Datasets:

autoevaluate

/

autoeval-staging-eval-project-c76b0e96-8395128

like 1

since prostate - specific antigen ( psa ) was demonstrated in prostatic tissue in 1970 , measurement of the serum psa level has become widely used for the early diagnosis and management of prostate cancer . however , it is well known that an increased serum psa level does not always indicate the existence of prostate cancer . the serum psa level can also be increased in patients with benign prostatic hyperplasia ( bph ) , in patients with prostatitis , and after interventions such as prostate biopsy and transurethral resection of the prostate ( turp ) . especially in patients with mildly increased serum psa ( 4 - 10 ng / ml ) , the single most common cause of serum psa elevation is known to be bph , rather than prostate cancer . other benign prostatic diseases that can cause elevation of the serum psa level include acute urinary retention , acute prostatitis , and prostatic ischemia . moreover , it has been reported that the serum psa level has a tendency to increase temporarily for 20 days after turp and will decrease afterwards . therefore , it is difficult to distinguish prostate cancer from benign prostatic conditions in patients who have undergone interventions on the prostate . one report on this issue suggested that 3% of patients who have undergone surgeries for bph will actually develop prostate cancer during the follow - up period ; thus , establishment of clinical guidelines for follow - up strategies for such patients is necessary . it is now well understood from several reports on changes in the serum psa level after turp that the serum psa level decreases after turp . by contrast , reports on changes in the serum psa level after potassium - titanyl - phosphate ( ktp ) laser vaporization of the prostate based on the analysis of large populations are rare . treatment of patients with bph by 80 w high - power ktp laser vaporization was first introduced in clinical practice in 2000 and is now accepted as an effective minimally invasive treatment modality . this method eliminates prostatic tissues that cause obstruction through vaporization , which occurs when hemoglobin selectively absorbs the ktp laser that generates heat energy . ktp laser vaporization has gained considerable attention among many urologists recently because this treatment modality is less invasive while offering treatment results similar to those of conventional turp . hwang et al reported that patients who underwent ktp laser vaporization demonstrated significant improvements in international prostate symptom score ( ipss ) , maximal flow rate ( qmax ) , quality of life ( qol ) , and residual urine 3 months after the operation . because the use of ktp laser vaporization is expected to increase , a need exists for establishing patterns in changes in the serum psa level after the operation . the elucidation of such patterns might offer useful clinical information on appropriate management and follow - up strategies . a total of 662 patients underwent ktp laser vaporization of the prostate for bph between october 2004 and august 2008 . among these patients , those with prostate cancer , prostatitis , a history of urinary retention , or use of antiandrogen medication , all of which can influence serum psa levels , also excluded were patients for whom insufficient data were available or who were lost to follow - up . therefore , 278 patients were included in the prospective analysis of serial serum psa levels . careful history taking , digital rectal examination ( dre ) , ipss , urinalysis / urine culture , transrectal ultrasound ( trus ) , qmax , postvoiding residual urine ( pvr ) , and serum psa levels were checked in every enrolled patient and evaluated to determine whether to perform ktp laser vaporization . patients with abnormal dre findings or a serum psa value of 4.0 ng / ml or higher underwent trus - guided 12-core prostate biopsy to detect and exclude prostate cancer . prostate volume was estimated by trus , first by measuring length ( l ) , width ( w ) , and height ( h ) and then by calculating volume by use of a prolate ellipsoid formula ( lwh/6 ) . either epidural or subarachnoid anesthesia was used for the operations , and the vaporization was carried out by use of an 80 w ktp laser system ( greenlight pvtm ; laserscope , san jose , ca ) that uses a 6 fr side - deflecting optical fiber emitting laser at a wavelength of 532 nm , which is delivered through a 23 fr , 30 continuous flow cystoscope connected to videoendoscopy . the distance from the probe to the prostatic tissue was kept closer than 2 mm , and normal saline was used as the irrigation fluid . the vaporization was performed until the tissues that caused the obstruction were completely removed , resulting in the formation of an appropriately sized cavity . a foley catheter ( 16 or 18 fr ) was inserted right after the procedure and was removed one day later . serum psa levels were measured in every patient before the operation and 1 , 3 , 6 , and 12 months after the operation to analyze patterns of change . in addition , serum psa levels at 24 months after the operation were also checked in 183 patients . the mixed linear model in spss ( version 12.0 , spss inc ) was used for statistical analysis of the changes in the serum psa level , and statistical significance was defined as a p - value of less than 0.05 . the mean age of the patients was 69.0 years ( range , 50 - 91 years ) . the mean serum psa value was 2.722.93 ng / ml , and mean prostate volume estimated by trus was 35.715.5 cc ( table 1 ) . the serum psa level temporarily increased and reached 3.183.23 ng / ml at 1 month after the operation ( p=0.032 ) . however , levels began to decrease continuously afterward and decreased to 1.922.26 ng / ml in 3 months ( p<0.001 ) and 1.791.82 ng / ml in 6 months ( p<0.001 ) . within 12 months , the serum psa level was 1.702.25 ng / ml ( p<0.001 ) , thus demonstrating a decreasing pattern of stabilization ( table 2 , fig . the decreasing pattern showed its greatest value between 1 month and 6 months ( fig . 1 ) . the serum psa level at 24 months after the operation was not checked in all patients , but it also was shown to decrease and stabilize ( table 2 ) . as a result , the serum psa level had decreased by 37.5% by 12 months after the operation compared with the preoperative level . bph is a common disease in older men ; 40% to 70% of men over the age of 60 years are suspected of having bph , and it is still on the rise along with increasing life expectancy and westernized diets . turp is accepted as the standard surgical method for treating the lower urinary tract symptoms of bph , although several other treatment options have been developed to date . however , complications of turp such as bleeding , tur syndrome , urethral stricture , retrograde ejaculation , and urinary incontinence are still among the side effects of this procedure and have not decreased significantly despite developments in techniques and instruments . ktp laser vaporization of the prostate was introduced in the 1990s but was not widely accepted as an effective treatment option because it was performed with a low - power ( 20 w , 34 w ) ktp laser in the early years and required a relatively longer surgical time than conventional turp . more recently , however , the 80 w high - power ktp laser was developed to improve vaporization speed , and as a result , ktp laser vaporization has become an effective treatment modality . malek et al proved its efficacy by reporting that patients with prostates over 45 cc who underwent 80 w ktp laser vaporization showed significant improvements in ipss , qol , qmax , and pvr within 5 years of follow - up . therefore , ktp vaporization is now widely practiced in many institutes because of its efficacy and reduced invasiveness , even though some controversy remains concerning its complication rates compared with conventional turp [ 13 - 15 ] . ktp laser vaporization can not eradicate prostate cancer that originates in the peripheral zone , however , because it only eliminates tissues at the transitional zone of the prostate . marks et al reported that among 82 patients who underwent turp to treat lower urinary tract symptoms , prostate cancer had developed in 6 patients within 5 years of follow - up . with ktp laser vaporization in particular , possible pathologic diagnosis of prostate cancer could be missed because it is impossible to obtain a prostate specimen from the operation , which is possible in conventional turp . therefore , it would be useful to establish clinical guidelines by serum psa follow - up after the operation to detect coexisting prostate malignancy with bph . to date , however , only limited reports on serum psa changes after ktp laser vaporization of the prostate were available . it is widely known that serum psa levels generally increase after interventions on the prostate for a certain period of time and decrease afterward . temporary elevation of the serum psa level occurs as a result of psa leakage to the systemic circulation due to damage to the blood - prostate barrier during manipulations . in addition , prostatic inflammation after the manipulation can also facilitate increases in the serum psa level . there are several different reports on the length of time it takes for the serum psa level to decrease after a procedure . volkan et al reported that the serum psa level increased immediately after ktp laser vaporization , but eventually decreased and returned to its preoperative level within 15 days after the operation . in our series , the serum psa level increased for up to 1 month and then decreased significantly over the next 3 months . it is not possible to clearly explain this variability in the length of time for which the serum psa level is increased . further investigation of the probable responsible factors , such as differences in prostate volume , the preoperative serum psa level , operating time , and devices , are necessary to clarify this matter . aus et al analyzed the serum psa level of 190 patients who underwent turp and reported that the serum psa level was reduced by 70% compared with its preoperative level . they also reported that the serum psa level became lower than 4 ng / ml in 90% of those patients . wolff et al also reported that the serum psa level became stabilized at 2 ng / ml or higher in patients who were diagnosed with prostate cancer after turp . therefore , similar to patients who undergo turp , the possible existence of prostate cancer should also be considered in patients who demonstrate a serum psa level that remains high or increases constantly after ktp laser vaporization . in our study , the serum psa level decreased significantly within 3 months after the operation and showed only a slight decrease from 6 to 12 months , which might mean that the levels stabilize after 6 months . in the present study , we were able to accurately analyze the changes in the serum psa level after ktp laser vaporization by frequently checking the postoperative serum psa level in a relatively large population for more than 1 year . the serum psa level may be temporarily increased after ktp laser vaporization for a certain period of time , but values will show a decreasing pattern within 3 months and will eventually become stabilized between 6 and 12 months . therefore , it may be appropriate to wait for 3 months if the serum psa level rises after the procedure . however , if the serum psa level remains high even after 6 months , close follow - up or further investigation should be considered .

purposethe prostate - specific antigen ( psa ) level decreases after transurethral resection of the prostate ( turp ) . however , changes in the psa level after potassium - titanyl - phosphate ( ktp ) laser vaporization of the prostate are not well known . the aim of this study was to investigate the effect of ktp laser vaporization of the prostate on psa levels in patients with benign prostatic hyperplasia ( bph).materials and methodsserum psa levels were checked before and 1 , 3 , 6 , and 12 months after the procedure in patients who underwent ktp laser vaporization between october 2004 and august 2008 . patients with prostate cancer , a history of urinary retention , or prostatitis during the follow - up period were excluded . the results for 278 patients were studied.resultsthe mean age of the patients was 69.06.7 years ( range , 50 - 91 years ) and the mean preoperative psa level was 2.722.93 ng / ml . the psa level tended to be increased at 1 month after the operation ( 3.183.23 ng / ml , p=0.032 ) but decreased within 3 months and became stabilized after 6 months at 1.791.82 ng / ml ( p<0.001).conclusionspsa levels may increase after ktp laser vaporization for a certain period of time , but eventually decrease and become stabilized after 6 months . therefore , it may be appropriate to wait up to 3 months if the psa level rises after the procedure , and further investigation should be considered if the psa level still remains high after 6 months .

these range from various slow - growing benign tumors and low - grade malignancies to fast growing high - grade malignancies . angiofibromas are one such group of tumors arising in this region , which present as swellings . of these , nasal angiofibromas ( nas ) are the most common and nas occurring in the region other than the nose are called as extranasopharyngeal angiofibromas ( ena ) . a 54-year - old male reported to our department with history of swelling over the right side of face since 5 years . the patient reported insidious onset of swelling with a gradual progress to the present size . he also reported mild , intermittent , and dull pain in the region of swelling . clinical examination confirmed a solitary , oval , well - defined swelling measuring approximately 7 5 cm in the preauricular region [ figure 1 ] . it extended superioinferiorly from the level of outer canthus of the eye to inferior border of mandible and anterioposteriorly extended from 2 cm in front of anterior border of ramus to the mastoid notch [ figure 1 ] . on palpation , the swelling was firm , non - tender , free from skin , and mobile over the underlying structures . ultrasonography revealed a large lobulated solid mass of 6 4 cm in the right parotid region with multiple vessels with low velocity flow and without any areas of calcification or cystic changes . findings were suggestive of a low - grade vascular tumor . computed tomography scan with contrast medium revealed a large well - circumscribed , solitary isodense lesion measuring 6.36 4.39 cm [ figure 2 ] . it was observed to be extending anteriorly over the superficial lobe of the parotid gland , with anterior displacement of parotid gland . fnac revealed numerous vascular channels with occasional singly scattered and single cluster of plump spindle cells . ct- scan transverse section classical superficial parotidectomy was performed under general anesthesia using a modified appiani incision . tumor mass was dissected anteriorly and excised along with the superficial lobe of parotid gland [ figure 3 ] . facial nerve was located using the anterograde method and all the branches of facial nerve were preserved . follow up , facial nerve function was intact and no sign of reoccurrence was observed . histopathological sections revealed connective tissue with numerous vascular spaces of variable sizes ranging from small capillary - like vessels to partly lined vessels . around the endothelial cells , cells were plump or stellate - shaped with mild inflammatory cell response and composed predominantly of plasma cells and a few lymphoid follicles [ figure 4 ] . photomicrograph shows numerous endothelial lined blood capillaries with collagen fibres interspersed with fibroblasts and fibrocytes ( h&e stain , 40 ) . ( b ) photomicrograph shows endothelial lined blood vessels with connective tissue wall in the background of collagen fibres interspersed with fibroblasts and fibrocytes ( h&e stain , 400 ) photomicrograph of the sections showing the blood vessels positive for cd 34 ( ihc stain , 100 ) various soft tissue tumors , both benign and malignant , present as swelling in the parotid region . clinical examination confirmed a smooth - surfaced , solitary , oval , firm , well - defined swelling measuring approximately 7 5 cm in the preauricular region . based on the clinical findings of location , consistency and borders a differential diagnosis of pleomorphic adenoma , solitary fibrous tumor ( sft ) , low - grade fibrosarcoma , and lipoma was made . as the most common tumors found in the region are parotid tumors , a provisional diagnosis of mixed parotid tumor was made . however , fnac and contrast - enhanced ct scan were in favor of a tumor with vascular component , shifting the differential diagnosis towards tumors with a vascular component presenting as slow - growing , circumscribed firm swellings . histopathological examination of the excised lesion revealed features suggestive of angiofibroma and had to be differentiated from lesions with similar features . the differential diagnosis included low - grade vascular lesions , spindle cell neoplasms , comprising of a large range of benign and low - grade malignant soft tissue lesions , including cellular angiofibroma , sft , low - grade fibromyxoid sarcoma ( lgfms ) , low - grade myxofibrosarcoma , myxoid liposarcoma , giant cell angiofibroma ( gca ) , angiomyolipoma , and angiomyofibroblastoma . cellular angiofibroma , usually occurs in the pelviperineal region , which would be an unusual location for the tumors reported herein ; however , cases have been reported to have occurred in the buccal mucosa , raising a diagnostic possibility . cellular angiofibroma shows more rounded , non - branching vessels , often of medium size with thicker walls . the tumors are generally more uniformly cellular , composed of lesional cells with short , stubby nuclei resembling those of spindle cell lipoma . sfts occur in a variety of locations in the head and neck region ; myxoid examples may be particularly difficult to identify and should be considered in the differential diagnosis . microscopically , besides the so - called patternless architecture , there is pronounced regional variation in cellularity , prominent thick collagen bundles and characteristic branching ectatic staghorn vessels , which are not accompanied by the abundant smaller - sized vessels present in angiofibroma of soft tissue . in addition , the tumor cells in sft express strong and diffuse cd34 in most cases . this entity lacks the innumerable , evenly distributed , arborizing thin - walled vessels characteristic of angiofibroma . lgfms is a distinctive fibroblastic malignant neoplasm characterized by a peculiar tendency to give rise to very late metastases . histologically , it shows alternating collagenous and myxoid areas with a usually swirling or whorled growth pattern , a frequently lobular appearance , and deceptively bland spindle cell morphology . the lesions tend to be more hypocellular , with a fibrous component that has uniform collagen deposition rather than the fibrillary or coarsely banded collagen fibers in angiofibroma of soft tissue . although lgfms may contain arcades of thin - walled vessels , vascularity is usually not prominent . usually occurring in subcutaneous tissues of the extremities , it shows distinctive histologic features including a lobulated growth pattern with infiltrative margins and fusiform , round , or stellate tumor cells with frequently slightly eosinophilic cytoplasm and hyperchromatic atypical or pleomorphic nuclei . obvious features of malignancy are usually present , characteristic elongated curvilinear vessels with perivascular hypercellularity , these features bear little or no resemblance to the rich vascular network of angiofibroma . myxoid liposarcoma contains a prominent plexiform network of thin - walled capillaries ( which has been referred to as a chicken wire or however , it also shows scattered univacuolar and multivacuolar lipoblasts throughout , as well as stromal mucin pools not seen in angiofibroma . gca has been reported as a benign mesenchymal tumor with 2 cases originating in the buccal mucosa . although benign , the lesion has potential for local reoccurrence , especially after incomplete resection . histopathologically , it has similar presentation to that of sft , with presence of multinucleated giant cells not seen in angiofibroma . angiomyolipoma differs from angiofibromas because of the presence of prominent muscular arteries while angiomyofibroblastoma differs because of the presence of fibrovascular component with a loose myxoid fibroelement . enas have interstitial stromal tissue predominance with less vascular elements such as that of long - standing na . other distinctive histologic features are angiofibroma of soft tissue , consisting of a vaguely lobular , variably cellular proliferation of bland , uniform spindle cells set in an abundant , variably myxoid or collagenous extracellular matrix with numerous small , and thin - walled , branching blood vessels . the complexity of the vascular pattern , often also including larger vessels of varying size and shape , is the most noticeable feature . immunohistochemical analyses may show that stromal cells have strong cytoplasmic reactivity for vimentin and are generally immunonegative for smooth muscle actin and desmin . histopathology coupled with immunohistochemistry usually confirms the diagnosis in favor of angiofibroma . in our case , the tissue specimen showed features consistent with the diagnosis of ena . in 1980 , de vincentiis and pinelli reviewed a series of 704 cases of angiofibroma and found that 13 cases manifested outside the nasopharynx , thus suggesting that extra nasopharyngeal localization of this tumor is a possible although rare occurrence . a review article by windfuhr and remmert in 2004 summarized 65 patients with enas . the most common site reported for enas is the maxillary sinus followed by the ethmoid , nasal cavity , and nasal septum . enas are also reported to originate from the ethmoid sinus , nasal cavity , nasal septum , larynx , sphenoid sinus , cheek , conjunctiva , oropharynx , retromolar area , middle turbinate , inferior turbinate , and tonsil . other rare sites for enas occurrence have also been described - external nose , hard palate , external ear , lacrimal sac , carotid bifurcation , oesophagus , trachea , facial nerve , middle cranial fossa , and infratemporal fossa . the most common age of incidence was the second decade ( 46% ) in comparison to 80% of patients with nas . enas have a higher mean age , i.e , 22 years compared to nas , which have a mean age of 18 years . this lesion has been described as different from that of the classical nasopharyngeal variety in being more common in females , older individuals with an early presentation , and being capsulated with poor vascularity and infrequent recurrence . unlike nas , enas present non - specific and numerous symptoms . imaging modalities such as ct scan , mri , ct angiography , and ultrasonography are required for optimal preoperative evaluation of nas and enas . imaging of nas with a contrast agent leads to diffuse and usually homogenous involvement in ct and mri scans with strong contrast enhancement . in contrast , enas enhances moderate amount of contrast or none due to its weak vascular involvement . surgical excision is the prime modality of treatment for enas ; radiotherapy maybe applied for non - resectable lesions . occurrence of enas , although rare in the maxillofacial region , should be considered in differential diagnosis of swellings in this region .

angiofibromas are rare , benign , locally invasive vascular tumors , which represent 0.05 - 0.5% of all head and neck tumors . most frequent site of occurrence is the posterior nasopharynx , called as nasopharyngeal angiofibromas ( na ) , when these arise outside the nasopharyngeal region they are termed as extranasopharyngeal angiofibromas ( ena ) . only 65 cases of ena have been reported , and the most common site has been reported to be maxilla followed by ethmoids . other unusual sites of occurrence reported so far in literature are nasal cavity , nasal septum , larynx , sphenoid sinus , pterygomaxillary fissure , infratemporal fossa , cheek , oropharynx , retromolar area , middle turbinate , inferior turbinate , and tonsil . ena arising from the superficial lobe of parotid gland has not been reported in the literature so far and this case is the first to be reported .

a 27-year - old man visited our hospital because of a sudden - onset generalized convulsion . he had been overworking and had slept less than 5 hours a day for the previous month . a week prior to the hospital visit , the patient had developed a fever and generalized myalgia but had not taken any medicine . high fever , anorexia , and generalized malaise appeared . on the day of the hospital visit , he could not be awakened , and he showed no responses to any stimulus . finally , he developed a generalized tonic - clonic seizure that lasted for about three min and that was accompanied by cyanosis , upward eyeball deviation , and tongue biting . on physical examination at the emergency department , the patient s body temperature rose up to 38.7c . he was confused and could not follow the examiner s verbal commands appropriately , and he often attempted to run out of the bed while yelling incomprehensible words and abuses . neck stiffness was found on neurologic examination . positive or negative myoclonic jerk was not observed . the cerebrospinal fluid ( csf ) was clear , and its pressure was measured at 16.0 cmh2o , with 20 leukocytes/l ( 95% lymphocytes ) , protein levels of 70.5 mg / dl , and normal glucose levels ( 63.0 mg / dl ) . aspartate aminotransferase ( ast ) , alanine aminotransferase ( alt ) , and -glutamyl transpeptidase levels were increased to 441 , 1294 , and 460 total bilirubin and direct bilirubin levels were normal ( 0.6 mg / dl and 0.2 mg / dl , respectively ) . seizure did not relapse after 30 min of continuous infusion of 15 mg / kg of phenytoin mixed with normal saline . he regained consciousness on the second admission day and became fully conscious the following day . intravenous acyclovir was given for two days because of the clinical suspicion of herpes encephalitis , which was discontinued after observing the clinical improvement and the detection of the igm antibody of hav . the patient s score on the korean version of the mini - mental status examination ( k - mmse ) score was 30 on the fifth admission day . serum and csf igm antibodies of herpes simplex type 1 , 2 , and varicella zoster were negative . polymerase chain reaction ( pcr ) of the csf for hav and enterovirus were also negative . ast and alt levels decreased to 125 and 432 iu / l on the seventh admission day . hav , which causes an acute inflammatory hepatitis , is a picornavirus , which is transmitted by the fecal - to - oral route . the clinical spectrum varies from mild flu - like illness to fatality caused by acute fulminant hepatitis . in the anicteric form , diagnosis may be delayed due to the atypical presentation of the disease . in general , the disease is preceded by flu - like prodromes , and the progression of the hepatitis symptoms and liver enzyme elevations is relatively rapid . in a week or so , liver enzymes stop elevating and gradually decrease to normal levels . diagnosis can be made by the detection of the serum igm antibody of hav [ 46 ] . common pathomechanisms are attributed to a disturbed detoxification process by the damaged liver and metabolic disturbances , such as fluid electrolyte imbalances . our patient had a seizure in an early stage of the disease , and he showed no specific laboratory abnormalities other than liver enzyme elevations . he showed neck stiffness and a clouding of consciousness that was accompanied by csf abnormalities that were compatible with encephalitis . these findings support the diagnosis of encephalitis rather than that of toxic - metabolic disturbances due to the hepatitis . after reviewing five cases , including the above report , altered consciousness and seizures are commonly manifested . positive hav pcr results were reported in one case , of which csf cells and protein were normal . the clinical courses were all benign ; all patients improved within a few days to a few weeks with supportive treatment [ 2,3,810 ] . hav - associated encephalitis is a very rare disorder , which has not been reported in korea . no specific radiological or eeg findings are observed . in particular , in the anicteric form of the disease , the diagnosis may be difficult without a clinical suspicion . when progressive liver enzyme elevations are observed in patients with encephalitis

encephalitis is caused by multiple organisms , but rarely by the hepatitis a virus . a 27-year - old man visited our hospital because of fever , altered consciousness , and seizures . on physical exam , a stuporous mentality and neck stiffness were found . on laboratory exam , elevated liver enzymes and cerebrospinal fluid abnormalities , including pleocytosis and elevated protein levels were observed . the hepatitis a virus ( hav ) igm antibody was also detected . we conclude that these findings were compatible with encephalitis associated with hav and discuss the pathomechanisms .

microsatellites are simple sequence repeats ( ssrs ) that exhibit complex patterns in their frequency of occurrence , genomic distribution , mutability , function and evolution . apart from being the source of informative genetic markers , microsatellites per se have attracted a lot of attention with respect to their origin , distribution , expansion , mutation and disintegration ( 17 ) . questions are also asked about the functional role of microsatellites in particular and biological significance of the microsatellites in general ( 4,812 ) . genetic studies and whole genome sequence analysis have established non - random distribution , variability and high mutability as characteristics of microsatellites . evidences are accruing , which support the role of microsatellites in gene regulation , transcription and protein function ( 13 ) . existence of qualitative and quantitative differences between microsatellites of different genomes and their role in adaptive evolution have also been theorized ( 2,8 ) . however , such studies require information on type ( mono to hexa ) , motif ( gc% ) , abundance ( motif preferences ) , frequency , distribution ( linkage group - wise and chromosomal position ) , location ( exon , intron , regulatory element and transposon ) , nature ( perfect , imperfect and compound ) and copy number ( existence of paralogs ) of microsatellites not only on a whole genome basis but also as a comparative analysis of multiple genomes that are related by phylogeny ( for instance , fully sequenced primate genomes or fungal genomes or insect genomes ) to draw functional conclusions . whole genome sequences of insects have lived up to the reputation of diversity and have thrown immense variability in size and organization of their genomes . among others , there are five fully sequenced insect genomes : drosophila melanogaster ( as a model organism it provides maximum annotated data ) , anopheles gambiae ( another dipteran but economically highly important as malarial vector ) , tribolium castaneum ( relatively early insect order of coleoptera ) , apis mellifera ( hymenoptera , relatively a recent insect order ) and bombyx mori ( economically important as silk - producing member of lepidoptera , members of which are crop pests ; also significant as a model for insect development ) . researchers attempting to understand the biology and evolution of microsatellites are often faced with the following questions : ( i ) do microsatellites occur everywhere in the genome ? ( ii ) ( v ) does the gc content of the motif affect the length , repeat units or mutation rate of microsatellites ? ( viii ) do microsatellites occur as families of common flanking sequences in the genomes ( paralogs ) ? insatdb , unlike many other microsatellite databases that cater to only the needs of microsatellites as markers , allows users to address the above - mentioned questions by accessing qualitative and quantitative genome level microsatellites profile of a single insect or to carry out comparative genomic analysis using all the five genomes . t.castaneum sequences were downloaded from genbank ( ) and bombyx mori sequences were downloaded from . repeats were extracted employing tandem repeat finder version 4 ( 14 ) . to ensure that the extracted repeat sequences were real microsatellites , those with less than five repeat units and shorter than 15 bp in length were excluded . tandem repeat finder does not employ minimal alignment score for detecting microsatellites ; rather a probabilistic model of random repeat sequences specified by per cent identity and frequency of insertions and deletions . this includes calculation of average per cent identity between the copies ( pm ) and average percentage of insertions and deletions ( pi ) . the algorithm has a pair of matching probability and indel probability values ( pm = 0.80 , pi = 0.10 ) as default to cover most divergent copies at every locus . we used two sets of alignment parameters ( match , mismatch , gap ) , ( + 2 , 3 , 5 ) and ( + 2 , 5 , 7 ) to score the matches . all the microsatellites with a minimum alignment score of 30 are reported in the database , which means that both perfect and imperfect microsatellites are listed . smit , r. hubley and p. green , unpublished data ; ) to obtain indices marking the occurrence of simple repeats , tandem repeats , segmental duplications , interspersed repeats including sines , dna transposons , retrotransposons , lines , etc . further , sequences were analysed for the delineation of exons and introns using genscan ( 15 ) . flanking sequences of microsatellites were aligned to catalogue paralogous microsatellites that exhibit identical origin and hence considered belonging to the same microsatellite family . occurrence of two or more microsatellites contiguously with intervening non - repeat sequence of 70 bp were separately categorized as compound repeats . it stores microsatellites from all the five insect genomes separately as well as carries complete annotations of these microsatellites . the database also provides basic information on each of the five insects and important links to obtain further knowledge , and contains a tutorial page and a glossary page . end users with adequate computational capabilities can batch download full complement of microsatellites ( insect - wise ) , microsatellite sequences , compound microsatellites and full list of microsatellite loci existing as families . these data are made available as csv files , which are compatible with spreadsheet programmes such as ms excel . alternatively , details of the microsatellites with highly specific characteristics may be queried using a multi - option query sheet ( figure 2 ) . the options include insect ( one at a time ) ; location ( intron , exon , i.e. boundary , upstream , intergenic , repeat elements single or in combination ) ; repeat type ( motif size , mono- to hexa - nucleotide ) or actual repeat motif ( by essentially entering up to five repeat motifs ) ; gc% ( fixed value or range ) ; repeat size in either base pairs or number of units ( fixed value or range ) ; repeat kind ( perfect or imperfect ) . once insect and location options the output is primarily a list of microsatellites annotated for all options of the query sheet and the output table is generated as a hierarchical pre - sorted list . each microsatellite is given a unique i d that also carries genomic sequence i d and corresponding indices . if the number of microsatellites selected based on the options of the query sheet exceeds 500 , the output is split into sets of 500 microsatellites . in addition , a csv file containing total output is also made available for downloading . if the query options do not select any microsatellite , a message indicating zero output is displayed and a back button is provided to refine the options . ssr motif and 100 bp each of the left and right flanking sequences are given for each microsatellite entry , which allows users to carry out sequence analysis of microsatellite vis - - vis locus . in addition , users can select individual microsatellites to convert them into locus - specific markers . this is facilitated by automatic uploading of repeat and flanking sequences of the selected microsatellite into primer3 query form ( 16 ) . screen shots of ( a ) insatdb homepage , ( b ) multi - option query sheet , ( c ) output table and ( d ) analysis page . our analysis showed that microsatellite content of five fully sequenced insect genomes is independent of both genome size and gc content ( table 1 ) . the database consists of a dedicated section ( analysis ) that describes the types of analysis that can be carried out using the data obtained from insatdb . some of the quick observations and inferences from a comparative genomic analysis are given in this section . microsatellite content of insect genomes preponderance of di- and tri - nucleotide repeats is observed in drosophila and anopheles , whereas tri- and tetra - nucleotide repeats are abundant in bombyx and tribolium . on the whole , shorter microsatellites are abundant in the five insect genomes ; as the length of the microsatellite increases their number decreases logarithmically typified by bombyx and drosophila microsatellites ( > 90% of the microsatellites < 50 bp ) ; on the other hand , anopheles and tribolium have longer microsatellites in a relatively high frequency . shorter microsatellites not only predominate microsatellite population in the five insect genomes , but also seem to possess higher number of imperfect repeat units . on the other hand , microsatellites spanning > 100 bp consisted of perfect , rather than imperfect repeats . interruptions , if at all , occur mainly in the middle region of the repeat sequence and the ends seem to be selected against decomposition . on the whole , there is no linear correlation between gc content and the average number of repeat units . average length of the microsatellite across gc range is 37 9 bp and between 0 and 5% gc content , microsatellites tend to be longer than 60 bp . compound microsatellites account for nearly 3.2% in the insect genomes analysed ; owing to high density of microsatellites , apis has higher number of compound loci ( 6.12% ) . anopheles and apis genomes have as many as 50 and 60% of the total microsatellites in coding region , respectively . bombyx genome has only 10% of the microsatellites in regions spanning exons , introns and their boundary . more than 70% of the microsatellites present in exons are trinucleotide repeats except in apis , where 50% tri- and 25% dinucleotide repeats are present in exonic regions . microsatellites in insects are at rich ( on an average 23.4% gc ) ; however , they exist within regions that are not always at rich . incorporation of microsatellite data from additional insects , query facility for better comparative genomic analysis such as gene - based microsatellite extraction and conservation analysis are planned . additionally , based on users ' feedback , supplementary features will be added to make insatdb a single window system for insect genome analyses using microsatellite tools .

insatdb presents an interactive interface to query information regarding microsatellite characteristics per se of five fully sequenced insect genomes ( fruit - fly , honeybee , malarial mosquito , red - flour beetle and silkworm ) . insatdb allows users to obtain microsatellites annotated with size ( in base pairs and repeat units ) ; genomic location ( exon , intron , up - stream or transposon ) ; nature ( perfect or imperfect ) ; and sequence composition ( repeat motif and gc% ) . one can access microsatellite cluster ( compound repeats ) information and a list of microsatellites with conserved flanking sequences ( microsatellite family or paralogs ) . insatdb is complete with the insects information , web links to find details , methodology and a tutorial . a separate analysis section illustrates the comparative genomic analysis that can be carried out using the output . insatdb is available at .

electrical impedance tomography ( eit ) [ 1 , 2 ] reconstructs the spatial distribution of electrical conductivity or resistivity of a closed conducting domain ( ) from the surface potentials developed by a constant current injection through the surface electrodes surrounding the domain to be imaged . before carrying out the practical measurements on patients , it is advised to test an eit system with a tissue mimicking model of known properties called practical phantoms [ 410 ] . hence , phantoms are often required to assess the performance of eit systems for their validation , calibration , and comparison purposes . two - dimensional ( 2d ) eit ( 2d - eit ) assumes that the electrical current flows in a 2d space which is actually three - dimensional inside real volume conductors . hence , the development of a perfect 2d practical phantom is a great challenge as the real electrodes always have a definite surface area , and hence the injected current signal can not be confined in a 2d plane in bathing solution . researchers have developed a number of practical phantoms which are three - dimensional objects , and those phantoms are designed and developed , generally , for their own eit systems . practical phantoms containing electrolyte ( or other conducting medium ) [ 410 ] are three - dimensional in shape and hence they will have some data error due to the three dimensional current conduction . also , the phantoms containing electrolytes ( e.g. , nacl solution or saline ) [ 5 , 7 , 8 ] are difficult to transport and are prone to errors since the evaporation of the water gives rise to changes in conductivity . in addition , temperature variations have a marked effect on the conductivity because the temperature coefficient is large . therefore , the practical phantoms will have a poor stability and a gradually increasing data error over time . network or mesh phantoms [ 12 , 13 ] are compact , more stable , rugged , portable , easy to move , consistent over time , and less temperature dependent . but these phantoms need a huge number of identical electronic components properly designed in a mesh mimicking the conductivity distribution of a practical biological tissue . furthermore , for a large tissue structure , a mesh phantom requires a huge number of very precision components . the reproduction of these kinds of phantoms having different properties is often time - consuming . the option for changing the position and property of an inhomogeneity is limited by the phantom structure and the number of elements in mesh phantom but the practical phantoms allow us to put several types of object in different positions in the bathing solution , but they produce several errors contributing to the poor signal to noise ratio ( snr ) in boundary data . reconstructed image quality in impedance tomography depends on the errors associated with practical phantom , electronic hardware , and inverse solver performance . image quality is largely affected by the practical phantom design parameters such as phantom geometry , electrode geometry , electrode materials , and the nature and behavior of the inhomogeneity and bathing solution . snr is also reduced by the error contributed by current injector , data acquisition system , and signal conditioner circuits . in practical phantoms , the voltage data developed by a three - dimensional current conduction are collected form surface electrodes connected to an analog instrumentation . therefore , it is quite confusing to identify the source of the errors responsible for poor image quality in a 2d - eit system . in order to overcome the difficulties and limitations of practical and mesh phantoms , a matlab - based boundary data simulator ( bds ) bds is an absolute 2d data simulator which is required to generate the errorless 2d boundary data to study and modify the inverse solver of a 2d eit system . as the bds is a computer program , it is free from the instrumentation errors and allows us to generate voltage profile with different types of phantom geometry , inhomogeneity and background conductivity profile , and inhomogeneity geometry ( shape , size , and position ) . moreover , it is absolutely stable , compact , easy to use , and easy to handle and modify for further development . boundary data for different phantom geometries are generated in bds , and resistivity images are reconstructed in standard reconstruction algorithm . bds is studied to conform its suitability to use for boundary data generation with different phantom configurations which are required to assess the eit inverse solvers . eit image reconstruction is a nonlinear inverse problem in which the electrical conductivity distribution of a closed domain ( ) in a volume conductor is reconstructed from the surface potential data developed at the boundary ( ) by injecting a constant current signal . a low frequency and low magnitude constant sinusoidal current is injected through an array of electrodes attached to the boundary , and the boundary potentials are measured using a data acquisition system . the voltage data collected from surface electrodes are then used by an image reconstruction algorithm which reconstructs the conductivity distribution of the domain under test ( dut ) . the reconstruction algorithm computes the boundary potential for a known current injection and known conductivity values and tries to compute the conductivity distribution for which the difference between the measured boundary potential ( vm ) and the calculated ( vc ) is minimum . the reconstruction algorithm is developed with two parts : forward solver ( fs ) [ 5 , 1517 ] and inverse solver ( is ) [ 1517 ] . forward solver calculates the boundary potential data for a known current injection and known conductivity values . inverse solver computes the conductivity distribution for which the boundary voltage difference ( v = vm vc ) becomes minimum . the dut will have the distinct conductivity values at each points defined by their corresponding coordinates ( x , y ) . due to a constant current injection , a potential profile is developed within dut , and its potential profile without any internal energy sources depends on the conductivity profile . hence , a relationship , called eit governing equation , between the electrical conductivity ( ) of the points within the dut and their corresponding potential values ( ) can be established . the governing equation in eit [ 1 , 2 ] can be derived from the maxwell 's equation and can be represented as ( 1)=0 . to calculate the domain potential developed for a constant current injected to the dut with a known conductivity distribution , the above equation is essentially to be solved . as the eit governing equation is a nonlinear partial differential equation , the direct or analytical technique fails to solve it . therefore , to calculate the domain potential , the equation is solved by developing a mathematical model called forward model which is derived from ( 1 ) using a numerical technique like finite element method ( fem ) . the eit governing equation has an infinite number of solutions , and hence the fem formulation of the eit technique is essentially required to be provided by some boundary conditions [ 1820 ] to restrict its solutions space . the boundary conditions are imposed into the fem formulation of eit by specifying the value of certain parameters ( voltage or current ) . the parameters defining the boundary conditions may be either the potentials at the surface or the current density crossing the boundary or mixed conditions . the boundary conditions , in which the parameters are the potential at the surface , are called the dirichlet boundary conditions and are represented as [ 1 , 5 , 19 , 20](2a)=i , where i = 1 , the boundary conditions , in which the parameters are current density crossing the boundary , are known as the neumann boundary conditions [ 1 , 5 , 19 , 20 ] which are given by ( 2b)n={+ion the source electrodeion the sink electrode0otherwise , where is the boundary , and n is the outward unit normal vector on an electrode surface . in eit , the fem technique is used to derive the forward model from the governing equation in the form of a matrix equation establishing the relationship between the injected current and the developed potential within a dut . the relationship can be assumed as the transfer function of the system which is mathematically represented as a matrix called global stiffness matrix ( gsm ) or transformation matrix constructed with the elemental conductivities ( ) and nodal coordinates ( x , y ) . in eit , fem discretizes the dut by a finite element mesh containing finite number of elements of defined geometry and finite number of node . fem applied on the governing equation to derive the forward model of a dut in the form of a matrix equation using the and nodal coordinates . in the eit forward model , the relationship established between the current injection matrix [ c ] ( matrix of the applied signal ) and the nodal potential matrix [ ] ( matrix of the developed signal ) through the transformation matrix [ k( ) ] is mathematically represented as ( 3)[]=[k()]1[c ] . now , in fem formulation in eit , when the current matrices [ c ] and [ k( ) ] are known , and the nodal potential matrix [ ] is unknown , the forward model or the mathematical problem is termed as the forward problem . the procedure of calculating the [ ] by solving the forward problem ( 3 ) with known [ k( ) ] and known [ c ] is termed as forward solution . in eit , the forward solver first computes the potential distribution with the assumed initial conductivity distribution ( 0 ) with a known constant current simulation , and then the inverse solver reconstructs the conductivity distribution from the measured boundary potential data for a same constant current injection through surface electrodes . the eit reconstruction algorithm tries to mathematically find the elemental conductivity values ( conductivity distribution ) for which the difference between the estimated nodal potentials ( vc ) computed in the fs and the potentials measured ( vm ) on the surface electrodes ( for a same current injection values ) becomes minimum . the inverse solver of the eit reconstruction algorithm is developed with a mathematical minimization algorithm ( mma ) [ 1922 ] such as gauss - newton - based mathematical minimization algorithm ( gn - mma ) . in gn - mma , the conductivity update vector ( [ ] ) is calculated and the boundary data mismatch vector ( v = vm vc ) is minimized by an iteration technique like the modified newton - raphson iteration technique ( nrit ) [ 1922 ] . the [ ] matrix is the desired variation in the elemental conductivity values in [ ] matrix for which the forward solver calculates the boundary potentials more similar to the measured value in next iteration using nrit . therefore , the algorithm starts with an initial elemental conductivity vector ( [ 0 ] ) , and it is then updated to ( [ 1 ] = [ 0 ] + [ ] ) in the next iteration . using this [ 1 ] , fs calculates a new potential distribution in dut and a new voltage mismatch vector [ v1 ] is thus obtained and compared with the previous voltage mismatch vector [ v0 ] . if the v1 is not found as the minimum , the iteration process is continued till the kth iteration using the conductivity update vector ( [ k ] ) developed by gn - mma . using , nrit the [ ] matrix is iteratively updated to [ k+1 ] = [ k]+[k ] and repetitively tries to find out the minimum value of [ v ] . hence , in the eit inverse solver , it is understood that the desired elemental conductivity matrix is obtained by a minimization algorithm ( mma ) which is composed of gauss - newton method and newton - raphson iteration in which the technique iteratively tries to find out an optimum conductivity distribution [ k ] for which the voltage mismatch vector is minimized [ v ] . at a particular iteration in this mma , the elemental conductivity matrix is calculated when the current matrices [ c ] and [ ] or [ v = vm vc ] are known . thus , when the current matrices [ c ] and [ ] are known , and the elemental conductivity matrix [ ] is unknown , the model or the problem is called the inverse problem . the procedure of calculating the [ ] or [ ] using with known [ v ] and the known [ c ] is termed as inverse solution . electrical conductivity imaging is a highly nonlinear and ill - posed inverse problem [ 1922 ] . in eit , a minimization algorithm is used to obtain an optimized elemental conductivity value [ ] for which the voltage mismatch vector [ v ] becomes minimum . in the image reconstruction process , the minimization algorithm [ 17 , 18 ] first defines an objective function ( s ) from the computational predicted data [ vc ] and the experimental measured data [ vm ] and runs iteratively to minimize it . generally , in the eit image reconstruction algorithm , the inverse solver searches for a least square solution of the minimized object the function ( s ) using by a gauss - newton method and the nrit - based iterative approximation techniques . if f is a function mapping a t - dimensional ( t is the number of element in the fem mesh ) impedance distribution into a set of m ( number of the experimental measurement data ( [ vm ] ) available ) approximate measured voltages , then the gauss - newton - method - based minimization algorithm [ 1926 ] tries to find a least square solution of the minimized object function ( s ) [ 1926 ] which is defined as : ( 4)s=12||vmf||2=12(vmf)t(vmf ) . now , differentiating ( 4 ) with respect to the conductivity , it reduces to ( 5)s=[f]t[vmf]=jtv , where the matrix j = f is known as jacobin matrix [ 1922 ] , which may be calculated by a method as described in [ 19 , 22 ] or by the adjoint method represented by ( 6 ) ( 6)j=sdd , where s is the forward solution for a particular source location , and d is the forward solution for the adjoint source location ( source at the detector location and detector at the source location ) . differentiating ( 5 ) with respect to again , the equation reduces to ( 7)s=[f]t[f][f]t[vmf ] . by gauss - newton method , thus , the conductivity update vector is given by ( 9)=[[f]t[f][h]tv]1jtv , where the higher - order term h = [ f ] is known as the hessian matrix . in ( 9 ) by neglecting h , the update conductivity vector reduces to ( 10)=[[f]t[f]]1jt[v ] . in general , using nrit method , the conductivity update vector expressed as in ( 10 ) can be represented for kth iteration ( where k is a positive integer ) as ( 11)k=[[jk]t[jk]]1[jk]t[vk ] , where [ vk ] and [ jk ] are the voltage mismatch matrix and jacobian matrix , respectively . the [ f]matrix in ( 11 ) is always ill conditioned [ 1924 ] , and hence small measurement errors will make the solution of ( 11 ) changes greatly . in order to make the system well posed , the regularization method [ 1926 ] is incorporated into the reconstruction algorithm by redefining the object function [ 1926 ] with regularization parameters as ( 12)sr=12||vmf||2 + 12||g||2 , where sr is the constrained least - square error of the regularized reconstructions , g is the regularization operator , and ( the positive scalar ) is called the regularization coefficient [ 1926 ] ( 13)sr=12(vmf)t(vmf)+12(g)t(g ) . differentiating the inject function in ( 12 ) with respect to the elemental conductivity : the following relations are obtained ( 14)sr=(f)t(vmf)+(g)t(g),(15)sr=(f)t(f)(f)t(vmf)+gtg . now , using gauss - newton- ( gn- ) method - based minimization process , the conductivity update vector [ ] is obtained as ( 16)=srsr=(f)t(vmf)(g)t(g)(f)t(f)(f)t(vmf)+gtg . neglecting the hessian matrix in ( 15 ) ( 17)=srsr=(f)t(vmf)(g)t(g)(f)t(f)+gtg . replacing f by j and gg by i ( identity matrix ) ( 21 ) reduces to ( 18)=jt(vmf)ijtj+i , where the matrix j = f is the jacobin as stated earlier . thus , the conductivity update vector ( [ ] ) is found as ( 19)=(jtj+i)1(jt(vmf)i ) . sometimes , the last term ( i ) is neglected , and the conductivity update vector [ ] is calculated as ( 20)=(jtj+i)1jt(vmf ) . in general , the eit image reconstruction algorithm provides a solution of the conductivity distribution of the dut for the kth iteration as ( 21)k+1=k+((jtj+i)1(jt(vmf)i))k . the eit algorithm starts with the solution of fp obtained from the eit governing equation , and the [ vc ] is calculated for a known current injection matrix [ c ] and an initial guess ( known or assumed ) conductivity matrix [ 0 ] . the voltage mismatch matrix [ v ] is estimated , and then it is used to calculate the conductivity update matrix [ ] using gn - mma and is added to the initial conductivity matrix ( [ o ] ) to update it to a new conductivity matrix [ 1 = o + ] using nrit . new update matrix [ 1 ] is used in forward solver to obtain a new calculated boundary data matrix [ vc1 ] which provides a new voltage mismatch matrix [ v1 ] . therefore , the nrit algorithms iteratively calculate the [ ] using gn - mma to find out an optimized [ ] matrix for which the [ v ] reaches its minimum value . thus , the eit reconstruction algorithm is found to work in the following sequences:(1)forward solver calculates the boundary potential matrix [ vc ] for a known current injection matrix [ c ] and an initial guess ( known ) conductivity matrix [ 0],(2)measured voltage data matrix [ vm ] is compared with [ vc ] to estimate the [ v ] as [ v = vc vm],(3)jacobian ( j ) is computed,(4)conductivity update vector [ ] is calculated by gauss - newton - based minimization algorithm,(5)[o ] matrix is updated to a new conductivity matrix [ 1 = o + ] by adding [ ] to [ ] using newton - raphson iteration technique ( nrit),(6)new update matrix [ 1 ] is used in forward solver to calculate the new voltage mismatch matrix [ v1],(7)check whether the [ v1 ] is minimum or not or compare the [ v ] with a specified error limit ( ) if provided,(8)stop the algorithm if v condition is achieved , otherwise repeat the steps 1 to 7 until the specified stopping criteria ( v ) is achieved . forward solver calculates the boundary potential matrix [ vc ] for a known current injection matrix [ c ] and an initial guess ( known ) conductivity matrix [ 0 ] , measured voltage data matrix [ vm ] is compared with [ vc ] to estimate the [ v ] as [ v = vc vm ] , jacobian ( j ) is computed , conductivity update vector [ ] is calculated by gauss - newton - based minimization algorithm , [ o ] matrix is updated to a new conductivity matrix [ 1 = o + ] by adding [ ] to [ ] using newton - raphson iteration technique ( nrit ) , new update matrix [ 1 ] is used in forward solver to calculate the new voltage mismatch matrix [ v1 ] , check whether the [ v1 ] is minimum or not or compare the [ v ] with a specified error limit ( ) if provided , stop the algorithm if v condition is achieved , otherwise repeat the steps 1 to 7 until the specified stopping criteria ( v ) is achieved . a two - dimensional boundary data simulator ( bds ) is developed in matlab r2010a using finite element method ( fem ) to generate accurate boundary data for studying the eit reconstruction algorithms . the matlab - based bds is developed as an absolute 2d data simulator for eit image reconstruction studies , and it is used suitably to generate the errorless 2d boundary data to study and modify the inverse solver of a 2d eit system . as bds is developed in a computer software , it is found free from errors produced by the eit instrumentation and phantom . bds also allows us to generate boundary potential data for different type of phantom geometry , inhomogeneity geometry ( shape , size , and position ) , inhomogeneity conductivity profiles , and background conductivity profiles . moreover , it is developed as a compact , absolutely stable , and easy to use and handle for eit studies . it is developed in such a way that it can be modified for further modifications . bds is developed with matlab - based computer program consisting of four - part imaging domain simulator ( ids ) , eit model developer ( emd ) , current injection simulator ( cis ) , and boundary data calculator ( bdc ) . imaging domain simulator ( ids ) in bds simulates a domain with inhomogeneity with their corresponding conductivity distributions . eit model developer ( emd ) derives a mathematical model of the forward solver by applying fem on the governing equation of the dut in the form of a matrix equation . current injection simulator ( cis ) simulates a constant current injection through the definite points at the domain boundary with neighbouring current injection protocol [ 1 , 2 , 2830 ] . the boundary data calculator ( bdc ) solves the governing equation by solving the forward model and calculates the potentials at all electrodes at the domain boundary . imaging domain simulator ( ids ) first defines a dut with a desired area ( ad ) defined by a required diameter and defined with a particular coordinate system . imaging domain simulator applies the fem to discretize the domain with a 2d finite element mesh containing finite element of triangular elements ( t ) and finite number of nodes ( n ) . in ids , a circular domain ( ) to be imaged is defined with a required radius ( rp ) using the cartesian coordinate system ( figure 1(a ) ) , and the domain is discretized with a finite element ( fe ) mesh ( figure 1(b ) ) . the mesh is symmetrically composed of the first - order triangular elements with linear shape functions [ 18 , 31 ] . the fe mesh is generated with the pdetool of matlab r2010a in such a way that it can be refined further to increase the number of elements as per the requirement . all the coordinates and parameters assigned to the finite elements and the nodes are stored in corresponding matrices . boundary nodes are identified , and the sixteen nodes among the boundary nodes are assigned as the electrodes called the electrode nodes . inside the domain one ( or more ) smaller region ( regions ) is ( are ) defined as the inhomogeneity ( inhomogeneities ) positioned at a particular place . the center point ( p ) of the inhomogeneity with the required shape and size is positioned inside the phantom domain by defining its center with a polar coordinate ( r , ) as shown in figure 1(a ) . single or multiple inhomogeneities are defined with their desired areas ( ai ) inside the dut , and elements within the inhomogeneity and the background are identified . the background area is defined as the area of the domain surrounding the inhomogeneity ( ab = ad ai ) , and the elements within the background area ( ab ) are identified . the elements within the inhomogeneity are assigned with a particular conductivity called inhomogeneity conductivity , ( i ) while the rest of the elements are assigned with a different conductivity called background conductivity ( b ) as shown in figure 1(b ) . the assigned conductivity values of all the elements are assumed to be featured at their corresponding centroids . eit model developer ( emd ) develops the mathematical model of the forward solver by applying fem on the governing equation and derive the forward model of a dut in the form of a matrix equation ( 3 ) using the elemental conductivities and nodal coordinates . the emd establishes a relationship between the current injection matrix , [ c ] ( matrix of the applied signal ) , and the nodal potential matrix , [ ] ( matrix of the developed signal ) , through the transformation matrix [ k( ) ] which is mathematically represented by ( 3 ) . the global stiffness matrix [ k( ) ] in eit is actually an admittance matrix that is formed using the nodal coordinates of all the elements with their corresponding conductivities . thus , the [ k( ) ] inforward model represents the transfer function of the eit system obtained from the governing equation by fem formulation . the current injection simulator ( cis ) is used to simulate a constant current injection through the sixteen nodes called simulated electrodes ( se ) on the domain boundary with neighbouring current injection protocol . the cis works in a for loop to execute all the projections [ 1 , 28 , 30 , 32 ] of current injection process . in bds , a constant current injection is simulated into the dut surrounded by the sixteen simulated current electrodes ( sei ) with all the possible combination of sei pairs , and the potential data are calculated on all the electrodes called voltage electrodes ( sev ) in bdc . the current injection through a particular current electrode pair ( say sei1 and sei2 ) and corresponding voltage data collection from all the possible voltage electrodes ( sev1 , sev2 , sev3 , sev4 , sev15 , sev16 , sev7 , sev8 , sev9 , sev10 , sev11 , sev12 , sev13 , sev14 , sev15 and sev16 ) is known as a simulated current projection ( scp ) . hence , in an n - electrode eit system , there will be n - different current projections each of which will inject current through a particular current electrode pair and collect m voltage ( differential / grounded ) data where m may be either equal to n or less than n depending on the eit data collection strategy called the current pattern [ 1 , 28 , 30 , 32 ] . therefore , a complete scan ( containing all the current projections ) conducted on the dut yields n m voltage data . as the bds is studied for sixteen electrode system , the cis runs for sixteen times and provides sixteen current projections ( scpv1 , scpv2 , scpv3 , scpv4 , scpv15 , scpv16 , scpv7 , scpv8 , scpv9 , scpv10 , scpv11 , scpv12 , scpv13 , scpv14 , scpv15 , and scpv16 ) . therefore , a complete data collection procedure ( called a complete scan ) in the bds collects m voltage data from the voltage electrodes or voltage electrode pairs in all the sixteen current projections and computes 16 m voltage data . boundary data calculator ( bdc ) calculates the potentials ( developed for a constant current injection by cis ) at all electrode points ( electrode nodes ) at the domain boundary in each current projection for a particular current pattern . the current injection matrix is formed in cis using the neumann type boundary conditions , and the potential matrix is calculated from ( 3 ) using the matrix inversion technique working on l - u factorization process . the bds is developed to run in an another for loop for m times to calculate the m electrode potentials from voltage electrodes or voltage electrode pairs at each of the steps of the loop . this second for loop runs within the first for loop for m times and collects m voltage data for each step of first for loop and hence collects 16 m voltage data as first for loop runs for sixteen times . moreover , as the eit reconstruction process needs a complete scan , the bds runs in each current projection and computes sixteen electrode potentials at each projection . the domain potential is calculated from the forward model ( 3 ) , and the potential values of all the nodes are stored in a nodal potential matrix [ 33 , 34 ] denoted by [ mnp ] . boundary potential data are separated from [ mnp ] and stored in a different matrix called boundary potential matrix [ mbp ] . the electrode potential data are extracted from the nodal potential matrix [ mnp ] and are stored in a separate matrix called electrode potential matrix [ mep ] . in sixteen electrode eit system , the [ mep ] is formed as a column matrix and contains the 16 m electrode potentials ( differential or grounded ) obtained for all the projections . in neighbouring or adjacent current injection method , first reported by brown and segar , the current is applied through two neighbouring or adjacent electrodes , and the differential voltages is measured successively from all other adjacent electrode pairs excluding the pairs containing one or both of the current electrodes . for a sixteen electrode eit system with domain under test surrounded by equally spaced sixteen electrodes ( e1 , e2 , e3 , e4 , e5 , e6 , e7 , e8 , e9 , e10 , e11 , e12 , e13 , e14 , e15 , and e16 ) , the neighbouring method injects current through the current electrode pairs for sixteen current projections ( figure 2 ) , and the differential voltages are measured across the voltage electrode pairs using four electrode method in each projection . as shown in figure 2(a ) in the first current projection ( p1 ) of adjacent method , the current is injected through electrode 1 ( e1 ) and electrode 2 ( e2 ) , and the thirteen differential voltage data ( v1 , v2 , v3 , , v13 ) are measured successively between the thirteen electrode pairs e3-e4 , e4-e5 , , and e15-e16 , respectively ( figure 2(a ) ) . as reported by brown and segar , in neighbouring current injection method , the current density within the dut is found highest between the current electrodes ( e1 and e2 for p1 ) ; the current density then decreases rapidly as a function of distance . similarly , in current projection 2 ( p2 ) , the current signal is injected through electrodes 2 ( e2 ) and 3 ( e3 ) , and an another set of thirteen differential voltage data ( v1 , v2 , v3 , , v13 ) are collected between the thirteen electrode pairs e4-e5 , e5-e6 , , e16-e1 , and so on . lastly , in the current projection 16 ( p16 ) , the last set of thirteen differential voltage data ( v1 , v2 , v3 , , v13 ) are collected between the thirteen - electrode pairs e2-e3 , e3-e4 , , and e14-e15 by injecting the current through the electrodes e16 and e1 . thus , the neighbouring current injection method in a sixteen electrode eit system data collection procedure consists of sixteen current projections ( p1 , p2 , p3 , , p15 , and p16 ) , and each of the current projection yields thirteen differential voltage data ( v1 , v2 , v3 , , v13 ) . therefore , a complete data collection scan with the neighbouring current injection method in a sixteen electrode eit system yields 16 13 = 208 voltage measurements . though in neighbouring method , eit boundary data are not collected across the electrode pairs containing one or two current electrode for contact impedance problem , but sometimes it is advantageous to collect the boundary data from all the electrodes including the current electrodes to obtain the greatest sensitivity to the resistivity changes in the domain as reported by cheng et al . . in the present study , the boundary potentials are calculated at all the electrodes ( figure 2(b ) ) with respect to a virtual ground point selected within the dut . hence , in a complete data collection scan , the potentials on all the electrodes are collected in all the sixteen current projection and are stored in [ mep ] . therefore , the [ mep ] is found as a column matrix containing 16 16 voltage data all collected with respect to the virtual ground point of the dut . hence , in the present study , with neighbouring current injection method , the [ mep ] is found as a 256 1 matrix containing 256 electrode potentials . in the present study , 1 ma current injection is simulated through the electrodes of the simulated domain containing sixteen nodal electrodes using adjacent or neighboring current injection protocol ( figure 2(b ) ) . the potentials on all the sixteen electrodes are calculated using boundary data calculator ( bdc ) for all the current projections , and the electrode potential matrix [ mep ] is used as the calculate boundary potential matrix [ vc ] to reconstruct the conductivity distribution of dut . the bds is designed in such a way that a huge number of voltage data sets can be generated using different types of phantoms with their different design parameters . boundary potential data [ vc ] are generated for different type of phantom configurations , and the boundary data have been tested with electrical impedance tomography and diffuse optical tomography reconstruction software ( eidors ) [ 37 , 38 ] for 2d - eit . a large number of data sets are generated by changing the values of one or more phantom parameters like : phantom diameter ( d = 2rp ) , inhomogeneity radius ( ri ) , inhomogeneity geometry ( shape , size , and position ) , inhomogeneity number ( ni ) , bathing solution conductivity ( b ) , and inhomogeneity conductivity ( i ) . 1 ma current injection is simulated to the domain boundary , and data generation in bds and image reconstruction in eidors are studied for different inhomogeneity geometries in dut . reconstruction is also studied for different iterations and for multiple inhomogeneity reconstruction to evaluate the bds . image reconstruction quality in eit depends on the boundary data accuracy which is dependent on the geometric accuracy of the inhomogeneity developed in bds . dimensional accuracy of the inhomogeneity depends on the number of finite elements in the fe mesh or mesh refinement number ( nmr ) as shown in figure 3 . as the nmr increases , the number of elements in the fe mesh is increased , and hence the geometric accuracy of the inhomogeneity increases which gives more accurate boundary data and better image reconstruction ( figure 3 ) . but the bds with a highly refined mesh needs a high pc memory and large computation time . in this paper , the mesh refinement is found suitable as nmr = 4 as per the configuration of the pc ( 2.4 ghz/1.5 gbram/ p - iv ) used . it is observed that the fe mesh with nmr = 4 ( containing 2048 elements and 1089 nodes ) gives almost an accurate geometry ( figure 3 ) to the desired inhomogeneity and generates a reconstructible data set in less than 10 seconds . eidors reconstructs the resistivity images from the bds data sets using regularized image reconstruction technique . results show that the resistivity or conductivity can be successfully reconstructed from the boundary data generated by our bds using a circular domain ( rp = 75 mm ) with a circular inhomogeneity ( r = 37.5 mm , ri = 25 mm , = 45 , i = 0.005 s / m , and b = 0.21 s / m ) in the 9th iteration ( figure 4 ) . it is also observed that the reconstructed shape of the inhomogeneity is similar to that of the original one ( figure 4(a ) ) , and the reconstructed conductivity profile in figure 4(b ) is almost similar to that of the original object in figure 4(a ) . iteration studies shows that in different reconstruction steps called iterations ( figure 5 ) , the reconstructed images become more localized from iteration to iteration and the reconstruction errors ( appeared by the red color at phantom periphery ) are gradually reduced ( figure 5 ) . it is observed that the resistivity is successfully reconstructed from the boundary data in the 9th iteration ( figures 5(i ) and 5(j ) ) , though the shape of all the reconstructed images in 9th12th iterations is almost similar to that of the original one ( shown by dotted circles in figure 5 ) . as the reconstructed resistivity profile similar to that of the original is obtained only in the 9th iteration , the 9th iteration is taken as the optimum reconstruction . in 13th and 14th the optimum iteration number depends on the data accuracy and reconstruction algorithm , and hence the bds can be used to generate the boundary data sets required for assessing the inverse solver in eit . voltage data are also generated for a domain ( rp = 75 mm ) with the circular inhomogeneities ( ri = 25 mm , i = 0.005 , s / m , and b = 0.21 s / m ) positioned at different places using the bds ( figure 6 ) . it is observed that the reconstructed image is more circular for an inhomogeneity positioned at the phantom centre where r = 0 and = 0 ( figure 6(a ) ) . on the other hand , for r 0 , that is , for the inhomogeneities near domain boundary ( figure 6(b ) ) , reconstructed images are not perfectly circular because of the comparatively less accurate shape of the original object obtained for r 0 . for a less number of mesh refinements , the geometry of the original side objects is not exactly circular itself ( figure 4 ) , and hence the corresponding boundary data have lower accuracy . an fe mesh with large nmr can easily produce an accurate geometry for the boundary objects ( objects near domain boundary ) with proper shape , which gives a boundary data without geometric error and automatically improves the image shape . boundary data sets are also generated with a circular domain ( rp = 75 mm and b = 0.21 s / m ) with a circular inhomogeneity ( i = 0.005 s / m ) with different diameters ( 2ri ) and all positioned at the phantom center ( r = 0 ) . results show that for the domain discretized with nmr = 4 , the data sets , generated with a diameter larger than 13.3% of the phantom diameter , are accurate enough ( figures 7(a)7(f ) ) to reconstruct the resistivity images in eidors-2d . it is clearly observed that for nmr = 4 , the triangular elements within the inhomogeneity with smaller ri are unable to shape themselves into a proper circle ( figure 7(g ) ) . hence , the data obtained for the inhomogeneity with a diameter of 20 mm has low accuracy ( figure 7(g ) ) , and hence the resistivity image ( figure 7(h ) ) is found with low resolution showed and some reconstruction error ( appeared in the red color at phantom periphery ) . increasing the fe elements in bds , the boundary data error can be minimized , and the improved resistivity image can be achieved even for smaller inhomogeneities with a diameter less than 13.3% of rp . boundary potential data are also generated for domains ( rp = 75 mm ) containing multiple circular inhomogeneities ( ri = 25 mm , r = 37.5 mm , i = 0.005 s / m , and b = 0.21 s / m ) placed at different positions inside the domain ( figure 8) . figure 8(a ) shows a domain with two circular inhomogeneities ( 180 apart from each other ) which are placed at a central distance ( r ) of 37.5 mm . similarly , another domain with three circular inhomogeneities ( 120 apart from each other ) placed inside the phantom domain is shown in figure 8(c ) . all the inhomogeneities in both the domains are positioned at a central distance ( r ) of 37.5 mm . 1 ma current is simulated with the neighbouring current pattern , and the boundary data are collected for resistivity reconstruction . it is noticed that the resistivity images ( figures 8(b ) and 8(d ) ) of inhomogeneities in both the domains are reconstructed successfully . results show that the boundary data simulator can be efficiently used to generate boundary potential data for a huge number of phantom configurations in less than 10 seconds . bds is software - based virtual eit phantom , and hence it has a number of advantages over the practical and mesh phantoms . the literatures [ 3941 ] presenting the phantom simulations are limited , and they only discuss the software phantoms developed for their own systems . bds is a software - based versatile boundary data simulator which generates boundary data suitable for studying the reconstruction algorithm required for several eit systems , and hence it is better suited for assessing the performance of the inverse solver of 2d electrical impedance tomography . a matlab boundary data simulator ( bds ) is developed for studying the resistivity reconstruction in inverse solvers of 2d - eit . bds is developed with four parts : imaging domain simulator ( ids ) , eit model developer ( emd ) , current injection simulator ( cis ) , and boundary data calculator ( bdc ) . imaging domain simulator ( ids ) simulates a domain with single or multiple inhomogeneities of different geometries defined with their corresponding conductivity distributions , whereas the eit model developer ( emd ) derives a forward model using fem to solve the governing equation of the dut . current injection simulator ( cis ) simulates a constant current injection through the simulated electrodes positioned at the domain boundary with the neighbouring current injection protocol . the boundary data calculator ( bdc ) solves the forward model to solve the governing equation and calculates the potentials at all the simulated electrodes . boundary data are generated with different type of domains simulated in bds by changing its input parameters . resistivity images are reconstructed from the boundary data using standard eit reconstruction software called eidors , and the bds is evaluated . it is observed that the bds with fe mesh with 2048 elements can simulate an inhomogeneity of desired geometry with suitable accuracy . the bds with 2048 elements suitably generates the boundary data for simulated domains containing the objects with different geometries which are found efficient for image reconstruction in eidors . results also show that the conductivity or resistivity profiles of the domains simulated in bds are successfully reconstructed from their corresponding boundary data generated for different type of single and multiple inhomogeneities . by changing the inhomogeneity position , diameter , and number in bds , multiple inhomogeneity imaging shows that the bds suitably generates boundary data with the desired accuracy , and the boundary data are found efficient for resistivity reconstruction in eidors . results also show that for the simulated domains discretized with nmr = 4 , the boundary data sets generated for circular inhomogeneity with a diameter larger than 13.3% of the phantom diameter are accurate enough to reconstruct the resistivity images in eidors . increasing the fe elements in bds , the boundary data error can further be minimized , and the improved resistivity image reconstruction can be obtained even for smaller inhomogeneities . hence , it is concluded that the bds generated a number of boundary data sets which can suitably be used for inverse solver assessment in eit .

phantoms are essentially required to generate boundary data for studying the inverse solver performance in electrical impedance tomography ( eit ) . a matlab - based boundary data simulator ( bds ) is developed to generate accurate boundary data using neighbouring current pattern for assessing the eit inverse solvers . domain diameter , inhomogeneity number , inhomogeneity geometry ( shape , size , and position ) , background conductivity , and inhomogeneity conductivity are all set as bds input variables . different sets of boundary data are generated by changing the input variables of the bds , and resistivity images are reconstructed using electrical impedance tomography and diffuse optical tomography reconstruction software ( eidors ) . results show that the bds generates accurate boundary data for different types of single or multiple objects which are efficient enough to reconstruct the resistivity images for assessing the inverse solver . it is noticed that for the bds with 2048 elements , the boundary data for all inhomogeneities with a diameter larger than 13.3% of that of the phantom are accurate enough to reconstruct the resistivity images in eidors-2d . by comparing the reconstructed image with an original geometry made in bds , it would be easier to study the inverse solver performance and the origin of the boundary data error can be identified .

in accordance with the 1997 documents of the world health organization ( who ) , amoebiasis is the infection by the protozoan parasite entamoeba histolytica with or without clinical manifestations . the only known natural host of e. histolytica is the human body with the large intestine as the major target organ . this parasite has a very simple life cycle in which the infective form is the cyst that is considered a resistant form of the parasite . the asymptomatic cyst passers and the intestinal amoebiasis patients are the natural transmitters ; they excrete cysts in their feces , which can contaminate food and water sources . the cysts are round structures around 1016 m in diameter . however , estimation of cyst diameter in entamoeba spp . in the old and recent literature the cyst has four visible nuclei when mature and only one when immature , and the nuclei are spherical with a membrane displaying small chromatin granules and a central karyosome . when in excystation , each cyst produces eight vegetative forms or trophozoites , which are the motile form of the parasite ; they are 2040 m in diameter . life cycle and the relevant structures of both forms of parasite are shown in figure 1 . cysts are resistant to desiccation in soil and can survive in humid environments and in water for several weeks . susceptible hosts exposed to the aforementioned infection sources ingest the cysts , which then undergo excystation during their pass through the gastrointestinal tract . amoebiasis is also considered a sexually transmitted disease , particularly in sexual relationships between men and in individuals with sexual anilingus practices . clinical and etiological diagnosis of intestinal and extra - intestinal amoebiasis is neither easy or simple in part because of the discovery of two species made from the previously known e. histolytica species , both indistinguishable under microscopy . e. histolytica sensu stricto is the potentially pathogenic species and e. dispar the commensal non - pathogenic entamoeba . d ) trophozoites of e. histolytica species with phagocyted erythrocytes ( dic 40 ) knowledge of both species with different pathogenic phenotypes comes from a large scientific debate during the second half of the twentieth century , which gave rise to the rapid development of diagnosis technology based on molecular and immunological strategies.[59 ] during the last 10 years , knowledge of the new epidemiology of amoebiasis in different geographic endemic and non - endemic areas has been obtained through the application of mostly molecular techniques.[1014 ] moreover , these molecular epidemiology studies have unveiled the extraordinary genetic variability[1315 ] of e. histolytica and e. dispar , allowing the discovery of other entamoeba species , such as e. moshkowskii , which can also infect the human intestine with a significant frequency . however , much of the epidemiology and its contribution to morbidity of entamoeba infections remain unknown . there are excellent recent reviews on the molecular epidemiology and intestinal and extra - intestinal characteristics of amoebiasis in the human host that can be consulted . nevertheless , the major purpose of the present work is to highlight the novelties in regard to human infection and the disease that can help the general physician from both endemic and non - endemic countries in their medical practice . this is especially critical given that emigration is undoubtedly a global phenomenon that is modifying the previous geography of infectious diseases worldwide . the speciation of entamoeba protozoa has been discussed since 1925 when emile brumpt proposed the existence of two distinct species that could infiltrate the human intestine : one associated with symptoms of diarrhea with or without dysentery and the other excreted with feces from asymptomatic individuals . while years of scientific discussions have left brump 's theory behind , no molecular technology prior to the 1990s allowed clear differentiation of the currently known e. histolytica and e. dispar species in terms of pathogenic or non - pathogenic phenotypes . both species are genetically diverse and this variability allowed for the beginning of studies on molecular epidemiology in different endemic areas . the new data on the epidemiology of amoebiasis based on frontier technology suggests that genetic variability could be an important tool in the study of geographic distribution of both species and particular strains of entamoeba , which may determine the morbidity rates of different forms of amoebic infection in different geographic areas . some e. histolytica genetic variants ( strains ) have been isolated from asymptomatic cyst passers , patients with invasive intestinal amoebiasis or from samples of amoebic liver abscess material . however , e. dispar has been mainly isolated in feces samples resulting from asymptomatic cyst passers and displays high genetic polymorphisms , even more than the e. histolytica species . we recently have obtained evidence that in at least two endemic countries ( brazil and mexico ) , e. dispar genetic variants have been detected in patients with invasive amoebiasis . in brazil , the icb - ado e. dispar strain was isolated from a non - dysenteric colitis patient maintained in culture with his own intestinal flora displaying a pathogenic behavior in experimental models of amoebic liver abscess . dna extracted from hepatic abscess material obtained from six patients in mexico also clearly showed the presence of e. dispar dna sequences . the third species of entamoeba , e. moshkowskii , has been considered a free - living organism since 1940s in contrast to e. histolytica and e. dispar , with a geographic distribution mainly in developing countries . e. moshkowskii has been frequently detected in individuals from developed and highly industrialized countries . particularly in regard to this species we are at the beginning of the study of its pathogenic potential and the context in which it is expressed and the epidemiologic significance of infection and its contribution to morbidity rates of diarrheic diseases . what doses of cysts are necessary for colonization of large bowel mucosa ? for the three entamoeba species this is not known with any certainty . moreover , we do not know which environmental characteristics are permissive for intestinal colonization , and this could be an interesting field for future research . finally , until today , the only species recognized as an etiologic agent of amoebic invasive disease is e. histolytica , which , once in the colon , undergoes excystation and the generation of trophozoites . trophozoites multiply by binary fusion and some of them may encyst and be excreted with stools . cyst viability under appropriate conditions of humidity may last as long as several weeks and thus they be available for a new susceptible host . we have to stress that more than 90% of infections have an asymptomatic course and are frequently auto - limited at different periods of time . after intestinal infection there is no evidence of induction of a long - lasting protective immune response , and in endemic areas , individuals may have several periods during the year of re - infection and clearance of infection . in relation to the susceptibility of hiv and aids patients to the invasive forms of infection , contradictory evidence exists ; however , morbidity seems to be more related to the particular prevalence of the e. histolytica strain with invasive phenotypes than to the specific immunological status of the patient.[2427 ] as for the invasive behavior of e. histolytica , some authors consider this trait not to be typical . on the contrary the natural history of invasive intestinal amoebiasis is an acute event , characterized by the presence of diarrhea that occurs days or weeks after exposure in our personal experience lasting no more than four to five weeks . although there are reports of occurrence years after exposure , in this case we presume the cause and effect relationship is extremely difficult to corroborate . intestinal amoebiasis is basically an acute disease in which the most frequent symptoms are abdominal pain ( colic ) and the presence of diarrhea with mucus and/or blood , or a clear dysenteric syndrome . however , fever and other systemic symptoms are infrequent . severe forms of invasive amoebiasis can be observed in young children ( < 5 years ) , pregnant woman , the elderly , and particular those with chronic diseases , such as diabetes mellitus , and in individuals being treated with immunosuppressants or those with immunodeficiency disorders . those severe forms of amoebiasis are colon ameboma , fulminant necrotizing colitis , and toxic mega colon . the appearance of symptoms , such as severe dysentery and pain with signs of peritoneal irritation ( rebound ) , intense tenesmus , fever ( > 38c ) , tachycardia , hypertension , nausea , and anorexia are suggestive of the previously mentioned severe forms of intestinal amoebiasis . the mortality rates of dysenteric syndrome due to e. histolytica are less than 1% , but mortality due to complications increases up to 75%.[2931 ] fortunately in the last few decades such complications are uncommon . the intestinal amoebiasis form known as chronic non - dysenteric colitis is the most frequent form of amoebiasis in people of all ages , characterized by non - specific symptoms . symptoms more relevant in this instance are periods of abdominal pain ( colic ) and auto - limited episodes of diarrhea alternating with constipation . however , both non - dysenteric amoebic colitis and irritable bowel syndrome are controversial themes in the clinical practice . where endoscopy examination is available , colonoscopy can be of great help in clinical diagnosis of invasive intestinal amoebiasis . this procedure allows for microscopic examination of samples taken directly from the characteristic flask - shaped ulcer produced by e. histolytica and from other sites of mucosal lesions . microscopic observations of this type of material are described in the diagnostics section and in figure 2 . on the other hand , colonoscopy detects the presence of lesions related to the mentioned severe forms of intestinal amoebiasis and allows for differential diagnosis of other pathologies , such as inflammatory bowel disease or colon carcinoma . d ) intestinal biopsy obtained from the edge of flask - shaped ulcer where large numbers of trophozoites ( he and pas stained , 60 ) are clearly visible . e ) biopsy obtained from the edge of amoebic liver abscess ( he and pas stained , 20 ) . notice the presence of trophozoites , hepatocytes , and the large number of inflammatory cells . what circumstances define the extra - intestinal invasive behavior of some e. histolytica strains ? this remains unknown today . for example , we do not know the frequency of extra - intestinal invasion after intestinal colonization with virulent e. histolytica . however , this seems to be an infrequent event as suggested by the low morbidity rates of amoebic liver abscess and other extra - intestinal forms of invasive amoebiasis compared with the prevalence rates of asymptomatic infections and intestinal disease . while amoebic liver abscess is a disease that can affect individuals of all ages , in some endemic areas the incidence rates are higher in both children under 5 years and young adults ( 2045 years ) . males are also more prone to developing amoebic hepatic abscess than females ( 1 female for 46 males ) . after exposure , 80% of patients display symptoms over a few days to 46 weeks . the most common symptoms suggestive of amoebic liver abscess are fever ( 38c ) , chills and diaphoresis , anorexia and abdominal pain in the right upper quadrant that increases during inspiration . pain also frequently radiates to shoulder and back . nausea has also been referenced but diarrhea is only occasionally mentioned ( 50% of cases ) . hepatomegaly can be detected during digital percussion of the hepatic area and is always related to the dimensions of the abscess ; patients can also display peritoneal signs ( abdominal guarding or rebound ) . absence of intestinal noises , jaundice , and pleural or pericardial rub are symptoms that should elicit alarm related to the rupture or imminence of rupture of the hepatic abscess . in general , the right hepatic lobule is the most frequently affected due to the portal circulatory system of the right colon . laboratory findings suggestive of amoebic liver abscess are the presence of leukocytosis , neutrophilia , increased globular sedimentation velocity , and high levels of alkaline phosphatase . thoracic x - ray data useful in the diagnosis of amoebic abscesses , as well as other types of hepatic abscesses , include elevation of the right hemidiaphragm , atelectasis , or pleural effusion [ figure 3a ] . ultrasound is the gold standard technique for diagnosis of amoebic liver abscess , as its positive predictive value ( ppv ) is around 95% ( 85100% depending on analyzed series ) . although contrast computed tomography ( ct scan ) [ figures 3d and 3e ] have a ppv up to 95% due to a higher definition capacity , ultrasound is considerably less expensive compared to ct scan technology , which is of tremendous importance to countries with limited medical and economic resources . ultrasound reveals hypoechoic areas that can be single or multiple with round edges [ figure 3b and 3c ] . several authors have mentioned the presence of a large single abscess as a frequent characteristic of a amoebic liver abscess . however , this characteristic is not a sine qua non of amoebic abscesses , and in our medical practice we have seen multiple abscesses more frequently than we had first assumed . early lesions due to amoebic invasion of hepatic parenchyma are multifocal in nature ( micro - abscesses ) as a consequence of tissue destruction and necrosis by proteases from e. histolytica and neutrophil recruitment to the site of infection . the advantage of ct scans and magnetic resonance is detection of small abscesses and the high definition of the images . moreover , other techniques not always available in endemic countries ( e.g. gallium scans ) can help differentiate between amoebic ( cold images ) and pyogenic abscesses ( hot images ) . thus , the difference is based on the absence ( amoebic ) or presence ( pyogenic ) of white blood cells in the abscess . additionally , we have to mention that in endemic countries the frequency of mixed abscesses ( pyogenic and amoebic ) is considerable ; in our practice this frequency is approximately 17% ( non - reported data ) . another important fact in medical practice is the coincidence of previous symptoms with the presence of high levels of serum anti - amoebic antibodies more than 90% of amoebic liver abscess patients develop this type of antibody response . however , in cases of fast development of amoebic abscess these antibodies may not be present . a ) thoracic x - ray of a patient with amoebic liver abscess showing the elevation of the right hemi - diaphragm . ultrasound images of : b ) single large amoebic abscess and c ) three amoebic hepatic abscesses . d ) contrasted computed tomography ( ct ) scan of a single abscess and e ) three clear amoebic liver abscesses etiological diagnosis of intestinal parasitic diseases has been mainly performed using direct or concentration techniques for microscopic examination of fecal specimens . while technically simple in approach , these techniques require the expertise of highly qualified technicians in the morphological identification of ova , cysts , and helminths to be feasible , and the sensitivity and specificity is no more than 80% . while this technique can not differentiate between the three entamoeba species already mentioned , in some endemic communities this is the only diagnostic technology available . on the other hand , during the last 10 years diagnostics in amoebiasis have changed dramatically , considerably improving sensitivity and specificity . some of the current techniques are based on immunological strategies , such as elisa and different modalities of polymerase chain reaction ( pcr ) , with clear advantages in bedside diagnosis and in clinical laboratories of health institutions . even though some of these diagnosis procedures are also suitable for large epidemiologic trials , it is mandatory to make a careful selection of the diagnosis test when the test has to be applied in the field . in particular , the election has to be directed to those procedures that do not need special conditions for sample preservation or pretreatment of specimens in the working field . in our experience , immunologically based diagnostics tests for detection of anti - amoebic secretory antibodies in feces or detection of intestinal amoebic antigens through polyclonal or monoclonal specific antibodies ( elisa ) are excellent tests in hospitals where fresh specimens ( feces ) can be obtained . results are reproducible and reliable . in contrast , in epidemiological trials , these techniques can be biased when samples are more than 18 hours old . tables 1 and 2 have a list of diagnostic tests that have proven to be useful in clinical and laboratory diagnosis of intestinal and extra - intestinal amoebiasis in first and second level health institutions . microscopy and immunoassays for e. histolytica detection pcr assays for e. histolytica and/or e. dispar detection the who / paho recommendations published in 1997 contain in detail the actions that who country members have to observe with regard to e. histolytica species infection . they highlight the characterization ( when possible ) of e. histolytica and e. dispar ( we now add e. moshkowskii ) to be treated properly . in accordance with the who recommendation only e. histolytica it is also important to remember that in some endemic countries , mixed infections ( e.g. e. histolytica and e. dispar ) are frequent , and that only those infected with e. dispar should be excluded for anti - amoebic treatment . table 3 shows treatment schedules that have proven to be highly effective in both intestinal and extra - intestinal invasive amoebiasis . in cases of large amoebic abscesses in which imminence of rupture or distances of less than 1 cm between the abscess wall and liver surface prevail , ultrasound - guided puncture is indicated . the procedure allows for the establishment of a differential diagnosis with other liver pathologies , especially pyogenic liver abscess , which is common in clinical practice . treatment of amoebiasis disease in our experience , patients with amoebic liver abscess may not excrete e. histolytica / e . however , some of these patients are asymptomatic cyst passers after treatment with systemic anti - amoebic drugs , such as metronidazole . in such cases , treatment has to include luminal anti - amoebic drugs . at present , evidence of low susceptibility or resistant strains of either e. histolytica or e. dispar species to metronidazole gastrointestinal infections are responsible for morbidity and mortality rates of children and young adults worldwide . in africa , diarrhea is responsible for 2575% of all childhood illnesses . infection and intestinal diseases with icd10 code a00-a09 are the second cause of disease in children under 10 years old in mexico , and intestinal amoebiasis ranks with some annual variations 5 and 6 in the list of the 20 major causes of disease in mexico ( http://www.dgepi.salud.gob.mx/anuario/index.html # ) . causes of diarrhea in endemic areas include a large variety of enteropathogens ( viruses , bacteria , and parasites ) . in mexico , parasitic intestinal infections are multiple infections that constitute approximately 40% of analyzed individuals in which it is possible to detect more than one pathogen together with commensal parasites that are an indicator of fecalism . prevalence of parasitic infection in three different communities in the state of morelos , mexico , are shown in table 4 , one of which is a strictly rural population ( amacuzac ) and two ( tlaltizapan and xoxocotla ) are suburban communities . the relevance of these results lies in the high frequency of mixed parasitic infections detected in the studied populations . a remarkable low prevalence of soil - transmitted helminthiasis was also observed and could be the consequence of a biannual anti - parasitic treatment of school children with albendazole . this policy was implemented by the health ministry since the 1990s . however , there are emerging parasites with an increasing prevalence in the last 10 years , including blastocystis hominis and in some areas cryptosporidium spp . in south africa intestinal mixed infection is present in 46% of patients with diarrhea and 33% in school children . furthermore , mixed intestinal infections due to bacteria , parasites , and viral pathogens are the major forms of intestinal infection in developing countries . however , cheun et al recently published a splendid study on diarrheal patients in hospitals in korea . the study documented the presence of enteropathogenic bacteria , parasites , and viruses in mixed infections , and highlighted the importance of diarrheal disease associated with protozoan infections . the major association of e. histolytica positive samples was with rotavirus type 1[10.3(6.114.6 ) positivity/100 infected individuals , 95% ci ] , astrovirus [ 9.3(5.213.4 ) positivity/100 infected individuals , 95% ci ] , pathogenic escherichia coli [ 7.2 ( 3610.0 ) positivity/100 infected individuals , 95% ci ] and clostridium perfringens [ 10.3(6.014.6 ) positivity/100 infected individuals , 95% ci ] . as the authors mentioned , the question is whether mixed infections with protozoa are more likely to induce serious diarrhea . prevalence rates of parasite intestinal infections in morelos , mexico efforts in the near future have to be directed on studies focusing the interactions of microorganism in the intestinal environment . this knowledge will have a positive impact in clinical and laboratory diagnosis of diarrheic syndrome , its treatment , and thereafter the implementation of more reliable control schedules .

in accordance with the 1997 documents of the world health organization ( who ) , amoebiasis is defined as the infection by the protozoan parasite entamoeba histolytica with or without clinical manifestations . the only known natural host of e. histolytica is the human with the large intestine as major target organ . this parasite has a very simple life cycle in which the infective form is the cyst , considered a resistant form of parasite : the asymptomatic cyst passers and the intestinal amoebiasis patients are the transmitters ; they excrete cysts in their feces , which can contaminate food and water sources . e. histolytica sensu stricto is the potentially pathogenic species and e. dispar is a commensal non - pathogenic entamoeba . both species are biochemical , immunological and genetically distinct . the knowledge of both species with different pathogenic phenotypes comes from a large scientific debate during the second half of the 20th century , which gave place to the rapid development of diagnostics technology based on molecular and immunological strategies . during the last ten years , knowledge of the new epidemiology of amoebiasis in different geographic endemic and non - endemic areas has been obtained by applying mostly molecular techniques . in the present work we highlight novelties on human infection and the disease that can help the general physician from both endemic and non - endemic countries in their medical practice , particularly , now that emigration is undoubtedly a global phenomenon that is modifying the previous geography of infectious diseases worldwide .

leishmania parasites are obligatory intracellular protozoa living in macrophages of humans and many other vertebrates . l. major is one of the main causes of the cutaneous form of the leishmaniasis in the world ( 1 ) . most of leishmania studies have yet been focused on leishmania itself or the immunogenicity and pathogenicity of the parasite when characterization of the lesion produced in cutaneous form of the disease is rarely addressed in these studies . identifying the pro - inflammatory genes preferentially expressed during the parasite infection would help to elucidate the mechanisms controlling gene regulation and intracellular survival of the parasite where identifying and characterizing the expressed genes and the molecular mechanisms underlying their regulation can be considered as therapeutic targets ( 2 ) . studies using biopsy samples from human cases have suggested different chemokine patterns linked to the phenotype of leishmaniasis ( 3 ) . in mice , various inflammatory mediators such as tnf- , il-1 and cc and cxc chemokines have been detected in in vitro and in vivo studies during l. major infections ( 4 ) however , it is still little known about the expression profiles of these mediators in leishmania infection . the profile of gene expression in macrophages varies in leishmania infection , entirely related to mechanisms applied by the macrophages to control the parasite ( 5 ) . in leishmania lesions , pro - inflammatory cytokines such as il-1beta , ccl3 and ccl4 activates macrophages enhancing parasite killing ( 6 ) where the expression of pro - inflammatory genes is shown to be associated with time evolution of the lesions ( 7 ) . on the other hand , neutrophils also play a crucial role in inflammatory responses and leishmania - specific immune responses to control the infections ( 8) and there is no report on the expression of pro - inflammatory genes in neutrophils in leishmania cases . in the present study , the expression of pro - inflammatory genes in leishmania infected mice in the lesion and neutrophils compared to see whether the situation of the lesion in leishmania cases can be predicted by determining the expression of these genes for therapeutic purposes . the standard iranian l. major promastigotes ( mrho / ir/75/er ) were obtained from pasteur institute of iran and cultured in biphasic nicol mac nalneavy ( nnn ) culture at 25 c and ph 5.5 for 47 d. the culture supernatant containing parasite promastigotes was transferred into rpmi- 1640 containing 100 u / ml of penicillin , 100 g / ml of streptomycin and 200 l / ml of fbs . specific primers for ten proinflammatorygenes including ccl4 , ccl3 , tnf- , il-1 , il-12p35 , il-12p40 , ccl5 , ccr5 , il-1 and ifn- were designed using the gene bank primer software . sequence of primers designed for pro - inflammatory genes 812 week female balb / c mice were obtained from pasteur institute of iran and bred at bu - ali sina university animal house . all animals were housed in accordance with bu - ali sina university codes of practice for the housing and care of animals ( code number 92385 ) . eight - weeks balb / c mice were purchased from pasteur institute of iran and housed in bu - ali sina university animal house according to the standard of ethical agreement for keeping inbred animals . l. major promastigots strain mhom/76/ir obtained from pasteur institute of iran and cultured in rpmi-1640 medium supplemented with 10% fcs . 1 10 leishmania promastigotes were intradermaly injected onto the base of the tail and the animals were divided into two groups of five mice . the first group was treated with 20 mg / kg glucantime half in the lesions and half intramuscularly . the size of the lesions was calculated using the following equation : p=(d+d)/2 ( d = the large diameter , d = the small diameter , p = the average size of the lesion ) haparinized blood samples taken from the heart of the mice were diluted with the equal volumes of nacl 0.85% . meglumine compound ( megluminediatrizoate 66% , sodium diatrizoate 10% ) was diluted in 3 times of volume of nacl 0.85% and used for isolation of neutrophils . five ml of the diluted blood were slowly added to 4ml of the diluted meglumine compound being careful not mixing the two phases of the blood and the meglumine compound . the samples were centrifuged for 15 min at 250 g and the supernatant was replaced with 0.5ml of pbs . two 25-seconds hypotonic lyses were applied with distilled water and nacl 2.55% and the cells were then centrifuged for 5min at 200 g replacing the super - natant with nacl 0.85% . total cell rna was isolated using denazist total rna isolation kit according to the manufacturer s instruction with modification . one ml of g1 lysing buffer was added and the sample was vortexed for 15 sec followed by incubation at room temperature for 5 minutes and centrifugation at 12,000 g for 10 minutes at 4 c . the supernatant was then transferred into a new tube and 200 l chloroform was added and vortexed for 15 sec . the tubes were incubated at room temperature for 3 min and then spined at 12,000 g for 15 min at 4 c . the top phase was transferred into a new tube and an equal volume of isopropanol was added . an equal volume of g2 buffer was added , mixed and incubated at room temperature for 10 min and then centrifuged at 10000 g for 10 min at 4 c . the supernatant was discarded and 1 ml of 70% ethanol was added to the pellet . after a quick vortex , the tubes were spined at 10000 g for 5 min at 4 c . the supernatant was then discarded and 30100 l of nuclease - free water was added . rt - pcr was performed using denazist kit according to the manufacturer s instruction with slight modification . rna - primer mixtures ( total rna 10g , oligodt primer 1l , dntp 1l , nuclease - free water top up to 10l ) was prepared and mixed . the mixture was incubated at 65 c for 5 min and chilled on ice for 2 min . the cdna synthesis mixture ( 10x buffer m - mulv 2l , m - mulv reverse transcriptase 100 unit , nuclease - free water top up to 10l ) was prepared and 10l of the cdna synthesis mixture was added to each rna - primer mixture and incubated at 42 c for 60 min . the tubes were then incubated at 85 c for 5 min and chilled on ice . the pcr was programmed as 40 cycle of denaturation at 95 c for 30s , annealing temperature in accordance with melting temperature , lasted for 30sec , extension at 72 c for 20sec . an initial denaturation step at 95 c for 10 min before the cycles and a final extension step at 72 c for 20sec after the cycles were also applied . the standard iranian l. major promastigotes ( mrho / ir/75/er ) were obtained from pasteur institute of iran and cultured in biphasic nicol mac nalneavy ( nnn ) culture at 25 c and ph 5.5 for 47 d. the culture supernatant containing parasite promastigotes was transferred into rpmi- 1640 containing 100 u / ml of penicillin , 100 g / ml of streptomycin and 200 l / ml of fbs . specific primers for ten proinflammatorygenes including ccl4 , ccl3 , tnf- , il-1 , il-12p35 , il-12p40 , ccl5 , ccr5 , il-1 and ifn- were designed using the gene bank primer software . 812 week female balb / c mice were obtained from pasteur institute of iran and bred at bu - ali sina university animal house . all animals were housed in accordance with bu - ali sina university codes of practice for the housing and care of animals ( code number 92385 ) . eight - weeks balb / c mice were purchased from pasteur institute of iran and housed in bu - ali sina university animal house according to the standard of ethical agreement for keeping inbred animals . l. major promastigots strain mhom/76/ir obtained from pasteur institute of iran and cultured in rpmi-1640 medium supplemented with 10% fcs . the first group was treated with 20 mg / kg glucantime half in the lesions and half intramuscularly . the size of the lesions was calculated using the following equation : p=(d+d)/2 ( d = the large diameter , d = the small diameter , p = the average size of the lesion ) haparinized blood samples taken from the heart of the mice were diluted with the equal volumes of nacl 0.85% . meglumine compound ( megluminediatrizoate 66% , sodium diatrizoate 10% ) was diluted in 3 times of volume of nacl 0.85% and used for isolation of neutrophils . five ml of the diluted blood were slowly added to 4ml of the diluted meglumine compound being careful not mixing the two phases of the blood and the meglumine compound . the samples were centrifuged for 15 min at 250 g and the supernatant was replaced with 0.5ml of pbs . two 25-seconds hypotonic lyses were applied with distilled water and nacl 2.55% and the cells were then centrifuged for 5min at 200 g replacing the super - natant with nacl 0.85% . total cell rna was isolated using denazist total rna isolation kit according to the manufacturer s instruction with modification . briefly one ml of g1 lysing buffer was added and the sample was vortexed for 15 sec followed by incubation at room temperature for 5 minutes and centrifugation at 12,000 g for 10 minutes at 4 c . the supernatant was then transferred into a new tube and 200 l chloroform was added and vortexed for 15 sec . the tubes were incubated at room temperature for 3 min and then spined at 12,000 g for 15 min at 4 c . the top phase was transferred into a new tube and an equal volume of isopropanol was added . an equal volume of g2 buffer was added , mixed and incubated at room temperature for 10 min and then centrifuged at 10000 g for 10 min at 4 c . the supernatant was discarded and 1 ml of 70% ethanol was added to the pellet . after a quick vortex , the tubes were spined at 10000 g for 5 min at 4 c . the supernatant was then discarded and 30100 l of nuclease - free water was added . rt - pcr was performed using denazist kit according to the manufacturer s instruction with slight modification . rna - primer mixtures ( total rna 10g , oligodt primer 1l , dntp 1l , nuclease - free water top up to 10l ) was prepared and mixed . the mixture was incubated at 65 c for 5 min and chilled on ice for 2 min . the cdna synthesis mixture ( 10x buffer m - mulv 2l , m - mulv reverse transcriptase 100 unit , nuclease - free water top up to 10l ) was prepared and 10l of the cdna synthesis mixture was added to each rna - primer mixture and incubated at 42 c for 60 min . the tubes were then incubated at 85 c for 5 min and chilled on ice . the pcr was programmed as 40 cycle of denaturation at 95 c for 30s , annealing temperature in accordance with melting temperature , lasted for 30sec , extension at 72 c for 20sec . an initial denaturation step at 95 c for 10 min before the cycles and a final extension step at 72 c for 20sec after the cycles were also applied . leishmania lesions were produced in two groups of balb / c mice by injecting standard iranian l. major . to evaluate the characterization of the lesions during the progressive and healing periods in terms of the lesion size and expression of pro - inflammatory periods , one group treated with glucantime ( group test)and the other group with pbs ( group control ) ( fig . leishmania lesions in balb / c mice 1 10 l. major promastigotes were intradermaly injected onto the base of the tail of balb / c mice . the first group was treated with 20mg / kg glucantime and the second group was injected with pbs for three weeks . a ) balb / c mice with leishmania lesions in group test , treated with glucantime b ) balb / c mice with leishmania lesions in group control , injected with pbs a week after injection of the parasites , lesions were appeared on the site of injection . the size of the lesions were measured and compared every two days in both groups . the results clearly showed an expansion in the size of lesions in group control but in group test , the lesions became smaller over the time until disappeared ( fig . 2 ) . comparison of the size of lesions caused by l. major balb / c mice treated with glucantime or pbs the size of leishmania lesions in two groups of five mice was measured every two days for three weeks . after three week , all mice in group test cured and all mice in group control died . the expression of ten pro - inflammatory genes ( ccl4 , ccl3 , tnf- , il-1 , il-12 p35 , il-12 p40 , ccl5 , ccr5 , il-1 , ifn- ) in leishmania lesions and neutrophils were evaluated in balb / c mice infected with l. major and treated with either glucantime or pbs ( fig . no sign of expression in pro - inflammatory genes was observed in the lesions and neutrophils . however , in early stages of infection ( before treatment ) or in the group received pbs in the lesions , ifn- and in neutrophils , ccl3 , il-12 p35 , il-12 p40 , ccl5 , ccr5 , il-1 , ifn- were expressing . in the first week after treatment in the group test ( the group received glucantime ) , the pro - inflammatory genes started expressing in both lesions and neutrophils where in the lesions , exceptil-1 , ccr5 and il-1 and in neutrophils except il-1 , ccr5 neutrophils ccl5 , ccl4 other genes were expressing . in the last week in this group , in the lesions except il-1 , ccr5 other genes were highly expressed but in neutrophils il-1 , il-1 and ccl4 were switched off and the other genes were expressing ( table 2 ) . expression of pro - inflammatory genes in mice infected with l. major ( lesion & neutrophils ) expression of pro - inflammatory genes in mice infected with l. major ( lesion & neutrophils ) the thickness of bands shown in the gel electrophoresis was marked from 1 to 3 plus balb / c mice were injected with 110 l. major promastigotes and the expression of pro - inflammatory genes in the lesions and neutrophils was evaluated by rt - pcr . the figure shows the expression of pro - inflammatory genes in lesions and neutrophils in leishmania infected mice treated with glucantime ( group test ) after two weeks of treatment . bands 18 shows the expression of tnf- , il-1 , il-12p35 , il-12p40 , ccl5 , ccr5 , il-1 , ifn- in the lesions , band 9 negative control , band 10 standard dna , 1119 the expression of ccl4 , ccl3 , tnf- , il-1 , il-12p35 , il-12p40 , ccl5 , il-1 , ifn- in neutrophils leishmania lesions were produced in two groups of balb / c mice by injecting standard iranian l. major . to evaluate the characterization of the lesions during the progressive and healing periods in terms of the lesion size and expression of pro - inflammatory periods , one group treated with glucantime ( group test)and the other group with pbs ( group control ) ( fig . leishmania lesions in balb / c mice 1 10 l. major promastigotes were intradermaly injected onto the base of the tail of balb / c mice . the first group was treated with 20mg / kg glucantime and the second group was injected with pbs for three weeks . a ) balb / c mice with leishmania lesions in group test , treated with glucantime b ) balb / c mice with leishmania lesions in group control , injected with pbs a week after injection of the parasites , lesions were appeared on the site of injection . the size of the lesions were measured and compared every two days in both groups . the results clearly showed an expansion in the size of lesions in group control but in group test , the lesions became smaller over the time until disappeared ( fig . 2 ) . comparison of the size of lesions caused by l. major balb / c mice treated with glucantime or pbs the size of leishmania lesions in two groups of five mice was measured every two days for three weeks . after three week , all mice in group test cured and all mice in group control died . the expression of ten pro - inflammatory genes ( ccl4 , ccl3 , tnf- , il-1 , il-12 p35 , il-12 p40 , ccl5 , ccr5 , il-1 , ifn- ) in leishmania lesions and neutrophils were evaluated in balb / c mice infected with l. major and treated with either glucantime or pbs ( fig . no sign of expression in pro - inflammatory genes was observed in the lesions and neutrophils . however , in early stages of infection ( before treatment ) or in the group received pbs in the lesions , ifn- and in neutrophils , ccl3 , il-12 p35 , il-12 p40 , ccl5 , ccr5 , il-1 , ifn- were expressing . in the first week after treatment in the group test ( the group received glucantime ) , the pro - inflammatory genes started expressing in both lesions and neutrophils where in the lesions , exceptil-1 , ccr5 and il-1 and in neutrophils except il-1 , ccr5 neutrophils ccl5 , ccl4 other genes were expressing . in the last week in this group , in the lesions except il-1 , ccr5 other genes were highly expressed but in neutrophils il-1 , il-1 and ccl4 were switched off and the other genes were expressing ( table 2 ) . expression of pro - inflammatory genes in mice infected with l. major ( lesion & neutrophils ) expression of pro - inflammatory genes in mice infected with l. major ( lesion & neutrophils ) the thickness of bands shown in the gel electrophoresis was marked from 1 to 3 plus balb / c mice were injected with 110 l. major promastigotes and the expression of pro - inflammatory genes in the lesions and neutrophils was evaluated by rt - pcr . the figure shows the expression of pro - inflammatory genes in lesions and neutrophils in leishmania infected mice treated with glucantime ( group test ) after two weeks of treatment . bands 18 shows the expression of tnf- , il-1 , il-12p35 , il-12p40 , ccl5 , ccr5 , il-1 , ifn- in the lesions , band 9 negative control , band 10 standard dna , 1119 the expression of ccl4 , ccl3 , tnf- , il-1 , il-12p35 , il-12p40 , ccl5 , il-1 , ifn- in neutrophils the main goal of this study was to examine the expression of ten pro - inflammatory genes including il-12p35 , il-1 , ccl4 , ccl3 , ccl5 , il-12p40 , ccr5 , il-1 , tnf- and ifn- in lesions and neutrophils of balb / c mice infected with l. major to see whether or not there is a relation between the expression of the genes in the lesion and neutrophils in leishmania infection . the results clearly showed that in uninfected mice , none of the pro - inflammatory genes was expressed in healthy tissues and blood derived neutrophils . similar figure was in the lesions of infected mice with no treatment at early stages of the infection where except ifn- other pro - inflammatory genes were not expressed in the lesions however , in the neutrophils , ccl3 , il-12p35 , il-12p40 , ccl5 , ccr5 , il-1 and ifn- were expressed . at late stages of the infection in this group , tnf- and il-1 were also expressed where the expression of ifn- in the lesions and ccr5 in neutrophils stopped . recent studies have shown a down - regulation in ifn- and tnf- produced by nk cells in diffuse cutaneous leishmaniasis caused by l. mexicana ( 9 ) . down - regulation of ifn- is also reported in l. braziliensis cases co - infected with mycobacterium leprae ( 10 ) . another study indicated an inhibition of il-12 through cr3 engagement by l. major ( 11 ) . we have also already showed the down regulation of mhc i in dcs infected with l. mexicana ( in press ) . lack of expression of the pro - inflammatory genes was in - line with other studies indicating a similar potency for l. major in managing the immune response and controlling the expression of not only il-12 but also the other pro - inflammatory genes including ifn-. we already showed that early expression of ifn- has direct relation and key role in with leishmania immunity in balb / c mice ( 12 ) therefore , down - regulation of ifn- in leishmania infection results in exacerbation of the disease . the role of neutrophils in inducing resistance against leishmania parasites have been reviewed already ( 13 ) . to the best of our knowledge , there is no report on the relation between the expression of pro - inflammatory genes in the lesion and blood neutrophils in leishmania infection . the expression of pro - inflammatory genes in blood neutrophils indicates that the neutrophils are primed by the parasite before migrating to the infected tissue . various cytokines and chemokines including il-17 , il-8 , ifn- , tnf- , gm - csf and ccl5 play prominent roles in the recruitment , activation and survival of neutrophils at the site of inflammation ( 1415 ) . ccl5 has also negative effect on the extravasation of neutrophils and monocytes into the peritoneal cavity ( 16 ) . it is known that most of neutrophils in the leishmania lesion migrate from the blood . the difference between the expression profile of pro - inflammatory gene in lesions and blood neutrophils of leishmania infected mice indicated that interaction of neutrophils with the parasite affects the expression profile of the genes in neutrophils migrated to the infected tissue . after treatment with antileishmanial drugs , a high level of expression in most of the pro - inflammatory genes including ccl4 , ccl3 , tnf- , il-12p35 , il-12p40 , ccl5 and ifn- in leishmania lesions was observed confirming the inhibitory effect of leishmania infection on the expression of the pro - inflammatory genes in the leishmania lesions . on the other hand , il-1 expressed in untreated or control mice only in neutrophils but not the lesion and after beginning of treatment with antileishmanial drug , the expression was down regulated . amastigotes are capable to induce il-1 in pbmcs in l. ( v. ) braziliensis ( 17 ) where production of il-1 promotes host resistance to leishmania infection ( 18 ) . our results for the first time demonstrate that l. major similar to l. ( v. ) braziliensis directly stimulates production of il-1in neutrophils . none of the control mice was expressed ccl4 and tnf- either in the lesion or neutrophils . however the gene was only expressed in groups received treatment and when the lesions began healing , ccl4 in the lesions and tnf- in both lesions and neutrophils started expression . therefore , tnf- can be candidate as an indicator for the healing of leishmania lesions . l. major can strongly suppress the expression of pro - inflammatory genes in the lesions . this may help the parasite control the immune responses induced by the host . the expression of pro - inflammatory genes in the lesions restarted when the lesions were treated with anti - leishmanial drugs . expression of pro - inflammatory genes in peripheral neutrophils was not suppressed by the parasite indicating the important role of these cells in leishmania infections . the expression of tnf- in the lesions and down - regulation of il-1 in neutrophils were only observed after treatment with anti - leishmanial drugs and could be accounted as an indication for healing of cutaneous leishmaniasis .

background : leishmaniasis is a worldwide disease prevalent in tropical and sub - tropical countries in the world . characterization of inflammatory responses produced in cutaneous leishmaniasis has not yet been completed.methods:the specific primers were designed for ten pro - inflammatory genes including ccl4 , ccl3 , tnf- , il-1 , il-12p35 , il-12p40 , ccl5 , ccr5 , il-1 and ifn- and their expression were assessed and compared using rt - pcr in the lesion and peripheral blood neutrophils in leishmania infected balb / c mice.results:none of the pro - inflammatory genes was expressed in the healthy tissue and except ifn- others were down - regulated by the parasite in the lesion in untreated mice . in mice treated with anti - leishmanial drugs , the expression of the pro - inflammatory genes restarted . the figure of pro - inflammatory gene expression in neutrophils was different was from the lesions in treated and untreated mice.conclusion:leishmania is capable to suppress the expression of pro - inflammatory genes in the lesions but not in neutrophils . the expression of tnf- in the lesions and down - regulation of il-1 in neutrophils could be accounted as an indication for healing of cutaneous leishmaniasis . the results open a new window on characterization of leishmania lesions and clarifying the role of neutrophils in leishmania infections .

emergency is a condition determined clinically or considered by the patient or his relatives as requiring urgent medical , dental or allied service , failing , which it would result in loss of life or limb.1 the identification of epidemiological trends in hospital admissions are essential for health - care planning and resource allocation . non - communicable diseases particularly cardiovascular diseases , diabetes mellitus ( dm ) , cancer and respiratory diseases are the major causes of morbidity and mortality in the developed world and are emerging as an important component of the burden of diseases in developing countries.2 there are reports on studies carried out in nigeria and other african countries on the pattern of medical cases admitted to the emergency unit , but none to our knowledge on the pattern of endocrine - related diseases presenting as an emergency among adult patients in sub - saharan africa.3456 in a study carried out in port - harcourt , nigeria , on the medical ward admissions over a 4-year period ; non - communicable diseases constituted 56.2% of all medical admissions , where cardiovascular , endocrine and renal systems were most commonly seen , accounting for 35.7% , 18.5% , and 16.8% respectively.6 knowledge on admission and mortality patterns of endocrine - related diseases will give insight into the magnitude of the condition and provide effective tools for planning , delivery and evaluation of health - care needs . this study aimed to determine the pattern of admission and mortality of endocrine - related diseases in the emergency unit of the lagos university teaching hospital ( luth ) . this retrospective study was carried out at the adult emergency unit of the luth , situated in lagos state in south western nigeria . the hospital occupies 92 acres of land and is an over 700 bed facility , making it one of the largest teaching hospitals in nigeria . it serves as a referral hospital for lagos and its adjoining states . the emergency unit we retrieved medical records of patients that visited the emergency unit of the hospital over a year period ( march 2011 to february 2012 ) from the hospital admissions and death registers . information retrieved included : age , gender , diagnosis at admission and death , co - morbidities . data were entered into excel work sheet for cleaning and then transferred to statistical package for social sciences ( spss for windows version 17 ) for analysis . quantitative data were expressed as mean standard deviation while qualitative variables were expressed as percentages . data were entered into excel work sheet for cleaning and then transferred to statistical package for social sciences ( spss for windows version 17 ) for analysis . quantitative data were expressed as mean standard deviation while qualitative variables were expressed as percentages . a total of 1703 adult cases were seen in the emergency unit from march 2011 to february 2012 . of the 1703 cases , 174 were endocrine - related , accounting for 10.2% of the total emergency unit visitation / admission in the hospital [ figure 1 ] . males were 81 ( 46.6% ) and females 93 ( 53.4% ) females , giving a male to female ratio of 1:1.2 . the mean age of the patients was 47.8 14.2 , with an age range of 18 - 78 years . percentage distribution of endocrine and non - endocrine admissions out of the 174 endocrine - related cases , 75 ( 43.1% ) had hyperglycaemic crises ( diabetic ketoacidosis , 36% and hyperosmolar hyperglycaemic state 64% ) ; 33 ( 19.0% ) had diabetes mellitus foot syndrome ( dmfs ) ; 23 ( 13.2% ) had hypoglycaemia ; 3 ( 1.7% ) had dm hand syndrome ; 1 ( 0.6% ) had conn 's syndrome ; 1 ( 0.6% ) had cushing 's syndrome ; 5 ( 2.8% ) had thyroid diseases , and 33 ( 19.0% ) had dm related co - morbidities [ tables 1 and 2 ] . distribution of endocrine - related admissions contribution of dm co - morbidities to endocrine - related admissions a total of 39 endocrine - related deaths were recorded in the emergency room within this period [ table 3 ] . there were 18 ( 46.2% ) males and 21 ( 53.8% ) females ( = 0.002 , p = 0.964 ) . about 35.8% ( 14 out of 39 ) of the mortalities were sepsis - related . the fatality rates were higher in patients who presented with thyrotoxic crises , 60% ( 3 out of 5 ) and hypoglycaemic coma , 39.1% ( 9 out of 23 ) . this study has attempted at showing the pattern of admissions and mortality of patients with endocrine - related conditions in the emergency setting in a resource poor tertiary health facility of a developing country . the diagnoses were mainly based on clinical and laboratory findings as autopsy could not be carried out for the majority of the patients on cultural and religious grounds . global projections of disease burden and mortality have indicated a significant shift from infection / communicable to non - communicable diseases world - wide , and this transition is expected to affect developing countries like nigeria.7 it has been projected that by the year 2000 , the prevalence of non - communicable disease will parallel that of the communicable diseases in developing nations , which will have to contend with the double burden of the two groups of diseases.8 in our study , endocrine - related diseases accounted for a significant proportion of the total adult medical emergency unit admissions , with dm emergencies predominating . this finding is in agreement with documentations of the preponderance of chronic non - communicable diseases including endocrine diseases in various hospitals across developing countries especially nigeria.391011121314 the preponderance of diabetic emergencies may be associated with the increasing prevalence of dm across the world , particularly in sub - saharan african where nigeria has the highest number of people living with dm . the reported prevalence of dm across nigeria varies from 0.65 in rural mangu village to as high as 11.0% in urban lagos where this study was carried out;15 this may also be linked to the increasing urbanization , reduced physical activity and the epidemic boom of obesity especially in the developing world . this finding is similar to results of a study carried out in ilorin , nigeria , in which the highest numbers of admissions were due to diabetic hyperglycaemic emergencies , septicaemia , and diabetic foot syndrome.16 the mean age of the subjects was similar to that seen in other related studies in nigeria.6 gender disparity was observed in the overall distribution of endocrine - related admissions , with more females compared to males . this finding is in variance with reported gender distribution of non - communicable diseases reported in previous studies.617 however , chinenye et al . reported a female preponderance in their study on the profile of dm patients , and suggested it may be a reflection of the health - care financing pattern in the country with females likely to be supported by relations and loved ones with financial assistance toward hospital visits than males.15 the mortality rate was also highest in patients who presented with hyperglycaemic emergencies , sepsis , thyroid , and hypoglycaemic crisis . this is also similar to the reports on mortality patterns in dm in other studies.1416 a greater proportion of those who presented with thyroid crises and hypoglycaemia died . late presentation and prolonged neuroglycopenia with irreversible brain damage is likely responsible for the non - response to treatment in hypoglycaemic patients . thyroid storm and thyrotoxic heart disease were the causes of death in patients who presented on account of thyroid crises . the prognosis for thyrotoxic crisis remains poor with high mortality recorded in untreated cases and mortality rates of 20 - 30% reported even with treatment.1819 this finding is similar to those cited by ogbera.20 most of the mortalities recorded were complicated by sepsis . this alluded the findings of a huge burden of infectious diseases on the outcome of medical admissions in a similar study.621 from this study , death from hyperglycaemic crises appears to be mostly associated with sepsis . the immunosuppressive state associated with dm may be responsible for the high rate of infection among this group of patients ; and sepsis may also be the precipitant for the hyperglycaemic crisis in them . endocrine - related diseases are common in the emergency room of this health facility , with diabetic complications accounting for most of the admissions and mortality . surveillance for infection is recommended for patients presenting to the emergency room with endocrine - related conditions , especially hyperglycaemic emergencies .

introduction : non - communicable diseases are emerging as an important component of the burden of diseases in developing countries . knowledge on admission and mortality patterns of endocrine - related diseases will give insight into the magnitude of these conditions and provide effective tools for planning , delivery , and evaluation of health - care needs relating to endocrinology.materials and methods : we retrieved medical records of patients that visited the emergency unit of the lagos university teaching hospital , over a period of 1 year ( march 2011 to february 2012 ) from the hospital admissions and death registers . information obtained included : age , gender , diagnosis at admission and death , co - morbidities . diagnoses were classified as endocrine - related and non - endocrine related diseases . records with incomplete data were excluded from the study.results:a total of 1703 adult medical cases were seen ; of these , 174 were endocrine - related , accounting for 10.2% of the total emergency room admission in the hospital . the most common cause of endocrine - related admission was hyperglycaemic crises , 75 ( 43.1% ) of cases ; followed by diabetes mellitus foot syndrome , 33 ( 19.0% ) ; hypoglycaemia 23 ( 13.2% ) and diabetes mellitus related co - morbidities 33 ( 19.0% ) . there were 39 endocrine - related deaths recorded . the result revealed that 46.1% of the total mortality was related to hyperglycaemic emergencies . most of the mortalities were sepsis - related ( 35.8% ) , with hyperglycaemic crises worst affected ( 71.42% ) . however , the case fatalities were highest in subjects with thyrotoxic crisis and hypoglycaemic coma.conclusion:diabetic complications were the leading causes of endocrine - related admissions and mortality in this health facility . the co - morbidity of sepsis and hyperglycaemia may worsen mortality in patients who present with hyperglycaemic crises . hence , evidence of infection should be sought early in such patients and appropriate therapy instituted .

lung cancer is the most deadly cancer disease with an estimated 27% of all cancer deaths , . a large part of patients with lung cancer undergoes radiotherapy . tracking tumor motion poses a significant challenge for precise dose delivery in lung cancer radiotherapy , due to respiratory motion of up to 3.5 cm for primary lung tumors . if the patient s breathing motion is not correctly predicted , tumor miss might occur , or sensitive normal tissue might be undesirably exposed resulting in unwanted treatment toxicity . advanced technologies of radiotherapy , intensity modulated radiotherapy and image guided radiotherapy , may offer the potential of precise radiation dose delivery for moving objects . however , they still need an additional function to predict the precise position of the tumor against subtle variations in real - time , . radiation dose is typically delivered in 3 to 5 fractions over 5 to 12 days for early stage lung cancer using stereotactic radiotherapy or 30 to 33 fractions over 6 to 7 weeks for more advanced disease with each fraction lasting between 10 and 45 minutes . the patient s breathing motions during these fractions are broadly divided into two categories : 1 ) intra - fractional and 2 ) inter - fractional variations . intra - fraction motion indicates changes where the patient is undergoing the radiation therapy , which turns up on a time scale of seconds to minutes , , . each individual shows different breathing patterns . on the other hand , inter - fractional variation is typically shown in a time scale of minutes to hours or a day - to - day level , , . inter - fractional motion is distinguishable from intra - fractional movement because the inter - fractional variation covers even baseline shifts and weight gain or loss , . however , most studies of breathing prediction so far have focused on respiratory motions within the single treatment session , i.e. , intra - fractional variation . recently , several studies have pointed out the difference between intra - fractional and inter - fractional movements and have discussed the importance of inter - fractional variation in radiation treatment or related imaging techniques . table 1 summarizes the comparison between intra- and inter - fractional movements.table 1comparison between intra- and inter - fractional variations.variation typeintra - fractioninter - fractiontime of occurrenceduring a single fraction , between different fractions , , , time scaleseconds to minutes hours or day - to - day level , , motion coverageinternal organ motion , breathing , swallowing , position changes of patients , patient weight gain / loss , internal organ motion , breathing , swallowing , prediction methods for intra - fractional variation have been addressed in many studies , , , , , as illustrated in table 2 . however , inter - fractional variation has not been actively studied as much as intra - fractional motion yet despite its necessity in radiotherapy , , , . intra- and inter - fractional variation of breathing motion can raise many challenges for respiratory prediction thirdly , the novel method should be able to handle any unpredictable breathing variation.table 2previous prediction methods for intra- and inter - fractional variations.methoddescriptiondrawbackvariationmargin-based compensated locational changes of the tumor in a primitive way , adding extra margins high possibility of over / under - dose since the margin is determined by motion range of the tumor without knowing its variationintra-/inter - fractionlinear predictive model ( lp ) , estimated the future state based on functions comprised of linear combination of input data , proper coefficients , and constants inferior prediction accuracy for breathing signals with a long latency poor performance improvement by its exclusive usage assumption that the nonlinear respiratory movement is linearintra-/inter - fractionadaptive filter ( af ) , , , , combined modified lps and additional filters that adjust coefficients of lps no guarantee of its superb performance in most cases because it highly depends on adaptation intervalsintra - fractionkalman filter ( kf ) , , , efficient recurrent filter which has been utilized in various forms : kalman constant velocity , kalman constant acceleration , an interacting multiple model , and hybrid implementation based on the extended kf ( hekf) only adaptable to linear or nearly linear estimation high computation complexity of kf - based models combined with other prediction toolsintra - fractionartificial neural network ( nn)-based , , , , , , , , , , showed outstanding accuracy for irregular patterns and abrupt changes, extended approaches : back propagation nn , feed - forward nn , recursive nn , wavelet nn , customized prediction with multiple patient interactions using nn ( cnn ) , and hekf long calculation time for prediction parameters and resultsintra - fractioncubic model estimated respiratory variance by using a third - order polynomial equation same drawback of low accuracy as lp because the cubic model is also one of the mathematic approaches like lpinter - fractionstochastic fluence map optimization ( fmo ) model extended deterministic fmo model , which assumes that a patient is static solved observed problems by employing convex penalty functions and numerous scenarios to characterize inter - fractional uncertainties unpredictable method for other disregarded scenariosinter - fraction in this paper , we propose a new prediction approach for intra- and inter - fraction variations , called intra- and inter - fractional variation prediction using fuzzy deep learning ( iifdl ) . the proposed iifdl clusters the respiratory movements based on breathing similarities and estimates patients breathing motion using the proposed fuzzy deep learning ( fdl ) . to reduce the computation time , first , this is the first analytical study for modeling multiple patients breathing data based on both intra- and inter - fractional variations . secondly , the proposed method has a clinical impact for enhanced adjustment of margin size because it achieves high prediction accuracy for respiratory motion , even for inter - fractional variation . thirdly , this study shows the clinical possibility of real - time prediction by largely shortening computing time . furthermore , the training process can be shortened , by training breathing signals with similar patterns together in the proposed iifdl . the proposed fdl is a combination of fuzzy logic and a nn with more than two hidden layers , i.e. deep learning network . due to the nn architecture of fdl , it has a self - learning feature , setting network parameters by training itself according to input and desired output values . fdl also has a fuzzy logic feature of reasoning capability for uncertainty . in fdl , a few fuzzy parameters , i.e. prediction parameters of fdl , determine weight values between nodes in the network , and weight values are considered as the prediction parameters in other methods . consequently , the number of prediction parameters is much less than that of other mutated nn methods and parametric nonlinear models . this reduces the computation time substantially and makes suitable for to real - time and nonlinear estimation . 1 exemplifies a simple architecture of fdl , including layer 1 through layer 4 in the hidden layers . the functions of four hidden layers can be summarized as follows : layer 1 provides membership functions which are determined by a membership function ( mf ) parameter set \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ m=$ \end{document } { \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ m_{i,1}$ \end{document } , \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ m_{i,2}$ \end{document } , \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ m_{i,3}$ \end{document } } , layer 2 applies a t - norm operation , layer 3 computes linear regression functions by normalized weights and a linear regression ( lr ) parameter set \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ r=$ \end{document } { \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ r_{i,1}$ \end{document } , \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ r_{i,2}$ \end{document } , \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ r_{i,3}$ \end{document } } , and layer 4 finally yields an output of fdl \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ f$ \end{document } by summing outcomes according to all fuzzy if - then rules . figure 1.fdl architecture including layer 1 through layer 4 in the hidden layers : layer 1 provides membership functions , layer 2 applies a t - norm operation , layer 3 computes linear regression functions , and layer 4 finally yields an output of fdl according to all fuzzy if - then rules . fdl architecture including layer 1 through layer 4 in the hidden layers : layer 1 provides membership functions , layer 2 applies a t - norm operation , layer 3 computes linear regression functions , and layer 4 finally yields an output of fdl according to all fuzzy if - then rules . for the training algorithm of fdl , we use the hybrid learning algorithm which is a combination of a gradient descent back - propagation algorithm and a least squares estimate algorithm . the mf parameter and the lr parameter are identified by this training algorithm . in fig . 1 , the number of fuzzy if - then rules is equivalent to that of nodes in layer 2 and 3 , which are given as follows : rule1:if \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ i_{1}$ \end{document } is \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ a_{1}$ \end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ i_{2}$ \end{document } is \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ b_{1}$ \end{document } , then \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ f_{1 } = r_{\mathrm { 1,1}}i_{1 } + r_{\mathrm { 1,2}}i_{2}+r_{\mathrm { 1,3}}$ \end{document},rule2:if \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ i_{1}$ \end{document } is \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ a_{2}$ \end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ i_{2}$ \end{document } is \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ b_{2}$ \end{document } , then \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ f_{2 } = r_{\mathrm { 2,1}}i_{1 } + r_{\mathrm { 2,2}}i_{2}+r_{\mathrm { 2,3}}$ \end{document } where \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ i_{1}$ \end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ i_{2}$ \end{document } are inputs of fdl , and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ a_{i}$ \end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ b_{i}$ \end{document } are fuzzy sets , which are linguistic labels . if \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ i_{1}$ \end{document } is \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ a_{1}$ \end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ i_{2}$ \end{document } is \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ b_{1}$ \end{document } , then \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ f_{1 } = r_{\mathrm { 1,1}}i_{1 } + r_{\mathrm { 1,2}}i_{2}+r_{\mathrm { 1,3}}$ \end{document } , if \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ i_{1}$ \end{document } is \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ a_{2}$ \end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ i_{2}$ \end{document } is \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ b_{2}$ \end{document } , then \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ f_{2 } = r_{\mathrm { 2,1}}i_{1 } + r_{\mathrm { 2,2}}i_{2}+r_{\mathrm { 2,3}}$ \end{document } the output \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ o_{\mathrm { 1},i}$ \end{document } in layer 1 is described as follows:\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } \begin{equation * } o_{1,i } \!=\!\begin{cases } { \mu _ { a_{i } } \left ( { { i_{1 } } } \right ) = 1 / { \left [ { { 1+\left | { { { \left ( { { i - m_{i,3 } } } \right ) } / { m_{i,1 } } } } \right |^{2m_{i,2 } } } } \right ] } , } \\ \quad \qquad \qquad \qquad \qquad \qquad { 1\le i\le 2 } \\ { \mu _ { b_{i-2 } } \left ( { { i_{2 } } } \right ) = 1 / { \left [ { { 1+\left | { { { \left ( { { i - m_{i,3 } } } \right ) } / { m_{i,1 } } } } \right |^{2m_{i,2 } } } } \right ] } , } \\ \quad \qquad \qquad \qquad \qquad \qquad { 3\le i\le 4 } \\ \end{cases}\quad \end{equation*}\end{document } where \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \mu _ { ai}(i_{1})$ \end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \mu _ { bi\mathrm { -2}}(i_{2})$ \end{document } are mfs of inputs for each fuzzy set of \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ a_{i}$ \end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ b_{i}$ \end{document}. also , \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ m_{i,1}$ \end{document } , \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ m_{i,2}$ \end{document } , and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ m_{i,3}$ \end{document } are the mf parameters chosen by the training algorithm . the functions of layer 2 multiply all the values coming from layer 1 , as follows:\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } \begin{equation * } o_{2,i } = { w}_{i } = \mu _ { a_{i } } \left ( { { i_{1 } } } \right ) \cdot \mu _ { b_{i } } \left ( { { i_{2 } } } \right ) \!,\quad 1\le i\le 2 \end{equation*}\end{document } where multiplication acts as the t - norm operator in the fuzzy system , and the output indicates the firing strength for the rule . in layer 3 , the linear regression function is applied to a ratio of the \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ i$ \end{document}th rule s firing strength to the summation of all rules firing strengths , and its result can be calculated by \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } \begin{equation * } o_{3,i } = \frac { w_{i}}{\sum \limits _ { j } { w_{j}}}\left ( { { r_{i,1 } i_{1 } + r_{i,2 } i_{2 } + r_{i,3 } } } \right ) \!,\quad 1\le i\le 2 \end{equation*}\end{document } where \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ r_{i,1}$ \end{document } , \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ r_{i,2}$ \end{document } , and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ r_{i,3}$ \end{document } are the lr parameters , derived from the training algorithm . the output of layer 4 is aggregate of ( 3 ) as follows:\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } \begin{equation * } o_{4,1 } = f=\sum \limits _ { i } { \frac { w_{i}}{\sum \limits _ { j } { w_{j}}}f_{i } } = \frac { \sum \limits _ { i } { w_{i } f_{i}}}{\sum \limits _ { i } { w_{i}}}. \end{equation*}\end{document } the output of fdl is computed by its weights and regression functions as ( 4 ) . the proposed iifdl is designed to reduce the computational complexity of prediction for multipatients breathing motion , which occurs during the single treatment session and between treatment sessions . to achieve this , the proposed iifdl clusters multiple patients based on their breathing feature similarities and trains their respiratory signals for each group . , a summary of its whole process is given as follows : 1)patient clustering : patients breathing feature metrics are computed from the respiratory signals , and then patients are clustered according to their breathing feature similarities.2)prediction using fdl : for each patient group , the training procedure of the hybrid learning algorithm is conducted , and then breathing signals with intra - fractional variation or inter - fractional variation are predicted using fdl . patient clustering : patients breathing feature metrics are computed from the respiratory signals , and then patients are clustered according to their breathing feature similarities . prediction using fdl : for each patient group , the training procedure of the hybrid learning algorithm is conducted , and then breathing signals with intra - fractional variation or inter - fractional variation are predicted using fdl . we describe the specific clustering procedure in subsection \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ a$ \end{document } first , and we explain fdl for intra- and inter - fractional variation prediction in subsection \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ b$ \end{document}. from patients respiratory signals , we extract breathing features as clustering criteria : autocorrelation maximum ( amv ) , acceleration variance ( acc ) , velocity variance ( vel ) , breathing frequency ( brf ) , maximum fourier transform power ( ftp ) , principal component analysis coefficient ( pca ) , standard deviation of time series data ( std ) , and maximum likelihood estimates ( mle ) . table 3 summarizes features extracted from the signals and their formula . in table 3 , amv is an indicator of the breathing stability , and acc , vel , and std are directly relevant to respiratory signals , , . in addition , we use the typical vector - oriented features pca and mleas well as other breathing characteristics such as brf and ftp , , . there are two improvements in the proposed patient clustering : the removal of unnecessary breathing feature metrics , and the use of clustering criteria with vector forms.table 3features extracted from the signals.pformulaused form in iifdlused form in amv\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \max \left ( { { \frac { 1}{2t}\int _ { -t}^{t } { x\left ( { t } \right ) x\left ( { { t-\tau } } \right ) d\tau } } } \right ) $ \end{document } ( \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ t$ \end{document } : period of observations)\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ p_{amv } $ \end{document } ( \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ 1\times 3 $ \end{document } vector)\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \vert p_{amv } \vert $ \end{document } ( scalar)acc\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ var\left ( { { \delta x \mathord { \left / { { \vphantom { \delta x { \delta t^{2 } } } } } \right . } { \delta t^{2 } } } } \right ) $ \end{document } ( \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ x$ \end{document } : observed respiratory data)\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ p_{acc } $ \end{document } ( \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ 1\times 3 $ \end{document } vector)\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \vert p_{acc } \vert $ \end{document } ( scalar)vel\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ var\left ( { { \delta x \mathord { \left / { { \vphantom { \delta x { \delta t } } } } \right . } { \delta t } } } \right ) $ \end{document}\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ p_{vel}$ \end{document } ( \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ 1\times 3 $ \end{document } vector)\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \vert p_{vel } \vert $ \end{document } ( scalar)brf\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \frac { 1}{n\left ( { i } \right ) } \sum \limits _ { i } { \left ( { { \frac { 1}{bc_{i } } } } \right ) } $ \end{document } ( n(\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ i$ \end{document } ) : number of breathing cycles , and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ bc_i:~i$ \end{document}th breathing cycle range)\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ p_{brf}$ \end{document } ( \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ 1\times 1 $ \end{document } vector)\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ p_{brf}$ \end{document}ftp\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \max \left ( { { \sum \limits _ { n=1}^{n } { x\left ( { n } \right ) e^{-\frac { j2\pi } { n}\left ( { { k-1 } } \right ) \left ( { { n-1 } } \right ) } } } } \right ) $ \end{document } ( \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ n$ \end{document } : number of breathing signal samples , 1 k n)\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ p_{ftp}$ \end{document } ( \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ 1\times 3 $ \end{document } vector)\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \vert p_{ftp } \vert $ \end{document } ( scalar)pcaprincomp\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \left ( { { { \mathbf{z } } } } \right ) $ \end{document } ( princomp(\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \cdot ) $ \end{document } : pca function , z : data matrix ( \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ n\times m$ \end{document } , \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ m=3 $ \end{document}))\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ p_{pca}$ \end{document } ( \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ 3\times 3 $ \end{document } vector)\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \vert p_{pca } \vert $ \end{document } ( scalar)std\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \sqrt { \frac { 1}{n}\sum \limits _ { i=1}^{n } { \left ( { { x_{i } -{x } ' } } \right ) ^{2 } } } $ \end{document } ( \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ x_{i}$ \end{document } : ith breathing signal sample , and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ x$ \end{document} : average of breathing signal samples)\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ p_{std}$ \end{document } ( \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ 1\times 3 $ \end{document } vector)\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \vert p_{std } \vert $ \end{document } ( scalar)mle\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \arg \max \limits _ { \theta \in \theta } \hat { l}\left ( { { \theta \left | { { x_{1 } , ... , x_{n } } } \right . } } \right ) , \hat { l}\left ( { { \theta \left | { x } \right . } } \right ) = \frac { 1}{n}\sum \limits _ { i=1}^{n } { \ln f\left ( { { x_{i } \left | { \theta } \right . } } \right ) } $ \end{document } ( \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ f(\cdot \vert \theta ) $ \end{document } : normal distribution)\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ p_{mle}$ \end{document } ( \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ 1\times 3 $ \end{document } vector)\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \vert p_{mle } \vert $ \end{document } ( scalar ) firstly , previous studies in , , , , , and chose two additional feature metrics , i.e. autocorrelation delay time ( adt ) and multiple linear regression coefficients ( mlr ) , in addition to those eight in table 3 for respiratory pattern analysis . however , adt depends on the length of breathing signal samples , rather than the individual respiration characteristics . the use of mlr assumes that breathing signals are linear , fixed values , and homoscedasticity . secondly , the existing study clustered patients based on the magnitude values of their respiratory feature vectors . however , the proposed method uses breathing feature vectors for patient clustering , not their magnitude values . for example , the proposed iifdl analyzes the similarities among patients pca by comparing each component of \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ 3\times 3 $ \end{document } vector \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ p_{pca}$ \end{document } , but the previous method in calculates the similarities based on the scalar value of \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \vert p_{pca}\vert $ \end{document}. accordingly , the previous method clusters patients as the same group when the breathing signals have the approximate magnitude of the breathing feature vector , even though they do not show the similar breathing features . thus , the proposed iifdl compares each component of breathing feature vectors , so that it can provide better clustering of breathing signals than existing methods . as shown in fig . 2 , respiratory signals are randomly selected from multiple patients and used for the breathing feature extraction . let us define \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \textbf{p}=$ \end{document}{\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ p_{amv}$ \end{document } , \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ p_{acc}$ \end{document } , \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ p_{vel}$ \end{document } , \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ p_{brf}$ \end{document } , \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ p_{ftp}$ \end{document } , \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ p_{pca}$ \end{document } , \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ p_{std}$ \end{document } , \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ p_{mle}$ \end{document } } as a feature selection metrics set , x as an arbitrary feature combination vector based on p , and y as an optimal feature combination vector . the total number of possible xs in the given data is 247 ( \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \sigma _ { i\,\mathrm { 8}}\text{c}_{i}$ \end{document } , \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } xs , y is selected using a criterion function \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ j(\cdot ) $ \end{document } , which is determined by within - class scatter \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ s_{w}$ \end{document } and between - class scatter \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ s_{b}$ \end{document } values . the within - class scatter \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ s_{w}$ \end{document } is defined as follows : \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } \begin{equation * } s_{w } \!=\!{\begin{array}{*{20}c } { \sum \limits _ { i=1}^{c } { \sum \limits _ { \textrm { x}\in c_{i } } \!{\left ( { { \textrm { x}-m_{i } } } \right ) \left ( { { \textrm { x}-m_{i } } } \right ) ^{t } } } , } & \quad { m_{i } \!=\!\dfrac { 1}{n_{i}}\sum \limits _ { \textrm { x}\in c_{i } } \textrm { x } } \\ \end{array}}\qquad \end{equation*}\end{document } where \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ c$ \end{document } is the number of classes less than the total number of patients \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ n$ \end{document } , \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ c_{i}$ \end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ m_{i}$ \end{document } indicate the \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ i$ \end{document}th class and its mean , and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ n_{i}$ \end{document } is the number of patients of class \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ i$ \end{document}. the between - class scatter \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ s_{b}$ \end{document } is defined as:\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } \begin{equation * } s_{b } = \!{\begin{array}{*{20}c } { \sum \limits _ { i=1}^{c } { n_{i } \left ( { { m_{i } -m } } \right ) \left ( { { m_{i } -m } } \right ) ^{t } } , } & \quad { m=\dfrac { 1}{n}\sum \limits _ { \textrm { x } } \textrm { x } } \\ \end{array}}\qquad \end{equation*}\end{document } where \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ m$ \end{document } is the mean of all feature combination vectors . with \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ s_{w}$ \end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ s_{b}$ \end{document } , the criterion function \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ j(\cdot ) $ \end{document } is given as follows:\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } \begin{equation * } j\left ( { { \textrm { x},\;c } } \right ) = \frac { s_{b}}{s_{w } } \end{equation*}\end{document } this implies that the larger \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ j(\cdot ) $ \end{document } allows , with low in - class and high inter - class dispersion , the more obvious distinction between classes . after criterion function values are calculated for all xs and all possible numbers of clusters \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ c$ \end{document } , y can be decided with the following condition:\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } \begin{equation * } \upsilon = \left \ { { { \textrm { x}\left | { { \max \;j\left ( { { \textrm { x},\;c } } \right ) \;and\;c < n } } \right . } } \right \ } \end{equation*}\end{document } after choosing y by ( 8) , the final number of clusters \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ c_{final}$ \end{document } is set , and patients are clustered as \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ c_{final}$ \end{document } classes depending on selected principal features of y. after multiple patients are clustered , we can train patients data for each group . for intra - fractional variation , fdl trains parameters based on input data in a single session and fdl predicts breathing motion by training the fdl network for multiple datasets of previous sessions . here , datasets of inter - fractional variation already include the patient s intra - fractional variation , as described in section i. training datasets consist of the initial data and the target data . we train the datasets with the hybrid learning algorithm . during the training procedure , two prediction parameter sets of fdl , i.e. , mf parameter set \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ m$ \end{document } and lr parameter set r , are obtained and applied to the proposed fdl . for estimating intra- and inter - fractional variation from the cyberknife data , fdl has a similar structure to fig . 1 , the input datasets consist of three - dimensional ( 3d ) coordinates for each channel . thus , we designed the proposed prediction method to have three fdls for each \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ x$ \end{document } , \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ y$ \end{document } , and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ z$ \end{document } coordinate , so that we can obtain all 3d coordinates of the estimated breathing signal . the total number of nodes in layer 2 and 3 is 27 , based on the number of fuzzy if - then rules , which are given as follows : rule1:if \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ i_{1}$ \end{document } is \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ a_{1}$ \end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ i_{2}$ \end{document } is \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ b_{1 } $ \end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ i_{3}$ \end{document } is \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ c_{1}$ \end{document } , then \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ f_{1 } = r_{\mathrm { 1,1}}i_{1 } + r_{\mathrm { 1,2}}i_{2 } + r_{\mathrm { 1,3}}i_{3}+r_{\mathrm { 1,4}}$ \end{document},rule27:if \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ i_{1}$ \end{document } is \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ a_{3}$ \end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ i_{2}$ \end{document } is \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ b_{3 } $ \end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ i_{3}$ \end{document } is \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ c_{3}$ \end{document } , then \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ f_{27 } = r_{\mathrm { 27,1}}i_{1 } + r_{\mathrm { 27,2}}i_{2 } + r_{\mathrm { 27,3}}i_{3}+r_{\mathrm { 27,4}}$ \end{document } where \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ i_{1}$ \end{document } , \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ i_{2}$ \end{document } , and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ i_{3}$ \end{document } correspond to inputs from three channels of cyberknife machine , and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ a_{i}$ \end{document } , \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ b_{i}$ \end{document } , and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ c_{i}$ \end{document } are fuzzy sets . if \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ i_{1}$ \end{document } is \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ a_{1}$ \end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ i_{2}$ \end{document } is \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ b_{1 } $ \end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ i_{3}$ \end{document } is \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ c_{1}$ \end{document } , then \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ f_{1 } = r_{\mathrm { 1,1}}i_{1 } + r_{\mathrm { 1,2}}i_{2 } + r_{\mathrm { 1,3}}i_{3}+r_{\mathrm { 1,4}}$ \end{document } , if \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ i_{1}$ \end{document } is \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ a_{3}$ \end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ i_{2}$ \end{document } is \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ b_{3 } $ \end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ i_{3}$ \end{document } is \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ c_{3}$ \end{document } , then \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ f_{27 } = r_{\mathrm { 27,1}}i_{1 } + r_{\mathrm { 27,2}}i_{2 } + r_{\mathrm { 27,3}}i_{3}+r_{\mathrm { 27,4}}$ \end{document } the output \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ o_{\mathrm { 1},i}$ \end{document } in layer 1 is computed as follows:\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } \begin{equation * } o_{1,i } = \begin{cases } { \mu _ { a_{i } } \left ( { { i_{1 } } } \right ) = 1 / { \left [ { { 1+\left | { { { \left ( { { i - m_{i,3 } } } \right ) } / { m_{i,1 } } } } \right |^{2m_{i,2 } } } } \right ] } , } \\ \qquad \qquad \qquad \qquad \qquad \qquad \qquad { 1\le i\le 3 } \\ { \mu _ { b_{i-3 } } \left ( { { i_{2 } } } \right ) = 1 / { \left [ { { 1+\left | { { { \left ( { { i - m_{i,3 } } } \right ) } / { m_{i,1 } } } } \right |^{2m_{i,2 } } } } \right ] } , } \\ { \mu _ { c_{i-6 } } \left ( { { i_{3 } } } \right ) = 1 / { \left [ { { 1+\left | { { { \left ( { { i - m_{i,3 } } } \right ) } / { m_{i,1 } } } } \right |^{2m_{i,2 } } } } \right ] } , } \\ \qquad \qquad \qquad \qquad \qquad \qquad \qquad { 7\le i\le 9 } \\ \end{cases}\quad \end{equation*}\end{document } where \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \mu _ { ai}(\cdot ) $ \end{document } , \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \mu _ { bi\mathrm { -3}}(\cdot ) $ \end{document } , and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \mu _ { ci\mathrm { -6}}(\cdot ) $ \end{document } are three kinds of the membership functions , which are calculated using the mf parameter set \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ m=$ \end{document}{\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ m_{i,1}$ \end{document } , \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ m_{i,2}$ \end{document } , \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ m_{i,3}$ \end{document}}. in layer 2 and 3 , outputs \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ o_{\mathrm { 2},i}$ \end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ o_{\mathrm { 3},i}$ \end{document } are defined as the following ( 10 ) and ( 11 ) , respectively:\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } \begin{align } o_{2,i}=&{w}_{i } = \mu _ { a_{k } } \left ( { { i_{1 } } } \right ) \mu _ { b_{l } } \left ( { { i_{2 } } } \right ) \mu _ { c_{m } } \left ( { { i_{3 } } } \right ) , ~~ 1\le i\le 27 \\ o_{3,i}=&\frac { w_{i}}{\sum \limits _ { j } { w_{j}}}\left ( { { r_{i,1 } i_{1 } \!+\!r_{i,2 } i_{2 } \!+\!r_{i,3 } i_{3 } + r_{i,4 } } } \right ) , ~~ 1\le i\le 27\qquad \notag \\ { } \end{align } \end{document } where \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ r_{i,1}$ \end{document } , \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ r_{i,2}$ \end{document } , \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ r_{i,3}$ \end{document } , and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ r_{i,4}$ \end{document } are the lr parameter set \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ r$ \end{document}. the output of layer 4 is as follows:\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } \begin{equation * } o_{4,1 } = f=\sum \limits _ { i } { \frac { w_{i}}{\sum \limits _ { j } { w_{j}}}f_{i } } = \frac { \sum \limits _ { i } { w_{i } f_{i}}}{\sum \limits _ { i } { w_{i } } } \end{equation*}\end{document } the equation ( 12 ) produces a single coordinate of the predicted respiratory signal , i.e. , \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ x$ \end{document } , \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ y$ \end{document } , or \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ z$ \end{document } estimation . as mentioned above , the proposed iifdl uses three fdls for \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ x$ \end{document } , \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ y$ \end{document } , and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ z$ \end{document } coordinates , so that we can derive estimated 3d coordinates of breathing signals from those fdls . we describe the experimental data for intra- and inter - fraction motion , in subsection \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ a$ \end{document}. the experimental result of patient clustering based on breathing features are presented in subsection \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ b$ \end{document } , and we evaluate the prediction performance of the proposed iifdl in subsection \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ c$ \end{document}. breathing data of 130 patients were collected in georgetown university medical center using the cyberknife synchrony ( accuray inc . the collected data contained no personally identifiable information , and the research study was approved by the georgetown university irb . during data acquisition , three sensors were attached around a target position on the patient s body . individual patient s database contains datasets recorded through three channels by led sensors and cameras . each database contains a record time , 3d coordinates , and rotation data of three channels . the intra - fractional variation dataset had 130 databases , and the inter - fractional variation dataset consisted of 32 databases with at least 1-hour time difference in - between . each database contains a record time , 3d coordinates , and rotation data of three channels . the intra - fractional variation dataset had 130 databases , and the inter - fractional variation dataset consisted of 32 databases with at least 1-hour time difference in - between . sampling frequencies for patients variation data were 5.20 , 8.67 , and 26hz , corresponding to the measurement intervals , 192.30 , 115.38 , and 38.46ms . each database contains calibrated datasets of a record time , 3d coordinates , and rotational data of three channels . during the training procedure , we randomly extracted 1000 samples for each patient . the obtained samples regarding the measurement intervals were about 0.63min for 38.46ms , 1.92min for 115.38ms , and 3.2min for 192.30ms . table 4 shows experimental data of intra- and inter - fractional variation . in the intra - fractional variation dataset , all of 130 databases were used , and training and test data were randomly selected within 1-hour time range . in the inter - fractional variation dataset , however , we selected 32 databases . training and test data were selected with at least 1-hour time difference in - between them for the inter - fractional variation dataset . this time scale is not on the day - to - day level as the standard definition of the inter - fractional variation , but it meets the inter - fractional time scale condition of . actual inter - fractional motion data might be larger than data we chose because changes occurred in fractions on different days such as weight gain or loss were not contained in experimental data.table 4experimental data.data typeintra - fractional variationinter - fractional variationpatient # 13032measurement intervals ( ms)38.46 , 115.38 , and 192.30inputsestimated tumor locationoutputsnext tumor position in the current fractiontraining dataprevious tumor location data in the current fractiontumor location data in the previous fractionstest datacurrent tumor location data in the current fractioncurrent tumor location data in the current fraction we present the patient clustering results with the calculated criterion function values \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ j$ \end{document}. fig . 4(a ) shows criterion function values \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ j$ \end{document } regarding the number of clusters , where we represented the proposed iifdl as a red line with a \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \vartriangle $ \end{document} maker , and the alternate cnn as a blue dotted line with a \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \blacktriangledown $ \end{document} marker . 4(b ) and 4(c ) show criterion function values \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ j$ \end{document } of iifdl and cnn with regard to the possible breathing feature combination . figure 4.criterion function values \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ j$ \end{document } of the proposed iifdl and cnn : ( a ) \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ j$ \end{document } of iifdl and cnn according to the number of clusters , ( b ) \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ j$ \end{document } of iifdl according to the breathing feature combination , and ( c ) \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ j$ \end{document } of cnn according to the breathing feature combination . in iifdl , the number of cluster \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ c_{final}$ \end{document } was 11 and the optimal breathing feature combination y was chosen as brf and mle by ( 8) . in cnn , \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ c_{final}$ \end{document } was 12 and its y was a combination of acc , vel , and pca . criterion function values \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ j$ \end{document } of the proposed iifdl and cnn : ( a ) \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ j$ \end{document } of iifdl and cnn according to the number of clusters , ( b ) \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ j$ \end{document } of iifdl according to the breathing feature combination , and ( c ) \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ j$ \end{document } of cnn according to the breathing feature combination . in iifdl , the number of cluster \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ c_{final}$ \end{document } was 11 and the optimal breathing feature combination y was chosen as brf and mle by ( 8) . in cnn , \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ c_{final}$ \end{document } was 12 and its y was a combination of acc , vel , and pca . the proposed iifdl selected the number of cluster \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ c_{final}$ \end{document } as 11 with the maximum \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ j$ \end{document } of 5.825 as shown in fig . the optimal breathing feature combination y was chosen with brfand mle by ( 8) as shown in fig . the alternate cnn selected the number of cluster \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ c_{final}$ \end{document } as 12 , and its y was chosen with acc , vel , and pca as shown in fig . the reason of their different clustering results is that iifdl uses respiratory feature vectors , whereas cnn uses the magnitude values of respiratory feature vectors . considered all possible 247 combinations from 8 features ( \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \sigma _ { i}~_{8}\text{c}_{i}$ \end{document } , \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ 1 < i \le 8 $ \end{document } ) , the combination chosen by cnn had a local maximum value of \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ j$ \end{document } , as shown in fig . thus , the combination of acc , vel , and pca can not be ythat has the maximum \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ j$ \end{document}. therefore , cyberknife patient databases were grouped into 11 classes using the proposed iifdl , and the clustering results for intra- and inter - fractional variation data are presented in table 5.table 5patient database clustering.class number1234567891011total # of data - basesintra - fractional variation183522726192118130inter - fractional variation1110156n / a2n / a1532 in table 5 , 130 databases of the intra - fractional variation and 32 databases of the inter - fractional variation were grouped into 11 and 9 classes , respectively . each class showed the similar breathing features regardless of the variation type . in the intra - fractional variation , some classes ( e.g. class 1 , 4 , 7 , 9 , and 10 ) have only one or two patients . they are most likely considered as the irregular respiratory signals , due to their less feature similarities with other patients breathing signals . class 2 and 8 for the inter - fractional variation also have highly few patients , but we do not consider these classes as the irregular breathing signals . it is difficult to judge the scarcity of class 2 and 8 based on the few number of intra - fractional variation databases , also these two classes were already considered as regular breathing groups for the intra - fractional variation . in this subsection , we compare the prediction performance of the proposed iifdl with existing methods . especially , previous methods for the inter - fractional movement are mathematical models depending on predefined scenarios of patients variation , without the self - learning feature . the prediction performance of these methods is susceptible to how many potential scenarios were considered . in other words , there is a practical limitation to get decent performance results in the experiment with those mathematical models . accordingly , we chose the existing methods for intra - fractional prediction , cnn and hekf , as the comparison targets , and we applied the selected methods to the case of the inter - fractional variation . the predictors used in cnn and hekf are nn and a combination of nn and kf , respectively , as mentioned in section i. thus , these methods have the self - learning feature . furthermore , cnn is the prediction approach designed for multiple patients motion like the proposed iifdl . we evaluate the prediction performance of iifdl using by the following three criteria : root - mean - square error ( rmse ) , overshoot , and prediction time . 5 shows prediction results of two databases by iifdl , cnn , and hekf , with 115.38ms interval as a median of [ 38.46 , 192.30ms ] . 5 ( a ) and 5 ( b ) present the prediction results of the intra - and inter - fractional variation datasets . here , a horizontal axis is the time index extracted from cyberknife data . a black line is a measurement , a red line with a \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \vartriangle $ \end{document} marker illustrates predicted values by the proposed iifdl , a blue dotted line with a \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \blacktriangledown $ \end{document} marker is the estimated results of cnn , and an orange dotted line with a \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \blacktriangleright $ \end{document} marker represents the estimation results of hekf . also , two green dotted lines are upper and lower boundaries of target data , respectively . figure 5.prediction results for ( a ) intra- and ( b ) inter - fractional variation by iifdl , cnn , and hekf : ( a ) db47 and ( b ) db121 with 115.38ms interval . the estimated values of the proposed iifdl were closer to the target values , i.e. measurements , than those of cnn and hekf . prediction results for ( a ) intra- and ( b ) inter - fractional variation by iifdl , cnn , and hekf : ( a ) db47 and ( b ) db121 with 115.38ms interval . the estimated values of the proposed iifdl were closer to the target values , i.e. measurements , than those of cnn and hekf . 5 , the estimated points of the proposed method iifdl were closer to the target values than those of cnn and hekf . in fig . 5 , many points of cnn were distributed near or out of the boundaries , and most of the points of hekf were out of the range between upper and lower boundaries . however , the predicted values of iifdl were within the boundaries in most cases . the rmse comparison of the intra - fractional variation of each patients class showed that the proposed iifdl , cnn , and hekf had the similar rmse values overall , and iifdl outperformed cnn and hekf particularly in class 4 considered as irregular breathing signals . for the inter - fractional variation of each patients class , the experimental result also validated that the proposed iifdl is less vulnerable to the breathing irregularity . in table 6 , we summarized the average rmse and standard deviation values of iifdl , cnn , and hekf for each different measurement interval . based on those results , we also derived improvement rate of iifdl , determined by the following formula : ( rmse average of cnn / hekf - rmse average of iifdl)/rmse average of cnn / hekf \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \ast ~100 $ \end{document}%.table 6rmse comparison.variationintra-fractional variationinter - fractional variationmeasurement interval ( ms)38.46115.38192.30average38.46115.38192.30averageiifdl ( mm)0.190.210.290.410.510.750.330.460.120.280.280.730.732.060.381.02imp . rate ) \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ = $ \end{document } ( average of cnn / hekf - average of iifdl ) / average of cnn / hekf * 100% . . rate ) \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ = $ \end{document } ( average of cnn / hekf - average of iifdl ) / average of cnn / hekf * 100% . for given the measurement intervals of the intra - fractional variation in table 6 , the rmse results presented that all the average rmse and standard deviation values of iifdl were lower than those of cnn and hekf , except the interval of 192.30ms . although iifdl was worse than hekf in comparison on the average rmse result for the time interval of 192.30ms , the average rmse of iifdl was 0.03 mm larger than that of hekf , which is a relatively small difference . with decreased time interval from 192.30 to 38.46ms , the proposed iifdl had the more improvement rate from 11.81 to 90.54% for cnn and 6.86 to 54.36% for hekf . in the total results , the proposed method had the standard deviation of 0.46 mm , whereas cnn and hekf had fluctuating rmse values with the standard deviation of 6.16 mm and 0.92 mm . in comparison to the existing methods , the proposed iifdl improved 38.27% and 21.69% of the average rmse values , for each cnn and hekf , in the experiment of the intra - fractional variation . as show in table 6 , the experimental results for the inter - fractional variation represent that all rmse values of iifdl were lower than those of cnn and hekf . the proposed iifdl improved rmse more when the time interval was smaller , which is the same as the experimental results of the intra - factional variation . the proposed iifdl with the overall standard deviation of 1.02 mm showed higher error stability than cnn and hekf with the overall standard deviation of 3.86 mm and 3.53 mm . moreover , iifdl enhanced 59.02% and 60.44% of rmse in comparison to cnn and hekf as shown in table 6 . therefore , we can expect that the proposed method contributes to the radiotherapy by providing higher prediction accuracy and error stability . the prediction overshoot rate is also one of the criteria that enable to assess prediction accuracy of rmse , and it can be defined as a ratio of the estimated points are out of the boundary ranges to the total ones , here the range was determined by the 95% prediction interval of target data . 6 presents the overshoot results by iifdl , cnn , and hekf for the intra - fractional variation . the measurement interval was 115.38ms , which is a middle interval of [ 38.46 , 192.30ms ] . a horizontal axis is the patient database number , and a red , blue , and orange bar indicate the overshoot value of iifdl , cnn , and hekf , respectively . the measurement interval is 115.38ms , which is a middle interval [ 38.46 , 192.30ms ] . the proposed iifdl had less variation of the error values only up to 9.1% , but cnn and hekf showed occasionally huge overshoot results almost 100% . the measurement interval is 115.38ms , which is a middle interval [ 38.46 , 192.30ms ] . the proposed iifdl had less variation of the error values only up to 9.1% , but cnn and hekf showed occasionally huge overshoot results almost 100% . 6 , the proposed iifdl had less variation of the error values only up to 9.1% , but cnn and hekf showed occasionally huge overshoot results almost 100% . in the same vein with the experiment of rmse , the proposed method improved overshoot performance with higher stability in databases we utilized . in fig . 7 , we show the overshoot results of iifdl , cnn , and hekf for the inter - fractional variation to demonstrate the stability of the proposed iifdl . the measurement interval is 115.38ms , which is a middle interval [ 38.46 , 192.30ms ] . however , cnn and hekf had large overshoot results up to 100% and wider variance of the overshoot rates than the proposed iifdl . the measurement interval is 115.38ms , which is a middle interval [ 38.46 , 192.30ms ] . however , cnn and hekf had large overshoot results up to 100% and wider variance of the overshoot rates than the proposed iifdl . there was no overshoot value in class 10 . as the experimental results of intra - fractional variation , cnn and hekf had wider variance of the overshoot rates than the proposed iifdl . 7 , the existing methods , cnn and hekf had large overshoot results up to 100% . however , the maximum overshoot value of the proposed iifdl was 8.4% . in table 7 , we summarized average overshoot rates and their standard deviation values of iifdl , cnn , and hekf for each measurement interval.table 7overshoot comparison.variationintra-fractional variation ( % ) inter - fractional variation ( % ) measurement interval ( ms)38.46115.38192.30average38.46115.38192.30averageiifdl4.652.443.902.123.692.294.082.284.202.533.722.333.552.273.822.38imp . rate over cnn 57.9763.7479.0066.9085.6783.6171.8180.37imp . rate ) \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ = $ \end{document } ( average of cnn / hekf - average of iifdl ) / average of cnn / hekf * 100% . improvement rate ( imp . rate ) \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ = $ \end{document } ( average of cnn / hekf - average of iifdl ) / average of cnn / hekf * 100% . as shown in table 7 , all average overshoot rates of the proposed iifdl are considerably lower than those of cnn and hekf , in both experimental results for the intra- and inter - fractional variation . furthermore , standard deviation values of the overshoot rate had remarkable differences in between iifdl and two other methods . for the intra - fractional variation , the total standard deviation values of iifdl , cnn , and hekf were 2.28% , 26.78% , and 28.26% , respectively . overall results for the intra - fractional variation showed that the proposed method improves the overshoot percentage by 66.90% for cnn and 74.96% for hekf . for the inter - fractional variation , also , iifdl markedly reduced not only the average overshoot percentage but also the standard deviation . the overall improvement rates of iifdl was 80.37% for cnn and 86.17% for hekf in the experiment for the inter - fractional variation . to evaluate and compare effects on the computational complexity by the proposed iifdl , we measured average cpu time of each prediction method using a pc with intel core i7 3.07 ghz and 16.0 gb ram . table 8 compares the computing time of iifdl , cnn , and hekf for each measurement interval used in the experiment , where time difference represents the difference of the computing time between the previous methods and iifdl.table 8computing time comparison.variationintra-fractional variation ( ms)inter - fractional variation ( ms)measurement interval ( ms)38.46115.38192.30average38.46115.38192.30averageiifdl1.324.911.615.061.705.071.545.011.324.911.615.061.705.071.545.01time diff . from cnn 252.60250.99254.74252.78253.16249.94251.32251.47time diff from hekf 251.76251.47252.82252.02250.72253.36249.85251.31atime difference ( time diff . ) \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ = $ \end{document } computing time average of cnn / hekf - computing time average of iifdl . \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ = $ \end{document } computing time average of cnn / hekf - computing time average of iifdl . in the experimental results for the intra - fractional variation of table 8 , iifdl had the average computing time of 1.54ms and the standard deviation of 5.01ms , for all databases and intervals . the average computing time and the standard deviation were 254.32ms and 11.68ms for cnn and 253.56ms and 10.74ms for hekf . thus , the total average of the time difference reduced by iifdl was 252.78ms for cnn and 252.02ms for hekf . for the inter - fractional variation , the average computing time of the proposed iifdl was 1.54ms and its standard deviation was 5.01ms throughput all databases and measurement intervals . the average computing time and its standards deviation were 253.01ms and 9.17ms for cnn , and 252.85ms and 6.17ms for hekf . in the experiment for the inter - fractional variation , the total average of the time difference reduced by iifdl was 251.47ms for cnn and 251.31ms for hekf . as we mentioned in section ii , the proposed fdl , requires less prediction parameters than cnn and hekf . accordingly , the proposed iifdl could reduce the computing time immensely as shown in the experimental results in table 8 . moreover , iifdl and cnn train the multiple breathing signals simultaneously based on the respiratory feature similarities . for instance , there were 35 intra - fractional variation databases of patients in class 2 , and hekf needed to train the respiratory signals 35 times more than iifdl and cnn , to acquire the prediction results . thus , the proposed iifdl is expected to improve the prediction speed maintaining the prediction accuracy during the treatment session in the clinical perspective . table 9 compares the two kinds of variation regarding rmse , overshoot , and computing time.table 9experimental result comparison of intra- and inter - fractional variations.variationintra-fractional variationinter - fractional variationrmseiifdl average ( mm)0.330.38cnn average ( mm)0.970.98hekf average ( mm)0.421.01improvement rate ( cnn ( % ) /hekf ( % ) ) 38.27/21.6959.02/60.44overshootiifdl average ( % ) 4.083.82cnn average ( % ) 13.1421.54hekf average ( % ) 16.6229.89improvement rate ( cnn ( % ) /hekf ( % ) ) 66.90/74.9680.37/86.17computing time ( ms)iifdl average1.541.54cnn average254.32253.01hekf average253.56252.85time difference ( cnn / hekf)252.78/252.02251.47/251.31 for rmse and overshoot of the previous methods cnn and hekf , results of the inter - fraction variation were worse than those of the intra - fractional variation as shown in table 9 . this is because the respiration variability for the inter - fraction is larger than that for the intra - fraction . on the other hand , iifdl showed similar rmse and overshoot results for both intra- and inter - fractional variation . due to the reasoning capability of iifdl for uncertainty , the proposed iifdl achieved the similar level of the prediction results with the intra - fractional variation in the experiment for the inter - fractional variation . the proposed iifdl reduced it less than 2ms , which were over 250ms in the previous methods , cnn and hekf . additionally , this implies that iifdl can be used in real - time applications as the proposed method can estimate the next respiratory signal before it comes . specifically , the next breathing signal will come with the interval of 38.46ms to 192.30ms , and iifdl can calculate the estimated value within 2ms on average that is before termination of the time interval . we provide more comparison with other previous methods , , , , , in table 10 , to verify the accuracy performance of iifdl . the previous methods in table 10 were referred to in section i. as shown in table 10 , the proposed iifdl had the lowest error results among 9 methods . however , comparability is limited as experiments were not conducted in the identical environment . table 10error comparison with previous methods.methodiifdlcnn hekf af , siso af / miso af kf , nn , lp cubic intra - fractional variation ( mm)0.330.920.58<2.01.58 / 1.71<2.5<2.51.2n / ainter - fractional variation ( mm)0.380.981.01n / an / an / an / a4.64.7 in a curative setting , high radiation doses need to be delivered with high precision , and safety margines need to be added to the target to ensure sufficient dose coverage . however , safety margins and resulting side effects of radiotherapy compromise the ability to deliver tumoricidal treatment doses . as a result , local tumor reccurences occur in 30% of conventionally fractionated treatments and less than 10% of stereotactic applications . respiratory tumor motion range and consistency vary with patient , within one fraction and between repeated fractions with change in tumor motion range > 3 mm in 20% of fractions . in addition to addressing intra - fractional variation , this paper also investigated prediction for inter - fractional variation that might be larger than intra - fractional variation and therefore more challenging to address . compared to currently applied population - averaged margins between 3 and 10 mm in motion - inclusive treatment , margins can be significantly reduced according to the residual prediction error for the individual patient using motion - tracking and iifdl . the proposed iifdl can contribute to treatment planning to improve delivery accuracy , by adjusting the treatment field position according to the predicted intra- and inter - fractional variation . based on the experimental results above , we have validated that the proposed iifdl can estimate the next breathing signal before the next incoming signal arrives . therefore , iifdl is expected to achieve real time prediction in a stream computing environment if the prediction system tolerates measurement delay of respiratory signal . future studies may seek to identify correlations between tumor location in the lung , as well as patient - related parameters and comorbidities and predicted intra- and inter - fractional variation to even further improve prediction accuracy . in addition , further study can be conducted on prediction with other machine learning methods to improve prediction accuracy of tumor motion , which have not been introduced yet for estimating intra- and inter - fractional variation , such as support vector machines , . based on this algorithm , we also proposed the specific estimation method for intra- and inter - fractional variation of multiple patients , called iifdl . our approach has three main contributions to prediction of patients motion during a single treatment session and between different fractional sessions . first , the proposed method is the first study on the modeling of both intra- and inter - fractional variation for multiple patients respiratory data , collected from the cyberknife facility . second , the proposed iifdl might enhance tumor tracking techniques due to its high prediction accuracy . third , the proposed fdl , the predictor used in iifdl , has a much shorter computation time than other methods , so that the proposed iifdl shows the optimistic perspective on real - time prediction . the experimental results validated that the rmse value of the proposed iifdl was improved by 38.27% of cnn and 21.69% of hekf for the intra - fractional variation . for the inter - fractional variation , iifdr improved the average rmse values by 59.02% for cnn and 60.44% for hekf . the iifdl also improved the prediction overshoot by 66.90% for cnn and 74.96% for hekf for the intra - fractional variation . in a case of the inter - fractional variation , for the average computing time , the previous methods spent over 250ms for computation , but the proposed iifdl consumed less than 2ms . the outcomes of rmse and prediction overshoot demonstrate that the proposed method has more of a superb prediction performance than existing approaches . particularly , computation time results showed that iifdl can be considered as a suitable tool for real - time estimation .

tumor movements should be accurately predicted to improve delivery accuracy and reduce unnecessary radiation exposure to healthy tissue during radiotherapy . the tumor movements pertaining to respiration are divided into intra - fractional variation occurring in a single treatment session and inter - fractional variation arising between different sessions . most studies of patients respiration movements deal with intra - fractional variation . previous studies on inter - fractional variation are hardly mathematized and can not predict movements well due to inconstant variation . moreover , the computation time of the prediction should be reduced . to overcome these limitations , we propose a new predictor for intra- and inter - fractional data variation , called intra- and inter - fraction fuzzy deep learning ( iifdl ) , where fdl , equipped with breathing clustering , predicts the movement accurately and decreases the computation time . through the experimental results , we validated that the iifdl improved root - mean - square error ( rmse ) by 29.98% and prediction overshoot by 70.93% , compared with existing methods . the results also showed that the iifdl enhanced the average rmse and overshoot by 59.73% and 83.27% , respectively . in addition , the average computation time of iifdl was 1.54 ms for both intra- and inter - fractional variation , which was much smaller than the existing methods . therefore , the proposed iifdl might achieve real - time estimation as well as better tracking techniques in radiotherapy .

diabetes mellitus is a common endocrine disease that is characterized by chronic hyperglycemia and insulin deficiency or resistance which are associated with other complications such as macroangiopathy and microangiopathy . moreover , studies have also recorded that hyperglycemia can eventually induce the production of reactive oxygen species ( ros ) and nitric oxide ( no ) in the long run , increase cell apoptosis , decrease cell mass , and cause insulin deficiency and resistance . to date , the treatment for diabetes including insulin , metformin , and sulfonylureas was found to cause various side effects especially the development of resistance after a certain period of time . thus , efforts to search for alternative and novel therapies to manage diabetes are still receiving great attention . personalized nutritional management and physical activity have been recommended to replace the american diabetes association diet to achieve better glycemic control in diabetic patients . besides , complementary and alternative medicine in the form of plant - based food and spices that are commonly used in traditional medicine to treat diabetes have also been recommend as better oral agents . for example , momordica charantia ( bitter melon ) is a traditional antidiabetic remedy that has been identified as a potential hypoglycemic agent in streptozocin / alloxan - induced diabetic and type ii diabetic subjects . other than herbs , whole grains and cereals that serve as the source of energy in asian food have also been suggested as potential antidiabetic food due to their low - glycemic indices [ 6 , 7 ] . the glycemic index of a food is defined as an effect on postprandial glucose in comparison to the reference food . low - glycemic index foods have been proven to improve glycemic control of insulin and noninsulin - dependent diabetes mellitus . mung bean ( vigna radiata l. ) is a food that is traditionally used to reduce fever and used for detoxification . among all types of seeds , mung bean has been recommended as an alternative food for diabetic patients due to its high - fiber content and low - glycemic index . yao et al . had reported that ethanolic extract of mung bean was able to reduce blood glucose , total cholesterol , and tg levels while enhancing the glucose tolerance and insulin sensitivity in type ii diabetic mice . fermentation is a common food processing method traditionally practiced in the east and southeast asian regions to improve the food colour quality , flavour , or even the nutrient content . alterations made by microflora during the fermentation process may help to release the active ingredients that are beneficial to human health . fermented soybean , for example , was found to have better antidiabetic effect due to attenuation of the structures and contents of isoflavonoids and smaller bioactive peptides . although the antihyperglycemic effect of mung bean has been reported , the potential of fermentation in improving the antihyperglycemic and the antioxidant effect of mung bean is still unknown . thus , this study compared the effects of fermented and nonfermented mung bean extracts on normoglycemic , glucose - induced hyperglycemic and alloxan - induced hyperglycemic mice . the serum antioxidant levels of extracts treated alloxan - induced hyperglycemic mice were also evaluated in this study . alloxan , glucose , folin - ciocalteu reagent , ascorbic acid , gallic acid , and gsh assay kit were purchased from sigma - aldrich ( usa ) . momordica charantia was purchased from ccm pharmaceutical ( malaysia ) as positive control in this study . strain 5351 inoculums were obtained from the culture collection center of the malaysian agricultural research and development institute ( mardi ) . seeds of mung bean ( vigna radiate ) were subjected to solid - state fermentation before extraction . then , the fermented bean was dried and ground into powder followed by water extraction in the ratio of 1 g of fermented seeds in 20 ml of deionised water ( 25c ) for 30 minutes . the mixture was then centrifuged and the supernantant was freeze - dried at an operating temperature of 50c to obtain a final yield of 25% ( w / w ) . uplc analysis was performed on a acquity uplc system ( waters corp , usa ) coupled with acquity uplc accq tag ultra column ( 2.1 100 mm , 1.7 m ) and pda detector at 55c to analyse gaba and amino acid concentrations . gaba and amino acids were separated using a gradient mobile phase consisting of a : accq tag ultra eluent a and b : accq tag ultra eluent b with the following gradient conditions : 00.54 min , 0.19.1% b ; 5.747.74 min , 9.1%21.2% b ; and finally , reconditioning the column with 0.1% b with isocratic flow for 2.1 min after washing column with 59.6% b for 0.30 min . one l of all samples and standards were injected at a flow rate of 0.7 ml / min . the data were then analyzed using the waters empower 2 software . from the analysis , every 100 g of the nonfermented mung bean extract contained 0.016 0.001 g of gaba and 0.256 g of total amino acids . in contrast , the concentration of gaba in the fermented mung bean extract increased by 7.6-fold to 0.122 0.009 g/100 g of dried powder while the amount of amino acids increased by 13 fold to 3.326 g/100 g dried powder . the experiments were evaluated on normoglycemic , glucose - induced hyperglycemic , and alloxan - induced diabetic mice . the mice were subjected to 18 h of fasting before each test was carried out . balb / c mice ( 8 weeks old , 1822 g ) were purchased from the animal house in the institute of bioscience , university putra malaysia . standard laboratory pellet diet and water were made available ad libitum throughout the experimental period at 22c of dark - light cycle . this study was approved by the animal care and use committee of university putra malaysia . mice were randomly assigned into their respective groups for normoglycemic , glucose - induced hyperglycemic , and alloxan - induced hyperglycemic studies as listed below . blood glucose was collected from all experimental mice for analysis after 18 h of fasting . group i : normal control mice without any treatment ; group ii : m. charantia extract ( 200 mg / kg ) ; group iii : nonfermented mung bean extract ( 1000 mg / kg ) ; group iv and v : fermented mung bean extract ( 200 mg / kg and 1000 mg / kg , resp . ) . after 18 hours of fasting , blood glucose was determined ( 0 min ) before oral administration of distilled water or the respective extracts ( 0.3 ml / mice ) was given to each mouse . monitoring of blood glucose level was continued at 30 , 60 , 120 , and 240 min after the administration of treatment or distilled water . mice were randomly assigned into five different groups ( n = 8) as listed above . after 18 h of fasting , blood glucose level was determined at 0 min . then , oral feeding of distilled water or the respective extract was given simultaneously with 1 g / kg ( 0.3 ml ) of glucose solution to each group . monitoring of blood glucose level was continued at 30 , 60 , 120 , and 240 min after the oral administration . group 1 was the normal control mice that received distilled water as placebo while groups 26 were diabetic mice . diabetes was induced using intraperitoneal injection of alloxan ( 100 mg / kg , 0.1 ml ) . the hyperglycemic mice were maintained on 5% glucose solution for the next 24 h to prevent hypoglycemia and monitored for 3 days to ensure constant blood glucose levels before they were subjected to 18 hours of fasting . after the fasting period , blood glucose was determined at 0 min , followed by oral feeding with distilled water ( group 1 and 2 ) or the respective treatment . group 3 received m. charantia extract ( 200 mg / kg ) ; group 4 received nonfermented mung bean extract ( 1000 mg / kg ) ; group 5 and 6 received fermented mung bean extract ( 200 mg / kg and 1000 mg / kg , resp . ) . in addition , all the mice were also fed with glucose solution once ( 1 g / kg , 0.3 ml , p.o . ) . monitoring of blood glucose level was continued at 30 , 60 , 120 , and 240 min after administration . treatments with distilled water and the extracts were continued for a total of 10 days . on the last day of treatment , all mice were fasted for 18 h before being anesthetized with ether and sacrificed by cervical dislocation . blood was collected to obtain serum for determination of glucose , total cholesterol ( biovision , usa ) , triglyceride ( tg ) ( biovision , usa ) , low - density lipoprotein ( ldl ) ( biovision , usa ) , high - density lipoprotein ( hdl ) ( biovision , usa ) , and insulin ( mercodia , sweden ) levels . the antioxidant level of serum was evaluated by detecting the level of malondiadehyde ( mda ) as described previously while serum nitric oxide level was determined using the griess method ( invitrogen , usa ) . the results for blood glucose level , serum biochemical profiles , and antioxidant level were presented as mean s.d . one way analysis of variance ( anova ) followed by duncan test was used in this study with p values < 0.05 being considered as significant . overall , fermented mung bean , nonfermented mung bean , and m. charantia extracts did not produce any hypoglycemic effect but caused slight hyperglycemic effect within 2 hours of oral feeding in normal mice ( figure 1(a ) ) . however , for the glucose - induced hyperglycemic mice , the animals from all groups were found to develop high blood glucose levels at the first 30 minutes after oral administration ( figure 1(b ) ) . however , treatment with 1000 mg / kg body weight of fermented and nonfermented mung bean extracts could significantly reduce the elevated blood glucose level in comparison to the normal control group . although significant effect was also shown by the m. charantia extract treatment but the effect was comparatively weaker than in the previous groups . on the other hand , low concentrations of the fermented mung bean extract did not show any significant difference in antihyperglycemic effect when compared to the normal control . significant changes of body weights were observed in the untreated normal mice . for all the diabetic mice , changes of body weights were not significant ( figure 2 ) . treatments on day 15 were based on 22 g / mice while from day 6 to10 were based on 24 g / mice . generally , diabetic mice ( groups 2 to 6 ) gained less weight than normal mice ( group 1 ) during the treatment period ( figure 2 ) . nonfermented mung bean showed a hyperglycemic effect similar to the untreated diabetic mice in group 2 . m. charantia and fermented mung bean extracts ( 200 mg / kg body weight ) on the other hand were able to prevent drastic increases in blood sugar when compared to the untreated diabetic mice . among all treatment groups , high concentration of fermented mung bean extract ( 1000 mg / kg body weight ) was able to reduce blood sugar level most significantly throughout the period of monitoring ( 30 min to 2 hours after feeding ) ( figure 1(c ) ) . the alloxan - induced diabetic mice were monitored continuously in the following 10 days with continued treatment for groups 3 to 6 . untreated mice in group 2 maintained a high blood glucose level in comparison to mice in the other groups . the blood sugar levels of m. charantia , nonfermented mung bean , and low concentration of fermented mung bean ( 200 mg / kg body weight ) extracts treatment groups were found to be reduced slightly at day 10 while a high concentration of fermented mung bean extract at 1000 mg / kg body weight was able to reduce blood sugar levels even at day 5 after administration ( figure 1(d ) ) . the serum lipid profile and the insulin level of the alloxan - induced hyperglycemic mice after 10 days of treatment were assessed . untreated diabetic mice in group 2 showed significantly higher levels of total cholesterol and tg but lower levels of hdl and insulin . in contrast , a high concentration of fermented mung bean extract ( 1000 mg / kg body weight ) showed lower levels of total cholesterol and tg but higher levels of insulin and hdl in comparison to the nonfermented mung bean extract ( table 1 ) . similar to the effects on serum lipid profile and insulin levels , untreated diabetic mice in group 2 exhibited significantly higher mda and no levels . both m. charantia and fermented mung bean extracts were able to restore the antioxidant level more effectively than the nonfermented mung bean extract . besides , we also observed that the antihyperglycemic effect of the fermented mung bean extract was dosage dependent whereby a higher concentration of fermented mung bean ( comparing between group 5 and group 6 ) exhibited better antioxidant activity with lower no level ( table 1 ) . previously , m. charantia and mung bean have been reported as potential antidiabetic agents . low - glycemic - index mung bean was able to reduce plasma lipid level , epidilymal adipocyte volume and plasma insulin [ 68 ] . thus , mung bean has been recommended as a food of choice for diabetic patients . however , it is still uncertain whether fermentation could enhance the antidiabetic effect of mung bean . in this study , we have compared the antihyperglycemic effects of fermented and nonfermented mung bean extracts in normoglycemic , glucose - induced hyperglycemic , and alloxan - induced hyperglycemic mice . normal fasting blood glucose for mice is around 90 mg / dl ( ~5 mmol / l ) . animals having fasting blood glucose levels more than 200 mg / dl ( ~11 changes of fasting blood glucose of normaglycaemic and glucose - induced hyperglycaemic mice which were 20% lower than those of the untreated normal control were considered as hypoglycaemia . all the extract - treated mice in the normoglycemic study showed slight increases in blood sugar without indication of hypoglycemic effect . this outcome may be contributed by the primary metabolites that are present in the water extract , or more specifically by the carbohydrates in this context . however , in both glucose- and alloxan - induced hyperglycemic mice , m. charantia , fermented and non - fermented mung bean extracts were able to reduce oral glucose tolerance to prevent drastic glucose increase in the blood . these results suggested the possibility of using fermented and nonfermented mung bean extracts for regulating blood sugar via their antihyperglycemic effects , which could enhance glucose adsorption in the gut . continued administration of the extracts for 10 days had also been associated with blood sugar reduction ( figure 1(d ) ) . fermented mung bean extract at 1000 mg / kg body weight showed the best reductions of blood sugar levels of diabetic mice at day 5 . m. charantia , nonfermented mung bean , and low concentration of fermented mung bean extracts showed similar trends of reduction at day 10 . the findings from this study were in good agreement with a previous report on the assistance of m. charantia in the regulation of blood sugar via improved insulin sensitivity and recovery of -cells in the pancreas after 12 days of treatment . in this study , fermented mung bean ( 200 mg / kg body weight ) and non - fermented mung bean exhibited a trend of blood sugar regulation similar to that of m. charantia extract . therefore , fermented and nonfermented mung bean extracts could also possibly regulate blood sugar level by enhancing the sensitivity of insulin and by the regeneration of -cells in the pancreas . clinical studies had reported that low - glycemic - index diet contributed small effects on the control of postprandial hyperglycemia in diabetic patients . thus , the improved antidiabetic effect due to fermented mung bean may be contributed by the enhancement of phytochemicals during the fermentation process . advances in the effectiveness for controlling glucose metabolism through fermentation were also reported for soy bean [ 2 , 16 ] . solid state fermentation was predicted to improve the antidiabetic effect of mung bean via enrichment of antioxidants and phytochemicals . in this study , we have found that enhanced blood sugar regulation by a high concentration of fermented mung bean may be contributed by the enriched gaba content ( 7.6 fold ) in the extract as compared to the nonfermented mung bean . the regenerative effect of gaba on islet -cell via activation of pi3-k / akt - dependent growth and survival pathways had been reported by soltani et al . and tian et al . free amino acids ( 13 fold increase in fermented mung bean ) had also been reported as an effective oral supplement for diabetic patients . among the tested free amino acids , lysine which recorded a marked increase in the fermented mung bean ( 0.001 g/100 g dry weight of nonfermented mung bean and 0.134 g/100 g dry weight of fermented mung bean ) ( result not shown ) had also been reported as being an enhancer to the insulin - receptor tyrosine kinase activity in type ii diabetic patients . these free amino acids or more specifically lysine may contribute synergistically with gaba to regulate the blood glucose of the fermented mung bean - extract treated diabetic mice . elevated serum lipid profile including cholesterol , tg , ldl with low hdl level is one of the pathogenesis of diabetes that also representing the risk factor for coronary heart disease . in this study , alloxan - treated diabetic mice was observed with high serum cholesterol , tg , and ldl when compared with normal mice . treatment with m. charantia , fermented and nonfermented mung bean extracts were able to reduce the risk factors for coronary heart disease by restoring the healthy lipid profile in the alloxan - induced diabetic mice . other than a higher lipid profile , the serum of diabetic patient was also indicated with higher level of mda and oxidative stress [ 22 , 23 ] . fermentation was able to improve the in vitro antioxidant and phenolic contents of mung bean . this effect may contributed greatly to the reduction of the mda level of the fermented mung bean extract ( 1000 mg / kg body weight ) treated diabetic mice . besides , our results also showed that fermented mung bean extract was able to reduce the nitric oxide ( no ) level in the serum of the alloxan - induced diabetic mice in a dosage dependent manner . where ethanolic extract of mung bean showed anti - inflammatory effect and reduced no synthesis in a macrophage cell line . thus , the significant reduction of no by a high concentration of fermented mung bean extract may indirectly help to reduce the damage of -cell . in this study , fermented mung bean extract further improved the antihyperglycemic effect of nonfermented mung bean extract in both glucose and alloxan - induced hyperglycemic mice . this effect may be due to the improvement of the gaba and free amino acid contents through the fermentation process . investigating on the details mechanism of fermented mung bean 's antihyperglycemic effect are still on - going .

mung bean was reported as a potential antidiabetic agent while fermented food has been proposed as one of the major contributors that can reduce the risk of diabetes in asian populations . in this study , we have compared the normoglycemic effect , glucose - induced hyperglycemic effect , and alloxan - induced hyperglycemic effect of fermented and nonfermented mung bean extracts . our results showed that fermented mung bean extracts did not induce hypoglycemic effect on normal mice but significantly reduced the blood sugar levels of glucose- and alloxan - induced hyperglycemic mice . the serum levels of cholesterol , triglyceride ( tg ) , and low - density lipoprotein ( ldl ) were also lowered while insulin secretion and antioxidant level as measured by malonaldehyde ( mda ) assays were significantly improved in the plasma of the fermented mung bean - treated group in alloxan - induced hyperglycemic mouse . these results indicated that fermentation using mardi rhizopus sp . strain 5351 inoculums could enhance the antihyperglycemic and the antioxidant effects of mung bean in alloxan - treated mice . the improvement in the antihyperglycemic effect may also be contributed by the increased content of gaba and the free amino acid that are present in the fermented mung bean extracts .

thirty - three eyes of 33 patients who underwent implantation of pc iols into the ac between may 2006 and july 2008 were evaluated retrospectively . fourteen eyes had inadequate support due to posterior capsular rupture during phacoemulsification , and 19 eyes were previously aphakic . the procedures were performed under topical or subconjunctival anesthesia . if the remaining capsular support was considered to be insufficient for iol implantation during phacoemulsification , an anterior vitrectomy was performed and acetylcholine was injected into the ac for miosis . the vacuum level of the vitrectomy was set to 200 mmhg and the frequency to 50 cuts / min . two iridectomies were performed on the midperipheral iris with a vitrectomy cutter at the 7 and 1 oclock positions . the iols were implanted in the ac with the haptics passing through the iridectomies to the pc . the first five patients received polymethylmethacrylate ( pmma ) iols ( aurolab , madurai , tamil nadu , india ) , while single piece foldable iols ( ocuva , vsy , istanbul , turkey ) were implanted in the remaining 28 patients . ( a ) intraoperative posterior capsule rupture and desantralization of the sulcus - fixated iol . ( d - f ) using the same probe at 50 - 100 mmhg vacuum , two iridectomies were created at the 1 and 7 oclock positions . ( g and h ) iol haptics were implanted into the iridectomies using a dialer with the aid of ocular viscoelastic substance . ( i - o ) suturation of the inferior and superior iol haptics to the iris using mccunnel 's technique the procedures were performed under topical or subconjunctival anesthesia . if the remaining capsular support was considered to be insufficient for iol implantation during phacoemulsification , an anterior vitrectomy was performed and acetylcholine was injected into the ac for miosis . the vacuum level of the vitrectomy was set to 200 mmhg and the frequency to 50 cuts / min . two iridectomies were performed on the midperipheral iris with a vitrectomy cutter at the 7 and 1 oclock positions . the iols were implanted in the ac with the haptics passing through the iridectomies to the pc . the first five patients received polymethylmethacrylate ( pmma ) iols ( aurolab , madurai , tamil nadu , india ) , while single piece foldable iols ( ocuva , vsy , istanbul , turkey ) were implanted in the remaining 28 patients . ( a ) intraoperative posterior capsule rupture and desantralization of the sulcus - fixated iol . ( d - f ) using the same probe at 50 - 100 mmhg vacuum , two iridectomies were created at the 1 and 7 oclock positions . ( g and h ) iol haptics were implanted into the iridectomies using a dialer with the aid of ocular viscoelastic substance . ( i - o ) suturation of the inferior and superior iol haptics to the iris using mccunnel 's technique the mean age of the 16 men and 17 women was 56.3 12.2 years . fourteen eyes had inadequate posterior capsular support due to posterior capsular rupture during phacoemulsification and underwent primary iol implantation . nineteen eyes that had previously been left aphakic for various reasons underwent secondary iol implantations . mild corneal edema , which resorbed in 5 - 7 days , was detected in eight of 14 patients with primary iol implants . pupillary block developed in two of the first five patients who had received a pmma iol , and neodymium - doped yttrium aluminum garnet ( nd : yag ) laser iridotomies were performed to relieve the block in these eyes . one of the patients with a pmma iol presented with dislocation of the haptic into the ac . the haptic was resutured to the iris with a 10/0 nylon suture for this patient . none of the patients had longlasting corneal edema , iris atrophy , uveitis , corneal contact with iol , or retinal detachment during the follow - up period . pigment dispersion was seen in four patients ; however , we did not document any pigmentary glaucoma . while mild guttata was seen in five eyes during the follow - up period , none of the eyes had corneal decompensation . a marked increase in visual acuity was observed in the patients with posterior capsular rupture during surgery compared to the preoperative levels ( 20/50 versus 20/25 ) , while visual acuity increased moderately from 20/40 to 20/30 in those who were previously aphakic and underwent secondary iol insertion . posterior capsular rupture is also a well - known intraoperative complication of cataract surgery . in the presence of a posterior capsular tear , an iol can be placed in the sulcus if the capsular rim is available , or in the bag if the tear is small . if the remaining capsule does not offer sufficient support for the iol implantation , the surgeon may choose one of following options : ac iol , iris - claw iol , iris - sutured iol , pc iris - sutured iol , sutureless iol with iris anchors , or scleral - fixated lol . ac iols and scleral - fixated iols are generally recommended when capsular support is insufficient or absent . complications associated with ac iols , including postoperative inflammation , pupillary transformation , glaucoma , and the loss of corneal endothelial cells have been reported . even though there is no contact between scleral - fixated iols and the fine structures of the ac angle and corneal endothelium , these iols also have some drawbacks , which limit their usage . recently , totan and karadag reported sutureless scleral fixation of a three - piece foldable iol using 25-gauge transconjunctival sutureless vitrectomy trocars in patients with insufficient posterior capsule support . iris - claw iols may be a good alternative , however higher costs limit their extensive usage . by implanting a pc iol in the ac through two iridectomies , the optics and haptics of the iol are placed in positions that are far from the corneal endothelium and the ac angle . we observed that patients had transparent corneas , centralized iols , and iol haptics that fitted into the iridectomies throughout the follow - up period . the number of patients with complications was very small , and the complications were negligible and not vision - threatening . we also found that primary iol implantations gave better postoperative visual results compared to secondary implantations . the main limitation of the study is the lack of availability of data associated with corneal endothelium pre- and postoperatively . we created the iridectomies at one and seven oclock positions 180 apart from the midperipheral iris . , iol dislocation may be due to large iridectomies , loose sutures or suture release , or the inappropriate positions of opposed iridectomies . however , iol dislocation in this technique can easily be overcome by resuturing the haptic into position . the surgical correction of an iol dislocation in our technique is less traumatic and complicated than that for sclera - fixated or posterior iris - fixated iols . this study suggests that this technique is a practical alternative that leads to favorable visual outcomes and minimized risk of complications in eyes without adequate capsular support . however , a long - term study on a large population is required to confirm these findings .

we aimed to evaluate the implantation of a posterior chamber intraocular lens ( iol ) in the anterior chamber ( ac ) with the haptics passing through two iridectomies to the posterior chamber . a total of 33 eyes of 33 patients with inadequate posterior capsular support due to either previous aphakia or posterior capsular rupture during cataract extraction were included in the study . a double iridectomy was performed on all patients using a vitrectomy probe on the midperiphery of the iris . iols were implanted in the ac , and the haptics were passed through the iridectomies to the posterior chamber . the mean follow - up time was 25.3 months . ac hemorrhage occurred in five patients during the iridectomy procedure . corneal edema was detected in eight of 14 patients with primary iol insertions . haptic dislocation was detected in only one patient . this technique may be a good alternative to scleral - fixated iol implantation in eyes with aphakia .

most commonly affects people of african descent . in nigeria , sickle cell anaemia affects about 1 - 3% of the nigerian population . individuals who have only one copy of the mutation are said to have sickle cell trait.12 these people are usually healthy but can transmit the disease to their children.3 sickle cell anaemia is characterised by acute episodes of pain ( in the abdomen , chest or joints ) and exhibits a range of severity.45 sickle cell disease is a condition which alters the shape of the red blood cells from round to sickle shape , causing them to block small blood vessels and interfere with normal blood flow . children affected with sickle cell disease experience chronic episodes of pain and an increased susceptibility to potentially life - threatening conditions , including bacterial infections and organ failure . at the present time , there is no cure for sickle cell anaemia . although there are some altering therapies such as hydroxyurea and hematopoietic cell transplantation for the management of sickle cell disease , but these can have serious side effects and are very risky the average life expectancy for people with sickle cell anaemia is less than 50 years . the first deoxyribonucleic acid ( dna ) diagnostic procedure for prenatal purposes was reported more than thirty years ago.6 subsequently , it was recognised that the mutation itself affected the cleavage site of a restriction enzyme , ddei , that could recognize the dna sequence of ctnag ( n = a , t , c , or g ) . while dna from a normal allele ( ctgag ) would be digested by the enzyme , dna from an affected allele in which a is substituted by t ( ctgtg ) would not.78 the resulting differences between dna fragment sizes can then be recognised by electrophoresis , thus forming the basis for diagnosis . with the advent of polymerase chain reaction ( pcr ) , rapid dna analysis methods have become available , and these techniques are now widely used for prenatal diagnosis.910111213 pre - implantation genetic diagnosis ( pgd ) is a procedure that has emerged against the backdrop of in vitro fertilisation ( ivf ) technology . in nigeria , this process of ivf was first introduced by ashiru et al.14 following their pioneering work , we were able to advance this technique for patients with infertility,1516 and now for patients with advanced maternal age and sickle cell disorders with the use of pgd . with pgd , the genetic status of an embryo can be determined before transfer into the uterus after ivf , thus almost completely eliminating the risks of bearing a child with the disease17(pgd is not 100% accurate ) . the most common form of pgd involves the extraction of one or two cells from the pre - implantation embryo , often around the 8-cell stage . couples at risk for the transmission of genetic diseases can now choose ivf and pgd to avoid the problem of selective abortion that is associated with pre - natal diagnosis during pregnancy . the patient was a 29-year - old woman and spouse with heterozygous genotype ( as ) . couple already have a 2-year - old child who is affected with sickle cell anaemia . prior to ovarian stimulation , hysterosonogram ( hsn ) was done which revealed normal uterine cavity . the protocol was also approved by the research and ethics committee of the centre . following 3 weeks of oral contraceptive use , the patient was down - regulated using a gnrhanalog ( leuprolide ) . super ovulation was achieved with the use of recombinant follicle stimulating hormone ( fsh ) . when three or more leading follicles measured > 18 mm in diameter , the patient was triggered with human chorionic gonadotropin ( hcg ) 5000 iu . the surrounding cumulus and corona cells were then removed and the nuclear maturity of the oocytes was assessed under an inverted microscope . only metaphase ii oocytes were injected with morphologically normal motile spermatozoa . further culture of injected oocytes was done in 20 l microdrops of culture medium under lightweight paraffin oil . fertilisation was confirmed after 16 - 18 hours by the observation of two distinct pronuclei ( 2pn ) . oocytes with 2pn were assessed on day 2 after injection for embryonic development . on day 3 , a single blastomere was biopsied for embryos at 6 - 8 cell stage with less than 50% fragmentation [ figures 1 and 2 ] . blastomere showing nucleus fifteen biopsied cells were sent for genetic screening and analysed using pgd / pcr technique [ figure 3 ] . results provided after 48 hours showed that 5 ( 33% ) of the biopsied cells were of genotypes unaffected by sickle cell anemia ; of these , three were heterozygous carriers of hb s ( as ) and two were homozygous for hba ( aa ) . three unaffected embryos ( two heterozygous normal and one homozygous ) were transferred on day 5 at blastocyst stage . endometrial lining was prepared for fet using increasing doses of estradiolvalerate from 2 mg daily up to 8 mg with weekly monitoring of the endometrium . two vitrified normal embryos ( one hbas and one hbaa ) were thawed both at hatched blastocyst stage and transferred [ figure 4 ] . the advent of ivf as a treatment for infertility has created the opportunity to study the chromosomal constitution of surplus human pre - implantation embryos . cultured human pre - implantation embryos have been used to develop methods which allow pgd analyses by pcr on biopsied blastomeres from an embryo.18 beta - thalassaemia and sickle cell anaemia are -globin chain quantitative and structural disorders that lead to anaemia syndromes . until recently , the only alternative for couples with a high genetic risk was to undergo prenatal diagnosis followed by termination of an affected pregnancy . the pgd of -thalassaemia and sickle cell anaemia is an alternative that avoids therapeutic abortion by diagnosing embryos for -globin defects before implantation into the mother 's womb.19 on a world - wide scale , pgd for -thalassaemia and/or sickle cell anaemia has already been applied on single blastomeres20 and on the first and second polar bodies.21 the molecular strategies used were dna amplification followed by genetic diagnosis by denaturing gradient gel electrophoresis analysis,20 restriction enzyme digestion , the creation of a new restriction enzyme recognition sequence involving the ivs1 nt 110 mutation2122 and the use of fluorescence pcr.22 in the present study , pgd was applied clinically for sickle cell anaemia on a fertile carrier couple with previous experiences of therapeutic abortion for affected foetuses , and a sickle cell disease child . despite the fact that sickle cell anaemia is one of the most common genetic disorders and detailed genetic information is available,23 unaffected pregnancies following pgd for sickle cell anaemia previously have not been reported . lack of previous success in this area presumably is due to the length of time and effort required to overcome technical difficulties inherent in these procedures , as well as lack of available research funding.17 our results demonstrate that sickle cell anaemia can be detected in single cells by pcr and restriction enzyme analysis and that unaffected pregnancies can be established by the transfer of embryos of known genetic makeup that have undergone biopsy . in total , one pgd cycle with a frozen embryo transfer cycle were carried out . the goal of pgd is to reduce the risk of having children born with genetic diseases from a priori risk of 25% to a value significantly less . patients undergoing pgd should be advised that if a pregnancy does occur from this treatment , they should consider undergoing chorionic villi sampling ( cvs ) or amniocentesis to confirm these micro - genomic results . in summary , this is the first unaffected pregnancy and delivery after successful pgd for sickle cell anaemia . our results demonstrate that pgd for the detection of sickle cell anaemia is a powerful diagnostic tool for carrier couples who desire a healthy child but wish to avoid the difficult decision of whether to abort an affected foetus . the procedure , successfully used in this case , may also be applied to other monogenic disorders and further supports the notion that pgd is destined to be an integral aspect of assisted reproductive technology . given the current methods and relatively high cost of the procedure , it is unlikely that pgd will totally replace prenatal testing . however , it is conceivable that with further refinements , pgd will certainly become an invaluable and powerful diagnostic modality .

a couple , both carriers of the sickle cell anaemia trait ( genotype hbas ) with an offspring already affected with the genetic disease underwent a pre - implantation genetic diagnosis / polymerase chain reaction screening of biopsied blastomeres . dna analysis of single blastomeres was carried out to find out indicated a viable intra - uterine pregnancy with embryos which carried the sickle cell mutation , which resulted in a livebirth ( hbas ) . pgd / pcr in combination with ivf appears to be the most suitable treatment plan for patients who are at a higher risk of reproducing offspring affected with inheritable genetic diseases .

using metagenomic deep sequencing , we analyzed fecal samples from 180 infants and children ages 7 days96 months ( mean 18.7 months ) in tunisia who had unexplained diarrhea that tested negative for rotavirus , norovirus , astrovirus , sapovirus , adenovirus types 40 and 41 , and aichi virus by reverse transcription pcr ( 7 ) . the fecal supernatants were filtered through a 0.45-m filter ( millipore , darmstadt , germany ) to remove bacterium - sized particles , and the filtrates were digested with a mixture of dnases ( turbo dnase from ambion , carlsbad , ca , usa ; baseline - zero from epicenter , madison , wi , usa ; and benzonase from novagen , san diego , ca , usa ) and rnase ( fermentas , pittsburgh , pa , usa ) to digest unprotected nucleic acids . enriched viral nucleic acids ( rna and dna ) were then extracted and amplified by using scriptseq v2 rna - seq library preparation kit ( epicenter ) and analyzed in pools of 10 specimens in 2 illumina miseq run of 250-bp end reads , yielding 20,693,619 unique sequences . we compared the illumina sequences with the genbank nonredundant protein databases using blastx ( http://blast.ncbi.nlm.nih.gov/blast.cgi ) . using a blastx e - score cutoff of 10 , we identified , in decreasing frequency , sequences related to the mammalian viruses : sapovirus ( 120,177 reads ) , anelloviridae ( 14,841 reads ) , parechovirus ( 10,557 reads ) , norovirus ( 4,551 reads ) , enterovirus ( 3,857 reads ) , circoviridae ( 2,127 reads ) , group a rotavirus ( 839 reads ) , adeno - associated virus ( 812 reads ) , picobirnavirus ( 274 reads ) , bufavirus ( 168 reads ) , wu polyomavirus ( 136 reads ) , bocavirus ( 62 reads ) , adenovirus ( 58 reads ) , papillomavirus ( 22 reads ) , cosavirus ( 20 reads ) , group c rotavirus ( 17 reads ) , human astrovirus 1 ( 14 reads ) , salivirus ( 4 reads ) , and aichi virus ( 2 reads ) . one pool showed a single read encoding a parvovirus - like protein segment with high levels of genetic similarity ( blastx e - score of 5 10 ) to the nonstructural protein ( ns ) 1 of rat parvovirus ( genbank accession no . was then identified by using pcr and underwent further deep sequencing as above , generating 11 more parovirus sequences . no other eukaryotic viral sequences were identified from 260,000 unique sequence reads from this patient . the near complete parvovirus genome was then acquired by filling genome gaps by pcr and amplifying 5 and 3 extremities using race ( rapid amplification of cdna ends , life technologies ) . we named this virus tusavirus 1 for tunisian stool - associated parvovirus . a nearly complete 4,424-bp genome ( tusavirus 1 , genbank accession no . kj495710 ) was successfully acquired with partial 5 untranslated region ( 243 bp ) , complete ns1 open reading frame ( 625 aa ) , complete viral protein ( vp ) 1 open reading frame ( 715 aa ) , and a partial 3 untranslated region ( 68 bp ) . tusavirus has a potential upstream start codon mss in a weaker kozak consensus sequence than maq ( figure , panel a ) , which we selected as the start codon . the walker loop gpattgks [ gxxxxgk(t / s ) ] , which is an atp- or gtp - binding motif , was found in the ns1 . potential splicing signals to express vp1 were identified on the basis of alignments to other protoparvoviruses and classic rna splicing motifs ( figure , panel a ) . the phospholipase a2 ( pla2 ) motif was identified in vp1 n - termini with expected calcium - binding site and catalytic residues . the methionine codon of vp2 was located upstream of glycine - rich sequence ( gggaraggvg ) . an unusual serine - rich sequence ( sssdsgpsss ) was also seen near vp1 n - termini . the alignment of the pla2 regions of representatives of 5 protoparvovirus species show the calcium - binding region and catalytic residues in tusavirus . pairwise sliding window of percentage nucleotide similarity of tusavirus aligns with the genetically closest kilham rat parvovirus . b ) phylogenetic trees generated with nonstructural protein ( ns ) 1 and vp1 of tusavirus and of the 5 international committee on taxonomy of viruses designated species in the protoparvovirus genus . fpv , feline parvovirus ; mev , mink enteritis virus ; cpv , canine parvovirus ; rapv , raccoon parvovirus ; rpv1 , rat parvovirus 1 ; mvmp , minute virus of mice , prototype ; hapv , hamster parvovirus ; ppv - kr , porcine parvovirus kresse ; simian bupv , simian bufavirus ; bupv1 , bufavirus 1 ; bupv2 , bufavirus 2 ; amdv , aleutian mink disease virus ; gfav , gray fox amdovirus ; b19v - lali , human parvovirus b19-lali . bootstrap values ( based on 100 replicates ) for each node are given if > 70% . protein sequence alignments were made by using clustalx version 2.0.3 ( http://www.clustal.org ) with the default settings ; a phylogenetic tree with 100 bootstrap resamples of the alignment datasets was generated by using the neighbor - joining method based on the jones - taylor - thornton matrix - based model in mega5 ( http://www.megasoftware.net ) . phylogenetic analysis showed that tusavirus 1 was distinct from known members of the protoparvovirus genus ( figure , panel b ) . vp1 and vp2 shared identities of 39% and 37% , respectively , to those of kilham rat parvovirus . according to the international committee on taxonomy of viruses , the members of the same parvovirus genus should share > 30% and members of the same species > 85% aa identity in ns1 . the protoparvovirus genus currently comprises species infecting carnivores , rodents , pigs , and humans ( 1 ) . tusavirus 1 is proposed as prototype for primate protoparvovirus 2 species that would join bufaviruses as human viruses in this genus . we used a nested pcr targeting ns1 to determine the prevalence of this virus in the 180 tunisia diarrhea samples . primers tusa - f1 ( 5-gaagaagctggaaactgtggtca-3 ) and tusa - r1 ( 5-ctcgtctttctcccaggcatct-3 ) were used for the first round of pcr , and primers tusa - f2 ( 5-attgctccaacaccagtcatca-3 ) and tusa - r2 ( 5-tctggtctggtccaatcttcttc-3 ) for the second round of pcr . the pcr conditions were : 95c for 5 min , 35 cycles 95c for 30 s , 52c or 51c ( for the first or second round , respectively ) for 30 s , and 72c for 1 min , a final extension at 72c for 10 min . no samples except the one initially detected by deep sequencing were pcr positive , yielding a low prevalence of 0.56% ( 1/180 ) in this tunisian population . we detected fecal shedding of a previously uncharacterized parvovirus in a child with unexplained diarrhea . the 18-month - old girl showed twice daily liquid and greenish feces over 3 days but no fever ( 37.4c ) , vomiting , or dehydration . to identify other viral infections in this patient , no other mammalian virus was detected , suggesting a possible role for tusavirus 1 in this patient s gastrointestinal illness , although the lack of testing for pathogenic bacteria and parasites does not enable us to exclude these alternative explanations . control pcr studies of unexplained diarrhea and serologic tests , are needed to define the prevalence and disease association of this new parvovirus species in different age groups and populations .

a divergent parvovirus genome was the only eukaryotic viral sequence detected in feces of a tunisian child with unexplained diarrhea . tusavirus 1 shared 44% and 39% identity with the nonstructural protein 1 and viral protein 1 , respectively , of the closest genome , kilham rat parvovirus , indicating presence of a new human viral species in the protoparvovirus genus .

noncoding regions are the major part of eukaryote genomes , and most of them are believed to evolve neutrally ( kimura 1983 ) . under this assumption , we expect that the frequency of a particular short oligonucleotide , or dna word , of 10 bp or shorter should be primarily determined through accumulation of neutral mutations , and the total set of frequencies of all dna words of certain length should follow some simple statistical rules . oligonucleotide frequencies of one genome can provide a useful mechanism of genome comparison ( karlin 2005 ) , including phylogeny reconstruction ( takahashi et al . most frequently , such comparisons are based on a dinucleotide composition model ( karlin and mrazek 1997 ; gentles and karlin 2001 ) or on self - organizing maps ( abe et al . 2003 ) . we created a series of statistical models predicting the frequencies of word of up to 4 nt in a genome . we retrieved all available complete eukaryote and prokaryote genomes , constructed such models for them , and compared the actual word frequencies with those predicted by the models to determine the discrepancy . here , we present a database , called genome composition database ( gcd ) , which shows how accurately each genome can be approximated by a model . the unique point of this database is that it allows to compare compositional complexity of genomes and to analyze over- or underrepresentation of particular oligonucleotides . 2007 ) , ensembl ( http://uswest.ensembl.org/ ; flicek et al . 2012 ) , university of california santa cruz ( http://genome.ucsc.edu/ ; fujita et al . 2011 ) , flybase ( http://flybase.org/ ; mcquilton et al . 2012 ) , and wormbase ( http://www.wormbase.org/ ; harris 2010 ) . genome sequences of a total of 1,228 species ( 101 eukaryotes , 1,043 eubacteria , and 84 archaea , as of june 2010 ) were used to construct the database . for every genome , we created a series of five composition models : uniform ( composition of a , c , g , and t are set to be all 25% ) , mononucleotide , dinucleotide , trinucleotide , and tetranucleotide . each composition model is based on the total size and word frequencies of an actual genome . we use both dna strands to perform the word counting , so the number of g bases is always same with number of c , same for a and t , and each dna word has the same frequency with its reversed complementary counterpart . among the 16 dinucleotides , there are 12 that differ from their reversed complementary dinucleotide and 4 that are identical to their reversed complementary one ( cg , gc , at , and ta ) . therefore , the first group of dinucleotides can be described with six frequencies ( 12/2 ) and the second with four . subtracting one , and adding the genome size , we obtain ten parameters for the dinucleotide model . in case of trinucleotide frequencies , none of the trinucleotides are identical to their reversed complementary counterpart , so the model has 4/2 = 32 parameters . in tetranucleotide case , there are 16 tetranucleotides that are identical to their reversed complementary counterparts , so the tetranucleotide model has ( 4 16)/2 + 16 = 136 parameters . for a genome g of total length m and a dna word w , a composition model can be used to compute p(w ) , which is the probability of observing w at any particular position in the genome . for example , the uniform composition model gives(1)where l is the length of w. the mononucleotide composition model predicts(2)where wi is the ith nucleotide of w , f(x ) is the observed frequency of x in the genome sequence , and c(x ) is the complementary sequence to x. using the same principle , p(w ) from dinucleotide , trinucleotide , and tetranucleotide composition models can be computed . the model expectation of the frequency of word w in both strands of the modeled genome is then given as follows:(3 ) then , we can define the deviation of the observed frequency from the expected frequency:(4 ) because each of the composition models assumes independence of different genome positions from each other , e(w ) follows the binomial distribution , and its variance can be computed as follows:(5 ) the standard deviation of e(w ) is its square root . we then can define the relative abundance of w , under this particular model , as follows:(6 ) this r(w ) is 0 for dna words , occurring in the genome with exactly the same frequency , as predicted by the composition model . r(w ) is positive when the actual frequency is larger than expected by the model . in such cases , we describe that w is overrepresented in the genome , according to this model . when the actual frequency is smaller than expected by the model , r(w ) is negative , and w is underrepresented . now we can summarize the overall magnitude of over- or underrepresentation of all dna words of length l in the genome ( using a particular composition model of choice ) as follows:(7)where w is the set of all dna words of length l and because r is the standard deviation of a sample of all r(w ) for a particular word length l , the unit of r is the same with that of r(w ) , which is e(w ) ( standard deviation of the word frequency , predicted by the model ) . for each w , re(w ) gives the relative number of occurrences of w , which would make w averagely rare or abundant . r is computed for a particular genome , composition model , and l and summarizes the ability of the composition model to predict the frequencies of words of length l in the genome . large r implies that many w 's have large absolute values of r(w ) , which means that their actual frequencies are far from those expected by the model . thus , a large value of r signifies that the model 's ability to describe the actual genome is poor . a good composition model has small value of r , with r being 0 for the perfect model . an example of such perfect model is the l - bp composition model used to predict the frequencies of words of the same length l bp or shorter . for instance , the dinucleotide composition model has the exact information about dinucleotide frequencies , so it gives perfect predictions for 1-bp or 2-bp word frequencies , resulting in r value of 0 . for the longer words , r is typically much larger than 0 for nonrandom sequences . on the other hand , when a random sequence is modeled using any composition model , the actual variances of the word frequencies are the same with the variances predicted by the model ; therefore , r is close to 1 in this case ( approaching 1 as the sequence becomes longer ) . this is also the case for semirandom sequences , where the deviation from uniform randomness is at most as complex ( controlled by at most as many parameters ) as the model used to analyze the sequence . for example , a semirandom gc - biased sequence can be accurately modeled by the nucleotide composition model , or any more complex model , but not by the uniform composition model . the r values obtained with the uniform composition model for such sequence are much larger than 1 , whereas other models still produce r close to 1 . figure 1 illustrates this by showing the example histograms of relative abundances for all words of length 8 in the human genome , using five different models . the strange bimodal - looking shape of the uniform model histogram results from the extreme depletion of cpg dinucleotide in mammalian ( including human ) genomes . any 8-bp word containing cpg will appear as strongly underrepresented when comparing the actual frequencies with those predicted by the uniform model . so , all such words contribute to the left peak on the histogram , whereas words without cpg form the other peak , in agreement with the model . histograms of relative abundances of all oligonucleotides of 8 bp in human genome , according to the five composition models . the words placed to the left of the line are underrepresented and to the right overrepresented . we computed r for all five composition models for available complete genomes , both eukaryotes and prokaryotes . we then extracted unusually rare and unusually abundant words , which we define as those having |r(w)| > r. these dna words , together with the corresponding statistics , are available for viewing and downloading at the gcd online . r value comparison for selected species note.this table compares the r values of e. coli , yeast , plant , fruit fly , fish , lizard , and mouse , respectively , for each of the five models we used , based on words of 8 bp . next , we analyzed the spacing patterns of individual dna words in complete genomes . looking at all occurrences of a particular dna word in the genome , we can extract the distances between the genomic locations of every two neighboring occurrences and use this set of distances as a spacing data set for this particular word . sample parameters ( mean , standard deviation , skewness , and kurtosis ) are computed for such data set . the mean distance approximately equals to the genome size divided by total number of occurrences , so it correlates with the reciprocal of the word frequency . skewness shows whether extremely unusual spacing values for this word tend to be large or small . kurtosis shows if the word tends to form clusters and the density of those clusters relative to the distance between them . taking a particular parameter for all words of length l furthermore , selecting only subset of dna words with parameters falling into particular ranges , we can extract interesting dna words . in order to verify the models and better understand the parameters , we constructed a range or semirandom sequences using a random sequence generator ( kryukov k , unpublished data ) . each semirandom sequence was based on particular real genome used as template ( e.g. , the human genome ) : it had the same size with the template genome , and it imitated n - bp composition of the template genome , with n ranging from 1 to 4 . we used genomes of five species as templates : human , anolis carolinensis ( lizard ) , xenopus tropicalis ( frog ) , oryzias latipes ( fish ) , and drosophila melanogaster ( fruit fly ) . figure 2 shows the comparison of r values for 101 eukaryote genomes used in this study , as well as representative prokaryote genomes , computed for 5 bp oligonucleotides . such r values represent how well different composition models can predict 5-bp composition of the genome . supplementary figure 1 ( supplementary material online ) shows comparison of all prokaryote genomes included in this study . r values of five composition models are displayed as differently colored areas . as can be seen mammals are compositionally more complex than nonmammal vertebrates , land vertebrates are more complex than fishes , and fishes are more complex than most invertebrates and plants , which are still more complex than fungi and protists . compositional genome complexity of prokaryotes , represented by r values , is comparable with that of fungi . comparison of r values based on oligonucleotides of 5 bp and all five composition models . ( a ) eukaryote genomes ( all available in public databases by october 2010 ) . figure 3 shows the average r values for different groups of organisms , with standard deviation . under all five composition models , statistically significant difference is observed between the r values of mammals and nonmammal vertebrates ( mann whitney p < 0.001 , see supplementary table 1 , supplementary material online for test results ) . interestingly , r values of invertebrates are close to those of plants and significantly higher than those of fungi , protists , or prokaryotes ( archaea and eubacteria ) . in terms of r values , average r values for different groups of organisms , with standard deviations , using five different composition models . tables 2 and 3 show the partial lists of under- and overrepresented words of 10 bp in human genome , using tetranucleotide composition model . the complete lists of under- and overrepresented words , for every of the included genomes , for each of the five composition models , and for dna words of up to 10 bp for eukaryotes and 8 bp for prokaryotes , are available at the gcd online . both the actual and the expected frequency are given for both dna strands combined , so each word 's frequency is identical with that of its reversed complementary counterpart ( given in parentheses ) . underrepresented oligonucleotides of 10 bp , example from human genome note.showing ten most underrepresented oligonucleotides , according to the tetranucleotide composition model . both the actual and the expected frequency are given for both dna strands combined , so each word 's frequency is identical with that of its reversed complementary counterpart ( given in parentheses ) . overrepresented oligonucleotides of 10 bp , example from human genome note.showing ten most overrepresented oligonucleotides , according to the tetranucleotide composition model . other than the reporting the general compositional complexity , the gcd can be used to compute the distances between the composition vectors of various complete genomes and submitted sequences ( similar to the method taken by takahashi et al . we used this tool to analyze three classes of human sequences : random sample from the human genome , conserved sequences of unknown function , and conserved functionally important sequences . although sequences from these three classes are all found in the human genome , they have different nature and evolutionary history , allowing interesting comparison . the uce data set ( human mouse rat ultraconserved elements , 481 sequence , 126 kbp in total , bejerano et al . human microrna ( mirna ) seed sequences ( 1,100 sequences from mirbase , 7.7 kbp in total , kozomara and griffiths - jones 2011 ) were used as functionally important conserved sequences . figure 4a shows the average euclidean distances between the composition vectors obtained from randomly sampled human sequence and composition vectors of complete vertebrate genomes . each sample was chosen to have the same number of sequences and average sequence length with the uce data set : 481 sequences , 262 bp each . di- , tri- , and tetranucleotide composition vectors are used for comparison . as expected , primate genomes are the closest to human sample , and more diverged species show progressively larger distances , with some fluctuations . euclidean distances between composition vectors ( oligonucleotide frequencies ) of sample data sets and complete vertebrate genomes for three composition models ( dinucleotide , trinucleotide , and tetranucleotide ) . one thousand samples were used , where each sample consisted of 481 sequences of 262 bp each ( for a total size of each sample same with the uce data set ) , taken from the random locations in the complete human genome . ( b ) the composition of the uce data set is compared with that of complete vertebrate genomes . ( c ) the composition of human mirna seed sequences is compared with that of complete vertebrate genomes . the compositional distances between the uce and the complete vertebrate genomes appear to be relatively uniform among vertebrates and much larger than those for the random human sample . interestingly , these sequences appear to be compositionally close to lizard , fish , and frog . figure 4c shows the compositional distances between human mirna sequence data set and complete vertebrate genomes . platypus and the fishes are compositionally the closest to this data set . to further investigate the differences between these three data sets , we computed the average distances by combining the genomes into four groups ( fig . 5 ) . 5a ) , while much more uniformity can be seen for uce and mirna seed data sets ( fig . 5b and c ) . average compositional distance ( euclidean distances between the composition vectors ) between sample data sets and complete genomes grouped into four groups . panels ( a , b , and c ) correspond to panels ( a , b , and c ) of figure 4 . figure 6 shows the plots for the pairs of spacing parameters , taken for 8 bp oligonucleotides for six species human , lizard , fish , fruit fly , yeast , and escherichia coli . although the interpretation is difficult , more structure can be seen in the plots of more complex organisms . plots of the spacing distribution parameters for six species , based on oligonucleotides of 8 bp . different columns show plots for different pairs of parameters , from left to right : mean spacing ( x axis ) versus standard deviation ( y axis ) , mean ( x ) versus skewness ( y ) , mean ( x ) versus log(kurtosis ) ( y ) , standard deviation ( x ) versus skewness ( y ) , standard deviation ( x ) versus log(kurtosis ) ( y ) , and skewness ( x ) versus log(kurtosis ) ( y ) . each dot in the plot represents a particular 8 bp dna word , so 48 words constitute the data set in each case . figure 7 shows spacing plots for four random genomes ( generated using human genome as a template ) , the complete actual human genome and the repeat - masked version of the human genome . repeat - masked is included because complexity is often associated with repetitive sequences . in case of the those elements correspond to the groups of dna words containing different number of gc . with gc contents being the only parameter for constructing the sequence , dna words with the same number of gc will have exactly same compositional properties , blurred only by randomness of the sequence . in case of hs random 2 similar grouping happens , this time depending on number of cpg each particular word may contain . going into more complex semirandom sequence , the discreteness becomes less clear , and the plots are getting closer to that for the real human genome . still significant difference remains between the plots of semirandom and real sequences and very little difference between the plots of repeat - masked and the complete human genome . plot of the spacing distribution parameters for semirandom sequences , compared with the real human genome , as well as repeat - masked one . based on oligonucleotides of 10 bp . semirandom genomes 1 , 2 , 3 , and 4 are constructed using 1- , 2- , 3- , and 4-bp composition of the actual human genome . the gcd provides a convenient measure of relative complexity of various genomes from statistical point of view . a genome is compositionally simple if its composition can be accurately described by a simple model . a set of r values for various word length and models can tell us how complex a particular genome is ? as figure 2 shows , r values become smaller with the increase of model complexity as expected , a more complex model can describe genome composition more accurately , which results in smaller discrepancy . we observe that , generally speaking , r values are related to the general complexity of the organism . remarkably , even tetranucleotide compositional models are unable to give good predictions of 5-bp composition in case of complex genomes , particularly for mammals and land vertebrates . figure 3 confirms that compositional complexity of a genome is in good correlation with general complexity of the organism . compositional discrepancy r computed with different composition models seems to be useful as a measure of compositional complexity of the genome . the extremely rare and extremely abundant sequences , as shown in tables 2 and 3 , suggest the possible mechanisms of creating compositional complexity . the most underrepresented 10 bp dna words ( using tetranucleotide composition model ) seem to be found on the boundary of mononucleotide repeats , particularly poly - a to poly - t boundary ( words 1 , 2 , 4 , 6 , 7 , 8 , 9 , 10 in table 2 ) also poly - a to poly - c ( words 3 and 5 in table 2 ) . this means that such boundary is much less common , than suggested by the 4-bp composition . among the top overrepresented words , there are poly - a ( word 5 in table 3 ) , dinucleotide repeats ( words 1 and 2 in table 3 ) , as well as fragments of sequence gcctgtaatcccagc ( words 3 , 4 , 6 , 7 , 8 , 9 in table 3 ) , which has about 800,000 occurrences in the human genome compared with the expected number of about 7,00010,000 . this sequence being unusual is already reported by valle ( 1993 ) ; however , no explanation for the cause was given . figure 4 shows the compositional distances between three sequence data sets ( human sample , uce , and mirna seeds ) and vertebrate genomes . although in all three cases , the sequences are contained in the human genome , the compositional distances of those sequences to various genomes show very different pictures . the random sample behaves as expected the compositional distance is increasing with the increase of divergence from human . however , uce and mirna seed data sets show more or less uniform compositional distances from various vertebrate genomes . this suggests that those sequences became conserved before the emergence of mammals . in case of mirna seed sequences , the composition distances to all vertebrate genomes are more or less uniform , suggesting those sequences were fixed much earlier than the emergence of vertebrates . composition of the uce and mirna seed sequences is frozen and represents the composition of the ancestoral genome , at the time where the fixation occurred . the compositional distance from the current day vertebrates is larger for mirna seed data set because the mirna fixation occurred much earlier , so larger compositional distance exists between the ancestoral genome and current day genomes . thus , this allows us to discuss the composition of premammal vertebrate genome ( in case of uce data set ) and early animal genome ( in case of mirna seeds ) . oligonucleotide spacing patterns , summarized as sample parameters and displayed as scatterplots ( figs . 6 and 7 ) , provide a further interesting view into the compositional complexity . it is apparent that the human genome is very different from the semirandom sequences that imitate only some compositional properties of the actual genome . however , the spacing scatterplots for the repeat - masked human genome looks similar to those of the complete genome and different from those based on the semirandom sequences . it remains to be seen whether the apparent complexity results from the isochore structure of the mammalian genomes ( bernardi et al . 1985 ) , the online gcd provides the means of comparing the compositional complexity of various complete genome and extracting unusual dna words . the composition parameters computed using five models , as well as histograms , are available . also spacing patterns , summarized as parameter histograms and 2d scatterplots , in addition that database features a facility for submitting a sequence data set and performing composition analysis and comparison with various complete genomes . compositional models that we used in this study only utilize the word frequencies as parameters . the natural next challenge is to design an integrated composition model , which would be based on both frequencies and spacing patterns . such model would better approximate the genome and thus would allow focusing more closely on the real source of complexity . supplementary figure 1 and table 1 are available at genome biology and evolution online ( http://www.gbe.oxfordjournals.org/ ) .

eukaryote genomes contain many noncoding regions , and they are quite complex . to understand these complexities , we constructed a database , genome composition database , for the whole genome composition statistics for 101 eukaryote genome data , as well as more than 1,000 prokaryote genomes . frequencies of all possible one to ten oligonucleotides were counted for each genome , and these observed values were compared with expected values computed under observed oligonucleotide frequencies of length 14 . deviations from expected values were much larger for eukaryotes than prokaryotes , except for fungal genomes . mammalian genomes showed the largest deviation among animals . the results of comparison are available online at http://esper.lab.nig.ac.jp / genome - composition - database/.

chronic itch , which is defined as itch lasting more than 6 weeks , is a prevalent problem that occurs in ~10% of the population ( mollanazar et al . , 2015 ) . chronic itch conditions negatively affect quality of life , and yet there are no therapies that are both efficacious and selective for itch . the lack of effective treatment is partly attributable to a poor understanding of the mechanisms that underlie it . although antihistamines are frequently prescribed as a treatment for itch , they are typically ineffective because most types of chronic itch are not histamine - mediated ( mollanazar et al . , 2015 ) . unfortunately , while there are numerous mediators that can cause itch , the factors that are responsible in most circumstances of chronic itch are largely unknown . human psychophysical studies have shown that application of serotonin into the skin causes itch ( weisshaar et al . , 2004 ) . in rodents , serotonin is a key component of mast cells , and it is a potent mediator of itch . however , until recently , the mechanisms through which serotonin causes itch have remained uncertain . many pruritogens bind to metabotropic receptors on primary sensory neurons ; however , these receptors must be coupled to ionotropic channels via intracellular signaling pathways in order to allow sufficient current influx to generate action potentials . several groups have shown that the cation channels trpv1 and trpa1 are coupled to different pruritogen receptors and that they are critical for different forms of itch transmission ( ross , 2011 ) . more specifically , trpv1 is required for histaminergic itch , whereas trpa1 is required for several types of non - histaminergic itch , such as that induced by chloroquine , bam8 - 22 , il-31 , endothelin-1 , thymic stromal lymphopoietin , and bile acids . until recently , whether serotonin receptors were likewise coupled to trps remained unknown . understanding serotonin - mediated itch has been complicated by the fact that there are numerous serotonin receptors that are expressed on primary afferents , as well as on immune mediators that could be involved in itch . it was previously hypothesized that the primary pathway through which serotonin causes itch is via stimulation of histamine release from mast cells . however , contrary to this idea , antihistamines failed to reduce serotonin - induced itch sensation in humans ( hosogi et al . , 2006 ) . a recent study has demonstrated that one way in which serotonin induces itch is via direct activation of 5-ht7 ( encoded by htr7 ) , which is expressed on subsets of primary sensory afferents ( morita et al . , 2015 ) . in this study , mice lacking either htr7 or trpa1 showed substantially reduced scratching behavior in response to an intradermal injection of a 5-ht7-selective agonist . furthermore , htr7 and trpa1 knockout mice scratched considerably less in a model of atopic dermatitis . however , it seemed likely that this was only part of the serotonin - itch story , because the 5-ht2-selective agonist , -methyl-5ht , is a potent pruritogen in mice . as reported in this issue of jid , the study by carstens and colleagues ( 2015 ) provides further insight into the molecular players involved in serotonin - evoked itch by defining a trpv4-dependent pathway that is likely to be downstream of 5-ht2-mediated itch . the original goal of this study was to investigate a possible role for trpv4 in itch . trpv4 is upregulated in the skin of individuals with certain itch conditions ( moore et al . , 2013 ; yang et al . , 2015 interestingly , trpv4 knockout mice displayed a significant reduction in scratching behavior in response to serotonin , but not to histamine , chloroquine , or sligrl ( akiyama et al . a trpv4 antagonist also reduced substantially the amount of serotonin - evoked scratching , supporting the idea that trpv4 is critical to serotonin signaling in normal mice . importantly , the authors showed that the change in response to serotonin in the trpv4 knockout mice was specifically a decrease in serotonin - evoked itch behaviors , and not a change in serotonin - evoked pain behaviors . this study demonstrates that trpv4 is a key downstream component of serotonin - evoked itch ( figure 1 ) . in order to link serotonin to trpv4 and the activation of sensory neurons serotonin - mediated activation was dependent on trpv4 , as a trpv4 antagonist reduced significantly the calcium response to the application of serotonin . in support of this finding , the authors demonstrated that the proportion of neurons that responded to serotonin was reduced significantly in trpv4 knockout mice . interestingly , the proportion of neurons responding to other types of pruritogens did not change in mice lacking trpv4 , indicating that trpv4 plays an important and specific role in responses to serotonin in primary sensory neurons . to identify the receptor through which serotonin acts , akiyama et al . the 5-ht2 antagonist , but not the 5-ht1 antagonist , reduced serotonin - evoked scratching . this finding raises the possibility that 5-ht2 , acting via trpv4 , is key mediator of serotonin - evoked itch . thus , there appear to be at least two distinct pathways through which serotonin mediates itch : a trpa1-dependant pathway that mediates 5-ht7-mediated itch , as well as a trpv4-dependent pathway that likely mediates 5-ht2-mediated itch . what remains to be tested is whether these receptors are expressed on distinct or overlapping populations of primary sensory afferents .

previous studies have revealed that trpv1 and trpa1 function downstream of many itch receptors , where they mediate inward current to trigger action potentials in primary afferents . although other trp channels , such as trpv4 , are expressed in primary afferents , whether or not they play an analogous role in itch was previously unknown . now , akiyama et al . provide evidence that trpv4 is a key mediator of serotonin - induced itch . this finding is important because it uncovers an unanticipated role for trpv4 in itch , thereby identifying a novel therapeutic target .

a modified radical mastectomy is a procedure in which the entire breast is removed ; including the skin , areola , nipple , and level i and level ii axillary lymph nodes , but the pectoralis major muscle is spared . in breast cancer cases with pectoral muscle involvement a radical mastectomy may need to be done if there is persistence of disease despite neoadjuvant chemoradiation . in a radical mastectomy all of the breast tissue along with the nipple , lymph nodes in the axilla , and chest wall muscles , under the breast are removed . due to the invasive nature of the procedure higher incidence of post - operative complications surgeons have relied on vision and clinical judgment to evaluate tissue perfusion . while experienced surgeons are often comfortable making this assessment , it remains subjective and 1 is an imaging system used as an adjunctive method for the evaluation of tissue perfusion in surgical procedures where additional perfusion information is needed . the spy elite system provides objective , intraoperative assessment of blood flow to tissues , allowing for immediate surgical changes that can lead to improved wound healing and reduce the risk for postoperative conditions . icg is a sterile , water soluble tricarbocyanine dye with a peak spectral absorption at 800810 nm . icg binds tightly to plasma proteins and has a short half - life of 2.53 min allowing for repeat evaluations during the surgical procedures . the spy elite intraoperative perfusion assessment system is available in the united states and canada . the system is cost effective because most hospitals view the complications that can arise when not using the device to far exceed the cost of the device . this study illustrates the use of the spy elite system to assess flap viability following a nipple - sparing radical mastectomy with an unusual incision site . a 65-year old african american female was diagnosed with grade 3 papillary carcinoma on biopsy of a palpable 3.7 cm left breast mass at 12 oclock position in april 2009 . in june 2009 pathology showed stage t2n0mx ductal carcinoma that was er / pr and her-2/neu negative with clear margins . the patient was advised chemotherapy by her initial treating oncologist but refused conventional treatment and opted for naturopathic treatment engaging in vitamin and dietary supplements . in december 2010 a biopsy showed invasive high grade ductal carcinoma with papillary features , er / pr and her-2/neu negative . the mass continued to grow occupying almost the entire left breast with increasing pressure and pain . in september 2011 the patient presented to our facility . a ct scan revealed a 14.5 cm 9.5 cm mass in the left breast extending toward the axillary with smaller adjacent nodules and slight nodular thickening of the skin with no metastatic disease . pathology confirmed a stage t2n0mx ductal carcinoma that was er / pr and her-2/neu negative with clear margins as shown in fig . 2 . although this was a triple negative disease , the patient was advised neoadjuvant chemotherapy followed by a mastectomy to potentially avoid resecting the pectoralis muscle during the mastectomy . the patient received six cycles of 365 mg of carboplatin and 100 mg of taxotere from september 2011 to march 2012 . during this time the patient had a break in chemotherapy due to neutropenia and for going on vacation . to may 2012 the patient got 5000 cgy to the left breast in 25 fractions . in july 2012 , given the mass still involved the pectoral muscle despite some response to neoadjuvant chemo and radiation therapy , a left nipple - sparing radical mastectomy with axillary dissection was performed in coordination with the spy elite system for assessing flap perfusion by injection of icg under general anesthesia . an elliptical incision was made , above the nipple areola from the lateral edge of the sternal border and pointing toward the axilla in its lateral aspect as shown in fig . there were dense adhesions of the skin to the upper flap area and given the concern that there could be tumor involvement , multiple frozen sections were done and all were negative for malignancy . the tumor was high up in the chest wall approximately 4 cm below the level of clavicle and was involving the pectoral muscle . the superior portion of the chest wall was dissected down to the level of the chest wall by going through the pectoralis muscle . the pectoralis major muscle was resected and the breast tissue was taken off the serratus anterior muscle inferiorly . the inferior envelope of the breast skin and nipple were spared and this helped in the closure of the wound later . frozen section of the breast tissue from just under the nipple was also negative for malignancy . a 14.5 cm 9.5 cm specimen was removed with a thin portion of skin . two number fifteen blake drains were placed , one in the axilla , and the other in the left anterior chest . although clinically the margins appeared well - perfused , it was decided preoperatively to use the spy elite imaging system to capture and view fluorescence images for the visual assessment of blood flow as an adjunctive method for the evaluation of tissue perfusion . 1 was positioned at the correct distance from the patient to achieve optimal imaging . using a three way stopcock attached to an injection port on the infusion line the prepared 2.5 mg / ml icg solution was injected as a tight bolus . the access on the stopcock was then switched to the syringe containing saline to briskly flush the icg bolus through the line with 10 ml of sterile saline to achieve optimal image quality . the 100 percent mark was placed in an area of undamaged skin where there was good perfusion . angiography with indocyanine green showed poor perfusion of the inferior flap quantified by the 15 and 25 percent marks as shown in fig . an additional 2 cm of skin of the inferior flap was resected and then approximated with the superior flap . after resection this border the dermis was closed with multiple interrupted 3 - 0 vicryl sutures , and the skin was approximated with running continuous 4 - 0 monocryl in a subcuticular fashion . there were no complications during the procedure , and the patient recovered well from surgery . the patient was discharged home at day one following surgery . at the last follow - up in august 2013 , thirteen months after surgery , ct and pet scan images showed no evidence of recurrent disease . the patient did not receive post - operative radiotherapy or chemotherapy as there was no recurrent disease . this case study shows that an individualized approach resulted in an optimal outcome for the patient . the infrequent procedure of a nipple - sparing radical mastectomy was done , with an unusual elliptical incision made in the superior aspect of the breast wall at least 6 cm above the areola as shown in fig . the spy elite intraoperative tissue perfusion assessment system to assess flap viability was used successfully to find a viable flap edge to promote optimal wound healing although clinical judgment erroneously suggested that the initial flap edges were well perfused . fluorescence angiography with icg is a sensitive diagnostic tool for detecting compromised tissue perfusion in trauma surgery and microsurgery . the spy elite system allowed the surgeon to compare areas of good tissue perfusion in undamaged skin to areas of poor perfusion . in this case the spy elite system showed poor perfusion in the inferior flap of the breast leading to an additional 2 cm being resected resulting in improved perioperative management and better clinical results . final pathology showed that all margins were clear of disease and there was no lymph node involvement . the patient recovered well from surgery with satisfactory wound healing and a good cosmetic result with minimal scarring as shown in fig . the surgeon is provided with an on - table assessment of breast skin perfusion that facilitates identification and removal of poorly perfused tissue that results in decreases complication rates . in this case study we illustrate the use of a tissue perfusion assessment system to assess flap viability in a patient undergoing a nipple - sparing radical mastectomy with an unusual incision site . this study shows that uncommon surgical practices can be performed successfully when technology is used to complement good clinical judgment in assessing tissue perfusion . written informed consent was obtained from the patient for publication of this case report and any accompanying images . a copy of the written consent is available for review by the editor - in - chief of this journal .

introductionstandard surgical approach for advanced breast cancer is a modified radical mastectomy with a periareolar elliptical incision . here a unique surgical approach is presented utilizing intraoperative real time tissue perfusion technology.presentation of casea 65-year old african american female was diagnosed with grade 3 papillary carcinoma on biopsy of a palpable 3.7 cm left breast mass at 12 oclock position . pathology showed a t2n0m0 invasive ductal carcinoma , triple negative disease , with clear margins . patient opted for naturopathic treatment . six months later , cancer recurred at the local site ; the patient persisted with natural remedies . nine months later , the mass had progressed to 14.5 cm with smaller adjacent nodules and nodular thickening of breast with no metastatic disease . patient received neoadjuvant chemoradiation . ten months later , patient underwent a nipple - sparing radical mastectomy given the persistent pectoral muscle involvement of this mass.discussionan elliptical incision was made in the superior aspect of the breast wall at least 6 cm above the areola . after tumor removal , the skin edges were approximated . it was decided preoperatively to use the spy elite system to assess perfusion of the flap edges . angiography with indocyanine green showed poor perfusion of the inferior flap and an additional 2 cm of skin was resected . final pathology showed that all margins were clear of disease and patient recovered well from surgery.conclusionthis case study shows that an individualized approach resulted in an optimal outcome for the patient . the infrequent procedure of a nipple - sparing radical mastectomy was done in coordination with spy elite to achieve good wound healing .

pig eyes were obtained from a local abattoir . only eyes that could be identified as right eyes were used . within 2 hours of death , the bulbar conjunctiva was preserved , while the palpebral conjunctiva was removed together with adnexal tissues . eyes irrigated with pbs were placed with the optic nerve into a cryogenic vial cup ( cryoelite cryogenic vial # w985100 ; wheaton science products , millville , nj , usa ) for compression free mount as described before . 1a ) , eyes were positioned under a surgical microscope looking up with the temporal side of the eye directed toward the surgeon . a clear corneal incision was fashioned with a 1.8-mm keratome approximately 2 mm anterior to the temporal limbus while the inside was slightly flared for a striae - free visualization during the procedure . tustin , ca , usa ) was placed on the cornea to visualize the chamber angle ( fig . the tip of a microsurgical handpiece ( # 600018 ; neomedix , inc . ) that was connected to a standard microsurgical system ( trabectome system # 600026 ; neomedix , inc . ) was inserted and advanced to the opposite nasal angle of the anterior chamber . since only right eyes were used in this study , this would represent the anatomic 3 o'clock position . after gentle goniosynechiolysis with the side of the instrument 's tip to disengage pectinate ligaments along the nasal angle , tm ablation ( fig . 2 with insert ) was continued toward the left by 45. the tip was then turned around inside of the eye , the tm was engaged again , and ablation continued by 45 in the opposite direction . ( a ) ( 1 ) trabectome inserted through a clear corneal incision ablates tm that is engaged in between footplate and bipolar electrodes . ( 2 ) handpiece and magnified view of tip . ( 3 ) stand , operating console with peristaltic pump and high frequency generator and footswitch . ( b ) direct , gonioscopic view of ablation in porcine eye immediately before engaging the tm ( left ) and with tip obscured by tm during ablation ( right ) . microspheres were tested for a size that is known to not pass through human tm within the perfusion time used here ( fig . 3a ) while allowing visualization of the collector channels after the tm was removed ( fig . we chose 0.5 m diameter carboxylate - modified microspheres ( fluospheres , 0.5 m , yellow - green fluorescent [ 505/515 ] , 2% solids ; thermo fisher scientific , eugene , or , usa ) . the fluorescent microspheres were diluted 100-fold with phenol red free dulbecco 's modified eagle 's media ( dmem ) to make the perfusate . following the intervention described below , ait , a 30-gauge needle was inserted through the nasal cornea 2 mm anterior to the limbus with the tip of the needle positioned in the center of the anterior chamber . the head ( fluid meniscus ) was positioned at 204 mm height above the needle , the equivalent of 15 mm hg , and the stopcock was opened to start the gravity - based infusion . fluorescence was visualized with a stereo dissecting microscope equipped for fluorescent imaging ( olympus szx16 with gfp filter cube and dp80 monochrome / color camera ; olympus corp . images during time lapse analysis ( cellsens ; olympus life science , tokyo , japan ) were acquired every 20 seconds for 15 minutes using 2 2 pixel binning and a resulting resolution of 580 610 pixels . to better obtain a contiguous image of the microbead distribution , subsequently , the entire uvea , including ciliary body ( cb ) and iris , was gently detached and the anterior segment was inspected with the dissecting microscope detailed above . ( a ) perfusion of eye with fluorescent microspheres that can not pass through the tm in a control eye ( top left , inside view after removal of uvea and iris ) , but light up the nasal outflow tract . there is additional flow beyond the ablation ends along the circumferential drainage elements and away from the eye along collector channels ( dashed arrow ) . ( b ) preferentially nasal outflow system filling is observed ( anterior chamber subtracted using baseline ) . ( c ) short filling times after ait nasal quadrants with occasional flow into adjacent quadrants . filling times of st and it quadrants without nonfilling eyes was 67 22 seconds and 46 29 seconds , respectively . a fluorescent tracer reperfusion technique was used in six eyes to compare outflow changes before and after ait detailed below using a quantitative canalography method we recently developed . reperfusion canalograms to analyze results of trabecular ablation required two different water soluble dyes because of partial diffusion into the extravascular space over time that makes displacement or washout attempts incomplete . use of colloids ( more viscous solutions ) would have changed the canalogram dye flow behavior and made it less similar to that of aqueous humor . we selected two fluorescent dyes that can be readily detected with common fluorescent filter cubes used in epifluorescent microscopes and have a reasonably low toxicity to be useful in future in vivo experimentation , fluorescein and texas red . a 30-gauge needle was inserted through the nasal cornea as previously described and used to remove 0.2 ml of anterior aqueous humor from the whole eye 's anterior segment . a 30-gauge needle was then placed in the anterior segment using the exact same entry site and media with fluorescein ( ak - fluor 10% , fluorescein injection , usp , 100 mg / ml , ndc 17478 - 253 - 10 ; akorn , lake forest , il , usa ) , at a concentration of 0.017 mg / ml , was infused via gravity . the outflow pattern was imaged every 20 seconds for 15 minutes using a stereo dissecting microscope equipped for fluorescent imaging ( fig . following ait , a new 30-gauge needle was placed in the anterior segment using the same entrance wound , and media with 0.28 mg / ml texas red ( sulforhodamine 101 acid chloride , 10 mg ; alfa aesar , ward hill , ma , usa ) was subsequently infused via gravity . pre- and post - ait canalogram frames are matched ( also see supplementary movie s1 ) . to determine differences in chromophore detection sensitivity , a hemocytometer chamber was filled with 10 l each of fluorescein and texas red at the previously stated concentrations . proper exposure times of 15 ms for fluorescein and 10 ms for texas red were determined with the fluorescence equipped stereo dissecting microscope above . initially , six eyes were perfused with fluorescein first immediately followed by texas red without ait . another six eyes were perfused with texas red first followed by fluorescein to determine whether the order of perfusion would have any effect . we chose the order to be fluorescein followed by texas red to avoid a type i error ( false positive flow enhancement ) because texas red had a slightly slower filling average that was not statistically significant in pilot eyes ( p = 0.06 , n = 12 ) . as described before , we used a program written in r to automatically compute the focal outflow changes ( fig . 5 , left ) and convergent perilimbal aqueous flow ( fig . 5 , right ) using the eye - canalogram package to process the image datasets , the source code of which we made available for download ( r package eye - canalogram , provided in the public domain at https://github.com/enbrown/eye-canalogram/tree/06461498c8 ) . quantitative canalograms with individual intensity fits ( left ) and circumferential flow rates ( right ) . both are increased in most eyes , even in quadrants away from the nasal ait site . briefly , for each image set , the cornea was first manually delineated and masked to exclude the bright fluorescence in the anterior chamber from the image analysis . this step was neutral to the mathematical analysis of fluorescence changes along the outflow tract but considerably improved how observers were able to see and interpret subtle filling of small caliber vessels ( fig . larger pixels corresponded to more intense fluorescein signals while red dots corresponded to faster flow . in addition , all regions ( clock hour and three radial rings ) were fit to a single gam using smoothing terms for the radial ring , clock hour , and frame number . pre- and posttreatment image sets for each eye were registered using the clock hour and radial distance to compute the change in fit metrics ( fig . similarly , all eyes were warped to a common reference frame and averaged to produce figure 6b . ( a ) quantitative change analysis after ait . each eye produces a pair of images : change in fluorescence intensity ( left image ) and change in rate of fluorescence uptake ( right image ) . red ( positive values ) indicates greater intensity or rate of uptake following ait ; blue ( negative values ) indicates less intensity or reduced uptake . each quadrant was also analyzed for first detection of fluorescence in an outflow structure downstream of schlemm 's canal segments . timestamps from time - lapse recordings were summarized as graphs ( average sd ) for the inferonasal ( in ) , superonasal ( sn ) , superotemporal ( st ) , and inferotemporal ( it ) quadrants . student 's paired two sample t - test was used to compare outflow changes in the same eyes before and after each intervention and to compare same eye quadrants . tests were two - tailed and results were reported as mean sd . segments were removed from the perfusion dish , rinsed in pbs , cut into quarters , and fixed with 4% paraformaldehyde and pbs for 48 hours before being placed in 70% ethanol . a corneoscleral wedge was taken from the lateral side near the incision and one from the nasal side where the ait had been performed ( fig . 2 ) . the section was paraffin - embedded for histological processing , cut at 6-m thickness , and stained with hematoxylin and eosin . pig eyes were obtained from a local abattoir . only eyes that could be identified as right eyes were used . within 2 hours of death , the bulbar conjunctiva was preserved , while the palpebral conjunctiva was removed together with adnexal tissues . eyes irrigated with pbs were placed with the optic nerve into a cryogenic vial cup ( cryoelite cryogenic vial # w985100 ; wheaton science products , millville , nj , usa ) for compression free mount as described before . 1a ) , eyes were positioned under a surgical microscope looking up with the temporal side of the eye directed toward the surgeon . a clear corneal incision was fashioned with a 1.8-mm keratome approximately 2 mm anterior to the temporal limbus while the inside was slightly flared for a striae - free visualization during the procedure . tustin , ca , usa ) was placed on the cornea to visualize the chamber angle ( fig . the tip of a microsurgical handpiece ( # 600018 ; neomedix , inc . ) that was connected to a standard microsurgical system ( trabectome system # 600026 ; neomedix , inc . ) was inserted and advanced to the opposite nasal angle of the anterior chamber . since only right eyes were used in this study , this would represent the anatomic 3 o'clock position . after gentle goniosynechiolysis with the side of the instrument 's tip to disengage pectinate ligaments along the nasal angle , tm ablation ( fig . 2 with insert ) was continued toward the left by 45. the tip was then turned around inside of the eye , the tm was engaged again , and ablation continued by 45 in the opposite direction . ( a ) ( 1 ) trabectome inserted through a clear corneal incision ablates tm that is engaged in between footplate and bipolar electrodes . ( 2 ) handpiece and magnified view of tip . ( 3 ) stand , operating console with peristaltic pump and high frequency generator and footswitch . ( b ) direct , gonioscopic view of ablation in porcine eye immediately before engaging the tm ( left ) and with tip obscured by tm during ablation ( right ) . microspheres were tested for a size that is known to not pass through human tm within the perfusion time used here ( fig . 3a ) while allowing visualization of the collector channels after the tm was removed ( fig . we chose 0.5 m diameter carboxylate - modified microspheres ( fluospheres , 0.5 m , yellow - green fluorescent [ 505/515 ] , 2% solids ; thermo fisher scientific , eugene , or , usa ) . the fluorescent microspheres were diluted 100-fold with phenol red free dulbecco 's modified eagle 's media ( dmem ) to make the perfusate . following the intervention described below , ait , a 30-gauge needle was inserted through the nasal cornea 2 mm anterior to the limbus with the tip of the needle positioned in the center of the anterior chamber . the head ( fluid meniscus ) was positioned at 204 mm height above the needle , the equivalent of 15 mm hg , and the stopcock was opened to start the gravity - based infusion . fluorescence was visualized with a stereo dissecting microscope equipped for fluorescent imaging ( olympus szx16 with gfp filter cube and dp80 monochrome / color camera ; olympus corp . images during time lapse analysis ( cellsens ; olympus life science , tokyo , japan ) were acquired every 20 seconds for 15 minutes using 2 2 pixel binning and a resulting resolution of 580 610 pixels . to better obtain a contiguous image of the microbead distribution , whole eyes were processed as previously described . briefly , after removing all adnexal structures , globes were hemisected along the equator . subsequently , the entire uvea , including ciliary body ( cb ) and iris , was gently detached and the anterior segment was inspected with the dissecting microscope detailed above . ( a ) perfusion of eye with fluorescent microspheres that can not pass through the tm in a control eye ( top left , inside view after removal of uvea and iris ) , but light up the nasal outflow tract . there is additional flow beyond the ablation ends along the circumferential drainage elements and away from the eye along collector channels ( dashed arrow ) . ( b ) preferentially nasal outflow system filling is observed ( anterior chamber subtracted using baseline ) . ( c ) short filling times after ait nasal quadrants with occasional flow into adjacent quadrants . filling times of st and it quadrants without nonfilling eyes was 67 22 seconds and 46 29 seconds , respectively . a fluorescent tracer reperfusion technique was used in six eyes to compare outflow changes before and after ait detailed below using a quantitative canalography method we recently developed . reperfusion canalograms to analyze results of trabecular ablation required two different water soluble dyes because of partial diffusion into the extravascular space over time that makes displacement or washout attempts incomplete . use of colloids ( more viscous solutions ) would have changed the canalogram dye flow behavior and made it less similar to that of aqueous humor . we selected two fluorescent dyes that can be readily detected with common fluorescent filter cubes used in epifluorescent microscopes and have a reasonably low toxicity to be useful in future in vivo experimentation , fluorescein and texas red . a 30-gauge needle was inserted through the nasal cornea as previously described and used to remove 0.2 ml of anterior aqueous humor from the whole eye 's anterior segment . a 30-gauge needle was then placed in the anterior segment using the exact same entry site and media with fluorescein ( ak - fluor 10% , fluorescein injection , usp , 100 mg / ml , ndc 17478 - 253 - 10 ; akorn , lake forest , il , usa ) , at a concentration of 0.017 mg / ml , was infused via gravity . the outflow pattern was imaged every 20 seconds for 15 minutes using a stereo dissecting microscope equipped for fluorescent imaging ( fig . a new 30-gauge needle was placed in the anterior segment using the same entrance wound , and media with 0.28 mg / ml texas red ( sulforhodamine 101 acid chloride , 10 mg ; alfa aesar , ward hill , ma , usa ) was subsequently infused via gravity . again pre- and post - ait canalogram frames are matched ( also see supplementary movie s1 ) . to determine differences in chromophore detection sensitivity , a hemocytometer chamber was filled with 10 l each of fluorescein and texas red at the previously stated concentrations . proper exposure times of 15 ms for fluorescein and 10 ms for texas red were determined with the fluorescence equipped stereo dissecting microscope above . initially , six eyes were perfused with fluorescein first immediately followed by texas red without ait . another six eyes were perfused with texas red first followed by fluorescein to determine whether the order of perfusion would have any effect . we chose the order to be fluorescein followed by texas red to avoid a type i error ( false positive flow enhancement ) because texas red had a slightly slower filling average that was not statistically significant in pilot eyes ( p = 0.06 , n = 12 ) . as described before , we used a program written in r to automatically compute the focal outflow changes ( fig . 5 , left ) and convergent perilimbal aqueous flow ( fig . 5 , right ) using the eye - canalogram package to process the image datasets , the source code of which we made available for download ( r package eye - canalogram , provided in the public domain at https://github.com/enbrown/eye-canalogram/tree/06461498c8 ) . quantitative canalograms with individual intensity fits ( left ) and circumferential flow rates ( right ) . both are increased in most eyes , even in quadrants away from the nasal ait site . briefly , for each image set , the cornea was first manually delineated and masked to exclude the bright fluorescence in the anterior chamber from the image analysis . this step was neutral to the mathematical analysis of fluorescence changes along the outflow tract but considerably improved how observers were able to see and interpret subtle filling of small caliber vessels ( fig . larger pixels corresponded to more intense fluorescein signals while red dots corresponded to faster flow . in addition , all regions ( clock hour and three radial rings ) were fit to a single gam using smoothing terms for the radial ring , clock hour , and frame number . pre- and posttreatment image sets for each eye were registered using the clock hour and radial distance to compute the change in fit metrics ( fig . similarly , all eyes were warped to a common reference frame and averaged to produce figure 6b . each eye produces a pair of images : change in fluorescence intensity ( left image ) and change in rate of fluorescence uptake ( right image ) . red ( positive values ) indicates greater intensity or rate of uptake following ait ; blue ( negative values ) indicates less intensity or reduced uptake . each quadrant was also analyzed for first detection of fluorescence in an outflow structure downstream of schlemm 's canal segments . timestamps from time - lapse recordings were summarized as graphs ( average sd ) for the inferonasal ( in ) , superonasal ( sn ) , superotemporal ( st ) , and inferotemporal ( it ) quadrants . student 's paired two sample t - test was used to compare outflow changes in the same eyes before and after each intervention and to compare same eye quadrants . segments were removed from the perfusion dish , rinsed in pbs , cut into quarters , and fixed with 4% paraformaldehyde and pbs for 48 hours before being placed in 70% ethanol . a corneoscleral wedge was taken from the lateral side near the incision and one from the nasal side where the ait had been performed ( fig . 2 ) . the section was paraffin - embedded for histological processing , cut at 6-m thickness , and stained with hematoxylin and eosin . visualization and tm ablation could be achieved with a standard microsurgical system ( neomedix , inc . ) and the kit included , modified swan jacob goniolens ( fig . 1a ) . the footplate encountered more stops than typical for human eyes when sc segment ends were reached . the histologic analysis showed that the relatively prominent tm and common sc segments had been ablated with a few exceptions of sc segments too small to enter with the trabectome tip ( fig . 2 , eye 1 , shown to scale ) . no coagulative damage was observed . eyes without ait that were infused with fluorescent spheres showed fluorescence only in the tm . when those were hemisected and the vitreous and iris removed , sphere distribution appeared relatively even throughout the tm circumference ( fig . in contrast , canalograms with fluorescent spheres obtained after ait experienced fast filling of proximal and distal parts of the outflow system along the ablation site followed by circumferential and then centrifugal filling of adjacent quadrants . filing of nasal quadrants was nearly 10 times faster than that of temporal quadrants ( fig . 4 and supplementary movie s1 ) had a 17 5-fold increase in filling in , 14 3-fold increase sn , and also an increase in the adjacent quadrants , with a 2 1-fold increase st and 3 3 it . the superonasal quadrant was the fastest to fill ( p < 0.05 ) followed by the in , st , and it quadrants ( figs . 4 , 7 ) . although fluorescent dyes used in these differential canalograms were not blocked by the tm like the fluorescent spheres , st and it quadrants often filled circumferentially from the site of ait . outflow change summary after ait . short bars indicate fast filling not only in the nasal quadrants ( in and sn quadrant ) , but also in the temporal quadrants ( st and it quadrants ) following ait . individual fit curve analysis indicated a shift in filling speed toward the nasal side and an overall faster filling throughout the remainder of the outflow system in most eyes ( fig . this can be seen by a shift toward red in the color coded analysis indicating a shorter time toward peak fluorescence , as well as the increased bubble size that describes the peak fluorescence obtained . with the exception of eye 1 , all eyes post - ait showed an initial uptake centered on the in and sn quadrants as expressed by the red color coding that spreads circumferentially from here ( fig . changes from pre- to post - ait fluorescence intensity changes are summarized in figure 6 . in average of all six eyes , peak intensity increased in the in quadrant and in the sn quadrant , as well as in the remainder of the circumference ( fig . in contrast , flow rate changes from pre- to post - ait were more substantial in the nasal quadrants ( fig . 6b ) . these changes from pre- to post - ait were statistically significant in all quadrants but more pronounced in the in and sn quadrants . there was no difference between the st and it quadrants pre- or post - ait . focal changes of conventional aqueous humor outflow are difficult to examine , yet are crucial to better understand how elements downstream of the tm may influence outflow . there is ample new clinical evidence that very significant outflow resistance exists downstream of the trabecular meshwork as trabecular ablation rarely achieves the theoretically lowest intraocular pressure , which would be equal to that of episcleral venous pressure according to the goldmann equation . the lack of an inexpensive , readily available , and high quality outflow model has impeded glaucoma research and training of surgery on this submillimeter structure alike . here we address both with a differential canalography technique that allows examination of the effect of trabectome - mediated ait on focal outflow in porcine eyes . visualization of the chamber angle and ablation of tm by ait was quite similar to surgery in human patients . angle surgery can be practiced in human eyes , but costs of those are high and the corneal clarity is often too compromised to see the angle . as a result , artificial eyes were preferred by trainees . the histology following ait shows that despite the anatomical differences between the pig and human chamber angle , an extensive ablation of tm can be achieved without an obvious coagulative thermal effect on adjacent tissues . different from coagulation devices , the instrument used here generates plasma to ionize tissue and has a highly confined heat dissipation cone that is similar to photodisruptive lasers . the initial canalograms obtained with fluorescent microspheres demonstrated that tm must be removed before they can enter the conventional outflow system . as has been demonstrated before in human and ungulate trabecular meshwork , the size of 0.5 m used here prevents spheres from moving into schlemm 's canal within the perfusion time used while preventing fluid blockage that can be observed with 10 m spheres . our choice of relatively small beads had the advantage that smaller collector channels could be visualized . although the angular aqueous plexus of pigs does not have a continuous schlemm 's canal as primate eyes do , but rather multiple sc - like segments , we observed circumferential flow that extended far beyond the ablation site . this indicates that canal segments are connected and that supraphysiological flow from the site of ablated tm is displacing the normal flow that is still occurring through the nonablated tm . the perilimbal flow analysis of differential canalograms showed high - flow areas near the in and sn angle . in pig eyes , this matches the areas in between the recti muscles , where larger collector channels reside ( fig . 4 ) . the circumferential flow patterns observed here contradicts the assumption of noncontinuous sc segments in the pig . a three - dimensional reconstruction at a higher resolution than conventional histological sections by sd - oct may be necessary . such an approach has enabled discovery of previously overlooked valve - like elements in human eyes . we provide a heatmap summary image that combines fluorescence and flow rate of all six eyes . this allows us to visualize how flow can be enhanced in nonglaucomatous eyes to levels above the physiological flow rate and beyond the tm ablation area . in this constant pressure perfusion system , ait led to increased flow and peak fluorescence in all quadrants , beyond the nasal site where ait was performed . this has practical implications for patient care and suggests that it may not be necessary to obtain a very extensive ablation or circumferential access to the outflow tract . carefully observing glaucoma surgeons these appeared to be limited to the site of ablation when observed through an operating microscope . such visualization may relatively underestimate the amount of flow that could be detected with more sensitive , fluorescent dyes as used here . there are well established angiography methods for organs larger than the anterior segment of the eye , such as the heart . characteristic for such angiography is that vessels branch off large primary vessels to subsequently smaller ones , and typically without collaterals . the outflow tract of the eyes is different and has a much more diffuse and connected nexus of vessels with variable caliber . the drainage system just distal to the outer wall of the sc is more similar to the honeycomb pattern of a capillary network , but its vessels are larger and collapsible depending on the perfusion pressure . this makes it challenging to use doppler strategies to compute flow speeds in single vessels . the data presented here validate the use of fluorescence change as a surrogate to tracking reflective particles . in conclusion , we developed a method to quantify outflow enhancement from plasma - mediated ait and show that nasal ablation of trabecular meshwork increased outflow not only locally but circumferentially .

purposeto quantify regional changes of conventional outflow caused by ab interno trabeculectomy ( ait).methodsgonioscopic , plasma - mediated ait was established in enucleated pig eyes . we developed a program to automatically quantify outflow changes ( r , package eye - canalogram , github.com ) using a fluorescent tracer reperfusion technique . trabecular meshwork ( tm ) ablation was demonstrated with fluorescent spheres in six eyes before formal outflow quantification with two - dye reperfusion canalograms in six additional eyes . eyes were perfused with a central , intracameral needle at 15 mm hg . canalograms and histology were correlated for each eye.resultsthe pig eye provided a model with high similarity to ait in human patients . histology indicated ablation of tm and unroofing of most schlemm 's canal segments . spheres highlighted additional circumferential and radial outflow beyond the immediate area of ablation . differential canalograms showed that ait caused an increase of outflow of 17 5-fold inferonasally , 14 3-fold superonasally , and also an increase in the opposite quadrants with a 2 1-fold increase superotemporally , and 3 3 inferotemporally . perilimbal specific flow image analysis showed an accelerated nasal filling with an additional perilimbal flow direction into adjacent quadrants.conclusionsa quantitative , differential canalography technique was developed that allows us to quantify supraphysiological outflow enhancement by ait .

as the cervical spine degenerates with age , there is increased risk of undesirable conditions such as displacement or degeneration of intervertebral disc , slackness of annulus fibrosis , osteophytosis of vertebral body and instability . degenerative cervical disc may cause posterior neck pain , radiating pain on arm or shoulder , or cervical myelopathy . anterior cervical discectomy and fusion ( acdf ) is a safe and standard operation for the treatment of degenerative cervical disc disease concerned with radiculopathy or myelopathy29 ) . the main purposes of intervertebral cage are biomechanical support , restoration of disc height , maintaining of cervical lordosis and ideal osteointegration4,17,19 ) . tricortical iliac crest autobone graft results in numerous complications including breaking of bone graft , collapsing , pseudoarthrosis , subsidence , angular deformation , protrusion of bone block , pain or bleeding of donor site and infection22,30,31 ) . the most frequently donor site related complication is pain , and infection of harvest site could be a nettlesome problem23 ) . to solve these problems , various types of artificial cages providing immediate firmness without a plate system a standard cage alone for acdf is an effective method to treat degenerative cervical disease23 ) . short term clinical follow up data has been published less than 18 months after acdf with the polyetheretherketone ( peek ) cage . in the current study , we present a retrospective long term(mean period : 36 months ) study of thirty consecutive patients after acdf with solis cage with iliac autobone graft . we collected information from charts of patients who visited our neurosurgical department from march 2006 to july 2008 , retrospectively . only patients with single level acdf without anterior cervical plate were eligible for the study , and thirty patients were selected ( male : 20 patients and female : 10 patients ) . the mean age was 47.67.1 years ( range from 28 to 63 years old ) . the patients who complained of radiculopathy were 21 , myelopathy were 2 and myeloradiculopathy were 7 patients . mean follow - up period was 36.48.1 months ( ranged from 23 to 49 months ) . a right side skin incision was done in all cases ; fluoroscopy was used to check the target level . complete removal of the disc , lateral decompression and end plate flattening for maximal contact with cage was performed . after selection of ideal trial size by using intraoperative fluoroscopy , harvested cancellous bone from the iliac crest filled in the hollow space of the cage . finally , we checked that the radiopaque titanium spike was in an adequate location by fluoroscopy . we used the japanese orthopedic association ( joa ) score for evaluation of myelopathy and visual analogue scale ( vas ) for radiating pain to estimate postoperative clinical outcome . we assessed degree of pain relief between preoperative and postoperative ( last follow - up ) status by using two scoring systems . three parameters were used to evaluate radiologic outcome : anterior disc height ( adh ) , interbody height ( ih ) and segmental interbody angle ( sia ) ( fig . they were checked by plain x - ray on true lateral standing and classified into flexion , extension and neutral position view and 3d ct scan every 6 months after the surgery . fusion was defined according to trabecular bony formation across interfaces between cage and endplates and bony bridge formation between endplates . fusion was classified into 3 classifications : grade i , bridging bone partially filling the cage ; grade ii , bridging bone filling the cage ; and grade iii , bridging bone within and around the cage26 ) . we collected information from charts of patients who visited our neurosurgical department from march 2006 to july 2008 , retrospectively . only patients with single level acdf without anterior cervical plate were eligible for the study , and thirty patients were selected ( male : 20 patients and female : 10 patients ) . the mean age was 47.67.1 years ( range from 28 to 63 years old ) . the patients who complained of radiculopathy were 21 , myelopathy were 2 and myeloradiculopathy were 7 patients . mean follow - up period was 36.48.1 months ( ranged from 23 to 49 months ) . a right side skin incision was done in all cases ; fluoroscopy was used to check the target level . complete removal of the disc , lateral decompression and end plate flattening for maximal contact with cage was performed . after selection of ideal trial size by using intraoperative fluoroscopy , harvested cancellous bone from the iliac crest filled in the hollow space of the cage . finally , we checked that the radiopaque titanium spike was in an adequate location by fluoroscopy . we used the japanese orthopedic association ( joa ) score for evaluation of myelopathy and visual analogue scale ( vas ) for radiating pain to estimate postoperative clinical outcome . we assessed degree of pain relief between preoperative and postoperative ( last follow - up ) status by using two scoring systems . three parameters were used to evaluate radiologic outcome : anterior disc height ( adh ) , interbody height ( ih ) and segmental interbody angle ( sia ) ( fig . they were checked by plain x - ray on true lateral standing and classified into flexion , extension and neutral position view and 3d ct scan every 6 months after the surgery . fusion was defined according to trabecular bony formation across interfaces between cage and endplates and bony bridge formation between endplates . fusion was classified into 3 classifications : grade i , bridging bone partially filling the cage ; grade ii , bridging bone filling the cage ; and grade iii , bridging bone within and around the cage26 ) . we compared vas for neck and arm between preoperative and last follow - up status , additionally , joa score was also used . the mean vas for neck at the last exam was 2.50.8 and for arm was 3.21.1 ( p - value < 0.05 ) . in joa scoring assessment for 9 patients who were suffered from myelopathy , score improved from 11.12.9 at preoperative status to 14.52.6 at last exam(p - value < 0.05 ) . among 30 cases , 22 patients were performed 3 dimensional ct scan ( 3d ct ) at last follow - up and remainders were checked by cervical dynamic plain x - ray . radiological fusion rate was accomplished by 100% in selected group after 36 months after the surgery . grade i fusion were found in 1 case , grade ii were in 3 cases and grade iii were in 18 cases on 3 dct scan . on plain x - ray , grade i fusion was no case , grade ii were 1 cases and grade iii were 7 cases ( fig . the mean adh was 6.271.47 mm before the surgery and improved to 10.631.32 mm after the surgery ( p - value < 0.05 ) . some degree of subsidence occurred at the last follow - up and final adh was 8.321.08mm(p - value < 0.05 ) . in same way , ih improved from 36.73.35 mm to 41.24.23mm(p - value < 0.05 ) and slightly decreased to 38.73.75 mm at the last exam(p - value < 0.05 ) ; however , we still achieved an increase of ih . the mean preoperative sia was -3.353.44 and postoperative sia was -6.853.01 ( p - value < 0.05 ) . at the final exam , sia was -3.213.61 , not statistically different between postoperative sia and final exam sia ( p - value=0.813 ) . we had no complications concerned with the surgery itself except one case of osteomyelitis . during the follow - up period the superficial osteomyelitis of iliac bone donor site developed in 1 patient and a culture study of the infection site confirmed methicillin resistant staphylococcus aureus ( mrsa ) infection . we performed local debridement and irrigation and treated with vancomycin intravenous treatment for 10 days . we compared vas for neck and arm between preoperative and last follow - up status , additionally , joa score was also used . the mean vas for neck at the last exam was 2.50.8 and for arm was 3.21.1 ( p - value < 0.05 ) . in joa scoring assessment for 9 patients who were suffered from myelopathy , score improved from 11.12.9 at preoperative status to 14.52.6 at last exam(p - value < 0.05 ) . among 30 cases , 22 patients were performed 3 dimensional ct scan ( 3d ct ) at last follow - up and remainders were checked by cervical dynamic plain x - ray . radiological fusion rate was accomplished by 100% in selected group after 36 months after the surgery . grade i fusion were found in 1 case , grade ii were in 3 cases and grade iii were in 18 cases on 3 dct scan . on plain x - ray , grade i fusion was no case , grade ii were 1 cases and grade iii were 7 cases ( fig . the mean adh was 6.271.47 mm before the surgery and improved to 10.631.32 mm after the surgery ( p - value < 0.05 ) . some degree of subsidence occurred at the last follow - up and final adh was 8.321.08mm(p - value < 0.05 ) . in same way , ih improved from 36.73.35 mm to 41.24.23mm(p - value < 0.05 ) and slightly decreased to 38.73.75 mm at the last exam(p - value < 0.05 ) ; however , we still achieved an increase of ih . the mean preoperative sia was -3.353.44 and postoperative sia was -6.853.01 ( p - value < 0.05 ) . at the final exam , sia was -3.213.61 , not statistically different between postoperative sia and final exam sia ( p - value=0.813 ) . we had no complications concerned with the surgery itself except one case of osteomyelitis . during the follow - up period the superficial osteomyelitis of iliac bone donor site developed in 1 patient and a culture study of the infection site confirmed methicillin resistant staphylococcus aureus ( mrsa ) infection . we performed local debridement and irrigation and treated with vancomycin intravenous treatment for 10 days . acdf has been performed for treatment of cervical degenerative disease and applied to infectious disease , cervical trauma and tumorous condition10 ) . clinically , acdf with cage system began to be used regularly after clinical success of prospective research year 200013 ) . single level acdf with autograft shows over 95% of fusion rate and approximately 80% of neurologic improvement15,24,25 ) . some reports postulated there was no need for fusion after cervical discectomy and fusion should be considered only when instability occurs32 ) . the limitation of a cage - alone procedure is weak initial mechanical stability and subsidence to endplate . a cervical anterior plate and screw system provides reduction of kyphotic angulation , prevention of implant migration , and increases fusion rate and durable fixation . there may be , however , dysphasia due to plate and loosening , breakage of screw , plate migration and stress shield3,5,15 ) . innovative development of surgical instrument have reduced complications of the anterior plate system . however , complications are still reported even though dynamic plate or self locking screw is suggested27 ) . the peek cages are biologically inactive which means they do not induce a corrosive reaction and provide high versatility and good mechanical properties while causing minimal artifacts on mri and ct8,9 ) . furthermore , excellent radiolucency gives information that surgeon can use to adjust the cage at an optimal location during operation , and bone fusion can be readily evaluated by plain x - ray11,34 ) . titanium spikes on upper and bottom can make easy to anchor the vertebral body and provide immediate fixation , therefore cage migration is prevented . elastic modulus is defined as the capacity of returning to its initial shape when load is removed . lower elastic modulus shows a more natural characteristic with respect of bone material and lead to reduction of stress shield and increase bony fusion rate33 ) . among several cervical implants , high elastic mismatch between cage and bone can affect bone growth , promoting cortical thinning and subsidence in the case of metallic cages18,34 ) . generally , it is acceptable that bone fusion is achieved around 3 to 6 months after the surgery when using the peek cage . cho et al . reported 100% of bone fusion in forty cases was achieved by using peek cage comparing 93.1% of bone fusion when using iliac tricortical bonegraft9 ) . in this study , we achieved 100% of fusion rate . only cancellous bone from the iliac crest might be great role of increase fusion rate and small size of patient group might be another cause . the frequency of harvest autograft has decreased gradually , because of the relatively high rate of complications18 ) . complications of tricortical iliac bone graft are various such as displacement bone graft , pseudoarthrosis , hematoma , pain , nerve injury and infection of donor site20 ) . the incidence of related complications has been reported to be as high as 20% to 50%1,28 ) . moreover , the low stabilization support of iliac crest grafts requires instrumentation with anterior plate34 ) . to reduce complications related with donor site , many types of material have been studied to substitute autologous bone , but none of these have showed advantage over autologous bone6,16 ) . many complications related with iliac bone graft have been reduced with the use of cage system23 ) . in our patient group , the wound incision on the donor site was performed minimally and harvested only small amount of cancellous bone to minimize related complications . numerous materials have been tried to substitute for autologous bone graft to reduce donor site related complications . the ultimate material could provide immediate structural support and osteogenic intergration23 ) . since introduction of the cervical cage , numerous types of cage have been designed ; however subsidence of cage was reported frequently . ha et al . studied subsidence in standalone solis cage and found 8.1% of cages had subsidence greater than 3mm12 ) . noted that a decrease of disc height after operation did not affect clinical outcome20 ) . lee et al . found that subsidence occurred on radiologic evaluation at last follow - up when they used dmb rather than autologous bone graft23 ) . however , our data shows that at 36 months follow - up ih is still maintained compared to preoperative ih which implies autologous bone graft helps earlier bone fusion than dbm . symptomatic adjacent segment problems occur at rate of 2.9% per year during ten years after acdf with autologous bone graft , the risk was lower in multilevel acdf than in single level , and the fusion rate declines as the number of involved levels increase11,14 ) . in our study , we could not find degeneration of adjacent levels , but we concluded that this is due to small size of patient group . in current study , the complications of acdf with the peek cage did not include breaking , pseudoarthrosis , kyphotic angulation , protrusion of cage itself , and severe subsidence . however , one patient suffered from infection of donor site . local heating and pus discharge occurred at right iliac crest where cancellous bone was harvested and culture study performed . methicillin - resistant staphylococcus aureus ( mrsa ) was detected and vancomycin was prescribed for a week . to establish a role of the peek cage in acdf the authors searched many articles to find a long term follow - up study for clinical outcome after acdf with peek cage longer than 36 months but we believe that this study is the first report for long term follow - up . acdf with the solis cage provides favorable clinical outcomes and radiologic fusion rates comparing with other classical or alternative cervical fusion methods . it does not cause plate relating complication and radiologic opacity of cage spike enable to locate a cage at optimal location by using fluoroscope . there have been several reports that describe the efficacy of acdf with peek cage for short term follow - up , but long term(more than 24 months ) follow - up studies are rare . we present here a long term follow - up study for acdf with peek cage and its clinical efficacy is favorable .

objectiveto evaluate the utility of anterior cervical discectomy and fusion ( acdf ) with polyetheretherketone ( peek ) cage and autograft through long term(average 36 months ) follow-up.methodsthirty selected patients ( male:20/female:10 ) who suffered from cervical radiculopathy , myelopathy or radiculomyelopathy underwent a single level acdf with peek cage and autograft from iliac crest from march 2006 to july 2008 in single institute . we followed patients for an average 36.48.1 months ( ranged from 23 to 49 months ) . the japanese orthopedic association ( joa ) score for evaluation of myelopathy and visual analogue scale ( vas ) for radiating pain was used to estimate postoperative clinical outcome . plain x - ray on true lateral standing flexion , extension and neutral position view and 3d ct scan were used every 6 months after surgery during follow - up period.resultsthe mean vas and joa scoring improved significantly after the surgery and radiological fusion rate was accomplished by 100% 36 months after the surgery . we had no complication related with the surgery except one case of osteomyelitis . there was one case of grade i fusion , four cases of grade ii , and 25 cases of grade iii by radiologic evaluation.conclusionthis long term follow - up study for acdf with peek cage shows that this surgical method is comparable with other anterior cervical fusion methods in terms of clinical outcomes and radiologic fusion rate .

osteoarthritis ( oa ) is a degenerative joint disease that progressively causes loss of joint function and is a major source of physical disability and impaired quality of life in many countries [ 13 ] . the pathological changes which occur during oa involve all the joint structures , that is , synovium , cartilage , and bone tissues , but the main hallmark of this disease is the degradation of cartilage [ 4 , 5 ] . aging , trauma , hormonal , and mechanical factors are reported to contribute to the onset and progression of oa [ 68 ] . in addition , several studies have demonstrated the polymorphisms of some genes may be related to the pathogenesis of oa as well [ 911 ] . it is now accepted that the excessive and spontaneous inflammation plays a significant role in the molecular pathogenesis of oa , contributing to a highly catabolic state , chondrocyte apoptosis , and the resultant progressive degeneration of articular cartilage [ 1214 ] . bradykinins , a family of oligopeptides derived from the enzymatic action of kallikreins on kininogens , can promote all the major signs of inflammation , including hyperemia , leakage of plasma proteins , and pain [ 1517 ] . the presence of bk was previously reported in the synovial fluid from patients affected by arthritis of different etiologies , including oa [ 18 , 19 ] . bdkrb2 has been detected on the synovial lining cells , fibroblasts , and endothelial lining cells of blood vessels from oa patients [ 18 , 21 ] . clinically , the administration of b2 receptor antagonists effectively reduced the inflammatory articular pain and knee oa progression , suggesting the bdkrb2 is involved in the development of oa [ 18 , 22 ] . the genetic variants of bdkrb2 may lead to altered biological activities of the functional protein . the gene polymorphisms of bdkrb2 have been shown to be related with acei - induced cough in hypertensive patients , left ventricular hypertrophy , and insulin resistance [ 2326 ] . however , its relation with oa remains unknown . in this study , we enrolled knee oa patients to explore the role of bdkrb2 in oa . a total of 245 patients with primary knee oa were recruited from dec 2008 to feb 2009 . the severity of oa was evaluated according to the kellgren - lawrence ( kl ) grade classification , and only patients with k / l grades of 2 or higher were included . both oa and control groups were interviewed to obtain demographic data and all of established risk factors . in the study , other etiologies causing knee diseases such as inflammatory arthritis ( rheumatoid , polyarthritic , or autoimmune disease ) , posttraumatic or postseptic arthritis , skeletal dysplasia , or developmental dysplasia were excluded from oa group . all the control never had any signs or symptoms of arthritis or joint diseases ( pain , swelling , tenderness , or restriction of movement ) . the clinical characteristics of all enrolled subjects , including age , sex , body mass index ( bmi ) , smoke status , bone fracture history , knee activity , and regular excise , were recorded . the study was approved by the ethics review committee of our hospital , and written informed consent was obtained from all participants . reaction conditions for genotyping the two polymorphic loci ( + 9/9 and c 58 t ) were as follows : dna ( 100 ng ) was amplified in a 25 l reaction buffer containing 0.2 mmol / l deoxynucleotide triphosphates , 1.0 mmol / l mgcl2 , 20 mmol / l tris / cl ( ph = 8.4 ) , 50 mmol / l kcl , 0.015 nmol of each primer , and 0.5 u taq polymerase ( invitrogen corporation , carlsbad , ca , usa ) for 40 cycles of one minute at 94c , 30 s at 60c ( + 9/9 ) or 57c ( c 58 t ) , and 10 s at 72c , followed by a five - minute soak at 72c in a g - storm thermal cycler ( alphametrix biotech gmbh , rdermark , germany ) . the primers for the bdkrb2 + 9/9 polymorphism were as follows : forward , 5-tccagctctggcttctgg-3 , and reverse , 5-agtcgctccctggtactgc-3 , and the amplification products were 80 bp ( 9 ) versus 89 bp ( + 9 ) . the bdkrb2 c 58 t polymorphism was assayed using a pair of degenerate primers which were as follows : forward , 5-aaggtggccgcagccttcc-3 , and reverse , 5-ctcatctttcaagggctggcta-3. the reverse primer contained a g - c transversion ( underlined ) that generated a recognition site ( 5-ctag-3 ) for the restriction endonuclease bfai ( new england biolabs , ipswich , ma , usa ) in the presence of the c allele . if the c allele was present , the 133 bp pcr product digested to 112 + 21 bp . all pcr or digestion products were size - separated by electrophoresis in 8% polyacrylamide gel electrophoresis gels run in 1 trisborate - edta buffer and visualized with ethidium bromide and ultraviolet light . when observed or expected values included a cell with a value less than 5 , fisher 's exact test was used . in all cases , or fisher tests were used to compare genotype frequency and demographic distributions between cases and controls . multiple logistic regression analyses were used to evaluate if each snp was independently associated with oa when adjusted for the potential confounding effects of important clinical variables . the odds ratios ( ors ) and 95% confidence intervals ( cis ) were calculated . all analyses were performed by using spss software ( statistical package for the social sciences , version 16.0 , spss inc , chicago , il , usa ) . table 1 shows demographic and clinical characteristics of all subjects in the study . there were no significant differences in sex , age , smoke status , and history of heavy labor work between knee oa cases and controls . obesity prevalence was significantly higher in the oa patient group than in controls ( p = 0.013 ) . table 2 described the genotype distributions and allele frequencies of bdkrb2 polymorphisms in knee oa and control subjects . the genotype frequencies for all polymorphisms did not differ significantly from those expected under hardy - weinberg equilibrium ( both p > 0.05 ) . the genotype frequencies and allele frequencies at bdkrb2 58t / c were similar between oa and control subjects . the 9/9 genotype was significantly higher in knee oa subjects than in controls ( 33.46% versus 20.07% ) . accordingly , the 9 allele frequency was higher in oa patients than controls ( 57.754% versus 47.34% , p < 0.001 ) . logistic regression analysis showed a significantly increased risk for knee oa for the 9/9 genotype compared with the + 9/+9 genotype ( or = 2.35 , 95% ci : 1.4093.937 ; p < 0.001 ) after adjustment with sex , age , bmi , smoke status , history of labor work , regular exercise , and knee activity . the adjusted or for 9 allele carriage was significantly higher than 9 allele carriage ( or = 1.52 , 95% ci : 1.1861.947 , p < 0.001 ) . all the oa patients were grouped into two subgroups : subjects with kl 3 and those with kl score > 3 ( table 3 ) . we found that the + 9/+9 genotype was higher in those with kl score > 3 than in those with kl score < 3 . the + 9/9 and 9/9 genotypes represented higher risks of being severer oa ( or = 3.09 , p < 0.001 , and or = 2.98 , p = 0.002 , resp . ) . osteoarthritis ( oa ) is a painful and degenerating progressive disease of the joints which affects millions of patients worldwide . in this study , we investigated whether bdkrb2 gene polymorphisms influence the susceptibility of oa in a chinese cohort . our results showed that the 9/9 carriers had markedly higher risk for oa compared with + 9/+9 carriers . besides , the + 9/9 and 9/9 genotypes represented higher risks of being severer oa than + 9/+9 carriers . to the best of our knowledge , this is the first study regarding the role of bdkrb2 gene polymorphisms in oa . it contributes to the initiation and maintenance of inflammation , to exciting and sensitizing sensory nerve fibres , thus producing pain , and to activating synoviocytes and chondrocytes which are the main cells involved in the homeostasis of synovial fluid and cartilage , respectively [ 29 , 30 ] . the bdkrb2 is constitutively expressed in most tissues and is considered a stronger mediator of vasodilation and inflammation through increased production and release of nitric oxide [ 31 , 32 ] . in humans the bdkrb2 gene contains a number of polymorphic loci , including a nine - base insertion / deletion in the first exon of the gene ( + 9/9 , rs5810761 ) and c to t transition in the promoter region ( c 58 t , rs1799722 ) . the 9 bp deletion ( 9 ) in the gene encoding the bdkrb2 is associated with expression of higher concentrations of receptor mrna , suggesting its strong functional relevance . the + 9/9 genetic polymorphisms have been reported to be associated with a series of pathological conditions including coronary artery disease , systemic hypertension , and increased left ventricular mass associated with hypertension and pulmonary artery pressure [ 3638 ] . to our surprise , although the role of bdkrb2 in inflammation has been documented , we did not find any reports with regard to the genetic polymorphisms of bdkrb2 gene and inflammation . in this study , we firstly reported the role of genetic polymorphisms of bdkrb2 in oa . we found that the 9 p polymorphisms , rather than the 58t / c polymorphisms , are not only associated with the oa risk but also the oa severity . this finding suggests that the bdkrb2 + 9/9 polymorphisms may be used as a genetic marker for the onset and development of oa . however , it should be pointed out that our study is preliminary , and the results need to be further confirmed in larger - scale study , ideally , in different ethnic populations .

background . the b2-bradykinin receptor ( bdkrb2 ) has been reported to associate with onset and development of osteoarthritis ( oa ) ; however , the role of bdkrb2 genetic polymorphisms in oa remains unknown . method . a total of 245 patients with primary knee oa and 264 healthy volunteer were recruited . bdkrb2 gene polymorphisms , 58t / c and + 9/9 bp polymorphisms , were genotyped . results . the genotype distributions and allele frequencies of + 9/9 bp polymorphisms significantly differed between oa and control subjects . logistic regression analysis showed carriers with 9/9 genotype had a significantly increased risk for knee oa compared with the + 9/+9 genotype ( adjusted or = 2.356 , p < 0.001 ) . the or for 9 allele carriage was significantly higher than + 9 allele carriage ( adjusted or = 1.52 , p < 0.001 ) . the + 9/9 bp polymorphisms also determined the oa radiographic severity . the presence of 9 bp was associated with severer oa . the 58t / c polymorphisms did not affect oa risk and severity . conclusion . the + 9/9 bp polymorphisms of bdkrb2 gene may be used as a genetic marker for the susceptibility and severity of oa .

acute lung injury ( ali ) is a devastating syndrome and an important cause of mortality in critically ill patients . the syndrome is characterized by hypoxemia and respiratory failure due to exudation to alveolar spaces which impairs gas exchange . the risk factors for developing this syndrome include pneumonia , gastric aspiration , sepsis , shock , and acute pancreatitis . although acute pancreatitis represents one of the less common clinical disorders associated with acute respiratory distress syndrome ( ards ) , severe attacks of pancreatitis are frequently associated with acute lung injury and respiratory failure . the underlying molecular mechanisms behind the development of lung injury are not fully understood , which may explain the lack of specific pharmacologic therapies . transforming growth factor ( tgf- ) is a multifunctional cytokine regulating inflammatory and fibrotic disorders . it plays a critical role in embryonic development as well as in the resolution of tissue injury in multiple organs , including the lung . tgf- exists in three isoforms and is a member of a large family of soluble proteins that modulate several cellular processes . of these isoforms , tgf-1 is generated in greatest abundance subsequent to tissue damage . tgf- signaling is initiated via ligand - induced heteromeric complex formation of the tgf- type i and type ii serine / threonine kinases receptors . upon ligand binding , the tgf- type ii receptor ( trii ) phosphorylates the type i receptor , which then propagates the signal through phosphorylation of the smad protein cascade . smad proteins constitute three functional classes : the receptor - regulated smad ( r - smad ) , the comediator smad ( co - smad ) , and the inhibitory smad ( i - smad ) . r - smads ( smad1 , 2 , 3 , 5 , and 8) are directly phosphorylated and activated by the type i receptor kinases and form heteromeric complexes with the co - smad , smad4 . the activated smad complexes are translocated into the nucleus and , in conjunction with other nuclear cofactors , regulate the transcription of target genes . the i - smad , smad6 and smad7 , negatively regulates tgf- signaling by competing with r - smads for receptor or co - smad interaction and by targeting the receptors for degradation . tgf- has been most thoroughly evaluated for its crucial role in the development of pulmonary fibrosis and airway remodeling during the late phases of chronic lung injury [ 6 , 7 ] . however , the involvement and regulation of tgf- in acute lung injury are largely unknown . murine models have demonstrated that the expression levels of several tgf--responsive genes involved in extracellular matrix modulation and fibrinolysis were dramatically increased in the early phase after induction of lung injury . in addition , elevated levels of tgf-1 as well as tgf--inducible genes , such as procollagen type iii and 1 , have been demonstrated in the lungs of patients with ards [ 9 , 10 ] . procollagen iii is one of the earliest predictors of the severity of ali [ 1114 ] . tgf- has been shown to directly increase alveolar epithelial permeability by increasing the gaps between the endothelial cells [ 1518 ] . increased epithelial permeability permits migration of neutrophils , which stimulates repair of the pulmonary epithelium . we hypothesized that tgf- signaling might be active early in the lungs in ali and plays a significant part in the flooding of the alveolar spaces and lung injury . the aim of the present study was to investigate the early activation of tgf- signaling in the lungs of a murine model of acute pancreatitis - associated ali . antibodies against tgf-1 - 3 , trii , and alk5 ( tri ) were from santa cruz biotechnology inc . ( santa cruz , ca , usa ) . antibodies against smad2 , 3 , 4 , and 7 and p - smad2 810 -week- old male wild - type c57bl/6 mice were purchased from charles river , germany . the mice were housed in appropriate facilities at lund university , under specific pathogen - free conditions and handled according to the institute guidelines with approval of the malmo - lund animal care ethics committee . the animals were kept under 12/12 h light / dark regime in standard mesh cages with laboratory chow and drinking water ad libitum . animal model . acute pancreatitis was induced using the combined pancreatic duct and bile duct ( bpd ) ligation model as described previously . the bpd ligation model is a highly acute model that elicits a pronounced pulmonary inflammatory response as early as 9 h after acute pancreatitis induction . briefly , the mice were anesthetized and maintained with 24% isoflurane . under aseptic conditions , the bile duct , proximal to its entry into the pancreas , and the common bile - pancreatic duct , near its junction with the duodenum , were dissected and ligated ( bpd group ) . the same procedure was applied to sham - operated control mice where the common bile - pancreatic duct and the bile duct were dissected , but not ligated , after which the abdomen was closed . the mice recovered rapidly after surgery , and postoperative buprenorphine analgesia ( 0.05 mg / kg , s.c . ) was administered twice daily . the animals ( n = 8 in each group ) were sacrificed by exsanguination through puncture of the abdominal aorta 9 and 24 h after pancreatitis - induced surgery . lung biopsies were harvested , fixed in 4% paraformaldehyde for further immunohistochemical processing or snap - frozen in liquid nitrogen , and stored at 80c until western blot analyses . endogenous peroxidase activity was quenched for 30 min in darkness by 1% h2o2 ( sigma aldrich , st . louis , mo , usa ) in methanol ( histolab , gothenburg , sweden ) . after blocking with avidin - biotin ( vector laboratories , burlingame , ca ) and normal goat serum ( 5% ) for 60 min , the sections were incubated with primary antibodies in tris - buffered saline ( tbs)/saponin buffer overnight . biotinylated goat anti - rabbit igg secondary antibodies were added in 2% normal blocking serum . slides were developed for 5 min in diaminobenzidine ( dab , vectastain , vector laboratories ) and counterstained with mayer 's hematoxylin ( histolab ) . positively stained cells were quantified as average number of cells in 10 microscopic fields ( 20x magnification ) by two researchers blinded to the samples . snap - frozen lung tissue was homogenized in liquid nitrogen using a mortar and pestle . proteins were extracted in 1% tritonx-100 , 10 mm tris - hcl , 50 mm nacl , 5 mm edta , 30 mm sodium pyrophosphate , 50 mm naf , 0.1 mm na3vo4 , and complete protease inhibitor cocktail ( sigma ) . lysates were dissolved in laemmli buffer , boiled and separated by sds - page ( 12% ) , and transferred to 0.2 m hybond - c extra nitrocellulose membrane ( amersham biosciences ) . blots were blocked in 5% ( w / v ) milk in tris - buffered saline tween-20 ( tbst ) and incubated overnight at 4c with the primary antibodies ( 1 g / ml ) . following washing , the membranes were incubated for 1 h with the secondary hrp - linked goat anti - rabbit antibody at 1 : 2000 . immunoblotted proteins were visualized by supersignal west dura substrate ( pierce thermoscientific ) using li - cor odyssey fc imager ( li - cor biosciences ) and image studio vr 2.0 software . statistical analyses were performed by two - tailed student 's t - test using prism software . a p value of < 0.05 was considered statistically significant . to investigate the role of the tgf- system in the progression of ali due to acute pancreatitis , levels of tgf-1 , -2 , and -3 were examined in the lungs of ligated animals with acute pancreatitis compared to sham . in the lungs of the animals with ap , tgf-1 was associated predominantly with the bronchial epithelium and macrophages at both time points . occasional fibroblast - like cells and type ii alveolar epithelial cells were also stained ( figure 1(b ) ) . there was a 1.68-fold enhanced expression of tgf-1 in the lungs of this group compared to the sham - operated animals ( p < 0.05 ; figures 1(a ) , 1(b ) , 1(g ) , and 1(h ) ) . these changes were more pronounced after 24 h as compared to 9 h ( p < 0.01 ; figures 1(g ) and 1(h ) ) . staining for tgf-2 in airways of the animals with ap showed similar pattern to that for tgf-1 . bronchial epithelial cells and smooth muscle cells were stained more intensely compared to other cell populations and fibroblast - like cells were stained more consistently compared to tgf-1 . neutrophils were positive for tgf-2 as well as macrophages , sub - epithelial fibroblast - like cells which were stained moderately . no obvious difference between the sham - operated and ligated animals at any of the time points ( figures 1(c ) and 1(d ) ) . macrophages , fibroblast - like , and smooth muscle cells were also showing expression . in the ligated group , macrophages were generally stained ; subepithelial fibroblast - like cells showed mixed but predominantly positive staining . the bronchial epithelial cells showed a stronger staining tendency in the ligated group in both 9 ( figures 1(e ) and 1(f ) ) and 24 h ( data not shown ) . protein extracts from the lungs of the sham - operated and ligated animals were analyzed by western blotting . total tgf-1 protein levels were higher in the lung extracts of the ligated animals at 9 and 24 h compared to the lungs of the sham - operated group ( figures 1(g ) and 1(h ) ) . there was not any difference for tgf-2 and 3 protein levels between the sham - operated animals and the acute pancreatitis group ( data not shown ) . these results indicate that early modulation of tgf- ligands in the lungs of mice with acute pancreatitis mostly relates to induction of the tgf-1 isoform rather than tgf-2 and tgf-3 . to assess modulation of two candidate receptors for tgf- signaling , the lung sections were stained for trii and alk5 ( tri ) . both the acute pancreatitis ( figure 2(b ) ) and sham - operated groups ( figure 2(a ) ) demonstrated high levels of trii in bronchial epithelial and smooth muscle cells , while alveoli , fibroblasts , endothelial , and infiltrating cells showed moderate to weak staining ( figures 2(a ) and 2(b ) ) . no obvious difference in the expression pattern of trii was observed between the acute pancreatitis group and sham controls at the time points studied . bronchial epithelial and vascular endothelial cells were strongly positive for alk5 , while fibroblasts and alveoli were moderately positive for alk5 in the lungs of the pancreatitis - induced group ( figures 2(d ) and 2(f ) ) . a similar staining pattern was observed in the lungs of the sham - operated groups ( figures 2(c ) and 2(e ) ) . interestingly , the bronchial epithelial cells demonstrated an enhanced nuclear accumulation of alk5 after 9 h that was further enhanced at 24 h after acute pancreatitis induction compared to sham controls . in addition , acute pancreatitis following bpd - ligation was further associated with enhanced number of infiltrating cells that were more alk5-positive compared to sham ( figures 2(d ) and 2(f ) ) . a significant overall increase in the number of alk5-positive cells per field was found in the pancreatitis - induced groups compared to sham at both 9 and 24 h ( figure 2(g ) , 53 versus 32 ; p < 0.001 and 45 versus 32 ; p < 0.05 ; resp . ) . the elevated alk5 levels in the lungs following acute pancreatitis induction were further confirmed by western blot of total protein extracts . a pronounced increase in the total protein levels of alk5 was detected at both 9 and 24 h in the pancreatitis group compared to sham control ( figure 2(h ) ) . these data indicate that the acute pancreatitis mediated regulation of tgf- responses at the receptor level predominantly involves induction of alk5 instead of trii . smad2 was detected at moderate levels in bronchial epithelium , infiltrating cells , and fibroblasts , while low levels were observed in alveoli and vascular endothelial cells in both sham controls and 9 h after acute pancreatitis induction ( figures 3(a ) and 3(b ) ) . high levels of smad3 were observed in bronchial epithelium , vascular endothelium , infiltrating , and fibroblast - like cells , while low levels were detected in alveolar cells in both sham controls and with acute pancreatitis induction ( figures 3(c ) and 3(d ) ) . similarly , lungs from both sham controls and acute pancreatitis - associated ali showed moderate levels of smad4 in bronchial epithelial , vascular endothelial and infiltrating cells ( figures 3(e ) and 3(f ) ) . a moderate smad4 induction was noted in the infiltrating cells in the ligated animals compared to sham controls ( figure 3(f ) ) . however , neither immunostainings nor western blot ( figures 3(g ) and 3(h ) ) analyses showed a significant modulation of the smad24 protein levels in the lungs following 9 or 24 h acute pancreatitis induction compared to sham controls . to further study regulation of the tgf- signaling pathway , bronchial epithelial cells as well as vascular endothelial , smooth muscle , and inflammatory cells showed considerably higher levels of smad7 9 h after acute pancreatitis induction compared to sham controls ( figures 4(a ) and 4(b ) ) . however , the smad7 induction appeared transient and with disease progression the levels of smad7 were reduced . after 24 h the levels were not altered notably compared to control ( figures 4(c ) and 4(d ) ) . analysis of the smad7 protein levels in lung extracts confirmed the immunohistochemistry findings , with 2.41-fold increased levels of smad7 ( p < 0.05 ) in the ligated group at 9 h , but not at 24 h , compared to sham controls ( figure 4(e ) ) . in order to study the level of active tgf- signaling during acute pancreatitis - associated acute lung injury , the activation and subcellular distribution of phosphorylated smad2 ( p - smad2 ) bronchial epithelial , vascular endothelial , infiltrating , and fibroblast - like cells in the sham - operated animals had a weak cytoplasmic expression of p - smad2 at both 9 and 24 h , with scattered cells showing a nuclear localization ( figures 5(a ) and 5(c ) ) . in contrast , enhanced levels of cytoplasmic and importantly nuclear translocated p - smad2 were detected in the lungs , especially in vascular endothelial cells , 24 h after acute pancreatitis induction compared to sham control ( figures 5(c)5(f ) ) . despite differences at the cellular level , the total protein level of p - smad2 was not altered between the sham - operated and ligated animals at any of the time points ( figure 5(g ) ) . a summary of the changes in expression of the tgf- signaling molecules is presented in table 1 . tgf- has a well - established role in the fibrotic processes during chronic lung diseases . in the present study , we show that tgf- signaling modulation starts as early as 9 h in the lungs of animals with acute pancreatitis - associated acute lung injury . these changes included an early increase in the levels of tgf-1 and alk5 ( tri ) . a parallel increase in the signaling regulator and general inhibitor of the tgf- signaling transduction , smad7 , was found at 9 h. later in the course of the disease at 24 h the levels of tgf1 and alk5 remained high , while levels of the inhibitory smad7 were reduced back to the level of the sham - operated animals . these changes were associated with an enhanced nuclear translocation of phosphorylated smad2 indicating an active tgf- signaling . this is the first report on the early modulation of tgf- signaling pathway in the acute lung injury due to acute pancreatitis . tgf- signaling regulates various cellular processes , including cell proliferation , recognition , differentiation , apoptosis , and specification of developmental fate during embryogenesis as well as in mature tissues . previous studies have indicated that tgf- not only participates in the late phase of acute lung injury , but also might be active early in acute lung injury and potentially could contribute to the development of pulmonary edema . tgf- mrna level increased in murine intraparenchymal mononuclear cells and in alveolar macrophages within 1 h in a hemorrhage - induced acute lung injury model . in addition to its classical role in fibrotic and extracellular matrix remodeling , tgf- signaling has a pivotal role in angiogenesis and vascular defects . the in vitro effect of tgf- on the integrity of vascular endothelium started within 1 - 2 h and was maximal 8 - 9 h after exposure to tgf- . tgf-1-induced lung endothelial cell barrier dysfunction is mediated by activation of rho and rho - kinase , which induce endothelial cell permeability . this effect appears to result from endothelial cell contraction through the activation of a myosin light chain kinase - dependent signaling cascade . our results showed an early increase ( 9 h ) in the protein level of tgf-1 in the lungs of animals with acute pancreatitis . this can be a contributing factor to the lung injury due to tgf- effects on the vascular integrity . we have previously shown a significant enrichment of inflammatory cells ( neutrophils and macrophages ) , recruited into the lung tissue of animals with acute pancreatitis at 9 h . in addition to its effects on vascular permeability , tgf-1 has been shown to enhance monocyte migration . tgf-1-driven monocyte motility was mediated via alk5-induced pi3 k and p38 signaling , independently of smad2/3 . the early rise in both tgf-1 and alk5 observed herein may thus contribute to stimulate the monocyte enrichment in the lungs at 9 h. disruption of the vascular integrity is not the only way that tgf- signaling can play a role in the initiation and progression of acute lung injury . tgf- activation plays a role in the development of acute lung injury through alteration of fibroproliferative responses , lung permeability , and inflammatory cell influx [ 18 , 2729 ] . tgf- and tgf--inducible genes are able to modify lung permeability , epithelial ion transport , fibrinolysis , extracellular matrix , and surfactant homeostasis . the integration of the changes in these molecular pathways by tgf- implicates it as a central mediator of acute lung injury . mice treated with anti - tgf-antibodies showed decreased levels of pro - inflammatory cytokines compared to untreated one in a hemorrhage - induced acute lung injury model . different human diseases have been associated with dysregulation of tgf- signaling , which shows the importance of a well - regulated signaling process . smad7 is part of an autoinhibitory feedback control , which interacts with alk5 through various mechanisms . smad7 resides in the nucleus in unstimulated cells and translocates to the plasma membrane following receptor activation , where it binds the receptors and inhibits further signaling . smad7 has a central role in pathological processes by its antifibrotic and anti - inflammatory properties . the anti - inflammatory activities of increased smad7 at early phase in our model can be interpreted as a protective mechanism in the lungs of the animals with acute pancreatitis . in this study , we showed increased levels of both tgf-1 and alk5 in the lungs as early as 9 h after the induction of acute pancreatitis . however , increased tgf- signaling via the smad2 pathway was observed first after 24 h following acute pancreatitis induction . increased nuclear translocation of phosphorylated smad2 at 24 h can be due to the decreased smad7 levels in the lungs . this time point was the peak of the inflammatory response associated with inflammatory cells recruitment to the lungs as well as pathological changes indicating the acute lung injury , in a previous report . the later activation of the signaling pathway can be of interest in the acute lung injury , making the tgf- pathway a potential therapeutic target . this is in accordance with previous report of attenuated lung injury by administration of a tgf- inhibitor 24 h after the injury . in summary , the present study shows an early rise in tgf-1 and alk5 which may activate the tgf-/smad2 signaling or alternative pathways to contribute to ali . acute lung injury is a critical syndrome due to a variety of precipitants , including acute pancreatitis . improvements in outcome following ali over the past decade are in part due to improved strategies of mechanical ventilation and advanced support of other failing organs and not a specific treatment . clinical and experimental studies indicate a role of tgf- in the early phases of ali , where tgf- contributes to the lung injury through epithelial and endothelial injuries . our data showed an early rise in smad7 which can block the tgf-/smad2 signaling . with disease progression , the smad7 levels were reduced with a concomitant increase in nuclear translocation of phosphorylated smad2 , an indicator of active tgf-/smad2 signaling .

acute lung injury is caused by many factors including acute pancreatitis . there is no specific therapy directed at underlying pathophysiological mechanisms for acute lung injury . transforming growth factor- ( tgf- ) is involved in the resolution of lung injury in later phases of the disease . some evidence exists demonstrating that tgf- not only is involved in the late stages , but also contributes to lung injury early on in the progress of the disease . acute pancreatitis was induced using ductal ligation in mice . tgf-1 , 2 , and 3 , trii , alk-5 , smad2 , 3 , 4 , and 7 , and p - smad2 expression in the lungs were analyzed at 9 and 24 h. we demonstrate that tgf-1 levels in the lungs of mice with acute pancreatitis increase as early as 9 h after induction . we observed an increased expression of alk-5 in acute pancreatitis at both 9 and 24 h. inhibitory smad7 expression was transiently increased at 9 h in acute pancreatitis , but reduced later at 24 h , with a concomitant increased nuclear translocation of phosphorylated smad2 . our findings demonstrate activation of tgf- signaling in the lungs as early as 24 h after acute pancreatitis , suggesting that tgf- may represent a potential therapeutic candidate in acute pancreatitis - induced acute lung injury .

primary amenorrhea is usually the result of a genetic or anatomic abnormality . in young women with primary amenorrhea , it is commonly caused by x - chromosome aberrations such as in turner syndrome , but individuals with a normal chromosome complement and ovarian dysgenesis also exist . a 35-year - old female patient presented to our medical outpatient department with complaints of palpitation and chest pain of 6 months duration . patient had paroxysmal episodes of palpitations that lasted few minutes , resolved spontaneously , and were not associated with exertion or other aggravating factors . patient had chest pain that was retro - sternal , intermittent not related to exertion and resolved spontaneously . menstrual history revealed that she never attained menarche . on examination she had dolicocephaly , arachnodactyly , high arched palate , she was tall statured [ height 165 cm ; figure 1 ] , her arm span ( 176 cm ) was more than her height , arachnodactyly [ figure 2 ] , reduced upper to lower body segment ratio ( 0.83 ) , and she had positive wrist and thumb sign . patient had underdeveloped rudimentary breasts ( tanner stage 2 ) , sparse pubic hair ( tanner stage 1 ) , and absent axillary hair . cardiovascular examination revealed mid - systolic click with a late systolic murmur , other systems were essentially normal . her blood glucose , renal function tests , liver function tests , and serum electrolytes were within normal limits . echocardiogram echo / doppler revealed prolapse of anterior mitral leaflet , mitral regurgitation and normal left ventricular systolic function . she had low levels of estrogen ( estradiol-10 pg / ml ; normal 15 - 200 pg / ml ) , serum testosterone ( 0.16 pg / ml , normal 0.6 - 6.8 pg / ml ) , and progesterone ( 0.56 ng / ml ) . she had elevated levels of gonodotropins , follicle - stimulating hormone ( fsh ) ( 101.3 serum prolactin ( 12 ng / ml , normal 0 - 20 ng / ml ) and thyroid function tests ( free t4 - 9.2 mcg / dl , normal 4.6 to 11.2 mcg / dl ; tsh-3.49mu / l , normal 0.4 - 5.0 marfanoid habitus : tall stature , height 165 cm ; arm span to height ratio of 1.067 ; upper segment to lower segment ratio of 0.83 arachnodactyly with high metacarpal index mci list of investigations that contributed in diagnoses of primary amenorrhea perrault and his colleagues in 1951 published the first report on two sisters with gonadal dysgenesis and with additional sensorineural deafness . hypothesized that there is a form of ovarian dysgenesis that is inherited as an autosomal recessive , female - limited disorder . neurologic data are available on 14 of 21 girls ; 7 of 14 had neurologic abnormalities . they concluded that high incidence of neurologic anomalies suggest that ataxia or mental retardation may not be just coincidental findings , but pleiotropic manifestations of perrault syndrome . reported on two sporadic and two familial new cases with sensorineural hearing impairment and ovarian dysgenesis , which are the cardinal signs of perrault syndrome in females . reported on two pairs of sisters with gonadal dysgenesis and deafness , cerebral , and ocular involvement who developed a progressive , severe sensory , and motor neuropathy . based on the clinical observations of known patients ; two forms of ps may be distinguished : one apparently non - progressive form and another with apparently progressive axonal - cerebellar degeneration . nishi et al . reviewed 21 patients from the literature , added ataxic gait , pes equinovarus , nystagmus , limited extraocular movements to the spectrum of neurologic defects in ps . absence of deafness in a patient with xx female gonadal dysgenesis ( xx - gd ) does not rule out perrault syndrome because the patients could develop deafness much later , at an older age . most patients had moderate to severe sensorineural deafness with mutism among patients with early onset of deafness . the findings of abnormal body proportions noted in our patients have been previously reported by jacob et al . in their observation of two siblings with perrault syndrome with marfanoid habitus . the pathogenetic basis for the ps is still unclear . studied a small family of mixed european ancestry includes two sisters with well - characterized perrault syndrome . whole - exome sequencing of genomic dna from one of these sisters revealed exactly one gene with two rare functional variants : hsd17b4 . further studies on other families are awaited to confirm the homogeneity of the genetic defect and the underlying molecular defect . these issues were discussed with our patient . during the follow up visits , we noticed depression and suicidal tendencies . after a comprehensive psychiatric evaluation , she was diagnosed with major depression and was put on anti - depressant medication . we did not advice any therapy for mitral valve prolapse as the prognosis in asymptomatic patients with nonsustained arrhythmias and structurally normal hearts is quite good . thus , the potential deleterious effects of drug therapy probably outweigh any risk from the arrhythmia in this setting . similarly , no antibiotic prophylaxis or anti - thrombotic prophylaxis was suggested as present guidelines recommends endocarditis prophylaxis for patients only at the highest risk . perrault syndrome is a rare cause of primary amenorrhea or ovarian dysgenesis , but should be considered in a female child with deafness / mutism . several reported cases have some form of neurologic deficit but our patient did not have any obvious neurological signs or symptoms , but she had marfanoid habitus , an association that was described only once in the literature . the marfanoid features could be considered as a part of extended phenotype of perrault syndrome .

gonadal ( ovarian ) dysgenesis with normal chromosomes ( 46 , xx ) , xx female gonadal dysgenesis ( xx - gd ) is a rare genetically heterogeneous disorder . in 1951 , perrault reported the association of gonadal dysgenesis and deafness , now referred to as perrault 's syndrome . perrault syndrome is a rare autosomal recessive condition affecting both females and males ; only females have gonadal dysgenesis associated with sensorineural deafness , which is present in both sexes . we present a case of sporadic perrault syndrome in a 35-year - old female with primary amenorrhea , sensorineural deafness , marfanoid features and normal karyotype . there are very few case reports describing the condition , even lesser reports of association with marfanoid habitus . we report this case for its rarity and add to the spectrum of the disease that remains undetermined .

bites from venomous snakes kill more people in the developing world than some of the world 's better recognized and better studied neglected tropical diseases . . though not all bites are by venomous snakes or result in poisoning , up to 2 million of these bites result in the injection of venom , with hundreds of thousands of significant injuries and as many as 94,000 to 125,000 deaths occurring primarily in india , southeast asia , and sub - saharan africa [ 2 , 3 ] . the vast majority of snakebites occur in impoverished , rural populations with limited access to medical treatment . mortality from snakebite is unequivocally linked to socioeconomic markers of poverty and even a successful hospital treatment can cause economic ruin . a recent study from the indian state tamil nadu analyzed how patients hospitalized for snakebite paid for their expenses : 40% took loans , 20% sold stored crops , 15% sold valuables 10% sold cattle , and many reported removing their children from school all while incurring up to 12 years income worth of debt . it is estimated that around 10,000 people die from snakebite each year in tamil nadu , alone , more than twice the total number of deaths claimed by landmines each year , worldwide [ 4 , 5 ] . neostigmine is an acetylcholinesterase inhibitor ( achei ) that is administered intravenously and is currently recommended by the who for the treatment of neurotoxic snakebite . acetylcholinesterase inhibiting drugs such as neostigmine and edrophonium are thought to reduce the neuromuscular block from neurotoxic snakebite by increasing the amount of acetylcholine at the neuromuscular junction as it does in the treatment of myasthenia gravis or the reversal of nondepolarizing neuromuscular blocking agents [ 69 ] . atropine or glycopyrrolate , in intravenous ( iv ) form , are usually coadministered with acheis to blunt the undesirable muscarinic effects of acheis . however , coadministration is not necessary in some clinical studies , for example , in myasthenia gravis patients receiving intranasal ( in ) administration for up to one year [ 10 , 11 ] . interestingly , in neostigmine has been used to treat myasthenia gravis in several studies [ 1013 ] and we recently showed in a human study that it could reverse mivacurium - induced neuromuscular blockade by this route . the present study tested the hypothesis that neostigmine , given in , would be an effective initial treatment of naja naja envenomed mice . the early use of acheis leads to a considerable increase in the ld50 in mice and rats having undergone experimental envenomation [ 15 , 16 ] . our study is distinguished from those by the replacement of parenteral neostigmine with topically applied in neostigmine . the rationale for this study is that since neurotoxic snakebites often occur far from hospitals , by eliminating the need for injection ( e.g. , of parenteral neostigmine or intravenous antivenin ) , we may be able to shorten time to treatment and save lives . the study was approved by the animal research committee of a contract research laboratory in hyderabad , india , an iacuc - certified laboratory and performed by a trained technician , a full - time dvm and one of us ( mrl ) who performed experiments at the facility . unfractionated n. naja venom was purchased from sigma - aldrich ( st . louis , mo , usa ) ; neostigmine and atropine were purchased from besse medical ( ann arbor , mi , usa ) . polyvalent antivenom ( vins bioproducts , andhra pradesh , india ) was available at all times in the event of accidental envenoming of staff . a small pilot study was carried out to assess the potency of the reconstituted lyophilized n. naja venom to test if it was comparable to published reports of other commercially available unfractionated , frozen , or lyophilized n. naja venom at 0.3 mg / kg [ 15 , 1719 ] . mice were pseudorandomized in batches of 5 with tails marked 1 to 5 stripes by sharpie felt tip pen to receive intraperitoneal ( ip ) injections of n. naja venom ( 2.5 ld50 , n = 20 ; 5 ld50 , n = 10 and 10 ld50 , n = 10 ) concomitantly with atropine , which blunts the muscarinic effects of neostigmine and has previously been shown to have no effect on ld50 when experimentally injected with snake venom . the ip agents ( venom and atropine ) were adjusted for the weight of each individual mouse by the facility veterinarian and injected by a single technician who was not aware of the hypothesis and who also recorded the survival times . animals received either 5 l of 0.5 mg / ml neostigmine or 5 l of saline by in administration by mrl . animals in the 2.5 ld50 group received treatment or control 10 minutes after venom injection . in the 5 ld50 and 10 ld50 groups , animals received in neostigmine 1 - 2 minutes after venom injection . preliminary studies the mice were already severely disabled by 10 minutes after experimental envenomation with the higher doses of venom and neostigmine did not appear to help . animals were observed continuously for up to 12 hours and assessed for signs of toxicity including respiratory distress , loss of spontaneous locomotor activity with the only endpoints being time to death or recovery . dead mice were removed immediately and tail - band number was recorded on a data sheet reflecting the mouse 's lot and individual band number as well as weight . surviving animals were euthanized after 12 hours by the same technician who performed the experimental envenomation procedure . the technician , however , was blinded to knowing which mice had been treated with in neostigmine or saline control . data were analyzed using graphpad prism ( la jolla , ca ) and the p values presented in the figures were as calculated by nonparametric mann - whitney test . envenomed mice were further characterized using a survival analysis that included censoring to account for the study being terminated at 12 hours ( 720 minutes ) after dosing . to plot survival time on a single y - axis , the survival time data was normalized within each envenomation dose to the mean survival time of each control group and then multiplied by 100 . because snakebites in the community can result in a highly variable amount of venom being delivered to the patient , we sought to determine whether in neostigmine could be effective in improving survival at several dosages of venom in our mouse model . figures 1(a)1(c ) show the effects of neostigmine in mice envenomed with naja naja venom at various concentrations : 2.5 ld50 ( a ) , 5 ld50 ( b ) , and 10 ld50 ( c ) . as described above , the rationale for using in neostigmine is to improve survival time from the moment of the snakebite . these results support our idea that early in achei therapy could improve survival even after a potentially severe neurotoxic envenomation . higher venom dosages resulted in earlier deaths , as expected , but for all dosages of venom , neostigmine provided a substantial and persistent window of increased survival . envenomed mice died at an average of 193 minutes compared to 553 minutes ( p < 0.02 ) for the treatment group ( 10/15 were euthanized after the arbitrary cutoff of 6 hours , but were behaving completely normally ) . at the 5 ld50 venom dosage , survival was prolonged from a mean of 45 minutes in the control group to 196 minutes in the treatment group ( p = 0.01 ) . likewise , at the 10 ld50 venom dosage , mean survival was prolonged from 30 to 175 minutes ( p < 0.02 ) . findings reached statistical significance even after reanalysis excluding surviving outliers in the 5 ld50 and 10 ld50 groups . most bites in humans are on the extremities , but we chose the ip route for consistency and to replicate elements of previously published mouse studies [ 1517 ] . due to limitations of funding , we only tried one type of experimental envenomation using a curare - like snake neurotoxin ; it is likely that the effects of in acheis will vary across different venom types . venoms contain a multitude of toxic peptides and proteins and published ld50 ranges vary widely between cobra species , subspecies and route of delivery ( e.g. , subcutaneous , intravenous , or ip ) [ 15 , 1720 ] . mice and humans differ greatly in their sensitivity to the same drugs [ 21 , 22 ] , and only one set of neostigmine to atropine concentrations was used . thus , as with all transitions from preclinical to clinical usage , dosages will need to be optimized for human use . fortunately , the development of in neostigmine for the treatment of myasthenia gravis [ 1013 , 23 , 24 ] provides a substantial head start for this transition . only a single dose of in neostigmine was administered , so it is not clear if mice would have survived longer with multiple treatments and no other acheis were tested . the concentration of neostigmine was significantly lower than that has been used in human studies , though total dose was comparable and the drugs were not aerosolized but dropped on the nares [ 1014 ] . in the present study , atropine was coadministered with in neostigmine through ip route . in previous mouse studies atropine we anticipate that an anticholinergic agent such as atropine ( which can be administered in ) would potentially be administered with neostigmine to blunt untoward muscarinic effects of an achei should these effects be present with in achei formulations in a human study . interestingly , in the year - long study by sghirlanzoni and colleagues , patients self - administering in neostigmine did not report any complications from in neostigmine . broggini and colleagues tested the bioavailability of high dose in neostigmine compared to iv administration in healthy human adults without coadministration of atropine and did not note any serious adverse events . the ip - absorption kinetics of atropine are more reliable and proven than the in absorption kinetics of atropine . thus , if we had coadministered atropine in instead of ip , we would be faced with the confoundedness that perhaps differential survival depended on intersubject differences in atropine - absorption kinetics . this confoundedness would be impossible to disambiguate from our central hypothesis in such a small study . by contrast , if survival depended on differential in absorption kinetics ( of neostigmine ) , that simply serves to further support the central hypothesis that neostigmine is the critical variable , especially in light of gieu 's results showing that ip atropine did not materially alter survival from experimental ip cobra envenomation . similarly , we did not attempt any skin hemorrhagic or myonecrosis activity assays , though no unusual bleeding was noted . mice were only observed for neurological manifestations of envenomation such as convulsion , hind limb paralysis , and respiratory distress after injection of reconstituted venom . muscle - contraction - dependent respiration is a necessary condition for life amongst all mammals and virtually all vertebrates . the present finding builds on our earlier demonstration that in neostigmine could reverse paralysis in an awake , experimentally paralyzed human subject . to our knowledge , this is the first demonstration that a topically applied drug could reverse venom - induced neurotoxicity . we previously showed that nasal neostigmine could reverse mivacurium - induced paralysis in an awake human . together , these data provide proof - of - principle that venom - induced toxicity should be treatable in the out - of - hospital setting and provide early , life - saving interventions at low cost . anil and colleagues showed that the mean time interval between bite and arrival to hospital was 4.5 h by which point the venom would have been entrenched at presynaptic axons . rapid death from krait bite most often comes as a result of the alpha - toxin and diaphragmatic paralysis and airway obstruction could be delayed by early achei therapy , but to our knowledge this idea has never been tested . in mouse studies , guieu showed that among the drugs they tested only acheis consistently resulted in increases in naja venom ld50s while atropine had no effect on the ld50 . similarly , flachsenberger showed that at otherwise lethal doses , all animals survived as a result of early achei treatment following ip administration of adder ( acanthophis antarcticus ) venom . flaschenberger further found that the expected survival time of animals subjected to even higher experimental venom doses was significantly extended . these animal [ 15 , 16 ] and human morbidity and mortality studies suggest that if acheis can be administered during the initial , critical stage after envenomation there could be a survival benefit to human victims [ 16 , 2732 ] . surprisingly , both the efficacy and optimal uses of antivenom and achei therapies for neurotoxic snakebite remain unproven even after decades of widespread use [ 2 , 14 , 3338 ] . it has been argued that the development of more diverse and regionally specific antivenoms is the most cost effective means of combatting morbidity and mortality from snakebite in the developing world [ 3941 ] . we argue that investment in repurposed , low - molecular - weight pharmaceuticals would be more cost effective in the long term because of their ease of use , heat stability , and safety profiles . in administration of neostigmine has the potential to provide snakebite victims with significantly increased access to an effective treatment for neurotoxic snakebite while suggesting a strategy for the development of topically administered antidotes to hemotoxic , cardiotoxic , and other complex envenomation in the future . this type of innovation would save lives while significantly lowering the economic burden on individuals , families , communities , and governments . to date , no prospective human study has been done to analyze the effect of immediate achei administration in the setting of neurotoxic snakebite . the primary aim of this pilot study was to test if early in administration of acheis and in principal any venom - inhibiting agent is plausible . the results of this study suggest that this is the case and that significant further study of this and other strategies is warranted .

objective . most snakebite deaths occur prior to hospital arrival ; yet inexpensive , effective , and easy to administer out - of - hospital treatments do not exist . acetylcholinesterase inhibitors can be therapeutic in neurotoxic envenomations when administered intravenously , but nasally delivered drugs could facilitate prehospital therapy for these patients . we tested the feasibility of this idea in experimentally envenomed mice . methods . mice received intraperitoneal injections of naja naja venom 2.5 to 10 times the estimated ld50 and then received 5 l neostigmine ( 0.5 mg / ml ) or 5 l normal saline by nasal administration . animals were observed up to 12 hours and survivors were euthanized . results . 100% of control mice died . untreated mice injected with 2.5 ld50 naja naja died at average 193 minutes after injection , while 10 of 15 ( 67% ) of treated mice survived and were behaviorally normal by 6 hours ( p < 0.02 ) . in the 5 ld50 group , survival was prolonged from 45 minutes to 196 minutes ( p = 0.01 ) and for 10 ld50 mice , survival increased from 30 to 175 minutes ( p < 0.02 ) . conclusion . this pilot suggests that intranasal drugs can improve survival and is the first direct demonstration that such an approach is plausible , suggesting means by which treatment could be initiated before reaching the hospital . further investigation of this approach to neurotoxic and other types of envenomation is warranted .

the knowledge about the role of cytokines in psoriasis has developed in the last several years . initially , only th1 cells and cytokines secreted by these cells , like tnf- , ifn- , and il-2 , have been associated with the development and maintenance of chronic inflammatory diseases , such as psoriasis . th1 cells differentiate from naive cd4 + cells in the presence of il-12 , il-18 , and ifn and . it is well known that th1 cytokines have strong inflammatory effects in activating macrophage , neutrophil , and cd8 + cytotoxic t cells . in the 1990s , th17 cells were described as a new t - cell population that produces il-17 , il-6 , il-21 , il-22 , and tnf . transforming growth factor ( tgf)-1 , il-6 , il-23 , and il-15 stimulated initial th17 differentiation from naive t cells . tgf-1 is secreted by activated t cells and it initiates t cell and fibroblast activation , as well as angiogenesis and neovascularization [ 37 ] . il-6 , secreted by macrophages , endothelial cells , and epithelial cells , is responsible for augmentation of keratinocyte hyperplasia and invasion of macrophages and t cells [ 3 , 8 ] . il-15 , produced by monocytes , macrophages , dcs , and t cells , can appear to induce angiogenesis , immune cell recruitment , and activation of keratinocytes [ 4 , 9 , 10 ] . cytokines produced by th17 cells were found to initiate acanthosis , hyperkeratosis , and parakeratosis . th17 cells demonstrated involvement in neutrophil and monocyte chemotaxis , t - cell migration and activation , and neovascularization . th22 cells have been recently described as inflammatory cd4 + t cells that produce cytokines such as il-22 , il-26 , and il-13 of which il-22 is the most important functional cytokine . recent studies indicate that il-6 and tnf- , along with the help of plasmacytoid dendritic cells , can promote the th22 phenotype [ 14 , 16 ] . the differentiation of main three t cell subsets involved in the pathogenesis of psoriasis , as well as th1 , th17 , and th22 cytokine production are illustrated in figure 1 . the aim of the study was to assess the serum levels of some cytokines involved in the th17 and th22 responses in psoriatic patients . the study comprised 60 psoriatic patients , 50 males ( 83.33% ) and 10 females ( 16.67% ) , as well as 30 healthy controls . the studied patients ' age was between 18 and 69 years , 45.6 13.2 years on average . the history of the disease was from 1 to 45 years , 18.7 11.5 years on average . thirty - four of the studied patients ( 40% ) reported two psoriasis exacerbations a year , whereas 9 persons ( 15% ) observed as many as 4 exacerbations a year . the skin lesions severity was assessed with the use of psoriasis area and severity index ( pasi ) , body surface area ( bsa ) , and physician global assessment ( pga ) scores . the pasi value in the studied group was from 4.8 to 64.2 and 15.7 9.7 on average . the bsa value was in the range of 9.096.9% and 31.4 18.2 on average . the pga score was 3 in 24 individuals ( 40% ) , 4 in another 24 individuals ( 40% ) , and 5 in 12 individuals ( 20% ) . blood samples were collected from psoriatic patients and controls and were centrifuged for 15 minutes at 1000 g . then , serum samples were subdivided into small aliquots to be stored at 80c until tested for cytokine levels . elisa kits were used to determine il-6 , il-12 , il-17 , il-20 , il-22 , and il-23 ( r&d systems , minneapolis , mn , usa ) serum levels , according to the manufacturer 's instructions . continuous variables were presented as mean standard deviation , while categorical variables were presented as absolute and relative frequencies . mann - whitney 's u test was used to compare continuous data between the studied and control groups . the statistical analyses of the conducted study results revealed significantly higher serum levels of il-6 , il-20 , and il-23 in psoriatic patients comparing to healthy controls ( table 1 and figure 2 ) . significant correlations between il-20 , il-22 , il-17 , and psoriasis severity were observed . no significant correlations were found between the concentrations of the studied cytokines and the sex , age , or psoriasis duration in the studied patients ( p > 0.05 ) . significantly higher il-6 values were found in the psoriatic patients in comparison to the control group ( p < 0.001 ) . il-6 contributes to the th17 cell line 's involvement in numerous processes of inflammation and autoimmunity by preventing the proliferation of t regulatory cells . il-17 can induce fibroblasts to produce il-6 potentially activating a positive feedback loop that strengthens th17 inflammation . analyzed 78 studies comparing the serum inflammatory markers , including il-6 , in psoriasis with healthy controls . the study showed that the standardized mean differences were higher in psoriatic patients compared to healthy controls for il-6 . elevated serum il-6 appears to be associated with greater psoriasis severity [ 18 , 21 , 24 ] . it was shown that il-6 might be the biomarker differentiating psoriasis arthritis from psoriasis without joint involvement [ 19 , 22 ] . significantly higher il-20 values were found in the psoriatic patients in comparison to the control group ( p < 0.001 ) . a significant positive correlation between the il-20 concentrations and psoriasis severity measured by the pasi was detected ( p < 0.001 ; r = 0.698 ) . il-20 is produced by keratinocytes in the presence of il-22 , tnf- , and il-17 but not ifn- or il-20 itself [ 15 , 25 ] . il-20 can play an important role in the later effector phase of psoriasis pathogenesis , in which it inhibits the terminal differentiation , increases antimicrobial competence , and production of chemokines for neutrophils in keratinocytes [ 25 , 29 ] . there are not many studies concerning il-20 serum level , but increased levels of il-20 were noted in lesional skin as well as in the blood in psoriatic patients . as in our study , il-20 serum levels correlated with pasi scores . a significantly higher increase in il-22 was observed in psoriatic patients in comparison with the healthy controls ( p < 0.001 ) . a significant positive correlation was found between the il-22 concentration and psoriasis severity measured by both the pasi and bsa score ; that is , p < 0.001 ; r = 0.557 and p < 0.001 ; r = 0.559 , respectively . il-22 is a member of the il-10 cytokines family and is mainly produced by th17 , th22 , and mucosal nk cells [ 3032 ] . il-22 upregulates keratinocyte proliferation and migration , inhibits keratinocyte differentiation by downregulating a variety of genes as filaggrin and involucrin genes [ 33 , 34 ] , and augments the expression of inflammatory molecules by keratinocytes , which leads to an increase in skin thickness in vitro and in vivo [ 3537 ] . il-22 increased the expression of the hbd-2 and hbd-3 in human keratinocytes and mmp1 and mmp3 in the skin [ 3840 ] . in psoriasis , il-22 is overexpressed most probably as a result of upregulated il-23 and il-6 levels [ 12 , 41 , 42 ] . the treatment with tnf inhibitor ( etanercept ) reduced serum levels of il-17 and il-22 . no significant differences were found in the il-12 and il-23 concentrations between the psoriatic patients and control group ( p > 0.05 ) . il-23 together with il-12 belongs to the il-12 family and are both structurally related ; il-12 is formed by the p40 and p35 subunits ; il-23 consists of p40 and p19 subunits [ 44 , 45 ] . although both il-12 and il-23 are present in psoriasis , studies support that il-23 , rather than il-12 , is crucial during the pathogenesis of psoriasis . il-23 is overexpressed in psoriasis lesional skin , as shown for example , by increased p40 and p19 mrna levels but not always p35 [ 4654 ] . il-23 is overproduced by dermal dendritic cells [ 48 , 53 ] and keratinocytes in lesional psoriatic skin . most recent reports show no increased expression of the il-12 in psoriasis [ 3 , 49 , 52 , 53 ] . statistically significant differences in serum il-12 level have been found in psoriatic patients comparing to healthy controls [ 20 , 56 ] . however , there are no significant studies comparing the serum levels of il-23 in psoriatic patients and controls . no significant differences were found in the serum il-17 concentrations between the psoriatic patients and control group ( p > 0.05 ) . a significant positive correlation between the il-17 concentrations and psoriasis severity measured by the pasi was detected ( p < 0.05 ; r = 0.277 ) . il-17 ( il-17a ) is a member of a newly identified cytokine family comprising il-17a , il-17b , il-17c , il-17d , il-17e ( il-25 ) , and il-17f . il-17 and il-17f have a proinflammatory activity inducing the expression of proinflammatory cytokines , colony - stimulating factors , and chemokines from dendritic cells , neutrophils , t cells , monocyte / macrophages , and epithelial cells [ 11 , 44 ] . il-17a and il-17f can mobilize , recruit , and activate neutrophils [ 44 , 57 ] . il-17 is undetectable in normal skin , and biological therapy that inhibits th17 pathways results in reduced expression of il-17 and il-23 and improved disease outcomes [ 11 , 24 , 39 ] . th17 cells and the cytokines produced by these cells are found in increased levels within skin affected by psoriasis [ 31 , 4749 , 5860 ] . statistically significant differences in serum il-17a level have been found in psoriatic patients comparing to healthy controls . il-17 serum levels correlated with the psoriasis area and severity index ( pasi ) . in addition , an analysis of mutual correlations between the concentrations of selected cytokines in the psoriatic patients was conducted . a significant positive correlation between the il-23 and il-17 values was found ( p < 0.05 ; r = 0.271 ) . an increase in the il-23 concentration was accompanied by an increase in the il-17 concentration . in previous studies , it was found that interaction of il-23 with its receptor on th17 cells stimulates the production of il-17 and other related proinflammatory cytokines activates nk cells and regulates antibody production [ 1 , 3 , 44 ] . we believe that the results of our study confirm involvement of th17 and th22 cytokines in psoriasis pathogenesis . elevated il-22 level without increase of il-17 level may suggest that th22 role is more significant in the inflammatory process of psoriasis . very high concentrations of il-22 in the patients ' serum can be connected with intensive il-6 stimulation . il-22 and il-20 itself induce production of il-20 , which is elevated in our study . it seems that il-6 , which initiates th17 and th22 pathways in psoriasis , may be helpful in the clinical practice as a soluble biomarker of the disease activity and its prognosis . the development of new therapeutical strategies targeting the initial step of cytokine network activation , for example , il-6 , may reduce the next events of inflammatory reactions and prevent the psoriasis exacerbation and systemic complications . furthermore , serum levels of il-20 , il-22 , and il-17 , which correlated with the clinical severity and activity of psoriasis , may be objective parameters of successful treatment and may be used in the followup .

introduction . psoriasis is a t cell - mediated inflammatory disease in which pathogenesis t helper ( th ) lymphocytes ( th1 , th17 , and th22 ) play an important role . the aim of the study was to assess the serum levels of some cytokines involved in the th17 and th22 responses in psoriatic patients . material and methods . the study comprised 60 psoriatic patients and 30 healthy controls . in the serum collected from psoriatic patients and healthy controls , the concentrations of il-6 , il-12 , il-17 , il-20 , il-22 , and il-23 were examined with elisa kits . severity of psoriatic skin lesions was assessed by means of pasi , bsa , and pga scores . results . il-6 , il-20 , and il-22 concentrations were significantly higher in psoriatic patients in comparison with the control group . the positive correlations between the concentrations of il-22 and il-20 and severity of psoriasis assessed with pasi and bsa scores as well as il-17 and pasi score were found . there was also a positive correlation between il-23 and il-17 concentrations . conclusions . results of the conducted studies suggest that th22 response may contribute to the skin and systemic inflammatory disease in psoriasis . it seems that early identification of soluble biomarkers and initiation of well - matched treatment may prevent exacerbation and progression of psoriasis .

herries ( [ 1 , page 11 ] ) reanalyses the published data from the most recent excavations at twin rivers and argues that there is considerable uncertainty about the age of the deposits and as a consequence about the significance of the site . he concludes that the sequence may be significantly younger than claimed and makes the general observation that excavators need to be extremely careful when relating fragments of flowstone to wider archaeological deposits in caves due to their complex depositional history . often dates are presented without any information regarding their reliability or context ( [ 1 , page 11 ] ) . as the archaeologist responsible for the most recent research at twin rivers , herries , however , in the case of twin rivers has misunderstood the stratigraphic sequence of the site and unwittingly conflated dates from unrelated deposits . he has also overlooked our critical assessment of the reliability of the association of the dated material with the archaeological deposits . his resulting reinterpretation throws considerable doubt on the integrity of the published association of dates with the deposits excavated in 1999 . according to herries his concerns .many researchers are sceptical over the association of the flowstone to the msa bearing deposits . if this is indeed the case [ no sources are cited ] then this uncertainty needs to be discussed in detail so that the reader can assess the validity of the critique . a brief history of the excavations provides the context for understanding the limitations of the site and the rationale for the most recent research in the 1990s . the location of the dated samples in relation to the excavated deposits is made clear which in turn reveals the source of herries ' confusion . twin rivers hill is located near the capital city of lusaka and was extensively excavated in 1954 and 1956 by clark . the excavated deposits were bone and artefact bearing breccias found in karst features ( fissures and former cave passages ) on the top of the hill and down its western flank . the largest area excavated was labelled f block ( on the hill top ) and below it the breccias were sampled in a series of excavation blocks labelled a the breccias were removed by controlled blasting using dynamite , and the blocks were reduced manually to extract artefacts . the artefacts were attributed to the lupemban industry of the middle stone age based on similarities with lupemban material excavated at kalambo falls to the northeast . radiocarbon dating was the only relevant radiometric technique available in the 1950s , and unsurprisingly the lateral extent of flowstone deposits was not recorded as that information was not considered significant at the time . ( the development of uranium - series dating of carbonates in the 1970s postdated the excavations at twin rivers . ) it was clear from clark 's published sections that flowstone was interlayered with the f block breccia . the lack of information on the lateral extent of flowstone remains problematical for reconstructing the association of the dated flowstone with the breccia deposits . the roofs of the cave passages ( f and a block ) had collapsed in the past and so it was not possible to identify points of entry for water that formed the flowstone deposits . the hill surface had also undergone extensive lowering by dissolution that meant the original height and size of these two separate caves could not be reconstructed ( see , pages 169172 for site formation details ) . these far from ideal conditions were the starting point for the research undertaken in the 1990s . the site was reexamined in 1995 to collect flowstone from f block for uranium - series dating ( th / u ) . a band of flowstone illustrated in clark 's section drawing was sampled from near the top of the 1956 excavation , but only isolated patches of breccia remained on the passage surfaces as recorded in our figure 10.15 ( [ 4 , page 182 ] ) . the middle pleistocene age that resulted ( 230 35/28 ka , barham and smart 1996 ) and subsequently redated using higher precision thermal ionisation mass spectrometry [ tims ] to 195 19 ka , indicated that the underlying lupemban was probably of comparable age if not older . although no breccia was sampled , we found a small tufa and sediment filled dip tube off the passage , and that material was excavated in 1999 . these deposits could not be associated directly with dated flowstone from the passage . in 1999 , a flowstone was found that extended from near the base of the passage to the top and it was sampled at its thickest point ( overlying a limestone shelf ) for dating . the resulting two ages from different layers within the sample were younger ( ~178 ka and ~139 ka , see below ) than the flowstone from near the top of clark 's section . as we reported , the irregular morphology of the f block passage had made the stratification of speleothem more complex than in a block ( [ 4 , page 181 ] ) . down slope in a block sufficient breccia deposits survived along the western wall of this passage to justify making this area the focus of excavation in 1999 . a series of flowstone deposits also survived adhering to the walls and floor of the a block passage , and one sample was interlayered with the artefact bearing breccia . the underlying breccia contained a fragment of flowstone dated to beyond the age limit of the technique ( > 400 ka ) , and a flowstone on the floor of the cave passage was also beyond the age range ( > 400 ka ) . above the breccia were two separate flowstones that formed in either a passage or fissure now destroyed by the erosion of the hill slope ( [ 4 , page 178 ] ) . these flowstones form part of the concordant sequence of dates from this western wall ( below ) , and more significantly they provided a minimum age for the underlying archaeological deposit of 172 ka/225 ka . the a block dates are discussed in more detail below as they are critical to unravelling the source of herries ' confusion , but there is one more area of the site to be described in this history as it too features in his reinterpretation of the site 's chronology . g block forms a part of the hilltop platform and is separate from f and a block and is not a cave or fissure but a lag deposit resulting from the dissolution of the limestone . though not part of the original project plan for 1999 , the sampling of g block was initiated to give a better understanding of the archaeological record on the surface of the hill top and to assess its formation . clark found later stone age and iron age material in these surface deposits , and our excavation confirmed his observations but also added middle stone age tools to the record . the densest concentrations were found in a shallow linear root - filled solution feature ( grike ) from which burnt quartz and sediments were collected for thermoluminescence ( tl ) dating ( [ 4 , pages 181183 ] ) . as the excavation of g block had not been planned in advance , there was no opportunity to incorporate in situ dosimetry as part of the sampling procedure . the resulting tl dates were all late pleistocene in age ( ranging from ~101 ka to ~13 ka ) , but they showed no consistency with depth with the youngest dates associated with the base of the grike ( [ 4 , page 183 ] ) . given the extent of mixing , no quantitative analysis of the archaeological deposit was undertaken . our report included illustrations of middle and later stone age retouched tools to demonstrate their presence , and the suggestion was made that middle stone age might be associated with the ~101 ka date . herries unfortunately incorporated the g block tl dates in his analysis of the f and a block speleothem dates without making reference to our published assessment of the deposits as being mixed . he inserted the misleading comment that the g block dates , being younger than the speleothem ages , lend further suspicion to an extremely complicated stratigraphy and infill ( the full quote is presented below ) . the g block sediments are of course part of twin river 's archaeological record , but they are unrelated to the formation or age - range of the cave passages and should be treated with great caution generally . the primary area of excavation in 1999 was the surviving breccia and decalcified sediments adhering to the western wall of the a block passage . the main aim of the excavation was to recover artefacts from contexts that could be dated by association with speleothem ( using u - series tims ) . six flowstone samples were collected from a block of which five came from the western wall of the passage and the sixth ( tra5a ) was from the eastern side of the passage and unrelated to the surviving deposits as was stated clearly and illustrated in our report ( [ 4 , pages 178 , 181 and figure 10.5 ] ) . with the exception of one sample ( tra14a ) all the flowstone samples were collected from lenses overlying and within the breccia ( [ 4 , page 172 ] ) . tra14a was unusual in that it was a fragment of flowstone that had become incorporated into the breccia . we included a photograph ( figure 10.14 ) showing the stratigraphic context of this one dislocated piece of flowstone as part of our critical discussion of the dating of a block ( [ 4 , page 178 ] ) . photographs of the intact flowstones were not included as they were the norm in both a and f block , but herries ' point is well taken that photographs should have been included for each speleothem . he also suggests that micromorphological analysis of the contact between the speleothem and archaeological deposit would help assess the depositional history of each sample . this is considered good practice now , but as far as i am aware it was not the norm in 1999 . our section drawings ( 10.13 for a block , 10.15 for f block ) show the vertical location of the dated samples associated with the surviving breccias and the plan of a block ( figure 10.5 ) shows the horizontal location . in a block , only two samples were accepted by us as being in contact with the archaeological deposits , traa1 and the fragment enclosed in breccia , tra14a . traa1 is a flowstone lens at the base of breccia wedged between two limestone blocks . the breccia grades into a decalcified deposit ( red sandy earth , figure 10.13 ) that is preserved between the passage wall and the adhering breccia that forms a continuous deposit along the western wall . the detritally corrected age of the flowstone ( 266 ka ) was interpreted as representative of the breccia deposits at approximately this depth in the absence of other dating controls . ( the one tl date on calcite from the decalcified deposit lacks in situ dosimetry , and as herries ' correctly observes it can not be considered to be reliable . ) the remaining flowstone samples provided maximum and minimum ages for the existence of the cave and for the archaeological deposits excavated in 1999 ( [ 4 , page 172 ] ) . samples tra4a and tra3a both formed in the passage or fissure above the breccia ( figure 10.5 ) and each was sub - sampled for dating as two distinct layers could be seen ( , page 175 ) . below the 266 ka age , the flowstone fragment incorporated into the breccia ( tra14a ) exceeds the age range of the u - series technique used and a sample of flowstone adhering to the bedrock below ( tra2a ) also has an open date of > 400 ka . we speculated that this basal flowstone might have been the source of the redeposited fragment but concluded that these two samples only provide a potential maximum age for the archaeological deposits ( [ 4 , page 178 ] ) . we do not know how long after the formation of the basal flowstone that sediments began to fill the passage as slurry flows . the deposits may all be 266 ka and younger or perhaps slightly older given the depth of deposit below traa1 [ 7 , 8 ] . block follow and include the uncorrected age , sample identifier , depth below datum , and the corrected age ( for further analytical detail see barham et al . 2000 [ 4 , table 10.1 ] ) . the thick flowstone sample from f block ( figure 10.15 , east wall ) was subsampled and the results are presented for each layer as is the case for tra4a and tra3a in a block . the corrected ages are included as these have been used in other publications [ 9 , 10 ] . a block , western wall : 173 3 ka ( tra4a , 243 cm , layer 1 , corrected age = 173 ka),166 3 ka ( tra4a , 243 cm , layer 2 , corrected age = 160 ka ) , 225 4 ka ( tra3a , 320 cm , layer 1 , corrected age = 225 ka),178 2 ka ( tra3a , 320 cm , layer 2 , corrected age = 172 ka ) , 275 6 ka ( traa1 , 340 cm , corrected age = 266 ka ) , > 400 ka ( tra14a , 383 cm ) , > 400 ka ( tra2a , 390 cm ) . 173 3 ka ( tra4a , 243 cm , layer 1 , corrected age = 173 ka),166 3 ka ( tra4a , 243 cm , layer 2 , corrected age = 160 ka ) , 225 4 ka ( tra3a , 320 cm , layer 1 , corrected age = 225 ka),178 2 ka ( tra3a , 320 cm , layer 2 , corrected age = 172 ka ) , 275 6 ka ( traa1 , 340 cm , corrected age = 266 ka ) , > 400 ka ( tra14a , 383 cm ) , > 400 ka ( tra2a , 390 cm ) . 173 3 ka ( tra4a , 243 cm , layer 1 , corrected age = 173 ka ) , 166 3 ka ( tra4a , 243 cm , layer 2 , corrected age = 160 ka ) , 225 4 ka ( tra3a , 320 cm , layer 1 , corrected age = 225 ka ) , 178 2 ka ( tra3a , 320 cm , layer 2 , corrected age = 172 ka ) , 275 6 ka ( traa1 , 340 cm , corrected age = 266 ka ) , > 400 ka ( tra14a , 383 cm ) , > 400 ka ( tra2a , 390 cm ) . a block , eastern wall : 199 2 ka ( tra5a , 220 cm , corrected age = 192 ka ) . 199 2 ka ( tra5a , 220 cm , corrected age = 192 ka ) . 199 2 ka ( tra5a , 220 cm , corrected age = 192 ka ) . f block , eastern wall : 181 6 ka ( trf layer 1 , 163 cm , corrected age = 178 ka),141 2 ka ( trf layer 2 , 163 cm , corrected age = 139 ka ) . 181 6 ka ( trf layer 1 , 163 cm , corrected age = 178 ka),141 2 ka ( trf layer 2 , 163 cm , corrected age = 139 ka ) . 181 6 ka ( trf layer 1 , 163 cm , corrected age = 178 ka ) , 141 2 ka ( trf layer 2 , 163 cm , corrected age = 139 ka ) . the above history of the excavation has been presented in some detail to address herries ' claim that in many instances , flowstone is sampled from the wall or edges of a cave cavity without definitive evidence for its association to the archaeology . i repeat , only two sample of flowstone were considered by us as being in contact with the archaeological deposits , traa1 and tra14a , and both were from a block . the near absence of continuous layers of flowstone that could be linked directly to the deposits is an artefact of the history of excavation . the following extended quote from herries ( [ 1 , page 11 ] ) contains the primary source of confusion in his account , and the points of misunderstanding are labelled with capital letters for referencing in the discussion that follows . ( a ) the fact that younger speleothem dated to between 184172 ka ( 178 6 ka ) and 141137 ka ( 139 2 ka ) occurs under a speleothem dated to between 200190 ka ( 195 5 ka ; 131 ) in block a. [ sic ] all tl dates from g block are younger than 117 ka ( 101 16 ka ) and lend further suspicion to an extremely complicated stratigraphy and infill . ( b ) the speleothem dates to between 266 6 ka ( 272260 ka ) and 172 2 ka ( 174170 ka ) may also have been eroded out from earlier deposits when the msa in - filled the cavity . ( c ) again younger speleothem samples occur with depth with the 172 ka sample being deeper ( 3.2 m ) than the 192 2 ka sample at the top of a block at 2.2 m. ( d ) all the msa in the top 1 m of a block is , therefore , younger than 174 ka , as the speleothem must have formed before it was eroded and incorporated into the breccia and so provides a maximum age . there is no speleothem dated to 141137 ka ( 139 2 ka ) in a block . the cited age range most closely matches sample trf ( layer 2 , 141 2 ka uncorrected , 139 ka corrected ) from f block ( see above ) . the sample that dated to 195 5 ka ( tra5a ) occurs on the eastern wall of the a block passage , and unless herries assumes that it was once continuous across the passage , it can not be related to the west wall speleothem this spatial separation was made clear in the published report and seems to have been overlooked . the speleothem is flowstone deposits that are in situ as described in the report ( above ) and not redeposited fragments . only sample tra14a ( > 400 ka , 383 cm ) is a redeposited fragment of speleothem as was stated clearly in the report ( [ 4 , page 178 ] ) . herries expands this line of reasoning later to suggest the if the majority of speleothem represents material eroded into the deposit then the lupemban from block a would be younger than 141 ka , significantly younger than the 266170 ka cited by barham et al . the 141 ka date is erroneous in relation to a block as is the suggestion that the majority of the speleothem samples are redeposited . again , the sample dated to 195 5 ka ( tra5a ) can not be related to any other speleothem on the western wall of a block . there is no extant middle stone age material in the upper 1 m of a block , only from below sample tra3a ( 320 cm ) ( see [ 4 , page 178 and figure 10.13 ] ) . herries continues this line of reasoning later in stating that the sample with a date of 160 3 ka also occurs at 2.4 m depth and is the youngest age from block a. this suggests that all the msa in block a may in fact be younger than 163 ka . this sample ( tra4a , layer ) overlies tra43 and as described clearly in our report is related ( along with tra3a ) to a separate passage or fissure above the archaeological deposits and unrelated to the material excavated in 1999 . science - based dating underpins our understanding of the process of human evolution and its variability in place and time . the past 20 years or so have seen a revolution in the development of radiometric methods of dating that have opened the middle pleistocene to closer and more informed scrutiny by palaeoanthropologists . we can now see more clearly the tempo of changes in human anatomy and behaviour that were previously obscured by poor chronological controls . it is in this context of an improving database that herries ' provides a much needed review of the archaeological and dating evidence of the transition from the acheulean to the middle stone age in southern africa . thoughtful reviews play an important role in the development of a discipline by distilling what is known about a subject and highlighting issues for further investigation . reviews are also often the first port of call for non - specialists and advanced students in need of a clear statement of the state of the art of a subject . herries cavalier treatment of the twin rivers published data , however , undermines my confidence in what appears otherwise to be a comprehensive treatment of the acheulean - middle stone age transition . twin rivers remains an important middle pleistocene site despite its history of excavation and complex stratigraphic sequence . i stand by the published interpretation of the age range of the limited a block deposits and am actively searching for a new this is the way forward in a region for which we still know so little about the behaviour of hominins before the evolution of homo sapiens .

herries provides a timely review of the archaeological and dating evidence of the transition from the acheulean to the middle stone age ( msa ) in southern africa , however , in relation to the site of twin rivers , zambia he makes several fundamental errors of interpretation that demand correction . the stratigraphic sequence of the site is admittedly complex , but it deserves a more careful analysis than that offered by herries . this detailed response by the most recent excavator of the site addresses herries critique by placing the site in its historical context and then dealing with the central issue of the association of dated speleothem with the surviving archaeological deposits . herries is shown to have mistakenly combined the dates from two separate cave passages and to have misunderstood the published sections , plans , and taphonomic assessment of each excavation area . his reinterpretation of the site as being significantly younger than published is based on a conflation of unrelated data .

in our model , each particle consists of a core sphere with four tetrahedrally oriented arms ( see fig . the central sphere and the arms are modeled as interpenetrating hard spheres with diameter , with the centre of each arm located a distance l from the centre of the core . on the surface of each arm the patch is modeled , via a standard kern - frenkel potential , as a square - well type attraction of depth : two particles are either bound or unbound , with no intermediate energy levels . the opening angle of the patch is given by cos = 0.95 , and the maximum interaction range = 0.251. this choice ensures that each patch can form a bond with only a single other patch . furthermore , in order to model arm flexibility , each arm can freely rotate around the core sphere within a maximum angle from its ideal ( tetrahedral ) position . note that there are no hard - core interactions within a particle : spheres belonging to the same tetramer can overlap . each mc simulation included translation moves , rotation moves rotating a full tetramer , rotation moves rotating only the core sphere , and rotation moves that rotate a single arm around the core . additionally , we added volume moves for isobaric simulations , and particle insertion and deletion moves for grand - canonical successive umbrella sampling ( sus ) simulations . to detect ll phase separation , we used sus simulations , generating the relative free energy as a function of the density . to calculate the phase diagrams in fig . 4 , and the crystallization lines in figs . 2 and 3 for the liquid phases , we used a high temperature fluid as a reference state , where we obtained the helmholtz free energy f by combining the chemical potential ( evaluated from a sus simulation ) and the pressure p at the same density ( taken from an npt mc simulation ) , using : ( 1)ffn=p , where n is the number of particles . we then used thermodynamic integration by integrating the temperature along an isochore : ( 2)2f(,t2)=1f(,t1)+12du(,t ) , with u( , t ) the average potential energy per particle , = 1/kbt and kb boltzmann s constant . typically , at sufficiently low temperatures , the energy as a function of temperature takes the form ( 3)u=2+cexp(2 ) , where 2 is the ground - state energy ( where each particle has four bonds ) and c is a ( density - dependent ) constant . this allows for straightforward extrapolation of the free energies to arbitrarily low temperatures after the regime in eq . this regime is accessible in our simulations for all cases where the fluid does not crystallize at low t ( i.e. cos 0.9 ) . system sizes for the sus simulations were chosen such that near the ll transition the system contained n 150 particles . other free - energy calculations were performed with similar or larger n. the investigated crystal structures were diamond and bcc ( corresponding to ice ic and ice vii in water , respectively ) . both are fully bonded structures and as such have the ( same ) lowest possible potential energy . depending on cos and l , there will be a variety of other fully bonded crystal structures . however , the structures commensurate with an ideal tetrahedral geometry will always have the highest entropy and hence will be more stable at the densities where they are accessible . thus , the only crystals which might compete with the ll phase separation are diamond and bcc . at high density , i.e. beyond the bcc density , the stable crystalline phases will be controlled by a competition between packing , energy , and entropy , but as these phases will not change the stability of the ll phase transition , they are outside of the scope of this letter . similarly , we do not expect these crystal phases to affect the phase diagrams in fig . 4 , with the possible exception of the ( dashed ) high - density liquid - bcc lines in panels ( c ) and ( d ) . to determine free energies for the crystal phases , we used an einstein crystal approach , for each t where a phase coexistence was calculated . subsequently , using npt mc simulations , we employed thermodynamic integration along the density at constant temperature : ( 4)f(,t)=f(ref , t)+refd()p2 , where ref is the density where the reference free energy was calculated . s4 in the si for examples ) . to determine whether spontaneous crystallization occured in our sus simulations , we used a bond - order parameter to find the largest crystalline cluster in the system . first , we determine the neighbors of each particle using a solid - angle based nearest - neighbor method . we then calculate for each particle the complex vector ql , the expansion of their environment in terms of spherical harmonics ylm , with l the order of the symmetry of the crystal , and l m l : ( 5)qlm(i)=1nb(i)j=1nbylm(r^ij ) . here , nb is the number of neighbors of particle i , and r^ij is the normalized vector connecting particle i to particle j. for the purpose of finding crystalline clusters , two particles are considered bonded when their environments are sufficiently similar . to determine this , we calculate : ( 6)dl(i , j)=re(ql(i)ql(j)ql(i)ql(j) ) . to detect bcc clusters , we choose l = 6 , consider two particles bonded if dl(i , j ) > 0.6 , and label any particle that has at least 5 bonds as a crystalline particle . for diamond , two particles are considered bonded if either dl(i , j ) < 0.87 or 0.3 < dl(i , j ) < 0.1 , and only particles with 4 bonds are considered crystalline . systems were considered to have crystallized spontaneously when more than 10% of the system was crystalline . note that although the q6 based order parameter is sensitive to multiple crystal structures , visual inspection of the detected clusters consistently showed a bcc structure in all cases .

one of the most controversial hypotheses for explaining the origin of the thermodynamic anomalies characterizing liquid water postulates the presence of a metastable second - order liquid - liquid critical point [ 1 ] located in the no - man s land [ 2 ] . in this scenario , two liquids with distinct local structure emerge near the critical temperature . unfortunately , since spontaneous crystallization is rapid in this region , experimental support for this hypothesis relies on significant extrapolations , either from the metastable liquid or from amorphous solid water [ 3 , 4 ] . although the liquid - liquid transition is expected to feature in many tetrahedrally coordinated liquids , including silicon [ 5 ] , carbon [ 6 ] and silica , even numerical studies of atomic and molecular models have been unable to conclusively prove the existence of this transition . here we provide such evidence for a model in which it is possible to continuously tune the softness of the interparticle interaction and the flexibility of the bonds , the key ingredients controlling the existence of the critical point . we show that conditions exist where the full coexistence is thermodynamically stable with respect to crystallization . our work offers a basis for designing colloidal analogues of water exhibiting liquid - liquid transitions in equilibrium , opening the way for experimental confirmation of the original hypothesis .

pulmonary artery aneurysms and pseudoaneurysms are uncommon ; most are caused by infections , like tuberculosis , vasculitis ( behet 's syndrome ) or trauma , often iatrogenic ; less common causes include pulmonary hypertension , congenital heart disease , lung carcinoma , and connective tissue disease ( 1 - 3 ) . because of potential risk of high mortality , secondary to pseudoaneurysm enlargement and rupture , prompt we , hereby , describe a case of ascending branch of the left pulmonary artery pseudoaneurysm , following a left upper lobectomy , for which a transcatheter endovascular embolisation of the aneurysm with intra - aneurysmal n - butyl 2-cyanoacrylate ( glue ) injection was performed . a 30-year - lady had been presented to us 3 months ago with multiple episodes of hemoptysis and one major episode of 400 cc , and gave us a history of intermittent fever , cough , breathlessness and chest pain for a period of 2 - 3 months . she was a known case of pulmonary tuberculosis with left upper lobe fungal ball ( pulmonary aspergillosis ) for the past 7 years . she had had complete a course of anti - tuberculosis therapy and was asymptomatic until this period when she was presented to us with hemoptysis . at this time the patient visited an emergency department again a month ago for exacerbation of the above symptoms . because of the recurrent symptoms and deteriorating pulmonary function test results , the left upper lobectomy for pulmonary aspergilloma was performed . the inferior pulmonary ligament was excised in order to enable the lower lobe to occupy the entire left thoracic cavity . the early postoperative period was uneventful . in the third post - operative week , she started having streaky hemoptysis . fibre optic bronchoscopy detected a normal tracheobronchial tree , however , the left upper lobe surgical closure site was congested and inflamed . though the white blood cell count was normal , the patient was treated for a presumed chest infection . the patient had spotty hemoptysis for the next two weeks , until she developed 2 - 3 episodes of massive hemoptysis of about 400 - 500 cc of blood . patient was intubated and emergency computed tomography ( ct ) pulmonary angiography was done , which revealed a large pseudoaneurysm of the ascending branch of the left pulmonary artery ( fig . because of the patient 's severe pulmonary insufficiency , she was not a surgical candidate and was referred to us for endovascular embolisation . under local anesthesia , with anesthetists standing by for emergency resuscitation if need arise , pulmonary angiography with 5 fr , 110-cm pigtail catheter ( cordis , johnson & johnson , new jersey ) was introduced via the right femoral venous approach , which showed approximately 3.5 cm aneurysm arising from the ascending branch of the left pulmonary artery , shortly after its origin ( fig . then , a 5 fr , 100-cm head hunter catheter ( cordis , johnson & johnson , new jersey ) was introduced into the feeding artery of the aneurysm , just short of the aneurysm sac . initially , we tried to occlude the feeding vessel with 35 - 5 - 5 and 35 - 8 - 8 coils ( cook , bloomington , in , usa ) , but both of these coils got misplaced proximally in the lateral basal and lower lobe trunk arteries , respectively . because of larger diameter of the coils than the caliber of these arteries , the misplaced coils got stuck in a proximal part of the arteries . on an angiogram , we could see the uninterrupted rapid blood flow through the coils to the lower branches . further , with digital road mapping , 5 fr head hunter catheter in the feeding artery , and acting as a guiding catheter , the aneurysm sac was catheterized with a 2.7 fr microcatheter ( terumo progreat ; terumo deutschland gmbh , germary ) . now we decided to occlude the aneurismal sac by completely filling the sac with n - butyl 2-cyanoacrylate ( glue ) injection . we calculated the volume of the glue mixture required in order to fill the aneurysm cavity by slowly calculating the volume of contrast injected , without causing the reflux of the contrast into the normal pulmonary circulation proximally . the volume required was approximately 4 cc . to prevent a reflux , 5 cc of higher concentration i.e. 75% glue mixture of histoacryl ( braun , melsungen , germany ) and iodized oil ( lipiodol , andre guerbert , aulnay sous bois , france ) was taken in a 5-ml luer - lock syringe , however we could only inject approximately 1.5 cc of the glue , as the microcatheter got blocked . catheter sticking or breakage did not occur during the process of catheter retrieval and was immediately flushed vigorously with 5% dextrose to reopen the lumen . check angiogram showed the glue cast in the central part of the aneurysm sac with aneurysm still filling in the periphery ( fig . we now attempted to occlude the feeding artery with coil , but this time , the coil got dislodged in the aneurysmal sac . now , the angiographic picture was much clearer , and on correlating with ct saggital reconstructed images , we got to know that the length of the feeding artery to the pulmonary artery aneurysm ( pap ) sac was very short . so now , not to compromise the pulmonary circulation , we did not have any other option except to fill the sac either with coils or liquid materials . in order to be economical on the cost , as well as our past experience with the glue , we decided to occlude pap with intra - aneurysmal injection of the glue . we introduced the previously used microcatheter into the sac , and this time , we used 50% glue mixture and were able to fill the sac completely with calculated volume of 3 cc of liquid mixture without spillage into the proximal normal circulation . post embolisation check angiogram showed a complete obliteration of the aneurysm sac with anterior ascending branch , and other branches of the left pulmonary artery being patent ( fig . there was no alteration in the blood flow through the coils into the lower lobe branches , and therefore , we did not try to retrieve the coils . ct performed on the 6th day showed glue cast with no filling of the aneurysm . however , after being asymptomatic for 2 months , she presented again to our hospital with a single episode of 300 cc of hemoptysis . emergency ct was performed , which did not show the new aneurysm or refilling of the previously embolised aneurysm ( fig . 1 g ) ; however , at this time , we could see a new aspergilloma in lateral basal segment of the lower lobe , and rib osteomyelitis ( fig . at present , she is still admitted and is on a conservative management and being further investigated for these new ct findings . pulmonary artery aneurysms and pseudoaneurysms ( paps ) are rare ; most are caused by infections , like tuberculosis , vasculitis ( behet 's syndrome ) or trauma , often iatrogenic , especially after swan ganz catheter insertion ; and less common causes include pulmonary hypertension , congenital heart disease , lung carcinoma , and connective tissue disease ( 1 - 3 ) . thus , any destructive process of the lung , whatever its pathogenesis , can erode the vessels in its vicinity , be it a pulmonary or systemic vessel . the etiology in this case can be attributed to inadvertent insult to the pulmonary artery during surgery for pulmonary aspergilloma . also , after lobectomy , significant increase in the pulmonary vascular resistance index has been described in the literature ( 4 ) , and this could have had a possible contributory role for the development of the pseudoaneurysm . another cause could be a low grade infection of the already weakened upper lobe pulmonary arterial wall , though the blood investigations were normal in our patient . the most common cause for intrapulmonary bleedings is the hemoptysis , due to bronchial artery erosion seen in as many as 95% of all cases . in contrast , bleeding from the pulmonary arteries is very rare , usually massive , accounting for less than 5% of all cases ( 5 ) , and is usually due to pseudoaneurysm rupture . because of the risk of pap enlargement and rupture , which leads to death in approximately 50% of patients , prompt therapy is required . the available treatment modalities for pap are medical therapy , surgery and percutaneous catheter embolisation of the pseudoaneurysm . medical treatment by the means of immunosuppressive drugs and steroids has been found to cure or decrease the size of aneurysms in behcets disease ( 6 , 7 ) . several surgical techniques , such as lobectomy , pneumonectomy , hilar clamping with direct arterial repair and ligation , have been used . however , in our case , due to the patient 's severe pulmonary insufficiency , she was not a surgical candidate . there are number of reports in the literature addressing the treatment of paps - most of them using metallic coils ( 8) or silicon balloon ( 9 ) to occlude the arterial feeders . these placements can also occlude the perfusion to aerated lung , distal to the embolisation site , and are associated with complications , like coil migration and damage to vessel wall . other authors have occluded the pap by intraneurysmal placement of coils ( 10 ) ; however it carries a potential risk of mass effect and aneurysm rupture . still , other authors have described the use of covered stents ( 11 ) , and recently , hovis and zeni ( 12 ) have used thrombin percutaneously for the paa refractory to coil the embolisation . in our case , initially , we attempted unsuccessfully to occlude the feeding artery with the coils . however , the coils migrated proximally to enter into the lower lobe circulation without compromising the blood circulation to these segments . we later realized that this was due to a short length and wide neck of the feeding artery , that we were not able to keep the catheter stable in this branch . we did not want to occlude the aneurysmal sac with coils , firstly because of the large size of the lesion , use of multiple coils could result in a mass effect after embolisation , and secondly it would have been very expensive ; also it might be further complicated by coil migration , resulting from the wide neck of the aneurysm . in our case , because of regular and comfortable experience at tackling abdominal visceral aneurysms with glue embolization , we decided to use this liquid material as embolic material . ( 7 ) embolised the feeding branch to paa , using the glue with a " bubble technique " ; however , this was not possible in our case because of the short length in the feeding artery . therefore , we considered the alternative option of intraaneurysmal injection of liquid embolic ( glue ) . glue ( n - butyl 2-cyanoacrylate ) is a rapidly hardening liquid adhesive , and has been used as an effective embolic agent for brain vascular malformations ; however , necessity of operator experience with the use of liquid embolic material is a major limitation in its application to aneurysms . there are some studies showing the feasibility of intraaneurysmal injection of the glue in intracranial aneurysms ( 13 ) , thereby keeping the antegrade flow in the aneurysm bearing artery patent . we report the first case , in which the n - butyl 2-cyanoacrylate was successfully injected , intraaneurysmally , through the transcatheter route for the occlusion of a pulmonary artery pseudoaneurysm , after an upper lobe lobectomy for aspergillosis . glue offers the advantage of permanent occlusion of the vessel , and because of its low viscosity , it can be injected through a microcatheter into small and tortuous arteries . it is admixed with ethiodized oil in various ratios to achieve radiopacity and to adjust the polymerization time allowing for more controlled embolisation . the use of higher concentrations of glue results in quicker solidification ; however , on the contrary , the longer the polymerization time , the greater the risk of non - target embolisation because there is the possibility of embolic material being washed away before it solidifies . in our case we initially used 75% glue to prevent the reflux into the parent artery ; however there was early polymerisation of the glue with the sac preventing an evenly distribution . therefore , we had to dilute the glue to make it 50% concentration , and this time , there was complete filling of the aneurysm . in conclusion intraaneurysmal injection of the liquid embolic materials is feasible , safe , and effective trancatheter treatment option for pulmonary artery aneurysms and is possibly not associated with the risk of rupture seen with packing of aneurysms with coils . however , appropriate concentration of the glue , long term results , and etc . will require further experience to confirm its safety and efficacy in pulmonary circulation .

we report a case of pseudoaneurysm of the anterior ascending branch of the left pulmonary artery , following a left upper lobectomy for pulmonary aspergillosis , for which we have done an endovascular treatment . this is the first case where complete pseudoaneurysm occlusion was accomplished after a transcatheter intra - aneurysmal n - butyl 2-cyanoacrylate ( glue ) injection .

propofol is a short - acting intravenous hypnotic agent , which is widely used for sedation and general anesthesia . however , pain during injection of propofol can occur in up to 80% of patients , which can be very stressful to patients . many methods including cooling or diluting the propofol solution or the concomitant use of drugs such as methylene blue , pregabalin , or magnesium sulfate have been used to reduce this pain . however therefore , propofol long - chain triglycerides ( lcts)/medium - chain triglycerides ( mcts ) were introduced to minimize injection pain , which has less concentration of aqueous free propofol than propofol - lct . however , pain on injection still occurs despite use of propofol - lct / mct . pretreatment with small dose of remifentanil has been demonstrated to be effective in reducing pain from propofol injection without side effects . esmolol , a short - acting 1 adrenergic receptor antagonist , is widely used to reduce cardiovascular stress response to layngoscopy and tracheal intubation . it was shown that perioperative infusion of esmolol reduced anesthetic requirement for surgery and postoperative analgesic consumption . recently , it was reported that pretreatment with esmolol 0.5 mg / kg has analgesic effect on rocuronium injection pain without side effects . the present study was designed to compare the analgesic effect of pretreatment with remifentanil 0.35 g / kg , and esmolol 0.5 mg / kg and 1 mg / kg in minimizing pain during injection of propofol - lct , compared with placebo . in all , 120 patients aged 18 to 70 years , american society of anesthesiologists physical status i and ii , scheduled for elective dental surgery requiring general anesthesia were included . we excluded patients who have cardiac , neurologic or psychiatric problem , patients who had analgesic or sedative agents within 24 hours before surgery , and patients requiring a rapid sequence induction . the present study was approved by the ethics committee of kyungpook national university hospital ( knuh 201305003001 ) and informed written consent was obtained from all patients . on arrival in the operating room , electrocardiogram , noninvasive blood pressure , and pulse oximetry were measured , and a 22-gauge catheter was inserted into a dorsal vein of the patient 's nondominant hand . using a computer - generated table , patients were randomized to 1 of the 4 treatment arms ( n = 30 each ) receiving normal saline , remifentanil 0.35 g / kg , esmolol 0.5 mg / kg and 1 mg / kg as pretreatment . a study - blinded nurse prepared pretreatment substance using identically coded syringes at room temperature . thirty seconds after injection of pretreatment drug , patients received propofol - lct 0.5 mg / kg at rate of 0.5 ml / sec using syringe pump . a study - blinded anesthesiologist measured score of injection pain of propofol using a 4-point scale ( 0 = none [ negative response to questioning ] , 1 = mild pain [ pain reported in response to questioning only , without any behavioral sign ] , 2 = moderate pain [ pain reported in response to questioning and accompanied by a behavioral sign , or pain reported simultaneously without questioning ] , 3 = severe pain [ strong vocal response or response accompanied by facial grimacing , arm withdrawal or tears ] ) . thereafter , propofol - lct1.5 mg / kg and rocuronium 0.8 mg / kg were administered for tracheal intubation , and anesthesia was maintained with desflurane 4% to 7% in 50% n2o / o2 . emergence reactions associated with pretreatment substances such as hypotension and bradycardia were recorded . in the present study , the incidence and severity of pain after propofol injection was the primary outcome , and all other variables were secondary outcomes . on the basis of previously published data , we estimated the incidence of pain during propofol injection in the placebo group to be around 80% . a 40% difference ( 80%40% ) between placebo group and treatment groups would be considered of clinical significance . using a 2-tailed test of the proportions with error of 0.05 and error of 0.8 , data were analyzed using statistical software ( spss , version 23.0 for windows ; spss , chicago , il ) . fisher exact test or the chi - square test was used for sex , incidence of pain , and incidence of side effects . in all , 120 patients aged 18 to 70 years , american society of anesthesiologists physical status i and ii , scheduled for elective dental surgery requiring general anesthesia were included . we excluded patients who have cardiac , neurologic or psychiatric problem , patients who had analgesic or sedative agents within 24 hours before surgery , and patients requiring a rapid sequence induction . the present study was approved by the ethics committee of kyungpook national university hospital ( knuh 201305003001 ) and informed written consent was obtained from all patients . on arrival in the operating room , electrocardiogram , noninvasive blood pressure , and pulse oximetry were measured , and a 22-gauge catheter was inserted into a dorsal vein of the patient 's nondominant hand . using a computer - generated table , patients were randomized to 1 of the 4 treatment arms ( n = 30 each ) receiving normal saline , remifentanil 0.35 g / kg , esmolol 0.5 mg / kg and 1 mg / kg as pretreatment . a study - blinded nurse prepared pretreatment substance using identically coded syringes at room temperature . thirty seconds after injection of pretreatment drug , patients received propofol - lct 0.5 mg / kg at rate of 0.5 ml / sec using syringe pump . a study - blinded anesthesiologist measured score of injection pain of propofol using a 4-point scale ( 0 = none [ negative response to questioning ] , 1 = mild pain [ pain reported in response to questioning only , without any behavioral sign ] , 2 = moderate pain [ pain reported in response to questioning and accompanied by a behavioral sign , or pain reported simultaneously without questioning ] , 3 = severe pain [ strong vocal response or response accompanied by facial grimacing , arm withdrawal or tears ] ) . thereafter , propofol - lct1.5 mg / kg and rocuronium 0.8 mg / kg were administered for tracheal intubation , and anesthesia was maintained with desflurane 4% to 7% in 50% n2o / o2 . emergence reactions associated with pretreatment substances such as hypotension and bradycardia were recorded . in the present study , the incidence and severity of pain after propofol injection was the primary outcome , and all other variables were secondary outcomes . on the basis of previously published data , we estimated the incidence of pain during propofol injection in the placebo group to be around 80% . a 40% difference ( 80%40% ) between placebo group and treatment groups would be considered of clinical significance . using a 2-tailed test of the proportions with error of 0.05 and error of 0.8 , data were analyzed using statistical software ( spss , version 23.0 for windows ; spss , chicago , il ) . fisher exact test or the chi - square test was used for sex , incidence of pain , and incidence of side effects . 1 ) . there was no difference in demographic data between groups ( table 1 ) . the incidence of pain during propofol injection was significantly reduced with remifentanil 0.35 g / kg ( 36.7% ) , esmolol 0.5 mg / kg ( 40% ) and 1 mg / kg ( 36.7% ) , compared with placebo group ( 83.3% ) ( respectively , p < 0.05 ) . in addition , pretreatment with remifentanil ( 3.3% ) , and esmolol 0.5 mg / kg ( 3.3% ) and 1 mg / kg ( 3.3% ) significantly decreased the incidence of severe injection pain , compared with placebo ( 26.7% ) ( respectively , p < 0.05 ) . there were no emergence reactions associated with pretreatment substances such as hypotension and bradycardia in all groups . . demographic characteristics of the study population ( n = 120 ) . incidence and pain severity during injection of propofol . this study showed that pretreatment with remifentanil 0.35 g / kg , and esmolol 0.5 mg / kg and 1 mg / kg , was equally effective to reduce pain during propofol injection , compared with placebo . but propofol is associated with high incidence of pain at injection site , which is often very stressful to patients . the direct exposure of nociceptive receptors or free nerve ending in the vein by free propofol can increase the pain on injection . varghese et al reported that when added with lidocaine , both propofol - lct / mct and propofol - lct had similar incidence of injection pain . by a systemic review and meta - analysis in 2011 , pretreatment with a small dose of opioids halved the incidence of pain after propofol injection , which can generally be recommended . the previous study demonstrated that pretreatment with remifentanil 0.35 g / kg reduced injection pain of propofol by 38.8% without any side effects . in the present study , the incidence of pain from propofol injection was 33.3% in the patients who received remifentanil 0.35 g / kg , which is consistent with the previous study . esmolol , antagonist of 1 adrenergic receptor , is often used to blunt adrenergic response to perioperative stimuli . it was demonstrated that a single injection of esmolol 1 to 2 mg / kg is effective to attenuate the increase of heart rate after intubation without adverse effects . in the previous studies , intraoperative infusion of esmolol decreased the requirement of opioid and inhalation anesthetic without causing hemodynamic change , and reduced postoperative analgesic consumption . up to date , the exact analgesic mechanism of adrenergic receptor antagonist remains unclear . adrenal hormone , commonly known as stress hormone , increases during emotional distress and anxiety , which are associated with activation of hypocampal neurons . adrenergic receptors are involved in learning - facilitated plasticity in the mammalian hippocampus , which requires activation of n - methyl - d - aspartate ( nmda ) receptor . the activation of nmda receptor in the hippocampus is involved in nociceptive processing , at least , in part . in addition , it was found that esmolol can facilitate inhibitory transmitter release in spinal trigeminal nucleus , which produces analgesic effects . in the present study , pretreatment with esmolol 0.5 mg / kg and 1 mg / kg and remifentanil 0.35 g / kg equally decreased pain during propofol injection . the incidence of pain when propofol was injected into vein of the dorsum of hand can reach as high as 80% . pretreatment substances such as remifentanil and esmolol can cause dose - dependent decrease in blood pressure and heart rate . therefore , a placebo group was included to investigate the adverse effect of the pretreatment substances . in the present study , there were no emergence reactions associated with pretreatment with remifentanil 0.35 g / kg , and esmolol 0.5 mg / kg and 1 mg / kg . these results were compatible with the previous studies . the present study had some limitations . in the present study , premedication , such as sedatives , the previous study showed that 87% of patients who did not receive anxiolytic premedication reported the recall about injection pain after propofol injection . therefore , another study is needed to examine the patient 's satisfaction about anesthetic care and the incidence of recall for pain during propofol injection . in conclusion , pretreatment with esmolol 0.5 mg / kg and 1 mg / kg , and remifentanil 0.35 g / kg were equally effective in reducing pain during injection of propofol without adverse effects .

abstractbackground : propofol is associated with pain during injection , which is stressful to patients . the present study was designed to investigate the analgesic effect of pretreatment with remifentanil and esmolol in minimizing propofol injection pain , compared with placebo.methods:in a randomized , double - blind , prospective trial , 120 patients , scheduled for elective dental surgery under general anesthesia , were randomized to 1 of the 4 treatment arms ( n = 30 each ) receiving normal saline , remifentanil 0.35 g / kg , esmolol 0.5 mg / kg , and 1 mg / kg before administration of propofol . during injection of 1% propofol 0.5 mg / kg , pain was evaluated by a 4-point score ( 0 = none , 1 = mild , 2 = moderate , 3 = severe ) . any adverse effects such as hypotension and bradycardia were recorded during the perioperative periods.results:in all , 120 patients completed this study . there were no significant differences in terms of demographic data . the incidence of pain on injection of propofol was 11 ( 36.7% ) with remifentanil 0.35 g / kg , 12 ( 40% ) with esmolol 0.5 mg / kg , and 11 ( 36.7% ) with esmolol 1 mg / kg , compared with 25 ( 83.3% ) with normal saline ( respectively , p < 0.05 ) . there were no significant differences in the incidence of pain between groups with remifentanil 0.35 g / kg , and esmolol 0.5 mg / kg and 1 mg / kg . there were no emergence reactions such as hypotension and bradycardia in all groups.conclusions:pretreatment with esmolol 0.5 mg / kg and 1 mg / kg and remifentanil 0.35 g / kg equally decreased pain during propofol injection .

patients with underlying or comorbid medical condition , psychotic depression , and those who were already on psychotropic medicines were excluded from the study . cases having contraindication for imipramine and/or lithium treatment were also excluded from the study . the aim of the study and the method adopted was explained to each patient and his / her cooperation was solicited . findings of physical examination , mental status evaluation , sociodemographic data were recorded on a specially designed pro forma . all baseline investigations including electrocardiogram and thyroid function were carried out as per standard guidelines . all patients were randomly assigned to one of the two groups : group a patients were given tablet imipramine and placebo . group b patients were administered tablet imipramine and tablet lithium carbonate as per schedule given below . the assessment of psychopathology was done by structured interview of the hamilton depression / melancholia scale designed by williams . the investigator had reviewed the records maintained at this center and found that clinical response was recorded in almost all cases at the dose range of 100150 mg . barring unforeseen developments , each patient was to be brought up to dose of 150 mg by day 14 . lithium carbonate was administered in such a way as to achieve a serum lithium concentration in the range of 0.60.8 meq / l by day 7 . lithium concentration was measured by atomic absorption spectrophotometry . the nursing staff who administered the drugs was blind to the nature of regimen given to the patients . students t - test was utilized to test the significance of the difference of means of scores at weekly intervals while categorical data were put to chi - square test , using the statistical package for social sciences - version 16.0 ( spss 16.0 . the investigator had reviewed the records maintained at this center and found that clinical response was recorded in almost all cases at the dose range of 100150 mg . barring unforeseen developments , each patient was to be brought up to dose of 150 mg by day 14 . lithium carbonate was administered in such a way as to achieve a serum lithium concentration in the range of 0.60.8 meq / l by day 7 . lithium concentration was measured by atomic absorption spectrophotometry . the nursing staff who administered the drugs was blind to the nature of regimen given to the patients . students t - test was utilized to test the significance of the difference of means of scores at weekly intervals while categorical data were put to chi - square test , using the statistical package for social sciences - version 16.0 ( spss 16.0 . demographic and clinical details of depressed patients in both groups did not show any significant differences [ table 1 ] . the two groups did not differ in duration for their current depressive episode [ table 2 ] . the patients did not differ in terms of frequency a particular symptom [ table 3 ] . depression scores of group a and group b patients at baseline and percentage reduction of scores at weekly intervals is shown in tables 4 and 5 , respectively . comparison of two groups in depression ratings at baseline and at weekly intervals [ table 6 ] . there is no difference between the two groups at baseline , but the difference is significant at the end of 1 week , 2 week , 3 week , and 4 week . demographic and clinical details of depressed patients duration of index episode at outset most common symptoms at the time of initial assessment depression scores of group a patients at baseline and at weekly intervals depression scores of group b patients at baseline and at weekly intervals comparison of two groups in depression ratings at baseline and at weekly intervals ( unpaired t - test ) mean percentage reductions in depression ratings at weekly intervals for both the groups revealed a larger reduction in depression ratings for group b as compared to group a at end of 1 , 2 , 3 , and 4 week [ figure 1 ] . difference between the baseline scores and at scores at weekly intervals for groups a and b is shown in table 7 . there are significant reductions in depression ratings for both groups at 1 week , 2 week , 3 week , and at 4 week intervals . however , the decline in scores is more for group b as compared to group a. the mean serum lithium level for the group achieved was 0.555 ( standard deviation : 0.186 ) . the plasma serum levels of lithium correlated with the clinical response positively at 1 week but had no correlation at 4 weeks [ table 8 ] . mean percentage reductions in depression ratings at weekly intervals for both the groups revealed a larger reduction in depression ratings for group b as compared to group a at the end of 1 , 2 , 3 , and 4 week difference between the baseline scores and at scores at weekly intervals for groups a and b ( student 's paired t - test ) mean serum lithium levels and percentage response at 1 week and at 4 weeks for group b patients majority ( 65% ) of patients of group b showed at least 25% improvement in depression ratings by the end of the 1 week . although the sample size in nonresponder group ( i.e. , < 25% by 1 week ) is small , but the trend shows a positive correlation of response with female gender , married status of the patient , absence of an enduring psychosocial problem , and a positive family history for a mood disorder [ table 9 ] . difference in variables associated with response at 1 week within group b between partial responders ( i.e. , having response > 25% and ) and nonresponders ( i.e. , having response < 25% ) the most common side effect for group a was dry mouth whereas it was digital tremor for the group b patients . other side effects encountered were constipation , postural hypotension , foul taste , blurred vision , urinary problems , palpitations , and impotence . manic switch for 2 patients in group a and dysarthria and arrhythmia in one patient each for group b were exclusively group specific [ table 10 ] . the last century was often termed as the century of anxiety . in contrast , 21 century can perhaps be described as the age of depression as evidenced by the fact that it is one of the most common scourges causing distress and disability . although remarkable advances in somatic and psychological interventions have brought in salutary change , but patients are still obliged to endure the anathema at least for a few weeks until the administered drugs start to take effect . ongoing research holds promise of rationalizing and optimizing drug therapies so as to provide maximum benefit to the patient . the current study was a step in this direction wherein an attempt was made to curtail the lag period of tca response by the addition of lithium from the outset and comparing it with the same tca monotherapy in a double - blinded randomized controlled study . the means are comparable to a similar study where mean age was about 39 years ( 39.5 for imipramine and 38.5 for imipramine + lithium group ) . a total of five patients in group a and 1 patient of group b [ table 1 ] shared a positive family of a mood disorder . a total of 6 patients of group a and 5 patients of group b [ table 1 ] had a history of mental or neurological illness . however , none of the patients had a concurrent medical or surgical illness and were not on any psychotropic medications ( exclusion criteria ) . the trial was extended to include unipolar , recurrent depression as well as dysthymic patients [ table 1 ] against an earlier study where they restricted the sample to only bipolar depressed with melancholic features . duration of the index depressive episode was identical for both the groups [ table 2 ] . the symptom profile for patients of both the groups at baseline [ table 3 ] is in agreement with a similar study , which suggests higher prevalence of somatic rather than cognitive symptoms in depressed subjects of this country . in the current study , patients receiving lithium and imipramine combination responded more rapidly and completely than the imipramine - placebo groups [ tables 4 , 5 and figure 1 ] . the differences in response between the two groups at the end of 1 week , 2 week , 3 week , and 4 weeks were both statistically significant and clinically meaningful . the mean percentage change in depression ratings [ figure 1 ] after 1 week ( 38.37% ) for the lithium + imipramine group was higher than the imipramine + placebo group ( 14.97% ) . although the difference between the two groups [ table 6 ] was not significant at baseline ( t = 0.5891 , p > 0.05 ) , but it was significant at week 1 ( t = 3.8747 , p < 0.01 ) , week 2 ( t = 3.6895 , p < 0.01 ) , week 3 ( t = 2.8153 , p < 0.01 ) , and at week 4 ( t = 2.2682 , p < 0.05 ) . the important clinical relevance in the finding is that the combination proves its superiority over monotherapy in that it brought a faster onset of action which persisted during the duration of the study . the mean percentage reduction at 4 weeks [ figure 1 ] of depression ratings was higher ( 96.2% ) for group b ( imipramine + lithium combination ) than that of 60.5% for group a ( imipramine + placebo combination ) implying that the combination brought a more complete remission . the findings are supported by a similar study who found better efficacy at 6 weeks rather than at 4 weeks . the principal hypothesized mechanism of action of imipramine is its ability to inhibit reuptake of both serotonin and noradrenaline . the exact mechanism of action of lithium remains a mystery though recent research points toward its salubrious effect in stabilizing ionic and molecular transmission . lithium is also known to produce striking enhancements in some aspects of serotonergic functions , which is also caused by imipramine . although the exact pharmacodynamics and pharmacokinetics were not the principal foci of this study , it appears that the superior response to the combination may have been obtained because of two separate actions concomitantly by imipramine ( in monoamine enhancement at the synaptic cleft ) and lithium ( in altering intra - neuronal signal pathways ) at molecular level . the strategy is not new to medical profession and is an accepted norm in the treatment of malignancies and chronic infections such as tuberculosis and hiv . lithium is not known to interfere with pharmacokinetics of imipramine , and the combination has been described to be a safe and effective one . at the outset , it was not known as to what degree patients would be tolerating the combination , and the emergence of side effects ( in the form of coarse digital tremor ) at the predefined serum levels of 0.60.9 meq / l was underestimated . emergence of this side effect in the combination group warranted a more cautious approach and serum lithium targets were revised from 0.60.9 the strategy helped in restricting the tremor to only a mild form , which was acceptable to the patients . the use of other antitremor agents such as clonazepam or propranol was of course considered but was not required as tremors reached acceptable levels by just lowering the mean serum lithium levels . that the therapeutic effect was obtained with this much concentration is supported by earlier studies , which suggest that lower concentrations may be as effective as higher concentration for augmentation purpose . moreover , correlation studies at 1 week and at 4 weeks [ table 8 ] suggest a mildly significant positive correlation at 1 week and an insignificant correlation at 4 weeks . lithium was administered for 4 weeks because the intent was to augment imipramine and interest was in early response . how far is the combination likely to be beneficial beyond 4 weeks is subject to further evaluation . however , existing research supports its use , and it may be an alternative in difficult cases . on further analysis , it is seen that 14 out of 20 patients in group b ( i.e. 70% ) showed a higher than 25% response in depression ratings by the end of 1 week [ table 9 ] . a search was made to study the variables associated with difference in response of more than 25% and that of < 25% . the variables of age , occupation , educational status , interpersonal relations , past history of mental or neurological illness , depression typology , or duration of index depressive episode did not significantly influence the outcome though the variables of gender ( of being females ) , married status , absence of enduring psychosocial problem , and a positive family history for a mood disorder predicted a better response . it appears fairly reasonable to presume at this stage that the response to lithium plus imipramine combination was quicker and superior than tricyclic monotherapy alone and it was seen across majority of depressed subjects . the limiting factor of the study was small sample size and a narrow spectrum of depressive disorders which were studied . concurrent administration of lithium and imipramine from the outset produced quicker antidepressant response in unipolar depression and the effect was evident in 70% of the patients by the end of the 1 week .

background : treatment of depressive episode often poses a challenge . although there are numerous medicines available for its treatment but they all have a lag period of 23 weeks before they start showing their result.aim:the aim of the present study was to test the hypothesis that an initial lithium - tricyclic antidepressant ( tca ) combination has a quicker and better antidepressant effect than standard tca treatment in unipolar depression.materials and methods : twenty unipolar depressed inpatients under lithium - tca treatment were compared with twenty patients with similar diagnosis treated with tca - placebo combination . the duration of the study was 4 weeks under double - blind conditions.results:initial lithium - tca treatment reduced depressive symptoms significantly more than tca alone . the difference was evident from 1st week onward and persisted at 4 weeks.conclusion:lithium augmentation of tca at the outset offers a strategy to reduce the lag period of antidepressant action . the choice can be made for those patients who are likely to benefit from long - term prophylaxis .

patients experience preventable harm from medical errors , mistakes and teamwork failures ( 1 ) . it is a guiding factor in daily care and a central issue in healthcare ( 3 , 4 ) . for example , in iran , it is not taught to medical personnel , traditionally ( 6 ) . however , preventable adverse events are common in developed and developing countries ( 7 ) . there has been a growing awareness of the measures and cost of incidence in two decades ago ( 8) . for example , childbirth s mortality and morbidity highlight the importance of learning from events ( 10 ) . it is necessary to revisit patient safety , changes , remained challenges , emerging new problems , and effect of health care in the quality and safety of healthcare ( 11 ) . patients perspective is patients beliefs and attitudes in the field of preventing and controlling errors and the risk of error occurring ( 13 ) . a patient engaging with safety is the most benefit of strengthening a relationship with physicians and nurses ( 14 ) . patients misperceptions result in emerging obstacles in the environment that patients themselves have to manage ( 13 ) . the patients negative perspective into hospital s patient safety may reversely conduce to incongruity in referrals and follow - up , petitions and allegations concerning jeopardizing patient s life . there are many individual , environmental and organizational factors for not accurately evaluating healthcare , quality and patient safety level in hospitals ( 16 ) . acording to the findings of australian patient safety report ( 2001 ) , public hospitals survey in kerman , iran ( 2006 ) , educational hospital survey in izmir , turkey ( 2006 ) , patient safety survey in urmia , iran ( 2010 ) , urmia patient safety survey ( 2012 ) , patient safety survey in isfahan , iran ( 2012 ) and iranian patient safety survey ( 2012 ) , the premier factors are as follows : age , gender , marital status , education , insurance coverage , employment status , period of referring to physician and the date of latest hospitalization ( 17 ) . even so , patients perspective have excluded in the construction of clinical governance and health - care reforms . it requires decreasing the imbalance of information and power between patients and healthcare professionals . addressing this problem therefore , it is necessary to notify , realize , modify or remove the cause and effect of the negative perspective ( 18 ) . the general aims of this study were : - to determine patient safety level in tehran university of medical sciences general hospitals from patients perspective- to determine the contributory factors on patients perspective . - to determine patient safety level in tehran university of medical sciences general hospitals from patients perspective - to determine the contributory factors on patients perspective . this study had a cross - sectional design carried out in a period of six - month from may 2011 to november 2011 . the study populations were inpatients in the clinical wards that had the experience of hospitalizing . first step : the sample size was calculated by using the following formula : n = z1-/22p(1-p)d2on the ground that no researches have been done so far , the favorable perception of involvement in treatment decisions and patient safety was considered 50% ( p=0.5 ) . the sample size for each treatment decision and perceptions of safety were calculated 180 in the first step considering to the confident interval 95% ( =0.05 ) and maximum deviation 7.5% ( d=0.075 ) . second step : according to clark s study ( 2001 ) , the minimum r that influenced various factors was 0.6 ( 19 ) . therefore , the desirable sample size was calculated 300 . in the spring of 2011 , the list of six general hospitals affiliated to tehran university of medical sciences ( tums) clinical wards were prepared . the numbers of clinical wards in each hospital were 120 as follows : - imam hospital : 39 wards ( icu & ccu : 13 , surgery , transplant , obstetrics and gynecology : 13 , internal medicine , infectious diseases , ear , nose and throat , general : 13)- baharlou hospital : 16 wards ( icu & ccu : 5 , surgery , transplant , obstetrics and gynecology : 5 , internal medicine , infectious diseases , ear , nose and throat , general : 6)- shariati hospital : 37 wards ( icu & ccu : 12 , surgery , transplant , obstetrics and gynecology : 12 , internal medicine , infectious diseases , ear , nose and throat , general : 13)- ziaian hospital : 13 wards ( icu & ccu : 4 , surgery , transplant , obstetrics and gynecology : 4 , internal medicine , infectious diseases , ear , nose and throat , general : 5)- amiralam hospital : 7 wards ( icu & ccu : 1 , surgery , transplant , obstetrics and gynecology : 1 , internal medicine , infectious diseases , ear , nose and throat , general : 5)- sina hospital : 8 wards ( icu & ccu : 3 , surgery , transplant , obstetrics and gynecology : 3 , internal medicine , infectious diseases , ear , nose and throat , general : 2 ) . - imam hospital : 39 wards ( icu & ccu : 13 , surgery , transplant , obstetrics and gynecology : 13 , internal medicine , infectious diseases , ear , nose and throat , general : 13 ) - baharlou hospital : 16 wards ( icu & ccu : 5 , surgery , transplant , obstetrics and gynecology : 5 , internal medicine , infectious diseases , ear , nose and throat , general : 6 ) - shariati hospital : 37 wards ( icu & ccu : 12 , surgery , transplant , obstetrics and gynecology : 12 , internal medicine , infectious diseases , ear , nose and throat , general : 13 ) - ziaian hospital : 13 wards ( icu & ccu : 4 , surgery , transplant , obstetrics and gynecology : 4 , internal medicine , infectious diseases , ear , nose and throat , general : 5 ) - amiralam hospital : 7 wards ( icu & ccu : 1 , surgery , transplant , obstetrics and gynecology : 1 , internal medicine , infectious diseases , ear , nose and throat , general : 5 ) - sina hospital : 8 wards ( icu & ccu : 3 , surgery , transplant , obstetrics and gynecology : 3 , internal medicine , infectious diseases , ear , nose and throat , general : 2 ) . eventually , the stratified random sampling method was used . the 120 wards were divided into three groups as : - group 1 : intensive care unit ( icu and ccu ) ( 38 wards);- group 2 : surgery , transplant , obstetrics and gynecology ( 38 wards);- group 3 : internal medicine , infectious diseases , ear , nose and throat , general ( 44 wards).300 samples were proportionally divided between 3 groups . the numbers of samples in each group were as : - group 1 : 95- group 2 : 95- group 3 : 110 - group 1 : intensive care unit ( icu and ccu ) ( 38 wards ) ; - group 2 : surgery , transplant , obstetrics and gynecology ( 38 wards ) ; - group 3 : internal medicine , infectious diseases , ear , nose and throat , general ( 44 wards ) . the numbers of wards in each group were : - group 1 : 5 wards- group 2 : 5 wards- group 3 : 6 wards . finally , the sample was selected as follows : - group 1 : imam ccu , baharlou ccu , shariati ccu , general imam icu , ziaian ccu and post ccu.- group 2 : imam surgery , amiralam surgery , sina general surgery , shariati general surgery , ziaian surgery.- group 3 : imam internal , amiralam internal , baharlou internal , shariati internal pulmonary , shariati internal , ziaian internal . - group 1 : imam ccu , baharlou ccu , shariati ccu , general imam icu , ziaian ccu and post ccu . - group 2 : imam surgery , amiralam surgery , sina general surgery , shariati general surgery , ziaian surgery . - group 3 : imam internal , amiralam internal , baharlou internal , shariati internal pulmonary , shariati internal , ziaian internal . library and internet research the questionnaire was developed by clark in 2001 ( 17 ) to assess patients opinions about patient safety issues , medical error , and event reporting . it includes 37 items in 4 sections as follows : demographic characteristics ( eight questions ) , general information regarding the doctors and hospitals ( six questions ) , participation in treatment decisions ( 12 questions ) and patient safety ( 11 questions ) . the five - level likert scale was employed for the responses as follows : strongly disagree ( 1 score ) , disagree ( 2 score ) , neither ( 3 score ) , agree ( 4 score ) and strongly agree ( 5 score ) . therefore , the participation s level was evaluated as follows : - 1236 score : low- 3660 score : high . therefore , the patient safety s level was as follows : - 2641 score : intermediate the questionnaire was translated into farsi . then , both the translated questionnaire and the original one were handed to some experts in order to revise it . after that , the comprehensibility of the survey was tested on 20 patients from the study population who had not been included in our sample . the reliability coefficient of the questionnaire was calculated 0.78 . according to patients perspective , we prepared the final version of the farsi questionnaire after altering some questions and eliminating irrelevant questions . the questionnaire was developed by clark in 2001 ( 17 ) to assess patients opinions about patient safety issues , medical error , and event reporting . it includes 37 items in 4 sections as follows : demographic characteristics ( eight questions ) , general information regarding the doctors and hospitals ( six questions ) , participation in treatment decisions ( 12 questions ) and patient safety ( 11 questions ) . the five - level likert scale was employed for the responses as follows : strongly disagree ( 1 score ) , disagree ( 2 score ) , neither ( 3 score ) , agree ( 4 score ) and strongly agree ( 5 score ) . therefore , the participation s level was evaluated as follows : - 1236 score : low- 3660 score : high . therefore , the patient safety s level was as follows : - 2641 score : intermediate the questionnaire was translated into farsi . then , both the translated questionnaire and the original one were handed to some experts in order to revise it . after that , the comprehensibility of the survey was tested on 20 patients from the study population who had not been included in our sample . , we prepared the final version of the farsi questionnaire after altering some questions and eliminating irrelevant questions . participants demographic characteristics were as follows : 60% were female , and the rests ( 40% ) were male . 20% , 23% and 20% were 2418 , 4435 and 55 years - old people , respectively . the ethnicity of 32% , 24.3% and 21% was azeri , kurd and fars , sequentially . health insurance , social security insurance and other insurances coverage were 37% , 23% and 25.7% , sequentially . patient safety was evaluated high , intermediate and low by 60% , 14% and 26% of patients , respectively . patient safety variables included : demographic variables ( including age , gender , education , ethnicity , marital status , insurance type , employment status and income statues ) , period of referring to family physician or general practitioner , the date of latest medical consultation , the number of hospitalizations in the past year , the date of latest hospitalization , hospital s type , exposure to adverse events and patient participation in treatment decisions . tables 1 and 2 show the results of linear regression and multivariate logistic regression , respectively . according to the table 1 , patients socio - demographic , medical and hospitalized variables affecting on the hospital s patient safety score were as follows : age , gender , ethnicity , marital status , education , insurance coverage , employment statues , period of referring to family physician , or general practitioner , the date of latest hospitalization , the date of latest exposure to adverse events , participation in treatment decisions ( p<0.1 ) . for adjusting possible problematical factors and achieving independent factors , affecting variables imported in the final multivariate logistic regression model by a stepwise method . the most important variables affecting on the hospital s patient safety score were as follows : education , employment status and marital status . education , employment status and marital status decreased odds ratio of dedicating high score to hospital s patient safety , 0.014 , 0.32 and 0.19 times , respectively . it was meaning that the unmarried or educated or employed individuals tended to score patient safety lower than others . according to the findings , patient safety was evaluated high by the most of patients ( 60% ) hospitalized in tums s general hospitals . considering to their perspective , much attention has been paid to patient safety in health care , the registration and the examination of safety incidents , particularly in hospitals . it is in concordance with sheikh beiklou s survey in urmia s public and private hospitals . according to the findings , patient safety was ranked high ( 56% ) from the patients perspective ( 17 ) . poor attention to patient safety results in errors , low quality of care , and increases the length of stay ( 5).there are a number of risk areas in which errors and risks are more likely to occur . therefore , patients perspective provides a rich source of data in looking at how patient s power impacts upon safety in organizational contexts ( 3 ) . education , employment status and marital status are the premier factors affecting on evaluating patient safety in hospitals . it is in concordance with florin s survey in 2006 . according to the findings , the disparate perspective was pertinent to age , marital and social status including example education , employment ( 21 ) . it is consistent with the findings of other surveys : clark in australia s private and general hospitals ( 19 ) , larsson et al . ( 22 ) , in kerman s public hospitals , iran ( 23 ) , in izmir s educational hospitals , turkey ( 24 ) , and schwappach and et al . nowadays , the consumers are more conscious in healthcare market . because educated people have more risk - assessment ability they rapidly conceive whether providers perform their duties , the services are concordant , effective and patient - centered , there is do it right culture in healthcare organization or not . it is consistent with the findings of other reviews : oskouiee and zare in tabriz s educational hospitals , iran ( 17 ) , leventhal ( 25 ) , ozdemir et al . in izmir s educational hospitals , turkey ( 24 ) , and ghaffari and rakhshande in iran ( 16 ) it is consistent with the findings of other reports : clark in australia s general and private hospitals ( 19 ) and ozdemir and et al in izmir s educational hospitals , turkey ( 24 ) . according to the findings of patient safety survey in urmia hospitals , mousavi et al . emphasized that patients perspective is the most important criterion for appraising patient safety in hospitals . it is pertinent to some of patients characteristics such as marital status ( 26 ) . it is because of communicating with others , increasing awareness and understanding issues such as safety . the employed or married patients inquire into disease , medical process and healthcare organizations from communicating or consulting with their colleagues , friends and family members . patients perspective is the most important catalyst to the emergence of a safety movement in healthcare over the last decade ( 3 ) . understanding the patients perspective is a pivotal way of generating knowledge about the processes involved in harm . it must nt ignore in the adoption of a no - blame culture in patient safety . however , tums s general hospitals are enough safe from patients perspective , patient safety should be improved . the contributory factors , such as education , employment and marital status , were conclusive to claim that these factors were predicting patients perspective in safety matters . in clinical governance , contributing patients perspective to the improvement of patient safety reforms is critical in generating new models of good practice . health care organizations can go beyond mainstream frameworks for quality and patient safety improvement by create higher value for patients perspective . this study has two research methods also have limitations : the lack of cooperation of some hospitals to do research and patients unwillingness to fill the questionnaire . ethical issues ( including plagiarism , informed consent , misconduct , data fabrication and/or falsification , double publication and/or submission , redundancy , etc . ) have been completely observed by the authors .

backgroundit is important to focus on creating opportunities for patients participation at all levels of health systems in order to promote their ability to improve patient safety and quality of services . the general aim of this study was to determine patient safety level in tehran university of medical sciences ( tums ) general hospitals , tehran , iran from patients perspective and to determine the contributory factors on their perspective.methods:this was a cross - sectional study . in the spring 2011 , the list of clinical departments of the six general hospitals affiliated to tums was obtained through the website of tums . by using stratified random sampling , the sample size was calculated 300 patients . data were collected by using a structured questionnaire and its validity and reliability were acceptable . descriptive statistics , linear regression and logistic regression were used for analyzing the data.results:totally , 60% of patients were female . patient safety was evaluated high by 60% of respondents . the unmarried or educated or employed individuals tend to score lower than others.conclusion:tumss general hospitals are enough safe from patients perspective , patient safety should be improved . in clinical governance , contributing patients perspective to the improvement of patient safety reforms is critical in generating new models of good practice .

oral myiasis is a rare condition that refers to the invasion of tissue of the oral cavity by fly larvae . the term myiasis ( greek : myia= fly , iasis = disease ) was coined by hope in 1840 and it was first described by laurance in 1909 . zumpt defined myiasis as the infestation of live human and vertebrate animals with dipterous larvae , which feed on living or necrotic tissues , liquid body substances , or ingested food . human myiasis is reported mainly in developing countries such as asian countries and very rarely from western countries . myiasis can be classified depending on the condition of the involved tissue as i ) accidental myiasis when larvae get ingested along with food , ii ) semi - specific myiasis when the larvae are laid on necrotic tissue of the wound and iii ) . based on anatomic site , it can be classified as i ) cutaneous myiasis , ii ) myiasis of external orifices and iii ) myiasis of internal organs . primary myiasis is caused by biophagous larvae ( feed on living tissues ) and also called as obligatory myiasis . secondary myiasis is caused by the necrobiophagous larvae ( feed on dead tissues ) and also called as facultative myiasis . the most common anatomical sites for myiasis are the nose , eyes , skin wounds , sinuses , ears , lungs , gut , gall bladder , vagina , nasal cavities , and rarely , the mouth . whereas cutaneous myiasis involves invasion of the skin through the wounds . the common predisposing factors are incompetent lips , poor oral hygiene , severe halitosis , anterior open bite , mouth breathing during sleep , facial trauma , extraction wounds , ulcerative lesions and carcinoma . most of the patients are senile , alcoholics , mentally handicapped , cerebral palsied,[121416 ] and also those living in poor conditions , with no age limitation . droma etal . reported that incidence of myiasis is more in anterior maxillary region and men are more affected than women . traumatic wounds in orofacial region , when neglected by patients themselves as well as care takers , can lead to development of myiasis . the present report describes a case of oral myiasis in a 14 year old boy with a history of trauma to the maxillary anterior region and it was neglected by him and parents . a 14 year old boy with learning disability presented to department of pedodontics and preventive dentistry , sjm dental collegeand hospital , chitradurga , with a chief complaint of upper lip swelling and itching sensation on the right side of the face since more than 2 weeks [ figure 1 ] . the patient gave a history of trauma to maxillary anterior dentoalveolar region and it was neglected for many days . on examination , there was swelling of the face on the right side , which extended from infraorbital region to upper lip [ figure 1 ] . intraoral examination revealed a deep lacerated wound which was infected and maggots were noticed on the upper vestibule and the nasal floor . the patient had an incompetent lip , swollen upper gingiva , and poor oral hygiene , and general symptoms like pain , fever and malaise were present . a cotton swab impregnated with turpentine was placed near the upper vestibule ( wound ) area for 510 minutes . many of the maggots came out from the nose , which were then removed one by one with the help of curved artery forceps [ figures 2 , 3 ] . during the 3 days interval , the length of the each maggot ranged from 6 to17 mm [ figure 6 ] . then , the wound was irrigated with hydrogen peroxide , antiseptic betadine solution and broad - spectrum antibiotics , and analgesics were prescribed . the patient was recalled for regular follow - up for wound debridement and the wound healed uneventfully . swelling of the right side of the face and the upper lip arrow shows larvae coming out from the nose number of maggots removed from this area collected larvae from the lesion each maggot was measured myiasis is an uncommon disease in humans and common in rural areas compared to urban areas . the most common sites are the nose , eye , ear , anus , vagina , and rarely , the oral cavity . predisposing factors are extraction wounds , poor oral hygiene , psychiatric patients , mouth breathing during sleep , facial trauma , open neglected wounds , necrotic tissues , suppurative lesions , severe halitosis , senility , cerebral palsy , mental retardation , hemiplegia and factors that favor persistent non - closure of the mouth.[121416 ] primary oral myiasis commonly affects the anterior part of the mouth . the patient reported here was residing in a rural area , with low socioeconomic background . the life cycle of a house fly begins with the egg stage followed by the larva , the pupa , and finally the adult fly . the conditions required for egg laying and survival of the larvae are moisture , necrotic tissue and suitable temperature . the larval stage lasts from 6 to 8 days , in which period they are parasitic to human beings . they are photophobic , and therefore tend to hide deep into the tissues , which also helps them to secure a suitable niche to develop into pupa . in the present case also , the larvae were present deep into the tissue and the nasal floor . proteolytic enzymes released by the surrounding bacteria decompose the tissue and the larvae feed on this rotten issue . oral myiasis can also be classified as- 1 ) larvae living outside the body , 2 ) larvae burrow into unbroken skin and develop under it . 4 ) eggs or young larvae are deposited in the wounds or natural cavities in the body . when there are multiple larvae and in advanced stages of development and there is tissue destruction , local application of various agents like turpentine oil , larvicidal drug like negasunt , ethyl chloride , ether , mercuric chloride , creosote , saline , iodoform , chloroform , clove oil , calomel , phenol mixture , olive oil , gentian violet , alcoholic solution in association with tobacco , camphor , sodium hypochlorite can be used for complete removal of all larvae . these agents asphyxiate the aerobic larvae and force them to a superficial position and these larvae are removed with less damage to tissues and larvae as well . the rupture of the larvae might cause allergic or foreign body reaction and secondary infection , so care must be taken not to rupture the maggots . in the present case , maggots were removed completely in 3 days interval by using turpentine oil . myiasis of orofacial region can be prevented by educating the people from rural areas and low socioeconomic groups about personal hygiene , taking care of any wound , control of fly population and maintenance of sanitation of the surroundings . we , the dentists , must educate parents / guardians to make them aware of the conditions , and the parents should bring children as early as possible for dental intervention to prevent further complications .

oral myiasis is a rare condition in humans and is associated with poor oral hygiene , severe halitosis , mouth breathing during sleep , mental handicap , cerebral palsy , epilepsy , anterior open bite , incompetent lips , and other conditions . in this report , a 14 year - old boy who had an orofacial trauma in the maxillary dentoalveolar region , which was neglected , has been described . there was a deep lacerated wound on the upper vestibule which was infected and maggots were found on the same wound . the clinical features , management , treatment are discussed and relevant literature is reviewed .

these injuries affect a large number of americans : in this country , craniofacial injuries make up more than 10% of all annual emergency room visits1 . furthermore , in recent conflicts in the middle east , craniofacial injuries account for more than one - quarter of all injuries sustained by us soldiers23 . a number of other situations can also lead to the need for mandibular reconstruction or augmentation ; for example , periodontal disease , congenital defects , tumor resection of the mandible , and atrophy of the alveolar ridge due to tooth loss45 . often , mandibular reconstructions are complex and require multiple procedures6 . to maximize the quality of life for these patients , full restoration of mandible function includes the ability to eat normally ; this often relies on the placement of dental implant restorations in proper occlusion . for patients undergoing mandibular reconstruction , one significant challenge faced is that the bone does not heal to pre - injury volume ; the height and/or width of the regenerated mandibular bone can be insufficient for implant restorations . ideally , the implant should be encompassed by at least 1 mm of alveolar bone in order to properly support the prosthesis7 . in addition to bone quantity , bone quality is an essential component contributing to implant success8 . unfortunately , none of these treatments are reliable enough to be considered the single clinical gold - standard5910 . in order to develop improved therapies for craniofacial bone regeneration , it is important to gain a better understanding of the mechanisms involved in the healing process . to ensure safety and efficacy of novel craniofacial - specific biomaterials prior to clinical trials , promising materials are often tested for anatomically appropriate efficacy in a larger pre - clinical animal model with comparable mandibular size and dentition to humans . testing therapies in these relevant models allows us to be more confident that findings will be clinically translatable . furthermore , by standardizing the large animal models used across the field , results from numerous studies can be easily compared . researchers have historically used dogs , goats , sheep , or pigs as a large animal model to perform pre - clinical craniomaxillofacial ( cmf ) bone healing trials ; with each model having specific advantages and drawbacks11 . goats121314 and sheep1516171819 have been used in numerous studies to further the understanding of craniofacial bone healing . however , the dentition of these animals is characterized by elongated tooth roots , continuously erupting teeth , and herbivorous chewing pattern , which are quite different from humans . dogs have been used extensively to study bone healing in mandibular defects , including the use of notch - type defects at the inferior margin202122 . dogs have similar dentition to humans and are considered a good model to study maxillofacial bone healing23 . even so , they can be expensive ; especially when breed - matched studies are performed . furthermore , ethical concerns regarding the use of companion animals in medical research have prompted many groups to seek alternative models11 . the pig is an attractive model because its mandible closely resembles the human mandible with regard to anatomy , morphology , healing , bone composition , bone remodeling and dentition2425 . mandibular defect models in pigs are used to evaluate the efficacy of promising new biomaterials26 ; however , some inconsistency has been noted in the literature as to the size of the defect that defines a critical - sized defect ( csd ) in these models . the non - segmental bone notch defect model is one such pig model that is useful in evaluating bone healing due to the fact that it mimics localized edentulous bone atrophy . a number of studies have selected a 5 cm defect as the csd to evaluate bone healing potential of various therapies2728 . however , a subsequent report suggests that a 5 cm defect may not be stringent enough to be defined as a csd . that study found that , with the creation of a resected bone block ( ~10.1 cm ) in the anterior alveolar region with periosteal preservation , the defect showed spontaneous regeneration via a normal physiologic response29 . ma et al.30 demonstrated that segmental defects as large as 6 cm in length in the presence of the periosteum or 2 cm in length when the periosteum was resected could be considered csds in the pig mandible . these results provide further support for the idea that the periosteum plays a key role in bone regeneration in large defects . there is a significant need to develop bone regenerative therapies to restore mandibular and craniofacial defects in a predictable manner . as such , it is essential that our preclinical models are appropriate and stringent for testing these novel therapies so that we have confidence in our study results . due to the inconsistencies in the available literature regarding the definition and characterization of csd healing in the miniature pig mandibular defect model , further investigation of a non - healing notch defect , we sought to define healing in a surgically - created mandibular notch defect measuring a minimum of 321 cm ( volume=6 cm ) with adjacent periosteal stripping in sinclair miniature pigs . we hypothesized that this model would mimic a similar human mandibular injury and would not heal without intervention . upon defining this model as a csd model , studies can then move forward to test promising bone regenerative therapeutics in the cmf region and justify their translation for use in human clinical studies . to evaluate the healing potential in mandibular bone defects , either with no restoration ( negative control ) or with autologous bone graft restoration ( clinical standard ) , notch defects 6 cm in volume were created bilaterally in five dentally - mature sinclair miniature pigs ( > 1 year of age ) . bone healing was monitored for 16 weeks ; in vivo radiographic assessments were performed prior to surgery , 4 weeks post - surgery , and 16 weeks post - surgery . this research study was approved by the institutional animal care and use committee at the united states army institute of surgical research ( no . a-11 - 017 ) . a schematic representation of the surgical protocol is shown in fig . 1 . a. bilateral mandible defects were created using an extra - oral surgical approach ; specifically , the defects were anatomically located anterior to the antegonial notch and posterior to the mental foramen . approximately 24 hours prior to surgery , a fentanyl transdermal patch ( 100 g / hr ) was applied to ensure appropriate levels of peri- and post - surgery analgesia . thirty minutes prior to surgery , telazol ( 4.4 mg / kg intramuscular ; zoetis , florham park , nj , usa ) was administered as anesthetic induction . following anesthetic induction , prophylactic antibiotics ( cefazolin , 1 g ) were administered , and the surgery site was prepared to ensure sterility . a skin incision was made parallel to the inferior border on both sides of the mandible , and the skin was reflected . using a reciprocating bone saw cooled with copious sterile saline , right and left mandibular osseous defects were created , followed by proximal periosteum dissection.(fig . c ) these defects were approximately 6 cm in volume ( anterior - posterior=3 cm , buccal - lingual=1 cm , inferior border - height of contour=2 cm).(fig . d - f ) to aid in histological analysis , gutta - percha was placed into small holes created in the cortical bone at the defect borders . bone sectioned from each side was ground in the r. qutin bone - mill ( qutin dental - products , leimen , germany ) to morselize both the cortical and cancellous bone.(fig . h ) the morselized bone from both sides was combined , hydrated with sterile saline , compressed ( fig . j ) a small amount of morselized bone was reserved for scanning electron microscopy evaluation of particle size . k ) all defects were plated using a 2.7 mm reconstruction plate with 2.7 mm self - tapping cortex screws ( synthes vet , west chester , pa , usa).(fig . k ) prior to reapproximating the tissue layers with resorbable 3 - 0 vicryl sutures ( ethicon us llc , somerville , nj , usa ) , a jackson - pratt drain was placed into the surgical wound site . next , 64-slice computed tomography ( ct ) scans ( aquilion 64 multislice helical ct scanner ; toshiba american medical , tustin , ca , usa ) were performed under anesthesia ( following the above described anesthesia protocol ) immediately prior to surgery and 4 and 16 weeks post - surgery . following the 16 week final ct scan , the pigs were euthanized via intravenously administered fatal - plus ( 1 ml/4.5 kg ; vortech pharmaceuticals , dearborn , mi , usa ) . sixty - four slice ct scan images were acquired at an effective pixel size of 500 m , and three - dimensional rendering of the image sets was performed using a standard " bone mask " in vitrea core ( version 6.3 ; vital , minnetonka , mn , usa ) . the clinical volumes were then upsampled using tri - linear interpolation at a factor of 5 ( imagej version 1.47 ; national institutes of health , bethesda , md , usa ) so that the resolution was 100 m31 . dataviewer ( skyscan , kontich , belgium ) was used to re - align the mandibles along the physiological axes , and dentition landmarks were used to ensure that the scans at different time points were all aligned in an identical fashion . the image stack was then imported into ctan software version 1.11 ( skyscan ) , and a region of interest ( roi ) was created to cover the defect site . the region was defined by the contour of the intact bone from the pre - surgical scan and was fixed within each animal for evaluation at 4 and 16 weeks.(fig . a ) the defect site roi spanned an average of 3 cm long , 1 cm deep , and 2 cm wide ( full thickness ) . a threshold of 659 mgha / ml was selected across all samples using the otsu algorithm32 to distinguish mineralized tissue from unmineralized tissue within the defect . a secondary roi was defined over the same length in each pig to evaluate any changes in bone morphology above the notch ( intact bone excluding teeth , as outlined with a dashed line in fig . the bone volume fraction and bone mineral density of the mineralized tissue were calculated within each roi for each sample using ctan . after the 16 week harvest , the mandibles were hydrated with formalin , and micro - computed tomography ( ct ) analysis was performed using a skyscan 1072 scanner ( bruker microct , kontich , belgium ) at a resolution of 36 m / pixel . the images were reconstructed using nrecon software ( bruker microct ) to generate grayscale images . dataviewer was used to re - align the mandible images using dentition landmark registration to the 64-slice ct data for consistency . a uniform threshold for bone the excised mandible sections were prepared for histology by dehydration in ascending concentrations of ethanol , followed by xylene at 4 and then embedding in poly(methyl methacrylate ) . the specimens were then cut and ground to 30-m thick sections using a diamond saw and microgrinder ( exakt technologies , oklahoma city , ok , usa ) . the sections were mounted on slides , stained with sanderson 's rapid bone stain , then counterstained with van gieson 's picrofuchsin to stain soft tissue blue and stain bone pink / red . next , 2.0 magnification histology slide images were acquired on an olympus szx16 research high - class stereo microscope ( olympus , center valley , pa , usa ) with an olympus dp71 microscope digital camera and compiled using photoshop ( version 7.0.1 ; adobe systems inc . , san jose , ca , usa ) . high magnification images ( 40 and 100 ) were acquired on a nikon eclipse 55i research microscope with a ds - f11 digital camera ( nikon instruments inc . , significance in 64-slice ct measures was determined using a two - way anova ( across time and experimental group ) and tukey 's test for post - hoc evaluation when significance was found ( sigmaplot version 11.0 ; systat software inc . , san jose , ca , usa ) . in the case of the ct data , to evaluate the healing potential in mandibular bone defects , either with no restoration ( negative control ) or with autologous bone graft restoration ( clinical standard ) , notch defects 6 cm in volume were created bilaterally in five dentally - mature sinclair miniature pigs ( > 1 year of age ) . bone healing was monitored for 16 weeks ; in vivo radiographic assessments were performed prior to surgery , 4 weeks post - surgery , and 16 weeks post - surgery . this research study was approved by the institutional animal care and use committee at the united states army institute of surgical research ( no . a-11 - 017 ) . a schematic representation of the surgical protocol is shown in fig . 1 . bilateral mandible defects were created using an extra - oral surgical approach ; specifically , the defects were anatomically located anterior to the antegonial notch and posterior to the mental foramen . approximately 24 hours prior to surgery , a fentanyl transdermal patch ( 100 g / hr ) was applied to ensure appropriate levels of peri- and post - surgery analgesia . thirty minutes prior to surgery , telazol ( 4.4 mg / kg intramuscular ; zoetis , florham park , nj , usa ) was administered as anesthetic induction . isoflurane ( 1.5%-4.0% ) and oxygen were then used to maintain anesthesia . following anesthetic induction , prophylactic antibiotics ( cefazolin , 1 g ) a skin incision was made parallel to the inferior border on both sides of the mandible , and the skin was reflected . using a reciprocating bone saw cooled with copious sterile saline , right and left mandibular osseous defects were created , followed by proximal periosteum dissection.(fig . c ) these defects were approximately 6 cm in volume ( anterior - posterior=3 cm , buccal - lingual=1 cm , inferior border - height of contour=2 cm).(fig . d - f ) to aid in histological analysis , gutta - percha was placed into small holes created in the cortical bone at the defect borders . bone sectioned from each side was ground in the r. qutin bone - mill ( qutin dental - products , leimen , germany ) to morselize both the cortical and cancellous bone.(fig . h ) the morselized bone from both sides was combined , hydrated with sterile saline , compressed ( fig . j ) a small amount of morselized bone was reserved for scanning electron microscopy evaluation of particle size . k ) all defects were plated using a 2.7 mm reconstruction plate with 2.7 mm self - tapping cortex screws ( synthes vet , west chester , pa , usa).(fig . k ) prior to reapproximating the tissue layers with resorbable 3 - 0 vicryl sutures ( ethicon us llc , somerville , nj , usa ) , a jackson - pratt drain was placed into the surgical wound site . next , 64-slice computed tomography ( ct ) scans ( aquilion 64 multislice helical ct scanner ; toshiba american medical , tustin , ca , usa ) were performed under anesthesia ( following the above described anesthesia protocol ) immediately prior to surgery and 4 and 16 weeks post - surgery . following the 16 week final ct scan , the pigs were euthanized via intravenously administered fatal - plus ( 1 ml/4.5 kg ; vortech pharmaceuticals , dearborn , mi , usa ) . sixty - four slice ct scan images were acquired at an effective pixel size of 500 m , and three - dimensional rendering of the image sets was performed using a standard " bone mask " in vitrea core ( version 6.3 ; vital , minnetonka , mn , usa ) . the clinical volumes were then upsampled using tri - linear interpolation at a factor of 5 ( imagej version 1.47 ; national institutes of health , bethesda , md , usa ) so that the resolution was 100 m31 . dataviewer ( skyscan , kontich , belgium ) was used to re - align the mandibles along the physiological axes , and dentition landmarks were used to ensure that the scans at different time points were all aligned in an identical fashion . the image stack was then imported into ctan software version 1.11 ( skyscan ) , and a region of interest ( roi ) was created to cover the defect site . the region was defined by the contour of the intact bone from the pre - surgical scan and was fixed within each animal for evaluation at 4 and 16 weeks.(fig . a ) the defect site roi spanned an average of 3 cm long , 1 cm deep , and 2 cm wide ( full thickness ) . a threshold of 659 mgha / ml was selected across all samples using the otsu algorithm32 to distinguish mineralized tissue from unmineralized tissue within the defect . a secondary roi was defined over the same length in each pig to evaluate any changes in bone morphology above the notch ( intact bone excluding teeth , as outlined with a dashed line in fig . the bone volume fraction and bone mineral density of the mineralized tissue were calculated within each roi for each sample using ctan . after the 16 week harvest , the mandibles were hydrated with formalin , and micro - computed tomography ( ct ) analysis was performed using a skyscan 1072 scanner ( bruker microct , kontich , belgium ) at a resolution of 36 m / pixel . the images were reconstructed using nrecon software ( bruker microct ) to generate grayscale images . dataviewer was used to re - align the mandible images using dentition landmark registration to the 64-slice ct data for consistency . a uniform threshold for bone was determined across all samples using the otsu algorithm and the bone defect rois . the excised mandible sections were prepared for histology by dehydration in ascending concentrations of ethanol , followed by xylene at 4 and then embedding in poly(methyl methacrylate ) . the specimens were then cut and ground to 30-m thick sections using a diamond saw and microgrinder ( exakt technologies , oklahoma city , ok , usa ) . the sections were mounted on slides , stained with sanderson 's rapid bone stain , then counterstained with van gieson 's picrofuchsin to stain soft tissue blue and stain bone pink / red . next , 2.0 magnification histology slide images were acquired on an olympus szx16 research high - class stereo microscope ( olympus , center valley , pa , usa ) with an olympus dp71 microscope digital camera and compiled using photoshop ( version 7.0.1 ; adobe systems inc . high magnification images ( 40 and 100 ) were acquired on a nikon eclipse 55i research microscope with a ds - f11 digital camera ( nikon instruments inc . , significance in 64-slice ct measures was determined using a two - way anova ( across time and experimental group ) and tukey 's test for post - hoc evaluation when significance was found ( sigmaplot version 11.0 ; systat software inc . , san jose , ca , usa ) . in the case of the ct data , a paired t - test analysis was used to determine significant difference . in order to evaluate the healing potential of a defined mandibular bone notch defect , we introduced a 7.5 cm notch ( average size as determined by ct analysis ) on each side of the mandible in each of 5 dentally mature sinclair miniature pigs . the bone removed during both the right and the left defect creations was morselized , combined , and then placed into the left side defect , serving as autograft . the average size of the morselized particles was found to be 670 m by scanning electron microscopy analysis . bone healing in the pigs was assessed at 4 weeks post - surgery via ct scans and at 16 weeks post - surgery using ct , ct , and histological techniques . the use of clinical ct scans allowed us to monitor bone healing throughout the course of the experiment and compare bone regeneration at multiple time points . sixty - four slice ct scans were taken at 3 time points : immediately before the defect creation , at 4 weeks post - surgery , and at 16 weeks post - surgery . the bone volume to tissue volume 2 . a ; outlined in dotted line ) at 4 weeks post - surgery , measurement of bone volume based on ct scan data revealed an absence of mineralized tissue within both the autograft - treated ( 180.746.5 mm ) and untreated defect sites ( 265.3111.7 mm ) in all pigs . in both defect sites at 4 weeks , measurement of the bv / tv ratio showed significantly less bone volume compared to both the pre - surgery and 16 weeks post - surgery time points ( p<0.001).(fig . 2 . b ) at 16 weeks post - surgery , bone volume measurements showed substantial bone regeneration in both defects : the mean bone volume measured 2,487.2507.8 mm in the autograft - treated defect sites and 1,665.0335.7 mm in the untreated defect sites . moreover , in both sites , bone volume was approaching pre - surgical bone volume value ( 2,114.1 175.9 mm ) . irrespective of treatment , no significant intragroup differences in bone volume were found between presurgery and 16 weeks post - surgery time points . however , at 16 weeks , significantly higher bone volume was regenerated in the autograft - treated defects compared with the untreated defects ( p = 0.013).(fig . b ) these same trends in bone regeneration were observed in three - dimensional reconstructions of each hemi - mandible from a representative animal . 4 ) for the purpose of obtaining higher resolution data regarding the bone healing in this model , ct imaging was used to analyze bv / tv ratio in the defect space post - mortem . a. in the images of both the autograft - treated and untreated groups , significant bone growth was evident in the defect space . the superior margins of the defect were identifiable by white gutta - percha markers ( indicated by the two centermost single white dots ) . greater bone regeneration was seen at the posterior interface compared to the anterior interface of the notch in both groups ; this result was observed in all 5 pigs . quantification of the bv / tv ratio indicated that there was no significant difference between the autograft - treated and the untreated groups ; however , similar to the ct results , more bone was regenerated in the autograft - treated defect compared to the non - treated defect ( p=0.46).(fig . b ) furthermore , the results of the ct analysis were consistent with the clinical ct analysis in demonstrating significant bone volume regeneration in both the treated and untreated defect spaces . a high correlation exists between the ct and ct results ( r=0.83 ) . in order to detect calcified bone , fibrous tissue formation , and the presence of cellular activity , histological analysis was performed on the regenerated mandibular bone . for both the treated and untreated defects , the histological slides revealed intramembranous trabecular - like healing into the defect from the anterior , posterior , and superior walls.(fig . 6 ) in general , the autograft - treated defects had a greater extent of thin trabecular spindles penetrating deep into the defect space . the non - treated defects showed less bony invasion into the defect space ; however , the trabecular - like in - growth was observed to occur in dense bone fronts.(fig . 6 ) in all pigs , neither defect spaces contain healed dense bone bridging of the inferior cortex or restoration of the bony anatomy to its pre - surgical condition . during the histological analysis process , we noted significant bone regeneration in the marrow space , superior to the initial defect . this observation led to the further investigation of the bone remodeling adjacent to the defect sites . first , analysis of the 64-slice ct scans was performed using an alternate roi encompassing intact bone.(fig . 3 . a ; outlined in dashed lines ) compared to pre - surgery values , the roi superior to the surgical site had a significant increase in bone volume fraction at 4 weeks post - surgery ( p=0.013).(fig . b ) at 16 weeks post - surgery , there was a further significant increase in bone volume in the superior site ( p<0.001 ) . however , the increase in bone volume in this superior roi was associated with a decrease in bone mineral density : these values were significantly lower after 16 weeks compared to preoperative levels ( p=0.005).(fig . c ) together , these results suggest that the bone did in fact remodel to increase load - bearing ability and compensate for the lack of bone in the defect area . consistent with the ct analysis of the defect - superior roi , the histological slides showed that bone invaded the marrow space superior to all defect sites , regardless of the treatment ( apparent in fig . in order to evaluate the healing potential of a defined mandibular bone notch defect , we introduced a 7.5 cm notch ( average size as determined by ct analysis ) on each side of the mandible in each of 5 dentally mature sinclair miniature pigs . the bone removed during both the right and the left defect creations was morselized , combined , and then placed into the left side defect , serving as autograft . the average size of the morselized particles was found to be 670 m by scanning electron microscopy analysis . bone healing in the pigs was assessed at 4 weeks post - surgery via ct scans and at 16 weeks post - surgery using ct , ct , and histological techniques . the use of clinical ct scans allowed us to monitor bone healing throughout the course of the experiment and compare bone regeneration at multiple time points . sixty - four slice ct scans were taken at 3 time points : immediately before the defect creation , at 4 weeks post - surgery , and at 16 weeks post - surgery . the bone volume to tissue volume 2 . a ; outlined in dotted line ) at 4 weeks post - surgery , measurement of bone volume based on ct scan data revealed an absence of mineralized tissue within both the autograft - treated ( 180.746.5 mm ) and untreated defect sites ( 265.3111.7 mm ) in all pigs . in both defect sites at 4 weeks , measurement of the bv / tv ratio showed significantly less bone volume compared to both the pre - surgery and 16 weeks post - surgery time points ( p<0.001).(fig . 2 . b ) at 16 weeks post - surgery , bone volume measurements showed substantial bone regeneration in both defects : the mean bone volume measured 2,487.2507.8 mm in the autograft - treated defect sites and 1,665.0335.7 mm in the untreated defect sites . moreover , in both sites , bone volume was approaching pre - surgical bone volume value ( 2,114.1 175.9 mm ) . irrespective of treatment , no significant intragroup differences in bone volume were found between presurgery and 16 weeks post - surgery time points . however , at 16 weeks , significantly higher bone volume was regenerated in the autograft - treated defects compared with the untreated defects ( p = 0.013).(fig . b ) these same trends in bone regeneration were observed in three - dimensional reconstructions of each hemi - mandible from a representative animal . for the purpose of obtaining higher resolution data regarding the bone healing in this model , ct imaging was used to analyze bv / tv ratio in the defect space post - mortem . a. in the images of both the autograft - treated and untreated groups , significant bone growth was evident in the defect space . the superior margins of the defect were identifiable by white gutta - percha markers ( indicated by the two centermost single white dots ) . greater bone regeneration was seen at the posterior interface compared to the anterior interface of the notch in both groups ; this result was observed in all 5 pigs . quantification of the bv / tv ratio indicated that there was no significant difference between the autograft - treated and the untreated groups ; however , similar to the ct results , more bone was regenerated in the autograft - treated defect compared to the non - treated defect ( p=0.46).(fig . b ) furthermore , the results of the ct analysis were consistent with the clinical ct analysis in demonstrating significant bone volume regeneration in both the treated and untreated defect spaces . in order to detect calcified bone , fibrous tissue formation , and the presence of cellular activity , histological analysis was performed on the regenerated mandibular bone . for both the treated and untreated defects , the histological slides revealed intramembranous trabecular - like healing into the defect from the anterior , posterior , and superior walls.(fig . 6 ) in general , the autograft - treated defects had a greater extent of thin trabecular spindles penetrating deep into the defect space . the non - treated defects showed less bony invasion into the defect space ; however , the trabecular - like in - growth was observed to occur in dense bone fronts.(fig . 6 ) in all pigs , neither defect spaces contain healed dense bone bridging of the inferior cortex or restoration of the bony anatomy to its pre - surgical condition . during the histological analysis process , we noted significant bone regeneration in the marrow space , superior to the initial defect . this observation led to the further investigation of the bone remodeling adjacent to the defect sites . first , analysis of the 64-slice ct scans was performed using an alternate roi encompassing intact bone.(fig . 3 . a ; outlined in dashed lines ) compared to pre - surgery values , the roi superior to the surgical site had a significant increase in bone volume fraction at 4 weeks post - surgery ( p=0.013).(fig . b ) at 16 weeks post - surgery , there was a further significant increase in bone volume in the superior site ( p<0.001 ) . however , the increase in bone volume in this superior roi was associated with a decrease in bone mineral density : these values were significantly lower after 16 weeks compared to preoperative levels ( p=0.005).(fig . c ) together , these results suggest that the bone did in fact remodel to increase load - bearing ability and compensate for the lack of bone in the defect area . consistent with the ct analysis of the defect - superior roi , the histological slides showed that bone invaded the marrow space superior to all defect sites , regardless of the treatment ( apparent in fig . to ensure stringent pre - clinical evaluation of the healing capability of a novel bone regenerative biomaterial , ideally , the therapy is tested in a standardized csd model . due to the increasing reluctance to use companion animals for preclinical research and the stark differences between the masticatory biomechanics of sheep or goats and humans , cmf models in pigs have been favored . pigs demonstrate similarity to human bone in form , function , bone healing characteristics , and bone mineral density29 . still , the consensus on defining what constitutes a full thickness notch type model in the pig mandible has been limited . plug type bone defects ranging ( diameterdepth ) from 48 mm33 to 94 mm34 or 95 mm35 or notch type defects ranging in size from 2020 mm36 to 2010 mm37 have all been evaluated in the minipig mandible . these observations have been primarily histological in nature with limited quantifiable metrics to demonstrate differences between the healing patterns of autologous grafts ( positive controls ) and sham treated ( negative controls ) groups . spontaneous healing of the mandible post bone resection has also been clinically observed in patients383940 . this underlines the need for better characterization of healing patterns in the pig mandible models so that standardized interpretation of bone healing responses to novel bone graft materials is possible . in the current study , we aimed to validate the premise that a mandibular bone notch at least 6 cm in volume in sinclair miniature pigs can serve as a csd . the presence of considerable bone in the untreated defect ( average size in this study was 7.5 cm ) at 16 weeks indicates that this model does not meet the criteria to be defined as a csd . however , the absence of a significant healing response in either treatment group after 4 weeks suggests that this notch model could be used to investigate bone graft therapies that aim to accelerate the bone healing response . as a potential strategy to induce better bone regeneration by controlled mechanical stimulation , there is an increasingly greater emphasis on immediate implant placement and early loading41 ; techniques to accelerate new bone regeneration could prove critical to successful outcomes . in this study , measurement of bone regeneration indicated that both autograft - treated and untreated mandibular defects had very similar bone healing profiles . minimal mineralization had occurred in both the autograft - treated and the untreated notch defect sites over 4 weeks , followed by significant bone regeneration at 16 weeks . these observations suggest that , during the initial 4 week time period , the majority of the autograft was resorbed . since histological analyses were not performed at 4 weeks , we can not confirm if the autograft particles were undergoing fragmented remodeling , complete resorption , or only demineralization , each of which would have rendered them undetectable to clinical ct measurement . however , jensen et al.35 observed similar trends over 4 and 8 weeks using 1,000 to 2,000 m range autologous bone chips to treat three - wall defects in the mandibular angles of gottingen minipigs . the results of this study indicate that it is essential to include long - term evaluations of the healing response to biological bone graft particles in large animals . this may potentially apply to human treatments as well because bone regeneration and resorption of graft particles often proceed at varying rates . an additional known factor that plays a role in graft bone healing success is size of the bone particles used . pig bone particles in the range of 600 to 1,000 m have been tested clinically as xenografts to treat maxillary sinus defects . at 5 months post - treatment with this particle size xenograft , researchers found retention of graft and significant new bone formation42 . in the current study , we used a bone mill to create autologous bone graft chips that had an average size of 670 m , which is within the range reported as ideal for bone graft preparation procedures43 . while significant bone volume recovery was observed in the untreated defects and autologous graft treated groups after 16 weeks , there was very little structural maintenance of the original mandibular geometry . it has been previously reported that the bone in proximity of the injury site adapts and remodels to compensate for the weakness in the injury area44 . similar results were observed in this study , where the bone superior to the notch defect increased in volume , bulk , and thickness in 4 weeks and further in 16 weeks.(fig . 3 ) this observed increase in volume with concurrent decrease in mineral density suggests that the mandible undergoes significant remodeling due to the creation of the notch defect in the mandible body and may be compensating for the loss of load carrying capacity . similar to the loss of height and thickness in the alveolar ridge after the loss of dentition45 , this remodeling response in this model could be utilized when evaluating treatments attempting to maintain the original bone geometry , quality , and quantity necessary for implant restorations . it is critical for bone graft therapies to demonstrate not only on bone volume regeneration , but also maintenance of space and structure specific to the function of the cmf components . a systematic standardized evaluation of a ~7.5 cm mandibular bone notch defect model in the inferior margin of the miniature pig with periosteal resection was performed ; autologous bone graft treatments were compared to untreated defects . both experimental groups showed limited mineralized tissue within the defect site after 4 weeks , indicating that this model could be used to investigate therapies targeting accelerated bone regeneration at this early time point . however , the presence of significant bone within the defect site after 16 weeks in the untreated defect precludes the use of this model as a csd for bone graft evaluation . in order to appropriately investigate bone graft materials , future studies should include appropriate negative controls in their choice of bone defect in the pig mandible to ensure lack of a significant spontaneous regenerative response .

objectivesto validate a critical - size mandibular bone defect model in miniature pigs.materials and methodsbilateral notch defects were produced in the mandible of dentally mature miniature pigs . the right mandibular defect remained untreated while the left defect received an autograft . bone healing was evaluated by computed tomography ( ct ) at 4 and 16 weeks , and by micro - ct and non - decalcified histology at 16 weeks.resultsin both the untreated and autograft treated groups , mineralized tissue volume was reduced significantly at 4 weeks post - surgery , but was comparable to the pre - surgery levels after 16 weeks . after 16 weeks , ct analysis indicated that significantly greater bone was regenerated in the autograft treated defect than in the untreated defect ( p=0.013 ) . regardless of the treatment , the cortical bone was superior to the defect remodeled over 16 weeks to compensate for the notch defect.conclusionthe presence of considerable bone healing in both treated and untreated groups suggests that this model is inadequate as a critical - size defect . despite healing and adaptation , the original bone geometry and quality of the pre - injured mandible was not obtained . on the other hand , this model is justified for evaluating accelerated healing and mitigating the bone remodeling response , which are both important considerations for dental implant restorations .

in most teleost fishes head kidney , pronephros plays an important role as main hematopoietic organ and blood cell reservoir ( fange 1994 ; houston et al . 1996 ; fijan 2002a , b ; romano et al . 2004 ; rombout et al . 2005 ; gangopadhyay and homechaudhuri 2011 ) . according to wendelaar bonga ( 1997 ) and weyts et al . ( 1999 ) , pronephros shows not only hematopoietic activity but also is a lymphoid and endocrine organ . however , head kidney is not the only site of hematopoiesis in fish . according to various authors ( glomski et al . 1996 ; kobayashi et al . 2006 , 2007 , 2008 ; zapata et al . 2006 2007 and santos et al . 2011 ) , other organs such as spleen , gut - associated lymphoid tissue ( galt ) , mucosa - associated lymphoid tissue ( malt ) , and intertubular tissue of trunk kidney ( mesonephros ) may also show hematopoietic activity . in some fish species , several hematopoietic organs are active , while in the others only one of them ( liu et al . morphology of hematopoietic tissue in fish is quite well known ( e.g. , fange 1994 ; 2002a , b ) , but little information is available on the effects of environmental factors on its structure and activity , and studies of hematopoietic tissue are seldom included in evaluation of physiological effects of toxic agents on fish . hematopoietic activity of head kidney tissue involves proliferation of stem cells and early precursors of all cell lines , differentiation and maturation , as well as apoptosis , and the rate of all these processes is a key factor that determines efficiency of hematopoiesis . stem cell renewal and precursor cell proliferation are counterbalanced by apoptosis in functionally inactive or terminally differentiated cells ( mckenna and cotter 1997 ) . apoptosis plays an important role in regulating early progenitor and stem cells , and particularly for the development and function of lymphoid cells ( domen 2000 ) . the marker protein of apoptosis is caspase 3an enzyme participating in degradation of nuclear and cytoplasmic proteins during this process . this caspase is commonly defined as effector caspase ( migliarini et al . 2005 ) . evaluation of both precursor cell proliferation and apoptosis rate is applied in hematological studies to evaluate the rate of cell turnover and hematopoietic activity ( thiele et al . have been proved to react with mammalian ( mouse or rabbit ) monoclonal antibodies , and these antibodies were successfully used for evaluation of proliferation and apoptosis of various cells in thalassoma pavo ( monteiro et al . 2009 ) , oreochromis niloticus ( brunelli et al . 2011 ) , and salmo salar ( yousaf et al . cadmium and copper are well known to induce hematotoxicity in fish , often resulting in anemia and immunosuppression ( e.g. , svobodova et al . 2004 ; seong - gil et al . 2004 ; ates et al . 2008 ; witeska et al . sometimes the values of hematological parameters of intoxicated fish fluctuate , and their changes are not always directly related to metal concentrations and time of exposure or time post - exposure ( ruparelia et al . these fluctuations may result from translocation of cadmium and copper within the organism , and their toxic action on various functions at different time . cadmium and copper probably affect not only circulating blood cells , but also newly developing ones in hematopoietic tissue . very scarce data concerning hematopoietic effects of heavy metals in fish ( garofano and hirshfield 1982 ; ghosh et al . 2007 ; som et al . 2009 ) and mammals ( lutton et al . 1984 ; mitsumori et al . 1998 ; van den heuvel et al . 1999 ; 2001 ; celik et al . 2005 , 2009 ) indicate that they are cytotoxic to precursor cells , and various cell lineages show different sensitivity to metal toxicity . the aim of present study was to evaluate the effects of copper and cadmium under various exposure conditions ( concentration and time ) on hematopoietic potential of common carp head kidney . common carp ( cyprinus carpio l. ) 6-month - old juveniles of body mass 21.5 8.3 g were harvested in october from the rearing ponds of the inland fisheries institute in abieniec and brought to the department of animal physiology , university of natural sciences and humanities in siedlce in plastic bags with water and supplied with pure oxygen . before the experiment , the fish were acclimated for 4 weeks to the laboratory conditions in the flow - through tank , at 1718 c . water was constantly aerated , and o2 concentration was 6.18.0 mg / dm of o2 ( 6687 % saturation ) , while concentration of no2 0.020.06 mg / dm , and nh4 4.67.1 mg / dm . the fish were fed aller aqua classic 4 mm feed at the rate of 2 % of stock mass per day . prior to the experiment survival tests were performed , and 96hlc50 values were calculated using the probit method for both metals . fish were exposed for 3 h to cd and cu concentrations equal to 100 % of 96hlc50 ( 6.50 and 0.75 mg / dm for cd and cu , respectively)groups cd - s and cu - s or for 4 weeks to 10 % of 96hlc50 ( 0.65 and 0.075 mg / dm , respectively)groups cd - l and cu - l . control group ( c ) was kept in clean tap water ( < 0.31 g / dm of cd , 233 g / dm of cu ) . experimental solutions were made using cdcl2 2 h2o and cuso4 5h2o , and 3/4 was renewed everyday without disturbing fish . the fish were kept in 100 dm aerated tanks ( 10 fish in each ) , and fed aller aqua classic 4 mm ( 1 % of stock mass , once a day before water renewal ) . five fish were sampled weekly for 4 weeks from each experimental group and killed for head kidney isolation . water quality parameters were measured everyday ( table 1 ) using portable do meter ( hanna instruments hi 9143 ) , ph meter ( elwro prl tn 5123 ) , and kits for nitrogen metabolites ( visocolor ammonium 0,210 mg / dm and visocolor nitrite 0,052 mg / dm , machery nagel ) . water hardness values were provided by the water supplier ( www.pwik.siedlce.pl).table 1water quality parameters during the experimentparametergroupccu - s + cu - lcd - s + cd - ltemperature ( c)17.0 0.517.1 0.517.2 0.6hardness ( mg / dm caco3)179198ph6.87.0o2 ( mg / dm)8.9 0.69.0 0.28.8 0.5no2 ( mg / dm)0.03 0.010.06 0.020.04 0.02nh4 ( mg / dm)3.9 0.65.2 0.86.1 1.6 water quality parameters during the experiment five fish were sampled weekly for 4 weeks from each experimental group and killed for head kidney isolation . the kidneys were sliced and smeared on degreased slides and dried at room temperature for 24 h. two preparations from each fish were stained giemsa and may - grunwald for cytological analysis . hematopoietic precursor cells were identified ( 22 types of cells , according to fijan 2002a , b , and kondera 2011 ) . immunocytochemical staining was also performed to identify proliferating cells ( showing pcna ) , and cells undergoing apoptosis ( showing caspase 3 ) using monoclonal mouse antibodies anti - proliferating cell nuclear antigen clone pc 10 ( dako cytomation ) selectively binding to the pcna antigen , and anti - caspase 3 ( active ) antibody produced in rabbit , ( sigma ) binding to active caspase 3 . dried preparations were hydrated with deionized water , and then peroxidase activity was blocked using 3 % h2o2 ( trace pur , merck ) . the antibody solution diluted 1:300 was applied and left on slides for 1 h at room temperature . cells with antibody protein complexes were visualized using dako cytomation en vision + system - hrp for use with mouse primary antibodies , and dako cytomation en vision + system - hrp for use with rabbit primary antibodies , respectively , according to the producer s instruction . the pcna - positive and caspase 3-positive cells stained brownish and were easily distinguishable from other cells ( stained light blue with hematoxylin ) . negative control staining was also performed ( the preparations were treated the same way except for incubation with antibodies ) and resulted in no color reaction . the cells were counted in at least 6 fields , and percentage of proliferating and apoptotic cells was calculated per 300 cells in each preparation . all preparations were preserved with histokitt , glaswarenfabrik karl hecht gmbh germany , covered with cover glass , and viewed using nikon eclipse e600 microscope at 1,000 magnification . eclipse e600 microscope connected with digital nikon coolpix camera and computer image analysis system coolview ( precoptic , poland ) . the results were subjected to statistical evaluation of significance of differences in values of all parameters between the control and metal - exposed groups using mann the study obtained agreement of the iii local ethical committee at the warsaw university of life sciences ( no 41/2008 ) . both metals induced significant changes in frequency of blast cells , as well as proliferating and apoptotic precursors . short - term exposures to cd and cu resulted in an increase in the frequency of early blast cells in head kidney of carp in 1 week after the treatments ( figs . 1 , 2 ) . the level of blasts in cd - s fish remained significantly elevated until the 3-week post - exposure , while in cu - s group decreased already in the 2 weeks . on the contrary , during long - term exposure , cd induced only transient increase in blast frequency ( 3 weeks ) , while the fish from cu - l group showed significantly elevated level of early blast cells beginning from the 2 weeks of exposure until the end of the experiment.fig . 1the effects of cd and cu on the frequency of early blast cells in head kidney hematopoietic tissue of common carp ( arithmetic mean s.e . , * different from the value before metal exposure ( time 0 ) , p 0.05 , u mann whitney test ) . cd - s , cu - s and cd - l , cu - l groups subjected to short- or long - term exposures , respectivelyfig . 2early blast cells the effects of cd and cu on the frequency of early blast cells in head kidney hematopoietic tissue of common carp ( arithmetic mean s.e . , * different from the value before metal exposure ( time 0 ) , p 0.05 , u mann whitney test ) . cd - s , cu - s and cd - l , cu - l groups subjected to short- or long - term exposures , respectively similarly , also the frequency of proliferating ( pcna - positive ) cells significantly increased in 1 week after short - term exposures ( fig . 3 , 4 ) . in cd - s group , the level of cells undergoing mitosis remained elevated until the 2-week post - exposure , while in cu - s proliferation rate quickly decreased to the control level . during long - term cd exposure , a significant increase in precursor cell proliferation took place in 2 weeks , and their level remained elevated until the end of the experiment . the reaction of fish from cu - l group was different : a significant increase in frequency of proliferating cells took place at the end of the experiment ( in 4 weeks of exposure).fig . 3the effects of cd and cu on the frequency of proliferating cells in common carp head kidney hematopoietic tissue ( arithmetic mean s.e . , * different from the value before metal exposure ( time 0 ) , p 0.05 , u mann whitney test ) . cd - s , cu - s and cd - l , cu - l groups subjected to short- or long - term exposures , respectivelyfig . 4pcna - positive cells the effects of cd and cu on the frequency of proliferating cells in common carp head kidney hematopoietic tissue ( arithmetic mean s.e . , * different from the value before metal exposure ( time 0 ) , p 0.05 , u mann whitney test ) . cu - l groups subjected to short- or long - term exposures , respectively both metals induced a significant increase in the frequency of apoptosis of hematopoietic precursor cells ( fig . 5 , 6 ) . both short - term and long - term exposures caused similar effects , but in case of cd exposures , the reaction was more pronounced.fig . 5the effects of cd and cu on the frequency of apoptotic cells in common carp head kidney hematopoietic tissue ( arithmetic mean s.e . , * different from the value before metal exposure ( time 0 ) , p 0.05 , u mann whitney test ) . cd - s , cu - s and cd - l , cu - l groups subjected to short- or long - term exposures , respectivelyfig . 6caspase 3-positive cells the effects of cd and cu on the frequency of apoptotic cells in common carp head kidney hematopoietic tissue ( arithmetic mean s.e . , * different from the value before metal exposure ( time 0 ) , p 0.05 , u mann whitney test ) . cd - s , cu - s and cd - l , cu - l groups subjected to short- or long - term exposures , respectively caspase 3-positive cells these changes resulted in a reduction of hematopoietic potential in all metal - exposed fish , measured as the ratio of frequencies of precursor cell proliferation and apoptosis ( fig . 7 ) . it is noteworthy that in case of short - term copper exposure , reduction in hematopoietic activity at the end of the experiment was deeper than in group subjected to short - term cadmium intoxication or to fish subjected to a long - term copper treatment . however , in all cases , hematopoietic activity was over than 1 showing that the frequency of proliferating cells was all the higher than percentage of precursors undergoing apoptosis.fig . 7the effects of cd and cu on cell turnover rate in common carp head kidney hematopoietic tissue ( arithmetic mean s.e . , * different from the value before metal exposure ( time 0 ) , p 0.05 , u mann whitney test ) . cd - s , cu - s and cd - l , cu - l groups subjected to short- or long - term exposures , respectively the effects of cd and cu on cell turnover rate in common carp head kidney hematopoietic tissue ( arithmetic mean s.e . , * different from the value before metal exposure ( time 0 ) , p 0.05 , u mann whitney test ) . cd - s , cu - s and cd - l , cu - l groups subjected to short- or long - term exposures , respectively the obtained results show that cadmium and copper disturbed hematopoiesis in carp but on the other hand indicate a considerable compensatory potential of carp hematopoietic system . the pattern of changes after short - term exposures ( a rapid increase in cell proliferation rate and early blast frequency , accompanied by an increase in apoptotic rate ) and during long - term treatments ( gradual increase in the values of these parameters during the exposures ) was different but the final effect reduction in cell turnover rate was very similar . the increase in apoptotic rate was higher when compared to acceleration of precursor cell proliferation . no anemia was observed in peripheral blood or a significant reduction in leukocyte count , and the most pronounced effect of metal exposures was significantly reduced frequency of peripheral phagocytes ( neutrophils and monocytes ) , accompanied by reduction in their metabolic activity ( kondera and witeska 2012 , and unpublished data of the same study ) . these results indicate that hematopoietic potential of carp head kidney tissue was reduced due to the increase in apoptotic cell destruction since no necrosis or other visible cell damage was observed . hematological effects of heavy metal intoxication of fish were extensively studied , but very little data concerning metal - induced alterations in hematopoietic system are available . according to garofano and hirshfield ( 1982 ) , 2-h exposure of ictalurus nebulosus at 61.3 mg / dm of cd resulted in complete destruction and elimination of all hematopoietic precursor cells in head kidney hematopoietic tissue over 24-h post - exposure , and the only cells present after intoxication were mature erythrocytes . also , saxena et al . considerable hematopoietic disturbances were also observed in labeo rohita subjected to cu treatment : 50 % 72hlc5025 mg / dm cu or 100 % 72hlc5050 mg / dm cu ( som et al . 2009 ) . sublethal exposure resulted in an increase of abundance of both erythrocyte and leukocyte precursors in head kidney hematopoietic tissue , while under lethal conditions , their number initially decreased , and then increased until the end of the experiment . the authors also observed an increase in blast cell abundance in cu - exposed fish . studies of the effects of metals on hematopoietic tissue of other vertebrates also show their hematotoxic potential . reduction of hematopoietic potential that resulted in anemia was observed in cadmium - treated rat ( mitsumori et al . the results of in vitro study revealed that cadmium , lead , and silver adversely affected erythropoiesis in rat bone marrow ( lutton et al . ( 1999 , 2001 ) observed that cadmium was more toxic to human and murine hematopoietic progenitor cells than lead , erythroid cell being more sensitive than myeloid precursors . ( 2005 , 2009 ) reported genotoxic and cytotoxic action of cadmium upon erythroid cells in rat bone marrow . almost no data are available on the effects of heavy metals on proliferative and apoptotic activity of fish hematopoietic tissue . ( 2009 ) who observed an increase in labeo rohita blast cell apoptosis during both lethal and sublethal cu exposures , while their proliferation rate increased only under sublethal conditions . there are , however , some data showing the effects of cadmium and copper on proliferative and apoptotic activity in other fish tissues . according to brunelli et al . ( 2011 ) , cadmium induced increase in proliferation and apoptosis rates in gill epithelium of thalassoma pavo which was followed by a decrease . ( 1999 ) reported a significant increase in proliferation and apoptosis rate of intestine epithelial cells of salmo salar fed cd - containing feed . activation of both cell proliferation and apoptosis in the intestine of liza aurata from metal - polluted natural environment was also reported by ferrando et al . ( 2011 ) , an increase in cell proliferation rate in cadmium - exposed s. salar and sparus aurata may be a protective mechanism reducing adverse effect of metal on fish tissues . according to hernandez et al . ( 2011 ) , danio rerio larvae subjected to 19.5 mg / dm of cuso4 for 2 h showed an increase in frequency of apoptosis of various types of cells , head kidney cells being more sensitive than brain neurons and gill epithelial cells . monteiro et al . ( 2009 ) reported an increase in proliferation rate of gill epithelial cells in cu - exposed oreochromis niloticus which was not accompanied by activation of apoptosis . massive mitotic activity was detected using pcna immunostaining in olfactory epithelium of tilapia mariae following 4-day exposure to 20100 g / dm of cu ( bettini et al . these observations confirm that cell proliferation is involved in tissue regeneration after metal - induced damage . metal - induced activation of cell proliferation and apoptosis was reported also in mammals . according to habeebu et al . ( 1998 ) , cadmium induced a dose- and time - dependent activation of murine hepatocyte proliferation and apoptosis . tsangaris and tzortzatou - stathoupoulou ( 1998 ) observed that cadmium induced apoptosis of human immune cells , b lymphocytes being more sensitive than t cells and lymphoblasts . the data obtained in the present study indicate that cadmium and copper may affect hematological and immune status of fish organism by disturbing the process of hematopoiesis . hematopoietic precursor cells are sensitive to intoxication and heavy metals enhance the rate of their apoptotic destruction . on the other hand , hematopoietic system of carp shows high homeostatic potential and tends to compensate cell loss by activation of mitotic divisions . the results showed that toxic effects of both metals were persistent and hematopoietic activity reduced after short - term exposures to cadmium and copper did not recover in 4-week post - treatment . they also showed that low sublethal concentrations of cadmium , and particularly of copper may significantly disturb hematopoietic processes in fish that do not show any other symptoms of intoxication . in conclusion , anemia and immunosuppression often observed in fish intoxicated with copper and cadmium may result from toxic effect of metals on hematopoietic system . additionally , cellular parameters of hematopoietic tissue : frequency of blast cells and the rate of proliferation and apoptosis are sensitive indicators of sublethal intoxication .

the effects of cadmium and copper on activity of common carp head kidney hematopoietic tissue were evaluated . the fish were subjected to short - term ( 3 h , cd - s and cu - s ) or long - term ( 4 weeks , cd - l and cu - l ) exposures to 100 % 96hlc50 or 10 % 96hlc50 , respectively . head kidneys were isolated weekly from 5 fish of each group for 4 weeks ( post - short - term exposure and during long - term exposure ) . percentage of early blast cells among the hematopoietic precursors was calculated . proliferative and apoptotic activity were evaluated using immunocytochemical staining for proliferating cell nuclear antigen ( pcna ) and caspase 3 , respectively . hematopoietic activity was calculated as the ratio of proliferating to apoptotic cells . all metal exposures induced an increase in frequency of early blast cells . the frequency of proliferating ( pcna - positive ) cells also significantly increased . a considerable and significant increase in the frequency of apoptotic cells was the most pronounced effect of metal exposures . both short - term and long - term treatments caused similar effects , but in case of cd exposures , the reaction was more pronounced . all metal exposures reduced hematopoietic potential of fish measured as the ratio of proliferating to apoptotic precursor cell frequency . however , in all cases , hematopoietic activity was higher than 1 showing that the rate of repair of hematopoietic tissue prevailed over destruction .

study sites - north sinai is located in the northeastern part of egypt ( 30.5n 33.6e ) , marking the point of connection between asia and africa . north sinai is bordered by the gulf of suez , the red sea and the mediterranean sea and is inhabited mainly by bedouins . the regions comprise the following districts : el - hassana , beer el abd , nekhel , sheikh zuweid , beer lehfen and rafah ( fig . 1 ) . the study sites were selected based on the distribution of cl cases in sinai to understand the potential role of both the sandfly and rodent in the dynamics of leishmania transmission ( samy 2009 , ministry of health of egypt , unpublished observations ) . the weather in north sinai is characterised as hot and dry , with marked differences in temperature between day and night . dramatic weather - related changes , as presented by the annual averages of environmental factors during the study period from january 2005-december 2011 , are listed in supplementary data and some habitats are illustrated in fig . 2 . fig . 1 : regional and local map of the study sites in north sinai . the six districts of north sinai are denoted by black dots and egypt with the black solid line . 2 : sampling localities showing different habitat types . a : wire - box rodent traps used during the study with an individual rodent collected during the study ; b : rodent burrows ; c : habitat of low hygiene support rodent and sandfly populations ; d : a sample of the outdoor habitats sampled in the study . sandfly collection and processing - sandfly collection was carried out using sticky paper traps and cdc light traps ( lt ) ( john w hock , gainesville , fl , usa ) for eight nights / year . five collection sites were selected randomly to represent each district in the study ; 10 cdc lt and 50 sticky traps ( st ) were used for each study district ( 2 cdc and 10 st / collection site ) . the collection sites were chosen to represent the most productive ones for fly capture based on our preliminary studies conducted in different sites of sinai . the recovered st were placed in labelled plastic bags , transported to a temporary field laboratory and then sent to the research and training centre laboratory ( rtc ) of ain shams university , cairo for processing . the live flies captured by the cdc traps were collected with a mechanical aspirator and dissected in saline with 50 u / ml of amikacin sulphate on a glass slide . the digestive tract was examined under an optical microscope with 400x magnification to identify flies harbouring parasites in their gut and for species identification via morphological keys ( lane 1986 ) . female digestive tracts that had flagellates were transferred to an eppendorf tube with saline containing 50 u / ml of amikacin sulphate and then inoculated into novy mac neal nicolle ( nnn ) culture medium . rodent trapping and processing - rodents were trapped using wire - box rodent traps ( morsy et al . each district was represented by five - eight collection sites where 10 - 18 traps each were used ; the traps were set before sunset and recovered the next morning . the rodents were identified using regional taxonomic keys ( osborn & helmy 1980 ) and then transported to the ain shams animal facility where they were maintained for at least six months to observe the development of any characteristic leishmania lesions . full - thickness punch - biopsies were removed from the border of suspected lesions and processed for parasite isolation in nnn medium . giemsa - stained impression smears were also performed for the lesions and examined for the presence of leishmania amastigotes ( soliman 2006 ) . all care and use of animals was conducted in compliance with the animal welfare act and in accordance with the principles set forth in the guide for the care and use of laboratory animals , institute of laboratory guiding principles for biomedical research involving animals ( cioms 1985 ) . molecular characterisation of leishmania cultures - isolates from rodents and sandflies with suspected leishmania parasites were initially inoculated from tissue samples and maintained in culture medium through subculture passages in nnn culture medium with 500 iu penicillin g / ml of blood . promastigotes from positive cultures were transferred to glass vials containing schneider s drosophila cell culture medium supplemented with 10% fetal calf serum ( sigma , saint louis , mo , usa and gibco - brl , gaithersburg , md , usa ) for mass rearing . one millilitre of each high - density ( ~1 x 10 cells ml ) leishmania culture was concentrated by centrifugation at 12,000 g for 10 min . dna was extracted from the pellet using the qiagen dna mini kit ( qiagen , valencia , ca , usa ) . approximately 25 l of the culture pellet was transferred to a sterile 1.5 ml tube , extracted as per the protocol instructions and eluted in 100 l elution buffer . the ribosomal its-1 was amplified using the primer pair l5.8s and litsr ( el tai et al . amplicons were analysed on 1.5% agarose gels by electrophoresis and visualised by ultraviolet light . a reaction was considered positive when a band of the correct size ( 300 - 350 bp ) was observed . the polymerase chain reaction ( pcr ) product was digested with the restriction endonuclease haeiii . the restriction fragment length polymorphism - pcr approach was applied for the detection and identification of leishmania parasites in the rodent and sandfly isolates . fragments were separated by electrophoresis on 2.5% agarose gels and compared with those of reference strains of l. major ( mhom / eg/06/rtc-63 ) and l. tropica ( mger / eg/06/rtc-74 ) using distilled water as a negative control . . 1997 ) was used to estimate the biodiversity index for both the sandfly and rodent populations . the bray - curtis similarity was used in cluster analysis to estimate the similarity between the sandfly or rodent populations across different districts of north sinai , egypt . chi - squared analysis was used to test the deviation of the resulting fly sex ratios ( female : male ) from the expected 1:1 ratio . ethics - verbal informed consent was obtained from the heads of the households from which sandflies were collected . we provided detailed information about the vector - borne diseases with a special focus on leishmaniasis risk , vectors and reservoirs in language understandable to the local bedouins communities . we also provided information for community - based control measures to help the communities to protect themselves against disease risk . the views expressed in this article are those of the authors and do not necessarily reflect the official policy or position of the egyptian or the united states of america government . the experiments reported herein were conducted in compliance with the animal welfare act and in accordance with the principles set forth in the guide for the care and use of laboratory animals , institute of laboratory animals resources , national research council , national academy press and council for international organizations of medical sciences . sandfly species composition - a total of 9,849 sandflies were collected from different districts during the study ( table i ) on 56 nights using 480 cdc and 2,800 st . males comprised 62.8% ( n = 6184 ) of the catch ( female : male ratio of 0.6 ) . a total of 23.3% ( 404 males , 1,892 females ) of the collected flies were caught indoors and the rest of the flies were caught outdoors and from around the rodent burrows . these flies represented six species of two genera : p. ( phlebotomus ) papatasi ( scopoli ) , phlebotomus ( paraphlebotomus ) kazeruni ( theodor & mesghali ) , p. ( paraphlebotomus ) sergenti ( parrot ) , phlebotomus ( paraphlebotomus ) ale- xandri ( sinton ) , sergentomyia ( sergentomyia ) antennata ( newst . ) and sergentomyia ( sintonius ) clydei ( sinton ) . the predominant species was p. papatasi ( 83.5 % , 8,221 flies ) , whereas p. sergenti and p. kazeruni represented 9% and 3.3% of the total , respectively . p. alexandri , the vl vector , represented only 1% and was found in limited distribution in nekhel . table iphlebotomine sandflies collected by cdc light traps ( lt ) and sticky paper traps ( st ) from six districts of north sinai , egypt , from january 2005-december 2011 number of collected flies ( f : m ) speciescollection methodel hassananekhelrafahbeer el abdbeer lehfenseikh zuweidtotalratio ( f : m ) phlebotomus papatasi lt383/142813/156966/23117/44546/35831/172,756/9482.9:1st141/1,069121/85585/1,33625/6988/6634/61464/4,0531:8.7 phlebotomus kazeruni ltna / na29/17na / nana / nana / nana / na29/171.7:1stna / na52/225na / nana / nana / nana / na52/2251:4.3 phlebotomus sergenti lt24/2345/12614/73na / na5/17na / na88/2391:2.7st2/9881/22177/43na / na2/37na / na162/3991:2.4 phlebotomus alexandri ltna / na26/43na / nana / nana / nana / na26/431:1.6stna / na0/33na / nana / nana / nana / na0/330 sergentomyia antennata lt3/14/40/23/70/1na / na10/151:1.5st1/2027/331/44/190/12na / na33/881:2.7 sergentomyia clydei lt1/2na / nana / na3/6na / nana / na4/81:2st10/2118/292/1510/471/4na / na41/1161:2.8 totallt411/168917/346980/30623/57551/37631/172,913/1,2702.3:1st154/1,208299/1,396165/1,39839/13591/7164/61752/4,9141:6.5f : female ; m : male ; na : not available . sandfly sex ratios - sex ratios ( females : males ) showed that males were overall approximately twice as common , with an overall sex ratio of 1:1.7 . there was a difference between the sex ratios of different sandfly species using both trapping methods ; the cdc traps collected more females than males for both the p. papatasi and p. kazeruni collections , but more males were collected from both species when the sticky paper traps were used ( table i ) . both trapping methods collected more males of p. sergenti , p. alexandri , s. antennata and s. clydei . the chi - squared analysis revealed a significant difference ( p = 0.00 ) between the overall sex ratio ( female : male ) and the equilibrium 1:1 sex ratio for all species , except with regard to the cdc collection of p. kazeruni ( p = 0.08 ) , s. antennata ( p = 0.32 ) and s. clydei ( p = 0.25 ) . sandfly natural infection - the results of sandfly dissections revealed the presence of leishmania - like flagellates in 15 p. papatasi specimens ( 0.5% of 3,008 dissected females ) . none of the p. kazeruni , p. sergenti and p. alexandri individuals were infected ( table ii ) . there was a significant difference in the infection rate between the different districts ( p < 0.05 ) ; the highest infection rates were in beer lehfen ( 0.73% ) and rafah ( 0.72% ) , whereas the infection rates in nekhel and el - hassana were low ( 0.37% and 0.26% , respectively ) . all the females collected from beer el abd and sheikh zuweid were negative for infection . the leishmania - like flagellates were inoculated into nnn medium and the parasites survived in only six out of 15 culture passages . table iinumber and species of phlebotomus ( ) dissected and naturally infected with leishmania major in different districts of north sinai , egypt , from 2005 - 2011speciesel hassana n ( % ) nekhel n ( % ) rafah n ( % ) beer el abd n ( % ) beer lehfen n ( % ) sheikh zuweid n ( % ) phlebotomus papatasi 383 ( 0.26)813 ( 0.37)966 ( 0.72)17 ( 0)546 ( 0.73)31 ( 0 ) phlebotomus kazeruni 0 ( 0)29 ( 0)0 ( 0)0 ( 0)0 ( 0)0 ( 0 ) phlebotomus sergenti 24 ( 0)126 ( 0)73 ( 0)0 ( 0)5 ( 0)0 ( 0 ) phlebotomus alexandri 0 ( 0)26 ( 0)0 ( 0)0 ( 0)0 ( 0)0 ( 0 ) total407 ( 0.24)994 ( 0.30)1,039 ( 0.67)17 ( 0)551 ( 0.72)31 ( 0 ) rodent species composition and natural infections - a total of 159 individual rodents were collected from different districts ( table iii ) . these rodents represented eight species : rattus norvegicus ( n = 39 ) , rattus rattus frugivorous ( n = 13 ) , rattus rattus alexandrinus ( n = 4 ) , gerbillus pyramidum floweri ( n = 38 ) , gerbillus andersoni ( n = 28 ) , mus musculus ( n = 5 ) , meriones sacramenti ( n = 22 ) and meriones crassus ( n = 10 ) . thirty - two rodents were found to be positive for infection by amastigote impression smear testing : g. p. floweri ( n = 16 ) , g. andersoni ( n = 5 ) , r. norvegicus ( n = 7 ) , r. r. frugivorous ( n = 3 ) and r. r. alexandrinus ( n = 1 ) ( table iii ) . none of the m. musculus , m. sacramenti and m. crassus specimens were positive for leishmania infection . the infected rodents included rodents collected from el - hassana ( 1 r. r. alexandrinus ) , rafah ( 7 r. norvegicus , 14 g. p. floweri and 5 g. andersoni ) and beer lehfen ( 3 r. r. frugivorous and 2 g. p. floweri ) . no positive infections were found in the rodents collected from the nekhel , beer el - abd and sheikh zuweid . all rodent samples were inoculated into nnn medium and the parasites survived in 29 out of 32 culture passages . table iiinumber of rodents trapped in different districts of north sinai , egypt , from 2005 - 2011 and infection percentages with leishmania speciesel hassana n ( % ) nekhel n ( % ) rafah n ( % ) beer el abd n ( % ) beer lehfen n ( % ) sheikh zuweid n ( % ) total n ( % ) rattus norvegicus 1 ( 0)0 ( 0)34 ( 20.58)1 ( 0)0 ( 0)3 ( 0)39 ( 18 ) rattus rattus frugivorous 2 ( 0)1 ( 0)0 ( 0)1 ( 0)9 ( 33.33)0 ( 0)13 ( 23.07 ) rattus rattus alexandrinus 3 ( 33.33)1 ( 0)0 ( 0)0 ( 0)0 ( 0)0 ( 0)4 ( 25 ) gerbillus pyramidum floweri 0 ( 0)0 ( 0)31 ( 45.16)0 ( 0)7 ( 28.57)0 ( 0)38 ( 42.10 ) gerbillus andersoni 0 ( 0)0 ( 0)23 ( 21.74)0 ( 0)1 ( 0)4 ( 0)28 ( 17.85 ) mus musculus 2 ( 0)1 ( 0)1 ( 0)0 ( 0)0 ( 0)1 ( 0)5 ( 0 ) meriones sacramenti 0 ( 0)0 ( 0)19 ( 0)0 ( 0)3 ( 0)0 ( 0)22 ( 0 ) meriones crassus 0 ( 0)0 ( 0)8 ( 0)0 ( 0)1 ( 0)1 ( 0)10 ( 0 ) total8 ( 12.5)3 ( 0)116 ( 22.41)2 ( 0)21 ( 21.73)9 ( 0)159 ( 20.12 ) sandfly , rodent diversity and habitat clustering : sandfly species diversity - both simpson diversity and berger - parker dominance indices revealed different diversity between the different districts , with the highest overall diversity in nehkel and beer el abd ; the least diverse site was sheikh zuweid , where p. papatasi was the only species occurring at this site ( fig . 3 : biodiversity index of both the sandfly and rodent populations collected from six districts of north sinai . a : the simpson ( 1-d ) and berger - parker dominance biodiversity index for the sandfly species ( 1/d ) ; b : the shannon ( h ) and berger - parker dominance biodiversity index for the rodent species . rodent species diversity - all districts sampled in the study had a different diversity index based on both shannon ( h ) and berger - parker dominance indices of rodent populations ( fig . the highest overall diversity index was that of rafah ( 1/d = 3.412 , h both nekhel and beer lehfen had higher diversity indices compared to el - hassana , beer el abd and sheikh zuweid . habitat clustering - bray curtis cluster analysis of the different districts in north sinai revealed levels of similarity between the habitats clusters . based on the sandflies collected from the different districts , two clusters were identified : sheikh zuweid and beer el abd formed a distinct cluster separated from the rest of the districts , which comprised a different cluster ( fig . however , the cluster analysis based on rodent data revealed different cluster patterns than those produced by the sandfly data , with both beer lehfen and rafah forming a distinct cluster and the other districts comprising another cluster in which beer el abd was separated from the lower part of the core ( fig . 4b ) . finally , the bray curtis analysis for the combination of the sandfly and rodent data formed two distinct clusters : one included both sheikh zuweid and beer el abd and the second cluster included the other districts , with rafah separated from the lower part of the core ( fig . 4 : dendrogram from bray - curtis cluster analysis based on the sandfly populations data ( a ) , rodents populations data in six districts of sinai peninsula ( b ) and both the sandfly and rodents populations data ( c ) . leishmania identification and characterisation - thirty - five samples from both the infected sandfly p. papatasi ( n = 6 ) and rodent reservoirs ( n = 29 ) produced viable cultures in nnn medium . these samples were found to be positive for l. major dna only ( supplementary data ) . twenty - nine rodent samples found to be positive for l. major were r. norvegicus ( n = 7 ) , r. r. frugivorous ( n = 3 ) , r. r. alexandrinus ( n = 1 ) , g. p. floweri ( n = 13 ) and g. andersoni ( n = 5 ) . all l. major - infected rodents were collected from the rafah ( n = 23 ) , beer lehfen ( n = 5 ) and el - hassana ( n = 1 ) , with no evidence for the presence of infections in the beer el abd , nekhel and sheikh zuweid . this study represents a comprehensive report of seven years in north sinai and provides evidence for the circulation of only one species of the leishmania parasite . previous studies in egypt reported the presence of only l. major circulating in sinai ( wahba et al . 2003 ) , though the most recent study in sinai reported the incursion of cl caused by l. tropica in a remote border area of north sinai on the egyptian - palestinian border . the possibility of the incursion of l. tropica from neighbouring countries could not be excluded according to a recent study ( shehata et al . therefore , we carried out our study to reveal insight into the ecological system for cl transmission with regard to sandflies and rodents by examining of several criteria used by the who to implicate either the vector(s ) or reservoir(s ) . there are several criteria adopted by the world health organization ( who ) to implicate p. papatasi as the potential vector for circulation of leishmaniasis in sinai , including anthropophilic behaviour , the ability to feed on the reservoir host(s ) , the presence of natural infections , the ability to support the growth of the parasite and the ability to transmit the parasite by bites ( who 2010 ) . however , the results revealed no evidence for the presence of infection in most of the sandflies collected ; for instance , the only species found infected with leishmania promastigotes was p. papatasi , with an infection rate close to 0.5% . the sandfly p. papatasi , the potential vector of l. major in the sinai peninsula ( wahba et al . 2009 ) , was the most prevalent sandfly in our catches . in the current study , most p. papatasi females were caught indoors and in large numbers , whereas , more males were collected outdoors . the difference in the indoor and outdoor catches reported here might suggest that female p. papatasi is more endophagic compared to p. sergenti , p. kazeruni and p. alexandri . there was a significant difference in the infection rates of the sandflies between different study districts , which might be attributed to the host preference of p. papatasi for different vertebrates . the host preference is influenced by the availability of hosts , for example , p. papatasi in beer lehfen and rafah had infection rates approximately 0.73% and 0.72% , respectively , correlating with the high density of gerbils at both sites . to understand cl eco - epidemiology , the ecology of the animal reservoir populations and their roles in disease transmission were also considered in our study . the most predominant species sampled in all the districts was r. norvegicus , previously identified in similar habitats in sinai as a potential leishmaniasis reservoir host ( morsy et al . 1992 ) . however , the current study revealed the presence of infections in g. p. floweri , r. rattus and g. andersoni ; infections were also recovered from r. norvegicus . similar observations were reported in different sites in egypt ( morsy et al . 1992 , fryauff et al . 1993 ) , but , interestingly , these observations also refer to the difference in the eco - epidemiology of cl in egypt and other countries ; for instance , jordan and morocco , where psammomys obesus was identified as the potential animal reservoir ( saliba et al . the burrows of p. obesus are identified by halophytic vegetation and by the remnants of plant material at the entrances ( who 2010 ) . the structure of habitats in the six districts of the current study was relatively similar to the p. obesus habitat , but with no record for the species during the seven years of collection . several criteria were also proposed by the who for the implication of animal reservoirs ( who 2010 ) with cl transmission ; one such criterion was fulfilled by isolating the parasite from wild rodents with positive infections collected from different sites in the study . secondly , the parasite was found to be identical to that isolated from patients attending clinics in north sinai communities ( am samy , unpublished observations ) . some criteria depend on the availability of the parasite in the skin in sufficient numbers for the sandfly to transmit . 2006 ) to infer the potential role of these animals in the dynamics of this disease . throughout the late phases of our study , we used cluster analysis to infer similarity between the habitats using the data from the collection of sandflies , rodents or the combination of both . interestingly , the areas identified to have disease risk formed a distinct cluster , for instance , the distinct cluster that included rafah , nekhel , beer lehfen and el hassana ( fig . these observations revealed the importance of multivariate methods in the study of disease ecology and in inferring the area with a favourable habitat for cl circulation . one of the interesting findings of this study was the presence of infections in different animal reservoirs that were not necessarily previously known as potential reservoirs ( morsy et al . these changes in the animal hosts may be a response to climate change , especially in the presence of continuous heavy rains and floods in sinai . these environmental changes coincided with the increase in cl incidence in sinai due to a change in the vector and rodent populations and consequently a change in the disease dynamics in the area . our report identified the presence of only l. major , whereas no l. tropica was detected during seven years of observations in the study areas . 2009 ) may be allochthonous , i.e. , the parasite may have originated from other sites where l. tropica is established ( jacobson et al . sergenti , the presumed vector of l. tropica , was found in this study , though we found no rock hyraxes , the main l. tropica reservoir in countries including israel and kenya ( mebrahtu et al . other factors that could mask the dynamics of l. tropica transmission might include differences in the seasonality of vectors or distinct reservoir populations for different transmission cycles ( faulde et al . l. major infections circulate in the country through different seasons of the year , with three incidence peaks in november , march and august and few sporadic cases were reported during the rest of the year . these peaks correspond to the time after the peaks of sandfly abundance ( samy 2009 , fahmy et al . the continuous circulation of l. major is maintained by the highest densities of both the p. papatasi and gerbil populations after the heavy rains that are considered as favourable habitats for the survival of the vector and reservoir populations . the number of zoonotic cutaneous leishmaniasis ( zcl ) cases is still underestimated due to the bedouin traditions of preventing females to visit clinics and their dependence on leishmaniasis treatment using routine heat therapy . the mean annual cases reported to the official public health centres in north sinai during 2006 - 2011 were 296.67 cases ( ministry of health of egypt , unpublished observations ) , with the highest infection rate reported during 2008 - 2010 due to a change in environmental conditions . toward the end of this period , the incidence of zcl caused by l. major decreased after control efforts for both vectors and rodent reservoirs by the egyptian ministry of health . due to such continuous disease dynamics in response to environmental changes , we plan in our future research to investigate the potential role of rodent populations in the circulation of the parasite in the sinai , to study in detail the coarse - resolution ecology and to study the biogeography of disease through mapping exercises and site suitability analysis using efficient quantitative techniques .

cutaneous leishmaniasis ( cl ) is a neglected clinical form of public health importance that is quite prevalent in the northern and eastern parts of egypt . a comprehensive study over seven years ( january 2005-december 2011 ) was conducted to track cl transmission with respect to both sandfly vectors and animal reservoirs . the study identified six sandfly species collected from different districts in north sinai : phlebotomus papatasi , phlebotomus kazeruni , phlebotomus sergenti , phlebotomus alexandri , sergentomyia antennata and sergentomyia clydei . leishmania ( -)-like flagellates were identified in 15 p. papatasi individuals ( 0.5% of 3,008 dissected females ) . rodent populations were sampled in the same districts where sandflies were collected and eight species were identified : rattus norvegicus ( n = 39 ) , rattus rattus frugivorous ( n = 13 ) , rattus rattus alexandrinus ( n = 4 ) , gerbillus pyramidum floweri ( n = 38 ) , gerbillus andersoni ( n = 28 ) , mus musculus ( n = 5 ) , meriones sacramenti ( n = 22 ) and meriones crassus ( n = 10 ) . thirty - two rodents were found to be positive for leishmania infection ( 20.12% of 159 examined rodents ) . only leishmania major was isolated and identified in 100% of the parasite samples . the diversity of both the vector and rodent populations was examined using diversity indices and clustering approaches .

the spinal dural arteriovenous fistula ( sdavf ) is the most common type of spinal vascular malformation , but it is rare condition in overall incidence561013171820 ) . it is characterized by progressive , insidious , and non - specific symptoms that are similar to those of more common etiology , such as degenerative spinal disorder and peripheral neuropathy5131920 ) . the fistulas of sdavf are located intradurally at the sleeve of the nerve root , and the obliteration of fistulas is the treatment goal for sdavf513182223 ) . sdavf can be treated by surgical interruption and endovascular embolization . to help ensure successful treatment , we present a patient with sdavf and a history of paraparesis during spinal angiography who was treated successfully using stereotactic radiosurgery ( srs ) using novalis system . a 43-year - old man presented with slow progression of back pain , voiding difficulty , and boring pain on both lower extremities during 5 months . neurological examination showed 420motor weakness of grade iv in both legs and his anal tone was grade zero . about 14 years ago , he had pain in the left leg and was diagnosed with spinal arteriovenous malformation . at that time , magnetic resonance imaging ( mri ) of the thoracolumbar spine revealed a vascular anomaly at the thoracolumbar level , and physicians performed spinal angiography for definite treatment . however , spinal angiography had failed three times in two other hospitals due to vasospasm and paraparesis . he recovered from these symptoms spontaneously , and he had not undergone any treatment thereafter . mri in our hospital showed a vascular anomaly with enhancement at the t12 , l1 , and l2 levels ( fig . axial images of the l1 level revealed a mass lesion , located on the left side of the intraspinal canal ( fig . we recommended selective spinal angiography , but the patient refused because of his experience , requesting a non - invasive technique for diagnosis and treatment . however , we required an alternative modality to selective spinal angiography for obtaining accurate information on diagnosis , level of the lesion , and follow - up after treatment . thus , a three - dimensional volumetric sagittal time - resolved imaging of contrast kinetics ( tricks ) abdominal magnetic resonance angiography ( mra ) using 1.5 t mri system were performed in quiet respiration ( tr / te / flip=4.2/1.1/45 , fov 330330 , equivalent slice thickness of 3 mm , matrix 256160 ) . contrast medium ( 15 ml gadolinium ) the study was post - processed into maximum - intensity projection ( mip ) images ( fig . the target , involving the dura margin , was constructed to include the fistula during structural segmentation under spinal computed tomography ( ct ) images ( fig . we used 10 conformal beams and a total irradiation of 18 gy with three fractions ( fig . we checked the three - dimensional sagittal tricks abdominal mra using 1.5 t for follow - up 7 months after srs , and three - dimensional sagittal tricks abdominal mra using 3.0 t mri system ( tr / te / flip=10.0/1.5/30 , fov 380380 , equivalent slice thickness of 4 mm , matrix 384160 ) was performed 3 years after radiosurgery . the size of the spinal lesion was decreased and the flow through the fistula was diminished on the 7-month post - treatment images ( fig . 4a ) , and the sequelae of the previous lesion was presented on follow - up mri and mra images ( fig . sdavf represent a rare pathological condition , but they account for 6080% of all spinal vascular malformation61317182023 ) . they are acquired lesions , and usually present with insidious and progressive symptoms , such as paraparesis and sensory deficits of the bladder , bowel , and lower extremities10131718 ) . as they present with non - specific and misleading clinical symptoms , their most common site is the thoracolumbar region , and the arteriovenous shunt is a low - flow shunt located at the dural sleeve of the spinal nerve root56101323 ) . the pathophysiology of sdavf - induced spinal cord ischemia and myelopathy is due to increased venous pressure , venous congestion , and decreased spinal cord perfusion caused by shunting arterial blood into the venous side56121315171823 ) . treatment methods for these lesions are microsurgery and endovascular embolization . because the selection of treatment method is mediated by the physician 's preference , selective spinal angiography is regarded as an essential procedure to confirm and treat sdavf5 ) . for successful surgery or endovascular coiling , selective spinal angiography is necessary to know the architectures and hemodynamics of the lesion561215181922 ) . however , even with experienced neuro - interventionists , selective spinal angiography can sometimes cause complications from vasospasm , increased venous pressure , and spinal cord infarction6812151720 ) . in our case , the patient experienced paraparesis three times during spinal angiography . although it occurred 14 years previously , the patient refused the spinal angiography . because the patient wanted a noninvasive method for diagnosis and treatment , we found an imaging technique to provide information about the lesion and be available for follow - up . there are some advanced imaging techniques for sdavf , such as contrast enhanced magnetic resonance angiography with high resolution , tricks sequence , gradient echo , and spinal angiography with a 256-slice ct23152024 ) . although the role of advanced imaging techniques is limited to reducing the exposure of contrast and radiation during the subsequent selective spinal angiography61215202124 ) , it is sufficient for diagnosing sdavf and localizing the fistula235152024 ) . of these imaging techniques , we used the three - dimensional sagittal tricks abdominal mra to obtain information about the spinal lesion and plan the srs . srs for sdavf is not an established method , so reports regarding sdavf treated by srs are very rare . however , in terms of radiosurgery for cranial dural arteriovenous fistulas , radiosurgery for sdavf is not an impossible treatment option22 ) . gao et al.7 ) reported that high expression state of endothelial progenitor cells ( epcs ) presented in the brain and spinal arteriovenous malformation ( avm ) tissue . other authors have published the results from an experimental study that radiosurgery decreases angiogenic activity in avm tissue , compared to that in untreated avm tissue1 ) . moreover , in an experimental study by jahan et al.9 ) , srs for an artificial animal avm model showed a reduction in the size of the lesion , compared to that in the non - radiosurgical model . although these studies are not results for sdavf , we thought that it was possible to perform radiosurgery for sdavf . dalyai et al.4 ) reported that srs for arteriovenous fistula lesions did not clearly show the mechanisms of treatment results , but they induced smooth muscle expansion , adventitial fibrosis , and an intimal response of arterial feeders , and eventually achieved obliteration of the fistula . however , it is not easy to find the exact location of fistulas with ct and mri - based image - guided structural segmentation . thus , we planned the target area to include the dura margin , because fistulas of sdavf are located at the sleeve of the nerve root in the intradural space5131822 ) . the planning of the radiosurgical dose was based some study , which the appearance of myelopathy from srs to spinal lesions appear rare ( < 1% ) when the maximum spinal cord dose is limited to the equivalent of 13 gy in a single fraction or 20 gy in three fractions1114 ) . however , these studies did not provide sufficient long - term data , and our patient had preexisting myelopathy . thus , we treated him with a slightly lower dose than those in the references . advanced imaging studies , including the three - dimensional sagittal tricks sequence , may be useful for obtaining information about sdavf and in performing srs and follow - up after srs when selective spinal angiography has failed . and we think that srs may be another treatment option , especially , for patients preferring non - invasive procedures . our study has the obvious limitation of only including one treatment case , so additional cases of sdavf treated by srs are necessary to determine if it is an effective treatment for this condition .

the spinal dural arteriovenous fistula ( sdavf ) is rare , presenting with progressive , insidious symptoms , and inducing spinal cord ischemia and myelopathy , resulting in severe neurological deficits . if physicians have accurate and enough information about vascular anatomy and hemodynamics , they achieve the good results though the surgery or endovascular embolization . however , when selective spinal angiography is unsuccessful due to neurological deficits , surgery and endovascular embolization might be failed because of inadequate information . we describe a patient with a history of vasospasm during spinal angiography , who was successfully treated by spinal stereotactic radiosurgery using novalis system .

smoking cessation is crucial for a better prognosis in patients with coronary heart disease ( chd)13 and copd.2,4,5 acute heart attacks are associated with high smoking cessation rates . in patients with a first myocardial infarction ( mi ) in the 1970s,3 among whom 78% were smoking , the quitting rate was 55% . in a systematic review from 2003 , the mean rate of smoking cessation within a year after a new diagnosis of chd was found to be 45%.1 a lower quitting rate was observed in patients with copd , in particular in subjects not participating in smoking cessation programs . among smoking copd patients in a swedish study , 10% of those receiving usual care had stopped smoking after 3 years , compared to 38% of those who took part in smoking cessation groups.6 among hospitalized patients with respiratory and cardiac diseases who took part in an intensive smoking cessation program in singapore , 60% of the cardiac patients and 40% of the respiratory patients were still abstinent from smoking after 2 months.7 the mortality due to chd has decreased considerably in the western world in the last few decades.8 evidence shows that decreased smoking prevalence in the general population , particularly among patients with heart disease , is an important reason for this decrease.811 the mortality due to copd has decreased less.12 a stronger tendency of persistent smoking among copd patients may partly explain this difference . copd patients reluctance to quit smoking may lead to a feeling of hopelessness among the doctors who treat them.13 our aim was to determine how the quitting rate in adults is influenced by getting a diagnosis of obstructive lung disease in the population - based troms study . we also wanted to investigate whether influence from this life event differs from being diagnosed with chd . a large proportion of the adult population in troms has participated in health surveys ( the troms study ) since 1974 . the troms study so far consists of six surveys , and this study deals with subjects who participated in both troms 5 ( 20012002 ) and troms 6 ( 20072008 ) . the attendance rates ( of those invited ) in troms 5 and troms 6 were 79% and 66% , respectively . details of the participants have previously been described.14 we included participants who answered the questions on smoking in both surveys . the regional committee for medical and health research ethics and the norwegian data inspectorate approved the troms 5 and troms 6 surveys with a license for further analysis on non - identifiable data , like this study . the invitation included a questionnaire with questions on smoking habits , education , and diseases . we classified subjects reporting daily smoking in troms 5 , but not in troms 6 , as quitters . we divided length of education into three categories , 12 years , 1316 years , and 17 years . we classified diseases reported in troms 6 and not in troms 5 as new diagnoses . we categorized mi and angina pectoris as chd and asthma and copd as obstructive lung disease . the frequencies of current smoking at baseline ( in troms 5 ) and smoking cessation among smokers were calculated by subject characteristics , and the statistical differences between subgroups were analyzed by chi - square statistics . significant variables in univariable analysis ( p<0.1 ) , as well as age and sex , were entered in the multivariable analysis . for the statistical analyses , we used the ibm spss statistic , version 21 ( ibm corporation , armonk , ny , usa ) . a large proportion of the adult population in troms has participated in health surveys ( the troms study ) since 1974 . the troms study so far consists of six surveys , and this study deals with subjects who participated in both troms 5 ( 20012002 ) and troms 6 ( 20072008 ) . the attendance rates ( of those invited ) in troms 5 and troms 6 were 79% and 66% , respectively . details of the participants have previously been described.14 we included participants who answered the questions on smoking in both surveys . the regional committee for medical and health research ethics and the norwegian data inspectorate approved the troms 5 and troms 6 surveys with a license for further analysis on non - identifiable data , like this study . in both surveys , the invitation included a questionnaire with questions on smoking habits , education , and diseases . we classified subjects reporting daily smoking in troms 5 , but not in troms 6 , as quitters . we divided length of education into three categories , 12 years , 1316 years , and 17 years . we classified diseases reported in troms 6 and not in troms 5 as new diagnoses . we categorized mi and angina pectoris as chd and asthma and copd as obstructive lung disease . the frequencies of current smoking at baseline ( in troms 5 ) and smoking cessation among smokers were calculated by subject characteristics , and the statistical differences between subgroups were analyzed by chi - square statistics . significant variables in univariable analysis ( p<0.1 ) , as well as age and sex , were entered in the multivariable analysis . for the statistical analyses , we used the ibm spss statistic , version 21 ( ibm corporation , armonk , ny , usa ) . a total of 4,631 subjects participated in both the fifth and the sixth surveys of the troms study , and 4,497 subjects comprising 1,852 men and 2,645 women answered the questions on smoking in both surveys . the mean time difference between attending the two surveys was 6.2 years ( standard deviation 0.5 years ) . the mean age at troms 5 was 61.1 years ( range 3081 years ) ; 1,150 ( 25.6% ) reported daily smoking and 1,753 ( 39.0% ) reported former smoking . the highest prevalence of smoking ( 43.8% ) was found in subjects with self - reported copd , whereas the frequency among those with self - reported chd was 19.0% . the characteristics of the population in troms 5 and the respective frequencies of smoking are listed in table 1 . in the sixth survey , 765 subjects ( 17.0% ) reported current smoking , and 428 of the 1,150 who had been smoking in troms 5 had quit ( 37.2% ) . a significantly higher quitting rate was found in men compared to women , and the quitting rate increased with the length of education . self - reported diseases registered in troms 5 had no significant impact on the quitting rate ( table 2 ) . the number of days between attending the two surveys had no impact on the quitting rate ( odds ratio = 1 , p=0.8 ) . table 3 shows the frequencies of new self - reported diseases reported in troms 6 , but not in troms 5 , and the association between a new diagnosis and smoking cessation . new diagnoses of asthma / copd ( n=79 ) and chd ( n=73 ) were both associated with increased frequency of quitting , 50.6% ( p=0.01 ) and 52.1% ( p=0.008 ) , respectively . both men and women belonging to any of these diagnostic groups showed increased quitting rates , 54.9% vs 39.8% ( p=0.02 ) in men and 47.1% vs 32.7% ( p=0.009 ) in women . the impact of getting these new diagnoses was particularly strong among the subjects with education length no longer than 12 years ( p=0.001 ; figure 1 ) . subjects with education length up to 12 years were also more frequently diagnosed with these diseases compared to those with higher education , 16.0% and 9.5% ( p=0.01 ) , respectively . among subjects with higher education , a new diagnosis of both chd and obstructive lung disease was significantly associated with smoking cessation when analyzed by logistic regression and also after adjusting for sex and education level in multivariable logistic regression analyses ( table 4 ) . half of the participants with a new diagnosis of asthma / copd or angina / mi quit smoking during the 6 years of follow - up . however , the association between these new diagnoses and smoking cessation was found only in participants with education length up to 12 years . the much higher smoking rate among those with asthma and , in particular , those with copd at baseline than in those with chd indicates a shift in attitude toward smoking cessation among subjects with copd . the high number of participants and the high attendance rates among those invited are strengths of the study . the prevalences of daily smoking among all the attendees in troms 5 and troms 6 were 31% and 22% , respectively,11 which are close to the national prevalences of 29% and 21% , as registered by statistics norway ( https://www.ssb.no)15 in 2002 and 2008 , respectively . in our study sample , the prevalence was lower at both points of time , 25.6% and 17.0% , respectively , and a healthy survivor effect may have contributed to the low frequency of daily smoking in our subsample . the study is based on questionnaires and not on objective measurements of smoking , such as cotinine and thiocyanate . in a previous norwegian study , self - reported smoking was strongly related to serum thiocyanate if the question was asked in a neutral setting.16 although the questions on smoking were included in a self - administered questionnaire , underreporting of daily smoking among those with a new diagnosis can not be ruled out . shift in diagnosis based on the same illness from troms 5 to troms 6 , for instance , between asthma and copd , may have taken place in some subjects . this is no longer a problem when asthma and copd are combined into one category ( asthma and/or copd ) and subjects with a new diagnosis of any of these diseases are compared with those with neither of the diagnoses at both troms 5 and troms 6 . although we have found associations between a new diagnosis and smoking cessation , we do not know for sure whether the extra cessations in the subgroups with a new diagnosis were really preceded by a new diagnosis . subjects in these subgroups could have stopped smoking before the diagnosis was given . in these cases , it is likely that symptoms from a pulmonary or heart disease had raised their awareness of the risk of continued smoking . no previous study has , to our knowledge , described smoking cessation in relation to a new diagnosis of heart or lung disease . most previous studies evaluated smoking cessation programs , and control groups in such studies can be compared with our participants . however , the quitting rate of 41.7% among subjects with a copd diagnosis reported in troms 5 was more similar to the rate of 38% among the copd patients , who had taken part in the smoking cessation program in a swedish study , than the rate of 10% among the copd patients on usual care.6 in a study from primary care , where smokers received smoking cessation advice and were followed up annually with spirometry , higher rates of abstinence were found among those with copd than among those with normal lung function.17 this result is in line with our findings . we found that the quitting rate increased with increasing length of education , and this association is well known from previous studies.18 qualitative studies have shown that patients with a copd diagnosis may have several reasons for not quitting despite the knowledge of harming themselves,19 and they do not always believe that quitting would give them a better life.20 copd patients often show little interest in receiving help from medication and describe unassisted quitting as the best method to stop smoking , based on willpower , strong motivation , and internal strength.21 in our study , a new diagnosis of copd or chd might have given many participants the motivation they needed to quit without assistance . in another qualitative study , the interviewees who had stopped smoking emphasized that persons close to them had a strong influence on their decision to quit.22 this gives a reason to believe that the decreasing acceptance of smoking in the society also influences copd patients . half of the participants with a new diagnosis of asthma / copd or angina / mi quit smoking during the 6 years of follow - up . however , the association between these new diagnoses and smoking cessation was found only in participants with education length up to 12 years . the much higher smoking rate among those with asthma and , in particular , those with copd at baseline than in those with chd indicates a shift in attitude toward smoking cessation among subjects with copd . the high number of participants and the high attendance rates among those invited are strengths of the study . the prevalences of daily smoking among all the attendees in troms 5 and troms 6 were 31% and 22% , respectively,11 which are close to the national prevalences of 29% and 21% , as registered by statistics norway ( https://www.ssb.no)15 in 2002 and 2008 , respectively . in our study sample , the prevalence was lower at both points of time , 25.6% and 17.0% , respectively , and a healthy survivor effect may have contributed to the low frequency of daily smoking in our subsample . the study is based on questionnaires and not on objective measurements of smoking , such as cotinine and thiocyanate . in a previous norwegian study , self - reported smoking was strongly related to serum thiocyanate if the question was asked in a neutral setting.16 although the questions on smoking were included in a self - administered questionnaire , underreporting of daily smoking among those with a new diagnosis can not be ruled out . all diagnoses were self - reported , and their correctness could not be confirmed . shift in diagnosis based on the same illness from troms 5 to troms 6 , for instance , between asthma and copd , may have taken place in some subjects . this is no longer a problem when asthma and copd are combined into one category ( asthma and/or copd ) and subjects with a new diagnosis of any of these diseases are compared with those with neither of the diagnoses at both troms 5 and troms 6 . although we have found associations between a new diagnosis and smoking cessation , we do not know for sure whether the extra cessations in the subgroups with a new diagnosis were really preceded by a new diagnosis . subjects in these subgroups could have stopped smoking before the diagnosis was given . in these cases , it is likely that symptoms from a pulmonary or heart disease had raised their awareness of the risk of continued smoking . no previous study has , to our knowledge , described smoking cessation in relation to a new diagnosis of heart or lung disease . most previous studies evaluated smoking cessation programs , and control groups in such studies can be compared with our participants . however , the quitting rate of 41.7% among subjects with a copd diagnosis reported in troms 5 was more similar to the rate of 38% among the copd patients , who had taken part in the smoking cessation program in a swedish study , than the rate of 10% among the copd patients on usual care.6 in a study from primary care , where smokers received smoking cessation advice and were followed up annually with spirometry , higher rates of abstinence were found among those with copd than among those with normal lung function.17 this result is in line with our findings . we found that the quitting rate increased with increasing length of education , and this association is well known from previous studies.18 qualitative studies have shown that patients with a copd diagnosis may have several reasons for not quitting despite the knowledge of harming themselves,19 and they do not always believe that quitting would give them a better life.20 copd patients often show little interest in receiving help from medication and describe unassisted quitting as the best method to stop smoking , based on willpower , strong motivation , and internal strength.21 in our study , a new diagnosis of copd or chd might have given many participants the motivation they needed to quit without assistance . in another qualitative study , the interviewees who had stopped smoking emphasized that persons close to them had a strong influence on their decision to quit.22 this gives a reason to believe that the decreasing acceptance of smoking in the society also influences copd patients . it has been suggested that a hard core of smokers will constitute an increasing proportion of copd patients who still smoke.23 the high quitting rates among subjects with both an established and a new diagnosis of copd in our study contradicts this pessimism . the study supports pursuit of early diagnosis of copd and gives reasons for a more optimistic attitude among health workers when they discuss smoking cessation with their copd patients .

backgroundpatients with copd have had a lower tendency to quit smoking compared to patients with coronary heart disease ( chd ) . we wanted to investigate if this is still true in a norwegian population.methodsour data came from the fifth and sixth troms surveys , which took place in 20012002 and 20072008 . the predictors of smoking cessation were evaluated in a cohort of 4,497 participants who had stated their smoking status in both surveys.resultsof the 4,497 subjects in the cohort , 1,150 ( 25.6% ) reported daily smoking in troms 5 . in troms 6 , 428 had quit ( 37.2% ) . a new diagnosis of obstructive lung disease ( asthma or copd ) and chd were both associated with increased quitting rates , 50.6% ( p=0.01 ) and 52.1% ( p=0.02 ) , respectively . in multivariable logistic regression analysis with smoking cessation as outcome , the odds ratios ( ors ) of a new diagnosis of obstructive lung disease and of chd were 1.7 ( 1.12.7 ) and 1.7 ( 1.02.9 ) , respectively . male sex had an or of 1.4 ( 1.11.8 ) compared to women in the multivariable model , whereas the ors of an educational length of 1316 years and 17 years compared to shorter education were 1.6 ( 1.12.2 ) and 2.5 ( 1.54.1 ) , respectively.conclusionthe general trend of smoking cessation in the population was confirmed . increased rates of smoking cessation were associated with a new diagnosis of heart or lung disease , and obstructive lung disease was just as strongly linked to smoking cessation as was chd . this should encourage the pursuit of early diagnosis of copd .

fried seeds subjected to grinding by adding sufficient water to it for 30 - 45 min . the mixture was filtered through muslin cloth and pea nut milk is separated . solvent { ethanol : acetone ( 1:1 ) } was added to the milk and then subjected to refrigeration for 30 min . indomethacin was dissolved in chloroform and bio - polymer solution was prepared by adding water to it . the drug solution was added to bio - material solution and mixed by magnetic stirrer until emulsion is formed . release of drug through egg shell membrane : egg shell membrane was separated using con . the egg shell membrane attached to the tube . measured quantity of micro particles 5 ml solution was withdrawal and 5 ml buffer solution was added to make the volume . same procedure was repeated for different formulated films of aceclofenac with phosphate buffer ( ph-7.4 ) . the dissolution studies were perform and subjecting it for dissolution for 3 hrs and analyze the samples by uv spectrophotometer at 320 nm . % cummulative release vs time in ph 1.2 % cummulative release vs time in ph 7.4 fried seeds subjected to grinding by adding sufficient water to it for 30 - 45 min . the mixture was filtered through muslin cloth and pea nut milk is separated . solvent { ethanol : acetone ( 1:1 ) } was added to the milk and then subjected to refrigeration for 30 min . indomethacin was dissolved in chloroform and bio - polymer solution was prepared by adding water to it . the drug solution was added to bio - material solution and mixed by magnetic stirrer until emulsion is formed . release of drug through egg shell membrane : egg shell membrane was separated using con . the egg shell membrane attached to the tube . measured quantity of micro particles 5 ml solution was withdrawal and 5 ml buffer solution was added to make the volume . same procedure was repeated for different formulated films of aceclofenac with phosphate buffer ( ph-7.4 ) . the dissolution studies were perform and subjecting it for dissolution for 3 hrs and analyze the samples by uv spectrophotometer at 320 nm . % cummulative release vs time in ph 1.2 % cummulative release vs time in ph 7.4 five different formulations were formulated using various proportion of bio loaded sustained release bio - micro particles was performed . it had t50% and t 80% of 1.56 hrs and 2.45 hr formulation fg-5 shows percentage yield t50% and t80% of 1.62 hrs and 2.61 hrs at hence these two formulations are the best among the five prepared formulations .

indomethacin microparticles prepared by extraction of bio polymer from arachis hypogen . in vitro drug release study was carried out through egg shell membrane for 3 hrs and analyzed sample by uv spectroscopy at 320 nm . a novel bio membrane from arachis hypogen was isolated by simplify economical process . the % yield was found to be 80% and particle range was 3265 m .

in an experimental study , fifty male weaning wistar rats ( pasture institute , iran ) , 21 days of age on arrival were housed individually in wire bar - floor cages . the animals ( weight : 35.59 0.39 ) were allowed 1 week of acclimatization in a standard environment at 22c , 50% humidity and 12-h light / dark cycles with free access to food and water . during the first week , all animals were fed a standard laboratory chow ( pasture institute , iran ) and afterwards , they were randomly assigned to five groups . the composition of standard diet ( sd ) was completely the same as the commercial ain-93 g . diet treatments included high fat diets ( hfd ) with soy oil ( hf - s ) , butter ( hf - b ) , fish oil ( hf - f ) or olive oil ( hf - o ) . high fat diets were prepared to provide equal vitamins and minerals per calorie , and contained equal percentages by weight of fiber . after an 8-week feeding period , blood samples were collected from the retro - orbital veins into polypropylene tubes containing sodium edta ( 1-mg / ml blood ) and aprotinin ( 500-unit / ml blood , bayer ) in the non - fasted and 24 h - fasted state for measurement of serum parameters and were then centrifuged for 15 min at 3000x g. plasma samples were stored at -80c . animals were anesthesized with co2 to minimize the potential impact of anesthesia on hormone levels . the experimental hfds were almost isocaloric ( table 1 ) , and composed of a fat - free basal diet based on american institute of nutrition rodent diets -growth purified diet-(ain93-g),25 containing carbohydrate ( corn starch , dextrinized corn starch , dyets company , usa ) , protein ( 98.5% casein hydrolisate and 1.5% l - cyctine , choline bitartrate , dyets companay , usa ) , fiber ( cellulose , dyets company , usa ) , vitamin - mineral mix , and tertbutylhydroquinone ( dyets company , usa ) corn starch . dietray fats were also added in order to provide a balanced diet and included fish oil and olive oil which were a generous gift from nooshdarooye darya institute , iran , soy oil ( purchased from ladan institute , iran ) and butter ( obtained locally ) . the diets were prepared weekly and stored as vacuum packed ( 500 g ) at 20c . the food was offered daily at the beginning of the dark phase , and the remains were weighed and removed after an 48 hours . all experiments were carried out in accordance with standards approved by the local ethics committee of the research institute for endocrine science of shahid behesti university of medical sciences . plasma glucose was determined by an enzymatic ( glucose oxidase ) colorimetric method ( pars azmoun co , tehran , iran ) . the assay sensitivity was 1 mg / dl , the intra- and interassay coefficients of variation were 1.2% and 1.8% , respectively . plasma insulin was determined by an elisa method ( mercodia ab , uppsala , sweden ) . g / l , the intra- and interassay coefficients of variations were 2.5% and 4.1% , respectively . blood samples were immediately transferred to chilled tubes containing na2-edta ( 1 mg / ml ) and aprotinin ( 500-unit / ml blood , bayer ) centrifuged in 2000 rpm for 15 min at 4c . hydrogen chloride was added to the samples at a final concentration of 0.1 n immediately after separation of the plasma . unacylated form of ghrelin was measured using dag elisa kit according to the manufacturer 's protocol ( mitsubishi kagaku iatron , inc ) . the minimal detection limit of dag in this assay system was 12.5 fmol / ml . the assay used to detect dag has less than 0.1% of cross - reaction with acylated ghrelin . insulin resistance was estimated by homeostasis model assessment ( homa ) , according to the formula : insulin resistance index = fasting insulin ( g / l ) fasting glucose ( mg / dl)/405.26 gas chromatography analyses were carried out on gas chromatography ( younglin instrument , 6000 series , south korea ) equipped with a split - injector and flame ionization detector . methyl - esters of fatty acids ( fame ) were prepared using methanolic koh , according to the standard method ( iso5509:2000 ) . the fatty acid profile was determined by gas chromatographic separation of their methyl esters ( iso 5508 : 1990 ) on a capillary column ( j&w scientific db-23 , 30 m 0.25 mm 0.25 m ) . chromatography software ( unicam 4880 chromatography data system ) was used for data collection and processing . data are presented in table 2 . fatty acid composition ( % ) of the diets analyzed by gas - liquid chromatography . statistical analyses were performed using spss 16.0 software ( chicago , il , usa ) . the kolmogorov smirnov test was applied to determine the normality of the distribution of the data to be used in the parametric test . one - way anova , paired t test and tukey test were used to compare the diet groups and p value<0.05 was considered statistically significant . nonparametric tests ( kruskal - wallis , wilcoxon signed - rank and mann - whitney u ) were also employed for insulin level and homa - ir variables and p value<0.05 was considered significant . the spearman 's rank correlation coefficient was also used to determine whether a significant relationship existed between insulin and dag concentrations . in an experimental study , fifty male weaning wistar rats ( pasture institute , iran ) , 21 days of age on arrival were housed individually in wire bar - floor cages . the animals ( weight : 35.59 0.39 ) were allowed 1 week of acclimatization in a standard environment at 22c , 50% humidity and 12-h light / dark cycles with free access to food and water . during the first week , all animals were fed a standard laboratory chow ( pasture institute , iran ) and afterwards , they were randomly assigned to five groups . the composition of standard diet ( sd ) was completely the same as the commercial ain-93 g . diet treatments included high fat diets ( hfd ) with soy oil ( hf - s ) , butter ( hf - b ) , fish oil ( hf - f ) or olive oil ( hf - o ) . high fat diets were prepared to provide equal vitamins and minerals per calorie , and contained equal percentages by weight of fiber . after an 8-week feeding period , blood samples were collected from the retro - orbital veins into polypropylene tubes containing sodium edta ( 1-mg / ml blood ) and aprotinin ( 500-unit / ml blood , bayer ) in the non - fasted and 24 h - fasted state for measurement of serum parameters and were then centrifuged for 15 min at 3000x g. plasma samples were stored at -80c . animals were anesthesized with co2 to minimize the potential impact of anesthesia on hormone levels . the experimental hfds were almost isocaloric ( table 1 ) , and composed of a fat - free basal diet based on american institute of nutrition rodent diets -growth purified diet-(ain93-g),25 containing carbohydrate ( corn starch , dextrinized corn starch , dyets company , usa ) , protein ( 98.5% casein hydrolisate and 1.5% l - cyctine , choline bitartrate , dyets companay , usa ) , fiber ( cellulose , dyets company , usa ) , vitamin - mineral mix , and tertbutylhydroquinone ( dyets company , usa ) corn starch . dietray fats were also added in order to provide a balanced diet and included fish oil and olive oil which were a generous gift from nooshdarooye darya institute , iran , soy oil ( purchased from ladan institute , iran ) and butter ( obtained locally ) . the diets were prepared weekly and stored as vacuum packed ( 500 g ) at 20c . the food was offered daily at the beginning of the dark phase , and the remains were weighed and removed after an 48 hours . all experiments were carried out in accordance with standards approved by the local ethics committee of the research institute for endocrine science of shahid behesti university of medical sciences . plasma glucose was determined by an enzymatic ( glucose oxidase ) colorimetric method ( pars azmoun co , tehran , iran ) . the assay sensitivity was 1 mg / dl , the intra- and interassay coefficients of variation were 1.2% and 1.8% , respectively . plasma insulin was determined by an elisa method ( mercodia ab , uppsala , sweden ) . g / l , the intra- and interassay coefficients of variations were 2.5% and 4.1% , respectively . blood samples were immediately transferred to chilled tubes containing na2-edta ( 1 mg / ml ) and aprotinin ( 500-unit / ml blood , bayer ) centrifuged in 2000 rpm for 15 min at 4c . hydrogen chloride was added to the samples at a final concentration of 0.1 n immediately after separation of the plasma . unacylated form of ghrelin was measured using dag elisa kit according to the manufacturer 's protocol ( mitsubishi kagaku iatron , inc ) . the minimal detection limit of dag in this assay system was 12.5 fmol / ml . the assay used to detect dag has less than 0.1% of cross - reaction with acylated ghrelin . insulin resistance was estimated by homeostasis model assessment ( homa ) , according to the formula : insulin resistance index = fasting insulin ( g / l ) fasting glucose ( mg / dl)/405.26 gas chromatography analyses were carried out on gas chromatography ( younglin instrument , 6000 series , south korea ) equipped with a split - injector and flame ionization detector . methyl - esters of fatty acids ( fame ) were prepared using methanolic koh , according to the standard method ( iso5509:2000 ) . the fatty acid profile was determined by gas chromatographic separation of their methyl esters ( iso 5508 : 1990 ) on a capillary column ( j&w scientific db-23 , 30 m 0.25 mm 0.25 m ) . chromatography software ( unicam 4880 chromatography data system ) was used for data collection and processing . data are presented in table 2 . fatty acid composition ( % ) of the diets analyzed by gas - liquid chromatography . statistical analyses were performed using spss 16.0 software ( chicago , il , usa ) . the kolmogorov smirnov test was applied to determine the normality of the distribution of the data to be used in the parametric test . one - way anova , paired t test and tukey test were used to compare the diet groups and p value<0.05 was considered statistically significant . nonparametric tests ( kruskal - wallis , wilcoxon signed - rank and mann - whitney u ) were also employed for insulin level and homa - ir variables and p value<0.05 was considered significant . the spearman 's rank correlation coefficient was also used to determine whether a significant relationship existed between insulin and dag concentrations . in an experimental study , fifty male weaning wistar rats ( pasture institute , iran ) , 21 days of age on arrival were housed individually in wire bar - floor cages . the animals ( weight : 35.59 0.39 ) were allowed 1 week of acclimatization in a standard environment at 22c , 50% humidity and 12-h light / dark cycles with free access to food and water . during the first week , all animals were fed a standard laboratory chow ( pasture institute , iran ) and afterwards , they were randomly assigned to five groups . the composition of standard diet ( sd ) was completely the same as the commercial ain-93 g . diet treatments included high fat diets ( hfd ) with soy oil ( hf - s ) , butter ( hf - b ) , fish oil ( hf - f ) or olive oil ( hf - o ) . high fat diets were prepared to provide equal vitamins and minerals per calorie , and contained equal percentages by weight of fiber . after an 8-week feeding period , blood samples were collected from the retro - orbital veins into polypropylene tubes containing sodium edta ( 1-mg / ml blood ) and aprotinin ( 500-unit / ml blood , bayer ) in the non - fasted and 24 h - fasted state for measurement of serum parameters and were then centrifuged for 15 min at 3000x g. plasma samples were stored at -80c . animals were anesthesized with co2 to minimize the potential impact of anesthesia on hormone levels . the experimental hfds were almost isocaloric ( table 1 ) , and composed of a fat - free basal diet based on american institute of nutrition rodent diets -growth purified diet-(ain93-g),25 containing carbohydrate ( corn starch , dextrinized corn starch , dyets company , usa ) , protein ( 98.5% casein hydrolisate and 1.5% l - cyctine , choline bitartrate , dyets companay , usa ) , fiber ( cellulose , dyets company , usa ) , vitamin - mineral mix , and tertbutylhydroquinone ( dyets company , usa ) corn starch . dietray fats were also added in order to provide a balanced diet and included fish oil and olive oil which were a generous gift from nooshdarooye darya institute , iran , soy oil ( purchased from ladan institute , iran ) and butter ( obtained locally ) . the diets were prepared weekly and stored as vacuum packed ( 500 g ) at 20c . the food was offered daily at the beginning of the dark phase , and the remains were weighed and removed after an 48 hours . all experiments were carried out in accordance with standards approved by the local ethics committee of the research institute for endocrine science of shahid behesti university of medical sciences . plasma glucose was determined by an enzymatic ( glucose oxidase ) colorimetric method ( pars azmoun co , tehran , iran ) . the assay sensitivity was 1 mg / dl , the intra- and interassay coefficients of variation were 1.2% and 1.8% , respectively . plasma insulin was determined by an elisa method ( mercodia ab , uppsala , sweden ) . g / l , the intra- and interassay coefficients of variations were 2.5% and 4.1% , respectively . blood samples were immediately transferred to chilled tubes containing na2-edta ( 1 mg / ml ) and aprotinin ( 500-unit / ml blood , bayer ) centrifuged in 2000 rpm for 15 min at 4c . hydrogen chloride was added to the samples at a final concentration of 0.1 n immediately after separation of the plasma . unacylated form of ghrelin was measured using dag elisa kit according to the manufacturer 's protocol ( mitsubishi kagaku iatron , inc ) . the minimal detection limit of dag in this assay system was 12.5 fmol / ml . the assay used to detect dag has less than 0.1% of cross - reaction with acylated ghrelin . insulin resistance was estimated by homeostasis model assessment ( homa ) , according to the formula : insulin resistance index = fasting insulin ( g / l ) fasting glucose ( mg / dl)/405.26 gas chromatography analyses were carried out on gas chromatography ( younglin instrument , 6000 series , south korea ) equipped with a split - injector and flame ionization detector . methyl - esters of fatty acids ( fame ) were prepared using methanolic koh , according to the standard method ( iso5509:2000 ) . the fatty acid profile was determined by gas chromatographic separation of their methyl esters ( iso 5508 : 1990 ) on a capillary column ( j&w scientific db-23 , 30 m 0.25 mm 0.25 m ) . chromatography software ( unicam 4880 chromatography data system ) was used for data collection and processing . fatty acid composition ( % ) of the diets analyzed by gas - liquid chromatography . statistical analyses were performed using spss 16.0 software ( chicago , il , usa ) . the kolmogorov smirnov test was applied to determine the normality of the distribution of the data to be used in the parametric test . one - way anova , paired t test and tukey test were used to compare the diet groups and p value<0.05 was considered statistically significant . nonparametric tests ( kruskal - wallis , wilcoxon signed - rank and mann - whitney u ) were also employed for insulin level and homa - ir variables and p value<0.05 was considered significant . the spearman 's rank correlation coefficient was also used to determine whether a significant relationship existed between insulin and dag concentrations . food , calorie intakes and body weights of the groups are shown in table 3 . high fat butter and hf - s groups had significantly higher food and calorie intake in comparison with sd , hf - f and hf - o groups ( f=6.38 , p=0.00 ) . initial body weights were not different among dietary groups but the weight gains in the hf - b and hf - s were 26.6 and 17.74 g higher , respectively , than the weight gain of sd group animals ( p=0.01 and p=0.04 , respectively ) . high fat butter had also 21.2 and 21.7 g higher weight gain compared with the hf - f and hf - o groups , respectively ( p=0.00 and p=0.00 , respectively ) . weight gain of hf - f and hf - o groups were 12.3 and 12.8 g higher than the weight gain of hf - s group , respectively ( p=0.04 and p=0.01 , respectively ) . final body weight in hf - s and hf - b groups was higher than that of ds , hf - f and hf - o groups ( p=0.04 ) . body weight , food and calorie intake of rats consuming high fat diets ( hfds ) for 8 weeks1 the plasma dag concentration was significantly decreased in sd , hf - f , hf - o and hf - s diets in the ad libitum fed status , compared with fasting condition ( p=0.00 , figure 1a ) . plasma dag levels at fed state in hf - b and hf - s diet were higher than those of sd , hf - f and hf - o diets ; however , these findings were not significant . plasma desacyl - ghrelin ( 1a ) , glucose ( 1b ) and insulin ( 1c ) levels and insulin resistance ( homa - ir ) ( 1d ) in rats consuming high dietary fats ( hfds ) for 8 weeks ( n=10 in each group ) . high fat fish , sd and hf - o diet rats showed 47.3 , 42.7 and 38.6 g / ml higher dag concentrations than the hf - b diet rats at fasted state , respectively ( p=0.00 ) ; meanwhile , plasma dag level in the hf - s diet rats was 16.4 g / ml lower than the hf - f diet rats ( p=0.00 ) . ad libitum fed plasma insulin concentration in the hf - b diet was significantly higher than that of the sd , hf - f and hf - o diets ( p=0.00 ) and the increase in the hf - s diet group was 0.35 , 0.37 and 0.31 g / l higher than that of the sd , hf - o and hf - f diets , respectively ( p=0.01 , figure 1b ) . furthermore , plasma insulin levels were decreased by fasting in all diet groups , although the decreases were not significant . rats on the sd , hf - f and hf - o diets had significantly lower fasting insulin plasma levels than those on hf - b ( p=0.04 ) . plasma glucose levels were significantly decreased by fasting in all of diet groups , compared with fed state ( p=0.00 , figure 1c ) . however , plasma glucose levels were not significantly different among dietary groups . after 24 h fasting , hf - b diet had significantly higher homa - ir in comparison to the hf - f , hf - o and sd diets ( p=0.05 , figure 1d ) . there was no significant correlation between changes in insulin and changes in dag levels in the feeding ( spearman correlation=0.16 , p=0.3 ) and 24 hour fasting status ( spearman correlation=-0.34 , p=0.06 ) . food , calorie intakes and body weights of the groups are shown in table 3 . high fat butter and hf - s groups had significantly higher food and calorie intake in comparison with sd , hf - f and hf - o groups ( f=6.38 , p=0.00 ) . initial body weights were not different among dietary groups but the weight gains in the hf - b and hf - s were 26.6 and 17.74 g higher , respectively , than the weight gain of sd group animals ( p=0.01 and p=0.04 , respectively ) . high fat butter had also 21.2 and 21.7 g higher weight gain compared with the hf - f and hf - o groups , respectively ( p=0.00 and p=0.00 , respectively ) . weight gain of hf - f and hf - o groups were 12.3 and 12.8 g higher than the weight gain of hf - s group , respectively ( p=0.04 and p=0.01 , respectively ) . final body weight in hf - s and hf - b groups was higher than that of ds , hf - f and hf - o groups ( p=0.04 ) . body weight , food and calorie intake of rats consuming high fat diets ( hfds ) for 8 weeks1 the plasma dag concentration was significantly decreased in sd , hf - f , hf - o and hf - s diets in the ad libitum fed status , compared with fasting condition ( p=0.00 , figure 1a ) . plasma dag levels at fed state in hf - b and hf - s diet were higher than those of sd , hf - f and hf - o diets ; however , these findings were not significant . plasma desacyl - ghrelin ( 1a ) , glucose ( 1b ) and insulin ( 1c ) levels and insulin resistance ( homa - ir ) ( 1d ) in rats consuming high dietary fats ( hfds ) for 8 weeks ( n=10 in each group ) . high fat fish , sd and hf - o diet rats showed 47.3 , 42.7 and 38.6 g / ml higher dag concentrations than the hf - b diet rats at fasted state , respectively ( p=0.00 ) ; meanwhile , plasma dag level in the hf - s diet rats was 16.4 g / ml lower than the hf - f diet rats ( p=0.00 ) . ad libitum fed plasma insulin concentration in the hf - b diet was significantly higher than that of the sd , hf - f and hf - o diets ( p=0.00 ) and the increase in the hf - s diet group was 0.35 , 0.37 and 0.31 g / l higher than that of the sd , hf - o and hf - f diets , respectively ( p=0.01 , figure 1b ) . furthermore , plasma insulin levels were decreased by fasting in all diet groups , although the decreases were not significant . rats on the sd , hf - f and hf - o diets had significantly lower fasting insulin plasma levels than those on hf - b ( p=0.04 ) . plasma glucose levels were significantly decreased by fasting in all of diet groups , compared with fed state ( p=0.00 , figure 1c ) . however , plasma glucose levels were not significantly different among dietary groups . after 24 h fasting , hf - b diet had significantly higher homa - ir in comparison to the hf - f , hf - o and sd diets ( p=0.05 , figure 1d ) . there was no significant correlation between changes in insulin and changes in dag levels in the feeding ( spearman correlation=0.16 , p=0.3 ) and 24 hour fasting status ( spearman correlation=-0.34 , p=0.06 ) . food , calorie intakes and body weights of the groups are shown in table 3 . high fat butter and hf - s groups had significantly higher food and calorie intake in comparison with sd , hf - f and hf - o groups ( f=6.38 , p=0.00 ) . initial body weights were not different among dietary groups but the weight gains in the hf - b and hf - s were 26.6 and 17.74 g higher , respectively , than the weight gain of sd group animals ( p=0.01 and p=0.04 , respectively ) . high fat butter had also 21.2 and 21.7 g higher weight gain compared with the hf - f and hf - o groups , respectively ( p=0.00 and p=0.00 , respectively ) . weight gain of hf - f and hf - o groups were 12.3 and 12.8 g higher than the weight gain of hf - s group , respectively ( p=0.04 and p=0.01 , respectively ) . final body weight in hf - s and hf - b groups was higher than that of ds , hf - f and hf - o groups ( p=0.04 ) . body weight , food and calorie intake of rats consuming high fat diets ( hfds ) for 8 weeks1 the plasma dag concentration was significantly decreased in sd , hf - f , hf - o and hf - s diets in the ad libitum fed status , compared with fasting condition ( p=0.00 , figure 1a ) . plasma dag levels at fed state in hf - b and hf - s diet were higher than those of sd , hf - f and hf - o diets ; however , these findings were not significant . plasma desacyl - ghrelin ( 1a ) , glucose ( 1b ) and insulin ( 1c ) levels and insulin resistance ( homa - ir ) ( 1d ) in rats consuming high dietary fats ( hfds ) for 8 weeks ( n=10 in each group ) . high fat fish , sd and hf - o diet rats showed 47.3 , 42.7 and 38.6 g / ml higher dag concentrations than the hf - b diet rats at fasted state , respectively ( p=0.00 ) ; meanwhile , plasma dag level in the hf - s diet rats was 16.4 g / ml lower than the hf - f diet rats ( p=0.00 ) . ad libitum fed plasma insulin concentration in the hf - b diet was significantly higher than that of the sd , hf - f and hf - o diets ( p=0.00 ) and the increase in the hf - s diet group was 0.35 , 0.37 and 0.31 g / l higher than that of the sd , hf - o and hf - f diets , respectively ( p=0.01 , figure 1b ) . furthermore , plasma insulin levels were decreased by fasting in all diet groups , although the decreases were not significant . rats on the sd , hf - f and hf - o diets had significantly lower fasting insulin plasma levels than those on hf - b ( p=0.04 ) . plasma glucose levels were significantly decreased by fasting in all of diet groups , compared with fed state ( p=0.00 , figure 1c ) . after 24 h fasting , hf - b diet had significantly higher homa - ir in comparison to the hf - f , hf - o and sd diets ( p=0.05 , figure 1d ) . there was no significant correlation between changes in insulin and changes in dag levels in the feeding ( spearman correlation=0.16 , p=0.3 ) and 24 hour fasting status ( spearman correlation=-0.34 , p=0.06 ) . our findings showed that insulin concentration at fed state was significantly lower in the hf - f and hf - o groups , in comparison to the hf - b and hf - s diets , although in fasting state , insulin level differences were similar . insulin resistance ( homa - ir ) was also higher in the hf - b diet , in comparison to the sd , hf - f and hf - o groups . on the other hand , food , energy intake and the following weight gain in hf - f and hf - o diets were lower than those of the hf - b and hf - s groups . although , the effect of different fat sources on appetite is controversial and limited , but previous studies have reported that each energy unit from fat had weaker satiety effects compared to carbohydrate and protein ; on the other hand , high fat foods usually have higher energy density , so these foods can lead to more food consumption and weight gain and obesity.27 alfenas and mattes have been shown that saturated fatty acid ( sfa ) absorption is less effective than unsaturated fatty acids in rats and they assumed that polyunsaturated fatty acid ( pufa ) has more satiety effect than monosaturated fatty acid ( mufa ) and mufa more than sfa.28 therefore , higher insulin levels or insulin resistance in rats receiving hf - b ( containing sfa ) or hf - s ( containing -6 pufa ) groups , probably , is related to higher weight or appetite.2930 so , in this study the satiety effect of pufas was not found in -6 pufa . this finding probably was related to the scientific fact that high proportion of -6 pufa to -6 pufa in the diet shifts the physiological state in the tissues toward the pathogenesis of many diseases like obesity.3132 latown and co - workers also reported that food containing sfa , compared to pufa , was accompanied by higher food and energy intake33 and may be , because of this , most previous studies suggest that fish oil high in polyunsaturated -3 fatty acids normalizes the insulin action and prevents insulin resistance induced by a hfd in rats33436 or can lead to better glucose response and obesity parameters in mice.37 furthermore , animal and human studies have demonstrated that sfa increases insulin resistance3839 and animal studies also showed that -6 pufa in comparison to -3 pufa could decrease insulin sensitivity.635 however , other investigators have suggested that higher intakes of sfa and -6 pufa do not adversely affect insulin secretion4041 and homa - ir.34 in addition , some studies have demonstrated that hfd with mufa does not improve insulin secretion and sensitivity in rats.2342 it should be noticed that the majority of these studies have used adult rats ( 125300 g body weight ) , fed more total calories than controls,243 while the present study utilized weaning , prepubertal rats fed an ad libitum diet . furthermore , duration of the study and composition of basal diet , especially fiber content , could affect insulin sensitivity and basal glucose metabolism.4445 these differences may explain the apparent contradictions among different researches . the present study has shown that the decrease in fasting plasma insulin and insulin resistance in the fish oil and mufa groups was associated with an increase in fasting plasma dag , suggesting that the increased dag levels observed in these rats may be due to decreased insulin secretion . although , the mechanisms responsible for the differential effects of fatty acids on insulin action and glucose homeostasis have not been fully elucidated,46 ghrelin levels were found to be reciprocal to those of glucose and insulin1447 and previous data available suggested a negative association between systemic ghrelin and insulin levels , with ghrelin inhibiting insulin secretion both in vitro and in vivo and in most human or animal studies.48 it should be pointed out that ghrelin and dag are two separate peptides but they can modify the actions of each other on glucose handling.16 in this study , it is reasonable to postulate that the low fasting dag levels in hf - b fed rats partially relieve its inhibition on insulin production . the insulin level therefore , is increased to compensate the peripheral insulin resistance caused by high sfa consumption as previously reported.39 nevertheless , this study could not show any significant correlations between insulin and dag concentrations . on one hand , this may be related to different metabolic status in growing rats and on the other hand , previous studies have measured insulin concentration in the portal circulation following intravenous injection of dag , which may affect the findings.244950 gauna et al . have hypothesized that assessment of insulin concentration in the portal vein might be more informative than that in the systemic circulation.24 as we said above , calorie intake , food intake and weight gain were higher in hf - b and hf - s diets in comparison to sd , hf - f and hf - o groups and on the other hand , hf - f and hf - o had higher dag and lower insulin and insulin resistance in comparison to the hf - s and hf - b diets . as , documented , ghrelin and insulin are two gut hormones playing an affective role in body weight regulation;6 dag could hence decrease food intake and gastric emptying in mice and rats.51 food intake modulator actions in the central nervous system have been suggested for insulin.5253 according to the findings of this study , food intake , calorie intake and weight gain were lower in groups with higher dag , which is consistent with recent report that dag induces a negative energy balance by decreasing food intake and delaying gastric emptying.51 on the other hand , in groups with higher insulin concentration and insulin resistance , food intake , calorie intake and weight gain also were higher . these findings are comparable with the buettner ( and coworkers ) study in which they have shown that groups with higher weight gain , had higher plasma glucose levels and less effective insulin - induced glucose disposal.2 rats fed with hfds containing mufa and -3 pufa had significantly lower weight gain , food and calorie intake and these changes were associated with increased fasting plasma dag concentrations , concomitant with lower insulin concentration and insulin resistance . results of this study suggest that hfds containing fish oil and olive oil can increase the dag which may play a role in weight , appetite control and insulin resistance improvement in young rats . as carried out the design of study , coordinated , carried out all the experiments and also writing the manuscript . mk , sz carried out the design , writing the manuscript and also supervised the project . mv carried out the design and coordinated the study , participated in most of the experiments and prepared the manuscript . ag , msd and mz participated in data collection and provided comments on the laboratory analysis of samples .

background : evidence exists for reciprocal effects of insulin and desacyl - ghrelin ( dag ) concentration , but the association between different fatty acid saturation in high fat diet ( hfd ) and these hormones remain to be established . to evaluate the impact of different sources of dietary fat and the level of fatty acid saturation on plasma insulin and dag levels and also the association of dag with insulin action this study was carried out.methods:male weaning wistar rats were randomly divided into four groups of hfds , high fat butter ( hf - b ) , high fat soy ( hf - s ) , high fat olive ( hf - o ) , high fat fish ( hf - f ) , and a group of standard diet ( sd ) . blood samples were collected after 8 weeks and after they were fasted for 24 h. body weight , food intake , plasma glucose , insulin , dag and insulin resistance ( homa - ir ) were measured.results:plasma insulin levels at fed and fasted status , were significantly higher in rats on hf - b compared to those on sd , hf - f and hf - o diets ( p<0.05 ) . insulin concentration in rats on hf - s was also higher than those on sd , hf - f and hf - o diets ( p<0.05 ) , in the feeding status . insulin resistance was significantly higher in rats on hf - b , compared to those on sd , hf - f and hf - o ( p<0.05 ) . rats that were fed with hf - b diet had lower fasting plasma dag levels than the sd , hf - f and hf - o groups ( p<0.05 ) ; furthermore , the hf - f group had significantly higher dag level than the hf - s groups ( p<0.05).conclusions : fish and olive oils may hence contribute to lower insulin level and homa - ir by increasing dag concentration and may have more health benefits than other fat sources in diets .

infantile postural asymmetry ( far better known as congenital muscular torticollis ) is characterised predominantly by asymmetric movement patterns , such as trunk convexity and unilateral restriction in head turning1,2,3 . to direct the focus on the trunk , the designation infantile postural asymmetry the expected cause of infantile postural asymmetry is an intrauterine - acquired asymmetric fixation , possibly modified by mechanisms throughout birth4 , 5 . the prevalence of this idiopathic form of infantile postural asymmetry is estimated to be 1525%6,7,8 . since 1992 infantile postural asymmetry and plagiocephaly have become more frequent2 , 4 due to the launch of the back to sleep campaign to reduce the risk of sudden infant death . the symptomatic form due to neuromuscular and skeletal disorders is fairly rare1 , 9 . infantile postural asymmetry occurs frequently with additional asymmetric features , such as hip dislocation , subluxation of the atlanto - axial joint , shortening of the sternocleidomastoid muscle , strabism and deformational plagiocephaly3 , 5 , 9 , 10 , 13 . to allow for unrestricted symmetric movements and to prevent a fixed torticollis , scoliosis and head deformity , there are different methods with are based largely on empirical evidence and supported by few studies ; they include stretching , positioning , handling , physical , manual and microcurrent therapy8 , 11,12,13,14 . there is also a randomised trial which supports the therapeutic efficacy of osteopathic treatment15 . in many countries neurodevelopmental treatment ( ndt ) and vojta therapy are used for the treatment of infantile asymmetry3 , 5 , 16 . however , there have not yet been any therapeutic trials in infants with postural asymmetry for these approaches . to evaluate the efficacy of vojta therapy versus ndt in infants with postural asymmetry , we performed a randomised controlled trial ( rct ) using a standardised video - based asymmetry scale2 , 17 . this study was carried out from 2008 to 2012 at the centre of developmental neurology , frankfurt , germany . all local paediatricians were asked to refer infants with postural asymmetry and a post - term age of six to eight weeks . eligible for study participation were otherwise healthy infants who had an asymmetry score of at least 12/24 points diagnosed by a paediatrician , had not yet been treated for their asymmetry and had had a pregnancy duration of at least 32 weeks2 . in addition , their parents had to provide written informed consent and had to have basic knowledge of the german language . infants with an extreme pelvic obliquity ( icd-10 m 95.5 ) , which does not allow evaluation of the spine in the supine position , were excluded from the study . furthermore infants were excluded from this study if they had significant underlying diseases or a treatment before or during the study according to other concepts . the study protocol was approved by the ethical committee of the martin luther university ( mlu ) halle - wittenberg and the hessen state chamber of physicians , germany ( approval number mc 95/2008 ) . a comparative study of vojta therapy against placebo was not allowed for ethical reasons because vojta therapy is an officially recognized treatment modality for infant asymmetry in germany and paid by health insurance . after written informed consent was obtained and the caregivers agreed to publication , the eligible infants were assigned to two groups using block randomisation . the sealed and sequentially numbered envelopes were not opened by the study coordinator until the family came to the first therapy session . infants of the first group were treated according to the vojta method , whereas infants in the second group received elements of ndt , such as handling and positioning . both groups were treated for 45 minutes twice a week for eight weeks at the centre of developmental neurology , frankfurt by experienced and certified vojta and ndt physiotherapists . developed by vaclav vojta , the vojta method is well known as reflex locomotion and can be divided into reflex crawling and reflex rolling ( phases 1 and 2 ) . by stimulating special reflex points , the physiotherapist can trigger these motor patterns . reflex crawling is performed in a prone position , whereas reflex rolling is induced from a supine ( phase 1 ) and side - lying ( phase 2 ) position . during this stimulation of motor patterns , the ndt group of infants received techniques opposing their preferred posture with the aim of activating synergistic muscles . parents were shown how to massage an infant to harmonise muscular imbalance and how to initiate special positioning during sleep , thereby antagonizing asymmetry . they were also trained to increase the prone position time during daytime ( 4 5 minutes ) . further exercises in the ndt group comprised handling according to the bobath concept , which includes recommendations for a specific positioning of the infant during everyday procedures , such as washing , feeding , picking up and laying down , in addition to the accommodation of the baby and the parental carrying20 . the primary outcome was to evaluate the therapeutic effects of the two methods and to test if vojta therapy might be superior to ndt in reducing infant postural asymmetry . before and eight weeks after intervention , postural asymmetry was quantified using a standardised video - based asymmetry scale developed by philippi et al.2 , 17 . therefore a tripod with the video camera was set up at the end of treatment mat , exactly two meters above the infants . on the treatment mat , a cross was painted , in order to assess the longitudinal axis ( spine ) and a horizontal axis ( shoulder girdle ) . recording commenced with the infant s head being held for a brief period of time in the middle supine position . a head turn was then induced by presenting noises , toys or the physiotherapist s face , and moving them from one side to the other . after at least two turns to each side , the infant was put in the prone position with its head held for a brief time in the middle prone position , and the same procedures were repeated2 . that means , the four items of this assessment comprise convexity of the trunk and restriction in head rotation in the prone and supine position during a maximal head turn induced by optic and acoustic stimuli to the right and left side of the infants . the range of the scale is set with a maximum of 4 6 = 24 points for maximum asymmetry and a minimum of 4 1= 4 points for symmetry . for each infant , this procedure was videotaped and analysed by three experienced and trained physical therapists ( table 1table 1.characteristics of the physical therapistspt 1pt 2pt 3genderfemalefemalefemaleage ( years)433553experience from getting the physio license20 years12 years22 yearsreceive vojta certification2001 - --1999receive ndt certification199720081995other certificationcastillo moralessystemic family therapy ) , who were blinded to the therapeutic method used . the three video scorers had contact neither to the treating physical therapists nor to the parents throughout the whole study . they did not know if the video was recorded before or after treatment and which treatment was used . the treating physical therapist and the parents were not blinded for the therapy method . the secondary outcome was the compliance of the parents , which was ensured through two appointments a week at the treatment centre and supervision of their manual therapy skills . the parents had to be present at 12 of the 16 possible appointments at the treatment centre to avoid elimination from the study . in addition , the frequency of therapy at home and the behaviour of the infants during these treatments were evaluated with a structured parent questionnaire . questionnaire parents were ask if the crying of their infants affected the duration and frequency of their exercises at home and if crying and behaviour changed over time . the statistical analysis was performed with spss 18.0 and an intention - to - treat - model used for the evaluation . the main thesis is tested on a statistical significance of 0.05 using a multivariate analysis of variance ( manova ) within all three scorers over all four items . an increase or decrease of four points ( out of 24 ) was determined to be the minimum for clinical relevance . the changes in an infant s behaviour were evaluated with the questionnaire through a four - point likert scale every two weeks . a correlation analysis between therapy and screaming behaviour the estimation of the number of subjects needed for this therapy study was performed with the software nquery advisor and sas / iml . a previous study about osteopathy and infantile postural asymmetry was used as the reference for the estimation15 . the group difference in the asymmetry reduction before and after treatment should be at least four points on the asymmetry scale . based on a power of 80 , a significance level of 5% , an estimated treatment effect of 4 points and a standard deviation ( sd ) of 3.5 points , 15 infants were needed for each group . a list of block randomisation was created with a computer - based random number generator at the institute of medical epidemiology , biometry and informatics at mlu . an independent person sent the order of allocation in closed , opaque and numbered envelopes to the investigator , who opened them after receipt of parental consent . because the envelopes were kept in a locked cabinet until opening , confidentiality was ensured . twenty - six infants exceeded maximal age of eight weeks during the referral and decision process . thirty - seven infants were found to be eligible and randomly assigned to the two groups , 19 receiving vojta therapy and 18 receiving ndt ( fig . consort flow diagram : order of study randomisation was successfully performed as shown by similar baseline criteria in both groups ( table 2table 2.baseline demographic and clinical characteristicscharacteristicsvojta therapy(n=19)ndt(n=18)mean ( sd ) age , weeks7.16 ( 0.77)7.61 ( 0.61)gender , male / female , n16 / 310 / 8mean ( sd ) growth , cm51.50 ( 3.4)50.38 ( 3.3)posture awake , nall positions54no prone position1414posture asleep , nsupine1712supine , side24prone02parental carrying , n<1 h / week2126 h / week221 h / day151224 h / day03plagiocephaly , n169twin birth , n13mean birthweight , g ( range)3,321 ( 2,3604,390)3,101 ( 1,5304,310)mean asymmetry score points ( sd)18.47 ( 1.72)18.35 ( 2.06)n : subjects ; sd : standard deviation ; h : hours ; cm : centimeter ; g : gram ) there were no protocol violations , such as dropouts or change of group affiliation . n : subjects ; sd : standard deviation ; h : hours ; cm : centimeter ; g : gram within an eight - week treatment either with vojta therapy or ndt , an average four - point reduction of postural asymmetry was achieved . the mean difference ( pre - post ) between both groups was 2.96 points ( 95% ci [ 5.01 ; 0.91 ] ) , a statistically significant improvement in favour of vojta therapy ( p=0.025 ) ( fig . 2.total score difference ( tsc ) in the vojta and ndt group represented as box plots . a negative tsc represents an improvement , while a positive tsc indicates deterioration . total score difference ( tsc ) in the vojta and ndt group represented as box plots . a negative tsc represents an improvement , while a positive tsc indicates deterioration . a discordant value is marked by a circle in the vojta group , the asymmetry score dropped from 18.47 points ( sd 1.72 ) to 10.72 points ( sd 2.77 ) ( 7.75 points 95%ci [ 6.43 ; 9.08 ] ) and in the ndt group from 18.35 points ( sd 2.06 ) to 13.56 points ( sd 3.53 ) ( 4.79 points 95%ci [ 3.12 ; 6.47 ] ) ( fig . 3fig . 3.manova regarding the difference in the primary outcome criteria before and after treatment ( pre - post ) ) . manova regarding the difference in the primary outcome criteria before and after treatment ( pre - post ) the changes of the supine position contributed more to the results than those of the prone position . the mean changes were 1.18 points ( p<0.001 ; 95% ci [ 0.082 ; 0.840 ] ) in head rotation supine , 0.81 points ( p=0.011 ; 95% ci [ 0.105 ; 0.921 ] ) in spinal convexity supine , 0.47 points ( p=0.094 ; 95% ci [ 0.107 ; 0.744 ] ) in head rotation prone and 0.50 points ( p=0.230 ; 95% ci [ 0.105 ; 0.610 ] ) spinal convexity prone . despite the recommendations of the physical therapists to treat their infants four times a day , parents in the vojta group treated their infants on average 2.21 times / day for 10.5 minutes . they attended on average 15.63 from 16 possible appointments with their children at the treatment centre . parents in the ndt group treated their infants on average 2.44 times / day for 10.9 minutes . thirty - four of 37 parents ( 91.9% ) reported similar or less frequent crying of their infant after eight - week treatment , whereas three parents ( 8.1% ) noticed more frequent crying ( one of the ndt group , two of the vojta group ) . infantile postural asymmetry in seven - week - old infants both in the ndt group and the vojta group showed clinically relevant improvement after an eight - week treatment interval consisting both of home treatment carried out by the parents twice a day for 10 minutes on average and the therapy at the treatment centre , which was performed twice a week for 30 minutes on average . with the same duration and frequency of treatment , there was statistically significant improvement in the vojta group . this study is the first rct to show the effects of vojta therapy and ndt on infantile postural asymmetry . the significant effect achieved through vojta therapy compared to ndt may be explained by its more intensive muscle activation due to relatively precisely guided movement responses to triggered reflexes . in contrast , ndt allows for more variation of muscle activation ; as a result , muscles which need activation may be missed because stronger muscles take over the work of weaker ones . a further strength of our study is that outcome was measured objectively by a standardised video - based score evaluated by independent raters , who were blinded for treatment and clinical data . although infants cry during vojta treatment , the acceptance of the parents in this study was good and did not influence compliance . it is assumed that crying during vojta therapy is more likely an expression of the infant s unwillingness to activate weak muscles rather than an expression of pain . this assumption is supported by the fact that crying stops as soon as the training ceases and by the report of parents that crying caused by pain sounds different . parents who can not bear the baby s crying under vojta therapy obtained with ndt a second , effective method but during the study period reached slightly less symmetry . compared with other measures8 , 10 , 11 , 14 , 15 both methods show very good results . in physical therapy usually parents do less home therapy than recommended ; this was also the case in our study . nevertheless , in our study physical therapy performed twice a day for ten minutes by the parents was sufficient in order to be effective . parents also have to perform home therapy if they apply other recommended approaches for torticollis like stretching8 , 10 , 11 . however , stretching is sometimes a difficult experience for both parents and infants as it is often rather painful . a novel therapy , kinesiology tape14 , seems to be a promising treatment option according to a first pre - post study . it can not be proven in the end that the natural course would not have achieved the same effect over time . a further limitation is the missing placebo group , which could not be implemented for ethical reasons . from two historical study groups ( n=12 and n=16 ) of infants with postural asymmetry who were not be treated for 4 weeks at the age of 612 weeks , we know that there was a minimal change of their postural asymmetry score ( 1 point on average)15 . this may indicate that initiating physical therapy is more beneficial than waiting . in the treat - or - not - to - treat debate , there are two further important clinical aspects which might offer a good argument to treat those infants early . infants with fixed movement restriction in cervical rotation are limited in their age - related participation because they can not explore the environment as they would like to and need to . in untreated infants , torticollis and spine convexity may become more fixed over time and the risk of scoliosis and headaches increases . with early treatment we have the chance to relax the asymmetrically tensed - up spine muscles more easily and quickly ; later on , however , the treatment of fixed torticollis , scoliosis and headache will be more extensive . our study supports the beneficial effect of physical therapy on infants with infantile postural asymmetry and indicates that physical therapy may be a good complement to stretching and other treatments . our data suggest that effectiveness can be attained by ten minutes of home therapy twice a day and one 30-minute - treatment per week by the physical therapist . our results show that therapy compliance was comparable in ndt and vojta therapy ; however , the total effect was greater in the vojta group . this good result of physiotherapy measures in the treatment of infantile postural asymmetry should now be examined with a greater numbers of participants , maybe in multicentre studies . this study was partially funded by physio germany ( german association of physical therapy zvk e. v. ) . this study was partially funded by physio germany ( german association of physical therapy zvk e. v. ) .

[ purpose ] physical therapy is an acknowledged and frequently applied method for infantile postural asymmetry . however , there is not yet sufficient evidence for its effectiveness . [ subjects and methods ] in a randomised controlled trial , the effect of vojta therapy versus neurodevelopmental treatment is assessed in infants with postural asymmetry . 65 infants with postural asymmetry were recruited . 37 infants aged six to eight weeks ( mean 7.38 ) were found to be eligible and randomly assigned to two groups , with 19 receiving vojta and 18 neurodevelopmental treatment . using a standardised and blinded video - based assessment , we documented restriction in head rotation and convexity of the spine in prone and supine position before and after therapy . a reduction of at least four points ( range of scale 20 points ) in postural asymmetry was regarded as a clinically relevant change . [ results ] on average a four - point reduction was achieved in both groups within eight weeks . a mean difference ( pre - post ) between the groups of 2.96 points in favour of vojta therapy was observed . [ conclusion ] while both neurodevelopmental treatment and vojta are effective in the treatment of infantile postural asymmetry and comparably well applied by the parents , therapeutic effectiveness is significant greater within the vojta group .

cesarean delivery rates have been increasing in a fast manner throughout the world within past few decades ( 1 ) . although reasonable cesarean rates have been proposed as 510% by who , cesarean delivery rates across the world varies between 0.4% and 41% ( 2 ) . while cesarean birth rates had reached 28% in usa , 21% in canada , it is around 37% in brazil , 39% in mexico , 40% in china ( 2 , 3 ) . cesarean birth rates are also increasing in turkey in parallel to the developments in the world . while 6.0% of all births were realized by cesarean section in 1998 , this rate has risen to 48.1% in 2013 ( 4 , 5 ) . the birth and postpartum processes can imply significant risks for both mother and infant health . one of the most important conditions , which have effect on these risks during the birth process is the way of delivery . these complications may include staying at intensive care unit , postpartum depression , infection , thrombosis , hysterectomy , bleeding , blood transfusion and internal artery ligation related to maternal health , and iatrogenic prematurity , pulmonary hypertension , inability to breastfeeding , fetal respiratory syndrome in relation to newborn ( 68 ) . cesarean delivery rates are influenced by many non - medical factors such as cultural factors , personal characteristics of the woman and socioeconomic features ( 9 ) . the purpose of this study was to determine cesarean birth rates and to find out social factors affecting the cesarean birth in primiparous women . this study was conducted in burdur province , turkey between the dates of 1 jan 201231 dec 2012 . there are 78 family health units and four general hospitals including three public , and one private sector in the province of the study . pregnancies and pregnancy outcomes ( abortion , stillbirth and live birth ) are reported to provincial public health directorate by the hospitals and family physicians . a total of 737 childbirths were realized between the dates of 1 jan31 mar 2012 . the universe of this cross - sectional type study was formed by 223 primiparous women . ninety - six percent of the universe was reached ( 214/223 ) . the most prominent reasons for inability to reach the women were absence at the address given ( 2 women ) , permanent migration out of the province ( 1 woman ) and temporary visit to their parents residing in neighboring provinces ( 6 women ) . data collection form was made up of the questionnaire containing women s sociodemographic , biodemographic , birth characteristics and babies gender and weight . the dependent variable of the study is cesarean delivery , and independent variables are the factors related to women s sociodemographic , socioeconomic , health features , health behavior and violence . the data was collected using face - to - face interview technique after getting verbal consent from the woman , by midwives working in community health center between the dates of 15 apr31 may 2012 after necessary permissions were obtained from public health directorate . the midwives who would collect data were provided 3-h training , which includes the aim of the study , what each of questions targeted and the circumstances required to be considered at the stage of data collection in order to ensure standardization before data collection . the data was analyzed in spss 20 ( chicago , il , usa ) packaged software . in these analyses , chi - square and backward lr logistic regression analyses were used , odds ratio and confidence interval was calculated . the independent variables ( p<0.05 ) which resulted as statistically significant in chi - square analyses , have been taken into backward logistic regression analyses . the universe of this cross - sectional type study was formed by 223 primiparous women . the most prominent reasons for inability to reach the women were absence at the address given ( 2 women ) , permanent migration out of the province ( 1 woman ) and temporary visit to their parents residing in neighboring provinces ( 6 women ) . data collection form was made up of the questionnaire containing women s sociodemographic , biodemographic , birth characteristics and babies gender and weight . the dependent variable of the study is cesarean delivery , and independent variables are the factors related to women s sociodemographic , socioeconomic , health features , health behavior and violence . the data was collected using face - to - face interview technique after getting verbal consent from the woman , by midwives working in community health center between the dates of 15 apr31 may 2012 after necessary permissions were obtained from public health directorate . the midwives who would collect data were provided 3-h training , which includes the aim of the study , what each of questions targeted and the circumstances required to be considered at the stage of data collection in order to ensure standardization before data collection . the data was analyzed in spss 20 ( chicago , il , usa ) packaged software . in these analyses , chi - square and backward lr logistic regression analyses were used , odds ratio and confidence interval was calculated . the independent variables ( p<0.05 ) which resulted as statistically significant in chi - square analyses , have been taken into backward logistic regression analyses . when the table is monitored , it is seen that there is statistically significant relationship between the delivery mode and the place of residence , women s age , women s family type and her husband s employment status and presence of health insurance . when it is examined in terms of birth and infants characteristics , a significant relationship was shown between the delivery mode with doctor s influence in taking decision and the place of birth ( table 2 ) . sociodemographic features of women birth and infant features 3 data is missing in cesarean group the factors affecting caesarean deliveries are seen in table 3 . accordingly , when public hospitals are taken as reference , caesarean deliveries were increased by 11.2 fold in the event of the delivery in private hospital ; 6.1 fold in the event of the delivery in university hospital . again with reference to the conditions of woman s husband work on her own account , working in private sector or public sector increases 2.2 fold the caesarean birth . doctor s guidance increases the caesarean 4.0 times with reference to those who say doctor had no impact on the delivery mode . when the deliveries made between 17:0007:59 are taken as reference , caesarean deliveries are increased by 7.1 times between 08:0016:59 . women s place of residence , age , presence of health insurance , family type , husband s job , the place of birth , the birth hour and doctor s intervention to delivery mode have been identified as factors affecting the caesarean section delivery in univariate analyses performed . meanwhile in multivariate analyses , the place of delivery , time of the birth , doctor s effect , and husband s employment status have been identified as factors affecting the caesarean delivery among these factors . caesarean deliveries realized 11.2 times more in private hospitals and 6.1 times more in university hospitals in primiparous with reference to public hospitals in the study conducted . it was demonstrated that caesarean deliveries were increased by 12.7 times in university and top level hospitals with reference to deliveries of primiparous women in second - line hospitals in a study conducted ( 3 ) . caesarean deliveries are particularly among the preferable methods in terms of avoiding the complications associated with the childbirth . caesarean deliveries are preferred especially for pregnant women at risk due to possible complications in terms of mother and infant during delivery , cephalopelvic disproportion or high birth weight infants . in such cases , if pregnant women are followed at 3rd step health institutions or are guided for delivery by 2nd step institutions , then it may increase caesarean deliveries in these institutions . one of the surprising aspects of the study was the 11.2 fold increase in caesarean delivery rates at private hospitals in spite of its equivalent adequacy with 2nd step health institutions in terms of the equipment with reference to public hospitals . caesarean delivery rates in private hospitals are significantly more than public hospitals in the studies performed ( 10 , 11 ) . this increment is rooted in social and economic factors as well as medical reasons . in our study , working female ratio is around 50% both in case and control groups . and a very small portion of the husbands are unemployed . the employed status of the husband regardless of private or public or his own account , means the woman is also under the insurance coverage . on the other hand , employed status of the husband caesarean deliveries are more in the women with any health insurance compared to those without insurance in all studies conducted ( 3 , 12 , 13 ) . this situation should be considered in conjunction with the finding of caesarean deliveries in private hospitals are , more which is another finding of the study . caesarean deliveries within working hours are 7.4 times more with reference to out of working hours ( 18:0008:00 ) in our study . caesarean operations increased on fridays and between 06:00 a.m. and 06:00 p.m. with respect to primaparous ( 14 ) . meanwhile in another study , a relationship was shown between the time of caesarean section and insurance status . while the time of caesarean shows dispersed within a day in kaiser type insured women , there was an increase between 4 in the morning and 6 in the evening in other type insured women having caesarean . the caesarean section rate is the lowest between 10 at night and 6 in the morning in all insured groups ( 15 ) . caesarean deliveries are also the operations performed with the patient s consent in line with physician s clinical evaluations and conviction just like in all other medical procedures . physicians can offer particular options about delivery mode even though a specific preference is expressed for the patient . if the caesarean delivery is planned , caesarean delivery will take place , however if the plan is vaginal delivery then the delivery may be realized through vaginal or caesarean section ( 16 ) . elective caesarean elective caesarean deliveries are estimated to be around 418% of all caesarean sections and 2% of all deliveries ( 17 ) . 31.1% of the women who gave birth through caesarean section have decided caesarean delivery without doctor s influence in the study . on the other hand , caesarean delivery rates increase by 4.03 times with reference to those without doctor s effect for the determination of delivery mode . we believe that the increase with doctor s effect in caesarean deliveries occurs in two ways . even if the woman herself decides the delivery mode , beforehand women are informed by physicians about benefits or risks of caesarean delivery ( 16 ) or physicians directly affect the patient s decision - making process in caesarean practices due to the knowledge asymmetry between the patient and the physician ( 14 ) . caesarean deliveries are preferred because of physicians habits , caesarean deliveries bring more income and vaginal births take more time and defensive medicine application due to the fear of malpractice and complication during birth or pregnancy ( 18 ) . although the results do not show all of the factors affecting the caesarean delivery in primiparous , they also reveal that medical reasons are not the only reason in this increase trend . health policy makers and health professionals are required to identify the causes of this increase and to take measures . the strong side of the study is taking only the women who gave first birth in the study and reaching the complete universe of the study . on the other hand , indetermination and non - exclusion of caesarean sections with medical causes in study questions ethical issues ( including plagiarism , informed consent , misconduct , data fabrication and/or falsification , double publication and/or submission , redundancy , etc . ) have been completely observed by the authors .

background : p cesarean delivery rates have been increasing throughout the world . parallel to the developments in the world the cesarean rate in turkey has risen to 48.1% in 2013 . some of the social factors were related with cesarean births . the purpose of this study was to determine cesarean birth rates and to find out social factors affecting the cesarean birth in primiparous women.methods:this study was conducted in burdur province , turkey between the dates of 1 jan 201231 dec 2012 on 223 primiparous women . the data was collected with data collection form prepared by the researchers by using face - to - face interview technique . in these analyses , chi - square and backward logistic regression analyses were used.results:in multivariate analyses , the place of delivery ( or : 11.2 [ 2.942.46 ] in private hospital and or : 6.1 [ 2.614.1 ] in university hospital ) ; time of the birth ( or : 7.1 [ 3.116.0 ] ) ; doctor s effect ( or : 4.0 [ 1.88.95 ] ) and husband s employment status ( or : 2.23 [ 1.04.7 ] ) have been identified as factors affecting the caesarean delivery in primiparous women.conclusion:although the results do not show all of the factors affecting the caesarean delivery in primiparous women , they reveal that medical reasons are not the only reason in this increase trend . health policy makers and health professionals are required to identify the causes of this increase and to take measures .

inspection of the database of clusters of orthologous groups of proteins ( cogs ) revealed only one family of such proteins that is represented in most of the sequenced bacterial , archaeal and eukaryotic genomes . the prototype of this family is the rhomboid ( rho ) protein from drosophila melanogaster , a developmental regulator involved in epidermal growth factor ( egf)-dependent signaling pathways [ 2 - 4 ] . not only were homologs of rhomboid detected in prokaryotes and eukaryotes , but the pattern of sequence conservation in this family appeared uncharacteristic of nonenzymatic membrane proteins , such as transporters . specifically , several polar amino - acid residues are conserved in nearly all members of the rhomboid family , suggesting the possibility of an enzymatic activity . as three of these conserved residues were histidines , it has been hypothesized that rhomboid - family proteins could function as metal - dependent membrane proteases . recently , however , it has been shown that rho cleaves a transmembrane helix ( tmh ) in the membrane - bound precursor of the tgf-like growth factor spitz , enabling the released spitz to activate the egf receptor , and that a conserved serine and a conserved histidine in rho are essential for this cleavage . thus , it appears that rhomboid - family proteins are a distinct group of intramembrane serine proteases . altogether , the genome of drosophila encodes seven rho paralogs ( now designated rho1 - 7 , with the original rhomboid becoming rho-1 ) , at least three of which are involved in distinct egf - dependent pathways , apparently through proteolytic activation of diverse ligands of the egf receptor . the newly discovered intramembrane proteolytic activity of rho places the rhomboid family within the framework of regulated intramembrane proteolysis ( rip ) , a new paradigm of signal transduction , which appears to be prominent in all forms of life . under rip , signaling proteins undergo site - specific proteolysis within tmh , resulting in the release of active fragments , which are the actual effectors in signal tranduction cascades . until recently , the only characterized cases of rip in eukaryotes involved presenilin-1 , an aspartyl protease , which cleaves a transmembrane helix in type-1 membrane proteins such as amyloid -precursor protein ( app ) , notch and ire1 , and the metalloprotease s2p , which cleaves a tmh in a type-2 transmembrane protein , the sterol - dependent transcription factor srebp . notably , s2p has highly conserved bacterial homologs , and the protease domain of presenilins also might be homologous to bacterial and archaeal type iv prepilin peptidases , although , in this case , the sequence similarity is low . in the case of the rhomboid family , the existence of homologs of rho in most prokaryotes is particularly remarkable because animal rho proteins are involved in signaling pathways that are not found outside metazoa , which seems to make functional conservation in prokaryotes a remote possibility . the only prokaryotic protein of the rhomboid family that has been characterized experimentally in considerable detail is aara from the bacterium providencia stuartii . this protein is involved in the export of a quorum - sensing peptide , a function that , in physiological terms , resembles that of rho , although the signaling molecules , other than rho and aara , are obviously unrelated . in a striking recent development , two independent research groups have shown that several bacterial rhomboid - family proteins , including aara , can cleave the egf receptor ligands ( spitz , keren and gurken ) that are normally cleaved by rho paralogs . the cleavage depended on the conserved serine and histidine residues and , moreover , transgenic flies that expressed aara developed a phenotype indistinguishable from that induced by overexpression of rho , whereas rho could substitute for aara in providencia stuartii . these unexpected findings demonstrated the conservation of a rip mechanism producing extracellular signals in eukaryotes and prokaryotes . eukaryotic rhomboid family proteins seem to show considerable functional variability ; in particular , cross - talk might exist between different rip pathways . a distinct representative of the rhomboid family has been shown to physically interact with presinilins 1 and 2 , and was accordingly named presenilins - associated rhomboid - like protein ( parl ) . the yeast ortholog of parl has been suggested to participate in the processing of cytochrome c peroxidase precursor during its import into the mitochondrion . the near ubiquity of the rhomboid family among bacteria , archaea and eukaryotes , along with the remarkable functional conservation , suggests that a signaling mechanism mediated by rhomboids might have functioned already in the last common ancestor of all extant life forms , with subsequent loss in several lineages . to address this possibility although the sequence similarity between eukaryotic and prokaryotic rhomboid family proteins is relatively low ( around 10 - 15% identity in the conserved region ) , the entire superfamily could be retrieved from the protein sequence databases within three iterations of the psi - blast program with a high statistical significance and without any false positives . the conserved core of the rhomboid family consists of six conserved tmhs ( figure 1 ) . the predicted catalytic serine is located in tmh5 , whereas the predicted catalytic histidine is in tmh7 ; tmh3 contains two additional histidines and an asparagine , which are conserved in the great majority of the rhomboid - family proteins ( figure 1 ) . the roles of these conserved residues are not known , but , given the remarkable evolutionary conservation , it seems likely that they also contribute to catalysis ; indeed , it has been shown that the conserved asparagine is required for the cleavage of spitz by rho . when examining the multiple alignment of the rhomboid superfamily proteins , we noticed that several eukaryotic members appear to be inactivated proteases , as indicated by the loss of the predicted catalytic serine or histidine ( figure 1 , and data not shown ) ; these inactivated forms could be regulators of active rhomboid proteases . several other proteins lack one or more of the conserved residues in tmh3 ; it remains unclear whether or not these are active proteases . bacterial and archaeal members of the rhomboid superfamily contain six tmh , whereas the eukaryotic members typically have an additional seventh tmh , which may be attached to the core either from the amino terminus or from the carboxyl terminus as discussed below . the phyletic distribution pattern of the rhomboid family shows that this intramembrane protease is extremely common in all three kingdoms of life , but is not necessarily essential for cell function . rhomboids are missing in the microsporidian encephalitozoon cuniculi , a eukaryotic intracellular parasite with a highly degraded genome , the archaea methanothermobacter thermoautotrophicus and thermoplasma volcanium , and several bacterial species , primarily parasites with small genomes but also species with moderately sized genomes , such as xylella fastidiosum ( see cog0705 at ) . in two instances , a representative of the rhomboid family is present in only one of a pair of relatively close genomes ( present in t. acidophilum but missing in t. volcanium ; present in the spirochete treponema pallidum but missing in the related bacterium borrelia burgdorferi ) , which suggests relatively recent , repeated losses of this gene . most of the prokaryotic species have a single gene coding for a rhomboid - family protein , although some have two or three paralogs ( see cog0705 ) ; in contrast , eukaryotes show expansion of the rhomboid family , with seven members in drosophila , and as many as 13 in arabidopsis . the multiple alignment of the 6-tmh core of the rhomboid family ( figure 1 ) was employed to construct a phylogenetic tree using the least - squares algorithm with subsequent optimization using the maximum likelihood ( ml ) method ( see materials and methods ) . only the conserved regions including the tmh and short adjacent stretches shown in figure 1 were used as the input for tree building , whereas the poorly conserved intervening regions were omitted to avoid noise from potentially misaligned residues ( except for the bayesian analysis , which used the complete alignment ; see materials and methods ) . the phylogenetic tree of the rhomboid family presents a complex and unexpected picture ( figure 2 ) . neither the eukaryotic nor the archaeal subsets of the family appear to form monophyletic clades . instead , the eukaryotic rhomboids are split between two major subfamilies , which are positioned in the midst of different prokaryotic branches ( figure 2 ) . the first subfamily , which includes six of the seven drosophila rhomboids , clusters with a distinct prokaryotic assemblage , consisting primarily of gram - positive bacteria as well as a subset of archaea ; this clade is strongly supported by bootstrap analysis ( figure 2 ) . the proteins in this group of eukaryotic rhomboids , which we designated the rho subfamily , typically have an extra tmh added carboxy - terminally to the 6-tmh core ; some of these proteins also contain ef - hand calcium - binding domains amino - terminally of the core ( figure 2 ) . the second eukaryotic subfamily , which we designated the parl subfamily , after parl , the human ortholog of drosophila rho7 , resides within a large , heterogeneous prokaryotic cluster ( figure 2 ) . within this subfamily , parl and its orthologs from other animals and from fungi have distinct domain architecture , with an extra tmh added to the amino terminus of the core , whereas the rest have only the core ( a carboxy - terminal tmh and a ubiquitin - associated domain are appended in one arabidopsis protein ; figure 2 ) . thus , the existence of two distinct subfamilies of eukaryotic rhomboids is supported by features of domain architectures that appear to comprise shared derived characters . within these two major eukaryotic subfamilies , several lineage - specific expansions of paralogs are noticeable , in insects , mammals and plants ( figure 2 ) . archaeal rhomboids are scattered over the phylogenetic tree , with two major clusters and , in addition , three isolated proteins joining different bacterial branches ( figure 2 ) . there is no indication of an affinity between any of the archaeal and eukaryotic rhomboids . although many of the bacterial rhomboids form phylogenetically coherent clusters corresponding to the established bacterial lineages , there are also several clusters that have an odd composition , such as the grouping of proteobacterial and gram - positive species ; some of these clusters are well supported by bootstrap ( see clusters 1 - 4 in figure 2 ) . this concern is particularly serious for highly divergent families of membrane proteins , such as the rhomboids , in which parallel amino - acid substitutions are likely . therefore we investigated the phylogeny of the rhomboid family in greater detail using several independent phylogenetic methods and the corresponding statistical tests . first , we assessed the robustness of the topology of the tree shown in figure 2 using the kishino - hasegawa ( kh ) test whereby the clade of interest is forced into various positions on the tree and the likelihoods of the resulting topologies are estimated . specifically , the kh test was used to evaluate two alternative topologies , in which the rho and parl subfamilies formed a clade , and two topologies , in which the rho subfamily formed a clade with archaeal rhomboids ( figure 2 and table 1 ) . each of these alternative topologies had a significantly lower likelihood than the original topology shown in figure 2 ( see table 1 ) . in addition , a tree of the rhomboid family was constructed using the bayesian inference method , which has recently become a practical alternative to the more traditional methods of phylogenetic analysis . the tree produced using the mrbayes package showed the same major clades as the tree in figure 2 ( data not shown ) ; moreover , clustering of the rho and parl subfamilies of eukaryotic rhomboids with the respective prokaryotic clades was supported by high posterior probabilities ( figure 2 ) . we also attempted to construct a phylogenetic tree of the rhomboid family by using the maximum parsimony method . the resulting tree contained the same major clades as the trees constructed using ml and mrbayes ; however , the number of parsimony - informative sites was insufficient to obtain high bootstrap support with this approach ( data not shown ) . the alternative phylogenies reflected two distinct hypotheses : first , clustering of the rho and parl subfamilies of eukaryotic rhomboids with the prokaryotic rhomboid families as suggested by the tree topology in figure 2 ; and second , monophyly of the eukaryotic rhomboids ( figure 3 ) . the phylogenies corresponding to these alternative hypotheses were compared to the best phylogeny using three statistical tests ( table 2 ) . the hypothesis 1 tree was not significantly different from the best tree under any of these tests whereas the hypothesis 2 tree was significantly ( p < 0.05 ) worse than the best tree according to each of the tests ( table 2 ) . the concordance of the results obtained with several independent methods for phylogenetic tree construction and statistical analysis specifically aimed at testing the alternative hypothesis of monophyletic origin of eukaryotic rhomboids shows strong support for the major aspects of the tree topology in figure 2 and , in particular , for the polyphyly of eukaryotic rhomboids . the phylogenetic tree of the rhomboid family shown in figure 2 and supported by the additional tests described above follows neither the ' standard model ' scenario , with the major split between the archaeo - eukaryotic and bacterial lineages nor the ' mitochondrial ' scenario , which postulates acquisition of a gene by eukaryotes from the pro - mitochondrial endosymbiont . neither can this tree be explained by postulating a small number of lineage - specific gene losses . the parsimonious interpretation of the rhomboid family tree seems to be that the evolutionary history of this family had been replete with horizontal gene transfer ( hgt ) and lineage - specific gene loss events . in particular , in spite of the presence of rhomboids in the majority of modern life forms from all three primary superkingdoms , phylogenetic analysis suggests that this family has not been inherited from the last universal common ancestor ( luca ) . instead , the tree topology seems to indicate that this family emerged in some bacterial lineage and afterwards had been widely disseminated by hgt , and then lost in some lineages . in particular , at least two hgt events seem to have contributed to the origin of eukaryotic rhomboids , one of them yielding the rho subfamily and the other one the parl subfamily , with a possible additional hgt in plants ( figures 2,3 ) . given the broad phyletic representation of both subfamilies of eukaryotic rhomboids , both the rho subfamily and the parl subfamily must have been acquired through hgt at an early stage of eukaryotic evolution , definitely before the divergence of the major crown - group lineages . this early epoch in eukaryotic evolution is thought to have been dominated by hgt from multiple bacterial symbionts . an alternative to this multiple - hgt scenario is that luca already had multiple , paralogous rhomboids , which evolved by a series of ancient gene duplications , and the odd topology of the phylogenetic tree is due primarily to differential loss of these ancient paralogs . although this can not be ruled out formally , this hypothesis implies the existence of an elaborate signaling system in luca and , accordingly , suggests that luca was a complex organism , which might have had as many genes as modern bacteria . theoretical analysis of evolutionary scenarios constructed on the basis of the phyletic patterns of cogs by applying the parsimony principle shows that the complexity of the inferred gene set of luca critically depends on the relative rates of gene loss and hgt at the early stages of evolution . a complex luca with around 2,000 genes is predicted only when one assumes that the rate of gene loss is an order of magnitude greater than the rate of hgt . however , explicit reconstruction of the gene set of luca under the assumption of equal rates of gene loss and hgt leads to a hypothetical genome that consists of only around 600 genes but appears to be ' compatible with life ' , that is , it includes genes responsible for most , if not all , essential cellular functions . we currently believe that this is the most realistic , albeit inevitably imprecise , reconstruction of luca 's gene set . with respect to the rhomboid family and other families whose phylogenetic trees show similar patterns , this makes the multiple - hgt interpretation the scenario of choice . further theoretical , comparative - genomic and experimental analyses aimed at determining relative rates of gene loss and hgt will help in a more objective assessment of the validity of this argument . the multiple - hgt interpretation of the evolutionary history of the rhomboid family , while supported by the above argument , seems , at least at first glance , distinctly counter - intuitive , given that this family is nearly ubiquitous among extant life forms . indeed , when attempts are made to construct parsimonious evolutionary scenarios on the basis of phyletic patterns alone [ 31 - 33 ] , there is no chance that such a widespread family is not assigned to luca . it should be realized , however , that these approaches are inherently probabilistic , and extensive hgt can fool them . for the rhomboid family , the multiple - hgt mode of evolution seems to be particularly plausible . it seems likely that the ultimate ancestor of the rhomboid family evolved from a nonenzymatic integral membrane protein , probably a transporter that might have been involved in an early primitive form of export of signaling peptides in bacteria . the protease active center might have evolved in such a transporter by chance emergence of the suitable catalytic amino acids within two or three of the tmhs ( figure 4 ) . this would enable the transition from simple transport to the rip mode of controlled export of signaling molecules . emergence of rip could have conferred a major selective advantage on the respective bacteria and might have resulted in an evolutionary sweep whereby the gene carrying this trait was repeatedly fixed , rather than eliminated , after hgt . in terms of the evolution of sequence itself , the requirements for the conservation of the protease activity apparently ' locked ' the rhomboid family in a regime of relatively slow evolution , which ensures significant sequence similarity between all family members ( figure 1 ) . the scenario of origin from non - catalytic transporters might potentially apply to other integral membrane enzymes , including intramembrane proteases involved in rip , such as presenilins and their homologs and the archaeo - eukaryotic signal peptide peptidase . although the sequence similarity between eukaryotic and prokaryotic rhomboid family proteins is relatively low ( around 10 - 15% identity in the conserved region ) , the entire superfamily could be retrieved from the protein sequence databases within three iterations of the psi - blast program with a high statistical significance and without any false positives . the conserved core of the rhomboid family consists of six conserved tmhs ( figure 1 ) . the predicted catalytic serine is located in tmh5 , whereas the predicted catalytic histidine is in tmh7 ; tmh3 contains two additional histidines and an asparagine , which are conserved in the great majority of the rhomboid - family proteins ( figure 1 ) . the roles of these conserved residues are not known , but , given the remarkable evolutionary conservation , it seems likely that they also contribute to catalysis ; indeed , it has been shown that the conserved asparagine is required for the cleavage of spitz by rho . when examining the multiple alignment of the rhomboid superfamily proteins , we noticed that several eukaryotic members appear to be inactivated proteases , as indicated by the loss of the predicted catalytic serine or histidine ( figure 1 , and data not shown ) ; these inactivated forms could be regulators of active rhomboid proteases . several other proteins lack one or more of the conserved residues in tmh3 ; it remains unclear whether or not these are active proteases . bacterial and archaeal members of the rhomboid superfamily contain six tmh , whereas the eukaryotic members typically have an additional seventh tmh , which may be attached to the core either from the amino terminus or from the carboxyl terminus as discussed below . the phyletic distribution pattern of the rhomboid family shows that this intramembrane protease is extremely common in all three kingdoms of life , but is not necessarily essential for cell function . rhomboids are missing in the microsporidian encephalitozoon cuniculi , a eukaryotic intracellular parasite with a highly degraded genome , the archaea methanothermobacter thermoautotrophicus and thermoplasma volcanium , and several bacterial species , primarily parasites with small genomes but also species with moderately sized genomes , such as xylella fastidiosum ( see cog0705 at ) . in two instances , a representative of the rhomboid family is present in only one of a pair of relatively close genomes ( present in t. acidophilum but missing in t. volcanium ; present in the spirochete treponema pallidum but missing in the related bacterium borrelia burgdorferi ) , which suggests relatively recent , repeated losses of this gene . most of the prokaryotic species have a single gene coding for a rhomboid - family protein , although some have two or three paralogs ( see cog0705 ) ; in contrast , eukaryotes show expansion of the rhomboid family , with seven members in drosophila , and as many as 13 in arabidopsis . the multiple alignment of the 6-tmh core of the rhomboid family ( figure 1 ) was employed to construct a phylogenetic tree using the least - squares algorithm with subsequent optimization using the maximum likelihood ( ml ) method ( see materials and methods ) . only the conserved regions including the tmh and short adjacent stretches shown in figure 1 were used as the input for tree building , whereas the poorly conserved intervening regions were omitted to avoid noise from potentially misaligned residues ( except for the bayesian analysis , which used the complete alignment ; see materials and methods ) . the phylogenetic tree of the rhomboid family presents a complex and unexpected picture ( figure 2 ) . neither the eukaryotic nor the archaeal subsets of the family appear to form monophyletic clades . instead , the eukaryotic rhomboids are split between two major subfamilies , which are positioned in the midst of different prokaryotic branches ( figure 2 ) . the first subfamily , which includes six of the seven drosophila rhomboids , clusters with a distinct prokaryotic assemblage , consisting primarily of gram - positive bacteria as well as a subset of archaea ; this clade is strongly supported by bootstrap analysis ( figure 2 ) . the proteins in this group of eukaryotic rhomboids , which we designated the rho subfamily , typically have an extra tmh added carboxy - terminally to the 6-tmh core ; some of these proteins also contain ef - hand calcium - binding domains amino - terminally of the core ( figure 2 ) . the second eukaryotic subfamily , which we designated the parl subfamily , after parl , the human ortholog of drosophila rho7 , resides within a large , heterogeneous prokaryotic cluster ( figure 2 ) . within this subfamily , parl and its orthologs from other animals and from fungi have distinct domain architecture , with an extra tmh added to the amino terminus of the core , whereas the rest have only the core ( a carboxy - terminal tmh and a ubiquitin - associated domain are appended in one arabidopsis protein ; figure 2 ) . thus , the existence of two distinct subfamilies of eukaryotic rhomboids is supported by features of domain architectures that appear to comprise shared derived characters . within these two major eukaryotic subfamilies , several lineage - specific expansions of paralogs are noticeable , in insects , mammals and plants ( figure 2 ) . archaeal rhomboids are scattered over the phylogenetic tree , with two major clusters and , in addition , three isolated proteins joining different bacterial branches ( figure 2 ) . there is no indication of an affinity between any of the archaeal and eukaryotic rhomboids . although many of the bacterial rhomboids form phylogenetically coherent clusters corresponding to the established bacterial lineages , there are also several clusters that have an odd composition , such as the grouping of proteobacterial and gram - positive species ; some of these clusters are well supported by bootstrap ( see clusters 1 - 4 in figure 2 ) . this concern is particularly serious for highly divergent families of membrane proteins , such as the rhomboids , in which parallel amino - acid substitutions are likely . therefore we investigated the phylogeny of the rhomboid family in greater detail using several independent phylogenetic methods and the corresponding statistical tests . first , we assessed the robustness of the topology of the tree shown in figure 2 using the kishino - hasegawa ( kh ) test whereby the clade of interest is forced into various positions on the tree and the likelihoods of the resulting topologies are estimated . specifically , the kh test was used to evaluate two alternative topologies , in which the rho and parl subfamilies formed a clade , and two topologies , in which the rho subfamily formed a clade with archaeal rhomboids ( figure 2 and table 1 ) . each of these alternative topologies had a significantly lower likelihood than the original topology shown in figure 2 ( see table 1 ) . in addition , a tree of the rhomboid family was constructed using the bayesian inference method , which has recently become a practical alternative to the more traditional methods of phylogenetic analysis . the tree produced using the mrbayes package showed the same major clades as the tree in figure 2 ( data not shown ) ; moreover , clustering of the rho and parl subfamilies of eukaryotic rhomboids with the respective prokaryotic clades was supported by high posterior probabilities ( figure 2 ) . we also attempted to construct a phylogenetic tree of the rhomboid family by using the maximum parsimony method . the resulting tree contained the same major clades as the trees constructed using ml and mrbayes ; however , the number of parsimony - informative sites was insufficient to obtain high bootstrap support with this approach ( data not shown ) . the alternative phylogenies reflected two distinct hypotheses : first , clustering of the rho and parl subfamilies of eukaryotic rhomboids with the prokaryotic rhomboid families as suggested by the tree topology in figure 2 ; and second , monophyly of the eukaryotic rhomboids ( figure 3 ) . the phylogenies corresponding to these alternative hypotheses were compared to the best phylogeny using three statistical tests ( table 2 ) . the hypothesis 1 tree was not significantly different from the best tree under any of these tests whereas the hypothesis 2 tree was significantly ( p < 0.05 ) worse than the best tree according to each of the tests ( table 2 ) . the concordance of the results obtained with several independent methods for phylogenetic tree construction and statistical analysis specifically aimed at testing the alternative hypothesis of monophyletic origin of eukaryotic rhomboids shows strong support for the major aspects of the tree topology in figure 2 and , in particular , for the polyphyly of eukaryotic rhomboids . the phylogenetic tree of the rhomboid family shown in figure 2 and supported by the additional tests described above follows neither the ' standard model ' scenario , with the major split between the archaeo - eukaryotic and bacterial lineages nor the ' mitochondrial ' scenario , which postulates acquisition of a gene by eukaryotes from the pro - mitochondrial endosymbiont . neither can this tree be explained by postulating a small number of lineage - specific gene losses . the parsimonious interpretation of the rhomboid family tree seems to be that the evolutionary history of this family had been replete with horizontal gene transfer ( hgt ) and lineage - specific gene loss events . in particular , in spite of the presence of rhomboids in the majority of modern life forms from all three primary superkingdoms , phylogenetic analysis suggests that this family has not been inherited from the last universal common ancestor ( luca ) . instead , the tree topology seems to indicate that this family emerged in some bacterial lineage and afterwards had been widely disseminated by hgt , and then lost in some lineages . in particular , at least two hgt events seem to have contributed to the origin of eukaryotic rhomboids , one of them yielding the rho subfamily and the other one the parl subfamily , with a possible additional hgt in plants ( figures 2,3 ) . given the broad phyletic representation of both subfamilies of eukaryotic rhomboids , both the rho subfamily and the parl subfamily must have been acquired through hgt at an early stage of eukaryotic evolution , definitely before the divergence of the major crown - group lineages . this early epoch in eukaryotic evolution is thought to have been dominated by hgt from multiple bacterial symbionts . an alternative to this multiple - hgt scenario is that luca already had multiple , paralogous rhomboids , which evolved by a series of ancient gene duplications , and the odd topology of the phylogenetic tree is due primarily to differential loss of these ancient paralogs . although this can not be ruled out formally , this hypothesis implies the existence of an elaborate signaling system in luca and , accordingly , suggests that luca was a complex organism , which might have had as many genes as modern bacteria . theoretical analysis of evolutionary scenarios constructed on the basis of the phyletic patterns of cogs by applying the parsimony principle shows that the complexity of the inferred gene set of luca critically depends on the relative rates of gene loss and hgt at the early stages of evolution . a complex luca with around 2,000 genes is predicted only when one assumes that the rate of gene loss is an order of magnitude greater than the rate of hgt . however , explicit reconstruction of the gene set of luca under the assumption of equal rates of gene loss and hgt leads to a hypothetical genome that consists of only around 600 genes but appears to be ' compatible with life ' , that is , it includes genes responsible for most , if not all , essential cellular functions . we currently believe that this is the most realistic , albeit inevitably imprecise , reconstruction of luca 's gene set . with respect to the rhomboid family and other families whose phylogenetic trees show similar patterns , this makes the multiple - hgt interpretation the scenario of choice . further theoretical , comparative - genomic and experimental analyses aimed at determining relative rates of gene loss and hgt will help in a more objective assessment of the validity of this argument . the multiple - hgt interpretation of the evolutionary history of the rhomboid family , while supported by the above argument , seems , at least at first glance , distinctly counter - intuitive , given that this family is nearly ubiquitous among extant life forms . indeed , when attempts are made to construct parsimonious evolutionary scenarios on the basis of phyletic patterns alone [ 31 - 33 ] , there is no chance that such a widespread family is not assigned to luca . it should be realized , however , that these approaches are inherently probabilistic , and extensive hgt can fool them . for the rhomboid family , the multiple - hgt mode of evolution seems to be particularly plausible . it seems likely that the ultimate ancestor of the rhomboid family evolved from a nonenzymatic integral membrane protein , probably a transporter that might have been involved in an early primitive form of export of signaling peptides in bacteria . the protease active center might have evolved in such a transporter by chance emergence of the suitable catalytic amino acids within two or three of the tmhs ( figure 4 ) . this would enable the transition from simple transport to the rip mode of controlled export of signaling molecules . emergence of rip could have conferred a major selective advantage on the respective bacteria and might have resulted in an evolutionary sweep whereby the gene carrying this trait was repeatedly fixed , rather than eliminated , after hgt . in terms of the evolution of sequence itself , the requirements for the conservation of the protease activity apparently ' locked ' the rhomboid family in a regime of relatively slow evolution , which ensures significant sequence similarity between all family members ( figure 1 ) . the scenario of origin from non - catalytic transporters might potentially apply to other integral membrane enzymes , including intramembrane proteases involved in rip , such as presenilins and their homologs and the archaeo - eukaryotic signal peptide peptidase . the rhomboid family might be the most widespread and conserved group of integral membrane proteins . in and by itself , this would suggest that this family is part of the gene repertoire of luca . however , phylogenetic analysis suggests a different scenario , one of emergence in a bacterial lineage with subsequent multiple , independent hgt events and gene losses . although caution is due in the evolutionary interpretation of phylogenetic trees for large families , particularly when membrane proteins with a relatively small number of conserved positions , such as the rhomboids , are involved , the multiple - hgt scenario seemed to be supported by several methods of tree analysis and statistical tests . eukaryotes probably acquired their two major rhomboid subfamilies , rho and parl , as the result of two independent , early hgt events . these events , which might have introduced rip as a means of intercellular communication , could have been pivotal in the evolution of eukaryotic multicellularity along the lines discussed previously with regard to the apparent bacterial origin of key components of eukaryotic programmed cell death machinery . subsequent evolution of rhomboids in eukaryotes proceeded by lineage - specific expansion of paralogs followed by diversification through the addition of an extra tmh in different positions relative to the catalytic core , some limited domain accretion ( see figure 2 ) and sequence divergence . phylogenetic analysis of the rhomboid family described here carries a general message for studies aimed at the reconstruction of ancestral life forms , particularly luca . although most of the ( nearly ) ubiquitous protein families probably do derive from luca , explicit phylogenetic analysis is required to ascertain this in each case . the nonredundant ( nr ) protein sequence database at the national center for biotechnology information ( nih , bethesda ) was searched iteratively using the psi - blast program with multiple starting queries . psi - blast was normally run with expectation ( e ) value of 0.01 as the cut - off for inclusion of sequences into the position - specific scoring matrix . multiple alignments of protein sequences were constructed using the clustalw program and manually adjusted on the basis of the examination of psi - blast search outputs and the superposition of the predicted tmhs , which were identified using the programs tmpred and tmap . phylogenetic trees were built using the least - squares method implemented in the fitch program of the phylip package , with subsequent local rearrangement using the protml program of the molphy package to obtain the maximum likelihood tree . the reliability of the tree topology was assessed using the rell ( resampling of estimated log - likelihoods ) bootstrap method of molphy , with 10,000 replications . alternative placements of selected clades in maximum - likelihood trees were compared by using the rearrangement optimization method ( kishino - hasegawa test ) as implemented in the protml program [ 43 - 45 ] . maximum parsimony trees were constructed using the heuristic search option of paup * . in addition , trees were constructed by bayesian inference using the markov chain monte carlo method as implemented in the mrbayes package . the complete alignment information , including columns with gaps , was used for the mrbayes analysis . constraint trees were imported into paup * and subjected to neighbor - joining search to generate the phylogenies corresponding to alternative hypotheses . these phylogenies were compared using the kh , templeton ( wilcoxon signed - ranks ) and winning - sites ( sign ) tests implemented in paup*. l.p . is supported by a grant from the natural sciences and engineering research council of canada . the alignment includes the majority of the detected rhomboid family proteins ; some closely related sequences were omitted . only the six conserved ( predicted ) transmembrane helices ( tmh ) and short surrounding regions are shown . the boundaries of the predicted tmh are indicated by gray shading and overline and they are numbered 1 - 6 . the number of amino - acid residues in the omitted terminal and internal regions are indicated . the consensus shows amino - acid residues present in at least 90% of the aligned sequences ; h stands for hydrophobic residues ( a , c , i , l , v , m , f , y , w in the single - letter amino - acid code ) and s for small residues ( g , a , s , d , n , v ) . the proposed catalytic serine ( tmh4 ) and histidine ( tmh6 ) as well as conserved residues in tmh2 with possible ancillary roles in catalysis are highlighted in color . the proteins are identified with the gene identification ( gi ) number from the nonredundant database and an abbreviated species name . bacterial species are color - coded green , eukaryotic species blue and archaeal species yellow . species name abbreviations : aerpe , aeropyrum pernix ; agrtu , agrobacterium tumefaciens ; anoga , anopheles gambiae ; arath , arabidopsis thaliana ; arcfu , archaeoglobus fulgidus ; bacsu , bacillus subtilis ; brume , brucella melitensis ; caeel , caenorhabditis elegans ; caucr , caulobacter crescentus ; chlte , chlorobium tepidum ; cloac , clostridium acetobutilicum ; corgl , corynebacterium glutamicum ; deira , deinococcus radiodurans ; dicdi , dictyostelium discoideum ; drome , drosophila melanogaster ; escco , escherichia coli ; haein , haemophilus influenzae ; halsp , halobacterium sp . ; homsa , homo sapiens ; lacla , lactococcus lactis ; lisin , listeria innocua ; metja , methanoccocus jannaschii ; metka , methanopyrus kandleri ; metma , methanosarcina mazei ; meslo , mesorhizobium loti ; mycle , mycobacterium leprae ; myctu , mycobacterium tuberculosis ; neucr , neurospora crassa ; nossp , nostoc sp . ; prost , providencia stuartii ; pyrab , pyrococcus abyssi ; pyrae , pyrobaculum aerophilum ; ralso , ralstonia solanaraceum ; sacce , saccharomyces cerevisiae ; schpo , schizosaccharomyces pombe ; sinme , sinorhizobium meliloti ; strco , streptomyces coelicolor ; strpn , streptococcus pneumoniae ; sulso , sulfolobus solfataricus ; sulto , sulfolobus tokodaii ; synsp , synechocystis sp . ; theac , thermoplasma acidophilum ; thema , thermotoga maritima ; thete , thermus thermophilus ; vibch , vibrio cholerae ; xanca , xanthomonas campestris ; xylfa , xylella fastidiosa . the sequences and their regions used to construct the tree are exactly those shown in figure 1 . the color coding and abbreviations are as in figure 1 . the two major eukaryotic subfamilies are denoted as rho and parl ( see text ) and four clusters containing unexpected ( from a phylogenetic viewpoint ) sets of species are denoted 1 - 4 . the clades that were investigated in the kh test are denoted a through d. although the tree is shown in a pseudorooted form for convenience , this is an unrooted tree . internal nodes with at least 70% rell bootstrap supported are denoted by black circles and nodes with a 50 - 70% support by blue circles . the posterior probabilities reported by the mrbayes program are indicated for some key internal branches . the rho and parl subfamilies are denoted ; the remaining clusters include prokaryotic rhomboids designated as in figure 2 ( with ' a ' added to the gi number ) . within each cluster , the trees are unrooted , although shown in a pseudorooted form . a hypothetical scenario for the origin and dissemination of the rhomboid family proteases . the figure schematically shows the proposed three stages of evolution of the rhomboid family . in ( a ) , the progenitor of the rhomboid family functions as a transporter for a regulatory peptide in some bacterial lineage . in ( b ) , the catalytic site of the intramembrane protease evolves , allowing the switch to rip as the mechanism of the regulatory peptide release . in ( c ) , the emergence of rip is followed by a burst of hgt . the transmembrane helices of rhomboid are designated as in figure 1 ; their topology in the membrane is based on that proposed in . the catalytic histidine and serine are shown and connected by a dotted line to indicate the proposed charge - relay system of the protease ; possible ancillary catalytic residues are not shown . log - likelihood analysis of possible placements of selected branches of maximum likelihood trees for the proteins analyzed * a - d , clades that were subjected to local rearrangements in the tree as indicated in figure 2 and discussed in the text . bootstrap probability of the given tree calculated using the rell method ( resampling of estimated log - likelihoods ) . statistical comparisons of the best neighbor - joining tree with the hypothesis 1 and hypothesis 2 trees * probability of getting a more extreme test statistic under the null hypothesis of no difference between the two trees ( two - tailed test ) .

the near - universal presence of the rhomboid family in bacteria , archaea and eukaryotes appears to suggest that this protein is part of the heritage of the last universal common ancestor , phylogenetic tree analysis indicates a likely bacterial origin with subsequent dissemination by horizontal gene transfer .

tuberculosis of oral cavity is a rare entity . even before antitubercular chemotherapy era , oral lesions occurred less commonly in patients with pulmonary tuberculosis . a 55-year - old labourer was referred to the outpatient department of our centre as a case of suspected gingivobu - ccal carcinoma for further evaluation and management . he had a non - healing ulcer in the oral cavity for one and a half months , which was associated with pain . he had been well until six weeks earlier when he noticed a lesion in his oral cavity . he visited the local doctor for this and was given symptomatic treatment and vitamin supplements . on enquiry , he had no systemic symptoms of chronic disease like fever , weight loss , and loss of appetite or weight . he also had no history of tuberculosis or contact with a tuberculosis patient . on clinical examination , the patient had an ulcer in the right lower gingivobuccal sulcus of size about 21 cm and was covered with slough . there was also mild fullness and soft tissue induration in the cheek below the lip . the patient 's height was 167 cm ; weight , 62 kg ; blood pressure , 124/76 mm hg ; and pulse , 74 beats per minute . on further investigation , haemoglobin was 13.9 gm% , total white blood cell count was 6,400 cells / dl , and erythrocyte sedimentation rate was 13 mm at the end of one hour . these are usually accompanied by associated history like a stressor event or the presence of a sharp tooth , etc , pointing to diagnosis . . the most common cause of a non - healing ulcerative lesion in the oral cavity is malignancy . the history is usually that of a rapidly growing lesion that does not respond well to any form of management . in most cases it is also usually accompanied by weight loss and features of chronic disease . in a developing country every year , approximately 2.2 million people develop tuberculosis , of which about one million are new - smear positive highly infectious cases and about 5 lakh people die of tuberculosis every year . this should be considered in the differential diagnosis , particularly in a non - healing lesion that does not respond to the usual therapy . actinomycosis is a rare , chronic , spreading , suppurative , granulomatous and fibrosing infection characterised by the formation of multiple abscess , draining sinuses and the release of characteristic sulphur granules . peak incidence occurs between 15 and 30 years , and males are more frequently infected than females . the majority of examples of the clinical disease are cervicofacial ( 55% ) , with only 20% occurring in an abdo - minopelvic form and 15% as a thoracopulmonic form . . are anaerobic or aerotolerant ( facultatively anaerobic ) , non - sporulating , gram - positive bacteria that tend to form branching rods and filaments and have a fermentative type of carbohydrate metabolism . are not regarded as virulent human pathogens and are best considered as opportunistic pathogens , as they are normally present in healthy individuals as commensals of the mouth cavity and the upper respiratory tract . their presence in the oral and respiratory specimens does not necessarily signify clinical disease and might often not be reported . are polymicrobial . the copathogens are most commonly colonisers of the respective organ systems involved . they act synergistically by inhibiting host - defense mechanisms or reducing the oxygen tension in the affected tissue , which promotes the growth of actinomyces spp . syphilis is an infectious disease caused by a spirochete called treponema pallidum ( tp ) , which has a tropism for several organs and tissues in the body , causing complex clinical manifestations . transmission of syphilis occurs mostly through sexual intercourse and sites of inoculations are usually genitals , though it can also be extragenital . it is characterised by several different dermatological lesions , involving both skin and mucous membrane . in the first stage of the disease ( primary syphilis ) , oral chancres syphilitic chancre is a solitary , painless , indurated , hard in consistency , reddish ulcer , accompanied by regional lymphadenopathy , which is localised at the site of tp inoculation and usually resolves after approximately one month without scarring . in secondary syphilis , the oral manifestations are characteristic lesions , which are multiple mucous patches that are slightly raised and covered by grayish , white pseudomembranes and surrounded by erythema . oral lesions are often painful and snail track ulcers result when multiple mucous patches become confluent . the diagnosis is confirmed by the specific serology and the demonstration of tp in the lesion . tp has a slender , coiled morphology and when examined by dark - field microscopy , it was seen moving in a drifting rotary motion ( corkscrew ) . naat is better than dark - field microscopic examination in the case of oral lesions because of the possible presence of saprophytic tp in the mouth . chest x - ray revealed an ill - defined patchy opacity and reticulo - nodular opacities in the upper and mid zone of both lungs [ figure 2 ] . sputum was positive for the presence of acid - fast bacilli 1 + in two consecutive samples . these are usually accompanied by associated history like a stressor event or the presence of a sharp tooth , etc , pointing to diagnosis . . the most common cause of a non - healing ulcerative lesion in the oral cavity is malignancy . the history is usually that of a rapidly growing lesion that does not respond well to any form of management . in most cases it is also usually accompanied by weight loss and features of chronic disease . in a developing country every year , approximately 2.2 million people develop tuberculosis , of which about one million are new - smear positive highly infectious cases and about 5 lakh people die of tuberculosis every year . this should be considered in the differential diagnosis , particularly in a non - healing lesion that does not respond to the usual therapy . actinomycosis is a rare , chronic , spreading , suppurative , granulomatous and fibrosing infection characterised by the formation of multiple abscess , draining sinuses and the release of characteristic sulphur granules . peak incidence occurs between 15 and 30 years , and males are more frequently infected than females . the majority of examples of the clinical disease are cervicofacial ( 55% ) , with only 20% occurring in an abdo - minopelvic form and 15% as a thoracopulmonic form . are anaerobic or aerotolerant ( facultatively anaerobic ) , non - sporulating , gram - positive bacteria that tend to form branching rods and filaments and have a fermentative type of carbohydrate metabolism . are not regarded as virulent human pathogens and are best considered as opportunistic pathogens , as they are normally present in healthy individuals as commensals of the mouth cavity and the upper respiratory tract . their presence in the oral and respiratory specimens does not necessarily signify clinical disease and might often not be reported . they act synergistically by inhibiting host - defense mechanisms or reducing the oxygen tension in the affected tissue , which promotes the growth of actinomyces spp . syphilis is an infectious disease caused by a spirochete called treponema pallidum ( tp ) , which has a tropism for several organs and tissues in the body , causing complex clinical manifestations . transmission of syphilis occurs mostly through sexual intercourse and sites of inoculations are usually genitals , though it can also be extragenital . it is characterised by several different dermatological lesions , involving both skin and mucous membrane . in the first stage of the disease ( primary syphilis ) , oral chancres syphilitic chancre is a solitary , painless , indurated , hard in consistency , reddish ulcer , accompanied by regional lymphadenopathy , which is localised at the site of tp inoculation and usually resolves after approximately one month without scarring . in secondary syphilis , the oral manifestations are characteristic lesions , which are multiple mucous patches that are slightly raised and covered by grayish , white pseudomembranes and surrounded by erythema . oral lesions are often painful and snail track ulcers result when multiple mucous patches become confluent . the diagnosis is confirmed by the specific serology and the demonstration of tp in the lesion . tp has a slender , coiled morphology and when examined by dark - field microscopy , it was seen moving in a drifting rotary motion ( corkscrew ) . naat is better than dark - field microscopic examination in the case of oral lesions because of the possible presence of saprophytic tp in the mouth . chest x - ray revealed an ill - defined patchy opacity and reticulo - nodular opacities in the upper and mid zone of both lungs [ figure 2 ] . sputum was positive for the presence of acid - fast bacilli 1 + in two consecutive samples . primary tuberculosis of the oral cavity is rare , as it occurs in young individuals and is associated with cervical lymphadenopathy.[258 ] secondary tuberculosis of the oral cavity usually occurs following pulmonary tuberculosis . it is more common than the primary variety and occurs more often in old age.[257 ] tuberculosis of the oral cavity is rare because the intact mucosa is resistant to tuberculous infection and saliva has a protective effect . other possible causes for the relative rarity of oral tuberculosis include the presence of saprophytes in the oral cavity and resistance of stratified muscles to bacterial invasion . there are reports in which dentists with pulmonary tuberculosis have infected patients during dental manipulation . nasolabial infection occurred in a physician who administered mouth - to - mouth resuscitation to a tuberculosis patient . other sites include the gingiva , soft palate , lip , buccal mucosa , floor of the mouth , and gingivobuccal sulcus . oral tuberculosis may present as single or multiple , painful or painless ulcers with irregular border . it can also present as nodules , fissures , vesicles , or peri - apical granulomas . the oral tuberculous ulcers have some characteristic clinical features including chronicity , hyperemic changes , and multiple or satellite lesions , which lead to the suspicion of a tuberculous lesion . oral tuberculosis occurs in 0.4 - 1.5% of patients with pulmonary tuberculosis . at present , with improved community health and anti - tubercular medication , the incidence of tuberculosis has decreased . oral tuberculosis is not considered in the differential diagnosis of patients with oral ulcer by many clinicians ; hence , it is missed or the treatment is delayed . the purpose of this paper is to alert clinicians to consider oral tuberculosis in patients with non - healing oral ulcer . on consultation with the physician , anti - tubercular therapy was initiated with isoniazid ( 10 mg / kg of body weight ) , rifampicin ( 10 - 20 mg / kg of body weight ) , and pyrazinamide ( 10 - 20 mg / kg of body weight ) and ethambutol for two months , followed by isoniazid and rifampicin for the following four months . during the period , the patient was instructed not to undergo any surgical procedure within the oral cavity and was warned of transmitting the disease to others . tuberculous ulcer of the oral cavity secondary to pulmonary tuberculosis . from the department of head and neck oncology , tata memorial hospital , mumbai .

tuberculosis of the oral cavity is a rare condition . a 55-year - old labourer was referred as a case of oral cancer for further management . the patient had no systemic symptoms . biopsy of the lesion revealed caseating granulomatous inflammation . chest x - ray and sputum revealed evidence of asymptomatic pulmonary tuberculosis . the purpose of this paper is to sensitize clinicians to consider oral tuberculosis as a differential diagnosis in patients with an non - healing oral cavity ulcer .

alopecia areata ( aa ) is a chronic , organ specific autoimmune disease , probably mediated by autoreactive t cells , which affects the hair follicles and sometimes the nails . there is a high frequency of a family history of aa in affected persons , ranging from 10% up to 42% of cases . clinically , the disease manifests as patchy alopecia , reticulate alopecia , ophiasis , ophiasis inversus ( sisaphio ) , alopecia totalis or alopecia universalis . a new subtype of aa is acute diffuse and total alopecia of the female scalp characterized by rapid progression of diffuse alopecia of the female scalp , marked female predominance and a favorable prognosis . nail changes ( diffuse fine pitting , longitudinal ridging , thin and brittle fingernails and toenails and trachyonychia ) may be seen in 3 - 30% of patients . dermatoscopy is a noninvasive technique allowing rapid and magnified in vivo observation of the skin with the visualization of morphologic features often imperceptible to the naked eye . dermatoscopy may be useful for differential diagnosis of difficult cases , in particular in diffuse aa or in patients with total hair loss by the presence of cadaverized hairs ( black dots [ bds ] ) , exclamation mark hairs ( tapering hairs [ th ] ) , broken hairs ( bhs ) , yellow dots ( yds ) and clustered short vellus hairs ( svhs ) in the hair loss areas . this study was carried out in 75 patients of aa visiting dermatology outpatient department of a tertiary care center in north karnataka between november 2012 and july 2013 . the clinical diagnosis of aa was established after a detailed history taking including past and family history and clinical examination . grading of aa was done using the following scale : scalp hair loss : s0 , no hair loss ; s1 , < 25% hair loss ; s2 , 26 - 50% hair loss ; s3 , 51 - 75% hair loss ; s4 , 76 - 99% hair loss ; s5 , 100% hair loss . body hair loss : b0 , no body hair loss ; b1 , some body hair loss ; b2 , 100% body ( excluding scalp ) hair loss . a digital dermatoscope ( of magnification 25 and 60 ) was used for the evaluation . the mean age of the patients at presentation was 26.94 years , youngest being 10 months and oldest being 68 years . alopecia areata patients categorized based on age the mean age of onset was 23.58 years . the mean duration of the current episode in recurrent cases was 5.7 months ( 1 week-3 years ) . a total of 46 patients had their first episode of aa at presentation ( males 32 , females 14 ) . patchy alopecia was the most common pattern of aa seen in 55 ( 73.3% ) patients ( 43 males , 12 females ) . 29 patients ( 23 males , 6 females ) had a single patch and 26 patients ( 20 males , 6 females ) had multiple patches . the other patterns observed were : ophiasis - 9 cases ( 6 males , 3 females ) , sisaphio - 3 cases ( 1 male , 2 females ) , reticulate - 2 cases ( 1 male , 1 female ) , diffuse - 3 cases ( 1 male , 2 females ) , alopecia totalis in 1 female and alopecia universalis in 2 males [ table 1 ] . 55 patients showed involvement of the scalp ( 34 males - 62.96% , 21 females - 100% ) which included : occiput - 27 , frontal and vertex - 19 each , temporal - 7 and parietal - 5 . the other sites involved were - beard 13 ( 13 males - 24.07% ) , moustache 8 ( 8 males - 14.81% ) , eyebrows 8 ( 4 males - 7.4% , 4 females - 19.04% ) , eyelashes 2 ( 1 male - 1.85% , 1 female - 4.76% ) , limbs 2 ( 2 males - 3.7% ) and alopecia universalis 2 ( 2 males - 3.7% ) [ graph 2 ] . sites of involvement in alopecia areata in both sexes a single site was involved in 59 patients ( scalp only - 46 , beard only - 9 , moustache only - 3 , eyebrows only - 1 ) . 11 patients had involvement of 2 sites and > 2 sites were involved in 5 patients . these included pitting in 7 patients , ridging in 1 patient and striate leuconychia in 3 patients . the dermatoscopic features seen in our patients were as follows : yds-43 ( 57.33% ) , bds - 63 ( 84% ) , bh - 28 ( 37.33% ) , svh - 51 ( 68% ) and th - 14 ( 18.67% ) [ figures 1 - 5 ] . all these dermatoscopic features were seen in 7 patients whereas 2 patients had none of the above features . dermoscopic features in various patterns of aa 44 patients ( 58.67% ) had received some form of treatment at presentation , whereas 31 patients ( 41.33% ) had not taken any treatment . 75% of treated patients showed presence of svh at presentation in contrast to 51.6% of untreated patients . the various dermoscopic features in patients with and without treatment is tabulated in table 4 . the onset is within the first three decades of life although it can start at any age . the sex incidence is probably equal . in our study , males were most commonly affected than females with a male : female ratio of 2.57:1 . , whereas the study conducted by inui et al . , showed an increased female preponderance . the mean age of onset of aa was 23.58 years which was consistent with the previous studies . patchy alopecia , being the most common pattern of aa in our study , was seen in 73.3% of patients . mane et al . , also noted patchy alopecia as the most common pattern involving 46.7% and 87.7% of patients respectively . dermoscopy has been established as an indispensable tool in the diagnosis and follow - up of hair disorders . in aa , dermoscopy of active disease shows yds , dystrophic hairs , as well as cadaverized ( bds ) and exclamation mark hairs . yds are a powerful new tool in the diagnosis of hair loss diseases initially proposed by ross et al . yds are marked by a distinctive array of yellow to yellow - pink , round or polycyclic dots that vary in size and are uniform in color . they represent distention of the affected follicular infundibulum with keratinous material and sebum . in aa , degenerating follicular keratinocytes probably constitute the bulk of the yd . in a study conducted by inui et al . , yds were seen in 63.7% ( 191/300 ) of cases in contrast to ross et al . the low incidence in our study may be attributed to the skin color of our patients which might make the yds difficult to perceive . ths ( exclamation marks hairs ) are characterized by wider diameter in the distal shaft and thinner diameter in the proximal shaft . this pattern marks presence of the lymphocytic inflammatory infiltrate affecting the hair bulb and thus , producing thinner hair shaft . ths were seen in 31.7% ( 95/300 ) cases of aa by inui et al . and we noted ths in 14 ( 18.67% ) cases which was consistent with the previous studies . bhs , considered to be dystrophic hairs produced by the least severely affected follicles in aa , are clinical markers of the disease activity and severity . inui et al . , demonstrated bhs in 45.7% ( 137/300 ) of alopecia cases . bds ( formerly cadaverized hairs ) which represent pigmented hairs broken or destroyed at scalp level are characteristic of black haired individuals . this sign is not seen in white population due to the hair color and cuticle resistance . these are a sensitive marker not only for disease activity , but also for the severity of aa . in our study , inui et al . , demonstrated bds in 44.3% ( 133/300 ) cases of aa . the presence of svhs indicates the nondestructive nature of aa , allowing hair regrowth whether or not it results in completely mature hair shafts the pigmented hairs of asians facilitate the detection of svhs by dermoscopy . the regrowth of svhs can be seen after treatment in dermoscopy even when the recovered hairs are hardly perceived by the naked eye . short hypopigmented vellus hairs are characteristic of remitting disease . in our study , 51 out of 75 patients ( 68% ) demonstrated the presence of svhs . our findings were consistent with the previous studies conducted by inui et al . , where svhs were observed in 72.7% ( 218/300 ) of cases . the higher incidence of svh in our study was probably due to the various forms of treatment already received by 58.67% of patients before their first visit to our center . demonstrated that for diagnosis of aa , yds and svhs were the most sensitive markers . the most common dermoscopic finding observed was bds , followed by svhs , yds , bhs and ths .

background : dermatoscopy is a new noninvasive tool for the diagnosis of various skin and hair disorders . dermatoscopy of alopecia areata ( aa ) shows various specific features , which may aid in confirming the diagnosis.aims:the aim of this study was to determine the various clinical patterns and the dermatoscopic features of aa.materials and methods : a total of 75 patients of aa were evaluated with a dermatoscope ( magnification 25 and 60).results : the mean age of onset of aa was 23.58 years . males were more commonly affected . scalp was most commonly involved . patchy alopecia was the most common pattern observed . 10 patients showed concomitant nail changes . the dermatoscopic features included yellow dots ( yds ) in 43 ( 57.33% ) patients , black dots ( bds ) in 63 ( 84% ) cases , broken hairs ( bhs ) in 28 ( 37.33% ) cases , short vellus hair ( svh ) in 51 ( 68% ) patients and tapering hair ( th ) in 14 ( 18.67% ) cases.conclusion:the most common dermatoscopic finding observed was bds , followed by svhs , yds , bh and th .

since dental ceramic restorations have been introduced in 20 century,1 reproduction of natural appearance of teeth has been a major concern in dentistry . for metal - ceramic restorations , light reflection from an opaque porcelain layer to mask the metal substrate resulted in opaque appearance and therefore , their use in high esthetic area was limited.2 glass ceramic restorations without metal substrate induced more light transmission and accordingly , they improved the ability to reproduce the appearance of tooth structure.3 despite the esthetic advantage of glass ceramics , the demands for stronger ceramic restorations have increased . as a result , high strength zirconia - based ceramics combined with cad / cam technology have broadened the range of their applications in dentistry.4 however , cohesive failure of the veneering porcelain has been reported as a major drawback56 and thereby , fabricating monolithic zirconia restoration which consists of a single zirconia material without any veneering could be an alternative approach to obviate the veneering failure.7 the esthetic value of dental ceramic restorations is influenced by several factors , such as color , translucency , fluorescence , surface texture and shape.8 furthermore , the overall color of ceramic restorations can be influenced by the thickness of the ceramic , the thickness and the color of luting agent , and the color of the underlying tooth structure . 9 several studies investigated the effect of the thickness on overall color and translucency of ceramic restorations.291011121314 changes of color and translucency may be expected when the thickness of porcelain layer changes , although the direction of color change may depend on the specific components of the ceramic systems.15 due to its inherent white and opaque appearance , monolithic zirconia can be colored in a pre - sintered state to match adjacent teeth . in a clinical situation , there could be a thickness reduction during the process of occlusal adjustment by dentists . however , there have been no reported studies regarding the changes of color and translucency as a function of changes in thickness using monolithic zirconia . the purpose of this study was to evaluate the effect of the amount of thickness reduction on color and translucency of dental monolithic zirconia ceramics . the null hypothesis to be tested was that there was no significant difference in color and translucency between monolithic zirconia ceramics with different amount of thickness reduction . one - hundred sixty - five square - shaped specimens from presintered yttria - stabilized tetragonal zirconia blocks ( lot no . : b 105566 , b 105583 , b 105565 , b 88712 ; bruxzir , glidewell laboratories , newport beach , ca , usa ) were colored with coloring liquid ( lot no . : 40127 , 40129 ; tanaka zircolor , a2 , tanaka dental , skokie , il , usa ) and assigned to 5 groups according to the number of coloring liquid application ( group i ( one time ) to v ( five times ) , n = 33 per each group ) following the same protocol used in our previous study.7 the specimens were heated in a furnace ( austromat basic , dekema dental - keramikfen gmbh , freilassing , germany ) with a step sintering procedure ; sintering at 950 for 10 minutes and at 1,500 for 2 hours . after sintering , the thickness adjustment was performed in the same manner as was used in our previous studies.716 accordingly , the final dimensions of the specimens were 16.3 mm 16.3 mm 2.0 mm . each group was then divided into eleven subgroups ( n = 3 per each subgroup ) by reducing the thickness of 0.1 to 1.0 mm in increments of 0.1-mm on the colored surface using a horizontal grinding machine ( hrg-150 , am technology , asan , korea ) ; subgroup 0 ( no reduction ) , subgroup 1 ( 0.1 mm reduction ) to subgroup 10 ( 1.0 mm reduction ) . color parameters were obtained from cie - lab ( commission internationale de l'eclairage l , a , b ) color space relative to d65 on a reflection spectrophotometer ( cm-3500d , konica minolta , tokyo , japan ) . for the instrument , diffuse illumination was used and the reflected light was measured ( cie diffuse/8-degree ) at the center and each quarter of the specimen . a 3-mm diameter aperture for diffuse illumination and 3-mm measurement area each of l , a and b values was measured against a black background ( cm - a 101b , konica minolta , tokyo , japan , l = 0.1099 , a = 0.2107 , and b = -0.4292 ) and a white background ( cm - a120 , konica minolta , tokyo , japan , l = 96.6880 , a = -0.1755 , and b = -0.1236 ) in the reflectance mode with specular component excluded ( sce ) at 10 nm intervals in the wavelength range of visible light , 400 - 700 nm . optical contact was obtained by placing a drop of distilled water ( refractive index : 1.33 , approximately ) between each specimen and a background.11 spectral reflectance against a white background was recorded at 10 nm intervals in the range of 400 to 700 nm . color difference between each subgroup was calculated using cie lab color - difference formula17 denoted by eab = [ ( l ) + ( a ) + ( b ) ] . l , a , and b refer to the difference on lightness , red / green axis , and yellow / blue axis , respectively . to determine the color difference , the average cie values against a black background were used . for translucency measurements , translucency parameter tp value was calculated by the color difference between values against a black and a white background18 which is denoted by tp = [ ( lb - lw ) + ( ab - aw ) + ( bb - bw ) ] . diffuse transmittance measurement was performed using an integrating sphere with the aperture size of 9.5 mm in diameter . all measurements , therefore , were made at the center and each quarter of the specimen and values were averaged . , chicago , il , usa ) and the level was set at 0.05 . normal distribution of each color value and tp value was verified with shapiro - wilk test . to identify if there is any significant difference in color and tp values among subgroups , one - way anova was carried out followed by multiple comparison scheff test . pearson correlation and linear regression was fitted to test for a relationship between the amount of thickness reduction and color and tp values . 3 showed means of cie l , a and b values of each group against a black background in the reflectance mode as a function of the amount of thickness reduction , respectively . cie a value generally increased , while cie b value decreased with the increase of thickness reduction in all groups . correlation analyses between l , a or b values against a black background in the reflectance mode and the amount of thickness reduction were conducted . there were negative , but weak correlations between l value and the amount of thickness reduction in most groups ( -0.58 < r < 0.34 , 0.09 < r < 0.34 ) . there were positive correlations between a value and the amount of thickness reduction in all groups ( 0.72 < r < 0.85 , 0.52 < r < 0.73 ) . there were negative correlations between b value and the amount of thickness reduction in all groups ( -0.86 < r < -0.07 , 0.00 < r < 0.74 ) . average spectral reflectance curves against a white background of each subgroup within groups were obtained ( fig . 4 ) . there was a significant difference between subgroup 0 and other subgroups through the entire spectrum and the values of spectral reflectance in other subgroups were lower than subgroup 0 . the interpretation of the color difference for this study is based on the visual matching study of johnston and kao19 who found that color difference of 3.7 eab unit was acceptable for resin composites . color differences between subgroup 0 and other subgroups were clinically perceptible ( eab > 3.7 ) ( fig . 5 ) color differences between subgroup 1 and 2 were within the range of perceptibility threshold ( eab < 3.7 ) except group ii . color differences between subgroup 2 and 3 were within the range of perceptibility threshold except group v. color differences between subgroup 3 and 4 , 4 and 5 , 5 and 6 , 6 and 7 , 7 and 8 , 8 and 9 , 9 and 10 were within the range of perceptibility threshold in all groups . means of tp for each subgroup within groups are calculated and ranged from 2.27 to 5.34 ( table 1 ) . highly significant correlations were found out between tp values and the amount of thickness reduction in all groups ( r > 0.94 , r > 0.89 , p < .001 ) . spectral transmittance of each subgroup exhibited similar spectral behavior through the entire spectrum and transmittance generally increased with increasing the amount of thickness reduction in all groups ( fig . according to the results of this in vitro study , the null hypothesis could be rejected because there were significant differences in l , a or b values and tp values between monolithic zirconia specimens with different amount of thickness reduction . the effect of various changes in thickness of each layer on the final appearance of layered metal - ceramic structures has been studied.212152021 l value substantially increased with the decrease of porcelain thickness212 and the direction of color changes were dependent on porcelain shade and the type of metal - ceramic alloy . increasing the thickness of dentin porcelain produced more scattering and absorption of the incident light and less light reflected back from the opaque layer . with regard to all - ceramic systems , l value generally decreased due to increased absorption of incident light with thicker specimens , while a and b values increased as the ceramic thickness increased.101113 there might be a difference in the amount of light reflection at the opaque core between all - ceramic systems with different core translucency . douglas and przybylska2 demonstrated that the semi - translucent all - ceramic systems were less affected by reduced porcelain thicknesses compared to metal - ceramics . in this study , the changes in l value showed a different feature compared to metal - ceramic or all - ceramic systems . there was a significant decrease in l value at initial reduction , but there were no further significant changes on l value in most groups ( fig . 1 ) . the different aspect of change might come from different optical and structural properties since monolithic zirconia ceramic is polycrystalline monolayer without any veneering . it can be inferred that there might be reduced scattering due to the reduced thickness which induces lower l value at first 0.1 mm reduction . however , as the thickness reduction proceeds , monolithic zirconia itself could act as an opaque core and induce internal reflection.22 thus , reduced reflection might compensate increased internal reflection and l value could be relatively stable . chromatically , a value increased , while b value generally decreased with increasing thickness reduction . regarding the shift in chroma , b value was more sensitive to the change of thickness than a value showing minimal shifts in a value . 21113 according to the study of douglas and brewer,23 dental observers were more sensitive and critical to the color difference in redness than yellowness for metal - ceramic crowns . however , their study was conducted with metalceramic crowns and therefore , further study should be performed to determine whether there is any difference in subjective color assessment between a and b value for monolithic zirconia restorations . 3 ) , group ii exhibited noticeable changes in a and b values down to 0.2 mm reduction and group iii ; to 0.3 mm reduction , group iv ; to 0.6 mm reduction , and group v ; to 0.5 mm reduction . there was no distinct difference in a and b values between groups after around 0.6 mm reduction . it can be inferred that the more coloring liquid is applied , the deeper the coloring liquid infiltrates . in addition , one time of coloring liquid application might infiltrate 0.1 mm deep through monolithic zirconia specimen , two times of application ; 0.2 mm deep , three times of application ; 0.3 mm deep , and four or five times of application ; around 0.6 mm deep through monolithic zirconia specimen . this study exhibited a perceptible color difference from no reduction ( eab > 3.7 ) even after first 0.1 mm reduction regardless of the number of coloring liquid applications . antonson and anusavice14 investigated the translucency of dental core and veneering ceramics as a function of ceramic thickness . there was a positive linear correlation between contrast ratio and thickness ( r > 0.81 ) . hefffernan et al . investigated the effect of the thickness of core materials,24 and the thickness of veneered core materials25 on the translucency of the specimens . o'keefe et al.26 suggested that the thickness of the porcelain veneer was the primary factor affecting light transmission and not the opacity . tp values generally increased as the amount of thickness reduction increased in all groups ( r > 0.89 , p < .001 ) . based on lambert 's law,27 decreasing the thickness of material the fraction of incident light that is reflected , absorbed , and transmitted depends upon the thickness of the specimen as well as the scattering and absorption characteristics.28 this in vitro study has several potential limitations . the first limitation is that even application of coloring liquid on the specimens and exact amount of the increase of coloring liquid were difficult to control . secondly , possible pressure fluctuation inside the furnace during the sintering process might have induced uneven color of the specimens . thirdly , the aperture diameter of spectrophotometer for reflectance measurement was 3 mm and possible edge loss would have affected the color measurement . finally , this study was conducted with limited color of shade a2 and with a specific kind of monolithic zirconia system and coloring liquid . therefore , the influence of varied color combinations with different monolithic zirconia systems should be further studied . increasing thickness reduction reduces lightness and increases a reddish , bluish appearance , and translucency of monolithic zirconia ceramics .

purposethis study investigated the effect of amount of thickness reduction on color and translucency of dental monolithic zirconia ceramics.materials and methodsone - hundred sixty - five monolithic zirconia specimens ( 16.3 mm 16.3 mm 2.0 mm ) were divided into 5 groups ( group i to v ) according to the number of a2-coloring liquid applications . each group was then divided into 11 subgroups by reducing the thickness up to 1.0 mm in 0.1-mm increments ( subgroup 0 to 10 , n=3 ) . colors and spectral distributions were measured according to cielab on a reflection spectrophotometer . all measurements were performed on five different areas of each specimen . color difference ( e*ab ) and translucency parameter ( tp ) were calculated . data were analyzed using one - way anova and multiple comparison scheff test ( =.05).resultsthere were significant differences in cie l * between subgroup 0 and other subgroups in all groups . cie a * increased ( 0.52<r2<0.73 ) , while cie b * decreased ( 0.00<r2<0.74 ) in all groups with increasing thickness reduction . perceptible color differences ( e * ab>3.7 ) were obtained between subgroup 0 and other subgroups . tp values generally increased as the thickness reduction increased in all groups ( r2>0.89 , p<.001).conclusionincreasing thickness reduction reduces lightness and increases a reddish , bluish appearance , and translucency of monolithic zirconia ceramics .

real - time monitoring of the circadian gene expression was performed using rat-1 cells expressing a luciferase reporter under the control of the upstream region of bmal1 gene . rat-1 cells were treated with 0.1 m dexamethasone for 2 h for the rhythm synchronization , and the bioluminescence signals from the cells were continually recorded at 37c under air with dish - type bioluminescence detector , kronos ( atto , ab-2500 ) or lumicycle ( actimetrics ) . the in vitro kinase assay was carried out at 30c in a reaction mixture ( 10 l ) consisting of 1 mm dithiothreitol , 100 m [ -p]atp , 10 ng 30k - camkii and 100 ng substrate protein . the substrate proteins , gst - sp , mbp - nt , gst or mbp ( each 100 ng ) were prepared as described previously . after incubation for 30 min , the reaction was stopped by the addition of 10 l of 2 sds sample buffer . real - time monitoring of the circadian gene expression was performed using rat-1 cells expressing a luciferase reporter under the control of the upstream region of bmal1 gene . rat-1 cells were treated with 0.1 m dexamethasone for 2 h for the rhythm synchronization , and the bioluminescence signals from the cells were continually recorded at 37c under air with dish - type bioluminescence detector , kronos ( atto , ab-2500 ) or lumicycle ( actimetrics ) . the in vitro kinase assay was carried out at 30c in a reaction mixture ( 10 l ) consisting of 1 mm dithiothreitol , 100 m [ -p]atp , 10 ng 30k - camkii and 100 ng substrate protein . the substrate proteins , gst - sp , mbp - nt , gst or mbp ( each 100 ng ) were prepared as described previously . after incubation for 30 min , the reaction was stopped by the addition of 10 l of 2 sds sample buffer . the animal experiments were conducted in accordance with the guidelines of the university of tokyo . the mice ( c57bl/6 background , male , 10-week - old ) were housed individually at 23c in cages with food and water available ad libitum . this work was supported in part by grants - in - aid for scientific research from jsps and mext , japan .

molecular oscillation of the circadian clock is based on e - box - mediated transcriptional feedback loop formed with clock genes and their encoding products , clock proteins . the clock proteins are regulated by post - translational modifications such as phosphorylation . we investigated the effects of a series of kinase inhibitors on gene expression rhythms in rat-1 fibroblasts . the period of the cellular circadian rhythm in culture was lengthened by treatment with sb203580 ( p38 mapk inhibitor ) , sp600125 ( jnk inhibitor ) , ic261 ( cki inhibitor ) and roscovitine ( cdk inhibitor ) . on the other hand , the period was shortened by sb216763 ( gsk-3 inhibitor ) or kn93 ( camkii inhibitor ) treatment . application of 20 m kn93 completely abolished the rhythmic gene expression . the activity of camkii exhibited circadian variation in a phase close to the e - box - mediated transcriptional rhythms . in vitro kinase assay revealed that camkii directly phosphorylates n - terminal and ser / pro - rich domains of clock , an activator of e - box - mediated transcription . these results indicate a phosphorylation - dependent tuning of the period length by a regulatory network of multiple kinases and reveal an essential role of camkii in the cellular oscillation mechanism .

classical pcr - ligation strategy is the most familiar one to clone for its convenience and efficiency . in long cds cloning , pcr and sequencing are the most challenging steps . dna is not easily amplified from complementary dna ( cdna ) for many reasons , e.g. cdna may not be in good quality , primers are easier to miss - prime during long extending time , gc - rich region will stop dna polymerizing . on the other hand , fidelity is far from our satisfactory . in addition , long fragment sequencing will be troublesome for both time and money cost on intermediated sequencing and primer synthesis . that 's why large gene , in many cases , have to be interrupted into several domains to imitate the whole gene function 1 . to solve the problem , somebody will turn to golden gate ligation system . because the cutting sequences of the two enzymes are not restricted , the overhanging 4 nucleotides could give at most 256 different patterns of cohesive ends . this dramatically increases the choices for our consideration to assemble small fragments into a long one 5 - 7 . however , if our target long cds contains bbsi or bsai restriction sites , golden - gate ligation system will not work well . besides , this strategy requires elite skills on cohesive end selecting and designing , it will not be favored by many scientists even though it is widely used in talen tandem assembly 8 . we found a strategy to clone large fragments of dna by dividing them to short pcr fragment cloning , followed by restriction digestion and ligation cloning 9 . this strategy shows dominance in amplifying efficiency , it helps overcome pcr problem , and constructs very big clones without turning to complex reagents and technologies , like red / et system10 or tar system 11 , 12 . this strategy shows potential in handling long cds clones , including introducing mutation , deleting and inserting domains . here , we name it restriction - based multiple - fragment assembly strategy . a slight modification was added to make it more compatible to sequencing system and easier for us to handle random mutation . a series of experiments were done to judge its efficiency and universality . in this modified strategy , instead of pcr - amplifying the entire cds , we amplify short fragments , which are no longer than 1,500bp , spanning the whole cds . since sanger sequencing 's read length is 800bp , 1,500bp is very friendly to bi - directional sequencing strategy . sequence - proved fragments were released by restriction digestion and assembled into our target vectors in a ligation system . since the digestion and ligation sub - cloning does not introduce random mutation , and restriction sites were found in the sequence to be cloned , ligation will not break open reading frame ( orf ) . in this study , mago2 ( nm_153178.4 ) was submitted to nebcutter v2.0 ( http://nc2.neb.com/nebcutter2/ ) 13 for restriction analysis . results showed mago2 contains an xhoi restriction site which breaks mago2 cds into 1.4 kb and 1.1 kb two fragments . each interrupted fragments were pcr - amplified from n2a cdna using primers mago2f1 ( 5'-acg gat ccg cca cca tgt act cgg gag ccg gcc ccg ttc-3 ' ) , mago2r1 ( 5 ' -act tgc ata cac agg agt t-3 ' ) , mago2f2 ( 5'-agc gcc agt gta cag aag tc-3 ' ) mago2r2 ( 5'-acg aat tca gca aag tac atg gtg cgc ag-3 ' ) by kod - fx ( cat : kfx-101 ) . pcr was processed 28 cycles on eppendorf thermos - cycler ( eppendorf ag 22331 hamburg ) with the denaturing temperature at 94 for 30seconds , annealing temperature at 58 for 30seconds , followed by extending temperature at 68 for 1min / kb . pcr product was purified ( guangzhou dongsheng biotech ) and ligated ( fermentas # k1423 ) to pbluescript - ksii that had been digested with ecorv to give blunt end . ligation product was transformed into top 10 competent e. coli . and plated onto lb agar plate supplemented with x - gal , iptg and ampicillin . purified fragments were ligated to pcdna3.1-myc / his a that had been digested by bamhi and ecori in one ligation system . this strategy to clone long dna fragment takes advantage of the dominance of short fragment pcr . but , full - length pcr product showed smear at 500bp and 1,000bp ( figure . after our analysis , hxrn1 cds would be divided into 4 short fragments ( a , b , c , d ) with their lengths at 0.7 kb , 1.5 kb , 1.4 kb , 1.4 kb adjoined by endonucleases aflii , hindiii , ecori . at the same time we got ksii - cd . again , we repeated the processes above and got pcdna3.1-myc / his - hxrn1 ( figure . hxrn1 full length pcr showed no band at all ; while fragments pcr shows clear and bright bands ( figure . this means that short fragments are much more easily amplified and products are more accurate . next , hxrn1 4 fragments were used to measure one round assembling efficiency of 2 fragments ( a / b ) , 3 fragments ( a / b / c ) and 4 fragments ( a / b / c / d ) . after overnight growth , 20 clones of each plated were picked for colony pcr . in 2 fragments system , 16 positive clones were checked , in 3 fragments system , 15 positive clones were checked , in 4 fragments system , only 6 positive clones were checked ( figure 3 ) . results showed that the more fragments are tried in an assembly system ; the lower success rate is checked . to overcome the efficiency problem , we recommend two or more round of assembly , as it has been processed on pcdna3.1-hxrn1 . in order to know how universal this strategy is , we searched the entire human and mouse cds in ccds database 15 to see how many of them will benefit from our strategy . sequences were checked in our python script ( supplementary material s1 ) if they were longer than 1,500bp , if 15 candidate restriction sites ( apai , bamhi , bglii , ecori , hindiii , kpni , ncoi , ndei , nhei , noti , saci , sali , sphi , xbai , xhoi ) could be found only once on a cds , and then if the distance between adherent restriction sites are no longer than 1,500nt . our data showed 12118 in 29064 human cdss and 9479 in 23874 mouse cdss were longer than 1,500 ( supplementary material s2 ) . further , 8304 in 12118 in human and 6678 in 9479 mouse meet our requirements ( supplementary material s3 ) . sequences meet our requirement are good candidates for restriction - based multiple - fragment assembly strategy . this data strongly suggests our strategy is potential to solve most long cds cloning problem . furthermore , we can increase the number by referring more restriction sites or turning to other ligation free system 16 . in this study , first , we discuss multiple - fragment assembly strategy 's dominance in pcr amplifying efficiency by amplifying short fragment rather than long one . fourth , we programmed a script to test its universality in the entire cds , and find a great number ( ~70% ) of long cds problem will benefit from it .

long fragment cloning is a challenge for its difficulty in accurate amplifying and tendency to get unwanted mutation . here we discuss restriction - based multiple - fragment assembly strategy 's advantages and limitations . in this strategy , rather than pcr amplifying the entire coding sequence ( cds ) at one time , we amplified and sequenced smaller fragments which are shorter than 1.5 kb spanning the cds . after that , the sequence - proved fragments were assembled by digestion - ligation cloning to the target vector . we test its universality in our script programmed in python . our data shows that , among the entire human and mouse cds , at least 70% of long cds cloning will benefit from this strategy .

the online version of this article ( doi:10.1007/s40121 - 015 - 0094 - 6 ) contains supplementary material , which is available to authorized users . extended spectrum -lactamases ( esbl ) are enzymes capable of hydrolyzing penicillins , broad - spectrum cephalosporins , and monobactams . these infections increase cost of care if inappropriate therapy , defined as non - susceptibility of pathogen to therapy by laboratory criteria , is administered . at present , the clinical and laboratory standards institute ( clsi ) and european committee on antimicrobial susceptibility testing ( eucast ) do not recommend routine screening for esbls or subsequent phenotypic confirmation testing that had been advocated previously [ 3 , 4 ] . while this approach has been supported in the clinical practice setting by the introduction of reduced breakpoints for many beta - lactams , it may be of value , particularly when evaluating novel therapies , to understand the potency of various agents against esbl producers . however , if one utilizes esbl classification with aztreonam ( atm ) , ceftriaxone ( cro ) , or ceftazidime ( caz ) minimum inhibitory concentrations ( mic ) as a simple screen , without phenotypic confirmation via the clavulanate test , this approach may include other resistant genotypes ( i.e. , carbapenemase producers ) that may not accurately predict the clinical utility of therapeutic agents under consideration . phenotypic screening tests to detect resistance mechanisms such as carbapenemase production or ampc expression are available and can be used . while molecular testing would yield the most definite results , it is also cost prohibitive and unavailable to most clinical microbiological laboratories . in this study , we tested the recently us food and drug administration ( fda)-approved compound , ceftolozane / tazobactam ( c / t ) , which has demonstrated in vitro activity against some esbl organisms . the purpose of this study was to compare the impact of mic - based screening versus confirmatory testing of esbls on the susceptibility profile of c / t versus selected antimicrobials . in this study , 44 us hospitals collected non - duplicate , non - urine escherichia coli ( n = 1306 ) and klebsiella pneumoniae ( n = 1205 ) over the period of june 2013 and october 2014 . participating sites identified the organisms using their established method and then transferred each isolate to trypticase soy agar slants for shipping . isolates were transferred onto trypticase soy agar plates containing 5% sheep blood at the central processing laboratory ( center for anti - infective research and development , hartford hospital , hartford hospital , hartford , ct , usa ) for mic determination using broth microdilution as described by clsi . mics were determined for c / t , cefepime ( fep ) , cro , caz , ciprofloxacin ( cip ) , atm , ertapenem ( etp ) , piperacillin / tazobactam ( tzp ) , meropenem ( mem ) , and tobramycin ( tob ) against this collection of 2511 contemporary clinical enterobacteriaceae isolates . c / t was provided by cubist pharmaceuticals , while all others antibiotics were purchased from sigma - aldrich ( st . e. coli 25922 and pseudomonas aeruginosa 27853 were utilized as quality control strains as recommended by clsi . clsi states that the initial mic - based esbl screening for e. coli and k. pneumoniae should be performed by evaluating the mic profile of one of the following drugs : cefpodoxime 4 g / ml , caz 1 g / ml , atm 1 g / ml , or cefotaxime 1 g / ml . it is noted that the use of more than one of these agents will improve detection of esbls . we defined a positive esbl screen as having an mic of 1 g / ml to 2 of the following : atm , cro , or caz . subsequent clsi defined , phenotypic , esbl confirmation studies were undertaken using caz and cefotaxime with and without clavulanate . probable carbapenemase - producing organisms were excluded based on etp ( 1 g / ml ) or mem ( 2 g / ml ) susceptibility profiles . while molecular - based confirmation of these enzymes would have been definitive , methodologies readily available to the clinical microbiology laboratory were utilized . recently , c / t has been approved in the us and susceptibility interpretative criteria have now been provided by the fda of 2 g / ml for the enterobacteriaceae . this surveillance program was reviewed by the institutional review board ( irb ) at the coordinating center , hartford hospital . since all samples were collected as part of routine medical care and no interventions were undertaken as a result of this testing , informed consent was deemed unnecessary by the irb . four - hundred and forty - two ( 18% ) isolates [ e. coli ( n = 231 ) , k. pneumoniae ( n = 211 ) ] screened positive for esbl production based on mic - based criteria . of these , 274 ( 62% ) isolates [ e. coli ( n = 146 ) , k. pneumoniae ( n = 128 ) ] were phenotypically confirmed positive for esbl production . with further exclusion of the 28 ( 10% ) isolates [ e. coli ( n = 13 ) , k. pneumoniae ( n = 14 ) ] that demonstrated carbapenem non - susceptible , a left shift in the mic distribution ( i.e. , enhanced potency ) against phenotypically confirmed esbl was noted for c / t , etp , tzp , and mem ( table 1 ) . figure 1 highlights these screening- and confirmation - based observations for c / t and tzp . improvements in % s between 8% and 17% were noted for confirmed versus screened - positive esbl isolates for c / t , etp , tzp , and mem . ( table 1 ) overall , % s of the other -lactams , tob and cip , was poor against phenotypically confirmed esbls . comparing the mic90 values for all esbl mic - based screen - positive versus phenotypically confirmed positive , we observed a reduction of twofold for c / t , sixfold for etp , and eightfold for mem ( table 2).table 1percent susceptibility of all agents against mic - based screen - positive ( screen + ) and phenotypically confirmed ( confirmed + ) esbl escherichia coli and klebsiella pneumoniae isolatespercent susceptibility for antimicrobialsc / tfepcrocazcipatmetptzpmemtoball screen + ( n = 442)64211018231674537945 confirmed + ( n = 274)7582914691619342 confirmed + , carbapenem ns removed ( n = 246)829291371006710042 e. coli screen + ( n = 231)79291324272386699054 confirmed + ( n = 146)889310101096759847 confirmed + , carbapenem ns removed ( n = 139)91941110101007810047 k. pneumoniae screen + ( n = 211)471251118962366534 confirmed + ( n = 128)6171718282468835 confirmed + , carbapenem ns removed ( n = 107)717171621005210036 atm aztreonam , caz ceftazidime , cip ciprofloxacin , cro ceftriaxone , c / t ceftolozane / tazobactam , etp ertapenem , esbl extended spectrum -lactamase , fep cefepime , mem meropenem , mic minimum inhibitory concentration , ns non - susceptible , tob tobramycin , tzp piperacillin / tazobactamfig . 1the mic distribution of c / t and tzp for the mic - based screen - positive isolates ( screen + ) , phenotypically confirmed positive ( confirmed + ) and confirmed + with carbapenem ns isolates removed ( confirmed + , no carbapenem ns ) of all enterobacteriaceae . c / t ceftolozane / tazobactam , mic minimum inhibitory concentration , ns non - susceptible , tzp piperacillin / tazobactamtable 2mic90 ( g / ml ) of all agents against mic - based screen - positive ( screen + ) and phenotypically confirmed ( confirmed + ) escherichia coli and klebsiella pneumoniae isolatesmic90 ( g / ml ) for antimicrobialsc / tfepcrocazcipatmetptzpmemtoball screen + ( n = 442)12812812812832128325123264 confirmed + ( n = 274)32128128128321280.55120.12564 confirmed + , carbapenem ns removed ( n = 246)212812812832640.125640.06464 atm aztreonam , caz ceftazidime , cip ciprofloxacin , cro ceftriaxone , c / t ceftolozane / tazobactam , etp ertapenem , esbl extended spectrum -lactamase , fep cefepime , mem meropenem , mic minimum inhibitory concentration , ns non - susceptible , tob tobramycin , tzp piperacillin / tazobactam percent susceptibility of all agents against mic - based screen - positive ( screen + ) and phenotypically confirmed ( confirmed + ) esbl escherichia coli and klebsiella pneumoniae isolates atm aztreonam , caz ceftazidime , cip ciprofloxacin , cro ceftriaxone , c / t ceftolozane / tazobactam , etp ertapenem , esbl extended spectrum -lactamase , fep cefepime , mem meropenem , mic minimum inhibitory concentration , ns non - susceptible , tob tobramycin , tzp piperacillin / tazobactam the mic distribution of c / t and tzp for the mic - based screen - positive isolates ( screen + ) , phenotypically confirmed positive ( confirmed + ) and confirmed + with carbapenem ns isolates removed ( confirmed + , no carbapenem ns ) of all enterobacteriaceae . c / t ceftolozane / tazobactam , mic minimum inhibitory concentration , ns non - susceptible , tzp piperacillin / tazobactam mic90 ( g / ml ) of all agents against mic - based screen - positive ( screen + ) and phenotypically confirmed ( confirmed + ) escherichia coli and klebsiella pneumoniae isolates atm aztreonam , caz ceftazidime , cip ciprofloxacin , cro ceftriaxone , c / t ceftolozane / tazobactam , etp ertapenem , esbl extended spectrum -lactamase , fep cefepime , mem meropenem , mic minimum inhibitory concentration , ns non - susceptible , tob tobramycin , tzp piperacillin / tazobactam after confirmatory esbl testing using the clavulanate test , 38% of strains identified as potential esbl producers using a simple mic screen were excluded . for agents with potential activity against esbls such as c / t , tzp , etp , and mem , reduced susceptibility the reason for this discordance is that carbapenemase producers , ampc , and other types of resistance would not be differentiated by mic - based screen testing alone . as such , although mic screening selects for resistant organisms , inclusion of these other genotypes may falsely under - predict the potency of several antibiotics against esbl producers and if such a method is used during published surveillance studies , it may limit applicability of these data to geographic areas not plagued with carbapenemase producers . for this reason , in scenarios , such as the clinical laboratory , when molecular testing is not available , clavulanate - based phenotypic confirmatory testing is recommended to better evaluate empiric therapy options against esbl . david p. nicolau is on the speaker bureau for cubist and has received grants from cubist . this surveillance program was reviewed by the institutional review board ( irb ) at the coordinating center , hartford hospital . since all samples were collected as part of routine medical care and no interventions were undertaken as a result of this testing , informed consent was deemed unnecessary by the irb . this article is distributed under the terms of the creative commons attribution - noncommercial 4.0 international license ( http://creativecommons.org/licenses/by-nc/4.0/ ) , which permits any noncommercial use , distribution , and reproduction in any medium , provided you give appropriate credit to the original author(s ) and the source , provide a link to the creative commons license , and indicate if changes were made .

introductionwhile the clinical and laboratory standards institute ( clsi ) recommends against routine screening for extended spectrum -lactamases ( esbls ) , knowledge of these data can provide valuable insights regarding epidemiology and drug therapy decisions . the purpose of this study was to compare the impact of minimum inhibitory concentration ( mic)-based screening versus phenotypic confirmatory testing of esbls on the susceptibility profile of selected antimicrobials.methodsbroth microdilution mics were determined for various antimicrobial agents against a collection contemporary clinical escherichia coli and klebsiella pneumoniae isolates . isolates identified as esbl - positive by mic screening were then subjected to confirmatory phenotypic testing . percent susceptibility was based on clsi or united states food and drug administration breakpoints.resultsfour-hundred and forty - two ( 18% ) isolates screened positive for esbl production . of these , 274 ( 62% ) were confirmed positive for esbl production ; 28 ( 10% ) were also carbapenem non - susceptible . we found an under - prediction of activity for ceftolozane / tazobactam ( c / t ) , ertapenem ( etp ) , meropenem ( mem ) , and piperacillin / tazobactam ( tzp ) when considering only the screen - positive testing.conclusionfor agents with potential activity against esbls such as c / t , tzp , etp , and mem , reduced susceptibility was noted when only considering the mic screen - positive test . although phenotypic screening selects for resistant organisms , inclusion of other genotypes besides esbl ( i.e. , ampc , carbapenemase ) may falsely under - predict the potency against some esbl producers and may limit applicability of surveillance data to geographic areas not plagued with carbapenemase producers.fundingcubist pharmaceuticals.electronic supplementary materialthe online version of this article ( doi:10.1007/s40121 - 015 - 0094 - 6 ) contains supplementary material , which is available to authorized users .

labor wellbeing refers to all efforts of employers , trade unions , voluntary organizations , and governmental agencies , which help employees feel better and perform ( work ) better . it is a comprehensive term that refers to the physical , mental , moral , and emotional wellbeing of an individual including intra and extra mural facilities . although wellbeing includes a wide range of programs and services in organizations , the focus of this study is on the employee assistance programs and employee group services , which are provided by employers according to the real needs of the employees . hence , it is necessary for organizations to identify the real needs , as a base to provide a wellbeing package for their employees through wellbeing need assessment techniques . wellbeing need assessment is a systematic process of gathering information to determine and address the needs or gaps between the current conditions and the desired conditions . a need can be a desire to improve the current performance or to correct a deficiency . the wellbeing needs assessment includes two main targets ; exploring the effectiveness of the delivered services and exploring those wellbeing needs that are not fulfilled by an organization . davis and gibson emphasize on the importance of a comprehensive wellbeing needs assessment , both for obtaining the required information needed to design the appropriate interventions and also for providing the basic required information to evaluate the effectiveness of the wellbeing program . wellbeing assessments are vital for the determination of the economic and social needs of employees and for the best decisions to be taken in response to such needs . reviewing the human resources management literature showed an absence of attention given to the employee 's benefits . moreover , various expectations of employees in the field of wellbeing services caused organizations , especially the human resources ( hr ) offices , to face many challenges ( chen et al . ) . therefore , for keeping employees satisfied with the wellbeing services , all challenges had to be truly and effectively met ( hyde et al . ) . research indicated that satisfaction of the employees was not positively correlated with the benefits of the welfare package ( e.g. dreher , ash , and bretz ) . dencker , joshi , and martocchio argued that individual differences in benefit preferences emerged from particular employment relationships , with individuals having greater experience . the tehran university of medical sciences ( tums ) , including 69 research centers , 25 hospitals , 11 educational and health care centers , three health networks , and 10 faculties with more than 2020 faculty members and 19,000 students ( tums 2012 ) , requires an improved comprehensive system for delivering the wellbeing services ( financial , insurance , healthcare services , educational and training services , etc . ) . taking a look at the functions of the university 's wellbeing services system ; it uncovers a gap between the employees real needs and what is delivered to meet their needs . it is because of the lack of a participatory strategic wellbeing delivery plan that is based on prioritized wellbeing needs ( requirements ) . as the first step to make a strategic plan is identifying the needs , the main purpose of this study is to assess the wellbeing services of the staff working in tums first to see if they are satisfactory enough or they need to be changed , and second , to help decision - makers develop services that are essential to improve the well - being of employees , as also the quality and effectiveness of the tums 's wellbeing delivery system . what are the services used and to what extent they have been satisfactory? this question aims to explore the reasons why they are not delivered . the second question is , what type of services are essential to be provided by the university? with respect to the main purpose of this research , the wellbeing delivery system of tums is assessed with a thorough answering of the questions mentioned above . the research design was a cross - sectional survey ( 2008 - 2009 ) using a structured non - disguised questionnaire . the sample size was 98 with a 95% level of confidence and absolute error of 0/01 . cluster sampling based on the occupational scope as the main variable , was used as the sampling method , with regard to the existence of different occupational scopes . data was collected from 98 officers working at different departments of central organizations of tums ( tehran university of medical sciences ) including logistics , education , research and technology , student and cultural affairs departments . the research participants were assured of the confidentiality of their personal information at the beginning of the questionnaire . the questionnaire included 45 questions ( 43 close - ended questions and 2 open - ended questions1 ) organized into two separate parts ( cranach alpha = 0.85 ) : according to table 1 , within the first part , the respondents were supposed to mark the wellbeing services if they had ever used any of them . those who used the services were supposed to show their level of satisfaction by choosing from almost satisfied , almost dissatisfied, and full dissatisfied , and those who had never used the services , were supposed to express their reasons by choosing from poor announcement , unwillingness to receive the service , undesirability of the service, and undesirability of the receiving process of the service. main parts and the main purpose of asking questions for each part in the second part , the respondents were provided with a list of not delivered wellbeing services to choose which of them is essential , neither essential nor non - essential or non - essential. for making sure if the questionnaire was valid content - wise , first a comprehensive collection of wellbeing services delivered both in tums and in other organizations was identified according to the comprehensive definition of wellbeing services . next , according to the main purpose of the research , they were put into classified groups to form the research tool . furthermore , to make sure about the appropriateness and transparency of each question and also the whole tool , in addition to its comprehensiveness , the questionnaire was sent to five professionals and experts in the relevant field . the reliability of the questionnaire was determined after thoroughly calculating the cronbach alpha , which was reported to be around 0.85 . subsequently , after improving and clarifying the instrument , the participants of sample group were asked to fill in the questionnaire . the data was gathered by means of filled questionnaires , and were analyzed with the excel software and spss , by calculating the frequency rate of the staff that used the welfare services and those who did not use the services . in addition , the t - test was used to calculate the satisfaction score for each service used by the staff . among all the 98 respondents , almost 46 employees with a mean satisfactory score of 48.46 used the existing services , for which the satisfactory rate was distributed as shown in table 2 . satisfactory scores of categorized wellbeing services the result shows that financial services , including loans for buying a car , emergency loan , loan for buying commodities , awards for staffs children , and two other kinds of non - profit loans in comparison with other categories is considered as the most satisfactory service ( average t = 61.83 ) . among respondents who did not use the categorized services ( 52 persons on an average ) , as shown in the table 3 , the most frequents reasons for not receiving services was , staff 's unwillingness to receive the service ( 38.75 in average ) and poor announcement ( unawareness on the wellbeing services ) ( 37.6 in average ) . frequency rate of reasons for not receiving welfare services table 4 presents the frequency of wellbeing services and necessity ( delivered by other public / private organizations ) , which were asked to be judged by respondents ( to be added or replaced by the delivered wellbeing services list ) , as follows : frequency distribution of wellbeing services necessity educational subvention for children of the staff , who were under their patronage is the only non - financial service , with the highest frequency ( 92.85 ) , identified as the most necessary wellbeing service among all . among other services that were mentioned by respondents ( 61 persons of the sample group ) , the provision of discount cards for using other organizations services ( frequency = 12 ) , providing employees with free health care services ( frequency = 7 ) , and contracting with adult higher education institutions ( frequency = 6 ) had the most frequency among other items . as mentioned , the objectives of the study were to measure the staff 's satisfaction with the wellbeing services received , identify the reasons for not receiving the existing wellbeing services , identify the wellbeing services that were not delivered , but were essential as per the staff , and then ask the staff about other wellbeing services that were possible to be delivered and sort them according to their priority . with regard to the first purpose , the results showed that almost half of the respondents used the wellbeing services provided by the wellbeing office of the university , among which almost half of them were satisfied with the services . the results suggested that not only were most of the staff not interested in using the provided services , but also more than half of those respondents who used them were not really happy . with regard to the second purpose , the results showed that among those who did not use the services , most of them decided not to use it by themselves . this was recommended to be surveyed in a separate study in the future . as was evident , it can be concluded that the functional desirability of the wellbeing service delivery system of tums was not evaluated as satisfactory enough , because of the almost high dissatisfaction level of services that were used . with regard to the third purpose , the results indicated a big gap between the required wellbeing services ( by employees ) and what was provided by the office , as almost all the respondents agreed with the necessity of services such as health , education , and safety . the existing gap can result from lack of managerial attention to differences in the demographical characteristics and expectations of employees . consistent with the arguments of boudreau and ramstad , dencker et al . argued that market segmentation of employees ( offering market segments have different benefits ) may strengthen the benefits return - on - investment. one of the most significant reasons for the dissatisfaction and unwillingness of employees to use the services refers to the different priorities and type of services they prefer to include , according to their individual differences . need assessment as a useful technique can help planners to pay more attention to employee 's priority differences in wellbeing services and what they really need to include , by designing the appropriate interventions , as davis and gibson emphasized . considering the employees as the most important organizational stakeholders makes them to participate in the wellbeing decision - making process , such as , asking them to add what services they prefer to be included within the wellbeing package . although the wellbeing service delivery system of tums has not been effective enough to meet the real needs of the staff by delivering the appropriate services , the most prioritized service type preference of most respondents can be identified . as in the first place the satisfactory score of educational and training services among those who used them was rather high , and second , the most necessary identified services were related to educational services , and of course , among the identified wellbeing service priorities , provision of educational opportunity was one of the preferences with high frequency , therefore , it was clear that educational and training opportunities were important for a majority of the respondents . the findings show that the functional desirability of tums wellbeing services is not satisfactory enough by the staff 's view point . the following conclusions can be drawn from the present study ; the first major finding is the existence of a big gap between the required wellbeing services ( by employees ) and what is provided by the wellbeing office of tums . the second and the most obvious finding of this study is the importance of the educational and training opportunities from the point of view of the staff , which has not been paid attention to by the wellbeing service provider in tums . although we tried to assess the overall quality and functional desirability of the wellbeing service delivery system of tums , some further studies are required in the researcher 's view . it is recommended that the factors that cause dissatisfaction and unwillingness to use services in employees be identified , and also the real needs and wellbeing requirements ( based on employees preferences , job categories , genders , age , and other considerable individual and social factors ) as a strategic basis for redesigning the current wellbeing service delivery system that appears not to be desirable enough in the employees view , be determined .

background : reviewing the human resources management literature shows an absence of attention given to the employee 's benefits . taking a look at functions of the tehran university of medical sciences wellbeing services system , it uncovers a gap between employees real needs and what is delivered to meet their needs . so it requires an improved comprehensive system for delivering wellbeing services ( financial , insurance , health care services , educational and training services , etc ) . wellbeing need assessment can helps planners to identify vital needs of employee and response to them effectively . moreover it can be used to evaluate the effectiveness of the current services which are delivered . thus , the aim of this study is to assess wellbeing services of staffs working in tums to ( 1 ) evaluate the satisfactory rate of services which are delivered , and ( 2 ) exploring those wellbeing needs which were not fulfilled by the organization.material and methods : being a cross - sectional and analytic - descriptive survey including 98 responding participants , it is conducted by a questionnaire collecting employees demographic information , their satisfactory rate of the implemented services , and determines unfulfilled wellbeing needs which were not already covered.result:results indicated that services related to financial , educational , non - financial , insurance , occupational health and tourism / recreational services were the most satisfactory services successively . staff 's unwillingness to receive services and poor announcement ( unawareness on the wellbeing services), were found to be the most frequent reasons for not receiving the existing wellbeing services.conclusion:to increase the satisfaction rate and responsiveness to the real needs of the staff , the current delivery system of wellbeing services in the tums should be redesigned by defining new wellbeing packages .

superior mesenteric artery ( sma ) syndrome is a rare disorder , recognized as weight loss , nausea , vomiting , and post - prandial pain due to compression and partial obstruction of the third portion of the duodenum by the sma . if conservative treatment fails , then laparotomy with duodenojejunostomy or lysis of the ligament of treitz is indicated . we report the first case of laparoscopic duodenojejunostomy as the definitive treatment of vascular compression of the duodenum . a very thin woman with a diagnosis of sma syndrome was prepared for surgery after having failed medical therapy . the patient was placed in a supine position , and four laparoscopic ports were required to perform a 5 cm duodenojejunostomy . it provides definitive treatment while preserving the benefits of minimally invasive surgical techniques in the debilitated patient . vascular compression of the duodenum was first described by rokitansky in 1842 , with the first successful operative treatment , a duodenojejunostomy , performed by stavely in 1908 . the site of obstruction typically occurs in the third portion of the duodenum as the organ is held between the superior mesenteric artery and lumbar spine . symptoms are typically chronic and intermittent and include nausea , vomiting , distention , and post - prandial epigastric pain , with resultant weight loss . the compression may occur in the setting of a narrowed aortomesenteric angle , abdominal compression by a cast or girdle , or it may be categorized as idiopathic . some authors have suggested a genetic predisposition patients are usually young , and women are affected more often than men . other technical approaches include lysis of the ligament of treitz or gastro - jejunostomy which may be less effective ; a duodenojejunostomy is required if these fail . recently , advances in laparoscopic skills have enabled surgeons to forego the need for laparotomy when performing operations of increasing complexity . in this report , we describe the first known case of laparoscopic duodenojejunostomy for superior mesenteric artery ( sma ) syndrome . the patient is a thin 24-year - old female with past medical history of total abdominal colectomy and ileorectal anastomosis five years earlier . she had previously done well ; however , she began to complain of nausea , bilious vomiting and a recent 20 pound weight loss . an upper gastrointestinal series with small bowel follow through demonstrated a partial obstruction of the third portion of the duodenum with marked dilatation proximally . with these clinical and radiologic findings , the diagnosis of sma syndrome was made . the patient did not improve with conservative management and subsequently surgical consultation and operation was requested . after thorough evaluation , the patient was taken to the operating room for a laparoscopic duodenojejunostomy . due to the previous operation , an open hasson technique was performed in the right paramedian position , lateral to the umbilicus . as the intra - abdominal adhesions were cleared , three additional trocars were placed , one each in the left lateral abdomen , xiphoid , and at the umbilicus ( figure 1 ) . a kocher maneuver was performed revealing no masses in the duodenum or head of the pancreas . the ligament of treitz was identified , and a portion of the proximal jejunum , approximately 30 cm distal to the ligament of treitz , was found to easily reach the duodenum . a silk suture was placed between the duodenum and jejunum , holding these two portions of the bowel in apposition . a duodenotomy was made in the lateral aspect of the second portion of the duodenum avoiding the ampulla . after performance of an anti - mesenteric jejunotomy , a 35 mm gia ( united states surgical corporation , norwalk , ct ) was introduced into both lumens and a duodenojejunostomy was created ( figure 2 ) . a second load of the 35 mm gia was used to extend the anastomosis in excess of 5 cm . the anastomosis was reinforced with interrupted 3 - 0 silk lembert sutures and was noted to be airtight by insufflating the duodenum under a pool of saline . no drains or nasogastric tube were required , and the trocar sites were closed in the standard fashion . the right paramedian trocar was inserted first utilizing an open procedure , due to a previous midline incision . creation of a laparoscopic duodenojejunostomy utilizing a 35 mm gia stapler ( united states surgical corporation , norwalk , ct ) . a gastrograffin study obtained on postoperative day 2 demonstrated free flow of contrast through the duodenojejunostomy ( figure 3 ) . she was discharged home on postoperative day 4 without complications , tolerating a regular diet . upper gastrointestinal series demonstrating a patent duodenojejunostomy with flow of contrast past the stapled anastomosis . sma syndrome is a rare condition whose incidence ranges from 0.0024 to 0.34% for the general population , with a slightly higher incidence in chronic care facilities . its actual incidence is largely unknown since its diagnosis is not frequently pursued in the chronically ill patients typically assume the knee - chest position after eating , which widens the aortomesenteric angle , relieves their partial duodenal obstruction , and allows the passage of gastric contents through this area of duodenal narrowing . the use of total parenteral nutrition or aggressive nutritional support may increase the bulk of the retroperitoneal fat pad and provide relief by widening the aortomesenteric angle . this syndrome can be caused by body casts or girdles and removing these implements can aid by decreasing the extraluminal compressive forces inflicted upon the duodenum . open surgical approaches have included amputation of the ligament of treitz with repositioning of the duodenum , gastro - jejunostomy , and duodenojejunostomy . the most successful approach for treatment of the sma syndrome has been the performance of a duodenojejunostomy , and some authors have suggested that other operative interventions are ineffective . our group opted to treat this syndrome laparoscopically by the same operation that we chose in open surgery , a duodenojejunostomy bypass . this is the first case report , to our knowledge , of performance of a laparoscopic duodenojejunostomy for treatment of sma syndrome . postoperative radiologic studies confirmed patency of the duodenojejunostomy , and there have been no further obstructive episodes . in conclusion , sma syndrome can be added to the growing list of disorders that can be successfully treated laparoscopically . laparoscopic treatment via duodenojejunostomy is safe and effective and may offer patients the benefit of decreased pain , hospital stay , and postoperative disability .

background and objectives : superior mesenteric artery ( sma ) syndrome is a rare disorder , recognized as weight loss , nausea , vomiting , and post - prandial pain due to compression and partial obstruction of the third portion of the duodenum by the sma . if conservative treatment fails , then laparotomy with duodenojejunostomy or lysis of the ligament of treitz is indicated . recently , laparoscopic division of the retroperitoneal attachments of the duodenum has been described . we report the first case of laparoscopic duodenojejunostomy as the definitive treatment of vascular compression of the duodenum.methods:a very thin woman with a diagnosis of sma syndrome was prepared for surgery after having failed medical therapy . the patient was placed in a supine position , and four laparoscopic ports were required to perform a 5 cm duodenojejunostomy.results:the patient did well postoperatively . a gastrograffin study revealed no leak with patency of the duodenojejunal anastomosis . she was subsequently discharged home on a regular diet on postoperative day four.conclusion:laparoscopic duodenojejunostomy is a viable option to treat vascular compression of the duodenum . it provides definitive treatment while preserving the benefits of minimally invasive surgical techniques in the debilitated patient .

according to the new report from world health organization ( who ) published in september 2011 , cardiovascular diseases ( cvds ) remain the leading cause of death and disability in the world . noncommunicable diseases accounted for more than 36 million deaths in 2008 with cvds responsible for 48% of these deaths , cancers 21% , chronic respiratory diseases 12% , and diabetes mellitus 3% . over 80% of cvd deaths occur in low- and middle - income countries . although , a large proportion of cvds is preventable , they continue to rise mainly because preventive measures are inadequate and it has been projected that by year 2030 , almost 23.6 million people will die from cvds . similarly , majority of cvd deaths in low income countries occur in individuals less than 60 years of age [ 1 , 2 ] . interestingly , while actions to reduce blood pressure and cholesterol are having an impact on overall cvd mortality in high - income countries , there is worsening of cvd risk profiles in most developing regions of the world . in sub - saharan africa , the prevalence of cvds has reached near epidemic proportions with sh being the main driver of cardiovascular complications . whereas sh was said to be rare in africans in the first half of the twentieth century , it is the commonest cause of heart failure , stroke , and kidney disease from many studies in africa . this upsurge in the incidence of sh and its complications in sub - saharan africa with high burden of infectious diseases and poverty had greatly reduced the life expectancy in this part of the world . although there are indications that sh plays a major role in cardiovascular outcomes , there is paucity of data particularly in the northeast nigeria on mortality profile of hypertension - related admissions into the medical wards , hence this study . this is a retrospective study which reviewed the frequency and outcome of hypertension - related admissions at the atbuth , bauchi north east nigeria . the hospital is a 650-bedded tertiary health care facility established in 2009 with 130 beds dedicated to medical admissions . the health facility serves as a referral centre for the residents of bauchi state with estimated population of 4.7 million ( 2006 nigerian population census ) and neighbouring states of gombe , yobe , and adamawa . diagnoses and management of all patients admitted into the emergency unit are usually discussed the next day at the morning review with all consultants in attendance . this is to ensure accurate diagnosis of cases and to provide quality care to the patients . blood pressure was measured in the emergency department using a standard mercury sphygmomanometer ( accoson ) every 30 minutes until it was stable . hypertension was defined as admission blood pressure of 140/90 mmhg or antihypertension medication usage . records of all patients admitted between 1st november 2010 and 31st october 2011 were studied . although we independently reassessed patients ' diagnoses from their medical records , the final diagnosis used in this study was that of the managing consultants . this was because there was high correlation between reviewed diagnoses and the initial one by the managing team . case files of those admitted for various complications of sh were retrieved using both nurses and medical records admission books . necessary information was extracted from the case files and entered into a proforma designed for the study . patients who were admitted for hypertensive heart failure , stroke , or transient ischemic attack ( tia ) due to sh , hypertensive nephrosclerosis and hypertensive emergencies or urgencies were included . excluded from the study were cases with blood pressure less than 140/90 mmhg at presentation and who were not on antihypertensive medication and no documented stigmata of long standing sh . information obtained from the case notes was patient 's age and gender , complications of sh , awareness of hypertension , duration of hypertension , drug compliance , alcohol use , and cigarettes smoking . others included patient 's weight , height , body mass index , sbp , dbp , duration on admission and outcome . total number of admissions and hypertension - related admissions were noted , and the percentage of latter was calculated . a simple frequency distribution of sh complications was generated . student t - test was used to compare means of continuous variables while chi - square test was used to compare means of proportions . three thousand one hundred and eight patients consisting of 1603 ( 51.6% ) males and 1505 ( 48.4% ) females were admitted at the medical wards of atbuth during the period of the study . three hundred and fifty - two deaths occurred in males and 236 in females with percentage mortality being higher ( p = 0.0001 ) in males ( 21% ) than in females ( 15.7% ) . of the total 3108 admissions , 735 ( 23.7% ) were due to hypertension - related complications , with mean age of 51.9 17.5 years . diabetes complications with sh as comorbidity were seen in 96 ( 3.1% ) patients , peripartal cardiomyopathy in 51 ( 1.64% ) , and stroke in the young not related to sh was diagnosed in 25 ( 0.8% ) patients . others included dilated cardiomyopathy in 18 ( 0.6% ) patients and coronary artery in 2 ( 0.06% ) patients . a total of 1220 ( 39.3% ) patients were admitted for cholera which ravaged bauchi state during the period of the study . when cholera patients were excluded from analysis three main occupations among the patients admitted included housewife ( 33.5% ) , trading ( 22.2% ) , and farming 21.4% ) . although hypertension - related admissions were 23.7% of total admissions , there was an excess of mortality from sh complications ( 42.9% ) . stroke / tia was the commonest complication of sh in the patients , and it accounted for 44.4% of cases . this was followed by hypertensive heart failure ( 27.8% ) , hypertensive emergencies ( 16.7% ) , and chronic kidney disease ( 11.2% ) . mean sbp and dbp were 167.4 18.2 and 98.6 13.5 at presentation . although 498 ( 67.8% ) patients were aware of their sh status at presentation , only 269 ( 36.4% ) were compliant with their antihypertensive medications . comparison of baseline characteristics of survivors and nonsurvivors of sh admissions is presented in table 2 . nonsurvivors were older ( p = 0.001 ) and had longer duration of hypertension ( p = 0.041 ) and higher body mass index than survivors . similarly , pulse rate , sbp , and dbp were significantly higher in nonsurvivors than survivors ( p = 0.001 , 0.001 and 0.001 , resp . ) . the mean duration of hospital stay was significantly shorter in nonsurvivors ( 6.6 7.8 days ) in comparison to survivors ( 11.7 13.6 days ) , p = 0.001 . the percentages for awareness of sh , compliance with antihypertensive medications , alcohol use , and cigarette smoking were similar between survivors and non - survivors . stroke had the highest mortality ( 39.3% ) , followed by chronic kidney disease ( 36.6% ) hypertensive emergencies ( 30.9% ) and hypertensive heart failure had the lowest intrahospital mortality ( 27.5% ) . while duration of sh and pulse rate at presentation was higher in males than in females , the mean body mass index was higher in females . on the other hand , mean age , duration on admission , sbp , and dbp were similar between the two groups . although mortality profile due to stroke , hypertensive heart failure , and chronic kidney disease as well as hypertensive emergencies was higher in males than females , the differences did not reach statistical significance . the probability of death increased with age ( odds ratio = 1.024 , p = 0.02 ) , pulse rate at admission ( odds ratio = 1.02 , p = 0.001 ) , and duration on admission ( odds ratio = 0.957 , p = 0.002 ) . the findings from this study showed that hypertension - related admissions accounted for sizeable proportion ( 23.7% ) of medical admissions among adult patients from a tertiary health institution in northeastern nigeria . this result is comparable to 20.2% from another tertiary hospital in southsouth and 18.4% from southeastern nigeria . similarly ndjeka et al . reported 19% from a rural hospital in south africa . interestingly , when cases of acute cholera admissions were excluded from the data because cholera was epidemic during the study period , the proportion of hypertension - related admissions rose to 38.9% . the three commonest complications of sh were stroke ( 44.4% ) , hypertensive heart failure ( 27.8% ) , and hypertensive emergencies ( 16.7% ) , respectively . although hypertension - related complications accounted for 23.7% of medical admissions , mortality related to this condition was 42.9% . this mortality profile is high and may be a reflection of severity of sh complications in the patients . casefatality of hypertensive - related admissions was 34.3% , and this was significantly influenced by age , duration of sh , body mass index , and admission pulse rate . factors that were predictive of mortality in this study were patients ' age , admission pulse rate , and duration of admission . some of these factors have also been identified in a study among congolese . the overall mean length of hospital stay was 10.1 12.7 days ( median 7 days ) . non - survivors had a median duration of 4 days at death compared to survivors with median stay of 8 days , and most deaths occurred within the first week of admission . mean duration of hospital stay has been documented in some studies to be associated with mortality . one important finding of this study is the fact that two - thirds of the patients had been diagnosed as being sh prior to admission . among those who were aware of their sh status , drug compliance rate was 54% this proportion is similar to what had been reported in other studies in africa [ 11 , 13 ] and may be one of the reasons for high mortality in the region . high level of illiteracy along with poverty and side effects of medications was among several reasons given for poor compliance . unlike the study from congo where death was associated with younger age , report of this study showed that hypertension - related death was more in older people . the tendency of older people having more cardiovascular comorbid conditions could partly explain this observation . high pulse rate was another factor that predicted risk of death from complication of sh in this study . several published data have demonstrated a positive association between pulse rate and all - cause mortality in hypertensive individuals [ 14 , 15 ] . this has an important implication for choice of medication especially in the presence of complications . although smoking and alcohol abuse had been associated with poor outcomes in hypertensive patients , findings from this study did not show any significant difference amongst survivors and non - survivor in this regard . in europe and america , hypertensive cardiovascular complications are commonly seen in older age group [ 16 , 17 ] ; however , relatively younger individuals were affected in our study . majority of our patients were not covered by the national health insurance scheme which has just started in nigeria and thus had to pay for drugs and services at the point of care which increase out - of - pocket expenses . in addition , a sizeable number of our patients were housewives and students with little or no sources of income . these reduce their financial capability to purchase antihypertensive medications and compliance with their treatment . stroke was the commonest complication of sh amongst this group of nigerians , and this agrees with previous studies from other regions in nigeria [ 8 , 9 , 17 ] . recent community and hospital - based data have shown increasing cases of stroke in africa [ 18 , 19 ] . on the other hand reports from high income countries seem to suggest a decline in hypertension - related complications . part of the reasons for this is availability of potent antihypertensive medications with minimal side effects which are associated with greater compliance . mortality among males ( 21% ) was significantly higher than in females ( 15.7% ) . gender - related difference in mortality among medical admissions had been reported from a hospital - based study in nigeria . although females tend to use hospital more frequently , male patients often present with complications . part of the limitations of this study includes the fact that it was a retrospective study and being hospital based . it might be difficult to generalize our result to the entire community since study was from a tertiary hospital which serves as a referral centre to the neighbouring states . low postmortem rate to confirm or refute diagnoses was another limitation of the study . in conclusion , sh complications are common among medical admissions in bauchi nigeria and occur at a relatively young age . hypertension - related admissions are associated with excess mortality , and stroke is the commonest . community intervention to health - educate the populace on the need for early detection , dangers of sh , and other cardiovascular risk factors is urgently needed . women empowerment programs and provision of gainful employment by the government will reduce poverty and improve medication compliance among hypertensive individuals .

cardiovascular disease has reached near epidemic proportion in sub - saharan africa , and systemic hypertension ( sh ) remains the driver of cardiovascular complications . we studied hypertension - related admissions and their outcome at the abubaker tafawa balewa university teaching hospital ( atbuth ) bauchi , northeast nigeria . records of all patients admitted into the medical wards between 1st november 2010 and 31st october 2011 were studied , and case files of those managed for sh complications were selected for detailed examination . of the total 3108 admissions , 735 ( 23.7% ) were hypertension related . mean systolic blood pressure ( sbp ) and diastolic blood pressure ( dbp ) were 167.4 18.2 and 98.6 13.5 , respectively , at presentation . although , hypertension - related admissions were 23.7% of total admissions , there was an excess of mortality associated with sh complications ( 42.9% ) . stroke was the commonest , and it accounted for 44.4% of cases . stroke had the highest mortality ( 39.3% ) , followed by chronic kidney disease ( 36.6% ) ; hypertensive emergencies ( 30.9% ) and hypertensive heart failure had the lowest intrahospital mortality ( 27.5% ) . in conclusion , sh - related admissions are common among medical admissions in bauchi nigeria and are associated with high mortality . community interventions that promote early diagnosis and reduction of cardiovascular risk profiles are urgently needed to reduce sh deaths .

but , considered little more than cellular garbage cans acting to discard unwanted molecular components , exosomes remained little studied for the next 10 years . over the past few years , however , evidence has begun to accumulate that the vesicles are like signaling payloads containing cell - specific collections of proteins , lipids , and genetic material that are transported to other cells where they alter function and physiology . the findings have reignited interest in exosomes , but also more generally in all secreted vesicles , whether they can be called exosomes or not , and the topic has now blossomed into a full - fledged field of research that of vesicle - modulated cell - cell communication . two years ago , i began receiving daily emails regarding my articles on exosomes , requesting reprints , details on exosome - related protocols , and advice on the purification and characterization of the vesicles . having worked in this area for more than 10 years , i thought i knew all the other researchers working on the subject , but the requests were coming in from groups i had n't heard of before . the flood of inquiries made me realize that the field had been growing , attracting the attention of more and more researchers in a relatively short period of time . a quick glance at the literature confirmed the trend : while fewer than 20 pubmed - referenced papers using the word exosomes were published in early 2003 , and just over 60 in 2007 , nearly 350 exosome studies have been published in the last 3 years alone . the idea thus came to me and to graa raposo , who discovered exosomes from immune antigen - presenting cells in 1996 , to organize an international workshop on exosomes ( iwe ) . although a meeting organized by the late rose johnstone , who participated in the first description of exosomes in 1983 , had drawn 25 scientists to montreal , canada , in 2005 , the new meeting , which took place this january at our home institution , the curie institute in paris , attracted nearly 10 times as many attendees . there , researchers discussed their recent findings on exosomes , and on other types of secreted membrane vesicles , in fields ranging from immunology to neurobiology and tumor biology , as well as potential clinical applications , such as biomarkers or as therapeutic tools . in pluricellular organisms , cells communicate with each other via extracellular molecules such as nucleotides , lipids , short peptides , or proteins . these molecules are released extracellularly by cells and bind to receptors on other cells , thus inducing intracellular signaling and modification of the intracellular physiological state of the recipient cells . but , in addition to these single molecules , eukaryotic cells also release in their extracellular environment complex structures called membrane vesicles , which contain numerous proteins , lipids , and even nucleic acids , and can affect the cells that encounter these structures in much more complex ways . although known to exist for several decades ( for instance , in blood , where they are generally called microparticles , or in seminal fluid , where they are called prostasomes ) , membrane vesicles have long been thought of as mere cell debris , signs of cell death , or structures very specific to a unique organ . the phenomenon of exosomes and their wider involvement in intercellular signaling began to emerge from this picture in the last decade . exosomes are formed in endosomal compartments called multivesicular endosomes , containing internal vesicles that package and store molecules in membrane - bound structures . endosomes are generally considered to function as an intermediate compartment between the plasma membrane , where endocytosis of extracellular molecules takes place , and compartments ( lysosomes ) , where these molecules are released and degraded . however , about 25 years ago , the groups of philip stahl in the united states and rose johnstone in canada described , using very elegant pulse - chase and electron microscopy experiments , that in reticulocytes undergoing maturation into red blood cells , multivesicular late endosomes could fuse back with the plasma membrane ( instead of with lysosomes ) , and release their contents , including numerous small vesicles , extracellularly . in 1987 , the term exosomes was proposed to define these extracellularly released intra - endosomal vesicles . exosomes remained all but forgotten for the next 10 years until raposo , while working with the group of hans geuze in holland in 1996 , showed that epstein barr virus ( ebv)-transformed b - lymphocytes secreted exosomes that bore molecules essential for the adaptive immune response : major histocompatibility class ( mhc ) ii dimers bound to antigenic peptides . these exosomes were also shown to present the mhc peptide complexes to specific t cells , suggesting that they could play a role in adaptive immune responses . two years later , the groups of raposo , amigorena , and zitvogel demonstrated that dendritic cells ( the immune cells that initiate adaptive immune responses by presenting mhc peptide complexes to nave t cells ) also secrete exosomes bearing functional mhc peptide complexes , which could promote induction of antitumor immune responses in mice in vivo . these results provided the basis for the hypothesis that exosomes could play an active role in intercellular communication , at least in the immune system , and prompted the very first attempt at using them in the clinic , as a new type of anticancer therapy in humans . ( after phase i trials held between 1999 and 2002 , a phase ii trial is currently ongoing at the gustave roussy institute ( with participation of the curie institute ) in france . ) the first major advance of subsequent years was linked to the development of large - scale protein analysis techniques , which allowed us to demonstrate that exosomes represent a specific subcellular compartment , rather than random cell debris . proteomic analyses of exosome composition were first performed on exosomes secreted by dendritic cells , and then on exosomes from numerous other different cell types , which are compiled in the exocarta compendium . these studies showed that exosomes did not contain a random array of the intracellular proteins , but a specific set of a few protein families , essentially coming from the plasma membrane , endocytic pathway , and the cytosol , with very limited amounts of proteins from other intracellular compartments ( e.g. , nucleus , endoplasmic reticulum , and golgi apparatus ) , which made them clearly different from membrane vesicles released by apoptotic cells . these results established that exosomes are actively secreted by live cells , and confirmed their intra - endosomal origin . in parallel , studies of exosomes purified in vitro from tissue cultures ( of immune cells but also epithelial and tumor cells ) , started showing that exosomes secreted by one cell could be captured by another cell and transfer information to the latter . the information transferred could include antigens or mhc peptide complexes for increasing the range of antigen - presenting cells and the efficiency of induction of immune responses [ 13 - 15 ] , or in some cases negative signals leading to death of the target cell . these observations provide the basis of the nowadays popular idea that exosomes represent a new type of intercellular messenger . the second real breakthrough in this field came in 2007 , with the convincing description by the group of jan ltvall in sweden of the presence of mrna and microrna ( mirna ) inside these vesicles . in addition , the authors showed , at least in vitro using large amounts of concentrated exosomes , that some mrna present in exosomes could be translated into proteins in target cells , suggesting that exosomes can transfer genetic information . this discovery , and the concomitant development of research on mirnas , sparked the recent exponential increase in the numbers of papers on exosomes . in january 2011 , oral and poster presentations at the iwe 2011 covered all the currently explored fields of exosome research spanning immunology and cell biology , their use as biomarkers , and their relationship to tumors . my four major conclusions from this meeting are that : ( a ) exosomes are not the only secreted membrane vesicles that could act as intercellular messengers , and efforts should be dedicated to combine and compare data obtained on these different vesicles ; ( b ) the next few years should show us whether rna and mirna in circulating vesicles ( exosomes or others ) will prove to be useful biomarkers of various diseases , providing new diagnostic or prognostic tools ; ( c ) although they were originally described in cells of the immune system , exosomes are now known to be secreted by many different cell types , and a large amount of recent data highlight their possible functions as messengers during development of tumors , in some functions of stem cells , in the nervous system , or during interactions of pathogens with their host ; ( d ) although the last 3 decades have expanded our knowledge of exosomes considerably , there is still no definite evidence for their physiological functions in vivo , and demonstrating such functions remains a major challenge of this field . the term exosomes should be used to define secreted membrane vesicles that form inside intracellular multivesicular compartments and that are released upon fusion of these compartments with the plasma membrane ( figure 1 ) . because of this intracellular origin , exosomes are similar in size to internal vesicles of multivesicular compartments ; that is , around 100 nm in diameter . exosomes are commonly purified on the basis of size by serial steps of centrifugation , with a final 100,000 g ultracentrifugation to pellet exosomes ; however , this purification is not absolute . some cells also release other types of membrane vesicles , which can , for instance , directly bud off the plasma membrane towards the outside of the cell . the size of such vesicles is not as strictly determined as that of exosomes , and they can be anywhere between 501,000 nm in diameter . various terms have been used for these vesicles , such as ectosomes , shed vesicles , or microvesicles , but this latter term has also been used more widely for any type of vesicle , whether intra- or extracellular , and regardless of its intracellular origin . the release of large plasma membrane - derived vesicles is quickly induced after stimuli such as fresh fetal calf serum on tumor cells , complement deposition , or increasing intracellular ca in neutrophils . vesicles can be separated by size using ultracentrifugation at different speeds , with the larger vesicles pelleting at lower speed than the smaller ones . but similarly sized vesicles of different intracellular origins ( i.e. , exosomes and small plasma membrane - derived vesicles ) will not be separated by this method . flotation of vesicles on sucrose gradients can allow some separation of vesicles with different densities , but this separation is not complete . thus , adequate means to distinguish the different types of vesicles secreted by a cell are still lacking . proteomic studies of microvesicles or ectosomes have not , so far , been as extensive as for exosomes , but they are underway and they will help to understand the specificity of their secretion . like exosomes , membrane microvesicles and ectosomes contain various active molecules , such as cytokines , growth factor receptors , and rnas , and also metalloproteases ( which have not been described in exosomes ) , but since studies comparing exosomes and other vesicles released by the same cells are only beginning now , understanding the functional specificity of each type of vesicle should become possible in the next few years . since the identification of rna in exosomes in 2007 and development of high - throughput techniques for nucleic acid analyses , there have been an ever increasing number of studies reporting sequences of the rna in exosomes . such studies show that not all messenger rnas present in a cell end up in exosomes , and there is apparently specific targeting of some mrna sequences into the released vesicles . these last observations refute the idea that mrna in exosomes results from a random contamination of secreted vesicles by mrna released extracellularly by dying cells . however , it is still unclear from the few published studies whether one can ( as for exosomal proteins ) find a set of exosomal mrna that would be consistently targeted to exosomes in any cell type , possibly in addition to cell type - specific mrna sequences . understanding the mechanisms of mrna targeting to these vesicles should open the way to understanding the function of rna delivery to secreted vesicles . of note , mrna has also been described in microvesicles ( or mixed exosome / microvesicle preparations ) released by tumors or embryonic stem cells [ 21 - 23 ] , and some ongoing studies are now comparing sequences of rna targeted to either exosomes or larger vesicles , and determining whether there is a distinct targeting to each of them . the situation is even more complicated for mirna : even though they have also been observed in various exosome preparations , the heterogeneity of techniques used to identify the mirna sequences do not allow one to conclude whether there is specific targeting of mirna to secreted vesicles . in addition , although extracellular release of mirna can be decreased by some drugs , the literature still describes heterogeneous results concerning the respective contribution of free ( or protein - associated ) mirna , as compared to mirna encapsulated in exosomes or other secreted membrane vesicles . despite the uncertainties about the nature of mrna and mirna - carrying vesicles , the biopharma industry has put a lot of effort into studying the use of secreted vesicles especially their mrna and mirna content as biomarkers in clinics . this is easier than it might seem to be because their encapsulation into membrane vesicles protects extracellular rnas from degradation , and allows efficient recovery from biological fluids , such as plasma , urine , milk , sperm , or saliva . work in several different laboratories to compare rna ( as well as protein ) sequences in vesicles isolated from normal and cancer cell lines , for instance , and from biological fluids of patients ( cancer or other diseases ) is ongoing . it is still too early to propose new biomarkers ( either for diagnosis , prognosis , or predictive response to therapies ) from these studies , but given the current effort put in this direction , the next few years should allow us to decide whether such markers exist and are useful . once secreted , membrane vesicles interact with surrounding cells : many fluorescence microscopy studies show capture of these vesicles and accumulation in internal endocytic or phagocytic compartments , especially in phagocytic cells such as macrophages , but one must keep in mind that vesicles smaller than 200 nm in diameter can not be detected by confocal microscopy techniques , and only electron microscopy allows detailed visualization of exosomes . hence , the way individual vesicles interact with recipient cells is still not known , and has been proposed to involve binding at the cell surface via specific receptors , internalization by endocytosis or micropinocytosis , and/or fusion with plasma membrane or with the limiting membrane of internal compartments . evidence that fusion does occur in certain cases comes from a recent study showing diffusion of exosomal lipids in the membrane of recipient cells : this observation explains how exosomes could release their internal content ( e.g. , rna ) into the cytosol of recipient cells . exosomes induce physiological changes in recipient cells upon interaction . because the original description of exosomes was in immune cells , there is a vast amount of data on the immunological effects of exosomes , and these vary strongly depending on the physiological state of the cells which secrete them ( see for references ) . for instance , mature dendritic cells secrete exosomes that carry antigens or mhc peptide complexes , and induce antigen - specific immune responses by other dendritic cells ( especially in the context of anticancer therapies ) ; conversely , exosomes secreted by dendritic cells subjected to immunosuppressive treatments , or modified to express immunosuppressive cytokines , can instead promote tolerogenic immune responses , which could make them useful as a treatment for autoimmune diseases . in a third example , macrophages infected with procaryotic mycobacteria release exosomes that , depending on the mycobacteria strain , bear antigens and promote immune responses ( nonpathogenic strain ) , or inhibit macrophage activation and cytokine secretion , thus dampening immune response ( pathogenic strain ) . although exosomes secreted by tumor cells carry antigens from the secreting tumors and can be captured and used to present tumor antigens by dendritic cells , they also bear various immunosuppressive molecules , which can inactivate t lymphocytes or natural killer cells , or promote the differentiation of regulatory t lymphocytes or myeloid cells ( which suppress immune responses ) . the net result of these contradictory effects in vivo is not yet established , and although several groups defend the hypothesis that tumors secrete exosomes to promote their growth by inhibiting antitumor immune responses , or by promoting angiogenesis or migration outside the tumor bed to form metastases , this has not been proved . still , it has been suggested that depletion of membrane vesicles from the blood circulation of patients could be used as an anticancer treatment , but i would be cautious in using such approaches in the absence of proper understanding of what tumor - derived exosomes or other membrane vesicles do in vivo . an alternative explanation is that membrane vesicles of tumor origin in the circulation of cancer patients could simply be the result of tumor expansion , rather than a sign of active involvement of these vesicles in tumor progression . other tissues or cells secrete exosomes bearing immunosuppressive molecules : placenta - derived vesicles , which bear ligands for natural killer lymphocytes , are found in pregnant women 's blood circulation , and extensive analyses of components of these vesicles are underway to identify their role in the mother 's tolerance to the fetus . depending on the state of the host , exosomes ( or vesicles ) present in their bronchoalveolar fluid can bear tolerizing molecules ( e.g. , in mice tolerized for an allergen ) or , conversely , increase proinflammatory cytokine secretion by airway epithelial cells ( in asthmatic human patients ) . secretion of exosomes by eukaryotic parasites ( leishmania major ) or pathogens ( such as fungi ) has also been recently described . it is thought to contribute to tolerance of the host for the parasite by dampening immune response or , conversely , to contribute pathologic inflammatory reactions of the host to the pathogen . exosomes are secreted by neural , epithelial , muscle , and stem cells , and their range of proposed functions is extensive . exosomes from mesenchymal stem cells contribute to tissue repair of host cardiac tissue , and , conversely , lung tissue can release exosomes ( or possibly other vesicles ) that modify stem cells to promote differentiation of the lung tissue into lung epithelial cells . exosomes are secreted by neurons , oligodendroglial cells , and microglia , and exosomes from each source can affect other neural cells [ 28 - 30 ] . exosomes are involved in the formation / transfer of pathogenic proteins ( such as prions and amyloid deposits ) . despite the amount of data on what exosomes ( and other secreted membrane vesicles ) can do in vitro , or in vivo when injected into animals , all data discussed above were obtained with vesicles purified and concentrated in vitro from cell culture supernatants or from biological fluids , so it is not clear whether these processes occur under physiological conditions . the main problem is that the efficiency of the purification and quantification procedures is unknown . it is likely that ultracentrifugation does not allow 100% recovery of the vesicles secreted at any given time , and that part of the secreted vesicles are even inaccessible to purification because they are recaptured by cells rather than released in the culture medium or fluid , so it is very difficult to know whether the amounts of membrane vesicles used to observe the effects described above correspond to physiological amounts secreted in vivo , or not . indeed , there remains a nagging question in the exosome field as to whether they actually have any physiological functions in vivo . answering this question requires tools to inhibit or increase exosome secretion specifically , without affecting secretion of other membrane vesicles , or affecting general secretion of proteins or lipid mediators . several groups are currently trying to identify such tools , especially by deciphering the molecular mechanisms involved in formation of intracellular vesicles of multivesicular compartments , and in the fusion of these compartments with the plasma membrane . several molecules have been shown to affect exosome secretion , although in the absence of means to visualize and quantify actual fusion of multivesicular endosomes with the plasma membrane in real time , it is still difficult to know whether they are involved specifically in this final step , or at another stage of the endocytic pathway . a consensus has not yet been reached on the molecular mechanisms involved . indeed , depending on the cell types , different molecules have been described in the biogenesis and secretion of exosomes : rab11 in erythroleukemia cell lines , rab27 in hela cells , and rab35 and neutral sphingomyelinase in oligodendroglial cells . it remains to be determined whether these discrepancies are due to different machineries used in different cell types , and/or whether the secreted vesicles analyzed in the different studies come from different intracellular compartments ( along the endocytic pathway , or even outside this pathway ) . recent studies showing that internal vesicles of multivesicular endosomes can , in some circumstances , form without the help of the escrt ( endosomal sorting complex required for transport ) machinery ( described as being responsible for segregation of molecules into internal vesicles of late endosomes in yeast ) suggest that , indeed , more types of multivesicular compartments than initially thought may coexist in the same cells , and may possibly lead to different types of exosomes . in any case , targeting one or the other of these molecules to affect exosome secretion will require careful evaluation of the consequences ( in terms of exosomes , but also other secretions ) in each different model system analyzed . other approaches to address the physiological functions of exosomes in vivo , proposed during the meeting in paris , include generating exosomes with modified expression of a given functional protein and analyzing their functional outcome , or containing bacterial enzymes to identify target cells via measurement of the enzymatic activity . using these approaches in genetically modified mice will be the next step for this challenging field . finally , similar cell biology studies on the generation of other secreted membrane vesicles are also underway , and hopefully will allow proper discrimination of the roles as messengers of the different types of vesicles . with the amazing expansion of the number of published studies on exosomes in the last 3 years , it is clear that research on secreted membrane vesicles and their roles as intercellular messengers is now a very exciting field , with new ideas , hypotheses , and questions coming up faster than answers ! the iwe in paris allowed most of the long - term exosome and vesicle aficionados , as well as many of the newcomers , to meet , exchange ideas freely , and to point out current problems with technologies , definitions , and characterization . the meeting ended with the decision to prolong this very productive workshop by setting up future yearly meetings , virtual spaces to record exchanges and discussions ( such as a website and/or a facebook page ) , and a scientific society dedicated to exosomes and secreted membrane vesicles . some of these are already underway , with the next iwe tentatively scheduled for april 2012 , a facebook page already up and running , a website for comparison of protein and rna composition of exosomes already set up , and the rest hopefully coming soon . we strongly encourage the readers of this article to check these web links to follow the next steps of this emerging scientific world .

exosomes are small membrane vesicles of endocytic origin secreted by most cell types , and are thought to play important roles in intercellular communications . although exosomes were originally described in 1983 , interest in these vesicles has really increased dramatically in the last 3 years , after the finding that they contain mrna and microrna . this discovery sparked renewed interest for the general field of membrane vesicles involved in intercellular communications , and research on these structures has grown exponentially over the last few years , probing their composition and function , as well as their potential value as biomarkers .

ovarian cancer affects close to 25,000 women yearly and most patients have extensive metastatic disease at the time of diagnosis.ovarian cancer metastasis is thought to result from exfoliation of tumor cells from the ovary and/or direct extension onto the peritoneal surfaces , the omentum , and the surface of organs such as the liver and bowel . a standard approach to therapy is to surgically remove surgically as much of the tumor(s ) as possible , a process known as surgical cytoreduction . this technique , which leaves only microscopic residual disease , is used in conjunction with chemotherapy . these dismal statistics show the need for improved understanding of the process of metastatic colonization , the final step in metastasis , in which cancer cells undergo progressive growth at secondary sites [ 2 , 3 ] ( see figure 1 ) . while invasion and adhesion have been well studied , mechanisms regulating metastatic colonization are largely unknown . remarkably , in 2000 when our laboratory began working on metastasis suppressors in ovarian cancer , there were only a handful of papers that specifically addressed aspects of ovarian cancer metastasis . not surprisingly , research in the molecular underpinnings of ovarian cancer metastasis continues to lag behind other cancer types . in addition to fundamental aspects of metastasis , there are promising developments in the area of therapeutic application of metastasis suppressors . dan theodorescu ( university of virginia ) demonstrates the feasibility of taking metastasis suppressors into the clinic ( reviewed in ) . the following sections describe our approach to using the jnkk1/mkk4 metastasis suppressor to dissect molecular events governing omental metastatic colonization in the skov3ip.1 model . it is our goal to encourage others to examine metastasis suppressors in clinical and experimental ovarian cancer metastases . this observation prompted the hypothesis that molecular processes regulating tumorigenicity and metastasis are distinguishable and could be targeted therapeutically . to identify events specifically involved in metastasis regulation , our laboratory and others hypothesized that genes and their encoded proteins that specifically regulate metastasis formation could be functionally identified [ 47 ] . metastasis suppressors are operationally defined as genes which , when ectopically expressed in metastatic cells , can inhibit the development of spontaneous overt metastases without significantly affecting primary tumor growth . this definition has been extended to include genes and their encoded proteins which specifically inhibit metastatic colonization ( i.e. , experimental metastasis formation using intravenous or intraperitoneal injection ) . identification of metastasis suppressors requires in vivo testing since in vitro assays generally do not model the process of metastasis . when efforts to find metastasis suppressors were initiated , it was expected that their utility would be in predicting disease outcome ; however , robust in vivo studies have showed that metastasis suppressors can control the growth of cancer cells at metastatic sites [ 4 , 8 ] . as a result there now is evidence that metastasis suppressors can influence the interaction of disseminated cells with the microenvironment of distant organs and impair metastatic colonization . interestingly , other investigators , working on completely different questions , also identified metastatic colonization as a rate - limiting step in metastasis formation [ 8 , 9 ] . to date our laboratory and others have identified 23 bona fide metastasis suppressors , many of which would not have been predicted a priori based on their previously known function(s ) [ 4 , 5 ] . determining how metastasis suppressors modulate cancer cell - microenvironmental interactions will shed light on their function in metastatic colonization , a clinically tractable therapeutic target [ 2 , 10 ] . our laboratory identified c - jun nh2-terminal kinase ( jnk ) kinase 1/mitogen - activated protein kinase ( mapk ) kinase 4 ( jnkk1/mkk4 ) as a prostate cancer metastasis suppressor in 1999 and subsequently as an ovarian cancer metastasis suppressor in 2002 . map kinases occupy a central position in cell growth , differentiation , and transformation . to date , three map kinase modules have been well characterized : extracellular signal - regulated protein kinase ( erk ) , c - jun nh2-terminal protein kinase ( jnk ) , and p38 . the jnk signaling cascade consists of two map2ks , jnkk1 , and mkk7 , while the p38 signaling cascade map2ks includes jnkk1 , mkk3 , and mkk6 . jnkk1/mkk4 is a dual - specificity kinase which , in response to extracellular stimuli , can become activated and in turn can phosphorylate and activate the jnk and p38 mapks ( figure 2 [ 24 ] ) . in contrast , the mkk7 map2k can only phosphorylate jnk , while the mkk3 and mkk6 map2ks can only phosphorylate p38 . downstream targets of mapk signaling include components of the ap-1 transcription factor complex . the biological outcome of mapk activation can depend , in part , on the transcriptional regulation of target genes . specificity depends on factors such as cell type , cell environment , signal strength and duration , and the particular composition of the transcription factor , such as ap-1 . while conventional wisdom stipulates that the jnk and p38 pathways mediate viability to stresses , increasing evidence from several model systems indicates a role for both of these mapks in cell cycle and consequent proliferation . for instance , reports demonstrate important functions for jnk in the g1/s transition , g2/m progression , and/or cytokinesis . similarly , p38 can activate the g2/m and spindle assembly checkpoints in mammalian cells and delay entry into mitosis or may prevent anaphase entry when the mitotic spindle is damaged [ 16 , 17 ] . in sum , the biological and biochemical functions of jnkk1 were consistent with its putative role in metastasis suppression ; however , there were no published studies testing its function in complex and dynamic pathological processes such as metastasis . jnkk1/mkk4 protein levels were significantly decreased in metastases as compared to normal ovarian surface epithelium . profiling studies identified high jnkk1/mkk4 expression as a significant predictor of improved response to surgical cytoreduction . in vivo functional studies used skov3ip.1 human ovarian cancer cells , which form metastatic deposits of a serious papillary histology and produce highly reproducible numbers of metastases on the omentum , liver , and bowel . after intraperitoneal injection of 1 10 parental skov3ip.1 or skov3ip.1-vector control cells into female immunodeficient mice , the cells adhere to target organs and by 30 days post injection ( dpi ) animals have 30 metastases . skov3ip.1 cells have low endogenous levels of jnkk1/mkk4 but retain physiologic levels of other components of its signaling cascade . ectopic jnkk1/mkk4 decreased the number of skov3ip.1 metastases by 88% ( p < .0001 ) and increased the animal lifespan by 70% ( wilcoxon , p = .0045 ) . its metastasis suppressor function is kinase - dependent and studies showed that selective activation of p38 by ectopic mkk6 reduced skov3ip.1 metastasis formation by 70% ( p = .0082 ) , while selective activation of jnk by ectopic mkk7 had no effect ( p = .43 ) ( figure 3 , 3(a ) ) . these data further defined jnkk1/mkk4 's metastasis suppressor activity and prompted the question what is the biological mechanism of jnkk1/mkk4-mediated metastasis suppression ? jnkk1/mkk4-mediated metastasis suppression could be due to decreased adhesion of cells , increased apoptosis of cells , or inhibition of cell proliferation . quantitative real time pcr showed that there was not a significant difference between the numbers of vector - only and jnkk1/mkk4-expressing cells present on the omentum at 3 dpi ( p = .06 ; ) . this showed rare apoptotic cells ( < 1% ) in both groups ( p = .43 , figure 4(a ) ) . these data were confirmed by morphological assessment as well as immunohistochemistry ( ihc ) for cleaved caspase 3 , which is an early marker of apoptosis . to determine if skov3ip.1-jnkk1/mkk4 cells were deficient in proliferation , incorporation of brdu ( a marker of s - phase cells ) and endogenous levels of phospho - histone h3 ( ( ph3 ) , a marker of m - phase cells ) these studies showed that brdu incorporation was decreased in skov3ip.1-jnkk1/mkk4 cells ( figure 4 ; 6% versus 19% positive cells , p < .0001 ) . similarly , ph3 staining showed decreased numbers of mitotic skov3ip.1-jnkk1/mkk4 cells ( average of 0.7% versus 2.5% positive cells in the skov3ip.1-vector cells , p = .004 ) . the decrease in brdu incorporation and ph3-staining in skov3ip.1-ha - jnkk1/mkk4 microscopic lesions suggested that fewer cells were traversing s- and subsequently m - phase compared to controls . this prompted the examination of cell cycle inhibitory proteins , including p21 and p27 , using ihc . this showed a nearly 10-fold increase in p21 in skov3ip.1-jnkk1/mkk4 microscopic lesions in vivo as compared to controls ( average 9% versus 1% , p < .0001 , figure 4(c ) ) . since only a portion of the total population of skov3ip.1 cells is in cell cycle at any point in time ( with 19% entering s - phase in a 4-hour window ) , the observed increase in p21 ( 9% of the population ) is biologically relevant . the observation that jnkk1/mkk4 activation inhibits disseminated cell growth prompted us to examine the extent and duration of this suppression . despite the reduction in the number of skov3ip.1-jnkk1/mkk4 metastases at 30 dpi and extension of survival , a mathematical analysis of the rates of overt metastasis formation suggested that suppression and outgrowth of jnkk1/mkk4 cells are due to the behavior of the population and not selection of a subset of cells , as would occur with increased apoptosis or differential adhesion to the omentum [ 20 , 21 ] . molecular analyses showed that overt metastases still express functional jnkk1/mkk4 , supporting the notion that metastasis formation was not due to selection for cells that have permanently altered their jnkk1/mkk4 signaling status . our accumulated data support a model in which binding of cells to the omentum results in the activation of jnkk1/mkk4 and induction of a cell cycle arrest . in order to determine what cellular and molecular signals activate jnkk1/mkk4 and how overt metastases ultimately form , we must consider the microenvironment in which suppression is taking place . in essence we are ahead of ourselves and need to step back and consider what is known about the structure , function , and morphology of the omentum and integrate this knowledge into our current understanding of jnkk1/mkk4-mediated suppression of metastatic colonization . the omentum , the primary site for ovarian cancer metastases , is a fatty peritoneal fold that covers most of the abdominal organs and serves as a storage site for lipids , as a regulator of fluid exchange , and as a reservoir for immune cells . despite its importance , prevailing views of ovarian cancer metastasis formation do not consider the potentially dynamic and specialized functions that the omentum may contribute to this process . historically , the omentum is viewed as being somewhat of an inert , black box the implication is that ovarian cancer metastasis formation is the result of uncontrolled growth of cancer cells and not a regulated process which is in part controlled by the omental microenvironment . a review of the literature challenges the view that the omentum plays a passive role in ovarian cancer metastasis formation . the human and murine omenta are structurally similar , being composed of both adipose - rich and translucent membranous tissues covered by a mesothelial layer . mesothelial cells share characteristics of both epithelial and mesenchymal cell types and range from flattened to cuboidal in shape , depending on the body site or state of activation [ 23 , 24 ] . it is well established that omenta from a wide variety of animals , including immunodeficinet rodents , contain aggregates of immune cells known as milky spots . these were first described by von recklinghausen in 1863 and termed milky spots by ranvier in 1874 . in the omentum , these structures are specialized to enable mobilization of immune cells for migration into the peritoneal cavity . they may also facilitate reentry of immune cells from the peritoneum into the connective tissue ( and therefore bloodstream ) [ 18 , 2230 ] . remarkably , physiologic functions of milky spots , or even their existence , have not been integrated into generally accepted models of ovarian cancer metastasis . this is a crucial oversight , as it does not consider the possibility that ovarian cancer cells may exploit a highly regulated physiologic system in order to adhere , survive , and grow into metastases . there is a limited amount of published data that suggests that cancer cells can specifically interact with milky spot structures [ 31 , 32 ] . interestingly , in our studies , lotan et al . found the association of skov3ip.1-vector and skov3ip.1-jnkk1/mkk4 cells with immune aggregates which we now suspect that they are milky spot structures ( figure 5 ) . our laboratory is currently investigating the potential role for milky spot interactions in jnkk1/mkk4-mediated suppression of metastatic colonization . we hypothesize that disseminated skov3ip.1 cells interact with milky spots in the omentum , and these interactions contribute to the microenvironmental context - dependent activation of jnkk1/mkk4 , resulting in impaired metastatic colonization . evidence for specific interactions of ovarian cancer cells with milky spot structures immediately identifies a target for mechanism - based studies of ovarian metastatic colonization . therapeutic leads may be discerned by determining why disseminated cancer cells , which have molecular modifications that should enable their growth at distant sites , often lodge at target organs and persist as undetectable , or dormant disease . our data to date support the hypothesis that activated jnkk1/mkk4 impairs proliferation of cells early in the course of metastatic colonization . it is remarkable that few , if any , studies have been conducted that specifically examine growth control of cells during metastatic colonization . from the standpoint of translational science , the crucial yet underexplored question is how disseminated cells ultimately bypass suppression and form progressively growing metastases . historically , the fundamental tenets of metastasis biology dictate that acquisition of metastatic ability is the result of the drive of malignant cells towards growth . thus it was predicted that bypass of suppression is simply the result of mutation - selection cycles which permanently inactivate jnkk1 or members of its signaling cascade . challenge this paradigm and suggest that jnkk1-mediated suppression may be due to a reversible cell cycle arrest concomitant with changes in jnkk1 activation status [ 20 , 21 ] . these findings demonstrate a crucial need to reexamine important but scattered literature on population - dependent behaviors of metastatic cells , which have heretofore been refractory to mechanistic study [ 3336 ] . this also presents an opportunity to examine the interaction of ovarian cancer cells with their microenvironment of the omentum during metastatic colonization . given the rich literature on the bidirectional communication between cancer cells and their microenvironments , it is important that we consider microenvironmental functions and adaptations as we examine the population - dependent behaviors of cancer cells . ultimately such studies can lay the foundation for the development of adjuvant therapies that can be used in conjunction with local therapy to delay the onset of disease recurrence , extend survival , and improve quality of life for patients with ovarian cancer .

ovarian cancer affects approximately 25,000 women in the united states each year and remains one of the most lethal female malignancies . a standard approach to therapy is surgical cytoreduction , after which the remaining microscopic residual disease is treated with chemotherapy . the vast majority of patients have disease recurrence , underscoring the crucial need for approaches to control the regrowth , or colonization , of tissues after local treatment . improved therapies require mechanistic information about the process of metastatic colonization , the final step in metastasis , in which cancer cells undergo progressive growth at secondary sites . studies of metastasis suppressors are providing insights into events controlling metastatic colonization . this paper reviews our laboratory 's approach to the identification , characterization , and functional testing of the jnkk1/mkk4 metastasis suppressor in ovarian cancer metastatic colonization . specifically , we demonstrate that interaction of ovarian caner cells with the omental microenvironment activates jnkk1/mkk4 resulting in decreased proliferation without affecting apoptosis . the potential role of the omental microenvironment , specifically milky spot structures , is also described . it is our goal to provide this work as a usable paradigm that will enable others to study metastasis suppressors in clinical and experimental ovarian cancer metastases .

association of osteomalacia or rickets with neurofibromatosis has been documented only rarely . as a rule , osteomalacia in neurofibromatosis is characterized by later onset in adulthood , renal phosphate loss with hypophosphatemia , and multiple pseudofractures in the typical cases . the hypophosphatemic conditions that interfere in bone mineralization comprise of many hereditary or acquired diseases , all of them sharing the same pathophysiological mechanism - reduction in the phosphate reabsorption by the renal tubuli . this process leads to chronic hyperphosphaturia and hypophosphatemia , associated with inappropriately normal or low levels of calcitriol , causing rickets in children and osteomalacia in adults . a 43-year - old woman presented to the orthopedic department of our institute with progressive bone pain and difficulty in walking since two years . the patient was a known case of neurofibromatosis-1 , with multiple cutaneous nodules , from her early childhood . she was otherwise healthy until the age of 40 years , when she started experiencing progressive bone pain affecting her thighs , pelvis , and left forearm . in recent times , she could walk only with the help of crutches . on examination , tenderness and deformity were present in the regions of her left forearm , bilateral thigh , left knee , and leg . multiple skin nodules were present all over her face , back , and abdomen [ figure 1 ] . 43 yrs old , female known case of von recklinghausen neurofibromatosis with multiple skin nodules all over her face and legs her skeletal survey revealed generalized osteopenia , coarse trabeculations , and nodular shadows in the soft tissue . in addition , a radiograph of her left forearm with elbow revealed fractures of the upper shafts of the radius and ulna [ figure 2 ] . a radiograph of her left knee revealed pseudofractures ( looser 's zone ) in the distal femur , upper shafts of the tibia / fibula and mid shaft of the fibula [ figure 3 ] . a radiograph of the pelvis with bilateral hips showed a deformed , triradiate pelvis , with bilateral symmetrical fractures of the upper shaft of the femur and pseudofractures of the inferior pubic rami [ figure 4 ] . and lateral revealed diffuse osteopenia with fractures of upper shafts of radius and ulna ( arrows ) radiograph of left knee with leg a.p and lateral revealed generalized decrease in bony density with pseudo fractures ( looser 's zone ) in the distal femur , upper shafts of tibia / fibula and mid shaft of fibula ( white arrows ) . note nodular shadows in soft tissue ( black arrows ) radiograph of pelvis - a.p . view . triradiate pelvis with osteopenia and bilateral , symmetrical fracture of upper shafts of femur ( white arrows ) with bilateral , symmetrical pseudo fracture of inferior pubic ramii ( black arrows ) the laboratory data in our institute were as follows : serum calcium was 8.7 mg / dl ( normal 8.5 - 10.5 mg / dl ) . serum phosphorus was 1.5 mg / dl ( normal : 2.5 - 4.5 mg / dl ) . alkaline phosphatase was 650 lu / l ( normal 44 - 147iu / l ) . the 24-hour urinary excretions of calcium and phosphorus were 98 mg/24 hours ( normal : 0 - 300 ) and 440 nmol/24 hours ( normal : 13 - 42 ) , respectively . her serum parathyroid hormone ( pth ) and 25-(oh ) vitamin d were within normal range . on the basis of the radiological and laboratory findings , a final diagnosis of hypophosphatemic osteomalacia in a patient of von recklinghausen disease was made . she has been prescribed a high dose of calcitriol and oral phosphate and in view of innumerable neurofibromas , surgical resection was not advised . her constitutional symptoms have improved , but the fractures have shown no radiological signs of healing in the last three months of follow - up . oncogenic hypophosphatemic osteomalacia ( oho ) is a rare endocrinological paraneoplastic syndrome , characterized by defective bone mineralization from renal phosphate loss . it is an unusual condition , but probably still is the most common cause of acquired hypophosphatemic osteomalacia in adult males . the affected age group range is between seven and seventy - seven years with a male : female ratio of 1.2:1 . patients characteristically present with joint deformities , waddling gait , bone pain , muscle weakness , anorexia , fatigue , and occasionally long - bone fractures . the initial clinical presentation may be mistaken for rheumatoid arthritis , muscular dystrophy or primary neurological disorder in some cases . if the biochemical profile of the patient is that seen in hypophosphatemia , namely low phosphate in the serum and high phosphate excretion in the urine , and the patient is not responding adequately to oral calcium and vitamin d therapy , then the possibility of an underlying cause of either renal or oncogenic or hereditary x - linked hypophosphatasia must be entertained . the most common tumor described is hemangiopericytoma , but other tumor types described include fibrous dysplasia , osteosarcoma , chondroblastoma , chondromyxoid fibroma , malignant fibrous histiocytoma , giant - cell tumor , hemangioma , paraganglioma , prostate cancer , and oat - cell carcinoma of the lung . hypothesize that putative melatonin deficiency in cases of neurofibromatosis-1 may play a role in the pathogenesis of hyperphosphaturia , by decreasing the sodium - phosphate cotransport , increasing the level of cyclic adenosine monophosphate ( camp ) and the un - antagonized effect of dopamine on phosphate reabsorption , and increasing the glucocorticoid levels . parathyroid overactivity that may occur secondary to osteomalacia may have synergistic effects with dopamine and further exaggerate the phosphate loss in urine . on the other hand moreover , in the presence of hypophosphatemia , hypercortisolism may further inhibit melatonin secretion that may lead to progression of bony deformities in these cases . in recent times , it has been suggested that in the epidermal nevus syndrome and type-1 neurofibromatosis , hypophosphatemic rickets / osteomalacia is probably due to increased secretion of fibroblast growth factor 23 ( fgf-23 ) by cells from the nevus or neurofibromas . x - linked hypophosphatemic rickets , autosomal dominant hypophosphatemic rickets , tumor - induced osteomalacia ( tio ) , fibrous dysplasia , and the mccune albright syndrome share a common underlying pathophysiological condition : increased phosphorus renal loss secondary to augmented fgf-23 plasma levels and activity . ( a gene on the x chromosome that codes for a zn - metaloendopeptidase proteolytic enzyme , which regulates the phosphate ) . fgf-23 , the largest member of the fibroblast growth factor family ( fgf ) , contains 251 amino acids and is encoded by a gene in 12p13 . the metabolic abnormalities in oncogenic osteomalacia are hypophosphatemia , hyperphosphaturia , low or normal serum calcium , raised alkaline phosphatase , low concentrations of 1,25 dihydroxy vitamin d , decreased tubular resorption of phosphates , normal paratharmone levels , and normal urinary calcium . these are believed to be the result of mesodermal dysplasia , intrinsic to the disease and they appear early in life . they cause bone deformities , and are not associated with disturbances in calcium and phosphate metabolism . in contrast , osteomalacia of neurofibromatosis is very rare , presents in middle age , and is associated with marked disturbance of phosphate metabolism . the presence of multiple symmetrical pseudofractures ( looser 's zone ) , high alkaline phosphatase , low serum phosphate , and generalized demineralization of the bones pointed to the diagnosis of hypophosphatemic osteomalacia . if complete excision of the tumor is achieved , it can lead to improvement in the clinical course of the disease as well as the biochemical markers , and may be curative . in patients with neurofibromatosis and osteomalacia , although innumerable neurofibromas are present , it is probably the largest ones or those with recent growth that cause oho and their surgical removal should be tried , to achieve permanent cure . high doses of calcitriol and oral phosphate salts are indicated , similar to those used in the treatment of x - linked hypophosphatemia . osteomalacia in neurofibromatosis is a very rare entity and distinct from the more common dysplastic skeletal affections of this disease , as a rule , being characterized by later onset in adulthood , with renal phosphate loss , and with hypophosphatemia and multiple pseudofractures in typical cases . in patients with neurofibromatosis , although innumerable neurofibromas are present , it is probably the largest ones or those with recent growth that cause oho , and their surgical removal should be tried , to achieve permanent cure , along with high doses of calcitriol and oral phosphate .

osteomalacia in neurofibromatosis is a rare entity and distinct from more common dysplastic skeletal affections of this disease . as a rule , it is characterized by later onset in adulthood . there is renal phosphate loss with hypophosphatemia and multiple pseudofractures in the typical cases . the hypophosphatemic conditions that interfere in bone mineralization comprise many hereditary or acquired diseases , all of them sharing the same pathophysiological mechanism - reduction in phosphate reabsorption by the renal tubuli . this process leads to chronic hyperphosphaturia and hypophosphatemia , associated with inappropriately normal or low levels of calcitriol , causing rickets in children and osteomalacia in adults .

complete debridement and effective disinfection of the root canal space is an important prerequisite for achieving long - term success of nonsurgical endodontics . chemomechanical instrumentation reduces majority of infecting bacteria , together with their principal substrate of necrotic pulp debris but retention of microorganisms within the dentinal tubules is thought to be a source of persistent endodontic infection . the use of an intracanal medicament helps in the elimination of bacteria that remain even after cleaning and shaping , thereby making the environment conducive for periapical tissue repair . it is probable that the physiologic state of the cells , particularly in retreatment cases , is closest to the starvation phase . recent studies have also shown that e. faecalis is highly resistant to commonly used intracanal medicaments , such as calcium hydroxide . even 2% chlorhexidine gluconate has been used as an irrigant and intracanal medicament in endodontics . chlorhexidine has a broad spectrum antimicrobial activity targeting both gram - positive and gram - negative microbes . hence , the combination of chlorhexidine and calcium hydroxide as an intracanal medicament has also been tried to achieve the properties of both medicaments but the antimicrobial action of chlorhexidine was found to be reduced . morinda citrifolia , commercially known as noni , is famous as an important folk medicine and as a health drink . the juice of m. citrifolia has a broad range of therapeutic effects , including antibacterial , antifungal , antiviral , antitumor , antihelminthic , analgesic , hypotensive , anti - inflammatory , and immune - enhancing effects . the effectiveness of m. citrifolia with sodium hypochlorite and chlorhexidine gluconate to remove the smear layer from the canal walls of endodontically instrumented teeth was compared by murray et al . and it was concluded that 6% m. citrifolia can be used as an endodontic irrigant ( as per article after usage of irrigant regime it was concluded ) . a gel based on papain , a proteolytic cysteine enzyme , exhibits significant antibacterial and anti - inflammatory properties . it acts only on affected tissues , which lack the 1-antitrypsine plasmatic antiprotease that inhibits proteolysis in healthy tissues . in addition to papain , the chloramines present have the potential of dissolving carious dentin by means of chlorination of the partially degraded collagen . cosmetic and some medicinal products are made from the mucilaginous tissue in the center of the aloe vera leaf and is called as aloe vera gel . there is no study to comparatively evaluate the antimicrobial activity of natural extracts of m. citrifolia , papain , and aloe vera ( all in gel formulation ) , 2% chlorhexidine gel and calcium hydroxide , against enterococcus faecalis . hence , this study was undertaken to evaluate the disinfection of dentinal tubules when contaminated with e. faecalis using m. citrifolia gel , papain gel , and aloe vera when compared with calcium hydroxide and chlorhexidine gel . a rotary diamond disk was used to decoronate the teeth 5 mm below cementoenamel junction and the apical part of the root to obtain 6 mm of the middle third of the root . 3 ( mani inc , tachigi - ken , japan ) in a slow speed handpiece was used to standardize the internal diameter of the root canals . the blocks were treated in an ultrasonic bath of 17% ethylene diamine tetra acetic acid for 5 min followed by 3% naocl for 5 min to remove the organic and inorganic debris . the traces of chemicals used were removed by immersing the blocks in an ultrasonic bath containing distilled water for 5 min . the first cycle was at 121c and the second was with the blocks immersed in 1 ml of tryptone soya ( ts ) broth in individual microcentrifuge tubes . all the blocks were coated externally with paraffin wax . the test organism used for this study was e. faecalis , which is a gram - positive facultative anaerobic bacterium . e. faecalis ( atcc 29212 ) was grown in ts agar for 24 h. the culture was suspended in 5 ml of ts broth and incubated for 4 h at 37c and its turbidity was adjusted to 0.5 mcfarland standard . each dentin block was placed in presterilized microcentrifuge tubes containing 1 ml of the ts broth . fifty microliters of the inoculum containing the e. faecalis was transferred into each of the microcentrifuge tubes . at the end of 24 h purity of the culture was checked by subculturing 5 l of the broth from the incubated dentin blocks in ts broth on ts agar plates . contamination of the dentin blocks were carried out for a period of 21 days . at the end of 21 days the blocks were irrigated with 5 ml of sterile saline to remove the incubation broth . group 1 : saline ( negative control ) group 2 : calcium hydroxide group 4 : m. citrifolia gel group 5 : aloe vera gel group 6 : 2% chlorhexidine gel calcium hydroxide ( sigma aldrich , mumbai , india ) was mixed with sterile saline in a ratio of 1.5:1 ( wt / vol ) to obtain a paste - like consistency . ltd , gujarat , india . ) was used as a thickening agent in the ratio of 2:1 ( vol / wt ) for group 3 ( papain raw extract taken from fruit ) , group 4 ( m. citrifolia raw extract taken from fruit ) , group 5 ( aloe vera raw extract taken from leaf ) , and group 6 ( chlorhexidine ) . hydroxyethyl cellulose is a nonionic , highly inert , and water - soluble agent and has been used in various studies for gel formation . the medicaments were placed inside the canals and sealed at both the ends with paraffin wax . they were incubated in an anaerobic environment for 37c . at the end of 1 , 3 , and harvesting of the dentin was carried out at 2 depths ( 200 and 400 m ) with gates glidden drills no . 4 and 5 , respectively . the collected dentin shavings were transferred into 1 ml of sterile ts broth and incubated in an anaerobic environment at 37c for 24 h. after 24 h , the contents of each tube was serially diluted , 100 l of the broth in 100 l of sterile saline for 5 times . fifty microliters of the dilution was then plated on ts agar plates and incubated for 24 h. colonies were counted and readings were tabulated as shown in table 1 . mean colony counts for different intracanal medicaments at 200 and 400 m depths at different time intervals the data were statistically analyzed with one - way analysis of variance followed by tukey multiple comparison means to check the difference in bacterial inhibition between the groups ( p < 0.05 ) . the paired t test was used to check for differences in growth at different time intervals within groups and for differences at the 2 depths ( p < 0.05 ) . a rotary diamond disk was used to decoronate the teeth 5 mm below cementoenamel junction and the apical part of the root to obtain 6 mm of the middle third of the root . 3 ( mani inc , tachigi - ken , japan ) in a slow speed handpiece was used to standardize the internal diameter of the root canals . the blocks were treated in an ultrasonic bath of 17% ethylene diamine tetra acetic acid for 5 min followed by 3% naocl for 5 min to remove the organic and inorganic debris . the traces of chemicals used were removed by immersing the blocks in an ultrasonic bath containing distilled water for 5 min . the first cycle was at 121c and the second was with the blocks immersed in 1 ml of tryptone soya ( ts ) broth in individual microcentrifuge tubes . the test organism used for this study was e. faecalis , which is a gram - positive facultative anaerobic bacterium . e. faecalis ( atcc 29212 ) was grown in ts agar for 24 h. the culture was suspended in 5 ml of ts broth and incubated for 4 h at 37c and its turbidity was adjusted to 0.5 mcfarland standard . each dentin block was placed in presterilized microcentrifuge tubes containing 1 ml of the ts broth . fifty microliters of the inoculum containing the e. faecalis was transferred into each of the microcentrifuge tubes . at the end of 24 h purity of the culture was checked by subculturing 5 l of the broth from the incubated dentin blocks in ts broth on ts agar plates . at the end of 21 days the blocks were irrigated with 5 ml of sterile saline to remove the incubation broth . group 1 : saline ( negative control ) group 2 : calcium hydroxide group 4 : m. citrifolia gel group 5 : aloe vera gel group 6 : 2% chlorhexidine gel calcium hydroxide ( sigma aldrich , mumbai , india ) was mixed with sterile saline in a ratio of 1.5:1 ( wt / vol ) to obtain a paste - like consistency . ltd , gujarat , india . ) was used as a thickening agent in the ratio of 2:1 ( vol / wt ) for group 3 ( papain raw extract taken from fruit ) , group 4 ( m. citrifolia raw extract taken from fruit ) , group 5 ( aloe vera raw extract taken from leaf ) , and group 6 ( chlorhexidine ) . hydroxyethyl cellulose is a nonionic , highly inert , and water - soluble agent and has been used in various studies for gel formation . the medicaments were placed inside the canals and sealed at both the ends with paraffin wax . they were incubated in an anaerobic environment for 37c . at the end of 1 , 3 , and harvesting of the dentin was carried out at 2 depths ( 200 and 400 m ) with gates glidden drills no . 4 and 5 , respectively . the collected dentin shavings were transferred into 1 ml of sterile ts broth and incubated in an anaerobic environment at 37c for 24 h. after 24 h , the contents of each tube was serially diluted , 100 l of the broth in 100 l of sterile saline for 5 times . fifty microliters of the dilution was then plated on ts agar plates and incubated for 24 h. colonies were counted and readings were tabulated as shown in table 1 . mean colony counts for different intracanal medicaments at 200 and 400 m depths at different time intervals the data were statistically analyzed with one - way analysis of variance followed by tukey multiple comparison means to check the difference in bacterial inhibition between the groups ( p < 0.05 ) . the paired t test was used to check for differences in growth at different time intervals within groups and for differences at the 2 depths ( p < 0.05 ) . contamination of the dentin blocks was confirmed when debris samples harvested from the saline group ( negative control ) yielded positive growth . table 1 shows the antibacterial activity , measured at 2 depths ( 200 and 400 m ) and at 3 time intervals ( 1 , 3 , and 5 days ) . the inhibition of growth in all the groups was statistically significant in comparison to the control group ( saline ) . group 6 ( 2% chlorhexidine gel ) was the most effective against e. faecalis to the depth of 400 m on all days of incubation . intergroup comparison of inhibition between groups 4 and 5 ( m. citrifolia gel and aloe vera gel ) showed no statistical difference on day 1 , but on days 3 and 5 there was a statistically significant difference . inhibition in group 4 ( m. citrifolia gel ) was also statistically significant compared with groups 3 and 2 ( papain gel and calcium hydroxide , respectively ) on all days ( 1 , 3 , and 5 ) . inhibition in group 3 ( papain gel ) was statistically better than group 2 ( calcium hydroxide ) on day 3 , whereas on days 1 and 5 they had similar efficacy . the inhibition of growth of e. faecalis at 200 and 400 m was uniform with no statistically significant difference for all the groups . the inhibition of growth of e. faecalis at the end of days 1 , 3 , and 5 was varied with different medicaments . group 2 ( calcium hydroxide ) showed sufficient antibacterial activity on day 1 , which decreased on day 3 and again increased by day 5.group 3 ( papain gel ) showed a decrease in antibacterial activity at the end of day 5.group 4 ( m. citrifolia gel ) showed constant antimicrobial efficacy on all the days ( 1 , 3 , and 5 days).group 5 ( aloe vera gel ) showed comparable antibacterial activity to m. citrifolia gel on first day , but there was a gradual decrease in the efficacy by the end of day 5 . group 2 ( calcium hydroxide ) showed sufficient antibacterial activity on day 1 , which decreased on day 3 and again increased by day 5 . group 3 ( papain gel ) showed a decrease in antibacterial activity at the end of day 5 . group 4 ( m. citrifolia gel ) showed constant antimicrobial efficacy on all the days ( 1 , 3 , and 5 days ) . group 5 ( aloe vera gel ) showed comparable antibacterial activity to m. citrifolia gel on first day , but there was a gradual decrease in the efficacy by the end of day 5 . to summarize the results , the overall percentage inhibition at 2 depths and different time intervals was , 100% with chlorhexidine gel , 86.02% with m. citrifolia gel , 78.9% with aloe vera gel , followed by 67.3% papain gel and 64.3% with calcium hydroxide [ figure 1 ] . ( abbreviations : mc , morinda citrifolia ; chx , chlorhexidine gel ; ca(oh)2 ; calcium hydroxide ) currently , the use of natural extracts in dentistry has gained importance both to patients and endodontic professionals as the shift is toward natural health remedies . hence the use of an intracanal medicament made of natural extracts is of great significance . the use of a biocompatible intracanal medicament possessing antimicrobial properties between appointments may reduce or eliminate bacteria in the root canal system and significantly increase the success of root canal treatment . the in vitro model developed by haapasalo and rstavik has been used to assess the efficacy of endodontic medicaments in the disinfection of dentinal tubules . lynne et al . modified this model to include quantitative analysis of bacteria in the dentin tubules to define a percentage of reduction in colony forming units in infected dentin before and after the application of intracanal medication preparations . e. faecalis was chosen as the test organism because it has long been implicated in persistent root canal infections and more recently has been identified as the species most commonly recovered from root canals of teeth with post - treatment disease . this study reveals the effect of newer organic intracanal medicaments ( when used as raw extracts ) against e. faecalis . on an average , chlorhexidine gel showed maximum inhibition of e. faecalis at depths of 200 and 400 m followed by m. citrifolia gel ( 86.02% ) , and aloe vera gel ( 78.9% ) . levels of inhibition of papain ( 67.3% ) and calcium hydroxide ( 64.3% ) were somewhat comparable . in the present study , chlorhexidine gel showed 100% inhibition at depths of 200 and 400 m from day 1 to 5 . the reason could be due to the bactericidal dosage of 2% and increased diffusion of the medicament into the dentinal tubules . showed that 2% chlorhexidine gel produced a better antimicrobial action as compared to 0.2% chlorhexidine gel or calcium hydroxide mixed with 0.2% chlorhexidine . m. citrifolia gel showed 86.02% inhibition at depths of 200 and 400 m from day 1 to 5 . claim that the presence of l - asperuloside and alizarin may be responsible for the antibacterial and antimicrobial property of m. citrifolia . this improved performance could be attributed to the increased contact time and physical contact of the gel . these results are in accordance with another study conducted by wang et al . , wherein 2% chlorhexidine solution when converted into gel form performed better than the solution alone . further studies are needed to determine the optimum concentration of m. citrifolia required when used in gel form as an intracanal medicament against e. faecalis . aloe vera showed 78.72% and 80% inhibition at depths of 200 and 400 m from day 1 to 5 . first day results of aloe vera gel were comparable to that of m. citrifolia gel , but the values declined over day 3 and 5 . the possible reason for antimicrobial action of aloe vera could be the presence of 75 potentially active constituents : vitamins , enzymes , minerals , sugars , lignin , saponins , salicylic acids , and amino acids . the pharmacologic actions of aloe vera , as studied in vitro or in animals ( in most cases the total leaf extract was used ) include anti - inflammatory , antibacterial , and hypoglycemic effects . gel based on papain showed 68.05% and 67.28% inhibition at depths of 200 and 400 m from day 1 to 5 . this was probably due to proteolytic cysteine enzyme present in papain , which exhibits antibacterial and anti - inflammatory properties . calcium hydroxide showed 63.82% and 66.22% inhibition at depths of 200 and 400 m from day 1 to 5 . gomes et al . reported that e. faecalis present in the dentinal tubules were resistant to calcium hydroxide intracanal dressing over 10 days . calcium hydroxide had decreased efficacy on day 3 , but had an increased antimicrobial efficacy at day 5 . chlorhexidine gel showed the maximum antimicrobial activity against e. faecalis , whereas calcium hydroxide showed the least . among the natural intracanal medicaments , m. citrifolia gel consistently exhibited good inhibition up to the day 5 followed by aloe vera gel and papain gel .

aim : a comparative evaluation of the antimicrobial activity of natural extracts of morinda citrifolia , papain , and aloe vera ( all in gel formulations ) , 2% chlorhexidine gel and calcium hydroxide , against enterococcus faecalis an in vitro study.materials and methods : the antimicrobial efficacy was assessed in vitro using dentin shavings collected at 2 depths of 200 and 400 m . the total colony forming units at the end of 1 , 3 , and 5 days were assessed.results:the overall percentage inhibition of bacterial growth ( 200 and 400 m depth ) was 100% with chlorhexidine gel . this was followed by m. citrifolia gel ( 86.02% ) , which showed better antimicrobial efficacy as compared with aloe vera gel ( 78.9% ) , papain gel ( 67.3% ) , and calcium hydroxide ( 64.3% ) . there was no statistical difference between data at 200 and 400 m depth.conclusion:chlorhexidine gel showed the maximum antimicrobial activity against e. faecalis , whereas calcium hydroxide showed the least . among the natural intracanal medicaments , m. citrifolia gel consistently exhibited good inhibition up to the 5th day followed by aloe vera gel and papain gel .

dermatomyositis ( dm ) is an uncommon idiopathic inflammatory myopathy that primarily affects skeletal muscle and skin with well - characterized cutaneous findings . it has been well documented that dm carries an increased risk of malignancy and can present as a paraneoplastic syndrome to multiple types of underlying malignancies [ 3 , 4 ] . however , 1530% of cases of dm are manifestations of paraneoplastic syndromes of an underlying malignancy . here , we present a case of concurrent dm and breast cancer to highlight a rare presentation , progression and regression of symptoms , as well as key components of diagnosis and treatment . the patient is a 47-year - old polish premenopausal female who presented with complaints of a non - tender palpable left breast mass for 4 months at an outside institution . she underwent a diagnostic mammogram and ultrasound that reported a 2-cm irregular , hypoechoic mass at 12 o'clock . there was a 2.2-cm enhancing mass in the left breast at 12:00 that was consistent with the patient 's biopsy - proven malignancy ( fig . , she underwent a core needle biopsy , which revealed a poorly differentiated triple - negative invasive ductal carcinoma ( fig . there is a 1.9 1.4 cm irregular mass in the left breast at 1112:00 6 cm from the nipple . there was a 2.2 cm enhancing mass in the left breast at 12:00 that was consistent with the patient 's biopsy - proven malignancy . high power view of the left breast core biopsy ( b ) . left breast ultrasound . there is a 1.9 1.4 cm irregular mass in the left breast at 1112:00 6 cm from the nipple . the circled area revealed a 2-cm irregular mass with biopsy clip noted . left breast on mri . there was a 2.2 cm enhancing mass in the left breast at 12:00 that was consistent with the patient 's biopsy - proven malignancy . two weeks after the biopsy , she complained of new onset pruritic , erythematous rash on her anterior chest , face and back of the hands ( fig . she was complaining of diffuse myalgias , worse during menstruation . owing to her worsening symptoms which included cuticular hypertrophy of the hands with associated erythema over the metacarpophalangeal and proximal interphalangeal joints bilaterally ( fig . 5c ) , she was transferred to the bellevue hospital breast clinic and referred to the rheumatology clinic for management of her symptoms . initial laboratories revealed moderately elevated laboratory values ( table 1 ) . at this time , she was presumptively diagnosed with paraneoplastic dm secondary to invasive ductal carcinoma of the left breast and treated with 20 mg prednisone daily . her persistent and slowly progressing symptoms despite aggressive treatments prompted our decision to proceed with surgical intervention in hopes of preventing progression of her musculoskeletal manifestations . postoperatively , she experienced rapid improvement in both cutaneous and musculoskeletal manifestations with visible clearing of her rash and return of her strength . she was maintained on prednisone with excellent symptomatic control . on her 6-month visit , we noted resolution of most of her rash , periorbital edema as well as myalgias and muscle weakness ( fig . table 1laboratory values prior to the surgery , 3 weeks postoperatively and 6 weeks postoperatively.preop3 weeks postop6 weeks postopwhite blood cell ( 10)9.312.67.8creatine kinase ( u / l)2183302160aldolase ( u / l)17.45.3myoglobin247ast ( u / l)1177744alt ( u / l)539130 figure 5:image of patient with facial rash and periorbital edema that initially developed during her workup ( a ) . images of the worsening rash on her chest and hands that initially developed during her workup ( b and c ) . image of patient with facial rash and periorbital edema that initially developed during her workup ( a ) . images of the worsening rash on her chest and hands that initially developed during her workup ( b and c ) . dm typically presents with progressive , symmetrical , proximal muscle weakness and characteristic skin lesions such as helitrope rash , gottron 's papules , gottron 's sign , the v - sign and shawl sign . additional cutaneous manifestations that have become more commonly recognized include vasculopathic changes ( i.e. telangiectasias and livedo reticularis ) , cuticular overgrowth ( mechanic 's hands ) and poikiloderma . initial presentation follows a bimodal distribution between ages 515 and 4564 and tends to progress over a 3- to 6-month period before the patient will seek medical attention . contrary to this typical presentation , the above patient experienced rapid progression of symptoms over a much shorter period and predominately reported skin manifestations with subsequent rapid development of muscular deterioration . the diagnosis and classification of dm commonly follows the criteria set forth by bohan and peter in 1975 ( table 2 ) [ 1 , 2 ] . initial evaluation for suspected dm should include such investigations as serum creatine kinase , aldolase , aspartate aminotransferase , alanine aminotransferase and/or lactate dehydrogenase . serum creatine kinase is the most sensitive muscle enzyme in the acute phase of the disease as it is released in the serum during muscle damage . serum inflammatory markers ( e.g. erythrocyte sedimentation rate and c - reactive protein ) may also be elevated during the active phase of the disease . table 2bohan and peter criteria for diagnosis of dermatomyositis.individual criteria symmetric proximal muscle weaknessmuscle biopsy evidence of myositisincrease in serum skeletal muscle enzymescharacteristic electromyographic patternstypical rash of dermatomyositisdiagnostic criteria definitive5 plus any three of 14probably5 plus any two of 14possible5 plus any one of 14 bohan and peter criteria for diagnosis of dermatomyositis . symmetric proximal muscle weakness muscle biopsy evidence of myositis increase in serum skeletal muscle enzymes characteristic electromyographic patterns typical rash of dermatomyositis definitive5 plus any three of 14 probably5 plus any two of 14 possible5 plus any one of 14 previous studies have shown that up to 30% of dm patients had underlying malignancies [ 6 , 7 ] . malignancies in dm patients have been found to be highest in those over 45 years of age , commonly diagnosed within the first year of initial presentation , and most strongly associated with lung , ovarian , gastric , pancreatic and colorectal origin . malignancy can precede , occur concurrently or develop after the diagnosis of dm . in our patient , the symptoms of dm occurred 2 weeks following her diagnosis of breast cancer . the goals of therapy in patients with dm are to improve the patient 's ability to carry out activities of daily living by increasing muscle strength and improving myalgias as well as treating the extramuscular manifestations ( including rash and arthralgias ) . there has been report of variable influence of the treatment of the underlying malignancy on the clinical course of the dm [ 9 , 10 ] . in our patient , the complete surgical excision of the underlying breast cancer resulted in dramatic improvement in both her cutaneous manifestations and her musculosckeletal symptoms . given the high frequency of malignancy in patients with a diagnosis of dm , any woman over the age of 45 with newly diagnosed dm should prompt a thorough physical examination , including a breast examination , as well as further workup for other malignancies ( e.g. ovarian or colorectal cancer ) . early diagnosis of dm as a paraneoplastic syndrome allows for initiation of systemic therapy for symptom control and also treatment of the underlying malignancy itself , which may aid in control of the dm symptoms .

breast cancer is the most common cancer in women in the usa , with the lifetime incidence of 1 in 8 women . dermatomyositis ( dm ) is an uncommon idiopathic inflammatory myopathy that can manifest as a paraneoplastic syndrome of an underlying malignancy . here , we report a case of a patient who presented with breast cancer and dm symptoms . the patient 's rash and muscle weakness progressed during the workup of her breast cancer , while she was already started on medical treatment of these symptoms with oral prednisone . her cutaneous and musculoskeletal improved dramatically following the treatment of her breast cancer . our case report describes the rapid progression and regression of her symptoms emphasizing the benefit of early diagnosis and treatment of dm as well as the underlying breast cancer .

current generation composite , light - weight , combat helmets provide enhanced fragmentation and ballistic protection , generally with reduced weight in comparison to previous generations of combat helmets . previous generations of military combat helmets , such as the us personal armor system ground troops ( pasgt ) helmets were made solely of aramid fibers , specifically kevlar , and generally weighed 3.6 lbs ( 1.6 kg ) . the current generation of composite combat helmets may weigh as much as 15% less than the pasgt helmets . these new generations of helmets are composite laminate structures which may still include kevlar but the addition of an updated generation of materials based on ultra - high molecular weight polyethylene ( uhmwpe ) fibers such as spectra or dyneema have resulted in their improved ballistic performance . in general , increased helmet weight implies increased stiffness due to either more layers of composite materials such as kevlar or increased matrix or resin mass . helmets with higher structural stiffness tend to manifest less dynamic back face deflection during ballistic impact . as the helmet weight is reduced , stiffness tends to also decrease , and thus the current generation of combat helmets tends to exhibit greater back face deflection for the same ballistic impact conditions as for the previous generation of helmets . achieving equivalent ballistic protection ( in terms of perforation or projectile defeat ) at a lighter weight is a significant achievement ; however , the tradeoff of greater dynamic back face deflection at reduced weight may result in other damage or injury mechanisms , such as blunt trauma injuries , coming to the forefront . as a result , behind helmet blunt trauma injuries resulting from non - perforating ballistic impact of fragments or bullets has become a concern to the warfighter and the designers of their personal protection equipment ( ppe ) . behind helmet blunt trauma ( bhbt ) and behind armor blunt trauma ( babt ) are injuries to the human body that result from back face dynamic deflection of the ppe armor system ( helmets or body armor such as esapi 1 ) responding to an impulsive load due to ballistic impact of a projectile . bhbt / babt results from non - perforating ballistic impact to the armor by the threat projectile , which means that the armor system has successfully defeated or stopped the threat . however , with the development of a new generation of ppe armor materials that have increased strength and toughness with lighter weight ( resulting in significantly increased ballistic mass efficiency ) , the propensity for blunt trauma injuries due to back face dynamic deflection has increased . for most helmet and body armor systems there is limited space available for significant back face deformation or deflection under ballistic impact to occur without the armor impacting the head or torso of the human body . in the case of combat helmets , pad suspension systems have been designed with the objective to attenuate blunt head impact forces , but the intensity of impact conditions used to design the suspension systems are significantly lower than that due to ballistic impact . they typically are designed for motor vehicle accidents , tripping and falling accidents , and parachutist impact conditions , where the impact velocity range is only from 10 ft / s to 14 ft / s ( 3 m / s to 4.3 m / s ) 2 . these types of impact conditions are fundamentally different from ballistic impact and the dynamic interaction that results between the helmet back face and the human head and cranium . for the case of accidents as cited above , where the head and helmet have an initial velocity and rapid deceleration is the primary injury concern , has ultimately resulted in the development of the wayne state tolerance curve 3 , 4 as well as other criteria such as the head injury criteria ( hic ) , the viscous criterion , angular rotation thresholds , translational acceleration limits , and head impact power . it is commonly accepted that skull fracture may be related to maximum dynamic force or impulse ; however , there is no consensus on the criteria to use to resolve the full spectrum of possible head injuries due to the range of different injury mechanisms . thus , to date , no equivalent injury criteria based on design guidelines for combat helmets have been developed to specifically address bhbt due to ballistic impact . the current requirement for ballistic transient deformation for the us army 's advanced combat helmet 5 and the us marine corps ' enhanced combat helmet 6 is no greater than 0.63-in ( 16.0 mm ) in roma plastilina clay . to the authors ' knowledge there is no correlation between level of injury and this requirement for maximum ballistic transient deformation . bhbt injuries have been observed in the field and in laboratory testing on post - mortem human subjects ( pmhs ) . pmhs tests of non - perforating ballistic impact to the head protected by a helmet have shown injuries ranging from skin lacerations to extensive skull fractures and brain damage 7 . in general closed skull fracture a simple or linear fracture is a break in the skull that is not displaced and may penetrate the entire thickness of the skull . simple or linear fractures are the most common type of skull fracture and are caused by low - energy , blunt force trauma over a wide area of the skull . basilar skull fractures are linear fractures , but occur at the base of the skull and are associated with more severe trauma due to longer duration impulsive loads . a depressed skull fracture is one in which the segments of fractured cranial bone is pushed inward or is crushed and may subsequently compress the brain . depressed skull fractures result from high - energy blunt force trauma to a small area of the skull . from a clinical perspective head injuries are defined as critical , moderate , and minor ; where critical is associated with long duration ( hours ) loss of consciousness , intracranial hemorrhaging and cerebral contusion ; moderate is associated with skull trauma with or without dislocated fractures and brief loss of consciousness ; and minor is associated with superficial fractures and no loss of consciousness . for dynamic conditions resulting from ballistic impact to the head / helmet system , all of these levels of blunt trauma injuries are possible . ballistic impact to combat helmets by fragments and bullets are typically a high - speed , low - mass event . however , the physical characteristics of the helmet itself ( materials and layup configurations ) tend to transform the impact to a reduced speed , slightly greater mass event with increased areal coverage due to the dynamic progression of the deflection and delamination of the back face materials of the helmet as it interacts with the projectile . the characteristics and understanding of the mechanics of this transfer of energy and momentum from the strike face to the back face of the helmet is critical to ppe designers , and the subsequent interaction of the dynamic back face deformation with the head and cranium are critical to warfighter survivability . to address all these concerns a research project was initiated to develop a methodology for evaluating bhbt in a consistent , reproducible , and validated approach . this project was funded by the us office of naval research ( onr ) as part of a future naval capability ( fnc ) program called limbr - lightweight individual modular body armor . the cornerstone of the experimental methodology developed in that effort is a high fidelity , human head surrogate ( hhs ) . this human head surrogate fills the void between post - mortem human subject testing and commercial ballistic head forms such as biokinetics ' ballistic load sensing headform . the void that the human head surrogate fills is that which exists between full biofidelic systems such as provided by cadavers ( pmhs ) and at the other extreme , non - biofidelic , mechanical head forms made of metal and elastomers . the swri human head surrogate ( hhs ) is made with actual human craniums and synthetic soft tissues for the brain , dura ( the soft tissue between the cranium and brain ) , and skin , supported by a hybrid iii 50 male neck assembly . the soft tissues are represented by specialized mixtures of ballistic gels with similar density , bulk modulus , and tensile strength to actual tissue . craniums which are then refreshed to a measured level of ductility consistent with fresh cranial bone . for example , the human surrogate head model 8 , developed primarily for blast testing , consists of head structures made of biosimulant materials , such as a glass / epoxy mixture for cranial bone , sylgard silicone gel for the brain , and syntactic foam for facial structures . the hhs head form incorporates a suite of installed instrumentation with includes surface pressure measurements , intracranial pressures , cranial strains , and head and helmet accelerations . high speed video ( phantom v7 ) and flash x - ray imaging are used to provide additional data as well as insights into the highly dynamic response of the head / helmet system . the human head surrogate ( hhs ) thus provides a unique combination of biofidelity with soft tissue simulants . the hhs is not encumbered by the medical restrictions for the uses and handling of pmhs but incorporates the essential features of pmhs relevant to bhbt testing ( specifically , human craniums with pressurized brain and dura ) . further , the hhs has a significant level of biofidelity not present in mechanical head forms , specifically the ability to directly measure skull fracture . this paper then provides a description of the human head surrogate , the methodology for ballistic testing using the hhs , plus a review of representative data for sets of ballistic tests with projectiles or threats which includes : 64-grain ( 0.15 oz ) right circular cylinder ( rcc ) , 9-mm full metal jacket ( fmj ) , 7.62 x 39 ( ps ) , and 7.62 x 51 ( m80 ) projectiles . for experiments using ps and m80 projectiles , a supplemental ceramic applique is attached to the helmet and allows for high velocity , non - perforating experiments to be conducted with these high energy threats . to date , over 70 experiments have been performed using the hhs . in the tests reported here , the helmet used is the us marine corps ' lightweight combat helmet ( lwh ) , manufactured by gentexcorp and made of a para - aramid material . the hhs uses as a keystone to the design refreshed human craniums , supplemented by synthetic soft tissues ( refer to figure 1 ) . the human craniums used in the hhs are processed craniums which may be purchased from many different sources . these craniums are typically dehydrated due to the processing methods used when they are cleaned and dried . since these craniums are fully processed they are not considered to be human subject testing nor generally require institutional review board approval as is required for pmhs testing . the us department of health and human services defines the guidelines for human research in the us in the code of federal regulations , title 45 , part 46 , protection of human subjects . each candidate human cranium that is received from a vendor undergoes a detailed examination to characterize the initial condition and structure of the cranium , including measurement of bone thicknesses , suture integrity , and native fractures due to handling . if the cranium successfully passes this screening and characterization phase , then the cranium undergoes a process to refresh it . processed cranial bone typically is more brittle than live or fresh bone as a result of the processing procedures ; thus it is necessary to develop a method for appropriate rehydration or refreshing of the craniums used in the hhs . the objective is to rehydrate or recondition the processed human cranial bone such that its primary characteristics of ductility and strength are similar to the method that resulted in an appropriate level of ductility is based on the soaking of the cranium for 30-minutes in a shellac solution ( consisting of ethanol , isopropanol , methyl isobutyl ketone , pure shellac and water ) . a three - point bend test configuration is used to evaluate the ductility and strength of the various refreshed bone samples based on each refreshment technique that was conceived and applied . these measured results are compared to the same three - point bending test of a fresh bone sample ( fresh bone in a formalin solution ) and to data in the open literature , primarily from mcelhaney et al . bending strength and modulus ( ductility ) are the measures used to assess level of cranial bone refreshment ; a third measure that may also be used is fracture toughness 10 . fracture toughness is not used in this study since reference 9 did not report values for it , and it is the primary source of supplemental data used here . in addition , the authors ' believe that if bending strength and modulus values are successfully achieved by the refreshment method , then fracture toughness will be appropriately achieved as well . figure 2 displays data from the tests performed for each refreshed sample type and the fresh bone sample ( identified as fa bone ) , and are compared to the mcelhaney et al . data for the quantities of strength ( maximum stress ) and ductility ( modulus ) . the blue horizontal lines in this figure indicate the range of variability in the mcelhaney et al . data , while the red horizontal line is the measured value for the single sample of fresh bone ( fa bone ) tested in this study . the uncertainty bars associated with each sample data point represents the variability in the measured data for each set of samples used here . it should be noted , however , that these tests did not constitute a statistically meaningful sampling set in that only three or four repeat tests were conducted for each sample type and only one fresh based on this data and these two measures , we judged the shellac solution soak technique to be the most appropriate method for refreshing cranial bone for this application . the data for the shellac solution method is highlighted in figure 2 by the colored oval . the shellac solution is a biological fluid secreted by an insect and when applied to the skull is absorbed by the cranial bone . the shellac solution refreshing method proved to be quite effective in this application and no evidence of brittle bone failure is observed in any of the test results . synthetic or surrogate soft tissues are used in the hhs to represent the brain , dura , cerebral spinal fluids , and the external skin . the brain and external skin are manufactured from perma - gel , a colorless , transparent petroleum - based thermoplastic material with a specific gravity of 0.85 ( density of 53 lb / ft or 0.85 g / cc ) and which at room temperature allows bullet penetrations equal to the fbi - standard 10% 250 a ordnance gelatin at 39.2 f ( 4 c ) , which simulates swine muscle tissue . perma - gel is also calibrated for a penetration of 3.35 inches ( 8.5 cm ) by a 0.177-in ( 4.5 mm ) steel bb shot with a speed of 590 ft / s ( 180 m / s ) 11 . the brain surrogate then consisted of 25 oz ( 700 g ) of perma - gel plus 25 oz ( 700 g ) of iron powder uniformly mixed into the perma - gel , resulting in a nominal brain mass of 50 oz ( 1400 g ) . perma - gel is also used to represent the external skin covering the cranium and is molded to the cranium with nominal skin thicknesses ranging from 0.2 to 0.3 inches ( 5 to 7 mm ) depending on location on the head . the dura ( the soft tissue between the cranium and brain ) is simulated by a thick layer of silicon with a nominal thickness of 0.02 inches ( 0.5 mm ) , where the typical thickness of the human dura is reported to vary from 0.01 to 0.03 inches ( 0.3 to 0.8 mm ) depending on age of the human . finally , the cerebral spinal fluids are represented by water pressurized to 0.29 psi ( 15 mm hg , 2000 pa ) . two different versions of the hhs have evolved as the system was developed and the experimental methodology was applied through the execution of testing ( see figure 1 ) . in one version of the hhs a full encapsulation of the head with perma - gel is developed ( a full - face version ) , fully reproducing the scalp and facial skin features ( top right image in figure 1 ) . whereas in the second version , only a skull - cap of perma - gel is used and covers the cranium sufficiently to represent the scalp skin covered by the helmet ( lower right image in figure 1 ) and still accounting for the proper interfacing between the helmet suspension system and the cranial skin . both versions of the hhs provided similar dynamic results and injury conditions ; however , the skull - cap version requires less time to assemble than the full - face version . in general , the hhs mass , size , and thicknesses of any and all surrogate components are tunable to be representative of actual nominal human tissues as reported in the open literature . thus , the hhs system ( minus the hybrid neck ) generally has an average mass of 8.8 lb or 4 kg ( with a range of 7.7 lb to 9.9 lb , 3.5 kg to 4.5 kg ) , where the variability is due to variations in cranium sizes and cranial bone thickness . as shown in figure 1 , a hybrid iii 50 male neck assembly is inserted at the base where the spine normally intersects the cranium . the attachment to the cranium is through a gasketed ring assembly that is torqued sufficiently to maintain a strong connection between the cranium and hybrid neck and eliminate spurious flexure at the contact surface . the attachment is intended to be representative of the intersection of the atlas and axis to the head , where the hybrid iii neck assembly represents the cervical vertebrae . the assembled hhs and neck are then rigidly mounted to a steel plate and appropriately angled ( to get a normal surface impact ) for each test configuration . the hhs includes a suite of embedded instrumentation for measuring intracranial pressure , cranial strain , and tri - axial accelerations . traditional piezoelectric pressure transducers and fiber - optic ( fabry - perot style ) gauges were initially used in the hhs . however , the fiber - optic gauges were abandoned due to their fragility ( repeated breakage of the fiber during installation or testing ) , but are a sensor type with great potential application in this context and will be revisited in a future effort . the four gauges are embedded directly into the surrogate brain and are positioned to measure incident pressures ; that is the sensing element of the transducer is flush - mounted with the brain surface . a gauge is placed in each of the four quadrants of the brain ; i.e. , front-0(gauge p1 in figure 3 ) , back-180(gauge p3 ) , right-90 ( gauge p2 ) , and left-270 ( gauge p4 ) with these angles in reference to the front , centerline of the brain . these pressure gauges then measure the over - pressure generated in the cerebral spinal fluid that surrounds the brain and is contained within the surrogate dura . the measured over - pressures result from the dynamic deflection of the cranium due to interaction with the dynamic back face deflection of the helmet materials . figure 4 displays the method for deploying tri - axial strain gauges for measuring cranial bone strains during ballistic impact . a total of 12 gauges are typically installed per hhs , arranged in groups of three gauges deployed in a triangular pattern around the anticipated impact or target points . in the tests conducted to date 5 hit points on the helmet are selected ; i.e. , frontal , crown , back , left side , and right side , all in reference to the normal human descriptions ( left ear , right ear , etc . ) . the gauges used are tokyo sokki kenyujo model fra-3 - 350 - 11 60 rosettes and have a range of 3% maximum strain . as shown in figure 4 , the gauges are bonded directly to the refreshed cranium and the surrogate skin is then molded over the gauges . based on test results , the bonding method for the strain gauges to the cranial bone did not alter or affect cranial fracturing in the surface areas where finally , two tri - axial accelerometers are installed with one gauge mounted in the surrogate ( attached to the hard palate ) and the other attached to the helmet ( attached to the outer surface of the back of the helmet ) . these two accelerometers are measurement specialties , model 53 - 0500 - 360 , and had an operational range of 20 - 1500 hz . data from all these gauges are captured in digital form using a dewetron dewe-4102 high - speed data acquisition system with a sampling rate of 1 million data points per second . the non - perforating ballistic test method used here is similar to that defined in the us nij - std-0106.01 15 . the objective of this test methodology is to study the effect of back face deflection of the helmet due to non - perforating ballistic impact , and thus an invalid test is one where the projectile perforates the helmet . thus , great care is taken in this study to ensure no perforations occur . in the test method , the hhs system is rigidly attached to a mounting plate , rather than a mobile stand as specified in the nij standard . this approach is appropriate for this application because a hybrid iii neck assembly is used to mount the head to the mounting plate rather than using a rigid cylinder as specified in the nij standard . the hybrid iii neck is designed to provide appropriate reaction to dynamic loads as would a human neck under crash applications and has been used in ballistic test research with other head forms , such as biokinetic 's ballistic load sensing headform 14 . the impact velocity of the projectile is measured using two ballistic light screens placed 1 meter apart . a digital chronograph connected to the screens measures the time the projectile breaks the light beam at each screen and the projectile velocity is then calculated based on the time difference . projectiles are fired from a universal gun mount system placed 2 meters in front of the first light screen , with the hhs and mount assembly placed 2 meters behind the second light screen per reference 15 . vision research 's phantom v7 high - speed cameras are used with frame rates ranging from 15,000 to 250,000 frames per second , where the frame rate is dictated by the purpose of the specific test . all projectiles are spin stabilized by using rifled gun barrels and their flight characteristics are confirmed through high - speed video imaging . in addition , a separate series of tests are executed in which flash x - ray imaging is used . here two pulserad 150 kv ( model 43731a ) flash x - ray tubes or heads are deployed in which one is viewing the dynamic event from the side of the test article , while the second tube views the event from the top looking down ( see figure 6 ) . during these tests , the first copper wire is attached directly to the cranium so as to more clearly outline the headform and the second copper wire is attached to the inside surface of the helmet to more clearly define the back face of the helmet surface . calibration tests for each projectile and velocity range are performed to measure the elapsed time from when the projectile exits the final timing screen to the instant of maximum back face deflection of the helmet . these elapsed times are then used in the hhs tests to define the timing delay for when the flash x - ray images are to be taken . figure 7 displays the initial experimental setup conditions as visualized by flash x - ray imaging . as with most ballistic test articles , the hhs is not generally intended to be used in multiple experiments but is rather a single shot test item . however , dependent on the test conditions , the hhs may be used in multiple experiments . the procedure for determining whether a specific hhs may be used in another experiment consists of removing the skin from the cranium and comparing the bone 's condition to the original cranium characterization performed when the cranium was first received . if no fractures have developed anywhere on the cranium and all sensors are still operating within calibration , then the hhs may be used in another experiment . however , if any minor , surface fractures have resulted from the previous test , then the hhs is retired and disassembled so that the sensors may be used in another hhs . a series of non - perforating ballistic tests have been conducted using the hhs and includes to date , 70 fully instrumented experiments . these tests studied the effects of projectile types , hit locations , pad suspension configurations , and ceramic applique effects on bhbt . team wendy pads are used in all tests , in either a 5 or 7 pad configuration . the 7 pad configuration is the typical pad layout consisting of pads located at front center , front right , front left , back center , back right , back left , and on the crown . the 5 pad configuration used in this study deleted the front and back center pads , leaving the front right , front left , back right , back left , and crown pads in place . two impact locations on the helmets are reported in this paper and are ( 1 ) front center impact of the helmet and ( 2 ) side impact of the helmet . front center hit locations , depending on pad layout configuration are either supported by a pad ( 7-pad configuration ) or are unsupported by a pad ( 5-pad configuration ) . all side impacts are unsupported by a pad since in either the 5 or 7 pad configurations this region of the helmet suspension has no pad deployed . the reader may see 16 for more complete details of the pad suspension system for the lightweight fragmentation helmet manufactured by gentexcorp and is representative of current applications for pad suspension systems . the threat projectiles used in this study are the 64-grain rcc , 9-mm fmj , 7.62 x 39 ( ps ) , and 7.62 x 51 ( m80 ) . the 7.62 ps round has a mild steel core that tends to not undergo significant deformation during impact , while the 7.62 m80 round has a lead core which does undergo significant deformation during impact . table 1 summarizes the projectile characteristics and the designed target impact velocity for each threat . the rcc projectile was modified to include a skirt which allowed the round to be fired using a .357 magnum cartridge . as discussed above , the ceramic applique is a surface conforming ceramic supplement to the baseline helmet to provide augmented performance to defeat rifle rounds such as the 7.62 x 39 ( ps ) and 7.62 x 51 ( m80 ) at or near muzzle velocities . these appliques are composed of a boron carbide ( b4c ) ceramic derivative developed by m cubed and named bsc-800 ceramic . two thicknesses of appliques were tested : ( 1 ) an applique with a nominal thickness of 0.2-in or 5 mm , and ( 2 ) an applique with a nominal thickness of 0.275-in or 7 mm . the appliques are bonded to the helmets using a two - component epoxy system ( h. b. fuller fh-3548 ) . an offset distance of 0.060-in ( 1.5 mm ) between the applique and helmet is used , and is achieved by using wire and glass beads with diameters of 0.060-in ( 1.5 mm ) . the appliques tested are ceramic only ; however in an actual deployed application , the ceramic will be encapsulated in a polyurea or polyurethane coating with thickness of 0.060-in ( 1.5 mm ) , thus the need for the offset distance in these tests . as discussed in an earlier section of this paper , cranial fractures may be simple ( linear ) , basilar , or depressed , and clinical treatments for these head injuries are respectively referred to as minor , moderate , and critical . in this effort cranial damage or fracture is similarly categorized into these three injury classes - minor , moderate , and significant or critical . minor fractures or injuries are characterized by surface simple ( linear ) fractures in which the fractures do not penetrate through the thickness of the cranial bone . moderate fractures or injuries are characterized by full penetrating simple ( linear ) fractures or fractures that do penetrate through the thickness of the cranium , but the fractures are not dislocated and the cranium is still intact as a single structure . critical or significant fractures or injuries are characterized by dislocated fracturing , with the condition of the cranium being fractured so as to no longer be a single structure and is fragmented into large pieces or segments . figure 9 shows examples of each of these classes of cranial injury as identified in this study . tables 2 and 3 summarize some of the key results from the experiments for the helmet only configurations . of the 38 fully instrumented tests reported here for the helmet only test conditions , 9 or 24% of these experiments result in fracturing characterized as moderate . these moderate fracturing or injury conditions all are from experiments where the impact location is front center and with a 5-pad configuration ( no pad support , off - pad hit ) . the threat projectile is the 9-mm fmj shot at an average speed of 1437 ft / s ( 438 m / s ) . for the conditions of a front center hit location with a 7-pad configuration ( so on - pad hit with pad support ) , and again with a 9-mm fmj projectile shot at an average speed of 1404 ft / s ( 428 m / s ) , results in no injuries or cranial fractures . although the average impact speeds of the 64-grain rcc projectiles are approximately 10% greater than for the 9-mm fmj projectiles , the kinetic energy due to the 9-mm fmj averages 60% greater than for the rcc projectiles ( refer to table 3 ) . thus , as suggested by other studies , kinetic energy of the projectile at impact is a critical parameter relating to cranial injury , as well as intracranial pressure 7 . as shown in table 3 , moderate cranial injuries result when the mean peak intracranial pressure achieves a value of 37 psig ( 255 kpa ) resulting from impact of a 9-mm round , which is similar to the values measured in tests with cadaveric heads 7 . the relationship of the suspension pads to the impact location appears to also be important , in that for side impacts , which are off - pad hit locations , no injuries are measured for these rounds . the side impact location is supported , however , by two large pads which provide lateral support to the off - pad region ; further there is essentially no curvature to the helmet structure in this region . thus , the lateral pads provide sufficient support to mitigate deflection in this region , whereas for the front impact location , the helmet surface is highly curved and the lateral pads are separated sufficiently so as to not provide lateral support in the deflected zone . in general , these tests confirm that pads provide an energy dissipation mechanism that helps to mitigate injury for on - pad hits , and that in surface regions of the helmet will little curvature , that lateral pads can also be effective at mitigating injuries for off - pad hits . note that results from ballistic head form testing confirms that the load on the pad when impacted by a 9-mm round is more spatially distributed , but that the local peak load along the flight path tends to be greater for an on - pad hit versus an off - pad hit 17 . the data in this study shows a different trend , in that on - pad hits with 9-mm rounds results in reduced intracranial pressures and reduced likelihood of injuries in reference to off - pad hits , as discussed further below . a similar set of tests to those just presented above , 9-mm ballistic experiments for a combat helmet , were performed by bass et al 18 , but with pmhs ( cadavers ) . in their 9 tests , projectile impact velocities ranged from 1312 ft / s to 1509 ft / s ( 400 m / s to 460 m / s ) and all were side impact tests ( although not stated , these were likely off - pad hit locations ) . they observed linear fractures in five of nine tests , with a 50% injury risk occurring at an impact velocity of 1433 ft / s ( 437 m / s ) . bass et al results are similar to those measured here with the hhs , in that moderate injury ( linear fractures ) result for average impact velocities of 1437 ft / s ( 438 m / s ) or greater for off - pad frontal hit locations . table 3 presents the mean peak intracranial pressure averaged across each experiment as well as the mean peak strain measured on the surface of the cranium in the region of impact . for 5-pad ( off - pad hit ) test conditions that result in moderate injuries , the mean peak intracranial pressure of 37 psig ( 0.255 mpa ) is nearly 3 times greater ( 2.85 times ) than for the corresponding 7-pad ( on - pad hit ) experiments where the mean peak intracranial pressure is 13 psig ( 0.090 mpa ) . the mean peak cranial strains ( shown in units of micro - strain in the table ) also show a similar trend in that for the 5-pad configurations the measured mean peak strain is -0.21% and is approximately 2 times greater ( 1.64 times ) than the mean value measured in the 7-pad configuration experiments ( measured value of -0.13% ) . the negative values for the strains in table 3 follow the standard sign convention for strain , and thus these are compressive values . clearly , the pad configuration is a significant factor in the magnitude of injury to the head . for these dynamic conditions , the pads are able to mitigate dynamic deflection and limit the impact conditions of the back face to the cranium when they are located between the back face deformation and the cranium . however , as presented later in this paper , as the kinetic energy of the projectile increases the ability of the pads to dissipate the back face energy is diminished . in two of the rcc side impact experiments , the rcc projectile perforated the helmet . from post - test examination of the helmet it is clear that a seam in the laminate layup in the helmet is in this area and thus represents a potential vulnerability of the helmet design for small , non - deforming projectiles such as rccs . tables 4 and 5 summarize some of the key results from the experiments for the helmet plus applique test conditions . of the 20 fully instrumented tests reported here , 14 of 20 ( 70% ) experiments result in fracturing characterized by critical . critical fracture injuries developed for 7-pad configurations with the 0.2-in ( 5 mm ) thick applique and 7.62 x 39 ( ps ) projectiles , and for all test conditions with the 7.62 x 51 ( m80 ) projectiles . in all these experiments , no perforations of the helmet resulted , which is remarkable since these high energy projectiles are all shot at muzzle velocities . in 5-pad configurations , and again using the 0.2-in ( 5 mm ) thick applique and the 7.62 x 39 ( ps ) projectiles , only minor injuries are observed . recall that the observations in the helmet only experiments are that the 5-pad configurations result in moderate injuries ( the highest level achieved in those experiments ) and the 7-pad configuration provided sufficient protection to fully mitigate and prevent injuries . those observations suggest that for projectiles with lower kinetic energy that the pads are able to absorb and dissipate the load and by so doing mitigate the intensity of interaction between the back face deflection and cranium . however , for the dynamic impact conditions associated with higher kinetic energy projectiles such as the 7.62 rounds , the pads can not respond quickly enough to either dissipate or distribute the load laterally over a sufficient area , but rather allow for a more intimate and immediate coupling between the helmet shell and the cranium , resulting in critical damage or injury . as shown in table 5 , for these 7.62 projectiles , the 5-pad ( off - pad hit ) configuration experiments result in reduced intracranial pressures and cranial bone strains . thus , we observe for 5-pad configurations a reduced level of injury because the pad is not present to provide the direct coupling from the shell to the cranium , and the shell back face deflection tends to be less localized or focused with more lateral spreading of the load . these observations are more fully illustrated in the flash x - ray images shown in figure 10 . in figure 10 are shown image sets from three different hhs experiments and they illustrate the characteristics of the peak dynamic deflection event , the back face signature for these helmets , and the response of the cranium to the blunt trauma resulting from back face impact . the flash x - ray technique allows for an instantaneous image at peak dynamic back face deflection based on a delayed trigger time . the top image pair shows the reference state against which the other three sets of images may be compared to . in all four image sets , the left image shows a side view of the event , while the right image shows a top down view of the event . in each image different colored curves are used to identify difference key layers in the helmet and hhs system . the yellow curve is the outer surface of the skin , while the red curve is the outer surface of the cranium ( bone ) . this sequence of images clearly demonstrates the benefit of pads for the 9-mm projectile impact in which for the on - pad condition the amount of back face deformation is significantly less than for the off - pad result ( compare the shape of the blue and yellow curves in the different images ) . the on - pad test shows no injury , while the off - pad hit results in moderate injury . further , the m80 projectile result keenly illustrates the concern with bhbt in that although the projectile is defeated by the armor system a significant amount of traumatic load is transmitted to the cranium resulting in critical injury . this threat is currently an over - matching threat for this helmet in terms of bhbt , and regardless of pad configuration , results in significant or critical injuries . in table 5 a similar summary of key mean data as that presented in table 3 is shown , but for the helmet plus applique experiments . for conditions resulting in critical damage or injuries to the cranium , the mean peak intracranial pressures are again approximately 3 times greater than for conditions that result in minor damage . the greatest cranial bone strains are measured for the 7-pad ( on - pad hit ) configurations with the 5-pad ( off - pad hit ) configurations having strains that are 24% ( for 7.62 x 39 projectiles ) and 57% ( for 7.62 x 51 projectiles ) less than for the corresponding 7-pad values . this data supports the on - pad versus off - pad hit location observations discussed earlier in this paper . figures 11 and 12 respectively display sample intracranial pressure and cranial strain time histories from selected experiments with the hhs . in these figures the data are for four different test conditions , but all are frontal impacts ( see figure for specific test details ) . the measured pressure response at gauge locations shows the classic signature of a propagating pressure pulse . at some gauge locations , a negative gauge pressure is typically seen in the pressure time histories measured in these experiments and suggests that cavitation of the surrogate csf ( cerebral spinal fluid ) may be developing , resulting from the dynamic interaction of the propagating pressure waves transmitted through the csf from the primary impact location . these negative pressure signals , however , do not show the typical rapid rise to an over - pressure followed by a low - pressure response as the pressure pulse reflects back to the source , which characterizes cavitation in a pipeline . rather , these pressure histories suggest a more diffused process of pressure propagation from the impact site , where the pressure response is less constrained and damped due to the flexible dura . when critical cranial damage results from projectile impact , the dynamic peak pressures measured at the impact location achieve values significantly greater than 50 psig ( 0.35 mpa ) , while for conditions where no cranial or minor damage results , the peak pressure at the impact location is less than 45 psig ( 0.31 mpa ) . further , the mitigating effect of application of a thicker ceramic applique against the same projectile is displayed in figure 11 where the peak pressure is reduced by a factor of 7 due to the increased thickness of the applique ( compare the upper right plot to the lower left plot ) . finally , the effect of 7-pad versus 5-pad configurations for similar projectile impacts are shown by comparing the data in the top right and lower right plots of figure 11 . here , the peak pressures are significantly reduced for the 5-pad configuration ( lower right image ) , when compared to the 7-pad configuration , by a factor of ~10 . in these two tests , the 7-pad configuration ( on - pad hit ) results in critical cranial damage , while the 5-pad configuration ( off - pad hit ) results in minor cranial damage . as shown in table 5 , the mean peak pressures ( averaged across similar tests for each pad configuration - see the values for the 7.62 x 39 projectiles with 0.2-in applique ) for 5-pad ( off - pad ) hit locations are less than for 7-pad ( on - pad ) hit locations by a factor of 2.8 . shown in figure 11 ( bottom plot ) are results from a set of similar and recent experiments due to liu et al 19 in which they measured intracranial pressure due to ballistic impact of 9-mm rounds using live , anesthetized pigs . in their tests , they used a flat plate of aramid composites ( 0.35-in or 9 mm in thickness ) to represent a helmet and was the target material impacted by the projectile . foam padding providing a 0.47-in ( 12 mm ) separation between the plate and the pigs head . they grouped impact velocities for the 9-mm rounds into three categories : velocities ranging from low ( 919 ft / s or 280 m / s ) , to moderate ( 1181 ft / s or 360 m / s ) , and to high ( 1377 ft / s or 420 m / s ) . an intracranial pressure sensor was inserted into the brain parenchyma and positioned approximately 0.47-in ( 12 mm ) under the parietal bone and facing the point of impact . for an average impact speed of 1404 ft / s ( 428 m / s ) , they measured a mean peak intracranial pressure of 109 psig ( 0.751 mpa ) from a sample set of 8 tests . as shown in figure 11 , the characteristics of the intracranial pressure signals measured in the live pigs are similar to those for the 9-mm projectile results from the hhs ( top left plot ) . however , the magnitude of the mean peak intracranial pressure measured in the live pigs is 3 to 8 times greater than that measured with the hhs for the same threat ( refer to table 3 , rows 4 and 5 ) . liu et al suggested that their high intracranial pressures may have resulted from the lack of scalp used in their tests as well as due to anatomical differences between pigs and humans . in figure 12 , the cranial strain time histories are measured in the region of the impact location . in these time history plots a negative strain corresponds to compression , while a positive strain is tension . in those experiments in which no or only minor cranial damage occurs , the strain data measured by a rosette shows similar responses in each leg of the rosette , whereas for conditions where fracturing of the cranium results , the strain histories at a rosette location show a dispersion in the signal histories measured by each leg in the rosette . the greater the amount of cranial fracturing that results in a test , the more dispersion in the signal time histories are present . in general , cranial fracturing is observed when dynamic peak strains greater than -0.4% are achieved at the measurement locations . finally , figure 13 displays head acceleration data from three different hhs tests and are representative of the type of data collected to date . in this figure , the head injury criterion 3,4 , hic , is applied using the acceleration time history data . hic is based on the average value of the acceleration over the most critical part of the acceleration event . the average acceleration is defined as the integral of the acceleration time history for a direction of 15 ms . acceleration in the z - direction ( refer to figure 5 ) is only used in the calculations here and accounts for primary motion of the head in the vertical centerline plane ( essentially nodding of the head with no rotations ) . the calculated hic values are shown in figure 13 . a hic value of less than 519 is equivalent to an abbreviated injury scale ( ais ) score of 1 , associated with headaches or dizziness , and is a minor injury . a hic value of 520 to 899 is equivalent to an ais score of 2 with unconsciousness of less than 1 hour and simple , linear fractures , and is a moderate injury . a hic value greater than 1860 is typically considered not survivable and has an ais score of 6 . as cited in 18 , the swri human head surrogate ( hhs ) is developed and applied for assessing behind helmet blunt trauma injuries . this human head surrogate is designed to fill the void between post - mortem human subject testing which has biofidelity but handling restrictions and commercial ballistic head forms which have little biofidelity but are easy to use . this unique human head surrogate is based on refreshed human craniums and surrogate materials representing human head soft tissues such as the skin , dura , and brain . a methodology for refreshing the craniums is developed and used in a series of experiments in which non - perforating ballistic impact of combat helmets is performed . sensors embedded in the human head surrogates allow for direct measurement of intracranial pressure , cranial strain , and head / helmet acceleration . experiments include both baseline combat helmets and helmets with a supplemental ceramic applique for addressing larger caliber threats . based on a relatively large number of tests , the swri human head surrogate has demonstrated great potential for providing insights in to injury mechanics resulting from non - perforating ballistic impact of combat helmets , allowing for a direct measure and assessment of behind helmet blunt trauma injuries .

a human head surrogate has been developed for use in behind helmet blunt trauma experiments . this human head surrogate fills the void between post - mortem human subject testing ( with biofidelity but handling restrictions ) and commercial ballistic head forms ( with no biofidelity but ease of use ) . this unique human head surrogate is based on refreshed human craniums and surrogate materials representing human head soft tissues such as the skin , dura , and brain . a methodology for refreshing the craniums is developed and verified through material testing . a test methodology utilizing these unique human head surrogates is also developed and then demonstrated in a series of experiments in which non - perforating ballistic impact of combat helmets is performed with and without supplemental ceramic appliques for protecting against larger caliber threats . sensors embedded in the human head surrogates allow for direct measurement of intracranial pressure , cranial strain , and head and helmet acceleration . over seventy ( 70 ) fully instrumented experiments have been executed using this unique surrogate . examples of the data collected are presented . based on these series of tests , the southwest research institute ( swri ) human head surrogate has demonstrated great potential for providing insights in to injury mechanics resulting from non - perforating ballistic impact on combat helmets , and directly supports behind helmet blunt trauma studies .

neuroblastoma ( nb ) is the most common extracranial solid tumor in children , with an incidence of 1 case per 100.000 children per year , and causes 15% of cancer deaths in pediatric age . nb originates from the sympathetic nervous system , most frequently in the adrenal medulla or the paraspinal ganglia . the causes are unknown , although 1 - 2% of nb may have a hereditary basis . different genetic alterations have been characterized in nb , that is , gain - of - function of alk gene , losses of 11q and 1p , gain of 17q , and amplification of the mycn gene . nb is heterogeneous , as it may undergo spontaneous remission or evolve to progressive metastatic disease , with dissemination to lymph nodes , bone , bone marrow , liver , skin , and other organs . in particular the international neuroblastoma risk group staging system takes into account genetic alterations , dna ploidy , histological features , and clinical data , as criteria for defining the risk classes . the prognosis of low / intermediate risk nb patients is favorable , and tumors can be cured by surgery alone or minimal chemotherapy . in contrast , high - risk nb patients ' prognosis is poor , in spite of aggressive treatment based on surgery , chemotherapy , radiation therapy , hematopoietic stem cell transplantation , and adjuvant therapy with retinoic acid . in fact , survival rates of these patients at 5 years are less than 50% . in the last years , the role of hla - class ib molecules in the progression of nb has been characterized by our group [ 47 ] and by others . hla - ib family includes hla - g , hla - e , hla - f , and hla - h . in contrast with high polymorphic hla - ia molecules ( hla - a , hla - b , and hla - c ) all these molecules display a limited polymorphism , with few alleles encoding a limited number of functional proteins . moreover , although hla - class ib molecules can bind small peptides and present them to specific cd8 t cell subsets ( similarly to hla - class ia counterparts ) , their main function is the modulation of the immune response in both physiological and pathological conditions . hla - g and hla - e are the best characterized among hla - ib molecules . hla - g has seven different isoforms , four membrane bound ( namely , hla - g1 , hla - g2 , hla - g3 , and hla - g4 ) and three soluble ( namely , hla - g5 , hla - g6 , and hla - g7 ) , that are generated by alternative splicing from the same primary transcript . hla - g can interact with at least four receptors , namely , immunoglobulin - like transcript ( ilt)2 , ilt4 , kir2dl4 , and cd160 , thus affecting the function of different immune effector cells ( t and b lymphocytes , natural killer nk cells , dendritic cells , granulocytes , and monocytes ) . in contrast , hla - e can be expressed as membrane bound or soluble isoform ( generated through metalloproteases cleavage ) and can inhibit cd8 t cells or nk cells though interaction with cd94/nkg2a heterodimeric receptor . however , hla - e can also interact with the activating receptor cd94/nkg2c , thus leading to nk cell activation . these interactions are crucial during trophoblast implantation to abrogate nk cell lysis of semiallogeneic fetal tissue and , on the other hand , to activate nk cell functions in the process of tissue remodeling . we have previously demonstrated that soluble ( s)hla - g concentration is higher in plasma samples from nb patients than in controls , and shla - g can be released by nb cells themselves , or by monocytes ( stimulated by soluble factors secreted by tumor cells ) . moreover , high shla - g plasma levels correlated with nb patients ' relapse . finally , we have assessed that hla - g is expressed by metastatic nb cells in the bone marrow from nb patients . also soluble hla - e levels are higher in nb patients than in healthy controls . however , we have demonstrated that high plasma levels of shla - e at diagnosis correlated with a better overall survival ( os ) of nb patients at follow - up , in contrast with shla - g . here , we demonstrated for the first time that shla - g and shla - e are present also in bm plasma samples derived from either nb patients at diagnosis or healthy donors . moreover , we have assessed that shla - g and shla - e levels in bm plasma samples are related to the stage of the disease . analysis of these patients at follow - up will reveal whether shla - g and shla - e concentration in bm plasma may predict the clinical outcome of nb patients . the study was approved by the ethics committee of the g. gaslini institute , genoa , italy . bone marrow ( bm ) samples were collected at diagnosis and centralized at istituto giannina gaslini in genoa , italy . patients ' characteristics , that is , age at diagnosis , sex , mycn amplification ( single copy or amplified ) , bm infiltration , and stage , are summarized in table 1 . as controls , bm aspirates were obtained from 13 healthy donors , selected according to the transplant unit clinical protocol of ematologia 2 at the irccs san martino - ist in genoa , following a written informed consent at the time of donation . samples were processed as described in , and an aliquot was taken at the end of processing to perform quality control tests , such as cd34 cell count , in vitro progenitors ' cell growth , and sterility . the remaining bm blood sample from this aliquot was subjected to centrifugation ( 3000 g 10 ) to obtain bm plasma . enzyme - linked immunosorbent assay ( elisa ) for shla - g and shla - e was performed as previously described . briefly , maxisorp nunc - immuno 96-microwell plates ( nunc a / s , roskilde , denmark ) were coated overnight at 4c with 1 g / ml of mem - g9 , specific for hla - g hc ( exbio , prague ) , that recognizes shla - g1/g5 , or 3d12 mab , specific for hla - e hc ( ebioscience , science center drive , san diego , ca , usa ) . after three washes with pbs 0.05% tween 20 ( washing buffer ) , plates were saturated with 200 l / w of pbs 2% bsa ( sigma , st . one hundred l of bm plasma samples and serial dilutions of 721.221.g1 cell line supernatant ( for hla - g ) or total extract from normal peripheral blood mononuclear cells ( standard ) were added to each well and incubated at rt for 1 hour . after three washes , 100 l of detection reagent ( hrp - conjugated anti-2 microglobulin mab , exbio , vestec , cz ) was added , and plates were incubated for 1 hour at rt . after three washes , 100 l of tmb ( substrate for hrp , sigma ) was added , and reaction was stopped after approximately 30 minutes by adding h2so4 5 n. absorbance at 450 nm was measured using infinite 200 pro spectrometer ( tecan group ltd . , results are expressed as ng / ml shla - g and arbitrary units / ml shla - e ( 1 unit = quantity of shla - e in 1 g of total extract ) . normal distribution of data was tested using kolmogorov - smirnov test , using prism software ( graphpad software inc . , la jolla , ca ) . since data distribution was not normal , differences in plasma levels between ( i ) patients and controls or ( ii ) different groups of patients were compared by mann - whitney test , using prism software . correlations between plasma levels of shla - g and shla - e were calculated by spearman 's test using prism software . a p value 0.05 significance ranges are the following : p < 0.05 ; p < 0.01 ; and p < 0.001 . first , we have tested shla - g and shla - e concentration in bm plasma samples from nb patients and healthy donors . as shown in figure 1(a ) , shla - g concentration was similar between nb patients ( median se : 24.69 8.45 ng / ml ) and controls ( 25.16 7.38 ng / ml ) . in contrast , shla - e levels were lower in nb patients ( 3.72 7.89 u / ml ) than in controls ( 48.01 10.93 u / ml ) . however , such difference was not statistically significant , likely due to the wide distribution of the results in both groups ( figure 1(b ) ) . finally , shla - g and shla - e levels in bm plasma samples from nb patients ( r = 0.96 , p < 0.0001 , figure 1(c ) ) and healthy donors ( r = 0.92 , p < 0.0001 , figure 1(d ) ) strongly correlated with each other . we have next analyzed possible correlation between shla - g and shla - e levels in bm plasma samples and patient 's characteristics or clinical parameters . accordingly , nb patients were divided into two groups on the basis of ( i ) mycn amplification ( single copy versus amplified ) , ( ii ) bm infiltration ( not infiltrated versus infiltrated ) , ( iii ) age at diagnosis ( < 18 months versus > 18 months ) , ( iv ) stage of the disease ( stages 1 - 2 versus stages 3 - 4 ) , and ( v ) sex ( male versus female ) . next , differences in shla - g and shla - e levels between these groups of nb patients have been evaluated . no significant differences in shla - g levels have been detected between nb patients ( i ) carrying amplified ( 29.96 13.57 ng / ml ) or single - copy ( 23.65 9.6 ng / ml ) mycn gene ( figure 2(a ) ) and ( ii ) presenting ( 31.17 11.99 ng / ml ) or not ( 21.05 9.91 ng / ml ) nb cells infiltrating the bm ( figure 2(b ) ) . in contrast , shla - e levels were higher in ( i ) patients with single - copy mycn ( 7.56 9.17 u / ml ) than in those with amplified mycn ( 1.03 16.2 u / ml ) ( figure 2(a ) ) and in ( ii ) patients with infiltrated bm ( 6.45 10.29 u / ml ) than in those without bm infiltration ( 1.86 12.43 u / ml ) ( figure 2(b ) ) . however , such differences were not statistically significant . furthermore , both shla - g and shla - e levels were similar between patients with an age below ( 21.05 9.92 ng / ml shla - g and 6.45 10.29 u / ml shla - e ) or above ( 28.77 11.36 ng / ml shla - g and 2.37 12.81 u / ml shla - e ) 18 months at diagnosis ( figure 3(a ) ) . notably , no correlation was found between age and shla - g or shla - e levels in bm plasma samples in healthy donors ( data not shown ) . both shla - g and shla - e levels were significantly higher in patients with disease stages 3 - 4 ( 32.34 8.08 ng / ml shla - g and 13.87 9.42 u / ml shla - e ) than in those with disease stages 1 - 2 ( 0 4.32 ng / ml shla - g and 0 3.27 u / ml shla - e , p = 0.01 and 0.03 , resp . ) surprisingly , both shla - g and shla - e levels were found to be higher in male ( 45.87 12.5 ng / ml shla - g and 34.19 14.83 u / ml shla - e ) than in female ( 2.52 8.81 ng / ml shla - g and 0 8.18 u / ml shla - e , p = 0.05 and 0.03 , resp . ) in contrast , healthy donors showed higher levels of shla - g and shla - e in female ( 50.74 14.1 ng / ml shla - g and 52.25 14.8 u / ml shla - e ) than in male ( 12.35 10.98 ng / ml shla - g and 11.33 13.25 u / ml shla - e ) subjects . however , such differences were not statistically significant ( figure 3(d ) ) . to the best of our knowledge , this is the first demonstration of the presence of shla - class ib molecules hla - g and hla - e in bm plasma samples . previous studies have demonstrated that shla - g can be released by some cell populations that are present in the bm environment , such as erythroblasts and mesenchymal stromal cells [ 1619 ] . in contrast , no information is available regarding hla - e expression and release in the bm . the strong correlation observed between the levels of these two molecules in bm samples either from nb patients or controls suggested that both molecules may be released by the same cell populations , or at least induced by similar stimuli . we have previously demonstrated that metastatic nb cells in the bm expressed high levels of hla - g on their surface , in contrast with primary tumors , that tested negative for hla - g . here , we have demonstrated that both shla - g and shla - e are present at similar levels in nb patients and healthy donors , thus suggesting that malignant metastatic nb cells are unlikely involved in their release . this observation is further confirmed by the finding that bm infiltration by metastatic nb cells did not affect shla - g or shla - e levels in bm plasma samples . moreover , mycn amplification and age at diagnosis that represent important prognostic factors were not related to shla - g and shla - e levels in bm , thus further suggesting that these molecules might be released by bm stromal cells or bm resident cell populations instead of nb cells themselves , and may be present in the bm environment in physiological conditions . however , the increased tumor burden might be correlated to a higher release of tumor - derived factor(s ) that , in turn , can upregulate hla - g and hla - e production by bm stromal cells . the finding that shla - g and shla - e bm plasma levels are higher in male than in female patients is in line with a previous study on multiple sclerosis , where the authors demonstrated that shla - g levels in plasma samples were higher in male than in female patients . however , this study has been carried out using peripheral blood plasma samples , and this is the first demonstration of this difference between male and female subjects in bone marrow plasma samples . notably , such difference may be a prerogative of nb patients , since shla - g and shla - e levels were higher in female than in male normal subjects . the most important finding of our study is the demonstration that shla - g and shla - e levels were significantly higher in bm plasma samples from patients with metastatic disease than in patients with localized nb . this data may suggest that the levels of these molecules in the bm at diagnosis might be associated with disease progression and might be predictive of the clinical course of nb patients . however , this hypothesis can be confirmed only by analyzing the clinical parameters of these patients at follow - up . in conclusion , we demonstrated for the first time that soluble hla - ib molecules hla - g and hla - e are present in bm plasma samples in physiological and pathological conditions , and their concentration correlated with stage disease in nb patients . the prognostic value of shla - g and shla - e concentration in bm plasma samples from nb patients at diagnosis has to be confirmed in future studies .

the role of nonclassical hla - class ib molecules hla - g and hla - e in the progression of neuroblastoma ( nb ) , the most common pediatric extracranial solid tumor , has been characterized in the last years . since bm infiltration by nb cells is an adverse prognostic factor , we have here analyzed for the first time the concentration of soluble ( s)hla - g and hla - e in bone marrow ( bm ) plasma samples from nb patients at diagnosis and healthy donors . shla - g and shla - e are present in bm plasma samples , and their levels were similar between nb patients and controls , thus suggesting that these molecules are physiologically released by resident or stromal bm cell populations . this hypothesis was supported by the finding that shla - g and shla - e levels did not correlate with bm infiltration and other adverse prognostic factors ( mycn amplification and age at diagnosis ) . in contrast , bm plasma levels of both molecules were higher in patients with metastatic disease than in patients with localized nb , thus suggesting that concentration of these molecules might be correlated with disease progression . the prognostic role of shla - g and shla - e concentration in the bm plasma for nb patients will be evaluated in future studies , by analyzing the clinical outcome of the same nb patients at follow - up .

this is a nonrandomized prospective comparative case study on 57 eyes seeking refractive surgery who were not indicated for laser corneal refractive surgery . patients with refraction error between 2.00 d and 14.50 d who could use both artiflex and artisan , were free to choose the type of the lens . other patients underwent artisan implantation . ophthalmic examinations before surgery included cyclo - refraction , uncorrected visual acuity ( ucva ) , best - corrected visual acuity ( bcva ) , topography , keratometry , endothelial cell count , pupil diameter , and anterior chamber ( ac ) depth measurement . according to patient history and examination , patients who had the following conditions underwent piol implantation surgery : insufficient corneal thickness for refractive corneal surgery , inappropriate corneal curvature and topography , high myopia more than 8 d which could not undergo corneal refractive surgery , negative history of any previous refractive surgery , sufficient internal ac depth ( 3 mm or greater ) , no history of intraocular pressure raise and endothelial cell density of 2500 cell / mm or more . lens dioptric power was calculated by van der heijde formula , using refractive error , refractive cylinder power , ac depth , and topographically derived keratometry values . emmetropia was the target power of the surgery , when the precise emmetropic lens was not available our choice was to a slight residual myopia . all surgeries were performed under general anesthesia , for artisan lens implantation , a superior 5 or 6 mm length corneal incision was created at the 12 o'clock position , followed by performing two stab incisions located at 2 and 10 o'clock . the lens was inserted into the ac under protection of intracameral ophthalmic viscoelastic material injection . artiflex lens implantation was performed similarly , although the lens was inserted through a 3.2 mm incision . other steps were carried out same as artisan implantation ; finally , the wound was closed by stromal hydration without the necessity of suturing . one year after surgery , cyclo - refraction , bcva , ucva , cs , hoa and patient satisfaction were assessed . cs was determined by csv-1000 chart , and refraction was obtained with topcon auto refractometer and then modified by subjective refraction . night vision , day vision , halo , photophobia , dryness , pain , and patient satisfaction were assessed by questionnaire with numerical scales ( 0 = weak , 1 = moderate , 2 = good , 3 = excellent for day and night vision 0 = none , 1 = mild , 2 = moderate , 3 = severe for halo , photophobia , dryness , and pain ) . the chart consists of four rows corresponding to spatial frequencies of 3 , 6 , 12 , and 18 cycles per degree ( cpd ) . the distance between the patient and the chart was 2.5 m. the test was performed with the patients monocular bcva to eliminate the effects of sia and residual post - operative refraction . the aberrations analyzed were classified in terms of hoa , vertical trefoil , vertical coma ; horizontal trefoil , horizontal coma , quatrefoil , second astigmatism , and fourth order spherical aberration . comparison between artisan and artiflex data were analyzed using parametric paired student 's t - test , p < 0.05 was considered statistically significant . this is a nonrandomized prospective comparative case study on 57 eyes seeking refractive surgery who were not indicated for laser corneal refractive surgery . patients with refraction error between 2.00 d and 14.50 d who could use both artiflex and artisan , were free to choose the type of the lens . other patients underwent artisan implantation . ophthalmic examinations before surgery included cyclo - refraction , uncorrected visual acuity ( ucva ) , best - corrected visual acuity ( bcva ) , topography , keratometry , endothelial cell count , pupil diameter , and anterior chamber ( ac ) depth measurement . according to patient history and examination , patients who had the following conditions underwent piol implantation surgery : insufficient corneal thickness for refractive corneal surgery , inappropriate corneal curvature and topography , high myopia more than 8 d which could not undergo corneal refractive surgery , negative history of any previous refractive surgery , sufficient internal ac depth ( 3 mm or greater ) , no history of intraocular pressure raise and endothelial cell density of 2500 cell / mm or more . lens dioptric power was calculated by van der heijde formula , using refractive error , refractive cylinder power , ac depth , and topographically derived keratometry values . emmetropia was the target power of the surgery , when the precise emmetropic lens was not available our choice was to a slight residual myopia . all surgeries were performed under general anesthesia , for artisan lens implantation , a superior 5 or 6 mm length corneal incision was created at the 12 o'clock position , followed by performing two stab incisions located at 2 and 10 o'clock . the lens was inserted into the ac under protection of intracameral ophthalmic viscoelastic material injection . artiflex lens implantation was performed similarly , although the lens was inserted through a 3.2 mm incision . other steps were carried out same as artisan implantation ; finally , the wound was closed by stromal hydration without the necessity of suturing . one year after surgery , cyclo - refraction , bcva , ucva , cs , hoa and patient satisfaction were assessed . cs was determined by csv-1000 chart , and refraction was obtained with topcon auto refractometer and then modified by subjective refraction . night vision , day vision , halo , photophobia , dryness , pain , and patient satisfaction were assessed by questionnaire with numerical scales ( 0 = weak , 1 = moderate , 2 = good , 3 = excellent for day and night vision 0 = none , 1 = mild , 2 = moderate , 3 = severe for halo , photophobia , dryness , and pain ) . the chart consists of four rows corresponding to spatial frequencies of 3 , 6 , 12 , and 18 cycles per degree ( cpd ) . the distance between the patient and the chart was 2.5 m. the test was performed with the patients monocular bcva to eliminate the effects of sia and residual post - operative refraction . the aberrations analyzed were classified in terms of hoa , vertical trefoil , vertical coma ; horizontal trefoil , horizontal coma , quatrefoil , second astigmatism , and fourth order spherical aberration . comparison between artisan and artiflex data were analyzed using parametric paired student 's t - test , p < 0.05 was considered statistically significant . a total of 57 eyes were included in the study ; of which , 24 eyes were in artisan group and 33 eyes were in artiflex group . the preoperative spherical equivalent ( se ) and bcva were obtained and compared , no statistically significant difference was noticed in the mean preoperative se ( 10.39 8.43 d in artisan group and 10.39 2.29 d in artiflex group ; p = 0.999 ) and bcva of two groups ( 0.25 0.21 logarithm of the minimum angle of resolution [ logmar ] for artisan group and 0.19 0.18 logmar for artiflex group ; p = 0.56 ) . the mean postoperative se was 0.93 1.28 d in the artisan group and 0.54 0.82 in the artiflex group , no significant difference was seen in in postoperative se between two groups ( p = 0.19 ) . one year after the operation , 54% of artisan - treated eyes ( 15/24 ) and 75.7% ( 25/33 ) of artiflex treated eyes were within 1.00 d of intended emmetropia [ figs . 1 and 2 ] . in the artisan group , 37.5% of the treated eyes ( 9/24 eyes ) had three or more snellen line improvement of postoperative bcva , 12.5% ( 3/24 eyes ) had two snellen line improvement and 25% ( 6/24 eyes ) had loss of two or more snellen lines . in the artiflex group , 51.5% of the treated eyes ( 17/33 eyes ) had three or more snellen line improvement of bcva , 15.1% ( 5/33 eyes ) had two line improvement , and no eyes had loss of two or more snellen lines of bcva [ fig . 3 ] . the bar graph shows the postoperative defocus equivalent 1 year after artisan ( a ) and artiflex ( b ) implantation bar graph of change in best - corrected visual acuity from the preoperative examination to postoperative examination in terms of the number of snellen line change . artisan ( a ) , artiflex ( b ) mesopic contrast sensitivity at spatial frequencies of 3 , 6 , 12 and 18 degree per cycles in this study , total hoa in artisan - treated eyes was significantly greater than artiflex - treated eyes ( p = 0.044 ) with a mean hoa of 0.44 0.15 root mean square ( rms ) for artisan and 0.35 0.15 rms for artiflex . there was no significant difference in the vertical trefoil , vertical coma , horizontal trefoil , horizontal coma , quatrefoil , second astigmatism , and fourth order spherical aberration . the evaluation of cs in mesopic conditions showed higher cs in artiflex - treated eyes at three spatial frequencies 6 , 12 , and 18 cpd ( p = 0.003 , p = 0.007 , and p = 0.00 , respectively ) , and no significant difference was seen between two lenses at 3 cpd spatial frequency [ table 1 and fig . contrast sensitivity data after phakic intra - ocular lens implantation subjective comparison of day and night vision in artisan versus artiflex treated eyes the mean of sia was 1.65 0.82 d in artisan group , and 1.31 1.05 in artiflex group , which showed no statistically significant difference between the groups ( p = 0.19 ) . in a subjective evaluation of day vision , all patients of the artiflex group reported good and excellent vision , in artisan group , 71% of patients reported good and excellent vision , whereas 7.1% complained of weak day vision . in the assessment of night vision , 50% of patients treated with artiflex reported good and excellent vision and no one complained of weak night vision . in artisan group , 71.4% reported good and excellent vision , whereas 21.4% reported weak night vision [ fig . subjective comparison of halo , photophobia , pain and dryness in artisan versus artiflex treated eyes among artiflex treated eyes , 50% reported moderate halos and in the artisan group 40% reported moderate to severe halos . about 12.5% of artiflex treated eyes experienced moderate photophobia , whereas 35.7% of artisan treated eyes experienced moderate to severe photophobia . in the artiflex group , only 12.5% of treated eyes caused mild pain , whereas 36.7% of artisan treated eyes caused mild to moderate pain . moderate to severe dryness was reported in 25% of eyes treated with artiflex , whereas no artisan treated eye experienced moderate or severe dryness [ fig . 6 ] . the bar graph of patient 's satisfaction in artisan versus artiflex groups satisfaction more than 60% was reported in 100% of patients in artiflex group versus 60% of patients in artisan group [ fig . the bar graph presents the postoperative spherical equivalent 1 year after artisan ( a ) and artiflex ( b ) implantation . as it is well - confirmed , the recently food and drug administration approved pmma artisan piol is an effective mean for the correction of refractive errors and have been shown to have acceptable safety and efficacy . however , studies have revealed instances of significant induced astigmatism , attributed to the larger incisions performed in the implantation of the artisan lens . artiflex iris - fixated piol , a foldable version of artisan , is an improvement of the iris - supported piol concept , with a lower incidence of sia . artiflex piol haptics are made of pmma and the foldable optical zone is made of silicon . the main purpose of this investigation is to evaluate the differences in optic quality between rigid piol versus flexible piol by comparing wavefront aberration , cs and patient satisfaction in patients who underwent artisan and artiflex iris - fixated iol implantation . in this study , mean postoperative residual se were 0.93 1.28 d and 0.54 0.82 d in the artisan and artiflex group , respectively , no significant difference was seen in postoperative se between two groups ( p = 0.19 ) . about 54% of artisan group and 75.7% of artiflex group were within 1.00 d of intended emmetropia . in a previous study , 58% and 83.9% of artisan and artiflex group had a residual postoperative se within 1.00 d , which was significantly better in artiflex group . another study reported that emmetropia ( 1.00 d ) was obtained in 60% and 91.7% of artisan and artiflex group , respectively , the difference was statistically significant [ table 2 ] . percentage of postoperative refraction within1.00 d of intended emmetropia in a retrospective comparative case series on 27 eyes , postoperative se was within 0.5 d in 76.2% and 85.7% of artisan and artiflex treated eyes , respectively . in a study of evaluating the outcome of iris - claw piol in fifty high myopic eyes , postoperative se was evaluated , which showed that 38% and 68% of the eyes were in the range of 0.5 d and 1.00 d , respectively . mean postoperative ucva was 0.34 0.25 logmar in artisan group and 0.12 0.15 logmar in artiflex group . mean postoperative bcva was 0.21 0.13 and 0.06 0.08 logmar in the artisan and artiflex groups , respectively [ table 3 ] . the differences of ucva and bcva in two groups were statistically significant ( p = 0.00 ) . in another study , postoperative bcva between artisan and artiflex groups was not significantly different ( p = 0.9 ) . postoperative visual acuity ( logarithm of the minimum angle of resolution ) in artisan group versus artiflex group in this study , although vertical trefoil , vertical coma , horizontal trefoil , horizontal coma , secondary astigmatism , quatrefoil and fourth order spherical aberration were not significantly different between the artiflex and artisan groups , total hoa was higher in artisan group , that may be due to the slight differences in each component , which totally increases the hoa ( p = 0.044 ) . in a previous study , assessment of hoas after implantation of rigid versus foldable iris - fixated lenses , showed a significant decrease in postoperative spherical aberration among artiflex group and a significant increase in postoperative spherical aberration in artisan group . in both groups , vertical trefoil and spherical aberration were higher in artisan group , p = 0.039 and p = 0.001 , respectively . assessment of cs in mesopic condition showed no significant difference between two groups at 3 cpd spatial frequency . cs was significantly higher in artiflex - treated eyes at three spatial frequencies 6 , 12 and 18 cpd ( p = 0.003 , p = 0.007 , and p = 0.00 , respectively ) . a previous investigation showed that mesopic cs was slightly better in artiflex group in comparison with artisan group , but the difference was not statistically significant , they also measured photopic cs function and found that both groups had poorer performance compared to the normal range . performance with the artisan lens was slightly better than performance with artiflex under photopic conditions , but worse under mesopic conditions ; neither differences were statistically significant . in this study , we have used artisan iol for patients not eligible for the available artiflex ( six myopic eye more than 14.5 d and one hyperopic eye ) , comparison of this two groups may have some biases because of other probable conditions such as retinal involvement or amblyopia , which can alter the results , this was one of our study limitations . in this study , 25% of patients with artisan lens lost two or more lines of bcva , we called the patients back and examined them again carefully , we recognized that in one patient both eyes had refractive error postoperatively in spite of implanting a lens with the same power of his preoperative se improvement in bcva was not seen with correction of this refractive error by trial - frame . in the other patients , we could not find any reason for the decrease in the bcva , unless considering pigment deposition on the iol as a reason for the visual loss .

aim of study : the aim of this study is to assess wavefront aberration and contrast sensitivity ( cs ) after implantation of foldable iris claw artiflex- and rigid iris claw artisan- phakic intraocular lenses ( piols).materials and methods : a nonrandomized prospective comparative case study was performed on 57 eyes ; of which , 54 were myopia and 3 were hyperopia . twenty - four patients had artisan piol implantation and 33 had artiflex piol implantation . higher - order aberration ( hoa ) and cs were obtained 1 year after surgery.results:total hoa in artisan group was greater than artiflex group ( p = 0.044 ) with a mean hoa of 0.44 0.15 root mean square ( rms ) for artisan and 0.35 0.15 rms for artiflex . although , there were no significant differences in the vertical trefoil , vertical coma , horizontal trefoil , horizontal coma , secondary astigmatism , quatrefoil , and fourth order spherical aberration in two groups . cs in mesopic conditions was better in artiflex - treated eyes at three spatial frequencies of 6 , 12 , and 18 cycles per degree ( cpd ) ( p = 0.003 , p = 0.007 , and p = 0.00 , respectively ) , and no significant difference was seen between two lenses at 3 cpd.conclusion:although the components of hoa were not significantly different between two groups , total hoa was higher in artisan group , which may be due to the slight differences in each component , increasing the hoa as a total . cs was significantly better in artiflex group .

both innate and adaptive immune responses are , in every way , affected by polarization with cytokines . the expression of costimulatory molecules and chemokines , as well as the execution of effector programs , is affected in monocytes . in humans and mice , t helper ( th)1 and th2 polarization with ifn - r and il-4 il-4 polarization , also known as either alternative or m2a activation , stimulates wound recovery and parasite immunity responses . ifn - r polarization , which is referred to as either classical or m1 activation , is responsible for tumor resistance , intracellular killing , and il-12 production in monocytes . m1 macrophages , which are activated by the classical pathway , are shown to be responsive to two signals : type 1 inflammatory cytokines and microbial products . there are three subsets of m2 macrophages : m2a , induced by il-4 or il-13 ; m2b , induced by immune complexes and agonists of tlrs or il-1 receptors ; and m2c , induced by il-10 and glucocorticoid hormones . m1 and m2 macrophages can be differentiated based on their receptors , expression of cytokines and chemokines , and effector function . m1 macrophages are microbicidal and inflammatory , and m2 macrophages are immunomodulators ( m2a and m2c ) and possess minimal microbicidal effects . recently , the activation or polarization of macrophages has been demonstrated to be rapid , plastic , and fully reversible . this shows that macrophages are dynamic when they first engage in the inflammatory response and the resolution process that follows and that changes in function are caused by changes in the microenvironment . low - level laser therapy ( lllt ) is a form of light emission with a power output of less than 500 mw and is therefore considered nonthermal irradiation to living tissue . lllt is known to be a noninvasive treatment modality and has been applied in various fields . lllt was thought to be effective in pain relief and promoting recovery of some pathology , including tendinopathies , osteoarthritis , temporomandibular joint disorders , wound healing , and nerve injuries [ 7 , 8 ] . the exact mechanism is still under investigation , but the mechanism is likely to be photochemically related . this would affect the biological regulation of nitric oxide and adenosine triphosphate and would further affect the inflammatory process or cytokine release . lllt is prevalent in the prevention and treatment of cancer therapy - induced oral mucositis [ 9 , 10 ] and may alter human immunity . lllt has also been shown to have several biological effects that favor the healing process . lllt ( 660 nm ) is able to promote the skin repair of burned rats by decreasing the necrotic area and upregulating cyclooxygenase-2 and vascular endothelial growth factor expression . an in vitro study demonstrated that increased intracellular calcium influx occurred in mast cells , followed by histamine release after laser irradiation , which may explain the biological effect of lllt in promoting wound healing . cytokine expression in short - term muscle remodeling is also modulated by lllt , which leads to a decline in tnf- and tgf- after cryoinjury . similarly , the clinical value of the potential immune modulation effect of laser therapy has recently been studied in the treatment of allergic rhinitis . the ability of the ktp/532 yag laser to reduce nasal congestion and discharge in patients with allergic rhinitis has been identified . the ktp/532 yag laser is effective as an additional treatment for patients who are refractory to medications , and the treatment is extremely well tolerated without significant side effects . after one year , nasal obstruction was improved in 69% of cases and nasal discharge in 40% of cases . 308 nm xenon chloride ( xecl ) uvb irradiation significantly minimized these symptoms , including rhinorrhoea , sneezing , and nasal obstruction , and improved the total nasal scores and the allergen - induced skin prick tests in a dose - dependent manner . the xecl uvb excimer laser may also serve as a new treatment option for treating allergic rhinitis , which is a th2-dominant disease that is suppressed by th1 or m1 immunity . controlled by the action of histone acetyltransferases ( hats ) , histone deacetylases ( hdacs ) , and methyltransferases , histone acetylation and methylation are important epigenetic modifications that influence gene transcription . modifications on histones , such as acetylation or trimethylation at h3k4 , h3k36 , and h3k79 , are associated with gene activation . it is unknown , however , whether lllt modulates human monocyte polarization and immune function via epigenetic regulation . because different types of lasers have been used for the treatment of th2-dominant disease , we evaluate the influence of lllt on monocyte polarization in this study . we investigated the regulatory effects of lllt on monocyte m1 polarization to provide evidence for the use of lllt for immunologic disorders . louis , mo ) supplemented with 10% fetal bovine serum , 100 u / ml of penicillin , and 100 g / ml of streptomycin at 37c with 5% co2 in a humidified incubator . thp-1 cells were centrifuged , resuspended in fresh media , and plated in 24-well plates at a cell density of 5 10/ml 24 hours before experimental use . the cells were pretreated with a low - power gallium - aluminum - arsenide ( gaa1as ) laser ( 03 j / cm ; 660 or 808 nm ) alone or 2 hours before lps ( 0.2 g / ml ) stimulation . cell supernatants were collected 12 , 24 , and 48 hours after lps stimulation . to investigate epigenetic regulation , the cells were pretreated with methylthioadenosine ( mta , a histone methyltransferase inhibitor ) or anacardic acid ( aa , a histone acetyltransferase inhibitor ) 1 hour before lllt . to investigate the mitochondria involvement in lllt - related monocyte polarization , the cells were pretreated with oligomycin ( 1 and 2.5 g / ml , sigma - aldrich , st . louis , mo , usa ) or antimycin ( 0.1 and 0.5 g / ml , sigma - aldrich , st . the gaa1as ultra red laser with wavelengths of 660 nm and gaa1as near - infrared laser with wavelengths of 808 nm ( transverse ind . a total volume of 1 ml of cell - containing media for 12-well plates was added into each well to decrease the refraction during the low - level laser irradiation treatment . the distance between the gaa1as laser source and the culture plate was adjusted to ensure homogeneous laser exposure in 12-well plates . the cells were treated with the gaa1as laser beam to reach a total energy of 0 , 1 , 2 , and 3 j / cm , respectively . thp-1 cells were treated with different doses of lllt and total rna was isolated from cells immediately ( t = 0 ) or 6 hours after lps stimulation . total rna was extracted from cells using trizol ( invitrogen , carlsbad , ca ) according to the manufacturer 's instruction . three g of rna from each sample was then reverse - transcribed into first - strand cdna in 20 l of reaction mixture using the superscript first - strand synthesis system with the real - time pcr kit ( invitrogen ) . measurements were performed by an abi prism 9700 ht sequence detection system ( applied biosystems , foster city , ca ) using a predeveloped taqman probe / primer combination for m1-related genes and glyceraldehyde 3-phosphate dehydrogenase ( g3pdh ) from the same cdna samples . taqman pcr was performed in 10 l using amplitaq gold polymerase and the universal master mix ( applied biosystems ) . threshold cycle numbers were transformed using the comparative threshold cycle and relative value methods according to the manufacturer 's recommendation and expressed relative to g3pdh , which is used as a housekeeping gene by multiplexing single reactions . the m1-related cytokine and chemokine genes are as follows : ccl2/mcp-1 , cxcl10/ip-10 , and tnf-. the ccl2/mcp-1 , cxcl10/ip-10 and tnf- concentrations in the cell supernatants were determined using commercially available elisa - based assay systems ( r&d systems , minneapolis , mn ) 5 10 cells were treated with 1% formaldehyde for 10 min at room temperature , followed by sonication of the dna and immunoprecipitation of chromatin overnight with antibodies against acetylated h3 and h4 and trimethylated h3k4 ( upstate biotechnology , waltham , ma ) . immune complexes were collected using a protein a slurry ( invitrogen ) , and the dna was reverse cross - linked , extracted , and quantified using a taqman sds 7900ht . for pcr amplification of chip products , primers and probes were designed to analyze the proximal promoter and intronic enhancer regions of the tnf- gene as previously described [ 19 , 20 ] , encompassing the following subregions relative to the transcription start site : tnf1 ( t1 , + 99 to 42 ) ; tnf2 ( t2 , + 32 to 119 ) ; tnf3 ( t3 , 100 to 250 ) ; tnf4 ( t4 , 195 to 345 ) ; and + 1417 , + 720 , and 1700 . primers and probes were also designed to analyze the proximal promoter regions of the cxcl10/ip-10 gene ( cxcl10/ip-10 - 1 : + 9 to 172 and cxcl10/ip-10 - 2 : 444 to 622 ) . ( 1 ml / well ) , treated with lllt ( 660 nm ) , and incubated for 24 h. the cells were harvested and washed 3 times with pbs for direct immunofluorescence staining using labeled monoclonal antibodies to cd14 , cd45ro , ccr7 , or cd86 . the cell surface markers were analyzed using a facscan flow cytometer and the cellquest software ( becton dickinson , franklin lakes , nj , usa ) . according to the manufacturer ( invitrogen , carlsbad , ca ) , an anchored oligo - dt primer was used to reverse - transcribe total rna ( 1 g ) using superscript ii . primer pairs were designed using primer3 ( http://frodo.wi.mit.edu/primer3/ ) and were validated using in silico pcr ( http://genome.ucsc.edu/cgi-bin/hgpcr ) and blast ( http://blast.ncbi.nlm.nih.gov/blast.cgi ) . the following primer sequences were used : mt - nd1nadh dehydrogenase , subunit 1 ( mt complex i ) fw : accatttgcagacgccataa and re : tgaaattgtttgggctacgg ; sdha succinate dehydrogenase complex , subunit a , flavoprotein ( mt complex ii ) fw : caaacaggaacccgaggtttt and re : cagcttggtaacacatgctgtat ; mt - cytb mitochondrial cytochrome b ( mt complex iii ) fw : gccctcggcttacttctctt and re : gacggatcggagaattgtgt ; cox1 ( mt - coi)cytochrome c oxidase i ( mt complex iv ) fw : ttcgccgaccgttgactattctct and re : aagattattacaaatgcatgggc ; mt - atp6atp synthase , h+ transporting , mitochondrial fo complex , subunit f6 ( mt complex v ) fw : tttgcggaggaacattggtgt and re : tccagatgtctgtcgcttagat ; ucp2uncoupling protein 2 ( mitochondrial , proton carrier ) fw : cctgaaagccaacctcatgac and re : caatgacggtggtgcagaag ; and 18 s rrna fw : tagagggacaagtggcgttc and re : cgctgagccagtcagtgt . for q - pcr time course samples ( n = 3 ) , 10 l reactions consisting of 3 l of diluted cdna and 0.3 m of forward and reverse gene - specific primers combined with 2 power sybr green pcr master mix ( applied biosystems , foster city , ca ) were aliquoted into 96-well plates using a biomeck 2000 laboratory automation workstation ( beckman coulter inc . , fullerton , ca ) . applied biosystems prism 7900ht sequence detection system was used for the amplification process that included a ten - minute 95c denaturation stage , then forty repetitions of 95c for fifteen seconds , and lastly 60c for one minute . quantifications were obtained by the comparative ct method ( ct ) ( applied biosystems , foster city , ca ) . the geometric mean of housekeeping gene ( gapdh ) expression served as the internal control . the relative copy number of mtdna was computed via normalizing the crossing points in the quantitative pcr curves between the mitochondrial nd1 gene and the nuclear 18s rrna gene , and the ratio was normalized to the control . differences between experimental and control groups were analyzed by using the mann - whitney u test . changes in chemokines and cytokines at different doses of lllt alone were analyzed using the wilcoxon signed rank test . a p - value < 0.05 was considered indicative of a significant difference between groups . we first tested whether lllt ( 03 j / cm , 660 and 808 nm ) influenced the m1-related chemokine and cytokine expression in thp-1 cells . real - time pcr data showed that the m1-related chemokine ccl-2 was enhanced by 660 nm ( 1 - 2 j / cm ) and 808 nm ( 1 - 2 j / cm ) lllt 24 hours after irradiation . the most powerful effect was produced by 1 j / cm of 660 nm lllt and 2 j / cm of 808 nm lllt ( figures 1(a ) and 1(b ) ) . however , 3 j / cm of lllt ( 660 and 808 nm ) suppressed ccl-2 expression in thp-1 cells . cxcl-10 mrna expression was enhanced by 660 nm lllt but suppressed by 808 nm lllt ( figures 1(c ) and 1(d ) ) . tnf- , an m1-related pro - inflammatory cytokine , was also enhanced by 660 nm lllt but suppressed by 808 nm lllt 24 hours after irradiation ( figures 1(e ) and 1(f ) ) . the effect of lllt on m1-related cytokine and chemokine mrna expression was observed at 12 , 24 , and 48 h time points ( figures 2(a ) , 2(b ) , and 2(c ) ) . there were no differences between the control group and all of the other groups with different doses of lllt treatment , indicating that cell viability was not affected by lllt ( data not shown ) . because lllt could induce m1-related cytokine and chemokine mrna expression in monocytes , we examined whether lllt could also induce m1-related cytokine and chemokine protein expression . one j / cm of 660 nm lllt significantly induced ccl2 and cxcl10 production in human monocytes , whereas 2 j / cm and 3 j / cm did not ( figures 3(a ) and 3(b ) ) . tnf- protein production was also enhanced by 660 nm lllt 24 h after irradiation ( figure 3(c ) ) . the influence of lllt on m1-related chemokine and cytokine production may also involve mitochondrial biogenesis and activation . it is known that oligomycin hinders atp synthase by blocking its proton channel ( fo subunit ) , which is necessary for oxidative phosphorylation of adenosine diphosphate to atp and leads to an increased proton gradient , which decreases both respiratory activity and oxidative phosphorylation , thereby resulting in mitochondrial dysfunction . antimycin is a mitochondrial inhibitor that binds in the energy - coupling site and inhibits the flow of electrons from cytochrome b to cytochrome c1 . low - intensity laser irradiation has been reported to improve mitochondrial dysfunction and leads to mitochondrial alterations [ 24 , 25 ] . the inhibition of lllt - induced ccl2 mrna expression by oligomycin and antimycin suggested mitochondrial involvement ( figure 4 ) . as shown in figures 5(a ) and 5(b ) , 1 j / cm of lllt significantly increased the copy number of mitochondria , but 2 j / cm of lllt did not . the data are similar to the lllt - induced production of m1-related chemokine and cytokine . next , we evaluated the involvement of respiratory chains including complexes i to v and uncoupling protein . one j / cm of lllt increased the mrna amount of complexes i to v and uncoupling protein , whereas 2 j / cm did not ( figures 5(c ) and 5(d ) ) . it has been shown that epigenetic modification at the tnf- gene locus occurs by a coordinated and complicated network of regulation involving dna methylation , histone modification , and chromatin remodeling . studies in monocytes and macrophages have shown that although there are different patterns of histone modifications , the main regulatory regions associated with histone modifications could be identified in lllt - treated monocytes . in fact , the involvement of histone acetylation in the regulation of tnf- expression was further supported by the finding that aa significantly suppressed tnf- expression in lllt - treated thp-1 cells ( figure 6(a ) ) . to determine whether histone modifications occurred in thetnf- gene locus in monocytes , chip analysis of thp-1 cells treated with lllt was conducted ; pcr primers corresponding to four overlapping subregions ( 1700 and tnf14 , covering the region between 345 and + 99 ) in the tnf- promoter and two intronic regions ( + 720 and + 1417 ) in the tnf- gene were used . compared to the histone modifications found in the medium control cultures , significant histone modifications were detected at the tnf- gene locus in lllt - treated thp-1 cells . as shown in figures 6(b ) and 6(c ) , upregulated tnf- expression in lllt - treated thp-1 cells was associated with an increased level of histone 3 acetylation primarily in the t1 , t4 , and intron sequence ( + 1720 ) of the tnf- gene ; however , increased histone 4 acetylation was found to be mostly associated with the proximal promoter regions of the tnf- gene in the t1 , t2 , and intron sequence ( + 1417 ) . we next examined whether the effects of lllt on tnf- expression were due to histone methylation . moreover , chip analysis also showed elevated levels of tri - methylated h3k4 at the proximal promoter subregion , as well as the tnf1 , tnf3 , and tnf4 regions of the tnf- gene in lllt - treated cells ( figure 6(e ) ) . next , we investigated whether lllt - induced ip-10 expression in human monocytes was induced by increasing histone acetylation and trimethylation . pretreatment with aa reversed lllt - induced ip-10 expression in thp-1 cells ( figure 7(a ) ) . chip analysis also showed increased levels of h3 at the proximal promoter subregion cxcl10 - 1 in the ip-10 gene in lllt - treated cells , whereas h4 occupation did not increase ( figures 7(b ) and 7(c ) ) . pretreatment with mta did not reverse lllt - induced ip-10 expression in thp-1 cells ( figure 7(d ) ) . therefore , these findings suggested that the effect of lllt on m1 polarization is associated with the cellular regulation of differential histone modification . polarization of t cells and macrophages with cytokines influences every aspect of the immune response , including innate and adaptive immunity [ 13 ] . it is important to understand and be able to control macrophage polarization to eventually be able to enhance our immunity and treat immune disorders . over the last decades , we have witnessed an increasing prevalence of allergic diseases , which are relatively common and often debilitating diseases . allergic diseases are caused by elevated th2 cells , but the reason for this preferential activation is unclear . macrophages are the major antigen - presenting cells involved in the induction of the primary immune response and play a critical role in immunity . ifn - r polarization , occurring through either classical or m1 activation , programs monocytes for phagocytosis , tumor resistance , and allergy suppression . it is also important to understand how to modulate the function of macrophages , induce m1 immunity to promote intracellular killing and tumor resistance , and prevent allergic reaction . lllt is a form of light therapy with therapeutic effects on living tissues . in this study , 660 nm lllt promoted m1 polarization and cytokine and chemokine mrna and protein expression . therefore , the effect of lllt on monocyte polarization may be a potential treatment for allergic diseases and may also promote immunity to viral infections and tumors . the optimal dose of 1 j / cm may be more effective for promoting m1 immunity than 2 j / cm or 3 j / cm . tnf- is an endotoxin - induced cytokine that causes necrosis and death of tumors and is also a pro - inflammatory cytokine predominantly released by macrophages . not only is tnf- a pro - inflammatory cytokine , but it is also an immunoregulatory molecule that can modify the balance of t regulatory cells . in addition , tnf- is a central cytokine that triggers inflammation in rheumatoid arthritis ( ra ) , indicating that the inhibition of tnf- is an effective treatment strategy for ra . following a viral infection , cxcl10/ip-10 is secreted by bronchial epithelial cells , and th1 cells are recruited via cxcr3 to eliminate the intracellular pathogen . baseline cxcl10 serum concentration is linked to the outcome of antiviral therapy in monoinfected hepatitis patients , as well as in patients coinfected with hiv [ 30 , 31 ] . mcp-1/ccl2 is one of the key chemokines that regulate migration and infiltration of monocytes and macrophages . both ccl2 and its receptor ccr2 have been shown to play vital roles in numerous diseases . the movement of monocytes from the blood stream across the vascular endothelium is required for both regular immunological surveillance and inflammatory response . ccl2 inhibits the viral attachment of human immunodeficiency virus ( hiv-1 ) to the ccr2 and ccr5 coreceptors . additionally , the expression of all m1 polarization cytokines and chemokines is promoted by lllt . therefore , lllt may be useful to promote antiviral immunity but may not be a suitable therapy for autoimmune or rheumatoid diseases . considering the importance of m1-polarized macrophages in various disease contexts , especially immunity to intracellular microorganisms and tumors , we examined the effects of different doses of lllt on the expression of m1-polarized macrophages related cytokines and chemokines by using human thp-1 monocytes and provided evidence supporting the effects of lllt on macrophage function . in this study , our results showed that after five days of muscular lesion , the activities of complex ii and succinate dehydrogenase elevated considerably in contrast to the control group . moreover , our results demonstrated that lllt significantly increased the activities of complexes i , ii , iii , and iv and succinate dehydrogenase compared to the muscle injury group without treatment . this study also shed light on the mechanisms of epigenetic regulation by lllt in immune cells . modifications on histones , such as acetylation or trimethylation at h3k4 , h3k36 , and h3k79 , are associated with gene activation . recently , histone modification has become a new target for antiallergy drug development . in this study , lllt induced histone h3 and h4 acetylation and h3k4 trimethylation in the tnf- gene promoter area . lllt also induced histones h3 acetylation in the ip-10 gene promoter region but did not induce acetylation of histone h4 . these results suggest that epigenetic regulation could be one of the important mechanisms by which lllt modulates m1-related cytokine and chemokine expression . in this study , 660 nm lllt appeared to be a potent enhancer of the production of pro - inflammatory cytokines and m1-related chemokines in monocytes . m1-related immunoregulations play important roles in the antiviral and antitumor immunity and the pathogenesis of inflammation in autoimmune diseases . because tnf- , mcp-1 , and ip-10 are important indicators of lllt - induced m1 polarization , lllt may promote anti - viral and anti - tumor immunity but enhance autoimmune and rheumatoid diseases . lllt may be a potent immune - enhancing agent that is suitable for the treatment of allergic diseases but may not be a good therapy for autoimmune and rheumatoid disorders .

low - level laser therapy ( lllt ) has been used in the treatment of radiotherapy - induced oral mucositis and allergic rhinitis . however , the effects of lllt on human monocyte polarization into m1 macrophages are unknown . to evaluate the effects of lllt on m1-related cytokine and chemokine production and elucidate the mechanism , the human monocyte cell line thp-1 was treated with different doses of lllt . the expression of m1-related cytokines and chemokines ( ccl2 , cxcl10 , and tnf- ) was determined by elisa and real - time pcr . lllt - associated histone modifications were examined by chromatin immunoprecipitation ( chip ) assays . mitochondrial involvement in the lllt - induced m1-related cytokine expression was evaluated by quantitative real - time pcr . flow cytometry was used to detect the cell surface markers for monocyte polarization . the results showed that lllt ( 660 nm ) significantly enhanced m1-related cytokine and chemokine expression in mrna and protein levels . mitochondrial copy number and mrna levels of complex i - v protein were increased by lllt ( 1 j / cm2 ) . activation of m1 polarization was concomitant with histone modification at tnf- gene locus and ip-10 gene promoter area . this study indicates that lllt ( 660 nm ) enhanced m1-related cytokine and chemokine expression via mitochondrial biogenesis and histone modification , which may be a potent immune - enhancing agent for the treatment of allergic diseases .

worldwide , the population with diabetes is currently estimated at 366 million and is expected to exceed half a billion by 2030 . foot ulcers are the principal cause of severe complications and hospitalization among patients with diabetes , substantially increasing the costs with this disease . in the united states , the annual cost of foot ulcers is estimated at us$11 billion . in brazil , the population aged 30 years and over with type 2 diabetes is estimated at 6.5 million . among these , roughly 323 000 cases of foot ulcers are reported annually , 97 000 of which require hospitalization . adding to the costs of managing infection , patients with diabetes are confronted with the risk of limb amputation , with rates 30 to 40 times higher than in individuals without the disease . studies have shown the incidence of diabetic foot to be on the order of 3% to 4% , accounting for roughly 11 million patients with this condition in 2014 [ 5 , 6 ] . peripheral neuropathy , ulceration , infection , and peripheral vascular disease are the principal factors for ulcer complications and loss of a lower limb in diabetic patients [ 7 , 8 ] . nonetheless , ambiguity remains as to which factors are most conducive to amputation outcomes and how strongly they affect these events . structured healthcare is one of the most effective approaches to reducing the indicators for diabetic foot amputation , and studies have shown that these can be reduced by as much as 75% . factors such as low socioeconomic status , smoking [ 10 , 11 ] , gender , renal impairment , ischemia , diabetic neuropathy , and high levels of glucose and triglycerides have been reported as importantly associated with the risk of foot amputation . this study evaluated the effect that clinical , biochemical , epidemiological , and patient - behavior - related predictors have on amputation outcomes in patients with diabetic foot . knowledge of these factors and their influence on this outcome is critical to enable multidisciplinary teams to develop management and treatment plans for diabetic patients so as to prevent the need for foot amputation . this cross - sectional study comprised 100 patients with diabetic foot hospitalized at the vascular surgery clinic of the conjunto hospitalar de sorocaba , in sorocaba county , so paulo state , southeastern brazil . inclusion criteria were minimum age of 18 years , diagnosis of diabetes , presence of infected ulcers on a lower limb , and agreement to participate ( expressed by signing a consent form ) . the project was approved by the research ethics committee of the universidade de sorocaba ( opinion 0028/10 ) and complied with the ethical standards laid down in the 1964 declaration of helsinki and its later amendments . the patients responded to a structured questionnaire about their sociodemographic status , knowledge of the disease , previous antibiotic use , and compliance with diabetes treatment . data on the clinical characteristics and health status of patients were collected from medical records . the clinical and laboratory evaluations were performed at the laboratory for diabetes conjunto hospitalar de sorocaba . comorbidities had been evaluated by a group of specialists , based on consensus and guidelines [ 1519 ] . compliance with outpatient treatment for diabetes was evaluated using the morisky test , which consists of four simple questions . sometimes , if you feel worse when you take you medication , do you stop taking it ? the higher the score , the more adherent the patient . given the high prevalence of limb amputation , we estimated prevalence ratios and their respective confidence intervals ( 95% ci ) for the univariate analysis of the relationships between variables and outcomes , using shapiro - wilk test , student 's t - test , or mann - whitney test . the variables with p values of less than 0.25 were selected for multivariate analysis using the cox regression model with robust variance . table 1 shows that age of the patients ( n = 100 ; 32 women , 68 men ) ranged from 31.9 to 89.7 years ( median : 62 years ) , with 55% of patients older than 60 . most patients were male ( 68% ) , caucasian ( 78% ) , poorly educated ( 69% ) , nonsmokers ( 81% ) , and alcoholics ( 84% ) and had type 2 diabetes ( 99% ) . of the total , 22% had been diabetic for less than five years , 24% from five to 10 years , 17% from 10 to 15 years , 16% from 15 and 20 years , and 21% for more than 20 years . in most patients , most had attended annual medical appointments ( 73% ) and , over the past year , had attended more than three appointments ( 67% ) and tested for blood glucose levels ( 86% ) . glucose levels at admission ranged from 4.10 to 28.7 mmol / l ( mean : 12.43 5.03 mmol / l ) . the most frequent chronic complications were neuropathy ( 91% ) , hypertension ( 72% ) , vascular peripheral disease ( 63% ) , retinopathy ( 42% ) , dyslipidemia ( 41% ) , nephropathy ( 26% ) , coronary insufficiency ( 23% ) , and cerebrovascular insufficiency ( 16% ) . on admission , 75% of patients had grade 4 ulcers , while 20% had grade 3 and 5% had grade 2 ulcers . less than half of the patients had undergone a prior conventional , nonsurgical procedure ( debridement ) ( 45% ) or amputation ( 32% ) . for 74% , most , however , had an ulcer of less than 2 cm ( 84% ) , gangrene ( 76% ) , and a neuroischemic diabetic foot ( 86% ) . most patients showed signs of inflammation ( 89% ) and had osteomyelitis ( 52% ) , which was also present with the high incidence of grade 4 ulcers ( 75% ) . compliance with treatment was poor in 72% of patients ( score 2 for 35 individuals , score 3 for 15 , and score 4 for 15 ) , while 27 were considered compliant ( score 0 for 23 patients and score 1 for five ) . no statistically significant differences were observed in the prevalence of diabetic foot amputation with regard to gender , ethnicity , schooling , monthly income , alcohol consumption , or smoking . no statistically significant differences in the prevalence of diabetic foot amputation were detected based on the occurrence of comorbidities . however , 75% of patients with two or three previous hospital admissions for chronic complications required foot amputation , whereas only 52.6% of those with one single admission experienced this outcome ( p = 0.043 ; table 2 ) . table 3 shows that 78.6% of poor compliers ( morisky scores 0 or 1 ) had a foot amputated , whereas only 54.2% of compliant patients ( scores 24 ) did so ( p = 0.012 ) . patients with a history of conservative procedures had a lower prevalence of amputation than those not subjected to this procedure ( p < 0.001 ) . however , previous amputation was unrelated to an amputation outcome ( p = 0.255 ) . also , amputations were more frequent in patients with osteomyelitis than those lacking this condition ( p < 0.001 ; table 4 ) . to identify variables independently associated with progression to amputation , cox multiple regressions ( with robust variance ) the association between ulcer grade ( wagner criteria ) and treatment compliance score ( morisky test ) was statistically significant ( p = 0.014 , chi - squared test ) . the prevalence of gangrene in patients with higher treatment compliance was 68.1% , rising to 92.8% in less compliant individuals ( morisky scores 0 or 1 ; wagner grade 4 ) . therefore , two models were found on multivariate analysis : one using the morisky test ( table 5 ) and the other employing wagner criteria ( table 6 ) . amputation outcomes proved independently associated with previous conservative procedures , previous use of antibiotics , and morisky test scores or wagner criteria ( tables 5 and 6 ) . the risk of foot amputation for patients who had received conservative treatment was 63% lower than for those with a previous amputation ( p < 0.001 ; table 5 ) , while for individuals previously treated with antibiotics the risk of foot amputation was 42% higher than for patients not subjected to this drug therapy ( p = 0.026 ) . considering wagner grades , the risk of foot amputation was 61% lower in individuals who had previously undergone conservative procedures than in those who had not ( p < 0.001 ) , table 6 . among those previously treated with antibiotics , this risk was 36% higher than for those without antibiotic therapy ( p = 0.042 ) . furthermore , for each unit increment in wagner grade , there was a 65% increase in the risk of foot amputation in patients admitted with infectious complications in a lower limb ( p = 0.018 ) . in most subjects ( 81% ) , blood glucose levels ranged from 5.55 to 16.65 mmol / l . glucose levels below 11.09 mmol / l at admission are associated with lower morbidity and mortality , and proper glycemic control is a critical factor for the infection eradication and ulcer healing . chronic hyperglycemia is the most frequent etiological factor for complications of diabetes mellitus [ 2225 ] . neuropathy was reported in 91% of patients , coinciding with published data indicating a high prevalence of neuropathy in diabetic patients hospitalized for foot injuries . retinal impairment and nephropathy are the two most common microvascular complications , both of which were present in the study population ( at 42% and 26% , resp . ) . in patients with diabetes , nephropathy is a marker for generalized vascular disease , and these patients are probably more susceptible to developing peripheral vascular disease . recent studies also suggest that the incidence of diabetic foot ulcers is more frequent in individuals with micro- and macroalbuminuria [ 2830 ] . patients who reported prior use of antibiotics had a 42% higher risk of major amputation than those not receiving antibiotic therapy . previous prolonged use of antibiotics selects for resistant microorganisms , making treatment more difficult and increasing the risk of amputation . the present data suggest an increased risk of amputation in patients less compliant with drug therapy . adherence to the prescribed therapy has led to significant improvements in the health and quality of life of patients with diabetes [ 7 , 3337 ] . compliance with medication is essential in chronic diabetes , improving control of disease progression and attenuating the severity of chronic complications . reinforcement of guidelines on diabetes care and the importance of medication , both of which can increase treatment compliance , are facilitated when patients have more than three medical appointments per year . in the present investigation , patients with a history of antibiotic use had an increased risk of progressing to amputation . each unit increment in ulcer severity ( measured in wagner grades ) increased the risk of amputation . similar results were found in a brazilian study that demonstrated a directly proportional relationship between wagner grade and risk of limb amputation . it is worth noting , however , that the morisky test was originally developed for hypertension but has been used to evaluate drug treatment in patients with diabetes , a feature that may constitute a limitation of the present study . another limitation is that information on previous use of antibiotics was self - reported rather than collected from medical records . studies evaluating the extent of problems related to diabetic foot can provide elements for intervention policies and prevention programs particularly in government - funded healthcare services involving multidisciplinary teams specialized in diabetic foot care , ultimately ensuring improved treatment with more efficient use of resources . the present findings highlight that antimicrobial therapy protocols for outpatients with diabetic foot need reviewing . control of the disease before hospitalization can significantly reduce amputations in patients with diabetic foot . knowledge of these factors and their influence on amputation outcomes is critical to allow multidisciplinary teams to develop management and treatment protocols for patients with diabetes . the present findings show that limb amputation outcomes were strongly lowered by conservative treatment and compliance with diabetes drug therapy . implemented in a preventive manner , these two measures can significantly reduce lower limb amputation in patients with diabetes .

the aim of this study was to identify and quantify risk factors for amputation in diabetic patients hospitalized for foot infections . this cross - sectional study comprised 100 patients with diabetic infectious complications in the lower limbs . the variables investigated were related to diabetes , infection , and treatment compliance . multiple cox regression analysis was performed to identify the variables independently associated with the outcome of amputation . the most prevalent chronic complications were neuropathy and hypertension . most patients presented with a neuroischemic foot ( 86% ) . the morisky test showed that 72% were not compliant with diabetes treatment . regarding patient outcome , 61% progressed to amputation , 14% to debridement , and 9% to revascularization . the results showed a 42% higher risk for progression to amputation in patients with previous use of antimicrobials . also , the amputation risk was 26% higher for those less compliant with diabetes treatment . an increase of one point in the wagner ulcer classification criteria corresponded to a 65% increase in the risk of amputation . undergoing conservative , nonsurgical procedures prior to admission provided a 63% reduction in the risk of amputation . knowledge of these factors is critical to enable multidisciplinary teams to develop treatment plans for these patients so as to prevent the need for amputation .

falls are both common and debilitating in patients with parkinson 's disease ( pd ) . they have devastating consequences for affected individuals , often leading to injuries , secondary immobility , and reduced quality of life . survival is reduced once falls have occurred , although a recent report failed to identify a relationship between falls and mortality risk in pd . falls are also important for the public health system , as the costs associated with falls and fall - related injuries are enormous . a prospective 20-year follow - up of 136 patients with newly diagnosed pd confirmed the high prevalence of falls ( 87% ) and resulting fractures ( 35% ) . for the management of environmental factors such as slippery floors , loose rugs , poor lighting , or inadequate footwear may also contribute . there is an increasing awareness that freezing of gait - a sudden and episodically occurring inability to generate effective forward stepping movements - is one of the leading causes of falls , presumably because patients are caught by surprise due to the often unexpected nature of freezing events . recent work has underscored the additional importance of cognitive impairment as a key factor contributing to both falls and freezing ; falls are an issue in demented patients in particular . possible explanations for this link include more prominent dopaminergic denervation of the caudate nucleus or more generalized cholinergic dysfunction . preventing falls is generally perceived as being difficult , but is not impossible . given the complex multifactorial nature of falls and the experience in elderly non - parkinsonian populations , a multidisciplinary approach appears preferable , but for patients with pd this strategy is not yet backed by scientific evidence . crucial elements in the therapeutic approach include optimizing pharmacotherapy - increasing pd medication for dopa - sensitive signs , and stopping sedative drugs - and tailored physiotherapy , based on evidence - based practice guidelines . here , we highlight a few important new developments in this field . the quest should not stop when one causative factor has been found because falls are typically multifactorial in origin . a recent prospective study in 101 patients with early - stage pd assessed the best prediction was reached by combining disease - specific measures ( such as pd severity and freezing of gait severity ) with balance measures ( such as the occurrence of symptomatic orthostatic hypotension , the tinetti total score , and the extent of postural anterior - posterior sway ) . however , even this combination attained a sensitivity and specificity for predicting falls of only around 80% . including cognitive measures that are more specific may further improve these predictive scores , but this remains to be examined . particular emphasis should be placed on testing for freezing of gait - using a series of provoking tests , including rapid 360 degree turns on the spot - and for frontal executive dysfunction . specific attention should be paid to fear of renewed falling as this is common in pd . fear of falling is not only a risk factor for renewed falls , it may also lead to secondary immobilization with all its related adverse consequences . most balance deficits are resistant to dopaminergic medication . however , gait problems - including freezing of gait - can improve with dopaminergic medication , although doses that are higher or more frequent than those typically needed to increase hand functioning may be required . recent work points to a possible role for cholinesterase inhibitors in the treatment of gait and balance deficits , both in pd and in alzheimer 's disease , given that many axial motor deficits may result from misbalance between central cholinergic and dopaminergic systems . it has become clear that stereotactic deep brain surgery should be reserved for patients whose gait and balance deficits are still levodopa - responsive pre - operatively . several studies are comparing bilateral stimulation of two different targets , namely the subthalamic nucleus ( stn ) and the internal globus pallidus . the initial results indicate that both approaches are effective in providing short - term relief of motor symptoms , but one study suggested internal globus pallidus stimulation may offer better long - term outcomes for gait and balance deficits . this difference was not evident in the largest study , although falls after a 2-year follow - up tended to be more common after stn stimulation , but this requires more study . in particular , stn stimulation has been associated with a worsening of gait and balance deficits , not only in the immediate postoperative phase , but also several years after follow - up . adjusting the stimulation parameters ( e.g. , markedly lowering the stimulation frequency ) may be helpful in such patients . the pedunculopontine nucleus has been studied as a promising new target , specifically for gait and balance deficits , but so far the results have not been very impressive . the evidence - based guidelines on physiotherapy for pd were recently updated , providing a menu of treatment modalities to improve mobility and reduce falls . examples of evidence - based physiotherapy strategies include cueing techniques , cognitive movement strategies , and the use of exercise . rhythmic auditory or visual cues can improve gait in pd , including freezing of gait . new inventive cueing approaches include walking glasses with different patterns of visual and auditory stimulation and mental singing while walking . another promising approach , especially for pd patients with freezing of gait , is the use of cycling , the skill for which can be remarkably preserved in some patients . evidence based mainly on the effects of cueing on laboratory measures of gait and balance remains ; the challenge is to ascertain an enduring clinical improvement in daily life , including a reduction of falls . fears that cues might worsen the tendency to fall - for example , by increasing overall mobility - have not been substantiated . a systematic review concluded that exercise in patients with pd results in improvement in postural stability and balance task performance . however , power and quality of exercise studies have hitherto been insufficient to make definitive recommendations . future randomized controlled trials will look into the ( cost ) effectiveness of exercise to reduce falls . there is a growing body of literature on the use of treadmill training for gait rehabilitation in patients with neurologic disorders in general and for patients with pd in particular . a recent cochrane review concluded that treadmill training may help to improve gait akinesia in pd , but the effect on falls remains unclear . another interesting new development is the use of robotics , which can assist pd patients in making medio - lateral anticipatory weight shifts in preparation for taking a step . the initial results are promising , and such new techniques now need to be implemented in situations that are more realistic to evaluate the clinical merits of these techniques in relation to everyday gait performance and falls . delivering such specific physiotherapy interventions to patients with pd a large cluster - randomized trial showed that a community - based professional network with trained expert physiotherapists improved the quality of physiotherapy care and reduced health care costs , but without health benefits for patients . the quest should not stop when one causative factor has been found because falls are typically multifactorial in origin . a recent prospective study in 101 patients with early - stage pd assessed the best prediction was reached by combining disease - specific measures ( such as pd severity and freezing of gait severity ) with balance measures ( such as the occurrence of symptomatic orthostatic hypotension , the tinetti total score , and the extent of postural anterior - posterior sway ) . however , even this combination attained a sensitivity and specificity for predicting falls of only around 80% . including cognitive measures that are more specific may further improve these predictive scores , but this remains to be examined . particular emphasis should be placed on testing for freezing of gait - using a series of provoking tests , including rapid 360 degree turns on the spot - and for frontal executive dysfunction . specific attention should be paid to fear of renewed falling as this is common in pd . fear of falling is not only a risk factor for renewed falls , it may also lead to secondary immobilization with all its related adverse consequences . most balance deficits are resistant to dopaminergic medication . however , gait problems - including freezing of gait - can improve with dopaminergic medication , although doses that are higher or more frequent than those typically needed to increase hand functioning may be required . recent work points to a possible role for cholinesterase inhibitors in the treatment of gait and balance deficits , both in pd and in alzheimer 's disease , given that many axial motor deficits may result from misbalance between central cholinergic and dopaminergic systems . it has become clear that stereotactic deep brain surgery should be reserved for patients whose gait and balance deficits are still levodopa - responsive pre - operatively . several studies are comparing bilateral stimulation of two different targets , namely the subthalamic nucleus ( stn ) and the internal globus pallidus . the initial results indicate that both approaches are effective in providing short - term relief of motor symptoms , but one study suggested internal globus pallidus stimulation may offer better long - term outcomes for gait and balance deficits . this difference was not evident in the largest study , although falls after a 2-year follow - up tended to be more common after stn stimulation , but this requires more study . in particular , stn stimulation has been associated with a worsening of gait and balance deficits , not only in the immediate postoperative phase , but also several years after follow - up . adjusting the stimulation parameters ( e.g. , markedly lowering the stimulation frequency ) may be helpful in such patients . the pedunculopontine nucleus has been studied as a promising new target , specifically for gait and balance deficits , but so far the results have not been very impressive . the evidence - based guidelines on physiotherapy for pd were recently updated , providing a menu of treatment modalities to improve mobility and reduce falls . examples of evidence - based physiotherapy strategies include cueing techniques , cognitive movement strategies , and the use of exercise . rhythmic auditory or visual cues can improve gait in pd , including freezing of gait . new inventive cueing approaches include walking glasses with different patterns of visual and auditory stimulation and mental singing while walking . another promising approach , especially for pd patients with freezing of gait , is the use of cycling , the skill for which can be remarkably preserved in some patients . evidence based mainly on the effects of cueing on laboratory measures of gait and balance remains ; the challenge is to ascertain an enduring clinical improvement in daily life , including a reduction of falls . fears that cues might worsen the tendency to fall - for example , by increasing overall mobility - have not been substantiated . a systematic review concluded that exercise in patients with pd results in improvement in postural stability and balance task performance . however , power and quality of exercise studies have hitherto been insufficient to make definitive recommendations . future randomized controlled trials will look into the ( cost ) effectiveness of exercise to reduce falls . there is a growing body of literature on the use of treadmill training for gait rehabilitation in patients with neurologic disorders in general and for patients with pd in particular . a recent cochrane review concluded that treadmill training may help to improve gait akinesia in pd , but the effect on falls remains unclear . another interesting new development is the use of robotics , which can assist pd patients in making medio - lateral anticipatory weight shifts in preparation for taking a step . the initial results are promising , and such new techniques now need to be implemented in situations that are more realistic to evaluate the clinical merits of these techniques in relation to everyday gait performance and falls . delivering such specific physiotherapy interventions to patients with pd a large cluster - randomized trial showed that a community - based professional network with trained expert physiotherapists improved the quality of physiotherapy care and reduced health care costs , but without health benefits for patients . asking about falls and their impact on daily functioning should be a standard part of the evaluation of patients with pd . while awaiting further evidence , neurologists should consider installing a multidisciplinary team approach to tackle the vexing problem of falls in patients with pd . management involves a systematic search for risk factors for falling , and a subsequent multifactorial approach aimed at eliminating or alleviating all patient - related and environmental risk factors for falling . apart from optimizing dopaminergic medication , cholinergic therapies are now beginning to enter the field of play as well . fear of falling must be addressed , and immobilization must be avoided as long as independent movements can still be made reasonably safely . the multidisciplinary team should ideally consist of trained and experienced professionals who treat large numbers of patients . using this integrated approach , the goal should be to at least reduce falls or perhaps prevent them altogether , restore mobility and independence , and thereby help to maintain the quality of life for patients with pd .

falls are among the most incapacitating features of parkinson 's disease . prevention of falls requires a systematic assessment of all contributing factors ( with emphasis on freezing of gait and frontal executive dysfunction ) , and a multidisciplinary treatment approach tailored to the specific pathophysiology of falls for each individual patient .

broomrapes ( orobanche spp . ) are fully parasitic flowering plants that lack chlorophyll ; hence they penetrate roots of susceptible hosts , removing water , minerals and sugars . ( egyptian broomrape ) attacks dicotyledonous crops cultivated around the mediterranean , causing massive yield losses . broomrape attached to the host by means of tubercle , a swollen organ which may be simple or composite . with the exception of the case of transgenic target - site , herbicide - resistant host plants , meant to be a temporary measure until other effective control means are found . orobanche generally maintains a close relationship with the host and so it is unreasonable to attack it using herbicides because the latter may adversely affect the nontarget host . despite research on orobanche spp . for over three decades , yield losses still abound because there is no sustainable method for controlling the parasite . fusarium compactum ( wollenw . ) the inundative biocontrol approach , with repeated applications of the biocontrol agent , generates a state of equilibrium with a very low level of weed density as a result of the artificial inoculation of the biocontrol agent but the fungi are not sufficiently virulent for field release , regardless of the amount used . a series of experiments were conducted using f. compactum , a biological control agent that infects orobanche without affecting the roots of tomato . pectins are complex polysaccharides and are one of the major components of the plant cell wall of dicotyledonous plants , where they control the ionic status , cell expansion , and separation . some cellulase producing fungi includes acremonium sp , aspergillus spp and fusarium sp , , trichoderma spp . [ 6 , 7 ] , zymomonas , and mutant penicillium . in this paper , a hydrolytic enzyme plays an important role in the pathogenicity of plants by facilitating fungal penetration through the host cell wall [ 10 , 11 ] . experiments using mycoherbicidal organisms plus pectinase ( ec 3.2.1.15 ) or cellulase ( ec 3.2.1.4 ) indicate that enzyme enhances the weed control of pathogenic fungi . here , pectinolytic and cellulolytic enzymes have been used to enhance the virulence of f. compactum on tomato plants infested with broomrape . a semiaxenic polyethylene bag system was used that allowed easy visual observation of the fungal infection of the tubercles . this study reports that the addition of pectinase and cellulase alone or in mixtures enhanced the virulence of f. compactum on broomrape . f. compactum was cultured on potato glucose agar ( pda , pronadisa ) in petri dishes incubated at 25c . subcultures were grown in 100 ml potato glucose broth ( pdb , pronadisa ) in 250 ml erlenmeyer flasks . the cultures were left on a rotary shaker ( brunswick scientific ) at 150 rpm for 48 h. f. compactum mycelia were harvested on miracloth ( calbiochem , la jolla , ca ) , rinsed with distilled water to remove remaining spores and excess medium , and harvested by vacuum filtration . the washed hyphae were chopped at 6,000 rpm for 2 min with a homogenizer ( ika t18 basic ultra - turrax usa ) , resuspended in sterile water , and the propagule concentrations of chopped mycelia were estimated after serial dilution and plating . surface sterilizing seeds ensure that the fungal infection on the seeds is from deliberate infection . thus , about 13 mg seeds in small bags formed of miracloth were wetted and surface sterilized in 80% ethanol for 1 min and in a mixture of 1% sodium hypochlorite in 0.01% aqueous tween 20 for 10 min . tomato transplant plugs at the two to three leaf stages in speedling insert trays were purchased from hishtil inc , ashkelon , israel . the pathogenicity of f. compactum was tested in the semiaxenic polyethylene bag system ; briefly about 13 mg of dry surface - disinfected seeds ( up to 1,500 ) were sprinkled on wet whatman gf / a glass - fiber sheets ( whatman int . the broomrape seeds were conditioned for a 7 d period on the wet glass - fiber sheets . a tomato seedling with three or four expanded leaves and washed roots was fixed inside each polyethylene bag containing conditioned broomrape seeds . the plant roots in each bag were moistened by capillary action with forty ml of modified hoagland 's solution in the base of each bag . modified hoagland 's solution fourteen - hour photoperiods were provided by a photosynthetically active light intensity of 65 e / m / s ( li - cor , inc . , photometer , model li-188b ) produced by six 40 w cool white fluorescent tubes suspended 35 cm above the benches . two ml of 5-g ml gr-24 ( synthetic germination stimulant ) were added to each bag with a pipette to augment the tomato root exudates . the broomrape seeds germinated , attached to tomato roots , and formed small tubercles during the following 2 weeks . allocation of treatment to orobanche - infested tomato plants were in such a way that the tubercle numbers and sizes were almost the same . the virulence of the fungus was determined with and without various concentrations of either pectinase ( ex fungal origin , 1.1 u mg , sigma ) and/or cellulase ( cellulysin , ex trichoderma viride , 10 u mg calbiochem - behring corp . , la jolla , ca 92037 ) . the effect of cellulase concentration ( 10 to 20 u ml ) on tubercle death was similarly determined at a constant inoculum level . thereafter , the virulence of the fungus with the two enzymes was determined in combination at varying ratios . control plants were mock - inoculated with either sterile distilled water containing 0.01% tween 20 or 4 to 20 u ml of single or combined enzyme preparations but without fungal mycelia . tubercles on the tomato plants infested with broomrape were counted and the diameters were measured with a ruler , with the assumption that the tubercles are perfectly spherical . the treatments consisted of f. compactum or f. compactum plus cellulase ( 4 to 20 u ml ) . one ml of aqueous fungal cellulase samples ( 10 units mg ) , freshly made for each experiment as a solution containing 10 u ml , and was checked for pectinase activity . pectinase activity was measured in a reaction mixture consisting of 533 l of 1% polygalacturonic acid ( pectin ) , 400 l of 50 mm sodium acetate buffer at ph 5.0 and 67 l of the cellulase . the mixture was incubated at 37c for 10 min as outlined by tonukari et al . . a 100-l aliquot of the reaction mixture was mixed with 1.5 ml of 1% 4-hydroxybenzhydrazide ( fluka , fluorescence grade ) in 0.5 m naoh . the mixture was heated at 100c for 10 min , and cooled on ice water . absorbance was measured at 410 nm against the zero time blank as outlined by lever , using a spectrophotometer with a versamax tunable microplate reader . pectinase activity of the cellulase was calculated from a standard curve prepared with a d - galacturonic acid ( sigma ) . one unit of enzyme forms 1 mol of galacturonic acid from polygalacturonic acid in 1 min under the conditions of the assay . broomrape tubercle deaths were recorded at 24 h intervals after fungal inoculation , for 8 to 11 d. tubercles were visually scored as healthy ( translucent , dense , and intact ) , infected ( diseased ) , or dead ( black and soft ) . the levels of infection caused by f. compactum plus pectinase in both experiments were always better than those achieved by the fungus without pectinase ( figures 1(a ) and 1(b ) ) . the numbers of broomrape tubercles infected continuously increased over time throughout the period of observation . this was not only due to inoculum buildup in the tomato root system but also to the enzyme action . this study wanted to ascertain whether the added pectinase would have an effect on suboptimal f. compactum inoculum . therefore , subthreshold levels of inoculum ( 10 propagules ml ) were investigated in the presence of pectinase . f. compactum alone killed 30% of broomrape tubercles at the suboptimal inoculum levels ( figure 1(a ) ) . at the lowest inoculation density , f. compactum ( 3.84 10 propagules ml ) combined with 11 u ml pectinase killed more broomrape tubercles than the f. compactum alone ( figures 1(a ) and 1(b ) ) . the killing of broomrape tubercles indicated that pectinase enhanced the virulence of f. compactum ( figure 2 ) . since both enzymes separately enhanced the severity of tubercle infection , it was ascertained whether the pathogenicity of f. compactum ( 1.4 10 propagules ml ) on broomrape tubercles could be synergistic through the joint action of the enzymes ( 10 u ml of each enzyme ) ( figure 3 ) . the broomrape tubercles on the tomato roots were large and healthy in the absence of fungal treatment but , at times , a few naturally brown tubercles could be seen ( figure 3(a ) ) . f. compactum alone infected all the inoculated tubercles but did not kill any significant number ( figure 3(b ) ) . infested tomato roots that were inoculated with mycelia plus pectinase ( 20 u ml ) ( figure 3(c ) ) had over 50% tubercles dead one week after treatment . those inoculated with mycelia plus cellulase ( 20 u ml ) ( figure 3(d ) ) had above 60% mortality . a mixture of both enzymes with f. compactum increased fungal infection of broomrape by f. compactum ( figure 3(e ) ) . the response of the infected tubercles varied from 100% kill to mild infection , depending on tubercle size . mycelia plus cellulase ( 20 u ml ) mix provoked about the same level of infection as mycelia in solution with cellulase and pectinase ( 10 u ml of each enzyme ) ( figure 3(f ) ) . it is logical to think collective mixing of pectinase and cellulase to f. compactum will effectively enhance the fungal biocontrol potential : thus , it was tested . at various enzyme compositions , the f. compactum treatment ( 1.05 10 propagules ml ) that caused only a hypersensitive reaction ( 9% death ) on the tubercles caused about 35 to 85% tubercle death when the tubercles were treated with mixtures that contained mycelia , pectinase , and cellulase in various ratios ( figure 4 ) . higher tubercle infection by f. compactum was observed with a high ratio of cellulase to pectinase . beginning from day 4 after f. compactum inoculation on broomrape infested tomato plants ; statistically significant differences among treatments were observed ( figure 4 ) . broomrape infested roots coinoculated with chopped mycelia plus pectinase and cellulase had substantial tubercle infection and subsequent large numbers of dead tubercles ( 3585% ) ( figure 4 ) . this system ensures easy examination of seedling attachment to the tomato roots and easy observation of tubercle infection in the course of the experiment . the activity catalyzed by an enzyme is a measure of the amount of enzyme present . values pooled from three sets of experiment showed that in a 1 mg ( 10 u mg ) cellulase preparation , 0.055 mg pectinase ( 1.1 u mg ) is present . this means the 10 u cellulase has a 0.06 u of detectable pectinase . the basis for this study stems from previous studies which examines single enzyme - assisted effect on fungi pathogenicity . the orobanche were at three main phases of their life cycle ( seed , germination , and parasitic phases ) at fungal inoculation . tubercles are usually present at the germination phase and later become parasitic . in this study , in apparently healthy tubercles , it may be possible to find diseased tubercles ( as depicted in figure 2 ) ; such tubercles deaths were induced by accidental infestation . in total , these results demonstrate that exogenous pectinase as well as cellulase can contribute to pathogenicity . the mycelia plus enzyme mix killed some broomrape tubercles , thus they could not form new seeds to replenish the orobanche seed bank . the rationale of approach is also applicable to soil grown tubercles where the presence of enzyme may be exogenous . this is well taken care of in nature because the tubercles are borne on the roots and roots are mostly below the soil surface . the temperature in the growth chamber was kept at 25c to induce infection by f. compactum . as demonstrated in this study , descriptions of actions of cell wall degrading enzymes are given by wanjiru et al . . f. compactum can infect the tubercle by degrading the cell wall components and invading the tissues and cells . pectinolytic and cellulolytic activities of the enzymes ( in this case of fungal origin ) result in a loss of structural integrity in the tubercle and characteristic damage . the enzyme substrate range and mechanism of action could partly explain the interaction between f. compactum and the enzymes on broomrape tubercles . the pathogenicity of f. compactum plus the enzyme mix observed could rarely be observed without pectinase and cellulase at the inoculum level used . besides , neither pectinase nor cellulase was ordinarily able to injure and kill broomrape at the concentration used ( max . 20 u ml ) , demonstrating that the broomrape tubercle infection and death observed are due to the addition of a mycoherbicidal organism . the role of pectinase and cellulase in the degradation of cell wall material as observed in this study corresponds with the reports of many authors [ 10 , 11 , 18 , 19 ] . in the previous paper , the results reported by sasaki and nagayama showed that the fungi pathogenicity was not always proportional to the enzyme activity . it is known that the level of -glucosidase in an enzyme preparation may affect the result of cellulase assays , for example , for the estimation of activities of extracellular cellulase enzymes produced by trichoderma . as pointed out by kumpoun and motomura , the pectinase used in their study is mainly pectinase , but some glycosidases were also present . the presence of -glucosidase or other enzymes , such as cellobiose phosphorylase , which are required for cellobiose metabolism and to enhance cellulose hydrolysis but which are not , strictly speaking , cellulases or rhamnosidase and -glucosidase activities in pectinase could further complicates research findings . care must be taken in interpreting the results of pathogenicity tests as the enzyme preparation may contain a battery of enzymes . this result may suggest the need to study the presence of other enzymes in an enzyme of interest even if the enzyme of interest is from a commercial source . contrary to some of the findings associated with enhanced f. compactum infection on broomrape , f. oxysporum pathogenicity on broomrape was not enhanced by pectinase and/or cellulase . thus , although f. oxysporum and f. compactum belong to the same genus , they may have different mycoherbicidal mechanisms . mycelia of f. compactum did not penetrate nor show apparent damage to the tomato roots as also observed in this study . in conclusion , pectinolytic and cellulolytic activities are widely exhibited by bacteria and fungi . the enzymatic activities can predispose broomrape tubercles to infection by fungi , in this case , f. compactum . the latter fact adds to the commercial value of f. compactum as a potential mycoherbicide when sufficiently virulent .

the use of enzyme could facilitate pathogen penetration into plant host . here the combination of cellulase and pectinase was ascertained on the pathogenicity of f. compactum ( 1.4 106 propagules ml1 ) on broomrape tubercles . f. compactum alone infected all the inoculated tubercles but did not kill any significant number . infested tomato roots that were inoculated with mycelia plus pectinase ( 20 u ml1 ) had over 50% tubercles dead one week after treatment . those inoculated with mycelia plus cellulase ( 20 u ml1 ) had above 60% mortality . mixtures of mycelial plus the two enzymes ( 10 u ml1 of each enzyme ) showed synergy . the activity catalyzed by an enzyme is a measure of the amount of enzyme present . it was shown that , in a 1 mg ( 10 u mg1 ) cellulase used , 0.055 mg pectinase ( 1.1 u mg1 ) is present . this explains why mycelial plus cellulase mix contends with mycelial plus the two enzymes .

acute kidney injury ( aki ) , defined as an abrupt drop of renal function within a short period , is a frequent and serious complication in the intensive care unit ( icu ) or after surgery , with an incidence of 7.7%42% in patients with previous normal renal function.1,2 aki or even a minor increase in serum creatinine level from baseline was independently associated with increased length of hospitalization , health care costs , cardiovascular events , and mortality.3,4 although there have been many clinical studies on the protection of kidney function in patients with critical illness or perioperative care , such as the administration of n - acetylcysteine , atrial natriuretic peptide , and fenoldopam , the results of such interventions are somewhat contradictory or unproven.5 consequently , it is paramount that more attention should be paid to explore effective preventative and therapeutic strategies for the management of aki . erythropoietin ( epo ) , a 30-kda glycoprotein hormone , is produced by the kidney to regulate the hematopoiesis in bone marrow , and recombinant human epo has been widely used in the treatment of anemia , especially in end - stage renal disease and certain hematologic diseases.6 interestingly , there is considerable evidence indicating that epo acts as a novel renoprotective agent against ischemic , toxic , and septic aki in animal experiments by reducing apoptosis , stimulating cell proliferation and eliciting its antioxidative and anti - inflammatory functions.7,8 recently , a few randomized controlled trials ( rcts ) analyzed the role of epo to prevent aki in patients within the icu or after surgery who were at high risk of aki.918 however , the results from these trials were inconsistent , partly because they involved single - site studies with small - scale samples . therefore , we conducted a systematic review and meta - analysis of rcts to determine whether the use of epo in patients with critical illness or perioperative care could ameliorate the incidence of aki and assess its adverse event . this systematic review and meta - analysis was conducted according to the preferred reporting items for systematic reviews and meta - analyses ( prisma ) statement recommendations.19 a comprehensive search was conducted in medline ( through ovid ) , embase ( through ovid ) , the cochrane central registry of controlled trials , and the web of science from inception to october 2014 . medical subject headings , entry terms , and text word searches included the following terms : critical illness , critical care , intensive care , icu , severely ill , perioperative care , perioperative period , erythropoietin , epoetin , epo , erythropoiesis stimulating protein , darbepoetin , acute kidney injury , acute renal injury , acute renal insufficiency , acute kidney insufficiency , acute renal failure , acute kidney failure , acute tubular necrosis , aki , arf , and atn . there was no restriction on language or publication date . in addition , other potentially relevant studies were searched from the clinical trials database ( http://clinicaltrials.gov/ ) for completed trials and the references cited in the retrieved articles and pertinent reviews . all titles , abstracts , and full articles were independently searched and evaluated using predesigned inclusion and exclusion criteria by 2 investigators ( c.z . and z.c.l . ) . any discrepancies were resolved by consensus with a third investigator ( q.m.l . ) if necessary , which was infrequent . studies were included when the following inclusion criteria were met : ( 1 ) rcts , ( 2 ) adult patients ( age 18 years ) with critical illness or perioperative care , ( 3 ) use of epo for prevention at least in 1 treatment group , ( 4 ) control group receiving placebo or usual treatment , ( 5 ) reported incidences of aki in both groups , and ( 6 ) for more than 1 publication on the same trial , data from the most recent or complete report were used . exclusion criteria were as follows : ( 1 ) nonrandomized or pseudo - randomized design , retrospective study , case report , and case series ; ( 2 ) enrolled participants undergoing chronic dialysis therapy , nephrectomy , or transplant surgery ( heart , liver , or kidney ) due to their complex situations ; ( 3 ) lack of a control group ; ( 4 ) studies not addressing the target outcome as mentioned above ; and ( 5 ) use of epo as a treatment agent after the occurrence of aki . two investigators ( q.m.l . and x.x . ) independently extracted data from all eligible trials and assessed the risk of bias . data included the first author , publication year , nation of origin , study participants , sample size , whether epo was used previously , mean age , proportions of male patients , hypertension , and diabetes mellitus , mean baseline hemoglobin and serum creatinine levels , mean blood transfusion volume , treatment regimens of the epo - based intervention and control groups , definition of aki , and outcomes measured . the primary outcome was the incidence of aki , the secondary outcomes included dialysis requirement , 30-day mortality , and the adverse events . when the study had several dosage intervention arms,14 all epo intervention arms were combined as one arm by weighted means . in the case of missing or incomplete data , the corresponding author of the original trial was contacted by e - mail for additional information . the risk of bias in the eligible trials was assessed according to the cochrane collaboration tool ( version 5.1.0),20 which included 7 items : random sequence generation , allocation concealment , blinding of participants and personnel , blinding of outcome assessment , incomplete outcome data , selective reporting , and other bias . in each item , an answer of low risk of bias suggested sufficient and correct information , high risk of bias indicated that the item was reported incorrectly , and unclear risk of bias meant insufficient or unmentioned details for judgment . for dichotomous outcomes ( the incidence of aki , dialysis requirement , and mortality ) , data were pooled as risk ratio ( rr ) with 95% confidence interval ( ci ) . the between - study heterogeneity was quantified by cochran 's q - statistic and the inconsistency index ( i ) . if there was significant heterogeneity among studies ( pq - statistic < 0.10 and i > 50% ) , the random effect model ( dersimonian and laird method ) was adopted to pool the results ; otherwise , the fixed effect model ( mantel - haenszel method ) was used . subgroup analysis was performed based on ( 1 ) entirely perioperative care , ( 2 ) no use of epo previously , ( 3 ) at least 2 doses of epo , and ( 4 ) patients at high risk for aki according to each study . sensitivity analysis was conducted to assess the influence of individual studies on the pooled estimate of effects by withdrawing 1 study at a time . an asymmetric funnel plot and pegger 's test less than 0.05 indicated a significant publication bias . the assessment for the risk of bias all statistical analyses were conducted using the stata / se 12.0 software ( stata corporation , college station , tx ) . a p value less than 0.05 by a 2-sided test was considered to be statistically significant . a comprehensive search was conducted in medline ( through ovid ) , embase ( through ovid ) , the cochrane central registry of controlled trials , and the web of science from inception to october 2014 . medical subject headings , entry terms , and text word searches included the following terms : critical illness , critical care , intensive care , icu , severely ill , perioperative care , perioperative period , erythropoietin , epoetin , epo , erythropoiesis stimulating protein , darbepoetin , acute kidney injury , acute renal injury , acute renal insufficiency , acute kidney insufficiency , acute renal failure , acute kidney failure , acute tubular necrosis , aki , arf , and atn . there was no restriction on language or publication date . in addition , other potentially relevant studies were searched from the clinical trials database ( http://clinicaltrials.gov/ ) for completed trials and the references cited in the retrieved articles and pertinent reviews . all titles , abstracts , and full articles were independently searched and evaluated using predesigned inclusion and exclusion criteria by 2 investigators ( c.z . and z.c.l . ) . any discrepancies were resolved by consensus with a third investigator ( q.m.l . ) if necessary , which was infrequent . studies were included when the following inclusion criteria were met : ( 1 ) rcts , ( 2 ) adult patients ( age 18 years ) with critical illness or perioperative care , ( 3 ) use of epo for prevention at least in 1 treatment group , ( 4 ) control group receiving placebo or usual treatment , ( 5 ) reported incidences of aki in both groups , and ( 6 ) for more than 1 publication on the same trial , data from the most recent or complete report were used . exclusion criteria were as follows : ( 1 ) nonrandomized or pseudo - randomized design , retrospective study , case report , and case series ; ( 2 ) enrolled participants undergoing chronic dialysis therapy , nephrectomy , or transplant surgery ( heart , liver , or kidney ) due to their complex situations ; ( 3 ) lack of a control group ; ( 4 ) studies not addressing the target outcome as mentioned above ; and ( 5 ) use of epo as a treatment agent after the occurrence of aki . two investigators ( q.m.l . and x.x . ) independently extracted data from all eligible trials and assessed the risk of bias . data included the first author , publication year , nation of origin , study participants , sample size , whether epo was used previously , mean age , proportions of male patients , hypertension , and diabetes mellitus , mean baseline hemoglobin and serum creatinine levels , mean blood transfusion volume , treatment regimens of the epo - based intervention and control groups , definition of aki , and outcomes measured . the primary outcome was the incidence of aki , the secondary outcomes included dialysis requirement , 30-day mortality , and the adverse events . when the study had several dosage intervention arms,14 all epo intervention arms were combined as one arm by weighted means . in the case of missing or incomplete data , the corresponding author of the original trial was contacted by e - mail for additional information . the risk of bias in the eligible trials was assessed according to the cochrane collaboration tool ( version 5.1.0),20 which included 7 items : random sequence generation , allocation concealment , blinding of participants and personnel , blinding of outcome assessment , incomplete outcome data , selective reporting , and other bias . in each item , an answer of low risk of bias suggested sufficient and correct information , high risk of bias indicated that the item was reported incorrectly , and unclear risk of bias meant insufficient or unmentioned details for judgment . for dichotomous outcomes ( the incidence of aki , dialysis requirement , and mortality ) , data were pooled as risk ratio ( rr ) with 95% confidence interval ( ci ) . the between - study heterogeneity was quantified by cochran 's q - statistic and the inconsistency index ( i ) . if there was significant heterogeneity among studies ( pq - statistic < 0.10 and i > 50% ) , the random effect model ( dersimonian and laird method ) was adopted to pool the results ; otherwise , the fixed effect model ( mantel - haenszel method ) was used . subgroup analysis was performed based on ( 1 ) entirely perioperative care , ( 2 ) no use of epo previously , ( 3 ) at least 2 doses of epo , and ( 4 ) patients at high risk for aki according to each study . sensitivity analysis was conducted to assess the influence of individual studies on the pooled estimate of effects by withdrawing 1 study at a time . an asymmetric funnel plot and pegger 's test less than 0.05 indicated a significant publication bias . the assessment for the risk of bias was performed with review manager software ( version 5.3 from http://tech.cochrane.org/revman ) . all statistical analyses were conducted using the stata / se 12.0 software ( stata corporation , college station , tx ) . a p value less than 0.05 by a 2-sided test was considered to be statistically significant . the initial search yielded 615 citations , of which 72 were duplicate studies that were excluded . after reviewing the titles and abstracts of 543 citations , 516 articles were removed because of irrelevant content . upon review of the full text of 27 articles , ten eligible rcts with 2759 participants were identified for this meta - analysis.918 flow diagram of article selection approach . the included studies spanned from 2002 to 2014 , and with the exception of 2 articles,9,10 the sample size of all other studies was relatively small ( 63108 participants ) . four trials were conducted in korea,12,13,16,17 2 in the united states,9,10 and the others in new zealand,11 switzerland,14 thailand,15 and sweden.18 napolitano et al10 reanalyzed the data from critically ill trauma patients in epo-2 trial,9 which had been included in this meta - analysis , so only the part of epo-3 trial was included in this analysis . the intention to treat of participants in 1 study included aki patients on randomization,11 and for the objective of this meta - analysis , the data of the subgroup not aki on randomization were used in this analysis . one study13 was the follow - up of a previous trial21 ; therefore , the incidence of aki was extracted from the former , and the baseline data were extracted from the latter . all studies enrolled participants from single - site center except 3.911 with respect to the participants setting , 8 studies were performed in perioperative period , 6 of which were conducted in patients with elective cardiac surgery,1216,18 one assessed patients undergoing thoracic aorta surgery with hypothermic cardiac arrest,17 and the rest one partly included patients with scheduled cardiothoracic surgery.11 baseline clinical characteristics of included studies six studies excluded patients who used epo previously,9,10,13,15,17,18 whereas other studies did not specify this issue . in 3 of the 10 studies , a high risk for developing aki , the definitions of which were not the same , was included in the enrollment criteria.11,14,16 in 8 studies , baseline end - stage renal disease or dialysis was set as a compulsory exclusion criterion.913,15,16,18 when reported , mean baseline hemoglobin levels ranged from 9.3 to 13.1 g / dl,9,10,1215,18 and mean baseline serum creatinine levels varied from 0.92 to 1.35 mg / dl.1316,18 the type of erythropoiesis - stimulating agent used in all of the intervention groups was epo - alpha or -beta , but not darbepoietin . the one - time epo dosage was either fixed as 20,000 units or 40,000 units in 3 studies9,10,14 or was based on participant weight ranging from 100 units / kg to 500 units / kg in the other 7 studies . the participants in 6 studies received only a single administration of epo1214,1618 ; however , participants received at least 2 doses in the other studies . two studies provided supplementary iron therapy to both the intervention and control groups,9,10 and 1 study provided an iron sucrose supplement only to the intervention group.12 there was considerable variation in the definition of aki across these studies , which was not clear in 2 studies.9,10 all ten studies reported randomization , but 7 studies described the methods of randomization,912,14,16,18 and only 4 studies showed the details of concealed allocation.11,13,15,18 all studies reported double blinding and no or few missing outcome data with the reason . eight studies provided the clinical trial registration number online with a low risk of bias in selective outcome reporting.10,11,1318 because of the unbalanced use of iron supplementation in 2 groups , 1 study exhibited a high risk of bias in the item other biases.12 risk of bias in included studies . a , risk of bias graph demonstrates the percentages of included studies for each item in the tool ; ( b ) risk of bias summary illustrates the review author 's judgments with a cross - tabulation for each eligible study . all ten eligible rcts reported that the overall incidence of aki was 10.57% ( 147 of 1391 participants ) in the epo - based intervention group and 10.38% ( 142 of the 1368 participants ) in the control group . pooled analysis using a fixed effect model showed that there was no significant difference for preventing the development of aki between the epo and control groups ( rr , 0.97 ; 95% ci , 0.791.19 ; p = 0.782 ) , as shown in figure 3a . meanwhile , the test for between - study heterogeneity among the included trials was not significant ( i = 20.2% and p = 0.257 ) . forest plots of rr estimates with the corresponding 95% ci for ( a ) the incidence of aki , ( b ) dialysis requirement , and ( c ) mortality in patients receiving epo therapy versus control . the columns of intervention and control were presented as number of events / number of participants . stratified analyses of studies with entirely perioperative care demonstrated no significant difference between the epo and control groups using a fixed effect model ( rr , 0.86 ; 95% ci , 0.661.12 ; p = 0.260 ; i = 33.9% ; p = 0.169).1218 among studies that excluded patients with prior epo use , similar result of rr was obtained ( rr , 0.89 ; 95% ci , 0.661.21 ; p = 0.467 ; i = 23.3% , p = 0.259).9,10,13,15,17,18 among patients who received at least 2 doses of epo911,15 or were at high risk of aki according to each study,11,14,16 the prevention of aki remained nonsignificant ( rr , 0.99 ; 95% ci , 0.731.35 ; p = 0.962 ; i = 44.3% , p = 0.145 and rr , 1.22 ; 95% ci , 0.891.67 ; p = 0.215 ; i the sensitivity analysis after exclusion of 1 study at a time demonstrated that the above pooled result was robust and did not change much depending on any single study ( fig . it should be noted that after removing the study,12 which gave iron supplement only to epo intervention group , the overall rr was 1.02 ( 95% ci , 0.821.27 ; p = 0.824 ) without statistical significance . the sensitivity analysis by removing each individual study at a time is shown on the pooled effect size of the incidence of aki . the funnel plot and egger 's test analysis indicated that there was no evidence of publication bias for the aki outcome ( fig . the funnel plots for publication bias tests of studies assessing the effect of epo on ( a ) the incidence of aki and ( b ) mortality . the dialysis requirement was reported in 7 studies11,1318 totaling 590 analyzable patients , and in 3 of these studies , no patient was treated with dialysis in either group.13,14,18 the overall incidence of dialysis was 2.65% ( 8 of the 302 participants ) in the epo - based intervention group and 3.82% ( 11 of the 288 participants ) in the control group . by meta - analysis for 4 studies using a fixed effect model,11,1517 there was no significant difference of mortality between the epo and control groups ( rr , 0.72 ; 95% ci , 0.311.70 ; p = 0.457 ) without significant between - study heterogeneity ( i = 0% , p = 0.662 ) , as shown in figure 3b . because there were only 4 articles in the literature with the effective data , the publication bias was not investigated . the ten included studies demonstrated that overall mortality was 11.07% ( 154 of the 1391 participants ) in the epo - based intervention group and 11.40% ( 156 of the 1368 participants ) in the control group . mortality was ascertained in - hospital in 3 studies,13,15,16 at 30 days in 5 studies,912,14 and unclear in the remaining study.17,18 pooled analysis using a fixed effect model showed that there was no significant difference of mortality between the epo and control groups ( rr , 0.96 ; 95% ci , 0.781.18 ; p = 0.705 ) without significant between - study heterogeneity ( i = 0% , p = 0.562 ) , as shown in figure 3c . meanwhile , there was no evidence of publication bias for the mortality outcome ( fig . six studies demonstrated that none of the patients who received the epo intervention suffered from adverse events , which were associated with the use of drug , throughout the study period , such as hypertension , symptomatic thrombosis , myocardial infarction , stroke , headache , and seizures.1216,18 one study did not report adverse events,17 and 1 study reported adverse events for the entire participants without specifically describing the specific group.11 corwin et al9 showed that the incidence of deep thrombophlebitis was 2.15% ( 14/650 ) among the epo intervention group and 2.30% ( 15/652 ) in the control group without significant difference . napolitano et al10 reported that the incidence of clinically relevant thrombovascular events was 16.42% ( 66/402 ) in the epo intervention group and 12.53% ( 49/391 ) in the control group with an rr of 1.31 ( 95% ci , 0.931.85 ) . the included studies spanned from 2002 to 2014 , and with the exception of 2 articles,9,10 the sample size of all other studies was relatively small ( 63108 participants ) . four trials were conducted in korea,12,13,16,17 2 in the united states,9,10 and the others in new zealand,11 switzerland,14 thailand,15 and sweden.18 napolitano et al10 reanalyzed the data from critically ill trauma patients in epo-2 trial,9 which had been included in this meta - analysis , so only the part of epo-3 trial was included in this analysis . the intention to treat of participants in 1 study included aki patients on randomization,11 and for the objective of this meta - analysis , the data of the subgroup not aki on randomization were used in this analysis . one study13 was the follow - up of a previous trial21 ; therefore , the incidence of aki was extracted from the former , and the baseline data were extracted from the latter . all studies enrolled participants from single - site center except 3.911 with respect to the participants setting , 8 studies were performed in perioperative period , 6 of which were conducted in patients with elective cardiac surgery,1216,18 one assessed patients undergoing thoracic aorta surgery with hypothermic cardiac arrest,17 and the rest one partly included patients with scheduled cardiothoracic surgery.11 baseline clinical characteristics of included studies six studies excluded patients who used epo previously,9,10,13,15,17,18 whereas other studies did not specify this issue . in 3 of the 10 studies , a high risk for developing aki , the definitions of which were not the same , was included in the enrollment criteria.11,14,16 in 8 studies , baseline end - stage renal disease or dialysis was set as a compulsory exclusion criterion.913,15,16,18 when reported , mean baseline hemoglobin levels ranged from 9.3 to 13.1 g / dl,9,10,1215,18 and mean baseline serum creatinine levels varied from 0.92 to 1.35 mg / dl.1316,18 the type of erythropoiesis - stimulating agent used in all of the intervention groups was epo - alpha or -beta , but not darbepoietin . the one - time epo dosage was either fixed as 20,000 units or 40,000 units in 3 studies9,10,14 or was based on participant weight ranging from 100 units / kg to 500 units / kg in the other 7 studies . the participants in 6 studies received only a single administration of epo1214,1618 ; however , participants received at least 2 doses in the other studies . two studies provided supplementary iron therapy to both the intervention and control groups,9,10 and 1 study provided an iron sucrose supplement only to the intervention group.12 there was considerable variation in the definition of aki across these studies , which was not clear in 2 studies.9,10 all ten studies reported randomization , but 7 studies described the methods of randomization,912,14,16,18 and only 4 studies showed the details of concealed allocation.11,13,15,18 all studies reported double blinding and no or few missing outcome data with the reason . eight studies provided the clinical trial registration number online with a low risk of bias in selective outcome reporting.10,11,1318 because of the unbalanced use of iron supplementation in 2 groups , 1 study exhibited a high risk of bias in the item other biases.12 risk of bias in included studies . a , risk of bias graph demonstrates the percentages of included studies for each item in the tool ; ( b ) risk of bias summary illustrates the review author 's judgments with a cross - tabulation for each eligible study . all ten eligible rcts reported that the overall incidence of aki was 10.57% ( 147 of 1391 participants ) in the epo - based intervention group and 10.38% ( 142 of the 1368 participants ) in the control group . pooled analysis using a fixed effect model showed that there was no significant difference for preventing the development of aki between the epo and control groups ( rr , 0.97 ; 95% ci , 0.791.19 ; p = 0.782 ) , as shown in figure 3a . meanwhile , the test for between - study heterogeneity among the included trials was not significant ( i = 20.2% and p = 0.257 ) . forest plots of rr estimates with the corresponding 95% ci for ( a ) the incidence of aki , ( b ) dialysis requirement , and ( c ) mortality in patients receiving epo therapy versus control . the columns of intervention and control were presented as number of events / number of participants . stratified analyses of studies with entirely perioperative care demonstrated no significant difference between the epo and control groups using a fixed effect model ( rr , 0.86 ; 95% ci , 0.661.12 ; p = 0.260 ; i = 33.9% ; p = 0.169).1218 among studies that excluded patients with prior epo use , similar result of rr was obtained ( rr , 0.89 ; 95% ci , 0.661.21 ; p = 0.467 ; i = 23.3% , p = 0.259).9,10,13,15,17,18 among patients who received at least 2 doses of epo911,15 or were at high risk of aki according to each study,11,14,16 the prevention of aki remained nonsignificant ( rr , 0.99 ; 95% ci , 0.731.35 ; p = 0.962 ; i = 44.3% , p = 0.145 and rr , 1.22 ; 95% ci , 0.891.67 ; p = 0.215 ; i = 0% , p = 0.805 , respectively ) . the sensitivity analysis after exclusion of 1 study at a time demonstrated that the above pooled result was robust and did not change much depending on any single study ( fig . it should be noted that after removing the study,12 which gave iron supplement only to epo intervention group , the overall rr was 1.02 ( 95% ci , 0.821.27 ; p = 0.824 ) without statistical significance . the sensitivity analysis by removing each individual study at a time is shown on the pooled effect size of the incidence of aki . the funnel plot and egger 's test analysis indicated that there was no evidence of publication bias for the aki outcome ( fig . the funnel plots for publication bias tests of studies assessing the effect of epo on ( a ) the incidence of aki and ( b ) mortality . the dialysis requirement was reported in 7 studies11,1318 totaling 590 analyzable patients , and in 3 of these studies , no patient was treated with dialysis in either group.13,14,18 the overall incidence of dialysis was 2.65% ( 8 of the 302 participants ) in the epo - based intervention group and 3.82% ( 11 of the 288 participants ) in the control group . by meta - analysis for 4 studies using a fixed effect model,11,1517 there was no significant difference of mortality between the epo and control groups ( rr , 0.72 ; 95% ci , 0.311.70 ; p = 0.457 ) without significant between - study heterogeneity ( i = 0% , p = 0.662 ) , as shown in figure 3b . because there were only 4 articles in the literature with the effective data , the publication bias was not investigated . the ten included studies demonstrated that overall mortality was 11.07% ( 154 of the 1391 participants ) in the epo - based intervention group and 11.40% ( 156 of the 1368 participants ) in the control group . mortality was ascertained in - hospital in 3 studies,13,15,16 at 30 days in 5 studies,912,14 and unclear in the remaining study.17,18 pooled analysis using a fixed effect model showed that there was no significant difference of mortality between the epo and control groups ( rr , 0.96 ; 95% ci , 0.781.18 ; p = 0.705 ) without significant between - study heterogeneity ( i = 0% , p = 0.562 ) , as shown in figure 3c . meanwhile , there was no evidence of publication bias for the mortality outcome ( fig . six studies demonstrated that none of the patients who received the epo intervention suffered from adverse events , which were associated with the use of drug , throughout the study period , such as hypertension , symptomatic thrombosis , myocardial infarction , stroke , headache , and seizures.1216,18 one study did not report adverse events,17 and 1 study reported adverse events for the entire participants without specifically describing the specific group.11 corwin et al9 showed that the incidence of deep thrombophlebitis was 2.15% ( 14/650 ) among the epo intervention group and 2.30% ( 15/652 ) in the control group without significant difference . napolitano et al10 reported that the incidence of clinically relevant thrombovascular events was 16.42% ( 66/402 ) in the epo intervention group and 12.53% ( 49/391 ) in the control group with an rr of 1.31 ( 95% ci , 0.931.85 ) . in this present meta - analysis of 10 rcts with 2759 participants , we found that compared with placebo , prophylactic epo therapy for patients who are critically ill or under perioperative care was not associated with a significant reduction in the incidence of aki , dialysis requirement , or mortality . meanwhile , the effect of epo on aki prevention was consistent with the above result for the stratified analyses on patients with entirely perioperative care , no previous epo use , or more than 1 dose of epo . in addition , epo therapy was not associated with adverse events in these studies , which appeared to be safe in this kind of patients . aki is a frequent and serious complication occurring in the critically ill or surgical patients and is associated with increased length of hospital stay , occurrence of end - stage renal disease , and mortality.22 ischemia and reperfusion injury , inflammation , oxidative stress , apoptosis , etc . have all been demonstrated as crucial factors in the development of aki.23 recently , results from several animal studies indicated that epo exerts a renoprotective effect against aki induced by cardiopulmonary bypass or sepsis through mechanisms of reducing ischemia / reperfusion injury , inhibiting apoptosis , and alleviating inflammatory responses.8,24,25 however , the benefits of epo in these animal studies were not reproducible in clinical trials or in this meta - analysis first , many patients included in these trials suffered from some comorbidities , such as hypertension , diabetes , dyslipidemia , or ischemic heart disease and had complicated pathophysiological conditions , which might reduce the effects of epo.26,27 second , compared with animal experiments , the dosage of epo in clinical studies is relatively lower , which might be unable to obtain therapeutic effects . third , the variable time of epo treatment in clinical studies is not the same as animal experiments , and the optimal time has not been established . only 1 epo intervention study was enrolled in a previous meta - analysis without estimating the risk of aki,28 and 9 additional rcts with over 2600 participants were included into our meta - analysis . the majority of trials in this analysis had good or moderate methodological quality , which indicated that the results were not susceptible to be influenced by the biases of original researches . meanwhile , most trials investigated the effect of epo on clinically hard end points such as dialysis requirement and short - term mortality . both the between - study heterogeneity and publication bias were relatively minimal without statistical significance , which made the pooled effect size less likely to be affected . in addition , the appropriate stratified analyses and sensitivity analyses , which removed one study at a time , were performed with consistent results . first , several inclusion trials might not have sufficient sample size with designed only at the single - center level.1217 in the future , more large multicenter rcts with adequately participants will be needed to elucidate the prevention role of epo . second , there were differences in patient selection , treatment regimen , and the definition of aki across these trials . an accepted uniform epo study protocol would reduce the degree of variation among the studies . finally , our meta - analysis was based on aggregated data , not on individual patient - level data . as a consequence , the results might be less accurate and could not be adjusted for certain confounding factors , such as age , comorbidities , and laboratory parameters , which might influence the true therapeutic effect of epo . in summary , this meta - analysis , based on currently available rct evidence , suggests that prophylactic epo treatment of patients with critical illness or under perioperative care does not reduce the incidence of aki , dialysis requirement , or death . considering the limitations of this study , larger scale , well - designed multicenter rct studies using optimal doses and administration times are needed to investigate the role of epo in aki prevention .

objective : the aim was to investigate the efficacy and safety of erythropoietin ( epo ) to prevent acute kidney injury ( aki ) in patients with critical illness or perioperative care.methods:randomized controlled trials comparing epo with placebo for aki prevention in adult patients with critical illness or perioperative care were searched in medline , embase , the cochrane central register of controlled trials , the web of science , and clinical trials.gov until october 2014 . the outcomes of interest included the incidence of aki , dialysis requirement , mortality , and adverse event . fixed effect model was used to calculate the pooled risk ratio ( rr ) and 95% confidence interval ( ci ) for eligible studies.results:ten randomized controlled trials involving 2759 participants were identified and included in the analysis . compared with placebo , epo administration did not reduce the incidence of aki ( rr , 0.97 ; 95% ci , 0.791.19 ; p = 0.782 ) , dialysis requirement ( rr , 0.72 ; 95% ci , 0.311.70 ; p = 0.457 ) , or mortality ( rr , 0.96 ; 95% ci , 0.781.18 ; p = 0.705 ) . moreover , epo had no effect on the risk of adverse events , but estimations of rr were difficult due to their relatively infrequent occurrence.conclusions:this meta - analysis suggests that prophylactic administration of epo in patients with critical illness or perioperative care does not prevent aki , dialysis requirement , or mortality .

a 60-year - old patient presented in the outpatient department with chief complaints of hematuria with off and on episode of urine retention . there was history of passage of small stones in urine occasionally for last few days . on ultrasonography he was found to have 35 g prostate with slightly thickened bladder wall with a large stone in the urinary bladder . x - ray kub showed a large radio - opaque shadow in the pelvic region [ figure 1 ] . patient underwent open cystolithotomy and large bladder stone [ figure 2 ] with multiple small stones were retrieved . patient was started on alpha blockers in the immediate postoperative period and foley 's catheter was removed on the eighth postoperative day . at follow - up of three weeks after the surgery the patient was voiding in good stream with minimal post - void residual urine . as the name implies this variety of stone has a characteristic shape resembling a child 's toy [ figure 3 ] . these types of stone are commonly described in the veterinary literature with common occurrence in cattle , cats and dogs . dogs are mostly commonly affected and canine jackstones are usually composed of silica . depicting child toy called jackstone calcium oxalate is the most common component of urinary calculi . calcium oxalate monohydrate calculi are usually smooth and black , whereas stones comprising calcium oxalate dihydrate tend to be irregular and yellow . prostatic diseases , previous lower urinary tract surgery , metabolic abnormalities , upper urinary tract calculi , intravesicular foreign bodies , spinal cord injuries , transplant surgery etc . the presentation of vesical calculi varies from completely asymptomatic to symptoms of suprapubic pain , dysuria , intermittency , frequency , hesitancy , nocturia , and urinary retention . other common signs include terminal gross hematuria and sudden termination of voiding with some degree of associated pain referred to the tip of the penis , scrotum , perineum , back , or hip . the discomfort may be dull or sharp and is often aggravated by sudden movements and exercise . assuming a supine , prone , or lateral head - down position may alleviate the pain initiated by the stone impacting the bladder neck by causing it to roll back into the bladder . in our case the prostate is the likely cause of this stone . enlarged prostate probably restricts the calculus into its eccentric location and contributes to the growth of stone by causing stasis of urine . it is important to recognize the characteristic shape of the jackstones as they are susceptible to lithotripsy . we did not offer lithotripsy as this modality is known to be less efficacious in case of vesical calculus .

jackstone calculi are urinary tract stones that have a specific appearance resembling toy jacks . they are almost always composed of calcium oxalate dihydrate consist of a dense central core and radiating spicules . they are usually light brown with dark patches and are usually described to occur in the urinary bladder and rarely in the upper urinary tract . their appearance on plain radiographs and computed tomography in human patients has been described .

when i hear the word quantitation , what comes to mind is the contrast between two famous 19th - century german scientists , alexander von humboldt and carl gauss , as described in measuring the world : a novel ( kehlmann , 2009 ) . von humboldt was a great prussian explorer who made many discoveries , including electric eels , in his expeditions to south and central america , which included the casiquiare canal , which connects the orinoco and amazon rivers . a man of extraordinary energy , he was the consummate quantitater he measured the heights of mountains and the numbers of lice on the heads of natives . gauss , as surveyor and astronomer for the kingdom of hannover , was also a quantifier , but with a different style . charged with devising a practical method to survey on a spherical earth , he laid the foundation for a school of geometry that culminated in the work of riemann and the notion of curved space - time in einstein 's general theory of relativity . the lesson here is that when you have a theory , measurement becomes very important and intellectually challenging . have all the relevant parameters been measured ? have all the confounding complications been considered ? does the theory really fit to the data ? how accurately have the underlying quantities ( parameters ) been measured ? what is a model ? what is the difference ? in biology , we usually distinguish three types of model : conceptual models , mathematical models , and simulations ( bowne - anderson et al . , 2013 ) . they all serve the same general purpose : to explain more complex phenomena in terms of more elementary processes or molecular interactions . this can be in the form of a cartoon or picture that conveys the author 's idea or explanation of his or her results . but can it really explain the data ? usually , more work is needed to establish the plausibility of a conceptual model . a mathematical model is the development of the conceptual model into a system of equations . the postulates are identified ( often in the form of parameters ) , and the implications or predictions are derived by solving the equations . the equations usually describe the average behavior of a large number of interacting molecules or entities a so - call mean - field theory ( although variances and other statistical properties can often also be calculated ) . the solutions are then compared with the experimental measurements the quantitation of the data . if the equations can be solved analytically , all is well and good because this usually indicates that the solution is simple , or at least familiar . if not , numerical solutions are readily provided by such programs as matlab ( www.mathworks.com ) . the predictions of the model ( with appropriate parameters ) can then be used to quantitatively account for the experimental data . this is the process of curve fitting , which can be used to ask whether the theory actually fits the data ( i.e. , establish plausibility ) and to measure the underlying parameters and their uncertainties . a simulation is a computer - based imitation of a system . like a mathematical model , a simulation postulates interactions between underlying molecules or entities . unlike a mathematical model , however , a simulation models individual behavior ( rather than mean behavior ) and often needs to be repeated a large number of times to obtain an accurate measure of the average behavior . simulations are especially valuable when modeling small - number systems , which can display highly stochastic behavior . simulations can be used for establishing the plausibility of a conceptual model , and by changing the parameters , the simulator can experiment with the model to gain insight into how it works . the first is that they often contain many details such as the precise initial conditions or the order of the interactions . in this sense they are often like experimental results , which also depend on many details ( e.g. , the composition of the buffers ) . in light of well - documented cases in which the results of simulations depended on these details , it has been argued that a simulation should be treated like an experimental result in the sense that it should be confirmed in different laboratories before being accepted ( mitchell , 2009 ) . a second potential limitation of simulation is that although it can establish plausibility of a mechanism , it might provide only limited insight . this is especially the case if the system behavior is unexpected and the elementary interactions give rise to so - called emergent or collective behavior . in this case , the behavior of the simulation may be as mysterious as the biological phenomenon being modeled , even when the simulator can probe the model by varying the model parameters ( analogous to performing wet experiments ) . an alternative approach is to use so - called toy models ( or idea models ; mitchell , 2009 ) , which , while oversimplifying the system under study , are nevertheless simple enough to solve using a mathematical model , thereby providing insight into mechanism . an example of a toy model is turing 's reaction - diffusion mechanism of pattern formation ( turing , 1952 ; gierer et al . , 1972 ) . i do not want the reader to think that simulations are always inferior to mathematical models . indeed , there are now very good algorithms that have solved many of the technical problems associated with simulations ( e.g. , the gillespie algorithm ; doob , 1945 ; gillespie , 2007 ) . the physicist freeman dyson recounts attending a conference at which enrico fermi criticized the complexity of dyson 's model by quoting the mathematician john von neumann ( dyson , 2004 ) : with four parameters i can fit an elephant , and with five i can make him wiggle his trunk . actually , it is not so easy to model an elephant with four parameters , although we recently achieved it , even making the trunk wiggle with the fifth parameter ( mayer et al . , 2010a ) ! if a model has a small number of premises or parameters that give rise to broad and/or unexpected implications , then we might call it a theory . evolution the modern evolutionary synthesis is a theory because it makes a relatively small number of postulates yet predicts a very broad range of observations , including the laws of inheritance and models of population genetics . it could be argued that other models , especially those underlying spatial oscillations ( e.g. , turing patterns ) and temporal oscillations ( e.g. , the cell cycle ; see later discussion ) , rise to the level of theories . theories and models can be used to establish plausibility , sufficiency , or impossibility . they can also be used to measure . the importance of establishing plausibility is illustrated by a recent example in which a textbook conceptual model was shown not to explain the observations . myosin cortex was driven by a gradient of tension ( bray and white , 1988 ) . however , using experiments ( laser cutting ) and theory , it was found that cortical flow in the one - cell caenorhabditis elegans embryo is driven not by a gradient in tension but by a gradient of contractility ( i.e. , motor activity ) : in the direction of flow , there is no tension gradient , but , counterintuitively , in the transverse direction , there is a tension gradient but no flow ( mayer et al . , 2010b ) ! this example shows the importance of developing a mathematical model ( and testing it ) to establish the plausibility of a conceptual model . two examples of the use of theory to establish sufficiency are the action potential and the cell cycle . in a remarkable feat that serves as a foundation for neurobiology , hodgkin and huxley ( 1952 ) formulated and solved equations showing that the action potential in nerve cells can be accounted for by the voltage - dependent interactions between sodium and potassium conductances ( channels in the modern parlance ) . the second example concerns the cell division cycle . following seminal discoveries showing the necessity of phosphorylation for controlling the transitions between phases of the cell cycle , tyson and novak ( 2011 ) showed the sufficiency of phosphorylation networks to drive the transitions . in other words , they answered the question , what do you need to build a molecular switch ( answer : feedback and cooperativity ) , and , by doing so , they made the problem of the cell cycle finite . in the process , they made key predictions that were confirmed experimentally and they explained many phenotypes . an excellent example of the use of theory to show impossibility is the prescient work of ken machin ( machin , 1958 ) . he proved that the periodic bending motion of cilia and flagella ( such as sperm tails ) can not be driven by motor activity localized to the base of the cilium only : if the beating were driven by a whip - like process at the base , the amplitude would die out with a characteristic shape due to the damping from the fluid . this shape is not consistent with the observed beating patterns , whose amplitudes are maintained along the length of the flagellum . instead , he proposed motors all along the length , with a traveling wave of activity propagating from base to tip . not bad , considering that the motor dynein had not been discovered ( gibbons and rowe , 1965 ) , nor was it known whether the filaments inside the flagellum ( the microtubules ) slid or contracted ( they slide ; satir , 1965 ) . of interest showing impossibility is the most powerful use of mathematical models : it allows hypotheses to be falsified , which is difficult to achieve using simulations . in my work , i have used theory as a tool to measure molecular properties and interactions . for example , we used precise mechanical measurements on hair cells the sensory receptors underlying the sensation of sound and acceleration to estimate the force needed to open a single channel , the displacement associated with the opening of the channel 's gate , and the number of channels ( howard et al . , 1988 ) . in other work , we used theory to infer the bending stiffness of actin filaments and microtubules from an analysis of their shape fluctuations ( gittes et al . , 1993 ) . more recently , we showed how molecular interactions between kinesin motor proteins and microtubules can give rise to length - dependent microtubule depolymerization , which may play a key role in determining the size of organelles such as the mitotic spindle ( varga et al . , 2006 , 2009 ; these include the following : morphology : what determines the size , number , and shape of cells and organelles?signaling : how do molecules compute , and what is the role of spatial localization and compartmentalization?scaling : how do we bridge from one scale to another ? are there universal laws ? morphology : what determines the size , number , and shape of cells and organelles ? signaling : how do molecules compute , and what is the role of spatial localization and compartmentalization ? scaling : how do we bridge from one scale to another ? are there universal laws ? especially important is to understand how variability is minimized within a cell to produce reproducible structures and signals , and amplified among cells to enlarge the number of stimuli to which a population of cells can respond . there has been rapid development of single - molecule techniques , making it possible to manipulate individual molecules using optical and magnetic techniques and to visualize their activity inside cells using fluorescence microscopy . in this way it is even possible to sequence single molecules of dna ( www.pacificbiosciences.com ) . at the whole - cell level the developments are as impressive : image processing techniques can be used to segment single cells in tissues to measure shape and activity , their total protein assayed by mass spectrometry , and their genomes sequenced . these studies have revealed remarkable cell - to - cell variability of identical cells . hand in hand with these developments , we must have theory and models to make sense of the experimental results , as exemplified by gauss , rather than the collection of data for their own sake . i predict that in the future , theory will drive biology as it does physics and engineering .

quantitative biology is a hot area , as evidenced by the recent establishment of institutes , graduate programs , and conferences with that name . but what is quantitative biology ? what should it be ? and how can it contribute to solving the big questions in biology ? the past decade has seen very rapid development of quantitative experimental techniques , especially at the single - molecule and single - cell levels . in this essay , i argue that quantitative biology is much more than just the quantitation of these experimental results . instead , it should be the application of the scientific method by which measurement is directed toward testing theories . in this view , quantitative biology is the recognition that theory and models play critical roles in biology , as they do in physics and engineering . by tying together experiment and theory , quantitative biology promises a deeper understanding of underlying mechanisms , when the theory works , or to new discoveries , when it does not .

the discovery of the silicon pn junction is a landmark in the development of modern microelectronics . silicon and other inorganic semiconductors are the predominant materials in electronic manufacturing today ; however , the development of organic - based electronic components has been a focus of intensive research and development . organic electronics have become an active research area in recent years because they are an alternative to the traditional semiconductor technology and challenges in design on a smaller scale from microscale to nanoscale . moreover , organic materials have vast potential for integration in low - cost microelectronic devices . organic - based semiconductors , for example polymeric gels , may have superior properties due to their flexibility against to regulate some physical properties of the materials even after the production , e.g. , by changing the volume of the gel . circuits and displays based on organic electronics may also be flexible , low - weight , and environment friendly . due to great diversity and functionality of the polymers , they may also be produced for specific requirements , like biocompatible semiconductors . last , some water - tolerant organic devices may be biocompatible , that is , they may be used in circuits that directly reside on or are implanted inside animal and human tissue and could perform various sensing , interfacing , and controlling functions for drug delivery , prosthetics , and neural - electronic integration . insulating polymers have been made conductive so far by using various methods such as ion implantation [ 1 - 4 ] , press contacting , and photochemical doping . the impressive properties of these materials that have been taken advantage are the ability to manipulate electronic properties by changing their molecular structure . differently current rectifying in semiconductor diodes via diffusion of ionic charges across a pn junction sets up a built in potential ; there is unidirectional current is observed across a membrane where a built in potential arises from diffusion of anions and cations in organic junctions . we considered that the principle of the electrical conductivity in polymeric gels can be changed by doping static ( inactive ) ions having counter ions as charge carriers and these gels can be used to form pn junctions that work similar to inorganic semiconductors . these semiconductor polymeric gels can be doped with both negative ( n - type ) and positive ( p - type ) counter ions as charge carriers . we have shown that the pn junction formed by combining p - type and n - type gels together in much closer contact rectifies the current . p - type hydrogels were synthesized via free radical cross - linking co - polymerization of acrylamide ( aam ) and n , n-methylene bisacrylamide ( bis ) as crosslink agent in the presence of pyranine ( 8-hydroxypyrene-1,3,6-trisulfonic acid , trisodium salt ) in varying amount , 10 , 10 , 10 mol / l [ 10 - 12 ] . the ratios of aam to bis and aam to aps were kept fixed for all samples ; aam / bis = 31 and aam / aps = 43 in bidistilled water . the samples were deoxygenated by bubbling nitrogen during 10 min , and the gelation was performed in the 1 1 cm square - shaped holders ( 4 cm of volume ) at 60c in a heat bath . after gelation processes were completed , gels were washed with pure water during 15 days with changing their water every day . thus , pollutions and unreacted chemicals washed out from the gel , and only pyranines , which were bound to the polymer strands chemically [ 10 - 12 ] , were stayed in the gel . after the gels dried at 40c furnace , they were cut into thin slices with ~1 mm thickness for electrical measurements . n - type gels were synthesized , similar to p - type , as free radical cross - linking co - polymerization of n - isopropylacrylamide ( nipa ) and n , n-methylene bisacrylamide ( bis ) as crosslink agent in the presence of methacrylamidopropyltrimethylammonium chloride ( maptac ) in varying amount , 3 10 , 3 10 , 3 10 mol / l [ 13 - 15 ] . the ratios of nipa to bis and nipa to aibn were kept fixed for all samples ; nipa / bis = 50 and nipa / aibn = 71 in dimethylsulphoxide ( dmso ) . these gels were prepared for electrical measurements in similar way with p - type gels . aam , nipa , and doping concentrations of the samples were summarized in table 1 . properties and codes of synthesizing semiconducting gels to be able to evaluate the net effect of the doping on the electrical properties , samples p1 , p5 , n1 , and n5 were synthesized without doping agents for comparison with the other samples . the gels , prepared in the slice shapes of area a and thickness d , were swollen to a certain swelling ratio , and then placed between platinum electrodes , and sealed from the air against drying . the current densities per unit mass , j / m , of the gel were measured against the time , the applied voltage and the swelling ratio of the gels . p - type hydrogels were synthesized via free radical cross - linking co - polymerization of acrylamide ( aam ) and n , n-methylene bisacrylamide ( bis ) as crosslink agent in the presence of pyranine ( 8-hydroxypyrene-1,3,6-trisulfonic acid , trisodium salt ) in varying amount , 10 , 10 , 10 mol / l [ 10 - 12 ] . the ratios of aam to bis and aam to aps were kept fixed for all samples ; aam / bis = 31 and aam / aps = 43 in bidistilled water . the samples were deoxygenated by bubbling nitrogen during 10 min , and the gelation was performed in the 1 1 cm square - shaped holders ( 4 cm of volume ) at 60c in a heat bath . after gelation processes were completed , gels were washed with pure water during 15 days with changing their water every day . thus , pollutions and unreacted chemicals washed out from the gel , and only pyranines , which were bound to the polymer strands chemically [ 10 - 12 ] , were stayed in the gel . after the gels dried at 40c furnace , they were cut into thin slices with ~1 mm thickness for electrical measurements . n - type gels were synthesized , similar to p - type , as free radical cross - linking co - polymerization of n - isopropylacrylamide ( nipa ) and n , n-methylene bisacrylamide ( bis ) as crosslink agent in the presence of methacrylamidopropyltrimethylammonium chloride ( maptac ) in varying amount , 3 10 , 3 10 , 3 10 mol / l [ 13 - 15 ] . the ratios of nipa to bis and nipa to aibn were kept fixed for all samples ; nipa / bis = 50 and nipa / aibn = 71 in dimethylsulphoxide ( dmso ) . these gels were prepared for electrical measurements in similar way with p - type gels . aam , nipa , and doping concentrations of the samples were summarized in table 1 . properties and codes of synthesizing semiconducting gels to be able to evaluate the net effect of the doping on the electrical properties , samples p1 , p5 , n1 , and n5 were synthesized without doping agents for comparison with the other samples . the gels , prepared in the slice shapes of area a and thickness d , were swollen to a certain swelling ratio , and then placed between platinum electrodes , and sealed from the air against drying . the current densities per unit mass , j / m , of the gel were measured against the time , the applied voltage and the swelling ratio of the gels . the pyranine binds to the polymer chains , over its oh group , chemically during the polymerization as it is discussed in detail in references [ 10 - 12 ] , and they form stable charged sites doped with positive counter ions . thus , the polyacrylamide gel is doped with pyranine having ions as side groups and na as counter ions , so - called p - type semiconducting gel . similarly , nipa gel was doped with maptac , having cl as counter ions , so - called n - type semiconducting gel . the maptac binds to the polymer chains chemically during the polymerization , thus they form stable charged sites doped with negative counter ions as represented in scheme 1together with the p - type gel . this doping process was also discussed in detail in references , . when these gels are in the collapsed state , no current is observed . when the gels start to swell , the current starts to flow through the gels . schematic representation of the p - type ( a ) and n - type ( b ) gels doped with pyranine and maptac the currents decrease with time for a constant applied voltage as shown in fig . as the charge carriers ( the ions in water phase of the gel ) were gathered on the electrodes , the density of the charge carriers decrease in time , and thus the current . as seen , the initial values of the currents measured for the doped gels are considerably bigger than that of the neat gel ( the gel that was not doped with ions ) at a certain swelling ratio , v / v0 = 1.28 and under constant applied voltage , u = 5 v. furthermore , the initial amplitude of the currents increases with increasing doping concentration . this clearly shows that the net charge in the gel increases with increasing doping concentration . aj / mgel vs time plots for the doped ( p2 , p3 , p4 ) and neat ( p1 ) gels under constant applied voltage , 5 v , and swelling ratio , v / v0 ~ 1,28 . bj / mgel versus time plots upon short - cut of the circuit for samples p4 , p3 , p2 , p1 . the vertical bar represents the standard error for each plot examples for the short - cut experiments -the source of the voltage was removed and the current was measured by means of an ammeter without changing its polarity- were also indicated in ( fig . 1b ) where all the current takes first a negative value , as it is expected , and then goes to zero with time . figure 1 clearly indicates that the free charges leading the current are accumulated on the surfaces of the gel on which the voltage is applied ( similar to charging a parallel plate capacitor ) and the gels have ionic charge carriers . figure 2a shows typical current - time plots of the slab gels for increasing pyranine content . the gels were swollen in pure water up to certain swelling degree ( v / v0 = 1,3 ) , under a fixed applied voltage , 1 v. as seen , the currents for all samples decrease with time ; however , the initial values of them increase with increasing doping agent ( pyranine content ) . aj / mgel versus time plots of the samples p6 , p7 , and p8 , b the ratios of j / mgel for the doped and neat gels ( p8/p5 ) as function of the applied voltage for varying swelling ratio , v / v0 figure 2b shows the ratio of the normalized current densities ( j / mgel ) for doped ( p8 ) to neat ( p5 ) gels as function of the applied voltage for varying swelling ratio . the currents were measured 5 s later just after applying voltage . as seen , the doping effect on the current decreases when the swelling ratio is increased . this may be due to the vast increase in the free ions coming from the water which causes screening . this picture may indicate that doping effect ( p - type behavior ) can be fulfilled up to a certain swelling degree of the above - mentioned gel which semiconducting behavior will be lost . the instantaneous currents the currents that were measured 5 s later just after changing the voltage- as function of the volume of the gels for varying voltages were also measured , and the results were indicated in fig . as seen from this figure , distinct peaks appear as the solvent uptake , v / v0 , increases . the peaks almost disappear for the gels doped with pyranine due to increasing homogeneity of the gels in the presence of the ions . the results coincide with the recent literature where three dominant peaks , each corresponding to a different swelling stage in the conductivity , were observed . figure 3 indicates that the volume of the gel is one of the main parameters determining the current . variation in j / mgel against v / v0 for ( a ) the neat gel , p1 , and for ( b ) the doped gel , p2 these peaks were related to the distribution of dense polymer regions ; they are defined as the blobs appearing in a microstructure of the given paam gel having at least some average sizes . this special behavior in these gels may result specific features related to the electrical features . the heterogeneity of the gel may decrease essentially in case when it is prepared with the charged groups . the internal electric field due to the charged sites could disturb the tendency between the polymer units ( affinity of the aam momoners to the cross - linker molecules ) because the charge excess has a tendency to form denser polymer regions especially in mesoscale regions . the formation of the rigid network in the charged gel makes it more homogenous in comparison with the neutral gel . this could cause the decreasing amplitude of the peaks , and overall decrease in the conductivity as it is confirmed by fig . 3 ( see also fig . 2 of reference ) . therefore , in the charged gel , the penetration of neutral water molecules through the system of large channels located in the vicinity of small blobs is facilitated . figure 4 represents the normalized current density per unit mass as function of the voltage for the gels ( sample p3 ) swollen with water ( fig . dmso is not a polar molecule ; therefore , the ions like h or oh are absent in it . as seen from this figure , the current density decreases fairly for the gels swollen with dmso since no contribution to the current occurs via h and oh ions . the current occurs mainly due to doped ions ( the counter ions of the doping agent ) . this observation clearly indicates that the possible negative effects of the water upon the pnjunctions that may be formed by means of our gels can be eliminated . j / mgel versus applied voltage , u , for the doped gel ( p3 ) swollen in ( a ) pure water , b and in dmso all the above - mentioned measurements were repeated for n - type gels , and the similar results were reproduced . here the results are not given to avoid the repetition . in fig . 5 , representative examples of i - u(current voltage ) character of polymeric diode are given for the neat and the doped gels . figure 5a shows the current voltage character that was made by means of close connection of p-(sample p4 ) and n - type ( sample n4 ) slab gels- putting one of the gel on the top of the other for each gel . the swelling ratio of each gel was kept the same , v / v0 = 1,2 . when the neat gels are used for both the p - and n - type sides , figure 5a clearly shows that the current of the interface between the cationic and anionic gels , which is passing through only one direction , originates directly from the doping effect of the gels . a i versus u plot for pn junction formed with p - and n - type gels ( p4-n4 ) , b i versus u plot for the junction formed with neat gels ( p1-n1 ) in this study , we have shown that p- and n - type doped hydrogels can be synthesized and be used to built pn junction . the synthesis of these gels and making junctions are more simple , inexpensive , and scalable than traditional pn junctions . the current voltage characteristic of the polymeric pn junction can be changed by changing doping concentration , swelling ratio etc that will be discussed in our feature works . the percentage of the standard deviations changes around 20% as can be seen from fig . the reasons for this high standard deviations can be explained by the following arguments : ( 1 ) the electrical futures of these gels depend strictly on the swelling ratio of the gels as can be seen from fig . 3 and from the detailed discussion given in a recent work and ( 2 ) on the internal morphology ( nonergodicity or random distribution of the heterogeneous regions in the gels ) . this strict volume dependence and the randomness of the internal distributions of the heterogeneous regions set a barrier for comparison of the samples from the point of the current amplitudes due to the difficulties to bring the gels to exactly the same swelling ratios and to repeat the synthesis with exactly the same internal morphology . therefore , the stability and reversibility problems need detailed experiments and probably more controllable polymer synthesis . this article is distributed under the terms of the creative commons attribution noncommercial license which permits any noncommercial use , distribution , and reproduction in any medium , provided the original author(s ) and source are credited .

in this study , we synthesized the new kinds of semiconducting polymeric gels having negative ( n - type ) and positive ( p - type ) counter ions as charge carriers . the polyacrylamide gel was doped with pyranine ( 8-hydroxypyrene-1,3,6-trisulfonic acid , trisodium salt ) , havingions as side groups and na+ as counter ions , so - called p - type semiconducting gel . the doping process was performed during the polymerization where the pyranine binds to the polymer strands over oh group chemically via radical addition . in a similar way , n - isopropylacrylamide ( nipa ) gel was doped with methacrylamidopropyltrimethyl ammonium chloride ( maptac ) , having cl as counter ions , so - called n - type semiconducting gel . here maptac was embedded by copolymerization within the polymer network ( nipa ) . these semiconducting gels can show different electrical properties by changing the concentration of the doping agents , swelling ratio etc . we have shown that the pn junction , formed by combining p - type and n - type gels together in close contact , rectifies the current similar to the conventional si and ge diodes .

humans have domesticated animals and plants through selective breeding , producing individuals with specific traits deemed beneficial ( hazel 1950 ) . hunting and plant harvesting can have selective , evolutionary effects on wildlife behavior and wildlife and plant morphology ( skogland 1989 ; mcgraw 2001 ; harris et al . 2002 ; coltman et al . 2003 ) . fishing can also be selective on certain life history traits ; many types of fishing gear are designed to remove some individuals in preference to others ( todd and larkin 1971 ; hamley 1975 ; law 2000 ; kuparinen et al . overall , human exploitation can cause significant changes to life history and morphological traits of wild populations , including fish ( darimont et al . larger fish are preferentially harvested to ( i ) avoid growth and recruitment overfishing , ( ii ) reduce harvesting and processing costs , and ( iii ) meet market demands for bigger fish ( walters and martell 2004 ) . the common phenotypic effect of fishing ( i.e. , reduction in mean age and size ) is widely known ( trippel 1995 ; hutchings 2004 ) , but more recently the possible genetic effects of fishery selection on life history traits such as age and size at maturity have received attention ( policansky 1991 ; law 2000 ; olsen et al . 2004 ; kuparinen and merila 2007 ) . experimental exploitation studies on captive atlantic silversides ( menidia menidia ) showed evolutionary effects of size - selective mortality on somatic growth , yield , and population biomass , among other traits ( conover and munch 2002 ; walsh et al . the researchers concluded that these effects were caused by selection of genotypes with variable growth rates . among wild populations , significant reductions in age and size at maturity in many canadian atlantic cod ( gadus morhua ) stocks coincided with dramatic decreases in abundance , and some scientists have suggested that heavy , size - selective fishing contributed to these life history changes ( hutchings and myers 1994 ; olsen et al . 2004 ) . most forms of fishing gear can be size - selective , but few studies have quantified fishery selection ( but see sinclair et al . such quantifications , though rare ( fenberg and roy 2008 ) , are necessary to reliably evaluate the consequences of fisheries - induced selection ( law 2007 ; hutchings and fraser 2008 ; kuparinen et al . comparison of the sizes and ages of fish that are caught with those that are not caught is essential for understanding the patterns of size selection , but such data are very difficult to obtain in most wild fish populations and fisheries . gillnets are especially size - selective because a fish is only caught if it is small enough to enter the mesh but large enough to become entangled by it ( hamley 1975 ; ricker 1981 ; bromaghin 2005 ) . however , selectivity curves for gillnets of specific sizes are difficult to determine , even with experimental fishing using gillnets of known mesh size ( todd and larkin 1971 ) . additionally , the use of multiple sizes of gillnets , as is frequently the case in commercial fisheries , makes the gillnet selectivity curves even more difficult to estimate . fishermen are often secretive about the sizes of gillnets they use and may change gear during a season . finally , many characteristics of fish and fisheries can further complicate size selection patterns , including seasonal migration timing of components of fish stocks that differ in age and size , temporal variation in fishing schedule and intensity , and the efficiency of the fishery when open . studies of gillnet fishery selection on pacific salmon ( oncorhynchus spp . ) are aided by their anadromous and semelparous life history . all salmon that pass through the fisheries and migrate into freshwater ( termed the escapement ) are maturing adults . these salmon can be counted and sampled for size and age , and those data can then be directly compared with data on samples from the catch because little natural mortality or growth typically takes place during this brief period . ricker ( 1981 ) used catch and escapement data from british columbia , canada populations of all five pacific salmon species and reported that fishery selection contributed to decreasing trends in age and body size in many populations , though he noted that these traits are affected by numerous factors . given the effects of density ( i.e. , competition ) and climate on growth and age at maturity of salmon ( e.g. , rogers and ruggerone 1993 ; pyper and peterman 1999 ; reviewed in quinn 2005 ) , it is important to carefully document fishery selection patterns over sufficient time periods that enable evolutionary changes to occur before associating fisheries with life history trait changes . in this study , commercial gillnet fishery catch and escapement data from 1946 to 2005 were used to quantify the magnitude and nature of selection on age and size at maturity for a commercially important and biologically diverse population complex of sockeye salmon ( o. nerka ) from the nushagak district of bristol bay , southwest alaska . this is an ideal study system because ( i ) there are long term data on size , age , and sex of sockeye in both the catch and the escapement ; ( ii ) the fishery exploits a large percent of the run each year ; and ( iii ) excellent records on the management of the fishery have been maintained over time , allowing us to examine the effects of covariates on the magnitude and direction of selection . first , few studies have quantified harvest selection in wild populations over the extended time periods needed to assess possible long term effects . previous studies in bristol bay , for example , only examined data over short time periods ( burgner 1964 ; bue 1986 ; hamon et al . most commercial fisheries occur over long time periods and experience many changes in environmental conditions , fishing technologies , and management schemes , so variation in selection may occur for a number of reasons . ( 2009 ) postulated that harvest selection can be a consistent force , and we wanted to explore annual patterns of selection over many years on a wild population . second , in many harvest selection studies , only the ages and sizes of individuals that are caught are known ; life history traits of individuals that are not caught are unidentified or only indirectly estimated ( but see carlson et al . 2007 ; we employed traditional methods to calculate yearly selection metrics , including selection differentials and vulnerability profiles , and we measured long term trends in these metrics . using this information we first determined whether the fishery has been generally size - selective over the past six decades . we then assessed the extent to which this selection has changed over the period of record , considering specifically the effects of changes in gear , fishing rate , and average fish body size . we did not seek to determine explicitly whether fishery selection in this system is leading to changes in age and size at maturity , as that topic can only be fully addressed after the selection itself has been quantified ( hutchings and fraser 2008 ) , and the effects of selection are integrated with the environmental factors that also affect growth and maturation . however , we present data to help assess the possible evolutionary and ecological consequences of the size - specific fishing pressure at a basic level . 1 ) , produces one of the most abundant and biologically diverse sockeye salmon runs in the world , and these salmon have been exploited by a commercial gillnet fishery since 1884 ( bue 1986 ) . the recent 25-year average total run size was 35 million fish , with an average annual catch of 24 million . 1 ) . sockeye salmon migrate through the nushagak bay on their way to spawn in three separate basins : the igushik , nushagak , and wood river systems ( fig . one other basin , the snake river , is so small and supports so few salmon that it is not considered . most sockeye salmon spawning in these systems spend 1 or , less frequently , 2 years rearing in lakes before migrating to sea , where they spend 14 ( typically 2 or 3 ) more years , returning in june - july and spawning in july - september ( quinn et al . the five fishing districts , and associated freshwater systems , of bristol bay , alaska , including the nushagak district . the history of the bristol bay sockeye fishery is well documented and knowledge of its management and its many changes allows greater understanding of the nature of fishery selection . commercial fishing began in the 1880s using fish traps and gillnets fished from wooden sailboats . motorized boats were not permitted until 1951 , at which time 32 feet was fixed as their maximum length . motorized vessels have evolved with technology , though the length regulation remains in effect ( link et al . mesh size has been regulated in bristol bay since 1924 , first at a minimum of 5 inches ( 146 mm ) and then , in 1962 , at a minimum of 5 inches ( 136.5 mm ) to lessen fishing pressure on larger sockeye . these early regulations were intended to increase profitability without reducing spawning success by increased the catch of longer sockeye , including more males , and allowed smaller fish , mostly females , to escape ( bue 1986 ; link et al . after the 1984 season , minimum gillnet mesh size regulations were ended and , since then , for the majority of the season , mesh size is not standardized , though in some years regulations to reduce exploitation of chinook salmon ( o. tshawytscha ) are enacted for short periods of time ( tim sands , alaska department of fish and game , pers . prior to 1951 most gillnets were made of cotton or linen twine , which caught fish of a narrow size range . multi - strand nylon web gillnets came into use in 1952 , followed by multi - strand nylon monofilament web in 1981 . these materials were superior to cotton and linen , catching more fish of a greater range of sizes because they were lighter , more transparent , and more elastic ( bue 1986 ) . since the 1950s the bristol bay sockeye salmon fisheries have been managed to achieve an escapement goal based on the carrying capacity of the system for spawning by adults and rearing by juveniles ( link et al . fisheries are opened conservatively based on predicted run timing to ensure that escapement goals are met ; after that , fisheries are opened to a greater extent . therefore , fishing rate often changes over the course of the season ( quinn et al . the fishery has also seen different levels of sockeye abundance over time , and the varying proportions of the run being caught may affect selectivity . since 1946 , 1986% of the annual sockeye salmon run in the nushagak district was caught , with an average harvest of 54% ( fig . this harvest percentage was high in the first years of this dataset , decreased in the 1960s and 1970s , and has been increasing since the late 1970s . changing ocean environments and other factors caused increased sockeye salmon runs to bristol bay after 1978 , also escalating catch rates ( hilborn et al . number of sockeye salmon in the nushagak district run and proportion of the run caught by the fishery , 19462005 . since 1946 scientists and fishery managers have estimated the nushagak district sockeye salmon catch and escapement , and collected age , sex , and length ( asl ) data on individual fish on a daily basis throughout the fishing and escapement periods . at fish processing plants , catch numbers are estimated and a sample ( range : 10656643 fish per year ) is measured for length and weight , scales are collected to be read for age determination , and sex of each fish is recorded . the wood , nushagak , and igushik rivers have counting towers or sonar devices to enumerate upstream migrating salmon that have escaped the fisheries . beach seine nets , which collect adults of all sizes , are used to sample the escapement for asl data each day ( range : 1503542 fish per year per river ) . daily catch and escapement counts were available from 1946 to 1959 but raw asl data were not available during this time . ( 1963 ) by measuring a sample of the salmon for asl and expanding these by the overall counts during the sampling time periods . therefore , from 1946 to 1959 these calculations , rather than data on individual fish , were used to characterize fishery selection . no data were available from 1960 to 1962 , and daily counts and asl data from individual fish were used from 1963 to 2005 . we used the yearly asl data to characterize length and length at age for all sockeye salmon in the nushagak district , treating males and females separately . because sockeye salmon of different ages , sizes , and sexes may enter the fishery and migrate upriver at different times ( older and larger fish generally enter earlier ; quinn 2005 ) and fish abundance varies greatly throughout the season , it would be imprecise to average length and age data on a seasonal basis to characterize the catch and escapement . therefore , daily asl data were used to estimate the distribution and abundance of all sockeye sizes and ages by weighting the number of fish sampled daily of a given age , length , and sex by the total number of caught or escaped on that day . on days when asl data were not collected , we estimated sockeye salmon length by interpolation from adjacent days with data . we characterized the age , sex , and length of all individuals escaping into each of the three rivers to avoid biases resulting from variation in proportions migrating to each river among years . to calculate the total escapement on a given day we first performed analyses on fish of all ages and then grouped fish by the number of years that they had been in the ocean ( ocean age ) . because salmon put on > 99% of their weight at sea , ocean age largely determines their overall size ( quinn 2005 ) , and thus vulnerability to being caught in a gillnet . if < 40 fish of each of these ages were examined for asl within a given year for the escapement into any of the three river systems , calculations were not made for that year . to calculate the total number of fish being caught or escaping of a given age , we multiplied the total catch or escapement by the proportion of fish of a given age group on a daily basis . we assumed that fish of all sizes and age groups , had , on average , equal contact with the fishery ( i.e. , opportunity to get caught ) in a given year and that differential fishing mortality was due to the effects of the gillnet fishery rather than some other attribute , such as migration route . fishing occurs throughout the nushagak fishing district , close to shore and in the open water , and the fishery is very effective at catching fish ( tim sands , alaska department of fish and game , pers . doctor ( 2008 ) provided evidence of subtle differences in migration timing among some populations within the nushagak fishing district but this complex , like others in bristol bay , is characterized by compressed migration timing and broad overlap among the components . for each year that data were available , we calculated exploitation ratio ( total proportion caught ) for fish of each age group ( all ages , ocean age 2 , and ocean age 3 ) and sex on a yearly basis ( py , a , s ) ( equation 1 ) . where cy , a , s is the number of fish of a certain age and sex caught in a given year and ey , a , s is the number of fish of a given age and sex in the escapement in that year . we also created yearly length and length at age frequency histograms ( in 10 mm bins ) of sockeye salmon in the catch and escapement to reconstruct their distribution in the total run . next we constructed yearly gillnet vulnerability profiles for each sex and age group showing , for each length bin , the proportion of fish that were caught ( lagler 1968 ) . proportions caught were calculated for a given length and age ( py , a , l ; equation 1 ) . for each year , proportions were scaled to 1 by dividing the proportion for each length by the maximum proportion within that year , allowing comparisons between years . the proportion caught was calculated only for length bins for which more than 3000 fish of all ages or 2000 fish of ocean ages 2 or 3 were caught on a given day to prevent inaccurate results due to small sample sizes . we calculated yearly length - based standardized selection differentials ( ssdy ) for each sex and ocean age ( equation 2 ) . this value is the difference in mean length of fish in the run ( , where ) versus those in the escapement ( ) ( i.e. , before versus after fishing ) ( law and rowell 1993 ) divided by the standard deviation of length of fish in the run ( ) to allow comparison between years . confidence bands about the vulnerability profiles and ssds were determined by bootstrapping the asl data on a daily basis , with 500 replicates per year ( 0.025 and 0.975 quantiles of the replicates ) . to better understand how changing fishery management , run size , fish size , and catch levels have affected selection over time , we performed ordinary least squares regression analysis of the form : these models regressed ssds and year - specific subsets of the following factors : ( i ) gillnet mesh size regulations ( as a categorical variable ) , ( ii ) run size , ( iii ) length deviation from the long term average , and ( iv ) date at which half of the total catch is reached ( catch date, which describes fishery timing ) . all regressions were performed for fish of each sex and ocean ages 2 and 3 separately because these groups were selected differently by the fishery . interactions among all factor combinations were examined for significance along with temporal autocorrelation , and the best models were chosen based on akaike information criterion with a second order correction for small sample sizes ( aicc ) ( burnham and anderson 2002 ) and r values . aicc values show how well a model fits the data without being overparameterized and r values show how much of the variation in the data is explained by each model . we picked the model that had the lowest aicc value and used the r value to support these decisions . 1 ) , produces one of the most abundant and biologically diverse sockeye salmon runs in the world , and these salmon have been exploited by a commercial gillnet fishery since 1884 ( bue 1986 ) . the recent 25-year average total run size was 35 million fish , with an average annual catch of 24 million . 1 ) . sockeye salmon migrate through the nushagak bay on their way to spawn in three separate basins : the igushik , nushagak , and wood river systems ( fig . one other basin , the snake river , is so small and supports so few salmon that it is not considered . most sockeye salmon spawning in these systems spend 1 or , less frequently , 2 years rearing in lakes before migrating to sea , where they spend 14 ( typically 2 or 3 ) more years , returning in june - july and spawning in july - september ( quinn et al . the five fishing districts , and associated freshwater systems , of bristol bay , alaska , including the nushagak district . the history of the bristol bay sockeye fishery is well documented and knowledge of its management and its many changes allows greater understanding of the nature of fishery selection . commercial fishing began in the 1880s using fish traps and gillnets fished from wooden sailboats . motorized boats were not permitted until 1951 , at which time 32 feet was fixed as their maximum length . motorized vessels have evolved with technology , though the length regulation remains in effect ( link et al . mesh size has been regulated in bristol bay since 1924 , first at a minimum of 5 inches ( 146 mm ) and then , in 1962 , at a minimum of 5 inches ( 136.5 mm ) to lessen fishing pressure on larger sockeye . these early regulations were intended to increase profitability without reducing spawning success by increased the catch of longer sockeye , including more males , and allowed smaller fish , mostly females , to escape ( bue 1986 ; link et al . after the 1984 season , minimum gillnet mesh size regulations were ended and , since then , for the majority of the season , mesh size is not standardized , though in some years regulations to reduce exploitation of chinook salmon ( o. tshawytscha ) are enacted for short periods of time ( tim sands , alaska department of fish and game , pers . prior to 1951 most gillnets were made of cotton or linen twine , which caught fish of a narrow size range . multi - strand nylon web gillnets came into use in 1952 , followed by multi - strand nylon monofilament web in 1981 . these materials were superior to cotton and linen , catching more fish of a greater range of sizes because they were lighter , more transparent , and more elastic ( bue 1986 ) . since the 1950s the bristol bay sockeye salmon fisheries have been managed to achieve an escapement goal based on the carrying capacity of the system for spawning by adults and rearing by juveniles ( link et al . fisheries are opened conservatively based on predicted run timing to ensure that escapement goals are met ; after that , fisheries are opened to a greater extent . therefore , fishing rate often changes over the course of the season ( quinn et al . the fishery has also seen different levels of sockeye abundance over time , and the varying proportions of the run being caught may affect selectivity . since 1946 , 1986% of the annual sockeye salmon run in the nushagak district was caught , with an average harvest of 54% ( fig . this harvest percentage was high in the first years of this dataset , decreased in the 1960s and 1970s , and has been increasing since the late 1970s . changing ocean environments and other factors caused increased sockeye salmon runs to bristol bay after 1978 , also escalating catch rates ( hilborn et al . number of sockeye salmon in the nushagak district run and proportion of the run caught by the fishery , 19462005 . since 1946 scientists and fishery managers have estimated the nushagak district sockeye salmon catch and escapement , and collected age , sex , and length ( asl ) data on individual fish on a daily basis throughout the fishing and escapement periods . at fish processing plants , catch numbers are estimated and a sample ( range : 10656643 fish per year ) is measured for length and weight , scales are collected to be read for age determination , and sex of each fish is recorded . the wood , nushagak , and igushik rivers have counting towers or sonar devices to enumerate upstream migrating salmon that have escaped the fisheries . beach seine nets , which collect adults of all sizes , are used to sample the escapement for asl data each day ( range : 1503542 fish per year per river ) . daily catch and escapement counts were available from 1946 to 1959 but raw asl data were not available during this time . ( 1963 ) by measuring a sample of the salmon for asl and expanding these by the overall counts during the sampling time periods . therefore , from 1946 to 1959 these calculations , rather than data on individual fish , were used to characterize fishery selection . no data were available from 1960 to 1962 , and daily counts and asl data from individual fish were used from 1963 to 2005 . we used the yearly asl data to characterize length and length at age for all sockeye salmon in the nushagak district , treating males and females separately . because sockeye salmon of different ages , sizes , and sexes may enter the fishery and migrate upriver at different times ( older and larger fish generally enter earlier ; quinn 2005 ) and fish abundance varies greatly throughout the season , it would be imprecise to average length and age data on a seasonal basis to characterize the catch and escapement . therefore , daily asl data were used to estimate the distribution and abundance of all sockeye sizes and ages by weighting the number of fish sampled daily of a given age , length , and sex by the total number of caught or escaped on that day . on days when asl data were not collected , we estimated sockeye salmon length by interpolation from adjacent days with data . we characterized the age , sex , and length of all individuals escaping into each of the three rivers to avoid biases resulting from variation in proportions migrating to each river among years . to calculate the total escapement on a given day we first performed analyses on fish of all ages and then grouped fish by the number of years that they had been in the ocean ( ocean age ) . because salmon put on > 99% of their weight at sea , ocean age largely determines their overall size ( quinn 2005 ) , and thus vulnerability to being caught in a gillnet . if < 40 fish of each of these ages were examined for asl within a given year for the escapement into any of the three river systems , calculations were not made for that year . to calculate the total number of fish being caught or escaping of a given age , we multiplied the total catch or escapement by the proportion of fish of a given age group on a daily basis . we assumed that fish of all sizes and age groups , had , on average , equal contact with the fishery ( i.e. , opportunity to get caught ) in a given year and that differential fishing mortality was due to the effects of the gillnet fishery rather than some other attribute , such as migration route . fishing occurs throughout the nushagak fishing district , close to shore and in the open water , and the fishery is very effective at catching fish ( tim sands , alaska department of fish and game , pers . doctor ( 2008 ) provided evidence of subtle differences in migration timing among some populations within the nushagak fishing district but this complex , like others in bristol bay , is characterized by compressed migration timing and broad overlap among the components . for each year that data were available , we calculated exploitation ratio ( total proportion caught ) for fish of each age group ( all ages , ocean age 2 , and ocean age 3 ) and sex on a yearly basis ( py , a , s ) ( equation 1 ) . where cy , a , s is the number of fish of a certain age and sex caught in a given year and ey , a , s is the number of fish of a given age and sex in the escapement in that year . we also created yearly length and length at age frequency histograms ( in 10 mm bins ) of sockeye salmon in the catch and escapement to reconstruct their distribution in the total run . next we constructed yearly gillnet vulnerability profiles for each sex and age group showing , for each length bin , the proportion of fish that were caught ( lagler 1968 ) . proportions caught were calculated for a given length and age ( py , a , l ; equation 1 ) . for each year , proportions were scaled to 1 by dividing the proportion for each length by the maximum proportion within that year , allowing comparisons between years . the proportion caught was calculated only for length bins for which more than 3000 fish of all ages or 2000 fish of ocean ages 2 or 3 were caught on a given day to prevent inaccurate results due to small sample sizes . we calculated yearly length - based standardized selection differentials ( ssdy ) for each sex and ocean age ( equation 2 ) . this value is the difference in mean length of fish in the run ( , where ) versus those in the escapement ( ) ( i.e. , before versus after fishing ) ( law and rowell 1993 ) divided by the standard deviation of length of fish in the run ( ) to allow comparison between years . confidence bands about the vulnerability profiles and ssds were determined by bootstrapping the asl data on a daily basis , with 500 replicates per year ( 0.025 and 0.975 quantiles of the replicates ) . to better understand how changing fishery management , run size , fish size , and catch levels have affected selection over time , we performed ordinary least squares regression analysis of the form : these models regressed ssds and year - specific subsets of the following factors : ( i ) gillnet mesh size regulations ( as a categorical variable ) , ( ii ) run size , ( iii ) length deviation from the long term average , and ( iv ) date at which half of the total catch is reached ( catch date, which describes fishery timing ) . all regressions were performed for fish of each sex and ocean ages 2 and 3 separately because these groups were selected differently by the fishery . interactions among all factor combinations were examined for significance along with temporal autocorrelation , and the best models were chosen based on akaike information criterion with a second order correction for small sample sizes ( aicc ) ( burnham and anderson 2002 ) and r values . aicc values show how well a model fits the data without being overparameterized and r values show how much of the variation in the data is explained by each model . we picked the model that had the lowest aicc value and used the r value to support these decisions . length frequency histograms showed variation in the length and length at age distributions of males and females over time . as expected , ocean age 3 fish were longer than ocean age 2 fish and males were longer than females for a given age , though overlap was observed among these groups . patterns of catch and escapement length distributions have also varied greatly among years , suggesting differing patterns of fishery selection . total yearly exploitation rates , or proportions of the fish that were caught , increased significantly over the years for males and females and fish of all age groups ( p < 0.05 ; fig . 3 ) , but they increased more for ocean age 2 fish ( of both sexes ) than for ocean age 3 fish . in most years , the proportion of males caught was higher than that of females . this difference was attributable to ocean age 2 fish ; from 1963 to 2005 , an average of 51% of ocean age 2 males were caught compared to 42% of ocean age 2 females . for ocean age 3 fish , an average of 62% of males and 64% of females were caught , and on average 57% of males and 54% of females of all ages were caught . proportion of the nushagak district sockeye salmon run caught of ( a ) all ages , ( b ) ocean age 2 , and ( c ) ocean age 3 as a function of ocean age and sex , 19632005 . vulnerability profiles revealed significant differences by length within and between sex and age groups over time ( fig . 4 ) , 1s . for females of all ages , longer fish ( > 550 mm ) were most vulnerable during earlier years , indicating directional selection favoring smaller fish ( fig . 4a ) . in later years vulnerability peaked at medium - long lengths , indicating disruptive selection favoring shorter and also the very longest fish . in only 2 years , 1991 and 2001 , vulnerability was highest for the shortest females ( < 450 mm ) and decreased for longer fish . vulnerability profiles for males of all ages were generally similar to those of females ( fig . 4b ) . however , in most years , even the early ones , the longest males ( > 600 mm ) were less vulnerable than the longest females , and male vulnerability curves peaked for the medium - long fish rather than the longest . this suggests that fishery selection on males has been less directional and more disruptive , compared to females . in recent years length vulnerability profiles of female ( a ) and male ( b ) sockeye salmon of all ages from 1946 to 2005 in the nushagak district . dotted black lines indicate the 95% confidence intervals ; data were insufficient for calculations in the early years . we found inconsistent patterns of vulnerability to the fishery over time for ocean ages 2 and 3 sockeye salmon . longer ocean age 2 fish were , in many years , most vulnerable to the fishery . however , in other years vulnerability profiles were dome - shaped or showed that shorter fish were most vulnerable . in the early years ( < 1979 for females , < 1973 for males ) , longer ocean age 3 fish were consistently more vulnerable than smaller fish . this pattern then weakened for both sexes , and in the later years smaller fish were most vulnerable , especially males . the different size selection patterns between ocean age 2 and 3 fish were consistent with the greater size of the ocean age 3 fish . however , the overlap in length distributions of the two ages and the generally greater length of males than females made overall fishery vulnerability patterns complicated . thus , the fishery has been size - selective but the most vulnerable length was not always the largest ; it depended on the combination of year , sex , and age of the fish . in 91% of the years ( 52 of 57 ) , ssds for female sockeye salmon of the nushagak district were negative , indicating that the fishery was catching longer than average fish ( fig . however , ssds for females have decreased in magnitude over time and in some recent years they have been positive . however , since 1965 positive or 0 ssds were evident in many years , showing that length selection has become weaker and less directional . standardized selection differentials for female and male sockeye salmon of all ages ( 19462005 ) and ocean age 2 and 3 ( 19632005 ) of the nushagak district . ocean age 2 females that escaped to spawn were , for the most part , shorter than fish in the run as a whole ( i.e. , before fishing ; fig . selection changed direction in 1982 . in 85% of the years ( 11 of 13 ) before that year ssds were positive , indicating that on average shorter males were caught than escaped . however , after 1982 ssds were mostly negative ( in 88% of years ) , so longer males were caught . in the most recent years , the selective trend has weakened and become variable . size selection on females and males of ocean age 3 was inconsistent over time ( fig . 5c ) . for females , in earlier years ( < 1979 ) all ssds were negative , but in 14 of 27 ( 52% ) years since then ssds were positive . a similar long term pattern was revealed for males . before 1973 , all 8 years with data had negative ssds but since then ssds were positive in most years ( 20 of 31 or 65% ) . regression models were consistent for male and female sockeye salmon of the same age group ( table 1 ) . factors most often included in the best fit models to explain ssds included gillnet mesh size regulation , run size , and fish length deviation from the long term average . for ocean age 2 fish , the best models included length deviation from the long term average and gillnet mesh size regulation . ssds increased , becoming more positive ( signifying weaker selection on big fish ) , as length deviation increased , mesh size decreased , and abundance of salmon increased . more complex models , which had higher r values of 0.540.56 , including ( i ) both gillnet mesh size regulation and run size and ( ii ) mesh size regulations , run size , and length deviation , explained selection best for ocean age 3 sockeye ; the factors affected ssds in the same way they did for ocean age 2 fish . significant first - order temporal autocorrelation was found for ssd regressions of ocean age 2 male fish . however , such autocorrelations were not detected for females of any age , nor for ocean age 3 males , so we did not analyze this factor further . models that best predicted standardized selection differentials ( ssds ) for sockeye salmon in the nushagak district , 19632005 , based on aicc and r values aicc , akaike information criterion with a second order correction ; ar1 , significant first - order autocorrelation coefficient . our study fills a need for quantifying the intensity of harvest selection and estimating selection differentials directly ( law 2007 ; kuparinen et al . examination of age- and size - selective harvest of sockeye salmon in a commercial gillnet fishery over 57 years revealed higher susceptibility and exploitation of older and larger fish in most years . this overall result confirmed the general belief that larger is more vulnerable, but the details of our findings revealed a much more intricate and variable pattern of exploitation and vulnerability ( fig . sockeye salmon runs with varying sex ratios and proportions of age classes experienced different selection patterns due to sex- and age - specific difference in fishery selectivity . the gillnet vulnerability curve and the selectivity of the fishery depend on the size distribution of fish that encounter the nets . in the nushagak district fishery , age composition , and thus length frequency , can change dramatically from year to year due to ocean conditions and the strength of different brood years , which can affect the vulnerability curves and size - selectivity . in most years more males than females and more ocean age 3 than ocean age 2 fish were caught ( fig . fishery selection was strongly directional in the early years ( 1946early 1970s ) ; longer fish were more vulnerable to the fishery than smaller fish ( fig . 4 ) . however , during and after the 1970s size selection became less directional and more disruptive , especially for males ; fish of intermediate lengths have been the most vulnerable . in many years more large females were caught than large males ( figs 4 and 5 ) because male sockeye salmon are , on average , longer than females . recently , the magnitude of fishery selection has decreased and the fishery has not consistently selected for or against fish of a given length ( fig . 5 ) . in this fishery , gillnet mesh size regulations , salmon abundance , and deviation in fish length from long term average were the most important variables affecting selectivity ( table 1 ) . when salmon were very numerous , larger fish experienced less selection than in years when there were fewer fish . the likely explanation is that when salmon were abundant the overall exploitation increased ( because the number allowed to escape to spawn is fixed ) and so the more intense fishing pressure caught more fish of all sizes . the effects of gillnet mesh size regulations were more obvious ; mandates for larger mesh sizes and regulations prohibiting the use of smaller mesh increased the catch of larger fish . finally , in years when the fish were larger , the largest fish tended to escape , likely because they were too big to be caught . short - term variability in size - selection patterns was due to different combinations of these factors . delta aic values were < 2 for all models shown in table 1 , indicating that each had similar support . for female fish , significant interactions were detected between year and length deviation and between year and run size . this suggests that for females , the effects of length deviation and run size on selectivity varied over time . just as age composition and length frequency changes can affect fishery selection patterns , changes in population composition over time different patterns of fishery selection and exploitation will be revealed at different spatial scales . assessing fishery selection on a fishing district scale is important because that is the level at which management actions occur ( minard and meacham 1987 ) . examining harvest selection on a population - level scale is important because that is the scale at which many processes of natural and sexual selection act . yearly estimates of the proportion of each spawning population passing through the fishery are not available . however , catch and escapement for the three main rivers that drain into the nushagak district ( thus a finer spatial scale than the district as a whole but not as fine as discrete spawning populations ) have been estimated ( adfg unpublished data ; kendall and quinn , in press ; branch and hilborn , in review ) . to assess how different proportions of fish returning to these river influenced fishery selection , we quantified the run size for each watershed and included the proportion of the run migrating to the wood river system ( the watershed typically with the largest run size ) as an additional parameter in our linear regressions of nushagak district - wide ssds . we found that for females , but not males , the proportion of the run heading to the wood river was a significant parameter in models explaining ssds . we also extended our fishery selection quantification to the finer spatial scale , quantifying population - specific exploitation rates , ssds , and vulnerability profiles ( kendall and quinn , in press ) . these analyses revealed that fishery selection and exploitation have not been uniform on populations that differ in average age and length . a long term , decadal perspective of harvest selection on a wild population is necessary to understand potential genetic changes that can result . short term studies may draw incomplete conclusions about the selective nature of harvest , and studies that examine only life history or morphological endpoints of wild populations ( e.g. , yoneda and wright 2004 ; hamilton et al . 2007 ) may not reveal annual variability and intermediary processes within a population that can have broader ecosystem impacts . for example , burgner ( 1964 ) found that gillnets in the nushagak district fishery were highly selective on larger , ocean age 3 fish , particularly females during 19461959 . thus , using only burgner 's results may produce different conclusions about fishery selection patterns and their potential implications than are indicated by a longer perspective . much recent research has focused on evolution of life history traits in wild fish stocks , both marine and freshwater ( law 2000 ; olsen et al . 2007 ) , and in wildlife ( coltman et al . 2003 ) due to size - selective harvest . in some studies size - selectivity was not directly measured but was assumed to be directional due to gear type used . our results demonstrate that even when size - selective gear is used and a large proportion of the stock is exploited , harvest selection is not necessarily consistent or predictable . thus , in modeling the effects of fishery and harvest selection and understanding ecosystem effects of such exploitation , scientists and managers can not assume consistent , directional selection and the consequences of such . in general , large size at seawater entry or rapid early growth at sea results in early age at maturation , and the older ( and ultimately larger ) fish are the slower - growing members of the cohort . the effects of disruptive harvest selection on norms of reaction are further complicated by differences in selection between males and females , resulting in uncertain overall consequences for the fish . thus , the variable nature of fishery selection over time in the nushagak district fishery , and likely many other fisheries , may hinder evolution of fish towards an optimal life history . an additional consideration is that there are many spawning populations within the nushagak district that were sampled collectively in our study . here we have assessed fishery selection at the fishing district scale and grouped all populations together . however , these populations have consistent differences in average age at maturity and length at age , and so their patterns of exploitation and selection also vary ( kendall and quinn , in press ) . we estimated length - based gillnet fishery selection , but a fish 's girth probably has more influence on its vulnerability to a gillnet rather than length per se . unfortunately , girth data are not available in the nushagak district , nor are they in many fisheries data sets , and they can not be calculated from the available data . regier ( 1969 ) found that unless precise girth measurements can be taken at the mesh mark , it is better to use length to understand fishery selection . still , girth is an important consideration in fishery selectivity , and because male and female salmon of the same length may have a different girth and shape , the actual selectivity patterns of male and female salmon may differ from those estimated from length data . our results revealed that the nushagak district fishery has caught longer than average fish during most of the past 60 years . from an ecological standpoint , beyond the reduction in abundance of spawning adults that inevitably results from fishing , size - selective fishing can reduce per capita productivity if the small fish that survive to breed produce fewer eggs than would have been produced by the prefishery size distribution . using the mean and maximum selection differentials observed for female sockeye salmon in the nushagak district , we estimated the decrease in egg production by females of average length due to such fishery selection using extensive length - fecundity data from the wood river system ( quinn et al . the average fishery selection differential from 1946 to 2005 was 8 mm , reducing the fecundity of an average female by only 5% ( 104 eggs ) . at the greatest observed selection differential ( 29 mm ) , the average female spawner would have 12% fewer eggs . there are undoubtedly other kinds of ecological effects of size - selection ( for example , larger females dig deeper nests than smaller females ; steen and quinn 1999 ) but these lines of evidence suggest that the numerical consequences of the selective fishery in this system have not been great . from an evolutionary viewpoint , it is of great interest whether nushagak district sockeye salmon , and others subject to size - selective harvest , have become smaller and younger as a direct result of such harvest . size selection patterns by the nushagak fishery , and likely many other fisheries , have varied over time , in part due to stochasticity of environmental and management conditions . in addition , they have also been affected by variation in population contribution over time ( kendall and quinn , in press ) . size and age at maturity of adult salmon are influenced by many factors , including but not limited to density of conspecifics , density of other salmon species , and ocean conditions ( rogers and ruggerone 1993 ; pyper and peterman 1999 ; ruggerone et al . thus , evolutionary effects of fishing can not be revealed without careful consideration of the many factors affecting growth and maturation . calculation of probabilistic maturation reaction norms ( dieckmann and heino 2007 ) is a way to integrate these effects with fishery selection ( e.g. , fukuwaka and morita 2008 ) . also from an evolutionary perspective , fish whose maturation size coincides with that of maximum vulnerability to its fishery could adjust their size or age to reduce the probability of being caught . a fish given age or mature at an earlier or later age and thus at a different size . overall , the nushagak district fishery has caught larger than average , but not the largest , sockeye salmon . in general this corresponds to large ocean age 2 fish and smaller ocean age 3 fish , and thus to reduce the probability of being caught , ocean age 2 fish should grow slower and ocean age 3 fish should grow faster . this would seem to require a complex change in the reaction norm between growth and probability of maturation that controls variation in age and size within and among populations ( quinn et al . nushagak district sockeye salmon have become both longer and older in recent decades ( fig . 6 ; p = 0.0004 and r = 0.27 for age of males , p = 0.07 and r = 0.09 for age of females ) , consistent with the hypothesis that density - dependent effects in the ocean depress growth and result in a phenotypic shift in age at maturation ( pyper et al . 1999 ; holt and peterman 2004 ) . this finding is inconsistent with the expectation that fisheries - induced evolution causes harvested fish populations to become shorter and younger , as was expressed for iteroparous species ( law and grey 1989 ) . however , the effects of such evolution on anadromous , semelparous fishes such as pacific salmon may be different and should be explored further . proportion of ocean age 3 sockeye salmon in the nushagak district run ( the vast majority of the remaining fish are of ocean age 2 ) , 19632005 . for fish and wildlife populations under size - selective exploitation , it may be important to maintain large numbers of phenotypically diverse breeders to buffer against the detrimental effects of selection ( darimont et al . the nushagak district fishery is managed using biologically - robust escapement goals , which have been increasing in recent years , allowing more sockeye salmon onto the spawning grounds . 1 ) met or exceeded its escapement goal in 85% of the years from 1962 to 2005 ( tim baker , alaska department of fish and game , pers . additionally , for most of the past 60 years , the fishery has not harvested the biggest fish returning to spawn , benefiting the nushagak district stocks in the short- and long - term ( law 2007 ) . the suite of populations thus seems to be very healthy , to the benefit of the ecosystems that depend on them ( naiman et al . thus , the biologically robust escapement goals used to manage the fishery and prevention of harvest of the largest individuals may contribute to the weaker and less consistent size - selectivity in recent years . such escapement goals and gear that spares the largest individuals may be included in a manager 's toolbox to prevent negative effects of size - selective harvest . finally , fishery and natural , including sexual , selection may act in opposition ( carlson et al . 2007 ; hutchings and rowe 2008 ) , and evolutionary trait changes may result from their combined effects ( edeline et al . 2007 ) . for bristol bay sockeye salmon and many other species , age at maturity and length at age result from a blend of natural , sexual , and anthropogenic selection . ecological processes on the spawning grounds that favor large individuals may compensate to some degree for the reduction in the overall numbers of these individuals . the fact remains the larger than average fish have been harvested in most years from the nushagak district sockeye salmon stock . the effects of such harvest selection on wild populations must be examined from many angles , and conclusions must be drawn using long term studies that incorporate ecological , ecosystem , and evolutionary considerations .

life history traits of wild animals can be strongly influenced , both phenotypically and evolutionarily , by hunting and fishing . however , few studies have quantified fishery selection over long time periods . we used 57 years of catch and escapement data to document the magnitude of and trends in gillnet selection on age and size at maturity of a commercially and biologically important sockeye salmon stock . overall , the fishery has caught larger fish than have escaped to spawn , but selection has varied over time , becoming weaker and less consistent recently . selection patterns were strongly affected by fish age and sex , in addition to extrinsic factors including fish abundance , mesh size regulations , and fish length variability . these results revealed a more complex and changing pattern of selective harvest than the larger is more vulnerable model , emphasizing the need for quantified , multi - year studies before conclusions can be drawn about potential evolutionary and ecological effects of fishery selection . furthermore , the results indicate that biologically robust escapement goals and prevention of harvest of the largest individuals may help prevent negative effects of size - selective harvest .

among technical errors which might cause misinterpretation of the us image of the examined focal lesion one can number inter alia artifacts resulting from the volumetric averaging in near and far field . an artifact in the near field can result in lesions localized at depths up to 10 mm not being visualized and small hypoechogenic cancers with hyperechogenic halo may be presented as hypoechogenic lesions . in order to eliminate this type of artifact , use a standoff pad or thick layer of gel is recommended . with particularly large breasts volumetric averaging artifacts in the far field result from the averaging of cyst echogenicity with normal tissues echogenicity localized at the same depth . as a result complex cyst ( arrow ) of uncircumscribed margin , with acoustic shadow behind the lesion , insusceptible to compression , mimicking solid lesion birads - usg 4 inappropriate setting of general enhancement or time gain curve ( tgc ) can have an influence on incorrect differentiation of focal lesions , e.g. neoplastic lesions and cysts . they should be set so that fat tissue echogenicity is identical in preglandular , glandular and post - glandular zone . otherwise fat tissue echogenicity differences at different depths can lead to an incorrect assessment of focal lesion echogenicity , which is assessed in relations to fat tissue ( fig . 4 ) . hyperechogenic focal lesion in relation to fat tissue , of identical echogenicity in particular zones the appropriate range of the ultrasound beam should include the chest wall . to improve penetration , an increase in general beam enhancement and/or compression force on the examined breast can be used . in the case of large breasts , breasts during lactation , breast inflammation , inflammatory cancer or breasts with radiation lesions , the number of errors can be decreased using a linear transducer of lower frequency , e.g. 5 mhz . the last group of technical artifacts are artifacts present in cysts or dilated lactiferous ducts ; they include reverberations , comet tail artifacts and lateral beam artifacts ( fig . transducer head rotation or its slope , the use of harmonic imaging or real time compound imaging may be useful . these can be divided into : false negative results where the assessed lesion is incorrectly identified as too low category in birads - usg classification relative to the histologic verification;false positive results where the assessed lesion is identified as to too high category in birads - usg classification relative to the histologic verification . false negative results where the assessed lesion is incorrectly identified as too low category in birads - usg classification relative to the histologic verification ; false positive results where the assessed lesion is identified as to too high category in birads - usg classification relative to the histologic verification . this can result from : the similarity of some benign lesions and normal breast structures to malignant neoplastic lesions ( false positive results);the similarity of some malignant lesions to normal breast structures or benign lesions ( false negative results);the characteristics of some breast diseases , with the absence of focal lesion ( both false negative and false positive results);lack of visualization of the lesion by the examiner ( false negative results);technical aspects ( false positive and false negative results ) . the similarity of some benign lesions and normal breast structures to malignant neoplastic lesions ( false positive results ) ; the similarity of some malignant lesions to normal breast structures or benign lesions ( false negative results ) ; the characteristics of some breast diseases , with the absence of focal lesion ( both false negative and false positive results ) ; lack of visualization of the lesion by the examiner ( false negative results ) ; technical aspects ( false positive and false negative results ) . false negative results the example can be focal lesions of malignant carcinomas which can mimic normal breast structures or benign lesions , e.g. ductal carcinoma in situ , invasive ductal carcinoma of high grade of histopathological malignancy , mucinous carcinomas , medullary carcinomas , metastases to breasts and also carcinomas in cysts and papillary carcinomas . papillary neoplastic lesions may mimic benign papillomas and other benign hyperplasias ( in the assessment of their character and in identifying their birads category one should take into account their size , localization and ultrasound structure ) ( fig . ductal carcinoma in situ ( dcis ) presenting itself in the us examination as dilated lactiferous duct with dense contents , insusceptible to compression , circumscribed margin of the walls birads - usg 3 in order to avoid incorrect diagnoses , one should use as many techniques enabling lesion character differentiation as possible , such as harmonic imaging , vascularization pattern assessment , compressivity in conventional imaging and in sonoelastography . this last method is particularly useful in the differentiation of focal lesions ( including invasive carcinomas ) from fat lobules which undergoes greater deformability in comparison with solid lesions . fat lobules may be incorrectly interpreted as solid lesions birads 3 or birads 4 or some malignant neoplastic lesions if they have decreased echogenicity or have uncircumscribed margins in us examination . false positive results identifying benign lesions and normal structures incorrectly as malignant neoplasms results most often from alack of knowledge of anatomy and the changes related to the regression of the lobules and stromal fibers of breasts resulting from aging ( that is the ratio of glandular and fat tissue in the breast ) . in the us image hypoechogenic areas mimicking focal lesions are visible , which are in fact fat tissue ( fig . 7 ) . in such situations a series of sections should be done in order to confirm or eliminate the connection of the lesion with the surrounding fat tissue . conversely , complex fibroadenomas , sclerosing , giving acoustic shadow or having angular edges are often classified to birads 4 category , although in the majority of cases they are benign ( fig . 8) . at the present stage of technological ultrasound development similarly , it is impossible to distinguish between papillary neoplasm hyperplasias in the cyst lumen and papillary metaplasia . doppler assessment of lesion vascularization helps to identify birads category ( 4 or 5 ) , in which carcinomas and intercystic papillomas usually have a vascular stem ( fig . b. the same lesion in a different section has the connection with surrounding fat tissue ( arrows ) solid , hypoechogenic lesion , oval , of uncircumscribed margin , blue in elastogramme ( as in lesion insusceptible to deformation ) . examination : fibroadenoma with sclerosing hyperechogenic solid lesion localized intraductally , with visible vascular stem , insusceptible to compression , in patient with high risk nipple discharge . in histopathological examination : papilloma in this group of false positive diagnoses there are also architecture disorders and lesions giving acoustic shadows such as fat tissue necrosis , adenosis sclerosans , scars after surgical procedures , biopsies , radial scar or focal fibrosis ( fig . hypoechogenic glandular tissue architecture distortion of spicular margins , with acoustic shadow ( arrow ) . biradsusg 5 . in histopathological examination : focal fibrosis fat tissue necrosis demands special attention ; depending on the reason and duration it may look like a simple cyst , complex cyst or solid lump . in later stages of the disease there are angular edges giving an acoustic shadow which resembles the us image of a cancer with desmoplastic reaction . in order to differentiate , one should asses the vascularization of the lesion fat tissue will not exhibit the features of the flow presence , it will undergo compression and in elastogrammes it will show the soft lesion pattern ( fig . 11 ) . in the case of postoperative scars or after biopsies , the differentiating element is the medical history . in cases of negative history , these lesions are classified as birads - usg 4 or 5 and demand histopathological verification . b. in elastogramme homogenous lesion , of blue color ( deformation susceptible lesion pattern ) , of the average value e = 13 kpa . in cytological examination fat tissue the last group of cases , both false negative and false positive , are lesions which do not form an image of a focal lesion . among this group of false negative lesions one can number malignant neoplasms such as carcinomas in situ of low grade of histopathological malignancy , lobular carcinomas , early stages of other carcinomas , in particular of small size . in the case of lobular carcinomas , in which neoplastic cells bands are scattered among normal stromal cells in the us examinations , they are often visible as acoustic shadows among echogenic fibrous tissue ( fig . these images are highly unspecific and may occur in benign and malignant hyperplasia . because in such cases mammography examination ( mmg ) has a limited sensitivity , histopathological verification should be performed . false positive lesions which do not form focal changes also include fibrocystic dysplasia , post - traumatic , postoperative , post - radiation lesions or fat tissue necrosis . solid hypoechogenic lesion with prevalence of superiorinferior dimension over latero - lateral dimension , giving acoustic shadow , in color doppler with pathological vessels , with hyperechogenic halo before the us examination , the doctor should perform a medical history and physical breast examination , he should also refer to previous imaging examinations performed ( fig . 13).a us examination performed according to the polish ultrasound society breast examination standards ( fig . 14).treating each pathological focal lesion or lesion in lactiferous ducts visualized in us examination which does not fulfill the criteria of a benign lesion , as suspected of malignant character until the final histopathological diagnosis ( fig . 15).very careful analysis of the visualized focal lesions in breasts , both clinical ( palpable ) and subclinical ( below 5 mm in diameter ) ; small focal lesions in breasts usually do not have the typical morphology of a benign or a malignant lesion ( fig . 16).obeying the rule that each focal change in breast in birads - usg 4 and 5 category is confirmed by microscope examination ( fnab , cb ) ( fig . 17 ) , whereas in birads - usg 3 category it is possible to perform fnab or refer the patient to a control examination in 6 months.very careful ultrasound examination of breasts with cystic changes , particularly multiple , which can cover small foci of breast cancer ( fig . referring for further diagnostics of all fluid - filled lesions in breasts which do not fulfill classical criteria of breast cysts ( that is birads - usg 2).precise ultrasound examination in women who have reported in medical history or currently have bloody discharge from the nipple , with its cytological assessment ( fig . 19).very careful performance of breast ultrasound examination in women with a predominance of glandular tissue with normal result of mammographic examination . in such cases many small , solid focal lesions which might be breast cancer are not visualized in mmg ( fig . 20).very careful performance of the ultrasound examination of glandular breasts with features of a significant degree of remodeling by stromal tissues . biopsy , mammography , magnetic resonance mammography and systematic 6 monthly control us examination.the use of a standoff pad or great amount of gel in breast focal lesions localized superficially in order to optimize the image ( fig . 22).careful performance of the ultrasound examination in women after mastectomy because of breast cancer and after breast conserving therapy one should remember that they have an increased risk of breast cancer morbidity in the second breast or a recurrence incidence ( fig . 23).careful performance of the examination in women after breast focal lesion excision . the scar after surgical procedure in us examination may be similar to focal malignant lesion ( fig . 24).a group particularly exposed to more frequent breast cancer incidence are women with familial breast cancer . from the moment of receiving this information they should be included in the program of prophylactic breast cancer examinations . in high and very high risk groups of breast cancer morbidity one should perform alternate mmg examination and magnetic resonance examination every 6 months complemented by the us examination of breasts every 12 months.in all doubtful and diagnostically difficult cases one should consult other doctors in more specialized centers.the diagnoses should be systematically verified and one 's diagnostic mistakes should be analyzed . before the us examination , the doctor should perform a medical history and physical breast examination , he should also refer to previous imaging examinations performed ( fig . a us examination performed according to the polish ultrasound society breast examination standards ( fig . 14 ) . treating each pathological focal lesion or lesion in lactiferous ducts visualized in us examination which does not fulfill the criteria of a benign lesion , as suspected of malignant character until the final histopathological diagnosis ( fig . very careful analysis of the visualized focal lesions in breasts , both clinical ( palpable ) and subclinical ( below 5 mm in diameter ) ; small focal lesions in breasts usually do not have the typical morphology of a benign or a malignant lesion ( fig . 16 ) . obeying the rule that each focal change in breast in birads - usg 4 and 5 category is confirmed by microscope examination ( fnab , cb ) ( fig . 17 ) , whereas in birads - usg 3 category it is possible to perform fnab or refer the patient to a control examination in 6 months . very careful ultrasound examination of breasts with cystic changes , particularly multiple , which can cover small foci of breast cancer ( fig . referring for further diagnostics of all fluid - filled lesions in breasts which do not fulfill classical criteria of breast cysts ( that is birads - usg 2 ) . precise ultrasound examination in women who have reported in medical history or currently have bloody discharge from the nipple , with its cytological assessment ( fig . very careful performance of breast ultrasound examination in women with a predominance of glandular tissue with normal result of mammographic examination . in such cases many small , solid focal lesions which might be breast cancer are not visualized in mmg ( fig . . very careful performance of the ultrasound examination of glandular breasts with features of a significant degree of remodeling by stromal tissues . the use of a standoff pad or great amount of gel in breast focal lesions localized superficially in order to optimize the image ( fig . careful performance of the ultrasound examination in women after mastectomy because of breast cancer and after breast conserving therapy one should remember that they have an increased risk of breast cancer morbidity in the second breast or a recurrence incidence ( fig . the scar after surgical procedure in us examination may be similar to focal malignant lesion ( fig . a group particularly exposed to more frequent breast cancer incidence are women with familial breast cancer . from the moment of receiving this information they should be included in the program of prophylactic breast cancer examinations . in high and very high risk groups of breast cancer morbidity one should perform alternate mmg examination and magnetic resonance examination every 6 months complemented by the us examination of breasts every 12 months . in all doubtful and diagnostically difficult cases classical us image as for a malignant lesion in the breast of 50 years old woman who had mammography performed in which no potentially malignant lesions were stated . the breast with predominance of glandular tissue segmentally dilated lobular lactiferous duct with tissue echoes ( arrows ) . in fnab ductal carcinoma in situ breast cyst with tissue echoes in its lumen ( arrow ) . these echoes did not change their localization after the change of breast position during examination . final diagnosis : papilloma in the cyst the first us examination in 37 years old woman who experienced repeated breast soreness in consecutive menstrual cycles . focal lesion in glandular tissue of the diameter of 6 mm ( arrows ) . in fnab examination : glandular cancer pathological focal lesion in breast ( arrows ) . in the us examination the pattern as for a benign lesion . histopathological diagnosis : medullary breast cancer focal lesion in breast of the diameter of 5 mm ( arrow ) among cysts . in histopathological examination : invasive ductal breast cancer intraductal breast papilloma ( arrow ) . in medical history reported bleeding from the nipple 1 month prior the us examination small , 7 mm in diameter , invasive ductal cancer of breast ( arrow ) in 45 years old woman with volumetric predominance of glandular tissue , who in previously performed mammography did not have any lesion suspected of malignancy a. glandular breast cancer ( arrows ) . b. area of increased remodeling of glandular tissue by stroma ( arrows ) breast skin fibroma ( arrow ) , the examination was performed with a standoff pad . us image of breast skin is indicated by small arrows breast cancer recurrence ( arrow ) in woman with breasts of glandular structure . the recurrence was diagnosed 8 months after quadrantectomy performed because of invasive ductal cancer scar in the breast ( arrows ) after fibroadenoma excision

sonomammography is often the first additional examination performed in the diagnostics of breast diseases . the development of ultrasound imaging techniques , particularly the introduction of high frequency transducers , matrix transducers , harmonic imaging and finally , elastography , influenced the improvement of breast disease diagnostics . nevertheless , as in each imaging method , there are errors and mistakes resulting from the technical limitations of the method , breast anatomy ( fibrous remodeling ) , insufficient sensitivity and , in particular , specificity . errors in breast ultrasound diagnostics can be divided into impossible to be avoided and potentially possible to be reduced . in this article the most frequently made errors in ultrasound have been presented , including the ones caused by the presence of artifacts resulting from volumetric averaging in the near and far field , artifacts in cysts or in dilated lactiferous ducts ( reverberations , comet tail artifacts , lateral beam artifacts ) , improper setting of general enhancement or time gain curve or range . errors dependent on the examiner , resulting in the wrong birads - usg classification , are divided into negative and positive errors . the sources of these errors have been listed . the methods of minimization of the number of errors made have been discussed , including the ones related to the appropriate examination technique , taking into account data from case history and the use of the greatest possible number of additional options such as : harmonic imaging , color and power doppler and elastography . in the article examples of errors resulting from the technical conditions of the method have been presented , and those dependent on the examiner which are related to the great diversity and variation of ultrasound images of pathological breast lesions .

through the last twenty years , the knowledge on thyroid disease during pregnancy has rapidly expanded . it is well documented that women with overt hypothyroidism during pregnancy have an increased risk of pregnancy loss and adverse pregnancy outcome [ 13 ] , but the consequences of subclinical hypothyroidism and the significance of concomitant thyroid peroxidase antibodies ( tpoab ) are debated [ 46 ] . subclinical hypothyroidism is a condition in which a slightly raised thyroid stimulating hormone ( tsh ) signal is representing an early , mild thyroid failure . the persistency of mild ( subclinical ) hypothyroidism may differ according to ethnicity and age ; however , tsh increase with age as well as the prevalence of tpoab positivity is increasing with age . further the presence of tpoab does seem important , as resolution to euthyroidism is reported much higher in tpoab negative subjects compared to tpoab positive . women with asymptomatic autoimmune thyroid disorders , who are euthyroid in early pregnancy , carry a significant risk of developing hypothyroidism progressively during gestation . the aim of this study was to estimate the significance of tsh , thyroid peroxidase antibody ( tpoab ) , and mild ( subclinical ) hypothyroidism in women from the danish general suburban population study ( gesus ) on the number of children born , the number of pregnancies , and the number of spontaneous abortions . the danish general suburban population study ( gesus ) was initiated in january 2010 and finished in october 2013 . gesus is a cross sectional study of the adult danish suburban general population in naestved municipality ( 70 km south of copenhagen ) selected on the basis of the danish central population register code . the gesus study was designed to invite only 25% of younger women of 2029 years age influencing the distribution of age . the health examination included a comprehensive physical examination ( body mass index ( bmi ) ) , biochemical tests and a self - administrated questionnaire ( prevalent disease ( diabetes mellitus , hypothyroidism , and hyperthyroidism ) , antihypertensive and cholesterol lowering medication , thyroid and antithyroid medication , contraception , smoking , income , education , employment , the number of pregnancies , the number of children born , age of first child , and the number of spontaneous abortions ) . gesus had an overall participation rate of women of 45% ( n = 11565 ) . in this study we included participants of european origin ( 99% danish ) ( n = 11387 ) and excluded participants with missing values of tsh , ft4 , and tt3 ( n = 50 ) and missing values of the number of pregnancies , the number of children born , and the number of spontaneous abortions ( n = 31 ) . prevalent hypothyroidism was defined as history of hypothyroidism or intake of t4/t3 medication , and prevalent hyperthyroidism was defined as history of hyperthyroidism or intake of antithyroid medication . thyroid hormones within the reference interval were defined as ft4 = 10.024.0 pmol / l , tt3 = 1.202.90 nmol / l , and tsh = 0.43.7 mu / l . mild ( subclinical ) hypothyroidism was defined as tsh > 3.7 mu / l and ft4 and tt3 within the reference interval , no history of thyroid disease , and no intake of t4/t3 or antithyroid medication . controls were defined as having 0.4 < tsh 3.7 mu / l and ft4 and tt3 within the reference interval , no history of thyroid disease , and no intake of t4/t3 or antithyroid medication [ 13 , 14 ] . thyroid peroxidase antibody ( tpoab ) positivity was defined by the cut - off value of tpoab > 60 u / ml . all biochemical tests were performed at the same laboratory at naestved hospital . measurements of tsh and of thyroid hormones - free thyroxin ( ft4 ) and total triiodothyronine ( tt3 ) were performed using an electrochemiluminescent immunoassay ( roche cobas 6000 , basel , switzerland ) . l ( cv < 5% ) , and tt3 reference range 1.202.90 nmol / l ( cv < 4% ) . tpoab was measured by kryptor antitpon ( brahms , henigsdorf , germany ) , with detection limit of 10 all statistical analyses were performed using stata version 13.0 for windows ( statacorp , college station , tx , usa ) . a value of p < 0.05 was considered statistically significant . tsh and tpoab were not normally distributed and therefore log - transformed ( logtsh and logtpoab ) . we performed the following statistical models : for the full cohort of women : linear regression analyses of tsh and tpoab of children born and the number of pregnancies , logistic regression for spontaneous abortion;for women with prevalent hypothyroidism versus controls : logistic regression analyses for 1 children born , 1 pregnancies , and spontaneous abortion;for women with subclinical hypothyroidism versus controls : logistic regression analyses for 1 children born , 1 pregnancies , and spontaneous abortion.models designed were either age - adjusted or multifactorially adjusted using age , bmi , diabetes , contraception , education , income , employment , smoking , antihypertensive medication , cholesterol lowering medication , and menopause as listed in table 1 . for the full cohort of women : linear regression analyses of tsh and tpoab of children born and the number of pregnancies , logistic regression for spontaneous abortion ; linear regression analyses of tsh and tpoab of children born and the number of pregnancies , logistic regression for spontaneous abortion ; for women with prevalent hypothyroidism versus controls : logistic regression analyses for 1 children born , 1 pregnancies , and spontaneous abortion ; logistic regression analyses for 1 children born , 1 pregnancies , and spontaneous abortion ; for women with subclinical hypothyroidism versus controls : logistic regression analyses for 1 children born , 1 pregnancies , and spontaneous abortion . logistic regression analyses for 1 children born , 1 pregnancies , and spontaneous abortion . the study was approved by the regional ethics committee of zealand , denmark ( reg . number rvk sj-177 , sj-113 , and sj-114 ) , registered with clinicaltrial.gov ( nct01335802 ) , and reported to the danish data protection agency . table 1 shows characteristics of women . in total , 758 ( 6.7% ) had mild ( subclinical ) hypothyroidism , 9.4% prevalent hypothyroidism , and 4.2% prevalent hyperthyroidism . in women with mild hypothyroidism tpoab logtsh and logtpoab were negatively linearly associated with the number of children born and number of pregnancies in the full cohort in age - adjusted and multiadjusted models ( table 2 ) . mild ( subclinical ) hypothyroidism was associated with a risk of not having children and a risk of not getting pregnant in age - adjusted and multiadjusted models . prevalent hypothyroidism was not associated with the number of children born , the number of pregnancies , or spontaneous abortions ( table 3 ) . in the present study , we showed that with higher tsh levels the less number of children born and the less number of pregnancies . coefficients for logtsh were higher than for logtpoab ; thus , the effect of tsh seems higher than for tpoab . mild hypothyroidism was also associated with a higher age of first child born and risk of not having children and not getting pregnant . tpoab was not a significant confounder in the models , and there was no interaction with age . this analysis is cross sectional and in a way retrospective for those women who are now menopausal . also , for women who are premenopausal we may not have the life - time full number of children born , the number of pregnancies , and the number of spontaneous abortions . we can not adjust for age of the mother at the birth of her 1st child as this only applies for those who have had children ; thus , those with no children have missing values in that category . we have included the information in table 1 , and it appears that there is a significant difference between those with mild hypothyroidism and controls . furthermore , were we not able to perform analyses of pregnancy and child birth history restricted to only within few years of the tsh examination . this may be caused by the fact that , during fertile life , early miscarriage may have gone unnoticed or been forgotten . had recently reported that women with a combination of subclinical hypothyroidism and thyroid autoimmunity were found to have the highest risk of miscarriage before 20 weeks of gestation compared to only tpoab positivity or subclinical hypothyroidism . in contrast , previous prospective studies have confirmed an association between mild hypothyroidism during pregnancy and pregnancy loss . allan et al . showed that stillbirth was significantly more frequent in women having tsh higher than 6.0 reported that the risk of child loss was increased with higher levels of maternal tsh , whereas concentrations of maternal ft4 and child loss were not associated . observed that the evolution of pregnancy did not depend on whether the hypothyroidism was overt or mild but depended on adequate treatment during pregnancy . these findings correspond to our results , since the odds ratios for 1 pregnancy and child birth versus none were not significant comparing prevalent hypothyroidism versus controls reflecting a well - treated condition . furthermore that mild hypothyroidism is representing nonadequate treatment and mild thyroid failure was associated with a risk of not having children and a risk of not getting pregnant . accordingly , in our study we observed that elevated tsh above the upper reference limit in mild hypothyroidism correlated with the number of pregnancies and child births . several studies have reported a possible association between thyroid dysfunction during pregnancy and specific adverse pregnancy outcome like preeclampsia [ 19 , 20 ] , placental abruption , or preterm delivery [ 21 , 22 ] . it has been suggested that higher tsh and tpoab positivity were independently associated with lower likelihood of reversion to euthyroidism . in a 20-year follow - up study , an increased serum tsh level was predictive of progression to overt hypothyroidism , and the annual rate of progression to overt hypothyroidism was more than 4% in women with both raised serum tsh and antithyroid antibodies . showed a trend towards slightly higher serum tsh levels in women with thyroid autoimmunity in the first trimester of pregnancy compared to women without thyroid autoimmunity and that women with asymptomatic autoimmune thyroid disease who were euthyroid in early pregnancy carried a significant risk of developing hypothyroidism progressively during gestation , despite a marked reduction in antibody titers . this retrospective cross sectional study showed that among women without any history of thyroid disease or antihyperthyroid / antihypothyroid medication 6.7% had mild ( subclinical ) hypothyroidism . the prevalence of mild hypothyroidism was comparable to previous studies like the colorado study in which 8.5% had subclinical hypothyroidism increasing with age explained by the chosen value of tsh cut - off defining mild hypothyroidism . the presence of mild hypothyroidism influenced the level of ft4 within the reference range as ft4 was decreased in women with mild hypothyroidism . this could be explained by an increased intracellular deiodination of t4 to t3 in women with mild hypothyroidism to avoid decreased levels of active intracellular thyroid hormone concentrations . we are not able to determine the status during pregnancy as the present study is retrospective , but it seems unlikely that tpoab would have an effect directly on metabolism and peripheral thyroid hormone regulated cellular function . however , we can not exclude the possibility that the women presenting with mild hypothyroidism have had a previous normalized tsh level . this population study was performed in naestved municipality eastern denmark representing a mild iodine deficiency . in denmark , the iodine intake was stable at a low level for many years and in 2000 , the mandatory iodine fortification of bread salt and household salt began . follow - up studies reported an increase in prevalence of hypothyroidism and tpoab positivity especially among younger women . the present study is limited by the fact that all clinical observations are self - reported questionnaire data . furthermore , we did not have any information about the numbers of induced abortions which could influence the data of child births although it is rarely recommended to induce an abortion only due to high levels of tsh during first trimester of pregnancy . in addition , individuals were classified based on a single blood test ; thus , we can not distinguish between transient and permanent tsh elevation ; however , somwaru et al . showed that subclinical hypothyroidism was persistent in 56% after 4-year follow - up . finally , due to financial reasons the gesus study was designed to invite only 25% of younger women aged 2030 years old influencing the distribution of age . the strength of our study was the high number of participants with blood samples of tsh , ft4 , tt3 , and tpoab in 11254 women . furthermore , for the analyses of mild ( subclinical ) hypothyroidism we excluded women with any self - reported thyroid disease or use of t4/t3 or antithyroid medication and only compared euthyroid and mild hypothyroid women . taken together , we observed that with higher tsh levels the less number of children born and the less number of pregnancies . mild hypothyroidism was also associated with a higher age of first child born and risk of not having children and not getting pregnant . in conclusion , we observed that impaired fertility is associated with tsh , tpoab , and mild ( subclinical ) hypothyroidism in a danish population of women .

introduction . the aim of this study was to estimate the significance of tsh , thyroid peroxidase antibody ( tpoab ) , and mild ( subclinical ) hypothyroidism in women from the danish general suburban population study ( gesus ) on the number of children born , the number of pregnancies , and the number of spontaneous abortions . methods . retrospective cross sectional study of 11254 women participating in gesus . data included biochemical measurements and a self - administrated questionnaire . results . 6.7% had mild ( subclinical ) hypothyroidism and 9.4% prevalent hypothyroidism . in women with mild hypothyroidism tpoab was significantly elevated and age at first child was older compared to controls . tsh and tpoab were negatively linearly associated with the number of children born and the number of pregnancies in the full cohort in age - adjusted and multiadjusted models . tsh or tpoab was not associated with spontaneous abortions . mild ( subclinical ) hypothyroidism was associated with a risk of not having children and a risk of not getting pregnant in age - adjusted and multiadjusted models . prevalent hypothyroidism was not associated with the number of children born , the number of pregnancies , or spontaneous abortions . conclusion . impaired fertility is associated with tsh , tpoab , and mild ( subclinical ) hypothyroidism in a danish population of women .

the metabolic syndrome ( mets ) is a clustering of metabolic and cardiovascular risk factors that have been widely discussed for at least 20 years . although some have questioned the clinical utility of metabolic syndrome , there are many reasons to believe that this entity is useful . identification of metabolic syndrome is a simple measure of finding people with a clustering of risk factors that put them at increased risk of diabetes and cardiovascular disease ( cvd ) . furthermore , such individuals need more intensive lifestyle interventions at an early stage to delay the disease progression to a still higher - risk category . also , the identification of metabolic syndrome will attract attention to various other related conditions such as fatty liver , polycystic ovary syndrome , and obstructive sleep apnea . since the first official definition of the metabolic syndrome put forward by a working group of the world health organization ( who ) in 1998 , a number of different definitions have been proposed . the latest definition given by international diabetes federation ( idf ) takes into account the evidence that abdominal obesity is an important component of the metabolic syndrome and proposes gender- and race - specific cut - offs for waist circumference ( wc ) . although the need for different wc is attributed to ethnic variation , it was observed that even within the same population , people with identical wc but different heights have different risks for metabolic syndrome . several studies from asia indicate that waist - to - height ratio ( whtr ) is more strongly associated with cvd risk factors than other anthropometric measures such as wc , body mass index ( bmi ) , and waist hip ratio ( whr ) . the aim of our study was to perform a comparative validation of wc , bmi , whr , and whtr for defining the metabolic syndrome in indian population living in the urban and rural areas of rohtak district , haryana , india . we used the idf definition of metabolic syndrome , excluding the measure of obesity , to determine which obesity measure among wc , bmi , whr , and whtr , and what appropriate cut - off value are most closely predictive of the non - adipose components of the idf 's definition of metabolic syndrome . informed consent was obtained after explaining the details of the procedure to all subjects . in rural population of these two rural blocks , 85 anganwadi centers ( awc ) were selected by the random selection method . from the population survey register of awc , male and female patients were randomly selected and called at the awc on a specified date and time after an overnight fast . in urban areas , two out of total six urban health centers were selected randomly , and from the survey registers of these two health centers , male and female patients were selected randomly . a day before the study , all subjects were advised to observe overnight fasting ( at least 8 hours ) and called at the nearest health center / awc in the morning . initial evaluation included detailed history and clinical examination of the subjects to exclude any systemic diseases . anthropometric indices including height ( without shoes and socks ) , weight , wc , and hip circumference were recorded for the subjects . height was measured to the nearest 0.1 cm using a portable stadiometer and weight measured to the nearest 0.1 kg using calibrated platform scales . waist circumference was measured to the nearest 0.1 cm at the midpoint between the subcostal margin and the margin of the supracristal plane according to the idf diagnostic criteria . hip circumference was measured to the nearest 0.1 cm around the thighs , at the height of the greater trochanter , with the patients in the standing position . blood pressure was recorded after patients were made to sit and rest for at least half an hour . blood pressure was recorded thrice at 5-minute intervals in a sitting position in the non - dominant arm , with the value to the nearest 2 mm hg , using a standard adult mercury sphygmomanometer . patients suffering from chronic renal , pancreatic or other severe illness , pregnant women , and women who delivered 2 months or less preceding the study , patients on lipid lowering agents , steroids , nicotinic acid , or other medications likely to cause dysglycemia , were excluded from the study . in the morning after an overnight fasting period , blood samples were obtained from the antecubital vein and transfused into vacuum tubes containing edta . all patients were allowed to sit and rest for at least half an hour before the blood samples were taken . plasma glucose , total cholesterol , triglycerides , and hdl - cholesterol were measured . according to the idf definition for the indian population , for an individual to be defined as having the metabolic syndrome , he / she must be diagnosed as having central obesity defined as waist circumference 90 cm in males or 80 cm in females plus any two of the following four factors : ( 1 ) triglycerides 150 mg / dl or specific treatment for this lipid abnormality ; ( 2 ) hdl - cholesterol < 40 mg / dl in males or < 50 mg / dl in females or specific treatment for this lipid abnormality ; ( 3 ) sbp 130 mmhg , or dbp 85 mmhg or treatment for previously diagnosed hypertension ; ( 4 ) fasting plasma glucose 100 mg / dl or previously diagnosed type 2 diabetes . all analyses were done separately for men and women and according to their place of residence . continuous data were expressed as mean sd . the optimal cut - off points for bmi , wc , whr , and whtr were obtained by selecting a point on the roc curve , which represented the largest sum of sensitivity and specificity . the area under the roc curve ( aurc ) was used as a measure of discrimination of a predictor . it measures the effectiveness of a diagnostic marker and enables the selection of an optimal threshold value ( cut - off point ) for the marker . according to the idf definition for the indian population , for an individual to be defined as having the metabolic syndrome , he / she must be diagnosed as having central obesity defined as waist circumference 90 cm in males or 80 cm in females plus any two of the following four factors : ( 1 ) triglycerides 150 mg / dl or specific treatment for this lipid abnormality ; ( 2 ) hdl - cholesterol < 40 mg / dl in males or < 50 mg / dl in females or specific treatment for this lipid abnormality ; ( 3 ) sbp 130 mmhg , or dbp 85 mmhg or treatment for previously diagnosed hypertension ; ( 4 ) fasting plasma glucose 100 mg / dl or previously diagnosed type 2 diabetes . all analyses were done separately for men and women and according to their place of residence . continuous data were expressed as mean sd . the optimal cut - off points for bmi , wc , whr , and whtr were obtained by selecting a point on the roc curve , which represented the largest sum of sensitivity and specificity . the area under the roc curve ( aurc ) was used as a measure of discrimination of a predictor . it measures the effectiveness of a diagnostic marker and enables the selection of an optimal threshold value ( cut - off point ) for the marker . the statistical program for social sciences , version 17.0 ( spss inc . , chicago il ) , was used for all statistical analyses . in the present study , 3,042 individuals were screened for the prevalence of metabolic syndrome and their baseline characteristics , as shown in table 1 . out of the 3,042 individuals selected , 1,693 were from rural areas ( male , 814 ; and female , 879 ) and 1,349 from urban areas ( male , 704 ; and female , 645 ) . in our study participants , the prevalence of metabolic syndrome according to the idf criteria was 23.8% and 42.6% in urban men and women , respectively , while it was 14.9% and 36.3% in rural men and women , respectively . in males , high blood pressure was the most common abnormality , followed by low hdl and hypertriglyceridemia . in females , impaired fasting glucose and diabetes mellitus were seen in 23.2% and 10.7% of the men , respectively , while these were seen in 22.7% and 8.7% of the women , respectively . baseline characteristics of study subjects stratified by gender the roc curve analysis was performed to find out optimal cut - off points for bmi , wc , whr , and whtr . the point on the roc , which represented the largest sum of sensitivity and specificity , was chosen to obtain the optimal cut - off point for each of these four measurements in predicting metabolic syndrome . figure 1 shows the roc curves of bmi , wc , whr , and whtr for predicting the presence of two or more non - adipose components of metabolic syndrome as defined for both men and women . the optimal cut - off value of wc in urban and rural males was > 89 cm , which was higher than that in urban and rural females , i.e. 83 cm and 79 cm , respectively , while the optimal cut - off for whtr was > 0.51 in rural females , 0.52 in rural males , and 0.53 in both urban males and females . whr cut - off for the prediction of metabolic syndrome was 0.87 and 0.93 , respectively , in rural females and males and 0.92 and 0.95 , respectively , in urban females and males . kg / m in both urban and rural males as well as urban females , while it was > 21 kg / m in rural females . table 2 shows aurc , optimal cut - off values , and the associated measure of each cut - off value . in both men and women , irrespective of their place of residence , wc was found to be a better predictor of metabolic syndrome than whtr [ table 2 ] . ( a ) roc curves of bmi , wc , whr , and whtr to predict the presence of two or more non - adipose components of metabolic syndrome in urban females . ( b ) roc curves of bmi , wc , whr , and whtr to predict the presence of two or more non - adipose components of metabolic syndrome in urban males . ( c ) roc curves of bmi , wc , whr , and whtr to predict the presence of two or more non - adipose components of metabolic syndrome in rural females . ( d ) roc curves of bmi , wc , whr , and whtr to predict the presence of two or more non - adipose components of metabolic syndrome in rural males . ( e ) roc curves of bmi , wc , whr , and whtr to predict the presence of two or more non - adipose components of metabolic syndrome in the entire study population irrespective of gender and place of living areas under the roc curve , cut offs , sensitivity , specificity of wc , bmi , whr and whtr when we compared these anthropometric variables as a predictor of metabolic syndrome irrespective of the place of living and gender , whtr was found to have the best aurc as a predictor of metabolic syndrome at a cut - off value of 0.52 [ table 2 ] , and it scored over wc as a predictor of metabolic syndrome ( p = 0.001 ) . varying degree of prevalence of metabolic syndrome is reported from various regions of the world and the indian subcontinent , but very few data is available regarding the prevalence of metabolic syndrome separately in the urban and rural population of haryana and also regarding which anthropometric parameter of adiposity is best suited for urban and rural population . we found a prevalence of 23.8% ( 168/704 ) , 14.9% ( 122/814 ) , 42.6% ( 275/645 ) , and 36.3% ( 319/879 ) in urban men , rural men , urban women , and rural women , respectively , using the idf diagnostic criteria . moreover , the prevalence is more common in urban population than in rural population , which is likely due to the higher educational status and sedentary lifestyle of urban population . we evaluated and compared the extent to which four different anthropometric variables of adiposity ( bmi , wc , whr , and whtr ) are able to predict two or more non - adipose components of metabolic syndrome using the idf criteria . it was observed that in both urban and rural men and women , wc is a better predictor of metabolic syndrome than the other three anthropometric variables ( bmi , whr , and whtr ) . however , when the entire population was clubbed together and analyzed irrespective of their place of residence and gender , it was found that whtr scored over wc as a predictor of metabolic syndrome . the optimal cut - off of whtr for this prediction was 0.52 , which is in accordance with several reports from other asian countries where a cut - off value of whtr > 0.5 appears to offer a simple and reliable index of identifying individuals who face increased future risk of metabolic complications . traditionally , bmi is a widely popular index of obesity used . wang et al . , in their study of chinese population , found that bmi and wc are more useful than whr for predicting two or more non - adipose components of metabolic syndrome . however , the majority of asian population is obese and at risk of developing metabolic complications even at bmi cut - off level of 25 kg / m , which is not in accordance with the who bmi cut - off level used to define obesity . this has prompted experts across the globe to redefine bmi standards for asian population , and which is now set at 23 kg / m or above for asian population . in the present study , the bmi cut - off of > 23 kg / m was also predictive of metabolic syndrome , except in rural females where optimal cut - off for bmi was > 21 kg / m . despite this change in bmi criteria , its use a large number of studies clearly suggest that the degree of central fat distribution is more clearly related to metabolic risk than bmi . in the present study , the comparison of roc of bmi with that of wc showed that bmi is inferior to wc in predicting metabolic syndrome ( p = 0.0001 ) . wc and whr have been used as measures of central adiposity and evidences suggest a greater association of these anthropometric variables with a future metabolic risk than bmi , which is a measure of general obesity . between wc and whr , several studies have shown that that wc is a better predictor of metabolic syndrome because of variations in the level of hip measurements , differences in cut - off values between men and women and among different ethnic groups , and the possibility of embarrassment to both examiner and examinee when measuring hip circumference . however , the ability of wc to be used as a universal predictor of central adiposity is limited by the use of different methods for the measurement of wc and different cut - offs used for men and women and for different ethnic groups . in the present study , the optimal cut - off value of wc is > 89 cm each in urban and rural males and > 83 cm and > 79 cm in urban and rural females , respectively , and is clearly superior to whr in the prediction of metabolic syndrome ( p = 0.0001 ) . whtr is another anthropometric variable that has been used and found to be a better predictor of metabolic complications in various studies . this is because the height of an individual influences the distribution of body fat , and this factor should be taken into consideration before adopting any anthropometric variable as a measure of adiposity . on average , men are taller than women and have larger waist circumferences . this means that average whtr values are closer for men and women than average wc values because of adjustments for height , and the same value can be used for both genders to indicate increased risk . earlier reported that whtr is a better parameter of central obesity and obviates the need for numerous wc cut - offs ; it may be useful in children where existing parameters are not useful . they also reported that using the average height in various countries and their respective wc cut - offs as defined by the idf consensus definition , the range of whtr varies from 0.51 to 0.58 among males and from 0.47 to 0.54 among females . in the present study , we also observed that a single value of whtr at more than 0.52 is a better predictor of metabolic syndrome in both genders . moreover , for the first time in the present study , we compared both urban and rural population and found that irrespective of the place of living , a single value of whtr can be used as a marker to identify individuals with a high likelihood of contracting central adiposity and metabolic syndrome . a study conducted on adult females from singapore demonstrated that whtr can act as the best screening tool for cardiovascular risk . in japanese men and women , whtr was found to be a better predictor of metabolic risk compared to other anthropometric indices . other studies also reported that the whtr is a simple and effective screening tool for cardiovascular risk factors in both men and women . in contrast , a dutch study revealed that height did not significantly influence the differences in measures of adiposity or intra - abdominal fat volume in women , or intra - abdominal fat areas in both genders . nakamura et al . reported that whtr did not confer an improved discriminatory performance compared to wc . kato et al . concluded that the predictive power of wc was not inferior to whtr , and wc is practically the most convenient measure for predicting metabolic syndrome because of its simplicity . in the present study , the roc and aurc values for wc are better than that for whtr in case of men and women in both urban and rural areas ( p = 0.0054 ) , but if one has to use a single value for the ease and simplicity of prediction of metabolic syndrome , irrespective of gender and place of residence , then at a value of 0.52 , whtr is a good predictor of metabolic syndrome in comparison to wc where one has to use different values for different gender and place of residence . also , for disease with a high prevalence in population , such as metabolic syndrome , there is the need for a test with high specificity to ensure all true negative cases are picked up and the test will have a high positive predictive value . the same is true for whtr , when used irrespective of gender and place of residence , which has high specificity as well as youden 's index . to conclude , although the predictive value of different gender - specific wc values is clearly superior to other anthropometric measures for the diagnosis of metabolic syndrome in both urban and rural population of both genders , a single value of whtr > 0.52 irrespective of gender and area of residence can be used as a universal screening tool for the identification of individuals at high risk to the development of metabolic complications .

aims : to compare waist circumference ( wc ) , body mass index ( bmi ) , waist hip ratio ( whr ) , and waist - to - height ratio ( whtr ) and define an appropriate cut - off , which is most closely predictive of the non - adipose components of the idf metabolic syndrome ( mets ) definition.methods and results : a total of 3,042 adults ( 1,693 in rural area and 1,349 in urban area ) were screened for the presence of mets according to the idf definition . among 3,042 adults selected as subjects , 1,518 were male and 1,524 were female . the receiver operating curve ( roc ) analysis was done to determine the optimal cut - off value and the best discriminatory value of each of these anthropometric parameters to predict two or more non - obese components of metabolic syndrome . the area under roc ( aurc ) for wc was superior to that for other anthropometric variables . the optimal cut - off value of wc in urban and rural males was > 89 cm , which is higher than that in urban and rural females at 83 cm and 79 cm , respectively ; the optimal cut - off for whtr was > 0.51 in rural females , 0.52 in rural males , and 0.53 in both urban males and females . both parameters were found to be better than bmi and whr . roc and aurc values for wc were better than those for whtr in men and women in both urban and rural areas ( p = 0.0054 ) ; however , when the entire study cohort was analyzed together , irrespective of gender and place of residence , then at a value of 0.52 , whtr scored over wc as a predictor of metabolic syndrome ( p = 0.001).conclusion : although the predictive value of different gender - specific wc values is clearly superior to other anthropometric measures for predicting two or more non - adipose components of mets , a single value of whtr irrespective of gender and the area of residence can be used as a universal screening tool for the identification of individuals at high risk of development of metabolic complications .

amyotrophic lateral sclerosis ( als ) is a rapidly progressive degenerative neurological disease . about 5%-10% of als is familial , with the remaining 90% of people diagnosed with als being classified as having sporadic disease ( 1 ) . although several environmental risk factors have been considered , the causes of als are largely unknown . the association between als and exposure to neurotoxic chemicals , such as solvents , pesticides and metals , has been investigated in several epidemiologic studies with inconsistent results ( 2 , 3 ) . pesticides are known to be important risk factors for als and other neurodegenerative diseases such as parkinson 's and alzheimer 's ( 4 ) . although the biologic mechanisms contributing to risk of als associated with exposure to pesticides are unknown , many pesticides are considered as potential neurotoxins in various ways ( 5 ) . in addition , an increased als risk with pesticide exposure was also reported from alteration of paraoxonase 1 function , which detoxifies organophosphates ( 6 ) . recently , a case of als was reported in korea involving a worker at a waste disposal site who had crushed glass pesticide bottles for for 15 yr ( 7 ) . previous epidemiologic studies , however , have produced inconsistent results when examining the association of pesticides and als . exposure to pesticides has been reported to be associated with als risk in some investigations ( 8 , 9 , 10 ) , but others have found no relationship ( 3 , 11 , 12 , 13 , 14 ) . one possible explanation for these inconsistencies may be low statistical power since the number of cases available for study is typically limited in the case of rare diseases such as als . therefore , two meta - analyses with regard to pesticide exposure and als have been conducted to date ( 15 , 16 ) . ( 15 ) showed that occupational exposure to pesticides as a group significantly increased ( about two - fold ) the risk for als . ( 16 ) also reported a roughly two - fold increase in risk of als among men , but not among women . previous meta - analyses , however , only included studies of pesticide exposure but excluded studies based on job title such as a farmer or those based on living on a farm , both of which would be used as important surrogate indices for pesticide exposure . since rural residence or aspects of agricultural activity other than pesticide use may also serve as a potential risk factor for als ( 13 , 17 , 18 , 19 , 20 ) , it is important to investigate the risk of als with overall environments , from residence in rural area to pesticide exposure . the objectives of this meta - analysis , therefore , were to investigate the overall scope of exposure to pesticides and rural environments with the risk of als by including studies for broad categories of exposure assessment categories such as rural residence , farmers , and pesticide exposure . we conducted systematic reviews for rural residence , farmers , and pesticide exposure according to the moose guidelines ( 21 ) . a search was performed in ovid medline and embase up to september 2013 using the medical subject headings ( mesh ) . the search terms for als included ' motor neurone disease ' , ' amyotrophic lateral sclerosis ' , ' lou gehrig disease ' , ' charcot disease ' . these were combined with search terms for the exposure which included ' agrochemicals ' , ' pesticide ' , ' organophosphorus compounds ' , ' insecticides ' , ' cholinesterase inhibitors ' , ' herbicides ' , ' paraquat ' , ' gramoxone ' , ' fungicide ' , ' agriculture ' , ' occupational exposure ' , ' farmer ' , ' farmworker ' , ' rural residence ' , ' rural environment ' . studies included in our analysis were selected based on the following inclusion criteria : 1 ) peer - reviewed cohort or case - control studies ; 2 ) studies which investigated the association between rural residence , farmers or pesticide exposure and amyotrophic lateral sclerosis ; 3 ) reported outcome measures with odds ratio ( or ) or relative risk ( rr ) for als , or that provided the number of individuals ; and 4 ) written in english . review articles , case reports , case - series , letters to editors , commentaries , proceedings , laboratory science studies , and any non - relevant tudies were excluded from analysis . as shown in fig . 1 , a total of 1,720 articles were obtained after searching databases and references and performing a hand - search . after excluding the duplicates ( n=434 ) , the remaining articles were reviewed ( n=1,286 ) and 1,220 articles were excluded for not meeting the selection criteria . the remaining 66 articles were selected for review of their entire content . among them , 44 were excluded for the following reasons : 25 were not case - control or cohort studies , 17 provided insufficient data ; no control group ( n=7 ) , no eligible exposure for rural living , farmer , pesticide ( n=4 ) , and no eligible outcome for als ( n=6 ) , and two were duplicate articles . therefore , a total of 22 studies were included in our meta - analysis ( 3 , 8 , 9 , 11 , 12 , 13 , 14 , 15 , 17 , 18 , 19 , 20 , 22 , 23 , 24 , 25 , 26 , 27 , 28 , 29 , 30 , 31 ) . when the study samples were overlapped in two or more articles , we selected the article with the most comprehensive population . based on the predetermined selection criteria , two of the authors independently selected all trials retrieved from the databases and bibliographies . disagreements between evaluators were resolved through discussion or in consultation with a third author . in the case of insufficient or missing data , they were derived either from the text or tables or , when possible , calculated from the relevant data within the study . standardized data extraction forms were used to extract the following data from the studies included in the final analysis : name of the first author with year of publication , journal name , country where the study was conducted , study design , diagnostic criteria , definition of rural residence , farmer , and pesticide exposure , adjusted factors , number of cases / controls or cohort participants , and rr or or with 95% confidence intervals ( cis ) . case ascertainment was based on using or not using el escorial criteria for diagnosis of als . the world federation of neurology developed the el escorial diagnostic criteria for als , which have proven to be accurate in diagnosis of als using pathology as a ' gold standard ' and represents them as universal guidelines for the diagnosis of als ( 32 ) . exposure assessment methods were summarized into two categories ( i.e. , self - reported vs. expert judgement ) . overall pooled estimates and their corresponding 95% ci were obtained using dersimonian and laird random effects models ( 33 ) . if the article reported stratified estimates , the strata were combined and the crude or was recalculated ( 22 , 26 , 27 , 31 ) . available raw data were used in a 22 table to calculate the or and 95% ci in a study ( 20 ) . as the incidence of als is low ( i.e. , 1 - 3 per 100,000 persons per year ) , we assumed odds ratio to be equal to relative risk . we conducted meta - analyses stratified by rural residence , farmers , and pesticide exposure separately . subgroup analyses were performed according to the following characteristics : 1 ) study design , 2 ) region ( europe , the usa , and others including australia and india ) , 3 ) gender , 4 ) case ascertainment ( el escorial criteria or not ) , 5 ) exposure assessment ( self - reported or expert judgment ) . between - study q - statistic p value of < 0.1 was considered statistically significant and i of 25 , 50 , or 75 indicates low , medium , or high heterogeneity , respectively ( 34 ) . we estimated publication bias by using begg 's funnel plot ( 35 ) and egger 's test ( 36 ) . in addition , contour - enhanced funnel plots were performed in order to aid the interpretation of the funnel plot . although publication bias for pesticide exposure was not significant for egger 's test ( p=0.09 ) , asymmetry in the funnel plot was observed and trim and fill analyses were therefore performed ( 37 ) . we used the stata se version 12.0 software package for statistical analysis ( statacorp , college station , tx , usa ) . we conducted systematic reviews for rural residence , farmers , and pesticide exposure according to the moose guidelines ( 21 ) . a search was performed in ovid medline and embase up to september 2013 using the medical subject headings ( mesh ) . the search terms for als included ' motor neurone disease ' , ' amyotrophic lateral sclerosis ' , ' lou gehrig disease ' , ' charcot disease ' . these were combined with search terms for the exposure which included ' agrochemicals ' , ' pesticide ' , ' organophosphorus compounds ' , ' insecticides ' , ' cholinesterase inhibitors ' , ' herbicides ' , ' paraquat ' , ' gramoxone ' , ' fungicide ' , ' agriculture ' , ' occupational exposure ' , ' farmer ' , ' farmworker ' , ' rural residence ' , ' rural environment ' . studies included in our analysis were selected based on the following inclusion criteria : 1 ) peer - reviewed cohort or case - control studies ; 2 ) studies which investigated the association between rural residence , farmers or pesticide exposure and amyotrophic lateral sclerosis ; 3 ) reported outcome measures with odds ratio ( or ) or relative risk ( rr ) for als , or that provided the number of individuals ; and 4 ) written in english . review articles , case reports , case - series , letters to editors , commentaries , proceedings , laboratory science studies , and any non - relevant tudies were excluded from analysis . 1 , a total of 1,720 articles were obtained after searching databases and references and performing a hand - search . after excluding the duplicates ( n=434 ) , the remaining articles were reviewed ( n=1,286 ) and 1,220 articles were excluded for not meeting the selection criteria . the remaining 66 articles were selected for review of their entire content . among them , 44 were excluded for the following reasons : 25 were not case - control or cohort studies , 17 provided insufficient data ; no control group ( n=7 ) , no eligible exposure for rural living , farmer , pesticide ( n=4 ) , and no eligible outcome for als ( n=6 ) , and two were duplicate articles . therefore , a total of 22 studies were included in our meta - analysis ( 3 , 8 , 9 , 11 , 12 , 13 , 14 , 15 , 17 , 18 , 19 , 20 , 22 , 23 , 24 , 25 , 26 , 27 , 28 , 29 , 30 , 31 ) . when the study samples were overlapped in two or more articles , we selected the article with the most comprehensive population . based on the predetermined selection criteria , two of the authors independently selected all trials retrieved from the databases and bibliographies . disagreements between evaluators were resolved through discussion or in consultation with a third author . in the case of insufficient or missing data , they were derived either from the text or tables or , when possible , calculated from the relevant data within the study . standardized data extraction forms were used to extract the following data from the studies included in the final analysis : name of the first author with year of publication , journal name , country where the study was conducted , study design , diagnostic criteria , definition of rural residence , farmer , and pesticide exposure , adjusted factors , number of cases / controls or cohort participants , and rr or or with 95% confidence intervals ( cis ) . case ascertainment was based on using or not using el escorial criteria for diagnosis of als . the world federation of neurology developed the el escorial diagnostic criteria for als , which have proven to be accurate in diagnosis of als using pathology as a ' gold standard ' and represents them as universal guidelines for the diagnosis of als ( 32 ) . exposure assessment methods were summarized into two categories ( i.e. , self - reported vs. expert judgement ) . overall pooled estimates and their corresponding 95% ci were obtained using dersimonian and laird random effects models ( 33 ) . if the article reported stratified estimates , the strata were combined and the crude or was recalculated ( 22 , 26 , 27 , 31 ) . available raw data were used in a 22 table to calculate the or and 95% ci in a study ( 20 ) . as the incidence of als is low ( i.e. , 1 - 3 per 100,000 persons per year ) , we assumed odds ratio to be equal to relative risk . we conducted meta - analyses stratified by rural residence , farmers , and pesticide exposure separately . subgroup analyses were performed according to the following characteristics : 1 ) study design , 2 ) region ( europe , the usa , and others including australia and india ) , 3 ) gender , 4 ) case ascertainment ( el escorial criteria or not ) , 5 ) exposure assessment ( self - reported or expert judgment ) . between - study q - statistic p value of < 0.1 was considered statistically significant and i of 25 , 50 , or 75 indicates low , medium , or high heterogeneity , respectively ( 34 ) . we estimated publication bias by using begg 's funnel plot ( 35 ) and egger 's test ( 36 ) . in addition , contour - enhanced funnel plots were performed in order to aid the interpretation of the funnel plot . although publication bias for pesticide exposure was not significant for egger 's test ( p=0.09 ) , asymmetry in the funnel plot was observed and trim and fill analyses were therefore performed ( 37 ) . we used the stata se version 12.0 software package for statistical analysis ( statacorp , college station , tx , usa ) . the study included a total of 19 case - control studies ( 8 , 9 , 11 , 12 , 13 , 14 , 17 , 18 , 19 , 20 , 22 , 23 , 25 , 26 , 27 , 28 , 29 , 30 , 31 ) and three cohort studies ( 3 , 15 , 24 ) ( table 1 ) . the studies were conducted mainly in europe or the usa , with the exception of one indian and one australian study . among the total studies , three ( 13 , 17 , 18 ) had data for rural residence , farming occupation , and pesticide exposure and two ( 19 , 26 ) included data for farming occupation and pesticide exposure . they include five case - control studies for rural residence ( 13 , 17 , 18 , 23 , 25 ) , ten case - control studies for farming occupation ( 13 , 17 , 18 , 19 , 20 , 26 , 27 , 29 , 30 , 31 ) , and 15 studies for pesticide exposure ; three cohorts ( 3 , 15 , 24 ) and 12 case - control studies ( 8 , 9 , 11 , 12 , 13 , 14 , 17 , 18 , 19 , 22 , 26 , 28 ) . el escorial criteria were used in six studies ( 8 , 17 , 18 , 22 , 26 , 27 ) and pesticide exposure was defined by expert judgment in four studies ( 8 , 9 , 19 , 24 ) . the risk of als was significantly increased with pesticide exposure ( or , 1.44 ; 95% ci , 1.22 - 1.70 ) and with farming occupation ( or , 1.42 ; 95% ci , 1.17 - 1.73 ) , but was not significant for rural residence ( table 2 ) . individual estimates from 22 studies and their overall pooled ors for rural residence , farming occupation , and pesticide exposure are presented in the forest plot separately in fig . pesticide exposure showed a significantly increased risk of als for studies with case - control design ( or , 1.49 ) , among males ( or , 1.96 ) and with applied expert judgment exposure assessment ( or , 2.04 ) . results of the q test and i2 statistics were significantly heterogeneous for total studies but not significant when sub - group analyses were conducted by region or gender . no evidence of publication bias was observed for all three exposure indices , but the plot was a slightly asymmetric in contour - enhanced funnel plot at pesticide exposure index ( fig . ors for pesticide exposure were still significant ( or , 1.40 ; 95% ci , 1.10 - 1.79 ) ( data not shown ) . our findings from the meta - analysis support an association between pesticide exposure and als . the increased risks of als were consistent by study deign , country , gender , als definition , and type of exposure assessment . the estimates for als had a tendency to be significant as the order of accuracy for pesticide exposure indicators , and the risks were higher in men , in studies using el escorial criteria and in those using expert judgment , compared to their counterparts . our results were consistent with previously published meta - analyses , which reported an association between pesticide exposure and als ( 15 , 16 ) . however , our increased risk both men and women were different with a previous study ( 16 ) which reported that the significant association was found only among men . in addition , our results showed that the ors for als became significant in the order of rural residence , farmer , and pesticide exposure , which was the order of accuracy for pesticide exposure indicators , and statistical significance was found both for farming occupation and pesticide exposure . the information on rural residence is a crude measure of pesticide exposure because not all rural residents are farmers nor are exposed to farming , and not all farmers actually use pesticides ( 38 ) . rural residents may also be exposed to physical , chemical or biological factors other than pesticides . since rural residence or farmer are a wider category of exposure than pesticide , using rural living or farmer as an indicator for pesticide exposure may underestimate the risk of association with pesticide exposure . similarly , no significant association between childhood leukemia and parental occupational exposure was observed when farming / agricultural work was used as a surrogate for pesticide exposure , whereas significantly increased risks were observed when specific use of pesticides by the parents was considered ( 39 ) . when using el escorial criteria for case ascertainment , ors for als tend to be higher than when not used . this may be explained by the assertion that clarifying case ascertainment by using el escorial criteria allows greater precision in the diagnosis of als which may impact these effects . similarly , the or for als was higher when expert judgement was used for exposure assessment compared to self - reported interviews or questionnaires . although self - reported information may provide detailed data at the individual level , exposure misclassification from recall bias or reliability issues are always of concern . expert judgment by using job title and occupational history creates greater precision in exposure assessment , despite the fact that it might also result in non - differential exposure misclassification ( 40 ) . therefore , our findings may stress the importance of using more objective information for defining disease and exposure in epidemiologic studies . men had a higher risk for als than women in regard to pesticide exposure , although the confidence intervals were overlapped . this discrepancy by gender was also observed in a previous meta - analysis ( 16 ) and a study from india ( 17 ) . this gender discrepancy included in these studies may partly be explained as men having different features of occupational exposure to pesticides , for example their being exposed to pesticide more frequently or in larger amounts when they use pesticide , or being influenced by sex - related factors . the possible factors leading to the different risks of als and pesticide exposure among countries may include differences in the amounts , pattern , and methods of pesticide use , as well as by genetics . we have considered all pesticides as a single exposure category although pesticides include many different chemicals . however , few studies investigated individual pesticides , their exposure duration or intensity ; therefore , we were not able to do subgroup analysis on these issues . possible interaction among pesticides and genetic factors may also potentiate the different results from countries . future studies with more detailed information on pesticide use and other potential risk factors are needed to clarify this issue . further studies for non - occupational pesticide exposure are also needed to describe the full scope of association with pesticide exposure and als . first , the original studies included in this meta - analysis had adjusted for limited potential confounding factors . however , majority of studies included cases and controls of similar demographic characteristics , thus the association between als and exposures would not be expected substantially to change by uncontrolled confounding factors . subgroup analyses by confounding factors were also limited due to few studies adjusted for same factors . however , the present analysis did not appear to be hampered by publication bias , since there was no evidence of publication bias as observed by begg 's funnel plot and egger 's test . duval and tweedie 's trim and fill analyses also provided an adjusted estimate of the effect of pesticide exposure on als and revealed that there was still significant risk of als with pesticide exposure ( 37 ) . heterogeneity may be inevitable in meta - analysis , but sub - group analyses showed consistent positive associations with pesticide exposure and the risk of als . despite some limitation in terms of detailed information on pesticide exposure , our findings from the meta - analysis of 19 case - control and three cohort studies support an association between pesticide exposure and als , but not for rural residence . these meta - analyses present overall scopes of categories for exposure to pesticide and/or rural environment assessment such as rural residence , farming occupation , and pesticide exposure , which help us to more comprehensively understand the relation between als and exposure to pesticides . considering that farmers are commonly frequently exposed to pesticides at a high level , it is important to recommend lowering exposure to pesticides in order to reduce the risk of development of als .

the aim of this study was to examine the relationship between the risk of amyotrophic lateral sclerosis ( als ) and exposure to rural environments . studies were identified through ovid medline and embase search up to september 2013 using as keywords rural residence , farmers , and pesticide exposure . twenty - two studies were included for this meta - analysis . summary odds ratios ( ors ) were calculated using random effect model by type of exposure index , and subgroup analyses were conducted according to study design , gender , region , case ascertainment , and exposure assessment . the risk of als was significantly increased with pesticide exposure ( or , 1.44 ; 95% ci , 1.22 - 1.70 ) and with farmers ( or , 1.42 ; 95% ci , 1.17 - 1.73 ) , but was not significant with rural residence ( or , 1.25 ; 95% ci , 0.84 - 1.87 ) . the risk estimates for subgroup analysis between pesticide exposure and als indicated a significant positive association with men ( or , 1.96 ) , and in studies using el escorial criteria for als definition ( or , 1.63 ) and expert judgment for pesticide exposure ( or , 2.04 ) as well . no significant publication bias was observed . our findings support the association of pesticide exposure and an increased risk for als , stressing that the use of more specific exposure information resulted in more significant associations .

noninvasive mechanical ventilation ( niv ) , including noninvasive positive pressure ventilation ( nippv ) , is a well - accepted treatment for chronic neuromuscular respiratory failure associated with conditions such as amyotrophic lateral sclerosis , and niv prolongs survival . clinicians are often pressed for an immediate decision as to whether niv or invasive ventilation should be used in patients with various neuromuscular diseases who suddenly present with potentially fatal arf . if invasive ventilation can be avoided by performing niv in patients with arf , the severity of disease can be effectively managed , and the outcomes of neuromuscular diseases can be improved because invasive ventilation requires endotracheal intubation or tracheotomy , which can cause serious complications , especially in patients with respiratory infection . in contrast , niv carries a lower risk of respiratory infection . it is important to clarify the characteristics of patients with neuromuscular diseases in whom initial niv is likely to be unsuccessful , leading to the need for invasive ventilation . we studied 27 patients in stable neuromuscular condition who initially received niv to manage fatal arf to identify differences in factors immediately before the onset of arf among patients who receive continuous niv support , patients who are switched from niv to invasive ventilation , and patients in whom niv is discontinued . we retrospectively studied 27 medically stable patients with neuromuscular diseases who presented with arf that required mechanical ventilation to save their lives and to relieve respiratory distress despite oxygen administration . patients with other causes of pre - ventilatory respiratory failure , such as chronic obstructive pulmonary disease or lung cancer , were excluded . none of the patients had a history of niv , endotracheal intubation , tracheotomy , or invasive ventilation , and all patients initially received niv after the onset of arf . all patients other than those with coma had severe respiratory distress . a decrease in consciousness level was evident in 16 patients , and coma status as defined as a score of 100 on the japan coma scale was seen in 6 patients . twenty - one patients were urgently admitted to our hospital , and the condition of 4 other medically stable patients suddenly worsened during hospitalization . two other patients were admitted to our hospital within 23 hours from presentation . before the initiation of niv , 26 patients were given the following diagnoses : probable multiple systemic atrophy ( msa ) according to the gilman criteria in 5 patients , clinically definitive parkinson s disease ( pd ) according to the uk parkinson s disease society brain bank criteria in 2 patients , clinically probable or definite amyotrophic lateral sclerosis ( als ) fulfilling the el escorial revised criteria in 8 patients , myotonic dystrophy ( myd ) in 6 patients , polymyositis ( pm ) in 1 patient , both myositis and myasthenia gravis in 1 patient , mg in 2 patients , and chronic inflammatory demyelinating polyneuropathy in 1 patient . human herpes virus-6 encephalitis was diagnosed on the basis of polymerase chain reaction after starting niv in 1 patient . arterial blood gas ( abg ) analysis was performed within a short period before starting niv ( median 68 minutes ) . at the same time , the presence of coexistent pulmonary disease such as aspiration pneumonia , the japan coma scale score , and the need for oxygen administration were evaluated . the modified ranking scale score or bulbar symptoms were evaluated when the patient was in medically stable condition within 1 month before the initiation of niv . each endpoint was judged as three states ( persistent niv support , transition from niv to invasive ventilation , and free of mechanical ventilation ) . variables that were not normally distributed were transformed to natural logarithms or categorical quartile groups . normally distributed variables are presented as means sd , and asymmetrically distributed variables are presented as medians with interquartile ranges ( iqr ) . the statistical significance of differences in pre - ventilation clinical factors among these three groups was analyzed by linear regression analysis . we obtained their informed consents of all patients as well as from their families about the clinical procedure including niv . as for the patients with compromised cognitive functions , we obtained the informed consent from their families . the protocol of this study was approved by the medical ethics committee of nara medical university . arterial blood gas ( abg ) analysis was performed within a short period before starting niv ( median 68 minutes ) . at the same time , the presence of coexistent pulmonary disease such as aspiration pneumonia , the japan coma scale score , and the need for oxygen administration were evaluated . the modified ranking scale score or bulbar symptoms were evaluated when the patient was in medically stable condition within 1 month before the initiation of niv . each endpoint was judged as three states ( persistent niv support , transition from niv to invasive ventilation , and free of mechanical ventilation ) . variables that were not normally distributed were transformed to natural logarithms or categorical quartile groups . normally distributed variables are presented as means sd , and asymmetrically distributed variables are presented as medians with interquartile ranges ( iqr ) . the statistical significance of differences in pre - ventilation clinical factors among these three groups was analyzed by linear regression analysis . we obtained their informed consents of all patients as well as from their families about the clinical procedure including niv . as for the patients with compromised cognitive functions , we obtained the informed consent from their families . the protocol of this study was approved by the medical ethics committee of nara medical university . detailed clinical information , including the results of abg analysis in each patient , is shown in supplementary table 1 . seventytwo hours later , 5 patients were switched from niv to invasive ventilation , and 5 patients continued to receive niv support ( figure 1 ) . seventy - two hours after the initiation of niv , the proportion of patients with a diagnosis of als differed significantly among the three groups ( p=0.039 ) , and other variables , including abg , did not differ ( table 1 ) . one week later , two patients ( 1 with pd and 1 with myd ) died , 5 patients received invasive ventilation , and 4 patients were free of ventilation . one month later , 8 patients underwent invasive ventilation or died , and 6 patients were free of ventilation . as for 8 patients with als , 3 patients received invasive mechanical ventilation after 72 hours . although statistical significance was not reached , hypercapnia before starting niv was frequent among als patients with unsuccessful niv ( figure 2 ) . the present study found that medically stable patients with als who initially received niv tended to require invasive ventilation after niv . one retrospective study that evaluated 76 patients who had various neuromuscular diseases associated with arf , including 10 patients with als ( 13.1% ) , reported that 12 patients ( 15.7% ) received continuous niv and 47 patients ( 61.8% ) required invasive ventilation or died . in the present study , including 8 patients with als ( 29.6% ) , 12 patients ( 44.4% ) received continuous niv support and 7 patients ( 25.9% ) required invasive ventilation or died . these results are inconsistent with the findings of previous studies , possibly because of different proportions of patients with als , much longer endpoints than those in the present study , or different definitions of endpoints . however , the proportion of patients who required invasive ventilation or died increased after 1 month ( figure ) , similar to the results of a previous study . we found no prognostically significant pre - ventilation values on abg analysis . in a previous study , lower ph and po2 values and higher pco2 values before ventilation were associated with poor functional outcomes at discharge , and bicarbonate > 30 mg / dl , pco2 > 50 mmhg , and ph < 7.30 were associated with an increased risk of death in survivors with neuromuscular diseases . seventy - two hours after starting niv , all patients with unsuccessful niv had a value of pco2 > 50 mmhg , and bicarbonate > 30 mg / dl and ph < 7.30 were seen in 4 patients and 3 patients with unsuccessful niv , respectively . however , mechanical ventilation was needed in a heterogeneous cohort of 22 patients with neuromuscular diseases .

if invasive ventilation can be avoided by performing noninvasive mechanical ventilation ( niv ) in patients with acute respiratory failure ( arf ) , the disease can be effectively managed . it is important to clarify the characteristics of patients with neuromuscular diseases in whom initial niv is likely to be unsuccessful . we studied 27 patients in stable neuromuscular condition who initially received niv to manage fatal arf to identify differences in factors immediately before the onset of arf among patients who receive continuous niv support , patients who are switched from niv to invasive ventilation , and patients in whom niv is discontinued . endpoints were evaluated 24 and 72 hours after the initiation of niv . after 24 hours , all but 1 patient with amyotrophic lateral sclerosis ( als ) received continuous niv support . 72 hours later , 5 patients were switched from niv to invasive ventilation , and 5 patients continued to receive niv support . 72 hours after the initiation of niv , the proportion of patients with a diagnosis of als differed significantly among the three groups ( p=0.039 ) . niv may be attempted to manage acute fatal respiratory failure associated with neuromuscular diseases , but clinicians should carefully manage the clinical course in patients with als .

the successful pathogen , toxoplasma gondii , is able to infect virtually all warm - blooded animals including birds and mammals in worldwide , obligating to the zoonotic toxoplasmosis ( 1 ) . human beings acquired the disease mainly through ingestion of tissue cysts or oocysts of t. gondii , containing in food or water ( 2 ) . t. gondii infection in healthy adults rarely causes clinical symptoms , but can lead to be fatal in immunocompromised individuals ( 24 ) . in wildlife , many animals also were infected by t. gondii . some studies reported high infection rate of t. gondii in zoo animals and wild birds . for example , murata in early 1989 just showed 29.28% ( 53/181 ) and 16.94% ( 61/179 ) of t. gondii igg in mammals and wild birds , respectively , by serological survey ( 5 ) . zhang et al . also reported there had 25% ( 4/16 ) of t. gondii antibody in primates , 69.4% ( 25/36 ) in carnivores , 27.6% ( 8/29 ) in herbivores and 11.11% ( 4/36 ) in birds in china ( 6 ) . there was 36.17% ( 51/141 ) in felids and 10.81% ( 4/37 ) in prosimians ( 7 ) . other recent reports also showed the high infection rate such as 36.1% ( 73/202 ) of wild birds captured from the wild environment ( 8) and 12.46% ( 39 /313 ) of house sparrows in china ( 9 ) . in recent years , different sources of t. gondii strains were identified using multilocus polymerase chain reaction - restriction fragment length polymorphism ( pcr - rflp ) method , which was established for genotyping by su and other scholars ( 1014 ) . the distribution of genetic diversity of t. gondii in wildlife animals is of great importance to understand the transmission of this parasite in the environment . some studies have identified several genetic characterizations of t. gondii isolates from cats , bats , sheep , and birds in china ( 1518 ) . however , little information concerning t. gondii isolates from zoo animals and pet birds in southeast china . the objectives of the present study were to determine the prevalence and genetically characterize t. gondii in wild animals from fuzhou zoo and pet birds farms in fujian province , southeastern china . a total of 185 animals were randomly collected from fujian province during 2012 and 2014 . the 45 heart tissue samples from were collected from zoo animals , and 140 heart tissue samples were collected from pet birds . genomic dna was extracted from heart tissue samples of wild animals and pet birds using tianamp genomic dna kit ( tiangen , beijing , china ) . in brief , 30 mg of heart tissue were treated with sodium dodecyl sulphate / proteinase k at 56 c for overnight digestion in a thermostat water bath . dna samples were prepared according to the previous study ( 19 ) and eluted into 60 ul with elution buffer . the positive genomic dna of t. gondii rh ( type i ) and pru ( type ii ) strains were kindly provided by fujian normal university and lanzhou veterinary research institute , respectively . at first , all the dna samples from tissues of wild animals and pet birds were identified using semi - nested pcr method based on t. gondii b1 gene as described previously ( 20 ) . in brief , the first round were amplified at 35 cycles with 93 c for 10 s , 57 c for 10 s and 72 c for 30 s. then the nested pcr was beginning at 93 c 10 s for denaturation , following by annealing at 62.5 c for 10 s and the 72 c 10 s for extension ( 21 ) . the pcr amplification was performed by veriti 96-well thermal cycler ( abi ) , and the products were separated by 1.5% agarose gel , visualized under ultraviolet light . the positive samples were then genotyped using multilocus pcr - rflp method as previously described by amplifications of 11 markers , including sag1 , 5 and 3-sag2 , alternative sag2 , sag3 , btub , gra6 , c22 - 8 , c29 - 2 , l358 , pk1 , apico , and cs3 ( ( 13 , ( 15 , ( 22 ) . the reaction volume ( 25 l ) contained 10 mm tris - hcl , 50 mm kcl , 1.5 mm mgcl2 , 0.3 mm each primer , 0 . 25 mm each dntp , 1.25 u golden dna polymerase ( tiangen , beijing , china ) , and 2 l t. gondii dna . all samples were incubated at 95 c for 5 min , then 35 cycles of pcr at 94 c for 30 s , 55 c for 30 s , 72 c for 40 s and 72 c for 7 min . the nested pcr was carried out with an annealing temperature at 60 c for 60 s for all the markers except apico , which was amplified at 55 c . the previous studies ( ( 9 , ( 13 , ( 14 , ( 15 ) are used to compare with the results of the genetic characterization of the chinese t. gondii in our present work . a total of 185 animals were randomly collected from fujian province during 2012 and 2014 . the 45 heart tissue samples from were collected from zoo animals , and 140 heart tissue samples were collected from pet birds . genomic dna was extracted from heart tissue samples of wild animals and pet birds using tianamp genomic dna kit ( tiangen , beijing , china ) . in brief , 30 mg of heart tissue were treated with sodium dodecyl sulphate / proteinase k at 56 c for overnight digestion in a thermostat water bath . dna samples were prepared according to the previous study ( 19 ) and eluted into 60 ul with elution buffer . the positive genomic dna of t. gondii rh ( type i ) and pru ( type ii ) strains were kindly provided by fujian normal university and lanzhou veterinary research institute , respectively . at first , all the dna samples from tissues of wild animals and pet birds were identified using semi - nested pcr method based on t. gondii b1 gene as described previously ( 20 ) . in brief , the first round were amplified at 35 cycles with 93 c for 10 s , 57 c for 10 s and 72 c for 30 s. then the nested pcr was beginning at 93 c 10 s for denaturation , following by annealing at 62.5 c for 10 s and the 72 c 10 s for extension ( 21 ) . the pcr amplification was performed by veriti 96-well thermal cycler ( abi ) , and the products were separated by 1.5% agarose gel , visualized under ultraviolet light . the positive samples were then genotyped using multilocus pcr - rflp method as previously described by amplifications of 11 markers , including sag1 , 5 and 3-sag2 , alternative sag2 , sag3 , btub , gra6 , c22 - 8 , c29 - 2 , l358 , pk1 , apico , and cs3 ( ( 13 , ( 15 , ( 22 ) . the reaction volume ( 25 l ) contained 10 mm tris - hcl , 50 mm kcl , 1.5 mm mgcl2 , 0.3 mm each primer , 0 . 25 mm each dntp , 1.25 u golden dna polymerase ( tiangen , beijing , china ) , and 2 l t. gondii dna . all samples were incubated at 95 c for 5 min , then 35 cycles of pcr at 94 c for 30 s , 55 c for 30 s , 72 c for 40 s and 72 c for 7 min . the nested pcr was carried out with an annealing temperature at 60 c for 60 s for all the markers except apico , which was amplified at 55 c . the previous studies ( ( 9 , ( 13 , ( 14 , ( 15 ) are used to compare with the results of the genetic characterization of the chinese t. gondii in our present work . of the total 185 samples , 10 samples were detected to be positive for the t. gondii b1 gene , including 7 zoo animals ( 1 black - capped , 1 wild red dog , 1 lemur , 1 zebra , 1 red panda , 1 peacock , 1 red - crowned crane , 15.56% , 7/45 ) and 3 pet birds ( 1 budgerigar , 1 black - billed magpie , 1 zebra finch , 2.14% , 3/140 , ) ( table 1 ) . the positive rate of t. gondii dna in zoo animals was significantly higher than that of pet birds in fujian , china ( p<0.05 . further genotyped the positive samples using multi - locus pcr - rflp method showed that 3 dis - tinct genotypes ( toxodb genotype # 9 , # 2 and # 10 ) of t. gondii from black - capped ( cebus apella ) , peacock ( peafowl ) and budgerigar ( melopsittacus undulatus ) respectively were identified ( table 2 ) . by using sequence - specific primers , the relative number of copies of a particular dna sequence can be determined . there are many applications of this technique in the field of diagnosis ( 2325 ) . t. gondii can be detected by semi - nested polymerase chain reaction ( pcr ) using b1 genes in pig , cat , and other wild animals ( 2629 ) . in the present study , we identified the t. gondii infection in black - capped , wild red dog , lemur , zebra , red panda , peacock , red - crowned crane , budgerigar , black - billed magpie , zebra finch in china , which indicated these animals could be served as a potential source of infection for other animals and even humans . pcr - rflp method is frequently used to identify differences between homologous dna sequences ( 13,15 ) , which have been successfully used for genotyping of t. gondii from cat , chicken , human , cougar , sheep , birds , sparrow , pig and other animals ( 2 , 9 , 13 , 1518 , 26 ) . further genotyped the positive samples using multi - locus pcr - rflp method showed that 3 distinct genotypes ( toxodb genotype # 9 , # 2 and # 10 ) of t. gondii from black - capped ( cebus apella ) , peacock ( peafowl ) and budgerigar ( melopsittacus undulatus ) respectively were identified ( table 2 ) . zoo animals and pet birds have formed a huge industry in order to prevent rare wild animals from extinction and to boost the economy . fujian province has a great advantage in convenient transportation because of its southeast coastal location in china , so the exchange of wild animals and pet birds becomes more ordinary . the results in this present study will enhance our understanding of the epidemiology and prevention of t. gondii in zoo wild animals and pet birds . one sample isolated from budgerigar belonged to toxodb genotype # 10 , supporting the previous study that toxodb genotype # 10 had been isolated from 3 sparrows in fuzhou ( 18 ) . this result indicated that toxodb genotype # 9 was predominant not only in southern , southwestern and central parts of china but also in southeast part of china ( 15 , 17 , 3032 ) . in addition , our finding support that toxodb genotype # 9 is at cs3 locus . our study is also the first report of genetic typing of t. gondii from zoo wild animals and pet birds in china . the high genetic diversity of t. gondii genotypes in fujian may cause by the high number of cats in city and other feline in mountainous areas . the positive rate of t. gondii dna was high in zoo animals ( 7/45 , 15.56% ) but very low in birds ( 3/140 , 2.14% ) in fujian , china . further genotyping analysis confirmed that the presence of t. gondii in zoo wildlife and pet birds were toxodb genotype # 10 , genotype # 9 and genotype # 2 , which suggested the integrated measures should be taken to prevent t. gondii infection in humans or other animals .

background : toxoplasmosis , a worldwide zoonotic disease , is caused by toxoplasma gondii . the distribution of genetic diversity of t. gondii in wild animals is of great importance to understand the transmission of the parasite in the environment . however , little is known about t. gondii prevalence in wild animals and birds in china.methods:we conducted the genetic characterization of t. gondii isolated from zoo wild animals and pet birds in fujian province , southeastern china . heart tissues were collected from 45 zoo animals and 140 pet birds . after identified using b1 gene , the genetic diversity of t. gondii isolates were typed at 11 genetic markers , including sag1 , 5 and 3-sag2 , alternative sag2 , sag3 , btub , gra6 , c22 - 8 , c29 - 2 , l358 , pk1 , apico , and cs3.results:seven of 45 zoo animals and 3 of 140 pet birds were positive by pcr amplification using t. gondii b1 gene specific primers . of these positive isolates , 3 isolates from black - capped ( cebus apella ) , peacock ( peafowl ) and budgerigar ( melopsittacus undulatus ) were successfully genotyped at 11 genetic loci , and grouped to three distinct genotypes : toxodb genotype # 9 , # 2 and # 10 , respectively.conclusion:this is the first genotyping of t. gondii isolated from zoo wild animals and pet birds in fujian , china . there is a potential risk for the transmission of this parasite through zoo wild animals and pet birds in this region .

the success of valproic acid ( vpa , 2-propylpentanoic acid ) , a short branched chain fatty acid , for the therapy of absence seizures , partial seizures , tonic - clonic seizures , bipolar disorder , schizoaffective disorder , social phobias , neuropathic pain and for the prophylaxis and treatment of migraine headaches has spurred investigation for its use in the treatment of other conditions . treatments for encephalopathy secondary to hyperammonemia as a side - effect of vpa treatment remain empirical and restoration of possible hepatic carnitine deficiency remains controversial . while some authors have found a positive correlation between plasma ammonia level and vpa dose or concentration others have found none . her elevated vpa levels were associated with elevated ammonia levels as expected of a positive correlation . in contrast , later on in the patient 's clinical course her raised venous ammonia levels were found to be slowly down - trending in the presence of sub - therapeutic serum vpa . the present case report is about a 25-year - old hispanic female with a history of depression since age of 12 years , bipolar disorder , borderline personality disorder , purging type bulimia and history of suicide attempts at age 12 was admitted to the intensive care unit after attempted suicide by consuming an unknown number of vpa pills . this patient had recently started taking vpa ( depakote ) as a mood stabilizer at a dose of 250 mg at bed time about 3 days earlier , after a failed therapy . patient was taking paroxetine 20 mg for depression ; this was incremented to 40 mg at the time vpa was started . she reported that the change to vpa made her listless , lowered her mood , decreased her motivation , worsened her depression and caused suicidal thoughts . she overdoses herself on vpa which she took with alcohol . after ingesting the pills she notified her family who then brought her to the emergency room . on admission , her vitals were stable ( blood pressure : 118/72 mm hg ; temperature : 98.7f ; pulse : 82 beats / min ; oxygen saturation : 99% on room air ) . on initial examination she looked disheveled , although drowsy , was oriented to person , place and time . the complete blood count and comprehensive metabolic panel that was recorded initially and subsequently were unremarkable [ table 1 ] . subsequently , she was administered oral lactulose once and then 1400 mg of levocarnitine orally every 6 h for the next 2 days . her vpa levels which peaked after admission continued to trend down over the next 4 days , the ammonia levels also peaked subsequent to admission then showed an initial dip followed by a very slow down - trend [ figure 1a ] . the normalized log - linear plot of vpa serum concentration over time showed a down - trending linear first - order kinetics with a calculated t = 15.08 h [ figure 1b ] ( expected t for depakote : 9 - 16 h following oral dosing regimens of 250 - 1000 mg . the serum ammonia normalized log - linear plot in contrast showed two different decay kinetics : initial sharp down - trend for vpa levels greater than 90.9 g / ml but much slower downtrend for vpa levels less than 90.9 g / ml down into the subtherapeutic range of 8.5 g / ml . patient continued to complain of lethargy for the next 4 days which subsequently alleviated . at 14 days laboratory values of the patient at the time of admission ( a ) valproic acid ( vpa ) and ammonia levels as a function of time ( days ) . vertical axes : straight line ( left ) : vpa levels ; dashed line ( right ) : venous ammonia levels . ( b ) logarithm of normalized vpa and ammonia levels as a function of time in days . the normalization for each compound , for levels at each recorded time point ( x ) was to its recorded maximum level ( xmax ) . the normalized log - linear plot of vpa showed linear first - order decay kinetics with a calculated t = 15.08 h ( r = 0.994 ) recognition of symptoms of hyperammonemia remains a challenge especially in psychiatric patients . in a review of 11 case reports of symptomatic hyperammonemia in a psychiatric setting it was noted that acute hyperammonemic encephalopathy in psychiatric patients may present in various ways , sometimes with subtle clinical features . the previously reported spectrum of clinical features included : improvement in mood , worsening of psychiatric symptoms , mild complaints of fatigue and delirium . in our patient , hyperammonemia secondary to vpa overdose caused listlessness , lowering of mood , decreased motivation , worsening depression and suicidal ideation . we observed presence of vpa in serum caused increased venous ammonia levels , which eventually trended down to normal after its cessation . increasing vpa levels in serum was associated with increasing venous ammonia levels initially [ figure 1 ] . the peak concentration of ammonia noted was likely a decrement from the real peak based on the time to peak of depakote tablets being 4 h ( the patients initial vpa levels were measured at 2 h after she allegedly consumed the vpa while the next blood draw was 9 h later ) . we also made the following observations : ( 1 ) raised venous ammonia levels may remain symptomatic for a significant period of time beyond discontinuation of vpa . ( 2 ) existence of more than one concurrent mechanism with different decay kinetics in the metabolism of ammonia in presence of high or low concentrations of serum vpa . unmasking of an inherent urea cycle metabolic disorder could have amplified the differential decay rates of venous ammonia . the possibility of more than one mechanism causing hyperammonia secondary to vpa use is suggested by the different proposed mechanisms of vpa metabolites causing hyperammonemia , these include : ( 1 ) propionic acid inhibiting the urea cycle enzyme carbamoyl phosphate synthetase i ; ( 2 ) valproyl - coa or a closely related compound as a proximate inhibitor of mitochondrial ureagenesis ; ( 3 ) valproyl - carnitine ester causing a relative carnitine deficiency and ( 4 ) 2,4-dien - vpa inhibiting b - oxidation . although , we can not speculate on the mechanisms responsible for the different kinetics of decay of ammonia levels in the presence of down - trending vpa levels we can confidently state that non - elevated hepatic enzymes and hyperammonemia despite carnitine replacement indicated that hepatic damage and carnitine deficiency had very little role in causing the slowly down - trending elevated ammonia levels in the presence of subtherapeutic serum vpa levels . hyperammonemia and psychiatric disturbance secondary to valproate use in our case showed a score of 9 by a naranjo algorithm , indicating strong causality with the drug and placing it in causality category of definite . our assessment of a high adverse reaction probability scale was based on the fact that there are previous conclusive reports of hyperammonemia secondary to vpa use with similar psychiatric features as presented in this case report , hyperammonemia occurred only after vpa use and eventually trended down to normal levels with discontinuation of vpa , patients psychiatric disturbance correlated with hyperammonemia , the patient symptomatically improved with drug discontinuation , there are no alternative explanation of hyperammonemia and altered mood in this case , the serum levels of vpa were elevated with concentrations known to be toxic and that toxic effects observed were more severe with high dose and less severe when secondary hyperammonemia decreased . this case report suggests that hyperammonemia , which is known to occur in about 50% patients treated with vpa , may have more than one concurrent etiologic mechanism with different decay kinetics which are not related to hepatic damage or carnitine deficiency .

valproic acid ( vpa ) has successfully been used in the therapy of a number of conditions including absence seizures , partial seizures , tonic - clonic seizures , bipolar disorder , schizoaffective disorder , social phobias , neuropathic pain and migraine headaches . there is a high rise in number of cases of toxicity due to overdose of vpa . hyperammonemia , a common side - effect of vpa , is caused by several proposed etiologies , reported as having uncertain correlation with vpa dose or concentration . we present here a case of a 25-year - old female patient with a past history of psychiatric complaints , presented with elevated serum vpa levels associated with elevated venous ammonia levels subsequent to vpa overdose . later in the presence of sub - therapeutic serum vpa levels her venous ammonia levels remained raised and slowly down - trending . vpa levels and ammonia levels were found to be normal after 14 days . patient was treated with levocarnitine . her liver enzymes were never elevated . different decay kinetics of venous ammonia in presence of high and low concentrations of vpa indicates that vpa can cause symptomatic hyperammonemia via more than one concurrent etiological mechanism . in this patient , the mechanisms causing hyperammonia secondary to vpa use were not related to hepatic damage or carnitine deficiency .

immunopathology is associated with the most common life - threatening disorders , including atherosclerosis and related cardiovascular diseases , cancer , and chronic inflammation . a number of diseases , such as lupus erythematosus , rheumatoid arthritis , or hiv infections , are characterized by pronounced immunopathologies ; others , such as atherosclerosis and cancer , by less obvious latent pathological changes in the immune system . such changes may represent early events in the disease initiation and development and might therefore be especially interesting for timely diagnostics and for development of preventive treatment . altered macrophage plasticity and polarization can contribute both to the malignancy development and to the tumor vascularization . in that regard , comprehensive analysis of the macrophage population diversity would be necessary for developing adequate therapeutic approaches and monitoring the therapy efficiency . recent studies have revealed many aspects of the complex and important role of macrophages in the pathogenesis of atherosclerosis . formation of the atherosclerotic plaque begins with monocyte activation and transformation into macrophages that reside in the subendothelial area of the blood vessel wall and accumulate lipids in their cytoplasm becoming foam cells . this lipid trapping is performed by means of uncontrolled phagocytosis . at the same time , certain types of macrophages are implicated in tissue repair , and these cells have been found in regressing plaques in mouse models [ 4 , 5 ] . therefore , different types of macrophages are responsible for the plaque initiation , growth , and , eventually , regression [ 68 ] . correspondingly , anti - inflammatory agents are considered as an important component of antiatherosclerotic therapy . here again , the analysis of macrophage phenotypic diversity could improve the understanding of the pathological process and assessment of the therapy efficiency . according to current epidemiological data , atherosclerosis - related diseases and cancer are the two greatest contributors to the overall mortality in the developed countries [ 10 , 11 ] . given that these diseases are tightly associated with immunopathology , development of comprehensive diagnostic methods and therapeutic approaches to modulate the immune system appears to be of the greatest importance . likewise , no drugs are available to date that allow targeted immune correction in atherosclerosis . it is clear that changes in cytokine expression and phenotypic features of macrophages may reflect the disease progression state . in many pathological conditions , the analysis of different types of cells circulating in the bloodstream can provide valuable information about the disease progression . during the recent years , a number of cell types have been isolated and studied for possible application in diagnostics and drug development . circulating tumor cells ( ctcs ) can be extracted from patient 's blood and used to analyze the expression of relevant genes and surface markers . for instance , successful isolation and molecular characterization have been described for metastatic breast cancer , metastatic colorectal cancer , and lung cancer . this strategy is especially useful in cases of advanced metastatic cancer , where the patients could benefit from a personalized treatment . the analysis of ctcs has a great diagnostic potential but can also help in revealing the possible drug resistance of the tumor and designing the optimal therapy . many current studies are focused on the improvement of ctc - based analyses and their clinical implementation . peripheral blood mononuclear cells ( pbmcs ) are relatively easily obtainable cells that can be used for monitoring a wide spectrum of conditions and pathologies . the analysis of mrna profiles of isolated pbmcs could be used for evaluation of metabolic changes . pbmcs can also be kept in short - term culture and used for studying cytokine production induced by stimulation . for instance , changes in proinflammatory cytokine production by isolated pbmcs have been described in such conditions as allergies , alterations of immune response , and immunization [ 1719 ] . studies on pbmcs have demonstrated that vascular endothelial growth factor ( vegf ) production was decreased in women with preeclampsia . isolated pbmcs can serve as a relevant system for testing various drugs , especially related to inflammation . recently , the potential of macrophage - based test system for diagnostics and treatment of atherosclerosis has been explored . atherosclerosis progression is usually slow , and the disease often remains asymptomatic until the ischemia of organs and tissues becomes evident . this may happen due to the obstruction of a blood vessel with growing atherosclerotic plaque or the embolism caused by a thrombus formed on a destabilized plaque . therefore , the first manifestations of the disease are often lethal [ 23 , 24 ] . however , it is hindered by the absence of clinical symptoms and complaints and by the fact that the spectrum of risk factors is very wide , including genetic predisposition , lifestyle and diet patterns , chronic inflammation , and metabolic factors . immunopathology is likely to be one of the mechanisms underlying atherosclerosis development starting from the early stages , and its assessment can therefore have an important diagnostic value . . these cells can eliminate pathogens by phagocytosis , release of reactive oxygen species , production of proinflammatory cytokines , and modulation of the t - cell immune response . macrophages are present in all organs and tissues and represent the first line of immune defence , responsible for removal of foreign agents and pathogens . the pool of macrophages remains constant in every tissue , and the cells are renewed from the population of circulating monocytes , although the results of recent studies suggest that these cells are also capable of self - renewal . it has been known for a long time that changes in the phagocytic activity of macrophages might be dependent on changes in the peripheral blood monocyte population , and alterations of the monocyte pool lead to various pathological conditions . proliferation of promonocytes , which can be stimulated by systemic inflammatory stimuli , leads to the increase of the number of circulating monocytes [ 29 , 30 ] . monocytes and macrophages , together with their precursors and dendritic cells , form the mononuclear phagocyte system ( mps ) , although the identity of the dendritic cells remains disputed [ 32 , 33 ] . the development , maintenance , differentiation , and function of mps are regulated mostly by colony - stimulating factor 1 ( csf-1 ) in homeostatic conditions and by granulocyte - macrophage colony - stimulating factor ( gm - csf ) during inflammation . inflammatory signals and various pathological conditions , including atherosclerosis development , stimulate the inactive circulating monocytes to become activated macrophages that can be distinguished by their phenotypic properties . macrophages can acquire different functional phenotypes influenced by the surrounding microenvironment in a process known as macrophage polarization . reaching consensus on macrophage classification was challenging due to the high variety of activation types , dependence of the results on the particular experimental setup , and differences of macrophage activation profiles between humans and animal models . recently , a group of leading immunologists have summarized the current knowledge on the issue and drawn recommendations for conducting and reporting the experiments involving macrophage polarization . initially , two main classes of macrophages , m1 and m2 , have been defined which could be obtained by activation of macrophages by proinflammatory interferon ( ifn- ) and lipopolysaccharide ( lps ) or by interleukin-4 ( il-4 ) , respectively [ 3739 ] . m1 macrophages are characterized by the production of proinflammatory cytokines tumor necrosis factor- ( tnf ) , il-1 , il-6 , il-12 , and proteolytic enzymes , as well as by the expression of fc- receptors on the cell surface [ 40 , 41 ] . polarization towards the proinflammatory phenotype can be induced in vitro by toll - like receptor ( tlr ) ligands , including tnf , lipopolysaccharide ( lps ) , and interferon ( ifn- ) that might also play a role in the pathogenesis of atherosclerosis . it has been demonstrated that m1 macrophages are present in the atherosclerotic plaques where they maintain the local inflammatory process and promote the extracellular matrix degradation contributing to the formation of unstable plaques that can induce thrombus formation and are therefore especially dangerous [ 4345 ] . the subpopulation of m2 macrophages was further divided into several subtypes depending on the activation stimuli ( figure 1 ) : m2a ( activated by il-4 ) , m2b ( activated by immune complexes ) , and m2c ( activated by il-10 ) . each of these subtypes is characterized by a distinct pattern of cytokine and surface marker expression which can also vary between the species . it has been proposed therefore to refer to different subtypes of macrophages indicating the activation type ( e.g. , m(il-4 ) instead of m2a ) . m2a macrophages have strong anti - inflammatory properties and can be regarded as tissue - repairing cells . they have poor phagocytic capacity and participate in the formation of extracellular matrix by stimulating production of collagen . they express il-1 receptor antagonist ( il-1ra ) and secrete ccl18 , transforming growth factor ( tgf- ) , and remodelling enzymes . m2b and m2c macrophages express different chemokine receptors , produce il-10 , and can modulate inflammation but do not synthesize the extracellular matrix and can therefore be regarded as regulatory macrophages . anti - inflammatory macrophages were also shown to express mannose receptor ( cd206 ) , stabilin-1 , and decoy receptor il-1rii on the surface [ 4951 ] . however , the heterogeneity of this population requires further studies and standardization of the nomenclature . for the sake of simplicity , later in this work , we will refer to the il-4-activated m2a macrophages as m2 phenotype . the production and release of the proinflammatory cytokines , such as il-1 and il-18 , are dependent on the macrophage inflammasome status [ 53 , 54 ] . inflammasome is a caspase - activating complex formed by several proteins , including caspase-1 , which is responsible for cytokine maturation . active caspase-1 can also be released from the activated cells and may contribute to the damage of neighbouring cells . in can be induced by danger- and pathogen - associated molecular patterns ( damps and pamps ) [ 5659 ] . importantly , inflammasome is activated in atherosclerosis in response to cholesterol accumulation in the blood vessel wall and formation of cholesterol crystals in foam cells . on the other hand , atherogenesis can be associated with ongoing infections with various pathogens , such as chlamydia pneumonia and helicobacter pylori , which can induce the inflammasome activation [ 6163 ] . there might exist other factors that contribute to the inflammasome activation and atherosclerosis progression , including the formation of uric acid crystals and impaired autophagy . therefore , the inflammasome activation and release of proinflammatory cytokines and caspase-1 are relevant for atherosclerosis progression and can be regarded as important markers of the pathological process . development of a reliable monocyte / macrophage - based functional test remains challenging due to several technical problems . the traditional method implies cell adhesion , which leads to monocytes activation and is therefore widely criticized . another method is fluorescence - activated cell sorting ( facs ) , which is fast and accurate but requires labelling of cells with specific antibodies , which can also lead to activation . a pure fraction of monocytes / macrophages can be isolated using magnetic separation . in this method , unspecific activation can also occur due to possible phagocytosis of paramagnetic particles . so far , the only method that can extract nonactivated monocytes is elutriation [ 66 , 67 ] . it requires , however , special equipment and is impossible to introduce into routine clinical practice . because of these technical problems , recent studies focused on the identification of molecular markers that could substitute for functional tests in diagnostics of immunopathologies . studies of monocyte function include the assessment of their motility , adhesion , phagocytic activity , and low - density protein ( ldl ) uptake [ 68 , 69 ] . macrophages can take part in pathological processes via stimulation with circulating soluble activation factors , adhesion to the endothelium , and migration into the tissue where they meet local activation factors . the monocytes ' response to these stimuli depends on their priming in circulation and therefore can have a diagnostic potential . the analysis of macrophage pro- and anti - inflammatory phenotypic classes can provide important information on the disease progression , as has been demonstrated for atherosclerosis . a monocyte / macrophage - based assay has recently been designed to evaluate changes in monocyte response to pro- and anti - inflammatory stimuli and to reveal possible bias of the macrophage polarization towards m1 or m2 phenotype . in this method , a pure population of blood monocytes was isolated using magnetic separation [ 49 , 70 ] ( figure 2 ) . the analysis of macrophage activity was performed by stimulating the cells with lps , proinflammatory stimulus ifn- , and anti - inflammatory stimulus il-4 . proinflammatory activity of macrophages was assessed by the levels of secreted tnf and il-1 and anti - inflammatory activity by the levels of ccl18 production and il-1ra expression . inflammasome activation can also be assessed in this experimental system by measuring the il-1 expression at mrna level and comparing the results with the amount of mature il-1 detected by elisa . another evidence of inflammasome activation that can be used as readout is the release of active caspase-1 . expression and release of the inflammasome - dependent cytokines tnf and il-8 should also be measured to provide the control of inflammasome activity . further characterization of macrophages can be performed by analyzing such markers as mmr , cd163 , tgf - rii , csfr1 , tnfri , cd16 , cd32 , cd64 , and stabilin-1 , as well as the expression of tlr1 , tlr2 , and tlr4 at mrna level and on the cell surface . the described experimental system can provide important information on monocyte activation state and possible skew of the monocyte predisposition towards pro- or anti - inflammatory response . apart from altered polarization towards one or the other phenotype , pathological conditions can be associated with other phenotypical alterations of monocytes / macrophage , including phagocytosis , migration , and proliferation . alterations of macrophage phenotype and plasticity associated with atherosclerosis have recently been discussed in a comprehensive review . the described method has been used to analyze activation of monocytes isolated from blood of healthy subjects ( n = 19 ) , atherosclerosis patients ( n = 22 ) , and breast cancer patients ( n = 18 ) . the obtained results demonstrated that production of proinflammatory tnf was significantly lower in atherosclerosis patients and significantly higher in cancer patients in comparison to healthy subjects . on the other hand , production of anti - inflammatory ccl18 was decreased both in atherosclerosis and in cancer patients . to evaluate the diagnostic potential of macrophages ' activation test in asymptomatic atherosclerosis , a study was performed on individuals with predisposition to atherosclerosis ( n = 21 , mean age 63 9 years ) and subclinical atherosclerosis ( n = 21 , mean age 62 7 years ) in comparison to healthy subjects ( n = 21 , mean age 60 9 years ) . predisposition to atherosclerosis and subclinical atherosclerosis were detected by measuring the age - adjusted carotid intima media thickness ( cimt ) . the analysis of tnf and ccl18 production by stimulated macrophages revealed dramatic individual differences between the analyzed subjects that may reflect the individuals ' predisposition to immunopathology . macrophages from subjects with subclinical atherosclerosis were characterized by especially low degree of activation in response to stimuli ( figure 3 ) . therefore , the ability of macrophages to polarize towards pro- and anti - inflammatory phenotypes was decreased at early stages of atherosclerosis development , although the causative significance of this observation remains unclear . changes of the immune system occur early in many pathological processes , opening the intriguing possibility that patients may benefit from a preventive treatment targeting the underlying immunopathology . enhanced monocyte activation may lead to macrophage polarization towards pro- or anti - inflammatory phenotype leading to chronic inflammation and atherosclerosis or to oncopathologies , respectively . for instance , it has been demonstrated that depolarization of macrophages from the m2 phenotype was associated with tumor regression . to explore the potential of the macrophage activation test for drug development , the macrophage depolarization effects of herbal extracts were studied on cells obtained from healthy subjects . plant extracts with immune - modulating properties are widely used in traditional medicine , but their therapeutic potential for modern clinical practice remains to be investigated . the extracts of the following plants with known anti - inflammatory activity were included into the study : flowers of hawthorn ( crataegus sp . ) , elderberry ( sambucus nigra ) , and calendula ( calendula officinalis ) and herbs of st . cultured macrophages were exposed to pro- and anti - inflammatory stimuli ( ifn- and il-4 , resp . ) , and tnf and ccl18 production was measured after 6 days . tnf secretion by ifn--stimulated macrophages treated with elderberry , calendula , and violet extracts was 1013-fold higher than that of untreated stimulated macrophages . on the other hand , hawthorn and st . john 's wort also suppressed the secretion of ccl18 by il-4-stimulated macrophages ( figure 4 ) . therefore , st . john 's wort and hawthorn extracts appear to be natural agents with immune - modulatory properties that could be used for macrophage depolarization . importantly , natural agents are characterized by relatively good tolerance and minimal side effects and are therefore especially suitable for long - term therapy , which is necessary for successful immune correction . one of the therapeutic strategies for treatment of atherosclerosis is the inhibition of intracellular cholesterol accumulation . it is well established that hypercholesterolemia is a potent risk factor for atherosclerosis development [ 7476 ] . however , the accumulating evidence demonstrates that atherogenic potential depends not so much on the total level of cholesterol as on the nature of cholesterol - containing lipoprotein particles that serve as a source of cholesterol storage in the arterial wall . low - density lipoprotein ( ldl ) and especially its modifications , such as small dense , oxidized , desialylated , or electronegative ldl , play the key role in atherogenesis , and their levels positively correlate with the disease progression [ 7779 ] . moreover , modified ldl particles can provoke formation of autoantibodies that initiate the inflammatory response and form highly atherogenic immune complexes with ldl particles . in that regard the ability of blood serum to induce cholesterol accumulation is referred to as serum atherogenicity . it has been previously demonstrated that serum obtained from atherosclerosis patients caused cholesterol accumulation in cultured cells and therefore was highly atherogenic . primary culture of human aorta cells can be a useful system for testing various antiatherosclerotic substances . using this system , atherogenic properties of patient 's blood serum can be analyzed before and after drug administration to assess its therapeutic potential [ 8284 ] . serum from study participants was added to cultured subendothelial intimal cells derived from uninvolved human aorta at concentration of 10% , and cholesterol accumulation was measured after 24 h using a previously established method . it was demonstrated that blood serum atherogenicity decreased in study subjects treated with a single dose of hawthorn extract . the observed decrease was 73% and 83% after 2 and 4 hours , respectively , in comparison to the baseline ( figure 5 ) . these results indicate that hawthorn extract may be regarded as a potent antiatherosclerotic agent . on the other hand , john 's wort extract was a potent macrophage depolarizing agent , and hawthorn was demonstrated to reduce the serum atherogenicity . further studies employing macrophage - based cellular test systems will allow identification of novel agents with therapeutic potential . monocyte / macrophage - based test system is a versatile tool to detect immunopathology , including increased monocyte activation and altered polarization of macrophages towards pro- or anti - inflammatory phenotypes . alterations in monocyte activation and imbalance in macrophage polarization can be associated with a variety of pathological conditions , including different types of cancer and atherosclerosis . therefore , the development of immunomodulating therapy might contribute significantly to the improvement of the existing treatment strategies . however , the complexity of the immunopathology requires flexible and reliable methods for diagnostics and monitoring of treatment efficiency . it was proven to be suitable for the analysis of immunopathology in subclinical atherosclerosis and breast cancer . this method can also be applied for studying numerous other pathologies , where monocyte / macrophage activation is implicated , including other types of cancer , chronic inflammation , and autoimmune disorders . given the broad spectrum of cytokines that may be analyzed , the described method can be improved to perform a more detailed study of macrophage activation . the application of monocyte / macrophage activation test for drug research was illustrated by screening a series of medicinal plant extracts for antiatherosclerotic activity . together , these results demonstrate the possibilities of macrophage - based cellular tests for diagnostics and drug research in conditions associated with immunopathology .

several highly prevalent human diseases are associated with immunopathology . alterations in the immune system are found in such life - threatening disorders as cancer and atherosclerosis . monocyte activation followed by macrophage polarization is an important step in normal immune response to pathogens and other relevant stimuli . depending on the nature of the activation signal , macrophages can acquire pro- or anti - inflammatory phenotypes that are characterized by the expression of distinct patterns of secreted cytokines and surface antigens . this process is disturbed in immunopathologies resulting in abnormal monocyte activation and/or bias of macrophage polarization towards one or the other phenotype . such alterations could be used as important diagnostic markers and also as possible targets for the development of immunomodulating therapy . recently developed cellular tests are designed to analyze the phenotype and activity of living cells circulating in patient 's bloodstream . monocyte / macrophage activation test is a successful example of cellular test relevant for atherosclerosis and oncopathology . this test demonstrated changes in macrophage activation in subclinical atherosclerosis and breast cancer and could also be used for screening a panel of natural agents with immunomodulatory activity . further development of cellular tests will allow broadening the scope of their clinical implication . such tests may become useful tools for drug research and therapy optimization .

several guidelines have been published regarding the treatment and prevention of deep vein thrombosis ( dvt)1 , 2 . the guidelines underscore the fact that comprehensive measures for prevention of dvt are necessary3 . guidelines for the diagnosis , treatment and prevention of pulmonary thromboembolism and deep vein thrombosis ( jcs 2009)2 state that elastic stockings are effective for the prevention of dvt . the mechanisms by which wearing elastic stockings prevents dvt are prevention of blood stasis by increasing the blood flow volume and decrease of the caliber of venous blood vessels by compression of the lower limbs4 . however , these effects are still under debate5 , 6 . nara et al . reported that there is little effect when elastic stockings are used as a single application7 , but scurr et al . indicated that a combination of elastic stockings and intermittent pneumatic compression was effective for prevention of dvt8 therefore , examination of the effects of combining elastic stockings with something else on prevention of dvt may be of clinical significance . previously reported that ankle positions affect the blood velocity in the common femoral vein during ankle pumping exercises9 , which was recommended for the prevention of dvt . the aim of this study was to identify how to effectively use elastic stockings to change the blood flow velocity in the common femoral vein under different ankle positions . the study subjects were 10 males without a history of cardiovascular diseases and no contraindications for exercise testing and training according to the guidelines of the american heart association10 . one experimenter ( y.f . ) measured the blood flow velocity in all of these experiments . time - averaged maximum flow velocity ( tamv ) in the left common femoral vein was measured using a pulse doppler method with a diagnostic ultrasound system ( acuson p300 , siemens healthcare , erlangen , germany ) . tamv is the averaged blood flow velocity per unit time in the left common femoral vein . the subject s heart rate , systolic blood pressure ( sbp ) , and diastolic blood pressure ( dbp ) were monitored ( suntech tango+ , suntech medical , usa ) continuously during measurement of tamv . in this study , stocking were used , and the right size for each subject according to the instruction manual was selected . subjects were asked to assume three different positions : supine ( supine position ) , supine with the legs up after the examination bed was raised to an 18-degree angle ( leg - up position ) , and supine with the head up after the examination bed was raised to a 30-degree angle ( head - up position ) ( fig . 1.experimental protocol ) . at the beginning of each condition , the subjects had a 3-min rest period to acclimatize themselves to each position . after the 3 min of rest , the tamv in the left common femoral vein was measured for 20 seconds . in total , the subjects were asked to undergo testing under six conditions , that is , each of the 3 positions with and without stockings . experimental protocol two - way anova for repeated measures was used to compare the tamv values of blood flow velocity . all analyses were performed using spss statistics ver . 17.0 ( spss inc . , chicago , il , usa ) , and statistical significance was accepted at an alpha level of 0.05 . this study was approved by the human ethics review of tokyo university of technology ( approval number ; e14hs-026 ) . under the without stockings condition , the tamv in the head - up position ( 16.6 6.1 cm / sec ) was significantly lower than those in the supine ( 30.1 17.8 cm / sec ) and leg - up positions ( 28.9 17.5 cm / sec ) ( supine vs. head up , p<0.05 , leg up vs. head up , p<0.05 ) . tamv showed no significant difference between the supine position and leg- up position ( table 1table 1.time-averaged maximum flow velocity in the common femoral vein in three different positions with and without stockings ) . under the with stockings condition , the tamv in the head - up position ( 13.6 4.4 cm / sec ) was also significantly lower than those in the supine ( 33.1 15.5 cm / sec ) and leg - up positions ( 27.7 9.4 cm / sec ) ( supine vs. head up , p<0.01 , leg up vs. head up , p<0.01 ) . tamv showed no significant difference between the supine position and leg - up position ( table 1 ) . in this study , elastic stockings did not affect the blood flow velocity in the common femoral vein . this can be attributed to the fact that subjects were young health males who had no problem in their venous valves and venous vascular walls . generally , the venous diameter is wider than the arterial diameter , but the venous vascular wall is thinner than the arterial vascular wall because it has a thinner layer of smooth muscle and fewer elastic components . for this reason , veins have great compliance and thus a high blood volume , and compression can easily change the venous shape11 . in venous incompetence , the number of collagen fibers increases , and the fibers are randomly aligned12 , 13 . furthermore , veins can not constrict and expand adequately in response to the stimulation of noradrenalin , potassium chloride , angiotensin ii , nitric oxide , calcium ion , etc . , and they do not function normally14 . additionally , expansion of veins and blood stasis occur easily because dysfunction of venous valves causes the blood pressure to increase in veins . thus , it is likely that elastic stockings are effective in preventing blood stasis in venous incompetence by compressing veins continuously and preventing them from expanding15 . in this study , therefore , it is suspected that compression by elastic stockings does not lead an increase in blood flow velocity , as their venous valves and venous vascular walls functioned properly . on the other hand , it is known that an increase in hydrostatic pressure disturbs venous return16 , thus in venous incompetence , the blood velocity in the common femoral vein can decrease markedly because venous incompetence disturbing venous return may be affected profoundly by gravity . this study has some limitations : ( 1 ) the number of subjects in this study was relatively low , and ( 2 ) the subjects were only young healthy male volunteers . this could have affected results , and a study for different age groups of people should be performed .

[ purpose ] the aim of this study was to identify how to effectively use elastic stockings . [ subjects and methods ] ten young healthy men participated in this study . time - averaged maximum flow velocity in the common femoral vein was measured for 20 seconds using a pulse doppler method with a diagnostic ultrasound system under six conditions ( three different positions and with and without stockings ) . changes of blood flow velocity were compared . [ results ] elastic stockings did not affect the blood flow velocity in the common femoral vein . for both the with stockings condition and without stockings condition , the time - averaged maximum flow velocity in the head - up position was significantly lower than that in the supine and leg - up positions . time - averaged maximum flow velocity showed no significant difference between the supine position and leg - up position . [ conclusion ] elastic stockings did not affect the blood flow velocity in the common femoral vein , but ankle positions did affect it . further studies of patients with venous insufficiency are needed .

the canadian integrated program for antimicrobial resistance surveillance ( cipars ) , established in 2003 , monitors antimicrobial drug use and resistance in selected species of enteric bacteria from humans , animals , and animal - derived food sources across canada ( www.phac-aspc.gc.ca/ cipars - picra / surv - eng.php ) . human salmonella isolates were submitted by all provincial public health laboratories in canada to the national microbiology laboratory for further characterization . antimicrobial drug susceptibility testing was performed by using broth microdilution ( sensititer automated microbiology system ; trek diagnostic systems ltd . , westlake , oh , usa ) and breakpoints established by the clinical laboratory standards institute ( 4 ) . a total of 76 s. enterica serovar kentucky isolates were submitted to the cipars program during 20032009 , and 23 ( 30% ) isolates showed ciprofloxacin resistance ( mic 4 ciprofloxacin - resistant isolates were identified from human case - patients in british columbia ( n = 2 ) , alberta ( n = 2 ) , saskatchewan ( n = 1 ) , ontario ( n = 12 ) , quebec ( n = 5 ) , and prince edward island ( n = 1 ) . age information was available for 54 of 76 case - patients infected with s. enterica serovar kentucky during the study period . black bars indicate ciprofloxacin - resistant isolates , and white bars indicate non ciprofloxacin - resistant isolates . of these isolates , ciprofloxacin resistance was observed among case - patients 1869 years of age , and 5 of 11 were 1829 years of age . case - patients 1829 years of age were 8 times more likely to have a ciprofloxacin - resistant strain than case - patients 5069 years of age ( odds ratio [ or ] 8.3 , 95% ci 1.03467.198 , p = 0.046 ) . of 21 ciprofloxacin - resistant isolates from case - patients who reported site of isolation , 20 were identified from feces and 1 from urine . there were no differences in site of isolation between ciprofloxacin - resistant and ciprofloxacin - susceptible s. enterica serovar kentucky isolates . although the total number of isolates associated with human infections was rare , of the 21,426 nontyphoidal salmonella spp . submitted for susceptibility testing as part of the human component of the cipars program since 2003 , s. enterica serovar kentucky had a significantly higher rate of ciprofloxacin resistance than all other nontyphoidal salmonella isolates and comprised 66% ( 23/35 ; p<0.0001 ) of all ciprofloxacin - resistant isolates identified during that period . in canada , ciprofloxacin - resistant s. enterica serovar kentucky was first identified in 2005 , when 22% ( 2/9 ) of isolates submitted for drug susceptibility testing were resistant to this drug . a significant increase ( or 10.5 , 95% ci 1.1159.913 , p = 0.04 ) in the number of isolates resistant to ciprofloxacin the largest number occurred during 20082009 , when ciprofloxacin - resistant isolates comprised 57% ( 17/30 ) of all s. enterica serovar kentucky isolates identified ( figure 1 ) . the number of cases reported in canada is comparable with that reported in denmark over a similar period ( 3 ) . we typed all isolates by using pulsed - field gel electrophoresis as described and restriction enzyme xbai ( 5 ) . a dendrogram depicting the results was generated with bionumerics version 3.5 ( applied maths , sint - martens - latem , belgium ) and is shown in figure 2 . all ciprofloxacin - resistant isolates clustered with a percentage similarity > 80% ; only 1 ciprofloxacin - susceptible isolate was found in this cluster ( figure 2 , panel a ) . dendrograms of macrorestriction fragments of all ( a ) and ciprofloxacin - resistant ( b ) salmonella enterica serovar kentucky isolates identified in canada , 20032009 . the dotted vertical line in panel a indicates a cutoff value of 80% similarity , and the box indicates ciprofloxacin - resistant isolates . left end and right end in panel b indicate pcr results for presence ( pos ) or absence ( neg ) of left and right junctions of salmonella genomic island 1 . pfge , pulsed - field gel electrophoresis ; mlst , multilocus sequence typing ; ac , amoxicillin clavulanate ; am , ampicillin ; ch , chloramphenicol ; ci , ciprofloxacin ; ge , gentamicin ; na , nalidixic acid ; st , streptomycin ; su , sulfisoxazole ; te , tetracycline ; st , sequence type ; tm , trimethoprim ; pei , prince edward island . multilocus sequence typing ( mlst ) was performed on a subset of 8 isolates on the basis of differences in pulsed - field gel electrophoresis patterns and variations in antimicrobial drug resistance . data were submitted to the mlst database website ( http://mlst.ucc.ie/mlst/dbs/senterica ) to determine mlst types ( 6 ) . all isolates tested were sequence type ( st ) 198 ( figure 2 , panel b ) . this sequence type and similar antimicrobial drug resistance patterns have been recently reported in france , england and wales , denmark , belgium , and africa ( 3,7,8 ) . many st198 multidrug - resistant isolates observed in europe and africa contained salmonella genomic island 1 ( sgi1 ) variants , particularly , sgi1-k , sgi1-q , and sgi1-p . to determine whether ciprofloxacin - resistant isolates from canada harbored similar sgi1 variants , we used pcr to detect the chromosomal left and right junctions of sgi1 as described ( 9,10 ) . the right junction was found in 22 of 23 isolates , and the left junction was found in 18 of 23 isolates ( figure 2 , panel b ) . analysis of s. enterica serovar kentucky isolates obtained during 20032009 from animal and retail meat samples as part of cipars did not identify any ciprofloxacin - resistant isolates ( www.phac-aspc.gc.ca/cipars-picra/index-eng.php ) . this finding suggests that human infections in canada were not acquired from domestically produced food . many ciprofloxacin - resistant s. enterica serovar kentucky human infections identified in europe have been linked to travel to countries in africa ( 3 ) . of 23 case - patients in canada travel history was defined as previous travel out of canada within the past 7 days . four case - patients had traveled to morocco ( 1 also had traveled to spain and portugal ) , 3 had traveled to egypt , 1 had traveled to libya , and 3 had traveled to africa ( no country reported ) . resistance to ciprofloxacin in salmonella spp . is a growing concern because it limits the ability to treat invasive disease . in this study , we described the characteristics of ciprofloxacin - resistant s. enterica serovar kentucky isolates in canada . similar drug - resistance patterns and genetic backgrounds of s. enterica serovar kentucky have been observed in europe and linked to travel to countries in africa ( 3 ) . that most isolates had multidrug resistance phenotypes is of particular concern . further studies are required to determine risk factors for acquisition of these infections in canada .

we report emergence of ciprofloxacin - resistant salmonella enterica serovar kentucky in canada during 20032009 . all isolates had similar macrorestriction patterns and were multilocus sequence type st198 , which has been observed in europe and africa . ciprofloxacin - resistant s. enterica serovar kentucky represents 66% of all ciprofloxacin - resistant nontyphoidal salmonella sp . isolates observed in canada since 2003 .

pregnant women and neonates are at greater risk for influenza - related complications than the general population [ 1 , 2 ] . most institutions and organizations recommend that all pregnant women receive the trivalent inactivated influenza virus vaccine [ 38 ] . such endorsements rely on the immunogenic response of the mothers , the lack of teratogenicity , and the contrandication of immunization in children younger than six months [ 7 , 911 ] . despite the broad recommendation to vaccinate pregnant women against influenza , coverage is still limited . a survey held by the centers for disease control and prevention involving women who were pregnant from october 2011 to january 2012 showed that only half of the respondents had been vaccinated and fewer than 10% had received the vaccine before giving birth . similar patterns were found in previous studies . although there is clear evidence of the efficacy of the influenza vaccine for the general population , to our knowledge , a systematic approach with regard to the evidence of the therapeutic effects of influenza vaccination in pregnant women is lacking . our objective is to review the effects of influenza vaccination in preventing influenza - related outcomes in pregnant women and their infants . we selected randomized controlled trials or cohort studies that assessed the effects of inactivated influenza vaccine in preventing influenza - related outcomes in pregnant women and their offspring compared with placebo , other vaccines , or no vaccines . we excluded studies that assessed monovalent vaccines , such as the h1n1 influenza vaccine , because they are used for specific epidemic situations . we searched for eligible studies in the following databases ( from inception to september 2013 ) : medline , embase , scopus , centre for reviews and dissemination ( crd ) , cochrane central register of controlled trials ( central ) , metaregister of current controlled trials ( mcrt ) , latin american and caribbean center on health sciences information ( lilacs ) , and scientific electronic library online ( scielo ) . references to relevant publications in the field were also screened to identify potentially eligible studies . there were no restrictions on language , length of followup , publication date , or publication status . we used the following search terms to search medline ( via pubmed ) and adapted the strategy for the other databases : ( influenza , human[mesh ] or influenza[tiab ] or human flu[tiab ] or influenza[tiab ] or influenzas[tiab ] or grippe[tiab ] or flu[tiab ] or cold[tiab ] ) and ( influenza vaccines[mesh ] or influenza vaccines[tiab ] or vaccine[tiab ] or vaccine[tiab ] or vaccines[tiab ] ) and ( mothers[mesh ] or mothers[tiab ] or pregnant women[tiab ] or pregnant[tiab ] ) and ( infant[mesh ] or infant[tiab ] or infants[tiab ] or infant , newborn[mesh ] or newborns[tiab ] or fetus[mesh ] or fetus[tiab ] or foetus[tiab ] or fetal[tiab ] or pregnancy ) . two independent reviewers ( eb and labl ) selected the studies by assessing titles and abstracts and extracted the data . the extracted data consisted of the following : year , country , study design , gestational age , type of vaccine , posology , comparators , sample size , followup , and outcomes . when necessary , we contacted the corresponding authors for additional information . to assess the risk of bias of randomized controlled trials ( rct ) , we used the cochrane collaboration tool , which includes judgments about the sequence generation , allocation sequence concealment , blinding , incomplete outcome data , selective outcome reporting , and other sources of bias . for observational studies , we evaluated the following : eligibility criteria , measurements of exposures and outcomes , control of confounding , and followup . we assessed the quality of evidence for each relevant outcome with the grading of recommendations assessment , development , and evaluation ( grade ) [ 17 , 18 ] . for this evaluation , we separated the bodies of evidence into experimental and observational centered on rct and cohort studies , respectively . following the grade approach , then , we assessed the evidence against five items that could decrease its quality : limitations ( risk of bias ) , inconsistency , indirectness , imprecision , and publication bias . after assessing these items , the resulting quality of evidence could be rated as high , moderate , low , or very low . when distinct levels of quality were available for the same outcome , we considered the experimental design ( rct ) evidence in rating the quality . the final judgments regarding the risk of bias and evidence quality were achieved by consensus . the primary outcome was the incidence of influenza - like illness , which was defined as fever and either cough or sore throat . for infants ' outcomes , we defined small for gestational age as a weight below the 10th percentile and prematurity as birth before a gestational age of 37 complete weeks . we extracted the estimates along with 95% confidence intervals ( 95% ci ) according to the data available in the original studies ( relative risk ( rr ) , odds ratio ( or ) , or hazard ratio ( hr ) ) . if reported , we only considered the adjusted estimates and did not perform further calculation . we attempted to perform meta - analyses using random effects models , if numerical data from studies allowed a summarization . twenty - three records were selected for full - text assessment , and nine were included in the review . were related to eight unique studies that enrolled 182,820 pregnant women and 182,246 neonates [ 3442 ] . we identified one rct conducted in bangladesh and seven cohort studies performed in the united states . the trivalent inactivated vaccine was the most common intervention and was assessed in seven studies [ 3541 ] . newborns were not vaccinated . only the rct had an active control group ( pneumococcal vaccine ) . nearly the entire sample of pregnant women came from three retrospective cohorts [ 35 , 37 , 41 ] . the length of followup of each outcome varied among studies and lasted up to 36 weeks . some studies adjusted their results for confounding factors , such as the women 's age , week of delivery , infant 's gender , and gestational age . observational studies that compared baseline characteristics of the groups showed that most variables did not differ between the groups . some studies showed that vaccinated women had a worse profile than unvaccinated women , which were of higher risk for complications , were older , and had higher body mass index , higher parity , and more multiple gestation . we could not perform meta - analysis because the studies used different measures of association for the same outcome ; the estimates are presented as available in the studies . mothers who received the influenza vaccine had a lower incidence of influenza - like illness , as did their infants ( high - quality evidence ) , but there was no difference found for influenza - like illness with fever higher than 38c ( moderate - quality evidence ) . a lower incidence of influenza in infants , as confirmed by laboratory tests , was also observed ( moderate - quality evidence ) . very - low - quality evidence showed no difference between comparisons with regard to the incidence of upper respiratory infection , hospitalization , and medical visits for influenza - like illness in mothers and infants . two studies found no difference in the incidence of hospitalization for influenza - like illness in infants [ 35 , 37 ] ; in one study , the reduction in the rate of hospital admission was significant . with regard to medical visits for influenza - like illness in infants , the observational studies showed no significant differences [ 35 , 37 , 40 ] , and the rct showed a reduction in such rate ( moderate - quality evidence ) . for the outcomes prematurity and small for gestational age , conflicting results were found across the studies . one single cohort indicated significant reduction in stillbirth and neonatal death among the influenza - vaccinated group ( moderate - quality evidence ) . we did not assess the incidence of adverse reactions because the included studies did not systematically evaluate this outcome . in general , influenza vaccination had no association with local or minor systemic effects , fever , apgar score at one minute , hyperbilirubinemia , or major malformations . the influenza vaccine was found to reduce the risk of influenza - like illness in mothers and infants as well as the risk of laboratory - confirmed influenza in infants . adverse reactions were not systematically assessed across the studies , but there was no evidence of increase in clinically relevant risk related to influenza vaccination during pregnancy . a big cohort study that focused on the safety of trivalent inactivated influenza vaccine , however , did not find any increased risk of adverse events and adverse obstetric events in the vaccinated mothers , when compared to unvaccinated pregnant women [ 43 , 44 ] . other factors can prevent influenza in infants such as the effect of breast - feeding and immunization of all the infant 's close contacts , also known as cocooning . to avoid confounding and enable comparison , groups should be set by randomization . in the present review , however , only one rct was identified and included . although most observational studies performed multivariate analyses , residual confounding may remain even after adjustment because this statistical procedure can not control for all biological variabilities . women receiving influenza vaccine would have more medical attention and be healthier than unvaccinated pregnant women ; thus , the result found would be attributed to the health profile of vaccinated women rather than to the vaccine itself . however , some studies reported that vaccinated women were at high risk during gestation , and this difference was also statistically controlled [ 37 , 42 ] . studies consistently reported that the patients and the clinicians made the decision about taking influenza vaccine or not . surveys about attitudes and beliefs of these actors regarding influenza vaccination in pregnancy show that the proportion of people who do not believe vaccine is safe is still high [ 48 , 49 ] . another limitation of our review is the absence of the systematic reporting of adverse reactions . although the incidence of adverse reaction was not shown to be a concern in the included studies , this lack of evidence may inadvertently lead to the conclusion that this risk is minimal or nonexistent . individuals with egg allergy , for example , require caution when receiving trivalent inactivated influenza vaccine . previous narrative reviews concluded that influenza vaccination is safe , that there has been no evidence of teratogenicity , and that many countries recommend influenza vaccination among women with both healthy and high - risk pregnancies [ 9 , 5156 ] . the role of education of patients and doctors in increasing adherence to maternal vaccination was also emphasized [ 5759 ] . one systematic review assessed the benefits and dangers of the influenza vaccine in special populations pregnant women included but limited the eligible studies to rcts only . apprehensions about the use of thimerosal - containing influenza vaccines , based on theoretical risk of harm to the fetal brain , were widely spread in scientific and lay communities during the past years [ 55 , 62 ] . subsequent research proved that no causal relation existed between immunization with vaccine containing thimerosal preservative including exposure during pregnancy and neuropsychological outcomes [ 63 , 64 ] . the most recent report of the global advisory committee on vaccine safety of the world health organization considered that available evidence strongly supports the safety of the use of thimerosal as a preservative for inactivated vaccines . it is expected that with the availability of higher - quality evidence , such concerns can be demystified . attending to claims for more evidence [ 66 , 67 ] , several rcts assessing influenza vaccination in pregnancy are planned and some are ongoing [ 6877 ] . such rcts focus on different populations , such as hiv - positive mothers , and factors that interfere with immunization coverage . we expect that , following the publication of these trials , the availability and quality of the evidence will radically improve . additionally , the issue about the comparability between the vaccinated and unvaccinated groups will be more properly addressed . maternal immunization for influenza significantly reduced the incidence of influenza - like illness in women and infants . for clinical practice , further studies should address this lack of evidence and enhance the overall quality of the outcomes .

objective . to assess the effects of the inactivated influenza virus vaccine on influenza outcomes in pregnant women and their infants . methods . we performed a systematic review of the literature . we searched for randomized controlled trials and cohort studies in the medline , embase , and other relevant databases ( inception to september 2013 ) . two researchers selected studies and extracted the data independently . we used the grading of recommendations assessment , development , and evaluation ( grade ) approach to assess the quality of the evidence . results . we included eight studies out of 1,967 retrieved records . influenza vaccination in pregnant women significantly reduced the incidence of influenza - like illness in mothers and their infants when compared with control groups ( high - quality evidence ) and reduced the incidence of laboratory - confirmed influenza in infants ( moderate - quality evidence ) . no difference was found with regard to influenza - like illness with fever higher than 38c ( moderate - quality evidence ) or upper respiratory infection ( very - low - quality evidence ) in mothers and infants . conclusions . maternal vaccination against influenza was shown to prevent influenza - like illness in women and infants ; no differences were found for other outcomes . as the quality of evidence was not high overall , further research is needed to increase confidence and could possibly change these estimates .

embryos generated through assisted reproductive technologies ( art ) are deemed surplus when , for some reason , they are not used for reproductive purposes ( svendsen and koch 2008 ; haimes and taylor 2011 ) ; instead , they are then disposed of or , where this is allowed by a country s art regulation , may be donated for a variety of research purposes . thus , the generation and subsequent fate of embryos that are designated surplus are determined as much by legislation as by embryo biology or technological constraints . for example , legislatures differ in whether cryopreservation of embryos is permitted , meaning that in some countries any ivf embryos not immediately transferred for pregnancy are surplus , while in others they may be frozen for later transfer . in some countries , the law considers surplus embryos as the primary source of material for human embryonic stem cell ( hesc ) research , while in others this use of embryos is expressly forbidden . although hesc research has been subjected to exhaustive ethical scrutiny , the lack of consensus on the ontological or ethical status of surplus embryos means that the uses to which they may then be put remain contested ( deckers 2007 ; guenin 2008 ; moller 2009 ) . even if using human embryos for stem cell research is deemed permissible , ethical issues continue to emerge as new social practices and roles develop around the act of embryo donation . the relative novelty of these practices and roles , complicated by the pace of change in technical possibility and regulation , mean that there is still uncertainty about how to conceptualise embryo donation , not just in terms of systematic ethics but as a sociomoral practice in everyday social life and morality ( banks , scully , and shakespeare 2006 ) . from a sociological perspective , and also to understand more generally how everyday morality deals with unprecedented ethical dilemmas , it is important to examine which conceptualisations emerge as salient and how they are stabilised and used . for example , one way of thinking about the donation of embryos to research is as a bodily gift relationship , one of the many established by modern biomedicine such as the donation of eggs and sperm for reproductive purposes , organs or tissues for transplantation , blood for transfusion , and other biological tissues for research . drawing analogies to existing practices in this way has proved helpful in other instances of bioethical novelty ( hofmann , solbakk , and holm 2006 ) . however , analogies can equally well be misleading , if there are morally relevant but unacknowledged differences between situations . the contexts in which different organs and tissues are donated vary significantly , and these differences influence the sociomoral understanding of donation in each case and make them noncomparable in ethical terms . reproductive tissue , for example , is generally distinguished from other types of donated tissue because eggs , sperm , and embryos have the potential to give rise to new individuals , not just to prolong the lives of existing individuals , or to be used for research . because embryos are generally considered to have a different moral status from other tissues , the use of surplus embryos in research raises moral unease about the instrumentalization of human life that is not raised in quite the same way by the donation of either ova or sperm . it is therefore unclear whether an embryo can meaningfully be treated as a gift ( donation ) without blurring the morally relevant differences between embryos and other tissues . similarly , hesc research , to which the embryo may be given , is a domain of biomedical practices and not an entity . as such , hesc research is not a subject with which a gift relationship can be established ( unlike , for instance , an organ recipient ) . understanding the social and ethical meanings that are emerging for the practices associated with embryo donation calls for a detailed empirical examination of people s reasoning behind donation decisions . however , most empirical studies of embryo donation have not focused on people s donation rationales in depth ( with some exceptions ; for example , haimes et al . 2008 ; de lacey 2003 ) . the scarcity of data on donor rationales means there is a corresponding lack of information on contextual and other factors that influence donor decisions and how these can be related to the evaluations of theoretical ethics . the authors of this paper have been involved in a series of linked qualitative studies of practices of embryo donation , first in the united kingdom ( researcher haimes and colleagues ) , then switzerland ( scully , rehmann - sutter , and porz ) , and in a smaller pilot project in china ( mitzkat , rehmann - sutter , and haimes ) . all three studies shared an interest in understanding reasons for the donation or non - donation of embryos . while the studies in switzerland and china drew upon the original u.k . design , each study was conducted independently , and the details of each project , including interview design , differed in light of the varying regulatory , clinical , and cultural contexts . however , by looking across the three data sets , we hope to gain cross - cultural insights into donation and non - donation rationales and the moral understandings on which they are based . the three studies all used open - ended , semi - structured , one - off interviews between the researcher and people who had been in the position of deciding whether to donate their surplus embryos to research . interviews were designed to explore in depth not just the interviewees decision about donation but also the background to that decision , such as their ivf story , their family and other relationships , their relationship with the clinic and its staff , and so on . the interviews were transcribed , coded , and initially analysed to identify the reasons for donation decisions given by participants in each study , using an interpretative approach that all of us have previously found useful for identifying key themes around decision - making and implicit or explicit ethical judgements ( charmaz 2006 ; smith , flowers , and larkin 2009 ) . study ran for more than three years ; after some familiarisation and observation in the collaborating clinic , 44 in - depth interviews were conducted with couples who had been asked to donate their surplus fresh embryos , generated through ongoing ivf treatment , to hesc research ( haimes and taylor 2009 ) . in the united kingdom , it has been possible for some years to donate unused embryos to stem cell and other kinds of research and also to other couples . the swiss study was carried out shortly after a change in the law that permitted fresh or cryopreserved surplus ivf embryos , under strictly defined conditions , to be donated to stem cell research only . in this study , 17 individuals who had variously chosen to donate or not to donate were interviewed ; thus , the decision concerned the fate of cryopreserved embryos some time after the ivf treatment that had produced them ( scully , rehmann - sutter , and porz 2010 ) . the chinese work involved a much smaller three - month pilot study carried out in a large art hospital . it was designed as a pilot to provide a comparison with the u.k . and swiss material and is , therefore , included here despite the low number of participants , but with no attempt to draw general conclusions from it . legislation in china does not allow the donation of embryos to other couples , but consent can be given for a surplus embryo to be used in stem cell research or for it to be discarded . the study included participant observation of the information and consent procedures and qualitative interviews with five ivf patients , three choosing to donate to stem cell research and two refusing ( mitzkat , haimes , and rehmann - sutter 2010 ) . for the purposes of this paper , the authors involved in the studies jointly compared the rationales for donation decisions given by their participants . we also independently reexamined interview transcripts for material relevant to the discussion of gratitude . in the rest of this paper , we first identify and compare the main reasons given by participants in these three studies for their decisions to donate or to refuse to donate their surplus embryos to research . we then look in more detail at the implications of our findings for one area of potential ethical concern : the possible role of gratitude in making embryo disposition decisions . in this way , we not only collect empirical data to help understand the emerging moral meaning of a new practice , but also give an example to show how empirical data can be used to question and then refine the conceptual basis of bioethical theory . participants who chose to donate their surplus embryos to research had a background premise that donation is fundamentally permissible because embryos do not have the sort of ontological or moral status that would forbid it . the swiss study discovered people stating this explicitly : [ embryos ] are not , they are not yet people ; they are nt beings with souls as far as i m concerned , as one swiss participant said.1 but this did not mean that the surplus embryos were considered as morally equivalent to any other tissue , and participants in both the swiss and u.k . interviewees stopped themselves midway through sentences referring to the left over embryos , which they clearly felt , on reflection , was an inappropriate phrase . so the embryos did not have the sort of moral status that would have made it wrong to donate them , but neither were they completely disposable . to some of our participants , embryos had a value ; they were a precious resource ( haimes et al . 2008 ) that made simply throwing them out an unjustifiable waste . as another u.k . [ i]t just really seemed a waste , really , not to have them used . it was not always clear , however , quite how interviewees were using this notion of precious : whether with reference to economic bio - value ( waldby 2000 ; waldby and mitchell 2006 ) or because they had been obtained at intense personal and emotional cost , or because they had high moral value , or possibly a combination of all these aspects . particularly in the swiss study , which involved cryopreserved embryos stored for some time , participants referred to embryos moral status in a nuanced way that was highly sensitive to the developmental stage of the embryo , its physical location ( whether inside or outside the body ) , and its state ( whether cryopreserved or not ) ( see scully , rehmann - sutter , and porz 2010 ) . studies seemed less interested in explicitly defining the moral status of an abstract embryo than working out what their own particular embryos meant for them at defined points in their own story , and what this meaning then indicated it was morally permissible for them to do with that embryo . across all three studies the commonest rationale for opting to donate was a willingness to contribute to potentially curative medical research . such research was seen as a valuable endeavour by those like the swiss participant who said , i feel that , fundamentally , research has to go on , and i support that . donation of their spare embryos to research was therefore seen as a morally good act , based on a kind of ethical arithmetic in which simple disposal produced zero good from the surplus embryo , while donation had the potential to do good by supporting research . as one u.k . interviewee said , it was quite simply that we ve been helped by the system , we should help the system back. not because of some sort of martyrdom or heroics or anything like that , just quite simply that without such efforts things do nt progress . in the u.k . study there was an added imperative to donate surplus embryos to research as there had been a lot of press coverage about the hoped - for curative outcomes of stem cell science : i think the research is very important , like it was in the news a while ago to say that [ the senior clinician ] was successful in stem cell research and that s what you need in order to provide medical assistance in the future , so i m all for it . this observation raises a separate ethical concern about the patients understanding of the information they were given about the research goals . here in the swiss study , the notification from the clinic storing the frozen embryos stated clearly that donation was to stem cell research , yet the majority of donors we interviewed who referred to research did so in terms that were directly relevant to infertility . a lot of preparatory work , research work , went on before medicine was advanced enough that it was possible for us to have children . [ t]his is now maybe a tiny tiny contribution , that we can give back , if we now donate a , er , fertilised egg , perhaps for further research . note that in the chinese pilot study none of the participants spoke in precise terms about the research involved ; however , they described it broadly as one chinese interviewee said she did not really know what the research was about , but trusted the doctors and hoped it would help other infertile women . in switzerland , the donors were former ivf patients donating cryopreserved embryos ; in china , they were current ivf patients donating either fresh or cryopreserved embryos . in neither of these studies were participants asked outright if they thought their donated embryo was being used in infertility research . however , the fact that they used phrases such as helping others as we have been helped ( italics added ) indicates a potential misunderstanding . it raises the possibility that if they had been fully aware that the research undertaken with their embryos did not concern infertility , participants might have chosen against donation . the u.k . participants had much clearer ideas about the research to which they were being asked to donate ; they knew that it was not for research on fertility issues . these participants , as in the chinese study , were current patients donating fresh embryos . the differences in comprehension are therefore unlikely to be due to the request context ( former vs. current patients or fresh vs. frozen embryos ) in itself . however , in the u.k . study participants were asked to decide whether or not to donate to a number of specific projects , for each of which the goal and methodology was explained in detail , orally and in writing . it is possible that this level of engagement with the detail of the research underlies the difference . it will be important to clarify this , and to identify best practices for maximising patient comprehension of the research goals , because if ( as our material indicates ) the type of research to which people donate is a relevant factor in their moral evaluation , then the question of whether they fully understand its nature is ethically crucial . as we have seen , some of our participants reasoned that if their embryo was not going to be used for pregnancy , then donating it to a good endeavour ( research ) would be more meaningful than simply discarding it . for example , one interviewee said : if we ve created life that we , or i , do nt want any more , then maybe it s least sinful , or however you want to put it , if something meaningful happens to it . i feel a little bit guilty sometimes , not very much , but a little bit like if we can at least give these embryos for a good reason , then it was nt completely in vain . using similar wording , another said , if i ve already gone a bit astray , and in a sense we ve produced life , erm , then at the very least something meaningful should come out of it . our interpretation of their statements is that they felt they had ( inadvertently ) done something wrong in creating life but then not using that life as intended in pregnancy , and that donation to a good endeavour would in some way make up for this wrong . ( we want to be quite clear here that we are not arguing that failure to use an ivf embryo in pregnancy actually is a moral wrong , only that some of our participants said that in their case they felt so . ) they did not indicate that they felt their use of ivf in itself had been wrong , but articulated the sense that in ending up with surplus embryos they had done something less than ideal . for these swiss participants , then , their donation decision appears to have been driven in part by what we could call a reparative urge . no indication of any similar reparative urge was observed in either the u.k . or the chinese interviews : we discuss this difference further below . across all three studies the commonest rationale for opting to donate was a willingness to contribute to potentially curative medical research . such research was seen as a valuable endeavour by those like the swiss participant who said , i feel that , fundamentally , research has to go on , and i support that . donation of their spare embryos to research was therefore seen as a morally good act , based on a kind of ethical arithmetic in which simple disposal produced zero good from the surplus embryo , while donation had the potential to do good by supporting research . as one u.k . we ve been helped by the system , we should help the system back. not because of some sort of martyrdom or heroics or anything like that , just quite simply that without such efforts things do nt progress . in the u.k . study there was an added imperative to donate surplus embryos to research as there had been a lot of press coverage about the hoped - for curative outcomes of stem cell science : i think the research is very important , like it was in the news a while ago to say that [ the senior clinician ] was successful in stem cell research and that s what you need in order to provide medical assistance in the future , so i m all for it . this observation raises a separate ethical concern about the patients understanding of the information they were given about the research goals . here in the swiss study , the notification from the clinic storing the frozen embryos stated clearly that donation was to stem cell research , yet the majority of donors we interviewed who referred to research did so in terms that were directly relevant to infertility . for instance , one participant said , a lot of preparatory work , research work , went on before medicine was advanced enough that it was possible for us to have children . [ t]his is now maybe a tiny tiny contribution , that we can give back , if we now donate a , er , fertilised egg , perhaps for further research . note that in the chinese pilot study none of the participants spoke in precise terms about the research involved ; however , they described it broadly as scientific research for the ivf treatment . one chinese interviewee said she did not really know what the research was about , but trusted the doctors and hoped it would help other infertile women . in switzerland , the donors were former ivf patients donating cryopreserved embryos ; in china , they were current ivf patients donating either fresh or cryopreserved embryos . in neither of these studies were participants asked outright if they thought their donated embryo was being used in infertility research . however , the fact that they used phrases such as helping others as we have been helped ( italics added ) indicates a potential misunderstanding . it raises the possibility that if they had been fully aware that the research undertaken with their embryos did not concern infertility , participants might have chosen against donation . participants had much clearer ideas about the research to which they were being asked to donate ; they knew that it was not for research on fertility issues . these participants , as in the chinese study , were current patients donating fresh embryos . the differences in comprehension are therefore unlikely to be due to the request context ( former vs. current patients or fresh vs. frozen embryos ) in itself . however , in the u.k . study participants were asked to decide whether or not to donate to a number of specific projects , for each of which the goal and methodology was explained in detail , orally and in writing . it is possible that this level of engagement with the detail of the research underlies the difference . it will be important to clarify this , and to identify best practices for maximising patient comprehension of the research goals , because if ( as our material indicates ) the type of research to which people donate is a relevant factor in their moral evaluation , then the question of whether they fully understand its nature is ethically crucial . as we have seen , some of our participants reasoned that if their embryo was not going to be used for pregnancy , then donating it to a good endeavour ( research ) would be more meaningful than simply discarding it . for example , one interviewee said : if we ve created life that we , or i , do nt want any more , then maybe it s least sinful , or however you want to put it , if something meaningful happens to it . i feel a little bit guilty sometimes , not very much , but a little bit like if we can at least give these embryos for a good reason , then it was nt completely in vain . using similar wording , another said , if i ve already gone a bit astray , and in a sense we ve produced life , erm , then at the very least something meaningful should come out of it . our interpretation of their statements is that they felt they had ( inadvertently ) done something wrong in creating life but then not using that life as intended in pregnancy , and that donation to a good endeavour would in some way make up for this wrong . ( we want to be quite clear here that we are not arguing that failure to use an ivf embryo in pregnancy actually is a moral wrong , only that some of our participants said that in their case they felt so . ) they did not indicate that they felt their use of ivf in itself had been wrong , but articulated the sense that in ending up with surplus embryos they had done something less than ideal . for these swiss participants , then , their donation decision appears to have been driven in part by what we could call a reparative urge . no indication of any similar reparative urge was observed in either the u.k . or the chinese interviews : we discuss this difference further below . approximately half of the swiss participants who were interviewed turned out to have decided against donation and instead have their surplus cryopreserved embryo(s ) destroyed . none of these explicitly used the moral status of the embryo as the fundamental basis for rejecting donation to research . the scientists would do with their embryo , which was articulated either as disapproval of specific types of research ( e.g. , not if it s for cloning ) or as a more general unwillingness to relinquish responsibility of the embryo to unknown others . in both sets of reasoning , therefore , participants were expressing unease about the loss of control over what would happen to their embryo . the two chinese interviewees who had opted against donation also did so because of reservations about lack of knowledge of exactly what the embryos would be used for , explicitly mentioning the fear that they would be donated to ( i.e. , used to generate pregnancy in ) other women . in addition , two of the swiss participants gave financial reasons , that is , they expressed anger that they would not be compensated for giving up their embryo and that through donation researchers were getting something for nothing . study , speculation about why some people might refuse to donate raised concerns about what might be done with the embryos and whether a baby would be developed through experimentation ; others wondered if refusers were worried that another infertile couple would receive their embryos and have a baby when they , the embryo providers , failed to do so . sample contained only two actual refusers , who objected on the grounds of possible use in animal research ( haimes and taylor 2009 ; hug 2008 ) . these observations provide material for an empirically grounded bioethics of the ivf stem cell interface ( franklin 2006 ) . in the rest of this paper , we consider a single aspect in detail : the potential problem of gratitude influencing informed consent . empirically , the main reasons given by our participants for donation were : ( 1 ) to avoid the waste of a precious resource , ( 2 ) to give something back to research , and ( 3 ) to compensate for a perceived moral wrong . in none of the three countries did our participants indicate that their decision arose out of any sense of gratitude to the physician who had given them ivf treatment . this is an important observation , because the possible impact of gratitude on informed consent in embryo donation has previously been raised by bioethical commentators . it has been suggested that if there is any institutional or procedural link between ivf treatment and hesc research , the potential donors gratitude toward the clinicians who have helped them to conceive may steer them toward opting for donation ( haimes and luce 2006 ; parry 2006 ; mcleod and baylis 2007 ; also discussed in roberts and throsby 2008 ) . the bioethical concern is that parents who receive the gift of a baby will feel a sense of gratitude ; feeling grateful might then cause parents to feel that they should respond with a gift in return ; and if a request for donation of surplus embryos is made in that context , potential donors might inadvertently be encouraged to see donation as an appropriate form of return gift . in this way the moral emotion of gratitude could compromise the potential donor s freedom to weigh the pros and cons of the request , which in turn means compromising the capacity to give fully voluntary consent . even where the clinicians and researchers themselves are scrupulous about not using persuasion , gratitude might be persuading potential donors to do something they would not otherwise choose to do . to avoid this possibility , countries that allow embryo donation for research may attempt a strict separation of ivf treatment and the stem cell research domain . ( not all legislatures do this , however : china is one country that does not . ) in the united kingdom , for example , it is accepted good practice that requests for donation of spare embryos should not be made by the physician(s ) who delivered the original ivf treatment . in switzerland , a predominant interpretation of the current law on embryo donation is that a couple undergoing ivf treatment should not be told even of the theoretical possibility that a surplus embryo might be generated unless it actually is ( porz et al . regulators hope to rule out any conflict of interest on the part of the treating physician as well as the possibility of gratitude on the part of the patient . there are several theoretical questions that can be asked about a claim that the risk of gratitude affects potential donors decisions . for example , moral psychologists might want to examine the emotional exceptionalism in which gratitude is seen as potentially compromising , while other emotions , or even the absence of emotion , is not . there is also an obvious empirical question which does not seem to have been closely examined : whether potential embryo donors actually do experience a sense of personal gratitude to the physician or one strong enough to sway their donation decision . however , they do indicate that participants rationales for donation indicate a desire to give back in a more complex way . first , our empirical results show the importance of distinguishing between the three moral emotions of gratitude , indebtedness , and solidarity . what we normally mean by gratitude is an emotion primarily associated with gifts or with help that is undeserved . gratitude has been defined as a feeling of thankful appreciation for favours received ( guralnik 1971 , 327 ) and is experienced as a positive emotion . ( 2006 ) provide a basis from experimental psychology for distinguishing between indebtedness and gratitude . one important distinction is that indebtedness is an emotion of exchange , whereas gratitude is not ( watkins et al . even if a debt of gratitude is felt , it does not appear to be analogous to an economic debt indebtedness , however , is , literally , a debt : a state of obligation to repay another ( mauss 2001 , 2 ) . a further feature associated with indebtedness but not with gratitude is the inherent imbalance of power , so that a hierarchy is created in which those who are indebted are rendered more vulnerable . the empirical social psychological work of watkins et al . indicates that , in experimental settings at least , a person s feelings of gratitude diminish as the expectation of return ( indebtedness ) increases . the more reciprocity is expected or demanded , importantly for considering the effects of these social emotions on donation decisions , watkins et al . found that the greater the expectation that something will be given back in return , the less motivated the participants were actually to comply with the norm of reciprocity ( watkins et al . these results suggest that if patients were to sense any expectation of return by an individual physician or researcher , it would if anything lessen any gratitude they might have felt . in the ivf context , what people have received ( the thing for which they might feel grateful ) is their baby or pregnancy , or at the very least , treatment . donors who achieve this have not received a gift , but a medical service , which will have been paid for in one way or another . in switzerland , where ivf is not covered by the mandatory health insurance , this will often be direct payment from the patients to the clinic , as it will also often be in china . in the united kingdom , patients who do not already have children commonly receive two free cycles of nhs treatment ( paid for through taxes on the population ) , and then they pay for future cycles directly through fees to the clinics . whatever the system of payment , however , the point is that the ivf physician or clinic has already been paid , directly or indirectly , for the treatment which produced the outcome . so in the case of embryo donation , it could be argued that neither gratitude nor indebtedness should be anticipated . gratitude would not be expected , because what patients have received was not a favour or unexpected gift ; and indebtedness would not be expected , because there is no debt if payment has already been made . in our three studies , although we found appreciation and high esteem were expressed for the work of the treating hospital or team , we found no evidence of gratitude being expressed toward an individual physician . this is despite the fact that in both the united kingdom and china mention was made of the well - known head physicians who led each clinic ; the mentions were in appreciation of their reputations , not as a debt of gratitude . participants wanted to do something with the surplus embryo that would be of benefit to research and medical treatment for infertility , but this was not directly associated with the physician who provided it originally . indeed , some of our interviewees were critical of aspects of their own ivf treatment , while still wanting to support the infertility research enterprise overall . in this context , it should be remembered that about half the swiss participants interviewed in fact chose not to donate , primarily out of anxiety about losing control over the fate of their embryos , but also in some cases because it meant researchers were getting something for nothing . study , a few patients were suspicious that research was being prioritised over treatment and that embryos might have been kept back for the research rather than frozen . although only a small number of participants expressed this view , it has particular relevance here as it indicates clearly the absence of either gratitude or indebtedness : indeed , it suggests that these participants felt that , if anything , donation would mean the researchers were receiving something beyond their entitlement or were indebted to the patients rather than the reverse . social exchanges may entail giving back not to an individual , because the individual may be unknowable or because the benefit may not have come from a single identifiable person , but to the pattern of social life ( becker 1986)for example , giving back to the institutional biomedical research that had helped the participants . in serial reciprocity , person a receives something from person b , but pays back not to person b but to some other third party ( moody 2008 ) . serial reciprocity accounts for the way that altruistic blood donors often do describe their action in terms of reciprocity , even though they have not received anything from the person to whom their blood eventually goes . what drives serial reciprocity is not gratitude or indebtedness to an individual or an organisation but a sense of solidarity with unknown others in the community . in the case of embryo donation , what appears to be a directly reciprocal act of gratitude a surplus embryo in return for treatment may thus be understood as something quite different . participants in our studies used a rationale for donation based not on reciprocal exchange between individuals , but on giving back to a research enterprise from which they had benefited and which they hoped would benefit unknown others in the future . for the swiss and chinese donors who choose to donate because they think they are supporting infertility research , these unknown others are not completely anonymous : they are known because of imaginatively shared experience . giving something back to the research that had helped them ( as they think they are doing ) was not considered an obligation but , rather , a form of return that was meaningful and seemed especially fitting to them because of the experiences they had gone through . in the u.k . study , although there was greater clarity about the purpose of the research being contributed to , there was still a sense among embryo providers that they were benefiting from the fact that others had participated in research in the past which had improved ivf ; they were clear in expressing solidarity with this imagined community of previous ivf research contributors by making their own contributions to research , albeit research in another domain . at least some of our participants , then , also see their donation to research as an indirect way of passing on the benefit they have received from research to someone else , whose situation in some way resembles their own . the social meaning of this indirect reciprocity is neither gratitude nor indebtedness , but solidarity with other present and future patients . to summarise : our interpretation of the material suggests that donors reasons for donating were not connected in any straightforward way to either gratitude or indebtedness . for some people the desire not to waste a valuable ( in more than one sense ) resource is foremost . a generally positive stance toward biomedical science means that donation is a good use of a valuable resource . with some of the swiss participants , we also identified a reparative urge coming from a sense of moral unease , and here donation seems to offer a route through which the urge to make reparation can be satisfied . all of this suggests that neither gratitude nor indebtedness per se are present in decision - making at the ivf stem cell interface , at least not in terms of undue inducement or of compromising the capacity for informed consent . the reparative urge foregrounds a different set of ethical questions about the sociomoral meaning of the generation of spare embryos and the act of donation . for example , the perceived need for reparation that appears to drive some of the swiss participants donation choices arises because people felt some sense of wrongdoing at creating embryos that are not used for pregnancy . the spirit of the swiss legal framework strongly reinforces the sense that the occurrence of embryos not used for pregnancy is to be considered as wrong . from this point of view , one possible conclusion could be that the felt desire for reparation is in fact an ethically appropriate response : if the act of deliberately creating an embryo is a morally significant one , which needs to be justified by the good of its intended outcome ( pregnancy ) , then not using it for the purpose that justifies it does indeed present a genuine ethical difficulty . on the other hand , the novelty of surplus embryos in the swiss legal and social context ( scully and rehmann - sutter 2006 ) meant that many patients would have been unaware at the time of their ivf of the possibility of generating a surplus embryo . moreover , in most cases there were perfectly valid clinical or legal reasons why the embryos could not be transferred , which fully justified the failure to use them as originally intended . that these factors were not in the participants control the swiss participants were quite aware of the valid reasons why their embryos could not be transferred , and yet some of them still said that they had fallen short of some moral standard . we suggest that this persistent unease ( which does not appear so prevalent in the u.k . these are captured in swiss legislation s highly defensive attitude toward embryos in general and the generation of surplus embryos in particular . swiss law operates from the presumption that a surplus embryo is an exceptional event that will happen only through the failure of regulation and practice specifically set up to prevent it ( porz et al . in addition , as we discussed earlier , the generation of surplus embryos is still an unfamiliar social practice and the role of the embryo donor is one that lacks widespread cultural recognition . in the swiss context of legal exceptionalism , then , producing one of these culturally unfamiliar entities may more readily be understood as something wrong for which reparation is in order . in the more permissive cultural and legislative context of the united kingdom , although some interviewees expressed guilt about other aspects of the process ( for example , inappropriate styles of speech about embryos ) , there was no sense that not using the embryos as intended in itself constituted a moral failing . if our interpretation is correct , as the creation of surplus embryos becomes normalised in swiss society and the role of embryo donor becomes normalised in both the u.k . and swiss ( and other ) societies , there will be a shift in ideas about the moral meaning of surplus embryos , and this should be empirically testable . for the majority of the participants in switzerland and the united kingdom who chose to donate their surplus embryos , donation decisions were not driven by a reparative urge but by the feeling that donation expressed solidarity with research and/or other patients . what our empirical work shows is that gratitude to an individual must be distinguished from a solidarity - based desire to give something back to medical research . however , this does not necessarily mean that solidarity - based reciprocity has no relevant impact on the capacity for voluntary consent . one possible consequence , for example , is that if potential donors feel solidarity with the research enterprise , or with present and future patients , then they might also experience an obligation to support it . however , in all three studies there were people who chose not to donate ( about half of the swiss interviewees did not donate , while in the united kingdom approximately 46 percent of those asked have been shown to opt against donation [ choudhary et al . 2004 ] ) , which suggests either that there is no sense of obligation , or that it is neither universal nor irresistible . there is a second problem if solidarity - based reciprocity is taken as something to be prevented . if there is a risk that gratitude felt by an individual could influence donation decisions , then the risk can be minimised by separating ivf and stem cell research physically and procedurally , as bioethicists have suggested and some clinics and guidelines have implemented . but if instead there is a desire to benefit research or to show solidarity with collective others rather than an individual , then what sort of physical or procedural barriers could be set up to prevent it having an influence ? there are further theoretical questions to be explored here about the assumption that contextual emotions such as gratitude or solidarity compromise the decision to donate . the situation in which donation of a surplus embryo is a possibility comes about as a result of a variety of social , cultural , political , legal , and emotional features that combine to make the situation what it is . it will be important to identify carefully the features that are constitutive of the situation of having a surplus embryo ( including a sense of solidarity to similar others , emotional bonds with the embryo that change over time , regret over the failure to use all embryos for pregnancy , and so on ) and to consider whether these constitutive features can or should also be treated as factors that compromise the responsible , autonomous decision - making capacity of the people involved . this introduces the question of the extent to which any decision to donate can be detached from its context and the contextual factors that shape how people respond to donation requests . finally , we should not forget that the possibility that some donors misunderstand the kind of research they are donating to raises some ethical difficulty . it means that donors may be deciding for donation out of a misplaced sense of solidarity a different ethical problem . the deliberative processes of the donor participants in our three studies incorporated their appreciation of the particular moral value of their own embryos and of the value of biomedical research . these deliberations are complex , and the participants own dependency on pre - existing medical research and their affiliation with others in similar situations must be recognised , we suggest , in order to understand how they might configure donation as a means to cope with the moral ambivalence of the situation in which they find themselves . their decisions are not driven by some unacknowledged sense of debt , but rather are responsive to the emerging social and moral reality of embryo donation in the first decade of the 21st century .

this paper is based on linked qualitative studies of the donation of human embryos to stem cell research carried out in the united kingdom , switzerland , and china . all three studies used semi - structured interview protocols to allow an in - depth examination of donors and non - donors rationales for their donation decisions , with the aim of gaining information on contextual and other factors that play a role in donor decisions and identifying how these relate to factors that are more usually included in evaluations made by theoretical ethics . our findings have implications for one factor that has previously been suggested as being of ethical concern : the role of gratitude . our empirical work shows no evidence that interpersonal gratitude is an important factor , but it does support the existence of a solidarity - based desire to give something back to medical research . thus , we use empirical data to expand and refine the conceptual basis of bioethically theorizing the ivf stem cell interface .

patients undergoing orthopedic surgery are of different ages and sizes . regional analgesia and anesthesia are often beneficial for these patients . the choices of anesthesia are as varied as the operations done through the scope , and include general blocks , central neuraxial blocks , peripheral nerve blocks , and intra - articular local anesthetic techniques.1 in the last decade , bupivacaine has been the most frequently used agent for spinal and epidural anesthesia.2,3 in ambulatory surgery , such as diagnostic knee arthroscopy , bupivacaine may delay the recovery of motor function and cause urinary retention , leading to delayed discharge.4,5 unilateral spinal anesthesia is frequently used in lower limb surgery.6,7 several advantages are claimed for this anesthetic technique , including fewer hemodynamic complications,8 selective block on the operated side , avoidance of unnecessary paralysis on the nonoperated side , better mobilization during the recovery period , lower incidence of postoperative urine retention,9 as well as good patient satisfaction.10 to achieve successful unilateral anesthesia , several factors are required , including needle shape and bevel direction , site and speed of injection of anesthetic , volume , baricity , and concentration of the anesthetic solution , as well as an appropriate degree of operating table inclination.11,12 moreover , patient posture is thought to be fundamental in determining the level of anesthesia spread , particularly when a hyperbaric anesthetic solution is used.13 previous studies have failed to determine the ideal dose of local anesthetic to achieve unilateral spinal anesthesia . therefore , our aim was to evaluate the influence of the dose of hyperbaric bupivacaine on the success of unilateral spinal anesthesia by assessment of maximum sensory and motor block on the operative and nonoperative sides during knee arthroscopy and its effect on hemodynamics . this study was carried out as a prospective , randomized , double - blind clinical trial . after approval of the local ethics committee and informed patient consent was obtained , 80 male and female patients undergoing diagnostic knee arthroscopy in routine surgical theaters at the suez canal university hospital in ismailia were enrolled in this study . inclusion criteria were american society of anesthesiologists ( asa ) score i ii , age 2150 years , body mass index < 30 kg / m , and height 160180 cm . patients with skin infection at the site of regional anesthesia , coagulopathy , taking anticoagulant drugs , having allergy to local anesthetic drugs , hypovolemia , low fixed cardiac output , neurologic disorder , or spine deformity were excluded from the study . the patients were randomly allocated into four groups ( n = 20 each ) receiving different doses of hyperbaric bupivacaine 0.5% . group 1 received 5 mg , group 2 received 7.5 mg , group 3 received 10 mg , and group 4 received 12.5 mg . all patients were given 2 mg midazolam intravenously as premedication , as well as an intravenous infusion of 7 ml / kg of lactated ringer solution . standard monitoring was used , including noninvasive blood pressure , electrocardiogram , peripheral pulse oximetry , and respiratory rate measurements . all patients were placed in a lateral position on the operative side , while the vertebral column was positioned as horizontally as possible . under complete aseptic technique and after back sterilization , dural puncture was performed using a midline approach at the l3l4 interspace with a 25 gauge spinal needle . using sealed envelopes prepared according to a computer generated randomization table , patients in each group received different doses of bupivacaine ( marcaine spinal heavy , astra , sweden ) , ie , group 1 received 5 mg bupivacaine 0.5% 1 ml , group 2 received 7.5 mg bupivacaine 0.5% 1.5 ml , group 3 received 10 mg bupivacaine 0.5% 2 ml , and group 4 received 12.5 mg bupivacaine 0.5% 2.5 ml . after observation of free flow of cerebrospinal fluid , the spinal needle aperture was turned toward the dependent side and the selected dose of local anesthetic solution was injected slowly with an injection speed of 0.5 ml/10 seconds without further aspiration maneuvers . patients were maintained in the lateral decubitus position for a 20-minute period , after which patients were turned to the supine position.11,14 an independent blinded observer evaluated the evolution of sensory and motor blocks on both sides immediately after turning the patient supine for 20 minutes after the block , and then after 10 minutes . sensory block was assessed as complete loss of sensation to pinprick ( via a 23 gauge hypodermic needle ) . motor block was assessed using a modified bromage scale whereby patients were asked to flex the limb at the hip , knee , and ankle joints , and the results were recorded as 0 = no motor block , 1 = hip blocked , 2 = hip and knee blocked , 3 = hip , knee , and ankle blocked.9 patients were judged ready for surgery when complete loss of pinprick sensation was reported at t12 on the operative limb . postoperative analgesia included oral ketorolac ( 50 mg every eight hours ) , with the first dose administered before surgery by the intravenous route.9 requirement for rescue analgesia was recorded . motor and sensory block was monitored in the postanesthesia care unit at 10-minute intervals until time to complete regression of spinal block . occurrence of adverse events , including nausea , vomiting , pruritus , and urine retention was also recorded . statistical analysis was performed using the program spss version 15 ( spss inc , chicago , il ) . demographic data , onset times to anesthetic block , and surgery times were analyzed by one - way analysis of variance ( anova ) , whereas changes over time were analyzed with a two - way anova for repeated measures . categoric variables were analyzed using contingency table analysis and the chi - square test with the appropriate corrections . all patients were placed in a lateral position on the operative side , while the vertebral column was positioned as horizontally as possible . under complete aseptic technique and after back sterilization , dural puncture was performed using a midline approach at the l3l4 interspace with a 25 gauge spinal needle . using sealed envelopes prepared according to a computer generated randomization table , patients patients in each group received different doses of bupivacaine ( marcaine spinal heavy , astra , sweden ) , ie , group 1 received 5 mg bupivacaine 0.5% 1 ml , group 2 received 7.5 mg bupivacaine 0.5% 1.5 ml , group 3 received 10 mg bupivacaine 0.5% 2 ml , and group 4 received 12.5 mg bupivacaine 0.5% 2.5 ml . after observation of free flow of cerebrospinal fluid , the spinal needle aperture was turned toward the dependent side and the selected dose of local anesthetic solution was injected slowly with an injection speed of 0.5 ml/10 seconds without further aspiration maneuvers . patients were maintained in the lateral decubitus position for a 20-minute period , after which patients were turned to the supine position.11,14 an independent blinded observer evaluated the evolution of sensory and motor blocks on both sides immediately after turning the patient supine for 20 minutes after the block , and then after 10 minutes . sensory block was assessed as complete loss of sensation to pinprick ( via a 23 gauge hypodermic needle ) . motor block was assessed using a modified bromage scale whereby patients were asked to flex the limb at the hip , knee , and ankle joints , and the results were recorded as 0 = no motor block , 1 = hip blocked , 2 = hip and knee blocked , 3 = hip , knee , and ankle blocked.9 patients were judged ready for surgery when complete loss of pinprick sensation was reported at t12 on the operative limb . postoperative analgesia included oral ketorolac ( 50 mg every eight hours ) , with the first dose administered before surgery by the intravenous route.9 requirement for rescue analgesia was recorded . motor and sensory block was monitored in the postanesthesia care unit at 10-minute intervals until time to complete regression of spinal block . occurrence of adverse events , including nausea , vomiting , pruritus , and urine retention was also recorded . statistical analysis was performed using the program spss version 15 ( spss inc , chicago , il ) . demographic data , onset times to anesthetic block , and surgery times were analyzed by one - way analysis of variance ( anova ) , whereas changes over time were analyzed with a two - way anova for repeated measures . categoric variables were analyzed using contingency table analysis and the chi - square test with the appropriate corrections . there were no significant differences in age , gender , body mass index , and duration of surgery between the patients in the four groups ( table 1 ) . no statistically significant difference was found between the four groups for heart rate changes during surgery ( figure 1 ) . there was a statistically significant decrease in mean arterial blood pressure in group 3 and 4 patients who had been injected with 10 mg and 12.5 mg , respectively . in group 3 , this drop lasted for only 15 minutes and , thereafter returned to near baseline values , while in group 4 this drop remained until the end of the operation ( figure 2 , table 2 ) . sensory block on the nonoperative side was significantly less than that on the operative side . in group 1 and in group 2 , strict unilateral anesthesia was reported among 90% and 85% of patients , respectively , in whom the level of sensory block on the operative side was t10 and t8 , respectively . in groups 3 and 4 , none of the studied patients showed strict unilateral spinal anesthesia and the sensory block in the non - operative side reached t12 and t8 levels , respectively , while the level of sensory block in the operative limb reached t6 and t5 , respectively ( tables 3 , 4 , and 5 ) . motor block on the operative side was statistically significant when compared with the nonoperative side ( p < 0.05 ) . motor block on the operative side in groups 2 , 3 , and 4 was statistically significant compared with motor block on operative side in group 1 , while no statistically significant difference was reported when comparing pairs of the former three groups . unilateral motor block ( modified bromage scale 0 ) was reported in 95% of patients in group 1 , 90% in group 2 , and only 5% in group 3 , while none of the patients in group 4 showed unilateral motor block ( table 6 ) . the time required for regression of motor block ( bromage scale 0 ) was more prolonged with higher doses and the difference was statistically significant . the regression time was 59.8 ( 55100 ) , 98.3 ( 60120),123.9 ( 60150 ) , and 148.9 ( 110180 ) minutes for groups 1 , 2 , 3 , and 4 respectively . the incidence of nausea , vomiting , and urine retention was similar in the four study groups ( table 7 ) . the ideal selective spinal anesthesia for knee arthroscopy would provide minimal or no motor blockade at the end of the surgical procedure , such that the patient can be fast tracked.5 using a minidose of lidocaine - fentanyl15 or hyperbaric bupivacaine,16 ben - david et al discharged their knee arthroscopy patients at 145 minutes and 202 minutes , respectively . as regards the hemodynamic effects of different doses of hyperbaric bupivacaine during surgery , no statistically significant differences were found between the four study groups with regard to heart rate changes during surgery . hypotension is a common complication of spinal anesthesia , occurring in 15%17 to 33%18 of patients when larger doses of local anesthetic have been used . unilateral spinal anesthesia with hypobaric or hyperbaric bupivacaine was associated with less hypotension,19,20 which is consistent with our results . in our study , unilateral spinal anesthesia ( regarding sensory block ) was reported by 90% and 85% of patients in group 1 and group 2 , respectively , while in group 3 and group 4 none of the studied patients showed unilateral anesthesia . for motor block , unilateral anesthesia was recorded in 95% of patients in group 1 , 90% in group 2 , and only 5% in group 3 , while none of the patients in group 4 showed unilateral spinal anesthesia . valanne et al21 compared the effect of 4 mg and 6 mg of hyperbaric bupivacaine for spinal anesthesia in 106 ambulatory adult patients undergoing knee arthroscopy . however , rapid regaining of motor function was reported with the lower dose . in our study , the time to regression of motor block was found to be significantly increased with increasing the injected dose of hyperbaric bupivacaine , with mean times of 59.8 , 98.3 , 123.6 and 148.9 minutes in groups 1 , 2 , 3 , and 4 , respectively . in another study , fanelli et al9 compared unilateral and conventional bilateral bupivacaine spinal block in outpatients undergoing knee arthroscopy . in the unilateral group , they used 8 mg of hyperbaric bupivacaine 0.5% in 50 patients in lateral decubitus position after spinal injection was maintained in the unilateral group for 15 minutes . they found that , for the unilateral group , sensory and motor blocks on the operated limb were t9 ( t12t2 ) with a bromage score 0/1/2/3 in 0/2/3/45 patients , respectively , in the unilateral group . two segment regressions of sensory level and home discharge required 81 25 minutes and 281 83 minutes with bilateral block , and 99 28 minutes and 264 95 minutes with unilateral block . borghi et al22 carried out a prospective , randomized , blinded study among 90 asa i and ii outpatients scheduled for elective knee arthroscopy . after placement of the patients in the lateral decubitus position , they received spinal block with 4 , 6 , or 8 mg of 0.5% hyperbaric bupivacaine on the operative side , injected slowly with the needle orifice directed toward the dependent side using a 25-gauge whitacre needle . the maximum level of sensory block on the operative and nonoperative sides was , respectively , t10 ( t12t6 ) and ( < l2 ) in the 4 mg group , t8 ( t12t6 ) and ( < l5 ) in the 6 mg group , and t7 ( t12t5 ) and ( < t10 ) in the 8 mg group . unilateral sensory block was observed in 27 patients in the 4 mg group ( 90% ) , 28 patients in the 6 mg group ( 93% ) , and 23 patients in the 8 mg group ( 77% , p < 0.28 ) . complete unilateral motor block was observed in 29 patients in the 4 mg group ( 97% ) , 28 patients in the 6 mg group ( 93% ) , and 28 patients in the 8 mg group ( 93% , p = 0.80 ) . complete regression of spinal anesthesia required 71 20 minutes in the 4 mg group ( range 40110 minutes ) , 82 25 minutes in the 6 mg group ( range 30160 minutes ) , and 97 37 minutes in the 8 mg group ( range 50 to 120 minutes ) . analysis of side effects showed that the injected dose did not affect the incidence of side effects , such as nausea , vomiting , urinary retention , or need for analgesia . although our study was different from other studies regarding dose , position , and patients being kept on the lateral side for 20 minutes , our results were found to be consistent with earlier ones because higher doses of hyperbaric bupivacaine were associated with higher levels of maximum sensory and motor block and longer duration to achieve regression of sensory block . unilateral sensory and motor block , a faster recovery profile , and a stable hemodynamic state can be achieved with doses of 5 mg and 7.5 mg of hyperbaric bupivacaine 0.5% injected slowly through pencil - point directional needles in patients who are maintained in the lateral decubitus position for 20 minutes . however , 7.5 mg of hyperbaric bupivacaine 0.5% was the dose required for adequate unilateral spinal anesthesia with adequate sensory and motor block .

objectiveto determine the dose of hyperbaric bupivacaine 0.5% required for unilateral spinal anesthesia during diagnostic knee arthroscopy.patients and methodsthis prospective , randomized , clinical study was performed in 80 patients who were assigned to four groups to receive different doses of intrathecal hyperbaric bupivacaine ( 5 mg , 7.5 mg , 10 mg and 12.5 mg in groups 1 , 2 , 3 , and 4 respectively ) . onset of sensory and motor block , hemodynamic changes , regression of motor block , and incidence of complications were recorded.resultsunilateral sensory block was reported in 90% and 85% of patients in group 1 and group 2 , respectively , but not in any patient in group 3 and group 4 . unilateral motor block ( modified bromage scale 0 ) was reported in 95% of patients in group 1 , 90% in group 2 , and only 5% in group 3 , while no patient in group 4 showed unilateral motor block . the time required for regression of motor block ( bromage scale 0 ) was prolonged with higher doses . the incidence of nausea , vomiting , and urine retention was similar in the study groups.conclusionunilateral sensory and motor block can be achieved with doses of 5 mg and 7.5 mg hyperbaric bupivacaine 0.5% with a stable hemodynamic state . however , 7.5 mg of hyperbaric bupivacaine 0.5% was the dose required for adequate unilateral spinal anesthesia .

clinical histories and condition of host dogs : in total , 173 cotton rectal swabs were collected from 93 dogs treated at rakuno gakuen university ( rgu ) veterinary teaching hospital ( ebetsu , japan ; university hospital ) and from 80 dogs treated at 8 companion animal clinics ( 10 samples per clinic , from different dogs ) in the community of ebetsu ( community clinics ) from june to december 2005 ( regardless of the clinical condition seen for the animal ) . all dogs admitted to the university hospital had also visited the community clinics previously . university hospital cases ( 15 male and 20 female dogs ) included those with tumor , cataract , glaucoma , keratitis , hip dysplasia , cushing syndrome and herniated intervertebral discs . community clinic cases ( 27 male and 24 female dogs ) included those undergoing castration , panovario - hysterectomy or treatment for urinary tract infections , cystitis , chronic diarrhea , dermatitis , otitis externa , gingivitis , pharyngitis and keratitis . dogs were aged 016 years ( university dogs : 8.2 3.7 y [ mean sd ] ; community dogs : 5.5 4.2 y ) . the 6-month history of antimicrobial use prior to sampling was also compared for the 54 dogs admitted to the university hospital and the 56 dogs admitted to the community clinics . samples were streaked on deoxycholate hydrogen sulfide lactose ( dhl ) agar ( nissui , tokyo , japan ) and incubated for 24 hr at 37c . colonies of suspected e. coli growing on these dhl agar plates were picked and subcultured on nutrient agar ( nissui ) . after incubation , the biochemical properties of these colonies were assessed using triple sugar iron agar ( nissui ) , lysine indole motility medium ( nissui ) and cytochrome oxidase tests . final identification of e. coli was performed using api20e codes ( biomrieux , tokyo , japan ) . the 173 canine samples were also assessed on dhl agar supplemented with 4 g / ml of enrofloxacin ( enr ; bayer , osaka , japan ) . susceptibility testing : susceptibilities to a panel of antimicrobials were examined using the agar dilution method , according to the guidelines of the clinical and laboratory standards institute ( clsi ) . mueller hinton ( mh ) agar was obtained from oxoid ( basingstoke , u.k . ) . ampicillin ( amp ) , amoxicillin ( amx ) , cefazolin ( cfz ) , cephalexin ( lex ) , gentamicin ( gen ) , kanamycin ( kan ) , dihydrostreptomycin ( dsm ) , oxytetracycline ( otc ) and chloramphenicol ( chl ) were obtained from sigma - aldrich ( st . louis , mo , u.s.a . ) , and cefpodoxime ( cpd ) was purchased from daiichi sankyo co. , ltd . staphylococcus aureus atcc29213 , enterococcus faecalis atcc29212 , e. coli atcc25922 and pseudomonas aeruginosa atcc27853 were used as controls . resistance to dsm ( 32 g / ml ) and otc ( 16 g / ml ) was microbiologically defined as described in the japanese veterinary antimicrobial - resistance monitoring system . intermediate interpretations for dsm and otc were defined as having two - fold lower minimum inhibitory concentration ( mic ) than those of the resistance category . phe - arg--naphthylamide ( pan ; sigma - aldrich ; final concentration : 20 g / ml ) was used as an efflux - pump inhibitor . organic solvent tolerance : organic solvent tolerance ( ost ) was investigated as previously described with slight modifications . an overnight culture of e. coli was diluted with 0.9% nacl ( approximately 1 10 cells / ml ) . a drop of cell suspension ( 5 l ) was spotted onto mh agar medium to form a circle with a diameter of 8 mm . the surface of the agar was overlaid with a mixture ( 3:1 , 1:1 , or 1:3 [ vol / vol ] ) of n - hexane ( 96.0% pure ; kishida chemical co. , ltd . , osaka , japan ) and cyclohexane ( > 99% pure ; merck kgaa , darmstadt , germany ) to a depth of 3 mm . cyclohexane is an organic solvent known to be a more effective agent against e. coli than n - hexane . bacterial growth was assessed after the plates were incubated at 37c for 1618 hr in a sealed vessel . confluent growth of the cells ( confluent ) was considered to be indicative of tolerance to the solvent tested . when only a few colonies ( < 10 ) grew on the plate or when no growth was observed , the cells were considered to be sensitive to the solvent tested ( non - confluent ) . determination of qrdr mutations , pmqrs , -lactamases and chl - resistance genes : mutations in qrdrs of gyra , parc , pare and gyrb were examined by direct dna sequencing of pcr products , as described by everett et al . . pmqr genes ( qnra , qnrb , qnrs , aac ( 6 ) ib - cr and qepa ) were detected by pcr using specific primers ( table 1table 1.sequences of oligonucleotides and fluorescence - labeled oligonucleotides used for pcr , direct sequencing and real - time rt - pcr in this studygeneforward primer ( 53)reverse primer ( 53)fluorescent probe ( 53)purposereferencegyraacgtactaggcaatgactggagaagtcgc cgtcgatagaacpcr and sequencinggyrbtgtatgcgatgtctgaactgctcaatagcagctcggaatapcr and sequencingparctgtatgcgatgtc tgaactgctcaatagcagctcggaatapcr and sequencingparetaccgag ctgttccttgtggggcaatgtgcagaccat cagpcr and sequencingqnraagaggatttctcacgccaggtgccaggcacagatcttgacpcrqnrbggmathgaaattcgccactgtttgcygyycgccagtcgaapcrqnrsgcaagttcattgaacagggttctaaaccgtcgagttcggcgpcraac ( 6)-ibttgcgatgctctatgagtggctactcgaatgcctggcgtgtttpcr and sequencingqepaaactgcttgagcccgtagatgtctacgccatggacctcacpcrblatematgagtattcaacattttcgttaccaatgcttaatcagtgpcr and sequencingblashvatgcgttatattcgcctgtgttagcgttgccagtgctcgapcrcata1agttgctcaatgtacctataaccttgtaattcattaagcattctgccpcrcata2acactttgccctttatcgtctgaaagccatcacatactgcpcrcata3ttcgccgtgagcattttgtcggatgagtatgggcaacpcrflorcgccgtcattcctcaccttcgatcacgggccacgctgtgtcpcrcmlattgcaacagtacgtgacatacacaacgtgtacaaccagpcracractatcaccctacgctctatcttcgcgcgcacgaacatacccgaacccggatcacactctrt - pcracrbgcggtcgtgtgaagaaagtttaactcccaacgagaagaggagaatgaccatcagcagcacgaacataccagtrt - pcrthis studytolcggtacgttgaacgagcaggatcccatcagcaatagcattctgttccctggcactgaacaatgcgctgagcaart - pcrthis studygapaaaaggcgctaacttcgacaagaacggtggtcatcagacctcaacgataacttcggcatcart - pcrthis studya ) m , a , or c ; h , a , or c or t ; y , c , or t. ) and direct dna sequencing [ 4 , 15 , 21 ] . to identify the amp - resistance mechanism , -lactamase genes , viz . , blatem and blashv , were detected by pcr and direct dna sequencing . , cata1 , cata2 , cata3 , flor and cmla , were detected by pcr as described in previous studies [ 17 , 27 ] . nucleotide sequences were determined using a bigdye terminator v3.1 cycle sequencing kit with a 3130 genetic analyzer ( applied biosystems , foster city , ca , u.s.a . ) . a ) m , a , or c ; h , a , or c or t ; y , c , or t. real - time reverse transcription - pcr : overnight cultures of e. coli isolates were diluted 1:100 in lb broth and grown to the mid - logarithmic phase . rna was isolated using an rneasy mini kit ( qiagen , hilden , germany ) according to the manufacturer s instructions and stored at 80c until used . the concentration of rna was determined spectrophotometrically ( biospectrometer , eppendorf , hamburg , germany ) . gene expression ( acra , acrb and tolc ) was estimated by quantitative reverse transcription ( rt ) taqman - pcr . the respective primer pairs and probes ( table 1 ) used for acrb , tolc and gapa in this study were designed according to the sequence of e. coli strain k12 substrain mg1655 , which is deposited in genbank ( accession number u00096 ) . the probes were labeled by the manufacturer ( sigma - aldrich ) with the reporter dye 6-carboxyfluorescein ( 6-fam ) at the 5-end and with the quencher dye 6-carboxytetramethylrhodamine ( tamra ) at the 3-end . purified rna ( 2.5 ng ) was used in one - step rt and real - time pcr amplification . rt - pcr amplification mixtures ( 20 l ) contained purified rna , 2 quantitect probe rt - pcr master mix , 0.2 l of quantitect rt mix ( quantitect probe rt - pcr kit , qiagen ) , 0.2 m of probe and 0.5 m forward and reverse primers . the cycle conditions comprised 20-min reverse transcription at 50c ; a 15-min initial activation step at 95c ; and 45 cycles each of 55c for 1 min and at 60c for 30 sec in a lightcycler 480 ( roche , mannheim , germany ) . e. coli strain ag100 ( k-12 arge3 thi-1 rpsl xyl mtl d ( gal - uvrb)supe44 ) was kindly donated by dr helen i. zgurskaya ( university of oklahoma , norman , ok , u.s.a . ) and used as a reference strain . statistical analysis : statistical significance of differences between the isolates obtained from dogs admitted to the 2 types of treatment facilities was determined by student s t - test and fisher s exact test . antimicrobial - resistance profile of canine e. coli isolates : there was a significant difference in the ages ( p<0.05 ) , but not in the gender distribution of the dogs admitted to the university hospital or the community clinics . seventy - four e. coli isolates were obtained from 93 rectal samples from dogs admitted to the university hospital ( 79.6% ) and 66 isolates from 80 rectal samples obtained from dogs admitted to the community clinics ( 82.5% ) , after culture on dhl agar plates that had not been supplemented with enr . there was no significant difference in the frequency of e. coli isolation between dogs admitted to the 2 types of treatment facilities ( p>0.05 ) . of all the canine e. coli isolates , 44.3% ( 62 of 140 isolates ) were resistant to at least 1 antimicrobial agent tested with aminopenicillin resistance being the most frequent ( approximately 30% ) ; approximately 50% of aminopenicillin - resistant isolates were also resistant to cephalosporins ( cfz and cpd ) . although there was no significant difference in the rate of resistance to amp or amx between isolates derived from university hospital cases and isolates derived from community clinics cases , when considering isolates with resistance as well as those with an intermediate interpretation to amp and amx , this rate was significantly more prevalent in the university hospital than in the community clinics samples ( p<0.05 , table 2table 2.antimicrobial susceptibility of e. coli strains derived from dogs attending rakuno gakuen university veterinary teaching hospital ( rgu ; university ) and animal clinics in the community ( community)antimicrobial(break point , g / ml)groupsrange(g / ml)mic50(g / ml)mic90(g / ml)number of strains ( % ) siri + ramp(32)university2>1284>12844 ( 59.5)*4 ( 5.4)26 ( 35.1)30 ( 40.5)*community0.5>1284>12850 ( 75.8)016 ( 24.2)16 ( 24.2)amx(32)university1>12816>12832 ( 43.2)**15 ( 20.3)**27 ( 36.5)42 ( 56.8)**community4>1284>12850 ( 75.8)016 ( 24.2)16 ( 24.2)cfz(32)university1>1282>12861 ( 82.4)1 ( 1.4)12 ( 16.2)13 ( 17.6)community1>1282>12857 ( 86.3)09 ( 13.6)9 ( 13.6)lex(32)university8>1288>12854 ( 73.0)5 ( 6.8)15 ( 20.3)20 ( 27.0)community4>1288>12847 ( 71.2)9 ( 13.6)10 ( 15.1)19 ( 28.8)cpd(8)university<0.125>1280.512862 ( 83.8)012 ( 16.2)12 ( 16.2)community0.25>1280.512857 ( 86.4)09 ( 13.6)9 ( 13.6)kan(64)university1>12823266 ( 89.2)1 ( 1.4)7 ( 9.5)8 ( 10.8)community2>1282>12859 ( 89.4)07 ( 10.6)7 ( 10.6)gen(16)university0.5>1281867 ( 90.5)07 ( 9.5)7 ( 9.5)community0.5641262 ( 93.9)04 ( 6.1)4 ( 6.1)dsm(32)university2>1284>12855 ( 74.3)1 ( 1.4)18 ( 24.3)19 ( 25.7)community2>1284>12848 ( 72.7)1 ( 1.5)17 ( 25.8)18 ( 27.3)otc(16)university2>1282>12856 ( 75.7)3 ( 4.1)15 ( 20.3)18 ( 24.3)community1>1282>12850 ( 75.8)016 ( 24.2)16 ( 24.2)chl(32)university4>12886454 ( 73.0)*9 ( 12.2)11 ( 14.9)*20 ( 27.0)*community4>1288861 ( 92.4)3 ( 4.5)2 ( 3.0)5 ( 7.6)enr(4)university0.011280.036459 ( 79.7)*015 ( 20.3)*15 ( 20.3)*community0.01640.031661 ( 92.4)05 ( 7.5)5 ( 7.6)amp : ampicillin , amx : amoxicillin , cfz : cefazolin , chl : chloramphenicol , cpd : cefpodoxime , dsm : dihydrostreptomycin , enr : enrofloxacin , gen : gentamicin , kan : kanamycin , lex : cephalexin , otc : oxytetracycline . the prevalence of chl - resistant and enr - resistant isolates was also significantly higher in the university hospital than in the community clinics samples ( table 2 ) . amp : ampicillin , amx : amoxicillin , cfz : cefazolin , chl : chloramphenicol , cpd : cefpodoxime , dsm : dihydrostreptomycin , enr : enrofloxacin , gen : gentamicin , kan : kanamycin , lex : cephalexin , otc : oxytetracycline . p<0.05 , * * p<0.01 ; difference versus community . in terms of susceptibilities to aminopenicillin and chl among the 15 enr - resistant isolates derived from the university hospital samples , 7 isolates showed resistance and/or intermediate interpretation to aminopenicillin , as well as resistance to chl . six of these isolates showed resistance and/or intermediate interpretation to aminopenicillin , but susceptibility to chl , while the remaining 2 isolates showed susceptibility to both aminopenicillin and chl ( data not shown ) . among the 5 enr - resistant isolates derived from the community clinics samples , 1 isolate showed both resistance to aminopenicillin and chl , and 4 isolates showed resistance and/or an intermediate interpretation to aminopenicillin , but susceptibility to chl ( data not shown ) . the prevalence of resistance to aminoglycosides ( kan , gen and dsm ) and otc was not significantly different between isolates derived from the university hospital cases and from the community clinics cases . enr - resistant isolates frequently demonstrated concomitant resistance to aminopenicillins , cephalosporins , gen , dsm and chl ( table 3table 3.prevalence of concomitant antimicrobial resistance on enr - resistant e. coli isolates derived from non - supplemented agarisolatesprevalence of concomitant resistance ( % ) ampamxcezlexcpdkangendsmotcchlenr - resistant ( 20)90.0**90.0**75.0**80.0**70.0**15.030.0**65.0**35.040.0**enr - susceptible ( 120)20.020.85.07.55.89.24.218.320.02.5amp : ampicillin , amx : amoxicillin , cfz : cefazolin , chl : chloramphenicol , cpd : cefpodoxime , dsm : dihydrostreptomycin , enr : enrofloxacin , gen : gentamicin , kan,:kanamycin , lex : cephalexin , otc : oxytetracycline . * prevalence of ost was significantly higher in isolates from the university hospital cases than from the community clinics cases ( table 4table 4.organic solvent tolerance ( ost ) of e. coli strains derived from dogs in attending rakuno gakuen university veterinary teaching hospital ( rgu ; university ) and animal clinics in the community ( community)ost(n - hexane : cyclohexane)groupsnon - confluentconfluent3:1university32 ( 43.2)**42 ( 56.8)**community55 ( 83.3)11 ( 16.7)1:1university60 ( 81.1)**14 ( 18.9)**community63 ( 95.5)3 ( 4.5)1:3university67 ( 90.5)7 ( 9.5)*community65 ( 98.5)1 ( 1.5)values indicate the number of e. coli isolates and ( percentage of the total ) . * amp : ampicillin , amx : amoxicillin , cfz : cefazolin , chl : chloramphenicol , cpd : cefpodoxime , dsm : dihydrostreptomycin , enr : enrofloxacin , gen : gentamicin , kan,:kanamycin , lex : cephalexin , otc : oxytetracycline . * values indicate the number of e. coli isolates and ( percentage of the total ) . the average number of antimicrobials used for each dog was significantly higher in the university hospital than in the community clinics cases ( table 5table 5.status of antimicrobial use in dogs attending rakuno gakuen university veterinary teaching hospital ( rgu ; university ) and animal clinics in the community ( community)antimicrobial useuniversitycommunityaverage number of antimicrobialsused for each dog1.4**0.8frequency of dogs treatedby fluoroquinolone24.1%**14.3%frequency of dogs treatedby all antimicrobials74.1%**50.0%we could obtain antimicrobial use history for 6 months prior to sampling from 54 dogs in the university and 56 dogs in the community . the frequencies of dogs treated with any antimicrobials and with fluoroquinolones were also significantly higher in the university hospital than in the community clinics cases ( table 5 ) . in addition , prevalence of fluoroquinolone - resistant isolates was significantly higher in dogs that had been treated with fluoroquinolones compared with that in dogs that had not been treated with this agent ( p<0.05 ; data not shown ) . we could obtain antimicrobial use history for 6 months prior to sampling from 54 dogs in the university and 56 dogs in the community . * isolation of fluoroquinolone - resistant e. coli using enr - supplemented dhl agar plates : to investigate fluoroquinolone - resistance mechanisms and the occurrence of multidrug resistance involving fluoroquinolone , we selected enr - resistant e. coli on enr - supplemented dhl agar plates ( fig . 1fig . 1.influence of enrofloxacin selection on isolation frequencies of e. coli isolated from canine rectal samples . amp , ampicillin ; amx , amoxicillin ; cfz , cefazolin ; chl , chloramphenicol ; cpd , cefpodoxime ; dsm , dihydrostreptomycin ; enr , enrofloxacin ; gen , gentamicin ; kan , kanamycin ; lex , cephalexin ; otc , oxytetracycline . * statistical difference for isolation with deoxycholate hydrogen sulfide lactose ( dhl ) medium without antimicrobials ; p<0.05 . ) . rate of resistance to aminopenicillins , cephalosporins , gen , dsm , otc and chl was significantly higher in isolates obtained from enr - supplemented dhl agar plates than those obtained from dhl agar plates that had not been supplemented with enr . isolates obtained from enr - supplemented dhl agar plates were most frequently amp resistant . influence of enrofloxacin selection on isolation frequencies of e. coli isolated from canine rectal samples . amp , ampicillin ; amx , amoxicillin ; cfz , cefazolin ; chl , chloramphenicol ; cpd , cefpodoxime ; dsm , dihydrostreptomycin ; enr , enrofloxacin ; gen , gentamicin ; kan , kanamycin ; lex , cephalexin ; otc , oxytetracycline . * statistical difference for isolation with deoxycholate hydrogen sulfide lactose ( dhl ) medium without antimicrobials ; p<0.05 . we further characterized the 31 e. coli isolates derived from enr - supplemented dhl agar plates ( table 6table 6.characterization of antimicrobial and organic solvent susceptibility , qrdr mutations , existence of resistant genes and expression levels of acrab in e. coli isolates derived by enr - supplemented agarstraincanine case historyantimicrobial usefor 6 monthsbefore samplingqrdr mutationsmic ( g / ml)-lactamasegenepmqrcp - resistancegeneexpression levelgyraparcpareampcpdenrchlacraacrbtolcs83d87s80e84a108university groupre18mastocytomacfz , lexlnig-->128>128128 ( 16)32 ( 16)n.d.n.d.n.d.2.623.763.27re21abdominal tumoramp , cfz , lex , enrlnig-->128>128128 ( 32)>128n.d.n.d.cata12.313.774.65re28rhabdomyosarcomacfz , lexlnig-->128>128128 ( 32)64 ( 16)blatem-1n.d.n.d2.177.133.46re33mastocytomacfz , lex , ofxlnig-->128>128128 ( 32)>128blatem-1n.d.cata12.8114.295.88re61herniated intervertebral discslexlnig-->1280.564 ( 8)16 ( 8)blatem-1n.d.n.d.1.432.343.21re63unknownamplnig--16 ( 8)264 ( 8)16 ( 8)n.d.n.d.n.d.0.752.681.87re20lung tumoramc , cfz , enrlniv-->128>12832 ( 4)16 ( 8)blatem-1n.d.n.d.2.162.93.95re2tumor of the breastgen , frmlni - t->128>128128 ( 16)32 ( 16)n.d.n.d.n.d.2.82.874.07re72glaucomacfz , ofx , orblni - t->128164 ( 8)16 ( 8)blatem-1n.d.n.d.0.890.961.77re80oral tumornonelni - t->128164 ( 8)16 ( 8)blatem-1n.d.n.d.1.021.011.72re4osteosarcomaamp , amx , frmlni -- e460a>128>12864 ( 16)>128blatem-1n.d.cata11.361.52re64oral tumorcfzlni -- e460a>1280.564 ( 16)>128blatem-1n.d.cata10.761.081.7re65unknownnonelni -- e460a>1280.564 ( 16)>128blatem-1n.d.cata10.81.041.29re22multiple myelomaenr , minlni -- s458a>1284128 ( 16)16 ( 8)blatem-1n.d.n.d.1.941.672.55re26unknowncfz , lexlni---4 ( 4)0.2516 ( 8)8 ( 4)n.d.n.d.n.d.1.11.582.36re50keratitisofx , orblni--->128>128128 ( 16)16 ( 8)blatem-1n.d.n.d.1.321.652.74re54biopsy of vertebral bodycfzlni--->128232 ( 16)>128blatem-1n.d.cata11.542.674.09re17cushing syndromecfzlwig--16 ( 8)164 ( 8)16 ( 8)n.d.n.d.n.d.1.362.763.87re39herniated intervertebral discsamplwig-->128>128256 ( 16)>128blatem-1n.d.cata11.183.283.74total ( % ) r84.263.110052.6 * 1.83 * 3.48**3.06**i + r94.752.610094.7**(13.9)(8.6*)community groupce7otitis externalex , genlnia-->128>128128 ( 16)>128n.d.n.d.cata10.881.42.01ce5unknownnonelnig-->1282128 ( 16)16 ( 8)blatem-1n.d.n.d.1.441.631.22ce6unknownlex , cfz , genlnig-->128>12864 ( 4)8 ( 4)n.d.n.d.n.d.0.250.370.43ce10diarrheanonelniv--4 ( 4)0.564 ( 8)4 ( 2)n.d.n.d.n.d.0.632.122.02ce14unknownnonelniv-->1280.5128 ( 16)4 ( 2)blatem-1n.d.n.d.0.841.261.6ce1unknownnonelni - t->128>12864 ( 8)16 ( 8)blatem-1n.d.n.d.0.91.271.32ce9otitis externalex , gen , lvxlni -- e460a>128>12832 ( 8)16 ( 8)blatem-1n.d.n.d.1.71.891.72ce12gingivitisclilni -- s458t>1280.532 ( 4)4 ( 4)blatem-1n.d.n.d.1.341.711.52ce13diarrheasxtlni -- s458a>1282128 ( 8)8 ( 4)n.d.aac ( 6)-ib - crn.d.0.240.460.56ce3pharyngitisamp , lex , ofxlgr--->1283232 ( 8)8 ( 4)blatem-1n.d.n.d.0.911.61.82ce4unknownnonelgr--->1283232 ( 4)8 ( 8)blatem-1n.d.n.d.0.50.91.25ce8keratitislex , lvxlgi--->128>12832 ( 8)8 ( 4)n.d.n.d.n.d.0.951.511.7total ( % ) r91.758.31008.30.971.341.43i + r91.766.710033.3(8.0)(4.6)amc : amoxicillin - clavulanic acid , cli : clindamycin , frm : fradiomycin , lvx : levofloxacin , min : minocycline , ofx : ofloxacin , orb : orbifloxacin , sxt : trimethoprim - sulfamethoxazole . b ) wild - type c ) fold - reduction of mic by pan . e ) mrna expression levels derived from real - time rt - pcr ( relative amount of ag100 ) . * p<0.05 , * * p<0.01 ; statistical difference versus community group . ) . all enr - resistant isolates had nucleotide substitutions in qrdrs accompanied by changes in 3 or 4 amino acids in qrdrs . the aac ( 6 ) ib - cr , one of the genes encoding pmqrs , was detected in only 1 strain . in total , more than 70% of the enr - resistant isolates had resistance or intermediate interpretation to amp and/or chl , and 74% of isolates with an amp mic of>128 g / ml possessed blatem-1 , and 100% of isolates with a chl mic of>128 g / ml possessed cata1(table 6 ) . expression levels of acra , acrb and tolc and the effect of pan were higher in chl resistance and chl intermediate interpretable isolates than in chl - susceptible isolates ( table 6 ) . isolates exhibiting ost had high acrb expression , while isolates with an intermediate interpretation to amp also exhibited ost and had higher acrb expression than did isolates that were amp - susceptible ( data not shown ) . amc : amoxicillin - clavulanic acid , cli : clindamycin , frm : fradiomycin , lvx : levofloxacin , min : minocycline , ofx : ofloxacin , orb : orbifloxacin , sxt : trimethoprim - sulfamethoxazole . b ) wild - type c ) fold - reduction of mic by pan . e ) mrna expression levels derived from real - time rt - pcr ( relative amount of ag100 ) . * p<0.05 , * * p<0.01 ; statistical difference versus community group . among dogs from which we isolated e. coli on enr - supplemented dhl agar plates , the frequency of dogs treated with any antimicrobials was significantly higher in the university hospital ( 89.5% ) than in the community clinics ( 58.3% ) cases ( table 6 ) . in contrast , the frequency of dogs treated with fluoroquinolones was not significantly different between the university hospital ( 31.6% ) and community clinics ( 25.0% ) cases . twenty - seven of 31 e. coli isolates obtained on enr - supplemented dhl agar plates showed resistance or an intermediate interpretation to amp and/or chl . among the 27 dogs from which we isolated e. coli with resistant or an intermediate interpretation to amp and/or chl on enr - supplemented dhl agar plates , 18 dogs had been treated with fluoroquinolone and/or -lactam antimicrobials ( table 6 ) . in this study , e. coli isolates with resistant or an intermediate interpretation to aminopenicillins , chl or fluoroquinolone were more frequently obtained from dogs admitted to the universal hospital than from those admitted to the community clinics . remarkably , isolates with resistance to fluoroquinolones more frequently showed resistance to aminopenicillins , cephalosporins , gen , dsm and chl , as compared with fluoroquinolone - susceptible isolates . this result suggested that the difficulty of providing effective antimicrobial treatment increases in secondary medical care . it indicated a need to investigate the mechanism underlying the emergence of this multidrug - resistance phenotype . to characterize in detail the fluoroquinolone - resistant isolates obtained from the university hospital and community clinics studied here , we investigated antimicrobial - resistance mechanisms of e. coli isolates derived from dogs using enr - supplemented dhl agar plates . all enr - resistant isolates obtained from enr - supplemented dhl agar plates possessed 3 or 4 mutations in qrdrs . a previous study showed that in vitro exposure to fluoroquinolone caused mutations in qrdrs and acrab this may indicate that in vivo fluoroquinolone exposure can also cause an increase in fluoroquinolone - resistant e. coli possessing multiple mutations in qrdrs and acrab tolc overexpression . indeed , prevalence of fluoroquinolone - resistant isolates was significantly higher in dogs that had been treated with fluoroquinolones compared with that in dogs that had not been treated with this agent , as determined using on dhl agar plates that had not been supplemented with enr . moreover , fluoroquinolone - resistant isolates derived from the university hospital had higher levels of acra , acrb and tolc expression than did such isolates obtained from the community clinics , as determined using enr - supplemented dhl agar plates . these findings suggested that the high prevalence of fluoroquinolone - resistant e. coli isolates derived from the university hospital may have been caused by frequent fluoroquinolone use in the university hospital and/or continuous fluoroquinolone use in the community clinics and the university hospital . this may have resulted in development of a mechanism that decreased fluoroquinolone susceptibility , viz . , overexpression of acrab tolc . in this study , chl , in addition to enr was another agent to which isolates derived from the university hospital showed a significantly higher prevalence of resistance than did those derived from the community clinics . all enr - resistant isolates with a chl mic of > 128 g / ml that had been derived from enr - supplemented dhl agar plates possessed cata1 . however , other resistant isolates with a chl mic of 32 and 64 g / ml and an intermediate interpretation isolates with a chl mic of 16 g / ml did not possess any specific chl - resistance gene . among all antimicrobial agents that we tested , isolates with enr resistance were most frequently co - resistant to aminopenicillins , and all the isolates showing resistance to amp , but not to cepharosporins , possessed blatem-1 . however , isolates with intermediate interpretation to amp did not possess any of the -lactamase genes for which we tested . these results indicated that the main resistance mechanisms for fluoroquinolones , amp and chl involved by acquisition of mutations in qrdrs and a resistance - associated gene , e.g. , blatem-1 or cata1 , although there may also be other mechanisms that decreased their susceptibilities and conferred co - resistance to these agents . to evaluate the mechanism underlying decreased susceptibilities and co - resistance to fluoroquinolone , aminopenicillins and chl , we investigated acrab tolc function , because acrab tolc is a major resistance nodulation division ( rnd ) family - type efflux pump that excretes several antimicrobials [ 14 , 19 , 20 ] . acrab overexpression increases the mics of aminopenicillins and chl to an intermediate interpretation ( 16 g / ml ) or resistance ( 32 or 64 g / ml ) level , and its effect is not limited to fluoroquinolone resistance [ 13 , 21 ] . tolc is also known to cause the efflux of several organic solvents , which cause cell death by breaking down microbial membranes ; therefore , investigation of ost is useful for identifying e. coli isolates that have active acrab tolc . we observed that ost isolates with higher acrb expression and isolates with an intermediate interpretation to aminopenicillins and chl , as well as isolates resistant to aminopenicillins and/or with chl mics of 32 and 64 g / ml , also exhibited ost and higher acrb expression than did susceptible isolates , as seen by analysis using enr - supplemented dhl agar plates . a higher prevalence of isolates with ost , decreased aminopenicillin susceptibility and decreased chl susceptibility , was observed in isolates obtained from university hospital compared to those from community clinics cases , as seen on agar plates without enr supplementation . tolc function contributes to a decrease in susceptibility to aminopenicillins and chl mics in some e. coli isolates obtained from dogs . our study revealed that the frequency of total antimicrobial treatment as well as fluoroquinolone use was significantly higher in the university hospital than in the community clinics . this evidence suggested that the frequent use of antimicrobials in dogs admitted to the university hospital and/or their continuous use in dogs moving from the community clinics to the university hospital facilitate selection of antimicrobial resistant e. coli strains with qrdr mutations , beta - lactamase gene and cata1 . in addition , our study also revealed that dogs admitted to the university hospital tend to be treated with multiple antimicrobials . indeed , our results showed that enr - resistant e. coli isolates had higher rates of resistance to several antimicrobials compared with enr - susceptible e. coli isolates , and enr - resistant isolates derived from the university hospital cases on enr - supplemented dhl agar showed a stronger development of the acrab tolc than did enr - resistant e. coli isolates derived from the community clinics cases . we considered that these findings substantially reflect the situation in japanese companion animal medicine , because the samples in this study were successively . in addition , a previous study also showed that amp or enr treatment led to the emergence of aminopenicillin enr chl - resistant e. coli isolates in dogs in the united states [ 2 , 8 ] . moreover , fluoroquinolone aminopenicillin chl - resistant e. coli isolates with overexpression of acrab tolc were frequently isolated from humans in university hospitals . these findings indicate that the emergence of this multidrug - resistant phenotype may mirror the same phenomenon in human and companion animal clinical fields in several countries in some cases . in these cases , a clearer strategy for choice and use of antimicrobials suitable to treatments is required in order to prevent the emergence and spread of these fluoroquinolone - resistant e. coli with decreased susceptibilities to several other antimicrobials . in particular , we suggest that it may be important to share the history of antimicrobials usage across the first and secondary medical care settings of companion animals to avoid treatment with several antimicrobials in the same period and to avoid extensive , continuous treatment with the same class antimicrobial . in conclusion , this study revealed that the higher prevalence of concomitant resistant and intermediate interpretations to fluoroquinolones , aminopenicillins and chl in isolates from the university hospital than in isolates from the community clinics was due not only to the acquisition of specific resistance mechanisms , such as -lactamases , cata1 and qrdr mutations , but also to overexpression of the acrab tolc efflux pump in canine e. coli .

abstractunderstanding the prevalence of antimicrobial - resistance and the relationship between emergence of resistant bacteria and clinical treatment can facilitate design of effective treatment strategies . we here examined antimicrobial susceptibilities of escherichia coli isolated from dogs admitted to a university hospital ( university hospital ) and companion animal clinics ( community clinics ) in the same city and investigated underlying multidrug - resistance mechanisms . the prevalence of e. coli with intermediate and resistant interpretations to ampicillin ( amp ) , enrofloxacin ( enr ) and chloramphenicol ( chl ) was higher in the university hospital than in the community clinics cases . use of antimicrobials , including fluoroquinolone , was also significantly higher in the university hospital than in the community clinics cases . upon isolation using enr - supplemented agar plates , all enr - resistant isolates had 34 nucleotide mutations that accompanied by amino acid substitutions in the quinolone - resistance - determining regions of gyra , parc and pare , and 94.7% of all isolates derived from the university hospital showed amp and/or chl resistance and possessed blatem and/or cata1 . the average mrna expression levels of acra , acrb and tolc and the prevalence of organic solvent tolerance , in isolates derived from enr - supplemented agar plates were significantly higher in the university hospital than in the community clinics isolates . thus , e. coli derived from the university hospital cases more often showed concomitant decreased susceptibilities to aminopenicillins , fluoroquinolones and chl than did those derived from the community clinics ; this was related to an active acrab tolc efflux pump , in addition to acquisition of specific resistance genes and genetic mutations .

denture lining materials are widely used for the base of a denture to reduce pain or to improve the fit between the denture and mucous membrane.1 they act as a cushion and provide an even distribution of functional load onto the stress - bearing mucosa.2 application of a soft lining material to the dentures can also increase the patient s masticatory performance , biting force and improve the chewing rhythm.3 denture lining materials can be classified as provisional or permanent , silicone rubber or acrylic resin , and can be either chemically or heat polymerized.4 a provisional liner is the one used intraorally for up to 30 days and a long - term liner is categorized as the one that maintains its softness and elasticity for more than 30 days.5 furthermore , in a study , a long term liner was classified to be the one used for 1 year or longer.6 silicone based lining materials are basically dimethylsiloxane polymers and do not contain plasticizer to produce softening effect.7 these lining materials are hydrophobic ; this reduces water sorption , but simultaneously inhibits good affinity to the supporting tissues.8 acrylic based lining materials are composed of the powder consisting of a higher methacrylate polymer ( usually poly ethyl methacrylate ) and a liquid of a higher methacrylate monomer ( e.g. ethyl , n - butyl ) , in addition a plasticizer , commonly a phythalate.9,10 when immersed in water , these materials undergo 2 processes ; leaching of plasticizers and other soluble materials into water and water imbibition by the polymer . eventually , the physical and mechanical properties of the materials change with time in the patient s mouth.9 an ideal processed denture liner should be resistant to imbibing oral fluids or releasing compounds into the saliva . high water sorption and solubility of lining material decrease mechanical properties such as hardness , transverse strength and fatigue limit . discoloration , dimensional change and separation from a denture base can also appear because of the high values of sorption and solubility parameters.3,11 thus , sorption , solubility and discoloration properties are important to evaluate the longevity of a liner.6 denture relining materials often show changes in mechanical properties with aging.12 their longevity was evaluated by immersion in water , accelerated weather testing and thermocycling.13 - 16 the use of accelerated aging process has increased in dental researches recently.17 - 20 this process simulates the effects of long - term exposure to environmental conditions through an accelerated weathering process that involves ultraviolet light exposure , temperature and humidity changes.21 besides , previous studies have shown the effect of accelerated aging on the physical and mechanical properties of the liner materials.12,22 color stability is an important property of a denture liner to retain its color in specified environment , especially in long term use . besides , color assessment and its reproduction is one of the most challenging aspects of dentistry.23 visual color matching is still the primary method for evaluating the color and may cause dissatisfying results.20,24 photoelectric tristimulus colorimeters have the potential to remove some of the variables found when the visual method is used exclusively and provide accurate and repeatable measurements . 25,26 color changes in the oral environment need to be investigated further in order to predict which materials will provide the best clinical service in long term use . according to ansi / ada specification no . 12 , the denture liner should pass the color stability test , which requires that the specimen show no more than a slight color change after an exposure of 24 hours.27 this requirement might be difficult to achieve because most of the liners show noticeable color changes when exposed to ultraviolet light.28 hence , the purpose of this in vitro study was to compare the effect of accelerated aging on the color stability of silicone and acrylic denture liners by using a colorimeter . two silicone and three acrylic based lining materials used in this study are listed in table 1 . sixty disc - shaped samples , with uniform size of 10 mm diameter and 2 mm in thickness , were prepared for each lining material according to the manufacturers instructions . all of the samples were stored in distilled water ( dw ) at 371c for 24 hours before color measurement . six samples from each tested liner material served as control groups and these samples were immersed in dw at 371c in a dark room for 900 hours . the remaining 6 samples from each group were subjected to accelerated aging in wheather - ometer instrument ( quv accelerated weathering tester , the q - panel company 26200 first st . , sn : 92 - 7475 - 44 , cleveland , ohio , usa . ) and exposed to continuous ultraviolet and visible - light , at a temperature of 110f and intermittent dw spray was used for a period of 18 minutes within each 2-hours period . the manufacturer of the weathering instrument estimates that 300 hours of aging intraorally is equivalent to 1 year of clinical service.17,29 the samples were kept for 900 hours either in weathering machine or immersed in dw ( equal to 3 years of service ) . before and after either aging or immersion in dw , color measurements of the samples were evaluated with the colorimeter ( spectrometer , gretag machbeth , sn : kh 1435 , regensdolf , switzerland ) . before each measurement session , the colorimeter was calibrated with its white reference tile according the manufacturer s instructions . the color change values of all samples were calculated by measuring the mean and standard deviation of e * values with the use of cielab color system.20,30 the critical remark of color change ( e * ) were quantified by the national bureau of standards ( nbs ) rates the way that a color change is evaluated by the human eye ( table 2 ) . as such , the color change values of all liner materials were multiplied by a factor of 0.92 to obtain the nbs values . 22,31 a kruskal - wallis , nonparametric one - way analysis of variance ( anova ) followed by a multiple comparisons test were used to analyze the k - independent group of data from this investigation . in addition , for two - independent samples comparisons mann - whitney u tests were used . the mean color measurements ( l * , a * , and b * ) of five liner materials recorded from the colorimeter are given in table 3 . the mean and standard deviation of color change ( e * ) values and their corresponding nbs values after subjecting them to dw and aging are shown in table 4 . the discoloration occurred after aging was significant when compared to the control samples stored in dw ( except uh ) . the highest discoloration in all conditions was apparent with dl ( e*aging = 16.30 ) ( change to other color ) and the least discoloration was found with up ( e*dw = 0.41 ) ( extremely slight change ) after immersion in dw . after aging treatment only dl showed color change to other color ( table 4 ) . the liner materials were compared with anova and then pairwise comparisons were done by using kruskal - wallis nonparametric tests . the results of anova and pairwise comparisons indicated that there were significant differences among the materials after immersion in dw ( except up and dl ; mp and tr ) ( for dw h=25.455 ; p<.001 ) and after aging ( except up and mp ) ( for aging h=25.974 ; p<.001 ) ( table 5 ) . the effects of treatments dependent to each material were examined by using mann - whitney u tests ( tables 6 and 7 ) . as seen in table 6 , the most discoloring treatment was aging ( e*dl = 16.30 , p=.004 ) and the least discoloring treatment was dw ( e*up = 0.41 , p=.004 ) . comparisons between these two treatments showed that there were differences in samples of up , dl , mp , and tr , but indifferences in samples of uh after immersion in dw and aging . control and aging groups were compared based on materials by using two - independent - samples mann - whitney u tests ( table 7 ) . comparisons between these two subgroups showed that there were not differences in samples of acrylic and silicone based liner materials after immersion in dw , but differences in them after aging . the color instability of the lining materials that may affect the patient s acceptance , have often been reported in clinical studies and may lead to a clinical decision to replace the lining.32,33 even though the properties of lining materials have been much improved , they still have disadvantages including water sorption , solubility and obvious color changes.34 the best liner materials available today do not demonstrate an extended service life of more than a few years.6,22 the technology for dental color matching has changed over the past several decades . in the previous studies , colorimeter measurements have been compared with spectrophotometer readings and deemed as reliable and accurate as spectrophotometer for color difference measurements.23,35 the colorimeter used in this study is new , easy to use , portable , offers accurate measurements , the spectral range is 380730 nm and for illumination it uses d65 gas filled tungsten . cielab color space is commonly used in perceptual studies and dental color assessment because of its uniform coverage of the color space . in this system there are three coordinates : l * , a * , b*. l * indicates lightness , which ranges from 0 ( black ) to 100 ( white ) . the quantities a * and b * are chromacity coordinates that indicate color directions : positive a * corresponds to red direction , whereas negative a * indicates the green direction ; positive and negative b * values correspond to yellow and blue directions , respectively.20,35,36 in the present study , a * values of the tested materials decreased ( to green ) either after aging or immersion in dw ( except mp after immersion in dw ) . l * values of all the tested materials ( except uh and mp ) increased ( to white ) after immersion in dw , while these values ( except dl and tr ) decreased ( to black ) after aging . b * values of the materials ( except dl after immersion in dw ) increased ( to yellow ) both after immersion in dw and aging . the national bureau of standards ( nbs ) established a rating system to describe color differences by nbs units.20 e * values of this in vitro study were converted to nbs units to facilitate comparison with clinical studies . according to the nbs units ; dl showed change to other color ( e*dl = 16.30 ) , while up and mp revealed marked change ( e*up = 3.46 , e*mp = 4.78 ) after aging . as a result , up showed the highest color stability after immersion in dw and aging . this property may be of advantage to its long - term serviceability in severe oral cavity environment . an accelerated aging process has been used in this study in order to simulate the oral environment . even if the oral environment is more complex , this aging treatment is still useful for the comparison of different lining materials as the closest simulation of oral environment.17 it has been reported that water spray and visible ultraviolet light have a direct effect on the properties of liners and cause them to swell.19 the changes that may occur in polymers as a result of this process are ; scission of the polymer chains by uv light , oxygen cross - linking , leaching of plasticizers and absorption of water.37 previous studies have shown the effectiveness of accelerated aging in evaluating the color stability of soft denture liners.17,22 similarly , in the current study , significant color changes were seen in all of the tested materials after aging . the clinical color stability behavior or performance of acrylic and silicone based lining materials would be different due to their different structures.38 water sorption and solubility can dramatically affect stain resistance , dimensional stability , physical and mechanical properties.6 when immersed in saliva during clinical use and may be soaked in water or cleansing agents when not in use ; plasticizers and other soluble may leach out over extended periods while water is absorbed until equilibrium is reached.16 at 1 week , water sorption value should not be more than 0.8 mg / cm and the solubility should not be more than 0.04 mg / cm for different liners.27 water sorption depends on the degree of hydrophobicity and porosity of the liner.3 acrylic resin liners have high water sorption and solubility . on the other hand , silicon liners considered to be stable in aqueous environments for variable lengths of time and the hydrophobicity of them reduces water sorption.8,39 these liners might be expected to possess more stain resistant than would the acrylic materials tested . kawano et al6 investigated the sorption and solubility of 12 soft denture liners and reported that mp had sorption values ( 0.230.01 ) less than 0.8 mg / cm after 1 year and this met the 1 week sorption requirements of ada specification 12 . in the current study , mp had low color change value after immersion in dw ( e * = 1.75 ) and after aging ( e * = 4.78 ) . shotwell et al22 investigated the color stability of long term soft liners after accelerated aging and showed the appreciable ( marked change ) nbs unit of mp ( nbs unit , 3.3 ) . anil et al12 compared the color stability of five denture reline materials and found the lower nbs unit of mp ( nbs unit , 1.94 ) than tr ( nbs unit , 3.8 ) and up ( nbs unit , 56.05 ) . however , up was the most color stable liner material in this study ( nbs unit , 3.18 ) and tr showed extremely marked change ( nbs unit , 11.96 ) after aging . the differences in color measurements of these two studies might be explained by the variations in the properties of the instruments used . this effect should be kept in mind while comparing the results of the researches about the color stability . in the present study , acrylic and silicone based liners exhibited significantly different color change values after aging . silicone based liners ( up , mp ) seemed to be more resistant to staining than acrylic based liners ( uh , tr , dl ) . furthermore , comparing acrylic based liners , uh showed marked change than the other acrylic based liners ( tr , dl ) after immersion in dw . this might lead us to associate this result with the chemical composition of uh , porosity formed by the air inclusions during mixing powder and liquid , surface roughness and water absorption . 34 residual monomer is a well - known plasticizer which remains in polymerized resin as free or unreacted monomer and it affects physical and mechanical properties of acrylics.40 according to the previous research by urban et al,40,41 comparisons between the residual monomer in hard acrylic relining resins ( dl , tr , uh , kooliner ) and heat - polymerized denture base resin ( lucitone 550 ) in 55c water bath resulted in an arrangement as kooliner ( 1.52% ) > dl ( 0.85% ) > uh ( 0.45% ) > lucitone 550 ( 0.24% ) > tr ( 0.14% ) . in the present study , dl showed poor color stability after aging ( e*=16.30 ) . this result might be related to the amount of leaching residual monomer with color stability . several studies have been done about the color measurements by using colorimeters21,22 and usually these studies have been compared directly . the present results can not be compared directly with previous studies because of the variations in the instruments used , sample sizes and conditioning of the samples . although the system of color change is not known exactly , it could be guessed by investigating how aging changes the physical and mechanical properties of denture liners.17,19 test conditions used for in vitro studies do not subject the materials to the aqueous environment , microorganisms , abrasion , thermocycling , material thickness and cyclic loading . the properties of liner materials in the clinical situations still differ from laboratory testing.42 there also seems to be a need for extra researches to understand the effect of aging on color change mechanism . the measurements showed that up and mp are clinically reliable denture liner materials . from a clinical aspect , for long - term clinical serviceability , it seems reasonable to recommend the use of silicone based instead of acrylic based liner materials .

objectivesthe aim of this study was to compare the color stability of three acrylic based hard liners ( ufi gel hard , dura - liner ii , tokuso rebase ) and two silicone based soft liners ( ufi gel permanent , molloplast b ) by using the colorimeter.methodssixty disc - shaped samples , with uniform size of 10 mm diameter and 2 mm in thickness were fabricated for each material . thirty samples were made as control group in distilled water and the remaining thirty samples were weathered in accelerated aging chamber . color measurements were made before and after distilled water and aging . data were statistically analyzed using nonparametric kruskal - wallis and mann - whitney u tests.resultsdata showed that there are significant differences among materials in both after distilled water and aging treatments ( p<.001 ) . these results indicated that the most discolored liner material was dura liner ii after aging ( e*=16.30 ) and the least discolored material was ufi gel permanent after distilled water ( e*=0.41).conclusionsbased on the results of this study , silicone based liner materials are considered to be more color stable than acrylic based liner materials .

the characteristics of keratoconus ( kc ) have been well documented in numerous populations worldwide . characteristics such as age , gender , visual acuity , severity , associated factors , and management have been reported in studies conducted in australia , england , india , iran , israel , jordan , malaysia , new zealand , scotland , singapore , turkey , and united states . to the best of our knowledge , there is no published study , from africa , of the characteristics of kc . the aim of the present study is to provide the first description of patients diagnosed with kc in an african community seen in a specialized contact lens clinic at a children 's hospital in kenya . a retrospective chart review was performed on all the ophthalmic records of patients with kc evaluated at the muthaiga eye clinic at gertrude 's children hospital in nairobi , kenya from january 2007 to october 2014 . all patients included in this had been initially diagnosed with kc by an ophthalmologist and referred either directly or through a third party to this clinic . data were collected on gender , age at initial presentation , source of referral , main complaint at referral , severity of kc , best - corrected visual acuity ( bcva ) , prior management , if any at first presentation , including optical correction , collagen cross - linking , and keratoplasty . during the study , this study was approved by the african medical research foundation , kenya and cardiff university , uk . patients with systemic or ocular pathology ( other than kc ) were excluded , as well as those whose records were incomplete . corneal curvature was measured with a keratometer ( bausch and lomb , rochester , ny , usa ) . the severity was assessed based on the classification used in the collaborative longitudinal evaluation of kc study , which is : mild kc < 45 d in both meridians , moderate kc 4552 d in one or both meridians , severe kc > 52 d in one or both meridians . visual acuity was determined using a keeler ( finesse ) snellen chart at 3 m. snellen readings were converted to logmar . smirnov test . if normality was satisfied , the t - test and chi - square test was used . in cases of nonnormal distribution , the mann all tests were two - tailed , and p < 0.05 was considered statistically significant . the mean age at presentation was 20.97 11.13 years ( n = 249 patients ; age was not recorded in the charts of five patients ) . the age data were not normally distributed ( z = 0.157 , p < 0.001 ) and slightly skewed towards the younger age ( median 18.0 ) . the ages ranged between 6 and 84 years although 75% of the patients were between the age of 6 years and 25 years . the percentage of male subjects was higher ( 59.8% , n = 152 ) than female subjects ( 40.2% , n = 102 ) , ( p = 0.002 ) , resulting in a ratio of 3:2 . the mean age at initial presentation was 21.06 11.91 years ( range , 684 years ) for males and 20.84 9.93 years ( range , 771 years ) for females . the remaining patients were directed by a teacher ( 6.7% ) or other sources , or very rarely an optometrist ( 0.4% ) , they had all been diagnosed initially by an ophthalmologist . about one - third of patients at first presentation had no refractive correction ( 33.9% ) . the remaining patients were managed with spectacles ( 28.7% ) , contact lenses ( 19.7% ) , or a combination of spectacles and contact lenses ( 17.7% ) . of these patients , the most common patient complaints at initial presentation was blurred vision ( 50% ) followed by poor visual acuity with spectacles ( 33.5% ) , contact lens intolerance ( 11.8% ) , unspecified ( 4.3% ) , and frequent change in refraction ( 0.4% ) . corneal curvature data were available in only 306 eyes as data were missing in the remaining eyes or the keratometric data were removed for eyes that had undergone corneal transplantation . based on the keratometry data available , 98.3% of the patients had bilateral kc of whom 6.2% had mild kc , 22.9% had moderate kc and 71% kc had severe kc . mean binocular bcva ( n = 248 ) was 0.24 0.23 ( n = 248 ) and the median was 0.20 , indicating a distribution skewed toward better visual acuity . seventy - five percent of kc patients had binocular bcva of 0.4 logmar ( 6/15 ) or better . bcva was 0.37 0.38 for right eyes ( n = 234 ) and 0.36 0.36 ( n = 233 ) for left eyes . the age at initial presentation and the corresponding bcva of the eyes of different severity are given in table 1 . the bcva data were not normally distributed ( z = 0.197 , p < 0.005 ) . patients with severe kc presented at an earlier age and had poorer visual acuity than those with mild and moderate kc ( p < 0.005 ) . age at first presentation and best corrected visual acuity of eyes with keratoconus based on severity although 66.1% of the patients had refractive correction at presentation after assessment , 98% required some form of refractive correction , 2% required no refractive correction . of those corrected , 34.6% were prescribed spectacles , 31.1% received gas permeable contact lenses and 32.3% were prescribed both spectacles and contact lenses and 16.5% of the patients were referred for keratoplasty . the reasons for referral were poor bcva with optical correction ( 55.2% ) , inadequate contact lens fitting ( 20.7% ) , hydrops ( 13.8% ) , and contact lens intolerance ( 10.3% ) . after keratoplasty , 92% required spectacles , 4% required contact lenses , and 4% required contact lenses and spectacles . in kenya , kc is occurring in people as young as 6 years of age . , a large proportion of patients in the present study were very young ( 75% were between the ages of 6 years and 25 years ) . notably , however , the age at presentation does not usually represent the age of disease onset , which is usually younger as the development of the disease is generally insidious and asymptomatic , and the patients had already been diagnosed by an ophthalmologist before referral . previous studies from india , iran , malaysia , israel , and jordan are similar to those obtained in the present study [ table 2 ] . however , kc seems to occur at a somewhat older age in the us and among caucasians in the uk . younger age at presentation means that the condition has an earlier onset and most likely faster progression in african , middle eastern and indian populations . the higher proportion of bilateral cases in this study ( 98.3% ) substantiates faster progression of the disease developing in the less affected or sub - clinical fellow eye . early occurrence of the disease suggests a more severe form of the disease , which progresses more rapidly to surgery . contrary to this observation , a lack of correlation between severity and age of onset was reported in one study . early onset may reflect the variability of the disease process and genetic differences between the various ethnic groups for which some evidence has been reported . the high proportion of bilateral cases in the current study concurs with other studies , where only 0.5% of patients had unilateral kc which was documented using the same procedure . in contrast , 14.2% of bilateral cases were reported in a study of 600 eyes conducted before the development of corneal topography . mean age of keratoconus patients at initial presentation , diagnosis , or self - reported onset of the disease in various countries the preponderance of males with kc in the current study is consistent with the majority of studies published in the last 30 years . papers published over 30 years ago report the opposite gender distribution . in a retrospective study from the netherlands using data from over 100,000 contact lens wearers from four university clinics and five contact lens centers between 1950 and 1986 , the ratio of males - to - females remained < 1.0 until the 1970s when the ratio significantly increased and reached 1.58 for patients diagnosed in 1985 and 1986 . a male majority may be explained by hormonal differences , and it has been noted that kc develops more rapidly in males than females which could account for the higher prevalence in some study samples . there could also be a gender bias in some societies where services are offered more so to males than females . the source of referral in kenya differs markedly from that in western countries . in kenya , the majority of referrals came from ophthalmologists similar to iran . in the uk and scotland , optometrists were the main source of referrals ( 72.2% and 79% , respectively ) . in a large study conducted at moorfields eye hospital in london however , in kenya patients are generally more likely to follow the advice of physicians such as ophthalmologists rather than nonphysician care providers . the most common complaint of the subjects was blurred vision followed by poor visual acuity with spectacles ( 83.5% total ) which is consistent with the large number of cases of severe keratoconus ( 71% ) who exhibited significantly poorer acuity than either patients with moderate or mild kc . this observation concurs with two other retrospective studies in the uk that reported symptoms of blurred vision of 78% and 93% . other complaints were contact lens intolerance ( 11.8% ) followed by unspecified reasons and frequent change in refraction . a high percentage of the patients in the current study had severe kc , which is not surprising as the study sample was from a hospital eye clinic to which patients are referred to by primary or secondary eye care practitioners and the age of presentation was younger . similar results are reported from studies from india and jordan [ table 3 ] from hospital contact lens clinics , except studies from the usa . in this study , 66.1% of the patients used some form of correction at presentation , 37.4% of whom had already been prescribed rigid contact lenses by a secondary eye care practitioner and 14.2% of the patients had already been treated by other specialists with either collagen cross - linking or keratoplasty before referral to this tertiary contact lens clinic . management of the vast majority of patients ( 98% ) was with some form of optical correction , which provided very good visual acuity and 72% of eyes had a bcva 0.3 logmar ( 6/12 ) . only rigid gas permeable contact lenses were used because the cost of hybrid lenses is too high for the patients presenting to this clinic and soft lenses were inappropriate for such irregular corneas . in the current study , this proportion of referral to corneal transplantation is well within the range of 2%29% reported in other studies ( with one outlier ) [ table 4 ] . however , recent studies report lower percentages of referral to keratoplasty likely due to the well - documented success of corneal collagen cross - linking . for example , a study from malaysia reported 52% of patients were prescribed contact lenses , 24% had cross - linking , and only 2.5% had a corneal graft procedure . severity of keratoconus reported in several studies from different countries percentage of keratoconus patients who have undergone unilateral or bilateral keratoplasty there are some limitations to this study . although this was a retrospective study conducted over a few years , all assessments were performed by the same practitioner . in addition , this is a hospital - based study , and the patients may have a more severe form of the kc compared to cases presenting to a routine eye care practice . the percentage of patients prescribed contact lenses would most likely be higher if hybrid or other customized lenses could have been used ; however , these lenses were cost - prohibitive for most patients in this study . this is the first study describing a cohort of kc patients from a tertiary hospital clinic in kenya , and to the best of our knowledge , in africa . the vast majority of patients were referred to this clinic by ophthalmologists which is similar to middle eastern countries . the age at referral tended was low with some cases as young as 6 years of age , which concurs with the findings in the middle east and india where there is a high prevalence of kc compared to europe and the us . the percentage of patients requiring corneal graft and the reasons for this procedure was similar to other studies .

purpose : to describe the characteristics of keratoconus ( kc ) patients seen in a contact lens clinic of a children 's hospital in kenya.results:a total of 254 patients records were analyzed . mean age at presentation to the clinic was 20.97 11.13 year ( range , 684 years ) with 75% between the ages of 6 and 25 years . there was a preponderance of males ( 59.8% ) . most patients were referred by an ophthalmologist . all patients were africans . the most common complaints were blurred vision ( 50% ) , poor visual acuity with spectacles ( 33.5% ) , contact lens intolerance ( 11.8% ) , and other ( unspecified ) . most cases were severe ( 71% ) followed by moderate ( 22.9% ) and mild ( 6.2% ) . mean bcva was 0.24 0.23 ( 6/11 ) . an optical correction was provided in 98% of cases ; 34.6% with spectacles , 31.1% with gas permeable lenses and the remaining with both . referral for keratoplasty was warranted in 16.5%.conclusion : this is the first study of kc conducted in kenya . kc presented at a very early age and tended to be severe . ophthalmologists were the main source of referral . the main presenting symptom was reduced vision . optical correction was the most common management and the percentage of patients referred for surgery concurred with other studies .

pasteurella multocida was first described by revolee in 1877 and further characterized by pasteur in 1880 . pasteurella species usually have low virulence in humans , but serious manifestations sometimes occur and can lead to bacteremia . we present a patient who developed septic shock as a result of p. multocida bacteremia , presumptively from an intra - abdominal infection . a 52-year - old african american female was brought to the emergency department for generalized abdominal discomfort , altered mental status , diarrhea , fevers and chills for 4 - 5 days . her past medical history was significant for alcohol abuse and alcohol - related liver cirrhosis . in the emergency department , vital signs were as follows : blood pressure of 74/42 mmhg , heart rate of 112 beats / min , respiratory rate of 20 breaths / min and temperature of 98.6 f. remarkable findings on physical examination included jaundice as well as abdominal distention and tenderness to palpation , especially in the right upper quadrant . as per family , she did not have recent travels or exposure to sick people . they denied having domestic animals at home or any contact to the patient with pets . admission diagnosis was systemic inflammatory response syndrome with sepsis and septic shock with multi - organic dysfunction syndrome , presumptively secondary to community - acquired pneumonia , possible biliary tract infection ( ascending cholangitis ) , probable spontaneous bacterial peritonitis ( sbp ) and alcoholic hepatitis . empiric intravenous antimicrobial therapy , composed by piperacillin / tazobactam ( 2.25 g every 8 h ) and azithromycin ( 500 mg every 24 h ) , was initiated . laboratory results on admission were : a complete blood cell count of 21,000/mm(90% neutrophils ) , a platelet count of 51,000/mm , a sodium level of 127 meq / l , a potassium level of 5.3 meq / l , a bicarbonate level of 15 meq / l and a creatinine level of 6.3 mg / dl . alkaline phosphatase level was 290 iu / l , gamma - glutamyl transpeptidase level was 290 u / l and lactate dehydrogenase level was 482 total bilirubin level was 14.5 mg / dl , with a direct bilirubin level of 10.1 mg / dl . arterial blood gases showed a ph of 7.15 , a pco2 of 23 , and a po2 of 132 while the patient was receiving mechanical ventilation with fio2 of 60% . after 24 h of admission , patient remained in critical condition and requiring maximum doses of vasopressors , despite of what it seems to be the appropriate empiric antimicrobial therapy . blood culture system bact - alert 3d was used for the recovery of the organism . no minimal inhibitory concentrations for these antimicrobials were reported . in spite of all medical efforts , p. multocida is a small gram - negative non - spore forming facultative anaerobe organism that is a natural inhabitant of the normal gastrointestinal flora and the upper respiratory tract of wild and domestic animals , especially cats and dogs . it is easily overgrowing by other flora in the sputum and might be regularly missed , as it resembles haemophilus influenzae , francisella tularensis and yersinia pestis . the five species that cause the majority of pasteurellosis are : multocida , septica , canis , stomatis , and dagmatis . human p. multocida infections have been reported to occur with and without animal exposure , the former mostly associated with the domestic cat and dog bites or scratches . most of the infections involve the skin and soft - tissues and they can be complicated by abscess formation , osteomyelitis or septic arthritis . the respiratory tract is the second most common site of infection with a wide spectrum of diseases that includes rhinosinusitis , tracheobronchitis , epiglottitis , pneumonia , empyema and lung abscesses . the majority of p. multocida pneumonia cases occur in elderly patients with underlying chronic pulmonary disease . invasive forms of p. multocida infection usually occur in immunocompromised patients , such as those with advanced age , chronic renal failure , solid tumors , hematological malignancies , diabetes mellitus or liver cirrhosis . p. multocida causes a wide variety of disease , including abdominal and pelvic infections , endocarditis , meningitis and endophtalmitis . von graevenitz et al . reviewed 21 proven cases of p. multocida bacteremia . a remarkable number of those cases involved patients with liver diseases , including liver cirrhosis of any etiology , hepatitis and infiltrating tumors . impaired function of the reticuloendothelial system and the presence of portosystemic shunts in patients with liver disease seem to play a major role in the development of bacteremia . this case seems peculiar in that no direct contact with a domestic animal could be documented . our patient had a history of alcohol - induced liver cirrhosis , which predisposed her to the development of bacteremia . however , retrospectively , it is difficult to establish the primary source of infection in this case . the findings of the abdominal examination may suggest that the primary source was the intra - abdominal cavity . unfortunately , the medical team was not able to performed paracentesis to obtain ascitic fluid for cytology and cultures due to patient s medical condition . no abdominal imaging was available . on the other hand , the chest radiography findings of infiltrate and pleural effusion may point the respiratory tract as the primary source of infection . we believed that , given the history of symptoms on admission and the presence of underlying liver disease , the intra - abdominal cavity was the most likely primary source of infection in this patient . nasopharyngeal colonization with p. multocida with transient bacteremia and seeding of the peritoneal cavity in immunosupressed cat owners could play an important role in the development of sbp . ten of these patients were exposed to animals , nine had positive blood cultures and four patients died . however , penicillin - resistant strains in human infections have been described . in these cases , 2 and 3 generation cephalosporins , macrolides , fluoroquinolones , tetracyclines , and trimethoprim - sulfamethoxazole outcome is associated with severity of the infection , the extent of the underlying disease and the early initiation of appropriate therapy . although cases of bacteremic p. multocida infections has been infrequently reported in the literature , clinicians should considered this organism as an important and potentially lethal pathogen in humans , where it can cause life - threatening infections . p. multocida should be included in the microbiologic differential diagnosis in patients with underlying chronic liver diseases who presents with possible intra - abdominal infection , even without history of exposure to domestic animals .

pasteurella multocida is a gram - negative organism characterized morphologically as coccobacillus . it is the commonest organism infecting pet bites . however , severe infections may occur in the absence of animal bites or scratches . pasteurella multocida serves as an opportunistic pathogen in humans , especially in patients with depressed immune system . few cases in the literature identify pasteurella multocida as the causative agent of septic shock , especially in cirrhotic patients . we report a patient who presented with septic shock as a result of pasteurella multocida bacteremia , without prior history of animal exposure .

neuroendocrine tumors ( nets ) originate from neural crest cells which belong to the amine precursor uptake and decarboxylation ( apud ) lineage and have both neural and endocrine cell features . these tumors are generally seen in the gastroenteropancreatic tract and lungs and rarely in ovary . these tumors can be imaged using metaiodobenzyl guanidine ( mibg ) tagged to 131-iodine ; which enters by a specific energy - dependent uptake mechanism competing with norepinephrine and majority of it is trapped in the intracellular granule fraction . this tracer has shown better sensitivity in sympathoadrenomedullary tumors as compared to the other net though the uptake is heterogeneous . over - expression of somatostatin receptors ( sstr ) is noted in these tumors and this patho - physiology is exploited in radioimmunoscintigraphy ( ris ) . sstr imaging in net is indicated for detection of the primary , staging , monitoring response to therapeutic somatostatin and treatment planning for sstr directed radionuclide therapy . all the subtypes of sstr expressed by net have affinity for the native peptide but vary in their affinity for the somatostatin analogues ; hence , the sensitivity of the study depends on the density of the sstr in the tumor and the type of analogue used in the study . indium 111 ( in-111 ) tagged somatostatin analogues were the commonly used tracers and majority of the literature related to somatostatin receptor scintigraphy ( srs ) had been done using this tracer . studies have revealed the sensitivity of in-111 labeledsrsto be in the range of 80 - 90% . it has shown superiority to other diagnostic imaging methods ( such ascomputed tomography [ ct ] and magnetic resonance ) in identifying and assessing the staging of net , except for insulinoma ( density of sstr is very low ) . the disadvantages of long half - life , physiological uptake in abdominal organs , and a higher energy of in-111 warranted research in use of a technitium-99 m ( 99mtc ) labeled agent for somatostatin receptor imaging , which is better suited for single photon emission computed tomography ( spect ) imaging . tc labeled tyrosine-3 octreotide ( toc ) has been identified as a suitable tracer which uses hydrazinonicotinic acid ( hynic ) as a complexing ligand . the pharmacokinetic properties of tc - hynic toc were found to be better than those of in - octreotide . higher target - to - non - target ratios and higher absolute tumor uptake values were observed for tc - hynic toc and the optimal acquisition time for imaging was identified as 4 h after injection . srs has low sensitivity for lesions that are present in organs having physiological tracer concentration like the liver and lesions smaller in size due to the limitation of the mechanics and tracers used in spect . imaging with pet ( positron emission tomography ) has higher resolution of the lesions , an inherent property of the modality . initial data showed the tracer gallium 68 ( ga 68 ) dota toc to have a good pharmacokinetic and imaging characteristic as compared to conventional nuclear medicine procedures . a large prospective study also demonstrates a higher accuracy of ga 68 dota toc in comparison to the anatomical imaging modality , ct , and conventional srs . however , the pet / ct modality is not often available and spect imaging is still the feasible option for imaging of net . our pictorial will try to demonstrate the utility of sstr imaging using tc hynic toc in various clinical settings and project its role in prognostication when done in conjunction with 18f flouro- deoxy glucose ( fdg)_pet / ct . patients receiving cold somatostatin therapy were asked to refrain from the therapy for 4 weeks , whereas those patients who had undergone a surgery had their imaging done after the 3 post - operative week . patients were injected with 20 mci ( 740 mbq ) of the tracer ; a whole body planar image was obtained at 30 min post - injection ( p.i ) on a dual head gamma camera ( infinia hawkeye , ge , milwaukee ) . a repeat whole body planar image and spect of the abdomen and regions with abnormal tracer uptake were performed 2 hafter injection in majority of the cases ; a pilot study of 15 cases revealed the 2-h images to be as sensitive as a 4-h image ( as suggested in literature ) . in cases with a doubtful lesion in the2-hp.i image , a delayed image at 4 h p.i . fdg pet / ct was done 60 - 90 min after intravenous injection of 18 fdg , with the patient in a fasting state within a week of the srs . acquisition was done as per the snm guidelines , from base of skull to mid - thigh on a dedicated pet / ct scanner ( discovery st , ge , milwaukee ) . the normal distribution of the tc hynic toc tracer is seen in thegall bladder , kidneys , liver , spleen [ figure 1 ] , and sometimes in the pituitary and thyroid . this image ( ( a ) anterior and ( b ) posterior ) depicts the normal distribution of the radiotracer , 99 m tc hynic toc . note the uptake in the thyroid ( small arrow ) , the liver and spleen . the kidney and urinary bladder are seen due to the part excretion through this system staging of histologically proven neuroendocrine malignancies.the management of net depends on the stage of the disease , i.e. , whether it is localized or metastatic . surgery is offered as an option to patients who have a non non - metastatic primary mass lesion . patients with locally advanced disease generally undergo a debulking surgery with the residual disease being treated with targeted therapies . cytoreduction followed by targeted therapies or specific local therapies like radioablation is the treatment option for a local disease with a solitary metastatic site . a disseminated disease is tried to control with targeted therapies.the conventional staging for net is done with a cect of the suspected local site with ct of abdominopelvic and thorax regions . ris is now incorporated in the staging of net as it helps trace the extent of the primary disease and also the spread of the malignancy in a single setting as seen in figure 2.netsshow unusual site of metastases less frequently though not uncommon . ris helps locate the odd sites of disease as seen in figure 3.initial detection and localization of suspected net and potential metastases in presence of a clinical or biochemical suspicion or to locate primary in a case identified to have a solitary metastatic lesion on conventional imaging.patients with netsmore often present with symptoms due to high endocrine secretion rather than the pressure effect caused by the primary mass . conventional imaging modalities are able to map the metastatic sites but tracing the primary site is difficult at times . figures 4 and 5 depict the utility of srs in this indication.treatment response assessment of net : patients with metastatic disease are treated with medical line of treatment and the treatment response assessment is generally done with biochemical markers and clinically . reduction of the symptoms with a decline in tumor markers is noted with responsive tumors . imaging studies are used to document treatment response ; however , it is difficult to differentiate between functional and non - functioning residual tissue . the ability to identify residual functioning tissue by a non - invasive procedure is useful to plan continuation of therapy . pre- and post - therapy srsis a helpful tool in this respect as shown in figures 6 and 7 . the management of net depends on the stage of the disease , i.e. , whether it is localized or metastatic . surgery is offered as an option to patients who have a non non - metastatic primary mass lesion . patients with locally advanced disease generally undergo a debulking surgery with the residual disease being treated with targeted therapies . cytoreduction followed by targeted therapies or specific local therapies like radioablation is the treatment option for a local disease with a solitary metastatic site . the conventional staging for net is done with a cect of the suspected local site with ct of abdominopelvic and thorax regions . ris is now incorporated in the staging of net as it helps trace the extent of the primary disease and also the spread of the malignancy in a single setting as seen in figure 2 . initial detection and localization of suspected net and potential metastases in presence of a clinical or biochemical suspicion or to locate primary in a case identified to have a solitary metastatic lesion on conventional imaging . patients with netsmore often present with symptoms due to high endocrine secretion rather than the pressure effect caused by the primary mass . identifying conventional imaging modalities are able to map the metastatic sites but tracing the primary site is difficult at times . treatment response assessment of net : patients with metastatic disease are treated with medical line of treatment and the treatment response assessment is generally done with biochemical markers and clinically . reduction of the symptoms with a decline in tumor markers is noted with responsive tumors . imaging studies are used to document treatment response ; however , it is difficult to differentiate between functional and non - functioning residual tissue . the ability to identify residual functioning tissue by a non - invasive procedure is useful to plan continuation of therapy . pre- and post - therapy srsis a helpful tool in this respect as shown in figures 6 and 7 . whole body planar images ( a ) of a 99 m tc hynic toc study of a recently detected case of pancreatic net reveals the uptake in the primary ( arrow ) and the metastatic lesions which are localized on the transaxial spect / ct images to correlate with the lesion in the skull ( b ) , a enlarged prevascular node ( c ) and a tiny pleural based pulmonary nodule ( d ) which is identified on the correlative ct image ( triangulated in e ) . another pulmonary nodule is seen as a focus of uptake in the left hemithorax on the whole body planar image ( a ) a diagnosed case of small cell carcinoma of the lung referred for staging using sstr imaging revealed a large uptake in the upper abdomen on the whole body planar images ( a ) , better visualized in the anterior aspect ( arrow ) . a spect / ct of the abdomen shows a large peritoneal mass ( b and c ) with focal tracer uptake in the primary in the left lung mass ( d ) and an unusual subcutaneous metastases in the posterior chest wall in paravertebral region ( e ) . no fdg pet / ct study was done for this patient patient with diarrhea evaluated for net , conventional ct imaging revealed hepatic metastases and was referred for somatostatin receptor scintigraphy . planar wb images show avid tracer concentration in the known sites of hepatic metastasis ( bold arrow in a and b ) . a small focus of uptake to the right of the midline in the abdomen ( small arrow in a ) corresponded to site of the primary in the duodenum well depicted on the spect / ct images ( triangulated in c ) patient who presented with metastatic left supraclavicular node from an unknown net with multiple hepatic metastases on cect of the abdomen was investigated with srs . the wb image in lesser intensity showed multiple hepatic lesions ( b ) , while the darker intensity images ( a ) showed focal uptake in the left supraclavicular node ( thin arrow a ) and an uptake in the left aspect of the upper abdomen ( thick arrow a ) which correlates on the transaxial spect ct image to the stomach wall ( arrow head in c ) suggesting gastrinoma as a possible primary , later confirmed histologically responder : a metastatic case of small bowel net ; the baseline planar whole body image ( a ) shows uptake in the primary ( thin arrow ) and the multiple hepatic metastases ( thick arrow ) . whole body planar sstr imaging ( b ) after 3 cycles of somatostatin therapy shows complete regression of the tracer uptake at the primary and the metastatic liver lesions depicting the suppression of somatostatin receptors due to the therapy . he was documented to be df on his last follow up , 1.5 year post last radioimmunoscintigraphy non responders : a case of net of the duodenum with hepatic metastases , the pre treatment wb planar images show multiple abnormal uptakes in the liver with no obvious focal uptake at the primary site ( a ) , the hepatic lesions showed partial regression in the post therapy scan ( b ) . a small focus of tracer in the right aspect of the abdomen corresponding to the primary ( arrow b and d ) of the post therapy scan which was not appreciated in the pre therapy scan ( c ) probably due to masking . the combined studies suggest suboptimal suppression of the somatostatin receptor pathway change in biology of the tumors is a known phenomenon and is attributed to either a change in the tumor receptor density or expression of a new receptor . delineating these patients on follow - up with clinical or biochemical suspicion of a recurrence evaluated with ris with poor to absent sstr expression raise the probability of altering receptor status . net is a well - differentiated pathology and does not express glucose transporter ( glut ) receptors and hence a fdg pet / ct study is not utilized in the work up . dedifferentiating tumors show an increase in the glut receptor expression with a decline in the somatostatin receptor density ; hence , a fdg pet / ct study would be efficacious in locating sites of tumor spread . combination receptor imaging will help in staging the disease as per the who classification which is based on the histology type 1a : well - differentiated benign , type 1b : welldifferentiated with low - grade malignancy , and type 2 poorly differentiated . the prognosis of the tumor is dependent on the differentiation of the tumor , poorly differentiated having a bad prognosis . netscan be categorized depending on the pattern of somatostatin and glut receptors expression with type i at one end of the spectrum suggestive of a well - differentiated tumor and type iv which depicts a dedifferentiated tumor with poor to absent sstr at the other end [ table 1 ] . categorisation of neuroendocrine tumors based on somatostatin receptor scintigraphy and flouro deoxy - glucose uptakes . figures 8 - 13 illustrate the various combinations of ris and fdg scans depicting the varied biologies of nets confirming the utility of conjugate receptor imaging . type i uptake pattern : the wb planar images of 99 m tc hynic toc study show multiple hepatic metastases ( a ) . the transaxial spect / ct images show focal concentration in the primary in head of pancreas ( b ) and the fused image of the hepatic metastases ( c ) . the mip image of the fdg pet / ct study ( d ) of this patient does not show abnormal focal fdg concentration either in the primary or the hepatic metastases . the combined srs and fdg images in this patient portray a type i pattern type ii uptake pattern : the anterior and posterior whole body planar image of ris ( a ) with avid uptakes seen in the liver metastases and right aspect of the midline region , the transaxial spect / ct images show the focal uptake in the right of the midline correlating with the primary in the body of the pancreas ( b ) and the multiple hepatic metastases ( c ) type ii uptake pattern ( contd ) : the fdg pet / ct study of the patient in fig 9 revealed an area of minimal increased tracer uptake in the right lobe of the liver on the mip image ( arrow a ) which on transaxial images corresponds to the largest hepatic lesion in the right lobe ( triangulated in b ) with no glut expression in the primary lesion at the junction of the body and head of the pancreas ( arrow c ) or the other larger hepatic lesions ( d ) , these tumors may have a propensity for alteration of tumor biology type iii uptake pattern : tumors with poor differentiation show reduction in density of sstr with increase in density of glut receptors ; these are visualized as fdg and srs avid lesions categorized as type iii pattern . this is a case of recurrent net of the tail of the pancreas evaluated with ris , the planar and the correlative fused transaxial spect / ct images show somatostatin avid recurrent lesion in tail of pancreas ( thin arrow a and triangulation in ( b ) . note the intense focal uptake in the gall bladder ( arrow head a ) , confirmed in the spect / ct image ( c ) type iii uptake pattern ( contd ) : the recurrent pancreatic tail lesion seen in fig 11 showed avid fdg uptake seen on mip image of the 18 f fdg pet / ct ( arrow head a ) and the transaxial image ( b ) suggestive of dense glut receptor expression . a low grade fdg uptake is seen in a hepatic lesion on the fdg pet / ct study ( arrow a and c ) with no hynic toc concentration in the liver on correlative transaxial spect image of the ris ( d ) . the metastatic lesions demonstrate altered biology , no somatostatin receptor expression but expression of glut receptor type iv uptake pattern : dedifferentiated tumors show poor somatostatin receptor expression with high expression of glut receptor which shows a type iv pattern of uptake -fdg avid and poor sstr lesions . a net of the lung with mediastinal nodal metastases shows poor somatostatin expression as seen by low uptakes on the whole body planar images of 99 m tc hynic toc study ( a ) with intense fdg concentration in the primary and the nodal disease seen on the mip image ( b ) and the transaxial images of the thorax ( c and d ) of the 18 f fdg pet / ct it would be appropriate to suggest that in combined srs and fdg pet / ct studies , an increasing fdg uptake with declining sr uptake would convey loss of tumor differentiation and predict a poor prognosis . peptide receptor radionuclide therapy ( prrnt ) is emerging as a promising therapeutic option in view of the specific targeting of tumor receptors . the consensus report of the net clinical trials planning meeting mentions the need for a randomized phase iii trial with use of prrnt in one arm which is based on the somatostatin receptor expression . sstr would be useful in this setting to identify the differentiation of the tumor , its spread , and will also be used for tailored dosimetry . it would be worthy to note the advantage of ris in that it provides all the necessary treatment planning information in a single study . change in biology of the tumors is a known phenomenon and is attributed to either a change in the tumor receptor density or expression of a new receptor . delineating these receptor changes assists in prognosticating the disease and alter management . patients on follow - up with clinical or biochemical suspicion of a recurrence evaluated with ris with poor to absent sstr expression raise the probability of altering receptor status . net is a well - differentiated pathology and does not express glucose transporter ( glut ) receptors and hence a fdg pet / ct study is not utilized in the work up . dedifferentiating tumors show an increase in the glut receptor expression with a decline in the somatostatin receptor density ; hence , a fdg pet / ct study would be efficacious in locating sites of tumor spread . combination receptor imaging will help in staging the disease as per the who classification which is based on the histology type 1a : well - differentiated benign , type 1b : welldifferentiated with low - grade malignancy , and type 2 poorly differentiated . the prognosis of the tumor is dependent on the differentiation of the tumor , poorly differentiated having a bad prognosis . netscan be categorized depending on the pattern of somatostatin and glut receptors expression with type i at one end of the spectrum suggestive of a well - differentiated tumor and type iv which depicts a dedifferentiated tumor with poor to absent sstr at the other end [ table 1 ] . categorisation of neuroendocrine tumors based on somatostatin receptor scintigraphy and flouro deoxy - glucose uptakes . figures 8 - 13 illustrate the various combinations of ris and fdg scans depicting the varied biologies of nets confirming the utility of conjugate receptor imaging . type i uptake pattern : the wb planar images of 99 m tc hynic toc study show multiple hepatic metastases ( a ) . the transaxial spect / ct images show focal concentration in the primary in head of pancreas ( b ) and the fused image of the hepatic metastases ( c ) . the mip image of the fdg pet / ct study ( d ) of this patient does not show abnormal focal fdg concentration either in the primary or the hepatic metastases . the combined srs and fdg images in this patient portray a type i pattern type ii uptake pattern : the anterior and posterior whole body planar image of ris ( a ) with avid uptakes seen in the liver metastases and right aspect of the midline region , the transaxial spect / ct images show the focal uptake in the right of the midline correlating with the primary in the body of the pancreas ( b ) and the multiple hepatic metastases ( c ) type ii uptake pattern ( contd ) : the fdg pet / ct study of the patient in fig 9 revealed an area of minimal increased tracer uptake in the right lobe of the liver on the mip image ( arrow a ) which on transaxial images corresponds to the largest hepatic lesion in the right lobe ( triangulated in b ) with no glut expression in the primary lesion at the junction of the body and head of the pancreas ( arrow c ) or the other larger hepatic lesions ( d ) , these tumors may have a propensity for alteration of tumor biology type iii uptake pattern : tumors with poor differentiation show reduction in density of sstr with increase in density of glut receptors ; these are visualized as fdg and srs avid lesions categorized as type iii pattern . this is a case of recurrent net of the tail of the pancreas evaluated with ris , the planar and the correlative fused transaxial spect / ct images show somatostatin avid recurrent lesion in tail of pancreas ( thin arrow a and triangulation in ( b ) . note the intense focal uptake in the gall bladder ( arrow head a ) , confirmed in the spect / ct image ( c ) type iii uptake pattern ( contd ) : the recurrent pancreatic tail lesion seen in fig 11 showed avid fdg uptake seen on mip image of the 18 f fdg pet / ct ( arrow head a ) and the transaxial image ( b ) suggestive of dense glut receptor expression . a low grade fdg uptake is seen in a hepatic lesion on the fdg pet / ct study ( arrow a and c ) with no hynic toc concentration in the liver on correlative transaxial spect image of the ris ( d ) . the metastatic lesions demonstrate altered biology , no somatostatin receptor expression but expression of glut receptor type iv uptake pattern : dedifferentiated tumors show poor somatostatin receptor expression with high expression of glut receptor which shows a type iv pattern of uptake -fdg avid and poor sstr lesions . a net of the lung with mediastinal nodal metastases shows poor somatostatin expression as seen by low uptakes on the whole body planar images of 99 m tc hynic toc study ( a ) with intense fdg concentration in the primary and the nodal disease seen on the mip image ( b ) and the transaxial images of the thorax ( c and d ) of the 18 f fdg pet / ct it would be appropriate to suggest that in combined srs and fdg pet / ct studies , an increasing fdg uptake with declining sr uptake would convey loss of tumor differentiation and predict a poor prognosis . peptide receptor radionuclide therapy ( prrnt ) is emerging as a promising therapeutic option in view of the specific targeting of tumor receptors . the consensus report of the net clinical trials planning meeting mentions the need for a randomized phase iii trial with use of prrnt in one arm which is based on the somatostatin receptor expression . sstr would be useful in this setting to identify the differentiation of the tumor , its spread , and will also be used for tailored dosimetry . it would be worthy to note the advantage of ris in that it provides all the necessary treatment planning information in a single study . the ability of the modality to delineate the somatostatin receptor expression gives explicit information of the biology of the net , both at primary and metastatic site and helps in treatment planning . srs in conjunction with glut receptor imaging helps locate change in tumor receptor expression and thus helps in prognostication of the disease . this can stratify patients who would benefit from somatostatin analogue or peptide therapy , which is the emerging treatment option for net . ris will be an effective method to monitor response to radioimmunotherapy , which will identify a non - responder early and help alter treatment in such patients .

somatostatin receptor scintigraphy is considered as a comprehensive imaging modality for many neuroendocrine tumors . multiple radiotracers using combinations of gamma or positron emitting radionuclides and tracers are now available . newer radiopharmaceuticals using 99mtc labeled with toc , tate , noc are good alternatives to the 68 - gallium radiotracers where the pet facility is not available . the pictoral depicts the role of srs using 99 m tc hynic toc radiotracers in staging and treatment planning of nets . characterization of the tumor biology using combined srs and fdg pet / ct is also demonstrated with a proposed categorization method . the emerging role of srs in tailored targeted radionuclide therapy is outlined in brief .

recent explosive advances in high - throughput sequencing technologies have led to the identification of numerous somatic mutations in cancer genomes.16 however , only a few of them functionally contribute to tumorigenesis . driver mutations that have a casual role in tumorigenesis from passenger mutations , which have no effect on tumorigenesis , is critical for our understanding of tumorigenesis . yet , if the driver mutations are not required for tumor maintenance , those gene products can not serve as anticancer drug targets.7,8 techniques used to assess whether the identified gene is associated with tumor maintenance in in vitro culture systems , include sirna - mediated gene expression knockdown or small chemical compound - mediated gene product activity inhibition.9 if these techniques abrogate gene product role in tumor cell growth , the gene may be required for tumor cell growth and therefore serves as a possible drug target for the inhibition of tumor growth.1013 several in vivo mouse systems have been used to verify these in vitro results . in particular , xenograft implantation systems have been extensively used to confirm in vitro data and to test the efficacies of small compounds for inhibiting tumor growth in mice.1416 in these systems , either tumor cells or tumor tissues are implanted into the immunocompromised mice to reproduce tumor growth . these xenograft implantation systems have several advantages over genetically - engineered mouse ( gem ) models , such as being easy to prepare and use in a large cohort of mice with synchronized tumor growth.14 however , tumor growth in xenograft implantation systems frequently fail to faithfully recapitulate the genetics and histology of corresponding human cancers , partially due to the lack of microenvironmental factors , including stromal cell components and an immune system.14 in this regard , conventional transgenic mouse models in which the transgene is expressed under the control of a tissue - specific promoter / enhancer regulatory elements are a more physiologically relevant system for determining whether the transgene expression is sufficient for tumor development and progression . unfortunately , there is no means to regulate ( either induce or suppress ) transgene expression in a temporal manner , making it impossible to determine whether the transgene expression is required for the maintenance of tumor phenotypes . to overcome this limitation , the inducible transgenic mouse model was developed . in this system , if turning off the expression of the specific gene in tumor - bearing transgenic mice shows that transgene expression is required for tumor maintenance , the suppression of transgene expression will likely lead to tumor regression , validating the transgene protein as a target for future anticancer drug development . given that tumor recurrence is always a concern in cancer therapy , understanding the molecular mechanisms underlying therapeutic resistance of tumor cells is critical for developing new therapeutic strategies against recurrent tumors . the majority of fully regressed tumors after turning off the expression of transgene by withdrawing doxycycline from the drinking water will reoccur in the original tumor site as transgene expression - independent.7,8,17 by analyzing these recurrent tumors , we can understand the molecular basis of how tumor cells escape from their dependence on doxycycline - induced transgene expression.1719 therefore , inducible mouse models enable us to extrapolate the collected in vivo data to predict therapeutic responses in clinical settings and develop new therapeutic strategies against recurrent tumors . in this review , we will highlight the importance of inducible mouse models in studying target validation and tumor recurrence by citing several previously developed inducible mouse models as examples . in the tet - on system , the expression of the transgene is turned on ( induced ) by administering doxycycline via drinking water and turned off ( suppressed ) by withdrawing doxycycline from the drinking water.20,21 two gem models are required for this system . the first model harbors a gene of interest fused to a modified tetracycline response promoter element ( tre ) that contains seven repeats of a 19-nucleotide tetracycline operator ( teto ) sequence.20,21 the second model expresses an artificial transcription factor of tetracycline - inducible transactivator ( rtta ) under the control of a tissue - specific promoter . to express the gene of interest in a specific tissue , these two mouse lines are crossed to generate compound mice harboring transgenes of both the gene of interest and rtta . in the presence of doxycycline ( adding doxycycline into the drinking water ) , doxycycline binding to rtta enables the doxycycline - bound rtta to stably bind to the tre element , leading to the expression of the gene of interest in a specific tissue.20,21 in the absence of doxycycline ( withdrawing doxycycline from the drinking water ) , doxycycline - free rtta can not bind to the tre element , resulting in the suppression of the gene of interest . mutations in exons 1821 of the human egfr ( hegfr ) gene encoding the atp - binding pocket of the receptor s tyrosine kinase domain are found in approximately 10% and 35% of patients with non - small cell lung cancer ( nsclc ) in the us and in east asia , respectively.2225 in particular , an l858r substitution in exon 21 ( hegfr l858r ) and an in - frame deletion in exon 19 ( hegfr del ) are the two most common mutations . however , the identification of these recurrent mutations at high frequencies in clinical specimens does not necessarily mean that these mutations functionally contribute to the initiation and progression of nsclc . most importantly , for these mutations to serve as future therapeutic targets , these mutations should be required for the maintenance of nsclc . therefore , to determine whether these two mutations are associated with initiation , progression , and tumor maintenance of nsclc , dr . wong s group developed inducible transgenic mouse models.26 firstly , the group generated a transgenic mouse model in which either hegfr l858r or hegfr del was fused tre to generate two gem mouse models : tre - hegfr l858r and tre - hegfr del . secondly , these mice were crossed with clara cell secretory protein promoter element - rtta ( ccsp - rtta ) mice to generate compound mice expressing either hegfr l858r or hegfr del in lung type 2 alveolar cells in a doxycycline - inducible manner 26 : tre - hegfr l858r / ccsp - rtta and tre - hegfr del / ccsp - rtta . administration of doxycycline resulted in tumor development in murine lungs , serially precancerous lesions and bronchioloalveolar carcinoma within a few weeks , and invasive adenocarcinoma with more than four weeks after induction.26 in addition , withdrawal of doxycycline to suppress the expression of hegfr l858r or hegfr del in tumor - bearing compound mice resulted in complete tumor regression without recurrences.26 these results suggest that lung tumor cells are dependent on the expression of their respective transgenes for their proliferation and survival , validating these hegfr mutant proteins as prospective drug targets for the treatment of lung cancers harboring these specific egfr mutations . these findings were immediately applied in preclinical trials of pharmaceutical inhibitors specific to the egfr mutants , such as gefitinib and erlotinib , to test their therapeutic efficacy against these inducible hegfr mutant - driven mouse lung tumors.26 these tumor cells showed dramatic responses to the egfr tyrosine kinase inhibitors , verifying that the egfr mutants serve as drug targets for the treatment of human lung cancers harboring these specific egfr mutations . in addition , these inducible hegfr mutant mouse models were validated as valuable tools for efficacy studies of newly developed egfr tyrosine kinase inhibitors . however , in clinical settings , the majority of primary egfr mutant non - small cell lung carcinomas that initially responded to egfr tyrosine kinase inhibitors became resistant to the inhibitors . 27,28 several genomic studies of recurrent patient tumor samples identified other genetic alterations , including the secondary mutation of egfr t790 m in the egfr gene and mutations in the k - ras gene.23,29,30 using another inducible mouse model that expresses a mutant egfr ( egfr tl ) containing both hegfr l858r from the primary tumor and egfr t790 m from the recurrent tumor in murine lungs in the same manner above , it was shown that egfr tl is oncogenic and essential for tumor maintenance.19 given that an irreversible egfr tyrosine kinase inhibitor , hki-272 , previously showed high efficacy against gefitinib - insensitive egfr mutants , a therapeutic strategy combining hki-272 with gefitinib was proposed to treat primary tumors driven by egfr l858r and to prevent recurrent tumors driven by egfr t790 m . preclinical trials of hki-272 alone in egfr tl - driven murine lung tumors showed suboptimal responses , consistent with unfavorable results from a phase i clinical trial of hki-272 for the treatment of previously treated nsclc patients.19 these studies suggest that results obtained from an inducible mouse model mirror clinical outcomes , validating inducible mouse models as promising tools for predicting clinical responses to cancer therapy . her / neu protein overexpression and/or her / neu gene amplification were observed in approximately 20% to 30% primary human breast cancers , and were also associated with breast cancer progression and poor prognoses.31,32 to determine whether her / neu protein overexpression is associated with initiation , progression , and tumor maintenance of breast cancer , dr . chodosh s group developed inducible transgenic mouse models.33 firstly , the group generated a transgenic mouse model ( teto - neunt ) in which a constitutively activate form of her2/neu with a substitution of valine for glutamic acid in the transmembrane domain ( neunt ) was fused to the minimal tet operator ( teto ) . secondly , these mice were crossed with mouse mammary tumor virus promoter - reverse tetracycline transactivator ( mmtv - rtta ) mice to express transgenes in the breast epithelia of the mammary ductal system . these mmtv - rtta / teto - neunt compound mice developed multiple invasive mammary carcinoma with pulmonary metastasis in the majority of tumor - bearing mice with doxycycline administration.33 after withdrawal of doxycycline , the tumors including pulmonary metastatic tumors , rapidly and fully regressed , suggesting that the activation of the her2/neu signaling pathway is required for tumor maintenance of both primary and metastatic tumors.18,33 since tumor recurrence is concern of breast cancer progression , they investigated the molecular mechanisms underlying recurrent tumors derived from fully regressed tumors after turning off the transgene expression in this mouse model.18 this study demonstrated that snail was upregulated in recurrent mammary tumors , and snail overexpression is sufficient for inducing rapid tumor recurrence after suppressing the expression of the transgene neunt in a xenograft model using tumor cell lines derived from the primary mouse tumors.18 therefore , snail may serve as a target for the treatment of recurrent breast cancer resulting from therapies against the her2/neu signaling pathway . c - myc gene amplification is also detected in up to 15% of human breast cancers , with a much higher frequency of approximately 50% in brca1-dysfunctional breast cancer.34 to investigate the functional contribution of c - myc overexpression in breast cancer development and progression , an inducible transgenic mouse model overexpressing c - myc ( mmtv - rtta / teto - c - myc ) was also generated by dr . group.8 while c - myc overexpression is sufficient for the development of mammary adenocarcinoma , approximately half of the primary tumors failed to regress after turning off the expression of the c - myc transgene . in addition , half of the fully regressed tumors recurred at the site of original primary tumor.8 therefore , the majority of the initially c - myc - driven tumors eventually lost their dependence on the c - myc signaling pathway , suggesting that c - myc may not be appropriate as a therapeutic target for the treatment of human breast cancers harboring c - myc gene amplification . many studies have reported the activation of the ras / raf / mek / erk pathway in the majority of androgen - depletion independent ( adi ) prostate cancers.3537 however , counter - intuitively , activating mutations in the ras / raf / mek / erk pathway are infrequent in human prostate cancers.7,9 to study the role of the activation of the ras / raf / mek / erk pathway in prostate cancer initiation and progression in vivo , dr . chin s group generated an inducible mouse model ( tyr - rtta / teto - braf ) , in which the expression of a potent activator of ras / raf / mek / erk signaling , braf , is targeted to the murine prostate epithelia by tyrosinase promoter / enhancer ( tyr).7 although the tyrosinase promoter / enhancer has specific activity in melanocytes , it also showed activity in the prostate epithelia for unknown reasons.7 these mice developed invasive adenocarcinoma , and these tumors further progressed to indolent adi lesions after castration.7 however , as in the case of the inducible c - myc transgenic mouse model , transgene braf - driven prostate tumors constantly grew even after turning off the transgene expression.7 therefore , this study proposed that targeting braf for the treatment of adi prostate cancer does not have positive therapeutic potential . more than 95% of pancreatic ductal adenocarcinoma ( pdac ) harbor mutations in the kras gene.3840 the expression of kras in murine pancreatic progenitor cells at a physiologically relevant level induced the full spectrum of pancreatic cancers from pancreatic intraepithelial neoplasias to invasive pancreatic cancer.41,42 these results suggest that the mutant kras is an oncogenic driver for the development of pancreatic cancer . to determine whether the mutant kras is required for tumor maintenance , dr . depinho s group generated an inducible mouse model wherein the mutant kras is expressed in murine pancreatic cells at a physiological level in a triple transgenic strain ( teto - lox - stop - lox - kras / rosa26-lox - stop - lox - rtta - ires - gfp / p48-cre ) in a doxycyline - inducible manner . in this mouse model , cre expression in murine pancreatic cells eliminates the lox - stop - lox cassette containing three repetitive transcriptional stop sequences from both tetolox - stop - lox - kras and rosa26-lox - stop - lox - rtta - ires - gfp to express rtta and gfp using the endogenous rosa26 promoter and to generate teto - kras.41 in the presence of doxycycline , the mutant kras is expressed in pancreatic cells of these triple transgenic mice . leveraging this elaborate mouse model , they proved that mutant kras is required for the maintenance of mutant kras - driven pancreatic tumors.41 to understand the molecular mechanisms of kras - mediated pancreatic tumor maintenance in this mouse model , they analyzed changes in the transcriptome of mutant kras - driven tumor samples at 24 hours after doxycyline withdrawal . they demonstrated that multiple metabolic pathways are down - regulated in mutant kras - driven tumors upon the termination of transgene expression , suggesting that the mutant kras reprograms metabolism to enhance tumor growth.43 therefore , this study proposes the possibility that mutant kras itself and associated metabolic pathways serve as drug targets for the treatment of mutant kras - driven pancreatic cancers . mutations in exons 1821 of the human egfr ( hegfr ) gene encoding the atp - binding pocket of the receptor s tyrosine kinase domain are found in approximately 10% and 35% of patients with non - small cell lung cancer ( nsclc ) in the us and in east asia , respectively.2225 in particular , an l858r substitution in exon 21 ( hegfr l858r ) and an in - frame deletion in exon 19 ( hegfr del ) are the two most common mutations . however , the identification of these recurrent mutations at high frequencies in clinical specimens does not necessarily mean that these mutations functionally contribute to the initiation and progression of nsclc . most importantly , for these mutations to serve as future therapeutic targets , these mutations should be required for the maintenance of nsclc . therefore , to determine whether these two mutations are associated with initiation , progression , and tumor maintenance of nsclc , dr . wong s group developed inducible transgenic mouse models.26 firstly , the group generated a transgenic mouse model in which either hegfr l858r or hegfr del was fused tre to generate two gem mouse models : tre - hegfr l858r and tre - hegfr del . secondly , these mice were crossed with clara cell secretory protein promoter element - rtta ( ccsp - rtta ) mice to generate compound mice expressing either hegfr l858r or hegfr del in lung type 2 alveolar cells in a doxycycline - inducible manner 26 : tre - hegfr l858r / ccsp - rtta and tre - hegfr del / ccsp - rtta . administration of doxycycline resulted in tumor development in murine lungs , serially precancerous lesions and bronchioloalveolar carcinoma within a few weeks , and invasive adenocarcinoma with more than four weeks after induction.26 in addition , withdrawal of doxycycline to suppress the expression of hegfr l858r or hegfr del in tumor - bearing compound mice resulted in complete tumor regression without recurrences.26 these results suggest that lung tumor cells are dependent on the expression of their respective transgenes for their proliferation and survival , validating these hegfr mutant proteins as prospective drug targets for the treatment of lung cancers harboring these specific egfr mutations . these findings were immediately applied in preclinical trials of pharmaceutical inhibitors specific to the egfr mutants , such as gefitinib and erlotinib , to test their therapeutic efficacy against these inducible hegfr mutant - driven mouse lung tumors.26 these tumor cells showed dramatic responses to the egfr tyrosine kinase inhibitors , verifying that the egfr mutants serve as drug targets for the treatment of human lung cancers harboring these specific egfr mutations . in addition , these inducible hegfr mutant mouse models were validated as valuable tools for efficacy studies of newly developed egfr tyrosine kinase inhibitors . however , in clinical settings , the majority of primary egfr mutant non - small cell lung carcinomas that initially responded to egfr tyrosine kinase inhibitors became resistant to the inhibitors . 27,28 several genomic studies of recurrent patient tumor samples identified other genetic alterations , including the secondary mutation of egfr t790 m in the egfr gene and mutations in the k - ras gene.23,29,30 using another inducible mouse model that expresses a mutant egfr ( egfr tl ) containing both hegfr l858r from the primary tumor and egfr t790 m from the recurrent tumor in murine lungs in the same manner above , it was shown that egfr tl is oncogenic and essential for tumor maintenance.19 given that an irreversible egfr tyrosine kinase inhibitor , hki-272 , previously showed high efficacy against gefitinib - insensitive egfr mutants , a therapeutic strategy combining hki-272 with gefitinib was proposed to treat primary tumors driven by egfr l858r and to prevent recurrent tumors driven by egfr t790 m . preclinical trials of hki-272 alone in egfr tl - driven murine lung tumors showed suboptimal responses , consistent with unfavorable results from a phase i clinical trial of hki-272 for the treatment of previously treated nsclc patients.19 these studies suggest that results obtained from an inducible mouse model mirror clinical outcomes , validating inducible mouse models as promising tools for predicting clinical responses to cancer therapy . her / neu protein overexpression and/or her / neu gene amplification were observed in approximately 20% to 30% primary human breast cancers , and were also associated with breast cancer progression and poor prognoses.31,32 to determine whether her / neu protein overexpression is associated with initiation , progression , and tumor maintenance of breast cancer , dr . chodosh s group developed inducible transgenic mouse models.33 firstly , the group generated a transgenic mouse model ( teto - neunt ) in which a constitutively activate form of her2/neu with a substitution of valine for glutamic acid in the transmembrane domain ( neunt ) was fused to the minimal tet operator ( teto ) . secondly , these mice were crossed with mouse mammary tumor virus promoter - reverse tetracycline transactivator ( mmtv - rtta ) mice to express transgenes in the breast epithelia of the mammary ductal system . these mmtv - rtta / teto - neunt compound mice developed multiple invasive mammary carcinoma with pulmonary metastasis in the majority of tumor - bearing mice with doxycycline administration.33 after withdrawal of doxycycline , the tumors including pulmonary metastatic tumors , rapidly and fully regressed , suggesting that the activation of the her2/neu signaling pathway is required for tumor maintenance of both primary and metastatic tumors.18,33 since tumor recurrence is concern of breast cancer progression , they investigated the molecular mechanisms underlying recurrent tumors derived from fully regressed tumors after turning off the transgene expression in this mouse model.18 this study demonstrated that snail was upregulated in recurrent mammary tumors , and snail overexpression is sufficient for inducing rapid tumor recurrence after suppressing the expression of the transgene neunt in a xenograft model using tumor cell lines derived from the primary mouse tumors.18 therefore , snail may serve as a target for the treatment of recurrent breast cancer resulting from therapies against the her2/neu signaling pathway . c - myc gene amplification is also detected in up to 15% of human breast cancers , with a much higher frequency of approximately 50% in brca1-dysfunctional breast cancer.34 to investigate the functional contribution of c - myc overexpression in breast cancer development and progression , an inducible transgenic mouse model overexpressing c - myc ( mmtv - rtta / teto - c - myc ) was also generated by dr . chodosh s group.8 while c - myc overexpression is sufficient for the development of mammary adenocarcinoma , approximately half of the primary tumors failed to regress after turning off the expression of the c - myc transgene . in addition , half of the fully regressed tumors recurred at the site of original primary tumor.8 therefore , the majority of the initially c - myc - driven tumors eventually lost their dependence on the c - myc signaling pathway , suggesting that c - myc may not be appropriate as a therapeutic target for the treatment of human breast cancers harboring c - myc gene amplification . many studies have reported the activation of the ras / raf / mek / erk pathway in the majority of androgen - depletion independent ( adi ) prostate cancers.3537 however , counter - intuitively , activating mutations in the ras / raf / mek / erk pathway are infrequent in human prostate cancers.7,9 to study the role of the activation of the ras / raf / mek / erk pathway in prostate cancer initiation and progression in vivo , dr . chin s group generated an inducible mouse model ( tyr - rtta / teto - braf ) , in which the expression of a potent activator of ras / raf / mek / erk signaling , braf , is targeted to the murine prostate epithelia by tyrosinase promoter / enhancer ( tyr).7 although the tyrosinase promoter / enhancer has specific activity in melanocytes , it also showed activity in the prostate epithelia for unknown reasons.7 these mice developed invasive adenocarcinoma , and these tumors further progressed to indolent adi lesions after castration.7 however , as in the case of the inducible c - myc transgenic mouse model , transgene braf - driven prostate tumors constantly grew even after turning off the transgene expression.7 therefore , this study proposed that targeting braf for the treatment of adi prostate cancer does not have positive therapeutic potential . more than 95% of pancreatic ductal adenocarcinoma ( pdac ) harbor mutations in the kras gene.3840 the expression of kras in murine pancreatic progenitor cells at a physiologically relevant level induced the full spectrum of pancreatic cancers from pancreatic intraepithelial neoplasias to invasive pancreatic cancer.41,42 these results suggest that the mutant kras is an oncogenic driver for the development of pancreatic cancer . to determine whether the mutant kras is required for tumor maintenance , dr . depinho s group generated an inducible mouse model wherein the mutant kras is expressed in murine pancreatic cells at a physiological level in a triple transgenic strain ( teto - lox - stop - lox - kras / rosa26-lox - stop - lox - rtta - ires - gfp / p48-cre ) in a doxycyline - inducible manner . in this mouse model , cre expression in murine pancreatic cells eliminates the lox - stop - lox cassette containing three repetitive transcriptional stop sequences from both tetolox - stop - lox - kras and rosa26-lox - stop - lox - rtta - ires - gfp to express rtta and gfp using the endogenous rosa26 promoter and to generate teto - kras.41 in the presence of doxycycline , the mutant kras is expressed in pancreatic cells of these triple transgenic mice . leveraging this elaborate mouse model , they proved that mutant kras is required for the maintenance of mutant kras - driven pancreatic tumors.41 to understand the molecular mechanisms of kras - mediated pancreatic tumor maintenance in this mouse model , they analyzed changes in the transcriptome of mutant kras - driven tumor samples at 24 hours after doxycyline withdrawal . they demonstrated that multiple metabolic pathways are down - regulated in mutant kras - driven tumors upon the termination of transgene expression , suggesting that the mutant kras reprograms metabolism to enhance tumor growth.43 therefore , this study proposes the possibility that mutant kras itself and associated metabolic pathways serve as drug targets for the treatment of mutant kras - driven pancreatic cancers . this short review article provides an overview of the significance of doxycycline - inducible transgenic mouse models in studying target validation and tumor recurrence by summarizing studies using inducible mouse models for lung cancer ( tre - hegfr l858r / ccsp - rtta , tre - hegfr del / ccsp - rtta , and tre - egfr tl / ccsp - rtta ) , inducible mouse models for breast cancer ( mmtv - rtta / teto - neunt and mmtv - rtta / teto - c - myc ) , an inducible mouse model for adi prostate cancer ( tyr - rtta / teto - braf ) , and an inducible mouse model for pdac ( teto - lox - stop - lox - kras / rosa26-lox - stop - lox - rtta - ires - g fp / p48-cre ) . despite investing much effort and time , many researchers have failed to identify driver genes that functionally contribute to tumor development . when a driver gene is successfully identified , the driver gene may later be found not to be required for tumor maintenance . thus , this driver gene product is not useful as a future drug target for the treatment of related cancers . these failures can be partially attributed to the limitations of in vitro and in vivo systems in studying target validation and tumor recurrence.16 for example , promising results regarding target validation through loss - of function study using either sirna - mediated knockdown or small chemical inhibitor treatment with tumor cell lines are not frequently reproduced in in vivo systems . as mentioned above , conventional transgenic mouse models are limited for the study of target validation and tumor recurrence due to the inability to regulate transgene expression in a temporal manner . these limitations are overcome with an inducible transgenic mouse model . despite the significance of inducible mouse models in studying target validation and tumor recurrence , many were wary about the extensive use of doxycycline due to its detrimental effects on mitochondria . in particular , doxycycline impairs mitochondrial proteostasis and induces some physiological changes associated with energy metabolism in mice.44 in addition , doxycycline is a tetracycline antibiotic , so it can change the gut microbiome , ultimately affecting mice immune system and metabolism.4547 these unwanted consequences might affect the tumorigenic potential of certain genes in this doxycycline - inducible mouse model . therefore , the effects of doxycycline should be well controlled to study the tumorigenic potential of genes associated with immune responses and metabolic pathways in particular . the ultimate goal of cancer research is to develop therapeutic strategies against primary tumors and recurrent tumors through the study of target validation and tumor recurrence .

genetically - engineered mouse ( gem ) models have provided significant contributions to our understanding of cancer biology and developing anticancer therapeutic strategies . the development of gem models that faithfully recapitulate histopathological and clinical features of human cancers is one of the most pressing needs to successfully conquer cancer . in particular , doxycycline - inducible transgenic mouse models allow us to regulate ( induce or suppress ) the expression of a specific gene of interest within a specific tissue in a temporal manner . leveraging this mouse model system , we can determine whether the transgene expression is required for tumor maintenance , thereby validating the transgene product as a target for anticancer drug development ( target validation study ) . in addition , there is always a risk of tumor recurrence with cancer therapy . by analyzing recurrent tumors derived from fully regressed tumors after turning off transgene expression in tumor - bearing mice , we can gain an insight into the molecular basis of how tumor cells escape from their dependence on the transgene ( tumor recurrence study ) . results from such studies will ultimately allow us to predict therapeutic responses in clinical settings and develop new therapeutic strategies against recurrent tumors . the aim of this review is to highlight the significance of doxycycline - inducible transgenic mouse models in studying target validation and tumor recurrence .

the 2007 american medical association expert committee on prevention , assessment , and treatment of childhood obesity identified caregiver feeding behaviors as an important target for intervention , categorically stating that there is consistent evidence to support avoiding overly restrictive feeding behaviors . a growing body of the literature indicating that caregiver feeding behaviors , in particular overly restrictive or controlling behaviors , significantly reduce a child 's ability to self - regulate their energy intake [ 24 ] and result in weight gain or a higher body mass index [ 46 ] shaped the expert committee 's guidelines . one area related to caregiver feeding behaviors is feeding dynamics , which is centered on the roles , interactions , and balance of control between the caregiver and child in a feeding relationship . food is offered , where food is eaten , and when food is eaten and allows the child to decide whether to eat as well as what and how much to eat of the food offered [ 7 , 8 ] . satter posits that children learn to trust and develop a healthy relationship with food when they and their caregivers each have an appropriate level of control and autonomy in the feeding relationship . the primary premise of feeding dynamics is based on nurturing optimal self - regulation of energy intake to support normal growth . young children have an innate ability to self - regulate their energy intake in response to their metabolic needs [ 1012 ] . this natural aptitude weakens as children get older and become more responsive to external influences on eating [ 1315 ] . children with the highest body fat and whose parents restrict their food choices and quantity of intake exhibit the weakest level of regulation . however , this relationship is complex , not always consistent , and probably bidirectional ; that is , the child 's characteristics , for example , age , gender , and weight , influence caregiver eating or feeding practices and vice versa [ 4 , 1719 ] . for instance , mothers who eat regular meals and choose nutritious foods for themselves are more likely to extend these behaviors to their children . mothers who eat intuitively ( giving themselves unconditional permission to eat , eating for physical rather than emotional reasons , and relying on their internal hunger and satiety cues to guide eating ) restrict their children 's food intake less and allow their children to share feeding responsibilities . the child 's perception of the caregiver 's controlling behavior can contribute to the complexity of the relationship [ 21 , 22 ] . limiting the amount and types of snack foods available in the home , a covert controlling action , is associated with decreased intake of unhealthy snacks [ 22 , 23 ] , while feeding practices , like pressuring the child to eat , are associated with an aversion to healthy food choices and a higher risk of overweight [ 4 , 24 ] . the challenge is to determine the right balance of control between the caregiver and the child . despite the complexity of the relationship , a review of the literature supported the feeding dynamic approach as a viable paradigm for obesity prevention or treatment and is described in depth elsewhere . what remains uncertain is how best to teach mothers to adopt these feeding roles , whether mothers will be willing or able to implement the roles , and how these roles can be adapted in an obesogenic environment , as scholars have not yet developed or tested this approach as a comprehensive program . the goal of this paper is to describe the development of the feeding dynamics intervention ( fdi ) , a parent - targeted program based on the feeding dynamics approach in addition to evidence - based lifestyle behaviors known to prevent or treat childhood obesity . in study 1 , we tested the acceptability and implementation of the feeding dynamic components . specifically , we initially piloted a 90-minute class to determine how best to teach the feeding dynamic roles and to obtain feedback from the mothers of 25-year - old children regarding their perception and experience implementing the feeding roles . we asked mothers of young children from two childcare centers if they would be willing to attend a 90-minute learning session with other mothers about how to feed their children . a total of 22 mothers indicated that they would like to attend a learning session . we invited mothers , as opposed to fathers , because mothers are typically the parent responsible for grocery shopping and meal preparation . of these 22 mothers , 17 attended the class and fourteen mothers completed both the pre- and postsurveys . mothers ' mean age was 32.8 ( sd = 4.2 ) years , and their children 's mean age was 3.6 ( sd = 1.2 ) years . they were identified as white ( 50% ) and african american ( 50% ) . as their highest level of education , they had graduated from high school ( 47% ) or from a 4-year college ( 50% ) ; 3% did not graduate from high school . we assessed feeding behaviors using the child feeding questionnaire ( cfq ) and the caregiver feeding responsibility scale ( cfrs ) . for the cfq restriction ( 8 items ) , monitoring ( 3 items ) , and pressure to eat ( 4 items ) subscales , higher scores reflect greater levels of the measured feeding behavior . restriction ranged from 1 ( disagree ) to 5 ( agree ) , and monitoring and pressure to eat ranged from 1 ( never ) to 5 ( always ) . cronbach alphas were 0.73 for restriction , 0.73 for pressure to eat , and 0.82 for monitoring . we used the cfq parent perception of child 's weight subscale to determine weight status . responses are markedly underweight , underweight , normal weight , overweight , and markedly overweight . the cfrs measures the feeding dynamic roles for caregivers and children as proposed by satter . specifically , items ask mothers about the extent to which they perform their responsibilities ( e.g. , feeding their children at regular times , serving meals with a variety of foods , and ensuring that the family eats together without distractions such as tv ) and allow their children to perform their responsibilities ( i.e. , deciding what or how much to eat of what has been offered ) . with a response scale ranging from 1 ( never ) to 5 ( always ) , higher scores indicate greater adherence to the feeding dynamic approach . the cfrs factor structure is unidimensional , demonstrates internal consistency reliability ( = 0.70 ) , test - retest reliability over a 5-week period ( r = 0.80 ) , and constructs validity among mothers of 2- to 5-year - old children . we also developed six independent questions on mothers ' prior familiarity with , as well as understanding and acceptability of , the feeding dynamic approach ( scale ranging from 1 ( strongly disagree ) to 5 ( strongly agree ) ) . specifically , two of these six questions queried mothers on the extent to which they knew about and fed their children according to principles within the feeding dynamic approach before taking the class if they were more familiar with the feeding dynamic approach prior to the class , then they would have less to gain from the class . one question asked whether they understood the feeding dynamic approach after the class to determine whether it was delivered in a clear and informative manner . the remaining three questions asked about their acceptability of the feeding dynamic approach , that is , the extent mothers believed that this approach would be beneficial for children , started feeding their children according to this approach , and planned to continue feeding their children according to this approach . the class content , adapted from ellyn satter 's work on caregiver / child division of feeding responsibility , focused on how to ( a ) implement each of the caregiver roles ( i.e. , what food is offered , where food is eaten , and when food is eaten ) and ( b ) allow and support the child in carrying out his / her roles ( whether to eat , what and how much to eat of the food offered ) [ 7 , 8 ] . she defined each role , emphasized the benefits of carrying out and supporting the roles , and provided step - by - step guidance on implementation . for example , in presenting the caregiver role of where food is eaten , the instructor recommended the caregiver designate an area in the home where all food and drink can be consumed except water . the instructor presented the benefit of undertaking such an action first from a caregiver perspective ( e.g. , you will have a cleaner home ) and then from the child 's perspective ( e.g. , if you maintain this rule in your home , your child will learn to associate eating with specific areas in the home at an early age and limit the likelihood he / she will eat in front of the tv or bedroom ) . she advised caregivers to have a family discussion about the action ( e.g. , limiting where food and drinks are consumed to a designated area ) a couple of days before the change and present the change as an opportunity for the family to encourage each other for the shared benefit of a cleaner home . she recommended that the caregiver and family select a designated area in the home for food or drinks ( preferably the kitchen ) . the instructor elicited input and problem - solved challenges and barriers raised by the participants , such as an uncooperative spouse or family , how to identify and prepare the physical space for the meal , or the absence of a kitchen or dining table in the home . she taught participants to share any potential exceptions to the rule ahead of implementation ( e.g. , we can eat in the living room but only on family fun nights ) . she advised them to try to implement each recommendation at least 80% of the time during the 46-week trial period . participants provided informal feedback on each recommendation for a significant proportion of the class time . we used paired t - tests to assess change in feeding behavior , between responses on the pre- and postintervention surveys . we applied the bonferroni adjustment to avoid a type i error due to multiple comparisons . because five items / scales on the maternal feeding behaviors from pre- to postintervention were skewed and/or kurtotic ( defined as skewness / standard error > |2| ) , we transformed these variables using reflect and square root transformations for four variables that were moderately negatively skewed and square root transformations for one variable that was moderately positively skewed . these transformations reduced skewness and kurtosis to acceptable levels , so paired - sample t - tests could be performed . effect size ( hedges ' g ) for each feeding behavior determined the magnitude in change following the class . we used hedges ' g in lieu of cohen 's d to estimate effect size because hedges ' g provides a better estimate for small sample sizes . however , the effect sizes are comparable in interpretation . specifically , per cohen , we considered an effect size of 0.20 a small effect , 0.50 a medium effect , and 0.80 a large effect . based on the independent questions developed by the research team ( range 15 with higher scores indicating greater familiarity , acceptability , and experience ) , mothers did not feed their children according to the feeding dynamic approach ( m = 2.00 , sd = 0.7 ) and indicated that they were not familiar with the approach ( m = 2.00 , sd = 0.9 ) prior to the intervention . after intervention , mothers reported that they understood the feeding dynamic approach ( m = 4.50 , sd = 0.6 ) , believed that children should be fed according to the feeding dynamic approach ( m = 4.22 , sd = 0.6 ) , planned to make lasting changes in how they feed their children ( m = 4.29 , sd = 0.5 ) , and were somewhat able to implement the changes ( m = 3.45 , sd = 1.0 ) . we noted that an effect size ( hedges ' g ) greater than 0.20 appeared in more than half ( 57% ) of maternal feeding behaviors ( table 1 ) , with the largest effect sizes ( hedges ' g 0.8 ) occurring with behaviors that represent the mother adopting her responsibility for determining what food is served , not using food as a reward , and not controlling her child 's intake . the mothers ' lowest scores were related to allowing children to carry out their eating roles . based on the cfq subscales , controlling behaviors such as restriction , pressure to eat , and monitoring decreased significantly from pre- to postintervention ( table 1 ) . at postintervention , mothers provided feedback on areas they thought would be challenging to implement or needed clarification . they recommended a guide on how much food to prepare or serve , without appearing to waste food . they anticipated that it would be difficult not to control or restrict their children 's food intake , and they had a preference to plate their children 's food at certain meals . mothers reported that they needed information on nutrition label reading , were insistent that label reading would help them be more knowledgeable when purchasing food , and verbalized that label reading should be a key component of any nutrition intervention . they identified commonly anticipated barriers , which included how to implement the recommendations with older children and nonsupportive family members , how to share the approach with extended family members who may also care for the child , and how to talk with their children about hunger and satiety . despite the small sample size , there was an improvement in behaviors aligning with the feeding dynamic approach following the class ( table 1 ) . guided by our prior work in this area [ 9 , 20 , 30 , 31 ] and results from study 1 , a research team of two dietitians , a physician , a curriculum expert , and psychologist developed the 6-lesson fdi . we designed study 2 to evaluate the fdi program content in three evaluations over six months and finalize its content . an evaluation team of three dietitians , five health educators , and a public health specialist from the university extension program in eight rural and urban ohio counties conducted the initial program evaluation . age of evaluators ranged from 33 to 56 years , and all were caucasian , had taught families for a minimum of five years , and currently worked with low - socioeconomic clientele of different ethnicities . in this initial evaluation , we assessed the evaluators ' perceptions about the feeding dynamic approach , the likelihood of their clients adopting these roles , and how best to present the material and identify benefits and challenges . they evaluated each lesson for content , ease of teaching , applicability for families , and appropriateness of supporting materials . the evaluators spent one day with the research team reviewing the fdi framework and content . they completed written and verbal feedback on each lesson and provided feedback during discussions with the research team . subsequently , a group of five reviewers , which included parents and two of the initial evaluators , conducted the second and third program evaluations . their ages ranged from 26 to 35 years , two had children who were toddlers and preschoolers , and one parent had a child who was overweight . in these second and third evaluations , we refined the fdi content based on results from the literature reviews , the pilot study ( study 1 ) , feedback from the evaluators , and research on feeding dynamics [ 9 , 20 ] . we structured each session to last 3 - 4 hours , not including time spent reviewing the material prior to the meeting . the evaluators reported all the caregiver and child roles in the feeding dynamic approach would be applicable for their clients . two evaluators expressed concern that allowing children to determine how much to eat would be challenging for parents who have children with impaired satiation . however , they all reported they would feel comfortable teaching the fdi content after only a brief training session . the final fdi content included information that ( a ) caregivers are responsible for offering nutritious foods and exposing children to new foods ( the what ) , providing structured snack and mealtimes to decrease indiscriminate snacking or grazing ( the when ) , identifying designated areas for eating or drinking within the home ( the where ) , and sitting and eating with children and keeping the eating atmosphere pleasant ( family meals and role modeling ) and ( b ) children are responsible for what to eat and how much ( or even whether ) to eat from the food provided ( table 2 ) . we also included evidence - based lifestyle messages , for example , reducing sweetened beverages , having family meals , serving balanced meals , decreasing fast food consumption and eating out , reducing tv viewing , and increasing physical activity in the fdi [ 1 , 32 ] . in the fdi , we discouraged tactics such as drinking water before meals , waiting 20 minutes between servings , or putting down the fork between bites for the sole purpose of food restriction . we also discouraged offering effusive praise like clapping hands , making smiley faces , or offering rewards for eating , as these behaviors constitute pressure to eat and may promote food consumption in the absence of hunger . instead , we incorporated techniques on how to use neutral phrases , such as you must have enjoyed your macaroni and cheese tonight , rather than wow , that 's too much macaroni and cheese in the fdi curriculum . at each lesson these changes are essential as they may improve the mother 's self - efficacy in carrying out the recommendations and strengthen her perception that the fdi will enable her to feed her child well and help her child learn to eat well . in the final fdi curriculum , we added a module to help mothers recognize their own hunger and satiety cues and be mindful of their eating behavior to each lesson in response to results from a prior study that found mothers who had positive eating behaviors ( i.e. , those who ate intuitively ) were more likely to allow their children to carry out their own feeding roles . this addition provides an opportunity for role modeling , a social - cognitive theory ( sct ) construct used in the development of the fdi . we also incorporated feedback obtained from the 90-minute class ( study 1 ) . to address mothers ' concern about how much food to prepare or serve without appearing to waste food and control or restrict their children 's intake , we encouraged mothers to use at least 1.5 portions per child when cooking as a guide . after much debate , the team decided to allow mothers to plate some meals as family style meals may not be realistic for certain meals / settings and could have a varied effect on portion size and energy intake in some children . for plating , the fdi instructs mothers to provide approximately three - fourths of a portion size initially , allowing the child to have additional servings if requested . we used these guidelines to provide a consistent approach within the curriculum and facilitate mothers ' adherence . because mothers in study 1 were unanimous that nutrition label reading should be a key component of any nutrition intervention we presented nutrition label reading as a guide to help with balancing food choices through the day or week , rather than restricting intake or food choices . in response to their feedback about anticipated barriers and the diversity in feeding behaviors recommendations from the reviewers included incorporating more hands - on activities , use of video clips to demonstrate division of responsibility roles , strengthening the authoritative parenting component of the sessions , emphasizing issues around food security , and using more pictures in the handouts . there was significant debate about the use of video clips drawn from contemporary television shows to illustrate feeding and parenting styles , as some reviewers felt it would limit the use of the curriculum in resource - poor settings . the team decided to include these video clips as they demonstrated strong visual examples of the feeding roles . in addition , they felt that , with rapid technological advancement , this concern may be less relevant in the future even in resource - poor areas . with each review , we identified and incorporated learner objectives and processes in structuring the content ( table 3 ) . with these modifications , the fdi content deviated in significant ways from the trust model as proposed by satter [ 7 , 8 ] . in the final study , we piloted the final curriculum of fdi to assess whether mothers who received the intervention adopted the caregiver roles and decreased excessive controlling feeding behavior ( i.e. , restriction and pressure to eat ) . we piloted the comprehensive 6-lesson fdi over 12 weeks with a convenience sample ( n = 8) of mothers recruited through an email sent to a parent - teacher association for the local school district . we targeted this parent - teacher association because the mothers in this association had children in the targeted age range for the fdi , the school was situated in the same county as the childcare centers , and mothers lived near the facility where the fdi would take place to ensure that distance was not a deterrent to completing the fdi . the eighth mother withdrew prior to the start of the intervention due to family reasons . at each lesson , mothers set goals for home and provided feedback on the content in a pre- and posttest survey . we noted that sample characteristics in studies 1 and 3 are comparable in terms of child age , although mothers in study 3 were slightly younger and less educated than mothers in study 1 . the participants completed a survey prior to and following the classes that included items on demographics , maternal height and weight , the cfq , and the cfrs . the postsurvey included similar measures and the six questions on perception , acceptability , and experience with feeding dynamic approach . we used paired - sample t - tests to compare differences between responses on the pre- and postintervention surveys . mothers reported that they were not familiar with the feeding dynamic approach before the intervention ( m = 1.71 , sd = 0.7 on a scale ranging from 1 = strongly disagree to 5 = strongly agree ) . after the intervention , they agreed that children should be fed according to the fdi ( m = 4.00 , sd = 1.0 ) , strongly agreed that they understood the feeding dynamic approach ( m = 4.57 , sd = 0.5 ) , and indicated a willingness ( m = 4.14 , sd = 1.46 ) and a plan ( m = 4.43 , sd = 0.8 ) to continue to feed their children according to the fdi . mothers felt neutral with regard to whether it was difficult to feed their children according to the fdi ( m = 2.86 , sd = 1.2 ) and strongly agreed that the fdi should be used with all children , regardless of if they are overweight ( m = 4.43 , sd = 0.5 ) , thin or underweight ( m = 4.43 , sd = 0.5 ) , or average weight ( m = 4.43 , sd = 0.5 ) . therefore , these mothers ' data show that they viewed the fdi as both acceptable and fairly feasible . following the intervention , six of the seven mothers who completed the intervention reported less restrictive and pressuring practices on the cfq ( table 4 ) . concern over their children 's weight decreased following the intervention ( preintervention : m = 3.2 , sd = 1.4 ; postintervention m = 2.3 , sd = 1.2 ) . six of the seven mothers reported that they were able to implement the following strategies : making one meal for all family members ( instead of short order cooking ) , letting children choose what to eat from what is on the table , having children drink only water between meals and snacks , and having food off - limits between meals and snack times . five of the seven mothers reported that they were able to let the children decide how much they want to eat from what was served and when they were done with eating . for the two participants that indicated otherwise , one had not yet tried and the other did not want to try it . participant # 3 disagreed with the roles in a feeding dynamic relationship , especially the child 's roles . she was latino , normal weight , married , and college educated and had an 11-month - old child in addition to the 5-year - old child in the study . she expressed concerns about cultural appropriateness of some of the recommendations and shared it was rude for the child not to taste from what had been served . she strongly believed in the importance of parental control over all feeding decisions . in summary , all but one participant responded well to the 6-lesson fdi ; mothers were able to implement the recommendations , and the level of controlling feeding behaviors improved . we used the results gleaned from these studies to further refine the program by including ( a ) a section on how feeding behaviors may be perceived by the child , ( b ) a discussion on the intersection between fdi recommendations and cultural beliefs , ( c ) a review of parental and child feeding roles in each lesson to reemphasize the core concepts of feeding dynamics ( we used this review to obtain periodic feedback on participants ' progress and to encourage mothers who have not yet tried the recommendations to do so ) , ( d ) a 3-dimensional child - friendly stomach model that illustrates three stomachs in different states ( i.e. , hungry , full , and stuffed ) and a module to instruct mothers how to use the stomach model with their young children , ( e ) team exercises on meal planning using paper food models , and ( f ) physical activity resource handouts on relevant community physical activity resources and an indoor play activity sheet . the activity sheet consists of 4 - 5 aerobic activities such as running in place , which the child and family can perform in 3060-second intervals . the objectives of the fdi in delineating child and caregiver feeding responsibilities and incorporating what children are fed within the broader framework of how they are fed enable caregivers to achieve the overall goal of feeding their children well , an act that evokes strong emotions tied to a sense of accomplishment as a parent . first , we developed the fdi , an innovative program which incorporates evidence - based recommendations for childhood obesity and a core focus on feeding dynamics . from our studies , we modified and expanded on the feeding dynamic concepts by adapting them appropriately to be pragmatic , cognizant of the prevailing obesogenic environment , and responsive to the mother 's needs and diversity in the child 's eating behaviors and patterns . second , we uncovered that mothers were receptive to the feeding dynamic approach concepts , found them understandable , and were willing and able to implement the intervention at home . the rigorous stepwise development of the studies allowed us to incorporate a wide range of data , prior research , and participant feedback which strengthened the final fdi ; however , limitations exist . we used convenience samples to pilot test the intervention ; thus , the mothers in our samples may have been more receptive to an intervention than the general population . we used the newly developed caregiver feeding responsibility scale to assess the feeding dynamic components , which needs further validation in different populations . additional limitations include report bias because the study relied solely on maternal reports and some of the items and subscales had relatively large standard deviations , which could impact effect size levels . the fdi needs to be carried out in larger samples before definitive conclusions are made . finally , based on the feedback from the mothers , the evolving research on feeding and eating behaviors in young children , and our research , the final fdi program contains significant deviations from the trust model [ 7 , 8 ] these changes include the addition of a module on portion sizes to guide the amount of food to cook , lack of insistence on family style meals , and introducing label reading to guide selections of nutritious options . the addition of evidence - based lifestyle recommendations beyond feeding behaviors further strengthened the fdi , increasing its potential to be a promising and practical program for obesity prevention or treatment in young children . they include researchers ( a ) investigating the outcome of the fdi with a larger and diverse population , ( b ) studying the degree to which children can be taught to recognize hunger and satiety cues via parent - directed intervention versus a child - targeted intervention , ( c ) videotaping within the home to assess the feeding environment rather than relying on caregiver self - report , ( d ) using objective assessments of self - regulation such as the energy compensation and eating in the absence of hunger tests , ( e ) validating the acceptability and feasibility of the physical activity component , and ( f ) exploring short- and long - term effects of the fdi on the child 's anthropometrics and eating behaviors .

targeting feeding dynamics , a concept centered on the roles and interaction of the caregiver and child in a feeding relationship , may have significant potential for obesity intervention . the aim of this paper is to describe the 3-phase development of the feeding dynamics intervention ( fdi ) , an acceptability and feasibility study on implementing the feeding dynamic roles ( study 1 ) , development of the fdi content ( study 2 ) , and a pilot study on use of the 6-lesson fdi to promote behaviors consistent with a feeding dynamic approach ( study 3 ) . sample population was mothers with young children , 25 years old . an effect size ( hedges ' g ) greater than 0.20 was seen in more than half ( 57% ) of maternal feeding behaviors , with the largest effect sizes ( hedges ' g 0.8 ) occurring with behaviors that represent the mother adopting her roles of determining what food is served , not using food as a reward , and not controlling her child 's intake . there was a significant decline in pressure to eat behaviors ( 2.9 versus 2.2 , p < 0.01 ) and monitoring ( 4.1 versus 3.5 , p < 0.001 ) . the fdi emerged as an acceptable and implementable intervention . future studies need to investigate effects of the fdi on the child 's eating behaviors , self - regulation of energy intake , and anthropometrics .

the two membranes of the nuclear envelope , the inner nuclear membrane ( inm ) and outer nuclear membrane ( onm ) , are separated by a uniform distance of 3050 nm . to facilitate the import and export of cargos , the inm and onm meet at junctions containing nuclear pore complexes ( npcs ) . furthermore , the onm is contiguous with the er . in addition to its role in containing the genome , the nuclear envelope has been implicated in cell signaling and regulation of many important cellular functions , such as localization of nuclear proteins , organization of heterochromatin , and dna repair . the role of nuclear envelope defects in a wide - ranging collection of human diseases is drawing increased attention to this complex cellular structure . in addition to npcs , connections between the inm and onm are also formed by linkers of nucleoskeleton and cytoskeleton ( linc ) complexes , consisting of sad1p , unc-84 ( sun ) proteins in the inm interacting with klarsicht , anc-1 , and syne homology ( kash ) proteins ( also known as nesprins ) in the perinuclear space ( pns ) . sun and kash proteins interact via conserved domains at their c - termini in the pns . sun proteins interact with lamins in the nucleoplasm and kash proteins recruit cytoskeletal components to the onm . in this way , linc complexes stabilize the nuclear envelope against cytoplasmic forces and facilitate nuclear positioning in a variety of cellular processes , including cell division , establishment of cellular polarity , fertilization , cellular migration , and differentiation . furthermore , linc complexes have been hypothesized to maintain the even spacing between the 2 membranes of the nuclear envelope . in caenorhabditis elegans somatic cells , the sun protein unc-84 interacts with the kash protein unc-83 , which recruits microtubule motors kinesin and dynein to facilitate nuclear migration . in the early embryo , hypodermal precursors line up in 2 rows across the dorsal midline . as cells intercalate and elongate to form one row of 16 cells , the nuclei migrate contra - laterally to the opposite side of the dorsal midline . the hypodermal cells eventually fuse , and in the resulting syncytia , hypodermal nuclei are anchored evenly throughout . in unc-84 or unc-83 mutant embryos , the elongation and intercalation of cells proceeds normally , but the nuclei fail to move from their initial positions . as the embryo continues to develop , mutant nuclei that fail to migrate are passively pushed toward the dorsal midline by underlying muscle cell migrations and can be observed by dic microscopy in the dorsal cord of the l1 larva . in the adult hypodermal syncytia , after cell fusion , in unc-84 or anc-1 mutants , the nuclei are unanchored and are free to drift throughout the syncytia , often clustering in groups . most sun proteins are large , with more than half of the protein residing in the pns . the c - terminal 200 amino acids contain the conserved sun domain , which trimerizes into a cloverleaf structure with the n - terminal stalk formed by a right - handed trimer coiled - coil . while the structure of the linker domain between the transmembrane domain and the trimeric coil is unknown , it has been proposed that the trimeric coiled - coil continuously extends to the transmembrane domain , forming a rod approximately 45 nm long . such an extended coil structure would be suitable to span the space between the onm and the inm and serve as a " molecular ruler " to regulate even spacing of the nuclear envelope ( fig 1a ) . interestingly , several divergent sun proteins , including human sun3 - 5 , which are restricted to the testis , and c. elegans sun-1 , which is restricted to the germ line , are predicted to have much smaller luminal domains than those of their somatic counterparts . the prediction is that tissues expressing these sun proteins would display narrower nuclear envelope spacing ( fig . 1b ) , but nuclear envelope spacing in those tissues has not been directly examined . sun proteins are depicted in the inner nuclear membrane ( inm ) with their nucleoplasmic domain in yellow and their conserved sun domain in red . sun domains bind kash proteins ( blue ) in the outer nuclear membrane ( onm ) . npc are nuclear pore complexes where the inner and outer nuclear membranes are connected . ( a ) the linker domains of human sun1/2 and c. elegans unc-84 , between the trans - membrane span and the sun domain , are predicted to form trimeric rods that span the 4050 nm distance between the inner and outer nuclear membranes . ( b ) shorter sun proteins ( human sun35 and c. elegans sun-1 ) are predicted to have shorter luminal domains and , as a result , narrower nuclear envelope spaces . ( c ) in the absence of linc complexes , lack of connection of the cytoskeleton to the nucleoskeleton is expected to cause the onm to separate from the inm . sun proteins are depicted in the inner nuclear membrane ( inm ) with their nucleoplasmic domain in yellow and their conserved sun domain in red . sun domains bind kash proteins ( blue ) in the outer nuclear membrane ( onm ) . ( a ) the linker domains of human sun1/2 and c. elegans unc-84 , between the trans - membrane span and the sun domain , are predicted to form trimeric rods that span the 4050 nm distance between the inner and outer nuclear membranes . ( b ) shorter sun proteins ( human sun35 and c. elegans sun-1 ) are predicted to have shorter luminal domains and , as a result , narrower nuclear envelope spaces . ( c ) in the absence of linc complexes , lack of connection of the cytoskeleton to the nucleoskeleton is expected to cause the onm to separate from the inm . the hypothesis that linc complexes may serve as molecular rulers for nuclear envelope spacing was primarily based on electron micrographs of hela cells either depleted for sun1 and sun2 or expressing a soluble dominant - negative sun domain fragment , showing large distortions of the pns and 100 nm separation of the onm away from the inm ( fig . however , hela cells in culture are in a very different environment than most nuclei in vivo . because they make extracellular contacts to a hard surface , stresses at the cell surface can cause long - range force propagation , extending to the nucleus and beyond . as a result , nuclei are usually more spherical and are presumably not subject to the same intracellular forces . unc-84 is the only sun protein expressed in somatic tissue , yet null mutants are viable and fertile . in unc-84(null ) tissues , both unc-83 and anc-1 fail to localize , which allowed us to examine nuclei completely lacking linc complexes . high pressure freezing and electron microscopy techniques are well established in c. elegans , which allowed us to expand our observations to a variety of tissues and developmental stages . the defects of the unc-84(null ) mutant can be fully rescued by an unc-84 transgene , which allowed us to express truncated forms of unc-84 as the sole somatic sun protein in an otherwise null background and to examine their effects on nuclear migration . we previously used this technique to locate the transmembrane domain in unc-84 , as well as multiple sorting motifs in the n - terminus required for inm localization . the absence of linc complexes caused significant deformations of the nuclear envelope in hela cell culture , but whether a similar phenotype would be observed in an animal lacking linc complexes remained an open question . the hypothesis that linc complexes serve as molecular rulers suggests that a sun - less animal would display gross nuclear envelope defects in most or all tissues throughout development . we therefore carried out a series of experiments to characterize the role of the sun protein unc-84 in the architecture of the nuclear envelope . we began by examining pre - morphogenesis embryos , near the stage where unc-84 and unc-83 function together to move nuclei contra - laterally across the dorsal midline of the developing hypodermis . in most wild type nuclei , the pns is consistently 3050 nm in width , in agreement with previously published results . surprisingly , nuclei from the null mutant unc-84(n369 ) strain are not significantly different than the n2 wild type laboratory strain . the pns of most unc-84 mutant nuclei are evenly spaced throughout , and are not significantly wider than wild type . similarly , in the first larval stage , most nuclei , including those of the pharynx and hypodermis , have normal nuclear envelope spacing in both wild type and unc-84(n369 ) animals ( fig . therefore , in contrast to hela cells , where an absence of linc complexes results in extreme separation of the onm away from the inm , in most c. elegans tissues , removal of linc complexes has little to no effect on nuclear envelope spacing . cells in the interior of the animal likely have less rigid cell - cell contacts than tissue culture cells , resulting in less overall strain to the cytoskeleton . figure 2.unc-84 is required for even nuclear envelope spacing only in body wall muscle cells . ( a ) hypodermal larval nuclei in the unc-84(n369 ) animal do not display blebbing of the nuclear envelope . ( b - c ) however , large distortions of the nuclear envelope were observed at the ends of body wall muscle nuclei ( arrows in b ) and occasionally , along the sides ( arrow in c ) . ( a ) hypodermal larval nuclei in the unc-84(n369 ) animal do not display blebbing of the nuclear envelope . ( b - c ) however , large distortions of the nuclear envelope were observed at the ends of body wall muscle nuclei ( arrows in b ) and occasionally , along the sides ( arrow in c ) . larva , the best candidates for a cell type with increased intracellular tension resulting from cellular shape changes are striated body wall muscles . in contrast to most other tissues where nuclei are nearly spherical , muscle nuclei are oblong , with the long axis oriented parallel to the muscle fibers . the pns of muscle nuclei are an even 4050 nm width all around the nuclei , although in some nuclei , the pns narrowed along the long axis and/or widened at the ends . we then examined unc-84(n369 ) muscle nuclei to determine if linc complexes play a role in stabilizing the nuclear envelope space in regions where forces appear to be highest ( fig . indeed , unc-84 mutant muscle nuclei have pns widths of 100500 nm . as with wild type nuclei , the largest distortions are at the ends of nuclei , although on occasion , smaller blebs are observed on the long axes ( arrow in fig . 2c ) . each nucleus was observed over multiple serial sections , which allowed for observation of the change in shape of the blebs section by section . in the z - plane , the blebs start out small , grow larger near the centers of nuclei , and are imperceptible at the bottom surfaces of nuclei . therefore , body wall muscle is the only c. elegans tissue of the wide variety of embryonic and larval tissues we observed that produces large nuclear envelope distortions similar to those observed in hela cells . the observation that most nuclei in the unc-84(n369 ) display normal nuclear envelope spacing does not in and of itself contradict the hypothesis that linc complexes set the dimensions of the pns . because unc-84 is required to recruit unc-83 to the onm , unc-84(n369 ) nuclei do not have unc-83 at the onm and therefore lack a direct connection to motors that pull on the nuclear envelope in wild type nuclei . a direct test of this hypothesis required the introduction of an abnormally sized sun protein that retains the ability to recruit and interact with kash proteins . the hypothesis predicts that the pns should then change to accommodate this mutant sun protein in all tissues where it is expressed . the majority of the linker domain of unc-84 in the pns between the trans - membrane span and the conserved sun domain bears little sequence similarity to other sun proteins . additionally , a hybrid protein with the c. elegans unc-84 nucleoplasmic domain fused to the human sun1 luminal domain , which contains 2 predicted coiled - coil domains , functioned normally in hyp7 nuclear migration , suggesting the linker domain is functionally conserved from worms to mammals . these two findings are consistent with a model where the linker domain of unc-84 assumes a helical structure . also consistent with this model is our finding that deletion of 15 amino acids immediately preceding the sun domain of unc-84 , which correspond to the 15 amino acids of human sun2 that form the coiled stalk of the trimer , completely disrupts recruitment of unc-83 . intriguingly , deletion of approximately 300 amino acids of the unc-84 linker domain ( residues 556861 between the transmembrane span and the conserved sun domain ; fig . 3a ) nonetheless produced a functional unc-84 protein that was able to recruit unc-83 to the onm and move nuclei . this unc-84 truncation therefore provided the perfect tool to directly test the hypothesis that sun proteins set nuclear envelope spacing . the nuclear envelope spacing in embryos expressing unc-84(556861 ) is not noticeably narrower than wild type . nor is there significant narrowing of pns width in the muscle nuclei of larvae . figure 3.two hypotheses for how unc-84(556861 ) interacts with kash proteins without narrowing the perinuclear space . ( a ) schematics of full - length unc-84 and the functional truncation mutant unc-84(556861 ) . ( b ) linc complexes may be spaced far apart and localized pinching together of the 2 membranes may not be resolvable by tem . ( c ) the luminal domain of unc-84(556861 ) may be fully extended to accommodate the normal 4050 nm perinuclear space . two hypotheses for how unc-84(556861 ) interacts with kash proteins without narrowing the perinuclear space . ( a ) schematics of full - length unc-84 and the functional truncation mutant unc-84(556861 ) . the transmembrane domain ( tm ) is depicted in black . ( b ) linc complexes may be spaced far apart and localized pinching together of the 2 membranes may not be resolvable by tem . ( c ) the luminal domain of unc-84(556861 ) may be fully extended to accommodate the normal 4050 nm perinuclear space . our results suggest that rather than setting nuclear envelope spacing , sun proteins have evolved to span the distance between the inm and onm . the question remains : if sun proteins do not determine nuclear envelope spacing , what does ? npcs certainly play a role , as the perinuclear space narrows around npcs in nuclei without linc complexes . however , our results , as well as sun protein knockdown in tissue culture , indicate that npcs are not sufficient to maintain 4050 nm spacing away from the pores . the answer may lie in the nuclear envelope 's closest relative the er . the membranes of the nuclear envelope share many properties with the er and the shape of the nuclear envelope echoes the shape of er . during interphase , er membranes are mostly in sheets , and polyribosomes are thought to provide the force to keep them flat . er sheets also have a characteristic spacing , although it is observed to be approximately twice as large as that of the perinuclear space in mammalian cells . the morphology of er sheets is maintained by the luminal spacer climp63 ; overexpression of climp63 results in an increase of er sheets when overexpressed . intriguingly , and in agreement with our results , depletion of climp63 does not , in fact , result in blebbing of er membranes . rather , the intermembrane distance in the er is reduced by half and more closely approximates the nuclear envelope distance , which is unaffected by climp63 levels . this suggests that climp63 functions to expand the width of er sheets to make them bigger than the default state found in the nuclear envelope . as the onm is contiguous with the er , polyribosomes could similarly be maintaining its flatness in the absence of linc complexes . chromatin could provide a similar force on the nucleoplasmic side of the nuclear envelope . in most tissues , these forces may be stronger than forces applied on the nucleus by the rest of the cell , such that even in the absence of sun proteins , the nature of the membranes is to lay flat and evenly spaced . therefore , the even spacing of the nuclear envelope in the absence of linc complexes may be similar to the default spacing for er sheets lacking climp63 . alternatively , there may be other inner nuclear membrane proteins with large luminal domains that mediate perinuclear spacing . by contrast , body wall muscle cells , or cells adhered to a dish , experience more mechanical strain than most in vivo cells . these forces are presumably strong enough to overcome the forces working to keep the nuclear envelope flat in the absence of linc complexes . another question is if the distance between the onm and inm is an inherent property of the membranes , how can unc-84(556861 ) mutant interact with kash proteins without narrowing the pns ? membranes could be pinched inward in areas too small to be resolved by em ( fig . if only a few , sparse linc complexes are required to move a nucleus ( fig . 3b ) , the pinching that results might not be resolvable under the sectioning and electron microscopy conditions we used . alternatively , the remaining 6080 residues could be fully stretched out . while the full - length unc-84 protein may contain a trimeric helical rod that spans the distance between the onm and inm , the unc-84(556861 ) mutant might not assume the same conformation . it is possible that instead of a rod , each linker region is an unordered polypeptide chain , with a greater capacity to extend than the full - length version ( fig . if each residue could fully extend to 3.8 in an open peptide backbone , the remaining residues in the linker domain could reach 2025 nm . adding on an additional 1415 nm ( 5 each for the onm and inm and 45 for the sun domain ) , gives a total of 40 nm , similar to the distances observed in nuclei expressing unc-84(556861 ) . the observation that the absence of linc complexes causes nuclear envelope architecture defects in cells under strain could have implications for understanding some human diseases . in c. elegans , nuclear envelope defects one such disease , emery - dreifuss muscular dystrophy ( edmd ) , is associated with mutations in several nuclear envelope proteins , including nesprin-1 and -2 and sun1 . edmd patients display early tightening of the elbows , achilles tendons , and neck , followed by progressive muscle wasting in the limbs and associated dilated cardiomyopathy . the mechanism by which these mutations cause disease in a tissue - specific manner with variations from patient to patient is poorly understood . we compared the swimming motility of unc-84(n369 ) larvae , near the same stage where nuclear envelope defects were observed by tem , to wild type control animals . using both manual and computational scoring techniques the unc-84(n369 ) notably , the motility defects we observed can not be attributed to the loss of ventral cord neurons that has been previously described , as the required nuclear migration event in precursor ( p ) cells occurs at a later stage in development . thus , we have identified a novel locomotion defect in the unc-84(n369 ) mutant consistent with a muscle contraction defect . as the structure of the muscle fibers in the mutant animal were not distinctly different from wild type , the nuclear envelope architecture defects could contribute in some way to the locomotion defects in live animals . however , a neuronal defect in a different cell lineage could lead to the locomotion disorder . a potential candidate is the lumbar ganglion neuron pvq , which is mispositioned in 15% of unc-84(n369 ) animals . nonetheless , our results open a new area for exploration in better understanding the relationship between muscle disease and nuclear envelope architecture . our work has clarified the prevailing model for the role of sun proteins in nuclear envelope spacing . sun proteins are necessary to maintain the even spacing between the inm and onm in cells under high mechanical strain , but are not needed in other cells , where the inherent characteristics of er - derived membranes are sufficient to keep them flat and evenly spaced . we also have also uncovered a potential functional consequence of nuclear envelope architecture defects in muscle tissue . further experiments are needed to better understand the nature of this connection and the role it might play in human disease . specifically , examination of nuclear envelope ultrastructure in tissues from mouse muscular dystrophy models , as well as patient samples , should be informative . we thank erin tapley ( uc davis ) , kent mcdonald ( uc berkeley ) , and benjamin cain ( uc davis ) , our co - authors on the original manuscript , for their wonderful scientific collaborations . cain is supported by american cancer society illinois division postdoctoral fellowship pf-13 - 094 - 01-cgc .

the nuclear envelope consists of 2 membranes separated by 3050 nm , but how the 2 membranes are evenly spaced has been an open question in the field . nuclear envelope bridges composed of inner nuclear membrane sun proteins and outer nuclear membrane kash proteins have been proposed to set and regulate nuclear envelope spacing . we tested this hypothesis directly by examining nuclear envelope spacing in caenorhabditis elegans animals lacking unc-84 , the sole somatic sun protein . sun / kash bridges are not required to maintain even nuclear envelope spacing in most tissues . however , unc-84 is required for even spacing in body wall muscle nuclei . shortening unc-84 by 300 amino acids did not narrow the nuclear envelope space . while sun proteins may play a role in maintaining nuclear envelope spacing in cells experiencing forces , our data suggest they are dispensable in most cells .

dental caries in primary teeth has been widely studied in many countries worldwide since it is known to be one of the most common oral diseases of childhood . however , figures to quantify the prevalence of such disease in palestine are almost inexistent . it is extremely important to study the prevalence of dental caries in preschool children in palestine to be able to provide a clear picture about the situation of oral and dental health in such population so as to help the local authorities to make future plans to reduce as much as possible the incidence of dental caries . many countries have developed different strategies to reduce or even eradicate dental caries from preschool children following dental caries surveys . some have already obtained excellent results using water and salt fluoridation , dental health education , school oral health program , and so forth . in palestine , dental caries surveys are rare and are unable to draw the attention of the local health authorities to take any reaction in fighting such common disease . the aim of this study is to give an idea about the actual situation of dental caries among preschool children in palestine . the results found here would probably be helpful in making future plans concerning the best methods to lower the level of such oral disease and make necessary improvements in the palestinian health system especially in the field of oral and dental health problems . the prevalence of dental caries in primary teeth is commonly evaluated using the dmft index . the number of decayed , missing , and filled primary teeth is calculated in each child to obtain a sum that is known to be the mean dmft score in such child . children of both sexes aged between 4 years and 5 years ( n = 1376 ) who were accompanied by their parents to the dental centre of the arab american university of jenin during the first 10 months of 2013 were examined clinically by one of the three calibrated examiners in the clinics of pediatric dentistry department after gaining the permission of the parents . as the families come from different geographic areas of northern palestine , the examined population was subdivided as shown in table 1 . medical and dental histories were taken for each child by the help of one of the parents before starting the clinical examination . the parent was asked about the mother 's level of education ( elementary school , secondary school , college graduated , or postgraduate studies ) . children who had previous history of receiving any specific organized preventive treatment were excluded from the study . clinical examination intraorally was achieved using sterile dental mirror and sterile dental explorer under dental unit 's light . the presence of cavitation has been considered to be indicative of carious lesion in accordance with the criteria recommended by the who in 1997 [ 24 ] . teeth which were missing due to trauma or congenitally absent teeth were excluded from the data processing ; therefore , they did not contribute to the final score . the number of dental restorations has also been registered for each child which contributed to the f component in the dmft score . the dmft scores of the clinically examined children were registered as shown in table 2 . it was found that only 330 children ( 24% ) were caries - free ( dmft = 0 ) at the age of 4 - 5 years while the other 1046 children have already experienced dental caries at this age . as for the ( d ) component , it was found that 932 children have had at least dental decay or caries in one or more primary teeth at the cavitation stage by the age of 4 - 5 years as shown in figure 1 . however , the number of decayed teeth in the whole population studied here was 2895 . the mean dt would be 2.10 while the number of children who had at least one missing primary tooth due to dental caries was only 98 representing 7.1% of the overall sample . the figure below shows the prevalence of missing teeth ( mt ) in the studied population ( figure 2 ) . the number of missing teeth in the whole studied population was 163 . when looking to the number of filled teeth representing the ( f ) component here , it was found that the number of children who had at least one restored primary tooth ( filled tooth ) was 154 representing 11.2% of the whole sample as shown in figure 3 , while the total number of restored teeth was 325 . when asked about their level of education , mothers of examined children were divided into 4 groups as shown in table 3 . as mentioned above , the number of children who had at least one restored ( filled ) tooth was 154 . mothers of such children have been found to have a high level of education in comparison to mothers of children who have decayed ( cavitated ) teeth or missing teeth ( table 4 ) . correlation between mother 's level of education and the presence of fillings in her child 's mouth has been found to be statistically significant ( p value < 0.05 ) . the overall caries prevalence in the study population was 76% with an overall mean dmft score of 2.46 of which decayed component is 2.10 , missing component 0.12 , and filled component 0.24 . difference between males and females in caries prevalence at the age of 4 - 5 years has not been found to be significant as demonstrated by table 5 . as seen above , caries prevalence in primary teeth of 4- to 5-year - old girls is 74.6% which is very close to that of boys at the same age ( 77.2% ) . the table below shows the mean dmft scores for both sexes ( table 6 ) . the prevalence of dental caries in primary dentition in 4- to 5-year - old children in northern palestine would be about 76% which means that almost 3 children out of 4 have already experienced dental caries by the age of 5 years in northern palestine . figures found here seem to be far from the who / fdi goals for 2000 ; that is , 50% of 5- to 6-year - old children should be caries - free . when compared to other developing countries , recent studies in pakistan and india revealed that caries prevalence in preschool children in different regions of both countries is about 5060% which is considered much better than what we found in our study here [ 69 ] . on the other hand , caries prevalence in preschool children in some arab countries like saudi arabia has been found to be high ( approaching the 75% ) [ 1012 ] . in the united arab emirates , a high prevalence of caries among preschool children has been registered as well ( 7080% ) [ 13 , 14 ] . kuwaiti kindergarten schoolchildren who are caries - free at the age of 4 - 5 years do not represent more than 2432% of such population according to a national epidemiologic survey done in kuwait in 2010 . these findings are almost similar to what we found here in northern palestine , although they are still far from the figures published by many developed countries as we could find in the united kingdom ( 4060% caries prevalence in 5-year - old children ) or in sweden ( 69% of 3-year - old preschool children are caries - free in 2003 ) as well as in brisbane , australia ( 66% of 4- to 6-year - old children are caries - free in 2002 ) [ 1618 ] . a probable explanation for such discrepancy can be the following : inequality in economic conditions and resources , effective fluoridation policy , efficiency of healthcare system , availability and consumption of refined sugars , standard of oral health awareness among public , dietary and oral hygiene lifestyles , and motivation status of parents and children . as expected , highly educated mothers tend to take their children to the dentist early in their lives so as to make regular check - ups and treat dental caries as soon as it appears , which best explains the high f component ( ft ) in case of children of college - graduated mothers . the mean dmft scores as well as caries prevalence in primary teeth of 4- to 5-year - old palestinian children reflect a considerable defect in the oral health care at home and at school , showing a real need to establish school oral health programs in the different regions of northern palestine [ 1 , 7 ] . such programs are possible to implement in cooperation with the ministry of health so as to be able to finance them properly . it is always possible to prevent dental caries in primary dentition and lower the caries prevalence in young children in northern palestine starting with good dental health education of the parents and teaching them how to take care of their children 's teeth as soon as they start to erupt . emphasis on babies feeding habits as well as the use of kids toothpastes is also important [ 1 , 20 ] . parents should be encouraged to take their children to the public dental clinics directed by the ministry of health or to their private dentist before the age of 1 year . they would be able to have an idea about dental health education programs and topical fluoride application campaigns . preventive measures campaigns including topical fluoride application , fissure sealants , and healthy diet promotion would be a lot of help to improve the situation of the oral and dental health in young children who go to nurseries and kindergartens . it is always possible to find volunteer dentists locally or to employ freshly graduated dentists to provide preventive measures to children in nurseries and kindergartens in different northern palestinian districts including fluoride varnish application to all primary teeth as early as possible , educating the teachers as well as the parents about the best hygiene methods and toothpastes to be used by preschool children , making regular dental check - ups to the children , and giving them advices about healthy nutrition .

aim . to determine the prevalence of dental caries among a representative sample of preschool children ( 4 - 5 years old ) who were accompanied by their parents to the dental centre of the arab american university in jenin whether they come seeking dental treatment or as visitors with adult patients . materials and methods . 1376 children of both sexes were investigated by three calibrated and trained examiners for dental caries using the dmft index according to the who method . results . 76% of the studied children have already experienced dental caries at the age of 4 - 5 years ( 1046 children ) . the mean dmft score was found to be 2.46 while the other 24% of children were caries - free . there was no significant difference in caries prevalence between boys and girls ( 77.2% versus 74.6% ) . children of highly educated and college graduated mothers were found to have more fillings ( restored teeth ) in comparison to those who belong to mothers who did not finish their secondary ( high school ) education . conclusion . the number of caries - free children in northern palestine is still far from numbers found in developed countries . there is a real need to make improvements at the level of parents dental health education , application of preventive measures , and dietary habits among preschool children .

drywood termites cause significant damage to wood in structures in the united states , with two species , incisitermes minor ( hagen ) and cryptotermes brevis ( walker ) , being responsible for the majority of damage ( su and scheffrahn , 1990 ; grace , 2009 ) . the economic cost of control and repair of damage is second only to that for subterranean termites ( su and scheffrahn , 1990 ) . remedial control of drywood termites in the united states relies primarily on either ( 1 ) fumigation of the entire structure with a toxic gas or heated air , or ( 2 ) localized chemical or physical treatments designed to eradicate small , localized colonies ( lewis and haverty , 1996 ; lewis , 2008 ; lewis and rust , 2009 ) . fumigation treatments are likely to kill all of the termites in a structure , while localized treatments can destroy all termites in a colony , provided the treatment is delivered to the entire gallery system . the size , number , and dispersion of drywood termite colonies in a structure can vary greatly , depending on the age of the infestation and the success of preventative or remedial treatments . drywood termite colonies also are considered single piece nesters , i.e. , they nest within their food source and do not forage from the nesting site to a food source ( abe , 1987 ) . in fact , large , dispersed colonies ( or even small colonies ) can live in a single piece of wood or in multiple pieces of wood that are joined together ( grace et al . , drywood termites are cryptic , seldom leaving obvious or visible external signs of their presence in wood . a commonly used sign for determining the presence of drywood termites is the occurrence of fecal pellets , ejected through a kick - out hole in the external surface of wood from the internal galleries ( ebeling , 1975 ) . these pellets often are found as conical piles or are scattered on horizontal surfaces below infested wood . these hexagonally sided pellets are diagnostic for drywood termites , and can be used to distinguish damage from that by other wood - destroying insects ( ebeling , 1975 ; moore , 1992 ) . grace and yamamoto ( 2009 ) demonstrated the relationship between the cellulose and lignin content of the food utilized by small groups of c. brevis and incisitermes immigrans ( light ) , and the quantity of fecal pellets produced over time . they also discussed the use of the size and number of fecal pellets for estimating both size and age of drywood termite colonies . drywood termites excrete feces in the form of hard , even - shaped fecal pellets . these fecal pellets contain the same mixture of hydrocarbons as the insects that produced them , albeit in slightly different proportions ( haverty et al . , 2005 ) . because cuticular hydrocarbons are species specific in termites ( page et al . , 2002 ) rather than simply signaling the general presence of termites or providing a diagnosis of the species of termite inhabiting the wood , we postulated that these pellets could be chemically characterized so as to determine the status of a colony as active ( alive ) or inactive ( dead ) . here , we report quantification of the hydrocarbons in pellets of i. minor aged for up to 1 year after they were produced . we document the changes in proportions of selected hydrocarbons as an indication of the length of time since the pellets were excreted . collection of termites and preparation of termite containment unit termites , i. minor , were removed from one naturally infested board ( 98.9 13.3 271.8 cm ) collected on 19 july 2006 from lakeview , california , and stored at the university of california richmond field station . the board was cut across the grain into pieces , 58 cm thick , and stored at room temperature . a wood chisel was used to separate pieces of wood into smaller pieces , 0.51.0 cm thick . all remaining live termites , including soldiers and primary reproductives ( alates ) , were placed in a termite containment unit ( tcu ) . termites thus collected were likely from a large mixed colony ( booth et al . , 2010 ) or from multiple colonies . we were not able to assign the various galleries in the wood to any particular colony.fifteen birch tongue depressors were bundled together , and three equally spaced holes drilled across the length of the bundle using a 2.8-mm bit . bamboo skewers , 1013 cm in length , were inserted into each of the three holes in the bundle of tongue depressors . spaces , 36 mm , were left between each tongue depressor allowing termites access to all tongue depressors . two sets of skewered tongue depressors were placed into a clean plastic container ( 17.5 12.5 6 cm ) , one on top of the other , such that the tongue depressors on the top layer fit into the gaps created by the tongue depressors on the bottom layer . tongue depressors were lightly misted with water , and then 6,662 drywood termites ( a mixture of pseudergates or workers , alates , and soldiers ) were placed in the tcu . tcus , with termites , were maintained in a dark cabinet in the laboratory under ambient conditions prior to collection of fecal pellets . a single colony or a mixture of two or more colonies , representing a single location within california , was prepared in this manner . pellet collection and aging process after all the tcus had acclimated to laboratory conditions over several weeks , new holding chambers were prepared . all wood debris , pellets , dead termites , and damaged tongue depressors were discarded . the termites in the new holding chambers were maintained in the laboratory under ambient conditions for 2 weeks . at the end of this period , all pellets were removed , and sub - samples collected and readied for the aging study . concurrently , three samples of 20 workers , three samples of 20 alates , and one sample of 20 soldiers were also collected for hydrocarbon analysis . live termites were placed in a 20-ml scintillation vial and frozen until extraction.fecal pellets were separated from debris by sequentially sifting them through successively smaller sieves ( haverty et al . , 2005 ) . thus , all substances such as hand lotion , lip balm , parafilm , and waxed paper were kept away from the work area . gloves were worn when handling pellets , and implements that came in contact with pellets were wiped with a paper towel dampened with absolute ethanol to remove any oils or waxes . pellets were separated from fine debris by removing individual pellets with forceps or with an aspirator , until a sample weighing approximately 200 mg was obtained.in developing this protocol we made one estimate and one critical assumption . the estimate was that at least 1,000 pellets were needed for each hydrocarbon analysis ( based on preliminary analyses of pellets collected from drywood termites maintained in our laboratory ) . ( 1997 ) using c. brevis and i. snyderi ( light ) from southern florida . in that study , 40 i. snyderi ( pseudergates or workers ) produced 573 pellets over 4 weeks , slightly less than 150 pellets / wk or about 3.5 pellets / individual / wk . in a study with small groups of c. brevis and i. immigrans , grace and yamamoto ( 2009 ) found that these species produced 4.9 to 7.0 pellets / individual / wk . for our study , we assumed that i. minor would produce pellets at roughly the same rate and , therefore , we needed about 3,000 to 5,000 individuals in a tcu for this study . we prepared one tcu to collect the requisite quantity of fecal pellets.four sub - sampling intervals , each replicated three times , were used : 0 , 30 , 90 , and 365 days from the initial collection date . sub - samples were stored in clean , 20-ml scintillation vials , sealed with 1.5 1.5 mm mesh screen . vials were stored in a dark cabinet at the university of california richmond field station at ambient temperature.voucher samples of i. minor pseudergates or workers and soldiers from this study ( fresh , not dried ) were preserved in 85% ethanol and deposited in the essig museum , university of california at berkeley ( haverty et al . , extraction procedure and characterization of hydrocarbons hydrocarbons from workers , alates , soldiers , and fecal pellets of i. minor were extracted , characterized , and quantified as previously reported ( haverty et al . , 2005 ) . frozen termite samples were thawed and dried at 70c for approximately 1 h before extraction . each sub - sample of fecal pellets or termites was placed in a 20-ml scintillation vial , and immersed in 10 ml of n - hexane for 10 min . after extraction , hydrocarbons were separated from other compounds through 4 cm of activated sigma silica gel ( 70230 mesh ) in pasteur pipette mini - columns . the resulting hydrocarbon fractions were evaporated to dryness under a stream of nitrogen and redissolved in 60 l of n - hexane for gas chromatography - mass spectrometry ( gc - ms ) analysis . a 3-l aliquot was injected into the gc-ms.gc-ms analyses were performed on an agilent 6890 gas chromatograph interfaced with an agilent 5973 mass selective detector , using agilent chemstation data analysis software ( g1701ca version c.00.00 ) . the gc - ms was equipped with an hp-1ms , fused silica capillary column ( 30 m 0.25 mm i.d , 0.25 m film thickness ) , and was operated in split mode ( split ratio of 30:1 ) , using helium as carrier gas . the column oven was programmed from 200320c at 3c min , with a final hold of 11 min . electron impact ( ei ) mass spectra were obtained at 70 ev.all chemicals of interest were identified by their retention times and mass spectra . mass spectra of methyl - branched alkanes were interpreted as described by blomquist et al . olefins were identified by their mass spectra , although double bond positions were not determined ( haverty et al . , 2005).in the text , tables , and figures , we use shorthand nomenclature to identify individual hydrocarbons or mixtures of hydrocarbons . this shorthand uses a descriptor for the location of methyl groups ( x - me ) , the total number of carbons ( cxx ) in the hydrocarbon component excluding the methyl branch(es ) , and the number of double bonds following a colon ( cxx : y ) . thus , pentacosane is represented as n - c25 , 11-methylnonacosane as 11-mec29 , 13,17-dimethylhentriacontane as 13,17-dimec31 , and heptatriacontatriene as c37:3 . hydrocarbons are presented in the tables for each caste and worker fecal pellets in the order of elution from our gc - ms system . statistical analysis gc - ms peak ( some peaks contained more than one compound or a mixture of positional isomers ) areas were converted to percentages of total hydrocarbon fraction , enabling mean ( sd ) relative amounts of each hydrocarbon peak for workers and alates , and overall mean ( sd ) of each hydrocarbon peak for the fecal pellets , to be calculated.the percentage of each hydrocarbon peak for pellets of each aging period was transformed to the log of the percentage ( dependent variable y ) and regressed against the days of aging ( independent variable x ) . hydrocarbons with slopes different from 0 ( = 0.05 ) were separated into two groups : those with a significant positive slope and those with a significant negative slope . for each aging period ( 0 , 30 , 90 , and 365 day ) , an index of age ( iage ) was created by subtracting the sum of the percentages of the hydrocarbons with a negative slope over time from the sum of the percentages of the hydrocarbons with a positive slope over time [ iage = ( peakpositive ) minus ( peaknegative ) , for each aging period ] . the iage for each aging period then was regressed against the aging period ( r development core team , 2004 ) . the cuticular hydrocarbons for i. minor pseudergates and fecal pellets were characterized previously ( haverty et al . , 2000 , 2005 ) . the composition of the hydrocarbon mixture for this species and the hydrocarbons from their fecal pellets in the present study are displayed in fig . 1total ion chromatogram of cuticular hydrocarbons from a workers of incisitermes minor ( hagen ) and b from fecal pellets from the same collection . acronyms for hydrocarbons are derived as follows : x - me location of methyl groups , the total number of carbons cxx in the hydrocarbon component excluding the methyl branch(es ) , and cxx : y the number of double bonds following a colontable 1relative abundance of hydrocarbons from pseudergates , alates , soldiers , and fecal pellets of incisitermes minor ( hagen)hydrocarbonspseudergates n = 3alates n = 3soldiers n = 1fecal pellets n = 122-mec220.06 ( 0.02)0.08 ( 0.02)0.090.11 ( 0.02)n - c231.30 ( 0.06)1.34 ( 0.05)1.481.35 ( 0.18)2-mec231.45 ( 0.40)1.72 ( 0.35)2.112.13 ( 0.28)3-mec231.31 ( 0.38)1.38 ( 0.30)1.712.06 ( 0.29)n - c240.46 ( 0.01)0.43 ( 0.02)0.480.32 ( 0.05)2-mec240.13 ( 0.03)0.19 ( 0.03)0.190.15 ( 0.02)3-mec240.08 ( 0.02)0.10 ( 0.02)0.120.11 ( 0.02)n - c2516.35 ( 0.16)11.75 ( 0.40)12.648.65 ( 1.05)2-mec250.18 ( 0.01)0.27 ( 0.01)0.240.14 ( 0.02)3-mec250.23 ( 0.04)0.36 ( 0.04)0.340.26 ( 0.03)n - c262.25 ( 0.15)1.17 ( 0.07)1.510.87 ( 0.12)2-mec260.14 ( 0.01)0.13 ( 0.01)0.140.07 ( 0.01)n - c2714.04 ( 0.55)6.81 ( 0.31)10.055.91 ( 0.65)2-mec270.13 ( 0.01)0.09 ( 0.01)0.130.06 ( 0.01)3-mec270.20 ( 0.01)0.19 ( 0.01)0.250.12 ( 0.01)n - c280.43 ( 0.05)0.17 ( 0.01)0.350.15 ( 0.03)n - c293.38 ( 0.33)1.27 ( 0.07)2.971.38 ( 0.18)11-mec290.06 ( 0.01)0.15 ( 0.01)0.100.09 ( 0.01)9,13-dimec290.70 ( 0.02)0.82 ( 0.01)0.910.63 ( 0.06)9,13,17-trimec290.11 ( 0.02)0.27 ( 0.00)0.160.22 ( 0.03)n - c300.04 ( 0.00)0.07 ( 0.00)0.100.0013-mec300.01 ( 0.02)0.08 ( 0.00)0.040.0010,14-dimec300.64 ( 0.06)1.45 ( 0.02)0.880.90 ( 0.03)10,14,18-trimec300.18 ( 0.02)0.43 ( 0.01)0.240.28 ( 0.02)n - c310.14 ( 0.01)0.10 ( 0.01)0.200.09 ( 0.01)15- ; 13- ; 11- ; 9-mec310.36 ( 0.03)0.82 ( 0.01)0.420.49 ( 0.02)13,17- ; 11,15-dimec317.45 ( 0.68)13.74 ( 0.52)8.5510.67 ( 1.80)9,13,17-trimec310.57 ( 0.05)1.19 ( 0.02)0.720.89 ( 0.06)7,11,15-trimec310.54 ( 0.04)0.99 ( 0.01)0.720.81 ( 0.09)14- ; 12-mec320.17 ( 0.01)0.33 ( 0.02)0.190.27 ( 0.03)12,16-dimec322.01 ( 0.14)3.57 ( 0.05)2.222.97 ( 0.28)10,14,18- ; 8,12,16-trimec320.46 ( 0.03)0.80 ( 0.02)0.610.82 ( 0.06)15- ; 13-mec330.93 ( 0.05)1.57 ( 0.03)0.921.30 ( 0.08)13,17- ; 11,15- ; 9,13-dimec334.63 ( 0.31)6.87 ( 0.11)5.117.41 ( 1.03)9,13,17-trimec331.30 ( 0.08)2.02 ( 0.02)1.863.47 ( 0.33)7,13,17-trimec330.21 ( 0.02)0.32 ( 0.01)0.320.47 ( 0.07)c35:31.01 ( 0.03)2.93 ( 0.17)1.641.76 ( 0.17)c35:22.31 ( 0.06)4.46 ( 0.14)2.713.55 ( 0.15)12,16-dimec34 ; c35:10.68 ( 0.02)1.16 ( 0.03)0.851.40 ( 0.10)10,14,18- ; 8,12,16-trimec340.28 ( 0.00)0.50 ( 0.04)0.450.89 ( 0.14)15- ; 13- ; 11-mec350.56 ( 0.02)0.85 ( 0.05)0.671.11 ( 0.09)13,17-dimec351.27 ( 0.09)1.96 ( 0.02)1.833.95 ( 0.46)9,13,17-trimec350.14 ( 0.01)0.28 ( 0.03)0.270.93 ( 0.14)c37:31.74 ( 0.06)3.33 ( 0.16)2.723.28 ( 0.34)c37:21.67 ( 0.06)2.55 ( 0.08)2.182.90 ( 0.10)12,16-dimec360.17 ( 0.01)0.34 ( 0.02)0.280.71 ( 0.08)c37:10.78 ( 0.02)0.76 ( 0.03)0.810.83 ( 0.06)10,14,18-trimec36 ; c37:10.44 ( 0.03)0.35 ( 0.05)0.430.58 ( 0.10)13 ; 11-mec370.71 ( 0.01)0.60 ( 0.04)0.770.89 ( 0.14)13,17- ; 11,15-dimec370.87 ( 0.05)1.27 ( 0.01)1.252.13 ( 0.22)9,13,17-trimec370.09 ( 0.01)0.13 ( 0.01)0.130.30 ( 0.06)c39:30.09 ( 0.02)0.18 ( 0.02)0.290.49 ( 0.16)c39:3 ; 12-mec380.49 ( 0.04)0.56 ( 0.03)0.761.03 ( 0.18)14,18 ; 12,16-dimec380.02 ( 0.03)0.14 ( 0.01)0.140.24 ( 0.04)c39:1 ; 10,14,18-trimec382.73 ( 0.19)1.73 ( 0.04)2.531.74 ( 0.23)13- ; 11-mec391.75 ( 0.09)1.03 ( 0.03)1.701.26 ( 0.20)13,17- ; 11,15-dimec390.90 ( 0.01)1.04 ( 0.14)1.361.44 ( 0.08)9,13,17-trimec390.41 ( 0.03)0.17 ( 0.09)0.110.20 ( 0.03)12- ; 10-mec400.38 ( 0.05)0.20 ( 0.01)0.350.26 ( 0.07)12,16-dimec400.27 ( 0.00)0.27 ( 0.02)0.340.32 ( 0.05)c41:13.31 ( 0.27)1.70 ( 0.04)2.791.58 ( 0.25)13- ; 11-mec412.78 ( 0.20)1.45 ( 0.06)2.591.74 ( 0.31)13,17- ; 11,15-dimec413.34 ( 0.13)2.90 ( 0.15)4.003.33 ( 0.19)9,13,17-trimec410.79 ( 0.02)0.30 ( 0.02)0.330.42 ( 0.19)12- ; 10-mec420.30 ( 0.03)0.15 ( 0.01)0.250.26 ( 0.27)12,16-dimec420.48 ( 0.04)0.37 ( 0.02)0.520.47 ( 0.12)c43:12.72 ( 0.28)1.25 ( 0.06)2.271.31 ( 0.26)15- ; 13-mec431.00 ( 0.14)0.46 ( 0.05)0.870.61 ( 0.16)13,17-dimec431.99 ( 0.16)1.18 ( 0.16)1.931.68 ( 0.28)14,18-dimec440.12 ( 0.02)0.07 ( 0.01)0.120.13 ( 0.06)c45:10.42 ( 0.09)0.16 ( 0.02)0.330.21 ( 0.07)13-mec450.000.000.000.04 ( 0.03)13,17-dimec450.37 ( 0.08)0.18 ( 0.02)0.340.43 ( 0.13)mean percent ( sd ) of total hydrocarbon composition . compounds are listed in elution orderacronyms for hydrocarbons are derived as follows : location of methyl groups ( x - me ) , the total number of carbons ( cxx ) in the hydrocarbon component excluding the methyl branch(es ) , and the number of double bonds following a colon ( cxx : y)these hydrocarbons were not reported for i. minor pseudergates or fecal pellets in haverty et al . ( 2005)an isomeric mixture or two or more compounds co - eluted in this peak total ion chromatogram of cuticular hydrocarbons from a workers of incisitermes minor ( hagen ) and b from fecal pellets from the same collection . acronyms for hydrocarbons are derived as follows : x - me location of methyl groups , the total number of carbons cxx in the hydrocarbon component excluding the methyl branch(es ) , and cxx : y the number of double bonds following a colon relative abundance of hydrocarbons from pseudergates , alates , soldiers , and fecal pellets of incisitermes minor ( hagen ) mean percent ( sd ) of total hydrocarbon composition . compounds are listed in elution order acronyms for hydrocarbons are derived as follows : location of methyl groups ( x - me ) , the total number of carbons ( cxx ) in the hydrocarbon component excluding the methyl branch(es ) , and the number of double bonds following a colon ( cxx : y ) these hydrocarbons were not reported for i. minor pseudergates or fecal pellets in haverty et al . ( 2005 ) an isomeric mixture or two or more compounds co - eluted in this peak hydrocarbons from termites n - alkanes and dimethylalkanes were the predominant classes of hydrocarbons in all castes and in fecal pellets ( table 2 ) , as previously reported by haverty et al . n - alkanes comprised from 23.12% to 38.39% , unsaturated components from 15.21% to 19.03% , terminally branched monomethylalkanes from 3.90% to 5.32% , internally branched monomethylalkanes from 7.70% to 9.01% , and dimethylalkanes from 25.25% to 36.18% , of the total hydrocarbon content . there was also a homologous series of trimethylalkanes , representing 8.26% to 9.48% of the total hydrocarbon content . table 2relative abundance of hydrocarbon classes from pseudergates , alates , soldiers , and fecal pellets of incisitermes minor ( hagen)hydrocarbon classpseudergatesalatessoldiersfecal pelletsnormal alkanes38.3923.1229.7718.71olefins18.3821.1120.3120.66terminally branched methylalkanes3.904.495.325.19internally branched methylalkanes9.017.708.888.33dimethylalkanes25.2436.1829.7937.40trimethylalkanes5.097.405.929.71percent of total hydrocarbon compositionall peaks with co - eluting olefins and saturated compounds are summarized as olefinsthe hydrocarbons of i. minor characterized in this study included all of the compounds reported by haverty et al . ( 2005 ) , as well as 18 additional hydrocarbons ( table 1 ) . these additional hydrocarbons were not abundant , never representing more than 0.85% of the total hydrocarbon ( as for the mixture of 12,16-dimec34 and c35:1 in soldiers ) content , and usually much less . the detection of these additional hydrocarbons in this study are likely due to the greater concentration of the extracted hydrocarbons used or , possibly , colony to colony variation . relative abundance of hydrocarbon classes from pseudergates , alates , soldiers , and fecal pellets of incisitermes minor ( hagen ) percent of total hydrocarbon composition all peaks with co - eluting olefins and saturated compounds are summarized as olefins hydrocarbons from termite fecal pellets in general , the hydrocarbons from whole - body extracts of i. minor were represented in extracts of fecal pellets . as with whole - body extracts of i. minor , dimethylalkanes were the predominant class of hydrocarbon , followed by olefins and normal alkanes ( table 2 ) . 1 ) were found in termites and not in fecal pellets , but these were present in small quantities , less than 0.1% of the total hydrocarbon content . the lack of these two hydrocarbons in fecal pellets may be a function simply of the concentration of the extracts . changes in hydrocarbons of fecal pellets over time we identified 73 hydrocarbon peaks in fecal pellets of i. minor ( table 1 ) . of these peaks ( data from non - significant slopes not reported ) , 19 of 73 ( 26% ) had a significant change , either positive ( five ) or negative ( 14 ) , over time ( fig . 2 ) . this is a much higher number of statistically significant slopes ( different from 0 ) , than would be expected by chance alone ( 5% of 73 peaks is < 4 peaks ) . 2changes in percent content of individual hydrocarbons , over time , from fecal pellets of incisitermes minor workers . a hydrocarbons with significant ( = 0.05 ) negative slopes , and b hydrocarbons with significant positive slopes . acronyms for hydrocarbons are derived as follows : x - me location of methyl groups , the total number of carbons , cxx in the hydrocarbon component excluding the methyl branch(es ) , and cxx : y the number of double bonds following a colonthe index , iage , for each of the three replications ( a , b , and c at 0 , 30 , 90 , and 365 day ) was plotted against the associated number of days ( fig . the fitted line , with a 95% confidence interval for the means to show the variability of the replicates , had a high adjusted r (= 0.888 ) value , suggesting that it might be possible to predict fecal age by the index . 3fitted line and 95% confidence intervals for a plot of the mean of index of age ( iage ) against age . values for 30 day are jittered a small amount so that all three data points can be seen changes in percent content of individual hydrocarbons , over time , from fecal pellets of incisitermes minor workers . a hydrocarbons with significant ( = 0.05 ) negative slopes , and b hydrocarbons with significant positive slopes . acronyms for hydrocarbons are derived as follows : x - me location of methyl groups , the total number of carbons , cxx in the hydrocarbon component excluding the methyl branch(es ) , and cxx : y the number of double bonds following a colon fitted line and 95% confidence intervals for a plot of the mean of index of age ( iage ) against age . values for 30 day are jittered a small amount so that all three data points can be seen we do not know the basis by which peaks increase or decrease over the 1-year period . in general , those that increased in relative abundance tended to have higher initial relative abundances ; i.e. , mono- , di- , or tri - methylalkanes with carbon chains of 31 , 32 , or 33 . those that decreased were represented in five of the six classes of hydrocarbons , ranging from c26 to c45 . the composition of the hydrocarbon mixture of insects is genetically controlled ( toolson and kuper - simbrn , 1989 ; kaib et al . , 1991 ; page et al . , 1991 ; coyne et al . , 1994 ) . this composition can be slightly affected by diet and environmental conditions ( hadley , 1977 ; espelie et al . , 1994 ; chapman et al . , 1995 ( 1996 ) demonstrated significant seasonal variation in quantities of some hydrocarbons of coptotermes formosanus shiraki from hawaii ; these differences were small and associated with the production of alates . however , the qualitative mix of hydrocarbons has been shown to be stable over decades among species of cone beetles in the genus conophthorus ( page et al . , 1990 ) . the motivation for our study was to devise a method for the evaluation of the success or failure of drywood termite treatments , including fumigation and local application methods . with the recent classification of sulfuryl fluoride ( the only fumigant active ingredient registered in california ) as a greenhouse gas ( mhle et al . , 2009 ) and the anticipated increase in local treatments , we felt that there would be considerable interest by the industry , regulatory agencies , and consumers for a simple and accurate means to determine whether or not a targeted colony / infestation is still in a structure . our method , based on changes in hydrocarbon chemistry over time , shows promise to this end . future research includes : ( 1 ) validating these findings for additional species of drywood termites and geographic populations of the same species , ( 2 ) validating these findings at different times of the year , and ( 3 ) exploring seasonality in pellet production and hydrocarbon quality in pellets .

hydrocarbon mixtures extracted from fecal pellets of drywood termites are species - specific and can be characterized to identify the termites responsible for damage , even when termites are no longer present or are unable to be recovered easily . in structures infested by drywood termites , it is common to find fecal pellets , but difficult to sample termites from the wood . when fecal pellets appear after remedial treatment of a structure , it is difficult to determine whether this indicates that termites in the structure are still alive and active or not . we examined the hydrocarbon composition of workers , alates , and soldiers of incisitermes minor ( hagen ) ( family kalotermitidae ) and of fecal pellets of workers . hydrocarbons were qualitatively similar among castes and pellets . fecal pellets that were aged for periods of 0 , 30 , 90 , and 365 days after collection were qualitatively similar across all time periods , however , the relative quantities of certain individual hydrocarbons changed over time , with 19 of the 73 hydrocarbon peaks relatively increasing or decreasing . when the sums of the positive and negative slopes of these 19 hydrocarbons were indexed , they produced a highly significant linear correlation ( r2 = 0.89 ) . consequently , the quantitative differences of these hydrocarbons peaks can be used to determine the age of worker fecal pellets , and thus help determine whether the colony that produced them is alive or dead .

drug induced safety issues , to include renal impairment , continue to be a significant reason that drugs fail the development process 1 . however , the ability to identify drug induced renal function changes during the development process continues to be a challenge . the traditional renal biomarkers of urea and creatinine are frequently obtained in all phases of clinical trials as these markers are accessible , analytically stable 3 , and cost effective , but viewed as insensitive and non - specific monitors of renal function 4 . the non - specific nature of urea and creatinine as renal markers may be advantageous in clinical trials if the ability to identify drug induce renal impairment can be improved . therefore , a sensitive statistical tool to identify drug induced changes in renal function , using these traditional biomarkers , will be valuable in the drug development process . the key element to identify a drug induced change in renal function from serum urea and creatinine is understanding that small changes are significant for these biomarkers . multiple definitions of a toxicity signal exist such as published toxicity tables , identifying values outside the reference interval , using multiples of the reference interval , evaluating multiples of the baseline value ( 2 fold increase , 3 fold increase ) , and % change from baseline . these definitions of a drug induced signal often fail because important drug induced changes for serum urea or creatinine will be small relative to the reference interval . alternatively stated , the index of individuality ( ioi = cvi / cvg where cvi is the intra - individual biological variability and cvg is the inter - individual biological variability ) is 0.67 for urea and 0.56 for creatinine 5 . a z - score can be defined as the number of standard deviations between a visit value and a baseline mean : where cva is the coefficient of analytical variation and n is the number of baseline readings 5 . assuming a cva of 5% , the 99% confidence interval ( z=2.58 ) for a change from two baseline values , and given cvi 's of 5% , 10% , and 20% , the important change for an analyte value is approximately 22% , 35% , and 65% increases from the baseline mean respectively . these % changes could easily be masked by the definition of the renal impairment signal . the cvi for creatinine is typically about 5% while urea 's cvi is typically in the range of 10% 5 . consequently looking at z=2.58 shift in the patient 's values , a 22% change in a serum creatinine value or a 35% change in a urea value , should be identified as a potential drug effect in a subject in a clinical trial . in comparison , if the mean value of the reference interval is used , 75 mol / l for creatinine and 5.0 mmol / l for urea , the absolute changes would be 16.5 mol / l ( final value 91.5 mol / l ) for creatinine and 1.8 mmol / l for urea ( final value of 6.8 these changes are well within the reference intervals ( see methods for reference intervals ) and all traditional definitions of renal impairment for urea and creatinine would be negative for more than half of the trial population if all subjects had a significant increase in biomarker value based on the estimated % cvi . the solution for improving the sensitivity of urea and creatinine as renal toxicity markers is to move from a traditional fixed limit definition of a toxic signal to a statistical evaluation of the signal . a z - score approach of defining an important change from the biological and analytical variation is partial solution to this issue 5 . recently , it has been shown that both traditional reference intervals and z - score formulas are two particular cases of a more general adaptive bayesian model 6 . population cvi and cvg can be used as prior information in a bayesian network ( bn ) to move from population- to individual - based intervals as the number of individual readings increases . heterogeneous factors leading to stratified reference intervals ( such as age and gender ) can be integrated in the bn to further remove between - subject variation . an assumption in the z - score formula is that the population % cvi is constant across the population . by moving to an adaptive bayesian approach , the detection algorithm is customized for biomarker and subject thereby minimizing assumptions and maximizing the sensitivity of signal identification . the adaptive bayesian approach has been successfully applied for the evaluation of biomarkers as formalized in the so - called biological passport 7 - 8 . biomarker signal defined statistically and detected through a very sensitive statistical technique may find an unimportant signal . however , in phase i and phase ii trials where populations are small , identifying a signal permits one to watch the signal in the development process to see if the signal becomes medically important 9 . the lack of a toxicity signal viewed through a very sensitive statistical tool early in the development process minimizes the risk of a toxicity being found later in development . two phase iii clinical trial datasets , with known drug induced renal impairment , are analyzed for a renal impairment signal by traditional methods and an adaptive bayesian approach in this report . interestingly , the knowledge of renal impairment makes it possible to estimate the specificity ( control group ) and sensitivity ( treated group ) of the applied methods for the first visits post - administration when the signal is most probably weak . two phase iii clinical trial datasets , one for urea , one for creatinine , were analyzed retrospectively . the clinical trial database for urea was composed of 590 patients ( aged 26 - 92 , median 65 ) distributed among the placebo ( 200 patients ) and two drug concentrations ( group 1 : 194 patients , group 2 : 196 patients ) . the creatinine clinical trial database had 532 patients ( aged 26 - 97 , median 65 ) distributed among the placebo ( 178 patients ) and two drug concentrations ( group 1 : 174 patients , group 2 : 180 patients ) . the patients had between 1 and 3 pre - treatment visits and data was analyzed for the first 3 visits after drug administration . the blood for the urea and creatinine measurements was collected in bd vacutainers ( becton dickinson , franklin lakes , nj ) , serum separated by the site , and transported to a central laboratory ( covance central laboratory ) . samples were analyzed on roche chemistry analyzers ( roche , basel , switzerland ) using roche urea and rate blanked compensated alkaline picrate creatinine reagents . all statistical simulations were performed on matlab version 7.7.0 with statistics toolbox version 7.0 ( mathworks , natick , ma ) . the following stratified reference intervals were used for creatinine : males 18 - 50 years , 40 - 110 mol / l ; females 18 - 70 years , 31 - 101 mol / l ; males 50 - 70 years , 40 - 119 mol / l ; males 70 - 80 years , 40 - 137 mol / l ; females 70 - 80 years , 31 - 110 mol / l ; males > 80 years , 40 - 145 mol / l ; females > 80 years , 31 - 128 mol / l ( covance central laboratory ) and for urea : males and females 18 - 70 years , 1.4 - 8.6 mmol / l ; males and females 70 - 80 years , 1.4 - 10.4 mmol / l ; males and females > 80 years , 1.4 - 12.1 mmol / l ( covance central laboratory ) . toxicity of grade 1 were computed for all data following the 2009 toxicity table of the national institute of allergy and infectious disease ( niaid ) . this table lists a grade 1 creatinine toxic value as 1.1 to 1.5 times the upper limit of normal ( uln ) and a urea toxic value as 1.25 to 2.5 uln . the adaptive bayesian approach was implemented in a hierarchical bn ( see figure 1 ) with biomarker signal decomposed into within - subject and between - subject components . it is assumed that a series of urea or creatinine values is normally distributed with mean and variance specific to each subject . prior distributions of within - subject variation ( denoted in figure 1 by the variable cvi ) and of the mean have been modeled as follows . the cvi is assumed to be log - normally distributed with geometric mean ( gm ) equal to -1.97 and -2.6 and geometric standard deviation ( gsd ) equal to 0.14 and 0.095 , for urea and creatinine respectively . with these parameters , the 99%-interval of prior distribution of cvi is [ 8 - 22]% for urea and [ 5.6 - 9.2]% for creatinine . the mean is assumed to be log - normally distributed with gm=0.89 and gsd of 0.15 for urea , gm=3.92 and gsd=0.13 for creatinine . the latter gsd gives the amplitude of the between - subject variations post - stratification . the stratification according to gender and age was modeled so that to obtain the stratified reference intervals given above ( assuming 99%-intervals ) . a bn was associated to each subject , with age and gender integrated as evidence in the bn before the start of the trial . then , bayesian inference techniques were used to iteratively and adaptively integrate pre - treatment visit values . posterior distributions of expected values were generated by the bn to analyze the values obtained in treatment . finally , 99%-intervals were computed as the 0.5 and 99.5 percentiles of the posterior distributions . these intervals can be viewed as biomarker and subject and pre - treatment data specific reference intervals . in addition to testing single visit values , the bn was also used to test sequences of visit values obtained after treatment 6 . for example , if the first two visit values fall both at the 95 percentile of the distribution of expected values , the sequence composed of these two values falls approximately at the 99.75 percentile of the distribution of expected sequences of length 2 . it has been shown that the latter approach has a significantly better sensitivity in the analysis of longitudinal biomarker data in the presence of a weak , but consistent over time , signal 9 - 11 . on pre - treatment data , an analysis of variance returned a cvi of 14% for urea and 6% for creatinine . these cvi were used in the z - score formula of equation ( 1 ) . the magnitude of the z - score is a measure in standard deviations of how far the value has moved from the baseline values . it has been shown that the z - score formula of equation ( 1 ) is a particular case of the bn described above 10 . the bn gives the same results as the z - score formula when ( 1 ) between - subject variations are assumed to be infinite , ( 2 ) the cvi is assumed to be universal ( i.e. no subject - based cvi ) and ( 3 ) no heterogeneous factors are taken into account 10 . similarly , by design , the reference intervals returned by the bn before the integration of any individual biomarker data correspond to the traditional reference intervals stratified according to age and gender 11 . the greatest false - positive signal for both urea and creatinine was % values above the reference intervals . the adaptive bayesian approach applied to single visit values or to sequences returned false - positive signals between 0.5 and 3.2% . these results are in agreement with a theoretical rate of 1% induced by the use of 99%-intervals . the mean and sd baseline values for urea and creatinine values across the cohorts are very similar ( control , group 1 , group 2 respectively , urea mean , 5.7 , 5.8 , 5.6 mmol / l , sd , 1.8 , 1.9 , 1.6 mmol / l ; creatinine , 75.6 , 76.6 , 76.4 mol / l , sd 20.5 , 17.9 , 22.7 mol / l ) prior to the administration of the drug indicating a well - executed randomization of the patients . the number of subjects per visit ranged from 187 to 173 for the urea data and ranged from 178 to 77 for the creatinine data . the number of patients for the creatinine measurement decreased by approximately 50% , by design , in moving across the visits . the creatinine mean values increased with time and drug dose while the urea mean values increased most directly with drug dose . a small signal was found with the traditional signal definitions of % high flags , niaid toxicity grade 1 , and 2 fold increases from baseline values . the adaptive bayesian analysis of sequences was still more sensitive than the bayesian approach based on a single visit value . no values were observed with a toxicity grade greater than 1 , no values exceeded twice the upper limit of the reference interval , and no values were observed with a 3 fold increase or greater . at the population level , the mean values by group and visit show that the mean values increased after drug administration . although the increases in mean values are small relative to the reference intervals , all increases were significant since the first visit in - treatment ( p<0.01 ) . in figure 2 , the graphs of % change from baseline to the adaptive bayesian z - value demonstrate the same % change can have different z values and that the placebo distributions are different from the drug treated patient distributions . placebo patients have only one z greater than 3 for urea and 2 z greater than three for creatinine . the adaptive bayesian methodology generated a prominent drug induced signal for renal impairment on both analytes at the first visit after drug administration . all traditional definition of renal toxicity produced none or significantly weaker signals than the adaptive bayesian approach . a dose dependent increase in the adaptive bayesian sequential signal indicates a drug effect is present and is increasing over time . the data shows that a drug effect can be identified at the first time point after drug administration . this urea change , although significant from a statistical point of view , is difficult to interpret from a biological perspective as this change remains in the reference interval and the renal handling of urea is complex and dependent on patient hydration . mol / l is more easily interpreted relative to the modification of diet in renal disease ( mdrd ) equation 12 . subsequently , an increase in the group 2 creatinine results of 21% by visit 3 results in a decrease in the population gfr by 16% . the signal definition for renal toxicity needs to reliably identify this magnitude of population serum creatinine increase . the out - of - reference range high values and toxicity grade 1 values do provide an indication of a drug effect and as the results are different between the placebo and treated groups . the weak signal could be due to noise in the system , due to expected disease related changes , or a function of the patient 's baseline value being close to the upper limit of the reference interval . the comparison of the out of range high results to the toxicity grade 1 results would imply that the high flagged results were false - positives as the % high results are 2 to 3 times greater that the tox grade 1 results . the use of multiples of the reference interval ( 2 or 3 uln ) to define renal toxicity is less sensitive that the toxicity grade 1 limits . for instance calculating a z - value using literature cvi values , at the boundary of 2 uln from the low and high ends of the reference interval , the patient z - values are very different . the z - value change in moving from the lower limit of normal for urea and a male creatinine results to 2 times the z - value change in moving from the upper limit of normal to 2 times the upper limit of normal is z=152 for a urea result and z=17 for a male creatinine result . this calculation demonstrates that the probability of generating a toxicity signal varies greatly with the baseline value and reference interval using traditional definitions of the biomarker signal . also multiples of the reference interval require a substantial drug effect on the kidney to define a toxic signal as the z - values are very high . the drug effect is concentration and time dependent using the adaptive bayesian methodology to calculate the signal . the false - positive reference interval high results were significantly greater for both biomarkers than the % mean false - positive adaptive bayesian results . the false - positive adaptive bayesian signal is in the range of one tenth of the true signal . on the contrary , the false - positive rate for the % above the reference interval signal was approximately 50% of the treated group 's signal . the toxicity grading had a low false - positive rate equal to the adaptive bayesian approach . however , the toxicity grading had a very low rate of true positive signal identification also . the adaptive sequential bayesian analysis rapidly produced a signal that exceeded the signal from the traditional definitions . the adaptive bayesian approach identified a drug effect on both analytes at the first visit after drug was administered on a significant number of patients . the rapid identification of a drug induced effect on renal function permits the rapid medical evaluation of this observed effect and , if appropriate , generate requests for additional renal biomarker data to define the mechanism and magnitude of the effect on key kidney function parameters . the same approach has been successfully applied for the evaluation of creatinine data in early phase clinical trials 9 . the data in figure 2 shows a marginal correlation of the % change from baseline to the adaptive sequential bayesian z - value results . the uncertain part of looking at % change from baseline is that the significance of the same % change from baseline will be different for different biomarkers and subjects . the % change from baseline methodology creates difficulties in scoring individual patients as having moved significantly from the baseline value . the challenge of a development protocol is to move from population data to individual patient data and be able to identify the individual patient who needs to be medically evaluated . this dataset provides insight as to the magnitude of an adaptive bayesian signal with a change in the population mean value . an approximate 20% change in the urea mean biomarker value generated an adaptive bayesian signal for 31% of the treated subjects while the toxicity grade 1 signal was 3.4% . an approximate 20% change in the creatinine mean value generated an adaptive bayesian signal for 29% of the treated subjects while the tox grade 1 signal was 6.5% . change from baseline analysis makes defining the point of significant change more difficult than the adaptive bayesian z value approach as the same % change has a different statistical meaning across biomarkers and across subjects . the adaptive bayesian approach will identify the specific patients that have changed from the baseline value and minimize the dilution of true positives with false - positive observations . both the creatinine and urea concentrations were rapidly effected by the drug even though the mechanism of clearance of creatinine and urea are significantly different . if renal impairment using non - specific markers such as creatinine and urea can reliably identify important changes from baseline with the adaptive bayesian approach , the non - specific nature of these biomarkers may be very appropriate for first line screening of renal effects in clinical trial populations . although much has been done by the predictive safety testing consortium ( ptsc ) to find new clinically relevant biomarkers of renal function 13 , our study suggests that conventional biomarkers like creatinine and urea are able to detect early kidney dysfunction when using individual reference ranges . also , the personalization of a biomarker signal makes possible the evaluation of drug efficacy and safety on an individual basis and in turn to tailor drug therapy at a dosage that is most appropriate for an individual patient . correlations with genotyping data on metabolic pathways in drug metabolism may be searched for still improved personalization 14 . a further advantage of the adaptive bayesian approach is that as one looks at historical biomarker data , the approach is independent of the analytical method and the reference interval and therefore is very appropriate for data - mining historical data sets . data mining using the adaptive bayesian approach should permit one to take clinical issues identified in large datasets and follow the biomarker data back through the phases of development . if a signal is found in early small populations , the long - term implications of small signals in early phases of development can be more thoroughly understood . two phase iii clinical trial datasets were used to evaluate traditional methods of renal impairment and an adaptive bayesian approach . these two datasets were appropriate for this analysis because they present a weak increase in mean urea and creatinine values after drug administration as well as a known drug induced renal impairment . traditional definition of toxicity limits such as greater than the upper limit of normal , toxicity table ranges , multiples of the reference interval , and greater than 2 or 3 fold changes from the baseline value all suffer from low sensitivity of signal generation and varying probabilities that the threshold will be exceed dependent on the baseline value . the % change from baseline is better than the fixed limit methods however there is not a single % change from baseline to define a significant signal for all biomarkers and for the same biomarker across subjects . the significance of a fixed value for the % change from baseline varies depending on the subjects cvi of the biomarker . the adaptive bayesian approach using all known factors provided superior sensitivity and specificity in these two large clinical trials for drug dependent renal impairment signal generation .

a major concern with the identification of renal toxicity using the traditional biomarkers , urea and creatinine , is that toxicity signal definitions are not sensitive to medically important changes in these biomarkers . traditional renal signal definitions for urea and creatinine have not adequately identified drugs that have generated important medical issues later in development . here , two clinical trial databases with a posteriori known drug induced renal impairment were analyzed for the presence of a renal impairment biomarker signal from urea ( 590 patients ; age 26 - 92 , median 65 ) and creatinine ( 532 patients ; age 26 - 97 , median 65 ) . data was analyzed retrospectively using multiple definitions for the biomarker signal to include values outside stratified reference intervals , values exceeding twofold increases from baseline , values classified by the 2009 niaid renal toxicity table , change from baseline represented as a z - score based on intra - individual biological variations , and an adaptive bayesian methodology that generalizes population- with individual - based methods for evaluating a biomarker signal . the data demonstrated that the adaptive bayesian methodology generated a prominent drug induced signal for renal impairment at the first visit after drug administration . the signal was directly related to dose and time of drug administration . all other data analysis methods produced none or significantly weaker signals than the adaptive bayesian approach . interestingly , serum creatinine and urea are able to detect early kidney dysfunction when the biomarker signal is personalized .

the apoptotic cell death pathway , in its basic tenents , is conserved among metazoans . during development , resistance to apoptosis is a hallmark of cancer , whereas excessive programmed cell death is associated with degenerative diseases . apoptosis is controlled and amplified through a variety of mechanisms , many of which converge on release of proapoptotic factors from mitochondria ( danial and korsmeyer , 2004 ) . ( 2011 ) now uncover how regulated trafficking of the proapoptotic protein bax off mitochondria and into the cytosol prevents mitochondrial permeabilization , reconciling discordant models for how antiapoptotic proteins on the mitochondrial surface inhibit proapoptotic proteins in the cytosol . the permeabilization of mitochondria is controlled by proteins belonging to the bcl-2 family , which is composed of anti- and proapoptotic members sharing homology in short stretches of amino acids called bcl-2 homology ( bh ) domains . the prosurvival members , including bcl-2 , bcl - xl , and mcl-1 , contain bh domains 14 and antagonize the prodeath members . the multidomain proteins , such as bax and bak , contain bh domains 13 and directly mediate mitochondrial permeabilization , whereas the bh3-only proteins ( e.g. , bid , bim , bad , etc . ) are thought to act as sensors of cellular stress ( danial and korsmeyer , 2004 ) . despite clearly defined roles for the bcl-2 family members , two major questions have remained : how are proapoptotic members activated , and how do the antiapoptotic members inhibit them ? the simplified rheostat model , first proposed in the early 1990s , suggests that pro- and antiapoptotic proteins directly counterbalance each other , with the more abundant protein dictating whether the cell dies or survives ( danial and korsmeyer , 2004 ) . complicating this model is the existence of two types of bh3-only proteins : the activators that directly activate the proapoptotic multidomains and the sensitizers that neutralize the antiapoptotic inhibition of the multidomain proteins ( letai et al . , 2002 ) . a modified version of the rheostat model postulates that activator bh3-only proteins act as receptors for multidomain proapoptotic proteins on the mitochondrial outer membrane ( om ) , whereas antiapoptotic proteins act like a sponge , soaking them off of the mitochondrial surface ( lovell et al . , a mutually exclusive model postulates that the antiapoptotic proteins directly bind and inhibit bax and bak , with bh3-only molecules acting as inhibitors of the inhibitors ( youle and strasser , 2008 ) . this latter model suffered from the lack of evidence that could explain the spatial paradox of this direct inhibition : under normal circumstances , bax is in the cytosol , whereas bcl-2 is on the surface of mitochondria . upon induction of apoptosis , bax accumulates on the mitochondrial om , undergoes conformational changes to expose a helical domain , and triggers the release of cytochrome c and other proapoptotic effectors . to gain insight into the regulation of bax , edlich et al . , ( 2011 ) examine the localization of a mutant version of bax that is constrained in its cytosolic conformation by engineered disulfide bridges . surprisingly , this mutant protein , which does not interact with the mitochondrial antiapoptotic protein bcl - xl , localizes to mitochondria but does not induce apoptosis . following up on this observation , the authors ask whether bax normally translocates to the mitochondrial surface . using fluorescence loss in photobleaching , they monitor the localization of gfp - bax in cells and find that bax cycles on and off the mitochondria in healthy cells . the presence of antiapoptotic proteins in the mitochondrial om is required to constitutively retrotranslocate bax into the cytosol . notably , the rate of retrotranslocation is almost doubled in cells overexpressing bcl - xl and requires the physical interaction between bcl - xl and bax . once in the cytosol , bax quickly returns to its monomeric form , ready to cycle back to the mitochondrial surface . edlich and coworkers observe an acceleration of the retrotranslocation rate upon the coexpression of bcl - xl and bax . similarly , the bcl-2/bcl - xl inhibitor abt-737 , as well as bh3-only proteins , disrupts the equilibrium between cytosolic and mitochondrial bax by reducing its retrotranslocation ( figure 1 ) . this new study provides a new paradigm for understanding bax regulation during apoptosis , but how the two categories of bh3-only proteins antagonize bax retrotranslocation by bcl - xl remains an open question . one possibility is that the activators ( e.g. , bid and bim ) directly inhibit bax retrotranslocation by unmasking its 9 helix and anchoring bax in the mitochondrial om . conversely , the sensitizer ( e.g. , bad ) could obstruct the binding of bax to bcl-2 . the interplay between proapoptotic and antiapoptotic proteins is part of the normal regulation of the trafficking of bax in healthy cells . under nonapoptotic conditions , the equilibrium between the cytosolic and mitochondrial pools of bax is maintained by its bcl - xl - dependent retrotranslocation . during apoptosis , however , this balance may be tipped by bh3-only proteins , which increase the insertion of bax into the mitochondrial om ( figure 1 ) . thus , the retrotranslocation model is an important step forward , reconciling two opposing models of how bh3-only , multidomain , and antiapoptotic proteins cooperate to dictate whether a cell lives or dies ( e.g. , cheng et al . , 2001 ; lovell et al . , 2008 versus willis et al . , in addition to this new model , edlich and colleagues also find that the weak interaction between bcl - xl and bax is sufficient to extract bcl - xl from the mitochondrial om and transiently localize it to the cytosol . this highlights an unappreciated conformational change that facilitates the removal of an antiapoptotic protein from the mitochondrial om . interestingly , the rate of bcl - xl retrotranslocation increases upon treatment with abt-737 , raising the possibility that inactive bcl - xl might be predominantly cytosolic . it will be important to verify whether this is a feature common to extramitochondrial antiapoptotics , such as endoplasmic reticulum ( er)-localized bcl-2/bcl - xl , and to understand the mechanism by which interaction with bax inactivates the transmembrane domain of bcl - xl . interestingly , a fraction of inactive bax is associated with intracellular membranes , including mitochondria and er in transformed cells , but not primary hepatocytes ( scorrano et al . , 2003 ) . understanding how oncogenic transformation influences the on and off rates of bax translocation could open new perspectives to apoptosis in cancer cells . from a teleological perspective , one might wonder why a cell would maintain a continuous flux of bax cycling on to the mitochondria and then back to the cytosol . one reason could be to prime cells to rapidly execute death , positioning bax in a ready to attack mode such that minor changes in the kinetics of bax retrotranslocation can swiftly induce apoptosis . another possibility is that bax has additional functions that require its regulated presence on cellular membranes . interestingly , inactive bax controls transient membrane events such as mitochondrial fusion ( hoppins et al . , 2011 ) and , however , bax can not remain on the organelle without becoming active and promoting apoptosis ( nutt et al . the retrotranslocation model not only provides a paradigm for understanding how apoptosis is regulated , but also provides a platform for integrating the diverse functions of bax and other bcl-2 family members .

antiapoptotic bcl-2 proteins on mitochondria inhibit prodeath proteins , such as bax , which are found primarily in the cytosol . in this issue , edlich et al . , ( 2011 ) show that bax and bcl - xl interact on the mitochondrial surface and then retrotranslocate to the cytosol , effectively preventing bax - induced permeabilization of mitochondria .

in a recent article in genome research , thompson and colleagues present a development of a next - generation sequencing technology - the heliscope sequencer - that enabled them to detect mutations in the human breast cancer 1 ( brca1 ) gene , as a model of a clinical diagnostic protocol . it therefore holds great promise for overcoming the emerging problem in clinical genetics of target overload : the presence of a large number of gene mutations of clinical relevance in a single disease entity . in no field is this challenge more apparent than in the genomics of cancer . the past few years have seen an unprecedented deluge of data on the genes mutated in cancer and other diseases . so far , the sequences of over 50 individual cancer genomes have been published and this number is set to increase exponentially . the advent of next - generation technologies ( such as the roche 454 gs flx+ , llumina hiseq 2000 , applied biosystems solid and heliscope single - molecule sequencer machines ) , which allow a human genome to be sequenced in a single week - long run , has led to a large shift in our understanding of the mutations that drive cancers . for the clinician , mutations in cancer can have relevance for diagnosis , prognosis and treatment choice . however , it is now apparent that these clinically relevant mutations will be both numerous and found at low prevalence in individual cancer types . in particular , for the majority of cancers there will be no single ' magic bullet ' targeted therapy . the breakpoint cluster region - abelson murine leukemia homolog ( bcr - abl ) fusion kinase , which is characteristic of chronic myeloid leukemia , is the exception not the rule when it comes to druggable cancer genes ; it seems , instead , that multiple drug targets will be mutated at low frequency throughout common cancers . this target overload is not restricted to the management of cancers and is also seen with monogenic disorders , for example , mental retardation and hereditary cancer pre - disposition . it is therefore necessary to screen numerous genetic loci to decide on the best course of clinical management for an individual patient and this must be done in a rapid and cost - effective manner . the current technology for searching for mutations is to amplify a region of interest - in multiple fragments of a few hundred base pairs each in separate pcr reactions - then sequence the products by standard sanger chain terminator sequencing . although highly accurate for the detection of single - nucleotide variants and small insertions or deletions , this approach is expensive , labor intensive and unable to detect large - scale insertions or deletions . this is because sanger sequencing can reliably detect mutant alleles only when they are present in more than about 20% of the relevant dna , and this will not be the case , for example , for a heterozygous mutation in a tumor contaminated with 60% normal dna , a scenario that is not uncommon . thompson and colleagues have used a next - generation true single - molecule sequencing ( tsms ) system , the heliscope sequencer , to profile the mutational pattern of the human cancer gene brca1 . germline mutations in the genes brca1 and brca2 are associated with dramatically increased rates of breast and ovarian cancers and contribute to about 10% of all breast cancer cases . in addition , poly - adp ribose polymerase inhibitors , a recently developed family of pharmaceutical agents , seem to show selective toxicity for cancers with mutations in the brca genes . cost - effective sequencing of these genes is therefore a highly desirable clinical tool for the management of breast cancer patients and those with strong family histories of the disease . the technology used is a development of the heliscope tsms platform . in the standard heliscope protocol , dna is fragmented and poly(a ) adaptors are added to the ends of fragments . they are then captured on a glass slide coated with covalently bound poly(dt ) oligonucleotides , and sequenced . thompson et al . were able to dispense with the initial sample preparation steps ( addition of poly(a ) adaptors and 3 ' blocking - performed to prevent extension of the 3 ' end of bound poly(a)-tagged dna molecules ) and instead directly captured only the fragments of dna belonging to the brca1 locus , using oligonucleotides that match sequences in the brca1 region ( figure 1 ) . approximately 20% of the sequenced reads mapped to brca1 , which equates to about 100,000-fold enrichment of the target sequence . as the length of sequence that can be read in this system is limited , oligonucleotides were designed at 20 - 30 base pair intervals throughout the coding sequence of the gene , to ensure complete coverage . importantly , the authors were able to obtain sequencing results from as little as 100 ng of input material - thus showing that the technology could be used with samples collected as diagnostic biopsies . tumor material can be collected and ( a ) snap frozen to preserve intact dna and rna or ( b ) fixed in formalin then embedded in paraffin for section and histopathological review . following ( c ) dna extraction , ( d ) the dna ( e ) dna fragments are hybridized to the flow cell , which is covered with oligonucleotides with sequence complementary to the region corresponding to the brca1 gene . ( f ) each individual molecule of dna is then sequenced simultaneously by sequential addition of fluorescently labeled nucleotides ( purple ) . this approach has several advantages over the more traditional sanger sequencing commonly used for the detection of mutations . firstly , there is little required in the way of sample preparation - only sonication of the dna , and in the case of archival formalin - fixed material it is possible that even this step could be dispensed with - therefore reducing cost , turn - around time and the risk of errors in sample handling . secondly , unlike sanger sequencing , the heliscope system allows the detection of large deletions , by determining the number of fragments of dna that are present from a specific location ; a decreased number of fragments from a region suggests a loss of genetic material . finally , the heliscope system directly sequences individual molecules rather than - as with sanger sequencing - examining the average sequence of many millions of dna molecules . this should provide increased sensitivity for the detection of low prevalence mutations , an essential feature in the sequencing of a heterogeneous cancer sample . the present technology is an advance over recently presented techniques for analyzing the mutational status of target genes using next - generation sequencing instruments . with the advent of more competitively priced next - generation sequencing machines , which can provide sequence data in a matter of hours , not days ( such as life technologies ' ion - torrent and illumina 's miseq ) , it is feasible that such approaches could be used routinely in the clinical setting . however , the instruments involved still require the selective amplification of target dna and the relatively complex preparation of this material for sequencing . thus , although they take advantage of the exceptionally cheap per - base cost of next - generation sequencing , competing techniques are still limited by its flaws : high complexity and slow turnaround time . genotyping by mass spectrometry has also been applied to the resequencing of relevant mutations . this approach , although sensitive , is limited , in that it is capable of detecting only known mutations and will therefore miss novel gene lesions . for the foreseeable future , the high cost and complexity of data analysis will limit the application of whole - genome sequencing for the detection of mutations in a clinical setting . targeted resequencing of areas of interest will therefore remain key to determining mutational status . the method published by thompson et al . although currently only a single gene is screened , there is clearly scope for the creation of multi - gene capture arrays , allowing large numbers of loci to be analyzed rapidly and cost - effectively with low dna input requirements . in its simplicity , this approach provides an opportunity to truly begin integrating the vast quantity of genomic data generated in this next - generation era with clinical practice . we would like to thank claire pike and karen howarth for helpful discussion and reading of the manuscript and the wellcome trust translational medicine and therapeutics program , breast cancer campaign and cancer research uk for funding .

in many fields it is now desirable to sequence large panels of genes for mutation , to aid management of patients . the need for extensive sample preparation means that current approaches for assessing mutation status in the clinical setting are limited . a recent publication demonstrates a single - step , targeted , true single - molecule sequencing approach to assessing the mutational status of brca1 . fragmented dna samples are loaded directly onto a flow cell and sequenced , thus detecting both small- and large - scale mutations with minimal sample preparation and high accuracy .

retinitis pigmentosa ( rp ) is a hereditary disorder , in which the progressive loss of rod and cone photoreceptor cells occurs . patients with rp generally experience loss of night vision ( nyctalopia ) in adolescence , side vision in young adulthood , and central vision ( tunnel vision ) in later life ( 14 ) . about 14% of rp may accompany usher syndrome , which consists of hearing loss as well ( 1 , 5 ) . retinitis pigmentosa is one of the most common causes of visual impairment in all the age groups with the prevalence of between 1/3000 and 1/5000 worldwide ( 3 , 610 ) . retinitis pigmentosais a common and significant finding in iranian population as well . in studies done in cities of shiraz and shahroud , rp was found to be the 1 and the 3 most common cause of visual impairment , respectively ( 11 , 12 ) . retinitis pigmentosa may be inherited as dominant autosomal , recessive autosomal , or x - related traits . however , it may sometimes be seen sporadically and without the family history ( 13 , 14 ) . consanguineous marriage , especially first cousins marriage , has been reported to be the most common etiology of rp in iran ( 12 ) . patients with rp may develop a kind of a psychological disorder in a period of their life . ignoring their mental disorder will deteriorate the rp course and finally result in their rejection by the society . therefore , attempt to prevent , diagnose , and treat the psychological problems are necessary to improve the overall quality of life in patients with rp . to the best of our knowledge , this is the first study on assessing the common psychological disorders in patients with rp in iran . this descriptive , cross - sectional study was carried out between january 2009 and january 2010 on patients with rp . all the 939 patients who were members of iran rp center in tehran were recruited to the study through census sampling method . this study was approved by the ethics committee of nursing and midwifery school at islamic azad university , tehran medical branch as well as iran rp center . then , the study goals were explained to the patients and a written informed consent was taken from each participant . being older than 18 years , residence of tehran , member of iran rp center , and suffering from rp for at least one year were considered as inclusion criteria . those with mental retardness or with a history of a diagnosed mental disorder prior to rp were excluded from the study . the necessary data were collected using questionnaires composed of two parts : the first part was about socio - demographic characteristics , including age , gender , marital status , education , occupation , income , type and location of accommodation , the family relationship between parents , the onset of rp , the history of rp amongst first - degree relatives , and cigarette , drugs , or alcohol consumption ( 14 questions ) . the second part composed of questions assessing the mental health and screening personality and psychosocial disorders , which were designed based on the modified minnesota multiphasic personality inventory-2 ( mmpi-2 ) ( 71 questions ) . the mmpi-2 is an inventory assessing mental health in psychiatric and medical settings in adults above the age 18 , which has been standardized for iranian population by mootabi and shahrami , and the validity and reliability of the questionnaire were confirmed ( 15 ) . to examine the scientific reliability of the instrument , the cronbach s alpha index was applied data were analyzed using spss software ( the statistical package for the social sciences , version 16.0 , spss inc . , chicago , illinois , usa ) through chi - square test to assess the relationship between socio - demographic characteristics and each mental disorder . the socio - demographic characteristics of the patients with rp are demonstrated in table 1 . as it shows , the majority of the participants were men ( 55.4% ) in the age range of 26 to 35 years , and single ( 48.7% ) . furthermore , most of the patients experience rp from their childhood ( 40.9% ) and had the parental family relationship ( 60.7% ) . socio - demographic characteristics of patients with retinitis pigmentosa based on mmpi questionnaire , patients with rp suffered from eight mental disorders with the following prevalence : obsessive compulsive disorder ( 39.3% ) , schizophrenia ( 38.1% ) , antisocial personality ( 37.6% ) , paranoia ( 36.7% ) , hypochondrias ( 35.3% ) , depression ( 31.2% ) , hysteria ( 26.9% ) , and hypomania ( 23.7% ) . the frequency of mental disorders in patients with retinitis pigmentosa the cronbach s alpha value was 0.8 , which is satisfactory , and the power of study was 80% ( if = 20% , 1- = 80% ) . statistical analysis showed no significant relationship between obsessive compulsive disorder , paranoia , depression , and hysteria and background characteristics ( p>0.05 ) . a significant association was found between schizophrenia and onset of rp ( p = 0.047 ) . furthermore , a significant association was seen between hypochondrias and educational level ( p = 0.026 ) as well as income ( p = 0.037 ) , and smoking ( p = 0.009 ) . there was also a significant association between hypomania and marital status ( p = 0.027 ) . in our study , of 417 patients with rp , 231 ( 55.4% ) were men , which is compatible with other studies . because rp has x - related trait as well ( 13 , 14 ) , it is more prevalent in men while women are mostly carriers . since the diagnostic value of mmpi-2 test decreases in subjects less than 18 years , we recruited patients above 18 years to our study . the most and the least of our patients have experienced rp from their childhood and infancy , respectively . this may be due to disability of infants to express the visual symptoms . besides , since the specific amblyopic examination is done in childhood , the diagnosis of rp increases in that life period . furthermore , because the parents are aware of the genetic transmission of rp to their children , they mostly take their child to an ophthalmologist for specific examinations , such as electroretinography . of 417 patients in our study , this is in line with other studies , including those performed in iran ( 11 , 12 ) . performed a study in shourideh educational center , which is the only educational center for blinds in shiraz , in the south of iran , and has students at different levels , from preschool to high school . of 145 students , 65 ( 44.8% ) had rp , which was the single most common cause of visual loss . large proportion of these blind children ( 47.5% ) had a positive history of consanguineous marriage in their parents ( first cousins marriage ) ( 12 ) . consanguineous marriage seemed to be the most probable cause of increased frequency of genetic etiologies of childhood blindness . therefore , avoidance of consanguineous marriage may reduce the number of blindness caused by rp . in a study on 970 patients with rp , significant depression , anxiety , and phobia risk of depression in patients with rp was 25.1% more than that in the general population ( 17 ) . patients with rp that experienced depression in the same period had poorer visual function in comparison with those without depression ( p<0.0005 ) ( 17 ) . in 2009 , rijavec and grubic reported a 28-year - old woman with usher syndrome ( rp with hearing impairment ) , who developed psychological disorders , including eating disorder , psychosis , panic , anxiety , and obsessive compulsive disorder ( 18 ) . in another study in 2012 on 26 children with usher syndrome , ( 23% ) had a mental and behavioral disorder ( 19 ) . john hopkins university followed up 50 patients with rp from 2007 to 2010 and reported that depression developed in patients with rp . the more depressed they were , the less visual function they had ( 17 ) . in a study carried out on 144 patients with rp , relationship between depression and the vision - related quality of life was assessed . therefore , it was suggested to diagnose and treat depression in order to enhance the overall quality of life in patients with rp ( 20 ) . depression was more frequent in patients with rp than those with glaucoma ( p<0.0005 ) ( 21 ) . our results showed that depression was mostly reported in women with rp , especially those who were divorced and were in the age range of 46 to 55 years . generally , depression is more prevalent in women . besides , getting divorced and increasing age are themselves predisposing factors for depression as well ( 22 ) . yet therefore , patients should be addressed towards rehabilitating institutions that help them obtain new skills and return to their life . furthermore , psychiatric counseling is required for patients with rp to accept and adjust to their condition . the findings showed that rp might lead to various mental disorders , especially obsessive compulsive disorder . therefore , psychological support , which can be provided by either professionals or supportive patientsfamily , is often crucial in the course of rp . further studies are required to evaluate the effect of orientation and training on the mental disorders in rp as well as comparing the psychological disorders in rp with other ophthalmological diseases . ethical issues ( including plagiarism , informed consent , misconduct , data fabrication and/or falsification , double publication and/or submission , redundancy , etc . ) have been completely observed by the authors .

abstractbackgroundto identify mental disorders and their prevalence in patients with retinitis pigmentosa ( rp).methodsthis descriptive study was carried out between january 2009 and january 2010 on 417 patients with rp , who were members of iran rp center . the necessary data were collected using questionnaires consisting two parts : the background characteristics and questions assessing the mental health and screening personality and psychosocial disorders , which were designed based on the minnesota multiphasic personality inventory . data were analyzed using spss software with chi - square test to assess the relationship between background characteristics and each mental disorder . scores in the range of 30 and 70 were considered normal.resultspatients with rp suffered from eight mental disorders with the following prevalence : obsessive compulsive disorder ( 39.3% ) , schizophrenia ( 38.1% ) , antisocial personality ( 37.6% ) , paranoia ( 36.7% ) , hypochondrias ( 35.3% ) , depression ( 31.2% ) , hysteria ( 26.9% ) , and hypomania ( 23.7% ) . no one had all the eight mental disorders simultaneously . statistical analysis showed no significant relationship between obsessive compulsive disorder , paranoia , depression , and hysteria and background characteristics . a significant association was found between schizophrenia and onset of rp ( p = 0.047 ) . furthermore , a significant association was seen between hypochondrias and educational level ( p = 0.026 ) as well as income ( p = 0.037 ) , and smoking ( p = 0.009 ) . there was also a significant association between hypomania and marital status ( p = 0.027).conclusionthe findings showed that rp might lead to various mental disorders , especially obsessive compulsive disorder .

in this issue of the jem , two articles describe a potential role for two bacterial toxins in the modulation of the immune system by interfering with t cell signaling . using an in vitro jurkat t cell system , gerke et al . ( 8) report that yersinia pseudotuberculosis inhibits t cell activation and that the inhibitory activity was strictly dependent on the yersinia outer protein h ( yoph ) , a potent tyrosine phosphatase that is delivered to host cells by a bacterially encoded type iii protein secretion system . previous studies by a number of laboratories have identified several tyrosine phosphorylated proteins as apparent targets for the tyrosine phosphatase activity of yoph in cell culture systems . these include p130cas , focal adhesion kinase , and paxillin in hela cells , and fyb / slap130 , p130cas , and skap55 in macrophages ( 912 ) . in general , these are proteins involved in integrin signaling , which is consistent with the proposed role of yoph as an antiphagocytic molecule . more recent studies have shown that yoph can also inhibit t cell signaling in - vitro and that this activity could be correlated with the presence of yoph and the dephosphorylation of the tyrosine kinase lck ( 13 ) . ( 8) have now extended those studies and added the t cell signaling adaptor proteins lat and slp-76 to the list of potential yoph substrates . these adaptor proteins are essential for the transduction of signals from the t cell receptor and its associated tyrosine kinases , and their tyrosine phosphorylation is required for their activities . ( 8) argue that tyrosine dephosphorylation of these adaptor proteins by yoph is responsible for the observed inhibition of t cell receptor signaling after yersinia infection of cultured jurkat t cells . they also present data that argue that both of these proteins are high affinity substrates of yoph , presumably requiring small amounts of translocated toxin to be targeted for dephosphorylation . in the second article , rossi paccani et al . ( 14 ) report that anthrax toxin also disrupts t cell signaling but by a completely different mechanism . anthrax toxin , which is produced by bacillus anthracis , is composed of two enzymatic or a subunits known as edema factor ( ef ) and lethal factor ( lf ) that alternatively associate with a b subunit , known as protective antigen , which mediates their delivery into target cells ( 15 ) . ef is a potent calcium / calmodulin - dependent adenylate cyclase , which causes a massive increase of cyclic amp in intoxicated cells and global disruption of cell signaling . lf is a zinc - dependent protease that specifically disrupts the mitogen - activated protein ( map ) kinase signaling pathways by cleaving the activating map kinase kinases mek1/2 and mkk3 , mkk4 , mkk6 , and mkk7 ( 1619 ) . ( 14 ) showed that treatment of peripheral blood lymphocytes with protective antigen in combination with either lf or ef effectively blocked t cell signaling as measured by the expression levels of the surface activation markers cd69 and cd25 , the production of cytokines , and cell proliferation . given the ubiquitous presence of the anthrax toxin receptors and the essential role for map kinases and camp in t cell signaling , the results presented by rossi paccani et al . the broader issue raised by these two and other studies with other bacterial toxins that disrupt immune cell function in vitro , however , is the in vivo relevance of the findings . do these pathogens specifically interfere with t cell signaling during the course of an infection ? unfortunately , in vitro studies , although useful to provide testable hypotheses , can not provide answers to these important questions ( 8) make a strong case for slp-76 and lat as high affinity substrates for this tyrosine phosphatase and hence of potential relevance during infection when presumably the pathogen would deliver small quantities of this toxin . indeed , it is often the case that under vitro experimental conditions , cells are exposed to toxin quantities not usually delivered during actual infections . nevertheless , it is not known how much yoph is delivered by yersinia during infection , and there is no evidence demonstrating that yersinia hampers t cell function during infection . yersinia infections are usually acute ( 20 ) , arguing against the need for these pathogens to counteract the host - specific adaptive immune responses during infection . however , although rare , chronic infections are sometimes observed ( 21 , 22 ) , and in those cases , the ability to interfere with t cell function might be useful to the pathogen . whether this function of yoph has been specifically selected by evolution or is simply a by - product of another of its demonstrated functions , such as disruption of macrophages during acute infection , remains to be established . anthrax toxin possesses even a more difficult challenge because its biochemical activity ( such as inhibition of map kinase signaling ) can potentially affect a large number of cellular processes . therefore , the ability of anthrax toxin to inhibit map kinase signaling can result in the in vitro inhibition of any of the rather large number of intracellular signaling pathways that involve these kinases , regardless of their relevance during infection . for example , if added to cultured neurons , anthrax toxin would certainly prevent neurite outgrowth , a process strictly dependent on map kinase signaling ( 23 ) . however , it would be hard to argue that this is a relevant function for the toxin during infection . by the same token , anthrax toxin predictably inhibited in vitro t cell signaling , a process strictly dependent on map kinase signaling . however , more experiments will be required to establish whether this activity of the toxin is important during infection . if untreated , b. anthracis infections are usually hyper acute ( 24 ) ; therefore , inhibiting t cell signaling may not provide a significant advantage to the pathogen . on occasions , b. anthracis can be associated with sub - acute infections ( such as cutaneous anthrax ; reference 24 ) , in which case inhibition of t cell function may provide some advantages to the pathogen . in any case , because b. anthracis is most likely an accidental pathogen of mammals , it is unlikely that evolution may have played any role in directly shaping the effects of anthrax toxin on t cells . therefore , this activity might be more a byproduct , relevant or not , of other activities of this toxin in the normal ecology of b. anthracis . although every pathogen must contend with the onslaught of the innate immune responses , it is not necessarily the case that every pathogen must counteract the acquired immune response to fulfill its replication program . for most pathogens that cause acute infections , their life cycle within the host is most often over by the time the naive host mounts a meaningful acquired immune response capable of controlling the infection . in fact , most infections with pathogens that have coevolved with their hosts are indeed asymptomatic , do not lead to overt harm , and most often result in protective convalescent immunity . on the other hand , pathogens that cause persistent infections might be under strong evolutionary pressure to evolve specific mechanisms to avoid acquired immune responses . indeed , mechanisms of antigenic variation or specific inhibition of antigen presentation evolved by microbial pathogens are well documented ( 25 ) . for example , many viral pathogens specifically interfere , by a variety of mechanisms , with both major histocompatibility class i and ii antigen - presenting pathways ( 26 , 27 ) . in addition , many viral , bacterial , and protozoan pathogens undergo rapid antigenic variation to evade the onslaught of the acquired immune response ( 2830 ) . whether inhibition of t cell signaling by anthrax or yoph toxins should be added to the list of pathogenic mechanisms specifically evolved to counter the acquired immune response

microorganisms that cause persistent infection often exhibit specific adaptations that allow them to avoid the adaptive immune response . recently , several bacterial toxins have been shown in vitro to disrupt immune cell functions . however , it remains to be established whether these activities are relevant during infection and whether these toxins have specifically evolved to disrupt the adaptive immune system .

polycystic ovary syndrome ( pcos ) , also known as stein - leventhal syndrome , is a common endocrine disorder that occurs in 510% of women of reproductive age . according to the 2003 rotterdam criteria , it is usually defined by presence of at least 2 out of the following 3 features : i ) oligoovulation or anovulation , ii ) clinical and/or biochemical signs of hyperandrogenism ( presence of at least 2 signs ) , or iii ) polycystic ovaries ( ovaries with many small cysts no larger than 810 mm ; they occur in 1520% of women ) . pcos has significant and various clinical implications , including reproductive , endocrine , and metabolic disorders such as hyperandrogenism and obesity . obesity , especially abdominal obesity , is an independent factor aggravating pcos endocrine abnormalities , as subcutaneous abdominal adipose tissues and the liver tissues contribute to extragonadal aromatization . as individuals become obese and their adipocytes enlarge , adipose tissue undergoes molecular and cellular changes affecting systemic metabolism . fasting body ffa and glycerol discharge from adipocytes refers to a condition characterized by an increase in levels of various inflammatory markers such as c - reactive protein ( crp ) , fibrinogen , tumor necrosis factor- ( tnf- ) , interleukin-1 ( il-1 ) , interleukin-6 ( il-6 ) , and neutrophil - to - lymphocyte ratio ( n / l ratio ) . recognition of the impact of inflammation on atheromatous plaque generation and rupture leads to interest in novel inflammatory markers and determining the best assay to define the relevant cardiovascular diseases ( cvds ) . respect , cellular immune activation can easily and sensitively be monitored by measurement of neopterin levels in biological fluids . biosynthetically derived from guanosine triphosphate , neopterin [ 2-amino-4-hydroxy-6-(d - erythro-1,2,3-trihydroxypropyl)-pteridin ] belongs to the class of pteridines . patients with pcos are considered to be at high risk for cardiovascular diseases because of hyperandrogenism , insulin resistance , glucose intolerance , type ii diabetes , and obesity which might accompany pcos . however , there is no study in the literature reporting a direct relationship between increased / early cardiovascular mortality or morbidity and pcos . the purpose of this study was to make a comparison between obese and non - obese patients with pcos and control subjects with regard to concentrations of inflammatory markers ( neopterin , il-6 , tnf- , n / l ratio , and crp ) and vitamin b12 , which might pose a risk for atherosclerosis in patients with pcos , and to investigate the correlation between the examined concentrations and the hormonal anthropometric and cardiometabolic parameters . this study was conducted in the obstetrics and gynecology clinic of dicle university and approved by the local ethics committee of the university . a total of 30 patients between 18 and 33 years of age ( mean 26.24.0 years ) who presented to dicle university faculty of medicine clinic of obstetrics and gynecology between june 2013 and july 2014 and were diagnosed with pcos based on their clinical and endocrinological data were included in this study . according to the revised rotterdam diagnostic criteria , pcos was defined by the presence of at least 2 out of the following 3 features : oligo - anovulation ( menstrual cycle length > 45 days or less than 6 menstrual cycles a year ) , clinical or biochemical hyperandrogenism ( ferriman - gallowey ( fg ) score > 8 or elevated serum testosterone levels ) , and polycystic ovaries on transvaginal usg ( tvusg ) ( enlarged ovaries with increased stromal volume and more than 10 follicles which measure 28 mm in diameter and localize along the periphery of the ovary in a way to form a pearl necklace appearance . thyroid functions , luteinizing hormone / follicle - stimulating hormone ( lh / fsh ) , prolactin , dehydroepiandrosterone sulfate ( dheas ) , 17-hydroxyprogesterone ( 17-ohp ) , androstenedione , and total and free testosterone were checked in patients with pcos and control subjects , and those with thyroid diseases , hyperprolactinemia , cushing s disease , or congenital adrenal hyperplasia and those who were administered agents such as hormonal agents , ovulation inducing agents , glucocorticoids , anti - androgens , or anti - hypertensives over the last 6 months prior to the study were excluded from the study . fifteen patients with body mass index ( bmi ) > 25 and 15 patients with bmi < 25 were included in the pcos groups and 15 healthy control subjects with bmi > 25 and 15 healthy control subjects with bmi < 25 who were between 17 and 35 years of age ( mean 27.64.3 years ) were included in the control groups . they were all clinically normal normo - ovulatory women who were selected for the study based solely on their bmi . all the participants , who were given detailed information about the study , gave their informed consent . bmi was calculated in all participants using the following formula : weight ( kg)/height ( m ) . thus , in the who and nih guidelines for asians , overweight is a bmi between 23 and 24.9 kg / m and obesity a bmi > 25 kg / m . waist and hip circumferences were measured , and those with waist - to - hip ratio ( whg ) > 0.85 were regarded as android obese . waist circumference was measured at the minimum circumference between the iliac crest and rib cage , and hip circumference was measured at the maximum circumference between waist and thighs . nine anatomic regions were assessed on a 4-point scale where 0 meant no growth of terminal hair and 4 meant maximum hair growth . scores below 8 were regarded as normal and scores between 8 and 36 were regarded as pathological . in addition to family history of metabolic disorders , a detailed history including menstrual cycle pattern , temporal or situated in the temples of the head profile , severity of unwanted hair growth , and drug intake was taken at the time of enrollment . clinical examination included measurement of body weight ( kg ) , height ( cm ) , and waist and hip circumferences ( cm ) as well as fg scoring . fg scoring was done by a single observer , and scores above 8 were taken as significant . a single observer performed trans - abdominal or transvaginal ultrasonography to reveal findings of polycystic ovarian morphology ( presence of at least 10 follicles around the ovary that measure 28 mm in size , with increased ovarian volume and/or echogenic ovarian stroma ) . blood samples were taken from the patients at early follicular phase ( between the third and the fifth days of the spontaneous or gestagen - induced menstrual cycle ) . venous blood was taken from the forearm between 08.0010.00 am after 8 h of fasting . blood samples were immediately centrifuged , and sera were kept at 80c until laboratory testing . serum neopterine , tnf- , and il 6 levels were determined using enzyme - linked immunosorbent assay method ( sunred biotechnology company , shanghai , china ) according to the manufacturer s protocols . serum triglyceride ( tag ) and total cholesterol ( total - c ) levels were measured using an architect c 16000 autoanalyzer ( abbott laboratories , abbott park , il , usa ) . vitamin b12 , follicle - stimulating hormone ( fsh ) , luteinizing hormone ( lh ) , and estradiol 2 ( e2 ) levels were determined by electrochemiluminescence immunoassay using a cobas e 601 analyzer ( roche diagnostics , mannheim , germany ) . serum - free testosterone ( f.test . ) levels were analyzed by means of radioimmunoassay ( ria ) using a ria testosterone commercial kit ( immunotech , beckman coulter ) . serum crp levels were measured using immunochemistry system nephelometric method ( image 800 , beckman coulter , usa ) . for n / l ratio measurements , complete blood counts of patients with pcos and control subjects were studied using an automated hematology analyzer ( cell - dyn ruby - abbott diagnostics , usa ) . statistical package for the social science ( spss 10.0 ) was used for data analyses . t test and nonparametric mann - whitney u test were used for comparison of clinical and biochemical data between the groups . whether intra - group variables demonstrated a normal distribution or not was determined by kolmogorov - smirnov test . spearman s correlation analysis was used for investigation of correlation between the values . a p value in addition to family history of metabolic disorders , a detailed history including menstrual cycle pattern , temporal or situated in the temples of the head profile , severity of unwanted hair growth , and drug intake was taken at the time of enrollment . clinical examination included measurement of body weight ( kg ) , height ( cm ) , and waist and hip circumferences ( cm ) as well as fg scoring . fg scoring was done by a single observer , and scores above 8 were taken as significant . a single observer performed trans - abdominal or transvaginal ultrasonography to reveal findings of polycystic ovarian morphology ( presence of at least 10 follicles around the ovary that measure 28 mm in size , with increased ovarian volume and/or echogenic ovarian stroma ) . blood samples were taken from the patients at early follicular phase ( between the third and the fifth days of the spontaneous or gestagen - induced menstrual cycle ) . venous blood was taken from the forearm between 08.0010.00 am after 8 h of fasting . blood samples were immediately centrifuged , and sera were kept at 80c until laboratory testing . serum neopterine , tnf- , and il 6 levels were determined using enzyme - linked immunosorbent assay method ( sunred biotechnology company , shanghai , china ) according to the manufacturer s protocols . serum triglyceride ( tag ) and total cholesterol ( total - c ) levels were measured using an architect c 16000 autoanalyzer ( abbott laboratories , abbott park , il , usa ) . vitamin b12 , follicle - stimulating hormone ( fsh ) , luteinizing hormone ( lh ) , and estradiol 2 ( e2 ) levels were determined by electrochemiluminescence immunoassay using a cobas e 601 analyzer ( roche diagnostics , mannheim , germany ) . serum - free testosterone ( f.test . ) levels were analyzed by means of radioimmunoassay ( ria ) using a ria testosterone commercial kit ( immunotech , beckman coulter ) . serum crp levels were measured using immunochemistry system nephelometric method ( image 800 , beckman coulter , usa ) . for n / l ratio measurements , complete blood counts of patients with pcos and control subjects were studied using an automated hematology analyzer ( cell - dyn ruby - abbott diagnostics , usa ) . statistical package for the social science ( spss 10.0 ) was used for data analyses . t test and nonparametric mann - whitney u test were used for comparison of clinical and biochemical data between the groups . whether intra - group variables demonstrated a normal distribution or not was determined by kolmogorov - smirnov test . in this study , no statistically significant difference was found between patients with pcos and control subjects in age and bmi ( p 0.395 , p 0.760 ) . whr and fg scores were significantly higher in patients with pcos compared to control subjects ( p 0.001 and p 0.000 ) . fasting blood glucose levels and tag were significantly higher in patients with pcos compared to control subjects ( p 0.001 , p 0.014 ) . lh / fsh ratio and f.test were significantly higher in patients with pcos compared to control subjects ( p 0.002 , p 0.014 ) ( table 1 ) . in this study , no statistically significant difference was found between patients with pcos and control subjects in neopterin , il-6 , tnf- and crp levels . however , n / l ratio levels were significantly higher ( p : 0.045 ) and vitamin b12 levels were significantly lower ( p : 0.033 ) in patients with pcos compared to control subjects ( table 1 , figure 1 ) . whr and fg scores , which were used for rating of hirsutism , were significantly higher in both obese and non - obese patients with pcos compared to control subjects ( p 0.000 and p 0.000 ; p 0.000 and p 0.024 , respectively ) . the comparison between obese patients with pcos and obese control subjects showed that fasting blood glucose levels were significantly higher in obese patients with pcos ( p : 0.001 ) . total - c and tag levels and lh / fsh ratio were significantly higher in the non - obese group with pcos compared to control subjects ( p 0.001 , p 0.007 and p 0.024 , respectively ) . crp levels were significantly higher in obese patients with pcos compared to control subjects ( p 0.007 ) . in the non - obese groups , il-6 levels were significantly higher in patients with pcos compared to control subjects ( p 0.021 ) ( table 2 , figure 1 ) . whr were significantly higher in obese patients with pcos compared to non - obese patients with pcos ( p 0.047 ) . triglyceride and crp levels were significantly higher in obese patients with pcos compared to non - obese patients with pcos ( p 0.029 and 0.018 , respectively ) ( table 3 ) . n / l ratio levels were found to be significantly higher in non - obese patients with pcos compared to obese control subjects ( p : 0.042 ) . in addition , il-6 levels were significantly higher in non - obese patients with pcos compared to obese patients with pcos . furthermore , crp levels were significantly higher in obese patients with pcos compared to non - obese patients with pcos ( p : 0.018 ) ( table 3 ) . in addition , vitamin b12 was negatively correlated with lh / fsh ratio , and no correlation was found between vitamin b12 and the inflammatory markers ( table 4 ) . the correlation analysis was performed in the present study demonstrated that tag and total - c were positively correlated with crp . we found that neopterin , il-6 , tnf- , and n / l ratio were positively correlated with the pcos parameters . furthermore , we demonstrated that neopterin and il-6 were positively correlated with lh / fsh ratio , a pcos biomarker ( r : 0.443 * p 0.014 and r 0.373 * p 0.042 , respectively ) . neopterin and tnf- , on the other hand , was positively correlated with e2 ( r 0.612 * * p 0.000 and r 0.431 * p 0.001 , respectively ) . in addition , vitamin b12 levels were found to be significantly lower in patients with pcos . the correlation analysis revealed a negative correlation between vitamin b12 and lh / fsh ratio ( figure 2 ) . the correlation analysis that was performed between crp , bmi , whr , tag , and total - c levels found a positive correlation between crp levels and bmi , whr , tag , and total - c levels ( table 4 , figure 2 ) . several studies reported an increased risk for cardiovascular diseases in patients with pcos ; however , the reason for this increased cardiovascular risk has not been clarified yet . chronic low - grade inflammation , such as is seen in individuals with an excess of visceral / ectopic fat , plays an important role in cardiovascular disorders , in addition to atherosclerosis , which is strongly influenced by the inflammatory components of visceral obesity . compared with that of lean individuals , adipose tissue in obese persons shows higher expression of proinflammatory proteins , including tnf- , interleukin 6 ( il-6 ) , transforming growth factor 1 , monocyte chemotactic protein 1 , inducible nitric oxide synthase , procoagulant proteins such as tissue factor , and factor vii plasminogen activator inhibitor type 1 . the purpose of this study was to investigate inflammatory markers in pcos as well as the impact of obesity on the inflammatory markers . n / l ratio levels were significantly higher in patients with pcos compared to control subjects . n / l ratio levels were found to be significantly higher in non - obese patients with pcos compared to obese control subjects ( p 0.042 ) . differences between the neopterin , crp , il-6 , and tnf- levels were not statistically significant in patients with pcos compared to control subjects . this result might have been caused by the limited number of participants included in this study . we used ultrasound to assess central obesity ; however , to evaluate central obesity magnetic resonance ( mr ) , computed tomography ( ct ) , and dual energy x - ray absorptiometry ( dexa ) may also used . patients as well as control subjects were divided into 2 groups as those with bmi > 25 and those with bmi < 25 , and it was found that only 1 inflammatory marker crp the increased inflammation in patients with pcos has not been clearly explained yet , and it is still unknown whether it is caused by pcos itself or the accompanying obesity . a meta - analysis reported increased wbc and crp levels in patients with pcos , and the increase was found to be independent of obesity . however , the meta - analysis had the limitation of inadequate bmi matching concerning the studies included . many researchers found increased crp levels in obese and non - obese patients with pcos compared to bmi - matched control subjects . in addition , crp levels were reported to be significantly higher in a pcos group with bmi > 25 however , there was no significant difference in crp levels between non - obese insulin - resistant pcos group and non - obese control subjects . the results of the present study were in agreement with those of the abovementioned studies , showing that crp might be affected by obesity . studies showed that n / l ratio correlated with crp in several diseases with chronic inflammation such as hypertension and diabetes mellitus . in this study crp was positively correlated with bmi , whr , tag , and total - c . studied leukocytes as an inflammatory marker , and found that neither patients with pcos nor control subjects had leukocytosis ; however , leukocyte count was significantly higher in patients with pcos . these results were interpreted as a potential explanation for the increased cardiovascular risk in patients with pcos . in the present study , n / l ratio levels were found to be significantly higher in patients with pcos compared to control subjects . in addition , crp levels were significantly higher in obese patients with pcos ( p 0.018 ) . it can be inferred from these results that increased inflammation is responsible for the increased risk for cardiovascular diseases and niddm in patients with pcos . as to the comparison between non - obese patients with pcos and obese control subjects , crp levels were higher in patients with pcos but the difference was not statistically significant . we also found that crp was positively correlated with bmi and therefore was affected by obesity . however , it could increase independent of obesity in patients with pcos but the increase would be more significant in obese patients compared to non - obese patients . high serum neopterin levels in patients with atherosclerotic diseases revealed that immunological mechanisms might be responsible for development of atherosclerosis and related complications . it was reported that neopterin , a key molecule taking part in organization of immune response , was released from active macrophages of atheromatous plaque and could be helpful for cardiovascular risk stratification . in this study , neopterin levels were higher in patients with pcos , but the difference was not statistically significant , perhaps due to the limited number of cases in our study . this finding suggests that macrophage activation occurs in women with pcos , as has been reported in cardiovascular disease . found that increased concentrations of scrp , neopterin , and wbc might be a contributory factor in increased risk for cardiovascular diseases in patients with pcos . in addition to the widely known risk factors for cvds ( such as hypertension , dyslipidemia , insulin resistance , and obesity ) , pcos comes to the foreground as a new risk factor for cvds . it was shown for the first time by this study that patients with pcos had significantly higher serum neopterin levels compared to healthy women with regular menstrual cycles . in the present study , n / l ratio levels were significantly higher in patients with pcos compared to control subjects . increased concentrations of n / l ratio might be a contributory factor in increased risk for cardiovascular diseases in patients with pcos . subclinical inflammation is considered to be a cause of atherogenesis , and il-6 and tnf- are also regarded as classic cardiovascular risk factors . the most widely known and perhaps the most important systemic effect of il-6 is the effect on acute - phase proteins , particularly c - reactive protein ( crp ) . pcos is a proinflammatory disorder , and several studies on pcos demonstrated increased levels of circulatory inflammatory markers such as plasminogen activator inhibitor-1 , il-18 , tnf- , il-6 , and hscrp . gonzalez et al . found that serum tnf- and il-6 levels were increased in patients with pcos and that the excess of adipose tissue was the most probable source . in this study , il-6 levels were significantly higher in non - obese patients with pcos compared to obese patients with pcos . it was demonstrated that il-6 is positively correlated with lh / fsh ratio , a pcos biomarker . our study supports the studies in the literature showing that inflammation markers increase in pcos , independent of obesity . it was shown that inflammatory markers that indicate low - grade chronic inflammation such as crp and il-6 were important predictors of niddm development . crp levels were found to be elevated in patients with pcos , and this finding was considered to be supportive of the hypothesis that elevated crp levels triggered chronic inflammation , leading to an increased risk for niddm and cvds in pcos . kurt et al . found significantly increased levels of crp , leukocytes , and neutrophils , which are inflammatory markers , and the increase was reported to be independent of obesity . although closely related to hyperglycemia , tnf- is produced independently of obesity . in the present study , when obese patients with pcos were compared to the non - obese patients with pcos , we found that il-6 levels were significantly higher in non - obese patients ( p 0.021 ) . in addition , il-6 and neopterin were positively correlated with lh / fsh ratio , a pcos biomarker , and tnf- was negatively correlated with whr . therefore , we conclude that il-6 and tnf- are positively correlated with pcos biomarkers , independent of obesity . in the present study , whr was found to be significantly higher in patients with pcos ( both obese and non - obese ) compared to control subjects , which led to the consideration that central body fat deposition occurred in a pathophysiological mechanism that was independent of obesity in patients with pcos . hosseinzadeh and rocha - gonzalez found that cyanocobalamin may have anti - inflammatory effect ( 38 , 39 ) . found significantly lower serum vitamin b12 levels in obese patients with pcos compared to obese control subjects . in the present study , as well , serum vitamin b12 levels were significantly lower in patients with pcos ( p 0.033 ) . however , unlike the abovementioned study , no significant difference was found between obese and non - obese patients with pcos . therefore , b12 can say that independently of obesity decreased in pcos . in the present study inflammatory activity is increased in patients with pcos , can lead to an increased risk for atherosclerosis , and this increase is not caused by obesity but rather by the polycystic ovary syndrome itself .

backgroundwe aimed to measure the levels of inflammatory markers and neopterin in obese and non - obese patients with pcos by using 2 separate control groups with matching body mass index ( bmi).material / methodsa total of 60 women of reproductive age with ( n=30 ) and without ( n=30 ) pcos were included in this study . based on their bmi , patients with pcos were divided into 2 groups as obese ( n=15 ) and non - obese ( n=15 ) pcos groups . in addition , 2 bmi - matched control groups were formed . neopterin , tumor necrosis factor- ( tnf- ) , interleukin-6 ( il-6 ) , c - reactive protein ( crp ) , neutrophil - to - lymphocyte ratio ( n / l ratio ) , and vitamin b12 were assessed by complete blood count.resultsno significant difference was found between patients with pcos and control subjects in neopterin , il-6 , tnf- , and crp levels . however , n / l ratio levels were significantly higher ( p 0.045 ) and vitamin b12 levels were significantly lower ( p 0.033 ) in patients with pcos compared to control subjects.no statistically significant difference was found between obese and non - obese patients with pcos and control subjects in neopterin , il-6 , tnf- , and n / l ratio levels . however , crp levels were significantly higher in obese patients with pcos compared to obese control subjects ( p 0.007).conclusionsit can be concluded that inflammatory activity is increased in patients with pcos , can lead to an increased risk for atherosclerosis , and this increase is not caused by obesity but rather by the polycystic ovary syndrome itself . however , studies with larger sample sizes are needed in this area .

based on the recent definitions having more than three of the following symptoms confirm the existence of metabolic syndrome in a patient . these symptoms include hypertension , triglyceridemia , dyslipidemia , abdomen obesity , and resistance to insulin , increase of c protein and fibrinogen . moreover , both metabolic syndrome and periodontitis coincide with systemic inflammation and glucose tolerance disorder , which indicate the common pathophysiologic pathway of these diseases . nevertheless , there is a little information about the relation of metabolic syndrome and hemodialysis ( hd ) . meanwhile , periodontitis and metabolic syndrome are prevalent in the patients suffering from hd . however , there is a little information about their association . although there are no specific signs in the mouth indicating the presence of chronic kidney disease , a whole range of changes occur in the mouth that is associated with chronic kidney disease and hd . this condition has been reported to affect the teeth , oral mucosa , bone , periodontium , salivary glands , tongue , mouth cavity , and temporomandibular joint . these patients suffer from bad taste in their mouth , xerostomia , severe periodontitis , poor dental status , no carious tooth tissue loss , and a 14% prevalence of moderate to severe periodontitis was reported among individuals > 20 years of age in the usa population . in their study , shimazaki et al . and khader et al . separately showed that the patients suffering from metabolic syndrome show more pocket depth and attachment loss . they concluded that metabolic syndrome increases the risk of periodontitis and thus , the patients with metabolic syndrome symptoms must be examined to diagnose whether they are affected by periodontitis or not . moreover , d'aiuto et al . and chen et al . separately showed that severe periodontitis is associated with metabolic syndrome in hd patients . it was concluded from nesbitt 's study that the volunteers with average to severe bone resorption had a higher chance to be affected by metabolic syndrome . since metabolic syndrome is a crucial problem of the society , it is necessary to determine the at - risk individuals to control it and decrease the mortality rate . a more exact and precise understanding of the metabolic syndrome side effects and the involving mechanisms can help to control and overcome it effectively . moreover , the on - time diagnosis of the disease inhibits its progress and increases the patient 's lifetime . based on the previous research , it seems that no study has been done to compare the healthy people and hd patients suffering from metabolic syndrome in iran . hence , the main goal of this research was to determine the effects of the metabolic syndrome on the periodontal indices of hd patients . in this descriptive - analytical study , 75 persons were selected by the simple method , 50 of them were hd patients ( for 5 years ) , and 25 of them were healthy people . the inclusion criteria to allow the patients to participate in the research are as follows : the patient must have more than 10 teeththe patient must not have the local alterations such as previous surgery or bone transplantation to change the results of the studythe patient must not smoke or take antibiotics from last 2 weeks onward . the patient must have more than 10 teeth the patient must not have the local alterations such as previous surgery or bone transplantation to change the results of the study the patient must not smoke or take antibiotics from last 2 weeks onward . the first group included 25 hd patients not suffering from metabolic syndrome ; the second group included 25 hd patients suffering from metabolic syndrome and the third group , namely the control group of the study , included 25 healthy persons ( not affected by hd and metabolic syndrome ) . age , gender , and physical condition were matched between the groups . to minimize the role of the intervening factors . this study was carried out at one of the therapeutic centers of najaf abad city . at first evaluation of the metabolic syndrome was done considering the five specifications according to the definition of the national cholesterol education program society of america as follows : abdomen obesity : the size of the waist more than 102 cm for men and more than 88 for womenhypertriglyceridemia : triglyceride more than 150 mg / dlhigh - density lipoprotein cholesterol : men < 40 mg / dl and women < 50 mg / dlhypertension : systolic > 130 mmhg and diastolic > 85 mmhghigh plasma glucose : glucose > 110 mg / dlat least , three of the above - mentioned specifications must be at the threshold level or higher to confirm the metabolic syndrome in the patient . then , the periodontal conditions of the selected persons were determined by radiography and the bone resorption was calculated by two periodontitis . to measure the bone resorption , digital panoramic radiography was used . the distance from the crest of the bone to the cement - enamel junction the distance more than 2 mm was considered as the bone resorption . considering the enlargement probability of the radiographies , the manufacturer 's guidelines were used to analyze the resorption value , and the exact values were obtainedafter selecting the patients , the average value of the bone resorption of the groups under study was measured and registered . then , the gingival index was calculated by the leo index in four points . to determine the probing pocket depth , the distance from the edge of the gingiva to the depth of the gingival fissure was measured using williams probe . the bleeding index in the interproximal areas then , the periodontal indices of the patients suffering from metabolic syndrome and the persons not affected by metabolic syndrome were compared . at the end , the data were analyzed by spss20 ( ibm , armonk , ny , united states of america ) using mann whitney and kruskal wallis tests at the meaningful level of = 0.05 . abdomen obesity : the size of the waist more than 102 cm for men and more than 88 for women hypertriglyceridemia : triglyceride more than 150 mg / dl high - density lipoprotein cholesterol : men < 40 mg / dl and women < 50 mg / dl hypertension : systolic > 130 mmhg and diastolic > 85 mmhg high plasma glucose : glucose > 110 mg / dl at least , three of the above - mentioned specifications must be at the threshold level or higher to confirm the metabolic syndrome in the patient . then , the periodontal conditions of the selected persons were determined by radiography and the bone resorption was calculated by two periodontitis . to measure the bone resorption , digital panoramic radiography was used . the distance from the crest of the bone to the cement - enamel junction the distance more than 2 mm was considered as the bone resorption . considering the enlargement probability of the radiographies , the manufacturer 's guidelines were used to analyze the resorption value , and the exact values were obtained after selecting the patients , the average value of the bone resorption of the groups under study was measured and registered . then , the gingival index was calculated by the leo index in four points . to determine the probing pocket depth , the distance from the edge of the gingiva to the depth of the gingival fissure was measured using williams probe . then , the periodontal indices of the patients suffering from metabolic syndrome and the persons not affected by metabolic syndrome were compared . at the end , the data were analyzed by spss20 ( ibm , armonk , ny , united states of america ) using mann whitney and kruskal wallis tests at the meaningful level of = 0.05 . the mean , minimum , maximum , median and standard deviation of the bone resorbtion analysis is shown in table 1 . the mean , minimum , maximum , median , and standard deviation of the probe depth for the groups being studied in terms of mm is shown in table 2 . the mean , minimum , maximum , median and standard deviation of the bone resorbtion analysis for the studied groups the mean , minimum , maximum , median and standard deviation of the probe depth for the studied groups in figure 1 , the frequency distribution of the groups under study according to the bleeding index of the gingiva around the teeth is shown . the frequency distribution of the groups under study according to the bleeding index of the gingiva around the teeth . in figure 2 , as it can be seen , the mean of the bone resorption , the mean of the probing depth , the value of the gingival index , and the bleeding index of the hd patients with metabolic syndrome show the maximum levels and those of the control group show the minimum values . since the condition of the unilateral variance test could not be provided for this study , the kruskal the obtained results showed a meaningful difference among the groups under study ( p < 0.001 ) . to complete the test , the mann the results of the test showed a significant difference among the obtained indices of the groups being studied in the binary form ( p < 0.001 ) too . periodontitis is an intensive response to the local pathogens of the gingival areas and periodontal tissues which resultsin bone resorption and tooth loss . previous studies have shown the high frequency of periodontitis in hd patients . in the patients suffering from periodontitis all of the risk factors are interrelated in a vicious circle : whereas poor oral health may lead to both inflammation and protein - energy wasting in hd patients , numerous pathways associate the accumulation of proinflammatory cytokines with different aspects of protein - energy wasting , including anorexia , muscle loss , low anabolic hormones , increased energy expenditure , and insulin resistance . the mean of the bone resorption for hd patients suffering from metabolic syndrome was calculated as 1.99 mm , for hd patients not suffering from metabolic syndrome as 1.45 mm and for the control group ( not suffering from hd and metabolic syndrome ) as 0.63 mm [ table 1 ] . the difference between the groups understudying the binary form was statistically significant ( p < 0.05 ) . hence , the maximum value of the bone resorption was observed in the group affected by both the metabolic syndrome and hd , and the minimum value was observed in the control group , including the healthy persons . therefore , the obtained results of this study are in line with the results of schimazaki 's , nesbitt et al . , chen et al . , and d'aiuto et al . hence , it can be concluded that because of the additive effect of metabolic syndrome and hd , the mean of the bone resorption will increase in such patients . furthermore , in this study , the means of the probe depth for the hd patients suffering from metabolic syndrome , the hd patients not suffering from metabolic syndrome and the control group including healthy persons were 2.73 , 2.17 , and 1.48 mm , respectively . hence , the patients suffering from both metabolic syndrome and hd showed the maximum value for probe depth and the control group , including the healthy persons showed the minimum value for the probe depth . thus , the results of this study are in agreement with the results of shimazaki et al . and therefore , it can be concluded that the additive effect of the metabolic syndrome and hd will increase the mean probe depth of the patients . in this study , the frequency of the gingival bleeding index showed the maximum value in the hd patient suffering from metabolic syndrome . furthermore , the results of this study revealed that the patients suffering severely from systemic inflammation showed a higher percentage of the gingival index frequency so that the patients suffering from both hd and metabolic syndrome showed the maximum value and the control group showed the minimum value of the gingival index . the difference between the groups being studied in the binary form was statistically significant ( p < 0.05 ) . therefore , the additive effect of the metabolic syndrome and hd increased the gingival index . in regard , based on the results obtained in a study on the 4 considered specifications of the periodontal indices , it can be concluded that the more the severity of the systemic disease increases , the more the health of the periodontal tissues will decrease . so that , in this study all the periodontal indices of the hd patients suffering from metabolic syndrome were at the lowest level in comparison with other groups and the patient not suffering from metabolic syndrome as well as the control group were in the second and third positions , respectively . the causes can be attributed to the hemodialysis role to disable the patient to care for his mouth and tooth health , the same risk factors of the metabolic syndrome and periodontal disease which intensify the periodontal disease and the suppression of the immune system resulting from chronic diseases . this study was limited by some factors , including a low number of the samples and the impossibility of the prevalence calculation of metabolic syndrome in the patients suffering from periodontal disease . a cross - sectional study with a limited case number , it has a little clinical impact , so the confounding effect of glucose intolerance or overt diabetes mellitus can not be clearly excluded in a small - scale study also panoramic is not a suitable radiographic for bone loss evaluation due to distortions and superimpositions , so a better radiographic is recommended . the results of this study revealed when the severity of chronic systemic disease increased the health of the periodontal tissues would decrease in such a manner that the hd patients suffering from metabolic syndrome showed the lowest level of health for the periodontal tissues , and the hd patients not suffering from metabolic syndrome and the control group showed the highest level of health , respectively . the authors of this manuscript declare that they have no conflicts of interest , real or perceived , financial or non - financial in this article . the authors of this manuscript declare that they have no conflicts of interest , real or perceived , financial or non - financial in this article .

background : the metabolic syndrome and periodontitis coincide with systemic inflammation and glucose tolerance disorder , which indicate the common pathophysiologic pathway of these diseases . the main goal of this study was to determine the effects of the metabolic syndrome on the periodontal indices of hemodialysis ( hd ) patient.materials and methods : in this descriptive - analytical study , 75 persons were selected by the simple method , 50 of them were hd patients , and 25 of them were healthy people . they were divided into three groups each of which included 25 persons . the periodontal conditions of the selected persons were determined by radiography , gingival index , probing pocket depth , and bleeding index . then , the periodontal indices of the patients suffering from metabolic syndrome and the persons not affected by metabolic syndrome were compared . at the end , the data were analyzed by spss software ( version 20 ) using mann whitney and kruskal wallis tests at the meaningful level of = 0.05 . since the condition of the unilateral variance test could not be provided for this study , the kruskal wallis test was used . to complete the test , the mann whitney test was used in the binary form among the groups being studied.results:the obtained results showed a meaningful difference among the groups under study ( p < 0.001 ) . the results of the test showed a meaningful difference among the obtained indices of the groups being studied in the binary form ( p < 0.001 ) too.conclusion:the results of the present study revealed when the severity of chronic systemic disease increased the health of the periodontal tissues would decrease .

mucormycosis is a rare but aggressive opportunistic fungal infection that is commonly caused by members of the family mucoraceae that include rhizopus , rhizomucor , mucor and absidia . mucormycosis can cause severe , sometimes fatal disease in susceptible individuals with uncontrolled diabetic ketoacidosis , neutropenia , chronic glucocorticoid use , hematological malignancy , chronic malnutrition and burn patients.13 rhino - orbito - cerebral mucormycosis ( rocm ) is an uncommon infection in immunocompetent hosts . rocm invades vessels , soft tissue , nerves , bone and cartilage producing tissue infarction and ultimately leading to tissue necrosis and vessel thrombosis.4 we present a case of an immunocompetent patient who survived rocm due to saksenaea vasiformis , and review the literature of this fatal condition . a 40-year - old healthy male presented with painful swelling in the left eye for two weeks . there was no history of eye trauma , dental carries , recent surgery , sinusitis or skin infection . the visual acuity was 6/60 in the left eye with 2-mm axial proptosis , with conjunctival congestion and limited ocular motility . the pupils were reactive bilaterally , with no evidence of a relative afferent pupillary defect in either eye . the patient was diagnosed with orbital cellulitis in the left eye . however , the primary cause was undetermined . broad spectrum antibiotic therapy was initiated that included intravenous cloxacillin 500 mg every 6 h , cefuroxime 750 mg every 8 h and metronidazole 500 mg every 8 h. there was minimal clinical improvement with the above regime after one week of hospitalization . the patient presented two weeks later to a tertiary hospital with severe pain and persistent purulent discharge and no light perception in the left eye . both upper and lower lids were swollen with discharging fistula proximal to the lateral canthus [ figure 1 ] . general examination revealed an alert , afebrile and well - oriented patient with no neurologic deficit . complete loss of globe structure and fistula formation on presentation plasma glucose , blood urea , full blood count and liver function test were normal . computed tomography ( ct ) of the brain and orbit showed destruction of the left eye , with an ill - defined mass and ring enhancement involving left pterygopalatine , inferotemporal fossa and adjacent bony destruction . it extended posteriorly to the orbital apex , causing a widening of the optic nerve canal and the superior orbital fissure . the cavernous sinus showed signs of thrombosis and presence of areas of infiltrate at the left maxillary , frontal and sphenoidal sinuses [ figure 2 ] . ( a ) ct scan of the orbit showing proptosis and distortion of the left globe ( b ) ct scan of brain ( post contrast ) showing an enhancement of the cavernous sinus suggestive of thrombosis a presumptive clinical diagnosis of rocm was made . intravenous amphotericin b 1.0 mg / kg / day was initiated after a test dose . the patient had no significant side effects due to intravenous amphotericin b. the patient consented to exenteration of left eye and extensive sinus debridement surgery . histopathology revealed broad , aseptate , long and right angled branching hyphae consistent with mucormycosis [ figure 3 ] . the intravenous amphotericin b stopped after 4 weeks of therapy and he was discharged with instructions to instill topical amphotericin b for another four weeks . photomicrograph showing aseptate , long broad , slender right angled branching hyphae , which is pathognomonic of mucormycosis postoperatively , the patient refused to repeat imaging and implantation of eye prosthesis due to poor family support and financial constraints . to date , the patient has been followed up for two and a half years with recurrence of rocm . rocm is usually associated with a fatal outcome especially in immunocompromised patients . for the last decade we reviewed 11 cases of rocm in immunocompetent hosts published in pubmed from 2000 to 2011 . table 1 summarizes age , gender , presentations , risk factor , causative organism and final outcome . summary of previous literature on rhino - orbito - cerebral mucormycosis in immunocompetent patients published in pubmed from 2000 to 2011 the presenting age ranged between 16 and 59 years and both genders were equally affected . nine out of 11 published cases were due to apophysomyces elegans.59 there was only one reported case of rocm caused by saksenaea vasiformis.11 apophysomyces elegans is an emerging pathogen that causes rocm via inhalation . whereas , saksenaea vasiformis is a soil saprophytic fungus and the only species in the genus saksenaea . in the previously reported cases , 7 immunocompetent patients who survived were infected by apophysomyces elegans.58 among three patients who died , two were infected by apophysomyces elegans and one with saksenaea vasiformis.8911 two of these three patients were above 50 years of age and died due to extensive brain involvement and severe cerebral vascular insult.811 this finding is similar to the findings of hargrove et al.12 that patients older than 46 years with concurrent frontal sinus involvement and fever were less likely to survive orbital mucormycosis . our patient was very fortunate to survive this fatal condition despite delayed diagnosis and treatment . this is likely due to his relatively young age and the lack of a pre - existing chronic medical illness . to the best of our knowledge , this is the first reported case of an immunocompetent patient with rocm due to saksenaea vasiformis who survived . our patient and other immunocompetent patients who survived rocm were treated with a combination of systemic amphotericin b , orbital exenteration and adjacent tissue debridement.58 this is consistent with roden et al.,1 who reported a survival rate of 70% for cases treated with antifungal and surgery . in contrast , only 61% of cases treated with amphotericin b deoxycholate only , 57% of cases that underwent only surgery and only 3% of untreated patients survived.1 in conclusion , diagnosis of rocm in immunocompetent patients is always misleading and possibly causes delay in treatment . it is essential to alert the managing ophthalmologist of the emergence of this rare disease among healthy individuals .

rhino - orbito - cerebral mucormycosis is a fungal infection that can be fatal especially in immunocompromised patients . it is extremely rare in immunocompetent individuals . we describe here an immunocompetent patient who survived rhino - orbito - cerebral mucormycosis due to saksenaea vasiformis , and provide a literature review of this rare entity .

crohn s disease ( cd ) is a chronic inflammatory disorder of the gastrointestinal tract characterized by focal , asymmetric , transmural inflammation of uncertain etiology and of an unpredictable course . the clinical presentation of cd is characteristically manifested by repeated cycles of active and quiescent disease of definable patterns according to disease location and types ( inflammatory , fibrostenotic and fistulizing).1,2 the prevalence and incidence of cd in the united states is estimated to be 50 per 100,000 and 5 per 100,000 annually , respectively.3 the treatment regimen is individualized based on disease activity , location and behavior taking into the account the balance between medications and their side effects and prevention of complications . the treatment of cd remains empirical and the disease is not curable since no clear etiology of cd disease has been yet elucidated . munkholm et al in their population - based cohort study from scandinavia4 demonstrated that among all patients treated with 5-aminosalicylic acid ( 5-asa ) agents and corticosteroids ( cs ) , 13% of patients will achieve complete remission , 20% of patients will experience annual relapse and 67% will have a combination of relapse and remission within the first 8 years after initial diagnosis . less than 5% of patients will have a continuous course of active disease . another population - based cohort based in olmsted county , minnesota , which was conducted prior to the routine use of anti - tumor necrosis factor ( anti - tnf ) agents , confirmed that a representative patient with cd would be expected to spend 24% of the time in medical remission without medications , 41% of the time in post - surgical remission without medications , 27% of the time in medical treatment with 5-asa derivatives and 7% of the time having disease activity requiring treatment with corticosteroids or immunomodulators.5 although cd has been recognized as having a chronic relapsing course , it is evident that the majority of patients remain in clinical remission at any particular time . however it is recognized that the majority of patients will progress from inflammatory to complicated fistulizing or penetrating disease over time . the cumulative risk for the development of a cd - related fistula has been estimated to be 33% at 10 years and 50% after 20 years based on a population based cohort study form olmsted county , mn.6 therefore the treatment strategies for cd must target lifelong management , addressing both short - term and long - term aspects of the disease and are guided by the disease location , severity , associated complications and concurrent therapy taken by the patients . these treatment strategies consist of a sequential ( step up ) approaches ranging from the first line agents such as 5-asa , controlled released corticosteroids ( budesonide ) and antibiotics all used to treat mild to moderate active cd to the second line with oral prednisone and the third line with conservative use of immunomodulators ( azathioprine ( aza ) , 6-mercaptopurine and methotrexate ) and further biological therapy ( infliximab , adalimumab , czp and natalizumab ) . recently , 5-asa has been critically analyzed for treatment of patients with cd and is suggested to be no more effective than placebo.7 however , recent data suggest that early initiation of combined treatment with immunomodulators and anti - tnf agents ( infliximab ) ( top down ) was more efficacious than conventional management with cs followed by aza and then infliximab8 in prior anti - tnf and anti - metabolite nave patients . therapy with anti - tnf antibodies has become a mainstay of treatment for patients with cd who are unresponsive to conventional medical management . currently there are three anti - tnf agents that have been approved by the u.s . food and drug administration ( fda ) in the treatment of cd , namely infliximab , adalimumab and czp . infliximab ( remicade ) is administered intravenously whereas adalimumab ( humira ) and czp ( czp ) ( cimzia ) are administered subcutaneously . treatment with infliximab consists of an initial loading regimen with three initial infusions at the dose of 5 mg / kg at week 0 , 2 and 6 followed by every 8 week maintenance schedule.9 treatment with adalimumab ( administered subcutaneously ) consists of initial loading dose of 160 mg ( given either in four doses of 40 mg each within 1 day or in two daily doses of 40 mg each over two consecutive days ) followed by 80 mg dose given two weeks later with initiation of maintenance treatment after additional 2 weeks at dose 40 mg every 2 weeks.10 treatment with czp is initiated with an initial loading dose of subcutaneous injection of 400 mg at weeks 0 , 2 and 4 followed by maintenance treatment every 4 weeks.11 czp was approved in april 2008 by the us food and drug administration and is currently approved for reducing signs and symptoms of cd and for maintaining clinical response in adult patients with moderate to severe activity of the disease with inadequate response to conventional therapy.12 anti - tnf therapy ( infliximab , adalimumab and czp ) was found to be significantly more efficacious than placebo in inducing remission at week 4 with a total mean difference in effect between anti - tnf agents and placebo of 11% ( 95% ci 6%16% , p < 0.001 ) based on the results of a meta - analysis of fourteen randomized placebo controlled trials that included a total of 3995 patients with cd.13 these biologic medications were also significantly superior over placebo in maintaining remission at weeks 20 through 30 with total mean difference in effect between active and placebo arms of 23% ( 95% ci 18%28% , p < 0.001 ) among patients who responded to an open - label induction with either infliximab , adalimumab or czp followed by randomized placebo controlled maintenance treatment.13 this review discusses the efficacy of czp and adherence to anti - tnf therapy with a particular focus on czp in patients with cd . the efficacy of czp was evaluated in two dose - response phase ii ( n = 384)14,15 and two phase iii ( the pegylated antibody fragment evaluation in cd disease : safety and efficacy 1 ( precise 1 ) and precise 2)16,17 ( n = 1330 ) randomized placebo controlled trials in adult patients with moderate to severe cd ( table 1 ) . the first phase ii trial ( n = 92 ) assessed efficacy of czp over 12 weeks period after single 30-minute intravenous infusion of either czp ( cdp870 ) ( 1.25 mg / kg , 5 mg / kg , 10 mg / kg or 20 mg / kg ) versus placebo.14 the primary endpoint was clinical response ( decrease in crohn s disease activity index ( cdai ) score at least by 100 points when compared to baseline ) at week 4.14 czp demonstrated similar efficacy to placebo in achieving primary endpoint ( 60% for 5 mg / kg , 58.8% for 10 mg / kg , 47.8% for 20 mg / kg vs. 56% for placebo).14 similarly , no difference between any dose of czp and placebo was observed with respect to secondary endpoints ( clinical response , remission , cdai score decrease by 70 points , c - reactive protein ( crp ) levels at weeks 2 , 8 , 12).14 on the other hand , czp given at 10 mg / kg was significantly more efficacious than placebo in inducing remission at week 2 ( 47.1% vs. 16% , p = 0.041).14 the second phase ii 12-week trial ( n = 292 ) evaluated efficacy of czp administered subcutaneously ( 100 mg , 200 mg or 400 mg ) or placebo.15 treatment with czp was not superior over placebo as assessed at the primary study endpoint ( clinical response at week 12 ) with the response rates among active drug arm of 36.5% ( 100 mg ) , 36.1% ( 200 mg ) and 44.4% ( 400 mg ) and in the placebo arm of 35.6%.15 however , czp was superior to placebo in achieving clinical response at week 2 ( 100 mg , 200 mg and 400 mg ) , 4 ( 200 mg and 400 mg ) , 8 ( 100 mg and 400 mg)and 10 ( 400 mg ) with the highest rates for 400 mg dose at any analyzed.15 in addition , czp was superior to placebo in inducing clinical remission at week 4 ( 100 mg , 200 mg and 400 mg ) and week 8 ( 100 mg and 400 mg ) but not week 12.15 treatment with the highest dose of czp ( 400 mg ) was superior to placebo in achieving primary ( 53.1% vs. 17.9% , p = 0.005 ) and secondary endpoints in patients with high baseline levels of crp ( 10 mg / l ) but not in those with low baseline crp levels in post - hoc analysis.15 based on these findings it was proposed that the efficacy of czp over placebo might not have been demonstrated due to the high placebo response rate in the large cohort of patients with low baseline level of crp.15 the latter findings were taken into consideration in the phase iii 26-week precise 1 trial ( table 1).16 patients in this trial ( n = 660 ) were stratified based on low ( < 10 mg / l ) or high ( 10 mg / l ) baseline crp levels and then randomized to subcutaneous injections of either czp 400 mg or placebo given every 2 weeks through week 4 and then every 4 weeks through week 26.16 czp was found to be significantly more efficacious in achieving the primary endpoint ( at least 100 point decrease in cdai score at week 6 and both weeks 6 and 26 in a cohort of 302 patients with high baseline crp levels ) with rates of 37% vs. 26% ( wk 6 , p = 0.04 ) and 22% vs. 12% ( both wk 6 and 26 , p = 0.05).16 in an overall cohort treatment czp was superior to placebo in achieving clinical response at week 6 ( 35% vs. 27% , p = 0.02 ) and both weeks 6 and 26 ( 23% vs. 16% , p = 0.02).16 on the other hand , no significant difference was found between the active arm and placebo arm with respect to achieving remission at any time point among all patients ( wk 6 : 22% vs. 17% , p = 0.17 ; both wk 6 and 26 : 14% vs. 10% , p = 0.07 ) or patients with high baseline crp level ( wk 6 : 22% vs. 17% , p = 0.29 ; both wk 6 and 26 : 13% vs. 8% , p = 0.24).16 concomitant use of immunosuppressants or cs , previous infliximab therapy or smoking status did not influence the response rates at the aforementioned time points.16 the presence of antibodies to czp were detected in 8% of czp - treated patients with a 4% rate in czp - treated patients who also received immunosuppressive agents and with 10% rate in czp - treated patients who did not receive concomitant immunosuppressive agents.16 the subsequent precise 2 trial ( table 1 ) observed that czp was superior to placebo in maintaining response and clinical remission in responders to induction therapy with czp.17 among patients who received an open - label induction therapy with 3 single doses of 400 mg czp given subcutaneously every 2 weeks 64% ( 428/668 ) responded ( at least 100 point decrease in cdai score vs. baseline score).17 these patients were stratified according to baseline crp levels ( 10 vs. < 10 mg / l ) and randomized to receive subcutaneously either czp 400 mg or placebo administered every 4 weeks through week 24 with follow - up through week 26.17 therapy with czp was superior to placebo in maintaining response to treatment through week 26 in patients with baseline high c - reactive protein levels ( primary end point ) ( n = 213 , 62% vs. 34% , p < 0.001 ) and in the intention to treat population ( n = 425 , 63% vs. 36% , p < 0.001).17 czp was also significantly superior to placebo in achieving clinical remission at week 26 in the cohort with high baseline crp ( 42% vs. 26% , p = 0.01 ) and in all patients in the intention to treat population ( 48% vs. 29% , p < 0.001).17 antibodies to czp were detected in 18% of patients receiving placebo maintenance therapy and in 8% of patients receiving continuous czp treatment ( p - value not reported).17 among those who received concomitant immunosuppressive agents the rates of detectable antibodies to czp were 2% in czp maintenance arm and 8% in placebo maintenance arm.17 on the other hand , the rates of patients with detectable antibodies to czp in those not treated with immunosuppressants were 12% in czp arm and 24% in placebo arm.17 a recent detailed analysis of a cohort of 108 patients with fistulizing cd that participated in the precise 2 trial17 showed that 58 ( 53.7% ) of them achieved clinical response to induction therapy with czp at week 6 and were subsequently randomized to receive further maintenance with either czp ( n = 28 ) or placebo ( n = 30).18 the complete fistula healing rate was achieved at week 26 in 36% of czp - treated and in 17% of placebo - treated patients ( p = 0.038).18 however , using the precise 2 trial17 pre - specified definition of fistula closure ( closure of 50% of fistulas at any two consecutive post - baseline visits at least 3 weeks apart ) there was no difference between czp and placebo arms with respect to percentage of patients achieving fistula closure ( 54% vs. 43% , p = 0.069).18 an additional analysis of randomized maintenance trial data from precise 2 highlighted that czp - treated patients with shorter duration of cd ( less than 1 year ) had higher response rates at week 26 when compared to those czp - treated subjects with longer duration of cd ( 5 years ) ( 89.5% vs. 57.3% , p < 0.05).19 however , czp - treated patients with both short ( < 1 year ) and long ( 5 years ) duration of cd had significantly higher response ( 89.5% vs. 37.1% , p < 0.01 and 57.3% vs. 32.7% , p < 0.001 , respectively ) and remission ( 68.4% vs. 37.1% , p < 0.05 and 44.3% vs. 23.5% , p < 0.001 , respectively ) rates than placebo recipients at week 26.19 the factors that independently predicted maintenance of response to czp at week 26 identified by logistic regression were shorter ( < 2 years ) vs. longer duration of cd ( 82.1% vs. 58.5% p < 0.006 ) , absence vs. presence of prior intestinal resection ( 67.5 vs. 51.6% , p < 0.027 ) , infliximab - nave status vs. prior exposure to infliximab ( 68.7% vs. 44.2% , p < 0.002 ) , and no corticosteroid use vs. corticosteroid use at baseline ( 65.7% vs. 57.3% , p < 0.001).19 although the precise 2 trial demonstrated that the efficacy of czp is higher in patients receiving this agent as the first - line biologic when compared to infliximab - exposed individuals a post - hoc analysis of precise 2 data showed that patients with cd may benefit from treatment with czp regardless of prior use of infliximab when compared to those treated with placebo.20 czp was significantly more effective than placebo as maintenance therapy at week 26 in both infliximab - exposed ( response : 44.2% vs. 25.5% , p = 0.018 ; remission : 32.7% vs. 13.7% , p = 0.008 ) and in infliximab nave patients ( response : 68.7% vs. 39.6% , p < it should be noted however that the superiority of czp over placebo was more distinct in infliximab nave patients.20 these interesting observations however require future validation in a large prospective placebo controlled trials . all patients who completed 26-week precise 2 trial were offered open label extension treatment with czp given at 400 mg s.c . dose every 4 weeks for 54 weeks ( precise 3 trial).21 the precise 3 trial included 141 patients who received czp ( precise continuous group ) and 100 patients who received placebo ( precise 3 drug interruption group ) in prior precise 2 trial.21 among patients who were either in response or remission at precise 3 baseline ( week 26 of precise 2 ) the rates of sustained response ( reduction in harvey - bradshaw index score 3 from baseline for all visits ) and remission ( hbi score 4 for all visits ) were similar between continuous and drug interruption arms at 26 weeks ( sustained response : 74.4% vs. 79.7% , respectively ; sustained remission : 72.8% vs. 73.5% , respectively ) and 54 weeks ( sustained response : 66.1% vs. 63.3% , respectively ; sustained remission : 62.1% vs. 63.2% , respectively ) of precise 3 trial.21 on the other hand , patients in the drug interruption arm had a greater incidence of adverse events related to czp than those receiving czp continuously ( 32% vs. 23.4% , p - value not reported).21 therefore it has been suggested that continuous administration of czp should be recommended due to its effectiveness and more favorable safety profile.21 all patients who relapsed ( increase in cdai 70 points above baseline or higher than baseline at week 6 of precise 2 trial with an absolute cdai score 350 points ) and decided to withdraw before week 26 of precise 2 trial were offered an open- label extension study ( precise 4).22 patients ( n = 124 ) enrolled in the precise 4 study were separated into either the continuous ( n = 49 ) or drug interruption ( n = 75 ) arm based on whether they received czp or placebo maintenance following czp induction during the precise 2 trial.22 patients who relapsed on czp maintenance therapy received a single dose of czp 400 mg s.c . whereas those who relapsed after czp interruption received three reinduction doses of czp 400 mg s.c . 2 weeks apart with subsequent maintenance administration every 4 weeks up to week 52.22 czp was equally efficacious in continuous and drug interruption treatment arms with 63.3% and 65.3% response ( reduction in harvey - bradshaw index score 3 from baseline ) rates at week 4 , respectively and 54.8% and 59.2% further maintaining this response at week 52 , respectively.22 the remission rates ( hbi score 4 ) at week 4 were 28.6% and 44% among those treated with czp continuously and with prior intermission , respectively with sustained respective remission rates at week 52 of 64.3% and 54.5%.22 patients with cd experiencing disease relapse on czp maintenance therapy following initial response to induction with czp may benefit from administration of an additional dose of czp . similarly , those with recurrence of cd after czp discontinuation may achieve improvement in their symptoms after reinduction of czp.22 a phase iiib welcome trial ( 26-week open - label- induction , double - blind - maintenance , placebo - controlled trial evaluating the clinical benefit and tolerability of czp induction and maintenance in patients suffering from cd with prior loss of response or intolerance to infliximab ) assessed the efficacy of czp in treatment of patients with active cd and prior loss of response or hypersensitivity to infliximab . 23 an open - label induction with czp administered s.c . at the dose 400 mg at weeks 0 , 2 and 4 in 539 patients resulted in 62% response ( decrease in cdai 100 points from baseline ) and 39.3% r emission ( cdai 150 points ) rates at week 6.23 there were 329 patients who responded to czp induction at week 6 who entered a double - blind maintenance part of the welcome trial that compared the efficacy of czp 400 mg maintenance treatment administered either every 2 weeks ( n = 161 ) or every 4 weeks ( n = 168 ) from week 6 through week 26.23 both maintenance regimens displayed comparable rates of sustained response ( 36.6% vs. 39.9% , respectively p = 0.55 ) and remission ( 30.4% vs. 29.2% , respectively , p = 0.81 ) at the end of the trial ( week 26).23 a recent randomized double blind placebo controlled 6-week trial ( table 1 ) evaluated the efficacy of czp in 439 adult patients with active cd and no prior exposure to anti - tnf therapy.24 patients were randomly assigned to either a single s.c . dose of czp 400 mg or placebo given at 0,2 and 4 weeks with subsequent assessment of clinical remission ( cdai 150 points ) at week 6.24 overall , there was no statistical difference in remission rates at week 6 between czp and placebo groups ( 32% vs. 25% , p = 0.174).24 however , among patients with baseline crp 5 mg / l treatment with czp resulted in a statistically significant difference in remission rates at week 6 when compared to placebo ( p = 0.031).24 certain demographic and baseline disease characteristics such as age 40 years , male sex , crp 10 mg / l , disease located in colon or in ileum and colon , no prior surgical resection , disease duration less than baseline mean , increased clinical disease activity ( cdai 300 points ) were associated with a statistically significant 23 fold higher rates of clinical remission with czp versus placebo.24 recent data from a swiss , prospective , questionnaire - based phase iv study of 60 clinical practice based - patients who received induction and maintenance treatment with czp 400 mg demonstrated 70% and 67% response ( decrease of hbi score 3 points vs. baseline ) rates and 40% and 36% remission ( hbi 4 points ) rates at week 6 and week 26 , respectively.25 in addition , 36% and 55% of patients had complete fistula closure at week 6 and 26 , respectively.25 among treated patients 88% and 67% continued czp beyond week 6 and week 26 , respectively.25 adherence has been defined as the degree to which the patient follows medication intake and other doctor s recommendations.26,27 the term adherence is currently preferred over the term compliance since it underlines the equal role of both patient and the doctor in their relationship whereas the term compliance underlines only the greater power of the doctor.26,27 according to the world health organization patient s adherence to treatment determines the success of given therapy.28 on the other hand , the adherence to treatment in patients with chronic disorders in developed countries has been estimated to be at 50%.28 levy and feld grouped patients reasons of patients non - adherence to gastroenterology medical management into either lack of adequate skills or knowledge to comply with prescribed treatment ( inadequate or poor information about prescribed medications ) , lack of patients belief that prescribed treatment is helping them or the lack of support from the patients environment ( financial or employment situation , situation at household not allowing to comply with treatment , difficulties with transportation ) ( table 2).27 in order to increase patients adherence physicians should understand that their recommendations for patients have to include clear explanations of rationale for treatment , why adherence to prescribed regimen is crucial to therapeutic success , review of therapeutic assignments given during past visits ( homework ) including discussion of any difficulties patients may have encountered , attempt to address them and praise success ( table 3).27 levy and feld suggested 10 recommendations addressing the reasons for nonadherence ( table 4 ) . they underline the crucial role of the proper physician - patient contact in establishing the pattern of patient s adherence . although levy and feld published their recommendations in 1999 when anti - tnf agents were emerging for treatment of cd their recommendations may be also applied to medications administered intravenously or subcutaneously in order to increase patient s adherence . for example , quality of the physician / patient relationship and patient s trust in physician s recommendations certainly would lead to increased adherence to any medication that is warranted . the major goal of treatment of cd is to induce and maintain disease in remission . it has been demonstrated that remission in patients with cd is associated with reduced hospitalizations and surgeries , increased employment and improved quality of life.29 this is why it is important to determine factors associated with adherence and factors associated with non - adherence to anti - tnf agents in order to improve adherence if patient does not adhere or to maintain adherence if patient adheres to prescribed regimen . until now and at the time of writing this manuscript , there have been no published studies on the adherence to czp in patients with cd . however , there are some data available on adherence to other anti - tnf agents in cd , namely infliximab and adalimumab . there have been only two studies that evaluated the adherence of infliximab30,31 and one study that assessed adherence to adalimumab32 in patients with cd . two studies assessed factors predictive of non - adherence for infliximab30 and adalimumab using multivariable models32 ( table 5 ) . in their first study kane et al collected data from outpatient databases that included 274 patients with cd who were scheduled to receive 1185 infusions with infliximab within 17 month period.32 the authors defined non - adherence as patient no - show without prior rescheduling of appointment by the patient.30 the observed non - adherence rate was 4% ( 48/1185 ) and a female sex and time from the initial infliximab infusion greater than 18 weeks were found to increase risk of non - adherence 2-fold.30 in an attempt to assess the impact of the adherence to infliximab on health care costs in patients with cd an analysis of the integrated health care information service national managed care benchmark database including medical histories of over than 25 million patients enrolled in managed care within the us was performed and identified 571 patients with cd who were receiving infliximab maintenance treatment over the 4 year time period ( at least four consecutive infusions ) within the first year after the initial infusion.31 non - adherence was defined as less than 7 infusions during the first year of treatment.31 its rate was found to be 34.3% and it was associated with nearly 3-fold increase in an all - cause hospitalizations ( or = 2.7 ; p < 0.001 ) and 2.5-fold increase in cd - related hospitalizations ( or = 2.5 , p < 0.001).31 in addition , non - adherence to infliximab was also associated with increased by 73% adjusted total medical costs excluding infliximab cost ( p < 0.001 ) , by 115% adjusted all - cause hospitalization cost ( p < 0.001 ) and by 29% adjusted all - cause outpatient cost excluding infliximab cost ( p < 0.001 ) when compared to adherence to infliximab.31 similarly , non - adherence to infliximab was associated with increased by 90% adjusted cd - related medical cost excluding infliximab cost , by 115% adjusted cd - related hospitalization cost and by 43% adjusted outpatient cost excluding infliximab cost when compared to adherence to infliximab ( p < 0.001).31 a group of french researchers performed a 21 month prospective observational multicenter study of adherence to adalimumab in patients with cd.32 non - adherence was defined as either delay or miss of at least one injection of adalimumab within 3 months prior to the study.32 among 108 patients with cd 49 ( 45.4% ) of them were non - adherent to adalimumab injection with 16 patients ( 14.8% ) missing at least one of injection and 33 patients ( 30.6% ) delaying at least one injection.32 the reasons for non - adherence were forgetfulness ( 24.6% ) , infection ( 24.6% ) , travel ( 20% ) , intentional non - adherence ( 10.8% ) , pharmaceuticals supply problems ( 9.2% ) , side effects ( 7.7% ) , pregnancy ( 1.5% ) and hospitalization due to cd ( 1.5%).32 overall , duration of disease greater than 93 months and adalimumab injection 80 mg every other week were negatively associated with injection delay or miss.32 the injection regimen of adalimumab at the dose of 40 mg every other week was associated with nearly 4-fold increase in injection delays whereas the presence of at least one relapse within last 12 months was a negative predictor of a delayed injection.32 duration of cd greater than 90 months was negatively associated with missed injection.32 current evidence strongly suggests that czp is an effective therapy for patients presenting with moderate to severe cd in anti - tnf nave patients as well as in patients with secondary loss of response or intolerance to infliximab . czp has expanded the spectrum of anti - tnf agents available for the treatment of patients with cd . patients with increased serum markers of inflammation ( crp ) belong to the subset of patients in whom czp is of particular benefit . studies have demonstrated czp to be an effective for induction and maintenance therapy in patients with cd and improving health - related quality of life for these patients.33,34 future studies on large number of patients are warranted to evaluate the efficacy of czp in the setting of clinical practice . there have been no published studies that assessed adherence to czp in patients with cd . there are limited data on adherence to other anti - tnf therapies , infliximab and adalimumab . treatment with czp is associated with improvement in quality of life and lessened work impairment in patients with cd . at this moment , health care professionals should be encouraged to follow ten adherence recommendations presented in table 4 to attempt to increase patient adherence to medications and regimens . patients should be encouraged to adhere to treatment with czp not only due to its efficacy in maintaining clinical remission in cd but also because of improvement in quality of life and reduction of work impairment . future studies should determine what factors are associated with non - adherence to czp and also other anti - tnf agents . this would allow us to make evidence - based steps necessary to increase patients compliance .

treatment with anti - tumor necrosis factor ( anti - tnf ) therapy has become a mainstay of therapy for patients with cd who are unresponsive to conventional medical management . currently there are three anti - tnf antibodies that have been approved by the us food and drug administration for the treatment of cd , namely infliximab , adalimumab and certolizumab pegol ( czp ) . several double blind placebo controlled trials determined that czp is effective as induction and maintenance treatment in adult patients with cd regardless of their prior exposure to other anti - tnf antibodies . this review discusses the efficacy of czp and adherence to therapy with anti - tnf antibodies in patients with cd .

organizing pneumonia ( op ) is characterized by an indolent clinical course and a favorable prognosis although a fulminant variant has been documented . pulmonary air leak comprising pneumothorax , pneumomediastinum , and subcutaneous emphysema is rarely a presenting feature of an op . the exact pathogenesis and an appropriate management guideline have not yet been established for this dreaded complication . review of medical literature reveals only a few case reports of air leak in op . here , we report a case of op secondary to bleomycin chemotherapy , where pulmonary air leak was the major presenting symptom , which has never been reported previously . a 43-year - old female presented to our emergency department with severe shortness of breath , diffuse neck swelling , and neck pain , of 1 day duration . she had a stage iii ovarian immature teratoma diagnosed 6 months back and was treated with bilateral salpingo oophorectomy followed by 6 cycles of chemotherapy with bleomycin , etoposide , and cisplatin . one week prior to the admission , she had fever and severe cough which was treated from a local hospital . on examination , she had respiratory distress with a respiratory rate of 32/min . her spo2 was 82% in room air , blood pressure 110/70 mmhg , and heart rate 110/min . examination of the respiratory system showed equal breath sounds on both sides with bilateral fine basal crepitations and muffled heart sounds . the values for the blood gas analysis were a ph of 7.42 , pco2 of 34 mmhg , and po2 of 65 mmhg . chest x - ray showed [ figure 1 ] features suggestive of subcutaneous emphysema and mediastinal emphysema with bilateral haziness and alveolar opacities in lower zones . a computed tomography ( ct ) thorax [ figure 2 ] with findings of ground - glass opacities and peripheral consolidation , confirmed the diagnosis of pneumonia and mediastinal emphysema . mediastinal emphysema and diffuse haziness in chest x - ray ( a - c ) serial computed tomography images showing bilateral diffuse ground - glass opacities , mediastinal emphysema , and peripheral consolidation with this clinical presentation of a pulmonary air leak syndrome and radiologic picture of bilateral predominant ground glass opacities with patchy consolidations , we considered the possibility of pneumocystis jiroveci pneumonia or a drug - induced lung disease like diffuse alveolar damage / op . since the patient had severe respiratory distress and hypoxemia , she was immediately taken up for surgical management . a video - assisted thoracoscopy was done [ figure 3 ] , and the mediastinum dissected revealing multiple paracardiac blebs . these blebs were ablated ; the pneumomediastinum drained into left hemithorax , and an intercostal drainage tube was inserted in left hemithorax . video - assisted thoracoscopy showing paracardiac blebs patient 's condition improved dramatically with rising oxygen saturation . she was shifted to the intensive care unit and was treated with antibiotics , steroids , and supportive treatment . biopsy of the lung specimen [ figure 4 ] revealed bronchiolitis obliterans organizing pneumonia ( boop ) . soon the air - leak disappeared , and she was discharged from the hospital with a long - term course of steroids and macrolide . ( a ) histology showed plugs of fibrous tissue in terminal bronchioles , ( b ) trichrome stain showing fibrous proliferation op is a clinicopathologic syndrome first described by davison and epler et al . in the 1980s . causes of secondary op include infections , drugs , connective tissue diseases , organ transplantation , and inflammatory bowel diseases . the manifestations of op are nonspecific ; hence , the diagnosis is delayed in many . high index of suspicion should be kept to diagnose secondary op , especially in patients with chemotherapy , organ transplantation , etc . a unique manifestation of bleomycin toxicity is multiple pulmonary nodules in ct mimicking metastasis and having histologic characteristic of op / boop . a study conducted by mokhtari et al . found that of the 43 patients with isolated boop in cancer patients , 3 were found to be due to bleomycin . kofteridis et al . , iwanaga et al . , and yang et al . have published case reports of air leak syndrome in boop . the hallmark of op is the presence of intraalveolar buds of granulation tissue consisting of fibroblasts - myofibroblasts embedded in connective tissue . these buds may extend from one alveolus to the next through the interalveolar pores and into the bronchioles obstructing the lumen ( bronchiolitis obliterans ) . the pathogenesis proposed for air leak is that , localized plugs of fibrous tissue in the bronchiole lumen in op , produce a ball valve mechanism and alveolar over - distension , eventually leading to rupture . the air dissects through the bronchovascular sheath and ascends toward the hilum to produce a pneumomediastinum and also along the subcutaneous connective tissue to cause subcutaneous emphysema . air leakage in the mediastinum may also occur due to the rupture of paracardiac bleb . in severe interstitial lung disease ( ild ) , we also considered the possibility of pneumocystis jiroveci pneumonia and metastasis as a differential in this immunocompromised patient with fever , cough , radiologically bilateral ground glassing , and air leak , but investigation profile proved against this . in our patient , the treatment of op is long - term steroid , and the treatment for massive pneumomediastinum is limited mediastinotomy and drainage . op should be included in our differential diagnosis list , whenever a patient presents with air leak . lung biopsy should be done to confirm the diagnosis and would prove to be lifesaving as this disease responds well to steroids . limited mediastinotomy and drainage of pneumomediastinum in massive air leak is lifesaving and gives rapid improvement .

organizing pneumonia ( op ) is a less common interstitial lung disease with varying clinical picture . the development of pulmonary air leak in a case of op is an extremely rare complication . here , we report the case of a 46-year - old female with carcinoma ovary , postchemotherapy who developed respiratory distress with pneumomediastinum , and subcutaneous emphysema . lung biopsy showed evidence of op . this turned out to be a rare case of op , secondary to bleomycin chemotherapy , presenting with pulmonary air leak .

nearly , 90% of metastatic tumors occur in jaw bones , especially premolar - molar region of the mandible , whereas metastases to soft tissues are extraordinarily rare and account for 0.1% of all oral malignancies . most metastatic tumors to the orofacial region are seen in patients aged between 40 and 70 years . metastasis to the soft tissues mostly involves gingiva and alveolar mucosal sites ( 54% ) followed by tongue ( 30% ) . in some cases , oral metastatic tumors are found to be the first sign of metastatic spread and in some instances ; they are an indication for unidentified primary tumor of the distant site . the primary site differs according to oral site colonization . in men , primary tumor of the lung followed by the prostate gland and kidney the breast is the most common primary tumor site affecting the jawbones and soft tissues ( 41% and 24.3% , respectively ) , followed by the adrenal and female genital organs . clinically , these metastatic lesions appear nonaggressive , mimicking reactive or benign lesions or even simple odontogenic infections . the clinical features of these lesions include a bony swelling with tenderness , pain , ulcer , hemorrhage , paresthesia and pathological fracture . it is important to diagnose the origin of the tumor as the management will depend significantly on the histological type . although infrequent , oral metastases are rarely encountered as the first sign of occult cancer . hence , this article emphasizes on detailed dentoalveolar examination and early diagnosis for finding the primary focus of metastatic tumor . a 60-year - old male patient presented with a swelling in the right lower back teeth region of the jaw since 3 months [ figure 1 ] . the patient complaints of pain for 10 days , radiating to the right temporal region . the patient was a known hypertensive since 4 years . a well - defined solitary swelling present on the right side of mandible on extraoral examination , a well - defined , solitary swelling measuring 4 cm 5 cm was noted on the right side of the mandible , which was hard in consistency and fixed to the underlying skin . no other pathologic findings were noticed during physical examination . on intraoral examination , firm , nontender swelling with ill - defined borders measuring 3 cm 3 cm was noted in the right mandibular premolar - molar region [ figure 2 ] . there was no ulceration , paresthesia or pathological fracture . on intraoral examination , firm , nontender swelling with ill - defined borders measuring 3 cm 3 cm was noted patient was advised for oral pantamograph and computed tomography ( ct ) scan . ct scan of the face with three - dimension reconstruction revealed a well - defined osteolytic lesion involving the ramus and body of the right half of the mandible , measuring 54 mm 45 mm 50 mm ( anterioposterior transverse craniocaudal ) . it showed speculated periosteal lesion with multiple irregular calcifications and extended into the lingual and mandibular soft tissues [ figure 3 ] . based on the clinical presentation , a differential diagnosis of inflammatory swelling , odontogenic cyst , odontogenic tumor , soft tissue tumor or metastatic tumor to the jawbones was given . computed tomography scan of the face with three - dimensional reconstruction revealed a well - defined osteolytic lesion with multiple irregular calcifications that extended into the lingual and mandibular soft tissues incisional biopsy was done for the histopathological diagnosis . histopathological examination of the h and e stained tissue showed diffuse fibrous connective tissue stroma invaded by the tumor cells which were cuboidal to short columnar with eosinophilic cytoplasm arranged in alveolar / follicular pattern of varying sizes [ figure 4 ] . bony trabeculae were evident in some areas [ figure 5 ] . based on these features , the lesion was diagnosed as a metastatic malignant tumor , probably metastasizing from the lung . ( h&e stain , 100 ) tumor islands along with few bony trabeculae were evident in some areas . ( h&e stain , 40 ) x - ray chest posterior - anterior view revealed consolidation of the right lower zone [ figure 6 ] . the ct scan of the chest with contrast revealed dense soft tissue mass lesion with speculated margins and focal pleural thickening noted at the right posterior basal segment . x - ray chest posterior - anterior view revealed consolidation in right lower zone of the lungs treatment for the patient was palliative external beam radiotherapy on linac given to a total dose of 3000 cgy in 10 fractions to jaw by rl / ll for 12 days which was well - tolerated by the patient . chemotherapy included injection cisplatin ( 75 mg)-intravenous ( iv ) ; injection etoposide ( 150 mg)-iv ; tablet vomiset ( 8 mg ) ; tablet ultracet . the common primary sources of tumors metastatic to the oral region are the breast , lung and kidney . the actual incidence of these cancers is unknown since oral metastatic disease is usually a manifestation of advanced disease . the mean age of occurrence is 54 years with slight male predilection . in our case , also the patient was aged about the same age ( 60 years ) as supported in the literature . most of the patients are aware of primary tumors before the metastatic spread to the oral cavity . in our case , the most common primary sites for oral metastases were the lung , kidney , liver and prostate for men ; breast , female genital organs , kidney , and colorectum for women . in our case too , lung was found to be the primary site . the clinical presentation of the metastatic lesions differed between the various oral sites . in the jawbones , most of the patients complain of rapidly progressing swelling , pain , paresthesia , difficulty in chewing , dysphagia , disfigurement and bleeding . our patient presented with features such as firm , nontender swelling with ill - defined borders . there was no paresthesia , difficulty in chewing , dysphagia , bleeding and pathological fracture . pathogenesis of oral metastasis is unclear but thought to be a multistage process in which cells detach themselves from the primary tumor and get transported by lymphatic or blood vessels . recent studies state that cancer cells metastasizing to bone have shown to alter the physiologic balance between both bone resorption and bone formation . treatment of oral metastasis depends upon its presentation and the stage during which it has been identified . management includes chemotherapy , radiotherapy , surgical excision or a combination of the techniques under local anesthesia . an average survival time for lung cancer metastasis is 4 months to 1 year with a maximum survival rate of 5 years .

oral cavity is an uncommon site for metastasis and is usually an evidence of widespread disease . the clinical presentation of the metastatic lesions differs between the various sites in the oral region . metastatic tumors account for 13% of all oral malignancies . the jawbones , particularly the mandibular molar area is more frequently affected than the oral soft tissues ( 2:1 ) . here , we report a case of a 60-year - old male patient with metastasis from lung to the mandible , where the metastasis was detected before primary tumor .