Datasets:

NeelNanda

/

pile-10k

like 15

Today, a federal court in Miami permanently barred Jessyca Bernard from preparing federal tax returns for others, the Justice Department announced today. The civil injunction order, to which Bernard agreed, was signed by Chief Judge K. Michael Moore of the U.S. District Court for the Southern District of Florida. The complaint alleges that Bernard, of Lauderhill, Florida, owned and operated Proper Taxes, Inc. in Miami Gardens, Florida. According to the complaint, Bernard fabricated losses for her customers’ side businesses in order to secure refunds to which her customers were not entitled. In one example cited in the complaint, Bernard prepared a customer’s tax returns that reported losses of more than $27,000 and $22,000 based upon fictitious expenditures for supplies, utilities, and medical expenses. Bernard also prepared a customer’s return that fabricated more than $11,000 in losses, including $8,000 in supplies for the customer’s side business of washing cars on weekends, according to the complaint. Return preparer fraud was one of the IRS’s Dirty Dozen Tax Scams for 2018 and taxpayers seeking a return preparer should remain vigilant. The IRS has some tips on its website for choosing a return preparer and has launched a free directory of federal tax preparers. In the past decade, the Tax Division has obtained injunctions against hundreds of unscrupulous tax preparers. Information about these cases is available on the Justice Department’s website. An alphabetical listing of persons enjoined from preparing returns and promoting tax schemes can be found on this page. If you believe that one of the enjoined persons or businesses may be violating an injunction, please contact the Tax Division with details.

Background {#Sec1} ========== Schizophrenia is a common psychiatric disease with unknown etiology, which symptoms include cognitive dysfunction in addition to positive and negative symptoms \[[@CR1]\]. Cognitive dysfunction, which may reflect genetic susceptibility, is now generally considered to be the core symptom of schizophrenia with its own pathological mechanisms and related to the abnormal development of the nervous system \[[@CR2]\]. The ubiquitin-proteasome system (UPS), which participates in the intracellular signal transduction, synaptic function, plasticity regulation and neurodevelopment, is an important non-lysosomal protein degradation pathway in human cells \[[@CR3], [@CR4]\]. More and more studies show that UPS plays an important role in the pathological process of many neuropsychiatric diseases, including schizophrenia \[[@CR5], [@CR6]\]. The composition of UPS includes ubiquitin (Ub), ubiquitin-activating enzyme (E1), ubiquitin-binding enzyme (E2), ubiquitin ligase (E3) and 26S proteasome, among which E3 is the key factor in the selective degradation mechanism of UPS. The protein encoded by the neural precursor cell-expressed developmentally down-regulated 4 (*NEDD4*) gene belongs to the E3 family of ubiquitin ligase \[[@CR7]\]. Current studies have shown that the *NEDD4* gene is associated with many neuropsychiatric disorders, such as schizophrenia \[[@CR8]\]. Our previous studies have shown that multiple single-nucleotide polymorphisms (SNPs) of the *NEDD4* gene may be associated with schizophrenia, and the TT genotype of rs7162435 locus may be associated with the clinical phenotype of excitement and hostility in patients with schizophrenia \[[@CR9]\]. The protein encoded by the *NEDD4* gene plays an important role in many physiological processes of the central nervous system. Most of these studies focus on degenerative diseases such as Huntington's disease, Parkinson's disease and Alzheimer's disease \[[@CR10], [@CR11]\]. Current research on the *NEDD4* gene and cognitive dysfunction of schizophrenia is rare. Several studies have shown that abnormal expression of the NEDD4 protein in brain affects the ubiquitination of the α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptor subunit glutamate receptor 1 (GluR1), and the dysfunction of GluR1 may be related to the pathogenesis of schizophrenia and its cognitive dysfunction \[[@CR12]--[@CR14]\]. Therefore, a case-control study was conducted by our research group to investigate the relationship between the *NEDD4* gene polymorphism and cognitive dysfunction in Chinese Han schizophrenia patients. Methods {#Sec2} ======= Subject recruitment {#Sec3} ------------------- The study sample included 296 patients with schizophrenia and 320 healthy physical examinees (Table [1](#Tab1){ref-type="table"}). Table 1The age and gender distributions of patients in case group and control groupGroup*N*Age (χ ± s)GenderMaleFemaleCase group29633.17 ± 10.99108188Control group32032.48 ± 10.73138182t/χ20.0022.825*P*0.4300.093 For the case group, all these patients were hospitalized in the Shandong Mental Health Center from March 2011 to December 2013, most of the patients who come to the hospital can cooperate to complete the psychological test, including MCCB test. The inclusion criteria were as follows: meeting the diagnostic criteria for schizophrenia in the Fourth Edition of the Diagnostic and Statistical Manual for Mental Disorders (DSM-IV); the diagnosis was made by at least two experienced psychiatrists according to the Structured Clinical Interview for DSM-IV (SCID); between the ages of 18 and 65 years old; biology parents were Chinese Han population; education level was junior high school and above; no anti-psychotic drugs were taken at least 1 month before entering the group (the time of inclusion was the day of hospitalization); no modified electric convulsive therapy was performed within 6 months before entering the group. The exclusion criteria were as follows: with other mental disorders except schizophrenia in DSM-IV; with major physical illness; in pregnancy or lactation. For the control group, a total of 320 healthy physical examinees from March 2011 to December 2013 in Shandong Province were included. The inclusion criteria were as follows: between the ages of 18 and 65 years old; biology parents were Chinese Han population. The exclusion criteria were as follows: with schizophrenia or other mental illnesses in DSM-IV; with family history of mental illness; with major physical illness; in pregnancy or lactation. Scale selection {#Sec4} --------------- The general clinical data questionnaire made by our research team was used to collect clinical data of the participants, including their age, gender, education level, marital status, occupation and other disease-related data. The severity of the clinical symptoms of the case group members was assessed by using the Chinese version of Positive and Negative Symptom Scale (PANSS), which has been tested in China for norm and factor analysis and can be used to assess the symptoms of Chinese patients with schizophrenia \[[@CR15]\]. We used the Chinese version of the Matrics Consensus Cognitive Battery (MCCB) to test the cognitive function of case group members. The reliability and validity of the Chinese version had been evaluated, which had been proven to be an effective tool for assessing cognitive deficits of Chinese patients with schizophrenia \[[@CR16]\]. MCCB consists of the following ten subtests: Trail Making Test A (TMT-A); Brief Assessment of Cognition in Schizophrenia (BACS): Symbol Coding; Category fluency Test: Animal Naming (Fluency); Continuous Performance Test-Identical Pairs (CPT-IP); Letter-Number Span Test (LNS); Wechsler Memory Scale-Third Edition (WMS-III): Spatial Span; Hopkins Verbal Learning Test-Revised (HVLT-R); Brief Visuospatial Memory Test-Revised (BVMT-R); Neuropsychological Assessment Battery (NAB): Mazes; Mayer-Salovey-Caruso Emotional Intelligence Test (MSCEIT): Managing Emotions. SNPs selection {#Sec5} -------------- The SNPs information of the *NEDD4* gene in Chinese Han population was downloaded from the home page of the the International HapMap Project \[[@CR17]\]. We analyzed these information by using Haploview 4.2 software and selected 9 Tagger SNPs with MAF \> 0.05 and *r*^2^ ≥ 0.8, which were rs2303579, rs3088077, rs7162435, rs11550869, rs16976592, rs9806179, rs2414451, rs12593446 and rs7174459. Functional SNPs were obtained from the National Center for Biotechnology Information (NCBI) Database \[[@CR18]\] and were searched according to the following principles: MAF \> 0.05 in Chinese Han population or located in the 5'UTR region or the 3'UTR region or the exon. The functional SNPs we found were rs2303579, rs2302580, rs62043855, rs3088077, rs7162435, rs11550869, rs3833005, rs16976592, rs9920007, rs17238461 and rs1042477. Based on these information above, rs3088077, rs7162435, rs11550869 in the 3′ UTR region and rs2303579 (chr15:55860531, exon 4), rs62043855 (chr15:55915613, exon 1) in the exon were finally selected for research. DNA extraction and SNPs genotyping {#Sec6} ---------------------------------- Peripheral venous blood (5 mL) of control group and case group members was collect separately. The blood samples were shaken up in an anticoagulant tube containing 0.5 mol/L EDTA. The anticoagulant tubes containing the blood sample were centrifuged for 10 min at 3000 rpm/min to remove serum and white blood cells. The deoxyribonucleic acid (DNA) of the blood sample was extracted using the modified potassium iodide method. Genotyping was performed using the Taqman probe method of real-time quantitative polymerase chin reaction (Q-PCR). The primers and probes used in the experiment were shown in Table [2](#Tab2){ref-type="table"}. The PCR reaction system was 10 μL, including 0.35 μL each of forward and reverse primers (20 pmol/μL), 0.35 μL each of FAM/HEX probes (10 pmol/μL), 5 μL of Premix, and 1.80 μL of double distilled water and 2 μL of DNA. The reaction conditions of PCR were as follows: denaturation at 95 °C for 3 min; reading at 95 °C for 15 s and 60 °C for 1 min, cycling 40 times; cooling at 4 °C for 30 min; 40 cycles in total. Table 2Primers and probes sequences of SNPsSNPPrimer (5′-3′)Probe (5′-3′)rs3088077Forward: GGCTGTGTTGCTTGATAGATGTTTProbe 1: FAM-TTCCAGACCAcGAGCCCCTAGTG\--TAMRAReverse: GTCCCCAGCTGCAGACCTTProbe 2: HEX-TTCCAGACCAtGAGCCCCTAGTGG-TAMRArs11550869Forward: AAAGCACCTTCTGATTGTATAACACTTTProbe 1: FAM-TCTGGAACTTCTGACAATCTGcCATGA-TAMRAReverse: TACTTAACCTCTCTGGATTCATATTTCTTCProbe 2: HEX-TCTGGAACTTCTGACAATCTGgCATGA-TAMRArs7162435Forward: TACTGCTTTGTGGATCTTTAATGTTTGProbe 1: FAM-ACCAATGGTCAAtAGGATATGCAGGCA-TAMRAReverse: GCAATGGGTAAAAAGTATTAAAGCCTProbe 2: HEX-TGGTCAAcAGGATATGCAGGCAAGA-TAMRArs2303579Forward: TTACTTGACGGTGGAGGTGATGProbe 1: FAM-AAGGCCTGGcTGC\--MGBReverse: TAAGAGAAGATGAAGCCACCATGTAProbe 2: HEX-AAGGCCTGGtTGCT-MGBrs62043855Forward: CAGATGTCCTATGCATGAGCTTAATATProbe 1: FAM-CTGAATCAGAATtAAG-MGBReverse: GTGATTGTAAACCAGAAATGTCAGAAAProbe 2: HEX-CTGAATCAGAATgAAG-MGB Statistical analysis {#Sec7} -------------------- In this study, SPSS 21.0 software was used to establish the database, and the goodness-of-fit Chi-square test was used to verify whether the allele and genotype frequencies of the members in the case group and control group corresponded to the Hardy-Weinberg equilibrium (HWE). The chi-square test was used to analyze the differences between the various qualitative data of the study subjects, including gender, family history, education level, allele frequency and genotype frequency, etc. Univariate analysis of variance, analysis of covariance and non-parametric tests were used to compare the differences in cognitive function of patients in the case group, and non-parametric tests were used for those with non-uniform variance. The LSD method was used to perform multiple analyses. All the analyses above were performed using SPSS 21.0 software. We performed a power calculation using the G\*power program based on Cohen's method \[[@CR19]\]. All statistical tests were considered statistically significant at *P* \< 0.05. Results {#Sec8} ======= Data from 296 patients with schizophrenia and 320 healthy controls were analyzed. The results showed that there was no statistical difference in gender (χ^2^ = 2.825, *P =* 0.093) and age (t = 0.002, *P =* 0.430) between the two groups (Table [1](#Tab1){ref-type="table"}). The present sample size revealed 99.86% power of detecting a significant association (α \< 0.05) given an effect size index of 0.2 (corresponding to a weak to moderate gene effect). Hardy-Weinberg equilibrium {#Sec9} -------------------------- The genotype frequency distributions of the five SNPs in the control group all met HWE. In the case group, the genotype frequency distributions of four SNPs were consistent with HWE, except for rs11550869 (χ^2^ = 4.247, *P* = 0.039), the reasons may be as follows: firstly, the rs11550869 locus may be associated with the occurrence of disease or linked to disease susceptibility genes; secondly, the sample size is not large enough, and it may be necessary to increase the sample size to further clarify this issue. Comparison of allele and genotype frequencies between case group and control group {#Sec10} ---------------------------------------------------------------------------------- The allele frequencies of rs3088077 (χ^2^ = 15.4464, *P* \< 0.001) and rs2303579 (χ^2^ = 8.301, *P* = 0.004) loci were significantly different between the case group and the control group, while the allele frequencies of rs11550869 (χ^2^ = 1.243, *P* = 0.265), rs7162435 (χ^2^ = 1.706, *P* = 0.192) and rs62043855 (χ^2^ = 1.080, *P* = 0.299) loci were not significantly different (Table [3](#Tab3){ref-type="table"}). Table 3Comparison of allele frequencies of five SNPs in the *NEDD4* gene between case group and control groupSNPAlleleCase groupControl groupχ^2^/*P*rs3088077C354 (0.598)451 (0.705)15.464/\< 0.001\*T238 (0.402)189 (0.295)rs2303579C324 (0.547)402 (0.628)8.301/0.004\*T268 (0.453)238 (0.372)rs11550869G93 (0.157)89 (0.139)1.243/0.265C499 (0.843)571 (0.861)rs7162435T413 (0.678)468 (0.731)1.706/0.192C179 (0.302)172 (0.269)rs62043855T383 (0.647)432 (0.675)1.080/0.299G209 (0.353)208 (0.325)Notes: \* *P* \< 0.05 The genotype frequencies of rs3088077 (χ^2^ = 14.961, *P* = 0.001) and rs2303579 (χ^2^ = 8.106, *P* = 0.017) loci were significantly different between the case group and the control group, while the genotype frequencies of rs11550869 (χ^2^ = 0.730, *P* = 0.694), rs7162435 (χ^2^ = 1.752, *P* = 0.416) and rs62043855 (χ^2^ = 1.047, *P* = 0.593) loci were not significantly different (Table [4](#Tab4){ref-type="table"}). Table 4Comparison of genotype frequencies of five SNPs in the *NEDD4* gene between case group and control groupSNPGenotypeCase groupControl groupχ^2^/*P*rs3088077CC108 (0.365)164 (0.513)14.961/0.001\*TT50 (0.169)33 (0.103)CT138 (0.466)123 (0.384)rs2303579CC95 (0.321)129 (0.403)8.106/0.017\*TT67 (0.226)47 (0.147)CT134 (0.453)144 (0.450)rs11550869GG12 (0.041)10 (0.031)0.730/0.694CC215 (0.726)241 (0.753)GC69 (0.233)69 (0.216)rs7162435TT143 (0.483)171 (0.534)1.752/0.416CC26 (0.088)23 (0.072)TC127 (0.429)126 (0.394)rs62043855TT126 (0.426)148 (0.463)1.047/0.593GG39 (0.132)36 (0.112)TG131 (0.442)136 (0.425)Notes: \* *P* \< 0.05 Comparison of general clinical data and PANSS scores {#Sec11} ---------------------------------------------------- We compared the differences of the general clinical data (age, gender, family history, smoking history, drinking history, history of psychosis, total disease duration) and the PANSS scores (PANSS scale total score, PANSS positive scale score, PANSS negative scale score, and PANSS psychopathology scale score) between different genotypes of each SNP. The results showed that the PANSS psychopathological scores of patients with different genotypes at rs2303579 locus were significantly different (*P* \< 0.05). The ages of patients with different genotypes of rs11550869, rs7162435, and rs62043855 loci were significantly different (*P* \< 0.05), and there was no significant difference in other general clinical data and PANSS scale scores between different genotypes of each five SNPs (*P* \> 0.05). Comparison of cognitive functions {#Sec12} --------------------------------- We used one-way analysis of variance to compare the scores of MCCB among the patients with three different genotypes (CC, TT and CT) of rs3088077 locus. Non-parametric tests were used for those with non-uniform variance. After multiple comparison tests, the results showed that there were no significant differences in MCCB subtests scores among patients with CC, TT and CT genotypes at rs3088077 locus (*P* \> 0.05). Covariance analysis was used to compare the scores of MCCB among the patients with three different genotypes (CC, TT and CT) of rs2303579 locus. The results showed that in the test of WMS-III Spatial Span, the scores of patients with CT genotype were significantly lower than those with CC and TT genotypes (*P* \< 0.05). The scores of patients with TT genotype were significantly higher than those with CT genotype (*P* \< 0.05) in the test of HVLT-R (Table [5](#Tab5){ref-type="table"}). Table 5Comparison of MCCB subtest scores in patients with different genotypes of the rs2303579 locusSubtestrs2303579F*PP*1*P*2*P*3CC (*n* = 95)TT (*n* = 67)CT (*n* = 134)TMT-A48.02 ± 8.59946.52 ± 18.22046.09 ± 11.2570.6410.5270.4310.2760.889BACS: Symbol Coding42.58 ± 10.38942.82 ± 10.02740.78 ± 10.0121.4080.2460.8500.1720.157Fluency49.13 ± 9.90547.75 ± 12.49946.64 ± 11.5831.4140.2450.4670.0940.470CPT-IP42.77 ± 10.61642.58 ± 9.99941.12 ± 11.6570.8450.4310.9470.2430.333LNS46.91 ± 10.07045.54 ± 10.14045.22 ± 12.4200.6230.5370.4270.2850.911WMS-III: Spatial Span45.83 ± 12.23246.16 ± 11.76442.46 ± 13.5072.9170.0560.8430.045\*0.046\*HVLT-R44.20 ± 11.27347.39 ± 10.11343.28 ± 11.3882.7860.0630.0810.5870.020\*BVMT-R43.83 ± 11.79344.22 ± 12.00742.49 ± 11.7640.6140.5420.8320.3690.328NAB: Mazes43.88 ± 9.94743.93 ± 10.45841.82 ± 10.1151.1950.3040.9460.1670.247MSCEIT: Managing Emotions48.33 ± 11.86248.12 ± 12.95747.60 ± 11.5740.0780.9250.8830.6950.846Notes: *P*1 value represented the statistical significance between patients with CC genotype and TT genotype. *P*2 value represented the statistical significance between patients with CC genotype and CT genotype. *P*3 value represented the statistical significance between patients with TT genotype and CT genotype. \* *P* \< 0.05 We used the covariance analysis to compare the scores of MCCB among the three different genotypes of rs11550869 locus, and the same comparison was also performed at rs7162435 and rs62043855 loci. The study of rs62043855 locus showed that patients with TG genotype had significantly lower scores than those with GG genotype (*P* \< 0.05) in the test of NAB Mazes, while no significant difference was found between TG and TT genotype in this subtest (*P* \> 0.05), neither between TT and GG genotype. In the remaining nine subtests of the MCCB, the scores showed no significant difference between patients with different genotype (TG, TT and GG) of this locus (*P* \> 0.05). When it came to rs11550869 and rs7162435 loci, no significant difference between patients with different genotype was found in any subtest of MCCB (*P* \> 0.05) (Table [6](#Tab6){ref-type="table"}). Table 6Comparison of MCCB subtest scores in patients with different genotypes of the rs62043855 locusSubtestrs62043855F*PP*1*P*2*P*3TT(*n* = 126)GG(*n* = 39)TG(*n* = 131)TMT-A47.30 ± 8.98947.49 ± 18.53046.13 ± 13.2060.7060.4940.8220.2430.561BACS: Symbol Coding42.59 ± 10.30143.26 ± 9.33240.66 ± 10.1812.2110.1110.9520.0530.161Fluency48.60 ± 10.77747.54 ± 11.48046.85 ± 11.7661.0140.3640.5160.1580.748CPT-IP42.23 ± 11.05842.49 ± 9.96541.59 ± 11.2150.4000.6710.8620.3790.665LNS46.83 ± 9.85845.28 ± 10.10545.03 ± 12.6341.9620.1420.2300.0580.922WMS-III: Spatial Span45.20 ± 12.49745.54 ± 12.55343.25 ± 13.1720.9490.3880.9080.2150.330HVLT-R44.41 ± 11.46247.03 ± 10.78643.85 ± 10.9411.2460.2890.3050.4530.120BVMT-R44.14 ± 12.06845.21 ± 11.22541.95 ± 11.6711.6690.1900.6210.1440.131NAB: Mazes43.61 ± 10.29945.44 ± 9.21041.60 ± 10.1622.7230.0670.3700.0920.03**\***MSCEIT: Managing Emotions47.72 ± 11.47348.26 ± 14.36548.08 ± 11.7170.0130.9870.8800.9090.942Notes: *P*1 value represented the statistical significance between patients with TT genotype and GG genotype. *P*2 value represented the statistical significance between patients with TT genotype and TG genotype. *P*3 value represented the statistical significance between patients with GG genotype and TG genotype. \* *P* \< 0.05 Discussion {#Sec13} ========== At present, studies have shown that the *NEDD4* gene may be related to the pathological process of schizophrenia. Primary study of our group showed that several loci of the gene may be associated with the occurrence of schizophrenia and the clinical characteristics of patients, however, there is no study to investigate whether the gene is associated with cognitive impairment of patients with schizophrenia. Therefore, we conducted the above studies to analyze whether there is an association between the *NEDD4* gene and cognitive impairment of patients with schizophrenia. The results of the study were analyzed as follows: The score of WMS-III Spatial Span in MCCB represents the nonverbal working memory of the testee \[[@CR20]\]. The multicomponent model of working memory proposed by Baddeley et al. believed that working memory should be elaborated into a three component system, including the visuo-spatial scratchpad, the articulatory loop and the central executive system \[[@CR21]\]. At least two types of working memory systems have been discovered, including verbal working memory for processing linguistic information and spatial working memory, which tested by WMS-III Spatial Span in MCCB, for processing spatial information. The spatial working memory plays an important role in the spatial orientation and the solution of visuospatial problems. Glahn found that spatial working memory impairment was one of the neurocognitive deficits that may mark the genetic predisposition to schizophrenia \[[@CR22]\], and his findings suggested that deficits of short-term spatial mnemonic processing may be an effective endophenotypic marker for schizophrenia. Combined with our findings, the scores of patients with CT genotype of rs2303579 locus were significantly lower than those with CC and TT genotypes in the test of WMS-III Spatial Span. So it can be considered that patients with CT genotype of rs2303579 locus has more severe spatial working memory impairments, which means the patients with this genotype have more serious defects in temporary storage and initial processing of visual and spatial information than patients with other two genotypes of rs2303579 locus. It is already known that the mutation of C \> T at rs2303579 locus can cause amino acid residues to change from Serine to Asparagine \[[@CR18]\]. It remains to be further studied whether this amino acid change affects the function of NEDD4 protein, and then leads to the deficiency of spatial working memory in patients with schizophrenia. The test of HVLT-R in MCCB can be used to test whether verbal memory and learning ability of schizophrenia patients are impaired \[[@CR20]\]. Warrick et al. found that people with high-risk schizophrenia showed impaired verbal memory and learning functions before the full expression of psychotic illness, so verbal memory dysfunction should be a genetic endophenotype of the disease \[[@CR23]\]. However, Gildas et al. found that depression, low processing speed and selective attention deficits may affect the verbal memory function of patients with schizophrenia, they believed that patient's verbal memory dysfunction was caused by the above symptoms rather than a primary feature of the disease \[[@CR24]\]. Therefore, there is still no unified view on whether the verbal memory dysfunction is the endophenotype of patients with schizophrenia. Combining our analysis results, the scores of patients with TT genotype of rs2303579 locus were significantly higher than those with CT genotype (*P* \< 0.05) in the test of HVLT-R. Although there was no significant statistical difference compared with those individuals with CC genotype, the TT genotype individuals also showed an increasing trend (*P* = 0.08), so it can be concluded that patients with TT genotype of rs2303579 locus have better verbal memory than patients with CC and CT genotypes. Therefore, we speculated that rs2303579 locus polymorphism may be associated with verbal memory impairment of patients with schizophrenia. The verbal memory impairment is related to genetic factors and may be one of the endophenotype of this disease. The cognitive function tested by the test of NAB Mazes in MCCB is the ability of reasoning and problem solving \[[@CR20]\]. The ability of reasoning and problem solving is part of the executive functions, which are very important to the appropriate behavior and interact with other cognitive dysfunctions in schizophrenia patients. The NAB Mazes required the patient to retain the information on the pathways that have been previously passed, and then infer the next step. The assessment found that the schizophrenia patient had a defect in the function of the previous information maintaining, which may be one of the important factors for the deficiency of its executive function \[[@CR25]\]. The NAB Mazes can be used to reflect the cognitive ability of the prefrontal cortex of the patient, including the patient's foresight, planning ability, and impulse control ability \[[@CR26]\]. The cognitive impairment may be involved with a wide area of the prefrontal cortex, and its specific pathological mechanism has not been elucidated \[[@CR27]\]. Combined with our study, patients with TG genotype of rs62043855 locus had a significantly lower score than those with GG genotype (*P* \< 0.05) in the NAB. There was no statistically significant difference between TG and TT genotype individuals, but TG genotype individuals also showed a decreasing trend (*P* = 0.092). Therefore, we believed that the genetic polymorphism of rs62043855 locus was associated with the impairment of the ability to reason and solve the problem in schizophrenia patients, the TG genotype patients' foresight, planning ability, and impulsive control ability were worse than those of other genotypes. As we already know, the mutation of T \> G at rs62043855 locus can cause amino acid residues to change from Asparagine to Histidine \[[@CR18]\], which may cause changes in the function of NEDD4 protein. However, the relationship among the amino acid residues changing, NEDD4 protein and the impairment of the ability to reason and solve the problem in schizophrenia patients still remains to be further studied. There were still some limitations in our research. First of all, only the MCCB was used to perform cognitive tests on patients, without other cognitive testing tools such as University of California, San Diego performance-based skill assessment (UPSA), so the cognitive deficits of schizophrenia patients may not be fully reflected. Secondly, our study only analyzed the association between a single locus of the *NEDD4* gene and cognitive dysfunction in schizophrenia. However, schizophrenia is a complex disease with multiple genes involved, therefore, the genetic mechanism of cognitive dysfunction in schizophrenia patients needs to be further discussed in terms of gene-gene interaction and gene-environment interaction. Conclusions {#Sec14} =========== In our research, the *NEDD4* gene polymorphism of rs3088077 and rs2303579 loci was associated with schizophrenia in Chinese Han population. The rs2303579 locus was associated with the disorders of spatial working memory and verbal memory in schizophrenia, in which the CT genotype was a risk factor of spatial working memory impairment, and the TT genotype was a protective factor of verbal memory. The rs62043855 locus was associated with the disorders of reasoning skills and problem-solving capacity in schizophrenia, in which the TG genotype was the risk factor of these disorders. AMPA : Α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid BACS : Brief Assessment of Cognition in Schizophrenia BVMT-R : Brief Visuospatial Memory Test-Revised CPT-IP : Continuous Performance Test-Identical Pairs DNA : Deoxyribonucleic acid DSM-IV : Fourth Edition of the Diagnostic and Statistical Manual for Mental Disorders E1 : Ubiquitin-activating enzyme E2 : Ubiquitin-binding enzyme E3 : Ubiquitin ligase GluR1 : Glutamate receptor 1 HVLT-R : Hopkins Verbal Learning Test-Revised HWE : Hardy-Weinberg equilibrium LNS : Letter-Number Span Test MCCB : Matrics Consensus Cognitive Battery MSCEIT : Mayer-Salovey-Caruso Emotional Intelligence Test NAB : Neuropsychological Assessment Battery NCBI : National Center for Biotechnology Information *NEDD4* : Neural precursor cell expressed developmentally down-regulated 4 PANSS : Positive and Negative Syndrome Scale Q-PCR : Quantitative polymerase chin reaction SCID : Structured Clinical Interview for DSM-IV SNP : Single-nucleotide polymorphism TMT-A : Trail Making Test A Ub : Ubiquitin UPS : Ubiquitin-proteasome system; UPSA : University of California, San Diego performance-based skill assessment WMS-III : Wechsler Memory Scale-Third Edition; **Publisher's Note** Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. Chao Han and Kaiyan Cui contributed equally to this work. We thank all participant for their support in this study. LL designed the research; CH and XB performed the experiments and analyzed the data; KC and XB conducted sample collection and contributed reagents/materials tools; LL, KC, LW, LY, XB and MS were responsible for clinical diagnosis; CH was responsible for manuscript writing. All authors read and approved the final manuscript. This study was supported by Medicine and Health Science Technology Development Program of Shandong province (2015WSB06012). The funding body played no role in the design of the study and collection, analysis, and interpretation of data and in writing the manuscript. Researchers interested in the study may contact corresponding author to obtain relevant data via email: liulf521\@163.com. The study was approved by the Ethics Committee of the Mental Health Center of Shandong Province, reference number: (2015) Ethics Review (R08). All participants signed the informed consent before participating in the study. Not applicable. The authors declare that they have no competing interests.

/* * Copyright 2008 The Closure Compiler Authors. * * Licensed under the Apache License, Version 2.0 (the "License"); * you may not use this file except in compliance with the License. * You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ package com.google.javascript.jscomp; /** * Tests for {@link RenameLabels}. */ public class RenameLabelsTest extends CompilerTestCase { @Override protected CompilerPass getProcessor(Compiler compiler) { return new RenameLabels(compiler); } public void testRenameInFunction() { test("function x(){ Foo:a(); }", "function x(){ a(); }"); test("function x(){ Foo:{ a(); break Foo; } }", "function x(){ a:{ a(); break a; } }"); test("function x() { " + "Foo:{ " + "function goo() {" + "Foo: {" + "a(); " + "break Foo; " + "}" + "}" + "}" + "}", "function x(){function goo(){a:{ a(); break a; }}}"); test("function x() { " + "Foo:{ " + "function goo() {" + "Foo: {" + "a(); " + "break Foo; " + "}" + "}" + "break Foo;" + "}" + "}", "function x(){a:{function goo(){a:{ a(); break a; }} break a;}}"); } public void testRenameGlobals() { test("Foo:{a();}", "a();"); test("Foo:{a(); break Foo;}", "a:{a(); break a;}"); test("Foo:{Goo:a(); break Foo;}", "a:{a(); break a;}"); test("Foo:{Goo:while(1){a(); continue Goo; break Foo;}}", "a:{b:while(1){a(); continue b;break a;}}"); test("Foo:Goo:while(1){a(); continue Goo; break Foo;}", "a:b:while(1){a(); continue b;break a;}"); test("Foo:Bar:X:{ break Bar; }", "a:{ break a; }"); test("Foo:Bar:X:{ break Bar; break X; }", "a:b:{ break a; break b;}"); test("Foo:Bar:X:{ break Bar; break Foo; }", "a:b:{ break b; break a;}"); test("Foo:while (1){a(); break;}", "while (1){a(); break;}"); // Remove label that is not referenced. test("Foo:{a(); while (1) break;}", "a(); while (1) break;"); } public void testRenameReused() { test("foo:{break foo}; foo:{break foo}", "a:{break a};a:{break a}"); } }

Käfer, Golf, ID.3: Volkswagen leitet mit der Vorstellung des ID.3 eine Revolution ein. Das batterieelektrische Kompaktauto könnte der Beginn einer völligen Umkehr beim Antrieb sein, weg vom Verbrennungsmotor. Der ID.3 ist das erste Auto des Konzerns auf Basis des flexiblen Modularen Elektrifizierungsbaukastens MEB. Ab dem Sommer 2020 erfolgt die Auslieferung. Schon 2021 sollen im Werk Zwickau sechs unterschiedliche MEB-Fahrzeuge verteilt auf drei Marken vom Band laufen. Geplante Stückzahl: 330.000 pro Jahr. Bis 2028 sollen es kumuliert 15 Millionen sein. Zur Einordnung die Vergleichszahlen: Tesla hat seit Bestehen insgesamt gut 800.000 Model 3 (Test), X und S produziert. Nissan brachte über 400.000 Leaf auf die Straße – verkauft wird der Wagen bereits seit 2010. Volkswagen will also eine neue Dimension erreichen. Die Aufregung auf der IAA, gleichgültig, ob inszeniert oder real, ist groß. In der Golf-Klasse Der Volkswagen ID.3 ist ausschließlich als Viertürer erhältlich und gleicht bei den Außenmaßen einem noch aktuellen Golf (Test): 4,26 Meter lang. 1,81 Meter breit. 1,55 Meter hoch. Der Radstand beträgt 2765 Millimeter, was exakt acht Zentimeter mehr sind als beim Sportsvan. Bei einer Sitzprobe vor drei Wochen konnte heise/Autos feststellen, dass die Fahrerposition wegen des Batteriepakets erhöht und in der Folge die Kopffreiheit geringer ist. Das Platzangebot ist alles in allem großzügig. Die Karosserieüberhänge sind kurz, was in Verbindung mit dem Heckantrieb zu einem kleinen Wendekreis führen soll. Gegenüber einem Golf sind die Proportionen also etwas verschoben. Der ID.3 ist Van-artiger gestaltet, ohne ein echter Raumgleiter zu sein. Im Innenraum erinnert manches an den BMW i3 (Test). Zwei Bildschirme, einer vorm Lenkrad, einer in der Mitte, zeigen die relevanten Inhalte von der Geschwindigkeit bis zum Ladestand der Batterie an. Um die Fahrstufe D einzulegen, gibt es einen Bediensatelliten in Griffweite wie beim i3. Insgesamt wirkt das Cockpit reduziert und simpel. Eine Verschiebung der typischen Funktionen – keine Umwälzung. Die Wolfsburger kennen ihre Käufer genau und wissen, was zumutbar ist und was nicht. Drei Batteriegrößen Volkswagen bietet für den ID.3 drei Batteriegrößen mit einer Nettokapazität von 45, 58 und 77 kWh. Die entsprechenden WLTP-Reichweiten liegen bei 330, 420 und 550 km. An dieser Stelle sei nochmals erwähnt, dass die Reichweite nicht der Quotient von Kapazität und Stromverbrauch ist, sondern in einem gesonderten Verfahren ermittelt wird. Zum Verbrauch gibt es bisher keine Angaben. E-Motorleistung und weitere Zahlen sind vorerst nur für den ID.3 1st, die Sonderserie mit 30.000 Exemplaren, erhältlich. Der 1st hat das mittlere Batteriepaket mit 58 kWh. Maximal 150 kW sowie ein Drehmoment von 310 Newtonmetern wirken auf die Hinterräder. Die Höchstgeschwindigkeit ist auf 160 km/h limitiert.

UEFA Champions League Here you will find the odds comparison of the Champions League, also called the Premier-class. This European Cup competition is just behind a European Championship or the World Cup as the most important trophy in international football. We supply betting odds on all the games from the qualifying matches of the group stage to the final without interruption. We continually update all odds, so you don’t miss out on any bet. The best European teams play against one another. These include teams like FC Barcelona, FC Bayern Munich, Real Madrid, Juventus Turin, Borussia Dortmund and FC Schalke 04. In addition to the betting tip 1, tip 2 and tip 3, you can find the goal betting odds, or, for example, double chance bets in our odds comparison.

Safety outcomes in meta-analyses of phase 2 vs phase 3 randomized trials: Intracranial hemorrhage in trials of bolus thrombolytic therapy. Recent studies have reported disagreement between meta-analysis of small trials and subsequent large trials addressing the same question. However, disagreement for uncommon but serious adverse safety outcomes has not been examined. To explore disagreement for serious adverse safety (intracranial hemorrhage [ICH]) and efficacy outcomes between meta-analysis of phase 2 (small) vs meta-analysis of phase 3 (large) randomized controlled trials comparing the efficacy of bolus thrombolytic therapy with infusion for acute myocardial infarction (AMI). Electronic databases (MEDLINE, Cochrane Database of Clinical Trials) between January 1980 and December 1999 using the search terms thrombolysis, thrombolytic therapy, and myocardial infarction; conference proceedings; and reference lists. Fifteen randomized trials comparing thrombolytic agents administered by bolus injection with standard infusion therapy in patients with AMI. Data on ICH, other causes of stroke, total mortality, and reinfarction were independently extracted from each study by 2 observers. Meta-analysis of 9 phase 2 trials (n = 3956) revealed a lower risk of ICH with bolus thrombolytic therapy (odds ratio [OR], 0.53; 95% confidence interval [CI], 0.27-1.01), which was not statistically significant. Meta-analysis of 6 phase 3 trials (n = 62 673) indicated a significant increase in risk of ICH (OR, 1.25; 95% CI, 1.06-1.49). These results were significantly different (P =.01). There was no disagreement for efficacy outcomes. Phase 2 trials included younger and heavier patients with lower baseline blood pressures, and were more often open-label. Subgroup analyses suggested that each of these factors was associated with a lower estimate of risk of ICH with bolus agents. Our results suggest that when therapeutic interventions are associated with a potential for uncommon but serious adverse safety outcomes, there may be differences between small phase 2 and large phase 3 trials that result in their disagreement for safety but not necessarily efficacy outcomes. Further investigation of the frequency and causes of disagreement between small and large trials for safety outcomes is warranted.

Brace yourselves, starting March 11, 2014, a new line of Game of Thrones-inspired clothing is coming from Black Milk. So far, they’ve posted a few pictures of the collection, but the full line has yet to be revealed. [Source: Black Milk on Facebook]

Preoperative assessment of anterolateral thigh flap cutaneous perforators by colour Doppler flowmetry. An anterolateral thigh flap is very useful in head and neck reconstruction because of its long and large-caliber vascular pedicle, large skin territory and elevation simultaneous with tumour resection. However, the number and locations of cutaneous perforators vary individually, and thus, it is not widely used because flap elevation is often complicated and time-consuming owing to unexpected anatomical variations. To overcome this disadvantage, we assessed the number and locations of cutaneous perforators preoperatively by colour Doppler flowmetry. These data were compared with the intraoperative anatomical findings and their reliability evaluated. A total of 48 cutaneous perforators were found by preoperative colour Doppler flowmetry scanning of 17 anterolateral thigh flaps. All the perforators except two were found intraoperatively. Doppler scanning failed to detect four perforators. Colour Doppler flowmetry assessment therefore has a 92% true-positive rate and a 95.8% positive predictive value. All the flaps except one included multiple perforators, and sufficient blood circulation was observed in all cases. No flaps were unexpectedly changed to anteromedial thigh flaps or contralateral anterolateral thigh flaps because of inappropriate cutaneous perforators or the absence of perforators. Though this investigation is relatively time-consuming (30-40 min) and requires skill, it is very useful for preoperative flap planning and increases the reliability and safety of elevating an anterolateral thigh flap.

Doraiswamy Raju Doraiswamy Raju or D. Raju (born 2 July 1939) was an Indian Judge and former Justice of The Supreme Court of India. Career Raju was graduated in 1959 and obtained B.L. degree in Law in 1961 from the Madras University. In 1962 he was enrolled as an advocate in Madras Bar Association and started practice in various High Courts of India on Civil, Constitutional, Taxation and Land related matters. Raju worked as Standing Counsel for various Public Institutions and Undertakings of Tamil Nadu and Andhra Pradesh Government including Food Corporation of India. He was designated as Senior Advocate of Madras High Court in 1987. He was appointed as the Judge of the same High Court in 1990. On 17 November 1995 Justice Raju became the Chairman, Advisory Board of COFEPOSA. He was elevated in the post of Chief Justice, Himachal Pradesh High Court on 1 July 1998 and in 2000 he was appointed as Justice of the Supreme Court of India. Raju was retired from judgeship on 1 July 2004. References Category:1939 births Category:Living people Category:University of Madras alumni Category:Justices of the Supreme Court of India Category:Chief Justices of the Himachal Pradesh High Court Category:Judges of the Madras High Court Category:20th-century Indian judges Category:21st-century Indian judges

Q: Maximum winner matches N players take part in tennis championship. In every match loser is out. Two players can play a game if in that moment the difference of played games of that two players is not more than 1. They are interested, how many matches will be in the championship (maximal possible number) and what's the maximal possible number of games in which can take part the champion in that case. Example: n=4, maximum games is 3 and winner plays at maximum 2 matches n=100 , maximum games is 99 and winner plays at maximum 9 matches I tried some cases and observed maximum matches are always n-1 but cannot generalize for maximum matches for winner? Is there a way to generalize or formulate for maximum matches played by winner? A: I'm going to assume here that the maximum number of matches played by the winner is monotonic in the total number of players - I haven't thought about a proof, but I believe it. Let $f(n)$ be the minimum number of players necessary so that the maximum number of matches is $n$. So $f(0) = 1$, $f(1) = 2$, $f(2)=3$, $f(3) = 5$. This suggests that $f(n)$ is Fibnoacci. To prove this, assume that players 1 and 2 play in the last match of the tournament. Then they haven't played before that point, so essentially, 1 and 2 have played two entirely separate tournaments to get to that point. If player 1 wins and has played $n$ games after the last one, the most efficient way to do that (by monotonicity) is if player 1 has played $n-1$ games, and player 2 has played $n-2$ games going into the final game. The minimum number of players needed to make that happen is $f(n-1) + f(n-2)$, which is thus equal to $f(n)$. So, if we count 1 as the 0th Fibonacci number, 2 as the 1st, etc., then the answer to your original question comes from counting those numbers. Round $n$ down to the closest Fibonacci number less than it. Whatever the index of that Fibonacci number is, that's your answer. So, for example, 100 would round down to 89, which is the 9th Fibonacci number, giving your answer above.

797 So.2d 778 (2001) STATE of Louisiana, Appellee, v. Jerry W. MUNHOLLAND, Appellant. No. 35,941-KA. Court of Appeal of Louisiana, Second Circuit. October 12, 2001. *779 Stephen A. Jefferson, Counsel for Appellant. Richard P. Ieyoub, Attorney General, William R. Coenen, Jr., District Attorney, Penny W. Douciere, Kenneth D. Wheeler, Assistant District Attorneys, Counsel for Appellee. Before WILLILAMS, GASKINS and KOSTELKA, JJ. WILLIAMS, Judge. The defendant, Jerry Munholland, pled guilty to driving while intoxicated ("DWI"), third offense, a violation of LSA-R.S. 14:98. Thereafter, defendant was sentenced to serve three years imprisonment at hard labor. The defendant now appeals. We affirm. FACTS The defendant was charged by bill of information on June 19, 1999 with DWI, third offense, which occurred on April 17, 1999 in Richland Parish. The bill of information alleged two predicate convictions of DWI: (1) March 21, 1996: State of Louisiana, Parish of Ouachita, Fourth District Court, and (2) June 29, 1998: State of Louisiana, Parish of Ouachita, Fourth District Court. On December 21, 1999, the defendant filed a motion to quash the bill of information, alleging, in pertinent part, that the June 1998 conviction "is constitutionally defective because there is an insufficient inquiry and colloquy between the defendant and the presiding judge." Parts 4 and 5 of the defendant's motion to quash read as follows: 4. The transcript of the guilty plea shows that the Trial Judge advised Mover of certain constitutional rights, however, the Trial Judge failed to ascertain: a) Whether or not the Defendant understood each constitutional right; and b) Whether or not the Defendant waived each constitutional right. 5. Mover shows that after the Trial Judge informed Mover of said rights, there was no affirmative showing by Mover, nor was there a response by Mover, that he understood and wanted to waive his constitutional rights. The evidence submitted, including the court minutes and transcript of the June 1998 guilty plea, shows that the defendant was not represented by counsel while entering his guilty plea. However, the defendant has not challenged the propriety of his waiver of counsel. Thus, the only issue presented for our review is whether the defendant made a knowing and voluntary waiver of his Boykin rights during the 1998 plea colloquy. *780 The pertinent part of the plea colloquy reads as follows: Q: Do you understand today's an arraignment session and normally people plead not guilty today and then come back in a couple of two or three months and then they change their plea to guilty. You don't have to plead guilty today or any other day for that matter. A: No. I want to go ahead and get it behind me. Q: Alright. A: That way I can work on it. * * * * Q: Okay. You're charged with DWI, driving under revocation, and improper lane usage resulting from a stop back in November. You took the chemical test and your results were .189. And of course if they're higher than .10 then you're presumed to be under the influence. Don't matter if you had two beers or twenty. You're telling me you want to plead guilty to DWI-first offense. You know what that is? A: Yes, sir. Q: Operating a motor vehicle on a public highway of this parish and state while under the influence of an alcoholic beverage. By pleading guilty you're giving up your right to a trial before a judge, you're giving up your presumption of innocence, you're giving up the right to subpoena witnesses on your behalf to testify for you if there were any, you're giving up the right to cross-examine the arresting officer that stopped you. It looks like it was a parish deputy ... a sheriff's deputy, Gene Caviness. He and anybody else that might have assisted in the arrest would be summoned to testify. And if you didn't have an attorney, then you could ask the officer questions about why he stopped you and how you did on the field sobriety and all of those other things. By pleading guilty you give up those rights. You give up the right to remain silent. You couldn't be made to testify against yourself. You give up any right to question why the officer stopped you in the first place-probably because of improper lane usage. You might have made a lane change without signalling (sic) or you might have gone back and forth or some other thing that might have given you. A: I know why he did it. Q: Why did he do it? A: On Highway 51 it's got a real sharp curve back to the left. And that improper lane says do not enter. Q: You crossed over into the other lane? A: Everybody in the world does it when ... that lives down there in there. But it's just one time I got caught doing it. Q: Okay. Well, that's a pretty honest way of looking at it. If I determine that there was a good reason for him to stop you, that would be enough for him if he had suspicion that you had been drinking to make you ... ask you to do field sobriety and chemical tests and then the whole bit. Do you understand what the penalty for DWI is? It's going to be a Five Hundred Dollar ($500.00) fine and a sixty ... a hundred and twenty days suspended— because this is not a true first—and about ten eight-hour days of community service work, plus going to the same classes that you did the *781 first time. See, that was suppose to be so much of a hassle for you and inconvenience you that you wouldn't want to do this again. But it didn't work though, did it? A: No, sir. Q: So you're probably going to have to go into some kind of alcohol treatment program. I'm not saying it has to be a hospital, but it's going to have to be something a little more serious than what you just got through going through because it obviously didn't work. Alright. Any questions? A: No, sir. Q: Alright. The next DWI you get— hopefully there won't be one—but it could be charged as a third. And that would be a felony and you'd be looking at a minimum of a year in the parish jail, possibly as much as five years in the penitentiary and a Two Thousand dollar ($2,000.00) fine, possibly the seizure and sale of your motor vehicle, the loss of driving privileges for God knows how long. DWI—fourth is a very serious felony. That's ten to thirty in the penitentiary. So it gets worse every time it happens. You're lucky you're not being charged as a second offender. Apparently because of when this occurred there was some question about whether or not they could actually process the second offense if you asked for a jury trial. So in any event, you're being allowed to plead. They just charged this as a first. Alright. Any questions? A: No, sir. Q: Alright. Are you pleading guilty because you are in fact guilty? A: Yes, sir. Q: On or about November 6, 1997, in Ouachita Parish, Louisiana, did you operate a motor vehicle while under the influence of an alcoholic beverage? A: Yes, sir. Q: Alright. And I told you what your results were..189. A: Yes, sir. Q: That's quite a bit higher than the minimum level of .10. By the court: Alright. The Court accepts the plea, finds the same to be freely, voluntarily, knowingly, and intelligently entered after due advisal of rights by the Court and further finds that he's made an intelligent waiver of his right to counsel knowing the dangers and disadvantages of self representation.... The court minutes for the present case reflect that on May 5, 2000, the defendant introduced the transcripts and minutes of the two predicate DWI offenses into evidence and the trial court took the motion to quash under advisement. The record does not reflect that the trial court made a formal ruling on the motion. On October 24, 2000, the defendant appeared in open court, with counsel, withdrew his previous plea of not guilty, and entered a plea of guilty pursuant to State v. Crosby, 338 So.2d 584 (La.1976), reserving his right to appeal the use of the June 28, 1998 DWI conviction as a predicate offense for the DWI, third charge. The defendant was sentenced to serve three years at hard labor. This appeal followed. DISCUSSION Whenever a misdemeanor guilty plea will be used as a basis for actual imprisonment, enhancement of actual imprisonment or the conversion of a subsequent misdemeanor into a felony, it is incumbent *782 upon the court to inform the defendant that by pleading guilty he waives (a) his privilege against self-incrimination; (b) his right to trial by jury where it is applicable; and (c) his right to confront his accuser. State v. Jones, 404 So.2d 1192 (La.1981); State v. Cadiere, 99-0970 (La.App. 1st Cir.2/18/00), 754 So.2d 294. What the accused understood is determined in terms of the entire record and not just certain "magic words" used by the trial judge. State v. Strain, 585 So.2d 540 (La.1991). Everything that appears in the record concerning the predicate offense, as well as the trial judge's opportunity to observe the defendant's appearance, demeanor and responses in court, should be considered in determining whether or not a knowing and intelligent waiver of rights occurred. Cadiere, supra; State v. Lodrigue, 97-1718 (La.App. 1st Cir.5/15/98), 712 So.2d 671. Factors bearing on the validity of this determination include the age, education, experience, background, competency, and conduct of the accused, as well as the nature, complexity and seriousness of the charge. Cadiere, supra. The defendant argues that he was not represented by counsel in the June 1998 guilty plea and although the trial court began to inform him of his three Boykin rights, the trial court made no inquiry or determination that he expressly and knowingly waived those constitutional rights in entering the guilty plea. He further contends that the trial judge must ask a defendant "whether he or she understands his or her rights and wants to give them up." The state argues that the defendant's rights were explained in simple, straightforward language and that the defendant was given the opportunity to ask questions before he pled guilty. The state further argues that it is clear from the transcript that the trial judge explained to the defendant that by pleading guilty he would be giving up his right to a trial, the presumption of innocence, the privilege against self-incrimination, the right to subpoena witnesses and the right to cross examine the state's witnesses. The exchange between the trial judge and the defendant during the colloquy gave the judge ample opportunity to observe the defendant's demeanor and conduct. The record shows that the judge advised the defendant of his right to counsel and that he did not have to plead guilty. The defendant responded, "No. I want to go ahead and get it behind me".... "That way I can work on it." The judge and the defendant discussed the defendant's probation stemming from a prior DWI. Also, later in the colloquy, the defendant answered affirmatively when asked whether he wanted to plead guilty to DWI first offense. Finally, the judge informed the defendant that by pleading guilty, he was giving up his right to trial, his privilege against compulsory self-incrimination, and his right to confront his accuser. After the trial judge informed the defendant of his constitutional rights, the defendant interjected and began to explain to the judge why he believed he was stopped by the officer. Thereafter, the judge explained to the defendant the penalties and consequences of his plea and asked him if he had any questions. The defendant responded, "No Sir." The judge also explained the penalty for a later conviction of a third DWI and then asked the defendant if he had any questions. The defendant again responded, "No Sir." Although the defendant was not represented by counsel when he entered his guilty plea, the conduct and demeanor of *783 the defendant demonstrated that he understood the proceedings and that he knowingly and intelligently waived his Boykin rights. In fact, the defendant's comments in regard to "getting this matter behind him" and "working on the matter" showed that defendant understood the nature of the charge and was knowingly and voluntarily pleading guilty to the charge. Also, the defendant's explanation of the facts surrounding the June 1998 charge and his discussion with the judge regarding a prior DWI conviction during the colloquy at issue is further evidence that the defendant understood the nature of the proceedings. Moreover, the defendant's rights were explained to him in detail and the trial court gave him numerous opportunities to ask questions. Instead, the defendant continued to express his desire to plead guilty. The Louisiana Supreme Court has stressed that neither Boykin v. Alabama, 395 U.S. 238, 89 S.Ct. 1709, 23 L.Ed.2d 274 (1969) nor the court's implementation of Boykin in State ex rel. Jackson v. Henderson, 260 La. 90, 255 So.2d 85 (1971), sets out a "magic word formula" which may "serve as a technical trap for conscientious trial judges who conduct a thorough inquiry into the validity of the plea...." State v. Madison, XXXX-XXXX (La.8/31/00), 768 So.2d 593; State v. Bowick, 403 So.2d 673 (La.1981). Here, the judge informed the defendant that by pleading guilty he was "giving up" the right to trial, the right to confront his accusers and the right to remain silent. After being so advised, the defendant stated that he wished to plead guilty. Therefore, in the present case, the absence of the question, "Do you understand?" following the 1998 colloquy does not negate this defendant's guilty plea, where it is clear from the record that the defendant knowingly and intelligently waived his Boykin rights. The assignment of error lacks merit. ERRORS PATENT Pursuant to LSA-C.Cr.P. art. 920, we have reviewed the record for error patent and have found none. CONCLUSION For the above reasons, the defendant's conviction and sentence are affirmed. AFFIRMED.

The source file for the Texas 2012 marriages puts the entire name in one field with no comma, so some entries with two-word surnames (such as Hispanic names) are misplaced. Look for Firstname Middlename Paternal Maternal as if Maternal was the first name (Paternal, Maternal Firstname Middlename). We can command our machine to detect the first space, but it does not know whether the next word is part of the surname or a given name. Search all our genealogy sites: Custom Search Use this website at your own risk. There is no warranty. All the material here is public information. Persons wanting names removed should CLICK HERE for our policy. According to the sources: GARRISON, WILLARD B. wasborn 07 August 1915, received Social Security number 431-26-6628 (indicating Arkansas) and, Death Master File says, died 28 July 2002 1272949 Check the source file (free) and then check Archives for WILLARD GARRISON. GARRISON, WILLARD C. wasborn 19 July 1921, received Social Security number 279-26-9997 (indicating Ohio) and, Death Master File says, died 21 February 2004 1272951 Check the source file (free) and then check Archives for WILLARD GARRISON. GARRISON, WILLARD ERSEL (child of JENNIE BERNARDA WILLARD (mother) who was born in COTTONWOOD, ARIZONA and ERSEL GARRISON who was born in MORGANTOWN, NC) wasborn 6 Aug 1925 in JEROME, ARIZONA;; died 25 Mar 1936 in YAVAPAI COUNTY, ARIZONA, U.S.A.. 1272952 Check the source file (free) and then check Archives for WILLARD GARRISON. GARRISON, WILLARD J who was 23 (born ABT 1947) married 5 SEP 1970 in GALVESTON COUNTY, TEXAS, U.S.A. abridenamed CAROLYN A SAMPLE who was 25 (born ABT 1945). 1272954 Check the source file (free) and then check Archives for WILLARD GARRISON. GARRISON, WILLARD J who was 44 (born ABT 1947) married 6 APR 1991 in GALVESTON COUNTY, TEXAS, U.S.A. abridenamed SHARON PERKINS who was 45 (born ABT 1946). 1272955 Check the source file (free) and then check Archives for WILLARD GARRISON. GARRISON, WILLARD J JR who was 18 (born ABT 1972) married 10 FEB 1990 in GALVESTON COUNTY, TEXAS, U.S.A. abridenamed REBECCA K MEADE who was 18 (born ABT 1972). 1272956 Check the source file (free) and then check Archives for WILLARD GARRISON. GARRISON, WILLARD J SR, born ABT 1947, and his bride CAROLYN A, born ABT 1945, married 5 SEP 1970, and they had two children under 18 when they got divorced in GALVESTON COUNTY, TEXAS, U.S.A. on 15 AUG 1990. 1272957 Check the source file (free) and then check Archives for WILLARD GARRISON. GARRISON, WILLARD L. wasborn 29 May 1925, received Social Security number 407-30-0643 and, Death Master File says, died 15 November 1987 1272958 Check the source file (free) and then check Archives for WILLARD GARRISON. GARRISON, WILLA W. wasborn 08 February 1911, received Social Security number 227-01-8869 (indicating Virginia) and, Death Master File says, died 10 December 1993 1272959 Check the source file (free) and then check Archives for WILLA GARRISON. GARRISON, WILLBURN wasborn 03 February 1904, received Social Security number 478-05-3551 (indicating Iowa) and, Death Master File says, died October 1969 1272960 Check the source file (free) and then check Archives for WILLBURN GARRISON. GARRISON, WILL C married 12 Dec 1883 in COOK COUNTY, ILLINOIS, U.S.A. abridenamed MARY B MCGREW. 1272961 Check the source file (free) and then check Archives for WILL GARRISON. GARRISON, WILLENA wasborn 07 January 1921, received Social Security number 258-22-2085 (indicating Georgia) and, Death Master File says, died April 1980 1272962 Check the source file (free) and then check Archives for WILLENA GARRISON. GARRISON, WILLENA wasborn 09 March 1884, received Social Security number 142-54-2018 (indicating New Jersey) and, Death Master File says, died November 1975 1272963 Check the source file (free) and then check Archives for WILLENA GARRISON. GARRISON, WILLENE wasborn 14 March 1944, received Social Security number 252-68-1333 (indicating Georgia) and, Death Master File says, died May 1984 1272964 Check the source file (free) and then check Archives for WILLENE GARRISON. GARRISON, WILLETTA wasborn 31 March 1916, received Social Security number 403-09-2491 and, Death Master File says, died 01 October 2004 1272965 Check the source file (free) and then check Archives for WILLETTA GARRISON. GARRISON, WILLEVI wasborn 24 November 1899, received Social Security number 451-38-0595 (indicating Texas) and, Death Master File says, died July 1986 1272966 Check the source file (free) and then check Archives for WILLEVI GARRISON. GARRISON, WILLIA A. wasborn 18 April 1898, received Social Security number 173-24-5923 (indicating Pennsylvania) and, Death Master File says, died 26 June 1994 1272967 Check the source file (free) and then check Archives for WILLIA GARRISON. GARRISON, WILLIA G. wasborn 19 September 1929, received Social Security number 525-48-9157 (indicating New Mexico) and, Death Master File says, died 08 January 1994 1272968 Check the source file (free) and then check Archives for WILLIA GARRISON. GARRISON, WILLIA M. wasborn 23 May 1929, received Social Security number 373-30-2765 (indicating Michigan) and, Death Master File says, died 15 February 2003 1272970 Check the source file (free) and then check Archives for WILLIA GARRISON. GARRISON, WILLIAM wasborn 1865 in MN died 18 Jul 1904 in ITASCA COUNTY, MINNESOTA, U.S.A. 1272971 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, William (son of Emeline [no surname shown] (mother) and John Garrison) wasborn 17 Aug 1865 in Tyler County, West Virginia, U.S.A.. 1272972 Check the source file (free) and then check Archives for William GARRISON. GARRISON, William (son of Lillie Garrison (mother) and Edward Garrison) wasborn 8 Oct 1901 in Shepherdstown, Jefferson Co. County, West Virginia, U.S.A.. 1272974 Check the source file (free) and then check Archives for William GARRISON. GARRISON, William (son of Sarah Grimm (mother) and John Garrison) wasborn ABT 1860;; died 11 Apr 1936 in Littleton, Wetzel, West Virginia. 1272975 Check the source file (free) and then check Archives for William GARRISON. GARRISON, William (son of Sarah Grimm (mother) and John Garrison) wasborn ABT 1860;; died 11 Apr 1936 in Wetzel, West Virginia. 1272976 Check the source file (free) and then check Archives for William GARRISON. GARRISON, William (father) , and Virginia Williams, hadababygirl, [no given name shown] GARRISON born ABT 1930. 1273047 Check the source file (free) and then check Archives for William GARRISON. GARRISON, William (son of Albert L Garrison) wasborn ABT 1907 in Oklahoma and he wasinthe1910census in Kiowa County, Oklahoma, U.S.A. 1273048 Check the source file (free) and then check Archives for William GARRISON. GARRISON, William (son of Joshua S. Garrison) wasborn ABT 1893 in Arkansas and he wasinthe1910census in Mayes County, Oklahoma, U.S.A. 1273049 Check the source file (free) and then check Archives for William GARRISON. GARRISON, William (son of Robert Garrison) wasborn ABT 1904 in Kentucky and he wasinthe1920census in Whitley County, Kentucky, U.S.A. 1273050 Check the source file (free) and then check Archives for William GARRISON. GARRISON, WILLIAM wasborn 0000, received Social Security number 079-03-1612 (indicating New York) and, Death Master File says, died June 1959 1273051 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 0000, received Social Security number 093-03-5322 (indicating New York) and, Death Master File says, died May 1948 1273052 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 01 April 1923, received Social Security number 141-16-2294 (indicating New Jersey) and, Death Master File says, died April 1974 1273053 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 01 August 1928, received Social Security number 169-24-1881 (indicating Pennsylvania) and, Death Master File says, died February 1968 1273054 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 01 December 1905, received Social Security number 209-03-8019 (indicating Pennsylvania) and, Death Master File says, died December 1979 1273055 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 01 December 1918, received Social Security number 400-18-1342 (indicating Kentucky) and, Death Master File says, died December 1985 1273056 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 01 December 1933, received Social Security number 052-28-5419 (indicating New York) and, Death Master File says, died August 1977 1273057 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 01 February 1922, received Social Security number 466-09-6012 (indicating Texas) and, Death Master File says, died June 1979 1273058 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 01 January 1897, received Social Security number 313-12-9719 (indicating Indiana) and, Death Master File says, died October 1962 1273059 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 01 January 1899, received Social Security number 207-14-8457 (indicating Pennsylvania) and, Death Master File says, died May 1978 1273060 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 01 June 1934, received Social Security number 241-52-4889 (indicating North Carolina) and, Death Master File says, died September 1965 1273061 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 01 March 1886, received Social Security number 237-07-5632 (indicating North Carolina) and, Death Master File says, died November 1975 1273062 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 01 May 1902, received Social Security number 489-09-0798 (indicating Missouri) and, Death Master File says, died October 1969 1273063 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 01 May 1902, received Social Security number 548-03-9319 (indicating California) and, Death Master File says, died September 1967 1273064 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 01 October 1901, received Social Security number 232-14-1090 (indicating West Virginia or North Carolina) and, Death Master File says, died March 1973 1273065 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 01 September 1906, received Social Security number 216-07-5547 (indicating Maryland) and, Death Master File says, died April 1978 1273066 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 02 August 1884, received Social Security number 430-74-2577 (indicating Arkansas) and, Death Master File says, died September 1973 1273067 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 02 August 1898, received Social Security number 437-09-3664 (indicating Louisiana) and, Death Master File says, died January 1970 1273068 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 02 March 1892, received Social Security number 238-52-1559 (indicating North Carolina) and, Death Master File says, died December 1964 1273069 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 02 May 1907, received Social Security number 077-05-4891 (indicating New York) and, Death Master File says, died September 1982 1273070 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 02 November 1906, received Social Security number 097-14-0441 (indicating New York) and, Death Master File says, died December 1972 1273071 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 02 October 1886, received Social Security number 500-05-7827 (indicating Missouri) and, Death Master File says, died 15 April 1966 1273072 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 03 December 1887, received Social Security number 274-10-0138 (indicating Ohio) and, Death Master File says, died November 1971 1273073 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 03 December 1906, received Social Security number 118-14-3744 (indicating New York) and, Death Master File says, died September 1977 1273074 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 03 July 1904, received Social Security number 165-05-8449 (indicating Pennsylvania) and, Death Master File says, died December 1983 1273075 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 03 July 1911, received Social Security number 556-20-9849 (indicating California) and, Death Master File says, died 12 July 2004 1273076 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 03 June 1894, received Social Security number 147-05-5443 (indicating New Jersey) and, Death Master File says, died May 1978 1273077 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 03 March 1894, received Social Security number 570-84-6347 (indicating California) and, Death Master File says, died September 1972 1273078 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 03 March 1917, received Social Security number 229-05-6359 (indicating Virginia) and, Death Master File says, died April 1972 1273079 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 03 May 1910, received Social Security number 215-05-9045 (indicating Maryland) and, Death Master File says, died February 1972 1273080 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 03 November 1887, received Social Security number 240-14-4729 (indicating North Carolina) and, Death Master File says, died March 1973 1273081 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 03 October 1948, received Social Security number 442-48-8170 (indicating Oklahoma) and, Death Master File says, died January 1987 1273082 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 04 April 1900, received Social Security number 422-52-2753 (indicating Alabama) and, Death Master File says, died July 1973 1273083 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 04 April 1906, received Social Security number 235-12-5998 (indicating West Virginia) and, Death Master File says, died April 1978 1273084 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 04 April 1908, received Social Security number 415-05-5364 (indicating Tennessee) and, Death Master File says, died April 1985 1273085 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 04 August 1884, received Social Security number 140-07-5133 (indicating New Jersey) and, Death Master File says, died February 1960 1273086 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 04 December 1878, received Social Security number 192-05-7778 (indicating Pennsylvania) and, Death Master File says, died November 1965 1273087 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 04 December 1894, received Social Security number 063-09-3865 (indicating New York) and, Death Master File says, died April 1969 1273088 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 04 February 1903, received Social Security number 247-09-9784 (indicating South Carolina) and, Death Master File says, died November 1961 1273089 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 04 July 1905, received Social Security number 376-03-6135 (indicating Michigan) and, Death Master File says, died September 1970 1273090 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 04 November 1886, received Social Security number 431-52-3488 (indicating Arkansas) and, Death Master File says, died October 1973 1273091 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 05 August 1932, received Social Security number 077-28-6801 (indicating New York) and, Death Master File says, died 22 April 1993 1273092 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 05 December 1891, received Social Security number 422-36-7679 (indicating Alabama) and, Death Master File says, died February 1964 1273093 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 05 February 1897, received Social Security number 258-16-3157 (indicating Georgia) and, Death Master File says, died February 1977 1273094 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 05 June 1901, received Social Security number 146-10-9247 (indicating New Jersey) and, Death Master File says, died August 1978 1273095 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 05 March 1886, received Social Security number 479-44-6433 (indicating Iowa) and, Death Master File says, died November 1975 1273096 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 05 November 1893, received Social Security number 357-01-2611 (indicating Illinois) and, Death Master File says, died July 1968 1273097 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 05 November 1915, received Social Security number 524-14-9199 (indicating Colorado) and, Death Master File says, died December 1980 1273098 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 05 October 1906, received Social Security number 238-10-4664 (indicating North Carolina) and, Death Master File says, died October 1984 1273099 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 05 October 1908, received Social Security number 492-14-3783 (indicating Missouri) and, Death Master File says, died May 1956 1273100 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 05 October 1914, received Social Security number 527-16-6381 (indicating Arizona) and, Death Master File says, died January 1982 1273101 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 05 October 1924, received Social Security number 350-24-5439 (indicating Illinois) and, Death Master File says, died November 1979 1273102 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 05 September 1900, received Social Security number 121-10-8714 (indicating New York) and, Death Master File says, died March 1967 1273103 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 05 September 1907, received Social Security number 460-07-3012 (indicating Texas) and, Death Master File says, died July 1974 1273104 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 06 December 1906, received Social Security number 492-03-7540 (indicating Missouri) and, Death Master File says, died January 1979 1273105 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 06 December 1918, received Social Security number 574-05-3041 (indicating Alaska) and, Death Master File says, died November 1965 1273106 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 06 July 1893, received Social Security number 458-05-7152 (indicating Texas) and, Death Master File says, died December 1953 1273107 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 06 May 1892, received Social Security number 534-01-3782 (indicating Washington) and, Death Master File says, died February 1963 1273108 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 06 October 1905, received Social Security number 516-16-0573 (indicating Montana) and, Death Master File says, died February 1967 1273109 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 06 September 1931, received Social Security number 529-34-7508 (indicating Utah) and, Death Master File says, died December 1968 1273110 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 07 August 1907, received Social Security number 509-05-6135 (indicating Kansas) and, Death Master File says, died February 1980 1273111 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 07 February 1896, received Social Security number 443-10-8377 (indicating Oklahoma) and, Death Master File says, died May 1964 1273112 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 07 January 1885, received Social Security number 489-09-2526 (indicating Missouri) and, Death Master File says, died November 1969 1273113 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 07 July 1909, received Social Security number 135-12-0216 (indicating New Jersey) and, Death Master File says, died 15 December 1991 1273114 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 07 March 1944, received Social Security number 141-34-1501 (indicating New Jersey) and, Death Master File says, died April 1977 1273115 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 07 May 1902, received Social Security number 408-01-2348 (indicating Tennessee) and, Death Master File says, died December 1971 1273116 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 07 May 1914, received Social Security number 142-09-5427 (indicating New Jersey) and, Death Master File says, died April 1983 1273117 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 07 May 1915, received Social Security number 237-09-0965 (indicating North Carolina) and, Death Master File says, died May 1986 1273118 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 07 November 1895, received Social Security number 317-24-1478 (indicating Indiana) and, Death Master File says, died January 1965 1273119 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 07 September 1916, received Social Security number 458-26-4617 (indicating Texas) and, Death Master File says, died December 1970 1273120 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 08 August 1916, received Social Security number 500-03-0869 (indicating Missouri) and, Death Master File says, died March 1977 1273121 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 08 December 1911, received Social Security number 277-05-5214 (indicating Ohio) and, Death Master File says, died 07 May 1992 1273122 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 08 February 1908, received Social Security number 280-10-4219 (indicating Ohio) and, Death Master File says, died April 1955 1273123 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 08 February 1908, received Social Security number 495-05-8086 (indicating Missouri) and, Death Master File says, died January 1973 1273124 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 08 July 1930, received Social Security number 244-40-5824 (indicating North Carolina) and, Death Master File says, died July 1982 1273125 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 08 June 1895, received Social Security number 094-09-0658 (indicating New York) and, Death Master File says, died December 1964 1273126 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 09 April 1900, received Social Security number 068-03-6376 (indicating New York) and, Death Master File says, died October 1959 1273127 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 09 August 1926, received Social Security number 444-28-9904 (indicating Oklahoma) and, Death Master File says, died June 1979 1273128 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 09 January 1894, received Social Security number 029-09-9931 (indicating Massachusetts) and, Death Master File says, died April 1976 1273129 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 09 July 1908, received Social Security number 375-05-7068 (indicating Michigan) and, Death Master File says, died August 1979 1273130 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 09 May 1896, received Social Security number 426-12-0126 (indicating Mississippi) and, Death Master File says, died February 1973 1273131 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 09 November 1887, received Social Security number 345-38-9860 (indicating Illinois) and, Death Master File says, died June 1967 1273132 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 09 November 1900, received Social Security number 522-03-8722 (indicating Colorado) and, Death Master File says, died December 1974 1273133 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 10 February 1921, received Social Security number 306-12-2852 (indicating Indiana) and, Death Master File says, died September 1969 1273134 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 10 February 1930, received Social Security number 234-36-4945 (indicating West Virginia) and, Death Master File says, died June 1986 1273135 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 10 March 1897, received Social Security number 051-01-9959 (indicating New York) and, Death Master File says, died November 1973 1273136 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 10 March 1897, received Social Security number 317-20-1978 (indicating Indiana) and, Death Master File says, died August 1965 1273137 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 10 October 1926, received Social Security number 373-28-7662 (indicating Michigan) and, Death Master File says, died November 1985 1273138 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 10 September 1886, received Social Security number 555-03-0395 (indicating California) and, Death Master File says, died May 1967 1273139 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 11 December 1903, received Social Security number 304-10-6426 (indicating Indiana) and, Death Master File says, died August 1964 1273140 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 12 July 1903, received Social Security number 334-01-8352 (indicating Illinois) and, Death Master File says, died June 1975 1273141 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 12 July 1911, received Social Security number 725-05-1741 (indicating Railroad Board) and, Death Master File says, died December 1977 1273142 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 12 May 1899, received Social Security number 225-14-8639 (indicating Virginia) and, Death Master File says, died January 1980 1273143 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 12 November 1887, received Social Security number 432-56-8246 (indicating Arkansas) and, Death Master File says, died December 1973 1273144 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 12 October 1899, received Social Security number 110-12-2003 (indicating New York) and, Death Master File says, died October 1974 1273145 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 12 September 1884, received Social Security number 717-09-0013 (indicating Railroad Board) and, Death Master File says, died March 1963 1273146 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 12 September 1920, received Social Security number 375-12-3233 (indicating Michigan) and, Death Master File says, died January 1970 1273147 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 13 April 1914, received Social Security number 422-07-8195 (indicating Alabama) and, Death Master File says, died 07 March 2005 1273148 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 13 February 1911, received Social Security number 461-05-3222 (indicating Texas) and, Death Master File says, died August 1980 1273149 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 13 February 1921, received Social Security number 552-18-4803 (indicating California) and, Death Master File says, died January 1978 1273150 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 13 March 1908, received Social Security number 550-12-9384 (indicating California) and, Death Master File says, died April 1979 1273151 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 13 March 1912, received Social Security number 515-07-8414 (indicating Kansas) and, Death Master File says, died February 1968 1273152 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 13 March 1913, received Social Security number 455-18-2761 (indicating Texas) and, Death Master File says, died January 1974 1273153 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 13 September 1931, received Social Security number 486-30-3846 (indicating Missouri) and, Death Master File says, died February 1985 1273154 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 14 April 1921, received Social Security number 453-20-2090 (indicating Texas) and, Death Master File says, died March 1982 1273155 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 14 August 1912, received Social Security number 234-10-9302 (indicating West Virginia) and, Death Master File says, died February 1984 1273156 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 14 February 1888, received Social Security number 541-14-9124 (indicating Oregon) and, Death Master File says, died October 1973 1273157 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 14 February 1893, received Social Security number 536-03-0046 (indicating Washington) and, Death Master File says, died October 1970 1273158 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 14 January 1918, received Social Security number 161-16-3557 (indicating Pennsylvania) and, Death Master File says, died July 1987 1273159 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 14 July 1948, received Social Security number 339-40-9014 (indicating Illinois) and, Death Master File says, died December 1977 1273160 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 14 March 1926, received Social Security number 165-20-6290 (indicating Pennsylvania) and, Death Master File says, died 01 August 1988 1273161 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 14 May 1888, received Social Security number 442-18-3820 (indicating Oklahoma) and, Death Master File says, died May 1979 1273162 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 14 May 1906, received Social Security number 188-05-1253 (indicating Pennsylvania) and, Death Master File says, died March 1982 1273163 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 14 November 1927, received Social Security number 198-22-5276 (indicating Pennsylvania) and, Death Master File says, died 12 June 2012 1273164 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 14 October 1889, received Social Security number 242-52-5182 (indicating North Carolina) and, Death Master File says, died August 1967 1273165 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 14 September 1901, received Social Security number 329-01-4415 (indicating Illinois) and, Death Master File says, died September 1977 1273166 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 14 September 1908, received Social Security number 523-16-1705 (indicating Colorado) and, Death Master File says, died February 1967 1273167 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 15 April 1895, received Social Security number 260-52-1807 (indicating Georgia) and, Death Master File says, died August 1970 1273168 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 15 April 1921, received Social Security number 139-14-1945 (indicating New Jersey) and, Death Master File says, died January 1977 1273169 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 15 August 1895, received Social Security number 231-36-1397 (indicating Virginia) and, Death Master File says, died January 1969 1273170 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 15 August 1903, received Social Security number 434-20-7700 (indicating Louisiana) and, Death Master File says, died May 1976 1273171 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 15 December 1915, received Social Security number 422-12-0333 (indicating Alabama) and, Death Master File says, died 21 September 2001 1273172 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 15 February 1905, received Social Security number 090-09-6262 (indicating New York) and, Death Master File says, died February 1978 1273173 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 15 July 1923, received Social Security number 259-20-5865 (indicating Georgia) and, Death Master File says, died January 1985 1273174 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 15 May 1892, received Social Security number 416-14-4783 (indicating Alabama) and, Death Master File says, died December 1978 1273175 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 15 May 1916, received Social Security number 228-10-0256 (indicating Virginia) and, Death Master File says, died March 1962 1273176 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 15 May 1917, received Social Security number 325-18-2302 (indicating Illinois) and, Death Master File says, died June 1972 1273177 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 15 November 1902, received Social Security number 433-01-3006 (indicating Louisiana) and, Death Master File says, died October 1970 1273178 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 15 September 1893, received Social Security number 147-07-2178 (indicating New Jersey) and, Death Master File says, died February 1982 1273179 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 15 September 1924, received Social Security number 569-30-9144 (indicating California) and, Death Master File says, died November 1979 1273180 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 16 April 1913, received Social Security number 404-03-5951 and, Death Master File says, died September 1974 1273181 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 16 April 1914, received Social Security number 266-10-6294 (indicating Florida) and, Death Master File says, died August 1975 1273182 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 16 July 1895, received Social Security number 133-05-2836 (indicating New York) and, Death Master File says, died April 1976 1273183 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 16 July 1910, received Social Security number 131-10-5329 (indicating New York) and, Death Master File says, died March 1983 1273184 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 16 June 1903, received Social Security number 293-09-3373 (indicating Ohio) and, Death Master File says, died April 1969 1273185 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 16 March 1897, received Social Security number 341-16-9415 (indicating Illinois) and, Death Master File says, died October 1979 1273186 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 16 May 1915, received Social Security number 362-12-8512 (indicating Michigan) and, Death Master File says, died 07 January 1988 1273187 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 16 October 1873, received Social Security number 412-64-3583 (indicating Tennessee) and, Death Master File says, died April 1963 1273188 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 16 October 1907, received Social Security number 240-05-8119 (indicating North Carolina) and, Death Master File says, died March 1980 1273189 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 16 September 1906, received Social Security number 537-05-8246 (indicating Washington) and, Death Master File says, died October 1974 1273190 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 17 April 1928, received Social Security number 153-20-0861 (indicating New Jersey) and, Death Master File says, died 18 August 2007 1273191 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 17 April 1930, received Social Security number 423-42-8685 (indicating Alabama) and, Death Master File says, died October 1970 1273192 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 17 February 1894, received Social Security number 532-05-0065 (indicating Washington) and, Death Master File says, died June 1975 1273193 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 17 June 1934, received Social Security number 250-52-2087 (indicating South Carolina) and, Death Master File says, died January 1972 1273194 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 17 March 1930, received Social Security number 308-28-7108 (indicating Indiana) and, Death Master File says, died January 1983 1273195 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 17 November 1900, received Social Security number 159-03-5921 (indicating Pennsylvania) and, Death Master File says, died January 1973 1273196 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 17 October 1882, received Social Security number 288-34-4812 (indicating Ohio) and, Death Master File says, died February 1970 1273197 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 18 February 1887, received Social Security number 439-48-2237 (indicating Louisiana) and, Death Master File says, died September 1968 1273198 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 18 January 1902, received Social Security number 500-10-3354 (indicating Missouri) and, Death Master File says, died December 1973 1273199 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 18 January 1921, received Social Security number 422-24-8612 (indicating Alabama) and, Death Master File says, died February 1975 1273200 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 18 March 1884, received Social Security number 125-01-2034 (indicating New York) and, Death Master File says, died July 1983 1273201 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 18 March 1950, received Social Security number 421-72-4230 (indicating Alabama) and, Death Master File says, died January 1981 1273202 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 18 May 1896, received Social Security number 240-14-5979 (indicating North Carolina) and, Death Master File says, died May 1970 1273203 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 18 November 1901, received Social Security number 532-32-8339 (indicating Washington) and, Death Master File says, died September 1983 1273204 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 19 August 1881, received Social Security number 499-10-2415 (indicating Missouri) and, Death Master File says, died October 1966 1273205 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 19 December 1926, received Social Security number 432-24-5190 (indicating Arkansas) and, Death Master File says, died November 1986 1273206 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 19 February 1912, received Social Security number 303-18-4390 (indicating Indiana) and, Death Master File says, died August 1973 1273207 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 19 July 1901, received Social Security number 228-12-7512 (indicating Virginia) and, Death Master File says, died January 1965 1273208 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 19 July 1904, received Social Security number 227-01-2002 (indicating Virginia) and, Death Master File says, died May 1967 1273209 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 19 July 1919, received Social Security number 254-12-0565 (indicating Georgia) and, Death Master File says, died June 1981 1273210 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 19 June 1904, received Social Security number 219-14-2950 (indicating Maryland) and, Death Master File says, died 30 July 1993 1273211 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 19 November 1896, received Social Security number 149-10-9876 (indicating New Jersey) and, Death Master File says, died November 1973 1273212 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 20 April 1900, received Social Security number 146-14-7740 (indicating New Jersey) and, Death Master File says, died May 1968 1273213 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 20 April 1926, received Social Security number 227-36-6918 (indicating Virginia) and, Death Master File says, died April 1973 1273214 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 20 August 1909, received Social Security number 430-12-5662 (indicating Arkansas) and, Death Master File says, died January 1970 1273215 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 20 December 1911, received Social Security number 430-20-8364 (indicating Arkansas) and, Death Master File says, died April 1977 1273216 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 20 February 1906, received Social Security number 565-05-4074 (indicating California) and, Death Master File says, died August 1971 1273217 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 20 September 1903, received Social Security number 405-28-1262 and, Death Master File says, died November 1978 1273218 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 21 August 1886, received Social Security number 238-48-2805 (indicating North Carolina) and, Death Master File says, died April 1972 1273219 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 21 August 1922, received Social Security number 364-22-6495 (indicating Michigan) and, Death Master File says, died November 1964 1273220 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 21 August 1934, received Social Security number 219-30-3109 (indicating Maryland) and, Death Master File says, died September 1985 1273221 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 21 December 1916, received Social Security number 524-10-9229 (indicating Colorado) and, Death Master File says, died September 1980 1273222 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 21 February 1905, received Social Security number 397-01-1337 (indicating Wisconsin) and, Death Master File says, died February 1979 1273223 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 21 July 1906, received Social Security number 178-07-4240 (indicating Pennsylvania) and, Death Master File says, died August 1985 1273224 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 21 June 1894, received Social Security number 430-20-0057 (indicating Arkansas) and, Death Master File says, died December 1971 1273225 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 21 June 1897, received Social Security number 142-09-4860 (indicating New Jersey) and, Death Master File says, died November 1973 1273226 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 21 June 1928, received Social Security number 459-38-7299 (indicating Texas) and, Death Master File says, died 21 February 1997 1273227 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 21 March 1897, received Social Security number 511-01-4936 (indicating Kansas) and, Death Master File says, died November 1965 1273228 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 21 March 1913, received Social Security number 313-03-0012 (indicating Indiana) and, Death Master File says, died November 1978 1273229 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 21 March 1925, received Social Security number 412-22-9540 (indicating Tennessee) and, Death Master File says, died July 1977 1273230 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 22 April 1900, received Social Security number 276-05-7548 (indicating Ohio) and, Death Master File says, died January 1969 1273231 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 22 April 1906, received Social Security number 130-03-8967 (indicating New York) and, Death Master File says, died November 1981 1273232 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 22 August 1896, received Social Security number 247-54-1422 (indicating South Carolina) and, Death Master File says, died August 1981 1273233 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 22 February 1917, received Social Security number 146-09-5899 (indicating New Jersey) and, Death Master File says, died April 1985 1273234 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 22 January 1893, received Social Security number 447-05-4675 (indicating Oklahoma) and, Death Master File says, died November 1967 1273235 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 22 July 1922, received Social Security number 509-20-3685 (indicating Kansas) and, Death Master File says, died September 1965 1273236 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 22 June 1915, received Social Security number 225-03-0889 (indicating Virginia) and, Death Master File says, died October 1968 1273237 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 22 May 1914, received Social Security number 524-05-3351 (indicating Colorado) and, Death Master File says, died August 1972 1273238 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 22 May 1928, received Social Security number 317-24-4740 (indicating Indiana) and, Death Master File says, died October 1983 1273239 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 22 November 1902, received Social Security number 450-12-4749 (indicating Texas) and, Death Master File says, died October 1983 1273240 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 22 November 1928, received Social Security number 463-22-7676 (indicating Texas) and, Death Master File says, died July 1983 1273241 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 22 October 1896, received Social Security number 513-05-7457 (indicating Kansas) and, Death Master File says, died January 1970 1273242 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 23 April 1916, received Social Security number 247-18-8841 (indicating South Carolina) and, Death Master File says, died 06 September 1993 1273243 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 23 August 1898, received Social Security number 252-38-5799 (indicating Georgia) and, Death Master File says, died August 1974 1273244 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 23 August 1925, received Social Security number 431-50-8411 (indicating Arkansas) and, Death Master File says, died October 1984 1273245 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 23 December 1886, received Social Security number 440-05-7419 (indicating Oklahoma) and, Death Master File says, died August 1981 1273246 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 23 December 1898, received Social Security number 368-07-2134 (indicating Michigan) and, Death Master File says, died April 1964 1273247 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 23 February 1892, received Social Security number 495-36-6438 (indicating Missouri) and, Death Master File says, died August 1981 1273248 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 23 January 1894, received Social Security number 152-16-2516 (indicating New Jersey) and, Death Master File says, died September 1965 1273249 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 23 January 1924, received Social Security number 257-26-9653 (indicating Georgia) and, Death Master File says, died February 1981 1273250 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 23 July 1901, received Social Security number 487-07-2211 (indicating Missouri) and, Death Master File says, died April 1978 1273251 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 23 September 1904, received Social Security number 541-09-0135 (indicating Oregon) and, Death Master File says, died June 1967 1273252 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 24 August 1900, received Social Security number 403-05-0147 and, Death Master File says, died April 1974 1273253 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 24 June 1912, received Social Security number 348-05-6074 (indicating Illinois) and, Death Master File says, died March 1968 1273254 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 24 March 1894, received Social Security number 413-24-5147 (indicating Tennessee) and, Death Master File says, died October 1953 1273255 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 24 March 1895, received Social Security number 287-10-3948 (indicating Ohio) and, Death Master File says, died January 1967 1273256 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 24 May 1905, received Social Security number 228-03-9918 (indicating Virginia) and, Death Master File says, died December 1986 1273257 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 24 November 1918, received Social Security number 251-40-7129 (indicating South Carolina) and, Death Master File says, died May 1985 1273258 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 25 December 1925, received Social Security number 218-22-7418 (indicating Maryland) and, Death Master File says, died April 1985 1273259 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 25 February 1904, received Social Security number 549-09-0460 (indicating California) and, Death Master File says, died March 1978 1273260 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 25 February 1933, received Social Security number 055-26-8727 (indicating New York) and, Death Master File says, died November 1978 1273261 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 25 January 1894, received Social Security number 266-09-3802 (indicating Florida) and, Death Master File says, died December 1970 1273262 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 25 July 1895, received Social Security number 311-09-5310 (indicating Indiana) and, Death Master File says, died October 1963 1273263 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 25 July 1898, received Social Security number 509-16-1340 (indicating Kansas) and, Death Master File says, died January 1957 1273264 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 25 July 1943, received Social Security number 255-68-5351 (indicating Georgia) and, Death Master File says, died May 1980 1273265 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 25 October 1894, received Social Security number 299-07-0166 (indicating Ohio) and, Death Master File says, died January 1975 1273266 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 26 January 1906, received Social Security number 267-18-4248 (indicating Florida) and, Death Master File says, died March 1977 1273267 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 26 January 1906, received Social Security number 374-22-0562 (indicating Michigan) and, Death Master File says, died July 1979 1273268 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 26 January 1916, received Social Security number 510-10-1714 (indicating Kansas) and, Death Master File says, died September 1985 1273269 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 26 June 1907, received Social Security number 217-09-8580 (indicating Maryland) and, Death Master File says, died October 1978 1273270 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 26 June 1912, received Social Security number 578-03-1818 (indicating District of Columbia) and, Death Master File says, died October 1986 1273271 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 26 June 1926, received Social Security number 158-14-5690 (indicating New Jersey) and, Death Master File says, died November 1986 1273272 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 27 August 1900, received Social Security number 270-07-5092 (indicating Ohio) and, Death Master File says, died December 1966 1273273 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 27 August 1903, received Social Security number 478-52-9030 (indicating Iowa) and, Death Master File says, died October 1971 1273274 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 27 August 1927, received Social Security number 540-28-7469 (indicating Oregon) and, Death Master File says, died September 1987 1273275 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 27 February 1924, received Social Security number 426-58-2323 (indicating Mississippi) and, Death Master File says, died August 1983 1273276 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 27 January 1892, received Social Security number 419-05-7675 (indicating Alabama) and, Death Master File says, died July 1964 1273277 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 27 January 1893, received Social Security number 098-24-1004 (indicating New York) and, Death Master File says, died May 1967 1273278 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 27 March 1895, received Social Security number 533-01-8962 (indicating Washington) and, Death Master File says, died January 1964 1273279 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 27 March 1908, received Social Security number 441-01-4386 (indicating Oklahoma) and, Death Master File says, died December 1974 1273280 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 27 May 1885, received Social Security number 489-30-0582 (indicating Missouri) and, Death Master File says, died May 1973 1273281 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 27 November 1899, received Social Security number 143-09-3833 (indicating New Jersey) and, Death Master File says, died April 1971 1273282 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 27 November 1904, received Social Security number 068-18-6781 (indicating New York) and, Death Master File says, died June 1974 1273283 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 27 September 1917, received Social Security number 239-22-5508 (indicating North Carolina) and, Death Master File says, died December 1968 1273284 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 28 April 1903, received Social Security number 422-20-8590 (indicating Alabama) and, Death Master File says, died October 1986 1273285 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 28 December 1889, received Social Security number 378-03-5886 (indicating Michigan) and, Death Master File says, died January 1965 1273286 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 28 December 1897, received Social Security number 297-48-0202 (indicating Ohio) and, Death Master File says, died May 1987 1273287 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 28 December 1925, received Social Security number 430-40-1138 (indicating Arkansas) and, Death Master File says, died December 1984 1273288 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 28 January 1900, received Social Security number 150-16-0347 (indicating New Jersey) and, Death Master File says, died February 1964 1273289 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 28 January 1902, received Social Security number 055-09-2233 (indicating New York) and, Death Master File says, died November 1978 1273290 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 28 January 1906, received Social Security number 254-14-2312 (indicating Georgia) and, Death Master File says, died December 1968 1273291 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 28 July 1913, received Social Security number 445-07-2754 (indicating Oklahoma) and, Death Master File says, died April 1970 1273292 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 28 July 1914, received Social Security number 433-03-7250 (indicating Louisiana) and, Death Master File says, died May 1982 1273293 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 28 June 1896, received Social Security number 243-05-2338 (indicating North Carolina) and, Death Master File says, died January 1977 1273294 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 28 June 1934, received Social Security number 081-28-1119 (indicating New York) and, Death Master File says, died March 1984 1273295 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 28 October 1881, received Social Security number 443-10-1778 (indicating Oklahoma) and, Death Master File says, died August 1962 1273296 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 28 September 1900, received Social Security number 330-12-1863 (indicating Illinois) and, Death Master File says, died June 1984 1273297 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 29 August 1899, received Social Security number 142-09-2116 (indicating New Jersey) and, Death Master File says, died September 1970 1273298 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 29 December 1914, received Social Security number 262-03-0254 (indicating Florida) and, Death Master File says, died October 1983 1273299 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 29 December 1914, received Social Security number 436-10-6153 (indicating Louisiana) and, Death Master File says, died 14 December 1987 1273300 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 29 January 1885, received Social Security number 578-07-9240 (indicating District of Columbia) and, Death Master File says, died November 1960 1273301 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 29 July 1892, received Social Security number 041-18-9058 (indicating Connecticut) and, Death Master File says, died July 1963 1273302 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 29 March 1896, received Social Security number 356-32-7074 (indicating Illinois) and, Death Master File says, died December 1978 1273303 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 29 May 1890, received Social Security number 405-01-7414 and, Death Master File says, died December 1963 1273304 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 29 November 1901, received Social Security number 577-70-5407 (indicating District of Columbia) and, Death Master File says, died October 1977 1273305 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 29 November 1925, received Social Security number 485-20-1080 (indicating Iowa) and, Death Master File says, died January 1987 1273306 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 30 April 1898, received Social Security number 294-22-1046 (indicating Ohio) and, Death Master File says, died 06 February 1989 1273307 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 30 April 1909, received Social Security number 248-01-8030 (indicating South Carolina) and, Death Master File says, died March 1984 1273308 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 30 August 1899, received Social Security number 385-09-2898 (indicating Michigan) and, Death Master File says, died October 1969 1273309 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 30 August 1910, received Social Security number 431-40-2364 (indicating Arkansas) and, Death Master File says, died June 1983 1273310 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 30 December 1957, received Social Security number 090-50-8508 (indicating New York) and, Death Master File says, died 03 November 2000 1273311 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 30 January 1924, received Social Security number 260-60-1461 (indicating Georgia) and, Death Master File says, died February 1981 1273312 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 30 July 1893, received Social Security number 531-18-7897 (indicating Washington) and, Death Master File says, died April 1972 1273313 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 30 March 1891, received Social Security number 472-01-9565 (indicating Minnesota) and, Death Master File says, died January 1968 1273314 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 30 March 1902, received Social Security number 216-07-3492 (indicating Maryland) and, Death Master File says, died December 1976 1273315 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 30 September 1911, received Social Security number 442-09-6497 (indicating Oklahoma) and, Death Master File says, died November 1979 1273316 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 30 September 1926, received Social Security number 360-14-9663 (indicating Illinois) and, Death Master File says, died May 1974 1273317 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 31 December 1880, received Social Security number 446-38-5652 (indicating Oklahoma) and, Death Master File says, died May 1969 1273318 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 31 October 1893, received Social Security number 142-09-4940 (indicating New Jersey) and, Death Master File says, died April 1966 1273319 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM wasborn 31 October 1934, received Social Security number 114-26-5888 (indicating New York) and, Death Master File says, died March 1984 1273320 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, William wasborn ABT 1866 in LA and he wasinthe1900census in Richland Parish, Louisiana, U.S.A. 1273321 Check the source file (free) and then check Archives for William GARRISON. GARRISON, William wasborn ABT 1873 in Maryland and he wasinthe1920census in Baltimore City, Maryland, U.S.A. 1273322 Check the source file (free) and then check Archives for William GARRISON. GARRISON, William wasborn ABT 1881 in Texas and he wasinthe1910census in Kiowa County, Oklahoma, U.S.A. 1273323 Check the source file (free) and then check Archives for William GARRISON. GARRISON, William wasborn ABT 1887 in New Jersey and he wasinthe1910census in Monmouth County, New Jersey, U.S.A. 1273324 Check the source file (free) and then check Archives for William GARRISON. GARRISON, William wasborn ABT 1907 in Oklahoma and he wasinthe1920census in Kiowa County, Oklahoma, U.S.A. 1273325 Check the source file (free) and then check Archives for William GARRISON. GARRISON, William wasborn ABT 1920 in Garrison and wasinthe1920census in Kiowa County, Oklahoma, U.S.A. 1273326 Check the source file (free) and then check Archives for William GARRISON. GARRISON, WILLIAM who was 17 (born ABT 1949) married 13 MAR 1966 in LAMAR COUNTY, TEXAS, U.S.A. abridenamed CAROL ROBERSON who was 17 (born ABT 1949). 1273327 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM who was 28 (born ABT 1953) married 16 JUN 1981 in HARRIS COUNTY, TEXAS, U.S.A. abridenamed CLAUDINE SAFFOLD who was 20 (born ABT 1961). 1273328 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM ALTON wasborn 29 Dec 1918 in NORTH CAROLINA (child of MAY (mother)) died 15 Nov 1997 in HENNEPIN COUNTY, MINNESOTA, U.S.A. 1273329 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM J. wasborn 19 Jul 1957 (child of GEE (mother)) died 13 Mar 1984 in SCOTT COUNTY, MINNESOTA, U.S.A. 1273330 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM A married 13 Aug 1868 in MONTGOMERY COUNTY, ILLINOIS, U.S.A. abridenamed SARAH E CUMPTON. 1273331 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, William A (father) , and Mary E FLORA, hadababy, William L GARRISON born 1885 in Warren County, Ohio. 1273332 Check the source file (free) and then check Archives for William GARRISON. GARRISON, WILLIAM A who was 21 (born ABT 1950) married 11 JAN 1971 in HARRIS COUNTY, TEXAS, U.S.A. abridenamed DEBORAH SHIPMAN who was 22 (born ABT 1949). 1273333 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM A. wasborn 02 July 1922, received Social Security number 465-18-7950 (indicating Texas) and, Death Master File says, died 29 December 2006 1273334 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM A. wasborn 02 March 1930, received Social Security number 496-32-7138 (indicating Missouri) and, Death Master File says, died 01 March 2002 1273335 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM A. wasborn 02 November 1913, received Social Security number 508-10-4918 (indicating Nebraska) and, Death Master File says, died 06 September 2012 1273336 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM A. wasborn 03 March 1922, received Social Security number 439-16-5836 (indicating Louisiana) and, Death Master File says, died 11 January 2004 1273337 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM A. wasborn 04 December 1920, received Social Security number 225-14-5763 (indicating Virginia) and, Death Master File says, died 20 August 1989 1273338 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM A. wasborn 05 November 1921, received Social Security number 261-20-5405 (indicating Florida) and, Death Master File says, died 11 December 1997 1273339 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM A. wasborn 07 August 1927, received Social Security number 039-09-1884 (indicating Rhode Island) and, Death Master File says, died 01 February 2009 1273340 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM A. wasborn 09 June 1919, received Social Security number 298-07-9757 (indicating Ohio) and, Death Master File says, died 05 July 1993 1273341 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM A. wasborn 11 April 1921, received Social Security number 393-14-1767 (indicating Wisconsin) and, Death Master File says, died 06 October 1991 1273342 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM A. wasborn 12 April 1924, received Social Security number 557-22-5629 (indicating California) and, Death Master File says, died 22 May 1997 1273343 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM A. wasborn 14 December 1888, received Social Security number 446-20-1170 (indicating Oklahoma) and, Death Master File says, died 22 August 1980 1273344 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM A. wasborn 15 July 1903, received Social Security number 500-05-8840 (indicating Missouri) and, Death Master File says, died 02 May 1994 1273345 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM A. wasborn 15 July 1927, received Social Security number 489-60-5625 (indicating Missouri) and, Death Master File says, died 25 May 2005 1273346 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM A. wasborn 17 April 1921, received Social Security number 218-18-1937 (indicating Maryland) and, Death Master File says, died 28 February 1999 1273347 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM A. wasborn 22 May 1923, received Social Security number 179-22-4596 (indicating Pennsylvania) and, Death Master File says, died 19 November 1990 1273348 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM A. wasborn 22 November 1905, received Social Security number 417-22-6764 (indicating Alabama) and, Death Master File says, died 07 March 1993 1273349 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM A. wasborn 23 August 1917, received Social Security number 168-07-7952 (indicating Pennsylvania) and, Death Master File says, died 14 July 1996 1273350 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM A. wasborn 28 August 1928, received Social Security number 448-30-1253 (indicating Oklahoma) and, Death Master File says, died 03 February 1983 1273351 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM A. wasborn 29 October 1915, received Social Security number 126-07-8904 (indicating New York) and, Death Master File says, died 06 March 1995 1273352 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM B. married 11 Mar 1874 in Carroll County, Arkansas abridenamed MALIPA O. MYERS. 1273353 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, William B. wasborn ABT 1807 in S.C.; wasinthe1850census in Tippah County, Mississippi. 1273354 Check the source file (free) and then check Archives for William GARRISON. GARRISON, William B. wasborn ABT 1859 in Texas; wasinthe1860census in Wise County, Texas. 1273355 Check the source file (free) and then check Archives for William GARRISON. GARRISON, WILLIAM B married 1 Jan 1881 in ROCK ISLAND COUNTY, ILLINOIS, U.S.A. abridenamed ELLEN (DRENNEN) DRENNAN. 1273356 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM B. wasborn 07 April 1907, received Social Security number 150-07-3132 (indicating New Jersey) and, Death Master File says, died 29 March 1990 1273357 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM B. wasborn 10 August 1910, received Social Security number 225-03-0394 (indicating Virginia) and, Death Master File says, died 27 November 1998 1273358 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM B. wasborn 12 June 1927, received Social Security number 424-26-1620 (indicating Alabama) and, Death Master File says, died 15 March 1992 1273359 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM B. wasborn 20 September 1918, received Social Security number 411-26-8117 (indicating Tennessee) and, Death Master File says, died 06 November 2002 1273360 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM B. wasborn 26 September 1913, received Social Security number 258-09-9117 (indicating Georgia) and, Death Master File says, died 30 December 2003 1273361 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM B. wasborn 31 July 1945, received Social Security number 218-44-2272 (indicating Maryland) and, Death Master File says, died 10 June 2009 1273362 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, William C. wasborn ABT 1826 in Morgan Cty, Alabama; wasinthe1850census in Morgan County, Alabama. 1273363 Check the source file (free) and then check Archives for William GARRISON. GARRISON, William C. wasborn ABT 1884 in Arkansas and he wasinthe1910census in Mayes County, Oklahoma, U.S.A. 1273364 Check the source file (free) and then check Archives for William GARRISON. GARRISON, WILLIAM C married 26 Apr 1866 in JEFFERSON COUNTY, ILLINOIS, U.S.A. abridenamed MARY J NOEL. 1273365 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, William C wasborn ABT 1893 in Oklahoma and he wasinthe1920census in Kiowa County, Oklahoma, U.S.A. 1273366 Check the source file (free) and then check Archives for William GARRISON. GARRISON, WILLIAM C who was 18 (born ABT 1952) married 14 APR 1970 in DALLAS COUNTY, TEXAS, U.S.A. abridenamed ADONICA G WITHERSPOON who was 16 (born ABT 1954). 1273367 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM C who was 21 (born ABT 1963) married 16 JUN 1984 in DENTON COUNTY, TEXAS, U.S.A. abridenamed PATRICIA L COLESON who was 21 (born ABT 1963). 1273368 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM C who was 33 (born ABT 1958) married 30 NOV 1991 in TRAVIS COUNTY, TEXAS, U.S.A. abridenamed ROSALYNN D GILL who was 30 (born ABT 1961). 1273369 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM C who was 35 (born ABT 1971) married 14 MAY 2006 in KAUFMAN COUNTY, TEXAS, U.S.A. abridenamed AMY L LEFLORE who was 34 (born ABT 1972). 1273370 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM C who was 50 (born ABT 1928) married 28 OCT 1978 in DALLAS COUNTY, TEXAS, U.S.A. abridenamed DORTHA E HALL who was 51 (born ABT 1927). 1273371 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM C who was 73 (born ABT 1928) married 13 NOV 2001 in KAUFMAN COUNTY, TEXAS, U.S.A. abridenamed KATHY J GAULDEN who was 43 (born ABT 1958). 1273372 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM C, and his bride KATHY Jmarried, , and they had no children under 18 when they got divorced in DALLAS COUNTY, TEXAS, U.S.A. on 1 FEB 2005. 1273373 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM C, born ABT 1929, and his bride PAULINE, born ABT 1931 married, , and they had one child under 18 when they got divorced in DALLAS COUNTY, TEXAS, U.S.A. on 18 OCT 1978. 1273374 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM C, born ABT 1952, and his bride ADONICA G, born ABT 1953, married 14 APR 1970, and they had three children under 18 when they got divorced in DALLAS COUNTY, TEXAS, U.S.A. on 21 NOV 1978. 1273375 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM C, born ABT 1963, and his bride PATRICIA L, born ABT 1962, married 16 JUN 1984, and they had one child under 18 when they got divorced in DENTON COUNTY, TEXAS, U.S.A. on 26 JAN 1990. 1273376 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM C. wasborn 04 June 1916, received Social Security number 423-03-4902 (indicating Alabama) and, Death Master File says, died 24 March 2000 1273377 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM C. wasborn 05 April 1923, received Social Security number 496-18-2534 (indicating Missouri) and, Death Master File says, died 10 February 1988 1273378 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM C. wasborn 07 March 1928, received Social Security number 426-46-2514 (indicating Mississippi) and, Death Master File says, died 19 July 1994 1273379 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM C. wasborn 08 August 1907, received Social Security number 239-03-2527 (indicating North Carolina) and, Death Master File says, died 17 January 1999 1273380 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM C. wasborn 08 February 1918, received Social Security number 152-07-2621 (indicating New Jersey) and, Death Master File says, died 27 February 2002 1273381 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM C. wasborn 08 January 1910, received Social Security number 443-12-9483 (indicating Oklahoma) and, Death Master File says, died 16 October 1989 1273382 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM C. wasborn 10 February 1942, received Social Security number 284-34-2200 (indicating Ohio) and, Death Master File says, died 06 October 2013 1273383 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM C. wasborn 11 January 1922, received Social Security number 185-14-5843 (indicating Pennsylvania) and, Death Master File says, died 18 December 2013 1273384 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM C. wasborn 20 May 1929, received Social Security number 410-56-2278 (indicating Tennessee) and, Death Master File says, died 05 March 1999 1273385 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM C. wasborn 26 March 1953, received Social Security number 224-74-3267 (indicating Virginia) and, Death Master File says, died 12 April 2007 1273386 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM C. wasborn 28 November 1912, received Social Security number 412-14-9559 (indicating Tennessee) and, Death Master File says, died 21 January 1999 1273387 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM C. wasborn 29 August 1897, received Social Security number 417-01-1493 (indicating Alabama) and, Death Master File says, died 14 September 1992 1273388 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM C. wasborn 31 May 1911, received Social Security number 268-01-9335 (indicating Ohio) and, Death Master File says, died 03 November 1988 1273389 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM CALVIN wasborn 18 Apr 1870 in IDAHO;; died 7 May 1933 in YAVAPAI COUNTY, ARIZONA, U.S.A.. 1273390 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, William Charles married in 1944 in Brooke abridenamed June Hummell. 1273391 Check the source file (free) and then check Archives for William GARRISON. GARRISON, WILLIAM C III who was 19 (born ABT 1971) married 19 MAR 1990 in ROCKWALL COUNTY, TEXAS, U.S.A. abridenamed ELMA GARCIA who was 16 (born ABT 1974). 1273392 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM C JR who was 27 (born ABT 1955) married 28 AUG 1982 in NUECES COUNTY, TEXAS, U.S.A. abridenamed ANGELITA GARCIA who was 25 (born ABT 1957). 1273393 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM C JR who was 32 (born ABT 1972) married 1 JAN 2004 in TRAVIS COUNTY, TEXAS, U.S.A. abridenamed SHAUNNA L MORK who was 29 (born ABT 1975). 1273394 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM C JR who was 33 (born ABT 1971) married 25 SEP 2004 in TRAVIS COUNTY, TEXAS, U.S.A. abridenamed SHAUNNA L MORK who was 29 (born ABT 1975). 1273395 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM C JR who was 36 (born ABT 1952) married 12 MAY 1988 in DALLAS COUNTY, TEXAS, U.S.A. abridenamed TRACEY A VINCIK who was 23 (born ABT 1965). 1273396 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM C JR who was 47 (born ABT 1951) married 25 SEP 1998 in KAUFMAN COUNTY, TEXAS, U.S.A. abridenamed KRISTY A HARDING who was 29 (born ABT 1969). 1273397 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, William D. married 31 Oct 1887 in Brooke County, West Virginia, U.S.A. abridenamed Grace D. Stewart. 1273398 Check the source file (free) and then check Archives for William GARRISON. GARRISON, WILLIAM D married 1 Apr 1889 in CASS COUNTY, ILLINOIS, U.S.A. abridenamed HATTIE HOOD. 1273399 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM D married 29 Jun 1852 in FRANKLIN COUNTY, ILLINOIS, U.S.A. abridenamed NANCY PEMBERTON. 1273400 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM D who was 21 (born ABT 1987) married 12 JUL 2008 in NUECES COUNTY, TEXAS, U.S.A. abridenamed CHRISTA M RASOR who was 19 (born ABT 1989). 1273401 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM D who was 27 (born ABT 1964) married 14 FEB 1991 in LAMAR COUNTY, TEXAS, U.S.A. abridenamed LESLIE CODY who was 30 (born ABT 1961). 1273402 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM D who was 28 (born ABT 1965) married 13 NOV 1993 in HARRIS COUNTY, TEXAS, U.S.A. abridenamed DEBORA K ANDERSON who was 28 (born ABT 1965). 1273403 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM D who was 30 (born ABT 1964) married 30 SEP 1994 in LAMAR COUNTY, TEXAS, U.S.A. abridenamed SHANNA D JOHNSON who was 25 (born ABT 1969). 1273404 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM D who was 30 (born ABT 1977) married 27 APR 2007 in TRAVIS COUNTY, TEXAS, U.S.A. abridenamed SAMANTHA M JAMES who was 23 (born ABT 1984). 1273405 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM D who was 44 (born ABT 1964) married 10 OCT 2008 in LAMAR COUNTY, TEXAS, U.S.A. abridenamed SHEILA D BALLARD who was 43 (born ABT 1965). 1273406 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM D who was 66 (born ABT 1917) married 16 SEP 1983 in DE WITT COUNTY, TEXAS, U.S.A. abridenamed JENNIE M GARLANGER who was 63 (born ABT 1920). 1273407 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM D, born ABT 1964, and his bride LESLIE A, born ABT 1962, married 14 FEB 1991, and they had one child under 18 when they got divorced in LAMAR COUNTY, TEXAS, U.S.A. on 11 OCT 1993. 1273408 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM D, born ABT 1965, and his bride SHANNA D, born ABT 1970, married 30 SEP 1994, and they had no children under 18 when they got divorced in LAMAR COUNTY, TEXAS, U.S.A. on 28 MAY 2008. 1273409 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM D. wasborn 02 March 1917, received Social Security number 079-34-6992 (indicating New York) and, Death Master File says, died 28 March 1999 1273410 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM D. wasborn 03 May 1902, received Social Security number 367-10-7512 (indicating Michigan) and, Death Master File says, died 02 March 1997 1273411 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM D. wasborn 04 January 1925, received Social Security number 396-18-3370 (indicating Wisconsin) and, Death Master File says, died 01 July 2004 1273412 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM D. wasborn 06 August 1934, received Social Security number 247-50-7427 (indicating South Carolina) and, Death Master File says, died 06 May 2000 1273413 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM D. wasborn 08 November 1916, received Social Security number 385-01-5484 (indicating Michigan) and, Death Master File says, died 03 June 2008 1273414 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM D. wasborn 14 May 1926, received Social Security number 113-16-3517 (indicating New York) and, Death Master File says, died 20 February 1991 1273415 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM D. wasborn 14 September 1913, received Social Security number 049-01-8186 (indicating Connecticut) and, Death Master File says, died 06 August 1991 1273416 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM D. wasborn 15 January 1948, received Social Security number 564-72-4047 (indicating California) and, Death Master File says, died 27 November 1996 1273417 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM D. wasborn 22 March 1954, received Social Security number 424-76-8816 (indicating Alabama) and, Death Master File says, died 01 August 2008 1273418 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM D. wasborn 26 December 1953, received Social Security number 216-58-8184 (indicating Maryland) and, Death Master File says, died 18 August 1998 1273419 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM D. wasborn 27 February 1922, received Social Security number 509-12-0857 (indicating Kansas) and, Death Master File says, died 21 January 1992 1273420 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM D. wasborn 28 January 1904, received Social Security number 387-05-8716 (indicating Wisconsin) and, Death Master File says, died 18 April 1988 1273421 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM D. wasborn 29 October 1939, received Social Security number 215-36-5174 (indicating Maryland) and, Death Master File says, died 04 December 2011 1273422 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM D. wasborn 30 July 1931, received Social Security number 242-40-2804 (indicating North Carolina) and, Death Master File says, died 03 July 2001 1273423 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, William Denver married in 1950 in Kanawha, West Virginia, United States abridenamed Mildred Dorine Carder. 1273424 Check the source file (free) and then check Archives for William GARRISON. GARRISON, WILLIAM DONALD who was 30 in 2010 (born about 1980) married 27 April 2007 abridenamed SAMANTHA MARIE who was 25 in 2010 (born about 1985) on 27 April 2007 and they had one child under 18 when they got a divorce 14 March 2010 in TRAVIS COUNTY, TEXAS, U.S.A. 1273425 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM DOUGLAS who was 43 in 2009 (born about 1966) married 12 October 2008 abridenamed SHEILA D who was 43 in 2009 (born about 1966) on 12 October 2008 and they had no children under 18 when they got a divorce 3 September 2009 in LAMAR COUNTY, TEXAS, U.S.A. 1273426 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM E married 15 Jan 1873 in SCHUYLER COUNTY, ILLINOIS, U.S.A. abridenamed ELLENORA LEGG. 1273428 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM E married 19 May 1900 in WHITE COUNTY, ILLINOIS, U.S.A. abridenamed EFFIE J JOHNSON. 1273429 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM E married 29 Jun 1891 in JEFFERSON COUNTY, ILLINOIS, U.S.A. abridenamed LOUIE TIPTON. 1273430 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, William E wasborn ABT 1840 in Ark; wasinthe1850census in Crawford County, Arkansas. 1273431 Check the source file (free) and then check Archives for William GARRISON. GARRISON, WILLIAM E who was 20 (born ABT 1967) married 26 JUN 1987 in LAMAR COUNTY, TEXAS, U.S.A. abridenamed SOPHIE B STACY who was 22 (born ABT 1965). 1273432 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM E who was 26 (born ABT 1951) married 4 NOV 1977 in HARRIS COUNTY, TEXAS, U.S.A. abridenamed DIANE L STOUT who was 19 (born ABT 1958). 1273433 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM E who was 27 (born ABT 1949) married 29 MAY 1976 in LAMAR COUNTY, TEXAS, U.S.A. abridenamed TAMMIE M HIGGINBOTHAM who was 17 (born ABT 1959). 1273434 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM E, born ABT 1927, and his bride BILLIE J, born ABT 1929, married 13 JUL 1966, and they had no children under 18 when they got divorced in BLANCO COUNTY, TEXAS, U.S.A. on 10 FEB 1972. 1273435 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM E, born ABT 1933, and his bride NANCY L, born ABT 1937, married 22 JAN 1958, and they had two children under 18 when they got divorced in SMITH COUNTY, TEXAS, U.S.A. on 11 DEC 1991. 1273436 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM E, born ABT 1948, and his bride LINDA F, born ABT 1947, married 27 OCT 1965, and they had two children under 18 when they got divorced in DALLAS COUNTY, TEXAS, U.S.A. on 30 AUG 1971. 1273437 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM E, born ABT 1949, and his bride LYNDA M, born ABT 1954, married 3 SEP 1971, and they had no children under 18 when they got divorced in DALLAS COUNTY, TEXAS, U.S.A. on 14 FEB 1972. 1273438 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM E, born ABT 1952, and his bride CHERYL A, born ABT 1950, married 14 JUN 1968, and they had one child under 18 when they got divorced in HARRIS COUNTY, TEXAS, U.S.A. on 18 JUL 1973. 1273439 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM E, born ABT 1952, and his bride RHONDA A, born ABT 1953, married 10 JUL 1972, and they had one child under 18 when they got divorced in HARRIS COUNTY, TEXAS, U.S.A. on 19 AUG 1981. 1273440 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM E. wasborn 01 August 1927, received Social Security number 512-20-6684 (indicating Kansas) and, Death Master File says, died 18 August 1996 1273441 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM E. wasborn 02 July 1948, received Social Security number 249-78-1582 (indicating South Carolina) and, Death Master File says, died 05 March 2007 1273442 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM E. wasborn 03 February 1938, received Social Security number 224-46-0116 (indicating Virginia) and, Death Master File says, died 19 April 2004 1273443 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM E. wasborn 04 February 1918, received Social Security number 440-01-6248 (indicating Oklahoma) and, Death Master File says, died 20 May 2004 1273444 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM E. wasborn 05 December 1926, received Social Security number 174-20-2608 (indicating Pennsylvania) and, Death Master File says, died 03 June 2010 1273445 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM E. wasborn 05 May 1897, received Social Security number 465-58-6675 (indicating Texas) and, Death Master File says, died 02 December 1989 1273446 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM E. wasborn 07 March 1912, received Social Security number 247-20-0835 (indicating South Carolina) and, Death Master File says, died 25 January 1994 1273447 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM E. wasborn 08 May 1904, received Social Security number 248-01-6554 (indicating South Carolina) and, Death Master File says, died 21 February 2000 1273448 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM E. wasborn 09 August 1925, received Social Security number 249-26-7001 (indicating South Carolina) and, Death Master File says, died 30 October 2006 1273449 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM E. wasborn 09 March 1952, received Social Security number 488-56-0438 (indicating Missouri) and, Death Master File says, died 22 December 2008 1273450 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM E. wasborn 10 February 1955, received Social Security number 141-50-0073 (indicating New Jersey) and, Death Master File says, died 11 December 2010 1273451 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM E. wasborn 10 January 1948, received Social Security number 438-66-5316 (indicating Louisiana) and, Death Master File says, died 17 November 2003 1273452 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM E. wasborn 10 May 1922, received Social Security number 137-18-6914 (indicating New Jersey) and, Death Master File says, died 02 August 2005 1273453 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM E. wasborn 12 March 1927, received Social Security number 231-20-5393 (indicating Virginia) and, Death Master File says, died 16 June 2007 1273454 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM E. wasborn 13 May 1924, received Social Security number 289-16-8981 (indicating Ohio) and, Death Master File says, died 04 July 1993 1273455 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM E. wasborn 14 May 1920, received Social Security number 367-14-1701 (indicating Michigan) and, Death Master File says, died 10 October 1999 1273456 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM E. wasborn 15 August 1928, received Social Security number 385-24-8166 (indicating Michigan) and, Death Master File says, died 18 August 2000 1273457 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM E. wasborn 16 October 1915, received Social Security number 224-60-5339 (indicating Virginia) and, Death Master File says, died 09 April 1995 1273458 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM E. wasborn 18 April 1920, received Social Security number 118-09-1775 (indicating New York) and, Death Master File says, died 10 December 1993 1273459 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM E. wasborn 19 May 1935, received Social Security number 423-42-5783 (indicating Alabama) and, Death Master File says, died 17 April 2008 1273460 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM E. wasborn 19 May 1943, received Social Security number 060-34-5577 (indicating New York) and, Death Master File says, died 07 August 2000 1273461 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM E. wasborn 19 November 1915, received Social Security number 442-18-4274 (indicating Oklahoma) and, Death Master File says, died 11 July 1996 1273462 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM E. wasborn 23 August 1920, received Social Security number 570-09-2878 (indicating California) and, Death Master File says, died 24 August 2006 1273463 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM E. wasborn 24 March 1904, received Social Security number 258-44-4440 (indicating Georgia) and, Death Master File says, died 05 December 2004 1273464 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM E. wasborn 24 May 1943, received Social Security number 242-68-2633 (indicating North Carolina) and, Death Master File says, died 01 July 2000 1273465 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM E. wasborn 25 April 1911, received Social Security number 157-09-7018 (indicating New Jersey) and, Death Master File says, died 16 December 1989 1273466 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM E. wasborn 28 June 1919, received Social Security number 359-01-9716 (indicating Illinois) and, Death Master File says, died 26 July 1993 1273467 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM EARL who was 17 (born ABT 1951) married 14 JUN 1968 in HARRIS COUNTY, TEXAS, U.S.A. abridenamed CHERYL ANN LOTT who was 18 (born ABT 1950). 1273468 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM E II, born ABT 1951, and his bride MARY A, born ABT 1954, married 11 FEB 1972, and they had no children under 18 when they got divorced in BELL COUNTY, TEXAS, U.S.A. on 1 JUN 1973. 1273469 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM E III who was 23 (born ABT 1955) married 18 MAR 1978 in WICHITA COUNTY, TEXAS, U.S.A. abridenamed MARY L CUNNINGHAM who was 24 (born ABT 1954). 1273470 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM E JR who was 29 (born ABT 1973) married 22 APR 2002 in HARRIS COUNTY, TEXAS, U.S.A. abridenamed MELISSA L GARZA who was 27 (born ABT 1975). 1273471 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, William F. married 14 Aug 1927 in Harper County, Kansas abridenamed Geneva Smott. 1273472 Check the source file (free) and then check Archives for William GARRISON. GARRISON, William F. wasborn in 1861; died 1936; and wasburied 22 Sep 1936 in Wichita, Sedgwick County, Kansas. 1273473 Check the source file (free) and then check Archives for William GARRISON. GARRISON, WILLIAM F married 30 Jun 1872 in PIATT COUNTY, ILLINOIS, U.S.A. abridenamed SARAH J CLAUTON. 1273474 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM F who was 37 (born ABT 1946) married 8 JUL 1983 in DALLAS COUNTY, TEXAS, U.S.A. abridenamed KATHY L SCHARLOCH who was 31 (born ABT 1952). 1273475 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM F, born ABT 1945, and his bride KATHY L, born ABT 1952, married 8 JUL 1983, and they had no children under 18 when they got divorced in DALLAS COUNTY, TEXAS, U.S.A. on 13 DEC 1983. 1273476 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM F, born ABT 1945, and his bride ROBERTA A, born ABT 1943, married 28 MAY 1966, and they had no children under 18 when they got divorced in VAN ZANDT COUNTY, TEXAS, U.S.A. on 4 APR 1973. 1273477 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM F, born ABT 1948, and his bride GWENDOLYN, born ABT 1948, married 5 SEP 1970, and they had one child under 18 when they got divorced in DALLAS COUNTY, TEXAS, U.S.A. on 6 JAN 1983. 1273478 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM F. wasborn 01 February 1939, received Social Security number 509-34-1409 (indicating Kansas) and, Death Master File says, died 23 February 2004 1273479 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM F. wasborn 01 March 1918, received Social Security number 453-03-4299 (indicating Texas) and, Death Master File says, died 03 April 1994 1273480 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM F. wasborn 03 April 1928, received Social Security number 442-24-7140 (indicating Oklahoma) and, Death Master File says, died 20 October 1995 1273481 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM F. wasborn 07 February 1929, received Social Security number 402-40-0814 and, Death Master File says, died 13 May 1991 1273482 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM F. wasborn 09 September 1925, received Social Security number 235-24-9752 (indicating West Virginia) and, Death Master File says, died 29 November 2002 1273483 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM F. wasborn 18 September 1924, received Social Security number 053-24-9024 (indicating New York) and, Death Master File says, died 02 September 1997 1273484 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM F. wasborn 20 February 1926, received Social Security number 257-26-7264 (indicating Georgia) and, Death Master File says, died 28 March 1990 1273485 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM F. wasborn 20 October 1915, received Social Security number 337-09-8171 (indicating Illinois) and, Death Master File says, died 03 July 1991 1273486 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM F. wasborn 22 December 1942, received Social Security number 152-34-0601 (indicating New Jersey) and, Death Master File says, died 24 December 2005 1273487 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM F. wasborn 22 July 1909, received Social Security number 521-03-9328 (indicating Colorado) and, Death Master File says, died 12 July 1996 1273488 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, William Franklin married in 1949 in Brooke abridenamed Charlotte Lorraine Goodall. 1273489 Check the source file (free) and then check Archives for William GARRISON. GARRISON, WILLIAM FRANKLIN wasborn 8 Sep 1892;; died 26 Nov 1956 in PIMA COUNTY, ARIZONA, U.S.A.. 1273490 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM FREDERICK who was 21 (born ABT 1945) married 28 MAY 1966 in HIDALGO COUNTY, TEXAS, U.S.A. abridenamed ROBERTA ANN HARBOUR who was 24 (born ABT 1942). 1273491 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM G married 19 Mar 1874 in MORGAN COUNTY, ILLINOIS, U.S.A. abridenamed LAURA E HOLIDAY. 1273492 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM G married in 1971 in Grand Traverse County, Michigan, U.S.A. abridenamed DEBRA S GARLAND. 1273493 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM G who was 23 (born ABT 1955) married 25 NOV 1978 in DENTON COUNTY, TEXAS, U.S.A. abridenamed DONNA J DUCKWORTH who was 21 (born ABT 1957). 1273494 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM G who was 26 (born ABT 1950) married 9 JUL 1976 in DALLAS COUNTY, TEXAS, U.S.A. abridenamed REBECCA S THOMAS who was 20 (born ABT 1956). 1273495 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM G who was 29 (born ABT 1961) married 15 SEP 1990 in HARRIS COUNTY, TEXAS, U.S.A. abridenamed DIANA K WORDEN who was 22 (born ABT 1968). 1273496 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM G, born ABT 1950, and his bride REBECCA S, born ABT 1956, married 9 JUL 1976, and they had one child under 18 when they got divorced in DALLAS COUNTY, TEXAS, U.S.A. on 21 JUN 1988. 1273497 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM G. wasborn 03 December 1927, received Social Security number 257-30-3402 (indicating Georgia) and, Death Master File says, died 12 December 2005 1273498 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM G. wasborn 15 March 1918, received Social Security number 113-03-0944 (indicating New York) and, Death Master File says, died 21 October 1989 1273499 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM G. wasborn 16 February 1917, received Social Security number 223-16-4958 (indicating Virginia) and, Death Master File says, died 02 December 2002 1273500 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM G. wasborn 21 April 1930, received Social Security number 300-28-4287 (indicating Ohio) and, Death Master File says, died 22 July 1999 1273501 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM G. wasborn 22 January 1918, received Social Security number 142-18-8542 (indicating New Jersey) and, Death Master File says, died 20 December 1998 1273502 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM G. wasborn 24 July 1919, received Social Security number 459-24-7229 (indicating Texas) and, Death Master File says, died 25 June 2004 1273503 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM G. wasborn 26 July 1928, received Social Security number 172-22-2863 (indicating Pennsylvania) and, Death Master File says, died 21 April 2011 1273504 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM G. wasborn 30 November 1935, received Social Security number 425-66-6070 (indicating Mississippi) and, Death Master File says, died 03 June 2004 1273505 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM G. wasborn 30 October 1915, received Social Security number 108-10-8467 (indicating New York) and, Death Master File says, died 23 May 2002 1273506 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON, WILLIAM GRAHAM who was 23 (born ABT 1945) married 27 JUL 1968 in TARRANT COUNTY, TEXAS, U.S.A. abridenamed SUSAN MCMAINS who was 21 (born ABT 1947). 1273510 Check the source file (free) and then check Archives for WILLIAM GARRISON. GARRISON , William H.? (father) , and Maria born in Harwich, hadababy, [no given name shown] GARRISON born 16 APR 1864 in Harwich, Barnstable County, Massachusetts. 1273511 Check the source file (free) and then check Archives for , GARRISON. GARRISON, William H. married in 1868 in Warren County, Ohio abridenamed Laura DEVELVISS. 1273512 Check the source file (free) and then check Archives for William GARRISON. Volunteers have worked tirelessly to transcribe old records, to make them available for free to anybody who has a computer and modem. Trouble is, if you already know it, you don’t need it, and if you don’t know it, you can’t find it. You won’t find your great aunt on the Left Overshoe County, East Dakota Deaths, 1889 unless you know the county and year. This site hopes to help solve that problem by linking to transcription entries, sorted by name. Some detail on this site may help you determine if it’s the same Maddalena O’Reilly as the one on your family tree. Attention irate copyright holders: Click Here

John III of Navarre John III (; 1469 – 14 June 1516) was jure uxoris King of Navarre from 1484 until his death, as husband and co-ruler with Queen Catherine. He was a son of Alain I, Lord of Albret and his wife Frances, Countess of Périgord. King of Navarre Marriage to Queen Catherine and accession to the throne He became King of Navarre and Count of Foix by virtue of his 1484 marriage to Queen Catherine (1470–1517), successor of her brother Francis Phoebus in 1483. He shared with Catherine tasks related to the government of the kingdom, but his rule was marked by the guardianship of Catherine's mother Magdalena de Valois up to 1494—she died in 1495—and persistent diplomatic and military pressure of Ferdinand II of Aragon over the Crown of Navarre, supported on the ground by the Beaumont party of Navarre. He and Catherine were crowned as monarchs in Pamplona on 10 January 1494. In the run-up to the ceremony, Louis of Beaumont—count of Lerín—had taken over and ransacked the stronghold. On Christmas 1493, the count blocked the access of the king and queen to the capital city, but after a fleeting peace agreement was reached, the ceremony was held. In the week-long festival following the crowning ceremony, John III and his father are referred to in Basque language verses as Labrit, their usual naming in Navarre—also at Olite in 1493, document written in Romanic language. The kingdom invaded In 1512, Navarre was invaded by a combined Castilian-Aragonese army sent by Ferdinand II of Aragon, whose second wife was Germaine de Foix (1490–1538), a cousin of Queen Catherine. The Castilian troops commanded by the duke of Alba crossed the Pyrénées onto Lower Navarre capturing St-Jean-Pied-de-Port on 10 September 1512 and wreaking havoc across much of the merindad. There the Castilians were doggedly opposed by lords loyal to John III and Catherine of Navarre, but the Castilians retained St-Jean-Pied-de-Port and its hinterland. Following the invasion, Navarre south of the Pyrenees was annexed to Castile nominally as an autonomous kingdom (aeque principalis) by the victorious Ferdinand after taking an oath to respect the Navarrese laws and institutions (1515). The royal family took shelter in Béarn, a royal Pyrenean domain and principality contiguous to Lower Navarre. The Parliament of Navarre and the States-General of Béarn had passed in 1510 a bill to create a confederation with a view to ensuring a better defence against external aggression. The capital city of Béarn was Pau, which John III and Catherine took as their main base along with Orthez and Tarbes in their last period. Reconquest attempt and death After the Aragonese king Ferdinand's death in January 1516, the king John III mustered an army in Sauveterre-de-Béarn made up of Navarrese exiles and men from all over his domains, especially from Béarn, but the total figure of combatants amounted to no more than several hundreds. The advance of the two columns led by Pedro, Marshal of Navarre was stopped by the Castilians right on the Pyrénées due to spies informing Cardinal Cisneros. The reconquest attempt was flawed. Depressed by the defeats and adverse diplomatic results, John III died at the castle of Esgouarrabaque in Monein, Béarn, on 14 June 1516 after lying gripped by fatal fevers. Up to the last moment he struggled to get Navarre back from the Spanish, urging his wife, Queen Catherine, to send a representative to the Cortes of Castile to demand the restoration of the kingdom of Navarre. Despite his wish to be buried at the Santa Maria Cathedral of Pamplona, the permanent Spanish occupation prevented that. His corpse rests instead at the Cathedral of Lescar along with Queen Catherine, who outlived him only a few months. Family John was the brother of Charlotte of Albret. He and Queen Catherine of Navarre were parents to thirteen children—other sources point to fourteen: Anne (19 May 1492 – 15 August 1532) Magdalena (29 March 1494 – May 1504) Catherine (1495 – November 1532), abbess of the Trinity at Caen Joan (15 June 1496 – last mentioned in November 1496) Quiteria (1499 – September/October 1536), abbess at Montivilliers a stillborn son in 1500 Andrew Phoebus (14 October 1501 – 17 April 1503) Henry II (18 April 1503 – 25 May 1555), King of Navarre Buenaventura (14 July 1505 – 1510/1511) Martin (c. 1506 – last mentioned in 1512) Francis (1508 – last mentioned in 1512) Charles (12 December 1510 – September 1528), captured during the Siege of Naples and died as a prisoner of war Isabella (1513/1514 – last mentioned in 1555), married to Rene I, Viscount of Rohan Ancestors Notes References External links Category:1469 births Category:1516 deaths Category:Navarrese monarchs Category:Jure uxoris kings Category:Burials at Lescar Cathedral Category:House of Albret Category:16th-century people from the Kingdom of Navarre Category:Counts of Périgord

Opinion issued May 20, 2005 In The Court of Appeals For The First District of Texas NO. 01-00-01163-CV NO. 01-00-01169-CV MALCOMSON ROAD UTILITY DISTRICT, Appellant V. FRANK GEORGE NEWSOM, Appellee On Appeal from the County Civil Court At Law No. 3 Harris County, Texas Trial Court Cause Nos. 691,631 & 691,632 DISSENTING OPINION ON REHEARING           I agree with the majority that Hubenak II requires us to apply the summary judgment standard of review to the trial court’s rulings on each of the statutory requirements for condemnation, including the unable-to-agree requirement. Applying this standard, I agree with the majority that the District conclusively proved that the parties were unable to agree on damages before the filing of suit. I also agree that the District carried its constitutional burden of proving that the taking was for a public use. See Tex. Water Code Ann. § 54.201(a), (b)(3) (Vernon Supp. 2004-2005) (delegating to utility districts power of eminent domain to “gather, conduct, divert, and control local storm water or other local harmful excesses of water”); Housing Auth. of the City of Dallas v. Higginbotham, 143 S.W.2d 79, 83 (Tex. 1940) (legislative determination that project is for public use is binding unless use is “clearly and palpably” private). However, because I believe the majority has imposed an improperly high standard of review on a utility district’s determination of the necessity of a taking for public use, and has therefore denied the District judgment to which it is entitled in law, I respectfully dissent.           As the majority states, a condemning authority’s discretion to condemn land for a public purpose is nearly absolute, and the courts will not review the exercise of that authority without a showing that the condemnor acted fraudulently, in bad faith, or arbitrarily and capriciously. See Ludewig v. Houston Pipeline Co., 773 S.W.2d 610, 614 (Tex. App.—Corpus Christi 1989, writ denied); Bradford v. Magnolia Pipe Line Co., 262 S.W.2d 242, 246 (Tex. Civ. App.—Eastland 1953, no writ); Meaney v. Nueces County Navigation Dist. No. 1, 222 S.W.2d 402, 405 (Tex. Civ. App.—San Antonio 1949, writ ref’d); Jones v. City of Mineola, 203 S.W.2d 1020, 1022 (Tex. Civ. App.—Texarkana 1947, writ ref’d). A condemnation determination is arbitrary and capricious when it is “willful and unreasoning action, action without consideration and in disregard of the facts or circumstances [that] existed at the time condemnation was decided upon, or within the foreseeable future.” Wagoner v. City of Arlington, 345 S.W.2d 759, 763 (Tex. Civ. App.—Fort Worth 1961, writ ref’d n.r.e.). Thus, to resist summary judgment, Newsom, as condemnee, had the burden to establish that the condemnation of his property was not for an authorized public use or was willful and unreasoning and made in disregard of the facts. As the majority puts it, “[T]o show that the District acted arbitrarily and capriciously, Newsom had to negate any reasonable basis for determining what and how much land to condemn for the pond and the ditch expansion.” Malcomson Rd. Util. Dist. v. Newsom, Nos. 01-00-01163-CV & 01-00-01169-CV, slip op. at 22 (Tex. App.—Houston [1st Dist.] May 20, 2005, no pet. h.); see Wagoner, 345 S.W.2d. at 763 (noting that non-movant landowner could “have raised the issue [of arbitrariness] only if it was unquestionably established in the evidence that there could have been no actual public necessity for the [condemning authority] to seek the land in question for [authorized public] purposes”) (emphasis added).             The majority acknowledges that [r]egarding the pond, a land planner testified for the District that, as HCFCD had concluded, a pond was necessary. Santasiero’s engineer, Newsom’s engineer, and Newsom’s land planner agreed that a detention pond was necessary, but did not specify a location. HCFCD did not require that the pond be placed on Newsom’s property, but Ray Zobel, president of the District’s board, testified that the board selected Newsom’s property for the pond because that location would have allowed Villagio to have more homes, thus increasing the tax base more than if Newsom had been allowed to develop his own land.   Regarding the ditch expansion, an engineer and a land planner testified for the District that, as HCFCD had concluded, the project was necessary. Newsom’s own land planner agreed that HCFCD “would prudently require” the ditch expansion. The existing ditch ran along the eastern boundary of Newsom’s northern tract of land. The only direction in which the ditch could be expanded was westward, onto Newsom’s property, because the land to the east of the ditch had already been developed. Malcomson, Nos. 01-00-01163-CV & 01-00-01169-CV, slip op. at 28. The District thus presented evidence both that there was an actual necessity for the condemnation of Newsom’s land for an authorized public use and that there was a reasonable basis for condemning the land. Newsom produced no evidence that showed this testimony to be fraudulent or given in bad faith.           The majority, however, places a burden on the District to go behind the evidence showing public necessity and a reasonable basis for the condemnation decision, to refuse to accept the testimony of persons whose interests are adverse to the landowner as sufficient, and to require its own engineers to confirm not just the necessity for the taking—here for the ditch and the pond—but also the necessity of condemning this ditch and this pond as opposed to any other. In addition, the majority imposes the burden on the District to consider and investigate the scope of the taking, specifically to investigate whether the right-of-way for a drainage ditch such be taken in fee simple or by easement. The majority concludes that “the above evidence raises a fact issue on whether the District declined to exercise its discretion in determining whose land to condemn for the pond and in deciding whether to condemn Newsom’s land in easement or in fee for the ditch expansion,” thus raising a fact issue “on whether the District reached its condemnation decisions arbitrarily and capriciously or by abusing its discretion.” Malcomson, Nos. 01-00-01163-CV & 01-00-01169-CV, slip op. at 31. I cannot agree.           First, the majority’s conclusion is not supported by the language of the governing statute. There is no requirement in the governing statute, section 49.222(a) of the Water Code, that the District determine whose land to condemn—only that it determine on an evidentiary basis that the condemnation is for a public purpose. See Tex. Water Code Ann. § 49.222(a) (Vernon 2000). Nor is there any requirement that the condemnor investigate whether to condemn land in easement or in fee and provide evidence for its determination; rather, the power to elect to condemn either in fee simple or in easement is expressly given to the condemning authority. See id. In both cases, the language of the statute under which the District sought to condemn Newsom’s property is plain: A district . . . may acquire by condemnation any land, easements, or other property inside or outside the district boundaries . . . necessary for water, sanitary sewer, storm drainage, or flood drainage or control purposes or for any other of its projects or purposes, and may elect to condemn either the fee simple title or a lesser property interest. Tex. Water Code Ann. § 49.222(a) (emphasis added); see also id. § 49.218(a)-(c) (Vernon Supp. 2004-2005) (granting districts right to purchase land or interest in land considered necessary for districts’ purposes).           Second, the majority’s holding conflicts with established authority. See Ludewig, 773 S.W.2d at 614–15 (holding landowners’ evidence that condemnor could have adopted plans circumventing landowners’ property or determined size of easement differently was no evidence of arbitrary or capricious behavior where there was reasonable basis for determination); Wagoner, 345 S.W.2d at 763 (holding, “When the use for which property is sought under authority of the statutes of eminent domain is an authorized public use, the necessity or expediency of condemning any particular property is not a subject of judicial cognizance”) (emphasis added); Meaney, 222 S.W.2d at 408 (holding where district had statutory authority to condemn fee title, determination whether to take fee rather than easement was primarily for commissioners; in absence of showing that determination was induced by fraud or was wholly arbitrary and founded on no adequate determining principal, district’s decision was final); Hardwicke v. City of Lubbock, 150 S.W.3d 708, 716–17 (Tex. App.—Amarillo 2004, no pet.) (holding where there was room for two opinions as to necessity of condemning specific properties for redevelopment, action of zoning authority was not arbitrary and capricious).           I believe the holding of this court improperly heightens the burden on the District in establishing the necessity of condemning property for an authorized public purpose and is contrary to the plain language of the statute the District relied on to condemn Newsom’s property, section 49.222(a) of the Water Code, and to authority interpreting the condemnation power. I also believe that Newsom failed to bear his burden of proof that the District acted fraudulently, in bad faith, or arbitrarily and capriciously in condemning a portion of his property. Therefore, I respectfully dissent. I would hold that the District carried its summary judgment burden of showing the necessity of the taking for an authorized public use and that Newsom failed to raise a fact issue as to the propriety of the taking. Conclusion           I would reverse the district court’s judgment denying the District’s motion for summary judgment, reverse the judgment granting Newsom’s motion for summary judgment and awarding him attorney’s fees and possession of the property and improvements on it, render partial summary judgment for the District, and remand for further proceedings in accordance with this opinion.                                                                Evelyn V. Keyes                                                              Justice Panel consists of Justices Taft, Keyes, and Higley. Justice Keyes, dissenting.

"Previously on "The L Word"" "I don't wanna break up with you." "You think we should go to therapy?" "Therapy's for people with problems." "Tell me you never want to see me again." "I never wanna see you again." "MUSIC" "What I want to do now, Kit, is just to be a really good business partner to you" " and this whole night club thing." " The Hit Club!" " Hit!" "It's a hit!" " That's a great name for a club." "I'm gonna call William." "Did you hear what happened with the movie?" " No." " They'll reshoot the ending." " To what?" " Jesse goes back to Jim and decides she isn't maybe lesbian after all." "I didn't call you at 2:15 in the morning to accuse you of being a sellout." "Oh my God!" "You need to fight for Jenny." "You're my best friend I've ever had and I'm profoundly ashamed of what I've done." "It's Jenny." "She said:" ""If you still wanna come over and see me, you can"." "You're nothing but a self absorbed, self-indulgent little brat." "And our little feeling on set was a showmance." "It's time for you to go." "Baby, don't be sad." "It's so boring." "Get off of me!" "Who the hell does she think she is?" "!" "She called me, she wanted me!" "And then she goes all Paris and Britney on me just like:" ""Oh, I never liked you and it was a showmance!"" "MUSIC" "Can you believe that?" "She fucks me all night long and then she has the nerve to say that's a showmance!" "I mean, I don't even know what the fuck that is!" " I'm googling." " Oh, it's, uh..." "Oh, it's, uh..." ""Phony romance that happens during a movie or a TV show"" ""usually between two stars, but it can"" " "also be between a star and"..." " You know what?" "I got it, alright?" "Do you know how many times has she said that she loved me?" "She's officially a liar and I officially hate her!" "You know what?" "Fuck her, alright?" "!" "I got over 16 million on my opening week end and she can't even get in at the premiere of my next movie." "She payed someone." "God!" "Makes wonder who broke her heart." "I can't believe she told you it wasn't you." "That was so harsh!" "You must feel horrible." "You know what?" "You are out of my 5!" " Nikki, you're my best friend!" " No, get out!" "Right now!" "Get out!" "Everyone, get out!" "Everyone!" "You know?" "You and you, and you, get out!" "Get out!" "Now!" "Move!" "Jenny Schecter is a liar and a user." "And trust me, you are not gonna get away with this." "You are dead meat, Schecter." "Dead." "And this is where we're gonna put the new DJ booth." "So, if you need anything, just let us know." "We'll get you all the right equipment." "Oh, I'll send you a list." "I love these colors." "We love them too." "We got morroconess out of "Casablanca" theme." " It's our favorite film." " Oh, say no more." "I love..." "So, what do we have to do to get the fabulous Sunset Boulevard to come and spin at Hit?" "Just keeping the fabulous Kit Porter." "You know you're my ultimate RB goddess?" "Oh, I don't know about the ultimate." "Ooh, somebody's been working out!" "Not that we're the type..." "you know, we're, uh..." "We've both swore off men." " Ages of it." " Good for you." "You two got a good thing going here." "You don't need some man in here messin' it up." "Okay, let me show you all of the textures and plans." " "I Like It" by The Emotions " "Oh, I'm vanilla and fruit." "Breakfeast burrito." "Thanks." "Excuse me." " I didn't order that." " Oh, they're from her." "Jenny, Shane wants you to know that she made them especially for you." "Excuse me, Alice?" "Do you mind just mentionning to Shane that I don't want her waffles?" "She doesn't want your waffles." "How much do you love the New Valley service?" "Oh, my God, Helena's taking this place to a whole new level." "Oh, and waffles!" "Look!" "I know that I love waffles." "I'm getting waffles." "Or not." "Haven't you heard that there are people starving in this world?" "I'm sure they don't want waffles, Kit." "Rock, paper, scissors, shoot!" "Shit!" "Okay, that's one to one." "Rock, paper, scissors, shoot!" " Fuck!" "I always loose." " 'Cause you're always rock." " Always." " Is that what it is?" "Have fun with the martyrs." "Have fun with the cheaters." "Wow, everyone's so industrial." "What are you doing?" " Learning." " I'm writing my new treatment." "What are you writing, Alice?" "A treatment." "A treatment for a film?" "I just..." "I had this kinda killer idea so I thought" "I'll just write a great screenplay and then sell it for millions and buy a house in Malibu?" "I don't like Malibu." " You've never been to Malibu." " I have been there." "I didn't know you wanted to be a screenwriter." "Well, I mean, you know, I never really did." "Really, but I thought how hard can it be?" "Right?" "Jenny?" "I mean, it's like, you get paid big time." "Well, if you, if you actually, Alice, if you would to amortize the payment of the 17 drafts that I did on "Lez Girls", you'll see that you actually don't get paid very much." "So..." "Alice is writing a treatment for a script." "Hope we're not in it." "Amen to that." "Actually, writing a good screenplay is what's really hard." "And Jenny's become a very good screenwriter." "Thank you, Tina." "You should ask her to read your treatment." "Sure." "Sure, sure, sure." "I would love to give you notes." "What?" "I need the carbs for training." "But do you need them that fast?" "You have them all over your suit." "Wow, you look amazing." " Thank you." " I dressed her." " Do a little spinzy, come on." " No." "It's her first day at the police academy, so..." "Excited?" "Yeah, I am, actually." "All my friends had the training, it's really, it's really rough." "I tried to dress her in my morning, but she just thought she looked like a girl." " It was inappropriate." " You looked so good in that." "You know it." "You just hate to look good or something." "What the fuck is that supposed to mean?" "There is like a lack of effort." "Tell me about fashion." "Fashion for..." "I don't know." "When you guys are gonna go to therapy?" "There is a thing called privacy, Alice." "Privacy." "Well, I see you at Dan Foxworthy's at 6." "There's parking on the..." "Wow, look at you!" "You look a million dollars!" "Fuck, you know?" "Bad vibes." "You and Shane should work your shit out, 'cause this place is becoming like the black hole of Calcutta." "It's good to see we're still asunder;" "nothing like a little dyke drama to tear the place out." "That's what I'm saying." " Bad vibes, man." " Helena, why don't you come and sit with us?" "No, I'm not picking sides, alright?" "I love you both." "Going for a run." "Go Swizerland!" " We have some good news." " Yeah, we have good news." "Yeah, good news." "Do you wanna tell them?" "Why don't you tell them?" "Bette and I are registered with three different agencies and they said the chance of us getting a baby within the next six months is really good." "What?" "!" " Congratulations." " And we're starting construction on the second storey 'cause we need an other bedroom." "But I thought you guys were talking about selling?" " We're staying." " We couldn't sell." "Not now." "I mean, with the poperty values, plumbing and everything." "So..." "When were you gonna tell me about construction?" "We're telling you now." "We have to." "We need a room for the baby." "How am I supposed to write with all that noise?" "I'm sorry, Jenny." "We will do our best not to disturb you." "But you might wanna get some earplugs." "I have to get a new roomate." "This is gonna be impossible" " with your racket." " Jenny, please!" "You don't need a new roomate!" "You have not spoken to me in a week." "Would you just talk to me?" "I know we can work this out." "Oh, right." "So, you want me to forgive you because you made me waffles?" "Well, why wouldn't you?" "Because you create this trail of destruction you don't take any responsibility for it." "Why should you be the only one that doesn't pay?" "I am paying." "You are so full of shit." "The black hole." " How you're doing?" " Hi, Shane." "So you're putting in those flower boxes Jenny wanted, huh?" "How many more things you're gonna do for her?" "I don't know yet." "There's something wrong with my computer and I wondered if you could fix it." "You know what?" "I can't 'cause I'm going to my final consult today." " Good luck." " Thanks." " Alright." "Are you ready for this?" " Do it." "I love it." "Love it." "Love it!" "We thought you would." ""The Girls", it's so fucking hot." "This thing is gonna make "Sex in the city" like a Disney movie." "What's "The Girls"?" "The movie is called "Lez Girls"." " "Lez"." " I haven't had a chance to talk to Tina about the market research." "I'll full you in in a minute." "In the meantime, why don't you just give me a briefing on the release." "After the initial two weeks, we'll go wide." "We have 2000 screens nation wide and select cities in here." " France is gonna eat this up." " No." "No what?" "No way." "I am not gonna let you get away with this." "I'm not gonna let you market this as some bullshit boy meets girl love story!" " That's not what this is!" " It's more than that." "It's boy meets girl, boy almost looses girl to girl..." "But in the end the audience wants love to prevail." "That's the winner hear." "The new ending tested through the roof." "What?" "The new..." "What you mean the new ending tested?" "When did you have a test screening?" "Get on board, Tina." "Train's not going to Lezzie town." "This is amazing." "Art General uses the correlation about how she uses human emotions like pieces of scrapped metal, words like found materials." "It works on so many levels." "I mean, here is the Curator who told people their work wasn't worthy." "The gallerist who wouldn't show an artist and now the Dean who rejects applications." "Exactly." "A woman who has stood in judgment of our art her entire career is now being thrust into the spot light as the art..." "It's brilliant." "This kind of praise is fantastic for our program." "I can guarantee that we're gonna see..." "We could use the same material throughout and..." "I can't talk right now." "Alright, bye." "Forgive me." "I had the contractors on the phone." "Do you know we're doing that second storey on the house for the baby..." "Phyllis, would you mind just finishing what you were saying?" "What I was saying was that based on" "C.U. associations with Jodi, I wouldn't be surprised if we see a significant increase in applicants this coming semester." "So one of my goals is to be able to take my shirt off at the beach within a year." "That's my goal." "Feel my pecs." "I've been doing like 200 pushings today." "Feel like I'm already bigger." "That's awesome." "Very good." "That's very impressive." "Yeah, I think I'm doing good with the contour." "I just, I hope I grew more chest to cover the scars." "Well, I think Dr. Stanhouse is gonna try to do the key whole procedure on you?" "Yeah, I'm hoping so." "And is your schedule for surgery on wednesday?" "Yeah, he called me this morning and he said that as soon as he gets the lab reports we're gonna be able to..." "I'm afraid there's a problem." "What's the problem?" "You're pregnant." "No, I can't, I can't be pregnant." " No, I've been taking testosterone." " Have you had intercourse?" "Have you and Tom had unprotected sex?" "Yeah, but we've been both tested for H.I.V." "We've been monogamous." "If you and Tom have had vaginal sex." "I know you might not call it that, but unfortunately, that doesn't stop it from working the same way." "Taking testosterone doesn't shut down the reproductive system." "What about my surgery?" "We're gonna have to postpone your surgery." "We're gonna have to find out how far along you are and you're gonna have to decide what you wanna do about it." "We'll have your budget done by the end of the week." "We cannot afford to have the art department last... again." "Thank you." "Can I ask how she responded?" "Our Dean?" "How did she respond to the work?" "He asks how I responded to your work." "I don't know." "How did you like the show?" "But I can't." "I have paints." "Can I talk to you, please?" "Sure, let's go to my office." "I hope Preston didn't bother you." "He's an old fool with a... for gossip." "It wasn't really about Preston." "I mean, the truth is that Jodi's behavior was completely inappropriate..." "Baby, when it comes down to it, this is all I have to offer you." " And if you can't love this..." " Joyce!" "Cover your junk!" "Sorry, Bette." "We reschedule?" "Joyce, what are you doing?" "You can't just pop out from behind a plant butt naked." "We have rules here." "I checked first to make sure you didn't have anything." "I was acting with my heart." "I'm a woman in love." "Please, take a lot of." "Phyllis" "Eleonore" "Victoria Kroll, you are one hell of a woman." "While the law in the state of California continues to acknowledge our love," "I would like to ask you to take my hand in holy matrimony." " I don't know what to say." " Say yes." " How many carats is this?" " Four!" " Say yes!" " How much did you spend?" " This must have cost a fortune." " I've got a friend who has a friend..." "Say yes, Phyllis, please." "But I said I never wanted to get married again." "We'll go to San Fransisco, we'll get married on..." "of City Hall," "Gavin said he'd marry us." "Gavin Newsom?" " The mayor of San Fransisco?" " That's right." "We raised a lot of money for that guy." "Say yes, Phyllis." "I'm freezing." " Yes." " Damn, lady!" "Come here, you!" "You've made me one happy woman." "MUSIC" "Who wants to tell me why you're here?" "Oh, we're just here for a tune-up." "Does that seem like an accurate assessment to you, Tasha?" "She's the one who called it that." "We've just had a couple of little, little things come up lately." " What sorts of little things?" " Money," "I make a lot more than she does." "How's that make you feel, Tasha?" "Resentful." "She doesn't want me to spend this much because she can't afford it." " Is that true?" " Absolutely." "We couldn't even get a bigger appartment because she couldn't share the rent fifty-fifty." "And I also think she resents me because I don't clean as much as she does." "Do you?" "Oh, look, now she's mad." "Is there anything else?" "Tasha broke up with me last week." "Really?" "Why did you break up with Alice, Tasha?" "Because she thought I cheated when I didn't even kiss the girl." "Did you think about it?" "Yeah, but, I mean, she wouldn't have even known if I didn't tell her." "So I think that mere fact that I disclosed the information should count to something." " Right?" " But if you knew Tasha's feelings about the subject of cheating, why did you choose to tell her?" "I think we're past it." " I think what we have to work..." " Alice, this is called couples' therapy for a reason." "Now, Tasha, this process works much more effectively if you participate." "Why do you think Alice told you?" "She doesn't even wanna be here." "I think that she told me because she wanted to break up with me and bringing this woman between us was the easiest way to do that." "She knew how I felt, she knew that" "I would break up with her and when I did, she got scared." "That's why we're here." "Can I help you?" "Uh, yes, I have an appointment?" "I called in earlier?" "Hi, I'm Max Sweeney." "I have an appointment." " For your girlfriend, or..." " No." "It's for me." "I need an abortion." " What did he say?" " If this is your idea of a joke it's not funny." "I'm not joking, alright?" "I'm pregnant." "Sir, if you don't leave now, I'm gonna have to call the security." "Look, I'm a F.T.M. transsexual, alright?" "Yeah, that's right!" "Take a good look!" "I'm a man and I'm pregnant." "It happens." "Don't you read the fucking tabloids?" "!" "Can I have my appointment now, please?" " "Run Run" by Those Dancing Days " "I'm trying to write." "Can I have my keys?" "I promise to make room in the appartment for your things." "And um," "I promise to try to see things through your point of view." "And to not talk to you with so much judgment." "And tomorrow when I wake up, for work, I'm gonna make you breakfeast." "I love that!" "It's good, right?" "Yeah, I know, it's good." "So, um, are you gonna give us more exercizes or...?" "I mean, maybe some homework." "I think we're ready for some homework." " Yeah." " Yeah, I'm ready." "Bring in on." "I'm not gonna give you homework." "I don't think you two should be in therapy." " That's what I said." "See?" " We rock." "You two have so little in common." "I really don't think you belong together." "I mean, what the fuck?" "It's like, we spent what, 55 minutes with this guy?" "Where is he fucking go off?" " I told you." "Therapy's bullshit." " It's bullshit, you're right." "He knows nothing about what we do and don't have in common." "What the hell is he talking about?" "We don't have anything in common." " Really?" "Dan?" " I know, it's crazy." " Give me my helmet." " I don't know." "Thank you." "Upsetting." "I'll see you tonight?" " "Flava In Ya Ear" by Craig Mack " "Come here." "Hey, are you okay?" "Sorry," "I couldn't get any sooner." "Should you be op already?" "They wouldn't do it." "I'm too far along already." " How far along?" " Four months." "How did this happen?" "How the fuck do you think it happened?" "!" "But, I didn't think you could." "You've been..." "Yeah, I thought if I was seeking testosterone," "I couldn't get pregnant, okay?" "I was wrong." "Why wouldn't your doctor tell you something like that?" "I don't know." "Maybe because she didn't think I was stupid enough" " to let some faggot fuck me!" " Hey, fuck you!" "Don't blame this on me!" "Who the hell am I supposed to blame, huh?" "Who the hell has his dick been inside me?" "How am I supposed to know?" "You got me pregnant, you faggot!" "It was you!" "I can't do this, Max." "I'm not ready." " "Great DJ" by The Ting Tings " "We gotta make a list." "Clear the desk." "What kind of a list?" "Pros and cons list." "My mother used to make this all the time to kinda decide whether she's gonna divorce her ex-husbands." "And that's the model we're gonna follow?" "Well, she had very successful divorces." "Pro." "Hold on." "Why con gotta be black though?" "It's not a race thing." "It's just..." "Red is happy." "Red is like pro..." "No, red represents the devil." "Fine." "I'm writing down "color weirdness" ." "The work is really good but the show is uneven." "This is, uh..." "This is weird." "I think it's weird." "Hey, someone spent some money, huh?" "Yes, she's spent a small fortune." "Really?" "God, I would kill to have a piece like this when I have my own gallery." "Me too." "Do you know who Kelly Wentworth is?" "A rich divorcée." "She walked away with 80 million dollars of Dick Wentworth's fortune." "And decided to spend it on making herself a presence in the art world." "Do you like my vanity project?" " It's lovely." " Thank you." "Oh, it was 89 million." "Bette Porter?" "Kelly Wentworth." "Please to meet you." "It's really a spectacular space." "You've been here a long time?" "You really don't remember me?" "Juicy fucking Freemont?" "!" "Jesus!" "Oh my God!" "I swear to fucking God, you look better than you did in college." " Bitch!" " Look at that biatch!" " The blond looks so good on you." " Thank you." "Look at your body." "Are you still a runner?" "I mean, sometimes." "Not, not really often." "God, what the hell are you doing in L.A.?" "I thought you were married to New York forever." "Well, I thought I was married to Dick Wentworth forever." "Holy fucking shit!" "I'm so, so happy to see you." "Oh my God..." "Oh, God, I'm sorry." "This is Tina Kennard, my partner." " Hello." " Still gay, hey, Porter?" "Yeah, well, I lack of imagination in some areas." "Not many." "This is Kelly Frimont." "The Kelly Frimont!" "Oh, Kelly Frimont, the college roomate!" "Right." "Well, I've heard a lot about you." "Did you tell Tina about you and me?" "Well, I told her that you let me kiss you once and were so ceased by a deep and abiding homosexual panic that you moved out of the house immadiately." "She got over me in two minutes." "Ten." "This piece is beautiful." " I know." " You have great taste." "I love the tonality." "I just ordered a roadster in this colour." "I did!" "Well, we're gonna go see the rest of the show." "Okay, but, don't leave without saying goodbye." " I will." " We will." " It was nice to meet you." " You too." ""Killalady" by Justine Electra " "There is way more cons than pros." "Alright, let's say this, like "doesn't cook with pepper"" "ever, right?" "It, uh, it shouldn't be, it shouldn't count as many points as, like," ""makes me wanna be a better person"." "Right?" "It's pretty good." "So we should do it on a point system." "Like," ""doesn't cook with pepper" should get what, two points, and..." " Like a point system?" " Yeah, like a point system exactly." "And then "is spontaneous", I just pick that one 'cause I," "I really appreciate that about you." ""Likes to get spanked" you should add." "Okay, this would get like 8 points." "Okay, that is so smart." "Very smart." "I mean, you're smart." "You're smart." "Give me this." " How many points?" " Oh, nine." "You get 9." "Oh yeah, the pros are so winning now." "So, call me and we'll arrange a studio visit." "Just one of the many things I love about the art world." "Yeah, well, he's a terrible artist." "Luckily I'm not interested in his work." "Oh, you guys aren't going, are you?" " Yeah, we are." " Yeah." "Well, we have to make a plan, lunch, diner, whatever." "I really wanna pick that brain of yours." "Yeah, well, the first thing I would tell you is not to sign an artist that you wanna fuck." "That comes from firsthand experience?" "I read your article on the Art Journal." " It was amazing." " Oh, thank you!" "Do you mind?" "No, I think you should." "Excuse me." "Just a second." "The cover?" "Incredible." "I loved your lips." "I need to talk to you." "I'm sorry." "Just a second." "Now what?" "James has been trying to schedule an appointment with you and you haven't come back to him." "I've been busy." "Do you realise that you report to me?" "And if I ask to see you, then you make it happen." "I don't report to you, Bette." "I don't report to anybody." "You have until tomorrow." "Or what?" "I knew about it if I couldn't choose my T.A." "I saw her." "It was like one after the next, little moths to a flame." "She burnt everyone of them." " Really?" " You know." "You're ready?" " It was really great to see you." " You too." " You too." " Good luck with the gallery." "Thank you." "I'll see you soon." "Nice to meet you." "MUSIC" "Yeah, you two are a great pair." "No alcohol, no sex." "It's..." "Well, that's what you have to do to keep your sanity and not to mention your shirt on in this business." "But, I mean, I'm not a complete nun." "I have the occasional drink." "I even have sex every now and then." "Alright, just not with people you like?" "Yeah, that's my new M.O." "All business, no attachment." "What the fuck?" "What?" "Twelve o'clock, the female in the lesbo sandwich." "Oh, you've gotta be kidding me!" "Dylan, did she come out of the closet?" "That girl used to be straight?" "Well, she wasn't gay back when she was fucking Helena." "Wow, looks like someone's carpet is about to get munched." "You're okay?" "Of course, why wouldn't I be?" "You're not freaking out?" " No, there's no reason to." " But that's the woman who extorted you for sexually harassing her!" "What is wrong with you?" "I'm just saying." "Of all the gin joints in all the world?" "I've been calling you." "I know." "My phone broke." "I wanted to say I'm sorry for the way I reacted." "You just caught me by surprise." "I..." "I've started to think about it." "What do you think about having the baby?" "Fuck off!" "Don't you wanna be a couple of West Hollywood fag dads?" "I don't know." "How we're fucking handle this?" "We can handle it." "We can." "We both make a decent living." "We love each other." "We've said we want to spend our lives together." "I'll have to think about it." "Sorry I kicked you in the balls." "I'm sorry I knocked you up." "Oh my God, she was so irritating." "Did you hear her?" ""Look at your body"!" ""Are you still a runner"?" "While you were talking to Jodi, she asked me if you were still a player." "I was never a player." "That's not what Kelly said." "She said no matter whether you're in a relationship or not, you've always had at least two other women on the side." "Kelly was too busy fucking every male professor to pay attention to what I was doing." "Oh and another thing, she's sorry she didn't take you up on that offer 20 years ago." "Did you tell her we're exclusive?" "No, I didn't, Bette." "I figured if some gorgeous woman from your past come along, talking about how hot you are and how sorry she is she didn't sleep with you," "I'm not gonna be the one to tell her that you're not available for a redo." "But you know that I'm not." "But you were flirting." "I was not flirting." "Yes, you were." "You can't help it." " What?" "You never flirt?" " Of course I flirt, but it's different for you." "It feeds you." "You feed off people wanting you." "And they do want you." "It's..." "It's like blood to a vampire." "So now, I'm a vampire?" "I love you." "I don't wanna deprive you of something that's so fundamental to who you are." "You need to trust that I know who I am." "And I know what to do with it." "I don't know what that means." "It means that everyone else can fuck off because I only want you." "I only wanna be wanted by you." "MUSIC" "Thank you." "Thank you, gorgeous." "Thank you, thank you, thank you, thank you." "You're with me?" " What?" "What are we gonna do?" " Get my back." "What did she do to Helena?" "Wait a minute." "Right now, I wanna tell her where she gets off messing with my friend." "I'm gonna tell her." "I'm so telling her." "Really..." " Really?" " Excuse me?" "I mean, come on, the hair." "The hair... and the documentaries!" "It's like..." "I'm... not... gay!" "Yeah, it's a good one." "A good one." "I got this." "She's got it." "You look, you look amazing." "Can we talk?" "Okay, so basically, that skankful Dylan Moreland almost ruined entire Helena's life." "First, she pretended to be in love with her, okay?" "So she and her boyfriend could sue her for sexual harassment and extort million of dollars from her." "Hi, we were..." "Sorry, dude, we just left." " Can you believe it?" " Get me a Pellegrino." "So, are you aware that this is my club?" "No, I just came back into town and, I mean, I heard that this was the best girl club in L.A." "And you were looking for a girl club, a lesbian girl club?" "Yes, I mean, you know." "Obviously, you, you helped me with that." "I mean, I finally figured it out, right?" "Good." "I just..." "I can't begin to tell you about how sorry I am about everything, about the way I behave, the way I treated you." "And I don't expect for you to care about my life at all right now." "I..." "I certainly don't expect for you to care that I've," "I've never stopped thinking about you." "Ever." "And wishing that I'd met you at a different time in my life." "I can go if you want me to go." "No, it's fine." "Look, I only came over because it would be akward for me not to say anything, especially since it's my club." "Stay, stay, have a good time." "Enjoy it." "Be with your friends." "So, her mother get so mad she cuts Helena off, so she has to come live with me" " and become a cook!" " I was a caterer." "Which was a disaster, and let's face it" "Helena is used to a certain standard of living." "So she meets this shady high-roller lady." "they hook up but she uses Helena and takes all her money and when Helena takes it back, and we still don't know where she buried it, she gets arrested and has to share a cell with some killer!" " She was in for text fraud." " Alright." "So, her mother can't take it anymore, she bails Helena out, but she doesn't wanna live under her mother's thumb anymore." "So she springs Dusty from jail, they go to Tahaa which she doesn't ever want to talk about, so it couldn't have been that great, right?" "Right." "And her mother gets stung by a jellyfish, all because of this woman." "Want me to kick her ass?" "Thank you." "You're a better person that me." "I'd have to beat a bitch down" " if she tried to do that shit to me." " Are you okay?" "I'm perfect." "And don't even get me started on her kids, 'cause where did they go?" "I don't give a fuck who's idea it was." "You took part." "You manipulated my emotions, you used me, and you humiliated me, and you've got to be fucking insane thinking you could just prance in here act as if nothing ever happened, tell me that you're happy," "tell me that you're out of the closet, tell me that you're oh so sorry for destroying my fucking life." "Fuck you!" "Thank you!" "Now I know you care." "I need my stuff." "Open the door." "Thanks." "So that's it?" "You're done trying?" "I'm out." "I don't see the point with you anymore." "Shane, you know that it was you, right?" "When I said that you broke my heart?" "I was talking about you." " "From the Valley to the Stars" by El Perro Del Mar " "You know, when I said it I felt like my, my, my heart was breaking." "I tried to tell you all week how sorry I am." "I'm not ever gonna hurt you like that again." "I also realized that I'm in love with you." "Now I'm like all those stupid girls." "What?" "The negative was stolen from the lab, Tina!" "We have no more film!" "And I'm holding you personally responsible for it." "Jenny, I'm gonna fucking kill you." "On the next all new episode of "The L Word"..." "Homophobia is alive and well." " I'm gotta get fired." " You don't always get rewarded for doing the right thing." "I got punished." "Are you really gonna make this about you right now?" "I'm gonna have to fire you." "Having her around makes you uncomfortable." "That's sexual harassment." "Are you threatening to sue me for sexual harassment?" " We're making a mistake?" " No." "I don't have expectations for our relationship." "Oh my God!" "So you guys are like a couple?"

Emergency declaration allows for broad coordination of state agencies to respond to outbreak WILMINGTON, Del. – Governor John Carney on Thursday issued a State of Emergency declaration to prepare for the spread of Coronavirus (COVID-19). The State of Emergency directs the Delaware Emergency Management Agency (DEMA) and the Delaware Department of Health & Social Services’ Division of Public Health to mobilize state agency resources to assist with Delaware’s response to the virus. The declaration becomes effective at 8:00 a.m. on Friday, March 13, 2020. Governor Carney’s emergency declaration also: Requires the Delaware National Guard to take precautionary and responsive actions to assist with Delaware’s response to the coronavirus; Advises event organizers in Delaware to cancel non-essential public gatherings of 100 people or more, to prevent community spread of coronavirus; Allows the State of Delaware to conduct public meetings electronically to prevent unnecessary public gatherings; Prohibits price gouging, or an excessive price increase of goods or services, during the coronavirus outbreak. “We are taking this situation extremely seriously,” said Governor Carney. “We have been expecting positive cases in Delaware, and for the last two months we have prepared our state’s response in close coordination with the experts at the Delaware Division of Public Health and the Delaware Emergency Management Agency. Today’s emergency declaration will make sure we have the authority and resources necessary to effectively prevent the spread of this virus. “There are things every Delawarean can do to stay healthy. Wash your hands. Cover your cough. Stay home from work or school if you are sick. It’s especially important for at-risk populations, specifically elderly Delawareans, to avoid large gatherings. And we’re advising Delaware organizations to cancel large, non-essential public events to prevent community spread of the coronavirus. We will continue to respond aggressively to this situation in close coordination with state and federal public health experts.” Governor Carney’s emergency declaration WILL NOT: Require schools or businesses to close their facilities; Implement any driving restrictions in Delaware; Close state office buildings. On Wednesday, Governor Carney and the Delaware Department of Human Resources issued guidance to state employees about coronavirus and potential impacts on the state workforce. Full-time and casual/seasonal state employees may be eligible for 14 or 30 days of Paid Emergency Leave if they are forced to miss work due to a coronavirus impact, or to care for a family member. Costs related to diagnostic testing for coronavirus (COVID-19) will be waived for Delaware families who are covered by the state’s health plan. Delawareans with questions about COVID-19 or their exposure risk can call the Division of Public Health’s Coronavirus Call Center at 1-866-408-1899 or TTY at 1-800-232-5460 from 8:30 a.m. to 4:30 p.m. Monday through Friday, or email DPHCall@delaware.gov. For the latest on Delaware’s response, visit de.gov/coronavirus. ### Click here to read the State of Emergency declaration.

Requires Xposed Framework! whether true or not Screenshots: Video: Compatibility: Google Nexus 10 Samsung Galaxy S4 Samsung Galaxy Note II Samsung Galaxy SII running Chameleon (mainly AOKP-based) 2012 Nexus 7 with CyanogenMod 10.2 (covers all CM10.2 devices). 2012 Nexus 7 with stock Google 4.4 LG Optimus L7 HTC One / HTC One (M8) HTC Sensation Sony Xperia Z / Z1 Galaxy S Advance GT-I9070 with CyanogenMod 10.1 (covers all CM10.1 devices). Issues: Download: Source code: Contribute to this! Thanks to: rovo89 for the Xposed Framework. Nottach for his module's source code, it helped with the icon colours. C3C076 for GravityBox, parts of the source code were used for keyboard detection. rovo89 and Tungstwenty, I borrowed some of the UI code from App Settings. Niek Haarman for his ListViewAnimations library. Lars Werkman for Holo Color PIcker. GermainZ for his suggestion on how to determine default icon colour and his many patches GriffinSauce for the icon. Developers! Support development: Inspired by iOS 6/7 and the latest Android 4.4 fake leaks (), implemented by Paranoid Android as manual tinting, and now, an Xposed module with automatic tinting for most apps.This module tints your status bar according to the currently shown activity, it also allows you to customize the tint color yourself on a per app basis. You'll need to do that for apps where auto detect doesn't work.It also allows you to have the KitKat gradient on devices that support this module, use 66000000 as the color to achieve that.All Jelly Bean and KitKat devices should be compatible. Some ROMs may introduce issues, if they're open source, I can look into it, if not, post a reply with a deodexed copy of your SystemUI.apkTested on:To report an issue, use Github, I can't track this thread due to how big it's become:Tinted Status Bar is licensed under GPLv3, including any parts of it in any of your code requires you to release the source code of it.I can't add default colours for all the apps that aren't auto detected. You can contribute to a list of colours that look great on the app.The quickest way to get the colours is to take a screenshot of the app and use an app like "Color Picker" from the store and using that to get the colour.Feel free to ask devs to add support for this!Get and add your colours here: https://docs.google.com/spreadsheet/...EE&usp=sharing Google Drive doesn't support transparency, so if you want to make a cell coloured, remove the first "ff"s, colours should be in the format "RRGGBB". My mod takes "AARRGGBB" too though.Here's the API, you can easily support this in your apps by using this class in your project: https://github.com/MohammadAG/Xposed...arTintApi.java If you found this mod useful, consider donating with PayPal or buying the Play Store donation package

Spotlight on Tdap₅ vaccine (Covaxis®) as a single-booster immunization for the prevention of tetanus, diphtheria, and pertussis: in children (aged ≥4 years), adolescents, and adults. Covaxis® (also licensed as Triaxis® or Adacel® in individual countries) is a Tdap₅ (i.e. combined tetanus toxoid, reduced diphtheria toxoid, five component acellular pertussis [namely detoxified pertussis toxin, filamentous hemagglutinin, pertactin, and fimbriae types 2 and 3]) vaccine for the prevention of diphtheria, tetanus, and pertussis. It is approved for use in Europe as a single intramuscular booster dose in children (aged ≥4 years), adolescents, and adults, and in the US it is approved for use in individuals aged 11-64 years. In large, randomized, controlled clinical trials conducted in the UK and North America, a single intramuscular booster dose of Covaxis® induced robust immune responses for all of its component antigens when given to children (aged ≥4 years), adolescents, and adults. In addition, Covaxis® vaccine was safe and generally well tolerated in terms of solicited and unsolicited local injection-site and systemic adverse events, most of which were of mild intensity and resolved without sequelae. Furthermore, the immunogenicity of each individual component and the reactogenicity of Covaxis® vaccine in children, adolescents, and adults was generally similar to that of comparator vaccines. Despite being a vaccine-preventable disease and having >90% primary vaccination coverage worldwide, pertussis remains uncontrolled, particularly amongst adolescents and adults. Given the changing epidemiology of pertussis and the requirement to reduce infection in adolescents and adults (including healthcare workers) and thereby prevent transmission of the disease from these individuals to very young infants, the new 'cocoon strategy' recommended in current vaccination guidelines has become a key strategy in the management of morbidity and mortality associated with pertussis. This strategy focuses on the immunization of healthcare workers, and the parents and family members of infants who are too young to have undergone primary immunization, so as to prevent the transmission of pertussis to these young at-risk infants. The implementation of the 'cocoon strategy' may finally give countries the ability to control pertussis infections in these at-risk infants and ultimately provide the desired herd immunity against pertussis. In line with this strategy, a booster dose of Covaxis® vaccine provides a valuable option to reduce pertussis morbidity and mortality, and to maintain seroprotection against diphtheria and tetanus in children (aged ≥4 years), adolescents, and adults.

This specification relates to backup power sources. Data center facilities are often used by providers to deliver Internet services to users. A data center, such as a server farm, typically contains thousands of server processing devices. Within the data centers the processing devices are arranged in racks, and each rack may contain dozens of servers. Assuming the power required for a single rack may be in the order of 50 kW, and that there may be hundreds of racks in a data center, it is not uncommon for a data center to have a power requirement on the order of megawatts. Data center facilities range in critical levels according to the cost of down time to a business that utilizes the particular data center, the cost of ownership for the data center, and other factors. Typically, a data center facility includes redundant power systems to provide power to the server in the event of a power anomaly (e.g., blackout from utility provider, unstable utility power, etc.). Data center facilities utilize in-rack batteries and diesel generators to provide back-up power during a power anomaly. In-rack batteries are sized as small as possible to cover short-durations and minimize cost and size of the battery. The diesel generators are designed to provide power for longer—duration power anomalies. The determination of which source provides power during the power anomaly is dependent upon the duration of the power anomaly.

Q: Is it possible to set custom status message (in utf-8) in http status header? I want to change http status header with my own status message. For example, change HTTP/1.1 200 OK to HTTP/1.1 200 custom status message in utf-8. To do it, I send some headers with php: Content-Type: text/html; charset=UTF-8 HTTP/1.1 200 custom status message in utf-8 But in Chrome developer tools I see status message in wrong encoding, for example Status Code:200 УпÑ! ЧÑо-Ñо. Is it possible to fix this? A: (a) the encoding is undefined, so it's not worth trying non-ASCII, furthermore, (b) the reason phrase does not exist anymore in in HTTP/2.

Important unanswered questions concerning B12-dependent enzymic processes are: What are the conformational changes which promote the rate of homolytic cleavage of the Co-C bond of coenzyme B12 by a factor of 10-10 and which favor homolytic over heterolytic cleavage in B12 holoenzymes? Why is the Co- N(DMBz) bond so long and what is the role of DMBz in these processes? If the contribution of the enzyme to rearrangement processes (e.g. methylmalonyl-CoA to succinylCoA) is restricted to insuring the existence of long-lived substrate radicals, how do the enzymes prevent radical combination with B12? These and other questions have not been fully answered for several reasons. The B12-dependent enzymes are large, making X-ray and some spectroscopic studies difficult. The cofactor generally lies tightly bound in a protected enzyme pocket inaccessible to probe reagents. Only four alkylcobaltcorrin X-ray structures including coenzyme B12 and methyl B12 have been reported. The molecules are complex and unique and spectroscopic methods are limited by this complexity and by a lack of background data. Therefore, the conformations of well studied coenzyme analogues are unknown. One consequence of this limited information is that there are few clear relationships between structure and spectra. Also, there remains an inadequate background with which to assess the steric factors leading to Co-C bond cleavage. To continue to address these questions, we propose a three-pronged approach. Detailed studies of (i) alkylcobaltcorrins, (ii) synthetic organocobalt species, and (iii) ribonucleotide reductase (RR) are contemplated. The range of conformations possible for alkylcobalamins will be defined via the synthesis of modified or sterically strained alkylcobaltcorrins (cobalamins, cobinamides and other side chain- modified derivatives) and additional organocobalt compounds with sterically or electronically modified equatorial ligands based on the Cosaloph and "Costa" systems. The effect of structural changes induced in these systems will be assessed by X-ray crystallography, modern spectroscopic methods (CD, 2D and HMQC NMR, Raman) and by reaction rates and mechanistic studies (DMBz dissociation, ligand exchange). Application of some of these methods has produced a wealth of information and provided new insight during this grant period. These methods will be extended to the study of RR. RR is relatively small, with a loosely bound accessible, B12 site and a mechanism of action related to the Fe enzymes. Thus, RR has special advantages and significance. Steric strain in the alkyl linkage between Co and adenine in coenzyme analogues will also be varied and the interaction of the analogues and coenzyme B12 with RR will be investigated. For NMR studies, we will employ cobalamins containing isotopically enriched sites. The spectroscopic (CD, vis, NMR (2D, HMQC)), background to be developed will be generally useful in studies on other B12 holoenzymes and on B12 transport systems.

CSS Tools – Mega Collection - ayushunibrain https://github.com/abhiprojectz/CSS-Generator ====== ayushunibrain Css generator is a mega collection of awesome css tools!

Q: Relationship between two tables and their primary keys I am little confused if I should go in this way I have tables like | account | | Acc_registration_Info | | AccID_PK | | AccRegInfo_PK | | | | | | | | | Should I connect them between both primary keys? Also how to secure them in case of mismatching IDs? I am trying to follow by Advanture Works DB structure, but this is little hard to understand, some of AW DB tables are splitted as hell (like users and their passwords in different tables). I don't really feel confident about making so much tables and relate them one-to-one by PKs... My other hard decision is to connect Shop table with details shop informations table by PK, etc. etc. On the other hand making too much non-primary columns to connect other tables doesn't look awesome A: i think you have to make one primary key of a table the foreign key of the ather, that's how it work: | account | | Acc_registration_Info | | AccID_PK | | AccRegInfo_PK | | #AccRegInfo_FK | | | | | | | like that if you want to know the reg info for an account you have just to pick the #AccRegInfo_FK of that account (in account table) and compart it to AccRegInfo_PK (in reg info table) and you ll get what you wnat , and of course what is called in relation databases joint

STT in Übernahme von No Tricks Zone, Pierre Gosselin Wie in Südaustralien, so geht es in auch Deutschland: Der Versuch, mit Sonnenschein und Brise ein Industrieland zu versorgen, hat zu explodierenden Energiepreisen, Armut und Mangel an Energie und zu einem Versorgungsnetz am Rande des Zusammenbruchs geführt. Der Blick von außen auf das deutsche Debakel von NoTricksZone, Pierre Gosselin, der hier einen Bericht auf Focus zusammenfasst: Manager Magazin berichtet, wie Erneuerbare Energie Deutschland in einen wilden Abwärtsstrudel führt Es ist das Paradoxon der deutschen Energiewende: Die Kurse an der Strombörse sind niedriger als je zuvor, doch die Konsumenten bezahlen inzwischen die höchsten Preise – ohne Begrenzung im weiteren Anstieg. Darüber hinaus, je mehr grüner Strom ins Netz eingespeist wird, desto mehr Kohle wird verbrannt. Kommunistische Staatsplanung Wenn die Beschreibung des heutigen deutschen Stromnetzes wie eine Horrorgeschichte des kommunistischen staatlich geplanten Managements klingt, dann weil es genauso so ist. Und überraschenderweise ist die ganze Industrie auf dem besten Weg zu einer sozialistischen Kernschmelze. Dafür sorgt die ehemalige DDR-Kommunistin Angela Merkel zusammen mit ihren grätenlosen westdeutschen CDU-Kollegen, von denen viele eifrig bei der Abzockerei mitmachen und das Land in einen Abwärtsstrudel reißen, ohne das einer aussteigen kann. Heute klärt uns der deutsche Manager Magazin über das grüne Stromnetz des Landes auf – mit Blick in die Leitwarte des Netzbetreibers Tennet. Manager Magazin nennt es das Herz der deutschen Energiewende. Hier entscheidet ein Team von Ingenieuren, wie viel wovon in die verschiedenen Netze eingespeist wird und welche Windparks liefern dürfen und welche nicht. Balanceakt Heute ist die Stromversorgung zu einem herausfordernden Balanceakt geworden. Betriebsleiter Volker Weinreich: „Wir müssen immer öfter eingreifen, um das Stromnetz stabil zu halten. Wir kommen immer näher an die Grenze heran. “ Der Grund für die Netzinstabilität: die wachsende Menge an schwankender Erneuerbarer Energie aus Wind und Sonne. Manager Magazin schreibt, dass es immer vier Mitarbeiter in der Tennet-Zentrale außerhalb von Hannover sein müssen, die die Netzfrequenz überwachen, um sicherzustellen, dass sie nahe bei 50 Hz bleibt. Zu viel Abweichung und Instabilität würde die „schlimmste denkbare Katastrophe bedeuten: Netzkollaps und Stromausfall“. Weitere Preissteigerungen in der Pipeline Deutschland hat inzwischen ein riesiges Überangebot an Strom der in das Netz flutet und damit sind die Preise an den Strombörsen auf nie zuvor gesehene Werte gesunken. Dennoch sind den erneuerbaren Stromerzeugern in den meisten Fällen außergewöhnlich hohe Energiepreise über einen Zeitraum von 20 Jahren garantiert. Das bedeutet, dass die Versorger Energie zu einem hohen Preis hereinnehmen müssen, aber dafür nur sehr wenig an den Börsen bekommen können. Das deutsche Wirtschaftsmagazin schreibt dann, dass wieder die Verbraucher die Last tragen müssen, da die Einspeisezuschüsse um weitere 0,53 Cent-Euro im Jahr 2017 klettern, so dass der Einspeisetarif für Stromverbraucher auf 6,88 Cent -Euro für jede Kilowattstunde klettert. Bayern steht vor dem industriellen Stromausfall Ein weiteres großes Problem ist, dass Deutschland bis zum Jahr 2022 die verbleibenden Kernkraftwerke abschaltet, eine Quelle auf die sich Deutschlands industrieller Süden verlässt. In der Zwischenzeit werden die notwendigen [genannten] Übertragungsleitungen zur Beförderung von Windenergie von der Nordsee nach Süden wegen starker Proteste nicht gebaut und bedingen dadurch Engpässe. Damit ist Bayerns Schwerindustrie gefährdet. Manager Magazin schreibt, dass die Übertragungsleitungen voraussichtlich nicht vor 2025 komplettiert sein werden! Im 3. Teil berichtet Manager Magazin, dass der Betrieb eines Stromnetzes aufgrund der erneuerbaren Energien komplexer und kostspieliger geworden sei und die Energiewende zu einer „ökologischen Torheit“ geworden sei. Weinreich beschreibt, wie an stürmischen Tagen Windparks gezwungen sind, herunterzufahren, um das Netz nicht zu kollabieren. Und je mehr Windkraftanlagen online kommen, desto öfter müssen Windparks abgeschaltet werden. Dies macht sie noch ineffizienter [aber ihren Betreibern ist das egal – die Vergütung wird trotzdem bezahlt, der Übersetzer]. Damit arbeiten nicht nur Wind- und Solaranlagen auf Teilzeitbasis, sondern jetzt auch die konventionellen Kraftwerke – alles nach den Launen des Wetters. Viel zu oft liefern sie Energie nur weit unterhalb der Nennleistung der Höchstleistung. Die Kosten dieser Ineffizienzen werden an die Verbraucher weitergegeben. Zehntausende Verbraucher mit niedrigem Einkommen wurden in die „Energiearmut“ gezwungen. Zitat: Der Verlust an Konkurrenzfähigkeit ist erschreckend. Wenn die Leute entscheiden, ob sie in Europa oder USA investieren, das erste an was sie denken sind die Energiekosten – Paulo Savona, Vorstand der Fondo Interbancario, Italien 1400 Netzeingriffe Weinreich berichtet, dass das Netz so instabil ist, dass es 2015 für Tennet notwendig war, etwa 1400 Mal einzugreifen. Mit den alten konventionellen Krafttagen waren es nur „ein paar Mal im Jahr“. In Teil 4 berichtet Manager Magazin, dass alle Netzeingriffe und Abschaltungen von hochlaufenden Windparks die Verbraucher „Milliarden kosten“. Allein im Jahr 2017 schätzt Tennet , werden die Netzkosten um 80% steigen, weitere 30 Euro mehr an Belastung pro Jahr für jeden Haushalt bedeutet. Das Geld fließt natürlich von armen Konsumenten die sich nicht wehren können in die Taschen wohlhabender Solar- und Windparkbetreiber und Investoren. Kein Wunder, dass viele Experten die deutsche Energiewende als die größte Vermögens Umverteilung von unten nach oben bezeichnen, die je erfunden wurde. Erschienen auf No TricksZone am 28.12.2016 http://notrickszone.com/2016/12/28/manager-magazin-reports-how-renewable-electricity-is-taking-germany-on-a-wild-ride/#sthash.VaUUtBC6.qddOw0GC.dpbs gefunden durch https://stopthesethings.com/2017/01/13/germanys-energiewende-nightmare-grid-collapse-looms-due-to-erratic-wind-solar/ Dort ein Gedanke von Brian Johnston: January 15, 2017 at 9:29 pm … im Artikel steht: Deutschland hat nun eine Überproduktion an Strom Zuleitungen um überschüssigen Strom von Norden nach Süden zu leiten kommen nicht voran. 1) Antwort: Richtiger ist, dass Deutschland eine Überversorgung mit nutzlosen, aber gefährlichen Oberwellen aufweist. Das führt dazu, dass die Situation ständig überwacht werden muss 2) Warum geben Sie Milliarden für Übertragungsleitungen aus, um unbrauchbare und gefährliche Oberschwingungen nach Süden zu transportieren? Übersetzt durch Andreas Demmig

Anterior cruciate ligament bundle measurement by MRI. An accurate in vivo method of measuring dimensions of the anteromedial (AM) and posterolateral (PL) anterior cruciate ligament (ACL) bundles has not been established. The purpose of this study was to measure each individual bundle using double oblique axial MR imaging of the ACL, to compare this with cadaveric measurements, and to investigate the range of measurements seen in normal subjects. In five cadaveric knees, measurements obtained of the proximal, middle, and distal segments of each ACL bundle from double oblique axial MR images were compared with direct measurements following anatomical dissection. Thereafter, the size of both bundles from 24 normal knees was measured using an identical MR technique. Inter-observer variation was calculated using intraclass correlation. ACL bundle measurement in the cadaveric knees had a strong correlation (r = 0.93) with measurements obtained following anatomical dissection. No significant difference existed between measurements obtained from cadaveric knees and living normal subjects (p > 0.05). Interobserver correlation for MR measurements was excellent (R = 0.92-0.93). Overall, the long and short axis of the AM bundle were significantly larger than those of the PL bundle (p < 0.05). Also, men showed significantly larger AM and PL bundles than women (p < 0.05). Bundle size was not related to age or knee dominance. The individual ACL bundles can be accurately measured on double oblique axial MR imaging. The AM bundle is larger in caliber than the PL bundle. Both bundles are larger in men than in women and there is no significant side-to side difference.

# -*- coding: utf-8 -*- # # This file is part of EventGhost. # Copyright © 2005-2020 EventGhost Project <http://www.eventghost.net/> # # EventGhost is free software: you can redistribute it and/or modify it under # the terms of the GNU General Public License as published by the Free # Software Foundation, either version 2 of the License, or (at your option) # any later version. # # EventGhost is distributed in the hope that it will be useful, but WITHOUT # ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or # FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for # more details. # # You should have received a copy of the GNU General Public License along # with EventGhost. If not, see <http://www.gnu.org/licenses/>. import errno import os import time from docutils.core import publish_parts from jinja2 import Environment, FileSystemLoader from os.path import abspath, join # Local imports import builder class BuildWebsite(builder.Task): description = "Build website" def Setup(self): if self.buildSetup.showGui: self.activated = False else: self.activated = bool(self.buildSetup.args.sync) def DoTask(self): buildSetup = self.buildSetup menuTabs = (HomePage, DocsPage, WikiPage, ForumPage, DownloadPage) env = Environment( loader=FileSystemLoader( abspath(join(buildSetup.dataDir, 'templates')) ), trim_blocks=True ) env.globals = { "files": GetSetupFiles(join(buildSetup.websiteDir, "downloads")), "MENU_TABS": menuTabs, } env.filters = {'rst2html': rst2html} for page in menuTabs: path = os.path.abspath(join(buildSetup.websiteDir, page.outfile)) try: os.makedirs(os.path.dirname(path)) except os.error, exc: if exc.errno != errno.EEXIST: raise env.get_template(page.template).stream(CURRENT=page).dump(path) class FileData(object): def __init__(self, path): self.path = path self.target = os.path.basename(path) parts = self.target.split("_") self.name = " ".join(parts[:2]) fileStat = os.stat(path) self.time = time.strftime("%b %d %Y", time.gmtime(fileStat.st_mtime)) self.size = "%0.1f MB" % (fileStat.st_size / 1024.0 / 1024) class Page(object): def __init__(self): pass class HomePage(Page): name = "Home" target = "/" outfile = "index.html" template = "home.tmpl" class DocsPage(Page): name = "Documentation" target = "/docs/" outfile = "css/header_docs.html" template = "header_only.tmpl" class DownloadPage(Page): name = "Downloads" target = "/downloads/" outfile = "downloads/index.html" template = "download.tmpl" class ForumPage(Page): name = "Forum" target = "/forum/" outfile = "css/header_forum.html" template = "header_only.tmpl" class WikiPage(Page): name = "Wiki" target = "/mediawiki/" outfile = "css/header_wiki.html" template = "header_only.tmpl" def GetSetupFiles(srcDir): if not os.path.exists(srcDir): return [] files = [] for name in os.listdir(srcDir): if name.lower().startswith("eventghost_"): if name.lower().endswith("_setup.exe"): path = join(srcDir, name) fileData = FileData(path) files.append(fileData) def Cmp(x, y): x = x.target.split("_")[1].replace("r", "").split(".") y = y.target.split("_")[1].replace("r", "").split(".") x = [int(s) for s in x] y = [int(s) for s in y] return cmp(x, y) return list(reversed(sorted(files, cmp=Cmp))) def rst2html(rst): return publish_parts(rst, writer_name="html")["fragment"]

Lewis acid catalyzed intramolecular Diels-Alder reactions of acyclic (Z)-substituted 1,3-dienes. Lewis acid catalyzed intramolecular Diels-Alder reactions of trienes (E,E,Z)-1a-d, (E,E,Z)-4a-d, and (E,Z,Z)-7a,b are described. Trienes containing enal or enone dienophiles cyclize in excellent yield under mild conditions using substoichiometric amounts of MeAlCl(2), in most cases with high levels of diastereoselectivity. The thermal IMDA reactions of 1a, 4a, and 7a require forcing conditions and proceed in low yield with reversed stereoselectivity in the cases of 1a and 4a.

A robot has been known in which a vertical operation mechanism and a horizontal mechanism are combined in order to move a work such as a large-sized liquid crystal substrate up-down or horizontally, and the vertical operation mechanism takes charge of the up-down operation and the horizontal operation mechanism takes charge of the horizontal operation (For example, Patent Document 1, Patent Document 2, and Patent Document 3). Patent Document 1: JP-A-2000-24966 Patent Document 2: JP-A-2002-326182 Patent Document 3: JP-A-11-123675

I dusted off my 'Gary Moore - Still Got The Blues' CD & ran it through my M3s. I forgot what a stellar blues guitar player that he was. Although the content of the whole album is great, 'Still Got the Blues & 'Midnight Blues' (the one that made him famous) stand out for me. It's not the most dynamic mix, but quite entertaining if you like electric blues. I thought that I'd post this here as well - to enable it to be more easily found: Well, I dusted off one of my vintage CDs that I use for evaluating my music systems - TELARC's Time Warp - to run through my newly upgraded audio system. Amazingly it is still available despite being released in 1984. This CD was recorded when digital was still in its infancy & according to the liner notes: "During the recording of the digital masters & the subsequent transfer to disc, the entire audio chain was transformerless. The signal was not passed through any processing device (ie, compression, limiting, or equalization) at any step during production". "The digital information was not subject to any analog intersteps, thus preserving the integrity of the original digital master". This indeed is an uncommon recording as most are not done without manipulation of some kind these days. If you want to hear a production that has been absolutely not altered, this is a good one. It is really too bad that TELARC is no more (swallowed up by Concord). If you get it, be sure to heed TELARC's Warnings - "Damage could result to speakers or other components if the musical program is played back at excessively high levels". That warning probably would still be valid today although our modern gear is more robust. I like that video/song all right. Pleasant enough. Where'd you hear about them? Also, I'm not sure about ume. For some reason, it's not ringing a bell. They were on a short music video on a local channel. Strange tune. The rest of their stuff sounds like garbage to me though. The lead singer and guitarist of UME is a hot little blond gal, so I just assumed you had their CD. I got their Phantom's CD a while ago and like it. http://www.youtube.com/watch?v=1mfB0X0-E-c

Billionaire returns top Australian award February 25, 2008 10:00am An Australian billionaire philanthropist returned the highest civic honor awarded by his country. Richard Pratt, who last year was fined a record $33 million after his cardboard company, Visy, was found to have been engaging in price fixing, sent back the Companion of the Order of Australia and resigned his membership in the Order. “Mr Pratt has the highest respect for the honors system and for all its many worthy recipients,” his spokesman said. “However, given his understanding that the honors committee was considering whether he should retain his honors, he had no wish to involve the committee or the honors themselves in any form of controversy. “Mr. Pratt’s decision will have no effect whatsoever on the philanthropic activities of the Pratt Foundation or the other many community and business activities in which his family and their company is involved.” The Pratt Foundation donates more than $11 million a year, much of it to Jewish causes in Australia and charities in Israel. Pratt, who is worth an estimated $5 billion, according to Business Review Weekly magazine’s annual rich list, in November donated $55,000 to the AFL Peace Team initiative by the Peres Center for Peace. He also provided $2.78 million in funding for the Park of the Australian Soldier due to open in Beersheba later this year. Only 30 or so Australians are known to have returned their medals or have had them rescinded.

The cases are piling up. Canadian Robert Schellenberg faces execution on drug charges after an unusually abrupt, accelerated and public retrial this week in a Chinese court. Two Canadians, Michael Kovrig and Michael Spavor, are being held by China for espionage — not yet charged, deprived of sleep and interrogated daily for more than a month now, according to Canadian diplomats. Other Canadians in China have complained of surprisingly harsh treatment for minor infractions. None of this violates Chinese law, which bends easily to Beijing's political objectives. But observers say it signals a new level of aggressiveness for a rising power quite prepared to throw its weight around when other nations' actions don't match its world view. "Death-threat diplomacy" is what Donald Clarke called it on his blog. He's a professor of law at George Washington University Law School and an expert on the Chinese legal system. Clarke said Beijing's actions against the three Canadians, underlined by Schellenberg's sentence, reinforce the message that "China views the holding of human hostages as an acceptable way to conduct diplomacy." Clarke followed the Schellenberg case closely and found many aspects out of the Chinese norm, from the speed of the retrial to the high-profile way it was covered by foreign and Chinese media, to the way a 15-year jail sentence suddenly turned into the threat of execution at the retrial. He says fewer than two per cent of appeals in criminal cases in China are sent to a retrial. Huawei chief financial officer Meng Wanzhou is escorted by a member of her private security detail while arriving at a parole office in Vancouver on Dec. 12. Neither Beijing nor Ottawa has drawn a public link between her case and the death sentence for Robert Schellenberg. but many experts say there is no doubt. (Darryl Dyck/Canadian Press) China's aim seems clear: to pressure Canada into releasing Huawei executive Meng Wanzhou, who was arrested while changing planes in Vancouver last month on an extradition request from Washington. Legal action against Canadians in China ramped up soon after. Beijing insists she has been "unjustifiably detained," according to official statements. Neither Beijing nor Ottawa has drawn a public link between the cases, but many experts, including Clarke, say there is no doubt. Indeed, China's ambassador to Canada Lu Shaye wrote a column in the Hill Times, an Ottawa publication, comparing the cases. "It's understandable that these Canadians are concerned about their own citizens. But have they shown any concern or sympathy for Meng after she was illegally detained and deprived of freedom?" asks Lu. He says they have not, because of "white supremacy." There has been outrage in China as well, in both English- and Chinese-language statements. The state-run tabloid Global Times, which sometimes reflects official thinking but always shows indignation, called Canada "rude" for its efforts to enlist international allies to push back against China. "Unreasonable pressure from outside public opinion means nothing to China," an opinion piece said this week. In this image taken from a video footage run by China's CCTV, Schellenberg attends his retrial in China's Liaoning province on Jan. 14. Schellenberg's death sentence on drug charges is an example of 'death-threat diplomacy,' says Donald Clarke, a professor of law at George Washington University Law School. (CCTV via Associated Press) The official reaction has also been unyielding. Chinese Foreign Ministry spokeswoman Hua Chunying rejected Prime Minister Justin Trudeau's complaints about China's "arbitrary" application of its laws as the reason for the Schellenberg death penalty verdict and for Canada's increasing the level of warnings to travellers. She called the remarks "irresponsible." She also said Trudeau was "making himself a laughingstock with specious statements." Personal attacks like these against leaders of countries China normally considers friendly are unusual. But the indignant tone has been increasingly common under the leadership of Chinese President Xi Jinping. His message has been strongly nationalistic, firing up feelings that China doesn't get the respect it deserves and that the Western world is out to get China. The reaction has often been swift and unyielding to comments by U.S. President Donald Trump on trade, to international courts when they rule against China on issues of sovereignty or to other countries when they criticize Beijing for its harsh anti-Muslim policies against Uighurs in the province of Xinjian. In a case that the authorities deem sufficiently important, the courts will do as they are told. — Prof. Donald Clarke "It's a clear demonstration of what I call the New China," said former Canadian ambassador Guy Saint-Jacques, who spent four years in Beijing. He said this is a China that is "a lot more assertive and aggressive, that acts in many ways as a bully." In the case of Meng, China has chosen not to direct its anger at the United States, which initiated her arrest, likely because it doesn't want to risk upsetting Washington during sensitive trade negotiations. Throughout the current dispute with Canada and the apparent crackdown on Canadians in China, Beijing has insisted that no such political motivation was possible. Its judiciary, said the Foreign Ministry, is independent and "free from any interference" from politicians. Many experts disagree. "Judicial independence is not even an ideal, let alone a reality" in China, said George Washington University's Clarke. "In a case that the authorities deem sufficiently important, the courts will do as they are told." Will Canada's public complaints, and its efforts to enlist foreign allies, including the U.S., have an impact in Beijing? Probably not, says Saint-Jacques. High-level talks suggested He suggests trying to arrange talks with a high-level body called the National Security and Rule of Law Dialogue, with officials from Canada and China. The group was set up in 2016 and helped influence the release of Canadian Christian Aid worker Kevin Garrett, who was also being held for political reasons. Saint-Jacques also says if the strategy of enlisting allies to help Canada pressure China doesn't work, Ottawa may have to consider more severe moves — anything from cancelling training for Chinese athletes who may be in Canada to prepare for Beijing's 2022 Winter Olympics to, ultimately, recalling Canada's ambassador to China or expelling China's ambassador in Ottawa "if things go very badly." But if Ottawa takes any of those measures, he warned, Beijing will respond in kind. "We have to keep our eyes wide open when we deal with China, and I'm not sure that people understand all that it implies," he said.

/* * **************************************************************************** * Cloud Foundry * Copyright (c) [2009-2016] Pivotal Software, Inc. All Rights Reserved. * * This product is licensed to you under the Apache License, Version 2.0 (the "License"). * You may not use this product except in compliance with the License. * * This product includes a number of subcomponents with * separate copyright notices and license terms. Your use of these * subcomponents is subject to the terms and conditions of the * subcomponent's license, as noted in the LICENSE file. * **************************************************************************** */ package org.cloudfoundry.identity.uaa.oauth.jwt; import org.cloudfoundry.identity.uaa.oauth.jwk.JsonWebKey; import org.cloudfoundry.identity.uaa.oauth.jwk.JsonWebKeySet; import org.springframework.security.jwt.crypto.sign.InvalidSignatureException; import org.springframework.security.jwt.crypto.sign.SignatureVerifier; import java.util.ArrayList; import java.util.Collections; import java.util.List; public class ChainedSignatureVerifier implements SignatureVerifier { private final List<SignatureVerifier> delegates; public ChainedSignatureVerifier(JsonWebKeySet<? extends JsonWebKey> keys) { if(keys == null || keys.getKeys() == null || keys.getKeys().isEmpty()) { throw new IllegalArgumentException("keys cannot be null or empty"); } List<SignatureVerifier> ds = new ArrayList<>(keys.getKeys().size()); for (JsonWebKey key : keys.getKeys()) { ds.add(new CommonSignatureVerifier(key.getValue())); } delegates = Collections.unmodifiableList(ds); } public ChainedSignatureVerifier(List<SignatureVerifier> delegates) { this.delegates = delegates; } @Override public void verify(byte[] content, byte[] signature) { Exception last = new InvalidSignatureException("No matching keys found."); for (SignatureVerifier delegate : delegates) { try { delegate.verify(content, signature); //success return; } catch (Exception e) { last = e; } } throw (last instanceof RuntimeException) ? (RuntimeException) last : new RuntimeException(last); } @Override public String algorithm() { return null; } }

Research Tools Lavoisier Purchased in 1962 through the generosity of Mr. and Mrs. Nicholas H. Noyes and Mr. and Mrs. Spencer T. Olin, the Lavoisier Collection is the largest collection outside of France on chemist Antoine-Laurent Lavoisier (1743-1794), commonly considered to be the founder of modern chemistry. Consisting of nearly 2,000 volumes, and 31 linear feet of manuscript and graphic materials, the collection provides insight into a crucial moment in both the history of science and the history of France, for Lavoisier was both a major scientist and an important government administrator who served during the French Revolution and ultimately fell victim to the Reign of Terror. The collection documents all aspects of Lavoisier's career, most notably his crucial work in areas such as the discovery of oxygen and the development of modern chemical nomenclature. Included among the manuscripts are laboratory notes from his dramatic experiments on the decomposition and recomposition of water, which helped to demonstrate the existence of oxygen and its role in chemical reactions. Also documented are his involvement in France's Academy of Sciences and his correspondence with other scientists of the day, including Baumé, Berthollet, Chaptal, Fourcroy, Lagrange, Monge, and Joseph Black. Included are Lavoisier's own copy of the first edition of his Traité élémentaire de chimie (1789), as well as multiple drafts of the plates drawn and engraved for this seminal work by Lavoisier's wife, Marie-Anne-Pierrette Lavoisier (1758-1836). Administrative documents in the collection chronicle Lavoisier's involvement in the Régie des poudres et salpêtres, the hated Ferme générale which administered tax collection, and a commission to evaluate the validity of Anton Mesmer's work. Beyond what it reveals about Lavoisier's career, the collection includes 600 volumes from the Lavoisiers' personal library which reflect the tastes of the enlightened French middle class at that time, including literary, historical, and musical works. A good number of the collection's books and manuscripts document the life of Marie-Anne-Pierrette Lavoisier, a talented pupil of Jacques-Louis David who both illustrated her husband's works and translated others' scientific work into French so he could read it. Family letters and personal artifacts add depth to the collection's portrait of this remarkable couple.

/* * @(#)DeclarationScanner.java 1.5 04/04/20 * * Copyright (c) 2004, Sun Microsystems, Inc. * All rights reserved. * * Redistribution and use in source and binary forms, with or without * modification, are permitted provided that the following conditions are met: * * * Redistributions of source code must retain the above copyright * notice, this list of conditions and the following disclaimer. * * Redistributions in binary form must reproduce the above copyright * notice, this list of conditions and the following disclaimer in the * documentation and/or other materials provided with the distribution. * * Neither the name of the Sun Microsystems, Inc. nor the names of * its contributors may be used to endorse or promote products derived from * this software without specific prior written permission. * * THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS "AS * IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED * TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A * PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT OWNER * OR CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, * EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO, * PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR * PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF * LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING * NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE OF THIS * SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE. */ package com.sun.mirror.util; import com.sun.mirror.declaration.*; /** * A visitor for declarations that scans declarations contained within * the given declaration. For example, when visiting a class, the * methods, fields, constructors, and nested types of the class are * also visited. * * <p> To control the processing done on a declaration, users of this * class pass in their own visitors for pre and post processing. The * preprocessing visitor is called before the contained declarations * are scanned; the postprocessing visitor is called after the * contained declarations are scanned. * * @author Joseph D. Darcy * @author Scott Seligman * @version 1.5 04/04/20 * @since 1.5 */ class DeclarationScanner implements DeclarationVisitor { protected DeclarationVisitor pre; protected DeclarationVisitor post; DeclarationScanner(DeclarationVisitor pre, DeclarationVisitor post) { this.pre = pre; this.post = post; } @Override public void visitDeclaration(Declaration d) { d.accept(pre); d.accept(post); } @Override public void visitPackageDeclaration(PackageDeclaration d) { d.accept(pre); for(ClassDeclaration classDecl: d.getClasses()) { classDecl.accept(this); } for(InterfaceDeclaration interfaceDecl: d.getInterfaces()) { interfaceDecl.accept(this); } d.accept(post); } @Override public void visitMemberDeclaration(MemberDeclaration d) { visitDeclaration(d); } @Override public void visitTypeDeclaration(TypeDeclaration d) { d.accept(pre); for(TypeParameterDeclaration tpDecl: d.getFormalTypeParameters()) { tpDecl.accept(this); } for(FieldDeclaration fieldDecl: d.getFields()) { fieldDecl.accept(this); } for(MethodDeclaration methodDecl: d.getMethods()) { methodDecl.accept(this); } for(TypeDeclaration typeDecl: d.getNestedTypes()) { typeDecl.accept(this); } d.accept(post); } @Override public void visitClassDeclaration(ClassDeclaration d) { d.accept(pre); for(TypeParameterDeclaration tpDecl: d.getFormalTypeParameters()) { tpDecl.accept(this); } for(FieldDeclaration fieldDecl: d.getFields()) { fieldDecl.accept(this); } for(MethodDeclaration methodDecl: d.getMethods()) { methodDecl.accept(this); } for(TypeDeclaration typeDecl: d.getNestedTypes()) { typeDecl.accept(this); } for(ConstructorDeclaration ctorDecl: d.getConstructors()) { ctorDecl.accept(this); } d.accept(post); } @Override public void visitEnumDeclaration(EnumDeclaration d) { visitClassDeclaration(d); } @Override public void visitInterfaceDeclaration(InterfaceDeclaration d) { visitTypeDeclaration(d); } @Override public void visitAnnotationTypeDeclaration(AnnotationTypeDeclaration d) { visitInterfaceDeclaration(d); } @Override public void visitFieldDeclaration(FieldDeclaration d) { visitMemberDeclaration(d); } @Override public void visitEnumConstantDeclaration(EnumConstantDeclaration d) { visitFieldDeclaration(d); } @Override public void visitExecutableDeclaration(ExecutableDeclaration d) { d.accept(pre); for(TypeParameterDeclaration tpDecl: d.getFormalTypeParameters()) { tpDecl.accept(this); } for(ParameterDeclaration pDecl: d.getParameters()) { pDecl.accept(this); } d.accept(post); } @Override public void visitConstructorDeclaration(ConstructorDeclaration d) { visitExecutableDeclaration(d); } @Override public void visitMethodDeclaration(MethodDeclaration d) { visitExecutableDeclaration(d); } @Override public void visitAnnotationTypeElementDeclaration( AnnotationTypeElementDeclaration d) { visitMethodDeclaration(d); } @Override public void visitParameterDeclaration(ParameterDeclaration d) { visitDeclaration(d); } @Override public void visitTypeParameterDeclaration(TypeParameterDeclaration d) { visitDeclaration(d); } }

Askings in the Dusk Scorched edges sealed-- so quick, with a ribbon tied-- That one can't help but wonder: Where landed the seeds The storm scattered? Seething pools inhabited The wells we dug with our hands Sparked, spattered, cracked The steam rises, Vapor entangled in the web of muted stars If swelling fire can turn to wisps so easily... Where landed the sparks? the ashes? This place is home, you say But home isn't stony chunks Dead trunks and roots upturned What of these trees? What of these mountains? What--tell me!-- What of these trees, When did home become flat, dead stools? What of these trees? What of these whispers home? You talk of past times Slippery are your words Drowned you change to watery defeat, Plunging to splash, a dip of your toes But never a dry word to dribble down your chin The tears you choke on Turn your syllables to liquidy fables When you talk of past times. With all of the gravity of the fading stars, And with all of the levity of the eternal Wind, I ask you: Where landed the seeds The storm scattered? Where landed the sparks? the ashes? Where settled the smoke that rose? Where anchored your feet-- after skidding on clouds and clouds, after digging your heels into the puff, leaping head over heels over head over and over-- Where anchored your feet? Where stood the Man you were? And where stands the man you have become? And where, in what space, stands the difference? I squint. Behind the mountains I see... Gray beings with foggy corners, Buoyed by the snowy peaks. I squint and I see clouds on clouds, chasing the pale dotty stars, or maybe just racing away, Far away racing from the smoke. In the dusk, I ask. In the smoke and the ashes, I ask. In the dusk and the vapor and the water, I ask. If the storm is passed, then why have the stars not brightened? If the smoke is cleared, then why do the ashes burn my nostrils? taint my palms? If the ground is dried, then why do my soles drip mud? In the dusk, I ask. And I wait for the tree I wait, I wait for the tree Then I will know Where landed the seeds The storm scattered. Subscribe Get Teen Ink’s 48-page monthly print edition. Written by teens since 1989.

I am a manatee, and I love you. Here is the official home of all calm manatees. Here is where you can donate to Save the Manatees.And here is where you can take action save manatees! Here's the FAQ!

Racial differences in young children's blood pressure. Responses to dynamic exercise. Studies have observed that black children exhibit greater blood pressure increases in response to dynamic exercise than white children. Seventy-five (51 white, 24 black) children aged 4 to 6 years old had their blood pressure and heart rate measured before, during, and 5 minutes after dynamic upright exercise on the treadmill. Girls had higher preexercise heart rate values than the boys, and showed a marginally slower recovery of diastolic blood pressure values. Black children had significantly lower preexercise and peak exercise heart rate values, higher systolic blood pressure values at peak exercise, and greater systolic blood pressure increases in response to exercise than did white children. These differences are discussed in terms of mechanisms that may be responsible for racial differences in essential hypertension.

Functional analysis of the c-myb proto-oncogene. Targeted mutagenesis studies were initiated to determine the normal biological function of the c-myb proto-oncogene. While heterozygous mice are phenotypically indistinguishable from their wild-type littermates, homozygous mutant fetuses die at approximately 15.5 days of gestation apparently due to anemia, which results from an inability to switch from embryonic yolk sac to fetal liver erythropoiesis. Studies are currently being done to determine the extent of hematopoietic abnormalities in the homozygous mutant fetuses. In vitro assays for hematopoietic colony-forming cells have been used to determine the frequency of both erythroid and myeloid progenitors in the fetal livers of wild-type, heterozygous, and homozygous mutant c-myb fetuses. The reduced number of erythroid progenitors was not unexpected considering the mutant fetus's pale color and reduced hematocrit. The dramatically reduced number of colonies derived from myeloid progenitors in the mutant fetuses in comparison to the number detected in phenotypically normal littermates suggests that expression of the c-myb proto-oncogene is critical for the proliferation and/or differentiation of early hematopoietic progenitors and possibly hematopoietic stem cells. Other possible explanations would include a hematopoietic progenitor migration problem from the yolk sac to the fetal liver or a defect in the microenvironment of the liver. Whether the lymphoid lineage is also adversely affected by the lack of c-myb expression remains to be determined. RT-PCR and Northern blot analyses were used in an attempt to identify downstream genes which may be directly or indirectly regulated by the Myb gene product. While the levels of expression of several genes involved in erythropoiesis (GATA-1, NF-E2, SCL, and EpoR) were reduced in the livers of homozygous mutant fetuses in comparison to phenotypically normal littermates and one gene, Kit ligand (KL), was expressed at higher levels in the mutant livers, these results must be viewed with caution. The livers of the mutant fetuses have been shown to be hypocellular in comparison to those of phenotypically normal littermates (35). It is possible that the Myb gene product is directly or indirectly modulating the expression of these genes. Conversely, the alteration in expression may be due to the reduced number or absence of specific hematopoietic lineages in the livers of the mutant fetuses. Differential display has also been used to identify putative novel genes that are involved in hematopoiesis. Preliminary studies suggest that this may be a powerful methodology to compare the expression pattern of genes in the fetal liver of wild-type, heterozygous, and homozygous mutant littermates at 14.5 days of gestation. To date nearly 60% of the partial cDNAs subcloned analyzed have been shown to be differentially expressed. More importantly, 75% of the differentially expressed cDNAs that have been sequenced appear to encode novel genes. Whether any of these novel genes are involved in the c-myb transcriptional cascade remains to be determined. Overall, analysis of the c-myb mutant fetuses have provided valuable insight into the biological function of this interesting proto-oncogene. The continued analysis of this resource will undoubtedly provide additional information concerning the role of the c-myb gene in hematopoiesis.

The present invention relates to an aqueous primer or coating, particularly a primer for use in polymeric material-to-metal adhesive bonding and a coating for protecting metallic surfaces. Primers are often used as an undercoat in combination with a covercoat adhesive in order to achieve superior bonding between two substrates made from different materials. One particular application for such primers is in bonding metal surfaces to elastomeric surfaces. Elastomer-to-metal bonding is subjected to severe environmental conditions in many industrial and automotive assemblies. For example, many engine mounting assemblies that employ elastomer-to-metal bonding contain fluids in order to assist in damping of vibration of the engine. These fluid-filled engine mounting devices are being exposed to increasingly high temperatures such that the elastomer-to-metal adhesive bonds within the mounts are being exposed to very high temperature fluid environments. Many elastomer-to-metal assemblies, particularly those utilized in automobile applications, are routinely exposed to materials that contain corrosive salts or other corrosive materials that may act to degrade the elastomer-to-metal adhesive bond. In light of the increasing regulations regarding volatile organic compounds (VOC), the use of traditional solvent-borne adhesives is becoming more problematic. Consequently, there is significant ongoing work to develop water-borne replacements. For example, U.S. Pat. No. 4,167,500 describes an aqueous adhesive composition that includes a water-dispersible novolak resin, a methylene donor and water. Aqueous or water-borne primers are known and described in U.S. Pat. Nos. 5,200,455 and 5,162,156, but they have various shortcomings compared to solvent-borne primers. For example, it is desirable to improve the environmental resistance performance of aqueous elastomer-to-metal adhesion primers that include polyvinyl alcohol-stabilized phenolic resin dispersions (see U.S. Pat. No. 5,200,455) when used with certain important adhesive covercoats. Elastomer-to-metal primers that include phenolic resins derived from water soluble phenolic precursors are also known (see U.S. Pat. No. 5,162,156) but these suffer from drawbacks that prevent their use to form robust, environmentally resistant films. Before being thermoset, films formed from water soluble phenolic resins tend to re-solvate when exposed to water. The source of the water can be an aqueous covercoat applied to the film. Application of the aqueous covercoat essentially washes away the film formed from the water soluble phenolic resin. In addition, such films exhibit very limited resistance to corrosive fluids. Another problem associated with the bonding of elastomer to metal relates to pre-heating or pre-baking of the dried adhesive prior to bonding. The metal substrate typically is coated with the adhesive, the adhesive is dried and then the adhesive-coated metal substrate is placed in a mold. Elastomer then is introduced into the mold and bonded to the metal substrate during vulcanization of the elastomer. The bonded part is removed from the mold and the next metal substrate is placed in the mold. When this subsequent metal substrate is placed in the mold it is subjected to the heat retained in the mold from the previous molding operation. The dried adhesive must be able to withstand this retained heat (referred to herein as xe2x80x9cpre-heatingxe2x80x9d) prior to bonding. Consequently, there exists a continuing need for an aqueous primer that provides robust adhesive bonding in hot, corrosive environments, has an affinity for a broad range of covercoats, and forms a flexible film that is resistant to pre-heating conditions and exhibits superior shelf-life stability and resistance to resolvation. It would be especially advantageous if such a primer could also be used as a coating for protecting a metallic surface. At present, there are two commonly-used metal coating methods electrodeposition and autodepositionxe2x80x94that are typically used subsequent to, or as a substitute for, phosphatizing of the metallic surface. Electrodeposition (frequently referred to as xe2x80x9cE-coatxe2x80x9d) involves immersing a metal surface in a composition then applying a voltage through the composition so that a coating will deposit on the metal surface. An autodeposition coating is commercially available from Henkel and its subsidiary Parker Amchem under the trademark AUTOPHORETIC(copyright). According to the patents and commercial literature, immersion of a metallic surface in an autodeposition composition produces what is said to be a self-limiting protective coating on a metal substrate. Autodeposition compositions are known to generally include water, resin solids dispersed in the aqueous medium, and an activator. For example, the aqueous autodeposition solution in one commercial embodiment contains 3-5 percent solids of a latex (polyvinylidene chloride or acrylic) and carbon black, ferric fluoride and a low concentration of hydrofluoric acid to provide a solution pH of 2.5-3.0. According to the commercialized multi-stage process, a clean degreased steel panel is immersed in an autodeposition solution for one to two minutes, the resulting xe2x80x9cgreenxe2x80x9d film is rinsed in a reaction rinse solution and then dried at 100xc2x0 C. The reactive rinse solution can include a diphosphonic acid. The dispersed resin solid typically is derived from ethylenically unsaturated monomers. Polyvinylidene chloride is the preferred resin. Polyethylene, polyacrylic, styrene-butadiene and epoxy resins are mentioned as possible resin particles that are dispersed or emulsified in water (see U.S. Pat. Nos. 4,414,350; 4,994,521; 5,427,863; 5,061,523; and 5,500,460). According to U.S. Pat. No. 5,486,414, AUTOPHORETIC(copyright) 800 Series compositions are based on polyvinylidene chloride and AUTOPHORETIC(copyright) 700 Series compositions are based on acrylic resins. The activator is an ingredient or ingredients that convert the composition into one which will form a self-limiting resinous coating on a metallic surface. The activating system generally comprises an acidic oxidizing system, for example: hydrogen peroxide and HF; HNO3; a ferric-containing compound and HF; and other soluble metal-containing compounds, for example, silver fluoride, ferrous oxide, cupric sulfate, cobaltous nitrate, silver acetate, ferrous phosphate, chromium fluoride, cadmium flouride, stannous flouride, lead dioxide, and silver nitrate in an amount of 0.025 to 50 g/l and an acid, which can be used alone or in combination with hydrofluoric acid, and including, for example, sulfuric, hydrochloric, nitric and phosphoric acid, and organic acids, including, for example, acetic, chloroacetic and trichloroacetic acids. In the case of treating zinciferous surfaces (e.g., galvanized steel), PCT International Patent Application Publication No. WO 97/09127 discloses treating the surface prior to autodeposition with a composition consisting of water, dissolved phosphonate (for example, diethylene triaminepenta(methylene phosphonic acid) or aminotri(methylene phosphonic acid)), aromatic sulfonate surfactant (for example, disulfonated derivative of dodecyl ether (DOWFAX 2A1 or 2A0)), and dissolved non-oxidizing acid (for example, hydrochloric acid). Autodeposition coatings are recognized as being very distinct from coatings formed by immersing metallic surfaces in compositions simply comprising solid resin particles dispersed in water (in other words, conventional latices) and coatings formed from acidic aqueous coating compositions that contain dispersed solid resin particles and relatively high amounts of water soluble corrosion inhibitors such as hexavalent chromium compounds (see U.S. Pat. No. 4,242,379). In both instances, the thickness of the resulting coating is not determined by the amount of time in which the metallic surface is immersed in the composition. According to the present invention there is provided a composition useful as a primer or a coating that includes (A) an aqueous dispersion of a phenolic resin that includes water and a reaction product of a phenolic resin precursor, a modifying agent and, optionally, a multi-hydroxy phenolic compound wherein the modifying agent includes at least one functional moiety that enables the modifying agent to react with the phenolic resin precursor and at least one ionic moiety, and (B) a flexibilizer. According to one embodiment the modifying agent is an aromatic compound. According to another embodiment the ionic moiety of the modifying agent is sulfate, sulfonate, sulfinate, sulfenate or oxysulfonate and the dispersed phenolic resin reaction product has a carbon/sulfur atom ratio of 20:1 to 200:1. One preferred embodiment of the composition is particularly useful as a primer for bonding a metallic surface to a polymeric surface and includes a novolak version of the phenolic resin dispersion (A), the flexibilizer (B), and (C) an aldehyde, preferably formaldehyde, donor compound. According to another preferred embodiment the composition is a coating for a metallic surface that includes a resole version of the phenolic resin dispersion (A) and the flexibilizer (B). When applied to a substrate surface, particularly a metal surface, and thermoset the composition forms a flexible film that protects the surface from high temperatures, corrosive conditions and chemical attack or degradation. In addition, when used as a primer in combination with an adhesive covercoat, the primer has improved adhesion to a broad range of covercoats and exhibits superior resistance to resolvation and chemically aggressive environments. The aqueous composition also has more than adequate shelf-life stability. A unique advantage of the composition of the invention is that it is autodepositable when applied to an electrochemically active metallic surface. Autodeposition enables the composition to form a self-limiting, substantially uniform film. There is also provided according to the invention a method for protectively coating a metallic substrate surface that includes (I) initially applying to the metallic substrate surface a metal treatment composition that contains (A) an aqueous dispersion of a phenolic novolak resin that includes water and a reaction product of a phenolic resin precursor, a modifying agent and a multi-hydroxy phenolic compound wherein the modifying agent includes at least one functional moiety that enables the modifying agent to react with the phenolic resin precursor and at least one ionic moiety, (B) an acid and, optionally, (C) a flexibilizer and then (II) applying to the treated metallic substrate surface the primer or coating composition described above. Unless otherwise indicated, description of components in chemical nomenclature refers to the components at the time of addition to any combination specified in the description, but does not necessarily preclude chemical interactions among the components of a mixture once mixed. Certain terms used in this document are defined below. xe2x80x9cPrimerxe2x80x9d means a liquid composition applied to a surface as an undercoat beneath a subsequently-applied covercoat. The covercoat can be an adhesive and the primer/adhesive covercoat forms an adhesive system for bonding two substrates together. xe2x80x9cCoatingxe2x80x9d means a liquid composition applied to a surface to form a protective and/or aesthetically pleasing coating on the surface. xe2x80x9cPhenolic compoundxe2x80x9d means a compound that includes at least one hydroxy functional group attached to a carbon atom of an aromatic ring. Illustrative phenolic compounds include unsubstituted phenol per se, substituted phenols such as alkylated phenols and multi-hydroxy phenols, and hydroxy-substituted multi-ring aromatics. Illustrative alkylated phenols include methylphenol (also known as cresol), dimethylphenol (also known as xylenol), 2-ethylphenol, pentylphenol and tert-butyl phenol. xe2x80x9cMulti-hydroxy phenolic compoundxe2x80x9d means a compound that includes more than one hydroxy group on each aromatic ring. Illustrative multi-hydroxy phenols include 1,3-benzenediol (also known as resorcinol), 1,2-benzenediol (also known as pyrocatechol), 1,4-benzenediol (also known as hydroquinone), 1,2,3-benzenetriol (also known as pyrogallol), 1,3,5-benzenetriol and 4-tert-butyl-1,2-benzenediol (also known as tert-butyl catechol). Illustrative hydroxy-substituted multi-ring aromatics include 4,4xe2x80x2-isopropylidenebisphenol (also known as bisphenol A), 4,4xe2x80x2methylidenebisphenol (also known as bisphenol F) and naphthol. xe2x80x9cAldehyde compoundxe2x80x9d means a compound having the generic formula RCHO. Illustrative aldehyde compounds include formaldehyde, acetaldehyde, propionaldehyde, n-butylaldehyde, n-valeraldehyde, caproaldehyde, heptaldehyde and other straight-chain aldehydes having up to 8 carbon atoms, as well as compounds that decompose to formaldehyde such as paraformaldehyde, trioxane, furfural, hexamethylenetriamine, acetals that liberate formaldehyde on heating, and benzaldehyde. xe2x80x9cPhenolic resinxe2x80x9d generally means the reaction product of a phenolic compound with an aldehyde compound. The molar ratio of the aldehyde compound (for example, formaldehyde) reacted with the phenolic compound is referred to herein as the xe2x80x9cF/P ratioxe2x80x9d. The F/P ratio is calculated on a per hydroxy-substituted aromatic ring basis. xe2x80x9cPhenolic resin precursorxe2x80x9d means an unmodified or conventional phenolic resin that is reacted with the aromatic modifying agent to produce the phenolic resin that is dispersed in an aqueous phase. xe2x80x9cElectrochemically active metalsxe2x80x9d means iron and all metals and alloys more active than hydrogen in the electromotive series. Examples of electrochemically active metal surfaces include zinc, iron, aluminum and cold-rolled, polished, pickled, hot-rolled and galvanized steel. xe2x80x9cFerrousxe2x80x9d means iron and alloys of iron. The phenolic resin dispersion (A) of the inventive composition can be obtained by reacting or mixing a phenolic resin precursor and a modifying agentxe2x80x94theoretically via a condensation reaction between the phenolic resin precursor and the modifying agent. One functional moiety provides the ionic pendant group that enables stable dispersion of the phenolic resin. Without the ionic pendant group, the phenolic resin would be unable to maintain a stable dispersion in water. Since the ionic pendant group provides for the stability of the dispersion there is no need, or at the most a minimal need, for surfactants. The presence of surfactants in an aqueous composition is a well-known hindrance to the composition""s performance. The other important functional moiety in the modifying agent enables the modifying agent to react with the phenolic resin precursor. The modifying agent can contain more than one ionic pendant group and more than one reaction-enabling moiety. Incorporation of aromatic sulfonate functional moieties into the phenolic resin structure via condensation is the preferred method of providing the ionic pendant groups. Accordingly, one class of ionic moieties are substituents on an aromatic ring that include a sulfur atom covalently or ionically bonded to a carbon atom of the aromatic ring. Examples of covalently bound sulfur-containing substituents are sulfonate (xe2x80x94S(O)2Oxe2x88x92M+), sulfinate (xe2x80x94S(O)Oxe2x88x92M+), sulfenate (xe2x80x94SOxe2x88x92M+) and oxysulfonate (xe2x80x94OS(O)2Oxe2x88x92M+), wherein M can be any monovalent ion such as Na, Li, K, or NR13 (wherein R1 is hydrogen or an alkyl). Another example of a covalently bound substituent is sulfate ion. Sulfonate is the preferred ionic group. The modifying agent should not include or introduce any multivalent ions into the phenolic resin dispersion since it is expected that the presence of multivalent ions would cause the phenolic resin to precipitate rather than remain dispersed. The reaction-enabling functional moiety of the modifying agent can be any functional group that provides a site on the modifying agent for undergoing condensation with a phenolic resin. If the phenolic resin precursor is a resole, the modifying agent reacts with an alkylol or benzyl ether group of the resole. If the modifying agent is aromatic, the reaction-enabling functional moiety is a substituent on the aromatic ring that causes a site on the ring to be reactive to the alkylol or benzyl ether of the resole precursor. An example of such a substituent is a hydroxy or hydroxyalkyl, with hydroxy being preferred. The hydroxy- or hydroxyalkyl-substituted aromatic modifying agent is reactive at a site ortho and/or para to each hydroxy or hydroxyalkyl substituent. In other words, the aromatic modifying agent is bonded to, or incorporated into, the phenolic resin precursor at sites on the aromatic ring of the modifying agent that are ortho and/or para to a hydroxy or hydroxyalkyl substituent. At least two reaction-enabling functional moieties are preferred to enhance the reactivity of the aromatic modifying agent with the phenolic resin precursor. Alternatively, the reaction-enabling functional moiety of the modifying agent can be a formyl group (xe2x80x94CHO), preferably attached to a carbon atom of an aromatic ring. In this instance, the phenolic resin precursor is a novolak rather than a resole. The novolak precursor is reacted via an acid catalyzed aldehyde condensation reaction with the formyl group-containing modifying agent so that the formyl group forms a divalent methylene linkage to an active site on an aromatic ring of the backbone structure of the novolak precursor. Consequently, the modifying agent structure (including the ionic moiety) is incorporated into the phenolic structure through the generated methylene linkage. Examples of such fdrmyl group-containing modifying agents include 2-formylbenzene sulfonate, 5-formylfuran sulfonate and (R)(SO3)CHxe2x80x94CH2xe2x80x94C(O)(H) compounds wherein R is C1-C4 alkyl groups. Another alternative reaction-enabling functional moiety could be a diazo group (xe2x80x94N2+), preferably attached to a carbon atom of an aromatic ring. In this instance, the phenolic resin precursor is a novolak rather than a resole. The novolak precursor is reacted via a diazo coupling reaction with the diazo group-containing modifying agent so that the diazo group forms a divalent diazo linkage (xe2x80x94Nxe2x95x90) to an active site on an aromatic ring of the backbone structure of the novolak precursor. Consequently, the modifying agent structure (including the ionic moiety) is incorporated into the phenolic structure through the diazo linkage. An example of such a diazo modifying agent is 1-diazo-2-naphthol-4-sulfonic acid. The modifying agent also can optionally include a functional moiety that is capable of chelating with a metal ion that is present on a substrate surface on which the phenolic resin dispersion is applied. The chelating group remains as a residual group after the condensation of the phenolic resin precursor and the aromatic modifying agent. Typically, the chelating group is a substituent on the aromatic ring that is capable of forming a 5- or 6-membered chelation structure with a metal ion. Examples of such substituents include hydroxy and hydroxyalkyl, with hydroxy being preferred. At least two such functional groups must be present on the modifying agent molecule to provide the chelating. In the case of an aromatic modifying agent, the chelating groups should be located in an ortho position relative to each other. A significant advantage of the invention is that hydroxy or hydroxyalkyl substituents on the aromatic modifying agent can serve two rolesxe2x80x94condensation enablement and subsequent metal chelating. An aromatic modifying agent is particularly advantageous. Preferably, the ionic group and the reaction-enabling moiety are not substituents on the same aromatic ring. The ionic group, particularly sulfonate, appears to have a strong deactivating effect on condensation reactions of the ring to which it is attached. Consequently, an ionic group attached to the same ring as the reaction-enabling moiety would not allow the modifying agent to readily react with the phenolic resin precursor. However, it should be recognized that this consideration for the location of the ionic and reaction-enabling moieties is not applicable to the formyl group-containing modifying agent and diazo modifying agent. A preferred structure for the aromatic modifying agent is represented by formulae Ia or Ib below: wherein X is the ionic group; Y is the reaction-enabling substituent; Z is the chelating substituent; L1 is a divalent linking group such as an alkylene radical (for example, methylene) or a diazo (xe2x80x94Nxe2x95x90Nxe2x80x94); a is 1; b is 1 to 4; m is 0 or 1; and c and d are each independently 0 to 3, provided there are not more than 4 substituents on each aromatic ring. If a chelating group Z is present it is positioned ortho to another chelating group Z or to Y. It should be recognized that the reaction-enabling substituent Y may also act as a chelating substituent. In this instance, the aromatic modifying agent may not include an independent chelating substituent Z. An aromatic modifying agent according to formulae Ia or Ib could also include other substituents provided they do not adversely interfere with the ionic group or the condensation reaction. Illustrative aromatic modifying agents include salts of 6,7-dihydroxy-2-napthalenesulfonate; 6,7-dihydroxy-1-naphthalenesulfonate; 6,7-dihydroxy-4-napthalenesulfonate; Acid Red 88; Acid Alizarin Violet N; Erichrome Black T; Erichrome Blue Black B; Brilliant Yellow; Crocein Orange G; Biebrich Yellow; and Palatine Chrome Black 6BN. 6,7-dihydroxy-2-naphthalenesulfonate, sodium salt is the preferred aromatic modifying agent. It should be recognized that the preferred sulfonate modification contemplated herein involves an indirect sulfonation mechanism. In other words, the aromatic modifying agent includes a sulfonate group and is reacted with another aromatic compound (the phenolic resin precursor) to obtain the chain extended, sulfonate-modified phenolic resin product. This indirect sulfonation is distinctly different than direct sulfonation of the phenolic resin precursor. Any phenolic resin could be employed as the phenolic resin precursor, but it has been found that resoles are especially suitable. The resole precursor should have a sufficient amount of active alkylol or benzyl ether groups that can initially condense with the modifying agent and then undergo further subsequent condensation. Of course, the phenolic resin precursor has a lower molecular weight than the final dispersed resin since the precursor undergoes condensation to make the final dispersed resin. Resoles are prepared by reacting a phenolic compound with an excess of an aldehyde in the presence of a base catalyst. Resole resins are usually supplied and used as reaction product mixtures of monomeric phenolic compounds and higher molecular weight condensation products having alkylol (xe2x80x94ArCH2xe2x80x94OH) or benzyl ether termination (xe2x80x94ArCH2xe2x80x94Oxe2x80x94CH2Ar), wherein Ar is an aryl group. These resole mixtures or prepolymers (also known as stage A resin) can be transformed into three-dimensional, crosslinked, insoluble and infusible polymers by the application of heat. The reactants, conditions and catalysts for preparing resoles suitable for the resole precursor of the present invention are well-known. The phenolic compound can be any of those previously listed or other similar compounds, although multi-hydroxy phenolic compounds are undesirable. Particularly preferred phenolic compounds for making the resole precursor include phenol per se and alkylated phenol. The aldehyde also can be any of those previously listed or other similar compounds, with formaldehyde being preferred. Low molecular weight, water soluble or partially water soluble resoles are preferred as the precursor because such resoles maximize the ability to condense with the modifying agent. The F/P ratio of the resole precursor should be at least 0.90. Illustrative commercially available resoles that are suitable for use as a precursor include a partially water soluble resole available from Georgia Pacific under the trade designation BRL 2741 and a partially water soluble resoles available from Schenectady International under the trade designations HRJ11722 and SG3100. As described above, the dispersed phenolic resin reaction product according to the invention can be hydrophilic or hydrophobic, but hydrophilic is preferred. In addition, dispersed resoles or novolaks can be obtained depending upon the selection and amount of reactants. Preferably, the dispersed resole is produced by reacting or mixing 1 mol of modifying agent(s) with 1 to 20 mol of phenolic resin precursor(s). A dispersed resole typically can be obtained by reacting or mixing a resole precursor or a mixture of resole precursors with the modifying agent or a mixture of agents without any other reactants, additives or catalysts. However, other reactants, additives or catalysts can be used as desired. Multi-hydroxy phenolic compound(s) can optionally be included in relatively small amounts in the reactant mixture for the resole. Hydrophilic resoles typically have a F/P ratio of at least 1.0. According to the invention, hydrophilic resoles having a F/P ratio much greater than 1.0 can be successfully dispersed. For example, it is possible to make an aqueous dispersion of hydrophilic resoles having a F/P ratio of at least 2 and approaching 3, which is the theoretical F/P ratio limit. Preferably, the dispersed novolak is produced by reacting 1 mol of modifying agent(s) with 2-20 mol of phenolic resin precursor(s) and, preferably, 2-20 mol of multi-hydroxy phenolic compound(s). An aldehyde compound, preferably formaldehyde, is also required to make the novolak. The aldehyde compound can optionally be added as a separate ingredient in the initial reaction mixture or the aldehyde compound can be generated in situ from the resole precursor. The resole precursor(s), multi-hydroxy phenolic compound(s) and modifying agent(s) co-condense to form the dispersed novolak. The reaction typically is acid catalyzed with an acid such as phosphoric acid. The F/P ratio of aldehyde compound(s) to combined amount of resole precursor(s) and multi-hydroxy phenolic compound(s) in the initial reaction mixture preferably is less than 0.9. Preferably, synthesis of the dispersed novolak is a two stage reaction. In the first stage, the resole precursor(s) is reacted with the modifying agent(s) and, optionally, a small amount of multi-hydroxy phenolic compound(s). Once this first stage reaction has reached the desired point (i.e. the resin can be readily formed into a translucent dispersion), the acid catalyst and a greater amount of multi-hydroxy phenolic compound(s) is added to the reaction mixture. Pyrocatechol (also simply known as catechol) is a preferred multi-hydroxy phenolic compound for reacting in the first stage and resorcinol is a preferred multi-hydroxy phenolic compound for reacting in the second stage. Hydrophilic novolaks typically have a hydroxy equivalents of between 1 and 3 per aromatic ring. Preferably, dispersed hydrophilic novolaks according to the invention have a hydroxy equivalents of 1.1 to 2.5, more preferably 1.1 to 2.0. The hydroxy equivalents is calculated based on the amount of multi-hydroxy phenolic compounds used to make the novolak. According to a preferred embodiment, the dispersed phenolic resin reaction product contains a mixture of oligomers having structures believed to be represented by the following formulae IIa or IIb: wherein X, Y, Z and L1 and subscripts a, b, c, d and m are the same as in formulae Ia and Ib, e is 1 to 6, L2 is a divalent linking group and Ph is the phenolic resin backbone structure, provided the xe2x80x94(L2xe2x80x94Ph) group(s) is(are) ortho or para to a Y group. L2 depends upon the particular phenolic resin, but typically is a divalent alkylene radical such as methylene (xe2x80x94CH2xe2x80x94) or oxydimethylene (xe2x80x94CH2xe2x80x94Oxe2x80x94CH2xe2x80x94). Preferably, e is 2 and the xe2x80x94(L2xe2x80x94Ph) groups are in para position to each other. According to a particularly preferred embodiment wherein the phenolic resin is a resole and the modifying agent is a naphthalene having a ionic pendant group X and two reaction-enabling substituents Y, the dispersed phenolic resin reaction product contains a mixture of oligomers having structures believed to be represented by the following formula III: wherein X and Y are the same as in formulae Ia and Ib, a is 0 or 1; n is 0 to 5; R2 is independently xe2x80x94C(R5)2xe2x80x94 or xe2x80x94C(R5)2xe2x80x94Oxe2x80x94C(R5)2xe2x80x94, wherein R5 is independently hydrogen, alkylol, hydroxyl, alkyl, aryl or aryl ether; and R3 is independently alkylol, alkyl, aryl, alkylaryl or aryl ether. Preferably, R2 is methylene or oxydimethylene and R3 is methylol. If 6,7-dihydroxy-2-naphthalenesulfonate, sodium salt is the modifying agent, X will be SO3xe2x88x92Na+ and each Y will be OH. It should be recognized that in this case the hydroxy groups for Y will also act as chelating groups with a metal ion. According to another preferred embodiment wherein the phenolic resin is a novolak and the modifying agent is a naphthalene having a ionic pendant group X and two reaction-enabling substituents Y, the dispersed phenolic resin reaction product contains a mixture of oligomers having structures believed to be represented by the following formula IV: wherein X and Y are the same as in formulae Ia and Ib, a is 0 or 1, n is 0 to 5 and R4 is independently hydroxyl, alkyl, aryl, alkylaryl or aryl ether. Preferably, R4 is tert-butyl. If 6,7-dihydroxy-2-naphthalenesulfonate, sodium salt is the modifying agent, X will be SO3xe2x88x92Na+ and each Y will be OH. In this case the hydroxy groups for Y will also act as chelating groups with a metal ion. It should be recognized that the dispersed phenolic resin reaction product may contain oligomers.or compounds having structures that vary from the idealized structures shown in formulae III and IV. If the modifying agent includes a sulfur-containing ionic group, the resulting modified phenolic resin should have a carbon/sulfur atom ratio of 20:1 to 200:1, preferably 20:1 to 100:1. If the sulfur content is greater than the 20:1 carbon/sulfur atom ratio, the modified phenolic resin begins to become water soluble, is more stable with respect to multivalent ions and is difficult to thermoset. These characteristics are adverse to the preferred use of the phenolic resin dispersion of the invention. If the sulfur content is below the 200:1 carbon/sulfur atom ratio, then the resin dispersion cannot maintain its stability. Viewed another way, the dispersed phenolic resins have 0.01 to 0.10, preferably 0.03 to 0.06, equivalents of sulfonate functionality/100 g resin. The aqueous dispersion of the phenolic resin preferably has a solids content of 1 to 50, preferably 15 to 30. The modifying agent and the phenolic resin precursor can be reacted or mixed under conditions effective to promote condensation of the modifying agent with the phenolic resin precursor. The reaction is carried out in water under standard phenolic resin condensation techniques and conditions. The reactant mixture (including water) generally is heated from 50 to 100xc2x0 C. under ambient pressure, although the specific temperature may differ considerably depending upon the specific reactants and the desired reaction product. The resulting product is a concentrate that is self-dispersible upon the addition of water and agitation to reach a desired solids content. The final dispersion can be filtered to remove any gelled agglomerations. The intermediate modified resoles or novolaks that are initially produced in the synthesis are not necessarily water dispersible, but as the chain extension is advanced the resulting chain extended modified resoles or novolaks become progressively more water dispersible by simple mechanical agitation. The chain extension for the dispersed resole is determined by measuring the viscosity of the reaction mixture. Once the resole reaction mixture has a reached the desired viscosity, which varies depending upon the reactant composition, the reaction is stopped by removing the heat. The chain extension for the dispersed novolak is determined by pre-selecting the F/P ratio of the total reaction mixture (in other words, the amount of aldehyde compound(s) relative to the amount of phenolic(s) in both the first and second stages). The reaction for the novolak is allowed to proceed until substantially all the total amount of the reactants have reacted. In other words, there is essentially no unreacted reactant remaining. Preferably, the molecular weight (i.e., chain extension) of both the resole and novolak should be advanced to just below the gel point. The phenolic resin dispersion (A) can be present in the primer or coating composition in any amount. Preferably, it is present in an amount of 1 to 30, more preferably, 8 to 15, based on the total weight of the non-volatile components of the composition. The flexibilizer (B) is any material that contributes flexibility and/or toughness to the film formed from the composition. The toughness provided by the flexibilizer provides fracture resistance to the film. The flexibilizer should be non-glassy at ambient temperature and be an aqueous emulsion latex or aqueous dispersion that is compatible with the phenolic resin dispersion (A). The flexibilizer preferably is formulated into the composition in the form of an aqueous emulsion latex or aqueous dispersion Suitable flexibilizers include aqueous latices, emulsions or dispersions of (poly)butadiene, neoprene, styrene-butadiene rubber, acrylonitrile-butadiene rubber (also known as nitrile rubber), halogenated polyolefin, acrylic polymer, urethane polymer, ethylene-propylene copolymer rubber, ethylene-propylene-diene terpolymer rubber, styrene-acrylic copolymer, polyamide, poly(vinyl acetate) and the like. Halogenated polyolefins, nitrile rubbers and styrene-acrylic copolymers are preferred. A suitable styrene-acrylic polymer latex is commercially available from Goodyear Tire and Rubber under the trade designation PLIOTEC and described, for example, in U.S. Pat. Nos. 4,968,741; 5,122,566 and 5,616,635. According to U.S. Pat. No. 5,616,635, such a copolymer latex is made from 45-85 weight percent vinyl aromatic monomers, 15-50 weight percent of at least one alkyl acrylate monomer and 1-6 weight percent unsaturated carbonyl compound. Styrene is the preferred vinyl aromatic monomer, butyl acrylate is the preferred acrylate monomer and acrylic acid and methacrylic acid are the preferred unsaturated carbonyl compound. The mixture for making the latex also includes at least one phosphate ester surfactant, at least one water-insoluble nonionic surface active agent and at least one free radical initiator. If nitrile rubber is the flexibilizer, it is preferably mixed into the composition as an emulsion latex. It is known in the art that nitrile rubber emulsion latices are generally made from at least one monomer of acrylonitrile or an alkyl derivative thereof and at least one monomer of a conjugated diene, preferably butadiene. According to U.S. Pat. No. 4,920,176 the acrylonitrile or alkyl derivative monomer should be present in an amount of 0 or 1 to 50 percent by weight based on the total weight of the monomers. The conjugated diene monomer should be present in an amount of 50 percent to 99 percent by weight based on the total weight of the monomers. The nitrile rubbers can also optionally include various co-monomers such as acrylic acid or various esters thereof, dicarboxylic acids or combinations thereof. The polymerization of the monomers typically is initiated via free radical catalysts. Anionic surfactants typically are also added. A suitable nitrile rubber latex is available from B.F. Goodrich under the trade designation HYCAR. Representative halogenated polyolefins include chlorinated natural rubber, chlorine- and bromine-containing synthetic rubbers including polychloroprene, chlorinated polychloroprene, chlorinated polybutadiene, hexachloropentadiene, butadiene/halogenated cyclic conjugated diene adducts, chlorinated butadiene styrene copolymers, chlorinated ethylene propylene copolymers and ethylene/propylene/non-conjugated diene terpolymers, chlorinated polyethylene, chlorosulfonated polyethylene, poly(2,3-dichloro-1,3-butadiene), brominated poly(2,3-dichloro-1,3-butadiene), copolymers of xcex1-haloacrylonitriles and 2,3-dichloro-1,3-butadiene, chlorinated poly(vinyl chloride) and the like including mixtures of such halogen-containing elastomers. Latices of the halogenated polyolefin can be prepared according to methods known in the art such as by dissolving the halogenated polyolefin in a solvent and adding a surfactant to the resulting solution. Water can then be added to the solution under high shear to emulsify the polymer. The solvent is then stripped to obtain a latex. The latex can also be prepared by emulsion polymerization of the halogenated ethylenically unsaturated monomers. Butadiene latices are particularly preferred as the flexibilizer (B). Methods for making butadiene latices are well-known and are described, for example, in U.S. Pat. Nos. 4,054,547 and 3,920,600, both incorporated herein by reference. In addition, U.S. Pat. Nos. 5,200,459; 5,300,555; and 5,496,884 disclose emulsion polymerization of butadiene monomers in the presence of polyvinyl alcohol and a co-solvent such as an organic alcohol or a glycol. The butadiene monomers useful for preparing the butadiene polymer latex can essentially be any monomer containing conjugated unsaturation. Typical monomers include 2,3-dichloro-1,3-butadiene; 1,3-butadiene; 2,3-dibromo-1,3-butadiene isoprene; isoprene; 2,3-dimethylbutadiene; chloroprene; bromoprene; 2,3-dibromo-1,3-butadiene; 1,1,2-trichlorobutadiene; cyanoprene; hexachlorobutadiene; and combinations thereof. It is particularly preferred to use 2,3-dichloro-1,3-butadiene since a polymer that contains as its major portion 2,3-dichloro-1,3-butadiene monomer units has been found to be particularly useful in adhesive applications due to the excellent bonding ability and barrier properties of the 2,3-dichloro-1,3-butadiene-based polymers. As described above, an especially preferred embodiment of the present invention is one wherein the butadiene polymer includes at least 60 weight percent, preferably at least 70 weight percent, 2,3-dichloro-1,3-butadiene monomer units. The butadiene monomer can be copolymerized with other monomers. Such copolymerizable monomers include xcex1-haloacrylonitriles such as xcex1-bromoacrylonitrile and xcex1-chloroacrylonitrile; xcex1,xcex2-unsaturated carboxylic acids such as acrylic, methacrylic, 2-ethylacrylic, 2-propylacrylic, 2-butylacrylic and itaconic acids; alkyl-2-haloacrylates such as ethyl-2-chloroacrylate and ethyl-2-bromoacrylate; xcex1-bromovinylketone; vinylidene chloride; vinyl toluenes; vinylnaphthalenes; vinyl ethers, esters and ketones such as methyl vinyl ether, vinyl acetate and methyl vinyl ketone; esters amides, and nitriles of acrylic and methacrylic acids such as ethyl acrylate, methyl methacrylate, glycidyl acrylate, methacrylamide and acrylonitrile; and combinations of such monomers. The copolymerizable monomers, if utilized, are preferably xcex1-haloacrylonitrile and/or xcex1,xcex2-unsaturated carboxylic acids. The copolymerizable monomers may be utilized in an amount of 0.1 to 30 weight percent, based on the weight of the total monomers utilized to form the butadiene polymer. In carrying out the emulsion polymerization to produce the latex other optional ingredients may be employed during the polymerization process. For example, conventional anionic and/or nonionic surfactants may be utilized in order to aid in the formation of the latex. Typical anionic surfactants include carboxylates such as fatty acid soaps from lauric, stearic, and oleic acid; acyl derivatives of sarcosine such as methyl glycine; sulfates such as sodium lauryl sulfate; sulfated natural oils and esters such as Turkey Red Oil; alkyl aryl polyether sulfates; alkali alkyl sulfates; ethoxylated aryl sulfonic acid salts; alkyl aryl polyether sulfonates; isopropyl naphthalene sulfonates; sulfosuccinates; phosphate esters such as short chain fatty alcohol partial esters of complex phosphates; and orthophosphate esters of polyethoxylated fatty alcohols. Typical nonionic surfactants include ethoxylated (ethylene oxide) derivatives such as ethoxylated alkyl aryl derivatives; mono- and polyhydric alcohols; ethylene oxide/propylene oxide block copolymers; esters such as glyceryl monostearate; products of the dehydration of sorbitol such as sorbitan monostearate and polyethylene oxide sorbitan monolaurate; amines; lauric acid; and isopropenyl halide. A conventional surfactant, if utilized, is employed in an amount of 0.01 to 5 parts, preferably 0.1 to 2 parts, per 100 parts by weight of total monomers utilized to form the butadiene polymer. In the case of dichlorobutadiene homopolymers, anionic surfactants are particularly useful. Such anionic surfactants include alkyl sulfonates and alkyl aryl sulfonates (commercially available from Stepan under the trade designation POLYSTEP) and sulfonic acids or salts of alkylated diphenyl oxide (for example, didodecyl diphenyleneoxide disulfonate or dihexyl diphenyloxide disulfonate commercially available from Dow Chemical Co. under the trade designation DOWFAX). Chain transfer agents may also be employed during emulsion polymerization in order to control the molecular weight of the butadiene polymer and to modify the physical properties of the resultant polymer as is known in the art. Any of the conventional organic sulfur-containing chain transfer agents may be utilized such as alkyl mercaptans and dialkyl xanthogen disulfides. The emulsion polymerization is typically triggered by a free radical initiator. Illustrative free radical initiators include conventional redox systems, peroxide systems, azo derivatives and hydroperoxide systems. The use of a redox system is preferred and examples of such systems include ammonium persulfate/sodium metabisulfite, ferric sulfate/ascorbic acid/hydroperoxide and tributylborane/hydroperoxide, with ammonium persulfate/sodium metabisulfite being most preferred. The emulsion polymerization is typically carried out at a temperature of 10xc2x0-90xc2x0 C., preferably 40xc2x0-60xc2x0 C. Monomer conversion usually ranges from 70-100, preferably 80-100, percent. The latices preferably have a solids content of 10 to 70, more preferably 30 to 60, percent; a viscosity between 50 and 10,000 centipoise at 25xc2x0 C.; and a particle size between 60 and 300 nanometers. Especially preferred as the butadiene latex is a butadiene polymer that has been emulsion polymerized in the presence of a styrene sulfonic acid, styrene sulfonate, poly(styrene sulfonic acid), or poly(styrene sulfonate) stabilizer to form the latex. Poly(styrene sulfonate) is the preferred stabilizer. This stabilization system is particularly effective for a butadiene polymer that is derived from at least 60 weight percent dichlorobutadiene monomer, based on the amount of total monomers used to form the butadiene polymer. The butadiene polymer latex can be made by known emulsion polymerization techniques that involve polymerizing the butadiene monomer (and copolymerizable monomer, if present) in the presence of water and the styrene sulfonic acid, styrene sulfonate, poly(styrene sulfonic acid), or poly(styrene sulfonate) stabilizer. The sulfonates can be salts of any cationic groups such as sodium, potassium or quaternary ammonium. Sodium styrene sulfonate is a preferred styrene sulfonate compound. Poly(styrene sulfonate) polymers include poly(styrene sulfonate) homopolymer and poly(styrene sulfonate) copolymers such as those with maleic anhydride. Sodium salts of poly(styrene sulfonate) are particularly preferred and are commercially available from National Starch under the trade designation VERSA TL. The poly(styrene sulfonate) can have a weight average molecular weight from 5xc3x97104 to 1.5xc3x97106, with 1.5xc3x97105 to 2.5xc3x97105 being preferred. In the case of a poly(styrene sulfonate) or poly(styrene sulfonic acid) it is important to recognize that the emulsion polymerization takes place in the presence of the pre-formed polymer. In other words, the butadiene monomer is contacted with the pre-formed poly(styrene sulfonate) or poly(styrene sulfonic acid). The stabilizer preferably is present in an amount of 0.1 to 10 parts, preferably 1 to 5 parts, per 100 parts by weight of total monomers utilized to form the butadiene polymer. The flexibilizer (B) preferably is present in the composition in an amount of 5 parts by weight to 300 parts by weight, based on 100 parts by weight phenolic resin dispersion. More preferably, the flexibilizer is present in an amount of 25 parts by weight to 100 parts by weight, based on 100 parts by weight phenolic resin dispersion. The composition also can optionally include ingredients known to be useful in adhesive compositions. A particular useful optional component is a metal oxide such as zinc oxide, magnesium oxide, lead oxide, iron oxide, cadmium oxide, zirconium oxide and calcium oxide, with zinc oxide and magnesium oxide being preferred. Lead oxide is not preferred due to environmental concerns. The metal oxides are well-known articles of commerce. The metal oxide is formulated into the composition in finely divided form or as a dispersion in an aqueous carrier. Another useful ingredient is mica. Other possible conventional additives include such as inert filler material, pigments, plasticizers, dispersing agents, wetting agents, reinforcing agents and the like in amounts conventionally utilized. Examples of such conventional additives include carbon black, silica, sodium aluminosilicate, titanium dioxide and organic pigments and dyestuffs. The composition of the invention preferably does not include any acid. As mentioned above, one preferred embodiment of the composition is a primer for bonding a metallic surface to a polymeric surface that includes a novolak version of the phenolic resin dispersion (A), the flexibilizer (B), and (C) an aldehyde, preferably formaldehyde, donor compound that is capable of crosslinking the novolak resin. The viscosity of the adhesive primer composition is not critical provided it is sufficient to withstand dripping and/or sagging. Typically, the adhesive primer may have a viscosity of 30 to 150 centipoise at 25xc2x0 C. The aldehyde donor can be essentially be any type of aldehyde known to react with hydroxy aromatic compounds to form cured or crosslinked novolak phenolic resins. Typical compounds useful as a aldehyde (e.g., formaldehyde) source in the present invention include formaldehyde and aqueous solutions of formaldehyde, such as formalin; acetaldehyde; propionaldehyde; isobutyraldehyde; 2-ethylhexaldehyde; 2-methylpentaldehyde; 2-ethylhexaldehyde; benzaldehyde; as well as compounds which decompose to formaldehyde, such as paraformaldehyde, trioxane, furfural, hexamethylenetetramine, anhydromaldehydeaniline, ethylene diamine formaldehyde; acetals which liberate formaldehyde on heating; methylol derivatives of urea and formaldehyde; methylol phenolic compounds; and the like. The formaldehyde source is utilized in an amount ranging from about 5 parts by weight to 100 parts by weight, preferably from about 10 parts by weight to 70 parts by weight, based on 100 parts by weight phenolic resin dispersion. Additionally, , high molecular weight aldehyde homopolymers and copolymers can be employed as a latent formaldehyde source in the practice of the present invention. A latent formaldehyde source herein refers to a formnaldehyde source which will release formaldehyde only in the presence of heat such as the heat applied during the curing of an adhesive system. Typical high molecular weight aldehyde homopolymers and copolymers include (1) acetal homopolymers, (2) acetal copolymers, (3) gamma-polyoxy-methylene ethers having the characteristic structure: R10Oxe2x80x94(CH2O)nxe2x80x94R11 and (4) polyoxymethylene glycols having the characteristic structure: HOxe2x80x94(R12O)xxe2x80x94(CH2O)nxe2x80x94(R13O)xxe2x80x94H wherein R10 and R11 can be the same or different and each is an alkyl group having from about 1 to 8, preferably 1 to 4, carbon atoms, R12 and R13 can be the same or different and each is an alkylene group having from 2 to 12, preferably 2 to 8, carbon atoms; n is greater than 100, and is preferably in the range from about 200 to about 2000; and x is in the range from about 0 to 8, preferably 1 to 4, with at least one x being equal to at least 1. The high molecular weight aldehyde homopolymers and copolymers are further characterized by a melting point of at least 75xc2x0 C., i.e. they are substantially inert with respect to the phenolic system until heat activated; and by being substantially completely insoluble in water at a temperature below the melting point. The acetal homopolymers and acetal copolymers are well-known articles of commerce. The polyoxymethylene materials are also well known and can be readily synthesized by the reaction of monoalcohols having from 1 to 8 carbon atoms or dihydroxy glycols and ether glycols with polyoxymethylene glycols in the presence of an acidic catalyst. A representative method of preparing these crosslinking agents is described in U.S. Pat. No. 2,512,950, which is incorporated herein by reference. Gamma-polyoxymethylene ethers are generally preferred sources of latent formaldehyde and a particularly preferred latent formaldehyde source for use in the practice of the invention is 2-polyoxymethylene dimethyl ether. As mentioned above, another preferred embodiment of the composition is a coating for a metallic surface that includes a resole version of the phenolic resin dispersion (A) and the flexibilizer (B). This coating can also be used as primer for polymeric-to-metal adhesion. Accordingly, the coating can be applied to substantially all of a metallic surface and then a portion of that coating-covered surface can be topcoated with a covercoat and then bonded to a polymeric surface. This single coating/primer composition provides significant corrosion protection under the bonded portion and in the exposed portion. According to conventional practices prior to this invention, the entire metal surface of a substrate is first coated with a protective coating and then only that portion intended for bonding must be coated with a primer having a composition different than that of the protective coating. Alternatively, the primer and adhesive are applied to the bonding area and then the resulting bonded assembly is post-painted with a protective coating. The invention provides a distinct processing advantage since the same composition can be used for both protective coating and priming for bonding on a metal surface and it eliminates the need for post-painting. Consequently, it is easier to ensure that the whole metal substrate or part has adequate corrosion protection. The viscosity of the coating composition is not critical provided it is sufficient to withstand dripping and/or sagging. Typically, the coating composition can have a viscosity of less than 25 centipoise at 25xc2x0 C. Substantial elimination of dripping and/or sagging at such low viscosities is another benefit of the present invention. A preferred optional component in the resole coating composition is a polyvinyl alcohol-stabilized aqueous resole dispersion. This dispersion can be prepared by a process that includes mixing the pre-formed, solid, substantially water-insoluble, resole resin; an organic coupling agent; and polyvinyl alcohol, at a temperature and for a period of time sufficient to form a dispersion of the resole in water. Such polyvinyl alcohol-stabilized resoles are described in more detail in U.S. Pat. No. 4,124,554, incorporated herein by reference, and are available commercially from Georgia Pacific under the trade designation BKUA-2370 and BKUA-2392. According to U.S. Pat. No. 4,124,554, the water-insoluble resole is produced by reacting formaldehyde with bisphenol-A in a mol ratio of 2 to 3.75 moles of formaldehyde per mole of bisphenol-A in the presence of a catalytic amount of an alkali metal or barium oxide or hydroxide condensation catalyst wherein the reaction is carried out at elevated temperatures. The condensation product is the neutralized to a pH of 3 to 8. Alcohols, glycol ethers, ethers, esters and ketones are the most useful coupling solvents. Specific examples of useful coupling solvents include ethanol, n-propanol, isopropyl alcohol, ethylene glycol monobutyl ether, ethylene glycol monoisobutyl ether, ethylene glycol monomethyl ether acetate, diethylene glycol monobutyl ether, diethylene glycol monoethyl ether acetate, propylene glycol monopropyl ether, methoxy acetone, and the like. The polyvinyl alcohol is typically prepared by hydrolysis of polyvinyl acetate. The most useful polyvinyl alcohol polymers are hydrolyzed to an extent of 85 to 91 percent and have molecular weights such that a 4 percent solids solution of the polyvinyl alcohol in water has a viscosity of 4 to 25 centipoises at 25xc2x0 C. The polyvinyl alcohol-stabilized resole dispersion, if present, typically is used in an amount of 10 parts by weight to 800 parts by weight, preferably 100 parts by weight to 800 parts by weight, based on 100 parts by weight of the phenolic resin dispersion (A). Water, preferably deionized water, is utilized in combination with the phenolic resin dispersion (A), flexibilizer (B) and any optional components of the invention in order to provide a composition having a final solids content of 5 to 50, preferably 15 to 30, weight percent. Since the coating or primer composition is waterborne it is substantially free of volatile organic compounds. The compositions may be prepared by any method known in the art, but are preferably prepared by combining and milling or shaking the ingredients and water in ball-mill, sand-mill, ceramic bead-mill, steel-bead mill, high speed media-mill or the like. It is preferred to add each component to the mixture in a liquid form such as an aqueous dispersion. The composition may be applied to a substrate surface by any conventional method such as spraying, dipping, brushing, wiping, roll-coating (including reverse roll-coating) or the like, after which the composition typically is permitted to dry. Although conventional application methods can be used, the composition can be applied via autodeposition. The phenolic resin dispersion (A) of composition of the invention enables autodeposition of the composition in the presence of multivalent ions. The general principles and advantages of autodeposition is explained in a multitude of patents assigned to Parker Amchem and/or Henkel (see, for example, U.S. Pat. Nos. 4,414,350; 4,994,521; 5,427,863; 5,061,523 and 5,500,460). Autodepositable compositions usually are applied by dipping the metallic substrate or part into a bath of the composition. The metal substrate can reside in the primer or coating composition bath for an amount of time sufficient to deposit a uniform film of desired thickness. Typically, the bath residence time is from about 5 to about 120 seconds, preferably about 10 to about 30 seconds, and occurs at room temperature. The composition typically is applied to form a dry film thickness of 10 to 30 xcexcm. According to the present invention when the composition is applied to an electrochemically active metal surface that has been activated so that there are multivalent ions present on the surface the multivalent ions appear to cause the composition to deposit on the metal surface a self-limiting, substantially uniform, gelatinous, wet film. The coating that is formed when the composition is in contact with the metal surface is known as the xe2x80x9cuncuredxe2x80x9d state. The subsequent drying of the coating converts the coating to a xe2x80x9ccuredxe2x80x9d stage. The formation of the coating is xe2x80x9cself-limitingxe2x80x9d in that the coating increases in thickness and areal density (mass per unit area) the longer the time the metal surface is immersed in the autodepositable composition. The autodeposition characteristic of the invention is important to provide corrosion and environmental resistance. It allows for the formation of an exceptionally uniform and thin protective barrier. Excellent corrosion and environmental resistance is possible only if the entire surface of a metal part is protected with a barrier coating. This requirement is usually difficult to achieve on substrate surfaces that have a very complex topology. With the superior autodeposition of this invention, wetting and thus protection of such complex surfaces is achieved. Another important advantage of the primer or coating composition is that a bath of the composition does not appear to change in composition as cumulative metal surfaces are dipped in the bath over a period of time. It is believed that since the very hydrophilic phenolic resin dispersion immobolizes or coagulates on the surface as a swollen wet gel rather than as a precipitate, the composition of the bath is the same as the deposited wet gel and the bath is not depleted. Activation of the metallic surface to prepare it for receiving the autodepositable composition can be achieved by pretreating the surface with an activating composition that generates freely-available multivalent ions on the surface. The activating composition can be an aqueous solution of multivalent ions such as calcium, magnesium, iron and manganese. The activating composition can also be an autodepositable, aqueous metal treatment composition that includes (Axe2x80x2) an aqueous dispersion of a phenolic novolak resin that includes water and a reaction product of a phenolic resin precursor, a modifying agent and a multi-hydroxy phenolic compound wherein the modifying agent includes at least one functional moiety that enables the modifying agent to react with the phenolic resin precursor and at least one ionic moiety, (Bxe2x80x2) an acid and, optionally, (Cxe2x80x2) a flexibilizer. The phenolic novolak dispersion and the flexibilizer can be the same as described above in connection with the primer or coating composition. The aqueous metal treatment composition is described in more detail in commonly-owned U.S. Provisional Patent Application No. 60/072,782 titled xe2x80x9cAqueous Metal Treatment Compositionxe2x80x9d (Attorney Docket No. IR-2486(CE)), filed Jan. 27, 1998 and incorporated herein by reference. The acid (Bxe2x80x2) of the metal treatment composition can be any acid that is capable of reacting with a metal to generate multivalent ions. Illustrative acids include hydrofluoric acid, phosphoric acid, sulfuric acid, hydrochloric acid and nitric acid. In the case of steel the multivalent ions will be ferric and/or ferrous ions. Aqueous solutions of phosphoric acid are preferred. When the acid is mixed into the composition presumably the respective ions are formed and exist as independent species in addition to the presence of the free acid. In other words, in the case of phosphoric acid, phosphate ions and free phosphoric acid co-exist in the formulated final multi-component composition. The acid preferably is present in an amount of 5 to 300 parts by weight, more preferably 10 to 160 parts by weight, based on 100 parts by weight of the phenolic novolak resin dispersion (Axe2x80x2). The flexibilizer (Cxe2x80x2) of the metal treatment composition, if present, preferably is included in the composition in an amount of 5 parts by weight to 300 parts by weight, based on 100 parts by weight phenolic novolak resin dispersion (Axe2x80x2). More preferably, the flexibilizer is present in an amount of 25 parts by weight to 100 parts by weight, based on 100 parts by weight the phenolic novolak resin dispersion (Axe2x80x2). Since the dispersed phenolic resin (Axe2x80x2) of the metal treatment composition is a novolak, a curative must be introduced in order to cure the film formed by the metal treatment composition. The curative can be an aldehyde donor compound that is present in the primer of the invention. When the curative-containing primer is applied over the metal treatment, the curative cures the metal treatment composition. It has been found that the formaldehyde species generated from the resole present in the primer appear to co-cure the novolak in the metal treatment coating via diffusion. It has also been found that the addition of a control agent to the metal treatment composition described in commonly-owned U.S. Provisional Patent Application No. 60/072,782 titled xe2x80x9cAqueous Metal Treatment Compositionxe2x80x9d dramatically improves uniform coating formation on more complex surface topography and enhances the autodeposition of subsequently-applied compositions thus improving corrosion resistance and overall robustness. The protective coating formed by the composition of the invention is particularly useful for providing corrosion resistance to metal substrates that are subjected to significant stresses and/or strains causing significant flexing or movement of the substrate surface. Due to the improved deposition caused by the control agent, the concentration of active ingredients in an autodepositable composition that includes the control agent can be reduced. Another advantage of the invention is that there is no need to post-rinse the treated surface in order to remove any control agent residue. Furthermore, the control agent eliminates or substantially eliminates the ambient staging period thus improving process efficiency. The control agent is any material that is able to improve the formation of an autodeposited coating on a metallic surface and, optionally, improve the formation of another autodeposited coating (such as the primer or coating of the invention) applied after the control agent-containing autodeposited coating. Addition of the control agent also increases the uniformity of the thickness of the autodeposited coating. The control agent-containing composition does not require an ambient staging period in order to develop fully the coating. In other words, the metallic coating conversion is complete upon drying of the coated substrate and any subsequent coating, primer or adhesive compositions can be applied immediately after coating and drying of the control agent-containing composition. The control agent also must be compatible with the other components of the composition under acidic conditions without prematurely coagulating or destabilizing the composition. The control agent may be a nitro compound, a nitroso compound, an oxime compound, a nitrate compound, or a similar material. A mixture of control agents may be used. Organic nitro compounds are the preferred control agents. The organic nitro compound is any material that includes a nitro group (xe2x80x94NO2) bonded to an organic moiety. Preferably, the organic nitro compound is water soluble or, if water insoluble, capable of being dispersed in water. Illustrative organic nitro compounds include nitroguanidine; aromatic nitrosulfonates such as nitro or dinitrobenzenesulfonate and the salts thereof such as sodium, potassium, amine or any monovalent metal ion (particularly the sodium salt of 3,5-dinitrobenzenesulfonate); Naphthol Yellow S; and picric acid (also known as trinitrophenol). Especially preferred for commercial availability and regulatory reasons is a mixture of nitroguanidine and sodium nitrobenzenesulfonate. The amount of control agent(s) in the metal treatment composition may vary, particularly depending upon the amount of any acid in the composition. Preferably, the amount is up to 20 weight %, more preferably up to 10 weight %, and most preferably 2 to 5 weight %, based on the total amount of non-volatile ingredients in the metal treatment composition. According to a preferred embodiment, the weight ratio of nitroguanidine to sodium nitrobenzenesulfonate should range from 1:10 to 5:1. The organic nitro compound typically is mixed into the composition in the form of an aqueous solution or dispersion. For example, nitroguanidine is a solid at room temperature and is dissolved in water prior to formulating into the composition. If conventional applications methods are used for the primer or coating of the invention, the metallic surface may be pre-treated prior to application of the composition via well-known conversion techniques. Conversion coating generally involves treating the surface with chemicals that form a metal phosphate and/or metal oxide conversion coating on the metal surface. The conversion coating provides protection against corrosion and can enhance adhesion of any subsequent coatings. Phosphatizing is an example of a well-established conversion process. Another conversion process is applying the above-described metal treatment composition. Curing of the primer or coating composition to form a highly crosslinked thermoset on the metallic surface can be accomplished by heating. The degree of heating will vary depending upon the specific composition, but in general the coated composition should be exposed to a temperature of 250 to 400xc2x0 F. for 5 minutes to one hour. The primer composition can be used to bond any types of adherends together, but it is particularly useful to bond a metal surface to a polymeric material surface. The polymeric material can be any elastomeric material selected from any of the natural rubbers and olefinic synthetic rubbers including polychloroprene, polybutadiene, neoprene, styrene-butadiene copolymer rubber, acrylonitrile-butadiene copolymer rubber, ethylene-propylene copolymer rubber (EPM), ethylene-propylene-diene terpolymer rubber (EPDM), butyl rubber, brominated butyl rubber, alkylated chlorosulfonated polyethylene and the like. The material may also be a thermoplastic elastomer such as those sold under the trade designations SANTOPRENE and ALCRYN by Monsanto and DuPont, respectively. The metal surface may be selected from any of the common structural metals such as iron, steel (including stainless steel and electrogalvanized steel), lead, aluminum, copper, brass, bronze, MONEL metal alloy, nickel, zinc and the like. For adhesive bonding, the primer composition typically is applied to the metal surface and then dried. The covercoat then is applied to the primer-coated metal surface and the coated metal surface and elastomeric surface are brought together under heat and pressure to complete the bonding procedure. The exact conditions selected will depend upon the particular elastomer being bonded and whether or not it is cured prior to bonding. In some cases, it may be desirable to heat the metal surface prior to application of the primer and/or covercoat composition(s) to assist in drying of the composition(s). The coated metal surface and the elastomeric surface are typically brought together under a pressure of 20 to 175 MPa, preferably from 20 to 50 MPa. If the elastomer is uncured, the resulting elastomer-metal assembly is simultaneously heated to a temperature of 140xc2x0 C. to 220xc2x0 C., preferably 160xc2x0 C. to 200xc2x0 C. The assembly should remain under the applied pressure and temperature for a period of 1 minute to 60 minutes, depending on the cure rate and thickness of the elastomeric substrate. If the elastomer is already cured, the bonding temperature may range from 90xc2x0 C. to above 180xc2x0 C. for 15 to 120 minutes. The bonding process may be carried out by introducing the elastomer as a semi-molten material to the metal surface as in, for example, an injection-molding process. The process may also be carried out by utilizing compression molding, transfer molding or autoclave curing techniques. After the process is complete, the bond is fully vulcanized and ready for use in a final application. The covercoat can essentially be any polymeric material-adhering adhesive, such as those described in U.S. Pat. Nos. 3,258; 3,258,389; 4,119,587; 5,200,459; 5,300,555 and 5,496,884. Elastomer-to-metal adhesive covercoats are commercially available from Lord Corporation. The invention will be described in more detail by way of the following non-limiting examples. The failure mechanism for the tested bond is expressed in terms of percent. A high percent of rubber retained (R) on the metal coupon is desirable since this indicates that the adhesive bond is stronger than the rubber itself. Rubber-cement failure (RC) indicates the percentage of failure at the interface between the rubber and the adhesive. Cement-metal failure (CM) indicates the percentage of failure at the interface between the metal substrate and the adhesive. For the boiling water test the bonded test assemblies or coupons were prepared according to ASTM-D-429-B. The leading edge of each of the assemblies was stressed by suspending a two kg weight on the overlapping rubber tail and the assembly was then mounted in a fixture so that the rubber tail was at an approximately 90xc2x0 angle to the plane formed by the bonded interface. The stressed edge interface was exposed to boiling water by immersing the coupon in boiling water for the indicated time period. After this time, the coupons were removed from the boiling water, allowed to cool and tested on either an Instron mechanical tester by pulling the rubber off the metal at a 45xc2x0 angle stripping fixture with a crosshead speed of 2 inches per minute or by manually peeling the rubber from the metal substrate. The amount of rubber retained on the bonded area is recorded as a percentage as described above. For the salt spray test the bonded test assemblies prepared according to ASTM-D-429-B were buffed on the edges with a grinding wheel. The rubber is then tied back over the metal with stainless steel wire so as to stress the bonded area. This exposes the bond line to the environment. The assemblies then are strung on stainless steel wire and placed in a salt spray chamber. The environment inside the chamber is 100xc2x0 F., 100 percent relative humidity and 5 percent dissolved salt in the spray, which is dispersed throughout the chamber. The assemblies remain in this environment for the indicated time period. Upon removal, the rubber is peeled manually from the metal substrate. The amount of rubber retained on the bonded area is recorded as a percentage as described above.

--- abstract: 'We report the growth of Nb$_{2}$Pd$_{0.73}$S$_{5.7}$ superconducting single crystal fibers via slow cooling solid state reaction method. Superconducting transition temperature ($T_{c}\sim6.5$K) is confirmed from magnetization and transport measurements. A comparative study is performed for determination of superconducting anisotropy, $\Gamma$, via conventional method (by taking ration of two superconducting parameters) and scaling approach method. Scaling approach, defined within the framework of the Ginzburg-Landau theory is applied to the angular dependent resistivity measurements to estimate the anisotropy. The value of $\Gamma$ close to $T_{c}$ from scaling approach is found to be $\sim2.5$ that is slight higher compare to conventional approach ($\sim2.2$). Further, variation of anisotropy with temperature suggests that it is a type of multi-band superconductor.' address: '$^{\mbox{a}}$ Department of physics, Indian Institute of Technology Bombay, Mumbai-400076 India' author: - 'Anil K. Yadav$^{\mbox{a,b}}$' - 'Himanshu Sharma$^{\mbox{a}}$' - 'C. V. Tomy$^{\mbox{a}}$' - 'Ajay D. Thakur$^{\mbox{c}}$' title: 'Growth and angular dependent resistivity of Nb$_{2}$Pd$_{0.73}$S$_{5.7}$ superconducting state single crystals fiber' --- introduction ============ Ternary chalcogenide of non-superconducting compound Nb$_{2}$Pd$_{0.81}$Se$_{5}$ turns into a superconductor with superconducting transition temperature $T_{c}\sim6.5$K when Se is replaced with S [\[]{}1[\]]{}. This superconductor has caused a lot of interest to research community due to its extremely large upper critical fields amongst the known Nb based superconductors and shown a possibility to grow long flexible superconducting fibers [\[]{}1,2[\]]{}. Structurally, this compound crystallizes in the monoclinic structure with symmetry $C2/m$ space group [\[]{}1,2,3[\]]{}. Its structure comprises laminar sheets, stacked along the b-axis, consisting of Pb, Nb and S atoms. Each sheet contains two unique building blocks of NbS$_{6}$ and NbS$_{7}$ atoms inter-linked by the Pd-atoms [\[]{}1,3,4[\]]{}. Yu *et al.*, have constructed the superconducting phase diagram of Nb$_{2}$Pd$_{1-x}$S$_{5\pm\delta}$ ($0.6<x<1$ ) single crystal fibers by varying composition of Pd and S and found maximum $T_{c}\sim7.43$K in Nb$_{2}$Pd$_{1.1}$S$_{6}$ stoichiometry compound [\[]{}2[\]]{}. One of the important parameter which needs to be determine precisely for this compound is the anisotropy ($\Gamma$) as it shown extremely large direction dependent upper critical field [\[]{}1[\]]{}. In the conventional approach, the anisotropy is determined as ration of two superconducting parameters (such as band dependent effective masses, penetration depth, upper critical fields etc.) in two orientations w.r.t. the crystallographic axes and applied magnetic field [\[]{}5[\]]{}. Zhang *et al.*, [\[]{}1[\]]{} have determined the temperature dependent anisotropy in this compound using the above conventional method by taking the ratio of $H_{c2}(T)$ in two orientations. However, in this case, estimation of $H_{c2}(0)$ is subject to different criteria and formalism which may introduce some uncertainty in the anisotropy ($\Gamma$) calculation [\[]{}6[\]]{}. Blatter *et al.*, have given a simple alternate way to estimate the anisotropy of a superconductor, known as the scaling approach [\[]{}7[\]]{}. In this approach, any anisotropic data can be changed into isotropic form by using some scaling rule in which only one parameter has to adjust for which all isotropic curves collapse into single curve, that adjusted parameter is anisotropy of superconductor. Thus its limits the uncertainty in the determination of $\Gamma$ as compared to the conventional approach. Employing scaling approach, Wen et al., have estimated the anisotropy of several Fe-based superconductors such as NdFeAsO$_{0.82}$F$_{0.18}$ [\[]{}8[\]]{}, Ba$_{1-x}$K$_{x}$Fe$_{2}$As$_{2}$ [\[]{}6[\]]{} and Rb$_{0.8}$Fe$_{2}$Se$_{2}$ [\[]{}9[\]]{}. Shahbazi *et al.*, have also performed similar studies on Fe$_{1.04}$Se$_{0.6}$Te$_{0.4}$ [\[]{}10[\]]{} and BaFe$_{1.9}$Co$_{0.1}$As$_{2}$ [\[]{}11[\]]{} single crystals. In this paper, we report the anisotropy estimation of Nb$_{2}$Pd$_{0.73}$S$_{5.7}$ single crystals via conventional and scaling approach methods near $T_{c}$. We also provide further evidence that the bulk superconducting anisotropy is not universally constant, but is temperature dependent down to $T_{c}$. method ====== Single crystal fibers of Nb$_{2}$Pd$_{0.73}$S$_{5.7}$ were synthesized via slow cooling of the charge in the solid state reaction method, as reported in reference [\[]{}1[\]]{}. Starting raw materials (powder) Nb (99.99%), Pd (99.99%) and S (99.999%) were taken in the stoichiometry ratio of 2:1:6 and mixed in an Ar atmosphere inside a glove box. The well-homogenized powder was sealed in a long evacuated quartz tube and heated to 800ïC with a rate of 10$^{\circ}$C/h. After the reaction for 24 hours at this temperature, the reactants were cooled down at a rate of 2$^{\circ}$C/h to 360$^{\circ}$C, followed by cooling to room temperature by switching the furnace off. As-grown samples look like a mesh of small wires when viewed under an optical microscope. Some part of the as-grown sample was dipped in dilute HNO$_{3}$ to remove the bulk material and to pick up a few fiber rods for further measurements. X-ray diffraction (XRD) was performed on powdered Nb$_{2}$Pd$_{0.73}$S$_{5.7}$ single crystal fibers for structure determination. High energy x-ray diffraction analysis (EDAX) is used to identify the chemical elements and composition. Magnetization measurement was performed using a superconducting quantum interference device - vibrating sample magnetometer (SQUID-VSM, Quantum Design Inc. USA). Angular dependent resistivity was carried out using the resistivity option with horizontal rotator in a physical property measurement system (PPMS) of Quantum Design Inc. USA. Electrical connections were made in four probe configuration using gold wires bonded to the sample with silver epoxy. Results ======= Structure analysis ------------------ Figure \[fig1\](a) shows the scanning electron microscope (SEM) image of Nb$_{2}$Pd$_{0.73}$S$_{5.7}$ single crystals fibers. It is clear from the image that the fibers are grown in different shapes and lengths. Figure \[fig1\](b) shows the XRD patterns of powdered Nb$_{2}$Pd$_{0.73}$S$_{5.7}$ single crystals. Rietveld refinement was performed on the powder XRD data using $C2/m$ monoclinic crystal structure of Nb$_{2}$Pd$_{0.81}$Se$_{5}$ as reference in the FullProf suite software. The lattice parameters ($a$= 12.154(1)A, $b$ = 3.283(7)A and $c$ = 15.09(9)A) obtained from the refinement are approximately same as reported earlier in reference [\[]{}1,3[\]]{}, even though the intensities could not be matched perfectly. Peak (200) is found to be the one with the highest intensity even when the XRD was obtained with a bunch of fibers, indicating a preferred crystal plan orientation along the ($l$00) direction in our powdered samples. Similar preferred orientation was also reported for single crystals in reference [\[]{}2[\]]{}. This may be the reason for the discrepancy in the intensities between the observed and the fitted XRD peaks. Further, to confirm the single crystalline nature of the fibers, we have taken the selective area electron diffraction (SAED) pattern of the fibers; a typical pattern is shown in Figure \[fig1\](c). Nicely ordered spotted diffraction pattern confirms the single crystalline nature of the fibers. Figure \[fig1\](d) shows the optical image of a typical cylindrical fiber of diameter $\sim1.2\,\mbox{\ensuremath{\mu}m}$ and of length $\sim1814\,\mbox{\ensuremath{\mu}m},$ which was used for the four probe electrical resistivity measurements (Fig. \[fig1\](e) shows the gold wires and silver paste used for the electrical connections). All chemical elements are found to be present in the compound with slight variation from starting composition in EDAX analysis. ![ \[fig1\] (Color online) (a) SEM image of bunch of single crystal fibers of Nb$_{2}$Pd$_{0.73}$S$_{5.7}$. (b) X-ray diffraction patterns: observed (green), calculated (red) and difference (blue) (c) SAED pattern of a single crystal fiber (d) optical image of a typical cylindrical wire used for transport study (e) Four probe connections on a fiber.](1) Confirmation of superconducting properties ------------------------------------------ In order to confirm the occurrence of superconductivity in the prepared single crystals, magnetic measurement was performed on a bunch of fibers (as alone single crystal fiber did not give large enough signal in magnetization). Figure \[fig2\] shows a part of the temperature dependent zero field-cooled (ZFC) and field-cooled (FC) magnetization measurements at H = 20Oe. The onset superconducting transition temperature ($T_{c}^{{\rm on;M}})$ is observed to be $\sim6.5$K which is taken from the bifurcation point of ZFC and FC curves. In order to confirm the superconducting nature of the grown single crystal fibers, resistivity was measured using one of the fibers removed from the ingot. We have plotted a part of resistivity measurement (in zero applied magnetic fields) in Fig. \[fig2\] along with the magnetization curve where zero resistivity transition temperature, $T_{c}^{{\rm zero}}$ matches well with the onset transition temperature of magnetization, $T_{c}^{{\rm on;M}}$ as well as the $T_{c}$ reported in reference [\[]{}1,2[\]]{}. However, the onset transition temperature from resistivity ($T_{c}^{{\rm on}}$ : the temperature at which resistivity drop to 90% from normal state resistivity) is found to be $\sim7.8$K, which is comparable to the optimized maximum $T_{c}^{{\rm on}}$ for this compound reported by Yu *et al.*, [\[]{}2[\]]{}. The narrow superconducting transition width ($\sim1.3$K) in resistivity indicates the quality of the single crystal fibers (see Fig. \[fig2\]). The residual resistivity ratio $(RRR\thickapprox\frac{R(300\,{\rm K)}}{R(8\,{\rm K)}})$, which indicates the metallicity of a material, is found to be $\sim3.4$ for our sample. This value of RRR is much less than the corresponding value for good conductors, that categorized it as bad metals.  Zero field-cooled (ZFC) and field-cooled (FC) magnetization curves at 20Oe (open circle) and resistivity measurement at zero field (open triangle). Onset superconducting transition temperature, $T_{c}^{{\rm on;M}}$, from magnetization and zero resistivity transition temperature, $T_{c}^{{\rm zero}}$, from resistivity measurements confirm the $T_{c}$ of Nb$_{2}$Pd$_{0.73}$S$_{5.7}$ superconductor.](2) Angular dependent transport properties -------------------------------------- In order to estimate the superconducting anisotropy properties, we have to assign single crystal fibers orientation axis. Since we cannot assign a growth direction for our cylindrical single crystal fibers from XRD due to very fine single crystals therefore we have adopted b-axis along length of fibers as given in reference [\[]{}1[\]]{} because of same synthesis method is followed to grow these single crystal fibers. Figures \[fig3\](a) and \[fig3\](c) show the resistivity plots as function of temperature in different applied magnetic fields from zero to 90kOe along H || b-axis and H $\bot$ b-axis. Three transition temperatures, $T_{c}^{{\rm on}}$, $T_{c}^{{\rm mid}}$and $T_{c}^{{\rm off}}$ are marked in the figure using the criteria, 90%$\rho_{n}$, 50%$\rho_{n}$ and 10%$\rho_{n}$ (where $\rho_{n}$ is normal state resistivity at 8K), respectively. The $T_{c}$ shifts toward the lower temperatures as field increases with the rate of 0.05K/kOe and 0.02K/kOe along H || b-axis and H $\bot$ b-axis, respectively. The HT phase diagrams are plotted at three transition temperatures in Figs. \[fig3\](b) and \[fig3\](d) for both the orientations. In order to find out upper critical fields ($H_{c2}(0)$), these HT curves are fitted with the empirical formula, $H_{c2}(0)=H_{c2}(T)(1-(T/T_{c})^{2})$ [\[]{}1, 2[\]]{}, further these fitted curves have been extrapolated to the zero temperature to extract the $H_{c2}(0)$ values, that come out to be $\sim$180kOe and $\sim$390kOe at $T_{c}^{{\rm on}}$ along H || b-axis and H $\bot$ b-axis, respectively. Conventionally the anisotropy is found to be $\sim2.2$, estimated by taking ratio of $H_{c2}(0)$ values in two orientations. In order to corroborate the $\Gamma$ values further, we have measured the angular dependent resistivity $\rho(\theta)$ at different magnetic fields at certain temperatures close to $T_{c}$.  Temperature dependent resistivity plots at different applied fields vary from 0kOe to 90kOe (a) for H || b-axis (c) for H $\bot$ b-axis. (b) and (d) plots show H–T phase diagrams at $T_{c}^{{\rm on}}$, $T_{c}^{{\rm mid}}$ and $T_{c}^{{\rm off}}$ transition temperatures. Dashed curves show the fitting curves corresponding empirical formula, $H_{c2}(0)=H_{c2}(T)(1-(T/T_{c})^{2})$. ](3) The insets of Figs. \[fig4\](a), (b), (c) and (d) show $\rho(\theta)$ curves at 10kOe, 30kOe, 50kOe, 70kOe and 90kOe for T = 5.0K, 5.5K, 6.0K and 6.5K, respectively. All the $\rho(\theta)$ curves show a symmetric dip at $\theta=90$$^{\circ}$ and a maximum at 0$^{\circ}$ and 180$^{\circ}$. In all the curves, the center of the dip shifts from zero to non-zero resistivity as the temperature and field increases. The main panel of the Fig. \[fig4\] shows rescaled $\rho(\theta)$ curves of 10kOe, 30kOe, 50kOe, 70kOe and 90kOe fields at temperatures (a) 5.0K (b) 5.5K (c) 6.0K and (d) 6.5K, respectively using the rescaling function: $$\tilde{H}=H\,\sqrt{{\rm sin^{2}}\theta+\Gamma^{2}{\rm cos^{2}}\theta}$$ where $\Gamma$ is anisotropy and $\theta$ is angle between the field and crystal axis. All rescaled curves at fixed temperature are now isotropic, i.e., all curves collapse on the single curve. In this method only anisotropic parameter, $\Gamma$, was adjusted to convert data into the isotropic form, that value of $\Gamma$ is the anisotropy at that temperature.  Insets of figure (a) to (d) show resistivity ($\rho$) plots as a function of angle, $\theta$ (angle between b-axis and applied magnetic fields) at fields 10kOe, 30kOe, 50kOe, 70kOe and 90kOe for temperatures (a) 5K (b) 5.5K (c) 6.0K and (d) 6.5K and main panels of figure show the resistivity plots as function of scaling field $\tilde{H}$ = $H\,\sqrt{{\rm sin^{2}}\theta+\Gamma^{2}{\rm cos^{2}}\theta}$.](4) Figure \[fig5\] shows temperature dependent anisotropy ($\Gamma(T)$) plot which is obtained from the angular resistivity data. Anisotropy decreases slowly as the temperature goes down in superconducting state. As Zhang *et al.* [\[]{}1[\]]{} have explained that this dependency of anisotropy in temperature may be due to the opening of superconducting gap of different magnitude on different Fermi surface sheets where each associated with bands of distinct electronic anisotropy. Li *et al.*, have reported similar temperature dependent anisotropy behavior for Rb$_{0.76}$Fe$_{2}$Se$_{1.6}$ , Rb$_{0.8}$Fe$_{1.6}$Se$_{2}$ , Ba$_{0.6}$K$_{0.4}$Fe$_{2}$As$_{2}$, Ba(Fe$_{0.92}$Co$_{0.08})_{2}$As$_{2}$ single crystals and explained that this may be due to the multiband effect or gradual setting of pair breaking due to spin-paramagnetic effect [\[]{}9[\]]{}. Shahbazi *et al.*, have also reported similar results for Fe$_{1.04}$Te$_{0.6}$Se$_{0.4}$ and BaFe$_{1.9}$Co$_{0.8}$As$_{2}$ single crystal through angular dependent transport measurements [\[]{}10,11[\]]{}. Various theoretical models for study of Fermi surface have supported the presence of multiband superconducting gap in Fe-based superconductors [\[]{}12,13,14[\]]{}. Here, the density functional theory (DFT) calculation indeed has shown that the Nb$_{2}$Pd$_{0.81}$S$_{5}$ superconductor is a multi-band superconductor [\[]{}1[\]]{}. Compared to MgB$_{2}$ [\[]{}15,16[\]]{} and cuprate superconductors [\[]{}17[\]]{} the anisotropy of Nb$_{2}$Pd$_{0.73}$S$_{5.7}$ is very small; however, it is comparable with some of the iron based (Fe-122 type) superconductors [\[]{}9[\]]{}.  Anisotropy variation with temperature measured from angular dependent resistivity.](5) Conclusions =========== In conclusion, we have successfully synthesized the Nb$_{2}$Pd$_{0.73}$S$_{5.7}$ single crystal fibers via slow cooling solid state reaction method. Superconducting properties of sample have been confirmed via magnetic and transport measurements. Conventionally, upper critical fields are measured from magneto-transport study. Angular dependence of resistivity are measured in presence of magnetic fields at different temperatures in superconducting state which further rescaled using a scaling function to convert isotropic form that direct provides anisotropy. The anisotropy is found to be $\sim2.5$ near $T_{c}$ which is less $\sim2.2$ compare to achieve from conventional method. Anisotropy decreases slowly with decreasing temperature, which is attributed to the multi-band nature of the superconductor. AKY would like to thank CSIR, India for SRF grant. [References]{} Q. Zhang, G. Li, D. Rhodes, A. Kiswandhi, T. Besara, B. Zeng, J. Sun, T. Siegrist, M. D. Johannes, L. Balicas, Scientific Reports, **3**, 1446 (2013).H. Yu, M. Zuo, L. Zhang, S. Tan, C. Zhang, Y. Zhang , J. Am. Chem. Soc. **135**, 12987 (2013). H. Yu, M. Zuo, L. Zhang, S. Tan, C. Zhang, Y. Zhang , J. Am. Chem. Soc.**135**, 12987 (2013). R. Jha, B. Tiwari, P. Rani, V. P. S. Awana, arXiv:1312.0425 (2013). D. A. Keszler, J. A. Ibers, M. Y. Shang and J. X. Lu, J. solid state chem. **57**, 68 (1985). W. E. Lawrence and S. Doniach, in Proceedings of the 12th International Conference Low Temperature Physics, edited by E. Kanda Keigaku, Tokyo (1971). Z. S. Wang, H. Q. Luo, C. Ren, H. H. Wen, Phys. Rev. B **78**, 140501(R) (2008). G. Blatter, V. B. Geshkenbein, and A. I. Larkin, Phys. Rev. Lett. **68**, 875 (1992). Y. Jia, P. Cheng, L. Fang, H. Yang, C. Ren, L. Shan, C. Z. Gu, H. H. Wen , Supe. Science and Technology **21**, 105018 (2008). C. H. Li, B. Shen, F. Han, X. Zhu, and H. H. Wen, Phys. Rev. B **83**, 184521 (2011). M. Shahbazi, X. L. Wang, S. X. Dou, H. Fang, and C. T. Lin, J. Appl. Phys. **113**, 17E115 (2013). M. Shahbazi, X. L. Wang, S. R. Ghorbani, S. X. Dou, and K. Y. Choi, Appl. Phys. Lett. **100**, 102601 (2012). Q. Han, Y. Chen and Z. D. Wang, EPL **82**, 37007 (2008). C. Ren, Z. S. Wang, H. Q. Luo, H. Yang, L. Shan, and H. H. Wen, Phys. Rev. Lett. **101**, 257006 (2008). V. Cvetkovic, Z. Tesanovic, Europhysics Letters **85**, 37002 (2009). A. Rydh, U. Welp, A. E. Koshelev, W. K. Kwok, G. W. Crabtree, R. Brusetti, L. Lyard, T. Klein, C. Marcenat, B. Kang, K. H. Kim, K. H. P. Kim, H.-S. Lee, and S.-I. Lee , Phys. Rev. B **70**, 132503 (2004). K. Takahashi, T. Atsumi, N. Yamamoto, M. Xu, H. Kitazawa, and T. Ishida, Phys. Rev. B **66**, 012501 (2002). C. P. Poole, Jr. H. A. Farach, J. Richard. Creswick, Superconductivity (Elsevier) (2007).

Governmental Institutions Does not Know How To Release Public Information 08.12.2009 Guria regional department for Registration and Privatization of State Property avoids release of public information. “Union for Democratic Development of Georgia” requested public information from the regional department on 28 October 2009. According to the lawyer of the same organization Irakli Papava, they requested copies of all documents about the sale of 97, 7 % shares of Ltd “Askana” in according to the resolution #8/1 of Ozurgeti district department of theMinistry of Property Management of Georgia issued on 11 February 1998. Representative of Guria regional Department for the Registration and Privatization of State Property Grigol Khurtsidze said they do not have the requested information and they should not have it as well. “However, in fact, exactly this department should release this information, because it is the legal descendent of Ozurgeti district department of the Ministry of Property Management of Georgia. Though, if this department does not have this information and even does not want to have it, they should reply to the request in written form,” said Papava. “Georgian Union for Democratic Development” will appeal to the court in these days.

Search Afropunk.com VIDEO PREMIERE: Ska band Judge Roughneck join Fishbone’s Angelo Moore in cover of classic “Mirror In the Bathroom” in new video December 1, 2016 Not many can do justice to classics, but Judge Roughneck and Fishbone’s Angelo Moore combine for this rework of The English Beat’s classic is effortless. “Mirror In The Bathroom” takes Judge Roughneck’s blend of ska & reggae to its peak, paying tribute to both the early ’80’s British 2-Tone movement and the original jazz-laced ska of Jamaica and infused with soul. The in-studio visual showcases the vibrant energy that radiates from this outfit, plenty of soul and passion to boot. Judge Roughneck’s vision came to him in the dead of night. He said, “The arrangement for ‘Mirror in the Bathroom’ came to me in a dream. In it, I heard the song how it is in the video; the tempo is slower than the original version, the style is more reggae and dub. I wrote the horn line and added the dancehall chorus. The overall outcome has a more menacing feel to it…not my intention, just the end result! Our director, Matt Nasi had some great ideas for the videos aesthetic. Angelo had a lot to do with the staging and shots as he has the most experience being in front of the camera.” And now it’s here for all of us to enjoy. Peep the video for “Mirror In The Bathroom” below!

397 F.2d 60 68-2 USTC P 12,538 Mrs. Frankie Lou Smith PRICHARD, Independent Executrix ofthe Estate of Houston Smith, Jr., Appellant,v.UNITED STATES of America, Appellee. No. 23931. United States Court of Appeals Fifth Circuit. June 20, 1968. George E. Ray, Dallas, Tex., for appellant. Melvin M. Diggs, U.S. Atty., Fort Worth, Tex., Mitchell Rogovin, Asst. Atty. Gen., Tax Div., Richard C. Pugh, Act. Asst. Atty. Gen., Meyer Rothwacks, Lee A. Jackson, Gilbert E. Andrews, Jeanine Jacobs, Attys., Dept. of Justice, Washington, D.C., for appellee. Before BELL, GODBOLD and DYER, Circuit Judges. GODBOLD, Circuit Judge: 1 This is an appeal from a judgment that appellant executrix is not entitled to refund of an alleged overpayment of estate tax on the estate of Houston Smith, 255 F.Supp. 552 (N.D.Texas 1966).1 The case concerns application of 2042 of the Internal Revenue Code, 26 U.S.C.A. 2042. The district court found for the government under sub-sections (1) and (2) of 2042. We affirm on the basis of sub-section (2), which requires inclusion in the gross estate of proceeds from insurance payable to beneficiaries other than the estate if the decedent possessed at the time of his death any incidents of ownership in the insurance. This makes unnecessary any discussion of sub-section (1). 2 The decedent, a building contractor, was a resident of Texas, a community property state. He approached Great Southern Life Insurance Company for permanent mortgage financing on a shopping center which he proposed to construct in Texas. Great Southern stated as one of its conditions for making the loan that Smith secure from it $250,000 of insurance on his life to be assigned as additional collateral. Immediately Smith applied for such a policy, on the application showing Great Southern as the proposed beneficiary and owner. The local Great Southern agent wrote on the application that the insurance was to be assigned to the company if the loan, then pending for approval, was approved. The company notified Smith it did not wish to be named beneficiary and owner, that an absolute assignment to it would be required. Mrs. Smith then was named beneficiary and owner. 3 Great Southern issued a commitment letter in a form usual in this type of transaction, committing the company to make a loan of $575,000 to Mr. and Mrs. Smith, secured by mortgage on the real estate and improvements of the shopping center.2 It contained a specific condition requiring that the $250,000 of insurance be absolutely assigned as additional collateral. Smith paid Great Southern a 'standby fee' of $5,750 for the commitment. Using the commitment to show that permanent financing had been arranged, Smith obtained interim financing from a bank for construction of the center. 4 Great Southern issued its policy on November 4, 1957 showing as beneficiary the wife if living, otherwise the surviving children of Smith by his said wife. The policy was ordinary life, with endowment at age 90. Smith was age 42 at issue. As part of the policy when issued there was attached a supplemental provision stating: 5 The application for this policy having been made by Houston Smith, Jr., insured, it is understood and agreed that the applicant having designated Frankie Lou Smith-- wife-- as the beneficiary to control this policy, it is understood and agreed that Frankie Lou Smith-- wife-- is the sole owner of this policy and shall have the power to exercise all of the privileges, benefits, rights and options granted to the insured in the policy. 6 The policy was delivered to either Mr. or Mrs. Smith, the record is not clear which. 7 On November 6 Great Southern wired its local loan representative that the leases (to shopping center tenants) had been approved, the loan approved, and the life insurance issued. Promptly thereafter construction of the center began. It was built larger than originally planned. Great Southern agreed to increase its commitment to $615,000 and issued a second commitment letter, making no charges except those necessitated by the new amount and containing a condition that the described $250,000 policy be absolutely assigned as collateral. 8 Under the terms of the policy and assignment of it had to be by Mrs. Smith as owner. (By other policy terms the right to make policy loans and the right to surrender the policy for its cash value also were in her as owner). 9 The Great Southern loan to the husband-wife community was closed July 7, 1958 when the center was complete. Necessary papers had been prepared by Great Southern; they included an absolute assignment of the insurance policy, prepared for the signatures of Mr. and Mrs. Smith, which was signed by them at the closing and delivered to Great Southern. Under the terms of the assignment Great Southern was given a lien upon the policy and the proceeds.3 The rights of the beneficiary were expressly made subordinate to Great Southern's rights under the assignment. 10 On July 15 Smith sent the original policy to Great Southern, which as assignee was entitled to possession of it. In June, 1959, Great Southern returned the policy to Smith with a form letter saying that it need no longer be held in the company's possession, that the existence of the absolute assignment had been noted on the policy and would be released when the secured indebtedness was retired. 11 Smith was killed in an automobile accident on July 2, 1960. The unpaid balance on the indebtedness at this time was $565,929.84. At the request of Mrs. Smith the company agreed to release to her $150,000 of the proceeds of the policy rather than applying all to the secured indebtedness as the company was entitled. The company stated it was doing this 'in order that it may be of some assistance to you in meeting the taxes that will be assessed against the Estate of your husband.' The other $100,000 was applied against the debt. 12 Appellant timely filed an estimated tax return. No portion of the $250,000 policy proceeds was included in the gross estate, but the entire amount of the unpaid indebtedness on the loan at the time of Smith's death was listed as a mortgage debt due Great Southern and was sought to be deducted under 2053(a) (4). On examination the commissioner included in the estate $125,000, one-half of the policy proceeds, and allowed deduction of one-half the outstanding balance on the mortgage loan. 13 Appellant paid the tax and sued for refund. From that unsuccessful suit comes this appeal. 14 The statute makes no attempt to define incidents of ownership. The regulations provide: 15 The term 'incidents of ownership' is not limited in its meaning to ownership of the policy in the technical legal sense. Generally speaking, the term has reference to the right of the insured or his estate to the economic benefits of the policy. Thus, it includes the power to change the beneficiary, to surrender or cancel the policy, to assign the policy, to revoke an assignment, to pledge the policy for a loan, or to obtain from the insurer a loan against the surrender value of the policy, etc. 16 Treas.Reg. 20.2042(1)(c). See generally Lowndes & Kramer, Federal Estate and Gift Taxation 13.6-13.8 (2d ed. 1962). This court, in Commissioner of Internal Revenue v. Chase Manhattan Bank, 259 F.2d 231 (5th Cir. 1958), refers to incidents of ownership as the whole bundle of the rights in a policy except the right to the proceeds, including 17 'the economic benefits of the insurance, the cash surrender value, the power to change the beneficiary, the power to surrender or cancel the policy, the power to assign the policy or revoke an assignment, the power to pledge the policy for a loan, the power to obtain from the insurer a loan against the surrender value of the policy.' 18 259 F.2d at 246, quoting from Benjamin & Pigman, Federal Estate and Gift Taxation of Louisiana Life Insurance, 28 Tul.L.Rev. 243, 247 (1954). 19 Section 2042(2) does not require that the decedent must have retained incidents of ownership in the insurance until his death, only that he possessed incidents of ownership at death. The language of the statute so provides. See also Lowndes & Kramer, supra 13.6.4 20 We agree fully with the conclusion of the district court that decedent enjoyed incidents of ownership which required judgment be entered for the government, although our conclusion is based on different grounds.5 21 Under Texas law a conveyance by husband to wife makes the property conveyed the wife's separate property, so that the quantum of Mrs. Smith's ownership of the policy, as a matter of state title law, was complete and sole. McAdams v. Ogletree, 348 S.W.2d 75 (Tex.Civ.App.1961); Reed v. Reed,283 S.W.2d 311 (Tex.Civ.App.1955). But we do not close our eyes to the realities. From the initial statement by Great Southern of what its conditions would be, and up to the time of Smith's death, the insurance policy and the loan were indispensable parts of an integrated transaction. The negotiations and the course of the loan transaction, the correspondence, and the other documents, admit of only one conclusion. Although Mrs. Smith was designated as owner we would be wholly unrealistic to conclude anything other than that she was named as owner under the understanding, agreement and arrangement that the policy must be assigned when the community loan was ready to be closed. The requirement that the policy be obtained and assigned was imposed before application was made for the insurance. The intent that it be assigned was reported by the agent on the original application, which was before the matter arose of Mrs. Smith's being named owner. Without an assignment by her there could be no loan to the community, and without the permanent loan the interim lender (who loaned on the faith of the Great Southern commitment for a permanent loan) could not be paid. There is no evidentiary support for any thesis that Mrs. Smith acted from a donative intent, or was lending collateral to the community, or from any intent other than carrying out the business arrangements which had been made. There is no evidence that she paid any premium. While the facts here hardly call for it, we note that we are bound to give effect to substance over form. Commissioner of Internal Revenue v. Court Holding Co., 324 U.S. 331, 65 S.Ct. 707, 89 L.Ed. 981 (1945). 22 Appellant emphasizes that the loan was closed eight months after Mrs. Smith was named owner, that had the loan never been closed the policy would have remained in force so long as the premiums were paid, that had Smith died before the loan was closed the policy would have been the property of Mrs. Smith, and had she died before the loan was closed, her husband surviving, the cash surrender or replacement value of the policy would have been includable in her estate.6 A husband may unconditionally make his wife the owner and beneficiary of an insurance policy on his life when it is issued, or later if he desires, so as to bar inclusion of it in his estate. Commissioner of Internal Revenue v. Estate of Noel, 380 U.S. 678, 85 S.Ct. 1238, 14 L.Ed.2d 159 (1965). The lapse of eight months, and the rights of the wife during that time, are evidentiary only; they are of little force here, since this was the period during which the center was being built under interim financing which was to be paid off out of the Great Southern loan upon completion. 23 Also appellant seems to contend that as a matter of law there was no incident of ownership in Smith at his death because the assignment had been made two years previously and any power or control that he may have had over the policy had been exhausted when the assignment was executed and delivered. But the arrangement existed for such a pledge or assignment to be made, and it was made, and the substantial economic benefit to the husband of having the policy stand as collateral for the community debt then commenced and continued up to his death. Smith's separate property could be liable for the community debt, 30 Tex.Jur.2d 124, and the assigned policy stood between his estate and that possible liability. (Possibly if his estate were subjected to liability it could seek reimbursement from the community estate, id. 134, but the economic benefit of protective insulation from a possible claim is not dissipated by the hope that if one is without the protection and has to pay he may-- or may not-- ultimately be made whole.) 24 An owner may lend collateral. Under different circumstances than in this case a wife who has become the absolute owner of an insurance policy on her husband's life, her husband no longer having any incidents of ownership therein, could assign it as collateral for a community debt and the husband would commence enjoying economic benefit from the time the assignment is made. Whether this alone would bring the policy within the husband's estate is a question for another case. It is not what happened in this case where in the total transaction there were incidents of ownership at all times, an unconsummated arrangement for eight months followed by the continuing economic benefit of the completed assignment. 25 There was testimony, though somewhat sparse, of the wife that during a period of about six months before discussion of the mortgage with Great Southern she and her husband discussed with various insurance agents the purchase of a large amount of insurance on his life to replace earlier policies which he had dropped; the Smiths felt they might afford the premiums which previously they had been unable to keep up, and the two of them saw in insurance a means of saving for the education of their children. This too was only evidentiary, and even if these family motivations were present they did not preclude the use of the policy in the manner that was required, arranged for and carried out. 26 Because we affirm under 2042(2) we do not discuss the applicability of 2042(1). The decision of the district court is 27 Affirmed. 1 The decision of the district court is discussed in Thies, Prichard Decision Confuses Estate Taxation of Life Insurance Receivable by the Executor, 25 J. of Taxation 291 (1966) 2 The commitment was for a 15-year mortgage, and it included conditions of completion of improvements, inspection and acceptance of improvements by Smith and Great Southern and the chief tenants, payment for all labor and material bills, survey, execution of satisfactory leases by tenants, and other normal requirements 3 In case of default on the mortgage note Great Southern was authorized to make policy loans or surrender the policy and withdraw the cash value, applying to the note proceeds so collected. If the proceeds became payable as a death claim Great Southern had the right, regardless of whether there had been a default in the note payments, to collect the proceeds, to apply them to any default existing, and, at its option, to apply the remainder to the payment of the last maturing installments owing on the indebtedness although not then due. Great Southern's rights under the assignment could be exercised without the necessity of resoring to, and without regard to, other security 4 Compare the wording of 2037, which requires that a reversionary interest be retained 5 The district court described the loan as being to Smith and as contingent on an assignemnt of the policy by him, and referred to the assignment as having been made by him and to his possessing incidents of ownership in making the assignment. Commitment and loan were to the community, and, under the terms of the policy commitment read together, assignment by the wife as owner was requisite. The critical time for determining whether decedent possessed incedents of ownership was at the time of death, not at the time of assignment. 26 U.S.C.A. 2042(2); First National Bank of Birmingham, Alabama v. United States, 358 F.2d 625 (5th Cir. 1966) 6 See Estate of Donaldson v. Commissioner, 31 T.C. 729 (1959)

Effect of stable xenon in room air on regional cerebral blood flow and electroencephalogram in normal baboons. Measurement of regional cerebral blood flow (rCBF) was performed in 6 healthy baboons during ventilation with 35% stable xenon in artificial air. rCBF was measured with the intraarterial xenon-133 method. EEG was recorded continuously. All CBF areas of interest over one hemisphere reacted in the same way. Mean flow increased during short-term exposure to stable xenon and decreased if stable xenon inhalation was continued for at least 24 minutes. EEG showed a decrease of alpha- and beta-wave patterns a short time after the start of stable xenon inhalation without further changes over the period when rCBF finally decreased. CO2 reactivity increased in most animals, and autoregulation to mild arterial hypotension was significantly impaired with increased flow. It is concluded that 35% stable xenon in artificial air increases rCBF after short-term exposure and decreases rCBF after longer exposure. EEG changes were noted after short-term exposure. rCBF and EEG recovered rapidly after the end of stable xenon inhalation.

ESD Posidriv Screwdrivers Quotation Thank you for your interest on HyperClaw ESD Posidriv Screwdrivers. As we make high quality ESD Posidriv Screwdrivers with reasonable price and good service, you are highly welcome to fill the quotation form below for good ESD Posidriv Screwdrivers. If, however, you are looking for cheap ESD Posidriv Screwdrivers of cheap quality and cheap service, please save your time NOT to fill the form. Also, we are a professional pliers manufacturer, we do not sell pliers by retail.

#ifndef OPENTISSUE_CORE_CONTAINERS_GRID_UTIL_GRID_BISECTION_LINE_SEARCH_H #define OPENTISSUE_CORE_CONTAINERS_GRID_UTIL_GRID_BISECTION_LINE_SEARCH_H // // OpenTissue Template Library // - A generic toolbox for physics-based modeling and simulation. // Copyright (C) 2008 Department of Computer Science, University of Copenhagen. // // OTTL is licensed under zlib: http://opensource.org/licenses/zlib-license.php // #include <OpenTissue/configuration.h> #include <OpenTissue/core/containers/grid/util/grid_gradient_at_point.h> namespace OpenTissue { namespace grid { /** * Grid Bisection Line Search * * @param q_a * @param q_b * @param phi * @param maximize If true the bisection method tries to find the maximimum value between q_a and q_b otherwise it tries to find the minimum value. * * @return The point that maximizes the value of phi on the line between q_a and q_b. */ template<typename vector3_type,typename grid_type> inline vector3_type bisection_line_search(vector3_type q_a, vector3_type q_b, grid_type & phi, bool maximize = true) { using std::fabs; typedef typename vector3_type::value_type real_type; real_type const precision = 10e-5;//OpenTissue::math::working_precision<real_type>(100); real_type const too_small_interval = sqr_length(q_b-q_a)*0.0001; //--- 1/100'th of distance! vector3_type n = unit(gradient_at_point(phi,q_a)); vector3_type r; real_type const sign = maximize? 1.0 : -1.0; bool forever = true; do { vector3_type q_c = (q_a + q_b)*.5; if( sqr_length(q_a - q_b) < too_small_interval ) { r = q_c; break; } vector3_type dir = unit(gradient_at_point(phi,q_c)); real_type n_dot_dir = inner_prod(n , dir)*sign; if(fabs(n_dot_dir) < precision) { r = q_c; break; } if(n_dot_dir > 0) { q_a = q_c; } if(n_dot_dir < 0) { q_b = q_c; } } while (forever); return r; } } // namespace grid } // namespace OpenTissue // OPENTISSUE_CORE_CONTAINERS_GRID_UTIL_GRID_BISECTION_LINE_SEARCH_H #endif

Angela Merkel endorses burka ban 'wherever legally possible' Published duration 6 December 2016 image copyright AFP image caption Mrs Merkel retains wide support but she faces a tough challenge from populists German Chancellor Angela Merkel has said the wearing of full-faced veils should be prohibited in the country "wherever it is legally possible". At a meeting of her CDU party, she backed a burka ban in schools, courts and other state buildings. It is widely accepted that a total ban would violate Germany's constitution. Mrs Merkel was re-elected CDU leader but faces a tough challenge by the right-wing anti-immigration AfD party in next year's polls. She has seen her approval ratings slip since her decision to allow about a million asylum seekers into Germany during last year's Europe-wide migrant crisis. However the centre-right chancellor, who has been power since 2005, still retains wide support. She was re-elected Christian Democratic Union (CDU) leader on Tuesday with 89.5% of the votes cast by about 1,000 delegates. The politics of symbolism - Jenny Hill, BBC News, Essen Mrs Merkel's comments drew thunderous applause from her party faithful but it will dismay those who have looked to her as Europe's defender of liberal values. German constitutional law would probably prevent the CDU from seeking a complete ban on burkas in public. Nevertheless, Mrs Merkel made her distaste for full face veils clear. In practice, very few women cover their faces in Germany. But this is about symbolism. Mrs Merkel has faced significant party and public anxiety about the integration of about a million asylum seekers. She has gradually hardened her asylum policy, making it easier, for example, to deport foreign-born criminals. And this is also about timing. Tuesday's speech in effect sets out the CDU stall ahead of next year's general election. Mrs Merkel's conservatives, like other established parties, are losing votes to the AfD. Even she admits this will be the toughest election she has ever fought. Mrs Merkel told the annual CDU congress in the city of Essen that it was right to expect integration from newcomers. She expressed support for a proposal, outlined in August by Interior Minister Thomas de Maiziere, to outlaw the burka or any full-face veil in public buildings. image copyright AFP image caption Mrs Merkel's right-wing opponents accuse her of presiding over the Islamisation of society In German culture, she said, it was not appropriate for women to completely cover their faces and the full veil "should be banned wherever it is legally possible". The BBC's Jenny Hill says it is the first time that the chancellor has made such comments in a major speech. In recent months, the Alternative fur Deutschland (AfD) has capitalised on a wave of anger over last year's migrant crisis, and made strong gains in regional elections. Polls suggest the AfD currently has 12% support nationally. Its success is mirrored by that of populist, anti-establishment parties in other European countries where elections are also due next year. In France - where the full-face veil has been banned in all public places since 2010 - the far-right National Front (FN) is credited with 30% support ahead of a presidential poll.

I've been trying to build a UR deck involving my favorite card in Innistrad, Ludevic's Test Subject. The goal is to use Delvers and control early game to keep the field level, keeping a draw-go type deck. Ludevic's abomination is a mana dump, and him flipping typically will win the match if he's not dealt with quickly. Originally the deck had 4 fling, but I realized that the card really hurt my card advantage if not used sparingly. The prospect of flipping the Test Subject, Swing, Fling for 26 damage turn 5 is too hilarious to pass up however, so it stayed as a 2of. Fling also works wonders with the charmbreaker devils w/ the pike. And as a last resort, in response to a Doomblade or etc, fling as a last bit of oomph out of the bigger cards. I've play tested it only slightly, and I'll be taking it to FNM this week. Please comment and critique! I want to build the deck as a direct response to a lot of the threats currently in the meta, and any constructive comment is a good one! Thanks!

Enhanced catalytic activity of α-FeOOH-rGO supported on active carbon fiber (ACF) for degradation of phenol and quinolone in the solar-Fenton system. A new heterogeneous solar-Fenton catalyst, α-FeOOH-reduced graphene oxide (rGO) supported on active carbon fiber (ACF), was synthesized via in situ electrophoretic deposition in a self-assembly process. Optimization of the components (electrophoretic deposition time of GO and Fe, GO dosages), the effect of pH and the catalysts stability were investigated systematically. The results indicated that rGO-α-FeOOH composite is formed during the ferrous-ion-induced self-assembly process on ACF. FeOOH-rGO/ACF displayed excellent catalytic activity for degrading phenol and quinoline under the solar-driven photo-Fenton process in a wide range of pH values (4.5-9.5) and possess good stability in neutral condition. The phenol oxidation process on this catalyst was described by a pseudo-first-order kinetics model. Both the ACF support and solar irradiation promoted greater H2O2 decomposition and produced more OH radicals, thus, significantly improving the catalytic capacity. The introduction of graphene improved the catalytic capacity of the catalyst under solar irradiation. The optimal electrophoretic deposition time of GO and the optimal Fe and initial GO content in deposition were 10 min, 9.8 wt% and 15.0 wt%, respectively. The degradation pathways of phenol and quinoline in the solar-driven photo-Fenton process were also elucidated.

By PocketSensei Description After nine months of development in close consultation with some of the world's finest gymnastic gyms in the United States and Eastern Europe, it's finally here! Elite Club Women's Gymnastics Card Maker is the first app to support gymnastic clubs with a host of exciting features. Whether your gym caters to beginning gymnasts or wold-class athletes, ECWG can help organize, inspire and promote your team. Elite Club covers each of the major varieties of gymnastic events for women recognized by the Fédération Internationale de Gymnastique (FIG). In artistic gymnastics the app includes gymnast profiles for vault, uneven bars, balance beam and floor events. In rhythmic gymnastics, hoop, ball, clubs and ribbons are covered. Even the relatively new sport of trampolining is accommodated with individual trampoline, synchronized trampoline, double mini trampoline and tumbling. Both the current Code of Points established in 2006 and the legacy Code (with its popular perfect 10 score) are supported within Elite Club's intuitive graphical user interface. Gymnasts, coaches and club administrators will all enjoy creating spectacular albums to showcase their club and individual gymnasts. Finished profiles can be promoted over Twitter, Facebook and other social media or emailed to recruiters at prospective colleges. From top to bottom, Elite Club Women's Gymnastics is designed to build your club to national, then global, prominence. Advance praise: ***** "Elite Club is just the jolt of innovation the gymnastics community has been looking for!" ***** "This is the first app to uniquely target women's gymnastics and give it the attention it is due!" ***** "Elite Club is an awesome app for one of the world's most awesome sports." ***** "Gymnastics have never looked so good! The app has the potential to inspire a new generation of champions."

Background {#Sec1} ========== Contamination of surface and groundwater by trace metals results in the deterioration of water quality which affect human health as well as the health of aquatic ecosystem (Krishna et al. [@CR4]; Bataynen [@CR2]). Trace metals in the aquatic environment creates an immense threat to the existence of organisms thriving in the area and the ecological integrity of the habitat, particularly as trace metals may enter the food chains, persist in the environment, bioaccumulate and bio-magnify. Though some trace metals in lower concentrations play important roles in metabolic processes of living organisms, high concentration have been observed to be toxic for human and aquatic life (Ouyang et al. [@CR4]; Adepoju-Bello et al. [@CR1]). High concentration of trace metals in water sources may lead to adverse effects such as deformities, cancer and bad health of aquatic animals and their terrestrial predators (Coeurdassier et al. [@CR2]; Volpe et al. [@CR15]; Kavacar et al. [@CR11]). In humans trace metals above certain concentrations may lead to health problems including liver diseases, kidney problems and Geno toxic carcinogens (Knight et al. [@CR12]; Gambrell [@CR2]). Metals enter rivers and lakes through a variety of sources such as eroded minerals within sediments, leaching of ore deposits, decomposing dead organic matter, fallout of atmospheric particulate and volcanism extruded products or anthropogenic sources including the discharge of liquid and solid waste, industrial or domestic effluents, channel and lake dredging etc. (Marcovecchio et al. [@CR11]). Trace metals enter the human body through several routes such as food chain, direct ingestion, dermal contact, fume inhalation and particles through mouth and nose (Li and Zhang [@CR19]; Wu et al. [@CR11]; USEPA [@CR12], [@CR4]). For effective assessment of water quality it is important to identify potential human health effects of pollution in water. The traditional method for evaluating health effects directly compare the measured values with permissible limits, but it is not sufficiently reliable to provide detailed hazard levels and identify contaminants of the most concern. Health risk assessment is an important tool for estimating the potential health impact in aquatic ecosystems caused by various contaminants (Wu et al. [@CR12]; Iqbal and Shah [@CR2]). This method has been applied to evaluate the potential adverse health effects from exposure to contaminated water (Kavacar et al. [@CR11]; Hartley et al. [@CR9]; Sun et al. [@CR36]). Although ingestion is considered the primary route of exposure to chemical contamination in drinking water sources inhalation and dermal absorption are increasingly being taken into account as important exposure pathways. Lakes have important multi usage components including source of drinking water, irrigation, shipping, fishing, land scape entertainment and hydro-energy production (Yu et al. [@CR39]). The Bosomtwe Crater lake which is a natural inland freshwater that originated from meteorite impact (Koeberl et al. [@CR9]) and serve many functions including water for drinking and domestic use, fishing, transportation, tourism and landscape entertainment. Therefore safeguarding the quality of water in the lake and its surroundings is a great responsibility of the Government of Ghana, researchers and environmentalist for the conservation of this important water resource and world heritage site. However, there is limited information on the effects of the different anthropogenic activities on the water quality and the resultant health effects of the Bosomtwe Crater Lake. The aim of the study is to determine the levels of the selected metals (As, Cu, Fe, Cr, Cd and Pb) in the lake and groundwater and to evaluate the health risk associated with expose to these metals through oral ingestion and absorption through the skin. These metals were selected based on the dominant anthropogenic activities around the lake which include agriculture, proliferation of artisanal gold mining which contribute to soil pollution and land degradation, with the attendant exposure of the environment to trace metals pollution. Methods {#Sec2} ======= The study area {#Sec3} -------------- Lake Bosomtwe is centered at 06°32′N and 1°25′W and is one of the nineteen (19) confirmed impact structures known on earth and has an age of 1.07 million years. According to Koeberl et al. ([@CR9]) it is associated with one of the four tektites strewn fields in the Cote d'Ivoire tektite field. The lake is completely filled with water in a circular structure of roughly 8.5 km in diameter with a rim-to-rim diameter of about 10.5 km and has a depth of about 78--80 cm in its central part (Watkins [@CR36]). The vegetation of the region around the lake is widely that of a dense tropical rainforest. The hydrogeology of the basin is dominated by aquifers of the crystalline basement rocks and the Birimian Province. Groundwater occurs mainly in the Birimian geological formations made up of the Lower Birimian (metasediment rocks) and the Upper Birimian (metavolcanic rocks). The Lower Birimian comprises of over 80 % of the total landmass of the basin while the Upper Birimian crops out in the eastern and extreme southern sections of the basin. Since the lake is a hydrological basin (Turner et al. [@CR11]) all pollutants remain in the lake resulting in a complex and fragile ecosystem as they do not have self-cleaning ability and therefore readily accumulate pollutants (Lokeshwari and Chamdrappa [@CR15]). The main occupation of the people around the lake is fishing and farming but quite recently there is a proliferation of artisanal gold activities around the area. Sampling and analysis {#Sec4} --------------------- Water samples were collected from the lake and bore holes from seven human settlements around the Bosomtwe Crater Lake namely at Anyinatiase, Nkowi, Adwafo, Abrodwum, Obo, Abono and Abease as indicated in Fig. [1](#Fig1){ref-type="fig"}. Sampling was done every 3 months from November, 2012 to August, 2013.Fig. 1Map of study area showing towns where samples were taken in the Bosomtwe Crater Lake area Samples were collected into sterile screw capped plastic containers which had been washed with detergents, 4.0 mol dm^−3^ nitric acid solution and distilled water and dried in an oven. The pH, conductivity total dissolved solids and temperature were measured on the site using CyberScan PC 650 multimeter whilst turbidity was measured with a Hanna HI 93414 turbidity meter. The samples were then filtered through pre-washed 0.45 μm Millipore nitrocellulose filters to remove any suspensions, acidified with 6 M Analar HNO~3~ (2 ml l^−1^) to keep pH \< 2 (USEPA [@CR39]), transported in an ice chest to the laboratory and stored at −4 °C in a refrigerator. The trace metals were determined using Atomic Absorption Spectrophotometer (Model; Varian 220) using air-acetylene flame at a temperature of about 2300 °C. The appropriate hollow cathode lamps (HCL) for each of the elements As, Fe, Pb, Zn, Cr, Cd and Ni were employed as common radiation source at operating wavelengths of 193.7, 248.3, 217.0, 213.9, 357.9, 228.8 and 232.0 nm respectively. Quality control {#Sec5} --------------- Quality control measures for the analysis were implemented through the analytical protocols, including sampling and sample preservation, instrument performance evaluation, calibration of instrument, recovery and reagent blank and replicate analyses. The instrument performance evaluation involved optimizing instrument parameters followed by sensitivity check. Statistical analysis {#Sec6} -------------------- The results were analyzed statistically employing Microsoft Excel (2010 edition) and statistical Package for Social Science (IBM SPSS version 20). Multivariate statistics in terms of principal component analysis (PCA) cluster analysis were carried out using the varimax-normalized rotation on the data (Shah et al. [@CR2]; Iqbal and Shah [@CR2]). Health risk assessment methodologies {#Sec7} ------------------------------------ The human health risk assessment methodologies for aquatic ecosystems has been described literature (Li and Zhang [@CR19]; USEPA [@CR12], [@CR19]; Wu et al. [@CR11]). The ingestion and dermal absorption are common for water exposure (USEPA [@CR12], [@CR19]; Wu et al. [@CR11]). The numeric expressions for risk assessment as obtained from the USEPA Risk Assessment Guidance for Superfund (RAGS) methodology (USEPA [@CR12]) are given as follows:$$\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$D_{\text{ing}} = \frac{Cwater \times IR \times EF \times ED}{BW \times AT}$$\end{document}$$ $$\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$D_{\text{derm}} = \frac{Cwater \times SA \times KP \times ET \times EF \times ED \times CF}{BW \times AT}$$\end{document}$$where *D* ~ing~ is exposure dose through ingestion of water (μg/kg/day); *D* ~derm~ is exposure dose through dermal absorption (μg/kg/day); *C* water is concentration of the estimated metals in water (μg/L); IR is ingestion rate (2.2 L/day for adults; 1.8 L/day for children); EF is exposure frequency (350 days/year); ED is exposure duration (70 years for adults; and 6 years for children); BW is average body weight (70 kg for adults; 15 kg for children); AT is averaging time (25,550 days for adults; 2190 days for children); SA is exposed skin area (18,000 cm^2^ for adults; 6600 cm^2^ for children); ET is exposure time (0.58 h/day for adults; 1 h/day for children); CF is unit conversion factor (0.001 L/cm^3^); and *Kp* is dermal permeability coefficient (cm/h). The dermal permeability coefficient for Fe, Pb, Zn, Cr and Ni are given as 1.0 × 10^−3^, 4.0 × 10^−3^, 6.0 × 10^−3^, 2.0 × 10^−3^ and 4.0 × 10^−3^ cm/h respectively (USEPA [@CR12], [@CR19]; Wu et al. [@CR11]; Liang et al. [@CR2]). Potential non-carcinogenic risks for exposure to contaminants were determined by comparing the calculated contaminant exposures from each exposure route with the reference dose (RfD) (USEPA [@CR12]). The hazard quotient (HQ) which is a numeric estimate of the systemic toxicity potential posed by a single element within a single route of exposure was calculated using the relation:$$\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$HQ_{\text{ing/derm}} = \frac{{D_{ing/derm} }}{{RfD_{ing/derm} }}$$\end{document}$$where HQ~ing/derm~ is hazard quotient via ingestion or dermal contact and Rf*D* ~ing/derm~ is oral/dermal reference dose (μg/kg/day). The Rf*D* ~ing~ and Rf*D* ~derm~ values were obtained from the literature (Li and Zhang [@CR19]; USEPA [@CR12]; Wu et al. [@CR11]; Liang et al. [@CR2]). The overall potential for non-carcinogenic effects posed by more than one element was evaluated by integrating the computed HQs for each element and expressed as a hazard index (HI) (USEPA [@CR12]):$$\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${\text{HI}} = \mathop \sum \limits_{i = 1}^{n} HQ_{ing/derm}$$\end{document}$$where HI~ing/derm~ is hazard index via ingestion or dermal contact. Chronic daily intake (CDI) was calculated using the relation:$$\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${\text{CDI}}_{\text{ing}} = {\text{C}}_{\text{water}} \times \frac{DI}{BW}$$\end{document}$$where C~water~, DI and BW represent the concentration of trace metal in water in (µg/kg), average daily intake of water and body weight respectively. Cancer risk (CR) was calculated using the formula:$$\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${\text{CR}}_{\text{ing}} = \frac{{D_{ing} }}{{SF_{ing} }}$$\end{document}$$where SF~ing~ is the cancer slop factor. The SF~ing~ for Pb is 8.5 and Cr is 5.0 × 10^2^ mg/kg/day (USEPA [@CR12], [@CR19]; Yu et al. [@CR4]; Vieira et al. [@CR2]). Results and discussion {#Sec8} ====================== Table [1](#Tab1){ref-type="table"} shows the mean pH, temperature and conductivity of water samples from Lake Bosomtwe and Groundwater in some towns around the lake in the wet and dry seasons. Table [2](#Tab2){ref-type="table"} also show the mean concentrations of As, Fe, Pb, Zn, Cr, Cd and Ni in water samples from Lake Bosomtwe and Groundwater in some towns around the lake in the wet and dry seasons. The values show that the water from the lake in the dry season is alkaline with the pH values above the recommended WHO standards of 6.50--8.50. However, the pH for lake water in the wet season and those of the groundwater for both dry and wet seasons were observed to be within the WHO range. These values indicate that there was not much difference in the pH in both the water from the lake and groundwater in the surroundings. Thus there in no significant variability of pH due to seasonal contamination. Almost all the water from the lake has the average temperature of 30 °C and the water from the groundwater has the average temperature of 29 °C. Generally the mean conductivities were high indicating that the water contains large amounts of ions which were responsible for such conductivities (APHA [@CR2]: Jain et al. [@CR15]). The health effects for consuming water with high conductivity are the disturbances of salt and water balance which have adverse effects on some myocardial patients and individuals with high blood pressure (Fatoki and Awofulu [@CR11]). The total dissolved solids which may be a measure of the dissolution mechanism of inorganic and organic materials in water for both groundwater and lake water were generally low and below the WHO value of 1000 mg/L for both seasons. Turbidity was also low for both sources of water for both dry and wet seasons and were also below the WHO limit of 5 NTU. Turbidity in water is caused by colloidal matters or suspended particles that obstruct light transmission through the water may originate from the presence of inorganic or organic matter or the combination of both.Table 1Mean values of some physical parameters in lake and groundwater samples collected from seven human settlements along the Bosomtwe Crater Lake in dry and wet seasonsSeasonSettlementLake waterGroundwaterpHTemperature (°C)TDS (mg/L)Turbidity/NTUConductivity (µs cm^−1^)pHTemperature (°C)TDS (mg/L)Turbidity/NTUConductivity (µs cm^−1)^Dry (\*N = 105)Anyinatiase9.83 ± 0.0130.00 ± 0.00237.40 ± 5.461.32 ± 0.031263.40 ± 8.636.77 ± 0.2729.00 ± 0.00197.99 ± 7.011.00 ± 0.011375.60 ± 177.91Nkowi9.77 ± 0.0130.00 ± 0.00215.25 ± 3.580.71 ± 0.011307.30 ± 73.117.19 ± 0.3031.00 ± 1.41178.79 ± 3.210.97 ± 0.011277.10 ± 3.96Adwafo9.82 ± 0.0230.00 ± 0.00215.80 ± 3.450.87 ± 0.041201.10 ± 41.447.18 ± 0.1429.00 ± 1.41200.46 ± 2.320.80 ± 0.031395.00 ± 26.09Abrodwum9.75 ± 0.0130.00 ± 0.00206.03 ± 4.681.06. ± 0.021250.45 ± 8.277.42 ± 0.1628.00 ± 0.00198.77 ± 4.330.71 ± 0.021242.35 ± 9.69Obo9.71 ± 0.0129.00 ± 0.00197.95 ± 5.210.90 ± 0.021787.05 ± 172.757.14 ± 0.0430.00 ± 0.00189.33 ± 1.240.67 ± 0.011285.28 ± 0.95Abono8.98 ± 0.0028.50 ± 0.00208.10 ± 4.280.88. ± 0.041266.23 ± 6.757.19 ± 0.0930.00 ± 0.00199.87 ± 2.450.42 ± 0.011264.60 ± 5.37Abease9.82 ± 0.0230.00 ± 0.00197.95 ± 3.321.00 ± 0.021197.35 ± 60.607.34 ± 0.2329.50 ± 0.71200.06 ± 3.420.50 ± 0.001238.63 ± 24.71Wet (\*N = 105)Anyinatiase6.88 ± 0.1129.00 ± 0.00206.70 ± 4.110.90 ± 0.021241.85 ± 6.726.77 ± 0.2729.00 ± 0.00256.87 ± 5.580.90. ± 0.021356.1 ± 150.40Nkowi6.99 ± 0.0131.50 ± 0.71199 67 ± 3.241.64 ± 0.011264.90 ± 37.907.19 ± 0.3031.00 ± 1.41211.43 ± 3.421.10 ± 0.031277.05 ± 3.89Adwafo7.14 ± 0.0829.50 ± 0.71180.14 ± 4.380.95 ± 0.031212.65 ± 24.827.18 ± 0.1429.00 ± 1.41209.76 ± 5.620.90 ± 0.011392.38 ± 24.25Abrodwum7.48 ± 0.0828.00 ± 0.00200.84 ± 3.681.23 ± 0.031260.00 ± 10.897.42 ± 0.1628.00 ± 0.00198.77 ± 4.180.81 ± 0.011218.35 ± 24.25Obo7.13 ± 0.0330.00 ± 0.00189.23 ± 5.131.32 ± 0.041269.75 ± 0.787.14 ± 0.0430.00 ± 0.00202.33 ± 3.010.78 ± 0.011282.30 ± 3.25Abono7.16 ± 0.0630.00 ± 0.00217.54 ± 3.560.98 ± 0.011243.50 ± 12.737.19 ± 0.0930.00 ± 0.00199.87 ± 4.320.52 ± 0.001260.55 ± 0.35Abease7.25 ± 0.1129.75 ± 0.35170.44 ± 2.311.02 ± 0.031258.15 ± 0.927.34 ± 0.2329.50 ± 0.71188.96 ± 2.340.61 ± 0.011238.30 ± 25.17\* N = sample size, i.e. 5 samples each for groundwater and lake water for each of the 7 settlements for 3 months within each season Table 2Mean concentrations in mg/L of some trace metals in water samples collected from seven human settlements along the Bosomtwe Crater Lake in the dry and wet seasonsSeasonSettlementLake waterGroundwaterAsFePbZnCrCdNiAsFePbZnCrCdNiDry (\*N = 105)Anyinatiase\<0.010.20 ± 0.020.17 ± 0.010.12 ± 0.010.03 ± 0.00\<0.01\<0.01\<0.010.57 ± 0.410.12 ± 0.000.14 ± 0.000.01 ± 0.00\<0.01\<0.01Nkowi\<0.010.37 ± 0.080.06 ± 0.070.21 ± 0.000.01 ± 0.00\<0.01\<0.01\<0.010.28 ± 0.040.10 ± 0.010.28 ± 0.000.02 ± 0.00\<0.01\<0.01Adwafo\<0.010.22 ± 0.020.13 ± 0.010.10 ± 0.00\<0.01\<0.01\<0.01\<0.010.58 ± 0.080.17 ± 0.010.25 ± 0.000.03 ± 0.01\<0.01\<0.01Abrodwum\<0.010.28 ± 0.040.14 ± 0.030.14 ± 0.000.05 ± 0.00\<0.01\<0.01\<0.010.20 ± 0.010.16 ± 0.020.13 ± 0.000.02 ± 0.00\<0.01\<0.01Obo\<0.010.38 ± 0.050.07 ± 0.000.21 ± 0.01\<0.01\<0.01\<0.01\<0.010.42 ± 0.040.10 ± 0.010.20 ± 0.000.02 ± 0.00\<0.01\<0.01Abono\<0.010.35 ± 0.040.09 ± 0.010.13 ± 0.010.02 ± 0.00\<0.010.02 ± 0.00\<0.010.29 ± 0.050.09 ± 0.010.19 ± 0.010.03 ± 0.00\<0.010.02 ± 0.00Abease\<0.010.27 ± 0.020.16 ± 0.020.12 ± 0.000.02 ± 0.00\<0.010.02 ± 0.00\<0.010.21 ± 0.010.16 ± 0.030.12 ± 0.010.02 ± 0.00\<0.010.02 ± 0.00Wet (\*N = 105)Anyinatiase\<0.010.27 ± 0.120.11 ± 0.030.18 ± 0.030.02 ± 0.01\<0.01\<0.01\<0.011.02 ± 1.290.12 ± 0.000.15 ± 0.000.02 ± 0.00\<0.01\<0.01Nkowi\<0.010.29 ± 0.060.10 ± 0.000.12 ± 0.050.01 ± 0.00\<0.01\<0.01\<0.010.39 ± 0.070.09 ± 0.010.28 ± 0.000.01 ± 0.01\<0.01\<0.01Adwafo\<0.010.28 ± 0.030.09 ± 0.020.11 ± 0.000.02 ± 0.00\<0.01\<0.01\<0.010.53 ± 0.050.07 ± 0.090.25 ± 0.010.03 ± 0.02\<0.01\<0.01Abrodwum\<0.010.37 ± 0.050.05 ± 0.050.14 ± 0.000.02 ± 0.00\<0.01\<0.01\<0.010.32 ± 0.060.07 ± 0.080.14 ± 0.010.02 ± 0.00\<0.01\<0.01Obo\<0.011.99 ± 0.770.06 ± 0.000.16 ± 0.030.01\<0.01\<0.01\<0.010.46 ± 0.050.07 ± 0.020.15 ± 0.030.01 ± 0.01\<0.01\<0.01Abono\<0.010.49 ± 0.080.04 ± 0.020.12 ± 0.010.02 ± 0.00\<0.010.02\<0.010.37 ± 0.050.05 ± 0.020.22 ± 0.010.02 ± 0.00\<0.010.19 ± 0.05Abease\<0.010.30 ± 0.020.07 ± 0.080.09 ± 0.010.02 ± 0.00\<0.010.02\<0.010.26 ± 0.030.06 ± 0.070.16 ± 0.020.01 ± 0.00\<0.010.19 ± 0.03\* N = sample size, i.e. 5 samples each for groundwater and lake water for each of the 7 settlements for 3 months within each season Trace metals {#Sec9} ------------ The mean levels of trace metals showed generally no significant differences between lake and groundwater or during the dry and wet seasons (Table [2](#Tab2){ref-type="table"}). The levels of the metals arsenic and cadmium, were generally small and generally below the detection limit of the instrument, Varian AAS 220 used which is 0.01 mg/L. This shows that their levels may be below those of WHO standard values of 0.01 mg/L for As, 0.003 mg/L for Cd and 0.02 mg/L for Ni. Fe recorded mean levels in the range of 0.20 ± 0.02--0.38 ± 0.05 mg/L and 0.20 ± 0.01--0.58 ± 0.08 mg/L in lake water and groundwater respectively in the dry season for all the sampling stations. In the wet season the mean values recorded for Fe were in the range of 0.27 ± 0.12--1.99 ± 0.77 mg/L and 0.26 ± 0.03--1.02 ± 1.02 mg/L for lake water and groundwater respectively. These give rise to overall mean values for both lake and groundwater around Lake Bosomtwe exceeding the WHO standard value of 0.3 mg/L ([@CR45]). Large amount of ingested iron may results in high iron levels in the blood which lead to reaction between iron and peroxides to produce free radicals. These free radicals are highly reactive and can damage DNA, protein lipids and other cellular components. Iron typically damage cells in the heart, liver and elsewhere which can cause significant adverse effect including coma, metabolic acidosis, shock, liver failure, coagulopathy, adult respiratory distress syndrome, long-term organ damage and even death (Dina et al. [@CR9]; Alada, [@CR2]; Ferner [@CR12]). Pb recorded mean levels in the range of 0.06 ± 0.07--0.17 ± 0.01 mg/L and 0.09 ± 0.01--0.17 ± 0.00 mg/L in lake water and groundwater respectively in the dry season for all the sampling stations. In the wet season the mean values recorded for Pb were in the range of 0.04 ± 0.02--0.11 ± 0.03 mg/L and 0.06 ± 0.07--0.12 ± 0.00 mg/L for lake water and groundwater respectively. All the recorded mean levels for Pb were above the WHO recommended standard of 0.01 mg/L. Mean Pb levels were generally relatively higher in the wet season than the dry season both lake and groundwater (Table [2](#Tab2){ref-type="table"}). Lead damages the nervous connections especially in young children and cause blood and brain disorders. Lead poisoning typically results from ingestion of food and water contaminated with lead. Several studies have shown that chronic lead exposure reduces nerve conduction velocity in peripheral nerves in adult subjects without clinical symptom or sign of disease (Skerfring [@CR15]). Long-term exposure to lead cause small increase in blood pressure especially middle-aged and older people and can cause anaemia. Exposure to high level can severely damage the brain and kidney in males (Golub [@CR15]). Zn recorded mean levels in the range of 0.10 ± 0.00 to 0.21 ± 0.00 mg/L and 0.12 ± 0.01--0.28 ± 0.00 mg/L in lake water and groundwater respectively in the dry season for all the sampling stations. In the wet season the mean values recorded for Zn were in the range of 0.09 ± 0.01--0.18 ± 0.03 mg/L and 0.14 ± 0.01--0.28 ± 0.00 mg/L for lake water and groundwater respectively. In general the levels of Zn in the water samples from groundwater were higher than those in the water samples from the lake. Zn levels at Nkowi and Obo were similarly higher in the wet season as compared to the dry season. Zinc is an essential mineral of exceptional biological and public health importance (Hambridge and Krebs [@CR12]). Zinc is believed to possess antioxidant properties, which may protect human beings against accelerated aging of the skin and muscles in the body. It also helps to speed up the healing process after injury (Milbury and Richer [@CR12]). Zinc toxicity can occur in both acute and chronic forms. Acute adverse effects of high intake of zinc include nausea, vomiting, loss of appetite, abdominal cramps diarrhea and headache (Prasad [@CR19]). Excessive amount of zinc is harmful as it suppresses copper and iron absorption (Fosmire [@CR9]). Zinc deficiency is associated with chronic liver disease, chronic renal disease, sickle cell disease, diabetes, malignancy and other chronic illness (Prasad [@CR19]). Cr recorded mean levels in the range of below detection to 0.05 ± 0.00 mg/L and 0.02 ± 0.00 to 0.03 ± 0.00 mg/L in lake water and groundwater respectively in the dry season for all the sampling stations. In the wet season the mean values recorded for Cr were in the range of below detection to 0.02 ± 0.00 mg/L and 0.01 ± 0.00 to 0.03 ± 0.02 mg/L for lake water and groundwater respectively. Chromium has no verified biological role and has been classified as not essential for mammals (Bona et al. [@CR2]). Cr(VI) is very toxic and mutagenic but has not been established as a carcinogen when in solution although it may cause allergic contact dermatitis (ACD) (Bona et al. [@CR2]). Several in vitro studies indicated that high concentration of Cr(III) in the cell can lead to DNA damage (Eastmond et al. [@CR2]). The level of Ni were generally below the detection limit of the instrument nickel except at two sampling stations where they recorded levels of 0.19 ± 0.05 mg/L and 0.19 ± 0.03 mg/L. Nickel plays an important role in the biology of the micro-organisms and plants (Astrid et al. [@CR4]). However, high concentrations of nickel have been reported to be toxic and have carcinogenic effects for a wide range of life forms (ATSDR [@CR2]; Goyer [@CR11]; IARC [@CR19]). Sensitized individuals may show allergy to nickel resulting in skins-dermatitis (skin itch). Once a person is sensitized to nickel, any further contact will produce a reaction and adverse health effects can occur at far lower concentrations compared to non-sensitized individuals (ATSDR [@CR2]). Multivariate analysis {#Sec10} --------------------- Figures [2](#Fig2){ref-type="fig"} and [3](#Fig3){ref-type="fig"} show the Box and Whisker plots of metals in the surface and groundwater from the Bosomtwi Crater Lake and its surroundings in the dry and wet seasons. The asterisks and white circles represent outliers. The effects of outliers on the outcome of the multivariate analysis were not significant at 95 % confidence limit by Student's t test. Tables [3](#Tab3){ref-type="table"} and [4](#Tab4){ref-type="table"} show the Principal component/factor analysis (PCA/FA) for selected trace metals in lake water and groundwater respectively for wet and dry seasons. PCA/FA identified two principal components (PC) for lake water in both wet and dry seasons with % total variance of 80.99 and 72.73 respectively. PCA/FA for groundwater identified two principal components (PC) for the wet season with % total variance of 73.80 and three principal components for the dry season with % total variance of 87.33. The ratios calculated for these trace metals suggest mineral weathering as a vital geochemical process that control the concentrations of the trace metals in both the lake water and groundwater in the study area.Fig. 2Box and whisker plots of metals in the water samples from the Bosomtwe Crater Lake in the **a** dry and **b** wet seasons Fig. 3Box and whisker plots of metals in the groundwater sample from the Bosomtwe Crater Lake in the **a** dry and **b** wet seasons Table 3Factor loading for selected trace metals in lake water samples for wet and dry seasonsVariableDry seasonWet seasonPC 1PC 2PC 1PC 2Fe−0.5410.2360.3380.677Pb0.564−0.0740.372−0.611Zn−0.531−0.2620.5390.059Cr0.318−0.139−0.406−0.292Ni0.0800.922−0.5400.282Eigenvalues2.9181.1312.2341.403% of variance58.36022.62744.67728.052Cumulative %58.36080.98744.67772.728 Table 4Factor loading for selected trace metals in groundwater samples for wet and dry seasonsVariableDry seasonWet seasonPC 1PC 2PC 3PC 1PC 2Fe0.492−0.3660.1420.577−0.005Pb−0.144−0.0690.9130.625−0.083Zn0.6350.285−0.167−0.1250.643Cr0.3660.6720.3290.0000.713Ni−0.4470.574−0.104−0.511−0.265Eigenvalues1.9351.3121.1202.3001.390% of variance38.70126.23222.39545.99827.801Cumulative %38.70164.93387.32845.99873.799 The R-mode HCA was used to determine the relationship among the various trace metals, pH, conductivity and temperature using Ward's method (Squared Euclidean distance as measure of similarity). Cluster analysis (CA) grouped these parameters into clusters on the basis of similarities within a group and dissimilarities between different groups. Parameters belonging to the same cluster are likely to have originated from a common source. The R-mode CA produced two clusters based on spatial similarities and dissimilarities (Figs. [4](#Fig4){ref-type="fig"}, [5](#Fig5){ref-type="fig"}) for the lake and groundwater for both dry and wet seasons. Cluster 1 for dry seasons for the groundwater and lake water contained the same parameters (i.e. Fe, Pb, Zn, Cr, Ni, TDS, Turbidity and Temp) whereas cluster 2 contained only pH and conductivity. Similarly for the wet seasons Cluster 1 for both groundwater and lake water contained the same parameters (Fe, Pb, Zn, Cr, Ni, TDS, Turbidity and Temp) whereas cluster 2 contained pH and conductivity. The fact that cluster 1 for both lake water and groundwater for both seasons contained Pb, Zn, Cr, Ni and Fe seem to suggest that these metals are mainly of lithogenic rather than anthropogenic sources.Fig. 4Dendrogram of trace metals pH, conductivity and temperature in the lake water samples from Bosomtwe Crater Lake in the **a** dry and **b** wet seasons using ward's method Fig. 5Dendrogram of trace metals pH, conductivity and temperature in groundwater samples from the surroundings of Bosomtwe Crater Lake in the **a** dry and **b** wet seasons using ward's method Health risk assessment for some selected metals {#Sec11} ----------------------------------------------- The results of non-carcinogenic health risk assessment for the selected metals in both lake and groundwater for adults and children via ingestion and dermal routes are given in Tables [5](#Tab5){ref-type="table"} and [6](#Tab6){ref-type="table"}. Human beings are exposed to trace metals through direct ingestion, inhalation through mouth and nose, and dermal absorption through skin. The health risk associated with ingestion of water depends on the volume of water consumed and the weight of the individual. Hence health risk assessment was determined using the maximum and minimum concentration of the Fe, Pb, Zn, Cr and Ni in the lake and groundwater. The results indicate that the hazard quotient through injection of water HQ~ing~ from the Bosomtwe Crater Lake for all the metals during both wet and dry seasons were less than unity for both adults and children which indicates that these metals could pose minimum hazard to local residents. The HQ~derm~ values were also found to be less than unity which means that dermal adsorption of the metals may have little or no health threat. Health hazard indices (HI) on exposure to water from both lake water and ground water through ingestion and dermal contacts for both seasons are less than unity. It is therefore obvious from the results that in both cases the observed values are below the safe limit of unity which clearly indicates that there was no cumulative potential of adverse risk in water sampled via direct ingestion or dermal ingestion to the Inhabitants. The chronic risk assessment (CDI) for the metals in the groundwater samples from habitats surrounding the Bosomtwe Crater Lake and water samples from the lake through the ingestion pathway is given in Table [7](#Tab7){ref-type="table"}. Generally health risk assessment indices like HQ and CDI and the overall non-carcinogenic health risk assessment (HI) less than unity are indicative of less significant risk through the ingestion route or dermal contact (Moore and Ramamoorthy [@CR39]; Wu et al. [@CR11]).Table 5Health risk assessment for the metals in the lake water samples from the Bosomtwe Crater Lake through ingestion and dermal absorption pathways during the wet and dry seasons for adults and childrenRfD~ing~ (µg/kg/day)RfD~derm~ (µg/kg/day)Wet seasonDry seasonAdultsChildrenAdultsChildrenHQ~ing~HQ~derm~HQ~ing~HQ~derm~HQ~ing~HQ~derm~HQ~ing~HQ~derm~Fe7001401.16 × 10^−5^--8.57 × 10^−5^2.76 × 10^−7^--2.03 × 10^−6^4.44 × 10^−5^--3.27 × 10^−4^8.14 × 10^−7^--6 × 10^−6^9.47 × 10^−5^--1.64 × 10^−5^2.25 × 10^−7^--3.88 × 10^−7^5.75 × 10^−3^--1.40 × 10^−2^6.63 × 10^−7^--1.15 × 10^−6^Pb1.40.428.61 × 10^−4^--2.37 × 10^−3^5.45 × 10^−5^--1.5 × 10^−4^3.29 × 10^−3^--9.04 × 10^−3^1.61 × 10^−4^--4.42 × 10^−4^1.51 × 10^−3^--3.66 × 10^−3^9.53 × 10^−5^--2.32 × 10^−4^3.62 × 10^−5^--6.25 × 10^−5^2.81 × 10^−4^--6.83 × 10^−4^Zn3001209.04 × 10^−6^--1.81 × 10^−5^6.44 × 10^−7^--1.29 × 10^−6^3.45 × 10^−5^--6.9 × 10^−5^1.9 × 10^−6^--3.8 × 10^−6^1 × 10^−5^--2.11 × 10^−5^7.15 × 10^−7^--1.5 × 10^−6^3.84 × 10^−5^--8.05 × 10^−5^2.11 × 10^−6^--4.43 × 10^−6^Cr30.0750--2.01 × 10^−4^0--7.63 × 10^−5^0--7.67 × 10^−4^0--2.25 × 10^−4^0--5.02 × 10^−4^0--1.91 × 10^−4^0--1.92 × 10^−3^0--5.63 × 10^−4^Ni205.40--3.01 × 10^−5^0--2.12 × 10^−6^0--1.15 × 10^−4^0--6.25 × 10^−6^0--3.01 × 10^−5^0--2.12 × 10^−6^0--1.15 × 10^−4^0--6.25 × 10^−6^HI~ing/derm~----8.82 × 10^−4^--2.70 × 10^−3^5.54 × 10^−5^--2.32 × 10^−4^3.37 × 10^−3^--1.03 × 10^−2^1.64 × 10^−4^--6.83 × 10^−4^1.53 × 10^−3^--4.23 × 10^−3^9.63 × 10^−5^--4.27 × 10^−3^5.83 × 10^−3^--1.62 × 10^−2^2.84 × 10^−4^--1.95 × 10^−3^ Table 6Health risk assessment for the metals in the groundwater samples from groundwater in settlements around the Bosomtwe Crater Lake through ingestion and dermal absorption pathways during the wet and dry seasons for adults and childrenRfD~ing~ (µg/kg/day)RfD~derm~ (µg/kg/day)Wet seasonDry seasonAdultsChildrenAdultsChildrenHQ~ing~HQ~derm~HQ~ing~HQ~derm~HQ~ing~HQ~derm~HQ~ing~HQ~derm~Fe7001401.2 × 10^−5^--4.39 × 10^−5^2.66 × 10^−7^--1.04 × 10^−6^4.27 × 10^−5^--1.68 × 10^−4^7.84 × 10^−7^--3.07 × 10^−6^8.61 × 10^−6^--2.5 × 10^−5^2.04 × 10^−7^--5.92 × 10^−7^3.29 × 10^−5^--9.53 × 10^−5^6.03 × 10^−7^--1.75 × 10^−6^Pb1.40.421.08 × 10^−4^--2.58 × 10^−3^6.81 × 10^−5^--1.63 × 10^−4^4.11 × 10^−3^--9.86 × 10^3^2.01 × 10^−4^--4.82 × 10^−4^2.94 × 10^−3^--3.66 × 10^−3^1.23 × 10^−4^--2.32 × 10^−4^7.40 × 10^−3^--1.40 × 10^−2^3.62 × 10^−4^--6.83 × 10^−4^Zn3001201.41 × 10^−5^--2.81 × 10^−5^1 × 10^−6^--2 × 10^−6^5.37 × 10^−5^--1.07 × 10^−4^2.95 × 10^−6^--5.91 × 10^−6^1.31 × 10^−5^--2.81 × 10^−5^9.3 × 10^−7^--2 × 10^−6^4.99 × 10^−5^--1.07 × 10^−4^2.74 × 10^−6^--5.91 × 10^−6^Cr30.0751 × 10^−4^--3.01 × 10^−4^3.81 × 10^−5^--1.14 × 10^−4^3.84 × 10^−4^--1.15 × 10^−3^1.13 × 10^−4^--3.38 × 10^−4^2.01 × 10^−4^--5.02 × 10^−4^7.63 × 10^−5^--1.14 × 10^−4^7.67 × 10^−4^--1.15 × 10^−3^2.25 × 10^−4^--3.38 × 10^−4^Ni205.40--2.86 × 10^−4^0--2.01 × 10^−5^0--1.09 × 10^−3^0--5.94 × 10^−5^0--3.01 × 10^−5^0--2.12 × 10^−6^1.09 × 10^−4^--1.15 × 10^−3^0--6.25 × 10^−6^HI~ing/derm~----2.33 × 10^−4^--3.24 × 10^−3^1.075 × 10^−4^--3.00 × 10^−4^4.59 × 10^−3^--1.24 × 10^−2^3.18 × 10^−4^--8.88 × 10^−4^2.16 × 10^−3^--4.24 × 10^−3^2.00 × 10^−4^--3.51 × 10^−4^9.34 × 10^−3^--1.54 × 10^−2^5.90 × 10^−4^--1.04 × 10^−3^ Table 7Chronic risk assessment (CDI) for the metals in the groundwater samples from settlements around the Bosomtwe Crater Lake and water samples from the lake through the ingestion pathway during the wet and dry seasons for adults and childrenDry seasonWet seasonLake waterUndergroundLake waterGroundwaterAdultsChildrenAdultChildrenAdultChildrenAdultChildrenFe6.29 × 10^−3^--1.19 × 10^−2^2.40 × 10^−2^--4.56 × 10^−2^6.29 × 10^−3^--1.82 × 10^−2^2.40 × 10^−2^--6.96 × 10^−2^8.49 × 10^−3^--6.24 × 10^−2^3.24 × 10^−2^--2.39 × 10^−1^8.17 × 10^−3^--3.21 × 10^−2^3.12 × 10^−2^--1.22 × 10^−1^Pb1.89 × 10^−3^--5.34 × 10^−3^7.20 × 10^−3^--2.04 × 10^−2^2.83 × 10^−3^--5.34 × 10^−3^1.08 × 10^−2^--2.04 × 10^−2^1.26 × 10^−3^--3.46 × 10^−3^4.80 × 10^−3^--1.32 × 10^−2^1.57 × 10^−3^--3.77 × 10^−3^6.00 × 10^−3^--1.44 × 10^−2^Zn3.14 × 10^−3^--6.60 × 10^−3^1.20 × 10^−2^--2.52 × 10^−2^3.77 × 10^−3^--1.07 × 10^−4^1.44 × 10^−2^--5.91 × 10^−6^2.83 × 10^−3^--5.03 × 10^−5^1.08 × 10^−2^--1.92 × 10^−2^4.40 × 10^−3^--8.8 × 10^−3^1.68 × 10^−2^--3.36 × 10^−2^Cr3.14 × 10^−4^--1.57 × 10^−3^1.20 × 10^−3^--6.00 × 10^−3^3.14 × 10^−4^--8.80 × 10^−^31.20 × 10^−3^--3.36 × 10^−3^3.14 × 10^−4^--6.29 × 10^−4^1.20 × 10^−3^--2.40 × 10^−3^3.14 × 10^−4^--9.43 × 10^−4^1.20 × 10^−3^--3.60 × 10^−3^Ni0--6.29 × 10^−4^0--2.40 × 10^−3^0--6.29 × 10^−4^0--2.40 × 10^−3^0--00--00--5.97E−030--2.28E−02 The carcinogenic risk (CR) assessment for the metals are through ingestion of both lake water and groundwater in the lake and its environs is given in Table [8](#Tab8){ref-type="table"}. The CR value has been calculated for calculated for Cr and Pb only because the value of cancer slop for Zn, Fe and Ni could not be assessed in the Integrated Risk Information System (IRIS, provided by USEPA database; USEPA [@CR19]). Generally a CR value greater than 1 in a million (10^−6^) is considered significant by USEPA. The results show that Pb and Cr exhibited ranges of carcinogenic indices exceeding 10^−6^ for both lake and groundwater for both adults and children for both seasons. This indicate that ingestion of both lake and groundwater from the lake and its environs poses carcinogenic risk with regard to the level of Pb and Cr. Hence appropriate control measures and interventions should be put in place to protect the health of the human population in the study area.Table 8Carcinogenic risk assessment (CR~ing~) for the metals in the groundwater from settlements around the Bosomtwe Crater Lake and water samples from the lake through the ingestion pathway during the wet and dry seasons for adults and childrenDry seasonWet seasonLake waterUndergroundLake waterGroundwaterAdultsChildrenAdultChildrenAdultChildrenAdultchildrenPb2.13 × 10^−4^--6.03 × 10^−4^8.12 × 10^−4^--2.30 × 10^−3^3.19 × 10^−4^--6.03 × 10^−4^1.22 × 10^−3^--2.30 × 10^−3^1.42 × 10^−4^--3.90 × 10^−4^5.41 × 10^−4^--1.49 × 10^−3^1.77 × 10^−4^--4.25 × 10^−4^6.77 × 10^−4^--1.62 × 10^−3^Cr6.03 × 10^−7^--3.01 × 10^−6^2.3 × 10^−6^--1.15 × 10^−5^6.03 × 10^−7^--1.81 × 10^−6^2.3 × 10^−6^--6.9 × 10^−6^6.03 × 10^−7^--1.21 × 10^−6^2.3 × 10^−6^--4.6 × 10^−6^6.03 × 10^−7^--1.81 × 10^−6^2.3 × 10^−6^--6.9 × 10^−6^ Conclusion {#Sec12} ========== The mean levels of Fe and Pb were above the WHO values for both lake and groundwater for both wet and dry seasons whereas the mean levels of Zn and Cr were below the WHO values for both lake and groundwater for both seasons. The hazard quotients (HQ) and health hazard indices (HI) through ingestion and dermal contact of lake and groundwater in towns around the lake for both adults and children gave values which were below the acceptable limit (\< 1), indicating the absence of non-carcinogenic health risk to the communities. The study however reveals that ingestion of both lake and groundwater from the lake and its surroundings poses carcinogenic risk with regard to the level of Pb and Cr. Hence appropriate control measures and interventions should be put in place to protect the health of the human population in the study area. CDI : Chronic risk assessment CR : Carcinogenic risk WHO : World Health Organization HQ : Hazard quotient AAS : Atomic absorption spectrometer HI : Hazard index IRIS : Integrated Risk Information System TAB performed the laboratory work. NKA-D and AAA conceptualized this study. TAB and NKA-D drafted the manuscript. NKA-D, and AAA provided the guidance and reviewed the manuscript. All authors read and approved the final manuscript. Acknowledgements {#FPar1} ================ The authors are grateful to the National Council for Tertiary Education (NTCE), Ghana for a research grant under the Teaching and Learning Innovation Fund (TALIF-KNUSTS/3/005/2005). We are also grateful to AngloGold Ashanti (Ghana) limited for the use of their Atomic Absorption Spectrophotometer. Competing interests {#FPar2} =================== The authors declare that they have no competing interests.

List of magazines in Serbia A AG magazin B C Cosmopolitan Serbia D - G H Hello Heroina, music K Kuhinjica L Lepota & Zdravlje M Miroljub N Nadrealista Danas i Ovde Naše novine Nedeljnik Newsweek Serbia NIN (magazine) Nova srpska politička misao O P Politikin Zabavnik Pop Express, music Q R Republika (Serbian magazine) S SciTech (magazine) Skamija T - U V Vasiona Vreme W - Y Z Zvonik Defunct Aerosvet Duga Džuboks, music Evropa Evropljanin Galaksija Hard Metal, music Izgled Naše novine Pogledi Ritam, music Ritam (Novi Sad), music Rock, music Rock Express, music Signal, International Review of Signalist Research Smederevska Sedmica Standard Tempo Vreme zabave, music YU rock magazin, music See also Media in Serbia List of newspapers in Serbia List of Serbian-language journals List of academic journals published in Serbia References * Serbia Category:Lists of Serbian media Category:Serbia-related lists

This invention relates to a non-volatile semiconductor memory device. A ROM capable of electrically erasing the stored contents and rewriting them is known as an EEPROM (Electrically Erasable Programmable ROM). Unlike EPROMs of the ultraviolet light erasable type, such EEPROMs mounted on a board can erase data by an electric signal alone. For this reason, EEPROMs are frequently used for various controls or memory cards. FIG. 1 is a cross sectional view showing the device structure of a typical memory cell in the EEPROM, and FIG. 2 is an equivalent circuit diagram thereof. In FIG. 1, for example, on a P-type substrate 80, N-type diffused regions 91, 92 and 93 are provided. Between the diffused regions 91 and 92 on the substrate 80, a floating gate electrode 95 formed of a polycrystalline silicon layer of the first layer is provided on an insulating oxide film 94. This floating gate electrode 95 overlaps with the N-type diffused region 92 through a thin film portion 94A of the insulating oxide film 94. On the floating gate electrode 95, a gate electrode 97 formed of a polycrystalline silicon layer of the second layer is provided on an insulating oxide film 96. Further, between the diffused regions 92 and 93 on the substrate 80, a gate electrode 99 formed of a polycrystalline silicon layer is provided on an insulating oxide film 98. The memory cell of FIG. 1 includes two transistors 1 and 2. Namely, one is a transistor 2 having a floating gate (called floating gate transistor hereinafter) as a non-volatile memory element having the N-type diffused region 91 as the source, the N-type diffused region 92 as the drain, the floating gate electrode 95 as the floating gate, and the gate electrode 97 as the control gate. The other is a select transistor 1 of enhancement type having the N-type diffused region 92 as the source, the N-type diffused region 93 as the drain, and the gate electrode 99 as the gate. These transistors 1 and 2 are connected in series. As indicated by the equivalent circuit of FIG. 2, the drain and the gate of the transistor 1 are used as the data line DL and the word line WL, respectively. The floating gate and the control gate of the floating gate transistor 2 are used as the floating gate FG and the control gate CG, respectively, and the source of the floating gate transistor 2 is used as the source S. It is to be noted that the memory cell of FIG. 1 constitutes a one bit data memory unit (memory element) for storing data of one bit. In the memory cell using a floating gate transistor as described above, as long as data erasing is not conducted, data once written is permanently held from an ideal point of view. However, in the case of an actual memory cell, after erasing or writing of data is carried out, charges in the floating gate are discharged with the lapse of time, and the stored data disappears. Particularly in the case of a cell where there is some defect in an insulating oxide film, etc., this charge dissipation occurs to a considerable degree. According to these circumstances, the memory cell becomes defective when used. Generally, as a technique for evaluating the holding characteristic of stored data, there is known a method of placing the memory cell in a high temperature state to accelerate the rate of occurrence of such deterioration. This method is called a high temperature shelf test. FIG. 3 is a characteristic curve showing changes in the threshold voltage (V.sub.th) of the floating gate transistor when the high temperature shelf test is conducted at 300.degree. C. The threshold voltage in an initial state is about 1 volt as indicated by a broken line. The case where electrons are discharged from the floating gate to store data of the "0" level will be first described. At this time, the threshold voltage of the floating gate transistor takes a substantially negative value, e.g., -5 volts. For this reason, a current flows even if the potential on the control gate is zero volts. The case where electrons are injected into the floating gate to store data of "1" level will now be described. The threshold voltage of the floating gate transistor takes a substantially high value, e.g., +10 volts. At the time of readout of data, the potential on the control gate is set to zero volts. The judgment as to whether the data stored in the memory cell is "0" or "1" is carried out by setting the operating point of the sense amplifier circuit, i.e., sense potential so that a suitable current flows in the memory cell. This sense potential is set to about -1 volt as indicated by the single dotted lines. In FIG. 3, in the case of the cell of "1" data, electrons in the floating gate are discharged with the lapse of time. Thus, the threshold voltage thereof lowers with the lapse of time to reach 1 volt, which is the threshold voltage in the initial state. On the other hand, in the case of the cell of "0" data, electrons are injected into the floating gate with the lapse of time. Thus, the threshold voltage rises with the lapse of time to reach 1 volt. At the time t.sub.N in the middle thereof, that threshold voltage goes through '1 volt, which is the sense potential of the sense amplifier circuit. FIG. 4 shows the change of the cell current (I.sub.cell) at the time of the high temperature shelf test of the memory cell in which "0" level data is stored. With the lapse of time, the cell current decreases. When the cell current is below the sense level current Is in the sense amplifier circuit, the sense amplifier circuit erroneously judges data which has been originally at the "0" level to be "1" level data. It is only the memory cells in which "0" level data is stored, that data may be erroneously detected as stated above. The time when such an erroneous data is detected is now assumed to be t.sub.N. In the case of the normal memory cell, the time required for reaching the time t.sub.N is sufficiently long, and there is therefore no problem in view of actual use. However, in the case of the defective memory cell, the time required for reaching the time t.sub.N is small. For this reason, there are instances where memory cells may become inferior or defective while they are being used in a product. Particularly, if erasing and/or writing are frequently repeated, the insulating oxide film is considerably deteriorated, so inferiority is apt to occur. FIG. 5 is a circuit diagram of a conventional typical EEPROM in which memory cells similar to the memory cell shown by the equivalent circuit of FIG. 2 are used to constitute a cell array. The control gates of the floating gate transistors 2 of memory cells MC-11 to MC-mn are connected to control gate select lines CGL1 to CGLn selected by column decoders 5-1 to 5-n through control gate select transistors 6. Further, the gate of the control gate select transistor 6 and the gate of the select transistor 1 in each same memory cell are both connected to one of the row lines WL1 to WLm selected by the row decoder 4. Drains of the select transistors 1 in respective memory cells are connected to column lines DL1 to DLn. Respective column lines DL1 to DLn are connected in common to a bus line 8 through column select transistors 7. The gates of the transistors 7 are connected to the corresponding column decoders 5 through column select lines CL1 to CLn, respectively. To the bus line 8, a data input circuit 9 and a sense amplifier circuit 10 are connected. The data input circuit 9 outputs data of "0" or "1" level depending on a write data signal Din inputted from the outside. The sense amplifier circuit 10 detects, as "0" or "1", the level of data stored in a selected memory cell MC. At the time of sensing the data level, the sense amplifier circuit 10 applies a bias voltage necessary for the readout of data to a corresponding data line DL. Namely, the sense amplifier circuit 10 includes a bias circuit. The data sensed at the sense amplifier circuit 10 is inputted to a data output circuit 12. Readout data is outputted from the data output circuit 12 to the outside. In EEPROMs of such a structure, in the case where erasing/writing were conducted about 10.sup.3 times with a device of a memory capacity of the order of 64K bits, the possibility that there takes place random cell inferiority in every bit due to defects as described above, etc., indicates a high value of about 0.1 to 0.2%. For this reason, there was the drawback that the reliability is low, leading to limited use from a viewpoint of the practical use. To prevent lowering of the reliability due to cell inferiority, a technique is conceivable to constitute each storage unit with two memory cells. However, the memory cell corresponding to 1 bit becomes large, resulting in that such a technique is not suitable for implementation of large capacity memory devices.

Main menu Category Archives: healing Post navigation Two years ago I celebrated my 40th birthday. Surrounded by friends and family in a house I’d bought six years earlier, in many ways my life was everything I’d ever wanted. My 30th birthday was spent in New York City … Continue reading → Two years ago the call came. “I don’t know why I was hesitant,” the social worker said. “Once I met you, it was clear you’re the right family.” My son, Adley, had languished in foster care for more than half a year once he was eligible for adoption. His social worker, who had been on the case since he entered the system at birth, was devoted to him. She wanted what was best and didn’t see how that could be me. Due to his special needs resulting from a micro deletion and micro addition genetically, her wish for him was a two parent home without any other children where he could be the primary focus. A single mother with two adopted children was not ideal. She waited. She searched. She tried to find what she thought was best. I appreciate her concern and dedication. Having been told I was not a possibility, I’d attempted to convince Raine and Athena that he was not going to be their brother after all. They would not believe me. I’d made them no promises. I’d not even introduced the idea to them. It was something the girls determined on their own. As they visited with Adley at my friend’s house where he was being fostered, they decided he would be their brother despite being told all along it was impossible. To begin with, adoption was not looking likely in his case. Then, when at last it was, our family wasn’t a consideration. Without any other options, the adoption department pushed the social work to at least meet me. Reluctantly, she agreed. Then we waited for her decision. Raine and Athena’s faith was unwavering. I knew the system well enough to know nothing was predictable. The meeting seemed to go exceptionally well but that was no guarantee. “Yes,” a stranger at McDonald’s playland recently said, “This is the right family for him.” The woman, a recently retired special needs EA, had watched my crew intently after I shared how we came together through adoption. Easter morning 2018 – Kinder Eggs and Lego (Duplo for the boys, but they like to call it Lego) “He has one older sister who really challenges him,” she said of Raine who was climbing in the structure calling to Adley to come up with her. “Another who is a little mother, encouraging him along,” she said of Athena who often came beside to gently lead him out of hesitation. “And a younger brother to run with,” she said of Branch. The two boys had taken off together in a rush when I announced they could leave the table and go play, that’s what had initially caught the woman’s attention. “This is the best thing for him,” she said with certainty, as I sat back drinking coffee. There are times I’ve wondered. Adley’s progress has been astounding since he came to me. He’d doing things previously thought impossible – eating on his own. There was a time he was choking so often a feeding tube was being considered. He’s speaking, sometimes in complete sentences. It was thought unlikely he’d ever communicate with words. His comprehension is often surprising. “Unless you have his full attention and speak directly to him in very simple words he won’t understand, “ his therapy team had told me in August before we moved here. We continued to do that. Yet often when I’m not speaking to him at all, Adley understands what’s going on. When I told Raine and Athena that he wouldn’t be going to school last Monday because he had a dentist appointment, Adley jumped into the conversation, “Tooth. Pull. Out. Gone. No doctor,” he said. The week before, he’d fallen at school and cracked his front tooth. An emergency trip to the dentist had resulted in the tooth being pulled. We were returning to check on how he was doing. Adley understood the word dentist though when speaking directly to him I’d always used doctor. He remembered what had happened and could explain it. And he didn’t see any reason to go back since his tooth was already gone. The many facets of that interjection were considered to be absolutely impossible when he first came to us. The team of therapists who had worked with him since birth didn’t anticipate him to ever reach that level of comprehension and communication. It was a hope, but not something they were expecting. This morning while waiting for the bus, he was jumping in puddles with his sisters like any other 4yr old would. Both feet left the ground as he tried to make splashes as big as theirs. When he came, there was still the real possibility that he could be wheelchair bound. That’s not even a consideration now. I worried about making a move that would result in Adley being in a regular school instead of one specifically for special needs children which is where he would have gone had we stayed where we were. It was a risk I took with the encouragement of the team of therapists who had worked with him most of his life. The school here on Wolfe Island has been outstanding. Being the only child with extensive special needs, Adley is able to access the full amount of funding designated for this area of education. He gets the same equipment he would have gotten at the special needs school. He has a one on one EA. He has friends who encourage and challenge him. At the little island school, he’s known and loved by all. Children fight over who gets to sit with him on the bus. From JK to Grade 8, the children are cheering him on as he makes exceptional gains. When God brought us together, He knew where our path would lead. Though at the time I had no idea we’d find ourselves on this island, God knew. It’s been such a special place for Adley. Not only is he accepted despite his special needs, he’s celebrated in ways I never imagined. Looking back on the boy who joined our family two years ago, I can hardly believe it’s the same child I watched splashing in puddles this morning. April 2016 – cautiously trying a meringue cookie. First place Athena wanted to take her new brother was the bakery. When I said yes to Adley it was with the knowledge that those simple milestones might never come. I said yes to loving him in the limitations of his condition. In love, he’s been able to grow and exceed many of the expectations. Today, I’m celebrating the son God saw fit to give me. He knew we were the right family for Adley. And I’m grateful for the opportunity to love him. Today Raine is 10 years old. When she arrived, a month after her 3rd birthday, I didn’t imagine we’d get to this point. The chubby little girl with a big, gruff voice wasn’t mine then. I was to be a … Continue reading → Arell (Hebrew) lion of God Adley (Hebrew) God is just Jeremiah (Hebrew) God will uplift April 25, 2016 Arell Adley Jeremiah Howden joined our family. The wait had been forever and, many times, looked like it would end in heartache. … Continue reading → When she came to me, Raine knew her name. She’d always introduce herself by her first and last name. At the point of adoption, she struggled with gaining a new last name. I received a great deal of resentment from her. She didn’t like being adopted and certainly didn’t want her last name to be changed. I pressed on, wondering if I should have refused the change or made her last name a middle name so Raine could hold onto that portion of her past. In the end, that frame made me uncomfortable. I knew it wasn’t ideal for her to hold onto the past. But I also knew that being adopted was costing her dearly. Raine struggled with the loss of her family of origin. And for what felt like a very long time, she resented her new last name. I thought of my sister who, caring nothing for marriage most of her life, entered into the institution after her son was born. His arrival made her want to have their family unified under a common last name. Giving Raine my last name gave us a recognizable connection. It mattered, though she didn’t know it in the moment. Now, years later, she can’t recall the first last name she bore. It’s gone from her memory and she values the name she has. It means she belongs to me and, finally, her heart is able to rejoice in that reality. When I decided to adopt Raine, several people said, “You’re crazy! I’d never do it. She’s so wild.” She really was. But I had a vision of who she could be. In the midst of all the nay-saying, a friend dreamed that during a Sunday morning church service Raine was at the pulpit saying, “I used to be so wild but Jesus healed my heart.” In the challenges following the adoption, I clung to that dream. “Are you sure you’re ok?” our pediatrician asked more than once in those early days. Raine ended up on medication and it took quite a while before we got to the right type and dose. Sometimes I wasn’t ok. But I had a vision of where we could be and was willing to do the work. There were days my willingness didn’t line up with my ability in the moment to manage her rage and resentment. Still, not wanting that vision to become a fantasy, I pressed on. There are things that remain obstacles, like Raine’s intense fear of abandonment that surfaces whenever we’re apart for more than a couple of hours. And that’s why you will find her in unlikely situations, such as when I’m catering an event at the church or yesterday when she and Athena came along to an all day seminar by Arthur Burk. The topic was “When Your Call is Blocked.” Watching Raine quietly colour all morning then watch movies in the afternoon while I listened, I realized my call may not be as blocked as I had imagined. I’m called to help my children heal and reach their full potential. “Your children are so well behaved,” was the comment we received through out the seminar. It took most of the day for me to accept the truth. It’s easy for me to cling to that old label of wild, difficult, or challenging. But it’s time for some new labels. Calm and peaceful are the words most often used to describe Raine these days. Of course there are still times when anxiety overtakes her but that’s no longer her constant state. After the season of struggle, I’m now able to catch my breath and see just how far we’ve come. Marvelling at the transformation, I was brought to tears when this song was sung at church this morning.

Utah Jazz, Miller family to install new video screens to add to the fans' experience. By Bill Oram The Salt Lake Tribune Published June 18, 2013 11:29 am This is an archived article that was published on sltrib.com in 2013, and information in the article may be outdated. It is provided only for personal research purposes and may not be reprinted. The kiss cam is about to get a whole lot more intimate. The Utah Jazz on Monday unveiled plans for an upgraded audio and video system at EnergySolutions Arena, including upgraded high-definition screens above center court, LED (light-emitting diode) rings around the top of the lower bowl and auxiliary screens in the corners of the arena. The screens over center court are 10 times larger on the sides than the current scoreboard, which was installed in 2001. The cosmetic update is the most visible component of $15 million in renovations to the 22-year-old arena and, team executives said, will significantly enhance the fan experience at the multipurpose venue, which hosts 1.2 million people annually. "We know that those 1.2 million guests are going to come and have the kind of experience that can't be found anywhere else," said Jim Olson, senior vice president for sales and marketing. The Jazz partnered with Utah-based Yesco, which has built signs including the video board at the Wynn Resort in Las Vegas, as well as video screens in college arenas, including the Spectrum at Utah State University. Yesco executives Jeff and Mike Young said the project is the company's largest ever in Utah — larger than the iconic rings of the 2002 Winter Olympics — and will be accomplished by a team of more than 100 local workers. All of the video components are expected to be installed before the start of the NBA exhibition season in mid-October. "This is the best sign system display technology in the world," Jeff Young said, "and we are overjoyed to be partners with the Miller family to make this dream come true." Three days after promising a "major facility announcement," Steve Miller, president of Miller Sports Properties, which operates the Jazz, revealed the plans for the overhaul, but said any other upgrades to the NBA's seventh-oldest arena are five to 15 years down the road. "This is going to give us enough runway to get into the future," Miller said. "EnergySolutions Arena is going to be where the Jazz play basketball and any enhancements that we make are to that end." The upgrades announced Monday represent some of the most significant since the arena opened in 1991 as the Delta Center. In 2006, EnergySolutions bought the naming rights to the venue. The screens above center court will measure 42 feet long and 24 feet high on the sides, and 26-by-17 on the ends facing each baseline. Screens on the soon-to-be former scoreboard were 10-by-10. Jazz President Randy Rigby said the No. 1 complaint of fans had been low-quality video. "These kind of moves tell people this team is very serious ... really giving people the experience," he said. Executives spent the past year trying to strike the right balance in overhauling the off-court product, including traveling to other arenas. The Houston Rockets and the Indiana Pacers, for example, have the largest video screens in the NBA, but Rigby said it was not the Jazz's aim to simply be the biggest. "We have such a great facility here," Rigby said, "we wanted to make sure the dimensions actually complement the game and not overpower it. I think the team has done a remarkable job of doing that very thing." Rigby lauded the fiscally conservative Miller family, which owns the Jazz, for opening the checkbook for the project, a trend in the past year that has included ramping up international scouting and more recently bringing in more players for pre-draft and free agent workouts. "This is the type of announcement that we rarely make because of the investment that it takes — the financial investment," Miller said. "But this is something that we're willing to do because of what it means to the fan experience and for the franchise overall." boram@sltrib.com Twitter: @tribjazz — EnergySolutions Arena upgrades • The Jazz will install center-court video screens that on the sides will be 10-times larger than the 12-year old scoreboard. • In addition to video boards throughout the arena, the franchise is also upgrading the building's audio system. • The audio/video upgrades are part of a $15 million renovation package, which will include new kitchens on suite levels.

EWS/ETS fusion genes induce epithelial and neuroectodermal differentiation in NIH 3T3 fibroblasts. Ewing's sarcoma is the least differentiated member of the peripheral primitive neuroectodermal (pPNET) tumor family. Chromosomal translocations involving the EWS gene and five different Ets family transcription factor genes create fusion genes encoding aberrant transcription factors and are implicated in the vast majority of Ewing's sarcoma cases. Here, NIH 3T3 fibroblasts were infected with control (tk-neo or RAS) and two different EWS/ETS-expressing retroviruses. In vitro studies of established polyclonal lines expressing the two EWS/ETS genes, either EWS/FLI1 or EWS/ETV1, showed induction of cytokeratin 15 gene expression. Both fusion genes also caused characteristic gross morphologic, histologic, and ultrastructural changes in NIH 3T3 cells when transformed cell lines were injected into CB-17-scid mice. Native NIH 3T3 cells with a spindled cell morphology were converted to polygonal cells with high nucleo-cytoplasmic ratios that continued to express abundant cytokeratin. Extracellular collagen deposition was abolished, rough endoplasmic reticulum was markedly diminished, and rudimentary cell-cell attachments appeared. Most strikingly, neurosecretory-type dense core granules like those seen in pPNET were now evident. This murine model, created in mesenchyme-derived NIH 3T3 cells, demonstrated new characteristics of both neuroectodermal and epithelial differentiation and resembled small round cell tumors microscopically.

Framers work May 9 on the roofline of a home at Lennar's Plateau community in Somersett in Northwest Reno. The aggregate price for 1,000 board feet of common framing materials is up 60 percent from January 2016. Courtesy Rob Sabo RENO, Nev. — Tariffs enacted on softwood lumber imported from Canada are helping create a “perfect storm” of escalating construction costs in Northern Nevada. In December 2017, the U.S. Department of Commerce imposed tariffs on five of Canada’s largest producers of softwood lumber such as fir, spruce and pine, which are commonly used to build single-family homes and multi-family apartment complexes. And as anyone who has driven around greater Reno-Sparks or Carson City during the past year can attest, there’s no small amount of new construction going on. The tariffs — set at 20.8 percent for the majority of Canadian softwood producers, and a bit higher for a few companies that were singled out for individual duty fees — are leading to increased construction costs for projects throughout Northern Nevada. Don Tatro, executive director of the Builders Association of Northern Nevada, says the tariffs amount to additional materials costs of nearly $6,400 per single-family home and $2,400 per multi-family unit. Coupled with white-hot demand for new housing and rising prices for fuel, land and labor, and it’s no wonder why housing and apartment prices across Northern Nevada have gone haywire. “All of this has had significant impact and contribution to the increased price of constructing a home,” Tatro says. “When the cost of a home goes up $1,000, there are 2,077 families priced out of a house in Nevada, and 348 in Washoe County. Just with the lumber price increases, that is more than 2,000 people priced out of a home.” Massive increases in lumber prices Canada is the largest exporter of lumber to the United States. In 2016, the U.S. consumed 47.1 billion board feet of lumber, the National Association of Home Builders reports. American mills produced 32.8 billion board feet of lumber, meaning it imported 14.3 billion board feet of lumber. About 95 percent of that wood was imported from America’s northern neighbor. According to the National Association of Home Builders, framing lumber prices have spiked 60 percent in the past 27 months. In January 2016, the Random Lengths Framing Lumber Composite price was $312. In March of 2018 it was $502. The price is an aggregate of 15 commonly used framing materials, such as 2×4 studs and other common lengths, calculated per one thousand board feet of material. The composite index does not include plywood and other types of sheathing common in residential and multi-family construction. Regional homeowners are bearing the burden for additional materials costs in residential construction, and it’s the same for developers of commercial projects. General contractor Frank Lepori says any increases in lumber costs typically are passed through to clients, but his team works diligently with subcontractors and vendors to lock in pricing and avoid potential cost increases for clients. “At this point we have not felt any effects to our schedule and work load,” Lepori says, (but) at some point clients may stop building projects if the costs do not work in our clients’ pro formas.” Boosting U.S. timber production is one way to counter the tariffs; however, any increases in the domestic supply of timber products requires a deep look at potential environmental impacts of increasing production on public lands, Tatro says. More at play than just lumber Lumber is just one aspect of rising construction costs. Perhaps more concerning to regional tradesman and advocacy groups such as BANN is the continued shortage of qualified labor. Lepori says the strain of a tight labor market has had a greater impact on regional construction efforts than the duty fees being imposed on imported materials – although that could change if imports dwindle and materials become harder to source. “Our biggest impact is the tight labor market,” Lepori says. “In our industry it takes years to be a first-rate foreman or supervisor, and that is the person most companies can’t find. Rising fuel costs are a concern, but they are not a show-stopper. “Rising material prices (also) are a problem, but the bigger problem is the lead times on products or not being able to find the product that you need.” Increasing regulatory costs and delays are the final piece of the puzzle that are pushing up construction costs. Tatro says tightening restrictions and lengthening delays on the regulatory side, coupled with the higher costs for homes and apartments, already has priced thousands of Nevadans out of the American Dream of home ownership. The solution, he adds, is for regional construction experts and business leaders to focus on changing aspects of regional development that are within the industry’s control, such as creating additional training programs and speeding up the approval process for new development. “We need to act fast,” Tatro says. “Whether it’s increased production of U.S. timber, or creating a pipeline of labor through through smart immigration and education of younger Americans in the trades – the average age of plumber in the U.S. is 57 years old – or increasing the speed at which we can move projects through and still conform to all local standards and master plans. “If we don’t find solutions to increasing costs and delays, we are stuck with an unaffordable product that is in significant need and substandard housing for those who should be able to afford it,” he adds. “It’s critical that regulators and elected officials understand that these costs are real and have a direct impact on every one of their constituents. “We can’t focus on a single type of housing; we need to focus on all types because we have demand for all types of projects, from infill housing to starter homes and luxury homes — we need them all.”

Photography Angela Stephenson In a London warehouse on a sunny day in June, Charli XCX is tied to the bonnet of a white Mercedes. Chris (formerly Christine and the Queens), her rescuer, is strapped to the boot. After Chris frees them both, the two clamber to the roof and writhe along to the lyrics Chris penned for their new collaboration, Gone, which debuted at Primavera back in June and hasn't been heard since... until now. Although Charli wrote the chorus line: “I feel so unstable fucking hate these people” is version 2.0. Her original version was “I feel so unstable fucking hate my label”. (“I wasn’t going through hate with them at the time or anything. I just thought it would be funny,” she clarifies). The dim industrial space of the Colin Solal Cardo-directed video shoot evokes the same warehouse rave backdrop of other Charli videos like 5 in the Morning. It’s the aesthetic of the afterparty; the brand Charli has spent the last four years and two mixtapes cultivating carefully. As the yell of “lunch!” reverberates to the cavernous ceiling, the pair dismount and totter carefully off to eat salads from styrofoam bowls. Charli’s aspirational image-crafting of eternal partying has been so effective, it’s startling to see her doing anything so mundane. Afterwards in a back room, the duo don towelly white bathrobes over their silver chains and black lace. (Charli’s corset and harness were designed by Fleet Ilya, her dress by Matilda Aberg). Settling side-by-side into a leather sofa in the corner, they’re still talking about Mark Ronson’s Club Heartbreak afterparty they attended together last night. Chris sensibly wanted to stay in given this morning’s early call time. Charli coaxed her out. Last night’s frivolities belie the laser sharp focus she’s training on her upcoming album, Charli, announced last month. “I’m in work zone,” she says. “I’m never in the moment, I’m always like ‘What’s next? How can I make it better?’” She’s not exaggerating her workaholism; as well as recent album material like Gone and Blame It On Your Love ft. Lizzo, Charli has put out standalone singles like Spicy ft. Diplo & Herve Pagez, and the song she co-wrote for Shawn Mendes and Camila Cabello just hit number one. “You know we text every other day? I feel like I’m in a relationship!” - Charli XCX As for Chris and Charli’s collaboration, it’s been a long time coming. Ever since they met a few years ago, the pair had spoken about working together. Then last year, Charli went to Sweden to do album sessions and found a beat she liked with collaborators Noonie Bao and Lotus IV. After Charli sent the fledgling piece to Chris, she fired back fully fleshed-out lyrics in twenty minutes. “I went to a museum, and by the time I got out you’d sent it back to me. I had to run back to my hotel to get headphones,” Charli laughs. Chris’ enthusiasm about the collaboration is evident, but still kind of surprising. Musically, Chris has always been a lone wolf. “I’ve been writing songs on my own in my basement in Paris for the longest time. It’s all I know,” she says. “I’d tried to collaborate previously and I felt so fucking uncomfortable, I was like ‘what am I doing here?’” Chris’ impact on pop in recent years has been monumental, but she’s an independent auteur. Her second album, where she reinvented herself as the androgynous Chris character and emerged from the chrysalis of ‘and the Queens’, was acclaimed for its exploration of her own queerness. Bringing her fiercely self-directed art to meet someone else’s was a challenge for her, and one she insists could only have been accomplished with IRL friend Charli. “You know we text every other day?” Charli blurts out. “I feel like I’m in a relationship!” “It was the first time collaborating and feeling comfortable for me,” Chris confesses. “I’d never do it just for the sake of doing it. Sometimes my record label are like ‘can you try to collaborate more?’ but I can’t force it.” So what was different about working on Gone? “The fact that she let me write her lyrics was proof of trust. I was on a Charli track but being myself”. Charli is a master of making people feel welcome in her sonic galaxy; in 2015, she abandoned conventional pop and has since spent four years honing the craft of collaboration. After her big US hits like Fancy with Iggy Azalea and Boom Clap, she got sick of waiting on a superstardom that never came. The anticlimax of mainstream charts drove her pivot to the weird PC pop team-ups that have become her trademark, and in the intervening four years she’s created a critically acclaimed body of work over two ten-track, non-charting mixtapes, Number 1 Angel and Pop 2. Her work in this period has been almost exclusively collaborative, and she has ongoing relationships with a who’s who of up-and-coming (largely queer) underground artists like SOPHIE, AG Cook, Dorian Electra, Kim Petras, and many others. Charli’s reinvention has resulted in a dual identity. The mainstream recognise Charli as a peripheral songwriter of top 40 hits, while a growing base of queer and subcultural fans know her as a messianic cult figure with an alchemical knack for bringing unique artists together on insane, experimental bangers. The contrast between these two personalities couldn’t have been more pronounced than last summer, when she supported Taylor Swift on her tour the very same week that she performed her sweat-slicked, pulse-pounding Pop 2 show in London’s Village Underground. It felt like watching two completely different artists. Charli is much more comfortable in the latter role; she sees herself and her collaborators as the future of pop music, and regularly updates her playlist on Spotify, unashamedly titled “the motherfucking future!” “For me, Number 1 Angel and Pop 2, that was me really throwing all my cares about commercial success out the window. And not being hooked on stats anymore, like ‘oh, I need to be the Boom Clap girl forever!’”, Charli says steadily. “Fuck that girl. That girl’s not me. I think that’s when I really garnered an actual fanbase who would really care about an album. AG Cook and I originally wanted to do a third mixtape, but then we said ‘fuck it, now feels like the right time for an album’.” Charli didn’t just reject commercial success after 2015, she rejected conventional release cycles too, declaring she would never release another album proper and having to initially record her Number 1 Angel mixtape without her label’s permission (which is why that altered “fucking hate my label” lyric piques interest). Her revision of that policy has left some wondering if the album signals another turning point for her. Is she boomeranging back at radio pop again, given that her recent collabs Boys and 1999 broke the UK top 40? Charli insists that’s not the case; she’s trying to simply evolve the legacy she’s already created, not turn away from it. “There are elements of Pop 2 on this album,” she says. “There’s no real theme lyrically other than it’s my most personal body of work. It has more emotional moments, even though I’m not someone who particularly cares about having everything drenched in feeling”. (No kidding -- Charli’s 2017 track Drugs ft. ABRA declared her dealer was the love of her life). “Parties are emotional places where weird things happen; you fall in love, you break up. But there are other sides of parties that aren’t so emotional -- like, I write about cars a lot,” she says bluntly. “For me, this album is just like a train of thought. It feels quite conversational.” Charli also reveals that Gone is her favourite song from the album (“Mine too,” jokes Chris) and that it’s the most representative of the whole body of work. “You kinda get everything that’s happening on the album from this one song,” she explains. It feels so incredibly right that Chris and Charli should finally come together. They both know what it is to reinvent themselves, they both know what it means to push boundaries, and they deeply appreciate each other’s sounds and aesthetics. “When I was working on my second album, I was listening with my sound engineer a lot to your mixtapes,” Chris tells Charli. “What you were doing was really challenging for other artists. You know how to write a banger but you challenge what a banger means. You’re questioning the form.” Chris hints insightfully that this is perhaps the mysterious link between Charli’s music and the queer community. She has worked with so many queer collaborators and the majority of the niche fans garnered from her mixtapes are LGBT. “Even an aesthetic can be deeply queer,” Chris analyses. “It’s the hybridity. The sound and production you have -- you’re in pop music but you’re questioning it, you’re not digested by it. I think that is quite queer.” Most queer fans probably don’t devote that much incisive thought to why we love Charli. (We just replace our daily spamming of “release Taxi!” to demand that Charli “drop Gone!” instead). And while it’s hard to imagine workaholic Charli ever taking a break -- she says that, without the LGBT community, she wouldn’t have the career that she has. “I might even have stopped,” she says seriously. “I owe so much to the queer community. I feel comfortable in my own skin standing on stage singing songs to people that really care and believe in me. That’s been a life-changing thing for me.” It’s easy to forget, with all the acerbic memes, that gay stan culture harbours much sentimentality. And you’d better believe that Charli ft. Chris is a queer stan fever dream; release day will surely become an international holiday on the same level of Power Bottom Appreciation Day. If there’s any ‘why’ question over this collab, it’s perhaps; ‘why now?’ Charli’s accelerating toward her self-titled album after several years of subterranean experimentation. It’s the heart-pounding climax of an upward journey. Chris, on the other hand, is winding down and back out of the spotlight after the massive self-mining operation that was her second LP. It seems like they’re at opposite points in their life-cycles right now, like they should be ships passing in the pop night. “It was a really intense year for me personally and artistically,” says Chris. “I’m still touring the second album and just having daydreams of how to follow it. I’m writing weird diaries every day. I have instincts and images -- it’s just a case of figuring out if it’s a good instinct, and then acting on it. I was telling Charli earlier, I feel like I’m a novelist and I have to write the third chapter.” Maybe it makes perfect sense then, that Charli XCX ft. Chris is happening right now. Both women are writing their third chapters, in a sense. This is a pivotal moment in Charli’s career -- she’s carved out a niche identity for herself over the last few years, defining herself by being rebellious against industry structures and pop norms, and now she’s faced with the challenge of integrating that oppositional spirit into something as conventional as an album. As if to remind her of that pressure, her team swoops back in. Chris is whisked away for make-up. “Tie me back to that car!” Charli yells. And suddenly, they’re both gone. Credits All photography Angela Stephenson

543 U.S. 835 CARTERv.COLLINS ET AL. No. 03-10457. Supreme Court of United States. October 4, 2004. 1 C. A. 4th Cir. Certiorari denied. Reported below: 55 Fed. Appx. 704.

Q: simple javascript, functions in objects var rooms = { bedroom: { info: "A dusty bed lies sideways in the midle of the room"; north: function ( ) { //this function returns an error } } }; I cant work out why this returns an unexpected identifier -- edit thanks another question in javascript the good parts he has var myObject = { value: 0; increment: function (inc) { this.value += typeof inc === 'number' ? inc : 1; } }; is this different to what I am doing? A: One should use a , inside of object literals when defining keys and values to separate them, not ;. var o = { name: 'john', age: 13 }

18 Stories That Prove Kids Will Always Make Us Wonder Why Children have the ability to amaze us every day with their discoveries, their growth, and their accomplishments. They always have an interesting perspective for what they learn and respond in ways that surprise everyone. But there are times that these reactions are beyond our understanding and leave us wondering where they came from. We at Bright Side found 18 stories that prove that children can be cute and weird at the same time.

Q: Programmatically added Views not behaving I've created many custom views and I am trying to add them to my fragment. They get added but I can't seem to get them to go where I want. There should be 2 columns and 3 rows but it ends up as 1 column with all of the custom views stacked on top of one another. Here is my code to add the views and set the layout params to the fragment layout: RelativeLayout fm = (RelativeLayout) view.findViewById(R.id.fragmentLayout); RelativeLayout.LayoutParams params = new RelativeLayout.LayoutParams(RelativeLayout.LayoutParams.WRAP_CONTENT, RelativeLayout.LayoutParams.WRAP_CONTENT); params.addRule(RelativeLayout.ALIGN_PARENT_LEFT, RelativeLayout.TRUE); CustomImages cs = new CustomImages(getActivity()); cs.setId(R.id.one); cs.setLayoutParams(params); params = new RelativeLayout.LayoutParams(RelativeLayout.LayoutParams.WRAP_CONTENT, RelativeLayout.LayoutParams.WRAP_CONTENT); params.addRule(RelativeLayout.ALIGN_PARENT_RIGHT, RelativeLayout.TRUE); params.addRule(RelativeLayout.RIGHT_OF, cs.getId()); CustomImages2 cs2 = new CustomImages2(getActivity()); cs2.setId(R.id.two); cs2.setLayoutParams(params); RelativeLayout.LayoutParams params2 = new RelativeLayout.LayoutParams(RelativeLayout.LayoutParams.WRAP_CONTENT, RelativeLayout.LayoutParams.WRAP_CONTENT); params2.addRule(RelativeLayout.ALIGN_PARENT_LEFT, RelativeLayout.TRUE); params2.addRule(RelativeLayout.BELOW, cs2.getId()); CustomImages3 cs3 = new CustomImages3(getActivity()); cs3.setId(R.id.three); cs3.setLayoutParams(params); RelativeLayout.LayoutParams params3 = new RelativeLayout.LayoutParams(RelativeLayout.LayoutParams.WRAP_CONTENT, RelativeLayout.LayoutParams.WRAP_CONTENT); params3.addRule(RelativeLayout.ALIGN_PARENT_RIGHT, RelativeLayout.TRUE); params3.addRule(RelativeLayout.RIGHT_OF, cs3.getId()); CustomImages4 cs4 = new CustomImages4(getActivity()); cs4.setId(R.id.four); cs4.setLayoutParams(params); RelativeLayout.LayoutParams params4 = new RelativeLayout.LayoutParams(RelativeLayout.LayoutParams.WRAP_CONTENT, RelativeLayout.LayoutParams.WRAP_CONTENT); params4.addRule(RelativeLayout.ALIGN_PARENT_LEFT, RelativeLayout.TRUE); params4.addRule(RelativeLayout.BELOW, cs4.getId()); CustomImages5 cs5 = new CustomImages5(getActivity()); cs5.setId(R.id.five); cs5.setLayoutParams(params); A: cs3.setLayoutParams(params); cs4.setLayoutParams(params); cs5.setLayoutParams(params); I believe params there should be replaced with params2, params3 and params4 respectively. UPDATE: Also, you should specify LAYOUT_BELOW for all views which are not on top, and do it correctly: params2.addRule(RelativeLayout.BELOW, cs.getId()); // not cs2 params3.addRule(RelativeLayout.BELOW, cs2.getId()); // add this params4.addRule(RelativeLayout.BELOW, cs3.getId()); // not cs4

package org.javaee8.jsonp.merge; import javax.json.Json; import javax.json.JsonMergePatch; import javax.json.JsonObject; import javax.json.JsonValue; import org.jboss.arquillian.container.test.api.Deployment; import org.jboss.arquillian.junit.Arquillian; import org.jboss.shrinkwrap.api.ShrinkWrap; import org.jboss.shrinkwrap.api.spec.JavaArchive; import static org.junit.Assert.assertTrue; import org.junit.Test; import org.junit.runner.RunWith; /** * Class that tests and demonstrates the JSON-P 1.1 Merge Operations. * @author Andrew Pielage */ @RunWith(Arquillian.class) public class JsonpMergeTest { // Create a JsonObject with some values to be used in each test private static final JsonObject json = Json.createObjectBuilder() .add("Wibbly", "Wobbly") .add("Replaced", false) .add("Lexicon", Json.createArrayBuilder() .add("Wibbles") .add("Wobbles") .build()) .add("Nested", Json.createObjectBuilder() .add("Birdie", "Wordie") .add("Bestiary", Json.createArrayBuilder() .add("Drowner") .add("Werewolf") .add("Chimera") .build()) .build()) .build(); @Deployment public static JavaArchive createDeployment() { // Create a JavaArchive to deploy JavaArchive jar = ShrinkWrap.create(JavaArchive.class); // Print out directory contents System.out.println(jar.toString(true)); // Return Arquillian Test Archive for application server return jar; } /** * Test that the JSON Merge operation replaces values as intended. */ @Test public void replaceTest() { // Create a JSON object that we'll merge into the class variable, replacing object members and array values JsonObject jsonToMerge = Json.createObjectBuilder() .add("Wibbly", "Bibbly") .add("Replaced", "Yes") .add("Lexicon", Json.createArrayBuilder() .add("Wibbles") .add("Bibbles") .build()) .add("Nested", Json.createObjectBuilder() .add("Bestiary", Json.createArrayBuilder() .add("Slyzard") .add("Dragon") .add("Ekimmara") .build()) .build()) .build(); // Create a merge patch and apply it JsonMergePatch mergePatch = Json.createMergePatch(jsonToMerge); JsonValue mergedJson = mergePatch.apply(json); // Print out to more easily see what we've done System.out.println("JsonpMergeTest.replaceTest: Before Merge: " + json); System.out.println("JsonpMergeTest.replaceTest: JSON to Merge: " + jsonToMerge); System.out.println("JsonpMergeTest.replaceTest: After Merge: " + mergedJson); // Test that everything is as it should be JsonObject mergedJsonObject = mergedJson.asJsonObject(); assertTrue("Merged JSON didn't merge correctly!", mergedJsonObject.getString("Wibbly").equals("Bibbly")); assertTrue("Merged JSON didn't merge correctly!", mergedJsonObject.getString("Replaced").equals("Yes")); assertTrue("JSON Array didn't merge correctly!", mergedJsonObject.getJsonArray("Lexicon").getString(0).equals("Wibbles") && mergedJsonObject.getJsonArray("Lexicon").getString(1).equals("Bibbles")); assertTrue("Nested JSON didn't merge correctly!", mergedJsonObject.getJsonObject("Nested").getString("Birdie").equals("Wordie")); assertTrue("Nested JSON Array didn't merge correctly!", mergedJsonObject.getJsonObject("Nested").getJsonArray("Bestiary").getString(0).equals("Slyzard") && mergedJsonObject.getJsonObject("Nested").getJsonArray("Bestiary").getString(1).equals("Dragon") && mergedJsonObject.getJsonObject("Nested").getJsonArray("Bestiary").getString(2).equals("Ekimmara")); } /** * Test that the JSON Merge operation adds values as intended. */ @Test public void addTest() { // Create a JSON object that we'll merge into the class variable, adding object members and array values JsonObject jsonToMerge = Json.createObjectBuilder() .add("Bibbly", "Bobbly") .add("Lexicon", Json.createArrayBuilder() .add("Wibbles") .add("Wobbles") .add("Bibbles") .add("Bobbles") .build()) .build(); // Create a merge patch and apply it JsonMergePatch mergePatch = Json.createMergePatch(jsonToMerge); JsonValue mergedJson = mergePatch.apply(json); // Print out to more easily see what we've done System.out.println("JsonpMergeTest.addTest: Before Merge: " + json); System.out.println("JsonpMergeTest.addTest: JSON to Merge: " + jsonToMerge); System.out.println("JsonpMergeTest.addTest: After Merge: " + mergedJson); // Test that everything is as it should be JsonObject mergedJsonObject = mergedJson.asJsonObject(); assertTrue("Merged JSON didn't merge correctly!", mergedJsonObject.getString("Wibbly").equals("Wobbly")); assertTrue("Merged JSON didn't merge correctly!", mergedJsonObject.getString("Bibbly").equals("Bobbly")); assertTrue("Merged JSON didn't merge correctly!", !mergedJsonObject.getBoolean("Replaced")); assertTrue("JSON Array didn't merge correctly!", mergedJsonObject.getJsonArray("Lexicon").getString(0).equals("Wibbles") && mergedJsonObject.getJsonArray("Lexicon").getString(1).equals("Wobbles") && mergedJsonObject.getJsonArray("Lexicon").getString(2).equals("Bibbles") && mergedJsonObject.getJsonArray("Lexicon").getString(3).equals("Bobbles")); assertTrue("Nested JSON didn't merge correctly!", mergedJsonObject.getJsonObject("Nested").getString("Birdie").equals("Wordie")); assertTrue("Nested JSON Array didn't merge correctly!", mergedJsonObject.getJsonObject("Nested").getJsonArray("Bestiary").getString(0).equals("Drowner") && mergedJsonObject.getJsonObject("Nested").getJsonArray("Bestiary").getString(1).equals("Werewolf") && mergedJsonObject.getJsonObject("Nested").getJsonArray("Bestiary").getString(2).equals("Chimera")); } /** * Test that the JSON Merge operation removes values as intended. */ @Test public void removeTest() { // Create a JSON object that we'll merge into the class variable, removing object members and array values JsonObject jsonToMerge = Json.createObjectBuilder() .addNull("Wibbly") .add("Lexicon", Json.createArrayBuilder() .add("Wibbles") .build()) .add("Nested", Json.createObjectBuilder() .addNull("Bestiary") .build()) .build(); // Create a merge patch and apply it JsonMergePatch mergePatch = Json.createMergePatch(jsonToMerge); JsonValue mergedJson = mergePatch.apply(json); // Print out to more easily see what we've done System.out.println("JsonpMergeTest.removeTest: Before Merge: " + json); System.out.println("JsonpMergeTest.removeTest: JSON to Merge: " + jsonToMerge); System.out.println("JsonpMergeTest.removeTest: After Merge: " + mergedJson); // Test that everything is as it should be JsonObject mergedJsonObject = mergedJson.asJsonObject(); assertTrue("Merged JSON didn't merge correctly!", !mergedJsonObject.containsKey("Wibbly")); assertTrue("Merged JSON didn't merge correctly!", !mergedJsonObject.getBoolean("Replaced")); assertTrue("JSON Array didn't merge correctly!", mergedJsonObject.getJsonArray("Lexicon").getString(0).equals("Wibbles")); assertTrue("Nested JSON didn't merge correctly!", mergedJsonObject.getJsonObject("Nested").getString("Birdie").equals("Wordie")); assertTrue("Nested JSON Array didn't merge correctly!", !mergedJsonObject.getJsonObject("Nested").containsKey("Bestiary")); } }

/(10/25). Let x = -8.47 - -8.6. What is the nearest to 0 in p, -1/2, x? p Let t = 144.16 + -2.16. Let g = t - 142. Which is the closest to 4? (a) g (b) 10 (c) -0.4 a Let h = 439 - -895. Let q be 1 + h/(-1460)*2. Let w = -2/73 - q. What is the closest to -4/5 in 3/4, w, 5? 3/4 Let q be -3 - -4 - (-25)/(-10) - 0. Let f = 33/61 - 587/183. Which is the closest to -1? (a) q (b) f (c) 15 a Let g(f) = -59*f - 166. Let v be g(-3). Let n be (-170)/(-55) - 1/v. What is the nearest to -0.1 in n, 4, 0, 0.3? 0 Let k = 893 - 893.05. Which is the closest to -1/26? (a) k (b) -5 (c) -2/13 (d) -2 a Let d = -10 + 14. Let c = -3894 - -27256/7. Let v = -5 - -4. What is the closest to v in c, 2/9, d? c Let t = -517/150 - -296/75. Which is the nearest to 2/9? (a) t (b) 28/5 (c) 2/9 (d) 0.14 c Let z = -3763.08 - -3763. What is the closest to 2 in 3, z, 1/5? 3 Let u be ((-2)/1)/(3 - 1). Let j = -9343 + 9342.9. What is the nearest to 0 in u, -0.42, j? j Let s be (-132)/22 + (-112)/(-19). Let v = -26 - -25.8. Which is the nearest to -1? (a) v (b) -0.11 (c) 5/4 (d) s a Let o = 951 - 949.4. Which is the closest to -8? (a) o (b) 0 (c) 0.1 b Let o = 5 + 10. Let z = o + -15. Suppose -16 = -m - 11. What is the nearest to 0.1 in z, m, 4? z Suppose -5*h - o + 12 = 0, 4 - 10 = -4*h - 2*o. Let u = 27.954 - -0.046. Which is the nearest to u? (a) -2/3 (b) 2/7 (c) h c Let r = -17556.057 + 17556. Which is the closest to -0.1? (a) 5 (b) 2 (c) 1 (d) r d Let a = -1.4599 - -0.4799. What is the nearest to -2/5 in a, -4, 1/4? a Let w = -0.07 - 3.93. Let o = -41 - -40. Let j = o - -6. Which is the closest to -1? (a) j (b) -9 (c) w c Let q = 28.837 + 0.363. Let u = q + -30.2. Let z = -2 - 0. What is the closest to u in 5/4, z, 2/7? z Let u = -0.0646 + 0.1646. Which is the nearest to -1/22? (a) 0.5 (b) u (c) 0.06 (d) 3 c Let l = -189440/7 + 27062. Which is the closest to 3? (a) 5 (b) l (c) -4/3 (d) 13 a Let r = 19369 - 35939. Let n = r - -1640387/99. Let v = n - -6/11. Which is the nearest to 1? (a) v (b) -1/2 (c) 4/19 c Let q = -172/7 - -24. Suppose 3*h = 11 - 2. Let f(o) = -2*o**2 + 8*o - 3. Let l be f(h). Which is the closest to 0.1? (a) 1/5 (b) l (c) q a Let x be ((-10)/(-6))/(6020/1032). Which is the nearest to -0.2? (a) -0.4 (b) x (c) -216 a Let s = 297/380 - 3/95. Let x = -73.5 + 73.1. Suppose 0 = 4*u, 0 = -5*m - 3*u - u - 20. Which is the nearest to -2/5? (a) m (b) x (c) s b Let r be (390/1430 - (-138)/(-22)) + 3*2. What is the nearest to r in 1, -2/95, -0.3, -1/2? -2/95 Let u be (2/22)/(9/(-54)). Suppose -6*s = -l - 3*s + 11, 4*l - s = 22. Which is the nearest to u? (a) 0 (b) l (c) -4 a Let y = 2922 - 2925.8. What is the closest to -1 in -1, -24, y, -5? -1 Suppose -3*n - 2*n - 4*j + 30 = 0, -4*n + 3 = -j. Let m = 488.3 + -488.1. What is the closest to n in -1/5, m, -7? m Let v be ((-1)/(-2))/((-6)/4). Let h = -2035.3 + 2033.3. What is the nearest to v in h, -8, 6/11, 4? 6/11 Let a(p) = p**3 + 10*p**2 - 8*p + 34. Let o be a(-11). What is the nearest to o in 1, -9.9, -0.4, 4/5? 1 Let w be (1 + 1)*(14/(-9))/((-436)/981). What is the nearest to 5 in w, 0.4, 2? w Let h be -4*(-6)/(-13758)*(-2)/(-4). Let u = 4604/20637 + h. Which is the closest to 0? (a) u (b) 0.5 (c) 4 a Let g = -1418 + 1416. Let z be -24*(6 + g + (-430)/105). Suppose 2*i - 2 = -0*i. What is the closest to 0 in z, -3, i? i Let x = -15.87 - -15.85. What is the closest to x in 0.5, 4, -2/5? -2/5 Let c = 0.1273 + 0.1727. Let u = 2654/13 + -204. What is the nearest to c in 1/4, u, 0? 1/4 Let v = -26.415 + 22.415. Which is the nearest to 1/6? (a) -1/4 (b) -1/6 (c) v (d) -3 b Let k = -20.244 + 16.244. Which is the nearest to k? (a) 1/10 (b) 1/7 (c) -3 (d) 566 c Let v = 36.1 - 35. Let x = -1110 + 1107. Which is the nearest to -1? (a) 5 (b) x (c) v b Let z = -5865 + 5865. Which is the nearest to z? (a) 0.212 (b) 4 (c) -5 a Let q = 151483/14700 - 1421/150. Let n = q + -4/49. Suppose v + 1 = 3*u, -4*u = -11*v + 8*v - 3. Which is the closest to -0.1? (a) 0.5 (b) u (c) n b Let o be 0 + -1 + 48/30. Let l = 32.1 - 32.2. Let r = 1.0797 - 0.0797. What is the closest to l in o, -2, r? o Let i = -79090 - -79094. Let b = -0.8 + -0.2. What is the nearest to b in i, -3/5, 1? -3/5 Let u(q) = -q**2 - 15*q + 24. Let y be u(-17). Let f = 1274.9 + -1275. What is the nearest to f in 0.3, 1/2, y? 0.3 Let v = -29.7 + 29.843. Let n = 0.123 - v. Which is the closest to n? (a) -0.5 (b) 0.1 (c) 4 b Let m = -55.4 + 71.4. Let a be (-22)/(-102) - (-1)/(-9)*3. What is the nearest to m in 1, a, -0.2? 1 Let p = 2951/3 - 984. Let n = -0.2 + 0.1. Let k = 0.2 + n. What is the closest to 2/3 in k, p, -4? k Let j = 200.5 - 74.6. Let m = j - 126. What is the closest to 5/4 in 0.1, 0, m? 0.1 Let w = -22411/42 - -3199/6. What is the closest to -0.1 in 1.6, -0.01, w? -0.01 Let a be ((-2)/6)/((-4)/36). Suppose 24*y = 20*y, 3*y + y + 3 = -3*l. Let g = 0.6 - 0.3. What is the closest to -4 in a, g, l? l Let d be 2/(-6)*11565/(-10) + -2. Let y = -384 + d. Which is the nearest to y? (a) 1/3 (b) -4/7 (c) 2 b Let y = -86196/7 - -12314. What is the closest to y in 1/5, 7, 5/6? 1/5 Let d be (-28)/70 - 26*1/25. Let t = d + 47/50. What is the nearest to 2 in -2/7, -5, t? -2/7 Suppose 5*g - 6 = 2*t, 4*g - 43*t = -47*t - 12. Let m(n) = n**2 + 5*n + 4. Let j be m(-3). What is the closest to g in j, -4, 0.2? 0.2 Let g = -588 - -521. Let k = g - -67. Suppose -2*w - w = 5*n - 23, -15 = -3*n - 3*w. Which is the nearest to -5? (a) -3 (b) k (c) n a Let c = 12250 - 12250. What is the nearest to 182 in c, 0.1, -29? 0.1 Suppose 4*t + t - 30 = 5*f, -4*f + 3*t - 28 = 0. Let j be 22/55*f/8. Let h = -7.8 - -7.5. Which is the nearest to j? (a) h (b) -1 (c) -0.2 a Let l = 63 - 62. Let w = -208 - -203. Which is the nearest to w? (a) l (b) -1/3 (c) -0.2 b Let q = -22143 - -88573/4. What is the closest to -3/19 in -0.05, q, 1/5, -3/7? -0.05 Let y be -37 + (-4767)/(-126) - 7/3. What is the nearest to -2 in -2/7, y, 0.4, -9? y Let n = 4863 - 4900. Which is the closest to 1? (a) n (b) -9 (c) 5 c Let f = 0.08092 - 0.18092. Which is the closest to f? (a) 82 (b) 0.2 (c) -3/16 c Let w = 21.98 - -3.32. Let g = 25 - w. Let p = -0.27 + 0.27. What is the nearest to 1 in p, g, 0.3? 0.3 Suppose -6 = l - 3*l. Let f be ((-2)/(-8))/(16*20/4160). Which is the nearest to f? (a) l (b) -2 (c) -5 a Let f = 1138 - 1133. Let n = 33 - 33.02. Let q = -0.02 - n. Which is the nearest to 1? (a) 3 (b) q (c) f b Suppose z + 9*z - 23*z = 0. Let t = -8/9 + 11/9. What is the closest to z in t, -5, 2/19? 2/19 Let z be (-18)/(-28) - 2/4. Let n = 1038 - 1037. Which is the nearest to n? (a) 1 (b) z (c) -0.2 a Suppose 39 = 5*w - 2*d, -w + 1416*d - 1412*d + 51 = 0. Let q = 5 - 3. Which is the nearest to 2/7? (a) 4/3 (b) q (c) w a Let w be (-690)/414 + 4/3. Let s = -4212/23 + 183. Which is the nearest to w? (a) 4 (b) s (c) 2 b Let r = -72 - -74. Suppose -5*b - 17 = g, 0 = 2*b - r*g + g + 4. Let m = -5 - -3. What is the nearest to m in -0.1, b, 0.08? b Let u(d) = d**3 - 20*d**2 - 73*d + 87. Let i be u(23). Which is the closest to -16? (a) 0.06 (b) -1/4 (c) i c Let d = 30497 - 30500. Which is the nearest to d? (a) -6/7 (b) -0.09 (c) -1/5 a Let x be (-7)/(-4) - 18*(-4)/(-36). Let f = 29/195 + 2/39. Let i = 140 + -134. Which is the nearest to f? (a) x (b) i (c) 5 a Let u = -28.6 - -29.6. Let l = 644 - 642. Which is the nearest to l? (a) 5 (b) -2 (c) u c Let m = 464.737 - 29.737. What is the nearest to 0 in m, 5, 0.4? 0.4 Let w = -1919/52 + 147/4. Let s = -2 - 2. Let n = -3.7 - s. What is the nearest to -1/2 in n, w, 2? w Let y be (-147)/105*(-12)/(-14). Let o = 2.15 + -0.15. Let k = -130 - -127. What is the closest to y in o, -4, k? k Let u be (0 - 13) + 27 - 8. Let w = -3.6 - -3. Which is the closest to -1/4? (a) 3 (b) w (c) u b Let d = -1.039 - -0.119. Let f = d - -4.92. Suppose 29*j + 4 = 27*j. What is the closest to 0.3 in j, f, -3? j Let l = 3622 - 3627. Which is the nearest to 2/3? (a) l (b) -1/3 (c) 16 (d) 3 b Let x be (2587/(-597))/((-26)/(-4)). Let n = -0.22 - -0.2. Which is the nearest to x? (a) 5 (b) -3/5 (c) n b Let o = 4 + -4.9. Let s = 0.1 - o. Let g = -0.01858 + -6.98142. What is the nearest to

--- title: 如何把一个 RegularJS 组件打成 npm 包 date: 2017-07-04 --- 本篇基于 RegularJS 热区组件，简单分享一下组件打包发布的全流程及主要遇到的问题。 ## 目录 1. 项目初始化 2. 开发环境准备，安装基础依赖 3. 将组件打包输出成多种模式!important 4. 进入开发 5. 包装工作 6. 最终发布 <!-- more --> ## 1. 项目初始化 #### 1. 在 GitHub 上创建项目仓库，添加 README 和 License 没什么好说的，License 一般设置成 MIT（开源万岁），详细协议介绍可查：[HELP](https://choosealicense.com/)。 #### 2. clone 到本地，设置 git config 本地全局的 git config 文件一般设置为公司的邮箱和用户名。为了避免泄露信息，可在初始化时提前进行项目层面的 config 设置： ```shell $ git config user.name "GitHub 用户名" $ git config user.email "GitHub 邮箱" ``` 这样提交代码时就以该用户名及邮箱作为用户信息了，此时执行查看命令可以看到： ```shell $ cat .git/config [user] name = GitHub 用户名 email = GitHub 邮箱 ``` #### 3. 执行 npm init，生成 package.json 按提示一步步来完成配置即可。 ## 2. 开发环境准备，安装基础依赖 这里偷了个懒，直接使用了 vue-cli 的 [webpack-simple](https://github.com/vuejs-templates/webpack-simple) 模式生成的 webpack.config.js 和 package.json，并调整成实际需要的配置。 配置比较简单，可以直接 [**戳我**](https://github.com/Deol/regular-hotzone/blob/master/webpack.config.js) 看一下（具体配置解释直接查阅 [文档](https://webpack.js.org/configuration/output/#output-librarytarget)）。 ## 3. 将组件打包输出成多种模式!important 既然是 RegularJS 组件，那么打包后的组件无论是直接以 `<script>` 标签形式引入，或者用 AMD / CommonJS 方式引入都应该可以使用。 ### 第一部分，webpack 配置 与此相关的配置项是这三个： - output.library && output.libraryTarget library 属性能让打包后的整个组件被当成一个全局变量使用。考虑命名污染及冲突，可以将 `library` 属性的值起得相对复杂些，如 `regularHotZone`。 另外，为了让组件在多种模式下都可运行，使用 `libraryTarget` 配置该组件的暴露方式为 **umd**。该模式意味着组件在 CommonJS、AMD 及 global 环境下都能运行： ``` output: { library: 'regularHotZone', libraryTarget: 'umd' } ``` - externals 这个配置是为了排除外部依赖，不将它们一起打包进去。对于 RegularJS 组件来说，并不需要把 RegularJS 也打包进去，此时就应该用 externals。 而配置中是这么写的： ``` externals: { regularjs: { root: 'Regular', commonjs: 'regularjs', commonjs2: 'regularjs', amd: 'regularjs' } } ``` 这是由于上述的 libraryTarget 设置为 umd，那么这里必须设置成这种形式，RegularJS 才能在 AMD 和 CommonJS 模式下通过 regularjs 被访问，但在全局变量下通过 Regular 被访问。 ### 第二部分，package 配置 另一方面，我们需要在组件的 package.json 中需要将 RegularJS 设置为同伴依赖 (`peerDependencies`)： ``` // 建议：不同于一般的依赖，同伴依赖需要降低版本限制。不应该将同伴依赖锁定在特定的版本号。 "peerDependencies": { "regularjs": "^0.4.3" } ``` 因为 RegularJS 组件是 RegularJS 框架的拓展，它不能脱离于框架独立存在。 也就是说，如果需要以 npm 包形式引入 RegularJS 组件，那么 RegularJS 框架必须也被引入，不管是以 npm 包形式引入，还是用 `script` 标签引入并配置 externals。 **注意**：如果安装组件包时，找不到 RegularJS 或者其**不符合同伴依赖的版本要求**，终端将抛出警告： ``` `-- UNMET PEER DEPENDENCY regularjs@^0.4.3 npm WARN regular-hotzone@0.1.14 requires a peer of regularjs@^0.4.3 but none was installed. ``` npm 使用的版本规则「[**在此**](https://docs.npmjs.com/misc/semver)」查看。 可以知道，上面设定 RegularJS 版本为 `^0.4.3`，相当于 version >= 0.4.3 && version < 0.5.0。 ## 4. 进入开发 跑个 `npm run startdev`，balabalabala... ## 5. 包装工作 1. 完成整体开发后，修改 package.json 中的 version（版本介绍「[**在此**](http://semver.org/lang/zh-CN/)」，每次发布都必须修改，否则无法发布），并利用 `npm run build` 打包输出 dist 文件夹。 2. 编写 Readme，可参考「[如何写好 Github 中的 readme？ - 知乎](https://www.zhihu.com/question/29100816/answer/68750410)」。 ## 6. 最终发布 最终阶段，进入 https://www.npmjs.com/ 完成注册后，执行： ``` $ npm publish ``` 完成登录后可能会发布失败，因为我们可能会将 npm 源设置为淘宝源，此时需要添加 `//` 暂时将其注释： ``` $ vi ~/.npmrc //registry=https://registry.npm.taobao.org ``` 保存后重新执行发布操作即可。 此时我们可以通过 npms.io 搜索 npm 包名，如（请忽略分数）：  并通过其[**分析**](https://npms.io/about)增强 npm 包的质量，最简单的可以有： - 完善 Readme、license、.gitignore 等； - 接入 [Travis CI](https://travis-ci.org/) 等，并确保覆盖率； - 去除过时依赖，减少依赖的脆弱性； - 增加专属站点，添加 Readme 上面的 icons； - 接入 ESLint，实现静态代码检查； - ...

Prime Minister Narendra Modi while addressing a rally in Bhopal, the state which goes to the polls alter this year has once again hit out the congress party. Without mentioning the on-going Rafale controversy, P M Modi accused the Congress of indulging in mud- slinging against the government and running away from debating issues of development with the government. The Prime Minister tweeted about his scheduled engagement in Bhopal Looking forward to interacting with the hardworking Karyakartas of @BJP4MP at the #KaryakartaMahakumbh in Bhopal today. https://t.co/ZxPSqlIoxJ — Narendra Modi (@narendramodi) September 25, 2018 Modi took a did at the Congress saying the 125-year-old party has been reduced to such a condition that it is “begging” with small parties for alliances. He said even if the Congress gets allies, the coalition will not be successful. Modi said his government believes in social justice for all and that its ‘Sabka Sath, Sabka Vikas’ (cooperation of all, development of all) campaign is not just a slogan. He expressed confidence that the BJP would emerge victorious in the upcoming Assembly polls in Madhya Pradesh as well as in the Lok Sabha elections next year.

I often ask parents that I’m working with: “What makes your little one laugh? What makes them happy?” Usually, this is an easy question to answer. “She thinks its so funny when her dad makes faces at here,” or “He loves it when he hears his mama’s voice.” Together, we can use this information to find out what’s motivating to children, to help them learn and grow. And then I ask the follow up question: “What brings you joy about your child?” This one’s a little harder to answer, but we get there. “I love the way she smiles,” or “I can’t get enough of the way his eyes crinkle in the light.” After that, I ask:. “What brings you joy?” That one’s a toughie. Especially from a new parent, or one that just found out their child has a developmental delay. There may not be a ton of moments of joy right now, or they may be being overshadowed by tiredness, or grief, or stress. But again, we get there. Together, we talk about how important it is to find those moments, to make time for them and really relish them. Then comes the hard one. The real stumper. “How do you and your child experience joy and delight together?” In the 2015 book, “All Joy and No Fun”, author Jennifer Senior writes about how there is such a focus on doing for your kids and on making sure they are learning and happy, that we forget to have fun. We want to make moments of joy and delight, but we don’t enjoy them. They end up being another box ticked in a list of milestones, doctor’s appointments, and playgroups. And you know what, a lot of times parenting isn’t fun. It’s not full of happiness and rainbows and puppies around the corner. And that’s fine. I want you to acknowledge you’re doing a good job. Notice the little things. Share your love and interests with your child because you know what? It's not just about them. It's about learning how to live life together. It's about teaching them how to find joy. And it's about knowing how to talk about all of our feelings. Senior writes: “Vocabulary for aggravation is large. Vocabulary for transcendence is elusive.” While I agree that sometimes it's easier to complain than it is to talk about the light in your life, I also think that you cannot have light without dark. And children need to be taught how to feel and talk about all the feelings. Then they can truly sit in and enjoy the joy with you. Need some help noticing what brings you or your child joy? Not sure how to delight in things together? Reach out and we can make it happen together!

Mrs. 3122's Family Fun Blog Sunday, August 31, 2014 As the days unfold and we come to what is probably your end of watch, I wanted to document the love I have for you and how you made my life a better place to be. I'm not sure why, but helps my heart a little to put it all in words. If anyone ever reads this, fine. If they don't, that's fine too. I don't want anyone to think I am a crazy dog lady. Even if I am. It's just my way of dealing with it. Here is your story. Way back when my dear husband, Rick, decided to change jobs and become a police officer, I told him ok, under one condition. I wanted a watch dog. A protector, a friend, a guardian to watch over me and our three children when he had to work over nights. I wanted a dog that was good with children, yet willing to bark loud enough to scare anyone away. I wanted a dog that I could talk to, confide in, and be my best friend. We had two dogs, a lovable black lab, Dixie, who didn't have a mean bone in her body, and an elderly basset hound, Boomer, that could hardly walk. I needed a dog that was a little more protective. In the summer of 2004, we went on a family trip and dropped Dixie and Boomer off at the kennel, and that was when I first laid eyes on you. You were the runt of the litter. The unclaimed puppy. The one no one wanted. In my eyes, you were perfect, and I instantly fell in love. Your name was Bear. I knew then in my heart that you would be a part of our family. I just had to talk my husband into it. I spent all week trying to convince him that you needed to come live with our family. He was adamant that he didn't want "three dog drama" or a dog named Bear. I said fine, then rename him. I begged, I pleaded, I cajoled. When the family trip was done, and it was time to pick up the dogs from the kennel, I eagerly offered to go, but I told Rick, "If that puppy is still there, I am bringing it home." He grabbed his keys and left in a huff, grumbling under his breath. Imagine my surprise an hour later when he lifted you out of the truck and set you in the grass and said, "His name is Fudge". Rick tries blaming the whole thing on the fact that the kennel guy gave him a fabulous deal he couldn't refuse and wiped out our kennel bill for buying you. I know better. I know that my husband just has a heart of gold, and he knew that you belonged with us. As much as he doesn't like to admit it, he wanted a protector for me when he wasn't home too, and you fit the bill perfectly, my dear clearance puppy. You fit into our little family perfectly. Claimed your place on the bed and in my heart immediately. Dixie had always been Rick's dog, and a few months after you came to live with us, Boomer went to the Rainbow Bridge. You filled the hole that left in our hearts. Our children adored you and played with you all the time. Life was good. Then "the bad thing happened" just a year later. It was a rough month for all of us. A lot happened in a short period of time. You'd been at the kennel and injured your paw, your boys, who you adored, had been at camp all week, then your girl, who you also adored, was at camp all week, and we moved. All at once. We brought you back to your new house and when Cassidy got home, she was SO excited to see you, and it happened all so fast. You were tired, and upset, and hurt, and she accidentally stepped on your foot when she came to say hello, and before we knew what happened, she was screaming, and you looked guilty. One quick bite and it was done. None of it was your fault really, but at that moment, I didn't want you to be part of our family anymore. I love my dogs, but in the pack hierarchy, my precious children rank WAY above any dog. Rick threw you in a kennel and we rushed Cass to get 9 stitches around her elbow. When we got home. I told Rick to "take you to the vet". Lucky for you, and eventually for me, Rick and the kids prevailed. They convinced me you didn't mean to do it, that it was an accident, and that we should just see how things went for a few days. It was a family vote and I was outvoted 4-1. Even Cassidy voted to keep you. I was not happy. I didn't want you around my precious daughter. I didn't trust you. Time softened my anger at you. You became the sweetest, gentlest dog, who was always wary around her. You always eyed me like you knew you'd done wrong and wished you could undo it. Little by little, you worked your way back into my heart and became trusted again. In 2006, Roscoe made his debut into our family as we missed having a hound. You instantly became besties. He's never been able to tolerate you being out of the room. He's a great sidekick, isn't he? In 2007, Dixie left for the Rainbow Bridge. F***ing cancer. She was only 7. She was more Rick's dog, and it was very hard on him. As the last few years have gone by, you've barked at strangers, growled at the wind, and made me feel safe more times than you know. You've snuggled up to sick children, as though you knew they needed you. You've sat outside on cold nights, protecting me as I sit in the hot tub, never letting me go out alone. You've cleaned up every mess I've ever made on the floor without once complaining. And thanks to you, I've never had to eat my own pizza crust. Every night, you jump on the bed, spin around and face the door at my feet. Always ready to jump in if I needed protecting. I sleep soundly knowing you are there to protect me. I've always felt safer. If I'm sad, you know, and you stick close, nudge me with that cold wet nose, and snuggle in closer. As the years have gone by, your face has gotten whiter, your walk a little slower, but ever still, you protect me every second of the day. Now, here were are again, faced with the dreaded cancer verdict, and just trying to enjoy our last few days with you. I've already cried a river of tears this week, but they just won't stop. And even though they are for you, you still come up and lick them off my face. We're trying to make the rest of your time here as happy as we can. There's been swimming, and belly rubs, and ice cream shared. Yes, off my spoon. I don't care. And so many kisses. I just want to sit forever and pet your ears and scratch your head. Rest assured, my dearest best friend, when the time comes that I think you are in pain or suffering, I will do the right thing. I will hold your faithful paw and stroke your angel soft ears as you cross the Rainbow Bridge. I will cry more tears for you then I thought possible, and I will miss you forever. You've been such a good dog and I am so glad you were part of my pack even if it only was for a short 10 years. I love you forever, Fudge. I've loved all my dogs over the years, but you are my absolute favorite. Update :( On September 3, 2014, while holding his sweet face, my doggie passed over the Rainbow Bridge. You will be forever missed. Wednesday, May 21, 2014 I have never done anything in my life that I have had such a love hate relationship with. I hate running. I really, truly do. But, the more I do it, the more I love to hate it and love it all at once. Confused yet? Good, because I am too.I will be honest, if my husband wasn't doing this with me, I definitely wouldn't still be running, so thank you, God, for him! I was running today with him, and he always pushes me to my best. I ran with him today, and felt like I really struggled and went so slow! But then thanks to my trusty RunKeeper software, I got done and realized I blew my last 5k time out of the water.And then I felt on top of the moon and was happy as can be. In the middle of running, I am not a happy camper, but the second I am done - woohoo! I can't be the only one that feels like this, right? Saturday, May 17, 2014 Ok, so yeah, I know, I don't post nearly as often as I should. LOL! Do I start every post like that, or what? I am still running, I am still working on being a better me. I am working full time as an ad rep for the local newspaper/magazine and I am in the process of training for a my first half marathon. Since we (my husband, friends and I) completed that first 5K at the Mankato Marathon last fall, we''ve completed 3 more 5ks, a 7k and are now just 2 weeks away from our first half marathon. On June 1st, we will be running our very first half marathon at the Minneapolis Marathon. I never could have accomplished something like this without the support of my friends and my family, and especially my husband. I cannot begin to tell you how impossible this all would have been without him. He's my rock, my inspiration, my everything! He runs faster than I do, and I don't care. He's always there to catch me at the end, and that's all that matters. 24 Day Challenge Kit My kids have been amazingly supportive too, but that's nothing new, they always have been. They are such awesome people! My newest inspiration comes from middle child, Conor. He introduced me to Advocare products over the last couple of years, and I have fallen in love and finally decided to take the plunge and become a distributor! I am very excited about it. They make amazing sports nutrition products and I am so excited to have joined the company. My daughter, Cassidy, and I are going to be doing the 24 day challenge starting on June 2nd. I am VERY excited to get another jumpstart on this healthy lifestyle and cleanse my body! Want to know more? Or join us? Contact me for more info! Here's some basic info on what the 24 day challenge is all about! Feel free to contact me with any questions you might have too.

China Film Archive The China Film Archive is a film archive in Beijing, China. See also List of film archives External links http://www.cfa.org.cn/ Category:Film archives Category:Archives in China Category:Cinema of China

Q: Warning message of deprecated link option of Docker I try to link a wordpress container to a mysql container with following command and get the output of warning about deprecated option of -link. $ sudo docker -v Docker version 0.9.0, build 2b3fdf2 $ sudo docker ps CONTAINER ID IMAGE COMMAND CREATED STATUS PORTS NAMES 3987ba6ef34e p-baleine/mysql:latest /run.sh 22 seconds ago Up 21 seconds 0.0.0.0:49153->3306/tcp sad_euclid $ sudo docker run -e="DB_PASSWORD=$DB_PASSWORD" -link sad_euclid:db -d -p 80 p-baleine/wordpress /run.sh Warning: '-link' is deprecated, it will be removed soon. See usage. I cannot find any information of deprecation of the link option. Why the link option is deprecated and what is the alternative of this option? A: I check usage and I understand that options should be specified by prefixed double hyphen. $ sudo docker run -e="DB_PASSWORD=$DB_PASSWORD" --link sad_euclid:db -d -p 80 p-baleine/wordpress /run.sh

Features of stabbing, cough, exertional and sexual headaches in a Turkish population of headache patients. The aim of this study was to determine the features and prevalence of primary stabbing headache, primary exertional headache, primary headache associated with sexual activity, and primary cough headache in a Turkish population of headache patients. The data for this study were obtained from 245 patients with headache. Of these patients, 55 fulfilled the International Classification of Headache Disorders (second edition) diagnostic criteria for 'other primary headaches' such as primary stabbing headache (n=31), primary cough headache (n=1), primary exertional headache (n=13), primary headache associated with sexual activity (n=4), and both primary cough headache and primary exertional headache (n=6). Primary stabbing headache was found in 12.6% of patients, primary cough headache in 0.4%, primary exertional headache in 5.3% and primary headache associated with sexual activity in 1.6%.

Structural Plasticity in Adulthood with Motor Learning and Stroke Rehabilitation. The development of advanced noninvasive techniques to image the human brain has enabled the demonstration of structural plasticity during adulthood in response to motor learning. Understanding the basic mechanisms of structural plasticity in the context of motor learning is essential to improve motor rehabilitation in stroke patients. Here, we review and discuss the emerging evidence for motor-learning-related structural plasticity and the implications for stroke rehabilitation. In the clinical context, a few studies have started to assess the effects of rehabilitation on structural measures to understand recovery poststroke and additionally to predict intervention outcomes. Structural imaging will likely have a role in the future in providing measures that inform patient stratification for optimal outcomes.

Fuel reformers reform hydrocarbon fuel into a reformate gas such as hydrogen-rich gas. In the case of an onboard fuel reformer or a fuel reformer associated with a stationary power generator, the reformate gas produced by the fuel reformer may be utilized as fuel or fuel additive in the operation of an internal combustion engine. The reformate gas may also be utilized to regenerate or otherwise condition an emission abatement device associated with an internal combustion engine or as a fuel for a fuel cell.

Q: Web api large file download with HttpClient I have a problem with large file download from the web api to the win forms app. On the win form app I'm using HttpClient for grabbing data. I have following code on server side: [HttpPost] [Route] public async Task<HttpResponseMessage> GetBackup(BackupRequestModel request) { HttpResponseMessage response; try { response = await Task.Run<HttpResponseMessage>(() => { var directory = new DirectoryInfo(request.Path); var files = directory.GetFiles(); var lastCreatedFile = files.OrderByDescending(f => f.CreationTime).FirstOrDefault(); var filestream = lastCreatedFile.OpenRead(); var fileResponse = new HttpResponseMessage(HttpStatusCode.OK); fileResponse.Content = new StreamContent(filestream); fileResponse.Content.Headers.ContentType = new MediaTypeHeaderValue("application/octet-stream"); return fileResponse; }); } catch (Exception e) { logger.Error(e); response = Request.CreateResponse(HttpStatusCode.InternalServerError); } return response; } on client side: private async void btnStart_Click(object sender, EventArgs e) { var requestModel = new BackupRequestModel(); requestModel.Username = txtUsername.Text; requestModel.Password = txtPassword.Text; requestModel.Path = txtServerPath.Text; var client = new HttpClient(); var result = await client.PostAsJsonAsync("http://localhost:50116/api/backup", requestModel); var stream = await result.Content.ReadAsStreamAsync(); var localPath = @"d:\test\filenew.bak"; var fileStream = File.Create(localPath); stream.CopyTo(fileStream); fileStream.Close(); stream.Close(); fileStream.Dispose(); stream.Dispose(); client.Dispose(); } } This is actually working, but the purpose of this program is to grab large files over 3GB and save it to the client. I have tried this on files sized 630MB what I notice is: When I call web api with http client, http client actually loads 630MB in the memory stream, and from the memory stream to the file stream, but when I try to load a different file I'm getting OutOfMemoryException. This is happening because the application doesn't release memory from the previous loaded file. I can see in task manager that it is holding 635MB of ram memory. My question is how can I write data directly from HttpClient to file without using memory stream, or in other words how can I write data to file while HttpClient is downloading data? A: To make the request, use a SendAsync overload that allows you to specify a HttpCompletionOption and use ResponseHeadersRead. You'll have to manually build the request though, without using the PostAsJsonAsync convenience method.

We've Got Car Insurance In New Holland Covered. I'm a 2nd generation insurance agent in the New Holland area. I feel strongly that it is my job to make sure customers understand their insurance needs. I'm a proud supporter of Akron Boy Scout troop 57. Directions: From the intersection of Rt 23 & Railroad Ave, turn left and continue east on Rt 23. We are across the parking lot from the beer distributor and beside Choice Windows and Doors.

Two decades after it started spraying coca fields with herbicide, Colombia is torn between continuing to wage a US-sponsored war on drugs from the sky and mounting fears of health risks. Launched in 1994, the spraying program was long treated as sacrosanct by Colombian officials, who gladly accepted billions of dollars in funding from Washington and succeeded in slashing the cocaine production that has fueled the country's five-decade civil war. But since the World Health Organization warned last month that glyphosate, the active ingredient in the herbicide, is "probably carcinogenic," infighting has broken out in President Juan Manuel Santos's cabinet over whether to continue the air war on coca, the raw ingredient for cocaine. Health Minister Alejandro Gaviria said last week that Colombia should "immediately suspend" spraying—a move vehemently opposed by Defense Minister Juan Carlos Pinzon, who said it would "give criminals the upper hand." The row erupted just as US Deputy Secretary of State Antony Blinken paid a visit to Colombia, which the United States sees as one of its closes allies in the region. The South American country has received $9 billion in US funding since 1999 under "Plan Colombia," a military and economic cooperation program aimed at fighting drug trafficking and the long-running insurgencies by the Revolutionary Armed Forces of Colombia (FARC) and the National Liberation Army (ELN). Aerial spraying, carried out with American planes and pilots, is a key component of the plan. Blinken urged Colombia to continue using glyphosate, "the most efficient way to fight illegal crops." He said the chemical—sold by US biotechnology company Monsanto under the brand name Roundup—was an agricultural product in widespread use in the United States and Europe. "Glyphosate is used in every state in my country, and believe me, we would have taken measures if there were any problem with it," he told El Tiempo newspaper. 'High collateral cost' Not everyone agrees. Daniel Mejia, the head of Colombia's Center for Research on Security and Drugs (CESED), called for a moratorium on glyphosate. "We carried out a study that showed fumigating caused dermatological and respiratory problems and provoked miscarriages," he told AFP. Mejia said aerial spraying has "little effect" anyway, because it only achieves results on three percent of the surface area treated. "That doesn't justify such a high collateral cost to people's health," he said, urging authorities to focus on clandestine drug laboratories and smuggling routes instead. But proponents say aerial spraying works. Thanks in part to the program, Colombia has succeeded in reducing its coca fields from more than 140,000 hectares (346,000 acres) in 2001 to 48,000 hectares in 2013, according to the United Nations Office on Drugs and Crime. It recently lost its long-standing title as the world's top cocaine producer to neighboring Peru. Less cocaine means less drug money fueling the long-running conflict that has drawn in a string of leftist guerrilla groups, right-wing paramilitaries and drug traffickers. The government has mainly used aerial spraying in the south of the country—a stronghold for the FARC, the largest guerrilla group, which authorities accuse of financing itself with drug trafficking. The FARC, which was founded in 1964 in the aftermath of a peasant uprising, says it is fighting for the rights of rural communities where coca farming is sometimes the only way to make a living. The FARC and the government have been holding peace talks since 2012, and in May last year reached a deal that aims to eliminate illegal drugs by supporting alternative crops and giving farmers incentives to voluntarily destroy their coca plants. But a peace accord has remained elusive, and both sides say the drug plan is contingent on reaching a final deal. In the meantime, President Santos has side-stepped the row over the aerial spraying. His staff said the final authority on the matter is the National Narcotics Council, which falls under the Justice Ministry. Explore further Colombia drug debate revived as herbicide deemed carcinogen © 2015 AFP

812 F.2d 1415 U.S.v.Burke 86-8442 United States Court of Appeals,Eleventh Circuit. 2/6/87 M.D.Ga., 808 F.2d 1522

if TARGET_TQM834X config SYS_BOARD default "tqm834x" config SYS_VENDOR default "tqc" config SYS_CONFIG_NAME default "TQM834x" endif

162 F.3d 98 Cornv.City of Fort Lauderdale*** NO. 97-5336 United States Court of Appeals,Eleventh Circuit. October 20, 1998 1 Appeal From: S.D.Fla. , No.84-06034-CV-JCP 2 Affirmed. * Fed.R.App.P. 34(a); 11th Cir.R. 34-3 ** Local Rule 36 case

Q: How to write a Cypher query with a condition on one of relationship properties in Neo4j database? My question: I am new to Neo4j and trying to create a query listing nodes and relationships into a graph with keyword as "id=0001" as below: (a) - [id:'0001', ref_id:null] -> (b) - [id:'0002', ref_id:'0001'] -> (c) - [id:'0003', ref_id:'0002'] -> (d) Start Node will be (a) since it has relationship with id=0001 But the database also exists relationships which I don't want: (a) - [id:'2001', ref_id:null] -> (b) - [id:'2002', ref_id:'2001'] -> (c) (a) - [id:'3001', ref_id:null] -> (b) - [id:'3002', ref_id:'3001'] -> (c) The result should only includes: (a)-[0001]-(b)-[0002, 0001]-(c)-[0003,0002]-(d) Below are what I was thinking before write question: I know how to create this query in SQL database like Oracle and MySQL, I can use query with "where" condition. For example: Select * from table_a parent, (select * from table_a) child where child.ref_id = parent.id Then I can loop the result set in Java to find all relationships. But this is stupid. I think the query should looks like: Match (n)-[r:RELTYPE]->(m) WHERE {some conditions at here} RETURN n,r,m Please help me, thank you! Yufan A: You could either use named relationships and filter in WHERE clause: match p = (a)-[r1:TYPE]->(b)-[r2:TYPE2]->(c) where r1.id='0001' and r2.id='0002' and r2.ref_id='0001' return p Please note that properties having null value are not allowed in Neo4j. So the first relationship won't have a ref_id. For the above notation is a shortcut by putting the conditions into the match: match p = (a)-[r1:TYPE {id:'0001'}]->(b)-[r2:TYPE2 {id:'0002', ref_id:'0001'}]->(c) return p On a side note: I'm not sure if the way you're using id and ref_id in relationship properties is a good way to model your data. Maybe you can use more verbose relationship types - however without understanding the domain it's not really possible to give a good advice here.

Q: T-SQL get columns of specific type I am trying to get names of columns with a specific type (so I can dynamically query the result). Code below seems to be getting me close (with i.e. type=56 standing for int) but it just seems to be incorrect. Not to mention that I've failed to find a good mapping from types to int representation. SELECT c.system_type_id as type FROM SYS.COLUMNS c JOIN SYS.TABLES t ON c.object_id = t.object_id WHERE t.name = 'MyTableName' Thanks A: You can find the mapping to types in the sys.types catalog view: SELECT c.name as column_name, ty.name as type_name FROM SYS.COLUMNS c JOIN SYS.TABLES t ON c.object_id = t.object_id JOIN SYS.TYPES ty ON c.system_type_id = ty.system_type_id WHERE t.name = 'MyTableName'

--- title: 关于公共服务的思考 date: 2016-12-07 21:12:53 tags: [] author: xizhibei issue_link: https://github.com/xizhibei/blog/issues/32 --- 前几日与一同行交流，一一交流下来，发现什么叫『固步自封』，跟外界交流少了，很多东西便会搞不清楚，甚至脱离主流。 比如最近一直在为团队做基础设施方面的工作，但是，会有一种吃力不讨好的感觉，虽然搭建完毕之后自己会很很有成就感，但是随之而来的维护成本却是很让人头疼。 是的，**『能花钱的，就不要花时间』**。 我也想反驳，但后来仔细回想，没有立即反驳是因为我认同这句话。我当时想反驳的便是：公共服务就像公交车，的确有时候会很方便，可是一旦你想自由些便是很困难，这时候便需要私家车。没错，私家车成本高，还要花时间金钱维护，但是，它就是比公交车方便。 所以，对于一个创业公司来说，你完全可以用公交服务，比如代码托管，文档管理，项目管理，云服务器，监控服务，CI&CD 服务。实际上，现在公共服务越来越多，创业成本实际上越来越低，最后可能到一种程度了之后，只要使用的人搭积木即可了，所有的服务都可以是公共的、现成的。 只是，我觉得高成本的服务才是有做成公共服务的硬需求的，也是价值非常高的，比如云服务主机，安全，APM，大数据等。 好了，话说回来，我列出有些部分为什么不用公共服务： 两个词：** 成本与收益 ** #### 成本： - 金钱：应该算是机器了，无论云服务或者自己买机器 - 时间：搭建与维护 - 人力：需要专门的人去维护 - 安全：数据不会泄露 #### 收益 - 时间：反馈时间，形成一个高效的正负反馈系统 - 可用性：满足需求，甚至比公共服务好用 这里插一句前提，国内的很多公共服务并不怎么好用，而且让人怀疑，虽然他们一再声明不会去查看甚至泄露用户数据。而国外的服务有非常多好用的，但是由于网络问题，得投入 VPN 成本，另外，他们很多是使用美元结算的，换算成 RMB 之后，很贵，不过他们的成本本来就很高。(T_T 国外好幸福。。。 比如当初选择 gitlab，一个是因为 github 有时候太慢，线上部署代码的时候太慢，换成 coding 之后，又觉得不如 github 好用。于是自己用 gitlab，然后那时候，gitlab 已经比较新，自带了 pipeline，可以直接作为 CI&CD。 然后是日志系统，目前国内好用的服务比较少，国外有个 loggy 不错，只是按照我们的需求来的话，至少得要 $5000 + 了，还不如自己搭建了，另外，由于需要上传数据到国外服务器，VPN 的成本不会太低，更别说有延时了。(其实还有点小私心，想要借此机会熟悉 ELK 好了，每个人都会有自己的选择，但是从个人角度来说：** 生命不息，折腾不止 **。 ### PS 目前就我接触下来，用过的产品中，ping++ 挺棒，起码会让人觉得好用，文档非常棒，虽然现在的公司因为担心数据没用。再吐槽下个推，文档真让人头大。。。 ### PPS 国内的服务目前还处于发展阶段，我觉得做出好产品是需要高成本的，并且跟创业公司是互相成就的，有条件的情况下还是多支持国内的同胞吧。。。 ### Reference 1. https://github.com/qinghuaiorg/free-for-dev-zh 2. https://github.com/ripienaar/free-for-dev *** 首发于 Github issues: https://github.com/xizhibei/blog/issues/32 ，欢迎 Star 以及 Watch {% post_link footer %} ***

Get the Recipe Pickled Grapes with Citrus and Spice Pickled grapes have been in the back of my mind for a long time now. I love salty, briny pickles and I love sweet, juicy grapes. Plus, I'm always on the lookout for something easy, unusual, and delicious to serve as hors d'oeuvre or alongside a cheese plate. Plus, pickled grapes are relatively healthy. You'll feel much more virtuous popping them in your mouth than say, a handful of roasted nuts or high-calorie olives. The first recipe for pickled grapes I looked at was in Toni Lydecker's cookbook, Serves One. It involves a simple brine of white wine vinegar, sugar, cinnamon, and minced onion, simmered together and then poured over red grapes. It looked easy enough, but I wanted something with a bit more spice. Next, I consulted Molly Wizenberg's book, A Homemade Life, and the blog Smitten Kitchen, which features an adapted version on Molly's recipe. It includes mustard seeds and black peppercorns along with the cinnamon, but again, it seemed a little ho-hum. Plus, the procedure called for trimming the stem end of every single grape with a pairing knife. Who has time for that? I rooted around in my pantry and kitchen for inspiration and came up with a jar of fennel seeds, a lemon, and an orange. The fennel seeds offer a hint of licorice (almost like throwing a star anise in each jar), and a few strips of lemon and orange peel gave the grapes a citrusy zing. After simmering all the ingredients for my brine together in a pot, I let the whole thing chill out for an hour before pouring it over the grapes. That way they pickled instead of cooked, and retained their crunchy-firm texture. After a night in the fridge my grapes were ready to eat. I unscrewed the lid from one jar and speared a nice fat one. The flavor was an amazing combination of sweet and sour, unlike any other pickled-thing I've tasted before. The sugar and white wine vinegar created a syrup that lightly coated the grapes and infused them with a mellow tanginess. I could definitely taste the cinnamon and citrus, but the fennel, black pepper, and mustard kept the grapes from being too fruity. These are not the sort of salty, dilly pickles you serve with sandwiches. Rather, I fantasized about serving them with funky microbrews at a craft beer tasting. The complex flavors and the play between sweet and savory would lead to some awesome pairings. This recipe yields two pint-sized jars of pickled grapes. They will keep for one month in the fridge. One jar and a six-pack of different beers would make a great gift. Get the Recipe Pickled Grapes with Citrus and Spice View Recipe » All products linked here have been independently selected by our editors. We may earn a commission on purchases, as described in our affiliate policy.

/* Copyright (C) 1995-1998 Eric Young (eay@cryptsoft.com) * All rights reserved. * * This package is an SSL implementation written * by Eric Young (eay@cryptsoft.com). * The implementation was written so as to conform with Netscapes SSL. * * This library is free for commercial and non-commercial use as long as * the following conditions are aheared to. The following conditions * apply to all code found in this distribution, be it the RC4, RSA, * lhash, DES, etc., code; not just the SSL code. The SSL documentation * included with this distribution is covered by the same copyright terms * except that the holder is Tim Hudson (tjh@cryptsoft.com). * * Copyright remains Eric Young's, and as such any Copyright notices in * the code are not to be removed. * If this package is used in a product, Eric Young should be given attribution * as the author of the parts of the library used. * This can be in the form of a textual message at program startup or * in documentation (online or textual) provided with the package. * * Redistribution and use in source and binary forms, with or without * modification, are permitted provided that the following conditions * are met: * 1. Redistributions of source code must retain the copyright * notice, this list of conditions and the following disclaimer. * 2. Redistributions in binary form must reproduce the above copyright * notice, this list of conditions and the following disclaimer in the * documentation and/or other materials provided with the distribution. * 3. All advertising materials mentioning features or use of this software * must display the following acknowledgement: * "This product includes cryptographic software written by * Eric Young (eay@cryptsoft.com)" * The word 'cryptographic' can be left out if the rouines from the library * being used are not cryptographic related :-). * 4. If you include any Windows specific code (or a derivative thereof) from * the apps directory (application code) you must include an acknowledgement: * "This product includes software written by Tim Hudson (tjh@cryptsoft.com)" * * THIS SOFTWARE IS PROVIDED BY ERIC YOUNG ``AS IS'' AND * ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE * IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE * ARE DISCLAIMED. IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE * FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL * DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS * OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION) * HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT * LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY * OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF * SUCH DAMAGE. * * The licence and distribution terms for any publically available version or * derivative of this code cannot be changed. i.e. this code cannot simply be * copied and put under another distribution licence * [including the GNU Public Licence.] */ #include <openssl/cipher.h> #include <assert.h> #include <string.h> #include <openssl/err.h> #include <openssl/mem.h> #include <openssl/nid.h> #include "internal.h" #include "../internal.h" const EVP_CIPHER *EVP_get_cipherbynid(int nid) { switch (nid) { case NID_rc2_cbc: return EVP_rc2_cbc(); case NID_rc2_40_cbc: return EVP_rc2_40_cbc(); case NID_des_ede3_cbc: return EVP_des_ede3_cbc(); case NID_des_ede_cbc: return EVP_des_cbc(); case NID_aes_128_cbc: return EVP_aes_128_cbc(); case NID_aes_192_cbc: return EVP_aes_192_cbc(); case NID_aes_256_cbc: return EVP_aes_256_cbc(); default: return NULL; } } void EVP_CIPHER_CTX_init(EVP_CIPHER_CTX *ctx) { OPENSSL_memset(ctx, 0, sizeof(EVP_CIPHER_CTX)); } EVP_CIPHER_CTX *EVP_CIPHER_CTX_new(void) { EVP_CIPHER_CTX *ctx = OPENSSL_malloc(sizeof(EVP_CIPHER_CTX)); if (ctx) { EVP_CIPHER_CTX_init(ctx); } return ctx; } int EVP_CIPHER_CTX_cleanup(EVP_CIPHER_CTX *c) { if (c->cipher != NULL) { if (c->cipher->cleanup) { c->cipher->cleanup(c); } OPENSSL_cleanse(c->cipher_data, c->cipher->ctx_size); } OPENSSL_free(c->cipher_data); OPENSSL_memset(c, 0, sizeof(EVP_CIPHER_CTX)); return 1; } void EVP_CIPHER_CTX_free(EVP_CIPHER_CTX *ctx) { if (ctx) { EVP_CIPHER_CTX_cleanup(ctx); OPENSSL_free(ctx); } } int EVP_CIPHER_CTX_copy(EVP_CIPHER_CTX *out, const EVP_CIPHER_CTX *in) { if (in == NULL || in->cipher == NULL) { OPENSSL_PUT_ERROR(CIPHER, CIPHER_R_INPUT_NOT_INITIALIZED); return 0; } EVP_CIPHER_CTX_cleanup(out); OPENSSL_memcpy(out, in, sizeof(EVP_CIPHER_CTX)); if (in->cipher_data && in->cipher->ctx_size) { out->cipher_data = OPENSSL_malloc(in->cipher->ctx_size); if (!out->cipher_data) { out->cipher = NULL; OPENSSL_PUT_ERROR(CIPHER, ERR_R_MALLOC_FAILURE); return 0; } OPENSSL_memcpy(out->cipher_data, in->cipher_data, in->cipher->ctx_size); } if (in->cipher->flags & EVP_CIPH_CUSTOM_COPY) { if (!in->cipher->ctrl((EVP_CIPHER_CTX *)in, EVP_CTRL_COPY, 0, out)) { out->cipher = NULL; return 0; } } return 1; } int EVP_CipherInit_ex(EVP_CIPHER_CTX *ctx, const EVP_CIPHER *cipher, ENGINE *engine, const uint8_t *key, const uint8_t *iv, int enc) { if (enc == -1) { enc = ctx->encrypt; } else { if (enc) { enc = 1; } ctx->encrypt = enc; } if (cipher) { /* Ensure a context left from last time is cleared (the previous check * attempted to avoid this if the same ENGINE and EVP_CIPHER could be * used). */ if (ctx->cipher) { EVP_CIPHER_CTX_cleanup(ctx); /* Restore encrypt and flags */ ctx->encrypt = enc; } ctx->cipher = cipher; if (ctx->cipher->ctx_size) { ctx->cipher_data = OPENSSL_malloc(ctx->cipher->ctx_size); if (!ctx->cipher_data) { ctx->cipher = NULL; OPENSSL_PUT_ERROR(CIPHER, ERR_R_MALLOC_FAILURE); return 0; } } else { ctx->cipher_data = NULL; } ctx->key_len = cipher->key_len; ctx->flags = 0; if (ctx->cipher->flags & EVP_CIPH_CTRL_INIT) { if (!EVP_CIPHER_CTX_ctrl(ctx, EVP_CTRL_INIT, 0, NULL)) { ctx->cipher = NULL; OPENSSL_PUT_ERROR(CIPHER, CIPHER_R_INITIALIZATION_ERROR); return 0; } } } else if (!ctx->cipher) { OPENSSL_PUT_ERROR(CIPHER, CIPHER_R_NO_CIPHER_SET); return 0; } /* we assume block size is a power of 2 in *cryptUpdate */ assert(ctx->cipher->block_size == 1 || ctx->cipher->block_size == 8 || ctx->cipher->block_size == 16); if (!(EVP_CIPHER_CTX_flags(ctx) & EVP_CIPH_CUSTOM_IV)) { switch (EVP_CIPHER_CTX_mode(ctx)) { case EVP_CIPH_STREAM_CIPHER: case EVP_CIPH_ECB_MODE: break; case EVP_CIPH_CFB_MODE: ctx->num = 0; /* fall-through */ case EVP_CIPH_CBC_MODE: assert(EVP_CIPHER_CTX_iv_length(ctx) <= sizeof(ctx->iv)); if (iv) { OPENSSL_memcpy(ctx->oiv, iv, EVP_CIPHER_CTX_iv_length(ctx)); } OPENSSL_memcpy(ctx->iv, ctx->oiv, EVP_CIPHER_CTX_iv_length(ctx)); break; case EVP_CIPH_CTR_MODE: case EVP_CIPH_OFB_MODE: ctx->num = 0; /* Don't reuse IV for CTR mode */ if (iv) { OPENSSL_memcpy(ctx->iv, iv, EVP_CIPHER_CTX_iv_length(ctx)); } break; default: return 0; } } if (key || (ctx->cipher->flags & EVP_CIPH_ALWAYS_CALL_INIT)) { if (!ctx->cipher->init(ctx, key, iv, enc)) { return 0; } } ctx->buf_len = 0; ctx->final_used = 0; ctx->block_mask = ctx->cipher->block_size - 1; return 1; } int EVP_EncryptInit_ex(EVP_CIPHER_CTX *ctx, const EVP_CIPHER *cipher, ENGINE *impl, const uint8_t *key, const uint8_t *iv) { return EVP_CipherInit_ex(ctx, cipher, impl, key, iv, 1); } int EVP_DecryptInit_ex(EVP_CIPHER_CTX *ctx, const EVP_CIPHER *cipher, ENGINE *impl, const uint8_t *key, const uint8_t *iv) { return EVP_CipherInit_ex(ctx, cipher, impl, key, iv, 0); } int EVP_EncryptUpdate(EVP_CIPHER_CTX *ctx, uint8_t *out, int *out_len, const uint8_t *in, int in_len) { int i, j, bl; if (ctx->cipher->flags & EVP_CIPH_FLAG_CUSTOM_CIPHER) { i = ctx->cipher->cipher(ctx, out, in, in_len); if (i < 0) { return 0; } else { *out_len = i; } return 1; } if (in_len <= 0) { *out_len = 0; return in_len == 0; } if (ctx->buf_len == 0 && (in_len & ctx->block_mask) == 0) { if (ctx->cipher->cipher(ctx, out, in, in_len)) { *out_len = in_len; return 1; } else { *out_len = 0; return 0; } } i = ctx->buf_len; bl = ctx->cipher->block_size; assert(bl <= (int)sizeof(ctx->buf)); if (i != 0) { if (bl - i > in_len) { OPENSSL_memcpy(&ctx->buf[i], in, in_len); ctx->buf_len += in_len; *out_len = 0; return 1; } else { j = bl - i; OPENSSL_memcpy(&ctx->buf[i], in, j); if (!ctx->cipher->cipher(ctx, out, ctx->buf, bl)) { return 0; } in_len -= j; in += j; out += bl; *out_len = bl; } } else { *out_len = 0; } i = in_len & ctx->block_mask; in_len -= i; if (in_len > 0) { if (!ctx->cipher->cipher(ctx, out, in, in_len)) { return 0; } *out_len += in_len; } if (i != 0) { OPENSSL_memcpy(ctx->buf, &in[in_len], i); } ctx->buf_len = i; return 1; } int EVP_EncryptFinal_ex(EVP_CIPHER_CTX *ctx, uint8_t *out, int *out_len) { int n, ret; unsigned int i, b, bl; if (ctx->cipher->flags & EVP_CIPH_FLAG_CUSTOM_CIPHER) { ret = ctx->cipher->cipher(ctx, out, NULL, 0); if (ret < 0) { return 0; } else { *out_len = ret; } return 1; } b = ctx->cipher->block_size; assert(b <= sizeof(ctx->buf)); if (b == 1) { *out_len = 0; return 1; } bl = ctx->buf_len; if (ctx->flags & EVP_CIPH_NO_PADDING) { if (bl) { OPENSSL_PUT_ERROR(CIPHER, CIPHER_R_DATA_NOT_MULTIPLE_OF_BLOCK_LENGTH); return 0; } *out_len = 0; return 1; } n = b - bl; for (i = bl; i < b; i++) { ctx->buf[i] = n; } ret = ctx->cipher->cipher(ctx, out, ctx->buf, b); if (ret) { *out_len = b; } return ret; } int EVP_DecryptUpdate(EVP_CIPHER_CTX *ctx, uint8_t *out, int *out_len, const uint8_t *in, int in_len) { int fix_len; unsigned int b; if (ctx->cipher->flags & EVP_CIPH_FLAG_CUSTOM_CIPHER) { int r = ctx->cipher->cipher(ctx, out, in, in_len); if (r < 0) { *out_len = 0; return 0; } else { *out_len = r; } return 1; } if (in_len <= 0) { *out_len = 0; return in_len == 0; } if (ctx->flags & EVP_CIPH_NO_PADDING) { return EVP_EncryptUpdate(ctx, out, out_len, in, in_len); } b = ctx->cipher->block_size; assert(b <= sizeof(ctx->final)); if (ctx->final_used) { OPENSSL_memcpy(out, ctx->final, b); out += b; fix_len = 1; } else { fix_len = 0; } if (!EVP_EncryptUpdate(ctx, out, out_len, in, in_len)) { return 0; } /* if we have 'decrypted' a multiple of block size, make sure * we have a copy of this last block */ if (b > 1 && !ctx->buf_len) { *out_len -= b; ctx->final_used = 1; OPENSSL_memcpy(ctx->final, &out[*out_len], b); } else { ctx->final_used = 0; } if (fix_len) { *out_len += b; } return 1; } int EVP_DecryptFinal_ex(EVP_CIPHER_CTX *ctx, unsigned char *out, int *out_len) { int i, n; unsigned int b; *out_len = 0; if (ctx->cipher->flags & EVP_CIPH_FLAG_CUSTOM_CIPHER) { i = ctx->cipher->cipher(ctx, out, NULL, 0); if (i < 0) { return 0; } else { *out_len = i; } return 1; } b = ctx->cipher->block_size; if (ctx->flags & EVP_CIPH_NO_PADDING) { if (ctx->buf_len) { OPENSSL_PUT_ERROR(CIPHER, CIPHER_R_DATA_NOT_MULTIPLE_OF_BLOCK_LENGTH); return 0; } *out_len = 0; return 1; } if (b > 1) { if (ctx->buf_len || !ctx->final_used) { OPENSSL_PUT_ERROR(CIPHER, CIPHER_R_WRONG_FINAL_BLOCK_LENGTH); return 0; } assert(b <= sizeof(ctx->final)); /* The following assumes that the ciphertext has been authenticated. * Otherwise it provides a padding oracle. */ n = ctx->final[b - 1]; if (n == 0 || n > (int)b) { OPENSSL_PUT_ERROR(CIPHER, CIPHER_R_BAD_DECRYPT); return 0; } for (i = 0; i < n; i++) { if (ctx->final[--b] != n) { OPENSSL_PUT_ERROR(CIPHER, CIPHER_R_BAD_DECRYPT); return 0; } } n = ctx->cipher->block_size - n; for (i = 0; i < n; i++) { out[i] = ctx->final[i]; } *out_len = n; } else { *out_len = 0; } return 1; } int EVP_Cipher(EVP_CIPHER_CTX *ctx, uint8_t *out, const uint8_t *in, size_t in_len) { return ctx->cipher->cipher(ctx, out, in, in_len); } int EVP_CipherUpdate(EVP_CIPHER_CTX *ctx, uint8_t *out, int *out_len, const uint8_t *in, int in_len) { if (ctx->encrypt) { return EVP_EncryptUpdate(ctx, out, out_len, in, in_len); } else { return EVP_DecryptUpdate(ctx, out, out_len, in, in_len); } } int EVP_CipherFinal_ex(EVP_CIPHER_CTX *ctx, uint8_t *out, int *out_len) { if (ctx->encrypt) { return EVP_EncryptFinal_ex(ctx, out, out_len); } else { return EVP_DecryptFinal_ex(ctx, out, out_len); } } const EVP_CIPHER *EVP_CIPHER_CTX_cipher(const EVP_CIPHER_CTX *ctx) { return ctx->cipher; } int EVP_CIPHER_CTX_nid(const EVP_CIPHER_CTX *ctx) { return ctx->cipher->nid; } unsigned EVP_CIPHER_CTX_block_size(const EVP_CIPHER_CTX *ctx) { return ctx->cipher->block_size; } unsigned EVP_CIPHER_CTX_key_length(const EVP_CIPHER_CTX *ctx) { return ctx->key_len; } unsigned EVP_CIPHER_CTX_iv_length(const EVP_CIPHER_CTX *ctx) { return ctx->cipher->iv_len; } void *EVP_CIPHER_CTX_get_app_data(const EVP_CIPHER_CTX *ctx) { return ctx->app_data; } void EVP_CIPHER_CTX_set_app_data(EVP_CIPHER_CTX *ctx, void *data) { ctx->app_data = data; } uint32_t EVP_CIPHER_CTX_flags(const EVP_CIPHER_CTX *ctx) { return ctx->cipher->flags & ~EVP_CIPH_MODE_MASK; } uint32_t EVP_CIPHER_CTX_mode(const EVP_CIPHER_CTX *ctx) { return ctx->cipher->flags & EVP_CIPH_MODE_MASK; } int EVP_CIPHER_CTX_ctrl(EVP_CIPHER_CTX *ctx, int command, int arg, void *ptr) { int ret; if (!ctx->cipher) { OPENSSL_PUT_ERROR(CIPHER, CIPHER_R_NO_CIPHER_SET); return 0; } if (!ctx->cipher->ctrl) { OPENSSL_PUT_ERROR(CIPHER, CIPHER_R_CTRL_NOT_IMPLEMENTED); return 0; } ret = ctx->cipher->ctrl(ctx, command, arg, ptr); if (ret == -1) { OPENSSL_PUT_ERROR(CIPHER, CIPHER_R_CTRL_OPERATION_NOT_IMPLEMENTED); return 0; } return ret; } int EVP_CIPHER_CTX_set_padding(EVP_CIPHER_CTX *ctx, int pad) { if (pad) { ctx->flags &= ~EVP_CIPH_NO_PADDING; } else { ctx->flags |= EVP_CIPH_NO_PADDING; } return 1; } int EVP_CIPHER_CTX_set_key_length(EVP_CIPHER_CTX *c, unsigned key_len) { if (c->key_len == key_len) { return 1; } if (key_len == 0 || !(c->cipher->flags & EVP_CIPH_VARIABLE_LENGTH)) { OPENSSL_PUT_ERROR(CIPHER, CIPHER_R_INVALID_KEY_LENGTH); return 0; } c->key_len = key_len; return 1; } int EVP_CIPHER_nid(const EVP_CIPHER *cipher) { return cipher->nid; } unsigned EVP_CIPHER_block_size(const EVP_CIPHER *cipher) { return cipher->block_size; } unsigned EVP_CIPHER_key_length(const EVP_CIPHER *cipher) { return cipher->key_len; } unsigned EVP_CIPHER_iv_length(const EVP_CIPHER *cipher) { return cipher->iv_len; } uint32_t EVP_CIPHER_flags(const EVP_CIPHER *cipher) { return cipher->flags & ~EVP_CIPH_MODE_MASK; } uint32_t EVP_CIPHER_mode(const EVP_CIPHER *cipher) { return cipher->flags & EVP_CIPH_MODE_MASK; } int EVP_CipherInit(EVP_CIPHER_CTX *ctx, const EVP_CIPHER *cipher, const uint8_t *key, const uint8_t *iv, int enc) { if (cipher) { EVP_CIPHER_CTX_init(ctx); } return EVP_CipherInit_ex(ctx, cipher, NULL, key, iv, enc); } int EVP_EncryptInit(EVP_CIPHER_CTX *ctx, const EVP_CIPHER *cipher, const uint8_t *key, const uint8_t *iv) { return EVP_CipherInit(ctx, cipher, key, iv, 1); } int EVP_DecryptInit(EVP_CIPHER_CTX *ctx, const EVP_CIPHER *cipher, const uint8_t *key, const uint8_t *iv) { return EVP_CipherInit(ctx, cipher, key, iv, 0); } int EVP_add_cipher_alias(const char *a, const char *b) { return 1; } const EVP_CIPHER *EVP_get_cipherbyname(const char *name) { if (OPENSSL_strcasecmp(name, "rc4") == 0) { return EVP_rc4(); } else if (OPENSSL_strcasecmp(name, "des-cbc") == 0) { return EVP_des_cbc(); } else if (OPENSSL_strcasecmp(name, "des-ede3-cbc") == 0 || OPENSSL_strcasecmp(name, "3des") == 0) { return EVP_des_ede3_cbc(); } else if (OPENSSL_strcasecmp(name, "aes-128-cbc") == 0) { return EVP_aes_128_cbc(); } else if (OPENSSL_strcasecmp(name, "aes-256-cbc") == 0) { return EVP_aes_256_cbc(); } else if (OPENSSL_strcasecmp(name, "aes-128-ctr") == 0) { return EVP_aes_128_ctr(); } else if (OPENSSL_strcasecmp(name, "aes-256-ctr") == 0) { return EVP_aes_256_ctr(); } else if (OPENSSL_strcasecmp(name, "aes-128-ecb") == 0) { return EVP_aes_128_ecb(); } else if (OPENSSL_strcasecmp(name, "aes-256-ecb") == 0) { return EVP_aes_256_ecb(); } return NULL; }

Q: Calculate the recurring dates between a range of dates in javascript How the recurrence actually works is not a question. I want to implement a way to calculate the days between two dates with a specified recurrence interval. That could be weekly, monthly, bi-monthly(which I don't exactly know about) yearly etc. The simplest thing I have done until now is the following which let me count all the days between two dates and then loop through them with an interval of seven days for weekly recurrence. I would be grateful if you can suggest me the better and correct implementation of it. Thanks. //Push in the selected dates in the selected array. for (var i = 1; i < between.length; i += 7) { selected.push(between[i]); console.log(between[i]); } A: Does this do something like what you're expecting? It would require an explicit argument for the number of days in the interval: // startDate: Date() // endDate: Date() // interval: Number() number of days between recurring dates function recurringDates(startDate, endDate, interval) { // initialize date variable with start date var date = startDate; // create array to hold result dates var dates = []; // check for dates in range while ((date = addDays(date, interval)) < endDate) { // add new date to array dates.push(date); } // return result dates return dates; } function addDays(date, days) { var newDate = new Date(date); newDate.setDate(date.getDate() + days); return newDate; } var startDate = new Date(2015, 0, 1); var endDate = new Date(2016, 0, 1); var interval = 20; console.log(recurringDates(startDate, endDate, interval)); Here's the example on JSFiddle. A: This function gives a date for every [interval] and [intervalType] (e.g. every 1 month) between two dates. It can also correct dates in weekends, if necessary. Is that what you had in mind? Here a jsFiddle demo. function recurringDates(startDate, endDate, interval, intervalType, noweekends) { intervalType = intervalType || 'Date'; var date = startDate; var recurrent = []; var setget = {set: 'set'+intervalType, get: 'get'+intervalType}; while (date < endDate) { recurrent.push( noweekends ? noWeekend() : new Date(date) ); date[setget.set](date[setget.get]()+interval); } // add 1 day for sunday, subtract one for saturday function noWeekend() { var add, currdate = new Date(date), day = date.getDay(); if (~[6,0].indexOf(day)) { currdate.setDate(currdate.getDate() + (add = day == 6 ? -1 : 1)); } return new Date(currdate); } return recurrent; }

Secularism in Egypt Secularism in Egypt has had a very important role to play in both the history of Egypt and that of the Middle East. Egypt’s first experience of Secularism started with the British Occupation (1882–1952), the atmosphere which allowed the protection of debate. In this environment pro-secularist intellectuals like Ya'qub Sarruf, Faris Nimr, Nicola Haddad whom sought political asylum from Ottoman Rule were able to publish their work. This debate had then became a burning issue with the work of Egyptian Shaykh Ali Abdel Raziq (1888–1966), “The most momentous document in the crucial intellectual and religious debate of modern Islamic history” By 1919 Egypt had its first political secular entity called the Hizb 'Almani (Secular Party) - this name was later changed to the Wafd Party. It combined secular policies with a nationalist agenda and had the majority support in the following years against both the rule of the king and the British influence. The Wafd party supported the allies during World War II and then proceeded to win the 1952 parliamentary elections. Following these elections, the prime minister was overthrown by the King leading to riots. These riots precipitated a military coup after which all political parties were banned including the Wafd Party and the Muslim Brotherhood. The government of Gamal Abdel Nasser was secularist-nationalist in nature which at the time gathers a great deal of support both in Egypt and other Arab states. Key elements of Nasserism: Secularist/Nationalist dictatorship; No religious or other political movements allowed to impact government Modernization Industrialization Concentration on Arab values rather than Muslim values Following the death of Nasser, President Anwar Sadat (1970–1981) continued economic liberalization and maintained the government's secularist policy, even going as far as signing peace agreements with Israel which was a first for any Middle Eastern country. However, following further intensive clampdowns on political opposition, Sadat was assassinated and replaced by Hosni Mubarak who again faces the issue of keeping the Islamist support at bay whilst keeping his power base during increased pressure to be democratic. Nowadays, most proponents of secularism emphasize the link between secularism and ‘national unity’ between Coptic Christians and Muslims. Following the Egyptian revolution of 2011 as part of the regional Arab Spring protests, Mubarak was ousted and the following year Mohamed Morsi who is backed by the Muslim Brotherhood won Egypt's first democractic elections. In 2013 Morsi was removed from power in a coup led by Abdel Fattah el-Sisi. Sisi has called for religious tolerance and has cracked down and banned the Muslim Brotherhood. He has closed thousands of mosques and has banned 'burkinis' on some beaches. A The Economist report in 2017 stated that Egyptians were turning more secular again, with supporters of sharia law dropping by more than half since 2011, people praying less than before, and gender equality now being widely accepted. The government has also acted to preserve its Jewish heritage through the restoration of the abandoned Eliyahu Hanavi Synagogue in Alexandria in 2017. See also Religion in Egypt Constitution of Egypt Islam in Egypt Christianity in Egypt Politics of Egypt Culture of Egypt References Category:Politics of Egypt Egypt Egypt Egypt

updated 10:25 pm EDT, Thu April 3, 2008 AT&T using LTE 4G AT&T today held a conference call regarding its acquisitions in the 700MHz spectrum, and confirmed that it will use the Long Term Evolution system for its upcoming 4G telecommunications infrastructure. Representatives during the call told MacNN its B-block acquisitions of the 700MHz spectrum would allow it to cover 87 percent of the US populace with its 4G architecture, and would give it finer control over its network and applications. Since it is a closed system, it allows AT&T to enable or restrict certain devices. Additionally, AT&T's existing HSPA network speed is said to be doubled in 2009 with the addition of a 7.2 Megabit communication standard. The introduction of AT&T's 4G network is pending release in 2009 as the band is still occupied by analogue television signals. The FCC declared that all television providers must switch to digital by the aforementioned time. Verizon also announced plans to use its share of the 700MHz spectrum for its own 4G LTE network, which would mean that AT&T hardware would be interoperable with the network, and likewise with Verizon hardware on AT&T. come February 2009 "The introduction of AT&T's 4G network is pending release in 2009 as the band is still occupied by analogue television signals. The FCC declared that all television providers must switch to digital by the aforementioned time." If one does not upgrade to digital and turns on their analog tv, they may not be receiving television signals to view their favorite sitcom, but will they pick-up phone calls? - lol - (it's a hypothetical question, I know the answer is "no")

Related Content The Science Behind Our Search for Waldo In London, Benjamin Franklin once opened a bottle of fortified wine from Virginia and poured out, along with the refreshment, three drowned flies, two of which revived after a few hours and flew away. Ever the visionary, he wondered about the possibility of incarcerating himself in a wine barrel for future resurrection, “to see and observe the state of America a hundred years hence.” Alas, he wrote to a friend in 1773, “we live in an age too early . . . to see such an art brought in our time to its perfection.” If Franklin were alive today he would find a kindred spirit in Ken Hayworth, a neuroscientist who also wants to be around in 100 years but recognizes that, at 43, he’s not likely to make it on his own. Nor does he expect to get there preserved in alcohol or a freezer; despite the claims made by advocates of cryonics, he says, the ability to revivify a frozen body “isn’t really on the horizon.” So Hayworth is hoping for what he considers the next best thing. He wishes to upload his mind—his memories, skills and personality—to a computer that can be programmed to emulate the processes of his brain, making him, or a simulacrum, effectively immortal (as long as someone keeps the power on). Hayworth’s dream, which he is pursuing as president of the Brain Preservation Foundation, is one version of the “technological singularity.” It envisions a future of “substrate-independent minds,” in which human and machine consciousness will merge, transcending biological limits of time, space and memory. “This new substrate won’t be dependent on an oxygen atmosphere,” says Randal Koene, who works on the same problem at his organization, Carboncopies.org. “It can go on a journey of 1,000 years, it can process more information at a higher speed, it can see in the X-ray spectrum if we build it that way.” Whether Hayworth or Koene will live to see this is an open question. Their most optimistic scenarios call for at least 50 years, and uncounted billions of dollars, to implement their goal. Meanwhile, Hayworth hopes to achieve the ability to preserve an entire human brain at death—through chemicals, cryonics or both—to keep the structure intact with enough detail that it can, at some future time, be scanned into a database and emulated on a computer. That approach presumes, of course, that all of the subtleties of a human mind and memory are contained in its anatomical structure—conventional wisdom among neuroscientists, but it’s still a hypothesis. There are electrochemical processes at work. Are they captured by a static map of cells and synapses? We won’t know, advocates argue, until we try to do it. The initiatives require a big bet on the future of technology. A 3-D map of all the cells and synapses in a nervous system is called a “connectome,” and so far researchers have produced exactly one, for a roundworm called Caenorhabditis elegans, with 302 neurons and about 7,000 connections among them. A human brain, according to one reasonable estimate, has about 86 billion neurons and 100 trillion synapses. And then there’s the electrochemical activity on top of that. In 2013, announcing a federal initiative to produce a complete model of the human brain, Francis Collins, head of the National Institutes of Health, said it could generate “yottabytes” of data—a million million million megabytes. To scan an entire human brain at the scale Hayworth thinks is necessary—effectively slicing it into virtual cubes ten nanometers on a side—would require, with today’s technology, “a million electron microscopes running in parallel for ten years.” Mainstream researchers are divided between those who regard Hayworth’s quest as impossible in practice, and those, like Miguel Nicolelis of Duke University, who consider it impossible in theory. “The brain,” he says, “is not computable.” And what does it mean for a mind to exist outside a brain? One immediately thinks of the disembodied HAL in 2001: A Space Odyssey. But Koene sees no reason that, if computers continue to grow smaller and more powerful, an uploaded mind couldn’t have a body—a virtual one, or a robotic one. Will it sleep? Experience hunger, pain, desire? In the absence of hormones and chemical neurotransmitters, will it feel emotion? It will be you, in a sense, but will you be it? These questions don’t trouble Hayworth. To him, the brain is the most sophisticated computer on earth, but only that, and he figures his mind could also live in one made of transistors instead. He hopes to become the first human being to live entirely in cyberspace, to send his virtual self into the far future—a journey as fantastic as that of those two flies that fell into a wine bottle in America and came back to life in England.

Q: Passing Jquery value to WordPress function I have a pop up that I would like to display the author information for that particular post. I am using WordPress Popup Maker and have created a function that I turned into a shortcode so I could use in Popup Maker. What I want to do is push the ID of a link onclick to a the function that displays the user data. Here is my Jquery in a hook in functions.php: add_action( 'wp_footer', 'my_custom_popup_scripts', 500 ); function my_custom_popup_scripts() { ?> <script type="text/javascript"> (function ($, document, undefined) { $('.author-popup').click(function() { var id = $(this).attr('id'); }); // Your custom code goes here. }(jQuery, document)) </script><?php } And here is my start of function where I want to control what user data is displayed: function my_author_box() { ?> <?php $args = array( 'author' => "31", //this what I want to change with Jquery ); query_posts($args); ?> And here is my link to trigger: <a href="#" class="author-popup" id="33">some user</a> I'm not really good with jquery or AJAX which I have read might be a solution. If anyone has any ideas I would really appreciate. Thanks in advance A: You have to use AJAX for that. What you have to do is: Create a JS script which sends an AJAX request to admin-ajax.php file: <script> jQuery(".author-popup").on("click", function(){ var id = jQuery(this).attr("id"); jQuery.post("http://www.yourdomain.com/admin-ajax.php", {action: "my_author_box", id: id}, function(response){ console.log("Response: " + response); //NOTE that 'action' MUST be the same as PHP function name you want to fire //you can do whatever you want here with your response }); }) </script> Create new file e.x. myajax.php and include it to functions.php Now write a function you want to fire on click, e.x.: function my_author_box(){ $args = array( 'author' => $_REQUEST['id']; ); query_posts($args); die(); } add_action( 'wp_ajax_my_author_box', 'my_author_box' ); add_action( 'wp_ajax_nopriv_my_author_box', 'my_author_box' ); That's all. As I said note that actionhas to be the same as PHP function. If you want to have some response from your PHP function just echo it and this is what you will get as a response. If you'll get 0 as a response it means that function you want to fire does not exists or you didn't call die() at the end of your function. Should work

578 F.2d 1384 U. S.v.Russell No. 78-1133 United States Court of Appeals, Eighth Circuit 6/30/78 1 D.N.D. 2 AFFIRMED** ** See Local Rule 9

Elisabeth Salom Elisabeth Salom (born 20 January 1989) is a Spanish group rhythmic gymnast. She represents her nation at international competitions. She participated at the 2008 Summer Olympics in Beijing. She also competed at world championships, including at the 2007 World Rhythmic Gymnastics Championships. References External links sportcentric.com Seleccion Española de gimnasia ritmica Conjunto Pekin 2008 Category:1989 births Category:Living people Category:Spanish rhythmic gymnasts Category:Place of birth missing (living people) Category:Gymnasts at the 2008 Summer Olympics Category:Olympic gymnasts of Spain

A week ago we published a guest post from David Galland of Casey's Daily Dispatch in which Galland presented his view on what the consequences of the upcoming introduction of a 1099-filing requirement for gold transactions over $600 would be. "Can’t a person just keep their gold purchases under $600? With the price of gold heading higher, that will increasingly require buying smaller-denomination bullion coins – which typically carry a higher premium. More importantly, a large body of case law gives the government license to charge people for “structuring” – i.e., taking active measures to get around a particular law. Thus, two $500 gold purchases could be construed as active evasion and carry additional penalties." The topic is suddenly red hot once again, this time with ABC finally getting on the bandwagon. Starting Jan. 1, 2012, Form 1099s will become a means of reporting to the Internal Revenue Service the purchases of all goods and services by small businesses and self-employed people that exceed $600 during a calendar year. Precious metals such as coins and bullion fall into this category and coin dealers have been among those most rankled by the change. This provision, intended to mine what the IRS deems a vast reservoir of uncollected income tax, was included in the health care legislation ostensibly as a way to pay for it. The tax code tweak is expected to raise $17 billion over the next 10 years, according to the Joint Committee on Taxation. Pat Heller, who owns Liberty Coin Service in Lansing, Mich., deals with around 1,000 customers every week. Many are individuals looking to protect wealth in an uncertain economy, he said, while others are dealers like him. With spot market prices for gold at nearly $1,200 an ounce, Heller estimates that he'll be filling out between 10,000 and 20,000 tax forms per year after the new law takes effect. "I'll have to hire two full-time people just to track all this stuff, which cuts into my profitability," he said. An issue that combines gold coins, the Obama health care law and the IRS is bound to stir passions. Indeed, trading in gold coins and bars has surged since the financial crisis unfolded and Obama took office, metal dealers said. The sudden interest into gold tax reporting requirement is occurring as gold selling companies are increasingly being put under a regulatory microscope: The recently revealed investigation by California authorities into consumer complaints against Goldline International, which has used Beck as a pitchman, and Superior Gold Group (which has not) has put a spotlight on what one liberal leaning politician, Rep. Anthony Weiner, D-N.Y., calls the "unholy alliance" between gold coin sellers, such as Goldline, and conservative talk personalities, such as Beck. Beck, who through his spokesman, Matt Hiltzik, declined to comment for this story, and Goldline marketers portray gold coins as a better alternative to owning bullion in the event that the U.S. government ever decides, as it did under FDR in 1933, to make it illegal for private citizens to own physical gold. At that time, the U.S. dollar was still pegged to the price of gold; the gold standard was abandoned during the Nixon administration. Several legal responses have already been drafted in opposition to the proposed "healthcare" law: Rep. Daniel Lungren, R-Calif., has introduced legislation to repeal the section of the health care bill that would trigger the new tax reporting requirement because he says it's a burden on small businesses. "Large corporations have whole divisions to handle such transaction paperwork but for a small business, which doesn't have the manpower, this is yet another brick on their back," Lungren said in a statement e-mailed to ABCNews.com. "Everyone agrees that small businesses are job creators and the engine which drives the American economy. I am dumfounded that this Administration is doing all it can to make it more difficult for businesses to succeed rather than doing all it can to help them grow." Yet while the escalating surveillance over the gold market can not infuse one with confidence that gold transactions will not be increasingly regulated in the future, as David Galland pointed out last week, the implications are more substantial than just in regulating the gold market: The implications of this move transcend just the precious metals. Rather, this is a deliberate step in the direction of implementing a VAT – once the government has everyone reporting essentially every transaction, taking the next step is a snap.. And for those that may have missed it, here is David's previous conclusion:

Specific and shared antigenic components of Taenia saginata oncospheres. Taenia saginata oncosphere components were analysed by double diffusion. Antigenic components in saline or detergent (Triton x-100) extracts of T saginata oncospheres were identified using a rabbit polyclonal serum directed against the oncosphere and compared with extracts prepared from the metacestodes and proglottids of T saginata and six other helminths commonly found in cattle. There were seven antigenic components found in the saline extract of the oncospheres, of which six were shared with the metacestodes and proglottids. None of these components was consistently different from those of the other six helminths. However, one of the four components in the detergent extract of the oncospheres was present in neither of the extracts of other stages of T saginata nor in extracts of other helminths. This may be of diagnostic significance.

U.S. weighing military exercises in Eastern Europe Apr. 20, 2014 - 06:00AM | Soldiers from Estonia, Latvia, Lithuania, the U.K. and the U.S. conduct a convoy June 10 into the field-training portion of Exercise Saber Strike in Latvia. The U.S. is considering deploying about 150 soldiers for military exercises to begin in Poland and Estonia in the next few weeks, a Western official said Saturday. (U.S. Army) WASHINGTON — The United States is considering deploying about 150 soldiers for military exercises to begin in Poland and Estonia in the next few weeks, a Western official said Saturday. The exercises would follow Russia’s buildup of forces near its border with Ukraine and its annexation last month of Ukraine’s Crimean Peninsula. Defense Secretary Chuck Hagel said earlier this week that the U.S. is looking for ways to reassure its NATO allies of its strong commitment to collective defense. The Pentagon’s press secretary, Rear Adm. John Kirby, said in a statement Friday that American officials are considering a range of additional measures to bolster air, maritime and ground readiness in Europe. Ground exercises in Poland and Estonia would last about two weeks but such exercises would continue on a rotating basis off and on over time, the official said, and other locations in Eastern Europe would be considered. The official was not authorized to discuss the plan by name because it has not been made final and requested anonymity. No specific date for the deployment of an Army company, which usually consists of 150 soldiers, has been set but an announcement was expected next week, the official said. Kirby’s statement about additional measures didn’t offer specifics. “Some of those activities will be pursued bilaterally with individual NATO nations. Some will be pursued through the alliance itself,” he said. On Thursday, Hagel met at the Pentagon with his Polish counterpart, Tomasz Siemoniak, and told reporters that they had identified new areas of military-to-military cooperation, including special operations forces, air forces and additional military exercises and training, as part of their discussion of closer defense ties. In an interview with The Washington Post, Siemoniak said the decision to deploy U.S. ground forces to Poland had been made on a political level and that details were being worked out, the newspaper reported. “The idea until recently was that there were no more threats in Europe and no need for a U.S. presence in Europe any more,” Siemoniak said, speaking through an interpreter during a visit Friday to the newspaper. “Events show that what is needed is a re-pivot, and that Europe was safe and secure because America was in Europe.”

Two small disclaimers first, (1) I’m very new in the world of Erlang, and (2) the company I work for has subsidiaries that only focus on Erlang, and shares in companies whose products are built on top of Erlang. I like to believe I’m not influenced by this, but I am influenced, amongst others, by my CTOs passion for the ecosystem. Erlang is two things: a VM called BEAM, and a language. The language is not to my taste, but I really like the VM. Lucky for me, there is a new language called Elixir that runs on the Erlang VM as a first class citizen. What I really like with writing for this ecosystem is that it launches a ton of green threads instead of GCD threads, and these processes do true (shared nothing) message sending between them. The actor model is back! Elixir has other fun stuff too, such as piping function calls as if they were commands in the terminal. So far, I find myself writing a bunch of pattern matching for the work I want it to do, in a more terse yet easy-to-read way than I’m used to coming from ObjC and the usual suspects of languages before that. I think you’d find it interesting diving into the Elixir and Erlang VM combination. The take-away I’ve got that I’d love to bring back to ObjC would to be (1) even tighter on making everything immutable, (2) introduce green threads where for instance singletons can live, and (3) make a objc_msgSend that sends messages between threads not containing pointers to data, but an actual message, and having the sending process being able to continue with its logic until it needs the answer back where it can block and wait if there is no reply yet. This was a bit longer than a 140 character tweet, but there you go. Oh, and to tie this together with the news, I only noticed Whatsapp because they sponsor conferences and give talks on how they built their backend in Erlang.

Properidine Properidine is an opioid analgesic and the isopropyl analog of pethidine. Properidine is under international control and is listed in the United States under the Controlled Substances Act 1970 as a Schedule I Narcotic with an ACSCN of 9644 and a 2 gramme annual aggregate manufacturing quota as of 2014. The salt in use is the hydrochloride, with a free base conversion ratio of 0.88. References Category:Mu-opioid agonists Category:Synthetic opioids Category:Piperidines Category:Carboxylate esters

Garnet: She must be upset that her son was taken into space by those Homeworld Gems. Steven: You mean Onion? He isn’t in space. Garnet: Sorry, I must be thinking of a different timeline . From the episode Pool Hopping:Because of that I did this XDI'm surprised I haven't seen anything like this yetAnd yes, I know if he or any of the other humans got stuck in space like Lars, they wouldn't have ended up the same way as Lars. It's just a joketumblr: imaplatypus-art.tumblr.com/pos… made on ibispaint xOnion belongs to Cartoon Network

{ "name": "bluetoothconnector", "full_name": "bluetoothconnector", "oldname": null, "aliases": [ ], "versioned_formulae": [ ], "desc": "Connect and disconnect Bluetooth devices", "license": "MIT", "homepage": "https://github.com/lapfelix/BluetoothConnector", "versions": { "stable": "2.0.0", "head": "HEAD", "bottle": true }, "urls": { "stable": { "url": "https://github.com/lapfelix/BluetoothConnector/archive/2.0.0.tar.gz", "tag": null, "revision": null } }, "revision": 0, "version_scheme": 0, "bottle": { "stable": { "rebuild": 0, "cellar": ":any_skip_relocation", "prefix": "/home/linuxbrew/.linuxbrew", "root_url": "https://linuxbrew.bintray.com/bottles", "files": { "catalina": { "url": "https://linuxbrew.bintray.com/bottles/bluetoothconnector-2.0.0.catalina.bottle.tar.gz", "sha256": "38d8b5c89fd8fee4a746eadaceb399d5b7e1148db2cee896381b6e093aef56e3" }, "mojave": { "url": "https://linuxbrew.bintray.com/bottles/bluetoothconnector-2.0.0.mojave.bottle.tar.gz", "sha256": "1a0c1e83b5640a35c48ba982f1b7cf5b1bebdda6fd4957368262c3e001c740e3" } } } }, "keg_only": false, "bottle_disabled": false, "options": [ ], "build_dependencies": [ ], "dependencies": [ ], "recommended_dependencies": [ ], "optional_dependencies": [ ], "uses_from_macos": [ ], "requirements": [ { "name": "xcode", "cask": null, "download": null, "version": "11.0", "contexts": [ "build" ] } ], "conflicts_with": [ ], "caveats": null, "installed": [ ], "linked_keg": null, "pinned": false, "outdated": false, "deprecated": false, "disabled": false }

While we regret to inform you that CarePages will be shutting down, due to an overwhelming response from our members seeking additional account support we will be extending access to CarePages and its content until December 31, 2017. For further assistance, please contact support@support.carepages.com. ADVERTISEMENT Profile benfiaschi34's Profile Location: 75157 - United States of America About Me: Single brew coffee makers were invented to make it easier for coffee drinkers to get their daily fix. Coffee companies have stepped up to the plate by offering an endless variety of roasts for consumers. The best k cup coffee depends on personal preference. k cup latte

Stefano Denswil moest maandagavond even flink door het stof bij Sportgala van Amsterdam waar Ajax als Ploeg van het Jaar op het podium mocht komen. Toen Denswil werd gevraagd naar zijn verdere doelen antwoordde hij met een stalen gezicht: 'Om vanuit Ajax uiteindelijk naar een mooie club te gaan.' De aanwezigen in de zaal en de spelers op het podium (Ricardo van Rhijn, Davy Klaassen, Lasse Schöne, Frank de Boer en Niklas Moisander) lachten zich rot om de gewaagde uitspraak, die niet helemaal over kwam zoals hij waarschijnlijk was bedoeld. 'Een club in het buitenland, ja', corrigeerde Denswil. 'Natuurlijk is Ajax een mooie club, maar je hebt ook bijvoorbeeld FC Barcelona en dat is voor iedere jongen een droom. Dan zeg ik Barcelona, ja.' Na een nieuw lachsalvo vanuit de zaal poogde presentator Peter Heerschop de boel wat te lijmen. Dromen van FC Barcelona is namelijk best logisch. Denswil moet uiteindelijk lachend beamen dat het in zijn carrière Ajax of FC Barcelona wordt, waarop Heerschop gevat grapt: 'Jij speelt nog wel een tijdje bij Ajax.' Bekijk de hilarische beelden van cameraman Reinand Visscher hieronder, app-gebruikers kunnen hier kijken. [video]http://www.youtube.com/watch?v=uoQa3dTeM2I[/video] T/m 18 december geen verzendkosten bij besteding van meer dan 50 euro in de officiële fanshop.