ite ê¸ ° H ex O J Q CA d H m otor q i s ink u á» v it É Ľ æ ĥ č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġc ancel Ġp ie Ġ" ^ it r Ġre store un link Ġe mb Ġ1 22 Ġ1 21 Ġ{ \ sp awn Ġu gettext ]) / os id AT TT ĠN or Ġun signed Ġlist en Ġro les cept ual Ġal ter AN AL (( - Ġpo inter au li Ġne ural check er ĠTest s DIR S Ġ.. .. duce d fin der Ġsend ing cap it ############ # seri alized dr ug rest ype va e åĬ ¡ å° Ĩ ı n Ġinte gration ĠST ART Ġlon gest éĻ IJ åĨ Ļ иР¼ Ab stract cum sum Child ren ĠEd ge !!!! !!!! ĠDire ctory shelf Idx ĠFa iled áĥIJ áĥ B est I LED S ent a max n om s lide s lider v lan y olo Ġ ĊĊ in sum or al re cent Ġi x Ġf all Ġf ac he et ut s Ġre cur Ġm al ch k Ġ[ {} ve hicle ĠC ore Ġ: = vi r ĠP os =' ./ pro x ac tiv ĠM L nt he Ġpro g tri bution che m min s Ġch apter 27 0 av as Ġdis count cor ners obj Prop UR ITY Ġgener ating DO C Ġseri alizers âĸ Ĵ over lay PU BL Pri ority success ful Ġcore hq ĠTrans action semb le wav es ced ure week day Left Overhang Dete ctor XY Z Thing Producer savet xt 3 11 3 13 4 19 5 64 6 02 > { A ug A tom H i R ST V P g un } ], å ĥ Ġc au Ġn c sel ines Ġo mega fi o Ġ1 07 Ġ1 26 Ġ1 35 te ll set Formatter Ġ7 9 Ġcon ver ser if ĠP ur pro ba Ġex periments ĊĠ ĊĠĠĠ Ġpar agraph ĠW ill Ġpy dantic 34 2 09 8 Ġtext ure Log ging Ġman ual Ġlib s Of Things оР¼ Ġclo sing ee k comm unity à® ª EE E Ġreplace d ĠFunction s ĠField Panel Go ogle Ne g equ als bri ef ĠOp tim SAM PLE Ġwi res Ġproper ly âĢįâĿ¤ï¸ı âĢįðŁĴ ĠTree Node Ġci pher GAM UT ĠTransl ators ĠFIX ME âĢįâĿ¤ï¸ıâĢįðŁĴ ĭ : ])) ; ', A ctor A FF B lack C apture E cho G U H ASH R B V OL c z d O e ti m oment v oter x W at tempt re presentation de termin ti g Ġf f Ġs pread Ġre duction ing redi Ġd aily Ġe mo Ġw f Ġw avelength def ines ĊĊ ĠĠĠĠĊĠĠĠ set ype th ro pp o pp rint ĠC opy sc orer vi es ĠL ED ĠM atch ĠM ust Ċĉĉ Ċ Ġj inja oc p Ġ5 000 ne e ĠRe quires mat rices Ġwe ather 24 57 Ġser vers mark up 82 17 sv m ãģ ¯ eval s ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ãĤ ¯ Sh ift Ġnoti fy Ġsplit s ĠLe arning Ġopt parse document ation аР· BO X Ġtrack ing zy AclV à° ¿ volume s Ġcorrespon ds Ġlat ent bus iness åº ĵ cert s Wh en differ ent ê n âĶĮâĶĮâĶĮâĶĮ âĶĮâĶĮâĶĮâĶĮ æĮ ĩ Ġflo or brain visa Ġflu id EMPT Y VIE W reion mod ) ]. 3 000 E s G round H G L W S OL c D e uler v F v b Ø ¬ æ ¡ é ĥ é ķ Ġ ------ in n er ation on der le et an ies Ġc trl Ġp f Ġf b Ġn úmero Ġs lices Ġre shape Ġw raps __ ", str ate Ġg g ": { Ġcon current om b Ġde clar ======== === read ing ĠV Base ĠV ideo 25 2 iti vity 34 0 Ġjson string 44 6 clo uds so lid err no mer ic Loc List sim ilar Ġvis ible Ġsecond ary Ġdebug ging ÃŃ do Cal lable reduce d crop ped Ġvo ice INTER VAL FUN CTION omin ator ìĹ IJ Uns upported éĽ Ĩ Ġstand ardi ALLOW ED ĠIE Core 3 16 4 77 7 36 G it M Q M ASK W ords p q Û ģ ì ľ Ĥ ¬ Ġc bar Ġf ine it able pe s ra da co g Ġto k ĠA BC qu id ĠP ub ĠL et im als app a ER N Ġme mo ĠN ational ĠR ot Ġen vi 100 101 ari os ([ ], ĠRe lease mat ic ast e Ġ` { Pro b Ġdo ctest Ġend points ĠJ OIN head s ãģ ª ERS ION uni If Com bin BO SE Tag s ĠTo ol IZ ATION Ġtick et л Ñı ĠDo main sess ment squ ares attach ment ол ÑĮ LABEL S dispatch er quis ition Ġled ger NORM AL avas cript OfThings Producer C li F ER H azard V X c nbtc n rows u er Ġ entropy Ġt rees Ġ' & Ġa way Ġs lug Ġm appings di alect Ġto po con ver sp rite ist ical ĠP lay ĠL ast ]) ]) Re moved ĠM ode ĠM ultiple Ċĉĉ ĠĠĠ "] ): ir y Con verter 06 8 sub s Pro blem Ġdf s sent ropy Test Model PE G sign up ðŁı´ółģ «ółģ ĠException s Max imum ik a itor ies Check er Fil ters parti tions Di ag Cal culate Ġhand led Ġgra ds WE IGHT çĶ¨ æĪ· ä¿ Ŀ Ġspect ra æĿ ¥ coeff s interpol ation è§ £ Ġhapp en nost ic Pub lish AUT O inning ThingProducer - ' C ri G as K S P lay P ERSON S an S up T EX i mag n T n ational p ulse u ss w raps ª ółģ at tempts st re ar b Ġs lack Ġm illi co dings 11 66 int ext Ġ( . from string "" ) ĠS ort ĠS PRITE Ġr m Ġl xml Ġ: - Ġth ing Ġth ink 02 57 ĠB ut oc ore SE ARCH Ġint ro Ġat ual pi ct inter net Ġare as IS H do es UR ATION sent s ĠJ an util ity а ÑĢ čĊĉĉ čĊĉ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠ Com mit ĠDe ep si vely ĠCh annel win ner '} }, ĠURL s Ġclick ed Ġassign ments POINT ER utor ial sn ake Ġfo od analy zer cycle s Ġcontribut or Ġcompat ible Ġfold ers ĠDistri buted ĠRet rieve PRI V çº ¿ HAL F ( {}) + "\ 6 55 C ounts E g I LL Y Z b ib k Z q ty v il v min x z y aw ¦ ółģ Æ ° Ġ × Ġ ################################################ en crypt Ġt v Ġi ou Ġ' | ro uting Ġc sr ', ) Ġs ystems Ġin c co vid Ġimport ant Ġto wer Ġg radients ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠ Ġh ouse =' %( Ġde cla Re ceived Ġme l ĠE nsure ĠR EST Ġlog file Ġco ef Ġpy tz ass oci cs r ðŁ Ļ ĠIn formation Ġcomp ressed 94 4 clu ding 85 8 ĠUn its Ġdescri be assert Raises The ta Ġcor r Ġpri m play list Ġ', '. и Ñı pen alty Ġbu y оРº dec ision ĠNOT ICE GR APH è¯ ķ mag ent xF D Ph one Struct ure Ġve h ÃŃ vel Stream Handler Ġface color slot Idx BR IDGE disc re mg mt sol ar 204 8 equ ipment æ¯ ı ĠDown load Ġevalu ated baz el 4 33 D UM L STM S HE T U T ol g ender p ct p alette v gg } - é ĥ½ Ġc ert Ġp ow Ġp seudo lo ops Ġ1 14 ot strap Ġto ggle us al ĠS G Ġg rouped ĠA z ser t Ġh lp Ġh params Ġst ores pro filer Re quire ĠE ner oc al lib raries Ġob served LE AN Ġsc atter aliz able Ġ} } Ġcont rollers trans formation cor der 35 4 atter y Ġ9 1 wait ing yp ical Ġdescri bed UL ES Config Parser graph ics "]) . tensor board Ġ". " Create s Ġwant ed Ġskip ped ĠXXXXXXXX X Element Tree UST ER ä¹ ĭ Ġpol l Web Kit Ġpla ces Fin der Extra ct é¡ µ Ġinher ited ĠRout e corre ction Forest Classifier ) % 3 56 A ut J S K HTML M agicMock O z X i d ap f all f ingerprint m ob r ates s ns x r Û Ĵ Ġ à at tn en hum Ġt cp al a ro ut it ations Ġn an Ġm oment urn ament Ġ+ " is ing ve x ĠS an ĠS tack ĠA li put Text ĠP ol Ġde g =" < ĠO ct Ġx max ĠR ob EN C ĠV ERSION ST ORE plot ting ĠH andle sub dir Data Type color ed Co ord 101 011 Ġsk ill 46 7 ĠJ ust off line Ġfilter ing ĠMe asurement button s Be am SH AR Ġcorrespon d CM D (? : RA W retri es Ġbul k æĶ ¹ Ġcoeffici ent BatchNorm alization éĤ £ SIM PLE Sta mp ' ; F ULL G TT H a O j Q n Q ual S cope T MP W o d N h ass l k n ight y c Ð ¶ Ø ³ å ¢ æ £ æ ² Ċ ĊĠĠĠĠĠĠĠĠĠ re comm re cognition Ġt l Ġn t Ġd om pe ts Ġe mit Ġ1 17 ĠS cript ĠS ince ig ate Ġr sp ĠA da '] }, ub es Ġpro ps ob servations ĠN orth Ġget pass 32 2 per ms ST EM index er gra ds RE Q ĠH as 34 9 Ġcomp ress Ġtry ing Ġdate util Ġend orse check sum Ġus d Ġmo ves nn nn not s ãģ Į ca o ĠÐ ± ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠ Ġfla vor Ġfollow s prefix es 012 34 report File ĠZ ero Ġjob lib sen ce eff ective ĠEX ISTS è¿ ĩ Ġhigh light Ġpop ulate << << ا ÙĦ ĠST AT Ġsen timent WA IT âŀĸâŀĸ âŀĸâŀĸ Rsp Tx Rsp Rx Ġwebs ite å¥ ½ ĠCre ating ĠCer tain Ġprom ote IGNORE CASE çħ § % . 5 85 5 86 A IS G ra H S H ERS N Y P atch R atio S n U r Z one [ ~ b an k u m I n ut t bl Å ¡ Ï ĥ é » de grees mp ath it ches Ġa o Ġs park li ps co ins Ġ1 24 Ġ1 95 ma ch __ ', ĠS ystems ĠA CL Ġh i ĠP ackage time line Ġos g ans ible ĠG en AR GS Ġhe art ag ue Ġint ensity CT IONS mi xed 23 1 =( - En coding bs d du ces block ing а Ñģ No ise ĠPar ser roll ment оР½ Ġtransform er cel ery Sub ject Ġans wers è¯ ¥ Ġpe sso ĠGe o Ġarti facts Menu Item ĠMO DEL Cap acity Cons umption âĸĪâĸĪâķ ij nost ics ĠComple x Dim ension ĠAT TR Ġzy AclV STOR AGE åĥ ı # : ) [- ? ' A udit F X G w M ay R D T V f ps f utures g is g ons m il m illi s ix v DataFrame Ê · ì ĸ de leg le ast me asurement ro bust Ġp at Ġp bar Ġs sl Ġd rive Ġm ult rom ium id ata Ġ[ (" (" :") ĠS afari ĠP rop ĠI I Ġde coded sh if ĠG EN we ak UT ION 88 4 AM A exp iration 97 45 {} : __( * LO Y Se par PO OL ĠPy Torch FA ILED Ġtensor board LI GHT Of FirstFixedSurface Def ine serv ing åĪ « Ġshow s Ġmock ed bit rary FO UND Pre dict Pre diction rad ar ĠConfig Parser dete ctions Ġow nership å° ± pla ys MET R Ġaccept ed Project s Ġè İ·åıĸ Ġvocab ulary Ġrelation ship Plus Tail ( = ) ': + ( : ( B ro B irth C AT C ancel H N O I S lice [ (' b boxes c ifar j alan m obile v j é ª al tern ce ptr Ġd m ad b ad as Ġ1 000000 Ġw ind iz ations ĠA L ĠF it Ġh ub ĠL ang sh ard ĠM AC ĠM PI Ġor ient ĠB eta Ġres pect Ġlist ed Ġpy lab config urations RE TURN 08 4 inter action em i ()) [ 20 93 the docs Ġbase name Ġclient s OP EN At tributes fla vor Ġedge color rat ic ä½ ĵ âķ Ŀ istic Regression Ġcons ist pla za Ġconv olution curs ion room s balance d åĮ ħ pas ses comb ine Poly gon ॠĩ ĠHel per ìĦ ľ unct uation WIN DO Ġtrust ee gover nment åı² éĢ² ometri c " < 4 096 D r N ac N av N DQ P ayload T w V s Y ES f T g if h ue p ron č čĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ rom Ġ ĊĠĠĠĠĊĠĠĠ ĠĠĠĠ ĊĠĠĠĠĠĠĠ Ġt n de clar Ġ' ; Ġs l Ġo d Ġo m Ġ1 00000 Ġ( {}) ĠT k ĠS at ") ): Ġg uild par sing ĠP latform time step add Widget ĠN T ff e ĠG u ĠW H max len ĠH yper ĠIn dependent ĠCon sole no vel Ġper centile trans formed AB C AD AP PO MER Ġspeci fication call y 47 4 Ġread able 29 1 ĠPro blem late x ATE G IP S extra ction App l Ġvis ibility åIJ ij Mat ches Pri mary аРº Cur ve mut ex GEN ER Ġprop agate åį ģ ĠReg ion decor ator aur us Right Overhang cipi ents ific ant Ġcompat ibility Ġrepe ated replic a çľ ĭ Ġrecomm ended Writ ing ĠApple WebKit POMER IUM ) // 3 17 6 77 8 02 8 98 B J C UDA D l F g H L K x P lan R q T aleParser V B i elds o h r ated t st Ì Ĩ ĠĠ ĊĠĠĠĠĠĠĠ re duction al arm Ġf ault ur is ss id Ġw ins ul s set Index con tacts as a et o ĠS ygusParser ĠC ap ĠC RE Ġh ack ĠP open ex periments Ġ3 000 ĠM DB ĠN aN Ġres ume Ġtest ed Ġal le Ġ\ ' 011 101 HE LP LO S Log Level ĠSt ates 67 4 ðŁı´ółģ µółģ ðŁı´ółģ ©ółģ ze ug mode s ãģ ¨ cho ose sw agger CA LL ba setype ĊĊĊĊ ĊĊ radi ans Ġparent s nb sp аР² Ġalign ed Update d dimension al Ġidenti fiers ĠRo om transport s contin uous rich let ĠTemp erature Ġderiv ative Chg Over ceptr on ) """ , . / _ 5 38 R en S olution c j c dot k mer m os o x Ä ĩ Ï Ħ ð IJ or ator re w Ġi g Ġc dot Ġf irm Ġs nap Ġin tr Ġo auth li me ri e ri z Ġb an str at (" * et String ĠC li sp ital log file Ġh dr pro viders sh uff oun ce AT ORS ĠR ange read able ST EPS AN K CT T Ġopen ed Ġne uron Ġend ing 45 8 Ġinter section inal ity 101 00 close st TR AN tribut ors Sh ared Ġ"" ", Ġ$ $ è¯ ¢ Ġerr no fail ures Ġve hicle Ġcir q ĠAd am ĉĉĉĉ ĉĉĉĉ glob als align ed Sign ature publish er PROCESS ING ĠUns igned ×Ļ × uber ne Ġfeatur ization $ ") , _ ? ") B ERS C y G x J I P AGE k r n ss r fc Ġ ĊĊĠĠĠĠĠĠĠ on sor at an st ations en h ar ith ti e Ġf tp Ġn ick ut r ra ppers Ġe pi () ))) ri os int roduction Ġ0 9 (' '' ve al ĠA C par a ĠF UN Ġh am ĠL ength Ġ""" \ Ġv k "] }, ĠB C len code IT LE aliz ations 55 4 RO LE default Check Ġfil led Co okie auth enticated pl ans DO UT struct ures Le arning req s Ġ-------- ------ ĠImport s SH A Ge o mix ins Ġpur pose Render er Dete ction ctype s inher it THRES H ĠLib rary Ġwi fi ĠFace book Repository Apps Ġexpl oration Ġbro ken ĠGrid SearchCV Ent ropy èĩª åĬ¨ Annot ation ĠEner gy ! ', ) }') 5 99 5 22 A pache B EGIN M ATCH P Z f u l us m outh t abs Ñ ī Ġ Ãł Ġt bl al ways Ġc atch Ġp aginator 00 10111 ur lopen ss a Ġin gredi Ġre load ad m Ġb ash ch apter Ġ[ {" ĠT ile ĠS cheduler ==== = ĠF low Ġh ierarchy ĠL ambda 0000 02 sh ards ĠM ET load balancer ĠW hat cept s Ġpre serve ([ ^ sk ills aliz es Ġspe cs Ġbo keh 75 8 38 3 Se quential Str ings UN IT TR UE limit ed const s Ġfind ing Bo ost ãĥ ª Ġph y ĠFor ward Dis able NE UT Cur sor Ġda mage cred ential segment ation Ġpl us Rout ine =', ') ĠAnal ysis Ġorgan ization Distri bution ĠInst all Ġrout ine LANGU AGE Accomp lishes . + . ')) / *. 6 01 7 07 > ') E ffect J y R K Z ip b am h or i prot t qdm } ( č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ar xiv ur s Ġm f ra do Ġe ta () / (" // Ġde velopment Ġde serialize out lier ĠB ert Ġget Rule ĠR aw 32 9 min der cur tain ST EP 03 1 we i Ġop acity LE TED Ġsh ip Ġspe ak ps f stri ct Ġpass ing Ġsp ider Ġrandom ly Ch art Ch unk Ġplot ted Ġass umed WAR D Ġsim ulate des ired report Error Process Error Ċĉĉĉĉĉĉ ĉĉĉ noti ce speci fied Edit ar Ġsegment ation ä¿ ® Ġenter ed writ ten Ġpla in Tri gger bon us æĽ ´ è· ¯ ĠKe ys may be copi es éľĢ è¦ģ éª Į setIndex Names uberne tes 4 02 8 000 N W O E S CALE U q Y T Z a b en f L g le g pc h ape p at p url r us s om s uggest ë § Ł © in spect er ce er cise on ts st a Ġt ornado Ġp ing Ġ" :" ent o co ol Ġb ench )) ): Ġ2 011 as numpy ĠC ell Ġl n ĠA cc ĠF ra sc oring qu otes Ġth row Ġ_ (" IN S "] ], Ġ) ; ======== == ph as ire ctional class Name SE G ax i Ġat ualiz sk i Ġwe ak map ped Ġla zy Ġdist inct HE Y Ġ| = Se ss iter rows open ssl tag ged std dev ĠSet ting ĠAll Vars mod ity Ġmon go UP LOAD ĠMan ager He alth velo per inte gr Ġtrack ed Ġembed ded Ġprob abilities ============ === Ġperiod s ĠNe ither Ġcred ential Ġcos ine ĠPh idget Ġmeasure ments INST ALL Ġscra py å¦Ĥ æŀľ Help Formatter CRY PT ĠRecognition Exception ĠgetRule Index ! ': " [ ; A x C ountry C lears E ach F amily H ar H ard J O L K N gamma P AY Q Color U Z W M X G Y M h ints o sc v ado y scale z ione ¹ ółģ Î ¿ ç ¦ ç Ħ Ġ ensemble Ġt y ri dd Ġ# ' Ġ[ _ ot ed is ol Ġto pk Ġ2 07 (" ~ (" ", ĠS un ĠS park end a sp ines '] }) 99 3 log it ĠL ab res olved Ġfile Name Ġj wt dir ty oc ation tri angle Ġpy spark SE Q ][ : 37 2 AL LED AS IC AS SI Ġne cess 28 9 30 92 ĠSe ction Ġinter sect files ystem Ġdire ctions De coder 67 6 EX AMPLE Ġimp rove Cont in Ġrender ing book s meta class tab ular language s Ġë ° START ED ni que Ġda emon ç» Ħ Default s Ġestim ated wrap ped cross ings UST OM Work flow :::: :::: Ġtak ing Ġdiag onal 2013 0101 DJ ANGO ĠWor ker vile ges ĠExec ute tStart Refresh ! ". ) ` 6 05 A bs B g H eat P ersist T er i y i la t g re boot Ġt iming me ters Ġ' ^ Ġ' $', Ġin ject Ġre ceiv Ġd ask li fied Ġb d Ġ1 47 Ġ( \ Ġw erk el s __ : ĠS ele ĠC y ĠC ost for k Ġcon trast Ġde ad Ġprint er Ġx p ys ics ci pher ĠN P ĠR ate ĠG R ĠV al SE ED ec ause Ġat tached ast ic Ġcomp uter spe ak mission ing Ġinter active Ġinter faces gen re gener alized cat s Ġquery set ĠValue s Message Box OL S åı ij Ġextra ctor 0100 101 seed s Ġgover ned ç o cast or BL END bucket s Ġclean ed support s contour s FLO W å¯ Ĩ eng lish pot ential scra pe identi fiers occ up ĠSci ence Ġcorre ction Pomerium Service 9214 0257 CEL ERY ĠMongo Client F ACE N orth N enhum Q N T mp _ * _ () _ (" c en c ab o F o e t up y outube | ') ´ ë č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ íķ de conv an onymous Ġp wd ss ss Ġo dd ct ree ra ster ri g ch ant ol in th res str and Ġ2 15 ĠC ity Ġg ather Ġcon ven vi ps Ġh ide ĠP lace ĠL at ub ble Ġst ations key points Ġx label Ġpro files "] } ob served col late OR IG cur ate 85 94 ron Dump color map 35 1 Ġcontain ed Value Type Ġim mediate gin es Ġtrans it Ġar ticles open cv ĠPro tocol link age Ġprocess or UM ENT struct ured Com m Not None Ġemail s STR Y ĠName Error Ġdomain s aff inity è® ¤ åĢ ĭ Ho liday Ġrestri cted Factor s Ġrect angle Rest ri Display String Ġdetermin ed webs ite Ġboot strap Pk ts She ll Ġsil ent Origin al ancest or pC ronDump assertIs NotNone ĠQuest ion HERS HEY # . ) = 2 80 7 05 ? " A Q A ck B i E st I END K C K N L u P n Z I a W b il f ed f use m ibBuilder n ia r ss s ma x m z ones æ Ħ è İ Ġ Ñĩ in et re search st ored Ġt This le aky Ġc ad Ġin s Ġo ci li x pe m ra us import er Ġdef ining ĠA PP type d log ged ĠL iteral ac quire Ġv oid 02 0 Ġme di Ġbe etle ĠG ets Ġco variance ĠW atch AR E ST D 93 3 ĠH o comp uted inter sect no on AL CHE IM S OT AL 28 64 ĠQ U pri se ict ure ĠEx pected ĠEx periment find ings DO M ãģ ¾ vide s Ġoper ators Lay ers 1111111111111111 11111111 Ġmig ration MAP E Ġgra b cid r Top ology Vis itor equ ation ĠEvent s Rel ation Bl end Ġut t HI GH uro pe ENABLE D TCL Script Ġlit tle dI HDR 123456 78 ĠSty le ĠtThis Flip ALCHE MY , ): : ** A z F M F ri I Q O pts R ank S at T J W rap Y W e os o led v w Ġa pt Ġe ye () ` Ġ1 41 Ġ0 2 val ia (' __ ĠT wo Ġh ue Ġde ci Re p ĠM ask Ġstr and py pi pre fs ap d ĠB us col lected ĠR ect ĠG T ĠU S Ġen cryption IT OR Ġtime it ne utron ðŁ ĺ mat lab AM PLES Ġac company 33 1 AS F ... ', port al 45 17 call er Ġsk in open stack 67 8 Add ing play ing Com missioning и е Man ifest Ġph rase äº ¤ Ġpost gres Ġpack ed åħ ¬ åħ Ī ĠCom ment cost s vari ants xF E Ġreport s Ġfit ting ĠSh ape Cal led SA VE Ġchain s WE B plan ation ":[ ]," ĠDate Time adjust ed udi es çī ĩ ĠMet adata Ġ'* ' OFF SET Err Rx æĸ¹ æ³ķ QUE UE æı IJ wee py Ġagree ments >( < Ġpsy copg . : . { D x D ST F ix M ore R adi S ol T ermin X r X s b anner c raw h om i po p ore r hs r fio t as w ho ½ æķ° É Ķ in fra ar cs Ġa k Ġs ob Ġin vert ing dom pe cts Ġ1 85 Ġ1 29 int ensity ch astic il s Ġ2 04 ĠS te ĠS outh ") ], end ant ĠA I sp ike 99 2 sc af sc enes qu bit Ġth umbnail im o Ġprint s Ġv p IN ED ĠE stim text wrap ep h 32 1 Ġco in EN CY ĠW in ST ANT 03 175 :// { :// /? ĠRe set inter active als o sum maries man age RI X File Handler Ar ticle 65 4 ĠCON T ĠAr ticle Ġpri mitive âĶ ¤ bl ur 0101 0000 Loc alized Ġtri p Ġsim ulator optim izers Ad j PR IMIT Ġret val Pre cision rat ings Gener al Check ing Ġjo urnal Ġsee ms cm scaf ĠCol lection ठ° ĠNum Py éĢ ģ Stream ALCARECOTkAl Ġmig rate Ġæ ī super vised Ġxml ns åĩ ½æķ° aff e Ġcent ers prec ation members hip ĠGraph QL åİ ĭ ä¼ ļ ç§ ° åij ¨ COLUM N Pack et writeField End writeField Begin Ġgu ar Ġoccur red ĠWor ld Inser ted Ġcook ies svc Class StreamALCARECOTkAl Cosmics " * ) /< C lip D s D if G ATE G MT H and M al M icro N y O Z R ad V l X S b ps d B f del g pl h up h ighest l ng l strip m ri t ml ³ ółĢ · ółģ -- ') he ll 00 9 Ġd types Ġb f __ )), Ġ2 14 Ġg y am in om ic ub untu Ġth rift Re gex ĠN V In ner 25 9 Ġwh itespace ST ACK ðŁ İ ĠRe place Pro be rep lay Ġcomp uting 33 9 00000000 1 Ġper f spe ech 66 8 go als obj ec ĠUn known check ed Me asures Se ed be low Buil ding To String Le arn ÑĢ а ĠGet ting verb osity Per formance ynam odb Sim ulation seri alization аР¿ Ġpub lication Ġsig moid Conv olution land scape Dire ct Ġtimestamp s Det alhes 3333 3333 è¦ ĭ ௠ģ separ ate é¡ ¹ chron ous YE AR aud it ÑĨ и Ġpyg let ++++++++ ++++++++ ĠUti ls Contour s Trained Model Ġwerk zeug ; ") A o B IND C U C amp D d G M L x P ayment S al S napshot S quare T or f ety t ETH x AB í Ħ in ge in come in vest Ġ= ================================================ st mt Ġt ell mp c Ġa mb un o Ġm r Ġthe me ma ven Ġfor est es p es is as ons Ġr anks ĠA sync '] * Ġcon vergence log gers pro duction Ġpar ty art ment Ġos d fo cus ĠV ol ĠU AV code c IT ER ag ers ID S nd r 24 9 37 1 Ġcom bo ĊĠĠĠĠ ĊĊĠĠĠ 011 1011 Ġtf learn AC A und les IM P clo sure 38 9 PT H ĠSt atic ðŁı´ółģ §ółģ FA CT No via dic ation eval u Ġauth enticate now ledge Ġman age Ġsa ver API View has hes google apis Dis patch Argument s je ctions handle s ACT IVE mut able Ġpas ses Ġpop up Ġarch itecture sr v Ġmonth ly Ġchain er Ġcar ry ĠPROVID ERS chart s POS IT Bytes IO æĮ ģ ĠSc ale measure ments Long Tensor ĠTop ic Ġlearn er FAIL URE prun ing éĶ ® ATTRIBUT E capit alize éĥ ¨ B uff F W G pu H M I m P j P p P s P repare R AT S yntaxError U nder X K b illing d ur d mag f ma f requ g AMA h ort j ack n h n id s df s now ¬ ółģ¿ à ¢ å ĸ ì ķ er man re served st ones st ellar Ġt ro Ġ' '), mp i Ġ" ve cs ĠP CA Ġ3 20 ]) ; Ġx ls ens ing ens ities ber g ĠE C per form St ates Ġra d LE CTION 22 22 ml p 37 3 em u Ġsub traction 87 3 AG ENT IS O ENT ER 75 43 cor s flow s mark ed TR Y De ath ins ics е ÑģÑĤ Frame works Ġback bone Ġcall er dis covery Ġstd dev 0100 1111 PRO FILE Ġmean ing For ward COL ORS ĠBase Model ĊĊĉĉ ĉĉ Te mplates Ġrepresent ed All Windows Ġlike lihood ä½ į Ġaut om Ġbound aries stage s Block s Ġ"# / Mark et Ġpol ynomial æĮ ī ĠEd it å¹ ¶ аÑĤ ÑĮ ółĢ² ółĢ Comple ted ĠHel p æ¯ Ķ ĠTR AIN CHAN GE Ġwatch er 687 896 Ġsr cs Mib Table scr atch Ġcel ery bK GD DCC SI 0100000000 00000 ilton ian ( .* C ERT H Z Q T R y S RC T ile T ele V m e insum h mm j vp k an l var n Z v ap x FFFFFFFF å ¡ in crease re cipient al gorithms Ġp ca 00 111 Ġn engo Ġre use Ġm apper Ġe e () * is k set Style Ġto ok th ere ĠA fter '] ])] Ġth ough Ġex e ]) ** Ġx array test case tra cer Ġj itter mo le 18 13 Ġk napsack Ġro unds Ġal go Ġpre dictor Ġtra vel mat erials Ġsub stit RO W CO UN ]] ] ĠEx port bot o Ġ{" $ Ġpri v EST AMP Ġover lapping ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠ Tra ffic Column s MO V PP ER dist inct PATH S static files Context Result Inter pol stop ped Sp rite _{ \ Ġ$ ( light s can o Ġdete ctions ĠRun ning BL UE CD F BO ARD âķ ļ TER M Di ameter ĠAl pha Ġ"{ { Ġmp i Ġcent re Ġcombin ations Vis ual ĠHe ader ĠValid ate Ġsn ippet Sec ret çī ¹ Ġur lopen destroy AllWindows :`~ . ðŁı´ółģ¬ółģ ¶ applic ations Ġsens ors IDD LE ìĬ ¤ nthe tic " $ 4 95 E FF H CP I ET L Z O s P AD Y s d ct e igen i q j h n lu } | à « è Ĭ Ċ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ re gs re ceipt se mi en arios Ġt issue al is de livery Ġi e Ġp ep Ġf out Ġa max Ġin ds li k li ze () `` Ġb et Ġ( (' as yncio ĠS C Ġof ten ht m for ma Ġl p Ġh over res ample out come ĠM ig ĠM od our s ĠB earer ĠE nt com ma read me read create Ġnum ero Ġen force Ġro uting IC RO 27 1 97 3 {} {} 26 9 AG A IM PORT RI BUT Ġsp rite 38 2 ĠPy Side ĠAr ch post erior adj ac 0101 0100 ĠDe bug Ġ200 9 Ġextra ction Ġrender ed Sp d Ġpost s Ġinstall ation å¤ ± ĠName space è¿ ŀ 9999 999 GO OG assign ed к и ĠAss ign Change d ĠIO Standard æ³ ¨ Ġasc ii ĠBatch Norm corre cted ĠOper ation sil ent Cent ral çİĭ éĢ² âĢĶâĢĶ âĢĶâĢĶ Ġsqu ares Den ied è¿Ľ è¡Į æĻ Ĥ è¾ĵ åħ¥ Ġgram mar abo ve Decode Error ĠSG ACL æ² ¡ ! `", 4 14 C i G re G CT K T N ON P g P MIB _ ): p value w asm Ġ âĸij or ical ro g Ġa pache Ġn ib Ġs olutions Ġe fficient la ci Ġb x di scri ĠT IME (" @ sp am ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠF ix ĠI tems ĠM c xf ca Ġv l Ġv ote pre f ĠB ound Ġname spaces """ . bo ards ĠU Int ĠU sers 16 6666 Ġlist dir 100 0110 05 0 05 4 sed ing enti ally ĠH ar Ġno hup Ġext reme Ġnode op Po ssible Me mbers File Type ĠY AML Ġver ified Un less graph y ĠPro gress cho ols dis connect Cont ents ãĤ ¿ si i qui et IP v Base PMIB gg ers az y LOG IN Ġjo ints xba Q modi fier å® ¢ ठ¾ SH ORT Ġdat os ìĿ Ģ åĬ Ľ rea ctor Ġinser tion GT erm Ġ"{} / TA IL Format Error ati ence Ġps util Ġsyn apse Ġsur vey Embed ding nor mpath hum idity 01001 0000 è½ ¬ HY s Ġrg ba phys ics **************************************************************** ******** Ġatual mente ĠAz ure Diameter BasePMIB ) [:, 4 17 4 80 7 06 D t F y I FT N j O bs P ush P ublic P Vals S em Y t Z ONE b W e ss k f n itro s it w hole x o y o z n z t z fill á Ĩ Ġ Ñĥ in el in ode Ġt up de lim de precated Ġa e lo v Ġd bs co or rom ent te e il t th inningThingProducer str ong ĠS pect Ġg i ĠA mazon Ġh or ĠL ock =' +', Ġst oring pro ducer .. ") Ġj vm com bo ise ct ard own Ġro c 08 0 88 3 Ġle aderboard av ailability 36 3 cri minator ... ' ix s CO PY AC H Ġmat lab cent roids Ġbase s Ġver ification ĠJ ava root s gram mar US B US AGE Ġstate ments Ġcor es cu i FA CTOR Ġcontext manager Ġcontinue Routine proto s bl end **************** ******** ÑĢ Ñĥ ĠLo ader ĠEn able Ġscale Factor cos ine prop agate Ph ysical Ġcons istent IF ICATION mid i DIS PLAY ĠRo ot Iter ator иР¹ Initi alize alert s Ġair flow sens itive Ġmar shmallow åı¯ 以 Ġpast e IDX GI éħ įç½® REPL Y çŃ ī Ġtransl ated ĠTechno logies Quest ion 8217 776 ' < 0 92 4 92 ; ') A ct D f D m P lug S can T B a el d anger i lo i ence k afka p HYs s id t al t one u o } ). ° ĥ æ ĵ ç Ī ë © Ġ ul st acle Ġt ang Ġc H Ġf r Ġf an Ġf ive Ġin dx Ġd ados Ġb log Ġb rain Ġb udget __ ))) us d ĠS GT up ling for est Ġr df Ġcon su am big ĠF ull log dir ĠL IB ub y ĠD el os g add on ep i Ġco eff ĠW OR loc ated Ġout dir AR M Ġan imation Ġen emy Ġk m Ġch anging Ġal ive sub parsers 88 2 start up with draw 27 2 =[ [ Ġtrain able ele vation Ġlo ops so ma Ġsp acy Po se Me ans Ċĉĉĉĉ Ċĉĉĉ Ġus r Ġgener ates dep ends Ġqu bit ĠAr ti Ġover all Ġab ility CA A present s DIT ION åĪ ¶ KEY S ä» » ĠApp Config å® ¶ еРº ĠAc tivity Ġprob es æĪ ĸ LA ST Cal endar gu ard Ġinser ted CM eta Go od aff old SM I Ġspect ral INPUT S ä¼ ł à± ģ Pick le ·· ·· Ġfore ground Ġcommunic ation 01234 56789 ADAP TER íĦ ° B AR D y D ash G RE G CC K K M ul N H N tw R AM S parse U ri e lo g ym g lyph k d k nn o ti p addle u ge v Z v oc ¥ ółģ¿ ® ółģ¿ Ľ 建 er ver re ci se verity Ġt dk Ġ' *. Ġc amp Ġc ampaign Ġn est Ġd z li mb Ġm ens Ġb ert ma ze ], ' import ance ĠS EC Ġr nn to ms Ġh ot ĠI BM file Name form er Re cords ĠM P oun ded Ġel f load ers len ame Ġnum ba line style Ġpy units ĠH ost Ġdi vide Ġac tivate 87 93 36 2 86 01 44 3 Co mplement of fice vis ited ud p doc string amp litude 47 61 ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ 46 2 CON NECTION exec file Ġfig ures ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠ Number Of License d Ġ'-- ', ĠWe ight dec lare Ġmark ed track OfThingsProducer ĠLo ok web hook rat ios ĠLe sser ############ ### On Flip ĠUnit ed Ġscal er Ph i 990284 08 å¾ Į ru it 010000 11 FE ED FE ATURE Ġsn ake AK ED Eval uation chan ism Ġvisu alization monitor ing Ġsym metric Ġblack list obo library Ġca ption Mac ro Ġsmooth ing Ġtar file ç´ ¢ postgres ql expl oration ĠSpecify ing ĠFore ignKey vvvv vvvv avor ite Wave Length æīĢ æľī Ġmne monic ìľ ¼ ç³ » Ġappe ars ORIG IN " ') 5 96 D W K G N i R n S GD e ck m ute t IME x gb } [ Ø ¹ á ħ de posit ti ff Ġp code Ġf ps Ġin cident pe x Ġb c Ġb la Ġ1 75 Ġ1 38 Ġw d ĠT CP us c Ġis ol ĠS ets ĠC lear Ġr y ĠA udio Ġh yp ĠP L ĠL STM =' ' est i Ġprint ing ĠM AGIC time series Ġse cs Ġor acle Ġpro posal ĠE lect ĠR a Ġun expected ĠU INT Ġ\ : Ġ{} . Ġle ading arch itecture DE C DE PTH Ġapp lies ron dump 26 2 sum s Ġmat ter ler ations 28 2 FI RST Ġcolor bar 35 2 83 34 UN I Ġar bitrary Ġcal ib )] )) Ġqu antum conv olution 1011 100 Input s Ġbot ocore ); ', PRO DU ons ible å¤ © å¤ Ħ cla im Ġsm allest Ġrecord ing æĸ Ń fail s Do uble Ġgr p gre ater Ġve hicles Ġprevious ly bind ings Ver ify >= /', C p E ff F w G LOBAL N aN R ating T q T ypical W I b ird j t m nt n ll u h v pn Ð ¹ å ĭ é Ĵ ì ĥ on ym de tailed Ġf ingerprint Ġ1 37 Ġ[ -- )) ** iz ação ab a ĠC OR ĠC enter up loaded ĠA DD ac ci Re gs app y sh adow ĠM ag Ġy lim Ġx lim Ġma ior ĠB L AT AT ĠR ED oc r ĠU til line styles 17 41 df a output File lin ed ak ing Ġcomp utes DE T av en Data Source Ġla m 011 01011 Ġper mutation Ġstart up clo sing Se verity ĠQ Color File Descriptor inal g Str Opt ĠEx it Ġver ts Ġdoc string ðŁı´ółģ ¤ółģ MA LL 1011 011011 Ġimp licit Ġ... ] 0101 010000 Ġ200 6 Ġ200 8 pec tive mc Rmt has hed Size Constraint ('/ ', 0011 010000 0011 10111111111111 BO DY ĠLog ging Jo hn ĠAc curacy dete cted 0001 0000010011 Valid ate respon d freq s Ġcons umption ĠInter net å¼ ķ Seri alize Ġep ic Ġrelative delta 0101111 10111111 Ġctsp Def havi our çİ ĩ xxxx xx sci ence Video Capture 984 5 ^{ - coef s Ġsimp lify Ġ'* ', 10111011 01000000 Comple te å± ħ central ity Ġbro ker Ġprote in Ġeas ier Rob ot 00101111 01111 eder ated æ± Ĥ Temporary File ĠRequires ContextResult WINDO W PomeriumService Account tlen eck 100010000 111111 62670 934 * ] 4 87 6 12 : ]] ? ') C am E mp I OR P tr Q J S s Y r b q c ron d ad h orizon j ac j inja l te l hs m int m ber u df v arn x v © ółģ¿ Å Ľ ç ¾ è Ĥ Ġ âĶĢâĶĢ ĠĠĠ ĊĠĠĠ er c se a ro sa 00 14 ce a ce ph ', \ ', ), Ġre moving Ġre curring Ġo id Ġd n la d Ġb ank es quis set Value ĠT aleParser et er for ge Ġl bl Ġl inalg end ency sp ring ic u am ber Ġ: ]. sc f om it Ġh int ĠP RE ĠP ress ĠI T ĠI p ub class ex press out side ]) * Ġv ary Ġy hat os d tra ctor Ġj et In ventory ĠW est Con version min imize line age Ġk l ener ated ne tic ok lyn ak ed yn Ov Ġac l 36 00 ... ] 44 44 Ġurl patterns Se g cre ti Ġtrans actions Test Obj gen otype ":" + Ġformat ting Time s 65 8 Ġqu otes Ġqu iet pass wd 1011 00 over all Ġbin ascii Ġsession s Man age QU AL disp lace 0100 011011011 Ġconvert ing Ġjo ined ĠCom m 10011 010000 white list mis phere ĠCont roller 0101111 10000 ati vely ĠRandom ForestClassifier Example s ĠAs set æİ Ĵ ä¸Ń çļĦ 00101 01110011111111 dz lu ĠNetwork s Ġcrop ped sto pping 1001111 011110101 bz l trust ee èĢ ħ ĠAv ailable 01011101 01110000 ĠCho ose 模 åŀĭ Ġmor ning bsd conv ĠLang Types 10001111 1010000 Ġjvm gen íĬ ¸ 101110110100 01110000 " ` 4 86 : > C CT E LE F s F IC F uture N K Q w V eri X I Y AML [ ^ _ "+ c Y e asy f A f ine k its m gr n od p agination s oc u da v R v u ı Ħ on a de ltas Ġc ry Ġf t Ġa mong Ġn rows Ġs us Ġs uggest li ft Ġm ixed ra ses ch assis def jvp ul ff (" | (" __ ĠC AN ĠA ssert sp i par ing ta c ment o ĠM i 02 9 ĠO racle Ġx min ER E 07 1 In clude ĠR t SE P 100 10111111 64 2 inter mediate Ġsub list CT RL Ġper mutations Ġcheck points 44 1 Ġadd on cc c TT T project ed UM E Ġsign ificant Ġ200 7 github usercontent Ġfollow ed ãĥ ĥ decode d н а az ione ç a non y æľ Ī '} ], Or ganization thread ing Ġ---------------------------------------------------------------- ---------- Ġ---------------------------------------------------------------- --------- Ġmove ment An im sn ippet cred its Ġcalcul ations Ass oci Ass istant LLLLLLLL LLLLLLLL dom in 00011 01001 Match er Bl ur Loop back ĠMin imum Eval uator front end stick ers 00001111 001 Ġann ual Ġdetermin es Poly Log 100111011 01110000 Ġscra ped scra ped 10111111 0011010000 Ġhold ing repe ated Syn th rg ba âĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢ âĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢ Ġparticip ant 010101111 01 Ġce il Spect rum Ġdispatch er 727 25 Ġprun e Ġrespec tively Ġsear ched Ġmn ist Ġpie ces Ġemo ji 0010111 000001 8594 276 687896 8594276 010010000 101111 1010011100 01010111101 000111111011 00000100 ktron ix 011101110011 000101 " '+ G CELL J WT K H O AUTH P Set S uggestions T ITLE W l c T d yn f ault f ly f ns i python j ni m ate t ur t urtle } ": } \\ ¯ ółģ¿ ì Īĺ Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ= ' st ops en velope Ġt ls Ġt ip ro des ti ties Ġc df 00 111111100 Ġin ventory Ġre lat ct an Ġe lasticsearch int ro ch ro el le (' > th umb str ates ĠC C ĠC annot ĠC ORS ĠC hem ĠA V ĠA ct ĠF LO ĠF IL od ds qu ant Ġh b Ġth us Ġst ub Ġu c Re ferences ĠM ass Ġme th Ġpro filer Ġj udge Ġget Logger mo val tri eq Ġtime step 25 37 ax v AN DS sub tract Ġclass name lat in HE D Ġ8 90 au ction IM AL Ġdis covery stri ke 11111111 111 98 9 Ġmo ved AD O gin x 45 0 Ġinter preter Ġlin ker ĠIN TE iter ate [- ] ðŁı´ółģ ¨ółģ EX PORT ca ffe 111 0000000000 Ġtoken ized ren ces dev s и л ba selines оР¹ 1000 11111111 has htag stop words Gener ic 0000000000000000 00 He avy bound aries Ġexit Rule VAL UES imp lied ado op аР´ 9902 818 Ġaut os Ph rase Ġfast a Ġsec ure feed s Scal ing 962775 917 /> . ĠCOPY ING 1011111111 111 Ġenter Rule REG ION ĠVariable s Area Dictionary æŀ ª Ġbuilt in æķ°æį® åºĵ separ ated Ġ{: < 11100 01 Ġmeasure d 00000100 011100 Connect ed 1001111 011111111111111 rist or Ġlab eled Ġaggreg ation 11101 000101 Ġcri tic åIJį 称 ________________ ________________ wik imedia 缮 å½ķ 0011100 010111110000 ĠContain er 10111111111111 011 01100100 010101111 æĥ ħ DUM M 11000011 0101111 0001010101010011100 101111 00010000010011 0101 1011101101000000 1110001 nony mous 010010000101111 0010110 011101110011000101 011111 6 16 A y B Z B TC C ity E CT E thernet G ot H it J ar O Auth S cheduler S pread W g W eek X Q Y u _ )) a ver b h b irth l ons m st n q n grams p ins r find z ing å ł æ · è º ë ³ re aded an other Ġc g Ġf ft Ġ" %( Ġn rd Ġs light Ġin flu Ġre act Ġd ut Ġd data Ġm obj Ġ1 65 def er ation Type (' + et ag ĠC ross ĠL ong Ġst em Ġde mon 0000 1011111111 Ġ""" ) Ġex clu ĠD ESC ac a ac cel ]) + oun tain que t Ġstr ategies pre dicate Ġbe come Ġ4 80 92 154 ĠR FC ĠW S scri bed sa ver Ġk o og rams ST Y 100 100111011 Ġ[] ; Ġdi ce comp osite ĠIn fo ĠIn struction Ġso ma av oid Ġno vo 87 297 011 0011101 Ġopen ing Ġz lib AG T List a Ġtext variable be e 77 8 Ġsk ipping Log s ĠSt at open api Un expected bot tle Ġexp ressed ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠ Ġass uming Ġchar set Ġtoken ize ose Version MO DI Ġ... ") edge color Ġlib ssl radi i åĪ © ################################################################ ########## æķ ´ vm Instance 0000000000000000 00000 timestamp s åħ ĥ rel path Ġest ab BO O rb f Ġrot ated Method s tech s Que ens Ġprop ortion ĠDo es divid uals sha res cour ses alan cing SimType Pointer SimType Bottom 0101111 1110000 writ ing Match ing 00100 1110000 LINE AR ffff ff ffff fff ĠPh one Ġsnapshot s follow ing prote cted ĠMark et Ġocc upancy æĽ ° adapt ers ĠMeasure Duration Success fully yb rid Dest ination Ġide al Ġnav igation čĊčĊčĊčĊčĊčĊčĊčĊ čĊčĊčĊčĊčĊčĊčĊčĊ ĠContain s èª ª Ġ'.. ', Cross Entropy VARI ABLE åŁ º 011101 0011101 ĠGRO UP 0001011100 1011111111111 001110111111111111 01011 0001101001 00000000000000 00011111101100000100 1111111 00111111100 011 000100000100110101 011111 " - ) < + )/ - ( 4 12 4 20 A ff B earer D V E w F Z F n H IP H orizontal M ust O l O rient P ure P ID R MS T idx V a V irtual a vi c amel d J f re i us j l j avascript l xml o int r split s us w it è © ê ² Ġ rid Ń ółģ¿ re h st retch en dif Ġt ier Ġi da Ġp ert Ġd ont la ys ad verti Ġ1 93 11 011 11 929 ch ore Ġ- ( ĠS u ĠA TT par dir Ġh olds Ġh orizon ĠP r ĠP ER Ġas m ub ar im m Ġex if Ġprint ed Ġv y Ġv an Ġv cf ext reme Ġx g ĠE xecution Ġj og user id ĠR F ĠR over Ġout liers Con sole coun tries Ġk ingdom 100 0111 ne al Ġtra jectories join path 08 3 pi vot Ġle ase Ġsub plots unc er Ġmin imal box score ref lect mission s dire cts Ch rome US H 000000 10011111111 total C ĠPar am Message History Ġover lay Ġframe N Object Name Reg isters 0100 0101011 +' \ Base d Ġconst s non ce ICs Un Ġauthor ization 0011 00000010000 ida des SD K Sc atter Ġwait info Ġbl ur Ġaut og Ġview er Ġconnect or Ġdat al Ġfail ures pa ired atom ic Ġprop agation ĠXXXXXXXX XX ĠCO MP DIS ABLE Ġplay list Ġspect rogram Ġfo i ĠHOLD ER ç½ ij ="" ): ĠModule s combin ations Host name ĠPri vate ARG IN Rot ation INST ALLED Resp Tx Resp Rx FUN C å· ² 10111011 01 lor ida Ġaggreg ate Wait ing Ġspi ke 0111111 0101111 && && conti gs Percent age ãĥ³ ãĥ hard ware Ġtun nel =-=- =-=- Vari ant ìĭ ľ 111011 01110011 ĠLim ited Publish er Dl Data 0100101 01011111111 01010000 10110011 Spd Mode ĠscaleFactor OfFirstFixedSurface inten ance 011011111111 1111111 è± ¡ 10110000011100 011100 62670934 8793 0010101110011111111 11111 100011111010000 10000 10011101101110000 11100 1110000000000 1011101101 00000100011100 100101 ' * ) { 4 99 5 84 8 38 A sc B ank C g H F J C K i L p P IN Q s T OTAL V F W y Z o a io b J b is c atch f H f usion g file g auss m ation t Stop u ary z ier Ï ģ Ø ´ ç Ĭ è ģ Ġ Ċĉĉĉĉ Ġ videos in coming de partment de aths mp ts Ġc n Ġ" ")) lo an lo id Ġs phere Ġre play ate ver um idity Ġw ish (' | ĠT ake ĠT imer ĠT Transport Ġ2 22 (" ( ĠS ame ĠS ync ĠS uper par m ĠF actor vi p Ġh pnicf Re fer Re ason Ġbe comes col lide ĠR R ĠR aise reate d per c ĠV LAN ). """ Ġen counter Ġcol lected St udent 03 9 Ġint ended ip pets Ġch ance Ġal location Ġtra j ĠRe pository LL L map cells Ġcomp ared Ġ} }" Ġlabel size run k 26 56 mon keypatch Ġ| \ Res ume Co in LO SS Ġcolor map Ġus uario Ġdistri butions ä¸ ¤ Ġbase string 47 3 101 011100 Ġq iskit round ing ĠPar allel bl k ĠConstraint s Comp ile Comp ose Ġab i access ion pr m View s Ġparameter ized Sh uffle GH I 0100 01 Inter section ĠID ENT Not ImplementedError Ġtransform ations Ġgover nment Ġnon zero Sub scription real m Ġcomple tion Ġstop ped ĠLog isticRegression еР¹ Ġbl end convert ed PAR EN Ġdat atype Ġreference d ("/ ", åĽ ł Ġappro ach conn ectivity Ġinte grate ĠUpdate d Ġretri eved Ġtw ice writ es 00011 001111 çİ ° ctsp Def aur ants men tions PK T hyper params pur ple Ġdash board 100111011 00 ĠJo hn Ġslot s deriv ative ĠWork flow ìĦ ± Ġfrag ments Ġfrag Two Pixel s repos itories ìł ķ Ġwt forms åĬŁ èĥ½ ç»ĵ æŀľ particip ant å½ĵ åīį ANAL Y SIMPLE X shuff led 001100 011011 Radi us AVAIL ABLE 011001 00000010000 101111000101 00100 01101011 001111 0100011011011 10011101100 72725 8903 vmInstance Uuid # ~ 5 83 6 88 7 16 ; ' B ert B IG C PP N p Q I Q INT S UR S outh T en T AB T AD U pper V g X o m W m us n H z u ¤ æĸŃ Â ° Ġ о st udents Ġt em al one al location Ġi mpl me tron me eting Ġre cipient Ġd rift Ġw andb and oc one ofs Ġ2 25 as er Ġ7 00 ĠS tri up stream Ġg uest Ġr ates Ġl c data s am ounts Ġh d Ġh id Ġh ier ĠP arent =' < Ġst able app engine Ġma intain Ġ% - Ġ% { tra its ĠR ight mo tif Ġan chors 05 2 '' ') AN C ĠH eat Ġ[" - arch ar CO OK 101 011011 Ġlin ux ĠOption Parser let ing De lay EX CEPTION total NC \\ . Ġwork load Ġsum s Ġorder ing Ser v OP S Ġlocal host At tach оР¶ Ġsome times Ġcsv file gest ion sm iles comple tion Ġì ķ 0000000000000000 000000000 Ġstruct ures ĠApp end tool kits à® ± kernel s ĠPre dict ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠ ĠQu antum Red uce SQL ALCHEMY Page s ĠSystem Exit Ġbyte order watch er Ġ--- # Storage Type PK G 00000100 010000000000000 trip le Translation MessageHistory Ġwhite list sup title Ġ"* " Ġmultip ly pole on ĠRO I Ġstar let Estim ate Fore ignKey RAN GE ĠBu cket éĶ Ļ writel n phen otype 101111111111 10011 å¼ł æĺ¯ Æ° á» METR ICS Ġguar ante Ġtdk TestObj 01000011 011011011 1011100 111111100 101101001111 00011001111 962775917 0879 èº « 0110011101 01000101011 0111010011101 00100 10110000011100011100 11111 001100011011 101111 4 84 4 96 A VE B reak C he J B M OR N X N z P ad S hould Z G b S d F d set f rm h ero h pnicf j U t une v ac w ide è Ļ ë ¶ ĠĠ Ċ Ġi dade ro ps Ġc affe Ġp ulse lo it Ġd ol Ġm qtt co uld Ġb tn Ġ1 42 id b Ġw arp di tive from array ol f el li ab b ĠA F Ġcon verts ĠD if ĠM enu čĊ čĊĉĉ Ġv in test app ER C Ġme ter Ġpro of In dividual ep ics Ġun cer Ġun used ĠW ed Ġout come Con structor ĠU ses Ġ6 55 05 9 Ġtra ces ðŁ į Ġsh utdown work ed 34 202 ĠIn strument Ġle s rep s 94 2 Ġopen pyxl stra in ... ". do i unc ased Ġmessage box act s CH UNK wh m du i Ġar cs CON DITION MP C cl ub CL UDE \\ \ ĠCo lour 01111 10011 Ġdif fic Comp any dist ro čĊĉ čĊ ä» İ Ġì ĭ WS Man Dis abled factor ies imp licit ĠOr gan å¤ ĸ Ċĉĉĉĉĉĉ ĉĉ lon gest ä½ ķ Spec ify SL ICE Ġshort cut Ġperform ing band width Noti fications ä¿ ħ ĠForm ats History Control Stat istical æĪIJ åĬŁ Ġut terance SK IP Modi fier ĠLib raries 0000000000000000000000 1 è¿Ļ æĺ¯ ĠStop Iteration REQUI RED #================================================================ ============== bas ics ĠChar acter Ġcrit eria PUBL IC Separ ator Ġaccompany ing GATE WAY consum ers ĠWebDriver Wait rypton ite 101010000001111 0111100 10010111111 101011100 0010111000001 000000001 001100000010000 11111111 011001110101000101011 01 ) ]: 0 93 1 00000000000000000000000 5 04 6 03 6 56 7 13 A m E AR L is N u P x R pc T p T y Y m b rid f light g cf j q j upyter m ile n E o log q cut t te y z y un y ond Ġ xf Ġ EST Ġ ../ or B at ura re views en codings de e Ġ' [" Ġ' ). ro graph Ġf ish Ġs on ss im 11 10 ch ance ), ' val i ers pective ĠS N ĠS ong Ġdef ense Ġl int '] + Ġcon vers to wn ĠF P sc anner qu er om al om ials ĠP ose ĠP OS ĠD rop ĠM ath Ġ_ ) ĠB a Ġ4 16 ff mpeg ĠR NN Ġlog out oc cur Ġco co Ġk lass 06 3 Ġ[] ), ou ght :// / RE LEASE IC H ĠRe mote Ġsh ots ĠIn clude em ale Ġsub scribe 96 854 čĊč ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ sum techs Ġdo copt IS S ele v man agers En g Ġmin imize Col Name 45 1 dire c 46 9 :: - ug ging char set roll back Ġ12 34 OP ER åı ° QU IT ĠFor ce App end Py ramid tran script ĠAPI s xel AclV GI E "} ), WOR LD Ġconn ectivity éĢ Ļ peri ence ĠAd just Ġlower case æĹ ł Ġdesc ending ĠExt ernal ĠIter ate 011111111 111 å½ ¢ Ġxy text ENS IONS ierarch ical agin ate visit Children Ġsubmission s 100111011 1010000 å¹ ´ 0111100 11111 Vo xel ãĥ¼ ãĥ Ġhapp ens è½ ½ buff ers å¿ ħ 00000011 1011111111 amazon aws ParseTree Visitor ÑĢаР² Ġeas ily mong odb åģ ļ Ġiss ubclass pron oun олÑĮз ов 010111110111111 101100 10111011010001110000 0111111 11101000101 00000000000 0011100010111110000 111 00111111100011 000111111 01100100000010000 1000111 01101011001111 011111111 010111110111111101100 11111 # ' 4 97 7 97 8 34 = > F ee H h H ero I LE K a M m M IDDLE N m P in S ong S PL S helf ` ): e ager f uel l M é ĵ Ġ art or ge or bit ar win an z -- ', Ġ' {}'. ro unded Ġp ed Ġp late Ġ" & Ġn m Ġre search Ġd ilation Ġm om fi m ent d Ġb or Ġimport ance ot t __ / (' ~ Ġ2 17 Ġ2 048 ĠS SH od ock Ġde tailed 0000 111111 Ġ3 02 Re minder sh ield Ġma intainer add ons 1111 1011111111111111111 tra jectories pre processor "] ', ĠN N Ġres ample Ġ4 096 ĠW arning ĠV ari Ġan im St atic cept or gra fi 22 14 eri v Ġsc roll ĠIn line ask et Ġare n Pro posal 96 2093 Ġcomp iled 33 0 RO UND exp ansion net loc sum mer Ġsp line ĠY ear find ing bg r sys log rol lo ren ch Ġ... ) transform ers SS S SC REEN serv able (* [ med river mod al Ġshow ing Ġmark s sm tp istr ator Ġge op Ġ$ \ Run timeError ĠAdd ing á rios We ights ĠTo ols CR IT Stream s abc def Range s pla cing Msg Rx ç» Ł EG ER 962775 916 ĠLoad ing ru ped ĠCO UNT Ġexpression s Parse Options ĠOf fice 87300948 11929 Ġcdbp Peer 00101 01001 har vester dem ic 964 11 SAM PLES å· ¦ ĠSU PPORT 808 0 Ġcycle s Ġexpl ore CONTRO LLER Ġconcat enate é¢ ĺ vile ge Fire wall IDD EN Tick s 01100100 011 Bul k ĠDAT AB Arch ive ä¿Ŀ åŃĺ ALPH A 00010000 101011011 ridd en 92140257 96854 ĠSEC URITY 0010111101111 01011 1001111011110101 0001111 0101110101110000 011111111 9902818 27 001001110000 11111111111 01111110101111 011 10111100010100100 1000110 001100011011101111 001111 ' - ' (? ; : A i A mazon C Readable G IS G PL L t N J P AN R EST V k W Z W all b G c time e es e con h oc i for m ann n U n ce p om s olute s olutions s kew v dui w an y ticklabels } .") Ù ī er ator at z at is Ġt tl al lo Ġp al Ġp ix Ġe gg Ġb w Ġb ath Ġb am Ġ1 99 Ġw est ot ential ol ling set ObjectName Ġto dos as l ĠS FP up s Ġg reat Ġr w Ġr ing Ġl t qu as Ġh azard Ġse x Ġma is ER ATURE Ġ% = Ġpro viding py g ĠB i ĠR AM Ġtest Obj lic ity EN UM 100 10011 join s ðŁ Į ĠH ead ast ro start Date inter preter ant ages ak a rep air ĠCon tributors no se lat s Ġz ones man ent auth enticate File System ',' -- 45 2 >> ", 46 3 Ġup stream ins n content types 111 0000000000000000000000 Ġover view 01111 1011111111111111111 Le g author perm Up on Ġgraph ene extra s optim al GR ID ]+ " Rule s Ġstat istic display Name Ġweb hook `. ` ĠAc cept à® ¿ Ip v ĠRed uce fast binary Ġestim ates flux es æī ĵ rup ted Ġplay ing Ġplay ed VALID ATORS Track ing Work space Ġrelease d Ġanaly zer WORK ER dz dmag allen ges Ġarti st ĠDO MAIN Ġir rel 800 4517 456 2864 Ġam ounts æĢ ģ lig ible 0004 6297 writeField Stop bat tle ĠSET T Ġregist ers Dele ted Ġheat map trunc ate ograph y ĠCOL UM ĠTechno logy é«ĺ ä¿ħ readField End readField Begin readStruct End readStruct Begin writeStruct End writeStruct Begin Oct etString ĠNor ris Ġenvi roment magent a å¯Ĩ çłģ Buff ers nitro gen 99028408 96411 1010100011 000000000000000 secuti ve 10111111111111011 0101011 01011111110000 100011111111 00000100011100100101 001 01000011011011011 011111 0111110011 01000000 990281827 3092 CReadable Transport 4562864 8004517 # ------------------------------------------------ % ', ) [: 5 07 5 93 B ITS C rop C trl D og D ia D TYPE I h M ail S ep S fp S ending T rust V Q V OC V LAN W rong Z s c A c X c ti c one g reedy g rowth n est n ullable r na ¢ ółģ¿ ç Ŀ ë ł ð ¥ re cur st ac de composition me tic Ġp are ut os ur ch Ġin str sel enium un et ra ken Ġe ver Ġe limin () ' Ġb boxes Ġ1 52 ul ls ol lower (' @ set Attr Ġto c Ġ2 001 iz z ĠS i Ġg ran Ġg ender Ġr st ĠA UT Ġh op po isson ĠP in ĠP ut ex am Ġex cluded Ġ3 12 Ġu dp ĠM IS Ġy ellow os o Ġpro cedure 12 28 In correct ĠR ET mo lecule OR ATION ĠV P Ġ5 62 array T 04 0 08 00 Ġsh ot Ġdi alect pos ure Pro cur yn chronous Ġno isy 36 1 26 1 ED Producer au di IM UM uc ation Ġvalid ators item getter ä¸ İ UN ITS To Pre Max Pooling cli ff send all At tention Al g scal ars äº ĭ æķ Ļ ĠDE LETE ME AN è¯ Ń ĠLe ft 108 36 Ġdiffer ences å® Į Ed itor Ġ---------------------------------------------------------------- ------------ Ġreq s stage d 9627 736 ĠAd ds desc endants ĠSub ject åĽ Ľ SA CTION ĠRequest s Ge om ĠNe ural ĠClient Error ati fied ĠAD AP ä¾ ¿ mix in ĠAss ume cdbp Local Sto pping Ġsv g ĠCustom er 表 示 Inst alled submission s notebook s Li ke #---------------------------------------------------------------- -------------- Ġmultip lier MEM BERS Ġtot als Ġ^ = Ġwebs ocket transl ated åŃĺ åľ¨ Ġcentral ity ĠPI PE CENT ER aci ón PARTICLE MANAGER 01110011111111 111 HAND LE smo othed ðŁı´ółģ²ółģ µółģ Ġcau ses å¢ ŀ è·¯ å¾Ħ 1813 9845 ìľ¼ ë¡ľ ashing ton uniV cl APPL ICATION 0101010000 01110011111111111 10011010000 01011111111 axv line 92154 18139845 87297 315 ĠIDENT IFIER 727258903 8903 10010111111101011100 111 1001110111010000 1001110 000000111011111111 11111 00010000101011011 011111111111 ifor nia 6 18 A u A re A ES A cts D EST F ig F oo H x H AT I k L and Q B R J S tri T ot T LS V ocê e tition f V f uniIf g x g ft h ind h yp k lo n k s lave u q v sd £ ółģ¿ ² ółĢ è °ĥ Ġ á in di on om at ivo Ġt axon de veloper Ġ' ? Ġc ada lo sed Ġs om Ġs oc Ġin come Ġd hw ent y co ut ri fied ri cul Ġ1 53 id le Ġw y ma de ath ena il led Ġof ficial 01 0000000000000000000000 am ba ĠF o qu ivo vi ri po em ine ar 10 80 =" ./ Ġv ers ĊĠ ĊĠĠĠĠĠĠĠ Ġpro t py sal "] = ĠB N ĠB ro Ġj ar // / ĠG pu Con sumer AR EA cur ves ag a ts k og gle ĠH AS Ġac p Ġac cs AL I Ġspe ll Ġdate fmt default dict spe ll IM AGES Ġdis placement 75 4 38 1 Ġmin im pop en be ar Col lector 77 2309 top LeftOverhang Ch at ĠJ S ld ap Ġq r 67 2 ĠPro xy fir ms Max Pool eval uator Comp iler Comp osite over laps Ġsign ing Ġexec uting Man agement Request ed Ġoptim ized Ġsu itable drop down rat os sen se Ġparti tions cd c аР¹ Ġ"% . Ed ges Ġconf lict SV C 115 34202 Char acter ĠOb j Ġsav es sym metric Sa int Ġ"# " subject s Target s íķ ´ Ġrequire ment Ġdot s dq n ('_ ')[ Ġ"$ { ĠId entifier Float ing Translation Messages Ret ry Ġrefer rer Lin ker Active TranslationMessages Ve hicle aud rate Ġattach ment SPE C ĠCurrent ly 00101111 011111111111111 ĠMer ge 01011101 001 particip ants TIM ESTAMP Ġaff inity MAT RIX Null Argument ĠSummary Writer Ġadjac ent ог о 101011 011111001101000000 ĠCRE ATE Ġalle le ĠTile Pyramid ĠMig rate ĠBatchNorm alization PECT ED ĠInstanti ate 1011100111111100 01011101001 Statistical Processing 00110000001000011111111 11111 962775916 1741 ricul um 11534202 07 " }\ & # . ] 6 85 7 15 E ye K D L exer N h O A P X R SA S UP T CHA U PPER W heel Z v b ic c ds d temp e se g U g ist h repr i ec m list m ale n othing z k Ð ¡ č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ Ùħ in er in ame se quent Ġ' )[ ro pping ti ll Ġa w lo de ur t Ġre lu Ġre scale li des ra form Ġe a Ġe h Ġe os ion i () ') ent h th row (" $ ĠS ie Ġof fer ĠC rypto ĠA lex Ġcon ditional Ġh w Ġst udents Ġde coding ine craft Re verse nt s ject or Ġpro vision py units ĠE ast AT L AT ER lot s mo vies per mit ssage s SE L ari ties ne ural '' . count y LE AR Ġ{} ' Ġall en [: ])) '. / ock ets lat ency stra ined Ġindex ed ... \ Res olution rc nn Ġli mb Co ords ä¸ » Ġar cade To o gener ators âĢ ľ No tes Ġwork book wo od Get Status Ġsum maries Ġshape ly ãĤ Ĭ åı £ Th rough font Size Sp ot ĠMe mo ĠDE V nb cr mock er Ġ---------------------------------------------------------------- ------ comm unities Ġdraw n Ġ'../ ../ à® ³ Ġhow ever screen shot Ġplatform s ĠWh ite ç» ĥ 024 0845 AUTH ORS Ġpa inter Grid Point COMP LETED Ġquanti le Order edDict VALID ATION BI KA Ġcdbp RealmMessageRoute Ġcla use ivers al perm ute Render System dw g å®ļ ä¹ī MON GO Ġfire wall ograph ic ĠTw itter Ba seline æµĭ è¯ķ Private Key ndi mage ĠAli gn æĦ ı IET F ë© ´ å¤Ħ çIJĨ 110000110101111 0000111111 11101101110011 101111111111 962093 0240845 1001101000001011111111 11111 87297315 10836 ) ". + ---------------- 6 11 6 36 6 57 F J F latten H pr K P K nown L VC M PT M usic N othing O i P GIE S orted T IC V t W ire X J X PATH Y G b rown c ff c func e ks f wd g ran i ot i ans o pe p up s ap s vo s outh t docs u ang x Pos z G ® ółĢ re lay le aves Ġp w Ġf m he ses ce p Ġs chool Ġs liding Ġin voice Ġre lax un tos Ġm b Ġm it Ġm ist ra x la w co t Ġb k Ġ1 43 int a Ġw ent Ġ[ [" )) + il enet Ġ2 06 as p op stress ĠS W ĠS ound ĠS TE ĠF ake ĠF ront Ġh h Ġst reet Ġde posit ĠD a ĠD ay Re pr Ġse u add GridPoint ĠB OT ĠB ridge format ters Ġout line Con vention ĠV irtual ĠU TC ST O max ima dd dd Ġra dio sub stit work sheet ĠCon verts 33 35 no isy Ġspe ech Ġext ern List s Ġunder stand local es Ġmin ima ich i sg d FA ST Ġgroup ing ik es conv ers ðŁij ¨ Ġ200 4 ---------------------------------------------------------------- ----------- na ma Ġscri bus Sub Element leg acy 0000000000000000 10010011 fill er transp arent ĠConfig ure hand led ĠCol lect ä½ įç½® vol ved 1001 000000000000000000 ane se Ġ') ' Min i Ġow l pa int Ġstack ed ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠ Ġradi al From String ا ر Ass ign Ġpresent ed tific ates vl rep hy dro lec tive cdbp RealmMessageRoute ü r ={} ): Ġshare x health y åŃŠ符 Ġseparate ly ĠKe ep ĠSw itch ĠHome Assistant phot os MULT I sser act quat ernion ðŁı´ółģ³ółģ© ółĢ°ółĢ Multiple Locator abe tes Ġflt Stmt Trade Que GIT HUB çĶŁæĪIJ çļĦ Pur chase Ġtopo logy Ġtrt l Ġimmediate ly å¡ « ðŁı´ółģ¬ółģ¶ ółĢ°ółĢ 没 æľī Heavy Test 0101000010110011 0101011 #~ #~ 01100100011 011110011111 ĠADAP TED * [@ . ': A ir A da C pu M ad N r P as S MS T ape W G W s W atch W ind W hether X z Z r b ay b road d V d ynamodb g te i log j R k nots k ryptonite o ol o xygen s keleton v q ç ¥ Ġ (), en gines an cial Ġ' ] A rial B K B w B US D on D st E K I Y I i L ang M ig M oney N AL O V S age S po S ites W est W ins Z t b urn c ensus d A d Y e uclidean m V n sp o i q N t reatment u w u its v X v z v pc x scale µ ółĢ à ° â ĺ ì ĺ í Ļ Ġ Å Ġ (): Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ in omial st udies en otype Ġt an Ġt fill ar ms Ġc bl 00 42 Ġn ic Ġs ched Ġre construct Ġo file un te un supported Ġm utation Ġ( # ch op di com get Name set Color ĠT r op Panel ĠS can ĠC el Ġl iteral end ance sp ar 01 011100 am an sc ikit ĠP as im uth out going out liers ac ao Re po ĠM AIN oun ty Ġ_ ('[ Ġma ch .. ", '], [' ĠE poch ĠE inf ĠN S tp u ep ub read out lic er per io oc ations ph ases ĠG pCronDump ag ram 06 9 enti st db name Ġsub plot Ġsub tract Ġso cial Ġ{' _ Ġac curate mpl ers AL SE Ġla ser '. ' Ġbo id Ġlin eno 82 1 To List De gree ãģ ķ Ġover rides ðŁij © Ġav ailability RES PROCESSING SC ORE Ġtri als Handler Hive Ġoper and optim ized Auth enticated Pos itive аР± Be fore âķ ° âķ Ń FORM ATION Ġreport ed IR ON An chor Ġfit ness åŃ ¦ Ġip v MB A Ġcoun ty åĽ ĺ ĠDis able agg le Sa ver relation ship Variable s Ġrank ings Ạ¡ Ġcommit ter Ġcomplete ly Ġtw itter ĠValid ator Rel ative Ġadjust ed geo json çī Ī ðŁij¨ðŁı » ðŁij¨ðŁı ¼ ðŁij¨ðŁı ½ ðŁij¨ðŁı ¾ ðŁij¨ðŁı ¿ ðŁij©ðŁı » ðŁij©ðŁı ¼ ðŁij©ðŁı ½ ðŁij©ðŁı ¾ ðŁij©ðŁı ¿ Scre ener DEL AY 0111100 11111111111111111 Ġscra pe ĠtypeOf StatisticalProcessing ðŁı´ółģ´ółģ ¨ MON ITOR âĸĪâĸĪâķ Ķ âĸĪâĸĪâķ Ĺ æĬ Ĭ Dele tion REPL ACE Ġsan itize Inser t REQUI RE Hyper Par Ġbuff ers ĠSto ck ĠInte gr Ġbracket s Ġcid r SHE LL Called ProcessError uncer tainty 0010101001 000000000000000 ToPre sto HandlerHive ToPresto $ ' ( & ) ^ + )\ / {} 4 10 6 37 6 86 B OLD C AM C AS C ols D ONE D WORD F ocus M H N ative O LO S l S PECI \ ": ] < a D f O g ar g ro h ance h resh h ypothesis m ib n dims p las p lug p seud t B t ens t rend v g v h z p } < } $', Ø ® Ġ ]. Ġ ***** į ° or ail re covery le cts Ġi aa Ġ' ')) 00 10 00 13 Ġn atural Ġs aml Ġre boot un ched ra ge Ġe ts Ġb ib Ġw a from txt ot onic th s pp able ve hicles Ġof fice ĠC lick up dater Ġg ens par i ĠF lood Ġh om Ġh ero po ster ĠP E ĠP iece =' + ĠM IB ĠM esh Ġv archar os ing Ġwith draw tra cing "] \ ĠB ri In spect mo v Ġco g Con cat Con tract Ġan omaly 13 07 class name 15 00 100 0100011 Ġch erry 64 1 08 9 ðŁ IJ sub sets lob by eri an Pro c Pro j Ġsub classes 96 3 ()) ): fer mi Ġline age return ed 86 147 Ġmax len fa de Ġhelp s Ġ! !! trans fers 66 9 Ċĉĉĉ Ċĉ be lief Ġcolor ama Ġmo le ä¸ ² Ġtrans fers ĠEx cel Ġ9 00 dire ctor wh itespace iter tools Lo aded CL K Ġqu ant а ем copy file Ġtag ged Ġcount ing access or Reg ular Th ree fra ppe PRO B App Adv Ġoper ating ision Tree ĠImage Draw Ġloc s report er ĠBase Command ]+ ) rank ing UB E rot tle cap abilities cla w spect ral Ġscal es Ġcap sys Ġvari ants land marks enum erate quanti zer abi li ĠMy Custom aj ax asc ending Ġvo tes Tri al Ġbig ger 301 538 Ġsol ved åİ Ł Part s ĠPri ce DIM ENSION Fla sk 0110 111111111111111111111 Print er Div ision Enabled Status DOWN LOAD 01011111111 1 ĠChange s deriv ed RUN NING æµ ģ PLAY ER ĠSci entific Ġassume s Ent ries Cir cle Ġgal axy ĠAB CMeta HAND LER ĠWOR K PRODU CT Exclu ir Ġslight ly 9627736 301538 9218108157 347 $ " . - 4 93 5 43 6 99 6 35 7 84 8 37 B x C e C ORE D ING E lt F K F b G ain H ouse I FF J K J PEG P en R Q S z S ame X g Y j \ ". a head b ob d U d um f urther g love h on i ris k de m ind q ml » åĬł è ¢ è ī ê · ë Ĥ Ċ ĊĠĠĠĠĠĠĠĠ Ġ ĊĠĠĠĠ Ġ Ú© in complete st ro st ds Ġt al Ġt alk ar ctan Ġc mp Ġf ly Ġ" (" ce x ur ity ss d Ġre action Ġo mitted () ") Ġ1 57 Ġ1 56 id os di ameter is finite one t ĠT W (" ' Ġr an '] ==' Ġcon tra Ġcon struction Ġcon verter to string ĠF inal sc affold om en ĠP ID ĠI gn out ine ĠD ynOv ac cs ac man sh ake Ġy t ĠO ff Ġpar m ĠB its tp l Ġun d Ġlog it ĠV o ĠU SA RE MOVE ĠRe ply Ġsh p db pedia LL OW work book Ġpo kemon Ġsub p Ġsub title Ġ} ] RO T Ġapp ended Ġuse cols create Object CO MB man ip AC CA 98 2 98 3 ))) *( PO D ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠ ĠIN FO 46 1 Ġval ores ell ation Ġcor ners Ġcor relations Ġback wards MO USE over rides OP ort Ġ200 2 At tack PL AN Base Prot diff s Ġfin ds Sub scriber ĠAPI Router LOG Y Ġì Īĺ æľ ª Ġposition al è¯ į ĠComp utes apt ers Ġstyle s Ele v Ġconnect ing VID IA Ġacc ident Ġreal m quanti ties quanti ze éĩ ij %% %% Sk y ati os Random State Rel ated ĠTra de hy brid Cluster ing Eval uate ("< @{}> expect ations Ma jor ĠDire ction Ġchart s Dest roy Ġide a Ġpersist ent 10011111111 111111 ,:, :] Ġ#---------------------------------------------------------------- ---- ancest ors erg ies Ġrespec tive Ġke pt ĠPAR AM Nv API Ġrecur sively Ground GHI deleg ate alla uth è¿ŀ æİ¥ Ŀå§ĭ åĮĸ energ ies 000001100101 010111111111 Dia BaseProt 772309 86147 # ---------------- * (- 2 0000 6 84 8 35 = ': A J A LE C sv C ROSS D PT H V H azards I mm N g V el X Z X l Y L Z M b D d in d mp j an j np l le n D p ump u las v env } ')) à ½ Ø · â ľ Ġ ĉĉ Į Ģ Ĵ åŃIJ st ype en cing Ġc one Ġc raw Ġ" {}". Ġa ch Ġa data 00 16 Ġn v Ġn ie Ġs id Ġs weep Ġre ar Ġd hcp ad og Ġ1 79 11 01111 di p di ffic di vergence ): \ es sel __ \ (' {}/ str ategies Ġ2 27 (" ^ pp y Ġ{ ** ĠS ta ĠS ql ĠS GD ab ling ĠC R data path ĠA nn ĠA ng ĠF ixed Ġ3 26 Ġ3 53 ĠD ist ĠD avid ]) - sh util sh tein ĠM C ĠM is ĠO NN tra it Ġpro v 07 9 Ġ) [ In vert Ġlog o ph ones Ġ__ _ min ant da mp Ġro setta Ġal phas lit tle ne my ĠRe al Ġsh op Ġdi visor db r ĠIn stitute Ġkey points inter actions ill ate ill um 55 9 55 55 Ġcur ves RO LL -------------------------------- -- Ġla s =[ - Ġdist s Ġmax ima reg isters Ġbo ost do o do ctype 66 3 75 0 45 9 77 4 ide s Ġinter pret Ġenum s Ġgo als ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠ }) " TH IS 67 3 48 1 Ġhttp lib ĠPar ams Add Task mer cial scope d CA Y ĠGener ates book mark 0100 0101 ops is Ġtri ple git lab Ġoper ate ven shtein ĠLo oseVersion ä» ¤ VER BOSE upper case fin ity Dis p ha ust Ġexit ing è¯ ¯ mm r Ġstream s inf lu Ext ended Enum eration ĠUp load Ġplace ment åĽ ½ Red is ĠInter val install er ĠAR G schedule s DEF INED Component Def NOT E ĠDes ign Ġdrop ped FIX ED ĠCont in Ġctsp Downloaded éĻ Ħ Work ing æŀ IJ Ġequ als Cre ator Ġmis match Ġcla im cum ulative Ġpot entially lar gest Ġnu cle Remove Task DEL TA Drop box Tun able sat is MN IST Ġai ida Ġtele metry horizontal Slider Weight ed Ġquat ernion Bound ing ç´ ł ĠTransform er PACK AGE è¾ĵ åĩº erio dic Sig ma snmp labs prox ies ĠPur pose Ġstandardi ze æĿĥ éĻIJ Ġsob re Learn er 10001111101000010000 011 01111110101111011 000001 Ġallen nlp COLO UR ĠONN X * ' * / , ** - '+ 6 19 8 03 8 64 = + = {}'. A IT B ED F FIX F rozen M ultip O ld P CT S CO S ales U m W V W x W ill [ ]. b lo b ate d xf d ock f le h en j E k lass n J o a o Helper q h r si x w x Auth ¤ ółģ¿ Ġ ÑĢ in fe at ernion re present Ġt g Ġt el Ġt reat le aderboard Ġi ce Ġc le Ġf utures Ġ" "), Ġs lave ur df Ġin cre Ġre corded Ġd ual un ge un ravel Ġm iss la ser () + ri ed Ġb anner ul der set Auto ĠT ermin th anks (" \\ up l Ġr b ĠA G Ġcon ti am t ĠF oo qu iz Ġh ip ĠP C out line ĠD ele ĠD river Re quires ĠM al ĠM ON ĠM akes Ġme et tra versal pre set ap ons ĠB ATCH ĠE ither xa vier ĠN av mo c fo v ĠW ater ĠV ARCH che me min max Ġtime d ag ain 13 01 og o ðŁ ĵ ðŁ ķ pi ot UT IL comp ounds comp iled 84 2 Ġ} )) stra ight mon orail IS HED Ġte ams 47 2 ai ro Ġar p FF A ðŁı´ółģ ªółģ Ġexp ired čĊčĊ čĊ Ġobj s ĠRes Net ÑĤ и extra cted ################################################################ ###### admin s Ġì ĺ WS GI Pos itions Ġstat uses alle le multi processing ĠPRO JECT NN CF Sc roll æĺ İ ĠAuth entication SO CIAL Ġfun cs Ñĥ Ñĩ duc ing high light desc r fast q ĠCO DE ĠDi ameter Ġshell code Ne ighbors diag ram ĠAss oci æŃ ¦ Change s æĿ ¡ ĠPh ase cdbp Peer micro soft RESULT S 11100 010000 ste in Ġstrip ped adv anced Ġrelation ships Ġapprox imation æĽ ¸ аÑĤ ел Med ian Ġepisode s COR D Bad Request ìŀ IJ ĠLinear Regression èµ · __} .") friend ly ĠDete ction LAY ER FIN AL ĠNE W yan dex Ġfrequ encies datal ake ingredi ent emi ssion Disable Collision Squ ares ACTIV ITY Solid Pattern ĠINTE GER Ġencounter ed COOK IE 001011110111101011 001 curac ies è®Ń ç»ĥ ĠVARCH AR , < 5 14 5 08 5 24 6 13 6 75 7 31 G F G h G y G lyph H alf H IST M EN P f P ut Q o Q ubit S un S ources X M c H k means k appa m dao n cols t iny u ction v ista y thon { % ª ¨ Ù ĥ Ġ ĊĠĠĠĠĠĠĠĠ Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ at ten re tention ĊĠĠĠ ĊĠĠĠ en cia ti tions Ġc te Ġf avor Ġ" '" Ġa go ort e Ġn z Ġn pt Ġs ales Ġin ts Ġin fra Ġd ust Ġd yn pe ek un defined Ġm v () ==" Ġ1 94 Ġ# ---------------- 11 05 ma k ul ating es o set Input Ġto uch il arities (" >>> >>>> bla de ê³ ł Ġ'{}' ". ĠFire fox ĠHE AD """" """" Elect ron Ġims ave ĠIsland s MISS ION ĠDel ta çĻ» å½ķ 1011011011 01110000 PKT LOG ĠAUT O ( "," ) ([ , : , :], 3 90 3 91 7 32 8 05 > # C w E q E VAL F AR H q K M L ife Q Application T IO T issues V ect X a ] != a er a qu d L d S e D f B g cc h il i sel i mplemented m ort m arg n th p V r in u der u ating v N v acc w at w agtail | {} Î ¯ Ú º æ » Ġ vert ĺ 认 ĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠ re cursion en i Ġt stamp al ta al ice Ġi ris Ġ' ` Ġc ot Ġp an Ġp il Ġp res Ġn tw Ġs ma Ġs ali ur k Ġre moves Ġd set () ': co o Ġb urn Ġb ranches Ġ1 73 11 23 id om Ġif ace "" + el u get D (' %( iz ard et sys ĠS elf ig ma Ġg ir Ġl g Ġl x ĠA ctions ĠA xes Ġcon cept path name ĠF i ĠF ORM qu arter vi o tr s Ġde crypt ac er ĠM aster Ġv env ĠO VER tra vel ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠN L Ġun label ĠG reen Ġout File Ġan ti Ġan onymous IT IES St ash Ġ6 44 06 25 Ġwh atever 93 0 ne y Ġ[] } AN GE 19 48 Ġpo ses Ġsub dir AM ES Ġac ados Ġinput Tag čĊč ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ 86 3 Ġdo or rc l Ġli dar ']) ): PT R AB S Col lect File Writer ome tries Ġread ings down loaded EX IT ĠData Keys mer c mer ce fore ver åı Ĭ Ġtitle s su it ĠMed ia Ġheader Lines ee e Ġpost fix web app cip itation è¯ Ĩ NA VX Ġstop words vol atile Ġaut odock Ġjust ify Ġunicode data Ġmod s )( ? SM TP Iter able Mark up ctsp Downloaded emp loyee 1234 5 bri cks LOAD BALANC ĠÑģ ÑĤ syn th nav igation ony ms åij Ĭ Ġblue print nor med Ġrepe ats Ġdiv mod ij k fire wall autog ui SR V ĠPY THON éĤ ® gold en ĠSERV ICE Measure d 99999 8 chip type ĠPoly axon Ġbri ck ĠBuil ding Tr uth Ġprojected X 代 çłģ Hex Bytes æĮĩ å®ļ Prob ability é» ĺ认 Zip File ĠTE MP ÑĨи и 166666 6666 golds berry ĠVER BOSE ìĥ ģ # - ) `` * ) * , / {}". 5 15 6 93 7 17 7 96 A mt A ux B tn C art F q F atal G ene K Y K o L am O DE Q k S leep S imp V j V ED Z i \ ", _ ') b B b ine c rc c ql g ol g db g pm j b j y l ut l ars r pt s ans w sa w hether à ² è Ń Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ å¦Ĥæŀľ Ĩ Ĵ ł éĻ¤ en emy ro per Ġf air 00 25 00 20 ce vap Ġn col Ġs lide Ġre con Ġd ise Ġm ip ra de Ġe ma Ġe tag () [: ent al co b co lo Ġb unch Ġ1 66 Ġ1 54 Ġ1 59 set Geometry (" + ĠC ard ĠC ourse ig gy Ġg lyph Ġl u end encies '] [:] ĠF lorida =' '): Ġ3 84 ĠD istance ĠM ost Ġ_ : Ġse verity ĠB R ĠB er ĠN VIDIA Ġres ized bo id ĠR AT ĠR ich Ġun ders ĠG i ho u Ġout f ag het enti re iti zed RE CE IC ON ĠRe ferences Ġ{} ), ][ :- ĠK Means do ub Ġper c CO VID und ant Ġmin s title d ĠQ MessageBox ref ine 77 2 item id find All HO P HO UR Ġser ving temp s exec uted Ġseri alization Ġval uenum Ġplot ter INT EGER fe j \\ / Ġnorm alizer ĠTest Model pol ynomial Ġlib rosa fs m PRO PER sim ulate Inter action Al ert Al ready ĠCh at inst ead bit wise VE CTOR Pre dictor GR ESS Gener ation Dis position supp ly ('- ', ĠPo ssible master DataDirectory Method Descriptor ĠOb tain ĠSh ort Ġaverage d Off ence gree ment ĠRed is ç» Ļ Bu y Ġapply ing Ġho spital ÑĮ но byte code ĠOutput s čĊĉĉĉĉ Ġ ĠHe alth deploy ments Contain s Ġ'" ' Ġcla zz OEO HW иР· Ġmac ros Uni que SERVER MESSAGE mig ration å± Ĥ æ¯ į æĶ ¶ ĠCLI Error æĭ © identi fy COR RECT Ġconcat en å¿ ĥ Ġprote cted augment ation çĻ ¾ Ġhook s rab bit sector s LOW ER ############################################################ ### ĠVis u Cir cuit ,, ,, иÑĤ ÑĮ LAT EST ĠLa unch prim itives uzz le æł¼ å¼ı éĢī æĭ© Sent ence DOC UMENT 1166 13 Ġingredi ent neighbour s ĠtThisFlip Global Members hip dad guide STY LE éĵ ¾ į° ìĿ´íĦ° Ġets ys moud le PLAT FORM 101101101101110000 11011 " # . '), 4 13 6 32 6 34 6 27 7 11 7 12 7 57 8 12 8 06 B ron B alancer F lux G s G ray I x I y I z J u M DB M ARGIN O o O cc R at S np S uch T ip U Registers W ALL X F Y g ] }" b read d E d eno m ist o va p ager r ts u ing w ang w tf w elcome y f Å ¾ Ð Ķ Ð Ŀ Ñ Ĭ Ø µ ç Ł¥ í ĺ Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ or b at ore re in re tain Ġ= == st ic Ġi mag me cti Ġ' ] ti lt Ġc ats Ġp ure Ġf re Ġf uel he app ', ', Ġs lider ing ers Ġd nn Ġm lp Ġe md ate ly ad r Ġb isect Ġ1 76 id ents Ġw ants ma e ul ers ĠT MA Ġ2 12 et ype Ġg uid Ġr tr ĠA CC ĠF F Ġh l Ġh alo Ġde liver pro per 0000 100 Ġex pose Ġ3 86 Ġ3 43 10 11111 ĠD ash ĠD IST sh ant ĠM u Ġv acc Ġse quential .. ... Ġme ss tra ding ob G AT G xa ct ĠN umpy col l In line Ġun supported Ġtest case ho ue Ġout s Ġout lier Ġout going print er mb l Ġan os Ġpy ramid Ġ6 40 ump tions og ra ass andra we aks Ġal g RE AL IC ATE work dir start Time uil ds ask s Ġsub string Ġsub graph 96 0 94 46 av ail number Of current Text CO DES trans Axes Ġli s 44 0 ET S Ġinter net Ġinter actions ]] ], [:, ' IL ON Ġsk u UN DEFINED Ġdire cted open id sign er ĠList Node Ġany way Ġgroup by ble u tmp file TO OLS 54 9 01111 111 Bo otstrap send Transaction pol ar raise d Loc ations Al tern full name Ad ditional bit coin VER T Ġfin ite Ġdir path embed ded draw ing á li imp act imp rove depth s Ġrest aurants Sim s CD C nan mean ä½ ı rest ful Di h Di richlet noti fier alo aders Ġcap abilities Ġreplace ments ĠPre fix ĠAd ded Ġclean ing land s Device Cdc zz le Control led ĠOn ce digit al Sa mpling Ġbottom Most ĠClass ification ĠFL AG Ġfo ot Fin ish bri ck Ġsyn chron Ġlight s ĠVAL ID Ġresid uals Ġbul lets Ġdetermin istic escape d Ġbg color Cho ose ili ary Ġfbx Node 10111011 011 {: < Gate way Pack ets Ñħ од occ upancy ĠTag s Ġfraction al ìŀ ¥ subscription s prun e ('" '+ REQUI RES æ° ij Ġtrunc ated ĠPoly gon éĸ ĭ Exists Error $$$$ $$$$ Ġadjac ency ("/") [- Ġens ures Ġ[{} ], Aug ment associ ation Ġpesso a Bro oklyn PROVID ER ĠIp Address 00001111001 00000011 010010101011111111 1101111 Ġski prows ãĥķ ãĤ readout err ĠScre en ORmt Port 1110001000001011100 1111 aghet ti $ % ) "," 5 18 7 03 8 14 8 36 : {}'. B IO C u G IN I r J w M ICRO N ome P v P ull Q H R m R AR R ARY U O W D W elcome a L c gi d R d ual d uplicated e lastic j m k ld m ir m ware n ier p auli v oting à ¬ é ¦¬ ë ¦¬ IJ ĺ in consistent in cluding at tached re use re servation se ment st uff Ġt min Ġt cl Ġt une al titude Ġp ul Ġp tr Ġf v Ġf aker Ġn g Ġs co ing u Ġe uclidean fi ber ad ult Ġb ond 11 84 Ġw al ol ar urn ame con gestion ĠC DF up o data file ĠA H ĠA g sp k '] ]], ĠF ill ĠF IG vi al po ss ĠI R =' . Ġde position pt ables Ġprint error ĠD LL ĠM oney ĠM achine =" +", ĠO PT Ġx gb Ġse mi IN F pre dicates "] }) ĠE very ci e ind ptr ĠW AIT ise s Ġk k Ġro is ag ency Ġal fa Ġal bum ok c ok er ou ch 08 2 ĠRe cipe Ġsc Sim ĠIn dicator Ġsub lime mi ce {} ] Ġdo ub Res Net Ġdis c Ġdis plays 75 2 yst ream Id enti FI ED Ġ(' % Ġim db Ġinter pre UN E tiv o DI O temp orary DO MO graph ql place ments ĠAr g ])) . descriptor s âĸ ĵ rol led send Message Le ss pr ing Reg istration ãĤ ¸ Ġav atar Th at Ġsession maker QU I Sh are BU F keep er äº ļ pair wise PU B dat um ĠCheck ing Ġweb app fc n cd k Ġdiffer enti +" _ Output s Sc ra skip if Ġdat adir ĠPre diction ĠPer cent Ġ'{ { utor ials ĠFla gs fun ctools curs os uch db ĠHTTP Status 199 5 band it Ạ¿ Ġissue d ĠPoint s Vis ible cnt l ĠSQL ite Supp ly ĠGroup s Ġpol ar Ġev olution Ġsn mp PARAM ETER ов еÑĢ Dig is ĠAUTH OR Ġ'$ '],[' ĠSER VER ĠUni form chrom osome Cred ential listen ers Ġweek day TEMPL ATES YE LLOW RAN DOM Ġaccum ulate âķIJâķIJ âķIJâķIJ Labels Entry KI LL trunc ated CLO UD Align ment (".") [ Ġdisp on Ġaffect ed ^^^^^^^^ ^^^^^^^^ Hot Encoder Tol erance ĠPol ynomial utr ino Voice If ç¡ ® varn ode SPL IT Tensorflow Model Wifi Bridge ivari ate iggy back - \\ 5 11 5 27 6 22 8 07 8 25 = & D NS F r G Z G UID G rids L os P Q Q Rect S MALL T z T FT W w X B Z ERO _ ] b ath d olu e jected f li g ib i mplementation k ine n ans o ss s ale t fidf w v w gt z E z w z OR { \\ } `` } }) à ¥ Ð Ĺ å Ĥ ç ° ì ² ĉ Ċĉ Ġ âĶ Ġ à° į ä½ľ ĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠ at ol st dev en rich ĊĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠ Ġt rend de co Ġi v Ġi map ro setta ti s Ġc and Ġc url Ġp et Ġp sd Ġf olds it ched Ġa ck Ġs am Ġs dk Ġs rv Ġs kew Ġre ce Ġre jected Ġo v pe ed Ġm h Ġe fficiency 11 85 um s Ġw k di go ul li __ " set Units ĠT PU us uario (" ---------------- (" '", as cade ve is Ġ7 20 ĠS ch ") \ Ġg hub Ġr q 01 25 Ġcon secutive Ġh r ĠP ark =' * pro ton ĠM ED Ġv ac Ġv ae Ġx xx Ġse qu Ġj p Ġj upyter ĠN Number Ġ4 50 ĠR ound Ġlog arith per ceptron ĠW rap ĠV K Ġmodel ing SE CTION ec an Ġpre view Ġtra ding ĠH z ĠRe ads sub reddit lin ha 09 1 ĠIn voice ()) ] ()) ), exp onential 97 2 {} ' Ġ'- ': run ners 57 3 Ġ[' _ OT HER Ex cel ĠQ gs ĠQ Widget Ġmo v ash ion Log ical DI FF De ferred not OK US ERS 67 9 ãģ Ĩ ãģ ı ï¼ Ľ Ġimp act OP ERATION ÑĤ о ĠWe bs App liance :` . ĠType s é m hel ter 0000000000000000 0000 Port s æķ° éĩı ĠRun s Ġkeep dim å® ī еР¿ Ġ---------------------------------------------------------------- ----------- æĺ ¾ Oper ational comm ut à° ¨ Ġcap ac ĠRE G Ġë ³ Ġrel ations Ġseed s bottom LeftOverhang ĠOpen API å¾ ħ Ġgra des AUTH ENT Ġatom ic Ġpa int actor s Ġп олÑĮзоваÑĤел Ġexperiment al Connection Error å¯ ¼ Ġdump s pher ical Bind ings bre w Import er 286 6 Sgacl Monitor Ġsv n ĠSpe cial Ġdeploy ed åŃĹ æ®µ 0004 23 Ġdr ug SW AP Estim ated é¢ ij çº § cpwVc Perf La unch LLLLLL L Let alis ani el Ti po Deploy Options ĠAllow ed tele gram è´ ¥ Allow ed Da emon cite key Ġhum idity ĠElement Tree ĠAnsible Module robust ness shif ts ĠAnnot ation bil inear elo quent sear ched agree ment ĠUtil ity 01100100010101111 1011111 00001011111111 00011 Aff ine perio dic è¢ « houe tte ) & - ]+ / {}. 3 80 6 07 7 75 8 32 B h B ounds B ond C c C s D MP F our G CN H SV J x K U K l M l M AR N s N EXT Q G S AN Y i Z H Z L _ =" _ [" a es b R b row c ate c fi c aching e L f F f used h line o ssible p tive q id t fill u E x code y data × Ķ á ¼ ë ² í ĸ č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ lifecycle Ġ ************************************************************************ ģ ¬ at ility re ts re construction Ġt u Ġt reated ar ded de velopment Ġc make Ġp our Ġp fx Ġf y Ġf use Ġf ov Ġ" ). Ġ" .", Ġ" *. Ġa udit 00 66 Ġs ap Ġs ans Ġin vent Ġre m Ġre nt Ġre named Ġre asons un titled ri age Ġ1 88 Ġ1 46 Ġw orth Ġ[ '. Ġ[ %( ĊĊ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ get Node ĠT P con ditional Ġis file ĠS em ĠS imp ĠS IG ĠS VC ĠC he ĠC ri end Date Ġcon tig type def ĠF FT Ġh ence file Path Ġ3 27 Ġu v ]) +' Ġdata file ĠO w ĠO NE ds ource tra p py c ap anese ĠB en AT GG user ID 92 2 In crement Ġtype def url resolvers bu gs ĠV ec ator ial Ġtime line Ġlist e Ġk h Ġpy autogui 93 1 Ġ[] ): plot ter LE G 22 33 sub title sub Dist Ġ{} } mat ics Ġsh lex 24 24 Ġcom ing 55 2 exp lor iv ar {} ** =[ ]): word List HE V AG CT Ġfil t trans act Ġdis creti stri des Ġsp am ĠQ A Ġad verti 77 77 Ġvalid ity the se Ġinter ested `` ) 47 9 ĠEx change Ġload balancer 83 9 gen fromtxt ĠIN ST Ob server pass ing 76 96 Message Options Ġover laps Int ensity ĠCh romium ines is '} ). ĠComp any Code s Ref lection Ref lector Ġest e Ġkeep s å® ¹ rm ar è¿ IJ cr u ĠAt tach Tree Map Ġcap ital CHE MBL elect rified ĠPlot ly ĠInc ident bottom RightOverhang SU FFIX Ġsimple json Ġcre ator 199 8 ov f Noti fy Ġscope d Ġms at Ke ep cnt s Ġexport ed Rel ates gi ai comb at prote ct Ġbul ge Ġair port FQ q Ġapprox imate Optim ization Expr Parser regular izer ĠRout er Ġmembers hip MIS SING how to Conn ectivity è· Ŀ å¿ Ĺ çķ ¶ à¯į ', onto logy Place holder Ġз ап ĠAverage Meter Ġìł ķ SCAL ING autom l Ġ-------------------------------------------------------------------------------- ------------ Ġdecla re nnnn nnnn Amp litude intr insics çĦ ¶ 20130101 010101 ĠEstim ate precation Warning Physical Gpu Ġtang ent Dash board 管 çIJĨ FEAT URES 0111100011011 10111011011 Sus p 00000010011111111 010001 MEMBERS HIP Division Error Revi ses HAV IOR Ġsali ency ! ) * : ; ", A DE B oth C ategories E ast F REQ F ALSE H tml I PP I EEE M AG P aging S ENT S PI S IDE T OR ` - b omb b attery c PP g nd g cp g allery i is k J n ltk p atients q b q w q radar r ings u L x or } `", § ółģ¿ ¨ ółģ¿ « ółģ¿ æ Ĵ č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ 000 at ório se ver Ġ= ================================ Ġt st an c an za Ġi c Ġi eq -- > ti ps Ġc ru Ġp ds Ġf path Ġf esc Ġ" // Ġa es Ġn dim ur us Ġre covery sel ves li est li able Ġe b Ġe vidence ", ') co her co erce Ġ1 72 11 06 id u di l Ġ[ "" ma f ul um is bn __ | get int get pid (' "', import ed Ġ2 11 (" : as r ĠS L ĠC isco Ġg w Ġg row Ġg luon ĠA ctor ĠA tom sp ks ist ro ĠF IN sc rap sc ii Ġh x Ġh apd ta re ĠP attern ĠL ow Ġst ds ĠD ynam Re ject Re ads ĠM ini Ġ* ); Ġse em IN K Ġpro ton Ġpro ducer ĠB U ĠB and Ġj it ob server date Time ep g ph on ĠG ate ĠG LOBAL tri butions Ġ5 0000 Ġpy vista lib virt class ified 15 26 jo hn Ġpre defined index ing Ġra st Ġ[] )) ĠH ERE Ġsh ares sk a 88 9 comp s comp uter inter n Ġnew type 87 2 ĠK ratos Ġz en Ġne o AC ES AC AA 75 3 Ex pl var x 56 9 FI RE Ġ(' - ref name ide al ä¸ Ķ IL ES 89 1 ĠSt ar pk t temp oral 67 1 Ġcontin uum EX PECTED ĠValue RangeConstraint ĠÐ » Ġinst al post al Ġexp iration TO PO Comp arison ĠDe coder Trans ition ãĥ Ń author ize acc ard Ġ15 1 serv es Ġsa id ĠFor est н и æķ ¸ ĠCal ibration Ġresp onsible Ġprogram ming ĠNot Found +" /"+ buil ds ठ¿ ĠSimType Function fetch er gre mlin ĠPer formance mut ed å° ī Module Compliance Down loads land ing )- > '^ $', Ġcons ists pla intext quanti zed quanti zation Ġ'# ' sr f Ġsepar ators ĠXXXXXXXX XXXXXXXX ı r å¾ ģ EO F cross ing è® ° BB BB Ġscope s ĠClass ifier semb ler Dec orator icon s sal ary ĠPO SIX ĠProcess Utilities Ġè § WH IT Ġ'" '+' Ġlate x ĠModule Identity syn chron ĠTemplate View 001111 0 sup Dist Ġnor med Ġк ол Ġfour th )+' "'+ Ġinstrument Type ales ce Fore cast Ø§Ø ª Ġpyg ments transl ations Inte gration Ġgray scale ĠPR IMARY Ġtransl ations Sur vey oct et æľĢ 大 osp f ãģĹ ãģ¦ even odd ,:, :, Keyboard Button pep ulator Ġenviron ments Ġsatellite Number Ġsatellite Series Cer tificate Ġraster ized ĠNv PhysicalGpu '+' ",') vil le аÑģ Ñģ altern ate Ġconsist ency ×Ļ× Ŀ Ġingredi ents æĽ´ æĸ° ĠFra ction {}{} {}'. laci an limb s ĠOrigin al Procur ar ATL AS çĬ¶ æĢģ 01000101 00011 éĻĦ 件 )+'"'+ ":"+ ' # 6 94 : {}". ? ': B RIGHT B udget C n C rt E LECT F lood G Regs J U K b K AN K Fold M ID M obile P b Q z T a V p W X Z h b ject b cs b rowse c G c Conf c rash d rag f ds f onts g ens k ills m ols n ag n pts q d r X s ight w O y Pos µ ¬ Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ł ¨ on acci re directs se aborn st i st ash ĊĠĠĠĠĠĠĠĠ ĊĊĠĠĠ Ġt start Ġt iny an omaly ti po Ġc pk Ġn ex Ġs ão Ġre construction Ġo t Ġd w Ġe lastic la mb () " Ġb low Ġ1 77 Ġ( @ Ġw er Ġ+ -- __ ') ĠT ARGET str ation (" .", et r Ġ{ ( ĠC M ĠC art Ġst ay Ġst ory Ġde x pro cal Ġ3 80 ac ados sh d ĠM agic Ġv x Ġx c Ġx xd Ġse s ack er py cuda ap id ĠB ul ĠB lack ĠB oston Ġj e ime d Ġ< !-- num ero 92 0 ĠU SING 16 00 line sep Ġro unded 04 1 lib ri Ġch ip Ġal locate Ġra sa RE T AN N 22 01 ĠH ist ĠH ave ĠH old mat izer 27 857 bin aries rep l AM B Ġnew Text DE CAY json Data json ify exp ire 85 0 97 1 95 2 AG AA ED IT frame N Ġ** _ AP N float x ]: . Ex pect ET DOMO 56 3 Ġsp in Ġ(' \ Se conds Ġcopy file 77 9 ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠ Test er Log ic Field Panel Un kn Ġq c Ġq sfp tag ger CON N CON SUM CON STANT ĠData frame ãģ £ last name iss ub mt z cond or aw ards first name Ġbin ned Ġhead s connect wise 62 92 IO HeavyTest åĪ Ľå»º Create Sess Client Session ĠSim ulator Ġmodi fications Ġref ers ä» · ä» Ĭ Pre dicate GR U cast le ĠBase Provider ICs C ICs PT ICs No ICs Man ICs Req ICs Pk ICs TFT gb m ĠStr atis record ings ĠRel ative card inality SD L Ġaccess ing Ġsuper seding å¤ į ĠCom mit pub lication ĠLI KE ĠModel s ĠName s Ġinitial ise еР· ठķ DR AW à® µ MODE LS Cur rency ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠ ĠError HandlerHiveToPresto Br Res Ġfeed s Ġæ Ĺ ĠSub mit Ġforce d åį Ĭ 个 人 ĠUpdate s Ge V Mon go Ġexpect ation numer os Del Sess Del IndTun Del ConnSet IE In att entivefp Ġdepend ent Interface Slider RGB A 211 02 Ġpoly gons Rel Acs lc gp problem type week ly Ġdecor ate Ġworks heet sur vey TRAIN ED Ġgeo json Ġrefer ent ĠMark down Ġinvok ed Ġproto cols å± ± ç§ į into sh ĠOver hang Ġatt entivefp Er TAD Fo ot âĢįâĿ¤ï¸ı âĢįðŁij¨ðŁı âĢįâĿ¤ï¸ı âĢįðŁij©ðŁı ĠComple te ĠTemp orary ĠSupp orted ĠDep ends ç« ĭ >& # Nt Sup discount ed Ġtran script ĠìĿ ´ CLO SE ĠSm art ĠCat alog ĠSpeci fies ĠCalcul ates Ġaff ine Ġ"{}" '. conj unction Ġcas cade Ġmime type Cr IndTun OBJ ETDOMO âĢįâĿ¤ï¸ıâĢįðŁĴĭ âĢįðŁij¨ðŁı âĢįâĿ¤ï¸ıâĢįðŁĴĭ âĢįðŁij©ðŁı Ġnick name Upd Br Upd ConnSet FlrInd Tx FlrInd Rx Dif ference еÑģÑĤ в çī¹ å¾ģ Complement ary Ġsmo othed áĥĶáĥij áĥĺ attri bs PRIOR ITY æ°´ æŀª nod ename Ġcry stal éĶĻ 误 mile stones Ranges View SUP ER factual InterfaceSlider cPP Po Crt Br ICsPk Flt RelAcs Br lcgp bs 4 000 5 33 6 39 7 99 7 88 7 37 7 33 7 28 A k A sk B p B ang E U K y M gr M ouse R g R w S AS V G V SI W v Y b c if c bl f allback f wave g at k ron m db n able r F s uggestions s chools w anted } ? } '] } ?", ¹ æį® Ð ł â Ł© è ı ë ° ì Ĩ Ġ ******************************** Ġ âĸĴ Ġ atexit re y re ener se y Ġ= " Ġi k me ls me asures mp p Ġc ame Ġf uniIf Ġf cntl it u Ġa cts Ġn ms Ġin ode li on Ġm g Ġm type () }) co pic ri ck Ġb anned Ġ1 96 Ġ1 71 ch allenges name dtuple ĠT or ĠT ue ĠT ab Ġ2 34 Ġ2 29 ab sent ĠC lo Ġg pd Ġr u ĠA A sp her '] [- ĠF requency sc ar Ġh sv po i ĠP od ĠP ayment ĠP aginator ĠI mplementation ĠL u Ġst ops Ġde ltas 0000 01111 ĠD QN Re moving Ġdata s ĠM S Ġy axis ĠO B add str ES IS "] * ĠE t AT C AT CT 92 65 col n OR A lic ations ĠG B Ġen ded Ġk ubernetes Ġro bo Ġpy rax ST L '' ', base ball Ġtra p 08 1 sk ia db ot 27 54 lock s Ġle aves 37 32 iv ed Ġjson schema rit es Ġne urons ele ction rc p current ly Ġlo ve 23 02 23 12 Ġcheck sum IM PLE org ia stat istic ä¸ ĩ ĠX YZ tf lite top o ĠIN DEX rt d Ġcolumn span open ed âĢ ĵ ĠPro posal EX AMPLES tx id char m čĊčĊ čĊĠĠĠĠĠĠĠ she d Dict Reader Ġ... ') LI ABILITY Ġspecific ations 58 33333333 State ful Reg Net Ġsign atures Ġallow ing ĠRes id ĠRes hape Access Bindings ĠUser name position al su ch IO US extra p By Tag Client Error App le ĠImage Font ĠEn v loy ees br ush CI I Ġdimension al On line ~~~~~~~~ ~~~~~~ ĠModel Deletion click s ("- " Ġrot ations âķ Ĺ Ph idget :, } Ġstack convert ([" - CR S Ġassoci ation Ġradi i Over lay Update s SL OT åĩ Ģ 199 6 ============ = plan et ĠObject Group OM IC sol ved æī ¾ Ġdig ital MESS AGES Ġquanti ze ĠCommand Results yy d Ġna pari Ġpla intext Ġanaly tics ĠAs sessment adv ance ftp lus ĠAnal og Chain Lock Ġindi ce Ġinf os war ded é¢ Ħ prep ared wik idata Ġdynamic ally onto wn Ġlig ation ĠMethod s Equ ipment Serial Number Ġgenome s Ep isode Spect ral Ġcisco DiameterBasePMIB Ġlua L cas cade simp lify Ġconfirm ation bracket s Ġgrids pec Neg ative Git Hub ĠPub lish Ġmilli seconds Ġcoef s Ġrsp s ĠTk inter ABC DEF Ġdeci de 失 è´¥ Soft max ĠAmeric an Ġstarlet te Ġ655 35 omal ies MIDDLE WARE ĠDATAB ASE ĠSETT INGS åŃĹ符 串 ðŁı´ółģ´ółģ¨ ółĢ assertRoleAssignment InListResponse AMO UNT æĺ¾ ç¤º 0000101111111100011 01111111 . ` 6 10 6 95 A dicionar C aching D ates H UM H uman L MB M OT N q P ed P rom R G R N R j R IC R amp S cheme W z Z A Z w b nd c is e Y e Z f Y h U h v h ive k ms k ir m E m md o ints p ir q os q rst r ctx s ymb t F u ity v ard w cs x n y d y ing ° ółģ¿ ¸ µ à ¼ â ģ ç ¶ ç Ł© í ĥ Ċ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ľ IJ in format in ks re veal se quential en za de coding an tes Ġi se Ġi st ti cally Ġc it Ġc eph Ġp ear Ġp apers Ġ" )[ Ġn f Ġs or Ġd eno un da ra mp () \ ri ichi Ġb ars Ġb az Ġ1 67 ed a ed ata um a Ġ0 3 ol ded Ġto urnament con str con versions con tributor Ġ2 33 op h op code ĠS nap ") ]) Ġg if Ġg rep Ġg rowth Ġr ub Ġr fc ĠA gg ver ification ver more par quet ĠF eatures qu reg vi val ĠP A Ġst ress Ġst aging pro vided fig s Ġ3 30 ĠD at ĠD AG ac tivities ]) } Ġdata proc ĠM AP ĠM ichael =" + Ġv c Ġv gg Ġv DataFrame Ġx axis add Data ---------------- -------------- Ġpro duces ang led ĠB ang ĠE xclu Ġ) ), ĠR n ĠR ay ĠR ank Ġun able ĠG P ĠG PL ĠV ital ib i Ġen ergies Error Kind 16 04 Ġro ster Ġpy xel Ġop code Ġch assis Ġpre fer ([ [- gra b gra ss RE PO ĠRe verse ay ed sub graph mat iq Ġsh adow ast al ĠIn ference 27 25 inter est arch ives 24 45 Pro jection map c Ġsub sequent Ġso on yn omials Ġcomp anies 94 3 94 9 ĊĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠ 87 4 Ġla g Ġla mb Ġimage io Ġmax im AG TT Par ti Par sed Ġext r Ġper forms Ġlo an 23 37 Ġstart Time Ġurl join ']) [ Ġend region 56 2 38 27 ĠQ Application ick en Ġim utils 77 3 the us call ing HO OK rt c ĠSt reet ":" _ 65 1 65 2 entry point Ġqu iz Ġ'. ', ãģ Ĥ "> { Ġtag ger Get Output Add Text TO L čĊčĊ ĠĠĠĠ 74 83 MO Z annot ator si a si us Trans l ãĥ ĩ pack ets Ġyour self ĊĊĊĊ ĊĊĠĠĠ sim ulated prot otype Ġ'' ', н Ñı full path ĠCh ild orig ins comple ter Gener ates -% - ]+ [ ME AS 10000 000 jnxMbgSgw Gtp CRE D SV D cloud watch thing Producer compat ibility platform s SO CKET à° ° Ġaccount ing ĠRE FER Ġcl us Ġmod name Ġdec imals 1111111111111111 111 ĠNO QA åº ľ Read y Ġworld mapc ı ÅŁ åį ³ export er Go al aff ine Ġ'{} / DIS K balance s ĠNe utron NotFound Exception lm nop tu lo 87300 94 Ġoc ticon 294 3 çİ ¯ Web Socket ali en Ġtermin ated WH M Conf lict Ġfe es ĠFil ename Could n Ġdiag ram Ġent rada 大 å°ı Ġfront end Ġbalance d ĠThere fore Ġca usal dj connectwise dhcp Snp Ġadv anced Basic Rule Distri buted Ġderiv atives Permission s aaaa aaaa Ġaltern ate ĠAut onomy ĠFin ally Ġshif ty bla h Pop ulation ĠAllow s ĠDete ct ×ķ× ª Ġsuc ceeded tro ops san itize Ġadapt ed Skip ped ç¼ © ç¼ ĸ Ġposs ibly ĠCOMM AND Ġnom bre æ£ Ģ ĠPhidget Support Defaults HelpFormatter speak ers æĵ įä½ľ ĠscaledValue Of ĠSu ite Ġxg boost olog ist Ġconvers ation Amazon Review Inher iting ĠMyCustom AmazonReview èī ² damp ing STAND ARD PERIM ENT LOADBALANC ING ) }\ / ) 4 91 5 10 5 28 5 89 6 50 7 66 7 46 8 27 A mb A orB B q B ET D ic E c G ases H n H int I gn J Y K NOWN L ESS M r M en M es N d N IC O ffer O EE P m P ay R H R ESS S J S chool T ier T rend X p Z O Z X c J e vidence g mm h ms j am k le m ne n as p ings r sp s xd s Request t win v nc } & à ĩ Ġ ()) Ġ 9999 ĠĠĠĠĠĠĠĠ ĊĠĠĠ re act re named Ġ= [] en coders Ġt range ar ant an ime Ġi ç ro gate ti de Ġc ubic Ġf ed he er he ast Ġa us Ġa db Ġs py Ġin complete Ġre fs Ġre veal sel y Ġo cs Ġd ynamics un zip Ġm iddleware ra z Ġe arth la mp co efficients Ġ1 64 Ġ1 86 Ġ1 91 11 55 um bs id f id r Ġ( {} urn als Ġ+ /- (' ( set tle ĠS parse ĠS UN ĠS olve ĠS hell ĠC l ig a Ġg ri Ġr te Ġr ms Ġr nd Ġl ane ĠA pr sp ans '] ]: ĠF O ĠF AIL Ġde creasing Ġde composition im ento ĠD rive Ġu z Re presents if name if th Ġv en Ġy data Ġx forms Ġstr ftime load mat ance led py lint art s ap an Ċĉ ĠĠĠĠĠĠĠ ĠB reak ĠB ody ĠB ecause ob ot model name ĠN ested ind u ĠR EL OR GAN ph rases ĠG amma ĠW rapper Ġen riched Ġk afka Ġpy qt lib c ST S ec Base max es dd d 22 15 ĠIn sert 27 34 by e ak ao Ġac cessed Ġcomp artment Ġnew Po no logy exp ired =[ ]) lat eral 23 01 AC CEPT Ġdis ambig En tities Co ol 38 95 Ġmin us Ac counts nn z gin ary }) \ 46 36 Ġdescri bes )] ), CON FIRM De mo о ÑģÑĤ 65 9 bot tleneck CL U Ġnet CDF Ġpoint ing EX TRA pass phrase content Transfer ĠAr m Ġimp roved Input Stream Ġab spath Ser vers Ġ16 9 pol ling ĠNo v Ġroot s ãĥ ¡ ia o pack s =_ (' ĊĠĠĠĠĠĠ ĊĠĠĠĠĠ ); ' оР¿ Ġmy py App ro ĠCh ain Ad ds Ad just Ñģ Ñı inst anti Ġcli que Check box oper and hand s Load s oo v ĠNot ationType ]], [[ Ġgr r PAR SER AV G à® Ł EE K ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ å° ij ros copic lev ance Ġlat tice bus car Sa fe Sum maries ov od Ġ'{} ') ĠCO M ]} ), flo od Ġdrop down ĠNe g Spe ech Ġroom s Ġ'< ( BE HAVIOR Ġpoly axon Document ation tel lo yy y LV ecBase COMM ENT 1234 56789 gri pper Ġsol ar ^{ ( Cap s åĪĨ ç±» ĠEd itor âķIJ âķĿ SAM L circle s ues sed ĠConv olution bridge s åij ½ life time ĠOne HotEncoder mal ware Long itude due ls Cent re ĠIM AGE calcul ation calcul ated åĿ Ģ ayes ian Ġscr atch Mapper Status CAN CEL Ġphot os ìĬ µ Arti fact æ¡ Ĩ æ£ Ĵ Capacity Gases ðŁı´ółģµółģ ³ółģ ĠCli Runner ç² ĴåŃIJ ĠBus iness Ġperf ect Ġbet as FIT NESS plex ity Ġdele tes PIX EL ĠATT RIBUT Ġgeop andas cPPPo ES Inheriting Object ĠnewPo em % ", ( $ ) [:- 5 13 5 06 5 36 6 92 6 09 6 28 7 25 7 22 7 34 7 67 7 48 8 24 B er B TS B ORDER C ert C ast G lobals H am I US I GH J wt L g O g Q W R b S x S mecti T ENSOR V ault [ [" ] +' b iz b anned c andle c fp e T e ight g pt j f j v j in j unit k W l cl n ical t OK v nd { }, Î ´ æ º Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠ Ġ ê°Ģ Ġ å°Ĩ ļ ĥ in ic in dividuals er un er oute re z se titem en rollment Ġt il Ġt pr ar man Ġ' ), ro d ro ster Ġc ite Ġc pc Ġc ategor Ġ" ; Ġin finite Ġre agent Ġre cipients Ġd v Ġd omin un expected Ġm ort Ġb q Ġb atched Ġb attery Ġ1 83 id ir Ġ( < di mage is numeric get Elements (' ; )) ], set env ĠT ER ĠT ransport str ar Ġ2 08 Ġ2 19 ĠC lasses Ġr si data center '] ") Ġcon vex ist ency Ġh xl ĠP ixel =' '' Ġde velop Ġ""" < Ġ3 115 ac q sh al key point Ġpar alle Ġx data Ġme chanism Ġpro jections ls q "] ]) ĠB ag Ġres olver In strument ĠR ou reate st 32 15 ĠG radient ĠW ire 25 00 25 24 jo ke 14 75 Ġresult ado :// % :// ' iti gnore LE M Type Id sub sample sk etch LL A Ġ` ~ Pro duction 96 00 Ġac quisition DE CL no op {} - 95 9 ################################ ############# Ġhas htag Ġne utral Ġmat riz Ġdis card Co verage Ġsp l Ġsp ent obj verts ĠUn comment CH ANG IL INE sche mes Ġcal lee assert Equals air s use ful ĠData Set fe a fe ssion fe asible ĠÐ Ł Max Scaler Ġexp onential ny m struct s 1011 10 Ġab stra fore ground и в ãĤ ³ 53 64 Man aged Int Type na poleon Ġtri angles Qu ad drop box ĠZ ip ĠZ ope ]+ )\ rank ings ĠCal ifornia velo cities Ġaccess ible ĠOr g TEST S dr one æĸ Ļ Ġ---------------------------------------------------------------- ----- Ele m Is Exist ("- ") á» ĭ Ph ot gh ijk ĠRE PORT ĠTrans formation bus y ĠLO CAL pick er Ġæ Ł¥ expression s With out READ Y Ġcalcul ates Ñĭ л Ġrank ed Ġpa ired COMP LETE }} } >, # SN R ital ic arp Inspect ĠAD DR mix er Ġturn s ('_ ', ĠMulti FieldPanel 人 åĥı appro val ametri c ен ие ceil ing Ġband width Cor pus pur pose Ġsym metry Fi xture sens itivity ĠSc enario è¾ ¹ prod utos VEN ICE AAAA AAAA ĠWork space Cred it Mac intosh LF N ĠGPU s Ġê ³ RAN K Notification Group éħ Ĵ uu ids Ġд лÑı Epoch s ĠPe ak ĠMac OS ĠInst ead čĊĠĠĠĠĠĠĠĠĠĠĠĠ čĊĠĠĠĠĠĠĠĠĠĠĠ Ġrout ines Pa inter persist ence Band width Some thing ĠìĿ ´ë BOT H chkpntTrap OID ĠCL ASS ĠLim it Bul let éĢļ è¿ĩ Ġsing ularity åķ Ĩ ĠNamed Tuple !!!!!!!! !!!!!!!! LABELS ENTRY Ġham ming ĠBC API ĠMET HO suggest ed ĠÑĩ иÑģ 12345678 12345678 ĠRect angle craw ler Micro soft Tor que IMP LIED Ġflood ing å±ħ æ°ij Ġuncer tainty ;: & ĠDEV ICE Ġgens im ĠPARAM ETERS Ġè¾ ĵ ĠLAB EL uder a getD ll 人åĥı éĿ¢ ' â ) ][ - ") 0 1111111111111111 4 98 5 0000 5 26 7 01 > % C X C ORS G al G AME I ll K VM L X L r N úmero P or R ights T f T rx U x U ART V T _ ") b mp c M c ubic e ur g age h od h ib h ale k ar k now k ws l arg l proj o S o q p waves s fx t ube w xyz w ildcard x form z f | '.' à ¸ Î º Î Ń Õ ¡ ç ¸ è « ì Ĥ¬ Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ اÙĦ or atory at ings re cipients Ġt ie Ġt utorial de part an to me theus Ġc row Ġc nx Ġc sl Ġc amel Ġp q Ġp eriodic Ġf obj it on Ġn i Ġn ump Ġin cid Ġre la Ġre ject Ġre views Ġre placing pe di un ter un register un subscribe Ġm arg Ġm ile fi b co efficient ri co Ġfor get Ġ- . ĠT IM us able Ġ2 16 (" =") [' -- et ry ĠS y ĠS CHE Ġg arbage Ġl ens data points ĠA ST ĠA LU am ut 99 1 par alle ĠF l od ge vi ations Ġh ints ** : all Keys ĠP ush =' >= 0000 110 ex if Ġ3 15 ĠD ag Re call Re ward if ft =" ` os aurus tra des ĠB as ĠE arth ĠN u ĠR A EN DS Con verts ĠU SB min ing min imal 18 75 Ġk s St and we apons Ġch k ax hline Ġal most ne igh ord an LE TT Ġtra verse 22 04 ĠRe po 19 86 19 76 Ġ` _ 84 9 24 12 Ġoutput File ĠCon dition CT YPE ull an Ġ8 6400 Ġtf x Ġper ceptual 28 12 Ġ(' + check ing check list Ġcopy ing Ar rays Ġim read PO LY ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠ Ġsize of du o Lo st nx os De mand sign ing Ġitem getter Ġarray T ãģ į Ġpri vileges Ġbreak s uni prot build Transaction OL UTION over nment queue s çļĦ æķ°æį® PL ACE pack aging Ġblock ing Ġexist ed Ġmask ing PRO GRAM na ire ĠjnxMbgSgw Gtp ĠSim Union sort ing rat o Ġsplit ting END ER gt k Function Descriptor Ġest a mk dtemp BO OT Mo tion this Component PAR ENT Char ge à° ² Ġcap it Ġcap ability ĠString Var vv v tech nique Down loading car ry Block Headers Ġæ Į ĠDis cord schedule d band s ĠMy Text inv ocations Dec lar FFFF FF Vis u lid ar ĠRead ing Ġfo oter wi fi deploy ed ĠEnd point Attribute Error BF UINT ĠMat plotlib Ġ"$ ( resid ent ĠNoti fy YY Y pipe s emb s ü n ä¸Ĭ ä¼ł Ġhyper parameter éģ İ Ġpk t Ġĉ Ġ Ġ------------------------------------------------ -------- #---------------------------------------------------------------- --------------- Ġescape d recipe s bro ken suc ceed 986 88 Ve locity repe ats METHO DS Lat itude Pop up PART ITION ãģĹ ãģŁ ĠSeq IO å¼Ģ å§ĭ åĵ ģ 10110011 0000011 Rt Stats thro ats WEIGHT S Ur ls Ġsnap ped ĠAC CEPT Mal formed Ġconsu med "` { Ġexclu ÃŃdo Ġestab lish tStop Refresh Ġhazard Body ð¥ ļĥ UNIC ODE 读 åıĸ ĠLaw rence ;, & TOPO LOGY ByTag Name MOZ ART getElements ByTagName ghijk lmnop " ------- # " . "), 4 30 5 05 7 30 7 45 7 47 B AN C INE C hem D uplicate E very E nsure F p G K G l J z J OR L m M id O t O u P ic P DB P adding R z S elf T al T ran V U V r X v Z b Z IP [ < ] ._ a K b tc c B g lo g ive g rand l vl n Q o la o file q bal s Out t S w atched y k à ĥ × ľ à ¦ è » ì ¹ ĉ Ċ Ġ ######## Ġ ancestor or um re scale re ceiv Ġt sv ar ator an et Ġi on ro bo ti x Ġc ra Ġp atience Ġf und lo st ge l ce t Ġin items Ġin vest Ġre lief Ġo doo Ġd ra pe ers ra io la v Ġb id Ġ1 84 Ġ1 48 Ġ1 78 Ġ# [ Ġw l Ġw rappers ul ators Ġfor ces ': [' ), ) ), \ Ġ+ "\ is i is im is her get ting get Future )) **( Ġto wards con tracts con centration Ġ2 52 ig i ") [" Ġl ut Ġl ats ĠA CT sp ore put s ic ious ĠF N ĠF R ĠF ollow od oc ĠP S tr ange Ġst ars pro filing form ers ĠD NS ĠM ul ĠM sg nt w if ace =" %( 02 00 Ġy Pos Ġme me pre train Ġbe ar ĠB all ĠE igen ĠE urope ob e AT HER ĠN othing ir ty Ġ4 000 92 1 ĠR PC 32 09 ĠG ot Ġco ins ity Error Ġhe misphere Ġan chore Ġen rollment 04 9 ass er Ġat tri Ġat trib vent s Ġra iden 22 06 ĠH uman input file Ġsh uff 88 0 output Dir 34 34 ĠIn v ĠIn ser 27 98 by ref ann y Pro pose em ies Ġcomp osed Ġcomp aring 55 0 87 65 ron tier 95 3 26 26 Par sing Ġ8 000 Res hape AC Y so ftplus 56 1 be heer Ġus u ]] ]) Ġpos ix ĠIN IT ĠIN SERT Config SgaclMapping ðŁı´ółģ ¦ółģ Ġquery ing Ġpri mes proto cols Max T Ġele vation Ġmake element Comp ound pr d Trans late Up dating SC R serv os åĪ łéĻ¤ Ġdocument ed Ġph enotype 1000 1111111111111111111 ĠCh uck sing ularity Sp ider ä» ½ DS A Ġpost ing GR AD LOG O NO K UP DAT light WifiBridge fin ance 0000000000000000 0 ĠFile System center ed Ġauthor ized åIJ Ħ Start ed rl lib ĠNot Implemented EXT ERN ĠDT OR ĠCom modity ĠCom bine ĠModel Checkpoint ĠEX T 9902 633 tool box ĠAt tr Ip Addr ĠAl ready )+ ". pid er zz z MENT ED Ġalign ments Over view ĠDis k CS RF PER IOD Ġadmin istr Ġinte gral 199 0 ĠReg ular As In As Out rr p inv ite tu f ĠMon itor ĠMulti Index åĨ į Ġsol ving TRAIN ING HW C iff ness ĠPermission Denied Lim its ĠSV G Ġzone Id Ali ve å· ® health check ĠSU CCESS ĠSc ra scra per manifest s spread sheet Flip Time Ġyy d regular ization ya hoo Ġaggreg ator GROUP S extractor s tun ing Ġali yun Su ffix urb an æĸ¹ å¼ı elf file Ġ192 0 Ġada fruit Ġregist rado Ġemp loyee Ġdocker file sho pping Ġck an calcul ator DICT ION Ġregard less Ġsens itivity åĿ Ĺ grids pec 9214 2537 èµ Ħ иÑĤ е ê³ ¼ Ġ################################################################ ################################################ Ġchrom osome Binding Term Binding GTerm ĠDAT ASET Ġforecast s DIST INCT GW P reach able through put Ġ[{} ] VOL UME Ġdeclar ation clouds dk Require ment (":") [ Predict ed declar ation Ġintr p Ġatualiz ado 太 åħ¬ cad ence forma ções uby te 缴 æİ¥ NacAppl Authentication 10111111111110011 0011110 convers ation IRON MENT Ġprac tice Ġè§ £ getFuture FlipTime # --- 5 32 5 30 7 18 7 29 8 10 ? : B k B ed B io B ASIC D ri E W E MP E OS E arth G J G p G uid H IC H DF I mplementation J ump L on L amp M UT M ale M ARY N umpy O m P ing R ates R ich S AL S now S izes T PU T ICK V W V z V ote V AE W iki W allet X H X f X u X GI Y ellow \ '\ a que a ec c W c ra c up c sc d C e ment e lasticsearch e limin f urnished f uzzy g lt h UK n dirs r ar r nd r angle s name s lab s ie w gs x array y M Ï Ĥ Ú ¯ á ı å £ è ² Ġ ][ Ġ áĥ Ġ ÙĦ Ġ об Ġt on al fa de que Ġi a Ġi py Ġi ps Ġc w Ġc ue Ġc aging Ġc aching Ġp waves it z 00 07 ce e Ġn cs Ġs x Ġre tention Ġd J Ġm dl Ġe u Ġ1 58 Ġ1 49 um or id p Ġ( ..., Ġw c Ġw ww ch ats def ense Ġ+ - is lower val ence (' $ ath on th ough Ġ2 44 Ġ2 35 Ġ2 73 as GRegs ĠS Y ĠS uch ĠS aving ab atic ĠC v ĠC FG Ġg n Ġg ds '] ][' '] }") Ġcon fidences ĠF W ĠF our ĠF TP qu il log istic Ġh al all ing ĠP ype ĠP UB ĠP ASS ĠP crit ub a pro fit out comes ĠD en =" ' Ġy a Ġy ields ĊĠ Ċ ĊĠ ĉĉ ĠO ur Ġ* . Ġse mantic Ġor den Ġpro fit label ing ĠB ob ĠB EGIN ĠE le ĠE OF ob el ob stacle user Name col lision read ings ĠG rad EN K EN ER ĠW R ĠV PN ). ', Ġen contra sa v Ġcol lector ag enda ec g ]. ") 88 1 19 12 ere um Pro te Ġsub scriber AM S 96 2 Ġcomp ound split ter node Name no ulli Data Generator ron ic =[ ( Ġuser id Ġz mq Ġne ither 90 92 und ance Co pper pop left ĠUn der Me mo uc er vis itor ud oku Ġim show fil m cent ric las se Ġser v ai a Ġq f Config s 29 87 Time Stamp âĢ ¦ Ġup dater ins ic EX IST Ġtemp er EL D debug ging post fix Ġ'/ '. Ġover flow Ġover ridden conf lict Key Constraint Com ments Ġuni verse ĠTest Client Ġ16 1 ĠDe mo Th en QU ANT URL CONF Ġsim s ################################################################ ################################ has attr =[' * äº Ľ æľ į fin ally Dis crete ĊĊĉĉ ĉĉĉ uri ed ('- ') ocab ulary prob es CI FAR Sim ulator Ġ") " Ġinclu ÃŃdo Pri or Box Points å® ĺ ठ¸ á» į LC G DX Y Service Client ĠPre cision ĠSh ared Ġannot ated pa id )+ ( ĠAd v car box Ġarch ivo Ġfp tr Ġæ Ń tw enty Ġmost ly gon al firm ware typ ename NOT ICE ffect s cn f Ġexpect ations decor ation Plot Scripts sess ments Ġsen ds break s Ġctsp Vlan 211 01 ĠAss ignment ĠForm atter ":[ [' Ġ{}) ". Ġfc st ĠDet ail Ġ~ / ĠToken Type COMM ANDS Ġenable s resid uals Post Processing DQ N ={} ) Ġhyper parameters SUB JECT MY SQL SEC URITY ç® ĩ Ġconstruct ed ĠJo urnal Modi fy Med ium æĶ ¯ Ġmar ble Ġindi co Ġparallel formers ham ming itect ures ('{} {}{}{}'. ĠVM ware ("_ ") Ġmonitor ing lem ma çĻ ½ Ġmix ins need s Ġmm cv ĠLink ed STATIC FILES ('" ') persist ent ĠRest ri voxel s ĠBuil der ĠUns upported ĠSa int Calcul ating Ġadapt ation ĠCons ists Bus iness ĠCir cle AGG REG Ġspread sheet thro at ĠMatch ing 线 ç¨ĭ Ġweak ref ASIC AP åıij éĢģ Ġamb ig ĠRa ioni EXEC UT Ġmind spore CATEG ORY ë³ ´ 011101001110100100 101110 ĠDif fer infe ction è·Ŀ 离 CONSUM ER qrst uv + ? 5 16 7 64 7 94 7 98 8 16 8 22 8 26 @ { A ssert A UG B UL B ands D z D id F MA G LE G auge H J H p L J L j M ont N atural P al Q X R k R otor S cores T iming W AN \ "" ^ - a Z a cted a ware b ell c ch c ers c ash d P g v g df h ir n R n se n ex n samples o axis o Prop t ns v out y G } ^ ± ółģ · ółĢ Î · Ø º â Ľ æ ¼ ç ¢ č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ ########## Ġ ÑĦ Ŀ ¼ ĠĠĠ ĊĠĠĠĠĠĠĠ or o or tions on o re ject st m en queue Ġt re Ġt ens de z Ġi am Ġ' ! Ġ' +' Ġf ds Ġf used Ġ" ? Ġ" ] it ors lo mb ge ometric ce ls ', )) Ġs ct Ġd up ct a ct u Ġm db ra dm Ġe f Ġ1 87 Ġ1 89 Ġ# -- ma cs "" : es ome is ine __ "] ĠT ak ĠT rust th rust Ġ2 03 op erate ĠS al ĠC ountry Ġg h Ġg er ĠA tt ic ago am d am ble Ġ: [] ĠF un Ġh g Ġh ypot Ġh aven ĠP ed ĠP ure =' { Ġst aff Ġ3 04 Ġ3 52 out let ĠD ot ĠM E ĠM Y Ġv it Ġy err Ġse d Ġme s ON S ĠB lob date d In ference In cident ĠG C ĠG auge AR ES ĠU pper ĠU su Ġro idb Ġal phab 93 75 ne o RE DIRECT ðŁ ¥ ĠH tml sub parser 88 77 19 87 output dir ID ER 27 86 inter act ann o clu st AS C 85 1 85 9 rid ing lat er 57 1 Ġtf p ware house mail s 28 164 38 13 38 37 pri l Ġmay a ict ures Ch n iter bi tag ging De partment sign atures Frame work 74 9 mem ristor String Var send ing ãĤ ° Man ip Of fice QU INT Sh adow RES H (* ) Ġmy db ################################################################ ######## Ġsu it tax onomy COL S æķ Ī ĠLo ads bit set Pre view af fi fin alize Ġcell ular Run s Mode s è¯ ¦ Ġcustom ization Ġvi ol Event Query cap ital æķ° ç»Ħ cla uses еР¶ short est Ġreport ing estim ated Min or ration al à® ¾ Ġpool ing ìĿ Į Search Results ĠPlot s Ġë ¶ Ġë ¹ Ġë į°ìĿ´íĦ° Ġgoogle cloudsdk Ġextract ing Update Particle sym metry percent ages mis p As sets charge s flo ps Ġpl ant Wh ich ĠBy te ĠGTP v Ġedit ing chart Data fri ction Val or COMM ON DT ranspose ĠMO DE accept ed accept able ĠPri mitive ste el ('.') [- Ġmid point Rot ate Sgt Mapping ĠMet rics Pair LocList ĠJo int ĠCHE CK æĭ ī ĠSign ature ðŁı´ółģ´ółģ ²ółĢ cart pole Ġdelay ed LIB RARY Cm Status Ġang ular Ġbenchmark s four cc Uns igned accum ulate markers ize åĿ IJ ############################################################ # Ġз а Ġopp onent ĠCOL OR ĠModi fy ĠPack et æ¸ ¬ ĠContract Function Ġcipher text SOL VER mob ilenet milli seconds POMERIUM SERVICE Boost ing ĠPhidget Exception 端 çİĭ Restri ct Ġtro op COUN TER Interpol ator ĠWeight ed æ¶ Ī ãģĭ ãĤī Ġ`{} ` ANCH OR COMPON ENT æ· »åĬł Orient ation reh ension pseud ogene nume l è¯Ĩ åĪ« 1666666666 67 AUTHENT ICATION Ġrast erio 0100010100011 01011 ĠStratis Cli 01111111111111111 111111 ĠhazardBody Phrase Ġ:[] ''' " ", # , ) ',' ) $', / ** 7 26 8 15 A toms B ag C lay C DATA C alo D aily E xc E CI F u F ar F lat G TP J h J q L N N b N CH O x P IC P red Q sfp R p S v S ym T b V an Y C Z j _ - ` .""" a H a J b kg b olds e O f W f one f names h aps h kl k pi k not m sc n C o ses o asis p atience s liding v ms w ich Å © Ġ ER Ġ è¿ĶåĽŀ in ject in ations re fix re login Ġ= \ al gebra me g Ġ' =' Ġc ars Ġp lug Ġf er Ġn orth Ġin ferred Ġo h Ġo mit Ġd h Ġd q un lock un less un stack Ġm ir Ġe min Ġe mission la ke () }, Ġb re 11 18 Ġ[ ...] __ [' get Text Ġto ur ĠT orch us a str ata (" --- (" ../../ Ġ{ ! ĠS ENSOR ĠC I ĠC la ht oken Ġg pus Ġg auss Ġg aps for bidden Ġr ss Ġr yu data source data Length sp acy sp lash sp onsor Ġcon crete ith ley ĠF eb ĠF AST om i om ics vi con Ġh mm ĠL and pt une ex changes ac ls ac ings Re lay Re ports ĠM or key space =" . Ġv sd Ġse per Ġma Utils '], \ pre ferences ap or ĠE p ĠE PS 92 17 ĠR us Ġun labeled OR IZ fo cal ĠG al IT UDE '), (' class if ST UD jo co Ġch an Ġpre sence ĠRe moves ml piot Ġdi vider 19 55 19 57 Ġsc orer Ġ` ' 34 56 27 27 Ġkey stone inter pret Ġsub command Ġac quire Ġcomp s Ġcomp osite Name List AL TH Data sets AS CII Ġla unched {} " Ġnumber Of run ch Ġz u 23 11 Ġte acher Ċĉĉĉ Ċ und red Ġdis co new lines 000 11111111 Ġsp onsor Ġsp inta 38 32 Po le be en Ġus ual Ar t sent inel cc l cc ion initi alization du ctor }) ') Ġar ange ĊĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ UL ATION ug a mt x ĠÐ ³ UM an Ġ'/ ') Ġcall data Ġele v --- + now led MIB Compliance Ġ... ], Com bo ush Button State Machine Ġ12 80 Ġsign er sw ig si qbal Ġlib t Ġav ail Th an Index er ĠSo ft :] ): BU IL binary Data åĪ ¤æĸŃ Ġtri ed Ġtri ggers Ġph ases mc mc Al bedo Ġsu a ĠCh unk é e Ġnon local Sub mit non linear Ġì § ('/ ')[ ĠMan age Te X Ġsci kit ĠComp are "} }, cost ing All Vars buffer Length Be a ठ¨ Ġcard inality LC S estim ates Address Length Ġ'{ % Ġround ing ĉĉĉĉ ĉ Ġcoun tries Over all ĠTrans fer л ÑĮ ĠSub scription Ġshort er super user tw ist SU PP available Items Ġfn match åĩ » Ġwin ning Ġcut ting IST ICS к аз OPT IM ĠObject DoesNotExist external ID sy ms Spe cial AF KA SimType Int Thread s AX IS tl b æŃ ¥ GD P ĠState ment Ġanaly tical ĠON LY Ġclip board Dig it Ġfl ame ĠPermission Error ен иÑı agin ated Ġв Ñĭ ол ÑĥÑĩ Ġaccording ly QP ushButton Ġâ Ī Head ing Param Registry CLIENT MESSAGE lig and 392 4 =", ") Ġhapp y Success ful Ø§Ø ¨ EPS ILON estimate Gas Ġflu entd oll ars mime type trust ed SIG TERM Press ure ĠFa ctory morph ology morph ologist irm ware Mis c Patient Num Generating Process bur g Ġsing ular SECON D нÑĭ Ñħ mess aging Ġdag ster à®ķ ள nom inal ĠZero DivisionError ĠWH ITE GENER ATED ðIJ ³ abbre v abbre viation Ġreceiv ing _* _ Comm unity Dispatch er âĢĶâĢĶâĢĶâĢĶ âĢĶâĢĶâĢĶâĢĶ ĠPL OT ĠCOR P Ġreact ant ĠStri ct Ġdiffic ulty WSMan DataType OPER ATOR 1228 17 diffic ulty Ġunic ast ogra fi VoiceIf Cfg indu stry Õ¡ Õ 92142537 28164 bolds ymbol ' ` ( ~ ( {} * ") . ")) 4 82 5 35 7 86 7 65 7 42 8 33 C losed D q D yn F MT H our H OT H At I U I ma K F L igate M irror N M P an P ix P IL P iggyback Q E R ock S phere V h V w V x V in X train ] ? ] }") ` " b se b ir b etter c Z e ce f M f S f pr f dr f ana f usc g ang g ps h in i ção j H k rb n B n M n ation p list p lat p bs s se s mi t doc t vm w ine w lt w ulff } ': £ ¼ Î ³ Ġ Ċĉĉĉĉĉĉ in fix in cluded on i at mo at least re co Ġt ur an alog Ġi state Ġi ÅŁ Ġ' ~ ti re Ġf whm Ġ" [" he mer Ġn th Ġs bol Ġin ches Ġre cover ing ress Ġo tp Ġd il Ġd na ct f un modified Ġm ine ra re ent ro Ġb son Ġ1 98 Ġ1 74 te c from hex is ot (' ) ". A UC B RE B Tag C Q C f C LOCK F ake G Q G SE H its H ierarchy I so L TE M iddle M AGIC M inecraft O mega P ED P lane Q l R h R and S ince S pring T rees U b V AC X x X test Y y Z y a ic b E c ant d ps d rain e quivalent f ur f av f avorite f uniVcl f amilies g cs h dl i contains j ug k el l just o ids p X q y s lip t utorial w file x ena | * } ;\ Ï ħ Ø ¦ à ¹ Ġ ĊĠĠĠĠĠĠĠĠĊĠĠĠĠĠĠĠ Ġ ç Ġ Ñį in iz in cident in dice or gs or row re ction re vert Ġt ds Ġt uf de crease le ader an imal me ld Ġ' ãĢģ ro b ti tan Ġc itation Ġc udnn Ġp value Ġp eri Ġp unctuation Ġf alcon Ġf abric Ġ" ]" Ġs box Ġre cursion Ġo up Ġd G li gate Ġm us Ġb ur te ardown from file Ġfor bidden get s get opt )) } ĠT Ac str path Ġ2 32 Ġ2 37 Ġ2 23 pp as ') " Ġis dir ĠS lack ĠC os ĠC ounty Ġg an Ġg cd Ġl mbda end ars data flow 01 011011 to y to urnament ĠF ort ĠF IR log info ĠP ad ĠP atch ĠP ull der e file list Ġth r =' - =' --') Ġde veloped out look ac ross sh ap sh arp time it oun g ĠO cc ds l Ċĉĉ Ċĉĉ Ġme ld tra cted ap pe Ġos id Ġj a AT I ĠN y ĠR m ĠR ack mo grafi Ġun iversal lic ing ĠG O ĠW idth tri ck mb lock Ġan on Ġen rich 18 00 Ġlist ening Ġk size Ġk appa Ġcol on Ġpre cedence ([ \ Type Checker Ġtra c Ġtra it 22 11 ĠH AP sub types eri ed lin ation ĠIn dividual 27 47 ann a 24 97 37 37 {} , [< UC g æł ¸ Spe cies lm db Ġretri evals align ments |' (' Multi Index ółĢ°ółĢ ³ółģ¿ Ġfreq s orph an Ġna ive arc cos BER T OEO Qsfp Ġpur chase Ġred undant rst p Cor r Ġlock ed ĠSpe ed Lin ks (""" \ Ġâ Ĭ xl arge pear son Li quid #---------------------------------------------------------------- ------------- Ġmultip lied Ġproto buf REF ER house hold Ġbi ases Ġн е Ġelect rum hdf s sat uration Ġsage maker MN OP ĠMeasure ments Cla im Ġflex ible utter ance Ġrl HistoryControl úmer os \\\\ \\\\ Ġalert s Forest Regressor instrument s Ġland scape ĠBig Integer Ġquick ly docsLoadBal ChgOver ż e íķĺ ëĬĶ Ġfact s Ġprun ing ĠCalcul ating Gaussian Blur iÉĻ w ĠLi vermore Combin ation Phone Number Beam Monitor ÌĨ ', ĠFUN CTIONS Dat um Ġmanip ulation Contin ue Nenhum a |') ' Fri end Termin al frequ entist èĬ Ĥ resample d vvvvvvvv vvvvvvvv esti val ĠOP EN owners hip xk cd ðŁı´ółģ¤ółģ º oint ment metron ome MOR PH AppAdv ToPeer dum mies Ġnucle oti ðŁı´ółģŃółģ« ółĢ å¼¹ ç° TIO CM aer on ĠGate way ĠALU s ĠCv Bridge 010001010001101011 0111111 TICData SelectorIfBit Ġ'ãĢģ ' IpTraffic Type å¼¹ç° § ) '] ) '. * [ 5 17 5 19 7 23 8 021 ; & = ') A IR B z C rypto D IC E j E uler F req F ORE G j G ender H X H old H MAC J M L k Q j Q p Q ot Q Size R SS W t Z z ] _ a A c itations d sp e P g tf g cd g uilds h rep i otype k ick k ern m L o dir o uti p lease r ance r ang r anger s is s ib s we w ing w info w andb y cb z es z eta Ð ļ æ Ł ì ¶ Ġ ################################################################################ Ġ ÑĢаРij £ in centi er ci re scaled se qu se ng st h Ġt info Ġt ilt de viation de velopers de bian de compress an at an th Ġi is me x Ġ' '] Ġc mt Ġc ev Ġp untos Ġp uzzle Ġf im Ġ" > Ġ" ..", Ġa ov 00 08 Ġs mb ss on Ġre mo Ġre cv Ġo gr li os pe ering un label Ġm obile Ġe ligible ri l Ġb en Ġb le Ġb il ed x ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ int ypes te ktronix di vider ma rend ], \ from isoformat es poem is na ĠT i ĠT ampa il inx us hes Ġ2 18 et un ĠS IM ĠS cal ĠS aref ĠS IZE ĠC ACHE ĠC ELL Ġdef ect Ġg uesses Ġr atios ĠA SN put ation Ġcon tacts ĠF ed ĠF atal sc v Ġh ou ĠI V ĠI ts ĠL INE Ġst orm est er Ġ""" . ex r fig ht Ġ3 07 ĠD b ac ct ac celer ĠM g add rs cess ing Ġbe hind 12 10 ĠN a ir rel len coded mo op ĠG re ĠG auss Ġco lo tri angles AR N ĠU rl Ġk de Ġk illed St ub St encil Ġpy type Ġset Name 05 1 03 65 rent al Ġpre set ou is AN A 22 13 22 65 Ġdi ameter ĠIn crement 27 02 27 39 own ed nd o Pro ps Pro filer 96 12 33 14 Ġuser ID 26 88 26 87 mon otonic Ġindex er create Grids CO S 66 2 ']) ] Id le ĠUn ix AB LES pri ors Ar m tim ers Ġerror Responder ĠY OLO Ġinter cept Ġtrans itions ]] > ' Ġback ends Ġover written ren ds ESC APE conv olve mer ica ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ roll up Ġfield names и ÑģÑĤ ãĤ ģ Ġ16 3 User Name åı į ĠRes ize radi ance SC EN Ġ"\ " cluster Name Ġmy Screener Qu it Sp atial gy pi side s side bar ML P Ġsql Content Check ed supp ress UB IC Ġmer ging til de æķ° åŃĹ Ġloop back ret ty ret weet Ġfinal Result Output data spect rograph Do D Case s SO AP Server Message aut oc à® ° hour ly elect rodes MIN OR pd p Ġtrace d New ton Control Config chine se Ġdownload ing fast er fun ds ĠTensor Board DU PL Ġcre ds Ġdesc r Ver tical Ver tices éĩ ĩ Ġinv ocation Ġ'{} _ Ġexc info WE EN Ġflow cell sy nthetic flatten ed Ġschedule d extract all Ġenter ing sol v Vis a ĠAD J Ġctsp If éĻ ³ ctsp Vlan ółĢ°ółĢ ´ółģ¿ ółĢ°ółĢ ²ółģ¿ ĠAnd roid Ġequ ipment orph ic Ġproxy client Ġadjust ment appro ved Ġknow ledge Ġcla mp SY N CAR D Cache d Uni prot Ġnone bot Ġpk l ĠPost gres ĠØ ¯ ॠĢ ĠStruct Field Ġ'$ ( nonzero y Ġtar ball Ġescape Squares ĠDocument ation Cm ts å¾Ĺ åĪ° ĠConnection Error Ġprote ct Ġsi ÄĻ ENTIAL S Ġsat uration dra matiq ĠMac ro accum ulator çŃ ¾ ĠFin ished Ġopp osite Ġhealth y Ġagree ment Ġsuc ceed Tick et ogene ous ĠEmbed ding tang ent Ġtor que posed ge ĠTrack er ĠSTART ED activ ations activ ated à°¿ à°Ĥ ðŁı´ółģ«ółģ ¥ Ġcsr f dN dzdmag recomm ender May a POMERIUM SESSION Ġspeak ers ĠWrit ten ĠBound ing Aggreg ate ĠTele gram Ġear lier DISABLE D ĠMIS SING ,? ,? plas mid ðŁı´ółģªółģ ° MEN U Ġintern ally gol ang Bron x ĠFIG URE 8730094 609308 Ġiç in ĠÑĩиÑģ л ĠALLOW ED # -------------------------------- ( .*? , :]) 5 23 5 46 6 30 7 43 8 13 B enchmark D EN D GRAM E v E urope E QUAL H op H AS H umidity I K L em O Q P andas P enn Q Y S il S am T axon V D V H W ay X k Y l \ ; ] ==" a Y b M c mb c runch d K d M g E j id j sp j unction k q l j m env n ib n atural p H p it p Desc p uls q emu v are v cp v fc x range z b } ): ° ¨ × ŀ æ ¥ é ½ Ġ ا Ġ ú ĠĠĠĠ ĊĊĠĠĠ in active in clusive er ed re current Ġ= ==== st y le id Ġi th Ġ' (' ro spy Ġc lu Ġc ros Ġc ities Ġp lat Ġf ns Ġf ram it é Ġn os Ġn gram Ġn dimage Ġn úmeros Ġs lm ur lencoded Ġin form Ġo o Ġd ip li r Ġe sc la do Ġ# " ed ited Ġ0 7 di visor di pole Ġfor ever ode tic get Value (' -------------------------------- )) ))) ĠT LS ĠT AX ĠT LV ĠT DXY Ġ2 99 Ġ2 88 Ġ2 48 (" => et Address ĠS ense ĠS now ĠS MS ab r ĠC i ĠC uda Ġ== > Ġg x Ġg allery Ġl ing end Time ĠA ES ĠA rc sp ikes '] ; '] [: to e to bs om bs ĠP df ĠP eriod ĠP Bind ĠP NG =' $ Ġde ath im ity Ġ3 01 ĠD ES Re comm Re presentation sh ire time course if n if def Ġv oting Ġnp r ĠO k Ġse at ĊĠĠĠĠĠ ĊĠĠĠ test er IN CLUDE Ġme tron Ġme eting ON ES ---------------- ---------- art in pre cip ĠB IP ĠB GR ob serve ly mp Ġres ampling ĠR ain ĠR DF ĠR SA ĠR ational Con d AR GE ĠU ID ). " Ġk means St rength Ġpy b ag it og en 05 18 dd f 64 5833333333 RE JECT Ġtra versal ĠH ub ĠRe ason eri alize ][ ::- Ġdi pole df g 19 32 19 82 19 65 ĠIn vent with Column ere quis 27 11 27 07 Ġle ader Ġle ague Ġconfig file Ġpo le Ġsub sets 94 0 AL IGN Ġopen api Ġid ent ĠK afka 26 57 26 75 Ġjson object create s List en CO DER md p api key 23 18 Ġte ktronix ps nr Ġdis ks Ġdis covered AP L Co ver 28 02 28 08 ther mal 56 77 cre st Ġdistri ct Ġtrans mission Ġreg enerated bg color 89 13 ĠSt ation Ġdire ctive root dir De g US SI cul ation ĠPro viding FF T ug ar ze bo ï¼ Ł (- ( conf s čĊčĊ čĊčĊč Ġmode m LI R stack ed Ġspecific ally Form ula over lapping pr p Ġ16 2 Ġbin aries ĠDe vices CA ST author ity ian a unit tests pu zzle Ġgl m ĠID XGI Ġmy list Qu ick Ġ[[ ] gest ure Ġmon key FO OT Pre set ]]) . Sub set æľ ± hex lify Check Box Port Status Ġ'% . ĠApp ro Ġsw ift .* , We ak Ġerr s multi class cla zz EXT ENSION nan o Oper and Oper ations GG T Ġ26 20 lang s á» ¥ á» ģ á» ĥ PAR SE gpu array à° ¸ fid ential termin als bb b Ġip address Cal c ĠError s Ġlat ency 1111111111111111 1111111 Ġplace holders PRE C ja co SU JI ó w ĠField Value ĠHTTP Server Ñı ем :" + %% " mes senger Ġpl ans sy mlink ĠPublic Key ółĢ± ółĢ°ółģ¿ Ġrep lication star ships dq m TS F Ġpol ling ĠMon th ĠMessage s Contain ers exe mpt Transaction Fee åıĸ å¾Ĺ Ġcla de ensemb ling Ġ================================================================= =========== Ġband s Ġsuffix es INST ST Ġsimp lified éĿ ŀ Ġball s quad ratic Hub Port dos age lig ated aggreg ator PW D ìĦ ¸ central Widget Ġtrigger ed Ġadv ance rack er 00000011 00000011 +'_ '+ ìŀ ħ ĠPe ople GP US ĠDep endencies èĢ ĥ Measure Node Ġfew er STREAM S hess ian Ġhy dro FRAME WORK CHANNEL S Wave Number Ġ################################################################ ################################ Ġneighbour s Ġvoxel s ìļ Ķ ĠcpwVc Perf MARK S éļ ı ĠSM TP Ġreplic a ĠNamed TemporaryFile Fetch er Ġconver ged Ġparagraph s Ġdeclar ative ìĹIJ ìĦľ Qual ity ĠAda pt ĠSTAT IC Tw itter rie ves Geo DataFrame isol ate cipher text åİĭ 缩 evalu ated Central WaveNumber discri minant ĠPa ul COMPON ENTS åĭ ķ ĠMeasureDuration Next Ġautog rad ĠSN MP ugging face å®Į æĪIJ ĠCUR RENT çīĪ æľ¬ é¦ ĸ éĵ¾ æİ¥ commut ator Estimated TransactionFee è®° å½ķ KAN SUJI Stateful Function 7483 647 Ġnump oints BlockHeaders WithChainLock æIJľ ç´¢ sali ency Cmts CmStatus " ``` " âŀĸâŀĸâŀĸâŀĸ ' & ) ''' , ", - ]) 4 89 7 92 8 17 8 28 B all B ill C rit D LOG F z G a G EM G PS G amut H ID I mpl J W J obs L ST M or M ult M IST P addle P kt R ig S keleton T t T LV W ake Y w Y PES [ / ] () a B a C a E a X a ções b L b colors c E d cc e R f get f red g M h space i Q j un m tick m ars n F n bins q we s j s nd t ck t utorials u data v D v ors v oucher w rist } ({ æ ħ ç ¿ é Ł³ č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ æķ°æį® Ġ ĉĉĉ in ux in clusion se cts de cess de em de mon le ague an ine Ġi ot Ġ' ))) ti an mp lot Ġp ct Ġp th Ġp format Ġp su ce le Ġn h Ġs ist Ġs sim ur g ss r Ġin a Ġre fit Ġm w Ġm gr Ġm ua Ġe k ad y co ind co hort Ġb er Ġb ay Ġ1 82 Ġ# @ rom acs di se ul ates ot p ': - ĊĊ ĊĊĠ __ (' __ ") get mtime set point set Enabled set Joint ĠT el Ġ2 0000 Ġ2 13 (" ! ') ][ as semble ve ct Ġ{ _ ĠS IGN ĠC ts ĠC AS ig an for ces Ġr na ĠA p '] [:, '] ]): ic lient to array path String ist io ĠF er ĠF loor od le Ġh du po ke ĠP hi ĠP addle Ġth ermal Ġde crypted 0000 0111 form set Ġu E key value =" [ Ġv v ĠO mega os itions Ġma kedirs Ġme ant pre sence Ġbe yond Ċĉ ĊĉĊ "] ]. ĠB oth ĠB roadcast 12 35 ĠE FF ĠE duc Ġj acobian """ \ ĠN C Ġ4 09 Ġget env ĠR AW Ġun ary OR ES ĠG IN ĠG tk Ġco arse url retrieve Con tig Con cepts bu fs ĠV CF ĠU DP Ġen codings min o line Edit Ġk ine 25 84 ST E ec s ip a Ġch kpntTrap ne uro enti d enti ment 22 05 22 64 22 35 ĠH i ĠH ands ĠRe quire Ġ{} .'. input Port df rame comp artment Ġ` % 27 14 ant age by pass bin omial ann ual 24 25 point cloud ache s Ġcomp as Ġcomp ose 55 00 33 06 ample s 87 9 (), ' AS Y 57 2 do xygen layer norm Ġlo ser 66 1 Ġli m Ġtext box 28 13 raw data Ġsp lice 38 18 AD J save z ĠX Y ĠEx iting Ġser vi UN ITE ĠIN TER ĠJ un ĠJ WT To Keys To Reference ost a not ation '][' @ Ġdb t CL IM 21 99 Ġ:: - context manager Ġqu oted iss uer âĸ Ħ Ġback off dic tive bar code uni verse Ġchar ges 54 1 next hop Form ID Ġiniti alizes åı Ī Int Opt ĠSo cial Ġmap a Ġgl ue (* , Tx link Ġmark up ĠTh us ee ded lr u }" ') Ġì ĥ Port Table UD P He ap END C '} ] Color Ramp Ġrest ored Ġweb page MC SCRIPT Ġmc IP Ġmc QCA Session Middleware POST GRES å¤ ´ å¤ ĩ Ġ[- ] modi fiers render ing Ġsm iles ĠLog Level term ux Norm alized `. '. Resource Id á» ı zy xelAclV SH OT Ġreport lab >< ![ ĠAl ert Ġperson al Ġfactor ies Ġ'{ :. Down loader Cal ibration Over lap Over ride Obj ective Ġdiff lib gal axies IF EST ç» Ń Ġside s ima ger å¾ Ģ Ġdesc ent simple filter ĠRequest Context room ID Register FileDescriptor ĠReg istration Ġimplement ing And Wait poly gons Ġms rest ółĢ± ółĢ±ółģ¿ Ġquanti zation Vis ibility IV RY Cmd Tx Cmd Rx Ġbook s ółĢ°ółĢ ¶ółģ¿ 01000000 01000000 Ġsn ippets PA IR Ġanaly se Ġgre mlin Ġdecor ators quot ed иР± ĠWeb Socket ĠBe gin Cap Lam Ġmid i SERV ICES Ġreason able âŀĸ \ benchmark s Ġв Ñģ Ġí Į Ġinvok er ĠLay ers å¸ « )))) /( Constant Option âĸĪâĸĪâĸĪâĸĪ âĸĪâĸĪâĸĪ æĭ ¿ è§ Ĩ Ġgu ard tracked Cells оÑĢ м åı¯ èĥ½ Ġrepro du Notif Tx Notif Rx Ġarc py Ġmx net Ġonto logy osa Outputdata SIGN ATURE Ġtrunc ation STRUCT URE west ern Ġcisco DiaBaseProt ĠåĪ Ľå»º ĠåĪ Ŀå§ĭåĮĸ tro op Calcul ator ĠSto kes Month ly Motor Control Ġpay in ĠCir cuit 604 166666666667 drug bank ĠOptim izer Combin ed ĠOct etString Stamp ed âŀĸâŀĸâŀĸâŀĸ âŀĸ\ lips is åĮħ åIJ« Primary KeyConstraint 677 9 Ter rain Ack Tx Ack Rx ++++++++++++++++ ++++++++++++++++ Prepare Node Ġsubstit utions ìĬ¤ íĬ¸ Ġrdf lib Ġcoeff s ···· ···· ĠConcat enate Ġinflu ence åħĥ ç´ł mW avelength ĠFo od ĠSTE P 8894 47 Mig ration ìĺ ¤ REQUIRE MENTS ĠIntegr ityError Ġheter ogeneity Ġbea utiful }`` `", íĸ ī ĠOw ner explor er ĠscaledValueOf CentralWaveNumber Ãĥ O Chn Pairs Combo Box ILAR ITY 645833333333 3335 æľ± æѦ "âŀĸâŀĸâŀĸâŀĸ âŀĸâŀĸâŀĸâŀĸâŀĸ\ setJoint MotorControl inputPort ByName # [ % ' ' ^\ ' ãĢģ ( ([ ) [::- + )', , ... . ( / $", : ")) = $ = (( > [\ C t C um C rv C LEAN D hcp D URATION D eriv E xact F H F irmware G t G z G EST H f J l J eff L arge O d O q P et P EN P DT Q D R ain R eroute S j S ink T om T ERS U w Z e a fs a je b T b V b are b br b ecause c K c U c ars c ategor c itation d ont d pa d uring d umb f N h E i id i row k B k max m iller n I n ail o tion p on p ile p unct q v r U r j s ds t Z v ag w space z j z hi } ={ à Ł Ä ° × © Ø ¶ Ù ¾ á ½ é ² ì ĽIJ Ġ ç Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ 计ç®Ĺ at mos re actions re construct st ill Ġt ight al phas Ġ' [' ti fs Ġc tr Ġc ubes Ġp aginate Ġf max Ġf sw he it Ġa IBi Ġa dicion lo u 00 94 ge mm Ġs dist Ġs hel Ġs ieve ur day Ġin de Ġre ver Ġo cr Ġd ynam Ġd rag Ġd raft Ġd anger li cts li gence () }") co a Ġb lo Ġb audrate ed its rom an te en di late ot ation ot to Ġfor k ol lo one of Ġto ml ĠT ax il ers th ings th readed con vex op ener ĠS lot ĠS calar Ġdef lection Ġg pcd Ġr mse Ġl ons ĠA void sp n '] ))) 01 03 Ġcon form Ġcon tribution am en sc m Ġh im ĠP D ĠP UT ĠL B ĠL if =' *', Ġde ve Ġde part Ġde livery Ġde aths ex ion ex cla im save im mutable Ġex clusive Ġex haust Ġ3 82 ĠD M ac ility Re ceive ĠM utable time d ew ard Ġy outube ĠO RI Ġ% } Ġ% }' Ġpro f Ġpro ble Ġpro mpts pre processed cess o ĠB enchmark ĠE q ĠE arly Ġj j ci ble ob i ans i user info bo ston Ġ4 11 Ġget ter In dicators ind a ind o ĠR ename ĠR obo per mutations ĠG est ĠG round ĠG ather Ġco vid Ġco alesce Ġout bound ĠV ision Ġan t min sn IT AL 18 99 Ġk mer Ġpy bullet http server jo y Ġop ener base path RE CORD 22 02 22 07 22 24 22 23 22 63 ĠH ouse ĠH osp image Canvas comp uting comp arisons 34 53 27 05 27 37 27 33 ĠThe ta 96 72 ĠCon version arn ed Ġno v Ġla mp ron ym 86 2 26 33 26 72 Ġdo fs rit ory 57 0 Ġper imeter Ġne mo ele ms "," + List Resource 23 52 ps ilon Ġ** { cor n mail box 28 14 RI P Ġpass wd Ġsp aghetti 38 35 Se quences ĠX test `` ). Ch i rt ol Num eric Ġdire c To x Config Option 29 16 29 06 Ġdoc x bot s :: : EX PL Ġany more place holders Ġ'. ': mt l pc ap Ġtyp ical tick ers fit ted Com bat cache s Ġuni q Class Name Input Transform Ġsupp osed ãĤ · change key Ġ200 3 ãĥ ¥ Up grade ĊĠĠ ĊĠĠĠ IP A ÑĢ Ñĭ Request ing Inter faces Ġsa fety Qu eries Ñģ п äº Ķ Ġloc us bit mask Pre tty DS M ++ + è¯ Ħ Ġfunc ion Ġloop ing Ġprogram me Ġ'_ ') single ton аР¶ pad x }' " Output Stream еР² SV G GL ES á» § short cut Ġpredict ing AV IS An imal mu R ĠBo ot Ip Sw Ip Hw Ġfun ção {\ " à° ¦ elect ric ĠString Field ÃŃ a Ġpop ular Msg Type VERS IONS Ġdepth s pytest mark ĠOpen CV Ġsepar ation ı z miss ive Ġestim ators Ġdesc endants gl canvas Open ed ółĢ° ółĢ±ółģ¿ WE ATHER Ġcommit s Ġcommit ment ah an ĠSE ARCH regex p submit ted unic ip Multi physics ĠRandom ized contin uum (', ', Ġtab u Ġpla ys Current ly 124 89193 ĠModule NotFoundError 146 12489193 Ġsur rounding ĠMin MaxScaler Exist ing ={} & Ġlinestyle s Ġba selines ĠBl ender dialog ue Ġden om sso a Common Middleware ili ar 008 14612489193 nor ms ĠBack ground âĸĪâĸĪâĸĪâĸĪ âĸĪ Ġк оÑĤоÑĢ Custom er DY NAM aggreg ation (': ')[ ĠMeasure d æĹ¥ å¿Ĺ Ġlearn ed Basic Auth stand alone kn ob Ġpod s SING LE Ġи з Ġlig ase Ġparticip ants PV T recover ies restri ct copi ed Ġtech nique Ġsho pping Ġ#---------------------------------------------------------------- ----------- cion es Ġsay ı Month s ç»ĵ æŀĦ smo ke ATTRIBUT ES Second FixedSurface Ġmime types DNA s ĠEqu ation datatype s Ġreplic as Ġrd kit ................ ................ 页 éĿ¢ nut nr Ġpesso as ĠComplex ity Ġorient ations Ġban ker ĠFUN CTION åıĺ éĩı ĠCred entials ĠJava Script æĪĸ èĢħ Ġisol ated UNI FORM è¶ ħ Docker file ĠRi ver Ġ`{} `.'. +-+- +-+- DRI VER åĽł 为 ë¶ Ħ Dog s elly fish ĠIgn ite Multip ly consu me DETAIL S |{} |{} rmar ry ĠKratos Multiphysics ĠRou ge >,# < pedi gree STRA INT GHIJKL MNOP BTag MIST ligate PostProcessing Ġcev ap DLOG P 00814612489193 6779 % ; * = 2 90 6 29 > - > : A spect B an B CM C d E k E gg E lapsed F ET G ri I v K w K AFKA L cl N k N or N ational O CI P w P UR P ref P inf Q Z Q MessageBox R ATION T RE U tf W Y W k W ashington W EEK Y x ^ {\ ` ). a P a S b A b X b ones c se c ust e A e C e F e H e vice g lass j og k raus l la m A m rstp n terms o ke p ink s Response s fr t mx u ar w et z ers z mq { ! } }" ¸ ë ¸ ółģ × ¤ × § Ú ¾ č č Ġ čĊĉĉ Ġ ĊĠĠĠĠĠĠ Ġ ZE Ġ ############ Ġ ancestors ĵ Ŀ ĠĠ č ĠĠ čĊĠĠĠĠĠĠĠ in ned in secure er ode at ur re cs ĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠ st ed st ars le ap an neal ti sh Ġc inder ge m ort ex Ġn w Ġn ll Ġn ÃŃvel Ġs par Ġs chools ur ator Ġin compatible Ġre ly Ġd av Ġd é un es un official Ġe id ion al ", ) Ġb read Ġb alancer Ġ# { 11 86 Ġw p ma sters ck g is hes (' {: (" ================ ĠS OL ĠS ESSION ab lock ĠC UI ig lm Ġg b Ġg df for me Ġl ha Ġl cd sp r '] ._ ic ence 99 0 sc a sc at Ġh uge Ġh ybrid ĠP RI ĠP ART ĠP eter ĠI C ĠL int ĠL ex ĠL ap ĠL ike Ġst y Ġst ones out path ĠD F Ġu handle ]) ], if old key stone =" ?", Ġv ul ĊĠ ĊĠ ĠO ld ds n art hek are house "] (" ĠE m ĠE asy Ġj t Ġj enkins ci as ob R wor m Ġ4 05 lu gg col name ĠR and ĠR EM ĠR Pi Ġun available Ġlog dir ph o ĠG PT ĠW ind ĠW idget ĠW iki ĠW ATCH ĠV GG Ġ5 50 mb ro ard en ard Table Ġk n 25 97 25 36 og g 06 14 Ġal ist ou sel gra vity RE TR ðŁ Ľ ĠH at sub class Ġ{} )) Ġ` . 34 47 pos als Ġwe eks 09 0 27 01 27 16 27 08 27 36 27 77 24 01 37 09 Pro cesses Pro vides Ġsub tree rep lies Ġnew lines Ġinput File Ġinput Image 55 1 33 65 AL TER exp onent exp iry CT R iv ity mi xture ron s =[ (' ĠK a 95 1 26 97 fa ir fa vicon Ġz f Ġz stack HE ALTH Ġ! / ... '. Ġ| _| IS PACE Ġne uro 23 07 Ġli ft 44 14 Ġdis connect 28 03 28 37 Ġpass phrase 38 24 pop t LO OD PO P PO LL ä¸ ļ Ġarg Dict Ġreg ressor wh it led ger du stry Log isticRegression Ġdescri ptive open ing ĠPy TypeChecker Ġseri alizable Time Ticks 48 02 fe arthek ãģ Ŀ copy tree Model Keys post process Get PriceReminder 76 2 Ġiter items TO M mer ger 54 32 const ellation enter prise fn a Ġdif fs Comp are PP ED job lib queue d Ġlib virt ĠGener ation qui libri Man ual Request Error Al location Ġ'' ') Ġentry point Ġsome one ĠMed al Ġclo uds FO O ĠDE C VER IFICATION Ġì ľ NE ED ha o factor ial áĥ £áĥ VAL ISPACE Ġcustom ize á vel ĠComp uter Sim ilarity Ġgen re Ġvector izer framework s Command Handler ĠLI ST SV M ठ¯ used BatchNorm á» ħ SH ADER Ġreport er TER MIN à® ® ìĿ ¼ Ġcap log ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġfactor ial GEN ESIS ev rmarry Ver bose 199 1 ĠReg ions ============ =") clip board ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġpl ural alan cers ĠNe ighbor Ġquanti les ############################################################################ # Unit Event mix up equ iv Random ForestClassifier delay ed Ġsq s Ġupper case yy yy analy ses cons istency ółĢ°ółĢ ·ółģ¿ WR AP RS Protocol ĠToken izer Constraints Intersection ĠMax Pooling ௠Ī Ġsy mlink Ġfe asible met as Ġbridge s Initi alizing nav rep hyper parameters pod s Ġocc ure FUN I rist ian д а Embed dings èĩ ³ ĠLay out å± ķ ç§ » ENV IRONMENT Ġbalance s Split ter Ġcloud watch ðŁı» âĢįâĻĢï¸ı ðŁı½ âĢįâĻĢï¸ı ðŁı¿ âĢįâĻĢï¸ı ðŁı¼ âĢįâĻĢï¸ı ðŁı¾ âĢįâĻĢï¸ı Empty String MIS C ĊĠĠĠĠĊĠĠĠĠ ĊĠĠĠĠĊĠĠĠĠ war der ĠStorage Functions Callback s Ġadv antages Ġattach ments circuit Components vile ged Ġevalu ating Ġaccum ulator CHAR ACT ĠMay be æı ı æľĢ å°ı čĊĉĉĉĉĉĉ ĉ qr code Ġfore ign Install er ĠMeta Data ãĤ¹ ãĥĪ ĠInte grate å®ŀ ä½ĵ ĠImp act Speci fication MARK ER Ġtrim med ĠNeed s Ġol dest DIST ANCE Hist ogram Ġcau ght Ġstandardi zed Ġslug ify ENC IES <<<< <<<< GENER AL SEG MENT ãĢĢãĢĢ ãĢĢãĢĢ xg boost Ġnecess arily Ġreceiv es âķļ âķIJâķĿ ĠArti st (',' )) Ġlh ablock DEPLOY OPTIONS Ġsatis fied Ġexceed s èĦ ļ ĠBL ACK ðŁı´ółģ¨ółģ µółģ Leg end ĠAlign ment substit utions HIST ORY 4546 368 Ġhay stack alta z ĠPolyaxon Client roper ly DOCUMENT ATION heapp ush Ġlogarith mic Letalis ce ĠCalibration Error Ġкол иÑĩеÑģÑĤв issub set ABCDEF GHIJKLMNOP =['* ']) BUL K abcdefghijklmnop qrstuvwxyz incenti ves FOOT ER UNITE VENT 889447 4546368 Ġlha code fearthek raken quilibri um " '{ / @ 4 326 5 29 5 31 6 20 7 19 9 000 < _| = (), > ) > '. > `. ? > B rightness C J C pp C od C ats C srf E nemy F ront G k G ar I PT I ATE J ust J UN K r L an M b P ie R aster R PAREN S X S HO S QU S LA T ar T el T xt U MP V Log W p W alk X ml Y p Y UV Z l Z u \ - _ ': a V a post b py b ates b ble b ssid c rl d str d ance g dp i U i pe i ri i vely j unk l ti n The n ie p mid p fx s rt s Resource u ci w get w ares x tick z g | ',' ¯ ¸ Æ ¡ Î ¸ Ð ŀ â Ŀ è į ì łģ Ċ ĊĠĠĠĠĠĠĠĠĠĠ re build ĊĠĠĠ ĊĠĠ al yst Ġ' }', ro ver Ġc ash Ġc lon Ġf q Ġf am Ġf arm Ġf ocal Ġf etched Ġ" ): Ġs ine Ġs nd Ġs now ss ian Ġin set Ġre ci Ġre write Ġo vers li sp li sm un able Ġm ad Ġm time Ġm iller ra pping Ġe ine Ġe ight Ġ( $ Ġ0 4 Ġw ird ot ors )) # Ġto wn ĠT AG ĠT Up th rows us hed con ts con tribution ers ic iz able iz za ve z Ġ{ ', ĠS am ĠS cope ĠS lice ĠC ut Ġg id Ġg amer Ġr python Ġl f ĠA str Ġcon tracts ĠF inds od a sc ans log Tag list ic ĠP seudo Ġas ynchronous ĠI mplement ĠL A res i res lice Ġth ro Ġth rown =' _ =' ../ Ġst im Ġ3 81 args pec out File Re ceiver Ġdata source ĠM D ĠM ol ĠM LP Ġv et IN CRE ance ll pre sen ang a Ġbe g Ġbe have 12 01 ĠE mp ĠE uler ob tain Ġ4 51 92 00 ĠR AD Ġun zip oc id ĠG MT tri ggers Ġout path bu oy ĠV ul ry o Ġ5 08 ard Entry Ġtime series cur ses Ġk shape 25 16 Ġset tle 04 99 ST AR Ġch apters dd b dd y dd ft ari um Ġpre cise Ġra ce gra v RE P 22 08 ĠH er ĠH umidity ĠRe call ĠRe ward ay lor ml m mat ria Ġdi ver Ġdi vergence db g ast ime 19 17 lin der Ġwe ird ĠIn fer ĠIn flux 27 32 27 96 27 26 27 74 inter pre inter rupt Pro cessed em d ĠCon ditional Ġnew ton [: ]) 33 99 no Letalisce ". / Ġopen v Ġdist ortion 86 0 86 9 mon d Ġ[' / reg ress CO ME md l =( ',', ps util IM READ Ġdis criminator AP PROX idx max ]: > .* A AC A lex B road C op C ategorical D ol D arwin G CM L ive L asso L PAREN M SC P ot Q h R u R fc R ULES R isk S ch S izer S trip T ho T REE U GH V en W J X N Y q Z N b undles c ny e N e ither f ld f inger f ederated g ff j ss k al k et k nowledge m box m jd n im n uc n PIm o DB p andoc p aginate r ds r arity s db t cl t IA u ations w ps x istent y in z lib } '][' ¼ '), Î ² å ĺ é Į ê ± Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ Ċĉĉĉĉĉ Ġ čĊĉĉĉ Ġ åľ¨ Ġ α Ħ ë in bound er mo at u re ds re moval re putation se at se is st ores st ories st iffness en roll de con an cia Ġ' |' ti k Ġp las Ġp unct Ġf pr 00 15 Ġn lu Ġs au Ġs sd Ġin active Ġe yes co es co tt co oldown Ġ1 81 Ġ( __ Ġ0 5 Ġw rt ch in di vergences is cal __ ()) __ "): get Time get pass ĠT V th y us m us ive import lib str tab con crete (" -------------------------------- op ti op rot ve o ve ction ĠS ide ĠS mooth ĠS VM ĠS ky ab ri ab stra ĠC apture ig bee Ġg love Ġl k ĠA lice ĠA UC ver ifier ke hl to logy ist or ĠF ranklin sc all sc iss vi mg all ure ĠP ACK ĠI PP res istance Ġth rows Ġde partment pro mpts pro cedures Ġex posed Ġ3 03 ow ski ĠD y ĠD ol ĠD arwin ac quisition Re ceipt ite xt ĠM ut ĠM EM ĠM SB key file lab or =" ../ Ġv oter ext remities Ġor m add option Ġel l tra pz ense es ĠB P ĠB LE ĠB alance ĠE v ĠE lastic ################ ###### lu ck ĠR IGHT Ġun sorted Ġun safe OR ED Ġtest only 32 93 32 46 ph iloc ĠG ri ĠG ene ĠG lobals Ġco uple Ġco ordinator ho tel ĠU sd Ġ5 40 ib ull Ġen h IT ED 18 17 18 55 18 95 18 76 cur y Ġcol l 25 32 Ġro b Ġro llo Ġset Up http d og Chain ip c Ġop ent valid ated lit s Ġat tn ok ernel error bar Ġrange Min Ġra re pi er 22 12 22 37 22 97 ust ic ĠRe ader ĠRe presents sub classes sub domain sub scriber eri ved mat gen Ġsh allow Ġdi vid 19 15 19 05 19 77 Ġ` [ 34 02 34 35 27 38 27 67 27 48 27 52 nd vi Ġle aving Ġpo isson yn opsis Ġac me ĠCon fidence ĠCon structor 94 1 33 57 RO S ()) ; row field 20 92 mi pt 95 0 Ġhelp ful IS ON Ġtf d Ġbo ards Ġper ceptron CO UR 66 0 66 20 75 1 idx min ef it 28 04 28 26 RI O so lete 38 34 pop s Buil ds bs z 77 0 PO L token ization token ized cc f ]] ]: face t ĠEx planation Ġgener ally Ġver nier du ck host config cp d Un defined To First ĠPy torch ĠPy Charm CON ST field set 29 05 Ġdoc utils MP I ĠPro perties ĠData Type link er Ġcount ed Ġfa de Ġele ms Ġiter ative MO UNT mem ories Comp utes ãĤ Ī seq eval ĠDe precationWarning pen e ĠRes ources sq s Def initions Ġ-------- ----- Ġfont weight *( ? Ġmy cursor fp n ':' + Group Id _{ :. cast er light ed ĠMan ifest ĠSO UND Function al diction aries è¯ ´ mm ing Ġparam iko ĠTime Ticks Ġsuccess or sched ulers ret ta nan max Ġdimension ality Mo ving Norm alizer Ġmulti cast GG G Ġaut oc zy me éĢ £ GN D Ġaverage s Over rides PRE TRAINED Ġdiff use ("" . Ġappro ved Ġ"{ :. ĠWh ile install ation NB PKG ([[ [ ov n Ġ'{} . OPT S ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠ ĠExt ended Ġexpression path cour age HTTP S LLLLLLLL LLLLL ĠText ure Exp onents åĢ Ļ answer ed bra ins program me Fixed LT ĠCor rect Ġnumer ator Ġfix es ðŁĩ ² wave form ółĢ°ółĢ ¸ółģ¿ Ġbr ute Ġ~ /. organ isation emp lo WH EN Ġanaly zed appro ve Ġclip ped Gen es Wrapper DF Ġrect angles trip les WIT CH WIT TER ĠSV D ki pping CY AN ĠØ ª ĠØ ¬ FUN CTIONS Ġâ ī Ġflo py ĠâĢ ĵ MI X webs ockets Ġlex icon ĠVer tical FOR CE ĠOver write ĠOper ator mf cc SCHE D [:,:, :, Ġbind ings Ġregist ro çķ Ļ Pod Resource IDX GIS Material Expression Mib Scalar ĠIM G accum ulation ĠApi Client communic ation čĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ čĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġinterest ing åħ³ éĶ® DEP END è¨ Ń Ġzy xelAclV AUTHOR IZED Ġflt Spec Ġcrypto graphy fort un Fra ction kingdom s Temporary Directory нÑĭ е Ġwb ia ĠContent Type ĠAnaly tical ãĤ¤ ãĥ« Ġalter ed yolo v METR IC Ġìŀ Ī Ġmanip ulate MISS IONS EXAMPLE xxxxxx Wrap ped Ġæī §è¡Į jack ing ĠTRAIN ING ĠSC RIPT Ġvl rep ĠSpect rum convolution al xxxxxx EXAMPLExxxxxx Seg ments è© ¦ loid y ForeignKey Constraint Rpc Error ĠInline KeyboardButton Ġá rea Ġì¶ Ķ fram erate Ġreconstruct ed ãģķ ãĤĮ sst ables ĠAbs olute Ġdise ase ãĥķãĤ ¡ Ġinterpre ted 00000000000000000000 010 ĠполÑĮзоваÑĤел Ñı Ġrent al Ġise qual CRED ENTIALS Ign oring ìĬµ ëĭĪëĭ¤ ä¸Ĭä¼ł çļĦ openv switch USSI AN ĠEduc ation ĠZE Logger astime zone tIA EA kehl chen ĠIPP ROTO " ** ) @ , ] - {}'. . ]* / "): 5 47 5 00000 6 98 6 379 B ri B link B AND B asis D avid E arly F rag G ap G pCronDump H ours I AS J D L d M x M argin O VS S OR S ib S LE S dk T ro T ax T AL T UN T IES V CV W a W ar X j b aby b ckg c upy d port e E e er f E f us g Q g row h ad h rs m ux m osaic n K n j o li p ter p ids p unch p ypeit q k s bin s old t N t end u F x Length y j à ¦ æ ¹ æ ¾ è Į é İ ë ª ë IJĺ č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ čĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ ~~~~~~~~~~~~~~~~ Ġ ä¸ĭ Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ķ ë in lines in gest in sensitive or che at l re ar re train re connect Ġt ap Ġt ill Ġt cod ar ma al ph de sk an h an ford Ġi dir Ġc ate Ġc sc Ġc ow Ġc ust Ġc andle Ġc ó Ġp atients Ġf light Ġf ancy Ġ" "] Ġ" +" he ld he misphere Ġa ea ge odetic ce mber Ġs lower Ġs queeze Ġs pherical ur ance ur ahan Ġre cs Ġd W li l li quid Ġm int Ġm ars Ġe in () == Ġb right Ġb kg Ġb ird Ġ1 999 ed ger Ġw space Ġw fr di abetes es se __ '): get output (' ! ĠT weet il ds th rottle Ġ2 26 Ġ2 54 [' < op tes ve mber ĠS el ĠS ys ĠC AP ĠC ached up time up loader Ġg lo Ġg loss Ġr bf Ġl d ĠA sk sp a ult aneous ver bs to dict 99 37 Ġ: ) ĠF ran ĠF req qu ist log var Ġh max Ġh ull ĠP ulumi ĠP retty ĠL ot ĠL YS =' --', Ġst retch Ġ3 75 Ġ3 39 ĠD an ĠD ialog Ġu d Ġv D IN ATION .. ') ---------------- -- Ġfile type Ġfile dialog 07 55 ĠB inder 12 06 ĠE s Ġ< { size of ĠN A Ġres ol In active ĠR L ĠR ing mo ke mo jo Ġun necessary read I Ġtest er Ġlog uru ĠG REEN ĠG erman EN O tri angular ĠU C Ġ5 55 ib ase che ss che bi 18 34 25 64 13 37 05 88 Ġ/ >< Ġat ri Ġat tempting Ġra ck Ġra dar 22 16 22 84 22 87 ĠH W ĠH SV ĠRe view ay er Ġsh ield Ġdi visible work place 19 02 19 85 34 2214 27 84 Ġkey code 37 96 ak o state ful rep lication ĠCon firm Ġ} \ ĊĠĠĠĠ ĊĊ Ġno ob exp lainer 97 97 lat tice stra pping 26 73 Ġmax imal mon ition Ġdate string Ġz er rit z number ing Ġbo dies 23 05 ps ql ps wd Ġdis cover Ġtext o OT H auth s 28 06 28 96 so li Ġsp end 38 11 38 16 38 04 38 15 my py be zier be yond ĠQ Label Ġmo vies AD R ',' - 45 85 fil tr ich io Ġrandom ize cc w 47 44 ĠEx ercise Test Suite Ġser á Ġevent ually host ing Ġcommand line ĠJ upyter Ġcal vin Ġread only To File 29 02 29 15 not a graph ene Table Request cu its )/ (( ca ke Ġ'/ ': 81 92 39 55 Ġsum marize Message Middleware Ġass umptions mer chant Ġobj ec vector ized Object Identity Bo ot Le ast Ġiniti alizing fore ign Ġbin ning CA DE View Middleware IND ER ãĥ Ĩ Ġstd scr At tempting ĠUser Profile ATE GY opt Error Image Message Image PatientNum Ġwas n ÑĢ ан ĠPath s Def SgtPolicy Ġ". ". Ġgl fw Not Sup CK ER Ġmy file Ġmy dict Tx Power Rx Power ĠMed ical hed ral ':' @ pg m Ġloc ator Ġref ine Ġrand range Auth ors ICs New gb f ]+ = Port folio cip ant åħ ¸ oper ons ĠCal c áĥ ł Ġsw itched ĠComp osite Ġpe ers ĠRun ner ĠTime Series Ġstream lit Mo vie auto escape Ġrecord ings Norm als Oper SgaclMapping respon ding Ġprefix ed Cur WorkMode mut ually ĠPlot ting Module Identity pd k ÃŃ n Ġë ª¨ zz a zz anine force d menu item ({' _ stock idx Ġcons ult Msg Tx desc endant ĠSub set Dire ctive Ġbit coind ĠTensor flow åį ĸ relation ships FLO WS çĶ¨ äºİ flo ors HOST NAME ĠObject Identity ################################################ ## Ġfetch ing Ġtool tip sol vers Ġcould n ond on Ġterm color ĠPO INTER Link ed ĠAD MIN Ġorigin ally BACK UP Exec utable ĠIs Authenticated person s amb ridge Pl ant æİ § Loop Detected ĠPrint s SY MB ĠSimple Namespace ĠPri ority BY TES workflow s Translation External Ġband it qs fp sto od adv antages Ġshare y pic ious ĠSc ene Ġmultip lication ĠAb ort 142 90 ÙĪ ر AU DIO Ġelect rodes Release Type è§ Ĵ ĠPort folio Qos Queue è¯ģ 人åĥıéĿ¢ Imp act Imp uter ółĢ±ółĢ ´ółģ¿ stand ing ĠdocsLoadBal Grp å¦Ĥ ä½ķ çķ ¥ Notification Type Adam Optimizer Ġsens itive Deploy ment Inf ected Ġta xa Ġquad ratic rw Motor Ġprun ed åºı åĪĹ bounding Rect Ġgdal test Ġqual quer Revision s CHO OL Elect ric ĠEqu ipment Yes No ĠNv API ın da Ġfac ility PUBL ISH æīĭ æĮģ ĠFeed Version prom otes xxxxxxxx xxxxxxxx ĠSpark Session Ġimprove ment Tmp Reg Ġ214 7483647 客 æĪ· èĪ ĩ NotSupp Tx NotSupp Rx Ġdri vers ĠscaledValue OfFirstFixedSurface èĤ ¡ ĠIT EM âĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢ âĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢ SUR F LEAR NING MONGO DB âĸĪâĸĪâķĶ âķIJâķIJ mib s ĠTW ENT POD RESOURCE VIR T lun gs VBox Layout Ġimb alance #- *- ingu ish TensorflowModel Performance ĠWebs ite IEIn cor èı ¯ ĠREFER ENCES ĠZip File Elem wise 详 æĥħ fusc ate ĠOh io ĠâĬ Ĺ Lem matizer ĠPaddle Paddle Contig ID excla mation apost rophe æĬ¤ çħ§ ICsNew PT TranslationExternal Suggestions " ({ " `. # -- # "+ ( ...) ) $ + (\ - $ B en B ID B attle C z D GET E mb E VER F IND F lex H j H ORIZ K ING K inesis L v L ex N OR N LP P c P value P AS P ivot Q M R aise S low S tem S ESS S inh V J V Z V v W ed W ell W ould X Frame Y D Y k Y OUR \ "] _ ), a I b F b ake b cm b ubble c N c V c ue c fn d lib d psf e B e W g test g arbage h lines i B i E j ud k ia l q l arch m ro m obj m hd n A n spath o ber p ch p am p omdog p anda q F q o q sub r B r Y r ps s ift s Req t ornado t ddft u D u N u Z u art v uint w ake x on x pr x ia y w z arr Ð ĺ á µ â ± æ Ĥ é ¾ ï ½ č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ ï¼Į Ġ **************************************************************** Ġ âĸĪâĸĪâķij ĠĠ ĊĊĠĠĠ ĠĠĠ Ċ in box in dependent er p re ceptor re serves en y en emies Ġt ells Ġt ao de velop an de Ġi file me v Ġ' "+ ti co ti ary Ġc wt Ġp rm Ġp agination Ġp snr Ġ" ;\ he avy Ġa wk lo h 00 12 00 92 00 62 ut ors Ġre covered Ġre bate pe l pe z un labeled Ġm dp ra ke Ġe fs Ġb at Ġb link Ġb colors id ian Ġ( (), Ġ0 11 Ġw avg Ġimport er ol ation Ġ+ + is alpha name Auth get LocalizedString set path ĠT ran xt ype con c con no Ġ2 28 Ġ2 45 pp r ĠS I ĠS ig ĠS AT ĠS ho ĠS AL ĠS kipping ab d ĠC G ĠC SA ĠC MD Ġg db Ġg uessed Ġr mtree ĠA nt sp ent ĠF C om inal ta o ĠP WM ĠL exer est ado im ent im balance Ġex planation Ġ3 74 10 37 ĠD r ĠD ESCRIPTION ĠD hcp Ġu art ]) ( Re corder ĠM AN ĠM ix ĠM ATCH if rame Ġv n Ġv t Ġv nc 02 32 Ġy ap Ġy Sorted test file Ġor ange add Link Ġel v '], ' Ġpro viders ĠB AR ĠB ill ĠB ank ĠB rowser ir an num b user data ĠR ts ĠR adi ep c 32 54 format ting EN VAR ĠW i ĠW IDTH Con fidence Con nections print f Ġ5 02 ib li Ġk ullan 25 02 25 18 St udy 13 96 15 53 100 2 max imize ass ertion 03 12 cs d Ġop ens ĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠ Ġal ta Ġal ice Ġal gor Ġal titude Ġal bedo 93 66 Ġpre dicates '' '. Ġra m :// {}: 22 36 22 47 ĠH H ĠH ot ml flow 19 07 19 16 19 06 19 47 (( ? 34 77 Ġ[" -- ann ote 24 15 37 16 Ġcomp ri 33 96 no x fic a exp lode AS M ". ') mi um net cap Ġid le 26 85 26 95 26 76 26 68 57 07 57 46 Ġ8 192 do fs man ufacturer api list 23 34 23 86 und ers Ġdis counts En hance 28 18 28 16 tem ber 56 0 38 29 be come AB BI File Dialog AD A ',' '). Ġad ditive table Name `` .* Ġ, ' command desc ĠEx pl las hes pert urb find ers find Contours cy ber Set Background ĠJ aco ĠJ apanese cp g cp m CON V 29 13 29 84 29 55 43 64 Ġ100 1 а Ñĩ а еÑĤ ãģ Ľ ])) ), ('-- - expr s Ġexp iry Ġexp loit Get optError Ġwrit able xy text 39 05 Ġover riding uni q build ers Ġed ited she l cmd line Ġtop Most Ġwhen ever ĠCo in Object Type Comp at Comp uter ãĤ ¢ pol arity pen as pen up pen ded Ġlib pysal Ġextra cts ãĥ Ĺ late au DB C BU Y ASE TS Ġsim ilarities Ġsa f year ly ĠImage DataGenerator ĠTh ree ĠTh reshold For All For bidden hash lib é ri sm allest Ġpi per help s ves sel ä» ħ ++ ) google ads dm g Ġcli pping non free ('/ '): fin Dummy Ġsplit ted Dis connect Token Type Ġjo ins Ġign oring Ġpick ed rot ations Ġinstall er ĠLe af Ġweb server Ġrepresent ations mk time ĠPo isson Ġtrack Tag click house prop het è¿ ij DEFAULT S Tag ger short name FORM ANCE Ġow ned aut omatic ĠAl ways Ġdat aloaders Ġcir cum exc itation Ġround Int +\ .\ car lo car rier OB S Doc s ******************************** ******** Ġarch ives ĠTrans ition Control List Ġæ ł Ġrel path Ġappro val ó rios Open GL assign ee kit ti Ġ"{} ", к Ñĥ Register ed Ġimplement ations ĠST D DA Q NOT IFICATION Ġcar acter Ġvol up Network Id ah l Ġidenti fies Ġidenti fying >" + LD AP 215 8 Ġcombin ing att endance pm f writ ers Parse Error scape s |' =' 211 4 bad ge Iter ations Ġderi ve Fixed Len в ед 216 7 eth ereum æŃ ¢ æŃ Į ĠMon te ctsp If amb ient Tri angle Named TemporaryFile pet scii Real nameAuth ĠPh oto Ġmag netic Dep endency dog s Ġdeal ing åİ Ĩ SY NC met ros Ġshift Marker Uni mplemented ĠNetwork Id Mask ed chan ic comb os expect ation Dete ct Rest art Cor rect ðŁı´ółģŃółģ ´ółĢ Meta Data Wor ks 307 2 every thing ç§ Ĵ REF RESH Write Line Ġretry ing ĠCH AR Ġboot camp boost s Qos If ółĢ±ółĢ ³ółģ¿ stand ardi Ø§Ø ¯ Ø§Ø ³ Ġang r ĠUnivers al tor que Exit Code plain er Ġд ÑĢÑĥ Ġevalu ations ĠIM URegisters è re čĊĠĠĠĠĠĠĠĠĠĠĠĠ čĊĠĠĠĠĠĠĠ Ġplan es Ġrout ers 312 22 CHAR S ĠBig Query ÑĢаР¼ Mis match eder ation Ġfriend ly ĠSpeci fic éĩį æĸ° Fun cs ĠDocker file ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ Ġhum mingbot Ġlife time contra il REGI STER ĠNv Method ĠRot ation Ġà Ģ cao conno Ġheart beat shif ted TRAN SL Ġlm ks ssss ssss Ġmedi um 项 缮 evalu ations ĠProgress Bar Act ual éķ¿ 度 ĠRad io ëĵ ¤ Ġoccup ied FU ZZ Ġprox ies Ġcomput ations TAB LES Individual RealnameAuth rollo ut quas ar ENUM ERATION Trust Sec è°ĥ çĶ¨ STO CK Ut ter è£ ħ ĠLookup Error Ġach ieve Ġretrie ving 8600 3388 Ġmention ed Ġads k Ġconcaten ated rabbit mq Los ses è« ĭ Ġgds factory Csrf ViewMiddleware VEHIC LE 342214 86003388 IndividualRealnameAuth sReq ' (\ ( ... ( \\ . ": 2 102 3 011 5 48 5 42 7 89 9 154 : * > """ B ay B idirectional C NOT D ry D ial D raft E lastic F em F mt F lour H ull H IDDEN K v K ine L n N pu O tp P ump P AG P ause Q x R ABBIT S ay S mooth S lave T u T v U z X e Z p ] <= _ {} b ab b ac b ill b isect b uried c Q d ss d Loss e J e vm f K f stab g name g loss g itignore h V h ap h len h ierarchical i M i Z i ver i que i col i ded i fications i SEG j M k ip l sp m other n uage p ine p att r tr r peaks s me t Requesting w en w ild y ang z gal | [ } }\ È Ļ Ð ¢ ë ¬¸ č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ čĊčĊĠĠĠ Ġ ĊĠĠ Ġ æĺ¯ Ġ ر Ġ åĴĮ in load re lat Ġ= ======= st k st un Ġt end Ġt pl Ġt fidf ar on an atom ro f Ġc ub Ġc aused Ġp ypeit Ġf min Ġf orth Ġf iring Ġ" ! Ġ" ~ Ġ" .") it Ãł Ġa wa lo uvain Ġn id Ġn ul Ġs ms ur andom li days ct c ct g un ions Ġm é Ġe at Ġe speci Ġe missions co mplement co upling ri stop Ġb rown Ġb pf Ġb undles Ġ# . ed ucation int el Ġ( ~ Ġ[ . ma cos from keys ol n ': " ), " is am get App Ġto ward ĠT ex il ons th ink Ġ2 66 op ath op ml ve g ĠS ol ĠS EM ĠS olver ĠC lock ĠC ASE ĠC Python Ġg ps ĠA mp sp os ult ra ver e 01 05 Ġcon test Ġcon ans am o to on ĠF ULL ĠF rozen ĠF ruit Ġh ab ĠĠĠĠĠ ĊĠĠĠĠĠĠĠ all er ĠP at ĠP EP ĠI G ĠL ONG Ġth umb Ġde tach form al Ġnot a Ġex ceeded Ġex posure Ġex emplo ĠD S ĠD eriv Re co Ġv r Ġv ision Ġnp u ĠO range Ġpar s Ġme lt py py pre co ls f Ċĉ Ġ ĠB r ĠB on ĠB RO ĠB AD ĠB LOOD ys mt ĠE st text Align ĠN F ĠN IC ################ ########### OR G lic ated 32 87 32 73 Ġco erce ĠV O ĠV IE Ġ5 87 Ġhe uristic Ġan o IT IZE 18 12 sa urus Ġk om 25 25 Ġpy pi ag s 04 00 og r lib curl 06 92 SE PARATOR ST ICK 03 11 we ka ne ver 22 25 22 09 22 27 22 95 ĠH y Ġ{} % Ġdi abetes 19 11 19 64 19 88 start time 27 97 27 43 27 42 Ġle ap Ġle ia ann ounce 37 34 aliz ar 55 076 DE G Data Object Ġla p Ġopen moc Ġuser data run Params run nable cri mes 26 66 26 89 26 39 Ġmax Value 57 08 "," -- try ing current frame 23 99 23 58 AC ING Ġte ar 44 67 cor al Co sh 28 11 28 25 56 78 Ġpass words 38 17 38 26 LO OP of ing pri mes 30 93 ))) * ĠSe g the ano Ġtrans mit Ġcode stream replace ments random ize UN AUTHORIZED iter dir 46 09 ĠJ ames open filename open cl Ob servation 29 64 21 93 search sorted vo ids cu sed down s down loader strip ped sv Filter EX CLU ãģ ł Ġfull path mt bx Ġexp lainer Add resses Ġsave path ren cies ik u Ġdim m String List stack s first ScreenText Ġiniti ate Ġiniti ally Ġbuild ers gr at Ġbot s system d sw da style sheet ĠRes olution Trans actions Index es PL TE inser ted Ġchange log Ġchange Degree Ġtmp T Ġgraph ics EM D PRO GRESS tom ine QL abel Ġsome where ĠCh arge Ad aptive ven io äº § win reg Ġpi er _{ : drop ped Ġge ology Ġthan ks Dis card nb r Tensor Holder ME I åħ ± åħ ĭ Ġjo ke oper ating ĠRel ates sd l .* \ Ġvi v Line Qubit Ġmer chant "} } Ġsingle ton nan min ĠEX AMPLES click jacking Ġthem selves (** { gh z bn f Button Text aut htoken Ġast ro hist orical Ġacc idents ĠOb servation ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠ ä¸Ģ 次 control led ĠPlot SnapList Ġindic ated Ġip db Ġflag ged car bon ******************************** **************** Ġmultiple s Ġsec fs ("" ), ĠQu aternion ĠNO DE Ġinser ts mar izer IF IC Ġstats models pare to ĠTH EN speci fication 199 2 199 3 aff ected ĠText IO Exp onential JSON DecodeError åĢ ¤ Parameter Set TOKEN S ĠSp atial Ġctsp IpSgt CIS ION under line ĠCor pus lis ions 216 2 ĠGe orge centi ve Ġprivate Key ółĢ°ółĢ ¹ółģ¿ zon a Ġes col (', ')] uck y PA WN Attr Data udi fy Ġtab la mq p Sec AuditLog tot als Ġless on 6666 66 Ab ort çī Į 984 1948 ен ÑĤ ĠBe am SERV O ĠNorm alized Ġ({ :. Ġ---------------- -------- ĠMark er Ġfbx Mesh å± ŀ åij ĺ Member Id regular izers å°ı 人 Pack ed Mac Address Ġgu ide ĠCar lo Sm art zM z RT V fire fox ĠпÑĢ о emo j Ġmi light egg BoxPoints Ġpod man Pub Key Inte gr Ġalt Camp iam at rn as Ġpersist ence 409 4 Raw DescriptionHelpFormatter ĠApply IndividualRealnameAuthsReq ___ / ĠCount Vectorizer arth ur Ġflatten ed ĠMongo DB Ġpanel s AFT ER Align ed bet as jk stra jet brains å®ŀ çİ° LANGU AGES CONTAINER MESSAGE Second ary OPTION AL bur st electron s åķ ı Ġconver ge æ¯ı 个 Cancel led declar ative urs day integr ations 太 å°ī Django Templates ĠCred ential ]+)/ $', Persist ent HIGH EST infra structure Rad io RAT IO èĬ ± Gre y KT BW discri minator Public Key IDXGI Output Ġconsu me à±ģ ', reci procal ç´¢ å¼ķ bayes ian Ħì ¸µ enci as wal ks Ġutiliz ar ĠComm unic aca demic ĠStat istics čĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊ čĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊ Ġhd rs Ġguarante ed hpnicf dot ëł ¥ stac les Ġsoc at #~#~ #~#~ COORD IN unte er ĠGpCronDump TestCase SPECI FIED ëĤ ĺ opro j ĠTun nel áli do Ġsvn test intern als Ġwer den IMPLE MENTED é¢Ħ æµĭ ĠSnap List ibi lities POMERIUMSERVICE ACCOUNT ĠFAST A ĠTfidf Vectorizer Unresolved References éĢŁ 度 Ġpyle ecan Disco Mode 0365 31222 ĠCuda TensorHolder PREC ATED ãĥķãĤ¡ ãĤ¤ãĥ« ĠTWENT Y TrustSec Policy 036531222 9841948 " ( ) `. / -- 2 133 5 20 6 21 B rowser C UT C ards D ur D RO D ns F ort F usedBatchNorm G v G OT G uess G rouped H ave I q J AVA K ED L l L etter M and M CTF N n N AS P aste S uc S CHOOL T j T m T od T weet T oggle T WITTER U a U o U su V rrp Y v Z UR b ys b ary b rato c il f C f arm f ancy f whm g io g host h mac j Äħ k A l ue m ens n Y n é n itude o up p rt q z r just s ac t min t body u ic u ros v ps v tx x H x Z | >\ } "] ¡ ° ¸ ółĢ Ä © ç ģ è ¼ Ġ ort Ġ lay Ġ lif Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠ Ĥ ° ĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠ or ent se al st u en riched Ġt ir ar im al ist de ath le ge an ta an ci an tos Ġ' ): Ġc gi Ġc StringIO Ġf at Ġf val Ġf ruit it tle Ġa ver Ġa im 00 09 00 010011 ge e ge xf Ġn as Ġs pars Ġin consistent Ġre build Ġre moval Ġo lymp Ġd B Ġd ans Ġd mg un discounted Ġm ols Ġm fc Ġe j Ġe ase la k () ', ", "" co la Ġ# % ed ition Ġ( (- ch ina te t te mpl di lation el lip urn e ĊĊ ĊĠĠĠĠĠ get data (' ;') ĠT M ĠT YPES con tributors con fidences con strained con sensus Ġ2 43 (" ================================ (" ------------------------------------------------ (" {}. pp ler ve ys ĠS HO ĠS PAR ĠC N ĠC am ĠC ategorical ig mp for get end time end ente data gen ĠA TH ĠA WA ĠA greement sp end sp lice Ġcon gru ic ao ith metic ĠF ifth om o Ġh á ĠP ep ĠP oll file obj ĠL en ĠL AT ĠL ife Ġst ories pro grams Ġ3 85 ĠD C ac curacies ert ure Re connect ĠM G ĠM iss ĠM ultip ĠM ARK nt hes Ġv ic Ġv ault 02 15 ew m Ġse lects IN HER Ġel lip 1111 0000111100001111 tra il ens ation py tz py dantic pre vs ls st 12 05 ĠE E ĠE ffects Ġj sii ob by text ures ir c num forms In come In jection In centive ĠR atio Ġun et fo g 32 76 ĠG mb ces fully tri g loc idade bu mp ĠV ir ĠU E ĠU r mb le ). \ Ġan alog Ġan imals Ġen roll min w 18 64 da des 25 08 ag c 06 0 ST ATION max h cs l Ġal ex valid ity ari an Ġpre fetch RE USE 22 99 Ġ\ | ĠH EL ĠRe LU ay a Ġ{} " mat o db tool 19 70 Ġsc ans Ġsc anning 34 27 34 65 pos y ĠIn vert ere o 27 15 27 88 27 46 bin ar 24 37 24 53 37 97 ak ota Ġsub options Ġsub section Ġ} }, 33 07 33 84 ĊĠĠĠĠ ĊĠ Ġlabel spacing 87 1 87 427 iv a 97 57 ĠK al Ġit ens run e 26 24 26 53 mon key Ġz z au ght trans it trans mission 23 16 23 95 Ġdx l AC LE 44 16 Ġ** {}** float y ']) +' 28 93 28 36 Ġsp aw ~~ ~ 38 19 LO O be an ĠQ Graphics ĠQ VBoxLayout Col l File Reader Ġim mutable Ġad r ide a Ġarg max Ġbase dir Set ConfigOption wait able Ġver ific }) ") Ġeach Hazard ĠJ ose 89 64 DI V Ġ] )) air mass let t CON CEPT gener ations 29 11 29 03 Ġwork around cli ps Ġexp onent 39 32 39 13 folder name conf test Key Value vector izer send to over la Class Instances pr j dist ort dist utils dist illate Ġsign up ĠNo ise ãĥ £ pb ind ordin ation pping Site Int ent radi x Loc ale BU DGET su la CC S IO U 300 8 Client Message medi cal Ġsu fficient diff use scal a home assistant ĠTh u Ġnon ce ä» ¬ reshape d Ġfin alize ALL Y 0000000000000000 00000000 zip kin ons ive Ġcho osing Ġjo ystick cut ter rel lo Ġpick led Ġcustom ized Color map .* ', á n ('- ')[ Ġresp on "} ] oo o Ġerr msg commit ment STR ATEGY pad y site map Ġ"_ ". Options Middleware cr ates gre et ĠAt tempt AV W Ġshe ets fici ency à° ļ fl ame elect rode ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠ +\ . bed tools ev ada Ġcenter ed boot camp super seding GT D Ġwin reg cross Val BR ACK ĠGo al Ġms b SN AP ĠClass Var ĠText Input Ġп еÑĢ Ne ighbor Ġhist orical Ġhist ograms Network s æł ¹æį® ä¸į èĥ½ Exp ired UND ER Ġdescriptor s ĠArgument Error bul ge Plot ter ĠDec lare sage maker Unit Selector ĠDB Session 384 6 bad ges bra vado II I ĠGe ometry cons ider 234 5 Attribute Type Ġtermin ation ĠMat erial COMM IT Attr s Ġps f 217 3 Ġmis sed push Button Ġsyn th Ġregex p INTER FACE Part y :::: : accept or Eval uating har vest Ab out Ab ility ĠPermission s Ġcast le Style s SUB NETWORK Ġnd ctl Ġpk mn Ġ#### ### pod cast ðŁı´ółģŃółģ ¤ółģ station ary eye brow pay in Ġworkflow s ĠCLI ENT Ġsche mes ĠSample s Ġdr one ĠRO LE identi fied Ġok c ĠOver ride Er rs Required Mixin Sm iles Ġê ¸ Ġquote char colour s Ġdetector s Ġll db '`` , 示 ä¾ĭ sho ulder ufact ure Ġprep end ĠCre ation AUT OT MULT ILINE Place ment ìł Ħ Ġcircle s Ġrecent ly Ġ################################ ######## Year s CAL C éĸ Ģ ĠåĪ ¤æĸŃ ĠSa mpling funcs ynopsis YS IS ĠLa TeX è¨ Ī ĠCONFIG URATION erg ens van illa gover n Ġeng lish },{ },{ æ¸ ¯ æ¸ ħ sam ba åĨħ 容 ли ÑĨ ĠAnaly tics ĠWait ing ðŁı´ółģ®ółģ §ółģ ĠBook ID Ġlisten ers Ġff mpeg Ġgg rc Ġintro duced Wo od Ġconsist ing Ġintr insics suggest ion ë§ ģ ĠPop ulation Abs olute ĠGR APH Blend Shape Ġ02 110 Ġinvert ed ĠCONT RO Ġæī ĵ MibTable Column MibTable Row eigen values Ġhover template ĠFix It ĠBound ary ĠSpect ral Ġbla h RAD IUS paragraph s ĠProb ability wap Chain ĠFE AT åħ¶ ä»ĸ ðŁı´ółģ¶ółģ ®ółĢ Ġear liest phan um ELE C FIC ATIONS Ġautos pec ĠBa seline ÑĢав ил rollo uts Ġpare to Ġxbmc gui Watch er sport s ĠSta ff AddTask Admin AddTask Owner influ xdb RemoveTask Admin RemoveTask Owner Tunable Type åIJ¯ åĬ¨ éĹ® é¢ĺ ĠMED IA ĠSem antic Connectivity Test ĠProposal Id GetOutput Port ĠNeg ative Bandwidth Conf ĠDag ster ĠINIT IAL ĠFW Core ĠPype It ĠTak en SetInput Connection ĠFIR ST ĠRack space Visa UnitSelector ĠHosp ital ĠPRI V ichio metry XFrame OptionsMiddleware ĠGmb H # _ # ", $ '], ' ') ' [\ * (( * ']), + =' , ', . "] / ~ 3 113 4 90 A KE B X B order B rain C ascade D PR E J E rf G V G b G n G un G ED H idden J H J OIN L Q M DO N l P ending Q OS Q Gradient R ing R EN R DD R olling S ed S ock S UN S olve S FR S ector S ENTRY T ake T indices W ho [ \\/ ] '] a F a os b Y b Z b ak b logs b elt b asket b audrate c F c in c ax e min f on f msg f paths g end h M h inge h appy i C j r j vm k on l sh l mb l angle l gb m type m ounts n il n where p N p and p vd r R s ad s ic s max s lp s ized s lc t max u je v cs v string w q w dir w izard w deployments } ]} × ¢ è ¥ è ¸ è IJ é Ĭ í Į Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ 第 Ģ ìŀ¥ in direct at k re defined st or Ġt et ar ri ar as Ġi h Ġi ocs mp o mp rop Ġc rt Ġp ins Ġf ock Ġf cn Ġf ür Ġ" == it m Ġa ve Ġa ft ge op Ġn k Ġn er Ġn oc Ġn map Ġs lash Ġs bj Ġo cp Ġd fa Ġd urations li zed li kely un handled Ġm z Ġm ate Ġm im Ġm istr Ġm utable Ġm outh Ġm iles Ġe trans ion a ad dition ", ". co upl Ġb are Ġ1 200 Ġw ing Ġw get Ġw cs Ġw ildcard ], [- Ġfor med el la is ations Ġto mor il le il ink con test (" ** (" ... (" ..") as g ve sters Ġis bn ĠS po ĠS ym ĠS urface ab la ab cd ĠC AL ĠC md ĠC LO Ġg requests Ġl iter ĠA bri '] +' '] }" Ġcon c Ġcon sum ke ley ke ithley to x Ġ: ]), od bc Ġh ap Ġh lines all Lines ta a ta xa ĠP al ĠP LAT ĠI ll ĠI mm ĠL uc ĠL ua ĠL ANG 0000 03 Ġex cluding Ġ3 77 Ġ3 31 out name ac ific time ToFirst if lags =" >= ext ends Ġy ticks Ġx bm os f ER ON IN O IN EMENT IN CIP Ġstr at .. \ ms vs Ġpro cur py smi pre scription pre serve ES E ES PACE ĠB B ĠB iking Ġname handler Ġj avascript ob b Ġ< -> AT O ĠN ONE ir r len et bo o 92 09 In verse append SF ĠR ock ep ort read ers lic an 32 64 per formed Ġco hort EN CH EN CODING Ġnum Rows min h Ġtime frames 18 000 Ġk t Ġk grid Ġcol lapsed 25 57 25 46 25 39 25 49 Ġro ugh St reet 04 49 04 984 15 07 max s max w max imal cs m 17 17 Ġpre ference Ġpre ferences ([ (' count down pi v 22 68 mat r mat ter Ġsh ar Ġsh ipment Ġdi ed lp adding 19 04 19 83 34 14 34 08 34 95 34 48 27 99 27 12 27 04 27 17 27 19 27 94 opy thon Ġconfig ura 24 92 24 32 24 65 37 92 37 88 37 24 37 45 Pro mpt Pro cedure em g Ġcom mas yn th ĠCon struction ĠCon sumer 94 93 94 0066 33 12 33 53 Ġno tion Ġno cover mpl erate AL S Data Size AS SET =[ _ =[ (" Ġid p ĠK it Ġdist illate view port 26 77 57 92 Ġ[' ', Ġext ends Ġ| ' IS SU Res er Res erved group ing 23 13 AC CT 44 06 Ġ** {' ENT ION 75 9446 Ġtext ual float X float w cor tical Co eff Co ordinator 56 25 38 38 Ġmin idom ĠUn til Po isson ĠQ oS AD C ran e Ġad am Ġvalid ating ich t ey es ĠX OR Ġpos itives ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠ UN C gen res func Name ear ing ĠSt and Un ary Ġq emu temp ted TR AVIS ĠPy SNMP Config Ext 29 07 US ID ]* \ gn a ĠPro vides Ġcontin uation INT E SI Z EX E link rowfield DAT ASETS Ġwork ed ĠPar ses ĠPar sing ren heit Ġfla ir ĠCo ver String Path Ġorder Information ĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠ gr n Ġweight ing âĢį ðŁİ Ġhead line ĠDe code Th inned PL US (_ ) (_ (' Ġ"/ ": Image Folder ĊĊĊĊ ĊĠĠĠĠĠĠĠ Ġ-------- ------- CC SD Inter active Option Parser ĠCh art Ñģ к inst itution Ġraw data hash ers Ġclo ser tax on best h best w tran scripts feature names bit map PR S PR IMARY Ġge m Pre paring web m NE WS Ġdir names ĠFile ExistsError Port Conf âĶĢâĶĢ âķŃ ĠCal ib ĠCal endar áĥ ķ Ġnn cf '} }) Per mit Or ders 0011 01 rad os ĠComp ose ĠComp uting cf gs cap log ĠPRO GRAM å¤ Ł аР³ TEST ING vari ation auto scale auto complete Ġkeys ToReference ĠEX IT CRE AT loaded ACL neg ate neg atives Oper Sgacl cloud y ĠAc quire Ġdraw er cr f gre at Ġhigh way Tree Node ish ing allow s Ġqueue d MAX IMUM ĠRE GI Off sets Ġpop ulated Ġcoun ters ni pe ("/ ")[ Ġ"{ : ĠInter national ç» ľ Stats Table ó du Content Type å¾ ª 192 7 export s divid end Ġcounter factualInterfaceSlider ĠNote book contour Area Ġpa ssages Ġap iname flo ath Ġsegment ed ĠJSON DecodeError 006 25 LLLLLLLL LLL Ġп од Instance Id Ne ighbour Req sts íķ ł IE Core 204 9 Plot ting ĠDB Manager IV S ä¾ Ľ Track OfThingsProducer Ġproblem type BACK ENDS dh w ĠStart s unic orn Cmd Context 294 7 193 1 My SQL den om den orm ĠAnd rew person al Ġcos mo ĠAs sets uest a good s km ers sur rogate RM SE ĠÑģ л Feature Set ĠMO D chan ical ARCH IVE Ġgeo tiff NT Name pod name ĠNorm alization lick r ĠQuery Set hold ing Segment ation ॠĭ vey or notebook id brain rat Ġ------------------------------------------------ ------- ĠSearch Query Drop down æĢ Ŀ ĠHel vetica UPDATE PARTICLE REF INEMENT 426 7 Release Level ĠVer tex FOR WARD bat ched UV W ĠAuto ML COR R LIB STR asm ota Volume s ĠпÑĢ овеÑĢ ĠdocsLoadBal BasicRule writerow s Ġproj ek Ġcolour s Ġcolour space Mib Identifier Transfer Function cisco Dot anim ations ĠTri gger ĠEmail Message Camera Conf Bridge Lamp QS fp ĠAccount ing Fire fox Language s restri ction åIJİ çļĦ Ġcel lpadding Rob ust Writ ten ×ķ× ¨ LAY ERS Ġfx n Ġintegr ity Worker Stats pend ulum autom ation ìļ ° Ġbag s Ġpys mi Fra gment âĸijâĸijâĸijâĸij âĸijâĸijâĸijâĸij Ġmini max Creation Form ĠES MP vic er ENC IL ĠSTAT US Dr ug ĠGu ard ðŁı´ółģ©ółģ ®ółģ CALL BACK Ġfirm ware arith metic Ġatualiz ada ĠTer raform MSE Loss ĠXXXXXXXXXXXX XX Squ ared Hard ware Contin uous invest ment POSIT ORY sit ename ĠLIB STR oti ent å¹³ åı° ĠDig it PROVID ERS dol lar èİĬ 客 ç¾ ¤ æķ´ æķ° ç½ij 绾 Zo om Firewall Rule Ġaccs fp Ġconflict ing ç¥ ¨ setColor At ĠVo ice illum ina xAuth ConfigExt Ġìĺ Ī appear ance dan cing usel ah Coded InputStream Ġfair seq Ġunders core еп ÑĢавил LEG ACY ĠHold ing ãģ£ ãģ¦ unda i Ġuz avg Tal lies Ġusu ário DICTION ARY ENER GY ĠiÅŁ le Recogn izer éļı æľº Ġsist ema ĠEarly Stopping ĠGest uring Ġzstack lib roperly Configured fortun ately FixedLen Feature Otp Blob 55076 3924 ZUR ICH timeToFirst Frame appendSF NTName 04984 759446 940066 550763924 04984759446 376 ! }] > :< A bove B IC B ATTLE C XX D u D UT D ie D MS D DEV F EN F ICATION G rand H AP I ron I PE I EM L DA M w M ip M AL M ount N HWC O HD P ast P oll P ENDING S pi S AV T ransp T akes U e U ARY W as X m X t Y ield \ ', _ *. a ire a ż b ld b msg b ish b alancers d shape f Q g Y g ly g ts g lib h dir h du h orse i K i N i Y i ptables j A j Q j en j av n log n acl n particles o vs p type s N s ine t V t ts v log v fs v ature v lex y Jog z l z score | -- ¹ ółĢ  «  » á ¹ â ² â Ļ è ¬ é ¼ ë ıĦ ë Ŀ¼ ì Ļ ð ŀ Ġ ari Ġ 001 Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ ä¸į Ġ ä¸Ń Ġ ########### Ġ æĺ¯åIJ¦ Ġ Ûģ ĠĠĠĠ čĊĠĠĠ in path or ot re new re curring re lax re liability st rom st udio en ough ĊĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĊĠĠĠ ĊĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠ Ġt pu al to Ġi sess Ġc out Ġc pg Ġp val Ġp cluster Ġp lex Ġp gm Ġp esquisa Ġf usion Ġa sp Ġa head Ġa qui lo ver 00 99 ', [ Ġn at Ġn od Ġn ans Ġs sr Ġs dbc ss ql Ġin k Ġin volved Ġo il Ġd g Ġd rm Ġd ensities un ame Ġm Dict Ġm ystream Ġm otors Ġm mtbx ra i Ġe lo () +" ue ls ad ict co ast id ad Ġ( """ Ġw rist Ġw omen def in ot vm ol c ol ina es i is mo is land __ = __ '] get All get Transaction set Revisions Ġto d Ġto y Ġto das ĠT s ĠT om ĠT erm ĠT iny xt er Ġ2 76 (" ; ') } as df arg where ĠS B ĠS us ĠS pi ĠS SD ĠS pread ĠC T ĠC p ig ar up loads Ġg rand Ġg Vals Ġg RPC Ġg reatest ter ior Ġr val Ġr atings data IO data proc ĠA mount sp rop ver is 01 42 Ġcon str am f to u Ġand roid ĠF aker ĠF AI ĠF rench qu ar ĠP or ĠP et ĠP rep ĠP atient ĠP esquisa ĠI GN ĠL C ĠL D ĠL y ĠL ane res n tr uck ex clusion Ġex perience Ġ3 09 Ġ3 56 10 88 ow y ĠD IM ĠD ie ĠD EL Re cur Re views Re cipe app hosting ĠM ad ĠM arch ĠM PL key frame =" $ =" -- =" {} Ġv j Ġv on Ġv pc Ġv endors test ed test mod Ġstr s load Error tra iling py qt ĠB el ĠB ACK ĠB udget ĠE VAL ci de ĠN AMES bo keh ĠR M ĠR ating mo on ep sg Ġun e Ġlog p 32 32 32 84 per centiles ĠG QL Ġco mplement ĠW alk ĠW ILL loc us ĠV IMS Ġ__ __ Ġen dian IT IVE Error Type Ġcol name 25 12 25 86 25 77 25 58 St roke Ġpy asn Ġpy matgen ag n lib pysal ST K ace lle 05 04 Ġop aque 17 55 Ġal ine 14 16 ne k iti vo RE TRI 08 06 22 18 22 48 ĠRe cur sub scri LL O 19 09 Ġ` / 34 11 34 05 34 67 Ġ[" / 84 24 ĠIn ner write I write String 27 03 27 22 27 09 27 87 27 29 27 73 27 53 27 017 bin ned result ado 37 06 37 15 37 17 37 19 37 36 37 66 37 44 37 98 37 76 Pro d Ġcom mercial Ġsub directories 96 15 Ġcomp arisons Ġnew est Ġnew Path 33 02 RO UGH node pathString AL G exp s exp id exp ert iv l '. \ 36 13 =[ ]), ĠK ind ĠK NeighborsClassifier 26 22 26 94 26 63 mon ics 57 06 Ġext ensive IS R reg amento do ctest Ġper centiles spe cular Ġne utrino CO CO Ġlo se 23 32 23 15 23 14 44 17 und ancy ulti part new ton Co coa RI ES Id Mapping so ap 56 55 Ġsp anning 38 33 38 28 box plot be ep UR CES ĠQ Size PT IONS ref lections AD VS Ar row ',' % token Id ĠY YYY "], " ]] [' Ġenum er Status Code ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ')) ] Ġver se du ino }) '. Ġar ches Num Bytes DI RECTION To Include DO CKER De aths Ġbatch size 29 18 US R gn ed MP P 43 92 43 88 show s head ings ĠPro vision 000000 1 cu isine Ġqu as fe et 42 02 ])) )) EL IST Model Mixin task Id Ġhttp d post ing kin a Ġexp lain 81 93 Ġiter ates build ings Ġtoken ization TO OL ui main čĊčĊ čĊčĊĠĠĠ Ġmode lo Tra jectory Vi T Ġoff line cv cConf fn c first Name State Name ãĤ Ń Ġdest dir job id Ġhead less CA AC CA AA Ġlib c ĠGener ating IND IC ãĥ ģ Ġ"/ ") Ġ"/ ". GH z RES OLUTION Ġmap type Loc s Ġter rain SC P su fficient Ġnetwork ing gg i Ġtransform ing TE LE ĠTh ings div or Ġmon omial Ġloc aliz bit rate PR ICE VE LO lr d Sub plot LOG LEVEL ĠEn code Entry point Dis cord supp lier Rule Default Ġparti r Ġ"- ", Ġexit ed cut mix her oku transp arency xad V Ġsw ig Ġsw itches Ġspec gram login User ĠLe arn Label Metrics Ġlink age ĠComp ound ĠComp iler cap ac Ġfunc name CI E CI R CI RC Ċĉĉĉĉĉ Ċĉĉĉĉ BL ANK multi part ĠImport ing So cial Ċĉĉĉĉĉĉ ĉĉĉĉ rm dir Sc anning custom ers ACT IONS tk var Ġconf Path Ġbl k Oper Status ("- ")[ Ġrot kehlchen Ġsupport ing FR AG ĠNum eric Ġdraw s filters Values Ph y Ġgr upo aut os à° ¬ Ġdat adog CHE D legend size ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠ bi ased mut ual Conv Net ĠRE QUI IZ ZI Ġmod o 002 0365312229841948 high er ni h sym bolic ula ção Peer Mapping NU tils ĠDis crete åº Ħ Ġshort name ea map ĠIP V abi listic Ġpr incip ç» ı snapshot file ima gined Ġcre acion EC DSA orn ia Det ermine export Symbols Sum mer Ġmp img 199 7 ĠCO CO big int poly lines ĠMo tion ĠColumn s ĠFIT S Ġvm ware Ġequal ity Ġexpect ing ĠSH A Ġidenti ties ĠNew ton ĠSE Q ĠIniti alization att ure Ġquanti zed star ter TF Record 384 3 ĠSp an Ġctsp PeerPolicy ANG ES warn s ĠLabel Metrics ðŁĩ ¬ ðŁĩ ¸ ctsp IpSgt wave function illa ge Ġdump ed Ġinternal Failure LV M 218 7 lec ion Ġpla za ATT ACK Execution er 208 1 bri di ĠPh ysics ĠGraph ics Extra ction Extra cts lookup s stit ution ĠWith out har monic ر ÙĪ met al retri ever Ġcapt cha :{ }, LT K ste er Ġmet al ç® Ģ Debug Info Ret ri Ġrefer ring Ġ"* ", Ġden orm Ġsv c say i Ġí Ļ Ġí ģ¬ Ġdiag nostic ONT AL ĠPi pe measure d å¸ ¦ âĸĪâĸĪâĸĪâĸĪ âĸĪâĸĪâĸĪâĸĪ Ġaggreg ated Convert ing Ġten ants Ġinstrument s ĠCH AIN aggreg ated ĠRO UND Distance s Er fi High way tit ch Mer ged Assignment Body gd al Ġang B Ġfire base EPS G ĠUN I ĠSw ap bag s Ġrev oc Ġи н ':[ ], ĠLoop back }$ ') Ġentire ly persist ed Ġsil ence Ġtransl ator Ġflip ped ĠGaffer Scene Annot ations ðŁı´ółģ¡ółģ ¦ółģ ĠPROC ESS Ġjump s Ġtech niques >[ ^ éĸ ĵ >` _ ìĭ Ŀ ĠRef resh 模 åĿĹ Ġste el orient ed social account Ġcr ud ĠImp roperlyConfigured Speci fied fort ran éĺ ¿ usb DeviceCdc ĠBO ARD ĠSec AuditLog Ġactiv ated Depth Stencil ELL IPS Ġib R Ġdiscount ed à°¿ ', LW AL MQ TT rout ers recomm endation ĠGeo DataFrame Ġrom an Ġmf cc mine craft Il legal isol ated Ġtro uble æĮī çħ§ COUN TRY Ġenforce ment ORIGIN AL Ġkv magent ('.. ') ĠVehicle Position æİĴ åºı Veri fication ĠLong itude MODI FICATIONS Refer er 身 份 Ġìĭ ľ Ġlint hresh åı° æ¹ quas ars ĠSW IG Ġsand box Spo ofing íĻ Ķ aman ho Concat enate COMB INED ĠAng le Ġcle ared emission s bea con Cos ine alex net Ġconfigur able ег о marg ins ĠTEMP ERATURE cob js Ġov lp è¿IJ è¡Į bject s åįĬ å¾Ħ ĠPUB LIC Manip ulator affi liation ("================================================ =============") ĠCTR L pcolor mesh urnit ure ĠStratified KFold BRE AK èĬĤ çĤ¹ Ġnucleoti des hrep rt outi d Jeff erson ĠORI GIN {! }', courage ments æ¾ ³ rwMotor Voltage Ġtomor row Wick Theorem IMEM ultipart Documented RuleDefault >}] {!}', ĠFAI LED ADVS Inputs ELLIPS IS åı°æ¹ ¾ ! ] ( *( * ') . ; . ). 1 0000000000000000000000 2 128 2 105 2 135 5 91 ; ^{ ? (? A nt A DED B log B OR C PT D ou D HW D ARK E FL F V F re F Re F ault F ocal G er G est G ill G ive G LO G AA G rab G reedy H al I c L ip M f M as M TE M DA N all N AN O jo O CT P u Q r Q ty R SI R AA S tim S ystems S MAPE T d T weaks U ne U ses U ATE V ocab W u W al X iv Z J ] }') ] `. a R b U b ang c ns c bs c math c NS c annon c insn d op e S e vi f num f obj f ashion g q h po h ls h param h av h ypot i file i ang k id k config k vm k ubernetes l mer p is p format p atched q str q ry r ses s ul t j t q t arg v U v maf x ED x samples y Z z Y { :. } __ } ]) à ģ æ ij ç · ç Į ç ĸ ð ¦ č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ ĊĊĠĠĠĠĠĠĠĠĠĠĠ Ġ ÅŁ Ġ 设置 Ġ åŁº Ġ velocities in se or is on ed re id re mark re lief se ded Ġ= ========= st eve Ġt docs al ing Ġ' ** Ġc j Ġc z Ġc type Ġc annon Ġp om Ġf le Ġf bs Ġf ich Ġf ru he y Ġa y Ġa pe 00 84 Ġn ui Ġn ational Ġs ds Ġs we ur able ss m Ġre pairs Ġre liability sel ler Ġd ar Ġd ll Ġd ill Ġd ai Ġd gm Ġd vc un real Ġm il Ġm ute Ġm anner Ġe i Ġe tr Ġe quipe () ", fi ps ent r ad io ad ores co lab Ġb z Ġb gr Ġb reed Ġb ubble Ġ# , ed f 11 12 rom iss um ann ch io ch ases ch icken di sh ma re urn ey __ (), get Data get Keys get ConfigFile (' (' Ġto pi ĠT MP ĠT runc Ġ2 87 Ġ2 38 Ġ2 62 arg ing op u Ġis close ĠS il ĠS ales ab eth ĠC E ig ree up on up scale up sert ") } Ġdef n Ġdef late Ġg nd ter raform Ġl mb Ġl vl end all data ble ĠA m ĠA ge sp anner '] - Ġcon sensus am bi am qp to d to mo ĠF H log space om s Ġh mac ** - ĠP ing ĠP IC ĠP OP ĠP ayload ĠP inf ĠP Vals Ġas ym Ġas semb ĠI AM file type Ġth res Ġth ick pro vide pt clouds ex hale Ġ3 22 ĠD J ĠD uration ĠD CC ĠD ensity ĠD WORD ĠD aniel Re current sh ar Ġdata flow ĠM SG if d if er Ġv pn Ġy p Ġy Jog Ġpar ses Ġx dr tra vers Ġfile obj py yaml ls a ang ent xd g ĠB IG ob ank xa o ĠR S ĠR OT ĠR TE ĠR OS ĠR idge Ġun seen Ġun successful 32 55 32 53 ĠG ui Ġon p ĠW EB ho g ho liday AR IES ĠV IS ĠV ocabulary Ġ5 76 Ġhe ating Ġan imal Ġan imate Ġen caps ise ctor che mprop 18 97 16 05 25 67 ec c max lon Ġint ents 17 28 17 77 93 47 14 00 Ġpre cipitation AN NOT 22 34 22 85 22 44 22 75 ĠH an ĠRe cords Ġsh adingEngine Ġdi vers sk image mit ter 88 87 19 13 19 14 19 43 19 68 19 72 Ġsc enarios 34 32 34 03 pos its Ġ[" # ree k 27 57 27 66 27 56 27 35 27 76 gs x Ġle ads ill ar 24 16 24 66 24 28 37 75 Ġare na Pro vide em er Ġpo i Ġsub graphs Ġcur riculum 33 11 33 94 Ġapp ending no ob iv istic 97 05 back off Ġuse less 26 16 26 84 26 55 26 71 sum marize Ġz e Ġz h 57 24 Ġext s XXXX XX Ġ| _ "," \ List PomeriumSession status Code 23 84 23 94 Ġte mpl Ġli quid AP IS Ġrun files 98 04 38 22 LO OK batch Size ĠQ Q img r File Exception 30 99 save path PO UT Ġinter national ĠX L 47 68 Ġcode c top os ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ dire ctive Test JobType Ch ars ner ability Ġlin space UN CH UN DS UN ORM UN SPECIFIED qual ified iter values ĠJ ul ĠJ enkins Ġdire ctor temp file 29 88 not null US i ell ing off ers Ġcor outine CL UST CL ICK FF E vid o ug g true div sv p Ġqu eried EX PERIMENT ãģ ij Ġtemp or ody ne "> \ cli m bl ind --- ') ĊĊĉ Ċ cv s Ġ... " send mail Ġuni fied Le ase Ġ12 345 lim ate SS D delta Peak Trans forms acc ident At titude ĠUser Actions ĊĠĠĠĠĠĠ ĊĠĠĠ Ġmsg pack ÑĤ аÑĤ fra structure EM BED sim ilarities ĠWe ek CC CC 41 99 âĶĢ âķŃ Qu ant mod s Ġdown stream ĠCh ina ĠMed ian ĠImage Net Py Qt az imuth Ġ[[ ], Ġcsv mware Sp am KEY WORD win ners æķ ¢ bit ration gy ro ĠDef ining DS RL Ġpost process web hooks Ġ$ -$ ĠZ hang ĠEn coding NE GAT tt ng sen try real cubes Port Entry supp ression Ġ"- ": 10000 01111 Ġstruct log Ġmeta class Or g imp roved "} ', åIJ ī multi label multi cast ĠTime s Ġvector ization Mo ves å® ¡ Ġwait OnFlip è¿ ĺ Ġbl ender Be low ठ² Jo ints Ġaut of Core Application vs is á» ĵ ĠTo gether Ġpredict s CONFIG URE IR D An imate aut odoc Ġcir cuits ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠString Type å° Ķ ĠRE F Cal ib Ġë Ħ menu Item Ñĥ ÑĢ gu a Ġæ ı Ġprop ag ĠDis patch MET RY GO AL ball s Stats Entry pare n Ġinte l åį ¡ å¼ Ĥ simple gui Det ermin Ġmp h gon ometric Ñĭ й Ġ"{} _ SELECT OR Ġap is ĠMy Resource clip se ĠFlask Form LLLLLLLL LLLL Ne ver Ġcar tesian Ġnormal ise ĠPoint ing >" +"\ ĠSE CTION Exp iration 384 7 Ġcross ing ä¾ Ŀ Supp lier mix ing FC ST Rel atório Ġrestri ct Exec uting 294 5 Ġfix ing ĠRandom ly ðŁĩ ¦ BA UD æĿ ± Ġremain s ÉĻ r BI J BI LL Ġpkg util Ġbuilder name WORK ERS WORK SPACE 000101 0100 217 7 297 5 ĠDO WN 301 6 Ġpercent ages иР¿ setdefault encoding Ġ================================================================= ================ 299 5 ĠCan vas many body nu clear flu ence 296 2 ----------- + NT U ste am {}_ {}_ Call ing small er Ġnu f stick y ("{} \ Ġdecimal Separator clock wise Ġcc q sso as SAM PL Card Objects Card Idx Drop ped Ġdiag nostics ĠOptions Screen piece wise å¸ ĥ Ġer c æĭ ľ Ġelect rical Chain s umbn ails onal d Ġrepe titions )+' _ ĠAuto Tokenizer ('# ') PLAY ERS LOCAL IZED dri ving ĠDistri ct approx imation Ġbus car Ġmi xture tor rent Pod Options ITEM S ('{ :. Ġide ological ðŁı´ółģ£ółģ ¯ółģ SEQU ENCE ĠCer tificate 432 1 Ġland marks Security Middleware MULT IP Ùĩ ا ĠRest ore Ġslim med liz abeth Ġsal ary Ġmount ed CLO SED ĠBuil t Ġta int RW Voltage ĠCho ice lua L simp lified NEW LINE nes day ç®Ĺ æ³ķ pend own Fra is Ġeigen vectors Ap pear Ġima ginary ĠmscModVcs E Ġtape s Ġil legal ĠNor ri åĨĻ åħ¥ Dimension s ĠProp het Birth day Ġ({}) ". Ġ'// *[@ ativ a ĠSeri alizer ĠSeri alizable ĠWrit es ĠmcRmt E ĠLab oratory valia ções Ġpostgres ql âķļ âķIJâķIJâķIJâķIJ Ġpep ulator Ġamax List 转 æį¢ Push Button Ġquantum cat èĭ ± Ġê² ½ BOUND ARY nP lateau ĠAmeric ans ê² Į Ġida api Ġdiffic ult occur rence Ġcoco a Shelf Idx ĠAccept ed VOC AB funiIf Conf onom ous ĠGENER ATED Ġcaps ule spar ql ê· ¸ cex pr Ġparm Dict fle ur ĠTermin al again st Scroll Bar Ġëĭ ¤ ĠIo U åħ© åĢĭ 对åºĶ çļĦ Jack son ĠTen cent Ġpul led ĠOB JECT Appro val cPPPoES erver LETT ER Declar ation ĠEigen Array Alive Exception ĠEOF Error Ġencontra do AUG MENT åĿIJ æłĩ Ġdeleg ate æľįåĬ¡ åĻ¨ ĠCos ine Ġenrich ment sib ling EXPL ORATION unicip ality DYNAM IC sted olan Ġopenv ino 顺 åºı SetBackground Colour evm os SNAP SHOT ódu lo UVW XYZ LRO nPlateau ĠCMT S ĠUserActions Info ' ãĢ ) >= * (\ + { - {}". . [ 2 999 2 076 2 137 3 111 3 131 4 167 7 10 : ]), > _ > {:< @ ' B on B ur B unch C q C el C nt C og C LE C AD C UD F UL F ish F ingerprint F REE G c G PT G TC I W K q L q L if L AND M h M ASS N f N ut O y O WN P ow P ops P erspective R ay S ens S PECIAL T n T RO U np V GG W rote Z x _ ()) a ac b I b st b un b bs b las b ctype c pt d ti d path d box d td d gm e ids g B g og g best g cn h j h us h ail h az h uggingface j ian j ane l é m im m arr n from n ine n pt n ik o od o ok o cean p nt p ls r ature s if s ftp t L v Y v Column w ed w orth x Y x st x la } .') ¡ ółĢ º ółģ¿  º à ¯ à ľ Å Ħ Ð IJ Ø « è Ĺ ð ij£ č čĊč Ġ ĊĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ ü Ġ ######### ij ľ ĺ ìĿ´ in basics or oll re ets se cho en tions Ġt col Ġt runk de serializer Ġi ronic Ġ' (': Ġc lr Ġc cd Ġc yl Ġc argo Ġc assandra Ġp add Ġp ron Ġp sql Ġp tc Ġp ssl Ġp aused Ġf ight Ġf ather Ġf emale Ġa partment Ġa uf lo ot 00 75 00 48 00 1000 ge ar Ġs lo Ġs df ss fr Ġin sp Ġin lines Ġin direct Ġin spector Ġre create Ġre order Ġre connect Ġre dbot Ġo attr Ġd in Ġd vid Ġd gl li ch li con li ked un roll Ġm angled Ġe specific la ces ad vent ", "") co er co uchdb Ġb ids 11 64 int ra int ensities id l Ġ( %( Ġ0 10 Ġw ine ch urn ch rm ch kpnt ): ", ma z from buffer ), - ode Plot __ ==' get Datetime (' }')) ĠT re con ll (" :", ') ]), et tes op end op hi Ġ{ % ĠS A ĠS K ab in ĠC tr ĠC ast ĠC EL ĠC ORE Ġg cs Ġg pio Ġl atter ĠA LT sp acings 01 06 01 23 Ġcon ta Ġcon duct ke p am on to ks ĠF ig ĠF lip sc anned vi m vi ol po file ta che Ġas king ĠL ists res a =' [ Ġst itch Ġst rain Ġde activate ex perience Ġex pert Ġ3 76 10 75 out flow ĠD est ĠD og ĠD uplicate ]) /( ĠM UST ĠM DP ĠM ICRO ĠM idi time table oun cing ext ents Ġx k Ġx m Ġse a ack ets test Obj Ċĉĉ ĠĠĠĠ ure ment ---------------- ---- tra ci tra js ES M ES MP 12 57 AT AG len g bo om Ġ4 41 ======== =") ĠR P Ġun set Ġun real Ġun wind 32 25 32 96 32 95 32 86 // ...', ĠG IT ĠG rant Ġco uchdb loc atable AR A ĠV an ĠV OC print ing ib ot Ġan omalies che t che ls 18 15 18 37 line Width da k Ġk nots 25 92 St retch Ġpy asl lt s ll vm 15 02 SE X SE LL ass ume ass istance ass umed 05 06 Ġch kpnt ax ial 93 97 14 36 Ġpre f ne es ne mo 64 02 Ġob serv Ġob stacle Ġ[] ] RE C pi an ĠH ACK sub dirs Ġsh ut db t 88 74 19 56 ID F Ġsc anner 34 39 34 73 84 17 ĠIn dicates 27 85 27 23 ill ation 24 07 24 17 24 95 24 75 24 35 24 42 37 99 37 28 37 67 Ġpath o Ġpath name ak h Ġsub type 96 88 33 87 33 66 Ġlabel encoder AL ARM CT C CT L AS ON AS SIGN mi stry 36 93 run files 26 92 26 64 26 65 26 54 Ġmax y Ġmax val Ġdo se Ġhas n AG UC Ġ! ! Ġ! ") Ġ| ____ IS ATION do se Text Node 90 93 23 06 23 85 Ġli ves frame on IM AG float s io loop En semble auth z 28 05 Id List raw ler 38 12 38 05 38 03 38 08 38 09 38 96 38 21 38 39 Ġwor st Ar b Ġad versarial gin a 45 44 amp ion Ġinter rupt ĠX MF initi ator Ġ, " 101 7 ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠ pl anner 83 95 rt t Ġar ity 46 75 ĠJ start ĠJ acobian Log out Num Buffers Field Def open xml Un lock Ġq id temp est Ġversion added To Transfer CON S De ck 29 12 US A Ġval i Time d 67 04 21 32 search able ug ate page able down stream FA o pass words fe ather red shift а ÑĨии 42 88 42 87 copy to Ġprocess ors iss er ĠÐ ľ Max Spread cli que cli mate ĠPar sed 39 09 ny der Ġover head Ġass umption Column Info Key Press Ġauth enticated Dict Writer Response Error PP P access ible "\ " ĠNo vo ãĥ ij Index Reg çļĦ åıĤæķ° Of State Of Day ĊĊĊĊ ĊĊĊĠĠĠ URL s +' - part OfState tom orrow Create ContainerMessage resp onsible 41 93 execute many н Ñĸ TE AM full StateName ĠCh anging Py Number Ġloc ais feature space arr aro DS V GR ATION VER TEX af ety dat os ĠEn abled Ġvar x Ġpack aging âĶĢâĶĢ âķ° ORM Base Per Point Ġsci ence imp ute MS GS inte gers hand joints depth wise cos mo Ġ") ], ĠFOR E seri alizable commit ter Output Folder Sc enario entic ator prop ortions js chart )/( ? Be lief Core RPC End Time á» ¯ Ġtr n Char Field à° Ĺ Ġdat lim second ScreenText Graph DebugInfo Ġreq Id pa ces )]) . Module LogLevel MIN UTE MIN IMUM zz o Ġthrough out Ġassoci ate Ñĥ ж ni co Msg Name PRE PAR Ġactual GroundGHI GO EO Read Only ĠTensor Dataset åį ĥ Ġgra sp Ass ertion Mon ster BB B Ġsegment Text COMP UT poly fit ################################################ ###### ĠDi richlet UC gU Sk el ĠNew Cell Exp licit Spe ll 215 5 åĢ ij rup o ĠRo berta IG D ough lin Ġsen ha ĠClient Configuration Sw aps break down lc g Ġrestri ctions ĠCommand Handler ĠGe orgia å½ ± 294 6 ðŁĩ ¹ hy undai rag ged RA FT æĿ ¿ âĸijâĸij âĸij Av atar Av ailability 264 1 264 2 Transaction Response æİ ī PIPE LINE Dig its Part Coords micro scope micro second syn apse gm Electron ĠCur sor 295 6 225 9 Ġconsider ing Print s ĠTask s éģ į Linear Regression Cor ner ĠInt Enum Ġapprox im ĠCustom User ðŁı´ółģŃółģ ¸ółģ Ġam end 233 5 Tool bar ais ing pic ard Ġ------------------------------------------------ --- Ġmultip lic uz zer ĠExtra ctor Param Attr Ġelect ric macro Network 293 8 tm db ĠDIS PLAY RUN TIME Release d Addr Bits Vlan Map è§ Ħ è½ ® éĿ¢ çļĦ ö l peg as sil ver Ġtele bot è¯ģ 件 Ġê µ¬ Ġwire less CUR R pow der ółĢ±ółĢ µółģ¿ Ġappropriate ly æĸ° å¢ŀ '[ { åıĤ èĢĥ cancel led BN L İ· å¾Ĺ Syn chron Pod s Ġpod cast los ion ĠUN KNOWN Ġaugment ed Pub lication Ġmix in wind ll èĢ ģ ĠExec utes ĠJob Status ĠEngine ering çľ Ł åĿ ĩ ĠAut umn Note book Bool ExprParser ĠSingle ValueConstraint tape s copi a docsLoadBal Grp aci lities Hyper volume åIJ¦ åĪĻ Cl one Ġfallback s Ġunpack ed Calcul ates Ġmotor dir Ġeg gs éĢļ è¡Į After Restore ĠAdmin istration ĠBad Request Ġcart opy PATCH LIST trim med нÑĭ й Fbx Node ĠTrack ing Mi lightWifiBridge ĠSchedule Block vic orn Ġ(? , Ġil lu Statistics Group Ġfac ilit eti o thro tt pulse io Ġprim itives discre ti DUM MY SHE ET Ġб Ñĭ Ġpat ent ĠProp Limit å°± æĺ¯ ĠRegion al POMERIUM SESSIONS VB INSTST Ġepi log inherit Cell ben z snp s Ġê° Ĵ Heat ing 92140257 87427 Restri cted lix mpp æıIJ 交 Sol ar craw l ĠEstim ator Ġgy ro objec tid ITER ATIONS Ġxls x Ġmeaning ful Ġtang led Calendar Query adaptive Predict ëĵ ľ Rename d Īë ıĦ provision ing å±ħ ä½ı ãĥĥ ãĥĪ ĠFLO AT åł ´ wit ness ĠHeat CapacityGases ISS UE Ġbor row grafi co recur sively ĠObj ective ĠSound Cloud ĠÅ ł ĠBri tish Proj ec stro kes UTIL S ĠHam iltonian extrapol ation hou ght RECE IPT PROPER TY Bootstrap Core Scra per Ġë³ Ģ éĻĦ件 为 nag ios frameN Start spher ical HUM AN MEAS UREMENT Offer ed ĠFO UND æº IJ å±ħæ°ij å±ħä½ı ĠRestri cted STUD ENT hemer al 0294 118 cosm os Ġmetron ome dqm BeamMonitor Rig id dise ase Ġìĥ Ŀ dumb cpm BTagMIST AG <_| <_| JUN IPER INCRE MENT ĠInflux DB ê± ° Ġlk ml è¨Ń å®ļ ä¸Ĭä¼łçļĦ éĻĦ件为 港 æ¾³ ĠFEAT URES ĠCHAN NEL 审 æł¸ odePlot Width getDatetime IST # + $ , % ': ' -- ' ## + =[ + )? , }, , "], , "\ . ]), / '), 2 123 2 175 2 104 2 196 3 109 6 90 < ! > ''' > {}>>> >>> Ġmut ually Sta ff Ġecho Log TASK SPEC aro ot Ġ================= === Mis sed COM MA EXP AND erk at QR ST Init Tech Ġusb DeviceCdc care er CW D Ġmajor ity ĠHE ADER éĩį å¤į ĠCent re han cer ('* ') BRO W åķ Ł 缸 åħ³ nos kip Ġdefer red Ġreach ability caps ule Ġcancel led ANAL YSIS Ġomega conf âĶĮâĶĮâĶĮâĶĮâĶĮâĶĮâĶĮâĶĮ âĶĮâĶĮâĶĮâĶĮâĶĮâĶĮâĶĮâĶĮ Ġcert s Extract ing Nav igation ак аз uris diction tagged item Dat atype ³³ Âł Har vester Rep lica Fix es Sol v ĠSouth ern Dif fer Probe Bundle à¯ģ ', frequ ent Ġsubstit ution Ġenforce d ĠArch ive Ci pher ĠLIB SEL Ġcamp o Ġmens agem ĠTho se Ġsatis fy heter ogeneity ĠìĹ ° DETE CT ĠMySQL db éĴ ® Emp loyee ELE MENT Associ ation åł ± Ġdemon strates ĠPhone Number ĠPr incipal èģ Ķ Ġhpnicf VoiceIfCfg EAR TH ãĥ¼ãĥ ī Ġped ido Ġgran ularity Ġtaxon omy Eye lid Ġì¶ ľëł¥ bay Stack PRESENT ATION SPECI FIC Ġwithdraw al ComponentDef Request Ġincre ases unge on cib ility senti ally Ġretrie ves ĠdocsLoadBalChgOver Status crow d ROUT ING Coded OutputStream recursion limit merce des PROPER TIES shant in Ġtcl fp Ġ["" ] AccessBindings Request dhcpSnp Db Ġven ue inic ial CHANG ED è¾¹ çķĮ hod noLetalisce ĠChuck a å£ « ĠEle ments æĶ¯ æĮģ COMPONENT DEF Bea utifulSoup Pix map psy copg meet ings ĠWIN DO REFER ENCE é½ IJ demon strate ĠFer net vag rant CHARACT ER ĠTUp Bound Ġvet or MODIFI ER ĠTruth Value COUR SE Ġâī ¤ 客æĪ· 端 Sinh Integral áµ § anatom ist Ġmelt ing Cosh Integral Ġolymp ia ĠSHO ULD LOO SE ##---------------------------------------------------------------- ----------## pathology Dict ĠNORM AL DDEV CAPS atture incloud NEGAT IVE ĠNorri sa __==' __ ĠXMF file openxml formats depVar Comp noskip ws " (? ( # ) ._ * )\ - {}. . %( 2 125 4 186 5 39 6 89 @ % B ale B NC B undles C x C lu C fn C ITY C MB E ta E CH E ither F all F nd F und F NAME G ro G XFP H b H u H Box H ARD I j J X K X K z K wargs L c M LE M pc M ichael N tuple N ested O CC P ICK P auli Q F R pt R Pr R KJ R PROP S d S el S AT S cor S PAR S weep S lope T cs T ors T iles T mr T Inc U EN V LD W avelength ] '. ] =[ _ ", ` ' a M a ims b om b abel c I c lt c mt c provider c argo c mice c ambridge d pl e U f to f no f rog g ss h olds h azard i T j on k aggle m yst m cc m ystream n fs o lic p int q e q j r dd s lo t gs v B v ad v able v layer v switch w intypes x ception x ref x pa y A y er y al y out | '' ¦ ółģ¿ Ï ĩ Ð ľ â ļ å ¨ å Ķ ë Ł ì °¨ Ċ ĊĠĠĠĠĠĠĠĠĊĠĠĠĠĠĠĠ Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ åĩĢ in set in as in del at im re la re write re balance se no st ime st emp Ġt ent Ġt bin Ġt umor ar v ar med de pt de stri le sky an chore me ds mp Det Ġc ab Ġp ika Ġp ushed Ġf url Ġf uzz Ġf uzzy Ġf attureincloud he v he mat Ġa is Ġa cs ge ometries Ġn acl Ġs vo ut en Ġin l Ġin tra Ġin dividuals Ġre n Ġre actions Ġre bulk Ġre directs ame d Ġo ic Ġd an Ġd um Ġd ynamodb li co un sorted un locked Ġm anti Ġe z Ġe lib Ġe pub Ġe quival la place fi fo ri b 11 02 11 45 11 00100 int vw Ġ( '. Ġw rote ch y te or te achers di abatic Ġ[ * ma ph ck le es b es m Ġ+ ------------- is q is r is ance __ ==" name list (' & set p Ġto mo ĠT ypical con sent con currency Ġ2 58 (" & op i Ġ{ $ ĠS ah ĠS aved ĠS helter ab Page ĠC ra ĠC ERN ig er ig ra ig ator ig MM up sampling ") ') Ġ== ' Ġg lt Ġg fp Ġg erman Ġr ated Ġr map Ġr mt Ġl j Ġl name data File data classes ĠA Z sp iders '] }\ Ġcon traction am ar to file to gg to wers 99 5677 ĠF X qu iring log path list ings om er Ġh at Ġh cal Ġh cl Ġh pc Ġh abit ĠP N ĠP ay ĠP LU ĠP DN ĠP aste ĠI ce file Changes ĠL ouis res ids Ġth l Ġde limited Ġde dicated Ġ3 06 Ġ3 55 Ġ3 66 10 93 out ing out bound out heast ow a ĠD ue ĠD id ĠD RAFT ert y Re j Re ci Re cent Re levant Re peat Re covery Re FRe ĠM OR ĠM ouse ĠM arc ĠM IMEMultipart nt p lab orator xf fff =" -", Ġv rs 02 99 ext s Ġy f ĠO uter ds o Ġx d Ġx Pos ER x IN Rat ms ds Ġpro ba Ġpro posed "] =" ĠB ranch ĠB NUtils 12 12 ĠE OS ĠE nemy ob fuscate wor st com ic ĠN LU ################ ######### Ġ4 02 Ġ4 40 col dtype In to In cr In verter In stanti In Use In ReFRe ind ers ĠR is ĠR aising Ġun install OR IT 32 18 32 74 32 78 ĠG S ĠG RU Ġco oper ĠW ave Con struction Con dI ĠV E ĠV oting ry ant print messages Ġ5 01 Ġ5 09 min lat IT Ãī Ġtime table 16 03 16 36 line Nav sa x Ġk on Ġk ar Ġk raus 25 47 25 48 25 59 St orm Ġpy th config file 13 99 13 16 lib gexf class Tissue ec al 05 47 cs Den ip latform Ġop codes 17 46 dd pg 93 34 14 05 Ġpre ce Ġpre train ord en '' )) iti zer RE V RE MOV Ġtra cer 08 77 22 66 22 72 ust o ĠH L ĠH ill ĠRe pe ĠRe comm sub str 19 62 output Executioner 34 82 34 76 34 78 pos x 09 57 27 13 27 58 27 69 27 61 24 18 24 13 24 38 24 48 24 58 37 33 37 87 37 35 Ġ@ % Ġsub directory AM D Ġcomp act Ġinput file 33 15 RO B Ġapp le fer mion Name To no v 20 32 Ġclass ical exp Rpt CT S Ġsys inv 97 0 97 18 back wards but or 011 01011011 query history ĠK nown ĠK iki ĠK uge Ġimage m 86 13 86 67 26 32 26 18 26 23 26 98 26 83 fa q 57 02 Ġext remities XXXX XXX ED GE ED ATA IS M IS igMM Res olve Res TInc ix Path do ctor Ġne ck man tics Ġli ving 44 03 AP NA yst e En crypted 28 07 28 22 28 94 Ġend Point 38 55 obj c Ġmin er Ġ(" % uc ciones UR DF ĠQ Vector 35 44 AB B AB CMeta Col NW step size pri vileged 45 43 ich r noun ce Ġrow Item CH N ĠEx pect ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠ Ġpd p wait info Ġmain ly Ġlin has host byname PE M cp lugin To Thinned ĠOption ally DO CTYPE De act Ġcod on 29 85 Ġ`` " о Ñĩ 43 94 vid or ółĢ ³ółĢ std lib PI P err back Ġany one No v No Vis 42 12 last Name iss calar Ġuti lization ous al Node Data tx Not Ġbut ter address Spoofing 31 99 Key Nt Dict List Ġ', ', Ġexpected Collection dis counts FT UE Comp ression cache dir dev null Le akyReLU Ġiniti ated Ġab orted access ories Ser vo User AUTH Ġport Access ĠDe ck Ġform ation Trans Code ãĥ ī connect Attr Th ird Th anks Th inningThingProducer ia f ĠUser CreationForm Up stream Sh utdown ba idu fra mer IP C disp osition :] + RES ER Ġgraph ql EM s su ites PRO BE sim d Ġoffset ToThinned ĠWe ave serv ic 300 3 åĪ Ŀå§ĭåĮĸ Not Allowed resp condition Base Model ĠjnxMbgSgw V mc CardIdx mc ShelfIdx Al most Ġdown loader diff usive =[' / ĠCh inese For ces For Sequence For NtSup div ers meta gene Ġhost apd KEY WORDS Ġret weet Pre dictions PU LL VER IFY Result Found element wise Ġparent hesis Ġcli ps Ġcli ques Ġì ¤ ICs UE ICs Ver ICs NOT ICs RM ICs Unknown ICs Opt ICs Accept ICs Syn ICs EI ICs Mis ICs Proto ICs Sys ICs IMS ICs RAT ICs Dt ICs Sem ICs GRE ICs APN ICs Lcl ICs ISR ICs Reloc ICs RPr ICs UEN ICs InReFRe ICs CondI ICs APNA ICs ColNW ICs UserAUTH GB M Ġcluster ed ĠStr ategy Dis criminator Dis carded ]+ ', ĊĊĉĉ ĉĉĉĉ layout V mount ed áĥ Ľ uri fication rot ter cm intvw á s Pe ople rad as MS ISigMM Ġcache s "} ' cf r arm or Ref uses Ġfeature map Ġpe lo Start up mock ed .... ... ĠTime d STR ATION Ġempty List cer tainty ĠUnit TypeId Ro les Ġind ptr Ed ucation CRE DIT è¿ ½ Ġembed s fail ing æĺ ĵ à¤ Ĺ times lots GG TT End ing End points End Marker á» Ń FR NC LC J SH UT Protocol ErrRx SO URCES :, :] trace d mu joco à® ² ead y Cur SpdMode ĠPre print language code ĠSh adow Ġannot ators ĠPer p bi os bi oproj )} { Device Type Ġlat in ni cos Msg Text Msg Fmt desc ending Ġfill style PRE V Filter ed Ġæ ¨ Ġæ ¯ Ġæ Ľ sn ippets MT L Ġ? ?? MAP EStd Ġpr g Ġmodify ing Ġface colors ç» § ball Dark OTA UserMsg ĠTensor Train cb f åį ´ ĠTH AT ĠTH RES ĠAR GS simple x Det ach Ver NotSup roid b Ġlogin User Register EnumDescriptor MAN IFEST ĠCO UN Ġpa id ĠMy Vm COMP AT dl g FORMAT S ################################################ ########## Ġms du sy mpy LLLLLLLL L LLLLLLLL LLLLLLL íķ ¨ ĠjnxMbgSgwPP V ĠjnxMbgSgwIf V Exp Rx exist ence 215 9 SM F SM ANT Ġrep lies sal cano 204 3 204 7 Ġhome page ĠDec isionTreeClassifier 211 2 211 3 average d ACC UM ĠCor relation 216 6 ĠCommand s Val Rcv ê° Ħ Ġpol ynomials analy se hy th BA IB condition var æĿ İ Attribute Description Ġes sential RS MA 218 4 Fail Tx Fail Rx Ġna poleon 264 4 Transaction Request 206 2 arc py Sec s Ġsyn ced Stop Paging Ġ--- ') 032 5844 Ġsy mp Gen otype instances ToTransfer Ġagg info 203 8 Ġresid ential Ind Tx Ind Rx ĠFI ELD Ġlookup s OC ID ен ий 306 6 REQUEST S 212 9 ĠBe fore 296 8 ANS IBLE Email s Email Backend 308 7 Pr Tx Pr Rx Channel s ĠSpe ech spark line 287 5 ĠMark up Ġstock s Resp Tmr ол ж 292 8 umb el Len Tx Len Rx ĠJo in UES us èĩ ´ 288 6 every one ĠBack ward 大 äºİ NV DA åī ² 293 1 293 7 ĠLib virt Ġcnt s ðŁı´ółģ´ółģ º 387 3 =", ", ĠAuto Model ãĥ¼ ãĥ« Branch ing æĹ¥ æľŁ HC Bytes El lipse dri ll Sm ith ĠRet ry ĠAction Chains mel ho ĠWor ks Inv ocation Ġregist rada Resources Entry æĬ ķ Detail View Full Loader ĠReference FormID Ġrl History æİ¥ åı£ Ġincorrect ly Sensor s Failure Notif cisco DiaBaseProt ÑĪ е Ġchem ical 请 è¾ĵåħ¥ calcul ations ĠApply ToKeys ç« ł Ġsan ic 缮 æłĩ èĢ Į Pa int rer un xC ast Ġland ing MULT ANS ĠLE VEL NP ref BLOCK HEADERS Ġsch olarly æłĩ çŃ¾ ĠGaffer UI Ġregistry mixin ðŁı´ółģ³ółģ© ółĢ± infos ys ĠGOO GLE è¿Ľ ç¨ĭ ĠTw ist Bucket s Book mark ÑĦ оÑĢм ĠRow Status ãģĦ ãĤĭ eder al san ity Ġadapt ers Ġflt Stat CHAIN LOCK frozen set Balance sResource éĺ µ @@ @@ Ġwheel s ('// *[@ Cer cano ĠCluster ing Arti facts WAY S ² ³ Ġmal icious Echo ReqTx Echo ReqRx Echo RespTx Echo RespRx dialect s 解 æŀIJ Ġmilli on assertRaises Regex Ġpow ers ĠNorth ern à¥ĩ à¤Ĥ Cy ber Ġtracked Cells Ġconj unto stan ford ICsInv Tot ICsInv MsgFmt Ġíķ © Restri ction Ġtrip les Sal cano frequ encies Ġautom ated HCP ackets 注 æĦı Pg UESus Ġnib abel Ġhor as ä¼ł åħ¥ å¾Į çĶŁ Ġsnp s è¶ ³ ĠDig ital Ġacceler ator ĠBool ExprParser incid ents Ġutiliz ado DETE CTION SHARED SET ĠPlan et PomeriumServiceAccount Response PomeriumServiceAccount Request ĠChem ical ĠAct ual ĠFIL ES Ġexclu ÃŃda ICsUn abPage ICsUn expRpt ICsUn PgUESus Ġdatal ake =-=-=-=- =-=-=-=- DlData Noti ('| ', Ġguarante e 011101001110100100 101111 ĠNN TP Ġwest ern pyg let molecule s Stri ct permit s ĠBOT LOG 545 1526 Ġbib li ĠìĦ ¤ Ġabbre viation ĠCalled ProcessError ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ("," ): vacc ine ĠFi xture deno ise Ġdoub les chromosome s Ġcapac idade Ġaes ara coher ence scrap ers ĠDynam oDB Unkn APN Ġqsfp Acc Ġqsfp Ntw ICsC mpDet ICsC txNot ICsPT MSISigMM ICsNo Res ICsNo Mem ICsMan IEM ICsReq Accept ICsReq Rej ICsTFT Sys ICsTFT SMANT ErTAD Tx ErTAD Rx ICsPkFlt Man ICsPkFlt Syn ĠTab ular âģ ´ 磩 éĺµ Ġlamb das ãģĤ ãĤĭ Amb ient Smecti tes ĠBas ilisk ì¹ ĺ UPDAT ED ĠSY STEM ĠWR ITE ĠMatching Result 測 試 Restrict Cm Dyn Ad ĠìĤ¬ ìļ© ICsServ Denied ĠBOOK STORE erci ses etun ing vare qual é² ¸ Ġbread th æıı è¿° SIA dbr 3975 353 VIRT UAL ICsNewPT NPref ĠдÑĢÑĥ з Ġespeci ally caff old ðŀ ¤ ivl set INDIC ATOR ĠíĻ ķ CLUST ERS INot Kn ĠUt terance ĠèĵĿ 鲸 åĮ¹ éħį __==" __ 995677 47116 KeyNt Fd ĠexpectedCollection Size FTUE CTX ĠoffsetToThinned Key diffusive flux ForSequence Classification ICsUE Refuses ICsNOT FTUECTX ICsRM ValRcv ICsAccept Part ICsEI FRNC ICsMis UnknAPN ICsProto NtSup ICsIMS INotKn ICsRAT Chg ICsDt ForNtSup ICsGRE KeyNtFd ICsAPN ResTInc ICsLcl Det ICsISR Deact ICsRPr Nt ICsUEN ot ICsCondI EMs ICsAPNA csDen ICsUserAUTH Fl 0325844 99567747116 RespTmr ExpRx ICsUnabPage U 5451526 3975353 ICsCtxNot Fnd ICsManIEM iss ICsEIFRNC En # // ' _ ( ! ) (\ ) }' ) != , # . > . ): . )/ . *( / | 2 106 2 857 2 194 3 0000 4 097 9 076 : ')) ; """) = ${ @ ( A In A lice B el B ids B ibli C j C one C MS D ue D NN D PS E e E CD F t F es F AT F eat F ranklin G X G d G MC G reat G allery H or H ue H ybrid I pt J un J AN K u L ON L ID L CD M orph N mult O ST P lc P USH R oll S ing S RESPONSE S inks S entiment V d V n W EST X h Y J Y Q Z U Z V Z k \ .\ ` ') a Q a fi b C b art b ip b pm c de c dist c zy e of e gress e tical f df f lying g F g wei h max h ann h ua h adm h abit i J i ÅŁ j sd j accard k agit l ds m S n ur n ob n ump n Enter n vd p j p acman q A q time r file s I s To s dist s atellite t H u Y v G v net v sphere w il w off w cet w sdl x AA y et y rs z J } ")) } }' } @{ Å Ļ Ø © ç ¯ é º ê µ Ġ Ì Ġ ï Ġ ĊĠĠĠĠĠĠĠĠĠĠ Ġ à® Ġ ä¿ĿåŃĺ in cr in Range er ant or ic at ty re ti Ġ= [ Ġ= === st ale st akes Ġt list ar ches de bt de precation an as an ia Ġi python Ġi ptables me k ro k Ġc math Ġp plot Ġp raw Ġp ores Ġp acman Ġf inger Ġa pex Ġa mqp lo om 00 34 00 98 00 46 Ġs me Ġs name Ġs mat Ġs Name Ġs io Ġs rs ut ch ur ich Ġin er Ġin gress Ġre co Ġre nd Ġre factor Ġre lies Ġre cursos mport s Ġd une li an pe ci Ġm fem Ġe ulerian () )). fi able Ġb ary Ġb gp Ġb idirectional 11 88 te ur def orm ): . ma intenance == \ ck t ck er ol tz ), )) val ores __ (" __ "][" get Num get Result (' =' (' *. )) ', set Organization set WindowTitle ĠT ASK ĠT odo ĠT ipo import ances str uc Ġ2 42 (" *** (" [-] pp s as d as sessment Ġis Complementary ĠS AN ĠS ends ĠS IO ĠC lay ĠC ube ĠC andidate ig th Ġg ist Ġg oto Ġg bS Ġr z Ġl un Ġl ttng ĠA ck ĠA gain ĠA pril '] +'/ 01 22 01 37 to mb ile y ĠF ACT ĠF urther ĠF ields od us value d vi se Ġh param Ġh orse Ġh ierarchical Ġh unter ĠP F ĠP OL file types ĠL edger ĠL LVM pro duce pro grama Ġ""" [ im i Ġex ons able Alt Ġ3 38 Ġ3 21 10 36 ĠD R ĠD ice ĠD HW ĠD akota ]) \ ]) +" Ġdata f ĠM ir ĠM ESS time check time tuple if ty key List Ġv card Ġy dk ĠO pt ĠO ID ĠO DE ĠO CL os x test bed IN Y IN EL IN FORMATION Ġel t ms du Ġfile input py src ap a 07 0 ang ulo ES ME ber to ĠB re 12 09 12 96 12 74 12 578 ĠE MPT ĠE thereum Ġ< % AT R }, ' Ġ4 0000 Ġ4 294 ff ee In fer In side In direction Ġtest file Ġtest suite lic al 32 75 32 82 32 79 32 58 32 41 oc sp ĠG ar ĠG nu ĠG reedy EN SO tri age ho using AR ROW AR ISON ĠV s ĠU i mb ing IT ERS Error Code 18 06 18 05 18 56 18 83 cur ated Ġk i 25 21 25 51 25 71 St ress Ġpy mol Ġpy rogram 13 05 13 94 ll ong 15 01 15 16 15 45 100 6 train ers 17 84 Ġal e Ġal la Ġal loc 93 93 Ġpre served Ġpre decess ne go '' ): Ġra mp Ġra il ðŁ Ĺ 22 00 22 17 22 69 Ġ\ "{ ĠH ypothesis ĠRe ports sub st sub strate Ġ{} /{} lob j Ġsh aring work tree 19 44 19 42 19 78 output data comp osed 34 13 34 06 34 17 34 24 34 36 34 79 34 52 Ġ[" % ĠIn dices ĠIn crease 27 06 27 64 27 68 24 82 24 46 37 02 37 64 37 27 37 95 37 57 37 38 37 77 37 47 37 59 37 62 em ons Ġ@ ( vel s 96 03 94 14 94 84 33 58 ()) ]) 20 99 exp orted 85 95 97 00 mi ch {} {}". 95 64 95 44 95 47 ock opt lat o view sets Ġcont rolling 26 15 26 21 26 79 26 58 Ġmax Length Ġdo xygen ################################ ######### Ġ[' # Par ses Ġper muted spe arman ele c Text File current Direction CO ST port stat man a 90 99 23 55 23 51 Ġte la 44 77 Ġdis aster ulti mate new lisp cor o En code En velope 28 33 28 97 28 23 cal lee Ġsp ans Ġsp ots 38 01 38 99 Ġmin max Ac ct UR NING ĠQ AE img ur Ġcolor ize 35 03 Ġmo on gin ia ng f table au ä¸ ĥ `` : ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠ pl and Ġgener ations iter ative iter ables ĠJ AN 107 2 89 32 DI VID DI rregular ome gas ĠSt anford open mm air flow DO I 29 01 US DT Ġ`` ( Ġ`` _ block At MP S show error Ġup datable INT S vo lo Ġpoint ers cu la true type ðŁı´ółģ ºółģ ie ved red ucer \\ ' 42 06 42 64 TT L Ġtemp dir ")) ), âĶ ģ ten ess Ġback filled "]) ), parent hesis Get ter 39 17 Ġ", \ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠ Vi ableAlt dis charge dis ruption Form View over ridden Ġab undance Ġdest path ĠNo ViableAlt style sheets spec grams åı ĥ ãĥ ł Access or Th ank çļĦ è·¯å¾Ħ Int l Def ined SC Y CK M 41 92 Base Reg API GATEWAY mc ast Al gorithms Qu ota fp d sets ockopt ĠTh ing hash ing Ġmon o select box Ġref und FL ASK vm ss ves pene Net If Ġpost al web cam Result ado ĠEn crypt æľ Ľ light ing GB Classifier Ġvar type equal ity Ġzip ped embed s grad cam oid c Te acher UB ERON ('- '* ĠConfig Manager mm m 110 11111111 thread Count Fil mografi OUT UBE ote l Ġaccess ory Ġmc Cm Process Id ranch ise commit log STR AP ĠTe ams ĠTe acher Ġconf licts Do or Do jo ठŁ ({" _ á» ± PAR ITY Min Max ĠUp grade Ġevery one question naire éĢ ¹ éĢ ł ĠSh are Ġannot ate Length s '+ "\ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ )+ \ )+ ") Ġ'{ ', atom ical Ġë ĮĢ zz are expand vars Ġcl n Ġradi ance Over write Ġday Of ĠInteger Type white listed quanti t proxy check chunk size Ġbit array shift state mis sed DU MP PER MISSION ĠDo D ĠDo xygen åį Ī ĠRequest ed contour f As sembly Ġsleep ing Ġpower ful }} }, router Vrrp 1011111111 1 numer ator LIST POMERIUMSESSIONS exist ent 215 6 215 7 401 4 Ġquanti dade GA w Ġspect rograph roy alty ('. '): VAR S VAR CHAR BE AT ĠForm ula Track ed ä¹ ¦ 216 3 216 4 Ġlinear ly Bl ank Bl ues å½ Ĵ 214 8 __)) )) ctsp PeerPolicy Ġrelease s Ġput ting BI AS emp loy PA USE 264 6 è¦ ª Ġcdbp AppAdvToPeer pas cal 232 3 232 5 DQ a Ġgre vlex Ġlight on иР´ ĠInvalid FileException 295 4 295 8 DP G ĠCan ada Initi alizer Ġrect angular UInt Ptr general Tracks 306 3 Ġfh kb 296 3 296 6 Ġproc Man Import ing ä¸ĭ è½½ Ġair mass Trap Host ç® ± ðŁı´ółģŃółģ ´ ĠNotification Group Lin coln ĠMark ov Ġflux es Ġneighbor ing ĠAnal isis 307 1 233 9 Ġcircuit Components Ġfbx Layer 292 1 umb ia Ġ------------------------------------------------ ----------- SK Y Ġproto c Ġ'$ '] catalog ue PROTO BUF Ġbi jector VIS OR ĠTR AN Ġexclude s åŃĹ åħ¸ Ġк лаÑģÑģ Ġcnt k )+' \ ðŁı´ółģ´ółģ ² Ġlegend group listen ing Ġok ay ('../ ') ðŁı´ółģ¬ółģ ´ 936 34 arrow style Ġsha de ('{} : Ġoccur rence Ġspi ce season ality Ġattack er hu ge rack space Ġaux iliary Ġsafe guard 309 8 Ġkw ds ä½ľ 为 Ġaccum ulation ìĹ ¬ Ġpersist ed Ġgenes is 00001 000000 aaaa aa å» ¶ Realm Known ĠSome times Ġlaunch er blueprint s Bool Opt oct ets Ġ################################ ######### .*? )\ hess ians friend ship Install s laps ible Vari ous Ġsuc cesfully Timestamp s Ġlit ex 8888 8888 ĠStream ing ĠLogin Manager Ġselector s ĠVAR I å¼Ģ åħ³ camp Run Ġcart s VARI ANT onic alize Endpoint Descriptor ĠSuccess fully ĠClean up Ġstrict ly IMG SIZE recogn izer Ġoct ets QUEST ION Ġib G ATTT T éĻIJ åĪ¶ VOL T determin ed Ġdeclar ations TestModel Branching Ġintro duce ILL UMINA fall ing ĠSan ity Ġб Ñĥ Capacity Gas ĠGu ide Shared Set ĠAcc ord nat cap ĠGra de æĮī éĴ® EFF ECT ĠEnt ries ACH ES tal ents paddle hub è³ ĩ Sci ence Ġimplicit ly Asc endente ĠConstraints Union ĠConstraints Intersection Compile Operation 10111111111110011 0010111 Ġìĭ ¤ ĠSUPPORT ED recur se Are as Vt Group cot ta fund ing GEO METRY ĠCel sius Fb las \". ", ĠMis c ĠVeri fication ĠdeÄŁ er èŃ ¦ Ġwal ks ë² Ī FIRE WALL Ġinstal lable ĠBul k ĠExclu de ĠMyCustomAmazonReview DataLoader åij½ 令 ĠæŁ¥ 询 Ġè¾ĵ åĩº hib ited ĠæĮ ī asser tions Ġshuff led ĠFour ier Webs ocket Referenced InheritingObject Ġperi pheral fight er éĻ³ éĢ¹ Ġling vo ĠOmega Conf ĠвÑģ е ĠMutable Mapping 9672 95 FET CH Ġclon ed ĠMaze Attitude Ġrollo ut SCHED UL SLE EP SYMB OL Stem mer Ġaver aging Ġxbm cplugin Permit Pkts ðĿ ħ PRINCIP AL Ġìŀħ ëł¥ è¬ Ŀ BLANK LINE LOCALIZED STRING QRST UVWXYZ Ġmelting pot 1100100 010101111 01101011011 00101 ĠTHRES HOLD ĠgbS izer ĠNoViableAlt Exception RealmKnown Peers ! =' ! =" " (\ % } ) "], ) """) , + , ]) 2 168 2 134 2 139 3 104 4 171 4 153 7 40 7 39 < ? B la B AM B old B BOX C v C us C oun C ER C ID C itation C yan D ust D SS D NO E aj E asy F f F m F inds F estival G em G ift G rams G rammar G romacs H an H alo H uang I IC I mplement K an K IT K eras L w L ng L vl M d M ind N w N uc N jY N Locator O zs P ct P late R d R r R od R FI R AF S US S MO S caffold T ur T num T LE T ING T alk T ranspose T ISSUE U ATION V iz V oting W inner Z S Z n ] ?\ a id a Cell b ore b ast b ef c ve c ave c pix c airo d min d ados d Space d urations e en e la e ulerian f co f ran f ather f bb g ir g map h atch h base i ge j V k ph k ube k akao l li l cm m F m le m Test m va n mp n ak n iter n unique n regions o tick p name p ension p illow p aga q U s W s X t data t rends t rello u ght v tc v gm v aci w itch x mp x pos x sd x GI y W y ms y arn z x z hang ~ = » ¿ à Ħ à Ķ Ä ij Î ¬ ç ı è ĥ è ħ ê µ¬ ë IJľ í ģ¬ ï »¿ č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ ESS Ġ ĊĊĉ Ġ ä¸Ĭ Ġ Ñħ Ġ 使çĶ¨ in ction at v at on at to re index re map re moving re corded re liable st itch en ed Ġt mpl de creasing le go an ç Ġi bound me zzanine ro cket ti que ti tulo mp ro mp ot Ġc time Ġc order Ġc dc Ġc airo Ġp z Ġp key Ġp ly Ġp color Ġp wm Ġf on Ġf sr Ġf bp Ġf tv Ġ" .. Ġ" *** he ets he aps Ġa val Ġa oc Ġn db Ġn eat Ġn iter Ġn br Ġs ip Ġs mi Ġs old Ġs igh Ġs rt Ġs licer Ġs udoku ut m ut ar ss i ss ip Ġin box Ġin spection Ġre map Ġre ferred Ġo vn Ġd uck li ves ct n un ny un directed Ġm inter ra k Ġe type la z ent rust co e co arse Ġb og 11 04 11 87 um mary um ble Ġ( (" Ġ( .*)", Ġw ake ch ol te k Ġ[ < ma kes es per Ġ+ ------- __ (): get response (' *', (' |') )) \ )) [: set Last ath ers ĠT X ĠT SC ĠT ower us ually Ġ2 67 Ġ2 21 Ġ2 68 (" *. as i as semb et f Ġ{ ") ĠS ing ĠS weep ĠS LM ĠS NP ab il ab ic ĠC F ĠC u ĠC DC up id ") ', Ġg ts Ġg mail Ġg ols ter rain ĠA J ĠA udit sp m ĠF ist ĠF air ĠF lux ĠF REE ĠF acility om Flag Ġh z Ġh vm ** (- po wers ta kes ĠP T ĠP AGE ĠP ier ĠP ages ĠP SF der ive ĠI ma file dialog ĠL R ĠL ines ĠL ee ĠL asso ĠL icence ub ly tr uss Ġth ought pro vince ex ons im stats Ġ3 32 Ġ3 79 Ġ3 72 Ġprint able Ġu a Ġu f Re boot ĠM ik ĠM andatory ĠM ountain Ġv net Ġx ticklabels Ġma i ER A Ġel bow load module Ġme chan ---------------- - tra verse Ġpro vince py d ls b 07 03 07 17 "] + ĠB al ĠB ow ĠB asis Ġos r 12 14 12 08 12 55 12 168 ĠE LF Ġj ellyfish ob solete AT AA AT ACT ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠN MS bo urne Ġ4 42 ger e col lapsible In List ĠR BF mo x Ġun ity lic ant Ġlog g 32 94 32 44 32 98 32 59 32 72 per ceptual // + ĠG AME Ġon t ĠW ay ĠW arnings ĠW allet tri bu tri vial Con ditional Con versions Con tacts ĠV AE Ġhe avy mb re Ġan c Ġan tes Ġen abling min x IT ERATION 18 92 18 87 18 86 18 74 18 73 ft alarm cur G da vid Ġk th Ġk od 25 93 25 96 25 55 25 75 Ġpy ro Ġpy tesseract ener e ag ens ag gr ag nostic Ġmodel dir 13 97 13 95 lib ndr 15 57 SE LECTION 100 111 03 03 Ġint ention we ide Ġop ção ax arr Ġal one Ġal gebra Ġpre computed Ġat r Ġat las right R enti able enti cating LE MENT main ing AN DOM pi per 22 96 22 94 22 26 22 98 22 21 Ġ\ _ ĠH R ĠH idden sub section Ġ{} ', Ġ{} ): Ġdi com 88 33 Ġargs ort 19 84 19 89 19 73 19 58 19 69 lin er 34 12 09 07 ĠIn sight 27 89 27 21 Ġkey pair Ġle ct 37 84 37 56 37 74 Ġoutput Path Ġsub j Ġsub id Ġsub menu Ġ{' )) Ġcomp rehension Ġnew sol 33 17 33 08 33 34 33 67 DE CODER RO K RO UTE row var av l CT G 85 04 36 200 čĊč ĊĠĠĠĠĠĠĠĠ ĠK h 86 55 26 27 26 74 26 78 Ġmax x Ġdo ql ################################ ############## Par ticles Ġ8 080 layer wise CO OL Ġunder stood trans ient 66 67 23 87 23 57 AC AT 44 01 44 05 ns ide 28 91 Ġend Time ther mo 98 55 38 92 38 23 Ġmin iglm check info Me th UR AL vis o html color pri sm ))) ] flow Monitor ĠSe par Ġad cp 45 14 zer vaci the mes call count ong odb Ġcode gen action Bar las hed Set Button ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġsk time gen SQL ĠJ uly Log Data Log Norm Num Views )] ]) 40 32 Ġmodule str open File assert Not Un named Un authorized Ġq y To Process To One CON DITIONS 29 19 Ġval ve âĢ ĺ block Size Ġdoc strings Ġdb us 43 87 ĠPro vince vo y Ġnet run Ġqu ar EX TRACT ĠData API pass ive Ġany where fe el ])) [ left R Ġcontinue s ca fe Ġhttp server kin ds "]) ] "]) ): ĠPar tial tx s Ġ'/ ', Ġass ertion Ġiter ated mer gency Ġframe on Key words cmd Line Ġnext hop FT P Comp utation Le ave pr f 78 33 OP CAPS Out going ãĤ ª pol ys ĠNo Such ĠNo ResultFound job types Ġman hole Ġsetup s ĠRes olve network ing connect ors Access Binding Ġneed le pack er cell ml IP ROP book ing +' "'+ Ġ202 101 300 5 300 7 Ġtri e Ġtri s fla ir Ġleft most Ġsrc path Client Id :` ( TE nd Fa ces ĠCh ristop rap ing ĠImage ChooserPanel Py game ĠAny DataObject az i ĠSim ilar sort er KEY DOWN Ġloc alization PR IM ĠDef ined arr s Ġact ing Net flowMonitor sql formula SER VE Ġcli ff Ġcmd line FP N Dis plays ]+ \. layout s Ġjo urnals engine ering ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠRel ated Argument Type Argument TypeError '} )) Per imeter á gina alle y Event Manager ĠComp ut Ġstri ke cap sys mag ma Mat ched MC ell modi fication ĠCom ments Mo sso å® Ĺ Ġscal ars js ke Map E zone Id Ġmulti line Met ers ठ¦ Resource Description OS Error Ġaut okernel á» © á» ī Ġgr n Ġ') ', IR A Window Text Ġshe ar mu a aut ore aut omatically Ġfun ds hist ograms GN U Ġsocket s ĠSh uffle Ġcir rus Search ing Ġfactor ization bi ge ĠFunction Of MIN IMAL Ġselect inload public URL Ġmod al Ġradi x Ġradi ation Ġalign er Ġseq no Ġarch itectures gu ar attribute Prop From Peer desc ent Ġ'# ': pick up Ġæ µ Ġæ · Ġæ Ĭ expression path Ġdepth wise ĠNO C Classifier IPv Ġcontrol led MAP P Ġpr d Ġsubject s ó s ĠEN T Property Registry Ġgra ss selected Index speci e к о sha ft clip ped ĠST FT è® ¢ LS Conn hot key dig i ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠ TRI ANGLES ĠObject s ĠObject Type sy nthesis Ġindent ed SN IPE Format ting Ġclear art Ġclear logo scription s Ġcar rier ĠNode s ãĢĤ | Ġtool chain íķ © ĠSE ED Dec ision bul ent bul lets GA USSIAN ĠSQL ALCHEMY Ġctsp ConfigSgaclMapping Supp ress 211 9 Rel u major ity в а в од Ġcred its History Resource éĻ Ĩ differ ences 294 9 214 1 214 5 ĠEnd Time Ġgene tic WR IT ano i COMM ENTS Post al ATT ACH Ġslice d 232 7 Ġarti ficial Ġcla ims åĩº åĬĽ Ġir radiance Ġlayout s Host Utilities Ġfl ds Ġ(% . Eval u äºĨ ä¸Ģ ĠSimple Imputer Ġshift width Ġ\" % retri eval ä h ä n flu idity 305 5 ê s 212 2 truth s Ġvisu alizations Ġdue l ĠBl end Call Back ("{} : ("{} ", еÑĢ а operation Context Sgacl Ipv Ġ---------------- -- Ġ---------------- ------- concept s æĽ ² 209 4 Drop NetflowMonitor Game s ĠAb ility ĠSER VERS å¸ § Ġelect rode ĠChange d Ġfold ing à± Ĩ ÙĨ ÛĮ 对 é½IJ identi fication cart s 455 7 Ġhard coded Show s LEX ER ë¡ Ŀ utter ances ĠRet rieves fire base Acc Sfp ółĢ±ółĢ ¶ółģ¿ ĠпÑĢ ав è· ³ Cm ds Ġclock wise ("_ ")[ Ġtruth s wik ibot HOLD ER Ġwar ped Ġд ан Handle s ĠEval uator pf am Transfer From getTypedRuleContext s Ġlig and calcul ating ualiz ar Snap Z ĠAP IClient CHAR GE Ans ible Security Group ðŁı´ółģ¢ółģ § ĠVis ual æı Ľ 次 æķ° Ġз аказ acion es Lat n ĠPart y ĠRest art Hyper bolic tissue s Vari ance THE FT Clean up ĠSa fe čĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ čĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġprod uto ez dxf ι κ chkpntTrap Category chkpntTrap Severity chkpntTrap MsgText Export ing ал ÑĮно care t ĠCallback Context ĠCallback Property TIM ES MOD UL lens fun orient ations ĠPrepare ADVSInputs Ġphot on hal py Sig moid æ± ł unt ário ĠPATH S bk data mlin ks Ġarrow props ĠCOMM ENT mirror ed Ġminor ticks 代 表 Pur pose lee py ĠAnaly zer Gi B iet f Ġima genet Ġfall s Ġrecur so VP DB Ġwavelength s æ¡ Ī Diag nostics Beam Spot Ġusd Utils PlusTail Context Bro ker ĠCap ital ðŁı´ółģ©ółģ ² Effect s ĠBert Tokenizer Chunk Node integr ator owl nets 空 éĹ´ Mg mt TRACK ING PAY MENT ĠLat itude Relation ship ĠMask ed Ġsob el ÑĢа Ñī åĸ ľ ìķ ¼ ìķ Ħ xFFFFFFFF FFFFFFFF ĠTIME OUT áĨ ¯ IDXGI Factory UNI QUE ν α Ġbir ds æł· æľ¬ inde cies Ann ih CATEG ORIES DRI VE оз в оз д Instr ucciones ĠSegment ation tac tics на Ñĩ 00001111001 00000111 caffe model Ġestab lished extreme RtStats å¼łæĺ¯ æīĭæĮģ ë¶ Ģ ĠSong request occur rences Ġrw Motor Ġelimin ate ĠBro ker ALI AS +---------------- + substit ution miner als Pas sed AppAdv FromPeer Trial Component COMB AT ĠIndi co ĠTrace back Ġortho gonal Look s ĠCombin ed Ġlan Mode ĠHOST NAME """""""" """""""" ĠBR DF íĺ Ħ Ġadverti sing nnnnnnnn nnnnnnnn Ġcru ft 磩 å½¢ Ġcit dl Parti cipant twin x instanti ate ĠTER M chkpntTrapOID Value know s ĠTIM ESTAMP AGGREG ATED æ¼ ¢ Ġë¶ Ģ Ġë¹ ĪëıĦ Calo Stage ĠEp isode nowled ged ografi a nation alization ACCESSBIND INGS PhoneNumber Desc Friend ly æ¥ Ĭ ĠInvent ário jaco bian ìĦ¸ ìļĶ Crit eria Ġkine tic muR fac lugg age Ġthro ats Dol lar abri el ĠBLE U IDXGIS wapChain Works heet Fem Resp ĠSEM I grat ulations orent z ĠPLAT FORM ĠImm utable xAuthConfigExt n gned in Ġfich ier topos ort å¼Ĥ 常 ophi licity ĠFORE IGN ĠìĥĿ ìĦ± RELAT IVE DTEX OPCAPS incron ização xpa eport maph ore qtime tadata ĠEMPT Y Ġ4294 967295 ĠHypothesis Test Tnum segments ( < * =\ , ") . '], 1 00000000 2 126 2 127 2 934 2 195 3 012 3 105 3 096 3 097 4 195 6 000 8 0000000 : $ B j B EG B roadcast B IBLE C are C ords C riterion D AG D ao D HT D etailed E z E ol E dition E Ag F ib F EM F arm F eb F loor G f G ran G AIN H at H over J e J PG K c K t K ick K raus L H L z L TR L FP L azy L ondon M n M ort M ine M AD M utation M omentum N im N AC N Content N ATIVE O db O pa P la P df P DO P CM P aper Q Vector R l R om R ING S MA T uesday U H V Co W n W ik Y a Y f Z ones ] /( a us a ab b ss c S c able c ag c rm d Q d ac d ob d ff d scp e in e bs e igh f en f ax f ant f uzz g ard g usm h ci h ay h ana i P i S i path i lio j es j query k Y k ub l um m ers m idx m sec n ces n ec n ings n ww n cc o sh o Target o hm p erspective q G q R r vs s H s Z s igh s ld t log t test t ender u R u in v on y ah y uv z ap z label z ave z mc } > } }. £ Ģ Å ĭ Ð £ × ª à ¾ ç ĭ ç Ł ê Ŀ č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ ]] Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ ############## Ġ å®ļä¹ī ĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ on set on aut Ġt ort Ġt ts Ġt ots ar let de lays le afs an ol Ġi tr me tab mp ip mp ted Ġc en Ġc ta Ġp po Ġp ai Ġp anda Ġp auli Ġp uls Ġp ileup Ġf reed Ġf ired Ġf ederated Ġa ware Ġa udi Ġa hr Ġa valiação lo ser lo Ve 00 83 00 72 ort heast ce f Ġn icht Ġs la Ġs orry Ġin order Ġre cts Ġre liable ing Policy Ġo x Ġo cean Ġd ad Ġd amp Ġd Space Ġd lg Ġm Config ra v Ġe dition Ġe jected la int fi co ent ral ri mir Ġb line Ġb aby Ġb zt Ġ1 0000000 ed o ed ance 11 15 11 03 11 65 Ġw id Ġw af Ġw atched ch ap ch ris ma kina from Utf el bow ), ), is class __ ()]) set Visible set recursionlimit xt b xt h th ena th ought Ġ2 86 Ġ2 57 Ġ2 77 Ġ2 65 Ġ2 39 et rade Ġis land Ġis Reverse ĠS R ĠS tra ĠS low ĠS PI Ġof a ĠC D ĠC e ĠC s ĠC pp ig s up dating Ġg ro Ġg reedy ter y Ġr ings Ġl ars Ġl dap data structures ĠA U 01 24 01 62 01 6292 Ġcon strained ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ic m am mo to wards 99 87 99 57 ĠF S ĠF PS od l qu ids Ġh ls Ġh ps ĠĠĠĠĠ ĊĠĠĠ po x ĠP la ĠP DB ĠP otential ĠI mg ĠL abs ĠL USID =' +') Ġst ash Ġde li Ġde dup Ġde veloper Ġ""" ! Ġnot ation Ġ3 16 Ġ3 05 Ġ3 23 10 22 10 95 10 68 ase g ow s ĠD UT ĠD urch ac me Ġu json ]) < ment al Ġdata points ĠM T ĠM ur ĠM AE nt l xf fffffff =" - =" .", Ġv ad Ġ* (_ add Item add Parameter IN C ore an ore tical tra vis Ġpro cs Ġpro gra py fun pre cond pre computed ap h ap ore ap dev 07 00 ES R "] ') ĠB idirectional Ġos f ĠE D Ġj d Ġj nt ci ti ci ety ans ions ĠN FT ĠN ÃŃvel len n Ġ4 43 Ġ4 48 lu ence 92 97 In voice ĠR V ĠR olling mo vi mo ji Ġun register OR B Ġtest cases Ġlog Tag 32 99 32 13 32 08 32 34 32 89 32 29 32 48 per p ĠG M ĠG Common EN AR ĠW s ĠW ar bu ck ĠU rn code cs Ġ5 44 Ġhe t ). ", ib a ib ble Ġ__ | 999 8 Error Handle 18 02 18 36 18 35 18 67 18 8877 16 75 line plot 25 19 25 31 Ġpy name 13 03 13 64 13 56 SE CS ST AGE 100 5 100 011 100 0100 max lat Ġthis Loop 03 75 Ġint ensive jo kes jo urnals we igh ip address 17 75 Ġal to RE PEAT 22 32 22 67 22 39 ĠH Y ĠH a ĠH ive ĠH AND ĠH AVE ĠH VAC ĠRe peat ĠRe cursive ĠRe ceipt ay ette sub path sub list sub strates Ġ{} ; Ġ{} ...". input File ][ ~ Ġdi vergences sk ipping df w 19 81 19 41 output Data ID ITY Ġsc p 34 97 34 74 Ġwe igh 09 09 ĠIn frastructure write List 27 59 inter leave Ġle gs ill ator 24 05 24 36 24 47 24 54 37 04 37 93 37 08 37 89 37 39 37 31 37 54 37 52 37 41 Pro duced em iss Ġsub str [: ,- 94 87 33 03 33 52 arn o av arii 87 08 fic ar exp lan CT A CT TT ensor ing ". " ". * 97 77 back log net list 36 94 36 75 Ġopen fermion Ġuser guide word net Ġcont ador 26 05 26 09 26 81 26 69 26 558 sum mon mon t Ġdate Time Ġz oo Ġ[' '] Ġext def Ġ| * Ġ| - Ġbo ss Ġne utr List Node AC G AC P Ġli e 44 12 44 66 44 65 IM e new ick En riched Co ok 28 17 28 09 28 24 ET F Ġsp rites FI LL local ity obj corners pop ulated Ġ(' _ uc ing UR G img t of p 35 04 ĠSe ed Ġcurrent Size 45 96 45 89 amp s amp hora item List the y the ad ide l 47 36 101 0111 Ġver ses wh ites du ate rt u }) ', Ġar rows 46 12 46 04 Ġcv b ĠSt ub )] = )] ): 40 93 Ġformat o Ġq ry ĠPy Installer let te CON TRACT DO F De viation 43 85 Ġ{" _ ĠCON STRAINT Ġup roject Ġup sert ĠPro ceed Ġ:: = ins ight cu a ie u session id 42 95 42 80 left L EL Y Ġpri mer Ġlimit ing DAT AD ĠValue SizeConstraint Max Pkt Max TEnd Ġback track UM B Node Name 39 14 Ġsum mer Message Handler cho lesky aw iki Ġword TreeMap ren te Tra it Ġtop down Ġdif er annot ators Ġeval s Cont rolling ãĤ µ pol ls âĢį ðŁļ Ġroot dir CA U ãĥ ĸ Access Key Ġwidth s çļĦ åĢ¼ Up dater lip id Ġdoes nt ÑĢ ем ÑĢ ед stream er Inter est Ġgl Bind Ġfont name Ġfont dict 300 2 Create File API Resource dec imals mod ern Ġoper ational ĠCh en rap id ven tions sing ular az el ĠSim ulate é n ĠDE P ee ee Ġact uator Pre processor GR AN ĠAPI Key LOG S ĠZ IP Ġì £¼ Ġans atz ĠMan ufacturer åħ « åħ Ń Ġstruct ural display ed her es Ġelement os è¯ Ŀ Ġsw agger dx l Ġvi brato cm marr Ġinstall ing vec tive "} }' cf fi ãĢ IJ ãĢ ij mock s document ed å¤ ¹ cla imed Pri vileges Ġpub sub On ce å® Ŀ seg m rm sprop Ġconn exion ä½ İ æĸ ¯ prop ensity Ġmulti label product Type short ening Ġ'../ _ Ġ') ') Ġhash able AV ES Server Info Ġve ga Ġclick ing peri pheral Ġcap able Ġassign ee ĠSh ipment ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ channels resource )+ ", ],[ [' å° ¼ ĠAd dition ĠAd apter bb ed land mark ÃŃ s âĶĮâĶĮ âĶĮ Ġpas senger Ġë ¡ Ġë ĵ Ñĥ ÑĪ Ñĥ Ñİ Block ing quanti les Ġdiff usion Filter ing just ify ĠOn Off mar shal Ġ? " Ġ? ', Ġadmin ist Ġadmin istrator Ġenvironment al chat bot sigma s Ġinv itation к л ĠCO O Ġpa usr typ ically ĠST DOUT rf m è® º LS B DIS COVER COMP ARISON ĠMo ving %% .. Ġdrop block IA I Mix In ----- ") scan code Ġcar ro Wh ile Ġhist o Ġnormal ised Ġri o ĠSE CONDS ------ ") icon o icon da 204 1 Ġ'< % Ho pping diag s čĊĉĉĉĉ ĠĠ Ġtw it 384 2 384 5 Link age Ġctsp Stats equ ip ":[ ], utc fromtimestamp MODEL META в Ñĭ éĻ ¢ 为 空 ĠGe om Sign ed 294 2 294 4 ctsp Stats EA ST contin uation Ġes se circ uits walk Tree organ ized emp irical Admin String uck s Ġtab stop ATT GG 208 4 pet ual åıĸ åĩº 217 8 217 9 232 4 AI OPS åĨ µ watch ers Ġsyn set Ġlight ing åĩº çİ° ,)) ; æĸĩ æľ¬ Ġsur vival squ ad 6666 6666 ĠÑģ о separ ators 207 5 295 1 295 9 met ro illi ams Lim ited Mask Width 305 4 Render ing 296 9 Ġhyper params Ġswitch ing NT Def prote ins Cor rection 308 2 Pr sa ä¸ĭ æłĩ INST ANCES dem os Sto kes Ġ"' {}' pod man (", ")] Shape s Ġ---------------- ------ 403 4 Api Client cod on âĢĻ , ãĤĴ ä½ľ Tool Bar Processing Job ĠResource Type Ġdeploy er 292 4 chi ef Ġ------------------------------------------------ - 209 7 ĠâĢ ¢ ĠâĢ Ķ ĠMain Window fh ir 436 7 987 5 LEVEL S æŶ åĢĻ 293 3 Tun ing Ġcwd mWavelength Ġdr ink Ġflash er Ġdet alhes FOR WAR ĠOver flow ãĥ¼ ãĤ¿ cook iecutter ĠConfiguration Error ĊĠĠĠĠĊĠĠĠĠ ĊĠĠĠĠĊĠĠĠ Send Command bid irectional suc ceeded ĠTag ged ĠOper ating ĠStore Result sil houette =(" ( =(" ", repe ating Ġattack s Ġ-------------------------------- --------------- Ġpartition ing æĸĩ件 夹 Ġemp loyees augment ed 309 838 kn ife ĠUN SET nv me hard share \\\\ \\ mult inomial calib rate ĠTri angle ĠBinary Tree 298 1 å¥ Ĺ alloc ator ':[ ]} ___ ") Shader Fixes Ġplan et SG W MER GE ï¼ī ï¼Į çľ ¼ ìł ľ ðŁı´ółģ¢ółģ ²ółģ Ġrevision s Let ters Ġeff ec Deploy ed Deploy Status ê³ ± lain Text Install ing ĠCPU s éł ĺ Ġsuc c Ġbri ef Ġincrement al åħ³ éĹŃ CONNECT IONS Ġठ¸ pal ettes bas in KER NEL Ġphot ons æīĢ 以 fq it decrypt ed CRY PTION ĠCons umption contrast CH åŁ Ł ĠBO OL æŃ£ åľ¨ âĸijâĸijâĸijâĸij âĸij Accomp lished ĠXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXX fan art vot ers Ġaffect s Ġfreeze gun nft s æĥ ³ Ġmal ware Ġfb las FUNCTION DESCRIPTOR Diag onal pict ures snake make associ ated GRAPH ICS Aut om Ġusd Mesh ban ana milli on ĠGEN OMIC Ġtensorboard X declar ations Ġ'; ' Ġsl urm Ġban ana YT ICS Ġbas in 01000100 01000100 extern als Replace Options ENTITY SCHEMA PAY LOAD occup ied Comm unic 705 0499 fed learner ĠQU ANT ĠHelp ers Tele gram Sprite Id Ġextreme RtStats glyph s Ġsnake make usc enes VO ICE ðŁı´ółģ¥ółģ §ółģ ĠAug ment Ġcool ing IDAT x 0111100011011 10111111111 SEND ER phan tom éĴ Ł ãĥĥ ãĤ¯ Ġcg tsvg Ġdemon strate audi ence ĠGpu Elemwise gran ts Air port 1307 2943 ĠSql ite ĠREQUEST ED Winter Festival ĠDiag nostic cau ght implement ations ĠÄ ij ĠTick et ĠAUTO GENERATED etsys NacApplAuthentication ental Data doub les ĠVisu alize ĠVisu alization Ġetsys NacApplAuthentication Ġrq st ĠQgs Processing SENT INEL TOR CH .` % ĠVital ErrorHandle cloudwatch log Trend ing Ãĩ ÃĥO Ġcite key Ġspl unk Ġè¾ĵ åħ¥ BOOT STRAP ĠMsg Type MaxT Begin Ġadministr ative ENK INS ARES IZE msc n Ġì§ Ģ 2953 93634 Ġterra cotta ĠTyped Dict ĠFed ora ester day ĠBounding Box ĠRequire ment ASY NC âĸĪâĸĪâĸĪâĸĪâĸĪâĸĪâĸĪ âķĹ Ġreprodu cibility Cum ulative Ġdynam ical Ġdirec tives Aspect Ratio Gri pper Ġspar ql ABCDEFGHIJKLMNOP QRSTUVWXYZ Pie ces Tho mas Ġobjec tives pgm var HORIZ ONTAL uros ynth Ġcongru ence ĠPep ulator phanum eric éĬ Ģ Ġkt ó itud inal bey az ATTEMPT S Ġfru its Ġdivers ity ĠCEL ERY isser and Americ an ĠusbDeviceCdc Component ĠSah ana åıĥ æķ¸ Ġ'$'] ],[[' SCHEDUL ER setLast Updated 12168 1553 36200 171 MAPP INGS COMBAT LOG æ¥Ĭ æĺ¥ BIBLE UTILS Ġahr spos ĠdSpace ID 188877 36200171 26558 121681553 MaxPkt Len cmmarr hx 309838 295393634 7050499 13072943 # / $ . ) ": + (? , -- - < - ] 2 925 2 948 2 103 2 131 3 025 3 857 3 121 3 129 4 567 6 70 6 81 : ': < % < ( A a A ID B re B AS B IL C andidate C losing C UBE D up D to D é D HCP E sc E xe E rc E ns E MA E CE F acing G Qy H d H ip H IV H ADOOP I jo K ron K UR L s L ite L atest L AMBDA M IL M pk M ixed M hz M bps M aking N FD N ominal O de O ur O range P q P ulse P ADD Q b R f R mon R DF R BR S in S ell T g U PL W Qy W ATER X or Y n Z q [ | [ (" ] ^ ` { a ea b lu b matrix b ounce b ounded c ce c ct c ub c ere d ow d ens d rc d rs d theta e pp f es f os f db f cc g am g px g kl g Term h artree k ant k ins l list m B m Y m di n S n ar n ba n You o main p unk p ane r N r te r rs r syslog s F s ire s ı s ppas t type t ld v ndr x j y B y or y am z Q | ] } .", ª ółģ¿ ¸ ¡ ¿ éĹ® Ä Ĺ Õ ¥ Õ ¾ æ ĩ ë į Ċ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ 0000 Ġ vice Ġ ride Ġ ############################################################################## Ġ çĶŁæĪIJ ĭ 转 in l at en re db se o st ft st ud st ability en ne ar f ar range al bert le ta an m an cies Ġi col Ġi df Ġi ous Ġi OS -- · me cab ti se ti linear Ġc ro Ġc print Ġc fp Ġc px Ġc lang Ġc pus Ġc anceled Ġp type Ġp pos Ġp pc Ġp att Ġp ictures Ġf onts Ġ" ')) Ġ" ;" it ons Ġa set Ġa py Ġa ci Ġa do Ġa wards 00 87 00 54 00 74 00 53 Ġn il Ġn ao Ġn dof Ġs os Ġs format Ġs weet Ġs urname ut to Ġin jected Ġre balance Ġre directed Ġre parm Ġo pe Ġo obG Ġd I Ġd it Ġd rops ct e un load un ches un bound Ġm ic ra iden Ġe w Ġe cr () ]. () ;\ fi cs ad oc co li co vs ri f ri gid Ġb dg Ġ1 998 11 08 11 83 int Div int erior Ġw v Ġw ulff ch g ): ") ma id ul ong == - == > Ġfor ge Ġfor cing ol en el ded el vin is le is able get C get Status get Device get Property get Attribute (' ** (' ================ (' === ĠT im ĠT OTAL il U th irty Ġ2 94 Ġ2 49 Ġ2 61 (" === (" )") pp le ') ", op o op codes ĠS in ĠS ay ĠS UM ĠS LP ĠS chool ĠS AVE ĠC K ĠC op ht t Ġg ib Ġg ave Ġr n Ġr sa Ġl arch Ġl gb ĠA ra ĠA ff ĠA PN sp ice sp aw ult s ver melho '] ( Ġcon di Ġcon tr Ġcon dense ic ion ke e to f path sep od river qu a log raph log Resource vi f ser y Ġh ora po li ĠP EM ĠP lane Ġas ks ĠL P =' .', Ġde da pro du est e 0000 2 Ġ""" """ im v im me able Conv Ġ3 83 ĠD NN ac curate app id app able ĠM F ĠM el ĠM il ĠM EN ĠM otor ĠM utation ĠM MR lab oration ew ee ew lett Ġ_ *_ Ġy an ĠO PER ĠO PTION os r test cases IN I ure au load URDF ON US py th py task py dev ap r ense s ĠB at ĠB ur ĠB IT ĠB alancing ĠB ayesian 12 07 12 04 12 84 ĠE xc ĠE ns ĠE lev ĠE lf ĠE lem Ġj pg ci x ci an ci are text box AT S Ġ) ): com ms }, " len gine bo y Ġ4 15 Ġ4 36 ff c ff set 92 55 In coming In secure In depVarComp ind ust ĠR W ĠR ace ĠR SS ĠR IP ĠR NA ĠR oman ĠR OC ĠR ANDOM ep hem Ġun k Ġun balanced Ġun wanted Ġtest utils 32 06 32 88 32 36 32 45 ph ers ph fqit Ġon mouse ĠW arp ho spit Ġout p AR C ĠV T ĠU Q ĠU V print able Ġ5 20 Ġen queue Ġen dif ard Objects che st 18 08 18 84 18 57 18 45 18 77 18 47 line ages array ScaleT cur riculum Ġk b Ġk x Ġk ube Ġk akao Ġcol n 25 33 25 95 25 72 St ator St aged Ġ6 0000 ener ate ag max ag ged 06 36 15 65 max hp ]. __ we ed train set Ġch ap 17 56 Ġal though 93 07 93 05 14 84 ord ot Ġat m right L Ġ[] ], gra ded Type List 22 92 22 45 22 77 22 82 22 89 22 73 Ġ\ "" ĠH D ĠH or ĠH int ĠRe action sub traction ml eri np x 88 55 lp m 19 67 19 63 Ġsc arlet 34 96 34 55 34 87 34 86 34 57 34 98 34 43 34 58 34 59 34 63 Ġ[" . ĠIn ception ĠIn no ĠIn direct ĠIn correct 27 95 27 31 27 62 27 51 bin count Ġle ak arch ivo ging Classifier 24 08 24 33 24 85 24 44 24 62 37 13 37 42 37 58 37 53 37 68 ak i em os em isto Ġpo etry Ġcom ms Ġsub sequence yn om AM ILY Ġac quired Ġcomp os Ġcomp ares Ġcomp licated 94 99 94 56 33 05 arn am DE LETED RO Y RO IN split ed 87 94 exp lain Ġla ke mi e mi ered 36 57 Ġopen rc ĠK E ĠK ubernetes Ġdist inguish 86 06 86 84 26 11 26 07 26 25 26 06 26 29 26 91 Ġmax lat Ġdo is Ġz samples HE L AG GT Par ametric ster esis ww ww IS A ix x do ors Text ures "," % List Issue List ComponentDef current Position CO H upp ort man ifold ach i trans mit 23 92 Ġstart Date Ġmat ters ps g 44 07 44 04 ns g und reds IM URegisters new est float ing 28 98 28 31 Ex pert fix er 56 76 98 96 FI p move axis my list my group LO B batch norm Se ason Ac tivate be aring ĠQ Image PT IME target ed AB I vis ão ud call tim ings doc format ',' ', stat combine 45 64 Ġinter ior "], ' Ġspeci e Ġcode d Str Var Ġ9 000 cy linder cord ance Test Result Ġgener ics Ġstring ify Ġver tically Ch unks Ġsize Tuples mark ing rop Tors UN et Ġcv cConf 89 04 89 55 yp us cp f )] [' assert In root Dir Un ordered tag statcombine ĊĠĠĠĠĠĠĠĠĠĠĠĠ Ċ Ġbatch norm Config Error 43 84 43 96 Ġcor al ĠPro te ĠPro filer CL R vo x )* | Ġqu otation EX CLUDE 42 96 42 85 msg str MA Y Ġright most ible s EL F ca fee iss pace DAT AS ĠÐ Ń ped antic Ġtag id Get Block Get Desc Ġwrit ers 39 04 39 03 Ġfa z bar rier Ġtyp ename Ġlast name 74 1 ĠCo okie Ġ... ' LI F LI ER Response V Le Net Le af Input Field 58 07 access Token pr á ãĤ » Ġ.. _ seq name Ġfollow ers Trans ient IND ICES ym al At tempt KE EP Ġ"/ ", erson ate 62 84 Sh ade Ġexist ente IP Address Ġtmp Pat RES P book id Def Cmd internal Failure SC loud su itable CC JC 300 4 ĠID XG åĪ ĩ Ġmy group Ġph p Ġph ys torch vision mc Cm keep ing Ġidx set ################################################################ ##### tests ocket ĠTh anks TYPE LESS win Width win Height Ġpi co feature d Pre c }" '. gress ive Ġscore board Ġì Ī Ġcmd class contain ed Ġvar args ĠMan y leg ends ĠSO AP ĠSO CK ĠSO CI rain bow ĠFile Path Rule Engine Ġsee ing áĥ ľ Ġelement o Per Line Per Primitive til ing lap lacian ĠCol ors OUT H SD N å¤ ľ !! ") chain er sched uling cost e Box Mesh cer tificates ĠLog s buffer ed ACT UAL tk n Ġtx s this Week Ġ---------------------------------------------------------------- - Met al Met atype ठ¬ Tag ged PORT S Ext end á» ķ á» Ĺ FR AMES Ġgr lex Ġcorrect ness ĠTo x zy f hat E seconds PerPoint SO UND :, . Server Status An other An neal Di vide Ġow ns Ġdebug ger Ġcommon ly Query Users Query Groups Query Uniprot à° Ł Source Code Ġdat atable Ġsort s pa inter Search T freq ghz Widget Item MIN US Ġë © Ġspace craft ĠAn imation Ġpop size Ñĥ б Ġmod ulus oto ols black listed Ġæ İ Ġæ £Ģ 004 07 SL M alf red bottom Most åº Ĺ mar ry tw ice ĠIP A SQL Alchemy Ġpr erequis CM ake ç» Ĩ ç» Ī created At Default Position cb c Ġbegin s ı m SA FE ĠTH L ĠAR M 192 8 orn ers SET UP ĠRequest Exception Ġnb rs mid point ĠUpdate View к ов /> ` Ġ'{} ', Ġ'{} {}'. topic Name band structure One of DD D Ġaccept ance And Dogs è® ¿éĹ® hot as Ġcost e TA U DEV NULL áº Ń balance Of poly line asci ic ĠMo on ĠColumn Expr Ġpl anner cour t HTTP Server Ġcar regamento 205 7 Ġtool box ä¸į æĺ¯ aj es Ġendpoint List 215 1 215 4 qt bot VC p ĠClient Session Ġretri eval RGB n Parse FromString ä¾ § Ġctsp Layer bra ce ĠEvent Settings čĊčĊčĊčĊ čĊč PN L ĠTra ding 193 6 193 7 ĠDate time ðŁĩ § çİ ī ctsp ConfigSgaclMapping 234 7 Ġpublic ations (', ')[ PA I Ġlinewidth s 264 5 Ġexpand user see also 217 2 232 9 Real loc Arg us ĠPh ysical Ġmag ma Ġgre eting 301 9 132 8 ĠModule Compliance Ġsy nthesis æķ°æį® éĽĨ Symbol Pair men ubar æĸĩ åŃĹ ĠMO V ('< @{}> Ġagg Reports ('[ ^ Encoder Policy Ġresid ues 299 7 follow s 315 5 HA VE saved ir visit ors 225 2 225 8 ko i Render Target trip let 212 1 Translation Bundles LT I prote ction 308 4 ĠInt ent 424 2 397 1 mx net 286 7 Ġcc j Ġcc rs Ġ"* ": Ġden ied Ġaz imuth Ġ---------------- --------------- cod able ĠBlock chain [] "," ĠQuery Privileges Ġí ħ 284 1 233 8 292 7 д ал ĠExtra cts 334 8 sock s ç§ ij é¡ » upy text VIS ION Ġer ro regular ized Ġelect odePlotWidth Convert ed Ġcy ber Ġcy thon Ġrepe ating lig ibility Mac OS Ġwatch ing Ġcri me ภ£ à¸ Ń dri ven Ġnotebook s tty USB /* ', Monitor ing Sampler Transformer ĠOper ational Fore ground ĠParse Error Ġcum sum XML Schema wire less ółĢ±ółĢ ¸ółģ¿ '[ ^ emo tion MED IUM gd rive ĠdocsLoadBal ChnPairs LAN DS ĠTry ing é¢ Ŀ prep end Ġsat ur ĠUN IT Ġvirtual env middle wares ðŁı´ółģ£ółģ ¤ółģ ðŁı´ółģ£ółģ ¨ółģ ðŁı´ółģ£ółģ ®ółĢ ĠIM AGES 298 2 NF KD ĠApi Exception Measure ments Lane No Ġtrust ed epe st Let BindingTerm Let BindingGTerm Lat ent Ġ#-------------------------------- --------- Avg Loc Ġgap ic WITH CHAINLOCK ż y ĠìĿ ¸ èª Ń music Directory AGC AGC TW O Ġ ° CHAT ID Ġfriend ship PACK AGES ĠLogin RequiredMixin ADMIN S bv dev ĠIntel ligence TI LE aren te Ġeg onet ðŁı´ółģ°ółģ ¥ółģ hal os ĠAdmin istr Ġamplitude s Ġqual ified Std out éļ Ķ reach ability ĠBit size Ġoct et Ġ#------------------------------------------------ --- ãģŁ ãĤģ Fetch ing efficient net slider Released ĠRot ate San ta associ ations mob i ĠPackage s 该 åŃĹ段 Audit Engine ĠWH AT ĠWH EN Ġalle les ав лÑı Ġban co ãĥª ãĤ¹ãĥĪ Health Check ALPH ABET ĠAre as ¹ółģ ¥ółģ ĠSpark Context Decoder Policy ĠCy thon æıIJ ä¾Ľ éĥ¨ åĪĨ ĠMc Gill SHORT ANS ilo meter çĪ ¶ epi log Ġcalib rated (',' ): Quantum Tape Ins ights heter o IDAT X Ġdestroy ed ĠTimeout Error èİĬ ä¸Ĭ ÐŁ ÑĢ Eff Var ÅĽ Äĩ æİĴ åĪĹ mst pX Ġreact ants Ġdut host RMS F å¿ħ é¡» pyg ments tsk dict ĠMigrate Command +---------------- -----------+ ĠXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXX Mad ison Elt wise ĠOff set ROT ATION %%%% %%%% influ ence ĠIndi cating ĠBootstrap Core extrapol ate Ġtit ulo ĠIo T æ¢ Ŀ Ġgir iniz ĠRich ard ĠDash board shant ins $$$$$$$$ $$$$$$$$ ^^^^^^^^^^^^^^^^ ^^^^^^^^^^^^^^^^ kine tics Operational Error 导 åĩº WHIT ELIST SUPER VISOR 9265 35 ĠGB OL Pay ments Ġaus pex ORGAN IZATION Smecti te Quad ratic ĠADDR ESS Tran Power receiv ers ĠEurope an ðŁı´ółģ¦ółģ ²ółģ èµĦ æĸĻ ĠDetail View EXECUT ABLE cels ius BUIL DS ĠStrict Version ĠMembers hip Decl Cmd ĠAggreg ate ĠMAT RIX 2497 8387 Ġdefect s åİĭ缩 åĮħ GEST URE Ġhuge ctr âĿ Į ancell ation åĺ į sciss ors DEPEND ENCIES Ġzer oth é¾ į ï½ ŀ Ġkullan ı ĠTex as Ġmols ysmt è¥ ¿ ĠAbri go Ñĥн к è´¦ åı· loadError Json RETRI ES subscri bers romiss o ĠDJ ANGO 1000001111 00011111111 Ġæı IJ æĿ± 京 Ġhaz Name Recv Power Ġvertica py dhcpSnpDb Stat Ġ+------------- +---------------------------+ ĠMOR NING NameTo Id Almost Equal Ġæ¨ ¡ BLOCKHEADERS WITHCHAINLOCK ĠAccord ing 0110101101100101 0101111 016292 24978387 intDiv Val ListIssue Templates PerPrimitive UnitCell mstpX st 01629224978387 3558 ' """ ' "{ ) '], ) $') ) $") - _ 2 107 3 024 3 117 3 133 4 173 5 21 6 0000 6 80 7 38 7 83 8 0000 8 2656 9 100 9 146 ? (\ A h A sh A IB A na A ov B urn C lo C our C CO C IB C apt C LEAR D an D pt E ste E igen F ac F act G AS H c H LL H flow H Num H TT H KEY I ED I OT I mag J G J j J t K Q K WARGS L eta L AMP M el M ats N LL N FT P atterns P refs P agination R ts R cd R PN S tra S ends S REQUEST S IBLE S WITCH T c T AR T PI T runc T runk U Qi V ap V ci V pi W m Y R Y e Z F Z Q [ +] ] ')) a U a as a im a ep a ov b P b fs b reed b unch b osity c ass c fa c ale d or d al d am d der d tr d rt e M e str e ther e ligible g ig g reg g fp g Rpc g Sfp h B h Q h R h ire h anced h EI h undred h renheit h ysds i O i R i ag j ay k z k ers k size k df l umi l relu m mi m vr m ountain n file n points n rb n vidia p val p ac p ens p bar p cluster p vc p lugs r G r ch s ct s op s ab s da s zz s lugs t E t put t value t weaks u pe u co v lines v center v ana v endors w M w N w U w is x link y proxy z ion z el z order | : } ]: ~ { Î ¾ Ñ ij à § â Ĥ â ħ â Ĩ ã Ħ è İ·å¾Ĺ ë ŀ ì ¸¡ ð ¨ ĉ čĊ Ċ ĊĠĠĠĠĠĠĠĠĊĠĠĠ Ġ ance Ġ čĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ Ñı Ġ 为 Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ Ãī Ġ åħ¨ Ġ çĤ¹åĩ» Ħ ภı Ļ ķ Į ĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠ er ical on Button at m at NameList re du re deem en p Ġt def Ġt ube Ġt issues de activate de limited le xe Ġi bm Ġ' --- ti o Ġc nf Ġp u Ġp ch Ġp and Ġp pp Ġp iles Ġp ágina Ġf em Ġf av Ġf avorite he me it rix Ġa pk Ġa pr lo la 00 55 ce c Ġs se Ġs ce Ġs ich Ġs ane Ġs mac Ġs cour Ġs naps ur q Ġin jection Ġre gs Ġre used Ġd ps Ġd sn un if un install un quote Ġm cast Ġe ur Ġe cc Ġe du () }" ", \ co uri co lare ri ers Ġb is Ġb cb Ġb lood Ġ1 065 Ġ# _ ed dl 11 97 11 28 um ar um ination int bv int elli Ġ( + Ġw aves ch ang ch lor ch anging te i te o ata b Ġ[ (- ma j ma v ma ima ma ya ol ink el ve is Valid is Opened get frame get boolean get Setting (' ` (' [-] (' =') )) >>>>>>> >>>>>>>> ("," )) Collect ing ĠVALID ATION fiber flat Ġalbum s ì² ´ enrich ment proton s cpwVcPerf Interval Ġinvent ed ĠINST ALL Reflection Pad Ġapproximate ly Ġзап ÑĢоÑģ 管çIJĨ åijĺ ĠDynam ixel lamb das ĠHist ogram IOHeavyTest In 个人 èµĦæĸĻ Ðł еÑģ åĩĢ æµģåħ¥ ĠVital ID Ġextr usion æ£Ģ æµĭ ĠMyCustomAmazonReview ACLDataLoader BET WEEN ĠFAIL URE Ġpyqt graph Ġmort ality paralle lism Ġmeme ber ĠFileSystem Loader ĠDiffer ential ĠAtt entiveFP ĠSoft max Piggyback MsgRx Piggyback MsgTx bir ds Ġpem file ĠRedirect View Ġarrange d docsLoadBalChgOver Status éĩĩ æł· puls ars LST MCell Ġbay Stack zhi hu ĠRobo tics ĠRandomized SearchCV ĠRand Augment Cats AndDogs ĠÑģп иÑģ ĠFran cisco æݧ åĪ¶ Ġsaf ely Dial ect Npu NumberFor bys hev ĠHEL P favor ites ĠPersist ent Above Elev SAV ED FRAG MENT Ġetr m Below Elev Monster Behavior éģį åİĨ CEE DED ORIT HM ĠKiki Pos SCY LLA 1100100010101111 100111 Ġ+------- +----------------+ ĠENT ITY озв ÑĢаÑī ĠrwMotor Torque ĠTERM IOS ĠisReverse Complementary Rmon Control --· --· isle mleri lograph ic ĠUQ py zyf lie Oneof Descriptor ï½ŀ ï½ŀ Ġbcb io ĠSCRE EN ĠSCY LLA addIndex Value ĠatLeast OneRequestDone FileCopyright Text ENSEMB LE NpuNumberFor Drop ! ? % ) ) _ + -------------------------------- , ))) - * . {}'. 1 923 2 096 2 124 3 168 3 103 3 137 3 106 3 119 3 112 3 162 4 103 4 146 4 156 4 235 4 139 5 81 7 82 7 60 8 6400 9 325 A FL A sia A APL A rena B b B ans B ins B sm C le C ant C US C PL C GI C ategor D j D ar D PI D CI D ASH D tlb E y E VEN F AC F AB F ids F lorida F ollower G m G el G ho G lob H oc H AD H ey I FACT I tlb J nt K d L uc L RS L ARGE L ittle M q M ars M illi N PT N Bo O VE P end P cs P LL P ressed P ae P otential R ID R AL R SFP R apid S ter S mo S ongs S LOW S Ãī S ensing T out T cp T ouch U ED U ndo V qt \ ( ] }. ] +'_ a ft b O b last b ial b ets b plus d gl e book e Source f val f acing h N h os i L i ap i fies i ÉĽ j ds j dk j dbc k S k ur k ps k var l val l ush l shift m set m tr m art m inter m angle m ush m fc n ch n col n pi n arr n asa o ve o vi o fa p U p de p ig p ong p jax q g q us r A r ut r ndr s dict s io t T t mpl t gz t instead u func u fe v H v at v rs v lad v iterbi w Q w ant w kt x V x h x ray y v y test z ef | ', } * } """ } (\ } '). ½ ij × ij â Ł¨ ç ĵ è ŀ é ¥ ê Ļ ì ħ ð ¤ ĉ Ċĉĉ Ċ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ quest Ġ ))) Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ ö Ġ æľĢ Ġ Ïĥ Ġ ä»İ in ch in fty or re on ia at tractor st in st uck st deriv en ic en ow Ġt test Ġt ink Ġt mx ar l ar able de fi de lt de coders de posits le gs le ading an cho Ġi loc Ġi cs Ġ' > ro se ti zer ti ous mp AdminString Ġc B Ġc up Ġc if Ġc ob Ġc cs Ġc rypt Ġc lears Ġc rops Ġc AddrBits Ġp name Ġp am Ġp par Ġp ump Ġp erspective Ġp aginated Ġf u Ġf ul Ġf ingers Ġ" ', Ġ" (% Ġa ic 00 24 ge ology Ġn j Ġn ation Ġn df Ġn row Ġn vars Ġn itro Ġs ul Ġs lab Ġs lc Ġin ch Ġin ic Ġin finity Ġre ti Ġre da Ġre levance sel inux self Test ing o Ġo vs Ġo obR Ġd T Ġd ones un as un publish un seen ra sp Ġe gress Ġe qs la c la red () `. fi fty ent ree co se co ustic Ġb ml Ġb ps Ġb orn Ġb road Ġb orders Ġb illing Ġb ombs 11 99 11 17 Ġ( :: Ġw gs ch air te ta te kit ma a Ġfor am is wap is atty val e get Element (' ---------------- (' {}. )) *( set mode set Current Ġ- * ĠT f ĠT x ĠT isserand con tr Ġ2 64 Ġ2 97 Ġ2 75 Ġ2 82 Ġ2 59 arg er ve led ve locidade Ġis r Ġis lice Ġ7 84 Ġ7 50 ĠS on ĠS py ĠS uc ĠS IDE ĠC SR Ġg name Ġg file Ġg lu Ġg ates Ġg mtime Ġl una end ent end Of data frames data sources ĠA mb ĠA LI ĠA FT ĠA SS ĠA waitable 01 32 01 94 01 35 01 65 Ġcon sent ic mp 99 00 99 92 99 75 path o ĠF OLD od on qu ench log log list e Ġh u po b ta cc ĠP G ĠP norm ĠP ants ĠP mod ĠP ink ĠP anel ĠP SL ĠP oker Ġas yn ĠI IS ĠL OS res on Ġth ermo Ġst p Ġst ator Ġst eward Ġde sp Ġde vs est he ex clusions im ming Ġ3 36 10 55 10 63 ĠD ry Ġu ic Ġu fl sh u sh all ĠM ID ĠM ich ĠM DS ĠM atches ĠM ah ĠM usic ĠM aps key code key press Ġv ap Ġ_ | Ġ* ' Ġ* \ os u Ġse gs Ġse ja test set Ċĉĉ Ġ ER IAL Ġel m Ġel ite ms k ms vc tra c Ġfile List py n py dicom py bedtools pre order pre sets pre proc ls l 07 87 07 26 label Slider ES SED Ċĉ ĠĠ ĠB K ĠB S ĠB an ĠB ra ĠB ed ĠB ET ĠB ug ĠB rand ĠB undle 12 16 12 15 12 64 ĠE PAN Ġj est Ġj ew Ġ< > ly de AT ATT xa xes ĠN x ĠN ut ĠN ight ĠN EC ĠN inja ĠN evada num Pixels ################ #### Ġres i Ġ4 08 Ġ4 20 ff o lu de lu tion col ha col lie In fin In vest append left ĠR am ĠR MSE Ġun load Ġun do 32 05 32 03 32 85 32 56 32 768 per plexity oc aml ĠG W ĠG f ĠG el ĠG lob ces o Ġco o Ġco digo Ġon set ĠW al ĠW riter ĠW ALL ĠW CS ĠW omen ĠV endor ĠU ART code point Ġ5 53 ib e Ġen gines 18 01 18 85 18 44 18 69 16 66 16 54 sa uce da veo '), ' Ġk inds Ġk ills 25 07 25 27 25 94 25 68 25 41 (): . Ġ6 000 13 04 13 75 og rad og LeNet 06 97 lif x ec tiv ass ador Ġch mod ĠĠĠĠĠĠ ĊĠĠĠ 17 06 17 08 17 36 93 55 14 11 14 17 14 40 ne u ok es Ġra z Ġra ys ou lomb gra fana :// ', RE POSITORY Ġtra cing Ġtra bal 08 05 ðŁ ¦ 22 29 22 62 Ġ\ ____ ĠH ack ĠH over ĠH ADOOP ĠRe member ĠRe presentation ĠRe curring sub directories ml vq Ġsh ap db i 88 44 19 08 19 79 comp ilation comp eti Ġsc ls Ġsc enes Ġ` -- 34 84 34 45 34 83 34 68 pos dis 09 06 nd ctl inter conv ant in gs E bin list arch itectures Ġax i Ġconfig uring 24 04 24 84 24 96 24 55 24 26 24 52 37 46 37 43 37 69 Pro x Pro ceed em ulator Ġsub module Ġsub system rep orted Ġcomp ass ĠCon an 94 98 33 13 33 37 33 56 33 54 DE AD RO WS av o av is no data AL LE Ġclass method Data Class AS Rs {} * 36 99 36 64 36 36 36 76 36 79 011 000000 Ġopen mc ĠK M return List word tag 86 92 stra ction 26 12 26 13 26 38 26 31 26 59 26 62 Ġmax v Ġmax size Ġmax lon Ġmax Version 57 93 57 64 57 37 Ġext er ED X Ġper plexity group dict ele e ele phant Text Stim 23 54 23 59 AC CC AC Rs Ġli p 44 11 44 15 44 09 44 62 44 72 IM O Ġdis connected 80 92 cor relations Ġrun times ']) ), En forcement 28 19 28 38 28 35 28 29 ET ASK so v cal cular 56 93 98 64 38 14 my db pop ularity ******** ** Ac tiv Ac cessed Ac quisition UR S UR ANCE ĠQ SFP ĠQ ubit ĠQ LineEdit Ġcolor Space 35 17 AB L AB ORT AB OUT olu ção Descri be Value Suggestions pri vileges ))) / Ġad m Ġcurrent ID Ġcurrent Time 45 47 45 29 ĠAN ION ĠAN SIBLE Ġarg us Ġbase ball ong ue ]] = core g command er top obank Ġsk f Ġone hot Ch icago }) ; Sg acls host ed 46 97 ĠJ ar ĠJ SD Log Trx Num Samplers Num ClassInstances ome d Ġdire cao assert Command Un recognized Ġq i Ġq q TH READ tag Name TR ICT TR UNC ost ream Config Value Config Dict Config Ipv sign alling graph Types MP NN Ġup grate Ġcor related Ġcor rupted ĠPro c CL ib search ing sv ps Ġqu ando Ġimg w Ġimg ui ĠData Generator ze isel TT A TT S ('-- -') iss ame Ġfull name Ġwork dir post code cli ques parent dir Get NumberOf Get EstimatedTransactionFee game events rect angles Add NodeOptions 31 92 src dir mer id Key Suggestions Ġobj eto vector ize ĠCo ordinate Form Set OL ane edge pair Ġab ri ART IFACT Ġfield name Out line Reg istro Ġlocal time Ġsign s ãĤ ¨ Ġdest e Ġdest file Ġ16 00 Ġbin ar User Data User Warning Ġman ila âĢį ðŁĶ ĠDe mand pen di ĠRes olver Th erm PL N Ġblock devs ĠUser Serializer If Not Up loaded Sh op Sh adingEngine xml ns fra ctions ĊĊĊĊ ĊĊĊĊĊ dot ControlConfig 49 64 DB lob sim o 202 9 }\ ' binary Object Ġfont properties 300 9 åĪ Ŀ Ġtri vial ĠjnxMbgSgw DelBr ĠjnxMbgSgw ModBr gg Number App Config App roved TE CH era ise Ad dition Ñģ Ñĭл inst agram az a hed Types ':' ', For Question Ġref dict Ġref lected PR F Ġret orno ä» Ģ Net V Net Lemmatizer Pre ferences Ġpost ag GR Q ç amento Ġfin Dummy Result Status sig y dat atable dat aloaders dat aroot LOG FILE Ġ// = Ġì ² Ġsql model light bus gb ncc GB P Ġcluster Id Ġvar name ]+ )? sen ior FILE PATH supp lies Ġsee also Ġstat istical br ute Ġauthor ize Or tho dx i Ġvi olin Ġresp rocessing ĠComp uted ĠComp arison imp ropTors "} ') SON ATA xbb v Load Q cf Query Ġest i none xistent Ġsuper cell vers ation ,\ ; ĠTime slot cla de mk ccj Ġold Map !! !") ĠPo inter ĠPo lice FIG URE normal ise å® Ł neg ated js ch MM M Do ing vol ving region al Method Type cr ust zy x Ġcore g Ġsig s ĠAt tack Min us Ġtr j istri bution Char ges ĠAl m ĠAl ter Source Sgt ii i Ġreq parse elect ra Ġfast q bi li å° ģ freq Arr è¡ Ĩ ĠAd aptive initial ise Version s Ġ'+ ': SP ACING Ġcoun ties Ġreal path Stream er Stream Encryption Ġmod ulo ĠTrans late Ġfill er ev in Ġfeed ing Ġconv olve Ġactual result SL Z 404 1 ĠOpen ing Ġxml rpc Classifier Inner agg io Ġbit coin âĢįâ ļ mis matches Ġstats d 9218108 169 192 9 ĠField Handler Layer Name Ġnb format MAN AGE Ge orge )" /> And Time plan ets namespace d COMP RESS Page d Ạ§ Ạ« Ag ents Ġeps ilons found ation sy mp sy scall Ġcommit ted ĠLight ning æį Ł ĠDi amond Ġп олÑĥÑĩ Pass port Ġri f Ġtool kit ä¸į åĪ° ĠjnxMbgSgwPP DelBr ĠjnxMbgSgwPP ModBr ĠjnxMbgSgwIf DelBr ĠjnxMbgSgwIf ModBr lm n 215 3 tar iff orizont ally Ġmarker facecolor Ġbar rier 384 8 å¯ ¨ |' # security hub ĠAss uming Track bar Rel Model Thread PoolExecutor Ġdot ted Ġmaster Inventory ĠResponse s Ġè °ĥ Ġvertex Id Sign er positive Rate 214 9 ĠLabel s Ġbook ing Ġev ds Ġ27 017 LED GER 234 6 Ġtermin ating Role Method ENS ORS walk ing 218 2 Ġna Test Ġps mooth Ġpla so floor div plus plus publish ing 232 2 Sec ure 301 4 OEO Cfg OEO Loopback OEO CurSpdMode Last Update Ġsyn onym Ġsyn onyms 114 9209 Ġem cc deg F Ġsur faces ĠWith in hw nd begin ning micro phone syn opsis ("[ +] Ġ{: > fb k 207 3 299 1 Ġcapt uring 306 8 306 2445 ĠDoc s 305 9 dw ell nav bar ye ast Translation ValueSuggestions Translation KeySuggestions corr coef ste ering front al benchmark ing Debug LogLevel EY j Ġrefer encing 286 9 Connect ing Sgacl GenId APP LI Ġ'* ': Ġaz ul Ġaz py Ġam ber pdb x Ġann ulus Ġ105 7 hold ings ĠØ ³ 307 7 233 3 revision s Ġâ Ĥ¬ 236 1 ĠResource NotFound Ġfbx Anim minor ticks Entity Schema Tk Agg Store Q ółĢ² ółĢ±ółģ¿ Expr Context Drop Pkts pay er Hub ble п ÑĢав REF s tv db 436 3 436 5 Constant Buffers 388 5 ĠBack hand 237 2 Ġlab or THRES HOL Ġactor s attack ed TX LOS 385 3 aux iliary omin atim 396 5 voltage s ãĥ¼ ãĤ¸ fm arno ภģ cha os manual Seed El Right Monitor Pkts EVENT S ĠStorage Profile bro oklyn ö nn ĠOper ations repe titions CUR ITÃī deep lab RAN CH Ġinterp QLF ĠdocsLoadBal Policy QQ w ("_ ", 314 9 Ġgain ed 285 6 Ġ################ # Ġtun ed Dest Sgt WC z ĠBoolean Field çİĭ éĥ½ Hash able four ier anim ate Ġmarkdown s âĢįðŁij¨ðŁı » âĢįðŁij¨ðŁı ¼ âĢįðŁij¨ðŁı ½ âĢįðŁij¨ðŁı ¾ âĢįðŁij¨ðŁı ¿ âĢįðŁij©ðŁı » âĢįðŁij©ðŁı ¼ âĢįðŁij©ðŁı ½ âĢįðŁij©ðŁı ¾ âĢįðŁij©ðŁı ¿ Login Status expl ored AW SCloud TRUST EE LM Head Ġsil ly ĠVis ualiz heap List æ® ¿ ĠRest aurant ðŁı´ółģ¡ółģ ²ółģ Close st CONTAIN ERS Joint State ĠIdenti fy 968 3895 Hyper parameter >[ < dX V Ġta iga Ġ#---------------------------------------------------------------- -------------- åİ» äºĨ éĸ ¢ Face book food s ĠCho ices )}) " tele metry ë¥ ł ç»ĵ æĿŁ /{}/ ". /{}/ {}/ Signal Array apple seed ĠPOST GRES jI y Fit ted fq dn ĠImp rove ĠEmpty Page Person al Experiment al Gradient BoostingClassifier Ġmovie py TRANS FER 99999999 999 MV OC ĠCir cular Ġcas o Ġspo iler Ġ+' _ instr s priv acy ç¨ĭ åºı ØŃ ÙĬ ĠURI Ref REGI STRATION Ġima ging Ġreplic ate quick en ticket s datal ist ANAL YTICS SOL ID Combin ations æĿ¥ å¾Ģ uss ian Ġclicked Pos ĠHandle s éĤ£ éĩĮ Scope s å¢ ĥ Å¡ no FX LOS mil lis åIJij éĩı ðIJ IJ strat um Ġhdr dict ounce ment OE OS OE OLane ç² ¾ Ġwiki pedia ³³ ³³³ ativ ity Confirm ation stan za foot print osc illator ASSI STANT Ġreceiv ers ĠSele ctor ĠSele cted Ġcontrast CH Ġconven ient 认 è¯ģ Clip board Ġ================================================= =============== Ġcarry ing â n åĸ Ŀ ĠHelp Panel laci ón ĠHar vard Ġhor ovod ĠArti fact ĠMP NN Ġbc value ĠElect ron ĠBin omial ðŁı´ółģ¥ółģ £ółģ uÉĻ j Ġê² ĥ Ġcnbtc TradeQue Ġcool neighbor Swap Chain PRIOR ITIZE Ġorbit al WI KI ĠPRE FIX ĠPress ure Ġjoined List ("| ") æĥħ åĨµ defer red reh end Ġnonzero x ìĦ± ê³± Ten ant Æ°á» £ dee med 绣 计 GPL v ĠHead ers FileSystem Loader cone ct ĠRET URN æķĻ éłŃ Ġprot otype convers ations tR NS ĠXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXX ĠDimension s íĻ ĺ CAS CADE accs fp MOUSE BUTTON PLAN ET Ġconti guous ĠMON GO ĠAssoci ating Ġinfra structure Ġtit an Ġill uminant ĠDiag nostics OEOHW Loopback OEOHW SpdMode bread cr deno ised ĠDIST INCT Ġmess aging Dih At Dih HAt ĠOPT IONS Ġsequ ana ĠWrap ped Ġзап иÑģ çĦ¶ åIJİ MID I Ġnex infosys ĠMagic DAQ ĠCommit ment ⣩ ⣨ ĠfuniIf Conf Ġdigital io ĠPublish er íĥ ľ æ£Ģ æŁ¥ Ham iltonian å±ħæ°ij æĿ¥å¾Ģ Ġincid ents Ġrela xed Ġmarg inal Ġinvest igate Ġdra gon ĠMul an ntw Type ĠScra pe Bed Tool sie ves Ġtemper atura conflict ing ĠUsu ally Ġseper ated Ġlibt bx âĢĶâĢĶâĢĶâĢĶâĢĶâĢĶâĢĶâĢĶ âĢĶâĢĶâĢĶâĢĶâĢĶâĢĶâĢĶâĢĶ uproject s Ġdiscri minant wing Lib withColumn Renamed qwe qwe STE WARD ĠíĮ Į Ġant lr Numeric PasswordValidator ĠWiki pedia Similarity Validator Cod ing SLA VE decon z Ġsau v VCV S éİ Ĺ Ġcó digo Ġfancy box æĬ¤çħ§ 个人èµĦæĸĻ pez oid getApp ointment ĠAmp litude bnf Suffix ĠprivateKey Selection ĠMultip ly Ġvic tim Incentive Proposal Ġê¸ ° ĠLANG U Ġrab bit ĠEXEC UTION ĠNAMES PACE Entrypoint Options ;^{ ;^{ Gest ure ĠMyResource Group Ġamend ment éĢļè¡Į è¯ģ åł´ åIJĪ çĹ ħ Ġ*| ", åķŁ çĶ¨ Gro File Relevant Status ĠæĽ ´ Cyber CP Ġíķ© ìĦ±ê³± Ġbary centric Ġalla uth LISTPOMERIUMSESSIONS REQUEST Gromacs GroFile anç as Ġminter ms cmdLine Vars bige vents Ġæµ ĭ Opa que ĠUrn en KUR AI ĠElem wise Unordered Access ĠSOCI ALE 00407 3062445 82656 1149209 couri er UserAttribute SimilarityValidator Locus Filters Ġbelon ging ĠLEAR NING 00000010011111111011 000 Fids InList SÃī CURITÃī ĠEPAN OS daveo ù ForQuestion Answering OEOCfg SpdMode AWSCloud Formation æĬ¤çħ§ä¸ªäººèµĦæĸĻ 页 004073062445 9683895 826561149209 74 " [\ # ; # ************************************************ ' {" , }) . ]]) . '+ . `", / (\ / >< 2 256 2 888 2 109 3 033 3 114 3 116 3 161 4 002 4 168 5 90 8 999 9 097 : {}: > ))> >" UN IMPLEMENTED }) { Ġar ms 46 15 46 98 ĠJ une Num Val options Form source forge ĠSt ores ail er open moc assert False Ġformat ters Un til Ob servations Config Group Config ura 29 32 29 09 Ġ`` . Time slot Time Step 43 02 bot ocore ĠCON STANT Ġup d ĠPro site ĠPro mpt CL US INT X SI E Ġmatch ers down cast 91 92 No Such ãģ Ĭ MA INT е Ñĩ idd ens ten nis Ġwork tree "> % post ings Ġexp ensive Get Name Get PomeriumSession game Node UM ENTS xy file (- \ 39 08 Ġbreak ing Ġ", ") bar o bar plot conf ounds conf ined aw esome anti s cv l Ġfind ings dis co dis sever LI P Comp et send Request Le et 58 02 ART S pr incip ĠTest Run ãĤ ´ Ġbot tleneck User Time Ġman im SS SS ĠDe ad ĠDe gree Ġexec utes View Data View port åı ¤ ãĥ ¢ ĠPython Operator unit ary ĠUser Mixin Up loader ank a IP ython +' -'+ PRO M 202 4 Request Context Request Warning Ġoptim iser IO MIT Ġmy func Ġsim bo make element gg plot Qu otes Qu antos ################################################################ #### ################################################################ ####### App lications =[' -- ĠCh i Ġmark ing optim iser Ad ditive lack py az ine tax id feature list ĠMe V VE C }" ' }" } Ġ$ " ĠBase TestCase ĠMan ual tt t ĠAdd resses åħ į Ġparti das Ġign ite Or More Ġopt parser ĠCol lector Ġpe la multi line single band POST S mk stemp ĠTe mplates ret ro loop back vari ability Mo on seg u Output File ĠLI R custom ize ĠEX AMPLE Ġwait er prop ag Map Entry Ġtx id success fully Ġglob ally æĺ ł ठ® Ġpad s ĠAc counts Ġunique s á» Ł FR ONT Ph s Ph enotype cr h ĠDefault Router 0001 01111 Total Sim Protocol Error SO LE Ġhash ing Min imap Ġconnect ors Struct ured ropo lis Ġast ute Ġast node Ġdat adict Graph QL CHE BI ĠSh ift ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ SP OT car la Over flow high way PRE CISION prev dir 004 1666667 åĽ ī boot loader ĠQu at Red shift Ġ"{ (' Ġ? ", mis matched pn l åį ł Property ParamRegistry EC P å¾ ® Sa hana 192 4 Ġmost re ------------------------------------------------ ------ éĩ Ĭ Open AL Ġcat an cid rs Ġ'{} _{}'. safe string Ge ometric Ge orgia dy lib plan ar inv olve 916 8 COMP UTE Ạ¹ Ạ» ĠMo vie ĠMo zilla %% ' ################################################ # ĠColumn Transformer Ġfetch er OM IT ĠText ualConvention Ne utron 205 1 numer ics Ġpresent ation Dec rypt rup ts ĠIniti ate ĠRo ad Parameter ised Plot SnapList }] ' }] ") ĠDec ision ĠConst Tree Ġexport s Ġexport ing IV O 384 4 Mod Sec nc bi 211 6 regex es equ alize reat he ĠTra kt Ġupper bound ä¹ ĺ ä¹ Ŀ buy ing Bl k Cmd Status Ġè ½ 193 3 193 4 Change Form NAM RES 234 9 Ġeven ly è¡Į æķ° Ġstatic method Serializer Mixin Stat uses 218 8 Fin ance 206 7 206 8 Ġmenu Text 297 9 appro ach dog park Stop ped Ġ--- " bp f Symbol Context Ġsur vi ĠParameter Name âŀ ŀ Left HoppableLocList ĠWeb hook AE P ../../ ../ NET LINK Ġprovider Lines Ùħ ÙĨ ARG UMENT BY L 306 9 ko on 305 6 305 7 nav igate ------------- ") SUB MISSION Email User UK h Linear SVC Cor elli mas ke ĠInt Var 424 0 LIN UX Ġsv d ðŁı´ółģŃółģ ¥ Api Exception 287 6 MR R ĠØ ® Auto ML ÛĮ ا 233 1 Ġorgan isation 406 9 ĠMain Engine 422 2 Ġdic cion uel le å¸ Ĥ executable s ĠSign ed macro state 426 9 303 9 Ġк аж 385 9 CREATE CONTAINERMESSAGE mal loc ан и ĠCA ST ĠBar ry ðŁı´ółģ´ółģ ¤ółģ HOME ASSISTANT Product s ĠFilter ed ãĥ¼ ãĥĪ ĠMem Box 386 1 occ ure dj f Ġmail box ĠSci py ?? ? Day light ĠLin ks Fo od Fo oter Qos MIB gap ic Ġretain ed Ġsoft tabstop verti ble ółĢ±ółĢ ·ółģ¿ deep ct adi abatic opp ortunity Ġ-------------------------------- ------------ Ġpartition ed ÑĨ иÑı Ġones ided Ġregist rados çķ ª Ġ56 24 Ġpm ids Ġwater fall perf ect Ġrl lab 285 2 Ġ################ ############ ĠBu y ĠSw ift Make file çİĭ åĽĽ Ġи м SIM ILARITY ĠDep loyment Ġincrease d Ġnav igate 302 8 Ġsan itized Equ il prun ed SPE ECH ĠPR INT ĠEngine Client expl ores Ġuniform ly ĠAP IT Ġ104 0 phot ometry **************************************************************** **************** ĠProduct s Ġcd na æı Ĵ Cir cular Ġqt py ships Api Ġvertical alignment restri ctions Click House morph o Ġhuman ize ='% . Ġtran sect Ġexecutable s íķĺ 기 Ġ================= ======= Ġincrement ed GRAY SCALE 438 3 Package s Ġìł Ħ Ġcare ful ĠAbstract User ĠTransl ator ал ÑĮ cro uch ε ι ĠInte gral å®ŀ ä¾ĭ autom ator MAT ERIAL Ġpys at Ġpay ments TRANS FORM éĺ ĪåĢ¼ Star shipsApi Ġcommunic ate stub ber Ġlongitude s ĠUnicode DecodeError campaign s Ġlot s ĠClean ing ĠSM OTE 缸 åIJĮ ĠSchedule d ELL OW Ġreach able Hist os ın ız ĠLearning Rate æĮĩ 令 éĽĨ åIJĪ ĠPub Med conver ge ĠJan uary Commit ment Ġhouse hold æ¯ı 次 Aut omatic ĠAli as éĤ£ å¾ĮçĶŁ lk ml recomm end POOL ING Ġrepeated ly ÏĦ α MATCH ES .+ ? integr ity ĠPop ulate ï¼ģ ') Fl ush ĠSeri alize nic ity ĠSun day Ter ms Ġíķ ¨ Sat uration Ġdeci ded 交 æĺĵ ÑĢа ÑĦ Tor rent ĠSC ORE FileType Code çŃī å¾ħ çĪ ¬ ambig uous ĠArti ficial ĠElect rical æ¶ ² Ġmirror ed sear ches Ġoccup ants Ġinteract ing Ġlic ence heter odyne Backup Info Ġsector s Ġvary ing fine x Ġsus pend domin ated åĪ© äºļ Ġproportion al Ġpert urbation ĠPER FORMANCE aio http Ten cent Ġо Ñĩ implicit ly ssim ilarity Ġresample d Ġegg BB Leg acy ĠJS Class iner tia Through put paint Result Ada pt Tape Sites Ġyolo v unte ers REPLACE OPTIONS Ġrear range ĠMal ware ĠMON TH ĠAssoci ated Ġgm sh //////////////////////////////// //////////////////////////////// Ġwik ilink ĠIMPORT S ĠIMPORT ANT Ġimb learn Life Cycle éĤ® ç®± Simp lify Ġunders cores refine ment pager ank Altern atives VERT ICAL Identi fication é¢ij çİĩ Expect ing Foot Control Ġrobo tide Transl ator mne monic flood Reason Caps ule ĠPixel StarshipsApi Ġcrow dsource Visu alization Ġ解 åİĭ Dri ven Guid er TICK ET ĠAdv anced Ġhypot heses Ġvit rage Ġë¶ Ħ Ġlibt cod krb cred entro pi ĠWik idata comput ational sth rough Ġhou ses ĠÑĩиÑģл о Ġú lti Ġfram erate ifn def Ġhydro gen categor ized lou is Ġnov amente Pretty Printer Ban ana Ġstones oup áĥ£áĥ ļ ĠEmp loyee Ġdiver ged ä¼ĺ åĮĸ Ġatri bu bake Directory Ġcaracter es ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ ~~~~~~~~~~~~~~ Grey Scale Tod ay Ġspars ity ("================================ =========") ĠCONTRO LLER Ġæīĵ åį° è¸ ¢ ĠìĺĪ 측 æ¤ ľ 5683 1817 NacAppliance MIB ="-- ", Ġdai lies ĠDispatch er Projec tile destri an Ġmanti ssa ĠPreprint View ĠGnu Painter generalTracks L rackspace cloud ubly Robust Ġæ· »åĬł ĠSongrequest Queue Ġë¶Ģ ë¶Ħ IMe ssages Hopping Rate Ġeffec tively PADD ING redb lackpy ĠOperational Error drt Time maima i Ġmovet obin éĢĢ åĩº ĠAFT ER DataClass DictMixin ĠQubit Operator ĠLANGU AGE IFIX C ISYM DU ListPomeriumService Accounts " `` ) ")) * } + =" + )", , :]. - ']. - %( / '): 3 128 3 022 3 124 3 345 4 175 4 102 4 118 4 136 4 196 4 155 4 375 4 161 6 31 8 30 9 126 : "): ; ; = $( ? < @ [ A bc B SE B ug B ONE B ubble B IDDEN B mV C it C CL C CA C hess C ounty C ACHES C orners D LL D FA D CAPS E CC E Qi E fficient E lasticsearch E EXIST F UT F usion F inger G RI G affer H INE H dr H emi H inge I b I ss J L J BIJ L abs L HK M ob M ERCHANTABILITY M arc N IL P AL P ear R AY R DK R ANGES S b S helter T l T ac U W U rban V ac V DI V END V oo W HE X U X b Y B Z P _ < a hat a Images a via a vier b org c def c name c nx d vid d cer d On f ut f url f ef f sw g lu g ql g auge h J h air h ui h rm h orn i op j N j our k X k ka k ali l da m Q n lat o eo p ck p ype p allet p onder r hel r fft s ok s Type s net t M t am t ally t reen t reat t ango u M u ale v W v dir v hash v nf w nd x en x ing y elp z L z pos | _ | --- } '\ ¢ ħ ± оÑĤ ¿ ½ à ĸ È Ľ Ï Į Ö ¼'), Ú Ĩ ð ł Ċ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ ents Ġ ESC Ġ čĊĉ Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ ############### Ġ ç»Ļ Ĵ Ģ ĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠ ĊĠ in j in id in volved in finity in spector in dependence er ow er vice er tions or na at rix re tail re loader re voke re levance en vi en cial Ġt fo Ġt ors Ġt amb Ġt asmota ar quivo al ian al phab al arms le ds Ġi row Ġi sso -- \ Ġ' ### Ġ' )\ Ġ' >' Ġ' =', Ġ' ?', ro of mp qa Ġc fn Ġc opts Ġc igar Ġp ue Ġp int Ġp set Ġp num Ġp gs Ġp tree Ġp rs Ġp loidy Ġf k Ġf ol Ġf ts Ġf parser Ġ" ...", Ġ" {\" it en it cho Ġa mi Ġa iplatform lo o 00 85 00 97 00 89 ge of ge ographic ort el ce pth Ġn im Ġn oun Ġn arr Ġn samp Ġs dp Ġs inger Ġs lixmpp Ġs leepy ss ors Ġin lined Ġin venio Ġre in Ġre index Ġre loading Ġre ordered Ġre places Ġo me Ġo grid Ġd E Ġd ow Ġd cor Ġd du Ġd ado Ġd uplic un u Ġm ongodb ra h ra der Ġe ep Ġe book () ][' ad ditions ", ), Ġthe tas Ġb one Ġb ic Ġb sc Ġb os Ġb fs 11 57 rom s um it um ina Ġw it Ġw dir Ġw env Ġw rapping ch isq te a te ss di ll and ro and um ma ked ma ko ma intain ol ine ol dest ': ( ĊĊ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ get url get Position get members (' ## (' {" (' {}'. set var set ResultStatus ĠT u ĠT ranspose th in us o Ġ2 89 Ġ2 41 ers hip pp i pp in as dict as any as ibility et V et os et cd ve p ve ga ĠS he ĠS qu ĠS tim ĠS PL ĠS QU ĠS trip ĠS igma ĠS incronização ab und ĠC AT ĠC rop ĠC ATEG Ġg z Ġg ol for cing for warded end Point data Dir ĠA ux ĠA SM sp ots ver ses ver ilog 01 09 01 77 ic n to ok to Ordinal to REFs ĠF re ĠF lu ĠF SM ĠF isher ĠF rance sc or log a list Pieces Ġh air Ġh dfs ** ") ĠP AN ĠP PO ĠP ratio ĠP ERSON Ġas sessment Ġas sembler ĠI con file Id file Dir ĠL S ĠL ET Ġth readed Ġst ands Ġde compress Ġde lays pro ven im in im sd im ulator Ġex cl Ġ3 97 Ġ3 78 Ġ3 51 10 77 out lets ow r ĠD ET ac id ac cording Ġu k Ġu gly Re moves sh adingEngine sh strtab Ġdata File ĠM M ĠM es ĠM age ĠM ic ĠM ary ĠM APE ĠM RIO nt rack time Period ĠNone Type if o =" @ Ġv ous Ġv sphere Ġv álido Ġ_ / Ġy Max Ġx n Ġx link Ġx Jog Ġma e Ġma int que da test e add Callback xe p .. >> ms i Ġ% > ON NX tra iler Ġfile handle our ite xc df pre parate pre amble ap cat ap tic ap ages Ċĉ ĠĠĠĠ ĠB ell ĠB ayes ĠB unny 12 97 Ġname Split ĠE th ĠE Client ĠE ye ly t ĠN im ĠN ick bo go Ġ4 18 Ġ4 06 Ġ4 65 Ġ4 63 ff tw Ġget Data In MsgName ep oll Ġun mask Ġun linked Ġun recognized OR ICAL Ġlog like Ġlog normal Ġlog istic 32 00 32 07 32 14 32 24 32 33 32 66 32 67 ph ia ĠG G ĠG ran ĠG uid ĠG ym ĠG Polygon Ġco gn Ġon s ĠW il ĠW ashington tri l tri s tri tion tri ang ho ma Ġout ros ĠV ID ĠV OL ĠV oter ĠU l print out Ġ5 04 mb ros ib G Ġan nounce Ġtime slots 18 78 18 53 18 68 16 93 ft c sa w cur dir cur rencies Ġk ur 25 03 Ġpy c Ġpy py http log 04 35 13 35 13 52 13 63 06 12 06 35 06 65 ST RI max iter ass ist 03 06 03 66 ]. ') ip ype 17 97 17 74 Ġal uno 93 64 ok E Ġby pass base Path gra u gra pe count ing Ġtra des 22 91 Ġ\ \" ĠH it ĠH IGH ĠRe actor ĠRe ceiver np a eri alizer ][ ( mat text sk m db a db e db ref 88 03 comp utes Ġsc f 34 07 34 75 34 28 34 46 start date 09 00 84 57 nd Connector inter fer bin file shape d ann os 24 14 24 83 37 01 37 29 37 51 Ġpo em Ġsub script Ġsub tracted 96 64 96 84 96 56 96 67 Ġall close 55 44 [: ], Ġcur tain Ġ} }' 33 04 33 69 DE PS json l json s row ning 87 55 87 87 AL WAYS '. " Ġsys root 85 67 85 76 97 08 97 66 back prop net run 36 29 36 68 cted Graph Ġopen cv Ġopen procurement ĠK ill 95 12 95 92 Ġnumber ing Ġnumber ed word press cri me 00000000 001 00000000 00000 86 85 86 56 26 82 26 51 Ġmax iter Ġz tp Ġz max Ġz mat Ġz ha Ġjson Mode string Value Ġtrain s 57 36 57 75 Ġ[' ',' Ġtf ds Res Type number ed ix y Ġbo a Ġne arly Ġne ptune List Of List Containers man de 44 22 44 95 44 23 44 45 44 79 44 68 IM A object Id RI L RI ER Ġend ere Ex plainer ET YPE var name cal endars 98 92 FI FO obj attr Ġ(' {} Me chanism Se a Ġcan al 35 08 35 85 AB c Col lapse AD DED nn x 45 13 45 87 45 66 45 82 45 42 amp ire cent rations the matic the ftalarm ĠY UV Ġspeci alized cc a initi alizing [:, :] Ġpos X pert ure cy to Set Color Set Element ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Test case Ġevent Queue Ġone gov IB M Ġag ency wh y ai able ai ida UN ARY UN IX UN SIGNED close ness rt l 82 06 PE ER Log o ome stic ĠSt one ĠSt ory open gl root path Un available pk a Ġq rl TH EN UL ATED To Image To urnament ĠPy Query CON SOLE field name field label field entry sign in 29 86 Ġ`` [ 43 14 43 37 show warning Ġitem id Ġcontin uar ins ula 48 03 ðŁı´ółģ ¹ółģ¥ółģ ĠData sets ĠData Pipeline 42 99 42 93 42 86 Ġright x Ġpri vilege Ġpri pis DAT ETIME Ġfig SM ĠÐ Ŀ Ġinst ant Max wellCC post eriors Ġexp lo Get X Get Size 39 12 39 16 39 19 Ġover time bar rage bl ing limit ers (\ " "][" $ ui automator she ar Ġframe Dir Dict Cursor cmd sh tick length MO W ĠCo verage less ness ĠTO pt Ġshape let Response s first Iteration PP ING edge width Ġsupp ression 58 36 Ser vicer gr upo Out Dir ãĤ ± ãĤ ½ Ġ16 000 User Id User Form Ġallow able CA Q CA UTION Ġdep set åı ī åı Į qui ver cell ent QU OT ba a DB A URL Y 0100 1011 (* _ (* (), Ġtri ang Tx n Ġleft x Ġsearch er dec ls medi ated dt t Ġwhere as 256 1 ĠCh urch ĠImage Name Py charm ĠSim ulated sort Expr Ġnon response FL ASH ĠLo aded vm V active View drop block Ġge opy Pre trained DS N ------- ") VER DI Ġmem ó dat an ĠZ urich non lin Dis placement ]+ ", real time Check out xde sc br ing Function Type Lib s display Mesh VAL S Or bit .* )\ á c Event Handler imp urity Line Search hand shake arm up ĠFOR WARD Ġmc Ntw vers or ĠPRO B NN P ling ual +" ' +" \\ ret val nan std Ġpub hits Ġstream link On tology Command Line auto commit Ġbinary IO çĶ ³ tk et Ġ---------------------------------------------------------------- --- DR Y Ġaut otvm Ġneg ativo Dir ty Ph eno Ph ysics gh ub tab u Ġskip s xs ct Ġow ners ĠAl gorithms à° µ EE G Ġvari ances Ġassign ing ĠPre processing Ġstack s ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠ ĠPer missive )+ ": ä¸Ģ è¡Į ä¸Ģ èĩ´ å° Ħ )} ` )} ', BASE LINE gamma s ĠRE PLACE car to basic Preset IZ ABLE ĠInteger Field correct ly New ValueType ĠTrans actions Update View ev olve Br Speed Ġæ °´ ĠSub scribe åĽ º SL UG Ġlang s Ġhand s Ġ19 00 ĠQu ote ĠLoc ale 404 5 CS Nodes FIL LED IF ICATE hidden L Ġbit fields ĠInter active ĠNumber Of å¼ µ miss ile 192 2 192 6 Ġuuid utils IST IC Ġmp atches Element Exception Ġho les Ġho lidays Ġcomment ed DEF ER Ge cko Mon te )" ', Ġpa ssage Ġap lic ĠST OR WE AP DA I inv itation arti al ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠ Ạ© Ạ½ }} ", Ġdes apare NOT ES ĠMo lecule ada ptor ################################################ #### ĠDes ired ________ ____ sy ft Ne ural Ne arest 205 2 Ġri gid origin ator Req s ĠNe arest ĠNe utrino Ġsigma s Ġ'< ' lid ers eno ise ĠCont rols ĠHe ights âĶĢâĶĢâĶĢâĶĢ âķ° Ġtw ist 384 9 Mod flow tific ado ĠTra jectory Ġfo lium MD P Single ton ĠGe V ê° ģ analy zers 294 1 214 3 214 6 Multi Scale ðŁĩ ® ðŁĩ ° ðŁĩ ± 3333 34 yes no Ġes sentially Directory Path (', '. 264 3 resid ues Conf usion Ġinterpol ator Ġanaly ses ¡ółģ ²ółģ¿ Transaction Internal 206 1 Script ing 217 6 232 8 297 1 297 3 ĠMax Pool Ġgre et Last Modified dn f pipe lined >>> ' Dig i :::: :: gm sh har bor har vesters (". // Ġprovider Name 299 4 rou ght Ġmac s ĠMock ed //////// // 306 7 Render Window ĠPerson al sdk Driver Container Options NAMES IZ Ġwhite listed Call Filters ĠSP ACE 304 9 Rot atingFileHandler Ġbul ges fft shift Standard Sequences Ġmet as Ġsimp li FQ g Ġcc xt Ġ"' % Ġden y åĪĨ åĪ« (", ")[ ðŁı´ółģŃółģ ® Ġ---------------- ---- Ġ---------------- ----------- ################################################################################ ############ dark red Meta Info 007 87 ĠBuild CallFilters lick ey parametri c Ġí Ĩ 307 5 427 2 Ġâ ľ ãĤĴ åıĸå¾Ĺ recv from Ġdeploy ments 292 9 interpol ator ółĢ² ółĢ²ółģ¿ Ġ------------------------------------------------ ----- ĠArray Datatype ĠJo ined lso ap ĠAb out OD ES Plus Context vc cs Ġbi jectors ism ic 388 1 AU DIT Ġer ase 303 7 à± ĭ corre ctions ан иÑı ðŁı´ółģ´ółģ ·ółģ ('# '): Ġcri mes Ġhex val ðŁı´ółģ¬ółģ ¹ółģ 425 9 /* ; cdf s Sm Length latitude s Qos CW Ġadv antage Mer chant Imp ersonate ç¤ ¾ ółĢ±ółĢ ¹ółģ¿ opp osite Ġ-------------------------------- ---- Ġ-------------------------------- --- Ġ-------------------------------- ---------- Ġ-------------------------------- ----------- å¿ ½ 407 4 Ġemp loy Ġroll up Ġbus y swap axes Ġmonitor ings Ġ{{ { Ġprote ction wik itext Ġsi mpler Help ers lem mas 309 5 ĠReference d çº ¦ Ġvtk modules 285 1 sho oting Save FeatureSet ĠDep loy Ġhar bor 302 9 ĠEmail Send ualiz ado KB QK Ġchat bot Ġ104 9 ел и ############################################################ ## uj u }.{ { CSS S Sur vi oct op caption s ê³ Ħ층 SETT ING ]}, { ĠDISCLAIM S Ġhy dra docsLoadBal BasicRule ĠWord NetLemmatizer Writ es Contact Info PART S 435 8 GAM MA linked in Ġsho ck Ġsho ulder ĠDraw ing 428 2 ĠBuil ds Ġmicro second 320 99 Ġठķ Ġdialog ue Calcul ation Kernel Pheno fac ility è¨ ĺ Http Response umin osity got Result cro pland ORD ENAR Ġintegr ator Fit ting pend ant ðŁı´ółģ°ółģ §ółģ æ± ĩ ĠCons ult TRANS PORT Oct ets 99999999 99999999 ĠCir klo scroll Height Ġposs ibility ĠExtension s åŁ İ æŃ£ ç¡® Elect rode discord bot BH mass mess a ĠBit coin г г ãĤ¤ ãĥ³ Ġemb s prox imity FER ENCE Play ing аÑĢ ÑĥÑĪ PRIV MSG 433 9 ä¹ĭ åIJİ Aut omatically <<<< <<< celery project Ê· ÉĽ Separ ableConv ак Ñģ uls ion Ġvk Type 707 107 hor ovod Primitive Statement Ġê° Ļ Hard Drive Ġë° ĺ ĠSele cts ĠVal ores BLEND FACTOR xm lsoap 12345678 90 Az ure æıIJ 示 Vl ans ðŁı´ółģ§ółģ ´ółģ Ġchainer x POSIT IVE ółĢ²ółĢ ³ółģ¿ Tele metry Ġpriv acy Ġ"{}/ {}". Sem antic IDXGI Adapter Ġmens agens Ġisol ate ĠElect ric ä¿®æĶ¹ 为 (',' ))) ÏĢ ο NotSupp orted hol m mscModVcs E rz sm variate Normal è³ ŀ Ġê² °ê³¼ Ġstamp s ĠTimeout Exception jw ks ĠcdbpLocal Appl ĠBL UE mcRmt E lad der ĠMi lightWifiBridge ________________________________ ________________________________ Jar Location è© ± adverti sed Ġvan illa å·² ç»ı ãĥ³ãĥ ī mus l èĻ ķ abb ix Ġconvers ations Mm Length ('~ / econ omy Ġpal av Alg os Ġvers a Ġminim ized Management Zone GetStatus Response ĠDa emon ĠDetermin istic ĊĊĊĊĊĊĊĊĊĊĊĊĊĊĊĊ ĊĊĊĊĊĊĊĊĊĊĊĊĊĊĊĊ ĠTS NE tens ordot abili dades Ġtalk ing Ġcraw ler Ġinterpret ation ĠContin uous ĠctspDownloaded SgtPolicy satis faction Ġtel lo ĠAG AIN Ġìĺ ¤ ñ o Ġmeas uring Ġrain bow merc MapE Balancer Exchange mist yproxy heapp op ĠDIST RIBUT UO US poss ibly Ġdispon ÃŃvel proton ated cpwVcPerf Total Increment al Ġpds olve coher ent dil ated Ġproton ation ĠBU ILD RegNet X RegNet Y âģ Ħ Ġreveal ed raz as ĠConvolution al ĠCLASS ES 1234567812345678 1234567812345678 Ġincid ence Ġmile stones ĠNu clear lav ni Ġ解 æŀIJ Snow Amt Copper Length ":[[' - Ġambig uous ĠMY SQL Ġmes senger ĠGal axy Ġdese ja ĠEL SE ACCESSBIND ING Ġoup ut ĠFort ran ĠGO val Datum Lis ì¶ ľ anth ill ĠSIM ILARITY SCEN E retweet ed messenger g Bill To cele ba ĠHi Seq Deriv ative Ġshel ve Ġconform ing ĠBoot campRun ãģĿ ãģ® WRAP PER Ġcloudwatch log interpre ters Ġíĺ ķ Frag ments filtr ation ĠMedical Example ĠAbort ing NOR TH Wed nesday ĠSAL ES iran lms Ġæł ¹æį® вед иÑĤе aller gen ĠDeriv ative TrustSecPolicy MIB Mand y Usu ario INHER ITED ĠSpo tify ĠCAL C Ġconfigura ção ĠVoice Activity Ġvot ers Ġaccom mod Transp arency é¼ ł ĠSpread sheet ĠUNI QUE Ġин ÑĦоÑĢм ĠXL Net Ġtempor arily 0001010100 010000000000000 Lif ecycle pian oroll ĠFv Regress ĠPhy lo tmpEle Loc ĠPLU GIN divers ity Ġæ¯ ı ĠLibvirt EventManager iÅŁ ken Dojo Family Scaffold Guider ĠпÑĢав он qtimetadata field ESR GAN Ġë¡ ľ ĠOnOff blockSize ĠGeom Combination åĺį åĽī Ġmcast ControlList ("========== > NoFrame skip Milli seconds getElement ById ĠæĽ´ æĸ° ĠUNT IL dcer pc itcho ver asany array ĠStim ulus apcat br Pycharm Projects Ġæ°´ æŀª ! ( " +" # % # ', $ ')) % " ' \\ + ',' - {}- . )* / "). / >\ 2 101 2 108 3 076 3 001 3 165 3 166 3 854 3 026 4 224 4 169 4 172 4 182 7 000 9 007 : '+ ; / ; '. = "," > :", ? ] A j A OO A pril C ine C pk C FLAGS C SEARCH C idr D PO E H E fficiency F j F ot F gs F DF F ov F SM F urther F LEX G auss H ide H acker I u I w I ATION I Unknown K k K m K MS K NN K Means K ONA L Point L GN M v M IME M HP N od N ag N ord N ick N ets N FC O dd O ops O GRAM Q e Q ry Q CoreApplication R ail R DS R ational R TS R IDE S IN S av S AP S ORT S rv S till T ap T au T ERR T odo U c V IN V ery V apor W ide Y O Y mJ Y STEM Y OUTUBE Z B Z R [ . ] # ] `` ^ [ _ ]. _ '): _ ${ a op a po a key a arch a ero a mpler b od c py c Type c group d ht d ts d max d orm d Base d cm d odge e li e em e ather f user f submission f rontier g V g ou g als g rep h A h I h W h all h nn h cc h pc h ysical h QK i pt i com i ops i peline i ota j urisdiction k un k net k ornia l ci l tp m N m T m X m ot m cp n X n bytes n rem n ically n uels o U o è p F p Z p ent p doc p du p fn q ti r M r line r ug r pg s obre t sp t node t batch t stamp t LS t reated u B u vs v le v int v ts v api v ital v cpus v soma w A w T w ot w ux x lm y axes y ama ´ ółĢ±ółģ¿ ¹ Ħ Î £ Ð § × ¦ × Ŀ â ³ ç ĥ ç Ĩ è ĵ é § í ģ ð £ Ġ ĊĊĠ Ġ velo Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ çĶ¨ Ġ ############################################################################ Ġ ðŁĴ Ġ 以 Ġ ÑĨ Ġ ãģ§ Ġ å¼Ģ Ġ íķľ Ġ athena Ġ 读åıĸ Ġ ensembling Ľ Ħ in ho or skip or tit on ad on na re lic re do re compute Ġ= ============ Ġ= ===== st arg en couragements Ġt arg Ġt ty Ġt ca Ġt ë ar an ar ra ar quia al co al ab de qu de vi de ta de cib le weide an di an che Ġi list Ġi ca Ġi pc Ġi zip Ġi otype me lon ti ers mp loyment Ġc rc Ġc lasse Ġc vimg Ġp es Ġp ension Ġp io Ġp norm Ġp opt Ġp andoc Ġp ecan Ġf en Ġf dr Ġf acing Ġf ounded Ġf etches Ġf iona Ġ" '' Ġ" );\ Ġ" [-] he matics it ative Ġa id Ġa cess Ġa ml Ġa md Ġa seg lo on 00 56 ge y ge ars Ġn ine Ġn ii Ġn ume Ġs ph Ġs var Ġs amp Ġs mt Ġs job Ġs sb Ġs ppas Ġs licing ur ri Ġin comp Ġin fe Ġin car Ġre dd Ġre direction Ġre aches sel ls ame se Ġo he Ġd xf Ġd db Ġd Loss li pp ct uation ct ransfer pe cc un set un ite un ay un wind un staged Ġm yst Ġm hd Ġm vn Ġe con Ġe print ion ization () ([ ent ly ent ric ad xv ad ditive co ck co var ri der Ġb h Ġb st Ġb es Ġb name Ġb ns Ġb ell Ġb allo Ġb öl Ġ1 173 Ġ1 996 11 95 11 44 11 001 11 59 int eriors id ing Ġ( [" Ġw fh ch opy te ff te lp te go ma st ma xf ma sses Ġfor wards "" ): ol t ode d __ ')) __ }" get option get Info get vlrep (' .* (' =', set Coordinate ĠT B ĠT et ĠT ic ĠT OR ĠT ok ĠT oo ĠT ransp ĠT iles ĠT urtle ĠT ELL import orskip str error Ġ2 98 Ġ2 53 Ġ2 51 ers phinx (" ..", ') * ') }) as ca et ape arg p arg on Ġis ql ĠS PECI ĠS TOP ĠS MAPE ĠC ID ĠC SC ĠC ALL ĠC ancel ĠC NV ĠC itrix ht ype Ġg am Ġg olds Ġr ds Ġr ts Ġr inse Ġl sp ĠA MP ĠA CK ĠA rab ĠA nonymous age marry 01 44 put header Ġcon cepts ic p ic ity ke k ke Train am iento to String to pping Ġ: ', Ġ: ') par ties par andum ist e ist ivity ĠF B ĠF all ĠF ACE ĠF lor ĠF WHM ĠF rowning sc re qu eness list Of om nis ser um Ġh repr Ġh adoop ta w ĠP AT ĠI m ĠI LL ĠI OS ĠI Hero ĠL UT ub k res nel res nest =' {} =' ${ =' -') Ġst one Ġst anza Ġde comp Ġde cl Ġde compressed pro duces pro vides pro posals est o est ate 0000 1011 form Stash ex us im ated Ġex changes Ġ3 25 Ġ3 08 Ġ3 35 10 92 10 84 10 56 10 35 out str out group out box out break ow away ĠD iff ĠD FS ĠD omin ĠD DPG ac tic Ġu reg Ġu fw Ġu uids ]) ', ]) == ]) ])) Re actor Re Lu sh in sh ops sh ading ĠM us ĠM AY ĠM ARGIN key type key Mgr lab us Ġv g Ġv out Ġv oc Ġv cs Ġv ai Ġv wo Ġv stack 02 01 ext r Ġy tick ĠO pp ĠO WL Ġ* [ Ġx z Ġx ray os cope Ġse es ack nowledged add Edge ER V load Model Ġme cab Ġme dication Ġfile types Ġpro ducing Ġpro metheus Ġpro hibited ens on art hest xc en pre duce ES G ber keley Ġbe havi "] +" ĠB W ĠB ind ĠB ED ĠB ond ĠB ORDER ĠE ight ĠE TH ĠE dition ĠE TA Ġj object ime k """ # com merce model Name ĠN AC ir er ################ ########## Ġ4 25 Ġ4 30 92 77 tp r col d col ate col lapsed In Out In gress In finity ĠR OR ĠR SE ĠR TR ĠR BR Ġun parse Ġun masked Ġun limited Ġun marked fo obar 32 39 32 31 32 69 ĠG Object ĠG ram ĠG rammar Ġco data Ġco herence Ġon de EN DED ĠW rong ĠW WW Ġout ro Con cept ĠU K ĠU b Ġ5 93 Ġ5 70 ib ile ise n che mistry 18 32 18 82 18 42 18 63 16 14 16 67 line Tokens array Peak sa int Ġk it Ġcol lide 25 09 25 98 25 38 25 43 Ġro ck St one St ores Ġpy ss Ġpy dap Ġpy atv Ġ6 90 Ġ6 50 ag ar http client 04 04 13 55 13 65 13 54 lib dcerpc class ic class path 15 12 15 46 05 00 05 07 03 05 03 55 03 77 we cook ip addr ip Address Ġop cua 17 47 dd o dd qn 93 36 93 65 93 76 14 02 14 64 14 47 14 54 Ġpre load Ġpre scription Ġresult NContent ne ck ok ia 64 89 error Message Ġra pid Ġra ising gra sp iti alize RE CO 08 58 22 88 22 28 22 49 22 71 ust ay Ġ. __ ĠH EO ĠRe ce ĠRe lay ĠRe public sub group sub modules sub routine ][ :] Ġsh words Ġdi a Ġdi al Ġdi es Ġdi str 88 97 88 56 19 74 (( \ Ġsc aly Ġsc anned 34 18 34 26 34 62 34 72 09 88 09 86 84 55 ĠIn etAddress 27 65 own ing nd of inter op inter actor Ġle v ill uminant arch s 24 27 24 23 24 39 24 31 24 79 24 74 24 72 24 71 37 55 37 94 point patterns Ġsub domain Ġsub strings Ġsub routine rep ortit 96 99 96 10 96 85 Ġnew Graph Ġall hub 94 08 94 47 94 73 Ġ} ' Ġ} [ 33 01 33 93 33 89 DE MO DE ATH RO ID 87 75 AL OG exp iring CT As Data Parser AS YS Ġla x Ġla pla 85 14 97 55 net mask 36 14 but ter 011 8 query Cells ĠK i ĠK y ĠK on ĠK MS Ġuser Name Ġuser bot 95 07 95 08 return ing word list Ġcont en cri ption 86 08 26 04 26 08 mon itors Ġdo i Ġdo me Ġz entral ################################ ## Ġjson utils AG ATT 57 01 57 45 Ġ[' < Ġ| / Ġ| __ create Element ED NESS reg ar reg rs Ġper ms Ġper haps CO LL version ing Ġlo l 90 32 api pe api index unc or Ġstart project Ġte k Ġmat ri Ġli ked 44 85 44 26 Ġdis ruption AP Y AP PRO cor responding OT k ef d En rollment Co V Co v Co ef 28 34 RI VER 56 79 98 15 Ġsp f 38 93 move To my resource Ġmin Value Ġmin length Ġ(" -- uc a be ams be hind Ġcan on ĠQ Dialog ĠQ Icon ĠQ ComboBox Ġcolor maps PT P 35 86 org Name Ġus ar Ġmo strar Ġmo że File Metadata doc us doc strings ))) ; Ġad vice 45 07 45 19 45 23 45 35 Ġvalid ates Ġinter op ]] \ Ġ, {' command map tf lux Ġpos ição Ġ9 16 Set Table pl ants IL ER Test Mixin Test Support Test CreateFile Ch ip Ch lor Ch allenge ai res 82 95 ear m Ġar xiv 46 54 ĠJ ones ĠJ uan 89 15 89 14 Ġ] \ ":" / )] * ANT IAL Ġq x ĊĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĊĠĠĠĠĠĠĠ To Test To Delete score board CON STRUCT DO OR Ob js De precationWarning field names 29 04 ]* )\ '][' $ MP SS 67 03 43 17 43 93 show Label Ġup sample Ġup grades Ġcor rupt vo us :: \ 000000 02 SI FT SI OC 48 97 EX PRESS ĠData Array ĠData Required FA oF fe cha No vo 42 11 42 07 42 17 42 14 MA E Ġpri ors Model Instance Model Stick ï¼ IJ ĠIS K mt urk Ġwork loads parent heses Get Color Get Item ĠPar ti 39 07 ny quist bl urb Ġiter ables play book PAT IAL Tra des Column Family Vi olation 74 22 Dict Model fy ra ĠCo ords dis connected fit params Ġimp rover Ġorder List Description s first Child Le e Class Linkage Ġab a Ġfield set ĠTest App Ġsign ificance ĠNo va Ġbin omial User Input Ġman aging Ġlanguage Style Ġexec utions sor ry github assets qui er ãĥ ļ ym orphic Ġstd lib At tached (_ , Of z If Index Sh ares Sh ots prefix ed Image Data :] ]) Ġtmp Array pu Device DB Manager DB Obj Def Context Ġ"\ "" 202 7 Ġfi ber Inter mediate Ġfont Tools pec an cluster map Create Dummy prot ot Ġtri ps fla kes API Result Ġsent inel Qu at ĠFor ces window Background fp tr Ġsrc file mod l medi o н ого Ġsome what stop Activity diff usion =[' - Ġshow legend aa S Ad verti Py dantic é o Sp awn Ġmon itors Ġloc alizations COL LECT Ġref name istr ations script en ines ses ä» ĵ Ġpost ed web p ++ ', Ġfin etune lr s ĠZ ERO ram fs NO UN Ġì Ĩ rs ync Ġsplit ter ĠSO M ]+ )', ĠFile Type Port State Ġwindow ed Token Mapping RL F âĶĢâĶĢ // draw downs Ġ"- ") Ġsee k ĠRel atório cpu set Or New .* )') Ġvi r á l ĠKey Value ĠLe ast ĠLe ague ĠConfig urations Ġresp onder imp u Line age SON G Ġrest oring prob ed CI LL Ġpe lican Ġpe ewee storage s Ġweb cam Ġest ão fc ntl multi Proc vers o vers ing ĠTime OfDay Ġattr getter Ġvector ize All But ws man vari ational reset JointState Ġsystem d auto discover =\ ""+ ĠEX PECTED ä½ Ļ inf lux TP C еР± IMIT ER js r GL M Do e Ele vation Oper atableStateMachine Ġyear ly Ġneg ate ĠNum bers Enum Type Ġ') [- Ġview ed apply map Ġhigh ly SO EVER ga e Min utes Ġtr g ĠUp dater Char Match Di pole Struct ural ĠBo at ĠBo iler aut onomy Ip Protocol Task Name va ex éĢ Ĵ EE II ii ii ĠOb servable fl ds Graph s termin ated Ġtk list Ġclean er MIN UTES Ġë Ķ Ġë ¬¸ bed s Ñĥ м enum ber ******************************** ************************ Ġsel ling Ġgoogle apiclient Ġarch ived Msg Finished PRE CAUTION bus ca ĠDis placement ĠQu ad åº ķ GO O MT U Ġshort ening ĠOpen Shift IF NAMESIZ Ġ? ? Ġbit mask ĠTensor board Ġdivision s Stats Total ĠNumber Normalizer Default Cnt 024 34 cb d Ġinte iro .' ", åį · Back SH Ġgra v Ġgra fo divid ers Ġjoin ing Go ogLeNet ĠRequest Message ru z ĠUpdate Expression Ñĭ Ñħ Ġho ppingSite Ġ"# ": speed s dy dx ĠMy Class ĠST RE del item inv ocation camera Tweaks TRI GGER dl c RU AL multiple s ĠClass ify 205 3 Ġ(_ ) Ġri der ãĢĤ ãĢĤ ĠNe o 215 2 åĢ Ĵ æī į æī ĺ ĠRo les 204 2 Parameter Context tol erant Ġway points wav file GA AC 384 1 writ able ('. ')) tific ations phase d Ġpublish ing Engine Error HEAD S ĠStart ed Rate Limit Profile Name 193 5 ĠLabel List ĠRandom State ðŁĩ µ ðŁĩ · cons ult 3333 33 Ġeven ing ali ens ĠCode s Ġtermin als It alic Stat en organ izer BI AN Ġflat land pher es ¡ółģ ®ółģ¿ Fin ancial 206 3 ä¸Ń æĸĩ 208 2 208 6 tb W Ġord inal ëĭ ¨ combin atorial Ġred shifts Ġwrap Width pin yin Ġsur ge Dig itizer ĠÑģ еÑĢ Part ner syn onym ĠMO DULE ios o 203 6 Ġshift state Prop agation 299 3 follow ed general Tissue 225 3 296 1 Ġbad ger ðŁı´ółģ³ółģ ¥ółģ bon a Linear Projectile Cor p 304 2 Ġnu ke Ġnu im Ġair craft 424 1 424 8 397 9 286 3 ĠTEST ING operation Id ĠSpe cies Ġ---------------- --------- ################################################################################ ######## HD x å· ´ 284 4 307 4 427 6 Ġorgan izations Ġorgan ização 406 3 Ġfbx Material ĠSc atter OF VERSION xl net Ġflo ps ółĢ² ółĢ°ółģ¿ 209 5 ĠSearch Result ĠâĢ ŀ 288 4 388 6 Ġer os Next Token æĭ ¬ executable Path ĠGame s 385 1 385 2 Ġcy to bright Red bright Blue bright Green bright White bright Black bright Yellow bright Cyan bright Magenta kk k water fall Ġml piot ĠWork book 395 7 mal icious RUN NER 392 1 ĠHTML Parser 396 3 Mac Addr 437 2 FOR BIDDEN visu alizations Ġwatch dog Ġatt endance replic ated Ġtrade mark Vlan Table Ma intenance Ġ88 1 ĠPort al prog ression ĠCar olina Callback Query 332 8 sil ence Ġcb or Ġcam eras vet or magic daq Screen shot Ġjoint Index 408 5 verti ca deep gmap Ġ-------------------------------- - æĸĩ件 çļĦ ãģ« å¤ī Ġgain s detector s Ġtm db èĩª å·± 309 1 Ġquat DMP Ġrecall s Cfg Group Cfg SkippedGroup Ġ################ ###### longitude s fbx Scene ìĹ ´ ìĹ Ń pip env Ġgui args calib bit LINK S four th Ġcatalog s 298 9 La Images éĽ ¢ NF KC è s Ġpv BackSH åĽ¾ åĥı Ġreview board Ġstand alone OVER WRITE áĦ ĭ ĠAP IS Low est 99999 7 kE g ĠMay a tenant Id beat s chip R ĠAut omatically KJ VK Ġeff ort JJ NJ (. + Ġ#-------------------------------- ---------- ĠCOL ORS Ġrx n Ġce ilometer Ġrcl py Pop ularity laps ing Book s dut host RX SS Ġsho ot }-{ : æĻ ļ ,:, :]) 438 9 TW Light ĠEl lipse Ġठ® Ġste em ĠFire wall cro ft Ġpic amera ĠSpeci fication Sys Font TIM ER Review Rating ĠConnect or smo other Ġlatitude s Arch interiors ĠAdmin istrator ô ng Trace back æĪij 们 Fe es anon ym éĺ ² Selected Text stub s Ġм аÑģÑģ ĠCOMM ON Ġnear by Pol ar åģ ı ĠCS RF ĠPassword Field hack s éĢī 项 Lookup Error ĠEnter prise ĠAnaly ze ĠRESULT S PLUGIN S Ġgp map Requests Mock exer cise ðŁı´ółģ®ółģ ¯ Ġ#------------------------------------------------ ---- Issue s ın ı 8217 77 ãĤ¯ ãĥ© éķ · Play list PERSON S PERSON AL Ġtv di ĠSan ta ĠSTAT ISTICS é» ij Ġorient ed Ġhack y Ġintr insic ĉĉĉĉĉĉĉĉ ĉĉĉĉĉĉĉĉ Geo JSON Boost Classifier flt Stat Ġbas erow Ùģ ÙĬ Ġly ric oẠ¹ oẠ» oẠ½ åıĺ æį¢ Asset Type ĠSkip ped Ġnecess ário Ġcontrast ive Ġdead line cab inet Fri day Ġguar dian IMP ÃĶ nowledge ment mole cular semi logy silent ly Gre ys laci er éħįç½® æĸĩ件 ĠAudio Segment ĠPL US UNI VERS Ġche ese KV Part èĪ ¬ Ġsmo other Ġdog s Ġexam ine Ġlem ma ðŁı´ółģ¶ółģ ® éłŃ éłĺ ĠcdbpLocal Vendor RNN Cell ĠNB PKG Ġcomput ational ĠMag nitude ĠctspDef Downloaded lhs Node Ġsuggest ion tac acs ðŁı´ółģ¨ółģ ² 缮å½ķ ä¸ĭ 00001011111111 000100 ê² ½ Ġdatal ine Ġabi lities Subscription s Ġuncer tainties ĠCharacter Model 713 57206 ĠInclude s ISS ION Ġ'{}'. ". Ġped idos Ġmom ents ('~ /. ĠcdbpPeer Vendor ĠMIS P Procur a DEST ROY gran ularity ار ج é£ İ Ġmusic score SMS User Ġcron tab Ġhom enet Ce iling Ġach ieved ĠctspDownloaded DefSgtPolicy Ġtel net æĿ¡ 件 atten tions ĠFunc Def ĠQuanti ty Ġfrequent ly çµ IJ ãģĵ ãģ® Ġpup pet Follow ing Tex as Ġmob ilenet etsys NacAppl vio let merc ator Already Exists Ġetsys NacAppl Occ upancy bread th ĠACC RUAL Ġdeliver ed Altern ative Ġsynchron izer Ġwal ker Ġsnmp mib ĠRound ingPolicy Ġ************************************************************************ ***** Ġ327 68 Ġìłķ ë³´ sever e scrap ing Ġproton ated Ġzen odo ELECT IONS ĠæĹ ¥ ìĨ į ĠAnalog ous Ped ido Prom o kir bi ãĥĩ ãĥ¼ãĤ¿ åį³ åı¯ aaaaaaaa aaaaaaaa ĠÐŁ ÑĢ Ġabstra cts ĠæŁ¥ çľĭ åķĨ åĵģ ĠMETHO DS PLACE HOLDER Ġshuff ling Ġphenotype s ĠMonitor ing ĠDen ied steel blue Ġfer mi اب Ø· ĠNET WORK Ġativ os vvvvvvvvvvvvvvvv vvvvvvvvvvvvvvvv ĠCvBridge Error DIC OM ĠTi pos Ġد ÛĮ ĠPdf FileReader ĠAdapt ed ĠLif ting |{}|{} |{} ĠLap lacian pho sph Ġclouds im å±ķ 示 Front SH Ġovers ampling ################################################################################################################ ######## multiplex er enroll ments ĠSky Coord ĠEv olution Ġج ات ĠAnalytical ModelStick èĤ¡ 票 Lex icon unders core shel ves **************************************** ****** sme ll Ġkom bu ĠMiss ile ĠPRIV ATE Cascade Classifier Ġmistr al Ġprocur a Neighbour s achability ServiceClient ĠChrom osome Ġgrace fully ĠIGN ORE heroku app CIRC LE titch ing >[^ / Ġcj mx ĠROT L ugg ling Ġpropag ated Ġê²½ ìļ° ččĊč č tache ment ĠGIT HUB dak ota 6704 31 Belief Event PREPAR EDNESS ĠVin cent fess or Ġsimultaneous ly OnOff start ĠKuge l ACCUM ULATION NVDA Object assertRaisesRegex p FAT AL ĠMESS AGE Ġlighton ml VOLT AGE LOCALIZEDSTRING TOKEN ĠNoSuch ElementException ĠChristop her Postal Address Ġpuls ar Ġprogra my outputData Name ĠQgsProcessing Parameter ĠInno DB COH ORT hetero sphere ĠSING LE ĠGlyph s assertValidRole ListResponse Bans al ALLE L ä»Ģ ä¹Ī å®Ł è¡Į 9218108169 88 APPLI ANCE leop ard ãĤ´ ãĥª Ġcatan DBObj Ġкаж д ĴĢ ë§ģ ĠSTOR AGE ðŁı´ółģŃółģ® ółĢ°ółĢ Ġaccommod ate é¼ł æłĩ ĠпÑĢавон аÑĢÑĥÑĪ onad ash Ġredd it Ġdxf attribs ĠTELL STICK ĠIHero Types Ġscaly r Ġlapla cian ANTIAL IAS MPSS imulator CharMatch Ind PRECAUTION ARY Archinteriors Vol ĠмаÑģÑģ ив 00001011111111000100 1000110 71357206 670431 ! =- $ & $ _{ ' | ( ("% + : + ":"+ . )), / '. 2 923 2 198 2 138 3 948 3 888 3 102 3 327 3 023 3 122 4 0000 4 201 4 107 4 165 4 157 4 177 4 178 4 183 4 141 8 937 9 107 ; """ = } ? ?\ A UR A ward A ws B t B as B ES B eat B IS B EST B rand B MI B LOB C tx C ATION C VE C ATTLE D v D ed D eri D Array D uring D rops E th E UR E QU E II F ns F ram F REQU F onts F rench G AP G az G tk G rd G ndConnector H t H er H ack H PP H LT H ANK I deal J on J ul K en L b L st L HE L PC M ES M IC M zM M secs M appings N Q N Number N LU N eeded N Phases N MVOC O e O SC P ype P US P seudo P eter Q SC Q Icon Q ScrollBar R v R ap R ifle S it S PR S uit S uggest S emi S ALT S afety S OUTH T Factor U ZZ V EST V CC V OI W c W rist W rV X form X we X GROUP Y U Z D Z Y Z ER Z DJ [ __ [ ]( \ ) \ ]" ] "). ] _. ` ; a qK b arch b GR c ame c label c gs c mpl c vimg d pc d stack d ollars e K e Q e ef e af f key f resh f comm f orth g G g K g j g ds g IC g las g mt g rounds h K h Z h size h ier i en j X j is j as j ailer k F k K k is k layout k oda l Z l tr l Mode m G m ant n par n po n ite n ds n fe n ics n features n Context n inja o V o ot o ob o ak o zone o Options o obG p ra p ers p ds p test p add p gs p led q O q ds q rt q iskit q oe r zy r partition s key s fm t G t W t keep t Found t lm t cex v end w mi w WC x add x size x edges y os y err y dl z ib z samples z na } ** } $", } ${ ~ / ³ ółĢ²ółģ¿ Î ¶ Ð ¦ × ĺ × ł å ² ç ij ë ¦ ì Ĥ° í ijľ ĉ Ġ č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ river Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ ÙĨ Ġ æľ¬ Ġ åIJĮ Ġ åħĪ Ġ оп Ġ اس Ī ìĬµëĭĪëĭ¤ in ia er tia or med or Pos on call on ERC at ri at son re constructor re structured re bates se mp Ġ= ( st w st ake en os ĊĠĠĠĠĠĠĠĠ ĉ Ġt ies Ġt stop Ġt yper Ġt ropo Ġt iff Ġt ango al d de position de select le iden le aved an omalies an terior Ġi co Ġi te me ms me xp Ġ' ## ro bin ti um mp f Ġc box Ġc ropping Ġc ctbx Ġp ile Ġp iv Ġp ps Ġp ager Ġp ids Ġp cl Ġp lastic Ġp itches Ġp seud Ġp lugs Ġf unk Ġf olded Ġ" >", he xa it os it ance it zer Ġa vec Ġa mino lo co ge on ge ll Ġn am Ġn aff Ġn dc Ġn ama Ġn vidia Ġs sc Ġs lit Ġs ie Ġs yl Ġs lashes ur d ur st Ġin ps Ġin secure Ġre duces Ġo y Ġo cur Ġo led Ġd U Ġd mp Ġd ream Ġd boxes Ġd ropping li q li ab ct al ct ls pe lu pe ll pe vent un parse un classified Ġm I Ġm app Ġm ason Ġm wi Ġm inecraft Ġe arned () > () }\ () }') fi ces fi bon ad cp ad visor ad igm co us co ordination Ġthe Event Ġb ent Ġb ump Ġb ays Ġb ios Ġb ought Ġb asket Ġ1 345 Ġ1 000000000 Ġ# ") 11 79 11 0011 id py Ġw m Ġw di Ġw ise Ġw arehouse ch apters di co di ma ul u ot f ot one Ġfor ma Ġfor warded el v el ong el urahan urn ika Ġ+ ---------+ get list get args get Server get tfill (' = )) - set Reference set Setting ĠT on ĠT ar ĠT FT ĠT AU ĠT aylor xt ools th ur Ġreturn as Ġ2 69 (" ) as u as ury ĉĉ Ċ op us op tical Ġis ce Ġis Stable ĠS AM ĠS ED ĠS ha ĠS lider None Type ĠC nd ĠC UB ĠC GI ĠC MS ĠC CS ĠC RY ĠC ubic ig able up ce Ġdef orm Ġg ca Ġg BB Ġl bs Ġl cm Ġl prob end zone ĠA IS sp ars '] [" '] }. 01 36 01 76 ic ing ic ustay am ide 99 03 99 08 99 84 Ġ: ") ith ium ĠF D ĠF ear ĠF ish ĠF ONT ĠF uel ĠF Comm od ate od om log p log scale list Key om History vi ated Ġh n Ġh rs po ur ta mp ĠP air ĠP ause ĠP LAYER ĠP SNR ĠP outing Ġas name Ġas sess ĠI l ĠI DE ĠI CON ĠL L ĠL ag ĠL DA tr Y Ġde viations ine Edit Ġex plan fig title Ġ3 0000 Ġ3 47 Ġ3 69 10 87 10 97 10 86 10 57 10 98 10 21 10 39 ĠD ask ĠD EST Re base Re covered Ġdata Dir ĠM ount ĠM ixed ĠM omentum ĠM RR ĠM AIL ĠM cD ĠM artin time wait time dia time Series xf er Ġv ent Ġv cp Ġv fc Ġv entilation 02 06 02 08 Ġy c Ġy l Ġy test Ġy dim ĠO C ĠO CI ĠO LS ĠO PF Ġ* ", Ġpar lai Ġx o Ġx st Ġx mf Ġx xxx Ġse xo Ġse lecion test X test utils test bot add Object Ġstr t .. ', xb ridge Ġme mc Ġfile paths Ġfile Names xc bar pre load ls r ls rc 07 76 ense d ber ish "] [' ĠB x ĠB Mode ĠB Plus 12 54 Ġname ly ĠE ff ĠE mb ĠE pic Ġj th Ġj unk Ġj á ci k ob stacles """ { Ġ) ]) ĠN g ĠN ak ĠN IST ĠN ico ĠN SF ĠN orte ĠN LTK ################ ############ ################ ############# Ġ4 10 Ġ4 90 ff in Ġget All Ġget hostname col V col pm In ception In dication ind P ĠR H ĠR X ĠR pc ĠR TL ĠR atings OR ING Ġlog norm 32 01 32 37 32 77 32 43 ĠG ain ĠG rand ĠG IAI Ġtype Name ĠW OW ĠW ORD tri cs Ġout car Ġout dated Con c Con current AR S AR ED ĠV ers ĠU M code build ry stal ry lov Ġ5 13 Ġhe mis Ġan ime Ġfrom config Ġen voy che at min y min length IT ES IT IONS Ġtime wait Ġtime slot Ġtime codes 18 11 18 18 18 25 18 72 16 16 16 84 16 97 coun tp sa i sa audio Ġk d Ġk ing Ġk not Ġk önn 25 06 25 52 Ġro d St as Ġpy mel Ġpy dicom Ġ6 47 lt t ag t 04 84 13 98 og re 15 92 15 15 ec aster 05 01 03 04 03 94 we ar train val 17 07 17 92 17 15 17 87 17 95 17 86 17 82 17 54 dd p valid s 14 99 14 04 14 09 14 98 14 74 ok a base url base URL ([ _ ([ { Type Var RE MO RE ASON Ġtra ct 22 19 22 38 22 74 22 61 Ġ\ ""+ ust ext ĠH K ĠH ide ĠH ugging ĠRe cogn ĠRe places sub folders sub lime Ġdi viding df e mit Mode LL R 88 75 comp ar Ġsc n 34 04 34 15 34 85 34 23 34 38 34 51 start IOHeavyTestIn Ġwe aver Ġkey ring nd deriv bin ning Ġle ar Ġax arr 24 86 24 68 37 12 37 03 Ġare kit Pro files em ice Ġsub dirs yn q AM Mode 96 16 96 05 96 55 96 97 Ġac ad ĠCon da ĠCon cept ĠCon verter Ġall reduce 94 94 94 67 33 92 33 97 33 31 DE M DE mote RO IP RO BOT ()) + split Str node sel 87 36 AL O AL ESC Data Item AS ER iv os 85 86 mi o net disk 36 78 36 52 =[ [' =[ {' Ġuse tex ĠK ong 95 06 95 87 Ġnumber Columns lat ents view Count cri spy 26 01 Ġdo e Ġdo it Ġz arr rit ton 57 55 57 54 Ġtf b do it Text Product "," - List Type __( ** port Access man ta trans itive 23 97 23 82 request Params request Body AC AG Ġcheck in 44 19 44 75 44 73 44 58 44 69 Ġdis joint Ġadd To Ġadd rs Ġnode Type Ġurl El Co ins Ex if 56 84 98 95 Ġpass port Ġsp conv pop ulations LO CALE ĠUn ity Ġ(' +', Ġ(" + Ġ(" @ Ġ(" \\ UR ER ĠQ s ĠQ MainWindow ĠQ HBox img H img W 35 00 ud r ref und ern ary Ġmo stra File List AD ING cre ators Ġad visory 45 11 45 38 Ġvalid ations ng rid fil tra the m the ws Ġerror String Ġerror Code act ers act uator ĠX new ĠX GBClassifier 47 12 47 94 47 26 47 66 ]] * csv File 101 6 face ts command Prop top level Set Point ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġsk etch Test Event Test Struct ')) ). HO LE 83 56 Ch ina ai e gen ame gen ius ĠIN VALID ear lier Ġar Xiv iter m 46 92 46 93 46 88 46 96 46 76 ĠJ a ĠJ OB ĠJ apan 89 06 89 08 Ġcolumn a DI Z loss al ĠSt orm ks i assert s assert AlmostEqual Ġq last temp o TR N sys config ĊĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĊĠĠĠĠĠĠĠĠĠĠĠ To Int ĠPy PI Ob served De posit De precated exec Path exec utions Config uring Config Factors Config urator US ING ESS ource gn c 43 15 43 86 head line use cols ĠPro to ĠPro per entry config down scaling PI A 48 08 FA LL ingle s \\ ": Ġarray Peak rate limit angle ment 42 04 42 19 42 37 Ġquery string stamp s EL SE EL IX Ġpri cing Model ID е ÑĪ ï¼ ĵ ĠIS AMMode mt k mt ab ĠÐ ļ Max AddressLength Ġexp tools Ġexp lode Ġexp lained parent Node Get Node game event game over 39 84 ny c Ġsum a pc ion Ġsave point Ġfa zer play lists Descriptor Size TO S Ġword net Ġmode li Tra ces Tra ding Ġobj Type ĠCo lab Ġimp ute Ġfilter Statement Response Wrapper Le ad Ġeval ml Ġeval Str Class Instance tree map Ġsupp lies Ġmath utils ĠYou Tube 58 35 State Trap ĠTest Env ĠNo vember Ġweight ings User Profile SS A style gan Ġlib cloud Trans mitMode IND ENT ctx s Ġav lMode çļ ® Th rows Th ursday çļĦ æŶåĢĻ At ten PL ATE PL AIN fs coer ets Bar ĠUser Warning Up Notif Sh ard 49 87 RES UME RES TRICT Ġwas m Ġgraph ical Ġgraph viz decode Binary Context s Ġ"\ [ }\ " CC D CC APS Ġfont Size AA U (* ' Ġtri mesh Ġdocument o Ġsa mplerate fla p fla vors API Key Al ways "); ', gg hh dec lared QL ineEdit 69 06 admin istrator Ġsu as other wise hed ra For ms ĠDict Mode é simo gest ures Sp in Ġnon dominated Ġclo udify FL C sin av hel m ee ks drop level Ġge ar PU D math cal google url Auth Server Auth ority ,' |') ĠBase Estimator ĠEn ables Ġthread pool UP ER non an Ġì Ļ ('/ ')) ICs All ICs Page ICs Den ICs NPT Pos ixPath ĠMan ip ĠMan aged Dis count can e can cer ha arc sen ha Check sum ĠFile Lock fill ment Ġpack ing threshold ing áĥ Ĵ sd p Ġstruct s Ġpick s transp osed ĠApp lies Ġmeta func .* ", Ġvi rt alle us Item List ĠLe ss We apon Array Wrapper OUT DUPL Mat Mul ĠFOR CE jnxMbgSgw V fc ulty Ġsuper set Ġgen omic Box es uter onom ĠLog ical lon d Command Error Ġconf test js Apdu Ġbl una success ors sers ic times lot PS F tool tips ĠAc celer DR AFT Ġaut ore ("- ", âķ ij á» £ short Name cr bug Ġsig num collection List Min AddressLength čĊĠ č VID IAN ={' ': Ġcommon s aut y aut or Query Set DX L à° ® à° ¯ GN SS Service Descriptor screen cast Ġvari ational Ġassign s Ġstack er hs l Ġ'{ :< Down Notif Row Counts bb ing ĠFunction al SP HER ĠSer vers duc tivity high res high lights ĠTrans mission ĠLO OP pick led CONT INUE Ġæ Ķ Ġæ Ŀ Peer Name Peer Sgt boot strapping Ġ19 16 Dire ctories GO V GO OD Ġclose ness Ġclose Enemy IF D Ġchunk ing Ġpr j Ġface tool ĠInter action With Time dash if åĩ ı Ġsimple st Ġsimple gui åį ĩ alg os EC B Ġds P Ġwin ners gl Enable Element Type Go ing ĠHTTP S ka iming lst sq Ġ"{} : ³ółģ ¡ółģ¿ ĠReg ents Mon key Mon day dc n SFP Info SFP Vendor look back rr d rr r WE LL And Output big Ntuple router Domain Ġdes kew ĠObject Msg ĠDes ktop 01011 1 proc man edit able Ġп ол 010000 111 Ne o Ġcar act 205 6 reverse Complement Ġbyte code Ġvol atility Ġri p æł ¹ ĠNode Clustering Ġbuffer ed cn v }/{ :. Ġanswer ed ĠNe uro Exp iry Spe ak original Egg Dec isionTreeClassifier Ġdig ite ĠIniti alizing Loss Alarm }] " Ġts utils pm ids ino is REG IONS Interface List ĠHe ssian Ġexport er IV s å¯ ¾ Ġcross over ideo logical ĠAD T Ġorigin ator Ġdiscord bot ĠNet CDF Engine ServiceClient under linen parsed Args dh od ACC AG в еÑĤ ĠProject parameters ĠProcess or éĻ į Val ve Ġè ´ eth anol eth nicity iso ma 214 2 æľī æķĪ cons umption Ġbook worm Ġverify ing LU A NAM ED phi Rb RS K It ens ENS ITY 915 8 organ ic PA E Ġexpand tab Ġtab index Anal og ä¸Ń åĽ½ arc sec Current Dir 208 5 208 9 good names ĠIO HeavyTest CN RM 297 2 Dep endencies Ġgre yscale watch dog Ġsyn chronous Stop Iso 906 7 åİ ® SY M ĠDescri be иР¶ sur vi sur faces micro states micro bial syn set HW Pri ("[ *] gm x ĠFind ing ü k ü ck 207 7 203 7 jnxMbgSgwPP V 295 0 DP MIS jnxMbgSgwIf V 315 3 Initi alized proj id DIM M 306 1 ä¼ Ĭ visit Lexer 305 3 Ġfs leyes nav igator ye arn ÙĦ Ùħ Ġcover ing ĠBe havior hit object Rest aurant 304 1 304 8 Import s Ġlock s pur ity Ġair foil demo graphics ("{ : 424 5 397 4 FQ o aby tes Sgacl Enforcement åĪĨ æŀIJ åĪĨ åī² Optim al Optim ize Ġ---------------- -------------- dark orange dark cyan 287 1 ĠBlock Row Poly Data Poly axon ĠØ ´ Ali g 284 6 307 3 427 5 Ġorgan ized 236 6 236 7 Inst ant 406 4 GC G ĠStruct ured è¾ ¾ interpol ated rist mas subnet s #---------------------------------------------------------------- ---------------- SK IN 288 2 334 9 sock sr Hub Message Ġ'$ { 422 8 Ġent ão 436 9 ÙĪ ÙĨ rich ii STATE MENT Ġti pos Ġti ene 388 4 Ġ44 100 426 1 426 8 303 1 Ġaggreg ates Site Map Ġк оÑĢ 385 6 385 8 cg f water mark corre late MIS P м еÑĤ Ġhold ers 457 2 457 7 457 9 boost ing 337 9 ham crest Product Type ìĦ Ŀ fish er Send Text ĠStorage Type MON STER æĸ¹ åIJij vet ype ĠTop level ç± į Ġsampling Time Func ion Acc XFP AZ URE Volume Claim CUR SOR aco te Ġ-------------------------------- -------------- 405 4 Non Zero æĸĩ件 åIJį称 Ġcutoff s 314 1 DN X Dim Shuffle Ġprote ins Exit Error Pod To ðŁ¤ · ĠSupp ose но е но ÑģÑĤ Ġ################ ########## Ġ################ ######### Ġ################ ############# ĠEval u ĠPe ssoa cpwVc IdMapping cpwVc PeerMapping Ġide mpot ĊĊĠĠĠĠ Ċ ĠBinary IO ì§ Ħ Colour s è me ĠĊĠ ĉ 缮 çļĦ Ġpv FrontSH Bin ar å§ ĵ infer no Sur rounding Ġ################################ #### иÑĤ ел PROCESS OR emit ter Ġopp osed Ġ#-------------------------------- ----------- ĠSequential Sampler kv magent åįķ åĩĢæµģåħ¥ Cloud FS ĠAccess Token Rob ert Ġsal a Ġsal do ĠTw isted Vari ational ĠVe hicles Axes Subplot bow l ĠBuil tin ,:, :], åİ» éĻ¤ ãģĦ ãģ¦ Ġmicro scope ('_') [- Fill er QR ad bas arim nes ota ε Ïĥ ãĤ¹ ãĤ¿ MOD ES ĠCalcul ation ĠCalcul ations ĠCommon s Ġfits io Ġphot ometry Analy ze Ġperm ute Modified AccessConditions })) }, ĠFast Ethernet ĠPAR AMETER Ġht m conj ure slow queryhistory æĺ¯åIJ¦ 为 sam tools Quest ions Ġrt na CHO ICE vtk Image discord app ĠPlugin s zZ s ØŃ ÙĪ bol t äºĮ 人 Src Port ľë ĮĢ ĠEdge Sampler Ġfac ial nthe size Atom ic ĠPur chase eti cally ĠLED s Ground SH Ġreshape d Ġmemo ize ĠTool kit Cli Format Ġtopo logical ĠSort ing Ġ################################################ ### Ġbuy ing ä¹ĭ éĹ´ Ġemit ting ĠGeo JSON ĠAL TER ĠNaN s rie ving ĠCli mbing shuff ling maybe Deferred sta fi unix time ĠFri day _{}_ {}. Ġindependent ly Ġonnx runtime joined List Adv anced ĠXXXXXXXXXXXX X Unicode Type ĠHash Mode isol ation :::::::: :::::::: Ġíķ Ħ rig ation Ġconven tions 认 为 æĦ Ł Ġcad ena ĠHo liday :** __\ Fri ends Sat urday hom ogeneous dB m â ng ENTER ASYS CERT IFICATE setStyle Sheet TERM IOS çĪ ² Sparse Tensor voc abs Ġnest e DEC IMATE Quantum EngineServiceClient Mol From è¶ Ĭ ĠAug ust Ġher mes Ġacceler ometer ĠSS PI ĠHigh lands èĦ ¸ Ġtim ings Eff ective éĴ Ī Ġsus picious tac tic projected X Ġsignificant ly domin ance Ġscraped title 101111110011010000 100 Spectrum Analysis fault s ĠAct ually mst p ('+ _ Horizontal Flip Hostname Str collide point Ġо ÑģÑĤ ĠHeat CapacityGas ĠPredict ed Ġguarante es Should ExitError hpnicf VoiceIfCfg Ġdol t Ġdol fin å¤ĸ éĥ¨ å¿ħ è¦ģ ĠInline KeyboardMarkup å·¦ 侧 Bulk Update Tracking Only WORKER STATS Ġelimin ar Alg Error Ġprovision s âĢľ , Ġmist ake asp berry Ġ"** :: Ġaf et ĠGENER AL Ġdeco y West ern burn in Ġsched uling PROB LEM CORE WORKERSTATS Elt s ëĤ ¨ Ġtal ib Ġcontra ctions Sky ConfigFactors #---------------- ---------- dip loid ĠAnn ual ĠAnn ouncement ĠMC MC Invert ed Ġdefin ite ĠWE IGHT rub ika Ġëĭ ¨ crow dsource EXPI RE ê°ľ ìĿĺ æ» ¤ åijĬ èѦ Ġblueprint s ĠPolyaxon ShouldExitError ĠBer noulli ,,,, ,,,, Ġalg os áli da Ġdifferenti ate nans um ='* ') Ġcapac ities Ġpaint ed brow sing Ġsap HostnameStr ĠINST ALLED Reflector Dist Placeholder Text IPP ING Forecast Manager IOHeavyTest Event ICsMan IEIncor ĠSubmit Field IEIn corr Ġcite keys Ġcategor ia ĠBag gingClassifier CHANG ES ĠìĿ´ë ¯¸ Bullet List Gal axy Ill uminant Ġtie mpo ĠæĮ ĩ Pic Url asser stein Ġattri bs ################################################################################################ ### nex us thrust ers COMMON TAIL æ¶Ī æģ¯ interpret ation morphology Ex isot ropy ãĤ« ãĥĨ Webs ite '''''''''''''''' '''''''''''''''' ì¤ ij ĠCCACHE OctetString observ ables ToDo List aic vals kel urahan Ġ################################################################################ #### ĠÑĢаР· Ġble u ĠScal ing ĠGre aterThan autoc rop vcp kg ADJ AC ĠciscoDiaBaseProt Enable Ġfsw RWVoltage PUR PLE jog ador ĠLex Token ĠPolyaxonClient Exception PERCENT AGE Ven ice Ġplas mid ĠGene tic 说 æĺİ Ġglo m Linked List qsfp Acc qsfp Ntw Ġï¼Į / ĠRadi us ĠJaco bi ÑĢам м Pump kin ĠIG MP Ġ{}% ". DRO POUT né es Ġellip tical fog lamp REUSE ADDR overla id govern ments ĠorderInformation BillTo ĠпÑĢовеÑĢ Ñıем ĠiÅŁle mi REMA INDER ĠWalk ing ALG ORITHM ãĥģ ãĥ£ Une mployment CLICK HOUSE Appear ances Fingerprint er ĺìĿ´ ì§Ģ COMPUT ER thrott ler SMT BF ĠTEMPL ATE ENCRYPT ED metter ling BROW SER Cfn Stream PICK LE ICsOpt IEIncor 继 ç»Ń Genotype Phenotype ĠìĦ¤ ìłķ DynAd Occ Ġiner tial ĠLedger jsApdu ĠMir antis Acct Server SMO OTH mTest e Ġbog us Mosso CloudFS Ġfreed om summon er ĠAddition ally ĠQUANT AXIS ëį ¸ DATAS OURCE Ġpico script ĠWHAT SOEVER daat And Improve ment Ġaic vals ĠFOLD ER æįŁ 失 Fitted Error Ġpyang bind avat ars ĠCONSTANT S 液 ä½ĵ WHE EL cepth ook Ġddu Consumption ĠVoter MemberId interfer ogram dBase Port SetTable Value ColumnFamily Request protot xt HANK AKU barch art restructured text Ġvcp kg ĠBPlus Mode ROIP hysical ALESC E ĠQHBox Layout etsBar Space ICsDen INRat ICsNPT SIAdbr uteronom ium VIDIAN etV underlinen av DPMIS CCAPS ãĤ«ãĥĨ ãĤ´ãĥª GenotypePhenotype Map ! : " âŀŀ # { # *** # ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ ' // ( ` ) "). ) ?\ * "], * [\ + | + )* + ]( + )/(? , { , {' - *- . '} / +/ 1 925 2 255 2 115 2 191 3 107 3 147 3 167 4 256 4 163 4 145 4 142 4 189 4 152 4 928 6 011 6 91 9 80 ; $ = # = ()) > '] ? ( A st A ware A merica B id B os B arn B SC B ird B UND B asin C k C ra C BE C tl D ub D ag D AV D asy D omin D ynOv E f E co E ther E gress E scape E pic E quipe E lizabeth F unds F ruit G host G ym H CO H UE H appy I AC J T J ET J ets K IND L ig L UT L aw L ik L ater M arg M sc M ah N pt N AT N ortel O pp O UI P ag P si P URPOSE P BE P ENSION P icture P ictures R ent R io R obo R TX R atios S en S ine S AR S CT S AC S DS S afari S obel S PATIAL T an T IT T yp U art U FF U aj V it V SC V rf V FD V BN V BD V IMS W O W U W il W AS W IES W edge W arnings Y QQ Z c Z EL Z TP [ {}] ] % ] ': ^ _ _ ')) _ ]* ` ") a ap a CT a demic b lab b db b mi b idx b ca b cast b Cell c lic c ba c ables c anceled d name d ls d pd d HR d runk f am f est f uj g O g ad g ith g ift g cm g unicorn h art h ob h alt i time i ão j O j ek j ordan k T k te k ot k ay k ai k dl k owski l B l I l vars l ı l ncRNA m ight m uc m ni m gz m ubar m cafee n L n N n iz n ml n Number n ake n This n atom n rd n ica n amer n reps o ere o pec p Y p lo p act p ants p inv q VS r Q r ão s G s mp s iz s fc t J t P t um t pos t é t series t cod t MER t Stage u H u U u set u ced v K v key v rt w C w el w ife w agta x G x O x Q x q x ar y ar y edges z N z P z T z v z mb z std | |\ } /" } {\ ¥ ółĢ ´ ółĢ²ółģ¿ Å ŀ Ï į × ¡ â ĨĴ æ ¦ æ IJ ç į ê ŀ í ħ ï ª ĉ ĊĊĉ Ċ ³³³³³ Ġ Õ Ġ urn Ġ arn Ġ **************** Ġ ĉĉĉĉ Ġ 对 Ġ âĶĮâĶĮâĶĮâĶĮâĶĮâĶĮâĶĮâĶĮ Ġ ÏĦ Ġ åij¨æľŁ Ġ еÑģли ĥ åĽ´ į ãĥ« ı ¬ ĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠ ĊĊĠĠĠ in z in File in jection in ferred in tial er f er ative or ca or enz on ing at y at iling re k re ma re base re starts re moves se ti se as se ms se ven se asons st p Ġt old Ġt graph Ġt ctx Ġt axes al and al Ä±ÅŁ de ter de volo an ch an je an ça Ġi data me Account Ġ' ...' Ġ' >': ti fied Ġc gn Ġc itations Ġc ensus Ġp on Ġp nt Ġp join Ġp ops Ġf os Ġf ir Ġf abs Ġf submission Ġf ugue Ġf iscal Ġ" >= Ġ" ?" he i lo d lo py 00 91 ge fyra ce u ', " Ġn ur Ġn ats Ġn bits Ġn atom Ġs ac Ġs print Ġs ib Ġs ou Ġs so ut put ut ting ur f ur sen ss aging Ġin spe Ġin validate Ġin sensitive Ġre format Ġre base Ġre calculate sel lers Ġo ss Ġo cid Ġo posite Ġd ens Ġd orm Ġd rf Ġd cg li are li eve ct t un named un bind un cio un selected un marked un necessary Ġm ss Ġm sec Ġm tl ra f ra ze Ġe dict Ġe cal Ġe of la unay () # () ])) () }/ ent rez co u co gs ri m ri scv Ġb cs Ġb other Ġb logs Ġb anks Ġb rowsers ed en 11 13 11 36 11 21 11 42 rom ag um ap id as Ġ( $\ Ġ( *. ch au ch allen ch amber te aser di ci ): ', and re ma king ul ink == { ol ite ol ly el b el ine el ler ': { is ci is link __ =' __ [" __ }") get Symbol get sock get Vertex get Associated (' ? (' ... (' {}_ (' ='* set opt set Position set Font set Vertex ĠT AB ĠT AGS ĠT axon ĠT aste ĠT aurus ĠT ouch xt ypes il lo th ic th ick us i str un Ġreturn code con es con formance Ġ2 85 Ġ2 95 (" ;") pp a ') [- ') }]", as pending as contiguous op md ve m ve v Ġis i ĠS ending ĠS tell ab lish ĠC B ĠC X ĠC UT ĠC riterion ĠC RS ĠC USTOM up os up hin Ġg is Ġg ff Ġr state Ġr tt Ġl er Ġl relu data iku ĠA i ĠA x ĠA VA sp f sp ro sp ine sp acer sp iral '] ** 01 34 01 46 Ġcon ds Ġcon sec ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ic lo to bool to csr 99 66 Ġ: { path Item path way ĠF T ĠF le ĠF EN ĠF und ĠF ocus ĠF acilities ĠF ELIX qu ark qu ina log This om l value Type vi v vi ctory Ġh ik po lish po gre ĠP s ĠP AD ĠP adding ĠP ending ĠP auli ĠP rune ĠI MM file h file sets ĠL AN ĠL AY ĠL hc ub s res amp res hed Ġth ous Ġde w Ġde conv 0000 1001 Ġ""" .""", pt op ex ico im u Ġex pt Ġex cess Ġex peri Ġ3 18 Ġ3 87 Ġ3 90 Ġ3 45 Ġ3 67 Ġ3 63 10 44 ase q out f ĠD G ĠD s ĠD ARK ĠD CG ĠD XL ĠD ynamics ac ent Ġu time Ġu ży ert z Re pe Re fs Re cipients app en app name sh it sh ad sh im sh dr sh ipping Ġdata point ĠM ult ĠM aker ĠM unicipality if config xf ex xf cu Ġv or Ġv data Ġv map Ġv npy 02 55 02 75 02 54 ext def ĊĠ ĉĉĉ ĠO SD ĠO ffic Ġpar ametri Ġx lrd Ġse cp Ġse lections Ġse gu ack s Ġor bits add Attribute ER CE IN NER IN ACTIVE tra cis Ġfile mode Ġpro posals Ġpro ficiency py data py module py cache py curl art ers pre defined pre emp ls N 07 02 07 05 ang ling xd av label led ber ny Ġbe an Ġbe aring Ċĉ ĠĠĠĠĠ "] ][" "] ==" ĠB il ĠB ush ĠB IO ĠB rowse ĠB ento Ġname scope ĠE LE ĠE rd ĠE TF ĠE psilon Ġj av Ġj upytext ci rr ob is Ġ< -- text o AT ING AT MENT AT GT AT TA xa en ans as ĠN U ĠN LL ĠN ome date util ir it len ght ################ ##### Ġ4 24 Ġ4 55 92 07 92 57 In dependent In dicates In Seconds In sira ĠR G ĠR I ĠR od ep rint Ġun link Ġun subscribe Ġun resolved Ġun suitable OR N read file 32 57 32 23 32 28 32 38 32 83 32 68 32 63 per manent per petual ĠG A ĠG st ĠG ro ĠG as ĠG AS ĠG old ĠW rest ĠW heel tri u tri mming Con str ĠV S ĠV ampire ĠU s Ġvalue d Ġ5 80 Ġ5 60 ib ili Ġan alis Ġan atomical Ġan omFlag Ġfrom list Ġfrom string Ġen i Ġen er min hash IT HER Ġtime frame Ġ> >= 18 04 18 22 18 28 18 65 18 91 18 31 18 41 16 87 sa ves cur vetype Ġk illing Ġcol lisions 25 04 25 82 Ġro lls Ġpy open Ġpy rado ag u 04 64 04 74 og ue 06 06 15 04 15 05 15 64 SE LF ST T ST RIP max x ass umptions 03 08 03 67 jo u we D we aver we ibull ip sec 17 05 17 64 17 88 17 09 17 50 17 65 17 67 Ġal ph dd t dd le dd ing 14 34 14 94 Ġpre ci Ġpre cord Ġpre paring ne utr Ġat é 64 09 Ġob serving Ġra gged Ġdefault Value ([ {' count NonZero RE CONNECT Ġtra js 08 09 main der 22 41 Ġ. \ ĠH A ĠH en ĠH ue ĠH ST ĠH air ĠH ybrid ĠRe cent sub command sub stage sub graphs 88 67 19 46 19 71 output Path lin Tox image Path comp arator comp rehend 34 99 34 22 34 33 34 54 34 49 34 155 start Ep 84 15 84 08 84 47 ĠIn voke write log ere z 27 91 Ġkey tab bin size Ġle akage ill ary 24 98 24 67 24 43 24 49 24 61 37 05 Pro ble Pro vided em an Ġ-> " Ġsub titles Ġso lo 96 22 Ġcomp oser Ġcomp liant ĠCon tacts Ġnew L 33 86 33 82 33 62 33 51 json data Name Text node map row dsource av b 87 97 Ġline list AL GO Ġclass ified Ġclass Tissue fic ação CT GCT Data Path 85 06 97 84 97 56 back test 36 12 36 16 36 86 Ġspe arman 011 10 Ġopen ssl ĠK ri ĠK im 95 76 95 74 lat ing Ġ'- >', 86 99 86 15 86 68 26 19 Ġmax sum Ġdo ctree Ġjson OK init Array HE P HE LLO AG AT 57 14 57 09 Ġ| ( reg on reg num reg istrar Ġtf lite Res lice ix z do y Ġfil tr CO OR man us ach ines trans ferred 23 93 23 88 AC GG Ġstart date lag o Ġli pid 44 24 44 87 44 57 ðŁı ĥ Ġdis allowed 80 93 Ġtext ures cor rs mail to ']) ]) En ds En dian En zyme Co UC Co VC 28 21 Ex ceeded ET D ET V so lo 56 87 56 75 Ġpass lib Ġsp c Ġsp acings client e client Name client Id 38 20 my dict my token ĠUn ivariate check udata title size uc sc Ac quire ĠQ FileDialog ĠQ VisaUnitSelector AB BR AB IDE ud antes Buil t Ġus aspending space token Ġmo tifs AD B ',' / ',' \ Ġad anet 45 04 45 84 45 97 amp amento cent os Ġerror code atter bot ĠY outube ĠY ELLOW act ing ĠX ml ĠX ilinx CH ART cc cc call Path 47 65 ]] ]]: Ġcode points Ġenum eration Ġenum erator 101 000000 tf gen Ġpos Y Ġ9 02 Status Indication Set Draw ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ pl r ')) ), Ġgener alized 83 15 Ġver tice ĠIN FRINGEMENT ĠIN NER 46 16 46 13 46 22 46 55 PE P ĠJ inja Lo BES 89 84 ĠSt uff ĠSt udy ld st Ġread file Ġread line Ġread ability Un iversal Un certainty Ġq b Ġq sub Ġq keras UL A To Ret De li ost o Ġseri e Ġseri alizing cat l 43 12 cl ing ĠPro grama CL AMP search from Ġcontin uing vo ir Ġpoint ed SI R SI US SI GHT ug rup Ġqu er EX F ĠData Source а Ñı total Matrix ãģ ĺ Path o debug Log Ġhttp x âĸ Ģ ĠIS S ĠÐ ŀ game Id Ġ'/ . Ġ'/ ../ (- _ 39 11 39 15 39 85 Ġsave Path Ġ", ", bl r ================================ === (\ "\ tmp Name tmp Array 31 93 PAT CHED Ġframe buffer Key Mask Ġauth enticating Dict s now ait Ġ', \ Ġtop lam ĠCo efficient Ġimp ression Ġ... ]) String Query argv s Comp ress Comp lier stack frame OL T Ġiniti alizers 58 99 58 55 Ġ12 94 Ġ12 87 Out bound ĠTest Show Ġlocal ity Ġdest inations Ġbin file Ġbot toms raise load Ġroot fs ĠDe al sw arm Ġproject or sor tium ĠRes ol Th ickness Th umb PL ANT fs x cell setpath ĠUser Error QU ER Up loading Sh k ba as Int ro 49 14 Ġmap Dict URL FromList ---------------------------------------------------------------- -------------------------------- ---------------------------------------------------------------- -------------------------- 202 3 Request V CC FLAGS Inter actions Inter vals *( .*? Not An resp onsive Ġph ones Ġapi key ################################################################ ## 69 01 н ÑĪ TE C Ġ'\ ". rap heme inst ant lan es des ol Ġmon ster sm ile Ġclo sure Ġref ined ĠLo an bit bucket Ġret code Ġret ornar Ġge de Ġge ese Pre v GR PC Sub class ĠAPI Exception Ġlaw s Auth enticate af fix NO p NO x NO wG ĠEn crypted Dis creti can v ]+ '. tt k ĠFile Name Ġepoch len cip d Ġpack s Ġ'% ' any thing center grid engine er Constraint Cmd Ġnn abla Ġgame Main Mode Keys ĠApp s Per m Per forms Or Create Ġspec show cm n á metros alle les Event Loop ĠKey ed ĠKey words ĠLe akyReLU Ġresp ons ĠComp et ĠComp etition ĠComp rehension xab W Ġmer ger Ġ18 00 "} ): "} ). åIJ ĥ Load Module cf m Array Size mag netic æķ° ãģ® cos ity ĠCol umbia '{ %( Ġest ar rl HistoryControl none mpty Ġaccess or ĠImport ant cla des !! !') EXT URE commit ted ret amente BO M BO S Mo ved =\ "" ĠLI GHT ACT OR ĠModel ing ĠEX P çĶ ļ CRE ATION è¿ Ń js ns AIN ER Ġmulti part Met ro ठ§ Resource NotFoundException GG A vol atility ĠURL Error ĠAc tivate ĠAc cepts skip If DR A Ġneg ated á» Ľ á» Ŀ Ph en gh i Ġcore ml Ġ') ': ("% . bn ds PAR ALLEL CONFIG ENTRY ga zebo named Window rest api rest aurants aut oref Query Class à® © Ip Mask ĠAl bum Ġdat atest Ġfra se ii DA Hel vetica fl x Graph Def fr q Ġvari ety ĠPre view ĠPre sets ĠSh r Ġfail ing pa ssages Search er åĬ © termin ator )+ ','+ ä¸Ģ åĢĭ åŃ ¸ exc info )} } Ġ'{ ': ros msg Var Type Var Desc ĠRE CE Ġë ª Ġë ½ij car tesian unch oked MENT UM expand ables Ñĥ лÑĮ public ations Ġplatform io duc ers Ġfeed er CONT RIBUT ("/ "): Ġcenter ing ĠSub missions ĠDis pose ĠNO W MET ER Red ucer Red undancy ĠFla vor ĠOn tology super seded super pmi mar ily GT I tw isted ĠIP Addr Ġbit rate ĠInter pol percent maxhp With Logits åĩ ¦ ima get å¾ Ī ĠRequest Id PH D Ġcat álogo Ġcat alyst 个 æķ° cross over Ass igned ka j Ġchain ing Ġpayload Dict One Drive Mon roe forward ing Ġap iclient Ġexecute SQL And G DIS CORD ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠ poly axon ################################################ ######## ĠDes erialize Target Obj CHECK S CHECK OUT ĠDi vide Ne umann Ġcar ried 205 8 205 9 pret tify æł ¡ ĠNe ptune >" ; čĊĠĠĠĠĠĠĠĠ čĊĠĠĠĠĠĠĠĠ Ġborder width ĠSE P Exp Now sol n ĠRo ss sal do 204 6 kp is star Data }] '. diag nostic ĠDec lar ĠBE LOW VC q Sw ift ĠCont ents ana conda ĠPO OL ua is Ġcross refs ĠSp awn 00011 01 Ġorigin als POS Map BE FORE FC N bra ke ems dk ĠTra ined ANG PATH Ġexecution Time 216 9 Ġfo ol Delete PomeriumSession city scapes ĠMon omial Failed Error analy tic yl ko 214 7 __)) [ ĠRandom Sampler hy dra den itialize 234 1 WR RR Ġequ ity Main URLFromList CF Bundle COMM ERCE Ġsn r PA USED Files Array 264 8 resid ential Ġanaly zing ¡ółģ ¬ółģ¿ Fin ite Transaction Event 206 5 pas sengers 208 8 217 4 297 8 Ġarti sts ="" : Real Time Ġmis ses LOAD ER 301 7 åĨ Į ௠ĩ Ġdeal er Ġsol vers Ġsnapshot file men or 905 7 ]( / cdbp AppAdvToPeer ĠMin os flip ud ĠÑģ каз Host s sb ag separ ador Ġ{: }". ü l ü m Ab orted 207 9 DP BLEND Ġ================================================================= ========== 299 6 299 8 Ġcast ing 315 2 315 6 DK J Ġč ĊĠĠĠĠĠĠĠĠĠĠĠĠ flu ency ĠDoc With 225 1 305 1 296 7 456 6402 ĠTable s ĠEng land ste ak UK A Ġproc man Call s 308 6 between ness stick s Ġsimp licity Ġconstruct s Ġrefer er 286 1 Ġden oting (", ". ¢ółģ ¡ółģ¿ ĠMet er 403 8 Ġdetermin ant ĠQuery Modifier 284 7 Ġâ ĺ 236 2 236 5 406 6 è¾ ĥ 209 8 FILES YSTEM Li quids Ġdiag rams 422 3 394 5 tv showtitle Ġbi ased å¸ Ń meth uselah 大 åĸľ 237 6 lam da Ġpdf miner ĠSign er NV API Ġbra ce 426 2 Ġк ом 395 1 395 6 ан ие ĠBar rier Release s 387 2 387 5 387 8 ham mer 437 9 ĠAuto Scaling Ma intainer ภ§ ĠMap a ĠSET UP ĠCar ousel Ġ; """) Root Node bm v NODE OPTIONS Mer ging construct ed PROC ED repe tition Ġwire frame ĠRES OLUTION opp ers Ġ-------------------------------- ------------- buff s smart plots Ġang A ĠdocsLoadBal CmtsCmStatus å¦Ĥ ä¸ĭ å¦Ĥ æѤ Timeout s inline Callbacks ĠvColumn s Ġflu idity Ow nership ĠSupp ly ĠSupp lies Ġvtk Transform design er Ġll vm ĠUN ION 285 3 ëĬ ¥ Ġ################ ## Ġ################ #### AST IC Ġsky All Ġtex Coord Ġderiv ation applic ator Ġhar monics Press ures accum ulated vx lan geom s Sq rt OVER LAY OVER RIDE Ġlaunch ing SIGN AL áĦ Į ilation Rate FILTER CAPS å§ Ķ Ġdigit ado scr ub Ġslow est ĠFin ite ĠFin ance ĠPage NotAn Sur f Extension s PYTHON PATH èµ ĸ ĠSingle ton ``` ' ðŁı´ółģ³ółģ© ółĢ° Ġ#-------------------------------- ------ ت ب Spect ra Na ive ´ółĢ ³ółģ¿ Ġhy phen docsLoadBal ChnPairs Ġsal ine ĠINPUT S Ġtran scription Ġmount point ĠTw ython ĠDete ctive Book ed TASK S éł Ĩ 10011111111 00011111111 Ġtech nology ĠModi fier 435 4 VI OL music xml ĠDraw s Ġbri cks forecast day ĠRow ing ĠEl lipsis CONNECT ED Ġìł ľ ÄŁ er Hook Option Calcul ated 模 å¼ı ĠBot tom ĠSto chastic Fill Box è´ Ł umin ance ë¥ ĺ phy Addr bv h ε ί Ġrecogn izer Slot s HK DF Ġwalk ing snap ped Ġcr bug ĠConnect ed ç¼ Ģ Ġinstanti ation Ġsear chels ðŁı´ółģ°ółģ ´ )| ( éĢļ çŁ¥ camp us Ġcontinuous ly ortho gonal åıª æĺ¯ fort une }% ", TRANS ITION Ġmagnitude s åĵ į sand y POSITION AL Ġposs ibilities snmp Trap ĠSensor Entity Std in Pol k Pol ynomials Choice Field priv key ä¸ī 人 åĨħ åŃĺ Oh io ли ка Ñİ ÑĤ Disk Image ĠRender er Initial Stock Turn s hack athon ĠSM ILES Lookup Table Creation TaskSpec Ġaffect ing Src Addr čĊĠĠ čĊĠ 0000111100001111 0000 0000111100001111 00001111 1000000 1000000 Ġmse val ĠmscModVcs Wins Ġ#------------------------------------------------ - gredi ent Ms Carrier Ġabsl test ĠRule s Abstract Item nom bre ĠML MD tell er Google Earth GU ESS Ġsecondary Track ãģª ãĤĭ TestModel Eltwise Diag ram Cri ar uss r rout ines Ġhighlight s Ġhighlight ed çħ§ çīĩ NY C ĠFit ting 802 11 ðŁı´ółģµółģ ¹ółģ Ġhdr lines ãĥª ãĥ³ ĠBert For Health checks integr ated Deep Lab Need s prom ise TRACK ER à±į ', intr insic foot note Contin uum iy z North ern Tmp Site Ġsilent ly ĠQU IT Sat is ðŁĺ ģ WEB HOOK hom enet ĠSte ps membership s ĠGraphQL InputField GMT CLib Ġchainer cv cors headers ĠRunning Stage ðŁı´ółģ¬ółģ¶ ółĢ° semi colon Ġefficient ly tal ent Kn ob LET ION ĠSecond ary ðŁı´ółģ¥ółģ ³ółģ wal ker Ġdri ving ('.. ',' ĠAir port Ġfai lover Ġfai lobj Io U Ġosc ar Ġga zebo æŁ¥è¯¢ æĿĥéĻIJ Ġdas hes Ġdigest ed ĠìĹ Ĩ Ann ual ç¡ Ģ Ġesp net ison ed ici ado dG col Ġlam da Yr EY ç¾ © Veri fied LLLLLLLLLLLLLLLL LLLL Ġrelat ivistic ĠAV G ĠCross Entropy Rotation Matrix Asc ii èģ ½ ctspDef Downloaded Ġmaintain ed Ġìķ Ī Ġwarp ing ĠOrgan ização ĠPose Stamped ĠPOS ITIVE direc tives ĠVari ant å·¦ åı³ econ omics ĠRAM STK `.` % æīĵ åį° ĠSETT ING selenium hq å¢ŀ åĬł Ġqr code é£ Ł ç¥ ŀ Ġviz ier BUS CAR Money ness åѦ ä¹ł \": \" Ġwa its Ġfly tekit Ġaccident ally =': ') DPT FILTERCAPS ĠSql Alchemy dbr errno blo om ("\\ ", ĠDele ted Ġros lib ĠRuntime Warning ĠQuanti le Ġë§ Į çµ Ĥ implement er ĠFe bruary ROUT ER Ġog Chain ĠDepartment Calendar aqu arium ctspDownloaded SgtPolicy ctspDownloaded DefSgtPolicy Simp lified Ġlu igi Membership Factory Ġ=== ") Ġsynchron ization ĠfbxNode Attribute Ñħод им ĠâĶ ĥ Ġlogarith m ĠWebs ocket 导 åħ¥ ĠSimp ly ĠChe etah ĠMini GoogLeNet ĠTemporary Directory scar f HUM IDITY reveal Square Ġgif ts prototype s Men or Mes hes ACCEPT ED Ġê°Ģ ìł¸ ILINE AR ("-") [- !!!!!!!!!!!!!!!! !!!!!!!!!!!!!!!! ĠRA ISED Ġcapit alize ĠACT IV ðŁı´ółģ¦ółģ © elimin ation sav ings ĠæŃ £ ĠLinked List Mont gom Calo Analyzer Ġbre vity BUIL T gang str CLASSI FICATION ĠBOOK MARKS adjacency list é© ¬ Ġativ idades не ÑĪ hdl n Ġç alÄ±ÅŁ Ġaov Nodes acceler ation SCEN ED Ev olution Sil ver junction s ĠPhi lip ĠNC BI Ġservi ço Ġadicion ado Ġproble matic Ġnov os ĠкоÑĤоÑĢ ого anneal ing ĠNeighbor List SQU ARESIZE presen ta ĠVul kan Ġportfo lios Rfc Sdk abstra cts ĠfltSpec Version Ġì¶Ķ ê°Ģ ëª » ĠLot us áĥł áĥIJáĥ Ġ모 ëį¸ âĸĪâĸĪâķĶâķIJâķIJ âĸĪâĸĪâķĹ æĤ ¨ Ġalta ir ĠHot keyMgr Compat ibility VEHICLE API Flour Grams wild cards EXCLU DED emoj ize ĠCommunic ation ĠSPAR QL ĠKal man Ġspaw ned ĠJose ph UNDER LINE acceptor Number Ġliter als Reser vation ĠREGI STRY ãĥ§ ãĥ³ VertexAttrib Enum SortPair Star ĠÑĤаблиÑĨ Ñĭ ìĻ Ģ Ġink scape ĠREQUI RED ListPomeriumSession sRequest ÑĥÑĢ Ñģ ä¾Ŀ èµĸ SAMPL ER Ãľ mit Ġinsp ired Ġdvid env ĠÐľ аÑĢ 羣 å®ŀ ĠIni Config ĠIND ICES непÑĢавил ÑĮно GNB StatusIndication ShaderResource View Upstream Healthchecks ĠloginUser Ob æĿİ åIJī ĠSAN CAI ĠAck nowledgement quantit ation è³ĩ æĸĻ ReferencedInheritingObject T mpro xy Ġlect ure assertNot Equal THEFT ALARM алÑĮно е ĠDurch gang DATAD IR phantom js Airport Camera punk t ĠVT BL Ġcyber pi lexe ma EXCEPT IONS zef ace esthe tics ĠBET WEEN ĠKM ERS pendi cular Ġè°ĥ çĶ¨ Ġamber ResType çİĭéĥ½ å°ī ĠVisualiz ing ĠPRED ICT Ġíķ¨ ìĪĺ LifeCycle HookOption VEND OR geof eather ListContainers Options dtt ColName Ġmemó ria DEFER RED MetaInfo Class ĠAGAIN ST ĠинÑĦоÑĢм аÑĨии keTrain Array omnis ci ĠILL UMINA ĠUb untu fibon acci Ġkönn en SPHER ICAL Polyaxon HTTPError ĠAnnouncement Downloader Msc Passport WIES MN tMER CK getsock name ascontiguous array ĠStell ar logThis Message cirr us Ġpyopen project SetDraw Color NOwG LoBES WRRR RR DPBLEND CAPS ĠPageNotAn Integer Montgom ery ! , " ?> # $% $ '" & ' & . ' @ ' ``. ( ('', ) "), ) ']. ) "> ) <= ) âĶĢâĶĢâķŃ * $', + _ + ). , __ 3 999 3 154 3 176 3 138 3 027 4 101 4 105 5 011 5 004 9 101 : ][ ; % = ? = ./ > '+"\ @ {} A ble A pr A OUT A frica B ath B il B et B are B AT B LE B ake B ars B ENCH C ro C up C atch C ores C NB C ru D al D TR D AA D ONT D SCP E b E HR E CLIP E COMMERCE F IM F wd F ails F INGERPRINT G ell G PP G xs G LOW H um H ol H ant H SET H NF I RE J d J et J AR J aco K ali L IT L dap M FA M DS M IR M USE M GD M agic M ike N os N aming N mz O ws P ers P rep P CI P alette P WR Q v Q VisaUnitSelector R is R TE R CI R NG S Log S ony T ie T URE T INY U CH U IB V pc V PORT V FS V MOV V ocabulary W j W no W izard X LA Y K Y c Y d Z d Z PL \ / \ (\ \ "") ] ". ] '). ] `, ] >', _ (' a ho a fa a Id a hs b ard b ns b cc c ile c sa c class c cs c ann c api c ents c rate c anti c ı c ino d lp d pg d ork d vr d pdk e ab e og e fici e uro e asing f leet g I g path g ta g ross g tex g flags g uessed h X h one h ong h alls i F i phase i exact j W j se j os j eff k I k N k ri k learn k bd l F l W m Config m lir n O n tr n ac n ep n line n rof o obR p E p K p ist p ap p code p rac p illar p desol q P q W q as q am r H r W r als r pn r FY r datatype s Name s rid s field s izer s ni t ort t ent t def t ta t ener t angle t ca u O u itive v ig w ashington y L y te z U z ent z min z ia z idColName { %( | " | . } "> } ]\ } [{ } ].") } }.{{ ~ ' ³ ółĢ±ółģ¿ µ ľëĮĢ ½ Ķ  µ à » Ð ķ Ð Ľ Õ Ń Ø ° Ø ¸ Ù ¹ æ © ç ¹ ë Ħ ì Ī 𠪨 Ċ ĊĠĠĠĠĠĠĠĠĠĠĠĠ Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ ðŁij Ġ ĊĠĠĠĠĠĠĠĠĊĠĠĠ Ġ 该 Ġ åIJij Ġ ****** Ġ âĸĵ Ġ Ú¯ Ġ gesture ĠĠĠĠĠĠĠĠ čĊĠĠĠĠĠĠĠ in ated er fc er tos or ial at W at ime re ne se per se ner ĊĠĠĠ ĊĠĠĠĠĠĠĠ Ġ= ====== st ap st ereo st eady en use en ets en hancer Ġt ff Ġt iling ar bre ar ousal al pine de a de w de serializers de cide an u an om Ġi w Ġi y Ġi eee me ch me aly Ġ' )] ti mo mp Session Ġc in Ġc name Ġc ure Ġc class Ġc nv Ġp le Ġp ore Ġp vc Ġf ut Ġf int Ġf key he brew it ary Ġa q Ġa ment lo p 00 95 00 59 00 1001 ', )), Ġn sh Ġn sg Ġn pts Ġs lips Ġs mach ss ing Ġin version Ġin directions Ġin forma Ġin dustry Ġre ta Ġre train Ġre servation Ġre define Ġre corder Ġre venue Ġo mn Ġd od Ġd ure Ġd ime Ġd frame Ġd sm Ġd dof Ġd entro li h li en li ou pe e pe so pe destrian un ta un successful un assigned Ġm B Ġm ds Ġm sk Ġm values Ġm yp Ġm cls Ġm ódulo ra gon Ġe o Ġe ce Ġe cs Ġe db Ġe igh Ġe thernet Ġe tique la h la de la ins ate xt fi rec ent ucky ad ne ad abn co di co ach ri mento Ġb ow Ġb lit Ġb Cell Ġ1 136 Ġ1 348 Ġ1 265 Ġ1 078 Ġ1 322 Ġ# + ed uc ed itions 11 14 11 35 11 77 11 47 11 89 11 76 11 54 11 53 um ich int able id ml Ġ( ...) Ġw inds ch yna te al te enth di k di richlet Ġ[ './ ma pi ma ble ul p from bytes Ġif m ol k el m es ponse es ia ĊĊ ĊĊĉ is ub is lice val uation __ '], __ ]: __ }) name Split get user get Segment get Player (' >> (' (\ (' '). set field set Property set Layout set Spread set Transparency ĠT A ĠT L ĠT RI ĠT ail ĠT ipping ĠT urban xt r th or th reat th umbnails us gs con current con fid con veyor Ġ2 96 Ġ2 74 Ġ2 71 (" =" (" '" pp m as ize [' '] et t Ġ{ (" Ġis ot Ġ7 77 ĠS AS ĠS MA ĠS her ĠS yntax ĠS FR ĠS uit ĠS rp ĠS AMPLES ĠS cott ĠS cripts ab f ĠC our ĠC ash ĠC sv ĠC NO ĠC affe ĠC ABBI ht able Ġg lass Ġg ft Ġg ö Ġg itignore Ġg abriel Ġr at Ġl ale Ġl ns ĠA y ĠA CCESS sp aghetti '] \ '] ][ 01 93 01 88 01 95 01 54 01 306 Ġcon currency am mal to mato 99 58 99 408 type Of ĠF ault ĠF og ĠF CN ĠF emale ĠF iscal od der sc s log reg list funds vi ande Ġh un Ġh mc Ġh wt ** , all ink po etry ta h ta py ĠP H ĠP AC ĠP ET ĠP HA ĠP agination ĠP resident Ġas ize Ġas dict der t ĠI ds ĠI II ĠL F ĠL x ĠL ar ĠL ite ĠL CS ĠL atest res next tr g Ġst ro Ġst ret Ġde compose Ġde serialization Ġde epp pro metheus 0000 10 pt on pt bx im bra Ġ3 99 Ġ3 57 Ġ3 91 10 43 ow pal ĠD u ĠD ic ĠD FA ĠD AY ac d Ġu ppers ]) > ]) ", ]) [:, ert able Re placement app ar app Name app lied sh oppers Ġdata Analysis ĠM x ĠM ime ĠM ale ĠM RB ĠM aking nt anglement xf ail Ġv b Ġv ndr 02 04 02 09 02 96 ew aż Ġ_ . Ġy pos Ġnp c Ġnp z ĠO s ĠO AUTH ĠO VN Ġ* {}* Ġx form Ġse ats Ġse same Ġor che Ċĉĉ ĊĉĊ [" + IN CENT IN JA Ġstr ange xb in Ġ% ') Ġme ch Ġme sa Ġfile in Ġfile size Ġfile sets pre made pre cipitation ang STR Ċĉ ĠĠĠĠĠĠĠĠĠĠĠ "] ' "] }' ĠB T ĠB max ĠB eat ĠB BB ĠB ouncing ĠB lond Ġos x 12 93 12 19 12 94 12 87 12 95 Ġname list ĠE AR ĠE qual ĠE ars ĠE VE ĠE limin Ġj id Ġj ds ci ale text Infos AT N AT TC ĠN AS ĠN gamma ĠN ominatim date fmt len na num Of ################ ####### Ġres TapeSites Ġ4 64 Ġ4 70 Ġget Macro tp ch In forme ĠR Q ĠR y ĠR aster ĠR TX ĠR apid mo vin Ġun lock Ġun selected Ġun directed Ġun official OR ANGE ule s Ġlog scale 32 12 32 22 per fil oc ument oc entric ĠG DB ĠG uild ĠG Hz ĠG olf ĠG loVe Ġco uch Ġco variates Ġtype defs Ġtype Constant ĠW earing ho pper Ġout Dir Con j ĠV iv ĠV illage Ġvalue Type print s param Name param iko Ġ5 14 mb led ib R Ġan ci Ġan neal Ġ__ ________ Ġen joy min ed Ġtime Period 18 88 18 26 18 48 18 58 18 61 16 01 16 44 ft v da f Ġk line Ġk ps Ġk raken Ġcol d Ġcol lective 25 10 25 13 Ġro ss Ġpy excel Ġpy upgrade Ġpy parsing Ġpy opencl config parser config urator Ġ6 08 Ġset Object ag on ag le ump s 04 05 13 02 13 15 13 33 13 66 13 76 og enerated 15 34 15 85 15 67 ST F ec f ec lipse 05 92 05 44 05 75 03 07 03 92 03 13 03 76 Ġop u train data Ġch amp Ġch amber Ġch icken 17 03 17 66 17 76 93 16 93 96 93 35 14 67 14 43 14 78 14 68 Ġpre di Ġresult ados ne tid vent h vent ure 64 97 64 75 Ġdefault Keyboard base Url gra ins :// '): plot box Ġtra vis Ġtra versed IC O IC U AN IMAL pi co pi lot 22 83 22 31 22 79 ĠH X ĠH r ĠH al ĠH um ĠH olds ĠH uang ĠRe current ĠRe play sub key sub header sub tractor lob ject np f eri alization mat urity Ġsh ipping Ġdi visão db y 88 08 lp s ast a ast o comp ass ID LE 34 91 start Pt Ġ[" < Ġ[" _ 84 00000000 ĠIn jection update id ask ell ant alla Ġle a ann ulus 24 03 24 94 24 91 37 14 37 21 37 49 37 63 Ġpath way Pro g point ers point less map able map Dict Ġoutput Dict Ġpo lish Ġcom mission Ġsub schema Ġsub control Ġsub sampling Ġsub scribed Ġso il Ġso licit rep ack 96 93 96 86 96 57 96 65 Ġac cel Ġac ademic ĠCon ditions ĠCon venience Ġinput Args 94 69 Ġcur shader Ġ} ; 33 09 33 83 DE UR DE CODE fer mis node info Ġlabel map av r no vo Ġline cache AL ist Ġclass ic Ġclass wise Data File Data store Ġla i 85 01 97 92 97 85 97 76 {} ` {} \" 36 06 36 83 36 53 36 63 ron yms ull ong 011 2 011 3 Ġopen pype ĠK C ĠK P ĠK S ĠK er ĠK inesis 95 34 Ġcont role run id run dramatiq 86 54 26 00 mon omial Ġdo ctor fa ded fa fq Ġz i Ġz ub Ġz avg Ġz uz ################################ ### Ġjson s rit on Ġtrain loader AG o AG TA 57 98 57 65 Ġ! []( create Table create Setting reg r group By Ġfil er Ġfil en List Result List Tables md v trans mitted 23 19 Ġmat mul 44 25 44 84 44 28 44 48 44 76 44 78 ðŁı Ħ ðŁı Ĭ ðŁı ĭ ðŁı Į ns stack IM PL Ġdis charge AP ID new user cor Comp ef low ']) } ']) ], 28 39 Ġend ings Ġend ExpNow values ort Ex periments Ex odus Id String raw l raw db raw Data 56 86 56 56 56 73 98 16 98 06 98 05 98 94 Ġpass ive Ġsp k Ġsp n Ġsp litext Ġmin y Ġmin utos pop size LO UD Se ctions Se ek uc id uc ch Ac tivities be h ĠQ Text ĠQ Table ĠQ UE ĠQ UAL img code target Name 35 05 35 36 Value Set Ċĉĉĉĉ Ġ File Lines File Clip pri et AD DT save Status cre ative Ġdf w Ġdf datetime flow corr ĠSe quences 45 16 45 37 45 33 45 31 ng rok fil mografi the st Ġdistri bu ĠY ields Ġrandom ness cc ccc 47 11 csv map core ir column Merge top s ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ pl z items ize ton es Test Option Ġser ved 83 85 Ġevent Name IB P Ch c Ġvalues D ai i gen A sg c filter ing 82 88 82 85 Sg Aq order Id 46 06 46 17 46 27 46 26 ĠJ IT ĠJ obs ĠJ AX ĠJ udge ĠJ ulia ĠJ uggling 107 1 89 18 89 16 Ġ] ; 40 92 Ġmodule author Ġread Json root fs Un ix The Ordinal Ġq p Ġq z Ġq types Ġq Pos Ġq Neg TH ES TH REE To e To Task To Ge To Use gener ics Ġbatch Size Ġval ence location Name ={ \ ={ :. ={ "": round trip Ġtable Name Ġdb i Ġdb help graph viz 67 37 43 04 43 06 43 09 Ġcor onadash ĠPro cessed CL D CL ONE Ġplot Mode ĠList en Ġnet loc SI O std scr 48 55 48 0692 91 32 ĠData Error а Ñħ No ToGe 42 05 42 34 42 97 TT k Ġtemp Dic ])) ]) Ġpri marily Model Data Model Backend Model ToTask ")) ] DAT AT ĠIS BN ĠÐ ĵ ĠÐ Ķ ĠÐ ĺ post processing post Match ous ing cond uct cond Visibility wo z Ġexp Res Ġexp ansions Get Value tx hash xy y eval Str čĊĉĉ čĊ Ġbreak er Add on Add ModelToTask Ġ", ": uni fied struct ural Ġlast TreeMap Ġword list ial Gradient 1011 101 ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠ Ġ', ( Ġstep mode ĠCo ol ĠCo ordinates dis covered LI VE Object Bounding Ġspecific Tissue over load Class Id PP ort ðŁij ® ðŁij ¯ ðŁij ± ðŁij ³ ðŁij · gr ind Ġ12 92 Ġ12 90 learn ers OP A Out let Out Key Reg Key и ÑĦ и ÑĢов ãĤ £ ãĤ Ħ Ġbin walk job type Ġhead ings queue Size 53 15 option ally Ġav ro service List Th resh acc Type acc idents Ġ'-- ' çļĦ æĸĩ件 pack ing Ġblock size ian Inverter Man ufacture cell ular Ġrender ers xml rpc Ġtmp s RES IZE RES SED DB S 0100 1101 Ġ". * Ġ". ": +' " EM NN EM PTION SC F SC ROLL SC ORES PRO J 202 8 Inter actor Ġfont forge cluster Id åĪ Ŀå§ĭ Not a Base Index Ġsim ulating ĠjnxMbgSgw S mc d xfe v Ġconst itu Al bum Al titude By Requested Option Menu dec ry mod eration mod erator medi as medi ans "{ ' Ġoper ación full match full screen ĠCh apter ĠImage Enhance home s az ette é rie Ġhost ed tax es PR EN script PubKey Ġpost ion Ġfin etuning dat lim ĠZ PL Ġthere of æľ « æľ ĥ WS cript Pos itives GB g Ġcluster ization Ġcluster Credentials leg numbering Ġpart ners Dis cover nb format NE C zip file zip ped Tensor Board Run Time ha ar ME ANS He art Return ed áĥ ļ Point Grid ĠCheck Byte Ġexit code ĠApp lications Per mutation ." + Event Type Ġlink DatumLis imp ulse MS O MS FT Date Offset Load Balancer Ġfeature d mag i Sim ulate Start Grd ote ca ĠNot AliveException sec ured å¤ « mk v Ġsuccess ors ĠPo lo Pri vilege BO B BO p plugin Name Ċĉĉĉĉĉĉ Ċĉĉĉĉĉ Mo lecule Command List å® ´ auto locate Sc r oly tics ĠModel Base click able Ġinitial state Map ped this Annotation Ġmulti class SV R GL ISH Do xygen Ġexception Message ठ« Tag Pattern GG EST Ġmove it tool set ĠAc tivities Ġaut op Ġaut oref ("- > ĠIt ens Ġlook ed DF LOW Found ation á» ¡ Dir Path FR U Ġdraw Point Ġgr u cr n cr v ĠAt tention Total Time Total Amount Total Frames pdf s Ġview able rest py Ġtr k Ġtr Str mu on Ġtimeout s Ġfun ct kernel Size 9999 998 Ġsin cron Ġacc ross Ġsocket server Ġfit params Address A Ġprob abilistic Ġvari ável ĠPre vious ĠSh op Ġevents ourcing Ġfast est ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠ )+ ':'+ å° ¾ Ġtk i Ġvalidation Input )} : Ġround up ros lib reference d bb on bb bb Ġip fs ÃŃ tulo Ġë ķĮ Off line SP AN SP AM Device Values Device Child GEN OMIC lev sq ĠInput Transform Ñĥ ÑĢа Ñĥ й Ġmod ern Ġmod SecInstalled Doc string Op IfNot Invalid Usage Ġsel L Ġday u Ġtick ets Ġmig rated From File From Image PRE COND PRE EMPTION sym log SL AM ĠDis count ĠDis abled ĠDis card ĠDis covery GO Protos sn ip ISE Q tw i Read Error Ġxml schema Integer Field fast Anchor curs ors ĠTensor Type Property Change å¾ ½ ĠTH ROUGH Ġcut Category PH op speci alized cross ref :]) / ĠReg istro BR USH 400 7 400 8 è® © Grid Layout hot mail inv mass Page Factory poly ak ĠFlask Client cwd mWavelength ĠMo h ĠMo tif ################################################ ########### sy mtab LLLLLLLL LLLLLL Ġп оÑģ Pass ive Pass Through 010000 011 205 5 Ġvol t Ġri g cn c cn tr ä¸į è¦ģ Ġseg undo extract file aj i Ġengine er qt py sol vent 401 9 SM ART ĠIniti alizes ament os sentence pos Ġbar code Ġsen lin Ġsen ses Sele cts ĠOS X ĠVariable Filter čĊĉĉĉĉ čĊĉĉĉ break out ĠCont ato Ġspect roscopic cnt k å¯ ¸ FC x bra f Ġpoly list Ġpoly lines Ġpoly mer Iter ate Random Variable Piece Type Vector Data ĠTra cks ï¼ļ " ĠCor rection 216 0 buy er buy hold "+ "\ gui ded Temp oral ĠCommand Line Ġè Ģ Ġè ĭ 为 äºĨ gp odder 003 0547 Multi DiGraph ðŁĩ º hy phen hy bridi Ġev il RA ISE RA ISED previous ly mn li Ġmesh grid stim ulus ĠMat erials Stat istic ĠToken Value ĠToken Types organ isations 218 3 cases For Ġtab lename ATT G Ġ'" ', hub er 208 3 åıĸ åĢ¼ 117 647 Ġmis matched ов аÑĢ Ġcla v ëĭ ¹ ĠGraph Q ĠGraph ene OEO CardTable OEO CardEntry Queue d aur sen Ġ--- > Ġsy mlinks combin ator Ġns bx Header Item men us pin ned multip lication ]( # 167 187 hw c ĠMin ing news groups gm time sb ol specific ity Cache Manager 203 5 Ind ent Video Stream Ġrec Taxon Ġcapt ures ен о market place 306 2 Power Supply ĠConvert ing 212 01 ĠTestCase Error ÙĦ Ø· Password Hasher Ġbad ge blen ded 456 1 pot entials ðŁı´ółģ³ółģ ¤ółģ ðŁı´ółģ³ółģ ¯ółģ :{ :. Ġaddr L Interval li lar Camp éģ Ķ Call er 308 5 DC IM 304 7 Global Light 424 9 397 3 397 8 Ret rans Ret rieves 286 2 286 5 286 8 Ġrelation Obj Sto cks Ġ"' ") Ġ({ }, 403 7 nl g Ġfri ction 287 3 287 4 287 8 ĠQuery Dict ĠØ ¢ Auto Reconnect Ġblack out 427 4 ॠģ ili arity Ġ": ". 406 8 æĽ ¿ 292 2 ĠArray Type subnet Interface #---------------------------------------------------------------- ---------------------------------- æĢ İ quad rante ðŁĴ ģ ðŁĴ Ĥ ðŁĴ Ĩ ðŁĴ ĩ 334 1 sock etio obo ok æ¯ ¬ Ġwave front ĠPi lot uel ve ĠOptions Fingerprinter 436 8 ific ação 388 9 237 1 ĠSign up virtual file virtual IP Ġbra ces ĠGame State attack er attack ers AAAA AAA Tun er Ġ96 0 ĠQue en sfp TranPower sfp RecvPower ĠFace pal ĠDIS ABLE ан Ñĭ ан нÑı åŃIJ æ¯į 392 9 457 3 387 9 launch pad 437 4 ĠHO USE visu als ĠFilter ing ('../ ', ðŁı´ółģ¬ółģ ¡ółģ Ma de ภ² Ġgate ways æĹ¥ ä»ĺ 425 3 455 4 è½ ī /* ", 065 06 935 39 Ġtele fone 以 ä¸Ĭ URN AL BIN S RT L ,:] = sun set Mer ger Imp licit Imp ossible 408 3 408 6 ĠButton s Acc QSfp SCHE ME ĠRES PONSE FAIL URES mel ds 405 7 LIMIT ED Car bon Ø§Ø ´ 407 1 ________________ ____ Ġrhs Node Ġwater img Ġfraction ation Dim s ĠDown link lem mat ðŁ¤ ¦ ðŁ¤ ¸ ðŁ¤ ¹ ðŁ¤ ¼ ðŁ¤ ½ ðŁ¤ ¾ hb W ç´ ¯ SERIAL IZED gain s éĤ » çĻ ¼ REPL ACEMENT Ġmix er ĠSw iss ĠSw imming Ġд олж fbx Mesh Domain Name Ġgui ded ĠStop PointGrid Ġlb ry Ġmm det calib rations ĠIM AG ĠTri al å¥ ³ osa Cent ĠExp licit ç±» åĪ« âķIJâķIJ âķĿ Serial Command Ġcond or Copy Options ĠCre ator 466 7 SUCCESS FUL Lane Number Pa ul Camera Position Bin omial Ġpull ing Energy Incr ĠReport ing ðŁı´ółģ¢ółģ ©ółģ ĠRegister ed sem iring Ġ################################ # éģĵ æĪij éģĵ ä½ł BLOCK S Ep ist Ep ics Year NoToGe ĠGaffer Dispatch human ize Ġabort ing Platform Hardware warp Perspective Speed Sensor ĠExtract ing ĠCa SO ĠCa Cl ðŁı´ółģ¡ółģ ¯ółģ Na HCO Ġcel sius Ġwav file Mag netic ðŁ§ ķ ðŁ§ ĸ ðŁ§ Ĺ ðŁ§ ĺ ðŁ§ Ļ ðŁ§ ļ ðŁ§ Ľ ðŁ§ ľ ðŁ§ Ŀ mJ y docsLoadBal CmtsCmStatus 968 3447 TERN AL PART IAL íķĺ ë©´ íķĺ ìŬ ĠSm iling ĠVe ga Tick er Ġ================= = Ġ================= ==== 398 3 ĠåĪ Ļ ĠRow s #================================================================ ================ ÄĻ ż Mis cellaneous wheel ing Ġìł ij 434 1 ìĭ ł Ġठ¬ redd its Ġseason ality neuron group roc ery Ġste er 475 8 Http Client dup s è´ ¹ ĠÑĤ о bal loon ĠHand ball ĠCallback LifeCycleHookOption slope s ĠMa ssage ĠCalcul ator ĠInte gration ĠInstance Id åı² 家 Ġ136 3 ometri cs Speci fies ÅĤ a ðŁļ £ ðŁļ ´ ðŁļ µ ðŁļ ¶ åıª è¦ĭ unt ários ĠPAR SER ĠNE ED Null Handler Ġdisp ersion Ġdl train ('* '), å¤ļ 个 Ú© Ú¾ Ñİ Ñĩ electron ic ог ÑĢаÑĦ vot ed ĠRESULT ING Mi xture ĠmscModVcs X ðŁı´ółģ®ółģ ¬ółģ ðŁı´ółģ²ółģ ³ popup s kh on Ġdos ya caps ul yolo x Ġfall ing ப à®Ł brief description eti tive ĠPub lication ERN p олÑĮ ко NORMAL IZE Publish Entry nT Def ({}) '. Ġ× Ĵ Ġ'| '. ðŁĻ ħ ðŁĻ Ĩ ðŁĻ ĩ ðŁĻ ĭ ðŁĻ į ðŁĻ İ Ġscatter ing mob ilkit Ha ired yc lic Ġemit ter ku ka é» Ħ Ġpesso al Ê· a Ġ'; ') ĠCap abilities ðŁı´ółģµółģ ¡ółĢ ðŁı´ółģ©ółģ ±ółģ ox ide ("* ", ĉĉĉĉĉĉĉĉ ĉ atan h wei bo Ġbas ics ĠTer ritory psu util æĿĥ éĩį Hy Par ativ as ĠActive Arena neighbour hood ĠXXXXXXXXXXXX XXX Äį e JO INT JO KE oF Ar Est ablished KN label ĠWatch er noon an hom oph Packet Size amin ated separate ly 873 02434 ISO DE Ġautom l ółĢ²ółĢ ´ółģ¿ Traffic Class ë r ĠMod bus ĠArch itecture 注 åĨĮ Gre ater discri m ĠMc Stas Yt W zn á ек ÑĤ ĠActivity Rights RAM AN Ġmens ajes Ġbla ze deal er Ġnice ly Ġyb TradeQue Ins ight album s ('.. ', DEPLOY ED Ġgold en Sound System ĠPick le 00000000000000000000000000000000 0000000000000000 ÐĴ ведиÑĤе News Popularity SEND GRID ĠProvider TestOption Datetime Index ĠRED IS ĠExit Stack 100010000111111 000001 QUAL ITY tur bulent ðŁı´ółģ¨ółģ ®ółģ Ġautos ummary Ġdemon str bottle s åŁº ç¡Ģ Pure es ĠSuper vised Coin Game Ġblend Shape Delay ed Pad Spread vac uum èĻ Ł elev ations Ġped igree ĠVari ance Firewall Group olling er ĠHead scarf battle s arrayT MAPE ðŁı´ółģ²ółģµółģ «ółģ funiIf Tx funiIf Rx Ġá gua iner tial south ern cep tible Jan uary Ġey etrack ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Lang Box ĠIntegr ated PROB ABILITY JPEG Images Pen alty hon or ê· ¼ ĠTrade marks 835 480692 =': ', DPT EXTURE ĠTermin ate ðŁķ µ HIST OGRAM Reply KeyboardMarkup bea utiful BOOK MARKS Ġcorp ora Ġ"... |* Ġب ار ĠUnique Constraint Java Script Ġeuler Rot ĠAltern ative Tex Coord æ¢ ¯ ĠTen ant Ġanno ying EVAL UATE Life Time ĠPYTHON PATH 0025 4566402 HOUR S íĺ ķ Ġvacc ination QUI RE åĤ ¨ ì² Ń Ġsequ entially ĠREG ARD ZL NZ Ġpfx file Ġinvent ário Ġkh ông rmar ital ĠAttach ment phon opy ĠCart wheeling ä»· æł¼ Mongo Client Ask s AccessBindings Metadata æī¾ åĪ° ĠAnalog SignalArray ĠDat adog ãģĤ ãĤĬ Transl ations ĠREFER ENCE ĠCl one ORGAN ISATION Cool ing CLU DED Safe Loader Jwt Rule ĠTER MIN 3215 4609 Phot os Ġmile stone Stand by Stand off BAN NER Ġattri bu Vote LogTrx Ġipy widgets ĠUnder lineNav Ġtemper atures Ġambig uity ĠDiffer ent غ ÙĦØ· ⼠¹ Ġ"] ": ĠDot ted Ġalphab etical Ġalphab etically ĠEPS G Ġelev ator nonlinear ity SUPP RESS Ima ging Xtrain Pos ĠAu stralia Ġmolecular DataFrame MIP MAP Pep ulator obar ic ĠGer many funiVcl Tx funiVcl Rx Ġsmb us ĠMg SO ĠMg Cl ĠNa ive Ġinform ations 8913 48 ìŀħ ëĭĪëĭ¤ ĠcpwVcPerf Interval Mult inomial ç¿ Ĵ zj lx Ġdepart ure âĸĪâĸĪâĸĪâĸĪâĸĪ âķĹ +-+-+-+- +-+-+-+- ĠLap lace Ġìľ Ħ ĠколиÑĩеÑģÑĤв Ñĥ éĮ ¢ ĠčĊĉĉĉ ĠĠĠĠĠ ĠPACK AGE Ġopent rons NBPKG INFO ĠPretty Table Ġ555 32 soli date Plant Sample åºıåĪĹ åĮĸ Well bore Ġcompri mento Masked LM ĠBon us ogr no Ġtear Down å±ŀ æĢ§ Integr ator #~#~#~#~ #~#~#~#~ FusedBatchNorm V xH xW çģ « Ġej ec erture Sensor Ġenroll ments Ġalex net BRACK ETS DPR ASTER [\\/ ] }]} $', Ġ"== ") SIZ ES ×ķר ×Ļ×Ŀ Ġnsp hi ĠAst Parser regard ing hacker rank RESOURCES ENTRY coast lines Recur sively ĠORIGIN AL }__ { ĠFH IR mim ic ĠDest ination Ġobserv atory pegas us Ġfacilit ate ĠInfluxDB Client Ġplen um ика ÑĨии Ġ---------------------------------------------------------------------------------------------------------------- --------- Bytecode Length ĠWINDO WS HARD WARE ĠAZ URE ĠRepe ated RESER VED Ġì¤ ij à¥ĩà¤Ĥ ", GMC Port ĠбÑĥ д ĠFair y ĠBow ing ĠæĬ Ĭ ACCESSBINDINGS REQUEST Kick Offset sigh an URG ENT ÑĢем Ñı DISCOVER Y ĠTriangle Scheme kant or ĠAra koon Ġdeda ux ROIN umber intelli gence ĠTyp ically ĠSteam y ĠPow TestModel clou dd Ġíİ ĺìĿ´ì§Ģ IDXGID evice ĠSurf ing Bsm ModelInstance FAB RIC Little Endian RID ES ĠHover Tool Ġabri go jsch uh è¡Ĩ 人 OEOS FP breadcr umbs getAppointment Dates DAM AGE pSrc Data delims ize FUT URE Ġtamb ém ĠLET TER ĠNeutrino Flux 忽 çķ¥ lavni Menu decib el setCoordinate Mode Ġzentral en Chlor ite windowBackground White Ġeros ion Ġtelnet lib ĠпÑĢавонаÑĢÑĥÑĪ ений Ġisce obj spars ity countp lot ĠHugging Face QRad ialGradient âng ulo ĠìĿ´ë¯¸ ì§Ģ ADJAC ENCY pogre Å¡no ĠOffic er ĠHair cut 34155 06506 Ġcoreml tools ĠShr ugging åĩ¦ çIJĨ 1001111111100011111111 1 WRRRRR W ECLIP SE 𪨠Ĩ Ġdure e firec racker 99408 3415506506 ĠMRB rain ĠGolf ing Ġzuz avg createSetting Row ADDT ASK creative commons ObjectBounding Mode ByRequested Time ĠCheckByte Conversions OpIfNot Empty 0030547 9683447 ĠFacepal ming YearNoToGe matria 835480692 93539 DPTEXTURE CAPS 00254566402 87302434 32154609 891348 DPRASTER CAPS BsmModelInstance Info 00305479683447 6292 ! ="": " __ " >>> $ / $ ']) % ',' ' âĪ ( @ ) "] ) """, ) `, * )? + [' + $', , )): , != - "+ / = 2 136 3 164 3 163 3 118 3 148 3 172 3 143 4 011 4 133 4 134 4 345 4 174 4 149 7 91 8 128 9 127 9 148 9 185 : ": < - < !-- = ; > "] > '), ? % A e A ce A ve A greement B f B v B at B box B FR B rowse B ILINEAR C ass C AC C SI C SC C ULL C ABBI C ORMBase D k D ock D FL E h E idxs E limin F os F lu F ou F light F avorite F acts G ON G yr G reatest H v H ou H ATCH H ASSI I ce J f J n J as J RI J ames J uly K DE L es L ag L AM L ERS L ouis L aursen M om M ari M ill M ai M dt M ML N c N an N br N fr N ano N MI N fX O CR O Vy O cean O nnx P il P AP P OT P FP Q O Q ig R ast R NS R anks R ND S ans S ud S lack S olutions S QS S STL T FL U d U j U tt V f V or V ST V IA W mi W ays W MS W CS X OR X Audio Y H Y Pos Y DA Z MO [ $ ] ": ] \\ _ } _ '), _ "): _ (\ _ (? ` "%( a al a ad a par a xe a achen b sp b ite b float b ie b orders b kt c im c no c var c ElementTree c anny d ab d time d ml d nd e fa e uc e lia f data f rt f ences f fill f qn g ust g ids g cloud g Clock g lsl h C h ht h oun h lt h db h ops h sm h oriz h Go h iddens i H i el i ers j te j ab j ie k H k im k STL l K l ings l ale l led l fn m H m ve m sh m arch m gt m vs m vir n G n st n row n ix n Sec n mpc n ortheast n uscenes o ma o á o Ãł p J p au p rc p cl p ics p ción p aginated q name q FA q FQq r J r S r ze r xdesc s V s as s yst s mote s RGB s bp s izing s ugar t th t to t art t dir t Reading u G u W u ino u ities v O v S w D w K w ls w his w vl x L x X x os x info x dim x inx x WA y F y X y de y metry z ss z ens z ob z pk z ie } /' £ Į ± ółģ¿ ³ ółĢ°ółģ¿  ¬ Ä ģ É ² Ï İ Ð ĵ Õ ¸ â ı â ij å µ æ § æ Ł³ č ĠĠĠĠĠĠĠ č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ Ù Ġ ate Ġ xfb Ġ 个 Ġ æĸĩ Ġ ãģ® Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ å½ĵ Ġ ад Ġ 主 Ġ że ĩ ண Ķ © ŀ Ħ ŀ ĺ ĠĠ ĊĊ in dir in let in validate in compatible in directions in voices in coh or en or ous or rect on click at r re charge re cons re configure re marks st ay st eward en st en de en ix Ġt ti Ġt data Ġt ac Ġt sk Ġt ally Ġt ylko ar abic al li al ou al ties de ley le b le man an cer Ġi le Ġi oc Ġi ron Ġi ii Ġi InstrTest ro ha ti py Ġc lt Ġc Grid Ġc rd Ġp de Ġp ac Ġp exp Ġp ssh Ġp vt Ġp ulls Ġf li Ġf og Ġf amilies Ġf ifth Ġ" = Ġ" } he a he al Ġa ce Ġa ot Ġa ster Ġa Cell Ġa inda Ġa priori lo x lo sure lo licon 00 64 00 88 00 57 ĊĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠ ort unities ', ] ', )( Ġn it Ġn ut Ġn ile Ġn ap Ġs le Ġs ate Ġs ps Ġs yst Ġs fe Ġs aw Ġs imgr ut ely ur bed ur istics Ġin format Ġre ch Ġre loaded Ġre serve Ġre scaling Ġre written Ġre quiring Ġo dir Ġo dhod Ġd ro Ġd sp Ġd min Ġd qn li que li ved li za ct ry pe st pe cs pe ech un fold un escape un mute un paired Ġm file Ġm dates Ġm ountain ra it Ġe ss Ġe ve Ġe ster Ġe qui Ġe ssa la ma la ire la homa la ptop ion ic ue m ue stra ent index ad ler co author Ġthe mes Ġb ip Ġb last Ġb Interface Ġb fnc Ġ1 168 Ġ1 992 ed t 11 07 11 09 11 37 11 43 11 73 11 63 11 854 rom ise um l int ention Ġ( [[ Ġ( ° Ġ0 12 Ġw is Ġw il Ġw sp Ġw ls Ġw intypes ch ao ch ampion te ira di ver di so def n ma gn ], - from sample Ġif rame ot ter ot os el ines es ar Ġ+ '/ __ ]) __ (). __ =""" get max get batch get Register get Child get Duration get tempdir get OrCreate (' }') (' )') (' ?') )) +' set Up set Pixel set Icon Ġ- ", Ġto list Ġto ks Ġto gg ĠT od ĠT AL ĠT ell ĠT SV ĠT reat ĠT Low ĠT ornado ĠT ilt xt al us g import ers con ns con tributions Ġ2 91 Ġ2 00000 (" ? (" ## (" }") (" >>> (" (", (" =", (" +") pp os ') + ') ") as ym [' % iz ione et l et to op tics Ġis ort ĠS ON ĠS av ĠS AV ĠS MT ĠS cour ĠS phere ĠS lave ab normal ĠC au ĠC OS ĠC IA ĠC BE ĠC LR up d Ġg un Ġg host Ġg era Ġg onna Ġr line Ġr cv Ġr dx Ġr dr Ġr tc Ġr eraise Ġl ma Ġl list Ġl fn Ġl ret Ġl umber Ġl erp data f ĠA val ĠA na ĠA toms ĠA orB sp s sp aper sp rts ver nier '] > '] =" 01 07 01 97 01 26 01 75 01 000 01 74 01 73 01 59 ic loud ke pt am ine Ġ: ( Ġ: \ par te ĠF A ĠF ib ĠF ive ĠF act ĠF lex ĠF ingerprint ĠF AKE ĠF INGERPRINT od er sc ent qu arantine log ist log norm log ia vi png ser ini Ġh k Ġh on Ġh undred ĠP ode ĠP ip ĠP AS ĠP ROM ĠP lus Ġas array Ġas sessments ĠI r ĠI np ĠI CS ĠI mplements ĠL c ĠL IC ĠL SB ĠL ady ub m ub ot =' " =' ^ =' \' =' ;', =' ;') Ġst k Ġst opp Ġde als est a ex cepthook able APIResource Ġ3 93 Ġ3 24 Ġ3 89 Ġ3 48 Ġprint WithTime ect ors ĠD D ĠD RAW ac cessed Ġu it Ġu float Ġu vs ]) *( ert urbation Re pair Re bate ĠM X ĠM ST time dist if ur =" *", Ġv I Ġv ow Ġv cc Ġv iterbi 02 22 02 65 Ġy new Ġy rs ĊĠ ĊĠĠĠĠĠ ĠO re ĠO SM ĠO BJ ĠO ROT Ġ* /") Ġx v Ġx box Ġx dim Ġse is Ġse asons Ġma pe Ġma ker Ġma cos Ġma Attr test list Ġor gs Ġor io add Segment ER OUT IN J IN STR IN ITION IN CORRECT xe L Ġel bo load balancers ms a ms d ms o ms dk ON TO ---------------- ------- tra s ens u py lib py mongo pre processors pre miered 07 83 atch mo ES SE are fa "] ._ ĠB AM ĠB ACE ĠB unch ĠB oto ĠB FS ĠB OO ĠB OX ĠB ashOperator Ġos m 12 18 12 37 12 36 12 47 12 76 12 31 12 51 ĠE r ĠE xe ĠE POCH Ġj ni Ġ< # AT AR Ġ) \ low ski ans atz ĠN G ĠN ative ĠN LP ir un ################ ## ################ ######## ################ ############## Ġres istor user Rating bo ss Ġ4 14 Ġ4 95 Ġ4 35 Ġ4 52 Ġassert s Ġget Manifest lu cose 92 85 In vent ind rical ĠR B ĠR as ĠR os ĠR PP ĠR é ĠR BL ĠR oll ĠR entalData ĠR aspberry mo tifs ep NumberBulk Ġun bound Ġun likely Ġtest Parse Ġtest suit ument ations Ġlog var Ġlog msg Ġlog gamma 32 81 32 49 32 61 ph ens son s ĠG r ĠG ir ĠG FF ĠG reat Ġco di Ġco ast EN ET ĠW AV ĠW atson tri e ho a ho lic ho uses loc alize Ġout let Ġlen ght bu ys ĠV a ĠV t Ġ5 10 Ġ5 07 Ġhe ar Ġhe app Ġan onym Ġen codes che f Error HandlerHiveToPresto 18 16 18 33 18 79 16 06 16 08 16 34 16 57 16 65 Ġlist ings Ġlist Postfix sa mplers cur ation Ġk er Ġk al Ġk its Ġk aggle 25 85 25 000 25 89 25 69 Ġpy gal Ġpy misp Ġpy odbc Ġpy modbus ts ne 04 86 04 857 Ġmodel ling 13 57 13 44 13 67 og a lib ro lib device lib ssl 06 66 ll l ll r 15 22 15 09 15 76 15 907 SE EK ST AC ass ault ass oc ass uming 05 76 orm al False Positives ip si Ġop md Ġch ia Ġch inese Ġch airs Ġch imsd 17 27 17 26 17 83 17 91 17 78 17 52 93 92 93 84 93 63 ĊĠĠĠĠĠĠĠĠĠ ĊĠĠĠ Ġpre order Ġpre cip Ġpre lude ne gs ord o Ġat an Ġat tribut ok http 64 04 64 65 index ers Ġra id Ġra zer Ġdefault Graph Type Name RE CV Ġtra pz 08 88 08 75 Ġ\ , Ġ\ \\ Ġ\ '{ ĠH om ĠH ence ĠH ID ĠH EM ĠH ours ĠRe cursos sub module sub system sub tests sub menu lob ber ][ ..., mat riz Ġsh ards Ġsh arp Ġsh antin Ġdi ve Ġdi ction Ġdi ssimilarity df lt db f db l db user db session work loads work spaces 88 83 output Dict output FilePath image Id comp as ID ENCE 34 09 34 89 pos filename 09 87 84 04 84 95 ĠIn f ĠIn dication own s inter sections gs m bin ance bin ascii lock file ĠThe me ann set ann ers arch ived 24 99 24 19 24 78 24 41 24 69 37 71 map Wrapper Ġoutput Parsed Ġcom ando 96 17 96 33 96 87 Ġac id Ġcomp ar Ġcomp vert aliz ado ĠCon fusion Ġnew state [: ( 94 95 Ġcur Obj Ġcur vature Ġ} ); Ġ} }', 33 19 33 81 33 61 DE COR RO OK ()) ], row col row Type av gs Ġno sec 87 35 no tion no aa Ġline stop Ġclass path exp k exp lo CT TG Data Reader Ġla ursen 85 92 85 19 85 85 97 99 97 32 back bones mi ko {} {}'. net stat 36 34 36 85 36 65 but t query Idx ĠK NN ĠK NOWN 95 04 95 88 95 68 return Type return Message lat lon Ġrequest ing Ġrequest data run way run times run ei 00000000 0001 86 98 Ġmax results sum mation fa a fa hr Ġz OR ################################ # ################################ #### HE T HE ART rit ório 57 03 57 19 57 95 57 43 Ġ! ') cle i cle ared cle andoc Par ity Par aG Ġ8 32 ww z ED DN ED IATE IS Y reg ist Ġtf s Res net Ġper l group name Text o Text Input List APIView current dir current Size CO B CO P color print man ually api Key request data request ID AC I Ġcheck list Ġcheck pdesol Ġli v 44 64 44 55 44 46 44 21 44 74 IM F ENT H ler p cor rupt mail ing Ġrun nable ef g ']) ; Ġend time fix its 56 74 go o 38 31 my Screener Ġmin size ĠUn directed check Box Se u ĠOR M ĠQ Node Ġcolor RGB Ġus o pri cing ran ts Ġtarget Position ĠSe ctions nn adapter gin i 45 27 45 86 45 45 45 21 45 41 amp ton PO SS fil li the ory Ġinter rupted ä¸ ¾ ĠX s ĠX u `` \ Ġbase Path CH R 47 07 47 25 47 84 47 95 ]] ]]): ĠEx plainer tf d tf r tf s Ġpos itivo find text Set Data Ġsk t Ġreg rets ')) [' Ġser vic Ġone flow Ch a Ch assis wh atever >> \ 82 64 ear liest Ġfiles ys ´ółģ ¡ółģ¿ Ġar rive 46 07 46 08 46 34 46 74 ĠJ er ĠJ ack ĠJ uli 107 6 Log Options Num s Lo oseVersion 89 88 ĠSt rength Field Value )] ; fg abe pk i Ġq str TH IRD sys root To Add To Put To BlockHeadersWithChainLock ĠPy g ĠPy ro ĠPy Py ĠPy PDF let or let BindingTerm let BindingGTerm CON STRAINT De part De compose Config Name not na block map Ġdb nd 43 34 show base Ġsource Layer ĠPro g search er Ġnet addr page Num Ġaction lib 48 05 48 33 sv brdf ĠData Reader red de red it а ÑĪ а ÑĢам 60 32 No Sp \\ { ãģ © 42 15 42 84 42 36 Ġgroup Sync Model Form EST IM NAME ID ca res ï¼ Ķ Ġfig Size metri cal Max NLocator Ġback test cond ensed "]) * Ġexp on Ġtag y Ġtag ging Get Info Get Layer game object ĠPar ámetros ched uling ERS C 39 01 39 88 Ġbreak down Ġsum med Add Node Ġover hang Ġover fitting .") ; Ġass istance build root Number ing aw stin Ġword cloud src file Tra ins Key Event Dict Key exit code MO C MO MENTUM mem cache ĠCo astal 01111 0011 ]), ( dis f fit ter Ġdif fculty Object Command Comp arator ush ort Ġuni prot annot s Form Context Response Model dev ops dist orted OP REN ĠTest er ĠTest Is ãĤ ı Ġbin i job ID 59 05 59 84 ĠDe lay ĠDe cember sw d sw ing si er si an Ġlib name åı ¸ ĠGener ative CE P ãĥ Ķ Th rift PL P 52 09 cell X ĠUser Factory QU AD Ġabs ol Ġtmp Index radi an book Info ÑĢ аÑĤ DB w DB Cluster Ġgraph ic Loc Info EM BER decode Protocol SC QS SC aT ĠSet point PRO D PRO TE Context Support Ġ"\ "\ 202 6 Inter net Inter ior 72 84 Ġmy name Base Segment Ġtri angular Ġph on By Index fp ga mod ulus Ġwrite File TE AC Ġsu cess Ġsu ites Ġdown sampled has MEI ĠCh ris other dbref Ñģ л track lets ĠSim Manager pg f win Layout bit mex FO CUS Ġge ographic Pre mium ient e GR ATE GR UC GR ADE VER DICT Ġfin n Sub string Sub scribed Ġrand U ML ANGPATH gress or ĠZ I ĠZ oom ,' - ĠBase Non ĠEn vi ĠEn codes ĠEn semble UP p non local Ġì ´ Ġì ļ gb k gb ind Ġcell ar Ġcell spath }. '. Ġbest route ĠStr ong ĠSO CIAL nb ath ]+ ( ]+ ". NE VER Tensor Shape sen ds ĠAdd on draw er Ġcomple teness Ġ14 07 Ġ14 27 Ġ14 56 Te ams áĥ ij Ġign ores br ushes rel la her mes '} : Mode Enabled Ġmeta file .* ') cm u Pe ssoa Event Id rad ky GI ZMO ĠLe ad ĠLe venshtein Label ing Ġresp ident Ġresp osta Ġresp onsive Ġsend To direct ly ason ic Code c Date Type lex ers NA gent Array Type Ref ValueType Sim ilar ./ ( oo oo OUT SIDE Ġest ados player id Ġmc script vers ification ĠPRO BE Ġgen py cla v requ encies +" }") +" /" ĠLog out }' ". pub lickey custom log ACT T Norm alization Norm LT Ro i Ro ots ĠEX ER è¿ İ Ġbl ind success or Be zier Do ublyRobust GG ING used datasets ĠAc quisition Ġaut or product name á» · FR ACTION ĠAuth z Enum erator cr its ĠDefault Dict SH R GE o Ġskip initial Min imal rest plus ĠUp dating USER INFO mu ch Ġve get à® ¯ à® ħ Ip EI fici ally final Result Ġselected Path Ġsort er ĠOb server Cur r ĠPre conditions ĠSh ar pa ho ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠ Search Domain ĠPer f bi partite æĪ ¿ ä¸Ģ å®ļ ä¸Ģ æĿ¡ å° į )} ", ĠFunction Error LA UNCH MIN I andid at car ousel '^ ', Ġreal ity menu Edit << \ Ñĥ Ñģ Stream Bank Ġ"+ ", Invalid Input oriz ations Ġdec im Block chain Ġsav ings symbol Pair Ġmerge s From Local л а Ġfeed parser )( = feed er Ġæ ± ĠSub sector sr p Ġ19 86 TIME ZONE ĠQu ant ĠLoc ations ea h mar co Read ings Read VariableOp Ġcontrol lable Ġface book ĠInter preter CM U Ġ<< = pkg build With draw With Examples Bu f Bu zz ĠTensor s DU ST ('% . PER SIST 9218108 178 æĹ ĭ转 ĠDo e å¼ º å¾ ŀ Ġds l Back test Ġcut x Ġcut y export ing relation al ĠRequest Factory PH YS Ġnb convert mid points upload file Ġ"{} /{}/ /> " Ġ"< " release d ]} _ Noti ce (? < DEF INITION DD z look ing Bar Chart audio FileType ao h inv itations 916 6 ÑĮ Ñı big ip dig itize TRI AL Ġdes de PC s Ġpl ants HTTP BasicAuth 01011 10000 Ġbuf size Format StrFormatter Target Type disc r disc uss 205 4 UC U origin ating fully typed ä¸į å¾Ĺ ä¸į åŃĺåľ¨ ĠSH AP ĠNew Type ĠSE QU ĠSE COND Dark ening 401 8 progress bar Ġbar f ama elia tz al çĽ ij REG EXP ĠClient s break point shell code direction al bf b IV ES ua ção ('. /{ ĠSp in Ġctsp SgtCaching Ġctsp AuthorizationSgaclFail Track let prec ate bd g lc q ACC EL ĠTra verse Cell Type в еÑĢ ĠCommand Context Sample Batch 00100 101 tl v Ġè ¦ Ġpol arity Multi variateNormal Ġbook marks Tuple List Ġev olve Ġequ iv person a ĠMat hemat ji ra Ġcomm unities Role Member organ iser Admin istrator 218 1 ĠBY TE complex es complex Type Ġ'" ') Float Type fx n ==" -- 206 4 206 9 Ġadjust ing ĠTORT IOUS ĠIO U 297 7 DQ M nr pe Ġmis matches Ġmis classified ĠMax well gri fy Ġdecor ation 301 3 åĨ Ĩ 132 4 ௠Ĩ weep er Ġem ulator ATTR S INTER POL ĠDescri pción иР³ usage s squ ash Host Name ĠMO VE ĠMO DFLOW har a ر ÛĮ Ab straction ĠCur so ĠCur riculum ĠPri or 203 685 ACHE D 295 2 Ġ\" {}\ Ùħ Ùħ Storage Account ä t lio pe ........ ... ĠNetwork X 306 4 306 5 305 8 Ġ99 999 296 296 Print ing 456 5 dropout s ste alth {}_ {}. ('.') ] EP G EP ISODE éģ ¸ SERV ING 308 9 109 100 148 148 397 6 397 7 ĠSum mer ĠTEST S Ġden ote (", ", ðŁı´ółģŃółģ £ółģ ðŁı´ółģŃółģ µółģ ĠSpe aker 表 åįķ Ġam f dark blue 287 2 PON G digest s Ġ105 6 CY CLE ĠØ ¹ 284 2 307 8 ĠEntity Query Ġorgan ize Tool Tip 236 3 ĠSc roll Ġ------------------------------------------------ ------------ 209 1 д Ñĭ д ел #---------------------------------------------------------------- --------- 288 3 288 7 288 9 п Ñĥб Ġ'$ ' 422 9 catalog s DOMAIN S Med ical FY h 394 1 394 3 394 4 394 7 394 9 ĠTR ACK Ġhalf pi Ġн Ñĥж 388 7 NG Key 237 3 237 8 NV q Ġelect rified Ġcloud rail 426 5 AAAA A 293 6 interp QLF capt ured å°ı åĺįåĽī deriv atives detect MultiScale 395 4 392 6 ðŁı´ółģ´ółģ ®ółĢ 396 6 396 9 Ġboot strapping 337 7 387 1 437 3 hdr names Ġcri ar Ġtrade marks Ġ*** ") ãĥ¼ ãĤ¹ PW C PW M Ġ88 88 386 6 ĊĠĠĠĠĊĠĠĠĠ Ċ 455 2 455 8 bid der 332 4 Cat álogo Ġbro ke Ġhard ness ('{} \ ĠOper ate Route Entry Qos Notif ĠVM s ĠпÑĢ од Ġang ulo ĠdocsLoadBal RestrictCm Used Amount horizontal Layout 407 5 407 7 407 9 é¢ ľ ĠView s 364 5 åĬ¨ æĢģ æģ IJ song request STRE ET kn ight Ġquat ControlConfig xi K third party Ġkw param halo mass Ġmen us ĠUN IX nv ml Ġevalu ates Ġtun er Ġtun able SF U SCRIPT S ĠLinear SVC Make MetadataLine çIJ ĥ Ġstation ary Ġpress ing Ġcomb os Ġide as GY z Ġcorre ctions ðŁı´ółģ£ółģ ¦ółģ Ġи ли Ġи Ñģп ÑĪ иб 409 5 Raw TextHelpFormatter ĠApply LocusFilters 298 3 Ġexecuted Cmd Ste ven Ġpv b Ġpv pc 466 2 Sq US vertical Layout ĠAP IMessages stem mer phot on mapp ers Ġaltern atively Ra WAN Ġtrunc ations ĠFail ing guide s ĠFin ish 次 æĹ¥ Mut ex Ġ################################ ## ĠGit lab Ġqt bot MAC RO (. +? =< - æ® º Ġ#-------------------------------- --- Ġ#-------------------------------- ------- bla ze ت Ùħ Ġmut ated ´ółĢ ´ółģ¿ ´ółĢ ¶ółģ¿ docsLoadBal Policy hm mer ĠAllow Any Ġpen nylane MJ s Ġtech nical Ġdc gm ãģĹ ãģ¾ãģĻ eu ros Ġsho e åħ³ ç³» Clean Up ãģĦ ãģ¾ãģĻ ĠSa mpler Ġmicro seconds mic ul Ġquad rature WW W ĠEVEN ING ĠRole Assignment tele gra ĠLogin Form ĠAbstract Base Äħ d Ġste am Ġste ering BLACK LIST MZ j ĠHand ling ju da erg ia Ġsever e Mar ion ãģ§ ãģį Blue print ĠSeq Parser Da mage ĠEmpty LocInfo Ġ136 9 ðŁı´ółģ°ółģ ¨ tang ente Ġpretty table Zero Padding Upload Limits 建 ç«ĭ Gradient Descent }% ". ============== ") éĺ Ł conj ugate Fra gs åĵ ª åĵ Ī dD od Ġcas adi åģ ľ å¤ļ å°ij Ġsup erior об Ñħодим ĠEqu ations OU GH ĠURI s {}> '. bol geler åķ Ĭ Fbx Criteria Src DataSize ĠES P Ġmor p ðŁı´ółģ®ółģ ©ółģ ðŁı´ółģ®ółģ ºółģ ATOM IC Ca ption Ġub untu ب ÛĮ near by Available Amount motor dir ın ın vir sh Aug ust gun ta ом Ñĥ brief Description BOX ES ĠRelease d ĠDomain s ðŁı´ółģ«ółģ ºółģ ĠDeep CT Æ° Æ¡ Ġ× © Ġcorr coef mob ili ĠRob ust Beam Fitter SHAR E å¢ Ļ 好 çļĦ deleg ated Bro ken gif s Ġwins ound ðŁı´ółģ©ółģ ´ółĢ ×Ļ× © Ġham crest adm ind ĠAnalysis Session ĠBert Config som ename servo ir Ġconj unction Mu on oẠ¡ oẠ£ flower blue 符 åı· Estimator Spec spl rep ĠMetric Meta ĠHash F ãĤĮ ãģ¦ Ġmanip ulating Ġë° © Ġë° Ľ ila dmin Ġgather ing #. # Est imation STD ERR Ġgrab acion ĠCONT ENT BIND ING FACT ORY jack son åĸ ļ Ġlikelihood s Tile Drain Tele fone Interpol ate ĠEnt rez Ġvl ans ãĤ¿ ãĤ¤ ************************************************************************ ***** ilo metry ä»» ä½ķ Ġgrp cio ACTIV ATION å¹³ åĿĩ Ħì Ĥ° ĠProb ably Aggreg ates 管 éģĵ Complex ity Ġoccup ations DEPLOY MENT ĠIssue s ĠCOR RECT John son Cam Info ç¾ İ esquis ar Ġmeth uselah ĠStat istical Ġoccupancy Dict Ġrid x Ġautog enerated Ġdatal ist ãĥ³ãĥ Ĺ ãĥ³ãĥ įãĥ« Ġcn st blk io prm Dict Shuffle Split Ġnonzero y ìłķ ë³´ BIG QUERY phenotype s Æ°á» Ľ Æ°á» Ŀ Ġdol lar Company Name ĠOrgan isation Nu clei vali able Ġresearch er Ġbor ough ĠYear s PAN EL REST ART Sfp Cmd nest erov äºĭ 件 ĠNeural Network Land mark Floating Point bic ubic ĠÙħ ÛĮÚº ĠEast ern Ġlimb s ĠMemo State ĠAlign IO Nothing ToDo Ġpw ned filler words Mini Kill ĠfltStmt Arb Arc min ĠÎ ³ æŀĦ éĢł IY QQ âĺ Ĩ ãģķ ãģĦ Positive Number Ġcapsys bin Ġtal ent âľ ħ Ġcone x Ġcraw ll ĠContin uum satis fies Frozen Amount ĠÑĢ ез ĠAuthentication Form Ùĥ ÙĦ eso lowski Ġyi elded senti als ñ a Ġill umination Ġrespond ent åľĨ ä¸ĭæłĩ mad lib ĠPan optes emann ian TRACE POINT EXPI RATION ìĥģ ìłģ \", \" Ġslide List ĠGi B RECE IVE Ġconcaten ation Bron ze Ġ=== > åĤ ³ åĤ Ļ commut ative ĠSIG INT ])+' -'+ Ġdiscreti ze cru ise cru ft john son ни к ĠNotFound Error ĠBul let EDIT AR Expect ation issub dtype Ġ******************************** ************************ informat ive 2337 203685 Men tions ĠCl ub ĠREL ATED ĠCOM MA kW rist inic io ('; ')[ DECL ARE Ġhashtag s arpInspect Log larg er ÎŃ ÏĤ Ġrela cion Ġmarg ins ĠFl ush neigh s Ġcapit alized Visu alizer Ġcra shes SAL ES hUK h Ú¯ ر ĠPASS WORD Prote ction ĠPrecision Type Pal indrome ĠFun ção Exc l ---+ ---+ MIBCompliance s Xtrain All isot ropic Ġhang man Ġomni hash ĠCCACHE Principal ĠOrient ation ĠdG col ĠOcc upancy appe ared appe tizer Newton LineSearch solv ency ĠctspIf SgtMapping éĻ³ éģĶ ĠCi pher Recomm endation ĠTel lo neuro imaging Ġreprodu cible ········ ········ CLEAN UP Pet Images Tom ato Ġexhaust ive obi eta corn flowerblue 0614 141 Ġlift ing Ġoccure nces ĠколиÑĩеÑģÑĤв о obtain ium æĬ¥ åijĬ Associated With ĠMut ual luck y MOUNT S ãĤĪ ãģĨ ëª ħ Ġä¸ĭ åįĪ Ġcandle s 9937 00787 ako on ÑĢан и Ġelv DOWN ĠWi fi TRANSL ATION ssssssss ssssssss Flour Percent ĠFruit Branch ĠBRO ADCAST ĠVIE W ĠVIE WS COORDIN ATE Ability Id ĠSpectral Shape ĠINITIAL IZE Ġrough ly Ñģк ий BCE WithLogits nir vana pul ses dele tions ĠBlink y Ġqm la applicable To Ġasp ose defin ite ĠQSize Policy Ġlocaliz ação DepthStencil View aling Data Ġswe eps ĠSales force ĠshadingEngine Lis gog data haz mat ĠSK IP ãĥij ãĤ¹ hought on ĠPLAY FIELD Ġenhance ment Ġê· ¸ë ĠпÑĢед меÑĤ COMPONENTDEF REQUEST ëŁ ¬ arv ud CHN GN servic er Discarded Frames 追 åĬł SHUT DOWN ĠдÑĢÑĥз ÑĮÑı AIn Scan czy zna Ġrend ers ĠClay ful tomb stone Ġpredecess or ĠJAN UARY 书 ç±į huge ctr Ġpcolor Opts Ġfbp cs ĠComput ational íķ© ëĭĪëĭ¤ çŁ Ń ĠImg ur explan ation MaxPktLen Conf ĠEns ures ĠÐŃ Ð» Ġprerequis ite ĠIntent WithExamples авлÑı ем HLL HC NFT Collection ĠçĤ¹åĩ» 左侧 SSign alingData ÐłÐµÑģ пÑĥб ĠÑģпиÑģ ок Ster eo nch w èŀ į Ġinic ial fifty one Ġxmlrpc lib MANAGE MENT LMHead Model ân cia MOUSEBUTTON DOWN Ġtitan ic YMO US Ġdesa stre ĠRh ino ouw ens ANON YMOUS Ġsimbo lo 000101111 000000 occure nce Ġим Ñı //////////////////////////////////////////////////////////////// ////////// sok et çĶ³ 请 åĽº å®ļ 约 æĿŁ акÑģ им Ġìĺ¤ ë¥ĺ iÅŁken in Ġballo on Ġdome stic ãĤ¯ãĥ© ãĤ¹ stw ister gell ert ĠEpic Serializer filtra do lossal ai ĠJacobi Polynomials ãĥģãĥ£ ãĥ³ãĥįãĥ« ĠIMM EDIATE preemp ted Ġpreci sely è¿Ń 代 ÑĥлÑĮ ÑĤаÑĤ AndG reed ĠÐľÐ°ÑĢ ий Gell ert jse iler liou ville INCENT IVE angSTR Call ĠEAR LY RunTime Params qtpy vcp ÄĻż czyzna HASSI O PFP upp Ġsfe py setPixel Color ĠInp lace Ġstopp oint EROUT ING ĠgetManifest Template ToPut In ToBlockHeadersWithChainLock s аÑĢам еÑĤ GRUC ell Ġskipinitial space NothingToDo Exception MiniKill CamInfo åľĨä¸ĭæłĩ buff 993700787 401 ĠçĤ¹åĩ»å·¦ä¾§ æĮīéĴ® ÐłÐµÑģпÑĥб лика " ? " _ " '. " ../ " '). # **************************************************************** ' /' * > + % + , + .*)') - (? . -- . ## . (\ / (( 3 146 3 134 3 142 3 171 3 021 4 255 4 124 4 198 4 106 4 176 4 148 4 138 4 162 4 151 5 105 8 23 8 948 9 0000 9 175 9 147 : '): ; *. ; :{ ; '/> = * > [- @ _ A ds A IC A ust A UD A rab A diabatic A thena B c B ps B service B ACE B KB B ONUS C IT C ANT C Msg C arraro D type D istr D TYPES D ynamics D aniel D erived E ID E MO E quivalent E CHO E EXF F er F path F RI F air F allback F qt F illing F acility G st G ad G ING G DB G OLD G erman G rupo H ans H cal H CI H ASS I e I on J pi J AV J acobian K nots K lineEdit L f L ICATION L acp L aser M il M ING M fg M ik M oment M organ N at N est N ear N MS N wc N REM N atl O am O Qk P ts P ET P PO P CH P layers P ier P added Q c Q CheckBox R ho R TC R pm R idxs R ental R agged S ense S IS S ale S PO S IB S ie S xx S MB S ua T ow T CI V ING V aj V IJ V wu W on W AG X DG Y F Y un Y aml Z GR Z mZ [ , [ ', \ : ^ & ^ ( _ ], _ '] _ |\ ` :: ` .\ a O a file a ag a ef a Mag b ies b dist b alancing c un c di c da c lp c ses c pl c groups c ione c arraro d to d sc d art d Type d ali e on e an e go e bar f min f pi f é f beta f estival f lashed g X g ue g ai g cr g irs g proj g aps g kE g topk g Xz h re h cl h ift h anded h aves i D i W i ad i ud j pl j si k at k th k ow k cs k rpc l xc l ph l inter l ant l mbda l prob l una l ÉĻr m ds m ys m code m ard m uti m List m call m Dict m ssql n ore n og n bin n ell n ones n uv n procs n ccl o D o J o mp o map o ster o las o SM p D p ite p sk p board p next p rase p nts q X q be q td q NB r ct r ta r ws r shift r uby s le s na s rs s cov s udoku t D t ut t var t ors t last t ank t ga t weak t Water t uesday t amanho t CaloStage u I u K u S u T v ark v card w Z w ig w ings w af w ish w pa x R x ss x si x account x Vals x BA x refs x WK x ilinx y C y K y Q y md y Test y Length y ara z or z are z Type z stack z inc | {}\ } }'. } `, } ^{ } >") « ìŀIJ ¯ ä¸Ģ ¯ 件 à Ĭ É £ à ¨ í İ č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ č čĊĠĠ Ġ ĊĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ оÑĢ Ġ åıĤæķ° Ġ ப Ġ ERC Ġ âķļâķIJâķĿ Ġ è¿ĻéĩĮ Ġ çĶ¨äºİ Ġ ultra Ġ åıĸåĩº ij å®ļ ĺ 리 Ŀ ì²´ ĠĠ ĊĊĠĠĠĠĠĠĠ ĠĠ čĊĠĠĠĠĠĠĠĠĠĠĠ in items in creasing in anet or ize or qa on oi at um at alog at órios re ce re im re auth re define re minder re zervaci se lective se ismic st b st bl st ica st owaway en ode ĊĠĠĠĠĠĠĠĠ ĊĠĠĠĠĊĠĠĠ Ġt S Ġt as Ġt am Ġt if Ġt mb Ġt ec Ġt ron Ġt SS Ġt body Ġt weak ar ai ar oo ar aoh al m de leting le f an mar an vil Ġi C Ġi q Ġi val Ġi dd Ġi graph Ġi Reg Ġi Scale Ġi cmp -- ") me lt me spath Ġ' == Ġ' }' Ġ' (', Ġ' ()': ro data ti q mp g Ġc ord Ġc obj Ġc txt Ġc Info Ġc fr Ġc rack Ġc oba Ġc limate Ġp li Ġp ra Ġp load Ġp ings Ġp doc Ġp tf Ġp dist Ġp vol Ġp isa Ġp izza Ġp urification Ġf ct Ġf size Ġf ron Ġf sql Ġf pad Ġf ashion Ġf ocused Ġ" ]] Ġ" && he e it t it ate it are it ools lo pt 00 96 00 65 ge les ort a ', '')) Ġn ar Ġn ist Ġn samples Ġn asc Ġn timesteps Ġs list Ġs xc Ġs ounds Ġs xy Ġs ized Ġs mote ss s ss v Ġin x Ġin out Ġin cl Ġin cr Ġin volves Ġre tail Ġre late Ġre distributions Ġre parandum Ġo e Ġo da Ġo dk Ġd Q Ġd ti Ġd jang Ġd lat Ġd ork li ber ct ate un iv un ify un filtered un specified un verified Ġm st Ġm op Ġm nt Ġm os Ġm box Ġm á Ġm jd ra cket Ġe ab Ġe list Ġe vs Ġe sses Ġe miss Ġe clipse la dy la cion la unched () < () """ () [:, () [:- ent rada ent halpy ad rado ", ", co le co pper co variates ri an ri me ri as Ġthe oretical Ġb ld Ġb pad Ġb aud Ġb lighted Ġ1 100 Ġ# ', ed b 11 16 11 25 11 94 11 78 um o int Type Ġ( > Ġ( ',', Ġw w Ġw et Ġw sg Ġw oman Ġw atches Ġw ood ch s ch al ch ia ch arging te tra te fact di vided ata re Ġself mon Ġself drive == ") ], ( ], ) from Buffer Ġfor mer Ġfor got ': "< es a es pan ĊĊ ĊĊĠĠĠĠĠĠĠĠĠĠĠ ĊĊ ĊĠĠĠĠĊĠĠĠ ode sic is inf is Active val ign name cols get ype get List get uid get Column get Block get Page get Cluster get pw (' ) (' () )) ? set Name set locale set Angle Ġto e Ġto mb ĠT al ĠT AD ĠT ank ĠT ILES ĠT itan il legal th rown us ps str f Ġ2 83 Ġ2 78 Ġ2 030 ers can (" %( (" {}". (" )", (" '% pp p pp t as f as se as ion as ant as nn as px ĉĉ Ċĉ [' @ op tic op cional Ġis Used Ġ7 60 ĠS HE ĠS ORT ĠS ROM ĠS CS ĠS inger ĠS entiment ĠS UPER ĠC r ĠC DS ĠC losing ig raph ig uous ig rams ") [' Ġdef initely Ġg cc Ġg ross Ġg cloud for wards Ġr er Ġr cs Ġr ush Ġr sqrt Ġr ational Ġr sem Ġl main Ġl ps Ġl sq Ġl rtc ": "" end oc end ere data model data ft data Type ĠA K ĠA W ĠA er ĠA FF ĠA valiações ĠA iiDA sp ack sp fx 01 27 01 55 01 33 01 85 Ġcon trib Ġcon ference ic ation ic lu ic ide to log to high to dense 99 212 Ġ: [' path nodes type defs ĠF rank ĠF OV ĠF ALSE od ou sc lient qu irer log like om ni Ġh v Ġh il Ġh all Ġh ire Ġh ive Ġh ough po ches ta pp ĠP t ĠP ast ĠP ron ĠP BE ĠP icture ĠP USH ĠI so ĠI van ĠI deal file menu ĠL t ĠL on ĠL PAR ĠL aser res izable Ġth rottle =' "', Ġde b Ġde ar pro ces pro vin ex a ex cluding im en im ized im mobili Ġex ercises Ġ3 11 Ġ3 34 Ġ3 44 Ġ3 28 Ġ3 71 10 25 10 34 10 49 ow ed ĠD ri ĠD ub ĠD ST ĠD ONE ĠD eno ĠD raft ac ad ac fg ac les Re action Re present Re curring sh ang sh iny Ġdata IO ĠM om ĠM ine ĠM RI ĠM atter ĠM use ĠM NE ĠM iddle ĠM irror ĠM Pa ĠM Ãī time frame time Stamp if u key ed Ġv ms Ġv are Ġv df Ġv umi Ġv aries Ġv switch Ġv Inc 02 02 02 16 02 03 ĠO db ds lx Ġ* ) Ġ* ', Ġx offset Ġx hat Ġx DP Ġse ps Ġse lective ack et test a test util add Transform add Weighted Ċĉĉ ĠĠĠĠĠĠĠ Ċĉĉ ĊĊ [" < [" @ ER Pp IN UOUS Ġstr ands .. # xb an load Tests ore tic Ġ% ]', Ġme mbro ---------------- ----- ---------------- --------- Ġpro cedures py mol art ments xc be pre ference pre cedence 07 07 07 907 xd ump xd gm Ċĉ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠB G ĠB or ĠB ou ĠB box ĠB ear ĠB GP ĠB illing ĠB azel 12 25 12 22 12 79 ĠE MA ĠE scape ĠE quival ĠE stab ĠE MBED Ġj ulian ci phers text Info AT IC Ġ) * low tohigh com and ĠN H ĠN Z ĠN r ĠN s ĠN uc ĠN TP ĠN atural }, {" len lp num FidsInList ################ ### Ġres istivity Ġ4 29 Ġ4 69 Ġget User lu is 92 75 92 000 92 67 In ds In flow In duce In crease In Scene In Place In Force In cluding ĠR s ĠR io ĠR ice ĠR DM ĠR HS ĠR asa ĠR abbit mo ore Ġun c Ġun like Ġun normalized Ġun electrified fo ster fo lios ule ur ule tte read mill 32 19 32 21 per clip oc a oc co son ic ĠG U ĠG a ĠG od ĠG reg ĠG rupo Ġco li EN DO ĠW M ĠW a ĠW ing ho ppingSite url join Ġout l bu zz bu ddy AR P Ġ5 15 Ġ5 05 Ġ5 46 Ġ5 91 Ġhe al ape x Ġan a Ġan ten Ġan ova Ġen calc Ġen coders che ster 999 6 18 09 18 24 18 81 16 12 16 15 16 86 16 56 16 98 line Citation sa mplerate cur ie cur Contrast da e Ġk id Ġk Wh Ġk endall Ġcol lects 25 01 25 05 25 91 Ġro uted St ations Ġpy mc Ġpy win Ġpy brain Ġpy quil Ġpy pandoc Ġpy fos Ġ6 16 Ġ6 24 Ġset Create ag ues ts d Ġmodel VertexAttribEnum 13 10 13 45 lib elle Ġwh ites Ġwh iten ll ar 15 24 SE E SE M SE MI ST AG ec tious max Force 05 05 05 57 Ġthis dir Ġthis Glyph 03 16 03 15 Ġint code cs i cs dk we ave Ġop Dict train Idx Ġch am Ġch dir ax ins 17 73 17 900 dd u 14 25 14 88 14 56 Ġpre vs Ġpre cursor Ġresult ed Ġat tribution info mapWrapper LE C LE AG Type def RE PRO IC IT 08 01 08 03 AN O 22 81 Ġ\ :[ ĠH G ĠH P ĠH TT ĠH MM ĠH unter ĠH PAI ĠRe vision sub plt sub Path Ġ{} ] input dir np u np bf eri mp ][ %( mat s Ġdi als df n db m db ag 88 15 lin has lin tian comp liant comp ensation ID ata Ġsc ored Ġsc rolled 34 88 34 41 pos able 84 64 84 36 84 98 ĠIn vest ĠIn creasing write bytes Ġkey space inter lace inter national by z Ġle fto 24 87 24 56 24 800 Pro v Ġoutput Col Ġpo li Ġsub plt Ġsub nodes 96 13 96 09 Ġac comp Ġcomp ounds ĠCon versation Ġnew list 94 97 Ġcur ated Ġcur Slide Ġ} . 33 38 DE FL Ġapp let Ġapp liance json string Ġno mes 87 99 87 64 87 96 87 74 no Noise Ġla sa Ġla gs 85 16 97 07 97 88 97 37 97 94 97 65 mi cha mi xtures net ometer 36 05 36 88 36 33 36 39 36 62 =[ {" Ġopen ff ĠK V ĠK u ĠK ol ĠK ills ĠK evin 95 05 95 75 lat Lng Ġit alic 86 18 stra va 26 10 26 02 Ġmax split Ġdo ctype Ġz info Ġz lb ################################ ######## process Receipt AG TC AG UU 57 33 57 66 57 82 Ġ! _ Ġ[' __ ... ")) Ġ8 05 Ġext Right create Data ED B IS US IS ODES reg plot do metry parse AndOutput group Id "," / Ġcreate Matrix current Index color scale color maps color imetry man ufacture version ed 66 04 23 00 AC S =( ? Ġcheck rain 44 94 44 91 44 81 44 54 44 59 44 53 frame bit IM U Ġdis cussion Ġdis nake ulti es Ġ** {" ENT RIES OT O Ġnode list ']) * raw source var Ch so ul 56 97 go ma go es 98 00 98 99 98 07 Ġsp iral local ftp Ġmin v ĠUn fortunately Po kemon Se en uc d Ac id Ac Fan be ck Ġcan onicalize ĠQ c ĠQ Settings ĠQ Painter ĠQ GridLayout Ġcolor Hex PT w PT unable 35 35 ud l Col lections ref dict ern ando Ġwor ry File Upload AD CP Ar ticles cre ments Ġim csdk doc no ',' *. ',' _') ĠSe parate Ġad mit norm Off 45 00 45 26 ng uin attr name ide code token izers ĠY T ĠY aml ĠY EAR Ġinter sections Ġrandom Line ĠX LS ĠX MPP `` .""" Ġbase Type Ġbase URL CH ASE call args 47 99 47 34 47 87 47 57 47 48 47 42 101 2 101 4 [:, [ [:, :- Set Name Set Avatar ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ pl ates IL T Ġreg ress Ġreg rid Test ed Test Size Test Loader ')) [ HO VER Ch ristian led ges du pes Ġlin et gen B gen bank gen otick sg f order By Ġar ctan 46 19 46 83 PE C ĠJ et ĠJ PEG ĠJ AVA ĠJ ordan ĠJ UMP ĠJ ulian 89 01 89 86 source File DI tem yp ass Field Options Ġcal ories [- ( )] < ld nn Ġmodule Context pk cs Ġq ty Ġq gis TH UMB TR T sys Log air play To Smiles ĠPy Pep Ġ''' `` DO S De k De pression De bian Config Stack US C ]* ', dim ms block devs Ġtable au Ġdoc body off s gn mi graph ml 67 96 43 16 Ġitem sets ĠCON TRI ĠPro cesses CL ANG vid Time Ġ100 01 vo icing Ġnet list SI F Ġmatch up cu los context lib 48 06 48 64 )* \ Ġqu orum Ġqu arantine Ġimg name EX TR red ner No se No va total FlourGrams Ġarray ScaleT ãģ ° ĠAr n 42 94 TT Y Ġtemp sum msg pack task path debug level ca e board list Ġfig title Ġuti lize ĠÐ IJ "> ', cli entid Ġtotal SendText "]) [ Get Data Get Cell Get Driver UM F Node Map ĠPar agraph rect angular xy xy 39 64 Ġsum it Ġsave Name rand Int initialize Range Ġele c Ġele man Ġass ertions --- ") Ġnorm alizing mer kle 54 84 Column DataSource Ġauth lib itle ts cv ae exit Code fn match Ġimp acts Ġ... : Ġ... ). Ġnext line Object InScene Bo dies ĠTO P dev table over time over loaded Input Layout Ġab sence 58 03 58 64 58 34 State Notification State Disabled access ors pr s pr sa gr anted gr inder dist Char dist Peak dist ortion learn ed Out come и к и Ñħ ãĤ ĥ ĠNo Return ĠNo tifications Ġbin ds Ġbin ario change speed 59 06 59 8424 ĠDe position ĠDe bian ĠDe livery sw aps CA path Ġexec vp Ġform ulas itor io ĠRes net ĠGener alized ãĥ ĭ Ġpage d Th rottle çļĦ 人 çļĦ æĸ¹æ³ķ At End PL C inser tions Up Time Ġhere in Ġabs or Int roduction IP V disp ersion :] ], RES ENT radi cal ĠPath ToTest DB OT BU GS +' /' EM MEN tic ity sim u Ġorig ins Ġoptim izing ĠWe ak stream Data Ġ15 2215 Inter p Inter cept Ġgl ance }") . na o na Letalis åĪ ¥ extra spath CK B med Var Ġmy rank 41 32 Ġtri mming mc Ntw Ġconst ellation "); ' Qu er Qu arantine By Class ĠFor bidden ################################################################ ############################################################ window ed mod flow dt m admin istr full chip full argspec has oc body Index uff ing uff ling inst it inst ein resource UUID az im az oo az ioni wise Conv Ġcsv reader Ġvis dom meta var des var Sp aces sm ar sm ith tax i /{ {{ FL UID sin i active background active Jobs ĠDE MO ee g VE LOCITY Ġge w GR L GR P web links cast ing math text Sub urb Ġ$ ' sql c SER IES dat adog gor illa NO FF ĠBase Handler Ġì µľëĮĢ rs age rs lt Ġnoti fied 61 92 Ġtwo chars GB A GB Y Ġcell Value Ġcluster ings Ġzip s hex str ]+ | ]+ ') NE F Ġposition ed Ġposition Gain Ġ'% ') draw n Ġ13 1072 ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ cut ting her m rot ors '} ]} Mode lo è¯ ij Or q Or gs Ġsw da Ġsw apping Ġsw apper GET BLOCK Pe ssoas Event Base ĠLe g Ġspecified Date Ġmer lin NA XIS cap np cap ped arm Controller thread Name CI SE oo vs Mat plotlib Start s jnxMbgSgw DelBr jnxMbgSgw ModBr .... ") multi sample multi dim long cmd ĠPRO FILE ĠPRO DU sec PerLine ĠTime InForce ĠOr d mk l Ġsuccess ive profile PicUrl chain ed chain code cd rom Pri v Pri medVar ĠCom ma Ġ"% " å® ĥ =\ ' term Summary Ġconn ectiv custom izations ACT TT ĠUnit Model ĠUnit Command parti ally 10011 00 rb ac ĠHttp Status CRE DS ĠName Count neg dis Ġ"_ "). Map a GL U GL Y Be ans ठī GG TC Ġpad rão vol umen fetch Status Ġrot ors validate Name End Date á» ³ á» µ á» ¹ Ġgr d SH L convert ing tile Name Valid ating ĠAt l respon ds Ġdon nées hes ity ish able ish ness Ġve g Ġve cs depend ents mac rolanguage Ip Ranges ĠAl len ĠAl bert Ġdat an Ġselected Features Service Linker Ġcap size ĠOb servations fl m fr ng screen ing ĠPre Trained ĠPre paring ĠSh ot Ġdelta Peak pa ul Ġstack ing Search Space ĠPer imeter æĪ ª Ġct u Ġattribute Type Ġattribute Name ([" % POINT OPTIONS å° º ĠAd Hoc reference Unit MB I STAT EDATA VENT ION Ġfailed VoteLogTrx ĠSer um ĠAn chor OB RACE 1111111111111111 1111111111111111 Range Start Range End black out period LE period ogram ĠLO CATION ĠLO GGING Ġdiff ers UU EMNN CONT ACT Ġæ ³ Ġæ ¸ Ġda q ĠSub Command SL ASH Ġhand y čĊĠĠĠĠ čĊĠĠĠĠčĊĠĠĠ ĠLoc ator GO EEXF ĠOpen ID ĠOn line Ġinser tions parameter ized Ġpatch ing ĠIP Address SQL ITE Classifier VlanMap ĠHttpResponse Error ĠHttpResponse Forbidden Ġcontrol Mode available classes Ġpr ó fun site ç» ijå®ļ mis ses Ġside bar Default Value Ġsubject ed Const Context Ġcop ula Ġzero es åį İ Ġcre at Property Meta Light Link Back bone 192 1 Ver micul gl Get Go To Go Lab ا ÙĨ relation Map speci fications ĠHTTP BasicAuth Ass ist к Ñĸ owner node Ġ"< ", NS amples Noti fier (? :\ ĠGo ing kw i Edit ing dc ad ĠMy Graph Ġtile db çĶ¨ æĿ¥ è® ¸ Grid Size Component Name COMP ANY TRI UMF }} $', ĠExt end Ag ain ĠMo ves dense Layer Ġcent res 01011 10 Ġcharacter istics Ġcharacter creator dummy path byte order disc arded disc losure ĠText Field ĠIter ations ĠIter ative Pass words media Type CV C scan dir Ġri se Ġri ce Sk u cn trs ato shi ä¸į ä¼ļ ä¸į å¤Ł ah y ascii art zen ith ĠSE AM Exp ire exist ant UND AY Dec or sol ns Ġep hemeral Ġrep lied switch ing 204 0 204 4 Ġhome work Plot ing star let Ġway point Ġsen ti ĠRead FemResp Sw itches break er Interface Number Account Name Account Que Account Selection ĠDB US IV UTIL Ġtw ilio Ġcross ings ('. '. ĠSQL ITE ĠAD G Args BaseIndex Random ForestRegressor ĠIndex ed BACK BONE under standing Fixed Width ĠTra vis pie zo Profile Args wall time ĠProcess PoolExecutor deploy er MD g Ġè · Ġè ĩ differ ential differ entiable Ġpol ys Ġpol ler ĠMon ths ðŁĩ © ðŁĩ « ðŁĩ Ń Work load Work book çİ © negative Rate contin ent BA ZEL 234 3 æŀ Ĺ sl di Ġequ ip Ġequ ally ĠCode d ĠDet alhes Ġvo ce Attribute Dict ji ang 01000000 3820 915 7 RC ardTable RC ardEntry ĠMulti Mode ĠMulti variate ĠMulti DiGraph BI ANA emp erature Ġexpand ing Ġtab ular ¡ółģ Ńółģ¿ 163 16 Ġcdbp RealmKnownPeers Ġlate xtools Tri gonometric Ġbig ip Ġinner datapath ä¸Ń å¿ĥ 208 7 ae iou shuffle Logic ĠDO ES Ġcla ve ĠPh ys Ġmd sspath 301 5 åĨ ³ Last Edit tot s Ġsol v Ġsol um Ġem ulate Ġem mental Space Token Bot tle Gen ome Ġfe conf Ġfe lix 905 5 Ġsur prise hw p ĠMin ute Feature Extraction Part Number Ġground SH separ able specific Tissue Ġthree bot (". "): Ab normOff ä¸Ĭ çļĦ ä¸Ĭ ä¸Ģ个 203 4 jnxMbgSgwPP DelBr jnxMbgSgwPP ModBr met atable jnxMbgSgwIf DelBr jnxMbgSgwIf ModBr 299 2 Ġ\" {}\" 315 7 315 8 315 9 Storage Class Ġ"[ % cum ul 857 143 Lim iter Lim itation GPU s PK CS ĠNetwork ing åħ¥ åĬĽ ĠAttribute Type ĠPerson s updated At Ġfh ir Translation Notification Translation Sync Translation Urls Translation Subscriptions ENTRY POINTOPTIONS Ġvisu als ANS WER Ġgeo coder 456 3 456 9 hyper path EP ISODES éģ ¿ Ġnone xistent Dete ctions Ġnd arrays 308 3 304 5 Pr incip pur chases Display Utils sto ppo sto ichiometry Ġmet atiling ("{} |{}|{}|{} ĠOp Test Ġvelocity Gain Ġden oted ðŁı´ółģŃółģ ¡ ðŁı´ółģŃółģ ¹ vor i say hi Ġ---------------- ----- Ġ---------------- ---------- Ġnor dic pdb flex VK h dark net Lin AlgError OFF ER Expression Context ki lo -> % ĠQuery Uniprot ĠØ · Ġí ĸ Ġí ĴĢë§ģ Auto Scaling å· ³ Ġavoid ing 284 3 284 9 427 7 427 9 Ġsignature x 292 6 Ġflo ors Ġdiag on Ġdic ion spread flag spread sheets ç§ ģ REF PROP OD g Med lineCitation rend ers 394 2 sz yst Ġblue tooth 436 6 ĠCLI P å¸ ¥ ific acion Ġadj Pvalue 388 2 388 3 Ġ'[ ': Ġ'[ {" 大 éĥ 237 7 Ġfront GroundGHI Ġlab s Vo tes Ġur ban Ġelect ro pix set pix format Ġcu isine 293 5 293 9 303 5 303 8 ĠLib re Accept ed Ġrepe atable qV QK à± Ĥ tm ux collect d HH HH æµ · Ġhold ings 396 8 457 4 Ġlegend size 337 2 337 8 387 6 387 7 ем Ñĥ 437 6 437 7 Vol unteer Report ed ĠOver lay ĠFilter Call åIJį åįķ Vlan Id Ġhex str Flag ged cook er 386 9 ĠDocument s 455 5 El Left ĠMap CellType è½ ¯ä»¶ tun gs ĠSci ences sound cloud 332 2 Sm allest Ġai y urb ine Ġcam Data bm ds Ġ----- ") ë¡ ¤ ç± ³ Func Animation aco ustic ĠShow s [:,:, : ĠпÑĢ ог 405 6 è· Ł Inv ite /# / Car lo Ø§Ø ¦ Ġpast ed ĠTry Lock çķ ° Ġroll ES Ġpacket Handler RESPONSE V 364 3 Ġurls afe online judge ĠCall ing Syn onym ĠGenerator Type 309 4 Ġarc name Ġ============================================================================= == ĠSupp ress ä½ľ åĵģ Ġpyg mo 285 8 Ġ################ ####### Ġ################ ############## ĠSw agger Ġд о onto logies Ġvirtual HostUtilities ="# " Ġalt ura GY RO Ġlb ls Ġcorre lación toc Str Ġheat maps cutoff s Equ ation Serial Query Serial StateNotification ipy ard ĠApi Error }$ ' Camera Setup Inser tion )[' \"] áĦ Ģ áĦ ĥ Diff Convs ĠAWS Region Ġaffili ation ("../ ") ðŁı´ółģ¢ółģ ·ółģ Stock Model taint ed Ġarm or Ġarm our Bool Type oct olytics åıĤæķ° åIJį称 Ep Number Band it Ġfragment ation ARB ALL åIJİ ç¼Ģ Ġ#-------------------------------- -------- Ġmanifest data ê³ µ ĠNEG ATIVE Spect roscopic morph W ĠAv ailability ´ółĢ µółģ¿ Mag ick Mag nitude Ġprom in Remote Server Dump ing spo iler Hw Histos LAY OUT CLO SING èª į èª ŀ VI ER Ġparticular ly Ġta H UAL IZ TW LIGHT (".") [- Keyboard Interrupt >` __ >` _. ĠStream s ê¸ Ģ Texture Filename pal indrome ĠLogin Error Http Error Ġdd trace Ġrecogn ised Mar shall ston ed exact ly ãģ§ ãģĻ street view ĠChar les ĠPosition al ĠImp licit Boolean Field autom ated Ġ'.. ') ="{ & ðŁı´ółģ°ółģ ³ółģ ðŁı´ółģ°ółģ ¬ółģ hal frng ĠDummy Operator ô t memo ize åıª å¾Ĺ åıª èĥ½ ĊĉĊĉ ĊĉĊ 448 55 algo Params ĠLi u contrast ive Ġtor ow Pol ynomial åģ ĩ Ġ+' /' Cer tain Elect rical vcf call Ġvoltage s åĨħ éĥ¨ acp ypes Ri ver Ġfunctional ities fruit Purees äºĮ åįģ Ġ"\\ " ĠDIR S Feed back Ġima gined Ġoct avia vic tim Ġmorph ology Ms gs Ġens uring ĠEdge DB Ġrecur Searcher chem ical Actor CreationTaskSpec Shift Arr Es colha Ġ'& ' ĠChannel s ({}) ". 655 36 Ġ× ¢ Ġ'| ',' éĥ½ æĺ¯ Ġtoggle Button Require Debug ä¹ĭ åīį vex Hull FULL SCREEN اÙĦ Ûģ nut tx Ïĥ η Ġosg Terrain аÑģ Ñĭл May be deleg ations LOY EE åĮħ æĭ¬ Tw it ак ÑĤи ĠCRE DIT LogLevel Response LogLevel Request Updated Notif ðIJ ij Ġig ual Cy thon Ġvk Value Learning Rate ĠMET ADATA ([^ '\ ĠInstall ing Ġroutine Timer Health y LER ANCE flt Spec Ġfocus able ï¼ģ ") ï¼ģ ï¼ģ ĠCould n ,* /*; Ġlm db 空 æł¼ Ġìŀ Īëĭ¤ åºĶ 该 JA EGER åħ¨ éĥ¨ ĠSkip Test ridd ing Ġ147 0 Ġíķ Ļ website Url Ġcad nano ãģ¾ ãģĽ Rank ing Ġstrand Over æıIJ åıĸ craw ling who is Ġæī Ģ Hand ling Rad ianInverter highest High 668 36 è¦ĭ äºĨ GM CC evalu ators ółĢ²ółĢ µółģ¿ ółĢ²ółĢ ¶ółģ¿ CHANGE LOG eigen vector ************************************************************************ *** inel las Ġgi ant COPY RIGHT blend Shape çĪ ± Ġfan Art Ġmens aje xgb c Ġisol ation âĪ ļ Mol ToSmiles enci ar enci amento Tech nical ν δ ĠFE ES PIX IVUTIL REL ATED ĠìĹ ¬ ĠDistribution NotFound 000001100101 0101111 getsize of agree ing ðŁı´ółģ¤ółģ ¥ółģ erc ic Veri fier cY mh easy Core domin ant Ġrelat ively ад аÑĩ OAuth Users aver aging æ· ± ê² ° Asc ending ANALY ZE Attach ments å¼łæĺ¯ åı°æ¹¾ Æ°á» Ł èĻ « ĠColour s Ġcoco tb Ġanim ated æīĵ å¼Ģ Trust ed ëł ¤ Ġpare ns KD Tree pup pet ĠfltStmt Ip cand y skeleton s த வ âĺ ħ Ġtan h ĠDisable Able MONITOR ING âĸĪâĸĪâķĶ âķĿ Ġ***** ") Ġhom ogeneous Ġ!!! !") ĠMyCustom NewsPopularity ĠBits Type Attack er Ġcraw l åĽ½ å¾½ BED ROOM represent ed Ġtreat ments Sun day atten uation ole ans consu med vul n ('../../ ') ĠSep tember ĠKo di Ġabbre viations ĠÄ ° meme ber Ġbirth day CCC GE Dynamic StockModel ĠPl anning COVER AGE ClassifierIp Source ClassifierIp Destination hil um marg inal Ġsma pe åıĬ æııè¿° ĠÑģÑĤ ÑĢок íĺ ¸ rein force Ñħод а Augment ation dR QQw Ġpul ses ĠArg Source ế u XB MLANGPATH kine tic Ġack nowled Ġvac ancy cpwVcPerf Current SAN CAI ĠSimp lify ĠCri tical Reflector s Keep er Optimization Status Ġл и ि à¤Ĥ JU MP ĠHist orical frameN Stop CONSTANT S cif s ë° ĺ planet ary informat ics reveal ed Ġdeno tes çݯ å¢ĥ settle ment Ġgri pper Ġpyqt Signal Ġperfect ly cPPPoES AbnormOff TENSOR FLOW Ġmort gage ĠOrg Extended Ġê³ Ħ층 ĠPeak Table POLY GON receiv ing robo tics ĠFollow ing Ġbear er 8765 432 Compound Object UPDAT ES Ġ################################################################################################################ #### Lon gest Prote cted Ġhg ail _- _ STUD Y Õ¡Õ ¬ ({} )) Hour ly Mirror ed Ġtur bin CLASSI FIERS onboard ing observ atory Ub untu ClassifierEthernet Source tektronix MDO ĠIncrement al ĠctspIf L DEN Y Way ne Ġcros ses Ġnos y Ġtektronix MDO jaco bi ĠMonth ly Ġ################################################################################################ ####### ĠcpwVcPerf Total ç¿ » Ġiot bx ĠINTER VAL Ġmsrest azure Ġshel ls Ġexhaust ed Combat LogData ãĤ· ãĥ§ãĥ³ Ġtabu ada pedigree Cells ק ×Ļש Ġsty ling HEALTH CHECK whit enoise ĠImpact o èĦļ æľ¬ SHO OT ĠAstr onaut æĬ¥ éĶĻ Lasso Lars ĠSmooth ing ĠUsd Geom Ġdivid end Wrapped Tokens Bri ef Ġrefine ment ÃŃn imo stockidx name åįĸ åĩº xia omi 0062 99212 ĠLeaf Indices STOCK S Dry Run Kine matics Smooth ing stun ned Ġhab en ĠEst imation EXCLU IR Packed Reflectors Ġguide lines Cancelled Error ","" ). nthes ise ĠVir ginia Ġverific ar Ġrespon ding CALC ULATED Solve Result íĮ Į Ġtet ra Ġconsum ers ĠPulse Error ĠJon athan ObjectRef Info ĠNavigation Toolbar ĠFRAME WORK getTransaction Receipt ĠRM utils cvcConf Controller 身份 è¯ģ人åĥıéĿ¢ Focal Point evi ctions ('(' ) ĠWEB HOOK Lease AccessConditions ल त Ġ================================================================================= = âķļâķIJâķIJâķIJâķIJ âķIJâķIJâķĿ ê·¸ ìĿ¸ AUGMENT ATIONS Ġpadd lenlp lich tungs UCgU CoVC è¯ģ件 éĻĦ件 å±ħæ°ijå±ħä½ı è¯ģ å±ħæ°ijå±ħä½ı è¯ģ人åĥıéĿ¢ ĠFritz Status å¨ ģ åĶ ¯ä¸Ģ rela xed Ġequival ence ĠTensorTrain Batch ĠCOUN TER Ġsymp ify ç¯ Ģ mich igan DIVID ER âĶģ âĶģ mcast ControlList ĠMik rotik DropNetflowMonitor Group SecurityGroup Tag Annih ilationRate hay stack Ġwaf lib ĠHY PER ĠProceed ings GRAN DEUR Ġvibrato Pos кл ÑİÑĩ ĠTagged Item Exe mplo yam ls Ġppc ls 0074 8417 BoxMesh Component SourceCode Pro ĠAdministr ators Insights Constants ĠMIDDLE WARE ĠUnp ack linu xbridge akk ında CONFL ICT Causal InsightsConstants ĠrwMotorTorque Config é¥ ° Ġnitro gen Ġreti red ĠDry Run Infin ium ĠConan File ClassifierInner VlanMap benchmarking ProcessId 殿 帥 UnorderedAccess View ĠMort gage Ġè½ ¬ Ġdiccion ario Ġë¶Ħ ìĦĿ Iss uer Ġpgs rc GetX axis QUOT ES ĠPROB LEM basicPreset Test ĠHEO SEvent APPRO VED Ġaba ixo éĺ² æŃ¢ Xform Op Ġndc g Ġbent oml ltt ng haarc ascade Alig ner MONSTER BEHAVIOR ĠæĮĩ å®ļ Vrf Name ĠAVA IL ĠMult inomial ĠErd AcFan Constr List ðŁĺģ ðŁĺģ ĠCrossEntropy Loss ½Ķ ëĵľ ÕŃ Õ¡Õ¬ 01306 398 Ġosx photos Ġ![]( ../../ ucch ini conduct ance Manufacture Date áĥļ áĥĺáĥ homoph ones zná mk Ġeyetrack str ĠMRBrain S BFR ange mvs net getmax yx ĠFib onacci 04857 958 ĠBaseNon Aggregate Ġè¦ ģ é¢ľ èī² éĺŁ åĪĹ somename space Ġcrawll Twit BCEWithLogits Loss AndGreed Indicator +.*)') ), ;:{ & mard at getpw uid Ġrsem gr xdgm ime 17900 058 DEFL ATED micha el parseAndOutput Csv SetAvatar Response ĠPathToTest File naLetalis ca GOEEXF PTunable GoLab OAuthUsers TranslationNotification Recipients TranslationSync Logs stoppo int ("{}|{}|{}|{} |{}\ ãģ¾ãģĽ ãĤĵ தவ à®± ĠDisableAble CommandHandler ĠMyCustomNewsPopularity DataLoader åĽ½å¾½ éĿ¢ 006299212 598424 UCgUCoVC cYmh ĠErdAcFan Setting " (.* # | ' ': ' ([ ' ". ' {} ' ({ ( | ( ('{ ) (* ) }. ) %\ ) $", * ?\ + )') + ="\ - , . """) / .* 2 00000 3 923 3 925 3 136 3 194 3 325 3 935 3 998 3 179 3 995 4 164 4 194 4 122 4 181 4 239 4 238 8 20 8 946 9 025 9 137 9 135 9 327 : _ : "] ; ;\ = `\ > '], ? ! A ri A tiv A IG A bri A OI B ent B ian B ANK B ecause B ayesian C rc C MSG C ERN C usto C oulomb D er D AS D ich D FF D ynam D MY D odge E a E inf E CS E AX E vidence E GRESS E psilon E mitter F im F ly F resh F uel F wu F etches G UN G uest G nu G eral H ang H eld H AM H ING H MM H ora I AM I dade I ERx J F J r K ern K CS K VS K VA K HZ L int L TT L umi L ITE L icence L obby M ur M us M os M ich M UL M ais M UV M sun M jI M appable N iter N EST N DY O wn O thers O puDevice P set P res P norm P ai P AGES P ckt P esquisar Q Table R am R AC R CL R AIN R oman S SE S ou S ID S AA S lc S ieve S IDER S ENSORS T ir T AN T Ex T ai T ank T ries T APE T Compute U v U VC V IC V gs V IL V ik V So V PC V PD V QA V endors W rl X GEo Y V Y olo Z f Z ap Z ENK [ ], [ ^\ ] }', ] >= ^ * _ ]) _ ). _ ([ _ [- b ub b low b ia b ene b DY b DZ b lood b umentations c log c ateg c item c las c vars c ortex c plusplus d ram d cd d pkg d ana d ropoff e te e ha e bi e thernet e charts e quilibrium f pp f elt f etched f lickr g J g L g ct g pp g ize g low g nn g static g ador g auc g lides g acha h dd h map h cal h ams h aw h mc h aven i I i ar i are i ÃŁ j K j Z j el j ellyfish k G k V k op k ou k ernal k fold k Hz k illed k itchen l C l gn l fe l cores l wr m gs m oto m alt m RM m Erro n ub n ary n True n net n vis n Time n steps n frames n asm n Rows n abla o K o ch o ha p L p M p W p ult p lu p values p Value p thread p convert p logical p Priority p ulls q I q Z q it q VC r C r I r val r ray r pi r fs r sqrt r wx s B s ir s mpl s aml s lan s quee s outheast t info t old t Description t bi t ros t Device t returns t qp t Ctrl u ite u wi v arg v map v ld v double v mlin w age w ash w OB w Go w mg x T x ue x co x id x right x left x Max x EA y ı z C z X z ab z max | "' } '), } _\ } ">{ ´ ółĢ°ółģ¿ µ ółĢ±ółģ¿ ¹ éĩı  ± É Ĥ Ñ Ķ × Ĵ Ø £ á ĩ â ° å Ħ ç ĩ é ¤ é Ĩ ê ľ ë ĮĢ ï ¿½ ĉ ĊĊ Ċ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ č ĠĠĠĠĠĠĠĠĠĠĠ Ġ uld Ġ 000000 Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ ÃŃ Ġ 002 Ġ âŀ Ġ è¿Ļ Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ ############# Ġ ðŁĺ Ġ ÑĨи Ġ éħįç½® Ġ lobby Ġ æĺ¾ç¤º Ġ å¾ĹåĪ° Ġ ç´¢å¼ķ ĥ £ Į ìĬ¤íĬ¸ ĺ 못 ļ Į ĠĠ čĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠ ĊĊĠĠĠĠĠĠĠ ĠĠĠ čĊĠĠĠ in ps in cor in variant in psd er de or ne or bits on off at in at traction re tt re buf se con se ps st ico en ie Ġt doc Ġt win Ġt urt Ġt utorials ar my ar si de la de ed de compose le p le igh an ity an ie Ġi z Ġi ct Ġi id Ġi max Ġi cons Ġi IndexReg me ts me dic Ġ' ;\ Ġ' $\ ro ok ro former ti ma ti ms ti ger mp q mp ls mp ileup Ġc Y Ġc is Ġc ance Ġc ens Ġc lif Ġc ass Ġc ele Ġc ents Ġc flags Ġc dp Ġc Profile Ġc ffi Ġc kt Ġc xC Ġp H Ġp he Ġp ers Ġp ound Ġp md Ġp ies Ġp ounds Ġf ab Ġf num Ġf ba Ġf rees Ġf rq Ġf ederation Ġf ifty Ġ" ': Ġ" ') Ġ" ?? Ġ" \\\\ Ġ" =": he te he ly he ating it k Ġa er Ġa res Ġa ob Ġa min Ġa ead Ġa fixed lo docus 00 76 00 10011 ge orge ge ese ĊĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠ Ġn ics Ġn fft Ġn inja Ġn reps Ġs op Ġs path Ġs if Ġs ids Ġs sm Ġs fc Ġs freq Ġs mass Ġs cout Ġs lides Ġs ür ss pec Ġin for Ġre k Ġre ff Ġre frame Ġre curs Ġre ceptor sel ength sel ayer Ġo ov Ġo dl Ġd al Ġd ss Ġd ub Ġd ert Ġd cm Ġd ÃŃ Ġd ni Ġd adi Ġd rac Ġd ollars li zer li zz pe w un er un map un mask un visit un typed un ichr Ġm ys Ġm cts Ġm tx Ġm alt Ġm ssql Ġm ÃŃnimo ra iser Ġe di Ġe og Ġe mitted ate e ate l () ]: fi e fi ds fi du ad mit ad ress ad monition co c ri or ri son Ġb ill Ġb ounce Ġb ayesian Ġb illion Ġb dotControlConfig Ġ1 997 11 32 11 33 11 38 ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ċ int f int ree id list Ġ( {" Ġ( "") Ġw o Ġw ild Ġw ally Ġw ie Ġw eno Ġw deployment Ġw urde ch od ch ans te et di um di ary di xel di hedral def lection ata pult Ġ[ / ma int ma gy ul k == [' Ġif f ot om ol on el H es sentials ode s is al is num is Checked is Flagged get default get status get Set get Config get String get Dir get addr get Struct get Speed one Turn one cker )) ') set value set Finish set ContactInfo Ġto m Ġto pos Ġto wers ĠT ol ĠT TF ĠT iamat th ir th ose import ing str t con fidential Ġ2 92 Ġ2 79 (" ([ (" (? pp ings as v as sembler arg Name arg names op c Ġ{ {} Ġ7 34 ĠS age ĠS ak ĠS AP ĠS xx ĠS hel ĠS SO ĠS ITE ĠS ector ĠS EG ĠS ticker ĠS pring ĠS IDER ĠS NOwGLoBES ab h ab l ĠC P ĠC W ĠC as ĠC oun ĠC IS ĠC fg ĠC GS ĠC ategor ĠC IE ĠC TF ĠC EA ĠC lusters ĠC lears ĠC APS ĠC ROSS ĠC ORMBase ig py ig json up c up ied up sampled rint er Ġg ab Ġg pt Ġg hosts Ġg unzip Ġg lavniMenu for security ter razas Ġr j Ġr peaks Ġr uby Ġl z Ġl tr Ġl ui Ġl mer Ġl sb Ġl ucky data size data In data Base ĠA io ĠA tiv ĠA ward ĠA ws ĠA CM ĠA xon sp anning ver ters '] " '] ' '] .__ '] ]] '] )). 01 08 01 58 Ġcon flow Ġcon vection ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠ ke xt am bo to bytes to ctree to TheOrdinal 99 04 99 14 ith ens ist itle ĠF G ĠF s ĠF ac ĠF EM ĠF inger ĠF ocal ĠF avorite od s log Dir om d value A Ġh pr Ġh alt Ġh anded Ġh kl Ġh orizontally ĠP B ĠP unk ĠP ATCH ĠP lainText Ġas in der ef ĠI var ĠI RC ĠI MF file d ĠL am ĠL CL ĠL atex ĠL INK ub o ub ution tr ump tr atio Ġth ank Ġth under =' .') Ġst upid Ġde ver Ġde coders Ġde duplicate Ġde duced Ġde precation Ġde sea pro gs pro cedure pro ficiency 0000 10000 ex on im b im array Ġex clus Ġex clusion Ġ3 94 10 85 10 23 10 47 10 40 ase m ect l ect ure out dated ow il ĠD P ĠD ust ĠD CT ĠD EM ĠD aily ĠD etailed ac z Ġu cp Ġu selength ]) | Re actions Re cover app i app run app store sh aw sh allow ĠM R ĠM ULT ĠM ink ĠM ocker ĠM ov ĠM outh ĠM apper ĠM KL time path čĊ čĊĉĉĉ =" ^ Ġv d Ġv z Ġv arnam 02 67 Ġ_ ): Ġy str Ġy scale Ġy cmd Ġy gg Ġy af Ġy pad Ġy rng Ġy lims Ġnp y ĠO ffer ĠO CC Ġ* " Ġpar te Ġpar ties Ġx res Ġx pos Ġx pad os ds Ġma ko que ens test word Ġor phan ER I IN A .. ',' xb u xb mc ore hole ore aders Ġ% }')) tra kt Ġfile Prefix our Excel Ġpro tot Ġpro mpted py ro py ver py file py md art en art lan xc or xc at pre l pre vent pre lim pre sto ap m ap erture 07 96 07 95 xd ays ense n Ġbe ats Ġbe lief Ġbe lieve Ġbe haves Ċĉ ĊĊ ĠB urn ĠB ST ĠB cc ĠB uff ĠB rad ĠB ah 12 32 12 86 12 83 12 29 12 72 Ġname Chunks ys on ĠE ar ĠE den ĠE yes ĠE AI ĠE quivalent ĠE ITHER Ġj accard Ġj ulia AT GA model path ĠN t ĠN IL ĠN ose date format bo le Ġ4 32 Ġ4 13 Ġ4 96 Ġ4 97 Ġ4 26 Ġ4 23 Ġ4 46 Ġ4 53 Ġ4 49 92 04 col laborator In dx In complete In structions In consistent In sufficient In HCBytes In HCPackets ind en ĠR ub ĠR ST ĠR ail ĠR OUT ĠR OW ĠR ENAME mo ons mo sphere mo odle ep ide Ġun filtered Ġun compressed Ġun stable OR L OR IZED fo vs Ġtest data Ġtest bed lic ence Ġlog dirs oc eny son ar // : ĠG E ĠG il Ġco gs Ġco ordination Ġco lossalai EN SA ĠW av ĠW ords ĠW GS tri buted Ġout box Con ns Con gratulations ĠV C ĠV ery ĠV alley ĠU W ĠU ri ĠU NA Ġ5 11 Ġ5 00000 Ġ5 600 mb a ib al ard ens ard uino min ar min io min eral min iglm 18 27 18 38 18 21 18 59 18 49 16 11 16 99 16 55 16 63 Ġlist ar cur vature da i Ġk ls Ġk ids Ġk pc Ġk si Ġk fp Ġk ws Ġk rb Ġk bd Ġk ahy 25 83 Ġpy z Ġpy doc Ġpy chron Ġpy omo Ġpy gears Ġpy loco Ġpy redner Ġ6 20 lt ot lt nw ag i ag artlan ump rod http components http Target 04 66 04 29 13 32 13 18 13 74 13 58 13 53 lib dir 06 87 06 52 ll ll class ical class wise 15 95 15 56 15 43 15 54 15 58 ST ABLE ec cen max y Ġthis Invocation 03 44 jo se Ġop end ute ur train loader Ġch allenges ax l 17 96 17 94 17 63 Ġal ip dd fa 93 02 93 33 93 77 93 43 93 52 ĊĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠ 14 06 14 08 14 87 14 83 14 76 ne ato Ġ/ ( Ġat tic Ġat tractor 64 08 index Type error handler Ġra ke Ġra cket ([ . ([ {" gra ce gra duate ence Error :// ') RE CLASS RE LAY RE CONSTRUCT IC MP 08 99 08 55 08 67 pi a Ġ. * ĠH IT ĠH ong ĠH alf ĠH IST ĠH ills ĠH ierarchy ĠH XL ĠH ilbert ĠH abilidade ĠRe levant ĠRe seller sub titles input DNAs eri e Ġdi richlet sk f sk ri db ToPutIn 88 05 88 14 88 52 ded uplicate ast ers lin n lin s comp yle ID AY ID GET ID ATH ID evice Ġsc Object Ġ` - 34 25 34 21 start tls Ġwe alth Ġwe apons 09 11 09 17 09 54 09 73 09 62 84 00 84 26 84 35 84 77 ĠIn ky write str ere k nd x ant lr gs util by tree bin info lock er Ġle aders Ġle venshtein ave gador 24 00 37 11 37 23 37 82 37 81 37 61 ak u Pro of Pro vision point net Ġoutput ting Ġpo x Ġcom ent Ġsub window Ġsub problems Ġso le rep rise 96 75 Ġcomp et Ġcomp iling Ġinput DNAs 55 64 55 56 94 07 Ġcur ried Ġ} }} 33 32 DE CK Ġapp Cfg Ġapp reci node list row id 87 44 87 45 87 77 87 78 no ck AL B AL READY Ġclass if exp losion Data source AS ig AS IBLE iv ens Ġla place Ġla unches 85 32 85 08 85 66 85 72 ". ' ". \ 97 74 back ports net app ================ =========== 36 17 36 96 36 66 36 73 36 61 36 00000 =[ . 011 4 011 6 011 7 011 01 011 0000 Ġopen id ĠK T ĠK an ĠK ing ĠK DE ĠK raus 95 02 95 77 95 73 lat tr Ġimage Layer 86 94 Ġtorch audio mon s Ġz mp Ġz id Ġjson file rit to rit ories 57 16 57 17 57 42 Ġ[' * Ġ| '.\ create Database reg istro Res ized Ġbo ols message Panel spe lls Ġfil ls List Context current Path color ize color ama Ġunder water port ed ach uset version eer Ġlo ose api Version status bar 23 89 request Id AC VM Ġcheck boxes Ġcheck ov Ġte achers 44 92 44 93 44 08 44 36 44 38 44 29 IM ES 80 99 AP PR 75 65 new list new Path new Cur stri king Ġnode id ef e ']) ( En abling Co VA ET x var args cal T cal z cal ing 56 59 go ti 98 32 98 08 my keyspace Ġmin x Ġmin val Ġmin pix Se ym uc r Ac meAccount be ing be ad be ch be ho be ach be ads UR B UR DAY ĠQ Object ĠQ Font Ġcolor es uple s of code target ing 35 01 35 13 35 87 35 83 AB IL vis c ref ined Value Validator Ġmo te Ġmo jo ain s AD I AD AGUC save mat cre am Ġad visor 45 08 45 22 45 34 45 28 Ġvalid ar ng amma fil mo ich olas cent ury item Class ey J ĠY e ĠY ANG Ġinter view Ġinter leave ĠX y ĠX ia ĠX DR Ġtrans mitted 47 97 47 67 ]] - action List command State Ġpos file Ġ9 03 find ById cy t Set Output Ġreg ulator mean ing 83 06 Ġmain loop Ġag nostic Ġag enda Ġver is led Collection du it Ġlin scale random ized UN AVAILABLE UN DAI gen rule gen omic order by Ġcommand Size 46 01 46 99 46 25 46 14 46 86 46 58 ĠJ eff Log Handler bg tools bg porter Num MsgRx Num MsgTx yle vels 89 05 89 85 source d lect ance DI A DI AN Ġ] * ":" ", ld r 40 99 Ġread fromBuffer ANT RA Un zip Un Sup Un Supported Ġversion ed TH OR TH AN TR UTH TR ULE ĊĠĠĠĠĠĠĠĠĠĠĠĠ ĊĊĠĠĠĠĠĠĠ ister ed air port air case To xCast CON TR De limiter Config urations dim red Ġval Summaries Time Span âĢ ¢ Ġtable fmt MP U cat tle 43 55 use package ĠCON V Ġup graded ĠPro fits Ġplot util uid ColName :: { 000000 5 Ġnet messages ug gle Ġmatch Tissue cu df page d std npf PI ECE 48 04 48 15 48 22 48 94 48 26 Ġqu otient Ġqu artz EX ACT 91 99 ĠData Validation err state red in Ġfirst name No isy \\ - content Type 42 32 42 18 TT emp Ġtemp s MA KE EL LE EL ASTIC Model Tag Model Serializer EST E )/ $', iss pmatrix DAT ORY ten ancy metri ces mt u "> " wo uld rol ls parent Constraint Get Bin Node Available ĠWAR N 76 87 Ġsum m Ġsum ming pc r Ġsave fig Ġsave Image Ġover writing Ġ", "") Ġtensor force bl ame Ġass ist Ġass im uni MIB play back cho co Number Exception aw an aw ner tensor rt --- \ Ġchar Set tmp Pat ik FootControl Key File 74 04 74 21 epoch len mem map mem cpy enter prises Ġfind all Ġimp artial String Plug String VectorData Object Index Object Store Comp ressed Comp ressor ĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠ Form Invalid ker beros Le gal Input Definition edge size Ġab und 58 17 58 09 58 95 dist ubution Out HCBytes Out HCPackets ĠTest case и и Ġlocal es Ġdest pattern "\ ( pol ler Ġbin size Ġman ages Ġman agers uper ação Ġport able ĠDe viation CA AU si aml Ġ200 01 height map Ġextra polation Ġbu ys network management Trans formed ORT E ãĥ į connect ing xff z ym ce Th ermal Th irty pb f Index In Index Handler Index Endpoint ĠPython Spec fs leyes 52 64 cell Y ĠUser Docker Of ficial Of SecondFixedSurface Up Stream ĊĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠ ĊĠĠ ĊĠĠĠĠĠĠĠ ); ') Sh i Ġ255 06 GH id Ġcase name Ġcase less Ġexist ent Image Name Image Reader Int Code ĠSo up disp ose 49 04 49 08 ÑĢ еÑģ DB NAME Ġmask grad part ners SC Q PRO TON stream Id Ġ15 17 Ġgl Color Ġgl Uniform serv ant ĠGet MainURLFromList cluster Path :\ /\ domain name åĪ Ģ Not Ready CK PT Base Url Ġtri gonometric Ġtri ângulo git repo font type Al loy Al rm Al phabet gg h keep dims keep alive fp fh ground truth 69 55 "{ _ Ġsome how full Name Rx Packets Ġgover n ĠCh ristian sleep time ĠImage Ops Py Node inst al Ġraw output For Account hash able hash map äº Ĵ track Validator ĠSim Array ĠSim CLR div mod é d Ġmock env Ġmon otonic Ġnon posy Ġhost ing Ġloc alized Ġref used æķ Ĺ ĠLo ve ays ia bit rage bit finex ĠDef initions Group Type xed o drop let drop Database VE Y arr ing Ġge ometric Ġge ocat Pre process PU Z GR AP web page web novel Sub classes Sub tract Sub Resource Sub menu Sub Account sig fac af c af eta ĠZ AP ,' % NO ISY ĠBase HTTPRequestHandler Ġì °¨ fin ais ã i Ġzip line ĠSO I Dis c ]+ "\ NE IGH Ġcho se ha ha ha hm sen ate ĊĊĉĉ Ċĉ ĠAdd Entities gt g supp lement any Of Ġ14 19 áĥ ĵ Point Pattern ĠCheck er ĠCheck point Lib virt rot ator ĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠ ĠApp State Ġcustom s Ġcustom ers Or Empty 0011 10 ." } cm divor Ġinstall Status Item Index ĠConfig Type ĠConfig ures ĠConfig YesNo âĸĪâĸĪ âĸij ĠComp ress ĠComp liance xab V imp acted We ibull hand verts Ġbefore hand "} )) åIJ ¬ Code Block Date AndTime prob ab prob ably ĠCol lision ĠCol lege Ġpe ace '{ _ Start Date Ġweb ob ASS URANCE BL K multi select multi lingual Ġmc mc Ġsuper class NN C Ġ[- ]') !! ' EXT ENTS requ is ĠPo kemon commit tee ling ton ())) )) ĠCom bat STR ICT All Users All Args ret to way point cer pt lon ass On T On z On es Command o Ġtrack lets ĠModel Form ĠEX PI Ġinitial value Ġinitial isation Ġmulti variate SV I Ġ---------------------------------------------------------------- --------------- Resource Properties xF AC xF CE xF DB used forsecurity Is Not DR mt 128 33 ĠIt alian End Event Ġdisable s short code Ġdraw down Ġgr ating ĠTo xCast unique s ĠAt tribution Ġview ing Ġview port SO M Ġskip na AV ATAR An imals pus hed mu Sensor :- ^ :- :< Query Executor à® Ļ ĠAl arm fici e final wgt EE B fr ance screen shots Ġvari ations Ġannot s Ġstack trace ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠPer mutation bi co ä¸Ģ è¦ ä¸Ģ æł· vv max Ġtk n [\ " hs b Ġround house Down Stream bb c bb re Ġip addr vas z vas ion ĠRE AL ĠRE PL ĠRE MOVE Ġë ¦¬ Ġë IJĺ )- ( car park Ġ25 000 menu T Ġcl ct Ġmod eration 925 92 Ġarch install Ġtick marks New Optimizer Ġvideo item Ġour selves Ġauto data Ġauto CH gu er gu ys pla idml Update Task Update Progress PRE FERENCE atic ity Ġio ctl ĠLO W UU G Ġæ ² Ġseed ing ĠDis p Ġhand shake čĊĠĠĠĠ čĊĠĠĠĠĠĠĠ čĊĠĠĠĠ čĊč JE CTION Red dit 404 4 sn iff MT k super type GT PPort IF ACE tw elve conn exion 500 7 Ġbit wise Ġpr ze Ġsepar able Ġsepar ating reward ing }: [ }: ){ ĠTensor Constant ĠTensor Product PER FORMANCE Const ellation Ġcre ar EC N ĠTH ESE Ġapply info Ver Rx Ver ErrRx Ġmp lt ------------------------------------------------ - Go als selected Layers Ġdev il éĩ įç½® PH Y PH j asis LinearRegression ka hy Ġinv ocations Ġpayload s Ġ"< !-- ĠCO DEC ]} } ]} }, Noti fs BR Y Ġpa ÃŃs Ġmemory view Ġgamma s audio FileMetadata And rew ao e çĶ¨ çļĦ Component Status BB BP DA w Batch Data Ạ± poly val fold ing ĠBUT TON Ġeps g ĠColumn DT Ġms ds alan obis HTTP Client Seri alizable proc Man æį ī free desktop CHECK SUM ĠDi gest Instance Identifier Ġnormal isation Ġ(_ ): UC s ĠNode Type }{ % }/{ : LIST EN .) [- asc ading >. > mol l FE ASIBLE Spe aker åĢ Ł 401 5 rd Config rup os Ġmarker styles Ġmarker edgewidth 204 5 att Hero Ġ'< ': ama s }] $', sess or ĠDec isionTree Panel s Sw itchover ĠPO LL ĠPO INTS bf gs roy al ĠDB s Ġtw enty writ eto loud ness Ġctsp Notif Uti lization ĠEvent Type rome try BACK OFF BACK WARD čĊčĊčĊčĊ čĊ gi ra éĻ ° 917 7 iso strf yl or 193 8 ĠLabel ledCollection ĠDate Value Multi Array square up ðŁĩ ¿ wave Mobile My Class My Sql negative NumberException den ied den omin RA ID WR ONG ĠCode c ĠCode Template ĠDet ach Ġtermin ations cir klo '" % ĠSequence Matcher COMM ISSION emp h emp loyees Ġflat s 218 5 uck les 264 7 Post Num Scalar Mappable Ġcer tainty Can ada ¡ółģ ¢ółģ¿ Url IndexHandler Ġcdbp AppAdvFromPeer WORK FLOW see ing Ġbig dl 137 2549 CN T Ġmis cellaneous (); ") ов Ñĭй Ġcla imed gri b Ġforward ing YY SgAq 132 5 Ġpur ple weep rint Gen re Ġfe j Ġfe ather emb data pin ning stit utions ĠMin imal Bytes Type AK hQK ĠÑģ к ĠÑģ озд Schema s Schema Error syn ced :::: ::: zo pe Sequence Type operator name Stack ed ĠInvalid Argument ris is indent ed ('[ *] sci entific har vard 207 1 203 1 Ġresid ent rou pe GRO OVE Ùħ ÙĦ Initi alizes 904 5 nu isance Ġ"[ +] Ġ"[ *] ĠItem Attr CAP ITAL OC orrect ен ÑĮ Ġč ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Reference FormID ARG ES Mask s ä¼ ° Ġba selayer ê u updated Egg ĠBe ach Container Deployed Ġut ter 908 4 456 2 SUB NET SUB PIXEL Interval Start Rest Client Use ful Ġnd vi Ġgeneral Dict tcp Sock Import ed Ġlock file Rot Mat Display Name 424 3 424 4 Ġmet atable Ġsym m еÑĢ ез operation Handle Ġ"' ", Buffer Size selector s ĠNorm ally ĠNorm alizer ĠCustom JS nz p ðŁı´ółģŃółģ ² ðŁı´ółģŃółģ Ń ĠSpe ll éĹ ¨ Ġlst sub ĠDynamic ally Ġnor ms VK J Ġĉ čĊĉĉĉ Ġpipe Dst MR Brain HD h ĠQuery Root Active Users Ġinvok ing Auto scaler Ġregular izer 307 9 427 3 Ġâ ģ Tool Button DEL IMITER ĠResource NotFoundError 406 5 Ġfbx AttributeType è¾ ¨ scra bble '% (' nf ld Ġ------------------------------------------------ -------------- ĠtypeOf SecondFixedSurface ĠCONTRIBUT IONS Len ErrRx д е #---------------------------------------------------------------- -------------------------------- Draw s Identity Pool 334 2 334 3 å± Ģ 008 04 325 46 MI LL LB Z dos ya ĠCLI ArgumentType Ġhalf width PONSE QUERY Driver Manager Next Action æĭ ħ æĭ Ł ĊĊĊĊĊĊĊĊ ĊĊ ĊĊĊĊĊĊĊĊ ĊĊĊĊ QK B Ġ109 5 426 6 VALUE ENTRY åŃĹ æ¯į ĠLib s BS XGEo Font Size Ġrepe tition ermin ator omin ate ĠWork ing 395 9 corre ctor ĠDIS CO ан о RUN E ðŁı´ółģ´ółģ ´ółģ FD ACVM 396 1 396 2 457 1 457 5 387 4 ÙĨ ا ĠVer tices vr net Ġsubmit ting Ġinf erior Ġinf ected Ġinf oln Ġannotation Dict visu alizer how dy Ġwatch list ĠOver view ĠLocal Settings Ġva ex è§ Ī Ġtot ally Ġhapp ening ðŁı´ółģ¬ółģ ²ółģ fm ri fm wk ภĦภĠPort ex ĠMeasure TFactor 386 2 386 5 425 2 425 8 Word Sent 455 9 ĠFeature ProcessError Cons ider Send Fail das d Ġexpl orer /* / /* ") ĠSci entist ĠCar bon bro oke HY UNDAI ĠLin coln Err Frames Err IndTx Err IndRx ĠCloud Formation Show ing æ¬ ł ĠJson UrlIndexHandler qq ında ĠPass ing Ġcum ul ĠRet ri 408 9 vn ic Ġlearn able opp onents hu flow sky lib 407 2 é¢ ¨ Ġbus io && & pw r Ġbon ded 364 8 Ġwater ston åĬł å¯Ĩ Syn set adow run ĠDown loads Distri butions èĩª å®ļä¹ī Ġpod er Ġarc sec Ġquat Rot PM Context Ġrl RmonControl но Ñģ Authentication Error Ġmen os ìŀ ¬ ìŀ Ī ĠUN DER nv link éĤ Ĭ ORDER ER Cost ing ðŁı´ółģ£ółģ µ ðŁı´ółģ£ółģ ¬ółģ Ġpersist ing ĊĊĠĠĠĠ ĊĊĠĠĠ SIG MA Ġparticip ating ince ton ĠGaussian Process ':[ (' Registry Test vk Type ĠCer tificates ĠApi Key çŃ ĸ dry run Ġdigit ou Security Token FFER ENCE MULT IC "% (( ĠReport er poll uted Sur vival WF hY ĠGit Lab acion al MAC HINE Ġ#-------------------------------- ---- CEL SIUS åįķ ä½į ĠBasic ally Ġmut agen VV V ´ółĢ ·ółģ¿ liz ard 818 93 FB eta Ġhy bridi Ġhy steresis FRAME BUFFER Pop ulate Sort ExprContext Ġsal ário limin ary Ġpen alties Book Main ×ķ× Ĺ ×ķ× Ļ éł ħ Ġtech nically GAM ES Ġinterest s Angle At Angle HAt èª ¿ ĠVe locity THE ME Ġsun ny Ġsho oting 428 1 428 3 428 9 fem ur 398 2 Proto ErrRx 434 2 LAT ENCY pan ic bN m ĠRef lection >( .*? san itized ê¸ Ī Ġask openfilename ĠUP LOAD fac ade Http Request Ġ"@ " ĠÑĤ ак âĢĿ , CSV Name nes prá Activity Task Clear ing Clear ance ĠMa intenance éĩį åĬĽ æµĭ éĩı FIN ISHED åºı æİĴåĪĹ SCAL ES Ġregression s Allow s åľ° æĸ¹ Fit Ins ç¼ º ç¼ ĵ JOB S Ġ'.. ' xclu de ĠDummy Resource Trade Limitation éĺ ħ Ġht s Fra ctional elt wise ĠLi quid Ġposs ui Ġcas a Ġnlp cc Ġeigen value Ġbp fmt DCC SIG Green e Saving Time Tab ular Turn ing enn ial AGG TT Ġvisual isation 代 çIJĨ Ġsubscription s Ġpsy chopy amer ican Feed Num guest s division s Ġ205 0 receive Data Perf ect áĥIJáĥ ¡áĥ slide set recent ly Ġrecur se Ġconver ters GU ARD Ġemo tion Ġgg plot éĽĨ 群 Ġstandardi zation Ġenvi ar ĠRelease Type TestModel DiffConvs ä¿Ŀ æĮģ 解 åİĭ Cri tic Cri mes Cri anças stre amp 1166 138 ĠDeep Mind Ġ× Ĺ Ġ################################################ ######### ок аз JS Complier ĠÃ Ĺ Ġcorrespond ence night ly Ġusd Skel âĸĪâĸĪâķij âĸijâĸij Dimension ality mil itary milli second (":") [- Ġwind ing ĠAL G Ġ({}) '. ĠHyper parameters ("* ") Ġ$$ | ĠAdam W PAGE BREAK enh anced Trigger ed gpc r ĠFra ctional LER E Ġ&= & Apply ToKeys æīĭ æľº ĠMember Configuration Ġrepos itorio Il mi Ġprec isa ĠGra ham Ġê° ģ ICsInv PrTx ICsInv PrRx ICsInv LenTx ICsInv LenRx ]+)/ $", ο ÏĤ ç¦ ® filesystem encoding ĠHo pe Blend State ĠUS AGE Manifest File Manifest Row Termin ate Termin ation Termin als ĠCONT INUE Packet Alloc Packet SendFail Hand lers Sal ary invest ed Ġ================================================= ===== FACT URE Im mediate snow flake 2222 2222 AGENT A ółĢ²ółĢ ·ółģ¿ IET x ĠMig ration è¿ŀ ç»Ń ĠHar vester Ġextreme ly Push ing Push Probe ÑĢÑĥ г withdraw al Good s Good bye 0123456789 0123456789 GRE Y Sparse Segment ĠHost name NumberOf Swaps Ġcalib rate PRODU IT Uniform Location UF xiK ĠFE ATURE ĠENV IRON CUSTOM ER XT ENSA resol v Behavior Group ÐĴ Ñĭ ici ar shrink age News letter oz w Eff ector aba qus respond ence Emp loyees lte Config Ġoid c Anim ations Ġsecure aws Ġdut y BOO ST RMS prop RMS Prop stretch ing Ġdont cares Ġvcf call DlData NotifTx DlData NotifRx DlData AckTx DlData AckRx 10001111101000010000 110 ĠVLAN s Resume NotifTx Resume NotifRx Resume AckTx Resume AckRx çİ° åľ¨ ĠJohn son Bert PreTrainedModel ож ал hpnicf proxycheck Ġbtn Click Ġ655 36 OPER ATORS æĹł æ³ķ å½¢ å¼ı Ġmom s harvester zerg ĠBi opython Mail box Ġ'? ': Ġvers us ĠBro ken bear type Chat Event SUP ERSC ĠÙħ ÙĨ ĠAlex ander FJ YYSgAq Oi J Ġmit mproxy ĠCollect ing Mini Mill Ġdeco uple FIRM WARE íĻ ķ Ġnic er ĠEpoch s åѦ ç¿Ĵ âĸĪâĸĪâķĶ âķIJâķIJâķIJâķIJ gro bid Ġbib tex manip ulate Evaluate Ins unge ons ĠDele ting Requires ContextResult èµ· ä¾Ĩ Glyph s Ġdyn spec mak etrans ĠSD SS ĠSn mpAdminString proportion al mip map ĠHam ming Ġè¾ ¹ Ġwik idata YYYY MM parate ur PriceReminder Item usel ahs Ġmob ility ĠTick er ĠSocket IO Ġbea con vacc ination wagtail core ĠÑģÑĤ аÑĤ Truth Value gdb init Ġdise ntanglement \\/ \\\\\\ ÐĿ ай rein amento Ġvacc ine Pull Probe ĠAg enda Ġ327 67 LEG AL explor atory Ġadverti sed FQq FQK Susp NotifTx Susp NotifRx Susp AckTx Susp AckRx East ern ĠLow est ä¸Ķ 說 BBBB BBBB Forecast Day Mobile Net Unkn MsgRx Unkn VerRx ãģ£ ãģŁ CreateSess ReqTx CreateSess ReqRx CreateSess RspTx CreateSess RspRx ICsPT NotSuppTx ICsPT NotSuppRx BrRes FlrIndTx BrRes FlrIndRx BrRes CmdTx BrRes CmdRx ĠæĹ ¶ DelSess ReqTx DelSess ReqRx DelSess RspTx DelSess RspRx DelIndTun ReqTx DelIndTun ReqRx DelIndTun RespTx DelIndTun RespRx DelConnSet ReqTx DelConnSet ReqRx DelConnSet RspTx DelConnSet RspRx CrIndTun ReqTx CrIndTun ReqRx CrIndTun RespTx CrIndTun RespRx UpdBr ReqTx UpdBr ReqRx UpdBr RspTx UpdBr RspRx UpdConnSet ReqTx UpdConnSet ReqRx UpdConnSet RspTx UpdConnSet RspRx SUPER USER CrtBr ReqTx CrtBr ReqRx CrtBr RspTx CrtBr RspRx RelAcsBr ReqTx RelAcsBr ReqRx RelAcsBr RespTx RelAcsBr RespRx ĠTor onto Ġru cio ĠPod man Ped igree Ġdeno ised čĊčĊĠĠĠĠ čĊĠĠĠ Transl ated Ġ()) ", Ġspy der ĠArm ored instanti ation æ¡Ĩ çļĦ Ber lin Ġdevelop ing Ġabstra ction Phot on 'â Ĩ Ill umina Ġcnx n Ġprivileges list Chem ical Ġfund ing ĠACT IVE ĠInv ite ĠInser tion SCR IM MUT ATE Ġоб Ñī Ġton ight ĠæŃ ¤ ĠctspVlan Config gv util ĠÑĦ Ñĥнк ĠPed ro ARES PONSEQUERY Ġë¹ Ħ GTP UnknVerRx Ġì§ Ħ ]? [ oni eważ ĠUT IL Sha ft DISCONNECT ED urnit ures Ġthrust er Ġstrong ly ĠYes No Shot Gun à°¤ à°ª Xtest Pos ๠Ī ĠÑį ÑĤ ĠArrow Draw Ġgenotype s CDOT ARESPONSEQUERY AIR PORT æŁ IJ DUPL ICATE ctspVlan Config DEN IED puls ar Ġfram ing ĠAppro x ĠAppro ach á»ģ u HubPort Speed BlockHeadersWithChainLock sRequest JW TRULE æħ ¢ otp Data ĠCts SecurityGroupTag Dhcp Relay Ù¾ ر amen ity Ġhim self Ġuniq List è¯Ħ 论 electric ity erode d ĠKa HyPar <<<<<<<< <<<<<<<< Raster izer Ġfam ous Ġeine m ĠAstr onom ĠRAD IO å·¥ ä½ľ Ġacme AccountSelection Ġautoc ast HTTPS Connection åħ³éĶ® åŃĹ ĠìŀĪ ëĬĶ War ren oli go èĮ ¶ èĮ ĥåĽ´ orche stration Ġresol ving EVER Y FIND ERS \"] ([^'\ ĠMAN IFEST Ġelv UP Ġalta z Ġalgor itm cyber Panel ĠCoin Gecko Ġforth coming ĠPat rick Ġtear off Ġdimm List Adaptive AvgPool IFIC ATIONS Ġescol h ĠCommunic ations čĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊ čĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊ DiscoMode BridgeLamp seal ed INHER IT ĠQGraphics View BRACK ET ConnectivityTest Request ĠDagster Instance ĠSym bolic ĠCLO SE Ġstrat ify ĠHex rdConfig DISPATCH ER Ġpearson r Ġnod ename tou ched ĠLD AP Recur so NumBytes Tx NumBytes Rx Ġprincip le Ġíģ¬ 기 usbDeviceCdc Descriptor BOR OUGH Dou glas NAN O ĠGui ded Sens itivity Ġfight er viol ations Ġarity Sum Synchron ization discreti ze Ġborrow ed mline file Ġapart ments Ġode int ĠSTO CK ĠBla ze OutOf Range ĠëĤ ĺ PeerConnection UpNotif PeerConnection DownNotif PeerAddr Type ĠåĩĢ é¢Ŀ ĠåĩĢ åįł togg l Ġhcal digi Ġprece ding ICsVer NotSuppTx ICsVer NotSuppRx ICsUnknown Tx ICsUnknown Rx ICsSyn ErTADTx ICsSyn ErTADRx ICsSys FailTx ICsSys FailRx ICsSem ErTADTx ICsSem ErTADRx ICsReloc FailTx ICsReloc FailRx ICsInReFRe PrTx ICsInReFRe PrRx ICsColNW ReqTx ICsColNW ReqRx à¤Ĺ लत EndMarker Tx EndMarker Rx VerNotSup Tx VerNotSup Rx StopPaging IndTx StopPaging IndRx ciscoDiaBaseProt Enable ICsInvTot LenTx ICsInvTot LenRx ICsInvMsgFmt Tx ICsInvMsgFmt Rx ICsUnexpRpt IERx ICsUnexpRpt IETx ICsUnPgUESus Tx ICsUnPgUESus Rx DlDataNoti FlrIndTx DlDataNoti FlrIndRx ICsCmpDet Tx ICsCmpDet Rx ICsPTMSISigMM Tx ICsPTMSISigMM Rx ICsNoRes Tx ICsNoRes Rx ICsNoMem Tx ICsNoMem Rx ICsReqAccept Tx ICsReqAccept Rx ICsReqRej Tx ICsReqRej Rx ICsTFTSys ErrRx ICsTFTSys ErrTx ICsTFTSMANT ErTx ICsTFTSMANT ErRx ICsServDenied Tx ICsServDenied Rx ICsNewPTNPref Tx ICsNewPTNPref Rx ĠíĻķ ë¥ł ICsUERefuses Tx ICsUERefuses Rx ICsNOTFTUECTX Tx ICsNOTFTUECTX Rx ICsRMValRcv Tx ICsRMValRcv Rx ICsAcceptPart Tx ICsAcceptPart Rx ICsMisUnknAPN Tx ICsMisUnknAPN Rx ICsProtoNtSup Tx ICsProtoNtSup Rx ICsIMSINotKn Tx ICsIMSINotKn Rx ICsRATChg Tx ICsRATChg Rx ICsDtForNtSup Tx ICsDtForNtSup Rx ICsGREKeyNtFd Tx ICsGREKeyNtFd Rx ICsAPNResTInc Tx ICsAPNResTInc Rx ICsLclDet Tx ICsLclDet Rx ICsISRDeact Tx ICsISRDeact Rx ICsRPrNt RspTx ICsRPrNt RspRx ICsUENot RespTx ICsUENot RespRx ICsCondIEMs Tx ICsCondIEMs Rx ICsAPNAcsDen Tx ICsAPNAcsDen Rx ICsUserAUTHFl Tx ICsUserAUTHFl Rx ICsUnabPageU ERx ICsUnabPageU ETx ICsCtxNotFnd Tx ICsCtxNotFnd Rx ICsManIEMiss Tx ICsManIEMiss Rx ICsEIFRNCEn Tx ICsEIFRNCEn Rx INFORMATION AL 延 å®ī VARIANT S bast ian ught er  # ĠIma ging Ġmechan isms PRIM ARIES 订 åįķ BeamSpot Rcd Ġdamp ing ĠGM TTemp Ġëĵ ¤ FORWAR DED sire ne Transient FailureNotif ĠìĪ «ìŀIJ wireless Config nrb Parser âĤ ĵ Ġsce ener queri er ĠgetIndicator Value Mechanical Object ĠForti Gate Permanent FailureNotif ĠTraffic Light NpuNumberForDrop Stats eSource Pivot pob servations reson ance pyn cho Ġesti magic Mlp Policy ê¹ Į heli al Ġindivid ually Ġinsur ance boxc ap ĠROB OT Ġlaz ily ĠYa hoo Configura ções OrMore Args ProtocolError Notif çķª åı· Gaffer UI Tac Toe Vac uum cnx n envi roment Ġpue de preparate urs STRI PE Ġendere ço Qry ContigID ltp FR starg ates 11001 00000000 AllBut One EnumType Wrapper BIS HOP ĠFear AndGreedIndicator tamp on ĠConda Env Throws Exception ĠEvalu ates Binar izer MolFrom Smiles Ġafet ada BUND LE fuj ita getSymbol Value ibili dade ĠKeyed Vectors IpMask Bits ĠCarousel Item ĠtexCoord Set HNF s csa il sener gize ĠBBB P AGo UCgUCoVCcYmh Ġtrk Coll Ġèĭ ¥ Epist asisLinearRegression oFAr FJYYSgAq Ġبار ÛĴ MML ab alou pe assault Rifle POSS IBLE ĠsendTo AllButOne FromLocal Action æĹĭ转 åľĨä¸ĭæłĩbuff GradientDescent Optimizer hUKh UFxiK 993700787401 576 BKB CoVA Ġoda huflow éģ¿ åħį lichtungs beho Pckt LenErrRx ZENK AKU isFlagged List Ġyaf owil Ġkahy par eccen ca achuset ts APPR ENT Seym ourExcel UnSup MsgRx UnSupported MsgRx ĠUserDocker Exception IntCode Program ĠglUniform Matrix RxPackets Dropped ĠAddEntities Callback cmdivor cx GTPPort ErrRx kahy par 1372549 01 AKhQK hUKhUFxiK updatedEgg ROI MRBrain S BSXGEo AKhQKhUKhUFxiK PacketAlloc Fail SUPERSC RIPT âĸĪâĸĪâķĶâķIJâķIJâķIJâķIJ âķĿ FQqFQK BSXGEoAKhQKhUKhUFxiK CDOTARESPONSEQUERY SERIALIZED ĠåĩĢåįł æ¯Ķ BeamSpotRcd Printer ĠGMTTemp File oFArFJYYSgAq FQqFQKBSXGEoAKhQKhUKhUFxiK BKBCoVA oFArFJYYSgAqFQqFQKBSXGEoAKhQKhUKhUFxiK BKBCoVAoFArFJYYSgAqFQqFQKBSXGEoAKhQKhUKhUFxiK AGoUCgUCoVCcYmh ! } # ---- ' = ' "] ' >< = -- = }") > () > ): > |\ ? >> Ġ' ()' ro v ro it ro medriver ti st ti ed mp u Ġc ual Ġc td Ġc job Ġc rl Ġc tkn Ġp st Ġp lo Ġp min Ġp ace Ġp ou Ġp ain Ġp range Ġp rt Ġp board Ġp spec Ġp long Ġp wave Ġp erio Ġf ic Ġf list Ġf open Ġf lm Ġf uck Ġf ledge Ġf ollower Ġf ranchise it ar it ype it as Ġa j Ġa ma Ġa qu Ġa pro Ġa ward Ġa Dict lo m 00 86 00 78 00 012 00 2672 ge vent ge so ', ], Ġn es Ġn ec Ġn comp Ġn types Ġn words Ġn side Ġn spath Ġn Bits Ġn rof Ġn ipype Ġs sa Ġs late Ġs CB Ġs lugs Ġs liders ut p ut zer ut ura ur ize ur fer ur adio ss ibly Ġin strs Ġre ts Ġre new Ġre mark Ġre compute Ġre minder ing Group Ġo fi Ġo der Ġd Z Ġd op Ġd end Ġd out Ġd time Ġd ob Ġd ace Ġd field Ġd Ed li ving pe ssoas un ra un balance un sch un translated un iversal un advertised Ġm name Ġm og Ġm ant Ġm tag Ġm angle Ġm ux Ġm sd Ġm arc Ġm tv Ġm kt Ġm jx Ġm srp ra st ra ven Ġe S Ġe T Ġe Node Ġe tl Ġe phys Ġe hf la ge la res ion ette () ')[ co te co op co bra co hol co astal ri id ri gh ri bbon Ġb om Ġb row Ġb bs Ġb pm Ġb uried Ġb ouwens Ġb acpypes Ġ1 156 Ġ1 151 Ġ# < Ġ# ================================================================ Ġ# === ed env 11 93 11 19 11 49 int ersphinx Ġw vs Ġw avel Ġw kt ch u ch re ch icago te ising di graph di jkstra and feel Ġ[ , Ġ[ !] ma sh ma preduce ul ename == [ == >", ], )) "" "). ol di ol us Ġ+ ------ is z is pec val pha get P get time get EstimatedTransactionFee get SfpCmd get filesystemencoding (' ================================ )) " )) [' )) }) )) +" set Data set Results set MinMax set Driven Ġ- ' Ġto x Ġto file Ġto days ĠT K ĠT c ĠT an ĠT ac ĠT ob ĠT own ĠT AP ĠT une ĠT TS ĠT iden il p th ous con ge con strain con secutive con ductor (" = (" ### (" .* (" };\ as ar [' -', iz ar et nam arg c arg List op ense Ġ{ [ Ġis nan Ġis Valid Ġ7 70 ĠS v ĠS ar ĠS mo ĠS END ĠS LA ĠS MF ĠS HOP ab use ĠC le ĠC lu ĠC ay ĠC ai ĠC CD ĠC IR ĠC Metric ĠC EOS ĠC rawler ĠC rowdsource up iter up vote Ġg od Ġg low Ġg params Ġg cp Ġg pr Ġg Term Ġg endoc for notify for got for earm ter a Ġr str Ġr type Ġr dd Ġr dfs Ġl file Ġl xc Ġl cs Ġl cp Ġl ÃŃ Ġl bd ": """ end date end ings data array data io data Line ĠA lib ĠA BS '] "). 01 86 01 29 01 48 Ġcon he Ġcon ductor Ġcon ductivity ic als ic ensing ke zi am ic to a to ut Ġ: ]* Ġ: ])) ĠF ab ĠF UZZ sc im qu ay log x log ilab list file list of value typed vi vi vi be ser de Ġh c Ġh an Ġh map Ġh mass Ġh sl Ġh abilidade ** . all ergens po cs po lice ta ylor ĠP P ĠP g ĠP ind ĠP ear ĠP ivot ĠP angolin ĠI LI ĠI HC ĠI PUZ ĠL M ĠL W ĠL EX ĠL RU ĠL dap ĠL obby ĠL isp ub mit Ġth reat Ġth rash Ġth umbnails =' '> =' |') =' ?') Ġst ems Ġst ereo Ġde con Ġde lt Ġde db Ġde be Ġde bian Ġde epest ine a est ro Ġ""" " Ġnot as im izer im fs Ġex ib Ġex clusions Ġ3 17 Ġ3 88 Ġ3 95 Ġ3 46 Ġ3 42 Ġ3 58 10 66 10 29 10 58 10 62 Ġprint Msg out p out Dir ĠD ID ĠD uring ĠD emisto ac qu Re ce Re ceiv Re ached Re maining Re achabilityServiceClient app spot sh ore sh uf sh aders Ġdata path Ġdata interface Ġdata Arrays ĠM ell ĠM argin ĠM UV ĠM Bus ĠM ATER ĠM exico nt rain time span time Step time Slice oun der if l if r key chain Ġv u Ġv xc Ġv utils Ġv tmp Ġv Imp 02 34 02 37 02 66 02 44 02 48 ext er Ġy n Ġy res Ġy out Ġy train Ġy Test Ġy Min Ġy arl ĠO O ĠO mni Ġpar ametric Ġx j Ġx mean Ġx amb Ġx clim alse nse Ġse mp Ġse us Ġse ir Ġma Uuid Ġma hotas test dir test Path add uct add Point add Event add Child [" % ER ARCH IN FOR IN SIGHT Ġstr atified load Collector ore a Ġme c Ġme h Ġme son ---------------- --------------- tra y ens o ens ics py bullet xc pp pre cs dex com ap ing 07 13 07 75 ang ry ang let xd o ES P ES OL "] [:] ĠB ath ĠB ern ĠB é ĠB ounded 12 11 12 88 12 45 12 67 12 91 12 59 ĠE P ĠE V ĠE tc ĠE ste ĠE Ap ĠE xact Ġj ane """ ### wor l wor lds text pos AT M AT CA AT GTT Ġ) / model file ans ys ĠN D ĠN an date string ir us num Comp Ġres izing user List user names user Input bo c bo dia Ġ4 92 Ġ4 17 Ġ4 19 Ġ4 33 Ġ4 45 Ġ4 77 Ġ4 21 ger many Ġget args Ġget Status Ġget Color 92 01 92 33 92 36 col lisions In tr In ject In fra In gest In Game In ertia In iciado ======== ") lot ter ĠR j ĠR ose ĠR otor ĠR AI mo ov Ġun related Ġun conditional Ġun hexlify Ġun compyle read List Ġtest set Ġtest dir Ġtest loader Ġtest infra Ġlog id Ġlog ins 32 71 oc ms oc chi ĠG an ĠG RE ĠG AM Ġco ordin Ġco efici Ġon Event EN N ĠW AN ĠW arn ĠW atched ĠW ulff tri ed Ġout ra Ġout break Ġout Tmp AR IUM AR esponse ĠV AC ĠV pc ĠV ia ĠV ocab ĠV oo ĠV oucher ĠV apor ĠV IVO ĠV BINSTST ĠU F ĠU m ĠU ber dict Config print Func param type Ġ5 16 Ġ5 94 Ġ5 33 Ġ5 85 Ġ5 81 Ġ5 400 Ġhe ated Ġhe aps mb ins ). ". ape l Ġan te Ġen map Ġen emies ise ase ire f ire ctory che byshev min ion min Max min iconda 999 0 Error Exception 18 14 18 29 16 94 16 73 16 69 array Key array SearchT sa mpl sa uri Ġk IR Ġcol span 25 76 Ġro ger St ory Ġpy o Ġpy pk Ġpy rfc Ġpy dub config File Ġ6 06 Ġ6 80 Ġ6 54 Ġ6 59 ag ator ag ara ag fusion 04 76 13 82 13 72 og n lib vul 06 03 06 94 06 95 06 86 15 87 15 47 15 69 SE xception ec r 100 8 max X max i max time 05 83 Ġthis Annotation 03 86 03 98 03 82 cs f we ig Ġch ats Ġch Names Ġch ina Ġch urch 17 18 17 93 17 22 17 45 Ġal phanumeric Ġal bumentations 93 99 93 03 93 95 93 57 93 83 93 39 93 53 93 68 14 55 14 95 14 66 stance s Ġpre con Ġpre lim Ġresult ant ord ons Ġat titude Ġat least 64 66 64 56 right x right key error Detail ings Serializer gra bbed 076 8 076 9 plot array LE AVE Type Ref Type Symbol RE FI RE WARD RE VERSE Ġtra il 08 28 ðŁ ħ ðŁ Ī pi ano 22 60 ĠH op ĠH all ĠH alo ĠH IV ĠRe cover ĠRe maining ĠRe paintResult sub length sub way sub sections sub scribed Ġ{} ", Ġ{} '). Ġ{} )[ input Col Ġdi ssip sk o sk ater db d LL ist UT A 88 02 88 36 88 95 88 82 Ġargs map 19 59 image io image space image builder comp lier ID A 34 01 34 29 pos i 09 01 09 68 84 13 84 75 84 43 ĠIn dian own x Ġkey press nd Box inter change inter rupted ant asy bin val bin path Ġle f Ġle aky result filename ann s 24 89 24 63 ak p state xclude Ġoutput String Ġ@ { Ġsub dict Ġsub packages Ġsub sections Ġsub packet als i als Response AM I 96 14 96 36 96 74 96 198 ĠCon d Ġnew Size Ġnew spaper ress o ress ources Ġall data 55 94 94 83 94 62 clu ÃŃdo Ġcur x 33 00 33 85 33 91 DE LT RO WN Ġapp imagebuilder ()) [: Name Context node Value Ġno op Ġline Type AL RM AL TERN AL NIC fic ulty (), \ '. """ Ġsys config 85 99 97 19 97 26 mi os rans form ================ ==== 36 87 36 97 36 56 36 38 36 91 011 5 011 00 011 0011 query string Ġid r ĠK r ĠK az ĠK VM ĠK night ĠK amaelia 95 11 95 24 95 97 view able run test run state 86 88 Ġmax i Ġmax s sum marizer Ġz k Ġz ap Ġz ll Ġz edenv ################################ ########## ################################ ########### process String Ġjson path Ġjson pickle Ġhas Next Ġindex Range default filters default FileName AG R AG GG 57 99 57 13 57 34 his hek Ġ[' \"]([^'\ create DataFrame Ġtf records Res ol Ġbo at au er au lo Text Info List File List Group CO V CO bj Ġunder Skeleton api Class trans Figure request Headers AC COUN Ġstart X Ġte ach Ġli sa 44 00 44 32 44 43 44 71 frame type cont ro cont orno IM MO IM IZE Ġdis cu Ġdis like Ġdis abling AP ACHE Des ired new sessionid OT SU yst one yst reets En c En vs En hanced Co Y Co vid auth data auth entic Ġend X Ex pires Ex perience ET A ET RM ET CB Ġ-- ' cal vin 56 99 56 17 56 64 56 85 56 54 56 72 56 021 98 97 Ġsp anner FI O my File Ġ(' < Ġ(' [ box ix Ġ(" [ Se arches be k be ast ĠQ T ĠQ max ĠQ LF ĠQ ahat Ġcolor space Ġcolor ful 35 22 35 66 35 28 35 21 AB AND vis dom ref eicao Value Ar Value Entry straint s Ċĉĉĉĉ Ċĉ Buil tin File Loader AD G ran co Ġtarget Layer cre ature Ġim Patho ))) [ ))) ]) ))) /( Ġcurrent QSize 45 12 45 88 45 81 ĠAN U ĠAN SI 77 88 amp ering the sauri Ġerror bars ĠY ES ĠY olo Ġinter im Ġinter leaved Ġrandom ized ĠX C ĠX lib ĠX GBoost Ġtrans verse Ġarg min Ġarg String cc ds 47 02 47 18 47 05 47 17 47 37 47 55 47 33 47 35 47 29 initi ate ]] [" face bank column configure ĠEx am ĠEx pects tf p Ġ9 0000 cy tomine ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ pl M pl Pitch Ġsk l Test Base Ġser vicer Ġpd k Ġevent o Ġevent HubMessage Ġver bs Ch er Ch rom Ch anging UN PUBLISH ĠIN TERNAL ors ma order ID 46 32 46 03 46 77 46 72 PE AK ĠJ s ĠJ am ĠJ ason Ġcv t Ġcolumn Merge DI GEST ĠSt ored Field ID 70 32 )] \ ail and Un link Un structuredGrid The y mask partial Ġq hat TH TH tag statexclude TR ESPONSE sys ctl ĊĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠ To Json To Many To Unzip Ġ''' . CON Z De S De Conv De uteronomium ost an field Name sign ers 29 000 US IGN Ġ`` { Ġ`` __ Time And block size '][' # usr data Ġdb cur MP R MP a 67 02 43 32 43 05 show er ĠCON TEXT Ġup scale Ġplot utils search path search Indicators Ġ100 2 :: " :: ] 000000 2 Ġpoint Size Ġpoint pattern Ġpoint Distance down grade 48 14 48 27 ðŁı´ółģ ·ółģ ie vv Ġqu ot Parser Error Ġimg ur EX PR EX TRAP EX ISTS fe lix red raw red ucing No N No OptionError total Count ze bra Ġ'. /' 42 13 42 33 ify ing ])) / Ġquery Cells last Error left x project Id EL S Ġpri sm Model Base link List debug Mode ï¼ Ĺ ĠIS LANDS ĠÐ ¢ "> {}( ĠSub tract sr ch expression file expression Header liter atura MET ANS 404 2 404 3 404 7 404 9 Ġ"{ }, Ġshort hand ĠOpen MMLab ĠIP SEC SU C SU GGEST Ġ? ) Ġ? )", Ġ? ???? ĠWh y agg Reports Ġbit map MAP PED glob F glob e Ġpr f Ġpr z Ġpr ng fast api ĠInter est ĠInter pre ĠInter faces ĠInter ceptor ç» ĺ ç» Ŀ }: {: With Selection With Overrides Stats SkippedGroup 962775 924 ı k uring Element joint Index ĠEN TER ĠEN VAR åľ ĸ Mem cache å¼ Ł Ġarea T wb em SET S simple jwt Ver bosity cogn ite PH RD uch sia Open CL Open Shift 011100 100 Ass istance Ass ayed cid o mid as merge sort к е /> ", ĠCO OK As ynchronous Local Logging DD M dy libs ĠMy InputTransform ĠMy BalancerExchange Top level Top ics Ġpower ed look andfeel 400 3 400 6 Ġtile Name rr set ĠST AR è® ¯ BB C big rams ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠ dimension ality Page View Ạ³ Ạµ Ạ· }} [( ĠObject Manager System Length System Exit Ġcent ro ################################################ ##### Ġexpression Builder sy l HTTP Connection Seri alizers eps ilons ä¿ º Ġclear ing edit page Pass ing Ne u Network ing Network Options Ġri vers Ġri scv ĠNode Map Ġtool z Ġtool tips dp f }{ { ĠPoint less semb ling čĊĠĠĠĠĠĠĠĠ ĉ zen odo power ed Ġcombin es Ġcombin atorial Ġque ens sol ving 401 6 IE s rd types sal ine Ġsite map pickle File Ġedit ors progress Bar Ho spital }] ') Ġterm os çĽ ¤ çĽ ĥ 9248 0215 Enter prise ino es SimType Function alias ing Unit Config ĠPO I å¯ « ('. /' ĠMake MetadataLine Mod N ĠSp am tu h ĠAD AGUC nc dm Ġctsp SgaclIpv contact able ĠEvent Context ĠEvent Types oring a Rel ativ serial ise submit ter program ming PN F Ġsq la Rate InSeconds Ġpermit s в еÑģÑĤ tel net Ġnumer al Exec utes wi pe ê° ľë ĠMon key Sign up Ġxy wh yl ated gp v æľī çļĦ 003 137254901 ðŁĩ ´ ðŁĩ » Change log ctsp SgtCaching ctsp AuthorizationSgaclFail ctsp SgaclIpv My Node DER IVED ĠEnd Point ĠAnd erson VS MOW WR ITER æŀ ¶ Ġworking area Ġequ alized Ġvo or annotation Dict BF S ĠMat ern phi h {}/ '. '" %( Ġstatic files circ a 915 5 LV a Admin istration uck le flush Input Ġ"$ " resid ents åĮ Ĺ Ġanaly sed Fin alize Tri e Ġadjust ments ned in uk as 117 64 Sec rets Sec DebugLogLevel DT D ĠDO I Arg Type Ġhref s dn coarse Ġregex s ĠPrint ing 165 42 Extra Info Ġsy scall Ġem ulation combin ase Ġfe cha Ġfe asibility INTER VENTION ierarch ies Ġmu ut Ġtransaction al sur gery Ġsur veys }_{ \ ĠMin utes ĠMin Hash disable s Ġcondition als Host Key Feature Collection Ġfid ucial Ġ{: } accept s hd ul ĠPri me Ġ================================================================= ===== met als follow ings Video Node Ġmac rolanguage retri eved ĠCan onical Ġ"[ %( machine Name RED DIT Uni Prot DK Z CAP AC ен но Reference Information eg as Ġpositions PerPrimitiveUnitCell Validation Folder 212 08 Password Reset Ġsquare form ENTRY TYPE Ġhyper opt Ġhyper visor Ġhyper bolic Ġmass Threshold 908 7 Ġgeo code SUB URB expect ing ðŁı´ółģ³ółģ ®ółģ ðŁı´ółģ³ółģ ¶ółģ ðŁı´ółģ³ółģ ¹ółģ Ġwhite lists {}_ {}". Email Message Ġnone mpty å®ļ ä½į Ġet na 304 4 Pr erequis coin base Standard Scaler Ġmet ros Sgt RowStatus Body Type Ret rieving IGN ORED Ġrefer ência BATCH ES EMAIL S Ġsv gd ĠEd ges ################################################################################ ########## 403 5 ĠStd Function ÑģÑĤ а Meta Names Remove ImageOptions Ġĉ ĠĠĠĠĠĠĠĠĠĠĠ HD L Ġbg api ĠØ Ń Segment edColormap Ġí Ķ ÛĮ ر ÛĮ س Build ImageOptions Build ImageMessage 284 8 427 1 ili a ili co 236 9 recv ing DEL IM Ġpin yin Ġfbx Skin Dialog Frame ĠSc anner ĠSearch ing browser stack Card inality pay ments Ġmultip licity ĠEnum ValueSet 288 1 288 5 oauth s oauth lib quad ric Ġdiag s Comple tion 334 4 334 6 422 1 422 6 Ġsync er ĠFirst File ĠThread Pool ìĿ´ ë ìĿ´ ëĭ¤ 436 2 ific ator ÙĪ Úº {: ^ ĠTR ACE AU X AU CTION ĠBack up 237 9 æĭ ¼ æĭ ¾ lam orous Param Type Ġmar ried Ġmar riage Ġhit ting ĠRout ing Ġdetection results 426 3 attack s ĠFree Solv Site TypeSymbol sfp Compliance sfp Voltage sfp Temperature sfp Connector sfp Wavelength sfp TransCode sfp BrSpeed sfp SmLength sfp MmLength sfp CopperLength 385 0 Ġfour ier ("# "): 395 2 Pack ing м ож м ин ĠBar code ĠConstruct s 396 7 457 8 launch ers FOR K ĠOver rides Ġatt ending cart opy åIJį åīį ภ¢ ภ± ĠPort erStemmer 386 3 Ġ'@ ': ĊĠĠĠĠĊĠĠĠĠ ĊĠĠĠĠ 455 6 Ġeth ereum Send TransactionRequest Ġmail to Ġmail bot dhcp Relay /* ') ĠCar negie 332 3 MON O 065 36 Ġsha ft crypto graphy ö yle Ġai ogram ĠOper ación Ġweek days Route Table æĸ¹ 便 zM zM Ġcam fi 947 2301 Qos Option Ġtele phone NODE LIST cookie jar VA o Ve hicles 408 4 408 8 Kp UK æĸ° çļĦ opp s patient Sep Ġ-------------------------------- --------- 687 5 ÑĨ Ñĭ åıĤ çħ§ Car ree Car roll Ent rada Bad dies ĠdocsLoadBal Channel Ang les MF PP eros ion ĠTF Record æĬ Ģ ADD ONS ĠProperty Registry tos is QUE UED subscribe ToBlockHeadersWithChainLocks wik is ĠDown loader augment ations ãĥ³ ãĤ¹ Pod Autoscaler Ġquat AM Ow ned Notification Target Qq FA bian chi ung ry åŃĺ åĤ¨ gas us hard en ĠAT I fbx Material jj z dra ke dra sil )? (\ еÑĤ од particle Flow ðŁı´ółģ£ółģ º ðŁı´ółģ£ółģ ©ółģ ĠIM U ĠDep ending 409 8 ĊĊĠĠĠĠ ĊĠĠĠĠĊĠĠĠ ĠTri ck ÙĬ ر Ġhar ness Ġhar vest ç« Ļ Ġnav bar ualiz ação è o Ġrs lt Interrupt Exception čĊĠĠĠĠĠĠĠĠĠĠĠĠ čĊĠĠĠ Ġdeep er Ġdeep lodocus Center Crop Ġpv lib Ġplan ets Processor Max Processor Current Copy Message ĠPR P 466 1 Pa ssage ï¼ī ', áĦ ī áĦ į KI LO '); ") trunc ation Byte Array composition al Threshold Rule Ġslow sql dag ster ĠVis itor WF W sem ver Sets Dict Clock Boost ¯ółģ Ńółģ Ġeff ector æłĩ è¯Ĩ ĠPoly gons ĠPoly tope Ġprime ira PROCESS ORS STREAM ING CAL IB Ġopp ortunity ðŁı´ółģ³ółģ© ółĢ² WK x Annot ator Annot ated Ġpiece wise Ġsock etio Install ation ĠIdenti fication Ġ'\\ ': ĠìĿ ½ sch en Ġdc Pitch Ġ================= =") Ġ================= ====== Inf lation æĻ ¯ forecast ed daemon ize 398 9 Clean ed ulo mb dead ended Align RNA 438 2 ĠNUM BERS tro uble 393 1 393 3 434 9 gf H Hook s bN my ROP IC 模 æĿ¿ Free Solv pal av Ġcare t è¨ Ĭ Ġsay ing Ġste ep cas a umin um Ġwarn ed mention ed How ever Home s don nees Stmt Renum van ag ORD ERS MANAG ERS +) '). OID C utt X Blue King Ġcrypto currency ĠSeq Record Fit ness Ġperm ite Ġinstanti ating Catalog s Catalog Manager "^ (\ Ġbed s ðŁı´ółģ°ółģ · ĠcpwVc IdMapping ĠcpwVc PeerMapping Person s hal ation abo lic Fold ers ĠPAR SE Ġht t ĠPack ard mini map ĊĉĊĉ ĊĉĊĉ æĺ¯åIJ¦ åŃĺåľ¨ Ġcommunic ating cdbpPeerStats DW pitch fork snmp v mh oltz alter Add alter Drop Ġм ож Ġм акÑģим sex o Ġspo tipy Ġeigen vector ĠASC ENDING 667 556 Ġhum ans Ġcrit erio ĠSec RuleEngine ĠSec AuditEngine ç© ¿ ĠSuccess ful ĠClean Resp emoji Panel rms d bol tz zW Y äºĮ åıī pseudo code pseudo count ĠBit Torrent Fbx Anim Feed Forward Hot Water Parent s tre asury ĠES OL ðŁı´ółģ®ółģ ² ðŁı´ółģ®ółģ ¡ółģ Sql MySql Ġmorph ological Ġ#------------------------------------------------ ------- samp lename Ġib is ilton ians Ġ-------------------------------------------------------------------------------- ----- vit ational capit als áĥIJáĥ ķ chk pt ĠPos itions DOC USIGN ĠPur ple GU EST æ¡ £ Ġconcurrent ly ĠVideo Stream ĠVideo FileClip solid ation cropped VideoDir 477 2 Ûģ ا ĠJOIN ED sprite collide ĠPlay list Diag nostic nT p does n Ġ× ij Ġ################################################ ########## Ġtv db Ġinc lination graphics View dap lab س ت Ġnt path Ġhighlight ing Gra vity Sn ake Gw Index Ê· Äĥ Ê· ɤ ĠProp agation OPEN ED Curve Node GENER IC oh lc ĠCap ability Ġhack er ðŁı´ółģµółģ ºółģ Ġig py shuff lenet CTT CT (''' \ ĠFUN C Ġvk String inherit ance ===== # ĠInstall ation Ġspeak ing ë§ Ī ĠFra gment د ر ĠOAuth Handler ãĢĢãĢĢ ĠĠĠ Dat os ç² ® Ġconj ugate psu A psu B ĠAnnot ations ĠActive Unit ĠMetric Summary Ġê° ľ ĠSpark Conf Ġimprove ments Ġë° ° Ġë° Ķ Ġë° ľ ĠCy tomine ĠGR ID ĠGR ACE olin ite ĠLat ent Est ado KN IGHT ARE AS ĠHo ok intersect ing ĠSte el ĠEstim ated Adj acent ³ółĢ ´ółģ¿ Snapshot Identifier ĠVol atility â y 11000011 000101111000000 æ¯Ķ äºļ (.* \ å¡ ŀ resample s ĠEnt ropy AGA AG 失 æķĹ COPY OPTIONS çŃī 级 DITION AL Ġnest erov Ġelf file trackOfThingsProducer D ìľ¼ ë©´ ç³» æķ° áħ µ FIT INS gebra ic EXEC UTE Ġflood system Ġcrash ing Design Id Animation Time ĠSupport s Ġpivot ed Ġsale or facebook research çĻ» éĻĨ ĠBuffer ed dol fin wid owed REL ATION corp ora μ ε μ ÎŃ Rename All Ġprox imity ĠHigh er ĠìĹ IJ áĥĺáĥ ļ CATEG ORICAL ĠConcat en Ġmed itation Ġcomput ers ÅĽ ci 4444 4444 Ġcry st dyn TaskName Ġrelat ing Ġrelat ório thumb print Ġhb TradeQue ил аннÑı Ġdemon stration 說 éģĵ Aff inity Horizontal PodAutoscaler Ġida es adverti sement ĠPER IOD Ġxg j ĠExecution Style Based Vlan Ġblur ring ĠPrivate Key ĠSuper visor Shuffle NetUnit South ern Ġtem os \\. [ completion Function Æ°á» ¡ ssim val quer da ĠPOS Indices Shelf Request Ġresearch ers odock VS ĠVari ational Static Text pyg mo repair ID #------------------------------------------------ -------------- Ġpare de Like lihood DEST INATION HAT Colour Stri de Ġaw esome Ġhw sim æµĭè¯ķ éĽĨ +---------------- ---+ Ġrelax ation ĠDa mage ĠÎ ² Ġxt riage Pas cal Ġsand y Inher it Resid ues Prim var Dst Port Mig rate Spo tify µółĢ ³ółģ¿ ĠPas sed ĠEpoch Array åĽĺ æĽ¸ CAM INFO CAM ERA Ġbib items PRODUCT S Ġ"(" : ĠTW O ("' {}' ĠìĪĺ ìłķ ĠCR UD ĠMC SCRIPT ĠContin ue Ġcle ans Requires Context ðŁı´ółģªółģ Ń Ġfavor ites Ġmv pa Ġ#---------------- --------------- ĠSn ake ĠRMS prop ĠÐĴ озвÑĢаÑī åı¥ åŃIJ Prun e Ġmas ses Ġpup ilometry Ġrobust ness Ġatten tions Photo Image Ġ"../../ ../ Ġnuc mer ĠHEAD ERS wat ers Ġglyph s ĠGi ang Gray scale Altern ate ĠEvery thing Identi fiers ãĤ¸ ãĤ§ Scra pe KILL CAMINFO ç¡® ä¿Ŀ enrich ments Ġimap lib usuario Iniciado Ġvac ation SAN ITIZE cate l ë² Ħ Ġkh mer Notify Global Amplitude Score Ġcru ise idu cial çĬ¶æĢģ çłģ ä»Ĭ æĹ¥ spher ic IMPLE MENT Equipment Class Spectral Distributions BET A settle d Appro x å°ij èı¯ BEHAVIOR GROUP BEHAVIOR ITEM CANCEL LED ĠWire Guard AAAAAAAA AAAAAAAA Ġê³ ĦìĤ° ĠFl Electrode ifft shift weapons ound ün ü ola f Ġbear type Ġattri buted GRAD IENT ĠScra per Rich mond Wiki pedia elimin ate Ġgn uradio Ġhal os ################################################################################################ #### ĠAdv ance ĠctspVlan SgtMapping æĶ¯ ä»ĺ ç¢ º Ġ########## ", Ġtre ats dez vous Ġ'! =' ASC ENDING POMERIUMSERVICE ACCOUN Exc itation ĠER Pp Ġbre ath classif zOR Bea con اب ع Ġdil ate ĠMobile NetV Ġrecommend ations ĠProgramming Error ĠCog n ĠFar be guy en leader boards ĠPull Request shap ing Ġtrait stone Ġterra script ä½Ĩ æĺ¯ Ġpurchase d Ġelectrum sv ĠÑĢаР¹Ð¾Ð½ Ġremo tes Idle State HAS HED ('-------------------------------- ---') Recomm ended REJECT ED ĠIDXGI Factory BlockHeadersWithChainLock sResponse ĠCAS CADE âĸĦ âĸĦ Ġinde ks Ġdanger ous 2352 94 è¯Ħ ä»· Ġfuncion ário Ġsayı sı è¶ħ è¿ĩ TRE ATMENT פ ר atur as ("================ == ĠEasy Dict Ġkn ack á»ħ u Ġreci procal Serve Graph ("-------------------------------- ------") ROS InterruptException VCV T ĠSel enium ĠCached PropertyRegistry PUBLISH ENTRY wake up ĠSig moid ĠSho pping ĠExpl orer xytext M ãĥĹ ãĥŃ ctspIf L ĠPhoto Image FUZZ ER (... ), relat ivistic Ġbrown ie Ġtoward Centre DEG REE LOOP BACK SecAuditLog Parts Aligned BoundingBox COORDIN ATOR mens a Ġspars ify ellip ses ĠUr ne BUDGET AMOUNT ĠGRAPH SLAM Ġmistr an ĠIll uminant Ġprocur ar ĠStand ardi Lap lacian jer sey Ġfort une disa ster Ġgar age immediate ly ĠJe an District Nodes BIC UBIC Mip Slice nlog lik setRevisions Descriptions ĠTiny Tag 0142 857143 ĠRecur sively Ġhttpd Config TELE GRAM divor ced Ġíģ¬ 롤 DepthStencil State Lip ophilicity çĮ ® ĠPIC MI Ġassemb lies shar pen LOOK UP 4768 26 Ġautof lush ĠëĦ £ paren tes SAMPL ING Ġëĭ¤ ìĿĮ Approval ForAll TRO OP jane la Ġü ber kep ler Ġpref ect accessible fornotify Ġdatlim z å½± åĵį Ġmultiplic ative RUNTIME PARAMS pegas os ĠбÑĭ ÑĤÑĮ Ġxlsx writer cac ert sar sa thal py ĠDEFIN ES Ġhospit als Ordered ByPk SUBMIT TED Replica Set Fund amental SPAR K myst ery uten berg opi lot Reci eved Recovery Token Instanti ate REMOV ED PREV IOUS ĠíĻķ ìĿ¸ Bibli ografia LON GLINK Ġsme aring oltz mann Ġrail rl 11011111111 001000000 ĠdayOf Week ĠdayOf Months employ er 00001000000 11111 Coun tries Plate Carree ĠPier re Ġintention ally actionBar Default ResourceDescription Paged LSConn State ĠAbility Id jes ica Ġcen ário whites ide ĠwordTreeMap List âĢįðŁļ Ĵ å®Ŀ åħ· %%.. %%.. ãĤĴä½ľ ãĤĭ ProcessingJob Summaries DeployStatus Message Communic ation ('=== > ĠCop ied Ġgib berish ĠOPER ATOR ĠRIP RouteEntry hospit alized GetBlock Request ĠIDXG IDevice Realloc Resource æĸĩåŃĹ åĪĹ Ġcython ize Ġsatur ate BLOCKHEADERSWITHCHAINLOCK SRESPONSE 80000 0858 TAR IFF Ġance stral atab ility ĠSPE ED ĠSTY LE Ġharm less ĠLip ophilicity Replay Buffer ĠRDK it ĠVas prun ĠVlan Index DIG ITS concaten ation Ġespa ço MonsterBehavior WithOverrides Cant aloupe LRS cheduler 𤠼µ ĠALI GN Ġthermo stat ĠBan co ĠTimeslot Collection Trackbar Pos RANCH ER Ġæµĭ éĩı #************************************************ ****** Hen ry Ġpend ulum ĠFly ter Ġdatadict s GraphQL Error ĠØ® ارج ĠAPIT estCase æıĴ åħ¥ áĥ£áĥļ áĥĺ CCL M Efficient Net Hemi Rect pck l ĠSqu ared triang ula ĠVID EO ĠUl tra vmV mps Ġæ°´æŀª éĢŁåº¦ TERR ARIUM Ч ÑĤо Ġinfe ction SONG INFO ĠDisplacement AmplitudeScore StatsTotal Packets åį· 积 åģı 移 UNIVERS AL FREQU ENCY SPR ITES itzer land getServer Stat ĠCRY STAL Ġexplan ations ĠMcD onald ĠEff ective ĠNSF G rylov Newton ogre tim ück en Ġdolfin x ĠfswRWVoltage Config ROIPhysical Property Dasy A oere blex getVertex OrNew ĠWrest ling manus cript Deli Line ĠRECE IVED ĠDeserialize Exception VIOL ATIONS ĠSensorEntity Description ãĥªãĥ³ ãĤ¯ åŃ¦ä¹ł çİĩ SCENED ESCRIPTION Ġomn isci Ġetique ta ĠSher brooke Seek bar TTk Button Ġ',( @' Ġsincron ização combinator ics lemmat ize DomainName Server Ġlbry net Ġìłij ê·¼ 梯 度 EVALUATE INS Ġnile arn DECOR ATOR HEART BEAT ĠUndirected Graph ĠExplainer Dashboard TEAC HER ĠEXER CISE MINI KILLCAMINFO Ġ\"{}\ "". ĠÑĢез ÑĥлÑĮÑĤаÑĤ 约æĿŁ åıĬæııè¿° аÑĢамеÑĤ ÑĢÑĭ AIC PA CMsg Vector Ragged Tensor sna pobservations Ġ"&& ", asion ally iclu mp immobili zer ĠDeno tes loadTests From ĠNuc lino erimp osed ĠAdHoc Command ĠSubCommand Failure dcad ol Ġrice cooker Ġèĩ ª (('{ % AIG PT Bian chi CMSG VECTOR Ġpies cope otom ous getStruct uringElement ĠCTF d ĠMocker Fixture ĠUNA UTHORIZED Ġalip ay ngamma fesc trackValidator TrackingOnly Commando Baddies ä¸Ģè¦ § ECN CLD ascading DictItem çŃĸ çķ¥ éłħ 缮 ç¼ĵ åŃĺ Ġì§Ħ íĸī ĠYesNo Type 延å®ī åºľ Ġsceener Regex ĠCondaEnv Exception Vmom i wows dir Ġperio di 002672 9472301 ĠdEd desc Ġ+------ + setResults Name setDriven Keyframe ĠMATER IAL adduct s ERARCH Y INSIGHT S AResponse QuerySerialized printFunc Test REFI ID IMMO BIL ETCB CH ABAND ON ValueAr rs ToUnzip To TimeAnd Size PROPOS AL ĠmyMin Hasher ClientProperties Message ĠpixelMatches Color 92480215 476826 patientSep erated ãĤ¸ãĤ§ ãĤ¯ãĥĪ å°ijèı¯ å±± ĠFlElectrode Extension POMERIUMSERVICEACCOUN TRESPONSE OrderedByPk Field 0026729472301 667556 ! """ # $ # ''' $ - % - ' ? ( (), ) ']) ) +'/ * < * )', , :: , )* - ) - / - ])[ . '] . )*( / ` / ). / ". 3 127 3 198 3 934 3 195 3 169 3 173 4 001 4 128 4 137 4 114 4 147 4 327 4 188 4 026 4 346 4 159 4 291 5 109 5 278 5 000000000 5 323 7 81 7 00000 7 002 7 020 8 996 9 011 9 024 9 117 9 136 9 116 9 015 : @ : `` < =\ = ([ = ]\ = ()), > @ > {} > ({ > .*? @ )\ A ra A ero B d B n B iz B low B AG B ING B ey B ear B IP B DS B etter B illing B ayes B lood C ss C ari C IM C AB C EST C NO C lon C ros C asing C ubes C anny D ex D ew D net D AB D CD D DR D Tree D PC E ql E wm E mergency F ON F RE F ran F iducial G AG G OL G gw G umb G oblet H ong H ai H TR H rs H ACK H ighest H AMS I PO I bis J V J ACK J itter J apan K on K ay L ly L OR L AP L CA L argest L lz M ate M ary M ute M ud M osaic M ódulo N ue N ES N ice N SS N Ro N ICK N jI N Streams N evada N LTK O OP O uest P UN P LI P ink P crit P unct P lain P acific Q Frame Q RS R an R ut R ose R PL R BF R PA R ESSION R idge R USSIAN S lit S IL S UL S AGE S OS S PRITE S tiff S cott T ak T AP T ell T ze T SV T iny T jc T ARBALL U f U pt U CC U CTOR U PTIME V b V FP V MS V TEC W f W is W AT W av W FS W wW W armup X O X ic X DR X Sa X gc Y train Y TE Y ork Y LABEL Y rV Y kJ [ âĪļ \ | \ "); _ ": _ ~\ ` ', a User b ce b pe b oun b size b date b df b ron b ible b Db b kc b arium b lighted b ryant c data c ator c arn c node c AG c not c fe c ensoring d ge d log d cor d ough d ır d ungeon d jske e vid e vv e quival e urope f list f als f ear f stream f ond f lies f strings f ranchise g luster g tt g fx g fm g ência g mdp g arden g AccSfp g ordons h O h un h im h app h ud h ba h All h rf h rp h undreds h ertz i G i up i elle i ère j G j S j th j om j db j ams j ogo k L k il k points k elp l H l L l P l T l ance l bo l fo l max l cs l df l md l cd l bc m D m grid m ics m mt m spath m rp n en n all n gs n ict n vs n Total n channels n days n secs o N o val o as o ise p ml p ant p map p va p ango p ileup q L q S q set q node q Pos q pid q icon q sl q vd q Neg q cow r O r data r list r tes r alized r src r é r gt r ó r svp s E s P s ra s ate s rom s data s min s api s ud s gen s alo s freq s lm t K t Q t at t str t ension t stop t Pumpkin t Tomato t Beans t Cantaloupe u en u ve u ition u handle v C v ro v ra v os v len v rh v zt v tec w P w ts w ars x se x len x SP x EC x proj x NT x FFFFFF y J y R y S y str y age y ect y ard y tes y ong y oung z F z H z I z K z in z ne z io z elle z ynq { / | $ | - | { } "], } >" ¡ áĥIJáĥ ¢ è¿İ ¤ å®ļ ¦ Ħ ¬ ´ ¬ áĥĿ ® åĬ© ± Ħë ´ Ģ µ ółĢ²ółģ¿ · ółĢ±ółģ¿ à Ľ Ä ĵ Î ķ Ö Ĥ × Ĺ é Ł ê ļ ì ° ð ¡ ĉ ĊĉĊ Ġ ange Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĊĠĠĠĠĠĠĠĠĠĠĠ Ġ æľī Ġ âĸijâĸij Ġ ä¸Ģ个 Ġ Ø§Ø Ġ åIJİ Ġ arial Ġ ãģ¨ Ġ å¤ĦçIJĨ Ġ åŃĹ符串 Ġ åħ³éĹŃ Ġ ********** Ħ IJ ī ´ ij '), ĸ ï¸ı ļ « ł íģ ĠĠĠĠ č ĠĠĠĠ ĊĠĠĠĠ ĠĠĠ čĊĠĠĠĠĠĠĠ in are in son in var in dic in car in manta er en er vices or p or ian at ta at ian at tribution re j re dir re format re alized re match re loaded re mapping re servations re cycle re serve re bate se de se min Ġ= =============== st f st t st alk en zyme Ġt T Ġt j Ġt ck Ġt ule Ġt ib Ġt iled Ġt rs Ġt SSS Ġt amanho Ġt ibble Ġt asty Ġt riton ar que ar rive ar Xiv al bers al phanumeric de li de comp de crement de mie le in le ve an ion an my Ġi type Ġi Row Ġi gu Ġi Dy Ġi BaseReg me o me ment me chan me chanic Ġ' >= Ġ' >', Ġ' !': Ġ' ------------------------------------------------------------------------------------------ ro ta ro ger ro ves ti ds ti os ti dy Ġc pt Ġc var Ġc item Ġc block Ġc ensoring Ġc imgt Ġc risis Ġp it Ġp is Ġp tp Ġp max Ġp ax Ġp his Ġp fn Ġp cov Ġp allet Ġp wn Ġp wc Ġp illow Ġp esto Ġp onieważ Ġf ur Ġf ax Ġf rm Ġf uzzer Ġ" ## Ġ" }" Ġ" >" Ġ" :") Ġ" ..." he igth it p it self it fs Ġa os Ġa ep Ġa jax Ġa cesso Ġa perture lo f lo os lo ose 00 19 00 45 00 79 ort n ort s ce edge Ġn q Ġn arg Ġn tr Ġn tp Ġn feat Ġn sen Ġn jit Ġn enhum Ġn aked Ġs mp Ġs ss Ġs sg Ġs bd Ġs paring Ġs gains ut ta ur ança Ġin g Ġin et Ġin data Ġin range Ġin struct Ġin div Ġin eligible Ġre w Ġre du Ġre make Ġre vised Ġre aching Ġre mind ing a Ġo xygen Ġd A Ġd V Ġd val Ġd sc Ġd dd Ġd ere Ġd mon Ġd rain li se li ds un f un ar un ov un ivers Ġm set Ġm lab Ġm ib Ġm repo Ġm svc ra el Ġe li Ġe ch Ġe TH Ġe je Ġe uclid Ġe mergency () { () ]), () `, () ``. () }:{ fi a fi s fi res fi red ue las ent in ent rance ad h ad u co at co ms co bj co alesce ri r ri ger Ġthe Ax Ġb cc Ġb less Ġb ake Ġb tc Ġb sha Ġb ounded Ġ1 157 Ġ1 250 Ġ# ================================================================================ 11 92 11 96 11 40 11 68 um ulative ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ id un id ate id ump id Name id ia Ġ( (* Ġw el Ġw tr Ġw cb Ġw ife Ġw olfram Ġw szyst ch t ch ure te la di gram def ect def ining ): # and ar ata k ata form Ġ[ # ma ine ul ars Ġimport able ], ), ck d el lo el der el ite el ens el bo ': '. es peci es ults ĊĊ ĊĠĠĠĠ ĊĊ Ċĉĉĉ is c is u is se is ch is new is Connected is crowd is Staged is disjoint val ds val ide val ences __ == __ )[ get ti get line get float get Index get Context get Conf get Nodes get Edge get TrackbarPos one st (' $\ (' [\ (' ----- )) % )) [:, )) [- set C set diff set Standard set Expression ĠT D ĠT y ĠT LD ĠT rend ĠT ICK ĠT angent il ent con an con ce con ju Ġ2 000000 (" ************************ ') # ') [: ') }" as cent as gi as yl iz a op las op ixel op otential Ġ{ # Ġ{ - Ġ{ :, Ġis First Ġis Match Ġ7 99 Ġ7 36 ĠS s ĠS x ĠS or ĠS up ĠS ine ĠS eat ĠS cor ĠS EX ĠS tick ĠS MC ĠS CR ĠS CM ĠS cores ĠS MAC ĠS NI ĠS ensing ĠS KU ab ba ab olo ĠC onse ĠC AM ĠC ron ĠC IM ĠC ream ĠC VE ĠC ros ĠC hole ĠC odon ĠC lyde ĠC rawl ig ue ht od up dat Ġg def Ġg lib Ġg att Ġg NMI for a for count ter ra ter ate ter ritory Ġr ct Ġr ue Ġr name Ġr data Ġr list Ġr pt Ġr ans Ġr max Ġr start Ġr cc Ġr pn Ġr ural Ġr mg Ġr lb Ġl ucid end urance data Access data science ĠA th ĠA ust ĠA lig ĠA OI sp ices '] ]= 01 87 01 57 01 66 01 47 01 79 01 0000000000 Ġcon solidation am at am yg to i to w 99 73 par as par ity path To ist ente ĠF AN ĠF ee ĠF ederated ĠF resnel sc n sc apy qu als qu ater qu anto qu arters log ue log print om ing om ena Ġh atch Ġh av Ġh undreds all on po a ĠP ump ĠP reset ĠP CRE ĠP illow ĠP Ann ĠP uzzle ĠP urification Ġas df ĠI z ĠI CU file size file Type file paths ĠL ake ĠL LR ĠL ENGTH ĠL ikes res ion res izing tr j Ġst un Ġst iffness Ġde ss Ġde ls Ġde si Ġde sig Ġde cryption Ġde xp Ġde dication Ġde vido pro ceed est ine est ablished Ġ""" ), pt f fig height fig Size Ġ3 98 10 27 10 48 10 54 10 51 out Name out spec ĠD L ĠD ell ĠD FT ĠD emon ĠD HT ĠD RV ac loud ac ronym Ġu st Ġu cd Ġu dr ]) # ]) [: ]) """, ]) != Re ar Re load Re ach Re jected Re cursion Re tire Re packer sh x sh ine sh irt sh chyna sh ipyard Ġdata Name Ġdata hub Ġdata cube ĠM r ĠM s ĠM art ĠM AR ĠM ight ĠM ont ĠM pr ĠM oment ĠM ike ĠM inecraft ĠM CTS nt arget time scale if s key len key map key pad key typed xf sm =" ï =" ]) =" '+ =" *") Ġv f Ġv h Ġv es Ġv ig Ġv inf Ġv ÃŃ Ġv stations 02 84 ew c ext langs Ġy int Ġy ang Ġy Data Ġy range Ġy lb Ġy oke Ġy grafico ĠO doo ds a ds on Ġx key Ġx ys Ġx api Ġx lb Ġx ena Ġx rng os at Ġse gy Ġse titem Ġma ptbx que en test results test steps Ġor ion Ġor dem add Node add Location add Tests add Both ject ure ER GY IN COME IN VOICE Ġel s Ġel la xb ch xb bo ure n 1111 011 Ġme ow Ġme ets Ġme todo Ġme tod ---------------- ------ Ġfile Severity Ġpro pos Ġpro state ens ate py datetime py pa py mysql py annote pre e pre st pre print pre Tasks ls on ap aper 07 08 07 88 07 85 07 45 ang ler ES TR Ġbe ep ĠB s ĠB ir ĠB ass ĠB lood ĠB asket Ġos geo 12 17 12 24 12 89 12 933 ĠE G ĠE ver ĠE ta ĠE OL ĠE CS ĠE MG Ġj v ime o ob an text pad AT GCT Ġ) ;\ low pass ĠN I ĠN X ĠN EXT ĠN MF ĠN okia }, {: ir ks ir atio len X len Y bo ify Ġ4 07 Ġ4 66 Ġ4 47 Ġ4 83 Ġ4 59 Ġ4 095 ff n ff s ff nn lu ent 92 16 92 88 92 95 92 66 92 50 92 62 In cid In formações In coherence ind f append only ĠR yan mo ver mo od mo gor mo eda ep hemeral Ġun loaded Ġun modified Ġun pickle Ġun deploy Ġun mute Ġun ivariate Ġun iversity Ġun ichr Ġtest plan lic as ĠG lass ĠG ust ĠG IM ĠG lonass Ġco q Ġco vs Ġon mt EN EF EN ZA EN GLISH ĠW elcome ĠW WZ ho les ho ugh Ġout data Con former Con vective bu tils ĠV H ĠV N ĠV V ĠV iz ĠV ic ĠV pn ĠV ali ĠV ella ĠU R ĠU RDF ry an Ġnum ls Ġ5 25 Ġ5 56 Ġ5 30 ). ' ib an ib mq Ġan vil Ġ__ _/ Ġen ame Ġen couragements che mic ator ia Ġtime spec Ġtime Var Ġ> / 18 19 16 13 16 22 16 53 line count sa f sa k sa ac Ġk z Ġk ub Ġk ir Ġk ale Ġk ong Ġcol names Ġro p Ġro ads St or St ored St uck St ories Ġpy com Ġpy cuda Ġpy fftw config Path config uring config urable Ġ6 32 Ġ6 25 Ġ6 04 ag as ag ios ts q 04 09 Ġmodel grid 13 13 13 83 13 39 13 78 13 51 lib psd lib rosa 06 02 06 07 06 15 06 72 Ġwh is ll hr class ifications 15 78 15 59 15 908 ST ONE 100 7 100 103 max length max Total max heap 05 12 05 67 Ġthis item 03 17 03 84 03 53 03 462 Ġint end Ġint uitive we bui uti ae ip fs Ġch ilds Ġch romedriver 17 00 17 11 17 02 17 14 17 98 17 42 17 39 17 72 Ġal ib Ġal umn Ġal oha 93 86 93 56 93 82 14 32 14 33 14 82 14 58 ari ma Ġpre co Ġpre fs Ġpre serving Ġpre pended ne opo Ġ/ $$ ok i Ġby e 64 17 64 55 64 86 right word Ġob spy enti sts Ġra iz Ġ[] }, Ġ[] }) ([ __ :// ", iti e RE PE RE POS RE LOAD RE VISION Ġtra pezoid IC F IC ATED 08 32 08 16 08 08 08 65 08 62 main file main frame main menu ty t ty per Ġ\ __ ĠH PO ĠH yp ĠH DU ĠRe v ĠRe base tain ment sub systems sub portal Ġ{} - Ġ{} ...'. ml Scene lob e eri alized mat t mat ron Ġsh ops Ġsh arded Ġdi ss Ġdi bu Ġdi xel sk ie df b df List work shop 88 32 88 42 19 80 output Directory comp iling comp acted Ġsc m Ġsc rolling Ġsc raping 34 61 Ġ[" __ Ġ[" {}/ uil la Ġwe ave 09 04 09 64 ĠIn s ĠIn compatible ĠIn dustry ask ed by Area Ġle an Ġle xe result N 24 81 24 51 37 72 Pro vince em scripten point ing point list point Format ark ed Ġsub model Ġsub total Ġsub project Ġsub modules yn ew rep ancy rep laces AM F 96 92 96 37 96 94 96 66 Ġac q Ġac cordance Ġcomp ressor Ġcomp arator Ġcomp romisso aliz a aliz ada ĠCon n 55 87 55 75 55 35 94 03 94 77 94 65 94 48 Ġ} },{ DE PRECATED RO LES node id node Id Ġlabel dict row wise av ro av ity av ily Ġno server 87 48 87 54 no o Ġclass room exp m exp lained CT TC Data Value Data Module Data Layer Data Store Data bricks Data Importer AS R Ġla cks 85 00 85 07 97 22 97 73 rid x back Auth {} ; {} @ net box ================ ======== 36 24 36 77 36 82 36 58 36 59 36 69 čĊč ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ but ing ron i ron o ron Emails Ġopen pose Ġopen shift ĠK d ĠK CS ĠK aggle 95 16 95 09 95 96 95 78 word le view Offset Ġcont aminated run ing run dir 86 2745 Ġmax X Ġmax Overlap mon omials Ġdate parser Ġz cond Ġz idColName ################################ ############ process Events default skin 57 84 57 67 57 74 Ġhelp Text Ġ! \ Ġ[' " Ġ[' \ Par as Par cel Ġext ents Ġext ending Ġext erior Ġ| -- Ġ| _) create Child create TextNode "), ( IS P IS OT reg ret Ġtf ssa ix in ix ar Ġbo ids Ġbo ston do h do ing do xy parse String au kee spe ckle Ġne i ele metry Text Line Ġfil ing Ġfil eno env var List ening current Time CO IN tle ment color space color Test color ado color Space upp y man hattan ach y Ġlo h Ġlo o trans fo trans mat AC ON AC GT Ġcheck first Ġstart Y Ġli d Ġli es Ġli ber 44 13 44 35 44 83 44 41 44 61 Ċĉĉĉ ĠĠĠĠ utf low Ġdis cart Ġdis appear AP IT 75 66 new Value Ġtext type Ġrun as Ġrun py ef fic ']) / En ables Co sts Co oldown Ġend loop Ex am Ex press Ex ercise raw File so x cal ifornia 56 92 go vt 98 25 98 26 Ġsp ring Ġsp lash 38 91 my app Ġmin X Ġmin DF pop in ĠUn like ĠUn iswap Po ses Po ols Ġ(' *', Ġ(" {} uc ion Ac ronym be b be it ĠQ Action ĠQ Calendar img type target Cells 35 99 35 07 35 25 35 88 35 09 35 26 35 47 35 46 ref purpose Ġus a File Names File Texture bs olar AD P AD RESSE Ar rows Ar mor Ar ffRow save Image save As Ġtarget Attr ))) # ĠSe ason Ġad opt Ġad mitted 45 99 45 18 45 93 45 94 45 49 77 10 77 66 77 72 PO W PO DO PO GOProtos attr getter ql U the th ide os Ġerror ed Ġerror Message Ġdistri b ĠY an ĠY ang Ġinter sects ä¸ ĸ Ġspeci ally ĠX code CH IP 47 22 47 96 initi es ]] } csv path 101 8 action Entity ĠEx erc tf m Ġload module Ġload CSVName ash i Set point Set List Set Size Set FileName pl anned cord inate Ġreg ards Ġreg istrar Ġreg ião 50 32 Test Config ')) ): ')) )) HO I HO O Ġser o 83 86 Ġevent Type Ġevent Id Ch ance Ch apters Ch inese wh ale UN ION UN USED UN CHANGED gen i gen code ĠIN I sg n rt na rt tm 82 02 82 12 82 94 host names order Type Ġar q iter text 46 05 46 95 46 38 46 81 ĠJ C ĠJ uniper loadText ure Log Event Num Str Num erical tiv ni lect ual DI ALOG Ġ] [' cp df open ai open citations Ġread Lines Ġq rels temp LE tag per ĊĠĠĠĠĠĠĠĠĠĠĠĠ ĊĊĠĠĠ UL ATE air craft To y To Markdown CON FI De al De former De cember exec uting sign bank 076923076 9 Time line Time span Time zone Time Profiler âĢ ĭ cul ant 65 85 Ġdb con 43 08 Ġup time Ġup coming Ġcor porate ĠPro x ĠPro of ĠPro metheus Ġcontin ent ins urance vo v vo le Ġpoint net Ġmatch Dict page size down sampled ''' \ 48 11 48 18 48 93 48 09 48 96 Ġqu ota Ġqu iver Ġimg Url err ar pass port iven ess Ġfirst Screen Ġfirst CharMatchInd No Int total Quantity mode st ãģ ¡ rate Limit ĠAr go ĠAr mor 42 09 TT N Ġgroup docs EL INE Model Request е ÑĦ ï¼ ij mt c Ġwork spaces ĠÐ ij ĠÐ Ĺ Frame buffer Ġinst itution Ġinst anci post ag Ġback ed Ġback bones ous ly Get Key Get NodeOptions game board Node Type ĠPar is ĠPar ametric match Tissue tx ns tx yz ny u Message ID address ing Ġsave Data Ġover la Ġover writes bl una play Id play ground ================================ ========== Ġmake file build out Descriptor Metadata aw transaction Ġchar ged TO W ik Handle duct ance mer ging mer gência 54 00 54 07 she ep Ġoff spring cv x const itu 74 18 cmd class MO L MO VIE Ġtop level Ġ'__ ** ĠCo hort 01111 01 73 88 dis GB dis LA dis GA dis LB dis MEI Ġ... ". String Type Object Id Object Group Com ic FT A Comp iling Ġorder by Bo ards send file ush i Ġuni ver next Execution Form er Form Field Response Result Response Body over stock Class Accessor Input Data Input File Input DNA edge list Ġsupp lement State Data wer k dist plot req d case fold ãĤ ¦ ãĤ ¬ Ġbot orch User ID User Manager Ġman ifold lim odou âĢį ðŁĮ Ġhead lines queue dJ ĠDe coding ĠDe compose ĠDe compiled pen nylane sw im CA QC si am Ġform ulation sor u sor ugrup Exception Check abs ch ãĥ Ģ ãĥ ľ Access Error Access Token Th row Th umbs author ship çļĦ æŶéĹ´ At ual unit cell 52 06 52 05 52 88 ĠUser Form ĠUser Facing Of Password QU AN 62 99 WAR DS ĊĠĠĠĠĠĠ ĊĠ ĊĠĠ ĊĠĠĊĠ Sh aring ba o Image Orientation oken poster IP SL :] ))) Ġtmp Site URL Error Ġgraph ite Ġ". |* Loc alization Ġter mios decode VTEC SC AR ĠSet ter ĠSet Plot PRO FILES 202 11 }\ /\ 63 03 63 87 Ġoptim izations CC CA Inter rupts 72 25 na pts åĪ · åĪ Ĵ extra cts Ġtask path Create LinearProjectile Ġmy funds Tx Gap Ġsim core Ġph s Ġsent encias âĶĢ âķ° By Request Client Async 69 05 mod SecInstalled App Data App lying н ов diff priv Fa zer patch name Ġmark ov aa qi ĠImage Share Ñģ ли Ñģ каз Py Seq az u az tec Ġcsv writer For Intent pg id meta file Ġmon ty Ġloc ust COL ON tran sect PR P PR NGKey Group By _{ *} active state ĠDE EP Pre processing Ġdatabase New GR AT web root ++ +\ Sub type Sub graphTypes Sub Equil ĠAPI Request af ford dat var LOG OPTIONS NO STORE Ġparent Is ĠEn coded Ġthread List UP LE UP AC Ġì Ĭ Ġì ĽIJ ('/ ' GB D GB K GB R Ġcell time Ġcell ranger Ġcell setpath Ġcluster Module ĠMan ually training Set Dis ks nb t zip File Tensor Flow Ġdir list Run Config real Width Check Info embed der Return Code Token Authentication Token Lookup Rule Spec åħ ĴåŃIJ price Type áĥ ¡áĥ Function Call sd ss ĠCheck out Ġgame ston display Warning Ġpick up GS PC Ġyield ing '} ): '} ]}, Per fil Per ceptual Per ceptron Or th .* . .* / GET USER á veis á fico Ġinstall Syn Ġlink ing Ġstri pe Ġsend Text direct notify imp ath imp utation Line Col Line Color Ġmer ceedge "} ]', Date Formatter Load Block cf l arm our Ref used Ġparam ters '{ :< Mat lab Ġ") ": Ġest udantes MC MC SD A fc st counter ed Count ing vers ible vers atile ĠRelation al mk p Ġ[- ]") !! ". EXT ENDED cd r cd na ling Error ĠTe mple ret code Box Size So il ming w vari ous vari ety Mo jo Mo vies lon don å® ¿ ~~~~~~~~ ~~~~ seg wit auto encoder Output Module rm ul Ġdisplay Name Level Behavior Ġinitial ised prop name prop ensities AIN S this dir Ġ---------------------------------------------------------------- -------- Ġ---------------------------------------------------------------- ---------------------------------- Met ering GL enum Ele ID Resource Data PS P PS NR GG GC xF CD Ġmove chance ĠURL S Ġoutputs GT issue d issue comment ĠAc tiv DR ULE Ġaut umn ("- "* 128 34 Ġrot ating short s Ġdraw style cr ude cr kc Ġcore props tile extent ("% - bn db Ġprefix exp Ġdon or IR q âĶĮ âĸĪâĸĪâĸĪ Ġnotice d Min er Min Size Ġregister ing ĠUp on xs x allow een Struct ures ratio TL aut umn aut of à® ļ Task Arg à° « hist oric Ġprevious Utt volume Type Ġdat ar Ġrate map member Id Ġcap np Address Type fr mt Cur rX Cur rY ĠPre dictions ĠPre processor *\ (\ pa ssage Ġfast path Ġfast ai Search List ĠPer ceptual bi jector ä¸Ģ å¼ł }'. \ payload s Ġfree zer bind x ĠAd ult land m pd c ÃŃ stica ĠRE MAIN Ġpas sengers CR C CR U '^ [ force field ĠAn ki Ġpop ulação Ġnamespace d ĠInput String bed path Ñĥ Ñī Stream Name enum bers enum eration Op in Invalid Configuration Over head stock Mar Ġcons iders oto ol NUM BERS Ġmultiple tau Ġauto array Ġauto encoder PRE DICTION л ем л Ñĸ ja cob Ġconv Config ("/ * ("/ ")) Ġactual mente Ġæ Ģ Ġprop het ĠSub st ĠSub lime ĠDis creti PY PY Ġlang name čĊĠĠĠĠ čĊ čĊĠĠĠĠ čĊčĊĠĠĠ GO PTIONS sn appy ĠOpen MOC super cell ĠIP s SQL ite Read Write Classifier Log ĠHttpResponse NotFound ĠInter p ĠInter pret }: " Ġside walk With Fbx install Status cb or Ġbegin ing ı rak æĹ § åį ½ ĠEN ERGY Ġestim ating ĠTH IR ĠTH IRD ĠAR CH Ġgra us Ġgra ding Ġgra fana gl ar cred def cred itor Ġmp ileup Element List alt ura cogn ito Layer Elements ĠHTTP CacheManager EO M Open ing Ġcat Jump Ñı з Ñı ÑĤÑĮ Ġinv ite aff le Register IncentiveProposal ]} ", BR ACE Ġimplement er dy graph Python FunctionDescriptor ĠMy Sum ĠMy Private Ġpower api WE BS And Compile Grid View BB T DA O 916 5 916 7 DIS CARD dig ite TA KE TA KER Ġsegment ations COMP ILER COMP RESSED permission Name permission Id flux err Batch Received Batch TransferFrom poly dets ĠJSON Response cert file NOT FOUND NOT IFICATIONS dense net Transform ations ĠDes k sy nthesize HTTP BadRequest SN D SN P Ġvm f Ġdrop na ssl Cert edit ing edit ors Ġп ок Instance Type Ne urons ĠNode List mg bl mg xs ĠSH ORT ĠSH ARED }{ :< Ġperiod LE ĠNe ver ĠNew Optimizer LIST CONTAINERS exist ed ĠBy e Ġcombin er Ġque en Ġep ics rd k rd class Rout es sal a sal ah pto mino tol int Ġedit able Ho le UST ED ĠDec or activity Id FIX ME VC g Order Traversal Interface Type Ġspect ro Ġretri ever ĠDB Name 384 615 ati co ĠSp line ĠSp onsor Ġhidden Layer Ġorigin ating Ġctsp SgaclMonitor Ġctsp OperSgaclMapping FC lose ĠAss istant Ġpoly fit king Status BC F Iter ative Track Pt ĠIndex er Mark ers Mark ups fri day program mer episode Separator Rate Coeff lis sement uit ar Ġnumer ically Ġprogress Bar éĻ ħ Ġxy xy æľī æѤ ĠMessage Handler Multi cast ĠRandom URI ðŁĩ ¼ hy ps EA U EA p archive path enc ils Mapping Error mn fld ali ased condition ing tan ame Ġvo ids Attribute Name ĠState I ĠMat thew Ġnoise s Ġstatic ally Ġpt b emp ties PA ID adjust able Files Formatter ĠId Token Ġps ds ĠGL X Pl anner 1234 567 ATT CT ATT ENTION \' ') ç½ · Ġ'" % ĠAs ynchronous Begin ning arc Length 00101 0000 dz eta Script Path Ġbranch ing XXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXX (); ' ĠMax wellCC 501 5 gri dding det to Dep endent ĠGraph Algos Ġappend ManifestFile ĠGoogle Home ĠModule Type åĩº ãģĹãģŁ Ġsy ft Gen res Record ing Ġns lices Job Status ¬ółģ ¡ółģ¿ ensemb l multip lic IMAGE MESSAGE IMAGE OPTIONS æĸĩ æ¡£ cdbp RealmKnownPeers cdbp AppAdvFromPeer sur veys ĠService Account Ġexternal Failure æĪIJ çļĦ flip ped Host Ip Ġfl x ĠParameter Grid Feature Vector news letter ("[ ") ĠInvalid Operation fb ps ĠSimple HTTPServer ĠPri m ĠPri vileges 207 2 203 9 met atype Env Var Ġcast s 315 1 perm al Ġrec uperação ĠFI EL Ùħ ÙĬ Ùħ Ø´ ĠMock Response LP Z nu ke Ġ"[ __ Ġroute map ........ .. Power ed eg onet Ġdetect ing ä¼ ģ 225 4 bt m asset Name dw f Ġfs x Ġ99 5 LR K Ġpot ato ĠBea con 908 5 456 8 hyper opt ðŁı´ółģ³ółģ ¡ :{ : LT L ste pper Ġmid as mas senergize neighbor distances tcp x Ġair lines Ġpk unit ĠInt roduction 424 6 424 7 ĠOp ti Ret val Ġsym metri Ġrelation Name åĪĨ éħį åĪĨ 辨 Windows Path 00001111 0000 ĠMet al Channel Id Optim ized Ġaz m igen omic reply error Ġam use ĠPost s ĠPost Serializer Api Server dark grid Ġв оз Remove ContainerMessage ĠBlock ing OFF ICE ĠMark s 907 5 HI ERARCHY Ġphase d [] "},{" [] "}]," Ġec g Poly DP decoder awtransaction Active Workspace å¹ ¿ å¹ ħ Build Element å· ŀ Dense Layer Ġâ Ħ Ġasc ent PREFIX ES Ġorgan iser Tool tip GC LOUD 808 1 è¾ ¼ è¾ ŀ xl wings Ġ------------------------------------------------ ---- Ġ------------------------------------------------ --------- Li q æĢ Ĵ --------- ") Comple ter ĠExtra Trees Modi fiers п од п оÑģ ĠSER IAL Ġinher iting webs ites 436 1 nor r å¸ ®åĬ© rich ard æŶ éķ¿ Ġн ом Ġer oded regular ize 大 éĻĨ Ġcloud pickle ĠFree BSD 303 4 Tun ed ĠResult Set aps ule aux iliar Simple HTR quis itions mysql db à± ĩ cg ranges lig ent Ġml func deriv s deriv ation redis DB )+' ;' 395 8 MIS MATCH IFI ED ij ax §ółģ ¡ółģ¿ м и 392 8 impl ant ðŁı´ółģ´ółģ ¬ółģ Ġpid file {}) ". solve NQueens Ġboot style 337 6 aggreg ations aggreg ators 437 8 Ġsubmit ter identi fies ĠAuto Config SW T è§ ģ ']} ), Ġhex lify rotate Z (': : ภ¡ Ġ88 2 ĠMicro Python 425 4 425 7 coverage s anchor Field das hes '> { ĠCar Bay ĠStorage Helper ä¿¡ åı· Ġxs lt 332 1 332 9 Transport s Conn ective Ġphi Arr Err back ö r ĠOper ators ĠCloud Error Qos Statistics ln k ĊĉĠĠĠ ĉĉ Screen ers 408 1 Acc Dup SCHE DULE Basic Preset ĠAction Result ĠShow ing mr k mr mlScene ĠDire ctedGraph Kp V autog enerated ĠпÑĢ и '[ ?] stand out 405 2 emo f emo tions hu ang ĠCSV Logger Inv Cmd smart s smart license å¿ « Car tesian sky blue fv ha approx PolyDP ĠContext Manager Ġbus ca ADD NODEOPTIONS 364 2 364 9 Ġmi pt ("_ ")) ĠProperty Mock ĠProperty ParamRegistry 314 2524 ple cos æľ¬ 次 æľ¬ åľ° Limit Participant dg ds Ġsi xth Full Name UA AC ãĥ³ ãĤ° kn uckles Prefix Length çº ¢ Ġwebs ites Transformer WrapperDF Qq F ç´ ħ ĠTech nical LEN BAL Ġrho i ìŀ ĺ못 design s XL l Ġaugment ations çĻ º REPL ICA Qy G due ling Ġincorrect amente ĠAT UALIZ Scene DescriptorMetadata ORDER ED çĤ¹ çļĦ SF PT bag ging hc X Ġuid ColName Domain s WC wW ĠEval uating Cost Center Inte grand ä¾Ĩ åĪ° sf u ĠSelect KB wa ze Ġbenchmark ing ĠStop Order )? ' Ġtex te еÑĤ ÑĮ Pixel Spacing rn aseq ðŁı´ółģ£ółģ ¡ółģ éĹ´ éļĶ 899 05 Ġlig ne Raw Data SIG KILL Ġhar vesters ĠGaussian NB ĠGaussian Broad osa Casing ffili ation Ste el 缮 åīį ACCOUNT S ĠCount ing ĠFa ça Login View 466 6 432 4 OVER FLOW }$ ") Ġmk time ï¼ī ãĢĤ wu Ew áĦ ģ Ġgeom Proj æ¨ Ļ Ġ104 2 Ans wers mapp able 99999 88 Security tube Ġmouse Jump ìł Ģ Ġwon der æ° Ķ rev oc ðŁı´ółģ¢ółģ ¦ ĠAut odockVS mZ kZ Note field Ġrecent Points ĠFin ancial ÑĢаР· STRUCT IONS zoom s Ġrecomm enders Ġrecomm endation than ol æłĩ åĩĨ Ġdesign ated ĠPart ying Annot ate Ġce iling bla zeface ê³ Ħ morph s osp fL Ġ{}: {}". Statement Type ´ółĢ ¹ółģ¿ Ġfore grad Ġgap hor Ġhy ps Remote Control docsLoadBal RestrictCm CENT RATION Ġbeam Line ед н additional Fields Book marks Cl ark éł Ī Ġsuc cesses ĠìĿ ¼ 435 1 435 2 bow tie Ġ================= ===== Ġsun less dead ends Ġmul heres Ġsto ichiometry AGC AG #================================================================ =========== 438 1 LAT ITUDE ĠCat álogo physical Value mw eri ìĭ ¤ ìĭ ľë Ġठ¤ Ġ µ Calcul ations Free ze dro ps pal m tele fone ĠSto pping ĠSto cks Ġste ak Http Uri checkbox test 399 3 MZ ML cas ses Schedule d Schedule Block pep tide âĢĿ . TI FF van ia +) $", Ġintegr ations Ġintegr ating ĠLim its ×Ļ ×Ļ×Ŀ Ġfee Cost ĠChar Field Boolean Expression "^ [ "^ __ ìļ ¸ MARK ET ÅĤ o ÅĤ ÄĻ Arch ived âĢįðŁĴ » æĪij çļĦ Fe bruary ĠCent ers Fun Cmd Bus car Oct o )# , )# . æ¸ ¸ cros copy Ġtor rent Ġspo of ĠBO A éĩĮ éĿ¢ æŃ£ éĿ¢ Blob Url éļ ¾ éļ Ĥ Ġ134 2 ĠCS Nodes об Ñĭ bracket ed Initial ise visual isation }` " ĠXXXXXXXXXXXXXXXXXXXXXXXX XXXXX Creation Time Ġincoming LaneNo Ok ay draft docs xD AD Ġ#------------------------------------------------ ---------- Ġ(? : Ġreplic ated Hist orical ema iled por c ĠQuest ions dH V uá» Ł vir us VP Set Actor TaskSpec ĠRequires Context æĮĩ éĴĪ æ¡ ¶ éķ ľ Ġmemo ized ĠRot atingFileHandler лÑı ÑĢ Ġmilli ons Eg k Ġ'| ', Ġveh res Ġnan ome ENC ER 101011 0100 Oj g dN dz Ġtl ds ĠAda BoostClassifier ãģĮ ãģĤãĤĭ Gra de ban ker mach inery Ê· i Ê· iÉĻ Ê· iu ĠSat urday novel s ADAP T GENER ATE çľĭ äºĨ orator ies riz ard Ġham iltonian inherit Expression Ġpreserve AspectRatio Boost Regressor Uq kU cool ing cool warm SEG MENTS د Ùĩ 0005 87 Ġbas arim ĠMember Id ç² ĺ Ġconj untos 464 3 Cycle s ativ os åıĺ åĮĸ Jp N _{}_ {}_{}_ prom ote PAY ROLL ç¦ ģ Ġty po Workflow Action Ġ'^ ', Ġinject or ĠCy ber occup ation Ġíķ ´ strand Middle sma pe ĠÑĩ ÑĤ ĠÑĩ еÑĢез Ġins ights ĠQU ERY ãģ¾ ãģĹãģŁ Fri ction Opts Cmd eos pecs 交 æį¢ ĠMetadata Catalog tas min tas max Ġ204 0 ĠCollection Remove Ds Map Hand shake ³ółĢ ³ółģ¿ ³ółĢ µółģ¿ ĠStatic Objects ðŁı´ółģ§ółģ ²ółģ RAT ING Forward ing ółĢ²ółĢ ¸ółģ¿ æ¯Ķ è¾ĥ 687896 85 Ġsubstit uto ĠExport er MOV ES MOV ING }| [ ĠEnt rada NON BLOCK Ġnib ble Push AllArgs ĠÑĥ каз Ġtup la ĠSpect roscopic ĠscaleFactor OfSecondFixedSurface IDXGI Resource Act uator danger ous Ġul ca usd Stage Ġconsu mes osg Terrain Ġcamp any amplitude s æīĢæľī çļĦ Kn uckle Ġ197 0 ĠBin walk five thirty Ġstrength s proof reader ĠDig raph ðŁı´ółģ¥ółģ ¥ółĢ lv ls zoo keeper ĠAir byte Ġexam ined ëĵ ł srcs ys Equals Foo ĠSS ASig Ġtrick y æŁ¥è¯¢ ç»ĵæŀľ Sci py incid in attri buted ĠcdbpLocal IpAddr Ġcomput ador åĮº åĪĨ åĮº åŁŁ Eff Op ìĥ Ŀ detailed description detailed Description Emp loy varn am èĤ ¯ èĤ » Manage mement Future Warning ona uti ĠAssert Error ĠMi ssion Synth Cmd ĠCORS Middleware åł Ĩ ĠLong Tensor Ġko ji Matching Styles camel case è© ŀ Ġtier dict ĠPER CENT Ġjog o Ġblur red Asc endants 2656 9498 åĽł æѤ Radius Arcmin Ġо ÑĪиб Break ing vac ation ðŁį ³ Proposal Id repair s #------------------------------------------------ ------------- Sep tember cdbpLocal Vendor cdbpLocal Appl Au stralia ALI ASES bic ycle Ġoffer ed law rence Ġ206 0 ĠSTE PS ðŁij¨ âĢįðŁij© Ġsand wich routine Timer Dst Addr Lang FileLines spar v plug ret tB anana ĠClick House ĠÚ© ÛĴ ROT ATE manip ulator diffic ulties ĠCR IT trait stones ---------------------------------- \ Ġboost ed Disp on haust ive satis fied SCO PES infe ctions ĠAG ENT æѦ åĻ¨ cdbpPeer Vendor è®Ńç»ĥ éĽĨ tiny db atten ded ĠDirect NotifyGlobal Ġdatum Leta Ġfeel ing Cb Cr rub bish Ġ"| " Ġ"| ". ĠRMS F Ġroad bed CLI QUE ĠìĦ ł Ġhess ian ãģĵ ãģ¨ !@ !@ cau ses Finding Tracklet Ġmob il aqu a hil bert mort gage ί α èŃ ° Ġfair ly 0025 57 ĠBR IDGE ĠBer lin doub ly Buy backAuth æĶ¶ æĭ¾ ص ÙĦ orb ance coll ator Ġoutgoing LaneNo Locations Reserved Ġfoot note ãĥķãĤ © ÐĹ Ð°Ð´Ð°Ñĩ ĠполÑĮзоваÑĤел ей bomb LocationsReserved æĴ ŀ ĠSL URM ĠBU CKET ĠStar lette ĠXXXXXXXXXXXXXXXX XX ,:,:, :], Ġnex us Logic Cmd Ġqc flag ĠSimulator Event VSI F VSI FClose ĠClo udflare ĠLu ke "]* )['\"] ~~~~~~~~~~~~~~ ~ Ġstackconvert STR MOT OR tF ot íĥ Ģ Ġdeno ise Ġdeno ising ĠPA IE ĠGPL v HOOK S ãĥĩ ãĤ£ ĠDetect ron ĠscaledValueOf SecondFixedSurface twin y ãĥ¡ ãĥ³ãĥĪ Ham ilton candle s æº ĸ Ġdomin ance Ġparalle lism sketch ycoco ãĤ³ ãĥŀ ĠìĿ´ë ¦Ħ Ġperiodic ity fib sem Ġfund amental Propose AddTaskAdmin Propose AddTaskOwner Propose RemoveTaskAdmin Propose RemoveTaskOwner 8765 4321 ĠAttr Dict Ġckan ext HDF S MUT ATION elimin ar ĠSY MB Ġserv os çĻ½ åIJįåįķ Ġambig uities æ¼ Ķ ĠÑĦ ай Ġdup lication ĠTrust ed Ġhypot enuse ĠPed ido ĠHtml Formatter ĠStratisCli EngineError ĠStratisCli Incoherence PIC IOUS getText Size ĠEPS ILON ĠnumberOf Months OPTIM IZER ({} ), hin iratio plat ypus atmo sphere Ġ'~ ' ĠSpider ApiException refentry title sira ble Ġphysics ClientId åĢį æķ° Miss ile mU wG Ġelection date ĠFar mer Ġthrust ers ĠOrient DB pyx ll ugue se )+"\ " ç»´ 度 Ġbur st CDOT AResponseQuerySerialized Ġне обÑħодим Ġnucleoti de hrep rl Ġ"> ": Ġben ches Ġben efit MLP Policy SYN TAX ĠÑĩиÑģл а ĠOk ta ALIGN ED Listen Port Ġglm fit Weak Method ĠSTATIC FILES Twitter Service éŁ³ é¢ij ĠCts Acl ĠRegistration Form AndWait ForIntent ìĺ¤ ê¸° tZ ucchini reconstruct ed still ma Ġdrag Data ĠLif ecycle ĠIC MP Ġvul ner Ġvul nerability Ġneuro lib Ġìľ ł Ġoccure nce SEGMENT IO YUV Pixel ipe lago èį ī ĠPseudo DojoFamily Ġasynchronous ly ĠRAD IUS ä¼ĺ åħĪ Categorical Dist Ġsau ce abstra ction Ġenh anced Ġopent elemetry Moving Average IDXGIS urface Tro uble orche strator ĠCached PropertyParamRegistry ĠUC SC Ġatri but larch dir Ġawk ward Enhance ment åİĨ åı² اد ر Utter AndWaitForIntent è£ħ 饰 RABBIT MQ ÈĻ i Ġ"~ / Ġmé dia Ġthumb print ĠBr ute emoj is POMERIUMSERVICEACCOUNT REQUEST Dns Server 00010011 000000000000000 templ ated ĠCam ada igmp Count nthes izer ĠInvert ed '])+' ",' greet ings +\. ?\ consider ed æ¸ħ çIJĨ [\\/ ]. basket ball è¸ ª arri ved Ġconsum ing Ġshar py Ġconfigura ções Interactive Session Mutable Mapping Sho ck Ġath lete ĠLos ses Ġ______ _ áĥIJáĥł áĥIJáĥ¡áĥ Ġplex api quar tile ĠEVAL UATE ãĤŃ ãĥ¥ à°¬ à°¡ Ġovlp s OCT AVES Wal ker dop out chicken pox travers als ANNOT ATION Ġtempl ated APIS chema MULTIP LIER Ùĩا ÛĮ Appear ance èĹ ı Ġcyl indrical opend ap Ġ--------------------------------------------------- # è§Ħ æł¼ Notebook Difference FbxNode Attribute Ġë³Ģ íĻĺ Ġiop rinter Ġnue va ĠMPC ORB ENCODE D 课 ç¨ĭ ê°Ĵ ìĿĦ æ°£ 毬 CWD MC ĠWINDO W comic Name ecal ho Ġapple seed Ġneck lace CREDIT S ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ debt or ĠFurther more ĠVs Ss ðĿħ ¥ SUS PICIOUS gir ar ĠESS C Ġaval ible Ġquar tile guar dian Ġelectrode Positions Ġдан нÑĭÑħ lensfun py Wik idata ĠCe CILL Produced Value âĢįðŁļ Ģ AccessKey Id ĠDEP LOY ServerInfo Response Ġadminist rador ĠOverflow Error å¥Ĺ åĪ© Ġ'$']],[[' $', gkl ss imme e ĠMEN U pydev d Insecure RequestWarning Anneal ing Ġë© Ķ Ġæ£Ģ æŁ¥ />` _ èªŃ ãģ¿ HealthCheck Options Hflow UMan NLL Loss ð¨ ļ« istra ils ĠDerived Level Ġobvious ly Ġsubscri bing Ġspa Cy ĠDescriptor s еÑĢаÑĤ ÑĥÑĢа Highlight MenuItem ĠìķĬ ìĿĢ æ´» åĬ¨ rasp berry endOf LoadBlock ĠMID I ĠMich igan ĠNinja BuildElement Ġtrabal ho wordtag counter Activ ations Uploaded File ÑģÑĭл ки StreamEncryption Property THRESHOL DRULE ĠзапиÑģ ей çª Ĺ ĠBright side Ġpret tify solicit acao MAINT AINER ĠQuat To ÙħÙĨ ابع çĪ¬ èĻ« GRI F tM oringa listPieces White ĠMic hel ĠVOL UME omestic HotWater WEAP ON ĠMocked Boto ĠíĨ łíģ Ġâľ ĵ ĠReferenced InheritingObject Ġpalav ra ĠDISTRIBUT ION Ġíĺķ íĥľ ĠVoiceActivity Version Cidr Ip Vapor Pressures gals pec vts Display alco holic Ġpes os ĠTic TacToe ĠTiles Converter ál culo ĠAPIS erver Ġsteem rewarding anonym ized ĠNBPKG INFO Ġtiff file ('= ')[ ĠNico las FALL BACK ĠfilterStatement Entry decodeBinary Int Ġпол ной originalEgg RotBBox ØŃÙĪ اÙĦÛģ ĠíķĦ íĦ° chau dh ĠCUT Status erez Comp COOR DS Universal Diff ToRet ain TransactionEvent Info GMTCLib Error rawData Repacker DATAT YPE огÑĢаÑĦ иÑı Ġpedigree Cells Ġtti immee Ġmountain s 9218108178 557 ĠSEQU ENCE 109100 129 Landmark Locations Ġconex ão ĠдÑĢÑĥзÑĮÑı Ñħ tWater melon ĠPron oun ĠEstab lish Ġpywin auto ddu Consumption LEAG UES interlace d ĠConversation Handler longcmd string ĠUnitModel Costing ĠPreTrained Tokenizer SearchSpace Name Ġæ³ ¨ Ġæ¸ ħ Vermicul ite ĠMultivariate Gaussian Ġsolv ated Princip alsResponse ĠпÑĢог ÑĢамм Ġ×¢ ׾ ĠíķĻ ìĬµ 0000011001010101111 11101 ĠAVAIL ABLE AOI cor Gnu Indicators Kern ingGroup kou fu qit argspec isal num Ġtopos ort Ġ{{} }'. Ġconflow gen Ġygg drasil PROTON ATED ĠEXPI RED royal blue ContainerDeployed Options Ġutter ances IdentityPool Provider MULTIC AST streamp lot оказ аÑĤÑĮ LERE QUEST ĠCoinGecko API lichtungsbeho erde BKBCoVAoFArFJYYSgAqFQqFQKBSXGEoAKhQKhUKhUFxiKAGoUCgUCoVCcYmh BKBCoVAoFArFJYYSgAqFQqFQKBSXGEoAKhQKhUKhUFxiKAGoUCgUCoVCcYmh Hinds ight buna ÅĤ å³ ° unra isable ĠAlib aba INFOR ESPONSE ĠGAM MA ĠVoucher Type libvul pes Ġdissip ation ALTERN ATIVE orsma al PRAG MA áp ida UniProt KB boltz mann Ġmistran scribe parentes co Fundamental Types 11011111111001000000 011 Ġperiodi cally djske letor gordons Model vtec Mode ±Ħë ĦIJ Ġ'------------------------------------------------------------------------------------------ ' setStandard Buttons ĠChole sky Ġrmg py Ġrlb ench mogor ov chemic als ĠQCalendar Widget PODO PTIONS actionEntity Set tivni Gumb NoInt en queuedJ obs ĠUserFacing GraphQLError ImageOrientation Patient aaqi hh ĠparentIs Class Ġgameston k ĠinstallSyn Apps ĠpreviousUtt Same ĠREMAIN S stockMar ke ırak ı ĠMyPrivate Cloud LISTCONTAINERS OPTIONS metatype s ĠSelectKB est ĠGaussianBroad ening ospfL sdb fivethirty eight Managemement Zones 26569498 055 VSIFClose L ãĤ³ãĥŀ ãĥ³ãĥī ĠStratisCliIncoherence Error áĥIJáĥłáĥIJáĥ¡áĥ ¬áĥĿ ĠíĨłíģ ° ĠUnitModelCosting Block ! / ! ')) ! \\ " ([ " /{ " ;\ # ================================================ $ $\ $ ^{- % ;"> ' __ ' '), ' + > ? > } > ": > ... > %( @ ! @ ", @ (\ A way A FIO B end B RI B IB B ell B ASIS B ench B NET B GP B attery C ot C name C as C able C ls C iv C ron C ele C raw C PC C BA C lar C ASH C ensus C linton D un D il D as D mass D NB D une D WR D hw D molar E mit E AB E PP E lite E bookInfo F ul F List F orth F VC F yu F izz F ashion G AL G BU G OB G angSTRCall H ad H ill H AB H mac H ints H oney H STS H askell H ISEQ H WND I df J c J m J ak J ones J pn K nn K now K iki K IA K aggle K itchen K elurahan L ar L prob L SH L emon M RI M Vi M over M ORE M NR M WT M fj M aria M CObj N am N ub N ob N ak N QU N TER N ao N MR N itr O ak O WS O Ag O utflow P our P HE P las P PI P atches P MT P MAN P WA Q SO R à R us R data R ace R nn R ACK R ICS R ussian S on S sh S tp S GT S queeze S aves S FIXED T on T ig T pro T rent T ou T input T output T ies T MPL T reatment T BD T UMan T aylor U net U CI U ENCE U ETYPE V AT V ATION V oucher W ED W SS W qV W atched W illiams W DItem X d X Interface X ilinx Y an Y et Y OU Y nJ Z score Z STD Z ENO [ ]) [ [\ [ ()] [ ÃĹ \ , \ '] \ '. \ "} \ ")\ ] -- ] ({ _ ))) _ [:, a ix a parser b time b ff b dd b att b proposal b JZ b fnc b reathe b redde c ld c arr c sts d ce d od d ds d cs d lat d pr d sets d ynam d FR d aniel e ing e bug e bb e uclid f de f eld f rc f lour f dip f etches g A g H g N g P g S g Z g ation g il g mk g ages g umb g modern h T h ame h ly h ne h ak h ps h box h umi h ues h vr i X i list i est i Reg j ing j ada j UY j amin k C k P k om k pt k und k nx k yper k dc k Wh k ras k eto k atz k raken k endall k obieta l O l Q l R l X l name l ators l orem m K m O m me m file m ang m ull m fr m angled m anga n li n ion n xb n step n sen n ão n wb n ogram n hood n Samples n ubar o Z o ab o vo o Bu p T p un p max p unc p FI p af p vals p wn p loidy p NumClassInstances q M q ls q config q FQ q dD r Z r ush r svps r ftc r lowtohigh s L s Y s xc s url s lit s dt s Di s bc s ÉĻ s Container s Äħd t ms t ref t Property t Connector t Tenant t SetPoint u J u P u able u dim u á u Ãł u XL u acao v A v ne v Down v tu v archar w ol w sp w ks w rf w Val w heat x ent x lf x mpp x Mid x Pae y P y la y ue y man y esterday z B z O z S z an z os z by z hat { %. } + } "\ } >' } ° ¡ æľī « ółĢ « æıı ¬ ¼ ¶ ółĢ±ółģ¿ · '), ½ ÕŃÕ¡Õ¬ ¾ çħ§  ª à IJ Ä § Õ ¬ × ĸ Ø ¢ à ½ è ij í Ĥ ð ¯ č ĠĠĠ Ġ ĊĊĊĠĠĠ Ġ vide Ġ ĊĊĊ Ġ âĸĪâĸĪ Ġ 840 Ġ ]). Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ è¡Į Ġ âĸĪâĸĪâĸĪâĸĪ Ġ ï¼Ī Ġ è¿Ľ Ġ åı¯ä»¥ Ġ ä¸ŃçļĦ Ġ æĪĸèĢħ Ġ ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ Ġ 示ä¾ĭ Ġ ÚĨ Ġ åİ»éĻ¤ Ĥ '), Ħ Īë Ī ï¸ı Ĭ éĻ¤ ij IJ ķ '), ķ ï¼ ķ ï¸ı Ĺ ç¤º ľ Īï¸ı ĠĠĠ ĊĊĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠ ĊĊĠĠĠ ĠĠĠĠĠĠĠĠ ĊĊĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠ ĠĊĠĠĠĠĠĠĠ in sp in order in divid in verter in dication in lined er d or u or else on ne on HighlightMenuItem at ro at ie at tk at onic re i re ta re label re loc re class re ns re fid re bind re tire ĠĠĠĠĠĠĠ ĊĠĠĠ ĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠ se cur st ing st da st pg st illa st sci st airs en ny en ia ĊĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĊĠĠĠĠĠĠĠĠĊĠĠĠĠĠĠĠ Ġt in Ġt pe Ġt name Ġt us Ġt type Ġt ray Ġt dict Ġt lim Ġt dl Ġt acker Ġt ambi ar py ar ff ar dian ar cade ar ques ar sten al axy al saaudio de u de er de es de gs de bs de project de ets de generate de precate le cular le akage le aders an se an image Ġi ch Ġi os Ġi stem Ġi StopIso Ġi StartGrd me c me ha me TRN Ġ' "\ Ġ' {\ Ġ' ```' ro st ro Mapping ro ism ti te ti pos ti cc ti led ti emp mp e Ġc D Ġc arg Ġc min Ġc ere Ġc ave Ġc cl Ġc xx Ġc opt Ġc dr Ġc atches Ġc dk Ġc bc Ġc wr Ġc ancellation Ġp ig Ġp sp Ġp size Ġp lu Ġp ll Ġp ik Ġp fs Ġp bf Ġp expect Ġp ony Ġp aga Ġf al Ġf he Ġf def Ġf oc Ġf format Ġf wave Ġf wr Ġf ichi Ġ" --- Ġ" != Ġ" ..") he p ## \ it ert it ario it unes it helial Ġa str Ġa book Ġa hat Ġa ffix Ġa sci Ġa meric Ġa dicionar Ġa voids Ġa dequ lo ci lo ps 00 32 00 17 00 27 00 82 00 190 ge ck ge eks ge psg ort o Ġn po Ġn states Ġn ano Ġn grams Ġn tok Ġn odo Ġn Samples Ġn ginx Ġn ulls Ġs rom Ġs as Ġs ó Ġs ugar ut om ur r ur are ur ora ur wid ss um ss cores Ġin Pos Ġin verter Ġin variant Ġin tial Ġin efficient Ġin feasible Ġin sufficient Ġre j Ġre tr Ġre version Ġre starts Ġre scaled Ġre mapped ing Event ing hua ame hame Ġo hem Ġd L Ġd ht Ġd all Ġd art Ġd size Ġd ff Ġd ass Ġd bg Ġd dt Ġd sets Ġd ram Ġd hi Ġd lite Ġd uf Ġd odge li as li ff li atu ct xt pe i un def un read un pickle un supervised un restricted un projected un igrams Ġm all Ġm md Ġm uc Ġm si Ġm mr ra ces ra sa ra dd ra mi ra sing ra shed Ġe ml Ġe els Ġe vecs la f la ware la uc la ining () }]', () <> ue la ue ling ad t ad mission co add ri v Ġb ol Ġb ang Ġb ass Ġb ak Ġb dist Ġb lan Ġb ryant Ġb bndb Ġb ırakı Ġ1 011 Ġ1 026 Ġ1 883 ed alize 11 27 11 24 11 29 11 81 11 62 um os ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ id algo id KickOffset Ġ0 105 Ġw u Ġw age ch ants ch ances ch atterbot te ls te vent te osat di er di ers di ment di os di cc di gal di visible di cities ): : ): ]) and l Ġ[ ])] ma cd ma stad ma hotas ma ptree ul aries == =\ ], :] Ġif s Ġif name Ġif Table ot r ot yp Ġfor bid "" ": "" """ el en es cap turn on ode te ode sk is play is Empty is posable val ent val ve val grind __ =" __ }') get able get Var get Instance get LevelName (' #### (' '), (' ([ (' ')) (' ------------------------------------------------ (' (', (' ---------- )) == )) }}[( set Window set Min set genes set Slider set Edge set Horizontal set Taxon Ġ- ") Ġto s Ġto oth ĠT G ĠT a ĠT it ĠT ur ĠT am ĠT ray ĠT ape ĠT eff ĠT RY ĠT RA ĠT Schema ĠT iming ĠT TL ĠT aking ĠT ABS ĠT Docs il de il Bert il lino th a th us us u us dt us band us dc str in str ange con tag con served con forms con serve Ġ2 080 (" == (" ---------------------------------------------------------------- (" ----- (" ]") pp oc pp Samplers pp ClassInstances pp ShaderResource pp ConstantBuffers as ys as ia as Params arg ate op al Ġ{ __ Ġis Infected Ġis Highway Ġis omorphic Ġis hift Ġ7 80 Ġ7 000 Ġ7 35 Ġ7 40 ĠS en ĠS ter ĠS ex ĠS ant ĠS ock ĠS rc ĠS AA ĠS PR ĠS LC ĠS cr ĠS IR ĠS pa ĠS CAL ĠS keleton ĠS YN ĠS till ĠS IGH ĠS afety ab ar ab ies ab uri ĠC ame ĠC one ĠC ome ĠC CI ĠC PC ĠC WT ĠC rown ĠC ifar ĠC amel ĠC ivis ĠC umulative ig lob up re up ut ") [- Ġ== \ Ġdef x Ġdef ini Ġg op Ġg flags Ġg wb Ġg unicorn for c for ks Ġr py Ġr br Ġr dg Ġr alph Ġr svps Ġl ud Ġl pm Ġl orentz end l end rec end ocal data plot data Name ĠA DB ĠA ged ĠA ki sp d sp at sp rint sp out sp lines sp ik sp aring sp licing ver key '] ]]): 01 64 01 38 01 39 01 78 01 53 01 52 01 055 01 00000000000000 01 0800 Ġcon centrations ic are ic ano am or am us am end am ts to List to World to ilet 99 32 99 05 99 64 99 86 99 28 99 82 99 74 par err path Checkpoint ist ure type check ĠF d ĠF sa ĠF allback ĠF usion ĠF aster ĠF alcon ĠF ingers ĠF ederal od x od ing sc ater sc ente qu ity qu iry log sum log gamma log uniform log Action vi k vi ti vi ate Ġh po Ġh item Ġh ail Ġh anging Ġh azards Ġh uggingface Ġh abilidades ĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠ ta i ta y ĠP x ĠP ig ĠP res ĠP IN ĠP cs ĠP OT ĠP UR ĠP rest ĠP VC ĠP RESET ĠP Hop ĠP acific Ġas data Ġas ign ĠI FF ĠI MAP ĠI TS ĠI muSensor ĠI UPAC file List file Output ĠL V ĠL ime ĠL TR ĠL ater ĠL BR ĠL AMP ĠL ARGE ĠL ondon ĠL ittle res im tr k ize Path Ġth ru =' ): =' {{ Ġst t Ġst ix Ġst udio Ġst reets Ġst eady Ġde pression Ġde dg Ġde duplicated Ġde ficit Ġde protonated Ġde cription pro verb pro px pro mpted pro ulette Ġ""" # pt p pt rain form Data form Wd ex cess ex its im on im list Ġex poses Ġex cellent able Object Ġ3 37 Ġ3 61 Ġ3 800 args list ption s 10 99 10 33 10 83 10 82 10 31 10 53 ase c out filename out ward ĠD Y ĠD ed ĠD ou ĠD ave ĠD OS ĠD IV ac io ac quired ac ca Ġu x Ġu funcs ]) " ]) `. ]) +'\ ert mgmt Re ps Re build Re member Re pas Re construction Re placing Re mainder ite ch app np app les sh as sh annon Ġdata Type Ġdata files ĠM W ĠM as ĠM ec ĠM ari ĠM ai ĠM VE ĠM á ĠM PY ĠM ango ĠM vir ĠM ASTER time ter time codes if null key format xf du =" ...") =" -") Ġv int Ġv file Ġv center Ġv cpu Ġv ital Ġv zf 02 33 02 97 02 26 02 35 02 76 02 58 ext m Ġ_ ` Ġy z Ġy size Ġy ref Ġy dl Ġy yy Ġy finance Ġy oung Ġnp hot ĠO H ĠO ST ĠO dometry Ġpar q Ġpar ola Ġx code Ġx off Ġx dot Ġx avier Ġse am Ġma h ĊĠĠĠĠĠ ĊĠĠĠĠĠĠĠ test Set Ġor a Ġor b add E add To add Attr add Parameters add LevelName add Errback IN BOUND Ġstr len Ġel lapsed xb au ange xpr ore ography ms on Ġme w ON LINE ON ICAL tra ctions Ġfile Type Ġfile ID Ġfile Handler Ġpro tolint py path py nq pre build pre Components pre Clock cess or cess ion ls as ap rf ap ril 07 27 07 97 xd ate xd ma xd omain label map label Size label Range label Format Ġbe gan are to Ċĉ Ċĉĉ "] '). ĠB OLD ĠB attle ĠB IDS ĠB ollinger 12 03 12 20 12 46 12 65 12 42 12 73 12 62 12 49 12 69 12 71 ys z ĠE z ĠE MP ĠE ffect ĠE FS ĠE rn ĠE vidence ĠE moji Ġj c Ġj k Ġj ed Ġj ud Ġj uniV Ġj ordan Ġj fscoer Ġj mespath ci vis ob W ob last Ġ< {}> AT GAT AT BW Ġ) ] xa ec xa ai čĊĠĠĠĠĠĠĠ čĊĠĠĠĠĠĠĠ ĠN de ĠN ul ĠN am ĠN est ĠN ER ĠN ik ĠN SS ĠN aming ir fft num values num enc bo i bo iler Ġ4 12 Ġ4 88 Ġ4 37 Ġ4 38 Ġ4 39 Ġ4 31 Ġ4 500 ger ber ff a Ġget Name Ġget Register Ġget Args 92 05 92 27 92 94 92 86 92 47 92 46 92 52 col Dec In spection In compatible In dustry In stitution append f append h ĠR D ĠR d ĠR val ĠR om ĠR vec ĠR PAR ĠR TF ĠR CNN ĠR ising ep idx ep hole ray a Ġun ip Ġun parsed Ġun matched Ġun observed OR ARY fo ck read Path read Net read buffer lic able Ġlog lambda 32 27 per ation ph os son y ĠG em ĠG Lib ĠG uess ĠG enes ĠG BP EN CODER ĠW D ĠW u ĠW y ĠW andb ĠW illow ĠW arehouse ĠW ishing ĠW illiam ĠW IDGET loc ally Ġout def Ġout Format Ġout Heading Con su ĠV u ĠV x ĠV ert ĠV RF ĠV VV ĠU B ĠU CS ĠU ndo ry p ry ptor Ġ5 97 Ġ5 95 Ġ5 77 Ġ5 73 mb ert ib atches ape st Ġan ts Ġan uga Ġan terior ard b ard our min v min cbar min kowski 999 3 ator io IT A IT H Ġtime Distance Error Config Error Dialog 18 43 18 39 16 95 16 77 16 74 16 49 16 61 16 384 Ġlist as sa id cur ium Ġk at Ġk pi Ġk ilo Ġcol con Ġcol labor 25 0000 25 60 St s St derr Ġpy d Ġpy cs Ġpy query Ġpy git Ġpy click Ġpy proj Ġpy MOR Ġpy perclip Ġpy echarts Ġ6 85 Ġ6 66 ag h ag no 04 24 Ġmodel led 13 14 13 09 13 87 13 77 13 47 06 93 06 75 06 67 ll er class room 15 84 15 91 15 74 SE PT ST AsIn ST AsOut ec ord ec vl ec tives 100 9 max split 05 25 05 55 05 95 05 79 05 050 05 7833 03 68 03 333334 jo e uti ve ip sg Ġop c Ġch urn Ġch ron 17 25 17 24 17 79 17 59 17 53 17 62 17 61 17 368 Ġal d Ġal gun dd ap 93 74 93 78 14 07 14 18 14 35 14 65 14 53 14 52 14 49 14 63 Ġpre T Ġpre print Ġresult set Ġresult Line ne ff Ġ/ _/ ok io 64 06 64 34 64 84 64 36 right y right Hand Ġrange d '' \ Ġra x Ġdefault ArgsBaseIndex base Aliases ou los ([ ]). gra der gra ding gra ined iti zers RE CL RE MAIN RE PLAY 08 11 08 02 08 18 08 66 main Window AN IM AN NOUN Ġ\ __, Ġ. " Ġ. ", Ġ. ") ĠH F ĠH AR ĠH ay ĠH ai ĠH orse ĠH ORIZ ĠH CCJC ĠH wVal ĠRe c ĠRe ion ĠRe load ĠRe build ĠRe active ĠRe actions ĠRe cti ay o sub g sub directory sub category sub protocol sub elem Ġ{} / ml md lob bies np s np lt ][ { Ġsh it Ġsh ls sk it sk inning df j db config db lock db Name mit re LL ITE 88 34 88 84 88 66 88 76 ast rec output Folder lin ode image A image List ID UMP ID leta (( (' (( .*)\ Ġsc rap Ġsc rypt start X ree ce 09 08 09 84 09 89 84 32 84 05 84 84 84 37 84 76 84 666 ĠIn tr ĠIn format ĠIn Memory ĠIn dicate ĠIn secure ĠIn dust ION IQ own Posts Ġkey gen ant enna gs Eg bin i bin ario lock B lock Unlock Ġle AG Ġle aks ĠThe ir result ante Ġax sh Ġax array Ġpath To Ġpath lines Ġpo f Ġcom ic Ġsub elem Ġsub strates yn o 96 11 96 02 96 32 96 83 96 54 96 68 96 62 Ġac cu Ġac companies Ġac yclic Ġcomp ly Ġcomp laint ses sed ĠCon ference ĠCon nections ĠCon tractor Ġall Lines 55 99 55 07 94 32 94 15 94 66 94 76 94 79 94 68 Ġcur ation Ġcur ry Ġ} " DE BIAN json Conf Name Count node Count 87 06 87 62 no ff no access no logies Ġline color Ġline Amt AL M exp at exp Info exp loit CT EST CT AList Data Error Data List Data Model Data center Data Resource Data Mdt AS IA AS AsIn AS AsOut '. * 97 17 97 36 97 44 97 98 97 58 97 53 rid ership back cast back testing back Components back Clock net rc net conf ================ ========== 36 25 36 04 36 15 36 27 36 23 36 72 Ġspe ckle ron es =[ [" =[ {}, Ġopen mm Ġid v ĠK en ĠK as ĠK ir ĠK wargs ĠK napsack ĠK elvin ĠK DTree 95 85 95 66 95 83 95 106 word wrap lat t Ġit k Ġ'- '. Ġdist ant Ġimage process Ġimage Urls run pytest run Interaction 86 64 86 75 86 52 stra uss Ġmax Y Ġmax Series Ġmax numvalues Ġdate str fa e ################################ ###### process able Ġjson able Ġjson Data rit o AG ER AG AG .__ .__ 57 18 57 25 57 97 57 56 57 35 57 77 57 47 57 39 57 58 57 72 his wap Ġ[' { Ġ[' *. Par is Ġext ention Ġext entions create Test IS CV IS BN Ġtf l Res Names ix Y Ġper ceived Ġne opixel Text Utility List edColormap current Color CO ÃĽ man o man ila md n md ss Ġlo ot Ġlo uvain 66 93 AC ED AC CR AC AsIn AC AsOut Ġstart Point Ġmat urity 44 99 und ra ENT O ENT UATION AP T AP UREMENT Ġadd Dir Des igned Des erialize 75 45 new p new key new bin new addr cor related io ctl ait on ]: ] ]: ', Ġurl quote clo ak ef ul En dere En ronEmails auth time 11111111 11 28 395 Ġend facet Ex cept ET rade so i cal liope ther m ther lands 56 04 56 03 56 14 56 88 56 35 56 89 98 18 98 03 Ġpass code Ġsp ur Ġsp ine client es FI t FI PS FI RING local StringPath 38 144 my o my dir my font obj eto Ġmin l LO ST LO LW box lib Ġ(" _ Ġ(" <<< uc c Ac cident be v be es be haviour ĠOR ANGE ĠQ C ĠQ obj ĠQ Timer ĠQ CheckBox ĠQ CoreApplication img path img file PT M 35 12 35 18 35 27 ick ing ref pipe ref parsers Value M ern ions Ġus ando space ship File Util File LineCol AD OR ont rol Ar k save Name Ġtarget Delete tim g cre ases doc utils ',' '), stat ustext flow ims ĠSe a ĠSe arches nn f 45 09 45 83 77 84 77 79 PO I the tas Ġerror message ĠY I ĠY s Ġmay an ĠX r ĠX FP `` `` `` `\ Ġrow id Ġarg nums Ġbase uri Ġbase Url Ġbase Interval cc ertmgmt 47 15 47 03 47 08 47 45 47 21 47 62 csv s event Name core ml 101 0101 weight ings Str ong Ġgo v tf l tf js Ġpos Xf Ġload steps ash ape cy clo cy cling Set Shader Set Speed Set ModuleLogLevel Set Reslice Ġmethod name Ġreg ulation Ġreg ret Test Files Ġser a 83 14 83 08 83 55 Ġpd m Ġmain frame Ġag rees Ġag regar Ġver ifier Ch ol Ch ristmas >> ', Ġlin Dim UN LOCK UN umber UN STABLE qual name ĠIN V ĠIN SUR ĠIN FORMATION ĠIN COME 82 99 82 18 82 93 Ġar v Ġar ri Ġar ousal 46 24 46 28 46 35 46 79 ĠJ O ĠJ u ĠJ PG ĠJ accard ĠJ IRA Log it Num Py Num ero Num Resources Lo RaWAN 89 02 Ġ] ): ĠSt udio ĠSt ages ":" ' ld as open qa open pose assert That Ġread VariableOp ANT I ANT S Un ity pk mn The ory mask m Ġq config Ġq arr temp files tag id tag text sys Mgmt ĊĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠ To Re To ok To Pod To UserName To ServiceLinker To Newsletter To HorizontalPodAutoscaler ĠOption Menu ĠPy th ĠPy test CON J CON VERSION CON VERT DO ES Ob ser Ob stacle gener ative De form De liver ost ree Config Source Config Args 29 00 Ġval Row о е ell ations Ġdb ot Ġdb user 43 56 Ġ{" __ Ġsource pattern cl kpnt use less ĠPro t ĠPro be ĠPro files FF ATBW uid l ĠList ing INT O dep ot dep ending 000000 01000000 Ġnet cdf Ġnet vtx SI FY ug ly Ġsample sheet cu X page Info page Size down sampling 48 07 Ġimg RGB Ġimg aug EX CEEDED ĠData s ĠData Parallel ĠData Transformation err s 60 92 Ġ'. [ \\ ") Ġarray Y Ġarray SearchT rate map ĠAr bitrary ĠAr duino 42 98 Ġtemp im ])) ; msg box last Date Path Name left y project Path EL IMIT EL ANTRA Ġpri imek Model Driver е е ")) [ iss uper ï¼ Ĵ ï¼ ķï¼ server List Ġinst ancia kin o Get Member Get Shader Get ModuleLogLevel Get TransactionResponse Get TransactionRequest Get UniformLocation Get Conformer Node Set Node Attributes tx prepare ĊĊĊ ĠĠ Ġclient ReferenceInformation ble s Ġbreak point Message LogData Add Actor Add PodOptions Ġsave Checkpoint rand seed initialize Slider bar ra bl stm Ġass ure Ġass oc folder Path matrix file uni h build Dir Ġ& # Number Interrupt Number Formatting aw sc --- > Ġlast N Ġlast Node Ġchar m TO WER TO LERANCE Ġword Dict Ġword POSMap ik vision conv en conv entions ĊĊĉ ĠĠĠ mer chants Tra iling Column Name Ġframe works 79 02 Key points ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠ 74 64 74 550 tick width epoch time MO DER Ġ', ') mem cached ĠCo variance less on 73 56 Ġimp utation Ġimp rimir datetime s LI FT Ġnext s String Field String Exp ĊĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠ Com b Comp eti Bo y Bo ss ush are 0101 001 Ġshape d Ġshape lets ker ns ][' # over head tree pars Ġiniti alizations 58 11 58 01 58 08 State Enabled pr qA pr qR Ser viço OP US Out SamplerTransformer ĠTest ed ĠTest Interpolator Reg ist и Ñī ãĤ ħ Ġ.. ................................ ĠNo tion Ġbin ance âĢį ðŁį³ SS W ĠDe precated pen et sw f sw gith Ġproject Id CA UC spec tive 68 95 ĠRes ampling ĠRes istor Ġextra pol Ġextra Fields network D static Counter ãĥ ¯ ãĥ Ħ ãĥ Ł connect To Access Authorization Th ick pb txt Index ing Index Next ia a çļĦ åij¨æľŁ çļĦ ç»ĵæŀľ çļĦ æķ°éĩı çļĦ æIJľç´¢ çļĦ åıĸåĢ¼ Ġneed ing At trition Ġblock map 52 02 52 25 cell Value ĠUser Info ĠUser Register Of Trending ATE LLITE )[ \ ); ", Sh ar Sh Me Sh ane Sh ipping Ġcase xml Image Net fra ud IP Resolution ĠSo lo lip tic Ġtmp Ele 49 17 RES OL RES PON radi usr ÑĢ о ĠPath Manager DB Name Def in Info Type internal Values +' +)', Ġter mo SC V su curi ĠVersion Info ĠVersion Conflict abel ing Context Cache sim ulations sim CaloStage sim iliarity Ġ"" ; Ġorig Id 63 85 Ġoptim um CC GE Inter ceptor Ġgl Gen Ġgl GetUniformLocation IO Settings na iv ĠID isposable Not Available Not InListResponse Ġtask Json setup s Create APIView Create FieldDef Ġmy str Ġtri map Ġsim u Ġph id Ġph araoh Ġsa zm Ġgrid data font name Al liance execute TestCase gg gg Qu iz By e By Epoch ################################################################ # Client Fan mod Sec App lied App Directories :` < н ÑĥÑİ admin istration Ġoper acao Ġsu cesso Ġsu curi ĠCh assis ĠCh aitanya optim izations scal ers Ad vice Ad Kraus ven n ven ues inst a ĠAny thing resource Payload lack s ĠTh rift ĠTh umbs ':' -', Ġraw source For warded For warder track id ĠType Ref xbc x clean ers clean Description é c é lé des kew Sp onsor Sp awner cel and Ġmon ai .\ .\ .\ ,\ Ġedge db win Choice help Text best move sin a sin us vm Membership PR EST ĠMe chanic ĠMe ssaging ĠMe teosat xed v ĠDE VELO Ġact Id Ġge z Ġge ot Ġge odesic Pre cedence Ġpost processing web api ç ao VER Y VER SED Ġfin alized Sub st Sub resource xcf c xbe g Ġ$ ${ xce y sig term dm f LOG OUT ĠZ hu ram ı NO M ĠBase map ĠEn force ĠEn velope UP A non uniform non pulsars Ġì ° Ġì ¢ħ xdb v æľ Ĺ æľ Ŀ WS FP fin ale fin alized GB B GB E Ġinit ramfs global StringPath ã y Dis aster Dis cussion can on ons ors Tensor Group Tensor Dataset Ġdir Sep Run off Port Idx fill Poly He uristic Token Error Token Mapper Ġpack Name RL Bot Rule Block Rule Violation åħ ī any diag record Time loy d draw coastlines ending Line Ġ14 29 )\ . ĠRel u account Name áĥ ¨ sd card ĠCheck ed rel and ĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠ xcb c '} ' ĠApp lying Ġcustom ise Or bits ("-- > xad Z Ġsw elling dx s Ġvi able Pe aks Event Args Event Send Event Dur rad ores Item Found GI VEN ĠLe vit ĠConfig Error dest inations Ġstri ps Ġsend Message imp o imp rimir Line ages Ġmer gers Ġmer cury MS D MS K MS W MS UB MS RP "} }) Code Type Date Range ixel s cap able thread Id thread pool thread Mode Ref lected prob num CI HP cos at ĠCol ored oo ooo OUT P OUT BOUND Mat t Ġ") ", Ġlong itudinal Start Server MC U jnxMbgSgw S multi tenancy none x Ġmc HW Ġmc AccXFP counter factualInterfaceSlider Ġhandle textpad Ġsuper user Count down Count Equal single s vers i ĠNot FittedError ĠTime Distributed Ġgen otick ĠImport ed cla ws !! \ chain net cd hit Pri ces STR sIn STR sOut normal LaImages CD N All TestFiles Ġsm ith ming a Mo tif pub s On Fail auto start Sc raping Ġconn len Ġconn width distri b ĠEX PORT Ġconf ined Ġbl ending Ġtx To Ġmulti modal OK BLUE Be er Do xyfile ठĸ eras ing Resource Policy Oper SgaclMonitor Oper IpTrafficType Ġresource Payload PS O GG M GG TG xF CA xF CC xF DA xF CF Ġunique Id Ġaut odoc Ġaut htoken Ġaut onomous month day Ġcard ano Ext erior Ġrot ational End Token Dir Name FR AIS FR UNumber short cmd ĠNum erical SH UFF Ġreport Gen gre se convert or expected result ĠAt tempts HER O bn ac Ġhigh level >< !-- linear Gradient SO FT Min Group Min ima Min MaxScaler Ġconnect To rest ored ĠUp loader USER PROFILE mu da noti f :- < semantic web alo cean Loader Photo aut obot aut okernel Ġfun ny Ġfun ções 9999 994 fid Node Ġperson a EE A EE EE GN G Ġfra ccion Service APIClient Ġacc XFP screen cap istic ally ĠPre trained ĠSh ader ĠSh ipping '+ _ Ġcir ca Ġcir culo 125 000 Ġcomponent Name ĠPer ceptron bi quad Policy Enabled )]) / )} ( Ġfree form Var Nuc Ġaverage Current Ġaverage Power ĠAd obe LA I LA X Ġip Address Version ing vas prun ĠRE JECT ĠRE VEN ĠRE PUBLIC SP DX SP READ Ġspace d GEN CY sync Overlay expand er Ġassoci ations Ġcl ues TC MB TC APS Doc Warning Params InMsgName Op Type ads abs Ġseq Names 002 37 Ġday time Ġsignal ing stock name Ġarch ivos white grid }/ ", New ErrorType Ġauto mpl gu ity gu ava From Path From Getting From UserName PRE LOAD sym m sym table bus inesses л иж UU UU Control Group Control XInterface ï¸ı âĥ£ Ġæ ĭ ]- ( ]- . ]- [ SL T Ġprev Indirection ĠDis plays PY PI ĠQu iz ĠQu eries Ġthreshold ing Red istribution 123 123 123 145 Ġclose Friendly ĠOpen Therm ea e gal era mar rend mar athon IF REQ Ġ? ' Read L ulator y Ġbit movin most Recent Ġpr one Ġmonth TotalAmount Ġmonth UsedAmount Ġmonth AvailableAmount Ġmonth FrozenAmount Ġface ts CM W CM SSW fun ct âĢįâ ľĪï¸ı Ġlow ers With Constants pn as EG A Const s tasks json ĠDo Nothing joint Positions ĠEN DS ĠEN DC åľ Ł Mem Dict ĠAR RAY ĠField Role Ġgra fica Ġgra vitational Ġmp s Ġactive Width ا Ùĩ container Name Layer Element speci als Ġnb Depth uch i Open CV Ġcat kin Ġcalcul ar kit benchmark Ġwould n mid t ensure data ĠUpdate Operand :]) ] Ñĭ е Ġchain code Ġchain params Ġchain Menu learning Rate Ġ"{} _{}". Ġ'{} {: ³ółģ µółģ¿ ³ółģ ¯ółģ¿ ĠCO ST ĠCO VID One time One ToOne One EqualsFoo As sembler Mon o Local ity DD PG DD TCAPS Ġap scheduler Ġpower line look s look ForAccount 400 9 Pi Graph Bar ang ĠST UD hi j rf v rec N rec setTaxon hot fix DA a DIS CLAIM DIS PATCHED ÑĮ ого dig itizers Ġsegment or Page Size Page Template Batch KMeans }} }) }} $", ĠJSON Field Ġdes conto ORE QUEST 600 06 Ag EA private key )' > )' %( ']] ]: Seri alization 01011 000011 Ġ]) ), ĠClass ic ĠClass Group edit ar Ġп ап ĠSystem Label ĠSystem Folder ĠSystem Mask gene tic CV S Ne uro Ne utral Wh it Ġvol atile æł Ī ãĢĤ ', Sk etch ä¸į éľĢè¦ģ ä¸į çŁ¥ ah med Ġseg uint Ġcontract Duration aj Äħ zen desk Exp loit ĠFL ASK FE rrs ------ ') Ġengine ering cov timedist Connection Index Dec lare decor ate 401 3 icon bitmap rd chem Ġroom Exist sal mon Ġedit ar Ġbar u wav s çĽ ĸ dk n Ġplay book Ġplay ground Ġplay lists ĠClient AuthenticationError Order ing Sw armController answer ordinal break points Interface MIB ana fi Unit Cache ĠHe avy Account Add Ġretri ed ĠPO UR ĠDB API Ġtw os align er ĠAS SIGN Ġcross origin ati lities VALID ATE Ġreset ting Ġctsp OperSgacl Project ed Project parameters bad guys Match Error Ġnull context 103 07907 Ġpoly line vp ip Engine Hybrid Random Crop Random WindowTitle Random HorizontalFlip }_ ${ Location Query Piece wise under water Ġdot net AX ON pie Chart ï¼ļ ", Ġ00 8 History Operation wall s Ġfo x PRESS URE Delete View wi Äħ translate Y Sample d 00100 1111 Bl ending Bl ender tl ds Ġè ¨ Ġè ¶ TS LA Area Field æŃ » Ġpol ls Ġpol ynom analy zed Multi class ĠRandom ize ðŁĩ ¾ Vc Index Work ed vl un ctsp OperSgacl Ġ{}) [' My Service ĠLine width ĠLine String Ġ27 001 contin uity previous Batch WR F sl n CP B CP US Mapping Mode -------------- ") tan mu ĠState R ados Ocp {}/ {} ASK S Role Admin Ġdump ing Ġcos a amb ia amb assador walk To 915 6 RC J Ġsn ip BI GGER uck er PA STY Ġscan py Ġscan code Ġ"$ $", è¦ Ĩ Post code lec un ATT GTT ATT ENTUATION ¡ółģ ³ółģ¿ Ġ'" ': Fin ally [[ _ Transaction Type PARAM SET Tri ps 00101 0 Current Time pet sc åľ¨ æѤ dz ie CN V Sec RuleEngine Sec AuditEngine Real ESRGAN Arg Parser gri df Ġ[{ }, Dep ends Menu Bar push integer push nil Ġmd traj Scale X OEO Objects OEO WorkMode OEO CardObjects Stop Server Ġless er Ġpur ity Ġpur ify 906 6 032 7 combin er deg C lf ns pin code 905 6 sur prise sur rounding ĠService Perimeter Ġcondition ed CAR GO VM ICRO Sequence Model ãģ® ãģ§ Stack s Stack er ('< ', Ġground truth ĠInvalid RequestError ú b ú l ú de Cache Entry Cache ImageOptions Cache ImageMessage hd g ('[ ', ĠFind CC ü ç Ġ================================================================= ======== Ġ35 000 Prop ortion Prop agator ĠCan cer Ùħ ر ĠMock Ibis Initi ating DK ernel ä l calculate State calculate Trigonometric market operations bt cvae Ġba ÄŁ Unknown Types Flow s OUTPUT S ĠDataFrame s Password Form Container Tools Ġhyper geometric Ġswitch erLoc Ġband its ANS FORMATION qs f hyper pars âĶĮâĶĮâĶĮâĶĮ âĶĮâĶĮâĶĮ Cap ac Cap ability lar ı å®ļ ä¸Ģ个 dialog Text Rest oring DC G ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ čĊĠĠĠĠĠĠĠĠĠĠĠ small print WIT HOVER ĠSV O ("{ :-^ nick Name Ġmet res Sgt StorageType Sgt GenId 397 2 Debug ger Debug ModeEnabled Ġfiltered MapDict WA w FQ oF Sgacl Index LIN ETO unpack dir unpack PNF æ³ ¢ Ġsv ds ################################################################################ ## 403 6 403 9 Api Error Api Key 287 7 Ġdetermin ation Remove ImageMessage Ġĉ ĠĠĠĠĠĠĠ Ġpipe graph ki poi MR ML ador a Resp ond ĠØ µ Ġí ĥ FUN CTYPE å¹ ² Processing Pipeline ĠResource ExistsError CB ERS Ġfbx Manager Ġscra mble Ġscra mbled Opt Table #---------------------------------------------------------------- ---------- pay out Ġmultip oly п л п ол п п å± ı 422 7 ĠPi CN osm os Player Type Vec s Ġeq tk MI STRY ĠCHE MISTRY ĠThread ing Ġent halpy unknown Rate vd loc Member Forces ÙĪ ا VIS IBILITY VIS UAL Ġadj Enemy Ġ'[ +] chrom a æĭ ¥ Ġlab ware HB HE Lines Corpus Ġgive back virtual Write virtual HostUtilities Ġlex ical Ġlex ico Ġlex icons Ġur is åī ĬéĻ¤ Ġmar ine rh ino Ġbra intree Ġ96 00 Accept ance ĠChange log destroy ed åĢ¼ 为 Ġcy t CLIENT S 895 2584 Ġindi cies aux ili Font Properties ĠWork ed Ġten nis Kind BackupInfo HH H Pack ard ij ing 392 7 æµ ª ĠCH ANGES ĠDelete View boost ed 337 3 337 4 ÙĨ Ùĩ launch Job Seq Record ZZ Z Vertex Shader Summary Writer UV s ('# % ĠOver all Product Fields Ġrefresh ing Ġcri se Ġcri ado Ġcri spy Ġtransfer no Ġtransfer ring PLAY FIELD SW IFT High er High charts ðŁı´ółģ¬ółģ µółģ ภĻ spatial Corr feedback s 425 1 455 1 fish List Send TransactionResponse 955 7 è½ ´ Ġfrag One dhcp Server tun a peer power ${ :. ĠCar Park bro chure Ġhard en Ġtrigger ing COR DS ĠDisplay Name suc atalog Ġ; ) peg Price Ġgs util ĠGrid Size 以 å¤ĸ æ¬ ¢è¿İ âĢįâĿ¤ï¸ı âĢįðŁij© âĢįâĿ¤ï¸ı âĢįðŁij¨ uf z ĠJson LinesCorpus Lock ed ĠDictionary ToInclude çĶŁ åij½ Ve lo PROC ID repe al Acc Retrans оÑĢ од ĠRES ET Filename NodeMap CUR DIR ĠTemp oral mr kr Ġattack ers Ġsubnet s Ġcallable s patient Id Ġ-------------------------------- -- mel bourne 405 1 405 3 LIMIT S Inv itation MED IATE Ġrepro duction percentage m Timeout Exception Ġzo ho continue Routine inline formset æĬ ½ Ġgpu db '''' '' Weight ing 364 6 ĠConnection Line ãģ« ãģĻãĤĭ ãģ« ãģ¤ tor valds QUE EN Ġtail le æľ¬ 软件 åĬł åħ¥ +'. '+ Ġflu ctuation STRE T augment er Ġquat A Prefix es Prefix Operator Find ings Qq EQ Ġ95 0 ä½ľ æĪIJ ìŀ ij Ġproj etos Ġunknown s Ġpyg sti Tools Dialog pull MessageLogData Region MAPE Pub med Ġmix up Ġrg kmax \"> \ Cost ByEpoch SCRIPT CONTEXT Make Dirs Ġsky walking âĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢ âĶĢâĶĢâĶĢâĶĢ Pixel Shader Ġи г LINK ED cisco TrustSecPolicyMIB 请 æĮī yu an SEQU ENCER ĠMethod PropertyMeta Ġhar v å¥ ĩ ì§ ¸ Ġnav rep osa Wellbore ĠExp onential ĠExp iring Ste llar è res Ġrs old RR G Ġdeep chem ĠHome s SPE CT craft Text tEXt Comment ĠExec Comp ĠExec uting Login Window ĠCre ar ĠJob Application оÑĤ ели 466 8 Sq Arr Measure Duration AW G }$ '. ë¡ľ ê·¸ìĿ¸ Does ThrowsException DESC R gaussian Blur guild ID éĶ Ģ éĶ ģ aG h MULT IS çľ ģ Ġfew shot composition path ðŁı´ółģ¢ółģ ªółģ Stock UF sser vice chip C ĠKEY S Den ver Ġcd lib Ġarm ory WF h ĠLE DEmote Cir c ĠAccount Info Ġ################################ ### Ġ################################ ############# ĠSymbol Table Ġз аг 第 ä¸ī ,, , Band Num Ġcf lib Ġcf gs ĠSingle Mode BM ES Ti ers emit ters warp Affine live streams 058 000002 SUM O åįķ è¯į gov uk ðŁı´ółģ¡ółģ ¬ Ġmut ations ´ółĢ ¸ółģ¿ 001011 000101 Ġslope s Ġsock eye Ġprom otion ĠTechno logist Ġhope fully Ġsal ario Ġ################################################################ # Ġstuff s Ġjump scale GRAM MAR Ġmount ing Rec Base spo on sch d ãģĹ ãģªãģĦ èª ¤ ĠVe il wallet balancer Ġ================= == ĠFormat ting 8888 88 åħ³ 注 398 1 ĠåĪ łéĻ¤ ĠMer ged Ġmicro phone COM ING mic ron čĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ čĊĠĠĠĠĠĠĠ Ġdecrease d Ġchrom aticity Ġquad rant Hook Options }; ") Ġठ² ĠAB IDE Ġ » tele scope tele phone ĠCL DR rw ParamsInMsgName 475 1 ĠFire fighter 399 1 399 2 Ġappear ing Export ar ал из /{}/ '. don eness ĠCallback s ĠCallback Query VIE WER ju lian jet o Ñĸ д Gaussian Noise kU ql lw ir nw iz Ġtax i Ġcr str Ġcr é iden Service ĠConnect ing ĠConnect Handler Analy ser Ġswap ped Bul lets lexer Alt å®ŀ éªĮ reion ize ĠInstance ToInclude zc ash Ġbed leak å¼Ģ åIJ¯ NI RO brand Name Arch ives âĢįðŁĴ ¼ }% '. ĠPAR A TRANS POSE AAA AG Machine Learning Star Context rV Z BIT TAG Nv me Ġgzip ped Ġм еÑĤод ĠcdbpPeerStats DW liver esults Ġbroadcast Severity ĠAM QP Activation Function åı· çłģ Ġazure ml Pol ling Mass Hierarchy vtk MRML ä¸ī ä¸ĩ åĨħ åľ° ':{' $ ĠPlugin Error Ġactiv ator 计 æķ° visual ise ĠSur ge bor row secrets manager polygon Index TEXTURE CUBE +". "+ Hot Key guest agent nos y Ġoct ave Sql ite Ġib api Reset Error ãĤ¤ ãĥ³ãĥ datal abeling qi u ATTT TT activ ator Google ContainerTools brief Doc âĢįâĿ¤ï¸ıâĢįðŁĴĭ âĢįðŁij© âĢįâĿ¤ï¸ıâĢįðŁĴĭ âĢįðŁij¨ determin ant ocp ra ج Ùħ ":{ }," 316 24 ERN pH Ġdoctest s ĠTool box ĠLast File TestModel s TestModel ShuffleNetUnit ðŁı´ółģ«ółģ ²ółĢ 解 åĨ³ PERSON NE nT iles Ġmilli second 1166 14 Ġthink ing does nt winner Code Ġtv showtitle Ġhouse holds bazel build pct g Oz k ĠSan tos (?: (?: Qual values TMP DIR dN dmag ж еÑĢ Ġtl v è¿ĩ 滤 好 æ¼¢ åĥı ç´ł ìĸ ¸ altern atives OPEN ING pron o alarm net ĠCRE ATED Ġig vm Ġig ibson ĠCli pper Ġneuron spath arith m Ġcatch up ĠMET A ĠMET RICS ([^ / RK NR pat ents Course Title Literal Context ç³ ĸ Ġbas ins æīĭ åĬ¨ Ùģ ÛĮ ç² Ĵ Ġsit uations ĠFeed Forward Phase RadianInverter SAME ORIGIN incorrect ly die sel Ġstra va skin ned uẠ¡ uẠ£ Replace ContainerMessage ĠGra fana ĠPerform ing Sy nthetic YM id Ġ207 0 ĠLab oratories ĠCost s åıij å¸ĥ BLEND MODE FACE BOOK ĠPlace ment fed ora fed SDN Ġcad ast ĠAPP LICATION Az imuth OFFSET S Localized DateAndTime Ġtrip let ³ółĢ ·ółģ¿ ³ółĢ ¶ółģ¿ Ġwhitespace Count Ġperf kitbenchmark ÑĨи Ñİ Ao û Ġtell ing Ġamb ient ðŁı´ółģ§ółģ ¥ółģ æĮģ ä»ĵ FW D RAT ELIMIT Under Sampler Under lineNav Tele phone Ġpriv key èĬ Ļ 注 éĩĬ çİĭéĢ² æĽ° áĨ « ĠÑĥ дал thinningThingProducer A ÑĢÑĥ пп Ġenemy Y GRE ATER Ġcamp y Ġnest a Ġelf tools office Document Ġcaption s Ġisol ates Ġunexpected ly Ġcalib rations 天 ä¸ĭ Verify ing æ¶ ¦ cq lengine Tech nique Tech nology mscModVcs X mscModVcs Wins album artist Ġcour t Ġbrand s Ġ(* , ('.. ')) ĠInit Harvester Ġlem mas ìĸ´ ìŀĪ stral ian REPORT S Ġsatis fies áĥĶáĥij áĥIJ tir ar Ġutiliz ando ĠìĹ ´ áĥĺáĥ ¡ AO V ÐŁ оказаÑĤÑĮ shrink ed energ ylevels ĊĠĠĠĠĉ ĠĠĠ ĠInternal Error ĠPlan ets Ġexpk p ĠMA KE uploaded JarLocation ĠExit Status ĠctspDef ConfigIpv Ġcropped Vid ("__ ") ĠMi B ĠMi light LLLLLLLLLLLLLLLL L Ġcdf vals Ġrelat órios ĠFLO OD Ġautos klearn OAuth Handler birth day Ġko libri åĪ© 润 åŁº æľ¬ Orient ed sus picious sus pended Ġpert Size ĠPr in Ġvy f ĠParam Info ĠCOMP ON ç½ij 页 Ġdatatype s ctspDef ConfigIpv QI u SUR FACE Ġhid ing ='< -', COOK IES ĠQuantum Black å¼łæĺ¯ æ¸¯æ¾³ ĠDif ficulty distro less Notifications Group Ġxf p dee prec town halls ISS AGE Ka olinite éĵ ¶ ('~ '), ĠVari ation Ġscroll bar abcdef g Firewall Policy 001011110111101011 000 Ġ199 0 593 10 recur rence Attention Transformer è¯Ń è¨Ģ #------------------------------------------------------------------------------ # Ik Cube Land marks indi cies ĠCrypto dome Too Long ĠMemo History ĠAlign ed cep tive ĠDa uphin Ġextern ally ðŁij¨ âĢįðŁij¨ Mini Blocks Ġxt ype Ġ"** /*. Ġeast us ander er Ġstraight forward Ada ptor WG US ĠPas o ĠPas cal perio dicities Ġsubtract ing Ġaccurate ly ðŁij© âĢįðŁij© ðŁij© âĢįðŁij¨ ðŁij¨ðŁı» âĢįðŁij¨ðŁı» ðŁij¨ðŁı» âĢįðŁij©ðŁı» ðŁij¨ðŁı¼ âĢįðŁij¨ðŁı¼ ðŁij¨ðŁı¼ âĢįðŁij©ðŁı¼ ðŁij¨ðŁı½ âĢįðŁij¨ðŁı½ ðŁij¨ðŁı½ âĢįðŁij©ðŁı½ ðŁij¨ðŁı¾ âĢįðŁij¨ðŁı¾ ðŁij¨ðŁı¾ âĢįðŁij©ðŁı¾ ðŁij¨ðŁı¿ âĢįðŁij¨ðŁı¿ ðŁij¨ðŁı¿ âĢįðŁij©ðŁı¿ ðŁij©ðŁı» âĢįðŁij¨ðŁı» ðŁij©ðŁı» âĢįðŁij©ðŁı» ðŁij©ðŁı¼ âĢįðŁij¨ðŁı¼ ðŁij©ðŁı¼ âĢįðŁij©ðŁı¼ ðŁij©ðŁı½ âĢįðŁij¨ðŁı½ ðŁij©ðŁı½ âĢįðŁij©ðŁı½ ðŁij©ðŁı¾ âĢįðŁij¨ðŁı¾ ðŁij©ðŁı¾ âĢįðŁij©ðŁı¾ ðŁij©ðŁı¿ âĢįðŁij¨ðŁı¿ ðŁij©ðŁı¿ âĢįðŁij©ðŁı¿ +)\ . Native Tokens Ġ***** "); Ġmole cool Three Finger ĠWORK LOAD ĠÚ© ر Ġcontra cted ĠIgn ored PLAN E CROSS ORIGIN ĠSta y Ġnucle i satis fy Multip lier ĠÑĢ еж ðŁķ ´ ĠAuthentication Error ĠAssoci ation ĠSn ippet svn NetIf å°ĩ 士 Modules TestStruct ĠPrimary Threshold eig s mip lib won ing Ġ)( ...) ĠRMS D assertRoleAssignment NotInListResponse extrapol ating Organ ized Weather ForecastManager lE ol Ġmas ke ãģĵ ãĤĮ ðŁı´ółģ¡ółģºółģ ³ółģ 离 å¢Ļ ĠMQTT SN Java FunctionDescriptor ¶ółĢ ³ółģ¿ ¶ółĢ µółģ¿ ¶ółĢ ·ółģ¿ Ġads refpipe Look ing INITIAL IZE Follow ers rk arsten Pipe Error KM CO æ» ij Ġpan optes Ġpres igned Ġntw XFP Ġburn in travel times Cart Pole ĠHealth Check OEOHW WorkMode æ¯į åŃIJ ,,,, , Ġetsys NacApplianceMIB PLATFORM S ĠACC ESSE ĠMu ShMe Ġsynchron ized RAR sIn RAR sOut ĠAg ents ĠOPT S INF OREQUEST Ġ'$'],[' $', fli plr Ġà° ļ Ġrece ber Ġrece bido Ġmov Avg Logical ResourceId Operational SgaclName Operational SgaclGenId Ġ************************************************************************ ****** ĠSIG TERM è¿IJ æļ Ġgrow ing ĠAtom ic Reject AddTaskAdmin Reject AddTaskOwner Reject RemoveTaskAdmin Reject RemoveTaskOwner ĠMini BatchKMeans Ġл ай Integration Client ospf Nbr Ġingredients Json gens im mols ysmt Ġnex B Expect ations Tester Ontology âĢįâĿ¤ï¸ıâĢįðŁij¨ðŁı » âĢįâĿ¤ï¸ıâĢįðŁij¨ðŁı ¼ âĢįâĿ¤ï¸ıâĢįðŁij¨ðŁı ½ âĢįâĿ¤ï¸ıâĢįðŁij¨ðŁı ¾ âĢįâĿ¤ï¸ıâĢįðŁij¨ðŁı ¿ âĢįâĿ¤ï¸ıâĢįðŁij©ðŁı » âĢįâĿ¤ï¸ıâĢįðŁij©ðŁı ¼ âĢįâĿ¤ï¸ıâĢįðŁij©ðŁı ½ âĢįâĿ¤ï¸ıâĢįðŁij©ðŁı ¾ âĢįâĿ¤ï¸ıâĢįðŁij©ðŁı ¿ âĢįâĿ¤ï¸ıâĢįðŁĴĭâĢįðŁij¨ðŁı » âĢįâĿ¤ï¸ıâĢįðŁĴĭâĢįðŁij¨ðŁı ¼ âĢįâĿ¤ï¸ıâĢįðŁĴĭâĢįðŁij¨ðŁı ½ âĢįâĿ¤ï¸ıâĢįðŁĴĭâĢįðŁij¨ðŁı ¾ âĢįâĿ¤ï¸ıâĢįðŁĴĭâĢįðŁij¨ðŁı ¿ âĢįâĿ¤ï¸ıâĢįðŁĴĭâĢįðŁij©ðŁı » âĢįâĿ¤ï¸ıâĢįðŁĴĭâĢįðŁij©ðŁı ¼ âĢįâĿ¤ï¸ıâĢįðŁĴĭâĢįðŁij©ðŁı ½ âĢįâĿ¤ï¸ıâĢįðŁĴĭâĢįðŁij©ðŁı ¾ âĢįâĿ¤ï¸ıâĢįðŁĴĭâĢįðŁij©ðŁı ¿ gat ron Ġ******************************** **************** ĠfuniIf Tx ĠfuniIf Rx ĠTor rent ĠPod cast ĠLu is ĠOB SERV ĠEt L Ġtrap Host Updates Rule ĠciscoDiameterBasePMIB Local mE wm ç¶ ĵ informat ique Ġbaz el ĠDat en Ġextr uct Ign ored RH WSFP jam bs Ġgri lle Ġven ues Cool ers оп ÑĢоÑģ 123456789 012 MapperStatus LO Ġ"""< ? Ġparalle lize DECL AR ĠÐŁ олÑĥÑĩ arpInspect Filter åķĨ ä¸ļ depart ure ĠSy mantic paralle ls POLY AXON ĠarrayT MAPE ĠarrayT MAPEStd ì¹ ´ Ġcra zy ĠMul timedia Parsing TesterOntology ĠRegular ization èµĦ 产 Ġchromosome s 太åħ¬ éģĵ Ġton as Memo Activity ('-') [- å®ĺ æĸ¹ ĠæŃ ¥ ĠAssignment Stmt ĠRestri ct EXECUT OR yG Qy ĠME AN ĠUsu ario Shadow socksr Ġviol ation mobilenet v ĠWeighted Point 1118 80 ĠCla us SUPP LY ĠâĪ Ĵ 122817 1851 Ima ginary ece f Ġ'~ /. Ġdil ated Ġhang s ĠWik ibase 2693 59 monte carlo refentry info Alloc Empty Referenced ROINumber dub lin é© ¾çħ§ Ġpag ina ĠMAT LAB ĠOrient ed hospital Name Ġ'-') }") á»ĩ u Cf gs rob js Ġdiscri min CDOT AS \\\\\\\\ \\\\\\\\ ĠOPEN ING ðŁı´ółģ¤ółģº ółĢ Ej ercic sequ encia Ġble ach acceler ator Ġsucceed s Ġا ÙĪ ĠPdf Pages á»ĥ u ĠcpwVcPerf Current ĠSNMP v Impl ant jun os decess ors ĠuE vt ="[ %( ĠRequire ments Ġsplice d Ġservi co Ġservi ços å¤ĩ éĢī 師 çĪ¶ è§Ĩ åĽ¾ ש ×Ŀ Ġblo cos IpSw PermitPkts IpSw DropPkts IpSw MonitorPkts IpHw PermitPkts IpHw DropPkts IpHw MonitorPkts BTagMIST AGT mrstp Port mrstp Bridge ĠLex icon ĠinputFile Map CHARACT ERS Gar age SQU ARE bble s crl f Ġclon ing Ġovers ample Ġstim uli grav atar Serve Pref åħ· ä½ĵ Cop ied kal di Ġplas ma Ġæī§è¡Į æĢ» TAL K ĠCAP TCHA ĠFreq Dist ĠDan cing Electric ity âĸĪâĸĪâķĶâķIJâķIJ âķĿ TensorflowModelPerformance Example HORIZ ON æĤ £ Ġ**************************************************************** ********************************************** Ġyap f Confidence Builder Ġalgor and 9366 8952584 ĠExpl oration ĠJaco b uniq TypeList Registered Item ĠSTD IN ĠCHAR ACT standardi ze standardi zed PAG INATION Ġmé todo oln mpc toon base Ġhab its Ġleia Texto ĠSeg AOIcor SecAuditLog Type SecAuditLog RelevantStatus TrustSecPolicy MIBCompliance CUT OFF Ġaim Trigger binar ize binar izer ĠQGraphics Item Ġrespon ded electrode Width Ġlldb suite funcsynopsis info èIJ ½ Ġave GroundGHI geop andas Street Map maximal Expression ISSU ER âĢįðŁİ ¤ âĢįðŁİ ¨ âĢįðŁİ ĵ Reqsts Out ĠSearchQuery Set FirewallRule Invalid Lap lace Stick y fol k remo ver ĠfuniVcl Tx ĠfuniVcl Rx fif th Ġhexa decimal Ġkern ing achability Service Ġcvx py financial Data ह र ĠMODI FY nucle us Was Cancelled jen ga ',[ ]) xter ity ĠSus pend Ġgrand parent ="{} "/> pyqt graph ĠRecur so Ġquas ars ggi are Ġlocaliz ado åºĦ 客 ĠSpan ish ç®Ģ åįķ ìĭĿ ìľ¼ë¡ľ ĠSecAuditLog Type ĠSecAuditLog RelevantStatus Verification Plugin 身份 è¯ģ Hal os RAA sIn RAA sOut sul ci ç· ļ çĸ ij ĠåŁº åºķ Ġfle xbe adio Button ĠTrunc ate ĠSil va Ġencaps ulate ANNOT ATIONS Ġzh mcclient Ġtempl ating Spam Emails Ġtaint ed Ġcocoa Popup cPPPoEServer Auth 'ãĢ Ķ Bon us FREE IPA Unp ack hus band Ġespecific ar advent ofcode ='[ %( ĠMICRO PY ĠVan illa ĠNewCell Bend Ġapproxim ates thrott ling BTagMISTAG J BTagMISTAG JB <_|<_| <_|<_| PAC B overs ampling Ġ../../ _ Ġincor por Ġincor retamente Ġmeg ux Ġapparent ly Ġboiler plate coroutine function checklists id ĠDecre ase ĠDecre ment Ġê· ¸ ĠìĹ° ìĤ° DETECT ORS Scor ing Sweep Input Ġdum mies Ġhabit at Ġkar ak Ġpyth ia orden ar REMOV ETASK ĠPerp Market COMPAT IBLE Ġdatalake Source =-=-=-=-=-=-=-=- =-=- Ġbibli oteca ĠqsfpAcc TxPower ĠqsfpAcc RxPower ĠqsfpNtw TxPower ĠqsfpNtw RxPower ĠèĵĿ鲸 æĻº hann es nur sery éº ½ Ġà® ĩண getResult Details Ġlun gs ĠPOL Y ĠOCL Array ATR ANSFORMATION Ġpredecess ors âĶģ âĶ Filmografi a Ġ----------------------------------------------------------- # ĠTRAN SL ĠTRAN SACTION ĠклаÑģÑģ иÑĦ ĠвÑģе Ñħ dSpace Get hatch styles zhang xinx ĠÑħ оÑĤели assemb led ĠSNP s zervaci ja 订 éĺħ 对é½IJ å®ŀä½ĵ Annih il kub eflow kub ectl loser Code ĠSlow Query 1095 93668952584 movi elens ĠWs Context ĠHAND LERS Ġweigh s Ġneutr alized ĠDEP END FORWAR DER ĠXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX X Autom ated Ġdynamical time gkl sh logResource Method ĠMEN LO ĠElev ator phfqit K phfqit OK Ġcompos it ListComponentDef sRequest )*| .", )*| ...", GetBlock Response QueryUsers Request QueryGroups Request Realloc Options RenderTarget View Ġsatur ated BLOCKHEADERSWITHCHAINLOCK SREQUEST ListIssueTemplates Request Hflow CMB Stra ight xtra ctor âĢįðŁı « âĢįðŁı Ń å®½ 度 Ġmultiflow m еÑĢаÑĤ оÑĢ ÏĦε Ïģ ĠзапÑĢоÑģ а --·--· --·--· lographic Orbits ï½ŀï½ŀ ï½ŀï½ŀ Pend ReqstsOut ĠSpy der Ġglu u ĠPink y ASRs In ASRs Out ACRs In ACRs Out calcular Pos Sgacls Monitor TRUNC ATE GetEstimatedTransactionFee Response GetEstimatedTransactionFee Request âĢįðŁĶ § âĢįðŁĶ ¬ binaryObject FileName binaryObject FileTypeCode Ġì² ĺ리 âĢįâļ ĸï¸ı âĢįâļ ķï¸ı frontal face ĠâĤ¬ { deeplab v ĠDiagnostics State å±ħæ°ijæĿ¥å¾Ģ 大éĻĨ å±ħæ°ijæĿ¥å¾Ģ åĨħåľ° Ġrabbit mq Demon strate PAND ORA apart ments èĨ Ĭ ï©Ĥ çĦ¶ Ġwvl ns Ġhai ku ĠBIN ARY Compet ency Minimap Event å¾® ä¿¡ ModSec Rules recommend ations krbcred info entropi es Ġome gas Ġbsc Mtd ĠSPL IT Ġgol ang ĠFlu id ĠFSM Context ĠmcNtw XFP +"' !") ĠNearest Neighbors Ġsimpli fies ĠGeomCombination Set ĠÑĨ ен devi ance ĠTet ris ĠAnonymous User 00001011 0000100000011111 RECO GN ĠParti cipant ĠBoiler plate Corp oration IMPÃĶ T Deri ve Pype It atri bu Ġtropo sphere rystal lographicOrbits ĠAcceler ator Funcion DoesThrowsException Ġidempot ency ĠWEIGHT S åijĬèѦ ä¿¡æģ¯ '// *[@ *[\ '"] Domin ant gad gets kot lin wagta iladmin ïª ĵ utput file ĠTaxon omy pathItem StringPath Ġhik ari ĠPrune Source Ġspearman r Ġfiltr ation OLT IPS QUER IES *(.*? )| DRA WN Phen ols Ġâĺ Ĩ PROCED URE AbstractItem View RfcSdk BlobUrl áĥłáĥIJáĥ ĵ ä¾Ŀèµĸ 项 MetaInfoClass Member CNB TC Cru ise GLOW BL nac imiento æ© Ł getSegment HostName typeOf Level Ġstro kes ĠMime Type ĠQText Edit ĠQUE UE decry pter FRU Name BRUSH STYLE ĠèĢ ĥ hbW Ui Ġ×Ĵ ש×Ŀ cloudd rive WRRRRRW WRRRRRW Onnx Model bite opt zob rist åµ Į ĠLIC ENCE ifur c ĠWatson Response 举 ä¾ĭ Decompose AttentionTransformer Ġìļ Ķ MultivariateNormal Diag дел аÑĤÑĮ EMO JI Mfg ID gai error muti yama Ġodk azy ĠEMBED DED Ġana conda curContrast CH Ġwhites paces Ġlefto ver administr ative GETBLOCK REQUEST ĠOrd inal å°º 寸 16316 32546 Ġdiagon als Ġpromin ence TENSORFLOW MODEL MONSTERBEHAVIOR WITHOVER Dich roism Pai ement RAC MO slan ey xue qiu ĠÑĨи ÑĦ ĠcxC d getstatus output ĠTTF ont ĠCfg Node xbu fs ĠKT BW Ġ['* '] Ġæ² ¡æľī ĠĉčĊĉĉĉ ĠĠĠĠĠ Ġâģ ł slideset Cover RMSProp Optimizer Ġè¾¹ çķĮ ShotGun Vis Rasterizer State Ġescolh ida APPRENT ISSAGE =-- =-=-=-=-=-=-=-=- rekt anglet selecion ar Ġ#< == teising ai ĠMell on Ġroger that Ġpypk gen Ġ['\"]([^'\ "]*)['\"] ListGroup Item apiClass Overrides ToMany Field LIUB ert Ġexecu ção symbo lize Relativ izePath ðŁı´ółģ£ółģº ółĢ vanag ari Ġë°Ķ ê μÎŃ Î½Î± Ġíģ¬ë¡¤ ë§ģ IMMOBIL IZER 5323 1750 Ġtasty pie especi ally setC ascadingDictItem abolo id pree mpt ĠGIM PW 03462 10307907 ĠConn ectivity 862745 098 werk zeug âĢįðŁĮ ¾ Overhead Event ĠSubst For WEBS ITE ĠFIEL DS Ġत र ÐĹадаÑĩ а VSIF ReadL [\\/]. *', áĥIJáĥłáĥIJáĥ¡áĥ¬áĥĿ áĥłáĥIJáĥĵ MCObj ective ZENO DO sÉĻ hv sContainer Context xMid YMid Ĺ示 æķ° stilla vailable tipos refeicao tiemp o Ġfichi ers 00190 92480215476826 geck odriver amehame ha Ġmmd nn Ġ0105 10 illino is ppShaderResource Views ĠSIGH ASH ĠMec ab ĠMá quina Ġnphot ons labelRange Minimum Ġunip ipeline REMAIN ING ANNOUN CE ĠHwVal Label lockUnlock Display createTest Step LOLW AT Accident Marker ToPod Linker ToHorizontalPodAutoscaler Linker issuper set ï¼ķï¼ ĸ ĠTestInterpolator Load staticCounter factualInterfaceSlider AccessAuthorization Rule ClientFan Coolers AppDirectories Finder EventDur List ĠLevit ating FromGetting UserInfo ĠMockIbis Client çĶŁåij½ åij¨æľŁ LocalizedDateAndTime Data Ġperfkitbenchmark er Aoû t ĠÑĢеж им 离å¢Ļ è·Ŀ离 è¿IJæļ Ĺ示æķ° ĠåŁºåºķ æĹ¥ä»ĺ ĠèĵĿ鲸æĻº äºij ĠклаÑģÑģиÑĦ икаÑĨии zhangxinx in ĠbscMtd Core 1631632546 3142524 MONSTERBEHAVIORWITHOVER RIDES 0346210307907 3131 ! ")," # ...# $ ". % '}), ' /{ ' "\( ( :, ) "): * % * "): * .* * ,\ * )( * /* + // + /\ + )' , & , ": , ). , (( , [- , ...] - "* . # . ']) . ]] . >> . "): / ')) / "> 2 111 3 126 3 123 3 175 3 186 3 184 3 188 3 937 3 994 4 999 4 076 4 111 4 108 4 115 4 131 4 158 4 776 4 231 5 646 5 967 5 050 6 125 6 005 8 936 8 997 8 055 8 555 9 115 9 00000 9 125 9 123 9 888 9 105 9 104 9 197 9 187 : ! : ; : | : "). : .* : [] = : = ":" = ('-- > ), > "), > "): > """. > ()' > ()', ? ". @ " A le A rap A For A void A dicion A waitable B le B row B cc B TO B AY B ah B earing B loom B ndBox C ST C ust C old C nn C IL C ART C If C DS C ities C uda C aught C abin C andidat C ROWN D ra D os D Type D PP D GL D rag D VS E data E OR F ol F ine F est F ew F cs F ord F ID F ive F ED F lying F reqs F isher F ayette F AMILY G ib G ust G ating G ram G rn G love G pio H un H IN H art H num H olds H LS H JZ H uo H alloween J N J er J it J ose J upyter J uan J apanese K ings K lU K nowledge K ratos L pe L id L af L ava L JJ L isa L xW L edger M int M use M SS M VA M artin M RIO N PP N bins N zM N pv N XV N ÃŃvel N nut N ITUDE O id O il O go O MP O ME O STRE O lU O regon P OR P IT P ics P NO P br P MENT P rd P wr P aused P illow P lainText P inellas Q ar Q CK Q Widget Q Font Q MARK Q MainWindow R az R TF S ph S ANT S NE S ticker S ockets S pherical S ATELLITE T ue T em T SI T bl T MB T WE T une T weets T bulk T fidf T URES T weak T rotter U in U name U UM U CK U DS U Box V enti V AB V CL V TP V DR V CS V pn V Qq V ROT V ASP W ise W arn W ear W EL W MT W BC W LF W arehouse X SS Y test Y outube Z TA [ ? [ (( \ ") \ "}, ] =" ] '), ] >> ] ;\ ^ ~ _ ][ _ .__ _ (- ` _ a ul a set a ind a ide a exit a uri a Hh b ax b ai b fe b rows b bx b orn b FY b aud c sp c ure c ci c ft c lib c be c Reg c job c ida c andid c IF c akes c assandra c lasse c UMan c umprod d un d end d uplic d cb d wi d comb d HB d lopen d ani d arts e fi e ep e oc e jo e vs e hr e ligibility e bnfSuffix f log f ang f dir f ug f cmd f inesse g D g son g ated g ns g xy g é g ML g mock g maps g roupe h G h set h ans h mi h au h ns h UL h bar h vd h KJ h kM h lts h gnc i V i Sib j L j at j ure j ee j ason k O k ata k to k ang k ings k xy k ik k ana k ivy k ullan k Pkt l N l S l bx l Ä±ÅŁ l baas m ms m bo m format m enti m df m fa m ud m core m é m rs m dates m iles m Uy m unicipality m alleus m ÄĻżczyzna n de n ue n xt n ind n print n sa n class n count n nd n mi n feat n Test n ca n words n asc n ino n spot n anny n lopt o Q o R o Y o spath o Mod p S p len p Name p Data p Shader p cie p angolin p ssm q B q H q ing q tree q codes q rels r path r ango r arily r hyth r xfsm s S s li s set s xt s pp s ke s box s Table s bx t A t U t X t ss t pp t list t ance t user t mb t sa t ars t ink t ready t Total t bb t Destination t asmota t rotter u ir u fo u ay u eno u yu u wsgi u RJ v I v md v idx v box v é v á v dc v cn v Xr w B w I w L w V w X w ow w right w edge w ia w Op w unsch w aukee x I x ON x model x unit x vals x AE x iao y I y dim y true y pred y ork y dk y pher y Axis y asg z R z id z limit z lim z ava z illow | [^ } = } ''' } %( ¢ áĥĶáĥijáĥĺ § ä½ © åħĭ ² å®Ĺ Ä « Î ® Ï Ī Ð ¤ Õ ´ Õ ¶ â Ĵ æ ¿ è ° è ĵĿ í Ĩ í ĭ í ŀ ð § Ċ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ ue Ġ )). Ġ čĊĠ Ġ ()): Ġ ãĢĤ Ġ ï¼ļ Ġ utcnow Ġ åīį Ġ 请 Ġ ε Ġ å½ĵåīį Ġ 表示 Ġ âĸĪâĸĪâķĹ Ġ æľĢ大 Ġ é¦ĸ Ġ ultimate Ġ ÙĩاÛĮ ģ '), į ìĬ¤íĬ¸ ı è§Ī ĠĠ ĉ ĠĠĠ č ĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠ Ċ ĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĊĠĠĠĠĠĠĠ in cl in vol in band in jected in aci in Audio in vivo er ddap or ce or os or ario or ama or lose on l on de on sets on tap at he re x re tr re ff re ive re weight re ticle re straints se v se vir se ña Ġ= - st x st ew st ks st ren st ools st xo en ca Ġt ss Ġt ed Ġt date Ġt ft Ġt gs Ġt map Ġt utils Ġt run Ġt sec Ġt ads Ġt orsion Ġt endency Ġt ÃŃtulo ar bitrary al as al ib al liance de ci de als de limit de pression de tached de multiplex le ek le vs an id an tom an cing Ġi ap Ġi cat Ġi gb Ġi ota Ġi Zt -- # me lo Ġ' = Ġ' :: Ġ' (? ro filer ti la ti fi ti alize ti des ti sm mp d mp h mp v mp ar mp tion Ġc us Ġc ve Ġc file Ġc ts Ġc group Ġc bs Ġc height Ġc af Ġc sd Ġc rv Ġc rab Ġc ivis Ġc atapult Ġp save Ġp ian Ġp tu Ġp unto Ġp rtc Ġp resident Ġp ushes Ġp antalla Ġf ity Ġf df Ġf ref Ġf lower Ġf build Ġf paths Ġf ridge Ġf lour Ġf ides Ġf usel Ġf arthest Ġf sspec Ġ" {' Ġ" ------ Ġ" =", Ġ" ``` he lical he xbin ## : Ġa an Ġa ad Ġa po Ġa bl Ġa ges Ġa udience Ġa ims Ġa coustic lo te lo mer 00 77 00 49 ge fahr Ġn ss Ġn ad Ġn bs Ġn features Ġn gl Ġn blocks Ġn runs Ġn lls Ġs li Ġs ad Ġs data Ġs ld Ġs level Ġs ake Ġs gt Ġs quee Ġs AX Ġs helter Ġs TmpReg ut ers Ġin ew Ġin flux Ġin cons Ġin consistency Ġin Worksheet Ġre buf Ġre dash Ġre started self lessness self ishness ing ency Ġo j Ġo th Ġo ob Ġo tf Ġo gg Ġo cm Ġo zone Ġd F Ġd path Ġd year Ġd dec Ġd any Ġd theta Ġd ali Ġd asem ct d ct eur pe a pe are pe lican un ed un os un ich un struct un equal un wrap un flatten un related un pause Ġm ing Ġm sm Ġm cf Ġm colors Ġm lm Ġm vir Ġm ibr Ġm nfld ra ction ra ds ra isim Ġe ul Ġe str Ġe do Ġe mul Ġe eg Ġe poll Ġe cvl Ġe mso ---- | ---- ') ---- -\ () ": () }. () [::- fi ction ue d ent D ent ina ent reprise ad di ad vice ad ay ad opt ad joint ad mitted ad icion ", )) co ci co assembly co digo co ulomb ri en ri sh ri sing Ġthe matic Ġb ub Ġb idx Ġb ern Ġb ail Ġb ets Ġb mk Ġb kc Ġ1 111 Ġ# \ Ġ# --- ed own 11 30 11 58 11 69 um ie um bers int ensive id v id an id loc id ai Ġ( ", Ġ( .) Ġw g Ġw and Ġw pi Ġw gt Ġw ired Ġw iring ch im ch train ch own ch ancel ch uck ch urch ch aitanya di me di ch di ode di ente di mento ): - ): ]. Ġ[ ` Ġ[ :, ul n ul wich from Time Ġif config ot te Ġfor ks Ġfor ked Ġfor nec ol int el er el ink ': ([ ': '\ es r es ource es cript turn ed Ġ+ ----------------- is he is ius is coroutinefunction val is val obj __ % __ _\ name text name servers get source get parent get Key get Function get attribute get Default get children get fits get Contours get ctime one amente ('  (' == (' [' (' }\ )) > set list set Type set err set pts set trace set Fill set DefaultValue Ġ- \ Ġto u Ġto w Ġto me Ġto urn Ġto ko Ġto uca ĠT d ĠT ro ĠT ot ĠT ou ĠT RE ĠT SS ĠT ier ĠT URN ĠT SF ĠT reatment ĠT BD ĠT utorial xt d il an th ai th ank th rash str m con us con ci con servation Ġ2 72 Ġ2 160 (" ---- (" ########## (" '") (" ******************************************************** pp c as x as mx as aurus iz i et as arg str op f op in op ent Ġ{ {\ Ġ{ :,} Ġ7 10 Ġ7 18 Ġ7 89 ĠS ti ĠS AR ĠS SE ĠS pl ĠS IL ĠS AME ĠS ymb ĠS izes ĠS SIM ĠS CAN ĠS IX ĠS liding ĠS UNDAY ab un ab orted ab sence ab hishek Ġof s ĠC ape ĠC lang ĠC TA ĠC NOT ĠC VS ĠC lar ĠC hess ĠC TU ĠC ensus ĠC ascade ig UC ht ar up age ") ") Ġdef ender Ġg or Ġg log Ġg object Ġg ait Ġg rain Ġg rown Ġg yr Ġg ismo for es for seti ter ial Ġr cond Ġr tn Ġr anging Ġr hea Ġr undra Ġl ar Ġl la Ġl anel Ġl unch ": % data Path ĠA pe ĠA ri ĠA sc ĠA PT ĠA rt ĠA ven ĠA sm ĠA BI ĠA PK ĠA stro ĠA frica ĠA thena sp inner ult on '] < '] [:- '] ]]]: 01 28 01 21 Ġcon son Ġcon fs Ġcon serv ic at am bul to cs to ward to ordinal 99 88 99 76 99 54 99 59 par r ist ion ist ors ĠF n ĠF on ĠF an ĠF ired ĠF OTA ĠF ah ĠF SW ĠF rappe ĠF uzz ĠF OUR ĠF ides ĠF etches ĠF abric ĠF ugue od oo od hodnoLetalisce sc rit sc rolled log Verbose list Nodes om ol om nib value B value X Ġh ol Ġh ops Ġh acer ** \ all Songs po ser po cket ta ker ĠP Z ĠP layers ĠP late ĠP itch ĠP IE ĠP Cre ĠP MF ĠP vt ĠP LEASE ĠP anda ĠP uts ĠP eriodic ĠP rade ĠP acote Ġas g Ġas pects ĠI de ĠI an ĠI mplemented ĠI TER ĠI ContentType file Label file services ĠL G ĠL p ĠL IN ĠL ift ĠL EA ĠL INES ub u ub in res u tr TC Ġth er Ġth or =' /') Ġst c Ġst ance Ġst ft Ġst raw Ġst udi Ġde queue Ġde quantizer Ġde activated Ġde limiters pro fits 0000 06 0000 066 Ġ""" { form ated ex position ex pyfun ex pertise im resize Ġex pos Ġex cut Ġex pyfun able Doc fig i fig width Ġ3 29 Ġ3 62 10 32 10 89 Ġprint out Ġprint outs out patient out Audio ĠD N ĠD ar ĠD un ĠD om ĠD AS ĠD OT ĠD SM ĠD IG ĠD RC ĠD avis ac b ac fd ac tively Ġu ob Ġu dim Ġu cm ]) ([ ]) }") ]) +( Re ss Re master Re constructor Re lax Re moval app path app admin sh ir sh ark sh dfs sh ields Ġdata In Ġdata array Ġdata Base ĠM U ĠM p ĠM ens ĠM AD ĠM SS ĠM CC ĠM att ĠM xN time gm lab ama xf fy =" {}_ Ġv qa Ġv apor Ġv álida 02 17 02 38 02 39 02 49 ew are Ġ_ ), Ġy am Ġy title Ġy off Ġy offset Ġy outs Ġy yyy Ġy esterday ĠO x ĠO pu ĠO SC ĠO VS ĠO OI ds v ds db Ġpar ame Ġpar ul Ġx out Ġx sum Ġx List Ġx new Ġx title Ġx scale Ġx tick Ġx account Ġx agents Ġx ác os as os able Ġse cts Ġse mantics Ġma v Ġma sters Ġma xcbar que z test network test loader test opts test Parameterised add Pair add Items add Switch add Sphere Ċĉĉ ĊĊĉ ER VER Ġstr SN xe bu xb at xb ee ure g load file ore p ore gressive ms m ms r ms marco Ġ% \ Ġ% }{{ Ġme ls Ġme mb Ġme adowrun our i Ġpro tor Ġpro kka py o py utils py xel py parsing py Sat py tesseract py nguin py scrabble pre built pre cise pre mium ls of ap iv ap unov 07 56 07 46 07 59 xd fo label List ber ries ber ita ber noulli are t are lation "] ]: "] != "] }), ĠB read ĠB ars ĠB ME ĠB mag ĠB ench ĠB ird ĠB rightness ĠB PF ĠB ASIC 12 27 12 53 Ġname Space ys a ys la ĠE A ĠE F ĠE u ĠE pi ĠE mit ĠE fficiency ĠE quipe ĠE clipse ĠE lizabeth Ġj ira Ġj avi Ġj apan Ġj asht ci v ob lin ob bs ob ama ly rics text file text tt size L com ando ĠN it ĠN AT ĠN ord ĠN atom ĠN itro date Modified date picker ir radiance num Units Ġres olutions user Info Ġ4 84 Ġ4 27 Ġ4 57 Ġ4 44 Ġ4 98 Ġ4 73 Ġ4 58 Ġ4 78 ger r ff d Ġget Time Ġget Offset Ġget Topology 92 99 92 64 92 82 92 76 92 68 tp s tp air col lege In k In de In Text In creasing In Progress In grese ind re ĠR J ĠR uth ĠR az ĠR ocket ĠR ANK ĠR uby ĠR enders Ġun weighted Ġun even Ġun fortunately Ġun documented Ġun obtainium Ġun idecode Ġun touched read Unit read FList Ġtest step Ġlog book Ġlog likelihood 32 016 per name oc l oc n oc chio ph ony son ian // \ ĠG d ĠG y ĠG CS ĠG IST ĠG LY ĠG rouped ĠG PDF ĠG RPC ĠG allery ĠG ardens Ġco loc Ġco gent EN ANCE ĠW it ĠW as ĠW all ĠW AS ĠW ould ĠW FS ĠW hole ĠW rapping ĠW illiams ho f ho se ho ge ho yde loc alized loc idad Ġout df Ġout group Con crete Con solid bu z AR SE AR PHRD ĠV or ĠV out ĠV oid ĠU PG code book Ġnum b Ġnum Blocks Ġnum aras print v print ers param Map Ġ5 88 Ġ5 27 Ġ5 90 Ġ5 23 Ġ5 45 Ġ5 78 Ġ5 68 Ġhe brew Ġhe uristics mb is ). ''' Ġan nu Ġ__ _| Ġen closed Ġen rolled che strator min l min ify min heap min Phi Ġtime Series Ġ> ") 18 23 16 02 16 32 16 37 16 000 16 45 16 29 16 43 16 52 16 72 line Elts Ġk im Ġk ann Ġk pts Ġk vs Ġk ornia Ġcol Number Ġcol liding Ġcol lateral Ġro yalty St ops St uff Ġpy G Ġpy unit Ġpy bind Ġpy yaml Ġpy ansys Ġ6 10 Ġ6 84 Ġset points ag han ts lam ts inghua http bin 04 13 04 15 04 22 04 95 04 47 04 48 04 69 Ġmodel Name 13 86 13 48 13 79 og k og den lib png 06 01 06 99 06 85 06 56 06 39 06 54 06 1728 ign er ign ement 15 32 15 13 15 94 15 86 15 23 15 28 15 61 15 926535 SE CRE ST RO ST AFF 100 109100129 max Y ass word ass calar 05 99 05 08 05 37 05 77 05 65 Ġthis Layer 03 85 03 63 cs ystem cs graph we icloud Ġop ti Ġop func Ġop ções Ġch ol Ġch own Ġch ann ax le 17 34 17 23 17 49 93 11 93 15 93 44 93 58 lit erate lit erature 14 14 14 22 14 85 14 38 14 45 14 42 14 81 14 39 Ġpre ench Ġpre compute Ġpre ço Ġpre tend Ġpre senter uth or ord on Ġat s Ġat ts Ġat temps Ġat uais Ġby z 64 16 64 64 64 38 error Code base string ([ * info max LE Error LE AF LE MENTED Type ViewSet RE DU Ġtra itlets IC ER IC AT 08 13 08 22 pi xbufs Ġ\ { Ġ\ _\ ĠH B ĠH S ĠH ang ĠH cs ĠH AN ĠH err ĠH appy ĠRe bounds ĠRe moved ĠRe covery ĠRe gressor ay ush tain er sub a sub data sub part sub geometry sub cool sub reddits Ġ{} .\ Ġ{} ;\ Ġ{} /{}'. input Data np m mat ure mat ive Ġdi ary Ġdi ou Ġdi amond df d db ody mit er 88 00 88 99 88 31 eat o comp ared comp ilers comp teur comp laint comp rimento comp artments Ġ` !! 34 19 34 37 34 42 34 31 34 71 start file Ġwe ig ated SVD 09 12 09 32 09 05 09 44 09 77 09 48 09 74 09 58 84 14 84 45 ĠIn d write Object write Only ere f Ġkey value Ġkey phrase nd ash nd Array inter rog gs cond shape ly lock ing ak an state less Ġoutput dir Ġoutput Bands Ġpo z Ġpo vez Ġpo isoned Ġsub types Ġsub way Ġsub commands Ġsub problem Ġsub division Ġso cks vel la vel ation yn ch ception s AM QP AM atrix 96 18 96 95 96 26 96 35 96 76 96 53 Ġac ronym Ġcomp atability ĠCon tour Ġnew l Ġnew file Ġnew relic Ġall er Ġall ure Ġall Atoms Ġall Games 55 54 94 05 94 09 94 24 94 85 94 44 94 52 Ġcur y Ġcur dir Ġ} ;\ Ġ} }{% ĊĠĠĠĠ ĊĊĊ Ġapp run json b ()) }") ()) +"\ node js row Item av V av lov Ġno Of Ġno updated 87 16 87 66 no pe no el no server AL A AL AR fic ado fic ada Data Entry iv s Ġla do '. /{{{ 85 17 85 37 85 97 85 75 97 11 97 25 97 04 97 24 97 75 97 68 rid en mi k 36 01 36 22 36 26 36 98 36 89 36 21 36 31 Ġspe cular =[ (- Ġopen peerpower Ġid c Ġid ct ĠK n ĠK s ĠK line ĠK ay ĠK PI ĠK ingdom ĠK EK ĠK entucky Ġuser PrincipalsResponse 95 18 95 46 95 79 word Id word cloud lat ure lat lng view shed run as run env 86 96 Ġtorch blocks mon to Ġdo ors Ġdo colour fa iss fa ilo Ġz b Ġz igpy ################################ ####### rit ter Ġtrain set Ġtrain Array AG AIN 57 11 57 12 57 15 57 76 57 68 57 296 ... > ... """ Ġ8 09 Ġext ens Ġ| __/ create File create Curve "), ], ED Analyzer reg rid Res caling ix map Ġbo ots Ġbo ÅŁ Ġper pendicular layer branch Ġne on env New "," < List Nodes List AccessBindingsRequest List NetworkOptions current q current Start CO D Ġunder line man uel md ump Ġlo ses 66 97 66 82 AC M AC CAA AC QUIRE Ġte ss Ġte eth Ġli ved 44 86 44 98 44 82 44 51 Ċĉĉĉ ĠĠĠ cont ador ns st und ler IM GS Ġdis appeared Ġ** -- ENT ITIES ler k Ġadd ons Des cul Des erialization 75 00 75 67 new value new Size new sol Ġtext size Ġtext Output cor ed mail ings Ġrun ghc OT P Ġnode DataArray Ġnode pathString ef ault ']) + En ergies En lla En ggNumber auth key auth enticator Ex oSM ET RE ET AB ET EMPL Id Info var bin var Name fix ups 56 00 56 05 56 94 56 313 98 23 Ġsp index client JSON move it my key my profile my cloud Ġmin Y Ġmin es Ġmin lon Ġmin Length Ġmin cbar Ġmin dsdb pop item ĠUn lock ĠUn bound ĠUn structuredGrid Po or Po vez box ed box nind Ġ(" __ Me eting uc f Ac celer method name ĠOR ACLE ĠQ L ĠQ Point ĠQ Sql img url Ġcolor ing 35 02 35 92 35 32 35 14 35 64 35 84 35 95 35 23 35 38 35 39 Descri bing ud ad ref meta Value For File Map pri ma AD irectory save as tim izer Ġim array Ġim mutability Ġdf n ))) ), ',' %( stat ÃŃstica ĠSe maphore Ġad vent Ġad ler Ġad vection nn Buy nn Sell 45 03 45 39 ĠAN AL 77 778 zer oline cent rics item configure the on the ir the oretic ĠY Leaf act ually Ġrandom isation Ġrandom Timer ĠX ST ĠX PATH `` ): Ġrow Type Ġrow Id Ġrow span Ġarg Name Ġarg vs Ġbase url CH AP CH ALL cc b 47 01 47 93 47 85 47 91 47 49 47 41 ]] âĸĪâĸĪ ]] âĸĴ Ġcode base csv DataParser event ually 101 3 Str atified ĠEx cept las ificacion Ġpos x top ographic Ġ<= > cy pher poch s Status Dict Status Response Status Page Set Up Set Range Set Mapper Ġpython com Ġpython osc pl umber pl ataform IL SV cord ion Ġsk opt Ġreg ridding Test Client Test Gen Ġevent related IB AI Ġver os Ch I Ch ris du ff random ly random ness rop ical UN ITY gen proto 82 04 82 86 }) ? }) [ }) ]) order edDict Ġar ith Ġar abic 46 18 46 84 46 33 46 31 46 78 46 52 ĠJ as ĠJ ian ĠJ Tol 107 3 107 4 107 9 Log an Log File Log ged Log Events Lo Py raph s 89 096 options Count options Must DI ES Ġ] '%( 70 93 ld da ld ots open bins assert CountEqual Ġread thedocs Un register Ġq h Ġq mid Ġq radial temp ertureSensor tag idx tag ym TR X TR ACES sys admin ĊĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĊĠĠĠ UL ATIONS To Port ĠOption List ĠPy game ĠPy Mongo ĠPy duino ĠPy Unused ĠPy Protected Ġ''' # DO G DO CTEST De formation De coding De bit De vanagari Ġval e Ġval ign Time Range о Ñı ={ { 65 02 65 06 65 05 65 44 Ġdb l Ġdb conf Ġdb motif Ġdb PrivateKey MP CAPS 67 07 cat alyst 43 11 Ġsource code cl fs Ġup dat Ġup loads Ġup wards Ġcor ed ĠPro d ĠPro duce ĠPro ducer ĠPro cedure ĠPro tein Ġplot y uid a ĠList ener ins z ins ns ins ilico :: % :: ** Ġnet app Ġnet ns Ġnet miko SI P SI b ug ation cu encia ''' (? context pred 48 16 48 25 48 19 48 34 48 000 ðŁı´ółģ ¯ółģŃółģ sv l )* (- Parser States Ġimg List EX OD FA DE err ing red hat red undant Ġfirst Iteration No vember total Cells ze go \\ , mode lo mode la ãģ ¸ ãģ Ķ Ġtemp TileTab ])) ( ])) * ])) ): msg List last nm last TreeMap last rowid project euler Ġpri hodnoLetalisce Model Grid Ġprocess String Ġcontinue d ")) ; ")) ). ï¼ İ ï¼ ĺ ï¼ Ļ axis width ĠIS C server Port ĠÐ ķ post ure cli pper Ġback ing Ġback testing Ġback propagation Ġtag name Get Index Get Property Get PodOptions Node T Node File 76 07 xy yy 81 99 Ġbreak points Ġsum marizer 001 0000 Add PomeriumServiceAccountResponse Ġfa hrenheit bar a bar h Ġele s Ġed uc Ġlast Date erate ly Ġchar ms tmp LFN Ġtoken list TO C TO O TO UR TO COL ren w ik k Tra der Tra verse 1011 011 Key Version Ġauth z Vi a Ġoff ence cv ss 74 86 within Seq Ġobj nuv MO DS Ġtop most less ons 01111 10000 ]), [ 73 84 dis miss fit nesses datetime format String Value Object FileName Object FileTypeCode Comp te Comp ly Bo hr ush en ful ness adj list first nm Le o Le ague Le gis Class Type Ġiniti ation edge pred edge wall Ġsupp ose 58 13 58 05 58 27 fore ach fore points fore stry State Key State Effector pr sco pr erun Ser ving gr lex dist ilbert ĠTest Base Reg istrar и ÑĢ Ġ16 384 pol lo Ġbin val Ġbin om Ġbot x change list User List User Login 59 55 seq map seq vae pen n sw elling Ġproject Modules CA a CA aD spec gram 53 32 Trans ceiver static derived qui la ãĥ ĵ Ġav sc Access Preview Ġpage size Th readed Th rashed pb xproj Ġsession no Ġsession Id ia world çļĦ æīĢæľī çļĦ 缮å½ķ çļĦ æĿĥéĻIJ ĠPython CI PL Y PL ACEMENT pack a Ġblock fs fs l unit proba ĠUser Input Of File Of Line Of ManagementZone QU IET 62 87 Up loads ank i WAR RANT )[ ^ ÑĤ а ÑĤ еÑĢ Sh allow Sh arp Image Type Int ens lip ped lip ines disp on ÑĢ ÑĬ Ġmap box ĠPath Type ĠPath ControlXInterface header hash Def ensive Ġ". /" Loc ate +' & +' "' Ġter cei SC M su ff Ġsorted list Context Manager sim bert 202 00 202 102 Ġfi la stream handler CC VS Ġgl Vertex Ġgl Enable IO Loop na Test ĠID urnika Ġtask Id med it Create TableRequest Ġmy server prot olint Ġtri age Tx Byte Ġph iloc Ġsa mplers fla re API Error execute Hive Qu otient keep dim ĠFor ma Ġheight map fp ae dec sec Client Builder Client Power mod ulo ink ing medi awiki ('\ '{ Ġoper ação full monte Rx Byte has ATA has Next diff exp ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠ era de ĠCh rist ĠNOT FOUND ĠMed ic Ġshow Progress Ġshow Animate Ġmark ovi tex as ĠImage List ĠImage Result ĠImage Stream ven us Py C Py th Py torch inst ar inst apaper Ġmean var resource Type az ir ĠTh resh ĠTh ermal For Day Ġvis py äº ¦ pg y ĠDict Config ĠDict Mixin é du Sp inner Sp acer Sp irit cel lid directory ToUnzipTo Ġnon lin pair ing Ġinfo str Ġinfo max Ġclo ses Ġclo sely Ġedge Splitter æķ ij les ion FL UX bit rarily PR ICES PR EROUTING ĠMe aly Group Index Ġret Str Ġret SiteMap Ġret inanet active Interval ĠDE LETED ____ _| ee info Ġact ualizado DS R Ġpost proc web console ++ " ++ \ Ġfin ance Sub system Sub scribe side bars sql session af r ĠZ hone Ġparent dir ĠEn hanced Ġì ½Ķëĵľ Ġcfg v Ġcfg file django apps light on light year fin Pitch gb its GB Q GB T GB Regressor Ġans w stats d stats models hex sha Ġbest move Dis covered nb d nb its nb atches ]+ )') NE CTOR zip s Tensor Like tt c Ġcho colate ha el ha proxy xde y ĠFile Status ĠFile StatusType Port List grad x He ads ĠAdd New Return ing supp l åħ µ Ġ'% ', Ġkernel pkg price High price Low draw s Ġcomple ter Ġ13 37 Ġ14 30 summary Stats Te ff mount point áĥ ª Function Component sd n sd conv Ġlayer Values Ġlayer branch ĠCheck Box Ġpick er Per c Per Pr Or Update xad o eff c Ġsw ing Ġsw ener xcc L xcc f zero es ." }) Ġspec grams cm st á g á rias xcd F ĠLe ader ek f ek t ĠConfig Loader ĠComp ressed xab H imp ression Ġmer id Ġmer kle hand yman "} : Date Form Date Picker Load ers Load Library NA IL Array Slice sequence d æķ° ãĤĴ CI X ĠRun off storage services Ċĉĉĉĉĉ ĠĠ Ġerr code Ġerr Str Mat rices Ġweb pack Ġest amos ASS OCI BL IND BL ENDO ote ls multi process multi lined Ġmc d Ġmc python Ġmc Fan Ġsuper vision Ġsuper pmi Process CreateTime Process UserTime POST ROUTING long long ĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠ vers ary ĠPRO TOCOL sec comp ĠTime line Ġgen res ĠPo le xdc r STR INGS +" ', All Folder All UpdatesRule Box Width nan median Ġempty buttons Ġ"% { Ġsm ile cer tain dr f Ġkeep alive framework configuration Mo h Mo strar pub hits On un å® « seg mask Ġdisplay io custom user custom DataType Ro I Ro yalty ĠModel Config inf ob rb frame ĠHttp Error tk list Ġconf used Ġconf luent Ġservice List Ġinitial ising TP DT Ġwait Release ]], [ INFO S fail safe GL X GL double ठª ठµ ठľ Resource Requirements Ġresource Type GG CT GG TTT vol atilities Ġfolder Dict xF AD xF CB Is Local Is Authenticated OS PF tool sets Core Error Ext er Ext reme End Point FR Block short hand ĠNum ba Ġdraw Animate ĠAuth Token Ph rases gh env Ġcore clr GE E Valid ators Total Surface pdf Path tab lissement Ġdon ation SO A SO ME Min ute Min imo Min imizer čĊĠ čĊ Ġtr usec Server Proxy xs lt Char acters Di GS Ġve locidade Query Result Ip E Ip VK Ġfun coes ĠAl phabet ĠAl though ĠAl catel 9999 99999 Ġsin h fici encies hour ss hist Img Source Args volume High volume Low Ġfra ctal member configuration Ġcap a Ġcap fd component Name Graph Name Graph JSON ĠPre c ĠPre sent ĠPre ference ĠSh utdown pa res Ġfast mvsnet Search Strategy ĠPer m bi jectors ä¸Ģ ä¸ĭ ä¸Ģ äºĽ ä¸Ģ èĪ¬ download ing exc ited exc iton ĠPlot ter )} ] )} }, =% - Ġthese Keys Down Button Row Panel bb d ĠFunction Transformer LA W atom y initial State Ġip f clear Events MB h Ġclean ly MIN IMAP ÃŃ san ĠRE Q ĠRE PEAT ĠRE POSITORY Cal houn Ġpas cal Ġë ² AND ROID Device Id Device Info Device Label VENT ORY car toon CR F support al ĠSer vi START PTS Ġpop n IZ ERS Stream Reader Stream Proc OB SERV Ġmod ular Ġmod ulation Ġ"+ ": Ġradi an Op V moved im )') ; after noon stock Code }/ ') Ġtick font New Type Ġvideo Name Ġauto complete ĠTrans fo gu in gu arded From Port Update Form desc s sym CoinGame Ġ'# ', bus queda Binary Op ĠLO CK Ġdiff opts UU GG CONT INUOUS Control ContainerMessage just e Ġæ Ļ 004 18 Ġrel ates ĠSub Resource ĠSub graphTypes boot style liter ation Ġ19 80 åº « sn akes MT F ĠOpen PN ĠOpen AIGPT parameter Name gal actic mar ine ĠRed uced tw ine tw alk Ġforce CTAList Ġum ap Classifier Name agg type 500 03 Ġbit string abi en mass ist akes peare ĠInter section fun nel pkg config With DeliLine NB q Bu ck ĠTensor RT dash boards DU INO Default Router Ġpossible Comment ó dico ı ÄŁ ĠDo ppler åį Ĺ ĠEN SO Mem Setup miss iles wb c Back ward Sa o ĠField List ĠField DataType ĠField RowPanel orn os SET AVATAR simple Type Ver key gl ut gl Bind gl fw Ġmp math ------------------------------------------------ -------- Ġdev type Ġdev ito éĩ İ ĠRequest Error ĠRequest State PH C PH I PH OT wrap ERC ĠIMP LEMENTED Ġcat enets 个 好 cid as Ġho liday Ġ"{} \ Ġ'{} : ³ółģ ¤ółģ¿ MAN Y MAN DATORY ]} ] NS W eve tech BR ID BR AND BR ICK ============ ') safe TransferFrom OPT IMAL DD DD world map Ġap ós charge Region Top o look ahead Ġexc itations Ġaccept orPos ĠST L ĠST AND ĠST ORE ĠST ORED rec tilinear è® ® Grid History Grid MixIn LS R inv itro same As flo p ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ COMP ILE Page Number TRI G TRI ANGLE }} { ĠJSON Parser Ġdes ispec hello world FORMAT TER ada delta ################################################ ####### )' ", PC F Ġflow m sy nt HTTP Status HTTP Provider First ArraySlice ĠLight GBM Ġclear ance ĠClass room ĠText Blob ĠDi jkstra Ġп ожал erm ite itter gefahr 010000 1111 Instance Error Ġvol untário ĠCallable Registry ĠCallable ParamRegistry Ġ(_ | UC F UC i ãĢĤ \ ä¸į åı¯ ah sin ĠSH APE \" % ĠNe il esc uelas ĠSE PARATOR power set Series Type mol leweide Ġque m wiki quote Ġenter prises æī ¿ æī ¹éĩı Ġep hem Ġbbox A icon Size Author ized Ġdig s switch erLoc ĠRo y bul ges sal ario Parameter Key att end sentence piece Vis cL Vis cUMan star map star red ĠDec rypt Ġsen list Ġterm generator Sele cione ĠBE ER ĠBE FORE Ġsaved ir ĠRead Resp Ġdepend ant ino tify rum b REG ULAR break ing Unit test TOKEN MAPPING Ġtw ill Ġgt mcore ĠAS R Ġcross ref ĠValid ates ĠSQL Context ĠSQL STATE ati ally ĠMake file VAR ARG Ġhidden W tu u ĠAD MM nc ml Ńółģ ¯ółģ¿ equ ity Ġpoly a ĠDark net ĠNet App serial Number Ġturn on Ġdot dict PN P Ġsq r Ġsq norm ĠTra cer ĠTra versal ï¼ļ { tel le ĠDevice Exception Mock AccessPreview clusters pec Ġprogress ive Ġnx os wi ener gi co MD k Val uation 为 å¿ħ Ġpol Phi Sign ificant iso dic yl vania Multi LineString square XPos square YPos Work ers ctsp OperSgaclMapping My Admin ĠOf ficial BA KE RA STER bc g archive Dir condition er Ġvo x Ġfreq ghz Ġinsert width orph ans ~~~~~~~~~~~~~~~~ ~~~~~~~~ ĠToken ize Ġsn model Ġsn ail Ġsn appy ĠMulti cast organ ize emp loyment Admin Status PA nn PA LETT Ġna pts Producer KF Ġmatching Symbols è¦ ĸ Ġtab tran Ġtab ela Ġpkg Name Ġpla ser Scalar Type Ġanaly tic MIT TED Ġcomplex es ¡ółģ £ółģ¿ Url Format Float Opt Float Slider hub System ĠAs semble PARAM ETRE Tri ggers variance s Ġpp in Current Status pet name åľ¨ 家 Script Compositions uk i solution Path Ġcompare path partition ed ĠMax NLocator Ġmag enta ëĭ ī Ġsyn aptic Nodes Data 132 2 Stop Iteration Ġusage s Ġregex es Ġless ons Ġgrad cam Ġlight bus geo coders execution Time åĩº ä¾Ĩ Ġsol vable 032 3 Ġsy loga Bot Chat Ġfe ers INTER IOR Ġred mapper lf w Header File ĠService Error squ ar squ idpy æĪIJ 交 ĠMin uit Ġir regular AK ER ĠParameter Error ĠParameter Key micro python ĠMO VED bre ath ("[ % ú s ú y specific Matrix ('[ % Ġprior ities fb ank sci av har ry Ab undance ĠCur ses NET S Ġ================================================================= ================================================ Ġmac OS retri able Ùħ ت ç¬ ij Ġtemperature float Ġ"[ ", Ġ"[ ": proj Tr Reference Args primary field GPU db PK L flu ids gc D ä¼ ´ dw Flags Style JSON ĠBe i LR P comb obox Print Msg Ġbad guy £ółģ ¡ółģ¿ special attack SUB TRACT pot ted Ġpretrained models ĠBl ank NT PT NT ASKS Ġwhite point Ġaddr R ('.') [: Cor re Cor relations Cor porate xFF B ĠSP M Import ant Pr D Pr ince Ġnu clear ĠTimestamp s ĠInt ro Debug Point half prod half Span еÑĢ ж Ġrelation al ĠTEST ED WA VE Ġ"* /*", Ġden omin åĪĨ ä»ĺ ftp server ĠCustom s ĠMet ropolis APP END Ġquestion naire ðŁı´ółģŃółģ ºółģ Ġaz im Ġaz lmb éĹ ľ 964 4 Ġ---------------- ------------- ĠPost ing ĠPost Form ################################################################################ # ################################################################################ #### ################################################################################ ######### Metadata Value ÑģÑĤ в Ġann data Ġв ид Ġв ÑĢемÑı Remove NodeOptions Remove ContainerOptions ĠBlock s MR i [] ' Ġocc asionally hold out Ġí ijľ Ġí ı¬ å¹ ¾ Build Context Ġregular ized Ġregular izers 375 08 ĠEntity Type ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ čĊĠĠĠĠĠĠĠĠĠĠĠ Ġorgan isms ĠSU FFIX ĠConv olve 406 2 406 7 Dialog ue Pair wise nf log Ġ------------------------------------------------ ------ Card Type Card Num Ġmultip lies SK VS SK ILL Ġproto s Embed ded Ġdiag nosis Modi fying п олÑĥÑĩ Ġwave forms Player Info REF INE OD Y Ġspecial String Hello Req Hello Resp åij Ī ìĿ´ ì§Ģ Ġent ers Ġserial ise Ġbi quad Ġaddition ally å¸ Ŀ ÙĪ ÙĦ ÙĪ Ù¹ 903 7 Constant ModN AU DI Ġ'[ { ĊĊĊĊĊĊĊĊ ĊĊĊ ĠSign Up Split s notify Global PD w ĠQue ens cher ry Ġcy linder Ġcy clic cnn lstm qV Qq ĠWork shop 395 3 Empty PairLocList mal formed ан а RUN S RUN PATH м ен æµ ıè§Ī Ġdr zave 897 5 Amount In Amount Out ÙĨ Ú© ĠVer bosity aggreg ates vr w ĠRO Is ĠValidation Exception LF y 对 äºİ ĠHO ME ('# ', Ġatt ns å¦ ¨ Ġ*** " ãĥ¼ ãĤ¯ Vlan Mode ìĦ ¤ ðŁı´ółģ¬ółģ © ĠPort folios 386 7 prog Bar Ġ65 27 LOCAL ID MK B MK TG Word Sn Cons ult Cons istency El se Send Message ĠMap ped Cla ims war ranty ĠSci Py apis erver CONTRO LS arrow Width COR RECTION suc cesses Ġstar fish ]; [ 以 ä¸ĭ Wait For æ¬ ² Ġoccur ing sun light LIB S Ġ85 0 Ġsoft fab weather map PROC ESSED 408 2 DJ Z Func Expr fire Claim fire Zap aud Rate pv Controller wire map ĠAction Type ĠShow PlatformHardware ĠDire ctories Ġbind Transform ĠпÑĢ а ĠпÑĢ оÑģÑĤ Ġ-------------------------------- ------- 405 8 hu iming ÑĨ а CG TT MED V Metric Summary Metric StatusDict Ġ[{' $ 355 5 355 7 Ġang ry Ġfire bird Ġanchor Origin MF n Timeout Expired approx imate 407 3 ĠContext ual Ġcs graph ADD ON ("_ "): Library Version ĠCall Back customer care perf tests lem matizer Prefix Digit Ġamp el æİ¥ æĶ¶ Adam W 357 4 ìŀ Ħ ĠLOG IN ĠSELECT ED Ġaugment er Ġ################ ### REPL ICATE ĠSchema Parser Ġд оÑģÑĤ fbx Skin coco a ('{ { +') ' Cent ro ìĹ ° WC x Ġ([ ], regression s ĠAddress A ĠLinear SegmentedColormap ĠSUB MISSION Inte grate æ³ķ 人 /? $", ĠSelect Field )? ( ĠCY AN Ġcorre lacion toc sc 077 20 ðŁı´ółģ£ółģ § LINK FLAGS Ġ"," [ 请 éĩįæĸ° 409 1 ĠMac Address åĽŀ è°ĥ alloc ators Ġgd spy Colour space éĽ £ éĽ Ħ ĠEmail s ĠInst agram Equ ity Equ iv Ste ep è n Big Bang RR P ita ire ('" % ĠHome page cached property SPE CS craft ed must Comply ĠExec utable Move ment ongs ide ĠCre ative 466 9 432 3 áĦ ħ Ġsens ible ograph s Ans atz Diff use LM DB Security System AUT OM ел ÑĮ ел еж ìł Ī ìł IJ 938 27 ĠProduct Type æ° ı ðŁı´ółģ¢ółģ ¢ ĠAut onomous Threshold Length ĠAns wers ĠFin der Geometry Shader oct ave quat Mad ĠLE ARN NP p ĠTarget s ÑĢаР±Ð¾ÑĤ æľĢ æĸ° æľĢ åIJİ æľĢ ç»Ī Ġ################################ ########### Ġз наÑĩ Bit te jump er jump scale ¯ółģ ²ółģ¿ ĠLevel s wr k ĠGaffer Image heap ify Ġdesign ate warp ing ¨ółģ ¡ółģ¿ Ġsudo ers ĠPool ing 058 16 uclide Result Details Response ت ا ĠBasic Auth ðŁı´ółģ¡ółģ Ńółģ GAT TT Ġmut ex Na Cl ĠAccess Control FB rowser sco ping Ġprom oted mJ i Ġrcl Factors Remote Jw hm ann Ġsal aris ед ел additional Properties ctr ine curl ine Ġpeak Value íķĺ ê³ł aro on Ġ================= ========= Ġsun set ĠFormat ted Ġ#---------------------------------------------------------------- ---------- dead be ĠSa ver æŁ¥ æī¾ 434 3 Ġpb k Ġquad mesh Ġquad radiusr Hook Name Hook Ex Ġsuppress ing CAN NOT Ġ « ĠNon linear ĠGeneric FormSet Ġsay i 475 4 QR adioButton ĠCONFIG UR likelihood s Master Metadata bas al ĠÑĤ ÑĢ bal sa Section Error ал и care home pC ryptor Ġbug gy ĠHand shake CW DM How ard Ġ115 200 Ñĸ Ñı Ġ[% ] door way ĠBox Layout capture bat KER N ĠHE OS +) $', ãģ§ ãģ¯ Ġke el refer ent $$$$ $$ zc z ometri cal hal ted Speci alized Zero DivisionError Ġpay er ô me }% , ĠCent OS ĠFast a éĺ ¶ PATCH ES AAA AT artifact Id Bus ca Oct ober åĵ ²å®Ĺ Ġau ctions Ġcommunic ator dD r Ġol du elt UMan scroll bar ĠPower Output ='# ') 设 å¤ĩ VARI ANCE åŁ · Ġcid rs Ġbroadcast ing flex ible ('* ' ======= ") Endpoint Address Dummy RecBase Green let Mass Flux ä¸ī åĢĭ ä¸ī åĽĽ ä¸ī ç®ĩ Async Client Ġttk bootstrap Ġsup ress Ġaccounts Trx paper ai White Mode ĠFramework Version ĠFramework Configuration Ġlot tery Ġiss uing ĠEqu ity Ġ74 97 Pur due fP n Ġsem ver Ġsem Rows Ġsem Cols fan Art Fbx LayerElement Qa D Qa hat Qa DT Ġgp flow Short Name Parent heses Ġima gename ĠWait er Quanti dade xD y г о Ġil k quick start ĠMIN IMUM datal ab Ġ-------------------------------------------------------------------------------- - QCA QC Ġalter ing éĻIJ å®ļ áĥIJáĥ Ļ Ġix network âĸĴ [[ Ġnc bi Ġnc ands Ġconver tion Ġlibs alt ĠOptim al Echo Cancel Ġspread sheets ĠCopy ing ĠMatch er Es se omb ie ìľ ¨ Ġtok val ĠRot ary ĠRelease Level Ġ`{ { ðŁı´ółģ«ółģ ° ä¿Ŀ è¯ģ æĿ¥ èĩª Cri me Gas Meter Ġmilli meters Ġfood item bib tex bib lio vil no Ġ× IJ æ¯ı ä¸Ģ个 Ġ}} ')) 356 9 Ġmoment o ĠOct ets ĠOct ober Qual ified Ġusd Geom ĠSTAT S Gra sp Ġheart beep ĠComplex Type Gw Name Ġèİ·åıĸ å½ĵåīį Cancel ResponseWrapper Nav Object Payload Record Primary Vertices åįģ ä¸ĩ Plan o Rq N Ġfault y LogLevel s /_ / ÏĦ ικ ("* " ĠRange s Shared Cooldown ĠAC COUNT Cookie Jar Geo coder Sequential DoublyRobust sta inger Ġatualiz adas Ùģ ت Ġsit ename Ġappe ared ĠFri end Confirm AddTaskAdmin Confirm AddTaskOwner Confirm RemoveTaskAdmin Confirm RemoveTaskOwner еÑģ Ñı åºĶ çĶ¨ Fx link award ing uáº Ń Dev Tiers foot ball Har vest Har vard ο ι ridd le Ġnecess idades Ġ'^ ': ĠGR N strand Over ValueType Context Est ablish ĠLiteral Parser ĠQU OT FM eltUMan Ġ02 111 ĠMask ing DST ENCIL ĠSte phen Clip To Dif fs Mal tego ĠNV DA 000000001 000000001 Performance WP Performance PayloadRecord YEAR S xAB A Ġamb assador ĠVol unteer ĠVol untário ĠVol unteers Under stand stellar mass Ġautom ation ółĢ²ółĢ ¹ółģ¿ âķļ âĸĪâĸĪâĸĪâĸĪ ðŁı´ółģ¬ółģ¶ ółĢ± ìĬ¤ íģ¬ }| {:^ ĠSGACL s Gre aterThan Ġvl ss ĠBound aries ãĤ¿ ãĤ° sit uation éħįç½® ä¿¡æģ¯ çŃī äºİ 492 1 osg GA Ġspectral Index KK K Ġtdk lib Rn R Ġbla de Fast a ĠOrigin ally ĠGPS O Room s sear chels Design ated ðŁı´ółģ¥ółģ ´ółģ Em ulate Em ulator Ġdri ll adaptive Threshold Ġlem mat åħ¶ ä¸Ń ĠENV IRONMENT smb client è³ Ĭ umber land Expand ing Expand WordSn ĠNormal ised Ġsb plt Ġosc illation ĠTurn s ĠKernel Density BOUND ING Ġdas hed Ġ((( _ ":{" $ Ġprox mox ĠBay ramı Behavior Item mop ool attri butions Ġbm ds LOGG ED north western WI K ĠMag Meter Ġstartup info 1011011011 0000000000000 å¼ķ çĶ¨ ç¾ Ĭ Ġdn stwister forge eks 4444 44 Ġft sel Ġsus ceptible lift sim lift Over ("__ "): ĠMi xture на Ñı Anim ated Ġannual Demand GCELL HO dyn spec fault y chro tron ĠAct uating Ġmeth ylation auction Period BTC USDT ë³ Ħ åĪ© çĶ¨ ĠDoes n Matching Parameter Matching Engine RMS D fre ertos Ġkingdom s Chrome Options ç½ij æł¼ catch ing Ïģ α Ø´ Ùħ ('| ')[ ĠFactor s LOSS ES SUR G zu lip Ġmaintain s ĠRight HoppableLocList OPS IS jU a èĻ İ ĠDif ference ĠInstrument s ĠOrgan ism EAR LY Ġ1234 567 Hero Positions Ġbor is ĠSSH Client Ġgeop otential 绣 ä¸Ģ allo ff Ġpal indrome Ġpal pite Ġpix loc Ġegg RotBBox Ġwest PartCoords Ġrw Factory FileSystem Finder Ġelimin ating izz es audi obook ĠLeft HoppableLocList Tot als è°ĥ è¯ķ Ġsom ar ĠFo ot tsk id Chat Id Vehicle API С ÑĤаÑĤ ĠÙħ ا Ġaw spfx ĠAlex Net LEAR N GetStatus Request 636 17368 Wire less Ġbk user Gr anted Ġeast PartCoords broad com Resid uals UNIC ORN ä¹Ł å°±æĺ¯ µółĢ µółģ¿ µółĢ ·ółģ¿ µółĢ ¹ółģ¿ ìĺ ģ ĠScan Code spar ser ĠPas co Ġmach inery gro k ĠBri an copyfile obj ]+) $', ajax Flag ĠWORK ING ĠDynOv Exp ACCA AA è¯į æ±ĩ Imm utable Ġcone ct ĠAnn Data ĠDist roMapping ĠDist ilBert Ġtriple ts Ġnucle us COLOUR S Frozen Set Sales APIClient blo cos Ġincre ments ĠAG ENTS ĠDele tes ĠMal formed æĺİ æĹ¥ SOCIAL ACCOUNT BadRequest Exception Ġ#---------------- - appear ances ĠVeri fied Ops Key eig val ĠоÑĤ веÑĤ Ġsfp TransCode Ġskeleton Obj consu mes ĠìĦ ± Organ isation Maps Dir Maps DictList åľĨ å½¢ å¼¹ æĢ§ alex a meme temps INV ITE Ġknee angle ĠHandler Type CIP HER ĠSyn chron ĠdeÄŁ iÅŁkenin EXPI RES EXPI RY ам и replicate Dict ("," ))) Xa vier wat son wat che etsys NacApplianceMIB ĠSelf Describing Sleep ing Ġslide Index ĠBer keley ICON DA ĠObtain s ĠShort cut Unique Constraint mist une ÑĬ нÑĪ Ġfoot print ãĥķãĤ £ Ir regular voting policy adult s poss um ĠRecipe Maintainer Identi fy Share holdings овеÑĢ Ñıем CLOUD WATCH ç¡® å®ļ ì² ľ Ġsam cli Ġvac uum Excel File ãģı ãģł Launch er ZH ONE xcode proj ×Ķ ×¢ getNode Config Ġadverti se these Keys 容 éĩı çķ¶ æĻĤ æĴ Ń varx ravel pkt log quantization Step Budget Amount Ġot ter ĠæĹ ł å±± 寨 ĠìĿ´ ìļ© æ°´æŀª ä½įç½® Ġcrystal lographic ë° ¥ ĠâĸĴ âĸij Ġmg mt Ġru amel scar let æī¾ ä¸įåĪ° cis intern Ġpear ll Ġsor u ĠRay theon ĠGP US 7483 648 Mes senger Ġfed learner Cool er ãĥ¡ ãĥĥ instanti ated Ber noulli Jwt Header Ġdomin ant Ġbq skit Ġrsi ValueArrs Ġconvex ity Managed Objects busy box è¾¹ çļĦ Ġhamming Distance ĠLABEL S Tf Idf xform Op Ġcrow ding ("=") + paralle lize LETT ERS BAN Q PDB s Ġion izing Ġcra shed ĠInser ter SCR ATCH Dri ving Rich ard sie ge ĠdJ db ĠdJ dW ĠGrad Cam Then Average ĠLinked In ĠTrust Sec ASC RIPT 详 ç»Ĩ Ġëį°ìĿ´íĦ° 를 ĠWeighted SequentialDoublyRobust Clay more YC LE ĠLand sat ĠChunk Matcher OPTIM A ĠвÑĭ вод Heading WithDeliLine Rock s Vin List reco il hemer is ĠCamp o ĠAu fgabe ĠAu stralian Ġdeleg ated comput ers çĶµ æ±ł 请æ±Ĥ çļĦ gpio zero Ïī ÏĦεÏģ ì¤ Ģ Contrast ive Ġpyle us 1415 926535 å¤ī æıĽ MONTH S kel vin ĠÑį лем titan ic ĠPatch Collection ĠrlHistoryControl Entry rang ler ĠÑĢаР±Ð¾ÑĤ sequ encing Ġremo vido Ġbil inear etun ed Ġhou ston ĠGre mlin иÑģÑĤ и åıį éĩįåĬĽ Spatial Reference ðŁı´ółģ«ółģ¥ ółĢ ,?,? ,?,? ðŁı´ółģªółģ° ółĢ #-------------------------------- ------------- Hop Site Ġclu mp Ġcros sed ALIGN MENT ĠIDXGI Output HubPort Device éŁ³ ä¹IJ Ġber noulli Ġlim ite ĠAlert s ĠíĮ ¨ âĸĪâĸĪâĸĪâĸĪâĸĪâĸĪâĸĪ âķij ++++++++++++++++++++++++++++++++ ++++++++++++++++++++++++++++++++ pon zi Ġproble ma Combat HeroPositions ủ a ủ y Ġplays ound ĠEquation Extractor Nor ESM ĠLike lihood lugg able ĠWidget s Ġkn ob Ġoccure nt 移 åĬ¨ Cpp FunctionDescriptor Tel net \- ]* Ġreci eved ĠAstr onomy Ġstim ulus presen ter ĠVul can Ġdiver gent regress ors ĠExist enceError çĶ± äºİ PERCENT ILE ĠPostgreSQL Storage Ven ue Ġpunct uations ĠMEM BERS Ġrollo uts Ġdivid ends pops Tol åħ³éĶ® çĤ¹ ãģķãĤĮ ãģ¦ ãģķãĤĮ ãģŁ Ġcandle stick Ġstretch ing ENO ENT ĠADMIN S SYMB OLS ĠPriority Queue Ġimbalance d Emb arked jud ger jud ged Ðĺ з ĠTran script ĠFC ST Ġvt reat 0312 100 Compat ible Ġcircum stances æŃĮ æĽ² ctspIf SgtMapping REGISTER ED (... ): Ġر Ûģ ĠNF LOG Ġtransmit ting EMD py åħ± æľī Ġviv otools ĠQuaternion Class Exponential MovingAverage ãĥķãĤ¡ãĤ¤ãĥ« ãĤĴ Suc ceeded mens aje Ġlif elines ĠSPAR SIFY igmp Filtering ĠLen T ĠLAT ENCY KeyValue Entry Ġsufficient ly govern ance ĠPypeIt Error ĠPypeIt MetaData '[\ '"\( geop lot ("** {}** tox ic ĠIll inois ĠLuc as Ġstrat um ISSU ETEMPL denorm alize ĠdocsLoadBalBasicRule Dis Ġprojek ti Ġprojek ty BCE Loss æļ Ĥ diss olve assayed file ĠHu go ĠRep lica Ġgrace ful Signing Key åijĮ èİĬ客 Mount Point Transp arent bish op Ġari adne ĠÛģ ÛĴ ĠCp G ĠCp wVc ĠDIM M Ġenumer ations Ġterrain Tile ĠLearn er TFRecord Writer رÙĪ ابط Retri ever Retri eved Ġdenorm alize Ġsteel py Ger many ð¦ ŀ Ġmil lis ĠCE FBrowser emer gency ListPomeriumSession sResponse offers B Determin es BILL ING ип иÑģ ĠBuilt In Declaration Node Cel sius CAD ENZA CUD NN jian renw sif ter èĹ Ŀ Ġslo upce Ġreconnect ing advent ure Ġstitch ing outflow ed ĠMidi Out ĠsegmentText Split Spell ing Ġ구 íĺĦ CURR ENCY discreti zation Restricted Transfer DUP LEX Hier arquia Shel ve harm less Ġnue vo raid Disk ĠENABLE D metter e gss api Ïĩ ε ì°¨ ìĽIJ ĠRis cv ĠVoting Policy ĠHL SSignalingData COMPAT IBILITY Ambient Volume ĠдÑĢÑĥз ей Ipt c ĠCandidate Info ĠBre ast ĠGar age ĠGar cia nego ti routerVrrp Status Fblas Order Coun ters Easy SNMP Kan po èħ ° stitch er chol B Ġanc illary COOL ERS Evalu ates Ġдан нÑĭе Ġзаказ а Gran ularity aus pex Ġtort oise Ġpileup read Ġpileup column igs list ĠPla intext emiss ive ĠglBind Texture Ġadminist radores Ġ"'{}' ". DeployStatus Options ĠAugment ation ĠDiagnostic Status éĬĢ åŃIJ Ġktó rzy Ijo i Mpk M blu zelle Õ¥ ÖĢ Ġapy hgnc ĠAff ine Ġcondense d produ cible Ġyan it ĠElev ation indust ries wwww wwww ListComponentDef sResponse ĠcvcConf Controller ĠProte ct ĠIDXG IS ĠìĪ ľ QueryUsers Response QueryGroups Response Ġæ£Ģ æµĭ Ġíħ ĮìĬ¤íĬ¸ Payments Percentage ListIssueTemplates Response mstpXst Port gig abytes gSfp Table gSfp Entry rch line zion ale ξ ÏīÏĦεÏģ Ġance stry ĠIsol ation ĠEfficient Net ĠGD AL ĠConf lict ListProjects Response ListProjects Request calo Stage ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠ GetUserInfo Request ImageFile Names RunAndWait Message RunAndWait Options gtgt gtgt spectro graphs concaten ated ĠShip ments åĩł 个 Digital InOut HYPER LEDGER SceneDescription Array mush room ìħ ĺ Ġ'> =' ĠPoker RuleViolation Ġdesp ite Ġraz ão Ġexter ne ĠProc Man Ġbinar ize пÑĢав ÑĸлÑĮ THRESHOL DS "[\ .\,\ frees ound frees urfer nand uri anymal C Ġppt x Ġnob ody Ġconcern ed obah n featur izer Leet Code Minimap DebugPoint Structured Grid Ġsurvi ve ĠSerialize Or ĠeggBB Ang dvid env treen umbers alphab etical proven ance ĠGran de ãĤ½ ãĥ¼ãĤ¹ ĠSimulated OpuDevice QosCW min QosCW max Incremental CompileOperation MIME Text wux iaworld Ġnume xpr Ġecon omic ĠTok ens ĠTransp arent ĠSPECI FIC ĠCID R scre ens ĠBED T EXPRESS ION ãģ«å¤ī æĽ´ severe Cases Jon athan Rap idity Sit uation nfe v vend ored çij ŀ geon ames ĠCMS Plugin colpm Dec ĠRecogn izer RESTRICT ED Spin Box 010000111 00000000000 Ġcaract ere ноÑģÑĤ ÑĮ å§ĵ åIJį mstp Gen BulkUpdate Failed Law rence æ¦ Ĥ Ġnur sery romag netic victory orlose Ġthous ands Ġdew point ĠBento Service tmpArray T Discreti zation Ġrespons ibility åIJĥ äºĨ imaget agger ĠDeclar ation Booked Serializer ĠSecondary Threshold ĠACTIV ITY è³ĩæĸĻ 庫 BENCH MARK canti le ìĪ ľ isub scriptions Ġhun ts Ġstret ches Ġdeepp avlov Ġjds ub ĠNAS A priet ary OPA QUE ĠMotif Finder Ġvolt tron hybridi zation Ġwaterimg Res REPLACEMENT S #================================================================================ ============ Hou ston TFL ITE Õ¸ ÖĤ Ġodhod noLetalisce Ġester ni chao xing ĠSMT BFRange ĠPROM PT ĠBOO LEAN Ġkits une ĠHEM ATO Ġservic enow ĠgroupSync Read ESTIM ATED ContextSupport Object StreamBank P PERSIST ENT PHYS ICAL ĠctspAuthorizationSgaclFail Notif lcq mc ĠMathemat ica EPG Refresh ĠOperate Code بÛĮ رÙĪ ãĤ¿ãĤ¤ ãĥł ĠfltStmtArb Value PFPupp iJ WAG TAIL wish list Ġretail Price Ġdjang ocms unfiltered MapsDictList Ġwsg iref ĠAer onauti ĠHTT Mock Ġlasa gna ĠKol mogorov Ġgew ittergefahr Workload IdentityPoolProvider ĠíĴĢë§ģ ê³Ħ층 Ġfragmentation Dictionary Ġacknowled gment Mirrored Strategy ĠMultinomial NB Ativ idades Mich igan QTable WidgetItem UVC et clas sed vmlin uz Ġfrees lots lizz ard getaddr info ĠShel ly ']]] ]): ĠMKL Matrix pymd ownx Weibull LT Ġ리 ìĬ¤íĬ¸ ĠDisp ersion ĠDecisionTree Regressor gira ffe Shaft Element AEG IS JNI Env Melt MassFlux fdi pest vut br èij£ å°ĩ士 encry pter opense arch ĠkIR G ðŁı´ółģ·ółģ ³ółģ ProcessKernel Time TaskExecution Spec ĠëģĿ ëĤĺ SUC CEEDED ç»ĺ åĪ¶ åľĸ çīĩ ĠCOOK IE Ġmuut tu particleFlow Cluster äºĮåıī æłij æĶ¯ä»ĺ å®Ŀ ReallocResource Message printFuncTest HeadingWithDeliLine DPC MPCAPS PUN CT idun nam oplas my ĠisFirst Pass Ġrue da ĠAlig ner CONFI GS FormField Invalid éļĤ 縣 ADAPT IVE ĠCRIT ICAL è£ħ饰 åĻ¨ ĠMultivariateGaussian Distribution Craw ford oBu ono stda uthor itert uples geeks forgeeks ppoc amp ĠCame mbert ĠDY NAM ĠNul lify Competi tie Ġphid ias ãģ«ãģ¤ ãģĦãģ¦ MULTIS AMPLE vtkMRML Markups ç²Ĵ 度 *[\'"] ('+_ ĠèĢĥ åı¤ ĠOrdinal Encoder Arap aho Muse Alg OSTRE E Pwr Down kPkt log §ä½ ©åħĭ stren ght Ġigb hvr Ġfides ops Ġfusel age Ġsquee zed chancel or Ġ+----------------- +-------------------+ Ġrundra matiq Ġlanel ines ĠFah renheit ĠFides OpsKey logVerbose File omnib us ĠPrade sh Remaster Procedure Ġprotor pc Ġjavi fy Ġjasht me createFile Symbol envNew Acronym ListNodes Options Descul pe ValueFor Factors ADirectory Error ILSV RC optionsMust Understand Ġqradial gradient ĠPyUnused Local ĠPyProtected Member EXOD US withinSeq Val ĠPythonCI LEError executeHive Query Ġmarkovi fy PerPr Alrm ĠOpenPN M SETAVATAR RESPONSE ViscL Man MockAccessPreview Finding Ġazlmb r полÑĥÑĩ аем RemoteJw ks DSTENCIL CAPS PerformanceWP Record ExpandWordSn ippets ĠSelfDescribing Json Shareholdings Of ãģıãģł ãģķãģĦ ×Ķ×¢ ר ĠWeightedSequentialDoublyRobust Estimator ĠÑįлем енÑĤ ξÏīÏĦεÏģ ικ ĠPokerRuleViolation Exception "[\.\,\ ?\ ĠAeronauti cs " & " _{ " âĿĮ # ( # ': $ ) $ '. % ']") ' >>> ' ྠ( ..., ) [:: * { + )) + """ + ].[ , ], , '), , '. , }', - & - [ - {} - '): - .', - ]+)/ - ].[ . ? . | . )\ . )** . "]/ / ": / "), / \\ 0 997 0 935 3 174 3 145 3 647 3 997 3 189 3 938 4 033 4 025 4 022 4 117 4 116 4 857 4 144 4 185 4 121 4 184 4 335 4 924 4 865 4 777 4 648 5 867 5 878 6 127 6 015 7 147 7 077 8 004 8 266 9 014 9 018 : + : {}/{}". < { = ',' = (". > ]) > ). > ',' > (\ > '). ? ")) @ $\ A ver A IME A wards A unt A gency A ffiliation B un B AC B ash B lower B SS B ee B MAP B anned B aba B oston B raz C ate C ow C ord C row C ors C xx C raft C rawler C RLF D om D UR D iss D uty D uplex E ar E om E mo E ok E cc E tc E Is E CHE E gamma E rase E Wrapper E uro E jected E ulerian E psg E ligibility E ESG F am F lower F CE F fs F é F rank F Loop F UK F gw F rac F XC F ederation F urniture F LIP F LossAlarm G on G row G reg G ps G PI G ren G RANT G cm G HOST G hg G rowth H se H ge H is H end H od H all H OR H AY H mass H CV H abit H molar H ierarchical I EC I RECT I ENCY J IS J ane J IRA J INJA K ur K om K im K IN K DF K CSS L SE L ING L INT L PORT L VAR L orentz M it M ens M art M ys M é M tu M ysql M ARCH M ounts M HD M UTE M cD M IPS M ountain M LIR N ation N types N EX N DS N GS N MT N rec N Rate N cases N bW N VIDIANetV O utils O Dict O GI P id P ul P list P ho P List P ng P ins P mt P END P CD P rf P sy P unctuation P PIP P erturbation Q fp Q qV Q ComboBox R ol R os R ip R Co R ide R CA R dr R PM R ATES R ides R entalData S la S ul S IC S eat S iv S RGB S FD S phinx S cheduling T ang T min T pos T AM T ld T SS T abs T EM T Loop T ftp T NR T DY T APS T UNE T ILES T ruck T LossAlarm T UPLE U int U CA U GG U gk V OR V Sg V IZ V PN V BA V RS V qs V ADD V éri W ard W ERS W HETHER W hole W raps W Vl W EDGE X tr X EN X code X OT X scale X AY X mas Y h Y TC Y uk Y HB Y ields Y oung Y CbCr Z AP Z illa Z MQ Z nZ [ ${ \ % ] """ ] "), ] ']) ] ``. ] ")[ ^ % _ + _ )): _ `. ` """ ` .') a ist a oc a string a List a verb a ee a CP a ð a Genes a esthetics b de b res b dir b ts b ass b mm b TA b els b rowsers c ine c app c np c box c uc c python c uid c PH c OH c ancellation c linical d re d list d ly d é d alpha d Check d cf e map e eprom f al f mp f ce f ct f ot f cs f row f parser f pc f On f spath f ridge f prop f bf f ü f Fx g up g ow g ac g tp g max g ium g lr g nome h F h S h get h ab h ag h rt h mt h je h ork h inds h ru h hi h del h MJ h urst i Col i oth i hash i js i ques j D j F j um j ub j ans j step j ars j kl j hh j NZ j apanese j azz j andro k D k R k ent k args k ib k ong k oth k aw k Hx l A l ame l line l pi l eri l vol l UC l probs l argo l ır l bfgs m co m ta m out m cu n te n lay n In n File n No n coder n proc n Connection n rotation n arrow n Bits n Creating n ZW n Actions n partitions n qubit n aked n Exiting n ifti n hwc n ominate o P o on o es o dict o attr p score p String p fs p vs p Device p lastic p ssh p awn p aie p ifu q C q at r L r value r start r ale r FI r limit r dtype r br r relu r pipe r uta r ulers s A s J s di s dir s ump s ou s ures s var s ids s LC s mac s bi s stable t file t valid t df t ANT t non t bd t Wr t umor u C u ac u alized u dic u dia u ada u los u ý v Q v ort v od v tr v ine v ann v bar v bd w text w mo w ok w sg w lan w addr w ired w rd w rn w Pg x er x res x out x ks x mask x Label x sec x forms x ima x BC x anim x OJ y D y U y q y me y um y res y ap y ll y fix y title y Max z D z ar z set z ale z ahl { [ { {\ { ((- | ( | < | > } ',' } =\ } !") } $$ } ),( } """) } `) } ://{ ¤ íĬ¸ ¦ ×ķ× ¦ éĻ¤ ª Ķ ª åķı ® áĥĶáĥij ³ å®ļ · ółĢ²ółģ¿ ¸ ĥ ¼ êµ Ã ļ Å º Å ij Æ Ĩ Æ IJ Î ł Õ ½ÕŃÕ¡Õ¬ × Ľ ã ij ã ¸ĥ è Ĵ è ĸ è ĺ ë ħ ë ¯¸ ì ´ ì Ľ ï ¹ ĉ Ċĉĉĉ Ċ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ċ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ ã Ġ ******** Ġ era Ġ čĊčĊĠĠĠĠĠĠĠ Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ ÛĮ Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ čĊĉĉĉĉĉĉ Ġ ед Ġ uber Ġ Äį Ġ æĸ¹æ³ķ Ġ 999999 Ġ è¿Ļ个 Ġ ç±»åŀĭ Ġ ÅĽ Ġ ÑĢав Ġ é»ĺ认 Ġ åIJĦ Ġ íķĺëĬĶ Ġ ä¹° Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ ãĦ Ġ âĸĪâĸĪâĸĴ Ġ é¼łæłĩ Ġ åįĩ Ġ 建ç«ĭ Ġ åĶ¯ä¸Ģ Ġ پر Ġ ðŁħ Ħ ìłĦ į ± Ļ çī¹ Ľ éĢī ľ ´ ľ áĥĺáĥ ĠĠ ĊĠĠĠĠĠ ĠĠ čĊčĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ in in in data in os in vent in cy in spec in dia in ferences in Channel in finite in scribed er q or c or est or cid on ta on io on ormal at ra at os at test at titude at tachement re on re se re inf re tracted re oriented re cruit se in se pt se gn se lections se eded se ja Ġ= [' st g st iti st ial st udi st upid st encils en ome en rico en codable ĊĠĠĠĠĠĠĠĠ ĊĊ Ġt val Ġt all Ġt form Ġt xf Ġt ern Ġt ict Ġt ik Ġt dm Ġt uh Ġt enth Ġt inta ar ro ar it ar der ar akoon al ick al ah al veo al berto al uminum de se de ut de sp de com de ll de init de quantize de limiters le on le en le aving an ager an nee Ġi j Ġi di Ġi path Ġi ho Ġi sto me st me ll me kk me teor me taname Ġ' ... Ġ' ']) Ġ' ----- Ġ' ]') Ġ' ]") Ġ' >') Ġ' }': Ġ' « ro tt ro cum ti ent mp j mp layer mp ika Ġc T Ġc X Ġc se Ġc def Ġc str Ġc args Ġc read Ġc max Ġc als Ġc AG Ġc ix Ġc err Ġc plt Ġc dm Ġc hex Ġc groups Ġc menu Ġc iso Ġc raft Ġc idade Ġc ortex Ġc Nos Ġp ype Ġp test Ġp ls Ġp ty Ġp act Ġp pl Ġp mem Ġp noise Ġp star Ġp nr Ġp onto Ġp endant Ġp prp Ġp ÅĻ Ġf ro Ġf action Ġf ear Ġf handler Ġf pattern Ġf beta Ġf lying Ġf mix Ġf qn Ġf elt Ġf lights Ġf isher Ġf lickr Ġf lashed Ġ" }, Ġ" ([ Ġ" ...") Ġ" }": Ġ" }$" he w he ar he us he im he lio it us it ore it mo Ġa ow Ġa ap Ġa post Ġa ero Ġa kg Ġa uch Ġa wx Ġa eros Ġa valiações Ġa diabatic Ġa valiable lo ys 00 23 00 28 00 81 00 025 00 186 00 1110000 ge p ge te ge xe ge com ge mini ge matria ge orep ce la ce loss ce des ', {" Ġn T Ġn op Ġn part Ġn é Ġn steps Ġn groups Ġn bx Ġn ya Ġn omin Ġn uclide Ġn lats Ġn uscenes Ġn avegador Ġn ysa Ġs ind Ġs dev Ġs é Ġs bp Ġs ftp Ġs ido Ġs amba Ġs olução ut on ur rent ss lo Ġin j Ġin its Ġin case Ġin duce Ġin visible Ġin sira Ġin dependence Ġin verso Ġin voicing Ġin valpha Ġre type Ġre var Ġre assign Ġre servations Ġre agents Ġre wind Ġre starting Ġre indexer Ġre jections Ġre naming Ġre ionization Ġre presenta ing en ing Center Ġo st Ġo mt Ġd S Ġd k Ġd name Ġd iz Ġd file Ġd len Ġd lu Ġd index Ġd row Ġd ern Ġd gen Ġd long Ġd dr Ġd lon Ġd vr Ġd obi Ġd unes Ġd ropoff li ens li sa li ations li gn ct ext ct tt pe pper un an un dir un ho un ref un mark un follow un masked un limited un managed un rotated un infected un hexlify un spent un distort un reid un explored Ġm A Ġm ce Ġm line Ġm ann Ġm mi Ġm ash Ġm use Ġm ie Ġm ush Ġm va Ġm uted Ġm uit Ġm ticker Ġm orse Ġm amba Ġm rcnn Ġm undo Ġm ariadb ra pp ra ine ra ctor ra zer ra mento Ġe V Ġe bs Ġe tf Ġe mg Ġe uro Ġe asing Ġe mice ate ur ate pc ate sts () ==' () ``, fi at fi la fi ssion fi ki ent size ent rant ad bb ad visory ", [ ", ") ", )), co x co ul co ment co word co led co xon co ffee ri j ri vers ri eb ri etta Ġthe sis Ġb pe Ġb end Ġb ite Ġb size Ġb plot Ġb abel Ġb cd Ġb ills Ġb outs Ġb dists Ġb reathe Ġb rought Ġb ÅĤÄĻ Ġ1 170 Ġ1 030 Ġ1 291 Ġ1 993 Ġ1 371 Ġ# (" ed al ed ro 11 22 11 20 11 90 11 000 11 82 11 46 11 91 11 72 11 51 rom o rom os um m um er um blr int ype int ake int ended id xb id ref Ġw pe Ġw ash Ġw ied Ġw tiles Ġw aste Ġw olf Ġw ishes ch p ch ow ch amp ch anger ch alice di as di ve di fier di std def pm ): ( and partner Ġ[ (( ma son ul ario Ġimport utils ], )); ot arget ot su ot Eo Ġfor ne Ġfor ecaster ol U el mo el ength el lipsoid el ancer ), '. es z es ara es sential ĊĊ ĊĠĠĠĠĠĠĠĠ Ġ+ '\ is not is Match is Enabled is Eulerian val l val ley __ "], __ }. __ }: name se name id name tag get ID get Path get Class get Options get Min get Ip get Filter get Next get BBox get Fbx get Servo get fullargspec (' "" (' >>> (' +', (' >') (' ==> set size set Column set Output set Source set ools set warnings set Param set Disabled set Focus set Stretch set Pixmap set RTS set ModelData set FixedWidth Ġto ps Ġto ctree Ġto NFD Ġto NFKD Ġto NFC Ġto NFKC ĠT LO ĠT ai ĠT ik ĠT XT ĠT SSS ĠT INY xt y xt end xt reme il let il ateral th xl th umbs th ursday str test Ġreturn t Ġreturn List con i con te con stra con ference ers ine (" .. (" **** (" >> (" ]", (" ===== (" ====== (" -----") ') }") ') }", as freq as ynchronous ĉĉ ĊĊĉ iz ip iz io et ti et code et work et namese arg y arg dict op a op ic op lan op aque op tapy Ġ{ {' Ġis im Ġis Flow Ġis crowd Ġis obaric Ġ7 07 Ġ7 04 Ġ7 83 ĠS F ĠS ab ĠS ens ĠS oc ĠS ph ĠS ix ĠS ymbols ĠS CV ĠS yl ĠS inh ĠS QS ĠS YS ĠS BP ĠS tein ĠS crud ĠS olar ĠS obel ĠS moke ĠS lixmpp ab en ab lo ab lue ĠC ate ĠC ls ĠC ele ĠC OT ĠC andle ĠC ake ĠC ards ĠC apt ĠC FR ĠC RED ĠC aching ĠC SSS ĠC assandra ĠC limate ĠC MPS ĠC RLF ĠC linTox ĠC apsule ig U ig ating ht f up lot up wind ") # Ġdef enders Ġg ad Ġg nn Ġg ks Ġg ater Ġg rl Ġg hi Ġg Best for bid for ecaster Ġr B Ġr ut Ġr value Ġr ta Ġr stop Ġr vec Ġr bv Ġl q Ġl te Ġl ite Ġl pi Ġl inter Ġl gs Ġl its Ġl rc Ġl so Ġl vm Ġl ung Ġl Units end code data Value data files data pipeline data hub ĠA O ĠA sh ĠA AT ĠA mt ĠA LA ĠA wards ĠA bra ĠA gency ĠA APL sp x sp hx sp inn ult ural age RnR '] }' 01 99 01 98 01 51 put y Ġcon tribute Ġcon verti Ġcon vective ic ur ic ata ic io ke let am ind am omHistory to self to grid to gether to ppings 99 07 99 55 99 62 Ġ: ' par ray par ry par aboloid ist y type of ĠF Q ĠF ine ĠF AR ĠF eat ĠF ED ĠF FA ĠF light ĠF arm ĠF rees ĠF ancy ĠF aked ĠF acts ĠF ees ĠF ollower ĠF urniture od k od or od lib sc en sc am sc ure sc reener sc enic qu im qu idity log f log os log ram log pdf log OnFail list box om ber om bre vi b vi vado vi brato vi meo Ġh ask Ġh nn Ġh ists Ġh ose Ġh rm Ġh dl Ġh artree Ġh ilbert ĠĠĠĠĠ Ċ all Data po or po di po známk ta per ta king ĠP n ĠP ra ĠP ic ĠP ap ĠP ING ĠP AP ĠP ref ĠP si ĠP CI ĠP SD ĠP TP ĠP SP ĠP TS ĠP HI ĠP acman ĠP iggyback ĠP HOT ĠP GOPTIONS ĠP luggable ĠI B ĠI ron ĠI OB ĠI CSS ĠI Vs ĠI CRS file Config file handler file Prefix file MinSize file ToRetain ĠL es ĠL em ĠL DI ĠL ars ĠL TE ĠL CD res o Ġth re Ġth irty =' > =' ### =' (', Ġst or Ġst ays Ġst dio Ġde duct Ġde compile Ġde generate Ġde dicate Ġde serializer Ġde lattr pro py pro duced est user est ados 0000 023 pt m pt x pt y form ulation ex o ex cl ex LB ex posed im l im is im os im enti im utils im ization im decode im ads im oto Ġex cp Ġex UB Ġex changed Ġ3 54 Ġ3 49 Ġ3 41 10 28 10 38 10 400 Ġprint c out text out num out prefix ĠD er ĠD ur ĠD os ĠD ream ĠD MP ĠD SS ĠD inner ĠD OM ĠD AQ ĠD ropping ĠD ollars ĠD QM ĠD utch ĠD uty ac ro ac ia Ġu df Ġu struct Ġu Total Ġu Prim ]) <= Re k Re pos Re qui Re payment Re corded Re bates ite am app log app context app oint sh ut sh lex sh arded sh ingles Ġdata iku ĠM int ĠM ob ĠM eld ĠM UT ĠM OT ĠM VA ĠM ade ĠM Ws ĠM JD ĠM achines time Filter time Created time Now time Secs if print key list key ids key chains lab x lab la lab ility =" // =" ([^ =" ;") Ġv w Ġv dc Ġv flip Ġv quad Ġv oted 02 12 02 93 02 52 02 63 ext ending ext ensive Ġy d Ġy vals Ġy uv ĠO D ĠO l ĠO u ĠO dd ĠO ps ĠO dim ĠO LD ĠO liver ds P ds b ds m Ġ* ") Ġpar quet Ġpar atext Ġx w Ġx ci Ġx size Ġx block Ġx dg os kin os aur Ġse al Ġse ach Ġma st Ġma xt Ġma proulette ack ed test name test client test tube Ġor y add V add param add headers add Scale add Lane Ċĉĉ ĊĉĉĊĉ ER P IN FIX IN COMING Ġstr in Ġstr on Ġstr tobool xe en xe ew xe fy .. """ Ġel ms Ġel lipsoid xb cp xb aa xb az ure ka ms ource Ġme smo Ġme trn Ġme mbros ON AL ---------------- -------- ---------------- --- ---------------- ------------- Ġfile ds Ġfile exists Ġfile Dir Ġpro yect py i py m py r py brain py uic xc u xc v pre ci ls StreamProc ap ns ap lan 07 99 07 14 07 22 07 24 07 52 ang r ang strom xd u xd cs xd au xd cy label Id Ġbe i Ċĉ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ "] )). ĠB ing ĠB mi ĠB run ĠB IL ĠB ounds ĠB ible ĠB az ĠB star ĠB asin ĠB ibli ĠB ONUS ĠB RANCH 12 90 12 66 12 78 12 63 Ġname ko ys ing ys ers ys nmp ĠE I ĠE TR ĠE Tag ĠE numer ĠE MD ĠE EP ĠE PG ĠE quilibrium ĠE ESG ĠE statÃŃstica Ġj an Ġj self Ġj no Ġj unc Ġj ie Ġj amf ._ . ime ters ci bo ci ja ci Adres ob u ob ble ob stime ob niz """ ( Ġ< --- ly tics text variable text Range text fsm AT TEST AT AAAA AT ERE low s com er com ics model led ĠN er ĠN ath ĠN ine ĠN ear ĠN ie ĠN xN ĠN athan ĠN exus date str }, {' ir regular ir onic ir rigation len EnggNumber num col num diff Ġres ort Ġres name Ġres izes Ġres Len bo a Ġ4 99 Ġ4 75 Ġ4 67 Ġ4 62 Ġ4 72 ger rit Ġget Random Ġget Six lu til lu tils dir Name 92 12 92 25 92 06 92 44 92 2337203685 tp age col laboration In format In Tree In coherent In gredient quest s ĠR ap ĠR ates ĠR ide ĠR ATE ĠR DS ĠR OM ĠR PM ĠR eroute mo o mo z mo zart ep l Ġun s Ġun ame Ġun if Ġun cut Ġun wrap Ġun flatten Ġun idade Ġun locked Ġun freeze Ġun authenticated Ġun assigned Ġun projected Ġun stacked Ġun answered OR F fo ol read Object read Bool Ġtest Pass Ġtest Folder lic ate lic ulas Ġlog Level 32 91 32 06536 per ks oc ross ph in ĠG or ĠG ab ĠG ear ĠG host ĠG CL ĠG ren ĠG TK ĠG aia ĠG umbel ĠG olly ĠG rupos Ġco pper Ġon delete Ġon wards Ġon going format o EN CI EN GE EN DIAN ĠW C ĠW N ĠW ins ĠW ars ĠW ML ĠW PS ĠW avelength ĠW SG ho pe ho tels loc mem Ġout filename Ġout ward Ġout lines Ġout fp Ġout Obj Con ts Con vergence Con ventions bu la AR ING AR DUINO ĠV est ĠV IP ĠV ERT ĠV ocê ĠV iterbi ĠV axman ĠV ectors ĠU mb ĠU nd ĠU CHAR ĠU tah ry ption dict Key print Usage Ġ5 06 Ġ5 17 Ġ5 64 Ġ5 22 Ġ5 19 Ġ5 37 Ġ5 86 Ġ5 83 Ġ5 21 Ġ5 74 Ġ5 51 Ġ5 987 Ġ5 0612 Ġhe mi ight er ib urg Ġan h Ġan ch Ġ__ , Ġen var Ġen gg Ġen cour Ġen large ise khon ard vark che ll min al 999 4 ator Player Ġtime scale Ġtime Step Error Detail Ġ> " 18 754 16 85 16 35 16 42 16 374 Ġlist Workflow line item line To line String coun cil ft en sa ga cur ry cur Obj da a Ġk ow Ġk ms Ġk config Ġcol widths (): ] Ġro ver Ġro of Ġro dap St ale St ars St ages St arter Ġpy re Ġpy te Ġpy gs Ġpy tools Ġpy dev Ġpy learn Ġpy pm Ġpy lons Ġpy mdb Ġpy kern Ġpy iem Ġpy roslib Ġpy hmmer config HASS Ġ6 15 Ġ6 33 Ġ6 45 Ġ6 53 Ġset t Ġset Vertex ag ra ag ri ag rant ts ig ts config http core 04 11 04 07 04 06 04 34 04 94 04 97 04 45 04 59 04 900 13 93 13 89 13 73 13 68 13 69 og i lib p lib ili 06 18 06 34 06 77 06 76 ign als ign oring 15 25 15 06 15 17 15 08 15 27 15 36 15 000 15 77 15 83 15 82 15 29 15 51 lif ford cept ors 100 0101 100 111111111111111111111 max xx max Length max Events max imo max NumberOf ass r ass ian 05 11 05 02 05 58 05 53 05 72 Ġthis ODict 03 93 03 87 03 57 03 56 03 58 03 62 ]. \ we athers Ġop ad Ġop ml train s train eree Ġch ans Ġch alice Ġch aos Ġch ampion 17 38 17 89 17 68 Ġal u Ġal mac onse nse 93 04 93 332 14 27 14 37 14 23 14 28 14 50 14 73 14 61 Ġpre par Ġpre face Ġpre exec Ġpre cio Ġpre sti Ġpre mium Ġpre pares Ġresult Func ne q ne ulink Ġ/ | Ġat ype ok eras ok oban vent ana 64 37 64 23 64 98 64 67 64 76 64 54 64 73 64 52 64 1975 right Panel right Arm Ġob t Ġob lik enti ated Ġra ma Ġra io ([ (( gra ine 076 2 076 5 076 6 076 7 :// "+ plot x plot y iti se iti an iti va iti zation Type Exception Ġtra ditional Ġtra kt IC M IC SS IC TCP 08 92 08 84 08 24 08 87 08 97 08 86 08 83 08 48 08 74 main dir ty name ðŁ Ĩ pi k pi et ust a Ġ. % Ġ. ') ĠH U ĠH our ĠH aw ĠH CC ĠH aving ĠH orizon ĠH azards ĠH acker ĠH anoi ĠH lsStreamProc ĠRe write ĠRe sets ĠRe ais ĠRe ached sub query sub total sub network sub clip sub packet Ġ{} !'. ml er input Widget input Args mat show mat ically mat thews Ġsh iny Ġsh aders Ġsh ingles Ġdi vs sk aters db key work shops 88 12 88 27 88 96 88 85 88 54 88 73 88 61 lp aW ded upe ast s ast ed image set image File image Pull comp os (( ?: Ġsc or Ġ` ! Ġ` @ 34 946 start work pos mask pos itivo Ġ[" * Ġwe ar Ġwe iÃŁ 09 03 09 66 09 45 09 52 09 69 09 103 84 86 84 44 84 65 84 67 84 62 84 63 ĠIn k ĠIn ject ĠIn coming ĠIn finite ĠIn jector write able write Bool ere lease ere ira 27 00 27 932 Ġkey values nd cg ant z gs Vel by token bin om bin centers shape Rdr lock time Ġle verage Ġle iden result ing arch er arch ipelago Ġconfig ures 37 176 Ġpath join Pro fit Pro cedures em v em is ark a Ġoutput F Ġoutput filename Ġ@ \ Ġpo a Ġpo lib Ġpo cket Ġpo les Ġpo sso Ġcom and Ġcom types Ġcom bat Ġcom merce Ġsub st Ġsub tra Ġsub samples Ġsub tags Ġsub dag Ġsub ckt yn ode Ġ{' __ rep rs AM aire 96 01 96 06 96 134 96 306 96 158 96 087 Ġac ampamento Ġac ordo Ġac quisitions ache lor ĠCon j ĠCon vergence ĠCon centration ĠCon vexHull Ġnew value Ġnew Map Ġnew states Ġnew Matrix ress ive Ġall tweets Ġinput ted 55 18 55 05 55 34 55 66 55 45 55 74 [: ]= 94 34 94 86 94 54 Ġcur P Ġcur ie arn s DE CRYPT DE LET DE VELO RO L RO PE RO bjects Ġapp oint json net split By Ġlabel pad row ave av x Ġno on Ġno Outgoing Ġno Incoming 87 00 87 04 87 85 87 29 no Of Ġline ages AL IVE fic ador exp val exp ids (), " -------------------------------- -------------- -------------------------------- ----------- ensor ed AS I iv f 85 45 85 73 85 78 97 13 97 86 97 67 back door mi er mi ke {} \' net f net dev ================ == 36 02 36 32 36 95 36 000 36 28 36 81 ron os =[ { =[ [[ 011 0000000000000000 Ġopen unreid Ġid l ĠK ur ĠK ine ĠK max ĠK ie ĠK SS ĠK CSS ĠK MOD ĠK NX ĠK SSS ĠK amehameha 95 01 95 99 95 14 95 86 95 26 95 43 95 39 word nets lat ter lat long Ġit m Ġdist ros Ġimage code Ġimage Path run cmd instance d 86 95 86 26 86 66 86 77 stra ddr Ġmax imize Ġmax Coin sum ma mon otone Ġdo ses fa w Ġz a Ġz um Ġz ep Ġz mc Ġz hat Ġjson field Ġjson Conf Ġjson rq HE LL string ify string Path default Test default Graph AG ING 57 00 57 88 57 86 57 26 57 57 57 44 57 48 57 78 57 52 57 014 Ġ! !") Ġ! @! Ġ[' -', Ġext ender Ġext Top ww tANT Ġ| ") create Integer create Trackbar ED UC ED GED IS C IS K IS HER reg a reg en reg ime Ġtf lib number of Ġbo ys Ġbo oleans do cteur Ġper mu Ġper cepts Ġper ennial message Id au f au gs group er group docs spe ar Ġne k Ġne ur Ġne ces Ġne urosynth ele ven Text ual Text area env opts List Equal CO G CO SE CO IL CO EFF CO ALESCE Ġfunction Name man ded man vol ach ieve Ġlo la Ġlo ved Ġlo sing Ġlo oo 66 07 66 77 23 839 AC FL AC ENTER Ġte h Ġte aching Ġmat hemat ps v Ġli q Ġli gate 44 96 44 33 44 31 Ċĉĉĉ Ċĉĉĉ frame Y und os und led IM IZER Ġdis hes Ġ** __): 80 32 AP D AP s AP AN AP IB Ġadd class Ġadd nodes Des k 75 05 new dir new order new Graph Ġtext blob cor rel cor rente cor responds cor respondence io ff ait ai Ġrun command Ġrun nings OT HERS Ġnode sel Ġnode info Ġnode Label ef v ef etch En codes En gines 28 367 Ġend Y Ġend y Ġend rec Ex r Ex cess Ex erc Ex haust ET a ET CBC Ġ-- ') Ġ-- >" so ciety cal cs ther as 56 95 go at go To 98 22 98 37 98 904 Ġsp m Ġsp ins Ġsp itz Ġsp orsmaal local db my path Ġdict Zigbee Ġmin ut Ġmin utiae Ġmin ThresholdLength LO V box style Ġ(" ../ check able check style check boxes check PositiveNumber batch norms Se guro uc l Ġcan tid UR ACY ĠQ ry ĠQ Tree ĠQ Pixmap img w img dir img msg Ġcolor izer Ġcolor scale Ġcolor Header target DB 35 11 35 16 35 96 35 94 35 9375 Descri ção ud pa Col lected Col umbia Ġus ado dataset Id dataset Version space one Ġmo od File ID AD Q AD AM AD JECT ual ated ran ties cre atable Ġim u Ġim lib Ġim resize Ġdf obj ',' _ stat ics stat istical flow cells ĠSe ven Ġad c Ġad alah 45 05 77 26 ng uess PO LE PO bject PO SCAR the il the os the sis token Weight token Balance bug fix Ġdistri butor noun s ĠY un ĠY et ĠY oung Ġinter medi Ġinter Bands ä¸ ĵ ĠX I ĠX S ĠX e Ġtrans versal Ġarg c Ġarg dict Ġarg Parser Ġarg complete Ġarg Format Ġbase y CH G CH W CH ANCE CH ILD cc rs 47 27 47 98 47 47 47 83 47 82 47 43 47 81 47 466 47 758 ]] ))) ]] ]] ]] âĸĵ csv name csv reader csv FilePath event ID core f ĠEx press ĠEx hale [:, _ tf x tf learn Ġ9 09 top K top lot top ological Ġload txt find bugs Set ter Set Num Set Current Set AccessBindingsRequest Ġpython Code dire ita dire cao Ġreg r Ġreg ime Test Plan Ġser en Ġser if 83 84 IB O Ġmain title Ġver ifies Ch orus Ch oreography wh ms nder e >> " Ġlin ode mark ings ai ss ai ka ĠIN S ĠIN CLUDE sg r sg fpath 82 96 }) '), Ġar rs Ġar bre iter ated 46 37 46 94 46 85 46 82 46 21 46 73 46 51 ĠJ i ĠJ r ĠJ es ĠJ os txt Box Ġcv s 107 8 Log Entry Log Mat Log Moneyness Lo ose Lo Or 89 11 source Folder DI terate Ġ] } loss y yp ad ":" $ cp x cp tr labels Entry )] '. ld h nx api Ġmodule Name open mc fg mask Ġread File Ġread pv Un set Un cle Un meth Un healthy pk ts mask points Ġq chem Ġversion eer TH ING UL F UL P UL Y UL FOR air things To A To Node To Dict To Binary To Remove To Math To Caller CON STR CON DA Ob serv De laware De seja ost op Config Dir sign ificance 29 101 US s US ym Ġ`` @ Time List Time Period Time Distributed Time Elapsed block height block Job Ġdb session 67 38 cat kin 43 03 43 19 show Amount show aia bot m bot toms cl rs cl oned ĠCON FL ĠCON NECT ĠCON CENTRATION Ġup vote Ġcor tical ĠPro v ĠPro ble ĠPro vided ĠPro pose Table Table Table Target CL s vid a ĠList a Ġcontin uity INT ERRU fir ming fir mative vo o vo ided :: [ :: %( 000000 111 Ġnet G SI mage Ġmatch string std v std int 48 17 sv r ie ee Ġqu ais Ġqu tip Ġqu odlib EX FL EX PTIME ĠData Update FA A ingle ss Ġany ways fe ctions red ds Ġfirst day No Args total Size total Supply \\ % \\ "} session Id ãģ ¹ ãģ ļ ĠAr ffRow TT F Ġtemp Line ])) + Ġgroup name last Updated pha idai MA KER MA COS Model Config Model Metrics Model Checkpoint EST ABL Ġcontext Name task map е ÑĨ ca des DAT ED DAT ATRANSFORMATION DAT ACENTER âĸ ł Ġfig let ten cent ĠIS R ĠIS SS mt cnn Ġwork place ĠÐ ¤ "> & "> '+"\ Max Global post gis Ġback stack Ġback cast Ġback warp Ġback tracking Ġback GTI "]) ], "]) [" Ġexp rs Get Frame Get Count Get Current Get Cluster Get Modified Get Cert Get ComponentDefRequest Get PomeriumServiceAccountResponse Get ManagedObjects game stage Node Error Node Lis Node Conts match up Ġ'/ '). Ġbut t (- . 39 18 ny ch ny zo Ġsum mar Message Dialog Add Renderer Ġover flows bar Number Ġtensor network Ġass m Ġass ault folder path matrix Spot uni Valid uni vals char dev char offset conf ound conf licts build type Ġ& \ cho o Number Bits aw ake Ġlast Time tmp path tmp fs tmp Site TO K TO UCH ren ded Ġfound CTAs conv s ui py ui ente čĊčĊ ĠĠĠĠĠĠ scale Mult PAT TER 54 75 png quant Tra j Tra its Column Type Ġframe Color 79 64 Key Name Key Id ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Vi ri cv c cv v const recharge 74 075 tick locs MIB Module Ġobj c exit Symbol MO X mem stats enter Symbol ĠCo ord ĠCo upling Ġpytest er 73 99 73 14 73 37 73 96 Ġfind Value dis allow fit x Ġimp uted Ġ... ]] LI Z Ġnext ype String Index ĊĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠ Com mitted Com mercial Comp act Comp Aux common mark common columns Ġorder Id send ers Ġuni con adj Pvalue ĠĠĠĠĠĠĠĠĠĠĠĠ ĊĊĠĠĠ pred id pred pixels Ġfilter Type Ġspecific Dict ĠTO OL ĠTO PIC first weekday ][' @ Class ic Class Info Ġiniti ator edge count edge colors Ġab r Ġab br Ġsupp l 58 12 State Change State Metadata access log pr x pr inceton gr d dist ill 78 26 OP F ĠTest Config case id ("\ " pol lution ĠNo OptionError Ġbin str job Script User Create User Factory User Credentials Ġman ubot 59 01 59 02 seq id seq Names Ġport a ĠDe ut ĠDe que ĠDe veloped ĠDe launay sw in sw ish Ġproject roles 53 08 View Up Ġform al Ġlength Of Ġfollow ings Exception Handler 68 6400 ĠRes er ĠRes pon Ġbu ck Trans itions ãĥ İ ãĥ Ŀ connect Nodes çļ ĩ ym m Th ermo Index Buffer acc db xx Sph çļĦ åĩ½æķ° çļĦ åĽ¾çīĩ çļĦ æľĢ大 çļĦ 大å°ı PL ACES pack file Ġblock txt inser ter fs f unit TestSupport (_ [ Ġchange point Ġchange State Ġ"/ . cell Stats cell Rows ĠUser Name If String If Mtu 62 04 ank d Sh utting Sh uffling opt parser ba ys prefix Operator fra gs ĊĊĊĊ ĊĠ IP SE IP VerErrRx IP ProtoErrRx ĠSo fa disp er disp ers Ġtmp Name Ġtmp Threshold 49 18 49 13 49 06 radi ation Ġmap Cells DB T DB Type DB Common DB OX Def s Ġmask rcnn Ġmask RCNN 012 95106 Ġgraph cut xaf I BU FF ards on EM Y EM INDER SC a SC RE SC RI su ave sim id sim ul Ġfi epi 63 07 Request Type Ġoptim isation stream consumer stream IDs Ġ15 35 Ġserver details CC F ĠGet Field ĠGet Page 72 13 72 03 cluster Status IO I IO mica na ea na pari wd th åĪ º åĪ » Not Defined Create ComponentDefRequest Create ColumnFamilyRequest Ġmy frame Ġmy screen resp ons resp rocessing Base Generator Ġtri o Ġtri stimulus Tx Rx Tx CurWorkMode Ġph en Ġph rases Ġph igaro Ġapi Class Ġsa o mc Fan Ġgrid color xfe U Al length Al DynAdOcc "); ') Ġ'' ))) Qu arter By Value Option Overrides 69 18 pect rogram Ġwrite ToFile App lies н ев dt ml TE LL Ġoper ates Ġ'\ ' Ġsu its Ġdown to Ġdown sampling has popup diff serv era SAS Fa de Fa ça ĠCh ang ĠCh alice ĠCh icago uff in uff man scal able Ad r ĠImage Folder ĠImage Grab Py YAML inst level resource index resource tags az w az ar az ul az ines az zo lan ta Ġ[[ [[ ĠTh row ':' # Ġcsv File Ġcsv FilePath Ġraw FileName Ġraw dbs hash er hash val xef K pg a div Val ĠDict Reader ero ot Sp ots setMax imum Ġmock ing pair T sm enu KEY UP KEY FILE KEY PAIR Ġclo set select inload Ġref Id Ġref lects FL G FL AT FL ink PR ICER ĠMe asures Ġret DQ _{ ( active Pitch FO X FO pt ee b ä» į Ġexpress ão Net Mask Net NLTK Pre parateur report Type Ġpost ure Ġpost code GR ASS web test web browser ++ ", Sub array Sub process Sub title Sub struct Ġrand n Ġrand y xdf G xdf j Result Set ML A ML Model sql mat Auth nContext af d af l dat at ĠZ S ,' +',' NO ON NO ULL Ġjob id Ġjob Id ĠBase Resource ĠBase Service ĠBase Api ĠBase Plugin Ġì º Ġì ¸µ xdb n xdb w WS q ICs Denied ICs Srv ICs AlDynAdOcc upper bound light blue light curve fin ds gb p gb if Ġtwo Squares GB C GB H GB O Ġcell Top Ġcell Rows Ġsplit ratio global DhcpRelay Ġans i Ġvar Name ĠMan ages ĠMan uel ĠMan ila leg ato Ġzip codes -% . hex string hex Value ]+ )* rain er Tensor sTo rank data ha Problem sen te sen ta sen vol sen tie ĊĊĉĉ Ċ xde q imple ments ĠFile Field ĠFile Handler UD GE grad y cfg mgr Ġpack er åħ ħ Ġjo y Ġkernel spec any ons any way insert width draw Bot Ġcomple to Ġ14 25 )\ (\"\ 10000 11100 Ġstat function Ġstat ics br ance br Limit sd am sd sc .', )) Lib raries xcb W her otarget Ġpick ing GS QL rot li rot Mat Ġauthor izer Ġcustom AttrData Per ry Per Class Per PeerStats Per Chunk Per haps Color Space Or Array eff ector 0011 000000 0011 011101 Ġsw irl Ġvi rus á ver á tica Item Field Item Alert ĠLe arned ĠConfig s ĠConfig Map ĠConfig Tree Label List Label Dataset Label Encoder Ġresp FromGettingUserInfo Ġlink List ĠComp osition Ġsend ers imp edance ," % Line Text We bui Ġmer cantile xdd w ategor i Load Balance mm detection arm hf thread safe Ref lectance Ġfeature DictObject Ġrest o Ġrest au CI Ig Sim Hits Ġpe ut Fil m Ċĉĉĉĉĉ Ċĉĉĉ OUT CAR ãĢ ķ'), Ġweb struct xda o BL AS 108 19 .... \ .... ..") rl on rl RmonControl multi set multi array multi tenant multi shard Ġmc Pm Ġsuper op Count ed button List button Canvas Ġemail er long name ĠRelation Type avg rate mk temp modi fications ĠPo licies commit Timestamps ())) ] STR ENGTH STR ATEG +" '" +" '") xac X Ġpub li Ġstream er ĠLog Message ĠLog Norm ĠLog Util So licit Ċĉĉĉĉĉĉ Ġ lon gs Command er buffer Position Ġtrack ers Output Base Output As buil ts term Represents Norm Disp Ro berta Ro yal ĠEX IST ĠEX TRA ĠEX CEPTION timeout ed 10011 10001111 ĠHttp Client æĸ ½ Ġchild Context tuple tree ĠName Expr ĠName Mapper Ġconnection Array prop val Map Line this Node Do ctor à¤ Ń Tag Set Resource List Resource MapEntry ([' / vol ta Ġfolder Name Ġmove ments bucket name flat land Is Remote Is HubPortDevice OS F OS X OS fp DR V ("- + Ext ender Ext Mib vs Attr inner most Ġrot ten FR B Ġdraw ings Ġdraw downs ĠAuth nContext Method NotAllowed (** _ (** {" (** {' cr d cr nr ĠTo y zy y SH AP tile db ĠAt ten ĠAt tempting ĠAt trition 115 200 Total Count Total Execution Total Charges Total Octets buf r Window Extractor Ġskip CTAs Button With AV R TER Y rest itution Server Name An se An chors An uncio VID EOS Di ctionaries Di hedral Ġow ning allow list noti ces Ġve ze ĠBo keh Ġ### ') depend ant aut ob Ip Filter ĠAl g ĠAl locate question group kernel spec fici ent à° ¹ Ġast ar Ġast ype hist o Ġdat o Ġdat at Ġdat alo obs N Service user Service Perimeter ii if Ġsort By ĠOb served Ġfit stbl fl ank Address B _, )) fr inge CHE M Ġreq Type ĠSh i Length TransferFunction *\ *\ Ġstack level termin ating æĪ ¸ æĪ ı ([" -- ĠString Indexer hs r )]) ), Ġ'{ :,} Ġ'{ :,. Ġfree ëIJĺ Conv Nets Module Selector tech niques Var Intens ĠAd Kraus ĠFunction ality Ġip sum clear ing MB q MB qN MB gM Version String MIN ER pd params ÃŃ ci ÃŃ das ÃŃ nh ĠRE CORD Ġamount OfBytes )- [: SP IDER CR N CR ONT support ing /\ )\(\"\ Ġ25 92000 ĠSer viço ĠAn ti ĠAn ime ĠAn geles GEN DIR ĠInput Layer Ġreal time Ġlat Lng IZ r IZ ATIONS Has Field Ġcl kpnt OB w Ġmod è axes pad Op Mode Ġsel marker Ġdec lination Block er oto pe ĠMIT RE high score }/ . Ġtick Log New EnvType Ġauto load Ġauto commit Que ueno attribute update From Unicode Update Event Update AccessBindingsRequest PRE FS ev Max Br ute Filter Attr ja h eq Pops rea is Control Set Control HistoryControl Control ContainerOptions 9218 107 004 77 Peer Gw ]- = ĠSub process ĠSub Element sr gan Ġprev lin Ġprev token ĠDis c ĠDis connect ĠDis ney PY TORCH ĠQu arter CLUD ES åº Ń 404 6 Ġ"{ ", Ġshort cuts ĠOpen SSL ĠOn coming Ġinser ir digit alocean ĠRed shift GT CA Ġforce Invoke Ġtimestamp ed agg info Ġcontrol Types Ġpr in Ġpr zy Ġlow Crv Ġside chainnet With Opts With LayerElements install ing NB p Bu oy DU s EG ROUND Default Info Default Measures PER M PER ATION ĠLoad Data ĠLoad Average ı lar Ġinte grand ĠDo ing ĠDo ctor å¼ · Ġcre ative Ġds out Sa ImagePatientNum ĠAR FF ĠAR TI SET FL Ġcut ter Ġgra bs gl xinfo Ġmp c Ġactive Job Element Field Element Selector Ġjoin Prune Go Archive Ġdev uelve PH F Ġnb Points ĠHTTP Adapter cells X Open ID ov y 011100 111111 Ass ume Ass uming kit ty ĠUpdate Failed :]) ), Ñĭ в Ġho omd ================================================================ ============== Ġ"{} -{}". Ġ"# "+ Register ServiceDescriptor /> ', ³ółģ ¥ółģ¿ Ġ"< % Ġ"< @{}> ĠCO ORD ĠCO ALESCE ]} { ]} /{ ]} -{ (? ! BR K ĠGo Pro Local Config Ġap itools ĠMy Screener Ġ'') ] Top K look ml Pi ke ĠST ILL And Start rec ver Ġflags Surrounding BB BS DIS P DIS CO Ġcost eA subject Name ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ COMP ARE poly mer Ġdes se Action Token 600 7 System Status NOT SET ĠMo ore ĠMo lecular private Key >, . Real istic ов аÑĤÑĮ Ġbn ds AI RE Ġ[{ : BER NOULL Menu Command LOCK ED YY aaqihh ĠGraph ite Ġworks heets 132 7 quot ation dn Z aur a ĠPrint Usage 165 114 ĠGoogle Cloud Ġpur chases Ġgrad var Ġlight ning Ġlight gbm geo server geo coder lookup field ,)) [ Space Create Bot tleneck Gen esis share X æķ°æį® çļĦ Ġred undancy 905 03 æĸĩ ç«ł cam ids PIPE LINES hw px ĠMin us ĠMin idump Ġir radiances ĠÑģ об ĠÑģ делаÑĤÑĮ CAR RY VM ware micro seconds ãģ® è¨Ńå®ļ HW Spd Stack Trace Ġground Truth accept ance Ġautomatic amente ĠWeb Error äºĨ åı²éĢ² ĠSimple State ĠSimple HTTPRequestHandler ĠSimple Grasp ĠPri mer ĠPri vilege contract Duration Ġresid ence Ġresid ents NET MASK met re thresh olded Ùħ ØŃ 904 9 Storage ClientAsync machine group Uni verse cum bent ĠItem Response OC ardTable OC ardEntry illi ard ен ÑĤи ={} : ={} \ Lim b Ġč ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ sell M linux dist Offset Str ĠNetwork Packets ä¼ ¯ ĠWindow Generator visit Symbol ĠTemplate NotFound ĠTemplate SyntaxError ko loj ê m Validation Result FS R Ġvisu alized Ġvisu alizing Print String Ġut xo ĠTask Type Ġswitch er Ġband pass prior itized SERVER STATUS hyper v ĠTable Definition Ġuseful ness ðŁı´ółģ³ółģ ³ółģ ðŁı´ółģ³ółģ ¢ółģ ðŁı´ółģ³ółģ ²ółģ {}_ {}'. Interval List Interval Secs EP IC bon h prote ome xFF A xFF E Ġnd min Ġgit lab sup ers Import From Ġown cloud Ġnu isance coin cid Display Entry æĮ ij Global Exception Global Tag Ġpk dlog Ġmet py Ġ36 00000 filtered MapDict ĠSum med Title s еÑĢ ем sens u WA KE operation Queue Sto chastic åĪ° çļĦ åĪĨ æķ° åĪĨ ä½į Windows Server Ġsv hn APP ID Ġquestion no Template Name gw ick 表 çļĦ -{ : spark Context ĠPost al ĠPost fix ################################################################################ ##### 403 1 Api Config dark file nl ons cod rive Ġann ually Remove PodOptions ĠBlock DevTiers ĠMark Sheet [] ',' Ġstock ing CY THON Select ing ĠØ º Ġguess ing Plugin Descriptor Plugin Control Plugin Specification ÛĮ ÙĪÙĨ Ali en Cho i Cho ices ili u Ġâ Ĩ ky fil ĠSU ITE Inst ead 406 1 æĽ ¾ 808 8 Entity Id ĠStruct Type Opt Entry è¾ ij umb ai chi are scra mble Ġ------------------------------------------------ ---------- Ġ------------------------------------------------ ------------- rist ol Operation Failed URI Ref д Ñĥ #---------------------------------------------------------------- ----------- Card Number Card Desc ĠJo e ĠJo hannes SK fT SK IPPING æĢ ª Ġproto bufs ĠVi olation quad rature Ġ'$ ': Ġwave function 647 0588 Player ClientPropertiesMessage REF GUID 142 857 åij ³ Ġreading old Points T Ġent ren Database s Ġblue bottle Ġbi en Ġbi ke nor et nor dic ĠCLI Abstraction connected Exception Member V ific a ÙĪ ب ÙĪ ج VIS ITED Ġhalf Site Ġн его Constant R Ġer ow Ġer ased Ġer pnext chrom s 大 çİĭ 大 åįķåĩĢæµģåħ¥ Ġfront Reflected Driver Attr Next LogEvents guess Types Write File Ġpdf s Param Name Param Constants Ġur wid Split ting rx pk åī © åī ª Ġcloud inary TX PCAPS sfp util ĠSource FileLoader 10111111 10111111 Convert Feature Ġк аÑĢ +/ - Ġcy clo å°ı æŶ ("# % ("# ", sat urday tm st tm nx )+' _'+ Ġten Flow ('/') [:- ĠStep LR existing FilenameNodeMap ан дÑĭ м еÑĢ 392 2 impl ants Ġboot loader Ġboot Code Ġsmooth ness 337 1 Ġtar dis ĠVer tica Seq Num Seq IO 437 1 bat im voltage Sensor Vertex Array Summary Provider ĠHO G Ġwatch ers cart Cords Ġescape s Ġgreen budget Ġasset Name åIJį åŃĹ Ġgu assian Ġhex U Ġhapp iness ðŁı´ółģ¬ółģ £ ðŁı´ółģ¬ółģ ´ółģ Ma ine Ma NodeName cook ing Ġwarning Cache 988 4 ĠConfiguration Space MK A ĠDocument Array fish ers fish eries Required Placement Required ResourcesEntry ĠSession Authentication El lipsis El vDown bid os ĠColor ado ĠDatabase Error dhcp v formula field Su cess ĠDistri butor ACCESS ION ĠLin ha Ġweek end 918 66 è¿Ļ äºĽ Analysis Directory Fo x zM w Qos Support Show Modal Show ErrorDialog elf eld sun day ĠTop Level mf F mse val qq q ĠPass w Ġcum m çĶŁ æķĪ Imp roper Pipeline State Ġspi ces verti cally Ġlearn ers SCHE MAS aud tool ĠDire ctor 892 44 autog rid ĠпÑĢ ипиÑģ 405 9 hu BaseGenerator ÑĨ ий è· ª è· Į Ġci bo Non current Ġmol leweide Metric Meta ĠSTR UCT 355 1 Bad ges Ġfire store ATH ON sky water Used ResourcesEntry approx im 407 8 Ġ86 01 ĠTF NNC ĠView er ĠView port «ółģ ¡ółģ¿ ãģ« ãģĤãĤĭ Ġsr hand Ġmonitor Info æģ © Ġtruth TrackPt åĬł ä¸Ĭ adow s UA UC egg roll libs mb Ġquat ES Ġwar ranties Bound aries ç´ ° 357 1 357 7 357 9 Cfg Link Ġsat test design ation design ations 285 9 uu u getTyped Value hard code Ġ################ ########### Runtime Warning Ġincorrect ament ĠSchema Migration fbx Anim Cent roid ìĹ ĪìĬµëĭĪëĭ¤ Ġhighest Coverage aref as Pick ler Pick led ä¾Ĩ åı²éĢ² take off wa its pf D pf ns еÑĤ а еÑĤ и Definition Arn ĠTraining DataImporter ufact uring ðŁı´ółģ£ółģ Ńółģ GP IB Hash Key 请 éĢīæĭ© yu da ĠTri e ĠTri g ĠTri p ĠBinary SearchTree ĠBinary LabelDataset calcul ates SIG MORPH SIG USR ÙĬ Ø© ĠGaussian Mixture illing ness Uns orted éĽ » osa icking ĠExp lo '$ |\ hl cv prun able Ġdeep ly åĽ¾ ä¸Ń èĢ Ĺ Ġbounding Rect Copy From Copy Paths ND SE ND Qu ND VI Snap s ĠJob Input IJ FI ĠCer tificado aaaa a ĠLoop ing 432 2 Ġlaunch Job 566 7 çŃ ĽéĢī SIGN ING áĦ Ħ áĦ ĩ áĦ Ĭ áĦ İ Ġouter most Bin Num Ġbel t ĠUUID Type ĠUUID NAME Ġsd File ='\ '\ Ġbehavior Node ograph ical 99999 73 086 3206536 čĊčĊĉ č kE gk --------------- \ Ġgc j Ġaltern ating Ġaltern atives uj Template ĠFloat ing ĠRegister Form ĠRegister View ĠAut ogenerated ĠKEY SIZE ĠKEY WORDS vstack ed Ġslow queryhistory Bool Parameter Geometry Id ĠTarget Finder ĠDense Net Term Context ĠGit CommandError BLOCK ED Ep Cut __} ({ jump s Ġsch metterling иÑĤ аÑĤ activate Position Lat in Lat tice Ġheap ify Ġopp ortunities ĠPart s ARB ON Ġ#-------------------------------- -------------- Ġ#-------------------------------- ------------- Ġdem os INIT IONS Deploy er Ġeas ysnmp ĠCOL ON SUM MAR åįķ åħĥ bla ke ت ÛĴ ĠBasic Conv Spect atorPlayer Ġ{}: ". friend id Sta ys Ġ87 2 liz ing ques ne FB X ]}, " gather ing sco laire Ġprom ise ĠEntry Point CONTAIN S Ġhealth check docsLoadBal Channel Install Params Sort ing ]][ [ Ġ################################################################ ####### Ġ'\\ ', Ġstuff toplot Ġpen alize Bucket Client NZ F arity Sum ×ķ× ¤ ×ķ× ĺ ;"> ' {}\ ''. 435 9 sch metterling sch lichtungsbehoerde "/ >< ade Anuncio kM vl èª ° Tick ers Ġ================= ============ Ġcisco TrustSecPolicyMIB Ġsun py Ġsun rise Ġny quist Ġ#---------------------------------------------------------------- -------------------------- åħ³ äºİ åİ» æİī ulo us dead lock NULL ABLE deployment Name ĠMer maid NL G Ġeasy dict Ġìł IJ Ġìł Ħì mic he pan optes pan asonic ç¨ ³å®ļ Ġquad rants pnic fpae dater ange Ġठ¦ Ġठ¹ ĠRole Requirement ĠGeneric Strings Ġfriend Name áĥĶáĥ ¡ áĥĶáĥ ł Ġcare ers Ġcare fully fac ial Ġssh Port 475 2 475 3 Ġdu pes ĠPV OL Init Resources Namespace Roles simp li Ġappear ance ĠHand lers é«ĺ 度 é«ĺ 太å°ī don ut xFA A ĠContact Form Ġneutron client ju lia Ġpic models Ġflt Global ĠMa intainer ì§Ģ ë§ mom s shutdown Notification Ġphot Filter Analy tics Analy zing Gamma k Ġke ithley authentication Mechanism æīĢ åľ¨ ĠPOST ROUTING Ġexpanded Frags Private Data Fit Res Ġeg de Ġperm iti Boolean Value Kh QK ðŁı´ółģ°ółģ ¹ Person aId lbl Info tang os éĢļ ä¿¡ éĢļ 讯 ĠOUTPUT S Speci fics wG g wG lyph ÅĤ u Experiment UrlFormat +- ]?[ Gradient Tape Ġgas ConstantR æĪij åĢij Constants Package Fe el }% ") ĠCent os TRANS FORMATION TRANS FORMS Fun ny \. [ Ġht ype ĠSent ences Ġau ssi rV idName æ¸ © odo Installed scroll command ĠChrome DriverManager algo Strategy ĠLi ang alter ed DIST RIBUT Ġм Ñĭ Ġм ен Ġм он Ġм ин Ġtor r Ġspo ken ĠBO UND ĠMove ment ĠMove It ('* '* bur ger Ġ134 1 Ġsup erimposed ĠSec ure ĠSec DebugLogLevel hover item ли енÑĤ Ġtenant adm Cut s Cut ting Tab Bar Cr é pres igned åIJĪ æ³ķ Ġfaster RCNN OBJ COPY fan SpeedSensor Ġpsy neulink Ġkill ers Ġfeatur ize ĠAnaly se Fbx Vector LONG ITUDE ĠTrack ed Depth wiseConv cw l ĠES Xi Ġuploaded JarLocation Quanti ze ELL IPSE Ġmorph s Ġ#------------------------------------------------ ----- samp width 094 12 ĠBook ing bes kyfil Ġrd Mol Ġbackup Count ĠNamed ItemList ب Ùĩ World Line nft Id ľë ıĦ dH Z uá» ³ uá» µ uá» · uá» ¹ Ġemb ryo drug design ĠSTART S áĥIJáĥ Ľ slide MenuItem ĠPos ixPath Atom Names Ġcipher Type xW J Ġemo tions VIEW DATA ج ÙĬ æ¡ Ĥ ĠVideo Capture 477 4 ĠPub med Ġ`{ \\" Cli Sock Hazard List uer to Diag nosis æĿ¥ æºIJ Publish ing Play back nT PerPrAlrm Ġfood s +"\ " kZ G kZ ER Ġ################################################ ########### covid gr Received Xmas Ġprim ers æ¯ı æĹ¥ éĥ½ ä¼ļ Ġcert bot Ġtcp CliSock ĠStack Overflow ĠOct o GTT T Scope Info hass py AIS Alarm Ïĥ ει ĠGen otype MenuItem Selected Audit Provider milli meters ìĸ ij deleg ates shif ter shif ty shif ting Prediction Class Cancel IncentiveProposal ĠMAC D ĠMAC M ìĦľ ìļ¸ Ġ'; ': Ġsl di Ġsl hand ĠPlatform s ĠHyper visor åįģ äºĮ uris ch ĠCap ac ãģ¨ ãģĹãģ¦ cj l Ġban anas Ġopened x Signature Messages ×Ļ× Ķ ×Ļ× ¦×ķ× Ñī ие Ġhierarchy View Sequential Handler ä¿® æŃ£ ben efit erce Type cool rack ĠAcc um ĠAcc ident Ġweak ly Health Status INSTALL ER gzip ped ĠPop ulated Axis System Ġturtle s ĠTer ritories Ġly apunov ĠFeed back Cycle Time ĠAnnot ator åıĺ æĪIJ SgaclMapping Table SgaclMapping Entry cad ena ĠGra fo Prot otype Adv ance ĠOrganization Member æŶéĹ´ ä¸įå¤Ł åĪĹ表 ä¸ŃçļĦ Ġê° Ŀì²´ ĠCred its foot notes Voice Interface Ġty f ("~ ") ("~ /. Ġnecess ários EXAMPLE xxxxx Abs W Abs On Abs Jnt Abs orbance ĠCy Get ĠGR AY Tmp Info _* }}$', rig ged #. ## xm lobject ĠÑĩ аÑģ Ġmedi as ĠHo le ĠQU EST Topology WithOpts Relation Type Wrap Mode eos pec Rep licas Ġstrand Middle collected Items Ġskin name Manifest Column ĠComment ed Termin ated hom o rhs Node who ami Ġinvert Map ĠSte ve ĠArticle Serializer blur red ĠGraphQL Error GMT InvalidInput Mal ware Rad ar Convolution al BIND INGS xAB B Ġ================================================= ============== Ġ================================================= ====== ACA ACAA ĠStatic Files ðŁı´ółģ§ółģ ¨ółģ FACT ORS éĶ® åĢ¼ åĸ ® ìķ Ħì consum ing CERT IFIC there fore Ġjitter x Ġjitter y Sprite List Ġ$( @ Secret AccessKey alis ca ĠEnt sche IMPORT ANT IMPORT ANCE ĠDebug ger Changed Meta Ġâĸij [[ Ġâĸij âĸĴ seding EventQuery ess ay thinningThingProducer D thinningThingProducer J thinningThingProducer M ĠLIB RARY ĠWOR LD ек ÑĤи GCC C Uri Method kd tree Ġcamp us Ġcamp os Ġcampaign s ĠIBM Q ĠLook s ع ÙĦ áħ ¡ áħ ¥ Ġbc ds Ġhyp nogram Inputs Entry 天 åŃIJ Wr F Ġmirror s Ġsubclass ing TRA IT iko la ĠIdentity Task NIST AMO ĠProb abilistic Aggreg ation was AssociatedWith Ġsmo ke Ġdri ven ĠAir flow ĠFE ED æľº åĻ¨ SYS CONFIG Ġ144 0 ĠTele phone ĠPa int ĠRi ot phs bx Ġpreferred Epsg Ġê² Ģ Station ID Rename TableRequest Sci Py Sci ssors Super vised Ġspot rac ĠGood s ç¡ ¬ èĦ « èĦ ± Ġrp ns Ġrp csystem ĠVER IS ù y åĮº åĪ« Chooser Window ĠRED IRECT ĠUtil Funcs ðŁı´ółģ¤ółģ ¯ ðŁı´ółģ¤ółģ Ń Validate ResourcePolicy cron s Ġdn aml express ing lineage Cells overall rate 模åŀĭ 认为 ELE MENTS NK wwtANT YAML Error Ġamong st scraped title dyn Vel ĠFIL ING Ġhb mqtt ðŁı´ółģ¨ółģ ´ółģ Ġautos ize æķ°æį®åºĵ ä¸Ń Week ly DV TXPCAPS Pure WindowsPath ĠSu ffix ĠExecution Context Ġjog ou ĠParam Exception Variant Selection 0101000010110011 0101001 Ø´ ÙĥÙĦ èģ ļ Ġhpnicf proxycheck Bert Policy aser ow ĠStri pe Ġguest s Serv let ож д Ġìķ Ħ Ġìķ Īë ĠQuantum Tape 484 3 496 2 Che f ë¶ ģ Ġuncer tain WSMan Plugin ĠCharacter ized Ġ1234 56789 éĢĻ åİ® ĠAdjust ed ãĥ¼ãĥ ł 797 9 orbit als Archive Path REST ful skew ness #------------------------------------------------ ------------ ëł Ī ĠRET URNING arrayT MAPEStd cdbpLocal IpAddr Ġwy ckoff Ġvers atile tsk set Ġminim izing Chat Wheel Compiler Error ай ÑĤе íķ´ ìķ¼ SPEC IES zk client Ġrelax ing Ġmist une ĠSTE VE Ġextern es legacy Modifier hydro gen ĠfltStmt Index Purchase d ÙĤ ÙĦ é£ ® ĠÎ » Ġaf ford ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠGENER IC ĠGENER ATE Ada grad Pas ses Pas senger ç¥ ĸ ĠMail box ĠRUN NING Resid ue ä¹Ł æĺ¯ µółĢ ´ółģ¿ µółĢ ¶ółģ¿ ĠÅ ½ âĸĪâĸĪâķĹ âĸij \": {\" Ġwa ist ĠPiece wise mov able Trial Inputs bob ux diameter Vendor ĠDynOv Exponents OPort Pri OPort HWPri ĠPARAM S è¿ŀæİ¥ æĸ¹å¼ı 684 1 Ġrear GroundSH ---------------------------------- ") ĠDesign ation thanks in ĠPC BA ðŁı´ółģªółģ ¯ółģ SCAN LINE senti ments Modules Directory ĠQuanti ze Where Filter Days OffsetStr çĶ» åĥı ĠTrace Runner TRANSACTION EVENT vul kan çµ ± Ġill umin Ġwik itext ãģĵ ãģĵ Ġabbre v åľĨ çļĦ ĠDiag onal Ġب Ùĩ ¶ółĢ ´ółģ¿ Ġpup a ĠFe lix Ġknee Friction ĠCombin ing ÏĨ α æ´ ª é¦ Ļ Ġfresh man ('^ [ ĠSocket Server Ġlan es ĠdeÄŁ eri Pipe lines Supported Version Electron Identification hil ums mort ality Ġgir ar Ġgir ls ĠFi xtures Truth Status Cart By Ġema cs æ¯į 親 Flux es ÐĶ лÑı ÑĬ ÑĢ ĠMu joco ATG AA ORmtPort HWPri RAR ITY ì nh poss ibilities Ġxgb c Ġdisc repancy ãĤ¸ ãĥ¥ ĠUniform Prior ĠUniform FloatHyperparameter WifiBridge Lamp Fr ance ÐĹ Ð°Ð¿ ĠâĶ ľ Ġà° ķ Ġà° Ĺ Ġpet scii Ġsam tools Ġimpact o ÑĤо Ñĩ Ġë³ ´ SgaclMonitor Mode 级 åĪ« )& ( Bond At Bond HAt Four ier ĠCri me ĠBen utzer 2424 2424 ĠExchange Error Observer Subscriber Relates To Ġìłķ ìĥģìłģ Paging Response Paging Request bomb Percent qb di æĴ ¤ æĴ ¥ ĠSL ACK ĠFIN N ĠBU FFER FIRE BASE Comparison Expression ĠXXXXXXXXXXXXXXXX X '# ') BRIGHT NESS ICsMan IEIncorr வ à®° ĠMarkdown Document ĠìĿ´ ê±° ĠSmart Link ĠClo ses ĠClo sure ĠPod s election date Stateful Set AccessBindings Response Prom otion bnd box íĥ Ŀ Ġrub bish ĠExclu ÃŃda Parti cip Ġloan er dhcpSnp Bind Adjust ment ĠOneHotEncoder Transform Jwt Authentication Ġê°Ģ ëĬ¥ Ġtil tr Ġparalle ls ĠGradient BoostingClassifier Managed Cluster arpInspect Statistics Credit CardNumber Ġê³ µ hod naLetalisca kar ate ø r depart ures ĠTIM ETO Visu alize éģİ åİ» Ġbear ings ĠInv aders Translate OpIfNotEmpty GRAD ES ĠFileSystem Storage Ġadministr ativa Ġ################################################################################################################ ######## glt f Ġáĥ ¨áĥĶáĥ ENK ETO Prote ct ################################################################################################ ## स à¤ķ persistent VolumeClaim Rk dH ç¢ ¼ ĠÑĦ оÑĢм Ġtre ating Ġhg web Ġsed grid Assets Resource Boosting Regressor Sym metric Å© y Ġfer net Ġomit Measurements Ġmir gecom Ġseper ate {}" '. Ġг ÑĢÑĥпп åĪ¤æĸŃ æĺ¯åIJ¦ OPTIM IZE Digit Date Misc Info '` { Pan Tilt Ġfwhm RMSF ĠCamp bell vien as Ġshrink age Ġadult s ICsServ NotSup ĠFlash VL ĠAuthorization Response ĠTRANS FORM '''''''''''''''' '''''' ĠAggreg ator BALL OC Mk dir sla ves ytick format Subnet InterfaceMIB ĠStratified ShuffleSplit passenger Obj scrapy d bibli ografia fur thest Ïħ ÏĦ ئ ÛĴ ๠Ģ ๠ĦภĠbur uz sharp ness Ġneigh bs PROMPT S ér ature Liquid Sky Hold ing Hold time mL dap swe eps ĠScal ed ĠGauss ians 2739 87 иÑģÑĤ ика éĩĩ éĽĨ ctspVlan SgtMapping SYN OPSIS (.*? ) ×ŀ ר sty lit Ġclu st ĠDES EN Strength s ĠInvent ories Formula Dict ụ y åĭķ çĶ» Mor itz Tt Form ĠAp skri ASY MM ĠSocial Account PAIR S è§Ĩ é¢ij ĠCircuit Python æľ±æѦ æ¥Ĭæĺ¥ ,... ], =$ '+ PEN AL categor ial ÃŁ e Ġinde ed ĠBlender bot Ġsayı yı WEEK DAY wet test ('{: > ("================ ==== worm hole ĠREM OTE ãģĿ ãĤĮ TERMIN ATE ãĢĢãĢĢãĢĢãĢĢ ãĢĢãĢĢĠĠĠ Walk ing pfx file ĠHer oku DIAG NO Serve Prefs ĠChallenge Host Ġshorten ed åĩĨ å¤ĩ å°ıäºİ éĺĪåĢ¼ fltStmt Arb MODIFI ERS Cop ies Cop ula nuc l éĮ ² atu ur Ġpunct uator ĠPACK ET ĠElastic Search ĠRIGHT S ĠGri ffin Ġcouple d Ġvernier Chip Ġautoc lass MaterialExpression Reroute åħ³éĶ® è¯į ĠAnalytical ElementSelector ãģķãĤĮ ãĤĭ Bri an TUN NEL TUN NISTAMO uF wu éİ Ń Ġcow s Ġ"+" -"* held out ĠSys root ĠBinder MethodNotAllowed soli dated foreign key Ġ모 ëĵł Ġconsult a Ġtooltip ped âĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢ âĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢ âĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢ âĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢ èı¯ éļĤ縣 ICsNewPT SIAdbr +(\ .\ Ben efit PAS CAL iment os ĠMix in 5746 165114 unders cores ĠExpl ore perturb ations BUY BACK QosIf Statistics ĠSpecific ally Kine matic Ġر Ú©Ú¾ isam Appliance announce ment ĠctspIpSgt Mapping Persistent Volume Persistent VolumeClaim Fort ran Suc cesses ("------------------------------------------------ ------------") Ġvic tims dbtool sservice 3427 89244 Coll ator overla ped Locale Middleware Neighbor Sampler },{},{ },{},{ ĠCONTRO L ĠBoundary Side Ġmim ic ĠCLO UD ĠLuc id obb ies ASSET S INTE GRATION ImageFolder Structure áĥķ áĥľ Ġhighway Sources Ġhighway Sinks Segmentation Class ĠAutoML Search Squared Error Tim ings Vir us jnt Root remo tes deliver ed diss olved disa greement ĠFuture Warning Ġ`( ..., Ġpoor ly dome stic Ġctl Name nucle i VertexAttrib Array &&&&&&&& &&&&&&&& Pruning TestModelEltwise Mip Levels jav atests ĠÛģ ÙĪ ĠSpi keTrainArray Ġcomplement ary Stroke Cap ĠREQUI RE ĠctspPeerPolicy UpdatedNotif ATTACK ER Retri eval ĠPROCESS ING éĺ¿ å°Ķ usbDeviceCdc Fun ĠSecAuditLog Parts Focal Loss æij © ĠÅŁ ey Ġmil k exhale Doxygen shar pe ĠVIS UAL USi V offers A EMBED DING Quant as multicast Status MULTIP LE âķļâķIJâķIJâķIJâķIJ âķIJâķĿ wed nesday chkpnt Cluster Ġgpio zero Ġstitch er ĠDest roy Ġchkpnt Cluster Ġshut ting akh stan IMAG ENET âĶĢâĶĢâķ° âĶ¤ ĠNewCell Length Explicit Hs lcg ce Ġillu strates Ġê°Ĵ ìĿĦ ĠCHANNEL S WAL K WAL LET fare t íĶ Ħ violin plot Ġpyn put Ġpyn wb cyc lic ĠResp ond ĠDEFIN ITION Ċĉĉĉĉĉĉĉĉĉĉĉĉĉĉ ĉ Ġ------------------------------------------------------------------------------------------------ ------------- ĠOrdered Set ffffffff ffff Differ entiable ĠìĹ° ìĨį èģĶ ç³» ĠNORMAL IZED Scor er å¨ ĺ Ġtent ar Ġcab ecalho ĠRis ch Ġcooper ative yste matic Ġminer als CHN ICAL ĠExpect ation ICsOpt IEIncorr ĠChemical ConstantsPackage ICsPkFltMan ErTx ICsPkFltMan ErRx ICsPkFltSyn ErTx ICsPkFltSyn ErRx DynAd Oc JAN UARY Sing apore êµ IJ 0046 0863206536 Ġrefactor ing ĠClay ton ĠFACT ORS Stress Regs MPS State ðŁı´ółģºółģ Ń ðŁı´ółģºółģ ·ółģ Quota Bucket ĠUpgrade Id zzare lla ĠклаÑģÑģ а ĠVARI ABLES EFFECT IVE åij½ä»¤ è¡Į Bla de Han cock mva EleID çı Ń èĥ Į ĠCF FI ĠLasso Lars loadmodule status ĠResolve Info AccessBinding Delta Ġ202101 09 guar ante ATTACH MENT AccSfp Exist MODUL ENAME nnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnn Hover Info Lazy Tensor Nim bus ྠ·'), çĭ ¬ Ġtort uga Ġgro bid ĠNFT Collection Ġdifer entes ĠAPIKey Header ServerInfo Request channelsresource bytoken å°¼ æĹ¥ ĠOperating System Ġì§Ģ ìłķ Õ¥ Õ¬ æĩ ī Ġaci ma Ġew ma ĠSay ı ĠAff inity ĠBat telle Ġonmouse out Ġkube config Ġfaz endo 6284 74075 Ġvarargs Index ım ız PNL Path Ġíħ įìĬ¤íĬ¸ LANDS AT ĠXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXX %%%%%%%% %%%%%%%% $$$$$$$$$$$$$$$$ $$$$$$$$$$$$$$$$ Ġkullanı cı ĠæıIJ 交 Cour ier Capt cha HTT PU Vap orizations zel and 0055 686400 ĠSQ RT queri e apri ka ĠgetIndicator Components Accum ulator GetUserInfo Response xxxxx EXAMPLExxxxx ĠDOC UMENT codename s Supports SetSpeed ĠAutom ation éĤ£ä¹Ī è¿Ļ个 Ġespa ços NpuNumberForDrop Stat Follower Num Pae MIBModule Smo othed mfc cs narr ation rut ina Ġnj emu Ġbombs Surrounding setCurrent Index Ġelite ch Ġjew e sov token ConfigValue String lmn ID ØŃÙĬ ØŃ qweqwe qwe Ġæµĭ è¯ķ Opaque Pointer Gather ing XLS X Ġdock ing ĠFully Connected ĠMiddleware Mixin Protein Dict arna at tokenAmount In tokenAmount Out GetPomeriumSession Response GetPomeriumSession Request Leet code Structured Text SPOT IFY Geometric Transform ĠScipy Matrix ClickHouse TableTarget ĠLearningRate Scheduler ÏĦα ι ĠоÑĩ ков Adapt ed Ġæīĵåį° æĹ¥å¿Ĺ ListPomeriumServiceAccounts Response ListPomeriumServiceAccounts Request DLL s Voo vv loo ped Ġpripis uje 01001011 0101110 datan um Impersonate Request Survi ved octop rint è¨ĺ äºĭ Ġê°Ļ ìĿĢ ĠDeterministic Variable Cpk Info Cpk ScopeInfo pent ine rug ged 0056 00460863206536 urri cane Ġbes ides mast ery ĠArab ic Ġbehavi ors arrayPeak Index Ġdies er DEMO GRAPHICS ï¼IJ ï¼IJ Adverti sement ĠSTRE AM ãģ«å¤ī æıĽ (.+ ?) ĉĉĉĉĉĉĉĉĉĉĉĉĉĉĉĉ ĉĉĉĉĉĉĉĉĉĉĉĉĉĉĉĉ phosph ate AUR US Ded icated Fram ing padd lex pgs ql å² Ľ Ġpiv ots Ġsyl labus ĠdU Arr Ġdream s ctls Entry Ġbasket ball ĠNak hon ĠGIAI FilterValue Ġlear ndash Ġacad admin ĠProper ies Traces Entry Ġsuas ive ICsAll DynAdOcc ICsAll DynAdOc ICsPage Tx ICsPage Rx áĥĴ áĥIJáĥł ĠcloseEnemy Targets Ġè´ Ł εÏĥ μ ãĤ¹ãĤ¿ ãĥ³ãĥĹ ä¹ĭéĹ´ çļĦ Ġëĭ¨ ìĸ´ ,,,,,,,, ,,,,, ICsManIEIncor Tx ICsManIEIncor Rx '''''''''''''''''''''''''''''''' '''''''''''''''''''''' ICsOptIEIncor Tx ICsOptIEIncor Rx ĠìĦ¤ìłķ íķľëĭ¤ daatAnd Skip ICsDenINRat Tx ICsDenINRat Rx ICsNPTSIAdbr Tx ICsNPTSIAdbr Rx +]( = Gym Env Lik ely Marg ins drunk datanum Ïį νδ ĠÕ § Ġpon tos Ġsib lings Ġoss dbtoolsservice Ġdorm er ĠLAY ER Ġuży wa Ġjav adoc Ġunresolved Dict Proble ma Thumb print QueryClass ifications ĠPreview Manager )}} [( æł¡ éªĮ ĠPOOL ING ĠìķĪ íķĺë©´ BUILT INS âĸĪâĸĪâķĶâķIJâķIJâĸĪâĸĪâķĹ âĸĪâĸĪâķij GNBStatusIndication IEs ĠPREDICT IVE #$% ^& Hum ans Jaco bi ntr ls ëĦ Ī Ġdod ges ĠHal os ĠHum mingbot fermis urface THES AURUS crn rlon Ñĥй ÑģÑĤа Penalty Goals honor ific Dock Widget Louis iana ĠCBE Data Ġhon or Invent ario ĠtestParse Book ĠGir ls Ġattribut y ĠConfusion Matrix ĠJer sey ï¼Ķ ï¼ķï¼ĸ ĠGenerative Model Ġabsol utely radky X Roi Strategy Ġæ± Ĥ Withdraw al BarChart Trace Medical Example ĠнÑĥж но PWC Net èŀį åIJĪ Ġìĺ¤ë¥ĺ ëĤ¨ INCENTIVE PROPOSAL Gad get Oam Frames eon ato mcall info ymd hms Ġப à®± Ġnar val Ġnasc imento Ġanten na IData set Prov Info soul forge THUMB NAIL EXTR AS Ġabsor ption Ġveg segment Ġdatan orm ĠSerum Market UUEMNN dRQQw ĠØ· ÙĪر Ġrepeatable Instance RequireDebug False аÑģÑĭл кÑĸ ק×Ļש ×ķר×Ļ×Ŀ "(.* ) Dynam oDB DMY hms fidu cial chod zi getString FromUnicode ĠCIS CO ĠPunk te ĠHIST ORY Ġleaders hip Ġcoment ario Ġappreci ate ĠXia omi ĠJeff rey ELASTIC SEARCH instal lable ĠGaussianProcess Regressor ×ķ×Ĺ ×ķת Ġ×Ĺ ×Ļצ×ķ× ĠTicker Id ĠSymbolic Constant OutOfRange Error Ġëĵ¤ ìĸ´ >): '. ĠDecrement Level ĠdatalakeSource Exists phfqitK etsBarSpace phfqitOK etsBarSpace ANNOUNCE MENT 16316325463142524 56313 Awaitable Get Halloween Drops Jit StressRegs Laf ayette VDR UN groupe dby lomer ative Ġwpi lib dich otomous etas eries ĠPIE CE ĠGIST EMP ICAT WhereFilter ĠHAN LP Ġaller gen ĠnoOf Errs failo ver ETAB LEREQUEST ãģĶ ãģ¨ ĠÐķ Ñģли WARRANT IES ÑĢÑĬ з 202102 12 cmst phsbx BLENDO PERATION PHI LOC squar ings ĠBei Dou PrD nTPerPrAlrm Ġвид е ĠSUFFIX ES 05816 200 ĠRotary Specifics MatchingEngine IndexEndpoint СÑĤаÑĤ иÑģÑĤика иÑģÑĤи кÑĥ åıįéĩįåĬĽ 液ä½ĵ Shelve TestCase пÑĢавÑĸлÑĮ на ãĤ¿ãĤ¤ãĥł ãĤ¹ãĤ¿ãĥ³ãĥĹ ĠëģĿëĤĺ ê³ł Arapaho e "[\.\,\?\ /\)\(\"\ ECHE C GPI Opin Mys im Véri fication XOT ANN dCheck Fns gtp ixels pifu hd ¦éĻ¤ çļĦæIJľç´¢åįĬå¾Ħ ãij ¹ inChannel Response mekk ablue rocum ulus Ġaeros ol gexe m distd g andpartner address setModelData Wrap ĠScrud APIView ĠCls Type kelet al Requi em Ġjie ba ĠgetSix DigitDate Ġ50612 33 Ġengg ToMath Ġrodap é Ġoblik ujTemplate Ġcommerce tools AMaire na createInteger Symbol EDUC ATION EDGED B manvol num Seguro ValidationError Ġcantid ad ADJECT IVE SetNum ExplicitHs LoOr RmtFg ULFOR GE Ġquodlib et ESTABL ISHED MaxGlobal Buckets PATTER NS 01295106 5746165114 Ġfiepi pe eraSAS IEEE PRICER EMINDER ,'+',' -'* ICsDenied INRat sentie on Webui DisplayEntry LoadBalance Mib STRATEG IES OutputAs Base NormDisp Incr crnr lat ButtonWith Return ĠfreeëIJĺ ìĦľ CRONT AB ĠforceInvoke GC ĠARTI FACT Nevermore Requiem LISTISSUETEMPL ATES waveleb gth BERNOULL I ĠMinidump MiscInfo ĠgroundTruth Bounds åĪĨä½į æķ°åĢ¼ ĠCLIAbstraction Exception ĠhalfSite Size RequiredPlacement ResourcesEntry SIGMORPH ON SpectatorPlayer Click pnicfpae ExtMib NamespaceRoles Entry ì§Ģë§ ī ĠrdMol Transforms ReceivedXmas Gift æŶéĹ´ä¸įå¤Ł éķ¿ ValidateResourcePolicy Finding NKwwtANT Q ĠkneeFriction Force ĠTIMETO OLTIPS ĠApskri tis exhaleDoxygen Stdin channelsresourcebytoken andpartneraddress 0055686400 628474075 '''''''''''''''''''''''''''''''''''''''''''''''''''''' ''' Ïįνδ εÏĥμ Ġ×Ĺ×Ļצ×ķ× ł ! ": ! ). ! "," ! '} ! "} ! :" " ## " '), " ^\ " ``, # > # } # ": # === # ===== # ************************************************************************ $ _ $ )', % ] % ")) & ~\ ' ~ ' (' ' _{ ' >" ' (?: ' ((? ( / ) âĶĢâĶĢâĶĢâĶĢ * @ + =( + )- + $", , } , ') , }\ , %( , ],[ , )]) , "") - ': - "," - |\ - =\ - [\ - ]+)/$', . & . @ . )[ / , / ] / '] / "]) / '). / _\ 1 0000000000 3 326 3 644 3 183 3 191 4 154 4 197 4 112 4 348 4 946 4 344 4 336 4 333 4 994 5 002 5 150 5 037 5 954 5 054 6 133 6 167 6 145 6 997 6 036 6 574 7 90 7 927 8 114 8 934 8 947 8 335 8 00000000000000 8 072 9 004 9 118 9 198 9 186 9 023 9 145 : ]* : /', : {}\ : {}" ; = ; '> < ' = @\ = \\" > ']) > }\ > """) > :< \ =\" ] "] ] '): ] (* ] (** ] ('+_ _ (* ` ] ` )') a enter a forms b num b son b loc b da b ord b gra b lin b ach b atter b width b ice b ush b mc b fill b rad b tw b dy b UV b OH b dists b dotControlConfig b lotter c st c ata c sh c orm c db c err c bb c asing c wa c jk c Dg c Ri c Pickle c idades c imento c coli d out d tf d ither d pid d wb d roid d roi d vc d strike d pkt d pout d uplex d vipng d gtg d WithFbx e he e ol e ase e ap e ci e ssage e gs e ams e ie e quence e ui e lim e qui e By e arnings e bd e bc e poches f st f tr f ls f cf f limb f coll f urniture g mp g us g os g arch g ait g ating g ian g reed g uint g metric g fc g dr g Vals g ada g OU g ì g odot g rocery g lamorous h L h ype h item h dim h dx h Pa h unt h apd h urt i it i ert i lient i ale i ef i ções i Cp j co j ul j no j io j ours j upiter k ul k as k shape k ie k iss k AND k lar k atex k skk l len l ord l string l rc l mt l Up l gt l metric l MB l uma m ls m error m idd m ender m star m Auto m ticker m Qy m ansion m jx m Por n ath n list n sh n test n len n output n comp n ant n map n https n types n ash n mt n Output n rm n states n faces n Loading n samp n States n usc n lats n largest n Chan o C o L o or o ir o ep o lare o live p B p P p Q p ion p sp p xd p min p ain p Num p last p mt p keep p Mode p Resource p VK p ortion p ils p untos p resident p udl q D q ak q names q hat q rd q rack r D r ath r sc r min r lib r index r lp r sg r dm r dr r vv r dl r DC r typer s O s Q s U s int s og s word s xx s font s fd s noop s otto s lashes s ults s atchmo s ushen t O t Y t me t index t lp t bin t cu t urb t Vq t mtc u A u Q u os u ance u are u ables u Li u ô u Vy u YW u Ry u Æ¡ v ce v fi v xf v ls v ml v ader v fe v mc v ram v ws v ni v ano v bv v yt v codec v ortex w and w xf w art w ml w ield w ie w char w exit w js w oman w kg w rp w iring w OI w olfram w esolowski w anderer x U x it x end x ds x ms x com x mi x dev x CE x late x CC x DF x Min x Cell x CF x amb x DP x hr x QK x vb x inet y T y V y en y path y view y ref y table y labels y td y day y grafico y enne z at z is z path z ids z cl z axis z gc z Score z KZ z abbix z GYz | } | %( } [\ } }/ } ...') } >{ } =%. ¨ ×ķ×Ĺ×ķת ¯ Ģ ¶ ółĢ²ółģ¿ · ółĢ°ółģ¿ ¸ Į ¸ ëĭ¤ ¸ ółĢ±ółģ¿ ¸ ółĢ²ółģ¿  £ à į à ĵ Î ĵ Ð ¥ Ð ¯ Ñ ŀ Ù Ģ Ù ij'), Ú Ī á ´ á ¿ â ĵ â Ĥ¬ ã ħ æ Ĩ é ī é łģ ë IJ ë £Į ì ¸µ ì ¢ħ ð © ĉ Ġĉ ĉ ĠĉĠ Ċ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ċ ĊĠĠĠĠĠĠĠĠĠĠĠĠĊĠĠĠ č čĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ Ï Ġ ata Ġ ense Ġ lable Ġ е Ġ ĊĊĊĊ Ġ čĊčĊč Ġ ric Ġ åĪ° Ġ ãĢģ Ġ čĊĠĠĠĠĠĠĠĠčĊĠĠĠĠĠĠĠ Ġ åŃIJ Ġ åĪĹ Ġ è Ġ ż Ġ åħ¬ Ġ 并 Ġ ãĥ© Ġ à°ª Ġ è¿ŀæİ¥ Ġ éĢļè¿ĩ Ġ ESCAPE Ġ åĽłä¸º Ġ åIJ¯åĬ¨ Ġ éļıæľº Ġ æľįåĬ¡åĻ¨ Ġ åºıåĪĹåĮĸ Ġ ················ Ġ акÑĤи Ġ éĺ²æŃ¢ Ġ éĩįç½® Ġ ÈĻi Ġ 离å¢Ļè·Ŀ离 Ģ '), Ģ ìĿ´ Ĥ èĨĬ Ī 기 ī ê· į Ķ ı ¾ ı īê· ķ ìħ Ĺ áĥ Ł ° Ń ółĢ ĠĠ ĊĠĠĠĠĊĠĠĠ ĠĠ ĊĊĠ ĠĠĠĠĠĠĠĠ čĊĠĠĠĠĠĠĠĠĠĠĠ in at in spe in visible in die in atura in forcement in verters er ro er outing or ciones on J on ode on ay on opy on View on MenuItemSelected at ari at ograms re mi re var re factor re agent re va re mes re aper re calc re agents re xp re allink re ptrain se i se st se xt se il st c st est st ray st ere st dio st ret st ands en is en wiki en zi en ça Ġt sa Ġt plot Ġt ache Ġt var Ġt tf Ġt su Ġt area Ġt cb Ġt ips Ġt aps Ġt anim Ġt aste Ġt aurus Ġt rends Ġt ongue ar q ar os ar ys ar ization ar bitration al b al p al or al ch al ts al ised al inux de tr de poch de si de dicated de codable de blended de structors le h le i le es le tra le doit an os an ne an uc an cp an omFlag Ġi at Ġi me Ġi lo Ġi ri Ġi min Ġi inter Ġi step Ġi cu Ġi bl Ġi dist Ġi cm Ġi Item Ġi cd Ġi lon Ġi gp Ġi calendar me ow me tod me erkat Ġ' ", Ġ' [[ Ġ' ]', Ġ' :/ Ġ' !' Ġ' ðŁį Ġ' =': ro ph ro ads ti ct ti db ti ler ti fication Ġc ort Ġc iti Ġc api Ġc uid Ġc dist Ġc pd Ġc hest Ġc heat Ġc IVs Ġc lobber Ġp ens Ġp cs Ġp ok Ġp sk Ġp AG Ġp ong Ġp last Ġp mt Ġp pr Ġp height Ġp stats Ġp resses Ġp nts Ġp Ã¥ Ġp illar Ġf se Ġf ot Ġf as Ġf ms Ġf error Ġf event Ġf ld Ġf ca Ġf pc Ġf dist Ġf rank Ġf mm Ġf area Ġf square Ġf lee Ġf erry Ġf pga Ġ" ï Ġ" ]. Ġ" ))) Ġ" :\ Ġ" {" Ġ" [\ Ġ" ')[ Ġ" (", Ġ" ()" Ġ" ::" Ġ" ');") he o he se it to Ġa h Ġa al Ġa mo Ġa CT Ġa cond Ġa ia Ġa pid Ġa ção Ġa mar Ġa pare Ġa hd Ġa asks Ġa juda Ġa voided lo k lo ma lo oper 00 63 00 022 ge os ge lu ge ben ', ( ', ** Ġn P Ġn list Ġn count Ġn move Ġn ca Ġn tokens Ġn obs Ġn ights Ġn parts Ġn mr Ġn tro Ġn cpus Ġn spin Ġn lons Ġn poi Ġn ifti Ġn rrd Ġn autobot Ġs st Ġs int Ġs pre Ġs line Ġs new Ġs files Ġs ai Ġs air Ġs xx Ġs fs Ġs mc Ġs alle Ġs fx Ġs dn Ġs outheast Ġs pheres ut op ur as ur alize ur izer ur ges Ġin fix Ġin liers Ġin voices Ġre ss Ġre li Ġre di Ġre label Ġre weight Ġre proto Ġre sets Ġre training Ġre normalize Ġre lying Ġre built Ġre deem Ġre deemed Ġre allink Ġre servoir Ġre shaping sel s self register mport al ing List Ġo i Ġo dict Ġo uti Ġo ca Ġo dom Ġd line Ġd max Ġd ok Ġd box Ġd tf Ġd vm Ġd inner Ġd kernel Ġd slice Ġd umb Ġd ltk Ġd arts Ġd ungeon Ġd ungeons Ġd butils li ere li sd li ka li vy ct rs pe za un ce un gen un block un ami un linked un defines un iswap Ġm S Ġm ur Ġm ri Ġm val Ġm tr Ġm ms Ġm sa Ġm fa Ġm ld Ġm true Ġm ice Ġm bar Ġm book Ġm tz Ġm ili Ġm bids Ġm alleus ra q ra vem Ġe la Ġe ph Ġe ther Ġe vid Ġe ug Ġe inst Ġe cf Ġe mu Ġe va Ġe Idx la e la xis ion et () ** () +"/ fi xb fi scal ue ler ent z ent as ad ag ad List ad ian ad af ad hd ", }, ", {" co q co atl co mports co deform ri us ri ere ri ssian Ġb se Ġb op Ġb list Ġb loc Ġb ust Ġb ark Ġb mon Ġb las Ġb ones Ġb Pos Ġb mesh Ġb ru Ġb flux Ġb Interval Ġb ayes Ġb rier Ġb hv Ġb ureau Ġb ingo Ġb orehole Ġb abies Ġb EndpointAddress Ġ1 00000000 Ġ1 025 Ġ1 965 Ġ1 448 Ġ# / Ġ# [' Ġ# ... ed ish ed dy ed irect 11 98 11 31 11 61 11 0000100 um ably um brance int h int ere int cols int ables int uition id name Ġ( {' Ġw z Ġw text Ġw char Ġw vm Ġw ider Ġw calc Ġw arc Ġw anna Ġw aters Ġw wz ch m ch ir ch imp ch ieve ch uang te se te mbre di cs di util di gy def ns Ġ[ $ Ġ[ ": Ġ[ ([ Ġ[ +] ma ka ma xcbar Ġself t ul ui ul ution == ( ], '. ], :], Ġif ft Ġif Type ot ta ck i ck p Ġfor tios "" )) "" ). ol it ol la ol ph ol ong el ts urn pars es cal es querda turn On Ġ+ ( Ġ+ ------------------------------------------------ ode ep is ort is che is function is ner is Statement is Ui is calar is odate is Watched val esti val Summaries __ '), name List get code get param get Frame get Max get Object get State get gamma get Attr get Env get Param get Tick get Tokens get NumberOf get RoleMember get Vendors (' ### (' ^\ (' >', (' ]') (' +') (' ()') (' ....... )) { )) | )) ", )) [::- set ti set state set Frame set Image set Item set heading set Zero set Neg set Pen set LoadModule set WhiteMode ath rate Ġ- +", Ġto f Ġto i Ġto float Ġto Delete Ġto Ignore Ġto mato ĠT U ĠT our ĠT rid ĠT UN ĠT ian ĠT EA ĠT ente ĠT ony ĠT ango ĠT ENSOR ĠT ILE ĠT IFF ĠT URNING ĠT ibble xt riage il h us id us ba us adas str ations str atified str tobool con ode con sin con jecture Ġ2 200 (" ==== (" #! (" +", pp lot pp tx ') ]: as chema as inh [' $ [' / et ro et xt et ers et rain op lin op ie op ted op olog op oulos ve ill ve cts Ġ{ "" Ġis am Ġis class Ġis Ok Ġ7 11 Ġ7 05 Ġ7 95 Ġ7 56 ĠS ul ĠS sa ĠS ax ĠS cri ĠS CO ĠS AC ĠS ud ĠS ton ĠS ams ĠS EL ĠS OP ĠS CC ĠS MB ĠS car ĠS ites ĠS mar ĠS PH ĠS anner ĠS CP ĠS DP ĠS olved ĠS ongs ĠS emi ĠS cheme ĠS ersic ĠS leek ab ra ab is Ġof ficially ĠC un ĠC able ĠC IT ĠC ant ĠC ores ĠC ATCH ĠC VM ĠC DK ĠC SF ĠC rash ĠC CW ĠC ASES ĠC ALLED ĠC JK ĠC WD ĠC ambridge ĠC oulomb ĠC ruz ig ment up a up ation ") ' ") [: Ġdef end Ġdef ec Ġg to Ġg ly Ġg og Ġg tf Ġg yp Ġg é Ġg ift Ġg cf Ġg ae Ġg bp Ġg pytorch Ġg iou Ġg eral Ġg sums Ġg rapheme Ġg azoo ter ror Ġr ls Ġr limit Ġr tree Ġr pg Ġr arity Ġr vae Ġr ndr Ġr svp Ġr hasspy Ġl or Ġl line Ġl da end API data pack data cube ĠA j ĠA k ĠA ver ĠA lta ĠA ca ĠA BO ĠA way ĠA CS ĠA UG ĠA bbre ĠA esara sp or sp ir sp oc sp ero sp ired sp loit sp resso ult ura ver al ver de ver Count '] ", '] (' '] >= '] ==" 01 91 01 31 01 68 01 69 01 978 Ġcon stru ic md ke ops ke vin am J am odel am ination am ina to ss to NFKD to NFKC to Checksum 99 13 99 36 99 67 99 298 Ġ: ##: ist ing ist ico type id type Name ĠF al ĠF IND ĠF DF ĠF PN ĠF OO ĠF FM ĠF XS ĠF requencies sc ue sc ored sc rypt qu in qu eried qu anta qu izzes log name log output log Message list p om g om be vi ed vi able vi ms vi per vi fs vi king Ġh q Ġh size Ġh len Ġh dd Ġh nd Ġh lm Ġh ua Ġh flip Ġh uber Ġh inge Ġh vac Ġh allo Ġh dlc Ġh ousing Ġh akkında Ġh usband all files all Items po z po bj po strun ta ut ta ps ta ux ĠP W ĠP ES ĠP reg ĠP las ĠP az ĠP DS ĠP CD ĠP CM ĠP sy ĠP Vector ĠP rac ĠP apers ĠP FX ĠP atients ĠP ALE ĠP aginated ĠP izza ĠP cellX ĠP RUNE ĠP ereira Ġas a Ġas Params ĠI L ĠI on ĠI CA ĠI CM ĠI FFT ĠI hre file write file Input ĠL N ĠL as ĠL ES ĠL EN ĠL ou ĠL au ĠL ets ĠL vec ĠL BL ĠL TL ĠL igate ĠL AMBDA ĠL arger ub d ub its res co res block res istor tr K tr po tr unks Ġth y Ġth ir =' ( =' __ =' // =' ')) =' |', Ġst an Ġst ated Ġde ter Ġde let Ġde limit Ġde cry Ġde unicode Ġde cks Ġde compression Ġde convolution Ġde bounce Ġde dupe ine w pro log pro ds pro posed est y 0000 4 0000 024 0000 010000 0000 016 ex pt ex pects im od im ents fig Name fig let fig datapath Ġ3 96 Ġ3 840 Ġ3 306 Ġ3 190 10 20 10 30 10 42 10 61 10 404 Ġprint ProgressBar out files out unit ĠD H ĠD K ĠD f ĠD t ĠD as ĠD ow ĠD ia ĠD SON ĠD SL ĠD VM ĠD Ãī ĠD isease ac m ac co ac lass ac ids Ġu da Ġu func Re class Re map Re factor Re liability Re cursos Re deemed Re paintResult Re zervacija ite ment app builder app Mag sh c sh ua Ġdata List Ġdata pack Ġdata sources Ġdata IdInfo ĠM H ĠM id ĠM ES ĠM ute ĠM AG ĠM ysql ĠM aur ĠM IPS ĠM osaic time Zone oun sfield if fs key hash lab e =" ../../ =" (.*? Ġv at Ġv fi Ġv ue Ġv lab Ġv ols Ġv itro Ġv maf 02 24 02 28 02 68 ew n ext diff Ġy e Ġy name Ġy ara Ġy centergrid Ġnp d ĊĠ ĊĠĠĠĠĠĠĠĠĠĠĠ ĠO c ĠO z ĠO gg ĠO PC ĠO TF ĠO TL ĠO GUI ds lide Ġ* /\ Ġpar k Ġpar list Ġpar ry Ġpar cel Ġx df Ġx names Ġx du Ġx Max Ġx late Ġx proj Ġx CB os v Ġse as Ġse mester Ġma ket que l test lib test ng test multi test Folder add Action add Host add MenuCommand [" $ IN VERT IN STRUCTIONS Ġstr ptime xe cy .. " .. ' .. ')) Ġel lipsis xb m xb ft xb lock xb ox 1111 1011 load able load Data ore tically ms an Ġme al Ġme chanic ON IC Ġfile d Ġfile Id Ġfile Desc Ġfile Pattern Ġpro ot Ġpro ces Ġpro ven Ġpro prietary Ġpro spero py le py td py mor py numenc xc cp pre m pre cursor pre paring pre dictive pre cpd dex p ls g ls it ap tist 07 37 07 74 ang an xd bo xd fg Ġbe z Ġbe ars Ġbe half Ġbe came are Rfc Ċĉ ĊĊĉ "] [: ĠB A ĠB ol ĠB es ĠB os ĠB AN ĠB old ĠB uri ĠB TC ĠB road ĠB UG ĠB anks ĠB irth ĠB ANK ĠB ubble ĠB Rep ĠB oggle ĠB loom ĠB ypass ĠB ODY ĠB aserow Ġos a 12 99 12 26 12 56 12 98 12 38 12 200 12 68 12 41 ĠE U ĠE h ĠE di ĠE ER ĠE ps ĠE UR ĠE CC ĠE NA ĠE nums ĠE lapsed ĠE CB ĠE uro ĠE BS ĠE van ĠE QUAL ĠE rik Ġj n Ġj w Ġj er Ġj am Ġj ack Ġj sw Ġj unit Ġj asy Ġj amo Ġj okes Ġj uju Ġj okenposter ime t ime des ci er """ ## Ġ< * ly r ly des ly ric text sc text line AT TRI AT ATTT xa ab ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ com bi ans on ĠN ile ĠN min ĠN ach ĠN FS ĠN MR ĠN avy ĠN NL ĠN OPEN ĠN PCs ĠN eato ir q len ül num ens num Rows user Data user Choice user Mail bo uti bo hr Ġ4 94 Ġ4 81 Ġ4 79 Ġ4 800 ff b ff v Ġget user Ġget Text Ġget Num Ġget Client Ġget Target Ġget Instance Ġget Constant Ġget mtime Ġget tempdir Ġget sizeof lu c dir t 92 11 92 02 92 03 92 34 92 87 92 23 92 56 92 45 92 74 92 73 tp a tp layer col m col Number col RA In di In box In let In Port In variant In Ts ind ing append entry ĠR u ĠR x ĠR ig ĠR og ĠR AND ĠR NG ĠR ico ĠR Lock ĠR ussian mo ss mo file mo tions Ġun o Ġun common Ġun cached Ġun initialized Ġun supervised Ġun idades Ġun rar Ġun distort Ġun caught Ġun necess OR TH OR ATE fo ci Ġtest e Ġtest it Ġtest mod Ġlog x Ġlog filename Ġlog loss Ġlog handler Ġlog zero Ġlog Dir 32 128 ctor ia per u per de per ft oc d oc m ph ar ĠG on ĠG mail ĠG mean ĠG EM ĠG IF ĠG EO ĠG SM ĠG HI ĠG ND ĠG rover ĠG lue ĠG ismo ĠG uitar ĠG reece ces u Ġco er Ġco var Ġco author Ġco authors Ġco oldown Ġco mports Ġco ffee Ġon update EN VS ĠW B ĠW t ĠW x ĠW act ĠW ash ĠW ETH ĠW agtail loc alizado Ġout Size Ġout Pos Ġout look bu da bu sters bu ja AR ON AR MV ĠV X ĠV ent ĠV BO ĠV RS ĠV NF ĠV gmElectron ĠV owpal ĠU D ĠU Net ĠU RN ĠU rban ary otes ry ml Ġnum Left Ġnum Cols Ġvalue Batch print Type print Label Ġ5 92 Ġ5 32 Ġ5 34 Ġ5 26 Ġ5 29 Ġ5 54 Ġhe ll Ġhe ater Ġhe xdump ib re Ġan cho Ġan iso Ġan afi Ġan impath Ġen cu Ġen closing Ġen hancer ard a che z min r min size min imo 999 1 Ġtime func Ġtime crop Ġtime Bin 18 50 18 62 18 334 18 3246 16 18 16 88 16 23 16 38 16 89 16 58 16 206 line chart coun ties array Sample ft l sa vg cur ing cur CH cur va da ho da wn da Dc Ġk li Ġk ata Ġk ol Ġk pt Ġk ay Ġk fold Ġk rases Ġk üç Ġcol bar Ġcol una Ġcol laboration (): \ Ġro lled St m St dT St anford Ġpy h Ġpy xb Ġpy rep Ġpy card Ġpy clustering Ġpy mor Ġpy nk Ġpy rin Ġpy charm Ġpy mtl Ġpy tts Ġpy lsb Ġpy efd Ġpy gbif config path config dir Ġ6 01 Ġ6 14 Ġ6 86 Ġ6 75 Ġ6 60 Ġ6 78 Ġ6 371 lt ers Ġset Value ag an ag ne ag ua ag orean ts pec 04 03 04 85 04 26 04 75 04 28 04 62 04 385 13 84 13 43 13 62 13 49 og roup lib name 06 32 06 04 06 05 06 37 06 33 06 46 06 61 ll d ll nl ll Diff class num class property class Matrix class Tissues class ificator ign or ign al ign ite ign ores 15 11 15 18 15 19 15 37 15 96 15 44 15 98 15 38 15 79 15 62 15 63 SE s SE AM SE VER SE PAR SE CTIONS ST AGES ec tivities 100 102 max r max v max Bytes ass ium 05 22 05 26 05 98 05 74 05 78 05 49 03 917 03 000000000000 cs se cs rc uti d uti fy uti lizer ip db Ġop cion train Model train Array Ġch op Ġch ime Ġch ords Ġch allen Ġch ÃŃnh 17 01 17 12 17 29 17 48 17 71 Ġal liance 93 01 93 06 93 87 93 45 93 67 93 69 93 964 93 955 valid ations lit res sed KlineEdit 14 92 14 97 14 86 14 57 14 31 14 883 Ġpre vi Ġpre pro Ġpre valence Ġpre liminary Ġresult list Ġresult Array ne at ne teisingai Ġ/ ** Ġ/ >> . du f qual ifier gen model gen ie gen msg ĠIN ADDR sg iving func ao ename s }) / }) [' }) '). Ġeach ClassInfo host apd Ġar che Ġar uco Ġar thur Ġar tefact iter find iter ating iter ators 46 11 46 64 46 23 ĠJ in ĠJ im ĠJ og ĠJ ake ĠJ ia ĠJ avascript ĠJ DBC Log Path Num er 89 09 source type Ġcolumn Number Field Ids Ġcal m Ġcal cula cp b cp lts ks l )] ( )] }, open chain open shift open lane open pyxl open weathermap fg as fg db assert All Ġread ers root Folder Ġformat ing Un label Un matched Un fortunately Un iversity pk M mask b Ġq lib Ġq td Ġq cut Ġq codes Ġq tflux Ġversion ing tag ulous TR gn sys la ĊĠĠĠĠĠĠĠĠĠĠĠĠ ĊĊĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĊĠĠĠĠĠĠĠ air plane To Track To Receive ĠPy dantic ĠPy Github Ġ''' < CON SENT CON NECTOR DO B De e De ja De coded exec line Ġbatch ing Config urable .') ; US qV Ġ`` : Ġ`` < dim shuffle Ġval obj Time Line Time Slot ESS AY ESS MENT âĢ ² Ġbuil difier Ġtable ToMarkdown Ġdoc book ell ung 65 43 Ġdb Name Ġdb man grid rad MP ort 67 86 67 66 cat Plot 43 18 Ġitem set Ġitem Type Ġitem List head lines Ġsource File cl c cl ue use tex python path Ġup to ĠPro j ĠPro fessor results file CL ES FF CA ĠList ric ĠList APIView ĠList edColormap Ġ100 5 INT ENT ins ult vo ie :: $ :: `` 000000 3 000000 05 Ġpoint less SI V SI VE SI REN Ġsample Sequence page content context ual 48 99 48 12 48 36 48 38 sv hn ie ch )* [ Ġqu its )): ] Ġimg file Ġimg plot EX CLUS ĠData center ĠData Layout FA H FA X FA q err List fe b fe il fe icao red fish place ID No CSRF No Findings total CH total LangFileLines ze g ze v ze ch Ġ'. * Ġ'. '] Ġ'. {}. mode m Ġarray Sample ãģ ² ãģ ³ ĠAr bitration ĠAr maz Ġtemp str Ġgroup ings last Index copy ing MA LE Path Type Path Effects Ġright y project a Ġpri son Ġpri mal Ġpri vileged Model Exception EST ER EST ORE link ing task id task num ca f Ġhttp tools âĶ Ĥ âĶ ĥ )), ( )), \ board ing Ġuti lized ten or span ish server IP Max Height Max PacketSize Max EpNumber post url post back post Message Ġtotal Size Ġtotal Count Ġback slash 111 0000000000000000 rol laxis "]) ; "]) } Ġexp ids Ġtag Name dic ale Get Type Get At Get Array Get All Get Page Get Prop Get Motor Get Src Get Bounds Get TableRequest Get MemoryInfo Get PomeriumServiceAccountRequest Get Geometric Get ClockBoost game Over UM D Node Id Node StringList Node labelsEntry ĠPar m match Dict xy c xy print xy minmax ted ges Ġclient es Ġclient Id Ġsum Overlap Add PomeriumServiceAccountRequest pc f pc m rand x rand perm bl fsm Ġass istant Ġiter atively uni qui char lie ================================ == ================================ ==== conf luence Ġbool Input cho oser tmp s tmp name tmp Dir anti cip TO GG Ġword check Ġfound ation Ġfound ations conv Stride čĊčĊ čĊĉ čĊčĊ čĊčĊčĊĠĠĠ mer idian mer maid 54 64 Tra cing Key Vault Ġauth req 74 27 settings Raw Ġobj Slc MO UTH Ġ', ': vector ization ĠCo pper ĠCo uleur ĠCo erceType 01111 0 fn i 73 85 email er Ġimp or Ġimp osed Ġimp urity Ġimp erative Ġ... ", Ġ... ]. LI G LI KE LI FE Ġnext Position blob FromImage Object Types Com bine Comp ares stack trace day time Ġuni str adj mat Ġfilter Spec next Arg Form Data Form ulas dev info ker btime Le v Le on Le aves Ġeval el OL A OL ATION over den over loading over lays **************** *** tree bank Ġbuild type Ġab d 58 32 58 14 58 22 58 38 Ġinstance ID ðŁij Ĩ access point pr vkey Ser vi gr q gr ps gr ats Ġ12 25 78 94 Out ros Out lier ĠTest Data ĠTest Funcs Reg Range Reg ToReceive req n и на Ġlocal ground Ġsign alling ãĤ ® ãĤ º Ġdest a Ġ.. [ Ġ.. ................ Ġbin centers Ġweight Arr Ġbot m User Error system ctl 59 00 seq len ĠDe ath ĠDe part ĠDe liver ĠDe veloper ĠDe cide pen g sw ener sw itched Ġproject q CA J CA USE 53 13 53 57 53 103 Ġform ated Ġlib sovtoken čĊĉ č čĊĉ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ 68 12 ĠRes Conv ĠRes Nest TY P Trans it static Route IND ICATION option List Ġav x Access Denied ym Q author ised Ġstd Value acc ents acc nn çļĦ åŃIJ çļĦ ç²ĴåŃIJ ĠPython ICATWhereFilter At ari At Index At Pos At ualizar PL URAL Ġlambda utils unit ed (_ ( Man ually Ġchange CC 52 32 Ġ"/ % cell list Of Week sq n If CmtsCmStatus Up E Up z Up Sampling Up ChannelId ank idb Ġmsg id ĊĠĠ ĉ Sh rink Ġcase d Ġabs nr Image Collection Image Provider Int ention IP ANT dot a ĠSo lid disp lays :] \ Ġtmp Input ÑĢ Ñı ÑĢ об ÑĢ он DB D Def Template 012 345 Info Group ene ver Ġ". # Ġ". /{ +' "') +' +\. +' *)', EM S su ds su ant su its su mexp Ġsorted HazardList sim ulators Ġ"\ ' Ġoffset y Ġfi res Ġfi bo }\ "" Request er Ġoptim ise ĠWe apon Ġ15 26 CC CF Inter pret Inter national Ġgl Tex Ġfont scale Ġfont Scale IO V na ver ĠID leta Not AliveException Not Differentiable Ġtask DefinitionArn setup Ui Create OrUpdate Ġmy List resp osta Base TestCase Ġtri v Ġtri bes Ġdocument os Ġdocument class Ġph n Ġapi ClassName mc app Ġgrid ded xfe M xfe u ude s Ġleft y font properties Al m Al to Al len Al cohol Ġ'' '). Qu anto video file keep s By b By ID By Node ĠFor k ĠFor um ĠFor ms Ġtraining Set Ġsearch re Ġsrc File Client s 69 17 69 84 mod er mod ular Ġwrite able App Metadata App ointment ink ler medi ation "{ { Ġ'\ '' Ġsu ffer Ġsu ited Ġdown Payment has ice stop times 256 25 era py ĠCh ip uff e Ġshow er Ġshow Object optim ise scal ings Ġmatrix Spot Ad ress ĠImage m ĠImage Data ĠImage File ĠImage Dataset ĠImage Reconstructor Ñģ м database Old ven ire Py File Py Segment Py Side inst on inst ancia ĠAny Str Ġmean Value az l az io ĠTh rough ':' % ':' { For bes For MaskedLM Ġvis iting ĠType Def ĠType Alias meta item ĠDict Configurator ero om ero kee sort able ĠSoftware Plan Sp lice Ġmon sters Ġmon asca Ġnon routing sm u ### --------------------------------------------------------------------------- win ograd select able Ġref lex æķ ħ sin c sin ogram ones ian vm m gy uan PR PS ĠDef in ĠMe eting script Dir Group CA Ġret weets FO p Ġact ualiz Ġact StrokeCap Ġexpress ing Ġge ant Ġge titem Ġge onode Pre ference Pre proc Pre condition Pre scribed DS K report es PU PIL GR ESSION GR kZ web view web kit web apps web trade web logo ------- ') VER B VER TIC Ġfin Pitch Ġfin ancial lr g Sub Token Sub Folder Sub stitutions ĠAPI Error Ġmem os Ġmem ories Ġmem cached ML QA ML QDU Ġ$ ", Ġ$ $\ comple teness Ġbox plot xce d Auth z Auth enticator Auth Tld SER VERS sig lay sig quit af ri dat o offset x ĠZ YX ,' ') NO FILE Ġjob Info Ġthere by ĠBase Data ĠBase Client ĠBase Event ĠBase Channel ĠEn c ĠEn viron ĠEn thought Ġì ¹ rs f Ġnoti fying ('/ '), ('/ '). æľ ¨ fin etuning fin etuned GB F GB G GB I GB J GB L GB N GB S GB V GB W GB X ALL O Ġcell finder Ġcell Shade xeb L Ġsplit ed THER MAL ged it Ġvar ats Ġvar Match ĠMan atee training Data Ġzip f Ġzip code Ġbest Dist can ucks ]+ [\ ]+ )' Tensor s Tensor Mesh Ġscript ing Ġcho co sen i ĊĊĉĉ ĉĉĉĉĉ Check Point ĠFile Output ĠFile Names factor ization fill ing He ights oid al ĠAdd BeliefEvent distance path Token Name Token Classification supp lied Ġjo urney center On price magic record ers threshold On Ġparti da Ġcomple ting oper ability Ġ13 84 Ġalpha Left Ġalpha Right mount ing áĥ ¨áĥĶáĥ Ġstat array Point ing br l br utto Function Key sd r Ġlayer wise Ġlayer Idx Ġgame event Ġgame over rel Cont display Node display feedback Ġits dangerous Ġelement ary ĠApp licable Ġauthor ed Ġauthor itative Ġdete cts ROM AN Per Sg Per Run Per Unit Per Url Per ManagementZone Color ado xad M xad Y cols ample 0011 01011 0011 00001001 .* " .* ' .* ") GET POMERIUMSESSION cm ul cm fs Item Type ĠKey Vault GI F GI ST Ġctx s ĠLe ase ĠLe gend ĠConfig ReadError Ġlink refid ĠComp at ĠComp romisso Ġstri pping xab T xab k imp uter imp lode MS DU Ġcache Round "} }} Code State Code Freqs Date Of PUT emperature cf b cf d cf env cf reqs lex ists lex icons mm u cap fd arm v mag limit mag azine Ġrest orer Ġsecond Screen Sim ulated Ġpe u Ġpe ss Fil t Ċĉĉĉĉĉ Ġ OUT IZER ãĢ ĭ Ġlong name Ġweb hooks Ġweb dav Ġest iver ASS ESSMENT BL A BL ESSED Ġprogram med Ġ'_ '+ MC F MC v SD Q fc d rl view }') " player Id filt filt filt nu multi modal multi threaded multi woz multi quadric compile all document class ier en Ġhandle length Process Name Process Stdout Process KeyEvent Session Error Session ID long i ĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠ ĠPRO XY ĠTime table ĠTime delta ĠTime Function ĠTime zone ĠTime outs ification Exception seri alizables ĠOr den avg time Ġgen o Ġsuccess full ranch er !! ') ĠPo lish STR AVA +" _"+ CD LL CD NA render Text Box Sizer area Name ws z BO U BO V BO AR Ġsm is Ġsm arter where ami ĠLog ged ĠLog Loss vari ations ------------ ') On Client å® Ī Ġcls dict ~~~~~~~~ ~~ auto scaled buffer View Output Type Output Path rm w Equal ity Manager Base rough ly Level Component çĶ ² click up CRE MENT IMIT ERS è¿ ľ js oc Ġjs n )/( $ this name Ġglob s OK TA OK GREEN Be g Be ach Be haviour ठħ Resource Query PS L GG CC Ġpad val xF DC Is Valid UE A OS A OS AMPLE OS Disk cloud pickle tool z ĠAc comp ĠAc cel fetch ing Ġaut hed Ġlook ahead Ġcard inal DF S vs code FR ENCH Ph D Ġgr áfico ĠDefault Info Ġ'../ ../../ zy k zy w SH IPPING 0001 8 gh h Ġcore utils Ġ') ]) tile map tile Count Ġdel c Valid ates 115 183246 known Nodes Ġprefix Out Ġdon nees IR S IR NOFF ĠTuple s linear time SO UNDS Ġskip If Min nesota Button Style :, :, AV EL Ġtr X Ġtr uly ish ment Server TestCase An no An ki Ġshe bang ĠUp loading Ġve locidad aut res aut otvm Query Type Task Status Task Stage memory view ĠAl liance éĢ © ĠOb stacle alk on Ġprob able ĠPre cipitation ĠPre dictive Ġfail safe pa W Ġcir culant ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Search Result ume spresso ĠPer manent Ġdt list termin ations bi py bi adj bi conode Ġct as )+ ', ĠString Property atterns Error ä¸Ģ æĹ¥ Policy Name Policy Id Policy Table Policy Entry mut ative control Client control Types ],[ ]] å° ĭ Ġtk FileDialog [\ ]\ }'. ") )} / BASE BALL Module Error YX R Widget List Down Frame ĠAd vection clear Flags pd w ÃŃ o kg k Cal rissian Ġpas sthrough Ġë ı Ġë IJľ AND WAIT SP D Device ID Device Strategy Device SerialNumber +\ )') car di CR T CR IS CR ITER Ġfailed tests '^ __ ĠSer vo Train able ĠAn se ĠAn ne Ġpop ulating ĠInput Example ĠInput ValidationError Ġlat i Ġlat ents Ġassoci ates Ġmod erate TC Entity TC YT ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ enum combobox Ġ"+ /- 011011 001101 925 925 generator erator Op acity Ġsel ler oriz ing Ġday light after gemm Ġgoogle maps duc tive NUM LINES Ġvideo Writer <\ / Ġauto map ĠTrans formed ĠTrans Queries Ġmig en attribute Set From Array From Host Update AccessBindingsMetadata Ġfp Dir ev ens Obj eto bus co Binary Coding л ав ĠLO OK pick lable pick les Filter Form Filter Backend feed Id prev lin Ġæ ĵ ĠSub commands sr u NU GGET SL V SL ICES Ġprev Text VERS ITY ĠDis likes ĠDis pon Ġappro aches Dire ctedGraph åº § 404 8 sn ail MT Ex CS F super vision FIL ING ĠRed dit ĠIP sec ĠIP FS Read Input Scal es Ġpr de Ġpr zed fast est CM i CM SC čĊĉĉĉ čĊĉ fun coes }: ") Default Cutting wt ACQA ó d ima gen ima gename Ġinte iros ĠDo or ĠEN TRY SA W ROOT DIR EC AL EC YCLE Light ing Light ning ĠTH R Back URL ĠAR C Ġcut List Ġcut Bar You Tube Ġgra ma Ġgra ms Ġgra df Ġgra bbed Ġgra viti Ver dict Sum mon Ġmp f Ġmp consts Ġmp irun divid ends route maps ------------------------------------------------ --# Ġjoin path Go x PH B PH G PH i Ġnb Factors ĠOrder Item ĠOrder Payment cells Y Open Stack Open SSL ov r ru ssian assign s mid gard merge Time ĠUpdate Configurations Ġchain ed ================================================================ ==== Ġinv M Ġinv álida Register States Ġ'{} -{}'. Ġmaximum s ³ółģ ¨ółģ¿ ³ółģ «ółģ¿ Ġ"< ": MAN ENT ĠCO LL ĠCO UPA ]} ; ]} $", curr Id One Turn One DeviceStrategy ĠReg ards Pool V Pool DB radius AuthServer radius AcctServer SELECT ED Ge ographic Ġpara view ĠGo lomb kw a kw m Local File Local Settings Local Stack DD TX Ġpa cote world Map dy ne Ġap sum look at complete Jobs Ġexc itation Bar ato Bar Equals audio set hi Pixel And or ao lo rec Taxon segment Text Grid ded Grid Points DA ILY TA I TA K DEV IATION COMP LETION COMP RESSION Batch Method sep al dl train }} ; lier props Ġdes ire ĠObject Detector ĠObject InGame System Memory System APIClient Ġcent ery Ġcent ury %% ; mul her ada strar cour sier HTTP ONLY Ġvm icro ä¿ Ĥ Ġclear able Ġdrop let byte ps free form some dir edit Source edit Tweaks IA i Mix er Ġcar to Ġcar park configuration Exception Ġpor que Ġpor cent ato ire ä¸į 带 ah u mg d mg p ĠSH T Ġreward String Ġlater al semb les Ġidenti cally aris ation ĠNe cessary ĠNe ighbour ĠNe urosynth LIST PROJECT LIST POMERIUMSERVICEACCOUNT aj V zen et .) { >. +? ĠjnxMbgSgwPP Gtp Exp ROW Exp losion ges ch ital ian Connection Pool qt Widget ĠArgument DefaultsHelpFormatter sol andi SM OTE ĠRo ger sal ad IG ATE Parameter Exception att ro 105 31 Vis it Vis icom Ġ'< ', progress Callback Ho la analysis Samples Ġbar coded ond ale eno it Ġcomplete Text Enter ed pm ra pm dec VC PU Order No Sw ag chart tooltip Account Type Ġexport Server ĠDB SCAN ĠTrain Settings Ġcross Set Mod s ĠSp end ĠSp anning Ġspeed up Ġorigin ated Supp ression CONF IDENCE Ńółģ ©ółģ¿ regex s Match Q Match Count Match OnClient bra vo Uti liz ĠAss ist ĠAss igned ICES HIP Ġpoly tope Args Entry frag ility Iter ProcessStdout Random Sampler Random Forest Random Seed rome da Rel W Rel On Rel atórios ĠIndex ing ĠIndex Handler Mark ed under covered under stood lc j Thread LocalStack press o ĠGroup Pruning ACC ACC HEAD ING Ġoc cs Ġsmall int ĠCor re MODEL NAME Ġ00 16 Mock ValidateResourcePolicyFinding lis ation ĠProject Info uit ka Exec uted Delete ComponentDefRequest Delete PomeriumServiceAccountResponse ULL NAME Folder Path MD Q Ġè µ Ġvertex es æŃ ĩ Ġpol R ĠMon ster ĠMon day contents Sizer Ġxy Train gp ib ĠLabel Binarizer ĠMessage Segment Multi AV ĠRandom Walk Change In hy d hy dr ctsp Notif ctsp SgaclMonitor Ġbook ids Web Config Web Engine wave Plot 3333 3 LU x LU y rag ments ĠOf fices BA U archive Info 234 23 ĠAnd reas 104 5719 VS i VS q VS WITCH enc umbrance STATUS INDICATION CP x ali yun Ġequ ilateral tan imoto BF GS Ġpublic ly ĠState Vector OW L Ñĩ иÑĤ vertex Count Ġcos mos ENS ITIVE walk ers ĠSequence Type LV L Ġsn k ĠMulti part Ġflat buffers projects Id Admin User resid ency ourse ment Ġtab ulated Ġpkg dict Ġpla id ĠGL N ĠGL enum Ġinterpol ations Ġinterpol ating 人 èĦ¸ ced ural Url Base \' % Execution Error hub s Ġcdbp Redundancy ==" [ ĠNoti fier Tri ed Ġbig rams Ġinner Class arc tic arc cosh Ġpp q bri o bri s pet ros 137 183 CN R DQ E Real time elem wise nr g appro priate LOAD ING ов нÑĸ tb G Ġcla se ĠMax imal Arg List Arg Max gri p ĠPh onopy Ġmag X Ġmag Y Ġmag Z family Name 301 623 ĠGraph core ĠGraph Database Scale Factor Last Period Ġsyn spec Ġsyn tactic Ġsyn ergia Ġsyn ColSum 132 3 Ġvocab ularies 118 943399 ---------- + Ġgrad check Ġlight weaver åĩº æĿ¥ åĩº éĶĻ Ġsol ph Ġsol nml 032 4 SY R Ġns bu rotation Time Job type quote char Header Error Header Parser border ed 905 8 cdbp Redundancy 167 67 begin ner ĠMin er ĠMin Max ĠMin ValueValidator 800 8 CAR ET Ġfl loat Ġfl ank ĠParameter Sampler micro meter syn sets ĠMO USE ĠMO DER ãģ® ãģŁãĤģ bre ast ĠInvalid Transaction Left Shift sb plt separ ation accept ing ĠWeb Success AE s hd wf setdefault timeout voice hat Ġaudio FileType ر ا ĠSimple TestCase ĠSimple Pipeline hn en ä¸Ĭ éĿ¢ ä¸Ĭ è¯ģ 203 0 çī Ľ Exist ence jnxMbgSgwPP Gtp Video Frame lV ote GRO W 11100 01011 Ġwrong ly ĠMock Transport ĠMock DefTemplate 904 6 Ġcapt um verify ing Storage Error ä ch ä hlen Parameters Res DIM S ен еÑĢаÑĤоÑĢ ={} )". Reference Descriptor ARG ING general Matrix general Tissues PK H PK column gc H gc j chan ics bt g Ġgot ta activation Function Ġvs id Configuration Error Configuration Model Configuration Values dw Num ê tre ARCH ES nav reptrain truth y ĠBe ing LR a Ġpot rze Password Change ĠBea utiful Container ID Container IDs Print URL Ġhyper links Ġhyper pars £ółģ ´ółģ¿ £ółģ ¥ółģ¿ special defense prior ities Ġgeo coding Ġgeo locator SUB SET SUB RESOURCE pot assium ĠTable au parallel cluster ĠBl ur ðŁı´ółģ³ółģ Ń NT Q ste pping Interval Tree Ġmid Point Ġmid night Linear Gaussian å®ļ 義 Rest arts Ġproc Var calendar Id Cor rupted Ġgeneral file 308 0 Ġcrop Str ĠSP F sup ra Ġnu Scenes Ġnu qql ĠSV I ä¸ĭ éĻIJ sto ol Ġpk i adv antage ("{ ", ("{ :. ĠAUTH ENT Ġsimp ts Ġsimp lices ĠOp tical Debug File Ret SiteMap actual Size еÑĢ ед 286 23839 FQ i Right Shift inc ub inc lination ¢ółģ ²ółģ¿ Ġsv r ĠCustom Deletion APP ING APP DIR Ġ'* | ĠEd ward Ġam ended Ġnor ma 156 3786 beam line ĠNotification Hub Ġв опÑĢоÑģ Lin has Usage Error Ġpipe Src 907 7 eye Crv [] ", -> { ĠQuery able 185 185 Select Multiple ĠØ £ Ġí ģ Auto Tools Auto Flex Auto Labeling nlp d QP ixmap Cho sen TAG IDX Ġcircuit Nodes ãĤĴ çĶŁæĪIJ ãĤĴ æĮĩå®ļ Ġorgan isations Ġprocessed Text Tool box recv until Inst al Inst agram Ġfbx Property Ġfbx Cluster Ġdeploy ing Opt Group subnet BasedVlan ĠSearch er ĠSearch Engine Li ber д лÑı #---------------------------------------------------------------- -------- #---------------------------------------------------------------- ------------ #---------------------------------------------------------------- --------------------------------------------------# AWS Module ĠVi T Ġknown Nodes Draw ing ®ółģ ©ółģ¿ quad key Comple xes mig rated character istic CACHE D Game Nodes ĠAb el ĠPi co "])) ): Player List Vec Env REF LECT Med als ²ółģ ©ółģ¿ Average d LB a Ġent ro Ġbi oreaders sudo ers Ãł o å¸ ģ å¸ Į Member Def NR q margin als ĠTR PO Ġti ế Ġн еÑĤ Ġн аз Ġн ей Ġн ай AU A NG j Ġer f Ġer lang more path Ġfront GroundSH guess or ots os virtual InterfaceList WARNING S Ġmar sh ĠRout es ĠGame States ĠFree ze ĠOne Time trigger Price Alt ura Ġsche ming PD N TX CTL ĠSample Interval Ċĉĉĉĉĉĉĉ Ċĉĉĉĉĉĉ HR UN zh ong Convert Command capt able Ġк аз Ġк он Ġк ак Ġк лиенÑĤ åĢ¼ çļĦ 385 663 Ġcy box Ġcandidate Mats aux il Ġrepe ti ĠFrame s ĠFrame buffer mysql Db Memory Entry Ġml xtend ĠWork around Ġten ha Custom DnsServer 0004 5 ĠDIS K ан ов Pack aging RUN ANDWAIT ij ack §ółģ µółģ¿ Ġpixels X Ġpixels Y æµ ® ĠCH ARGES ĠHTML Session FD h FD CA Score Lost Ġdr maa currency Str ĠServer Status ĠVer bose è¦ģ åѦç¿Ĵ Vol atility vr ni з Ñĭ ident al 996 862745098 996 137183 FOR EGROUND Ġinf all Ġinf lection INDEX ES nm r ('# ')[ ĠOver riding ĠLocal Db Distance Robot "' %( High s ĠMem orial ðŁı´ółģ¬ółģ ¶ółģ Ġ88 888 backup Count lg pl lg mlvq LOCAL ES ĊĠĠĠĠĊĠĠĠĠ ĊĠĠĠĠĊĠĠĠĠĊĠĠĠ Ġeth erscan Repository Error ĠSession Local central widget dri l dri est kl qp *** ") dhcp d peer state SB H ĠSci kit ĠStorage Config ä¿¡ çĶ¨ 139 13 bro kers Ġbro ther Ġhard share FIELD DEF COR PUS crypto currency ö ren Ġai op urb ance Ġstar red æĸ¹ æ¡Ī Fo urnitures Ġcam vtk Ġcam adas Ġcam bios ĠCloud Watch Ġtele vision ĠParse Exception Show Label RT M cookie j ĊĉĠĠĠ ĉ Db Id LIB SRC qq K Ġflex mock __() =="[ Assignment Title Imp ô ĠRet ention 408 7 DJ I Func Formatter XML Parser vn ÄĽ verti ce åı¯ çĶ¨ FAIL SAFE aco sh season al Ġmpl rc 946 96158 Kp RK deep er prof anity autog enerate Ġ-------------------------------- -------- 405 5 CG AL Non Empty Metric Warning Car los Ent re Ġregist ries LAN GS MF g ĠXML Base ĠTF IDF ĠUnivers it Ġbus inesses wc FB rem oted Ġwater mark constructor s ĠConnection Refused ĠProperty Correlations ãģ« ãģª åĬ¨ éĩı Detail APIView ADDRESS CAPS BAL ANCE Ġ': ': Ġsr gan Ġsr HNFs Ġmedian Value Ġmarket Class Ġprote ome åĬł èĵ wik ilink ĠDown sample Dele tes Full screen Ġtm ux ĠKe el kn obs rg kmax ðŁ¤ Ķ Ġkw mo Qq HA ç´ į php MyAdmin éħ ĭ 357 3 three bot Ġvtk Image Ġpyg mt ĠUN SIGNED nv cc éĤ ī Ġ################ ######## Ġincorrect o Ġexplicit OCorrect Flags Entry 902 8 coco tools She ep jj j Domain Shader Dest inaci SCRIPT OMIC ĠLinear Interp Ġsky scrapers cpwVc Local cpwVc Remote cpwVc Inbound Ġrev ocation Ġrev oked ĠSelect ing ĠDI FFERENCE tEX ticc Agg FuncExpr iam i traj data Definition Error Ġterminal tables Ġled ges Ġи д may ankd ĠTri mesh ĠBinary Node ĠBinary Expression ÙĬ ع Ġpeople Total Ġcatalog ue blog spot plate au Uns upervised éĽ ¶ Ġray a ':[ ],' Shader Node KB aL Ġmargin als 887 9230327 Ġplan il geom space Ġinp utid ê°Ģ ì§Ģ Copy Entry gold Rat ĠPR Data Ġoverlap ped 466 5 909 8 Sq WS TARGET S risk Score Ġthresh olded Ġstand ards 432 9 AW AY OVER ALL å» Ł Ġmk ldnn ĠEND POINT Camera Status Ġlaunch pad 566 8 çŃ µ SIGN UP wu h ĠDEBUG GING Ġdigit ados ĠFore caster ograph ie Ans i Diff Entry Ġland m Ġland mask Byte Count bash rc kE ql kE gl rev oked ðŁı´ółģ¢ółģ ´ ðŁı´ółģ¢ółģ ¯ółģ ðŁı´ółģ¢ółģ ´ółĢ ĠKEY WORD mZ m Ġsqu idpy Background Tasks ĠVis dom Bool Const Bool Expr oct ober quat A sem seg ĠTarget Type Ġquick er ÑĢаР¶ åıĤæķ° çļĦ Ġ################################ ############### Ġqt binpath 第 ä¸Ģ个 éģĵ å°ı人 EI GEN èµ ´ Bit map иÑĤ еÑĢаÑĤÑĥÑĢа wr angle Ti pos ĠSk learn Ġdesign s čĊčĊčĊčĊčĊčĊčĊčĊ čĊčĊčĊčĊ Side Force Ġopp s live count åIJİ éĿ¢ Selection TimeoutError Ġ#-------------------------------- - Ġeas iest ĠCOL LECTION Click ed XC hem ت ÛĮ ت ØŃ ĠDIRECT ORY kc j Ġdns utils Ġ{}: '. Ġscr ub Na T Ġ87 1 Ġfore head Compliance s sco ut mJ mZ Ġtd odbc Ġhy dr Ġ108 4 ĠIdenti fiers ĠERROR S è¿Ľ åĪ¶ WITH IN Ġtran sed Rec tilinear ĠDete cts ĠMatrix Error spo ilers MJ D MJ h MJ PG MJ lM PART MENT ĠìĿ ¸ë ĠModi fication íķĺ ìĦ¸ìļĶ leaf let PF X Ġsho ppers 666 99298 428 31624 æĻ ® forecast ing dX F åħ³ èģĶ AFT s Ġconstructor s Ġsto mach Ġfeedback type deployment Label Ba L ĠMer chant Ġmicro states Ġmicro bepy "; "); gf tratio xE F čĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ čĊĠĠĠĠĠĠĠĠĠĠĠ Ġpb kdf }; " Ġठª 845 03917 ĠStream Encryption CAN ONICAL ĠNon Empty ĠNon ParaG DM UL Ġcare er ĠPipeline Context roc eries Ġsay ac Ġsay ının QUERY USERS QUERY GROUPS 485 8 Http ResponseError Ġdu pe Init CpuEntry Master Filler dup lication lU q è´ ¨ Ġdd pg Schedule Slot Export Exception ç»ĵ å°¾ care ers tracking Particles don ate don ot Ġrecogn ise Ġrecogn izers Sys Path Sys ctlsEntry TIM ELINE Ġ118 63 ĠEmbed dings ĠInitial CameraPosition Ġgateway forms TI ER 848 1675 social wall ĠCalcul ated è¿Ķ ãģĻ éĩį è¯ķ Ġintegr ates Ġintegr ators utt seg Ġiso format Ġdecision s 064 88 Switch ing Credentials Error 使çĶ¨ è¿Ļ个 Ġquality Mask refer ral åľ° åĽ¾ TG TT Compute Shader ĠChar acters å®ŀ éĻħ published At NETWORK S Kh QL Ġmt fixb ="{ { DateTime Field )| *. Ġmn ar ĠDummy Metric 274 94 Ġfrac Value abo ok CRY STAL Ġpys nmp Arch itecture +- ]+ åıª è¦ģ Internal Error TRANS PARENT mini po Graphics Context RPC Server Ġtc ax Ġau stralia Span ish Span Sec Selected Path scipy biteopt dD px sand wich Ġwheel base Ġposs ÃŃvel dnn lib Ġqual trics contrast LaImages Expected Improvement Ġspo on Ġeigen vec Std Src 465 10819 bur den åĨħ çijŀ Async Thread Ġims izes Ġdry Run contra cted Ġmini po )+" /"+ Cut Strategy об ÑĢаж Groups Enabled DNA class Ġiss parse Ġiss uer iser ver ĠClean ed ĠPassword Reset OUR A éĢī 课 +] ?[ Ġdense net chrome os 0100000000 0000 äºĮ è¿ĽåĪ¶ ĠXXXXXXXXXXXXXXXXXXXXXXXX XX pretty Print bullet Order Creation Rate fan Rpm Ġnom i Ġdark file BAD GR amer icano čĊĠĠ č Force On Depth s Depth Combined ĠAnsible AWSModule éľĢ æ±Ĥ tre k tre x ĠES O Ġima gen ĠmscModVcs RowStatus Ġgrids ize æѤ æŶ æѤ åŃĹ段 Sync ing draft s Ġmorph ing Ġ#------------------------------------------------ -- ĠSplit s Ġrd class clicked Pos Ġosp rofiler ĠPDF s ãĤ¤ ãĥª mor ning por tions Ġens ured Ġchord length dH d motor bike uá» ij uá» ĵ uá» ķ uá» Ĺ Ġpie zo Ġemb d Ġ.... : Abstract EventLoop !!!!!!!! !!!! Sent Clock slide SetSubmenu ='./ ', prox mox Priority Queue XYZ Info Atom Tree Atom Sym ĠOptim ize HASH SEED xW I determin er Ġemo j åºĵ çļĦ VIEW PORT HG Cal SOL UTION 477 8 Ġticket LinkFun ĠDomain Charge Cli mb Cli pping VX LAN Ġtopo logies ĠPlay book ĠMode m ðŁı´ółģ«ółģ §ółģ çĶ¨æĪ· çļĦ ä¿Ŀ çķĻ TEX COORD Ġintro duces Commit Log Ġfood Spawn ĠDistributed Sampler PRIV KEY 线 æĢ§ Ġ× ¨×ķ×Ĺ×ķת Ġ################################################ # Ġ################################################ ## routing Status ðŁĻ ı ок ен decision s 433 1 Ġtoggle Dict Ġà ® Ġnan ose ĠStack er colored logs FULL Y ĠZero Padding è¿ĩ ç¨ĭ ĠSTAT ES Patch y Sn mpAdminString Zone Index Å¡ ÃŃ é» ŀ ĠACL s Ġosg DB ĠGen Img аÑģ к âĸĪâĸĪâķij âĸijâĸijâĸij Dimension al ĠGEN E Separ ate Predict ing å°± ä¸į Cancel Request ĠAL TFONT ĠFit ted Dr zave Ġ'; '. ĠPlatform Info ĠGu ardian ĠCap acity ðŁı´ółģµółģ ¡ ðŁı´ółģµółģ ŃółĢ ãģ¨ ãģį choose op ĠRoom s ĠCli pping ĠRange Index 10100 1001101 ×Ļ× ĺ Annotation Task lus ive ([^ < ĠFra is integr als Course Locate abbre viations ĠCase Study Deep Learning clamp ed (':') [- ãģĻãĤĭ ãĤĪãģĨ Ġsit ting ĠFeed ElementList 464 1 464 9 Ġ':' ))) ĠAnnot ate Ġprec is еÑģ ÑĮ åıĺ æĽ´ Ġsmart y Ġsmart ystreets Ġorders Priority Jp OJ cad astro uẠ¥ uẠ§ uẠ© uẠ« wy z wy ckoff || | Ġrpc peer spl char spl unk åħ¨ å±Ģ ĠAlgorithm Blocks ĠMetric Type wl cs Äį no Äį eno ãĤĮ ãĤĭ ĠmcRmt HW Ax on Har rison JO URNAL YM H ο Ïģ isol ine Ġnecess idade Contin uing :::::::: :::: ĠWorker Pool Heat CapacityGas ĠCy Uart ĠVal uation Ġcomputer Choice North land cen us oe uvre ORIG INS #. ''', AQ AB aW l bil ateral æĦ Ľ ĠAPP RO STD DEV Topology Exception Relation ships :** ") eos fit Ġeye lid ĠMask RCNN ĠBus ca Ġphrase List ĠShape file WEB PACK ĠDateTime Field Fix It who se endant Cell Ġcoin cid ĠArticle Part र ठĠæī ¾ åĩ½æķ° çļĦ ³ółĢ ¹ółģ¿ ĠNV Link objec tids Seed s Ġ================================================= = Ġ================================================= ============= ĠAsync Mock ĠAsync Iterable ACA AC ĠStatic Kernel FACT OTUM Ġpopup s Gpu DimShuffle Under lying snow leopard ìķ ½ ìķ Ī covariance s (.* )", QT q increase d Ġsubstit uting Traffic Light MOV ED LZ L Ys W ë nim semi logx Ġpep ulators htm lt AGA AGC IMPORT ED ĠDebug ging è¾ĵåħ¥ çļĦ Ġâĸij âĸĪâĸĪâĸĪ ĠHar ry Ġextreme ties GTerm Context Nj Ss sit ting ĠÑĥ же Physical ResourceId Plug Value ë© Ķ Ġrdf value ĠLIB SRC ек ÑĤоÑĢ kd xa Ġdz do Ġmens al office document ĠForeignKey Constraint Ġincident Details ĠAudio Clip ĠPL ACE æĸŃ è¨Ģ Double PFPuppiJ ĠWebDriver Exception æĢ§ èĥ½ Ji Y RAD AR RAD IO âĪ « èĭ ¦ Ġ---- # ACTIV ATE 缴 åĪ° Ġbio shareX ĠRad ar ĠRad ial åħ¶ å®ŀ çĻ» éĮ² ìĸ´ ì§Ħ hY UF èİ·åıĸ æķ°æį® ĠRi emann ĠInstanti ates SSH Client Ġê² Į Pat rick μ α Ġosc ill ĠSS LO Ġga ze Ġgold Rat ĠKernel s áĥĶáĥij áĥ£áĥļáĥĺ Super visor Super sedingEventQuery slog an wavelength s Ġdur ch Ġdur ante ĠVolume Liquids Ann ounce Īë ¹Ħ Ġbm Attributes Fw Version ìĥ ī ĠctspDef OperSgaclMapping æ±Ĥ ãĤģ cron tab xv g ÅĽ li rosa urus Ġdn ld icu uc ĠPRE V Conversion Exception 1001111011110101 0001101 íĬ¸ ëĦĪ Veri fies lift ing ĠCAN CEL tur bo ìĪĺ ê°Ģ Ġrelat ives ĠAct uator ĠFIL ENAME quant umespresso Ġstub ber axv span ил ÑĮ æĥħ åł± ë³ µ ('+ ','-'* ĠInstruction TestGen ĠStat istic æķ´ 个 æĽ° ä½ł reh ensive Ġ193 1 ĠPr ince extreme ties 083 91 pivot ed Ġlease Parameters ĠCOMP LEX ç½ij ç«Ļ ãĥ³ãĥ Ģ ìĭľ ì§Ģ ìĭľ ê°Ħ Ki K catch ment ('| '. ('| '): ĠParallel Aggregator 010001 000 Ġblend Mesh Ġhier arquia Ġmaintain ing motif Strengths Pages MountPoint ĠBucket Lock ĠBucket Permission frm PlayerInfo could n CHUNK S Ġìĭ ł Ġìĭ ľëıĦ ĠRNN Cell occur red ĠAdjust ing ĠExternal Writer олÑĮзов аÑĤÑĮ lM tl orbit al Ġplate Corners Ġbor rar ĠVari ous Ġanim ations Static Files modal ities ĠcdbpPeer IpAddress 01111110101111011 001001 Ġbam boo ĠReduce Mean #------------------------------------------------ ---------- Ġever green Ġgran de Ġyellow brick äºĭ åĬ¡ å®Į åħ¨ 表示 åıĸä¸įåĪ° Au ction indi co Ġtaxon Data Ġwy kon ALI EN Ġspell ing Targets Entry bic an ĠCrypto graphy æµĭè¯ķ çĶ¨ Ġmit suba FAST A Ġowl nets quaternion ic ĠfltStmt Action 809 0 ÙĤ اÙĦ è£ ¡ ĠÎ ´ Ġxt rain ĠHDF S Ġmission s ĠXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX X Wind Gust Zr MZ broad ening ool kit Ġsouth west ĠCUR R Ġviz Engine Ġcomposition al Resid ence és ult ĠLabelEncoder Transform organism Tag vX v µółĢ ¸ółģ¿ chop ped dicom Mode ĠPas ses \": \"" ths Float Inspect eur mov Avg Concat Dataset belief s Ġquant as Regular Polygon åİŁ ä¾Ĩ åİŁ å§ĭ æµģ ä½ĵ ĠWORK FLOW 493 1 Gain s mind waveMobile ĠÚ© Ûģا ĠOff sets PLAN ES Elev ator Sky Coord ĠTrade Info Evaluate Res Destroy Particle è¿ŀæİ¥ å±Ĥ AJ ADQ DPT ADDRESSCAPS ZM n Ġnv cc ĠDist inct ĠMis configurationException ĠReal ESRGAN 5555 55 误 å·® Working Directory ĠTransformer Mixin blo q Ġmeet ings æѦ èĹĿ cdbpPeer Index cdbpPeer IpAddress ĠNEW LINE Gy ro Put nam Ġdefin icao Ġconvention al ĠFunc Animation ĠDirect Label Reply Error ĠVeri fies ĠQuanti zation RAS A Ug mk cit dl ĠCIF Article ĠHam mer ĠÐĴ аÑĪ ĠìĦ ¸ Organ ism TAX E Prun eSource ר ×IJ ilit Ãł ĠQual trics åIJ¯ çĶ¨ Ġneighborhood s Ġب Ø´ÙĥÙĦ çķĮ éĿ¢ XP ENDING XP atternsError ĠÄ IJ Ġeig s Ġeig vals Ġeig vecs ĠTun able Ġrh os ĠCombin es CIP ES λ μÎŃνα æ´ Ĺ Ġfresh maker Ġnuc ypher ĠTick ets ĠSyn chrotron ĠdeÄŁ il Capabilities CA çĻ»å½ķ 失败 Vect s aqu amar æ» ļ Ġpres umed Ġburn er Ġburn ed ĠFORM ATION Ġanti petros åıĬ åĪ©äºļ ĠÑģÑĤ ÑĢани cql types jb od èŃ ĺ doub an Generation Id ĠVisu alizer Tip Info ÐĿ е rein forcing retain ed Ġ'] ': Ġpure ly Ġfre ely Ġguid ing ĠACC EL Ġdeliver oo Inline Text Ġalg um VERT ICES Dih Num Rm dir Ġwal dur ='. '): Ġdoub let fli pper ĠâĶ Ķ deco Gift Ġsequ encing DIFF USE å®ī åĵ¥ ĠREG ION 832 92 ë² ķ Ġcmake Lines ĠSimp lified ])+' " ĠOw ned Intensity Analyzer IPP ROTO Ġ================================= ======= Ġeb cli Ġ["" ], phon ology Expl orer refname div Ġinstal ação Comparison Result Downloads Directory ĠClassifier Explainer ospf If ,:,:, :]) ELECT ORATE Zh one Ġelastic ache apid oc apid ocs RET URNING AGAA CT åĪĽå»º ä¸Ģ个 ĠæĹ ĭ转 Mongo DB ç§į ç±»åŀĭ ĠSupported DBType Bang TokenType SAS Dot èı ľ mels pectrogram Ġcame o ĠClo udify Ġrobo corp Apple TV ChainLock SignatureMessages Episode s bnd l kir bid unda ção oph ily ĠGP IB archives Password Ġsubsequent ly Ġlamb d Ġmaxim ally AGTT A čĊčĊĠĠĠĠ č MEAS URE åºľ ä¸Ń WebSocket Server 大å°ı åĨĻ Mes her ZO OM ZX h Ġcubic web ĠFO Vs obot ocore Ġpyqt Slot ĠArm Pose Servers Net gpt g Instrument s ĠWire Cut ãĤ³ ãĥ¼ãĥī ĠZope TestCase Phot ometry ĠTransformation Params Ñĭл о }}} }' åķĨ åºĹ ĠÑĩиÑģ ел ĠSy nthetic ĠSCHE D Ġlens fun ĠNu Images POLY TRACKER Ġestablish ing Gl ance Ġion type ĠInser ts ĠEXT ENSION ĠEXT ENSIONS ĠDisk Usage SAL AIRE cra zy cra zyflie sie ving Ġáĥ ij Ġáĥ Ľ Ġips o ĠPUB L Ġya hoo QUANT AXIS AGGREG ATE Lj C Timing Point Timing Points ±ółģ ¡ółģ ·ółĢ ³ółģ¿ ĠAtt endance ĠPed idos ĠME AS Inference Session ĠUsu ário UpdateParticle Ent æĭī åħĭ æ¶Ī è´¹ æ·»åĬł åĪ° /** '), Ġè¿ĶåĽŀ æŁ¥è¯¢ç»ĵæŀľ algebra ic ĠCla use ĠMor an ĠMor ning ductor s Ġг од ĠWHITE POINT ĠStrict Redis ĠStrict HostKeyChecking Ġdil ithium ĠTfidf Transformer ĠEric sson ĠNR PE ĠRefer er comput ations ãĤĤ ãģ® ĠHeight map ĠTRANS FER Hk df Ðij ележ Ġchess board ĠNET LINK ĠGer enciar ĠHard ware Subnet PacketSize glue point ???? ???? ciscoDiameterBasePMIB Local bibli ography 696 969 CLOCK BOOST Rh ode fav ourite |* ': ĠÑį к dere ference shap enet Ġdiscri m TimeSeries Categor Ġbottle s 京 師 ér é ĠrlHistoryControl Buckets DIC ALE Freq GHz FORE IGN kick ed rang t æŁ ± ì¶ Ķ edx app tektronix DPO tektronix MSO ĠGre ater ĠYOLO X DUPL ICATED çŃ¾ åIJį Ġtorque Rod (.*? )= ìŀħ ëł¥ Ġ################################################################################################ ########### Ball jump }({ %( æħ ĭ Ġæķ°æį® åĮºéĹ´ ĠCts SgaclMonitorMode ĠPhi lipp Ġkine matics ipa healthcheck CLIM BING Heap Item 0100000001000000 0100000001000000 åı¯èĥ½ è¿ĶåĽŀ Ù¾ ÛĮÙĪÙĨ Ġç ı¾ Ġocr d Ġblo om Ġdeve m 2814 121 InputTransform Processor è¯Ħ ä¼° æĹ¥å¿Ĺ å¹³åı° Cd tr PUR CHASE POP ULATION 4802 34946 èĩ³ ä»Ĭ ĊĠĠĠĠĊĠĠĠĠĊĠĠĠĠĊĠĠĠĠ ĊĠĠĠĠĊĠĠĠĠĊĠĠĠĠĊĠĠĠĠ âķļâķIJâķĿ âĸijâĸij èĦļ 注 Cpp check Cod er Lan Mode ipe trash ìłģ ìĿ¸ ĠMol Kit ĠMLP Classifier ĠConditional Poisson ĠConditional Logit Ġopenv switch ĠQiskit MachineLearning ãĤĵ ãģ§ ĠLOAD ING incremental CompileOperation enhance ment Alex Net Alex ander Risk Map chin astock abstra ctions ĠDol t ĠBP synapse ĠBalance d ĠElastic Net Ġvernier Cell ãĤĪ ãĤĬ Ġbrute force MaterialExpression FunctionInput DEPEND ENT Ġì¶Ķ ì¶ľ Blink y Tax Id TUN ING Ġ~~~~~~~~~~~~~~~~ ~~~~~~ Ġ~~~~~~~~~~~~~~~~ ~~~ Ķë ī´ Ķë ĦĪë arma cy Ġcow say Ġbright ening ĠCAP DU Ġglo uton ĠConfirm Dialog BACKUP INFO èı¯ éĻ° BID POSTS Emb ryo FIND ING Ġblink py ĠSAT URDAY ĠCG AL Ġyap ı Ġcompri sed Ġcompri sing ä»ħ ä»ħ Ġarchives Username OpenGL Context ĠдÑĢÑĥ г TRANSL ATOR Ġachieve ment Say Hello gloss ary hap loid pine apple relat iv stk var macos x Reco Tracks ĠBRO KER 产 çĶŁ è¼ ª è¼ ¸ Ġlif espan Ġnas ceu Ġcongru ent ĠMARK ER 11110000111100001111 0000 agc gg ĠHEL PER sendto address ĠпеÑĢ ед Networks Entry Party Type ĠWaiting Analyser BlendShape Channel pand da ×¢ ׾ èIJ ¬ arri vals ĠCLO SING 1717 996137183 Ġshar pe Unary AggFuncExpr INTE GR ImageFolder Dataset ĠMOD ULES æ¤ į Ġ************************ ******* deliver oo ĠBlog Post ĠRen ew Conformance Classes Ġhexa gon Ġrab bits ĠHu BMAP ĠRep lication temper atuur ĠZe it ĠZe eman ĠMajor é ĠSentence Transformer ĠÑĤаблиÑĨ Ñĥ Grand Parent Spi keTrainArray aż er bld r jav adoc ìĻ ¸ olc Database ĠPrep end Ġendian ness Ġaline file ĠProvision ing Ġquas ar 8193 37176 capac itor capac idade Social Media åºĦ ä¸Ĭ ĠPhysics Tools ĠUNI VERSITY ĠGafferScene UI ĠRefresh Token éĺ¿ èģĶ Ġìĭľ ê°Ħ æij Ħ ç· ¨ ĠåŁº äºİ Ġpom dp Ġdill file entr ys Ġze ep 5724 819337176 ãģij ãĤĭ è¿ĺ æĺ¯ Calib ri ĠMyResource Pool BILL BOARD funiIfConf Sig funiIfConf Ilmi Cog n Perspective Transform hj ong ččĊč čĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġpron oun amon ds Ġxk cd è§Ħ åĪĻ èĢģ æ¼¢ Ġillu strate Ġlkml dict Aes Gcm Shel by kor ali íĶ ¼ Ġiop c Listing Mutation Ġquater x Ġtrig code Ġìĸ ¼êµ GNB STATUSINDICATION ä¸įåIJĮ çļĦ Differ ent Clu starData Fund ing slo upce arv ind Ġez ff ĠFX O Ġthl flux owa Äĩ ĠVE LOCITY sax utils ĠRecomm end ĠRecomm ended ĠKuge ln ãĥī ãĤŃãĥ¥ servic enow áĥĽ áĥ£áĥļ 追 踪 ĠAutoModel ForSequenceClassification è¿Ľç¨ĭ æ±ł ĠèĵĿ鲸 åŁºç¡Ģ ĠèĵĿ鲸 æĹ¥å¿Ĺå¹³åı° habit at reti en Ġreco il getNum Pages ĠSIO CGI ĠPOL ARON ĠOID C 12578 05 12578 056 Ġ<% = Infer rer mich al ĠJAN VIER ðŁı´ółģºółģ ¡ółģ ä¸ĭè½½ ä»»åĬ¡ ĠfbxLayer Materials ĠбÑĥ к èѦ åijĬ ë²Ī íĺ¸ Viz Params cairo cffi Ġ".. ")) tek st ĠBal dry tribu tivity Conditional Generation ĠendTime Phrase 7833 8879230327 ]+\. [ Suppress Mentions WRIT ABLE WRIT TEN åĩºåĬĽ ãģĻãĤĭãĤĪãģĨ Evalu ated än ge 对é½IJ çļĦ è·³ è¿ĩ Ansible Module Friendly Locs Worksheet Index ĠImmutable Map Fib count Fib onacci fant asy qG SIb Ġpai ement Ġsla ves ĠCpp check ĠMur ray lenn ium emiss mat ĠStub ber CONTRACT S ÑĢед ел rapid yaml displayed Bookmarks ãĢij ãĢIJ Ġëĵ ± associated Typedef seo ul (")") [- spaw ned poli tics ĠMutation Type pyth ia 3245 000 hospit als weed ie ĠHor ns ĠHor ovod Ġcompos ites ãĤ» ãĥ¼ãĤ¸ Ġphys net Tagged Item Ġprerequis ites Ġazimuth Offsets ç§ij å¨ģ ĠAdministr ative dhcpSnpDbStat Last Ġ模 åŀĭ Cour ses Fac ade cass ini greg Name iag R Ġpand ac Ġfem ur chlor ide ĠSTY LES Ġsubscri bes Envi ar 5606 2425 CONFL UENCE ĠForti OS NNNN NNNN spectro grams Trip let çŃĶ æ¡Ī Snippet Options Residual Connection Ġë§Ī ì§Ģë§ī Luc ent Smo kingStatus çĵ ľ ĠÏĥ ÏįνδεÏĥμ defi chain Ġcif Tags Ġcob ra Ġpam ogk Ġreda ctions ĠSon os ĠAmb iguous ĠASS URANCE Ġuic md ĠGf Matrix ĠGel man Ġshap enet merid ional Approved ForAll TECH S à¸ģ ภfourier Har ượ c PLANET ARY ĠMONGO DB âĢĶâĢĶâĢĶâĢĶâĢĶâĢĶâĢĶâĢĶâĢĶâĢĶâĢĶâĢĶâĢĶâĢĶâĢĶâĢĶ âĢĶâĢĶâĢĶâĢĶâĢĶâĢĶâĢĶâĢĶâĢĶâĢĶâĢĶâĢĶâĢĶâĢĶâĢĶâĢĶ Bor ough HMF CA Panda Modules Sar ah Tutorial TipInfo xtension s modelPath Bare Ġroz umie ASSE MENT Ġcontro urs TextIO Wrapper NoSuch Process MAINT ENANCE princip le Ġmanim lib propag ators ĠBarry ExportException ĠBarry ConversionException ĠSMOTE ENN 缸åIJĮ çļĦ ĠElectrical Demand Ġúlti mas Elasticsearch Exception fsw Algorithms |--- |--- Ġnarr ative maked oc ĠSQU ARE ĠAux iliar listPieces Black ĠDET ECT ĠBayes Classifier Ġcogn ito Tournament Drop Ġexplo ded CommandLine Argument WEAP ONS Ġdesapare cidas ĠíĨ µ ãĤĴåıĸå¾Ĺ ãģĻãĤĭ Impersonate Response æ±ĩ æĢ» Ġë°ĺ íĻĺ Ġpalav ras Hide Show Nod al Sav ings aero spike sobre nome Ġãģ§ åĩºåĬĽãģĻãĤĭãĤĪãģĨ Ġ"'' ")) extr usion ERV ICE Ġbehavi ours Ġconten ant Ġconten ido Ġfiber flat Adverti sing ĠìĨ į influx DB éĢĴ å¢ŀ Ñĥм енÑĤ consult ar vertica py ĠMaya Cmds IMPÃĶ TS tacacs AuthServer tacacs AcctServer Fram erate Pseudo DojoFamily Suggest ed aqK lineEdit forth coming Ġاس ت Ġico los Ġsie ves elong ation igable String Ġdeform ation ĠIDE A Ġselecion ado addObject AtPos ĠEmb arque colpm RA GetNode Attribute ĠColab oratory Ġautore load ĠæĿ ¡ ĠæĿ ¥ Neo Pixel æľīæķĪ åĢ¼ ä¼Ĭ æľĹ ä¼Ĭ æĭīåħĭ ĠØ´ دÙĩ Robert son εÏĥ ÏĨα ì¤ij ì¹ĺ SMTBF SweepInput Cra ig Eco EII Pag SeguroValidationError SAR SA VIMS Error YQQ Q blab la yar ac Ġnats orted viv ace Ġsegu ir Ġbean count ĠELE MENTS ĠETF s ĠRod rig Ġalph amind Proble mas 6901 84503917 BOS ITY DeletePomeriumSession Request å§Ķ æīĺ å§Ķ åĨħçijŀ Surf Node GUESS ES ĠBertFor MaskedLM Satis faction ĠAirport Map ĠSqlAlchemy BatchData Menor Valor UpstreamHealthchecks Active UpstreamHealthchecks Passive cirrus vet BAT TERY Bars Plot pist ol sni per decide Server Ġblit z xtr uth 9958 115183246 ĠFog gy Ġhwt Hls ĠPET Sc appar ate Ġorche stration Ġcouch base Ġanci ent ĠsetObject Clean Ġchamp ions ĠReplay Buffer ListTables Response ListTables Request filmografi a ĠqPos AvgLoc ĠqNeg AvgLoc 6737 3052 ĠÐĵ енеÑĢаÑĤоÑĢ Ġautop ct ĠMoh amed ĠCorrection Swaps casesFor ICU casesFor Venti GlobalLight Color GlobalLight Direction osaCent A osaCent B ĠExplicit ly Ġdemonstr ated FirewallGroup Port ĠбÑĥд еÑĤ ADDTASK ADMIN ADDTASK OWNER Jas per JRI J wvl ns Ġrech te peech MatchOnClient ĠTod ay ĠSAV ING ĠPAS SED Ġvow el INSTR UMENT ĠEPOCH S epNumberBulk In Ġheapp ush ĠProg Bar Ġphon enumbers +"/" +" Ġdecim ator Ġ"{}/{}/ {}". çĽij æݧ INTERPOL ATED åĵª 个好 Excl usion .-- .-- Distr ito SMB H nore ply Ġåıĸåĩº 该 ĠdQ Arr getCluster Id ":"" },{" ĠAW IPS Ġhil las ĠMÃī DICALE ĠBor uta ĠRabbit MQ ĠCONTRI BU ĠPRODU CT ĠHttpStatus Error åįİ ä¸º 大éĥ ŀ ç©ºæł¼ éĶ® Ġturbin ia áĥļáĥĺáĥ Ŀ Bent on Mais Barato eha B lgn rm squee zenet Ġaer on atel ja ĠCategor ia Ġexclus ively ="^ ", ALB UM Resized Crop goti ation CONTR AST Transformed Distribution IndexIn Cycle :\/\ / GRAP HY NEIGH BORS ĠCombat Data moll view Switchover Interval denomin ators à¸Ħภ³ >(.*? )]) > : |\ : ,\ : ?\ : ")," ; {\ < {}>'. = âĢĻ = }< > * > ; > /", > ${ > }]', ? '. ? "), ? ~\ @ &\ @ ~\ A ER A lta A tmp A fee A juda A symCoinGame A chieve B is B price B mag B tc B EE B bb B percent B Ag B anner B aby B QK B utter B Kp B ike B ounded B orrow B isector B ashOperator B rizard B ristol C en C ort C ts C ws C AND C ANCE C ropping C assandra C lasse C DELT C umberland D ing D ab D od D ert D ob D AP D ick D ear D MA D Matrix D MD D ados D NT D uel D ARRAY D ARTS D exter D omesticHotWater E ight E ps E du E ym E sm E je E tw E uk E Kh E HG E vil F en F ds F LL F its F ear F sw F ONE F lick F MJ F ENCES F rontier F resnel F alsi F ulton G if G AR G mail G AD G MA G Bo G si G QL G rat G CD G rove G PG G bz G Xy G JA G LOSS G umbel G ears G TRX G UNICORN H xe H IVE H gc H MI H CLK H artree I a I st I AG I IS I STR J ST J RE J AL J ama J AE J uniper J icn J APAN K in K is K ES K AR K ORE K NR K hg K illing K ubernetes K NeighborsClassifier K ᵧ K evin K UKA K rylovNewton L um L as L AG L PP L hx L pd L BR L ao L lc L BA L java L GC L dv L iving L VARS L ASER M pe M ic M im M eld M net M IM M AB M org M ash M ins M mk M tl M ails M aur M ATH M zA M iller M zMz M ammal N ur N min N max N UT N IS N ix N my N dim N ERS N TY N samples N LC N Ip N FS N nz N MF N bio N uclideResult N GridPoints O ON O US O vers O js O pus O dk O VC O HH O hm O CEAN P nt P min P AM P ron P lat P ension P IM P ong P CK P states P GN P kg P ula P eng P JJ P INS P lugs P eriodic Q PE Q ym Q Policy Q RA Q Slider Q uiet R ack R ER R sa R cs R ou R ust R TT R é R pd R SP R SM R HW R QK R RF R BM R cL R acp R ollo R ifer R HEL R WSpeed R ISCV S or S lo S name S ms S oc S ight S db S old S AD S ze S ymb S late S part S ML S MC S BO S rm S USE S mass S NS S sl S dw S lices S olved S aref S molar S lides S HOP S trap S ENDS S tix S PARSE S obre T es T one T et T ic T our T ls T oc T AS T run T Ac T ong T PE T Class T IF T ama T ANG T eng T DK T rends T angent U il U IC U rb U dp U wm U rn V St V db V AM V io V TO V CE V tk V AI V QR V DW V IPER V axman W an W ON W are W lt W rt W IND W IP W SC W TF W ASH W aste W XK W inston X ar X ST X EL X ian X sd X FORM X VID X mx X RANGE X MPP Y ang Y np Y NC Y CB Y zW Y eti Z EN Z max Z ED Z END Z HR Z TI Z ONES \ _ \ )\ \ +\ \ ":[ \ ":"+ ] "], ] |\ ] _, ] _[ ] +'\ ] !=" ^ / _ \\ _ )[ _ }\ _ {}/ _ ^_ ` ]( ` ='% a xb a ument a mag a ired a NG a partment a Quote a fts a iplatform b rom b ure b ls b ly b names b mode b dt b vec b ida b mk b ii b Obj b ills b qs b Ra b wr b ctest b cnts b ureau b ionic c args c mo c line c number c ai c fs c dm c On c Files c rab c Place c OX c tives c racker c Sib c rane c lobber d de d te d us d all d file d lab d ans d line d ok d reg d obj d year d topic d uel d RT d Kp d ining d ala d Errors e class e utils e Fh e ÄŁer f th f sp f line f ak f api f bs f tag f ca f spec f mod f rank f NA f eng f bc f prime f phab f rench f uzzer f arthest f abien g ma g ab g all g are g ob g code g da g ag g ast g ant g run g ists g colors g qa g pa g cov g pickle g ives g markers g opro g libc g romacs g lade g änge h P h ence h uc h ists h ank h gt h oly h ii h MN h jj h ocr h indi h anoi h orizontally h ldr h ierarchies h lmann i ew i add i print i max i info i au i lities i vals i NR i KR i InstrTest i StopIso j pp j file j ak j pn j dc j Ãł j QI j uly j uju j fscoer j unior k ol k am k ls k ap k lif k Num k az k account k vs k orean l ith l pt l vert l bn l Mesh l ZW m P m R m ss m get m reg m object m AP m nn m ug m DB m fin m ips m scMod m indx m lengine n fig n args n out n param n action n dist n spec n If n ature n vars n obs n fl n Invalid n Content n logs n prec n phi n Host n levels n Plus n pix n Done n Hash n Press n Running n Your n udge n qn n engo n ulls n rrd o T o ed o el o ED o ai o aG p ce p ate p ang p low p join p ale p lag p cre p aw p Of p fp p rag p iles p folio p volumes p itches p unte p Lvl p NodeConts q T q in q type q em q conf q State q freq r P r gs r message r ud r vert r gn r gw r prof r Vq r dataclass r Rj s C s D s ut s ult s format s map s run s batch s bg s content s idd s late s chi s Ri s Available s QJ s nek s Kaolinite s OutputBase t ore t ense t num t atus t we t Data t client t case t unit t Code t LC t vv t chunk t insertion t Loss t means t Unknown t pex t Deleting t ır t Qp u ai u ffer u vm u dims u uv u PDF u KA v ue v di v xt v ens v ys v dict v og v ign v nn v cpu v cm w end w ere w ann w ick w amp w MD w arc w rote w esi w asserstein x K x in x def x test x dex x AC x title x AD x yp x match x lang x MT x vertices x DC x ctype x BD x imo x liff x FilesFactor y ch y len y ummy y inc z al z he z ad z pp z we z mat z BY z ipping z mr z hao { ((( { ;( | % | , | ") | }\ | (? } '): } "]) } ]), } |\ } /\ } >'. © å±ķ ¬ å¦Ĥ ¶ ółĢ°ółģ¿ ¸ ìĿ´ » è¾ij ¾ ¸  § à ĺ Ä ¼ Å £ Å ĺ Ê ĥ Ë ĭ Ð Ń × ĵ â ¬ â ĭ ã Ī é ¬ é ± é ĭ ë ¨ ë Ī ë ıĻ ì ½ ì Ĥ ì į í ľ´ ĉ čĊĉ Ċ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ċ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ċ ĊĠĠĠĠĠĠĠĠĠĠĠĠĊĠĠĠĠĠĠĠĠĠĠĠ č ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ ,- Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ ãĤĴ Ġ 854 Ġ Ċĉĉĉĉĉĉĉ Ġ · Ġ ãģ« Ġ 877 Ġ éĩį Ġ å°± Ġ 9999999 Ġ è¿Ľè¡Į Ġ çŃī Ġ íķľëĭ¤ Ġ å¾ħ Ġ ãĥŃ Ġ å¼Ģå§ĭ Ġ åĨį Ġ åıijéĢģ Ġ ĉĉĉĉĉ Ġ âĸĪâĸĪâĸĪâĸĪâĸĪâĸĪâĸĪâķĹ Ġ å¢ŀåĬł Ġ ERNp Ġ åħ¥åĬĽ Ġ arduino Ġ με Ġ ç»ĺåĪ¶ Ģ ëĭī Ī æĿĥ Ĭ ¹ ĺ IJ Ń IJ ĠĠ Ċĉĉ ĠĠ čĊč ĠĠĠĠ ĊĊ ĠĠĠĠ ĊĠ ĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠ ĊĊ ĠĠĠĠĠĠĠĠ č in W in en in ti in form in size in Name in version in vention in ria er ange er ste er ased or un or ff or io or relation or pay or arily on ion on key on do on tract on eline at n at te at ms at dl re el re ver re ll re mat re process re bound re hand re writer re scaling re zoom re cog re servoir se le se ems se texpr se mester se diment st as st ain st itle st aircase en r en rol en vio en ggNumber en dix ĊĠĠĠĠĠĠĠĠ ĊĠĠĠĠ ĊĠĠĠĠĠĠĠĠ ĊĊĊĠĠĠ Ġt sp Ġt ep Ġt dd Ġt dim Ġt span Ġt scale Ġt domain Ġt inputs Ġt vars Ġt cr Ġt cn Ġt lf Ġt ente Ġt ivar Ġt ernary Ġt ampering Ġt ahsin ar U ar V ar W ar st ar te ar ation ar ak ar massist al n al umn al gs al ie al ics al RT al bedo de h de i de ce de mi de mean de compile de berta de quantizer de cember de epest le ments le gen le xtype le thal an ing an zi an alyst an isotropy an uncio Ġi ut Ġi print Ġi lat Ġi ran Ġi met Ġi SEG Ġi TmpReg me in me call me mdump Ġ' ...') Ġ' != Ġ' \\\\ Ġ' ;', ro a ro sen ro bjects ro cessor mp n mp img mp ool mp irun Ġc data Ġc path Ġc ac Ġc lic Ġc dict Ġc base Ġc ream Ġc ai Ġc ors Ġc No Ġc mode Ġc fs Ġc sin Ġc cf Ġc enum Ġc ea Ġc rf Ġc dh Ġc aster Ġc fm Ġc Extension Ġc insn Ġc EffOp Ġc rumb Ġp ion Ġp el Ġp data Ġp im Ġp ap Ġp ele Ġp sys Ġp exit Ġp sm Ġp ram Ġp cap Ġp fc Ġp coords Ġp ino Ġp gp Ġp nl Ġp cie Ġp AUC Ġf j Ġf str Ġf ist Ġf args Ġf ang Ġf ip Ġf ids Ġf ysical Ġf acilities Ġf ifo Ġf antasy Ġ" ][ Ġ" '. Ġ" ]: Ġ" ); Ġ" ]/ Ġ" ]') Ġ" ]", he in he ated he tes he ater he aven he xdomain ## ------------------ it ron it oken it bx Ġa file Ġa ms Ġa mpl Ġa graph Ġa ingle Ġa pts Ġa mn Ġa mazon Ġa sex Ġa houghton lo ler 00 80 00 30 00 40 00 73 00 68 00 51 00 033 00 916 00 057 00 058 00 2657 00 4802 ge ster ge mann ort emp ce b ce m ce tt ce mbre ', ): Ġn ion Ġn ub Ġn In Ġn lat Ġn ies Ġn height Ġn fs Ġn sq Ġn images Ġn cm Ġn unique Ġn ada Ġn regions Ġn wires Ġn ominator Ġn Deg Ġn ortheast Ġs pp Ġs col Ġs ire Ġs ag Ġs port Ġs parser Ġs izer Ġs hed Ġs ift Ġs vec Ġs rm Ġs bi Ġs ni Ġs amb Ġs runner Ġs upy Ġs ö Ġs izing Ġs Äħ Ġs onic Ġs phs Ġs IndexReg Ġs atchmo ut an ut are ut filepath ur ale ur den ss us ss are Ġin dir Ġin File Ġin files Ġin Size Ġin sn Ġin formed Ġin duced Ġin clusion Ġin gestion Ġin hib Ġin volving Ġin progs Ġre x Ġre ma Ġre com Ġre no Ġre number Ġre do Ġre location Ġre project Ġre active Ġre parsed Ġre translate Ġre defined Ġre locations Ġre voke Ġre versal Ġre tire Ġre alsense Ġre compiling sel L sel ib self text ing Handler ing Process Ġo val Ġo db Ġo Parser Ġo asis Ġo tu Ġo phy Ġo seo Ġo msdk Ġd C Ġd N Ġd Y Ġd la Ġd am Ġd xd Ġd col Ġd np Ġd sk Ġd map Ġd do Ġd var Ġd ong Ġd tt Ġd sd Ġd cd Ġd desc Ġd gp Ġd PIm Ġd scp Ġd wy Ġd Phi Ġd vipng li v li ment li go li web li ato li citi ct b ct p ct ct ct ags ct apipe pe cial un que un split un parsed un watch un compressed un initialized un yt un balanced un mapped un healthy un recognized un ivariate Ġm E Ġm V Ġm str Ġm ule Ġm iti Ġm yn Ġm AP Ġm types Ġm cc Ġm rs Ġm tb Ġm ango Ġm ichael Ġm osaic Ġm Eq Ġm gear Ġm ás Ġm medit Ġm umbai Ġm mgp ra ct ra ub ra ising ra ison ra ça Ġe sk Ġe df Ġe fa Ġe las Ġe ating Ġe fit Ġe spec Ġe pg Ġe scalar Ġe ffici Ġe ox Ġe quilibrium Ġe Bay la dim la use ---- + ate Site ion es ion ale () }} fi k fi z fi bo fi mI fi ddle ent hought tion al ad p ad code ad ia ad rat co pts co vars co binding co operative ri pe ri ment ri que ri em ri pple Ġthe Arr Ġthe orem Ġb ou Ġb ere Ġb float Ġb graph Ġb ene Ġb ii Ġb ads Ġb patterns Ġb Idx Ġb ÄĻ Ġb cnts Ġb ouncing Ġb runei Ġb angexpr Ġb cookiej Ġ1 300 Ġ1 1000 Ġ1 023 Ġ1 185 Ġ1 162 Ġ1 995 Ġ1 978 Ġ1 378 Ġ1 260 Ġ1 476 Ġ1 983 Ġ# }, ed m ed Device ed Throughput 11 34 11 50 11 000000 11 74 11 643 rom ole um on int oken id n id al id ung Ġ( ', Ġ( ([ Ġ( ${ Ġ( ((( Ġ( './ Ġw if Ġw mo Ġw ts Ġw edge Ġw lan Ġw ells Ġw pas Ġw zh Ġw dv Ġw rangle Ġw urden ch n ch le ch sel ch am ch é te ach te za te strun di ac di ou di amond di lution di enst di atonic def or ata base ata mento Ġ[ ': Ġ[ __ Ġ[ :] Ġ[ âĢĺ ma m ma pe ma ck ma xt ma ml ma sq ma mm ma eters Ġself droid ul ário Ġimport ances from srcdir ot as Ġfor um Ġfor warder el and el son ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ': < ': '' ), (- urn aghan es net turn Off ĊĊ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ+ ', ode Angle is ic is date is Local is Null is aurus val le val avan get state get create get header get Handler get Group get Color get Bytes get Camera get Em get LineColor get YUVPixel (' ==== (' $', (' << (' .' (' [[ (' ]', (' @@ (' âĻ )) ])) )) }" )) }.{ set Config set Path set points set Node set State set Filter set Register set Title set Flags set osa set blocking set Contents set Goal set Velocity set Brightness set metatable ath am Ġ- (( Ġ- \\ Ġ- %] Ġto il Ġto string Ġto JSON ĠT Z ĠT m ĠT RO ĠT cp ĠT ee ĠT ek ĠT ropo ĠT alk ĠT Doc ĠT agg ĠT ao ĠT ama ĠT Func ĠT APE ĠT REE ĠT Compute ĠT AKE ĠT ambi ĠT ruck xt on xt ron xt rain il ance il ly il ars il lover th andler th ru us in us ch us ible us sen us bb Ġreturn arg con son con mon con cert con verts con former con sequent con cordance con duit Ġ2 345 ers burg (" (" (" ******** (" :: (" [\ (" >" (" ##### (" =========== (" ."+ (" ----------------------------------\ pp l pp SwapChain ') ' ') [:- ') }), as z as man iz dy iz ki iz ações et w et x et adata et racker et kconfig arg val arg group op name op last op era ve au Ġ{ ", Ġis a Ġis Plot Ġis Constant Ġ7 0000 Ġ7 06 Ġ7 37 Ġ7 55 Ġ7 21 Ġ7 69 ĠS X ĠS q ĠS ed ĠS ENT ĠS US ĠS entry ĠS pr ĠS URE ĠS LD ĠS RC ĠS MI ĠS DL ĠS titch ĠS titching ĠS qrt ab sor ab ier ab gp Ġof r ĠC ow ĠC iv ĠC ENT ĠC types ĠC fn ĠC ats ĠC xx ĠC BO ĠC ells ĠC TC ĠC rea ĠC orn ĠC itation ĠC ampaign ĠC NF ĠC itr ĠC ENTER ĠC ropping ĠC srf ĠC oughlin ĠC osmos ĠC lasificacion ĠC PUTemperature ig b ig gs ig uchi ht w up r up t up start ") ]. ") }) ") '). ") }') ") [::- Ġg ize Ġg our Ġg ag Ġg pb Ġg tex Ġg rat Ġg prev Ġg uro Ġg spread Ġg lims Ġg wf Ġg olf Ġg opro Ġg uilds Ġg oblet Ġg arden Ġg allon Ġg pnas for ensics for Rnn ter mo Ġr code Ġr count Ġr unc Ġr paths Ġr hot Ġr bc Ġr bp Ġr pyc Ġr nas Ġl data Ġl ld Ġl umi Ġl rs Ġl Count Ġl pad Ġl Format Ġl dg Ġl umin Ġl ág Ġl NumberBits Ġl usid end line end stamp end Block data point data description data Frame ĠA h ĠA w ĠA la ĠA ma ĠA us ĠA sp ĠA RI ĠA DO ĠA ero ĠA spect ĠA EA ĠA FQ ĠA rist ĠA hm ĠA scii ĠA sia ĠA mino ĠA TOM ĠA aron sp lugin '] ]), '] }] 01 96 01 90 01 30 01 83 01 0000000000000000 01 0001111 Ġcon ll Ġcon vol Ġcon ferences ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ čĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ic z ic do ic ns ke stra am u am oto to g to me to ys to ko to coo to ppar to DaysOffsetStr 99 12 99 06 99 22 99 24 99 26 99 56 99 47 99 65 99 665 Ġ: ][ Ġ: )") Ġ: !: par al path ing path For ile m ist ol ist as ist ep ist ema type v ĠF M ĠF z ĠF ro ĠF red ĠF aw ĠF ALL ĠF lap ĠF RA ĠF ota ĠF LEX ĠF SR ĠF illing ĠF avor ĠF uzzy ĠF etched ĠF BX ĠF ighter ĠF uniValid od ynamics sc ss sc li sc end sc si sc rapper sc rolling sc alls qu y qu an qu qu qu ip qu akes log M log on log filename log Info log Msg log probs log ica log ico log likelihood list ify list Bullet om ix vi ction vi are vi vl vi rial Ġh ic Ġh file Ġh append Ġh ast Ġh ill Ġh iv Ġh ud Ġh ca Ġh stack Ġh anoi ** /*. ĠĠĠĠĠ ĊĊĠĠĠ all pairs all neighbordistances po c po und po of po ws po ente ta e ta k ta ubar ta urus ĠP c ĠP ul ĠP ST ĠP ric ĠP CR ĠP aging ĠP eng ĠP HY ĠP BT ĠP TI ĠP romise ĠP RESENT ĠP aulo ĠP egas Ġas h ĠI K ĠI U ĠI CE ĠI Unknown ĠI Arr ĠI ANA ĠI PIP ĠI roha ĠI saac ĠI hnen file id file set file info file ID file string file Box file spath ĠL s ĠL ed ĠL ens ĠL MS ĠL SL ĠL HK ĠL una ĠL TD ĠL ukas res se res ur res pective tr u tr unch tr iton tr usec ize Pkts Ġth ailand =' -- =' ), =' {}' Ġst u Ġst eve Ġst ests Ġde i Ġde fi Ġde pt Ġde ap Ġde du Ġde duce Ġde lr Ġde cr Ġde bt Ġde sirable Ġde creases pro cur pro ble pro ficiencies est ream 0000 101 0000 101111 Ġ""" ). pt c ex yz ex cep ex cerpt ex haustive ex hau im H im W im ma im ul im view im ba im inder Ġex ps Ġex abgp able Mixin Ġ3 00000 Ġ3 500 Ġ3 072 10 69 10 563 Ġprint md out data out age out lines out Path out Has out filepath out links ow der ĠD p ĠD or ĠD ER ĠD ob ĠD ip ĠD em ĠD ED ĠD ont ĠD UM ĠD slice ĠD SA ĠD RY ĠD Matrix ĠD ICT ĠD sl ĠD ados ĠD AI ĠD ASH ĠD rops ĠD XF ĠD MAR ĠD ragon ac r ac re ac us ac cio ac tives ac celerated ac ronyms ac cordion Ġu pp Ġu hat Ġu Arr Ġu liweb ]) ') ]) ]] ]) }) ]) [- ]) ")') ert s Re setting Re cipient Re vit Re combinase Re Äįeno ite p app ari app liance app hire sh er sh an sh ull sh aff sh iro Ġdata model Ġdata Frame Ġdata Dictionary Ġdata Mag Ġdata qc Ġdata Omega ĠM K ĠM ER ĠM ind ĠM ace ĠM IC ĠM ASS ĠM UDA ĠM Hz ĠM TL nt one nt otal nt fs nt ario time unit time zones time taken time smar time Mins if cb key store key ring key vault lab Cfg lab undance lab labla xf p xf s xf v xf ep xf by xf lag xf ffff xf lags =" __ =" .") Ġv ard Ġv ou Ġv pos Ġv Max Ġv router Ġv dom Ġv lc Ġv isto Ġv enn Ġv ários Ġv edo Ġv modl Ġv olumetric 02 10 02 47 02 69 02 157 02 447 ext ant Ġy ar Ġy ul Ġy keys Ġy Vals Ġy appi Ġy argy Ġnp er Ġnp ad ĠO U ĠO t ĠO ER ĠO CS ĠO CP ĠO regon Ġ* _): Ġpar sl Ġpar cels Ġpar adigm Ġpar maeters Ġx G Ġx mp Ġx ub Ġx std Ġx dis Ġx ia Ġx opt Ġx edges Ġx Cell Ġx vb Ġx cen Ġx npts Ġx oro Ġx centergrid Ġx Wrt os X Ġse v Ġse ção Ġse ni Ġse lec Ġse award Ġma j Ġma xc Ġma ven Ġma estro que ak que uing que tzal test path test user test Data test group test module test package add user add ral add Rotate add Interfaces add Knob add PyFile Ċĉĉ ĊĉĉĊ [" # [" ), ER ING IN R IN AL IN DIRECT IN FIN IN VOL IN CLUDED IN uttX IN VENTORY Ġstr atis Ġstr OutputPath .. { xb di xb ep xb cs xb dd xb du xb cu xb mr ange l 1111 0 1111 100 load Module load Information load Balancer ore gon ms b ms ize Ġ% ] Ġ% )") Ġme at Ġme io Ġme teo ON BOAR tra SAS tra indf Ġfile id Ġfile server Ġfile hash Ġfile encoding Ġpro verbs Ġpro ducers ens ures py h py p py w py pp py query py obj py doc py github py side py bind py spark py fits py dap py basics py RRG xc l xc er xc fo xc fe xc nc xc abh pre di pre lu pre fill pre loop pre calc mage s cess ario ls ankidb ap ta ap man ap scheduler ap ivot ap agar 07 15 07 84 07 23 07 35 07 89 07 54 ang B ang hai xd an label names ES K ES ELECT ber e ber ger Ġbe ir Ġbe ard Ġbe em Ċĉ ĊĠĠĠ Ċĉ ĠĠĠĠĠĠĠĠĠĠĠĠĠ "] () "] ))] "] }], ĠB F ĠB j ĠB iz ĠB ac ĠB ER ĠB ib ĠB ak ĠB AC ĠB CE ĠB ays ĠB OM ĠB eng ĠB uck ĠB AZ ĠB IAS ĠB olt ĠB BBBBBBBB ĠB ình Ġos utils 12 50 12 39 ys log ys ide ys ze ys sey ĠE sp ĠE max ĠE cs ĠE ager ĠE du ĠE bi ĠE gyp ĠE sta ĠE uclid ĠE instein Ġj query Ġj step Ġj ug Ġj sd Ġj Query Ġj uris ci ous ob d ob vious ob ench ob uy ob fusc Ġ< << Ġ< <<< ly a text cat text bf text vali AT P AT CCT Ġ) ', Ġ) ", Ġ) [:, xa ew xa ep xa az low rank low high size X com mas com una com arques model er ĠN ur ĠN ep ĠN ou ĠN AN ĠN net ĠN ão ĠN As ĠN ullable ĠN AK ĠN SW ĠN REM ĠN amer ĠN HWC ĠN ÃĥO ĠN guyen date Simulation ir Image ir relevant num code num Blocks Ġres on Ġres lt Ġres umed user from user details bo effc bo Gears Ġ4 87 Ġ4 85 Ġ4 86 Ġ4 28 Ġ4 89 Ġ4 71 ger ed ff tp Ġget time Ġget Node Ġget Temp Ġget Current Ġget Channel Ġget Next Ġget Items lu ca lu stre lu igi lu dge 92 92 92 32 92 93 92 08 92 19 92 83 92 89 92 81 tp ad col at col ation col Name col Num col lateral col labor In Folder In ky In spector In voices In fluence lot to ĠR ust ĠR parms ĠR Spec ĠR ULES ĠR anch ĠR ápida mo vel mo sso mo tivo mo zzarella Ġun umpy Ġun clear Ġun enc Ġun escape Ġun closed Ġun merged Ġun formatted Ġun yt Ġun authorized Ġun confirmed Ġun reachable Ġun infected Ġun allocated Ġun reliable Ġun released OR I OR w OR AT fo ss read random read frames read Only Ġtest app Ġtest group Ġtest ng Ġtest Tag lic hess Ġlog f Ġlog Flag Ġlog Publisher 32 90 per r per ceived per ishable // " // ( ĠG s ĠG low ĠG Label ĠG NN ĠG Window ĠG IZ ĠG uest ĠG iving ĠG rey ĠG iga ĠG nedin ĠG ageRnR ĠG uillaume Ġco mport Ġco add Ġon b Ġon ap Ġon error Ġtype Code EN EMY ĠW P ĠW o ĠW en ĠW ant ĠW AL ĠW ild ĠW arm ĠW ood ĠW olfram ĠW armup ĠW HOLE ĠW rangler tri o tri mesh ho ff ho YG ity a ity Image url ToImage Ġout age Ġout files Con ver Con ds Con tributors Con sensus Con tributions Con versation Con grats bu c bu ch bu til AR IO AR GB ĠV A ĠV R ĠV ik ĠV IR ĠV ERY ĠV GM ĠV entilation ĠU CI ĠU Arr ĠU TM ry max Ġnum int Ġnum col Ġnum eri Ġnum Iterations Ġnum FidsInList print ed param Id Ġ5 24 Ġ5 35 Ġ5 82 Ġ5 89 Ġ5 67 Ġ5 48 Ġ5 42 Ġ5 39 Ġ5 31 Ġ5 58 Ġ5 63 Ġ5 72 Ġ5 61 Ġ5 71 Ġhe ard Ġhe sap mb ling ). * ib ar ssion e Ġen r che v che ese min F min a min dist 999 5 ator ies Ġtime lines Ġtime String Ġtime zones Ġtime machines Error Response Error Handler Error Notification scri ptor scri bus 18 10 16 25 16 09 16 27 16 21 16 68 Ġlist ens line A line of line parsed line Buffer array SMAPE sa ss sa ction sa ys da gs Ġk il Ġk ull Ġk ake Ġk Hz Ġk night Ġk arma Ġk orre Ġcol lation Ġcol pm Ġcol ums Ġcol lege Ġro ta Ġro sbag Ġpy po Ġpy dm Ġpy bm Ġpy curl Ġpy tket Ġpy berny Ġpy Vmomi Ġpy inotify config Value Ġ6 97 Ġ6 95 Ġ6 65 Ġ6 39 Ġ6 74 Ġ6 63 Ġ6 72 Ġset Point Ġset Color Ġset Label ener ator ag gs ag rams ump er http URL 04 14 04 63 13 88 13 91 13 42 13 59 13 071 og c og ad og onal lib path lib gmt lib tcod lib retranslate 06 17 06 09 06 26 06 98 06 42 06 31 06 78 Ġwh ats ll db ll bG class Node class Counts ign up 15 14 15 88 15 75 15 35 15 39 15 73 15 68 15 71 ST X ST OB ec l 100 10000 100 01000100 100 1011101 100 89905 max int max val max min max Value max pool max Len 05 17 05 09 05 27 05 94 05 87 05 85 05 86 03 34 03 33 03 95 03 47 03 78 03 010000003820 Ġint f Ġint seqs cs ip cs ock jo or we v we th we ird we ixin ip api ip Status ip acker Ġop j Ġop in Ġop tapy train X Ġch g Ġch log Ġch ang Ġch uck Ġch aque 17 04 17 13 17 37 17 69 17 136 17 996 Ġal m Ġal locations Ġal saaudio Ġal packa Ġal ongside 93 12 93 14 93 42 93 62 93 400 93 397 valid token lit ter 14 12 14 13 14 24 14 96 14 46 14 29 14 21 14 91 14 59 14 72 14 41 14 71 Ġpre dic Ġpre training Ġresult file uth er ne ur ne yu ne urosynth Ġ/ ) Ġ/ >\ Ġby ref Ġby Area 64 88 64 87 64 77 64 8193 Ġob Conversion Ġob fuscate Ġob tener index TRgn error es error List '' ( '' * Ġra j Ġra s Ġra dk Ġra cks Ġdefault ed Ġ[] ') Ġ[] ']) Ġ[] {}". Ġsub q Ġsub cal Ġsub files Ġsub terms Ġsub tbl Ġsub linn Ġso v Ġso us vel ho Ġ{' ': AM IL AM AX 96 25 96 77 96 29 96 218 96 299 96 6400 Ġac quires Ġac tively Ġcomp osing Ġcomp ensation Ġcomp lains Ġcomp etitive ĠCon strained ĠCon gratulations Ġnew name Ġnew fig Ġnew Col Ġnew item Ġnew Model Ġnew Start Ġnew Files Ġnew Gen Ġnew Quote Ġnew Implant Ġall files Ġall configs Ġall ura Ġall ManagemementZones Ġinput String Ġinput Tensor Ġinput Line Ġinput GPU Ġinput FileName 55 28 55 83 55 46 55 73 55 62 55 314 55 4744 [: ]: [: ])]) 94 18 94 16 94 06 94 37 94 26 94 29 94 43 94 91 Ġ} "}) ĊĠĠĠĠ ĊĠĠĠĠĠ ĊĠĠĠĠ ĊĊĠĠĠĠ arn Vault DE BT DE POSITION DE LEGATE RO ZXh Ġapp engine Ġapp Engine json api ()) ( ()) / ()) == ()) [:- ()) +'. fer ti fer ential fer roni node manager node Label Ġlabel color Ġlabel left Ġlabel stf av obj av ailab Ġno x Ġno split 87 33 87 56 87 47 87 42 87 299 no zero no alias Ġline count AL AD Ġclass id Ġclass Dict Ġclass property fic ación exp liciti CT CT CT CCT -------------------------------- ----- Data Particle AS AP iv r Ġla o 85 12 85 18 85 13 85 03 85 84 85 28 85 47 85 46 85 65 85 74 85 62 85 175 85 377 97 03 97 64 97 27 97 28 97 47 97 50 97 42 rid able rid wen back ed back slash {} } net G net ns 36 03 36 51 36 71 Ġspe ar =[ ^ Ġuse RWVoltage 011 200 011 010011 Ġid en Ġid xt ĠK J ĠK un ĠK ra ĠK ub ĠK ick ĠK ML ĠK ali ĠK onto ĠK AFKA ĠK NOW ĠK EEP ĠK roger ĠK absch Ġuser info Ġuser adm 95 22 95 94 95 36 95 23 95 38 95 45 95 48 95 62 95 72 95 69 95 287 923 89 return Argument word space lat i Ġ'- ')) Ġdist ort view topic Ġrequest Str run opp run IDs 86 12 86 24 86 82 86 72 stra ck stra da Ġmax time Ġmax match Ġmax pool Ġmax Area Ġmax zoom Ġmax imo sum med Ġdo odle Ġdo Overwrite Ġdate Added fa f fa h fa i fa z fa el fa hrenheit Ġz n Ġz un Ġz sc Ġz mb Ġz step Ġjson data init T HE F rit órios string Order Ġtrain solv default Resolution default WorksheetIndex AG N 57 32 57 27 57 23 57 38 57 81 57 51 57 224 57 026 57 13913 Ġ! " Ġ! !!!! Ġ[' {} Ġ[' ../ ... ], Ġ8 07 Ġ8 55 Ġext rem ster ic ster ne ww a Ġ| --> Ġ| __| create Node create Image create Dir "), ' ED A IS ION IS ADE IS LAND reg u reg ulator reg rets Ġtf name Ġtf record Ġtf snippet Res ur do ei au k au ro au la layer Number ele s try bunaÅĤ rc file rc ase rc min List T List ed List Panel List Store current Contour CO C CO W CO INS color Hex color blind port Handler port Security man ame Ġlo ans trans list trans Data 66 02 66 88 66 62 66 72 23 123145 Ġdx kxy unc ached unc losed AC g AC DA Ġcheck box Ġcheck Layout Ġcheck pointer ING RESS Ġstart angle lag stafi Ġte a Ġte ma Ġte quila ps N ps imi Ġli ability Ġli eu 44 97 44 904 ns bx ns ylvania IM T IM ARIES Ġdis order Ġdis position Ġ** ( AP IC AP PNP ler a Ġadd Layer Ġadd asnn Des erializer 75 02 75 95 75 26 75 44 75 83 new er new data new file new url new class new Gen Ġtext file Ġtext line Ġtext Rect Ġtext ToUse Ġ-*- \ cor a cor ona mail man io o io stream Ġrun id OT L OT ONIC ]: , ]: \ Ġnode js Ġnode Editor Ġurl split Ġurl List Ġurl unparse clo sures ef ef ']) - En countered Co upling Co efficients RI FT Ġend date Ġend task Ex MT Ex ports ET AG ET RA Id y Id Invalid Ġ-- " Ġ-- ") Ġ-- >", Ġ-- > ly J ly wood ly copersicum text L text x text size text input text width text grid text ui text Output text Over text Backend AT AN AT ERS AT IO AT AGC AT IQ AT ACAA AT IVES Ġ) + Ġ) { Ġ) } Ġ) """ Ġ) [::- xa x xa an xa fi xa ed xa ch xa es xa fo xa ft xa fa xa ey xa fe xa fy xa aa ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ low ip low level low mid low Val low Eyelid size V size Parallel čĊĠĠĠĠĠĠĠ čĊĠĠĠ com id com ers com be com enda com unas com manded com IpFilter com modities com inciare model v model Config model entity model Location model members ans w ans he ans ing ans lar ĠN M ĠN Y ĠN b ĠN n ĠN se ĠN par ĠN ag ĠN max ĠN ant ĠN io ĠN types ĠN UL ĠN layers ĠN CL ĠN PI ĠN DB ĠN GO ĠN half ĠN PROP ĠN INET ĠN Samples ĠN iko ĠN REL ĠN MU ĠN ulls ĠN ATIVE ĠN aT ĠN WB ĠN ifti ĠN MVOC ĠN SEvent ĠN uttX ĠN ombre ĠN SImage ĠN bonh ĠN ttExtractor ĠN ixon date Id date Path date Dict }, ') }, {}'. ir in ir ion ir ho ir cle ir ca ir atory ir hom len G len a len z len Dict num W num h num int num box num nodes num Features num Black num Pages num Missed num subgroup num PerClass num FidNodes num Fingers Ġres ist Ġres izer Ġres red Ġres olute Ġres ubmit Ġres UsedDsMap user lib user File user case user Color user Search user Deleted user Brightness bo di bo og bo logy bo hotels bo gus Ġ4 600 Ġ4 2000 Ġ4 403 Ġ4 235 Ġ4 065 Ġ4 444 Ġ4 341 Ġ4 054 Ġ4 959 ger i ff x ff de ff unction ff wd XX H Ġget Y Ġget size Ġget date Ġget ID Ġget current Ġget status Ġget files Ġget Log Ġget Config Ġget Max Ġget Message Ġget Context Ġget Request Ġget fla Ġget Code Ġget Min Ġget Device Ġget Block Ġget Objects Ġget Matrix Ġget Transaction Ġget Left Ġget Soup Ġget scheduler Ġget Right Ġget Meta Ġget Usage Ġget Points Ġget Vertex Ġget Summary Ġget XML Ġget Save Ġget Shader Ġget launcher Ġget Saved Ġget Pixels Ġget Weather Ġget Outputs Ġget Forecast Ġget EstimatedTransactionFee Ġget argspec Ġget Outgoing Ġget Incoming Ġget Facebook Ġget Resolved Ġget Oops Ġget jobID Ġget Complexity Ġget fullargspec Ġget pyver Ġget Sensitivity Ġget LSE Ġget Goto Ġget CartByGoods Ġget OurTimeAndSize Ġget sitepackages Ġget Akiba lu o lu me lu la lu ci lu hn lu cas lu dG lu orescence dir Out 92 107 92 91 92 63 92 216 92 327 92 138 92 156 92 808 92 965 92 969 92 0103 tp h tp m tp th tp ls tp cc tp mex col data col ator col Id col let col ons col dest col Count col liding col ortemp In Q In et In comp In File In fil In Image In Run In Filter In With In dian In DQ In Memory In Stock In finite In sensitive In Anchor In Hours In deed In quiry In hPa In surance In scrição ind E ind ab ind xx ind ucing ind ocument append Constraint append HTML quest a ĠR Y ĠR an ĠR ang ĠR ENT ĠR IB ĠR ounds ĠR CL ĠR ug ĠR OP ĠR CE ĠR DB ĠR CV ĠR ama ĠR bf ĠR inger ĠR ivers ĠR asm ĠR osa ĠR TD ĠR TEX ĠR ubble ĠR IPv ĠR aman ĠR ANGE ĠR IPP ĠR ABBIT ĠR svp ĠR onald ĠR abin ĠR behaviour ĠR icker mo og mo stra mo meta mo othed ep ared ep hemerals ray on ray let ray leigh Ġun st Ġun ew Ġun mark Ġun struct Ġun conf Ġun stack Ġun patch Ġun ions Ġun pad Ġun async Ġun tu Ġun scaled Ġun initialised Ġun published Ġun readable Ġun desired Ġun protected Ġun warped Ġun satis Ġun managed Ġun usable Ġun biased Ġun amed Ġun furl Ġun declared Ġun tangle Ġun igrams Ġun constrain Ġun realized Ġun judged Ġun desirable Ġun igram Ġun serem OR ALE fo u fo ver fo ai fo fc fo xtrot ule t ule te read val read json read Count read ibility read INI read DocChart read SignalStrength reate Database Ġtest val Ġtest list Ġtest label Ġtest lib Ġtest base Ġtest pos Ġtest Path Ġtest Map Ġtest corpus Ġtest Convert Ġtest XML Ġtest Prefix Ġtest Cloud Ġtest leaf Ġtest Fix Ġtest Expand Ġtest scenarios lic are lic ato Ġlog py Ġlog Name Ġlog sum Ġlog group Ġlog space Ġlog gin Ġlog files Ġlog cat Ġlog post Ġlog istics Ġlog levels Ġlog FilePath Ġlog feeder Ġlog RotateOnStartup 32 70 32 60 32 175 32 194 32 303 32 895 32 376 32 374 32 066 32 878 32 098 32 2079 32 4661 32 99587 per lin per man per page per mu per Page per plexities oc q oc u oc z oc lass oc alize oc ater oc cer oc curs oc PH oc rd ph id ph araoh ph obert ph arynx // _ // ---------------------------------# ĠG la ĠG ad ĠG ol ĠG ub ĠG ds ĠG ap ĠG lif ĠG LO ĠG EST ĠG FT ĠG si ĠG ater ĠG reed ĠG Line ĠG dk ĠG LU ĠG DT ĠG love ĠG pio ĠG EOF ĠG ilbert ĠG oblet ĠG romacs ĠG arden ĠG wen ĠG haz ĠG FLOP ĠG abriel ĠG ibson ĠG lacier ĠG azette ĠG ivens ĠG utenberg ĠG RIB ĠG uilherme ĠG upta ĠG FPGAN ĠG CLIENTSECRET ĠG YRO ces a ces ful Ġco al Ġco vars Ġco variant Ġco mplementation Ġco uplings Ġco elhos Ġon ed Ġon value Ġon Tree Ġon rack Ġon ERC Ġon Hover Ġon glides Ġon rech Ġon codrive Ġtype model Ġtype check Ġtype of Ġtype checking format D EN EG EN IX ĠW n ĠW ER ĠW ard ĠW orm ĠW right ĠW ak ĠW ED ĠW ANT ĠW ie ĠW EL ĠW MO ĠW inner ĠW EE ĠW ells ĠW ISE ĠW FC ĠW eng ĠW EA ĠW PA ĠW INTER ĠW rist ĠW MI ĠW AU ĠW adi ĠW alter ĠW enn ĠW onder ĠW aste ĠW ISH ĠW oj ĠW rench ĠW rote ĠW izard ĠW EEK ĠW sResource ĠW DItem ĠW bGit ĠW elch tri co ho es ho con ho med ho ek ity labs loc X loc Y loc a loc alizations url dir url Counter url Summary Ġout set Ġout str Ġout num Ġout config Ġout flow Ġout queue Ġout unit Ġout vals Ġout channels Ġout door Con form Con fidences Con sortium Con trary Ġlen n Ġlen v Ġlen AB Ġlen stronomy bu x bu ging bu je AR CT AR TR AR glass AR VIND AR elation AR PROJECTILE ĠV I ĠV j ĠV k ĠV r ĠV v ĠV ad ĠV min ĠV RO ĠV ader ĠV ale ĠV env ĠV server ĠV ERS ĠV MD ĠV micro ĠV ä ĠV servers ĠV inh ĠV ista ĠV IPS ĠV endors ĠV QE ĠV ASP ĠV iana ĠV CCS ĠV esper ĠV CVS ĠV RRP ĠV FFSL ĠV ISTED ĠV intage ĠU ne ĠU CT ĠU TR ĠU NN ĠU rb ĠU Graph ĠU SP ĠU TA ĠU ntrack ĠU tara code author code pipeline code Editor code chef code ToHTML ry Z ry u dict Name dict Var Ġnum f Ġnum IB Ġnum lines Ġnum IP Ġnum actions Ġnum Nodes Ġnum PK Ġnum chunks Ġnum Frames Ġnum IAC Ġnum ToBinary Ġnum uPDF Ġnum FidNodes Ġnum ransacs Ġnum CHRG Ġnum ForegroundPixels Ġvalue Dict print Color print Schema print Separator print Verbose param dir Ġ5 800 Ġ5 121 Ġ5 050 Ġ5 080 Ġ5 4612 Ġhe m Ġhe aded Ġhe igth Ġhe xdomain mb e mb p mb r mb v mb ta mb asic mb alance ). """, ). *', ib l ib or ib il ib ale ib ia ib ench ib bean ib agh ib ilitÃł Ġan i Ġan at Ġan cu Ġan atom Ġan ima Ġan ki Ġan umber Ġan nih Ġan them Ġan atomy Ġan ynode Ġan oplura Ġ__ ________________ Ġ__ ________________________________________________________________ Ġfrom at Ġfrom date Ġfrom buffer Ġfrom Interval Ġfrom Previous Ġen e Ġen n Ġen quire Ġen cry Ġen igma Ġen rico Ġen zymes ise e ise ed ise ul ise Labels ire z ard arsysla che ga che ptomino min n min qual min Node min ority min pairs min Rate min Coord min kms min Enclosing min SequenceSize min Revenue min ResF 999 35 999 82 IT B IT SU IT DA IT ORY IT CODE Ġtime C Ġtime type Ġtime code Ġtime Point Ġtime Code Ġtime Init Ġtime stops Ġtime Since Ġtime OfDay Ġtime XPos Ġtime Lable Error Count Error Messages Error Checker scri bd Ġ> ( Ġ> . 18 30 18 301 18 298 18 01802 16 92 16 26 16 201 16 91 Ġlist map Ġlist item Ġlist Tb line X line No line Number line cache line stop line Array line Length line arities line breaks coun tratio array Part ft count sa ger sa uc sa ik sa gt sa hara cur a cur batch cur pk cur Priority cur Slide da al da api da gger da chi da han da jte '), ) Ġk c Ġk le Ġk mp Ġk un Ġk os Ġk per Ġk ph Ġk ho Ġk base Ġk init Ġk ld Ġk red Ġk ia Ġk ernal Ġk NN Ġk pd Ġk ı Ġk dc Ġk Vals Ġk rpc Ġk RS Ġk Mean Ġk kt Ġk arb Ġk oh Ġk aka Ġk ratos Ġk law Ġk ilog Ġk elly Ġk elp Ġk jf Ġk aż Ġk orna Ġk lipped Ġk ludge Ġk appas Ġcol data Ġcol type Ġcol lab Ġcol width Ġcol tran Ġcol ons Ġcol sd Ġcol gate Ġcol Dec Ġcol Names Ġcol lapsing Ġcol ortemp 25 20 25 50 25 70 25 0000000 25 211 25 907 25 422 25 085 25 080 Ġro data Ġro ok Ġro bin Ġro score Ġro dar Ġro ku Ġro lename Ġro ppy Ġro ulete St ab St ony Ġpy R Ġpy p Ġpy op Ġpy text Ġpy format Ġpy code Ġpy ec Ġpy rite Ġpy right Ġpy node Ġpy net Ġpy parser Ġpy of Ġpy flow Ġpy az Ġpy help Ġpy mesh Ġpy ja Ġpy dash Ġpy wt Ġpy dl Ġpy dp Ġpy robot Ġpy cycle Ġpy coin Ġpy virtual Ġpy performance Ġpy latex Ġpy infra Ġpy kd Ġpy radio Ġpy ocr Ġpy mort Ġpy coral Ġpy bedtools Ġpy riemann Ġpy dgm Ġpy copia Ġpy kka Ġpy grape Ġpy pinyin Ġpy raf Ġpy coreir Ġpy serini Ġpy nvml Ġpy hcl Ġpy scrabble Ġpy twalk Ġpy pkgpath Ġpy stratis Ġpy rogue Ġpy monad Ġpy whatkit Ġpy hocon config server config DescriptorSize Ġ6 11 Ġ6 13 Ġ6 96 Ġ6 57 Ġ6 56 Ġ6 98 Ġ6 35 Ġ6 89 Ġ6 81 Ġ6 79 Ġ6 58 Ġ6 49 Ġ6 61 Ġ6 71 Ġ6 007 Ġ6 854 Ġ6 563 Ġ6 2269 lt n lt y lt on Ġset ters Ġset On Ġset term Ġset rgb Ġset Main Ġset Remote Ġset uppy Ġset distrocname ener o ener ating ag ata ag ment ag pl ag aa ag ada ag Ax ag tg ag Az ag Ay ag Vg ag Xg ag gingClassifier ag regar ag gressor ag ritrop ts B ts i ts igma ts unami ts ikchen http x http lib http Statuses 04 87 04 20 04 011 04 30 04 42 04 39 04 79 04 73 04 78 04 53 04 52 04 41 04 51 04 007 04 386 04 355 Ġmodel path Ġmodel list Ġmodel info Ġmodel Config Ġmodel Number Ġmodel API Ġmodel Button Ġmodel Task Ġmodel Location 13 90 13 30 13 111 13 165 13 987 13 054 13 5802 og u og gi og aster og awa og rsf lib E lib re lib py lib exec lib xml lib cz lib GLES lib pyqt lib erty lib sass lib daal 06 44 06 38 06 83 06 91 06 49 06 51 06 194 06 907 06 172 06 937 06 966 06 311 06 2742 06 3850 Ġwh irl ll h ll ä ll Tr ll crnrlon ll crnrlat class y class id class Id class ref class parent class indices class Folder ign ature ign side ource Pack 15 99 15 93 15 923 15 90 15 80 15 81 15 31 15 72 15 916 15 104 15 208 15 387 lif espan lif ecyle SE U SE p SE DIM SE MBL SE VEN SE CTOR SE rrs ST B ST H ST ask ST DS ST AK ST LINK ST AMP ST IX ST ENCI ec m ec ce ec la ec bf ec cObs 100 06 100 05 100 64 100 1111111111111111 100 101111 100 01000000 100 0111111 100 926 100 756 100 0100010001000100 100 18754 ĠLicense s max width max encode max radius max jobs max sol max well max Coord max shield max Lon max Tries max imization max ImagesPerCategory max Knee ass ur ass are ass isted ass orb 05 64 05 97 05 45 05 101 05 107 05 42 05 54 05 59 05 300 05 61 05 384 05 305 05 457 05 405 05 899 05 018 05 377 05 865 05 768 05 389 05 2264 05 1501 05 3943 Ġthis url Ġthis Span 03 37 03 36 03 80 03 35 03 42 03 59 03 49 03 71 03 132 03 114 03 436 03 478 03 3613 orm at orm an orm uBot Ġint ers Ġint array Ġint General Ġint Corner Ġint Invoice ]. +-\ cs ocket cs dn cs beam cs Relative cs ApiClient jo K jo ken jo hns jo oneal we f we h we fz we Dy we arable we ewx we bgl uti ans uti lis uti ques ip tr ip lot ip ip ip opt ip fw ip scraper Ġop a Ġop ense Ġop sys Ġop ción Ġop tix Ġop CodeFreqs eld rit ute ch train A train B train Y train ings train String train Longitude train Latitude train Stays Ġch n Ġch s Ġch ce Ġch air Ġch si Ġch lor Ġch aves Ġch agn Ġch arger Ġch Additive Ġch ameleon Ġch ickens ĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ 17 90 17 207 17 296 17 397 Ġal oc Ġal td Ġal tu Ġal bert Ġal ayer Ġal cun Ġal cohol Ġal igment Ġal coholic dd k dd ot dd dh 93 61 93 103 93 167 93 857 93 808 93 918 93 892 93 912 93 902 93 909 93 911 93 474 93 3732 93 0906 valid er valid ates valid ChapterNum ĊĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠ lit V lit ro lit ros lit ues sed thick 14 000 14 101 14 89 14 48 14 60 14 175 14 156 14 0705 ari us ari as Ġpre st Ġpre mask Ġpre buffer Ġpre emp Ġpre conditions Ġpre filer Ġpre Best Ġpre serves Ġpre bang Ġpre scriptions Ġpre dix Ġpre emph Ġpre conditioner Ġpre fijo Ġresult B Ġresult C Ġresult Q Ġresult Number Ġresult Dict Ġresult ante Ġresult Json ne X ne h ne au ne mpty ne ider ne arly ne uml ne pochs Ġ/ " Ġ/ { Ġ/ \\ Ġ/ >', ord ine ord pi Ġat c Ġat n Ġat list Ġat test Ġat ob Ġat dict Ġat temp Ġat Tree Ġat Names Ġat traction Ġat Sym ok in ok it ok base Ġby name Ġby hour **** """ umn i 64 99 64 25 64 15 64 22 64 19 64 27 64 96 64 85 64 40 64 74 64 78 64 41 64 180 64 198 64 106 64 375 64 396 right most right arrow right Brow Ġob b Ġob ie Ġob ten Ġob servers Ġob lique Ġob scure index Value index File index To index Size index Words error message enti eth Ġrange breaks Ġra g Ġra ug Ġra stream Ġra dec Ġra ider Ġra mas Ġra stre Ġra fiki Ġra menia Ġdefault Node Ġdefault VariantSelection Ġdefault prjid base data base test base Value base dirname base Metric base objs base Paths base SpanSec Ġ[] ' ou o ou z ou la ou res ou venir ([ #\ gra is gra ffi gra ppe 076 92 076 73 info list plot data plot size plot Dir plot Global plot Experiment plot Baseline plot Trades plot ImageProvider arget s count Matrix iti c iti ga iti tl LE DO LE MS LE TS LE TON LE EF Type Context Type Derived Type UnaryAggFuncExpr RE A RE ATE RE VE RE BASE RE CS RE LU RE Cluster RE ACTIVE RE MASTER RE PARAMETER RE ALLOC RE WARDS RE VERSED RE ALLO RE ASONS Ġtra s Ġtra ing Ġtra ded join able IC J IC Y IC ITY IC ATES IC urr IC LASS IC reateDatabase 08 0000 08 14 08 38 08 46 08 91 08 42 08 39 08 54 08 0101 08 59 08 71 08 307 08 918 08 875 08 645 08 274 08 33333333 08 1450 08 36782 argument list main Frame main chain main Sizer main ToolBar AN Z AN HO AN IES AN NUM AN SU AN UNCIO pi i pi ped pi xs pi overview pi cosat pi lihan 22 107 22 70 22 202 22 207 22 212 22 267 22 015 22 223 Ġ\ + Ġ\ \' ust ays Ġ. ' Ġ. { Ġ. /{ ĠH c ĠH n ĠH ab ĠH od ĠH ip ĠH ari ĠH base ĠH cal ĠH AD ĠH off ĠH INT ĠH EX ĠH adj ĠH itch ĠH ero ĠH UB ĠH ier ĠH oriz ĠH ough ĠH ints ĠH oney ĠH LT ĠH EY ĠH uber ĠH uan ĠH TM ĠH abit ĠH wang ĠH ORA ĠH otel ĠH abilidades ĠH askell ĠH ousing ĠH ulk ĠH FTA ĠH uffman ĠH iguchi ĠH asting ĠH immelblau ĠH ampshire ĠH ijacking ĠH fArgumentParser ĠH extream ĠRe ar ĠRe ed ĠRe id ĠRe mo ĠRe index ĠRe create ĠRe order ĠRe Frame ĠRe initialize ĠRe curs ĠRe setting ĠRe visit ĠRe bulk ĠRe construct ĠRe cursion ĠRe production ĠRe bec ĠRe messa ĠRe ionization ĠRe connecting ĠRe agan ĠRe gula ĠRe deemErc ĠRe levé ĠRe movinator ay e ay i ay ing ay Response ay ama sub n sub form sub step sub token sub channel sub Class sub columns sub window sub select sub zip sub sequence sub vol sub figure sub packages sub lists sub tiles sub categories sub formula sub division sub worksheet sub rsa sub locality sub grupo sub linn sub Cort Ġ{} & Ġ{} ." Ġ{} ={} Ġ{} /{}/ Ġ{} """. Ġ{} }}}, Ġ{} ..'. Ġ{} ãĢĤãĢĤãĢĤãĢĤ ml f ml box input data input List input box input Value input files input Number input String input Options input rpc input Cols input Electrode input MagMeter np v np le np age eri k eri er eri co eri alizes ][ :]) mat ric mat ryoshka Ġsh r Ġsh at Ġsh go Ġsh andler Ġsh ake Ġsh utter Ġsh ields Ġsh runk Ġsh ameless Ġdi o Ġdi u Ġdi pha Ġdi electric Ġdi urne Ġdi aling Ġdi oxide sk n sk p sk ar sk il sk us sk os sk else sk opt sk irt sk aya sk bitmap sk idl sk ynet df ac df player df opts db ef db dump db Exception db Access db tt db constants db room db Wh db postgres db Pil mit ry LL V LL q LL DP UT M UT able UT IONS UT OL UT ERON UT uning work path work let work sheets 88 11 88 92 88 26 88 98 88 46 88 89 88 29 88 234 88 217 88 906 88 427 88 425 88 955 88 227 88 335 88 393 88 454 88 575 88 477 88 3399 88 2831 lp df lp wan ded uplicated ast art ast yle Ġargs cope 19 100 19 000 19 50 19 126 19 000101 19 045 19 159 19 648 eat er output Type output List output String output RGB output Filename output factors output FileType lin a lin q lin scale lin cRNA image utils image quality comp i comp action comp vert comp Index comp osto comp rens comp laints comp actify ID B ID V ID INE ID Ref ID OS ID IFIER ID AES ID ADE (( .+)\ Ġsc ad Ġsc cs Ġsc ron Ġsc rapper Ġsc VI Ġsc itype 34 169 34 237 34 426 34 036 34 975 34 500735 start net start Point start One start Page start Msecs start IOV start ReleaseTime pos se pos res pos Xf pos sessed Ġ[" ' Ġ[" { Ġ[" /", Ġ[" -", Ġ[" *"], Ġwe py Ġwe iter Ġwe asy Ġwe ibull ree FloatImage 09 67 09 42 09 006 84 92 84 999 84 16 84 39 84 41 84 69 84 61 84 115 84 896 84 397 84 687 84 357 84 067 84 435 84 245 84 727 84 447 84 669 84 1563786 ĠIn str ĠIn spe ĠIn File ĠIn let ĠIn gress ĠIn bound ĠIn duction ĠIn dia ĠIn dicators ĠIn ici ĠIn fusion ĠIn quirer ĠIn ChI ĠIn spired ĠIn jured write block write Count write All write Val write Tests write plots write SAM with google with Day with mpi with gft ere q ere my ere ady 27 964 27 848 orch id update State update ROI update GUI update Rho ask an ask sper ask saveasfilename ask okcancel Ġkey able Ġkey Value Ġkey Vals Ġkey byte Ġkey pressed nd g nd ar nd tr nd point nd ocs inter webs inter connectivity inter regnum ant al ant ro ant ine ant art ant prop ant arti ant lir ant ennas gs l gs z gs rc gs iftp by o by ol by ear bin data bin keys bin ia bin Count bin Samples shape let lock path lock Type lock Value lock Max lock Min lock Precision lock Increment lock Continuous lock OneTurn lock ShowLabel Ġle l Ġle ather Ġle ste Ġle etcode Ġle itura ill on ĠThe il result set result count result Function ann i ann uel ann uum arch Num ging Surrogate Ġax range 24 50 24 002 24 211 24 219 37 334 37 387 37 3061 37 8968 Ġpath list Ġare sta Ġare Equivalent ak J ak N ak U ak ci ak ari ak ia Pro ds Pro vas Pro pell state info state Info state vars em li em var point pattern point Types ark ansas map line map List map mask map Filters map Sentence Ġoutput PK Ġoutput Full Ġ@ !@ Ġpo fs Ġpo lec Ġcom ming Ġcom bind Ġcom manded Ġsub G Ġsub key Ġsub stance Ġsub main Ġsub word Ġsub keys Ġsub dep Ġsub cmd Ġsub spec Ġsub components Ġsub typ Ġsub parts Ġsub proc Ġsub sol Ġsub elements Ġsub family Ġsub Container Ġsub traj Ġsub trees Ġsub lineage Ġsub subdirs Ġsub Criteria Ġsub misson Ġso ul Ġso lids Ġso dipodi yn i yn an yn es yn olds yn fev als am rep func rep aired AM w AM Service AM CTRL AM ERIC 96 19 96 34 96 28 96 98 96 81 96 096 96 217 96 501 96 032 96 904 96 236 96 237 96 355 96 364 96 913 96 877 96 985 96 092 96 963 96 1755 96 3481 96 5984 Ġac qu Ġac ert Ġac loud Ġac quiring Ġac nfg Ġcomp l Ġcomp on Ġcomp data Ġcomp ens Ġcomp resses Ġcomp lain Ġcomp rehend Ġcomp romise Ġcomp artments Ġcomp ete Ġcomp anion Ġcomp ensate Ġcomp romised ses ame aliz i aliz ando aliz acao aliz zare ĠCon stru ĠCon gress ĠCon servation ĠCon texts ĠCon currency ĠCon solid ĠCon fli ĠCon fluence ĠCon solidate Ġnew H Ġnew f Ġnew val Ġnew str Ġnew text Ġnew json Ġnew node Ġnew List Ġnew template Ġnew Dict Ġnew seed Ġnew Line Ġnew topic Ġnew plan Ġnew spacing Ġnew hp Ġnew pile Ġnew Intervals Ġnew EntityId Ġnew Districts Ġnew comers ress l ress ão Ġall H Ġall y Ġall args Ġall tags Ġall docs Ġall Full Ġall radii Ġall Fragments Ġall EntityTypes Ġall KernelPaths Ġinput Data Ġinput box Ġinput files Ġinput dim Ġinput Dict Ġinput Array Ġinput rpc Ġinput Attr Ġinput CRS Ġinput Sd 55 01 55 0000 55 12 55 22 55 88 55 19 55 33 55 95 55 000 55 31 55 58 55 78 55 59 55 555 55 283 55 2454 55 1116 [: ][' 94 89 94 49 94 41 94 61 94 71 94 384 94 232 94 906 94 935 94 314 94 244 94 866 94 313 94 676 94 3503 94 44444444 94 6009 clu string clu stal Ġcur G Ġcur L Ġcur ator Ġcur hp Ġcur seek Ġcur ious Ġ} ') Ġ} ]] Ġ} } ... `: Ġ8 01 Ġ8 25 Ġ8 06 Ġ8 93 Ġ8 08 Ġ8 34 Ġ8 21 Ġ8 001 Ġ8 190 Ġ8 064 Ġ8 2644 Ġext gw Ġext inct Ġext Corner ww G Ġ| ___ create Text create Job create Edge create Dimension create Reverse create TextureCube create CLAHE create ClassificationImageFolderStructure create AutoEncoderImageFolderStructure create LabelFileFromPathoDict "), ), ED S ED o ED URE ED OTA ED Alias ED RIVER IS VS reg type reg incid Ġtf c Ġtf worker Ġtf prof Res n Res Parser Res izes Res uming Res ampler number Range number Directory number Azimuth number oframes number forindex ix w ix network Ġbo logna Ġbo utiques do z do pp do Not do Try Ġper ceive Ġper Volume Ġper mutate Ġper deu Ġper missões message id parse Data parse Log parse Int parse fromstring ale a ale jandro au X au i au me au che au cs group list group opt spe cul spe tto Ġne X Ġne Y Ġne ue Ġne upy Ġne lem Ġne vow Ġne pochs ele tt ele land Text Value Text Parser Text API Text Rank Text Ctrl Ġfil ereader env en env info env yconfig "," @ "," \\ "," (.* "," &# Ġ10 99 Ġcreate func Ġcreate Table Ġcreate Option Ġcreate Row Ġcreate Spoiler try out try bun try Again List ings List Property List Mixin List Wrapper List Dialog List CreateAPIView current user current File current stop current Module current Iteration current Section current Archive current Enzyme current Remap CO Bh CO PTIONS CO bjects tle d Ġfunction call Ġfunction startTime old Value old Pos color izer color scheme color cycle color FromPlugs upp ing upp asd port o port Auth port folios port BasedVlan man ia man Filter man ufacturing man oeuvre man hatten ach orro md ps md Status version List version Info version Tag Ġlogging Flag Ġlo ci Ġlo ude Ġlo vasz 90 924 api os api user api keys api Node api Client api Url api Handle api Mirror trans from trans code trans verse trans coder trans missions status Text status page status Titles 66 15 66 03 66 17 66 34 66 37 66 95 66 38 66 76 66 39 66 178 66 509 66 3503 23 022 23 105 23 918 23 078 23 643 Ġdx data Ġdx psf unc a unc lipped unc laimed AC ER AC ION AC CL AC BE AC BA AC AGC AC AGT AC ACAA AC UMOS =( .* =( ",", Ġcheck dir Ġcheck Piece Ġcheck summer Ġstart Index Ġstart dat Ġstart prob Ġstart Block Ġstart Interval Ġstart Epoch Ġstart tls Ġstart Ep Ġstart Addresses Ġstart InterfaceNumber Ġstart EpCut Ġstart SessionResponse lag r lag ged lag tigt lag uerre Ġte i Ġte ve Ġte aspo Ġmat r Ġmat s Ġmat name Ġmat ure Ġmat Times ps G ps ionic Ġli ck Ġli king Ġli abilities Ġli ées 44 40 44 568 44 444 44 559 44 2943 frame set frame match frame Size frame alpha frame Rate cont rei ns q ns id ns bu ns ink ns lices ns ynfev und y und en und ancies und ocumented IM M IM DB IM PRO IM HD IM ixin Ġdis con Ġdis lib Ġdis place Ġdis pose Ġdis allow Ġdis pla Ġdis closed Ġdis patches Ġdis advantages Ġdis regard Ġdis fluency Ġdis poser Ġdis cretion Ġdis juncts Ġ** / Ġ** \ Ġ** ` Ġ** >** ENT E ENT ROPY object Storage AP M AP OT AP POINT AP PC AP PLE AP ATH AP OST AP UNLOCK AP ointer AP IMixin ler o ler in ler ows ler mont Ġadd op Ġadd end Ġadd time Ġadd File Ġadd Num Ġadd Link Ġadd Sample Ġadd rtype Ġadd hom Ġadd FramingCodes Des al Des afio 75 10 75 25 75 08 75 09 75 24 75 36 75 86 75 000 75 89 75 48 75 31 75 69 75 355 75 312 75 399 75 068 75 3764 75 9671 new P new X new c new g new t new ly new json new img new ids new head new password new font new Scale new Feature new Mesh new Root new Scene new Contents new Fish resh ard resh ared idx es Ġtext a Ġtext obj Ġtext grid Ġtext position Ġtext Size Ġtext rank Ġtext Format Ġtext clf Ġtext magic Ġtext SecondScreen float Path cor os cor az cor ked cor vette cor asick mail from mail list mail server mail Sender io f io q io Type io vec io logy io Calc io peia Ġrun e Ġrun set Ġrun state Ġrun Name Ġrun tests Ġrun Process OT IDE ]: # ]: [ ]: ", Ġnode pool Ġurl conf Ġurl Start clo set clo ser clo vebooks ef P ef ax ']) ** ']) }, ']) [: yst ores yst oolbox yst aple En roll En trust En hancer En codable En cType En thalpyVaporizations En cyclopedia Co W Co me Co il Co fig Co RA Co DeS auth n auth file 11111111 1101111 28 204 28 187 28 947 28 2465 RI SE RI LL RI BU RI VE RI GER Ġend l Ġend pt Ġend coding Ġend Block Ġend Idx Ġend Msecs Ex pose Ex Jpi ET est ET IC ET AS ET TER Id P Id Y Id Z Id t Id ent Id By Id Token raw i raw io raw Transaction raw nie raw bitrate var P var o var q var pi var ID var types var names var mask var RWModel fix cols so o so us so loud so uma cal er cal ulate cal Temp cal centi cal Offset cal ories cal Slope cal inski cal lowip Ġmessage list Ġmessage Handler 56 01 56 02 56 12 56 09 56 26 56 30 56 21 56 53 56 512 56 808 56 396 56 357 56 977 56 576 56 066 56 901 56 758 go lem go AAA go sta 98 36 98 923 98 916 98 164 98 295 98 007 98 1100 98 2837 98 2386 98 3199 98 3759 98 3068 98 2459 98 3956 98 9235 Ġpass worword Ġsp d Ġsp num Ġsp mi Ġsp ends Ġsp inn Ġsp acer Ġsp rings Ġsp leen Ġsp illover client callbacks FI ABLE FI REPLACE local Path local Run local InertiaDiagonal 38 000 38 133 38 336 move Past my name my th my model my param my ip my query my project my database my Session my writer my Method my mesh my inv my Series my Profile my Files my Offset my PDF my PackedPoint my elin obj f obj p obj Type obj copy obj dump obj cls obj fname obj StockMst Ġdict a Ġdict b Ġdict Name Ġmin u Ġmin is Ġmin UP Ġmin ority Ġmin Vector Ġmin Peak Ġmin zoom Ġmin Phi Ġmin Radius Ġmin kowski Ġmin Rapidity Ġmin SequenceSize Ġmin inums pop d pop stat pop PR ******** **** LO L LO p LO DE LO VF ĠUn subscribe ĠUn seen ĠUn identified ĠUn certainty ĠUn picklingError ĠUn balancedDataset ĠUn normalizes Po i Po z Po ti Po li Po lish Ġ(' ( Ġ(' =', box line box scores box novel Ġ(" ([ Ġ(" *. Ġ(" '% check path check pt check Version check Joint check Ack check unsigned check PermissionOwnership batch import title ment Me e Me ad Me aly Me ga Me ade Me lodic module str module Path Se an Se ver Se agate Se vere Se venth Se znam Se questro Se dezev Se otud uc an uc cd Ac quired Ac cr Ac ampamento method Array method caller be z be ek be bb be holder be lie be ggars Ġcan dies Ġcan ucks UR T UR w UR SDAY ĠOR CA ĠOR GAN tes i tes la ĠQ K ĠQ M ĠQ g ĠQ o ĠQ ED ĠQ List ĠQ Time ĠQ String ĠQ Item ĠQ UI ĠQ LD ĠQ Thread ĠQ Url ĠQ Standard ĠQ Brush ĠQ Activation ĠQ HL ĠQ ProgressBar ĠQ idian ĠQ nabla ĠQ AbstractItemView ĠQ TabBar ĠQ WebEngine ĠQ InputDialog ĠQ MetaObject ĠQ KeySequence ĠQ CoDeS 200 204 img A img id img test img sets img loaded img filepath img ByteArr Ġcolor log Ġcolor List Ġcolor xy PT A PT Z PT URN of D of y of day of contents of eng of ei of Rectangle of fices target Path target Dir target Layer target Delete 35 33 35 000 35 127 35 156 35 1055 sample Json AB l AB LY AB RID vis ibile ud ging Col laborator Col umbus ref l ref Data ref seq ref metric ref Count ref itter ref raction Value List Value Key Value Types Value Buffer Ġwor n org util org ensen html filter html testapp Ċĉĉĉĉ Ġĉĉ Ġus fm Ġus Processor dataset Name Ġmo q Ġmo ss Ġmo is Ġmo ver Ġmo vi Ġmo file Ġmo tiv Ġmo tivation Ġmo ea Ġmo eda Ġmo teur Ġmo jom Ġmo isture Ġmo yenne File d File Form File Response File Mode File Match File Controller File Only File Extension File Converter File Matcher File Resolver File NotFoundException File Recorder File Zilla ain i bs G bs v bs df bs dm bs mn bs wap bs gda Ġresponse List pri a pri mc pri zes Ġcopy text Ġcopy Textures 201 37155 AD M AD ate AD Core AD GROUPS AD Andor ran m Ar h Ar son Ar AG Ar gon Ar AK Ar cher Ar thur Ar lington Ar chiver save out save Data save kw save Checkpoint save Localizations Ġtarget user Ġtarget db Ġtarget layer Ġtarget room Ġtarget Cell Ġtarget Cells Ġtarget Handle Ġtarget Contexts tim eraSASIEEE cre sc cre ations cre alm Ġim files Ġim hei Ġdf c Ġdf list Ġdf test Ġdf List Ġdf range Ġdf betas Ġdf vfs doc name doc file doc Id doc fx doc setPath ))) ( ',' # ',' ( ',' { stat ues stat Genes flow lines flow chart ĠSe verity ĠSe paration Ġad as Ġad dict Ġad words Ġad missions Ġad ınız Ġad rese Ġcurrent start Ġcurrent Path Ġcurrent Start Ġcurrent Enzyme Ġcurrent ModSecRules nn g nn cf nn rq norm Config 45 10 45 395 45 0576 77 00 77 01 77 99 77 17 77 64 77 55 77 44 77 65 77 69 77 975 77 648 77 433 77 751 amp i amp o amp ro amp osm Ġvalid Snaps Ġvalid FileOnly ng c ng if ng als PO X PO p PO UND PO ffset table DG table ToMarkdown zer oth zer bai zer orank zer ototal zer ocater attr Data ich er ich tb ich naea cent ery cent ralized item Name item metadata item ized item ById ql Y ql wu ql enth the file the irs the Ax the Hostname ide m ide tail Ġdatetime format function Name function Derivative Ġerror count Ġerror Derivative ey r ey Jv ĠY o ĠY am ĠY Error ĠY Type ĠY ann ĠY AM ĠY FI ĠY aw ĠY ev ĠY Filter ĠY lm ĠY ubi ĠY elp ĠY ARN ĠY NEG ĠY ModelError Ġinter c Ġinter limb Ġinter ceptor Ġinter ruption Ġinter helical act list ä¸ ¡ ä¸ ¥ ä¸ ĺ feat Holder "], )) "], [" Ġspeci fi Ġspeci alize Ġrandom izer Ġrandom String Ġrandom Card Builder Factory ĠX E ĠX v ĠX Text ĠX SD ĠX Block ĠX Interface ĠX Import ĠX HTML ĠX OVER ĠX CMD ĠX enia ĠX dbException sent Error `` """ Ġtrans length Ġtrans location Ġtrans literate Ġtrans literation Ġtrans akci Ġrow list Ġrow props Ġarg u Ġarg num Ġarg values Ġarg Max Ġarg Names Ġarg Proc Ġarg minmax Ġarg OrArgTuple Ġbase P Ġbase flow Ġbase Dir Ġbase Coin CH U CH AS CH OO CH ASTIC CH INA CH eader cc m cc lcgce call p call Id call TB call instrs call Later 47 19 47 28 47 46 47 165 47 299 47 325 47 903 47 087 47 1228 47 880 47 4542 ong lides ong qing initi ating ]] # ]] + ]] ]. ]] }) Ġcode List Ġcode box Ġcode book csv r ict s Ġenum aration event o event hub event Ticket event SeqNum core gen 101 0100 101 00101 101 325 101 344 101 607 101 5625 action str action url action logs face Start command Name Str s column Names column Combination ĠEx ps ĠEx ceeded ĠEx posure ĠEx haust ĠEx pertise ĠEx PASy ĠEx plained ĠEx oGENI [:, " Ġgo o Ġgo st tf n tf w tf ac tf ms tf tp tf devices files B files izes files imul las jon names cope Ġpos dict pert Size Ġ9 10 Ġ9 12 Ġ9 1000 Ġ9 00000 top n top rint top num top down top Down top two top crop top generated top Bids top fifty top lankton ream ento Ġload model Ġload cols Ġload funcs Ġload Ui Ġload DataSet Ġload Entries Ġload HDL Ġload AndCompileList find val find table find And find Median find Entities find NumBytes find Homography ash in ash er cy m cy press cy rillic Status Of Status Result Status Check Status Args Status VO Status OutputType Set tle Set File Set Option Set Item Set Dir Set Source Set And Set Grid Set Full Set Pixel Set Joint Set Pad Set RenderWindow Set EditText Set WindowsHookEx ning ton Ġpython w Ġpython starter pl MB pl unge .""" . IL AB IL DR IL TS Ġmethod Id Ġmethod nums ĠOF A ĠOF ORSIGN dire tto Ġsk m Ġsk aio Ġreg name Ġreg idx Ġreg las Ġreg Obj Ġreg iões vert ure Test Program Test Password Test Agent Test Common Test Gadget Test Harness Test EpRet Test WebsocketRegisterAgent Test namePow ')) ]) mean P mean var mean std mean fesc Ġgener ically HO G HO LY HO ULD HO UGH license plates 83 01 83 99 83 92 83 16 83 13 83 17 83 57 83 90 83 916 83 132 83 905 83 875 83 558 Ġstring From range li range Sampling range PixelSize range RandomWeight Ġevent label Ġevent Nodes Ġevent InstanceType Ġone Turn Ġone fuzz IB E IB g IB KJ IB Ij Ġmain part Ġmain lane length scales length Scales Ġver ity Ġver warming Ch en Ch ad Ch urn Ch op Ch ave Ch IP Ch imp Ch eng Ch allen Ch anger Ch rg Ch ances Ch erry Ch omsky wh l wh dr response query response Elements response Received Ġsize Policy led Demo >> ' du de du ke du fan du zione du ytan Ġlin en Ġlin ia Ġlin enum Ġlin uxbridge mark one mark two mark twor mark onern random start random ised ai j ai al UN A UN W UN CTION UN DEF UN NER UN COMPRESSED UN PAID qual ification qual icati gen ic gen List gen ef gen mask gen Model gen elatex ĠIN IC ĠIN DU ĠIN CLUS ĠIN STRUCTIONS close fig close Event sg ol sg pa filter able filter Date filter Spec filter Edit filter Enabled rt n rt List rt temberg ĠReturn Stmt ĠReturn TotalRowCounts 82 13 82 08 82 97 82 000 82 1010 }) ', dim X dim name dim gray Ġseri ously Ġval min Ġval max Ġval ences Time Text Time step Time Code Time Setting Time Tagger ESS OR ESS ARY âĢ » âĢ Į block name block time block types block fs block header block hex block quote round Int Ġtable t Ġtable sample 65 18 65 13 65 17 65 97 65 86 65 38 65 45 65 48 65 81 65 164 65 432 65 465 off ense off Max off ering gn E gn U Ġdb m Ġdb Id Ġdb host graph array graph ie grid name grid der grid app grid world grid Fx grid Fy MP AS 67 11 67 14 67 19 67 34 67 27 67 94 67 87 67 26 67 80 67 75 67 35 67 43 67 42 67 376 67 3762 cat Index 43 00 43 13 43 040 show all show Py show background show instr show Macro show Logs show spikes show userdata bot te Ġitem count head count head water Ġ{" *": Ġsource layer Ġsource Table Ġsource language Ġsource Width Ġsource Folder cl ss cl ark cl onal cl athrates use Multi use Cp use Bias use explorer use tempo use ExoSM use ExplicitDryRunSpec use Autoc ĠCON J ĠCON VER ĠCON VERSION ĠCON VERSATIONS python ize device set device Type Ġup f Ġup lo Ġup start Ġup ward Ġup down Ġup vector Ġup sampler Ġup firdn Ġcor po Ġcor als Ġcor rep Ġcor nac Ġcor outines ĠPro do ĠPro ton ĠPro cedural ĠPro jeção level ing Table Type Table Name Table au Table View Table Def Table Values Table Schema Table Bootstrap CL e CL IN CL DN Ġplot data Ġplot dat Ġplot All FF C FF LAGS 21 934 search box search File search filter search Time search tools search Form search Keys search Bean search CallLater Ġ:: :: ĠList ar ĠList Property ĠList Serializer ĠList MetricSummary ĠList MetricMeta ĠFlag Region Ġcontin ua lines wcs lines ToRm Ġ100 4 Ġ100 9 Ġ100 14 Ġ100 24 INT RO fir mier fir ulais vo i vo it :: / :: ', :: ], dep hell dep latformr 000000 08 000000 011101 000000 0101110 000000 0424 000000 1001111011111111 Ġnet rc Ġnet port Ġnet box Ġnet stat Ġnet Dict Ġpoint list Ġpoint Time Ġpoint Index Ġpoint clouds SI GL SI Wi SI REPO ug u ug ues ug uin ug iem ug uay Ġmatch dict Ġmatch Type Ġmatch Str Ġmatch tag Ġmatch IdList entry ByName cu H cu Q cu as cu ir cu je cu grape Ġother move Ġother dbref page Number page banner true skill down By down sampler std arg Ġaction able Ġaction Id Ġaction server Ġresults gen PI R PI ID PI ENT PI KE PI ECES context Name context List context math 48 32 sv s sv ilupp ie me )* (( Ġqu in Ġqu di Ġqu art Ġqu anta Ġqu eremos Parser Storage Parser Arguments Ġoptions Categorized store AccessToken Ġimg B Ġimg W Ġimg Y Ġimg Z Ġimg Name Ġimg net Ġimg File Ġimg Width Ġimg Height Ġimg ContainerUrls EX A EX AM EX CL ĠData source ĠData Table ĠData Object ĠData proc ĠData ONE ĠData Wrapper ĠData Collection ĠData Import ĠData Sink ĠData Collator ĠData Preparation ĠData TextParser only rot ical y FA V FA p FA AS FA ql FA VOR err file err level err Code err prob err ortext pass code ting roup ting ham plt Average plt ModeSplit ĊĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠ Ġany config Ġany Set Ġany cache Ġany body Ġany Adjacent fe u fe af fe vals fe bb fe Offset fe ira red dish 60 93 Ġfirst Num Ġfirst Occur No Encryption No Pen No Arrow No vembre total Fail total Weight total Frames total gft total Cases total SendText total ThreadCount ze j ze se ze gov ze mailer Ġ'. - Ġ'. ---- Ġ'. ')) Ġ'. \\ Ġ'. /', Ġ'. {:. \\ : \\ ') \\ '] \\ ". \\ "+ session less session Affinity Ġarray X Ġarray Size Ġarray SMAPE Ġarray GroupIndex ãģ ¥ ãģ ´ ãģ ŀ ãģ Ń rate c content moderator ĠAr r ĠAr min ĠAr my ĠAr med ĠAr rows ĠAr bre ĠAr gent ĠAr dour ĠAr vind 42 367 ify GT TT ES Ġtemp F Ġtemp U Ġtemp Time Ġtemp sock Ġtemp Org Ġtemp Quat Ġtemp ertureSensor Ġtemp ConfigPath Ġtemp LetLog ])) /( ])) +', msg Type msg handler Ġgroup Id Ġquery view Ġquery List Ġquery parser Ġquery Func Ġquery DbFetch last one last Data last Update last Page last Cmd last Login descriptor Size copy sign copy button MA I MA ID Path Data Path To Path Patch Ġright state ĠException Utils left value left KerningGroup left Brow project or project DirPath project ssites EL ab EL BO EL TA EL SIF '): {' Ġpri vs Model ler Model Session Model Names Model Parameters Model Selector Model GAT Model GCN Model APPNP EST ATIONS EST ATUS link text link Data link Embedding Ġcontext Data Ġcontext ual Ġcontext Seq Ġprocess Sample task name task data task mage task paren Ġlimit NumberOfFile ffer ed debug Count debug talk debug EDDN ca ers ca path ca po ca file ca ded ca det ca Cer ")) \ Ġhttp header expr ng iss mantics )), ) )), - DAT ARE board d âĸ Į axis below Ġfull Order Ġfull Sequence Ġuti lio Ġuti liza ten Input ten Grid ten emos ĠIS IC ĠIS SN ĠIS OLATION ĠValue Enum server URL server nodes metri que mt g mt ed ative Power Ġwork List Ġwork instartups ĠÐ § Frame Or Frame Codes Frame Latency Ġinst ability Ġinst Pool Max Range Max Req Max Files Max Vertex Max Span Max Age Max Latency Max Sessions Max UserNum post ion post ed post gress post Process post loop post codes post ests cli mato kin n kin je Ġtotal size Ġtotal count Ġtotal power Ġtotal Cells Ġtotal Chunks Ġtotal LangFileLines Ġback s Ġback ers Ġback logs Ġback ports Ġback door Ġback tester Ġback ported Ġback jumping ous Plus 111 000000000000 cond tion wo j wo ol ped ro ped Dataset ped Body Ġexp n Ġexp iring Ġexp Scores Ġunit less Ġunit tests Ġunit Mgr parent Index parent Elements parent FolderPath Ġtag outfilepath Ġcount Dict Ġcount Coin Get File Get attr Get Log Get Path Get Int Get Device Get Doc Get Ver Get Transform Get Random Get Header Get Display Get Constant Get Split Get Pod Get Parent Get Maximum Get Records Get Animation Get Rotation Get Dst Get Capabilities Get Charge Get TimeSeries Get ClassName Get Partner Get MainURLFromList Get LookupTable Get Nbins Get PrivateData Get BlendShapeChannel Get ServiceConnector Get SecondDouble Get AttrValue Get PrivateKeyFileName game start game play game pad Ġwrit ting UM o UM ass Node To Node Port Node Idx Node Linker ĠPar ticles ĠPar aguay match Template match zoo match Expansion 76 99 76 92 76 08 76 19 76 84 76 97 76 95 76 26 76 35 76 29 76 31 Ġ'/ '), Ġ'/ ')) Ġ'/ '): Ġ'/ {}'. Ġ'/ _' Ġ'/ *') Ġ'/ {}', ted With ted ModelDriver ĊĊĊ ĊĠĠĠĠĠĠĠĠĠ 39 877 Ġclient Secret ny Bot ny dail Ġcall ate Ġcall sm Ġcall TIIReviewServ ble stone čĊĉĉ čĊĉĉ ice va ice cream Ġbreak Condition td y Ġsum o Ġsum sk Ġsum Range Ġsum ário Ġsum ranks Ġsum atoria Ġargument e Ġargument o Message Text Message Button Message Attr Message Definition Message ToString Message Receiver address To 001 93 001 000001 001 000011 Add Button Add Sample Add Cmd Add Callback Add Analysis Add Hs Add Variations pc ax pc ay Ġsave ext Ġsave image Ġsave Model Ġsave kw Ġsave Fig Ġsave Processed Ġsave Montage Ġover ide Ġover den Ġover density Ġover ridable rand index rand quote rand Alpha eta ire bar r bar names bar bican ĠTHE M ĠTHE Y ĠTHE ME bl cD Ġass cIncident uni bo uni cos uni codes char ged ================================ ===== Ġmake Schedule Ġmake Slice conf Mat build dir build From Ġ& , limit ing limit éĻIJåĪ¶ cho se cho sed cho osed cho osing cho oses Number Query aw b aw et aw ag aw ning aw ips aw cz aw amoto aw sume (\ "" (\ )\ Ġed X Ġed ad Ġed getype Ġlast H Ġlast Vid Ġlast AppliedLayer Ġlast InstallPackageModifiedTime Ġchar List Ġchar pters tmp f tmp data tmp img tmp root tmp FD tmp OutputFolder tmp UDS tmp icns Ġtoken Id Ġtoken prog dump ing dump docfile anti l anti le anti cs anti sense Ġnorm aliz Ġnorm atoms Ġnorm RedirectTarget TO B TO F TO s TO PK TO DEVICE TO MBSTONE Ġword Vals Ġword Counts Ġword Break ren ta ESC REATE Ġfound Sig Ġfound ACTS Ġfound ImproperDihedTypes Ġfound CANS ik SC ik Qg ik Qh conv out "][" / "][" _ src Path src Folder src jar ĊĊĉ Ġ future Type Ġmode ms Ġmode los Ġ## " entity type entity IdList scale Factor scale fctr mer av 54 03 54 93 54 14 54 08 54 94 54 23 54 82 54 91 54 3665 Tra ded Column Transformer Column ClickhouseAnnotation Ġframe Number Ġframe buf 79 01 79 13 79 84 79 87 Key point Key Up Key NotFoundException Ġfla kes Ġauth file ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Vi u Vi ctor Vi vien Vi enna Vi ctoria Ġoff value Ġoff ensive Ġoff shoot cv b const val const delta const tau 74 01 74 99 74 92 74 14 74 36 74 66 74 98 74 35 74 82 74 89 74 907 74 0726 ĠVar in ĠVar ipacker ĠVar oquaux cmd map cmd tools cmd loop roll ups now s Ġdim H Ġdim Z Ġdim in tick format tick lbls Ġobj id Ġobj class Ġobj dump Ġobj spec Ġobj loader Ġobj cls Ġobj etos Ġobj StockMst epoch File exit Binary exit Expression exit Simple exit Literal exit Primitive exit Unary exit PrefixOperator MO VIELENS Ġ', '% Ġstep f Ġstep ic vector c mem Total mem consumer mem Active mem chr enter Binary enter Expression enter Simple enter Literal enter Primitive enter Unary enter PrefixOperator Ġ'__ ']) ĠCo al ĠCo di ĠCo coa ĠCo operative ĠCo zmo less andro 01111 011101 01111 1011111110111111 01111 011010011 01111 001111101111 fn ext fn half Ġexpected Content Ġexpected Surviving 73 07 73 08 73 34 73 09 73 98 Ġfind All Ġfind New Ġfind Font dis i dis m dis course dis asm dis appear dis assembler fit to fit path Ġimp ar Ġdif fract LI V LI k LI UD LI UTable Ġnext y Ġnext Row Ġnext Val Ġnext Enzyme blob storage ĊĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠ Object Error Object List Object Class Object Exception Object DD Object Link Object Meta Object NotFoundError Object Permission Object CommandContext Object storeSiteMover Com o Com ms Com BAT FT PS Comp iles Comp liant Comp romisso Comp arable Comp InDQ common Prefix common wealth Ġorder cn Ġorder books cache Obj Ġdevice Diff Bo o Bo NN Bo ole Bo yer stack ers stack traces day ton day Locator day cnv send Data send Coin send ThePacket send VKey ush a ush y ush ar ush ima ful filled ĠĠĠĠĠĠĠĠĠĠĠĠ ĊĊĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠ čĊĠĠĠ 0101 387 unk er unk own Ġfilter type Ġfilter bank Ġspecific values Ġspecific Matrix Ġspecific Tissues variable FromSymbols next s next ype next loc next gen next Token next Valid next Enzyme ĠTO ML ĠTO LERANCE Ġshape Type Ġshape files Form Boundary Response Schema first String first day first lineno dev name dev str Le i Le go Le aving Le aky else if Ġeval t Ġeval results Ġeval ution ULT ANEOUS over line over fit Class Def Class ifiers Class ificação Ġ>>> ]) **************** ***** Input Set Input Form Input Handler Input Label Input Device Input Folder Input Features Input Receiver PP A PP M PP RO PP PP PP lus PP vss PP zww PP bYY tree bohotels Ġiniti lize Ġbuild tool Ġbuild Feature Ġbuild Boss Ġab map Ġab road Ġab rig Ġsupp lier Ġsupp lément 58 15 58 076 58 201 58 025 58 147 58 327 58 244 58 088 State ments State Info State Dir State Ebl ART Y Ġinstance DictStr Ġfield Values access ory pr P pr st pr ince Ser des gr b gr m gr ino gr ubu Ġ12 84 Ġ12 96 Ġ12 95 Ġ12 645 dist il dist ace dist ancia dist illation dist ancing dist UrlBase dist pickymodel 78 07 78 18 78 15 78 076 78 09 78 37 78 0064 OP ENT OP ERT OP Hj Out T Out ALCARECOTkAlMinBias ĠTest ers ĠTest Auth ĠTest Session ĠTest Dataset ĠTest Block ĠTest Script ĠTest Common ĠTest ando ĠTest Stage ĠTest DSM ĠTest CreateFile ĠTest oot ĠTest XDRI Reg ula Reg Plot req header .", ) case db case less Ġlocal config Ġlocal stack Ġlocal BBox ., :: Ġsign ify Ġsign ifies ãĤ ¶ ãĤ į "\ )> Ġ16 64 Ġ16 09 DIR CEU Ġ.. , Ġ.. ...... ("\ "" ("\ "", pol la pol ito pol Phi ĠNo Op ĠNo Args ĠNo DictKey ĠNo Deps ĠNo InputNoOutput ĠNo ReverseMatch stru zione stru ktion Ġbin list Ġbin ho Ġbin width Ġbin arr Ġbin Width Ġbin capacity Ġbot member job log job Num job Title job Limit change Type change Constraint change Format change ScaleX change ScaleY change AppId User ge User bot User DB User Code User With User Action User JSON User Mixin User Serializer User Admin User Encoder User Controller User Answer Ġman oeuvre etch up lim g 59 14 raise num raise NotDefined Ġparse args Ġparse mod XXXXXXXX XXX XXXXXXXX XXXXXX XXXXXXXX XXXXXXX seq x seq tax seq repo seq logo Ġport ray Ġport anto Ġport foly Ġallow Env SS OF queue DepthCombined ĠDe fi ĠDe pression ĠDe composition ĠDe senvol ĠDe enis ĠDe Soto sw m sw at sw int sw indow sw pc sw imming sw ifter Ġproject X CA w CA ej CA IX CA AGCT CA STS CA lign style N Ġexec utar spec D 53 12 53 03 53 96 53 94 53 97 53 95 53 86 53 56 si ena si emContext View name View able View Controller View Dimension View Columns View TestMixin View SelectedPath rule z rule type rule Protocol sor ties itor i Ġlib ri Ġlib mc Ġlib forms Ġlib louis Ġlib mkl Ġlib pthread Ġdep args Ġdep lete Ġdep ósito čĊĉ čĊĉ čĊĉ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ åı « åı Ļ åı ¶åıĺæį¢ 68 99 68 07 68 06 68 15 68 64 68 24 68 37 68 33 68 98 68 097 68 2313 68 0210 ĠRes izing ĠRes moke ĠRes posta ĠRes cales Ġstatus Code Ġextra Info Ġextra Arg Ġextra cellular Ġextra errList TY FP Ġbu fs Ġbu ddy network P network id network mode Trans E Trans fo Trans lating ORT ASK IND RO CE O CE IL CE xtension qui ri qui bo ctx manager Ġav od Ġav aial License Text Access Log Access Point Access Service Access Flags xff C xff J xff L xff N xff P xff T xff V xff m xff p ym up ym do ym tau Ġpage able Ġpage List Ġpage Num Ġpage link Ġpage Size Ġpage Url service config Th r Th in Th ur Th res Th ieu Th inningTest Index Response Index Entry Index Val Index Console ia h ia ÅĤ ia Soft author izations acc ine acc Utils xx large Ġserialized ATN çļĦ data çļĦ ä¸Ģ çļĦ åŃĹ çļĦ åīį çļĦ ç±» çļĦ 使çĶ¨ çļĦ åºĵ çļĦ ä¿®æĶ¹ çļĦ 线ç¨ĭ çļĦ æķ°åŃĹ çļĦ åıĺéĩı çļĦ 模åĿĹ çļĦ æĹ¥æľŁ çļĦ æłĩçŃ¾ çļĦ æĸĩ件夹 çļĦ éªĮè¯ģçłģ çļĦ å®ŀä¾ĭ çļĦ 缮çļĦ çļĦ 个æķ° çļĦ è³ĩæĸĻ çļĦ ç©ºæł¼ çļĦ åŃĹæ¯į çļĦ åľ°æĸ¹ çļĦ è§Ħæł¼ çļĦ è¿ŀæİ¥æĸ¹å¼ı çļĦ å¤ĩéĢīåij¨æľŁ Ġneed Clean ĠPython Qt At an At Top At tribution At lanta PL v PL table PL IES PL ITE PL wp PL ayer PL ACED PL CPB pack b pack name Ġblock Expired Ġblock Untrusted inser ting fs ync fs lots fs upplicant ian te ordin at ordin ario ordin aten unit ag (_ . (_ (? Man a Man App Ġchange ps 52 10 52 12 52 13 52 15 52 085 ets RL Ġ"/ * Ġ"/ {}". Ġ"/ "+ Ġ"/ ../../ Ġ"/ *") cell width cell spath cell Bot cell centers cell dms cell notation ĠUser API ĠUser Query ĠUser Update ĠUser Detail ĠUser Details ĠUser Errors ĠUser Keyword ĠUser Premium ĠUser Obstacle ĠUser IdInvalid ĠUser RateThrottle ĠUser PoolId Of ast Of fic Of The Of Class Of Tx Of Service Of Container Of Beta Of Share Of Difference Of Improvement Of Motif position ed QU A QU ES QU ET QU ARE sq L sq li sq norm sq lengine If Files 62 02 62 98 62 992 62 061 Up x Up Block Up sampling Up Pins ank le ank owski WAR P WAR ES ĠCreate Database ĠCreate Help ĠCreate APIView ĠCreate ableAPIResource Ġfeatures R Ġfeatures copy Ġfeatures Names ĊĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠ )[ [" )[ \' Ġmsg type Ġmsg hash Ġmsg Hdr ĊĠĠ ĊĊĠĠĠ ĊĠĠ ĊĊ ĊĠĠ ĉĉ ĊĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ÑĤ оÑĤ ÑĤ ак ÑĤ ÑĢа ); '. Sh en Sh ield Sh utter Sh erman Sh amos Sh uffled remove Item remove Child opt vis opt block opt vars opt insn Ġrender Object xml dir xml doc xml Url Ġcase sensitive Ġexist ance Ġtitle case ba ut ba ad ba its ba ÅŁ ba ixo Ġabs Path Image d Image Error Image Num Image Surface Image Caption fra id ĊĊĊĊ ĠĠ ĊĊĊĊ ĊĊĠ Int Array Int Msg IP y IP AC IP lugin IP SET xec C xec F xec K xec U xec g xec z xec ute dot m dot dict ĠSo C ĠSo licit ĠSo ciale lip le lip ids lip tical lip ayResponse disp os disp angle disp osable :] }") AGE MENT Ġtmp ID Ġtmp src Ġtmp String Ġtmp Step Ġtmp Ret Ġtmp FD Ġtmp Std Ġtmp Tags Ġtmp OutKey Ġtmp OutVar Ġtmp Incomp Ġtmp MaxFiles 49 88 49 85 RES IDENT pu Key radi ative Ġwas AssociatedWith book end book sn book marks book shelf ÑĢ оÑĩ ÑĢ еÑĪно Ġmap cells ĠPath Patch ĠPath Definitions ĠPath Effects DB E DB F DB I DB size DB Exception DB BACKUP Ġ300 7 URL æĺ¯ URL FORMAT URL åľ°åĿĢ Def ense Def ence Def lection Def ender Def Loader Ġtuple Data Ġmask thresh Ġmask gradient 0100 10111 0100 100101 012 878 012 98288 012 11039 Ġgraph it xaf G xaf T Info Objects Info Serializer Info Hash ---------------------------------------------------------------- -------- ene tic Ġ". \ Loc ators Loc alizer BU MP +' [' example SetFiles EM F Ġter á Ġter reno Ġ202 5 Ġ202 8 decode bytes SC C SC mat SC riterion SC Xy SC ISS tic ut Ġmore Products su o su mes su kunimi ĠVersion s Ġsorted List Ġsorted By ĠSet Color ĠSet ModuleLogLevel ĠSet ClipboardText ĠSet TheView PRO G PRO SE PRO PS PRO BA PRO FACT PRO MISC Context Menu Context Word sim dir sim core sim ulink Ġ"\ ">" Ġ"\ "}],\" tom cat 202 202 202 00110 202 10331 Ġoffset Delta Ġfi las }\ : }\ """" }\ "". }\ ">" Ġorig trees Ġorig VideoDir 63 17 63 84 63 97 63 86 63 56 63 91 63 858 63 3709 Request ID Ġoptim ally Ġoptim ised This Full stream sx Ġ15 01 Ġ15 10 Ġ15 19 Ġ15 81 Ġserver uid Ġserver tools Ġserver Port seed set binary package CC R CC Ac CC CL CC GG CC aller Inter calib Inter sects Inter changeFormat Ġgl End Ġgl Read Ġgl Init Ġgl Clear Ġgl TexCoord Ġgl Lightfv Ġgl BufferData Ġgl DrawArrays Ġgl VertexAttribPointer Ġfont able Ġfont Type Ġfont family ĠGet Data ĠGet ters ĠGet Inter ĠGet Capabilities ĠGet Scores ĠGet EstimatedTransactionFee ĠGet ModuleLogLevel ĠGet CmdStatus ĠGet RoleMember ĠGet Badges ĠGet Deployer ĠGet LongPathName ĠGet ShortPathName *( < *( .+ *( ?: *( .*?)\ 72 99 72 12 72 32 72 16 72 176 pec w pec util pec tives cluster er cluster arn cluster ization cluster Idx cluster Credentials delete user ĠAll ure ĠAll Users ĠAll Categories ĠAll classscore AA F AA AG AA AD AA AF AA ATGG AA djust IO p IO CON IO HW nodes Enriched na f na h na z na val na if :\ ([#\ ĠID CG (* [_ wd n wd t wd v wd TU åĪ ¤ Not able Not Set Not Done Not Before __) } __) }" Ġtask set Ġtask mage med line med itech Create Key Create Event Create Graph Create New Create PDF Ġmy type Ġmy col Ġmy map Ġmy File Ġmy table Ġmy cv Ġmy mesh Ġmy SQL Ġmy rn Ġmy bash Ġmy treenumbers resp ath prot ID Ġ"__ " Base s Base View Base Check Base Item Base Loader Base Service Base Dataset Base Mixin Base Transformer Base SearchCV Base dD Base FormView Base InputHandler Tx Period Ġsim batch Ġsim body Ġexample SetFiles Ġph q Ġph ra Ġph il Ġph aset Ġapi list Ġapi Client Logger Provider Ġsa as Ġsa pos Ġsa dece Ġsa firnotification Ġlevel q Ġlevel Order Ġlevel Drop git o API Router API è°ĥçĶ¨ torch tb mc f mc id mc nt mc python mc Transceiver mc TxByte mc RxByte Ġgrid Input Ġgrid GT Ġgrid Pred xfe C xfe L xfe Q xfe R xfe b Ġleft crop font z font prop font goggles '][ ()] '][ ()], ars ide Al O Al b Al ger Al uno Al mond "); \ Ġsent Pose Ġsent encia make File make DataFrame make Move make filePath execute builtin gg reg Qu z Qu AD Qu ench Qu ando Qu oted Qu adr Qu andl Qu arentined video Dict keep ass By User By Page By Day By Region By Most By Patient By Axis By Cov By ConstantModN By Nation By LineText ĠFor ne ĠFor rest ĠFor Each ĠFor seti Ġidx j Ġidx sh Ġidx min Ġidx max Ġidx sg Ġidx sphi Ġidx ToTag Ġtraining state window size fp names Ġsearch path Ġsearch Index Ġsearch terms Ġsearch Paths dec ree dec Deg QL ID Client es Client Options Client Util Client Cert Client Deployer '\ [ '\ (" '\ `([^\`]+)\ 69 64 69 112 69 085 pect ra mod o mod base mod als mod logs Ġwrite up Ġwrite Output App ia App Info App Auth App Window App Service App Collection App Flow App rove App NRate App licator ular isation :` - :` [ :` _ medi es medi atype н ен н оз н ей н ез н омÑĥ dt c dt w dt cv dt tt dt Float dt orun "{ __ ZE C bool Path TE A TE B TE lement TE AMS ('\ [ ('\ "', Ġwhere Str admin User admin panel Ġoper ated Ġoper ador Ġ'\ / Ġsu v Ġsu ck Ġsome stream Ġ"-- >", Ġdown wards full res full model full title Rx Buffer Rx Trace Rx PWR has u has Data has flux has GLE has Defected has BeenRun xfb A xfb D xfb E xfb I xfb Q xfb p stop ics stop Event stop One stop Words stop Btn 256 56 era e body len Ġgover nor Fa z ĠCh ad ĠCh im ĠCh ase ĠCh ern ĠCh aco ĠCh erry ĠCh arts patch notes ĠNOT ACHAR Ġapplic ability uff les uff enh register Name register Command register New Ġshow Log Ġshow case Ġshow cases Ġshow Help Ġshow instr Ġshow Matches Ġshow Tables Ġmark ings optim um optim iz optim izes optim istic optim alg optim istically other m other Property aa fu tex file tex info bytes Beyond Ġconvert ors Ġconvert ToOne Ad c Ad versarial Ad Hoc rap li ĠImage Token ĠImage Button ĠImage Grid ĠImage Reader ĠImage Normalize ĠImage Viewer ĠImage Attachment home Space Ñģ а Ñģ е Ñģ и Ñģ ка Ñģ ÑģÑĭлки ven ia Py Flow Py roc Py blo Py FileWriter Py Installer Py EMD Py qtree Py IOmica inst Lumi ï¼Į ', ï¼Į âĢľ ĠAny where tests dk Ġmean freq resource ID resource manager Ġheader ed Ġheader hash az o az ia lan ır lan elet hed rals orig en Ġ[[ . Ġ[[ { Ġ[[ [] ĠTh an ĠTh ick ĠTh reader ĠTh erm ĠTh ickness ĠTh ames ĠTh rottle ĠTh ief ':' - Ġcsv name Ġcsv files Ġraw Label Ġraw ADCP For am For ID For Loop For Job For Windows For Quote For Updates For Exact For BridgeLamp For nec For Causal For TokenClassification For Hotword hash Sequence hash pw TYPE PRODUIT TYPE INTERVENTION Ġvis cm Ġvis Params äº ® äº ² äº Ĥ xef C xef E xef H xef I xef N xef z track e track name track ml track let track Pause ĠType Engine ĠSim fast ĠSim Library ĠSim ulates xfc E xfc J xfc S xfc Y xfc m xfc r pg p pg num pg again pg Yeti Size Converter div w div ing div es xfa N xfa W xfa Z xbc H xbc K xbc L meta Data meta store meta interp ĠDict Array ĠDict Serializer ĠDict Cursor '}, {' é mo é nom gest or sort box des conto Sp O Sp ans Sp lash Sp iral cel lo Ġunittest instance Ġmock obj Ġmon omer Ġnon spatial Ġnon Direct Ġnon posx Ġnon singular Ġnon parametric Ġnon memberRefName Ġoptional Flags sm X sm x sm len sm gr sm iley sm alisca Ġinfo dict Ġinfo Node Ġinfo Object Ġinfo Element KEY FRAME KEY POINTS KEY SETS .\ . .\ +\ Ġloc ates Ġloc alizable Ġclo ak Ġclo vars Ġclo udf Ġedge list Ġedge pair ### ------------------------------------------- win rm Ġpi Tom DataFrame s /{ { help core help Filename select Expr Ġref l Ġref string Ġref Task Ġref reshes æķ µ best child FL D FL AC FL SH FL ANK FL AKE FL APUNLOCK tran scribe tran scriber sin es pool size pool choice pool ports pool Choice pool Supply ĠLo vec ĠLo Ra ĠLo pez feature List feature DictObject vm f vm id vm adm vm Vlans bit o bit code bit Array bit coind gy o gy ong istr ative hel v PR C PR ref PR oute PR BSE PR EREQUISITE ĠMe ga ĠMe chanism ĠMe mbro ĠMe Cab script name Group Norm Group Service Group Delta Group MAPE xed K xed M xed S xed U xed Y xed c xed d xed f xed h xed k xed u Ġret as Ġret angulo _{ % _{ ' _{ - active Time active Distance FO FC ĠDE LET Ġinclude First Ġinclude FrameCodes drop rate Ġchannel Box VE o ä» ª arr Client arr anging Ġact W Ġact uelle Ġact uators Ġge mini Ġge odetic Ġge ometrical Ġge lenAcilar Net Model Net Loop Net Scaler Net Icon Net EncoderPolicy Pre S Pre par Pre vent Pre Index Pre scription Pre serve Pre Processor Pre liminary Pre diccion Pre InOrder Pre AuxLogits DS B DS unny DS ACAT report c report results report Counter Ġpost ive Ġpost Only Ġpost routing PU F PU I GR k GR ATIONS GR Pct GR LostBarn web dataset web Settings web spider Ġbetween ness sqrt n ç gen ç ek ç amentos ]]) / ]]) ; ++ . ++ ': ++ )', Ġfin er Ġfin ais Ġfin alizada lr p lr us math group math close math open math world alid as Ġgenerate Points Sub dir Sub command Sub graph Sub level Sub directory Sub Title Sub traction Sub mitted Sub Sys Sub Accounts Sub menuItem Sub Meshes ĠAPI Version ĠAPI Factory ĠAPI 说æĺİ xcf C xcf E xcf S xcf d xcf q xcf w Ġrand index Ġrand samples Ġrand erso xdf A xdf F xdf J xdf L xdf M xdf Q xdf k xdf l xdf m Result Type Result File Result Size Result Category rat t element Id ML X ML Parser ML CA ML PB xbe H xbe P xbe X xbe a xbe j xbe v Ġ$ $$$$$ ĠArgs Parser Ġlaw suit docs LoadBalanceMib Ġbox s Ġbox lines xce B xce I xce L xce P xce R xce Z xce b xce x xce XV google source google play google plus sql Content Auth n Auth enticating Auth AdminStatus sig M sig m sig la sig args sig mask sig req sig thresh sig Region af q af fil af firm dm Z dat i dat filepath LOG ON LOG NAME LOG ERROR LOG FEEDER offset type DATA ANSWER Ġscore List ĠZ H ĠZ ur ĠZ int ĠZ pp ĠZ ac ĠZ table ĠZ SI ĠZ ubi ĠZ achary ĠZ ymo ,' // ,' +') ram eny NO VO NO DELAY Ġjob man Ġjob flow Ġjob Limit Gener ators Gener Topo Ġthere Exists ĠBase Config ĠBase Class ĠBase Manager ĠBase Block ĠBase Layer ĠBase Component ĠBase Serializer ĠBase Schema ĠBase Player ĠBase Metric ĠBase Transformer ĠBase Processor ĠBase Exchange ĠBase OAuth ĠBase Grant Ġparent frame Ġparent Id Ġparent Tab Ġparent MatchingStyles Ġ// //////////////////////////////////////////////////////////////// ĠEn ds ĠEn ough ĠEn caps ĠEn trée Ġcli mb Ġcli mat Ġthread Id Ġthread Count UP pz non iid non relativistic non mnfld non alch non domination non edict Ġì ħ Ġì į¼ Ġì ¦ī Ġì ī½ Ġì Ľ¹ rs l rs bs rs OrPr Ġnoti fi Ġnoti fic Ġcfg rib xdb P xdb Q xdb m xdb r xdb t ('/ '+ æľ Ń WS M WS z WS ERS WS wW WS PAM WS GJs Ġcmd str Ġcmd list Ġcmd args Ġcmd Str Ġcmd Max Ġcmd Man Ġcmd Min Ġcmd Diff Ġcmd CommitLog upper Limit upper Physical Ġsql list Ġsql where Ġsql vc Ġsql lineage dio vas xbf F xbf L xbf P xbf T xbf V xbf u Pos ix Pos Er Pos ição Pos Handles light er light Color light novel light curves light kube light nings fin i fin ire fin alization fin fish gb kconfig GB EE GB sb GB gY Entry ListResource Ġcell data Ġcell width ()). \ Ġcluster lib ux heat section def section FromNode Ġremove LF Ġremove Dirs Ġremove BBOX Ġremove Duplicates xeb A xeb C xeb D xeb G xeb H xeb J xeb R xeb W xeb X xeb d xeb r xae D xae K xae O xae R xae U xae V xae X xae h xae k xae v Ġsplit ing Ġsplit graph Ġsplit lines Ġsplit arr Ġsplit KeyList Ġinit Cmds global token global temp global Mass ã u Ġans wr INE A alpha f alpha py Ġvar list Ġvar ID Ġvar mask Ġvar Types Ġvar Degree ĠMan hattan FP C FP F FP j leg ar leg alize leg ale training DataFile Ġzip Field Ġzip bObj Ġpart nership -% % }. * hex val hex digits hex archive Ġbest Buffer Ġbest substring Ġbest AvgValue 0000000000000000 0001 0000000000000000 0000000000 ĠStr and ĠStr Arg ĠStr Lines ĠStr uts ĠStr atum ĠSO FT ĠSO ME ĠSO URCES Dis pose Dis ables Dis connected Dis ambig Dis abling Dis ruption Dis criminant nb Depth nb Samples nb ananas can ary can Be can objverts can Robo amera Server ]+ )) ]+ \\ ]+ $", ]+ .*[ NE i NE OD zip Code zip Directory zip åIJİç¼Ģ zip bObj ons ite rain fall Tensor List Tensor Train Tensor RT Ġdir Y Ġdir Out Ġscript process tt amente Ġcho ke Run Descriptor Run Command Run Method Run Cmd Run Queue Run Checks Run IIF rank ers ha ma ha State ha Identifier ha Lh ha usdorff ME O sen list sen Rot real key real ms real loc real istic real gdp real Donal Check Request Check Item Check Output Check Failure Check GreaterThan Check LanMode xde B xde F xde M xde X xde b ĠFile path ĠFile Stream ĠFile NotFound ĠFile Link ĠFile Write ĠFile Console ĠFile Allowed Port land Port Stat Port ugal UD N UD IM UD matrix grad var grad check grad norm grad Fill factor ize px OJ px rpython fill r ]): # He mp He im He els He lios He avily ĠAdd r ĠAdd Analysis ĠAdd JointLimitParticipant cfg Path gt P gt c gt gf gt cag include Overview distance data distance Dict Return Statement Token Stream Token Validator Token Parts Token Semicolon supp osed supp liers supp lements xfd B xfd F xfd J xfd K xfd L xfd M xfd S xfd T xfd j xfd x xfd z cip ents Qt ChooserWindow Qt Qml Qt WebEngineWidgets Ġjo urnée Ġ'% " Ġ'% ': any one any where center Y price Id price Reminder Ġparti cipi loy ds loy alty loy ola draw able draw timing alog ger oper on oper aciones Ġ"- "] Ġ"- // Ġ"- ")) Ġ"- "). Ġ"- >", Ġ"- >". Ġ13 11 Ġ13 06 Ġ13 19 Ġ13 85 Ġ13 80 Ġ13 000 Ġ14 87 Ġ14 20 Ġ14 26 Ġ14 75 Ġ14 000 Ġ14 28 ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġsee king Ġalpha f Constraint Model )\ .(\ account info Te k Te mpl 10000 11 Ġstat ue Ġstat vfs UB YTE Point less Point Start Point Flow br h br ine br db br rp br vt Function On Function Task Function Generator Function Expression Function Factors sd ls sd ollars Ġlayer Outputs ĠCheck list ĠCheck sum ĠCheck pointer ĠCheck Availability ĠCheck WarningCount ĠCheck ErrorCount Ġexit status Ġgame object Ġtests Without rel Delta ĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĊĠĠĠĠĠĠĠ Lib an display Information Ġ[], [],[],[ Argument Error Argument Context xcb H xcb L xcb M xcb V xcb i xcb j xcb m her ic Ġpick les Ġelement SetData Ġelement SetFull GS LIST rot to rot mat rot Save Mode ToUse ĠApp Run ĠApp Kit ĠApp Dashboard ĠApp rentice ĠApp Adder Ġmeta Cols VAL RNG VAL UETYPE Ġnow list Ġnow date Ġnow ait Ġnow here Ġauthor Genders Ġcustom id Ġcustom izer Ġcustom izations Ġcustom ises ROM AGNET ROM MEO Per p Per Cluster Per Cap Per centile Per Meter Color ed Color Py Color Array Color DataSet Color Primvar Color PlugValue Or che Or Tuple Or den Or Password Or Json Or Copy Or Baseline Or Emotion Or chestrator Or MetricFn Or NameAlreadyExists xbd B xbd F xbd h xbd j xbd v xbd x xad D xad P xad R xad S xad a xad w xad y xad z xad IE eff e eff bot eff ectif 0011 2233 Ġsw at Ġsw ir Ġsw ell Ġsw iss Ġsw edish Ġsw ngSeed xcc F xcc P xcc W xcc b xcc d xcc r zero Terminated Ġspec imen .* "], .* ']), .* $') Ġvi ver Ġvi list Ġvi vi Ġvi ele Ġvi ik GET POMERIUMSERVICEACCOUNTREQUEST cm x cm nt cm ip cm df cm divw á k á u á y á cie á ticas á lisis Ġflask app Ġflask App Ġflask cbv Pe te Pe pper Pe ugeot Pe epholeOptimise xba S xba Z xba h xcd C xcd E xcd K xcd S xcd V xcd c xcd q Ġinstall ers Ġinstall dir Ġinstall Reactor Event Name Event List Event Log Event Table Event Number Event Entry Event Run Event Content Event Types Event Provider Event Store Event Hub Event Detail Event Bus Event Changes rad lat rad ps Item Id vec Inferrer ĠKey Bundle ĠKey Jar ĠKey OrNameAlreadyExists GI R GI p GI LL GI FT GI GANT card dav xea D xea E xea N xea U xea Z ĠLe v ĠLe vi ĠLe aving ĠLe ón ek a ek sterne cial is ĠConfig Engine ĠConfig Store ĠConfig Selection ĠConfig urator velo ce Ġverbose Level Label Path Label sets Label Edit Label Format Label Scaler Label Opts Label Calibration Label Ranking Ġsci unit Ġresp u Ġresp once Ġlink i âĸĪâĸĪ âĸĵ âĸĪâĸĪ âĶĮâĶĮâĶĮâĶĮâĶĮâĶĮâĶĮâĶĮâĶĮâĶĮâĶĮâĶĮâĶĮâĶĮâĶĮâĶĮ âĸĪâĸĪ âĸĢ dest in dest DirPath ĠComp oser ĠComp oses ĠComp liant ĠComp laint ĠComp etitiveSignal ĠComp osedForm Ġstri vial Ġsend o Ġsend Data Ġsend Transaction Ġsend MQTT xab B xab K xab Q xab c xab f xab i xab j xab m xab o imp e imp Data imp erial imp oss ," =", Line list Line User Line Width Line Interval Line Samples We ird We aver Ġmer curial Ġ18 000 MS ID xdd A xdd B xdd R xdd Z xdd g ategor ioj 71 92 71 32 Ġcache Dir Ġcache Block hand bag åIJ ¨ åIJ ¸ åIJ ¹ åIJ ı åIJ Ĺ Code To Code View Code Gen Code Len Code Pipeline Code Mgr |\ . |\ .\ |\ +)?(\ depth ens depth Data Date line Date Code Date Let xbb Y xbb b xbb h xbb j xbb k ving stewart til vÃŃsanir Ġavailable classes Ġavailable ForStaticIp Load Mesh Load Threads cf engine cf proxy lex info lex pand mm g mm ata NA Q cap stone Ġsingle source Ġsingle Parameter arm nn arm uPDF Ġopt space Ġopt vars Ref lect Ref Count Ref GT Ref Page Ref Seq Ref Selector Ref Aligner Ref SeqNum Ġaddress Length Ġfeature Vec Ġfeature Transformer Ġfeature Maker Ġfunc body Ġfunc Size mag ne mag netometer mag hAll æķ° 缮 æķ° å¼ı æķ° åįģ Ġrest ing Ġrest id Ġrest shop prob type xee B xee M xee W Ġsecond Line Ġparam list Ġparam Count Ġparam descs CI K CI PE CI ATED CI ELab Ġstop when ĠCol lider ĠCol lapsed Ġpe ach Ġpe destrian Ġpe liculas Ġpe gtree ĠRun Go ĠRun MCMC storage Path storage Size Ġloop infos Fil tro oo h Ċĉĉĉĉĉ Ċĉ '{ \ '{ ", OUT S ãĢ ĩ Ġerr msgs Ġerr oneamente Ġerr oneous Mat Print Mat GAN Ġ") [- Ġlong dir Ġlong Options Start Point Start End Start Main Start OfContainer Ġweb test Ġweb api Ġweb store Ġweb settings Ġweb stack Ġweb Service Ġweb interface Ġweb logo Ġweb dnn Ġlocation Data xda G xda K xda L Ġest ilo Ġest ekak ASS IS BL B 108 07 Ġprogram Size MC S MC GILL jnxMbgSgw PPIP SD FG fc ns fc GHz .... >> .... -', rl ControlHistoryControl }') ], je z je on je an ote book ote cas ote iro player ClientPropertiesMessage multi var multi mask multi graph multi level multi tags multi NC multi subject multi byte multi matic multi threading multi maskm document Element document Constant Ġaccess bot Ġaccess ions Ġaccess ories Ġaccess Policies Ġmc apps ERROR DETAIL ier es ier ry ier ung counter a WOR ST Ġhandle Rep Ġsuper types Ġsuper access Ġsuper fluous policy ID =[], [] Count State Count XPos button Frame button Any Process Factory Process Memory POST ER long dir long table long names long Path long sec long running long deg ĠPRO CES ĠPRO PAG ĠNot Html ,\ .: sec Type sec lines sec meters ĠTime Program ĠTime Delta ĠTime Limit ĠTime Period ĠTime tracking NN S NN p Ġattr dict seri alizing ĠOr ka ĠOr phan å¤ ® avg Interval avg Len Ġgen et Ġgen mk Ġgen Lim Ġgen bank Ġgen shin ĠImport MatrixVal cla he cla mm cla imer cla iming cla mation mk y mk z mk line mk isofs Ġold C Ġold Cur Ġold EntityId Ġ[- ( !! ) !! ', !! !' ender er EXT REME chain analysis chain RIC requ ote ĠDT W anel lo ĠPo les Pri ze Pri mor xdc L xdc R xdc Z xdc b xdc j xdc q commit ting ling id ())) ), ())) +". Ġcontains Object Ġcontains Point ĠCom mission ĠCom Replace ĠCom Dust STR AT Ġdiffer net ĠTe sseract ĠTe lom normal ising +" & +" ...") +" $") +" ("+ cost eA cost OfEquity CD D CD M CD CD render Mode render Properties handle Unknown Ġinputs A Ġinputs B All Target All Close All Completed All Plots xac E xac G xac M xac T xac f xac m xac w ret value ret stat ret na Box Predictor nan rankdata ws L ws FI ws dm aly an Ġfinal es Ġfinal list Ġfinal Df Ġfinal Trending BO Y BO n BO UN BO MB BO IDS BO ILER Ġpub ids Ġdimension less Ġ"% % uter ms way Network way veai Ġsm al Ġsm id Ġsm ali Ġsm irks loop time pad w pad len cer tify plugin name ĠLog File ĠLog Event ĠLog normal ĠLog Statistics ĠLog Diag 111111 01001001110001111 So ma So Far dr b dr ar dr pc dr inking }' ")) }' "}) Ġkeep going Ċĉĉĉĉĉĉ ĠĠĠ Ċĉĉĉĉĉĉ Ċĉĉĉ vari o Ġallowed Attrs Mo tivo Mo yen tack er pub l pub keys pub Date pub chem pub nub On j On to On Di On Cluster On ClickAction On CompileCompleted Command State Command Params Command NotFound Command KeyMask å® ħ Values Helper ~~~~~~~~ ~ seg reto auto log auto layout auto augment auto contrast auto Ping auto awsume Ġtrack name Ġtrack able Output LOCAL Output Rescaling rm g rm r Ġkeys Pressed Sc rapper Equal Case Equal Sign Ġconn ectivities ĠLI FT ĠLI GE ĠLI WC xaa I xaa N xaa O /( .+ site key site config ACT ORS ACT INIA ACT ATACAA ACT ORTASK lux I ĠUnit ary ĠUnit Cell ĠUnit Price ĠUnit OfWork qa oq Ġbinary Vals Ġbinary ObjectFileName Ġbinary ObjectFileTypeCode Ġbinary ToNum distri cts parti cul Manager Dialog Norm an Norm alizing spect r ĠModel Data ĠModel Keys ĠModel Schema ĠModel GAT ĠModel GCN ĠModel APPNP ĠEX ACT ĠEX TERN ĠEX CLUDE ĠEX TERNAL ĠEX PRESSED inf eld inf ested inf usion inf ectious inf lations inf lated Ġind CC Ġind uctive Ġind ustries timeout EDDN 10011 0101 rb t rb ps ĠHttp d ĠHttp Runner ĠHttp Endpoint ĠHttp BadRequestException ĠHttp Locust Ġcompute Exp Ed F Level Manager Level Formatter Ġchild type Ġchild hood click models tuple Id tk ge 9902 83 9902 63 ĠName Contains Ġconf use Ġinitial Network TP B TP X Ġconnection Socket entic ado Ġwait list neg ro prop Neg prop ulsion Ġcreated At js Alert js bGR Ġbl bf Ġbl stm Ġjs chart Ġnodes ToAdd Ġnodes ListPerNodeLabel Ġ"_ "+ Map Maker Map Prefixes Ġtx groups this is this own this Notes generate Method generate Tests generate CreditCardNumber Ġmulti path Ġmulti url Ġmulti ml Ġmulti grid Ġmulti scale Ġmulti agent Ġmulti language Ġmulti world Ġmulti proc Ġmulti effects Ġmulti quadric SV TYPE Met as OK U OK AY æĺ Ń GL ON GL float GL ASS GL USTER Be Read Be Assigned Do Y Do ub Do ador Do Firmware Do AccountAdd Do ImportConfig Do ExportConfig Do NotToogleChargingException Do odadESSource Ele ctsys Tag Key Tag Manager Tag Map Tag Enabled Tag BaseEnabled Ġhtml text Ġwant ing Resource Status Resource Serializer times lice Ġalso Occupied ([' {} ([' ../ ([' ________________________ Oper Mode Ġresource Group Ġresource Kind Spec Py Spec Func Spec DataReader Spec Nest Spec imen PS A PS QL PS AE GG AG GG AA GG TAG GG GTT Ġpad list Ġpad Start Ġpad tok Ġdomain sizeX fname In vol ont vol Shape xca Q xca R xca e {' ;'. xF EE xF BA xF BD used Object ĠSimType Long flat s flat Map Is n Is Enabled Is Timeout Is Unicode Is olation Is Collecting Is rael Jo N ICE DataPath Ġproduct info agent e UE Q ĠURL SSS ĠURL Resolver OS UB OS Runner OS PIKE ({" $ cloud run cloud Manager cloud Member cloud monitoring tool path tool dict tool belt ĠAc cesses ĠAc meAccount ĠAc ampamento ĠAc qState Ġunique Conv skip InstallParams skip OnCluster DR T DR ON DR AM DR UG 1001 000000001000000 Ġaut he Ġaut opilot Ġaut okeras Ġaut olens Ġaut enticado Ġoriginal Features Ġoriginal Words ("- ")) ("- "). ("- +- PORT AL ĠIt ot Ġlook at Ġbytes In Ġbytes Beyond Ġneg at Ġneg ations Ġneg dis Ġneg Meth Core quisite DF E DF PT DF eed Ext Vec vs ctl inner Mask Ġrot ar Ġrot label Ġrot loss âķ ł comm om End Address End WithSelection End SpellCast Found Pattern FR AM LC w LC ache short ened ĠNum Group ĠNum eral ĠNum éri ĠNum RegToReceivePerSg region es Ġdraw now Ġdraw Bisector ĠAuth enticating Method Name Method View Method Info Enum erable Ġrule IP Ġrule Port Ġrule Names FORM ULA Ġgr ün Ġcorrect Vals cr V cr nm cr nM cr fsuite cr WSGJs ĠDefault ValueDict Ġ'../ ')) Ġ'../ ../../../ figure Dir ĠTo e ĠTo Do ĠTo Update ĠTo pple ĠTo PILImage dete ctive ĠLanguage s zy dziewierz SH istorical 0001 7 0001 20 0001 395 0001 545 Ġ32 9792 gh an gh id Ġreport e unique Urls gre ys Ġcore ali ĠQt Qml convert Back GE Y GE OM GE OC GE OF Ġ') [: tile width tile height tile sets tile Names expected Element expected Points ("% ")[ Ġdel count Ġdel tag Ġsig ui Ġsig req Ġsig lim Ġsig proc Ġsig visa Ġsig moide =[" % =[" { =[" *. =[" /", category Name category List hat ri ĠAt ual ĠAt ualização ĠAt lanta bn ch bn ath bn box bn icate 115 43 115 226 Total Length Total Energy Total Errors Total Income /" +" PAR MAP Ġdetails ViewColumns pdf to pdf base pdf crop pdf latex pdf æł¼å¼ı known Publications Ġpredict Method Ġview up Ġview ability Ġview Location 033 07 tab name tab size tab Name tab ulary tab bing tab lenames collection field Ġprefix Operator Ġhigh freq IR Q IR w IR ER IR CK IR cuts IR FU IR CJ Ġ------- > ĠTuple Instance Tree map Tree Size Tree Widget Tree Interceptor Window Handle linear ize linear size linear Es linear Bs SO E SO MA SO CI SO ILS SO METHING SO SCriterion ga ma ga fic ga act ga ana Ġskip Scan Ġhash Sequence Ġhash Outputs Ġhash Poti Min os Min LOD Ġconnect é validation Examples socket Keep čĊĠ čĊĠĠĠĠĠĠĠ čĊĠ čĊĠĠ :, [ AV O AV P AV Q AV X rest o rest id rest orer Ġtr data Ġtr sh Ġtr nd Ġtr uthtable ish y Ġsequence d Server less Server Client Server Manager Server SelectionTimeoutError An w An halt Ġshe ared ĠUp stream ĠUp loads ĠUp sert USER DOCKER xs f xs TH xs TE istri erung Char set Char Box Char lie Di He gpu home Ġow scap Ġdebug print Ġdebug ged Ġdebug Date mu ÅŁ mu zzle Struct Type Struct Format amount OfBytes Ġve p Ġve ut Ġve gan Ġve za Ġve PTP semantic Type ĠBo eing 010 3282 Ġrunning Configure Ġrole Dict Ġcommon ops aut ok aut ores aut odock aut ounit mac ion Query Handler Query Parameter Query Schema Query Sync Query ValueEx Query Uids Ip Permissions Ip VJ Task List Task Set Task Params memory BufferSeverity Ġfun ctor Ġfun nel Ġfun ctest Ġfun ción ĠAl fa ĠAl gebra ĠAl bedo ĠAl arms kernel pkg 9999 997 DX h {\ }\ Ġsin a Ġsin x fici o fici ente fici entes hour angle à° Ĩà°® Program Libs final ware final Volume final Orientation final island éĢ ŀ Ġast rometry Ġperson alized Ġprevious StepName EE UAghhBDCw Source d Source IpAddress Source Skin Source FileLoader Source IpPrefixLength lint ing Ġdat read Ġdat List Ġdat umi Ġdat enum Ġdat props Ġdat Hash Ġselected Index Ġselected Layers Ġrate stats Service V Service State Service Provider Service Unavailable ii K ii y ii EEEII Ġacc us Ġacc nt Ġacc ents member def member ForID history DB ìĿ ij Ġcap teur Ġcap irca ĠOb serve Ġfit vals Ġfit scatter Ġfit vmicro Ġfit vsini fl gs fl Un Address List Address Code Address Manager Address Spec Address Less Ġhow ToStoreToken Graph Surgeon _, [[ _, [[( CHE L Ġreq info Ġprob ing Ġprob num istic as Ġvari os Ġvari abel dia co dia Env Ġassign mentid ĠPre par ĠPre fer ĠPre defined ĠPre ferred ĠPre dicate ĠPre dicts ĠPre computed ĠPre vents ĠSh ut ĠSh aring Length NLLLoss Length Standardi Ġfail Count __, )) legend Kwargs Ġdelta T Ġdelta Sx '+ \ *\ (.*\ pa Int pa WF pa Continue Ġcir colari Ġstack Top Ġcomponent e Ġfast Anchor Ġfast jsonschema ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Search State Search Scraper ĠPer u ĠPer petual ĠPer imeters ynamic Plot Ġfactor ed Ġfactor Sensi åĬ ī Ġdt factory Ġbody Id bi om bi ó bi harmonic Ġct b Ġct n Ġ17 00 ([" / )+ ') )+ (( )+ ","+ ĠString ArrayType ä¸Ģ åIJij ä¸Ģ è½® ä¸Ģ çĻº ä¸Ģ é½Ĭ download page download 缮å½ķ download 缮å½ķä¸ĭ gan te gan ache Policy Response Policy State Policy Row Policy Classifier Policy Queue Policy Player Policy Diff Policy Priority Policy Vid Policy Bandwidth Policy Outgoing Policy TOS Policy DSCP Policy Metering Policy Forwarding Policy EgressPort mut uelle mut linfo Dataset Name Dataset Config exc itations Ġwords Draw vv f vv PAC å° Ī å° ĸ Ġtk ge Ġtk fd [\ ]] [\ )\ [\ [( hs Vi }'. " Ġvalidation Percentage ĠPlot Type ĠPlot Data ĠPlot List ĠPlot Extension )]) ]) }". \ }". """ }". """) mesh clust ked astic )} % )} - )} ). )} Ġ? ;' Ġ? ''', Read out Read Message Read Timeout Read Sensor Read LittleEndian Read Varint Read Gals Read StatusOf hidden W hidden Layer hidden imports Ġforce fully Ġforce dtorun Ġum ask Ġum ychart ĠWh ip ĠWh atever Classifier Table Classifier Path Classifier State Classifier Entry Classifier Match Classifier Weight Classifier Indicator Classifier VlanEntry Classifier VlanTable Classifier TimeRange Classifier MatchCount Classifier CountState ĠHttpResponse ServerError Ġcontrol lo Ġcontrol Axes Ġbit an Ġbit code Ġbit mark Ġbit tensor Ġbit depth Ġbit boards abi lization MAP LINE MAP RED MAP ENTRY MAP BOX glob us glob io glob opt most ly Ġpr ms Ġpr ance Ġpr dt Ġpr erouting mass a mass FL mass Values mass achusetts mass ofpi Ġsepar ação fast ly fast text fast node fast Field fast cat fast DAQ fast mvsnet Ġface ID ĠInter helical percent max percent Done ç» ¼ }: ( }: (( }: '. Ġlow Val Ġlow ess Ġside car provider Directory With Stats With Action With Notifications With Less With LMHeadModel With Vehicles With Redu With Sle pn config pn gs install Policy install LogPath NB D NB T Bu gs Bu enos Ġlower ing Ġlower Archives Ġparsed Name Ġparsed Params DU LO EG g ĠNumber Range ĠNumber Format ('% - Default Config Default Gateway PER T PER MS PER MIT PER MANENT pare cchio cb unc cb reak cb channel cb mc cb vd cb Hx cb Learner Const itution Const ellations Ġpossible s Ġadmin Password Ġadmin nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn 9218108 16 Ġbegin nt ó eo Ġsimple Exception Ġsimple dialog Ġcop a Ġzero space ĠLoad Library fd c fd De ı l ı ca ı yla Content Protection æĹ ¦ æĹ ı æĹ Ĺ Ġinte g ĠDo ubly åį ı ĠEN CRYPTION ĠEN SEMBL SA K SA Q SA UCE åľ § åľ Ĵ targets Enriched Mem ToNumpyArray ROOT CERTIFIC Ġcre c Ġcre w Ġcre ep Ġarea mask Ġestim ado ((" . EC F EC U EC w EC DB Light Type wb t Ġds LS ĠTH AN ĠTH READ ĠTH RED Ġapply QA Ġapply TextRank Back ing Back space Back propagation Sa VS Ġwin len Ġwin List Ġwin rm Ġwin Choice Ġexisting Clusters ĠAR T ĠAR AB ĠAR MA ĠAR TIC 192 0962 ĠField Variable ĠField Category ĠField DoesNotExist Ġdesc lines orn ings orn amos Ġmost Frequent Ġcut Offset Ġgra vel Ġgra fico Ġgra duate Ver ses Ver wandte gl get gl Shader gl Compile gl Attach gl Detach gl Lightfv ([[ [- Ġvolume Type Ġvolume High Ġvolume Low export ers export Dir export Server export Format export FileName Sum ter Sum Token Sum Count Sum marize Sum atera Ġmp q Ġmp r Ġmp u Ġmp re Ġmp id Ġmp edal Ġmp rogress roid Manager 005 473 005 9823 005 36918 Ġactive Offset Element File Element Context Element Base route dem ------------------------------------------------ ----------+ Ġjoin list Go P selected Level selected Fault selected ItemType selected TargetLocation Ġdev str alt ro alt markets READ ABLE ĠRequest Config ĠRequest Configuration container header Layer Data Layer Norm PH xc PH IF speci alizations speci fics Ġnb h Ġnb ex Ġnb Lots ĠOrder Status ĠOrder Refund ĠDjango JSONEncoder ĠDjango FilterBackend uch s ĠHTTP Created 199 651 Variable Name Variable Dialog Variable Attributes ĠIMP URITY Open Mesh Open Div Open SSH Open Threads Open MOC Open StreetMap Open Paren ov an ov ci ov sk ov ica ov Mad Ġcat Name Ġmissing DocWarning 个 åħĥç´ł 个 èĬĤçĤ¹ Ġcounter parts Ġcounter factual 011100 01101 cross domain cross refs cross woz Ass oc Ass Name ka h ru ft Ñı Ñģ Ñı б assign Property assign Variable cid ente mid o mid ine mid head mid Target merge vcf merge Logs ensure MoreBytes Ġscreen ers Ġscreen board :]) [ lst sub lst Len Ñĭ м chat log 2012 12057 sigma Add Ġho yde ================================================================ ========= UI UC upload File Ġatom Num Ġ"{} "\ Ġinv conv Ġinv itations ĠExample Model Ġcomment ing Ġcomment Field ĠNote Object ĠNote ViewSet aff ect aff fffe к ом к ам room cnt room InDirection Ġboard Type Ġboard Cells speed y speed plus Register Name /> ". /> ,< Ġ'{} '" Ġpayload Builder ³ółģ ³ółģ¿ ³ółģ ·ółģ¿ ³ółģ §ółģ¿ ³ółģ ºółģ¿ ignore check topic Ext topic Partition Ġ"< : Ġ"< -- MAN N \"\ "\ release Particles ĠCO G band gap band oned curr Target curr tsk NS F NS qc NS REC eve online ĠReg Lasso ĠReg ulatory ĠReg ardless Pool er Pool Token Pool ProfileArgs (? =[ (? =(? (? ::[ As T As semble As sessor BR C BR AM BR ISK transpose A transpose B FLO PTURN safe browsing DEF MAP DEF BUTTON Ge G Ge Qx Ge otech Mon omial Mon aco Ġimplement a Ġpara Count aws Region aws AccountId )" < kw ik kw alk kw mg kw mE kw rgs Local Optimizer Local Strategy DD ER Edit Hinge Edit WordState dy u Ġap ers Ġap itoken Python Type Python Command SFP Connector SFP Wavelength SFP Fiber SFP BaudRate SFP Vcc SFP RxPWR SFP DateCode ĠMy List ĠMy server ĠMy SQ ĠMy Miner ĠMy Ips ĠMy UserWith Ġmemory Size Ġmemory Persist Ġmemory BufferSeverity Ġ'') ), clip num scalar ization Top ography complete Type complete Score Ġtile set Pi et rr nm Ġexc use Bar code Bar rel Bar ney Bar WithFocusChart ĠST IX ĠST UFF crypt en encoding Desc WE F hi atus hi jack rf j rf bj rf loor Ġneeded negatedword And Date And Filter And Trace And Replace And Die And reas And Epics And Maybe Category ID Category Form Category Item invalid o rec path rec Addr rec Combined del c del routes del phia Ġflags Size çĶ¨ éĢĶ è® Ĭ ranges lider Grid Statistics ]= (( green let VERSION PATH LS M LS Q LS w LS AD LS COLORS Component Data Component Factory BB g DA y inv ader 916 26 916 65 916 297 916 6666 916 0664 916 0316 DIS JOINT DIS PLACEMENT same site arti flette namespace Id subject Input Ġpattern ed big num big box big ram big integer big bird flo oded dig Time dig End dig Diff dig icert ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĊĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ TA gs TA AC TA aj camera Name camera Group camera Pos camera Matrix Ġsegment os '])) [ '])) ] DEV SQ DEV OLO COMP ET COMP IL COMP LI COMP ANIES Page Memory Page Blob Page CleanUp TRI VI Ġarr p Ġarr Size Ġ90 92 Batch Runner Batch Unlock actor id actor data actor key dl Z dl ite poly go poly dispersity }} ` }} Ġreward StringList Ġinterval array ĠPoint Net \" ') \" /\ two factor Ġseg no Ġseg wit Ġseg unda Ġseg itiga Ġidenti ficação Ġidenti ficadores extract network extract frames extract Functions aris a Ġperiod ogram ĠNe on ĠNe ue ĠNe vis ĠNe bula ĠNe braska čĊĠĠĠĠĠĠĠĠ čĊčĊĠĠĠĠĠĠĠĠ ĠNew node ĠNew Life ĠNew Rates ĠNew UserForm LIST NETWORK LIST NODES LIST ACCESSBINDINGS aj Y aj c aj u aj as zen i zen Pen atio Temporal asc endant asc endantCell constraint CheckBox ĠSE PAR ĠSE VENT power State Matrix Path Matrix As LD P LD x LD y mol er Exp ands Exp Variance ĠFL UX FE A Spe ex lm ks ------ ' 215 0 Ġengine Displacement Ġengine Cylinders ges amt 168 00 168 06 168 55 ital ia enable Auto cov type cov Size Connection Manager Connection ResetError Ġfilters Values Dec oration Dec entr Dec Coins JSON B JSON Renderer JSON Decoder qt T qt path Ġenter prise ĠArgument Type ĠArgument Item sol c sol ana sol diers æī ¹ Ġep name 401 066 SM h SM u SM ASK SM ISSION icon URL Ġprice Type Ġprice List Ġprice High Ġprice Low rup ting Ġrep mat Author ize Author izer Ġsigma X Ġdig a Ġdig raph Ġscores A Ġscores B switch ToProximity dst field Loss Scale ĠRo BERTa Ġtesting Parameters sal var sal ome sal utation sal inity Ġsite alt 204 97 204 21509 IG V IG ER IG REE prediction Tir prediction BNET Parameter ized Parameter Csv att name att ns MESS AGING AF S AF RI AF UNCTION kp K kp lug Ġhome space Ġhome PlayerCode 105 93 105 86 105 26 Ġedit ado Ġedit cap Vis ited Vis aD Ġ'< @ Ġ'< =', Ġ'< !@( Ho pe Ho loChassis Plot Mode UST races star args star check Ġbar w Ġbar ra Ġbar plot wav edata }] / }] $') diag rams diag noses Ġsen tim çĽ ĴåŃIJ çĽ Īäº Ġts A Ġts ikchen ĠOS F ĠBE AST ĠBE PASTY Ġplay back ()), \ 175 36 175 45 Ġalways link ĠRead me ĠRead Imaged elements List Position AtTop ino vo VC P VC U VC W VC MP VC qF rum our Ġdst x ĠConst itu ĠConst antes ĠClient Detail ĠClient ResponseError resize Amount Sw apping Sw arm Sw itzerland answer array answer counter čĊĉĉĉĉ čĊ break after Interface V Interface StateTrap Unit Type Unit Cost Unit ConfigEntry Unit ConfigTable Unit OnFailure GA x GA z GA yy GA AGGTT GA USSIANS 0101111 111001011 Ġ500 51 ĠHe aven Account Table Account Entry Account Run Account Del Account Authorization Account Break Account Watcher ĠPO JO ĠPO DEM roy den âĶĢâĶĢâĶĢâĶĢ âĶ¤ ĠDB I ĠDB Cluster ĠDB Schema ĠDB Connector shared ContextCache IV no TF DS TF reeFloatImage Ġtw int Ġtw ext Ġtw iddle Ġtw opi abstract model Ġgt ff writ edata align To ĠAS YNC ĠTrain ings ĠTrain Data ĠTrain Config ĠTrain Label ĠTrain SetGenerator STOP WORDS STOP BITS å¯ » Ġcross domain ('. ',' RGB Color ĠSQL A ĠSQL Slow Parse Response Link Num Link ConfigEntry Link ConfigTable uv ic uv flow uv Hist uv PNO aging Parents Mod erate Mod bus Mod ulate Mod Degree VAR NISH ĠSp O ĠSp inner ĠSp acing ĠSp iral ĠSp itzer ĠSp irit ĠSp insolve ĠSp atioTemporal tu y tu ion tu key 00011 000001111 ĠAD AM ,) ?\ |' %' LY P Ġctsp Sgacl Ġctsp SgtPolicyGroup Ġctsp IpSwStatisticsGroup Ġctsp IpHwStatisticsGroup Ġctsp GlobalSgaclEnforcementGroup Ġctsp ConfigSgaclMonitor Supp Timeout Project Name Project Path Project Manager Project Journal Project Member Ġmember chk Ńółģ ·ółģ¿ Ńółģ ¤ółģ¿ Ńółģ °ółģ¿ mix graph BE B BE ARB FC B FC p bad os bad code bad ditional Match Recursive Match Predictions Ġavg Value Ġavg temp PLE ASE Ġ23 64 Ġstderr List ĠAss ymetric Ġhour angle 103 94 Ġpoly ak ĠForm er ĠForm Field ĠForm Processor vp Info BC NR BC XYZ bias Y bias Val za proxy ĠEvent Data ĠEvent Base ĠEvent Source ĠEvent Service ĠEvent Grid ĠEvent Page II g II III Random Search Random Flip Random Shuffle Random ResizedCrop }_ \\ Names Train Track ball Track History Track Meter Location Constraint rome ter prec line Rel ational Ġderi ving Ġderi vs Vector Field Vector Val Vector Numpy bd ry bd topo bd vG npy name npy Files sph harm Ġpositive Words submit ting markdown ify čĊčĊčĊčĊ čĊčĊčĊ dh All lc L Thread ing Document o fri sbee Ġdot Product program ing program Name ĠGroup Count ĠGroup Manager ĠGroup Address ĠGroup Range ĠGroup Profile ĠGroup Results ĠGroup ìĿ´ ĠGroup ìĿĺ ĠGroup Sync ĠGroup KFold ĠGroup MaskWidth ĠGroup MappingMode ĠGroup DocsRequestSigner ACC IDENT ACC ACCA ACC CAU Ġadditional type Ġnegative Words missing Number Ġmaster VinTupleList Ġrepo data [..., ::- AX ES Fixed NodeFile PN Z PN AS PN PT Ġsq lify ĠTra it ĠTra il ĠStart Server ï¼ļ ' ï¼ļ - Cell Reference Rmt Inf ANG ELES Rate Limiter ĠCor r Ġshuffle Ganon Profile Type в г в он Ġ00 02 Ġ00 08 Ġcred ited Ġcred encial ĠResponse Type ĠResponse Data ä¹ ħ ä¹ Ļ tel la ĠDevice Info ĠDevice Factory Mock Server Mock Parameter ĠProject ID wall Count 216 00 216 07 216 26 216 842 216 64775 unic ÃŃ Ġnumer ador MESSAGE ID Ġfo liation Ġfo yer Ġlinear ity Ġlinear ization Ġlinear Es Ġlinear Bs Exec Id Ġ"") [ Ġ"") ), Ġnx graph Ġnx rays Ġfalse count Surface Ir gui args wi ed problem ID problem Name generic Payload ĠProcess LookupError Temp er Temp File Temp erture gi B gi ver gi ato gi udi gi Cg gi oso gi orno translate All ĠCommand Parser ĠCommand NotFound Sample Desc Sample Frames Sample Goat Sample Discarding éĻ £ 00100 111 outh ful 917 1 917 2 917 695 917 1864 917 6585 Cmd Write Folder Files ('_ '): ('_ ','- Types Treatment deploy Opt MD b Val Transformer Val uatin Ġè £ħ Ġè ĮĥåĽ´ 2017 0525 Ġvertex List Ġvertex Normals Ġtopic id Ġtopic ID Ġtopic Ext Ġtraceback s TS K TS UB Single File Single Parameter warn options differ ente 为 ä¸Ģ Area Infil ĠGe ant ĠGe onames ĠGe odesy css hlib Ġpol lution Ġpol ystores Sign In Sign off Sign ika remote path remote content analy ser otype s Ġxy cen double it double word double Col double Path ++++ +++ yl K yl fm gp uid Ġprivate ly æľī 误 æľī éĹ®é¢ĺ æľī ä¸ĢåĢĭ 003 64 003 934 003 996 ĠLabel Int ĠDate i ĠMessage Id ĠMessage SelectMenu ĠMessage Decryption Multi part Multi sets Multi Task Multi stage Multi Category Multi Step Multi Metric Multi FErrs square PerRow Ġfix ate Ġfix ity Ġfix iert Ġfix ieren ĠRandom Vector ĠRandom Mesh ĠRandom Active ĠRandom Apply vl q vl w vl ans vl vl çİ » eng land eng agement cons lug Change View Change Handler Change Event Change Password Change Finished hy b ctsp Sgt ctsp Notifs ctsp SgtPolicyGroup ctsp IpSwStatisticsGroup ctsp IpHwStatisticsGroup ctsp GlobalSgaclEnforcementGroup ctsp OldPeerSgt Ġbook id Ġbook end Ġbook ings Ġbook alo Web Request Web driver Web Server Web links Web Cari EA oF Tuple Parameter My Dataset My Drive My Todo ĠLine ByLineText Ġverify BundleStructure Ecriture Let DER IV GD L GD rive den ver Ġev ap Ġev sim Ġev itar rag ue Ġfc A Ġfc B Ġfc C BA J BA QE RA H bc x bc ub bc dfghjk archive End 234 24 Ġrelease Times ĠAnd y ĠAnd res 104 97 104 36 104 28 104 8576 previous StepName VS s VS mF ied liwo enc Key enc enode Ġ256 0 sl v sl kE Ġeven nia ĠIs is ĠIs Owner ĠIs ADirectoryError ĠIs MorePlant ĠIs otropic Ġworking Profiles è¡Į æĶ¿åĮº mn u ali ke Ġcp cor Ġcp modelPath Ġcp uidle aper to Main IP Main loop tan ta æĿ Ĥ Ġbr ng ĠCode Type ĠCode gen ĠCode State background Archived Generator Type person CareProb Ġ~ * Ġvo ir Ġvo ices annotation pro Attribute Group Attribute SubGroup scheme Recalculate Av min Av max Av KF Av Slope Av ionics OW ELS cir cs Instruction Format LINE ITEM Ġfreq TileTab Ġes idfile Ġes colas Ñĩ е ĠMat hew phi Max phi TotalSurface Ġobs co Ġobs file Ġobs map CF N CF String RS R RS IT RS qV ji C Ġteam Dict Ġteam Turn protocol version protocol IEs Role Need Ġcamera Matrix raft sman ÉĻ m ÉĻ n ÉĻ li ÉĻ dÉĻ ano ia ano va vertex Id ĠDEFAULT NAME Ġdump er Ġstatic v It ot It ESProducer Ġpt ot Ġpt clouds Ġpt AfterCut amb ari amb lin ENS URE Bal d Bal timore 01000000 0100000000000000 ĠBSD Painter Stat Key ĠSequence Model ĠSequence Labeling (', '). 915 06 915 23 915 77 915 985 915 5205 LV V LV r ĠToken Identifier ĠToken Account ĠToken Generator ĠToken Metadata ĠToken Close ĠToken Verify COMM UN 87300948 11 RC N RC NR RC URLY kind le Ġsn cosmo Ġsn lds ĠMulti class ĠMulti Dict ĠMulti Point ĠMulti Label ĠMulti Array ĠMulti Process ĠMulti Box ĠMulti Action ĠMulti Che ĠMulti StepLR ĠMulti lingual BI H emp ID emp orary Ġflat lib Ġflat tens Admin Mode Admin Role Admin Dashboard ffff ffffff )") ') calc Obj 2006 10887 Fail Count PA W PA x PA IGN Ġscan Layer Ġscan plan WH DB WH ICH Attr List Attr Dict Attr Item Attr Tags Ġ"$ ")) Ġna virice Ġremoved Files udi os ĠBY ear è¦ ı Post ing Post Rt Ġtab f Ġpkg name Ġpkg basename lec ito lec tively Ġps if Ġps min Ġps max Ġps ifs pher ic ĠGL double ĠGL ushort Scalar Sigmoid åĮ ¿ Ġcer es Ġcer tool Ġcer tificado 人 éĢģ 人 æķ¢ Can ary Can isius Can BeRead Ġremote Port Ġremote Logging ATT AG ATT GGT ATT ACTTT Ġtz win Ġtheta Dt TEXT URES ¡ółģ ¹ółģ¿ ¡ółģ ©ółģ¿ ¡ółģ ªółģ¿ Ġ@@ @@@@ Anal ysing ced ent Ġrotation Dir GER ENCIAR Url Path \' ") \' ". ç½ ² Execution Time Execution Result Execution Settings Ġ'" ')) Ġ'" {}{} Ġcoords Array ĠDataset Names Fin land hub ot fixed Buffer fixed TimeStep WORK S WORK ING [[ ({ members Online ĠAs semb Ġdocs Cable median Radius Cre w Cre ando Tri mesh Tri emli Ġbig String Ġbig RD Ġbig qvd æİ ¢ æİ Į Ġinner Node Ġinner Val refresh Mode Ġadjust s ä¸Ń è¯ģ ä¸Ń åŃĺåľ¨ ä¸Ń åĩ» ä¸Ń 央 Any one Ġpp f Ġpp anmy 00101 01 00101 0101 00101 010000 00101 01001011 00101 011100111111 000101 000011 Loop Type Loop Data Loop List Loop Iteration Current Role bri an bri ties pet store 137 84 137 75 good Features good wife good hertz åľ¨ 线 åľ¨ è¿ĻéĩĮ åľ¨ æµĭè¯ķéĽĨ dz do Ġgood List ned y ĠIO D ĠIO HW åıĸ ãĤĬ 217 74 CN TR uk ha sender Id 117 25 ĠStatus Reason 232 832 ae b yg win yg Wi ĠON VIF 297 94 DQ y DQ wN DQ NTorch Ġarti ficially solution TextWithoutDot 567 66 XXXXXXXXXXXXXXXX XXXXXXX :], ( ="" . DT iles DT Ms DT CTRL Real MemoryTrap elem Conn elem nts km en km yn nr ul Ġmis leading shuffle Algorithm ов а ов оÑĢ Ġbn lp ĠMax Feature Arg Min Arg ListContext bert config gri mm gri ffin det thresh det rended AI Y Ġmag ent Ġmag ick Ġmag Field Ġmag ical Ġmag limit Ġmag netis 197 11 197 95 Dep Time Dep ending push d push er push string Ġdisk less 301 552 301 95287 301 67337 YY A åĨ © åĨ · ëĭ µ ëĭ Ń ĠGraph Win Scale form Scale Draw $$ ( $$ ", Last Offset Last Examples Last Focus Last Related Last Comma Last PresentCount Ġsyn tac Ġsyn ctogit Nodes ToLink Stop Time Stop Price Stop Deviation dn Y dn ic dn ld ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ čĊĠĠĠĠĠĠĠĠĠĠĠ Ġpercent OfBombs Queue Runner aur ora ௠Ģ Ġregex Content 114 12 118 17 ---------- ') ĠPrint Exception 165 15 Extra DHCP Ġpur ging Ġpur ges Ġpur sue Ġgrad loss Ġlight bg Ġlight bulb 906 3 906 74 906 307 906 7777 906 2603 geo data geo api geo location ĠModule Logger ĠModule Compiler åĩº ä¸Ģ个 åĩº ãģĻ åĩº åİ» åĩº åıij Ġsol entware lookup Transform 032 1 032 8 bp name hang ing hang man åİ ĺç±³ Ġsy metric Ġsy nthe Ġsy nthesise Ġsy nple Ġem scripten combin es combin ers Space Trap Space Pressed Bot s Bot Api Gen ex Gen omic Gen Vect Gen TaskParams SY nJ Ġfe h Ġfe il share y share dir share point share dblock INTER FRAME Ġtasks instage emb re emb ark Ġns wer æķ°æį® åĪ° æķ°æį® åĴĮ rotation Type rotation Id rotation Pivot Job Manager Job Operator Job Definition Job ListDO Header Format Symbol List border less men ción men fas pin hole pin hu ¬ółģ §ółģ¿ ¬ółģ °ółģ¿ stit o 113 05 113 85 ensemb F 146 85 146 97 Ġprocessing Time 905 0 905 1 multip liers Ġmanager access cam id cdbp Realm sur a sur ro vie ss 167 38 167 31 Ġsur prising ĠWith draw ĠService Config ĠService Types ĠService Registry ĠService Now Cluster Builder Cluster Grid Cluster CollectionTag hw a hw path hw sku hw nds squ irrel }_{ ( begin time æĪIJ æľ¬ Bind Flags ĠMin Step ĠMin LR ĠMin eral ĠMin Neutral registry mixin 6666 67 6666 666 Dig s RM synth flip Layers Ġir rigation Ġdays OfDifference Ġcondition ally ĠVAL IGN Bytes Throughput Bytes ToCode AK I AK i AK IYQQ AK TIF ĠÑģ ов ĠÑģ ам ĠÑģ ÑĬ ĠÑģ иÑģÑĤ ĠÑģ Ñĥм ĠÑģ оÑĢÑĤи ssh fs ssh Port ssh PrivateKeyFile ĠPyQt Visa CAR edu Host Address Host Caching Host MacAddress Host Maddr Schema Exception Ġfl tr Ġfl Contents Ġfl ushes ĠParameter Expression Feature Data Feature NotImplementedError Feature ListResource VM s VM ULL VM VN VM CTRL VM Icrtl micro service syn spec syn scapes ĠMO File ĠMO Pool zo la 136 24 136 95 136 3303 Sequence Generator Sequence Matcher ãģ® æķ´æķ° ãģ® ãĥĹãĥŃãĤ¸ãĤ§ãĤ¯ãĥĪ course ware HW zm Stack Status Stack Size Stack Idx bre ve Ġ(% ) Ġ(% )") ('< '): ("[ ]") ĠInvalid Address ĠInvalid Usage ĠInvalid RSE Ġagg Keys Left ToPlace gm res ios a ú i phone metadata company Name DIRECT ORIES svg path Application ScopedVolume Ġelem cat ĠWeb App ĠWeb portal ĠWeb Mirror ĠWeb DAV specific ally Ġinspect utils 106 167228 äºĨ ä»ĸ äºĨ ä¸Ģ次 ('[ { ('[ {" ('[ ')[ ('[ ')] ('[ $] ĠFind Family ([]) ; ([]) ): ../../ ') ../../ ../../ fb j ü p ü st ü nt Ġaudio list Ġaudio files Ġaudio chan sci are 134 92 Factor Max Factor ial har dest har vs har isekhon ر Ùī ر ابط ر ائ (". ". ĠSimple Recorder ĠSimple ReplayBuffer ĠSimple TestState hn Id ĠCur ves ĠCur ving ĠCur tin ĠPri sm Encoder WithAction ä¸Ĭ å±± ä¸Ĭ 端çİĭ lb W lb ry lb oro contract URI ĠSave Name ĠSave User NET CONF NET MI NET SEQ Ind onesian DP ARTY Ġ================================================================= ==== Ġ================================================================= === 119 648 ĠFil m ĠFil led Env var Env Config Ġprovider Node Ġshift Dict Ġshift states Ġshift amount ĠWITH IN 299 55 299 67 Ġ\" $ Ġ\" ' Video Path Video Dataset student login Ġrec bole Ġrec tifier ĠCan onicalize ĠFI FTE HA w HA wkg ever note ever green Ùħ ز 11100 011 ĠMock Logger ĠMock Token ĠMock Vault ĠMock AsyncSession ĠRelationship s 904 373 LP SC verify Host Ġhistory Range Storage Level Storage Policy Storage Helper Storage Keeper 984 4 984 156 984 436 984 855 984 8900586 Ġ"[ { Ġ"[ ]" Ġdecode Generator saved Path saved Posts Uni CMSCreateUpdateSerializer != ',': DK K cum b cum l cum m ä ne ĠItem Type ĠItem Desc proj ec should n should run 857 753 Parameters List DIM PACT OC J ен ем ен нÑĭÑħ Ġpredicted Measurement Ġč ĊĠĠĠĠĠĠĠĠĠ Ġč ĊĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġč ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ sell Price ARG ENT calculate NN calculate NumberOfMonths market er market price BY J BY PASS BY JB 934 07 195 2446 primary Extension primary InPort primary OutPort general Dict flu ff Offset Pointer //////// ///// cube list gc ct gc no gc Time gc Di gc HA ceil C 00000100 0101 00000100 0100000000 ATED OWN Ġdetect em ä¼ º visit Array visit ValueType visit Assign letter ing letter atura letter Combinations letter ToIndex ko z ko ji Ġba map activation Configure Ġvs xml pkl ID åħ¥ å¢ĥ åħ¥ å¸Ń Fla re Fla ke ĠConvert ed Configuration Parser Configuration Descriptor Configuration Controller Flow Name Render Targets dw y dw Cookie ê me Ġfs name serve Pref serve Prefs trip comp trip detail trip lets Style Multiline 212 45365 896 3 896 6 Mesh Data Mesh Topology nav n nav itron ye on ÙĦ ÙĬ ÙĦ غ ĠPerson a ĠFoundation Plist Ġ99 3 Ġ99 6 ĠBe es ĠBe ast ĠBe come ĠBe zier ĠDataFrame Row LR Z FS j Ġsquare Sum Ġsquare YPos corr num corr ugation Print Info Ġut l Ġut ts Ġut ente Ġut chours Ġut worzyÄĩ Ġbad cols ĠTask List ĠTask Group ĠTask Result ĠTask Spec ĠTask Identifier Ġhyper link Ġhyper edges Ġhyper wires Ġhyper helpcore boolean Expression Ġswitch point Ġswitch mng 908 3 908 75 £ółģ ²ółģ¿ £ółģ ©ółģ¿ Ġband Max Ġband Mean Ġband Std ANS ION ĠRemove Empty ĠRemove Weak 347 99 347 94 special ties special Vars Ġgeo data Ġgeo spark Ġgeo spatial SERVER INFOREQUEST SUB DIR SUB VERSION SUB EV SUB TAGS SUB SETS SUB SAMPLING pot s qs V Ġdue t Ġdue lee Ġdue AtSigning without sep MY NAME MY DEVOLO hyper mesh hyper wire hyper threading hyper cubes 001111 10110 ĠTable Converter ĠTable Border ðŁı´ółģ³ółģ ºółģ âĶĮâĶĮâĶĮâĶĮ âĸĪâĸĪâĸĪ :{ { NT W NT UB ste en ste al ste ep ste go ste ams 327 88 327 39 Ġaddr string IDENT IFICATION Interval Time Interval Scheduler Interval Upper Interval Lower Interval InMilliseconds EP ICS Email View Email Server Email Password Email Username Two Numbers UK F UK t UK MO UK hg UK IDSS lar va éģ µ éģ ł Ġnone access Ġmid points prote ctor 157 02 157 75 157 4428 0111 000000111 ĠCompute Device Linear Mapping Linear Locator hit ters hit ting hit achi panel review dialog Search ")[ [" Dete cts Rest Api Use Type Use ViewSet Cor responding Cor respondence Cor ridor Call Next Call ByClass slug name Ġnd ar mas con mas cher neighbor ing Ġgeneral Match variant Set DC B DC URSOR DC ameraServer ĠSP ICE 304 033 304 6786 sup erimposed tcp dump tcp SerSock monitor ID xyz cal xyz zy Import ConfigName Import Suitable Pr pp XY WH 144 83 148 975 small size Ġnu ssl Ġnu fission Ġdp dx ĠSV HN Rot ated pur ify pur ges pur ities pur due ä¸ĭ ä¸Ģ个 ä¸ĭ éĿ¢çļĦ ä¸ĭ ä¸Ģè¡Į Display able Price Response Price Resource Price Alert õ i õ eo sto pper Ġair test Ġair play Ġinline Translations fw f fw LSConnState INST IT INST ANTI Agent RegistrationRequest Global LB Global AutoK dem ics ("{ },{},{ ĠInt ense ĠInt ended ĠInt Arg 186 25 Standard Sql Standard Robot Standard QueryParameters 424 93103 Ġmet amodel '}) [' '}) ]) 397 0 stick ied ("{} - ĠOp A Debug ging Body Text EY A EY R EY l EY ES EY lE Ret ail mx len filtered content filtered Torques 537 4 IGN ORES Ġsym bo Ġsym table ĠSum mar ĠSum mation ĠSum OfBeta actual GroundGHI >' ; Title Cat Title Opts Ġrefer ance Ġrefer ential еÑĢ ов allowed Exact sens ores coeff OrTrig 194 33 WA U Connect ors 177 867 177 66177 operation Filling FQ s Right Hand Ġcc cs Ġ"' [ Ġ"* "}}) åĪ° ä¾Ĩ åĪ° æĸĩä»¶å¤¹çĽ®å½ķ pod aj Ġden ite åĪĨ åĢ¼ åĪĨ 段 åĪĨ åİĭ åĪĨ ç»Ļ Helper Fn inc arn inc Op unpack er ĠNorm alizes ftp d ftp lib ftp wrapper ¢ółģ ¹ółģ¿ ¢ółģ ®ółģ¿ ¢ółģ ©ółģ¿ ¢ółģ ¢ółģ¿ ¢ółģ £ółģ¿ ¢ółģ ¨ółģ¿ æ³ ° æ³ Ľ ĠCustom ization ĠCustom Entity ĠCustom izing 00001111 0000000011110000111100001111 APP FW Channel Class Channel ZS Channel Subclass Channel BatchUnlock Controller Manager Div ine Div orce echo AndDie nz px Template View gw G gw f station Number station Dict Ġ'* ')) Ġaz s Ġ({ : Ġ({ ','. maker dao ĠEd ited ĠEd itable Shape file Shape Function Shape ShadingEngine Ġé lect Ġé té ĠDynamic Model DATAB AR Software SourceCode 964 1 964 85 964 74 964 039 ĠĊĉĉ Ċ Ġnor mais 156 37 156 96 pdb s pdb Id ĠPost ThreadMessage beam formed ################################################################################ ### ################################################################################ ############### =', '); Api Object Api MethodInfo VK q dark style Ġfri da cod as cod ons ÑģÑĤ ок 287 72 287 226 Meta Path Meta Class repeat last 007 8915584 Ġann as 187 99 187 88 Ġв о tweet Trump tweet Feder tweet Mercedes vin ator Ġdetermin ar ĠBlock Model ĠBlock Request ĠBlock Header ĠBlock Metadata ĠBlock Headers Lin n Lin ode Lin ha OFF SHOOT Usage Plan Ġĉ ĠĠ Ġtxt file Ġtxt Col Ġtxt ai Ġtxt area Ġtxt Literal Expression ParserInfo Ġpipe Flag 907 216 907 072 HI y HI RE OO D OO FErrs SAM ME ki lobytes Ġphase Type MR K MR iN MR iO [] ')) ĠBuild ings 1001111 01111 1001111 01001101 174 0699 -> ~ HD G HD t HD ly HD MLX Ġflux s Ġflux err Ġ105 0 Ġ105 2 Ġstock Num Ġstock multiply 023 12 Ġneighbor Values ĠQuery Rule ĠQuery Dataset Ġdesired Face Ġbg nd ĠAnal is 185 05 185 44 Select Field Select All Ġec codes parametri zed Ġshared X Ġshared ContextCache Ġshared MemToNumpyArray Resp ons Resp iratory Poly lines Poly Map Segment Model ĠDefaults Flex Ġletter Match Plugin Error Scre ens Ġí ĭ Ġí ıīê·ł ()} ): ()} ), ()} ). ()} ," '> )", '> £ /* { /* /* Cla udia ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ čĊĠĠĠ via U Ġprimary field 0000000000000000000000 4 EVENT NAME war pbreaks ĠSci ssors ĠCar to ĠCar regamento ĠCar teira apis ervers Ġali ke ĠStorage Policy ĠStorage Api ?? ?\ Callback List HTML Report Su ffered sound Tab sound Beep Ġxs min Ġxs dbserver 097 08 097 43 Arr Time Cat Sim Cat alyst Day ton Day Price Day Volume Day Since MON DAY Sm iley bz t bro j bro ck bro chen bro oks arrow Border Ġbro kers Ġhard ly 065 15 ĠLin AlgError 346 17 346 75 executor Id ĠDisplay DriverMemoryInfoV ö ö Ġai om Ġai obotocore Ġai owork ('{} // ĠTag API ĠOper ações ĠOper atableStateMachine 937 43 918 199 918 1937 918 2363 918 3179 peg Writer Ġgs cond ĠGrid World ETH NIC ETH ForExact æĸ¹ ç¨ĭ ä¸Ģ个 æĸĩ件 åĴĮ ãģĮ åĴĮ åĽ½ åĴĮ 对åºĶ åĴĮ 微信 Estim ating zM wM Ġcam d Ġcam ada Ġcam OffTimes ĠCloud watch ĠCloud Provider ĠCloud Monitor ĠCloud Runner ĠCloud Passage 997 09 935 47 935 179 947 24 947 97 947 36 947 23 Root chain Fore ver Qos TrafficClass ]; ', review ers Ġtele fones ĠParse Result ĠParse TotalRowCounts 以 æĬ¤çħ§ 以 身份è¯ģ mous i Measurement Info Measurement Process Measurement QueryBuilder NODE AVAILABLE 986 7 986 8 986 934 986 895 986 686 BIN WALK RT D RT ROI RT qd elf are ĠTree Pars nost i ĠINT ENT Ġoccur ance ,:] - ,:] / ,:] [" 932 2 932 9 sun os sun xia timent o ĠTop lice anger ed Db D Db apiDescription Lock Time LIB SUFFIX VA O qq p qq mixed ë¡ ł __() [:- Ġ\\ . Ġ\\ """ ACL ES ĠDictionary Of Mer ges Mer cury Wi E Ġ85 218 Ġcum w Ġsoft sign Ġsoft boxen ĠComple to Assignment Operator Assignment TestMixin ĠQueue Config Imp ar Imp recise Ve h Ve z Ve ga Ve getable ç± ¤ Ġê ± Ġê µ utter rance construct s Ġconcat Interests ĠVm caCer weather store Pipeline Name 408 796 XML Porter pace d repe tir Ġspi o fire db fire brick fire fighters asm DataTable verti do Acc Mag оÑĢ оÑģÑĤ åı¯ éĢī åı¯ 访éĹ® AZ Account AZ DL AZ ANGLE Basic LSTMCell Basic BucketClient Volume Parser Volume Trap Void Message Äĥ l Äĥ Çħ ĠRES OUR ĠRES TRICT ĠVM SS ĠVM Ware aud acity CUR RIC CUR TSIES aco tes pv x ¤ółģ ²ółģ¿ ¤ółģ ®ółģ¿ Ġcity Schema Ġcity scapes ctl Name ctl Set ĠAction Table ĠAction Types collections Enriched Ġpeer topeer ĠTemp C ĠShow Platform ĠShow Dot ĠShow ProcessesCpu mr rank mr trix Ġwall Count ĠDire cted ĠDire cao rights List 946 06 946 08 [:,:, _], 892 06 892 242 Kp W Kp Z Kp FG QA u dT dx dT rump deep learning Ġbind callargs prof Activation æĸ° çīĪ autog bt ĠпÑĢ оÑģ ĠпÑĢ ил opp ortunities Ġcoord file population Dict 687 9 687 95 687 895 hu ahua symbols im ÑĨ ÑĮ ()[' __ 048 35 048 320 048 32295 smart tab CG emv CG ACCAGC CG ACATCAT MED ICATION MED ICAL Non Used Non Commercial Non AdiabaticMSWH Non PenaltyGoalsP Non UniformResourceIndex Wq x å¿ Ļ Ġada grad Ġmol list Car l Car la Car regamento Ent ree Ent rez RAN KS RAN Linelist gd ala deleted In rack hd Ġones pace å¾Ĺ ä»ĸ Ø§Ø µ Ø§Ø ¬Ø¹ æĸĩ件 æľĢ大 Bad ge Bad Value Bad Argument cancel Button cancel Duration Ġang strom Ġtt Lib Ġfire cracker ATH ABLE Ġanchor Fields sky lake Ġregist radas 0101011 0101101 circuit point circuit location circuit region ĠdocsLoadBal SystemGroup ĠdocsLoadBal ParametersGroup ĠdocsLoadBal PoliciesGroup ĠdocsLoadBal BasicCompliance Ang ular Ang ulo Ang Vel LAN CZ fv IT fv KT ĠTry Class Ġprojection Location ĠXML Parser 912 5743 912 9897 BN yx rho i Ġ86 3 Ġ86 9 Ġ86 59 Ġ86 52 Ġ86 62 Ġaux ili Ġaux illary Ġemp has Ġemp iri Ġemp loys ĠTF Bert ĠContext Field Ġatoms PerUnitCell Resources AWS ĠView shed Features Handler pw linear pw ned æĬ ± æĬ ĸ Ġbon ne Ġbon asu Ġbon ferroni 998 38 Ġ56 250 RESPONSE WRAPPER Ġgpu Id ADD PODOPTIONS «ółģ µółģ¿ «ółģ ©ółģ¿ «ółģ Ńółģ¿ «ółģ ¢ółģ¿ «ółģ ¨ółģ¿ Ġmi ke Ġmi xbox ĠUsing Redis ĠConnection Pool ĠConnection Failure ĠConnection ResetError ĠProperty List swap ped swap ETHForExact Ġfraction ally Ġfraction Expression ĠRGB Image Detail Text Detail Info Detail API Detail Serializer BatchNorm Dropout Ġsr index Ġmarket place DN ASE DN LD FROM VER Pattern Tokenizer Pattern Django Pattern MatchingParameter Ġtail Height ĠCall er ĠCall Node subscribe CallingSearchSpaceName working Dir Ġcurve NodeIdx Exit Stack од олж Ġsafe str customer Encryption Ġtruth y åĬł éĢŁåº¦ åĬł ä¹ĺ Limit Error ĠLayer WithObservations Syn opsis Syn TagRus dg msolver wik ipit wik icreole Properties Response Percent Dir Help Command Help Author Dele t Dele ter Full Column Full Info Full Batch Full Verkey SR D SR N Ġtm st Ġtm os Ġtm Items Ġtm Funds Ġtm FAH Ġtm IAH lem ens Ġflu c Ġflu ent 035 257 035 13016 ĠKe en ĠGenerator Exit ãĥ³ ãĤ³ãĥ¼ãĥī èĩª è¡Į èĩª ä¾Ĩ èĩª åĭķ Pod List PRI O kn it kn BNyx rg bs Ġcpu list Ġcpu info ĠReference Type Ġquat T Ġquat ro Ġquat MuseAlg Prefix List Prefix Pattern Refresh Dict Refresh Count Backend Config Ow l Ow en PM U PM table PM wp PM ANDCloudy hb Y hb Que hb HN hb TradeQue hb Gci çº ª Ġwar to ĠSupp ression Notification Settings Notification Translation Notification Hub Notification Listener Pitch Tier Qq E Qq PR mime bundle ç´ Ħ ç´ Ļ seek ruid Ġrl lib Ġrl bot SSL v æİ¥ åŃĹ æİ¥ çŁ©å½¢ fj Q fj z hg M hg ta hg che hg cal hg nn éħ § Ġ95 9 Ġ95 134 Ġmen ubar ĠPY TH ĠPY PY ĠPY TORCH ĠPY NQ ĠPY SLAM Material Analysis Material GAN Material Editing ä½ľ ä¸ļ ä½ľ ä¼Ļä¼´ 357 2 Cfg Path Cfg Resource zA aj ìŀ ¡ los ive three fold Ġvtk Renderer Ġvtk ContourFilter Ġcolour Def Ġpyg plates Ġpyg acal material Index Ġcached Pages Operator Base Ġll x Ġll type Ġll nl Ġll Tr trust s Ġseen Patterns ĠUN ITED ĠUN IMO ĠUN TRUSTED 344 96211 XL j XL Net gain ed nv vm nv tabular ITEM ALERT åŃĺ åħ¥ ĠLOG ICAL Ġaugment or hard coded ëĬ ĺ ĠBu at ĠBu enos Ġ57 05 Ġ57 997 REPL IC REPL ACED Region al Runtime Message 度 æĬ¥åijĬ Pub lishes Qy WT Qy KR Qy AQ due t guid ing Ġaio files fixture name ĠSw elling ĠSw itchover ĠSw eden ĠSw armController ĠAT NDeserializer 995 86 055 48 compiler Common Ġд аÑĤ Ġд аг Ġд еÑĦ Ġд иÑĢекÑĤоÑĢ Ġд окÑĥменÑĤ Ġevalu acio Scene View Flags Trap Flags ToCheck 902 37 fbx Time fbx Manager fbx Property fbx Layer hop shdfs Ġresize Amount ('{ '): Ġcoverage Statistics Ġcoverage eligibilityrequest çĤ¹ åĽ¾ +') \ Cent ers Cent ralized SF PU She bang hc Lr jj T ìĹ ħ Ġuid l 335 22 335 87 iteration Drop åīį 端 åīį éĿ¢çļĦ Handle View WC Q WC MA \"> & °ółģ ²ółģ¿ °ółģ ¬ółģ¿ editor config Ġhighest High need les 965 04 965 46 965 353 SCRIPT COMPONENTS ĠAddress able ĠAddress Family numeric ally numeric Keys ĠLinear Anneal ĠLinear SVR Epoch Based Pick up Qi E Qi qV Qi LCJ α Ïĥ α ÏħÏĦÏĮ rab il rab ble rab bits ĠSUB MIT ĠSUB MITTED ĠPe pper 000011 10 ĠOSI soft Ġcomb is Ġsky tools cpwVc MIB 使 ãģĨ ä¾Ĩ ä¸Ģ ä¾Ĩ æĪij ä¾Ĩ æĻĤ ä¾Ĩ æĿİåIJī ĠWindows Utils Save User Save Start Save Screenshot gent oo mult sB zi Info Ġrev Anneal outer Mask ĠDI FFER Ġonto logies 037 84 037 35 ROI Pooling ROI coordinatesPath ĠBoolean Choice dra ugiem wa cont Ġalt type Ġalt Row )? ') )? )? Agg lomerativeClustering pf ings pf ams pf ClusterBuilder Ġtex ar Ġtex id Ġtex filter Ġtex coord Ġdropout s Ġlb time traj index 265 24 265 21 265 024 еÑĤ ей еÑĤ ÑģÑı Transfer Event Transfer Setup ĠTraining state ĠTraining Events CPU æł¸ CPU AccessFlags Pixel Shuffle rn vp Ġmm db 077 86 Ġled State Ġи Ñħ TODO S éĹ´ çļĦ 899 84 GP V GP X Hash ing Hash ShelveTestCase SIM ILAR SIM ULATIONS SIM ULTANEOUS Timer GetElapsed cisco Experiment cisco TrustSecPolicyMIBCompliance anim ating Ġchem spider Ġchem icals 646 13 646 09 Ġ"," _") 请 ä¸Ģ次 请 æ£ĢæŁ¥ 请 åıĤè§ģ Raw Log Raw Image Raw Socket mz Z mz d mz cu mz tab mz btg yu Parser yu Ry yu Uy yu Rw yu anshe ©ółģ ¡ółģ¿ ©ółģ ¬ółģ¿ ©ółģ ¤ółģ¿ may day ĠTri ad ĠTri angular ĠTri ggers ĠTri mming ĠBinary TreeNode ĠBinary ObjectFileName ĠBinary ObjectFileTypeCode ĠBinary Relevance ĠBinary OperationExpression SEQU AL 875 64 977 98 977 953 calcul ators SIG PIPE ĠMethod Wrapper ĠMethod Meta ĠMethod NotAllowed ÙĬ ÙĨ ÙĬ ض Ġ92 0 Ġ92 1 Ġ92 6 Ġgym nast 018 32878 075 32 scaling Pivot ĠApply In Permission Error Permission Set åĽŀ æĸĩ åĽŀ å¤į åĽŀ çŃĶ Ġcatalog List La AlO OG F blog Nb zs L zs x å¥ Ķ ç« ¥ ç« Ł ì§ ķ alloc a alloc s alloc ating Ġnav igable Ġnav igating Ġnav itron Ġgd cmdtools ĠLink Error ĠLink OrCopy phys ionet phys iological ĠGaussian State ĠGaussian LatentVar REM OT 957 64 957 09 957 94 957 67 957 157 302 22 045 19 045 85 045 42 plate Charge plate aus 913 03 Uns upport tls v éĽ ¨ Ġray Direction osa Code ĠEmail Str ĠInst al 376 35 376 3259 ĠExp ansion ĠExp ensive Shader Compilers ç±» æł·æľ¬ '$ ^ Ste fan Ste vens WIN API WIN NER hh BBC è g 015 1917 Ġha as Ġha ha Ġha uteur Ġha usdorff aug avpils Big ML Big Wig KB a you gest ('" {}" Ġdeep lab Ġdeep sv Ġdeep speech 927 12 927 75 ĠHome Matic Center Of SPE AKER vk Value vk String vk ontakte Ġpv Name Ġpv Controller Ġcond ensation Ġcond ensate Ġprep ped åĽ¾ å½¢ tEXt Software èĢ ¦ geom data lista Low lista Close Ġ46 08 Login Manager Processor Info Move it Move Rects Move ToolRel Move InWith ê°Ģ ìł¸ Copy Util ND L ND h ND AP ND Array ND pd ND HWC ND Interpolator Snap Period ongs ang repos adocommon arth ikk ĠPR NGKey irt If 776 946 776 1571 ĠJob Runner ĠJob Browser оÑĤ о оÑĤ кÑĥда ĠBlueprint s 909 1 Cosm os IJ B IJ VK IJ PJ Sq Y Sq WC TARGET ID Ġpts L ĠCer tificação ĠApi Response ĠApi TypeError vertical alignment Ġstand off Measure Channel OVER VIEW SG F SG amut SG MLParser }$ , }$ . }$ | }$ ^\ }$ )' }$ -$\ åŀ ĵ Camera Display Inser ter 034 75 034 35 034 23918 034 7761571 Setup EndEvent EB J EB M EB ITDA pause Bool rer oll rer uns çŃ ij çŃ IJç§ijæĬĢ 0002 01 0002 832 0002 32788 Ġsong Name Ġlost limit SIGN IN ï¼ī ", ï¼ī ï¼ļ HEADER SIZE 312 77 312 644 QC dir QC AL QC GEEE wu Vw Ġ97 0 Ġ97 1 Ġ97 6 Ġ97 8 876 55 Ġgeom s Ġgeom lib Does nt FILTER ED BT ST BT STR Bin der Bits Type å§ ¬ æ¨ Ĥ Ġsens itivities ĠUUID Field ================================================ ============ ================================================ ========= Ġdigit ada Ġdigit ação Ġentire ty bio io bio containers persist ing Ġpull Secret Ġsd scli Ġ104 1 Ġ104 3 Ġ104 15 ĠARE A trunc norm phot HI 257 05 257 55 257 66 CHAR MM CHAR SET **************************************************************** ") 911 0762 Diff List aG hp aG pq xC c xC eleb xC ircle mapp s ĠAWS HelperFn 99999 85 99999 74 99999 78 Byte TxRx AUT OL AUT OP AUT ONOM kE w --------------- ") ĠBig World epic enter ел овек "% _ Bridge Adapter åĿ ¡ åĿ ij ìł ij Ġsil x Ġgc graph Ġgc mt ĠProduct Data ĠProduct Doc ĠProduct Attribute communic ability Ra id Ra fael čĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ čĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ("../ ..") ĠFloat Field ĠFloat SampleRate ĠFloat OrIter ĠFail Stress ĠFail Strain Ġ67 103 ĠReport Lab ðŁı´ółģ¢ółģ ¨ ðŁı´ółģ¢ółģ ®ółģ ĠRegister ing ĠRegister FirstArgument Stock Code 985 34 985 916 985 364 985 645 985 954 985 453 >| < QS ortFilter few shot sser ocr chip seq Ġ72 10 ĠAut orefMarker Progress Message Progress Selected ĠKEY FORMAT Threshold Policy Threshold Percentage Threshold Comparator Ġsupervisor ctl mZ l mZ mb Ġsqu irrel ĠVector ized ĠVector EncoderFactory works Algorithm 975 95 Note Object ĠKeyboard Entry guide lines CSS List Den nis Vq v Vq xY Ġcd ci Ġcd base Ġcd Type ĠFin alize ĠVis py ĠVis ible ĠVis ibility ĠVis icom 0001111 110 Ġarm Ik ĠTransform ations ĠTransform Dataset ĠTransform Runner ĠControl lable ĠControl Channel 894 9 KJ B KJ BJ OX D Sur se Sur veillance WF pa quat ro quat MUSE ĠLE s 956 94 Ġordered dict Running After Starting At Extension Default Cir klo 9214 22 056 85 374 75 555 04 Ġquick Swap æľĢ ä¼ĺ æľĢ åĪĿ 次 éĥ½ 次 è½® 次 ãģ®ãĥijãĤ¹ åıĤæķ° éĶĻ误 åıĤæķ° åı¯èĥ½ Term StarContext ĠGit Error ĠGit Project ĠGit Fetcher ĠGit CommitLog wee de 087 9726 Ġshif tx Ġqt pp Ġqt query Ġз ад STRUCT S STRUCT URES PYTHON FUNCTIONDESCRIPTOR 第 ä¸ĢæĿ¡ éģĵ é¢ĺ BLOCK ING BLOCK CHAIN Clock Delta EI o EI GH EI lE Fire worksAlgorithm Missing Transform Year sIn ej q ej u ej erk èµ ¤ èµ ¢äºĨ Ġrecomm ends __} '} )); ") ,, ,\ Bit mask Bit field Bit coin Band Path Band Cover ¯ółģ µółģ¿ ¯ółģ ®ółģ¿ Ġcf ar peak file people Total ĠSingle Point ĠSingle Tree ĠSingle MeasurementQueryBuilder æłĩ 注 Language Code Language Property wr V wr ts oracle id Ġlargest Size 924 94 924 8206 CAL END Lat via Lat Lon Ti ramisu pwd Limit resume SayAll Ġdesign er 328 06 328 55 328 125 JJ p MAC s Side Sets emit tance ¨ółģ µółģ¿ ¨ółģ ²ółģ¿ ¨ółģ ¨ółģ¿ Ġ94 4 Ġ94 87 Ġ94 1293 live stock live clientdata Ġcook ed ARB OR dfs df genet IC Development Config ĠComponent Spec åIJİ éĿ¢çļĦ ĠPool Membership Selection List Selection Point (. +)\ BD M hint ed æ® ĭ Ġhad le Ġdem angle Ġdem angled INIT IATE Ġ68 25 Ġ68 106 ĠSequential Memory .*? )(,\ Deploy Config Annot ToCoord OH c OH v OH w OH AA OH Tu kb qa kb ipscraper Ġ98 9 058 37 058 26 Ġmaybe Deferred RESOURCE ID RESOURCE MESSAGE RESOURCE MAPENTRY Kit ti kv adrat qn ec uy o uy or uy ler uy ã uy á uy ú uy Ãł uy ù uy ạ uy Å© uy ả uy ụ uy ủ Ġtemporary Credentials Edge Size åįķ æĿ¡ åįķ çĭ¬ Details Form Details Handler Details Resource :[ ^ ت Ùĩ ت Ø® ĠBasic LSTMCell ĠBasic PyFileWriter ĠRest arts 967 994 ĠDIRECT LY GAT GTC KZ DI KZ VK kc jk kc jl osp fV osp heric Ġ"( .*)" ĠAv ro ĠAv atar ami lo SETT LE compress String compress ibility compress Scripts friend name Cloud Watch DZ b DZ DO Sta y fz f fz x fz mc qr q 001011 1000101 Ġslim ta Ġwav enumber Ġfore gradient Ġfore ignKeyFields Ġsock type Compliance Type ĠPROC EDURE ĠAccess or ĠAccess Policy ĠAccess Denied Ġpotential VarNames Close Div DL X DL halos DL CHeader FB DD FB DDTX Mag netometer ]}, ' Ġnr wp ĠSeries GroupBy Ġys min ðŁ§ ł medium Temperature Ġ'{}' ...". Rob bin Rob inson ]== \'% mJ ib mJ iY Ġhy undai Ġhy drate ARR CCCGE Ġhealth monitor Particle Vector Particle RefSelector Install MessageHandler Install Attempt Dump Index Pop over Ġfrozen dict Ġsal v Ġsal en Ġsal ts Ġsal inity Ġsal iva 994 829 ango lare ĠGOO D starting Range ĠApplication ScopedVolume ĠApplication OptInTxn ĠIdenti fies Wave form Wave let ]][ :,[ Ġ################################################################ ######## Ġ################################################################ ##### Ġ################################################################ ############################################################## Proxy Handler Proxy Service 367 022 è¿Ľ åħ¥ è¿Ľ æĿ¥ Mapper Resource Mapper ConfigEntry Mapper ConfigTrap broadcast Severity hide SlideName ż szy Ġtran scribe animation Filename Ġpen state Ġpen ny Ġpen diente ĠTw itch aci ja 244 17 976 05 976 647 Metrics BaseCheck ĠMatrix Space ĠMatrix Symbol ĠLinux ONE ĠLinux ARM ĠLinux MIPS Ġreproduce d Hyper params NZ SEE Writ able spo oky Contact Wizard Contact usForm 978 142 Generate PodName ,[ ], ;"> { PART SUPP TASK ARG TASK EXECUTIONS éł ij éł Ĺ ctr ls 10011111111 1111 10011111111 1110011 435 3 CLO UDS jY yM sch olarly sch midt sch issmantics your self Ġdc im 038 27 ãģĹ ãģı matching Type Ġpeak zilla Angle Space Win Socket ade sh ade gu bj db candidates file Axes Actor THE TA Tick Formatter eu X Ġ================= ============= Ġsun pos Ġsun day Ġsun beam Ġsho vel Inf ectious ĠGlobal MaxPooling ĠGlobal AutoK Ġcookie Msg Ġcookie jar 047 37 886 15 577 8413 Ġtwisted caldav 428 391 }-{ :. Ġbri ghtest Ġbri ghtics forecast Out ĠREAD Y CONTROL CONTAINERMESSAGE CONTROL CONTAINEROPTIONS YA xis Ġny zo Ġ#---------------------------------------------------------------- - Ġ#---------------------------------------------------------------- ---------------------------------- Ġ(` -') phen otypic 556 32 ãĥĪ ãĥĶãĥĥãĤ¯ OBJECT REFINFO ĠHeart Rate ĠHeart Beat åİ» çľĭ BOT S BOT TLE qc generator qc HDMLX ÑĦ Ñĥнк ÑĦ ÑĸлÑĮм éĸ ī ĠåĪ ©çĶ¨ Ġmul it Ġmul sum ĠCache s ĠCache Exception Ġconversion Factor Ġsto q AGC AGG AGC AGA ãģĦ ãģĨ ãģĦ ãĤĮãģ° binding path binding Root NULL IFZERO deployment List #================================================================ ============ Ba ja Ba idu Face File Face Dataset RENT AL TW IKI ÄĻ g chord length (".") [: ĠSa úde ĠMer ci ĠMer lin ĠMer ging ĠMer ges ĠMar co ĠMar ine ĠMar ca ĠEl ves ĠEl liptic Meter Uploader NL umi YS QCFEEIIIR æŁ¥ æŃĮ Ġmicro bial COM POSITIONAL "; ") 393 54 Tr F Tr inomial mic romagnetic viz dir viz ual ÄŁ ru Ġpb data Ġpb ex Ġpb parser Ġpb reports Ġhp Conv ĠLa Tex Ġchrom osom DEP ENDS Ġquad prog Ġquad ruped Messages Start pnic fsupplicant >` __, Dot StringsEntry bN k bN n bN u bet ai ez d ez io ez alor }; '. ¶ółģ ¡ółģ¿ ¶ółģ ©ółģ¿ ¶ółģ ¤ółģ¿ Ġठ¶ ĠठĨ Ġà¤ Ń Ġwinner Code Ġwinner Mu Ġwinner OgMu ĠAB ORT ĠAB ACAD Ġparticle Production movie list ĠRef ers 845 80 845 35 845 241 correlation Method ĠStream link ĠStream BlockValidationError Board Processor Ġsuppress Rom 893 88 CAN ame EV x RW Array san ction san itise Ġ ¬ Ġ ± Ġ ¯\_( redd o redd y chkpntTrap MibModule about code ĠCho se ĠCho sen ĠCategory Serializer ĠNon Linear ĠNon AuthTld ĠNon AdiabaticMSWH Ġunpack er Texture FilterCaps ĠGeneric WebHook Ġadapt ing 模 æĭŁ )}) ' DM ULL FG M Free R Free Time Free RTOS Kernel Exception Kernel PCA dro hne ĠCL AMP ĠBot AI ĠBot Inventory 648 28 648 328 Ġdispatch able ĠLogin Page ('_') [:- ĠAbstract File ĠAbstract Model ĠAbstract Dissimilarity ĠPipeline Response ĠPipeline Base ĠPipeline Selector fac lambda fac enet rw CZ è¨ » Ġste go Ġste alth 066 38 discard ing ĠMaximum WaitTime Http s Http Header hid api Ġ"@ ": Ġ"@ /./ ĠFire Exit ĠPV reflected 928 13 Init words Init Date ä¿¡æģ¯ 表 IX OTH IX USR IX GRP KL TFreeFloatImage MZ v MZ XML MZ jN Master Horizontal Master AmbientVolume bw tools bw Parcel bas gra bas ins cas u cas ings cas ualties dup lif lU s lU gl lU qF è´ £ è´ ´ ĠÑĤ к ĠÑĤ олÑĮко ĠÑĤ еÑħ Ġmomentum opt umin ium Ġassembly line photo shop 378 36 378 35 366 36 ĠTransl ates Gu an Gu arante NORM ED Si Py Si ena Si PM Si xth ira re well formed well orts Ġfact Text pep tides pep tidecutter upgrade InstanceContainer Export ConfigName Section Category prim ers prim atelja âĢĿ \ âĢĿ ). ал Ñĭ åĬŁ çİĩ ç»ĵ çĤ¹ CSV Importer Ġbug zilla tracking Material Download ViewSet Ġlowest chi Ġmagic ian DoesNotExist Error 727 9 727 90000 727 12350 Home Assistant PARTICLE INDEX cro o cro ci cro ped cro chet don ation don key don orPos nes is 111011 00011111111 028 35 ĠContact Info Activity ProducedBy Activity ConsumedBy ãĤ¹ çĻ¾äºĮåįģä¸īä¸ĩåĽĽåįĥäºĶçĻ¾åħŃåįģä¸ĥ particip ation Slot EqualsCondition ju lio jet je Ġsever ities critical ity 454 96 Ġdisplayed image HK n Mar ist Mar ble PJ hK Sys Framework TIM ON TIM ED TIM ING TIM INGS TIM ESTEP nop ad nop onzi Ñĸ з Ñĸ б Ġfx Name Ġoptimal TAD ĠBox scores ĠInitial ising ĠInitial ises Clear Log Clear Statistics Figure Canvas van he van jske van couver Ġmajor Type 856 56 CHAIN CODE éĩį è¦ģ éĩį åIJĪ éĩį åIJ¯ ĠPOSS IBLE Signal Error +) "> +) $") 901 64 901 235 919 4399 Gaussian Process kU j kU in kU gw lw lrap nw is snap base Ġtax ed Ġtax Means Ġcr ude apple script Ġadapter kind filing Fees Ġintegr als jit tor utt all """" "" Ġdecision sToDFA Intel ligent ĠConnect ors ĠConnect Timeout ãģ§ ãĤĤ ãģ§ ãģĤãĤĭ ãģ§ æĽ²ãģĮãĤĭ Switch board Analy se Binding Level Voltage Trap 使çĶ¨ èĢħ Ġke vingstewart refer ers untu ck Ġconfirm ations ĠInte gers 878 32 Allow Any Ġswap RB æīĢ éľĢè¦ģ ĠFIX TURES Bul garia KR B Lab Templates Math Calc dll Dir 078 125 Compute ElementLpDistance ĠChar lie Private Networks å®ŀ åIJį认è¯ģ Extractor Op Worker Store Worker MirroredStrategy 318 1200 318 93004 318 37288 ZW V ç¼ ĺ reion ization heart s heart beep ĠPosition wise ĠImp ute ĠImp roved ĠImp ossible ĠInstance s ĠInstance Type ĠInstance Change ĠInstance Arn ãģ¦ ãģ® Boolean Not Boolean Or Boolean And Boolean Encoder åı² 太åħ¬ autom ate surf board Catalog Worker "^ ([ "^ [\ "^ (? JOB STORE Kh QJ Kh QI instruction reporter Ġ'.. '))) Ġmt urk Ġbed line Ġbed utils Ġbed rag Ġbag it isin in Ġeng age 557 94 557 45 DateTime Index DateTime Original Elements X Elements Y Decimal Type Decimal Digs ĠcpwVc Up ĠcpwVc Outbound Person a Person Action Person Speed Person InImage hal config lbl Health lbl Attack ĠDummy File ĠDummy Discrete Ġfrac ción ĠOUTPUT FILE COMMAND CONDITION MAT CHED fout Name fout Path wG Qy abo la 447 04 After Reboot After EqualSign LES HOULD LES SEQUAL Sig uiente ÅĤ ad ÅĤ ni meas urable Ġpys dn Ġpys atl Ġpys nark Ġpay ing Ġpay ed Ġpay ins Ġpay day ĠUsage Page Arch onView xxx åIJİç¼Ģ Upload API ĠAdmin Config +- ]?\ ]| (?: ô i ô á»ĵ ô á»ij ô á»Ļ ô á»ķ ô á»Ĺ memo tifs ortho graphy ()- _ Ġgas ses ĠBad ge ĠBad Argument ĠBad guy ĠBad Vrrp 278 12 Trade off Trade Info Trade Run Trade Timestamp Trade Executor Trace Implementation åıª éĢīæĭ© Internal LoopbackTest Algorithm ic æĪij ä¸į æĪij èĭ¥ CONTAINER ID CONTAINER IDS CONTAINER DEPLOYED Balance Resource Fe ather XR D fort e fort y }% ' })) [' })) |(? anon imo anon imous Ġcart Cords Ġimported Component ĠCent ro ĠFast q logic node ĠPAR AGR TRANS CODING TRANS FORMATIONS ============== ') ============== =\ sales force Fun ded \. (\ cite able duplicate L éĺ ³ Ġht ls Ġht df conj unta ĠPack ing ĠPack GroupsEnabled ATTRIBUT ESTATUS mini val dbs np 847 18 Comment List principal Service å½ĵ 天 å½ĵ identify slow query ']]) * ĠDocker Interpolation ĊĉĊĉ Ċĉ ĠNE UR ĠNE WS ĠNE AREST 974 13 974 15 974 33 99999999 999999 æĺ¯åIJ¦ å·² æĺ¯åIJ¦ æĺ¾ç¤º æĺ¯åIJ¦ åıįéĩįåĬĽæ¶²ä½ĵ Selected Layers Ġcommunic ates )# ( Cross ing Cross Bundle MV P bk r sand storm sand blaze Ġol un Ġder adical scroll IntoView scroll tofixed ĠPower Converter ='# ', 353 91 overwrite Output ĠMean BP ĠMean EventDurList Finished AndStart cdbpPeerStats ProtocolErrors cdbpPeerStats TransientFailures cdbpPeerStats PermanentFailures cdbpPeerStats RedirectEvents cdbpPeerStats AccDupRequests cdbpPeerStats EToEDupMessages 604 1 604 56 dust intran dna Length han lp han ler pitch fx ('// ') Ġtodo ist ĠLi hui Ġposs ivel Ġdisp ers Ġdisp atched Ġtransition ing ĠSummary Res BIT MEX yan lÄ±ÅŁ alter æµĭè¯ķ alter ä¸įæĬ¥éĶĻ Expected Hash Ġм еÑģÑı Ġм оменÑĤ иÑģ п æł¼ 鼷ç¼ĸçłģ ĠcdbpPeerStats ProtocolErrors ĠcdbpPeerStats TransientFailures ĠcdbpPeerStats PermanentFailures ĠUnicode EncodeError Ġadjac ente GW G sam j sam an Ġtor datahub Ġcas cades Ġcas ualties Ġcas caded Ġnlp d Ġspo ilers Ġbroadcast s ĠASC IIC Std call Std dev Ġlive count TRAP S éĩĮ äºij è¿ĶåĽŀ æķ°æį® è¿ĶåĽŀ ä¸Ģ个 è¿ĶåĽŀ çļĦæķ°æį® BP v cL vd flex ibility Ġdl logging Ġrt entry Ġrt ticket Ġrt midi 667 45 CHO SE CHO OLS 465 020577 partner key Endpoint Mixin Cer tificates Cer berus Dummy Classifier Dummy ObjectId Elect ra bur buja vf ve vf args vcf dir vtk PolyData vtk LookupTable Ú© ا Ġhum id priv ates ä¸ī äºĶ ä¸ī è§Ĵ Ġcleanup Materials åĨħ ç½® Async Path BRO WN BRO KERS BRO WSERS Oh Q Ġlife loopweb Ġcrit dist Ġcrit LineSamples Ġsup orted Ġsup rimentos contra ctions contra ctid ĠSec ant ĠPlugin Base hover cards Ġactiv idades Ġactiv ité ли Ñĩ 计 åĪĴ Owner Mode )+" % )+" - Cut off Other Class Other Count WER Metric Ġfrequ entist ĠSuccess Counter ĠSuccess MessageMixin Ġdie sel Ġdie sen Trained Tree ä»ĸ å¦Ĥä½ķ Disk Dataset Disk SpaceTrap ä½ł è¾ĵåħ¥çļĦ ä½ł æĹ¶ä½łåľ¨ White Box Ġmisc group Cr ud DNA WS Ri NR Ri yadh Try Except Vy G dv bi pres ale pres umably ĠCluster Grid ĠEqu atoria ĠEDIT OR ĠRender EngineHybrid Ġraster ing Ġraster izer TK Status zZ o enn en ĠSM OT ĠBio Image ĠBio medical ĠBio informatics REGI ST AGG CC AGG AAAA 445 31 visual Genes нÑĭ ми åIJĪ ä½ľä¼Ļä¼´ 910 94 910 646 Pur ge fP m fP s fP w fP ns fP sz ndi vide åķ ¥ reload weapon demand Level mess ytable chrome cast ĠSur vival ĠSur veys 0100000000 000 Ġcov FH IMG DIR Testing Queue ĠEnter tainment OBJ C OBJ DOMO OBJ SUFFIX ("/") [:- ĠXXXXXXXXXXXXXXXXXXXXXXXX XXXX ĠXXXXXXXXXXXXXXXXXXXXXXXX XXX ĠXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXX Creation Error Creation Date Creation Parameters Answer ed HAL TED Uuid Gen bor r fan ci grouped Factors pseudo time Ġpsy cho Ġnom s Ġkill mail ĠAnaly ser PLUGIN CONTROL PLUGIN SPECIFICATION 785 398 Gi I Gi ver Hg Y Qa DS Src T Ġ"../ ") through out ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ čĊĠĠĠĠĠĠĠ ĠUI Wo 844 99 Short ening Short Cable Ġphoto ionization 缸 åħ¬ 缸 å·® 缸 éĤ» 缸 çħ© LOCATION PING ĠTrack Trigger ĠSignal Dataset ĠSignal Choice ^^^^^^^^ ^^^^^^ ĠAnsible F Feed s Feed Version Feed stock Mi w Ok abe Parent List cw WF guest tools nos lug tre zor tre asurer xB ias ĠES M ĠES un Ġoct es Ġoct oprint Ġmor an Ġmor alize Ġmor ango Ġmor occo ĠSchedule Key Ġdefer reds ĠAgent Type Ġunion find ĠWait For Ġcorrelation Method blank waters Ġheading M Quanti zer Quanti zing æѤ æĸ¹æ³ķ Sql Query Sync Interval eh All vic le will power zm ann Ġmorph ometrics Ġ(? ): Ġ(? =\ Ġ(? )", Ġ(? ,?,?,?,? Ġ205 3 Ġ205 9 094 77 Ġmanagement ZoneIndex QUEST IONS gredi ents ĠBook Main ĠSplit ter ĠSplit Mode ĠSplit PatternTokenizer Actions Resource Ca AQQ Issue NotDefined bes selj yi Xy г Ñĥ quick check quick ref quick sort quick helper ĠMIN OR ĠMIN US ĠMIN LP ĠNv Error Ġcombination Sum Ġcombination Probability ĠNormalize Integrand Nx M cus o ب Ùħ ب ÙĪ isa Äĩ ĠPDF Parser Ġleaf let ãģŁ ãģĻ ãĤ¤ ãĥ³ãĥĪ Team Form åIJĮ æŃ¥ Ġpolygon Idx World Transform '+' \ '+' -'* kh mer mor let mor eland por tia eral a Ġdos n Ġdos age Ġshader ObjectTypes Perf omer Ġ-------------------------------------------------------------------------------- --- Ġ-------------------------------------------------------------------------------- -------------- Ġ-------------------------------------------------------------------------------- --------------- qi ang uá» Ľ vit b æĥ ± æĥ ¹ Ġcancel frame Ġpie Chart Ġ"^ [ Ġ"^ (? Ġrestore Count Ġemb data ATTT GATT ĠNor wegian Ġalter Add Ġ.... ') Ġ.... ... capit ol serialized ATN drug target Ġlongest Palindrome åĨĻ çļĦ им ен им еÑĢ Abstract Application ĠEdge Lines ĠDirectory Names ĠFailed Predicate ĠFailed SystemCall Best Models vlan Trunk recent Points Ġmal colm ĠCore Config ĠCore NLP ĠPos ix ĠPos ição ='./ '): prox ito ĠML KNN chem ist chem graph âĸĴ âĸĪâĸĪâĸĪâĸĪ ĠTransaction Normalized >{ }, Atom MappingDict VP USH Ġcau chy Ġnc file Ġnc client Ġnc pl tell ing Ġconver ta ĠPur ge Ġtexture Offset Logging Context ப à®± Google Net Neg Mask Ġcipher TextFile Black ListedQuestions GU AR GU CC HASH ES HASH KEY HASH DIFF RB w RB AR VOL ATILE cz P cz d dO x eti co xW LB determin es Ġff std setype s 2457 84357 Ġnotify Control æĮĩ æķĻ Ground Withdrawal Ground Phos SOL TY cD CS cD gd ج Ú¾ Ġ------ " inn amor Ġgg DNAs Ġdeclar acion reading Type Callable Registry Callable ParamRegistry Ġvoice box INTERVAL S ìĹIJ ê²Į ĠIECore Maya Git Habit MASK ING Words With pq Sk Ûģ ÛĮ ìľ ¡ Ġtok endito Ġmemo list Ġenvi ados 100101 010110110000 aste lo ĠJOIN ING ãģª ãģ© Combin es Tags List ĠTool InputFile ĠTool OuputFile squares GroupedByInds NORMAL ISED Cli que cnbtc Que cnbtc TradeQue Ġ'& . ĠPlay books ĠMode Baseline Problem Adapter Problem StateTrap TestModel Select TestModel Alter çĶ¨æĪ· è¿ŀæİ¥ æĿ¥ æŀĦéĢł 解 çłģ 解 æ³ķ AUTO UNIT Cri ança Play Sound Play Pause PERSON NEM San itizer nT t nT ank ªółģ ©ółģ¿ arb our Ġslack bot Ġ:- ) Ġthink plot 0257 064 ISH IRING Commit ed ĠDeep lab ĠDeep Learning Ġfood Pos ({}) ^ +"\ ");") bib code bib number ¦ółģ ¡ółģ¿ ¦ółģ ¬ółģ¿ Æ° i Ġ× ł Ġ× ¡×ķפת Ġdecla res Ġmel bourne ĠREST Client Ġcoef ficents associ ator ĠInformation al Ġcompressed Data Ġcompressed Code 858 04 Ġcorr fp playlist Items ок о decision sToDFA decision ToState GRAPH JSON Structure View Ġveh Desc equipment class æ¯ı ä¸Ģè¡Į æ¯ı ä¸Ģå¼ł SHE BANQ gender izer vgg net }- {}". éĥ½ åĪ° ĠSG AINS Ġ}} """ Ġ}} "> ä¹ĭ ä¸Ĭ Ġpoll ID WebKit FormBoundary 页 æķ° 页 çłģ xr ff Ġà ¾ Ġà ĺ Ġà ľ Ġnan op ĠSan to ĠStack Trace ĠRob ocorp ENC ESCREATE Coord System 101011 0010101 Beam Search æĶ¹ 为 '; '), FULL DIR GTT C GTT AG GTT GCT GTT TTTT Ha W Ha q TMP NAME dN ative hass io س Ùħ س ØŃ Ø³ Ø® å¢ » æ£ ® æ² ¿ Ġdom ish Ġdom blk Ġdom ÃŃnio ĠScript Item ĠAda max ĠHas htag ĠHas ColE Ġcompress ive Ġusd Material Ġб оÑĤ Ġб ал Ġб аз اÙĦ Ùĩ اÙĦ Ùģ 好 äºĨ 好 äºĭ 585 1589 586 857 Gra pe Gra des Gra sped HS IC NY T NY PL Zone Names ban co mI tr Å¡ Äįe Ïĥ ᵧ Ïĥ ÏĢά Ïĥ μαÏĦα é» İ Ġspark ml Ġspark tk Ġhi per ansible testvcn ĠGen ie ĠGen Task Noise less ĠParser ATN он а Subject s Subject Type Subject Map Subject Confirmation Subject Locality 该 æłĩè¯Ĩ 该 çĶ¨æĪ·çļĦ 该 URLåľ°åĿĢ ĠGeo coder ĠGeo spatial ĠGeo jsonPointItem MenuItem Id Capacity Units âĸĪâĸĪâķij âĸĪâĸĪâķijâĸijâĸij FX Inverter Gw MA fps Single gis mo milli sec Ġpat ID Ġpat rol Ġdrive se Ġmult s Ġmult ado weak ly expiration Date {}: {}'. POOL DEV LIGHT ING åĪ« åIJį Prediction Outcome å°± åı¯ä»¥ å°± æ·»åĬłæķ°æį® Ġèİ·åıĸ SQL Ġèİ·åıĸ æľĢæĸ° Ġèİ·åıĸ çĶ¨æĪ·ä¿¡æģ¯ Bro j altern ates altern ating Ġdm utils Ġdm ubar Ġwind LE ĠAL SO ĠFit bit ĠLang Type shard Count Ġorient Controller OPEN CL ratic ule Nav bar Tw ident Tw ython Vs ersion fT z gif ts Ġrom Var Ġsl urp Ġod abir Ġom ist ĠPlatform Package ĠGu o ĠHyper band ĠHyper Parameter ĠHyper geometric ĠHyper Leda novel full novel spread ABC DE Primary Key Primary DefList åįģ èIJ¬ 677 08 Fg E Kx SL Plan et Plan Args Rq MR VB IC oh ui tst X uls ory setIndex Func ĠCRE ATION ĠCRE DS ĠCRE ATING Ġ\' {" Ġ\' {}\ Ġ\' {}\''. 011101 0011100 674 9600 ãģ¨ ãģĹãģŁ ãģ¨ ãģªãĤĭ ав иÑĤ ав ки Ġaligned Points ĠRoom Image ĠRoom KeyRequest ĠRoom StreamToken 538 2 Ren amer Solution Loop ÏĦ Ïİ Ġig xml ("* : ĠCli ques CTT CA CTT GA CTT AACTTC Ġopened File TRAN SI Shared Key Shared Library Shared Secret Shared AccessAuthorizationRule Shared SystemMemory Signature Serializer kr kbipscraper Ġepi demi ĠAC ER ĠAC CL para fita Ġham m Ġham iltonians Geo code Geo Country Detection Point inherit file Ġbroken axes èĩªåĬ¨ å®ļä½į èĩªåĬ¨ éĩįæĸ°çĻ»å½ķ Annotation Config 599 2 MATCH ONCLIENT fu ori Ñī о Ġcatch er Ġcatch ment adm ica 000002 00 ĠMET S ĠMET RIC ([^ , UNIT ER Ġphy cas ĠForward Kinematics Disable RFC Distribution Wrapper .+ ?) RK PR hor st ĠRaw Data ĠRaw Message ĠRaw Result ĠRaw Deletion ĠRaw DescriptionHelpFormatter ĠRaw StorageMode Ġspeak later strict ly Chunk ing specified DateStr Trigger Results éľĢè¦ģ ä¸Ĭä¼ł éľĢè¦ģ å¡«åĨĻ 402 22 YT Qa Za WF ben nojoy fL s gle ason pat role rus sell suggest s ë§ IJ ë§ Īëĭ¤ Ġ":" + ĠFra ser INS IDE SEG MENTED axi om Ġatualiz acao tagged Validators UPLOAD LIMITS Health care integr ators Ġscrapy d å¦Ĥæŀľ æĺ¯ Img ur flt Global qK y 0005 9896 0005 18528 ĠTE HTÃĦVÃĦ ĠSite Stat ĠCase Accessors ĠCase Folding servo Ear ĠPop over Ġclassify Model Deep Key Deep ImageWriter IOS cheduler æīĭ ä¸Ń thresholds ByDetector (':') + ãģĻãĤĭ ãģŁãĤģ 设置 æĪIJ Amp R Need ToReconfigure VL DR nat urale Ùģ ÙĦÙħ Ùģ ÙĪÙ¹ Ġsit n Ġsit atlar Ġwiki quote divide s ĊĊĠĠĠĠĠĠ ĊĠĠĠ Ġly ing Ġconj uncts ĠFeed Group 01000100 010001111 01000100 1100001001 CRAFT ASSIST 空 åĢ¼ 空 çĻ½ Hy P Hy steresis Mj g uan ia uan za ativ ado unix Time ĠSeri alized ĠSeri alizers ĠFri ction Confirm Total Confirm ationType Ġprec autions oku Wiki Ġsolid ity Ġgoes Through еÑģ Ñĭ åıĺ æµģä½ĵ Ġìŀ ĺ Ġìŀ ijìĦ± 001100 010001000 太 大 Ġsmart noise 00010000 1111110011011101 åºĶ 为 Asset Loaders Django Translations Django FilterBackend Fx k Fx n Jp Op Mg R NER Tagger UX HEAT cad air cad ene prom o prom ising uẠ¯ uẠ± uẠ³ uẠµ uẠ· wy er wy chow wy ższy || _ || ** stan bul ĠCamera Intrinsics Ġrpc api ĠMissing Required ĠMissing Extension ĠGra dec ĠGra bbing 468 22 TRACK ML ĠTesting Config packed Point Adv EMDpy åħ¨ éĸĭ External Tool External LoopbackTest External NonContainerDatabase Unicode String Unicode Hex æŶéĹ´ è¦ģ ĠMemory File Age Care EZ PROXY Sy SQ Sy nthesise ]** (- cO HE Ġê° ķ atile Image 0003 8992 Ġintent os ĠHash ing ĠHash Permutation ĠHash Permutations Ġmanip ulator ĠVerify ing Family Id Hard t Hard Disk Hard Sigmoid Hard LinkNum PAY PAL osc ap Ġty pos ("~ "* dirty FDF Ġintersect ing Ġë° ķìĬ¤ ç»Ħ æĪIJ Ġestimated NoiseMap wrapped UuidGen Ġdiagonal Difference ĠExecute Preprocessor Bg MM Ter razas iy or ila pi Ġ(\ *|([ Ġwerk nemer els Ã¥ ĠSele ctiveKeyRestoreOperation ĠCy Set ĠCy Jtag fork server Ġdead lock Ġxp Array ĠRate Limited ĠGR ASP ĠVal entyn speak TextInfo cats List ĠValues View 0100101 0010010101 ço is Ġcleaned Sentence supports Interface contours Filter Ġcorrection path North ampton oF os tup la youtube VOS čĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ čĊĠĠĠĠĠĠĠ Ġodd ly strand Orient ĠLat ency ĠProtocol Error ĠProtocol Specification Shell ys Shell Command Original FollowerNum ĠQuestion group Est afeta ZI PL aW QiOi rss feed sma shing æĦ ¿ ĠÑĩ еловек research gate Ġcad ences Ġcad CAD Ġcad áver Ġmedi ans ĠWatch dog ĠHo ch ĠHo oks ĠQU AT ĠExperiment Point ãģ¾ ãģŁ ãģ¾ ãĤĬ Topology Component Topology Changed Blend Operation Blend Func HIGH BROW IQ J Rank ed Rank Map YW l vw ap Ġdeci bels Rep ai ĠRect angulo ITOR IES neutron client portal Login Ġskin list Ġskin ny Manifest Error Ġpacked Point ĠDateTime Parser ĠDateTime Picker çīĩ 段 ĠMetadata Mixin æĸ¹æ³ķ éªĮè¯ģ æĸ¹æ³ķ 模æĿ¿ æıIJ é«ĺ DST PATH DST OPTS who Can Ġsob ie Ġ185 2 Ġ204 9 ĠSte em ĠSte wart Ġcoin base Ġcoin cident Article Title ĠArticle Info Ġprimitive Info Adj ective Precision Quantization Precision DecimalType General Category Ġjournal ière ĠNumPy Net Ġæī ¹éĩı ĠGraphQL String ĠGraphQL View ĠGraphQL Float ĠGraphQL Boolean ä¼ļ æľī ä¼ļ åľ¨ ä¼ļ èĩªåĬ¨ ä¼ļ 导èĩ´ Packet Format Packet Rate Ġguar ded Clip Sampler Mal ta Micro scope Ny M OZ z Rad raster Vl Z dB aggingClassifier Ġ214 7483648 Ġgy ral Ġgy roscopic Ġgy psy amin ont Regex p ĠNV Me ĠNV API replay ed Building Block Learn python 33333333 3333 33333333 334 33333333 333 audit Info BIND TODEVICE GM DS GM CObjects Sal em Sal do Sal ário Square Idx invest or Ġ================================================= ==== Ġmr na esp I esp lice esp tool ĠAsync IOScheduler focus LastFocus 0111011 011 ĠStatic Maze ðŁı´ółģ§ółģ ¬ółģ ðŁı´ółģ§ółģ ¢ółģ ðŁı´ółģ§ółģ ·ółģ Dispatch Prefix Ġpopup Menu ĠTopic Node ĠTopic Arn RAT IC Under line snow LE snow board â nd åĸ Ĭ ìķ ¡ Ġbt list Ġbt ns consum o States AndTrace Ġrad util Forward Delay Forward Kinematics Forward Declarations ä½į åĢ¼ Blocks Response Market Supply ĠEdit ra ĠEdit Areas 并 æıIJ交 æ¯Ķ å¦Ĥ scratch dir QT qc Vm HostIp xFFFFFFFF FFFF increase Energy 00111 00000100 isk ater Ġexe time Ġalgo Analysis ROW ID BLUE PRINT ĠAlpha Go Ġcentre ID Visual Alert ĠHeader Size ĠHeader FieldTypeError Secret ResourceProperties Secret ToPodLinker "$ ( 495 9 495 0117696 Os Type eigen val iq VC jh j }| } }| /( }| (?:[ regs istered semi ology semi covariance Ġtissue Testing lik ad Ġbet abin ĠSC ENAR ĠMod ul ĠEnt re ĠEnt ropia AGA ACAACT ĠArch onView 9999999 3 Central Dir Central Moments Ġsquares GroupedByInds è¿Ľè¡Į çĶ»åĽ¾ Ġgrammar FileName GCT AAC GCT ATACT Ġnib p Ġbx common ("@ ")[ ĠMc Gu Ġvl cp Ġvote LogTrx 054 88 054 98 ĠProgress Log Contents OfFile ãĤ¿ ãĥĸ quiet er 客 æĪ¿ Embedding Inferrer 转 为 转 åıij 转 è½½ Ġrgba Data )[:, : 417 27 706 86572 Sem imajor bW Jlci sit n sit uations whole File zn O ĠÑĥ д ĠÑĥ Ñħод ĠÑĥ знаÑĤÑĮ inode s lov acco roment Vars thinningThingProducer E thinningThingProducer F Ġgi riÅŁ ĠAmazon as Ġhor Headers Ġhor rible ĠLock ed ĠLock time Ġroc ch 080 933732 COPY MESSAGE COPY PATHS ACH AT ĠJava Field Physical Point ĠRoot Bank ĠRoot ServersNet åı¯ä»¥ çľĭåĪ° çŃī ä»· '< [ '< .*? 092 1 492 54 Plug board Scan Order TB ang TB Meters æĵ ¡ æĵ º æĵ Ħ æĵ Ķ æĵ ļ ë© Ķëī´ Ġul ps Ġfr max Ġfan tastico Ġindx m Ġindx p usd prize ĠFull Connected ĠWOR KS Means Denoising Ġusr pass 家 åºŃ ĠActivity Log ĠActivity Context ĠActivity Member LAST PERIOD ä¼ł è¾ĵ BAR CODE Dy lan KK KK Sparse Driver Sparse CategoricalCrossentropy kd Tree vZ V voc base voc bases reci ation reci ver reci procitylabs Ġdz data Ġdz psf Ġhot key Ġhot word Ġhot fix former PreTrainedModel ĠHost s ĠWeight ing ratios pectra Phi los Evaluation Results Macro Name ç³» çµ± 596 1503 KG goAAA }[ +] }[ *] áħ ¢ pex pect Ġbc deter ĠClear ing ĠClear Active ĠElect rodes ĠElect ronic ĠRa fael Ġcalib re 天 èī² 天 æ°Ķ Ġsmallest Size Double EG Double Buffer æį¢ 为 æĢ§ åĪ« picture Enhancer ä¿®æĶ¹ 并æıIJ交 310 48 Fast Speech Fast GFile Ji Q Ji ang Kn ife RAD II SQ SC UF dX dZ dU ÏĢ Ïī ÏĢ ÏĮ âĪ ¨ Ġ---- > Ġche mistry Ġ197 1 Ġ197 2 Ġ197 9 thr sh Quantum Package Quantum Black Quantum Calibration å¹³ ä¹IJ å¹³ ç±³ 597 1 Js Parser Mc On Mol Sys èĪ ī èĪ į Ħì Ľ Ħì ¹ĺ stroke Color enci ais Ġtweepy s Ġcrash reports Ġstroke Weight Ġvid list Ġvid mode Ġvid cap Construct ing Construct ListOf Ġkv pair Encryption Type Encryption Settings PECT IVE ĠProb Rules ĠProb Lexicon Ġsupply Temperature Alpha Centauri Tech no Tech nologies Docker Image Em ulation bos on jitter x jitter y lv q mscModVcs Add mscModVcs Call mscModVcs Acc mscModVcs IntOpt mscModVcs NetworkId wal dur was Sourced Ġcour sier Ġcour tesy Ġdog pile Ġbio info Ġbio informatics Ġbio imageio Ġbio diesel ĠAir lines ĠAir plane Ġher ramienta Ġdele ter Ġexam ines ĠRad iaSoft PIX SCALE PRINT ING æľº è¿IJè¡Į 999999 79 ĠSTATE MENT 管 å¾ħ è¿Ļ个 å¼Ģåħ³ è¿Ļ个 URLæĺ¯ Ġmkdir p dol or dol ar hY WF pure es pure storage è³ ¢ è³ « è³ ľ íĬ ¼ ====== ") ĠPa ints ĠPa ÃŃs Ġxb bo REL DIR REL ATIONS overview Text ĠThird Level ĠBool Expr Tracker TFP Tracker MaterialAnalysis ĠNormal isation Ġoccup ies Ġoccup ancies Media Swapped Ġbinding path 598 9 598 0702 Pat Algos dent ro Ġcnbtc Que Ġshelf Idx uns ized Ġbir ini ĠScore Ref ĠSSL Error ĠSSL Context Ġga intable Ġstamp ed Ġyaw DMP collapse Summary collapse Trigger Indicator Comment ĠGRO UND Ġencrypted var Station ary Station ZO 000000000000 11100 1010100011 000000 ãĥ© ãĥª ãĥ© ãĥĻãĥ« ãĥ© ãĥ³ãĥĢãĥł Ġtrick ier Soft wares ĠâĢĺ [âĢĻ ĠâĢĺ ]âĢĻ æŁ¥è¯¢ è¯Ńåı¥ áĥĶáĥij áĥĶáĥijáĥĺ FU o FU signal JR AL JR QK Lh MD lls g Ġlic z teacher count ":{" _ ĠPick ing ĠPick les ĠPick lingError Ġprox imal Ġprox ied ĠVolume Liquid Ġlisting local ĠHigh Level Ġdigest mod ĠInventory Entry Ġspot seeker CLUSTER ED CLUSTER BACKEND Ġutiliz ing ãĤī ãģ£ ĠìĹ Ń 00000000000000000000000000000000 000000000000 00000000000000000000000000000000 00000000000000000000000000000000 ĠTimeout Expired Behavior alRTLIR Swap Strategy Swap MemoryTrap éłŃ åı£ áĥĺáĥ ij èİĬ éĻ¢ Ann ouncement DG MG Flt Clock Flt Filt PRES ERVE Saved Width Saved Height Saved ModelBuilder iw nlp iw WC jw Y ÐĴ аÑĪ ÐŁ еÑĢ ÐŁ олÑĥÑĩ ÐŁ аÑĢамеÑĤÑĢÑĭ èĦ ij Ġpode mos Ġauc list Ġesp tool ĠVER BOSITY Ġtraits ui subj list DataSet ModelSerializer à¤Ĥ ", Backup Day Ġgrade Actions ĠMySQL Client ĠcdbpLocal IpAddress 592 997 595 769 625 035 625 2900 Drive NetIcon Maker Notes SEND FILE north west ù a ù i ('\\ '): ('\\ ','') ('\\ ')[- ĠAmeric as ĠPlan ck ĠDim orphite Ġmed als Ġmed ida Ġmed filt played card Ġidxs bx 101111000101 001001 Ġbullet X æ°´ æ» 0001010101010011100 101011 /- / Cp wVc GLOBAL NAME jt alk åĭ ¤ åĭ ¾ åĭ ĩ éĴ © ĠCOR BA shadow Link dfa ust DET ACHED ĠExit Point MALL OC 1011011011 0000000101110 ĠLogging Exception å¼ķ ä½Ļ Serialize ToDoList ĠctspDef SwStatisticsGroup ĠctspDef HwStatisticsGroup 100010000111111 001000 62670934 87 Cam adas Emp loyment Ptr Errs jac r udf ul èĤ ¥ sea file lad visor Ġhint List ĠPRE PROCESSING express ao Ġjet zt Inventory AccountWatcher aked on Ġacl content Seg Evaluator displace d ĠComm unities ĠComm Care Examples Directory ĠAsset Type æİĴ éĻ¤ 0010101110011111111 11101 模åŀĭ è®Ńç»ĥ 100011111010000 10001110 10111011010001110000 0100100 486 1 ELE M ELE VATION Veri log Veri fique Veri ficar [^ * easy ops easy Science mgr state soc re vR p Ġcry spy Ġft nt lift ed ("__ ")[ ERE QUEST ĠRt DB TTT CT Organization Group snippet compiler Associ ates Matcher Data Ġannual InterestRate Ġannual CostsReduction rgba f Ġdispatcher Instances Ġemoji count Ġemoji Mention GCELL IDLE JWT HEADER JWT AUTHENTICATION cT id cT uT fault Type fly e Ġtls v Ġtip i Ġcdf Beta intro duce intro spect ('> ......'), ĠCC X ĠFLO P ĠFLO Ps quant Dict Ġhb ldh Ġmeth ionine latin um latin English auction Parameters 989 857 ил ÑĮно Generic JSON Generic Phase ад ÑĢеÑģ Ġfasta parser Ġsecure ly Ġsecure crt Scaling Model 缮å½ķ çļĦè·¯å¾Ħ 缮å½ķ åĴĮ对åºĶ 0011100010111110000 010 ĠContainer Properties ECT L ECT S Ethernet Cards Week Data ë³ ´ë Ġcg pa Ġfft convolve Ġreact ome 92154 1801802 Ġko lay Ġko ef Ġko ÅĦ ĠInfo Declar ĠInstruction List AGT ATAG AGT GCGC 778 64 ĠStat ify Unexpected ly bottle prefixes bottle brominations åĪ© çİĩ æķ´ åºĵæĿĥéĻIJ åħĥ ãĤ¿ãĤ¤ãĥłãĤ¹ãĤ¿ãĥ³ãĥĹ Ġproportion ally 01011111110000 100011 ĠPhone Repository Destination IpAddress Destination IpPrefixLength Ġideal point 00111111100011 0001111 )< " 412 23126 Ew mg FZ r Pure Path Pure Notefield PID ER PID Status Va ata Virtual ID Virtual File Virtual Device Virtual Link dJ db fre ar fre quencey Ġrid ing Ġida des Ġdont break adverti se chore ography ĠSu curi ĠPr inceton ĠPER MISSION ĠPER MITTED Ġexif data Ġexif tool ĠRF SException Ġtrajectories SortedBy ĠParam Desc Based Cache Ġblur ry Ġautog rid Ġautog alaxy ĠCOMP UT ĠCOMP RESS Ġplaylist id ç½ij åħ³ FUNC FLAG å·² åŃĺåľ¨ Ġspike metrics 11101101110011 101111 499 1 584 2 838 26257 Bank Stab Cg Q bis ch bis que catch er catch ments Ïģ ί Ø´ ÙĨ Ø´ Ùĩ Ø´ ØŃ Ø´ ج Ø´ Ø® çĬ ¬ Ġcn ti Ġwish list ('| ')) ('| ')] ĠSuper Expr ĠFactor Max ĠFactor ielle ĠFactor ioCalc Refer ències Ġallocation Table Ġ|\ _ Resume Move blk size Shuffle NetV 010001 011011 010001 0000000000 Intersection Index Subscription Type ĠLogisticRegression CV ctspDef SwStatisticsGroup ctspDef HwStatisticsGroup ĠWorkflow Factory åĬŁèĥ½ APIè°ĥçĶ¨ å½ĵåīį çĶ¨æĪ· 688 1 CPP M CPP FUNCTIONDESCRIPTOR Np vl Ten nessee Vg MB mus cle mus culus Ġhd us Ġhier achy Ġmaintain ability \\. \\ Serv os Serv Action ож ие gestion soci Ġìķ ŀ à®± ப ĠQuantum Instance ĠQuantum Computer Estimate Key ĠBucket s å¼łæĺ¯ èº«ä»½è¯ģ人åĥıéĿ¢ å¼łæĺ¯ èº«ä»½è¯ģ å¼łæĺ¯ ä¸ªäººæīĭæĮģ身份è¯ģ人åĥıéĿ¢ å¼łæĺ¯ ä¸ŃåĽ½ä»¥å¤ĸ驾çħ§ 484 1 Che ese Che byshev Che yenne JB KR NX OS ZG QE frm ts hero es hero Sprite hpnicf VoiceInterface wide vine Ġdol ore abb age ĠAF FILI Ġvin Field Ġvin Tuple Ġproof read ĠInstrument Identifiers Company APIClient WSMan Close ĠOrgan izations å¤ĸ 驾çħ§ å¤ĸ æİ¥çŁ©å½¢ longest Ones è¿Ļæĺ¯ ä¸Ģ个 #============================================================================== # ĠCharacter istics ĠCharacter LevelCnnModel GATEWAY S 10010111111101011100 110 093 75 504 3 603 3684 Ty Z jq d nE U olog ists olog ia ĠEST Ãģ Ġ../ % orB asis dee ppink Ġson o Ġson Lib ĠPOS form ĠDrop shot ĠBa sel ĠBa um ĠBa iley RELEASE PARTICLEINDEX ĠRemote Project Ġsubscribe Camera direc iton åı° éĺ¶ ĠForce field ĠForce Run WORLD LINE éĢĻ æĺ¯åĢĭ ĠExternal Type Ġxytext A Voxel GPU Voxel Library ãĥ¼ãĥ į pronoun s 497 9 797 69 834 142 Hero StatGrowth MIDDLE WARES SPL ASH Ġart s orbit number anz as Ġplate Charge Ġ"& ", Ġbor da ('~ ') ĠSSH Runtime Reminder Request Ġresample s ĠVari ants Ġanim StackIdx Proposal DurationInHours ĠcdbpPeer StorageType ĠcdbpPeer PortListen 0010101001 0000000000011 Archive Info ä¿ĿåŃĺ æķ°æį® ä¿ĿåŃĺ åľ°åĿĢ '(? :\ Amazon as PAN ASONIC pom mern allo ther Ġpal at Ġpal abras Ġpix data Ġpix ette Ġbam files Ġwest HemiRect Ġgreat ly Ġrw OutName Ġrw randomstart Ġsex ual pyg df ĠBi LSTM ENUM S ĠHead s astro pedia optimal count Ġstatistic ally WORKER TYPE Ġartist ft é«ĺä¿ħ åľ¨ é«ĺä¿ħ åģļ å¯Ĩçłģ ä¸įèĥ½ Ctrl Sum Mail Address Sep Conv VQ D VQ SHL VQ DMULH VQ DMULL ëł ¨ izz are ĠSi amese Ġgender Dict exam score Ġ312 55 ĠMIS C oso vo ĠRET RY 0800 08 Ġshot Submission Ġdialect s audi odb 9627736 29908 ĠSubject Confirmation ĠSubject Locality åĽĽ çĻ¾ cdbpLocal ConfigReset cdbpLocal ResetTime cdbpLocal StatsTotalUpTime Ġsvg dirpath ðŁı´ółģ²ółģµółģ Ńółģ ðŁı´ółģ²ółģµółģ ¡ółģ ðŁı´ółģ²ółģµółģ °ółģ ðŁı´ółģ²ółģµółģ ¶ółģ å¢ŀ 大 Foo Car Ik F Ik Handle QB EE QB FEII Stri pe Tot ally Tot ErrSecs TLS v hyp sklearn è°ĥ èĬĤ Ġá reas Ġtaxon Id Ġsoc faker Ġwy kop Ġwy ÅĽwi made Flag Ġprot ID ĠBro oks ĠGpu Tri ĠGpu ArrayConstant Consumer Name AREA IMOL popen Executioner ĠJS Complier ĠProxy Router ĠProxy Fix Management Error Management System Edges Between Character istic Character DesignId ĠObj ectives íķ´ ëĭ¹ íķ´ ìĻ¸ Retry Rate Retry IntervalInMilliseconds ĠMerge Digests Ġadjacent Diff 685 667 PX WW cds xmatch С ÑģÑĭлка ĠÙħ ر Ġaw ful Ġaw ake Ġaw scam ("$ " ("$ "+ Ġprovision al ĠEast side ATER ESPONSE neural network Ġallen act 主 é¢ĺ 主 åºĵçļĦ Too Large GetStatus Approach ãĤĬ ãģ¾ãģĻ ĠMemo ization ĠDEV ICES ĠDEV NULL ĠWhite Noise Ġclause cat å®ļä¹ī çļĦ ĠTwitter User æµĭè¯ķ æĸ¹æ³ķ模æĿ¿ 657 029 Flatten BatchNormDropout Known Value Music Track Music Url Music Player Oi hh Vt Mapping pup ut pup ils sap m zG c Ġfm client Ġschool Data Ġmit xgraders Ġmist akes Ġmist aken asp loit ĠSTE ADY ĠFake Context ĠFront ExtractorOp ĠDa vide ĠDa Vinci Repr Def ĠBridge s ĠBridge Agent ĠBridge Optimizer substit utes filler K Ġowl ready Ġradial axis Assign Sub hydro graphy cdbpRealmMessageRoute Index ĠKeep Alive MULTI PLY ĠfltStmt IpProtocol Purchase PlanArgs 没æľī 以 Arc Color ĠÎ º ĠÎ ĵ Ġcss Constellation Ġ"** / Ġ"** ", Ġ"** ") Ġ"** /* Ġaf firm Ġey ed Ġey etracker Ġeast HemiRect 0102 144769 Ġ*( () Indices WithLayerElements MASTER METADATA Services Response Services Credentials ин е ин Ñģкий åı³ 侧 Ġdirty FDF à°Ĥ ', Ġlegacy Modifier Restore User Restore Default Ġzope Password ĠCentral ity ĠXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXX ĠXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXX ĠDimension Error Air craft Ada ir Pas sengers SMS Server SMS Password SMS Username WG KV Wind ing Wind Farm skeleton ize skeleton ByNode Ġcron job ury at Ġbob spassword Ġwide ly ĠCUR SOR ĠCUR TSIES ":[" $ ":[" . Ġdeco func Ġdeco upage Ġdeco defunc ĠDiv a ĠMail ing ĠMail Sender Inc Rate Ġencrypt ing Join Chars à°ª à°¦ Ġcaps ul credit card æŀĦ æĪIJ organism IGV æĢ» åħ± æĢ» 容éĩı PRESENT ED BK GND BUS CO Don ation Dst T IY Rw Lang s Lang Types Mig rated burn t nsp r nsp ats vX t Ġ(): (' Ġsched ulers Ġ(# ) setColor BridgeLamp ĠTr inomial ĠScan Bunch Ġliteral Names ĠPas sengers ĠPas sthrough Ġsocial network аб оÑĤ Before Store åѦ ç§ij åĽĺ æĿ±äº¬ ạ o ạ u Relative Ranks Ġbuffers z )^ ( /{} " 686 2 CAM ER CAM PAIGN CAS s Focus In Sl ur gar min gar cia gro ovy plug ged tB enchmark trend ings Ġets pecutil Ġhom ography poster ity ĠPiece Color ĠMesh Clust Ġwithdraw n ĠBri ll Inspect Done Concat Att Contract UriMethod 089 02707208 Proj ek Proj IdentitySpace returned Time fade Dark Ġ!!! ") Ġquant arhei аем ÑĭÑħ PROB LEMS ]+) (\ spectral Index ajax uploader Ġvotes Final åİŁ åĽ¾ ĠWORK SPACE .- ]+ .- .', 699 67 JPEG InterchangeFormat Pen nsylvania Sz r Sz olnok Same Name Same TypeUnaryAggFuncExpr \". \ dum mys hon ba qml file ê· Ģ Ġ"(" + ("' "): Ġran ch ĠOff ers ĠVo vov ĠVo xCeleb REMOVE IMAGEMESSAGE REMOVE IMAGEOPTIONS REMOVE PODOPTIONS REMOVE CONTAINEROPTIONS ĠReply KeyboardMarkup ĠReply KeyboardRemove MOUSE INPUT PLAN ETS ĠìĪĺ íĸī æľª çŁ¥ æľª æŃ£ç¡®éħįç½® è¯į åħ¸ Ġaccident al Related Field Related Tracks Related UserStory Related AWSResources Evaluate Local ,:,:] + #---------------- # #---------------- ------------- 20000 28 Csv Path CROSS REF Vel ho Xl Z YL fb din ero din osaur nD ear Ø· ر Ġcraw led Ġnv db dip not dip loma ('{}/ {}_ ("^ (\ ĠSta inger ĠFixed String ĠDist utils ĠDist ances ĠDist illation ĠMC SCF ĠMis classified trait stone ĠReal m ĠReal time Ġboost Hi THIS DIR ĠParams Of 令 éĥŀ influ xd ĠDesign er ĠctspDownloaded SgaclMappingGroup ĠTransformer Encoder Ġsobre nome *' -') PCT N SCO PER SCO PING dock area jE aj jE Qi qh All rsi DF xAuth Method xAuth ConfigEntry xAuth Quiet xAuth ReAuth xAuth ServerTimeout xAuth MaxReq xAuth TxPeriod xAuth SuppTimeout represent atives Ġcle o Ġcle and Ġcle andoc ĠTermin ated ĠTermin ating Ġrb ac ĠFoo Identifier ĠPC s ĠDele gates ĠNav igableString fov Input ĠWater fall ĠWater Pumping Ġìĺ Ī문 WSGI Application WSGI RequestHandler Scroll bar ĠAuthentication Exception highlight er Neighbors Regressor ĠAssoci ate ĠAssoci ações cdbpPeer IpAddr èµ· åĭķ èµ· æ¢ĨåŃIJ friendly Name ĠDetection Metrics 508 397 613 19159 GF Command Gh ob Half Fix Put ting XM curr cH j Ùĥ Ùħ Ġsales Tax Ġinfra ctions Ġdyn asty Ġdyn atrace Ġmv mat Ġ#---------------- ----- Ġ#---------------- -------------- mak etx opro to ĠSD GraphObject Ġdefin tions excluded ServerNumber ĠDir NotFoundError ĠDirect Object ĠWE ATHER ĠVeri ficar ĠIndi cies senti re ĠRuntime Determined BOOK STORE ĠBootstrap DeployConfig Ġdatum Dic å°ĩ è®Ģåıĸ ĠQuanti ties ĠQuanti zed CFG FILE CFG Fast 常 éĩı Ġcritical Switch ä»»åĬ¡ 管éģĵ RAS R ]==' /': cit ati cit tad eX Bl eig sh eig sigS jz zy mip maps ĠоÑĤ обÑĢаж ĠоÑĤ ноÑĪ Ġ"| ") distr oname ĠTT LCache ĠPM ID ĠPM Context Ġbeat en ĠNext Marker Ġkick back Ġroad runner ĠHam iltonians Ġdivided Fxn populate Indicators Ġcorp oration CLI KEYS swift stack radial Gradient Organ izer Organ iser çĶ» åĩº Ġëĭ ´ TAX ES Posts ByPage combination Probability Principal Panel Ġsymbolic Names ĠASCII ReplyDecoder 488 9 ñ ol Ġortho gon Ġtit re Ġill umina Ġ"=" * Ġ"... / 0006 22708 Ġmas con Ġmas quer Ġmas querade Ġwik idated Ġwik ilanguage ('../../ ../ veh ConfigInMsgName spit z ĠBLOCK CHAIN ĠNull Market Ġchrome os ĠKo opman ĠQual ys ĠQual ification Ġrespond ents pubmed id åľĨ åįĬå¾Ħ ĠNews letter ĠNews Article Ġب اÙĦ ĠdocsLoadBalChgOver MacAddress ĠdocsLoadBalChgOver InitTech ðŁı´ółģ¡ółģºółģ ¢ółģ ðŁı´ółģ¡ółģºółģ §ółģ !@ }') !@ #$%^&* 787 0366 Bs ouvenir VR AMP WP ACT crow din dan ja mad rileno nice ly uV x alex ander Ġprac tices Ġeig val ĠFe et Ġatten dees compact Descr ĠExpression AttributeValues EXTENSIONS MENU )+'. '+ çī© 车 applicant dashboard INITIAL IZED ingredients Priority 483 9 795 374 But te Bias Metrics Dynamic Effector Ignore Count Jack Descriptor Us F Us Iml λ ÎŃ æ´ Ľ Ġremember ing Ġog Message Ġmob ili elp igraph ('^ ([ ĠSyn set ĠSocket Client ĠSocket Executer ĠSnapshot File Ġlan mode ĠAbs orb ĠPl XTask ĠPl äne ĠdeÄŁ iÅŁken Ġunic lass Ġunic orn Ġanno ations compound def Coordinate Transformation Ġquarter TotalAmount Ġquarter UsedAmount Ġquarter AvailableAmount Ġquarter FrozenAmount PROX IES PROX MOX Ġsearching For ам а ам Ñĭл Ġshortest Distance ClassifierIp Table ClassifierIp Entry ClassifierIp Protocol ClassifierIp DSCP ClassifierIp Precedence ClassifierIp EstablishOnly ClassifierIp ToS """""""" ) ĠDelta Zk çĻ»å½ķ 页éĿ¢ ĠAUTO COLUMN ,: ]), ,: ][' ,:], ' Cw SD KM f KM IA Life Noise dS dU fB mV hil berthuang vacc inations wat ts wat contacts wagtail katex ί δ recursion Level eni em alta re Ġ'` -- Ġcot b Ġcot c Ġcot angent Ġpan oramic Ġpil box Ġpres umably urk on urk ana ĠSelf Handling Ġlg block Ġlg win Ġlg mlvq ĠNL Q ĠGreen e ĠoutFile Plot Ġanti aliased 0625 000 rcl Rebate ABS ENT ABS FILEPATH ĠMedia File webapp service ctspDownloaded SgaclMappingGroup LOADBALANC ER ĠÑģÑĤ ен firewall Status firewall Utilities golden set golden Path Measured Error Measured Process æĮĩå®ļ è·¯å¾Ħ Probability Weighting Probability HasChanged é»ĺ认 容éĩı ZipFile Manager ĠTEMP ORARY 1666666666 6 1666666666 7 ìĥģ ìĿĢ #- # 796 52085 Aux Q Aux iliary Aux iliaire Btn Div Cart Cords Gene Reviews KY H Lam ar Qk q Sleep Action gol and ò i ò eo ĠĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠ Ġå¦Ĥæŀľ 没æľī Ġå¦Ĥæŀľ ä½ľèĢħ Ġfair ness cevap lar Ġslide Group Ġmip maps cob alt cob blestone Ġ166 0 Ġ159 1142400000 ĠCard inality Ġglyph Name Ġlu as Ġlu xtronik ĠBR USH ĠRAT IO ĠRich Text ĠRich String ĠRich Handler ĠGi ampaolo ĠGi useppe hou go RECE IV RECE IVER ICON SIZE doub led Already Exist Already Running Already ExistsError ĠRedis Client ĠHealth care из а æĶ¶ çķĻ æĶ¶ çĽĬ æł¼å¼ı æĺ¯ æł¼å¼ı 为 712 150 757 467 Balancer PoolToken Ix WL Iy A Iz vori Iz jave Iz danja Ju gs Occ lusion Rat ings mist ake wtf s ž ev ÐĶ жеÑĢела ص ÙĬ rein amentos Ġimag Part Ġcats List ĠACC URACY Ġhalo struct Ġ386 2259 Ġmess y ATG ACAAGTT Inline KeyboardButton Ġoutgoing Hom ogra fÃŃa Ġalg od REAL TIME polar ization polar scan drawing ml Controlled Type ìŀ¥ ë©´ éĸĭ å°ģ éĸĭ ãģķãĤĮãģ¦ãģĦãĤĭ Augment ed association proxy 814 40 BIO MD Ir rigation MICRO S MICRO SLEEP Pull Requests QH BoxLayout dual tor ì a ì u 馬 åıªè¦ĭ Ġpul p Ġpul sed Ġpul zar fiber bitmask ĠAg ilent ĠDLL ist ĠOPT IMA "]}) ' okc Que okc TradeQue ĠRecipe s Ġdoub t Identi dade Ġinterpre te Ġinterpre ters ĠArg Cb Registration Inline ãĤ¸ ãĥĥãĥĪ Share BuybackAuth PUB KEY datum Dic Ġdifferenti ated ĠPrediction ContextCache ĠPercent ages ĠPercent StyleMultiline PARAMETER LIST KILL S Alignment SummaryMetrics ^^^^^^^^^^^^^^^^ ^^^^") 807 374 Ww Wq XB t wgt q ÐĹ Ð° ÐĹ Ð½ÐµÑĪнÑĸÑı ÐĹ Ð²ÑıзанÑĭ åĤ į åĤ ħéĩĮ ì² ĺëŁ ĉĊĉ ĊĉĊ ĠâĶ « ĠâĶ ı ĊĠĠĠĠĠĠĠĠĊĠĠĠĠĠĠĠĠ ĊĊĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĊĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĊ Ġsdk Driver Ġsrv file Ġrece bidas peed s ("---------------- -----") ("---------------- -------") ("'", "") ("'", ""). ĠSch midt ĠSch uffenh ĠPark way Ġjp ype Ġjupyter ed ĠWrap Erc {}' ". Ġ['_ '. ĠQgs Wkb Logical Not ãģı ãĤĭ ãģı ãģĻ Appliance s å®ī åħ¨ ĠREG ULAR ĠREG ENTS Ġë³ µ Ġë³ ¸ Ġexperimental OCorrect brew ery Ġsvn NetIf Letalis c ĠAllowed Range è´¥ äºĨ Affine Scalar -]+ @[ 607 00 Bh ww Four CC Four Sdk Jx WK Jx WL MAR CO Ns lits ZH SK qid ian uE f ×Ķ ×ŀ íĸ ĪìĬµëĭĪëĭ¤ Ġtu flow Ġpour riez Ġaudit ors Ġsap Instances Ġsap RfcSdkBlobUrl Ġsans Type Ġinvent or Ġinvent ree Ġrent Payment getNode TargetNodeStringList ĠCri cket ĠCri mes ĠCri mson bugs nag AGCT TTTT Ġfilt filt Ġspam writer Ġspam reader 7777 77778 Ġloadbalancer v è¿IJ åĬ¨ ĠAttach ments Ġcreator Type Ġcreator Name Keep ing çķ¶ å¤ľ Ġìłķ ìĿĺ Ġìłķ ëĭµ *: .* SENT ENCES TOR ONTO kJ wuje Ġ================================= = Ġ================================= == Ġ================================= ") Ġic ustays Ġeb last Ġeb Split coher ency dil ithium Ġgw q Ġgw fname Ġgw ots ĠActor Critic ĠLow Rank ĠMini BatchSize Ġproton s ĠBU CK ĠBU ILT ĠBand it ĠBand Path Ġjit Chol dateTime Path phon o phon edit phon ique intern ally Ġnewtype list ĠKratos Mapping ĠKratos Unittest FIRE FOX postal address Transition MovingPlatform ĠForest s ни ка æķ¸ åŃĹ æķ¸ çĽĥ ĠPerformance s ır ı EOF Error Ġè§ Ĩ Forecast er ospf VirtualLink ãģĹãģ¦ ãģĬãģı KeyboardButton Url alternate Identifiers Ġingredients Priority éĻĦ件 åį³åı¯ '# { ELECT RIC ELECT RICAL ELECT ROMAGNET Mobile Phone Ta xa wO By Ġtiny DB Ġelastic ity Ġelastic beanstalk lamb data lamb ert Ġblow fish ĠCM IP ĠCM DS ĠMagic Parser pycuda decon ĠBoston VolumeParser Ġje dem Ġchip type Ġchip Width Ġchip Dims ANN DIR ĠHist GradientBoostingClassifier AGAA UU AGAA UC AGAA AGTA AGAA CTTG EDIT ABLE CONSUM ED åĪĽå»º æķ°æį®åºĵ ĠSimulator Interface å¤į æĿĤ publication Year Currency Code ĠSubmit s ĠSubmit Config åįĬ å¹´ åįĬ å¤ľ 个人 éĵ¶è¡Į 个人 æī« GeV optimized Foot Scale ĠìĿ´ ìĥģ ĠSmart y ĠCatalog ue çī¹å¾ģ çĤ¹ éĶĻ误 å½ĴåĽł SUPER ADMIN 533 18 Bang Bang Mouse Pos Mouse Button Mouse Stuff Rw anda SAS peci VG J Yb FY Yb DZ Yb Va gat k rF ar ë° © Ġ******************************** *** Ġ******************************** ****** Ġ******************************** ******* ĠâĸĴ [[ ĠâĸĴ âĸĪâĸĪâĸĴ Ġik ke Ġik HandJoint ĠfuniIf Established Ġmg lat Ġmg mol ()}) ; ĠTor Request ĠPayment Status ĠPayment Method ĠPayment Txn ĠLu xtronik ĠMS Result ĠMS Results ATCT CAT 9265 12 coln all Ġrobo cop STL ING ĠEnv Spec ĠAnalog In ĠciscoDiameterBasePMIB Compliance ĠciscoDiameterBasePMIB NotificationsGroup ĠciscoDiameterBasePMIB TrapCfgGroup Softmax Layer ðŁı´ółģ´ółģ¨ółĢ ¸ółĢ ðŁı´ółģ´ółģ¨ółĢ ¹ółĢ Human Readable Ped ra RN ASeq kir by qrst vwxyz symb iflow ༠ĭ ç¶ » antes FormView Ġist edi Ġist agged ramp ic ramp Object oph ie ĠPA INT Ġvc cs ĠBang Seq ĠBang Glob ĠExclu ded ĠRay Process ĠRay mond ibi ção Ġroster id Ġshadow List 949 096 874 567 Ġmaxim ise AGTT TC 2337 58036 HOOK OPTIONS čĊčĊĠĠĠĠ čĊčĊĠĠĠ ãĥĩ ãĥIJ ĠChild ren jnxMbgSgwGtp If jnxMbgSgwGtp Mib jnxMbgSgwGtp PeerGw jnxMbgSgwGtp PrDnTPerPrAlrm jnxMbgSgwGtp AlarmStatCounter à°° à°¸ WebSocket App WebSocket SubscriptionManager Conflict ing ĠFilename NodeMap Distributed Object Permissions Error Permissions AccessControl aaaaaaaa aa 缩 è¿Ľ 缩 æĶ¾ ĠSuite Split ĠMyCustomAmazonReview NIPS 589 00 827 25656 Hn vs JY THON Mr Worldwide Offer ing OEE Objects OEE CardObjects Trend Strategy Xp Y jam o jam alogger kle ene react ants renamed ToFilename renamed FromFilename Ġfed SecAg Ġaus ge Ġaus reich Ġadb ID Ġspy ne Ġspy ware unzip ped Ġearth quake Ġ({} ), Ġ({} )\ ĠSparse Matrix ĠShell CommandOutput ĠCl ark ĠFO GLAMP ĠBreak s ĠNested RenameAll ddd ppp lateral Tile Ġdisambig uator Ġdisambig uated Ġminus Minutes ĠChain Map à®Ł à®° ĠNeg ation tello Flip tello Move MapperStatus Table MapperStatus State MapperStatus Entry MapperStatus Resource MapperStatus CmdStatus MapperStatus AISE MapperStatus RxTrace MapperStatus MultiFErrs MapperStatus OOFErrs MapperStatus TotErrSecs CANCEL INCENTIVEPROPOSAL CANCEL RESPONSEWRAPPER ĠATTRIBUT ES ĠATTRIBUT ION 722 43 Ber bice BTS RX QW Table ]+' ",' candle stick junit xml æº Ģ Ġê°Ģ ìŀ¥ rod Displacement Ġcategor ie Ġdomin ion Ġdomin os Ġbatched TransactionConfig ('; '): ĠPixel EncoderFactory Instrument Values 9600 6409 DECL TYPES Coverage Algorithm ãĤ³ ãĥ³ãĥ ãĤ³ ãĥ¡ãĥ³ãĥĪ Managed CustomImage Managed PrefixList Phot ons Phot ography Ġbandwidth s Ġsymmetry Tolerance Fixture ItemField ĠWorkspace Service Bandwidth PortNumber ĠìĿ´ë £¨ ĠìĿ´ë Ł° ĠìĿ´ë ²¤íĬ¸ 1234567812345678 12345678 ĠRectangle Mesh Microsoft AMD 人åĥıéĿ¢ çħ§çīĩ Gal axies GAME OVER Ill umination Ill uminance Por que Ux M VT PR hib it zf dir zf index ç¸ Ľ è« ¸ ìĤ¬ ëŀĮ Ġni vel Ġmarg en ĠSy nthesise ĠSCHE ME ĠPush Button Reward Embed ="` ! ĠEarth quake Ġchk pt Ġchk stab 1976 34169 ĠCondition ally ĠarrayT Index ãģį ãĤĭ PROGRAM ER PROGRAM FILES Charge Controller Downloading Resource lidar msg ün ün ä¸Ĭä¼ł App ãģĹãģŁ ãĤī ð¥ļĥ ä¾Ĩ Gl ue Mid land Mid town Padding FIFOQueue Tal ha ]._ . glo ver tS NE è» Ĭ Ġion ospheric robo corp robo grammatic Ġcra zyflie Ġcra ssus Ġinvest igations Ġdra stically Ġbid ding Ġwl name ':[' _. ĠFN DC ĠDNS KEY ĠMul her ĠMsg Prefix 0200 1909 ĠyPos Loc ĠEigen value ĠEigen values ĠEigen vectors ĠRPC Response 3209 0 ĠHuman Name inputfile Etot Ġshuff les ĠInser ting ðŁı´ółģ¦ółģ Ńółģ Compound AssignmentBody Spider Py ĠFileSystem EventHandler ĠCombine Operand ĠAttr Formatter ĠAlready AliveException Overview Text Ġadministr atively ĠRegular ized ĠRegular GridInterpolator Limits Helper å·® 人 spreadsheet ml æĸ¹å¼ı ä¸ĭ 太åħ¬ åķı 缴æİ¥ ä¸Ĭéĩĩæł· Bio SQL Bio Nano Dri ll Dri bbles Earth Feature Earth Interior GJ T Male Setup Ping Test Rich ardson TPU Strategy Vote Trx Wallet Balancer Yellow Cards cra shed dC dz rar åIJİç¼Ģ rnd o yM JoBB è² ¨ è² ª è² ¬ è² » Ġáĥ ĵ ĠÙĦ ا ĠÙĦ ÙĨÚ© Ġоб ÑĬ Ġоб ÑĢабоÑĤ itz ky 0007 01682 0007 57657 ('$ \\ ('$ '+ quil file Ġhal ves Ġhal acha Ġhal fnhalf Ġya par ĠGrad Scaler ĠWR ONG Prote ctor DataGenerator Cfg Ġserv ant âĢ¦ ' Ġtemper ed Prior itized á»į i á»į eo ĠæŃ ¦åĻ¨ ĠctspVlan ConfigGroup ĠctspVlan SgtRowStatus ={}) '. SUBJECT S ĠUnsupported Format åıijéĢģ æ¶Īæģ¯ EXECUT ED 764 46202 816 57 Assert s Mont ana Natural EarthFeature Pal au Timing Foot WAN Pil ±ółģ ¡ółģ¿ غ ÛĮر ç¢ ij Ŀ¼ ë©´ oro ot Ġtre ys Ġtens ordot Ġ"] ;\ lomb scargle Ġdup lified ctu dir ĠSal ary Ġger çek amd secs ĠPed antic ĠPed alboard ='{ {" ĠDot ty ĠDot Map ĠDot StringsEntry ĠGC J ĠUpper case anno optimize later ale shortest Distance ĠPlots Producer Assets PriceResource ĠByte Util Rotate XYZ ĠJoint State ĠJoint Commands ĠCHECK POINT ĠCHECK POINTS Ġangular axis åĿIJ ä¸ĭ 測 a試 COMPONENT NAME æ·»åĬł ä¸Ģ个 #, ## Far mer LN nz Nb Wh Nb OfTx Ox nP Van illa Zj NZ aJ Q nC z Å© a Å© i ĠER A ĠER F ĠER ASED Ġè¿ĶåĽŀ ä¸Ģ个 Ġè¿ĶåĽŀ æĢ»è¡Įæķ° meg set meg ux meg adriver Ġfer enda Ġnorth ern Ġdh client ĠTorch Trainer ĠTorch Predictor ĠTorch Categorical ĠTorch Scorer ĠTorch DistributionWrapper ĠMor av ĠGal ileo 2727 2727 Ġkeystone auth ĠnumberOf Nodes ĠnumberOf Frames ĠnumberOf Steps ĠnumberOf Interfaces Ġdisco Mode Ġsponsor ship Ġг оÑĤов Ġelev ations Ġlibt bb Than h ĠSoft Butter ĠChunk Registry Submit Cone ĠCompare Methods Overall LSConnState ĠSubscription Adjustment Ġwinning BetThreshold OPTIM IZATIONS æŃ¥ æķ° Digit One ĠâĪ Ī ĠâĪ ŀ) 786 9 Dyn Class Dyn Interface IU PUI Mirror Mode Rock y ]? $', bir atnag bir atchowk hin av nation Idx wine hq Ġtur bulence Ġtur icreate Ġ'~ ': ("================================================ ==============") ("================================================ =======") ĠSpider Monkey ĠLive Lobby Ġdese mp Ġdese ased Ġxpath helper ĠEL MO Ġresistance List Ġtyped py Ġshrink A AGCA UG AGCA ACG ãģ¿ åIJĪãĤıãģĽ ãĤ« ãĥ¬ ãĤ« ãĥ¼ãĥĸ fract al ĠìĤ¬ ëŀĮ ĠìĤ¬ ìĿ´ì¦Ī áĥĿ áĥĴáĥłáĥIJáĥ¤áĥĺáĥIJ Road Runner çĶµ è§Ĩ ĠFlash textBackend Decl Ref Ġbring ing ĠAuthorization CodeGrant Ġrolling cs fabric ation ĠSecret Value ĠOptimization Task ĠAggreg ating æľįåĬ¡ 端 735 991 BALL OON Miss oula Pep ulators Syntax Path SENSOR PROPERTY bel indab Ïī Ïĥη Ðij Ñĭ Ðij аÑģкеÑĤ Ðij ибли Ġpag ure Ġpag ify lai Product ĠCV PR ĠLan caster ĠLan çamento ĠLan diaEnv Recogn ize observ ability ĠGer ando 1415 9265 ĠHard coded Ġscreener result Ġ'-') })", Ġ'-') }/" Ġdistro dict ãĥ¬ ãĥ¼ãĥ sqr thann не Ñĩ Subnet Group Materials Manager Prime Max Prime Transactions Prime Award Prime UTR Flash Test Flash Size ĠPeer Read ĠPeer IdInvalid bibli ographic çĦ¡ æ³ķ ĠWSGI Adapter BRE ATHABLE CLOCK S Hierarchy Tree Middle sex Minecraft Forge Plane Stats Plane Position Rand Idx Yy Mj hdl c ئ Ùħ ئ ÛĮ ๠ī Ġç ok animal Info titan ium Ġperi ódico Ġperi helion Ġmus i Ġmus ical Ġbur ger Ġbur sts ĠSlack ApiError Ġgan bon Ġgan joor toy rnn ĠFIR MWARE ='- ')) ĠOcc upation ĊĉĉĊĉĉ ĊĉĉĊĉ Ġmeld en appe xec appe ars Ġja xboard ĠGO ES ĠWidth s Ġanon link Ġcolon na AGU AA cython ize Ġarrange ment ĠStats Bomb TimeSeries Panel Ġoffers A ĠTyped ListType Ġnonlinear ity ClassifierEthernet Type ClassifierEthernet Table ClassifierEthernet Entry ClassifierEthernet Inner ClassifierEthernet PacketFormat ả o ả u ả y UCg W Ġnaive bayes pearson r Liquid ator #----------------------------------------------------------------------------- # MNOP QRS ĠrlHistoryControl Index Ġlandscape s Combination Algorithm vvvvvvvvvvvvvvvv vvvv ĠOPEN STACK 弹簧 éķ¿åº¦ AIR TABLE Bz r Ej er Ej ecutar FORE CAST Lk S Qj UZ dsp ilt kern ing mL vl Ðļ ом Ðļ он æŁ » ì¶ © ì¶ ľëł¥ Ġ################################################################################ ##### incenti ve anth os 0008 8729 Ġremo vida Ġremo vidos Ġremo vinator Ġble ak Ġbil ly Ġbil hetes tektronix OA etun imi ĠScal er ĠScal es ĠFed Avg ĠFed Learner ĠIV no ester no 9612 8803 COS MOS Idle Time Idle Code Idle Worker åıį 转 Ġ"\" [' autoc lass autoc reate autoc apture à®° ண à®° à®Ļ Ġtraced Stories Ġinvocation Dictionary ĠctspIf SgtRowStatus ctspVlan ConfigGroup Ġclamp ing ĠPostgres Operator Ġد ÙĪس Ġprotect able Ticket APIMixin Aggregate Error #-------------------------------- # #-------------------------------- ------------ Pandas DataFrame Sil va Sil houette Sam uel VD UP gE AgEA ×ŀ ×ķ×Ĵרפ×Ļ×Ķ æ¥ µ Ġا ÙĬ Ġا Ù¾ Ġú ltimos sty led Ġclu mps Ġfram enet Ġinform ar Ġinform ado Ġdip de ('-------------------------------- --------') ĠTLS v Ġling id '][: ][ ĠPeriod s ĠDES IGN ĠDES AFIO Ġvoting policy precip itations Cond or ogen ize ogen ised 0518 51994 Ġident Pos Ġtektronix OA ï¼Ł ', ĠIDXGI Resource Ġmonkey Patch Subset or Subset TransformerWrapperDF PortStatus Table PortStatus Number PortStatus Entry PortStatus Link PortStatus Media PortStatus PortState PortStatus SpdDpx PortStatus FlwCtrl PortStatus AutoNego ĠAppro pri ụ a ụ i Ġhydro gens åĭķ è©ŀ ĠCURRENT S æIJľç´¢ åĪĹ表 '& '], Skeleton s Wake up [/ ] [/ ]?$', aB c aE WM jun tar nF calls udata ptr æħ Į æħ ķ ç¿ ł Ġæķ°æį® éĽĨ decess or Ġpsu A Ġpsu B Ġnh au Ġnh Æ° Ġsist emin urg ia cohort e dise ases otp base ĠTel ler ĠTel ink ĠFer mi ĠBroadcast ing ĠNC CL ĠGtk DocComment Ġkine tics Ġkine matic ecs ke ĠchkpntTrap OID neuro image neuro svn pointcloud npz Ġloser Code Ġloser Mu Ġloser OgMu 2813 1239818 ADJ USTED âĸĦ âĸĪ Ġìĥ Īë¡ľ Ġsmiles Dict ĠLogLevel Response ĠLogLevel Request á»ı i á»ı eo Calibration Assertions Override Provider ĠRegistration Response ĠíĮ ¬ìħĺ æĭ¿ åĪ° SIGNATURE MESSAGES Monthly Income åĮħåIJ« 桶 åĮħåIJ« download缮å½ķä¸ĭ Migration Required ìĺ¤ ë©´ ,... ]. =$ (_ Dhcp Options Dhcp Setting Deriv atives Firmware FileName Jl MB PEN DED QD ab hE Ug sds rc Ä° K Ù¾ ا é² ľ Ġç £¨çļ® Ġç łĶ究 0094 1961 0094 07024 Ġdynam ixel Ġdraft s Ġtoml kit threaded Response ĠSlot MPolar ĠLB aaS Ġdepart ures Ġproble mas ĠBenchmark s ansi string Ġant lir 2263 37 ĠConversion Error ĠConversion FailedError 2633 52 Ġperimeter x Tox icity Ġdocx file mtl novel Ñģп ÑĢав Ñģп аÑģÑĭлкÑĸ äºĶ æł¼ äºĶ ä¸ĥ Pretty TimeDelta è¯Ħ åĪĨ Ġfuncion a Ġfuncion alidades ủ i Ġdescendants Collector ĠкоÑĤоÑĢ аÑı BasicAuth ConfigArgs 页éĿ¢ æıIJ交 åıĺéĩı PATH æĪĸèĢħ ç¦ģçĶ¨ +-+-+-+- +-+-+-+ >- ?\ Ek sterne Nk Y Nor way PUR GED PUR BBANK Pref light eF its glass face oke x pink y ¸ë ¯¸ פ ×Ļ׾ anneal er spr inger Ġvul gatus ĊĠĊĠ ĊĠĊĠ ĠEm scripten pho enix ĠGPT J ĠWind ing 0614 1411 2777 78 fair field fair play Ġzf ec HEALTH STATUS whit en ĠGeneration Utils Manual Cleanup Manual TimeSetting áĥ£áĥ ¨áĥĶáĥ TERMIN ATED yyyy yyyy metas chema æľĢå°ı çļĦ ĠколиÑĩеÑģÑĤв а ĠколиÑĩеÑģÑĤв ам <_| > <_| ;^{;^{;^{;^{ Cod on Front end IPT C Lan tern SLA AC Tar Info Tel ink Xml Attributes Æ¡ i θ εί θ αÏĥ Ðŀ ÑĤ Ðŀ б Ðŀ ÑĪиб èį ¯ Ġcash Flow Ġfq file Ġfq dn Ġsnd Bonus Ġmad lib ĠSam melr ĠCut off ĠCut Strategy ĠImplement ations ĠMD Traj ĠMol erTest presen te presen tive Ġbeg gining ĠEmp loyment ĠGMT CLib Ġ508 62 Ġrace car grav ite grav Bodies ĠHer zegov Ġweird ness ĠInflux Db Ġnewton s ĠPara StorageKeeper ################################################################################################################ ########### Spline Map sdc list Anti derivative Anti Horaria Ġdescendant Cells BRANCH ES ää rin ĠLayerNorm GRUCell ]|[ !*\(\), ë§Į íģ¼ fltStmt Action fltStmt SrcPort fltStmt DstPort BoundingBox es éĤ®ä»¶ åĪĹ表 éĤ®ä»¶ éħįç½® Exploration RightsModel >.* )/ >.* )$', Broad band Rfc Enable Sch utter Sch norr Sch uyler Tho usand nim base β ιβλιογÏģαÏĨ Ġåľ¨ æīĢæľī tik novel Ġplas mas Ġplas TeX 0015 1885 chin ch ("-------------------------------- ---") opti track ĠSide Bar ĠSky borg Ġlk is ĠAUC Metric ĠDy lan ĠDol ores ĠMut uelle ĠBalance Of ĠBalance Sheet ĠUsd Shade Ġenh ances 1817 633709 Ġrob odk Ġopent racing ĠRepresents Float POL LED ToFirst Name ĠDataType Util ĠDataType Converter Ġfade Color Ġfade Params GGG mqooYY éĢ£ çµIJ ĠVertical Flip SCHED ULES ĠìŀĪ ìĿĦ ĠSpectrum Library loidy PlotDir ãģķãĤĮ ãģ¾ãģĻ 698 029 Basis Features Frag Color IAS et Ld Js Margin Phase SOR ENTO Sdk InstallAttempt Tro ves TAL colors grow ing mux ings mosaic Dir oli vier sold List æ¾ ĹèĻİ èĮ ĥ ëIJĺ ìĸ´ Ġ~~~~~~~~~~~~~~~~ ~~~~~~~~~~ rear range rear ranged anh ulle Ġcó lera lil lirier ĠSys BP ĠCached SchemaRegistry Ġld da Ġld Distances spa vent ĠFran çois ĠLot terie ĠDan ach ĠDialog Message ĠBinder NotFound ĠNA ICS readI List ENO DEV chess bot 1834 985 Ġrack ed replication Params ĠConfirm ation 4585 24 Boot Version Least Squares ãĥĨ ãĤ¹ãĥĪ åħ¸ åŀĭ ĠCalc Attrs menuitem radio åįĸ ä¸Ģ Linked In LoopDetected Table LoopDetected Number LoopDetected Entry LoopDetected Action LoopDetected CurrentStatus LoopDetected Resumed LoopDetected StateEbl è§Ĵ 度 ĠPortfolio Lab ĠdocsLoadBalGrp IsRestricted å¦Ĥä½ķ æľ±æѦ Deployment ToHorizontalPodAutoscalerLinker Electric ité ĠEquipment Holder YesNo Type æīĭæĮģ æĬ¤çħ§ä¸ªäººèµĦæĸĻ页 客æĪ· ID æĬ¤çħ§ åħ¥å¢ĥ BID BASKET Stem Pooling Wed strijden Would BeAssigned YD CI bubble s cfn Properties iB log iE Qi kia de qo es uD FFF wake Reason wake UpPins é¾ Ļ ï½ Ķ Ġ**************************************************************** *************************** Ġrebate Expiration Ġbat H ĠTran scribe ĠSho vel ĠSho oting ĠCG emv ĠFC Repo ĠMAN DATORY ĠMAN UFACTURER ĠMAN UALLY ĠMAN AGEMENT ĠMix ing ĠMix ins ĠBill Importer ĠBank note ĠWi ener ĠWi Fi Confidence Bound Ġopens lides Ġaltitude s 9366 31 Ġram da Ġram disk 1906 21 ((? <=\ explode Obj CONV SEG xytext B uniq If ĠCoin base Computer System Ġsaf exl Forbidden Exception ĠLeaf DataList ĠPoisson ElasticNet Ġæł ¼ Ġæł ĩ ĠSTD DEV Ġcaracter isticas Iterations PerEpoch 2167 82 ĠMonte Carlo SYNC DB Masked Bijector ç§Ĵ åĨħ standardi zation ĠUniversal Automatic torque Rod Mismatch Error TABLES PACE Utter State (... )) Elastic ity Elastic Search Kine ctA bab ies bab boon cQ TT gloss is hV qu mother board ÈĻ at Т ек Ġر د stk off Ġ"! "])) Ġ"~ ", Ġnul lptr getApp Config getApp Metadata Ġhab itable Ġdetach ing Ġpars able ĠBon jour ĠBon jours ĠNIC OS 3273 148975 Ġano atual ĠHy dr ĠHy steresis ĠHy SDS announce ments Ġlap se 5708 04 4467 97913 ĠSeg ments 4609 66 Observation Date Observation Expression ãģł ãģĹ stacks Pairwise grat itude Ġbots Online Transactions Response ĠCharge ment Adaptive Mode 产 åĵģ åħ± 享 Ġviv intpy "}} }' Ġastro ML ĠctspIpSgt AddressType Ġescol he å®ŀçİ° äºĨ Persistent DictClient Radio Button Grey Scaled ëĤĺ ëĬĶ ĠTunnel Endpoint TrustSecPolicy MIBCompliances Dns Name Dns Setting Fort nite Mand reel Mand arin NAS Net Tweet Output bys ource fwhm RMSF gio vann Ä© a Ä© u è¼ ķ Ġaver ager 0009 57045 0009 32505 00010011 0000000011 ("------------------------------------------------ ") ("------------------------------------------------ --") ĠSHO GUN ĠSPAR K ĠCam adas ĠCategorical Field Ġhá stafi ĠPoll ForActivityTask ĠLen nyBot ĠLAT EST ĠMiss ouri ĠMultip lic ĠMultip lication ĠMultip lies ĠEE PROM fog lio ĠUr sula Ġanalog ue Ġanalog ous Ġenroll Id Ġprefetch ing 87427 7 9757 84 Ġspaw ning bean count bean ContextSupportObject airmass format KeyValue Array Ġjoystick s án tico Neighbor hood Expired ObjectDeleteMarker bulge Found consider ando Ġsynth text Ġsynth tool Ġê¸ Ģ Years SinceLast funcsynopsis div ĠWaiting ForHotword suggestion Id Absolute Max Absolute Min ĠGRAPH IC ĠCONTRO LS åIJ¯åĬ¨ 线ç¨ĭ BandwidthConf Table BandwidthConf Entry '[\ (\ ."] ' Nl MeansDenoising Pending Panel Rolling Micro Rolling Macro Sed Net Sed AFactor Sed AAdjust cin que fon ti fon do smax P ×¢ ×ij èIJ ¨ stor ia Ġtet ris arri ving Ġih rem Ġner ve addition als Ġwget Results ("... ")) asg op ĠSpo oq ĠCAL IFORNIA ĠCmd Line ĠAbri mos ']+' #'+ Ġconc ave ĠPal m ĠPal indrome ĠIll umination obb dets ATO MS ATO GRAPHY Street Client maximal file piv ots Ġnotion al ISSU ANCE Reser ve Reser voir ]*\ )\( SIZ ED ĠCover ed ĠorderInformation LineItems taxon omic NEWS LETTER NEWS PIDER PortConf Table PortConf Number PortConf Description PortConf Entry PortConf PortState PortConf SpdDpx PortConf FlwCtrl ĠCalib Calorimetry аг ÑĢамм CREAT ING CREAT ELINE CREAT ETABLEREQUEST ĠNotebook ManagementError Neighbour IdStringList denorm alized uesta Resource ĠMOD PATH UPDATEPARTICLE LATENCY ĠпÑĢовеÑĢ ка ĠdocsLoadBalBasicRule Table ĠdocsLoadBalBasicRule Group ĠdocsLoadBalBasicRule Entry Ġprojek tit ĠTrigger SleepAction åIJİçļĦ å¯Ĩçłģ xAuthConfigExt Table xAuthConfigExt Entry ãģ£ãģ¦ ãģĦãĤĭ Af firmative Bob Cat Kal imantan Tim ers jer zydziewierz sos petto zq mixed aters hed dele ter ĠfuniVcl Fa Ġnsp ins Ġsiz y ("{}/ {}". ("{}/ {}_ ĠSorted Set ĠAst roidManager sper seg 0192 0385 0192 197634169 ĠPAY MENT ĠPersist ence Recursive Func foil Import Ġhexa gons Ġ______ __ 1851 99146 9354 24 ĠHex adecimal Ġcodepoint N cyl inders ãģĪ ãĤĭ ĠChrom osomal PRINCIP ALS ĠEncryption Type ừ i ừ u Ġctl Grp ä¹° ä¸Ģ Trig Status ĠMODI FIER пÑĢ им пÑĢ оÑģÑĤ ASTER OID ĠDependency File Guard Band ĠFigureCanvas Agg ĠFILTER ING BIC DOS Du quesne Poll ForActivityTask Spi ke Spi Dev iN ed ovs db ðŀ ¥ relax ing Ġpgm Name Ġpgm var Ġnat cap Ġnod os olc Sp __'] .__ getTransaction Count ĠSpi ke ĠCT As ĠCp ds tou pels Ġandroid AccMag ĠFrench Customer quar tet truck s ĠDie IfFiles ="{} ">{}[- \ >[- &\ Adiabatic MSW CIT ON EMO JIS Hcal Plugins JAV AFUNCTION Lacp StateDisabled Lacp StateEnabled Mik hail Pier re Vwu F Vwu h clp OrganisationId flashed Fly hift KeyMask kow itz lph All lph Obs sle pt íİ ĺ íİ ĺìĿ´ìĬ¤ ččĊĠĠ ččĊĠĠ ĠоÑĢ деÑĢ lef texpr Ġcrack ing Ġptf adapter Ġfocused Cells Ġ"]] ", hee zy Ġodk az Ġmop idy Ġmá quina Ġemiss ary Ġblighted Pixels Ġwet test charging tariffs (') ','') setAngle AndDistance asf array ĠisUsed Shadow ĠSHE LL ĠSHE ET ĠCr tomo Ġhil um ĠPt Max ĠPBE s ĠIso SpecPy ĠIdeal Gas ĠLon go Ġdeb fullname ĠDub lin acad admin Represent ing Represent ativePower 0216 38144 Ġxhat minus ..# .", ..# ..# ĠEquival ences },{" _ ĠGa ifax ĠGreg ory Ġcoli coords Ġheal py curContrast SaImagePatientNum Ġkid ney 1345 96128803 ĠHTT POk ĠHMM ERModel ĠInvest ig ĠInvest igation Ġlefto vers Ġaccomp lish Ġaccomp anied Ġnewlist t AGUU UU goma cc 9807 73 ĠYaml ConfigurationParser ĠbaseURL SSL Ġregress ing sgf rlf sourceFile Values sourceFile Keys ĠArn old ĠÐIJ д GetDriver ByName 5834 349 prsa Obs learned mgrstate 5906 02001909 ĠGeneralized Binomial ĠGeneralized Trinomial ãĥĭ ãĥ¥ PLC JS Interp Dat Ġglance client åĪ¥ è¨ĺäºĭ uffing ton ĠìµľëĮĢ íĴĢë§ģ rslt name GETBLOCK RESPONSE ĠPRODU CTION GGTC GCTATACT ĠPerimeter ator æĪª åĽ¾ ĠOpenID Schema Ġpró ximo LightLink ConnectionIndex ä¸įä¼ļ 被 zenith distance Expire Date Decor ators ĠTravis CI æŀĹ åŃIJ ĠCoded OutputStream ĠcdbpRealmKnownPeers Index aeiou y StorageClass Linker cumul ants Ġ--------------------- # kilo meter Ġíĸ ĪìĬµëĭĪëĭ¤ Ġelectro Pyy Accepted PacketRate collectd mon æµ· å¤ĸ驾çħ§ ElLeft Reflector ElLeft ReflectorDist ElLeft HyperbolicReflector ElLeft HyperbolicReflectorDist ç±³ çŃIJç§ijæĬĢ Bandit Learner åıªèĥ½ æĺ¯ äºĮåįģ ä¸ĩ Ïĥη ÏĤ fltSpec Index fltSpec Version GMCC ardObjects blendShape ByNode çĪ± 丽 æ·± è¯ģ Attachments View å¼łæĺ¯åı°æ¹¾ å±ħæ°ijå±ħä½ıè¯ģ å¼łæĺ¯åı°æ¹¾ å±ħæ°ijå±ħä½ıè¯ģ人åĥıéĿ¢ Æ°á»Ł i Æ°á»Ł u candy cane âĸĪâĸĪâķĶâķĿ âĸĪâĸĪâķij CCCGE g ClassifierIpSource IpAddress ClassifierIpSource IpMaskBits ClassifierIpSource SocketRangeStart ClassifierIpSource SocketRangeEnd ClassifierIpDestination IpAddress ClassifierIpDestination IpMaskBits ClassifierIpDestination SocketRangeStart ClassifierIpDestination SocketRangeEnd cPPPoESAbnormOff PerThreshold cPPPoESAbnormOff PerAlarm Ġê³Ħ층 ìĿĦ 8765432 0988 ({})) ". Mirrored Ports ClassifierEthernetSource Ports ClassifierEthernetSource MacAddress ClassifierEthernetSource MACMask ClassifierEthernetSource Trunks HEALTHCHECK OPTIONS DryRun Operation 身份è¯ģ人åĥıéĿ¢ æĸĩ件åIJį称æĺ¯abc è¯ģ件éĻĦ件 缮åīį âĶģâĶģ âĶģâĶģ ĠTaggedItem FormSet Ġ转 åĮĸ为 åĽ½å¾½éĿ¢ æĺ¯def Abri r Bent ley Evidence Type Geral do Lobby Populate Own GroupId Own UserId Ram Size TAN ButtonText Yolo sec ^* _{ bene ath ete cho glow pick iar ou nvis ii squee zed varg en çĩ Ĵ ëĮĢ ë¹Ħ ĠÃŃ cone Ġâŀ Ł Ġâŀ ¡ï¸ı onoff glides secon dext Ġtwin x dela xes Ġiz nos medic ine Ġcance ls Ġcele stial Ġ"?? ?" Ġrek ja Ġrek ordbox Ġrecurs iva ĠdÃŃ as Ġbounce time maint ype getSet Brightness getSet DiscoMode Ġtom ada ĠTol erance thir ds thir teen ĠSak ai ĠCROSS OVER ĠAtiv idade ĠAward SearchView ĠAxon DeepSeg ambo anga 9904 55 ĠFac ulty ĠFavorite Place ĠLam bdas ĠLam SlotMag ĠLINK ASLI Recover Time ĠMULT IP ĠMink Loc ĠMink owski Ġprotot ypical pymd mix xcor r aperture c ĠBuff Id ĠBah r Insufficient PrivilegeError ĠRail Env ĠROUT ERS epide mies 1827 296 dai lies 0466 1834985 llll ll Ġopend ap grace fully ĠHIT RANLinelist Ġcompet ências ĠKan ban filmo graphy filmo graf ĠYANG Bool ĠYANG ListType ĠYANG DynClass DIA LECT Noisy Dataset Compressor Finder Ġgovern ance äºĴ è´¨ Preprocess Response NEIGH BOR supplement al áĥĵ áĥĶáĥijáĥIJ OrEmpty Docstring Ones Complement IsNot My ĠAlarm Setting Ġannots Graph ĠPermutation Group [\" | Ġ리 íĦ´ ĠëIJĺ ìĸ´ìŀĪëĬĶê°Ģ procMan ForJob åĢŁ ç²® RAID VolumeTrap grib file ĠInvalidArgument Exception ÙħÙĦ ØŃÙĪظ 9084 887 RotMat NP ĠSpell Checker #------------------------------------------------------------------------------------------------ ------------ MILL ION dosya Ismi åŃĹæ¯į çļĦ ĠWorking Directory corrector Status ðŁı´ółģ´ółģ´ółģ ³ółģ ðŁı´ółģ´ółģ´ółģ °ółģ fmri prep åĬłå¯Ĩ åIJİçļĦå¯Ĩçłģ ĠApiKey Model åįķä½į åIJijéĩı 81893 004 Ġhybridi zations >(.*? )< ê¸Ī ìķ¡ ĠLiquid atable ä¿ĿæĮģ ä¸Ģèĩ´ 解åİĭ åįķ个 解åİĭ æķ´ä¸ªçĽ®å½ķä¸ĭ ĠALG ORITHM Triggered Spectrum æīĭæľº åı·çłģ Immediate Context SparseSegment Sum Ġbibtex parser Ġbeacon ing ĠLowest Period Photon Luminosity Ġprivilegeslist Count ĠобÑī иÑħ ĠÑĦÑĥнк ÑĨиÑı æŁIJ 个 æŁIJ äºĽ æħ¢ æĹ¥å¿Ĺ <<<<<<<<<<<<<<<< <<<<<<<<<<<<<<<< èĮĥåĽ´ åĨħ ĠDagsterInstance MigrationRequired ĠBlaze CashBuybackAuth ĠëĤĺ íĥĢ ĠTrafficLight Error 1100100000000 11111111110 âĸĪâĸĪâķĶâķIJâķIJâķIJâķIJâķĿ âĸĪâĸĪâķĶâķIJâķIJâķIJâķIJâķĿ Anon ym CORM UUID Dual MediaSwapped Emotion BasedD Fed ora Fully Connected Liter atur PDE Problem PERS P PERS PECTIVE Sop ron Tre asure VINT AGE Warp Image fet al oé t tti var ĠåĬłè½½ æķ°æį®éĽĨ relig ions Ġtessel ation decompressed File Ġcrl fs Ġpst ary Ġpain el Ġapro pri Ġapro vado Ġnes nel Ġnes mdb Ġdop hon Ġmog rify Ġmant ém Ġmangle Function Ġ#================================================================ =========== ĠTob ago ĠTune in ĠSmo kingStatus ĠCIR RO ĠCrowdsource Form forgot ten ĠFab ian listof data Ġhan alearn ĠPg net ĠLM Logger ĠLdap Usage Ġdelt ree ĠDID Type ĠOmni Error ĠBern ard ĠBounded Tensor ĠEP ICS worl de ATGTT AGCGT 9233 18636 ĠGan esan Ġcoordin ators Ġcoefici ent ĠVapor Pressure weig tedAverage Ġleaky ReLu 01100 10111111 01100 010001001100001001 ĠKr onecker 9597 888711769 AGGG CG Ġdiscu ssing Desired Capabilities Ġ('< ', bek istan ĠcurrentQSize Read ĠXGBoost Node Cher bourg THTH THTH DeConv Clean Ġimgur python Travel Time QUICK NAV WARM STEP Ġ"\", \" Ġ"\", \"" ĠWei bo Adres se FOUR CC NNTP Base Solo mon Ġconfusing ly EndOf Container Phys Rev GEEE I éĢĤ åºĶ ĠSham al ĠSham aliyah ĠAdverti sing Ġmoder ns ĠLOWER CASE Ġ"{}, {}". SUGGEST IONS Memcache Set Memcache Increment LocalLogging State syl labus ê°ľë ³Ģ ctspAuthorizationSgaclFail Info ctspAuthorizationSgaclFail Reason åĮĹ äº¬ surgery tf ĠPrime iro ÛĮس ÛĴ AUX HEAT ย าวà¹Ħม ĠdocsLoadBalChannel Entry ĠdocsLoadBalChannel IfIndex Ġharvest ed CALIB RATED è¨Ĭ æģ¯ Ġsteep ness Fitness Max Catalogs List Ġhtt mock cdbpPeerStatsDW CurrentStatus cdbpPeerStatsDW ReqTimer FbxAnim Layer FbxAnim CurveNode SqlMySql T ĠMetricSummary Response ĠMetricSummary Proto Adjacent Edges trackOfThingsProducerD Plus ĠBuffered S RenameAll Serialize ĠConcaten ation Ġcryst als ưỡ i ưỡ u Pascal VOC ĠCRUD dy Alternate KeyMask çĬ¶æĢģçłģ æĸŃè¨Ģ EquipmentClass Form Approx imation AAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAA âĸĦâĸĦ âĸĦ thalpy Vaporization ReplicaSet ToHorizontalPodAutoscalerLinker ReplicaSet ToDeployment actionBarDefault SubmenuItem Ġgibberish Output 800000858 00000000000000000000004 𤼵 è·¡ ĠFlyter Sender Ġخارج ÙĬØ© åį·ç§¯ æł¸ UNIVERSAL DIFF Ġìłijê·¼ ìĿĦ ĠÑĢезÑĥлÑĮÑĤаÑĤ Ñĭ immobilizer Release immobilizer Lock loadTestsFrom TestCase Vmomi Support ĠMATERIAL IZED Ara koon Billing Record CNO SPFC Dew Maple DAB ING FRE ETEXT GAG GCGAAAAAAA Kay naklar Mud OPDensity Mud IPDensity Nue vo NES DAY Punct Tokenizer Slit Separation WAT CHED boun cer blighted Pixels blighted HSV gluster fs hun ting hrp an kil pasarja kelp Props lance lot ngs im qPos AvgLoc qNeg AvgLoc vzt mpl Îķ ί Îķ ξÏīÏĦεÏģικ éŁ ĵ ì° Įê°ľ ervices Id Ġtj list Ġigu anas Ġpit op Ġpis ze unf olded unar date univers ities Ġech oscope ĠeTH ls Ġbtc Valuatin 1168 93 Ġwolfram alpha Ġwszyst kich Ġ[# ] isnew tskset isnew checktask ĠTangent Space ĠSup orte ĠSMAC CV ĠSNI PE ĠConse quent ĠCron Job ĠCodon Lprob updat eneighbour ĠFee Code quater x Ġdess iner Ġdels um Ġdels uper ĠDemon strate ĠDemon stration ĠvÃŃ tma ĠvÃŃ timas Ġordem Servi prest ig prest odb ĠEta Max ATGCT GGTCGCTATACT ĠNI RO ĠVic tim Ġkir bi Stored InfoType 15908 29943 Ġalumn o resultN Var resultN FilePath ĠKaggle Word Ġexterior Color ISOT ROPIC TextLine Dataset ĠYan dex ĠXcode Project ĠExerc iser ĠExerc ÃŃcio gencode vm Deal er ĠProx imity insurance claim GetKey Code ĠParametric DB Ġoverla id Ġoverla ppath ĠCohort e bao chen 20211 016 Interrupts Trap TxGap Ind ĠImageShare Form Ñģказ аÑĤÑĮ COLON IZABLE ĠìĽIJ ëŀĺ RuleSpec Context Orth ogonal ĠsendText Total Counting Thread Soil IncRate GGGC AGATGATGTC ĠActiv ations ä¸Ģå¼ł 个人æī« ĠAnki JsonExporter PREDICTION CLASS ("/")) - ClassifierLog State ClassifierLog Notification BatchReceived Method BatchTransferFrom Method ĠctspOperSgaclMapping Group RateCoeff Estimator multiplic ar ĠInvalidOperation Error Ġpotato es 广 åijĬ поÑģ иланнÑı ä¿¡åı· åIJį称 SFPT emperature SFPT xPWR SFPT xBias еÑĤÑĮ ей éĹ´éļĶ æŶéĹ´ æ¨Ļ æºĸ æ¨Ļ 籤 æłĩåĩĨ çłģ Octo Print 游 æłĩ Ġspoof ed æŃ£éĿ¢ çħ§çīĩ ĠincomingLaneNo G Historical Record ç²ĺ è¿ŀ ç¦ģ è»įæķĻéłŃ Ġíķ´ ìķ¼ ĠcdbpLocalIpAddr Type èĤ¯ æĶ¾ ĠClickHouse Cluster ĠoutgoingLaneNo G ãĥķãĤ© ãĥ«ãĥĢ æºĸ åĤĻ ĠìĿ´ë¦Ħ ìĿĦ ĠSYMB OLS ĠTrusted UserJSON ĠnumberOfMonths Changed Missile Design ĠOkta Collection ĠLifecycle HookName ĠLifecycle ActionToken èįī åłĤ æ¸ħçIJĨ æĪIJåĬŁ Shock ConsumerType ðĿħ¥ '), ĠDEPLOY ED dduConsumption PerManagementZone ĠPreTrainedTokenizer Fast å³° 度 Cele bA EAB WriteAlternate Ful fillment Fashion MNIST Nob ody PMAN DRainning PMAN DFoggy PMAN DSunny Rus sell Stp StateDisabled Stp StateEnabled Stp TopologyChanged Treatment MachineName Williams burg Yan lÄ±ÅŁ YnJ zE \'] ') carr era kom bu kWh r nxb entrust slit len slit wid uá i uá y uÃł i uÃł y wol fv Ġvide ostream ĠâĸĪâĸĪâĸĪâĸĪ âĸĪâĸĪ Ġ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ ~~~~~~~~~~~~~~~~ Ġ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ ~~~~~~~~~~~~~~~~~~~~~~~~ ĠÚĨ اÛģ Ġ"--- " Ġ"!= ", Ġ"!= ") Ġaffix es 0032 200610887 Ġretr uns unread Counter unread MessagesStart Ġbang cont odete ct isplay Control valgrind Args getVar ByName ('------------------------------------------------ -') setEdge Property Ġtooth pick ĠTray Menu ĠTeff st strin ged conforms To ĠSter ling ĠSant é ĠScr udful ĠCome t spik etrain 9905 15 ĠFd File oding ViolationErrs scater data Ġhitem list ĠPig tail ĠPres ley ĠPrest on ĠPVC s ĠLV DS trk let Ġstudio library excess ive ĠMari ana ĠMai or ĠMango AccountFlags keyformat versions 0226 323 0235 842 Ġmah alanobis addTo Parset ĠBollinger Bands ATGAT ATTACTTT xaai q boi ardo ĠWandb Logger ĠVert rees ĠUB Int Stderr Handler ĠHay en ĠHORIZ ON ĠRec SysFramework linode ID ĠInformat ics ĠInformat ik ĠIndicate MissingTransform lockB Max lockB Min lockB Increment ========================== =" ĠKas sel 9566 75 ĠimageUrls HD Deserialize ToDoList ĠtargetDelete DB ĠYI ELD Ġargnums l cyclo matic Chol era Ġarri ved Ġarri vals ToRe veal Deliver able clkpnt s ĠarraySearchT MAPE ĠArbitrary Timestamp kino Directory GetMember Count bles Spectrum connectTo SwarmController ĠUserRegister Form Defin ite ĠglGen Buffers ĠglGen VertexArrays Alliance Name scalers RawToDigi Advice Type AdKraus Ops éc édent ĠDEVELO PER ĠDEVELO PMENT Ġì° ¾ Heuristic NoAng EventSend Email EventSend Trap EventSend SMS ĠColored LevelFormatter nonex istant nonex isting UUUU UC learningRate Conv Mono space recN Prsa recsetTaxon Parent recsetTaxon Synonym ĠClassic FSM Whit ney Whit taker ä¸įéľĢè¦ģ åĮħåIJ«æ¡¶ çĽĸ ç«łé¡µ AccountAdd Name AccountAdd Password Ġè¨ Īç®Ĺ Multiclass Pipeline SequenceModel ing SequenceModel InputToHidden Stacker Classifier Stacker Regressor dialogText Blue dialogText Gray Ġíĥ Ģ пл аÑĤ HBHE Darkening Ġlexico gafic pegPrice Max pegPrice Min pegPrice Deviation 欢è¿İ ä¿¡åĬŁèĥ½ Velo cities æĬ½ å¥ĸ Pubmed Document Ġиг ÑĢÑĭ LINKED DATA å¥ĩ æĢª ë¡ľê·¸ìĿ¸ ìłķë³´ìĿĦ 001011000101 01011000011 schd uler telephone Number ĠCallbackQuery Handler AAAAG GC ãĤ¤ãĥ³ãĥ ĩãĥĥãĤ¯ãĤ¹ åĥıç´ł åĢ¼ PhaseRadianInverter RealTimeModel uạ i uạ y uả i uả y ĠGrafana Error Ġcadast ra Ġcadast radas áĨ« áĨ· ĠÑĥдал Ñıем ĠcroppedVid Final Oriented Reviews ç½ij页 ä¸Ĭ å¼łæĺ¯æ¸¯æ¾³ å±ħæ°ijå±ħä½ıè¯ģ人åĥıéĿ¢ svnNetIf Name svnNetIf Address Organized Submission ĠetsysNacApplianceMIB Group Ġreceber á Ġлай ки Ġлай ков Ġлай каÑħ ĠciscoDiameterBasePMIBLocal CfgGroup ĠciscoDiameterBasePMIBLocal CfgSkippedGroup ĠciscoDiameterBasePMIBLocal StatsSkippedGroup MapperStatusLO FErrs MapperStatusLO SErrs MapperStatusLO PtrErrs ĠæŃ¥ in ĠWeightedPoint Bisector Ġdiscrimin ate CDOTAS PEECH \\\\\\\\\\\\\\\\ \\\\ BTagMISTAGT CH BTagMISTAGT CHEM BTagMISTAGT CHEL mrstpPort Designated mrstpBridge Index Ġæī§è¡ĮæĢ» æŶéķ¿ ĠfuniVclTx Clp ĠfuniVclRx Clp cPPPoEServerAuth Requests cPPPoEServerAuth Failures cPPPoEServerAuth Successes ĠNewCellBend Upper ĠNewCellBend Lower ĠNewCellBend Overall <_|<_|<_|<_| <_|<_|<_|<_| Ġincorpor ated Ġincorpor ates ĠìĹ°ìĤ° ìŀIJ 订éĺħ éĵ¾æİ¥ Annihil ating ĠDEPEND ENCY 宽度 ä¿®æĶ¹ä¸º å±ħæ°ijæĿ¥å¾Ģ大éĻĨ éĢļè¡Įè¯ģ人åĥıéĿ¢ å±ħæ°ijæĿ¥å¾ĢåĨħåľ° éĢļè¡Įè¯ģ人åĥıéĿ¢ RECOGN ITION Derive Response atribu ido ĠPruneSource Count ĠPruneSource Address ĠPruneSource MaskWidth 举ä¾ĭ å¦Ĥä¸ĭ ĠìļĶ 리 Ġè¾¹çķĮ åİĭåĬĽ LIUBert State LIUBert Duration LIUBert ErrSecs Ġë°Ķê ¿ IMMOBILIZER LOCK IMMOBILIZER RELEASE ĠTestInterpolatorLoad Normal ĠTestInterpolatorLoad Big ĠTestInterpolatorLoad Small ,": ", 8555 24 Ble edFill CIf D Cabin Cat DGL Graph Jupyter LabTemplates Kings Raid Kratos ProcessFactory Lpe L Lid hje Raz ão SANT A TWE ETS VAB D Wise FeedForwardNetwork Youtube DL _][ \ csp attern cure k candid tates jee z kang aroo mms im mUy G tink off vmd k Õ¶ Õ¥ÖĢ è° · èĵĿ èī² íĨ ł Ġ请 åľ¨ ĠæľĢ大 åĢ¼ Ġultimate ly Ġted istgrp Ġ':: ' Ġ'(? :' mpv Args mption Granularity Ġcaf eteria Ġpunto Cercano Ġpunto Minimo Ġsgt bx rish abh Ġwand bs chim era otte sa ishe ye getsource file Ġtow ns ĠTot EventDurList ĠTier ra opin ion opent db opent herm ĠClar a ĠClar iteia ĠCensus Query ĠAven ger scrit os scrolled text ĠMens agem Ġyam ls Ġmemb ase ĠEmit s 32016 080101 hose Data Ġnumaras ını 0413 758 0656 156 1528 0102 100109100129 101 Ġopti mbench REDU CE complaint Period ĠInd onesia 5715 388 57296 36 6697 1817633709 ĠUnbound Context Acceler ation ĠQSql Query StatusPage Client ĠJian fa ĠProd uto Via Appia cvss V 0111110000 110 Compte Lib foreach RDD Serving InputReceiver penn ies Ġtercei ra ĠglEnable VertexAttribArray ĠtaskId Str ĠImageStream Image PyC QA ĠMealy State Ġfinance database ĠZhone RowStatus Ġì½Ķëĵľ 를 ttc gt ĠAddNew Line áĥª áĥľáĥĿáĥijáĥĶáĥijáĥĺ ĠCompressed Image excited Numerical DeviceInfo List ĠvideoName Split ĠæĻ Ĥ ĠæĻ ®éĢļ ĠReduced DensityMatrix Buck nell -------------------------------------------------------- -\ DDDD DD PageNumber Pagination 0100001111 10110 Ġquem ado Ġsenlist order ctspOperSgaclMapping Group RASTER IZER PALETT E INTERIOR TOW Ġ================================================================================================================= ===== Ġíijľ ìĭľ REFINE FINAL Consult ar ĠCallBack s ĠдоÑģÑĤ авки fbxSkin ToSkin ðŁı´ółģ£ółģ§ ółĢ 请éĩįæĸ° ä¿®æĶ¹å¹¶æıIJ交 éĽ£ å¾Ĺ áĦħ áħ¡ GATTT ATATTT ĠrclFactors Expiration ĠCONFIGUR ATIONS ĠÑĤÑĢ еб ĠÑĤÑĢ еÑĤÑĮей Specialized SemanticVariant éĺ¶ èĬĤçĤ¹ AAAAT AGAACAACT åĵ²å®Ĺ çļĩå¸Ŀ ĠWaiter Error ĠFriend ship uáºŃ y Maltego Message Maltego Transform GreaterThan OrEqual 绣ä¸Ģ çļĦ è°ĥè¯ķ 使çĶ¨è¿Ļ个PID ìĺģ ìĥģ ĠVerified BootVersion ĠSynchron ize ĠSynchron ization ĠShortcut Column ĠìĿ´ìļ© íķ´ ĠвÑĭвод им Contrastive Loss ĠGremlin ServerError Ġclump Info Venue Info ãģķãĤĮãģ¦ ãģĦãģ¾ãģĻ ĠCpwVc IndexType ĠCpwVc IDType RestrictedTransfer Method ĠCandidateInfo NotFound mstpXstPort Designated ĠfltStmtArbValue High ĠfltStmtArbValue Low WorkloadIdentityPoolProvider Oidc WorkloadIdentityPoolProvider AwsArgs MeltMassFlux Man Ġmuuttu ja Ġmuuttu jan æĶ¯ä»ĺå®Ŀ åĴĮ微信 ĠCamembert ForSequenceClassification ãģ«ãģ¤ãģĦãģ¦ è¨Ģ logVerboseFile Parsed ×Ķער ×ķת >',' _', >',' **', Aver aging Aunt Of Bun stable Cord oba Crow dAnki Emo jis Flower Service Greg or Greg ory Habit at IEC ORE Mé todo Nrec Prsa Pmt Inf Psy chiat Rip ley Sul fate TUNE DEMBED VOR R VRS QR Yuk on Yuk ki gup ta hab its ijs sel jum bo plastic ity uý u wsg iserver yum iceva yap en zar vary Ġã İ ĠčĊĉĉĉĉĉĉ ĉĉĉ Ġuber mag ĠÄį arou ĠÄį iarou ĠåIJĦ ç§į Ġåįĩ åºıæİĴåĪĹå¾ĹåĪ°çļĦ inspec z recruit ing recruit ment Ġtict actoe arit me Ġ'« ', Ġcread a Ġcplt s Ġcdm Corpus Ġcraft ed Ġpype flow Ġpstar x Ġponto on ĠpÅĻ i Ġfelt type Ġ"}, ") Ġsé curité Ġdern ier Ġdobi Seznam uninfected Area Ġmline file Ġmash umaro rapp resent ĠbÅĤÄĻ d ĠbÅĤÄĻ dy romo lecule Ġwash er chp NeedToReconfigure isEulerian Walk getFilter Width getFilter Bias getFbx BlenShape ('"" \ constra ins (".. ")) ĠSoc cer ĠSph ero ĠSinh Integral ĠCandle stick ĠCapt uring ĠClimate Entity Ġrut ina Ġrut inas Ġlte Config 9907 31 ĠFED ER vibrato Pos poznámk y ĠPic amera ĠPap irus Ġstor ms ĠDuty Failure ĠMUT UELLE apns Token ĠBIL STM ĠBibli oteca ĠEEP s ĠEPG Refresh ĠEquilibrium DB ATTEST ATIONS ATAAAA AGATTCTTG ATERE MOVE ATERE QUEST ĠNer vanaGPU Ġuns ichtb ĠGor ica ĠGren oble ĠWC IC ĠVest Device Ġanch ored 1508 33 Ġpresti ges Ġrama Parrafo ĠHour ly 0969 32 ĠInfinite Iterator ĠInjector File noOf Tweet ĠKine tics ĠKie ffer faw nofija Ġneur ite Ġneces ario correl ator efv hh Exhaust ed goTo Main 98904 3 Ġintermedi ates ĠargFormat String Ġseren dipity LogMat urity Uncle Of GetFrame Statistics Classic Control disper se åĪº éİĹ使æ£Ĵ Quarter ly diffserv Map Fade Gesture Ġ[[[[ ] ä»į çĦ¶ Ġìº Ķ Ġ층 ìĿĺ 0011000000 100111101001101 ĠLearned MgrState ĠfeatureDictObject B rlRmonControl HistoryControl Solicit ado æĸ½ 禮 ĠToy ota Ġastar Solver Ġdatat ree obsN Prsa ServicePerimeter SpecArgs ServicePerimeter StatusArgs CHEM ICAL ÃŃci us Distro less Whats ItESProducer Decre ase 000110000001100000011 000 ĠmasterOperation Thread ĠcalcDecJan Feb ĠGoogleCloud Storage Genesis Block ĠSimpleGrasp Srv ĠSimpleGrasp WithSle ImportFrom EPSG æĮij äºĨ 表çļĦ æŁ¥è¯¢æĿĥéĻIJ ĠâĨ ij #--------------------------------------------------------------------------- # ĠкаÑĢ ÑĤ ĠкаÑĢ ÑĤе +/- /_ Ġcyclo stats tmnx Dot ĠVertica Py Ġspices Num Noncurrent Days approxim ant ĠViewport EngineHybrid CfgLink Name ĠTrig Simplify 鼻 æµģ 鼻 åľ§ 5667 326 BinNum Expr ĠìłĦì ²´ ĠìłĦì Ĩ¡ miche le miche lson é«ĺ度 ä¿®æĶ¹ä¸º Ġpermiti r DISTRIBUT ED Ġмен Ñİ Ġмон еÑĤ Ġмин им Cré er uỳ u uỵ u uá»· u uỹ u ĠPubmed DumpIndex ĠOcto Bot ĠOcto Pod ĠProbabilistic Model Ġê²Ģ ìĥī èĦ± æķı èĦ± æľºè¿IJè¡Į ĠSuffix Trie Ġwyckoff Sum ĠfltStmtIndex New Adagrad Optimizer diameterVendor Ietf æ´ª ä¿¡ Ġìłķìĥģìłģ ìĿ¸ Ġìłķìĥģìłģ ìĿ´ì§Ģ æĴ¤ éĶĢ ĠSmartLink Condition StatefulSet ToHorizontalPodAutoscalerLinker 碼 表 ĠÑĦоÑĢм аÑĤе à¹Ģ à¸ģ å°ıäºİéĺĪåĢ¼ çļĦå¤ĩéĢīåij¨æľŁ ĠctspIpSgtMapping Group PersistentVolumeClaim Linker PersistentVolumeClaim ToPodLinker ĠCONTROL LED ĠExpectation Claim èĥĮ æĻ¯ ĠLassoLars IC guarante ed guarante es ĠNFTCollection Validator ĠXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX X %%%%%%%%%%%%%%%% %%%%%%%%%%%%%%%% ĠæıIJ交 ä¸Ńåĩ» ĠDOCUMENT ATION rutina Ejercicios ãģ«å¤īæıĽ ãģĻãĤĭ ĉĉĉĉĉĉĉĉĉĉĉĉĉĉĉĉĉĉĉĉĉĉĉĉĉĉĉĉĉĉĉĉ ĉĉĉĉĉĉĉĉĉĉĉĉĉĉĉĉĉĉĉĉĉĉĉĉĉĉĉĉĉĉĉĉ Dedicated SystemMemory Dedicated VideoMemory DockWidget Area ĠtestParseBook ChVs "[\.\,\?\/\)\(\"\ !]", GPIOpin OUT Ġ5061233 105 PRICEREMINDER ITEM )âĶĢâĶĢâĶĢâĶĢ âĶĢâĶĢâķŃ 8335 34 Bmp ImageFile CAME O DAN Co Flor ian Greet ings IIB yMJoBB Jim my Kamp ong Nth Co NDR H Pit ts Pup Menu Pfx FileName Rex xar RSV P SCH UL Snipe Checkin Snipe CheckoutForm Vest ur Vacc ine VSH LL VICT IM VICT ORIA batter ystaple equi lib hitem name midd lename pNum Modes plast id uô i wie sen xit Coordinator xlate To xCell x ytd l ãħ ¤ ëIJ ¨ Ġric ga Ġż ar Ġãĥ© ãĤ¤ãĥ³æ¤ľåĩº ĠåIJ¯åĬ¨ æĸ¹å¼ı ĠæľįåĬ¡åĻ¨ 端åıĤæķ° ĢìĿ´ ìĬ¤ indie hackers rexp and sext o alb ano tict oc Ġpens insula Ġ"ï ĭ Ġaia map Ġamar a Ġspre ading Ġsfs idb Ġress oures Ġeph id Ġwaters hed ],'. ', ],'. ') Ġfortios api turnOn WifiBridgeLamp getRoleMember Count setFrame Shape setFrame Shadow setWhiteMode BridgeLamp ĠSsa Instr ĠSax ony ĠSCO PE ĠSCC Search ĠSMB us ĠSCP Client Ġdefec ation Ġgog api ĠAj out ĠAlta ir spir alarm ĠFFM pegWriter ĠPCD Alignment ĠPsy cho ĠPrac tical ĠPrac tices ĠPALE TTES Ġdeter rent Ġdelet ar Ġdecry ptor ĠMES H ĠMIPS InstructionFormat ĠOGUI LE ĠBroad band ĠBloom berg Ġjer sey ATTRI B bouti ques ĠgetConstant Weight luc inda ĠGEM SA ĠGlue Dataset ĠWash list Ġancho Min Ġpyh pecw Ġpycard dav Ġpylsb out ignor etarget Ġlemp ivari Ġacer tou noops ym 36885 39 ĠimageName Dict AGAC AU parseC Struct 6605 2536 IMPERSON ATERESPONSE IMPERSON ATEREQUEST Encaps ulateItWithGlobalException Ġspr inger ĠUnregister HotKey Acer tou 举 西 CHRO ME SetNumberOf TableValues IBAIB AKB Ġagate charts ĠArmaz ém 1110000000000000000 011110 Ġimpor per Leon ardo çļĦåŃIJ 缮å½ķåĴĮ对åºĶ Shrink age moder ato ĠChip Type ĠshowObject Scale Ġreflex ive afri ca ĠEnc Dec Pointing HandCursor GETPOMERIUMSESSION REQUEST Filt red Ġcardinal ities ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠ WidgetList ChangeEvent ĠAdvection RK ĠServo Kit TCEntity Array ĠDispon ibilidade OpenStack VirtualMachine Geographic Location ä¿Ĥ ãĤĬ editSource KeyPress editTweaks KeyPress IAi CI mgd logs LISTPROJECT SREQUEST LISTPOMERIUMSERVICEACCOUNT SREQUEST Visicom ReverseGeocoder Utiliz ado Marked Location Ġèµ · ĠRandomWalk Robot ĠRandomWalk EqOracle ChangeIn X ChangeIn Y hydr us archiveInfo Format OWL NETS ĠMultipart Encoder ----------+ -----------+ åĩºæĿ¥ çļĦ 16767 400 ãģ®ãģŁãĤģ ãģ« dwNum Entries navreptrain rnn Ġpotrze buje LinearGaussian WithKnown Corrupted Error stool box ĠQueryable Property ĠQueryable Properties ĠØ£ ÙĬض AutoLabeling Config subnetBasedVlan Src ĠknownNodes Lock Ġназ наÑĩен Ġmarsh alled Ġrepeti tive RUNANDWAIT MESSAGE æµ® 浪 AssignmentTitle c ĠRetention Policy ĠUniversit at ĠUniversit ät ĠKeel Attribute Ġplanil ha 9098 075 å»Ł ð¥ļĥ èµ´ å¸Ń XChem Utils ĠMerchant OrderNo ĠNonParaG auss QUERYUSERS REQUEST QUERYGROUPS REQUEST ç»ĵå°¾ 没æľī以 ĠqualityMask EPIC +-]+ @[ åıªè¦ģ åĮħåIJ«download缮å½ķä¸ĭ Ġimagen um uá»ij i uá»ĵ i uá»ķ i uá»Ĺ i !!!!!!!!!!!! !! è¿ĩç¨ĭ ä¸Ń âĸĪâĸĪâķijâĸijâĸijâĸij âĸĪâĸĪâķij ãģ¨ãģį ãģ¯ DeepLearning Examples Ġprecis amos åıĺæĽ´ ç±»åŀĭ uấ y uầ y uẩ y uẫ y ĠMetricType Proto ĠCyUart Set bilateral Filter ë©Ķ ìĭľì§Ģ Ġìĭł ê²½ë§Ŀ å®Įåħ¨ æĪIJ交 Ġwykon aj ĠfltStmtAction Arg ĠRealESRGAN v ĠCIFArticle Form ĠÑģÑĤÑĢани ÑĨÑĭ ĠâĶĶ âĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢ AGTTA ATACT AGTTA AGTGCGC ãĤĤãģ® ãĤĴ ĠrlHistoryControlBuckets Granted ä»ħä»ħ éľĢè¦ģä¸Ĭä¼ł ä»ħä»ħ æĶ¯æĮģjpg 輸 åĩº 111100001111000011110000 1111111111111111 ĠReplication Remote GrandParent Of ç·¨ 碼表 Cogn acy Ġpronoun s Different Humps sloupce Y fantasy Points MAINTENANCE COMPUTER ĠíĨµ íķ´ ĠRodrig uez pistol Modes 9958115183246 07 apparate cfg ĠsetObjectClean TransformShadingEngine ĠsetObjectClean ShapeShadingEngine casesForICU ByRequest åįİ为 åĪĨéħį åįİ为 åĪĨç»Ļ daylightSavingTime EndDate daylightSavingTime StartDate ĠSYMBOL s ĠbaÄŁlant ı createCurveFrom OrderedEdges ĠSignUpForm Serializer INTERRUPT ED ĠReseqTrack DB casesForVentilators ByRequest !* '. "\\ ])* ,?) """, 5856 881 6935 072 8164 97 8235 471228 AER OSPIKE Bprice To Bprice From Bpercent To Bpercent From Bounded FloatText Cen ário CAND Y Flick Rate Flick ering GBo C HMI JS IAG et JAE UQgghh LBA AS NUT TX NuclideResult List Overs izePkts QRA E Ré férences SMC ALFLOW Stix Path Tes oura TANG ENT Urb BankStab VQR DMULH Wan delroutes ZEN ANGLE ZTI b \+\ )\( aument ar cOn WK frank furt jak obs lbn m oel int paw lytics punte ggi punte ggio pLvl Grid twe en tData Input vog s wend en wann ier Ëĭ ËĬ ÐŃ ÑĤо ìį ¨ stas hes mpool TransactionResponse Ġpexit grp Ġnub armuPDF Ġnies koÅĦ Ġsport sipy Ġsrm v Ġsö ylen Ġingestion Time Ġrecom end Ġdam n Ġesk apade Ġeffici eny riem LogR Ġbere its ĠbÄĻ dzie edm testThings idal oc cham fer maxt asksper ':'' } turnOff WifiBridgeLamp ('==== > setBrightness BridgeLamp ĠTagg ableManager ĠTama Tou ĠSed iments ĠSUS PECT ĠStitch SrcVolume absor ing absor ption ĠCtypes Type ĠCorn ell ĠCitr ine Ġlld butil ĠAero space ĠFro benius ĠFALL BACK ĠFlap Interval ĠFlap Enabled ĠFLEX netDC ĠFuniValid Vci ĠFuniValid Vpi Ġhic cup proble matic ĠDER IV ĠDip loid ĠdataMag Body ĠdataMag LVLH ĠdataOmega RW xfffff fffffff Ġvou loir Ġseni or Ġseni ors Ġstratis d 0754 163 ĠBak ery ĠBCE Loss ĠBays Booked ĠBeng io ĠBBBBBBBBB B ĠEgyp tian ĠEgyp tians movel ate readrandom writerandom ĠGrey Scale ĠWAL LET ĠWarmup Cosine ĠVik idia ErrorNotification Interval ErrorNotification Enabled dags ar lldb test Ġchang enum 1713 94622 Ġradk y Ġradk yX ĠReplacing MergeTree ĠReachabilityService Transport availab ilities 85377 94244 ĠKun quat ĠdateAdded Local ĠdateAdded UTC 7773 13 Ġgoog lenet SetScalar ModeToUse Testimon ials Ġverstr line sgp ceilC Ġcalcu ate ToBe Added ConfigMap ToPodLinker Traditional Variant Traditional OpenSSL cvm fs LIUC mdStatus LIUC odingViolationErrs ObjectField Selector dayof week nextPage Key UserStory Factory ĠResilient Component Threat Response ĠGetProjection Plane Algor it ĠrawListOf Trending ĠSimCC Stdcall ĠSimCC MicrosoftAMD Ġnonuniform resourceindex Ġpiirt ä Ġpiirt ää Ġgeol ucidate ĠìĤ Ńìłľ ĠcmdLine Parse uxi ème alphaS value alphaS order ĠCheckbox WithLegend PerMode Small Ġviral Advertising GETSTATUS REQUEST GETSTATUS RESPONSE GETTRANSACTION REQUEST GETTRANSACTION RESPONSE CIAi C ....# ...... ĠPROX IES ĠPROX MOX lingu istics Scrolled Window ĠEXPL ICIT DRMSystem List ĠbytesTo Send ĠbytesTo Short CaseStudy Version à°ĩ à°¦ ĠPrescription Form /\__ /\__ TrainTest WithGen OBST ACLES ĠTransitions Table symmetri ze ĠLOST Geometries Ġdiffpriv lib PYTH ONTESTR ĠOnBegin Round ĠOnBegin SpellCast ĠIPC Channel SQLè¯Ńåı¥ ç»ĵ尾没æľī以 ClassifierLogging State ClassifierLogging Interval WithLoss Cell åľº æĻ¯ speedUp DiscoMode speedUp DiscoModeBridgeLamp invaders peeds ĠMoved IssueNotDefined Decord Init Decord Decode ĠepNumberBulk In ĠepNumberBulk Out Visualiz ing IIYQQ wsFI ê°ķ ìĽIJ MyBalancerExchange Add MyBalancerExchange Remove Ġvoxe lized ĠStateAttribute LimitsHelper Ġcommenti ds Ġcommenti zer ĠMultiAgent Env FilesWin Cast Triple ts FeatureSupport DataSize ("[{} ][{}] ĠFIRE FOX ĠTaskPlugin Upload fwLocalLogging Stat fwLocalLogging Desc ĠвÑħод ов ĠíļĮ ìĽIJ Ġâļ ł ĠJourney TravelTime lorenz ian triggerOrder Type Ġcyc ler FDwf AnalogIO Ġdetal les DELETEPOMERIUMSESSION REQUEST DELETEPOMERIUMSESSION RESPONSE Ġinfectious ness ElApply PackedReflectors ElApply PackedReflectorsDist ElExpand PackedReflectors ElExpand PackedReflectorsDist ä¿¡åĬŁèĥ½ éĻIJåĪ¶ Fouls Suffered Fouls Commited SERVICEACTIVATION CONFIGURE ĠcsMoney Limits ĠvtkRenderWindow Interactor EnvironmentVariable Args ExecuteInitialize SolutionStep ExecuteFinalize SolutionStep αν θαÏĥ ĠDIAG RAM hhBB COBh ĠJobInfo Factory оÑĤÑĢ иÑĤе ĠstandStill End ĠstandStill Ends BTSC ERT ĠTransformers SeqPairDataset ĠCausal Factor Magnet Type ĠnrOf C ĠnrOf I ProxyModel Model schueler A ĠciscoTrustSecPolicyMIBCompliance Rev Ġìłľë ª© ĠCatmull RomBlend ĠStreamBank Eros è´Ń çī©è½¦ ĠÑĤек ÑģÑĤ ĠÑĤек ÑĥÑī Marital Status slowDown DiscoMode slowDown DiscoModeBridgeLamp ĠLiquity Staking ĠLiquity Troves pressureValve Outlet pressureValve Inlet çĽ¸å¯¹ URL çĽ¸å¯¹ ä½įç½® uá»Ļ i æĥº æĥº VOLUM ES ìľĦ íķ´ Ġintrospect ing Ġק ש×ķר×Ļ×Ŀ ĠPolyn esia ĠFitness Plot åįģæķ° ä¸ĩ stratis d taggedIn Posts taggedIn Comments PrimitiveItem Context uẹ o uẻ o uẽ o Ġê°ľë ħIJ ĠValis pace áĨ² áĨ´ DEPLOYSTATUS MESSAGE DEPLOYSTATUS OPTIONS ÐŁÐ¾Ñģ иланнÑı ĠMySQLTotalExecution Counts ĠMySQLTotalExecution Times SENDTRANSACTION REQUEST SENDTRANSACTION RESPONSE mstMap Vlans 1001001110110101 0111111111 ĠPOSITION AL cdbpLocalStatsTotalPackets In cdbpLocalStatsTotalPackets Out ĠfltStmtSrcPort High ĠfltStmtSrcPort Low ĠfltStmtDstPort High ĠfltStmtDstPort Low Skinned Mesh Ġdjf appendf Ġdjf appendh Ġtanmu OpenDiv Ġtanmu CloseDiv ãģķãģĽ ãģŁãģĦ Ġ#---------------------- # çµĦ ãģ¿åIJĪãĤıãģĽ ClassifierIpPacketLen RangeStart ClassifierIpPacketLen RangeEnd èѬå¦Ĥ æĬ¤çħ§ä¸ªäººèµĦæĸĻ页æĸĩ件åIJį称æĺ¯abc èѬå¦Ĥ 身份è¯ģ人åĥıéĿ¢æĸĩ件åIJį称æĺ¯abc Ġrecebe u 77777777 78 Ġ**************************************** ***** ĠikFootControl Grp ĠciscoDiameterBasePMIBPeer CfgGroup ĠciscoDiameterBasePMIBPeer CfgSkippedGroup ĠciscoDiameterBasePMIBPeerStats Group ĠciscoDiameterBasePMIBPeerStats SkippedGroup ĠciscoDiameterBasePMIBRealm CfgSkippedGroup ĠciscoDiameterBasePMIBRealm StatsSkippedGroup 網 åĿĢ 綳 èĮ¶ AGTTGTT CTATTTTA cPPPoESNormOff PerThreshold cPPPoESNormOff PerAlarm Omni Wheel ĠWRIT TEN ç¢Ĺ éħĴ ĠFunny QueryClass ĠFunny QueryType CDOTAM sg CDOTAM SG ClassifierEthernetDestination MacAddress ClassifierEthernetDestination MACMask fltStmtIp SrcAddr fltStmtIp DstAddr Gvrp StateDisabled Gvrp StateEnabled BandwidthConfStorm State BandwidthConfStorm BW BandwidthConfIngress State BandwidthConfIngress BW BandwidthConfEgress State BandwidthConfEgress BW ĠÑģлов о ctspIpSgtMapping Group parente mail ĠNewCellWidth Mean BTagMISTAGSS VH BTagMISTAGSS VHEM 港澳å±ħæ°ijå±ħä½ıè¯ģ åĽ½å¾½éĿ¢ Ġ------------------------------------------------------------------------------------------------------ % Bibliografi ja 8888888888888888 88888888 ĠcdcEndpoints SAM ĠcdcEndpoints Pic å¼łæĺ¯æīĭæĮģåı°æ¹¾ å±ħæ°ijå±ħä½ıè¯ģ人åĥıéĿ¢çħ§çīĩ å¼łæĺ¯æīĭæĮģåı°æ¹¾ å±ħæ°ijæĿ¥å¾Ģ大éĻĨéĢļè¡Įè¯ģ人åĥıéĿ¢ å¼łæĺ¯æīĭæĮģ港澳 å±ħæ°ijå±ħä½ıè¯ģ人åĥıéĿ¢çħ§çīĩ å¼łæĺ¯æīĭæĮģ港澳 å±ħæ°ijæĿ¥å¾ĢåĨħåľ°éĢļè¡Įè¯ģ人åĥıéĿ¢ åĪĩãĤĬ æĽ¿ãģĪ ĠæİĴ éĻ¤ ĠdocsLoadBalChnPairsIfIndex Depart ĠdocsLoadBalChnPairsIfIndex Arrive 该åŃĹ段填åĨĻ test 该åŃĹ段填åĨĻ abc Investment Cost åĪĿæľŁ åĮĸ ãģĿãģ®ä»ĸ ãģ®ãĥĹãĥŃãĤ¸ãĤ§ãĤ¯ãĥĪ DESTROYPARTICLE INVOLVING ĠMakerdao Vault ĠMakerdao DSR ĠclavController Grp 1590788 458524 ĠctspSgtCachingVlans Second Ġê·¸ë¦ °ëĭ¤ LacpPort Added LacpPort TrunkFailure prsaRec Combined ĠìĹ¬ê¸° ìĦľ å¼łæĺ¯åı°æ¹¾å±ħæ°ijæĿ¥å¾Ģ大éĻĨ éĢļè¡Įè¯ģæŃ£éĿ¢ å¼łæĺ¯åı°æ¹¾å±ħæ°ijæĿ¥å¾Ģ大éĻĨ éĢļè¡Įè¯ģåıįéĿ¢ ĠfltStmtIpSrcAddr High ĠfltStmtIpSrcAddr Low ĠfltStmtIpDstAddr High ĠfltStmtIpDstAddr Low cPPPoESAbnormOffs Threshold cPPPoESAbnormOffs Alarm Ġsürü mlerinden ĠYearnVault s ĠYearnVault sV ĠLiquidation Event ĠLiquidation Processor çł´ 綻 ĠíĶĦ ë¡ľ Approximate ly saveImageFor Classification saveImageFor AutoEncoder åĪ©æ¶¦ç©ºéĹ´ å°ıäºİ åĪ©æ¶¦ç©ºéĹ´ 大äºİ å¼łæĺ¯æ¸¯æ¾³å±ħæ°ijæĿ¥å¾ĢåĨħåľ° éĢļè¡Įè¯ģæŃ£éĿ¢ å¼łæĺ¯æ¸¯æ¾³å±ħæ°ijæĿ¥å¾ĢåĨħåľ° éĢļè¡Įè¯ģåıįéĿ¢ Ġæī§è¡ĮæĢ»æ¬¡æķ° åĢĴåºıæİĴåĪĹ TENSORFLOWMODELPERFORMANCE EXAMPLE ĠTrouble Maker RoyaltyBps Method NTPTime Sync NTPTime Zone PersistentVolumeTo StorageClassLinker PersistentVolumeTo PersistentVolumeClaimLinker 6465423123145 6460312100645 Ġåıĸåĩºè¯¥éĽĨ群 çļĦè¿ŀæİ¥æĸ¹å¼ı GETESTIMATEDTRANSACTIONFE ERESPONSE GETESTIMATEDTRANSACTIONFE EREQUEST PolicyOutOfProfile Action PolicyOutOfProfile DSCP TCEnhancedEntity Array OpenCVEgg ROICurr 个人æīĭæĮģ身份è¯ģ人åĥıéĿ¢ æĺ¯gh 个人è¯ģ件认è¯ģ æŶè¯ģ件éĻĦ件 å¦Ĥä½ķèİ·åıĸxaccountTypeçļĦåıĸåĢ¼ å¦Ĥä½ķèİ·åıĸxaccountTypeçļĦåıĸåĢ¼ #---------------------------------- # *[: =]\ +), (\ 5276 75 8000000 080008 =([^ ]]*)\ Carg amos CURLY NAME Equival ência Gle ason Goth ic NTP Server Nobs Prsa Nspawn Setup Ota vio Pree mptionGranularity PASSI VE Rib bon Sic ilia Und ersizePkts Vig ilance Vsn Ss VOX EL Winds orize ajs noia cador ias dnx STS dHash Space evoke Persist hsc ic miti gation pato is rne bot rmy knife sJob Config wes ley zyst a çŀ ŀ íı¬ 구 ĠÉĻ laq Ġáĥĺáĥ ®áĥĺáĥļáĥĶáĥĹ ĠовеÑĢ ÑģÑĤок Ġå¤īæıĽ åħĥãĤ¿ãĤ¤ãĥłãĤ¹ãĤ¿ãĥ³ãĥĹ insh uo recurs ice Ġtreen o Ġimit ation mpto te Ġcach eready Ġcake chat Ġpuzz les Ġpzm test Ġsfr d Ġrestr ito Ġrequ red Ġregra s rave py rament a Ġesg enerator covert ree rifer imenti Ġ[~ ]> Ġ[:: ]: Ġ[#' ../../ isApp Exist getNumber AfterEqualSign getSample Power setContext Property ĠTru ss ilj atelja conserv ancy veget ables vegg iedag Ġ{... }, Ġisom eric ĠSPC ert ĠSUC ESSO ĠSlov ens ĠCHO ICES ĠCLIC KHOUSE ĠCpw OperStatus ĠCHOL MOD Ġgmw fbps Ġlsh f ĠAFor Root icer igi 99011 37 99537 037 ĠFAT AL ĠFUND AMENTAL listFile LumiArray ĠPbot Y ĠLav ender ĠLEG END ubber Band Ġthal iana Ġstark net propell ant exclu deref 10866 170 ĠDra vi ĠDias BP ĠDanger ous ĠDMG State Ġuia utomator ĠMAS QUERADE ĠMOB ILE 02158 245784357 ĠOZ PACBCRS Ġparrain é oreg istry pyt nyu apic ls ATCAA ATGTTAGCGT ĠNAV IGATION ĠNNC F ĠNSA p ĠgetArray BaseName ĠRp Address ĠGross o ĠGrapheme BreakProperty ĠWT Forms ĠUMN Sub Ġlistof data Ġkik net Ġkalan ını Ġpyfasta q agio tis 03426 3046786 ĠHeter odyne imageData GeometryFilter ĠIncor porated emm our Ġlagr angian netd Service 8627 451 summar ization 57476 17 Ġcheckstyle Name Coer cing docbook file ĠSeis CL CHOS x Christop her Ġdiret amente Ġcorn flow Ġcorresp oing Ġcontinu ua cuff links svgs lides Ġquan itze NoData Plugin Ġutilis é ĠtotalFC alls Ġbacklog todo GetMethod Config AddN chw Ġabge brochen CAE eaA çļĦçī¹å¾ģ åĽ¾ çļĦåħ·ä½ĵ åĢ¼çĶ± ImageIntermediate Writer AAl phabet AAo hhBBCOBh Ġphssum csv mcg ill '\[( .*)\ Ġmodifi ee Ġretard ance çı yı ĠZü rich ĠEnketo Error Ġì¼ ĢìĿ´ìĬ¤ GBw cx NEO PIXEL Teardown EndEvent PerS RECluster ĠmcTransceiver Dist PointerShape BufferSize dru gs ()[] {}" âķĶ âķĿ Phili pp TreeItems FromItem GraphNode Proto ĠPreserve LoggingContext CRAI GSLIST ÑĥлÑıÑĢ но BinaryClassification Evaluator ĠSubscri bes bootstra pper PYv Hk åįĺ èªŀ Ġ'{}.{}. {}. BRD ADDR VERSIONING ANNOTATION ĠcarPos x LISTTABLES RESPONSE lmnp qrstvwxyz čĊĉĉĉĉĠĠĠĠĠĠĠĠĠ č AccountBalance s BCrypt SHA 91776 56 ĠèĻ ļæĭŁ Ġgenepool detail backgroundTasks Lock ĠStateful Function ĠMatth ieu Ġcalcual ted FilesIn Dir åĩºäºİ ä»»ä½ķ Rendered PageBreak sensing Start 40375 6749600 éĿł è¿ij paypal http Ġentr ée humid ifier è·ij åĩº ĠBinarySensor Entity ÙĩÙħ ÚĨÙĨÛĮÙĨ 1010000101000000 1010000101000000 ĠÑĤел еÑĦ ĠBadges ByCategory GiRaFFE food çĽ¸ä¼¼ 度 ĠmscModVcsAdd OptTable ĠmscModVcsAcc OptTable ĠmscModVcsIntOpt Table isaac muse имоÑģÑĤ ÑĮ 012345678 90 GREET INGS ãĥ©ãĤ¤ ãĥĸãĥ©ãĥª detailedH Path ĠblendColors Node Chegada Fila ĠAssumeRole PolicyDocument åı³éĶ® éĶ® æµģéĩı åĢ¼ èīº æľ¯ ĠStaging Area blox route ĠFuncion ário éĸĭå§ĭ æĹ¥ pirates base Xplat Enabled ĠBreakout Graphics è²´ èİĬ ãĤ°ãĥ© ãĥł 9217975 031371 Ġглав ное Õ¡Õ¶ Õ¡Õ ÏħÏĢο Ïĥημ SLAVER EQ DIAGRAM S BootcampRun Enrollment ĠSolaris x ĠHydro Weno çģ° 度 ĠпеÑĢв ой Ġmatem ática ĠCalibrated LabelRanking OtpBlobNo Urls OtpBlobEmpty Urls ninety five ĠSSDP Response wedstri jd ĠhpnicfVoiceIfCfgEchoCancel Switch Rollback Error TeacherExtra Form Ġìĭ¤ìłľ ë¡ľ Captured Text ê¹Ģ ë°¥ ä¹Ŀç´ĭé¾į åı²éĢ² ĠìĻĦìłĦ ìĹ°ê²° 対象 ãĥģãĥ£ãĥ³ãĥįãĥ« æIJŃ éħį ĠÚ¯Ùģت Ùĩ windowBackgroundWhiteBlue Text ĠFAULT Y decodeProtocolSigned HundredthsFloat iadEnable Symbol икипед ии Shipper Response 800000858000000000000001000000 01 ("****************************** ") 68789685924 92 Ġseamless ly ĠзагÑĢÑĥ ж ĠShowPlatformHardwareQfp Bqs NGSIM Env Ġphenom enological ĠNachrich ten Ġencuent ra ĠMOUSEBUTTON DOWN Ġíģ´ë ¦Ń ĠìĨįìĦ± ëĵ¤ ĠæĿ¡ä»¶ åĪ¤æĸŃ ĠespecÃŃ ficos EcalLaserAPDPNRatios Rcd McafeeEsm Get Ġ\'\'\ ' ĠMockPowerOutput Driver %| ''' *([ +- 200000000000000000000000000000000 0000 4873 1097 5147 88 6068 27 7097 88 9195 2705 =.*? &", >\\ +=;,? ¼ê°ģ íĺķ Úĵ Ùĩ Ġåıĸ å¼ķä½Ļ ĠðŁļ ¨ Ġè¯Ń ä¹ī Ġåİĭ缩 å¯Ĩçłģ Ġæĸĩæľ¬ éķ¿åº¦ Ġçİ°åľ¨ æĺ¯ä¸ŃåĽ½ ĠéŃĶ æ³ķ Ġä¿¡çĶ¨ åį¡ senn a Ġtama ño alon so allag h anam nesis Ġ'#! '+ Ġccm lib Ġppi Complex Ġfoll wing Ġ"------------------------------- " 00107 395201212057 00176 968 geire m ĠnÄĽ m Ġswee ep Ġrequis itos ĠdÅĤu go Ġmont age Ġmidd lename Ġmgl ng Ġecos ante ()+". ") 11327 923318636 defaul ter getMeta Settings ('================================================================ ================================ setApp Name setShareholder MaxShares ĠTIO CM ("^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^ ^^^^^^^^^^^^^^^^^^^^") ppError Msgs ['* :% Ġ{âĢĺ ,âĢĻ ĠSiste mas Ġrde lts Ġrug ged ĠAtribut o 01347 9252695 01057 32 01556 99 ĠFwd Fx ĠFUJ ITSU vibr ant ĠION IQ ĠLPW STR ĠLiech ti Ġstabili zed Ġdesm os imbar azz ĠDIC OM ĠDDR Tree ĠDENS IDAD ĠMos cow ĠMTC NN ĠMENTION ED Ġvarn m 02224 93 Ġparâ metros test測試 test 111110 11111111111111110 xcent ers ĠBIND ABLE ĠButter worth ĠEIP CR ĠEspeci ally Ġjuli amirror ĠNog iBlog boj one ĠgetUrl Params ĠgetHint Group InV MT Inno DB ĠRAPID YAML hoyo lab ĠVirt utech ĠUcs Handle Ġhesit ate Ġanteri ores Ġenjo ying minis creen linePlus BarWithFocusChart TrueSkill Dictionary saven py Ġkne ejerk Ġkolo m Ġpyrom ancy Ġpydot Graph ecim ila 03474 831399 ipzig js ĠpreActivate Values neigb ors entitle ments 08116 82 ĠReconnect WebSocket ][-\ +]?[ ĠInve ce ĠInclu ÃŃda Progra my DELI VERY ĠnoIn Conns Ġlash able ĠKash mir ĠKLI FS wordprocessing ml 0000000000101 000 Ġdopp lershif processRaw File initWith ContentsOfFile ĠindexTo Direct Ġ8388 608 23903 880 contaminated Area Ġdiscus sed corrisp ond Enga jado Coapplicant Income 28384 648328 56964 59 Ġpassow rd Ġspé ci myDS MWB ĠQi ita 35964 7736 Ġworl dbody ADDIT IVE ĠSev cik ĠXD MF IBR ION Chir ality ĠINSTANT IATE DIFFER ENTIAL assertSame Entity ĠPyMissing OrEmptyDocstring ConfigJob CreationError reduc ers buildand deploy ĠCoordinator Entity Complain ant prerequis ites çļĦå¹³åı° æłĩè¯Ĩ GHJ KL puzz les 01218 646 ContextChild Peer ĠglDisable VertexAttribArray ĠChib rary Ġshowf liers homeLocation Window Ñģег да SizeOf Info gyhaz a vespa interactive Preprint View DSAT AB Ġ$@ ". datar obot datalo ad ĠinitInv F ĠAddW Map åħĦ å¼Ł áĥ¬áĥ§áĥIJáĥłáĥĿ áĥĶáĥijáĥĺ PointOr Unit LoadImage FromFile SimState LoopData costum ers Mov Valid ĠAcumos Session ĠbytesPer Record LCQ MC Philli ps GEMP ad Ġtrang ain auton otebook à®Ĩ த ĠëĺIJ ëĬĶ 92592592 59 00297 00000000000004 correcthorse batterystaple ĠQuin tile ĠOpenGeneral Licence 00527 447 ĠUpdateOne Pass Ġapag ado ĠDesp legar Neutrino Decay Ġbarrage BtnDiv Selecion ar BEH IND RAWSIM output ĠGLubyte Array 11864 21774 GenParticle Validation risult ato democ ratico Ġamic able Ġannivers ary ĠвÑĤоÑĢ ой ĠBlockfs Stack Ġoccas ions ĠâĤ ½' ãĤĴåIJ«ãĤĢ æĸĩç¯Ģ 0082495 42493103 connectedComponents WithStats 帰 å±ŀ æĭĴ ç»Ŀ åĢ¼æĺ¯åIJ¦ åľ¨ ĠCHAP TER ĠROCK STAR åIJįåĴĮ download缮å½ķ VlanPort BaseEnabled æĹ¥æľ¬ èªŀ WordIn DifferentHumps Carto grapher ãģ«æĪ» ãģĻ NotificationConfig StreamingConfigArgs ĠиÑģÑĤоÑĢ иÑİ ĠSingleOutput LinearGaussianWithKnown Ġtranscend ental schiz ont ĠSmtp Messenger ãĥĪãĥ¼ãĤ¯ ãĥ³ ĠUnsupervised Trainer ãĥ«ãĥ¼ãĥ Ĺ ĠDATAS OURCE TDatum Type ĠменÑĮ ÑĪе ĠRecordManager WithNotifications ĠAnalyzed Series åIJĮåIJį 书ç±į PerfTest CodeGen slideCover SubTitle GroundTruth Simulator ĠDownloadProgress Spinner Ġèİ·åıĸèµĦ产 æķ°æį® ĠWHIT ELISTED ĠLibraryCharge Handler Datadog AWSIntegration cadast rados ĠGrass hopper Ġæī«æıı æĢ»è¡Įæķ° ÑĢаÑĪ иваем апиÑĪ иÑĤе ĠRunningMean Std âķļâķIJâķIJ âĸĪâĸĪâķĶâķIJâķIJâķĿ AGAATCT TTTTATT DwarseMarkering Verschu ÏĢί ÏĥηÏĤ èİ·åıĸæĸ¹æ³ķ 请åıĤè§ģ RoundTrip Loader ĠMagma Protocol ATATAA ATCACGCTAAC ATATCAT GCGTCA ĠPREPAR E 01011101011100000111111 10 flytekit plugins YuXM n æ·® å·ŀ 1001001110110101011 0111111 CgY EA å¯Ĩçłģæĺ¯ ç»Łä¸ĢçļĦ ürk çe ÑįÑĤ омÑĥ ThreeEquals Four ĠIgnorable Exception Ġnvml Device ĠÑĢек омен ĠоÑĤг ад ĠâĶĹ âĶģâĶ ATCGT ATGTGA rosterId Row ãĤ³ãĥ³ ãĤ½ ĠInvitation Id 貫 è³ŀéĮ¢ ηγ ÎŃÏĤ Mirroring Port ĠCognite Client ×ŀש ×IJ×ij×Ļ×Ŀ é¦ĸ次 å®ŀåIJį认è¯ģ æľ±æѦçŃī ä¸ī人 åĽłä¸ºæĺ¯ æī¹éĩı ]|[$-_@.&+ ]|[!*\(\), éĮ¦ è¥ĸ Ķ모 리 orchestral WinButton Usuarios FormView ĠPeptide Seq Shoot Gallery asdfgh jkl ĠSuspicious Operation >[^:] +?)\ æijĺ è¦ģ "(?? ĠCTAEqual Risk ÙħتعÙĦÙĤ Ûģ Ġnécess ite ="([^"] +)"> ĠìķĪëIJĺ ìĸ´ìŀĪëĬĶê°Ģ Ġklij enta CHROMO SOME plagiar ised ĠgetCurrentLine Region åįģåħ«èĪ¬ æѦèĹĿ ã¨į éĸij Ġ"âĶĶ âĶĢ Ġmoused own ("\"\"\ ,") LINESTY LES ĠнаиболÑĮÑĪ им Ġrhinoscripts yntax Ġ00216316305403 042524 åŀĥåľ¾ è¯įæ±ĩ ()*+,- ./ ĠÑĥÑģлов иÑı ConsoleAuthTokens Controller 1526020019150506 0405180910390 ÏħνδÎŃ ÏĥειÏĤ meccan ico ĠNNTPP ermanentError createBackgroundSubtractor MOG áĥ¤áĥĺáĥļáĥĽ áĥĿáĥĴáĥłáĥIJáĥ¤áĥĺáĥIJ ={'_':_ }, Ġпози ÑĨии åĩºä¸īåįĥ 貫è³ŀéĮ¢ аÑĤегоÑĢ ии SAIohBBCCOFg JAEUQgghh èĢģç§įç¶ĵçķ§ 缸åħ¬ )_/ ¯ *([- , *"- ") 10000000000000000 0000011 70657 269 81166 9 ;<>? =< Axi om Ayr ıca Bstat trak BTree ShelveTestCase BAX T Bbv CI BLOO DIMPACT Cann ondale Crest s Crypton ian Casca ded Dpr Bert Dram Test EAT EN EQUIT IES Fdf Parser Ftrl Optimizer FNOM IA GULL Y Gilli land HISE QX Hazel nut IUDE xists JUM POUT JUD D JfT pJk KVlan List MACK RL Mdns Scanner Mental OrEmotion NORE PEAT Nccl AllReduce Rfl Ld Raph Algorithm Suff olk Sú visi TIL DA Tenth Degree Ult mt Vnf Instance Waf Error Wü rttemberg Wcet ResParser ZABBI X Zusam menfas [). +(?=\])) blid h bhattach an cFunction Prefix dGu PNPT dinn ertable dSigma Add egon n flib ble fles ch gme ep hbp apps harging tariffs iVB ORw jero fi jdon ÃŃthat kii roo kloud trader lbra gstad lOX F madd pg nsted API ncoh ers oZI hvc pith y pures nmp pnx enopoulos pConcern edDevice rxc allback rgy b tPED IGREE tEduc atedGuess tmotiv ated uORB Topics vass Result yif an ¯âĢįâ Ĺ Õį ÕŃÕ¡Õ¬ Ġuto ol ĠãĢĢãĢĢãĢĢãĢĢ ãĢĢãĢĢãĢĢãĢĢãĢĢãĢĢĠĠĠ ĠáĥĶáĥł áĥĹ ĠæĸŃè¨Ģ çĬ¶æĢģçłģ Ķë¡ľ ìĽĮ ķáĥł áĥĶáĥijáĥĺ intill ation oron ix reprodu cibility stpz crnm enni als Ġtare hart Ġtream ent Ġtian shou Ġtula jdonÃŃthat Ġtäh än Ġioth read Ġitemp rop Ġikin ci Ġirem os memp tr meis anggou Ġ'???? ?' rostatics Handler Ġcil antro Ġcux filter Ġcling o ĠcOne Runtime Ġcnl unardate ĠcKnn Runtime Ġpale omix Ġpogle dajte Ġpbx proj Ġpunte ggi Ġplugg y Ġfulls ky Ġ"ï¼ī ") Ġ"========================== =\ helip ad ##________________________________________________________________ __|| Ġaix ò Ġawc Bongo Ġaforem entioned 00256 1574428 00178 19648 001813 47 009999999 77648 001986 31 002727 58 002668 96963 002466 75 008874 85 003299 71 geerling guy ĠnFF THalf ĠnInner Quantum Ġnazy wa Ġsapi ens Ġsnee ze urlab ari ssly ze ssrc ss Ġrestring ir Ġogre tim Ġoanda pyV Ġduy gu Ġdjit ellopy ĠdNr Pops liush ilive unpop ped Ġmmsg hdrs Ġmsmar co Ġebee Split Ġeteen päin cocost uff codefor ces Ġbessel j ĠbJack Type romanti clovebooks umont real idÅĤ owo idalph ar Ġ(+/ -%. Ġ(âī Ī chalog in chridd yp teok set definic ao andaGri pper odesch ini isLo oped iscu ous isTarget Grasped isocal endar isWeak Ref isRfc Installed isNVDAObject InApplication isDefensive PI namedt upe getOpen FileName getCV s getExecution Service getouter frames getMiddle Point getPanda Logger getRaised Exception getRxPacket Error ('...... >'), setAccess Mode setnc attr setMag Filter setEndOf LifeNoise setKeyable Attributes ĠTBU tility ĠTga Format ĠTwi lio ĠTWR P ĠTAE YONG ĠTrist an strTensor Tuple ("================================================================ =======") ("################################################################### ") ppDis assembly pprm Hdr ppRenderTarget Views Ġishash ad ĠisSingle Quote ĠisDouble Quote ĠSenti ments ĠStem mer ĠSMSG ateway ĠStac PropertyView ĠSán chez ĠSMITH SONIAN abez ado ĠCrit eria ĠCMW DB ĠCSSH at ĠCUMP LE ĠCédu las igital Errs htfL GeQx Ġgim memotifs Ġglot tal Ġgriz li Ġrhop late Ġrápid o ĠlEvent Num Ġldl decom endof text ĠAlon so ĠAmr hein ĠACES tream ĠAdiabatic MSW 019347 04661834985 Ġconsoli dates toGPUS hape ithasht u pathRemoved Styles ĠFonse ca ĠFmt Str ĠFergus on odmlt ables logMb aryon ĠPyn guin ĠPESS OA ĠPsql D ĠPrpc rypt ĠPYY AML ĠPLAST K Ġasfg it ĠIeo mapSentence fileRec N fileObs N ĠLTLE ncoder ĠLuminoso Client Ġthril led Ġstea mapi Ġstixc ore progra mas 00002899 65 exect ute exfxc xdxbxegedabagacad Ġ3956 071 104675 16072 Ġprinthelp line outOf Band ĠDeps Modifier ĠDiox ide acier tos accou feat Ġugan il Revelation Model ĠMpO uthApi ntImp ares timeStorageClass Updated ifNotExists Flag keyåŃĹ段 æŶ Ġvinc paths Ġvæ re ĠvShi elded 021383 5778413 ĠOPe NDAP ĠObn iz ĠOgc Api ĠOdys sey Ġxld lib Ġxigtx ml oscedastic ity Ġmahal Dist Ġmaxter ms addGL GetConstant addJoint FromPos addStiff Wire INNO DB INVS RC INCOMPRESS IBLE ĠstrLog Name Ġelpig raph Ġmelh or Ġpropri edade pyec ore pyAS A pyaw abi pyrami de artTo CatSim aplic acion ĠBouw meester 1210078 0307 ĠnameAnd Aov ĠEdd ystone ĠEting of Ġjndi Str worfk low textOver flows ATAN ButtonText ĠNPROP HET irho mass irhom olar numBlack Pieces Ġresizer atio Ġgetfla pi ĠgetUsage Embed ĠgetForecast SummaryFromTemp ĠgetResolved Options ĠgetOops Embed ĠgetGoto Code ĠgetAkiba TimeAndSize InAnchor Names Inquiry Request ĠRCV ALL ĠRTEX ITCODE ĠRIPP acket Ġuntu k foai wej ĠtestCloud Passage ĠGLO BUS ĠGLU COSE ĠGEOF RED Ġonrech te ĠWEA VER ĠWsResource NotFoundError ĠWDItem Engine ĠVintage ousPlus Ġ54612 33125 ibagh eri Ġannih ilation ĠfromPrevious Step chega mais minEnclosing Circle dachi py ĠkMean Cluster Ġkjf elt Ġcolsd one Ġpyec sca Ġpymesh fix Ġpyja mas Ġpydl m Ġpyvirtual display Ġpyinfra box Ġpyradio config Ġpymort ests Ġsetrgb color ĠsetRemote Sensor libcz mq libGLES v 06194 9587 06311 989 Ġwhirl pool SEDIM ENT STENCI LOP 100926 053943 maxKnee Force 051501 304 03478 013479252695 ĠintGeneral Ledger csRelative Path utilis ateur eldrit ch Ġchagn ges Ġrastream ento Ġramenia app baseMetric V grappe lli plotGlobal Use REMASTER PROCEDURE REPARAMETER IZED REALLOC RESOURCEMESSAGE REALLO COPTIONS ANNUM S ANSU hEUg ĠRecurs iva ĠRegula Falsi subCort Aff Ġ{}/{}/ {} Ġ{}ãĢĤãĢĤãĢĤãĢĤ '. inputMagMeter Name skelse c Ġscron sole 34500735 416 Ġweasy print writeAll BranchCatalogs withgft zero updateGUI Image updateRho Prd ĠConfli cts 943503 36 9444444444 444444 DETA ILED DEHUM IDIFIER DEUTERON OMY ROTT LE Ġappinvent ormuBot NameGender Classifier avgb pm ĠnoOut Conns Ġnovac lient ALAAAAAA QAB CTGCCC AGATGCGA CTGCGCA CTTAACTTC DataZoom Opts ivaz is 851475 143 Ġspecp ad 011165 12332600 011169 100926053943 Ġopenarticle gauge ĠKiven C ĠKRB CRED ĠuserExist InRoom ĠuserWants ToExit Ġcontfract beta ĠimageToMap Id ĠmaxPoint Index ĠmaxSurvey Dist Ġzmator der ĠhasVar args AGWE ED createReverse Node ISVS JfTpJk numberRange Looks numberAzimuth Looks doTry Next specul ative trybun at currentRemap Filename Ġloude st ĠcheckPiece MovValid Ġdispla cy APPOINT MENT APOST ROPHE 753764 06311989 282465 18 ETTER BEEK calcenti res Ġspinn man movePast EndOfContainer myPDF path ĠUnidentified ImageError Mealy State ĠQUI ET ĠQStandard Item ĠQidian Exception targetDelete DB ABRID GED primc aps 20137155 06 77975 000005 zerbai jan eyJv cmdf ĠXImport Filter CHOO SE cclcgce li 474542 8888 toptwo hundred TestnamePow TestRunner ĠstringFrom Gralog rangeSampling Rate Chrg Br marktwor nn markonern n ĠfilesToBe Used iterNodes ByType iterReachable TreeItemsFromItem NumRT Vs NumCompanies Worked Loyo la assertHTMLE qual ĠreadOne Operation ĠreadMaster File TRadi obutton ULocal OptGroup ToTra sferList ToGL Type ToGP ULocalOptGroup ToCir culant ĠPybind Base ĠPyFE MP ĠPyShadow ingBuiltins ĠPyPortfolio Opt ĠPyCUD ADeviceInfo ConfigExpected StackSize 65465 24242 67376 064 showPy plotGlobalUse showMacro Window useMulti GPU useCp ROI useAutoc alling ĠListMetricSummary Response ĠListMetricMeta Response 000000011101 00111110110 0000001001111011111111 0 FAVOR ITE pltAverage PersonSpeed ĠanyAdjacent Occupied ĠfirstOccur List ifyGT GFCommand ĠqueryDbFetch All lastCmd Time taskparen tidmap DATARE QUEST ĠfullOrder Data FrameOr SearchList climato logies GetHeader Value GetDst Property nydail ynews Ġcallsm usic ĠasscIncident Count buildFrom PreInOrder awcz yni 543665 000518528 ĠfindNew Heights Ġdiffract ogram LIUD igitalErrs ObjectDD L ObjectLink ConnectionIndex Ġordercn stit Boole Set Ġsupplément aires ĠTestXDRI OCToD Regula Falsi struktion en Ġportfoly o 682313 03 CExtension Array etsRL AngleSpace celldms x cellnotation spath ĠCreateHelp Text ImageCaption ing ĠtmpIncomp List ĠPathDefinitions Weighted DBBACKUP PATH 01298288 6546524242 ĠsortedBy RankMap PROFACT IV }\"""" ) ThisFull path Ġphaset hread torchtb profiler ByCov Rate ClientCert Failure '\`([^\`]+)\ `', AppAuth Client hasGLE xtension optimalg ft ĠconvertToOne Hot Pyroc lastic Pyblo xy ĠTherm Bands ForBridgeLamp Cmd Fornec er ForCausal LM pgYeti Maya ĠnonDirect Sites .\+\ ):\ Ġcloudf erry ĠpiTom ation ĠLovec ruft FOFC WT SubSys Id SubAccounts Serializer MLPB aseline Ġ$$$$$$ /| sigRegion ChangeFinished ĠZubi eta GenerTopo Edges rsOrPr nAmt hexarchive file Discriminant Analysis canBe Wrapped NEOD yS RunIIF all realDonal dTrump ĠFileConsole Logger PortStat uDescription pxrpython subst ĠAddJointLimitParticipant Step priceReminder List Ġparticipi al ĠelementSetFull PathData PerCap ita ColorPlugValue Dialogue OrPassword Error zeroTerminated Floats EventChanges Tracker GIGANT UM LabelCalibration Settings æķ°å¼ı ãģ¨ãģĹãģ¦ ĠRunGo ToTest documentConstant Identifier ĠPROCES SED ĠPROPAG ATING ĠNotHtml Exception ,\.: ;\ ĠoldCur Slide ĠTelom ere handleUnknown Assignment ĠfinalTrending List BOILER PLATE ĠLogStatistics Agent EqualCase Ignore ĠLIGE LE ACTORTASK SPEC DoFirmware Upgrade (['________________________ ', ĠuniqueConv os 1001000000001000000 111 SHistorical Record 0001545 48 ĠQtQml Viewport socketKeep Alive Ġowscap able QuerySync Params LengthStandardi zer Ġcircolari List ĠstackTop List PolicyRow status PolicyQueue Action PolicyDiff ServAction PolicyPriority Action PolicyOutgoing Action PolicyMetering State PolicyForwarding Action Ġë¸Ķ ë¡Ŀ ĠflagBits Size ANDrQC soYYaaqihhhpq CRCAlign Errors sortedJun cs computeDistance ToSubspace StreamFlow VolAdj TCATTTGT ATAGTTTTTTT 0110110111111 011011 InvalidMnemonic OrPasswordError 0028877 3763259 0029275 1363303 002991155 233758036 NewEvents Result Ġautoscalings im Queenst own UpdateProperty Cache nihl atak PRECONDST ARTR ("""""""""""""""""" """""""") readexact ly ĠSubaward View ĠSubroutine Node ĠSubthesauri LabelCalibrationSettings ĠQuTi P ĠOpenMDA O ĠOnSpell Effect ClassifierMatch Order WithVehicles InTree WithRedu ctions ĠTHRED DS ĠapplyQA OA ĠARTIC LE ĠmostFrequent Alternative glShader Source glCompile Shader glAttach Shader glDetach Shader 005473 17766177 0059823 10467516072 specifics name VariableAttributes Error ensureMoreBytes CanBeRead currtsk name SFPConnector Type SFPFiber Type ĠMyUserWith SameName rfloor div AndReplace InAnchorNames recAddr Stream TRIVI ALLY ĠJSONWeb TokenAuthentication ActionMulti Panel ActionSelect IdleWorker ActionSpatialUnit SelectionPoint TransformBroadcast er TransformIndexTo PhysicalPoint externalController Output ĠColumnShift TableBootstrap ĠTextMel ID ĠnormalizeTwitter WordsWith ahrsp os ĠNewLife Utils LISTNETWORK OPTIONS LISTNODES OPTIONS LISTACCESSBINDINGS RESPONSE zenPen xil Decentr alized VisaD ynamicPlot çĽĪäº ı AccountBreak downBy uvHist Block agingParents MoveInWith ĠSpatioTemporal Dataset ĠAssymetric Node RandomShuffle Queue TrackHistory Length 21664775 94350336 SurfaceIr radiances Temperture Trap SampleDiscarding Kernel 003934 64 003996 98 ĠRandomMesh Composer ĠLineByLineText Dataset bcdfghjk lmnpqrstvwxyz iedliwo ÅĽÄĩ ĠTokenVerify View ĠMultiChe b emporary Error ĠremoteLogging Config Ġ'"{}{} "'. 00101011100111111 0111101 åľ¨çº¿ è°ĥè¯ķ使çĶ¨è¿Ļ个PID 232832 34 ĠONVIF Camera Ġmagnetis ation 30195287 69064523 30167337 74 ExtraDHCP Validation 906307 7870366 GenVect Lin ĠMinNeutral Pt CARedu ceCuda HWzm RR ĠInvalidRSE Expression NETMI KO 9848900586 3667 ATEDOWN LOAD servePref Set IntervalUpper Key IntervalLower Key CallNext HookEx DCURSOR CAPS INSTANTI ATED ĠSumOfBeta Ece allowedExact Paths ĠEditable Filter 0078915584 89063755 tweetFeder er ĠBlockHeaders WithChainLock ĠdesiredFace Width ĠDefaultsFlex ibility AutoUploadLog State ४ॠ« ãĤĴæ¤ľ åĩºãģĹãģŁ 置信 度 GCATCT GGGCAGATGATGTC 017378 134596128803 ĠExtractive QAPipeline пÑĸ Ñģ UPDATEPARTIC LESHOULD 42261826 1740699 0082734 080933732 0089297 12100780307 0089257 34500735416 szkol anka ĠнелÑĮ зÑı ConstantPyIOmica ExamplesDirectory âĸĪâĸĪâĸĪâĸĪâĸĪâĸĪâķ ¦âķĿ triggerOriginal Price triggerTrailing StopDeviation updatesMerged Block ĠChangeActivePlots Var å°ıå®ĺ 人 )+'|| '+ CustomMetric LookupError 0004947 33 ijnv anhulle ScoreDiffs PerSRECluster wmLHE GS ReleaseParticle Index ĠmediaTrabal hos 4379383 01211039 ĠOverdamped Brownian ãĥ¼ãĤ± ãĥ³ãĤ¹ VlanDouble TagEnabled VlanMetro ModeEnabled LOCALISATION PRODUIT fishpig cow ĠFeatureTracker Types arrowBorder width Ġaiowork ers ĠCloudPassage Handler 以æĬ¤çħ§ 举ä¾ĭ 以身份è¯ģ 举ä¾ĭ RTROI ObservationsSequence sunxia ofei ĠVmcaCer tool ĠRESOUR CES CURRIC ULUM Ġpeertopeer utils CGACCAGC ATTCACATACG LANCZ OS Ġempiri cally swapETHForExact Tokens 035257 446797913 03513016 359647736 MaterialEditing Library ĠUNIMO Model ĠLinearAnneal edPolicy EpochBased Runner ĠDIFFER ENT 请ä¸Ģ次 åıªéĢīæĭ© Ġgymnast ics 01832878 1006857753 blogNb PostsByPage arthikk annan ĠJobBrowser BFF 03423918 1186421774 0347761571 9248206 QCGEEE IIByMJoBB AUTONOM IE QSortFilter ProxyModel 次éĥ½ å°ıäºİéĺĪåĢ¼ 次轮 è®Ń åıĤæķ°åı¯èĥ½ 为空 ĠGitCommitLog Node YearsIn CurrentRole resumeSayAll Mode ospfV irtIf 0010111000101 000001001 ARRCCCGE cDCS TASKEXECUTIONS PEC 100111111111110011 001101 pnicfsupplicant proxycheck rwCZ dGuPNPT ĠMaximumWaitTime Exceeded Ġ"@/./ +/-/_ ĠPVreflected Irr 11101100011111111 111111 Ñĸб лÑĸ ĠDummyDiscrete Env CONTAINERDEPLOYED OPTIONS ĠPARAGR APH å½ĵidentify Type ĠLihui yuParser ĠASCIIC mdEncoder åIJĪä½ľä¼Ļä¼´ çļĦå¹³åı°æłĩè¯Ĩ ĠUIWo YD ATTTGATT AAAATAGAACAACT ĠFailedPredicate Exception PERSONNEM ORALE WebKitFormBoundary F Ġdomblk error ĠParserATN Simulator 该æłĩè¯Ĩ çļĦåħ·ä½ĵåĢ¼çĶ± 该URLåľ°åĿĢ å¿ħé¡»æĮīçħ§é¡ºåºı âĸĪâĸĪâķijâĸĪâĸĪâķijâĸijâĸij âĸĪâĸĪâķĹ wychow awczyni åħ¨éĸĭ ãģ§æĽ²ãģĮãĤĭ AgeCare Scaling ĠHashPermutation Mapper PAYPAL ISHIRING Estafeta Label æĸ¹æ³ķéªĮè¯ģ çļĦdata PrecisionQuantization Config Ġæī¹éĩı 解åİĭ focusLastFocus ableObject ĠStaticMaze Navigation 4950117696 081450 Ġbetabin om ĠSCENAR IO è¿Ľè¡ĮçĶ»åĽ¾ æĵįä½ľ ĠÑĥÑħод ов LASTPERIOD AMOUNT KGgoAAA ANSUhEUg ConstructListOf Processes è¿Ļ个URLæĺ¯ çĽ¸å¯¹URL 101111000101001001 000000 æ°´æ» ¸ AGTATAG CGACCAGCATTCACATACG ĠtrajectoriesSortedBy StartEnd 83826257 32775 ĠFactorioCalc Base gestionsoci etaire å¼łæĺ¯èº«ä»½è¯ģ åĽ½å¾½éĿ¢ å¼łæĺ¯ä¸ŃåĽ½ä»¥å¤ĸ驾çħ§ æŃ£éĿ¢çħ§çīĩ ĠAFFILI ATES éĢĻæĺ¯åĢĭ å¾Īéķ·çļĦåŃĹ 00101010010000000000011 00 QBFEII IYRw GetStatusApproach Position FlattenBatchNormDropout Extractor 0102144769 15280102 ĠMeshClust Enabled xAuthQuiet Period xAuthReAuth Period ĠWaterPumping StationZO ĠRuntimeDetermined EnviromentVars å°ĩè®Ģåıĸ Excel Ġwikilanguage s UsIml zX амÑĭл ков 79652085 14613565 ATGACAAGTT CTTGAAAACA ĠoutgoingHom enet éĸĭå°ģ åºľ åĤħéĩĮ åı¶åıĺæį¢ ì²ĺëŁ ¼ ĠSchuffenh auer ĠQgsWkb Types ĠexperimentalOCorrect List kJwuje htfLGeQx ELECTROMAGNET IC AGAAAGTA ATATCATGCGTCA 个人éĵ¶è¡Į åį¡è®¤è¯ģ SASpeci alizedOSDisk PermissionsAccessControl Args ĠMyCustomAmazonReviewNIPS DataLoader Ġausreich end MapperStatusAISE rrs MapperStatusRxTrace Errs 96006409 3299587 ĠìĿ´ë£¨ ìĸ´ì§Ħ Ġgerçek leÅŁ NbOfTx s ĠSoftButter fly biratnag ar Ðijибли огÑĢаÑĦиÑı ĠLancaster Stemmer PrimeAward Summaries ரண à®® 051851994 185199146 ĠGtkDocComment Block 009407024 106167228 页éĿ¢æıIJ交 åıĤæķ°åı¯èĥ½ä¸ºç©º æĪĸèĢħç¦ģçĶ¨ åĽ¾åĥıä¼łè¾ĵ פ×Ļ׾ ×ŀ×ķ×Ĵרפ×Ļ×Ķ áĥ£áĥ¨áĥĶáĥ ķáĥłáĥĶáĥijáĥĺ <_|;^{;^{;^{;^{ ;^{;^{;^{: ÐŀÑĪиб ка ĠSammelr öhrchen ĠHerzegov ina SdkInstallAttempt Time ĠCachedSchemaRegistry Client æīĭæĮģæĬ¤çħ§ä¸ªäººèµĦæĸĻ页 æĺ¯def æĬ¤çħ§åħ¥å¢ĥ çĽĸç«łé¡µ ĠUniversalAutomatic Answer 3273148975 0759 giovann icuriel 000100110000000011 00000 YearsSinceLast Promotion ×¢×ij ×ķ×ĵ×ķת CREATELINE ARPROJECTILE Affirmative Id 01920385 3016733774 0192197634169 13338 ĠDieIfFiles Mismatch usbDeviceCdcBuf Pool åįĬå¾ĦçļĦç²ĴåŃIJ æĿ¥è¯´ æij½åħİ æĿİåIJī Ġpomodor r 11129900 1912 cPPPoEServerCurr Sessions à°Ĺà°® à°¨ åIJ¦åĪĻ忽çķ¥ 该åŃĹ段çļĦåıĸåĢ¼ åIJ¦åĪĻå¿ħå®ļ æĬ¥éĶĻ ĠSoundCloudLiked Tracks EcalIntercalib Constants KjelsÃ¥ s VersorAt Time 003528131239818 3218 004765164 8537794244 ChanBrizard EOM LIUAnalog Errs LIUExcess Zeros LIUPRBSE rrs æĶ¯æĮģåĪĨåİĭ åį· Ġ+-------------+---------+ ----------------------------------------------------------+ 374769085 3614695 Thanksgiving WeekData ĠspiceTls Port å¼łæĺ¯æīĭæĮģä¸ŃåĽ½ä»¥å¤ĸ驾çħ§ 人åĥıéĿ¢çħ§çīĩ xpaeportHandshake Status xpaeportUserNum Now xpaeportMcast TrigStatus åħ«åįģèIJ¬ ç¦ģè»įæķĻéłŃ æīĢ以å¿ħé¡» å¯Ĩçłģæĺ¯ç»Łä¸ĢçļĦ 005489088 061949587 áĥľáĥIJáĥĽ áĥ£áĥ¨áĥĶáĥķáĥłáĥĶáĥijáĥĺ çİīé¾į çŃĨæŀ¶ Ġíݸ미 ë¶Ħ IDXGIDecode SwapChain åįķ个æĸĩ件æľĢ大 ä¸įè¶ħè¿ĩ ÏĦελεÏħ ÏĦα ĠPersistentDictClient Exception ĠAdaptiveParamNoise Spec '{"-": > Ġ解åİĭæĸĩ件çļĦ 缮çļĦåľ° Ġ解åİĭåİĭ缩æĸĩ件 åĪ°æĸĩä»¶å¤¹çĽ®å½ķ MarcSkovMad sen 03665756 2013715506 ÏĢοÏĥÏĢά ÏĥμαÏĦα Ġãģ§ãĤīãģ£ ãģıãģĻ ĠBWAPIT ool ЦиÑĦ ÑĢа ĠRpcAmqp Client REMOVENODE OPTIONS OptimizeFunctionOn NextCall ĠкоÑĢнев ой PodToReplicaSet Linker PodToStatefulSet Linker PodToDaemonSet Linker èĦ¸çļĦåĽ¾çīĩ éĻĦ件åį³åı¯ FruitPuree Percent ACTORCREATION TASKSPEC ĠBertForQAS imple 못ê°Ģìł¸ ìĺ¤ë©´ BareBones FireworksAlgorithm SonyElectronics Corporation tortuguin ha ذرائ ع ATTGACGC ATGATATTACTTT MinimalPhsBandCover ing ĠAbstractBaseTestFor HDP JAVAFUNCTION DESCRIPTOR 021638144 24420707 åĪ¥è¨ĺäºĭ æķ°ãģ® çĪ±ä¸½ ä¸Ŀ å¼łæĺ¯åı°æ¹¾å±ħæ°ijå±ħä½ıè¯ģ åĽ½å¾½éĿ¢ è¯ģ件éĻĦ件缮åīį ä»ħä»ħæĶ¯æĮģjpg secondext inctiongame 解åİĭæķ´ä¸ªçĽ®å½ķä¸ĭ å¤ļ个 PhotonLuminosity Density EmotionBasedD ic çĬ¶æĢģçłģæĸŃè¨Ģ 失败 ReplicaSetToDeployment Linker CNOSPFC lBr GAGGCGAAAAAAA ATATAAATCACGCTAAC ĠordemServi co 1590829943 940 ä¸Ģå¼łä¸ªäººæī« èĦ¸çļĦåĽ¾çīĩéĻĦ件åį³åı¯ ĠTrustedUserJSON Presenter 0032200610887 23078 ä¸įéľĢè¦ģåĮħåIJ«æ¡¶ åIJįåĴĮdownload缮å½ķ å¥ĩæĢª çļĦåıĤæķ° CDOTASPEECH MATCHONCLIENT <_|<_|<_|<_|<_|<_|<_|<_| <_|;^{;^{;^{;^{;^{;^{;^{: Ġè¾¹çķĮåİĭåĬĽ æĿĥéĩį 32016080101 91 66971817633709 65 GATTTATATTT TTTTTCGCCTCGACATCAT WorkloadIdentityPoolProviderOidc Args TUNEDEMBED DING ATAAAAAGATTCTTG TTTTCAAGAACTTG fawnofija wef ĠSimpleGraspWithSle w èĦ±æľºè¿IJè¡Į æĪĸèĢħç¦ģçĶ¨åĽ¾åĥıä¼łè¾ĵ ĠæıIJ交ä¸Ńåĩ» è´¥äºĨ SnipeCheckin Form ĠæľįåĬ¡åĻ¨ç«¯åıĤæķ° éªĮè¯ģ çļĦåŃIJ缮å½ķåĴĮ对åºĶ æĸĩ件åIJį称åį³åı¯ ĠØ£ÙĬض ا åıªè¦ģåĮħåIJ«download缮å½ķä¸ĭ çļĦåŃIJ缮å½ķåĴĮ对åºĶæĸĩ件åIJį称åį³åı¯ AGTTAAGTGCGC AGAAAGTAATATCATGCGTCA ä»ħä»ħéľĢè¦ģä¸Ĭä¼ł ä¸Ģå¼łä¸ªäººæī«èĦ¸çļĦåĽ¾çīĩéĻĦ件åį³åı¯ åįİ为åĪĨç»Ļ åIJĪä½ľä¼Ļä¼´çļĦå¹³åı°æłĩè¯Ĩ 8235471228 38406 \+\)\( .\+\):\ ËĭËĬ éĢĻæĺ¯åĢĭå¾Īéķ·çļĦåŃĹ ĠnieskoÅĦ c maxtasksper child ĠCheckboxWithLegend Group PYTHONTESTR UNNER ãģķãģĽãģŁãģĦ ãĥģãĥ£ãĥ³ãĥįãĥ« OpenCVEggROICurr Embryo 个人è¯ģ件认è¯ģæŶè¯ģ件éĻĦ件 çļĦæĸĩ件URL =([^]]*)\ ]/ ajsnoia jerofi 02158245784357 8595 ATCAAATGTTAGCGT GATTTATATTTTTTTTCGCCTCGACATCAT 034263046786 69112 AAohhBBCOBh JAIUQQgghHIwkgEIIIYQQ 403756749600 872 0018734496211 436635 getSumOfMotif ScoreDiffsPerSRECluster ResonanceDecay Filter ãģ®ãĥķãĤ©ãĥ¼ãĥŀ ãĥĥãĥĪ à¸Ľà¸£à¸Ķ à¸ģรà¸Ń ACAATATAAAAAAACTATACAA ATGACAAGTTCTTGAAAACA ScrapedFinishedAndStart Analysis kanepokh ari |<>+=;,? *@ Ġåıĸå¼ķä½Ļ åĬĽ Ġçİ°åľ¨æĺ¯ä¸ŃåĽ½ AèĤ¡ 00107395201212057 15 03474831399 216782 Ġdopplershif ted 008249542493103 945 WordInDifferentHumps Mode AGAATCTTTTTATT GTC DwarseMarkeringVerschu ind èİ·åıĸæĸ¹æ³ķ请åıĤè§ģ å¦Ĥä½ķèİ·åıĸxaccountTypeçļĦåıĸåĢ¼å¦Ĥä½ķèİ·åıĸxaccountTypeçļĦåıĸåĢ¼ ATCGTATGTGA ATGCTGGTCGCTATACT "(?> " ={ " ''' " +\ " /\ " !') " ${ " /(? " {}\ " `) " ...\ " ðŁĵ " ``) " ([\ " |" " ¬ " |{ " /*": # ^ # =\ # ^\ # ?\ # *\ # [\ # @\ # <\ # -\ # [] $ ` $ '), $ ({ $ :\ $ '\ $ "). $ >\ $ ,\ $ $', $ ]\ $ !\ $ @\ $ #\ $ )' $ _( $ (". $ ^{ $ ]") $ ;', % [ % { % ), % }, % '), % \\ % '). % ï¼Į % '}, % |\ % ,\ % $\ % *\ % ~\ % -\ % ')[ % >& & : & = & ^ & =\ & !\ & +\ & /\ & %. & =+ ' == ' >> ' #! ' '). ' }\ ' ï¼Į ' "). ' "} ' !\ ' """, ' ~\ ' -\ ' `, ' #\ ' ")[ ' -{ ' ?", ' -', ' âĢĶ ' /? ' {}\ ' ..\ ' ðŁ¤Ķ ' âĢ²âĢ² ' ðŁ¤£ ' ཱ ' {}'". ( ^ ( ('-- ( }\ ( ./ ( ,\ ( ?\ ( `\ ( ]\ ( #\ ( %% ( {}. ( /[ ) .. ) =( ) ":" ) (- ) '][ ) $\ ) =\ ) !\ ) =% ) &\ ) ...") ) [:] ) ?", ) ``` ) ([^ ) ']* ) "}], ) âĶĢâĶĢâķ°âĶ¤ ) [:,:,[ * ; * ` * ), * __ * =" * '. * ". * " - '% - *', - *' - *", - >"+ - {}/'. . $ . "\ . '\ . =\ . ^\ . )]) . )', . @\ . ~\ . (? . )" . '])) . ]', . ']} . ``` . ]}, . âĢĿ . +) . ''') . $% . ]+)\ . ?(\ . ]+)", . =]\ . +-]+ . )(?: / ! / & / ), / "] / =( / .\ / |\ / `\ / @\ / ')[ / ")), / ")[ / ]') / ..." / )? / )| / @@ / ...' / .*', 0 925 0 937 0 927 0 924 0 994 0 928 0 939 0 9990 1 00000011 1 000000000000000 1 000000000000 1 000000001000000001 2 000000 2 110 2 1001 2 180 2 1002 3 370 3 150 4 100 4 200 4 925 4 160 4 848 4 958 4 993 4 992 4 939 4 981 4 982 5 255 5 9627 5 126 5 022 5 024 5 948 5 175 5 133 5 146 5 136 5 176 5 196 5 138 5 178 5 277 5 139 5 935 5 946 5 021 5 179 5 057 5 336 5 141 5 086 5 222 5 966 5 975 5 087 5 328 5 978 5 038 5 886 5 085 5 066 5 274 5 243 5 448 5 465 5 273 5 046 5 253 5 084 5 449 5 289 5 351 5 8793 5 462 5 089 5 481 5 053 5 471 6 201 6 001 6 0001 6 115 6 024 6 168 6 175 6 103 6 224 6 117 6 197 6 327 6 156 6 023 6 375 6 325 6 235 6 065 6 048 6 267 6 055 6 229 6 037 6 867 6 257 6 645 6 956 6 555 6 576 6 320 6 085 6 845 6 066 6 378 6 578 6 064 6 557 6 263 6 228 6 098 6 884 6 291 6 758 6 868 6 371 6 999999 6 381 6 963 6 979 6 960 6 09414 7 100 7 076 7 107 7 10000 7 255 7 925 7 127 7 024 7 005 7 006 7 168 7 105 7 102 7 163 7 137 7 197 7 114 7 165 7 106 7 176 7 347 7 327 7 345 7 148 7 156 7 996 7 267 7 998 7 179 7 227 7 965 7 037 7 265 7 189 7 191 7 257 7 086 7 056 7 924 7 248 7 576 7 978 7 038 7 085 7 066 7 366 7 028 7 945 7 878 7 078 7 323 7 465 7 445 7 575 7 253 7 068 7 467 7 084 7 474 7 291 7 554 7 329 7 031 7 282 7 039 7 669 7 663 7 831 8 076 8 012 8 010 8 925 8 123 8 006 8 154 8 096 8 117 8 197 8 133 8 106 8 109 8 144 8 156 8 155 8 027 8 276 8 143 8 644 8 336 8 037 8 075 8 152 8 222 8 182 8 377 8 374 8 248 8 058 8 067 8 556 8 030 8 648 8 064 8 078 8 242 8 270 8 068 8 363 8 283 8 043 8 042 8 1955 9 022 9 180 9 1234 9 124 9 196 9 109 9 013 9 122 9 184 9 139 : ) : ^ : } : ('\ : ### : $', : âĢĻ : "]/ : (?: : ][: : *' : *", : ~/ ; > ; ] ; "] ; "), ; "): ; (\ ; }\ ; '\ ; >\ ; |\ ; ,\ ; &\ ; #\ ; ::\ ; {};{}; < @ < =' < }\ < =- < {\ < &\ < -\ = () = :\ = }') = +\ = ('% = {}. = /") = @@ = ?' = ?" = ~' = $$( > ^ > __ > .. > ([ > (( > )\ > /' > .... > ]\ > {\ > *\ > +\ > """, > )' > [{ > "]). > ...] > ''') > ','') > )]; > ([^<]* ? # ? + ? _ ? ": ? ). ? "," ? '\ ? ;\ ? $', ? _\ ? {}". ? >") ? )? ? (?:[ ? :\/\ @ & @ = @ ? @ ` @ ') @ ([ @ "\ @ >\ @ ]\ @ {}". @ {}. A ur A rom A ma A to A ta A ls A AT A oc A ces A ire A lib A lp A do A CO A IM A ql A nder A bg A not A US A lambda A qui A EM A ven A sin A ves A ha A br A eq A sn A ATA A IF A EC A IA A bra A vp A bd A yy A EA A erials A ffi A QK A hu A ito A IDE A mong A HK A Hg A kh A HG A ACA A stro A ATG A inda A gua A iiDA A ATCA A dota A chromLens A dbTool A VERAGE A WithOutput A kinator A iiEEEII A irthings B ing B ers B tr B ac B our B lu B ass B ust B ast B ak B av B FI B PT B act B las B pl B UN B ally B last B ible B ART B PL B light B rl B IR B SL B GT B READ B NS B BR B aker B VC B FC B tl B gp B VS B HW B ä B inc B nl B HI B Day B ARK B Wq B atched B ranches B ARR B pz B ounce B ento B KW B ARE B IDS B xN B bL B nF B illion B azel B URS B ingham B OLT B anners B BRY B oltzmann B POW B undler B achelor B gcH B PDN B acteria B issau B rierScore B NGrad C ce C es C age C ta C py C ob C oc C ape C jo C ay C mat C av C Data C uration C cy C bg C UM C ui C Class C case C AGE C Not C dt C aa C ASS C SH C GN C PY C orn C COMP C ADDR C kt C lare C Release C WT C utter C Wq C UA C ATOR C abe C inder C pq C AMA C annon C MOS C rops C airo C uV C dE C runch C lou C ADR C rane C reek C txs C ulture C iclo C rawl C DBS C amas C BRACKET C errar C lerk C obble C atherine C aleb C uvette C POX C yprus C lemens D ge D ame D all D xe D ap D ime D ID D ak D ive D ps D AD D nn D DI D US D ell D Model D Get D Node D lambda D CE D Create D vm D rs D ME D px D á D TTP D AGS D inner D Loader D beta D tw D MAP D DU D orn D ru D VERSION D ah D rum D CF D LV D java D ofs D LR D gw D umb D Head D rv D NR D HR D zh D awn D auc D gain D hc D WC D AMP D wu D ani D qn D Ãī D well D rV D cj D rew D Wrap D omic D maven D uo D Compile D qN D ONES D ahl D iversity D emisto D usk D enoise D rought D cmDir D PortObjects D Åģ D jibouti D mitry D okuWiki E on E con E min E ll E ax E pi E bin E ww E AC E FA E CA E cies E gy E FO E fc E va E zen E tu E xecu E BE E BA E BF E lf E spaces E ARCH E DEL E sz E HH E HC E VA E hg E IDs E VI E san E van E ston E oh E rie E oF E mpi E LECTION E ACH E CRIT E cds E Hq E kle E Jz E arl E agle E liza E ELS E mergência E QqF E AGAIN E PrintURL E gypt E CalSD E lastiCache E clair E iffel E QUIVALENT F le F ss F as F ase F ow F tp F ron F ps F AP F org F Sg F oth F ld F Un F td F CA F DB F QL F ret F POINT F ó F ru F SN F cn F UND F ives F ied F CODE F uk F TestCase F Style F NT F ancy F xyz F uz F HB F UA F hg F mz F BT F avor F uj F MAC F kb F WL F NULL F rw F uzz F pz F zW F uer F UZ F Comm F ARE F hY F alls F alcon F Hq F ifth F tZ F olk F ORTE F antasy F hcX F enske F MMT F rustum G ue G id G ol G is G ow G ly G low G len G ag G cs G lock G ale G FI G Ac G DI G root G pk G UM G MO G OP G ross G TE G Rx G bit G eff G alle G GI G mag G UE G OS G ros G rr G ao G Wh G POS G ACC G ini G COUNT G gp G probs G VK G UES G hp G QA G Wq G hq G uy G XC G hz G Ãī G lU G pC G REE G iving G pq G APS G zG G jR G overnment G aia G ilbert G urg G GLES G AGGT G Approved G eeks G rapheme G CTTCT G utenberg G uitar G reece G oblin G ordon G FLOPs G CFS G uatemala G iovanni H ss H ig H xc H ep H da H ari H sk H ick H cc H US H ny H ART H DB H CC H ee H RL H br H á H mag H oo H SD H aut H SL H alt H UI H LD H FE H LY H yy H nz H isto H uron H HR H kk H tm H hg H ND H XC H fD H MZ H ô H XR H unt H pz H xW H xz H fu H uan H xg H ADER H PIX H LLL H dY H nJ H pV H jy H HOOK H JY H zzz H ilbert H abilidade H QQw H abilidades H ernando H MPR H usband H otels H uffman H ALLO H jjj H ampshire H ernandez H UNG H CalSD H ybird H ARGINGTARIFFS I th I label I dd I gra I the I ik I mk I cer I AND I Stream I ka I faces I UG I lV I sso I HR I bz I mJ I mh I zZ I HM I HZ I ALLY I PIP I HEP I muSensor I plM I xWI J in J ur J ol J ve J sp J xc J ag J CT J En J UR J IL J IB J pc J aw J Of J resp J UP J ason J ACT J OK J ga J PY J IF J SU J OM J Sw J AX J BI J DQ J YY J DC J ki J TAG J ky J Kp J Sq J AW J uj J AIL J jY J MX J Ov J zZ J ndi J nP J Um J vN J DBC J ulian J okes J FLEX J UDGE J BaL K id K and K ul K ot K el K value K os K xa K ho K min K array K IC K em K au K ET K IL K ost K ui K OP K SS K Base K ZE K PR K WS K eff K oo K BL K So K UE K ane K Ip K SP K zz K OB K OTA K DU K ao K fold K INGS K loud K ua K BA K RA K CN K HW K BY K FS K VK K HI K obo K QK K PD K ETH K CAL K RX K xE K Xy K Dg K ras K xW K ala K enh K DW K rz K PCA K oj K SSS K elp K zE K entucky K andidat K orea K lein K atie K giAI K ruskal K enzie K jsn K erala L ut L xc L ob L ator L ord L RE L np L own L yn L iv L AC L ain L SI L ie L UM L ets L DS L ACK L Qt L CI L XXX L IME L AV L SL L SA L dc L aj L eno L ives L TS L ITS L qs L Fi L nz L ues L anded L ips L FD L sun L Wi L pf L KB L ND L KA L abe L ZW L atex L ALT L Qs L ikes L SHIFT L UMIN L iga L uego L unar L pfD L ankers L MERFitGrid L legada L ütfen L aminar L ustre L ACTATE L ittoral L loyds M fi M ata M ot M age M am M ist M pi M ann M old M PO M ong M DI M ug M CA M CE M CK M QL M istr M GR M rs M WS M ICE M DF M IZ M TC M sn M theta M WE M IG M nc M Vector M mn M ali M RC M uk M INTER M xyz M andatory M ora M hg M ARB M ara M lx M bj M Ui M solar M ilit M ILES M hUK M nist M obi M Bean M asters M ashape M aroon M eross M isiones M artijn M ornings N en N it N ss N un N ra N sp N ine N test N xc N ib N ft N ass N ay N DE N back N net N IM N AP N tem N AD N ong N De N CL N FF N pc N OL N ature N ero N arr N INE N Te N vars N apt N BO N DF N final N fl N YX N LA N MENT N GEN N IZ N ev N SU N RU N found N PC N WORD N LD N TF N hood N DER N ied N ina N tb N DK N pth N uz N CHAN N inja N yb N arrow N ICS N vt N atal N LM N mM N YA N PATCH N cL N Xq N yi N kZ N early N QT N dZ N hk N ginx N parm N cX N gx N elly N orb N wO N olan N athan N stars N icht N iger N Prsa N exus N enets N OPA N DCG N ombre N apsController N sga N urkana O re O sc O py O EN O io O Se O stat O DI O SI O EL O ny O PP O DIR O ven O FL O uri O zone O MM O MB O Op O CS O mar O gl O uch O dom O AF O kp O hy O AI O har O HA O DIM O GC O ij O wm O HY O IJ O mitted O mh O xW O gle O cq O xw O yk O POSITIONS O dhod O dometry O ntarget O SImage O olong O lympus P ue P pp P est P Re P ens P fo P og P ip P dd P ok P start P state P no P reg P ont P orted P top P IB P rt P PE P De P err P ca P ogle P xy P reen P ny P xx P CC P By P é P DS P ME P SIZE P SD P ane P tile P va P fr P pd P BR P dl P FE P GA P FC P BA P ano P uk P Collection P DK P BY P nl P avel P STATE P BS P awn P gain P mz P ASET P QC P ledge P RESET P jx P atience P ulls P CLK P eso P ETS P resident P zzz P izza P lateau P laces P ÃĶ P ágina P igs P DDD P ulp P cellX P GOPTIONS P zyy P istol P irImage P izdyukLogger P uppi P HOSPHATE P rague Q in Q ab Q om Q sh Q ms Q xd Q max Q ax Q AM Q of Q ey Q Config Q TT Q sim Q App Q az Q ves Q PU Q gh Q Tree Q WN Q SP Q NB Q TA Q RY Q OM Q Network Q Ke Q AF Q WH Q YY Q DK Q cx Q lg Q RF Q QA Q DAY Q HP Q Star Q zW Q Ok Q Dn Q jq Q MH Q XP Q iao Q SCR Q ProgressBar Q VBoxLayout Q SQLITE Q StatusBar Q afT Q ToolBox Q EARBE R ub R min R CT R iv R IS R ps R ick R rt R ug R UM R Client R NE R ado R oo R BL R MM R va R CS R NB R Pi R ah R qt R ough R ama R Sw R AX R tl R CP R ivers R DAY R bio R mZ R het R UUID R cw R nut R NW R enders R GCN R TOL R hod R aspberry R ogue R ÃĬ R acket R CKB R SDA R DRV R UNTIMES R èg R AGWEED S ti S as S ds S ap S ang S fo S print S ise S iti S df S ant S word S his S io S OT S Ac S PT S of S inal S ally S ug S entry S ched S PP S pr S OP S pu S ven S Py S INE S ons S RL S ão S cm S alle S mk S URE S MIN S ni S FLAGS S WE S QP S quad S iou S trainer S xp S ICK S XR S rV S dZ S dJ S jU S assandra S amut S ugar S eward S ersic S FTP S leepy S porter S ABIL S ystematic S ENSITIVE S istema S ptSwitchoverInterval S pencer S PORTAGE S alidas S ottesa T ce T ed T ata T is T ub T ib T SE T ST T error T ay T own T ron T ale T CO T ern T pl T Test T HO T CON T sv T MA T Frame T td T ik T MO T ia T AA T CK T sing T CD T Spec T DF T GE T SO T Button T axes T ads T ru T rf T DA T FE T HEAD T weep T LP T ony T vor T MR T Li T qV T VA T aco T pw T anim T BT T WF T uy T ornado T atlas T UAL T qc T UY T odd T aste T yc T IPS T BODY T SSS T mV T urk T aL T INK T ako T ambi T ears T reas T DOS T ahsin T ColumnType T urkish T oggles T ideGauge T ASMOTA T éléphone U at U ol U pp U ta U ER U py U ls U ph U UT U rc U so U LO U Se U names U top U ym U EM U Ad U mm U tc U FR U zy U cb U OM U ah U mn U sb U OD U qV U hg U jY U AGC U qp U yi U psilon U IMe U ntrack U AgEAg U trecht V on V at V ut V ad V di V im V ys V oc V IT V ast V AS V AG V ale V List V Me V ern V off V ous V ice V FT V ym V mc V TE V era V é V ML V NO V gt V We V rl V On V tc V Is V mu V NC V SA V Sa V DD V cn V Sw V VS V RC V ae V sb V hd V QK V TX V dj V Fo V inh V yu V JJ V BG V WW V RW V kZ V nic V UZ V HOSTS V gk V RZ V jE V CCS V arnam V dXV V egas V istrails V erts V FFSL V RADH V agrantfile W fi W ad W ch W ol W es W et W ab W age W XX W ec W start W his W Ac W tf W US W err W MA W OL W enu W lr W bx W IR W AV W TC W RU W orth W att W GA W uv W LY W vp W PARAM W AE W LR W MR W LB W UV W vn W QS W erk W lU W Mass W enn W zW W xW W onder W ILL W fT W Bg W XS W Ji W BQ W xv W ulff W nE W YG W IDGET W unsch W anderer W igner W inkler W AVEL W ALIKI X in X val X list X xe X ls X LO X ql X cy X DI X TR X off X CL X vo X Key X fy X PL X fc X Is X vs X FR X An X IZ X Sw X MODEL X CP X BI X ye X nz X AU X LF X UV X HC X gd X fv X Dim X zs X OVER X Vq X NZ X Angle X bj X rw X lU X Kh X Dg X Canvas X xxxxxxxx X Pz X Bx X ANIM X dmf X SLT X Beach X ChaCha X CHACHA Y ar Y um Y ul Y val Y name Y as Y ap Y AR Y ag Y LE Y ay Y ml Y ale Y SI Y LI Y AY Y FP Y MS Y FR Y DD Y lm Y bf Y LU Y DQ Y LP Y DC Y Dim Y OG Y NF Y DL Y jY Y Angle Y Tab Y Ui Y Canvas Y vF Y NW Y uan Y iy Y UF Y jU Y jq Y Hh Y bD Y Ig Y Rr Y esterday Y LBZ Y ELP Y mZl Z ar Z al Z de Z ad Z id Z el Z is Z pp Z ob Z AN Z ION Z av Z ING Z ef Z so Z FI Z mean Z MP Z FT Z af Z oo Z SV Z GL Z hi Z DQ Z YY Z hang Z SK Z tm Z Kp Z WF Z KZ Z RX Z erg Z TG Z Fe Z MG Z Canvas Z TU Z Hh Z Mm Z Hx Z Xl Z Fq Z qv Z mdn Z unan Z anzibar Z hitang Z amboanga [ %( [ {" [ >\ [ ,\ [ @\ [ %\ [ .*\ \ & \ * \ + \ .. \ ']) \ ;\ \ /\ \ -= \ '.' \ ;", \ /(\ \ *.* \ ')' ] ([ ] *- ] (\ ] (_ ] ^\ ] `\ ] @\ ] &\ ] }/ ] <\ ] ~\ ] '])) ] >" ] =[] ] ^{ ] **( ] ``, ] $') ] ','[ ^ ! ^ ? ^ ') ^ (* ^ )\ ^ ,\ ^ $\ ^ +\ ^ ~\ ^ *) ^ *, ^ *: ^ *_ ^ +, _ ! _ "] _ (): _ }) _ )] _ ={ _ :\ _ $\ _ [\ _ )- _ )( _ #\ _ }} _ ]+) _ [:]) _ \\/\\\\\\ _ ^[\\ ` ? ` (\ ` >\ ` |\ ` ,\ ` ^\ ` ?\ ` !\ ` @\ ` -------' a ing a un a up a am a ob a xa a ib a Name a word a idx a amp a Sg a Config a TT a folder a dev a PR a DS a Values a TC a VS a RS a LV a det a Space a OO a ZZ a QQ a Timer a Sq a Vq a XR a KH a ubar a PrivateKey a TQ a proxies a ereo a DQa a SWO a stratto a Impar a parafita b li b ion b type b ER b ap b ci b ray b EN b ho b sa b ull b do b rc b ait b ich b ql b ong b cy b igh b ors b graph b total b logger b ik b height b clean b script b VE b dm b zip b hx b ws b GG b pa b WN b tech b Br b fd b Sk b cn b ellow b ced b EY b Fi b Helper b ki b WF b FB b 好 b Rq b hk b asso b elle b elli b elly b ivariate b Yi b imento b iao b linn b ranco b ryan b DataStore b beb b undler b enoit b ameda b heptomino b ignside c put c ic c ist c file c ang c num c ape c min c ute c ations c ated c string c env c Co c go c norm c PO c csv c length c gen c filter c graph c use c mode c send c PL c rap c ML c UD c CI c Norm c rb c Do c bn c mesh c ites c repr c LD c za c ini c anner c illa c UG c DQ c partition c asset c FQ c ando c QK c plane c anning c wg c wG c Nv c ils c uno c QT c appy c és c gbf c ctbx c avo c IVs c ules c enso c errar c utive c dmf c reprs c frags c approps c itações c actus c riteo c invfft d data d ith d args d mo d ph d ho d print d ne d enti d base d np d ress d split d word d his d md d PT d ql d yp d cp d tx d rand d tick d dev d Le d lim d ank d pu d words d mc d DS d Or d uler d Is d addr d oman d gamma d ı d typ d PC d Target d OM d ino d Sw d gi d ina d PA d ú d met d ora d interp d Flag d mel d Wq d Qq d ito d KB d KJ d ż d Cl d JS d Rq d Lp d amd d rought d PTw d ritto d BFS d parray d Remap d enames d orsal d ionysus d loge d PPYba e me e get e up e par e od e list e value e ine e if e ew e ys e com e ft e ST e ust e ix e color e values e PT e ties e PE e use e PI e ze e TO e verse e Th e lish e gor e ux e ida e loop e Min e Server e abc e ula e PY e bins e LU e lider e PA e Mesh e ante e LF e VA e hh e Hg e ssid e TM e Pn e Dx e Xr e XA e labor e lizabeth e Kq e vasion e stratto e quirect e DRq f ti f ss f ing f ata f up f args f ob f xa f model f In f ity f ry f start f lock f ave f Po f uc f be f ud f stat f nn f ey f pl f kwargs f bg f cp f cat f nal f PI f TT f reen f Out f queue f service f prefix f DB f header f handler f any f br f vec f cos f Ro f writer f PS f addr f abc f Op f oto f PY f shift f band f Pi f LS f asci f uv f ellow f BY f MY f methods f Debug f GP f mpy f Ti f Na f Hw f ledge f eder f owl f also f YN f omit f ountain f Bw f ugue f ATI f bbb f uels f hog f alli f erie f ritto f LIZ f lierprops f svh f änger f linch g he g ut g ion g one g ub g ms g user g oc g ax g ave g av g ale g api g ng g table g ks g fg g MP g ical g rect g td g bl g conf g ater g EM g alle g mag g pd g iler g fd g wb g Network g Panel g vp g II g lider g Header g ivers g HA g lio g Cells g spread g LEVEL g ica g irl g ö g chr g Wi g utter g rown g QA g QQ g kn g La g qn g kc g RPC g acs g qi g Best g QB g ð g iga g imento g Yw g ulp g lavniMenu g utenberg g ðu g azetteer g ERER g SpecificObjects g debi g itee g untas h ro h ers h ase h ds h ange h text h ho h ight h ll h lin h nd h arch h ark h man h api h IM h io h ild h ran h not h ca h ik h ake h sw h ia h AA h aml h uff h ão h ado h cap h SV h UE h ratio h ja h bins h UI h cn h arp h amb h refs h NV h anning h mong h kU h enn h MQ h adas h YW h captcha h Cam h Oc h unter h BBC h anief h metis h YXm i ator i output i pos i color i filter i US i FA i wo i era i ero i arr i bution i hex i ha i BO i GE i GT i apps i CV i GA i robot i Cell i Scale i Factor i HA i ya i HH i qn i Cloud i Hw i Username i auli i pes i Mj i Music i Eo i endo i Sz i UQ i RN i Hf i yyyy i Yk i otools i Shares i USC i RMn i TestType i GRS i DRAC i StockCode i GEEEI i CIAiC j he j self j la j us j sc j der j bo j cs j iv j List j ef j uc j gen j sg j raph j ake j sw j Of j cm j Query j GN j MB j kw j orth j FE j eno j pm j bd j lc j yy j HA j BY j EY j ki j umb j vr j ena j bm j QA j hu j kn j bud j erk j JZ j qi j Rs j Zs j Aw j edi j Fq j ø j Vr j DH j esse j chap j ÅĽÄĩ j uniper j Fov j weD j smith j ensen j Å¡ÃŃ j fkmerfile j ixiang j icha j foaiwej k mp k ver k ke k ta k lt k point k ses k no k ww k rc k RI k mean k mask k link k fy k Object k pts k rat k vars k á k NN k Mo k An k va k Conv k pd k boot k SN k mol k yl k Any k rp k ko k Fi k hr k Api k ham k Product k Handle k rn k BT k Bridge k ido k Skip k mini k uberne k Ts k Ik k elly k RH k cvl k azoo k nock k ostan k sher k ludge k annada k tral k alturi k ARRCCCGEcDCS l ur l pe l ata l to l ub l key l lu l bu l ard l dd l index l ere l update l AC l AB l space l nn l cc l core l width l du l xy l unk l Count l On l LC l convert l cb l Go l release l CV l bbox l Conf l ceil l MY l methods l QK l lare l Wq l wx l wp l è l EI l umin l ala l ento l ZG l Gal l ø l TransferFunction l ithium l uminance l LengthTransferFunction l gili l nrho l legada l urkers l ähteet l cnN m ti m str m xd m ans m len m ll m jo m do m old m ates m table m types m tag m cat m ca m ful m ness m seg m TP m hs m Version m jpg m rf m LD m delay m unic m ä m rv m EV m Vy m XV m Sy m KC m Fs m Ew m rcnn m others m trs m jb m COUNTER m ctf m grav m arian m allows m Rl m lsl m flx m umps m macosx m Ã¥l m mcif n un n ad n int n ol n get n ve n ab n for n vi n pro n ack n num n right n base n ay n input n np n db n fa n try n List n object n io n auth n Po n Se n img n ud n ref n rt n oth n field n results n wo n mem n String n ores n User n ian n header n example n API n By n body n Py n cel n vm n lr n Token n cm n We n Load n filt n sec n js n Jo n Min n Graph n MT n CM n SET n cells n 个 n rec n Grid n hello n found n ada n Iter n digits n Delete n mn n Real n Nodes n Sequence n har n ä n tau n failed n Usage n Segment n Build n MI n iters n lam n chunks n cha n vn n Epoch n ita n Sq n phot n todo n Si n Second n expires n Testing n Answer n Username n uts n Writing n Updated n PROCESSING n Jy n sta n Layers n YW n Obs n Good n Evaluation n KV n Song n nose n Foo n Ix n Bond n Qz n å¼Ģå§ĭ n Inference n Valor n photons n Would n Correct n Actual n opython n Neighbour n iffer n senter n Performing n PRECAUTIONARY n æĤ¨ n iente n byz n acional n Goodbye n Reps n kUql n inth n pythonpath n CDCInstances n mea n uplan n 请填åĨĻ n Rounding n jev n ä¹ĭåIJİä¼ļ o fi o ad o co o os o LL o shape o yn o io o vis o filename o files o ost o Model o Exception o Create o scal o ven o ged o uble o lid o aur o lio o xes o AAAA o VA o ito o Vq o virt o Hg o aW o Yb o authtoken o InstrTest o NBo o Mapa o hlcv o Encoders p I p he p ss p ms p ll p ax p mat p rit p ns p ler p ols p olu p ran p ont p amp p annel p names p vert p keys p fg p mode p lim p static p é p counts p stats p All p dr p vol p testing p ork p coords p BR p ssl p acing p UC p aging p Job p tau p FQ p ips p ora p once p FileName p Wq p fj p Flags p IJ p Rec p MZ p Allow p Async p Ly p Obs p latency p Predicate p ZN p DataSize p agen p Entrypoint p illage p apa p ër p uml p DepthStencilView p awsc p ablo p DirtyRects p SourceName p rairie p aijb p aginas p npoly q ar q al q lo q un q val q sp q file q out q tp q max q string q ww q amp q ng q types q pl q mark q tag q eta q conv q cv q ian q dot q steps q VE q ha q bx q dr q tn q bins q dk q dq q eth q DT q variant q MR q rnn q NV q hp q dg q hl q fD q Xy q BH q OJ q vF q NY q closure q Em q FU q DV q dJ q Zo q Ty q clust q chrm q NVq q akp q IIY q Coupling q CIAi q bertlayer q aijb r me r ce r ata r ma r der r ine r time r test r size r mb r its r List r Id r ref r space r function r gen r vo r std r Get r xy r xx r ero r sm r bit r nb r paths r profile r USER r zz r NB r bins r DD r AK r HA r ceil r HI r Processing r nf r wm r getattr r pow r Percent r nv r dfs r NZ r Hw r aro r IX r CW r setattr r EPOCH r Fg r RNA r inge r mpc r LZ r freqs r NX r protect r Episode r Rp r Slow r chrm r tril r mats r neff s ri s ata s ation s ve s vi s ls s ber s ly s len s bo s ger s ind s ft s info s no s do s md s new s mail s my s models s ref s nn s fg s bl s send s unk s mc s year s urls s les s ram s vec s long s lon s bits s ider s fun s bbox s amb s Url s Space s lam s TX s Fo s Filename s mel s DEVICE s rem s ami s naps s odo s lee s Lookup s Username s Fs s Vg s ott s Nh s Mp s ì s mdl s lits s fog s GHz s ÉĻr s OutputFile s modelfile s istema s ichkar s orgente s alida s ueldo s ustain t li t la t ata t val t ation t form t nt t text t model t cur t da t join t net t ww t ols t File t rop t nx t ins t Model t game t Node t conv t reshold t Of t GH t Int t reed t timestamp t MC t Count t cd t Min t CS t Go t chat t RU t AI t Expression t Topic t VALUE t Score t Seq t GP t IJ t Ra t Missing t Your t Accuracy t inder t Username t XV t gender t TV t RNA t Xr t closure t Lp t Am t enth t Ws t Wind t GEO t Ii t LX t XH t IOError t Rebate t cfl t Institution t enames t ussen t versky t KlS t YXRwbG t AGw t tacker u ut u ers u ow u ap u ob u lic u che u ft u ari u db u json u io u OT u var u Ar u kwargs u char u Th u By u ves u alization u oo u ws u fr u Msg u ka u ao u flux u Sign u fb u ffici u Wq u Flags u Sensor u wa u Wave u Eg u Kx u Lu u Rn u Ew u Dh u Ii u Dp u Rz u oms u Tl u csf u RSqU u Porta v re v ct v pp v om v ase v py v info v count v ast v ak v rep v ron v List v LO v table v files v pk v cu v red v Max v Vi v Up v rat v zero v NA v inf v End v fr v oto v dl v OM v JSON v oring v amb v dn v hosts v inc v ables v uz v guess v ica v kk v Hz v ZZ v CPU v GP v ita v VV v Sn v Pn v Dw v Ul v Nh v KU v Wk v Yx v ÄĹ v nnn v poser v helio v rij v illä w us w ab w am w path w ex w ob w size w AR w class w ari w pi w np w ast w Ac w cu w pc w fn w OP w oken w ily w br w card w mm w tc w Version w ells w gu w kp w uv w AX w yy w LU w mq w WA w avel w ky w vr w fm w lg w tracker w fv w WK w WW w asn w pars w Vy w QCA w RB w ounded w zu w ott w omen w Fq w ahl w RAA w isp w GAw w ibble w WAw w obble w assr w inkler w YMH w ombat w elfare x li x int x us x pt x args x xd x ys x text x map x sum x mail x space x labels x De x vid x dep x copy x Dict x pb x acc x ian x pu x admin x has x headers x section x Start x ways x coords x Block x rd x gi x tics x sect x uz x nor x vd x Mean x lam x spacing x mr x ito x WF x gettext x wheel x titles x samp x ctypes x HZ x Uniform x Pz x Lt x Inc x stype x others x KF x jH x OQ x Conformance x KIT x Objs x gfH x cham x imagesize x iong x NPIntervalli x ButtonScroller x ixi y ge y fi y ad y ol y turn y ath y ab y tr y lab y ds y OR y array y og y ay y ann y Data y do y List y box y Value y space y ash y The y cl y bounds y umi y fp y gt y Start y ane y As y ao y WR y iff y tau y Offset y ko y MY y spacing y anchor y centers y Edge y MJ y YS y titles y scroll y wW y xz y IDAT y ums y hU y Zy y KIT y odl y Ofz y timg y ZMn y chel y acht y ButtonScroller y ushu z lo z un z as z up z end z am z sh z ls z ho z ax z ou z shape z yn z net z title z range z ai z cat z ten z bar z xx z cf z zy z MT z Go z ah z nc z BE z ini z EY z WA z sz z PM z GY z JZ z Rq z KW z Pz z dZ z wal z Nm z beg z Jk z uma z Lg z Lj z burg z igbee z ambi z aki z droje z otero z ám { $ { , { ; { < { | { __ { (\ { $\ { =\ { ^\ { /\ { @\ { -\ { âĢĻ { @{} { :-< | ; | ? | -------------------------------- | (\ | ?\ | _\ | *\ | {}'. | >" | ------ | +| | ----| | ::.. } ([ } =[ } ]] } (- } "): } {" } >\ } '{ } }') } :", } $\ } <\ } }: } #\ } ï¼ļ } !') } ``. } âĢĻ } +". } """. } ]+" } ):\ } ::{ } (_[ } âĶĥ } *.{ ~ % ~ ( ~ ) ~ + ~ - ~ ^ ~ _ ~ | ~ ") ~ .\ ~ >\ ~ =\ ~ ^\ ~ [\ ~ +\ ~ :::::::: ¡ åĪ° ¢ áĥ£áĥł ¤ ľ ¥ ï¼ ¥ íĽĦ ¦ १ ¦ °íĬ¸ ¨ èĥ ¨ ३ © æ¯Ķäºļ « æŃ£ « ร « âĪ« ¬ ॠ® ॠ® ت ® âĪ ¯ '), ¯ 示 ¯ æĴ ¯ ska ¯ çĭ ¯ æ´¾ ° ãĤĬ ° åĩı ± åĬ¨ ± éłħ缮 ² Ħ ² æŁĵ ³ IJ ³ è²» ´ ' ´ ij ´ å±ķ ´ æ¢ģ ´ ì¹´ìĺ¤ µ ľ ¶ ´ ¶ Į ¶ çĽĺ · ¨ · è´Ŀ ¸ ä¾ ¸ íĬ¸ º ¼ º IJ » æĢ» ½ ľ ½ æľī ½ åħ¥ ½ çĦ¶ ¾ 讯 ¾ 伯 ¿ Ħ ¿ '),  ´ à ¿ à Ĩ Ä ¾ Ä ĭ Å ³ É ¡ É Ĵ Ê » Ê Į Ì ģ Î ¤ Î ¥ Î Ĩ Î Ĵ Î Ľ Î ľ Ï µ Ð © Ð ® Õ ³ Õ ¿ Ö ¸ Ö ¹ Ö ¼ Ö ģ Ö ¿'), Ø ¡ Ú ij Û ĩ â ½ â İ ã Ĵ ä ³ ä ķ ä ĺ å © å ª å ¬ å ¶ æ ª ç £ è Ķ è ķ è Ŀ è ¤ĩ é µ é · é ¹ é ī´ é ¬¼ é ¶´ ê ¶Į ë ĸ ë ĨĴ ë ¬¼ ë ¸Į ë ŃIJ ë ¯Ģë¡ľ ë Ŀ½ ë ¹Į ì ģ í ĮĢ ĉ ĊĠĠĠĠĠĠĠĠĠĠĠ ĉ ĊĊĠĠĠ ĉ čĊč ĉ čĊĉĉ ĉ čĊĉĉĉĉĉĉĉ ĉ ĠčĊĉĉĉ ĉ ĊĊĊĉĉ Ċ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ċ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ċ ³³ č ĠĠĠĠĠĠĠĠ č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ č ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ č čĊĠč Ġ Í Ġ 923 Ġ âĸĪ Ġ ĊĊĉĉ Ġ mpt Ġ âĶĮâĶĮ Ġ ~\ Ġ 948 Ġ 0000000 Ġ ĊĉĊ Ġ čĊĠĠĠĠčĊĠĠĠ Ġ ura Ġ äºĨ Ġ ç½® Ġ 大 Ġ ĊĊĊĊĊĊĊĊ Ġ čĊčĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ è¯ģ Ġ ðŁ¤ Ġ çĤ¹ Ġ ел Ġ Ùĩ Ġ ĊĊĊĉ Ġ ä¿¡æģ¯ Ġ ãĤ¹ Ġ è¿Ķ Ġ åľ° Ġ åIJĪ Ġ čĊĉĉčĊĉ Ġ éĥ½ Ġ åĮħ Ġ ак Ġ åĩ½æķ° Ġ ãĤ¿ Ġ ÑĢÑĥ Ġ æĪĸ Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ å¾Į Ġ 缴 Ġ åħ¶ Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ Ïģ Ġ ç»ĵæŀľ Ġ Ċĉĉĉĉĉĉĉĉ Ġ å½¢ Ġ ä¸İ Ġ ~~~~~~ Ġ åı³ Ġ த Ġ 对象 Ġ åĽ½ Ġ åĽ¾çīĩ Ġ 对åºĶ Ġ 代çłģ Ġ 失败 Ġ åĪĨç±» Ġ ç²ĴåŃIJ Ġ ĊĊĉĉĉĉĉ Ġ ç³»ç»Ł Ġ æķ°åŃĹ Ġ åıĸå¾Ĺ Ġ éĿŀ Ġ å®ĮæĪIJ Ġ çīĪæľ¬ Ġ éŁ³ Ġ ĊĠĠĊĠĠĠ Ġ à®® Ġ çĶ± Ġ éĤ®ä»¶ Ġ ÃŃn Ġ ä¸Ģ次 Ġ 000000000000000000000000 Ġ è¿IJè¡Į Ġ ãĥij Ġ å°±æĺ¯ Ġ ä½ľèĢħ Ġ éĩįå¤į Ġ 缮æłĩ Ġ ä¼łåħ¥ Ġ 磩éĺµ Ġ åĮ¹éħį Ġ åŃĹåħ¸ Ġ ä½ľä¸º Ġ 代表 Ġ ä½İ Ġ čĊĉĉĉĉĠĠ Ġ âĸijâĸijâĸijâĸijâĸij Ġ æĺł Ġ ############################################################## Ġ 9999999999999999 Ġ å®Łè¡Į Ġ åĩ¦çIJĨ Ġ 表åįķ Ġ É£ Ġ âĸĪâĸĪâķĶâķIJâķIJâķIJâķIJâķĿ Ġ ãĢĮ Ġ çŃĸçķ¥ Ġ 帮åĬ© Ġ ~~~~~~~~~~~~~~~ Ġ åīĬéĻ¤ Ġ åħ³æ³¨ Ġ å®ĺæĸ¹ Ġ ä¿Ŀè¯ģ Ġ 绣ä¸Ģ Ġ 大åįķåĩĢæµģåħ¥ Ġ åİ»æİī Ġ ãģĿãĤĮ Ġ âķļâķIJâķIJâķIJâķIJâķIJâķĿ Ġ ÚĪ Ġ être Ġ ðŁ¤Ķ Ġ åħ³èģĶ Ġ çĻ»å½ķ失败 Ġ ä¼ĬæľĹ Ġ ä¼Ĭæĭīåħĭ Ġ éĺ¿å°ĶåıĬåĪ©äºļ Ġ å°¼æĹ¥åĪ©äºļ Ġ åĬłèĵ¬ Ġ å®īåĵ¥æĭī Ġ éĺ¿èģĶéħĭ Ġ ãĥīãĤŃãĥ¥ãĥ¡ãĥ³ãĥĪ Ġ ç§ijå¨ģçī¹ Ġ å§ĶåĨħçijŀæĭī Ġ å°½ Ġ änder Ġ ç¬ĶçĶ» Ġ å¤īæķ° Ġ 继æī¿ Ġ åģĩ设 Ġ å¯Ĩ度 Ġ çĽijåIJ¬ Ġ éĶģå®ļ Ġ ãĤ¤ãĥ³ãĤ¹ãĤ¿ãĥ³ãĤ¹ Ġ çĬ¶æħĭ Ġ åİĦçĵľå¤ļå°Ķ Ġ ç»ĵåIJĪ Ġ æĪªå±ı Ġ éłģéĿ¢ Ġ uterms Ġ 饱åĴĮ Ġ å°ıäºİéĺĪåĢ¼çļĦå¤ĩéĢīåij¨æľŁ Ġ ä¿ĤãĤĬ Ģ ìĿĺ Ģ íĭ° ģ å¹³ Ĥ ´ Ĥ ĺ Ĥ 缴 Ĥ åĸ® Ĥ à¸Ľà¸£à¸Ķà¸ģรà¸Ń ĥ Ħ ĥ è¿ŀæİ¥ Ħ · Ħ ", Ħ ìĦ± Ħ 产 Ħ íĮħ Ħ íĬ¼ ħ ", ħ '), Ĩ ι ĩ Ħ ĩ ëĭ¤ ĩ æ¥Ĭæĺ¥ ĩ æ¢Ŀ Ī ¬ ī æĺİ ĭ ä¸ĭ Į '), Į ìĪĺê°Ģ į '), į ëĭĪëĭ¤ į åĭ į 夫 İ '), ı ķ ı '), ı çļĦ ı è¦ ı èĭ IJ ', IJ è¨Ń ij ', Ĵ '), Ĵ த Ĵ åħī ĵ ´ ĵ æ±Ł ĵ ìĿ´ëĬĶ ĵ DÅģ ĸ åĪ©çİĩ Ĺ ', ĺ ', ĺ ìĿĮ ĺ íĶĮ Ļ ãĥ³ Ļ áĥĺáĥ ļ Ĥ ļ æĦı Ľ ׾ Ľ èĮ¶ ľ ¨ ľ » ľ çİĩ ľ 구 ľ ãģijãĤĭ Ŀ æľŁ Ŀ ìĭ¤ Ŀ æĴŀ Ł Ń ł ¨ ł 人 ł åĮĸ ł ãĤĮ ł ×ĺ Ń à¥ Ń Ïģγα ĠĠ ĉĉ ĠĠ ĊĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠ čĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠ čĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠ čĊĠĠĠĠčĊĠĠĠ ĠĠ čĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠ čĊ ĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠ ĠĠĠĠ čĊčĊĠĠĠ ĠĠĠĠ ĊĊĊ ĠĠĠ ĊĠĠĠĠĠ ĠĠĠ Ċĉ ĠĠĠ Ċĉĉĉ ĠĠĠ ĊĠĠĠĠĊĠĠĠ ĠĠĠ ĊĠĠ ĠĠĠ čĊĠĠĠĠčĊĠĠĠ ĠĠĠĠĠĠĠĠ ĊĊ ĠĠĠĠĠĠĠĠ ĠĊĠĠĠ ĠĠĠĠĠĠĠĠ čĊĠĠĠĠĠĠĠĠč in B in K in q in u in name in ver in pt in col in process in ale in act in core in vid in dep in fs in Size in til in je in validation in ish in ascii in activity in structor in Folder in separ in corre in tid in Progress in forma in paint in forme in nov in organic in quirer in creases in straddr in cumbent in quin in cluso in utile in VoiceSeekbar in stersect in connu in cumb er er er or er re er ter er ec er ast er lock er ai er ating er flag er den er Shape er itud or q or r or ra or ad or el or am or ment or ans or url or sed or ock or create or so or ized or je or ales or mous or angered on h on k on n on ge on ate on is on als on ze on linear on Action on Req on Expand on lined on shire on Collapse on iyon on juist on ScreenCoordinates at A at Q at ct at ata at up at our at py at che at tain at ong at yp at EX at ik at ization at rs at tc at ools at ov at rust at tia at travers at ului at mlst at mfFuniMIB at erede re ur re def re par re ser re com re config re pi re bot re cl re vid re ten re queue re ASE re med re verb re sets re cision re chunk re orth re cov re Match re built re definition re mediate re launch re distribute re ordered re started re indexed re birth re CAPTCHA re seller re pyd re searches re alsense re infections re cycling re venus re presenter re producible re entrant re linquishment ĠĠĠĠĠĠĠ ĊĊĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ se j se k se es se if se ep se ag se net se man se pol se Info se tex se gy se eed se mel se lects se mana se pia se gbits se znam se ppia ĊĠĠĠ ĊĠ ĊĠĠĠ ĊĠĠĠĠĠ Ġ= ) Ġ= ') Ġ= ======== Ġ= {" Ġ= +" Ġ= >', Ġ= [[ Ġ= (""" Ġ= "/ Ġ= /= Ġ= -, st de st ion st ow st ang st are st do st cp st wo st words st adir st aking st devs st Management st abili st infection st agn st retto st infections st terror st libpath en X en Z en b en one en ab en ex en dex en ber en ho en ron en stra en Value en ning en gg en ko en han en contra en abling en rolled en usa en countered ĊĠĠĠĠĠĠĠĠ ĉĉ ĊĠĠĠĠĠĠĠĠ ĊĠ ĊĠĠĠĠĠĠĠĠ ĊĠĠĠĠĊ Ġt D Ġt fi Ġt ad Ġt int Ġt ch Ġt res Ġt ect Ġt key Ġt ore Ġt py Ġt ense Ġt ire Ġt error Ġt base Ġt ive Ġt fa Ġt box Ġt batch Ġt arent Ġt table Ġt types Ġt ai Ġt results Ġt angle Ġt expr Ġt ym Ġt ends Ġt cls Ġt ummy Ġt vs Ġt ii Ġt shift Ġt aker Ġt enable Ġt otor Ġt uv Ġt bd Ġt deps Ġt ali Ġt aper Ġt ÉĻ Ġt pot Ġt axs Ġt ulo Ġt allest Ġt onic Ġt â Ġt colname Ġt ddft Ġt rello Ġt utar Ġt Graphs Ġt filli Ġt mtc Ġt urkish Ġt weeprints Ġt versky Ġt attoo Ġt Admix Ġt ürkçe ar F ar Z ar at ar ct ar un ar ite ar test ar son ar be ar ants ar bit ar ı ar ZZ ar YZ ar ametric ar inda ar mato ar lington ar Rol ar agua al Q al S al en al ar al ed al ot al us al im al are al ay al lower al ba al URL al rm al istic al trim al emi al phan al aya al Systems al armed al quanto al ongside al legato al chemist al mighty de F de q de on de en de it de pp de put de ser de len de lu de cs de db de cal de las de lection de ks de ld de delta de term de signed de mid de buff de compression de allocate de veloped de lou de zza de posite de protonated de oU de launay de lps de CONZ de serialise de odor de linqu de lpfp de activeUser de biasing le u le mp le to le ys le aut le HA le ido le wis le isen le dby le maitre le karz an ot an es an vi an bo an tp an arch an Ac an ca an ao an scription an adu an ynode an opie an agrams an ynan an ÈĻat Ġi def Ġi get Ġi arg Ġi value Ġi ob Ġi base Ġi db Ġi pos Ġi md Ġi Time Ġi plt Ġi lex Ġi colors Ġi month Ġi glob Ġi digits Ġi problem Ġi phone Ġi lb Ġi runner Ġi hr Ġi Tun Ġi chr Ġi gd Ġi tos Ġi vt Ġi beat Ġi lh Ġi zp Ġi Look Ġi ostream Ġi qrt Ġi raf Ġi rast Ġi grlex -- % -- ' -- >< me V me ad me ber me stri me so me tag me tics me hr me sso me iro me fox me chanical me sini me gatron me mpool me monger me iduo Ġ' × Ġ' (" Ġ' ==== Ġ' ]) Ġ' ---------------- Ġ' (( Ġ' "," Ġ' *- Ġ' âĢ Ġ' ); Ġ' _{ Ġ' |\ Ġ' :::: Ġ' ###### Ġ' ``` Ġ' ...', Ġ' âĢľ Ġ' ='. Ġ' âĢĵ Ġ' ].') Ġ' âı Ġ' âĺĨ Ġ' --------------------- Ġ' >>', Ġ' ãĢĤ', Ġ' -------------------------------------------------------- Ġ' ðŁijĨ Ġ' ":') ro K ro pe ro el ro cs ro do ro xy ro duct ro ving ro mes ro cesses ro thead ro blox ro bbie ro tondo ti u ti z ti ro ti ert ti che ti da ti max ti pi ti tems ti zen ti sser ti chen ti amen mp k mp m mp el mp as mp cs mp net mp tive mp io mp ca mp mt mp help mp rot mp litude mp lare mp qY mp oline mp lutil Ġc E Ġc ex Ġc ci Ġc ly Ġc lot Ġc fo Ġc ape Ġc ft Ġc ag Ġc ated Ġc ak Ġc split Ġc do Ġc ler Ġc go Ġc doc Ġc ng Ġc open Ġc python Ġc ui Ġc src Ġc objects Ġc dt Ġc é Ġc ero Ġc bit Ġc uuid Ġc paths Ġc á Ġc mm Ġc pid Ġc ited Ġc ÃŃ Ġc ima Ġc wrap Ġc uv Ġc nc Ġc bp Ġc transfer Ġc Title Ġc levels Ġc ais Ġc defs Ġc ota Ġc rg Ġc IDs Ġc jp Ġc finder Ġc ElementTree Ġc idades Ġc zf Ġc sharp Ġc Restricted Ġc ulture Ġc NoN Ġc avity Ġc álculo Ġc uppa Ġc Nei Ġp C Ġp E Ġp one Ġp to Ġp ta Ġp out Ġp line Ġp sa Ġp ant Ġp ak Ġp Name Ġp Data Ġp rit Ġp group Ġp List Ġp lag Ġp idx Ġp ols Ġp ict Ġp gen Ġp labels Ġp post Ġp tx Ġp lambda Ġp conv Ġp unk Ġp pts Ġp lim Ġp center Ġp loads Ġp gamma Ġp mass Ġp rag Ġp ints Ġp serve Ġp Pr Ġp nm Ġp bid Ġp anning Ġp ango Ġp fio Ġp agers Ġp rcp Ġp zscore Ġp Gm Ġp encils Ġp aprika Ġp residency Ġp JML Ġf di Ġf ma Ġf us Ġf log Ġf om Ġf ext Ġf ap Ġf xa Ġf user Ġf ff Ġf config Ġf cs Ġf ou Ġf by Ġf ak Ġf als Ġf man Ġf api Ġf of Ġf ream Ġf ug Ġf Path Ġf debug Ġf lan Ġf ling Ġf cr Ġf va Ġf rf Ġf lies Ġf ati Ġf sl Ġf flush Ġf allen Ġf lf Ġf Env Ġf udge Ġf fq Ġf Tmp Ġf Dx Ġf aked Ġf ought Ġf izz Ġf curves Ġf uction Ġf alta Ġf printf Ġf glm Ġf ldr Ġf uniMIB Ġf MRI Ġf uther Ġf fai Ġf usions Ġf bgn Ġf paramlims Ġf uniMIBCompliance Ġf isheye Ġ" -------- Ġ" ]) Ġ" ={ Ġ" ({ Ġ" )): Ġ" )), Ġ" (- Ġ" '\ Ġ" )\ Ġ" '{ Ġ" ==" Ġ" ([^ Ġ" };\ Ġ" ],\ Ġ" âĻ Ġ" âļ Ġ" âĢ¢ Ġ" ------------------- Ġ" ï¼Į" Ġ" });\ Ġ" ===============\ he Z he c he de he ur he ath he ff he mo he lin he av he ters he cho he ker he ats he pb he xample he aring he zza he sian he Know he lae he licopter ## - ## ": ## ==== ## === it ent it ap it ory it no it utils it ão it ja it és it eness it oba it arian it amar it ranslations it Kenar Ġa co Ġa if Ġa mple Ġa ec Ġa cted Ġa idx Ġa var Ġa my Ġa pri Ġa ql Ġa column Ġa pert Ġa fir Ġa fe Ġa ics Ġa pc Ġa char Ġa day Ġa ctx Ġa present Ġa year Ġa ged Ġa je Ġa sec Ġa month Ġa PY Ġa irs Ġa Dist Ġa sph Ġa det Ġa Space Ġa ios Ġa phrase Ġa quisition Ġa OI Ġa stral Ġa cea Ġa ð Ġa proxies Ġa cessing Ġa merica Ġa éri Ġa jay Ġa mais Ġa voir Ġa urora Ġa Hnum Ġa amodel Ġa parente Ġa buse Ġa divinhar Ġa fraid lo T lo ut lo path lo af lo ons lo va lo uv lo far lo ski lo eck lo ž lo osh 00 076 00 29 00 67 00 39 00 300 00 61 00 123 00 104 00 164 00 800 00 896 00 375 00 808 00 900 00 026 00 158 00 097 00 065 00 995 00 034 00 087 00 968 00 240 00 085 00 095 00 111111111111111111111 00 074 00 769 00 1800 00 3239 00 010001000 00 3900 ge u ge me ge li ge lab ge low ge oc ge min ge og ge we ge ps ge ld ge cko ge ography ge obox ge lato ge odesic ge otool ge ysers ge ographical ge bco ĊĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ort ing ce o ce ew ce ses ce lis ce NG ce PG ce lain ce ola ', % ', , ', - ', __ ', '), ', '' ', :], Ġn A Ġn F Ġn W Ġn Y Ġn ing Ġn and Ġn val Ġn ig Ġn ls Ġn text Ġn xa Ġn dir Ġn lt Ġn ok Ġn ast Ġn pos Ġn exp Ġn mi Ġn ale Ġn color Ġn new Ġn ref Ġn tim Ġn files Ġn open Ġn vid Ġn msg Ġn board Ġn mt Ġn Max Ġn match Ġn dist Ġn ude Ġn mod Ġn af Ġn rs Ġn mm Ġn rl Ġn All Ġn vals Ġn control Ġn Doc Ġn ula Ġn sr Ġn days Ġn wb Ġn theta Ġn hi Ġn itter Ġn exist Ġn lis Ġn ylim Ġn Space Ġn Cells Ġn aux Ġn ico Ġn ivo Ġn ales Ġn apis Ġn ö Ġn Outer Ġn rack Ġn rg Ġn particles Ġn udge Ġn shots Ġn trees Ġn zc Ġn uber Ġn Things Ġn ãģĮ Ġn Possible Ġn Obs Ġn Levels Ġn largest Ġn orte Ġn repeats Ġn lake Ġn acelle Ġn Endpoints Ġn ifty Ġn comms Ġn halos Ġn hwc Ġn neighs Ġn ominate Ġn locktime Ġn lyric Ġn annan Ġn uitka Ġn Depths Ġn Slides Ġn vpicpr Ġn imare Ġn CompletedIter Ġn EdgesOnCell Ġn loe Ġn awet Ġs S Ġs re Ġs val Ġs value Ġs vi Ġs ore Ġs ang Ġs ise Ġs lt Ġs ump Ġs ings Ġs ark Ġs word Ġs params Ġs List Ġs be Ġs models Ġs inal Ġs led Ġs du Ġs uid Ġs ia Ġs font Ġs win Ġs pool Ġs scores Ġs ga Ġs DX Ġs sn Ġs ru Ġs rf Ġs cov Ġs omatic Ġs vp Ġs anner Ġs bc Ġs ano Ġs perm Ġs iting Ġs celer Ġs gain Ġs ung Ġs ÅĤ Ġs cool Ġs ppr Ġs intel Ġs resids Ġs ieved Ġs agas Ġs lipped Ġs oluções Ġs alida Ġs ueldo Ġs mlb Ġs pparser Ġs ushy Ġs CMOS ut el ut inal ut ong ut ants ut ado ut ino ut zt ut tivo ur ers ur age ur bo ur ag ur ip ur ated ur ak ur bs ur du ur ie ss b ss as ss op ss ic ss vi ss ub ss ize ss os ss ign ss uto ss ier ss olver ss hs ss dp ss imo ss peed ss sZ ss ysla ss ische ss erae Ġin ame Ġin path Ġin ns Ġin gor Ġin equal Ġin Port Ġin gre Ġin ev Ġin TS Ġin good Ġin canvas Ġin gres Ġin dem Ġin bm Ġin Place Ġin sects Ġin spa Ġin ÃŃcio Ġin manta Ġin iciado Ġin Workbook Ġin moov Ġin actives Ġin lining Ġre us Ġre to Ġre pt Ġre param Ġre join Ġre lin Ġre bin Ġre mi Ġre color Ġre auth Ġre cal Ġre open Ġre ponse Ġre ik Ġre qui Ġre fp Ġre loader Ġre ç Ġre tract Ġre connection Ġre bind Ġre created Ġre scan Ġre press Ġre frac Ġre distribution Ġre xp Ġre lia Ġre formatted Ġre mappings Ġre indexed Ġre plays Ġre playing Ġre marked Ġre located Ġre visited Ġre configured Ġre writes Ġre cep Ġre compiled Ġre creating Ġre builds Ġre initialization Ġre formatting Ġre disa Ġre locatable Ġre vise Ġre publishing Ġre lación Ġre numbered Ġre straints Ġre configuring Ġre zervacija Ġre Emulate Ġre entrant Ġre scue Ġre infective Ġre cherche Ġre parameterization Ġre linquishment Ġre ltol Ġre jonowy Ġre cipents sel in sel FnDir self v self type self boost ing l ing In ing ui ing yu ing dong ing entésimo ing ParentList ame y ame zon Ġo F Ġo L Ġo q Ġo se Ġo self Ġo path Ġo om Ġo os Ġo df Ġo iv Ġo do Ġo ks Ġo cat Ġo debug Ġo String Ġo ven Ġo cf Ġo oo Ġo writer Ġo Options Ġo cn Ġo vl Ġo dn Ġo lar Ġo ficial Ġo ike Ġo virt Ġo grey Ġo hms Ġo meg Ġo mtk Ġo stap Ġo dios Ġo topi Ġo strich Ġo golem Ġd D Ġd log Ġd odel Ġd ci Ġd ax Ġd base Ġd info Ġd df Ġd ave Ġd ress Ġd uct Ġd my Ġd tes Ġd nx Ġd fir Ġd ync Ġd ics Ġd td Ġd dev Ġd acc Ġd depth Ġd cr Ġd sr Ġd cb Ġd dy Ġd typ Ġd ilon Ġd vp Ġd Vector Ġd wi Ġd wave Ġd pot Ġd Delta Ġd vn Ġd ances Ġd Timer Ġd rew Ġd Xs Ġd udp Ġd Radius Ġd arwin Ġd Lambda Ġd scraper Ġd ÃŃa Ġd anh Ġd ibase Ġd akota Ġd dxi Ġd FDF Ġd deta Ġd uca Ġd MAE Ġd gtg Ġd kepler Ġd sgn Ġd dzeta Ġd orsal Ġd abei Ġd andan Ġd tracers Ġd airy Ġd chpNeedToReconfigure li J li pe li dir li ctor li ssage li vo li si li vious li cos li ev li eg li ante li via li wc li dade li ott li oso li oproj li dades li yah li lien li mpar ct h ct z ct aw ct hing ct Offers ct RNS ct tttt pe th pe sc pe que pe ap pe per pe ste pe lem pe wa pe ito pe fac pe lle pe sca pe ckle pe lato pe asant pe destrians un r un de un ck un ist un ime un group un sign un conf un ged un eff un vec un gh un ga un trained un obs un gu un conn un tar un configure un cia un listed un blocked un idata un needed un configured un till un rolled un protect un opened un solved un watched un validated un happy un tested un targeted un referenced un hashable un pushed un settled un rigged un itless un potable un disturbedMediumFlow un laden un stucking Ġm L Ġm M Ġm ge Ġm sc Ġm mo Ġm dict Ġm valid Ġm ari Ġm ill Ġm ses Ġm default Ġm lag Ġm client Ġm top Ġm length Ġm cat Ġm cl Ġm dep Ġm scale Ġm ful Ġm req Ġm Entry Ġm fname Ġm ni Ġm sigma Ġm rec Ġm otype Ġm rio Ġm ij Ġm vr Ġm gd Ġm alloc Ġm tls Ġm qc Ġm RNA Ġm TLS Ġm stype Ġm unge Ġm others Ġm Ã¥ Ġm COUNTER Ġm ccore Ġm angling Ġm toa Ġm minion Ġm scn Ġm uffin Ġm osaicking Ġm unkres Ġm ême ra N ra ma ra pt ra sed ra pi ra gen ra ins ra ined ra cial ra spi ra ffin ra Destinacije Ġe er Ġe ol Ġe ac Ġe sa Ġe da Ġe ip Ġe clu Ġe img Ġe call Ġe Max Ġe pc Ġe struct Ġe ui Ġe scope Ġe sim Ġe vm Ġe cm Ġe chain Ġe loop Ġe tw Ġe gl Ġe eps Ġe vp Ġe voke Ġe wm Ġe Er Ġe lision Ġe yr Ġe volved Ġe bay Ġe distr Ġe kle Ġe laboration Ġe commerce Ġe vasion Ġe arns Ġe ttä Ġe lapsingTime Ġe ternal Ġe tiche la j la it la us la sa la cs la ip la vo la uto la pack la rea la dos la wn la mente la wl la zione la mports la skie ---- \ ---- +-------------------+ ---- .----- ate Impact ion o ion are ion ado ion ato () ? () '), () '. () ". () ï¼Į () }_ () `) () +'\ fi N fi de fi um fi is fi lat fi bs fi lip fi é fi ves fi Dataset fi xdate fi loso ue le ue me ue ce ue ix ue do ue ee ent on ent re ent rep ent ino ent ário ent herm ent omino ad it ad ms ad ise ad mi ad ition ad ain ad ies ad ams ad block ad ics ad words ad mm ad hi ad rive ad bd ad ente ad amente ad anet ad nego ad detto ad resu ad ownet ad ptv ad aboost ad skil ", ( ", - ", . ", _ ", ]: ", )}, co on co str co con co sa co work co try co pri co cc co loss co vo co initialize co oper co uter co gh co processor co mplementation co locate co erc co operate co ewm co ppin co upler ri D ri u ri re ri di ri pp ri gs ri be ri buted ri era ri card ri cer ri router ri ama ri pet ri cks ri cally ri zzo ri zzare ri conosc ri unito ri spet ri inng Ġthe o Ġthe il Ġthe data Ġthe ft Ġthe Time Ġthe saurus Ġthe audiodb Ġb F Ġb time Ġb ew Ġb ure Ġb label Ġb num Ġb lu Ġb ard Ġb start Ġb pos Ġb av Ġb rid Ġb word Ġb sum Ġb group Ġb tle Ġb atter Ġb fe Ġb ics Ġb pc Ġb ats Ġb ends Ġb dot Ġb decode Ġb gg Ġb mod Ġb dat Ġb rs Ġb Function Ġb sd Ġb zero Ġb vec Ġb Map Ġb ored Ġb pd Ġb band Ġb aker Ġb lists Ġb rio Ġb ili Ġb ora Ġb tm Ġb phrase Ġb jd Ġb ento Ġb uns Ġb atz Ġb ounty Ġb vg Ġb vh Ġb eso Ġb unches Ġb mtk Ġb oltzmann Ġb Hnum Ġb imod Ġb ishop Ġb ifurcations Ġb alsam Ġ1 107 Ġ1 0101 Ġ1 0000000000000000 Ġ1 128 Ġ1 123 Ġ1 948 Ġ1 104 Ġ1 224 Ġ1 137 Ġ1 146 Ġ1 177 Ġ1 145 Ġ1 140 Ġ1 130 Ġ1 946 Ġ1 344 Ġ1 360 Ġ1 037 Ġ1 075 Ġ1 034 Ġ1 975 Ġ1 149 Ġ1 968 Ġ1 577 Ġ1 246 Ġ1 366 Ġ1 454 Ġ1 578 Ġ1 324 Ġ1 958 Ġ1 242 Ġ1 467 Ġ1 439 Ġ1 678 Ġ1 973 Ġ1 382 Ġ1 462 Ġ1 673 Ġ1 891 Ġ# $ Ġ# ~ Ġ# ---- Ġ# (' Ġ# '/ Ġ# !/ ed k ed ig ed do ed ium ed Image ed des ed Dataset ed bf ed Iter ed Identity ed gar ed mak ed izione ed ikt ed wardyehuang 11 999 11 41 11 011011 11 00101 11 146 11 299 11 158 11 143 11 977 11 376 11 226 11 086 11 248 11 085 11 323 11 358 11 440 11 92813 rom DialogFrame um u um ise um ag um ax um ay um ere um und um ail um isi ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĊĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĊĠĠĠ int p int v int on int an int as int ance int reg int ele int rain int Query int rp int Between id B id G id in id us id ic id log id col id io id ding id let id cache id uous id Len id uals id alab id Sud id CheckItem Ġ( , Ġ( ": Ġ( =" Ġ( '' Ġ( ''' Ġ( ____ Ġ( .* Ġ( ?? Ġ( ___ Ġ( => Ġ( --> Ġ( ')', Ġ0 16 Ġ0 17 Ġ0 77 Ġ0 39 Ġ0 110 Ġw q Ġw ri Ġw sc Ġw im Ġw ore Ġw ib Ġw ings Ġw nn Ġw amp Ġw tf Ġw ks Ġw aw Ġw dt Ġw mac Ġw ii Ġw rd Ġw ots Ġw adi Ġw irtual Ġw elt Ġw vf Ġw StringIO Ġw mos Ġw oe Ġw ashing Ġw Cam Ġw oke Ġw rds Ġw assr Ġw asteful Ġw lauto ch d ch pp ch ic ch time ch if ch ise ch ou ch iti ch ave ch arn ch ler ch oth ch anel ch rift ch ka ch asm ch kM ch uan ch berg ch ott ch olar ch itz ch ristop ch arger ch ameleon ch isquare ch ungszentrum ch idSud te F te Y te ma te str te sp te ase te spy te Lpe te indre di gs di ale di ler di var di pha di hed di mag di gamma di ções di atomic di lemma di xY di visão di hedTypes di ÄŁer di arization di pendente di ÄŁiniz di ametro di chroic di haml def f def ra def set def ence def ba def lections def Exist def macro def Grp def Opts def unto def rost def FilterAttr def DriverAttr ): = ): ** ): ]: and j and u and are and amount and ria and aran ata y ata class ata sets ata mente Ġ[ ! Ġ[ : Ġ[ ? Ġ[ (), Ġ[ {\ Ġ[ _, Ġ[ _. Ġ[ ("_ Ġ[ ']', ma an ma ce ma sc ma res ma py ma ging ma bra ma cher ma wa ma Tokenizer ma ara ma zione ma jÄħ ma ptbx ma estro ma uve ma hjong Ġself v Ġself Closing ul q ul an ul lo ul te ul let ul ki ul atable ul mts ul ées ul mano Ġimport mail Ġimport ando Ġimport ante == "" == ''' ], "\ ], ..., ], ...] ], :,:], from iter from samples from tuple from Enum from Matrix from arrays from Place from Year from Mag from sizing from MFP Ġif c Ġif rag Ġif ttt ot E ot F ot n ot y ot ho ot ak ot fr ot ros ot hello ot gw ot Fo ot timo ot helial ot helio ot ranslations ck en ck out ck nn ck ks Ġfor c Ġfor ums Ġfor 문 Ġfor eman "" ], ol w ol ate ol cs ol table ol lection ol sen ol kit ol ano ol tre ol hos el L el n el name el ke el sa el ves el gp el lapsed el lie ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠ ': , ': '), ': {} ': {}, ), _ ), )); urn o urn ar es k es me es ame es im es col es ign es Type es ses es rc es ources es rf es cores es gd es xi es gf es imo es erc es ional es sentially es pecial es cluso es kenar es iduals turn o turn ing turn ip ĊĊ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĊ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĊ ĊĠĠĠĠĠĠĠĠĠĠĠĠ ĊĊ ĊĠĠĠĠĠĠĠĠĠĠ ĊĊ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĊ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĊ ĊĠĠĠĠĠĠĠĠĊ Ġ+ / Ġ+ ') Ġ+ ---------------- Ġ+ ". Ġ+ "]/ Ġ+ -", Ġ+ ")") Ġ+ ------------+-------------------------------- ode code ode gree is A is d is ct is ma is ow is que is ure is ard is ive is number is method is PO is ning is match is ia is Py is On is crit is Interface is abstract is strings is done is cam is cher is Wi is Enable is Ri is cus is outlier is Music is Same is Working is Visible is Absolute is nil is Summer is printable is Playing is csi is lington is NodeType is Subtype is PrescribedForceOn is lava is miniz is TrustedForwarder is urvey is unchecked is piel is AfterSelection is phx is MyView is NotDone val ore val ib val do val core val range val Input val loader val Loss val bard val uable val uables val utare val dienst val proate __ ? __ """ __ ]. __ '. __ ( )) +"\ )) #. )) -( )) +'\ set or set ters set Id set raw set The set Table set uid set pass set ores set Pos set Server set Graph set Content set Transform set zen set Width set Scale set Left set Right set Plugin set Database set Root set Filename set Progress set Background set funcs set Master set Home set Locator set DateTime set Tags set logfile set Family set Interaction set Popup set Maya set LoginStatus set Resolved set PlaceholderText set Speaker set ValidData set EndPoint set RestrictedTransfer set readermode set RoyaltyBps set InitialState set BoardState set TlogCompression set hreads ath i ath ar ath lete ath ani ath leen Ġ- # Ġ- | Ġ- `` Ġ- ### Ġ- ]", Ġ- __| Ġto a Ġto g Ġto en Ġto ut Ġto ck Ġto us Ġto str Ġto ile Ġto bs Ġto Str Ġto Get Ġto Node Ġto pping Ġto bytes Ġto ee Ġto Task Ġto sses Ġto Ret Ġto Write Ġto Skip Ġto Feed Ġto Currency Ġto Continue Ġto urney Ġto StateList ĠT q ĠT iz ĠT art ĠT ls ĠT ir ĠT oc ĠT AR ĠT og ĠT em ĠT ache ĠT av ĠT UR ĠT of ĠT ies ĠT ash ĠT ld ĠT gn ĠT ie ĠT Path ĠT send ĠT ram ĠT NO ĠT ERR ĠT Ref ĠT SD ĠT HER ĠT fl ĠT SA ĠT UI ĠT VM ĠT Collection ĠT udo ĠT recv ĠT iling ĠT VA ĠT ung ĠT Canvas ĠT weak ĠT MAPE ĠT amba ĠT AMS ĠT pch ĠT asmota ĠT REC ĠT MAPEStd ĠT ears ĠT ARBALL ĠT IPO ĠT UPLE ĠT ilde ĠT arefas ĠT FOD ĠT ASMOTA ĠT éléphone ĠT DataStd ĠT odeschini ĠT seep xt or xt ol xt ree xt rans xt ream xt ured xt FileReader xt rak il k il al il ter il son il da il cm il sym il ja il mente il Uh il rys th age th ou th ug th ats th MB th unks th rew th ogonal us an us qu us ho us bu us api us ual us ins us ão us ato us unu us Imaging us abl us Cari import r import able import Conditions str g str r str str str list str File str Log str ative str nc str ando str utt str PID str utto str INI str Peptide str prose str ategic Ġreturn names Ġreturn Image Ġreturn Array Ġreturn Values Ġreturn Vec Ġreturn Vect con z con ch con ject con check con tex con joint con sens con vey con wc con currently con cet con corrente con firming con dicional con tribs con tempor con seguente Ġ2 854 Ġ2 097 Ġ2 344 Ġ2 057 Ġ2 181 Ġ2 977 Ġ2 333 Ġ2 368 Ġ2 067 Ġ2 928 Ġ2 338 Ġ2 856 Ġ2 078 Ġ2 343 Ġ2 329 Ġ2 339 Ġ2 371 Ġ2 363 Ġ2 852 ers cript ers Registry ers pectral (" ''' (" }\ (" .\ (" ------- (" !! (" +" (" !") (" [[ (" _" (" (% (" && (" ``` (" :[ (" ============== (" <<<< (" || (" ~~~~~~ (" !!! (" <<<<<<<< (" ==> (" ==") (" ```\ (" ]")[ (" ]"): (" ðŁĶĦ pp x pp py pp Start pp End pp Factory pp Adapter pp Texture pp icture pp DepthStencilView pp GeometryShader pp SignatureBlob pp ImmediateContext ') - ') ]. ') ". ') `. ') "%( ') })) as K as name as par as ds as ir as col as pi as ound as iv as object as ie as matrix as wiki as gd as Regs as dfa as witch as dasd as jno as urv ĉĉ ĊĊ iz h iz q iz y iz an iz sa iz zy iz bi iz zo iz Zw iz pis iz dihaml -------- ", et b et k et u et ur et us et up et tings et fs et Code et ernal et obs et ric et tu et Backend et Round et ów arg en arg num arg ins arg ui arg reed arg flag arg comment arg oment arg Format op K op j op k op m op ad op set op str op am op ac op lot op Dict op anel op ulate op hic op amine op orto op omba ve de ve la ve ig ve ze ve enk ve stito Ġ{ (' Ġ{ """ Ġ{ :% Ġ{ [] Ġis up Ġis ic Ġis list Ġis nt Ġis valid Ġis float Ġis stream Ġis pec Ġis Client Ġis Output Ġis inf Ġis pkg Ġis null Ġis void Ġis Local Ġis Scale Ġis Last Ġis Collection Ġis Translation Ġis Shader Ġis Texture Ġis Primitive Ġis Holiday Ġis Possible Ġis pagination Ġis Week Ġis Rotation Ġis Loaded Ġis Major Ġis Negative Ġis Numeric Ġis larch Ġis Squared Ġis Mutable Ġis CGI Ġis Hashable Ġis odate Ġis DataFile Ġis herm Ġis Legal Ġis dcf Ġis Excluded Ġis loggedin Ġis AfterSelection Ġis Cryptography Ġis Witness Ġis AllCompleted Ġis AveCost Ġ7 01 Ġ7 22 Ġ7 85 Ġ7 97 Ġ7 90 Ġ7 000000 Ġ7 81 Ġ7 31 Ġ7 58 Ġ7 63 Ġ7 41 Ġ7 61 Ġ7 71 Ġ7 800 Ġ7 373 Ġ7 463 Ġ7 50003 ĠS lo ĠS li ĠS ang ĠS ob ĠS che ĠS IT ĠS ass ĠS ip ĠS lit ĠS tain ĠS au ĠS box ĠS table ĠS cy ĠS air ĠS ESS ĠS ounds ĠS ous ĠS aw ĠS dist ĠS ank ĠS aml ĠS hash ĠS ays ĠS WS ĠS ized ĠS ão ĠS cf ĠS BL ĠS rl ĠS pub ĠS hist ĠS SP ĠS ices ĠS dk ĠS ana ĠS AX ĠS css ĠS VS ĠS wers ĠS LR ĠS QP ĠS FD ĠS MON ĠS ln ĠS vn ĠS DN ĠS ung ĠS iam ĠS AMP ĠS CAT ĠS CU ĠS RAM ĠS PECT ĠS aba ĠS amba ĠS andra ĠS amut ĠS tix ĠS licing ĠS WITCH ĠS CHOOL ĠS irr ĠS PORTS ĠS zor ĠS ushi ĠS oluções ĠS unglasses ĠS loppy ĠS lurm ĠS doMessage ĠS NLDS ĠS tpmex ĠS ROMPy ĠS itja ab w ab an ab ot ab ay ab ef ab func ab lon ab ato ab uck ab bag ab uy ab rams ab bond ab Instr ab onne None Value None Statement Ġof t Ġof proto ĠC n ĠC t ĠC in ĠC ul ĠC name ĠC us ĠC et ĠC up ĠC sp ĠC od ĠC ub ĠC im ĠC ance ĠC url ĠC SE ĠC ec ĠC ari ĠC row ĠC ents ĠC ern ĠC ies ĠC MA ĠC tx ĠC TO ĠC Class ĠC IP ĠC arr ĠC rs ĠC WS ĠC ERR ĠC RL ĠC BL ĠC ordinates ĠC PS ĠC Loader ĠC MB ĠC MAX ĠC OB ĠC aj ĠC arp ĠC ities ĠC reat ĠC RA ĠC NAMES ĠC Tk ĠC rist ĠC TX ĠC BS ĠC atar ĠC MN ĠC LF ĠC Setting ĠC PM ĠC idade ĠC nv ĠC atal ĠC GP ĠC La ĠC acher ĠC yr ĠC Term ĠC rating ĠC itations ĠC GTT ĠC ROW ĠC KK ĠC Fs ĠC REST ĠC UBE ĠC KAN ĠC locks ĠC idr ĠC anny ĠC abin ĠC usto ĠC orners ĠC UED ĠC ubs ĠC SafeLoader ĠC BRACE ĠC ARBON ĠC atherine ĠC leveland ĠC uckoo ĠC rying ĠC amilo ĠC astelo ig le ig ame ig as ig als ig ates ig ao ig matic ig uity ig ibson ht g ht me ht ra ht op ht bl ht docs ht bc ht bW ht heory up V up in up il up map up rt up link up ped up side up sampler up buff up scaling up voted ") ]: ") ]] ") }" ") }. ") }' ") }} ") ])]) ") ]]/ Ġ== [ Ġ== ": Ġ== ". rint s Ġdef val Ġdef file Ġdef Mode Ġdef vars Ġdef ensive Ġdef uns Ġdef aul Ġdef erring Ġdef eats Ġg list Ġg ta Ġg ase Ġg py Ġg fo Ġg mb Ġg ml Ġg uil Ġg als Ġg mi Ġg ids Ġg wh Ġg ists Ġg lim Ġg fs Ġg luster Ġg logging Ġg enu Ġg az Ġg dat Ġg ha Ġg apt Ġg qa Ġg tc Ġg dirs Ġg ssl Ġg dp Ġg ino Ġg bf Ġg gp Ġg Cells Ġg pointer Ġg ROI Ġg wu Ġg bench Ġg prox Ġg erce Ġg psd Ġg lad Ġg mst Ġg enders Ġg Qg Ġg ì Ġg usto Ġg athers Ġg streamer Ġg unif Ġg mlvq Ġg éo Ġg ulp Ġg ridding Ġg erek Ġg üç Ġg roceries Ġg idgethub Ġg iraffe Ġg ShootGallery for f for n for age for ex for aging for syn for 循çݯ for zare for tios for xmail ter e ter es ter ry ter rit ter font ter gom Ġr N Ġr Q Ġr W Ġr Y Ġr k Ġr on Ġr me Ġr ation Ġr set Ġr par Ġr test Ġr lt Ġr ust Ġr lp Ġr string Ġr List Ġr File Ġr ong Ġr filter Ġr sign Ġr xy Ġr header Ġr dat Ġr bucket Ġr cloud Ġr flux Ġr dp Ġr Idx Ġr pm Ġr tl Ġr hy Ġr sb Ġr gw Ġr ffi Ġr anger Ġr pw Ġr mv Ġr freqs Ġr umor Ġr chrm Ġr ussian Ġr tfm Ġr ápida Ġr neff Ġr Äĥzboi Ġr GoldenGate Ġl Y Ġl li Ġl ul Ġl sc Ġl value Ġl num Ġl tp Ġl ts Ġl index Ġl shape Ġl box Ġl sg Ġl sign Ġl strip Ġl mem Ġl si Ġl ctx Ġl fs Ġl Base Ġl hash Ġl lr Ġl ending Ġl bx Ġl freq Ġl shift Ġl ó Ġl mid Ġl pairs Ġl dst Ġl tl Ġl Ãł Ġl ora Ġl yt Ġl spl Ġl delim Ġl fns Ġl Ix Ġl coh Ġl shas Ġl nbits Ġl orenzian Ġl urkers Ġl gtm Ġl AllTarget ": \ ": ^ ": {} ": '+ ": ''. end m end re end id end ale end idx end less end Index end ario end Module end uses end Screen end HOLD end globals end anz end EpCut end ToEnd end ReleaseTime end othelial data S data Y data stat data Set data block data folder data Handler data storage data Pointer data Map data cursor data generator data repo data fast data Location data Types data Points data Release data Filename data Prefix data stores data Written data Uploader data wT data Sine data SetList data sinks ĠA e ĠA o ĠA de ĠA par ĠA pt ĠA lp ĠA ask ĠA no ĠA stra ĠA ster ĠA AB ĠA ud ĠA AD ĠA PO ĠA sg ĠA ld ĠA TR ĠA cl ĠA ble ĠA MO ĠA si ĠA lan ĠA PR ĠA prob ĠA POST ĠA long ĠA STR ĠA CD ĠA TP ĠA GG ĠA SH ĠA bb ĠA MB ĠA utor ĠA SL ĠA mar ĠA fri ĠA Bl ĠA OC ĠA vin ĠA MR ĠA MIS ĠA FD ĠA uf ĠA eros ĠA xi ĠA yr ĠA KA ĠA EI ĠA Ãī ĠA mor ĠA KS ĠA IPS ĠA VB ĠA WARD ĠA ZI ĠA xo ĠA Zs ĠA aga ĠA symmetric ĠA gar ĠA gro ĠA ATG ĠA éri ĠA tribu ĠA lyt ĠA ffiliation ĠA pollo ĠA symCoinGame ĠA ffected ĠA fghan ĠA dbTool ĠA cerca ĠA WithOutput ĠA lamos ĠA meba ĠA acAudio ĠA bandoned ĠA ivazis sp b sp g sp re sp mp sp id sp ire sp og sp yn sp ress sp mi sp old sp ies sp ide sp ost sp ie sp ian sp dx sp arm sp ru sp uman sp inning sp iking sp rime sp orsmaal sp orgente sp msyntax ult ad ult ry ver i ver me ver ge ver ed ver di ver ke ver Info ver aging ver ific ver Importer ver lauf age l age o age Of age bins age ingList '] ') '] '] '] :] '] += '] }{ '] +( '] }." '] ][( 01 80 01 00000 01 025 01 2019 01 917 01 915 01 045 01 367 01 928 01 358 01 00000000000000000000 01 661 01 4407 01 3400 put data put line put env put request put Number Ġcon ter Ġcon ts Ġcon List Ġcon cord Ġcon sect Ġcon wc Ġcon cluded Ġcon former Ġcon sequ Ġcon veys Ġcon cordance Ġcon duit Ġcon jecture Ġcon gé Ġcon solidated Ġcon ductive Ġcon teúdo Ġcon inue ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ čĊĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĊĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĊĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ic j ic y ic li ic ue ic nt ic ds ic lass ic ache ic lique ke v ke te ke es ke by ke xec ke liminar am c am x am om am bu am ock am ie am ura am ico am idade am aro am mor to str to ine to test to date to dd to lower to Get to Index to samples to integer to JSON to Parse to aster to Bytes to sessions to lare to Send to Delta to Screen to Bits to Place to Year to pprint to Append to vag to analyses to ctext to bii to kyo to mpkins to tigmmass 99 18 99 27 99 35 99 77 99 50 99 46 99 63 99 400 99 600 99 218 99 264 99 124 99 895 99 405 99 048 99 335 99 045 99 376 99 316 99 478 Ġ: < Ġ: ]] Ġ: ]+ Ġ: {}". Ġ: )" Ġ: ${ Ġ: {}, Ġ: '_ Ġ: +: ith a ith r par d par are par vo par ting par ado par cov par lament par anoia path array path view path Set path Model path spec path ops path Args path Cap path Seq path Root path lens path Aug path ãģ¯ path Posts path ogen Ġand er Ġand erson Ġand romeda ile a ile x ile an ist ence ist ere ist ress ist omock type error type attr type Model type Dict type cast type inf type åĢ¼ä¸º ĠF V ĠF p ĠF are ĠF max ĠF eld ĠF ou ĠF AL ĠF AC ĠF NAME ĠF fs ĠF ian ĠF DB ĠF reed ĠF requ ĠF vv ĠF SP ĠF MT ĠF SA ĠF aces ĠF RU ĠF ellow ĠF FS ĠF rac ĠF wr ĠF utures ĠF irm ĠF TD ĠF arb ĠF onts ĠF ZI ĠF Manifest ĠF ountain ĠF orte ĠF ederation ĠF anta ĠF atture ĠF GLM ĠF alli ĠF antasy ĠF ulton ĠF AMILIES ĠF inkel ĠF loppy ĠF aucher ĠF GSD ĠF wVersion ĠF ischer od u od at od un od as od les od rome od HR sc b sc u sc ion sc vi sc iv sc rt sc ared sc aff sc uro sc imo sc endent sc ritto sc ilpy sc ielo qu F qu x qu z qu en qu ared qu vv qu ando qu into qu antes qu arant qu inas qu artz qu imb qu andl qu stion log E log an log time log config log Data log view log group log ler log loss log ists log post log Formatter log ically log FilePath log thumb log stash log eny log enetic list c list comp list layers list Info list All list Search list panel list formats list Groups list Zigbee list Observ list alinux list fromusers om ation om ers om ens om bra om ogene om ische om kull om munic value type value format value List value Node vi ch vi bo vi ral vi ii vi ited vi ä vi Äĩ vi athan vi ère vi kid vi lian vi jayesh vi vente vi ssuto ser rat ser aph Ġh L Ġh ut Ġh ype Ġh one Ġh fig Ġh dir Ġh ight Ġh min Ġh ump Ġh ace Ġh ust Ġh of Ġh ong Ġh rt Ġh keys Ġh plt Ġh lr Ġh dx Ġh auto Ġh inds Ġh orizont Ġh ana Ġh uck Ġh rp Ġh pix Ġh ij Ġh dg Ġh dry Ġh ô Ġh bboxes Ġh ø Ġh dbg Ġh inz Ġh ertz Ġh ende Ġh olon Ġh erring Ġh uffman Ġh ijack Ġh iguchi Ġh ermitian Ġh igiene Ġh indered Ġh endrix Ġh ylfm ** ' ** /* ** {}** ĠĠĠĠĠ ĊĠĠĠĠĊĠĠĠ ĠĠĠĠĠ čĊčĊĠĠĠ ĠĠĠĠĠ čĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĊĠĠĠĠĠĠĠĠĠĠĠ all E all ine all gen all nan all thing all Temp all configs all Cells all Err all centers all Tags all vecs all bars all Anchor all Dates all Tiles all Solutions all Tally all DMD all EntityTypes all GMD all gemein all popstat all NPrsa po f po lo po ise po let po pper po ker po lis po lished po ppy po ppler po jen po obah po wied po olid ta G ta j ta ve ta ine ta xf ta go ta act ta pas ta uk ta zione ta vg ta ceto ĠP X ĠP q ĠP ue ĠP ys ĠP ir ĠP lu ĠP ard ĠP eri ĠP db ĠP ree ĠP au ĠP ain ĠP ey ĠP ict ĠP Lo ĠP DO ĠP CL ĠP lambda ĠP ats ĠP Image ĠP URE ĠP ane ĠP MT ĠP GA ĠP RA ĠP AE ĠP eg ĠP ony ĠP avel ĠP REF ĠP ampa ĠP SB ĠP aged ĠP AST ĠP rab ĠP ENSION ĠP HS ĠP unctuation ĠP SSH ĠP lugs ĠP andoc ĠP erspective ĠP ulls ĠP eso ĠP etr ĠP Basis ĠP lateau ĠP irates ĠP laces ĠP apa ĠP INTS ĠP arente ĠP esto ĠP eller ĠP erez ĠP itt ĠP apel ĠP DUs ĠP istol ĠP ushover ĠP runed ĠP wnState ĠP esquisas ĠP exBinary ĠP ensei ĠP impData ĠP loidyPlotDir ĠP NASNet ĠP andaGripper ĠP livo Ġas str Ġas ic Ġas Array Ġas hes Ġas gi Ġas Pickle Ġas sessed der d der p der ain ĠI pt ĠI ms ĠI low ĠI oc ĠI AC ĠI PT ĠI face ĠI python ĠI MO ĠI KE ĠI dx ĠI mag ĠI BR ĠI EA ĠI GD ĠI RS ĠI FS ĠI ZZ ĠI Copy ĠI BP ĠI RON ĠI Browser ĠI dea ĠI Enumerator ĠI daho ĠI PRoute file N file c file time file key file count file input file group file tmp file Result file storage file counter file Read file Link file share file Sep file TimeSpan ĠL U ĠL or ĠL de ĠL ion ĠL ack ĠL ange ĠL ance ĠL ind ĠL OR ĠL ID ĠL ies ĠL iter ĠL ESS ĠL ie ĠL iss ĠL Max ĠL OL ĠL CA ĠL é ĠL PUT ĠL NA ĠL inf ĠL STAT ĠL MT ĠL ima ĠL HOST ĠL PC ĠL itter ĠL ond ĠL ives ĠL CF ĠL ae ĠL ya ĠL IDs ĠL PF ĠL omb ĠL xm ĠL argo ĠL PAREN ĠL SHIFT ĠL enz ĠL MDB ĠL bands ĠL APL ĠL ucky ĠL uminosity ĠL loyd ĠL ütfen ĠL aminar ĠL udwig ĠL aird ĠL nurl ĠL UNA ub B ub w ub en ub ut ub ject ub ator ub scription ub traction ub hav res as res list res dir res ave res Seq res umed res pects res ampling res istente res RetSiteMap tr Z tr c tr f tr z tr ing tr data tr ys tr ates tr ny tr dp tr uls Ġth xl Ġth inningThingProducer Ġth ë Ġth rought Ġth redds Ġth rsl =' [" =' '), =' ?' =' [% =' "- =' */ Ġst m Ġst al Ġst ing Ġst ime Ġst event Ġst reak Ġst ake Ġst xo Ġst aking Ġst airs Ġst anje Ġst arring Ġst adium Ġst romal Ġst avke Ġst robogrammatic Ġde ed Ġde vi Ġde line Ġde cs Ġde ty Ġde vel Ġde fic Ġde cri Ġde init Ġde spe Ġde mail Ġde pri Ġde poch Ġde tx Ġde ux Ġde vided Ġde sses Ġde press Ġde central Ġde sert Ġde ben Ġde mek Ġde struc Ġde dik Ġde ctate Ġde klar Ġde quip Ġde activating Ġde partement Ġde activates Ġde buging Ġde serializing Ġde uxième Ġde chif ine z ine co ine vit ine gar pro w pro ot pro pos pro so pro fil pro position pro dot pro site pro va pro duc pro ced pro ofs pro vj pro vado pro guard pro prio pro fess pro logue pro digal pro digy pro gess est ad est able est ark est ores est Curve est atico 0000 5 0000 8 0000 13 0000 15 0000 14 0000 20 0000 42 0000 51 0000 01110000 0000 017 0000 1010000 ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ""" % Ġ""" + Ġ""" @ Ġ""" ## Ġ""" ** Ġ""" \" Ġ""" ++++++++++++++++++++++++++++++++ pt u pt tion pt ed pt us pt alk pt Loss pt race pt onext form Id form style form Grid form ulario form ismatch ex X ex b ex d ex f ex w ex db ex now ex groups ex ceeded ex haust ex pel ex cused ex mods ex ractor ex ceeding ex aminer ex conly Ġnot ably im f im ge im ms im ir im ute im odule im sg im Input im medi im Array im atic im ini im Import im Xy im Paths im balanced im former im sharp im bab Ġex a Ġex ot Ġex val Ġex per Ġex json Ġex pop Ġex amp Ġex abel Ġex ov Ġex onic Ġex erc Ġex cepthook Ġex changer Ġex ascale Ġex ercice Ġex ibição able By able Tool able Callback able Iterator able PPO fig file fig text fig num fig arch Ġ3 999 Ġ3 076 Ġ3 011 Ġ3 200 Ġ3 000000 Ġ3 1000 Ġ3 256 Ġ3 126 Ġ3 0000000 Ġ3 400 Ġ3 193 Ġ3 016 Ġ3 456 Ġ3 017 Ġ3 013 Ġ3 143 Ġ3 250 Ġ3 077 Ġ3 034 Ġ3 275 Ġ3 151 Ġ3 926 Ġ3 240 Ġ3 320 Ġ3 078 Ġ3 974 Ġ3 329 Ġ3 676 Ġ3 019 Ġ3 241 Ġ3 473 Ġ3 451 Ġ3 090 Ġ3 941 Ġ3 1883 args InText 10 300 10 600 10 401 10 904 10 857 10 878 10 223 10 451 10 754 Ġprint ers Ġprint String Ġprint alert Ġprint ables Ġprint After ase Config ase cross ect yper ect ady out T out b out c out l out form out fig out out out row out var out of out dim out scale out tree out Color out Cache out Cols out Globals out Instant out liar out VoiceSeekbar ow w ow ard ow ell ow itz ĠD X ĠD n ĠD re ĠD type ĠD ance ĠD orm ĠD ere ĠD ock ĠD PT ĠD ies ĠD ear ĠD ome ĠD DO ĠD PI ĠD EX ĠD IP ĠD PR ĠD rain ĠD ha ĠD SO ĠD ja ĠD IF ĠD CM ĠD DD ĠD RU ĠD ah ĠD ana ĠD bd ĠD PN ĠD eng ĠD DT ĠD hw ĠD DK ĠD HI ĠD GC ĠD ONT ĠD ETER ĠD MF ĠD PM ĠD uy ĠD FB ĠD FG ĠD rink ĠD UMP ĠD uels ĠD emos ĠD ulwich ac u ac at ac ce ac sc ac ore ac ces ac dd ac lient ac map ac cc ac ular ac gt ac ão ac orn ac relation ac dc ac cesses ac Current ac ios ac chi ac cade ac Voltage ac quisitions ac ımız ac acag ac MaxPower Ġu P Ġu h Ġu data Ġu file Ġu ds Ġu lic Ġu Type Ġu ids Ġu dev Ġu role Ġu fp Ġu clean Ġu cf Ġu Sensor Ġu vic Ġu Bel Ġu IdxRegVal Ġu Ctxs Ġu sethreads ]) % ]) ` ]) ][ ]) \\ ]) (\ ]) ][" ]) }') ]) }' ]) [:- ]) ]} ]) [..., ]) +'. ]) }-{ ]) [:: ert xt ert rain Re m Re in Re id Re create Re act Re Comp Re send Re coder Re marks Re calibration Re lief Re confirm Re mess Re yk Re conc Re versing Re constructed Re lacion Re cruit Re ceptive Re venus Re inforcement Re mediation Re wF Re finery Re combining ite ments ite press ite mprop ite mpro ite mia ite erd ite eritud app t app df app db app files app Context app Version app hook app lier app lies app arente app rentice app alachian app reciation sh am sh ub sh ms sh atter sh andler sh bot sh andle sh na sh Domain sh kM sh ih sh IH sh ëm sh outout ment Status ment ação ment Migration ment aal Ġdata F Ġdata I Ġdata description Ġdata gram Ġdata folder Ġdata joint Ġdata hot Ġdata Batch Ġdata sizes Ġdata grams Ġdata iterator Ġdata gateway Ġdata Center Ġdata zoom Ġdata Csv Ġdata XZ Ġdata sketch Ġdata bse Ġdata pssm ĠM j ĠM un ĠM am ĠM ile ĠM are ĠM ans ĠM uth ĠM np ĠM ann ĠM old ĠM IM ĠM yst ĠM ong ĠM DO ĠM next ĠM IP ĠM ined ĠM GR ĠM ICs ĠM SON ĠM BL ĠM ender ĠM cd ĠM MM ĠM Ph ĠM SO ĠM AV ĠM SP ĠM SL ĠM OM ĠM dp ĠM LD ĠM allet ĠM AI ĠM ais ĠM LF ĠM bid ĠM PG ĠM RT ĠM EB ĠM ansion ĠM LM ĠM PJ ĠM NI ĠM cL ĠM iser ĠM ELL ĠM iy ĠM els ĠM FM ĠM MU ĠM inta ĠM SCO ĠM ilit ĠM obi ĠM IPT ĠM fcc ĠM ASSE ĠM APPING ĠM eyer ĠM tcnn ĠM orphometrics ĠM unkres ĠM ORTALITY ĠM oteur nt ree nt bus nt ables nt ılar time me time file time parse time Frame time Index time Point time Cells time Limit time ctrl time Execute time Deleted time OfDay time stepping time tric time ofday ĠNone x oun i oun ced if c if p if lo if ex if are if Type if act if names if Table if true if ren if cmd if ae if ctl if fie key val key name key string key version key values key File key String key Resource key Down key frames key NodeData lab a lab dir lab script lab oratory xf en xf de xf ct xf co xf ck xf es xf ds xf ff xf ak xf av xf fa xf be xf bs xf act xf fg xf cl xf bl xf chl ror i čĊĠĠĠ č =" & =" | =" ): =" ** =" ([ =" (\ =" .* =" $\ =" +" =" ..." =" (.+?) =" {}:{}". =" ðŁ§ł Ġv H Ġv le Ġv type Ġv list Ġv len Ġv print Ġv ign Ġv index Ġv space Ġv ain Ġv ld Ġv If Ġv dot Ġv med Ġv mod Ġv sm Ġv Item Ġv cd Ġv yper Ġv Min Ġv ao Ġv wave Ġv amb Ġv ê Ġv gw Ġv cx Ġv rho Ġv gain Ġv Switch Ġv lad Ġv asp Ġv indo Ġv lil Ġv ál Ġv árias Ġv rij Ġv agrant 02 13 02 100 02 64 02 88 02 21 02 000000 02 42 02 31 02 79 02 0101 02 51 02 192 02 199 02 600 02 168 02 175 02 135 02 896 02 187 02 178 02 988 02 276 02 918 02 368 02 377 02 865 02 846 02 085 02 0300 02 7777777778 ew a ew s ew ed ew idth ew ell ew ater ew ka ext ype ext ure ext ree ext math ext Top ext Temp ext Setup ext Corner ext PluginDescriptor ext remes ext ruder ext ratrees ext rems ext RunDescriptor Ġ_ \ Ġ_ /| Ġy B Ġy D Ġy g Ġy pp Ġy value Ġy lab Ġy ms Ġy ard Ġy ok Ġy block Ġy ell Ġy std Ġy bounds Ġy bar Ġy dm Ġy sd Ġy ummy Ġy mu Ġy Train Ġy scatter Ġy amb Ġy Fail Ġy Eval Ġy ubi Ġy Mean Ġy Vertex Ġy mw Ġy acs Ġy cbar Ġy tilt Ġy atim Ġy Zn Ġy versor Ġy Intervalli Ġy scrollcommand Ġy wyz Ġy adda Ġy LocBomb Ġnp m Ġnp ol Ġnp time Ġnp utils Ġnp adding Ġnp lus Ġnp runed ĊĠ ĊĊ ĊĠ ĊĊĠ ĊĠ ĊĠĠ ĊĠ ĉĉĉĉĉĉ ĠO M ĠO Q ĠO m ĠO o ĠO st ĠO de ĠO sh ĠO rc ĠO go ĠO TH ĠO pc ĠO system ĠO ba ĠO bit ĠO PR ĠO DS ĠO GR ĠO cr ĠO ja ĠO mar ĠO uest ĠO OC ĠO aks ĠO sf ĠO BT ĠO Tr ĠO smo ĠO omi ĠO DEN ĠO Correction ĠO lof ĠO BRACE ĠO ued ĠO SPF ĠO SEO ĠO LTP ds x ds um ds file ds out ds max ds LS ds ourcing ds witch Ġ* & Ġ* ; Ġ* "+ Ġ* âĢĺ Ġ* /*', Ġ* -* Ġpar al Ġpar tion Ġpar is Ġpar ler Ġpar ries Ġpar ked Ġpar king Ġpar alla Ġpar alist Ġpar fait Ġpar cellation Ġpar celas Ġx Q Ġx in Ġx sel Ġx ue Ġx ent Ġx te Ġx val Ġx str Ġx end Ġx right Ġx Data Ġx rc Ġx iter Ġx yp Ġx cp Ġx Table Ġx left Ġx delta Ġx body Ġx ero Ġx encode Ġx dm Ġx vars Ġx Label Ġx units Ġx LC Ġx pdf Ġx vals Ġx Length Ġx ways Ġx SP Ġx Train Ġx Range Ġx slice Ġx scatter Ġx align Ġx prec Ġx gp Ġx Offset Ġx Cells Ġx Draw Ġx Vertex Ġx mr Ġx Center Ġx pan Ġx mh Ġx tilt Ġx Lg Ġx DNN Ġx ephem Ġx versor Ġx Crypt Ġx hats Ġx Punct Ġx liff Ġx itorch Ġx inshuo os l os ge os mo os sed os ml os ible os urface os mu os iton os isoft os kedastic Ġse ma Ġse bu Ġse net Ġse be Ġse ams Ġse pc Ġse si Ġse bi Ġse pare Ġse ura Ġse maphore Ġse venth Ġse aport Ġse qlenth Ġma f Ġma gs Ġma ix Ġma pb Ġma Txt Ġma gna Ġma xtruth Ġma anged Ġma elstrom Ġma ingui ĊĠĠĠĠĠ ĊĠĠĠĠĠĠ que v que ta que io que lon que das ack a ack up lass ian test A test B test y test id test val test object test img test dataset test mode test struct test String test Ref test Map test Matrix test helper test Collection test Acc test Runner test Labels test harness test Digits test aid test Tpro test Tpos test ResourceMap Ġor ds Ġor ang Ġor json Ġor ignal Ġwith args Ġwith Header Ġwith Display Ġwith Geom Ġwith Ens add end add ock add Text add angle add Class add rule add ends add nodes add Button add Var add Row add Filter add Plot add Cell add Loop add Div add Database add Parent add Curve add Arguments add Anchor add Changes add Buttons add Legend add Roles add Jnt add endum add tobin add BytesToCode add orment Ċĉĉ ĊĠĠĠĠĠĠĠ Ċĉĉ Ċĉĉĉ Ċĉĉ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ [" ../ ER OW ER NR ER EQ ER EZ ER ZEL ER CKB ER ASED IN B IN P IN DE IN ATE IN OUT IN CR IN SN IN CAR IN FK IN FRA IN COMPATIBLE IN DEPENDENT IN CLUSION IN VOKE Ġstr util Ġstr Port Ġstr End Ġstr anger Ġstr LogPath Ġstr ategic xe F xe J xe i xe at xe le xe an xe as xe ab xe am xe ex xe bo xe fo xe ay xe ak xe be xe cp xe ca xe aw xe ba xe az xe af xe Bw xe Jx .. , .. ]) .. ._ .. ...", Ġel ts Ġel pi Ġel yra xb p xb ot xb el xb bu xb ec xb ay xb db xb output xb bs xb ai xb af xb tw ange lo ange li ange ls ure up ure Count ure qs ure nce 1111 12 1111 101 1111 65 1111 101111 1111 1011101 mple ted load Dir load DLL load balancing load SubSection ore ms ore Äĩ ore feicao ore alistic ms me ms key ms ys ms ft ms ou ms result ms coco ms xm ms pecies Ġ% }] Ġ% },{ Ġme q Ġme lo Ġme ll Ġme tab Ġme dn Ġme hr Ġme taname ON N ON CO ON DIS ON LOAD ---------------- -") ---------------- ------------") tra di tra sp tra versed tra itlets tra intype tra jectroy tra itements ance And Ġfile data Ġfile lib Ġfile start Ġfile state Ġfile io Ġfile manager Ġfile imp Ġfile Map Ġfile pattern Ġfile Found Ġfile Location Ġfile Exists Ġfile Servers Ġfile LastModified Ġfile ToRetain Ġfile togenerate Ġfile VList our land Ġpro iz Ġpro log Ġpro pi Ġpro uct Ġpro ud Ġpro fil Ġpro ving Ġpro dy Ġpro ced Ġpro fits Ġpro vj Ġpro ceso Ġpro medio Ġpro spective Ġpro ficiencies Ġpro geny Ġpro iek Ġpro iect ens g ens al ens ore ens ord py q py u py ss py val py str py sc py dir py bin py fa py File py cell py dot py clean py gpu py gamma py reader py cred py dy py dig py dense py excel py arrow py probe py guide py demic py scaffold py zmq py duino py cbc py rcc py eem py flakes py ensembl py instapaper py exo py docteur py qbdi py cocotools py Mez py cpdflib py medphys py elftools py armnn py zbar art plug xc an xc ce xc ad xc co xc di xc ab xc ci xc bo xc ft xc ag xc dd xc do xc bg xc cl xc lim xc ba xc dt xc TE xc aa xc zu xc lusive pre q pre te pre sponse pre ader pre feat pre pl pre mask pre loaded pre ench pre Sum pre jection pre Register pre conditions pre ste pre attention pre fers pre serves pre calculated pre gunta pre alm pre mier pre RegistrationInline pre decessor ls bu ls bs ls ru ls NContent ls Ijo ap w ap en ap ses ap stra ap ilar ap rg ap itools ap tepc ap opto ap imatic 07 34 07 38 07 175 07 301 07 315 07 176 07 908 07 964 07 236 07 288 07 436 07 987 07 303 07 364 07 902 07 875 07 956 07 577 07 213 07 474 07 279 ang ar ang ere ang ulation ang rot ang olo ang won xd m xd ct xd di xd ap xd ay xd fa xd ai xd cp xd cl xd fe xd ca xd cd xd zs xd fff label ss label Name label color label ler label Col label Mat label Font atch ing ES g ES un ES kM ES erver ES ERVICES ber i ber ra ber ang Ġbe ad Ġbe ch Ġbe cu Ġbe press Ġbe lie are x are z are ach are ns are mba Ċĉ ĠĠĠĠĠĠĠĠĠĠ "] - "] '. "] ])) "] }" "] ]], "] [:- "] }} "] += "] '))) "] },{ ĠB Z ĠB n ĠB un ĠB id ĠB ic ĠB am ĠB om ĠB oun ĠB ray ĠB ok ĠB ast ĠB ark ĠB row ĠB ron ĠB ale ĠB ING ĠB LO ĠB UR ĠB org ĠB ash ĠB MP ĠB EL ĠB SS ĠB AY ĠB ALL ĠB oid ĠB ender ĠB tn ĠB orn ĠB hi ĠB aker ĠB lec ĠB ATT ĠB Bot ĠB ever ĠB asset ĠB orders ĠB inja ĠB hard ĠB abe ĠB OID ĠB ASES ĠB erry ĠB tst ĠB rew ĠB INS ĠB undles ĠB eni ĠB urk ĠB ICON ĠB ivariate ĠB anc ĠB dil ĠB orrow ĠB rake ĠB ENCH ĠB oris ĠB URS ĠB IAC ĠB lotter ĠB ndBox ĠB ranco ĠB ryan ĠB achelor ĠB PDN ĠB hattach ĠB ishop ĠB rierScore ĠB ắc ĠB airro ĠB entley ĠB csApiClient ĠB ofeng ĠB uryat ĠB etRound Ġos u Ġos pe Ġos bot Ġos gb Ġos vol Ġos container 12 923 12 43 12 81 12 202 12 211 12 218 12 295 12 129 12 360 12 576 12 289 12 9999999 12 054 12 443 12 2736 Ġname size Ġname ID Ġname of Ġname Output Ġname parts Ġname Match Ġname servers Ġname chars ys W ys X ys j ys pec ys imple ys lam ĠE O ĠE k ĠE at ĠE co ĠE ch ĠE ph ĠE scri ĠE da ĠE ip ĠE sk ĠE map ĠE mpl ĠE AB ĠE nn ĠE MO ĠE qui ĠE VER ĠE gor ĠE lex ĠE vals ĠE fr ĠE GO ĠE merge ĠE UI ĠE rf ĠE mul ĠE IGHT ĠE UG ĠE lite ĠE quality ĠE OC ĠE special ĠE YE ĠE jected ĠE OG ĠE LM ĠE priv ĠE BAD ĠE KS ĠE WM ĠE Ps ĠE ACH ĠE OA ĠE rin ĠE mir ĠE PUB ĠE KF ĠE labor ĠE EMD ĠE fet ĠE VERY ĠE AGAIN ĠE motions ĠE CDH ĠE rosion ĠE tiqueta Ġj lo Ġj un Ġj ul Ġj pp Ġj as Ġj up Ġj type Ġj sk Ġj stat Ġj ids Ġj uni Ġj ones Ġj ó Ġj ä Ġj ij Ġj ade Ġj dbc Ġj tup Ġj unto Ġj orgs Ġj ailer Ġj oka Ġj eden Ġj Exam Ġj alap Ġj fieldID Ġj iosa Ġj usqu Ġj shbot ._ -]+\.[ ime i ime ssage ime tro ime dean ci O ci P ci ma ci ag ci ence ci ante ci lia ci vil ci liation ci lieg ci vilian ob c ob la ob io ob bi ob spy ob ras ob serving ob rig ob lox ob raine ob soletes """ ' """ @ """ [ """ ` """ .. """ `` """ **************************************************************** wor n wor de Ġ< ! Ġ< " Ġ< [ Ġ< ==== Ġ< <<<< ly q ly x ly z ly an ly Error text C text color text ual text files text Content text ura text classification text Score text dlg text Orig text SecondScreen text dbPil AT Z AT ON AT ree AT PT AT TY AT ABLE AT IV AT ACCA AT CAAC AT CHED Ġ) (" Ġ) ** Ġ) .', Ġ) ][" Ġ) [:- Ġ) &\ Ġ) #. Ġ) ?(? xa al xa co xa ff xa io xa udio xa Lh ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ low n low ers low freq low Depth low Controls low aÄĩ size pixel size Opt size Sequential čĊĠĠĠĠĠĠĠ čĊčĊĠĠĠĠĠĠĠ com une com ico com addon com andi com Pers com bustion model c model net model grid model Description model fields model Json model ctrl ans sen ans JP ĠN f ĠN h ĠN m ĠN p ĠN ic ĠN ist ĠN res ĠN os ĠN ob ĠN AR ĠN ations ĠN CT ĠN ich ĠN ong ĠN lim ĠN PU ĠN INE ĠN ME ĠN vars ĠN BO ĠN OK ĠN obs ĠN OB ĠN hi ĠN rf ĠN DA ĠN aj ĠN ina ĠN HD ĠN MI ĠN CHAN ĠN omin ĠN ATURE ĠN BT ĠN adam ĠN FW ĠN SQ ĠN leaves ĠN GIN ĠN yd ĠN vidia ĠN amen ĠN ADC ĠN vim ĠN ATS ĠN Phases ĠN acional ĠN NTPT ĠN uclideResult date Type date parse date parser date To date page date tuple date From date AndTime }, } }, ". }, {}". ir f ir k ir reg ir tt ir sym ir nov len P len e len q len ce len um len ded len pass len tities num u num list num files num Variable num VS num Left num cores num Vertex num loops num ubar num Cpu num Trees num ComboBox num Stem num Recurrent num ITEMS num Timeouts num Pts num Splits num ransacs num erix num doclint Ġres n Ġres num Ġres Start Ġres End Ġres umption Ġres peci Ġres umo Ġres peaker user ns user command user bar user tool user Account user bw user RoleMethod user HoldMohAudioSourceId bo ch bo ck bo us bo ses bo obs bo vl bo oli bo oru Ġ4 001 Ġ4 404 Ġ4 127 Ġ4 102 Ġ4 567 Ġ4 456 Ġ4 027 Ġ4 936 Ġ4 687 Ġ4 360 Ġ4 086 Ġ4 244 Ġ4 320 Ġ4 072 Ġ4 979 Ġ4 571 ger ar ger al ger ino ff u ff ast ff ler ff tf Ġassert py Ġassert Equality Ġget Q Ġget X Ġget val Ġget data Ġget frame Ġget score Ġget Frame Ġget Exception Ġget URL Ġget Group Ġget Auth Ġget Token Ġget Process Ġget Module Ġget Row Ġget gamma Ġget signal Ġget Red Ġget Property Ġget Top Ġget dirs Ġget submit Ġget Cmd Ġget Conf Ġget members Ġget Real Ġget Record Ġget Header Ġget failed Ġget Global Ġget Active Ġget Tool Ġget Hub Ġget Report Ġget Root Ġget Used Ġget Support Ġget Labels Ġget Camera Ġget Tick Ġget Messages Ġget Figure Ġget Finished Ġget Accuracy Ġget Answer Ġget Fbx Ġget Best Ġget Filters Ġget Oj Ġget Final Ġget Ts Ġget ConfigEntry Ġget Tip Ġget Visible Ġget Comments Ġget Materials Ġget Vir Ġget Predictions Ġget TapeSites Ġget Ends Ġget WCS Ġget SfpCmd Ġget Perceptual Ġget Annealing Ġget pwnam Ġget Accel Ġget JobDocument Ġget ClusterInfo Ġget Faq Ġget AccSfpCmd Ġget AccQSfpCmd Ġget NimbusConf Ġget NtwQSfpCmd Ġget errortext Ġget doubleword lu v lu ce lu cent lu cente dir n dir ver dir log dir list dir tree 92 10 92 100 92 21 92 54 92 41 92 51 92 033 92 206 92 232 92 132 92 147 92 207 92 908 92 964 92 287 92 903 92 897 92 646 92 565 92 867 92 818 92 858 92 2577 92 0194 tp at tp ot tp ip tp anel col w col in col lo col um col type col no col gate col lar col ums col mA col unas col lins col lage In J In l In dic In Or In Map In Project In sts In stitute In Given In Scope In duces In die In lined In Pending In capac In Shutdown In equality In ês In scre In quirer In stitutions In ProcessKernel In esistente In Stones In fection In gredients In scritos ======== ') ind ro ind Id ind onesian ind uctive append s append ing append able append To lot l lot y lot ti lot lib lot win ĠR ss ĠR um ĠR ho ĠR ise ĠR ip ĠR ings ĠR IC ĠR ave ĠR ive ĠR ong ĠR ai ĠR ost ĠR idd ĠR ays ĠR iddle ĠR PUT ĠR ado ĠR CI ĠR oo ĠR uler ĠR pipeline ĠR ough ĠR isco ĠR tl ĠR TS ĠR anks ĠR ica ĠR MON ĠR Adam ĠR yu ĠR ND ĠR Bucket ĠR arity ĠR BV ĠR PAREN ĠR SHIFT ĠR CX ĠR alph ĠR ifle ĠR iding ĠR ISCV ĠR UCK ĠR ibre ĠR oland ĠR oughly ĠR ANSAC ĠR UNTIMES ĠR Äĥzboi ĠR ussia ĠR apptz ĠR ÃŃos mo i mo q mo or mo lo mo am mo ser mo ses mo ids mo ose mo vs mo uel mo ya mo cha mo jom ep ot ep ab ep num ep ass ep File ep By ep iso ep ney ep isodic ray ids ray tracing Ġun list Ġun doc Ġun match Ġun clean Ġun vec Ġun bind Ġun sync Ġun cover Ġun squeeze Ġun shared Ġun processed Ġun serialize Ġun met Ġun ivers Ġun reason Ġun filled Ġun rolling Ġun colored Ġun rated Ġun mapped Ġun expanded Ġun encrypted Ġun typed Ġun restricted Ġun important Ġun till Ġun bookmark Ġun muted Ġun feasible Ġun sharp Ġun standardi Ġun shifted Ġun identified Ġun tested Ġun marshal Ġun successfully Ġun pickled Ġun lucky Ġun tapp Ġun versioned Ġun subscribed Ġun settled Ġun intended Ġun methylated Ġun subscribing Ġun escaper Ġun ikal Ġun usual OR ADO OR AIRES OR DIAL fo i fo gb ule y ule gaard read x read from read os read len read wise read Line read Bytes read Buffer read Word read YAML read ahead read Excel read NodeFile read ConfigurationFile Ġtest a Ġtest o Ġtest es Ġtest user Ġtest net Ġtest fn Ġtest samples Ġtest Client Ġtest Mode Ġtest Code Ġtest Ref Ġtest opts Ġtest Range Ġtest dirs Ġtest arguments Ġtest Collection Ġtest Timeout Ġtest Execute Ġtest Pairs Ġtest Pred Ġtest oot ument s lic ize lic ited Ġlog M Ġlog T Ġlog list Ġlog step Ġlog err Ġlog tools Ġlog Info Ġlog returns Ġlog Offset Ġlog ica Ġlog FileName Ġlog StreamName Ġlog fgas Ġlog sumexp Ġlog MoneynessTensor 32 20 32 214 32 164 32 232 32 296 32 334 32 422 32 903 32 396 32 924 32 052 per it per to per ry per cept per sed per ish per mut per fm per Monkey per ché per corso per messo oc x oc ated oc hem oc ente oc cipital ph D ph at ph is ph op ph am ph ne ph ps ph ash ph ins ph inf ph ages ph onto ph MJ ph ishing ph ssum ph oronix son er son line son uc son Printer son printer // @ // :. // {}. ĠG b ĠG lo ĠG ert ĠG tp ĠG ated ĠG nd ĠG ates ĠG loss ĠG cp ĠG ia ĠG oo ĠG ros ĠG CR ĠG TC ĠG orn ĠG FLO ĠG LS ĠG att ĠG ua ĠG ems ĠG MAIL ĠG PA ĠG arc ĠG ye ĠG OFF ĠG reet ĠG NG ĠG OVER ĠG AIL ĠG uy ĠG eral ĠG bps ĠG esti ĠG FZ ĠG LOSS ĠG aga ĠG OV ĠG GGG ĠG oric ĠG lenn ĠG aza ĠG oren ĠG UNICORN ĠG eyer ĠG TFS ĠG lorot ĠG esam ces k ces ar ces ary ces itKenar Ġco h Ġco at Ġco le Ġco te Ġco ck Ġco sh Ġco lab Ġco hes Ġco expression Ġco variate Ġco RNN Ġco ulomb Ġco CardType Ġco CardNum Ġco CardDesc Ġco arsen Ġco uleurs Ġco isas Ġon load Ġon End Ġon Site Ġon Bit Ġon critical Ġon Payment Ġon vif Ġon offglides Ġtype v Ġtype checker Ġtype hints Ġtype guard format Seconds EN ROLL EN ANE ĠW A ĠW m ĠW on ĠW an ĠW ort ĠW and ĠW ir ĠW ag ĠW ide ĠW ong ĠW HO ĠW EST ĠW mag ĠW MC ĠW ish ĠW MODE ĠW pa ĠW ired ĠW ond ĠW arc ĠW IFI ĠW raps ĠW LAN ĠW sgi ĠW ELL ĠW BOX ĠW KHTML ĠW ildcard ĠW AVE ĠW ANN ĠW QX ĠW anna ĠW arden ĠW AKE ĠW RMSE ĠW urst ĠW itt ĠW inkler ĠW inkel ĠW ALIKI ĠW LNS ĠW YSI ĠW ATCHED tri os tri ax tri med ho ot ho ve ho isted ho ffset ho ehner ity ta ity Element loc version loc culation ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ url split url match url vir url åľ°åĿĢ url unsplit url brevity Ġout F Ġout L Ġout h Ġout val Ġout ers Ġout row Ġout Log Ġout dim Ġout folder Ġout Class Ġout edges Ġout wards Ġout fd Ġout links Ġout Files Ġout FileName Ġout Cols Ġout anns Ġout FMatch Con ti Con ce Con test Con ll Con so Con duct Con fid Con ferences Con fidential Con centrations Con tributed Con teúdo Con dição Ġlen p Ġlen buf Ġlen Pattern Ġlen gend bu dg bu cks bu ono bu Ä¡ AR CO AR ET AR OB AR CS AR IA AR MED AR Cfg AR PEN AR IMA ĠV it ĠV low ĠV ener ĠV cs ĠV UT ĠV api ĠV DI ĠV SI ĠV ie ĠV ous ĠV PR ĠV Group ĠV END ĠV SD ĠV DF ĠV LC ĠV NC ĠV shared ĠV illa ĠV õ ĠV otes ĠV OX ĠV Ps ĠV AO ĠV scf ĠV egas ĠV allon ĠV ét ĠV OUCH ĠV liet ĠV MTK ĠV lillirier ĠV bscript ĠU G ĠU L ĠU d ĠU h ĠU k ĠU pp ĠU graph ĠU MA ĠU Values ĠU OS ĠU bi ĠU SM ĠU DT ĠU hr ĠU funcs ĠU RP ĠU lti ĠU Tuning ĠU PTIME ĠU ValueList code pro code Names code Points code mirror code gens ry a ry w ry hof dict attr dict Of dict Service dict Words dict Chars Ġnum ang Ġnum len Ġnum Comp Ġnum lim Ġnum bits Ġnum Ver Ġnum CN Ġnum tables Ġnum Bytes Ġnum Parameters Ġnum Active Ġnum Features Ġnum TK Ġnum RK Ġnum Hs Ġnum Layers Ġnum Complete Ġnum brid Ġnum bnd Ġnum Processes Ġnum éri Ġnum ITEMS Ġnum Quotes Ġnum Profiles Ġnum Queued Ġnum Reps Ġnum Bags Ġnum Decs Ġvalue Arr Ġvalue BTC print info print State param file param class param string param dim param Panel param touch Ġ5 025 Ġ5 006 Ġ5 195 Ġ5 896 Ġ5 284 Ġ5 228 Ġ5 640 Ġ5 262 Ġ5 1301 Ġ5 1300 Ġ5 1006 Ġhe y Ġhe cho Ġhe bb Ġhe aves Ġhe lix Ġhe IPP Ġhe sab Ġhe xbin Ġhe xbytes Ġhe aviside Ġhe ksher Ġhe xtream mb s mb z mb ad mb ab mb art mb io mb box mb ia mb rl mb tiles mb logthumb ). '%( ib en ib ert ib bert ib Scale ib eB ib orne ib auer ib ullet ape uti Ġan um Ġan ex Ġan ty Ġan ton Ġan non Ġan ivers Ġan alizar Ġan isotropic Ġan omalous Ġan álisis Ġan tpat Ġ__ _\ Ġ__ ___| Ġfrom to Ġfrom key Ġfrom Node Ġfrom Task Ġfrom JSON Ġen de Ġen is Ġen orm Ġen ery Ġen vo Ġen ities Ġen closure Ġen kon Ġen laces Ġen contr Ġen closures ise uil ise mail ire view ard ab ard are ard ummy che y che mis che mpy che wing che zza che aron min es min ers min len min Time min Point min cost min month min Width min Vector min uit min pix min ante min Limit min Cost min payment min inode min ole min elv min imizer min utiae 999 86 999 47 999 800 999 892 ator es ator ie IT U IT ATION IT MS IT TER IT VAE Ġtime file Ġtime point Ġtime List Ġtime eval Ġtime diff Ġtime sec Ġtime DT Ġtime tracking Ġtime Slice Ġtime stepper Ġtime vortex Ġtime stepping Ġtime traSAS Ġtime ToFloat Error To Error Model Error String Error Event Error Factory Error Mixin Error Counter Error Information Error Reset Error Wrap scri m scri bble scri vere Ġ> ] Ġ> ", Ġ> ___ 18 076 18 90 18 80 18 012 18 915 18 208 18 232 18 964 18 287 18 932 18 876 18 454 18 2278 16 07 16 076 16 41 16 033 16 004 16 400 16 205 16 232 16 174 16 023 16 284 16 288 16 088 16 354 16 383 16 071 16 5500 16 2902 16 1104 Ġlist A Ġlist B Ġlist i Ġlist file Ġlist key Ġlist Array Ġlist All Ġlist SN Ġlist Val Ġlist Files Ġlist members Ġlist setpass line Y line a line up line with line Name line color line ins line Color line ares line plus line Ct line Ordering line loadings True Color True QStar coun ta array gen array Factor ft d ft se ft conditions sa I sa o sa ggio sa kai sa idas sa hedron sa voie sa wyer cur f cur file cur Dir cur pairs cur tis cur SaImagePatientNum da V da u da ct da um da ab da os da ha da vin da mak da maging '), \ Ġk J Ġk T Ġk in Ġk to Ġk lu Ġk result Ġk cal Ġk ont Ġk off Ġk iss Ġk tx Ġk med Ġk bit Ġk tk Ġk ares Ġk ali Ġk vectors Ġk yu Ġk urt Ġk agit Ġk ää Ġk amaelia Ġk atalog Ġk sclient Ġk azoo Ġk uvv Ġk amus Ġk aitai Ġk pobjs Ġk undu Ġk ết Ġk ripp Ġcol w Ġcol val Ġcol num Ġcol map Ġcol Num Ġcol dest Ġcol Count Ġcol lie Ġcol lins Ġcol lided 25 199 25 400 25 234 25 203 25 277 25 986 25 877 25 428 25 443 (): ") Ġro pe Ġro jo Ġro dz St V St k St ark St ability St ategy St amen St mts St argate St abilize Ġpy q Ġpy ver Ġpy path Ġpy ta Ġpy df Ġpy db Ġpy md Ġpy ns Ġpy norm Ġpy cord Ġpy Test Ġpy td Ġpy mer Ġpy ats Ġpy seed Ġpy inst Ġpy cf Ġpy js Ġpy compat Ġpy pa Ġpy cred Ġpy route Ġpy ina Ġpy micro Ġpy lb Ġpy NT Ġpy ftp Ġpy Tool Ġpy obo Ġpy ech Ġpy bat Ġpy ln Ġpy SPACE Ġpy contacts Ġpy bam Ġpy pcd Ġpy spi Ġpy quaternion Ġpy rsa Ġpy wifi Ġpy tmx Ġpy httpd Ġpy ingest Ġpy amf Ġpy CMB Ġpy cbf Ġpy cairo Ġpy caret Ġpy jokes Ġpy gmsh Ġpy SIR Ġpy corrector Ġpy fora Ġpy tai Ġpy montecarlo Ġpy exo Ġpy keops Ġpy trek Ġpy medphys Ġpy jsparser Ġpy covjson Ġpy embroidery Ġpy frechet Ġpy iom Ġpy teamup Ġpy BigWig Ġpy chpp Ġpy logview config db config ID config Name config Info config Button config FilePath Ġ6 07 Ġ6 22 Ġ6 27 Ġ6 200 Ġ6 83 Ġ6 67 Ġ6 68 Ġ6 144 Ġ6 373 Ġ6 2995 Ġ6 396288 lt l lt en Ġset size Ġset default Ġset Text Ġset Id Ġset types Ġset Status Ġset host Ġset Level Ġset New Ġset Red Ġset Property Ġset attrs Ġset Args Ġset Left Ġset Right Ġset Weight Ġset Angle Ġset LogLevel Ġset Reward Ġset Brightness Ġset Scenario Ġset recursionlimit Ġset Teams Ġset distroname ener ge ag p ag os ag ire ag ence ag ulation ag rees ag uer ag ono ag ésimo ag osto ag gggg ag ayan ump ur ump Exception ts H ts f ts ib ts utils ts io ts Num ts ks ts ync ts lice ts fdye http c http version http auth 04 100 04 96 04 36 04 56 04 98 04 400 04 216 04 234 04 301 04 132 04 897 04 364 04 181 04 409 04 248 04 219 04 866 04 928 04 228 04 356 04 3478 04 2800 04 2160 04 5600 04 93827 Ġmodel Dir Ġmodel cov Ġmodel KeysSet 13 0000 13 100 13 80 13 101 13 70 13 033 13 404 13 132 13 134 13 145 13 017 13 647 13 845 13 856 13 088 13 674 13 569 13 1045 13 1217 og s og x og an og ui og lion og litazone og loski og osml lib net lib Config lib Path lib cache lib mc lib ars lib pg lib jpeg lib usb lib mkl lib apprun lib resolv lib gdk lib pulseaudio lib zyre lib ressl 06 0000 06 16 06 88 06 27 06 96 06 923 06 28 06 101 06 89 06 62 06 300 06 41 06 69 06 205 06 175 06 384 06 193 06 208 06 905 06 203 06 196 06 007 06 427 06 209 06 946 06 407 06 393 06 434 06 342 06 3846 06 2616 06 2200 06 25755 Ġwh ist ll f class ind class group class var class fied class Total class Extractor ign itions ign atures 15 0000 15 70 15 40 15 123 15 224 15 096 15 334 15 178 15 237 15 326 15 988 15 644 15 309 15 357 15 965 15 646 15 977 15 877 15 978 15 866 15 246 15 445 15 442 15 060 lif u lif ter lif lower SE K SE Y SE AT SE MA SE IR SE LEX SE Linux SE ncoder ST i ST OL ST SR ST rial ST ILL ST XT ST VQ ST ALE ST INGER ST emplate ST exture ĠTrue RNG ec p ec let ec sv ec isionTree ec centric ec ticut cept js ace work ace Stats 100 14 100 27 100 97 100 50 100 1000 100 011011 100 024 100 011111 100 1110000 100 0100000000 100 100101 100 010100110 max R max T max l max abs max Int max diff max Point max rot max month max Sum max Dist max Iter max It max xyz max XY max Limit max Speed max slope max Contour max Rank max Coin max Radius max Allowed max readers max Retries max elv max Assayed max Attempts max CpuCount max ResultSize max CodeLen ass m ass ol ass able ass ass ass ai ass ists ass ia ass istent ass umption ass itance ass ibauer 05 03 05 19 05 23 05 80 05 000 05 28 05 201 05 48 05 73 05 41 05 51 05 127 05 205 05 214 05 906 05 422 05 987 05 385 05 386 05 355 05 466 05 877 05 985 05 219 05 665 05 399 05 772 05 2699 05 2246 Ġthis num Ġthis Type Ġthis comp Ġthis step Ġthis File Ġthis Path Ġthis Comp Ġthis Sim Ġthis Exp Ġthis Tf 03 30 03 48 03 91 03 025 03 401 03 104 03 136 03 403 03 406 03 422 03 955 03 687 03 055 03 555 03 928 03 044 03 972 orm ensal Ġint u Ġint Total Ġint Const Ġint tol Ġint entions Ġint repyd False Positive ]. ' cs n cs y cs go cs olve cs wrapper cs money cs strans jo v jo an jo ao jo hanna we Q we W we Z we g we is we ise we Dg we Dx we Dz uti en uti co uti fier uti ves uti liz ip f ip an ip data ip age ip type ip mi ip ron ip File ip Version ip kg Ġop Level Ġop tics Ġop beat Ġop tig Ġop tima Ġop acus eld g eld aten train label train Set train stop train Dataset train Folder train solv Ġch w Ġch al Ġch List Ġch ao Ġch ama Ġch asing Ġch anger Ġch rg Ġch uang Ġch ữ Ġch adcode Ġch isquare Ġch arect ax x ax num ax info ax ml ax Iterations ax elrod ĠĠĠĠĠĠ ĊĊ ĠĠĠĠĠĠ čĊĠĠĠ ĠĠĠĠĠĠ ĉĠĠĠĠĠ 17 32 17 16 17 101 17 21 17 31 17 202 17 404 17 211 17 150 17 117 17 299 17 184 17 188 17 385 17 565 17 018 17 648 17 454 17 671 17 1875 17 2475 17 1394 17 2596 17 0906 17 5855 Ġal im Ġal og Ġal ters Ġal dis Ġal gorith Ġal way Ġal pn Ġal tar Ġal locator Ġal bow Ġal eph Ġal phan Ġal ır Ġal inux Ġal phanum Ġal uminum Ġal unos Ġal imentos dd H dd c dd ts dd ress dd do dd raw dd Th dd dp dd mList 93 19 93 91 93 73 93 59 93 115 93 192 93 384 93 915 93 305 93 896 93 016 93 392 93 309 93 055 93 302 93 985 93 576 93 994 93 665 93 458 93 1545 valid Num valid adeAnuncio valid DataOperator ĊĠĠĠĠĠĠĠĠĠ ĉĉ lit re lit ches lit térature 14 19 14 80 14 69 14 400 14 384 14 102 14 537 14 964 14 445 14 369 14 562 14 4675 14 4808 roup ier ari ens ari py ari vo ari amente ari yla Ġpre y Ġpre cs Ġpre check Ġpre filter Ġpre gn Ġpre build Ġpre position Ġpre loop Ġpre formed Ġpre corpus Ġpre ceed Ġpre processors Ġpre existing Ġpre vention Ġpre tal Ġpre compiled Ġpre ddf Ġpre emphasis Ġpre TestResult Ġpre frontal Ġpre mature Ġpre mier Ġpre scriptors Ġresult Args Ġresult ColumnName uth era ne W ne ments ne bag ne berg ne utrino ne vents ne ssione ne arside ne threitz Ġ/ [ Ġ/ ` Ġ/ __/ Ġ/ ___/\ ord ado Ġat ti Ġat List Ġat yp Ġat rs Ġat tract Ġat ypical Ġat mos Ġat oi Ġat mpro Ġat oma Ġat mlst Ġat oolbox Ġat taches Ġat mfFuniMIB ok lahoma ok ogawa Ġby r Ġby Atom Ġby passes **** / **** ") vent y 64 14 64 44 64 45 64 43 64 21 64 68 64 69 64 61 64 0657 64 567 64 964 64 426 64 555 64 067 64 047 64 653 64 0394 64 8834 64 15926535 right Port right Count right SM right buff right KerningGroup Ġob p Ġob sc Ġob ses index Name index Search error ed error id error list error width error Status error Count error codes error Messages enti er enti el enti ers enti as enti ane enti tlement Ġrange Type Ġrange selector Ġra f Ġra k Ġra ds Ġra ces Ġra mse Ġra cog Ġra isim Ġra hav Ġra cine Ġra dicale Ġra paz Ġdefault username Ġdefault Version Ġdefault Lemmatizer base Name base store base objects base service base Interval base Points base validators Ġ[] ))) ou fla ou gou ([ % ([ (- ([ _( ([ -. ([ \' ([ "". ([ ],[],[ gra p gra il gra us gra cc gra mbling gra afia gra veyard 076 19 076 37 076 54 :// [ :// {} :// "), :// `` :// {}'. :// [[ :// *: info Element plot num plot Key plot Option plot Array plot Filename plot Figure plot Normalized count values count Lines count CNot iti zing iti vos LE A LE V LE AD LE TH LE Ge LE AST LE mitter Type Def Type As Type Left Type Validator RE Z RE PUT RE VERS RE VERSION RE LS RE PASS RE CAP RE BIN RE QS RE CALL RE TEN RE LIABILITY RE PAIR RE PRESENTATION RE IRA RE LAX RE TRAIT RE PAINT RE HEN RE UNICA RE INFORCE Ġtra x Ġtra der Ġtra sh Ġtra iter Ġtra ppy join all join style IC B IC P IC AN IC obj IC ASS 08 93 08 33 08 36 08 923 08 23 08 82 08 81 08 63 08 41 08 69 08 297 08 207 08 299 08 185 08 426 08 457 08 235 08 348 08 998 08 893 08 674 08 758 08 481 08 952 08 8877 08 1478 08 20676 argument type main page main Info main hand AN g AN ION AN INE AN NE AN CI AN CHO AN LLL AN DBack ty u ty List pi en pi al pi ate pi xes pi Ym pi ombo pi heptomino pi oglitazone 22 90 22 200 22 30 22 234 22 032 22 905 22 225 22 145 22 932 22 946 22 312 22 047 22 476 22 883 Ġ\ ([ Ġ\ '" Ġ\ """" Ġ\ _| Ġ\ __/ Ġ\ __| Ġ\ -----------> ust an mand er mand ato Ġ. + Ġ. , Ġ. [ Ġ. :: Ġ. -. Ġ. %%........%%....%%..%%.. Ġ. ----.----- ĠH Q ĠH V ĠH Z ĠH un ĠH il ĠH iz ĠH end ĠH ER ĠH ap ĠH ob ĠH AT ĠH Type ĠH AM ĠH av ĠH ED ĠH PI ĠH edge ĠH DB ĠH SC ĠH su ĠH FP ĠH ASS ĠH auto ĠH oly ĠH UE ĠH AV ĠH dl ĠH dp ĠH Loss ĠH TS ĠH RS ĠH HA ĠH Ãł ĠH RF ĠH RT ĠH ARK ĠH wp ĠH SG ĠH MAC ĠH DL ĠH enn ĠH ubble ĠH inge ĠH aven ĠH vac ĠH indi ĠH RP ĠH Ignore ĠH JD ĠH utch ĠH inch ĠH HHH ĠH ALF ĠH imesis ĠH ughes ĠH ockey ĠH ARBOR ĠH arbour ĠRe q ĠRe ss ĠRe fi ĠRe count ĠRe cre ĠRe gress ĠRe cr ĠRe compute ĠRe wards ĠRe jection ĠRe balance ĠRe pas ĠRe versed ĠRe placement ĠRe covered ĠRe aching ĠRe formatted ĠRe corder ĠRe paint ĠRe mind ĠRe vise ĠRe arrange ĠRe cession ĠRe produced ĠRe connaissance ĠRe vient ĠRe ynolds ĠRe ktangel ay ak ay Scale ay xyx tain ed sub d sub res sub code sub dict sub point sub Text sub box sub models sub space sub item sub event sub files sub block sub package sub unit sub words sub steps sub actions sub ways sub actor sub strings sub daily sub networks sub loops sub tabs sub divide sub sequent sub pout sub divisions sub classed Ġ{} $ Ġ{} ( Ġ{} > Ġ{} ? Ġ{} :: Ġ{} )), Ġ{} "). Ġ{} ]\ Ġ{} )} Ġ{} )" Ġ{} %\ Ġ{} )], Ġ{} !". Ġ{} {}{} Ġ{} ({} Ġ{} >'. Ġ{} ]'. Ġ{} ({})". odule s ml h ml log ml process ml ctx ml blocks ml perf ml Uq ml BCE ml Dao ml compass input X input type input class input node input ters input stream input Folder input enc input Attr input Shape input Dictionary input Choice input datadir lob ar np d np w np ri np sql np blocks eri DNXSts ][ * ][ / ][ ^ ][ :: ][ ^\ mat A mat al mat plot mat io mat ik mat gan mat free mat ica mat eria mat ika mat tone mat hew mat heus Ġsh m Ġsh or Ġsh en Ġsh am Ġsh ft Ġsh atter Ġsh du Ġsh irt Ġsh ënim Ġsh udder Ġsh erlock Ġsh preader Ġdi is Ġdi jo Ġdi ves Ġdi agin Ġdi ário Ġdi ssim Ġdi poles Ġdi coms Ġdi amonds Ġdi yoruz Ġdi mples Ġdi hedrals Ġdi lidir sk g sk r sk is sk om sk time sk jer sk uidlist df B df p df dU db V db b db lp db Data db host db ins db service db dt db admin db pool db rs db Query db ea db Args db eb db Wx db arra db latt mit m mit z mit te LL ERS LL CG LL TL LL MHeadModel LL TGE UT Q UT ILITY UT TER UT RAN work phone 88 10 88 23 88 80 88 71 88 925 88 224 88 301 88 905 88 225 88 305 88 304 88 987 88 426 88 385 88 065 88 997 88 986 88 565 88 018 88 015 88 967 88 067 88 246 88 945 88 901 88 658 88 1115 88 4393 88 5709 88 07907 88 6466 88 235294 lp V lp r lp ush lp bins ded Slice ded uction ast ate ast ec 19 40 19 033 19 125 19 002 19 567 19 116 19 325 19 184 19 865 19 847 19 756 19 868 output path output files output fn output cache output State output factor output buffer output Stream output Format output Paths output Commands output Constellation lin f lin de lin ers lin ename lin enum lin elen image x image Name image files image Get image Size image Login image Paths image Digest comp o comp ly comp check comp ability comp Vec comp licated comp enses comp arable comp romise comp actividad ID C ID N ID T ID ES ID AS ID ING ID Set ID From ID DIST ID colName ID potnika ID PERT (( { (( (( (( ((_ Ġsc d Ġsc at Ġsc ion Ġsc reed Ġsc aper Ġsc Tools Ġsc qubits Ġsc rews Ġsc intillation Ġ` ** Ġ` {" Ġ` .* Ġ` -------' 34 076 34 90 34 199 34 204 34 217 34 364 34 956 34 343 start Z start ers start pos start Ch start Key start At start dat start indices start Line start prob start Session start Button start Volume start Quest start Btn start WallClock start Verses pos Y pos b pos ion pos dict pos itor pos itivity pos iljatelja Ġ[" $ Ġ[" {} Ġ[" $% Ġ[" #", uil t Ġwe ars Ġwe chat Ġwe aker Ġwe ewx Ġwe ibo Ġwe pppy ated ListPageFactory 09 076 09 75 09 101 09 59 09 49 09 41 09 033 09 126 09 401 09 895 09 887 09 877 09 476 09 439 09 5668 84 19 84 27 84 33 84 66 84 82 84 89 84 70 84 21 84 58 84 78 84 125 84 925 84 199 84 401 84 193 84 132 84 299 84 908 84 537 84 286 84 986 84 946 ĠIn de ĠIn to ĠIn version ĠIn cl ĠIn dic ĠIn Out ĠIn fra ĠIn active ĠIn validate ĠIn spection ĠIn cluding ĠIn fine ĠIn dividuals ĠIn fos ĠIn ertia ĠIn iciar ĠIn tialize ĠIn icio ĠIn surance ĠIn vasive write Log write mem write Info write bits write Pixels write Xml write ToFile write STDERR ery Keys with space with python ere a ere m ere se ere al ere ce ere gin ere very ION E ION IZATION 27 916 27 294 27 2000 27 915 27 296 27 286 27 394 27 997 27 018 27 445 27 3645 own load update lib update Log update At update Report update Geometry update Cofig update ManagerDialog ask rá ask atche Ġkey ing Ġkey up Ġkey state Ġkey man Ġkey Str Ġkey down Ġkey chains Ġkey binding Ġkey loggers Ġkey bindings Ġkey stroke nd en nd an nd ots nd hwc inter m inter ed inter ception inter ns inter cnt inter stellar inter ventions inter RoleMethod ant as ant onio gs F gs d gs i gs o gs u gs v gs Vi gs fit gs fc gs LC gs Fg gs orte gs Vh gs heets gs peech by l by os by Time by Size by stage by passed by strom by chev by testate bin Str bin width bin dist bin del shape Blending lock out lock names lock paths Ġle lo Ġle sen Ġle ech Ġle aking Ġle aked Ġle itos Ġle verCount Ġle ipzigjs Ġle aguer ill ers ill ness ĠThe sis ĠThe oretical result file result Paths result NContent ann data ann are ann eld arch spec arch ae ave fcns Ġax img Ġax ju Ġax elrod Ġconfig y Ġconfig Value 24 80 24 200 24 60 24 127 24 888 24 384 24 218 24 424 24 987 24 895 24 160 24 377 24 99999999 ound ary 37 10 37 40 37 60 37 164 37 232 37 456 37 907 37 987 37 303 37 037 37 938 37 247 37 367 37 318 37 358 Ġpath ing Ġpath Mapping Ġare al ak l ak t ak ro ak um ak ir ak ov ak ita ak tas ak iba ak umar ak elts ak meister ak chott Pro si Pro ba Pro spect Pro vin Pro grams Pro jet Pro ceeded Pro Dy Pro fession Pro metheus Pro fessor Pro yect Pro cedural Pro jeção Pro mpter state point state matrix state machine em en em ma em yst point B point plot point ee point OutMsgName map client map match map serv map Point map Nx map Renderer map Ny Ġoutput q Ġoutput size Ġoutput node Ġoutput files Ġoutput fn Ġoutput Filename Ġoutput Fs Ġoutput Cols Ġoutput DNAs Ġoutput Connections Ġ@ ' Ġ@ , Ġ@ !! Ġpo zw Ġpo zyx Ġpo istion Ġpo lolu Ġpo sedge Ġpo incare Ġcom er Ġcom me Ġcom un Ġcom Data Ġcom order Ġcom unic Ġcom fort Ġ-> ") Ġsub l Ġsub m Ġsub fig Ġsub label Ġsub index Ġsub lin Ġsub token Ġsub function Ġsub event Ġsub location Ġsub msg Ġsub struct Ġsub argv Ġsub network Ġsub fields Ġsub ways Ġsub stage Ġsub lists Ġsub setting Ġsub categories Ġsub lista Ġsub systems Ġsub grp Ġsub Centre Ġsub locality Ġsub pout Ġsub grupo Ġsub routines Ġsub thesauri Ġsub subbasepath Ġsub termRepresentsLessSignificant Ġsub rayado Ġsub thesaurus Ġso ch Ġso version Ġso okie Ġso chi Ġso ciety Ġso ciale Ġso umise lace d lace ment vel en vel lo vel diff vel vet vel æ yn chron yn etwork yn chemis Ġ{' % Ġ{' { Ġ{' +': rep id rep Num rep lan rep lying rep vgg rep avgs rep ubb AM J AM U AM HD AM Bg AM INA AM ETABLEREQUEST AM essage AM lJo 96 23 96 38 96 79 96 125 96 126 96 192 96 0000000 96 915 96 208 96 137 96 297 96 165 96 908 96 148 96 235 96 5000 96 045 96 956 96 038 96 393 96 310 96 1500 96 663 96 2092 96 9896 96 5225 Ġac g Ġac n Ġac y Ġac re Ġac se Ġac li Ġac res Ġac ces Ġac cord Ġac tives Ġac uer Ġac ctypes Ġac ertos Ġac redit ache co Ġcomp ss Ġcomp te Ġcomp ren Ġcomp eti Ġcomp licate Ġcomp liment Ġcomp Numb aliz enu aliz ador aliz ações ĠCon str ĠCon clu ĠCon sum ĠCon fd ĠCon roy ĠCon versions ĠCon formance ĠCon firmed ĠCon tracted ĠCon fidential ĠCon formal ĠCon duit ĠCon dicional ĠCon fluent ĠCon sumes Ġnew R Ġnew Y Ġnew c Ġnew id Ġnew data Ġnew path Ġnew args Ġnew code Ġnew array Ġnew result Ġnew query Ġnew values Ġnew File Ġnew link Ġnew Index Ġnew Image Ġnew feature Ġnew Item Ġnew metric Ġnew term Ġnew trace Ġnew Ip Ġnew pm Ġnew Val Ġnew Sequence Ġnew Meta Ġnew Head Ġnew regions Ġnew iters Ġnew Word Ġnew Filename Ġnew Pixel Ġnew Events Ġnew Socket Ġnew blk Ġnew jsonData Ġnew Coordinates Ġnew Processes Ġnew Poll Ġnew Getter Ġnew Signer Ġnew tds Ġnew ElementType Ġnew Dek Ġnew Bone Ġnew comer Ġnew AnchorName Ġnew regionaltoken Ġnew dimname Ġnew globaltoken Ġnew SnapPeriod Ġnew MasterAmbientVolume Ġall seed Ġall year Ġall caps Ġall Templates Ġall movies Ġall Skipped Ġall DNAs Ġall DictList Ġall Stars Ġall TimeList Ġall Prods Ġall MeasurementInfo Ġall FilesInDir Ġinput str Ġinput data Ġinput type Ġinput filename Ġinput Parser Ġinput Path Ġinput Inter Ġinput Size Ġinput Fs Ġinput Amplitude 55 02 55 06 55 17 55 93 55 27 55 85 55 98 55 38 55 200 55 77 55 82 55 29 55 65 55 21 55 39 55 264 55 198 55 119 55 857 55 196 55 166 55 293 55 455 55 956 55 328 55 454 55 068 55 843 55 1615 94 00 94 10 94 04 94 55 94 50 94 39 94 214 94 915 94 117 94 114 94 147 94 198 94 295 94 296 94 347 94 903 94 932 94 227 94 886 94 666 94 568 94 311 94 12892 clu mp Ġcur i Ġcur se Ġcur id Ġcur time Ġcur ly Ġcur len Ġcur Str Ġcur Volume Ġcur Indirection Ġcur idloc Ġcur blockindex Ġ} / Ġ} ): Ġ} }/ Ġ} }] Ġ} ................ 33 10 33 109 33 148 33 647 33 309 33 995 33 189 ĊĠĠĠĠ ĊĊĠĠĠĠĠĠĠ ĊĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠ ĊĊĠ ĊĠĠĠĠ ĊĠĠ ĊĠĠĠĠ ĊĠĠĠĠĠĠĠĠĊĠĠĠ ĊĠĠĠĠ ĊĊĠĠĠĠĊĠĠĠ DE K DE f DE w DE DE DE BUT DE PART DE POSIT DE DICTION DE PREC DE ADC DE DUCTION RO O RO IS RO IO RO TE RO PS RO TS RO BIN RO CONTROL RO rig Ġapp config Ġapp Config Ġapp struct Ġapp attack Ġapp daemon Ġapp oints Ġapp veyor Ġapp ctxt json lines json OK json gameevent json Fpath ()) " ()) > ()) [" ()) ._ ()) [- ()) ''' ()) +' ()) +". ()) ;', ()) +"'" split Quadratic fer c fer n fer ry fer rit fer dian fer ito fer imeter Name ID Name Of Name Mapping Name Prefix Name ConflictError node user node bug node labels node Time node Manager node Names node Features node sktop node mgr Ġlabel ss Ġlabel list Ġlabel font Ġlabel codes Ġlabel Style Ġlabel Propagation row er row ed row Map row land ample bottles av U av X av c av p av u av ion av gn av ille jang a Ġno f Ġno di Ġno error Ġno mask Ġno fit Ġno Rs Ġno EGStitching Ġno heaven Ġno Punc 87 14 87 19 87 09 87 57 87 107 87 21 87 81 87 58 87 59 87 202 87 255 87 005 87 401 87 234 87 295 87 896 87 287 87 293 87 385 87 392 87 988 87 5000 87 875 87 298 87 266 87 554 87 839 87 1709 mpl ane no S no et no out no sed no index no output no ai no static no echo no xl no Seq no cks no vertical no sem no Creation no oz no coerce no splash no stdlib no ocsp no yar no ExoSM no Outlier no DeleteAtEnd no Rotates Ġline a Ġline end Ġline Num Ġline bot Ġline strip Ġline Array Ġline break Ġline Len Ġline ctr Ġline Thickness Ġline itempro AL P AL j AL AM AL SO AL MENT AL IA AL BERT AL PAG AL LEMENT Ġclass x Ġclass ind Ġclass map Ġclass group Ġclass Count Ġclass refs Ġclass ific Ġclass Acc Ġclass Hits Ġclass Tallies fic ent fic amos fic titious exp list exp times exp tool exp asy exp Points exp unge exp Scores CT E CT ime CT ED CT GG CT ATT CT GC CT CG CT GAT CT TTT CT AAC CT RIA -------------------------------- ------- -------------------------------- ------------- Data point Data Message Data Access Data App Data Point Data Pointer Data Length Data Page Data Iter Data Types Data AI Data Header Data Buffer Data Len Data Mapper Data Free Data Cube Data Spectral Data Arrays Data ReadList Data gramProtocol AS D AS V AS an AS PP AS CI AS FLAGS AS hw AS GC AS erver AS RQ AS ession AS AKi iv z iv ist iv ly iv no iv tk iv shchyna Ġla va Ġla dy Ġla dos Ġla kew Ġla ctate '. { '. '), '. *\ Ġsys Name Ġsys Location Ġsys Contact Ġsys UpTime 85 10 85 02 85 88 85 98 85 000000 85 41 85 61 85 916 85 168 85 154 85 216 85 218 85 164 85 295 85 857 85 327 85 177 85 907 85 174 85 233 85 292 85 394 85 987 85 326 85 900 85 997 85 314 85 344 85 965 85 153 85 312 85 244 85 968 85 398 85 313 85 678 85 939 ive au ". +? 97 01 97 100 97 83 97 41 97 294 97 193 97 567 97 327 97 196 97 424 97 397 97 286 97 174 97 284 97 236 97 422 97 955 97 065 97 227 97 077 97 466 97 818 97 435 97 245 97 777 97 393 97 485 97 046 97 910 97 3736 rid t rid y rid otto back pack back projection back tracking back office mi N mi i mi et mi are mi era mi xF mi ura mi chi mi RNA mi stral mi eni mi lion mi amidade {} & {} ], {} __ {} ]+ {} }} {} *** {} \\\\ {} """. ken o ken berg ken nethreitz net o net sh net ware net cat net proto net common net stats net addr net speed net atmo net blow rans action 36 500 36 203 36 647 36 026 36 995 36 909 36 317 36 2597 Ġspe cre Ġspe corder Ġspe ktral čĊč ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ čĊč ĊĠĠĠĠĠĠĠĠĠĠ čĊč ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠ but es but ane ron d ron izer ron dis ron land ron soft ron esia ron ingen ull veig =[ ': =[ ": =[ ])), =[ #{ Ġuse f Ġuse able Ġuse default Ġuse keys Ġuse match Ġuse Cython Ġuse ExoSM 011 87 011 28 011 83 011 0100 011 101111 011 001111 011 912 011 316 011 01010100 Ġopen file Ġopen box Ġopen File Ġopen flow Ġopen CV Ġopen Main Ġopen Price Ġopen vz Ġopen ToNewsletter Ġopen nem Ġopen ravepy query Status query Element Ġid t Ġid Des Ġid Max Ġid Sub Ġid Window ĠK G ĠK H ĠK p ĠK t ĠK v ĠK w ĠK in ĠK ate ĠK id ĠK il ĠK om ĠK value ĠK ore ĠK lu ĠK IT ĠK ok ĠK ings ĠK ak ĠK em ĠK api ĠK ies ĠK not ĠK amera ĠK ube ĠK NET ĠK LT ĠK SK ĠK uz ĠK NP ĠK ori ĠK ras ĠK oh ĠK asa ĠK uh ĠK illed ĠK YC ĠK amen ĠK nox ĠK lue ĠK iK ĠK vad ĠK arna ĠK elv ĠK ubo ĠK acz ĠK archer ĠK irsch ĠK insh ĠK ruskal ĠK NearestNeighbor ĠK arelia ĠK NeighborsRegressor ĠK Qkq ĠK loeck ĠK laip utils TestSupport Ġuser tools Ġuser resp Ġuser account Ġuser Menu Ġuser Agent Ġuser Assignment Ġuser Temperature Ġuser Saturation Ġuser TestList 95 100 95 84 95 923 95 000 95 49 95 025 95 925 95 404 95 215 95 204 95 216 95 294 95 003 95 264 95 905 95 203 95 225 95 308 95 286 95 187 95 808 95 145 95 422 95 277 95 337 95 346 95 408 95 015 95 909 95 856 95 944 95 756 95 099 95 8844 95 8692 95 1156 95 9605 95 13788 ader ente 923 55 923 57 923 54 Ġnumber At Ġnumber Lost word file word seg word piece word vecs word pieces lat ore lat tices lat ino lat ina lat ColName lat Deg lat MinStr lat decsec lat tante Ġit max Ġit no Ġit terate Ġit iné Ġ'- % Ġ'- ']) Ġdist n Ġdist la Ġdist min Ġdist Type Ġdist ants Ġdist Record Ġdist iller Ġdist urbance view name view models view Set view cvs Ġcont enu Ġcont enders Ġcont ornos Ġcont atos Ġcont orl Ġimage folder Ġimage Object Ġimage Out Ġimage Int Ġimage Counter Ġimage Amp Ġrequest info Ġrequest Obj run Name run call run Test run scope run tests run Target run Job run Cancel run Simulation run Ima run estone Ġtry job cri min 00000000 03 00000000 005 00000000 10001111 instance type instance Id instance Tot 86 04 86 22 86 33 86 87 86 23 86 28 86 200 86 69 86 384 86 2000 86 207 86 387 86 235 86 988 86 276 86 355 86 247 86 266 86 047 86 557 86 289 86 092 stra ce stra der stra ights stra das stra sse 26 384 26 984 26 286 26 907 26 293 26 364 26 875 26 161 26 238 26 246 26 2345679 Ġmax C Ġmax k Ġmax ri Ġmax ed Ġmax pro Ġmax shape Ġmax mon Ġmax score Ġmax Key Ġmax Reg Ġmax seq Ġmax cost Ġmax radius Ġmax Power Ġmax iters Ġmax Distance Ġmax Delta Ġmax Contour Ġmax Depth Ġmax attempts Ġmax Chunk Ġmax Steps Ġmax Pixels Ġmax visits Ġmax Retention Ġmax Asks Ġmax Rapidity Ġmax Perturbation Ġmax sofar Ġmax CpuCount Ġmax endinghere ension e sum ade Ġtorch data Ġtorch ify mon ds mon lam mon ograph mon tare mon ahan mon omer Ġdo h Ġdo x Ġdo yle Ġdo ze Ġdo Get Ġdo fit Ġdo seq Ġdo ador Ġdo ssier Ġdo ilea Ġdate list Ġdate line Ġdate diff Ġdate Rule Ġdate Line Ġdate finder Ġdate Generation Ġdate InStock descri zione descri ptive fa A fa ith fa zer fa eda fa ileds Ġz T Ġz d Ġz w Ġz in Ġz mi Ġz ach Ġz ain Ġz err Ġz div Ġz cls Ġz Array Ġz beta Ġz scatter Ġz cnt Ġz Cell Ġz hang Ġz fh Ġz Vertex Ġz elle Ġz tilt Ġz uten Ġz versor Ġz awi Ġz azu Ġz aseden process er process date process Frame process All process Mesh process Csv process VideoStream Ġjson b Ġjson str Ġjson Str Ġjson logger Ġjson Object Ġjson Array Ġjson ified Ġjson Mas Ġjson Fpath init file init State init Persistent HE H HE I HE U HE ET HE MA HE LI HE ADE HE BAG HE DarkeningEP rit rary rit rat Ġparser fromhell Ġhas mat Ġhas mark Ġhas pr Ġhas neg Ġhas Big Ġhas PDF Ġhas Diff Ġhas Defected Ġhas PathSum string val string ere string isoformat string Repl Ġindex able Ġindex File Ġindex Of Ġtrain ings Ġtrain List Ġtrain Method default root default Key default Item default auto default Source default boot default Target default Marker default Capacity default Radius default TestLoader AG B AG GA AG GAT AG TTTT AG Ns AG PLL AG ACTTT AG Wstart 57 923 57 30 57 101 57 70 57 69 57 025 57 005 57 105 57 214 57 218 57 132 57 203 57 857 57 347 57 345 57 148 57 907 57 375 57 236 57 325 57 394 57 303 57 895 57 235 57 386 57 425 57 936 57 097 57 986 57 932 57 364 57 057 57 913 57 226 57 377 57 509 57 818 57 666 57 777 57 434 57 893 57 074 57 467 57 093 57 2503 57 7687 57 28906 57 09604 57 01129 57 21626 Ġ! . Ġ! > Ġ! !' his o cle os cle vis cle ars cle ansing Ġ[' $ Ġ[' ~ Ġ[' ']: Ġ[' $\ Ġ[' $', Ġ[' (', Ġ[' *', Ġ[' -' Ġ[' [', Par agon ... ( ... { ... } ... '), ... `` ... ')) ... '%( ... `") ... >>. Ġ8 10 Ġ8 92 Ġ8 16 Ġ8 15 Ġ8 03 Ġ8 14 Ġ8 22 Ġ8 27 Ġ8 24 Ġ8 95 Ġ8 35 Ġ8 30 Ġ8 91 Ġ8 39 Ġ8 31 Ġ8 123 Ġ8 195 Ġ8 086 Ġ8 061 Ġ8 9569 Ġext en Ġext ype Ġext List Ġext names Ġext colors Ġext inguish ster n ww J ww n ww Go ww pdb Ġ| ) Ġ| , Ġ| { Ġ| __) Ġ| _. Ġ| "+ Ġ| ::.. Ġ| ^)([ create Config create Function create Market create Tasks create Vault create Incident create ExpectationsPath create PointsEmbed "), (" "), ]), ED I ED k ED CE ED ITION ED LM ED LIT ED iphone IS i IS ES IS CO IS DIR IS SS IS ORT IS UP IS UB IS CR IS BI IS ATIONS IS PATCHED IS CSI IS OPREN IS ÃīS IS FIABLE IS ATTY reg as reg ulation reg istr reg ados reg Raw reg arded reg ulars reg olare Ġtf low Ġtf board Ġtf example Res izing Res cue Res olução Ġnumpy ro number One number Steps ix xxx ix Yt ix yyy ix xyy Ġbo xy Ġbo ven Ġbo hm Ġbo yer Ġbo effc do te do om do jo do times do va do zen do Individual do ssi do xyfile do gey do ReadInput Ġper o Ġper me Ġper from Ġper ig Ġper man Ġper forma Ġper missive Ġper imeters Ġper colation Ġper dida message Text message Link parse date parse addr parse DOM parse LTE parse Zigbee ale vel ale Net au fn au quier group id group Name group settings group Te group shared group retry group Sync spe tt layer list layer Count layer ValueM Ġne e Ġne u Ġne ve Ġne go Ġne ko Ġne Adv ele x ele ktron Text View Text Stream Text Block Text Rules Text DataObject Text ãĥģãĥ£ãĥ³ãĥįãĥ« Ġfil me Ġfil ms Ġfil texpr Ġfil navn env ar env Var env Variables env isning "," & "," ( "," ^ "," _ "," \' "," (", "," ("). Ġcreate string Ġcreate Parser Ġcreate Order Ġcreate Player Ġcreate Ground Ġcreate Compose Ġcreate Voxel Ġcreate Sphere Ġcreate UserForm Ġcreate XSCRIPTCONTEXT Ġcreate SffCdataStruct rc z rc lasses rc Param rc ulo List as List Str List Config List Path List Model List Comp List Index List Request List API List By List Size List Opt List VO List Prompt List Pods List Shards ware Definition current Config current Node current Count current Version current Link current Document current Directory current Points current DateTime current FilePath current ProfileName __( _ CO O CO c CO PE CO OP CO GS CO MAN CO MF CO UPL CO HERENCE Ġfunction ally Ġfunction Signature old way old TS color dict color Value color sys color Index color ante color Chooser color Trait color Doing color ShaderNodeName upp s upp ers Ġunder take port no port tab port raits port ugues man ti man parser man land man uals man uale man ubot man abar man ifolds ach in ach at ach al ach ute md g md t md utils md ca md runner md nJ version id version Major Ġlo i Ġlo k Ġlo on Ġlo pt Ġlo os Ġlo hi Ġlo fti 90 324 api Group api ajax api explorer trans Image trans ducer trans ceiver trans istion trans loadings status up status Dict 66 01 66 09 66 75 66 28 66 83 66 81 66 54 66 59 66 71 66 808 66 238 66 8675 23 10 23 128 23 132 23 114 23 119 23 176 23 008 request url request class request Obj unc entered AC F AC U AC h AC No AC ATION AC GAT AC ATTT AC GCC AC QUI AC AGTT AC LOUD AC omp AC NNNNN =( * Ġcheck up Ġcheck path Ġcheck file Ġcheck pt Ġcheck File Ġcheck Input Ġcheck button Ġcheck Sum Ġcheck invalid Ġcheck Delete Ġcheck Body Ġcheck Marker Ġcheck Inverse Ġcheck CartByGoods Ġcheck FullVerkey Ġcheck PhsConsistency Ġcheck ScrapedFinishedAndStartAnalysis Ġcheck formismatch ING EST ING EF Ġstart V Ġstart Z Ġstart x Ġstart Ch Ġstart Process Ġstart numbers Ġstart Draw Ġstart Mid Ġstart CircN lag om Ġte str Ġte go Ġte ilt Ġte krar Ġmat ype Ġmat plot Ġmat utils Ġmat Score Ġmat gend Ġmat erialized ps b ps gs ps ico Ġli ens Ġli ken Ġli sd Ġli dh Ġli fts Ġli pids Ġli gnes uld ron uld uk 44 000 44 117 44 287 44 927 44 967 44 088 44 068 44 4249 Ċĉĉĉ ĊĊ Ċĉĉĉ ĊĊĉ Ċĉĉĉ ĊĉĉĉĊĉ ðŁı º frame d frame Num frame times cont or cont Num cont ante cont orl ns l ns name ns us ns object ns nap ns opts ns dc ns Credentials ns lots und raw und ling und Control und aria und ária IM L IM ITY IM OS IM PAR IM AX IM IZATION IM MUT IM etadata Ġdis Y Ġdis ab Ġdis put Ġdis pl Ġdis pen Ġdis curs Ġdis orders Ġdis cern Ġdis continuous Ġdis proportion Ġdis appearance Ġdis appoint Ġdis regarded ulti mo ulti Dict *- * *- { Ġ** = ENT ATION ENT SOE object model object Type object Set object Class object Annotation AP C AP O AP h AP ON AP ED AP EX AP latform AP IO AP NS AP OD AP SED AP YQ AP RÃĪ ler ine Ġadd f Ġadd text Ġadd angle Ġadd Edge Ġadd Indices Ġadd Rand Ġadd Monitoring Ġadd Delimiter Ġadd tional Ġadd TrainingData Ġadd endum Ġadd NodesToLink Ġadd TwoNumbers Des peckle 75 11 75 03 75 93 75 14 75 82 75 29 75 63 75 41 75 217 75 286 75 057 75 2886 new W new Y new path new time new Type new state new query new mask new block new context new String new Comp new body new win new expression new tasks new Layer new Category new Target new Width new Order new Url new Word new Bits new Sheet new modal new Vocab new Publication new metatable new ComponentStatus new TokenName new sela stri x stri ps stri ca Ġtext X Ġtext files Ġtext cat Ġtext book Ġtext props Ġtext attack Ġtext Height Ġtext grids Ġtext Fill Ġtext stripped Ġ-*- : float Query float sit cor er cor rf cor onadash cor riere mail name mail bot mail Template mail paper io a io v io lib io info io tis io tio ait a Ġrun file Ġrun if Ġrun compile Ġrun Folder Ġrun Tests Ġrun pandas Ġrun Med OT Z OT Jk ]: ( ]: < ]: ]) Ġnode ids Ġnode Names Ġnode Sets Ġnode IpAddr Ġnode ConnectionData 000 11111 ild askrá Ġurl Counter Ġurl resolvers Ġurl canon Ġurl Subj clo th ef n ef sm ef Ik ']) [- ']) +" En er En force En coded En closed En rico En laces En cerramento Co a Co or Co op Co ving Co ales Co fee Co VB Co Simulation Co Initialize Co Robot Co upon Co YB Co û Co conut Co voit ,- \ auth user auth sets 11111111 00001111000011110000 11111111 0010011 28 10 28 90 28 000 28 134 28 295 28 212 28 312 28 257 28 911 28 252 28 084 28 3293 28 2806 RI p RI EN RI BE RI HY RI STM RI VV RI GID Ġend Z Ġend search Ġend Index Ġend oscope Ġend EpCut Ġend orsed Ex o Ex x Ex Start Ex End Ex pn Ex MY Ex ocross Ex PASy Ex hibit ET HERE ET Paths ET TES Id Set Id Field Id Table Id Dict Id Method Ġ-- ")) Ġ-- -\ raw N raw s raw input raw request raw Features raw Capture raw Prediction raw Deck raw DataParser raw midifile raw idÅĤowo var Match var shp var tis var ibles var fdiff so z so fs so lare so fth so dipodi Ġwill SayAll cal m cal dir cal do Ġmessage IdSet 56 27 56 923 56 38 56 102 56 567 56 934 56 304 56 854 56 288 56 013 56 986 56 932 56 985 56 818 56 648 56 2584 56 93588 56 18438 go on go us go vi go left go yal go vori go comics go ofy 98 90 98 300 98 175 98 214 98 218 98 217 98 147 98 135 98 195 98 212 98 286 98 332 98 048 98 965 98 018 98 975 98 087 98 399 98 993 98 262 98 0232 98 0113 Ġpass w Ġpass er Ġpass able Ġpass é Ġpass band Ġsp z Ġsp ill Ġsp its Ġsp lines Ġsp ines Ġsp atio Ġsp linalg Ġsp glib Ġsp hexa Ġsp irit Ġsp orco Ġsp ørsm client protocol client Secret FI B FI jk FI FTH local stack local domain local zone local isation local toc local mtime local BBox ding o 38 232 38 165 38 315 38 337 38 936 38 065 38 644 38 371 38 040 move Window move BookmarkTo my v my log my col my url my Name my Data my table my Str my Object my words my cluster my admin my bucket my Doc my Msg my repo my container my secret my Page my POS my consumer my Post my paste my funcs my dirpath my sensors my expired my Srv my anmar my emph my configdir my admintoken my Wing my badtoken my maxencode my oniyon obj name obj str obj names obj Func obj gain obj CodeMgr Ġdict ates Ġdict Char Ġdict Print Ġdict Tags Ġdict Glove Ġmin T Ġmin st Ġmin fi Ġmin ri Ġmin ers Ġmin ver Ġmin pro Ġmin mon Ġmin Num Ġmin To Ġmin dim Ġmin dep Ġmin Frame Ġmin conf Ġmin Number Ġmin Index Ġmin cnt Ġmin ims Ġmin uts Ġmin Lon Ġmin Bids Ġmin Ascendants Ġmin Perturbation Ġmin LUy Ġmin Pnt Ġmin Occurs Ġmin Concav Ġmin úsculo pop ul pop over pop olare Ġobject Expr ******** ***** LO AN LO PE LO FF LO BB LO YE LO zs LO bject ĠUn load ĠUn license ĠUn ify ĠUn link ĠUn roll ĠUn install ĠUn flatten ĠUn watch ĠUn changed ĠUn ached ĠUn closed ĠUn ido ĠUn resolved ĠUn restricted ĠUn idades ĠUn Supported ĠUn iva ĠUn occupied Po C Po D Po o Po v Po ster Ġ(' " Ġ(' # Ġ(' @ Ġ(' ## Ġ(' >', Ġ(' (', Ġ(' ........ Ġ(' "', Ġ(' *** Ġ(' #' Ġ(' ~/ box Args box props box Condition Ġ(" # Ġ(" ( Ġ(" '" Ġ(" {: Ġ(" *" Ġ(" =================================== check param check items check Path check board check If check Int check rain check Item check On check Transform check White check lstring check MinimumList batch s batch log parser é¢Ħå¤ĦçIJĨ title Text title var rix inyu Me als Me ze Me SH Me teo Me thanol Me ubles Me asuring Me mpoolTransactionResponse module store module Header Se pt Se ff Se gs Se eed Se ja Se ems Se qs Se aG Se vier Se asons Se idel Se minar Se gundo Se alURL Se minole uc ci uc ination uc umber uc davis Ac ross Ac cesses Ac quis Ac commodator method ology method IDs be ed be au be mpty be gri be atable Ġcan List Ġcan ada Ġcan Diff Ġcan Bullet UR U UR SE UR THER UR FACE ĠOR A ĠOR D ĠOR F ĠOR CAS ĠQ E ĠQ a ĠQ v ĠQ Name ĠQ stat ĠQ Config ĠQ pg ĠQ PU ĠQ UB ĠQ Gui ĠQ RS ĠQ Menu ĠQ VM ĠQ Buffer ĠQ Dense ĠQ vd ĠQ iling ĠQ UA ĠQ Shell ĠQ Media ĠQ Printer ĠQ Visa ĠQ Splitter ĠQ ScrollBar ĠQ trac ĠQ AbstractItem ĠQ SpinBox ĠQ DockWidget ĠQ ProgressDialog ĠQ FormLayout ĠQ iniu ĠQ ALocalize ĠQ RadioButton ĠQ VisaDynamicPlot ĠQ Vistrails 200 01 200 35 200 68 200 600 200 106 img B img list img List img feat img folder img math img dup img Gray Ġcolor Value Ġcolor si Ġcolor scales Ġcolor jitter Ġcolor aide PT E PT F PT V PT o PT TT PT ABLE PT QConfig uple ft of n of inger of lw of votes of legends of lows of fidx target Type target group target Table target cell target Port target addr target Directory target Url target wcs target GroupIds 35 999 35 232 35 197 35 808 35 377 35 66587 sample List sample table sample CA sample Sequence sample FSS AB IS AB AB AB NO AB LA AB USE AB RT AB Ln AB IRER Descri pcion vis h vis nights ud H ud ley ud ctOffers Ġcontain ig Col Start Col End Col Dir Col gate Col liding Col lective Col lects Col lege ref d ref r ref in ref ra ref ers ref node ref page ref na ref pages ref unds ref reshed step max step ped step linear step functions step funcs step rms Value A Value Field Value Exception Value Method Value Provider Value ToType ern ité Ġwor ries Ġwor lds org en org Id straint ables Ċĉĉĉĉ Ċ Ġus h Ġus ps Ġus pec Ġus ability Ġus bx Ġus bb Ġus ada Ġus phi Ġus Pattern dataset Path space x space mail space images space clean space craft Ġmo e Ġmo lo Ġmo sh Ġmo tions Ġmo ons Ġmo vers Ġmo mapper File Input File IO File Check File Dir File Stream File Buffer File Lock File IDs File Catalog File Finder File Manifest File Fragments File BasedCache File CorruptedError ain an ain file ain lp bs olve bs witch bs ExcessLiquid Ġresponse Val Ġresponse Bool pri g pri mo pri sed pri vo pri rodni pri stine 201 01 201 94 201 36 201 50 201 68 201 00102 AD URL AD Net AD OPT AD OW AD KV AD IFF AD VERT AD ORES AD PCM AD Leo ual a ran obe ran opie Ar V Ar bre Ar uba Ar rondis save params save folder save All save Output save Stack save Contour save Fig save EXR save SimulationData Ġtarget Q Ġtarget group Ġtarget ref Ġtarget File Ġtarget ted Ġtarget ctx Ġtarget language Ġtarget Letter Ġtarget Slaves tim m tim dett cre a cre ep cre ener Ġim A Ġim Folder Ġim cyl Ġim treat mission e Ġdf nrows Ġdf ncols Ġdf Pred doc val doc End doc Const doc ente doc Len doc Props ))) - ))) }}[]< ',' %. stat i stat parse stat Dict stat metas flow class flow meter ĠSe am ĠSe go ĠSe ções ĠSe vere ĠSe bastian ĠSe curities ĠSe infeld Ġad t Ġad or Ġad ap Ġad mission Ġad verse Ġad groups Ġad vs Ġad joint Ġad missão Ġad lı Ġad venture Ġad versary Ġad desses Ġad vemdpy Ġcurrent Status Ġcurrent User Ġcurrent Index Ġcurrent Dir Ġcurrent Ip Ġcurrent Loop Ġcurrent Month Ġcurrent FilePath Ġcurrent Extracts Ġcurrent VinList Ġcurrent ModelNames nn Q nn cs nn api nn Module nn nu nn ä nn Title nn nm nn vu gin al gin ation gin ny norm Err 45 004 45 905 45 403 45 267 45 366 45 343 45 319 45 859 45 940 ĠAN O ĠAN ET ĠAN GU ĠAN ACON 77 02 77 25 77 22 77 19 77 37 77 23 77 28 77 30 77 89 77 76 77 81 77 31 77 68 77 49 77 132 77 900 77 687 77 183 77 557 77 417 77 492 77 0258 77 25887 amp m amp q amp r amp er amp li amp as amp Out amp uz Ġvalid s Ġvalid Number Ġvalid Char Ġvalid Ans Ġvalid Extensions ng a ng z ng or ng round ng pu ng cr ng uy PO A PO C PO M PO UR PO LOGY PO PTS PO MDO PO DDER fil ings fil ante fil mato table a table t table data table Id table schema table Widget table Cols table linkrowfield zer inde attr on ich ar ich al ich é cent r cent age cent res item def item set item list item count item Address item Player item ToDelete item SetList item TagPath item LoopIteration ql E ql V ql W ql k ql ite ql Wq ql Yr ql Qo the o the data the time the ories the ora the things the bun ĊĊĠ ĊĠĠĠ ide Dir ide abuck token ed token State bug gy bug bear ved a ved o ved enie Ġerror File Ġerror width Ġerror Count Ġerror Obj Ġerror Angle Ġerror Messages atter Bot Ġdistri buting ey etracker ĠY P ĠY R ĠY tr ĠY ong ĠY mean ĠY ML ĠY uri ĠY eo ĠY ên ĠY CbCr ĠY aleNet Ġinter fer Ġinter fe Ġinter comparison Ġinter activ Ġinter jections Ġinter acted Ġinter quartile filen m filen r act ose act tca act caag ä¸ ¢ ä¸ ´ ä¸ ¹ ä¸ Ī ä¸ Ł feat B feat dir Ġfloat x Ġmay avi Ġspeci fiers uage m Ġrandom izes Ġrandom Integer Ġrandom Choice Builder Flag ĠX g ĠX en ĠX tr ĠX scale ĠX Key ĠX opt ĠX prev ĠX SL ĠX CODE ĠX FAIL ĠX EB ĠX uan ĠX AXIS ĠX iang ĠX SLT ĠX Beach ĠX TRIM ĠX BMC ĠX lsx ĠX mapEntry ĠX FStyle ĠX anadu sent pair sent encing fier Set `` ; `` `", Ġtrans fo Ġtrans code Ġtrans Figure Ġtrans forma Ġtrans located Ġtrans boeffc Ġtrans bfeffc Ġrow an Ġrow data Ġrow Dict Ġrow major Ġrow Recipe Ġarg um Ġarg sparser Ġbase x Ġbase width Ġbase mask Ġbase Port Ġbase Length Ġbase Delta Ġbase RefName CH M CH X CH andler CH EST CH OL CH DIR CH ATE CH AK CH ORD CH ARGINGTARIFFS CH ILDR CH ASSIS cc y cc ase cc ca cc make cc arini filename Component filename fmt filename Save inal ado call Method 47 00 47 103 47 132 47 394 47 277 47 408 47 093 47 0408 47 9605 47 0049 initi alizations ]] == ]] ])) ]] ]], ]] +\ ]] ))), ]] âĸĦâĸĦâĸĦ Ġcode block Ġcode system csv v csv out Ġenum Types event Type event names event let event expr event handler event bus event Added event InstanceId event EventId event InstanceType event SetTime Ġ, -- Ġ, (' core ID core vel core utils core api core meta core hq core Tf 101 84 101 27 101 97 101 90 101 80 101 98 101 77 101 207 101 700 101 01001101 101 001001111 action Count action transition action Pressed face Aligned command Id command StartAddress weight kg weight spaceship Str at Str PROSE column ar column Dict column Delimiter ĠEx amine ĠEx haustive ĠEx ercice [:, :], Ġgo less Ġgo opylib tf c tf Cb files ToReference files Processed las ot las ers las ysla names Classes Ġpos i Ġpos ibility Ġpos sessions Ġpos itivity Ġpos icao Ġpos ibles Ġpos sessor Ġpos itiva Ġpos itively pert angent Ġ9 32 Ġ9 15 Ġ9 17 Ġ9 08 Ġ9 55 Ġ9 001 Ġ9 127 top N top class top hat top Matrix top lists top Right top Lists ream ble replace The replace By replace With Ġ<= , Ġ<= ") Ġload data Ġload Json find path find file find point find number find Cell find windows find Closest find Nearest ash ip cy d cy box cy grpc cy chiti Status CH Status Event Status Widget Status Serializer Status Proto Status DHW Set X Set Y Set Error Set ters Set Status Set Field Set Key Set Load Set Resource Set Invalid Set Filter Set Variable Set Prop Set Parameters Set Channel Set Points Set Split Set Distance Set Marker Set Arn Set Console Set Separator Set Indices Set FileMetadata Set ToolTip Set NodeAvailable Set PasswordForm Set SecondDouble Set SettingValue Set ForwardingPipelineConfig Set CoolerLevels Set WindowTextW Ġpython s Ġpython Version Ġpython cile Ġpython neat ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĊĠĠĠ pl U pl py pl mn pl Eu pl orer pl Ratio pl urals items PerPage IL A IL DS IL ITIES IL ogger cord inates ton al dire ccion Ġsk us Ġsk inning Ġsk idl Ġreg al Ġreg type Ġreg meta Ġreg enerating vert ed Test Error Test Comp Test Image Test DB Test Script Test Corpus Test FunctionName ')) \ mean ed mean cost mean Corr mean SquaredError Ġgener ado HO U HO X HO PS HO URLY HO POPTS Ġser de 83 10 83 02 83 12 83 37 83 94 83 567 83 968 83 847 83 0193 Ġpd g Ġstring val Ġstring Length Ġevent map Ġevent queue Ġevent NO Ġevent InstanceId Ġone cell Ġone part Ġone Student wait time wait listed IB k IB it IB ase IB lock IB BO IB MQ IB qN IB CCCGE IB ELS IB YTE IB AKBQ IB DRS Ġmain fields Ġmain hand Ġmain Blocks Ġag b Ġag ility Ġag rega Ġag rirouter Ġag ogosml Ġver de Ġver ack Ġver ticle Ġver dade Ġver bal Ġver sement Ġver ece Ġver kri Ġver wenden Ch u Ch w Ch am Ch ari Ch ui Ch ops Ch imer Ch amb Ch ampaign Ch aco Ch icken Ch atham Ch apman Ch ongqing Ch anneld wh a wh als wh YI wh eres response Type response String nder iv ner ve ner gie led ore led ang led gers >> .. >> << du h du z du an du ro du os du je Ġlin o Ġlin solver Ġlin tian Ġlin cRNA random contact random Split random UUID ai ra ai om ai opening ai jer ai oregex ai xdzs rop olit UN H UN L UN b UN k UN s UN ER UN ING UN CE UN POST UN SW UN HAND UN EXPECTED UN ENCRYPTED UN SUBMITTED UN BLOCKED UN STRUCTURED UN SURE qual itative qual cuno gen a gen ex gen func gen conf gen za gen ö gen stein gen omics ĠIN P ĠIN TR ĠIN CAR ĠIN TERN ĠIN STITUTE ĠIN VOL ĠIN UTIL ĠIN VERT ĠIN DIC ĠIN VERSE ĠIN CLUDED ĠIN SPECT ĠIN VENTORY close Context sg t sg an sg bd sg lite filter Text filter queue filter Obj filter bank filter Labels filter Entities func ion func data func decls rt g rt sp rt tr rt dir rt ree ĠReturn RowCounts 82 10 82 03 82 106 82 908 82 027 82 987 82 997 82 365 82 956 82 111165 }) $ }) ` }) ], }) ...') }) ?") }) $' }) ;""") }) ?(\ Ġeach Para Ġfiles A Ġfiles Counters Ġfiles PassFilter ams un ams math ´ółģ µółģ¿ ´ółģ ´ółģ¿ ´ółģ ©ółģ¿ ´ółģ ¢ółģ¿ ´ółģ £ółģ¿ ´ółģ ¨ółģ¿ Sg p Sg u host serv host Port host ports host Release host elname order id Ġar s Ġar ap Ġar son Ġar util Ġar vo Ġar rary Ġar cg Ġar vet Ġar maz Ġar bitrage Ġar massist Ġcommand Name Ġcommand Id iter et iter bytes iter walk 46 20 46 216 46 297 46 305 46 284 46 987 46 303 46 645 46 246 46 356 PE ERS PE MS PE Metric PE Yj ĠJ K ĠJ en ĠJ al ĠJ ur ĠJ ens ĠJ ax ĠJ ID ĠJ ell ĠJ ets ĠJ ACK ĠJ uri ĠJ ama ĠJ ij ĠJ NI ĠJ FK ĠJ iao ĠJ oris ĠJ urisdiction ĠJ unior ĠJ MATS ĠJ anssen txt RSYST lower ing lower ed lower Limit Ġcv utils Ġcv fd Ġcv nets 107 37 107 87 107 45 107 60 107 0047 107 142857 Log Y Log on Log Text Log cat Log Info Log Group Log Mem Log istics Log Loss Log Formatter Log ica Log Subscription Log StartTime Log Dz Log EndTime Log TreeSize bg sub bg nd bg Color bg uess Num Id Num File Num Samples Num Atoms Num Respond Num RegToReceivePerSg Num IterationsPerEpoch oth on oth ic Lo te Lo ci yle ss yle aves 89 118 89 167 89 195 89 157 89 035 89 844 89 558 89 1327 89 87299 source date source info source ware source description source author source language source Desc source Glyph source Vault source Brand source codepro Ġcolumn ar Ġcolumn es Ġcolumn Name Ġcolumn Combination tiv eness lect ure DI E DI I DI o DI mage DI VISION Ġ] ], Ġ] ') Ġ] ._ Ġ] """ Ġ] }, Ġ] '. Ġ] ))) Ġ] |(? ome t ome ters ome than yp U yp ants yp ush yp Dot ĠSt an ĠSt inner ĠSt arter Field Set Field Index Field Mixin Field Prefix Field NotSupported Field Regrid Field IdDict Ġcal or Ġcal post Ġcal kow cp L cp a cp v cp lt cp raw cp gz cp daily [- _ [- _. [- +]?[ 70 926 ks vm ks Nv ks ander ks jon )] ", )] == )] ') )] ") )] ][ ld c ld l ld us ld api ld XV Ġdire cts Ġdire cotry ail ure ail saction 40 934 40 325 nx graph Ġmodule List Ġmodule Dir open all open connect open orders open Db open SSL open census open pipes open pmd open hackathon fg Y fg an fg color assert No assert ResponseError assert Calibrated Ġfeat arr Ġfeat MD Ġread back Ġread Input Ġread ily Ġread iness Ġread Filename Ġread Sensor Ġread Csv Ġread Excel Ġread ucr Ġread WKT Ġread McGill root ed root Key root Element root Zip root NVDAObject Ġupdate Config Ġupdate pc Ġupdate Entry Ġupdate CM Ġupdate Json ANT AGES Un V Un iv Un comment Un stage Un hook Un Register Un safe Un changed Un seen Un limited Un corrected Un verified Un necessary Un idades Un titled Un classified Un reachable Un stripped Un zipping Un scrambled Un subscribing pk ok pk fail The Example The Matching The Faces mask thresh mask RCNN Ġq un Ġq name Ġq th Ġq app Ġq xf Ġq ap Ġq we Ġq stat Ġq func Ġq rt Ġq dev Ġq network Ġq dot Ġq App Ġq tt Ġq rr Ġq yr Ġq kv Ġq anda Ġq vecs Ġq Pairs Ġq cow Ġq Secondary Ġq chrm Ġq gpv Ġq sortran Ġq InstallMessageHandler Ġq ibullet Ġq ipkg temp C temp ate temp ds temp Count temp bucket temp gui temp TS temp Next temp TweetIDs Ġversion tuple Ġversion Major TH A TH B TH M TH o TH x TH ub TH IN TH AC TH andler TH Tensor TH IR TH VC TH ICK TH Half TH oW TH ROTTLE tag on tag value tag line tag ne tag count tag map tag git tag cn tag lio tag gio tag æłĩçŃ¾ TR J TR a TR ING TR CK TR ender TR ADA TR UCK TR LDR TR AVEL TR ITON TR AREPRO description Node sys info sys Name sys rc sys obj sys location sys fs sys bytes sys Location sys Contact sys descr ĊĠĠĠĠĠĠĠĠĠĠĠĠ ĊĊ ĊĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĊĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĊĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĊĠĠĠĠĠĠĠĠĠĠĠĠĊĠĠĠĠĠĠĠĠĠĠĠ UL U UL DB UL DER air spaces air glow To sh To Item To Array To Var To Row To Cell To Sign To Space To Write To Delta To Root To Db To gether To Selection To CSV To Boolean To Fun To Theta To Define To Replace To Rename To Maker To Cart To Keep To Html To Portfolio To TreeNode To Grab To urney To Milliseconds To Polar To Gst To ArgumentList To TreeItems To Pym To Settle To InputForm Ġonly once ĠPy E ĠPy com ĠPy ong ĠPy Node ĠPy Core ĠPy lint ĠPy Open ĠPy Formatter ĠPy Engine ĠPy YAML ĠPy Bullet ĠPy EMD ĠPy Spark ĠPy copia ĠPy MISP ĠPy BBIO ĠPy ColourChooser ĠPy MVPA ĠPy CallByClass ĠPy JsParser ĠPy xitCoordinator ĠPy DME ĠPy Inquirer ĠPy Exocross score Pairs score atpercentile let tes let Transform let Geo CON TEST CON NS CON VS CON VERSIONS CON SIST CON CENTRATION CON GÃī DO L DO W DO Z DO bjects DO utput Ob m Ob n Ob z Ob ama Ob mZ Ob stacles Ob tenemos Ġrequired Name Ġrequired Keys Ġrequired DLLs gener ally gener acion De er De pt De ap De ze De bt De activate De compress De limited De posits De blas De compressor De voir De bub De Pagamento De cides De parting De positor ost ation exec l exec dir exec Button exec Cmd exec lfile gram fort field list field file field count field Info field Net field Width field Names field Precision Ġbatch i Ġbatch er Ġbatch ID Ġbatch List Config ID Config For Config Failed Config ValidationException Config Chess .') [- .') ;") sign a sign ific Ġcod alab 29 028 29 323 29 852 29 0400 not f not er not ch not set not Äĥ not finite not edown not atka not choosed US G US I US ub US Processor US iU US Reqs US FDACVM Ġ`` - Ġ`` \\ Ġ`` "# ]* ' ]* . ]* = ]* ') ]* )", ]* )*( ]* )? ]* ?: dim Z dim en Ġseri vce Ġval o Ġval es Ġval uation Ġval ptr Ġval lee Ġval pct Ġval Seed Ġval esti Ġval ormensal Time Type Time To Time Model Time DT Time Feature Time Interval Time Condition Time Steps Time APIClient Time SelectedText Time Spectra о Ñī о оÑĢд âĢ Ĭ block ers block model block wise block hash block storage block TagPath location panel location forecast cul ator cul ations cul ating cul ater cul enet round Val round robin Ġtable spoons Ġdoc id Ġdoc name Ġdoc ly Ġdoc filter Ġdoc qa Ġdoc umen Ġdoc plex Ġdoc BatchSize Ġdoc nado 65 07 65 16 65 04 65 93 65 24 65 87 65 26 65 23 65 35 65 82 65 46 65 91 65 49 65 315 65 396 65 227 65 272 65 939 65 4321 65 98904 off screen off eso Ġstate String gn K gn al gn as gn ize gn ato gn occhi Ġdb F Ġdb a Ġdb f Ġdb w Ġdb x Ġdb ss Ġdb type Ġdb ml Ġdb port Ġdb object Ġdb manager Ġdb username Ġdb Manager Ġdb factory Ġdb pedia Ġdb KeysSet Ġdb Instancetype graph scope graph dy graph cats grid L grid X grid ce grid ded grid scale grid Inds MP V MP h MP IP MP CM MP LS MP STrial 67 10 67 13 67 88 67 84 67 33 67 85 67 95 67 83 67 68 67 301 67 207 67 904 67 908 67 394 67 937 67 687 67 213 67 848 67 575 67 0134 cat on cat ure cat Num cat sand cat maid 43 10 43 001 43 934 43 964 43 955 43 968 show Info show Admin show calls show Fig show Plots show Legend show stores show Chorus show CategoryItem show Fps show XCanvas show YCanvas show ZCanvas bot an bot om bot states bot Web nal t Ġitem types head c head arr head Jnt head xsect Ġ{" ()": Ġsource IP cl str cl enter cl vm cl kk cl vls use Device use nc use Skip use Abs use Https ĠCON N ĠCON TR ĠCON DA ĠCON CEPT ĠCON CURRENT ĠCON VERT python s python da python bytes device info device Info device Label Ġup map Ġup link Ġup Pos Ġup Block Ġup Target Ġup take Ġup mL Ġup Blink Ġup Eyelid Ġup gList Ġshould Abort izer Spawner Ġcor o Ġcor os Ġcor so Ġcor rs Ġcor rf Ġcor ona Ġcor retamente Ġcor riere ĠPro MP ĠPro sim ĠPro jections ĠPro ceso ĠPro digal ĠPro fesional Ġdataset te Ġdataset Name Ġdataset Dict results dir Table Column Table Input Table Rows Table ClickhouseAnnotation CL Y CL h CL BZ Ġplot Next Ġplot Legend Ġplot nine FF D FF V FF CE FF FC FF mpeg vid mode vid cap vid jeti vid goyal search Model search pts search For search Cat search Insert search Friends Ġ:: ::: uid o uid map uid attr ĠList as ĠList ings ĠList Size ĠList Dataset ĠList Instances ĠFlag Maker Ġcontin ents Ġ100 07 Ġ100 18 Ġ100 28 Ġ100 21 Ġ100 109100 INT EXT INT ENSITY INT HEBAG ins i ins om ins urer ins Discretizer fir N fir ing fir ingEvent vo or vo ce vo coder vo lare :: | :: ", :: %. dep Name 000000 12 000000 13 000000 06 000000 23 000000 43 000000 100101010110110000 Ġnet wor Ġnet utils Ġnet cat Ġnet proto Ġnet conf Ġnet weaver Ġnet uitive Ġnet filterqueue Ġpoint A Ġpoint data Ġpoint wise Ġpoint rs SI H SI q ug ent ug am ug os ug are ug acy ug ato ug abo ug ibi ug uale ug askan Ġmatch able Ġmatch model Ġmatch tags Ġmatch Result Ġmatch Matrix Ġmatch maker Ġmatch Tallies entry type entry points entry Key ({ ( Ġsample type Ġsample Id Ġsample Num Ġsample Names Ġsample Mean Ġsample Success cu ss cu ador cu QI cu encias Ġother name Ġother Utils Ġother Cost Ġother Purchase Ġother Mortgage page Token down text down step down buff down going down Payment down town down voting std call Ġaction Btn Ġresults File PI I PI K PI x PI PS PI PEN ''' + 48 10 48 95 48 28 48 644 48 272 48 2814 sv V ie urs ie zione )* ' Ġqu y Ġqu als Ġqu reg Ġqu ake Ġqu acc Ġqu arti Ġqu ê Ġqu ocsp Ġqu anity Ġqu ieres )): . Ġimg H Ġimg i Ġimg base Ġimg fmt Ġimg Filename Ġimg filenames Ġimg zmq EX B EX O EX v EX ION EX PAT EX PY EX ENAME EX CEL EX ASY EX PERIMENTS EX CITON 91 934 91 937 91 927 ĠData Value ĠData Test ĠData Parser ĠData Key ĠData pack ĠData Logger ĠData Handler ĠData Element ĠData Format ĠData Plot ĠData Types ĠData hub ĠData Sequence ĠData Flow ĠData Hub ĠData Transformer ĠData Si ĠData Robot ĠData InputStream ĠData Normalizer ĠData Plotter ĠData Uploader ĠData GridView ĠData KernelException ĠData LengthStandardizer ĠData plotOption #! !!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! only include FA CTION FA HP FA IRE FA IBAIB FA HRENHEIT FA gEAgEA err ata err log err info err ero err DecShiftArr err RaShiftArr err DecShift err RaShift pass o pass in pass er pass ation pass Filter pass ato ĊĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠ Ġany call fe B fe K fe Name fe ey fe her fe els fe Flood fe GaussianBlur fe omorphic fe itos fe ilaktig Ġfilename ids ating Aggregator red dest red die а е а ÑĨи 60 996 60 9975 Ġfirst ip Ġfirst Time Ġfirst Pos Ġfirst Char Ġfirst Img Ġfirst Vid Ġfirst Coeff Ġfirst MaxHeight Ġfirst StrFound Ġfirst DotIdx No a No on No pe No ob No vel No ised No Mac No Selection No VI No Editor No Focus No Wx No eF No DataValue No MatchError No JetsBVeto total count total Time total results total Info total Results total hosts total dos total Energy total Colors total occupancy total Months total SaImagePatientNum total Alerts total Liquidity total Earnings total FruitPureePercent ze al ze ip ze apy ze jie ze botWeb Ġ'. % Ġ'. -. \\ ']. \\ *\" mode li Ġarray List Ġarray Test Ġarray Valid Ġarray Factor Ġarray Expr Ġarray ByteCount Ġarray GroupMAPE Ġarray ToGLType ãģ IJ ãģ Ĵ rate list rate Fire content type content file content Language content Encoding content Disposition ĠAr ts ĠAr gon ĠAr kh ĠAr rival ĠAr kestra 42 025 42 074 42 088 42 363 42 1875 42 1885 TT G TT ING TT EST TT ABLE TT GS TT LS TT ae TT Font TT IGG Ġtemp d Ġtemp n Ġtemp img Ġtemp func Ġtemp Path Ġtemp Dict Ġtemp window Ġtemp TS Ġtemp Pnts Ġtemp TweetIDs ])) ' ])) \ ])) } ])) ], ])) +" msg types msg hdr msg RateInSeconds Ġgroup size Ġgroup Df Ġquery String Ġquery Norm Ġquery Cell Ġquery BatchSize ĠOptional ListStr last size last move last cmd last hop last Modified last Actions last Changed last uidl last PTB last segid last messageid pha setwo stamp ing stamp file stamp ato copy able copy Attributes copy FolderFiles MA V MA l MA AA MA udio Path Tra Path Component Path Cost Path Details Path Finder Path Strings Ġright avg Ġright Square ĠException Wrapper ĠException Middleware ĠException Reporter left s left Port left Count left SM left buff left Margin project dir project Config project Configuration project Labels project calico logger Handler EL IB EL APSED '): ] Ġpri zes Ġpri skirt Ġpri pojen Model IO Model API Model Cache Model Adapter Model Permissions Model Assembler Model CheckPoint Model SummaryCsv EST OR EST ONES EST IMATE link it link ers link ings link state link Name link Node link Object link uri link Style Ġcontext Dir Ġcontext Word Ġprocess data Ġprocess Node Ġprocess monitor Ġprocess Standard Ġprocess Func )/ " )/ ', )/ (\ )/ <( task class task view task flow task Token task master task Definition task Conds е Ñī ca j ca ma ca val ca using ca emo proto buffer proto byname mbed ding ")) ( ")) ): Ġhttp Protocol expr Search âĶ Ľ iss n iss ar )), ), Ġaxis System Ġaxis below DAT AROB board position âĸ ¶ ï¼ ĭ axis Swap Ġfig s Ġfig uring Ġfig ura Ġfull model Ġfull title Ġfull tag Ġfull negatedword Ġfull originalword Ġuti lites Ġuti litues ten a ten able ten acity ten stein ĠIS A ĠIS IS ĠIS INs ĠIS OTROPIC lete PomeriumSession span bound ĠValue Type ĠValue Change ĠValue Proxy ĠValue ToWrite server name server Socket server Uri mt n mt ks mt bl Ġwork horse "> [ "> #' "> "+"\ "> / "]) \ "]) ]) "]) ]. "]) }) "]) ;\ Ġexp j Ġexp map Ġexp List Ġexp resses Ġexp Year Ġexp Month Ġexp unge Ġexp anse Ġexp CompInDQ Ġunit b Ġunit Size Ġunit PreIndex parent al parent MatchingStyles Ġtag type Ġtag line Ġtag Type Ġtag filter Ġtag Map Ġtag strings Ġcount L Ġcount Var Ġcount Groups Ġcount firmreward points Blockerized dic are dic ante dic enet Get Res Get Text Get Time Get Max Get Response Get State Get Base Get Sub Get Label Get Resource Get Min Get Op Get Element Get Local Get Python Get Target Get JSON Get Project Get Directory Get Step Get Translation Get Container Get Global Get Tool Get Points Get Full Get Processor Get Angle Get Sys Get Axis Get PomeriumServiceAccount Get Inventory Get Spacing Get ComponentDef Get Dynamic Get PodResource Get Executable Get Quaternion Get Joints Get RootNode Get Ram Get ConnectivityTestRequest Get FieldID Get Compositions Get VFP Get MappingMode Get Dihedral Get Pstates Get LastError Get SecretValue Get Dlg Get SPName Get ForegroundWindow Get CoolerSettings Get BuildDir Get ProgressMessage Get ExternalNonContainerDatabase Get PfxFileName Get NumAtoms game time game Main game loading game Nr game Started Ġwrit ed Ġwrit eto UM ASK UM DQ UM BER UM ULATION Node Def Node Not Node Query Node Func Node Ports Node Attrs Node LabelList ĠPar rot ĠPar alle ĠPar adox ĠPar abéns match back match rank match toks tx p tx info tx To tx Start tx xxx tx ctls 76 11 76 16 76 04 76 06 76 14 76 34 76 09 76 36 76 57 76 75 76 28 76 98 76 214 76 906 76 306 76 185 xy C xy scale xy PosHandles Ġ'/ '+ Ġ'/ **/*. 81 998 lambda F lambda G lambda S ERS ERVICE 39 177 39 854 39 075 39 088 ymb Bar eval Date eval Files Ġclient config ny Z Ġcall from Ġcall Args Ġcall Later ice k ice ye Ġbreak ed Ġbreak Strings td q td w td z Ġsum Fit Ġsum Square Message Add Message Event Message Factory Message Popup Message Lite Message ToDict Message ListenerCallback address List address book Add To Add Method Add Unit Add Imm Add Translate Add Relu Add Accessed Add Fiducial Add BookmarkCallback Add LineageRequest Add RuntimeMessage Add Channeld pc L pc g pc nt pc ds pc ms pc dn pc LxW Ġsave able Ġsave filename Ġsave Dict Ġsave hist Ġsave Category Ġsave Img Ġsave ModSec Ġover ly Ġover views Ġover come Ġover writ Ġover buy Ġover due Ġfa ust Ġfa ça Ġfa ileds rand s rand var rand ao Ġ", # Ġ", "\ Ġ", "). Ġ", \\") Ġ", "")) bar Width bar sizes bar PA bar Height bar horizontal bar ometer bar shi bar ney bar riers bar polu Ġtensor shape Ġtensor pack Ġtensor bay Ġtensor hive Ġtensor FromSentence Ġele ctions bl m bl num bl ending bl ksz Ġass ists Ġass inatura Ġass igment Ġass inalado Ġiter at Ġiter count Ġiter Items Ġiter fzf matrix js uni str uni ver uni fication uni kal uni queness uni MIBCompliances Ġtyp name play Other play grounds char le char ter char count char map char List char les char mcraft ================================ ============= Ġmake tests Ġmake Color Ġmake Json Ġmake Eight Ġmake DLP struct ed struct log struct Type struct Base conf name conf str conf Directory build args build project build Number build settings build tool build Scopes Ġbool Deep Ġbool Bias Ġ& &&&&&&&&&&&&&&&& limit ation limit ée cho y cho colate Number Sum Number Images Number edList aw ss aw spk aw arded (\ ( (\ '' (\ +|- tensor network --- * --- .__ Ġed g Ġed l Ġed m Ġed en Ġed pt Ġed getpu Ġed wardyehuang Ġlast h Ġlast file Ġlast ip Ġlast row Ġlast Data Ġlast Num Ġlast block Ġlast URL Ġlast Pos Ġlast Entry Ġlast Item Ġlast Version Ġlast seen Ġlast Face Ġlast Img Ġlast TradeTimestamp Ġlast linelen Ġchar ma Ġchar data Ġchar Str Ġchar IDs Ġchar lie tmp c tmp File tmp filename tmp dirname tmp profile Ġtoken f Ġtoken files Ġtoken Create Ġtoken izing Ġtoken TimeStamp dump search dump xml dump vars dump button dump STR dump Shebang anti alias anti clockwise Ġnorm i Ġnorm alizations Ġnorm alizar TO BJ TO URS Ġword t Ġword files Ġword And Ġword Vectors Ġword relationships Ġword toix ren as ren tes ren dez ren cias ĠSee ingClearly ESC HEMA Ġfound row Ġfound End Ġfound Existing Ġfound Mails Ġfound Mets Ġfound FirstBreak Ġfound Treemap ik Q ik W ik Y ik r ik iz ik model ik UA ik Qi ik usi ik ostan ik HandJoint duct code conv in conv seg conv bert conv Ret conv large conv Missing conv gru conv Layers conv Inputs ui y ui jn čĊčĊ ĠĠĠĠĠ čĊčĊ čĊĉĉ čĊčĊ čĊĠĠĠĠčĊĠĠĠ čĊčĊ Ġč src Paths src Img src TestFilePath ĊĊĉ ĊĊ ĊĊĉ ĊĉĊĉĊ Ġmode ci Ġ## ') Ġ## ::::::::: entity Type entity TypeIndex scale IK PAT R PAT ENT PAT ERN mer o mer ry mer cen 54 11 54 17 54 27 54 55 54 36 54 932 54 555 54 321 54 15926535 channel Id she ffc Tra sh Tra vis Tra duction Tra ils Tra ctatus ial lo 1011 01011 1011 001111 1011 1001111 Ġframe time Ġframe match Ġframe bit 79 00 79 14 79 558 79 0510 Key code Key String Key Response Key Point Key Spec Key Provider Key Pair Key Chain Key InUse Key ReferenceArgs Ġfla ming Ġfla voring Ġinto x Ġinto gen template file template dir Ġauth s Ġauth name Ġauth key Ġauth enticator Vi et Vi Tt Ġoff s Ġoff load Ġoff shore itle y cv d cv f cv Hi const it 74 12 74 17 74 93 74 96 74 87 74 23 74 77 74 144 74 876 74 901 74 9615 74 0907 74 15926535 ĠVar Def ĠVar Pool ĠVar Bind ĠVar DeclarationNode ose q Dict Flatten cmd queue cmd Arg roll ES Ġdim X Ġdim mention tick r tick list tick Log tick interval MIB Objects Ġobj f Ġobj et Ġobj attr Ġobj etivo epoch num epoch Save exit Status MO US MO LLERS Ġ', " Ġ', '] Ġ', '). Ġ', '\ Ġ', ''))) Ġstep E Ġstep Num vector List ĠTone Set ĠTone Analyzer Ġtop score Ġtop left Ġtop Level mem or mem set mem UtilTask enter box enter tainment Ġ'__ / ĠCo M ĠCo co ĠCo ach ĠCo oper ĠCo arse ĠCo alesce ĠCo NLL ĠCo lossal ĠCo qState ĠCo vJSON less er less ubscribe 01111 1101 01111 10110 01111 1011111111111111101 fn r fn fe fn Dict Ġexpected Values Ġexpected Parent Ġexpected Indexes Ġexpected Thinned 73 00 73 02 73 12 73 347 73 1965 email Data Ġfind Max Ġfind Sub Ġfind Tag Ġfind And Ġfind Children Ġfind Pole Ġfind Substring Ġfind MinimalPhsBandCovering dis X dis ce dis array dis own dis inf dis cout dis GOL dis rupter dis chtime fit r fit ters fit Status fit datastat Ġimp ut Ġimp ath Ġimp rint Ġimp ls Ġimp lic Ġimp Model Ġimp uting Ġimp ulse Ġimp rima Ġimp ulso Ġimp recision property Node Ġ... }, Ġ... '): Ġ... "}, Ġ... ]): Ġ... )') Ġ... ]]: LI b LI QU LI WC LI PID Ġnext B Ġnext f Ġnext List Ġnext char Ġnext Ts String Reader String Handle ĊĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠ Object Set Object Factory Object Container Object Ids Object Detector Object ExprContext Object PathComponent Com Arg Com oe Com anche Com Pes FT M FT EST FT oken FT IR FT PARA Comp lt Comp uted Comp rome Comp lian Comp etitiveSignal Comp arer Comp utational common ly common prefix common js common Device common libs common Phone common datastorage Ġorder book cache able cache Control cache Ver cache Blocks cache hierarchies Bo om Bo ule Bo VB stack triax day Key day Of day diffs send term send Next send mmsg ush ing Ġuni forms Ġuni forme ful TestCase adj s adj close adj agecy ĠĠĠĠĠĠĠĠĠĠĠĠ Ċ ĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĊĠĠĠĠĠĠĠĠĠĠĠ 0101 7 0101 0000011 0101 011100001111 Ġtyping ctx pred st pred step pred File objects JSON unk i unk n Ġfilter Global Ġfilter banks Ġfilter Entities Ġfilter StatsEntry Ġspecific Match variable Count variable Conditioner next Node next Key next Entry next card next Char next Job next Func next Ts next SlideControl ĠTO O ĠTO MOR ĠTO POLOGY Ġshape Shading Response Results Response Processor Response MPCM ium a first frame first RetryIntervalInMilliseconds views CSV dev ic dev nodes dev Price Le vi Le ia Le ather Le aderboard Le Decoder Le uco Le banon Ġeval d Ġeval Gamma ats u OL TZ over use over pass over rider over powered over lord over ridable Class Factory Class Mixin Class Miss Class Cached role Dict role Credentials **************** ******* Input Values Input Default Input Element Input Connection Input ValidationError Input Sentence Input Cmds PP G PP n PP POE PP XUU PP vkk tree ToDict Ġbuild Tree Ġbuild Graph edge List Ġab it Ġab ert Ġab ide Ġab tools Ġab aq Ġab ritrary Ġsupp resses Ġmath jax 58 1024 58 224 58 197 58 013 58 996 58 937 58 947 58 966 58 247 58 067 58 945 58 343 58 354 58 1559 ores ize State Set State Method State Changed State TableError Ġinstance List Ġinstance ToTrasferList Ġfield ing Ġfield list Ġfield file Ġfield Name Ġfield Ptr wer o access Service access contextmanager access subg access KeyId pr q pr r pr u pr v pr er pr atic pr zed pr pCryptor pr ntframe Ser de Ser um Ser vic Ser gio Ser vidor Ser pent Ser pentine Ser pJob gr áfico Ġ12 12 Ġ12 06 Ġ12 03 Ġ12 17 Ġ12 14 Ġ12 37 Ġ12 97 Ġ12 36 Ġ12 86 dist in dist id dist max dist map dist files dist ante dist into dist eso dist urbance Cont amination learn able learn fair 78 01 78 10 78 92 78 32 78 25 78 19 78 27 78 9218 78 196 78 9577 OP L OP V OP p OP PI OP SA OP POSITE OP ASDF Out File Out Back Out liers Out Given Out standing Ġsettings Dict ĠTest e ĠTest ON ĠTest Path ĠTest Comp ĠTest Result ĠTest Server ĠTest Loader ĠTest Search ĠTest With ĠTest Vector ĠTest Multi ĠTest Utils ĠTest Player ĠTest Simple ĠTest Images ĠTest Runtime ĠTest bench ĠTest Persist ĠTest Scheduler ĠTest DataDirectory ĠTest Goal ĠTest Impl ĠTest HET ĠTest SetGenerator ĠTest Tensorboard ĠTest AdminMixin ĠTest Gyp ĠTest CallRate ĠTest CormEnum Reg CM Reg Density req from req val req Account req Ids case block case No и ÑĢÑĥем и анÑĤ Ġlocal list Ġlocal dict Ġlocal File Ġlocal User Ġlocal cidr ., ;: Ġsign o Ġsign bank ãĤ © Ġdest Path Ġdest Group Ġdest iny "\ . "\ /\ "\ "# Ġ16 18 Ġ16 25 Ġ16 85 Ġ16 90 Ġ16 77 Ġloss fn Ġloss Function DIR TY Ġ.. - ("\ "") ("\ ""+ pol R pol name pol ated pol Angle pol lination pol ynode ĠNo i ĠNo Item ĠNo Engine ĠNo Cache ĠNo PluginError stru ÃŃdo Ġbin I Ġbin ner Ġbin keys Ġbin edges Ġbin ja Ġbin Samples Ġbot pie Ġbot ões job app job search job trace change it change time change point change Number change sets change Reason change Fsync User Def User Size User Resource User Detail User Details User Messages User Slice User Dashboard User CreationForm Ġman que Ġman ki Ġman uscript features L system Name system Url system Settings system Host lim ine 59 18 59 16 59 55504 Ġparse Input Ġparse Int Ġparse addr Ġparse opts Ġparse lem Ġparse Drug Ġroot Name Ġroot Dir XXXXXXXX X uper pixel seq B seq db seq Dict seq tk seq fullname seq CWT Ġport list Ġport hole Ġallow ance SS Q SS a SS LC Ġhead water queue delay ĠDe ve ĠDe als ĠDe velop ĠDe bt ĠDe convolution ĠDe composer ĠDe couple ĠDe hydr ĠDe coy pen L pen insula sw ss sw ob sw av sw allow sw orth sw ana sw aran sw aty sw rangler Ġproject es Ġproject Dir Ġproject Title CA F CA k CA s CA z CA CT CA SET CA xis CA USED CA AAA CA UX CA ATCT CA FFE CA AGGT CA STLING Ġsetup aws Ġexec time Ġexec ure Ġexec uter spec name spec unit spec mod spec Dir spec Epoch 53 92 53 34 53 025 53 159 si q si ot si xd si ATI si Strip View point View let View URL View Filter View Mixin View Func rule set rule IP Ġform ing Ġform ulated Ġform FieldPrefix sor ce sor tid delta Intervallo github rest Ġlength y Ġlength Scales Ġlib E Ġlib ro Ġlib mp Ġlib path Ġlib act Ġlib ell Ġlib ros Ġlib dirs Ġlib city Ġlib fb Ġlib ensemble Ġlib crypto Ġlib atlas Ġlib jax Ġlib vips Ġlib gexf Ġlib nacl Ġlib ecc Ġlib Ensemble Ġlib cellml čĊĉ čĊĉčĊ Exception Message åı © 68 00 68 32 68 14 68 96 68 94 68 97 68 28 68 113 68 094 68 943 68 2815 68 92494 ĠRes olved ĠRes istance ĠRes Grp ĠRes cue ĠRes umo setStatus Bar Ġstatus code Ġstatus Params Ġextra ce Ġextra dep TY E TY H TY b TY f TY ER TY UI TY PING network zone network Dir network Location network Epoch network Uuid network Zones network HoldMohAudioSourceId Trans X Trans f Trans Value static ally abs list abs diff ĠGener alize ĠGener alization ĠGener ador IND UCTOR option chainanalysis CE B CE F CE KHI qui co ãĥ ¨ ãĥ ² ãĥ Į Ġglobal Scope numpy doc Ġav ant Ġav conv Access ing Access Type Access ory Access URL Access Logger Ġdirectory ToUnzipTo xff A xff B xff D xff E xff I xff Q xff R xff Y xff b xff q ym U ym q ym ine ym ind ym enu ym metric ym shIH package Name service connector service Agreement Th w Th z Th us Th under Th ilo Th ailand pb I pb Data pb ank pb alls pb rasil Index Length Index Word Index Pipeline Index Slice ia is ia ith ia Bot ia oct ia XN author ing Ġstd q Ġstd r Ġstd channel Ġstd meta acc are acc group acc gg acc ès xx ht xx xyyy xx Pvz Ġ'-- '), çļĦ shape çļĦ 为 çļĦ æĪIJ çļĦ ä¸Ģ个 çļĦ åĪĹ çļĦ ãģ« çļĦ åħ¨ çļĦ éĶ® çļĦ éħįç½® çļĦ åŁº çļĦ å¯Ĩçłģ çļĦ 主 çļĦ å®ļä¹ī çļĦ 对象 çļĦ è¾ĵåĩº çļĦ ä»»åĬ¡ çļĦ åľĨ çļĦ 代çłģ çļĦ æĵįä½ľ çļĦ æķ°ç»Ħ çļĦ ç³»ç»Ł çļĦ éĿŀ çļĦ æķ´æķ° çļĦ åĿIJæłĩ çļĦ 缮æłĩ çļĦ æł·æľ¬ çļĦ éĢī项 çļĦ å½¢å¼ı çļĦ åģı移 çļĦ 维度 çļĦ çĪ¬èĻ« çļĦ åŁºæľ¬ çļĦ ç½ijæł¼ çļĦ åĮºåĪ« çļĦ ä½ľçĶ¨ çļĦ è¡Ģéĩı çļĦ æķ°çĽ® çļĦ protobuffer ĠPython s ĠPython Module ĠPython LaunchDescription At test At Start At Step At Least At tribu At LastLine PL A PL X PL Z PL ly PL ING PL IB PL ANS PL ICATION PL MN PL KK pack two pack Manifest Ġblock ers Ġblock list Ġblock Name Ġblock header Ġblock diag Ġblock Names Ġblock Types Ġblock Sizes Ġparameter ised late xtool fs n fs Path fs mt fs decode fs anitize ordin ating ordin ators unit b unit dist unit Ãł (_ ). Man aging Man teiner Ġchange set Ġchange list Ġchange Angle ency clo 52 99 52 19 52 96 52 97 52 90 52 98 Ġ"/ ? Ġ"/ ^ Ġ"/ _ Ġ"/ *" cell Out cell wise cell any cell Values cell aris cell props cell Expression cell Reserved schema Ref schema Location schema validator ĠUser Account ĠUser Schema ĠUser Credentials ĠUser Course ĠUser WebSocket ĠUser Defined ĠUser Follower ĠUser Preferences ĠUser UpdateForm ĠUser OpenID Of F Of lines Of Link Of Two Of Expr Of Fields Of Interest Of fices position Exists position AtLastLine QU g QU FB QU Cg QU ENCH sq ls sq lex sq euclidean sq ladvisor If Name If pert If Box If Cap If Needed If VlanId If Necessary 62 12 62 03 62 88 62 19 62 96 62 85 62 86 62 347 62 865 Up Lo Up URL Up keep Up Down ank u ank y ĠCreate Object ĠCreate Button ĠCreate From ĠCreate Proposal ĠCreate Digest Ġfeatures L Ġfeatures Version ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠ nap aka nap akk )[ [' )[ ()] )[ ...] Ġmsg First ĊĠĠ ĊĠĠĊĠĠĊĠ ÑĤ ом ÑĤ олÑĮко Ġhere under Sh in Sh all Sh ark Sh ah Sh annon Sh akespeare remove stamp remove Class remove Bookmark remove NonAscii Ġ255 2 Ġ255 3 Ġ255 6 opt flow opt Estimator ublic ate GH w xml filename xml String xml Ser xml schema xml gameevent Ġexist en Ġexist ant Ġtitle bar ba H ba af ba atar ba Wavefunction Image Handler Image Button Image Stream Image NotFound Image Container Image Font Image ROI Image DataGenerator Image HDU Image SpriteId Image Png Image InstanceCollection pping Rate oken izer oken Parameter ĊĊĊĊ ĊĠĠĠĠĠ ĊĊĊĊ Ċĉĉ ĊĊĊĊ ĊĊĊĠ ĊĊĊĊ ĉĉĊ Int f Int ra Int set Int Action Int ConstContext Int ArgType IP R IP Sec IP SUM xec D xec H xec I xec L xec P xec Q xec X xec Z xec b xec d xec f xec j xec m xec r dot o dot log dot count ĠSo lem ĠSo Ca disp name disp lot disp uted disp osed disp osing :] } :] ', :] == :] }" :] `. :] }/{ Ġtmp f Ġtmp File Ġtmp dirname Ġtmp fname Ġtmp New Ġtmp First Ġtmp Json Ġtmp Filename Ġtmp Each Ġtmp Tmp Ġtmp Layers Ġtmp Fig Ġtmp LFN Ġtmp Exr Ġtmp FilesList Ġtmp PeakOrder 49 84 49 646 49 086 RES ELECT RES PAWN RES UMED RES ISTOR pu ff pu db radi obutton book ed book title book lets book worm ÑĢ ог ÑĢ иб ÑĢ еÑĦ Ġpackage dir Ġpackage Name Ġpackage LastModifiedTime Ġmap set Ġmap size Ġmap utils Ġmap entity Ġmap Wbem Ġmap Survol ĠPath List ĠPath Wrapper ĠPath Validator ĠPath finding DB Y DB z DB us DB Reader DB Unknown DB Snapshot DB DRIVER DB lue DB IAC DB tAI URL Base header ed header path header col header metadata header Cache Def end Def ending Ġtuple Id Ġtuple tuple Ġmask i Ġmask w Ġmask able Ġmask Gray 0100 10 0100 55 0100 10011 0100 1100 0100 10110 0100 0101100000111 0100 1010110010101 012 852 Ġgraph args Ġgraph array Ġgraph net Ġgraph ie Ġgraph dot Ġgraph sage Ġgraph ivz xaf D xaf Q xaf X xaf Z xaf c xaf d xaf l xaf q xaf r xaf w Info Ex Info Method Info Factory Info Wrapper Info Title Info Actor ---------------------------------------------------------------- --- ---------------------------------------------------------------- ------- ---------------------------------------------------------------- ------------ ene g ene i ene er ene gal ene Pipeline ene gro Ġ". "): Ġ". "}, Ġ". "))) Ġ". *") Loc File internal Id internal Are BU FG +' -% +' }' +' %- +' ">'+ part B part ly part config part probe part nership example Plot example SetDir EM ail EM LB EM KB Ġter adata Ġter med Ġter cio Ġter restre Ġter itori Ġ202 7 Ġ202 00 decode Htm SC K SC N SC IM SC RC SC rypto SC VI SC UDE SC gU SC IPY SC ORER tic ional tic stoolbox Ġmore Changes su a su er su us su ic su da ĠVersion Meta ĠVersion Upgrade Ġsorted Array Ġsorted Champs ĠSet or ĠSet Name ĠSet ters ĠSet Property ĠSet Motor ĠSet Slice ĠSet Cart ĠSet MemberForces ĠSet RestrictedTransferMethod PRO CM PRO PN PRO CFS abel le Context o Context Error Context Var Context Types Context Flags Context Creator sim Ecal sim Sbe Ġ"" ))) Ġ"" }) Ġ"" }], Ġ"\ '" Ġ"\ '% 202 01 202 534 Ġoffset box Ġoffset Start Ġfi er Ġfi ssion }\ ', }\ ", }\ ") }\ )? }\ "") }\ '') }\ .){ }\ ..{ }\ [\]] Ġorig count Ġorig ial Ġorig ination Ġorig intrain 63 16 63 04 63 15 63 34 63 80 63 033 Request Get Request State Request View Request URL Request Wrapper Request Body Request Apdu Request ForQuote Ġoptim izes This Batch ĠWe ber ĠWe ird ĠWe eks ĠWe apons ĠWe ibull ĠWe hrmann stream sets stream Arn stream Encryption stream Stopped Ġ15 99 Ġ15 0000 Ġ15 18 Ġ15 04 Ġ15 03 Ġ15 08 Ġ15 37 Ġ15 94 Ġ15 20 Ġ15 86 Ġ15 90 Ġ15 28 Ġ15 29 Ġ15 21 password MsgFinished Ġserver less Ġserver IP Ġserver Count Ġserver Settings binary Path CC B CC P CC z CC or CC IO CC DF CC CS CC ACHE CC ACA CC GCT CC Pic CC BRK Inter leave Inter peter Inter nationalization Inter faz Inter DayOnline Inter operabilityTag Ġgl and Ġgl Ortho Ġgl Framebuffer Ġfont bakery ĠGet Builder ĠGet Info ĠGet Token ĠGet Color ĠGet Output ĠGet Local ĠGet Dist ĠGet Project ĠGet Location ĠGet Note ĠGet Called ĠGet Vm ĠGet Lambda ĠGet Sky ĠGet Dynamic ĠGet Cert ĠGet Followers ĠGet EndPoints ĠGet ClipboardText ĠGet NumSamples 72 11 72 92 72 18 72 04 72 19 72 86 72 98 72 3303 72 0603 cluster Config cluster Ip cluster Module cluster apps cluster TimeSeriesCategorization delete hash delete Property delete UI delete ByName ĠAll Hub ĠAll detections ĠAll Imgs AA V AA g AA CT AA ACT AA AE AA UCU AA ITMS aded Attention IO Manager IO Device IO Buffer Ġthen ew nodes List na W na ip na idm na virice ĠID CT ĠID potnika (* ), (* [( wd w wd x domain Name domain Count itch er itch at ASE TTING åĪ ¼ Not Implemented Not Av Not Installed Not Loaded Not oS Not Interactive Not AssociatedWith Not Yet Not LinkBlock Not Consistent __) +"/ Ġtask i Ġtask num Ġtask flow Ġtask Index Ġtask Run CK bz med T med itations med nH setup script Create String Create Object Create Service Create DXGI Create Container Create Mapper Create Texture Create ByName Create Solver Create RG Create BlendShape Create ConnectivityTestRequest Create AuditProvider Create LogGroup Ġmy data Ġmy json Ġmy utils Ġmy field Ġmy Number Ġmy service Ġmy diff Ġmy Map Ġmy cloud Ġmy lang Ġmy region Ġmy Doc Ġmy Range Ġmy consumer Ġmy Offset Ġmy Interval Ġmy Func Ġmy Round Ġmy fwd Ġmy Formula Ġmy GroupId Ġmy Qr Ġmy Sensors Ġmy NodeName Ġmy Screeners Ġmy StickyRange resp s resp uesta Base Q Base ID Base Path Base Object Base Request Base Resource Base Task Base ball Base Position Base Controller Base fits Base Repository Base Sampler Base Backend Base Adapter Base Signal Base Distribution Base Migration Base HDU Base PerRun Ġtri l Ġtri ad Ġtri gg Ġtri angulo Ġtri vially Ġtri mestri metadata Format Ġcontent types Ġcontent On Ġdocument ing Ġsim ule Ġsim mate Ġsim iliarity Ġsim étrica Ġexample Value Ġph ne Ġph antom Ġph armacy Logger File Ġsa fer Ġsa hara Ġsa isie ross o ross rv ross zul Ġlevel two Handler Class Handler Manager Handler Adapter git Release git timo Ġnetwork Handler Ġnetwork Uuid fla m fla x fla vour API s API v API Url API ErrorCode ĠjnxMbgSgw T ĠjnxMbgSgw ProtocolErrRx ĠjnxMbgSgw PPT ĠjnxMbgSgw PacketSendFail ĠjnxMbgSgw DlDataNotifTx ĠjnxMbgSgw DlDataNotifRx ĠjnxMbgSgw DlDataAckTx ĠjnxMbgSgw DlDataAckRx ĠjnxMbgSgw ResumeNotifTx ĠjnxMbgSgw ResumeNotifRx ĠjnxMbgSgw ResumeAckTx ĠjnxMbgSgw ResumeAckRx ĠjnxMbgSgw SuspNotifTx ĠjnxMbgSgw SuspNotifRx ĠjnxMbgSgw SuspAckTx ĠjnxMbgSgw SuspAckRx ĠjnxMbgSgw UnknMsgRx ĠjnxMbgSgw CreateSessReqTx ĠjnxMbgSgw CreateSessReqRx ĠjnxMbgSgw CreateSessRspTx ĠjnxMbgSgw CreateSessRspRx ĠjnxMbgSgw BrResFlrIndTx ĠjnxMbgSgw BrResFlrIndRx ĠjnxMbgSgw BrResCmdTx ĠjnxMbgSgw BrResCmdRx ĠjnxMbgSgw DelSessReqTx ĠjnxMbgSgw DelSessReqRx ĠjnxMbgSgw DelSessRspTx ĠjnxMbgSgw DelSessRspRx ĠjnxMbgSgw DelIndTunReqTx ĠjnxMbgSgw DelIndTunReqRx ĠjnxMbgSgw DelIndTunRespTx ĠjnxMbgSgw DelIndTunRespRx ĠjnxMbgSgw DelConnSetReqTx ĠjnxMbgSgw DelConnSetReqRx ĠjnxMbgSgw DelConnSetRspTx ĠjnxMbgSgw DelConnSetRspRx ĠjnxMbgSgw CrIndTunReqTx ĠjnxMbgSgw CrIndTunReqRx ĠjnxMbgSgw CrIndTunRespTx ĠjnxMbgSgw CrIndTunRespRx ĠjnxMbgSgw UpdBrReqTx ĠjnxMbgSgw UpdBrReqRx ĠjnxMbgSgw UpdBrRspTx ĠjnxMbgSgw UpdBrRspRx ĠjnxMbgSgw UpdConnSetReqTx ĠjnxMbgSgw UpdConnSetReqRx ĠjnxMbgSgw UpdConnSetRspTx ĠjnxMbgSgw UpdConnSetRspRx ĠjnxMbgSgw CrtBrReqTx ĠjnxMbgSgw CrtBrReqRx ĠjnxMbgSgw CrtBrRspTx ĠjnxMbgSgw CrtBrRspRx ĠjnxMbgSgw RelAcsBrReqTx ĠjnxMbgSgw RelAcsBrReqRx ĠjnxMbgSgw RelAcsBrRespTx ĠjnxMbgSgw RelAcsBrRespRx ĠjnxMbgSgw GTPUnknVerRx ĠjnxMbgSgw StopPagingIndTx ĠjnxMbgSgw StopPagingIndRx ĠjnxMbgSgw DlDataNotiFlrIndTx ĠjnxMbgSgw DlDataNotiFlrIndRx ĠjnxMbgSgw PcktLenErrRx ĠjnxMbgSgw UnSupportedMsgRx ĠjnxMbgSgw RxPacketsDropped ĠjnxMbgSgw GTPPortErrRx ĠjnxMbgSgw PacketAllocFail ĠjnxMbgSgw IPVerErrRx ĠjnxMbgSgw IPProtoErrRx mc r mc as mc ap Ġgrid weights Ġgrid linewidth Ġgrid Dim Ġgrid peak Ġgrid linestyle AY YB xfe B xfe I xfe e xfe g ude ep Ġconst ela Ġleft Square font able font dir font color font File font Scale font Height font Weight font Properties font Face font Roboto enu wrap '][ ( '][ { ars is Al f Al z Al an Al te Al one Al ong Al Al Al arms Al anine Al corn Al ameda Al monds Ġsent num Ġsent Ctr Ġsent entias make code make Response make install make Record make depends make meme make Legal make DimLess make AttrTags year Company Ġ'' " Ġ'' + Ġ'' ", Ġ'' '), execute Preview Ġenv py gg able gg save gg cc gg ara gg ttcgt gg actcaag Qu in Qu ake Qu asi Qu Miw ause n ause Method video archiver video ListPath keep ers =- ' =- ( Ġsame Region Ġsame OriginOnly By Data By List By Path By String By Default By Layer By Action By Ag By Feature By Cycle By Alg By Middles Option Builder ĠFor ex ĠFor ked ĠFor wards ĠFor enci Ġidx Split ################################################################ ############################################################### Ġtraining data Ġtraining Mat window Title fp g ground work ground state ground Truth ground truths Ġsearch Model Ġsearch Element Ġsearch Keys Ġsearch Subdir Ġtransform lat Ġtransform List Ġtransform lng 1000 1111111111111111101 dec r dec in dec il dec im dec Mat dec lares Ġsrc Path Ġsrc GT Ġsrc Content Ġsrc Paths QL B QL V QL GR QL BY QL FY Client Exception Client Factory Client BackURL Client ConnectorError '\ { '\ ${ Ġscri m 69 03 mod type mod index mod erate mod ulation mod Content mod dynamic mod Security Ġwrite OK Ġwrite Location Ġwrite Area Ġwrite Edge Ġwrite CSV Ġwrite STL Ġwrite ModelSummaryCsv App State App les App Auto App Kit App rentice App StateError App BasicAuthConfigArgs App EnvironmentVariableArgs ink i ink oglion :` [- :` **{}** н еÑĢ н ед н аÑĢ н ак н еп н нÑı н оп н иÑĤе н ÑĥÑĤÑĮ н изÑĥ Ġpandas SQL dt or dt ode dt val dt max dt factory "{ : "{ \ ZE VOL bool Query TE ARDOWN "}, " ('\ " admin pass admin Password Ġoper ative Ġ'\ [ Ġ'\ '), Ġ'\ "' Ġ'\ '') Ġsu ave Ġsu iv Ġsu kal Ġsu dachipy Ġsome string Ġdown right Ġdown ward Ġdown scale Ġdown scaling full P full cell full hd full scene full reload full cw full ccw full StationID Rx Norm Rx Escape has Image has Label has Quest has markup has LTE has Zigbee has Commits xfb B xfb L xfb R xfb T xfb Y xfb c xfb k xfb q xfb w stop bits stop iteration stop oulos diff args diff spec diff Tuple =[' < 256 04 256 34 256 24 256 39 era ção era zione Ġgover ns Fa W ĠCh or ĠCh ol ĠCh op ĠCh ab ĠCh ave ĠCh ick ĠCh ao ĠCh eng ĠCh aves ĠCh ung ĠCh allenges ĠCh icken ĠCh ampion ĠCh orus ĠCh itiva ĠCh ronos ĠCh EMBL images out images ToUse images DType ĠNOT SET ĠNOT ICES uff t uff es uff us register ing register ation register Aug register Interaction register Triggered Ġshow img Ġshow grid Ġshow UI Ġshow Score Ġshow arrow Ġshow spikes Ġshow Moon scal c scal endar Ġmatrix es other tags other mal aa ai aa KD aa acgc aa zebotWeb tex p tex ar bytes Per bytes rem Ġconvert Type Ġconvert File Ad w Ad Pauli Ad rian Ad opters rap in ĠImage Num ĠImage View ĠImage Group ĠImage Change ĠImage Store ĠImage Meter ĠImage Math ĠImage Cro ĠImage Magick ĠImage Preprocessing ĠImage LinearizationExtractor home stack home phone home brew home automation Ñģ ÑĢ Ñģ ем Ñģ Ñİ Ñģ ом Ñģ ÑĥÑĢÑģ Ñģ ноÑģка ven ator ven ient ven iam ven aria Py test Py PI Py Doc Py SQL Py Pi Py yy Py CF Py Script Py craft Py dicom Py TypeChecker Py UnresolvedReferences Py BBIO Py PSA inst s inst orm inst ock inst aId ï¼Į [[ ĠAny mail ĠAny IO ĠAny way ĠAny Suggestion Ġmean a Ġmean time Ġmean col Ġmean count Ġmean Corr Ġmean CostByEpoch resource Name resource Group resource UrlBase Ġheader file Ġheader text Ġheader Size sing apore sing ularities az M az b az no az iland lan i lan ker lan caster hed ges orig map orig Filename ĠTh i ĠTh in ĠTh ur ĠTh under ĠTh umb ĠTh rust ĠTh irty ĠTh anh ĠTh rush ĠTh inking ':' ../ ':' _', ':' #', Ġcsv Out Ġraw i Ġraw db Ġraw Data Ġraw groups Ġraw FilePath Ġraw Df Ġraw Sentence Ġraw spc Ġraw Foreground For get For Text For CM For Action For Repository For Testing For Aut For Voice For Signing For Binomial For LogNormal For Benchmarks For AnimationPath For ProxyModelModel hash key hash cat hash diff hash Prevouts hash icorp TYPE VARS Ġvis ÃŃveis xef B xef J xef P xef R xef S xef U xef j xef m xef u track Event ĠType Input ĠType Context ĠType Checker ulation Level ĠSim u ĠSim ics ĠSim body ĠSim ulators ĠSim Muon ĠSim Calorimetry xfc D xfc H xfc L xfc M xfc N xfc O xfc R xfc T xfc V xfc W xfc d xfc g xfc w pg ate pg host pg aa pg schemas Size In Size Max Size Array Size NC Size Limit div Count xfa D xfa H xfa I xfa O xfa Q xfa R xfa V xfa q xfa ctor ']: . xbc F xbc W xbc b xbc j xbc m