content
stringlengths 7
1.05M
| fixed_cases
stringlengths 1
1.28M
|
|---|---|
class BoundingBox:
x: int
y: int
x2: int
y2: int
cx: int
cy: int
width: int
height: int
def __init__(self, x: int, y: int, width: int, height: int):
self.x = x
self.y = y
self.width = width
self.height = height
self.x2 = x + width - 1
self.y2 = y + height - 1
self.cx = round(x + width / 2)
self.cy = round(y + height / 2)
| class Boundingbox:
x: int
y: int
x2: int
y2: int
cx: int
cy: int
width: int
height: int
def __init__(self, x: int, y: int, width: int, height: int):
self.x = x
self.y = y
self.width = width
self.height = height
self.x2 = x + width - 1
self.y2 = y + height - 1
self.cx = round(x + width / 2)
self.cy = round(y + height / 2) |
#!/usr/bin/env python3
def convert_to_celsius(fahrenheit: float) -> float:
return (fahrenheit - 32.0) * 5.0 / 9.0
def above_freezing(celsius: float) -> bool:
return celsius > 0
fahrenheit = float(input('Enter the temperature in degrees Fahrenheit: '))
celsius = convert_to_celsius(fahrenheit)
print(celsius)
if above_freezing(celsius):
print('It is above freezing.')
else:
print('It is below freezing.') | def convert_to_celsius(fahrenheit: float) -> float:
return (fahrenheit - 32.0) * 5.0 / 9.0
def above_freezing(celsius: float) -> bool:
return celsius > 0
fahrenheit = float(input('Enter the temperature in degrees Fahrenheit: '))
celsius = convert_to_celsius(fahrenheit)
print(celsius)
if above_freezing(celsius):
print('It is above freezing.')
else:
print('It is below freezing.') |
numero = str(input('digite um numero'))
print('unidade: {}'.format(numero[1]))
print('dezena: {}'.format(numero[2]))
print('centena: {} '.format(numero[3]))
print('unidade de milhar: {}'.format(numero[4]))
| numero = str(input('digite um numero'))
print('unidade: {}'.format(numero[1]))
print('dezena: {}'.format(numero[2]))
print('centena: {} '.format(numero[3]))
print('unidade de milhar: {}'.format(numero[4])) |
def f():
'''f'''
pass
def f1(): pass
f2 = f
if True:
def g(): pass
else:
def h(): pass
class C:
def i(self): pass
def j(self):
def j2(self):
pass
class C2:
def k(self): pass
| def f():
"""f"""
pass
def f1():
pass
f2 = f
if True:
def g():
pass
else:
def h():
pass
class C:
def i(self):
pass
def j(self):
def j2(self):
pass
class C2:
def k(self):
pass |
IPlist = ['209.85.238.4','216.239.51.98','64.233.173.198','64.3.17.208','64.233.173.238']
# for address in range(len(IPlist)):
# IPlist[address] = '%3s.%3s.%3s.%3s' % tuple(IPlist[address].split('.'))
# IPlist.sort(reverse=False)
# for address in range(len(IPlist)):
# IPlist[address] = IPlist[address].replace(' ', '')
# IPlist.sort(key=lambda address: list(map(int, address.split('.'))))
IPlist.sort(key=lambda address: list(map(str, address.split('.'))))
print(IPlist) | i_plist = ['209.85.238.4', '216.239.51.98', '64.233.173.198', '64.3.17.208', '64.233.173.238']
IPlist.sort(key=lambda address: list(map(str, address.split('.'))))
print(IPlist) |
class Base1:
def FuncA(self):
print("Base1::FuncA")
class Base2:
def FuncA(self):
print("Base2::FuncA")
class Child(Base1, Base2):
pass
def main():
obj=Child()
obj.FuncA()
if __name__ == "__main__":
main()
| class Base1:
def func_a(self):
print('Base1::FuncA')
class Base2:
def func_a(self):
print('Base2::FuncA')
class Child(Base1, Base2):
pass
def main():
obj = child()
obj.FuncA()
if __name__ == '__main__':
main() |
KIND_RETRIEVE_DATA = {
"_embedded": {
"naam": {
"_embedded": {
"inOnderzoek": {
"_embedded": {
"datumIngangOnderzoek": {
"dag": None,
"datum": None,
"jaar": None,
"maand": None,
}
},
"geslachtsnaam": False,
"voornamen": False,
"voorvoegsel": False,
}
},
"geslachtsnaam": "Maykin Kind",
"voorletters": "K",
"voornamen": "Media Kind",
"voorvoegsel": "van",
},
"geboorte": {
"_embedded": {
"datum": {"dag": 15, "datum": "1999-06-15", "jaar": 1999, "maand": 6},
"land": {"code": "6030", "omschrijving": "Nederland"},
"plaats": {"code": "624", "omschrijving": "Amsterdam"},
"inOnderzoek": {
"_embedded": {
"datumIngangOnderzoek": {
"dag": None,
"datum": None,
"jaar": None,
"maand": None,
}
},
"datum": False,
"land": False,
"plaats": False,
},
}
},
"inOnderzoek": {
"_embedded": {
"datumIngangOnderzoek": {
"dag": None,
"datum": None,
"jaar": None,
"maand": None,
}
},
"burgerservicenummer": False,
},
},
"burgerservicenummer": "456789123",
"geheimhoudingPersoonsgegevens": True,
"leeftijd": 21,
}
KIND_RETRIEVE_DATA_NO_DATES = {
"_embedded": {
"naam": {
"_embedded": {
"inOnderzoek": {
"_embedded": {
"datumIngangOnderzoek": {
"dag": None,
"datum": None,
"jaar": None,
"maand": None,
}
},
"geslachtsnaam": False,
"voornamen": False,
"voorvoegsel": False,
}
},
"geslachtsnaam": "Maykin Kind",
"voorletters": "K",
"voornamen": "Media Kind",
"voorvoegsel": "van",
},
"geboorte": {
"_embedded": {
"datum": {"dag": None, "datum": None, "jaar": None, "maand": None},
"land": {"code": "6030", "omschrijving": "Nederland"},
"plaats": {"code": "624", "omschrijving": "Amsterdam"},
"inOnderzoek": {
"_embedded": {
"datumIngangOnderzoek": {
"dag": None,
"datum": None,
"jaar": None,
"maand": None,
}
},
"datum": False,
"land": False,
"plaats": False,
},
}
},
"inOnderzoek": {
"_embedded": {
"datumIngangOnderzoek": {
"dag": None,
"datum": None,
"jaar": None,
"maand": None,
}
},
"burgerservicenummer": False,
},
},
"burgerservicenummer": "456789123",
"geheimhoudingPersoonsgegevens": True,
"leeftijd": 0,
}
| kind_retrieve_data = {'_embedded': {'naam': {'_embedded': {'inOnderzoek': {'_embedded': {'datumIngangOnderzoek': {'dag': None, 'datum': None, 'jaar': None, 'maand': None}}, 'geslachtsnaam': False, 'voornamen': False, 'voorvoegsel': False}}, 'geslachtsnaam': 'Maykin Kind', 'voorletters': 'K', 'voornamen': 'Media Kind', 'voorvoegsel': 'van'}, 'geboorte': {'_embedded': {'datum': {'dag': 15, 'datum': '1999-06-15', 'jaar': 1999, 'maand': 6}, 'land': {'code': '6030', 'omschrijving': 'Nederland'}, 'plaats': {'code': '624', 'omschrijving': 'Amsterdam'}, 'inOnderzoek': {'_embedded': {'datumIngangOnderzoek': {'dag': None, 'datum': None, 'jaar': None, 'maand': None}}, 'datum': False, 'land': False, 'plaats': False}}}, 'inOnderzoek': {'_embedded': {'datumIngangOnderzoek': {'dag': None, 'datum': None, 'jaar': None, 'maand': None}}, 'burgerservicenummer': False}}, 'burgerservicenummer': '456789123', 'geheimhoudingPersoonsgegevens': True, 'leeftijd': 21}
kind_retrieve_data_no_dates = {'_embedded': {'naam': {'_embedded': {'inOnderzoek': {'_embedded': {'datumIngangOnderzoek': {'dag': None, 'datum': None, 'jaar': None, 'maand': None}}, 'geslachtsnaam': False, 'voornamen': False, 'voorvoegsel': False}}, 'geslachtsnaam': 'Maykin Kind', 'voorletters': 'K', 'voornamen': 'Media Kind', 'voorvoegsel': 'van'}, 'geboorte': {'_embedded': {'datum': {'dag': None, 'datum': None, 'jaar': None, 'maand': None}, 'land': {'code': '6030', 'omschrijving': 'Nederland'}, 'plaats': {'code': '624', 'omschrijving': 'Amsterdam'}, 'inOnderzoek': {'_embedded': {'datumIngangOnderzoek': {'dag': None, 'datum': None, 'jaar': None, 'maand': None}}, 'datum': False, 'land': False, 'plaats': False}}}, 'inOnderzoek': {'_embedded': {'datumIngangOnderzoek': {'dag': None, 'datum': None, 'jaar': None, 'maand': None}}, 'burgerservicenummer': False}}, 'burgerservicenummer': '456789123', 'geheimhoudingPersoonsgegevens': True, 'leeftijd': 0} |
# -*- coding: utf-8 -*-
#from pkg_resources import resource_filename
class dlib_model:
def pose_predictor_model_location():
return "./models/dlib/shape_predictor_68_face_landmarks.dat"
def pose_predictor_five_point_model_location():
return "./models/dlib/shape_predictor_5_face_landmarks.dat"
def face_recognition_model_location():
return "./models/dlib/dlib_face_recognition_resnet_model_v1_for_asian.dat"
def cnn_face_detector_model_location():
return "./models/dlib/mmod_human_face_detector.dat"
class opencv_model:
def caff_model_location():
return "./models/opencv/res10_300x300_ssd_iter_140000_fp16.caffemodel"
def caff_cfgfile_location():
return "./models/opencv/deploy.prototxt"
def tensorflow_model_location():
return "./models/opencv/opencv_face_detector_uint8.pb"
def tensorflow_cfgfile_location():
return "./models/opencv/opencv_face_detector.pbtxt"
class classifier_model:
def classifier_location():
return "./models/classifier/face_classifier.pkl"
| class Dlib_Model:
def pose_predictor_model_location():
return './models/dlib/shape_predictor_68_face_landmarks.dat'
def pose_predictor_five_point_model_location():
return './models/dlib/shape_predictor_5_face_landmarks.dat'
def face_recognition_model_location():
return './models/dlib/dlib_face_recognition_resnet_model_v1_for_asian.dat'
def cnn_face_detector_model_location():
return './models/dlib/mmod_human_face_detector.dat'
class Opencv_Model:
def caff_model_location():
return './models/opencv/res10_300x300_ssd_iter_140000_fp16.caffemodel'
def caff_cfgfile_location():
return './models/opencv/deploy.prototxt'
def tensorflow_model_location():
return './models/opencv/opencv_face_detector_uint8.pb'
def tensorflow_cfgfile_location():
return './models/opencv/opencv_face_detector.pbtxt'
class Classifier_Model:
def classifier_location():
return './models/classifier/face_classifier.pkl' |
# %% [705. Design HashSet](https://leetcode.com/problems/design-hashset/)
class MyHashSet(set):
remove = set.discard
contains = set.__contains__
| class Myhashset(set):
remove = set.discard
contains = set.__contains__ |
words_count = int(input())
words_dict = {}
def add_word(word,definition):
words_dict[word] = definition
def translate_sentence(words_list):
sentence = ""
for word in words_list:
if word in words_dict:
sentence += words_dict[word] + " "
else:
sentence += word + " "
return sentence
for i in range(words_count + 1):
text = input()
words = text.split(" ")
if len(words) == 2:
add_word(words[0] ,words[1])
else:
print(translate_sentence(words))
| words_count = int(input())
words_dict = {}
def add_word(word, definition):
words_dict[word] = definition
def translate_sentence(words_list):
sentence = ''
for word in words_list:
if word in words_dict:
sentence += words_dict[word] + ' '
else:
sentence += word + ' '
return sentence
for i in range(words_count + 1):
text = input()
words = text.split(' ')
if len(words) == 2:
add_word(words[0], words[1])
else:
print(translate_sentence(words)) |
''' Control Structures
A statement used to control the flow of execution in a program is called a control structure.
Types of control structures
1. Sequence ******************************************************
In a sequential structure the statements are executed in the same order in which they are specified in the program, the control flows from one statement to the other in a logical sequence, all sequences are executed exactly as run.
It means that no statement is kept and no statement is executed more than once.
Statement # 1
Statement # 2
Statement # 3
Statement # 4
An example
Start
|
input base
|
input height
|
input height
|
calculate area
Area = 1/2 * base * height
|
Display Area
|
End
2. Selection ******************************************************
A selection structure selects a statement or set of statements to execute on the basis of a condition.
In this structure, a statement or set of statements is executed when the condition is True. And ignored when the condition is False.
An example
Suppose a program that imputs the temperature and then displays the message on the screen.
If the temperature is greater than 35, the it displays the message "Hot day".
When the temperature is between 25 and 35 the it displays the message "Pleasant day".
If it is less than 25, then it displays the message "cool day".
Flowchart of simple selection.
Condition
T or F
T F
(if True) (if False)
Statement #1 Statement #2
3. Repetition
A repetition structure executes a statement or set of statements repeadadly.
It is also known as iterations or loops.
An example.
Suspose we want to display a message to the screen "Hello World" one thousand times!
It takes huge time to write that code and it takes more space as well. (lenghty awkward looking code)
It is very easy to perform this task usig loops or repetition structure.
Flowchart of Repetition
_______
| |
| |
| Condition = F
| T or F |
| | T |
| | |
| Statement |
|_______| |
|
End of loop
4. Relational or Comparision Operators.
Less than, greater than or equal to.
Sometime we need to do a lot of comparisions in order to see whether a specific command should be executed.
The conditional statements are used to specify conditions in programs.
A relatinal operator compares two values. It produces a result as True or False.
The relation operators are sometimes called the conditional operators as they test conditions that are tru or false.
RELATIONAL OR COMPARISION OPERATORS
> Greater than returns true if the value on the left side of > is greater than the value on the righr side. Otherwise, it returns false.
>>> # greator than operator (>)
>>> 10 > 3
True
>>> 10 > 13
False
< Less than operator returns true if the value on the left side < is less than the value on the rught side. Otherwise it returns false.
>>> # Less Than operator (<)
>>> 3 < 7
True
>>> 10 < 7
False
== Equals operator returns true if the value on both sides of == are equal. Otherwise returns false. == The assignment operator is used to assign the value on the right hand side of any expression to the variable on the left hand side while the equal equal operator which is Gradley comparision operator is used to compare the two to values on the left and right hand side of this operator.
>>> 10 == 10
True
>>> 10 == 11
False
>= Greater that or equal to operator returns true if the value on the left side of >= us greator than or equal to the value on the right hand side. Otherwise returns false.
>>> # Greater that or equal to operator (>=)
>>> 10 >= 9
True
>>> 10 >= 10
True
>>> 10 >= 11
False
<= Less that or equal to operator returns true if the value on the left of <= is less than or equal to value on right side. Otherwise returns false.
>>> # Lesser than or equal to operator
>>> 10 <= 10
True
>>> 10 <= 11
True
>>> 10 <= 9
False
!= The not equal to operator. Returns true if the value on the left side of != is not equal to the value on the right. Otherwise returns false.
>>> # not equal to operator
>>> 10 != 10
False
>>> 10 == 10
True
>>> 3 != 5
True
'''
| """ Control Structures
A statement used to control the flow of execution in a program is called a control structure.
Types of control structures
1. Sequence ******************************************************
In a sequential structure the statements are executed in the same order in which they are specified in the program, the control flows from one statement to the other in a logical sequence, all sequences are executed exactly as run.
It means that no statement is kept and no statement is executed more than once.
Statement # 1
Statement # 2
Statement # 3
Statement # 4
An example
Start
|
input base
|
input height
|
input height
|
calculate area
Area = 1/2 * base * height
|
Display Area
|
End
2. Selection ******************************************************
A selection structure selects a statement or set of statements to execute on the basis of a condition.
In this structure, a statement or set of statements is executed when the condition is True. And ignored when the condition is False.
An example
Suppose a program that imputs the temperature and then displays the message on the screen.
If the temperature is greater than 35, the it displays the message "Hot day".
When the temperature is between 25 and 35 the it displays the message "Pleasant day".
If it is less than 25, then it displays the message "cool day".
Flowchart of simple selection.
Condition
T or F
T F
(if True) (if False)
Statement #1 Statement #2
3. Repetition
A repetition structure executes a statement or set of statements repeadadly.
It is also known as iterations or loops.
An example.
Suspose we want to display a message to the screen "Hello World" one thousand times!
It takes huge time to write that code and it takes more space as well. (lenghty awkward looking code)
It is very easy to perform this task usig loops or repetition structure.
Flowchart of Repetition
_______
| |
| |
| Condition = F
| T or F |
| | T |
| | |
| Statement |
|_______| |
|
End of loop
4. Relational or Comparision Operators.
Less than, greater than or equal to.
Sometime we need to do a lot of comparisions in order to see whether a specific command should be executed.
The conditional statements are used to specify conditions in programs.
A relatinal operator compares two values. It produces a result as True or False.
The relation operators are sometimes called the conditional operators as they test conditions that are tru or false.
RELATIONAL OR COMPARISION OPERATORS
> Greater than returns true if the value on the left side of > is greater than the value on the righr side. Otherwise, it returns false.
>>> # greator than operator (>)
>>> 10 > 3
True
>>> 10 > 13
False
< Less than operator returns true if the value on the left side < is less than the value on the rught side. Otherwise it returns false.
>>> # Less Than operator (<)
>>> 3 < 7
True
>>> 10 < 7
False
== Equals operator returns true if the value on both sides of == are equal. Otherwise returns false. == The assignment operator is used to assign the value on the right hand side of any expression to the variable on the left hand side while the equal equal operator which is Gradley comparision operator is used to compare the two to values on the left and right hand side of this operator.
>>> 10 == 10
True
>>> 10 == 11
False
>= Greater that or equal to operator returns true if the value on the left side of >= us greator than or equal to the value on the right hand side. Otherwise returns false.
>>> # Greater that or equal to operator (>=)
>>> 10 >= 9
True
>>> 10 >= 10
True
>>> 10 >= 11
False
<= Less that or equal to operator returns true if the value on the left of <= is less than or equal to value on right side. Otherwise returns false.
>>> # Lesser than or equal to operator
>>> 10 <= 10
True
>>> 10 <= 11
True
>>> 10 <= 9
False
!= The not equal to operator. Returns true if the value on the left side of != is not equal to the value on the right. Otherwise returns false.
>>> # not equal to operator
>>> 10 != 10
False
>>> 10 == 10
True
>>> 3 != 5
True
""" |
#33
# Time: O(logn)
# Space: O(1)
# Suppose an array sorted in ascending order is rotated at some pivot unknown to you beforehand.
# (i.e., 0 1 2 4 5 6 7 might become 4 5 6 7 0 1 2).
#
# You are given a target value to search. If found in the array return its index, otherwise return -1.
#
# You may assume no duplicate exists in the array.
class binarySearchSol():
def searchInRotatedArrayI(self,nums,target):
left,right=0,len(nums)-1
while left<=right:
mid=(left+right)//2
if nums[mid]==target:
return mid
elif (nums[mid]>nums[left] and nums[left]<=target<nums[mid]) or \
(nums[mid]<nums[left] and not (nums[mid]<target<=nums[right])):
right=mid-1
else:
left=mid+1
return -1
| class Binarysearchsol:
def search_in_rotated_array_i(self, nums, target):
(left, right) = (0, len(nums) - 1)
while left <= right:
mid = (left + right) // 2
if nums[mid] == target:
return mid
elif nums[mid] > nums[left] and nums[left] <= target < nums[mid] or (nums[mid] < nums[left] and (not nums[mid] < target <= nums[right])):
right = mid - 1
else:
left = mid + 1
return -1 |
class Task:
def __init__(self,name,due_date):
self.name = name
self.due_date = due_date
self.comments=[]
self.completed=False
def change_name(self,new_name:str):
if self.name==new_name:
return f"Name cannot be the same."
self.name=new_name
return self.name
def change_due_date(self,new_date:str):
if self.due_date==new_date:
return "Date cannot be the same."
self.due_date=new_date
return self.due_date
def add_comment(self,comment:str):
self.comments.append(comment)
def edit_comment(self,comment_number:int,new_comment:str):
if 0<comment_number>=len(self.comments):
return "Cannot find comment."
self.comments[comment_number]=new_comment
return f"{', '.join([x for x in self.comments])}"
def details(self):
return f"Name: {self.name} - Due Date: {self.due_date}"
| class Task:
def __init__(self, name, due_date):
self.name = name
self.due_date = due_date
self.comments = []
self.completed = False
def change_name(self, new_name: str):
if self.name == new_name:
return f'Name cannot be the same.'
self.name = new_name
return self.name
def change_due_date(self, new_date: str):
if self.due_date == new_date:
return 'Date cannot be the same.'
self.due_date = new_date
return self.due_date
def add_comment(self, comment: str):
self.comments.append(comment)
def edit_comment(self, comment_number: int, new_comment: str):
if 0 < comment_number >= len(self.comments):
return 'Cannot find comment.'
self.comments[comment_number] = new_comment
return f"{', '.join([x for x in self.comments])}"
def details(self):
return f'Name: {self.name} - Due Date: {self.due_date}' |
class ManuscriptSubjectAreaService:
def __init__(self, df):
self._df = df
self._subject_areas_by_id_map = df.groupby(
'version_id')['subject_area'].apply(sorted).to_dict()
@staticmethod
def from_database(db, valid_version_ids=None):
df = db.manuscript_subject_area.read_frame()
if valid_version_ids is not None:
df = df[df['version_id'].isin(valid_version_ids)]
return ManuscriptSubjectAreaService(df)
def get_ids_by_subject_areas(self, subject_areas):
df = self._df[self._df['subject_area'].str.lower().isin(
[s.lower() for s in subject_areas]
)]
return set(df['version_id'])
def get_subject_areas_by_id(self, manuscript_version_id):
return self._subject_areas_by_id_map.get(manuscript_version_id, [])
def get_all_subject_areas(self):
return set(self._df['subject_area'].unique())
| class Manuscriptsubjectareaservice:
def __init__(self, df):
self._df = df
self._subject_areas_by_id_map = df.groupby('version_id')['subject_area'].apply(sorted).to_dict()
@staticmethod
def from_database(db, valid_version_ids=None):
df = db.manuscript_subject_area.read_frame()
if valid_version_ids is not None:
df = df[df['version_id'].isin(valid_version_ids)]
return manuscript_subject_area_service(df)
def get_ids_by_subject_areas(self, subject_areas):
df = self._df[self._df['subject_area'].str.lower().isin([s.lower() for s in subject_areas])]
return set(df['version_id'])
def get_subject_areas_by_id(self, manuscript_version_id):
return self._subject_areas_by_id_map.get(manuscript_version_id, [])
def get_all_subject_areas(self):
return set(self._df['subject_area'].unique()) |
def _cc_stamp_header(ctx):
out = ctx.outputs.out
args = ctx.actions.args()
args.add("--stable_status", ctx.info_file)
args.add("--volatile_status", ctx.version_file)
args.add("--output_header", out)
ctx.actions.run(
outputs = [out],
inputs = [ctx.info_file, ctx.version_file],
arguments = [args],
executable = ctx.executable.tool,
)
return DefaultInfo(files = depset([out]))
cc_stamp_header = rule(
implementation = _cc_stamp_header,
attrs = {
"out": attr.output(
doc = "C++ header file to generate",
mandatory = True,
),
"tool": attr.label(
default = Label("@rules_cc_stamp//cc_stamp_header_generator"),
cfg = "exec",
executable = True,
),
},
)
| def _cc_stamp_header(ctx):
out = ctx.outputs.out
args = ctx.actions.args()
args.add('--stable_status', ctx.info_file)
args.add('--volatile_status', ctx.version_file)
args.add('--output_header', out)
ctx.actions.run(outputs=[out], inputs=[ctx.info_file, ctx.version_file], arguments=[args], executable=ctx.executable.tool)
return default_info(files=depset([out]))
cc_stamp_header = rule(implementation=_cc_stamp_header, attrs={'out': attr.output(doc='C++ header file to generate', mandatory=True), 'tool': attr.label(default=label('@rules_cc_stamp//cc_stamp_header_generator'), cfg='exec', executable=True)}) |
print('Challenge 14: WAF to check if a number is present in a list or not.')
test_list = [ 1, 6, 3, 5, 3, 4 ]
print("Checking if 6 exists in list: ")
# Checking if 6 exists in list
# using loop
for i in test_list:
if(i == 6) :
print ("Element Exists") | print('Challenge 14: WAF to check if a number is present in a list or not.')
test_list = [1, 6, 3, 5, 3, 4]
print('Checking if 6 exists in list: ')
for i in test_list:
if i == 6:
print('Element Exists') |
# dictionaries
friends = ["john", "andre", "mark", "robert"]
ages = [23, 43, 54, 12]
biodatas_dict = dict(zip(friends, ages))
print(biodatas_dict)
# list
biodatas_list = list(zip(friends, ages))
print(biodatas_list)
# tuple
biodatas_tuple = tuple(zip(friends, ages))
print(biodatas_tuple)
| friends = ['john', 'andre', 'mark', 'robert']
ages = [23, 43, 54, 12]
biodatas_dict = dict(zip(friends, ages))
print(biodatas_dict)
biodatas_list = list(zip(friends, ages))
print(biodatas_list)
biodatas_tuple = tuple(zip(friends, ages))
print(biodatas_tuple) |
#!/usr/bin/env python
def count_fish(lanternfish: list, repro_day: int) -> int:
return len([x for x in lanternfish if x == repro_day])
def pass_one_day(fish_age_hash: dict, day: int, lanternfish: list=None):
if day == 0:
if not lanternfish:
raise AttributeError("Error: lanternfish list must be passed as arg")
new_fish_age_hash = {
'zero': count_fish(lanternfish, 1),
'one': count_fish(lanternfish, 2),
'two': count_fish(lanternfish, 3),
'three': count_fish(lanternfish, 4),
'four': count_fish(lanternfish, 5),
'five': count_fish(lanternfish, 6),
'six': count_fish(lanternfish, 0) + count_fish(lanternfish, 7),
'seven': count_fish(lanternfish, 8),
'eight': count_fish(lanternfish, 0),
}
else:
new_fish_age_hash = {
'zero': fish_age_hash['one'],
'one': fish_age_hash['two'],
'two': fish_age_hash['three'],
'three': fish_age_hash['four'],
'four': fish_age_hash['five'],
'five': fish_age_hash['six'],
'six': fish_age_hash['zero'] + fish_age_hash['seven'],
'seven': fish_age_hash['eight'],
'eight': fish_age_hash['zero'],
}
return new_fish_age_hash
# Import data
with open('/home/agaspari/aoc2021/dec_6/dec6_input.txt') as f:
lanternfish = [int(x) for x in f.read().split(',')]
# Task 1
fish_age_hash = dict()
for day in range(0, 80):
fish_age_hash = pass_one_day(fish_age_hash, day, lanternfish)
print(sum([v for v in fish_age_hash.values()]))
# Task 2
fish_age_hash = dict()
for day in range(0, 256):
fish_age_hash = pass_one_day(fish_age_hash, day, lanternfish)
print(sum([v for v in fish_age_hash.values()]))
| def count_fish(lanternfish: list, repro_day: int) -> int:
return len([x for x in lanternfish if x == repro_day])
def pass_one_day(fish_age_hash: dict, day: int, lanternfish: list=None):
if day == 0:
if not lanternfish:
raise attribute_error('Error: lanternfish list must be passed as arg')
new_fish_age_hash = {'zero': count_fish(lanternfish, 1), 'one': count_fish(lanternfish, 2), 'two': count_fish(lanternfish, 3), 'three': count_fish(lanternfish, 4), 'four': count_fish(lanternfish, 5), 'five': count_fish(lanternfish, 6), 'six': count_fish(lanternfish, 0) + count_fish(lanternfish, 7), 'seven': count_fish(lanternfish, 8), 'eight': count_fish(lanternfish, 0)}
else:
new_fish_age_hash = {'zero': fish_age_hash['one'], 'one': fish_age_hash['two'], 'two': fish_age_hash['three'], 'three': fish_age_hash['four'], 'four': fish_age_hash['five'], 'five': fish_age_hash['six'], 'six': fish_age_hash['zero'] + fish_age_hash['seven'], 'seven': fish_age_hash['eight'], 'eight': fish_age_hash['zero']}
return new_fish_age_hash
with open('/home/agaspari/aoc2021/dec_6/dec6_input.txt') as f:
lanternfish = [int(x) for x in f.read().split(',')]
fish_age_hash = dict()
for day in range(0, 80):
fish_age_hash = pass_one_day(fish_age_hash, day, lanternfish)
print(sum([v for v in fish_age_hash.values()]))
fish_age_hash = dict()
for day in range(0, 256):
fish_age_hash = pass_one_day(fish_age_hash, day, lanternfish)
print(sum([v for v in fish_age_hash.values()])) |
class MyClass:
def __call__(self): print('__call__')
c = MyClass()
c()
c.__call__()
print()
c.__call__ = lambda: print('overriding call')
c()
c.__call__()
| class Myclass:
def __call__(self):
print('__call__')
c = my_class()
c()
c.__call__()
print()
c.__call__ = lambda : print('overriding call')
c()
c.__call__() |
token = 'Ndhhfghfgh'
firebase = {
"apiKey": "AIzaSyBYHMxJYFVWP6xH55gAY1TJpVECq4KRjKM",
"authDomain": "test24-13912.firebaseapp.com",
"databaseURL": "https://test24-13912-default-rtdb.firebaseio.com",
"projectId": "test24-13912",
"storageBucket": "test24-13912.appspot.com",
"messagingSenderId": "939334214645",
"appId": "1:939334214645:web:3d8f56ea422989878f76bc",
"measurementId": "G-C95H67C4ZD"
} | token = 'Ndhhfghfgh'
firebase = {'apiKey': 'AIzaSyBYHMxJYFVWP6xH55gAY1TJpVECq4KRjKM', 'authDomain': 'test24-13912.firebaseapp.com', 'databaseURL': 'https://test24-13912-default-rtdb.firebaseio.com', 'projectId': 'test24-13912', 'storageBucket': 'test24-13912.appspot.com', 'messagingSenderId': '939334214645', 'appId': '1:939334214645:web:3d8f56ea422989878f76bc', 'measurementId': 'G-C95H67C4ZD'} |
class InstagramQueryId:
USER_MEDIAS = '17880160963012870'
USER_STORIES = '17890626976041463'
STORIES = '17873473675158481'
| class Instagramqueryid:
user_medias = '17880160963012870'
user_stories = '17890626976041463'
stories = '17873473675158481' |
class person:
def __init__(self, first_name, last_name, age):
self.first_name = first_name
self.last_name = last_name
self.age = age
def get_full_name(self):
return f"{self.first_name} {self.last_name}"
def introduce(self):
return f"Hi. I'm {self.first_name}. {self.last_name}. I'm {self.age} years old"
Phuong = person ('Phoang', 'hoang', 25)
full_name = Phuong.get_full_name
print(f"{full_name}: {Phuong.introduce()}")
#print (f" i'm {Phuong.first_name} {Phuong.last_name}. I'm {Phuong.age} years old")
#https://www.youtube.com/c/TechWithTim/playlists | class Person:
def __init__(self, first_name, last_name, age):
self.first_name = first_name
self.last_name = last_name
self.age = age
def get_full_name(self):
return f'{self.first_name} {self.last_name}'
def introduce(self):
return f"Hi. I'm {self.first_name}. {self.last_name}. I'm {self.age} years old"
phuong = person('Phoang', 'hoang', 25)
full_name = Phuong.get_full_name
print(f'{full_name}: {Phuong.introduce()}') |
#
# PySNMP MIB module HPN-ICF-FLASH-MAN-MIB (http://snmplabs.com/pysmi)
# ASN.1 source file:///Users/davwang4/Dev/mibs.snmplabs.com/asn1/HPN-ICF-FLASH-MAN-MIB
# Produced by pysmi-0.3.4 at Mon Apr 29 19:26:48 2019
# On host DAVWANG4-M-1475 platform Darwin version 18.5.0 by user davwang4
# Using Python version 3.7.3 (default, Mar 27 2019, 09:23:15)
#
ObjectIdentifier, OctetString, Integer = mibBuilder.importSymbols("ASN1", "ObjectIdentifier", "OctetString", "Integer")
NamedValues, = mibBuilder.importSymbols("ASN1-ENUMERATION", "NamedValues")
ValueSizeConstraint, ConstraintsUnion, ValueRangeConstraint, SingleValueConstraint, ConstraintsIntersection = mibBuilder.importSymbols("ASN1-REFINEMENT", "ValueSizeConstraint", "ConstraintsUnion", "ValueRangeConstraint", "SingleValueConstraint", "ConstraintsIntersection")
PhysicalIndex, = mibBuilder.importSymbols("ENTITY-MIB", "PhysicalIndex")
CounterBasedGauge64, = mibBuilder.importSymbols("HCNUM-TC", "CounterBasedGauge64")
hpnicfCommon, = mibBuilder.importSymbols("HPN-ICF-OID-MIB", "hpnicfCommon")
InetAddress, InetAddressType = mibBuilder.importSymbols("INET-ADDRESS-MIB", "InetAddress", "InetAddressType")
NotificationGroup, ObjectGroup, ModuleCompliance = mibBuilder.importSymbols("SNMPv2-CONF", "NotificationGroup", "ObjectGroup", "ModuleCompliance")
ModuleIdentity, TimeTicks, Counter64, Integer32, ObjectIdentity, IpAddress, Bits, Unsigned32, MibIdentifier, MibScalar, MibTable, MibTableRow, MibTableColumn, Counter32, Gauge32, iso, NotificationType = mibBuilder.importSymbols("SNMPv2-SMI", "ModuleIdentity", "TimeTicks", "Counter64", "Integer32", "ObjectIdentity", "IpAddress", "Bits", "Unsigned32", "MibIdentifier", "MibScalar", "MibTable", "MibTableRow", "MibTableColumn", "Counter32", "Gauge32", "iso", "NotificationType")
TruthValue, RowStatus, TextualConvention, DisplayString, TimeStamp = mibBuilder.importSymbols("SNMPv2-TC", "TruthValue", "RowStatus", "TextualConvention", "DisplayString", "TimeStamp")
hpnicfFlash = ModuleIdentity((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5))
hpnicfFlash.setRevisions(('2013-05-23 00:00',))
if mibBuilder.loadTexts: hpnicfFlash.setLastUpdated('201305230000Z')
if mibBuilder.loadTexts: hpnicfFlash.setOrganization('')
class HpnicfFlashOperationStatus(TextualConvention, Integer32):
status = 'current'
subtypeSpec = Integer32.subtypeSpec + ConstraintsUnion(SingleValueConstraint(1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31))
namedValues = NamedValues(("opInProgress", 1), ("opSuccess", 2), ("opInvalid", 3), ("opInvalidProtocol", 4), ("opInvalidSourceName", 5), ("opInvalidDestName", 6), ("opInvalidServerAddress", 7), ("opDeviceBusy", 8), ("opDeviceOpenError", 9), ("opDeviceError", 10), ("opDeviceNotProgrammable", 11), ("opDeviceFull", 12), ("opFileOpenError", 13), ("opFileTransferError", 14), ("opFileChecksumError", 15), ("opNoMemory", 16), ("opAuthFail", 17), ("opTimeout", 18), ("opUnknownFailure", 19), ("opDeleteFileOpenError", 20), ("opDeleteInvalidDevice", 21), ("opDeleteInvalidFunction", 22), ("opDeleteOperationError", 23), ("opDeleteInvalidFileName", 24), ("opDeleteDeviceBusy", 25), ("opDeleteParaError", 26), ("opDeleteInvalidPath", 27), ("opDeleteFileNotExistInSlave", 28), ("opDeleteFileFailedInSlave", 29), ("opSlaveFull", 30), ("opCopyToSlaveFailure", 31))
class HpnicfFlashPartitionUpgradeMode(TextualConvention, Integer32):
status = 'current'
subtypeSpec = Integer32.subtypeSpec + ConstraintsUnion(SingleValueConstraint(1, 2, 3))
namedValues = NamedValues(("unknown", 1), ("rxbootFLH", 2), ("direct", 3))
class HpnicfFlashPartitionStatus(TextualConvention, Integer32):
status = 'current'
subtypeSpec = Integer32.subtypeSpec + ConstraintsUnion(SingleValueConstraint(1, 2, 3))
namedValues = NamedValues(("readOnly", 1), ("runFromFlash", 2), ("readWrite", 3))
hpnicfFlashManMIBObjects = MibIdentifier((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1))
hpnicfFlashDevice = MibIdentifier((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1))
hpnicfFlhSupportNum = MibScalar((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 1), Integer32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpnicfFlhSupportNum.setStatus('current')
hpnicfFlashTable = MibTable((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 2), )
if mibBuilder.loadTexts: hpnicfFlashTable.setStatus('current')
hpnicfFlashEntry = MibTableRow((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 2, 1), ).setIndexNames((0, "HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhIndex"))
if mibBuilder.loadTexts: hpnicfFlashEntry.setStatus('current')
hpnicfFlhIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 2, 1, 1), Integer32().subtype(subtypeSpec=ValueRangeConstraint(1, 2147483647))).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpnicfFlhIndex.setStatus('current')
hpnicfFlhSize = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 2, 1, 2), Integer32()).setUnits('bytes').setMaxAccess("readonly")
if mibBuilder.loadTexts: hpnicfFlhSize.setStatus('deprecated')
hpnicfFlhPos = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 2, 1, 3), PhysicalIndex()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpnicfFlhPos.setStatus('current')
hpnicfFlhName = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 2, 1, 4), DisplayString().subtype(subtypeSpec=ValueSizeConstraint(0, 255))).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpnicfFlhName.setStatus('current')
hpnicfFlhChipNum = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 2, 1, 5), Integer32().subtype(subtypeSpec=ValueRangeConstraint(1, 64))).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpnicfFlhChipNum.setStatus('current')
hpnicfFlhDescr = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 2, 1, 6), DisplayString().subtype(subtypeSpec=ValueSizeConstraint(0, 64))).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpnicfFlhDescr.setStatus('current')
hpnicfFlhInitTime = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 2, 1, 8), TimeStamp()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpnicfFlhInitTime.setStatus('current')
hpnicfFlhRemovable = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 2, 1, 9), TruthValue()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpnicfFlhRemovable.setStatus('current')
hpnicfFlhPartitionBool = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 2, 1, 11), TruthValue()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hpnicfFlhPartitionBool.setStatus('current')
hpnicfFlhMinPartitionSize = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 2, 1, 12), Integer32()).setUnits('bytes').setMaxAccess("readonly")
if mibBuilder.loadTexts: hpnicfFlhMinPartitionSize.setStatus('current')
hpnicfFlhMaxPartitions = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 2, 1, 13), Integer32().subtype(subtypeSpec=ValueRangeConstraint(1, 8))).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpnicfFlhMaxPartitions.setStatus('current')
hpnicfFlhPartitionNum = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 2, 1, 14), Integer32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpnicfFlhPartitionNum.setStatus('current')
hpnicfFlhKbyteSize = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 2, 1, 15), Integer32()).setUnits('kbytes').setMaxAccess("readonly")
if mibBuilder.loadTexts: hpnicfFlhKbyteSize.setStatus('current')
hpnicfFlhHCSize = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 2, 1, 16), CounterBasedGauge64()).setUnits('bytes').setMaxAccess("readonly")
if mibBuilder.loadTexts: hpnicfFlhHCSize.setStatus('current')
hpnicfFlashChips = MibIdentifier((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 3))
hpnicfFlhChipTable = MibTable((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 3, 1), )
if mibBuilder.loadTexts: hpnicfFlhChipTable.setStatus('current')
hpnicfFlhChipEntry = MibTableRow((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 3, 1, 1), ).setIndexNames((0, "HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhIndex"), (0, "HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhChipSerialNo"))
if mibBuilder.loadTexts: hpnicfFlhChipEntry.setStatus('current')
hpnicfFlhChipSerialNo = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 3, 1, 1, 1), Integer32().subtype(subtypeSpec=ValueRangeConstraint(1, 64)))
if mibBuilder.loadTexts: hpnicfFlhChipSerialNo.setStatus('current')
hpnicfFlhChipID = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 3, 1, 1, 2), DisplayString().subtype(subtypeSpec=ValueSizeConstraint(0, 5))).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpnicfFlhChipID.setStatus('current')
hpnicfFlhChipDescr = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 3, 1, 1, 3), DisplayString().subtype(subtypeSpec=ValueSizeConstraint(0, 32))).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpnicfFlhChipDescr.setStatus('current')
hpnicfFlhChipWriteTimesLimit = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 3, 1, 1, 4), Integer32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpnicfFlhChipWriteTimesLimit.setStatus('current')
hpnicfFlhChipWriteTimes = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 3, 1, 1, 5), Counter32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpnicfFlhChipWriteTimes.setStatus('current')
hpnicfFlhChipEraseTimesLimit = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 3, 1, 1, 6), Integer32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpnicfFlhChipEraseTimesLimit.setStatus('current')
hpnicfFlhChipEraseTimes = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 3, 1, 1, 7), Counter32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpnicfFlhChipEraseTimes.setStatus('current')
hpnicfFlashPartitions = MibIdentifier((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4))
hpnicfFlhPartitionTable = MibTable((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 1), )
if mibBuilder.loadTexts: hpnicfFlhPartitionTable.setStatus('current')
hpnicfFlhPartitionEntry = MibTableRow((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 1, 1), ).setIndexNames((0, "HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhIndex"), (0, "HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhPartIndex"))
if mibBuilder.loadTexts: hpnicfFlhPartitionEntry.setStatus('current')
hpnicfFlhPartIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 1, 1, 1), Integer32().subtype(subtypeSpec=ValueRangeConstraint(1, 8)))
if mibBuilder.loadTexts: hpnicfFlhPartIndex.setStatus('current')
hpnicfFlhPartFirstChip = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 1, 1, 2), Integer32().subtype(subtypeSpec=ValueRangeConstraint(1, 64))).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpnicfFlhPartFirstChip.setStatus('current')
hpnicfFlhPartLastChip = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 1, 1, 3), Integer32().subtype(subtypeSpec=ValueRangeConstraint(1, 64))).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpnicfFlhPartLastChip.setStatus('current')
hpnicfFlhPartSpace = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 1, 1, 4), Integer32()).setUnits('bytes').setMaxAccess("readonly")
if mibBuilder.loadTexts: hpnicfFlhPartSpace.setStatus('deprecated')
hpnicfFlhPartSpaceFree = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 1, 1, 5), Gauge32()).setUnits('bytes').setMaxAccess("readonly")
if mibBuilder.loadTexts: hpnicfFlhPartSpaceFree.setStatus('deprecated')
hpnicfFlhPartFileNum = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 1, 1, 6), Integer32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpnicfFlhPartFileNum.setStatus('current')
hpnicfFlhPartChecksumMethod = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 1, 1, 7), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2, 3))).clone(namedValues=NamedValues(("simpleChecksum", 1), ("undefined", 2), ("simpleCRC", 3)))).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpnicfFlhPartChecksumMethod.setStatus('current')
hpnicfFlhPartStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 1, 1, 8), HpnicfFlashPartitionStatus()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpnicfFlhPartStatus.setStatus('current')
hpnicfFlhPartUpgradeMode = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 1, 1, 9), HpnicfFlashPartitionUpgradeMode()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpnicfFlhPartUpgradeMode.setStatus('current')
hpnicfFlhPartName = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 1, 1, 10), DisplayString().subtype(subtypeSpec=ValueSizeConstraint(0, 255))).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpnicfFlhPartName.setStatus('current')
hpnicfFlhPartRequireErase = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 1, 1, 11), TruthValue()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpnicfFlhPartRequireErase.setStatus('current')
hpnicfFlhPartFileNameLen = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 1, 1, 12), Integer32().subtype(subtypeSpec=ValueRangeConstraint(1, 256))).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpnicfFlhPartFileNameLen.setStatus('current')
hpnicfFlhPartBootable = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 1, 1, 13), TruthValue()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpnicfFlhPartBootable.setStatus('current')
hpnicfFlhPartPathForGlobalOpt = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 1, 1, 14), TruthValue()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hpnicfFlhPartPathForGlobalOpt.setStatus('current')
hpnicfFlhPartHCSpace = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 1, 1, 15), CounterBasedGauge64()).setUnits('bytes').setMaxAccess("readonly")
if mibBuilder.loadTexts: hpnicfFlhPartHCSpace.setStatus('current')
hpnicfFlhPartHCSpaceFree = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 1, 1, 16), CounterBasedGauge64()).setUnits('bytes').setMaxAccess("readonly")
if mibBuilder.loadTexts: hpnicfFlhPartHCSpaceFree.setStatus('current')
hpnicfFlhFiles = MibIdentifier((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 2))
hpnicfFlhFileTable = MibTable((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 2, 1), )
if mibBuilder.loadTexts: hpnicfFlhFileTable.setStatus('current')
hpnicfFlhFileEntry = MibTableRow((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 2, 1, 1), ).setIndexNames((0, "HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhIndex"), (0, "HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhPartIndex"), (0, "HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhFileIndex"))
if mibBuilder.loadTexts: hpnicfFlhFileEntry.setStatus('current')
hpnicfFlhFileIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 2, 1, 1, 1), Integer32().subtype(subtypeSpec=ValueRangeConstraint(1, 2147483647)))
if mibBuilder.loadTexts: hpnicfFlhFileIndex.setStatus('current')
hpnicfFlhFileName = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 2, 1, 1, 2), DisplayString().subtype(subtypeSpec=ValueSizeConstraint(1, 255))).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpnicfFlhFileName.setStatus('current')
hpnicfFlhFileSize = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 2, 1, 1, 3), Integer32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpnicfFlhFileSize.setStatus('deprecated')
hpnicfFlhFileStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 2, 1, 1, 4), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2, 3))).clone(namedValues=NamedValues(("deleted", 1), ("invalidChecksum", 2), ("valid", 3)))).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpnicfFlhFileStatus.setStatus('current')
hpnicfFlhFileChecksum = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 2, 1, 1, 5), OctetString()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpnicfFlhFileChecksum.setStatus('current')
hpnicfFlhFileHCSize = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 2, 1, 1, 6), CounterBasedGauge64()).setUnits('bytes').setMaxAccess("readonly")
if mibBuilder.loadTexts: hpnicfFlhFileHCSize.setStatus('current')
hpnicfFlashOperate = MibIdentifier((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 2))
hpnicfFlhOpTable = MibTable((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 2, 1), )
if mibBuilder.loadTexts: hpnicfFlhOpTable.setStatus('current')
hpnicfFlhOpEntry = MibTableRow((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 2, 1, 1), ).setIndexNames((0, "HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhOperIndex"))
if mibBuilder.loadTexts: hpnicfFlhOpEntry.setStatus('current')
hpnicfFlhOperIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 2, 1, 1, 1), Integer32().subtype(subtypeSpec=ValueRangeConstraint(1, 2147483647)))
if mibBuilder.loadTexts: hpnicfFlhOperIndex.setStatus('current')
hpnicfFlhOperType = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 2, 1, 1, 2), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2, 3, 4, 5))).clone(namedValues=NamedValues(("net2FlashWithErase", 1), ("net2FlashWithoutErase", 2), ("flash2Net", 3), ("delete", 4), ("rename", 5)))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hpnicfFlhOperType.setStatus('current')
hpnicfFlhOperProtocol = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 2, 1, 1, 3), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2, 3, 4))).clone(namedValues=NamedValues(("ftp", 1), ("tftp", 2), ("clusterftp", 3), ("clustertftp", 4))).clone('ftp')).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hpnicfFlhOperProtocol.setStatus('current')
hpnicfFlhOperServerAddress = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 2, 1, 1, 4), IpAddress().clone(hexValue="FFFFFFFF")).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hpnicfFlhOperServerAddress.setStatus('deprecated')
hpnicfFlhOperServerUser = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 2, 1, 1, 5), DisplayString()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hpnicfFlhOperServerUser.setStatus('current')
hpnicfFlhOperPassword = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 2, 1, 1, 6), DisplayString()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hpnicfFlhOperPassword.setStatus('current')
hpnicfFlhOperSourceFile = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 2, 1, 1, 7), DisplayString().subtype(subtypeSpec=ValueSizeConstraint(1, 255))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hpnicfFlhOperSourceFile.setStatus('current')
hpnicfFlhOperDestinationFile = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 2, 1, 1, 8), DisplayString()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hpnicfFlhOperDestinationFile.setStatus('current')
hpnicfFlhOperStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 2, 1, 1, 9), HpnicfFlashOperationStatus()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpnicfFlhOperStatus.setStatus('current')
hpnicfFlhOperEndNotification = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 2, 1, 1, 10), TruthValue().clone('false')).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hpnicfFlhOperEndNotification.setStatus('current')
hpnicfFlhOperProgress = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 2, 1, 1, 11), TimeTicks()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpnicfFlhOperProgress.setStatus('current')
hpnicfFlhOperRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 2, 1, 1, 12), RowStatus()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hpnicfFlhOperRowStatus.setStatus('current')
hpnicfFlhOperServerPort = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 2, 1, 1, 13), Integer32().subtype(subtypeSpec=ValueRangeConstraint(0, 65535))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hpnicfFlhOperServerPort.setStatus('current')
hpnicfFlhOperFailReason = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 2, 1, 1, 14), DisplayString()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpnicfFlhOperFailReason.setStatus('current')
hpnicfFlhOperSrvAddrType = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 2, 1, 1, 15), InetAddressType()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hpnicfFlhOperSrvAddrType.setStatus('current')
hpnicfFlhOperSrvAddrRev = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 2, 1, 1, 16), InetAddress()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hpnicfFlhOperSrvAddrRev.setStatus('current')
hpnicfFlhOperSrvVPNName = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 2, 1, 1, 17), DisplayString()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hpnicfFlhOperSrvVPNName.setStatus('current')
hpnicfFlashNotification = MibIdentifier((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 3))
hpnicfFlhOperNotification = NotificationType((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 3, 1)).setObjects(("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhOperStatus"))
if mibBuilder.loadTexts: hpnicfFlhOperNotification.setStatus('current')
hpnicfFlashMIBConformance = MibIdentifier((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 2))
hpnicfFlhMIBCompliances = MibIdentifier((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 2, 1))
hpnicfFlhMIBCompliance = ModuleCompliance((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 2, 1, 1)).setObjects(("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhGroup"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhPartitionGroup"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhFileGroup"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhOperationGroup"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhNotificationGroup"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhChipGroup"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
hpnicfFlhMIBCompliance = hpnicfFlhMIBCompliance.setStatus('current')
hpnicfFlashMIBGroups = MibIdentifier((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 2, 2))
hpnicfFlhGroup = ObjectGroup((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 2, 2, 1)).setObjects(("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhSupportNum"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhSize"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhPos"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhName"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhChipNum"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhDescr"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhInitTime"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhRemovable"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhPartitionBool"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhMinPartitionSize"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhMaxPartitions"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhPartitionNum"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhIndex"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhKbyteSize"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
hpnicfFlhGroup = hpnicfFlhGroup.setStatus('current')
hpnicfFlhChipGroup = ObjectGroup((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 2, 2, 3)).setObjects(("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhChipID"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhChipDescr"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhChipWriteTimesLimit"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhChipWriteTimes"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhChipEraseTimesLimit"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhChipEraseTimes"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
hpnicfFlhChipGroup = hpnicfFlhChipGroup.setStatus('current')
hpnicfFlhPartitionGroup = ObjectGroup((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 2, 2, 4)).setObjects(("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhPartFirstChip"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhPartLastChip"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhPartSpace"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhPartSpaceFree"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhPartFileNum"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhPartChecksumMethod"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhPartStatus"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhPartUpgradeMode"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhPartName"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhPartRequireErase"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhPartFileNameLen"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhPartBootable"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhPartPathForGlobalOpt"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
hpnicfFlhPartitionGroup = hpnicfFlhPartitionGroup.setStatus('current')
hpnicfFlhFileGroup = ObjectGroup((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 2, 2, 5)).setObjects(("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhFileName"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhFileSize"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhFileStatus"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhFileChecksum"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
hpnicfFlhFileGroup = hpnicfFlhFileGroup.setStatus('current')
hpnicfFlhOperationGroup = ObjectGroup((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 2, 2, 6)).setObjects(("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhOperType"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhOperProtocol"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhOperServerAddress"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhOperServerUser"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhOperPassword"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhOperSourceFile"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhOperDestinationFile"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhOperStatus"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhOperEndNotification"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhOperProgress"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhOperRowStatus"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhOperServerPort"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhOperFailReason"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
hpnicfFlhOperationGroup = hpnicfFlhOperationGroup.setStatus('current')
hpnicfFlhNotificationGroup = NotificationGroup((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 2, 2, 7)).setObjects(("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhOperNotification"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
hpnicfFlhNotificationGroup = hpnicfFlhNotificationGroup.setStatus('current')
mibBuilder.exportSymbols("HPN-ICF-FLASH-MAN-MIB", HpnicfFlashPartitionUpgradeMode=HpnicfFlashPartitionUpgradeMode, hpnicfFlhChipTable=hpnicfFlhChipTable, hpnicfFlhFileHCSize=hpnicfFlhFileHCSize, hpnicfFlhChipDescr=hpnicfFlhChipDescr, hpnicfFlhOperSrvAddrType=hpnicfFlhOperSrvAddrType, hpnicfFlashOperate=hpnicfFlashOperate, hpnicfFlhPartStatus=hpnicfFlhPartStatus, hpnicfFlhPartitionBool=hpnicfFlhPartitionBool, hpnicfFlhOperSrvAddrRev=hpnicfFlhOperSrvAddrRev, hpnicfFlashMIBConformance=hpnicfFlashMIBConformance, hpnicfFlhDescr=hpnicfFlhDescr, hpnicfFlhFileName=hpnicfFlhFileName, hpnicfFlhHCSize=hpnicfFlhHCSize, hpnicfFlhOperSrvVPNName=hpnicfFlhOperSrvVPNName, hpnicfFlhPartFileNum=hpnicfFlhPartFileNum, hpnicfFlhMIBCompliances=hpnicfFlhMIBCompliances, hpnicfFlhSize=hpnicfFlhSize, hpnicfFlhPartHCSpace=hpnicfFlhPartHCSpace, hpnicfFlhOperType=hpnicfFlhOperType, hpnicfFlhPartitionEntry=hpnicfFlhPartitionEntry, hpnicfFlhOperProtocol=hpnicfFlhOperProtocol, hpnicfFlhFileStatus=hpnicfFlhFileStatus, hpnicfFlhPartRequireErase=hpnicfFlhPartRequireErase, hpnicfFlashDevice=hpnicfFlashDevice, hpnicfFlhOperRowStatus=hpnicfFlhOperRowStatus, hpnicfFlhOperationGroup=hpnicfFlhOperationGroup, hpnicfFlhPartitionNum=hpnicfFlhPartitionNum, hpnicfFlhFileIndex=hpnicfFlhFileIndex, hpnicfFlhChipID=hpnicfFlhChipID, hpnicfFlhOperServerUser=hpnicfFlhOperServerUser, hpnicfFlhOperDestinationFile=hpnicfFlhOperDestinationFile, hpnicfFlhOperIndex=hpnicfFlhOperIndex, hpnicfFlhChipWriteTimesLimit=hpnicfFlhChipWriteTimesLimit, hpnicfFlhNotificationGroup=hpnicfFlhNotificationGroup, hpnicfFlhOperEndNotification=hpnicfFlhOperEndNotification, hpnicfFlhSupportNum=hpnicfFlhSupportNum, hpnicfFlhPartChecksumMethod=hpnicfFlhPartChecksumMethod, hpnicfFlhPos=hpnicfFlhPos, hpnicfFlhOperSourceFile=hpnicfFlhOperSourceFile, hpnicfFlhPartFirstChip=hpnicfFlhPartFirstChip, hpnicfFlhFileGroup=hpnicfFlhFileGroup, hpnicfFlhOperFailReason=hpnicfFlhOperFailReason, hpnicfFlhFileEntry=hpnicfFlhFileEntry, hpnicfFlhChipNum=hpnicfFlhChipNum, hpnicfFlhPartSpace=hpnicfFlhPartSpace, hpnicfFlashTable=hpnicfFlashTable, hpnicfFlhMinPartitionSize=hpnicfFlhMinPartitionSize, hpnicfFlhFiles=hpnicfFlhFiles, HpnicfFlashPartitionStatus=HpnicfFlashPartitionStatus, hpnicfFlhPartIndex=hpnicfFlhPartIndex, hpnicfFlhInitTime=hpnicfFlhInitTime, hpnicfFlhPartitionTable=hpnicfFlhPartitionTable, hpnicfFlhOpTable=hpnicfFlhOpTable, hpnicfFlhOperNotification=hpnicfFlhOperNotification, hpnicfFlhChipWriteTimes=hpnicfFlhChipWriteTimes, hpnicfFlhFileTable=hpnicfFlhFileTable, hpnicfFlash=hpnicfFlash, PYSNMP_MODULE_ID=hpnicfFlash, hpnicfFlhChipEraseTimes=hpnicfFlhChipEraseTimes, hpnicfFlashMIBGroups=hpnicfFlashMIBGroups, hpnicfFlhMaxPartitions=hpnicfFlhMaxPartitions, hpnicfFlhChipSerialNo=hpnicfFlhChipSerialNo, hpnicfFlashChips=hpnicfFlashChips, hpnicfFlhPartName=hpnicfFlhPartName, hpnicfFlhOperServerAddress=hpnicfFlhOperServerAddress, hpnicfFlhChipEntry=hpnicfFlhChipEntry, hpnicfFlhName=hpnicfFlhName, hpnicfFlhPartSpaceFree=hpnicfFlhPartSpaceFree, hpnicfFlhOperProgress=hpnicfFlhOperProgress, hpnicfFlashEntry=hpnicfFlashEntry, hpnicfFlhPartPathForGlobalOpt=hpnicfFlhPartPathForGlobalOpt, hpnicfFlhOperPassword=hpnicfFlhOperPassword, hpnicfFlashManMIBObjects=hpnicfFlashManMIBObjects, hpnicfFlhPartUpgradeMode=hpnicfFlhPartUpgradeMode, hpnicfFlashPartitions=hpnicfFlashPartitions, hpnicfFlhIndex=hpnicfFlhIndex, hpnicfFlashNotification=hpnicfFlashNotification, hpnicfFlhOperServerPort=hpnicfFlhOperServerPort, hpnicfFlhChipEraseTimesLimit=hpnicfFlhChipEraseTimesLimit, hpnicfFlhOperStatus=hpnicfFlhOperStatus, hpnicfFlhOpEntry=hpnicfFlhOpEntry, hpnicfFlhGroup=hpnicfFlhGroup, hpnicfFlhPartHCSpaceFree=hpnicfFlhPartHCSpaceFree, hpnicfFlhRemovable=hpnicfFlhRemovable, hpnicfFlhPartLastChip=hpnicfFlhPartLastChip, hpnicfFlhChipGroup=hpnicfFlhChipGroup, hpnicfFlhKbyteSize=hpnicfFlhKbyteSize, hpnicfFlhFileSize=hpnicfFlhFileSize, hpnicfFlhPartitionGroup=hpnicfFlhPartitionGroup, hpnicfFlhPartBootable=hpnicfFlhPartBootable, HpnicfFlashOperationStatus=HpnicfFlashOperationStatus, hpnicfFlhMIBCompliance=hpnicfFlhMIBCompliance, hpnicfFlhFileChecksum=hpnicfFlhFileChecksum, hpnicfFlhPartFileNameLen=hpnicfFlhPartFileNameLen)
| (object_identifier, octet_string, integer) = mibBuilder.importSymbols('ASN1', 'ObjectIdentifier', 'OctetString', 'Integer')
(named_values,) = mibBuilder.importSymbols('ASN1-ENUMERATION', 'NamedValues')
(value_size_constraint, constraints_union, value_range_constraint, single_value_constraint, constraints_intersection) = mibBuilder.importSymbols('ASN1-REFINEMENT', 'ValueSizeConstraint', 'ConstraintsUnion', 'ValueRangeConstraint', 'SingleValueConstraint', 'ConstraintsIntersection')
(physical_index,) = mibBuilder.importSymbols('ENTITY-MIB', 'PhysicalIndex')
(counter_based_gauge64,) = mibBuilder.importSymbols('HCNUM-TC', 'CounterBasedGauge64')
(hpnicf_common,) = mibBuilder.importSymbols('HPN-ICF-OID-MIB', 'hpnicfCommon')
(inet_address, inet_address_type) = mibBuilder.importSymbols('INET-ADDRESS-MIB', 'InetAddress', 'InetAddressType')
(notification_group, object_group, module_compliance) = mibBuilder.importSymbols('SNMPv2-CONF', 'NotificationGroup', 'ObjectGroup', 'ModuleCompliance')
(module_identity, time_ticks, counter64, integer32, object_identity, ip_address, bits, unsigned32, mib_identifier, mib_scalar, mib_table, mib_table_row, mib_table_column, counter32, gauge32, iso, notification_type) = mibBuilder.importSymbols('SNMPv2-SMI', 'ModuleIdentity', 'TimeTicks', 'Counter64', 'Integer32', 'ObjectIdentity', 'IpAddress', 'Bits', 'Unsigned32', 'MibIdentifier', 'MibScalar', 'MibTable', 'MibTableRow', 'MibTableColumn', 'Counter32', 'Gauge32', 'iso', 'NotificationType')
(truth_value, row_status, textual_convention, display_string, time_stamp) = mibBuilder.importSymbols('SNMPv2-TC', 'TruthValue', 'RowStatus', 'TextualConvention', 'DisplayString', 'TimeStamp')
hpnicf_flash = module_identity((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5))
hpnicfFlash.setRevisions(('2013-05-23 00:00',))
if mibBuilder.loadTexts:
hpnicfFlash.setLastUpdated('201305230000Z')
if mibBuilder.loadTexts:
hpnicfFlash.setOrganization('')
class Hpnicfflashoperationstatus(TextualConvention, Integer32):
status = 'current'
subtype_spec = Integer32.subtypeSpec + constraints_union(single_value_constraint(1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31))
named_values = named_values(('opInProgress', 1), ('opSuccess', 2), ('opInvalid', 3), ('opInvalidProtocol', 4), ('opInvalidSourceName', 5), ('opInvalidDestName', 6), ('opInvalidServerAddress', 7), ('opDeviceBusy', 8), ('opDeviceOpenError', 9), ('opDeviceError', 10), ('opDeviceNotProgrammable', 11), ('opDeviceFull', 12), ('opFileOpenError', 13), ('opFileTransferError', 14), ('opFileChecksumError', 15), ('opNoMemory', 16), ('opAuthFail', 17), ('opTimeout', 18), ('opUnknownFailure', 19), ('opDeleteFileOpenError', 20), ('opDeleteInvalidDevice', 21), ('opDeleteInvalidFunction', 22), ('opDeleteOperationError', 23), ('opDeleteInvalidFileName', 24), ('opDeleteDeviceBusy', 25), ('opDeleteParaError', 26), ('opDeleteInvalidPath', 27), ('opDeleteFileNotExistInSlave', 28), ('opDeleteFileFailedInSlave', 29), ('opSlaveFull', 30), ('opCopyToSlaveFailure', 31))
class Hpnicfflashpartitionupgrademode(TextualConvention, Integer32):
status = 'current'
subtype_spec = Integer32.subtypeSpec + constraints_union(single_value_constraint(1, 2, 3))
named_values = named_values(('unknown', 1), ('rxbootFLH', 2), ('direct', 3))
class Hpnicfflashpartitionstatus(TextualConvention, Integer32):
status = 'current'
subtype_spec = Integer32.subtypeSpec + constraints_union(single_value_constraint(1, 2, 3))
named_values = named_values(('readOnly', 1), ('runFromFlash', 2), ('readWrite', 3))
hpnicf_flash_man_mib_objects = mib_identifier((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1))
hpnicf_flash_device = mib_identifier((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1))
hpnicf_flh_support_num = mib_scalar((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 1), integer32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpnicfFlhSupportNum.setStatus('current')
hpnicf_flash_table = mib_table((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 2))
if mibBuilder.loadTexts:
hpnicfFlashTable.setStatus('current')
hpnicf_flash_entry = mib_table_row((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 2, 1)).setIndexNames((0, 'HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhIndex'))
if mibBuilder.loadTexts:
hpnicfFlashEntry.setStatus('current')
hpnicf_flh_index = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 2, 1, 1), integer32().subtype(subtypeSpec=value_range_constraint(1, 2147483647))).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpnicfFlhIndex.setStatus('current')
hpnicf_flh_size = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 2, 1, 2), integer32()).setUnits('bytes').setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpnicfFlhSize.setStatus('deprecated')
hpnicf_flh_pos = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 2, 1, 3), physical_index()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpnicfFlhPos.setStatus('current')
hpnicf_flh_name = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 2, 1, 4), display_string().subtype(subtypeSpec=value_size_constraint(0, 255))).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpnicfFlhName.setStatus('current')
hpnicf_flh_chip_num = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 2, 1, 5), integer32().subtype(subtypeSpec=value_range_constraint(1, 64))).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpnicfFlhChipNum.setStatus('current')
hpnicf_flh_descr = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 2, 1, 6), display_string().subtype(subtypeSpec=value_size_constraint(0, 64))).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpnicfFlhDescr.setStatus('current')
hpnicf_flh_init_time = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 2, 1, 8), time_stamp()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpnicfFlhInitTime.setStatus('current')
hpnicf_flh_removable = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 2, 1, 9), truth_value()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpnicfFlhRemovable.setStatus('current')
hpnicf_flh_partition_bool = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 2, 1, 11), truth_value()).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
hpnicfFlhPartitionBool.setStatus('current')
hpnicf_flh_min_partition_size = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 2, 1, 12), integer32()).setUnits('bytes').setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpnicfFlhMinPartitionSize.setStatus('current')
hpnicf_flh_max_partitions = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 2, 1, 13), integer32().subtype(subtypeSpec=value_range_constraint(1, 8))).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpnicfFlhMaxPartitions.setStatus('current')
hpnicf_flh_partition_num = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 2, 1, 14), integer32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpnicfFlhPartitionNum.setStatus('current')
hpnicf_flh_kbyte_size = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 2, 1, 15), integer32()).setUnits('kbytes').setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpnicfFlhKbyteSize.setStatus('current')
hpnicf_flh_hc_size = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 2, 1, 16), counter_based_gauge64()).setUnits('bytes').setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpnicfFlhHCSize.setStatus('current')
hpnicf_flash_chips = mib_identifier((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 3))
hpnicf_flh_chip_table = mib_table((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 3, 1))
if mibBuilder.loadTexts:
hpnicfFlhChipTable.setStatus('current')
hpnicf_flh_chip_entry = mib_table_row((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 3, 1, 1)).setIndexNames((0, 'HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhIndex'), (0, 'HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhChipSerialNo'))
if mibBuilder.loadTexts:
hpnicfFlhChipEntry.setStatus('current')
hpnicf_flh_chip_serial_no = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 3, 1, 1, 1), integer32().subtype(subtypeSpec=value_range_constraint(1, 64)))
if mibBuilder.loadTexts:
hpnicfFlhChipSerialNo.setStatus('current')
hpnicf_flh_chip_id = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 3, 1, 1, 2), display_string().subtype(subtypeSpec=value_size_constraint(0, 5))).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpnicfFlhChipID.setStatus('current')
hpnicf_flh_chip_descr = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 3, 1, 1, 3), display_string().subtype(subtypeSpec=value_size_constraint(0, 32))).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpnicfFlhChipDescr.setStatus('current')
hpnicf_flh_chip_write_times_limit = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 3, 1, 1, 4), integer32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpnicfFlhChipWriteTimesLimit.setStatus('current')
hpnicf_flh_chip_write_times = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 3, 1, 1, 5), counter32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpnicfFlhChipWriteTimes.setStatus('current')
hpnicf_flh_chip_erase_times_limit = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 3, 1, 1, 6), integer32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpnicfFlhChipEraseTimesLimit.setStatus('current')
hpnicf_flh_chip_erase_times = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 3, 1, 1, 7), counter32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpnicfFlhChipEraseTimes.setStatus('current')
hpnicf_flash_partitions = mib_identifier((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4))
hpnicf_flh_partition_table = mib_table((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 1))
if mibBuilder.loadTexts:
hpnicfFlhPartitionTable.setStatus('current')
hpnicf_flh_partition_entry = mib_table_row((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 1, 1)).setIndexNames((0, 'HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhIndex'), (0, 'HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhPartIndex'))
if mibBuilder.loadTexts:
hpnicfFlhPartitionEntry.setStatus('current')
hpnicf_flh_part_index = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 1, 1, 1), integer32().subtype(subtypeSpec=value_range_constraint(1, 8)))
if mibBuilder.loadTexts:
hpnicfFlhPartIndex.setStatus('current')
hpnicf_flh_part_first_chip = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 1, 1, 2), integer32().subtype(subtypeSpec=value_range_constraint(1, 64))).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpnicfFlhPartFirstChip.setStatus('current')
hpnicf_flh_part_last_chip = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 1, 1, 3), integer32().subtype(subtypeSpec=value_range_constraint(1, 64))).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpnicfFlhPartLastChip.setStatus('current')
hpnicf_flh_part_space = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 1, 1, 4), integer32()).setUnits('bytes').setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpnicfFlhPartSpace.setStatus('deprecated')
hpnicf_flh_part_space_free = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 1, 1, 5), gauge32()).setUnits('bytes').setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpnicfFlhPartSpaceFree.setStatus('deprecated')
hpnicf_flh_part_file_num = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 1, 1, 6), integer32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpnicfFlhPartFileNum.setStatus('current')
hpnicf_flh_part_checksum_method = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 1, 1, 7), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(1, 2, 3))).clone(namedValues=named_values(('simpleChecksum', 1), ('undefined', 2), ('simpleCRC', 3)))).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpnicfFlhPartChecksumMethod.setStatus('current')
hpnicf_flh_part_status = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 1, 1, 8), hpnicf_flash_partition_status()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpnicfFlhPartStatus.setStatus('current')
hpnicf_flh_part_upgrade_mode = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 1, 1, 9), hpnicf_flash_partition_upgrade_mode()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpnicfFlhPartUpgradeMode.setStatus('current')
hpnicf_flh_part_name = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 1, 1, 10), display_string().subtype(subtypeSpec=value_size_constraint(0, 255))).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpnicfFlhPartName.setStatus('current')
hpnicf_flh_part_require_erase = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 1, 1, 11), truth_value()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpnicfFlhPartRequireErase.setStatus('current')
hpnicf_flh_part_file_name_len = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 1, 1, 12), integer32().subtype(subtypeSpec=value_range_constraint(1, 256))).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpnicfFlhPartFileNameLen.setStatus('current')
hpnicf_flh_part_bootable = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 1, 1, 13), truth_value()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpnicfFlhPartBootable.setStatus('current')
hpnicf_flh_part_path_for_global_opt = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 1, 1, 14), truth_value()).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
hpnicfFlhPartPathForGlobalOpt.setStatus('current')
hpnicf_flh_part_hc_space = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 1, 1, 15), counter_based_gauge64()).setUnits('bytes').setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpnicfFlhPartHCSpace.setStatus('current')
hpnicf_flh_part_hc_space_free = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 1, 1, 16), counter_based_gauge64()).setUnits('bytes').setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpnicfFlhPartHCSpaceFree.setStatus('current')
hpnicf_flh_files = mib_identifier((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 2))
hpnicf_flh_file_table = mib_table((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 2, 1))
if mibBuilder.loadTexts:
hpnicfFlhFileTable.setStatus('current')
hpnicf_flh_file_entry = mib_table_row((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 2, 1, 1)).setIndexNames((0, 'HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhIndex'), (0, 'HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhPartIndex'), (0, 'HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhFileIndex'))
if mibBuilder.loadTexts:
hpnicfFlhFileEntry.setStatus('current')
hpnicf_flh_file_index = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 2, 1, 1, 1), integer32().subtype(subtypeSpec=value_range_constraint(1, 2147483647)))
if mibBuilder.loadTexts:
hpnicfFlhFileIndex.setStatus('current')
hpnicf_flh_file_name = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 2, 1, 1, 2), display_string().subtype(subtypeSpec=value_size_constraint(1, 255))).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpnicfFlhFileName.setStatus('current')
hpnicf_flh_file_size = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 2, 1, 1, 3), integer32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpnicfFlhFileSize.setStatus('deprecated')
hpnicf_flh_file_status = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 2, 1, 1, 4), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(1, 2, 3))).clone(namedValues=named_values(('deleted', 1), ('invalidChecksum', 2), ('valid', 3)))).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpnicfFlhFileStatus.setStatus('current')
hpnicf_flh_file_checksum = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 2, 1, 1, 5), octet_string()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpnicfFlhFileChecksum.setStatus('current')
hpnicf_flh_file_hc_size = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 2, 1, 1, 6), counter_based_gauge64()).setUnits('bytes').setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpnicfFlhFileHCSize.setStatus('current')
hpnicf_flash_operate = mib_identifier((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 2))
hpnicf_flh_op_table = mib_table((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 2, 1))
if mibBuilder.loadTexts:
hpnicfFlhOpTable.setStatus('current')
hpnicf_flh_op_entry = mib_table_row((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 2, 1, 1)).setIndexNames((0, 'HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhOperIndex'))
if mibBuilder.loadTexts:
hpnicfFlhOpEntry.setStatus('current')
hpnicf_flh_oper_index = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 2, 1, 1, 1), integer32().subtype(subtypeSpec=value_range_constraint(1, 2147483647)))
if mibBuilder.loadTexts:
hpnicfFlhOperIndex.setStatus('current')
hpnicf_flh_oper_type = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 2, 1, 1, 2), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(1, 2, 3, 4, 5))).clone(namedValues=named_values(('net2FlashWithErase', 1), ('net2FlashWithoutErase', 2), ('flash2Net', 3), ('delete', 4), ('rename', 5)))).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
hpnicfFlhOperType.setStatus('current')
hpnicf_flh_oper_protocol = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 2, 1, 1, 3), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(1, 2, 3, 4))).clone(namedValues=named_values(('ftp', 1), ('tftp', 2), ('clusterftp', 3), ('clustertftp', 4))).clone('ftp')).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
hpnicfFlhOperProtocol.setStatus('current')
hpnicf_flh_oper_server_address = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 2, 1, 1, 4), ip_address().clone(hexValue='FFFFFFFF')).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
hpnicfFlhOperServerAddress.setStatus('deprecated')
hpnicf_flh_oper_server_user = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 2, 1, 1, 5), display_string()).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
hpnicfFlhOperServerUser.setStatus('current')
hpnicf_flh_oper_password = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 2, 1, 1, 6), display_string()).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
hpnicfFlhOperPassword.setStatus('current')
hpnicf_flh_oper_source_file = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 2, 1, 1, 7), display_string().subtype(subtypeSpec=value_size_constraint(1, 255))).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
hpnicfFlhOperSourceFile.setStatus('current')
hpnicf_flh_oper_destination_file = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 2, 1, 1, 8), display_string()).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
hpnicfFlhOperDestinationFile.setStatus('current')
hpnicf_flh_oper_status = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 2, 1, 1, 9), hpnicf_flash_operation_status()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpnicfFlhOperStatus.setStatus('current')
hpnicf_flh_oper_end_notification = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 2, 1, 1, 10), truth_value().clone('false')).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
hpnicfFlhOperEndNotification.setStatus('current')
hpnicf_flh_oper_progress = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 2, 1, 1, 11), time_ticks()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpnicfFlhOperProgress.setStatus('current')
hpnicf_flh_oper_row_status = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 2, 1, 1, 12), row_status()).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
hpnicfFlhOperRowStatus.setStatus('current')
hpnicf_flh_oper_server_port = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 2, 1, 1, 13), integer32().subtype(subtypeSpec=value_range_constraint(0, 65535))).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
hpnicfFlhOperServerPort.setStatus('current')
hpnicf_flh_oper_fail_reason = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 2, 1, 1, 14), display_string()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpnicfFlhOperFailReason.setStatus('current')
hpnicf_flh_oper_srv_addr_type = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 2, 1, 1, 15), inet_address_type()).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
hpnicfFlhOperSrvAddrType.setStatus('current')
hpnicf_flh_oper_srv_addr_rev = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 2, 1, 1, 16), inet_address()).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
hpnicfFlhOperSrvAddrRev.setStatus('current')
hpnicf_flh_oper_srv_vpn_name = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 2, 1, 1, 17), display_string()).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
hpnicfFlhOperSrvVPNName.setStatus('current')
hpnicf_flash_notification = mib_identifier((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 3))
hpnicf_flh_oper_notification = notification_type((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 3, 1)).setObjects(('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhOperStatus'))
if mibBuilder.loadTexts:
hpnicfFlhOperNotification.setStatus('current')
hpnicf_flash_mib_conformance = mib_identifier((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 2))
hpnicf_flh_mib_compliances = mib_identifier((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 2, 1))
hpnicf_flh_mib_compliance = module_compliance((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 2, 1, 1)).setObjects(('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhGroup'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhPartitionGroup'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhFileGroup'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhOperationGroup'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhNotificationGroup'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhChipGroup'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
hpnicf_flh_mib_compliance = hpnicfFlhMIBCompliance.setStatus('current')
hpnicf_flash_mib_groups = mib_identifier((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 2, 2))
hpnicf_flh_group = object_group((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 2, 2, 1)).setObjects(('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhSupportNum'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhSize'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhPos'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhName'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhChipNum'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhDescr'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhInitTime'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhRemovable'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhPartitionBool'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhMinPartitionSize'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhMaxPartitions'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhPartitionNum'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhIndex'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhKbyteSize'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
hpnicf_flh_group = hpnicfFlhGroup.setStatus('current')
hpnicf_flh_chip_group = object_group((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 2, 2, 3)).setObjects(('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhChipID'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhChipDescr'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhChipWriteTimesLimit'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhChipWriteTimes'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhChipEraseTimesLimit'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhChipEraseTimes'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
hpnicf_flh_chip_group = hpnicfFlhChipGroup.setStatus('current')
hpnicf_flh_partition_group = object_group((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 2, 2, 4)).setObjects(('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhPartFirstChip'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhPartLastChip'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhPartSpace'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhPartSpaceFree'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhPartFileNum'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhPartChecksumMethod'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhPartStatus'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhPartUpgradeMode'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhPartName'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhPartRequireErase'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhPartFileNameLen'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhPartBootable'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhPartPathForGlobalOpt'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
hpnicf_flh_partition_group = hpnicfFlhPartitionGroup.setStatus('current')
hpnicf_flh_file_group = object_group((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 2, 2, 5)).setObjects(('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhFileName'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhFileSize'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhFileStatus'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhFileChecksum'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
hpnicf_flh_file_group = hpnicfFlhFileGroup.setStatus('current')
hpnicf_flh_operation_group = object_group((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 2, 2, 6)).setObjects(('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhOperType'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhOperProtocol'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhOperServerAddress'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhOperServerUser'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhOperPassword'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhOperSourceFile'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhOperDestinationFile'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhOperStatus'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhOperEndNotification'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhOperProgress'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhOperRowStatus'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhOperServerPort'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhOperFailReason'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
hpnicf_flh_operation_group = hpnicfFlhOperationGroup.setStatus('current')
hpnicf_flh_notification_group = notification_group((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 2, 2, 7)).setObjects(('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhOperNotification'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
hpnicf_flh_notification_group = hpnicfFlhNotificationGroup.setStatus('current')
mibBuilder.exportSymbols('HPN-ICF-FLASH-MAN-MIB', HpnicfFlashPartitionUpgradeMode=HpnicfFlashPartitionUpgradeMode, hpnicfFlhChipTable=hpnicfFlhChipTable, hpnicfFlhFileHCSize=hpnicfFlhFileHCSize, hpnicfFlhChipDescr=hpnicfFlhChipDescr, hpnicfFlhOperSrvAddrType=hpnicfFlhOperSrvAddrType, hpnicfFlashOperate=hpnicfFlashOperate, hpnicfFlhPartStatus=hpnicfFlhPartStatus, hpnicfFlhPartitionBool=hpnicfFlhPartitionBool, hpnicfFlhOperSrvAddrRev=hpnicfFlhOperSrvAddrRev, hpnicfFlashMIBConformance=hpnicfFlashMIBConformance, hpnicfFlhDescr=hpnicfFlhDescr, hpnicfFlhFileName=hpnicfFlhFileName, hpnicfFlhHCSize=hpnicfFlhHCSize, hpnicfFlhOperSrvVPNName=hpnicfFlhOperSrvVPNName, hpnicfFlhPartFileNum=hpnicfFlhPartFileNum, hpnicfFlhMIBCompliances=hpnicfFlhMIBCompliances, hpnicfFlhSize=hpnicfFlhSize, hpnicfFlhPartHCSpace=hpnicfFlhPartHCSpace, hpnicfFlhOperType=hpnicfFlhOperType, hpnicfFlhPartitionEntry=hpnicfFlhPartitionEntry, hpnicfFlhOperProtocol=hpnicfFlhOperProtocol, hpnicfFlhFileStatus=hpnicfFlhFileStatus, hpnicfFlhPartRequireErase=hpnicfFlhPartRequireErase, hpnicfFlashDevice=hpnicfFlashDevice, hpnicfFlhOperRowStatus=hpnicfFlhOperRowStatus, hpnicfFlhOperationGroup=hpnicfFlhOperationGroup, hpnicfFlhPartitionNum=hpnicfFlhPartitionNum, hpnicfFlhFileIndex=hpnicfFlhFileIndex, hpnicfFlhChipID=hpnicfFlhChipID, hpnicfFlhOperServerUser=hpnicfFlhOperServerUser, hpnicfFlhOperDestinationFile=hpnicfFlhOperDestinationFile, hpnicfFlhOperIndex=hpnicfFlhOperIndex, hpnicfFlhChipWriteTimesLimit=hpnicfFlhChipWriteTimesLimit, hpnicfFlhNotificationGroup=hpnicfFlhNotificationGroup, hpnicfFlhOperEndNotification=hpnicfFlhOperEndNotification, hpnicfFlhSupportNum=hpnicfFlhSupportNum, hpnicfFlhPartChecksumMethod=hpnicfFlhPartChecksumMethod, hpnicfFlhPos=hpnicfFlhPos, hpnicfFlhOperSourceFile=hpnicfFlhOperSourceFile, hpnicfFlhPartFirstChip=hpnicfFlhPartFirstChip, hpnicfFlhFileGroup=hpnicfFlhFileGroup, hpnicfFlhOperFailReason=hpnicfFlhOperFailReason, hpnicfFlhFileEntry=hpnicfFlhFileEntry, hpnicfFlhChipNum=hpnicfFlhChipNum, hpnicfFlhPartSpace=hpnicfFlhPartSpace, hpnicfFlashTable=hpnicfFlashTable, hpnicfFlhMinPartitionSize=hpnicfFlhMinPartitionSize, hpnicfFlhFiles=hpnicfFlhFiles, HpnicfFlashPartitionStatus=HpnicfFlashPartitionStatus, hpnicfFlhPartIndex=hpnicfFlhPartIndex, hpnicfFlhInitTime=hpnicfFlhInitTime, hpnicfFlhPartitionTable=hpnicfFlhPartitionTable, hpnicfFlhOpTable=hpnicfFlhOpTable, hpnicfFlhOperNotification=hpnicfFlhOperNotification, hpnicfFlhChipWriteTimes=hpnicfFlhChipWriteTimes, hpnicfFlhFileTable=hpnicfFlhFileTable, hpnicfFlash=hpnicfFlash, PYSNMP_MODULE_ID=hpnicfFlash, hpnicfFlhChipEraseTimes=hpnicfFlhChipEraseTimes, hpnicfFlashMIBGroups=hpnicfFlashMIBGroups, hpnicfFlhMaxPartitions=hpnicfFlhMaxPartitions, hpnicfFlhChipSerialNo=hpnicfFlhChipSerialNo, hpnicfFlashChips=hpnicfFlashChips, hpnicfFlhPartName=hpnicfFlhPartName, hpnicfFlhOperServerAddress=hpnicfFlhOperServerAddress, hpnicfFlhChipEntry=hpnicfFlhChipEntry, hpnicfFlhName=hpnicfFlhName, hpnicfFlhPartSpaceFree=hpnicfFlhPartSpaceFree, hpnicfFlhOperProgress=hpnicfFlhOperProgress, hpnicfFlashEntry=hpnicfFlashEntry, hpnicfFlhPartPathForGlobalOpt=hpnicfFlhPartPathForGlobalOpt, hpnicfFlhOperPassword=hpnicfFlhOperPassword, hpnicfFlashManMIBObjects=hpnicfFlashManMIBObjects, hpnicfFlhPartUpgradeMode=hpnicfFlhPartUpgradeMode, hpnicfFlashPartitions=hpnicfFlashPartitions, hpnicfFlhIndex=hpnicfFlhIndex, hpnicfFlashNotification=hpnicfFlashNotification, hpnicfFlhOperServerPort=hpnicfFlhOperServerPort, hpnicfFlhChipEraseTimesLimit=hpnicfFlhChipEraseTimesLimit, hpnicfFlhOperStatus=hpnicfFlhOperStatus, hpnicfFlhOpEntry=hpnicfFlhOpEntry, hpnicfFlhGroup=hpnicfFlhGroup, hpnicfFlhPartHCSpaceFree=hpnicfFlhPartHCSpaceFree, hpnicfFlhRemovable=hpnicfFlhRemovable, hpnicfFlhPartLastChip=hpnicfFlhPartLastChip, hpnicfFlhChipGroup=hpnicfFlhChipGroup, hpnicfFlhKbyteSize=hpnicfFlhKbyteSize, hpnicfFlhFileSize=hpnicfFlhFileSize, hpnicfFlhPartitionGroup=hpnicfFlhPartitionGroup, hpnicfFlhPartBootable=hpnicfFlhPartBootable, HpnicfFlashOperationStatus=HpnicfFlashOperationStatus, hpnicfFlhMIBCompliance=hpnicfFlhMIBCompliance, hpnicfFlhFileChecksum=hpnicfFlhFileChecksum, hpnicfFlhPartFileNameLen=hpnicfFlhPartFileNameLen) |
#
# PySNMP MIB module BENU-IP-MIB (http://snmplabs.com/pysmi)
# ASN.1 source file:///Users/davwang4/Dev/mibs.snmplabs.com/asn1/BENU-IP-MIB
# Produced by pysmi-0.3.4 at Wed May 1 11:37:23 2019
# On host DAVWANG4-M-1475 platform Darwin version 18.5.0 by user davwang4
# Using Python version 3.7.3 (default, Mar 27 2019, 09:23:15)
#
Integer, ObjectIdentifier, OctetString = mibBuilder.importSymbols("ASN1", "Integer", "ObjectIdentifier", "OctetString")
NamedValues, = mibBuilder.importSymbols("ASN1-ENUMERATION", "NamedValues")
ConstraintsUnion, ValueSizeConstraint, ValueRangeConstraint, ConstraintsIntersection, SingleValueConstraint = mibBuilder.importSymbols("ASN1-REFINEMENT", "ConstraintsUnion", "ValueSizeConstraint", "ValueRangeConstraint", "ConstraintsIntersection", "SingleValueConstraint")
benuPlatform, = mibBuilder.importSymbols("BENU-PLATFORM-MIB", "benuPlatform")
ModuleCompliance, NotificationGroup = mibBuilder.importSymbols("SNMPv2-CONF", "ModuleCompliance", "NotificationGroup")
ModuleIdentity, Counter32, Unsigned32, ObjectIdentity, Integer32, NotificationType, IpAddress, MibIdentifier, TimeTicks, MibScalar, MibTable, MibTableRow, MibTableColumn, iso, Counter64, Gauge32, Bits = mibBuilder.importSymbols("SNMPv2-SMI", "ModuleIdentity", "Counter32", "Unsigned32", "ObjectIdentity", "Integer32", "NotificationType", "IpAddress", "MibIdentifier", "TimeTicks", "MibScalar", "MibTable", "MibTableRow", "MibTableColumn", "iso", "Counter64", "Gauge32", "Bits")
TextualConvention, DisplayString = mibBuilder.importSymbols("SNMPv2-TC", "TextualConvention", "DisplayString")
bIPMIB = ModuleIdentity((1, 3, 6, 1, 4, 1, 39406, 1, 6))
bIPMIB.setRevisions(('2014-12-17 00:00', '2013-11-28 00:00', '2013-05-31 00:00',))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
if mibBuilder.loadTexts: bIPMIB.setRevisionsDescriptions(('updated MIB file with change in bIPNotifObjects', 'Marked bIPPortTxFramesWoErrExclPausFrame as deprecated as it is not supported. Removed unnecessary IMPORTS and added missing. Also, Changed SYNTAX of bIPPortIndex from Integer32 to Unsigned32.', 'Initial Version',))
if mibBuilder.loadTexts: bIPMIB.setLastUpdated('201412170000Z')
if mibBuilder.loadTexts: bIPMIB.setOrganization('Benu Networks')
if mibBuilder.loadTexts: bIPMIB.setContactInfo('Benu Networks Inc, 300 Concord Road, Billerca MA 01821 Email: support@benunets.com')
if mibBuilder.loadTexts: bIPMIB.setDescription('This MIB module defines IP utilization statistics. Copyright (C) 2001, 2008 by Benu Networks, Inc. All rights reserved.')
bIPMIBObjects = ObjectIdentity((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1))
if mibBuilder.loadTexts: bIPMIBObjects.setStatus('current')
if mibBuilder.loadTexts: bIPMIBObjects.setDescription('MIB objects for IP utilization statistics are defined in this branch.')
bIPNotifObjects = ObjectIdentity((1, 3, 6, 1, 4, 1, 39406, 1, 6, 0))
if mibBuilder.loadTexts: bIPNotifObjects.setStatus('current')
if mibBuilder.loadTexts: bIPNotifObjects.setDescription('Notifications of IP utilization statistics are defined in this branch.')
bIPPortTable = MibTable((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1), )
if mibBuilder.loadTexts: bIPPortTable.setStatus('current')
if mibBuilder.loadTexts: bIPPortTable.setDescription('The table of IP utilization performance metrics of each interface.')
bIPPortEntry = MibTableRow((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1), ).setIndexNames((0, "BENU-IP-MIB", "bIPPortIndex"))
if mibBuilder.loadTexts: bIPPortEntry.setStatus('current')
if mibBuilder.loadTexts: bIPPortEntry.setDescription('An entry containing IP utilization performance metrics for each interface.')
bIPPortIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 1), Unsigned32())
if mibBuilder.loadTexts: bIPPortIndex.setStatus('current')
if mibBuilder.loadTexts: bIPPortIndex.setDescription('Interface index of the port This will be similar to ifIndex of IF-MIB.')
bIPPortInterfaceName = MibTableColumn((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 2), DisplayString()).setMaxAccess("readonly")
if mibBuilder.loadTexts: bIPPortInterfaceName.setStatus('current')
if mibBuilder.loadTexts: bIPPortInterfaceName.setDescription('Name of the interface associated with this port.')
bIPPortTxBytesInFrameWoErr = MibTableColumn((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 3), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: bIPPortTxBytesInFrameWoErr.setStatus('current')
if mibBuilder.loadTexts: bIPPortTxBytesInFrameWoErr.setDescription('Total bytes transmitted without errors.')
bIPPortTxFramesWoErrExclPausFrame = MibTableColumn((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 4), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: bIPPortTxFramesWoErrExclPausFrame.setStatus('deprecated')
if mibBuilder.loadTexts: bIPPortTxFramesWoErrExclPausFrame.setDescription('Total frames transmitted without errors excluding pause frames.')
bIPPortTxBcastFrames = MibTableColumn((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 5), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: bIPPortTxBcastFrames.setStatus('current')
if mibBuilder.loadTexts: bIPPortTxBcastFrames.setDescription('Total broadcast frames transmitted.')
bIPPortTxL2McastFrames = MibTableColumn((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 6), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: bIPPortTxL2McastFrames.setStatus('current')
if mibBuilder.loadTexts: bIPPortTxL2McastFrames.setDescription('Total Layer 2 multicast frames transmitted.')
bIPPortTxPausFrame = MibTableColumn((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 7), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: bIPPortTxPausFrame.setStatus('current')
if mibBuilder.loadTexts: bIPPortTxPausFrame.setDescription('Total broadcast frames transmitted.')
bIPPortTx64byteFrames = MibTableColumn((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 8), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: bIPPortTx64byteFrames.setStatus('current')
if mibBuilder.loadTexts: bIPPortTx64byteFrames.setDescription('Total 64-byte frames transmitted.')
bIPPortTx65to127byteFrames = MibTableColumn((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 9), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: bIPPortTx65to127byteFrames.setStatus('current')
if mibBuilder.loadTexts: bIPPortTx65to127byteFrames.setDescription('Total 65 to 127-byte frames transmitted.')
bIPPortTx128to255byteFrames = MibTableColumn((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 10), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: bIPPortTx128to255byteFrames.setStatus('current')
if mibBuilder.loadTexts: bIPPortTx128to255byteFrames.setDescription('Total 128 to 255-byte frames transmitted.')
bIPPortTx256to511byteFrames = MibTableColumn((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 11), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: bIPPortTx256to511byteFrames.setStatus('current')
if mibBuilder.loadTexts: bIPPortTx256to511byteFrames.setDescription('Total 256 to 511-byte frames transmitted.')
bIPPortTx512to1023byteFrames = MibTableColumn((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 12), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: bIPPortTx512to1023byteFrames.setStatus('current')
if mibBuilder.loadTexts: bIPPortTx512to1023byteFrames.setDescription('Total 512 to 1023-byte frames transmitted.')
bIPPortTx1024to1518byteFrames = MibTableColumn((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 13), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: bIPPortTx1024to1518byteFrames.setStatus('current')
if mibBuilder.loadTexts: bIPPortTx1024to1518byteFrames.setDescription('Total 1024 to 1518-byte frames transmitted.')
bIPPortTx1519to1522byteFrames = MibTableColumn((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 14), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: bIPPortTx1519to1522byteFrames.setStatus('current')
if mibBuilder.loadTexts: bIPPortTx1519to1522byteFrames.setDescription('Total 1519 to 1522-byte frames transmitted.')
bIPPortTx1523toMaxByteFrames = MibTableColumn((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 15), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: bIPPortTx1523toMaxByteFrames.setStatus('current')
if mibBuilder.loadTexts: bIPPortTx1523toMaxByteFrames.setDescription('Total 1523 to Max-byte frames transmitted.')
bIPPortTx17to63byteFrames = MibTableColumn((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 16), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: bIPPortTx17to63byteFrames.setStatus('current')
if mibBuilder.loadTexts: bIPPortTx17to63byteFrames.setDescription('Total 17 to 63-byte frames transmitted.')
bIPPortTxBadFcsFrames = MibTableColumn((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 17), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: bIPPortTxBadFcsFrames.setStatus('current')
if mibBuilder.loadTexts: bIPPortTxBadFcsFrames.setDescription('Total bad FCS frames transmitted.')
bIPPortRxBytesInFrameWoErr = MibTableColumn((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 18), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: bIPPortRxBytesInFrameWoErr.setStatus('current')
if mibBuilder.loadTexts: bIPPortRxBytesInFrameWoErr.setDescription('Total bytes received without errors.')
bIPPortRxBcastFrames = MibTableColumn((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 19), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: bIPPortRxBcastFrames.setStatus('current')
if mibBuilder.loadTexts: bIPPortRxBcastFrames.setDescription('Total broadcast frames received.')
bIPPortRxL2McastFrames = MibTableColumn((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 20), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: bIPPortRxL2McastFrames.setStatus('current')
if mibBuilder.loadTexts: bIPPortRxL2McastFrames.setDescription('Total multicase frames received.')
bIPPortRxPausFrames = MibTableColumn((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 21), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: bIPPortRxPausFrames.setStatus('current')
if mibBuilder.loadTexts: bIPPortRxPausFrames.setDescription('Total pause frames received.')
bIPPortRx64byteFrames = MibTableColumn((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 22), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: bIPPortRx64byteFrames.setStatus('current')
if mibBuilder.loadTexts: bIPPortRx64byteFrames.setDescription('Total 64-byte frames received.')
bIPPortRx65to127byteFrames = MibTableColumn((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 23), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: bIPPortRx65to127byteFrames.setStatus('current')
if mibBuilder.loadTexts: bIPPortRx65to127byteFrames.setDescription('Total 65 to 127-byte frames received.')
bIPPortRx128to255byteFrames = MibTableColumn((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 24), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: bIPPortRx128to255byteFrames.setStatus('current')
if mibBuilder.loadTexts: bIPPortRx128to255byteFrames.setDescription('Total 128 to 255-byte frames received.')
bIPPortRx256to511byteFrames = MibTableColumn((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 25), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: bIPPortRx256to511byteFrames.setStatus('current')
if mibBuilder.loadTexts: bIPPortRx256to511byteFrames.setDescription('Total 256 to 511-byte frames received.')
bIPPortRx512to1023byteFrames = MibTableColumn((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 26), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: bIPPortRx512to1023byteFrames.setStatus('current')
if mibBuilder.loadTexts: bIPPortRx512to1023byteFrames.setDescription('Total 512 to 1023-byte frames received.')
bIPPortRx1024to1518byteFrames = MibTableColumn((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 27), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: bIPPortRx1024to1518byteFrames.setStatus('current')
if mibBuilder.loadTexts: bIPPortRx1024to1518byteFrames.setDescription('Total 1024 to 1518-byte frames received.')
bIPPortRx1519to1522byteFrames = MibTableColumn((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 28), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: bIPPortRx1519to1522byteFrames.setStatus('current')
if mibBuilder.loadTexts: bIPPortRx1519to1522byteFrames.setDescription('Total 1519 to 1522-byte frames received.')
bIPPortRx1523to10368byteFrames = MibTableColumn((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 29), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: bIPPortRx1523to10368byteFrames.setStatus('current')
if mibBuilder.loadTexts: bIPPortRx1523to10368byteFrames.setDescription('Total 1523 to 10368-byte frames received.')
bIPPortRxShortFrames = MibTableColumn((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 30), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: bIPPortRxShortFrames.setStatus('current')
if mibBuilder.loadTexts: bIPPortRxShortFrames.setDescription('Total short frames received.')
bIPPortRxJabberFrames = MibTableColumn((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 31), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: bIPPortRxJabberFrames.setStatus('current')
if mibBuilder.loadTexts: bIPPortRxJabberFrames.setDescription('Total jabber frames received.')
bIPPortRxOvrSzFrames = MibTableColumn((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 32), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: bIPPortRxOvrSzFrames.setStatus('current')
if mibBuilder.loadTexts: bIPPortRxOvrSzFrames.setDescription('Total oversize frames received.')
bIPPortRxLenFldErrFrames = MibTableColumn((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 33), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: bIPPortRxLenFldErrFrames.setStatus('current')
if mibBuilder.loadTexts: bIPPortRxLenFldErrFrames.setDescription('Total length field error frames received.')
bIPPortRxSymbErrs = MibTableColumn((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 34), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: bIPPortRxSymbErrs.setStatus('current')
if mibBuilder.loadTexts: bIPPortRxSymbErrs.setDescription('Total symbol error frames received.')
bIPPortRxIntrPktJunk = MibTableColumn((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 35), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: bIPPortRxIntrPktJunk.setStatus('current')
if mibBuilder.loadTexts: bIPPortRxIntrPktJunk.setDescription('Total inter packet junk error frames received.')
mibBuilder.exportSymbols("BENU-IP-MIB", bIPPortTx64byteFrames=bIPPortTx64byteFrames, bIPPortRxJabberFrames=bIPPortRxJabberFrames, bIPPortIndex=bIPPortIndex, bIPPortTx65to127byteFrames=bIPPortTx65to127byteFrames, bIPPortTx1523toMaxByteFrames=bIPPortTx1523toMaxByteFrames, bIPPortTxFramesWoErrExclPausFrame=bIPPortTxFramesWoErrExclPausFrame, bIPPortTxL2McastFrames=bIPPortTxL2McastFrames, PYSNMP_MODULE_ID=bIPMIB, bIPPortRxSymbErrs=bIPPortRxSymbErrs, bIPPortRx512to1023byteFrames=bIPPortRx512to1023byteFrames, bIPPortRx256to511byteFrames=bIPPortRx256to511byteFrames, bIPPortRx65to127byteFrames=bIPPortRx65to127byteFrames, bIPPortRxLenFldErrFrames=bIPPortRxLenFldErrFrames, bIPNotifObjects=bIPNotifObjects, bIPPortTxBadFcsFrames=bIPPortTxBadFcsFrames, bIPPortRx1024to1518byteFrames=bIPPortRx1024to1518byteFrames, bIPPortRx128to255byteFrames=bIPPortRx128to255byteFrames, bIPPortRxOvrSzFrames=bIPPortRxOvrSzFrames, bIPPortRxPausFrames=bIPPortRxPausFrames, bIPPortTx1024to1518byteFrames=bIPPortTx1024to1518byteFrames, bIPPortRxBytesInFrameWoErr=bIPPortRxBytesInFrameWoErr, bIPPortTx17to63byteFrames=bIPPortTx17to63byteFrames, bIPPortRx1519to1522byteFrames=bIPPortRx1519to1522byteFrames, bIPPortRxBcastFrames=bIPPortRxBcastFrames, bIPPortTable=bIPPortTable, bIPPortTx1519to1522byteFrames=bIPPortTx1519to1522byteFrames, bIPPortTxBcastFrames=bIPPortTxBcastFrames, bIPPortRxShortFrames=bIPPortRxShortFrames, bIPPortTx128to255byteFrames=bIPPortTx128to255byteFrames, bIPMIBObjects=bIPMIBObjects, bIPPortTx512to1023byteFrames=bIPPortTx512to1023byteFrames, bIPPortEntry=bIPPortEntry, bIPPortTx256to511byteFrames=bIPPortTx256to511byteFrames, bIPPortRx64byteFrames=bIPPortRx64byteFrames, bIPPortRx1523to10368byteFrames=bIPPortRx1523to10368byteFrames, bIPPortInterfaceName=bIPPortInterfaceName, bIPMIB=bIPMIB, bIPPortRxIntrPktJunk=bIPPortRxIntrPktJunk, bIPPortRxL2McastFrames=bIPPortRxL2McastFrames, bIPPortTxBytesInFrameWoErr=bIPPortTxBytesInFrameWoErr, bIPPortTxPausFrame=bIPPortTxPausFrame)
| (integer, object_identifier, octet_string) = mibBuilder.importSymbols('ASN1', 'Integer', 'ObjectIdentifier', 'OctetString')
(named_values,) = mibBuilder.importSymbols('ASN1-ENUMERATION', 'NamedValues')
(constraints_union, value_size_constraint, value_range_constraint, constraints_intersection, single_value_constraint) = mibBuilder.importSymbols('ASN1-REFINEMENT', 'ConstraintsUnion', 'ValueSizeConstraint', 'ValueRangeConstraint', 'ConstraintsIntersection', 'SingleValueConstraint')
(benu_platform,) = mibBuilder.importSymbols('BENU-PLATFORM-MIB', 'benuPlatform')
(module_compliance, notification_group) = mibBuilder.importSymbols('SNMPv2-CONF', 'ModuleCompliance', 'NotificationGroup')
(module_identity, counter32, unsigned32, object_identity, integer32, notification_type, ip_address, mib_identifier, time_ticks, mib_scalar, mib_table, mib_table_row, mib_table_column, iso, counter64, gauge32, bits) = mibBuilder.importSymbols('SNMPv2-SMI', 'ModuleIdentity', 'Counter32', 'Unsigned32', 'ObjectIdentity', 'Integer32', 'NotificationType', 'IpAddress', 'MibIdentifier', 'TimeTicks', 'MibScalar', 'MibTable', 'MibTableRow', 'MibTableColumn', 'iso', 'Counter64', 'Gauge32', 'Bits')
(textual_convention, display_string) = mibBuilder.importSymbols('SNMPv2-TC', 'TextualConvention', 'DisplayString')
b_ipmib = module_identity((1, 3, 6, 1, 4, 1, 39406, 1, 6))
bIPMIB.setRevisions(('2014-12-17 00:00', '2013-11-28 00:00', '2013-05-31 00:00'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
if mibBuilder.loadTexts:
bIPMIB.setRevisionsDescriptions(('updated MIB file with change in bIPNotifObjects', 'Marked bIPPortTxFramesWoErrExclPausFrame as deprecated as it is not supported. Removed unnecessary IMPORTS and added missing. Also, Changed SYNTAX of bIPPortIndex from Integer32 to Unsigned32.', 'Initial Version'))
if mibBuilder.loadTexts:
bIPMIB.setLastUpdated('201412170000Z')
if mibBuilder.loadTexts:
bIPMIB.setOrganization('Benu Networks')
if mibBuilder.loadTexts:
bIPMIB.setContactInfo('Benu Networks Inc, 300 Concord Road, Billerca MA 01821 Email: support@benunets.com')
if mibBuilder.loadTexts:
bIPMIB.setDescription('This MIB module defines IP utilization statistics. Copyright (C) 2001, 2008 by Benu Networks, Inc. All rights reserved.')
b_ipmib_objects = object_identity((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1))
if mibBuilder.loadTexts:
bIPMIBObjects.setStatus('current')
if mibBuilder.loadTexts:
bIPMIBObjects.setDescription('MIB objects for IP utilization statistics are defined in this branch.')
b_ip_notif_objects = object_identity((1, 3, 6, 1, 4, 1, 39406, 1, 6, 0))
if mibBuilder.loadTexts:
bIPNotifObjects.setStatus('current')
if mibBuilder.loadTexts:
bIPNotifObjects.setDescription('Notifications of IP utilization statistics are defined in this branch.')
b_ip_port_table = mib_table((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1))
if mibBuilder.loadTexts:
bIPPortTable.setStatus('current')
if mibBuilder.loadTexts:
bIPPortTable.setDescription('The table of IP utilization performance metrics of each interface.')
b_ip_port_entry = mib_table_row((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1)).setIndexNames((0, 'BENU-IP-MIB', 'bIPPortIndex'))
if mibBuilder.loadTexts:
bIPPortEntry.setStatus('current')
if mibBuilder.loadTexts:
bIPPortEntry.setDescription('An entry containing IP utilization performance metrics for each interface.')
b_ip_port_index = mib_table_column((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 1), unsigned32())
if mibBuilder.loadTexts:
bIPPortIndex.setStatus('current')
if mibBuilder.loadTexts:
bIPPortIndex.setDescription('Interface index of the port This will be similar to ifIndex of IF-MIB.')
b_ip_port_interface_name = mib_table_column((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 2), display_string()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
bIPPortInterfaceName.setStatus('current')
if mibBuilder.loadTexts:
bIPPortInterfaceName.setDescription('Name of the interface associated with this port.')
b_ip_port_tx_bytes_in_frame_wo_err = mib_table_column((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 3), counter64()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
bIPPortTxBytesInFrameWoErr.setStatus('current')
if mibBuilder.loadTexts:
bIPPortTxBytesInFrameWoErr.setDescription('Total bytes transmitted without errors.')
b_ip_port_tx_frames_wo_err_excl_paus_frame = mib_table_column((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 4), counter64()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
bIPPortTxFramesWoErrExclPausFrame.setStatus('deprecated')
if mibBuilder.loadTexts:
bIPPortTxFramesWoErrExclPausFrame.setDescription('Total frames transmitted without errors excluding pause frames.')
b_ip_port_tx_bcast_frames = mib_table_column((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 5), counter64()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
bIPPortTxBcastFrames.setStatus('current')
if mibBuilder.loadTexts:
bIPPortTxBcastFrames.setDescription('Total broadcast frames transmitted.')
b_ip_port_tx_l2_mcast_frames = mib_table_column((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 6), counter64()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
bIPPortTxL2McastFrames.setStatus('current')
if mibBuilder.loadTexts:
bIPPortTxL2McastFrames.setDescription('Total Layer 2 multicast frames transmitted.')
b_ip_port_tx_paus_frame = mib_table_column((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 7), counter64()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
bIPPortTxPausFrame.setStatus('current')
if mibBuilder.loadTexts:
bIPPortTxPausFrame.setDescription('Total broadcast frames transmitted.')
b_ip_port_tx64byte_frames = mib_table_column((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 8), counter64()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
bIPPortTx64byteFrames.setStatus('current')
if mibBuilder.loadTexts:
bIPPortTx64byteFrames.setDescription('Total 64-byte frames transmitted.')
b_ip_port_tx65to127byte_frames = mib_table_column((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 9), counter64()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
bIPPortTx65to127byteFrames.setStatus('current')
if mibBuilder.loadTexts:
bIPPortTx65to127byteFrames.setDescription('Total 65 to 127-byte frames transmitted.')
b_ip_port_tx128to255byte_frames = mib_table_column((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 10), counter64()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
bIPPortTx128to255byteFrames.setStatus('current')
if mibBuilder.loadTexts:
bIPPortTx128to255byteFrames.setDescription('Total 128 to 255-byte frames transmitted.')
b_ip_port_tx256to511byte_frames = mib_table_column((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 11), counter64()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
bIPPortTx256to511byteFrames.setStatus('current')
if mibBuilder.loadTexts:
bIPPortTx256to511byteFrames.setDescription('Total 256 to 511-byte frames transmitted.')
b_ip_port_tx512to1023byte_frames = mib_table_column((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 12), counter64()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
bIPPortTx512to1023byteFrames.setStatus('current')
if mibBuilder.loadTexts:
bIPPortTx512to1023byteFrames.setDescription('Total 512 to 1023-byte frames transmitted.')
b_ip_port_tx1024to1518byte_frames = mib_table_column((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 13), counter64()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
bIPPortTx1024to1518byteFrames.setStatus('current')
if mibBuilder.loadTexts:
bIPPortTx1024to1518byteFrames.setDescription('Total 1024 to 1518-byte frames transmitted.')
b_ip_port_tx1519to1522byte_frames = mib_table_column((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 14), counter64()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
bIPPortTx1519to1522byteFrames.setStatus('current')
if mibBuilder.loadTexts:
bIPPortTx1519to1522byteFrames.setDescription('Total 1519 to 1522-byte frames transmitted.')
b_ip_port_tx1523to_max_byte_frames = mib_table_column((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 15), counter64()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
bIPPortTx1523toMaxByteFrames.setStatus('current')
if mibBuilder.loadTexts:
bIPPortTx1523toMaxByteFrames.setDescription('Total 1523 to Max-byte frames transmitted.')
b_ip_port_tx17to63byte_frames = mib_table_column((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 16), counter64()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
bIPPortTx17to63byteFrames.setStatus('current')
if mibBuilder.loadTexts:
bIPPortTx17to63byteFrames.setDescription('Total 17 to 63-byte frames transmitted.')
b_ip_port_tx_bad_fcs_frames = mib_table_column((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 17), counter64()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
bIPPortTxBadFcsFrames.setStatus('current')
if mibBuilder.loadTexts:
bIPPortTxBadFcsFrames.setDescription('Total bad FCS frames transmitted.')
b_ip_port_rx_bytes_in_frame_wo_err = mib_table_column((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 18), counter64()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
bIPPortRxBytesInFrameWoErr.setStatus('current')
if mibBuilder.loadTexts:
bIPPortRxBytesInFrameWoErr.setDescription('Total bytes received without errors.')
b_ip_port_rx_bcast_frames = mib_table_column((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 19), counter64()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
bIPPortRxBcastFrames.setStatus('current')
if mibBuilder.loadTexts:
bIPPortRxBcastFrames.setDescription('Total broadcast frames received.')
b_ip_port_rx_l2_mcast_frames = mib_table_column((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 20), counter64()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
bIPPortRxL2McastFrames.setStatus('current')
if mibBuilder.loadTexts:
bIPPortRxL2McastFrames.setDescription('Total multicase frames received.')
b_ip_port_rx_paus_frames = mib_table_column((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 21), counter64()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
bIPPortRxPausFrames.setStatus('current')
if mibBuilder.loadTexts:
bIPPortRxPausFrames.setDescription('Total pause frames received.')
b_ip_port_rx64byte_frames = mib_table_column((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 22), counter64()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
bIPPortRx64byteFrames.setStatus('current')
if mibBuilder.loadTexts:
bIPPortRx64byteFrames.setDescription('Total 64-byte frames received.')
b_ip_port_rx65to127byte_frames = mib_table_column((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 23), counter64()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
bIPPortRx65to127byteFrames.setStatus('current')
if mibBuilder.loadTexts:
bIPPortRx65to127byteFrames.setDescription('Total 65 to 127-byte frames received.')
b_ip_port_rx128to255byte_frames = mib_table_column((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 24), counter64()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
bIPPortRx128to255byteFrames.setStatus('current')
if mibBuilder.loadTexts:
bIPPortRx128to255byteFrames.setDescription('Total 128 to 255-byte frames received.')
b_ip_port_rx256to511byte_frames = mib_table_column((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 25), counter64()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
bIPPortRx256to511byteFrames.setStatus('current')
if mibBuilder.loadTexts:
bIPPortRx256to511byteFrames.setDescription('Total 256 to 511-byte frames received.')
b_ip_port_rx512to1023byte_frames = mib_table_column((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 26), counter64()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
bIPPortRx512to1023byteFrames.setStatus('current')
if mibBuilder.loadTexts:
bIPPortRx512to1023byteFrames.setDescription('Total 512 to 1023-byte frames received.')
b_ip_port_rx1024to1518byte_frames = mib_table_column((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 27), counter64()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
bIPPortRx1024to1518byteFrames.setStatus('current')
if mibBuilder.loadTexts:
bIPPortRx1024to1518byteFrames.setDescription('Total 1024 to 1518-byte frames received.')
b_ip_port_rx1519to1522byte_frames = mib_table_column((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 28), counter64()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
bIPPortRx1519to1522byteFrames.setStatus('current')
if mibBuilder.loadTexts:
bIPPortRx1519to1522byteFrames.setDescription('Total 1519 to 1522-byte frames received.')
b_ip_port_rx1523to10368byte_frames = mib_table_column((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 29), counter64()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
bIPPortRx1523to10368byteFrames.setStatus('current')
if mibBuilder.loadTexts:
bIPPortRx1523to10368byteFrames.setDescription('Total 1523 to 10368-byte frames received.')
b_ip_port_rx_short_frames = mib_table_column((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 30), counter64()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
bIPPortRxShortFrames.setStatus('current')
if mibBuilder.loadTexts:
bIPPortRxShortFrames.setDescription('Total short frames received.')
b_ip_port_rx_jabber_frames = mib_table_column((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 31), counter64()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
bIPPortRxJabberFrames.setStatus('current')
if mibBuilder.loadTexts:
bIPPortRxJabberFrames.setDescription('Total jabber frames received.')
b_ip_port_rx_ovr_sz_frames = mib_table_column((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 32), counter64()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
bIPPortRxOvrSzFrames.setStatus('current')
if mibBuilder.loadTexts:
bIPPortRxOvrSzFrames.setDescription('Total oversize frames received.')
b_ip_port_rx_len_fld_err_frames = mib_table_column((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 33), counter64()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
bIPPortRxLenFldErrFrames.setStatus('current')
if mibBuilder.loadTexts:
bIPPortRxLenFldErrFrames.setDescription('Total length field error frames received.')
b_ip_port_rx_symb_errs = mib_table_column((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 34), counter64()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
bIPPortRxSymbErrs.setStatus('current')
if mibBuilder.loadTexts:
bIPPortRxSymbErrs.setDescription('Total symbol error frames received.')
b_ip_port_rx_intr_pkt_junk = mib_table_column((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 35), counter64()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
bIPPortRxIntrPktJunk.setStatus('current')
if mibBuilder.loadTexts:
bIPPortRxIntrPktJunk.setDescription('Total inter packet junk error frames received.')
mibBuilder.exportSymbols('BENU-IP-MIB', bIPPortTx64byteFrames=bIPPortTx64byteFrames, bIPPortRxJabberFrames=bIPPortRxJabberFrames, bIPPortIndex=bIPPortIndex, bIPPortTx65to127byteFrames=bIPPortTx65to127byteFrames, bIPPortTx1523toMaxByteFrames=bIPPortTx1523toMaxByteFrames, bIPPortTxFramesWoErrExclPausFrame=bIPPortTxFramesWoErrExclPausFrame, bIPPortTxL2McastFrames=bIPPortTxL2McastFrames, PYSNMP_MODULE_ID=bIPMIB, bIPPortRxSymbErrs=bIPPortRxSymbErrs, bIPPortRx512to1023byteFrames=bIPPortRx512to1023byteFrames, bIPPortRx256to511byteFrames=bIPPortRx256to511byteFrames, bIPPortRx65to127byteFrames=bIPPortRx65to127byteFrames, bIPPortRxLenFldErrFrames=bIPPortRxLenFldErrFrames, bIPNotifObjects=bIPNotifObjects, bIPPortTxBadFcsFrames=bIPPortTxBadFcsFrames, bIPPortRx1024to1518byteFrames=bIPPortRx1024to1518byteFrames, bIPPortRx128to255byteFrames=bIPPortRx128to255byteFrames, bIPPortRxOvrSzFrames=bIPPortRxOvrSzFrames, bIPPortRxPausFrames=bIPPortRxPausFrames, bIPPortTx1024to1518byteFrames=bIPPortTx1024to1518byteFrames, bIPPortRxBytesInFrameWoErr=bIPPortRxBytesInFrameWoErr, bIPPortTx17to63byteFrames=bIPPortTx17to63byteFrames, bIPPortRx1519to1522byteFrames=bIPPortRx1519to1522byteFrames, bIPPortRxBcastFrames=bIPPortRxBcastFrames, bIPPortTable=bIPPortTable, bIPPortTx1519to1522byteFrames=bIPPortTx1519to1522byteFrames, bIPPortTxBcastFrames=bIPPortTxBcastFrames, bIPPortRxShortFrames=bIPPortRxShortFrames, bIPPortTx128to255byteFrames=bIPPortTx128to255byteFrames, bIPMIBObjects=bIPMIBObjects, bIPPortTx512to1023byteFrames=bIPPortTx512to1023byteFrames, bIPPortEntry=bIPPortEntry, bIPPortTx256to511byteFrames=bIPPortTx256to511byteFrames, bIPPortRx64byteFrames=bIPPortRx64byteFrames, bIPPortRx1523to10368byteFrames=bIPPortRx1523to10368byteFrames, bIPPortInterfaceName=bIPPortInterfaceName, bIPMIB=bIPMIB, bIPPortRxIntrPktJunk=bIPPortRxIntrPktJunk, bIPPortRxL2McastFrames=bIPPortRxL2McastFrames, bIPPortTxBytesInFrameWoErr=bIPPortTxBytesInFrameWoErr, bIPPortTxPausFrame=bIPPortTxPausFrame) |
class Item:
def __init__(self, name, price, rarity, typ):
self.__name = name
self.__price = price
self.__rarity = rarity
self.__typ = typ
def getName(self):
return self.__name
def setName(self, name):
self.__name = name
def getPrice(self):
return self.__price
def setPrice(self, price):
self.__price = price
def getRarity(self):
return self.__rarity
def setRarity(self, rarity):
self.__rarity = rarity
def getType(self):
return self.__typ
def setType(self, typ):
self.__typ = typ
| class Item:
def __init__(self, name, price, rarity, typ):
self.__name = name
self.__price = price
self.__rarity = rarity
self.__typ = typ
def get_name(self):
return self.__name
def set_name(self, name):
self.__name = name
def get_price(self):
return self.__price
def set_price(self, price):
self.__price = price
def get_rarity(self):
return self.__rarity
def set_rarity(self, rarity):
self.__rarity = rarity
def get_type(self):
return self.__typ
def set_type(self, typ):
self.__typ = typ |
class Quantity(object):
def __get__(self, instance, owner):
return getattr(instance, self.target_name)
def __set__(self, instance, value):
if not hasattr(self, 'target_name'):
self.set_target_names(instance)
if value > 0:
setattr(instance, self.target_name, value)
else:
raise ValueError('value must be > 0')
def set_target_names(self, instance, owner=None):
owner = owner if owner else instance.__class__
for key, attr in owner.__dict__.items():
if hasattr(attr, 'set_target_names'):
setattr(attr, 'target_name', '_%s__%s' % (owner.__name__, key))
class LineItem(object):
weight = Quantity()
price = Quantity()
def __init__(self, description, weight, price):
self.description = description
self.weight = weight
self.price = price
def subtotal(self):
return self.weight * self.price
| class Quantity(object):
def __get__(self, instance, owner):
return getattr(instance, self.target_name)
def __set__(self, instance, value):
if not hasattr(self, 'target_name'):
self.set_target_names(instance)
if value > 0:
setattr(instance, self.target_name, value)
else:
raise value_error('value must be > 0')
def set_target_names(self, instance, owner=None):
owner = owner if owner else instance.__class__
for (key, attr) in owner.__dict__.items():
if hasattr(attr, 'set_target_names'):
setattr(attr, 'target_name', '_%s__%s' % (owner.__name__, key))
class Lineitem(object):
weight = quantity()
price = quantity()
def __init__(self, description, weight, price):
self.description = description
self.weight = weight
self.price = price
def subtotal(self):
return self.weight * self.price |
def sort_012(inputList):
next0 = 0
next2 = len(inputList) - 1
frontIndex = 0
while frontIndex <= next2:
if inputList[frontIndex] is 0:
inputList[frontIndex] = inputList[next0]
inputList[next0] = 0
next0 += 1
frontIndex += 1
elif inputList[frontIndex] == 2:
inputList[frontIndex] = inputList[next2]
inputList[next2] = 2
next2 -= 1
else:
frontIndex += 1
return inputList
print(sort_012([0, 0, 2, 2, 2, 1, 1, 1, 2, 0, 2]));
# 0, 0, 0, 1, 1, 1, 2, 2, 2, 2, 2]
print(sort_012([1,0]));
# [0, 1]
print(sort_012([]));
# []
| def sort_012(inputList):
next0 = 0
next2 = len(inputList) - 1
front_index = 0
while frontIndex <= next2:
if inputList[frontIndex] is 0:
inputList[frontIndex] = inputList[next0]
inputList[next0] = 0
next0 += 1
front_index += 1
elif inputList[frontIndex] == 2:
inputList[frontIndex] = inputList[next2]
inputList[next2] = 2
next2 -= 1
else:
front_index += 1
return inputList
print(sort_012([0, 0, 2, 2, 2, 1, 1, 1, 2, 0, 2]))
print(sort_012([1, 0]))
print(sort_012([])) |
class Node:
def __init__(self, data):
self.data = data
self.left = None
self.right = None
def __repr__(self):
if type(self.data) != 'str':
return str(self.data)
return self.data
def inorder(root, is_last_node=False):
if root:
inorder(root.left)
print('{}->'.format(root), end='')
inorder(root.right)
return
def preorder(root):
if root:
print('{}->'.format(root), end='')
preorder(root.left)
preorder(root.right)
return
def postorder(root):
if root:
postorder(root.left)
postorder(root.right)
print('{}->'.format(root), end='')
return
def level_order(root):
if root is None:
return
queue = []
queue.append(root)
while(len(queue) > 0):
print(queue[0].data, end=' ')
node = queue.pop(0)
if node.left is not None:
queue.append(node.left)
if node.right is not None:
queue.append(node.right)
return
def build_tree_one():
root = Node(1)
root.left = Node(2)
root.right = Node(3)
root.left.left = Node(4)
root.left.right = Node(5)
return root
def build_tree_two():
root = Node(1)
root.left = Node(12)
root.right = Node(9)
root.left.left = Node(5)
root.left.right = Node(6)
return root
if __name__ == '__main__':
tree_one = build_tree_one()
print('*** Tree One ***')
print('Inorder Traversal')
inorder(tree_one)
print('\nPreorder Traversal')
preorder(tree_one)
print('\nPostorder Traversal')
postorder(tree_one)
print('\nLevel Order Traversal')
level_order(tree_one)
tree_two = build_tree_two()
print('\n\n*** Tree Two ***')
print('Inorder Traversal')
inorder(tree_two)
print('\nPreorder Traversal')
preorder(tree_two)
print('\nPostorder Traversal')
postorder(tree_two)
print('\nLevel Order Traversal')
level_order(tree_two)
| class Node:
def __init__(self, data):
self.data = data
self.left = None
self.right = None
def __repr__(self):
if type(self.data) != 'str':
return str(self.data)
return self.data
def inorder(root, is_last_node=False):
if root:
inorder(root.left)
print('{}->'.format(root), end='')
inorder(root.right)
return
def preorder(root):
if root:
print('{}->'.format(root), end='')
preorder(root.left)
preorder(root.right)
return
def postorder(root):
if root:
postorder(root.left)
postorder(root.right)
print('{}->'.format(root), end='')
return
def level_order(root):
if root is None:
return
queue = []
queue.append(root)
while len(queue) > 0:
print(queue[0].data, end=' ')
node = queue.pop(0)
if node.left is not None:
queue.append(node.left)
if node.right is not None:
queue.append(node.right)
return
def build_tree_one():
root = node(1)
root.left = node(2)
root.right = node(3)
root.left.left = node(4)
root.left.right = node(5)
return root
def build_tree_two():
root = node(1)
root.left = node(12)
root.right = node(9)
root.left.left = node(5)
root.left.right = node(6)
return root
if __name__ == '__main__':
tree_one = build_tree_one()
print('*** Tree One ***')
print('Inorder Traversal')
inorder(tree_one)
print('\nPreorder Traversal')
preorder(tree_one)
print('\nPostorder Traversal')
postorder(tree_one)
print('\nLevel Order Traversal')
level_order(tree_one)
tree_two = build_tree_two()
print('\n\n*** Tree Two ***')
print('Inorder Traversal')
inorder(tree_two)
print('\nPreorder Traversal')
preorder(tree_two)
print('\nPostorder Traversal')
postorder(tree_two)
print('\nLevel Order Traversal')
level_order(tree_two) |
sum=0
for i in range(5):
a=int(input())
if a<40:
a=40
sum+=a
print(sum//5) | sum = 0
for i in range(5):
a = int(input())
if a < 40:
a = 40
sum += a
print(sum // 5) |
# Some constants to work for https://github.com/Di-Ny/LoRaPacketForwarderDomoticzConfigurator
#
# Author: DiNy
###########
## Global
GW_UNIT_ID=10
###########
## LORA
DR_2_SFBW_EU868 = {
"0":["12","125.0","5"],
"1":["11","125.0","5"],
"2":["10","125.0","5"],
"3":["9","125.0","5"],
"4":["8","125.0","5"],
"5":["7","125.0","5"],
"6":["7","250.0","5"],
"7":["12","125.0","7"],
"8":["12","62.5","5"],
"9":["12","62.5","7"],
"10":["12","31.25","5"],
"11":["12","31.25","7"],
"12":["10","125.0","7"],
"13":["10","62.5","5"],
"14":["10","62.5","7"],
"15":["8","62.5","5"]
}
| gw_unit_id = 10
dr_2_sfbw_eu868 = {'0': ['12', '125.0', '5'], '1': ['11', '125.0', '5'], '2': ['10', '125.0', '5'], '3': ['9', '125.0', '5'], '4': ['8', '125.0', '5'], '5': ['7', '125.0', '5'], '6': ['7', '250.0', '5'], '7': ['12', '125.0', '7'], '8': ['12', '62.5', '5'], '9': ['12', '62.5', '7'], '10': ['12', '31.25', '5'], '11': ['12', '31.25', '7'], '12': ['10', '125.0', '7'], '13': ['10', '62.5', '5'], '14': ['10', '62.5', '7'], '15': ['8', '62.5', '5']} |
# Login information for the 6.034 Automated Tester
USERNAME="lcchiang_MIT_EDU"
PASSWORD="yu7Q4nPJNRALMY3AJ6ze"
XMLRPC_URL="https://ai6034.mit.edu/labs/xmlrpc/"
| username = 'lcchiang_MIT_EDU'
password = 'yu7Q4nPJNRALMY3AJ6ze'
xmlrpc_url = 'https://ai6034.mit.edu/labs/xmlrpc/' |
ENDPOINT = "https://en.wikipedia.org/w/api.php"
def make_url(id, is_expanded=False, is_html=False):
# TODO: isdigit is not robust enough, title could be number instead of string
return make_id_url(id, is_expanded, is_html) if str(id).isdigit() else make_title_url(id, is_expanded, is_html)
def make_title_url(id, is_expanded=False, is_html=False):
url = ENDPOINT + "?action=query&titles=" + url_safe_spaces(str(id)) + "&prop=revisions|pageprops&rvprop=content&format=json"
if is_expanded:
url += "&rvexpandtemplates"
if is_html:
url = ENDPOINT + "?format=json&rvprop=content&prop=revisions&rvparse=&titles=" + url_safe_spaces(str(id)) + "&rvlimit=1&action=query"
return url
def make_id_url(id, is_expanded=False, is_html=False):
url = ENDPOINT + "?action=query&pageids=" + url_safe_spaces(str(id)) + "&prop=revisions|pageprops&rvprop=content&format=json"
if is_expanded:
url += "&rvexpandtemplates"
if is_html:
url = ENDPOINT + "?format=json&rvprop=content&prop=revisions&rvparse=&pageids=" + url_safe_spaces(str(id)) + "&rvlimit=1&action=query"
return url
def url_safe_spaces(text):
return text.replace(" ", "%20") | endpoint = 'https://en.wikipedia.org/w/api.php'
def make_url(id, is_expanded=False, is_html=False):
return make_id_url(id, is_expanded, is_html) if str(id).isdigit() else make_title_url(id, is_expanded, is_html)
def make_title_url(id, is_expanded=False, is_html=False):
url = ENDPOINT + '?action=query&titles=' + url_safe_spaces(str(id)) + '&prop=revisions|pageprops&rvprop=content&format=json'
if is_expanded:
url += '&rvexpandtemplates'
if is_html:
url = ENDPOINT + '?format=json&rvprop=content&prop=revisions&rvparse=&titles=' + url_safe_spaces(str(id)) + '&rvlimit=1&action=query'
return url
def make_id_url(id, is_expanded=False, is_html=False):
url = ENDPOINT + '?action=query&pageids=' + url_safe_spaces(str(id)) + '&prop=revisions|pageprops&rvprop=content&format=json'
if is_expanded:
url += '&rvexpandtemplates'
if is_html:
url = ENDPOINT + '?format=json&rvprop=content&prop=revisions&rvparse=&pageids=' + url_safe_spaces(str(id)) + '&rvlimit=1&action=query'
return url
def url_safe_spaces(text):
return text.replace(' ', '%20') |
#!/usr/bin/python3
def main():
buffersize = 50000
infile = open('obama.png', 'rb')
outfile = open('obama-copy.png', 'wb')
buffer = infile.read(buffersize)
while len(buffer):
outfile.write(buffer)
print('.', end = '')
buffer = infile.read(buffersize)
print()
print('Done.')
if __name__ == "__main__": main()
| def main():
buffersize = 50000
infile = open('obama.png', 'rb')
outfile = open('obama-copy.png', 'wb')
buffer = infile.read(buffersize)
while len(buffer):
outfile.write(buffer)
print('.', end='')
buffer = infile.read(buffersize)
print()
print('Done.')
if __name__ == '__main__':
main() |
a, b, c = sorted(list(map(float, input().split())))
if(((a+b) > c)and((c-a) < b)):
print('It is a triangle.')
if(((a**2)+(b**2)) == (c**2)):
print('-> also a Right triangle.')
if(not(a-b)):
print('-> Wow it\'s a Isosceles right triangle!')
else:
print('not a triangle.') | (a, b, c) = sorted(list(map(float, input().split())))
if a + b > c and c - a < b:
print('It is a triangle.')
if a ** 2 + b ** 2 == c ** 2:
print('-> also a Right triangle.')
if not a - b:
print("-> Wow it's a Isosceles right triangle!")
else:
print('not a triangle.') |
def alternating(list_of_ints):
pass
print(alternating([1, 2, 3, 4]))
print(alternating([10, 11, 1, 12]))
print(alternating([10, 21, 22, -5, 100, 101, 2]))
| def alternating(list_of_ints):
pass
print(alternating([1, 2, 3, 4]))
print(alternating([10, 11, 1, 12]))
print(alternating([10, 21, 22, -5, 100, 101, 2])) |
DEVICE_NAME = '00002a00-0000-1000-8000-00805f9b34fb'
MODEL_NUMBER = '00002a24-0000-1000-8000-00805f9b34fb'
SERIAL_NUMBER = '00002a25-0000-1000-8000-00805f9b34fb'
FIRMWARE_VERSION = '00002a26-0000-1000-8000-00805f9b34fb'
HARDWARE_VERSION = '00002a27-0000-1000-8000-00805f9b34fb'
MANUFACTURER_NAME = '00002a29-0000-1000-8000-00805f9b34fb'
LYWSD02_DATA = 'EBE0CCC1-7A0A-4B0C-8A1A-6FF2997DA3A6'
CGG_DATA = '00000100-0000-1000-8000-00805f9b34fb'
MJHT_DATA = '00000001-0000-1000-8000-00805f9b34fb'
MJHT_BATTERY = '00002a19-0000-1000-8000-00805f9b34fb'
| device_name = '00002a00-0000-1000-8000-00805f9b34fb'
model_number = '00002a24-0000-1000-8000-00805f9b34fb'
serial_number = '00002a25-0000-1000-8000-00805f9b34fb'
firmware_version = '00002a26-0000-1000-8000-00805f9b34fb'
hardware_version = '00002a27-0000-1000-8000-00805f9b34fb'
manufacturer_name = '00002a29-0000-1000-8000-00805f9b34fb'
lywsd02_data = 'EBE0CCC1-7A0A-4B0C-8A1A-6FF2997DA3A6'
cgg_data = '00000100-0000-1000-8000-00805f9b34fb'
mjht_data = '00000001-0000-1000-8000-00805f9b34fb'
mjht_battery = '00002a19-0000-1000-8000-00805f9b34fb' |
pkgname = "libusbmuxd"
pkgver = "2.0.2"
pkgrel = 0
build_style = "gnu_configure"
hostmakedepends = ["pkgconf", "automake", "libtool"]
makedepends = ["libusb-devel", "libplist-devel"]
pkgdesc = "Client library to multiplex connections to/from iOS devices"
maintainer = "q66 <q66@chimera-linux.org>"
license = "LGPL-2.1-only"
url = "https://libimobiledevice.org"
source = f"https://github.com/libimobiledevice/{pkgname}/archive/{pkgver}.tar.gz"
sha256 = "8ae3e1d9340177f8f3a785be276435869363de79f491d05d8a84a59efc8a8fdc"
def pre_configure(self):
self.do("autoreconf", "-if")
@subpackage("libusbmuxd-devel")
def _devel(self):
return self.default_devel()
@subpackage("libusbmuxd-progs")
def _progs(self):
return self.default_progs()
| pkgname = 'libusbmuxd'
pkgver = '2.0.2'
pkgrel = 0
build_style = 'gnu_configure'
hostmakedepends = ['pkgconf', 'automake', 'libtool']
makedepends = ['libusb-devel', 'libplist-devel']
pkgdesc = 'Client library to multiplex connections to/from iOS devices'
maintainer = 'q66 <q66@chimera-linux.org>'
license = 'LGPL-2.1-only'
url = 'https://libimobiledevice.org'
source = f'https://github.com/libimobiledevice/{pkgname}/archive/{pkgver}.tar.gz'
sha256 = '8ae3e1d9340177f8f3a785be276435869363de79f491d05d8a84a59efc8a8fdc'
def pre_configure(self):
self.do('autoreconf', '-if')
@subpackage('libusbmuxd-devel')
def _devel(self):
return self.default_devel()
@subpackage('libusbmuxd-progs')
def _progs(self):
return self.default_progs() |
def main():
return 'THIS_IS_MAIN_MAIN'
def func():
return 'THIS_IS_MAIN_FUNC'
| def main():
return 'THIS_IS_MAIN_MAIN'
def func():
return 'THIS_IS_MAIN_FUNC' |
def get_msg_with_punctuations(old, new):
new_org_text = new
for i in range(len(old)):
if not str.isalpha(old[i]):
new_org_text = new_org_text[0:i] + old[i] + new_org_text[i:]
for i in range(len(old)):
if str.isupper(old[i]):
new_org_text = new_org_text[0:i] + str.upper(new_org_text[i]) + new_org_text[i + 1:]
return new_org_text
def get_alphabetic_msg(text):
normal = ''
for ch in text:
if str.isalpha(ch):
normal += ch
return normal | def get_msg_with_punctuations(old, new):
new_org_text = new
for i in range(len(old)):
if not str.isalpha(old[i]):
new_org_text = new_org_text[0:i] + old[i] + new_org_text[i:]
for i in range(len(old)):
if str.isupper(old[i]):
new_org_text = new_org_text[0:i] + str.upper(new_org_text[i]) + new_org_text[i + 1:]
return new_org_text
def get_alphabetic_msg(text):
normal = ''
for ch in text:
if str.isalpha(ch):
normal += ch
return normal |
class Solution:
def lowestCommonAncestor(self, root, p, q):
if root is None or p == root or q == root:
return root
l = self.lowestCommonAncestor(root.left, p, q)
r = self.lowestCommonAncestor(root.right, p, q)
if l is None:
return r
if r is None:
return l
return root
| class Solution:
def lowest_common_ancestor(self, root, p, q):
if root is None or p == root or q == root:
return root
l = self.lowestCommonAncestor(root.left, p, q)
r = self.lowestCommonAncestor(root.right, p, q)
if l is None:
return r
if r is None:
return l
return root |
### This program subtracts ###
def minus(a, b):
sub = a - b
print(sub)
print("Welcome to subtracting your life version 1.0.0.0.0.0.0.1!")
x,y = input("Please input the digits of your life that you wish to subtract: ").split()
x = int(x)
y = int(y)
minus(x,y)
| def minus(a, b):
sub = a - b
print(sub)
print('Welcome to subtracting your life version 1.0.0.0.0.0.0.1!')
(x, y) = input('Please input the digits of your life that you wish to subtract: ').split()
x = int(x)
y = int(y)
minus(x, y) |
class ListNode:
def __init__(self, x):
self.val = x
self.next = None
class Solution:
def reverseList(self, head: ListNode) -> ListNode:
if head == None or head.next == None:
return head
next_node = head.next
head.next = None
while next_node:
next_next_node = next_node.next
next_node.next = head
head = next_node
next_node = next_next_node
return head
def reverseList_recursive(self, head: ListNode) -> ListNode:
if head.next == None:
return head
remaining = head.next
head.next = None
remaining = self.reverseList_recursive(remaining)
cur = remaining
while cur.next:
cur = cur.next
cur.next = head
return remaining
if __name__ == "__main__":
h = ListNode(1)
h.next = ListNode(2)
h.next.next = ListNode(3)
h.next.next.next = ListNode(4)
solu = Solution()
solu.reverseList_recursive(h) | class Listnode:
def __init__(self, x):
self.val = x
self.next = None
class Solution:
def reverse_list(self, head: ListNode) -> ListNode:
if head == None or head.next == None:
return head
next_node = head.next
head.next = None
while next_node:
next_next_node = next_node.next
next_node.next = head
head = next_node
next_node = next_next_node
return head
def reverse_list_recursive(self, head: ListNode) -> ListNode:
if head.next == None:
return head
remaining = head.next
head.next = None
remaining = self.reverseList_recursive(remaining)
cur = remaining
while cur.next:
cur = cur.next
cur.next = head
return remaining
if __name__ == '__main__':
h = list_node(1)
h.next = list_node(2)
h.next.next = list_node(3)
h.next.next.next = list_node(4)
solu = solution()
solu.reverseList_recursive(h) |
def Cel():
celsius = float(input("Enter the temperature in Celsius ")) # It will take user input
fahrenheit :float = (celsius * 9 / 5) + 32 # calculation part
print("Value in Fahrenheit ", fahrenheit)
def Far():
fahrenheit = float(input("Enter the temperature in Fahrenheit ")) # It will take user input
celsius :float = (fahrenheit - 32) * 5 / 9 # calculation part
print(" Value in Celsius", celsius)
def condition():
cont=int(input((" Enter 1 to continue or else to exit ")))
if cont ==1:
main()
condition()
def main():
print(" To convert Temperatures")
choice=int(input("Enter 1 to convert Celsius to Fahrenheit 0r Enter 2 for vice versa "))
if choice ==1 :
Cel()
elif choice ==2 :
Far()
else :
print(' Wrong choice ')
return
main()
condition()
| def cel():
celsius = float(input('Enter the temperature in Celsius '))
fahrenheit: float = celsius * 9 / 5 + 32
print('Value in Fahrenheit ', fahrenheit)
def far():
fahrenheit = float(input('Enter the temperature in Fahrenheit '))
celsius: float = (fahrenheit - 32) * 5 / 9
print(' Value in Celsius', celsius)
def condition():
cont = int(input(' Enter 1 to continue or else to exit '))
if cont == 1:
main()
condition()
def main():
print(' To convert Temperatures')
choice = int(input('Enter 1 to convert Celsius to Fahrenheit 0r Enter 2 for vice versa '))
if choice == 1:
cel()
elif choice == 2:
far()
else:
print(' Wrong choice ')
return
main()
condition() |
#CP2
#Thomas Franceschi
#Kyle Williams
#import sys
class baseParser:
def __init__(self, expression, length, counter):
self.expression = expression #String being parsed
self.length = length #Max range for token
self.counter = counter #Token
self.M = '' #Output
def parseRegexp(self):
self.M = self.parseUnion()
if self.counter == self.length:
return self.M
else:
print('regex error, count: ' + str(self.counter) + ' length: ' + str(self.length))
return 1 #ERROR
def parseUnion(self):
self.M = self.parseConcat()
if self.counter == self.length:
return self.M
if self.expression[self.counter] == '|': #If next token is |
self.counter = self.counter + 1 #'read' |
self.M = self.union(self.M, self.parseConcat())
return self.M
def parseConcat(self):
if self.counter == self.length:
return self.epsilon()
if self.expression[self.counter] == '|' or self.expression[self.counter] == ')':
return self.epsilon()
else:
self.M = self.parseUnary()
while self.counter < self.length and self.expression[self.counter] != '|' and self.expression[self.counter] != ')':
self.M = self.concat(self.M, self.parseUnary())
return self.M
def parseUnary(self):
self.M = self.parsePrimary()
if self.counter == self.length:
return self.M
if self.expression[self.counter] == '*':
self.counter = self.counter + 1; #read *
return self.star(self.M)
else:
return self.M
def parsePrimary(self):
if self.expression[self.counter] == '(':
self.counter = self.counter + 1 #read (
self.M = self.parseUnion()
self.counter = self.counter + 1 #read )
return self.M
elif self.expression[self.counter] == '@':
self.counter = self.counter + 1 #read @
return self.emptyset()
elif self.expression[self.counter] != '(' and self.expression[self.counter] != ')' and self.expression[self.counter] != '*' and self.expression[self.counter] != '|':
a = self.expression[self.counter]
self.counter = self.counter + 1
return self.symbol(a)
else:
print('parse primary error')
return 1 #Error
#Placeholders
def emptyset(self):
return 'emptyset()'
def epsilon(self):
return 'epsilon()'
def symbol(self, a):
return 'symbol(' + str(a) + ')'
def union(self, M1, M2):
return 'union(' + str(M1) + ',' + str(M2) + ')'
def concat(self, M1,M2):
return 'concat(' + str(M1) + ',' + str(M2) + ')'
def star(self, M):
return 'star(' + M + ')'
if __name__ == "__main__":
#expression = '(ab|a)*'
length = len(expression)
counter = 0
parser = baseParser(expression, length, counter)
M = parser.parseRegexp()
print(M) | class Baseparser:
def __init__(self, expression, length, counter):
self.expression = expression
self.length = length
self.counter = counter
self.M = ''
def parse_regexp(self):
self.M = self.parseUnion()
if self.counter == self.length:
return self.M
else:
print('regex error, count: ' + str(self.counter) + ' length: ' + str(self.length))
return 1
def parse_union(self):
self.M = self.parseConcat()
if self.counter == self.length:
return self.M
if self.expression[self.counter] == '|':
self.counter = self.counter + 1
self.M = self.union(self.M, self.parseConcat())
return self.M
def parse_concat(self):
if self.counter == self.length:
return self.epsilon()
if self.expression[self.counter] == '|' or self.expression[self.counter] == ')':
return self.epsilon()
else:
self.M = self.parseUnary()
while self.counter < self.length and self.expression[self.counter] != '|' and (self.expression[self.counter] != ')'):
self.M = self.concat(self.M, self.parseUnary())
return self.M
def parse_unary(self):
self.M = self.parsePrimary()
if self.counter == self.length:
return self.M
if self.expression[self.counter] == '*':
self.counter = self.counter + 1
return self.star(self.M)
else:
return self.M
def parse_primary(self):
if self.expression[self.counter] == '(':
self.counter = self.counter + 1
self.M = self.parseUnion()
self.counter = self.counter + 1
return self.M
elif self.expression[self.counter] == '@':
self.counter = self.counter + 1
return self.emptyset()
elif self.expression[self.counter] != '(' and self.expression[self.counter] != ')' and (self.expression[self.counter] != '*') and (self.expression[self.counter] != '|'):
a = self.expression[self.counter]
self.counter = self.counter + 1
return self.symbol(a)
else:
print('parse primary error')
return 1
def emptyset(self):
return 'emptyset()'
def epsilon(self):
return 'epsilon()'
def symbol(self, a):
return 'symbol(' + str(a) + ')'
def union(self, M1, M2):
return 'union(' + str(M1) + ',' + str(M2) + ')'
def concat(self, M1, M2):
return 'concat(' + str(M1) + ',' + str(M2) + ')'
def star(self, M):
return 'star(' + M + ')'
if __name__ == '__main__':
length = len(expression)
counter = 0
parser = base_parser(expression, length, counter)
m = parser.parseRegexp()
print(M) |
__all__ = [
'PrimaryStatus',
'InputStatus',
'OutputStatus',
'StopReason'
]
class PrimaryStatus:
QUEUING_CHECKS = "QUEUING_CHECKS"
# one of checks tasks has been started
CHECKING = "CHECKING"
# when all first level tasks has been finished
CHECKS_FINISHED = "CHECKS_FINISHED"
# It will be set outside of tasks,
# when CHECKS_FINISHED and not INPUTS_DOWNLOADING
QUEUING_INPUTS_DOWNLOADING = "QUEUING_INPUTS_DOWNLOADING"
# when one of checks tasks has been started
INPUTS_DOWNLOADING = "INPUTS_DOWNLOADING"
# when downloading all inputs has been finished
ALL_INPUTS_DOWNLOADED = "ALL_INPUTS_DOWNLOADED"
# It will be set outside of tasks,
# when ALL_INPUTS_DOWNLOADED and not QUEUING_OUTPUTS
QUEUING_OUTPUTS = "QUEUING_OUTPUTS"
# when one of level3 chains has been started
OUTPUTS_PROGRESSING = "OUTPUTS_PROGRESSING"
# when all outputs are finished
# means total_outputs == (ready_outputs + revoked_outputs + failed_outputs)
FINISHED = "FINISHED"
# when all outputs revoked
REVOKED = "REVOKED"
# when one of checks has been failed, one of inputs has been failed,
# or all outputs has been failed
FAILED = "FAILED"
class InputStatus:
# for every input
PREPARATION_DOWNLOAD = "PREPARATION_DOWNLOAD"
DOWNLOADING = "DOWNLOADING"
DOWNLOADING_FINISHED = "DOWNLOADING_FINISHED"
QUEUING_TO_ANALYZE = "QUEUING_TO_ANALYZE"
ANALYZING = "ANALYZING"
ANALYZING_FINISHED = "ANALYZING_FINISHED"
INPUT_REVOKED = "INPUT_REVOKED"
INPUT_FAILED = "INPUT_FAILED"
class OutputStatus:
# for every output
OUTPUT_REVOKED = "OUTPUT_REVOKED"
OUTPUT_FAILED = "OUTPUT_FAILED"
PREPARATION_PROCESSING = "PREPARATION_PROCESSING"
PROCESSING = "PROCESSING"
PROCESSING_FINISHED = "PROCESSING_FINISHED"
# It will be set outside of tasks,
# when PROCESSING_FINISHED and not UPLOADING
QUEUING_UPLOADING = "QUEUING_UPLOADING"
UPLOADING = "UPLOADING"
UPLOADING_FINISHED = "UPLOADING_FINISHED"
class StopReason:
FORCE_REVOKED = "FORCE_REVOKED"
INTERNAL_ERROR = "INTERNAL_ERROR"
# CheckInputKeyTask and DownloadInputTask
INPUT_VIDEO_ON_S3_IS_404_OR_403 = "INPUT_VIDEO_ON_S3_IS_404_OR_403"
# CheckInputKeyTask
FAILED_INPUT_KEY_CHECKING = "FAILED_INPUT_KEY_CHECKING"
# CheckOutputBucketTask
FAILED_OUTPUT_BUCKET_CHECKING = "FAILED_OUTPUT_BUCKET_CHECKING"
OUTPUT_BUCKET_ON_S3_IS_404_OR_403 = "OUTPUT_BUCKET_ON_S3_IS_404_OR_403"
# CheckOutputKeyTask
FAILED_OUTPUT_KEY_CHECKING = "FAILED_OUTPUT_KEY_CHECKING"
OUTPUT_KEY_IS_ALREADY_EXIST = "OUTPUT_KEY_IS_ALREADY_EXIST"
# DownloadInputTask
DOWNLOADING_FAILED = "DOWNLOADING_FAILED"
# AnalyzeInputTask
FAILED_ANALYZE_INPUT = "FAILED_ANALYZE_INPUT"
# AnalyzeInputTask
INPUT_VIDEO_CODEC_TYPE_IN_NOT_VIDEO = "INPUT_VIDEO_CODEC_TYPE_IN_NOT_VIDEO"
# InputsFunnelTask
AGGREGATE_INPUTS_FAILED = "AGGREGATE_INPUTS_FAILED"
# CreatePlaylistTask
FAILED_CREATE_PLAYLIST = "FAILED_CREATE_PLAYLIST"
INPUT_VIDEO_SIZE_CAN_NOT_BE_ZERO = "INPUT_VIDEO_SIZE_CAN_NOT_BE_ZERO"
REPRESENTATION_NEEDS_BOTH_SIZE_AND_BITRATE = "REPRESENTATION_NEEDS_BOTH_SIZE_AND_BITRATE"
# UploadDirectoryTask
FAILED_UPLOAD_DIRECTORY = "FAILED_UPLOAD_DIRECTORY"
# GenerateThumbnailTask
FAILED_GENERATE_THUMBNAIL = "FAILED_GENERATE_THUMBNAIL"
# UploadFileTask
FAILED_UPLOAD_FILE = "FAILED_UPLOAD_FILE"
# AddWatermarkTask
FAILED_ADD_WATERMARK = "FAILED_ADD_WATERMARK"
# InputsFunnelTask
# when job_details not found
JOB_TIMEOUT = "JOB_TIMEOUT"
| __all__ = ['PrimaryStatus', 'InputStatus', 'OutputStatus', 'StopReason']
class Primarystatus:
queuing_checks = 'QUEUING_CHECKS'
checking = 'CHECKING'
checks_finished = 'CHECKS_FINISHED'
queuing_inputs_downloading = 'QUEUING_INPUTS_DOWNLOADING'
inputs_downloading = 'INPUTS_DOWNLOADING'
all_inputs_downloaded = 'ALL_INPUTS_DOWNLOADED'
queuing_outputs = 'QUEUING_OUTPUTS'
outputs_progressing = 'OUTPUTS_PROGRESSING'
finished = 'FINISHED'
revoked = 'REVOKED'
failed = 'FAILED'
class Inputstatus:
preparation_download = 'PREPARATION_DOWNLOAD'
downloading = 'DOWNLOADING'
downloading_finished = 'DOWNLOADING_FINISHED'
queuing_to_analyze = 'QUEUING_TO_ANALYZE'
analyzing = 'ANALYZING'
analyzing_finished = 'ANALYZING_FINISHED'
input_revoked = 'INPUT_REVOKED'
input_failed = 'INPUT_FAILED'
class Outputstatus:
output_revoked = 'OUTPUT_REVOKED'
output_failed = 'OUTPUT_FAILED'
preparation_processing = 'PREPARATION_PROCESSING'
processing = 'PROCESSING'
processing_finished = 'PROCESSING_FINISHED'
queuing_uploading = 'QUEUING_UPLOADING'
uploading = 'UPLOADING'
uploading_finished = 'UPLOADING_FINISHED'
class Stopreason:
force_revoked = 'FORCE_REVOKED'
internal_error = 'INTERNAL_ERROR'
input_video_on_s3_is_404_or_403 = 'INPUT_VIDEO_ON_S3_IS_404_OR_403'
failed_input_key_checking = 'FAILED_INPUT_KEY_CHECKING'
failed_output_bucket_checking = 'FAILED_OUTPUT_BUCKET_CHECKING'
output_bucket_on_s3_is_404_or_403 = 'OUTPUT_BUCKET_ON_S3_IS_404_OR_403'
failed_output_key_checking = 'FAILED_OUTPUT_KEY_CHECKING'
output_key_is_already_exist = 'OUTPUT_KEY_IS_ALREADY_EXIST'
downloading_failed = 'DOWNLOADING_FAILED'
failed_analyze_input = 'FAILED_ANALYZE_INPUT'
input_video_codec_type_in_not_video = 'INPUT_VIDEO_CODEC_TYPE_IN_NOT_VIDEO'
aggregate_inputs_failed = 'AGGREGATE_INPUTS_FAILED'
failed_create_playlist = 'FAILED_CREATE_PLAYLIST'
input_video_size_can_not_be_zero = 'INPUT_VIDEO_SIZE_CAN_NOT_BE_ZERO'
representation_needs_both_size_and_bitrate = 'REPRESENTATION_NEEDS_BOTH_SIZE_AND_BITRATE'
failed_upload_directory = 'FAILED_UPLOAD_DIRECTORY'
failed_generate_thumbnail = 'FAILED_GENERATE_THUMBNAIL'
failed_upload_file = 'FAILED_UPLOAD_FILE'
failed_add_watermark = 'FAILED_ADD_WATERMARK'
job_timeout = 'JOB_TIMEOUT' |
# __getattr__ is not implemented by default
# __getattribute__ run for every attribute access (w/o looking at attributes on object)
# __getattr__ only run when attribute not found in normal ways
class Foo(object):
def __getattribute__(self, item):
print('Foo called __getattribute__ on {0}'.format(item))
return super().__getattribute__(item)
def __getattr__(self, item):
print('Foo called __getattr__ on {0}'.format(item))
return super().__getattr__(item)
class Bar(Foo):
def __getattribute__(self, item):
print('Bar called __getattribute__ on {0}'.format(item))
return super().__getattribute__(item)
def __getattr__(self, item):
print('Bar called __getattr__ on {0}'.format(item))
return super().__getattr__(item)
if __name__ == '__main__':
b = Bar()
# b.x = 4
b.x | class Foo(object):
def __getattribute__(self, item):
print('Foo called __getattribute__ on {0}'.format(item))
return super().__getattribute__(item)
def __getattr__(self, item):
print('Foo called __getattr__ on {0}'.format(item))
return super().__getattr__(item)
class Bar(Foo):
def __getattribute__(self, item):
print('Bar called __getattribute__ on {0}'.format(item))
return super().__getattribute__(item)
def __getattr__(self, item):
print('Bar called __getattr__ on {0}'.format(item))
return super().__getattr__(item)
if __name__ == '__main__':
b = bar()
b.x |
# palindrome_check.py
# recursion in strings
def isPalindrome(s):
# check if string is a palindrome
def toChars(s):
# convert string to characters
s = s.lower()
ans = ''
for c in s:
if c in 'abcdefghijklmnopqrstuvwxy':
ans = ans + c
return ans
def isPal(s):
#Return true/false if string is a palindrome
if len(s) <= 1:
return True
else:
return s[0] == s[-1] and isPal(s[1:-1])
return isPal(toChars(s))
# test goes here:
test1 = isPalindrome('ama')
print(test1)
| def is_palindrome(s):
def to_chars(s):
s = s.lower()
ans = ''
for c in s:
if c in 'abcdefghijklmnopqrstuvwxy':
ans = ans + c
return ans
def is_pal(s):
if len(s) <= 1:
return True
else:
return s[0] == s[-1] and is_pal(s[1:-1])
return is_pal(to_chars(s))
test1 = is_palindrome('ama')
print(test1) |
f = open('./deu.txt','r')
fwde = open('./deu.de','w')
fwen = open('./deu.en','w')
lines = [line for line in f.read().split('\n') if line]
for line in lines:
items = line.split('\t')
assert len(items)==3
fwen.write(items[0] + '\n')
fwde.write(items[1] + '\n')
fwde.close()
fwen.close()
| f = open('./deu.txt', 'r')
fwde = open('./deu.de', 'w')
fwen = open('./deu.en', 'w')
lines = [line for line in f.read().split('\n') if line]
for line in lines:
items = line.split('\t')
assert len(items) == 3
fwen.write(items[0] + '\n')
fwde.write(items[1] + '\n')
fwde.close()
fwen.close() |
height_map = [int(e.strip()) for e in input().strip().split(',')]
count = 0
negative = False
for i in height_map:
if i < 0:
negative = True
else:
if negative:
count += 1
negative = False
print(count) | height_map = [int(e.strip()) for e in input().strip().split(',')]
count = 0
negative = False
for i in height_map:
if i < 0:
negative = True
else:
if negative:
count += 1
negative = False
print(count) |
# Find value that occurs in odd number of elements.
# Find the number in an non-empty array that does not have pair
# Array [9,3,9,3,9,7,9] pairs
# A[0] = 9 and A[2] = 9
# A[1] = 3 and A[3] = 3
# A[4] = 9 and A[6] = 9
# A[5] = 7 no pair
# the function should return 7, as explained in the example above.
# Important
# N is an odd integer within the range [1..1,000,000];
# each element of array A is an integer within the range [1..1,000,000,000];
# all but one of the values in A occur an even number of times.
def solution(A):
A = sorted(A)
current = A[0]
count = 0
for i in A:
if current == i:
count += 1
else:
if count % 2 != 0:
return current
count = 1
current = i
return current
# Testing
print(solution([9,3,9,3,9,7,9]))
# Result
# Detected time complexity: O(N) or O(N*log(N)) | def solution(A):
a = sorted(A)
current = A[0]
count = 0
for i in A:
if current == i:
count += 1
else:
if count % 2 != 0:
return current
count = 1
current = i
return current
print(solution([9, 3, 9, 3, 9, 7, 9])) |
Data_File = open("Day2_Data.txt")
Data = Data_File.read()
Data = Data.split(',')
for i in range(len(Data)):
Data[i]=int(Data[i])
Data_Backup = Data.copy()
for noun in range (100):
for verb in range(100):
Data = Data_Backup.copy()
Data[1] = noun
Data[2] = verb
Index_Number = 0
while(True):
if(Data[Index_Number] == 1):
Data[Data[Index_Number+3]] = Data[Data[Index_Number+1]] + Data[Data[Index_Number+2]]
Index_Number +=4
elif(Data[Index_Number] ==2):
Data[Data[Index_Number + 3]] = Data[Data[Index_Number + 1]] * Data[Data[Index_Number + 2]]
Index_Number += 4
elif(Data[Index_Number] == 99):
#print("Terminated successfully")
break
else:
#print("Something has gone wrong, read opcode:"+ str(Data[Index_Number]))
#print("Terminated")
break
if(Data[0] == 19690720):
print("noun :" + str(noun) )
print("verb :" + str(verb) )
exit()
| data__file = open('Day2_Data.txt')
data = Data_File.read()
data = Data.split(',')
for i in range(len(Data)):
Data[i] = int(Data[i])
data__backup = Data.copy()
for noun in range(100):
for verb in range(100):
data = Data_Backup.copy()
Data[1] = noun
Data[2] = verb
index__number = 0
while True:
if Data[Index_Number] == 1:
Data[Data[Index_Number + 3]] = Data[Data[Index_Number + 1]] + Data[Data[Index_Number + 2]]
index__number += 4
elif Data[Index_Number] == 2:
Data[Data[Index_Number + 3]] = Data[Data[Index_Number + 1]] * Data[Data[Index_Number + 2]]
index__number += 4
elif Data[Index_Number] == 99:
break
else:
break
if Data[0] == 19690720:
print('noun :' + str(noun))
print('verb :' + str(verb))
exit() |
# https://www.facebook.com/roshan.philipines/posts/2769055946717382
# Subscribed by Roshaen
#Implementation of ISBN number
def isbn(n):
lst=[]
j=0
for i in range(len(n)):
lst.insert(j,n[i])
j+=1
i=0
sum=0
for i in range(len(lst)):
sum=sum+int(lst[i])*(10-i)
if(sum%11==0):
print("Valid ISBN number")
else:
print("Not a valid ISBN number")
inp=input("Enter isbn number: ")
isbn(inp)
| def isbn(n):
lst = []
j = 0
for i in range(len(n)):
lst.insert(j, n[i])
j += 1
i = 0
sum = 0
for i in range(len(lst)):
sum = sum + int(lst[i]) * (10 - i)
if sum % 11 == 0:
print('Valid ISBN number')
else:
print('Not a valid ISBN number')
inp = input('Enter isbn number: ')
isbn(inp) |
def get_defaults():
return {
"acceptable_size": 100,
"acceptable_time": 3,
"get_pages": True,
"get_assets": True,
"get_images": True,
"get_scripts": True,
"get_stylesheets": True,
"give_second_chance": True,
"logfile_location": "gyroscope.log",
"logfile_mode": "w",
"log_level": 30,
"log_too_big": True,
"log_too_slow": True,
"sites_file": "sites.json",
"asset_types": []
} | def get_defaults():
return {'acceptable_size': 100, 'acceptable_time': 3, 'get_pages': True, 'get_assets': True, 'get_images': True, 'get_scripts': True, 'get_stylesheets': True, 'give_second_chance': True, 'logfile_location': 'gyroscope.log', 'logfile_mode': 'w', 'log_level': 30, 'log_too_big': True, 'log_too_slow': True, 'sites_file': 'sites.json', 'asset_types': []} |
#PROBLEM LINK:- https://leetcode.com/problems/shuffle-the-array/
class Solution:
def shuffle(self, nums, n):
v = []
for i in range(n):
v.append(nums[i])
v.append(nums[i+n])
return v
| class Solution:
def shuffle(self, nums, n):
v = []
for i in range(n):
v.append(nums[i])
v.append(nums[i + n])
return v |
# coding: utf-8
##############################################################################
# Copyright (C) 2018 Microchip Technology Inc. and its subsidiaries.
#
# Subject to your compliance with these terms, you may use Microchip software
# and any derivatives exclusively with Microchip products. It is your
# responsibility to comply with third party license terms applicable to your
# use of third party software (including open source software) that may
# accompany Microchip software.
#
# THIS SOFTWARE IS SUPPLIED BY MICROCHIP "AS IS". NO WARRANTIES, WHETHER
# EXPRESS, IMPLIED OR STATUTORY, APPLY TO THIS SOFTWARE, INCLUDING ANY IMPLIED
# WARRANTIES OF NON-INFRINGEMENT, MERCHANTABILITY, AND FITNESS FOR A
# PARTICULAR PURPOSE.
#
# IN NO EVENT WILL MICROCHIP BE LIABLE FOR ANY INDIRECT, SPECIAL, PUNITIVE,
# INCIDENTAL OR CONSEQUENTIAL LOSS, DAMAGE, COST OR EXPENSE OF ANY KIND
# WHATSOEVER RELATED TO THE SOFTWARE, HOWEVER CAUSED, EVEN IF MICROCHIP HAS
# BEEN ADVISED OF THE POSSIBILITY OR THE DAMAGES ARE FORESEEABLE. TO THE
# FULLEST EXTENT ALLOWED BY LAW, MICROCHIP'S TOTAL LIABILITY ON ALL CLAIMS IN
# ANY WAY RELATED TO THIS SOFTWARE WILL NOT EXCEED THE AMOUNT OF FEES, IF ANY,
# THAT YOU HAVE PAID DIRECTLY TO MICROCHIP FOR THIS SOFTWARE.
##############################################################################
def instantiateComponent(comp):
GFX_INTF_SMC_H = comp.createFileSymbol("GFX_INTF_SMC_H", None)
GFX_INTF_SMC_H.setDestPath("gfx/interface/")
GFX_INTF_SMC_H.setSourcePath("../drv_gfx_disp_intf.h")
GFX_INTF_SMC_H.setOutputName("drv_gfx_disp_intf.h")
GFX_INTF_SMC_H.setProjectPath("config/" + Variables.get("__CONFIGURATION_NAME") + "/gfx/interface")
GFX_INTF_SMC_H.setType("HEADER")
GFX_INTF_SMC = comp.createFileSymbol("GFX_INTF_SMC", None)
GFX_INTF_SMC.setDestPath("gfx/interface/parallel_smc/")
GFX_INTF_SMC.setSourcePath("templates/drv_gfx_disp_intf_parallel_smc.c.ftl")
GFX_INTF_SMC.setOutputName("drv_gfx_disp_intf_parallel_smc.c")
GFX_INTF_SMC.setProjectPath("config/" + Variables.get("__CONFIGURATION_NAME") + "/gfx/interface/parallel_smc")
GFX_INTF_SMC.setMarkup(True)
GFX_INTF_SMC.setType("SOURCE")
### Interface type is required for all interface components. This is queried by the driver to determine
### the display interface supported by the interface component. Valid values are "SPI 4-line", "Parallel 16-bit",
### and "Parallel 8-bit"
InterfaceType = comp.createStringSymbol("InterfaceType", None)
InterfaceType.setLabel("Interface Type")
InterfaceType.setDescription("The interface configuration")
InterfaceType.setDefaultValue("Parallel 16-bit")
InterfaceType.setVisible(False)
### Driver settings menu
DriverSettingsMenu = comp.createMenuSymbol("DriverSettingsMenu", None)
DriverSettingsMenu.setLabel("Driver Settings")
UseSyncBarriers = comp.createBooleanSymbol("UseSyncBarriers", DriverSettingsMenu)
UseSyncBarriers.setLabel("Use Synchronization Barriers")
UseSyncBarriers.setDescription("Use Synchronization Barriers.")
UseSyncBarriers.setDefaultValue(True)
UseSyncBarriers.setVisible(False)
DelayNOPCount = comp.createIntegerSymbol("DelayNOPCount", DriverSettingsMenu)
DelayNOPCount.setLabel("Number of NOP for delay")
DelayNOPCount.setDescription("Number of NOP for delay")
DelayNOPCount.setDefaultValue(4)
###
### Interface settings menu
InterfaceSettingsSMCMenu = comp.createMenuSymbol("InterfaceSettingsSMCMenu", None)
InterfaceSettingsSMCMenu.setLabel("Parallel 8080 Display Interface Settings")
EBIChipSelectIndex = comp.createIntegerSymbol("EBIChipSelectIndex", InterfaceSettingsSMCMenu)
EBIChipSelectIndex.setLabel("EBI Chip Select Index")
EBIChipSelectIndex.setDescription("The chip select index")
EBIChipSelectIndex.setDefaultValue(0)
EBIChipSelectIndex.setMin(0)
EBIChipSelectIndex.setMax(4)
EBIChipSelectIndex.setVisible(False)
ControlPinsMenu = comp.createMenuSymbol("ControlPinsMenu", InterfaceSettingsSMCMenu)
ControlPinsMenu.setLabel("Control Pin Settings")
ChipSelectControl = comp.createComboSymbol("ChipSelectControl", ControlPinsMenu, ["GPIO", "Peripheral"])
ChipSelectControl.setLabel("CS# Control")
ChipSelectControl.setDescription("Chip Select Control")
ChipSelectControl.setDefaultValue("GPIO")
ChipSelectControl.setReadOnly(True)
DataCommandSelectControl = comp.createComboSymbol("DataCommandSelectControl", ControlPinsMenu, ["GPIO", "Peripheral"])
DataCommandSelectControl.setLabel("D/C# Control")
DataCommandSelectControl.setDescription("Data Command Select Control")
DataCommandSelectControl.setDefaultValue("GPIO")
DataCommandSelectControl.setDependencies(onDataCommandSelectSet, ["DataCommandSelectControl"])
ReadStrobeControl = comp.createComboSymbol("ReadStrobeControl", ControlPinsMenu, ["GPIO", "Peripheral"])
ReadStrobeControl.setLabel("RD# Control")
ReadStrobeControl.setDescription("Read Strobe Control")
ReadStrobeControl.setDefaultValue("GPIO")
WriteStrobeControl = comp.createComboSymbol("WriteStrobeControl", ControlPinsMenu, ["GPIO", "Peripheral"])
WriteStrobeControl.setLabel("WR# Control")
WriteStrobeControl.setDescription("Write Strobe Control")
WriteStrobeControl.setDefaultValue("GPIO")
DCXAddressBit = comp.createIntegerSymbol("DCXAddressBit", DataCommandSelectControl)
DCXAddressBit.setLabel("DCX Address Bit")
DCXAddressBit.setDescription("Address bit used for DCX signal.")
DCXAddressBit.setDefaultValue(12)
DCXAddressBit.setMin(0)
DCXAddressBit.setMax(31)
###
def configureSMCComponent(comp, smcComponent):
print("Configuring SMC")
smcChipSelNum = comp.getSymbolValue("EBIChipSelectIndex")
smcComponent.setSymbolValue("SMC_CHIP_SELECT" + str(smcChipSelNum), True, 1)
smcComponent.setSymbolValue("SMC_MEM_SCRAMBLING_CS" + str(smcChipSelNum), False, 1)
# SMC Write Timings
smcComponent.setSymbolValue("SMC_NWE_SETUP_CS" + str(smcChipSelNum), 4, 1)
smcComponent.setSymbolValue("SMC_NCS_WR_SETUP_CS" + str(smcChipSelNum), 0, 1)
smcComponent.setSymbolValue("SMC_NWE_PULSE_CS" + str(smcChipSelNum), 4, 1)
smcComponent.setSymbolValue("SMC_NCS_WR_PULSE_CS" + str(smcChipSelNum), 10, 1)
smcComponent.setSymbolValue("SMC_DATA_BUS_CS" + str(smcChipSelNum), 1, 1)
smcComponent.setSymbolValue("SMC_NWE_CYCLE_CS" + str(smcChipSelNum), 3, 1)
# SMC Read Timings
smcComponent.setSymbolValue("SMC_NRD_SETUP_CS" + str(smcChipSelNum), 2, 1)
smcComponent.setSymbolValue("SMC_NCS_RD_SETUP_CS" + str(smcChipSelNum), 0, 1)
smcComponent.setSymbolValue("SMC_NRD_PULSE_CS" + str(smcChipSelNum), 63, 1)
smcComponent.setSymbolValue("SMC_NCS_RD_PULSE_CS" + str(smcChipSelNum), 63, 1)
smcComponent.setSymbolValue("SMC_NRD_CYCLE_CS" + str(smcChipSelNum), 110, 1)
# SMC Mode Configuration
smcComponent.setSymbolValue("SMC_DATA_BUS_CS" + str(smcChipSelNum), 1, 1)
smcComponent.setSymbolValue("SMC_BAT_CS" + str(smcChipSelNum), 0, 1)
smcComponent.setSymbolValue("SMC_READ_ENABLE_MODE_CS" + str(smcChipSelNum), True, 1)
smcComponent.setSymbolValue("SMC_WRITE_ENABLE_MODE_CS" + str(smcChipSelNum), False, 1)
def onDataCommandSelectSet(sourceSymbol, event):
if (sourceSymbol.getComponent().getSymbolByID("DataCommandSelectControl").getValue() == "GPIO"):
sourceSymbol.getComponent().getSymbolByID("DCXAddressBit").setVisible(False)
else:
sourceSymbol.getComponent().getSymbolByID("DCXAddressBit").setVisible(True)
def onInterfaceTypeChanged(sourceSymbol, event):
print("Interface type changed")
def onAttachmentConnected(source, target):
#print(source["component"].getID() + ": " + dependencyID + " dependent component added ")
if source["id"] == "SMC_CS":
configureSMCComponent(source["component"], target["component"]) | def instantiate_component(comp):
gfx_intf_smc_h = comp.createFileSymbol('GFX_INTF_SMC_H', None)
GFX_INTF_SMC_H.setDestPath('gfx/interface/')
GFX_INTF_SMC_H.setSourcePath('../drv_gfx_disp_intf.h')
GFX_INTF_SMC_H.setOutputName('drv_gfx_disp_intf.h')
GFX_INTF_SMC_H.setProjectPath('config/' + Variables.get('__CONFIGURATION_NAME') + '/gfx/interface')
GFX_INTF_SMC_H.setType('HEADER')
gfx_intf_smc = comp.createFileSymbol('GFX_INTF_SMC', None)
GFX_INTF_SMC.setDestPath('gfx/interface/parallel_smc/')
GFX_INTF_SMC.setSourcePath('templates/drv_gfx_disp_intf_parallel_smc.c.ftl')
GFX_INTF_SMC.setOutputName('drv_gfx_disp_intf_parallel_smc.c')
GFX_INTF_SMC.setProjectPath('config/' + Variables.get('__CONFIGURATION_NAME') + '/gfx/interface/parallel_smc')
GFX_INTF_SMC.setMarkup(True)
GFX_INTF_SMC.setType('SOURCE')
interface_type = comp.createStringSymbol('InterfaceType', None)
InterfaceType.setLabel('Interface Type')
InterfaceType.setDescription('The interface configuration')
InterfaceType.setDefaultValue('Parallel 16-bit')
InterfaceType.setVisible(False)
driver_settings_menu = comp.createMenuSymbol('DriverSettingsMenu', None)
DriverSettingsMenu.setLabel('Driver Settings')
use_sync_barriers = comp.createBooleanSymbol('UseSyncBarriers', DriverSettingsMenu)
UseSyncBarriers.setLabel('Use Synchronization Barriers')
UseSyncBarriers.setDescription('Use Synchronization Barriers.')
UseSyncBarriers.setDefaultValue(True)
UseSyncBarriers.setVisible(False)
delay_nop_count = comp.createIntegerSymbol('DelayNOPCount', DriverSettingsMenu)
DelayNOPCount.setLabel('Number of NOP for delay')
DelayNOPCount.setDescription('Number of NOP for delay')
DelayNOPCount.setDefaultValue(4)
interface_settings_smc_menu = comp.createMenuSymbol('InterfaceSettingsSMCMenu', None)
InterfaceSettingsSMCMenu.setLabel('Parallel 8080 Display Interface Settings')
ebi_chip_select_index = comp.createIntegerSymbol('EBIChipSelectIndex', InterfaceSettingsSMCMenu)
EBIChipSelectIndex.setLabel('EBI Chip Select Index')
EBIChipSelectIndex.setDescription('The chip select index')
EBIChipSelectIndex.setDefaultValue(0)
EBIChipSelectIndex.setMin(0)
EBIChipSelectIndex.setMax(4)
EBIChipSelectIndex.setVisible(False)
control_pins_menu = comp.createMenuSymbol('ControlPinsMenu', InterfaceSettingsSMCMenu)
ControlPinsMenu.setLabel('Control Pin Settings')
chip_select_control = comp.createComboSymbol('ChipSelectControl', ControlPinsMenu, ['GPIO', 'Peripheral'])
ChipSelectControl.setLabel('CS# Control')
ChipSelectControl.setDescription('Chip Select Control')
ChipSelectControl.setDefaultValue('GPIO')
ChipSelectControl.setReadOnly(True)
data_command_select_control = comp.createComboSymbol('DataCommandSelectControl', ControlPinsMenu, ['GPIO', 'Peripheral'])
DataCommandSelectControl.setLabel('D/C# Control')
DataCommandSelectControl.setDescription('Data Command Select Control')
DataCommandSelectControl.setDefaultValue('GPIO')
DataCommandSelectControl.setDependencies(onDataCommandSelectSet, ['DataCommandSelectControl'])
read_strobe_control = comp.createComboSymbol('ReadStrobeControl', ControlPinsMenu, ['GPIO', 'Peripheral'])
ReadStrobeControl.setLabel('RD# Control')
ReadStrobeControl.setDescription('Read Strobe Control')
ReadStrobeControl.setDefaultValue('GPIO')
write_strobe_control = comp.createComboSymbol('WriteStrobeControl', ControlPinsMenu, ['GPIO', 'Peripheral'])
WriteStrobeControl.setLabel('WR# Control')
WriteStrobeControl.setDescription('Write Strobe Control')
WriteStrobeControl.setDefaultValue('GPIO')
dcx_address_bit = comp.createIntegerSymbol('DCXAddressBit', DataCommandSelectControl)
DCXAddressBit.setLabel('DCX Address Bit')
DCXAddressBit.setDescription('Address bit used for DCX signal.')
DCXAddressBit.setDefaultValue(12)
DCXAddressBit.setMin(0)
DCXAddressBit.setMax(31)
def configure_smc_component(comp, smcComponent):
print('Configuring SMC')
smc_chip_sel_num = comp.getSymbolValue('EBIChipSelectIndex')
smcComponent.setSymbolValue('SMC_CHIP_SELECT' + str(smcChipSelNum), True, 1)
smcComponent.setSymbolValue('SMC_MEM_SCRAMBLING_CS' + str(smcChipSelNum), False, 1)
smcComponent.setSymbolValue('SMC_NWE_SETUP_CS' + str(smcChipSelNum), 4, 1)
smcComponent.setSymbolValue('SMC_NCS_WR_SETUP_CS' + str(smcChipSelNum), 0, 1)
smcComponent.setSymbolValue('SMC_NWE_PULSE_CS' + str(smcChipSelNum), 4, 1)
smcComponent.setSymbolValue('SMC_NCS_WR_PULSE_CS' + str(smcChipSelNum), 10, 1)
smcComponent.setSymbolValue('SMC_DATA_BUS_CS' + str(smcChipSelNum), 1, 1)
smcComponent.setSymbolValue('SMC_NWE_CYCLE_CS' + str(smcChipSelNum), 3, 1)
smcComponent.setSymbolValue('SMC_NRD_SETUP_CS' + str(smcChipSelNum), 2, 1)
smcComponent.setSymbolValue('SMC_NCS_RD_SETUP_CS' + str(smcChipSelNum), 0, 1)
smcComponent.setSymbolValue('SMC_NRD_PULSE_CS' + str(smcChipSelNum), 63, 1)
smcComponent.setSymbolValue('SMC_NCS_RD_PULSE_CS' + str(smcChipSelNum), 63, 1)
smcComponent.setSymbolValue('SMC_NRD_CYCLE_CS' + str(smcChipSelNum), 110, 1)
smcComponent.setSymbolValue('SMC_DATA_BUS_CS' + str(smcChipSelNum), 1, 1)
smcComponent.setSymbolValue('SMC_BAT_CS' + str(smcChipSelNum), 0, 1)
smcComponent.setSymbolValue('SMC_READ_ENABLE_MODE_CS' + str(smcChipSelNum), True, 1)
smcComponent.setSymbolValue('SMC_WRITE_ENABLE_MODE_CS' + str(smcChipSelNum), False, 1)
def on_data_command_select_set(sourceSymbol, event):
if sourceSymbol.getComponent().getSymbolByID('DataCommandSelectControl').getValue() == 'GPIO':
sourceSymbol.getComponent().getSymbolByID('DCXAddressBit').setVisible(False)
else:
sourceSymbol.getComponent().getSymbolByID('DCXAddressBit').setVisible(True)
def on_interface_type_changed(sourceSymbol, event):
print('Interface type changed')
def on_attachment_connected(source, target):
if source['id'] == 'SMC_CS':
configure_smc_component(source['component'], target['component']) |
input_numbers = input('Enter numbers separated by a space : ').split()
max = int(input_numbers[0])
min = int(input_numbers[0])
avg = 0
sum = 0
for i in range(0, len(input_numbers)):
input_numbers[i] = int(input_numbers[i])
sum = sum + input_numbers[i]
if input_numbers[i] > max:
max = input_numbers[i]
if input_numbers[i] < min:
min = input_numbers[i]
avg = sum / len(input_numbers)
print (max, min, avg) | input_numbers = input('Enter numbers separated by a space : ').split()
max = int(input_numbers[0])
min = int(input_numbers[0])
avg = 0
sum = 0
for i in range(0, len(input_numbers)):
input_numbers[i] = int(input_numbers[i])
sum = sum + input_numbers[i]
if input_numbers[i] > max:
max = input_numbers[i]
if input_numbers[i] < min:
min = input_numbers[i]
avg = sum / len(input_numbers)
print(max, min, avg) |
'''3. Write a Python program to print the square and cube symbol in the
area of a rectangle and volume of a cylinder.
Sample output:
The area of the rectangle is 1256.66cm2
The volume of the cylinder is 1254.725cm3'''
area = 1256.66
volume = 1254.725
print(f"The area of the rectangle is {round(area, 2)}cm2")
print(f"The volume of the cylinder is {round(volume, 3)}cm3") | """3. Write a Python program to print the square and cube symbol in the
area of a rectangle and volume of a cylinder.
Sample output:
The area of the rectangle is 1256.66cm2
The volume of the cylinder is 1254.725cm3"""
area = 1256.66
volume = 1254.725
print(f'The area of the rectangle is {round(area, 2)}cm2')
print(f'The volume of the cylinder is {round(volume, 3)}cm3') |
#!/usr/bin/env python3
def clear_screen(lines=128):
if not isinstance(lines, int) or lines < 64:
lines = 64
print( '\n' * lines, end='' )
class Player:
def __init__(self, n):
self.score = 0
self.name = n
self.attack1 = ''
self.attack2 = ''
self.guard = ''
def step(self):
clear_screen()
print(self.name + '\'s turn:')
self.attack1 = ''
self.attack2 = ''
while len(self.attack1) <= 0 or len(self.attack2) <= 0:
print()
a = ''
if len(self.attack1) <= 0:
print('High or Low?')
if len(self.attack2) <= 0:
print('Left or Right?')
while len(a) <= 0:
a = input('Attack: ').lower()
# test input
if 'hi' in a:
self.attack1 = 'high'
elif 'lo' in a:
self.attack1 = 'low'
if 'le' in a:
self.attack2 = 'left'
elif 'ri' in a:
self.attack2 = 'right'
self.guard = ''
while len(self.guard) <= 0:
print()
a = ''
print('High, Low, Left, or Right?')
while len(a) <= 0:
a = input('Guard: ').lower()
# test input
if 'hi' in a:
self.guard = 'high'
elif 'lo' in a:
self.guard = 'low'
elif 'le' in a:
self.guard = 'left'
elif 'ri' in a:
self.guard = 'right'
clear_screen()
def attack(self, p):
print(self.name + ' attacks ' + p.name + ' with a ' + self.attack1 + ' ' + self.attack2 + '.')
print(p.name + ' guards ' + p.guard + '.')
if (self.attack1 != p.guard) and (self.attack2 != p.guard):
print('HIT!')
self.score += 1
else:
print('BLOCK!')
print()
class Engine:
def __init__(self):
self.players = list()
x = input("How many players?: ")
print()
try:
numOfPlayers = int(x)
except ValueError:
numOfPlayers = 2
if numOfPlayers > 8:
numOfPlayers = 8
elif numOfPlayers < 2:
numOfPlayers = 2
print('Setting to '+ str(numOfPlayers) +' players.\n')
x = 1
print('(Player Names)')
while len(self.players) < numOfPlayers:
a = input('Player '+str(x)+': ')
if len(a) > 0:
self.players.append(Player(a))
x += 1
print()
self.rounds = None
while not isinstance(self.rounds, int) or self.rounds < 1:
self.rounds = input('# of Rounds: ')
try:
self.rounds = int(self.rounds)
except ValueError:
self.rounds = None
self.roundsC = self.rounds
input("\nNOTE: You only need the first two letters. (HI LO LE RI) ")
def mainloop(self):
if len(self.players) > 1:
self.running = True
self.roundsC = self.rounds
for p in self.players:
p.score = 0
while self.running and self.roundsC > 0:
clear_screen()
print('Round ' + str((self.rounds - self.roundsC) + 1) + ':')
input('\n( Begin ) ...')
for p in self.players:
p.step()
# process player attacks
for p in self.players:
for q in self.players:
if p != q:
p.attack(q)
# display scores
for p in self.players:
print(p.name + ': ' + str(p.score))
a = ''
while 'ok' not in a:
a = input('\n( Type "ok" ) ').lower()
self.roundsC -= 1
print('\nFinal scores:\n')
for p in self.players:
print(p.name + ': ' + str(p.score) + '\n')
def main():
e = Engine()
e.mainloop()
if __name__=="__main__":
main()
| def clear_screen(lines=128):
if not isinstance(lines, int) or lines < 64:
lines = 64
print('\n' * lines, end='')
class Player:
def __init__(self, n):
self.score = 0
self.name = n
self.attack1 = ''
self.attack2 = ''
self.guard = ''
def step(self):
clear_screen()
print(self.name + "'s turn:")
self.attack1 = ''
self.attack2 = ''
while len(self.attack1) <= 0 or len(self.attack2) <= 0:
print()
a = ''
if len(self.attack1) <= 0:
print('High or Low?')
if len(self.attack2) <= 0:
print('Left or Right?')
while len(a) <= 0:
a = input('Attack: ').lower()
if 'hi' in a:
self.attack1 = 'high'
elif 'lo' in a:
self.attack1 = 'low'
if 'le' in a:
self.attack2 = 'left'
elif 'ri' in a:
self.attack2 = 'right'
self.guard = ''
while len(self.guard) <= 0:
print()
a = ''
print('High, Low, Left, or Right?')
while len(a) <= 0:
a = input('Guard: ').lower()
if 'hi' in a:
self.guard = 'high'
elif 'lo' in a:
self.guard = 'low'
elif 'le' in a:
self.guard = 'left'
elif 'ri' in a:
self.guard = 'right'
clear_screen()
def attack(self, p):
print(self.name + ' attacks ' + p.name + ' with a ' + self.attack1 + ' ' + self.attack2 + '.')
print(p.name + ' guards ' + p.guard + '.')
if self.attack1 != p.guard and self.attack2 != p.guard:
print('HIT!')
self.score += 1
else:
print('BLOCK!')
print()
class Engine:
def __init__(self):
self.players = list()
x = input('How many players?: ')
print()
try:
num_of_players = int(x)
except ValueError:
num_of_players = 2
if numOfPlayers > 8:
num_of_players = 8
elif numOfPlayers < 2:
num_of_players = 2
print('Setting to ' + str(numOfPlayers) + ' players.\n')
x = 1
print('(Player Names)')
while len(self.players) < numOfPlayers:
a = input('Player ' + str(x) + ': ')
if len(a) > 0:
self.players.append(player(a))
x += 1
print()
self.rounds = None
while not isinstance(self.rounds, int) or self.rounds < 1:
self.rounds = input('# of Rounds: ')
try:
self.rounds = int(self.rounds)
except ValueError:
self.rounds = None
self.roundsC = self.rounds
input('\nNOTE: You only need the first two letters. (HI LO LE RI) ')
def mainloop(self):
if len(self.players) > 1:
self.running = True
self.roundsC = self.rounds
for p in self.players:
p.score = 0
while self.running and self.roundsC > 0:
clear_screen()
print('Round ' + str(self.rounds - self.roundsC + 1) + ':')
input('\n( Begin ) ...')
for p in self.players:
p.step()
for p in self.players:
for q in self.players:
if p != q:
p.attack(q)
for p in self.players:
print(p.name + ': ' + str(p.score))
a = ''
while 'ok' not in a:
a = input('\n( Type "ok" ) ').lower()
self.roundsC -= 1
print('\nFinal scores:\n')
for p in self.players:
print(p.name + ': ' + str(p.score) + '\n')
def main():
e = engine()
e.mainloop()
if __name__ == '__main__':
main() |
class Assert(object):
@staticmethod
def is_instance(instance, instances_class):
assert isinstance(instance, instances_class), '{0} should be an instance of class {1}'.format(
instance.__name__, instances_class.__name__
)
| class Assert(object):
@staticmethod
def is_instance(instance, instances_class):
assert isinstance(instance, instances_class), '{0} should be an instance of class {1}'.format(instance.__name__, instances_class.__name__) |
#Prime Number Checker
#Parker Dinkins
'''
This program asks for a number between 0 and 5000
If the number isn't in that range it asks for it again
When a proper number is entered it checks if it is prime
If the numbr is prime it prints the two factors
If the number is not prime it prints all the factors
Finally it asks if you want run the checker again or not
'''
# This function takes a number and prints the factors
def print_factors(x):
print("The factors of", x, "are:")
for i in range(1, x + 1):
if x % i == 0:
print(i)
print(x, "is NOT a prime number")
# this functoin check to see if a number is prime and if so prints that out
# if the numbe is not prime it pushes the user input variable into the print_factors function
def prime_checker():
try:
# user input
a = int(input("Enter a number between 0 and 5000: "))
# checks to make sure the number is within the specified range
if a > 5000:
# prints out and error if the check fails and reruns the function with clean memory
print('\n\t****ERROR****')
print('Enter a number between 0 and 5000\n')
return prime_checker()
# place hold variable
k = 0
# this finds the number of factors of the number
for i in range(1, a):
if a % i == 0:
k = k + 1
# this checks to see if the number has less than or one factor
# if the number satisfies this then it is prime and it prints out
if k <= 1:
print('The factors of your number are:')
print('1')
print(a, 'is a prime number')
# if the number has more than one factor it is not prime and it lands here
# the number is then put into the print_factors function
else:
print_factors(x=a)
# this handles the error when the user inputs something other than number into the input statement
except ValueError:
print('\n\t****Invalid*Input****\n\tPlease enter a number\n')
# loop variables
run = True
run1 = True
# first loop that runs the functions when the program one time when the program is opened
while run1:
prime_checker()
break
# second loop that asks the user if they want to run the program again or quit
while run:
option = input("\nContinue and run again? [y/n]: ").lower()
if option == "y":
prime_checker()
elif option == "n":
break
else:
print("\nNot a valid option. Please enter 'y' or 'n'")
| """
This program asks for a number between 0 and 5000
If the number isn't in that range it asks for it again
When a proper number is entered it checks if it is prime
If the numbr is prime it prints the two factors
If the number is not prime it prints all the factors
Finally it asks if you want run the checker again or not
"""
def print_factors(x):
print('The factors of', x, 'are:')
for i in range(1, x + 1):
if x % i == 0:
print(i)
print(x, 'is NOT a prime number')
def prime_checker():
try:
a = int(input('Enter a number between 0 and 5000: '))
if a > 5000:
print('\n\t****ERROR****')
print('Enter a number between 0 and 5000\n')
return prime_checker()
k = 0
for i in range(1, a):
if a % i == 0:
k = k + 1
if k <= 1:
print('The factors of your number are:')
print('1')
print(a, 'is a prime number')
else:
print_factors(x=a)
except ValueError:
print('\n\t****Invalid*Input****\n\tPlease enter a number\n')
run = True
run1 = True
while run1:
prime_checker()
break
while run:
option = input('\nContinue and run again? [y/n]: ').lower()
if option == 'y':
prime_checker()
elif option == 'n':
break
else:
print("\nNot a valid option. Please enter 'y' or 'n'") |
#!/usr/bin/env python3
# Write a program that computes the GC fraction of a DNA sequence in a window
# Window size is 11 nt
# Output with 4 significant figures using whichever method you prefer
# Use no nested loops. Instead, count only the first window
# Then 'move' the window by adding 1 letter on one side
# And subtracting 1 letter from the other side
# Describe the pros/cons of this algorith vs. nested loops
seq = 'ACGACGCAGGAGGAGAGTTTCAGAGATCACGAATACATCCATATTACCCAGAGAGAG'
w = 11
window = ""
count = 0
for i in range(w):
window += seq[i]
if seq[i] == 'G' or seq[i] == 'C':
count += 1
print(f'{0} {window} {count / w : .4f}')
for i in range(1, len(seq) - w + 1):
if window[0] == 'G' or window[0] == 'C':
count -= 1
if seq[i + w - 1] == 'G' or seq[i + w - 1] == 'C':
count += 1
window = window[1:] + seq[i + w - 1]
print(f'{i} {window} {count / w : .4f}')
| seq = 'ACGACGCAGGAGGAGAGTTTCAGAGATCACGAATACATCCATATTACCCAGAGAGAG'
w = 11
window = ''
count = 0
for i in range(w):
window += seq[i]
if seq[i] == 'G' or seq[i] == 'C':
count += 1
print(f'{0} {window} {count / w: .4f}')
for i in range(1, len(seq) - w + 1):
if window[0] == 'G' or window[0] == 'C':
count -= 1
if seq[i + w - 1] == 'G' or seq[i + w - 1] == 'C':
count += 1
window = window[1:] + seq[i + w - 1]
print(f'{i} {window} {count / w: .4f}') |
#!/usr/local/bin/python3
class Duet():
def __init__(self, instruction_list):
self.instruction_list = [ instruction.split() for instruction in instruction_list ]
self.program_counter = 0
self.registers = {}
self.played = None
self.nonZeroPlayed = False
self.__instr_set = {
'set': self.__set,
'add': self.__add,
'mul': self.__mul,
'mod': self.__mod,
'snd': self.__snd,
'rcv': self.__rcv,
'jgz': self.__jgz,
}
def __set(self, x, y):
if y.isalpha(): y = self.registers[y]
self.registers[x] = int(y)
def __add(self, x, y):
if y.isalpha(): y = self.registers[y]
self.registers[x] += int(y)
def __mul(self, x, y):
if y.isalpha(): y = self.registers[y]
self.registers[x] *= int(y)
def __mod(self, x, y):
if y.isalpha(): y = self.registers[y]
self.registers[x] %= int(y)
def __snd(self, x):
self.played = self.registers[x]
def __rcv(self, x):
if self.registers[x] != 0:
self.nonZeroPlayed = True
def __jgz(self, x, y):
if self.registers[x] > 0:
self.program_counter += int(y) - 1
def __exitCriteria(self):
if self.nonZeroPlayed:
return True
if self.program_counter >= len(self.instruction_list):
return True
return False
def __execute(self):
instruction = self.instruction_list[self.program_counter]
self.program_counter += 1
if instruction[1] not in self.registers:
self.registers[instruction[1]] = 0
self.__instr_set[instruction[0]](*instruction[1:])
def run(self):
while not self.__exitCriteria():
self.__execute()
with open("./input.txt") as f:
INPUT = f.readlines()
duet = Duet(INPUT)
duet.run()
print("Star 1: %s" % duet.played)
| class Duet:
def __init__(self, instruction_list):
self.instruction_list = [instruction.split() for instruction in instruction_list]
self.program_counter = 0
self.registers = {}
self.played = None
self.nonZeroPlayed = False
self.__instr_set = {'set': self.__set, 'add': self.__add, 'mul': self.__mul, 'mod': self.__mod, 'snd': self.__snd, 'rcv': self.__rcv, 'jgz': self.__jgz}
def __set(self, x, y):
if y.isalpha():
y = self.registers[y]
self.registers[x] = int(y)
def __add(self, x, y):
if y.isalpha():
y = self.registers[y]
self.registers[x] += int(y)
def __mul(self, x, y):
if y.isalpha():
y = self.registers[y]
self.registers[x] *= int(y)
def __mod(self, x, y):
if y.isalpha():
y = self.registers[y]
self.registers[x] %= int(y)
def __snd(self, x):
self.played = self.registers[x]
def __rcv(self, x):
if self.registers[x] != 0:
self.nonZeroPlayed = True
def __jgz(self, x, y):
if self.registers[x] > 0:
self.program_counter += int(y) - 1
def __exit_criteria(self):
if self.nonZeroPlayed:
return True
if self.program_counter >= len(self.instruction_list):
return True
return False
def __execute(self):
instruction = self.instruction_list[self.program_counter]
self.program_counter += 1
if instruction[1] not in self.registers:
self.registers[instruction[1]] = 0
self.__instr_set[instruction[0]](*instruction[1:])
def run(self):
while not self.__exitCriteria():
self.__execute()
with open('./input.txt') as f:
input = f.readlines()
duet = duet(INPUT)
duet.run()
print('Star 1: %s' % duet.played) |
NUM_ALLELES = 3
ALLELE_PRIOR = 1.0 / NUM_ALLELES
ALPHA = 1.5
MINUS_INFINITE = -1000000000
mBound = 6
jA = 10.0
jB = 0.5
pA = 0.1
pD = 0.1
pC = 1.0 - pD
pI = 0.1
if __name__ == '__main__':
print('This is a configuration file!')
| num_alleles = 3
allele_prior = 1.0 / NUM_ALLELES
alpha = 1.5
minus_infinite = -1000000000
m_bound = 6
j_a = 10.0
j_b = 0.5
p_a = 0.1
p_d = 0.1
p_c = 1.0 - pD
p_i = 0.1
if __name__ == '__main__':
print('This is a configuration file!') |
class A:
def feature1(self):
print("Feature 1 working")
def feature2(self):
print("Feature 2 working")
a1 = A()
a1.feature1()
class B(A):
def feature3(self):
print("feature 3 working")
def feature4(self):
print("feature 4 working")
b1 = B()
b1.feature2()
| class A:
def feature1(self):
print('Feature 1 working')
def feature2(self):
print('Feature 2 working')
a1 = a()
a1.feature1()
class B(A):
def feature3(self):
print('feature 3 working')
def feature4(self):
print('feature 4 working')
b1 = b()
b1.feature2() |
# Application Install Directory (Relative to Inside Container)
SNODAS_APP = '/app/cumulus/snodas/core'
# Archive of UNMASKED files downloaded from NSIDC
SNODAS_RAW_UNMASKED = '/app/data/snodas/raw_unmasked'
# Archive of MASKED files downloaded from NSIDC
SNODAS_RAW_MASKED = '/app/data/snodas/raw_masked'
| snodas_app = '/app/cumulus/snodas/core'
snodas_raw_unmasked = '/app/data/snodas/raw_unmasked'
snodas_raw_masked = '/app/data/snodas/raw_masked' |
expected_output = {
'vrf': {
'VRF501': {
'address_family': {
'ipv4': {
'routes': {
'192.168.111.1/32': {
'route': '192.168.111.1/32',
'active': True,
'source_protocol_codes': 'L',
'source_protocol': 'local',
'next_hop': {
'outgoing_interface': {
'Loopback501': {
'outgoing_interface': 'Loopback501',
'updated': '1d22h'
},
},
},
},
'192.168.4.0/24': {
'route': '192.168.4.0/24',
'active': True,
'source_protocol_codes': 'C',
'source_protocol': 'connected',
'next_hop': {
'outgoing_interface': {
'GigabitEthernet0/0/0/0.501': {
'outgoing_interface': 'GigabitEthernet0/0/0/0.501',
'updated': '20:03:59'
},
},
},
},
'192.168.4.1/32': {
'route': '192.168.4.1/32',
'active': True,
'source_protocol_codes': 'L',
'source_protocol': 'local',
'next_hop': {
'outgoing_interface': {
'GigabitEthernet0/0/0/0.501': {
'outgoing_interface': 'GigabitEthernet0/0/0/0.501',
'updated': '20:03:59'
},
},
},
},
},
},
},
'last_resort': {
'gateway': 'not set'
},
},
'VRF502': {
'address_family': {
'ipv4': {
'routes': {
'10.144.0.0/24': {
'route': '10.144.0.0/24',
'active': True,
'source_protocol_codes': 'B',
'source_protocol': 'bgp',
'route_preference': 20,
'metric': 0,
'next_hop': {
'next_hop_list': {
1: {
'index': 1,
'next_hop': '192.168.154.2',
'updated': '19:38:48'
},
},
},
},
'10.144.1.0/24': {
'route': '10.144.1.0/24',
'active': True,
'source_protocol_codes': 'B',
'source_protocol': 'bgp',
'route_preference': 20,
'metric': 0,
'next_hop': {
'next_hop_list': {
1: {
'index': 1,
'next_hop': '192.168.154.2',
'updated': '19:38:48'
},
},
},
},
'10.144.2.0/24': {
'route': '10.144.2.0/24',
'active': True,
'source_protocol_codes': 'B',
'source_protocol': 'bgp',
'route_preference': 20,
'metric': 0,
'next_hop': {
'next_hop_list': {
1: {
'index': 1,
'next_hop': '192.168.154.2',
'updated': '19:38:48'
},
},
},
},
'192.168.4.1/32': {
'route': '192.168.4.1/32',
'active': True,
'source_protocol_codes': 'L',
'source_protocol': 'local',
'next_hop': {
'outgoing_interface': {
'Loopback502': {
'outgoing_interface': 'Loopback502',
'updated': '1d22h'
},
},
},
},
'192.168.154.0/24': {
'route': '192.168.154.0/24',
'active': True,
'source_protocol_codes': 'C',
'source_protocol': 'connected',
'next_hop': {
'outgoing_interface': {
'GigabitEthernet0/0/0/0.502': {
'outgoing_interface': 'GigabitEthernet0/0/0/0.502',
'updated': '20:03:59'
},
},
},
},
'192.168.154.1/32': {
'route': '192.168.154.1/32',
'active': True,
'source_protocol_codes': 'L',
'source_protocol': 'local',
'next_hop': {
'outgoing_interface': {
'GigabitEthernet0/0/0/0.502': {
'outgoing_interface': 'GigabitEthernet0/0/0/0.502',
'updated': '20:03:59'
},
},
},
},
},
},
},
'last_resort': {
'gateway': 'not set'
},
},
},
}
| expected_output = {'vrf': {'VRF501': {'address_family': {'ipv4': {'routes': {'192.168.111.1/32': {'route': '192.168.111.1/32', 'active': True, 'source_protocol_codes': 'L', 'source_protocol': 'local', 'next_hop': {'outgoing_interface': {'Loopback501': {'outgoing_interface': 'Loopback501', 'updated': '1d22h'}}}}, '192.168.4.0/24': {'route': '192.168.4.0/24', 'active': True, 'source_protocol_codes': 'C', 'source_protocol': 'connected', 'next_hop': {'outgoing_interface': {'GigabitEthernet0/0/0/0.501': {'outgoing_interface': 'GigabitEthernet0/0/0/0.501', 'updated': '20:03:59'}}}}, '192.168.4.1/32': {'route': '192.168.4.1/32', 'active': True, 'source_protocol_codes': 'L', 'source_protocol': 'local', 'next_hop': {'outgoing_interface': {'GigabitEthernet0/0/0/0.501': {'outgoing_interface': 'GigabitEthernet0/0/0/0.501', 'updated': '20:03:59'}}}}}}}, 'last_resort': {'gateway': 'not set'}}, 'VRF502': {'address_family': {'ipv4': {'routes': {'10.144.0.0/24': {'route': '10.144.0.0/24', 'active': True, 'source_protocol_codes': 'B', 'source_protocol': 'bgp', 'route_preference': 20, 'metric': 0, 'next_hop': {'next_hop_list': {1: {'index': 1, 'next_hop': '192.168.154.2', 'updated': '19:38:48'}}}}, '10.144.1.0/24': {'route': '10.144.1.0/24', 'active': True, 'source_protocol_codes': 'B', 'source_protocol': 'bgp', 'route_preference': 20, 'metric': 0, 'next_hop': {'next_hop_list': {1: {'index': 1, 'next_hop': '192.168.154.2', 'updated': '19:38:48'}}}}, '10.144.2.0/24': {'route': '10.144.2.0/24', 'active': True, 'source_protocol_codes': 'B', 'source_protocol': 'bgp', 'route_preference': 20, 'metric': 0, 'next_hop': {'next_hop_list': {1: {'index': 1, 'next_hop': '192.168.154.2', 'updated': '19:38:48'}}}}, '192.168.4.1/32': {'route': '192.168.4.1/32', 'active': True, 'source_protocol_codes': 'L', 'source_protocol': 'local', 'next_hop': {'outgoing_interface': {'Loopback502': {'outgoing_interface': 'Loopback502', 'updated': '1d22h'}}}}, '192.168.154.0/24': {'route': '192.168.154.0/24', 'active': True, 'source_protocol_codes': 'C', 'source_protocol': 'connected', 'next_hop': {'outgoing_interface': {'GigabitEthernet0/0/0/0.502': {'outgoing_interface': 'GigabitEthernet0/0/0/0.502', 'updated': '20:03:59'}}}}, '192.168.154.1/32': {'route': '192.168.154.1/32', 'active': True, 'source_protocol_codes': 'L', 'source_protocol': 'local', 'next_hop': {'outgoing_interface': {'GigabitEthernet0/0/0/0.502': {'outgoing_interface': 'GigabitEthernet0/0/0/0.502', 'updated': '20:03:59'}}}}}}}, 'last_resort': {'gateway': 'not set'}}}} |
class Node:
def __init__(self, name=None, terminal=False):
self._name = name
self._children = []
self._level = None
self._terminal = terminal
# ====================
# GETTERS E SETTERS
@property
def name(self):
return self._name
@name.setter
def name(self, value):
self._name = value
@property
def terminal(self):
return self._terminal
@terminal.setter
def terminal(self, value):
self._terminal = value
@property
def level(self):
return self._level
@level.setter
def level(self, value):
self._level = value
@property
def children(self):
return self._children
@children.setter
def children(self, child):
self._children.append(child)
| class Node:
def __init__(self, name=None, terminal=False):
self._name = name
self._children = []
self._level = None
self._terminal = terminal
@property
def name(self):
return self._name
@name.setter
def name(self, value):
self._name = value
@property
def terminal(self):
return self._terminal
@terminal.setter
def terminal(self, value):
self._terminal = value
@property
def level(self):
return self._level
@level.setter
def level(self, value):
self._level = value
@property
def children(self):
return self._children
@children.setter
def children(self, child):
self._children.append(child) |
def get_all_includes(comp_args, dst_includes):
i = 0
while i < len(comp_args):
curr_arg = comp_args[i].strip()
if curr_arg == "-isystem":
curr_arg1 = "-I" + comp_args[i+1].strip()
if curr_arg1 not in dst_includes:
dst_includes.append(curr_arg1)
if curr_arg == "-include":
curr_arg1 = comp_args[i+1].strip()
if "dhd_sec_feature.h" not in curr_arg1:
final_arg = curr_arg + " " + curr_arg1
if final_arg not in dst_includes:
dst_includes.append(final_arg)
if curr_arg[0:2] == "-I":
if curr_arg not in dst_includes:
if 'drivers' not in curr_arg and 'sound' not in curr_arg:
dst_includes.append(curr_arg)
i += 1
| def get_all_includes(comp_args, dst_includes):
i = 0
while i < len(comp_args):
curr_arg = comp_args[i].strip()
if curr_arg == '-isystem':
curr_arg1 = '-I' + comp_args[i + 1].strip()
if curr_arg1 not in dst_includes:
dst_includes.append(curr_arg1)
if curr_arg == '-include':
curr_arg1 = comp_args[i + 1].strip()
if 'dhd_sec_feature.h' not in curr_arg1:
final_arg = curr_arg + ' ' + curr_arg1
if final_arg not in dst_includes:
dst_includes.append(final_arg)
if curr_arg[0:2] == '-I':
if curr_arg not in dst_includes:
if 'drivers' not in curr_arg and 'sound' not in curr_arg:
dst_includes.append(curr_arg)
i += 1 |
def push(data_json):
# A user pushes 1 or more commits to a repository.
repository = data_json['repository']
# repository_scm = repository['scm']
repository_name = repository['name']
repository_link = repository['links']['html']['href']
actor = data_json['actor']
actor_name = actor['display_name']
actor_profile = actor['links']['html']['href']
pushh = data_json['push']['changes'][0]
push_forced = pushh['forced']
push_created = pushh['created']
push_truncated = pushh['truncated']
push_closed = pushh['closed']
push_commits_all = pushh['commits']
commits_str = ""
for commit in push_commits_all:
commit_hash = commit['hash']
if len(commit_hash) > 7:
commit_hash = commit_hash[:7]
commit_link = commit['links']['html']['href']
# commit_summary = commit['summary']['raw']
commit_message = commit['message']
# commit_author_name = commit['author']['user']['display_name']
# commit_author_link = commit['author']['user']['links']['html']['href']
commits_str += '\n\t#{} [{}]({}) \n=> _{}_'.format(push_commits_all.index(commit),
commit_hash, commit_link,
commit_message)
push_link = pushh['links']['html']['href']
push_new = pushh['new']
push_old = pushh['old']
message = "[{}]({}) pushed to [{}]({})" \
" \nCompare: [compare]({})" \
" \nCommits: \n{}".format(actor_name,
actor_profile,
repository_name,
repository_link,
push_link,
commits_str
)
return message
| def push(data_json):
repository = data_json['repository']
repository_name = repository['name']
repository_link = repository['links']['html']['href']
actor = data_json['actor']
actor_name = actor['display_name']
actor_profile = actor['links']['html']['href']
pushh = data_json['push']['changes'][0]
push_forced = pushh['forced']
push_created = pushh['created']
push_truncated = pushh['truncated']
push_closed = pushh['closed']
push_commits_all = pushh['commits']
commits_str = ''
for commit in push_commits_all:
commit_hash = commit['hash']
if len(commit_hash) > 7:
commit_hash = commit_hash[:7]
commit_link = commit['links']['html']['href']
commit_message = commit['message']
commits_str += '\n\t#{} [{}]({}) \n=> _{}_'.format(push_commits_all.index(commit), commit_hash, commit_link, commit_message)
push_link = pushh['links']['html']['href']
push_new = pushh['new']
push_old = pushh['old']
message = '[{}]({}) pushed to [{}]({}) \nCompare: [compare]({}) \nCommits: \n{}'.format(actor_name, actor_profile, repository_name, repository_link, push_link, commits_str)
return message |
class LifeCycle:
def __init__(self, id, label, composed_of):
self.id = id
self.label = label
self.composed_of = composed_of
| class Lifecycle:
def __init__(self, id, label, composed_of):
self.id = id
self.label = label
self.composed_of = composed_of |
a = []
maximum = 0
for _ in range(6):
tmp = [int(x) for x in str(input()).split(" ")]
a.append(tmp)
for i in range(6):
for j in range(6):
if (j + 2 < 6) and (i + 2 < 6):
result = a[i][j] + a[i][j+1] + a[i][j+2] + a[i+1][j+1] + a[i+2][j] + a[i+2][j+1] + a[i+2][j+2]
if(result > maximum):
maximum = result
print(maximum) | a = []
maximum = 0
for _ in range(6):
tmp = [int(x) for x in str(input()).split(' ')]
a.append(tmp)
for i in range(6):
for j in range(6):
if j + 2 < 6 and i + 2 < 6:
result = a[i][j] + a[i][j + 1] + a[i][j + 2] + a[i + 1][j + 1] + a[i + 2][j] + a[i + 2][j + 1] + a[i + 2][j + 2]
if result > maximum:
maximum = result
print(maximum) |
def NumpyInList(array,l1):
for i in l1:
if i[0] == array[0] and i[1] == array[1]:
return True
return False
| def numpy_in_list(array, l1):
for i in l1:
if i[0] == array[0] and i[1] == array[1]:
return True
return False |
def create_matrix(size):
matrix = []
for _ in range(size):
matrix.append([int(x) for x in input().split()])
return matrix
def is_valid_cell(position, size):
row = position[0]
col = position[1]
return 0 <= row < size and 0 <= col < size
def print_matrix(matrix):
for row in matrix:
print(' '.join([str(x) for x in row]))
def count_alive_cells_and_sum_them(matrix, size):
alive_cells_count = 0
alive_cells_sum = 0
for r in range(size):
for c in range(size):
if matrix[r][c] > 0:
alive_cells_count += 1
alive_cells_sum += matrix[r][c]
return alive_cells_count, alive_cells_sum
size = int(input())
matrix = create_matrix(size)
base_matrix = matrix
bomb_coordinates = input().split()
target_rows = [-1, -1, -1, 0, 1, 1, 1, 0]
target_cols = [-1, 0, 1, 1, 1, 0, -1, -1]
for row_col in bomb_coordinates:
tokens = row_col.split(',')
row, col = int(tokens[0]), int(tokens[1])
current_bomb = base_matrix[row][col]
if base_matrix[row][col] > 0:
for i in range(8):
bombed_cell_position = [row + target_rows[i], col + target_cols[i]]
if is_valid_cell(bombed_cell_position, size):
cell_row = bombed_cell_position[0]
cell_col = bombed_cell_position[1]
if matrix[cell_row][cell_col] > 0:
matrix[cell_row][cell_col] -= current_bomb
matrix[row][col] = 0
base_matrix[row][col] = 0
alive_cells_count, alive_cells_sum = count_alive_cells_and_sum_them(matrix, size)
print(f"Alive cells: {alive_cells_count}")
print(f"Sum: {alive_cells_sum}")
print_matrix(matrix)
| def create_matrix(size):
matrix = []
for _ in range(size):
matrix.append([int(x) for x in input().split()])
return matrix
def is_valid_cell(position, size):
row = position[0]
col = position[1]
return 0 <= row < size and 0 <= col < size
def print_matrix(matrix):
for row in matrix:
print(' '.join([str(x) for x in row]))
def count_alive_cells_and_sum_them(matrix, size):
alive_cells_count = 0
alive_cells_sum = 0
for r in range(size):
for c in range(size):
if matrix[r][c] > 0:
alive_cells_count += 1
alive_cells_sum += matrix[r][c]
return (alive_cells_count, alive_cells_sum)
size = int(input())
matrix = create_matrix(size)
base_matrix = matrix
bomb_coordinates = input().split()
target_rows = [-1, -1, -1, 0, 1, 1, 1, 0]
target_cols = [-1, 0, 1, 1, 1, 0, -1, -1]
for row_col in bomb_coordinates:
tokens = row_col.split(',')
(row, col) = (int(tokens[0]), int(tokens[1]))
current_bomb = base_matrix[row][col]
if base_matrix[row][col] > 0:
for i in range(8):
bombed_cell_position = [row + target_rows[i], col + target_cols[i]]
if is_valid_cell(bombed_cell_position, size):
cell_row = bombed_cell_position[0]
cell_col = bombed_cell_position[1]
if matrix[cell_row][cell_col] > 0:
matrix[cell_row][cell_col] -= current_bomb
matrix[row][col] = 0
base_matrix[row][col] = 0
(alive_cells_count, alive_cells_sum) = count_alive_cells_and_sum_them(matrix, size)
print(f'Alive cells: {alive_cells_count}')
print(f'Sum: {alive_cells_sum}')
print_matrix(matrix) |
(rows_count, columns_count) = map(int, input().split())
matrix = []
new_matrix = []
player_position = []
player_wins = False
for i in range(rows_count):
row = [x for x in input()]
if "P" in row:
player_position = [i, row.index("P")]
row[row.index("P")] = "."
row2 = row.copy()
matrix.append(row)
new_matrix.append(row2)
commands = list(input())
for command in commands:
next_player_position = []
if command == "U":
next_player_position = [player_position[0] - 1, player_position[1]]
elif command == "D":
next_player_position = [player_position[0] + 1, player_position[1]]
elif command == "L":
next_player_position = [player_position[0], player_position[1] - 1]
elif command == "R":
next_player_position = [player_position[0], player_position[1] + 1]
for r in range(rows_count):
for ch in range(columns_count):
if matrix[r][ch] == "B":
if r - 1 >= 0:
new_matrix[r - 1][ch] = "B"
if ch - 1 >= 0:
new_matrix[r][ch - 1] = "B"
if ch + 1 < columns_count:
new_matrix[r][ch + 1] = "B"
if r + 1 < rows_count:
new_matrix[r + 1][ch] = "B"
matrix = [x.copy() for x in new_matrix]
if 0 <= next_player_position[0] <= rows_count - 1 and 0 <= next_player_position[1] <= columns_count - 1:
player_position = next_player_position
if matrix[player_position[0]][player_position[1]] == "B":
break
else:
player_wins = True
break
[print("".join(x)) for x in matrix]
if player_wins:
print(f"won: {player_position[0]} {player_position[1]}")
else:
print(f"dead: {player_position[0]} {player_position[1]}")
| (rows_count, columns_count) = map(int, input().split())
matrix = []
new_matrix = []
player_position = []
player_wins = False
for i in range(rows_count):
row = [x for x in input()]
if 'P' in row:
player_position = [i, row.index('P')]
row[row.index('P')] = '.'
row2 = row.copy()
matrix.append(row)
new_matrix.append(row2)
commands = list(input())
for command in commands:
next_player_position = []
if command == 'U':
next_player_position = [player_position[0] - 1, player_position[1]]
elif command == 'D':
next_player_position = [player_position[0] + 1, player_position[1]]
elif command == 'L':
next_player_position = [player_position[0], player_position[1] - 1]
elif command == 'R':
next_player_position = [player_position[0], player_position[1] + 1]
for r in range(rows_count):
for ch in range(columns_count):
if matrix[r][ch] == 'B':
if r - 1 >= 0:
new_matrix[r - 1][ch] = 'B'
if ch - 1 >= 0:
new_matrix[r][ch - 1] = 'B'
if ch + 1 < columns_count:
new_matrix[r][ch + 1] = 'B'
if r + 1 < rows_count:
new_matrix[r + 1][ch] = 'B'
matrix = [x.copy() for x in new_matrix]
if 0 <= next_player_position[0] <= rows_count - 1 and 0 <= next_player_position[1] <= columns_count - 1:
player_position = next_player_position
if matrix[player_position[0]][player_position[1]] == 'B':
break
else:
player_wins = True
break
[print(''.join(x)) for x in matrix]
if player_wins:
print(f'won: {player_position[0]} {player_position[1]}')
else:
print(f'dead: {player_position[0]} {player_position[1]}') |
coordinates_FFFFCC = ((149, 117),
(149, 118), (149, 119), (149, 120), (149, 121), (149, 122), (149, 123), (149, 124), (149, 125), (149, 126), (149, 127), (149, 128), (149, 129), (149, 130), (150, 111), (150, 112), (150, 113), (150, 114), (150, 115), (150, 116), (150, 131), (150, 133), (151, 107), (151, 108), (151, 109), (151, 110), (151, 117), (151, 118), (151, 119), (151, 120), (151, 121), (151, 122), (151, 123), (151, 124), (151, 125), (151, 126), (151, 127), (151, 128), (151, 129), (151, 130), (151, 135), (152, 104), (152, 106), (152, 111), (152, 112), (152, 113), (152, 114), (152, 115), (152, 116), (152, 117), (152, 118), (152, 119), (152, 120), (152, 121), (152, 122), (152, 123), (152, 124), (152, 125), (152, 126), (152, 127), (152, 128), (152, 129), (152, 130), (152, 131), (152, 132), (152, 133), (152, 137), (153, 102), (153, 103), (153, 107), (153, 108), (153, 109), (153, 110),
(153, 111), (153, 112), (153, 113), (153, 114), (153, 115), (153, 116), (153, 117), (153, 118), (153, 119), (153, 120), (153, 121), (153, 122), (153, 123), (153, 124), (153, 125), (153, 126), (153, 127), (153, 128), (153, 129), (153, 130), (153, 131), (153, 132), (153, 133), (153, 134), (153, 135), (153, 139), (154, 96), (154, 97), (154, 98), (154, 99), (154, 100), (154, 104), (154, 105), (154, 106), (154, 107), (154, 108), (154, 109), (154, 110), (154, 111), (154, 112), (154, 113), (154, 114), (154, 115), (154, 116), (154, 117), (154, 118), (154, 119), (154, 120), (154, 121), (154, 122), (154, 123), (154, 124), (154, 125), (154, 126), (154, 127), (154, 128), (154, 129), (154, 130), (154, 131), (154, 132), (154, 133), (154, 134), (154, 135), (154, 136), (154, 137), (154, 141), (155, 91), (155, 93), (155, 94), (155, 95), (155, 102), (155, 103),
(155, 104), (155, 105), (155, 106), (155, 107), (155, 108), (155, 109), (155, 110), (155, 111), (155, 112), (155, 113), (155, 114), (155, 115), (155, 116), (155, 117), (155, 118), (155, 119), (155, 120), (155, 121), (155, 122), (155, 123), (155, 124), (155, 125), (155, 126), (155, 127), (155, 128), (155, 129), (155, 130), (155, 131), (155, 132), (155, 133), (155, 134), (155, 135), (155, 136), (155, 137), (155, 138), (155, 139), (155, 143), (156, 90), (156, 96), (156, 97), (156, 98), (156, 99), (156, 100), (156, 101), (156, 102), (156, 103), (156, 104), (156, 105), (156, 106), (156, 107), (156, 108), (156, 109), (156, 110), (156, 111), (156, 112), (156, 113), (156, 114), (156, 115), (156, 116), (156, 117), (156, 118), (156, 119), (156, 120), (156, 121), (156, 122), (156, 123), (156, 124), (156, 125), (156, 126), (156, 127), (156, 128), (156, 129),
(156, 130), (156, 131), (156, 132), (156, 133), (156, 134), (156, 135), (156, 136), (156, 137), (156, 138), (156, 139), (156, 140), (156, 141), (156, 145), (157, 89), (157, 91), (157, 92), (157, 93), (157, 94), (157, 95), (157, 96), (157, 97), (157, 98), (157, 99), (157, 100), (157, 101), (157, 102), (157, 103), (157, 104), (157, 105), (157, 106), (157, 107), (157, 108), (157, 109), (157, 110), (157, 111), (157, 112), (157, 113), (157, 114), (157, 115), (157, 116), (157, 117), (157, 118), (157, 119), (157, 120), (157, 121), (157, 122), (157, 123), (157, 124), (157, 125), (157, 126), (157, 127), (157, 128), (157, 129), (157, 130), (157, 131), (157, 132), (157, 133), (157, 134), (157, 135), (157, 136), (157, 137), (157, 138), (157, 139), (157, 140), (157, 141), (157, 142), (157, 143), (157, 146), (158, 89), (158, 91), (158, 92), (158, 93),
(158, 94), (158, 95), (158, 96), (158, 97), (158, 98), (158, 99), (158, 100), (158, 101), (158, 102), (158, 103), (158, 104), (158, 105), (158, 106), (158, 107), (158, 108), (158, 109), (158, 110), (158, 111), (158, 112), (158, 113), (158, 114), (158, 115), (158, 116), (158, 117), (158, 118), (158, 119), (158, 120), (158, 121), (158, 122), (158, 123), (158, 124), (158, 125), (158, 126), (158, 127), (158, 128), (158, 129), (158, 130), (158, 131), (158, 132), (158, 133), (158, 134), (158, 135), (158, 136), (158, 137), (158, 138), (158, 139), (158, 140), (158, 141), (158, 142), (158, 143), (158, 144), (158, 146), (159, 89), (159, 91), (159, 92), (159, 93), (159, 94), (159, 95), (159, 96), (159, 97), (159, 98), (159, 99), (159, 100), (159, 101), (159, 102), (159, 103), (159, 104), (159, 105), (159, 106), (159, 107), (159, 108), (159, 109),
(159, 110), (159, 111), (159, 112), (159, 113), (159, 114), (159, 115), (159, 116), (159, 117), (159, 118), (159, 119), (159, 120), (159, 121), (159, 122), (159, 123), (159, 124), (159, 125), (159, 126), (159, 127), (159, 128), (159, 129), (159, 130), (159, 131), (159, 132), (159, 133), (159, 134), (159, 135), (159, 136), (159, 137), (159, 138), (159, 139), (159, 140), (159, 141), (159, 142), (159, 146), (160, 88), (160, 90), (160, 91), (160, 92), (160, 93), (160, 94), (160, 95), (160, 96), (160, 97), (160, 98), (160, 99), (160, 100), (160, 101), (160, 102), (160, 103), (160, 104), (160, 105), (160, 106), (160, 107), (160, 108), (160, 109), (160, 110), (160, 111), (160, 112), (160, 113), (160, 114), (160, 115), (160, 116), (160, 117), (160, 118), (160, 119), (160, 120), (160, 121), (160, 122), (160, 123), (160, 124), (160, 125), (160, 126),
(160, 127), (160, 128), (160, 129), (160, 130), (160, 131), (160, 132), (160, 133), (160, 134), (160, 135), (160, 136), (160, 137), (160, 138), (160, 139), (160, 140), (160, 141), (160, 145), (161, 86), (161, 89), (161, 90), (161, 91), (161, 92), (161, 93), (161, 94), (161, 95), (161, 96), (161, 97), (161, 98), (161, 99), (161, 100), (161, 101), (161, 102), (161, 103), (161, 104), (161, 105), (161, 106), (161, 107), (161, 108), (161, 109), (161, 110), (161, 111), (161, 112), (161, 113), (161, 114), (161, 115), (161, 116), (161, 117), (161, 118), (161, 119), (161, 120), (161, 121), (161, 122), (161, 123), (161, 124), (161, 125), (161, 126), (161, 127), (161, 128), (161, 129), (161, 130), (161, 131), (161, 132), (161, 133), (161, 134), (161, 135), (161, 136), (161, 137), (161, 138), (161, 139), (161, 140), (161, 142), (162, 84), (162, 85),
(162, 88), (162, 89), (162, 90), (162, 91), (162, 92), (162, 93), (162, 94), (162, 95), (162, 96), (162, 97), (162, 98), (162, 99), (162, 100), (162, 101), (162, 102), (162, 103), (162, 104), (162, 105), (162, 106), (162, 107), (162, 108), (162, 109), (162, 110), (162, 111), (162, 112), (162, 113), (162, 114), (162, 115), (162, 116), (162, 117), (162, 118), (162, 119), (162, 120), (162, 121), (162, 122), (162, 123), (162, 124), (162, 125), (162, 126), (162, 127), (162, 128), (162, 129), (162, 130), (162, 131), (162, 132), (162, 133), (162, 134), (162, 135), (162, 136), (162, 137), (162, 138), (162, 139), (162, 141), (163, 81), (163, 82), (163, 83), (163, 86), (163, 87), (163, 88), (163, 89), (163, 90), (163, 91), (163, 92), (163, 93), (163, 94), (163, 95), (163, 96), (163, 97), (163, 98), (163, 99), (163, 100), (163, 101),
(163, 102), (163, 103), (163, 104), (163, 105), (163, 106), (163, 107), (163, 108), (163, 109), (163, 110), (163, 111), (163, 112), (163, 113), (163, 114), (163, 115), (163, 116), (163, 117), (163, 118), (163, 119), (163, 120), (163, 121), (163, 122), (163, 123), (163, 124), (163, 125), (163, 126), (163, 127), (163, 128), (163, 129), (163, 130), (163, 131), (163, 132), (163, 133), (163, 134), (163, 135), (163, 136), (163, 137), (163, 138), (163, 140), (164, 76), (164, 77), (164, 78), (164, 79), (164, 84), (164, 85), (164, 86), (164, 87), (164, 88), (164, 89), (164, 90), (164, 91), (164, 92), (164, 93), (164, 94), (164, 95), (164, 96), (164, 97), (164, 98), (164, 99), (164, 100), (164, 101), (164, 102), (164, 103), (164, 104), (164, 105), (164, 106), (164, 107), (164, 108), (164, 109), (164, 110), (164, 111), (164, 112), (164, 113),
(164, 114), (164, 115), (164, 116), (164, 117), (164, 118), (164, 119), (164, 120), (164, 121), (164, 122), (164, 123), (164, 124), (164, 125), (164, 126), (164, 127), (164, 128), (164, 129), (164, 130), (164, 131), (164, 132), (164, 133), (164, 134), (164, 135), (164, 136), (164, 137), (164, 139), (165, 74), (165, 75), (165, 80), (165, 81), (165, 82), (165, 83), (165, 84), (165, 85), (165, 86), (165, 87), (165, 88), (165, 89), (165, 90), (165, 91), (165, 92), (165, 93), (165, 94), (165, 95), (165, 96), (165, 97), (165, 98), (165, 99), (165, 100), (165, 101), (165, 102), (165, 103), (165, 104), (165, 105), (165, 106), (165, 107), (165, 108), (165, 109), (165, 110), (165, 111), (165, 112), (165, 113), (165, 114), (165, 115), (165, 116), (165, 117), (165, 118), (165, 119), (165, 120), (165, 121), (165, 122), (165, 123), (165, 124),
(165, 125), (165, 126), (165, 127), (165, 128), (165, 129), (165, 130), (165, 131), (165, 132), (165, 133), (165, 134), (165, 135), (165, 136), (166, 72), (166, 76), (166, 77), (166, 78), (166, 79), (166, 80), (166, 81), (166, 82), (166, 83), (166, 84), (166, 85), (166, 86), (166, 87), (166, 88), (166, 89), (166, 90), (166, 91), (166, 92), (166, 93), (166, 94), (166, 95), (166, 96), (166, 97), (166, 98), (166, 99), (166, 100), (166, 101), (166, 102), (166, 103), (166, 104), (166, 105), (166, 106), (166, 107), (166, 108), (166, 109), (166, 110), (166, 111), (166, 112), (166, 113), (166, 114), (166, 115), (166, 116), (166, 117), (166, 118), (166, 119), (166, 120), (166, 121), (166, 122), (166, 123), (166, 124), (166, 125), (166, 126), (166, 127), (166, 128), (166, 129), (166, 130), (166, 131), (166, 132), (166, 133), (166, 134),
(166, 135), (166, 136), (166, 138), (167, 70), (167, 74), (167, 75), (167, 76), (167, 77), (167, 78), (167, 79), (167, 80), (167, 81), (167, 82), (167, 83), (167, 84), (167, 85), (167, 86), (167, 87), (167, 88), (167, 89), (167, 90), (167, 91), (167, 92), (167, 93), (167, 94), (167, 95), (167, 96), (167, 97), (167, 98), (167, 99), (167, 100), (167, 101), (167, 102), (167, 103), (167, 104), (167, 105), (167, 106), (167, 107), (167, 108), (167, 109), (167, 110), (167, 111), (167, 112), (167, 113), (167, 114), (167, 115), (167, 116), (167, 117), (167, 118), (167, 119), (167, 120), (167, 121), (167, 122), (167, 123), (167, 124), (167, 125), (167, 126), (167, 127), (167, 128), (167, 129), (167, 130), (167, 131), (167, 132), (167, 133), (167, 134), (167, 135), (167, 137), (168, 68), (168, 69), (168, 72), (168, 73), (168, 74),
(168, 75), (168, 76), (168, 77), (168, 78), (168, 79), (168, 80), (168, 81), (168, 82), (168, 83), (168, 84), (168, 85), (168, 86), (168, 87), (168, 88), (168, 89), (168, 90), (168, 91), (168, 92), (168, 93), (168, 94), (168, 95), (168, 96), (168, 97), (168, 98), (168, 99), (168, 100), (168, 101), (168, 102), (168, 103), (168, 104), (168, 105), (168, 106), (168, 107), (168, 108), (168, 109), (168, 110), (168, 111), (168, 112), (168, 113), (168, 114), (168, 115), (168, 116), (168, 117), (168, 118), (168, 119), (168, 120), (168, 121), (168, 122), (168, 123), (168, 124), (168, 125), (168, 126), (168, 127), (168, 128), (168, 129), (168, 130), (168, 131), (168, 132), (168, 133), (168, 134), (168, 136), (169, 67), (169, 70), (169, 71), (169, 72), (169, 73), (169, 74), (169, 75), (169, 76), (169, 77), (169, 78), (169, 79),
(169, 80), (169, 81), (169, 82), (169, 83), (169, 84), (169, 85), (169, 86), (169, 87), (169, 88), (169, 89), (169, 90), (169, 91), (169, 92), (169, 93), (169, 94), (169, 95), (169, 96), (169, 97), (169, 98), (169, 99), (169, 100), (169, 101), (169, 102), (169, 103), (169, 104), (169, 105), (169, 106), (169, 107), (169, 108), (169, 109), (169, 110), (169, 111), (169, 112), (169, 113), (169, 114), (169, 115), (169, 116), (169, 117), (169, 118), (169, 119), (169, 120), (169, 121), (169, 122), (169, 123), (169, 124), (169, 125), (169, 126), (169, 127), (169, 128), (169, 129), (169, 130), (169, 131), (169, 132), (169, 133), (169, 135), (170, 65), (170, 68), (170, 69), (170, 70), (170, 71), (170, 72), (170, 73), (170, 74), (170, 75), (170, 76), (170, 77), (170, 78), (170, 79), (170, 80), (170, 81), (170, 82), (170, 83),
(170, 84), (170, 85), (170, 86), (170, 87), (170, 88), (170, 89), (170, 90), (170, 91), (170, 92), (170, 93), (170, 94), (170, 95), (170, 96), (170, 97), (170, 98), (170, 99), (170, 100), (170, 101), (170, 102), (170, 103), (170, 104), (170, 105), (170, 106), (170, 107), (170, 108), (170, 109), (170, 110), (170, 111), (170, 112), (170, 113), (170, 114), (170, 115), (170, 116), (170, 117), (170, 118), (170, 119), (170, 120), (170, 121), (170, 122), (170, 123), (170, 124), (170, 125), (170, 126), (170, 127), (170, 128), (170, 129), (170, 130), (170, 131), (170, 132), (170, 133), (170, 135), (171, 64), (171, 67), (171, 68), (171, 69), (171, 70), (171, 71), (171, 72), (171, 73), (171, 74), (171, 75), (171, 76), (171, 77), (171, 78), (171, 79), (171, 80), (171, 81), (171, 82), (171, 83), (171, 84), (171, 85), (171, 86),
(171, 87), (171, 88), (171, 89), (171, 90), (171, 91), (171, 92), (171, 93), (171, 94), (171, 95), (171, 96), (171, 97), (171, 98), (171, 99), (171, 100), (171, 101), (171, 102), (171, 103), (171, 104), (171, 105), (171, 106), (171, 107), (171, 108), (171, 109), (171, 110), (171, 111), (171, 112), (171, 113), (171, 114), (171, 115), (171, 116), (171, 117), (171, 118), (171, 119), (171, 120), (171, 121), (171, 122), (171, 123), (171, 124), (171, 125), (171, 126), (171, 127), (171, 128), (171, 129), (171, 130), (171, 131), (171, 132), (171, 134), (172, 63), (172, 65), (172, 66), (172, 67), (172, 68), (172, 69), (172, 70), (172, 71), (172, 72), (172, 73), (172, 74), (172, 75), (172, 76), (172, 77), (172, 78), (172, 79), (172, 80), (172, 81), (172, 82), (172, 83), (172, 84), (172, 85), (172, 86), (172, 87), (172, 88),
(172, 89), (172, 90), (172, 91), (172, 92), (172, 93), (172, 94), (172, 95), (172, 96), (172, 97), (172, 98), (172, 99), (172, 100), (172, 101), (172, 102), (172, 103), (172, 104), (172, 105), (172, 106), (172, 107), (172, 108), (172, 109), (172, 110), (172, 111), (172, 112), (172, 113), (172, 114), (172, 115), (172, 116), (172, 117), (172, 118), (172, 119), (172, 120), (172, 121), (172, 122), (172, 123), (172, 124), (172, 125), (172, 126), (172, 127), (172, 128), (172, 129), (172, 130), (172, 131), (172, 133), (173, 61), (173, 64), (173, 65), (173, 66), (173, 67), (173, 68), (173, 69), (173, 70), (173, 71), (173, 72), (173, 73), (173, 74), (173, 75), (173, 76), (173, 77), (173, 78), (173, 79), (173, 80), (173, 81), (173, 82), (173, 83), (173, 84), (173, 85), (173, 86), (173, 87), (173, 88), (173, 89), (173, 90),
(173, 91), (173, 92), (173, 93), (173, 94), (173, 95), (173, 96), (173, 97), (173, 98), (173, 99), (173, 100), (173, 101), (173, 102), (173, 103), (173, 104), (173, 105), (173, 106), (173, 107), (173, 108), (173, 109), (173, 110), (173, 111), (173, 112), (173, 113), (173, 114), (173, 115), (173, 116), (173, 117), (173, 118), (173, 119), (173, 120), (173, 121), (173, 122), (173, 123), (173, 124), (173, 125), (173, 126), (173, 127), (173, 128), (173, 129), (173, 130), (173, 132), (174, 60), (174, 63), (174, 64), (174, 65), (174, 66), (174, 67), (174, 68), (174, 69), (174, 70), (174, 71), (174, 72), (174, 73), (174, 74), (174, 75), (174, 76), (174, 77), (174, 78), (174, 79), (174, 80), (174, 81), (174, 82), (174, 83), (174, 84), (174, 85), (174, 86), (174, 87), (174, 88), (174, 89), (174, 90), (174, 91), (174, 92),
(174, 93), (174, 94), (174, 95), (174, 96), (174, 97), (174, 100), (174, 101), (174, 102), (174, 103), (174, 104), (174, 105), (174, 106), (174, 107), (174, 108), (174, 109), (174, 110), (174, 111), (174, 112), (174, 113), (174, 114), (174, 115), (174, 116), (174, 117), (174, 118), (174, 119), (174, 120), (174, 121), (174, 122), (174, 123), (174, 124), (174, 125), (174, 126), (174, 127), (174, 128), (174, 129), (174, 130), (174, 132), (175, 59), (175, 61), (175, 62), (175, 63), (175, 64), (175, 65), (175, 66), (175, 67), (175, 68), (175, 69), (175, 70), (175, 71), (175, 72), (175, 73), (175, 74), (175, 75), (175, 76), (175, 77), (175, 78), (175, 79), (175, 80), (175, 81), (175, 82), (175, 83), (175, 84), (175, 85), (175, 86), (175, 87), (175, 88), (175, 89), (175, 90), (175, 91), (175, 92), (175, 97), (175, 98),
(175, 99), (175, 102), (175, 103), (175, 104), (175, 105), (175, 106), (175, 107), (175, 108), (175, 109), (175, 110), (175, 111), (175, 112), (175, 113), (175, 114), (175, 115), (175, 116), (175, 117), (175, 118), (175, 119), (175, 120), (175, 121), (175, 122), (175, 123), (175, 124), (175, 125), (175, 126), (175, 127), (175, 128), (175, 129), (175, 131), (176, 57), (176, 60), (176, 61), (176, 62), (176, 63), (176, 64), (176, 65), (176, 66), (176, 67), (176, 68), (176, 69), (176, 70), (176, 71), (176, 72), (176, 73), (176, 74), (176, 75), (176, 76), (176, 77), (176, 78), (176, 79), (176, 80), (176, 81), (176, 82), (176, 83), (176, 84), (176, 85), (176, 86), (176, 87), (176, 88), (176, 89), (176, 90), (176, 93), (176, 94), (176, 95), (176, 96), (176, 100), (176, 101), (176, 102), (176, 103), (176, 104), (176, 105),
(176, 106), (176, 107), (176, 108), (176, 109), (176, 110), (176, 111), (176, 112), (176, 113), (176, 114), (176, 115), (176, 116), (176, 117), (176, 118), (176, 119), (176, 120), (176, 121), (176, 122), (176, 123), (176, 124), (176, 125), (176, 126), (176, 127), (176, 128), (176, 130), (177, 56), (177, 59), (177, 60), (177, 61), (177, 62), (177, 63), (177, 64), (177, 65), (177, 66), (177, 67), (177, 68), (177, 69), (177, 70), (177, 71), (177, 72), (177, 73), (177, 74), (177, 75), (177, 76), (177, 77), (177, 78), (177, 79), (177, 80), (177, 81), (177, 82), (177, 83), (177, 84), (177, 85), (177, 86), (177, 87), (177, 91), (177, 92), (177, 102), (177, 104), (177, 105), (177, 106), (177, 107), (177, 108), (177, 109), (177, 110), (177, 111), (177, 112), (177, 113), (177, 114), (177, 115), (177, 116), (177, 117), (177, 118),
(177, 119), (177, 120), (177, 121), (177, 122), (177, 123), (177, 124), (177, 125), (177, 126), (177, 127), (177, 128), (177, 130), (178, 55), (178, 58), (178, 59), (178, 60), (178, 61), (178, 62), (178, 63), (178, 64), (178, 65), (178, 66), (178, 67), (178, 68), (178, 69), (178, 70), (178, 71), (178, 72), (178, 73), (178, 74), (178, 75), (178, 76), (178, 77), (178, 78), (178, 79), (178, 80), (178, 81), (178, 82), (178, 83), (178, 84), (178, 85), (178, 86), (178, 89), (178, 102), (178, 104), (178, 105), (178, 106), (178, 107), (178, 108), (178, 109), (178, 110), (178, 111), (178, 112), (178, 113), (178, 114), (178, 115), (178, 116), (178, 117), (178, 118), (178, 119), (178, 120), (178, 121), (178, 122), (178, 123), (178, 124), (178, 125), (178, 126), (178, 127), (178, 129), (179, 54), (179, 56), (179, 57), (179, 58),
(179, 59), (179, 60), (179, 61), (179, 62), (179, 63), (179, 64), (179, 65), (179, 66), (179, 67), (179, 68), (179, 69), (179, 70), (179, 71), (179, 72), (179, 73), (179, 74), (179, 75), (179, 76), (179, 77), (179, 78), (179, 79), (179, 80), (179, 81), (179, 82), (179, 83), (179, 84), (179, 87), (179, 102), (179, 104), (179, 105), (179, 106), (179, 107), (179, 108), (179, 109), (179, 110), (179, 111), (179, 112), (179, 113), (179, 114), (179, 115), (179, 116), (179, 117), (179, 118), (179, 119), (179, 120), (179, 121), (179, 122), (179, 123), (179, 124), (179, 125), (179, 126), (179, 128), (180, 53), (180, 55), (180, 56), (180, 57), (180, 58), (180, 59), (180, 60), (180, 61), (180, 62), (180, 63), (180, 64), (180, 65), (180, 66), (180, 67), (180, 68), (180, 69), (180, 70), (180, 71), (180, 72), (180, 73),
(180, 74), (180, 75), (180, 76), (180, 77), (180, 78), (180, 79), (180, 80), (180, 81), (180, 82), (180, 85), (180, 102), (180, 104), (180, 105), (180, 106), (180, 107), (180, 108), (180, 109), (180, 110), (180, 111), (180, 112), (180, 113), (180, 114), (180, 115), (180, 116), (180, 117), (180, 118), (180, 119), (180, 120), (180, 121), (180, 122), (180, 123), (180, 124), (180, 125), (180, 126), (180, 128), (181, 52), (181, 54), (181, 55), (181, 56), (181, 57), (181, 58), (181, 59), (181, 60), (181, 61), (181, 62), (181, 63), (181, 64), (181, 65), (181, 66), (181, 67), (181, 68), (181, 69), (181, 70), (181, 71), (181, 72), (181, 73), (181, 74), (181, 75), (181, 76), (181, 77), (181, 78), (181, 79), (181, 80), (181, 81), (181, 84), (181, 101), (181, 103), (181, 104), (181, 105), (181, 106), (181, 107), (181, 108),
(181, 109), (181, 110), (181, 111), (181, 112), (181, 113), (181, 114), (181, 115), (181, 116), (181, 117), (181, 118), (181, 119), (181, 120), (181, 121), (181, 122), (181, 123), (181, 124), (181, 125), (181, 127), (182, 51), (182, 53), (182, 54), (182, 55), (182, 56), (182, 57), (182, 58), (182, 59), (182, 60), (182, 61), (182, 62), (182, 63), (182, 64), (182, 65), (182, 66), (182, 67), (182, 68), (182, 69), (182, 70), (182, 71), (182, 72), (182, 73), (182, 74), (182, 75), (182, 76), (182, 77), (182, 78), (182, 79), (182, 82), (182, 100), (182, 102), (182, 103), (182, 104), (182, 105), (182, 106), (182, 107), (182, 108), (182, 109), (182, 110), (182, 111), (182, 112), (182, 113), (182, 114), (182, 115), (182, 116), (182, 117), (182, 118), (182, 119), (182, 120), (182, 121), (182, 122), (182, 123), (182, 124), (182, 125),
(182, 127), (183, 53), (183, 54), (183, 55), (183, 56), (183, 57), (183, 58), (183, 59), (183, 60), (183, 61), (183, 62), (183, 63), (183, 64), (183, 65), (183, 66), (183, 67), (183, 68), (183, 69), (183, 70), (183, 71), (183, 72), (183, 73), (183, 74), (183, 75), (183, 76), (183, 77), (183, 80), (183, 99), (183, 101), (183, 102), (183, 103), (183, 104), (183, 105), (183, 106), (183, 107), (183, 108), (183, 109), (183, 110), (183, 111), (183, 112), (183, 113), (183, 114), (183, 115), (183, 116), (183, 117), (183, 118), (183, 119), (183, 120), (183, 121), (183, 122), (183, 123), (183, 124), (183, 126), (184, 50), (184, 52), (184, 53), (184, 54), (184, 55), (184, 56), (184, 57), (184, 58), (184, 59), (184, 60), (184, 61), (184, 62), (184, 63), (184, 64), (184, 65), (184, 66), (184, 67), (184, 68), (184, 69),
(184, 70), (184, 71), (184, 72), (184, 73), (184, 74), (184, 75), (184, 76), (184, 79), (184, 97), (184, 100), (184, 101), (184, 102), (184, 103), (184, 104), (184, 105), (184, 106), (184, 107), (184, 108), (184, 109), (184, 110), (184, 111), (184, 112), (184, 113), (184, 114), (184, 115), (184, 116), (184, 117), (184, 118), (184, 119), (184, 120), (184, 121), (184, 122), (184, 123), (184, 125), (185, 49), (185, 51), (185, 52), (185, 53), (185, 54), (185, 55), (185, 56), (185, 57), (185, 58), (185, 59), (185, 60), (185, 61), (185, 62), (185, 63), (185, 64), (185, 65), (185, 66), (185, 67), (185, 68), (185, 69), (185, 70), (185, 71), (185, 72), (185, 73), (185, 74), (185, 77), (185, 94), (185, 95), (185, 96), (185, 99), (185, 100), (185, 101), (185, 102), (185, 103), (185, 104), (185, 105), (185, 106), (185, 107),
(185, 108), (185, 109), (185, 110), (185, 111), (185, 112), (185, 113), (185, 114), (185, 115), (185, 116), (185, 117), (185, 118), (185, 119), (185, 120), (185, 121), (185, 122), (185, 123), (185, 125), (186, 49), (186, 51), (186, 52), (186, 53), (186, 54), (186, 55), (186, 56), (186, 57), (186, 58), (186, 59), (186, 60), (186, 61), (186, 62), (186, 63), (186, 64), (186, 65), (186, 66), (186, 67), (186, 68), (186, 69), (186, 70), (186, 71), (186, 72), (186, 76), (186, 91), (186, 93), (186, 97), (186, 98), (186, 99), (186, 100), (186, 101), (186, 102), (186, 103), (186, 104), (186, 105), (186, 106), (186, 107), (186, 108), (186, 109), (186, 110), (186, 111), (186, 112), (186, 113), (186, 114), (186, 115), (186, 116), (186, 117), (186, 118), (186, 119), (187, 48), (187, 50), (187, 51), (187, 52), (187, 53), (187, 54),
(187, 55), (187, 56), (187, 57), (187, 58), (187, 59), (187, 60), (187, 61), (187, 62), (187, 63), (187, 64), (187, 65), (187, 66), (187, 67), (187, 68), (187, 69), (187, 70), (187, 71), (187, 74), (187, 88), (187, 89), (187, 90), (187, 94), (187, 95), (187, 96), (187, 97), (187, 98), (187, 99), (187, 100), (187, 101), (187, 102), (187, 103), (187, 104), (187, 105), (187, 106), (187, 107), (187, 108), (187, 109), (187, 110), (187, 111), (187, 112), (187, 113), (187, 114), (187, 115), (187, 116), (187, 117), (187, 118), (187, 121), (187, 122), (187, 124), (188, 48), (188, 50), (188, 51), (188, 52), (188, 53), (188, 54), (188, 55), (188, 56), (188, 57), (188, 58), (188, 59), (188, 60), (188, 61), (188, 62), (188, 63), (188, 64), (188, 65), (188, 66), (188, 67), (188, 68), (188, 69), (188, 72), (188, 85),
(188, 86), (188, 91), (188, 92), (188, 93), (188, 94), (188, 95), (188, 96), (188, 97), (188, 98), (188, 99), (188, 100), (188, 101), (188, 102), (188, 103), (188, 104), (188, 105), (188, 106), (188, 107), (188, 108), (188, 109), (188, 110), (188, 111), (188, 112), (188, 113), (188, 114), (188, 115), (188, 116), (188, 117), (188, 119), (189, 48), (189, 50), (189, 51), (189, 52), (189, 53), (189, 54), (189, 55), (189, 56), (189, 57), (189, 58), (189, 59), (189, 60), (189, 61), (189, 62), (189, 63), (189, 64), (189, 65), (189, 66), (189, 67), (189, 71), (189, 83), (189, 87), (189, 88), (189, 89), (189, 90), (189, 91), (189, 92), (189, 93), (189, 94), (189, 95), (189, 96), (189, 97), (189, 98), (189, 99), (189, 100), (189, 101), (189, 102), (189, 103), (189, 104), (189, 105), (189, 118), (190, 49), (190, 51),
(190, 52), (190, 53), (190, 54), (190, 55), (190, 56), (190, 57), (190, 58), (190, 59), (190, 60), (190, 61), (190, 62), (190, 63), (190, 64), (190, 65), (190, 66), (190, 69), (190, 81), (190, 85), (190, 86), (190, 87), (190, 88), (190, 89), (190, 90), (190, 91), (190, 92), (190, 93), (190, 94), (190, 95), (190, 96), (190, 106), (190, 107), (190, 108), (190, 109), (190, 110), (190, 111), (190, 112), (190, 113), (190, 114), (190, 115), (190, 116), (190, 118), (191, 49), (191, 51), (191, 52), (191, 53), (191, 54), (191, 55), (191, 56), (191, 57), (191, 58), (191, 59), (191, 60), (191, 61), (191, 62), (191, 63), (191, 64), (191, 67), (191, 80), (191, 83), (191, 84), (191, 85), (191, 86), (191, 97), (191, 98), (191, 99), (191, 100), (191, 101), (191, 102), (191, 103), (191, 104), (191, 105), (192, 49),
(192, 51), (192, 52), (192, 53), (192, 54), (192, 55), (192, 56), (192, 57), (192, 58), (192, 59), (192, 60), (192, 61), (192, 62), (192, 66), (192, 80), (192, 86), (192, 87), (192, 88), (192, 89), (192, 90), (192, 91), (192, 92), (192, 93), (192, 94), (192, 95), (192, 96), (193, 50), (193, 52), (193, 53), (193, 54), (193, 55), (193, 56), (193, 57), (193, 58), (193, 59), (193, 60), (193, 61), (193, 64), (193, 80), (193, 82), (193, 83), (193, 84), (193, 85), (193, 86), (194, 50), (194, 52), (194, 53), (194, 54), (194, 55), (194, 56), (194, 57), (194, 58), (194, 59), (194, 62), (195, 50), (195, 52), (195, 53), (195, 54), (195, 55), (195, 56), (195, 57), (195, 60), (196, 51), (196, 53), (196, 54), (196, 58), (196, 59), (197, 51), (197, 56), (197, 57), (198, 51), (198, 53), (198, 54),
(199, 51), (246, 54), (246, 57), (247, 54), (247, 58), (247, 59), (248, 54), (248, 56), (248, 57), (248, 61), (249, 54), (249, 56), (249, 57), (249, 58), (249, 59), (249, 63), (250, 53), (250, 55), (250, 56), (250, 57), (250, 58), (250, 59), (250, 60), (250, 61), (250, 62), (250, 65), (251, 53), (251, 55), (251, 56), (251, 57), (251, 58), (251, 59), (251, 60), (251, 61), (251, 62), (251, 63), (251, 67), (252, 53), (252, 55), (252, 56), (252, 57), (252, 58), (252, 59), (252, 60), (252, 61), (252, 62), (252, 63), (252, 64), (252, 65), (252, 68), (252, 69), (252, 84), (252, 86), (252, 87), (252, 88), (252, 89), (252, 90), (252, 91), (252, 92), (252, 93), (252, 94), (252, 95), (252, 96), (252, 97), (252, 98), (252, 99), (252, 100), (252, 101), (252, 102), (252, 103), (252, 104), (252, 105),
(252, 106), (252, 107), (252, 108), (252, 109), (252, 110), (252, 111), (252, 112), (252, 113), (252, 114), (252, 115), (252, 116), (252, 118), (253, 52), (253, 54), (253, 55), (253, 56), (253, 57), (253, 58), (253, 59), (253, 60), (253, 61), (253, 62), (253, 63), (253, 64), (253, 65), (253, 66), (253, 67), (253, 70), (253, 86), (253, 119), (254, 52), (254, 59), (254, 60), (254, 61), (254, 62), (254, 63), (254, 64), (254, 65), (254, 66), (254, 67), (254, 68), (254, 69), (254, 72), (254, 88), (254, 91), (254, 92), (254, 93), (254, 94), (254, 95), (254, 96), (254, 97), (254, 98), (254, 99), (254, 100), (254, 101), (254, 102), (254, 103), (254, 104), (254, 105), (254, 106), (254, 107), (254, 108), (254, 109), (254, 110), (254, 111), (254, 112), (254, 113), (254, 114), (254, 115), (254, 116), (254, 117), (254, 118),
(254, 121), (255, 52), (255, 54), (255, 55), (255, 56), (255, 57), (255, 60), (255, 61), (255, 62), (255, 63), (255, 64), (255, 65), (255, 66), (255, 67), (255, 68), (255, 69), (255, 70), (255, 73), (255, 89), (255, 93), (255, 94), (255, 95), (255, 96), (255, 97), (255, 98), (255, 99), (255, 100), (255, 101), (255, 102), (255, 103), (255, 104), (255, 105), (255, 106), (255, 107), (255, 108), (255, 109), (255, 110), (255, 111), (255, 112), (255, 113), (255, 114), (255, 115), (255, 116), (255, 117), (255, 118), (255, 119), (255, 121), (256, 51), (256, 59), (256, 62), (256, 63), (256, 64), (256, 65), (256, 66), (256, 67), (256, 68), (256, 69), (256, 70), (256, 71), (256, 72), (256, 75), (256, 91), (256, 95), (256, 96), (256, 97), (256, 98), (256, 99), (256, 100), (256, 101), (256, 102), (256, 103), (256, 104),
(256, 105), (256, 106), (256, 107), (256, 108), (256, 109), (256, 110), (256, 111), (256, 112), (256, 113), (256, 114), (256, 115), (256, 116), (256, 117), (256, 118), (256, 119), (256, 120), (256, 122), (257, 60), (257, 63), (257, 64), (257, 65), (257, 66), (257, 67), (257, 68), (257, 69), (257, 70), (257, 71), (257, 72), (257, 73), (257, 76), (257, 93), (257, 97), (257, 98), (257, 99), (257, 100), (257, 101), (257, 102), (257, 103), (257, 104), (257, 105), (257, 106), (257, 107), (257, 108), (257, 109), (257, 110), (257, 111), (257, 112), (257, 113), (257, 114), (257, 115), (257, 116), (257, 117), (257, 118), (257, 119), (257, 120), (257, 122), (258, 62), (258, 64), (258, 65), (258, 66), (258, 67), (258, 68), (258, 69), (258, 70), (258, 71), (258, 72), (258, 73), (258, 74), (258, 75), (258, 78), (258, 95), (258, 99),
(258, 100), (258, 101), (258, 102), (258, 103), (258, 104), (258, 105), (258, 106), (258, 107), (258, 108), (258, 109), (258, 110), (258, 111), (258, 112), (258, 113), (258, 114), (258, 115), (258, 116), (258, 117), (258, 118), (258, 119), (258, 120), (258, 121), (258, 123), (259, 63), (259, 65), (259, 66), (259, 67), (259, 68), (259, 69), (259, 70), (259, 71), (259, 72), (259, 73), (259, 74), (259, 75), (259, 76), (259, 79), (259, 97), (259, 101), (259, 102), (259, 103), (259, 104), (259, 105), (259, 106), (259, 107), (259, 108), (259, 109), (259, 110), (259, 111), (259, 112), (259, 113), (259, 114), (259, 115), (259, 116), (259, 117), (259, 118), (259, 119), (259, 120), (259, 121), (259, 122), (259, 123), (260, 64), (260, 67), (260, 68), (260, 69), (260, 70), (260, 71), (260, 72), (260, 73), (260, 74), (260, 75), (260, 76),
(260, 77), (260, 78), (260, 81), (260, 99), (260, 103), (260, 104), (260, 105), (260, 106), (260, 107), (260, 108), (260, 109), (260, 110), (260, 111), (260, 112), (260, 113), (260, 114), (260, 115), (260, 116), (260, 117), (260, 118), (260, 119), (260, 120), (260, 121), (260, 122), (260, 124), (261, 65), (261, 68), (261, 69), (261, 70), (261, 71), (261, 72), (261, 73), (261, 74), (261, 75), (261, 76), (261, 77), (261, 78), (261, 79), (261, 82), (261, 101), (261, 104), (261, 105), (261, 106), (261, 107), (261, 108), (261, 109), (261, 110), (261, 111), (261, 112), (261, 113), (261, 114), (261, 115), (261, 116), (261, 117), (261, 118), (261, 119), (261, 120), (261, 121), (261, 122), (261, 123), (261, 125), (262, 67), (262, 69), (262, 70), (262, 71), (262, 72), (262, 73), (262, 74), (262, 75), (262, 76), (262, 77), (262, 78),
(262, 79), (262, 80), (262, 81), (262, 83), (262, 103), (262, 106), (262, 107), (262, 108), (262, 109), (262, 110), (262, 111), (262, 112), (262, 113), (262, 114), (262, 115), (262, 116), (262, 117), (262, 118), (262, 119), (262, 120), (262, 121), (262, 122), (262, 123), (262, 124), (262, 126), (263, 68), (263, 70), (263, 71), (263, 72), (263, 73), (263, 74), (263, 75), (263, 76), (263, 77), (263, 78), (263, 79), (263, 80), (263, 81), (263, 82), (263, 85), (263, 105), (263, 108), (263, 109), (263, 110), (263, 111), (263, 112), (263, 113), (263, 114), (263, 115), (263, 116), (263, 117), (263, 118), (263, 119), (263, 120), (263, 121), (263, 122), (263, 123), (263, 124), (263, 126), (264, 69), (264, 72), (264, 73), (264, 74), (264, 75), (264, 76), (264, 77), (264, 78), (264, 79), (264, 80), (264, 81), (264, 82), (264, 83),
(264, 86), (264, 106), (264, 107), (264, 110), (264, 111), (264, 112), (264, 113), (264, 114), (264, 115), (264, 116), (264, 117), (264, 118), (264, 119), (264, 120), (264, 121), (264, 122), (264, 123), (264, 124), (264, 125), (264, 127), (265, 70), (265, 73), (265, 74), (265, 75), (265, 76), (265, 77), (265, 78), (265, 79), (265, 80), (265, 81), (265, 82), (265, 83), (265, 84), (265, 85), (265, 88), (265, 108), (265, 110), (265, 111), (265, 112), (265, 113), (265, 114), (265, 115), (265, 116), (265, 117), (265, 118), (265, 119), (265, 120), (265, 121), (265, 122), (265, 123), (265, 124), (265, 125), (265, 126), (265, 128), (266, 71), (266, 74), (266, 75), (266, 76), (266, 77), (266, 78), (266, 79), (266, 80), (266, 81), (266, 82), (266, 83), (266, 84), (266, 85), (266, 86), (266, 89), (266, 110), (266, 112), (266, 113),
(266, 114), (266, 115), (266, 116), (266, 117), (266, 118), (266, 119), (266, 120), (266, 121), (266, 122), (266, 123), (266, 124), (266, 125), (266, 126), (266, 127), (266, 129), (267, 73), (267, 75), (267, 76), (267, 77), (267, 78), (267, 79), (267, 80), (267, 81), (267, 82), (267, 83), (267, 84), (267, 85), (267, 86), (267, 87), (267, 88), (267, 91), (267, 110), (267, 112), (267, 113), (267, 114), (267, 115), (267, 116), (267, 117), (267, 118), (267, 119), (267, 120), (267, 121), (267, 122), (267, 123), (267, 124), (267, 125), (267, 126), (267, 127), (267, 128), (267, 130), (268, 74), (268, 76), (268, 77), (268, 78), (268, 79), (268, 80), (268, 81), (268, 82), (268, 83), (268, 84), (268, 85), (268, 86), (268, 87), (268, 88), (268, 89), (268, 93), (268, 107), (268, 108), (268, 109), (268, 110), (268, 111), (268, 112),
(268, 113), (268, 114), (268, 115), (268, 116), (268, 117), (268, 118), (268, 119), (268, 120), (268, 121), (268, 122), (268, 123), (268, 124), (268, 125), (268, 126), (268, 127), (268, 128), (268, 130), (269, 75), (269, 78), (269, 79), (269, 80), (269, 81), (269, 82), (269, 83), (269, 84), (269, 85), (269, 86), (269, 87), (269, 88), (269, 89), (269, 90), (269, 91), (269, 94), (269, 97), (269, 98), (269, 99), (269, 100), (269, 101), (269, 102), (269, 103), (269, 104), (269, 105), (269, 106), (269, 110), (269, 111), (269, 112), (269, 113), (269, 114), (269, 115), (269, 116), (269, 117), (269, 118), (269, 119), (269, 120), (269, 121), (269, 122), (269, 123), (269, 124), (269, 125), (269, 126), (269, 127), (269, 128), (269, 129), (269, 131), (270, 76), (270, 79), (270, 80), (270, 81), (270, 82), (270, 83), (270, 84), (270, 85),
(270, 86), (270, 87), (270, 88), (270, 89), (270, 90), (270, 91), (270, 92), (270, 93), (270, 96), (270, 106), (270, 107), (270, 108), (270, 109), (270, 110), (270, 111), (270, 112), (270, 113), (270, 114), (270, 115), (270, 116), (270, 117), (270, 118), (270, 119), (270, 120), (270, 121), (270, 122), (270, 123), (270, 124), (270, 125), (270, 126), (270, 127), (270, 128), (270, 129), (270, 130), (270, 132), (271, 77), (271, 80), (271, 81), (271, 82), (271, 83), (271, 84), (271, 85), (271, 86), (271, 87), (271, 88), (271, 89), (271, 90), (271, 91), (271, 92), (271, 93), (271, 94), (271, 95), (271, 97), (271, 98), (271, 99), (271, 100), (271, 101), (271, 102), (271, 103), (271, 104), (271, 105), (271, 106), (271, 107), (271, 108), (271, 109), (271, 110), (271, 111), (271, 112), (271, 113), (271, 114), (271, 115), (271, 116),
(271, 117), (271, 118), (271, 119), (271, 120), (271, 121), (271, 122), (271, 123), (271, 124), (271, 125), (271, 126), (271, 127), (271, 128), (271, 129), (271, 130), (271, 131), (271, 133), (272, 79), (272, 81), (272, 82), (272, 83), (272, 84), (272, 85), (272, 86), (272, 87), (272, 88), (272, 89), (272, 90), (272, 91), (272, 92), (272, 93), (272, 94), (272, 95), (272, 96), (272, 97), (272, 98), (272, 99), (272, 100), (272, 101), (272, 102), (272, 103), (272, 104), (272, 105), (272, 106), (272, 107), (272, 108), (272, 109), (272, 110), (272, 111), (272, 112), (272, 113), (272, 114), (272, 115), (272, 116), (272, 117), (272, 118), (272, 119), (272, 120), (272, 121), (272, 122), (272, 123), (272, 124), (272, 125), (272, 126), (272, 127), (272, 128), (272, 129), (272, 130), (272, 131), (272, 132), (272, 134), (273, 80), (273, 82),
(273, 83), (273, 84), (273, 85), (273, 86), (273, 87), (273, 88), (273, 89), (273, 90), (273, 91), (273, 92), (273, 93), (273, 94), (273, 95), (273, 96), (273, 97), (273, 98), (273, 99), (273, 100), (273, 101), (273, 102), (273, 103), (273, 104), (273, 105), (273, 106), (273, 107), (273, 108), (273, 109), (273, 110), (273, 111), (273, 112), (273, 113), (273, 114), (273, 115), (273, 116), (273, 117), (273, 118), (273, 119), (273, 120), (273, 121), (273, 122), (273, 123), (273, 124), (273, 125), (273, 126), (273, 127), (273, 128), (273, 129), (273, 130), (273, 131), (273, 132), (273, 133), (273, 135), (274, 81), (274, 83), (274, 84), (274, 85), (274, 86), (274, 87), (274, 88), (274, 89), (274, 90), (274, 91), (274, 92), (274, 93), (274, 94), (274, 95), (274, 96), (274, 97), (274, 98), (274, 99), (274, 100), (274, 101),
(274, 102), (274, 103), (274, 104), (274, 105), (274, 106), (274, 107), (274, 108), (274, 109), (274, 110), (274, 111), (274, 112), (274, 113), (274, 114), (274, 115), (274, 116), (274, 117), (274, 118), (274, 119), (274, 120), (274, 121), (274, 122), (274, 123), (274, 124), (274, 125), (274, 126), (274, 127), (274, 128), (274, 129), (274, 130), (274, 131), (274, 132), (274, 133), (274, 136), (275, 82), (275, 85), (275, 86), (275, 87), (275, 88), (275, 89), (275, 90), (275, 91), (275, 92), (275, 93), (275, 94), (275, 95), (275, 96), (275, 97), (275, 98), (275, 99), (275, 100), (275, 101), (275, 102), (275, 103), (275, 104), (275, 105), (275, 106), (275, 107), (275, 108), (275, 109), (275, 110), (275, 111), (275, 112), (275, 113), (275, 114), (275, 115), (275, 116), (275, 117), (275, 118), (275, 119), (275, 120), (275, 121), (275, 122),
(275, 123), (275, 124), (275, 125), (275, 126), (275, 127), (275, 128), (275, 129), (275, 130), (275, 131), (275, 132), (275, 133), (275, 134), (276, 83), (276, 86), (276, 87), (276, 88), (276, 89), (276, 90), (276, 91), (276, 92), (276, 93), (276, 94), (276, 95), (276, 96), (276, 97), (276, 98), (276, 99), (276, 100), (276, 101), (276, 102), (276, 103), (276, 104), (276, 105), (276, 106), (276, 107), (276, 108), (276, 109), (276, 110), (276, 111), (276, 112), (276, 113), (276, 114), (276, 115), (276, 116), (276, 117), (276, 118), (276, 119), (276, 120), (276, 121), (276, 122), (276, 123), (276, 124), (276, 125), (276, 126), (276, 127), (276, 128), (276, 129), (276, 130), (276, 131), (276, 132), (276, 133), (276, 134), (276, 135), (276, 137), (277, 84), (277, 87), (277, 88), (277, 89), (277, 90), (277, 91), (277, 92), (277, 93),
(277, 94), (277, 95), (277, 96), (277, 97), (277, 98), (277, 99), (277, 100), (277, 101), (277, 102), (277, 103), (277, 104), (277, 105), (277, 106), (277, 107), (277, 108), (277, 109), (277, 110), (277, 111), (277, 112), (277, 113), (277, 114), (277, 115), (277, 116), (277, 117), (277, 118), (277, 119), (277, 120), (277, 121), (277, 122), (277, 123), (277, 124), (277, 125), (277, 126), (277, 127), (277, 128), (277, 129), (277, 130), (277, 131), (277, 132), (277, 133), (277, 134), (277, 135), (277, 136), (277, 138), (278, 86), (278, 88), (278, 89), (278, 90), (278, 91), (278, 92), (278, 93), (278, 94), (278, 95), (278, 96), (278, 97), (278, 98), (278, 99), (278, 100), (278, 101), (278, 102), (278, 103), (278, 104), (278, 105), (278, 106), (278, 107), (278, 108), (278, 109), (278, 110), (278, 111), (278, 112), (278, 113), (278, 114),
(278, 115), (278, 116), (278, 117), (278, 118), (278, 119), (278, 120), (278, 121), (278, 122), (278, 123), (278, 124), (278, 125), (278, 126), (278, 127), (278, 128), (278, 129), (278, 130), (278, 131), (278, 132), (278, 133), (278, 134), (278, 135), (278, 136), (278, 137), (278, 139), (279, 87), (279, 89), (279, 90), (279, 91), (279, 92), (279, 93), (279, 94), (279, 95), (279, 96), (279, 97), (279, 98), (279, 99), (279, 100), (279, 101), (279, 102), (279, 103), (279, 104), (279, 105), (279, 106), (279, 107), (279, 108), (279, 109), (279, 110), (279, 111), (279, 112), (279, 113), (279, 114), (279, 115), (279, 116), (279, 117), (279, 118), (279, 119), (279, 120), (279, 121), (279, 122), (279, 123), (279, 124), (279, 125), (279, 126), (279, 127), (279, 128), (279, 129), (279, 130), (279, 131), (279, 132), (279, 133), (279, 134), (279, 135),
(279, 136), (279, 137), (279, 138), (279, 140), (280, 88), (280, 90), (280, 91), (280, 92), (280, 93), (280, 94), (280, 95), (280, 96), (280, 97), (280, 98), (280, 99), (280, 100), (280, 101), (280, 102), (280, 103), (280, 104), (280, 105), (280, 106), (280, 107), (280, 108), (280, 109), (280, 110), (280, 111), (280, 112), (280, 113), (280, 114), (280, 115), (280, 116), (280, 117), (280, 118), (280, 119), (280, 120), (280, 121), (280, 122), (280, 123), (280, 124), (280, 125), (280, 126), (280, 127), (280, 128), (280, 129), (280, 130), (280, 131), (280, 132), (280, 133), (280, 134), (280, 135), (280, 136), (280, 137), (280, 138), (280, 139), (280, 141), (281, 89), (281, 92), (281, 93), (281, 94), (281, 95), (281, 96), (281, 97), (281, 98), (281, 99), (281, 100), (281, 101), (281, 102), (281, 103), (281, 104), (281, 105), (281, 106),
(281, 107), (281, 108), (281, 109), (281, 110), (281, 111), (281, 112), (281, 113), (281, 114), (281, 115), (281, 116), (281, 117), (281, 118), (281, 119), (281, 120), (281, 121), (281, 122), (281, 123), (281, 124), (281, 125), (281, 126), (281, 127), (281, 128), (281, 129), (281, 130), (281, 131), (281, 132), (281, 133), (281, 134), (281, 135), (281, 136), (281, 137), (281, 138), (281, 139), (281, 140), (281, 142), (282, 90), (282, 93), (282, 94), (282, 95), (282, 96), (282, 97), (282, 98), (282, 99), (282, 100), (282, 101), (282, 102), (282, 103), (282, 104), (282, 105), (282, 106), (282, 107), (282, 108), (282, 109), (282, 110), (282, 111), (282, 112), (282, 113), (282, 114), (282, 115), (282, 116), (282, 117), (282, 118), (282, 119), (282, 120), (282, 121), (282, 122), (282, 123), (282, 124), (282, 125), (282, 126), (282, 127), (282, 128),
(282, 129), (282, 130), (282, 131), (282, 132), (282, 133), (282, 134), (282, 135), (282, 136), (282, 137), (282, 138), (282, 139), (282, 140), (282, 141), (282, 143), (283, 91), (283, 94), (283, 95), (283, 96), (283, 97), (283, 98), (283, 99), (283, 100), (283, 101), (283, 102), (283, 103), (283, 104), (283, 105), (283, 106), (283, 107), (283, 108), (283, 109), (283, 110), (283, 111), (283, 112), (283, 113), (283, 114), (283, 115), (283, 116), (283, 117), (283, 118), (283, 119), (283, 120), (283, 121), (283, 122), (283, 123), (283, 124), (283, 125), (283, 126), (283, 127), (283, 128), (283, 129), (283, 130), (283, 131), (283, 132), (283, 133), (283, 134), (283, 135), (283, 136), (283, 137), (283, 138), (283, 139), (283, 140), (283, 141), (283, 142), (283, 145), (284, 95), (284, 96), (284, 97), (284, 98), (284, 99), (284, 100), (284, 101),
(284, 102), (284, 103), (284, 104), (284, 105), (284, 106), (284, 107), (284, 108), (284, 109), (284, 110), (284, 111), (284, 112), (284, 113), (284, 114), (284, 115), (284, 116), (284, 117), (284, 118), (284, 119), (284, 120), (284, 121), (284, 122), (284, 123), (284, 124), (284, 125), (284, 126), (284, 127), (284, 128), (284, 129), (284, 130), (284, 131), (284, 132), (284, 133), (284, 134), (284, 135), (284, 136), (284, 137), (284, 138), (284, 139), (284, 140), (284, 141), (284, 142), (284, 143), (284, 146), (285, 94), (285, 96), (285, 97), (285, 98), (285, 99), (285, 100), (285, 101), (285, 102), (285, 103), (285, 104), (285, 105), (285, 106), (285, 107), (285, 108), (285, 109), (285, 110), (285, 111), (285, 112), (285, 113), (285, 114), (285, 115), (285, 116), (285, 117), (285, 118), (285, 119), (285, 120), (285, 121), (285, 122), (285, 123),
(285, 124), (285, 125), (285, 126), (285, 127), (285, 128), (285, 129), (285, 130), (285, 131), (285, 132), (285, 133), (285, 134), (285, 135), (285, 136), (285, 137), (285, 138), (285, 139), (285, 140), (285, 141), (285, 142), (285, 143), (285, 144), (285, 146), (286, 95), (286, 97), (286, 98), (286, 99), (286, 100), (286, 101), (286, 102), (286, 103), (286, 104), (286, 105), (286, 106), (286, 107), (286, 108), (286, 109), (286, 110), (286, 111), (286, 112), (286, 113), (286, 114), (286, 115), (286, 116), (286, 117), (286, 118), (286, 119), (286, 120), (286, 121), (286, 122), (286, 123), (286, 124), (286, 125), (286, 126), (286, 127), (286, 128), (286, 129), (286, 130), (286, 131), (286, 132), (286, 133), (286, 134), (286, 135), (286, 136), (286, 137), (286, 138), (286, 139), (286, 140), (286, 141), (286, 142), (286, 143), (286, 145), (287, 96),
(287, 98), (287, 99), (287, 100), (287, 101), (287, 102), (287, 103), (287, 104), (287, 105), (287, 106), (287, 107), (287, 108), (287, 109), (287, 110), (287, 111), (287, 112), (287, 113), (287, 114), (287, 115), (287, 116), (287, 117), (287, 118), (287, 119), (287, 120), (287, 121), (287, 122), (287, 123), (287, 124), (287, 125), (287, 126), (287, 127), (287, 128), (287, 129), (287, 130), (287, 131), (287, 132), (287, 133), (287, 134), (287, 135), (287, 136), (287, 137), (287, 138), (287, 139), (287, 140), (287, 141), (287, 142), (287, 143), (287, 145), (288, 97), (288, 99), (288, 100), (288, 101), (288, 102), (288, 103), (288, 104), (288, 105), (288, 106), (288, 107), (288, 108), (288, 109), (288, 110), (288, 111), (288, 112), (288, 113), (288, 114), (288, 115), (288, 116), (288, 117), (288, 118), (288, 119), (288, 120), (288, 121), (288, 122),
(288, 123), (288, 124), (288, 125), (288, 126), (288, 127), (288, 128), (288, 129), (288, 130), (288, 131), (288, 132), (288, 133), (288, 134), (288, 135), (288, 136), (288, 137), (288, 138), (288, 139), (288, 140), (288, 141), (288, 142), (288, 144), (289, 98), (289, 100), (289, 101), (289, 102), (289, 103), (289, 104), (289, 105), (289, 106), (289, 107), (289, 108), (289, 109), (289, 110), (289, 111), (289, 112), (289, 113), (289, 114), (289, 115), (289, 116), (289, 117), (289, 118), (289, 119), (289, 120), (289, 121), (289, 122), (289, 123), (289, 124), (289, 125), (289, 126), (289, 127), (289, 128), (289, 129), (289, 130), (289, 131), (289, 132), (289, 133), (289, 134), (289, 135), (289, 136), (289, 137), (289, 138), (289, 139), (289, 140), (289, 141), (290, 99), (290, 102), (290, 103), (290, 104), (290, 105), (290, 106), (290, 107), (290, 108),
(290, 109), (290, 110), (290, 111), (290, 112), (290, 113), (290, 114), (290, 115), (290, 116), (290, 117), (290, 118), (290, 119), (290, 120), (290, 121), (290, 122), (290, 123), (290, 124), (290, 125), (290, 126), (290, 127), (290, 128), (290, 129), (290, 130), (290, 131), (290, 132), (290, 133), (290, 134), (290, 135), (290, 136), (290, 137), (290, 138), (290, 139), (290, 140), (290, 143), (291, 100), (291, 103), (291, 104), (291, 105), (291, 106), (291, 107), (291, 108), (291, 109), (291, 110), (291, 111), (291, 112), (291, 113), (291, 114), (291, 115), (291, 116), (291, 117), (291, 118), (291, 119), (291, 120), (291, 121), (291, 122), (291, 123), (291, 124), (291, 125), (291, 126), (291, 127), (291, 128), (291, 129), (291, 130), (291, 131), (291, 132), (291, 133), (291, 134), (291, 135), (291, 136), (291, 137), (291, 138), (291, 139), (291, 141),
(292, 102), (292, 104), (292, 105), (292, 106), (292, 107), (292, 108), (292, 109), (292, 110), (292, 111), (292, 112), (292, 113), (292, 114), (292, 115), (292, 116), (292, 117), (292, 118), (292, 119), (292, 120), (292, 121), (292, 122), (292, 123), (292, 124), (292, 125), (292, 126), (292, 127), (292, 128), (292, 129), (292, 130), (292, 131), (292, 132), (292, 133), (292, 134), (292, 135), (292, 136), (292, 137), (292, 140), (293, 103), (293, 105), (293, 106), (293, 107), (293, 108), (293, 109), (293, 110), (293, 111), (293, 112), (293, 113), (293, 114), (293, 115), (293, 116), (293, 117), (293, 118), (293, 119), (293, 120), (293, 121), (293, 122), (293, 123), (293, 124), (293, 125), (293, 126), (293, 127), (293, 128), (293, 129), (293, 130), (293, 131), (293, 132), (293, 133), (293, 134), (293, 135), (293, 138), (293, 139), (294, 104), (294, 107),
(294, 108), (294, 109), (294, 110), (294, 111), (294, 112), (294, 113), (294, 114), (294, 115), (294, 116), (294, 117), (294, 118), (294, 119), (294, 120), (294, 121), (294, 122), (294, 123), (294, 124), (294, 125), (294, 126), (294, 127), (294, 128), (294, 129), (294, 130), (294, 131), (294, 132), (294, 133), (294, 137), (295, 105), (295, 108), (295, 109), (295, 110), (295, 111), (295, 112), (295, 113), (295, 114), (295, 115), (295, 116), (295, 117), (295, 118), (295, 119), (295, 120), (295, 121), (295, 122), (295, 123), (295, 124), (295, 125), (295, 126), (295, 127), (295, 128), (295, 129), (295, 130), (295, 135), (296, 106), (296, 109), (296, 110), (296, 111), (296, 112), (296, 113), (296, 114), (296, 115), (296, 116), (296, 117), (296, 118), (296, 119), (296, 120), (296, 121), (296, 122), (296, 123), (296, 124), (296, 125), (296, 126), (296, 131),
(296, 132), (297, 108), (297, 113), (297, 114), (297, 115), (297, 116), (297, 117), (297, 118), (297, 119), (297, 120), (297, 121), (297, 127), (297, 128), (297, 129), (297, 130), (298, 109), (298, 111), (298, 112), (298, 122), (298, 123), (298, 124), (298, 125), (298, 126), (299, 113), (299, 114), (299, 115), (299, 116), (299, 117), (299, 118), (299, 119), (299, 120), (299, 121), )
coordinates_993300 = ((222, 20),
(222, 22), (222, 23), (222, 24), (222, 25), (222, 26), (222, 27), (222, 28), (222, 29), (222, 30), (222, 31), (222, 32), (222, 33), (222, 34), (222, 35), (222, 36), (222, 37), (222, 38), (222, 39), (222, 40), (222, 41), (222, 42), (222, 43), (222, 44), (222, 45), (222, 46), (222, 47), (222, 48), (222, 49), (222, 50), (222, 51), (222, 52), (222, 53), (222, 55), (222, 73), (222, 75), (222, 76), (222, 77), (222, 78), (222, 79), (222, 80), (222, 81), (222, 82), (222, 83), (222, 84), (222, 85), (222, 86), (222, 87), (222, 88), (222, 89), (222, 90), (222, 91), (222, 92), (222, 93), (222, 94), (222, 95), (222, 96), (222, 97), (222, 98), (222, 99), (222, 100), (222, 101), (222, 102), (222, 103), (222, 104), (222, 105), (222, 106), (222, 107), (222, 108), (222, 109), (222, 110), (222, 111), (222, 112),
(222, 113), (222, 114), (222, 115), (222, 116), (222, 117), (222, 118), (222, 119), (222, 120), (222, 121), (222, 122), (222, 123), (222, 124), (222, 125), (222, 126), (222, 127), (222, 128), (222, 129), (222, 130), (222, 131), (222, 132), (222, 133), (222, 134), (222, 135), (222, 136), (222, 137), (222, 138), (222, 139), (222, 140), (222, 141), (222, 142), (222, 143), (222, 144), (222, 145), (222, 146), (222, 147), (222, 148), (222, 149), (222, 150), (222, 151), (222, 152), (222, 153), (222, 154), (222, 155), (222, 156), (222, 158), (223, 20), (223, 22), (223, 23), (223, 24), (223, 25), (223, 26), (223, 27), (223, 28), (223, 29), (223, 30), (223, 31), (223, 32), (223, 33), (223, 34), (223, 35), (223, 36), (223, 37), (223, 38), (223, 39), (223, 40), (223, 41), (223, 42), (223, 43), (223, 44), (223, 45), (223, 46), (223, 47),
(223, 48), (223, 49), (223, 50), (223, 51), (223, 52), (223, 53), (223, 55), (223, 73), (223, 75), (223, 76), (223, 77), (223, 78), (223, 79), (223, 80), (223, 81), (223, 82), (223, 83), (223, 84), (223, 85), (223, 86), (223, 87), (223, 88), (223, 89), (223, 90), (223, 91), (223, 92), (223, 93), (223, 94), (223, 95), (223, 96), (223, 97), (223, 98), (223, 99), (223, 100), (223, 101), (223, 102), (223, 103), (223, 104), (223, 105), (223, 106), (223, 107), (223, 108), (223, 109), (223, 110), (223, 111), (223, 112), (223, 113), (223, 114), (223, 115), (223, 116), (223, 117), (223, 118), (223, 119), (223, 120), (223, 121), (223, 122), (223, 123), (223, 124), (223, 125), (223, 126), (223, 127), (223, 128), (223, 129), (223, 130), (223, 131), (223, 132), (223, 133), (223, 134), (223, 135), (223, 136), (223, 137), (223, 138),
(223, 139), (223, 140), (223, 141), (223, 142), (223, 143), (223, 144), (223, 145), (223, 146), (223, 147), (223, 148), (223, 149), (223, 150), (223, 151), (223, 152), (223, 153), (223, 154), (223, 155), (223, 156), (223, 158), )
coordinates_FFFF7F = ((192, 109),
(192, 110), (192, 111), (192, 112), (192, 113), (192, 114), (192, 115), (192, 116), (192, 117), (192, 118), (192, 119), (192, 120), (192, 121), (193, 99), (193, 100), (193, 101), (193, 102), (193, 103), (193, 104), (193, 105), (193, 106), (193, 107), (193, 108), (193, 122), (193, 123), (193, 124), (193, 125), (194, 90), (194, 91), (194, 92), (194, 93), (194, 94), (194, 95), (194, 96), (194, 97), (194, 98), (194, 99), (194, 109), (194, 110), (194, 111), (194, 112), (194, 113), (194, 114), (194, 115), (194, 116), (194, 117), (194, 118), (194, 119), (194, 120), (194, 121), (194, 126), (194, 128), (195, 80), (195, 82), (195, 83), (195, 84), (195, 85), (195, 86), (195, 87), (195, 88), (195, 89), (195, 99), (195, 100), (195, 101), (195, 102), (195, 103), (195, 104), (195, 105), (195, 106), (195, 107), (195, 108), (195, 109), (195, 110),
(195, 111), (195, 112), (195, 113), (195, 114), (195, 115), (195, 116), (195, 117), (195, 118), (195, 119), (195, 120), (195, 121), (195, 122), (195, 123), (195, 124), (195, 125), (195, 129), (195, 130), (195, 131), (196, 80), (196, 90), (196, 91), (196, 92), (196, 93), (196, 94), (196, 95), (196, 96), (196, 97), (196, 98), (196, 99), (196, 100), (196, 101), (196, 102), (196, 103), (196, 104), (196, 105), (196, 106), (196, 107), (196, 108), (196, 109), (196, 110), (196, 111), (196, 112), (196, 113), (196, 114), (196, 115), (196, 116), (196, 117), (196, 118), (196, 119), (196, 120), (196, 121), (196, 122), (196, 123), (196, 124), (196, 125), (196, 126), (196, 127), (196, 128), (196, 132), (196, 133), (196, 134), (197, 80), (197, 82), (197, 83), (197, 84), (197, 85), (197, 86), (197, 87), (197, 88), (197, 89), (197, 90), (197, 91),
(197, 92), (197, 93), (197, 94), (197, 95), (197, 96), (197, 97), (197, 98), (197, 99), (197, 100), (197, 101), (197, 102), (197, 103), (197, 104), (197, 105), (197, 106), (197, 107), (197, 108), (197, 109), (197, 110), (197, 111), (197, 112), (197, 113), (197, 114), (197, 115), (197, 116), (197, 117), (197, 118), (197, 119), (197, 120), (197, 121), (197, 122), (197, 123), (197, 124), (197, 125), (197, 126), (197, 127), (197, 128), (197, 129), (197, 130), (197, 131), (197, 136), (197, 137), (198, 81), (198, 84), (198, 85), (198, 86), (198, 87), (198, 88), (198, 89), (198, 90), (198, 91), (198, 92), (198, 93), (198, 94), (198, 95), (198, 96), (198, 97), (198, 98), (198, 99), (198, 100), (198, 101), (198, 102), (198, 103), (198, 104), (198, 105), (198, 106), (198, 107), (198, 108), (198, 109), (198, 110), (198, 111), (198, 112),
(198, 113), (198, 114), (198, 115), (198, 116), (198, 117), (198, 118), (198, 119), (198, 120), (198, 121), (198, 122), (198, 123), (198, 124), (198, 125), (198, 126), (198, 127), (198, 128), (198, 129), (198, 130), (198, 131), (198, 132), (198, 133), (198, 134), (198, 135), (198, 139), (198, 140), (199, 82), (199, 86), (199, 87), (199, 88), (199, 89), (199, 90), (199, 91), (199, 92), (199, 93), (199, 94), (199, 95), (199, 96), (199, 97), (199, 98), (199, 99), (199, 100), (199, 101), (199, 102), (199, 103), (199, 104), (199, 105), (199, 106), (199, 107), (199, 108), (199, 109), (199, 110), (199, 111), (199, 112), (199, 113), (199, 114), (199, 115), (199, 116), (199, 117), (199, 118), (199, 119), (199, 120), (199, 121), (199, 122), (199, 123), (199, 124), (199, 125), (199, 126), (199, 127), (199, 128), (199, 129), (199, 130), (199, 131),
(199, 132), (199, 133), (199, 134), (199, 135), (199, 136), (199, 137), (199, 138), (199, 143), (200, 84), (200, 91), (200, 92), (200, 93), (200, 94), (200, 95), (200, 96), (200, 97), (200, 98), (200, 99), (200, 100), (200, 101), (200, 102), (200, 103), (200, 104), (200, 105), (200, 106), (200, 107), (200, 108), (200, 109), (200, 110), (200, 111), (200, 112), (200, 113), (200, 114), (200, 115), (200, 116), (200, 117), (200, 118), (200, 119), (200, 120), (200, 121), (200, 122), (200, 123), (200, 124), (200, 125), (200, 126), (200, 127), (200, 128), (200, 129), (200, 130), (200, 131), (200, 132), (200, 133), (200, 134), (200, 135), (200, 136), (200, 137), (200, 138), (200, 139), (200, 140), (200, 144), (200, 145), (200, 146), (201, 87), (201, 88), (201, 89), (201, 90), (201, 99), (201, 100), (201, 101), (201, 102), (201, 103), (201, 104),
(201, 105), (201, 106), (201, 107), (201, 108), (201, 109), (201, 110), (201, 111), (201, 112), (201, 113), (201, 114), (201, 115), (201, 116), (201, 117), (201, 118), (201, 119), (201, 120), (201, 121), (201, 122), (201, 123), (201, 124), (201, 125), (201, 126), (201, 127), (201, 128), (201, 129), (201, 130), (201, 131), (201, 132), (201, 133), (201, 134), (201, 135), (201, 136), (201, 137), (201, 138), (201, 139), (201, 140), (201, 141), (201, 142), (201, 143), (201, 148), (202, 91), (202, 92), (202, 93), (202, 94), (202, 95), (202, 96), (202, 97), (202, 98), (202, 104), (202, 105), (202, 106), (202, 107), (202, 108), (202, 109), (202, 110), (202, 111), (202, 112), (202, 113), (202, 114), (202, 115), (202, 116), (202, 117), (202, 118), (202, 119), (202, 120), (202, 121), (202, 122), (202, 123), (202, 124), (202, 125), (202, 126), (202, 127),
(202, 128), (202, 129), (202, 130), (202, 131), (202, 132), (202, 133), (202, 134), (202, 135), (202, 136), (202, 137), (202, 138), (202, 139), (202, 140), (202, 141), (202, 142), (202, 143), (202, 144), (202, 145), (202, 146), (202, 149), (203, 99), (203, 100), (203, 101), (203, 102), (203, 103), (203, 104), (203, 105), (203, 106), (203, 107), (203, 108), (203, 109), (203, 110), (203, 111), (203, 112), (203, 113), (203, 114), (203, 115), (203, 116), (203, 117), (203, 118), (203, 119), (203, 120), (203, 121), (203, 122), (203, 123), (203, 124), (203, 125), (203, 126), (203, 127), (203, 128), (203, 129), (203, 130), (203, 131), (203, 132), (203, 133), (203, 134), (203, 135), (203, 136), (203, 137), (203, 138), (203, 139), (203, 140), (203, 141), (203, 142), (203, 143), (203, 144), (203, 145), (203, 146), (203, 147), (203, 148), (203, 150), (204, 51),
(204, 53), (204, 54), (204, 55), (204, 56), (204, 57), (204, 58), (204, 59), (204, 104), (204, 105), (204, 106), (204, 107), (204, 108), (204, 109), (204, 110), (204, 111), (204, 112), (204, 113), (204, 114), (204, 115), (204, 116), (204, 117), (204, 118), (204, 119), (204, 120), (204, 121), (204, 122), (204, 123), (204, 124), (204, 125), (204, 126), (204, 127), (204, 128), (204, 129), (204, 130), (204, 131), (204, 132), (204, 133), (204, 134), (204, 135), (204, 136), (204, 137), (204, 138), (204, 139), (204, 140), (204, 141), (204, 142), (204, 143), (204, 144), (204, 145), (204, 146), (204, 147), (204, 148), (204, 150), (205, 51), (205, 59), (205, 60), (205, 61), (205, 62), (205, 63), (205, 64), (205, 65), (205, 66), (205, 67), (205, 68), (205, 69), (205, 70), (205, 71), (205, 104), (205, 106), (205, 107), (205, 108), (205, 109),
(205, 110), (205, 111), (205, 112), (205, 113), (205, 114), (205, 115), (205, 116), (205, 117), (205, 118), (205, 119), (205, 120), (205, 121), (205, 122), (205, 123), (205, 124), (205, 125), (205, 126), (205, 127), (205, 128), (205, 129), (205, 130), (205, 131), (205, 132), (205, 133), (205, 134), (205, 135), (205, 136), (205, 137), (205, 138), (205, 139), (205, 140), (205, 141), (205, 142), (205, 143), (205, 144), (205, 145), (205, 146), (205, 147), (205, 148), (205, 150), (206, 51), (206, 53), (206, 54), (206, 55), (206, 56), (206, 57), (206, 58), (206, 59), (206, 72), (206, 73), (206, 74), (206, 75), (206, 76), (206, 77), (206, 78), (206, 79), (206, 80), (206, 104), (206, 106), (206, 107), (206, 108), (206, 109), (206, 110), (206, 111), (206, 112), (206, 113), (206, 114), (206, 115), (206, 116), (206, 117), (206, 118), (206, 119),
(206, 120), (206, 121), (206, 122), (206, 123), (206, 124), (206, 125), (206, 126), (206, 127), (206, 128), (206, 129), (206, 130), (206, 131), (206, 132), (206, 133), (206, 134), (206, 135), (206, 136), (206, 137), (206, 138), (206, 139), (206, 140), (206, 141), (206, 142), (206, 143), (206, 144), (206, 145), (206, 146), (206, 147), (206, 148), (206, 149), (206, 151), (207, 50), (207, 52), (207, 53), (207, 54), (207, 55), (207, 56), (207, 57), (207, 58), (207, 59), (207, 60), (207, 61), (207, 62), (207, 63), (207, 64), (207, 65), (207, 66), (207, 67), (207, 68), (207, 69), (207, 70), (207, 71), (207, 81), (207, 82), (207, 83), (207, 103), (207, 105), (207, 106), (207, 107), (207, 108), (207, 109), (207, 110), (207, 111), (207, 112), (207, 113), (207, 114), (207, 115), (207, 116), (207, 117), (207, 118), (207, 119), (207, 120),
(207, 121), (207, 122), (207, 123), (207, 124), (207, 125), (207, 126), (207, 127), (207, 128), (207, 129), (207, 130), (207, 131), (207, 132), (207, 133), (207, 134), (207, 135), (207, 136), (207, 137), (207, 138), (207, 139), (207, 140), (207, 141), (207, 142), (207, 143), (207, 144), (207, 145), (207, 146), (207, 147), (207, 148), (207, 149), (207, 151), (208, 50), (208, 52), (208, 53), (208, 54), (208, 55), (208, 56), (208, 57), (208, 58), (208, 59), (208, 60), (208, 61), (208, 62), (208, 63), (208, 64), (208, 65), (208, 66), (208, 67), (208, 68), (208, 69), (208, 70), (208, 71), (208, 72), (208, 73), (208, 74), (208, 75), (208, 76), (208, 77), (208, 78), (208, 79), (208, 80), (208, 85), (208, 86), (208, 102), (208, 104), (208, 105), (208, 106), (208, 107), (208, 108), (208, 109), (208, 110), (208, 111), (208, 112),
(208, 113), (208, 114), (208, 115), (208, 116), (208, 117), (208, 118), (208, 119), (208, 120), (208, 121), (208, 122), (208, 123), (208, 124), (208, 125), (208, 126), (208, 127), (208, 128), (208, 129), (208, 130), (208, 131), (208, 132), (208, 133), (208, 134), (208, 135), (208, 136), (208, 137), (208, 138), (208, 139), (208, 140), (208, 141), (208, 142), (208, 143), (208, 144), (208, 145), (208, 146), (208, 147), (208, 148), (208, 149), (208, 151), (209, 49), (209, 51), (209, 52), (209, 53), (209, 54), (209, 55), (209, 56), (209, 57), (209, 58), (209, 59), (209, 60), (209, 61), (209, 62), (209, 63), (209, 64), (209, 65), (209, 66), (209, 67), (209, 68), (209, 69), (209, 70), (209, 71), (209, 72), (209, 73), (209, 74), (209, 75), (209, 76), (209, 77), (209, 78), (209, 79), (209, 80), (209, 81), (209, 82), (209, 83),
(209, 84), (209, 87), (209, 88), (209, 100), (209, 101), (209, 103), (209, 104), (209, 105), (209, 106), (209, 107), (209, 108), (209, 109), (209, 110), (209, 111), (209, 112), (209, 113), (209, 114), (209, 115), (209, 116), (209, 117), (209, 118), (209, 119), (209, 120), (209, 121), (209, 122), (209, 123), (209, 124), (209, 125), (209, 126), (209, 127), (209, 128), (209, 129), (209, 130), (209, 131), (209, 132), (209, 133), (209, 134), (209, 135), (209, 136), (209, 137), (209, 138), (209, 139), (209, 140), (209, 141), (209, 142), (209, 143), (209, 144), (209, 145), (209, 146), (209, 147), (209, 148), (209, 149), (209, 150), (209, 152), (210, 48), (210, 50), (210, 51), (210, 52), (210, 53), (210, 54), (210, 55), (210, 56), (210, 57), (210, 58), (210, 59), (210, 60), (210, 61), (210, 62), (210, 63), (210, 64), (210, 65), (210, 66),
(210, 67), (210, 68), (210, 69), (210, 70), (210, 71), (210, 72), (210, 73), (210, 74), (210, 75), (210, 76), (210, 77), (210, 78), (210, 79), (210, 80), (210, 81), (210, 82), (210, 83), (210, 84), (210, 85), (210, 86), (210, 89), (210, 90), (210, 91), (210, 92), (210, 93), (210, 94), (210, 95), (210, 96), (210, 97), (210, 98), (210, 99), (210, 102), (210, 103), (210, 104), (210, 105), (210, 106), (210, 107), (210, 108), (210, 109), (210, 110), (210, 111), (210, 112), (210, 113), (210, 114), (210, 115), (210, 116), (210, 117), (210, 118), (210, 119), (210, 120), (210, 121), (210, 122), (210, 123), (210, 124), (210, 125), (210, 126), (210, 127), (210, 128), (210, 129), (210, 130), (210, 131), (210, 132), (210, 133), (210, 134), (210, 135), (210, 136), (210, 137), (210, 138), (210, 139), (210, 140), (210, 141), (210, 142),
(210, 143), (210, 144), (210, 145), (210, 146), (210, 147), (210, 148), (210, 149), (210, 150), (210, 152), (211, 47), (211, 49), (211, 50), (211, 51), (211, 52), (211, 53), (211, 54), (211, 55), (211, 56), (211, 57), (211, 58), (211, 59), (211, 60), (211, 61), (211, 62), (211, 63), (211, 64), (211, 65), (211, 66), (211, 67), (211, 68), (211, 69), (211, 70), (211, 71), (211, 72), (211, 73), (211, 74), (211, 75), (211, 76), (211, 77), (211, 78), (211, 79), (211, 80), (211, 81), (211, 82), (211, 83), (211, 84), (211, 85), (211, 86), (211, 87), (211, 88), (211, 99), (211, 100), (211, 101), (211, 102), (211, 103), (211, 104), (211, 105), (211, 106), (211, 107), (211, 108), (211, 109), (211, 110), (211, 111), (211, 112), (211, 113), (211, 114), (211, 115), (211, 116), (211, 117), (211, 118), (211, 119), (211, 120),
(211, 121), (211, 122), (211, 123), (211, 124), (211, 125), (211, 126), (211, 127), (211, 128), (211, 129), (211, 130), (211, 131), (211, 132), (211, 133), (211, 134), (211, 135), (211, 136), (211, 137), (211, 138), (211, 139), (211, 140), (211, 141), (211, 142), (211, 143), (211, 144), (211, 145), (211, 146), (211, 147), (211, 148), (211, 149), (211, 150), (211, 151), (211, 153), (212, 46), (212, 48), (212, 49), (212, 50), (212, 51), (212, 52), (212, 53), (212, 54), (212, 55), (212, 56), (212, 57), (212, 58), (212, 59), (212, 60), (212, 61), (212, 62), (212, 63), (212, 64), (212, 65), (212, 66), (212, 67), (212, 68), (212, 69), (212, 70), (212, 71), (212, 72), (212, 73), (212, 74), (212, 75), (212, 76), (212, 77), (212, 78), (212, 79), (212, 80), (212, 81), (212, 82), (212, 83), (212, 84), (212, 85), (212, 86),
(212, 87), (212, 88), (212, 89), (212, 90), (212, 91), (212, 92), (212, 93), (212, 94), (212, 95), (212, 96), (212, 97), (212, 98), (212, 99), (212, 100), (212, 101), (212, 102), (212, 103), (212, 104), (212, 105), (212, 106), (212, 107), (212, 108), (212, 109), (212, 110), (212, 111), (212, 112), (212, 113), (212, 114), (212, 115), (212, 116), (212, 117), (212, 118), (212, 119), (212, 120), (212, 121), (212, 122), (212, 123), (212, 124), (212, 125), (212, 126), (212, 127), (212, 128), (212, 129), (212, 130), (212, 131), (212, 132), (212, 133), (212, 134), (212, 135), (212, 136), (212, 137), (212, 138), (212, 139), (212, 140), (212, 141), (212, 142), (212, 143), (212, 144), (212, 145), (212, 146), (212, 147), (212, 148), (212, 149), (212, 150), (212, 151), (212, 153), (213, 45), (213, 47), (213, 48), (213, 49), (213, 50), (213, 51),
(213, 52), (213, 53), (213, 54), (213, 55), (213, 56), (213, 57), (213, 58), (213, 59), (213, 60), (213, 61), (213, 62), (213, 63), (213, 64), (213, 65), (213, 66), (213, 67), (213, 68), (213, 69), (213, 70), (213, 71), (213, 72), (213, 73), (213, 74), (213, 75), (213, 76), (213, 77), (213, 78), (213, 79), (213, 80), (213, 81), (213, 82), (213, 83), (213, 84), (213, 85), (213, 86), (213, 87), (213, 88), (213, 89), (213, 90), (213, 91), (213, 92), (213, 93), (213, 94), (213, 95), (213, 96), (213, 97), (213, 98), (213, 99), (213, 100), (213, 101), (213, 102), (213, 103), (213, 104), (213, 105), (213, 106), (213, 107), (213, 108), (213, 109), (213, 110), (213, 111), (213, 112), (213, 113), (213, 114), (213, 115), (213, 116), (213, 117), (213, 118), (213, 119), (213, 120), (213, 121), (213, 122), (213, 123),
(213, 124), (213, 125), (213, 126), (213, 127), (213, 128), (213, 129), (213, 130), (213, 131), (213, 132), (213, 133), (213, 134), (213, 135), (213, 136), (213, 137), (213, 138), (213, 139), (213, 140), (213, 141), (213, 142), (213, 143), (213, 144), (213, 145), (213, 146), (213, 147), (213, 148), (213, 149), (213, 150), (213, 151), (213, 152), (213, 154), (214, 43), (214, 46), (214, 47), (214, 48), (214, 49), (214, 50), (214, 51), (214, 52), (214, 53), (214, 54), (214, 55), (214, 56), (214, 57), (214, 58), (214, 59), (214, 60), (214, 61), (214, 62), (214, 63), (214, 64), (214, 65), (214, 66), (214, 67), (214, 68), (214, 69), (214, 70), (214, 71), (214, 72), (214, 73), (214, 74), (214, 75), (214, 76), (214, 77), (214, 78), (214, 79), (214, 80), (214, 81), (214, 82), (214, 83), (214, 84), (214, 85), (214, 86),
(214, 87), (214, 88), (214, 89), (214, 90), (214, 91), (214, 92), (214, 93), (214, 94), (214, 95), (214, 96), (214, 97), (214, 98), (214, 99), (214, 100), (214, 101), (214, 102), (214, 103), (214, 104), (214, 105), (214, 106), (214, 107), (214, 108), (214, 109), (214, 110), (214, 111), (214, 112), (214, 113), (214, 114), (214, 115), (214, 116), (214, 117), (214, 118), (214, 119), (214, 120), (214, 121), (214, 122), (214, 123), (214, 124), (214, 125), (214, 126), (214, 127), (214, 128), (214, 129), (214, 130), (214, 131), (214, 132), (214, 133), (214, 134), (214, 135), (214, 136), (214, 137), (214, 138), (214, 139), (214, 140), (214, 141), (214, 142), (214, 143), (214, 144), (214, 145), (214, 146), (214, 147), (214, 148), (214, 149), (214, 150), (214, 151), (214, 152), (214, 154), (215, 42), (215, 45), (215, 46), (215, 47), (215, 48),
(215, 49), (215, 50), (215, 51), (215, 52), (215, 53), (215, 54), (215, 55), (215, 56), (215, 57), (215, 58), (215, 59), (215, 60), (215, 61), (215, 62), (215, 63), (215, 64), (215, 65), (215, 66), (215, 67), (215, 68), (215, 69), (215, 70), (215, 71), (215, 72), (215, 73), (215, 74), (215, 75), (215, 76), (215, 77), (215, 78), (215, 79), (215, 80), (215, 81), (215, 82), (215, 83), (215, 84), (215, 85), (215, 86), (215, 87), (215, 88), (215, 89), (215, 90), (215, 91), (215, 92), (215, 93), (215, 94), (215, 95), (215, 96), (215, 97), (215, 98), (215, 99), (215, 100), (215, 101), (215, 102), (215, 103), (215, 104), (215, 105), (215, 106), (215, 107), (215, 108), (215, 109), (215, 110), (215, 111), (215, 112), (215, 113), (215, 114), (215, 115), (215, 116), (215, 117), (215, 118), (215, 119), (215, 120),
(215, 121), (215, 122), (215, 123), (215, 124), (215, 125), (215, 126), (215, 127), (215, 128), (215, 129), (215, 130), (215, 131), (215, 132), (215, 133), (215, 134), (215, 135), (215, 136), (215, 137), (215, 138), (215, 139), (215, 140), (215, 141), (215, 142), (215, 143), (215, 144), (215, 145), (215, 146), (215, 147), (215, 148), (215, 149), (215, 150), (215, 151), (215, 152), (215, 153), (215, 155), (216, 41), (216, 44), (216, 45), (216, 46), (216, 47), (216, 48), (216, 49), (216, 50), (216, 51), (216, 52), (216, 53), (216, 54), (216, 55), (216, 56), (216, 57), (216, 58), (216, 59), (216, 60), (216, 61), (216, 62), (216, 63), (216, 69), (216, 72), (216, 73), (216, 74), (216, 75), (216, 76), (216, 77), (216, 78), (216, 79), (216, 80), (216, 81), (216, 82), (216, 83), (216, 84), (216, 85), (216, 86), (216, 87),
(216, 88), (216, 89), (216, 90), (216, 91), (216, 92), (216, 93), (216, 94), (216, 95), (216, 96), (216, 97), (216, 98), (216, 99), (216, 100), (216, 101), (216, 102), (216, 103), (216, 104), (216, 105), (216, 106), (216, 107), (216, 108), (216, 109), (216, 110), (216, 111), (216, 112), (216, 113), (216, 114), (216, 115), (216, 116), (216, 117), (216, 118), (216, 119), (216, 120), (216, 121), (216, 122), (216, 123), (216, 124), (216, 125), (216, 126), (216, 127), (216, 128), (216, 129), (216, 130), (216, 131), (216, 132), (216, 133), (216, 134), (216, 135), (216, 136), (216, 137), (216, 138), (216, 139), (216, 140), (216, 141), (216, 142), (216, 143), (216, 144), (216, 145), (216, 146), (216, 147), (216, 148), (216, 149), (216, 150), (216, 151), (216, 152), (216, 153), (216, 155), (217, 40), (217, 42), (217, 43), (217, 44), (217, 45),
(217, 46), (217, 47), (217, 48), (217, 49), (217, 50), (217, 51), (217, 52), (217, 53), (217, 54), (217, 55), (217, 56), (217, 57), (217, 58), (217, 59), (217, 60), (217, 64), (217, 65), (217, 66), (217, 67), (217, 68), (217, 69), (217, 70), (217, 71), (217, 73), (217, 74), (217, 75), (217, 76), (217, 77), (217, 78), (217, 79), (217, 80), (217, 81), (217, 82), (217, 83), (217, 84), (217, 85), (217, 86), (217, 87), (217, 88), (217, 89), (217, 90), (217, 91), (217, 92), (217, 93), (217, 94), (217, 95), (217, 96), (217, 97), (217, 98), (217, 99), (217, 100), (217, 101), (217, 102), (217, 103), (217, 104), (217, 105), (217, 106), (217, 107), (217, 108), (217, 109), (217, 110), (217, 111), (217, 112), (217, 113), (217, 114), (217, 115), (217, 116), (217, 117), (217, 118), (217, 119), (217, 120), (217, 121),
(217, 122), (217, 123), (217, 124), (217, 125), (217, 126), (217, 127), (217, 128), (217, 129), (217, 130), (217, 131), (217, 132), (217, 133), (217, 134), (217, 135), (217, 136), (217, 137), (217, 138), (217, 139), (217, 140), (217, 141), (217, 142), (217, 143), (217, 144), (217, 145), (217, 146), (217, 147), (217, 148), (217, 149), (217, 150), (217, 151), (217, 152), (217, 153), (217, 154), (217, 156), (218, 40), (218, 42), (218, 43), (218, 44), (218, 45), (218, 46), (218, 47), (218, 48), (218, 49), (218, 50), (218, 51), (218, 52), (218, 53), (218, 54), (218, 55), (218, 56), (218, 57), (218, 61), (218, 62), (218, 63), (218, 72), (218, 74), (218, 75), (218, 76), (218, 77), (218, 78), (218, 79), (218, 80), (218, 81), (218, 82), (218, 83), (218, 84), (218, 85), (218, 86), (218, 87), (218, 88), (218, 89), (218, 90),
(218, 91), (218, 92), (218, 93), (218, 94), (218, 95), (218, 96), (218, 97), (218, 98), (218, 99), (218, 100), (218, 101), (218, 102), (218, 103), (218, 104), (218, 105), (218, 106), (218, 107), (218, 108), (218, 109), (218, 110), (218, 111), (218, 112), (218, 113), (218, 114), (218, 115), (218, 116), (218, 117), (218, 118), (218, 119), (218, 120), (218, 121), (218, 122), (218, 123), (218, 124), (218, 125), (218, 126), (218, 127), (218, 128), (218, 129), (218, 130), (218, 131), (218, 132), (218, 133), (218, 134), (218, 135), (218, 136), (218, 137), (218, 138), (218, 139), (218, 140), (218, 141), (218, 142), (218, 143), (218, 144), (218, 145), (218, 146), (218, 147), (218, 148), (218, 149), (218, 150), (218, 151), (218, 152), (218, 153), (218, 154), (218, 155), (219, 39), (219, 58), (219, 60), (219, 73), (219, 158), (220, 39), (220, 41),
(220, 42), (220, 43), (220, 44), (220, 45), (220, 46), (220, 47), (220, 48), (220, 49), (220, 50), (220, 51), (220, 52), (220, 53), (220, 54), (220, 55), (220, 56), (220, 57), (220, 73), (220, 75), (220, 76), (220, 77), (220, 78), (220, 79), (220, 80), (220, 81), (220, 82), (220, 83), (220, 84), (220, 85), (220, 86), (220, 87), (220, 88), (220, 89), (220, 90), (220, 91), (220, 92), (220, 93), (220, 94), (220, 95), (220, 96), (220, 97), (220, 98), (220, 99), (220, 100), (220, 101), (220, 102), (220, 103), (220, 104), (220, 105), (220, 106), (220, 107), (220, 108), (220, 109), (220, 110), (220, 111), (220, 112), (220, 113), (220, 114), (220, 115), (220, 116), (220, 117), (220, 118), (220, 119), (220, 120), (220, 121), (220, 122), (220, 123), (220, 124), (220, 125), (220, 126), (220, 127), (220, 128), (220, 129),
(220, 130), (220, 131), (220, 132), (220, 133), (220, 134), (220, 135), (220, 136), (220, 137), (220, 138), (220, 139), (220, 140), (220, 141), (220, 142), (220, 143), (220, 144), (220, 145), (220, 146), (220, 147), (220, 148), (220, 149), (220, 150), (220, 151), (220, 152), (220, 153), (220, 154), (220, 155), (220, 156), (220, 158), (225, 43), (225, 45), (225, 46), (225, 47), (225, 48), (225, 49), (225, 50), (225, 51), (225, 52), (225, 53), (225, 54), (225, 55), (225, 56), (225, 58), (225, 72), (225, 74), (225, 75), (225, 76), (225, 77), (225, 78), (225, 79), (225, 80), (225, 81), (225, 82), (225, 83), (225, 84), (225, 85), (225, 86), (225, 87), (225, 88), (225, 89), (225, 90), (225, 91), (225, 92), (225, 93), (225, 94), (225, 95), (225, 96), (225, 97), (225, 98), (225, 99), (225, 100), (225, 101), (225, 102),
(225, 103), (225, 104), (225, 105), (225, 106), (225, 107), (225, 108), (225, 109), (225, 110), (225, 111), (225, 112), (225, 113), (225, 114), (225, 115), (225, 116), (225, 117), (225, 118), (225, 119), (225, 120), (225, 121), (225, 122), (225, 123), (225, 124), (225, 125), (225, 126), (225, 127), (225, 128), (225, 129), (225, 130), (225, 131), (225, 132), (225, 133), (225, 134), (225, 135), (225, 136), (225, 137), (225, 138), (225, 139), (225, 140), (225, 141), (225, 142), (225, 143), (225, 144), (225, 145), (225, 146), (225, 147), (225, 148), (225, 149), (225, 150), (225, 151), (225, 152), (225, 153), (225, 154), (225, 155), (225, 156), (225, 158), (226, 44), (226, 60), (226, 70), (226, 158), (227, 45), (227, 48), (227, 49), (227, 50), (227, 51), (227, 52), (227, 53), (227, 54), (227, 55), (227, 56), (227, 57), (227, 58), (227, 61),
(227, 69), (227, 72), (227, 73), (227, 74), (227, 75), (227, 76), (227, 77), (227, 78), (227, 79), (227, 80), (227, 81), (227, 82), (227, 83), (227, 84), (227, 85), (227, 86), (227, 87), (227, 88), (227, 89), (227, 90), (227, 91), (227, 92), (227, 93), (227, 94), (227, 95), (227, 96), (227, 97), (227, 98), (227, 99), (227, 100), (227, 101), (227, 102), (227, 103), (227, 104), (227, 105), (227, 106), (227, 107), (227, 108), (227, 109), (227, 110), (227, 111), (227, 112), (227, 113), (227, 114), (227, 115), (227, 116), (227, 117), (227, 118), (227, 119), (227, 120), (227, 121), (227, 122), (227, 123), (227, 124), (227, 125), (227, 126), (227, 127), (227, 128), (227, 129), (227, 130), (227, 131), (227, 132), (227, 133), (227, 134), (227, 135), (227, 136), (227, 137), (227, 138), (227, 139), (227, 140), (227, 141), (227, 142),
(227, 143), (227, 144), (227, 145), (227, 146), (227, 147), (227, 148), (227, 149), (227, 150), (227, 151), (227, 152), (227, 153), (227, 154), (227, 155), (227, 157), (228, 47), (228, 49), (228, 50), (228, 51), (228, 52), (228, 53), (228, 54), (228, 55), (228, 56), (228, 57), (228, 58), (228, 59), (228, 60), (228, 63), (228, 64), (228, 65), (228, 66), (228, 67), (228, 70), (228, 71), (228, 72), (228, 73), (228, 74), (228, 75), (228, 76), (228, 77), (228, 78), (228, 79), (228, 80), (228, 81), (228, 82), (228, 83), (228, 84), (228, 85), (228, 86), (228, 87), (228, 88), (228, 89), (228, 90), (228, 91), (228, 92), (228, 93), (228, 94), (228, 95), (228, 96), (228, 97), (228, 98), (228, 99), (228, 100), (228, 101), (228, 102), (228, 103), (228, 104), (228, 105), (228, 106), (228, 107), (228, 108), (228, 109),
(228, 110), (228, 111), (228, 112), (228, 113), (228, 114), (228, 115), (228, 116), (228, 117), (228, 118), (228, 119), (228, 120), (228, 121), (228, 122), (228, 123), (228, 124), (228, 125), (228, 126), (228, 127), (228, 128), (228, 129), (228, 130), (228, 131), (228, 132), (228, 133), (228, 134), (228, 135), (228, 136), (228, 137), (228, 138), (228, 139), (228, 140), (228, 141), (228, 142), (228, 143), (228, 144), (228, 145), (228, 146), (228, 147), (228, 148), (228, 149), (228, 150), (228, 151), (228, 152), (228, 153), (228, 154), (228, 155), (228, 157), (229, 48), (229, 50), (229, 51), (229, 52), (229, 53), (229, 54), (229, 55), (229, 56), (229, 57), (229, 58), (229, 59), (229, 60), (229, 61), (229, 62), (229, 69), (229, 70), (229, 71), (229, 72), (229, 73), (229, 74), (229, 75), (229, 76), (229, 77), (229, 78), (229, 79),
(229, 80), (229, 81), (229, 82), (229, 83), (229, 84), (229, 85), (229, 86), (229, 87), (229, 88), (229, 89), (229, 90), (229, 91), (229, 92), (229, 93), (229, 94), (229, 95), (229, 96), (229, 97), (229, 98), (229, 99), (229, 100), (229, 101), (229, 102), (229, 103), (229, 104), (229, 105), (229, 106), (229, 107), (229, 108), (229, 109), (229, 110), (229, 111), (229, 112), (229, 113), (229, 114), (229, 115), (229, 116), (229, 117), (229, 118), (229, 119), (229, 120), (229, 121), (229, 122), (229, 123), (229, 124), (229, 125), (229, 126), (229, 127), (229, 128), (229, 129), (229, 130), (229, 131), (229, 132), (229, 133), (229, 134), (229, 135), (229, 136), (229, 137), (229, 138), (229, 139), (229, 140), (229, 141), (229, 142), (229, 143), (229, 144), (229, 145), (229, 146), (229, 147), (229, 148), (229, 149), (229, 150), (229, 151),
(229, 152), (229, 153), (229, 154), (229, 155), (229, 157), (230, 49), (230, 51), (230, 52), (230, 53), (230, 54), (230, 55), (230, 56), (230, 57), (230, 58), (230, 59), (230, 60), (230, 61), (230, 62), (230, 63), (230, 64), (230, 65), (230, 66), (230, 67), (230, 68), (230, 69), (230, 70), (230, 71), (230, 72), (230, 73), (230, 74), (230, 75), (230, 76), (230, 77), (230, 78), (230, 79), (230, 80), (230, 81), (230, 82), (230, 83), (230, 84), (230, 85), (230, 86), (230, 87), (230, 88), (230, 89), (230, 90), (230, 91), (230, 92), (230, 93), (230, 94), (230, 95), (230, 96), (230, 97), (230, 98), (230, 99), (230, 100), (230, 101), (230, 102), (230, 103), (230, 104), (230, 105), (230, 106), (230, 107), (230, 108), (230, 109), (230, 110), (230, 111), (230, 112), (230, 113), (230, 114), (230, 115), (230, 116),
(230, 117), (230, 118), (230, 119), (230, 120), (230, 121), (230, 122), (230, 123), (230, 124), (230, 125), (230, 126), (230, 127), (230, 128), (230, 129), (230, 130), (230, 131), (230, 132), (230, 133), (230, 134), (230, 135), (230, 136), (230, 137), (230, 138), (230, 139), (230, 140), (230, 141), (230, 142), (230, 143), (230, 144), (230, 145), (230, 146), (230, 147), (230, 148), (230, 149), (230, 150), (230, 151), (230, 152), (230, 153), (230, 154), (230, 155), (230, 157), (231, 50), (231, 52), (231, 53), (231, 54), (231, 55), (231, 56), (231, 57), (231, 58), (231, 59), (231, 60), (231, 61), (231, 62), (231, 63), (231, 64), (231, 65), (231, 66), (231, 67), (231, 68), (231, 69), (231, 70), (231, 71), (231, 72), (231, 73), (231, 74), (231, 75), (231, 76), (231, 77), (231, 78), (231, 79), (231, 80), (231, 81), (231, 82),
(231, 83), (231, 84), (231, 85), (231, 86), (231, 87), (231, 88), (231, 89), (231, 90), (231, 91), (231, 92), (231, 93), (231, 94), (231, 95), (231, 96), (231, 97), (231, 98), (231, 99), (231, 100), (231, 101), (231, 102), (231, 103), (231, 104), (231, 105), (231, 106), (231, 107), (231, 108), (231, 109), (231, 110), (231, 111), (231, 112), (231, 113), (231, 114), (231, 115), (231, 116), (231, 117), (231, 118), (231, 119), (231, 120), (231, 121), (231, 122), (231, 123), (231, 124), (231, 125), (231, 126), (231, 127), (231, 128), (231, 129), (231, 130), (231, 131), (231, 132), (231, 133), (231, 134), (231, 135), (231, 136), (231, 137), (231, 138), (231, 139), (231, 140), (231, 141), (231, 142), (231, 143), (231, 144), (231, 145), (231, 146), (231, 147), (231, 148), (231, 149), (231, 150), (231, 151), (231, 152), (231, 153), (231, 154),
(231, 156), (232, 51), (232, 53), (232, 54), (232, 55), (232, 56), (232, 57), (232, 58), (232, 59), (232, 60), (232, 61), (232, 62), (232, 63), (232, 64), (232, 65), (232, 66), (232, 67), (232, 68), (232, 69), (232, 70), (232, 71), (232, 72), (232, 73), (232, 74), (232, 75), (232, 76), (232, 77), (232, 78), (232, 79), (232, 80), (232, 81), (232, 82), (232, 83), (232, 84), (232, 85), (232, 86), (232, 87), (232, 88), (232, 89), (232, 90), (232, 91), (232, 92), (232, 93), (232, 94), (232, 95), (232, 96), (232, 97), (232, 98), (232, 99), (232, 100), (232, 101), (232, 102), (232, 103), (232, 104), (232, 105), (232, 106), (232, 107), (232, 108), (232, 109), (232, 110), (232, 111), (232, 112), (232, 113), (232, 114), (232, 115), (232, 116), (232, 117), (232, 118), (232, 119), (232, 120), (232, 121), (232, 122),
(232, 123), (232, 124), (232, 125), (232, 126), (232, 127), (232, 128), (232, 129), (232, 130), (232, 131), (232, 132), (232, 133), (232, 134), (232, 135), (232, 136), (232, 137), (232, 138), (232, 139), (232, 140), (232, 141), (232, 142), (232, 143), (232, 144), (232, 145), (232, 146), (232, 147), (232, 148), (232, 149), (232, 150), (232, 151), (232, 152), (232, 153), (232, 154), (232, 156), (233, 52), (233, 54), (233, 55), (233, 56), (233, 57), (233, 58), (233, 59), (233, 60), (233, 61), (233, 62), (233, 63), (233, 64), (233, 65), (233, 66), (233, 67), (233, 68), (233, 69), (233, 70), (233, 71), (233, 72), (233, 73), (233, 74), (233, 75), (233, 76), (233, 77), (233, 78), (233, 79), (233, 80), (233, 81), (233, 82), (233, 83), (233, 84), (233, 85), (233, 86), (233, 87), (233, 88), (233, 89), (233, 90), (233, 91),
(233, 92), (233, 93), (233, 94), (233, 95), (233, 96), (233, 97), (233, 98), (233, 99), (233, 100), (233, 101), (233, 102), (233, 103), (233, 104), (233, 105), (233, 106), (233, 107), (233, 108), (233, 109), (233, 110), (233, 111), (233, 112), (233, 113), (233, 114), (233, 115), (233, 116), (233, 117), (233, 118), (233, 119), (233, 120), (233, 121), (233, 122), (233, 123), (233, 124), (233, 125), (233, 126), (233, 127), (233, 128), (233, 129), (233, 130), (233, 131), (233, 132), (233, 133), (233, 134), (233, 135), (233, 136), (233, 137), (233, 138), (233, 139), (233, 140), (233, 141), (233, 142), (233, 143), (233, 144), (233, 145), (233, 146), (233, 147), (233, 148), (233, 149), (233, 150), (233, 151), (233, 152), (233, 153), (233, 154), (233, 156), (234, 52), (234, 54), (234, 55), (234, 56), (234, 57), (234, 58), (234, 59), (234, 60),
(234, 61), (234, 62), (234, 63), (234, 64), (234, 65), (234, 66), (234, 67), (234, 68), (234, 69), (234, 70), (234, 71), (234, 72), (234, 73), (234, 74), (234, 75), (234, 76), (234, 77), (234, 78), (234, 79), (234, 80), (234, 81), (234, 85), (234, 86), (234, 101), (234, 102), (234, 103), (234, 104), (234, 105), (234, 106), (234, 107), (234, 108), (234, 109), (234, 110), (234, 111), (234, 112), (234, 113), (234, 114), (234, 115), (234, 116), (234, 117), (234, 118), (234, 119), (234, 120), (234, 121), (234, 122), (234, 123), (234, 124), (234, 125), (234, 126), (234, 127), (234, 128), (234, 129), (234, 130), (234, 131), (234, 132), (234, 133), (234, 134), (234, 135), (234, 136), (234, 137), (234, 138), (234, 139), (234, 140), (234, 141), (234, 142), (234, 143), (234, 144), (234, 145), (234, 146), (234, 147), (234, 148), (234, 149),
(234, 150), (234, 151), (234, 152), (234, 156), (235, 53), (235, 55), (235, 56), (235, 57), (235, 58), (235, 59), (235, 60), (235, 61), (235, 62), (235, 63), (235, 64), (235, 65), (235, 66), (235, 67), (235, 68), (235, 69), (235, 70), (235, 71), (235, 72), (235, 73), (235, 74), (235, 75), (235, 76), (235, 77), (235, 78), (235, 79), (235, 80), (235, 81), (235, 83), (235, 84), (235, 85), (235, 86), (235, 87), (235, 88), (235, 89), (235, 90), (235, 91), (235, 92), (235, 93), (235, 94), (235, 95), (235, 96), (235, 97), (235, 98), (235, 99), (235, 102), (235, 103), (235, 104), (235, 105), (235, 106), (235, 107), (235, 108), (235, 109), (235, 110), (235, 111), (235, 112), (235, 113), (235, 114), (235, 115), (235, 116), (235, 117), (235, 118), (235, 119), (235, 120), (235, 121), (235, 122), (235, 123), (235, 124),
(235, 125), (235, 126), (235, 127), (235, 128), (235, 129), (235, 130), (235, 131), (235, 132), (235, 133), (235, 134), (235, 135), (235, 136), (235, 137), (235, 138), (235, 139), (235, 140), (235, 141), (235, 142), (235, 143), (235, 144), (235, 145), (235, 146), (235, 147), (235, 148), (235, 149), (235, 150), (235, 153), (235, 155), (236, 53), (236, 55), (236, 56), (236, 57), (236, 58), (236, 59), (236, 60), (236, 61), (236, 62), (236, 63), (236, 64), (236, 65), (236, 66), (236, 67), (236, 68), (236, 69), (236, 70), (236, 71), (236, 72), (236, 73), (236, 74), (236, 75), (236, 76), (236, 77), (236, 78), (236, 79), (236, 81), (236, 101), (236, 103), (236, 104), (236, 105), (236, 106), (236, 107), (236, 108), (236, 109), (236, 110), (236, 111), (236, 112), (236, 113), (236, 114), (236, 115), (236, 116), (236, 117), (236, 118),
(236, 119), (236, 120), (236, 121), (236, 122), (236, 123), (236, 124), (236, 125), (236, 126), (236, 127), (236, 128), (236, 129), (236, 130), (236, 131), (236, 132), (236, 133), (236, 134), (236, 135), (236, 136), (236, 137), (236, 138), (236, 139), (236, 140), (236, 141), (236, 142), (236, 143), (236, 144), (236, 145), (236, 146), (236, 147), (236, 148), (236, 149), (236, 152), (237, 54), (237, 56), (237, 57), (237, 58), (237, 59), (237, 60), (237, 61), (237, 62), (237, 63), (237, 64), (237, 65), (237, 66), (237, 67), (237, 68), (237, 69), (237, 70), (237, 81), (237, 102), (237, 104), (237, 105), (237, 106), (237, 107), (237, 108), (237, 109), (237, 110), (237, 111), (237, 112), (237, 113), (237, 114), (237, 115), (237, 116), (237, 117), (237, 118), (237, 119), (237, 120), (237, 121), (237, 122), (237, 123), (237, 124), (237, 125),
(237, 126), (237, 127), (237, 128), (237, 129), (237, 130), (237, 131), (237, 132), (237, 133), (237, 134), (237, 135), (237, 136), (237, 137), (237, 138), (237, 139), (237, 140), (237, 141), (237, 142), (237, 143), (237, 144), (237, 145), (237, 146), (237, 147), (237, 150), (238, 54), (238, 56), (238, 57), (238, 58), (238, 59), (238, 60), (238, 61), (238, 62), (238, 63), (238, 64), (238, 71), (238, 72), (238, 73), (238, 74), (238, 75), (238, 76), (238, 77), (238, 78), (238, 80), (238, 103), (238, 105), (238, 106), (238, 107), (238, 108), (238, 109), (238, 110), (238, 111), (238, 112), (238, 113), (238, 114), (238, 115), (238, 116), (238, 117), (238, 118), (238, 119), (238, 120), (238, 121), (238, 122), (238, 123), (238, 124), (238, 125), (238, 126), (238, 127), (238, 128), (238, 129), (238, 130), (238, 131), (238, 132), (238, 133),
(238, 134), (238, 135), (238, 136), (238, 137), (238, 138), (238, 139), (238, 140), (238, 141), (238, 142), (238, 143), (238, 144), (238, 145), (238, 146), (238, 149), (239, 54), (239, 65), (239, 66), (239, 67), (239, 68), (239, 69), (239, 70), (239, 104), (239, 106), (239, 107), (239, 108), (239, 109), (239, 110), (239, 111), (239, 112), (239, 113), (239, 114), (239, 115), (239, 116), (239, 117), (239, 118), (239, 119), (239, 120), (239, 121), (239, 122), (239, 123), (239, 124), (239, 125), (239, 126), (239, 127), (239, 128), (239, 129), (239, 130), (239, 131), (239, 132), (239, 133), (239, 134), (239, 135), (239, 136), (239, 137), (239, 138), (239, 139), (239, 140), (239, 141), (239, 142), (239, 143), (239, 144), (239, 145), (240, 54), (240, 56), (240, 57), (240, 58), (240, 59), (240, 60), (240, 61), (240, 62), (240, 63), (240, 64),
(240, 104), (240, 106), (240, 107), (240, 108), (240, 109), (240, 110), (240, 111), (240, 112), (240, 113), (240, 114), (240, 115), (240, 116), (240, 117), (240, 118), (240, 119), (240, 120), (240, 121), (240, 122), (240, 123), (240, 124), (240, 125), (240, 126), (240, 127), (240, 128), (240, 129), (240, 130), (240, 131), (240, 132), (240, 133), (240, 134), (240, 135), (240, 136), (240, 137), (240, 138), (240, 139), (240, 140), (240, 141), (240, 142), (240, 143), (240, 144), (240, 146), (241, 54), (241, 55), (241, 104), (241, 106), (241, 107), (241, 108), (241, 109), (241, 110), (241, 111), (241, 112), (241, 113), (241, 114), (241, 115), (241, 116), (241, 117), (241, 118), (241, 119), (241, 120), (241, 121), (241, 122), (241, 123), (241, 124), (241, 125), (241, 126), (241, 127), (241, 128), (241, 129), (241, 130), (241, 131), (241, 132), (241, 133),
(241, 134), (241, 135), (241, 136), (241, 137), (241, 138), (241, 139), (241, 140), (241, 141), (241, 142), (241, 143), (241, 145), (242, 103), (242, 105), (242, 106), (242, 107), (242, 108), (242, 109), (242, 110), (242, 111), (242, 112), (242, 113), (242, 114), (242, 115), (242, 116), (242, 117), (242, 118), (242, 119), (242, 120), (242, 121), (242, 122), (242, 123), (242, 124), (242, 125), (242, 126), (242, 127), (242, 128), (242, 129), (242, 130), (242, 131), (242, 132), (242, 133), (242, 134), (242, 135), (242, 136), (242, 137), (242, 138), (242, 139), (242, 140), (242, 141), (242, 142), (243, 100), (243, 101), (243, 104), (243, 105), (243, 106), (243, 107), (243, 108), (243, 109), (243, 110), (243, 111), (243, 112), (243, 113), (243, 114), (243, 115), (243, 116), (243, 117), (243, 118), (243, 119), (243, 120), (243, 121), (243, 122), (243, 123),
(243, 124), (243, 125), (243, 126), (243, 127), (243, 128), (243, 129), (243, 130), (243, 131), (243, 132), (243, 133), (243, 134), (243, 135), (243, 136), (243, 137), (243, 138), (243, 139), (243, 140), (243, 141), (243, 142), (243, 144), (244, 90), (244, 91), (244, 92), (244, 93), (244, 94), (244, 95), (244, 96), (244, 97), (244, 98), (244, 99), (244, 103), (244, 104), (244, 105), (244, 106), (244, 107), (244, 108), (244, 109), (244, 110), (244, 111), (244, 112), (244, 113), (244, 114), (244, 115), (244, 116), (244, 117), (244, 118), (244, 119), (244, 120), (244, 121), (244, 122), (244, 123), (244, 124), (244, 125), (244, 126), (244, 127), (244, 128), (244, 129), (244, 130), (244, 131), (244, 132), (244, 133), (244, 134), (244, 135), (244, 136), (244, 137), (244, 138), (244, 139), (244, 140), (244, 141), (244, 143), (245, 86), (245, 88),
(245, 89), (245, 100), (245, 101), (245, 102), (245, 103), (245, 104), (245, 105), (245, 106), (245, 107), (245, 108), (245, 109), (245, 110), (245, 111), (245, 112), (245, 113), (245, 114), (245, 115), (245, 116), (245, 117), (245, 118), (245, 119), (245, 120), (245, 121), (245, 122), (245, 123), (245, 124), (245, 125), (245, 126), (245, 127), (245, 128), (245, 129), (245, 130), (245, 131), (245, 132), (245, 133), (245, 134), (245, 135), (245, 136), (245, 137), (245, 138), (245, 139), (245, 140), (245, 142), (246, 84), (246, 90), (246, 91), (246, 92), (246, 93), (246, 94), (246, 95), (246, 96), (246, 97), (246, 98), (246, 99), (246, 100), (246, 101), (246, 102), (246, 103), (246, 104), (246, 105), (246, 106), (246, 107), (246, 108), (246, 109), (246, 110), (246, 111), (246, 112), (246, 113), (246, 114), (246, 115), (246, 116), (246, 117),
(246, 118), (246, 119), (246, 120), (246, 121), (246, 122), (246, 123), (246, 124), (246, 125), (246, 126), (246, 127), (246, 128), (246, 129), (246, 130), (246, 131), (246, 132), (246, 133), (246, 134), (246, 135), (246, 136), (246, 137), (246, 138), (246, 139), (246, 141), (247, 83), (247, 86), (247, 87), (247, 88), (247, 89), (247, 90), (247, 91), (247, 92), (247, 93), (247, 94), (247, 95), (247, 96), (247, 97), (247, 98), (247, 99), (247, 100), (247, 101), (247, 102), (247, 103), (247, 104), (247, 105), (247, 106), (247, 107), (247, 108), (247, 109), (247, 110), (247, 111), (247, 112), (247, 113), (247, 114), (247, 115), (247, 116), (247, 117), (247, 118), (247, 119), (247, 120), (247, 121), (247, 122), (247, 123), (247, 124), (247, 125), (247, 126), (247, 127), (247, 128), (247, 129), (247, 130), (247, 131), (247, 132), (247, 133),
(247, 134), (247, 135), (247, 136), (247, 137), (247, 138), (247, 140), (248, 83), (248, 118), (248, 119), (248, 120), (248, 121), (248, 122), (248, 123), (248, 125), (248, 126), (248, 127), (248, 128), (248, 129), (248, 130), (248, 131), (248, 132), (248, 133), (248, 134), (248, 135), (248, 136), (248, 137), (248, 139), (249, 83), (249, 85), (249, 86), (249, 87), (249, 88), (249, 89), (249, 90), (249, 91), (249, 92), (249, 93), (249, 94), (249, 95), (249, 96), (249, 97), (249, 98), (249, 99), (249, 100), (249, 101), (249, 102), (249, 103), (249, 104), (249, 105), (249, 106), (249, 107), (249, 108), (249, 109), (249, 110), (249, 111), (249, 112), (249, 113), (249, 114), (249, 115), (249, 116), (249, 117), (249, 120), (249, 121), (249, 124), (249, 128), (249, 129), (249, 130), (249, 131), (249, 132), (249, 133), (249, 134), (249, 135),
(249, 136), (249, 138), (250, 83), (250, 118), (250, 121), (250, 122), (250, 126), (250, 130), (250, 131), (250, 132), (250, 133), (250, 134), (250, 137), (251, 128), (251, 136), (252, 121), (252, 130), (252, 132), (252, 134), )
coordinates_F8F8FF = ((164, 154),
(164, 155), (164, 156), (164, 157), (164, 158), (164, 159), (165, 151), (165, 153), (165, 161), (166, 151), (166, 154), (166, 155), (166, 156), (166, 157), (166, 158), (166, 159), (166, 161), (167, 150), (167, 152), (167, 153), (167, 154), (167, 155), (167, 156), (167, 157), (167, 158), (167, 160), (168, 150), (168, 152), (168, 153), (168, 154), (168, 155), (168, 156), (168, 157), (168, 159), (169, 149), (169, 151), (169, 152), (169, 153), (169, 154), (169, 155), (169, 156), (169, 158), (170, 148), (170, 150), (170, 151), (170, 152), (170, 153), (170, 154), (170, 155), (170, 156), (170, 158), (171, 147), (171, 149), (171, 150), (171, 151), (171, 152), (171, 153), (171, 154), (171, 155), (171, 156), (171, 158), (172, 146), (172, 148), (172, 149), (172, 150), (172, 151), (172, 152), (172, 153), (172, 154), (172, 155), (172, 156), (172, 158), (173, 146),
(173, 148), (173, 149), (173, 150), (173, 151), (173, 152), (173, 153), (173, 154), (173, 155), (173, 156), (173, 158), (174, 145), (174, 148), (174, 149), (174, 150), (174, 151), (174, 152), (174, 153), (174, 154), (174, 155), (174, 156), (174, 157), (174, 159), (175, 145), (175, 147), (175, 150), (175, 151), (175, 152), (175, 153), (175, 154), (175, 155), (175, 156), (175, 157), (175, 159), (176, 148), (176, 149), (176, 152), (176, 153), (176, 154), (176, 155), (176, 156), (176, 157), (176, 159), (177, 150), (177, 153), (177, 154), (177, 155), (177, 156), (177, 157), (177, 158), (177, 160), (178, 154), (178, 155), (178, 156), (178, 157), (178, 158), (178, 160), (179, 153), (179, 155), (179, 156), (179, 157), (179, 158), (179, 159), (179, 161), (180, 153), (180, 155), (180, 156), (180, 157), (180, 158), (180, 159), (180, 160), (180, 162), (181, 139),
(181, 154), (181, 156), (181, 157), (181, 158), (181, 159), (181, 160), (181, 162), (182, 139), (182, 155), (182, 157), (182, 158), (182, 159), (182, 160), (182, 161), (183, 138), (183, 155), (183, 157), (183, 158), (183, 159), (183, 160), (183, 161), (183, 162), (183, 165), (184, 137), (184, 156), (184, 158), (184, 159), (184, 160), (184, 161), (184, 162), (184, 163), (184, 164), (184, 166), (185, 136), (185, 137), (185, 156), (185, 158), (185, 159), (185, 160), (185, 161), (185, 162), (185, 163), (185, 164), (185, 165), (186, 135), (186, 137), (186, 157), (186, 159), (186, 160), (186, 161), (186, 162), (186, 163), (186, 164), (186, 165), (186, 166), (186, 169), (187, 134), (187, 136), (187, 137), (187, 157), (187, 159), (187, 160), (187, 161), (187, 162), (187, 163), (187, 164), (187, 165), (187, 166), (187, 167), (187, 170), (188, 133), (188, 135),
(188, 137), (188, 158), (188, 160), (188, 161), (188, 162), (188, 163), (188, 164), (188, 165), (188, 166), (188, 167), (188, 168), (189, 121), (189, 124), (189, 132), (189, 134), (189, 135), (189, 136), (189, 138), (189, 158), (189, 160), (189, 161), (189, 162), (189, 163), (189, 164), (189, 165), (189, 166), (189, 167), (189, 168), (189, 169), (189, 172), (189, 174), (190, 120), (190, 133), (190, 134), (190, 135), (190, 136), (190, 137), (190, 139), (190, 158), (190, 160), (190, 161), (190, 162), (190, 163), (190, 164), (190, 165), (190, 166), (190, 167), (190, 168), (190, 169), (190, 170), (190, 171), (190, 174), (191, 123), (191, 125), (191, 129), (191, 132), (191, 133), (191, 134), (191, 135), (191, 136), (191, 137), (191, 138), (191, 140), (191, 159), (191, 161), (191, 162), (191, 163), (191, 164), (191, 165), (191, 166), (191, 167), (191, 168),
(191, 169), (191, 170), (191, 171), (191, 172), (191, 174), (192, 127), (192, 128), (192, 133), (192, 134), (192, 135), (192, 136), (192, 137), (192, 138), (192, 139), (192, 142), (192, 159), (192, 161), (192, 162), (192, 163), (192, 164), (192, 165), (192, 166), (192, 167), (192, 168), (192, 169), (192, 170), (192, 171), (192, 172), (192, 174), (193, 130), (193, 132), (193, 136), (193, 137), (193, 138), (193, 139), (193, 140), (193, 144), (193, 159), (193, 161), (193, 162), (193, 163), (193, 164), (193, 165), (193, 166), (193, 167), (193, 168), (193, 169), (193, 170), (193, 171), (193, 173), (194, 133), (194, 134), (194, 135), (194, 139), (194, 140), (194, 141), (194, 142), (194, 145), (194, 146), (194, 147), (194, 160), (194, 162), (194, 163), (194, 164), (194, 165), (194, 166), (194, 167), (194, 168), (194, 169), (194, 170), (194, 171), (194, 173),
(195, 136), (195, 137), (195, 138), (195, 142), (195, 143), (195, 144), (195, 148), (195, 160), (195, 164), (195, 165), (195, 166), (195, 167), (195, 168), (195, 169), (195, 170), (195, 171), (195, 173), (196, 139), (196, 140), (196, 141), (196, 145), (196, 146), (196, 148), (196, 161), (196, 162), (196, 163), (196, 166), (196, 167), (196, 168), (196, 169), (196, 170), (196, 172), (197, 142), (197, 144), (197, 148), (197, 164), (197, 165), (197, 168), (197, 169), (197, 171), (198, 145), (198, 146), (198, 149), (198, 166), (198, 167), (198, 169), (198, 171), (199, 147), (199, 149), (199, 168), (199, 170), (200, 150), (200, 169), (200, 170), (201, 151), (201, 170), (202, 152), (202, 170), (203, 152), (204, 152), (204, 155), (205, 153), (205, 156), (205, 169), (206, 153), (206, 155), (206, 158), (206, 169), (207, 153), (207, 155), (207, 156), (207, 160),
(207, 161), (207, 167), (207, 169), (208, 154), (208, 156), (208, 157), (208, 158), (208, 162), (208, 163), (208, 164), (208, 165), (208, 166), (208, 169), (209, 154), (209, 156), (209, 157), (209, 158), (209, 159), (209, 160), (209, 161), (209, 167), (209, 169), (210, 155), (210, 156), (210, 157), (210, 158), (210, 159), (210, 160), (210, 161), (210, 162), (210, 163), (210, 164), (210, 165), (210, 166), (210, 167), (210, 169), (211, 155), (211, 157), (211, 158), (211, 159), (211, 160), (211, 161), (211, 162), (211, 163), (211, 164), (211, 165), (211, 166), (211, 167), (211, 169), (212, 155), (212, 157), (212, 158), (212, 159), (212, 160), (212, 161), (212, 162), (212, 163), (212, 164), (212, 165), (212, 166), (212, 167), (212, 169), (213, 156), (213, 158), (213, 159), (213, 160), (213, 161), (213, 162), (213, 163), (213, 164), (213, 165), (213, 166),
(213, 167), (214, 156), (214, 158), (214, 159), (214, 160), (214, 161), (214, 162), (214, 163), (214, 164), (214, 165), (214, 166), (214, 168), (215, 157), (215, 159), (215, 160), (215, 161), (215, 162), (215, 167), (216, 158), (216, 163), (216, 164), (216, 166), (217, 159), (217, 161), (217, 162), (225, 160), (225, 162), (226, 160), (226, 164), (226, 166), (227, 160), (227, 162), (227, 163), (227, 167), (227, 169), (228, 159), (228, 161), (228, 162), (228, 163), (228, 164), (228, 165), (228, 166), (228, 171), (229, 159), (229, 161), (229, 162), (229, 163), (229, 164), (229, 165), (229, 166), (229, 167), (229, 168), (229, 170), (230, 159), (230, 161), (230, 162), (230, 163), (230, 164), (230, 165), (230, 166), (230, 167), (230, 169), (231, 159), (231, 161), (231, 162), (231, 163), (231, 164), (231, 165), (231, 166), (231, 168), (232, 158), (232, 160),
(232, 161), (232, 162), (232, 163), (232, 164), (232, 165), (232, 166), (232, 168), (233, 158), (233, 160), (233, 161), (233, 162), (233, 163), (233, 164), (233, 165), (233, 166), (233, 167), (233, 168), (233, 169), (234, 158), (234, 167), (234, 169), (235, 158), (235, 160), (235, 161), (235, 162), (235, 163), (235, 164), (235, 165), (235, 166), (235, 170), (236, 167), (236, 170), (237, 155), (237, 169), (237, 171), (238, 152), (238, 155), (238, 170), (238, 171), (239, 150), (239, 154), (239, 170), (239, 172), (240, 149), (240, 152), (240, 154), (240, 170), (240, 172), (241, 148), (241, 150), (241, 151), (241, 153), (241, 170), (241, 173), (242, 147), (242, 149), (242, 150), (242, 169), (242, 171), (242, 173), (243, 146), (243, 148), (243, 149), (243, 152), (243, 169), (243, 171), (243, 172), (243, 174), (244, 145), (244, 147), (244, 148), (244, 151),
(244, 168), (244, 170), (244, 171), (244, 172), (244, 174), (245, 144), (245, 146), (245, 147), (245, 150), (245, 167), (245, 169), (245, 170), (245, 171), (245, 172), (245, 174), (246, 143), (246, 146), (246, 149), (246, 166), (246, 168), (246, 169), (246, 170), (246, 171), (246, 172), (246, 174), (247, 143), (247, 145), (247, 148), (247, 165), (247, 167), (247, 168), (247, 169), (247, 170), (247, 171), (247, 172), (247, 174), (248, 142), (248, 144), (248, 164), (248, 166), (248, 167), (248, 168), (248, 169), (248, 170), (248, 171), (248, 172), (248, 174), (249, 141), (249, 143), (249, 145), (249, 163), (249, 165), (249, 166), (249, 167), (249, 168), (249, 169), (249, 170), (249, 171), (249, 172), (249, 174), (250, 140), (250, 142), (250, 144), (250, 162), (250, 164), (250, 165), (250, 166), (250, 167), (250, 168), (250, 169), (250, 170), (250, 171),
(250, 172), (250, 174), (251, 139), (251, 141), (251, 143), (251, 161), (251, 163), (251, 164), (251, 165), (251, 166), (251, 167), (251, 168), (251, 169), (251, 170), (251, 171), (251, 172), (251, 174), (252, 140), (252, 141), (252, 161), (252, 163), (252, 164), (252, 165), (252, 166), (252, 167), (252, 168), (252, 169), (252, 170), (252, 171), (252, 172), (252, 174), (253, 136), (253, 139), (253, 140), (253, 142), (253, 160), (253, 162), (253, 163), (253, 164), (253, 165), (253, 166), (253, 167), (253, 168), (253, 169), (253, 170), (253, 171), (253, 172), (253, 174), (254, 133), (254, 135), (254, 138), (254, 139), (254, 141), (254, 160), (254, 162), (254, 163), (254, 164), (254, 165), (254, 166), (254, 167), (254, 168), (254, 169), (254, 170), (254, 171), (254, 172), (254, 174), (255, 136), (255, 137), (255, 138), (255, 140), (255, 159), (255, 161),
(255, 162), (255, 163), (255, 164), (255, 165), (255, 166), (255, 167), (255, 168), (255, 169), (255, 170), (255, 174), (256, 134), (256, 136), (256, 137), (256, 138), (256, 140), (256, 159), (256, 161), (256, 162), (256, 163), (256, 164), (256, 165), (256, 166), (256, 167), (256, 168), (256, 169), (256, 172), (256, 174), (257, 135), (257, 137), (257, 138), (257, 140), (257, 159), (257, 161), (257, 162), (257, 163), (257, 164), (257, 165), (257, 166), (257, 167), (257, 170), (258, 136), (258, 138), (258, 140), (258, 158), (258, 160), (258, 161), (258, 162), (258, 163), (258, 164), (258, 165), (258, 166), (258, 169), (259, 136), (259, 138), (259, 140), (259, 158), (259, 160), (259, 161), (259, 162), (259, 163), (259, 164), (259, 165), (259, 167), (260, 137), (260, 140), (260, 157), (260, 159), (260, 160), (260, 161), (260, 162), (260, 163), (260, 164),
(260, 166), (261, 138), (261, 140), (261, 157), (261, 159), (261, 160), (261, 161), (261, 162), (261, 163), (261, 165), (262, 138), (262, 141), (262, 156), (262, 158), (262, 159), (262, 160), (262, 161), (262, 162), (262, 163), (262, 165), (263, 139), (263, 142), (263, 156), (263, 158), (263, 159), (263, 160), (263, 161), (263, 162), (263, 164), (264, 140), (264, 155), (264, 157), (264, 158), (264, 159), (264, 160), (264, 161), (264, 163), (265, 142), (265, 144), (265, 155), (265, 157), (265, 158), (265, 159), (265, 160), (265, 161), (265, 163), (266, 144), (266, 145), (266, 154), (266, 156), (266, 157), (266, 158), (266, 159), (266, 160), (266, 162), (267, 145), (267, 146), (267, 153), (267, 155), (267, 156), (267, 157), (267, 158), (267, 159), (267, 160), (267, 162), (268, 146), (268, 147), (268, 152), (268, 154), (268, 155), (268, 156), (268, 157),
(268, 158), (268, 159), (268, 160), (268, 162), (269, 147), (269, 150), (269, 153), (269, 154), (269, 155), (269, 156), (269, 157), (269, 158), (269, 159), (269, 161), (270, 148), (270, 152), (270, 153), (270, 154), (270, 155), (270, 156), (270, 157), (270, 158), (270, 159), (270, 161), (271, 151), (271, 152), (271, 153), (271, 154), (271, 155), (271, 156), (271, 157), (271, 158), (271, 159), (271, 161), (272, 149), (272, 151), (272, 152), (272, 153), (272, 154), (272, 155), (272, 156), (272, 157), (272, 158), (272, 159), (272, 161), (273, 150), (273, 152), (273, 153), (273, 154), (273, 155), (273, 156), (273, 157), (273, 158), (273, 159), (273, 160), (273, 162), (274, 151), (274, 153), (274, 154), (274, 155), (274, 156), (274, 157), (274, 158), (274, 159), (274, 160), (274, 162), (275, 152), (275, 154), (275, 155), (275, 156), (275, 157), (275, 158),
(275, 159), (275, 160), (275, 161), (275, 162), (275, 164), (276, 152), (276, 154), (276, 155), (276, 156), (276, 157), (276, 158), (276, 159), (276, 160), (276, 161), (276, 162), (276, 164), (277, 153), (277, 155), (277, 156), (277, 157), (277, 158), (277, 159), (277, 160), (277, 161), (277, 163), (278, 153), (278, 155), (278, 156), (278, 157), (278, 158), (278, 159), (278, 160), (278, 163), (279, 154), (279, 156), (279, 157), (279, 158), (279, 159), (279, 162), (280, 154), (280, 156), (280, 157), (280, 160), (281, 154), (281, 159), (282, 155), (282, 157), )
coordinates_F45DF4 = ((177, 144),
(177, 146), (178, 94), (178, 95), (178, 96), (178, 97), (178, 98), (178, 100), (178, 143), (178, 147), (178, 149), (179, 91), (179, 93), (179, 100), (179, 142), (179, 144), (179, 145), (179, 146), (179, 150), (180, 89), (180, 94), (180, 95), (180, 96), (180, 97), (180, 99), (180, 142), (180, 144), (180, 145), (180, 146), (180, 147), (180, 148), (180, 149), (180, 151), (181, 87), (181, 91), (181, 92), (181, 93), (181, 94), (181, 95), (181, 99), (181, 141), (181, 143), (181, 144), (181, 145), (181, 146), (181, 147), (181, 148), (181, 149), (181, 150), (181, 152), (182, 85), (182, 86), (182, 89), (182, 90), (182, 91), (182, 92), (182, 97), (182, 141), (182, 143), (182, 144), (182, 145), (182, 146), (182, 147), (182, 148), (182, 149), (182, 150), (183, 84), (183, 87), (183, 88), (183, 89), (183, 93), (183, 94), (183, 95),
(183, 140), (183, 142), (183, 143), (183, 144), (183, 145), (183, 146), (183, 147), (183, 148), (183, 149), (183, 150), (183, 151), (183, 153), (184, 82), (184, 85), (184, 86), (184, 90), (184, 91), (184, 92), (184, 140), (184, 142), (184, 143), (184, 144), (184, 145), (184, 146), (184, 147), (184, 148), (184, 149), (184, 150), (184, 151), (184, 152), (184, 154), (185, 81), (185, 87), (185, 88), (185, 89), (185, 139), (185, 141), (185, 142), (185, 143), (185, 144), (185, 145), (185, 146), (185, 147), (185, 148), (185, 149), (185, 150), (185, 151), (185, 152), (185, 154), (186, 79), (186, 84), (186, 85), (186, 86), (186, 139), (186, 141), (186, 142), (186, 143), (186, 144), (186, 145), (186, 146), (186, 147), (186, 148), (186, 149), (186, 150), (186, 151), (186, 152), (186, 154), (187, 77), (187, 83), (187, 139), (187, 141), (187, 142),
(187, 143), (187, 144), (187, 145), (187, 146), (187, 147), (187, 148), (187, 149), (187, 150), (187, 151), (187, 152), (187, 153), (187, 155), (188, 76), (188, 79), (188, 81), (188, 139), (188, 142), (188, 143), (188, 144), (188, 145), (188, 146), (188, 147), (188, 148), (188, 149), (188, 150), (188, 151), (188, 152), (188, 153), (188, 155), (189, 74), (189, 77), (189, 78), (189, 80), (189, 140), (189, 144), (189, 145), (189, 146), (189, 147), (189, 148), (189, 149), (189, 150), (189, 151), (189, 152), (189, 153), (189, 154), (189, 156), (190, 72), (190, 76), (190, 77), (190, 79), (190, 142), (190, 146), (190, 147), (190, 148), (190, 149), (190, 150), (190, 151), (190, 152), (190, 153), (190, 154), (190, 156), (191, 71), (191, 74), (191, 75), (191, 76), (191, 78), (191, 144), (191, 148), (191, 149), (191, 150), (191, 151), (191, 152),
(191, 153), (191, 154), (191, 156), (192, 69), (192, 72), (192, 73), (192, 74), (192, 75), (192, 76), (192, 78), (192, 146), (192, 147), (192, 150), (192, 151), (192, 152), (192, 153), (192, 154), (192, 155), (192, 157), (193, 67), (193, 68), (193, 71), (193, 72), (193, 73), (193, 74), (193, 75), (193, 77), (193, 148), (193, 150), (193, 151), (193, 152), (193, 153), (193, 154), (193, 155), (193, 157), (194, 66), (194, 69), (194, 70), (194, 71), (194, 72), (194, 73), (194, 74), (194, 75), (194, 77), (194, 150), (194, 152), (194, 153), (194, 154), (194, 155), (194, 156), (194, 158), (195, 64), (195, 67), (195, 68), (195, 69), (195, 70), (195, 71), (195, 72), (195, 73), (195, 74), (195, 75), (195, 77), (195, 150), (195, 152), (195, 153), (195, 154), (195, 155), (195, 156), (195, 158), (196, 62), (196, 66), (196, 67),
(196, 68), (196, 69), (196, 70), (196, 71), (196, 72), (196, 73), (196, 74), (196, 75), (196, 76), (196, 78), (196, 150), (196, 152), (196, 153), (196, 154), (196, 155), (196, 156), (196, 157), (196, 159), (197, 60), (197, 64), (197, 65), (197, 66), (197, 67), (197, 68), (197, 69), (197, 70), (197, 71), (197, 72), (197, 73), (197, 74), (197, 75), (197, 76), (197, 78), (197, 151), (197, 153), (197, 154), (197, 155), (197, 156), (197, 157), (197, 158), (197, 160), (198, 58), (198, 59), (198, 62), (198, 63), (198, 64), (198, 65), (198, 66), (198, 67), (198, 68), (198, 69), (198, 70), (198, 71), (198, 72), (198, 73), (198, 74), (198, 75), (198, 76), (198, 77), (198, 79), (198, 151), (198, 153), (198, 154), (198, 155), (198, 156), (198, 157), (198, 158), (198, 159), (198, 162), (199, 56), (199, 57), (199, 60),
(199, 61), (199, 62), (199, 63), (199, 64), (199, 65), (199, 66), (199, 67), (199, 68), (199, 69), (199, 70), (199, 71), (199, 72), (199, 73), (199, 74), (199, 75), (199, 76), (199, 77), (199, 78), (199, 80), (199, 152), (199, 154), (199, 155), (199, 156), (199, 157), (199, 158), (199, 159), (199, 160), (199, 163), (199, 165), (200, 53), (200, 54), (200, 55), (200, 58), (200, 59), (200, 60), (200, 61), (200, 62), (200, 63), (200, 64), (200, 65), (200, 66), (200, 67), (200, 68), (200, 69), (200, 70), (200, 71), (200, 72), (200, 73), (200, 74), (200, 75), (200, 76), (200, 77), (200, 78), (200, 81), (200, 155), (200, 156), (200, 157), (200, 158), (200, 159), (200, 160), (200, 161), (200, 162), (200, 167), (201, 51), (201, 63), (201, 64), (201, 65), (201, 66), (201, 67), (201, 68), (201, 69), (201, 70),
(201, 71), (201, 72), (201, 73), (201, 74), (201, 75), (201, 76), (201, 77), (201, 78), (201, 79), (201, 82), (201, 154), (201, 156), (201, 157), (201, 158), (201, 159), (201, 160), (201, 161), (201, 162), (201, 163), (201, 164), (201, 165), (201, 168), (202, 51), (202, 53), (202, 54), (202, 55), (202, 56), (202, 57), (202, 58), (202, 59), (202, 60), (202, 61), (202, 62), (202, 63), (202, 75), (202, 76), (202, 77), (202, 78), (202, 79), (202, 80), (202, 81), (202, 84), (202, 85), (202, 155), (202, 158), (202, 159), (202, 160), (202, 161), (202, 162), (202, 163), (202, 164), (202, 165), (202, 166), (202, 168), (203, 64), (203, 65), (203, 66), (203, 67), (203, 68), (203, 69), (203, 70), (203, 71), (203, 72), (203, 73), (203, 74), (203, 86), (203, 87), (203, 88), (203, 156), (203, 160), (203, 161), (203, 162),
(203, 163), (203, 164), (203, 165), (203, 166), (203, 168), (204, 75), (204, 76), (204, 77), (204, 78), (204, 79), (204, 80), (204, 81), (204, 82), (204, 85), (204, 89), (204, 90), (204, 91), (204, 92), (204, 93), (204, 94), (204, 95), (204, 96), (204, 97), (204, 158), (204, 163), (204, 164), (204, 165), (204, 166), (204, 168), (205, 83), (205, 84), (205, 87), (205, 88), (205, 89), (205, 98), (205, 99), (205, 100), (205, 102), (205, 160), (205, 162), (205, 167), (206, 85), (206, 86), (206, 89), (206, 90), (206, 91), (206, 92), (206, 93), (206, 94), (206, 95), (206, 96), (206, 102), (206, 163), (206, 165), (206, 166), (207, 87), (207, 88), (207, 98), (207, 99), (207, 101), (208, 89), (208, 90), (208, 91), (208, 92), (208, 93), (208, 94), (208, 95), (208, 96), (208, 97), (237, 89), (237, 91), (237, 92),
(237, 93), (237, 94), (237, 95), (237, 96), (237, 97), (237, 99), (237, 157), (237, 159), (237, 160), (237, 161), (237, 162), (237, 163), (237, 164), (237, 165), (238, 88), (238, 100), (238, 157), (238, 166), (238, 167), (238, 168), (239, 87), (239, 89), (239, 90), (239, 91), (239, 92), (239, 93), (239, 94), (239, 95), (239, 96), (239, 97), (239, 98), (239, 99), (239, 101), (239, 157), (239, 159), (239, 160), (239, 161), (239, 162), (239, 163), (239, 164), (239, 165), (239, 168), (240, 73), (240, 74), (240, 75), (240, 76), (240, 77), (240, 78), (240, 79), (240, 80), (240, 81), (240, 82), (240, 83), (240, 84), (240, 85), (240, 88), (240, 89), (240, 90), (240, 91), (240, 92), (240, 93), (240, 94), (240, 95), (240, 96), (240, 97), (240, 98), (240, 102), (240, 156), (240, 158), (240, 159), (240, 160), (240, 161),
(240, 162), (240, 163), (240, 164), (240, 165), (240, 166), (240, 168), (241, 67), (241, 68), (241, 69), (241, 70), (241, 71), (241, 72), (241, 87), (241, 99), (241, 101), (241, 156), (241, 158), (241, 159), (241, 160), (241, 161), (241, 162), (241, 163), (241, 164), (241, 165), (241, 166), (241, 168), (242, 60), (242, 61), (242, 62), (242, 63), (242, 64), (242, 65), (242, 66), (242, 73), (242, 74), (242, 75), (242, 76), (242, 77), (242, 78), (242, 79), (242, 80), (242, 81), (242, 82), (242, 83), (242, 84), (242, 88), (242, 89), (242, 90), (242, 91), (242, 92), (242, 93), (242, 94), (242, 95), (242, 96), (242, 97), (242, 98), (242, 155), (242, 157), (242, 158), (242, 159), (242, 160), (242, 161), (242, 162), (242, 163), (242, 164), (242, 165), (242, 167), (243, 54), (243, 55), (243, 56), (243, 57), (243, 58),
(243, 59), (243, 67), (243, 68), (243, 69), (243, 70), (243, 71), (243, 72), (243, 73), (243, 74), (243, 75), (243, 76), (243, 77), (243, 78), (243, 79), (243, 80), (243, 81), (243, 82), (243, 85), (243, 86), (243, 87), (243, 154), (243, 156), (243, 157), (243, 158), (243, 159), (243, 160), (243, 161), (243, 162), (243, 163), (243, 164), (243, 166), (244, 54), (244, 55), (244, 57), (244, 61), (244, 62), (244, 63), (244, 64), (244, 65), (244, 66), (244, 67), (244, 68), (244, 69), (244, 70), (244, 71), (244, 72), (244, 73), (244, 74), (244, 75), (244, 76), (244, 77), (244, 78), (244, 79), (244, 80), (244, 81), (244, 84), (244, 153), (244, 155), (244, 156), (244, 157), (244, 158), (244, 159), (244, 160), (244, 161), (244, 162), (244, 163), (244, 165), (245, 59), (245, 60), (245, 63), (245, 64), (245, 65),
(245, 66), (245, 67), (245, 68), (245, 69), (245, 70), (245, 71), (245, 72), (245, 73), (245, 74), (245, 75), (245, 76), (245, 77), (245, 78), (245, 79), (245, 80), (245, 81), (245, 152), (245, 154), (245, 155), (245, 156), (245, 157), (245, 158), (245, 159), (245, 160), (245, 161), (245, 162), (245, 164), (246, 61), (246, 65), (246, 66), (246, 67), (246, 68), (246, 69), (246, 70), (246, 71), (246, 72), (246, 73), (246, 74), (246, 75), (246, 76), (246, 77), (246, 78), (246, 79), (246, 80), (246, 82), (246, 151), (246, 153), (246, 154), (246, 155), (246, 156), (246, 157), (246, 158), (246, 159), (246, 160), (246, 161), (246, 163), (247, 63), (247, 67), (247, 68), (247, 69), (247, 70), (247, 71), (247, 72), (247, 73), (247, 74), (247, 75), (247, 76), (247, 77), (247, 78), (247, 79), (247, 81), (247, 150),
(247, 152), (247, 153), (247, 154), (247, 155), (247, 156), (247, 157), (247, 158), (247, 159), (247, 160), (247, 162), (248, 65), (248, 69), (248, 70), (248, 71), (248, 72), (248, 73), (248, 74), (248, 75), (248, 76), (248, 77), (248, 78), (248, 79), (248, 81), (248, 149), (248, 151), (248, 152), (248, 153), (248, 154), (248, 155), (248, 156), (248, 157), (248, 158), (248, 159), (248, 161), (249, 67), (249, 70), (249, 71), (249, 72), (249, 73), (249, 74), (249, 75), (249, 76), (249, 77), (249, 78), (249, 80), (249, 148), (249, 150), (249, 151), (249, 152), (249, 153), (249, 154), (249, 155), (249, 156), (249, 157), (249, 158), (249, 160), (250, 69), (250, 72), (250, 73), (250, 74), (250, 75), (250, 76), (250, 77), (250, 78), (250, 80), (250, 147), (250, 149), (250, 150), (250, 151), (250, 152), (250, 153), (250, 154),
(250, 155), (250, 156), (250, 157), (250, 158), (250, 160), (251, 70), (251, 73), (251, 74), (251, 75), (251, 76), (251, 77), (251, 78), (251, 80), (251, 146), (251, 148), (251, 149), (251, 150), (251, 151), (251, 152), (251, 153), (251, 154), (251, 155), (251, 156), (251, 157), (251, 159), (252, 72), (252, 75), (252, 76), (252, 77), (252, 78), (252, 79), (252, 81), (252, 145), (252, 147), (252, 148), (252, 149), (252, 150), (252, 151), (252, 152), (252, 153), (252, 154), (252, 155), (252, 156), (252, 158), (253, 73), (253, 76), (253, 77), (253, 78), (253, 79), (253, 80), (253, 83), (253, 144), (253, 146), (253, 147), (253, 148), (253, 149), (253, 150), (253, 151), (253, 152), (253, 153), (253, 154), (253, 155), (253, 156), (253, 158), (254, 75), (254, 78), (254, 79), (254, 80), (254, 81), (254, 84), (254, 143), (254, 145),
(254, 146), (254, 147), (254, 148), (254, 149), (254, 150), (254, 151), (254, 152), (254, 153), (254, 154), (254, 155), (254, 157), (255, 76), (255, 79), (255, 80), (255, 81), (255, 82), (255, 83), (255, 86), (255, 143), (255, 145), (255, 146), (255, 147), (255, 148), (255, 149), (255, 150), (255, 151), (255, 152), (255, 153), (255, 154), (255, 155), (255, 157), (256, 78), (256, 81), (256, 82), (256, 83), (256, 84), (256, 88), (256, 142), (256, 144), (256, 145), (256, 146), (256, 147), (256, 148), (256, 149), (256, 150), (256, 151), (256, 152), (256, 153), (256, 154), (256, 155), (256, 157), (257, 79), (257, 82), (257, 83), (257, 84), (257, 85), (257, 86), (257, 89), (257, 142), (257, 144), (257, 145), (257, 146), (257, 147), (257, 148), (257, 149), (257, 150), (257, 151), (257, 152), (257, 153), (257, 154), (257, 156), (258, 81),
(258, 84), (258, 85), (258, 86), (258, 87), (258, 88), (258, 91), (258, 142), (258, 144), (258, 145), (258, 146), (258, 147), (258, 148), (258, 149), (258, 150), (258, 151), (258, 152), (258, 153), (258, 154), (258, 156), (259, 82), (259, 85), (259, 86), (259, 87), (259, 88), (259, 89), (259, 90), (259, 93), (259, 142), (259, 144), (259, 145), (259, 146), (259, 147), (259, 148), (259, 149), (259, 150), (259, 151), (259, 152), (259, 153), (259, 154), (259, 155), (259, 156), (260, 84), (260, 87), (260, 88), (260, 89), (260, 90), (260, 91), (260, 95), (260, 142), (260, 144), (260, 145), (260, 146), (260, 147), (260, 148), (260, 149), (260, 150), (260, 151), (260, 152), (260, 153), (260, 155), (261, 85), (261, 88), (261, 89), (261, 90), (261, 91), (261, 92), (261, 93), (261, 97), (261, 143), (261, 145), (261, 146), (261, 147),
(261, 148), (261, 149), (261, 150), (261, 151), (261, 152), (261, 153), (261, 155), (262, 87), (262, 90), (262, 91), (262, 92), (262, 93), (262, 94), (262, 95), (262, 99), (262, 143), (262, 145), (262, 146), (262, 147), (262, 148), (262, 149), (262, 150), (262, 151), (262, 152), (262, 154), (263, 88), (263, 91), (263, 92), (263, 93), (263, 94), (263, 95), (263, 96), (263, 97), (263, 101), (263, 144), (263, 146), (263, 147), (263, 148), (263, 149), (263, 150), (263, 151), (263, 152), (263, 154), (264, 90), (264, 93), (264, 94), (264, 95), (264, 96), (264, 97), (264, 98), (264, 99), (264, 103), (264, 145), (264, 147), (264, 148), (264, 149), (264, 150), (264, 151), (264, 153), (265, 91), (265, 94), (265, 95), (265, 96), (265, 97), (265, 98), (265, 99), (265, 100), (265, 101), (265, 105), (265, 146), (265, 148), (265, 149),
(265, 150), (265, 152), (266, 93), (266, 105), (266, 107), (266, 147), (266, 152), (267, 94), (267, 96), (267, 97), (267, 98), (267, 99), (267, 100), (267, 101), (267, 102), (267, 103), (267, 148), (267, 150), )
coordinates_FF5500 = ((168, 161),
(169, 161), (169, 165), (170, 160), (170, 162), (170, 163), (170, 166), (171, 160), (171, 162), (171, 163), (171, 164), (171, 165), (171, 167), (172, 160), (172, 161), (172, 162), (172, 163), (172, 164), (172, 165), (172, 166), (172, 168), (173, 161), (173, 163), (173, 164), (173, 165), (173, 166), (173, 168), (174, 161), (174, 163), (174, 164), (174, 165), (174, 166), (174, 167), (174, 169), (175, 161), (175, 163), (175, 164), (175, 165), (175, 166), (175, 167), (175, 168), (175, 169), (176, 162), (176, 164), (176, 165), (176, 166), (176, 167), (176, 168), (176, 170), (177, 162), (177, 164), (177, 165), (177, 166), (177, 167), (177, 168), (177, 169), (177, 170), (178, 163), (178, 165), (178, 166), (178, 167), (178, 168), (178, 169), (178, 171), (179, 163), (179, 165), (179, 166), (179, 167), (179, 168), (179, 169), (179, 171), (180, 164), (180, 167),
(180, 168), (180, 169), (180, 170), (180, 172), (181, 165), (181, 168), (181, 169), (181, 170), (181, 172), (182, 167), (182, 169), (182, 170), (182, 171), (182, 172), (182, 173), (183, 168), (183, 170), (183, 171), (183, 173), (184, 169), (184, 171), (184, 173), (185, 170), (185, 173), (186, 171), (186, 174), (187, 172), (187, 174), (258, 172), (258, 174), (259, 170), (260, 169), (260, 173), (261, 168), (261, 170), (261, 171), (261, 173), (262, 167), (262, 169), (262, 170), (262, 171), (262, 173), (263, 166), (263, 168), (263, 169), (263, 170), (263, 172), (264, 166), (264, 168), (264, 169), (264, 170), (264, 172), (265, 165), (265, 167), (265, 168), (265, 169), (265, 170), (265, 171), (265, 172), (266, 165), (266, 167), (266, 168), (266, 169), (266, 171), (267, 164), (267, 166), (267, 167), (267, 168), (267, 169), (267, 171), (268, 164), (268, 166),
(268, 167), (268, 168), (268, 170), (269, 164), (269, 166), (269, 167), (269, 168), (269, 170), (270, 163), (270, 164), (270, 165), (270, 166), (270, 167), (270, 169), (271, 163), (271, 165), (271, 166), (272, 168), (273, 164), (273, 167), )
coordinates_CC3300 = ((163, 143),
(164, 142), (164, 144), (165, 141), (165, 143), (165, 146), (165, 147), (165, 149), (166, 140), (166, 142), (166, 143), (166, 144), (167, 139), (167, 141), (167, 142), (167, 143), (167, 144), (167, 145), (167, 146), (167, 148), (168, 141), (168, 142), (168, 143), (168, 144), (168, 145), (168, 147), (169, 138), (169, 140), (169, 141), (169, 142), (169, 143), (169, 144), (169, 146), (170, 137), (170, 139), (170, 140), (170, 141), (170, 142), (170, 143), (170, 145), (171, 136), (171, 138), (171, 139), (171, 140), (171, 141), (171, 142), (171, 143), (171, 145), (172, 138), (172, 139), (172, 140), (172, 141), (172, 142), (172, 144), (173, 135), (173, 137), (173, 138), (173, 139), (173, 140), (173, 141), (173, 143), (174, 134), (174, 136), (174, 137), (174, 138), (174, 139), (174, 140), (174, 141), (174, 143), (175, 133), (175, 135), (175, 136), (175, 137),
(175, 138), (175, 139), (175, 140), (175, 141), (175, 143), (176, 133), (176, 135), (176, 136), (176, 137), (176, 138), (176, 139), (176, 140), (176, 143), (177, 132), (177, 134), (177, 135), (177, 136), (177, 137), (177, 138), (177, 139), (178, 131), (178, 133), (178, 134), (178, 135), (178, 136), (178, 137), (178, 138), (178, 140), (179, 131), (179, 133), (179, 134), (179, 135), (179, 136), (179, 137), (179, 139), (180, 130), (180, 132), (180, 133), (180, 134), (180, 135), (180, 136), (180, 138), (181, 131), (181, 132), (181, 133), (181, 134), (181, 135), (181, 137), (182, 129), (182, 131), (182, 132), (182, 133), (182, 134), (182, 136), (183, 128), (183, 130), (183, 131), (183, 132), (183, 133), (183, 135), (184, 128), (184, 130), (184, 131), (184, 132), (184, 134), (185, 127), (185, 129), (185, 130), (185, 131), (185, 133), (186, 127), (186, 129),
(186, 130), (186, 132), (187, 126), (187, 128), (187, 129), (187, 131), (188, 126), (188, 130), (189, 126), (189, 129), (190, 127), (252, 123), (252, 126), (253, 123), (253, 128), (254, 123), (254, 125), (254, 126), (254, 130), (255, 124), (255, 125), (255, 126), (255, 127), (255, 128), (255, 131), (256, 124), (256, 126), (256, 127), (256, 128), (256, 129), (256, 130), (256, 132), (257, 125), (257, 127), (257, 128), (257, 129), (257, 130), (257, 131), (257, 133), (258, 125), (258, 127), (258, 128), (258, 129), (258, 130), (258, 131), (258, 133), (259, 126), (259, 128), (259, 129), (259, 130), (259, 131), (259, 132), (259, 134), (260, 127), (260, 129), (260, 130), (260, 131), (260, 132), (260, 133), (260, 135), (261, 127), (261, 129), (261, 130), (261, 131), (261, 132), (261, 133), (261, 135), (262, 128), (262, 130), (262, 131), (262, 132), (262, 133),
(262, 134), (262, 136), (263, 129), (263, 131), (263, 132), (263, 133), (263, 134), (263, 135), (263, 137), (264, 130), (264, 132), (264, 133), (264, 134), (264, 135), (264, 136), (264, 138), (265, 130), (265, 132), (265, 133), (265, 134), (265, 135), (265, 136), (265, 137), (265, 139), (266, 131), (266, 133), (266, 134), (266, 135), (266, 136), (266, 137), (266, 138), (266, 140), (267, 132), (267, 134), (267, 135), (267, 136), (267, 137), (267, 138), (267, 139), (267, 142), (268, 133), (268, 135), (268, 136), (268, 137), (268, 138), (268, 139), (268, 140), (268, 143), (269, 134), (269, 136), (269, 137), (269, 138), (269, 139), (269, 140), (269, 141), (269, 142), (269, 144), (270, 137), (270, 138), (270, 139), (270, 140), (270, 141), (270, 142), (270, 143), (270, 145), (271, 135), (271, 137), (271, 138), (271, 139), (271, 140), (271, 141), (271, 142),
(271, 143), (271, 144), (271, 146), (272, 136), (272, 138), (272, 139), (272, 140), (272, 141), (272, 142), (272, 143), (272, 144), (272, 145), (272, 147), (273, 137), (273, 139), (273, 140), (273, 141), (273, 142), (273, 143), (273, 144), (273, 145), (273, 146), (273, 148), (274, 138), (274, 140), (274, 141), (274, 142), (274, 143), (274, 144), (274, 145), (274, 146), (275, 139), (275, 141), (275, 142), (275, 143), (275, 144), (275, 145), (275, 146), (275, 147), (275, 149), (276, 140), (276, 142), (276, 143), (276, 144), (276, 145), (276, 146), (276, 147), (276, 148), (276, 150), (277, 141), (277, 143), (277, 144), (277, 145), (277, 146), (277, 147), (277, 148), (277, 149), (278, 142), (278, 144), (278, 145), (278, 146), (278, 147), (278, 148), (278, 151), (279, 143), (279, 145), (279, 146), (279, 147), (279, 149), (279, 150), (279, 152), (280, 144),
(280, 146), (280, 148), (281, 145), (281, 147), (282, 146), )
coordinates_FFCCCC = ((159, 58),
(159, 59), (160, 58), (161, 58), (161, 59), (163, 58), (163, 59), (183, 29), (183, 31), (184, 27), (184, 34), (185, 25), (185, 28), (185, 29), (185, 30), (185, 31), (185, 32), (185, 35), (185, 36), (185, 37), (186, 24), (186, 27), (186, 28), (186, 29), (186, 30), (186, 31), (186, 32), (186, 33), (186, 34), (186, 38), (186, 40), (187, 23), (187, 25), (187, 26), (187, 27), (187, 28), (187, 29), (187, 30), (187, 31), (187, 32), (187, 33), (187, 34), (187, 35), (187, 36), (187, 37), (187, 40), (188, 22), (188, 24), (188, 25), (188, 26), (188, 27), (188, 28), (188, 29), (188, 30), (188, 31), (188, 32), (188, 33), (188, 34), (188, 35), (188, 36), (188, 37), (188, 38), (188, 39), (188, 41), (189, 24), (189, 25), (189, 26), (189, 27), (189, 28), (189, 29), (189, 30), (189, 31), (189, 32),
(189, 33), (189, 34), (189, 35), (189, 36), (189, 37), (189, 38), (189, 39), (189, 40), (189, 43), (189, 44), (189, 46), (190, 21), (190, 23), (190, 24), (190, 25), (190, 26), (190, 27), (190, 28), (190, 29), (190, 30), (190, 31), (190, 32), (190, 33), (190, 34), (190, 35), (190, 36), (190, 37), (190, 38), (190, 39), (190, 40), (190, 41), (190, 46), (191, 20), (191, 22), (191, 23), (191, 24), (191, 25), (191, 26), (191, 27), (191, 28), (191, 29), (191, 30), (191, 31), (191, 32), (191, 33), (191, 34), (191, 35), (191, 36), (191, 37), (191, 38), (191, 39), (191, 40), (191, 41), (191, 42), (191, 43), (191, 44), (191, 45), (191, 47), (192, 19), (192, 21), (192, 22), (192, 23), (192, 24), (192, 25), (192, 26), (192, 27), (192, 28), (192, 29), (192, 30), (192, 31), (192, 32), (192, 33),
(192, 34), (192, 35), (192, 36), (192, 37), (192, 38), (192, 39), (192, 40), (192, 41), (192, 42), (192, 43), (192, 44), (192, 45), (192, 47), (193, 19), (193, 21), (193, 22), (193, 23), (193, 24), (193, 25), (193, 26), (193, 27), (193, 28), (193, 29), (193, 30), (193, 31), (193, 32), (193, 33), (193, 34), (193, 35), (193, 36), (193, 37), (193, 38), (193, 39), (193, 40), (193, 41), (193, 42), (193, 43), (193, 44), (193, 45), (193, 47), (194, 18), (194, 20), (194, 21), (194, 22), (194, 23), (194, 24), (194, 25), (194, 26), (194, 27), (194, 28), (194, 29), (194, 30), (194, 31), (194, 32), (194, 33), (194, 34), (194, 35), (194, 36), (194, 37), (194, 38), (194, 39), (194, 40), (194, 41), (194, 42), (194, 43), (194, 44), (194, 45), (194, 46), (194, 48), (195, 18), (195, 20), (195, 21),
(195, 22), (195, 23), (195, 24), (195, 25), (195, 26), (195, 27), (195, 28), (195, 29), (195, 30), (195, 31), (195, 32), (195, 33), (195, 34), (195, 35), (195, 36), (195, 37), (195, 38), (195, 39), (195, 40), (195, 41), (195, 42), (195, 43), (195, 44), (195, 45), (195, 46), (195, 48), (196, 17), (196, 19), (196, 20), (196, 21), (196, 22), (196, 23), (196, 24), (196, 25), (196, 26), (196, 27), (196, 28), (196, 29), (196, 30), (196, 31), (196, 32), (196, 33), (196, 34), (196, 35), (196, 36), (196, 37), (196, 38), (196, 39), (196, 40), (196, 41), (196, 42), (196, 43), (196, 44), (196, 45), (196, 46), (196, 47), (196, 49), (197, 17), (197, 19), (197, 20), (197, 21), (197, 22), (197, 23), (197, 24), (197, 25), (197, 26), (197, 27), (197, 28), (197, 29), (197, 30), (197, 31), (197, 32),
(197, 33), (197, 34), (197, 35), (197, 36), (197, 37), (197, 38), (197, 39), (197, 40), (197, 41), (197, 42), (197, 43), (197, 44), (197, 45), (197, 46), (197, 47), (197, 49), (198, 16), (198, 18), (198, 19), (198, 20), (198, 21), (198, 22), (198, 23), (198, 24), (198, 25), (198, 26), (198, 27), (198, 28), (198, 29), (198, 30), (198, 31), (198, 32), (198, 33), (198, 34), (198, 35), (198, 36), (198, 37), (198, 38), (198, 39), (198, 40), (198, 41), (198, 42), (198, 43), (198, 44), (198, 45), (198, 46), (198, 47), (198, 49), (199, 16), (199, 18), (199, 19), (199, 20), (199, 21), (199, 22), (199, 23), (199, 24), (199, 25), (199, 26), (199, 27), (199, 28), (199, 29), (199, 30), (199, 31), (199, 32), (199, 33), (199, 34), (199, 35), (199, 36), (199, 37), (199, 38), (199, 39), (199, 40),
(199, 41), (199, 42), (199, 43), (199, 44), (199, 45), (199, 46), (199, 47), (199, 49), (200, 15), (200, 17), (200, 18), (200, 19), (200, 20), (200, 21), (200, 22), (200, 23), (200, 24), (200, 25), (200, 26), (200, 27), (200, 28), (200, 29), (200, 30), (200, 31), (200, 32), (200, 33), (200, 34), (200, 35), (200, 36), (200, 37), (200, 38), (200, 39), (200, 40), (200, 41), (200, 42), (200, 43), (200, 44), (200, 45), (200, 46), (200, 47), (200, 49), (201, 15), (201, 17), (201, 18), (201, 19), (201, 20), (201, 21), (201, 22), (201, 23), (201, 24), (201, 25), (201, 26), (201, 27), (201, 28), (201, 29), (201, 30), (201, 31), (201, 32), (201, 33), (201, 34), (201, 35), (201, 36), (201, 37), (201, 38), (201, 39), (201, 40), (201, 41), (201, 42), (201, 43), (201, 44), (201, 45), (201, 46),
(201, 47), (201, 49), (202, 15), (202, 17), (202, 18), (202, 19), (202, 20), (202, 21), (202, 22), (202, 23), (202, 24), (202, 25), (202, 26), (202, 27), (202, 28), (202, 29), (202, 30), (202, 31), (202, 32), (202, 33), (202, 34), (202, 35), (202, 36), (202, 37), (202, 38), (202, 39), (202, 40), (202, 41), (202, 42), (202, 43), (202, 44), (202, 45), (202, 46), (202, 47), (202, 49), (203, 14), (203, 16), (203, 17), (203, 18), (203, 19), (203, 20), (203, 21), (203, 22), (203, 23), (203, 24), (203, 25), (203, 26), (203, 27), (203, 28), (203, 29), (203, 30), (203, 31), (203, 32), (203, 33), (203, 34), (203, 35), (203, 36), (203, 37), (203, 38), (203, 39), (203, 40), (203, 41), (203, 42), (203, 43), (203, 44), (203, 45), (203, 46), (203, 47), (203, 49), (204, 14), (204, 16), (204, 17),
(204, 18), (204, 19), (204, 20), (204, 21), (204, 22), (204, 23), (204, 24), (204, 25), (204, 26), (204, 27), (204, 28), (204, 29), (204, 30), (204, 31), (204, 32), (204, 33), (204, 34), (204, 35), (204, 36), (204, 37), (204, 38), (204, 39), (204, 40), (204, 41), (204, 42), (204, 43), (204, 44), (204, 45), (204, 46), (204, 47), (204, 49), (205, 14), (205, 16), (205, 17), (205, 18), (205, 19), (205, 20), (205, 21), (205, 22), (205, 23), (205, 24), (205, 25), (205, 26), (205, 27), (205, 28), (205, 29), (205, 30), (205, 31), (205, 32), (205, 33), (205, 34), (205, 35), (205, 36), (205, 37), (205, 38), (205, 39), (205, 40), (205, 41), (205, 42), (205, 43), (205, 44), (205, 45), (205, 46), (205, 47), (205, 49), (206, 13), (206, 14), (206, 15), (206, 16), (206, 17), (206, 18), (206, 19),
(206, 20), (206, 21), (206, 22), (206, 23), (206, 24), (206, 25), (206, 26), (206, 27), (206, 28), (206, 29), (206, 30), (206, 31), (206, 32), (206, 33), (206, 34), (206, 35), (206, 36), (206, 37), (206, 38), (206, 39), (206, 40), (206, 41), (206, 42), (206, 43), (206, 44), (206, 45), (206, 46), (206, 47), (206, 48), (207, 13), (207, 15), (207, 16), (207, 17), (207, 18), (207, 19), (207, 20), (207, 21), (207, 22), (207, 23), (207, 24), (207, 25), (207, 26), (207, 27), (207, 28), (207, 29), (207, 30), (207, 31), (207, 32), (207, 33), (207, 34), (207, 35), (207, 36), (207, 37), (207, 38), (207, 39), (207, 40), (207, 41), (207, 42), (207, 43), (207, 44), (207, 45), (207, 46), (207, 48), (208, 13), (208, 15), (208, 16), (208, 17), (208, 18), (208, 19), (208, 20), (208, 21), (208, 22),
(208, 23), (208, 24), (208, 25), (208, 26), (208, 27), (208, 28), (208, 29), (208, 30), (208, 31), (208, 32), (208, 33), (208, 34), (208, 35), (208, 36), (208, 37), (208, 38), (208, 39), (208, 40), (208, 41), (208, 42), (208, 43), (208, 44), (208, 45), (208, 47), (209, 13), (209, 15), (209, 16), (209, 17), (209, 18), (209, 19), (209, 20), (209, 21), (209, 22), (209, 23), (209, 24), (209, 25), (209, 26), (209, 27), (209, 28), (209, 29), (209, 30), (209, 31), (209, 32), (209, 33), (209, 34), (209, 35), (209, 36), (209, 37), (209, 38), (209, 39), (209, 40), (209, 41), (209, 42), (209, 43), (209, 44), (209, 46), (210, 13), (210, 15), (210, 16), (210, 17), (210, 18), (210, 19), (210, 20), (210, 21), (210, 22), (210, 23), (210, 24), (210, 25), (210, 26), (210, 27), (210, 28), (210, 29),
(210, 30), (210, 31), (210, 32), (210, 33), (210, 34), (210, 35), (210, 36), (210, 37), (210, 38), (210, 39), (210, 40), (210, 41), (210, 42), (210, 43), (210, 45), (211, 13), (211, 15), (211, 16), (211, 17), (211, 18), (211, 19), (211, 20), (211, 21), (211, 22), (211, 23), (211, 24), (211, 25), (211, 26), (211, 27), (211, 28), (211, 29), (211, 30), (211, 31), (211, 32), (211, 33), (211, 34), (211, 35), (211, 36), (211, 37), (211, 38), (211, 39), (211, 40), (211, 41), (211, 42), (211, 44), (212, 15), (212, 16), (212, 17), (212, 18), (212, 19), (212, 20), (212, 21), (212, 22), (212, 23), (212, 24), (212, 25), (212, 26), (212, 27), (212, 28), (212, 29), (212, 30), (212, 31), (212, 32), (212, 33), (212, 34), (212, 35), (212, 36), (212, 37), (212, 38), (212, 39), (212, 40), (212, 41),
(212, 43), (213, 14), (213, 16), (213, 17), (213, 18), (213, 19), (213, 20), (213, 21), (213, 22), (213, 23), (213, 24), (213, 25), (213, 26), (213, 27), (213, 28), (213, 29), (213, 30), (213, 31), (213, 32), (213, 33), (213, 34), (213, 35), (213, 36), (213, 37), (213, 38), (213, 39), (213, 42), (214, 15), (214, 17), (214, 18), (214, 19), (214, 20), (214, 21), (214, 22), (214, 23), (214, 24), (214, 25), (214, 26), (214, 27), (214, 28), (214, 29), (214, 30), (214, 31), (214, 32), (214, 33), (214, 34), (214, 35), (214, 36), (214, 37), (214, 38), (214, 41), (215, 18), (215, 19), (215, 20), (215, 21), (215, 22), (215, 23), (215, 24), (215, 25), (215, 26), (215, 27), (215, 28), (215, 29), (215, 30), (215, 31), (215, 32), (215, 33), (215, 34), (215, 35), (215, 36), (215, 37), (215, 38),
(215, 40), (216, 16), (216, 18), (216, 19), (216, 20), (216, 21), (216, 22), (216, 23), (216, 24), (216, 25), (216, 26), (216, 27), (216, 28), (216, 29), (216, 30), (216, 31), (216, 32), (216, 33), (216, 34), (216, 35), (216, 36), (216, 37), (216, 39), (217, 17), (217, 19), (217, 20), (217, 21), (217, 22), (217, 23), (217, 24), (217, 25), (217, 26), (217, 27), (217, 28), (217, 29), (217, 30), (217, 31), (217, 32), (217, 33), (217, 34), (217, 35), (217, 36), (217, 38), (218, 18), (218, 20), (218, 21), (218, 22), (218, 23), (218, 24), (218, 25), (218, 26), (218, 27), (218, 28), (218, 29), (218, 30), (218, 31), (218, 32), (218, 33), (218, 34), (218, 35), (218, 37), (219, 19), (219, 37), (220, 20), (220, 22), (220, 23), (220, 24), (220, 25), (220, 26), (220, 27), (220, 28), (220, 29),
(220, 30), (220, 31), (220, 32), (220, 33), (220, 34), (220, 35), (220, 37), (225, 19), (225, 21), (225, 22), (225, 23), (225, 24), (225, 25), (225, 26), (225, 27), (225, 28), (225, 29), (225, 30), (225, 31), (225, 32), (225, 33), (225, 34), (225, 35), (225, 36), (225, 37), (225, 38), (225, 40), (226, 18), (226, 41), (227, 18), (227, 20), (227, 21), (227, 22), (227, 23), (227, 24), (227, 25), (227, 26), (227, 27), (227, 28), (227, 29), (227, 30), (227, 31), (227, 32), (227, 33), (227, 34), (227, 35), (227, 36), (227, 37), (227, 38), (227, 39), (227, 40), (228, 17), (228, 19), (228, 20), (228, 21), (228, 22), (228, 23), (228, 24), (228, 25), (228, 26), (228, 27), (228, 28), (228, 29), (228, 30), (228, 31), (228, 32), (228, 33), (228, 34), (228, 35), (228, 36), (228, 37), (228, 38),
(228, 39), (228, 40), (228, 41), (228, 44), (229, 16), (229, 18), (229, 19), (229, 20), (229, 21), (229, 22), (229, 23), (229, 24), (229, 25), (229, 26), (229, 27), (229, 28), (229, 29), (229, 30), (229, 31), (229, 32), (229, 33), (229, 34), (229, 35), (229, 36), (229, 37), (229, 38), (229, 39), (229, 40), (229, 41), (229, 42), (229, 45), (230, 15), (230, 17), (230, 18), (230, 19), (230, 20), (230, 21), (230, 22), (230, 23), (230, 24), (230, 25), (230, 26), (230, 27), (230, 28), (230, 29), (230, 30), (230, 31), (230, 32), (230, 33), (230, 34), (230, 35), (230, 36), (230, 37), (230, 38), (230, 39), (230, 40), (230, 41), (230, 42), (230, 43), (230, 44), (230, 46), (231, 14), (231, 16), (231, 17), (231, 18), (231, 19), (231, 20), (231, 21), (231, 22), (231, 23), (231, 24), (231, 25),
(231, 26), (231, 27), (231, 28), (231, 29), (231, 30), (231, 31), (231, 32), (231, 33), (231, 34), (231, 35), (231, 36), (231, 37), (231, 38), (231, 39), (231, 40), (231, 41), (231, 42), (231, 43), (231, 44), (231, 45), (232, 14), (232, 16), (232, 17), (232, 18), (232, 19), (232, 20), (232, 21), (232, 22), (232, 23), (232, 24), (232, 25), (232, 26), (232, 27), (232, 28), (232, 29), (232, 30), (232, 31), (232, 32), (232, 33), (232, 34), (232, 35), (232, 36), (232, 37), (232, 38), (232, 39), (232, 40), (232, 41), (232, 42), (232, 43), (232, 44), (232, 45), (232, 46), (232, 48), (233, 13), (233, 15), (233, 16), (233, 17), (233, 18), (233, 19), (233, 20), (233, 21), (233, 22), (233, 23), (233, 24), (233, 25), (233, 26), (233, 27), (233, 28), (233, 29), (233, 30), (233, 31), (233, 32),
(233, 33), (233, 34), (233, 35), (233, 36), (233, 37), (233, 38), (233, 39), (233, 40), (233, 41), (233, 42), (233, 43), (233, 44), (233, 45), (233, 46), (233, 47), (233, 49), (234, 13), (234, 15), (234, 16), (234, 17), (234, 18), (234, 19), (234, 20), (234, 21), (234, 22), (234, 23), (234, 24), (234, 25), (234, 26), (234, 27), (234, 28), (234, 29), (234, 30), (234, 31), (234, 32), (234, 33), (234, 34), (234, 35), (234, 36), (234, 37), (234, 38), (234, 39), (234, 40), (234, 41), (234, 42), (234, 43), (234, 44), (234, 45), (234, 46), (234, 47), (234, 48), (234, 50), (235, 13), (235, 15), (235, 16), (235, 17), (235, 18), (235, 19), (235, 20), (235, 21), (235, 22), (235, 23), (235, 24), (235, 25), (235, 26), (235, 27), (235, 28), (235, 29), (235, 30), (235, 31), (235, 32), (235, 33),
(235, 34), (235, 35), (235, 36), (235, 37), (235, 38), (235, 39), (235, 40), (235, 41), (235, 42), (235, 43), (235, 44), (235, 45), (235, 46), (235, 47), (235, 48), (235, 49), (235, 51), (236, 13), (236, 15), (236, 16), (236, 17), (236, 18), (236, 19), (236, 20), (236, 21), (236, 22), (236, 23), (236, 24), (236, 25), (236, 26), (236, 27), (236, 28), (236, 29), (236, 30), (236, 31), (236, 32), (236, 33), (236, 34), (236, 35), (236, 36), (236, 37), (236, 38), (236, 39), (236, 40), (236, 41), (236, 42), (236, 43), (236, 44), (236, 45), (236, 46), (236, 47), (236, 48), (236, 49), (236, 51), (237, 13), (237, 15), (237, 16), (237, 17), (237, 18), (237, 19), (237, 20), (237, 21), (237, 22), (237, 23), (237, 24), (237, 25), (237, 26), (237, 27), (237, 28), (237, 29), (237, 30), (237, 31),
(237, 32), (237, 33), (237, 34), (237, 35), (237, 36), (237, 37), (237, 38), (237, 39), (237, 40), (237, 41), (237, 42), (237, 43), (237, 44), (237, 45), (237, 46), (237, 47), (237, 48), (237, 49), (237, 51), (238, 12), (238, 13), (238, 14), (238, 15), (238, 16), (238, 17), (238, 18), (238, 19), (238, 20), (238, 21), (238, 22), (238, 23), (238, 24), (238, 25), (238, 26), (238, 27), (238, 28), (238, 29), (238, 30), (238, 31), (238, 32), (238, 33), (238, 34), (238, 35), (238, 36), (238, 37), (238, 38), (238, 39), (238, 40), (238, 41), (238, 42), (238, 43), (238, 44), (238, 45), (238, 46), (238, 47), (238, 48), (238, 49), (238, 50), (238, 52), (239, 13), (239, 15), (239, 16), (239, 17), (239, 18), (239, 19), (239, 20), (239, 21), (239, 22), (239, 23), (239, 24), (239, 25), (239, 26),
(239, 27), (239, 28), (239, 29), (239, 30), (239, 31), (239, 32), (239, 33), (239, 34), (239, 35), (239, 36), (239, 37), (239, 38), (239, 39), (239, 40), (239, 41), (239, 42), (239, 43), (239, 44), (239, 45), (239, 46), (239, 47), (239, 48), (239, 49), (239, 50), (239, 52), (240, 13), (240, 15), (240, 16), (240, 17), (240, 18), (240, 19), (240, 20), (240, 21), (240, 22), (240, 23), (240, 24), (240, 25), (240, 26), (240, 27), (240, 28), (240, 29), (240, 30), (240, 31), (240, 32), (240, 33), (240, 34), (240, 35), (240, 36), (240, 37), (240, 38), (240, 39), (240, 40), (240, 41), (240, 42), (240, 43), (240, 44), (240, 45), (240, 46), (240, 47), (240, 48), (240, 49), (240, 50), (240, 52), (241, 13), (241, 15), (241, 16), (241, 17), (241, 18), (241, 19), (241, 20), (241, 21), (241, 22),
(241, 23), (241, 24), (241, 25), (241, 26), (241, 27), (241, 28), (241, 29), (241, 30), (241, 31), (241, 32), (241, 33), (241, 34), (241, 35), (241, 36), (241, 37), (241, 38), (241, 39), (241, 40), (241, 41), (241, 42), (241, 43), (241, 44), (241, 45), (241, 46), (241, 47), (241, 48), (241, 49), (241, 50), (241, 52), (242, 13), (242, 15), (242, 16), (242, 17), (242, 18), (242, 19), (242, 20), (242, 21), (242, 22), (242, 23), (242, 24), (242, 25), (242, 26), (242, 27), (242, 28), (242, 29), (242, 30), (242, 31), (242, 32), (242, 33), (242, 34), (242, 35), (242, 36), (242, 37), (242, 38), (242, 39), (242, 40), (242, 41), (242, 42), (242, 43), (242, 44), (242, 45), (242, 46), (242, 47), (242, 48), (242, 49), (242, 50), (242, 52), (243, 13), (243, 15), (243, 16), (243, 17), (243, 18),
(243, 19), (243, 20), (243, 21), (243, 22), (243, 23), (243, 24), (243, 25), (243, 26), (243, 27), (243, 28), (243, 29), (243, 30), (243, 31), (243, 32), (243, 33), (243, 34), (243, 35), (243, 36), (243, 37), (243, 38), (243, 39), (243, 40), (243, 41), (243, 42), (243, 43), (243, 44), (243, 45), (243, 46), (243, 47), (243, 48), (243, 49), (243, 50), (243, 52), (244, 13), (244, 15), (244, 16), (244, 17), (244, 18), (244, 19), (244, 20), (244, 21), (244, 22), (244, 23), (244, 24), (244, 25), (244, 26), (244, 27), (244, 28), (244, 29), (244, 30), (244, 31), (244, 32), (244, 33), (244, 34), (244, 35), (244, 36), (244, 37), (244, 38), (244, 39), (244, 40), (244, 41), (244, 42), (244, 43), (244, 44), (244, 45), (244, 46), (244, 47), (244, 48), (244, 49), (244, 50), (244, 52), (245, 13),
(245, 15), (245, 16), (245, 17), (245, 18), (245, 19), (245, 20), (245, 21), (245, 22), (245, 23), (245, 24), (245, 25), (245, 26), (245, 27), (245, 28), (245, 29), (245, 30), (245, 31), (245, 32), (245, 33), (245, 34), (245, 35), (245, 36), (245, 37), (245, 38), (245, 39), (245, 40), (245, 41), (245, 42), (245, 43), (245, 44), (245, 45), (245, 46), (245, 47), (245, 48), (245, 49), (245, 50), (245, 52), (246, 14), (246, 16), (246, 17), (246, 18), (246, 19), (246, 20), (246, 21), (246, 22), (246, 23), (246, 24), (246, 25), (246, 26), (246, 27), (246, 28), (246, 29), (246, 30), (246, 31), (246, 32), (246, 33), (246, 34), (246, 35), (246, 36), (246, 37), (246, 38), (246, 39), (246, 40), (246, 41), (246, 42), (246, 43), (246, 44), (246, 45), (246, 46), (246, 47), (246, 48), (246, 49),
(246, 50), (246, 52), (247, 14), (247, 16), (247, 17), (247, 18), (247, 19), (247, 20), (247, 21), (247, 22), (247, 23), (247, 24), (247, 25), (247, 26), (247, 27), (247, 28), (247, 29), (247, 30), (247, 31), (247, 32), (247, 33), (247, 34), (247, 35), (247, 36), (247, 37), (247, 38), (247, 39), (247, 40), (247, 41), (247, 42), (247, 43), (247, 44), (247, 45), (247, 46), (247, 47), (247, 48), (247, 49), (247, 50), (247, 52), (248, 14), (248, 16), (248, 17), (248, 18), (248, 19), (248, 20), (248, 21), (248, 22), (248, 23), (248, 24), (248, 25), (248, 26), (248, 27), (248, 28), (248, 29), (248, 30), (248, 31), (248, 32), (248, 33), (248, 34), (248, 35), (248, 36), (248, 37), (248, 38), (248, 39), (248, 40), (248, 41), (248, 42), (248, 43), (248, 44), (248, 45), (248, 46), (248, 47),
(248, 48), (248, 49), (248, 50), (248, 52), (249, 15), (249, 17), (249, 18), (249, 19), (249, 20), (249, 21), (249, 22), (249, 23), (249, 24), (249, 25), (249, 26), (249, 27), (249, 28), (249, 29), (249, 30), (249, 31), (249, 32), (249, 33), (249, 34), (249, 35), (249, 36), (249, 37), (249, 38), (249, 39), (249, 40), (249, 41), (249, 42), (249, 43), (249, 44), (249, 45), (249, 46), (249, 47), (249, 48), (249, 49), (249, 51), (250, 15), (250, 17), (250, 18), (250, 19), (250, 20), (250, 21), (250, 22), (250, 23), (250, 24), (250, 25), (250, 26), (250, 27), (250, 28), (250, 29), (250, 30), (250, 31), (250, 32), (250, 33), (250, 34), (250, 35), (250, 36), (250, 37), (250, 38), (250, 39), (250, 40), (250, 41), (250, 42), (250, 43), (250, 44), (250, 45), (250, 46), (250, 47), (250, 48),
(250, 49), (250, 51), (251, 15), (251, 17), (251, 18), (251, 19), (251, 20), (251, 21), (251, 22), (251, 23), (251, 24), (251, 25), (251, 26), (251, 27), (251, 28), (251, 29), (251, 30), (251, 31), (251, 32), (251, 33), (251, 34), (251, 35), (251, 36), (251, 37), (251, 38), (251, 39), (251, 40), (251, 41), (251, 42), (251, 43), (251, 44), (251, 45), (251, 46), (251, 47), (251, 48), (251, 49), (251, 51), (252, 16), (252, 18), (252, 19), (252, 20), (252, 21), (252, 22), (252, 23), (252, 24), (252, 25), (252, 26), (252, 27), (252, 28), (252, 29), (252, 30), (252, 31), (252, 32), (252, 33), (252, 34), (252, 35), (252, 36), (252, 37), (252, 38), (252, 39), (252, 40), (252, 41), (252, 42), (252, 43), (252, 44), (252, 45), (252, 46), (252, 47), (252, 48), (252, 50), (253, 16), (253, 18),
(253, 19), (253, 20), (253, 21), (253, 22), (253, 23), (253, 24), (253, 25), (253, 26), (253, 27), (253, 28), (253, 29), (253, 30), (253, 31), (253, 32), (253, 33), (253, 34), (253, 35), (253, 36), (253, 37), (253, 38), (253, 39), (253, 40), (253, 41), (253, 42), (253, 43), (253, 44), (253, 45), (253, 46), (253, 47), (253, 48), (253, 50), (254, 17), (254, 19), (254, 20), (254, 21), (254, 22), (254, 23), (254, 24), (254, 25), (254, 26), (254, 27), (254, 28), (254, 29), (254, 30), (254, 31), (254, 32), (254, 33), (254, 34), (254, 35), (254, 36), (254, 37), (254, 38), (254, 39), (254, 40), (254, 41), (254, 42), (254, 43), (254, 44), (254, 45), (254, 46), (254, 50), (255, 18), (255, 20), (255, 21), (255, 22), (255, 23), (255, 24), (255, 25), (255, 26), (255, 27), (255, 28), (255, 29),
(255, 30), (255, 31), (255, 32), (255, 33), (255, 34), (255, 35), (255, 36), (255, 37), (255, 38), (255, 39), (255, 40), (255, 41), (255, 42), (255, 43), (255, 44), (255, 47), (255, 49), (256, 18), (256, 20), (256, 21), (256, 22), (256, 23), (256, 24), (256, 25), (256, 26), (256, 27), (256, 28), (256, 29), (256, 30), (256, 31), (256, 32), (256, 33), (256, 34), (256, 35), (256, 36), (256, 37), (256, 38), (256, 39), (256, 40), (256, 41), (256, 42), (256, 43), (256, 45), (256, 46), (256, 49), (257, 19), (257, 21), (257, 22), (257, 23), (257, 24), (257, 25), (257, 26), (257, 27), (257, 28), (257, 29), (257, 30), (257, 31), (257, 32), (257, 33), (257, 34), (257, 35), (257, 36), (257, 37), (257, 38), (257, 39), (257, 40), (257, 41), (257, 42), (257, 44), (258, 20), (258, 22), (258, 23),
(258, 24), (258, 25), (258, 26), (258, 27), (258, 28), (258, 29), (258, 30), (258, 31), (258, 32), (258, 33), (258, 34), (258, 35), (258, 36), (258, 37), (258, 38), (258, 43), (259, 23), (259, 24), (259, 25), (259, 26), (259, 27), (259, 28), (259, 29), (259, 30), (259, 31), (259, 32), (259, 33), (259, 34), (259, 35), (259, 39), (259, 40), (259, 41), (259, 43), (260, 22), (260, 25), (260, 26), (260, 27), (260, 28), (260, 29), (260, 30), (260, 31), (260, 32), (260, 36), (260, 37), (260, 38), (261, 23), (261, 33), (261, 34), (261, 35), (262, 25), (262, 26), (262, 27), (262, 28), (262, 29), (262, 30), (262, 31), (264, 48), (264, 50), (265, 52), (265, 53), (266, 49), (266, 51), (266, 54), (267, 50), (267, 53), (267, 56), (268, 51), (268, 54), (268, 57), (269, 53), (269, 55), (269, 56),
(270, 54), (270, 56), (270, 57), (271, 54), (271, 56), (271, 57), (271, 58), (271, 60), (272, 54), (272, 56), (272, 57), (272, 58), (272, 59), (272, 61), (273, 54), (273, 56), (273, 57), (273, 58), (273, 59), (273, 61), (274, 53), (274, 55), (274, 56), (274, 57), (274, 58), (274, 59), (274, 60), (274, 62), (275, 53), (275, 55), (275, 56), (275, 57), (275, 58), (275, 59), (275, 60), (275, 62), (276, 53), (276, 55), (276, 56), (276, 57), (276, 58), (276, 59), (276, 60), (276, 62), (277, 53), (277, 55), (277, 56), (277, 57), (277, 58), (277, 59), (277, 61), (278, 52), (278, 54), (278, 55), (278, 56), (278, 57), (278, 58), (278, 59), (278, 61), (279, 52), (279, 54), (279, 55), (279, 56), (279, 57), (279, 58), (279, 59), (279, 61), (280, 53), (280, 54), (280, 55), (280, 56), (280, 57),
(280, 58), (281, 53), (281, 60), (282, 54), (282, 56), (282, 57), (282, 59), )
coordinates_FF6600 = ((157, 76),
(157, 78), (158, 74), (158, 78), (158, 79), (159, 68), (159, 73), (159, 76), (159, 77), (159, 78), (159, 80), (159, 81), (159, 82), (159, 83), (159, 84), (159, 86), (160, 66), (160, 68), (160, 73), (160, 75), (160, 76), (160, 77), (160, 78), (160, 83), (160, 85), (161, 64), (161, 69), (161, 72), (161, 74), (161, 79), (161, 80), (161, 82), (162, 61), (162, 65), (162, 66), (162, 67), (162, 68), (162, 75), (162, 76), (162, 77), (162, 78), (163, 61), (163, 63), (163, 64), (163, 65), (163, 66), (163, 67), (163, 68), (163, 69), (163, 73), (163, 74), (164, 61), (164, 63), (164, 64), (164, 65), (164, 66), (164, 67), (164, 68), (164, 72), (165, 58), (165, 60), (165, 61), (165, 62), (165, 63), (165, 64), (165, 65), (165, 66), (165, 67), (165, 70), (166, 59), (166, 61), (166, 62), (166, 63),
(166, 64), (166, 65), (166, 68), (167, 60), (167, 62), (167, 63), (167, 64), (167, 67), (168, 60), (168, 61), (168, 62), (168, 65), (169, 61), (169, 64), (170, 60), (170, 62), (171, 61), (172, 57), (172, 60), (173, 55), (173, 58), (174, 54), (174, 57), (175, 52), (175, 56), (176, 50), (176, 55), (177, 49), (177, 54), (178, 47), (178, 50), (178, 53), (179, 46), (179, 49), (179, 52), (180, 45), (180, 47), (180, 48), (180, 49), (180, 51), (181, 44), (181, 46), (181, 47), (181, 48), (181, 50), (182, 43), (182, 45), (182, 46), (182, 47), (182, 49), (183, 42), (183, 44), (183, 45), (183, 46), (183, 48), (184, 42), (184, 44), (184, 45), (184, 47), (185, 42), (185, 44), (185, 45), (185, 47), (186, 42), (187, 43), (187, 46), (258, 46), (258, 48), (258, 49), (258, 50), (258, 51), (258, 52),
(258, 53), (258, 54), (258, 55), (258, 56), (258, 57), (258, 59), (259, 45), (259, 60), (260, 46), (260, 48), (260, 49), (260, 50), (260, 51), (260, 52), (260, 53), (260, 54), (260, 55), (260, 56), (260, 57), (260, 58), (260, 59), (260, 61), (261, 47), (261, 52), (261, 53), (261, 54), (261, 55), (261, 56), (261, 57), (261, 58), (261, 59), (261, 60), (261, 63), (262, 48), (262, 50), (262, 51), (262, 54), (262, 55), (262, 56), (262, 57), (262, 58), (262, 59), (262, 60), (262, 61), (262, 64), (263, 52), (263, 53), (263, 56), (263, 57), (263, 58), (263, 59), (263, 60), (263, 61), (263, 62), (263, 63), (263, 65), (264, 54), (264, 58), (264, 59), (264, 60), (264, 61), (264, 62), (264, 63), (264, 64), (264, 66), (265, 56), (265, 59), (265, 60), (265, 61), (265, 62), (265, 63), (265, 64),
(265, 65), (265, 68), (266, 58), (266, 60), (266, 61), (266, 62), (266, 63), (266, 64), (266, 65), (266, 66), (266, 69), (267, 59), (267, 61), (267, 62), (267, 63), (267, 64), (267, 65), (267, 66), (267, 67), (267, 70), (268, 60), (268, 62), (268, 63), (268, 64), (268, 65), (268, 66), (268, 67), (268, 68), (268, 69), (268, 71), (269, 61), (269, 63), (269, 64), (269, 65), (269, 66), (269, 67), (269, 68), (269, 69), (269, 70), (269, 72), (270, 62), (270, 64), (270, 65), (270, 66), (270, 67), (270, 68), (270, 69), (270, 70), (270, 71), (270, 74), (271, 63), (271, 65), (271, 66), (271, 67), (271, 68), (271, 69), (271, 70), (271, 71), (271, 72), (271, 75), (272, 63), (272, 65), (272, 66), (272, 67), (272, 68), (272, 69), (272, 70), (272, 71), (272, 72), (272, 73), (272, 76), (273, 64),
(273, 67), (273, 68), (273, 69), (273, 70), (273, 71), (273, 72), (273, 73), (273, 74), (273, 75), (273, 77), (274, 64), (274, 66), (274, 69), (274, 70), (274, 71), (274, 72), (274, 73), (274, 74), (274, 75), (274, 76), (274, 78), (275, 68), (275, 71), (275, 72), (275, 73), (275, 74), (275, 75), (275, 76), (275, 77), (275, 79), (276, 69), (276, 72), (276, 73), (276, 74), (276, 75), (276, 76), (276, 77), (276, 78), (276, 81), (277, 71), (277, 74), (277, 75), (277, 76), (277, 77), (277, 78), (277, 79), (277, 82), (278, 72), (278, 75), (278, 76), (278, 77), (278, 78), (278, 79), (278, 80), (278, 83), (279, 74), (279, 76), (279, 77), (279, 78), (279, 79), (279, 80), (279, 81), (279, 82), (279, 84), (280, 75), (280, 77), (280, 78), (280, 79), (280, 80), (280, 81), (280, 82), (280, 83),
(280, 85), (281, 76), (281, 79), (281, 80), (281, 81), (281, 82), (281, 83), (281, 84), (281, 86), (282, 77), (282, 80), (282, 81), (282, 82), (282, 83), (282, 84), (282, 85), (282, 88), (283, 81), (283, 82), (283, 83), (283, 84), (283, 85), (283, 86), (283, 89), (284, 80), (284, 82), (284, 83), (284, 84), (284, 85), (284, 86), (284, 87), (284, 90), (285, 81), (285, 83), (285, 84), (285, 85), (285, 86), (285, 87), (285, 88), (285, 89), (285, 91), (286, 82), (286, 85), (286, 86), (286, 87), (286, 88), (286, 89), (286, 90), (286, 92), (287, 83), (287, 86), (287, 87), (287, 88), (287, 89), (287, 90), (287, 91), (287, 93), (288, 84), (288, 87), (288, 88), (288, 89), (288, 90), (288, 94), (289, 86), (289, 89), (289, 90), (289, 92), (290, 87), (291, 90), )
coordinates_FF9966 = ((152, 74),
(152, 76), (153, 71), (153, 73), (153, 77), (154, 69), (154, 74), (154, 75), (154, 77), (155, 67), (155, 71), (155, 72), (155, 73), (155, 77), (156, 65), (156, 74), (156, 75), (157, 63), (157, 64), (157, 67), (157, 68), (157, 69), (157, 70), (157, 71), (157, 72), (158, 62), (158, 65), (158, 66), (159, 61), (159, 64), (160, 61), (160, 62), (276, 64), (276, 66), (277, 64), (277, 68), (278, 63), (278, 64), (278, 65), (278, 66), (278, 69), (279, 63), (279, 65), (279, 66), (279, 67), (279, 68), (279, 71), (280, 63), (280, 65), (280, 66), (280, 67), (280, 68), (280, 69), (280, 72), (281, 62), (281, 64), (281, 65), (281, 66), (281, 67), (281, 68), (281, 69), (281, 70), (281, 71), (281, 73), (282, 62), (282, 63), (282, 64), (282, 65), (282, 66), (282, 67), (282, 68), (282, 69), (282, 70),
(282, 71), (282, 72), (282, 75), (283, 63), (283, 64), (283, 65), (283, 66), (283, 67), (283, 68), (283, 69), (283, 70), (283, 71), (283, 72), (283, 73), (283, 76), (284, 58), (284, 62), (284, 63), (284, 64), (284, 65), (284, 66), (284, 67), (284, 68), (284, 69), (284, 70), (284, 71), (284, 72), (284, 73), (284, 74), (284, 77), (285, 58), (285, 60), (285, 61), (285, 62), (285, 63), (285, 64), (285, 65), (285, 66), (285, 67), (285, 68), (285, 69), (285, 70), (285, 71), (285, 72), (285, 73), (285, 74), (285, 75), (285, 76), (285, 78), (286, 59), (286, 61), (286, 62), (286, 63), (286, 64), (286, 65), (286, 66), (286, 67), (286, 68), (286, 69), (286, 70), (286, 71), (286, 72), (286, 73), (286, 74), (286, 75), (286, 76), (286, 77), (286, 79), (287, 60), (287, 62), (287, 63), (287, 64),
(287, 65), (287, 66), (287, 67), (287, 68), (287, 69), (287, 70), (287, 71), (287, 72), (287, 73), (287, 74), (287, 75), (287, 76), (287, 77), (287, 78), (288, 61), (288, 63), (288, 64), (288, 65), (288, 66), (288, 67), (288, 68), (288, 69), (288, 70), (288, 71), (288, 72), (288, 73), (288, 74), (288, 75), (288, 76), (288, 77), (288, 78), (288, 79), (288, 82), (289, 62), (289, 65), (289, 66), (289, 67), (289, 68), (289, 69), (289, 70), (289, 71), (289, 72), (289, 73), (289, 74), (289, 75), (289, 76), (289, 77), (289, 78), (289, 79), (289, 80), (289, 83), (290, 63), (290, 66), (290, 67), (290, 68), (290, 69), (290, 70), (290, 71), (290, 72), (290, 73), (290, 74), (290, 75), (290, 76), (290, 77), (290, 78), (290, 79), (290, 80), (290, 81), (290, 82), (290, 84), (291, 65), (291, 68),
(291, 69), (291, 70), (291, 71), (291, 72), (291, 73), (291, 74), (291, 75), (291, 76), (291, 77), (291, 78), (291, 79), (291, 80), (291, 81), (291, 82), (291, 83), (291, 86), (292, 66), (292, 69), (292, 70), (292, 71), (292, 72), (292, 73), (292, 74), (292, 75), (292, 76), (292, 77), (292, 78), (292, 79), (292, 80), (292, 81), (292, 82), (292, 83), (292, 84), (292, 87), (293, 68), (293, 71), (293, 72), (293, 73), (293, 74), (293, 75), (293, 76), (293, 77), (293, 78), (293, 79), (293, 80), (293, 81), (293, 82), (293, 83), (293, 84), (293, 85), (293, 89), (293, 90), (294, 69), (294, 73), (294, 74), (294, 75), (294, 76), (294, 77), (294, 78), (294, 79), (294, 80), (294, 81), (294, 82), (294, 83), (294, 89), (295, 71), (295, 75), (295, 76), (295, 77), (295, 78), (295, 79), (295, 80),
(295, 81), (295, 84), (295, 85), (295, 89), (296, 73), (296, 83), (296, 88), (296, 89), (297, 76), (297, 77), (297, 78), (297, 79), (297, 81), (297, 89), )
coordinates_CCFF33 = ((237, 83),
(237, 86), (238, 83), (238, 85), )
| coordinates_ffffcc = ((149, 117), (149, 118), (149, 119), (149, 120), (149, 121), (149, 122), (149, 123), (149, 124), (149, 125), (149, 126), (149, 127), (149, 128), (149, 129), (149, 130), (150, 111), (150, 112), (150, 113), (150, 114), (150, 115), (150, 116), (150, 131), (150, 133), (151, 107), (151, 108), (151, 109), (151, 110), (151, 117), (151, 118), (151, 119), (151, 120), (151, 121), (151, 122), (151, 123), (151, 124), (151, 125), (151, 126), (151, 127), (151, 128), (151, 129), (151, 130), (151, 135), (152, 104), (152, 106), (152, 111), (152, 112), (152, 113), (152, 114), (152, 115), (152, 116), (152, 117), (152, 118), (152, 119), (152, 120), (152, 121), (152, 122), (152, 123), (152, 124), (152, 125), (152, 126), (152, 127), (152, 128), (152, 129), (152, 130), (152, 131), (152, 132), (152, 133), (152, 137), (153, 102), (153, 103), (153, 107), (153, 108), (153, 109), (153, 110), (153, 111), (153, 112), (153, 113), (153, 114), (153, 115), (153, 116), (153, 117), (153, 118), (153, 119), (153, 120), (153, 121), (153, 122), (153, 123), (153, 124), (153, 125), (153, 126), (153, 127), (153, 128), (153, 129), (153, 130), (153, 131), (153, 132), (153, 133), (153, 134), (153, 135), (153, 139), (154, 96), (154, 97), (154, 98), (154, 99), (154, 100), (154, 104), (154, 105), (154, 106), (154, 107), (154, 108), (154, 109), (154, 110), (154, 111), (154, 112), (154, 113), (154, 114), (154, 115), (154, 116), (154, 117), (154, 118), (154, 119), (154, 120), (154, 121), (154, 122), (154, 123), (154, 124), (154, 125), (154, 126), (154, 127), (154, 128), (154, 129), (154, 130), (154, 131), (154, 132), (154, 133), (154, 134), (154, 135), (154, 136), (154, 137), (154, 141), (155, 91), (155, 93), (155, 94), (155, 95), (155, 102), (155, 103), (155, 104), (155, 105), (155, 106), (155, 107), (155, 108), (155, 109), (155, 110), (155, 111), (155, 112), (155, 113), (155, 114), (155, 115), (155, 116), (155, 117), (155, 118), (155, 119), (155, 120), (155, 121), (155, 122), (155, 123), (155, 124), (155, 125), (155, 126), (155, 127), (155, 128), (155, 129), (155, 130), (155, 131), (155, 132), (155, 133), (155, 134), (155, 135), (155, 136), (155, 137), (155, 138), (155, 139), (155, 143), (156, 90), (156, 96), (156, 97), (156, 98), (156, 99), (156, 100), (156, 101), (156, 102), (156, 103), (156, 104), (156, 105), (156, 106), (156, 107), (156, 108), (156, 109), (156, 110), (156, 111), (156, 112), (156, 113), (156, 114), (156, 115), (156, 116), (156, 117), (156, 118), (156, 119), (156, 120), (156, 121), (156, 122), (156, 123), (156, 124), (156, 125), (156, 126), (156, 127), (156, 128), (156, 129), (156, 130), (156, 131), (156, 132), (156, 133), (156, 134), (156, 135), (156, 136), (156, 137), (156, 138), (156, 139), (156, 140), (156, 141), (156, 145), (157, 89), (157, 91), (157, 92), (157, 93), (157, 94), (157, 95), (157, 96), (157, 97), (157, 98), (157, 99), (157, 100), (157, 101), (157, 102), (157, 103), (157, 104), (157, 105), (157, 106), (157, 107), (157, 108), (157, 109), (157, 110), (157, 111), (157, 112), (157, 113), (157, 114), (157, 115), (157, 116), (157, 117), (157, 118), (157, 119), (157, 120), (157, 121), (157, 122), (157, 123), (157, 124), (157, 125), (157, 126), (157, 127), (157, 128), (157, 129), (157, 130), (157, 131), (157, 132), (157, 133), (157, 134), (157, 135), (157, 136), (157, 137), (157, 138), (157, 139), (157, 140), (157, 141), (157, 142), (157, 143), (157, 146), (158, 89), (158, 91), (158, 92), (158, 93), (158, 94), (158, 95), (158, 96), (158, 97), (158, 98), (158, 99), (158, 100), (158, 101), (158, 102), (158, 103), (158, 104), (158, 105), (158, 106), (158, 107), (158, 108), (158, 109), (158, 110), (158, 111), (158, 112), (158, 113), (158, 114), (158, 115), (158, 116), (158, 117), (158, 118), (158, 119), (158, 120), (158, 121), (158, 122), (158, 123), (158, 124), (158, 125), (158, 126), (158, 127), (158, 128), (158, 129), (158, 130), (158, 131), (158, 132), (158, 133), (158, 134), (158, 135), (158, 136), (158, 137), (158, 138), (158, 139), (158, 140), (158, 141), (158, 142), (158, 143), (158, 144), (158, 146), (159, 89), (159, 91), (159, 92), (159, 93), (159, 94), (159, 95), (159, 96), (159, 97), (159, 98), (159, 99), (159, 100), (159, 101), (159, 102), (159, 103), (159, 104), (159, 105), (159, 106), (159, 107), (159, 108), (159, 109), (159, 110), (159, 111), (159, 112), (159, 113), (159, 114), (159, 115), (159, 116), (159, 117), (159, 118), (159, 119), (159, 120), (159, 121), (159, 122), (159, 123), (159, 124), (159, 125), (159, 126), (159, 127), (159, 128), (159, 129), (159, 130), (159, 131), (159, 132), (159, 133), (159, 134), (159, 135), (159, 136), (159, 137), (159, 138), (159, 139), (159, 140), (159, 141), (159, 142), (159, 146), (160, 88), (160, 90), (160, 91), (160, 92), (160, 93), (160, 94), (160, 95), (160, 96), (160, 97), (160, 98), (160, 99), (160, 100), (160, 101), (160, 102), (160, 103), (160, 104), (160, 105), (160, 106), (160, 107), (160, 108), (160, 109), (160, 110), (160, 111), (160, 112), (160, 113), (160, 114), (160, 115), (160, 116), (160, 117), (160, 118), (160, 119), (160, 120), (160, 121), (160, 122), (160, 123), (160, 124), (160, 125), (160, 126), (160, 127), (160, 128), (160, 129), (160, 130), (160, 131), (160, 132), (160, 133), (160, 134), (160, 135), (160, 136), (160, 137), (160, 138), (160, 139), (160, 140), (160, 141), (160, 145), (161, 86), (161, 89), (161, 90), (161, 91), (161, 92), (161, 93), (161, 94), (161, 95), (161, 96), (161, 97), (161, 98), (161, 99), (161, 100), (161, 101), (161, 102), (161, 103), (161, 104), (161, 105), (161, 106), (161, 107), (161, 108), (161, 109), (161, 110), (161, 111), (161, 112), (161, 113), (161, 114), (161, 115), (161, 116), (161, 117), (161, 118), (161, 119), (161, 120), (161, 121), (161, 122), (161, 123), (161, 124), (161, 125), (161, 126), (161, 127), (161, 128), (161, 129), (161, 130), (161, 131), (161, 132), (161, 133), (161, 134), (161, 135), (161, 136), (161, 137), (161, 138), (161, 139), (161, 140), (161, 142), (162, 84), (162, 85), (162, 88), (162, 89), (162, 90), (162, 91), (162, 92), (162, 93), (162, 94), (162, 95), (162, 96), (162, 97), (162, 98), (162, 99), (162, 100), (162, 101), (162, 102), (162, 103), (162, 104), (162, 105), (162, 106), (162, 107), (162, 108), (162, 109), (162, 110), (162, 111), (162, 112), (162, 113), (162, 114), (162, 115), (162, 116), (162, 117), (162, 118), (162, 119), (162, 120), (162, 121), (162, 122), (162, 123), (162, 124), (162, 125), (162, 126), (162, 127), (162, 128), (162, 129), (162, 130), (162, 131), (162, 132), (162, 133), (162, 134), (162, 135), (162, 136), (162, 137), (162, 138), (162, 139), (162, 141), (163, 81), (163, 82), (163, 83), (163, 86), (163, 87), (163, 88), (163, 89), (163, 90), (163, 91), (163, 92), (163, 93), (163, 94), (163, 95), (163, 96), (163, 97), (163, 98), (163, 99), (163, 100), (163, 101), (163, 102), (163, 103), (163, 104), (163, 105), (163, 106), (163, 107), (163, 108), (163, 109), (163, 110), (163, 111), (163, 112), (163, 113), (163, 114), (163, 115), (163, 116), (163, 117), (163, 118), (163, 119), (163, 120), (163, 121), (163, 122), (163, 123), (163, 124), (163, 125), (163, 126), (163, 127), (163, 128), (163, 129), (163, 130), (163, 131), (163, 132), (163, 133), (163, 134), (163, 135), (163, 136), (163, 137), (163, 138), (163, 140), (164, 76), (164, 77), (164, 78), (164, 79), (164, 84), (164, 85), (164, 86), (164, 87), (164, 88), (164, 89), (164, 90), (164, 91), (164, 92), (164, 93), (164, 94), (164, 95), (164, 96), (164, 97), (164, 98), (164, 99), (164, 100), (164, 101), (164, 102), (164, 103), (164, 104), (164, 105), (164, 106), (164, 107), (164, 108), (164, 109), (164, 110), (164, 111), (164, 112), (164, 113), (164, 114), (164, 115), (164, 116), (164, 117), (164, 118), (164, 119), (164, 120), (164, 121), (164, 122), (164, 123), (164, 124), (164, 125), (164, 126), (164, 127), (164, 128), (164, 129), (164, 130), (164, 131), (164, 132), (164, 133), (164, 134), (164, 135), (164, 136), (164, 137), (164, 139), (165, 74), (165, 75), (165, 80), (165, 81), (165, 82), (165, 83), (165, 84), (165, 85), (165, 86), (165, 87), (165, 88), (165, 89), (165, 90), (165, 91), (165, 92), (165, 93), (165, 94), (165, 95), (165, 96), (165, 97), (165, 98), (165, 99), (165, 100), (165, 101), (165, 102), (165, 103), (165, 104), (165, 105), (165, 106), (165, 107), (165, 108), (165, 109), (165, 110), (165, 111), (165, 112), (165, 113), (165, 114), (165, 115), (165, 116), (165, 117), (165, 118), (165, 119), (165, 120), (165, 121), (165, 122), (165, 123), (165, 124), (165, 125), (165, 126), (165, 127), (165, 128), (165, 129), (165, 130), (165, 131), (165, 132), (165, 133), (165, 134), (165, 135), (165, 136), (166, 72), (166, 76), (166, 77), (166, 78), (166, 79), (166, 80), (166, 81), (166, 82), (166, 83), (166, 84), (166, 85), (166, 86), (166, 87), (166, 88), (166, 89), (166, 90), (166, 91), (166, 92), (166, 93), (166, 94), (166, 95), (166, 96), (166, 97), (166, 98), (166, 99), (166, 100), (166, 101), (166, 102), (166, 103), (166, 104), (166, 105), (166, 106), (166, 107), (166, 108), (166, 109), (166, 110), (166, 111), (166, 112), (166, 113), (166, 114), (166, 115), (166, 116), (166, 117), (166, 118), (166, 119), (166, 120), (166, 121), (166, 122), (166, 123), (166, 124), (166, 125), (166, 126), (166, 127), (166, 128), (166, 129), (166, 130), (166, 131), (166, 132), (166, 133), (166, 134), (166, 135), (166, 136), (166, 138), (167, 70), (167, 74), (167, 75), (167, 76), (167, 77), (167, 78), (167, 79), (167, 80), (167, 81), (167, 82), (167, 83), (167, 84), (167, 85), (167, 86), (167, 87), (167, 88), (167, 89), (167, 90), (167, 91), (167, 92), (167, 93), (167, 94), (167, 95), (167, 96), (167, 97), (167, 98), (167, 99), (167, 100), (167, 101), (167, 102), (167, 103), (167, 104), (167, 105), (167, 106), (167, 107), (167, 108), (167, 109), (167, 110), (167, 111), (167, 112), (167, 113), (167, 114), (167, 115), (167, 116), (167, 117), (167, 118), (167, 119), (167, 120), (167, 121), (167, 122), (167, 123), (167, 124), (167, 125), (167, 126), (167, 127), (167, 128), (167, 129), (167, 130), (167, 131), (167, 132), (167, 133), (167, 134), (167, 135), (167, 137), (168, 68), (168, 69), (168, 72), (168, 73), (168, 74), (168, 75), (168, 76), (168, 77), (168, 78), (168, 79), (168, 80), (168, 81), (168, 82), (168, 83), (168, 84), (168, 85), (168, 86), (168, 87), (168, 88), (168, 89), (168, 90), (168, 91), (168, 92), (168, 93), (168, 94), (168, 95), (168, 96), (168, 97), (168, 98), (168, 99), (168, 100), (168, 101), (168, 102), (168, 103), (168, 104), (168, 105), (168, 106), (168, 107), (168, 108), (168, 109), (168, 110), (168, 111), (168, 112), (168, 113), (168, 114), (168, 115), (168, 116), (168, 117), (168, 118), (168, 119), (168, 120), (168, 121), (168, 122), (168, 123), (168, 124), (168, 125), (168, 126), (168, 127), (168, 128), (168, 129), (168, 130), (168, 131), (168, 132), (168, 133), (168, 134), (168, 136), (169, 67), (169, 70), (169, 71), (169, 72), (169, 73), (169, 74), (169, 75), (169, 76), (169, 77), (169, 78), (169, 79), (169, 80), (169, 81), (169, 82), (169, 83), (169, 84), (169, 85), (169, 86), (169, 87), (169, 88), (169, 89), (169, 90), (169, 91), (169, 92), (169, 93), (169, 94), (169, 95), (169, 96), (169, 97), (169, 98), (169, 99), (169, 100), (169, 101), (169, 102), (169, 103), (169, 104), (169, 105), (169, 106), (169, 107), (169, 108), (169, 109), (169, 110), (169, 111), (169, 112), (169, 113), (169, 114), (169, 115), (169, 116), (169, 117), (169, 118), (169, 119), (169, 120), (169, 121), (169, 122), (169, 123), (169, 124), (169, 125), (169, 126), (169, 127), (169, 128), (169, 129), (169, 130), (169, 131), (169, 132), (169, 133), (169, 135), (170, 65), (170, 68), (170, 69), (170, 70), (170, 71), (170, 72), (170, 73), (170, 74), (170, 75), (170, 76), (170, 77), (170, 78), (170, 79), (170, 80), (170, 81), (170, 82), (170, 83), (170, 84), (170, 85), (170, 86), (170, 87), (170, 88), (170, 89), (170, 90), (170, 91), (170, 92), (170, 93), (170, 94), (170, 95), (170, 96), (170, 97), (170, 98), (170, 99), (170, 100), (170, 101), (170, 102), (170, 103), (170, 104), (170, 105), (170, 106), (170, 107), (170, 108), (170, 109), (170, 110), (170, 111), (170, 112), (170, 113), (170, 114), (170, 115), (170, 116), (170, 117), (170, 118), (170, 119), (170, 120), (170, 121), (170, 122), (170, 123), (170, 124), (170, 125), (170, 126), (170, 127), (170, 128), (170, 129), (170, 130), (170, 131), (170, 132), (170, 133), (170, 135), (171, 64), (171, 67), (171, 68), (171, 69), (171, 70), (171, 71), (171, 72), (171, 73), (171, 74), (171, 75), (171, 76), (171, 77), (171, 78), (171, 79), (171, 80), (171, 81), (171, 82), (171, 83), (171, 84), (171, 85), (171, 86), (171, 87), (171, 88), (171, 89), (171, 90), (171, 91), (171, 92), (171, 93), (171, 94), (171, 95), (171, 96), (171, 97), (171, 98), (171, 99), (171, 100), (171, 101), (171, 102), (171, 103), (171, 104), (171, 105), (171, 106), (171, 107), (171, 108), (171, 109), (171, 110), (171, 111), (171, 112), (171, 113), (171, 114), (171, 115), (171, 116), (171, 117), (171, 118), (171, 119), (171, 120), (171, 121), (171, 122), (171, 123), (171, 124), (171, 125), (171, 126), (171, 127), (171, 128), (171, 129), (171, 130), (171, 131), (171, 132), (171, 134), (172, 63), (172, 65), (172, 66), (172, 67), (172, 68), (172, 69), (172, 70), (172, 71), (172, 72), (172, 73), (172, 74), (172, 75), (172, 76), (172, 77), (172, 78), (172, 79), (172, 80), (172, 81), (172, 82), (172, 83), (172, 84), (172, 85), (172, 86), (172, 87), (172, 88), (172, 89), (172, 90), (172, 91), (172, 92), (172, 93), (172, 94), (172, 95), (172, 96), (172, 97), (172, 98), (172, 99), (172, 100), (172, 101), (172, 102), (172, 103), (172, 104), (172, 105), (172, 106), (172, 107), (172, 108), (172, 109), (172, 110), (172, 111), (172, 112), (172, 113), (172, 114), (172, 115), (172, 116), (172, 117), (172, 118), (172, 119), (172, 120), (172, 121), (172, 122), (172, 123), (172, 124), (172, 125), (172, 126), (172, 127), (172, 128), (172, 129), (172, 130), (172, 131), (172, 133), (173, 61), (173, 64), (173, 65), (173, 66), (173, 67), (173, 68), (173, 69), (173, 70), (173, 71), (173, 72), (173, 73), (173, 74), (173, 75), (173, 76), (173, 77), (173, 78), (173, 79), (173, 80), (173, 81), (173, 82), (173, 83), (173, 84), (173, 85), (173, 86), (173, 87), (173, 88), (173, 89), (173, 90), (173, 91), (173, 92), (173, 93), (173, 94), (173, 95), (173, 96), (173, 97), (173, 98), (173, 99), (173, 100), (173, 101), (173, 102), (173, 103), (173, 104), (173, 105), (173, 106), (173, 107), (173, 108), (173, 109), (173, 110), (173, 111), (173, 112), (173, 113), (173, 114), (173, 115), (173, 116), (173, 117), (173, 118), (173, 119), (173, 120), (173, 121), (173, 122), (173, 123), (173, 124), (173, 125), (173, 126), (173, 127), (173, 128), (173, 129), (173, 130), (173, 132), (174, 60), (174, 63), (174, 64), (174, 65), (174, 66), (174, 67), (174, 68), (174, 69), (174, 70), (174, 71), (174, 72), (174, 73), (174, 74), (174, 75), (174, 76), (174, 77), (174, 78), (174, 79), (174, 80), (174, 81), (174, 82), (174, 83), (174, 84), (174, 85), (174, 86), (174, 87), (174, 88), (174, 89), (174, 90), (174, 91), (174, 92), (174, 93), (174, 94), (174, 95), (174, 96), (174, 97), (174, 100), (174, 101), (174, 102), (174, 103), (174, 104), (174, 105), (174, 106), (174, 107), (174, 108), (174, 109), (174, 110), (174, 111), (174, 112), (174, 113), (174, 114), (174, 115), (174, 116), (174, 117), (174, 118), (174, 119), (174, 120), (174, 121), (174, 122), (174, 123), (174, 124), (174, 125), (174, 126), (174, 127), (174, 128), (174, 129), (174, 130), (174, 132), (175, 59), (175, 61), (175, 62), (175, 63), (175, 64), (175, 65), (175, 66), (175, 67), (175, 68), (175, 69), (175, 70), (175, 71), (175, 72), (175, 73), (175, 74), (175, 75), (175, 76), (175, 77), (175, 78), (175, 79), (175, 80), (175, 81), (175, 82), (175, 83), (175, 84), (175, 85), (175, 86), (175, 87), (175, 88), (175, 89), (175, 90), (175, 91), (175, 92), (175, 97), (175, 98), (175, 99), (175, 102), (175, 103), (175, 104), (175, 105), (175, 106), (175, 107), (175, 108), (175, 109), (175, 110), (175, 111), (175, 112), (175, 113), (175, 114), (175, 115), (175, 116), (175, 117), (175, 118), (175, 119), (175, 120), (175, 121), (175, 122), (175, 123), (175, 124), (175, 125), (175, 126), (175, 127), (175, 128), (175, 129), (175, 131), (176, 57), (176, 60), (176, 61), (176, 62), (176, 63), (176, 64), (176, 65), (176, 66), (176, 67), (176, 68), (176, 69), (176, 70), (176, 71), (176, 72), (176, 73), (176, 74), (176, 75), (176, 76), (176, 77), (176, 78), (176, 79), (176, 80), (176, 81), (176, 82), (176, 83), (176, 84), (176, 85), (176, 86), (176, 87), (176, 88), (176, 89), (176, 90), (176, 93), (176, 94), (176, 95), (176, 96), (176, 100), (176, 101), (176, 102), (176, 103), (176, 104), (176, 105), (176, 106), (176, 107), (176, 108), (176, 109), (176, 110), (176, 111), (176, 112), (176, 113), (176, 114), (176, 115), (176, 116), (176, 117), (176, 118), (176, 119), (176, 120), (176, 121), (176, 122), (176, 123), (176, 124), (176, 125), (176, 126), (176, 127), (176, 128), (176, 130), (177, 56), (177, 59), (177, 60), (177, 61), (177, 62), (177, 63), (177, 64), (177, 65), (177, 66), (177, 67), (177, 68), (177, 69), (177, 70), (177, 71), (177, 72), (177, 73), (177, 74), (177, 75), (177, 76), (177, 77), (177, 78), (177, 79), (177, 80), (177, 81), (177, 82), (177, 83), (177, 84), (177, 85), (177, 86), (177, 87), (177, 91), (177, 92), (177, 102), (177, 104), (177, 105), (177, 106), (177, 107), (177, 108), (177, 109), (177, 110), (177, 111), (177, 112), (177, 113), (177, 114), (177, 115), (177, 116), (177, 117), (177, 118), (177, 119), (177, 120), (177, 121), (177, 122), (177, 123), (177, 124), (177, 125), (177, 126), (177, 127), (177, 128), (177, 130), (178, 55), (178, 58), (178, 59), (178, 60), (178, 61), (178, 62), (178, 63), (178, 64), (178, 65), (178, 66), (178, 67), (178, 68), (178, 69), (178, 70), (178, 71), (178, 72), (178, 73), (178, 74), (178, 75), (178, 76), (178, 77), (178, 78), (178, 79), (178, 80), (178, 81), (178, 82), (178, 83), (178, 84), (178, 85), (178, 86), (178, 89), (178, 102), (178, 104), (178, 105), (178, 106), (178, 107), (178, 108), (178, 109), (178, 110), (178, 111), (178, 112), (178, 113), (178, 114), (178, 115), (178, 116), (178, 117), (178, 118), (178, 119), (178, 120), (178, 121), (178, 122), (178, 123), (178, 124), (178, 125), (178, 126), (178, 127), (178, 129), (179, 54), (179, 56), (179, 57), (179, 58), (179, 59), (179, 60), (179, 61), (179, 62), (179, 63), (179, 64), (179, 65), (179, 66), (179, 67), (179, 68), (179, 69), (179, 70), (179, 71), (179, 72), (179, 73), (179, 74), (179, 75), (179, 76), (179, 77), (179, 78), (179, 79), (179, 80), (179, 81), (179, 82), (179, 83), (179, 84), (179, 87), (179, 102), (179, 104), (179, 105), (179, 106), (179, 107), (179, 108), (179, 109), (179, 110), (179, 111), (179, 112), (179, 113), (179, 114), (179, 115), (179, 116), (179, 117), (179, 118), (179, 119), (179, 120), (179, 121), (179, 122), (179, 123), (179, 124), (179, 125), (179, 126), (179, 128), (180, 53), (180, 55), (180, 56), (180, 57), (180, 58), (180, 59), (180, 60), (180, 61), (180, 62), (180, 63), (180, 64), (180, 65), (180, 66), (180, 67), (180, 68), (180, 69), (180, 70), (180, 71), (180, 72), (180, 73), (180, 74), (180, 75), (180, 76), (180, 77), (180, 78), (180, 79), (180, 80), (180, 81), (180, 82), (180, 85), (180, 102), (180, 104), (180, 105), (180, 106), (180, 107), (180, 108), (180, 109), (180, 110), (180, 111), (180, 112), (180, 113), (180, 114), (180, 115), (180, 116), (180, 117), (180, 118), (180, 119), (180, 120), (180, 121), (180, 122), (180, 123), (180, 124), (180, 125), (180, 126), (180, 128), (181, 52), (181, 54), (181, 55), (181, 56), (181, 57), (181, 58), (181, 59), (181, 60), (181, 61), (181, 62), (181, 63), (181, 64), (181, 65), (181, 66), (181, 67), (181, 68), (181, 69), (181, 70), (181, 71), (181, 72), (181, 73), (181, 74), (181, 75), (181, 76), (181, 77), (181, 78), (181, 79), (181, 80), (181, 81), (181, 84), (181, 101), (181, 103), (181, 104), (181, 105), (181, 106), (181, 107), (181, 108), (181, 109), (181, 110), (181, 111), (181, 112), (181, 113), (181, 114), (181, 115), (181, 116), (181, 117), (181, 118), (181, 119), (181, 120), (181, 121), (181, 122), (181, 123), (181, 124), (181, 125), (181, 127), (182, 51), (182, 53), (182, 54), (182, 55), (182, 56), (182, 57), (182, 58), (182, 59), (182, 60), (182, 61), (182, 62), (182, 63), (182, 64), (182, 65), (182, 66), (182, 67), (182, 68), (182, 69), (182, 70), (182, 71), (182, 72), (182, 73), (182, 74), (182, 75), (182, 76), (182, 77), (182, 78), (182, 79), (182, 82), (182, 100), (182, 102), (182, 103), (182, 104), (182, 105), (182, 106), (182, 107), (182, 108), (182, 109), (182, 110), (182, 111), (182, 112), (182, 113), (182, 114), (182, 115), (182, 116), (182, 117), (182, 118), (182, 119), (182, 120), (182, 121), (182, 122), (182, 123), (182, 124), (182, 125), (182, 127), (183, 53), (183, 54), (183, 55), (183, 56), (183, 57), (183, 58), (183, 59), (183, 60), (183, 61), (183, 62), (183, 63), (183, 64), (183, 65), (183, 66), (183, 67), (183, 68), (183, 69), (183, 70), (183, 71), (183, 72), (183, 73), (183, 74), (183, 75), (183, 76), (183, 77), (183, 80), (183, 99), (183, 101), (183, 102), (183, 103), (183, 104), (183, 105), (183, 106), (183, 107), (183, 108), (183, 109), (183, 110), (183, 111), (183, 112), (183, 113), (183, 114), (183, 115), (183, 116), (183, 117), (183, 118), (183, 119), (183, 120), (183, 121), (183, 122), (183, 123), (183, 124), (183, 126), (184, 50), (184, 52), (184, 53), (184, 54), (184, 55), (184, 56), (184, 57), (184, 58), (184, 59), (184, 60), (184, 61), (184, 62), (184, 63), (184, 64), (184, 65), (184, 66), (184, 67), (184, 68), (184, 69), (184, 70), (184, 71), (184, 72), (184, 73), (184, 74), (184, 75), (184, 76), (184, 79), (184, 97), (184, 100), (184, 101), (184, 102), (184, 103), (184, 104), (184, 105), (184, 106), (184, 107), (184, 108), (184, 109), (184, 110), (184, 111), (184, 112), (184, 113), (184, 114), (184, 115), (184, 116), (184, 117), (184, 118), (184, 119), (184, 120), (184, 121), (184, 122), (184, 123), (184, 125), (185, 49), (185, 51), (185, 52), (185, 53), (185, 54), (185, 55), (185, 56), (185, 57), (185, 58), (185, 59), (185, 60), (185, 61), (185, 62), (185, 63), (185, 64), (185, 65), (185, 66), (185, 67), (185, 68), (185, 69), (185, 70), (185, 71), (185, 72), (185, 73), (185, 74), (185, 77), (185, 94), (185, 95), (185, 96), (185, 99), (185, 100), (185, 101), (185, 102), (185, 103), (185, 104), (185, 105), (185, 106), (185, 107), (185, 108), (185, 109), (185, 110), (185, 111), (185, 112), (185, 113), (185, 114), (185, 115), (185, 116), (185, 117), (185, 118), (185, 119), (185, 120), (185, 121), (185, 122), (185, 123), (185, 125), (186, 49), (186, 51), (186, 52), (186, 53), (186, 54), (186, 55), (186, 56), (186, 57), (186, 58), (186, 59), (186, 60), (186, 61), (186, 62), (186, 63), (186, 64), (186, 65), (186, 66), (186, 67), (186, 68), (186, 69), (186, 70), (186, 71), (186, 72), (186, 76), (186, 91), (186, 93), (186, 97), (186, 98), (186, 99), (186, 100), (186, 101), (186, 102), (186, 103), (186, 104), (186, 105), (186, 106), (186, 107), (186, 108), (186, 109), (186, 110), (186, 111), (186, 112), (186, 113), (186, 114), (186, 115), (186, 116), (186, 117), (186, 118), (186, 119), (187, 48), (187, 50), (187, 51), (187, 52), (187, 53), (187, 54), (187, 55), (187, 56), (187, 57), (187, 58), (187, 59), (187, 60), (187, 61), (187, 62), (187, 63), (187, 64), (187, 65), (187, 66), (187, 67), (187, 68), (187, 69), (187, 70), (187, 71), (187, 74), (187, 88), (187, 89), (187, 90), (187, 94), (187, 95), (187, 96), (187, 97), (187, 98), (187, 99), (187, 100), (187, 101), (187, 102), (187, 103), (187, 104), (187, 105), (187, 106), (187, 107), (187, 108), (187, 109), (187, 110), (187, 111), (187, 112), (187, 113), (187, 114), (187, 115), (187, 116), (187, 117), (187, 118), (187, 121), (187, 122), (187, 124), (188, 48), (188, 50), (188, 51), (188, 52), (188, 53), (188, 54), (188, 55), (188, 56), (188, 57), (188, 58), (188, 59), (188, 60), (188, 61), (188, 62), (188, 63), (188, 64), (188, 65), (188, 66), (188, 67), (188, 68), (188, 69), (188, 72), (188, 85), (188, 86), (188, 91), (188, 92), (188, 93), (188, 94), (188, 95), (188, 96), (188, 97), (188, 98), (188, 99), (188, 100), (188, 101), (188, 102), (188, 103), (188, 104), (188, 105), (188, 106), (188, 107), (188, 108), (188, 109), (188, 110), (188, 111), (188, 112), (188, 113), (188, 114), (188, 115), (188, 116), (188, 117), (188, 119), (189, 48), (189, 50), (189, 51), (189, 52), (189, 53), (189, 54), (189, 55), (189, 56), (189, 57), (189, 58), (189, 59), (189, 60), (189, 61), (189, 62), (189, 63), (189, 64), (189, 65), (189, 66), (189, 67), (189, 71), (189, 83), (189, 87), (189, 88), (189, 89), (189, 90), (189, 91), (189, 92), (189, 93), (189, 94), (189, 95), (189, 96), (189, 97), (189, 98), (189, 99), (189, 100), (189, 101), (189, 102), (189, 103), (189, 104), (189, 105), (189, 118), (190, 49), (190, 51), (190, 52), (190, 53), (190, 54), (190, 55), (190, 56), (190, 57), (190, 58), (190, 59), (190, 60), (190, 61), (190, 62), (190, 63), (190, 64), (190, 65), (190, 66), (190, 69), (190, 81), (190, 85), (190, 86), (190, 87), (190, 88), (190, 89), (190, 90), (190, 91), (190, 92), (190, 93), (190, 94), (190, 95), (190, 96), (190, 106), (190, 107), (190, 108), (190, 109), (190, 110), (190, 111), (190, 112), (190, 113), (190, 114), (190, 115), (190, 116), (190, 118), (191, 49), (191, 51), (191, 52), (191, 53), (191, 54), (191, 55), (191, 56), (191, 57), (191, 58), (191, 59), (191, 60), (191, 61), (191, 62), (191, 63), (191, 64), (191, 67), (191, 80), (191, 83), (191, 84), (191, 85), (191, 86), (191, 97), (191, 98), (191, 99), (191, 100), (191, 101), (191, 102), (191, 103), (191, 104), (191, 105), (192, 49), (192, 51), (192, 52), (192, 53), (192, 54), (192, 55), (192, 56), (192, 57), (192, 58), (192, 59), (192, 60), (192, 61), (192, 62), (192, 66), (192, 80), (192, 86), (192, 87), (192, 88), (192, 89), (192, 90), (192, 91), (192, 92), (192, 93), (192, 94), (192, 95), (192, 96), (193, 50), (193, 52), (193, 53), (193, 54), (193, 55), (193, 56), (193, 57), (193, 58), (193, 59), (193, 60), (193, 61), (193, 64), (193, 80), (193, 82), (193, 83), (193, 84), (193, 85), (193, 86), (194, 50), (194, 52), (194, 53), (194, 54), (194, 55), (194, 56), (194, 57), (194, 58), (194, 59), (194, 62), (195, 50), (195, 52), (195, 53), (195, 54), (195, 55), (195, 56), (195, 57), (195, 60), (196, 51), (196, 53), (196, 54), (196, 58), (196, 59), (197, 51), (197, 56), (197, 57), (198, 51), (198, 53), (198, 54), (199, 51), (246, 54), (246, 57), (247, 54), (247, 58), (247, 59), (248, 54), (248, 56), (248, 57), (248, 61), (249, 54), (249, 56), (249, 57), (249, 58), (249, 59), (249, 63), (250, 53), (250, 55), (250, 56), (250, 57), (250, 58), (250, 59), (250, 60), (250, 61), (250, 62), (250, 65), (251, 53), (251, 55), (251, 56), (251, 57), (251, 58), (251, 59), (251, 60), (251, 61), (251, 62), (251, 63), (251, 67), (252, 53), (252, 55), (252, 56), (252, 57), (252, 58), (252, 59), (252, 60), (252, 61), (252, 62), (252, 63), (252, 64), (252, 65), (252, 68), (252, 69), (252, 84), (252, 86), (252, 87), (252, 88), (252, 89), (252, 90), (252, 91), (252, 92), (252, 93), (252, 94), (252, 95), (252, 96), (252, 97), (252, 98), (252, 99), (252, 100), (252, 101), (252, 102), (252, 103), (252, 104), (252, 105), (252, 106), (252, 107), (252, 108), (252, 109), (252, 110), (252, 111), (252, 112), (252, 113), (252, 114), (252, 115), (252, 116), (252, 118), (253, 52), (253, 54), (253, 55), (253, 56), (253, 57), (253, 58), (253, 59), (253, 60), (253, 61), (253, 62), (253, 63), (253, 64), (253, 65), (253, 66), (253, 67), (253, 70), (253, 86), (253, 119), (254, 52), (254, 59), (254, 60), (254, 61), (254, 62), (254, 63), (254, 64), (254, 65), (254, 66), (254, 67), (254, 68), (254, 69), (254, 72), (254, 88), (254, 91), (254, 92), (254, 93), (254, 94), (254, 95), (254, 96), (254, 97), (254, 98), (254, 99), (254, 100), (254, 101), (254, 102), (254, 103), (254, 104), (254, 105), (254, 106), (254, 107), (254, 108), (254, 109), (254, 110), (254, 111), (254, 112), (254, 113), (254, 114), (254, 115), (254, 116), (254, 117), (254, 118), (254, 121), (255, 52), (255, 54), (255, 55), (255, 56), (255, 57), (255, 60), (255, 61), (255, 62), (255, 63), (255, 64), (255, 65), (255, 66), (255, 67), (255, 68), (255, 69), (255, 70), (255, 73), (255, 89), (255, 93), (255, 94), (255, 95), (255, 96), (255, 97), (255, 98), (255, 99), (255, 100), (255, 101), (255, 102), (255, 103), (255, 104), (255, 105), (255, 106), (255, 107), (255, 108), (255, 109), (255, 110), (255, 111), (255, 112), (255, 113), (255, 114), (255, 115), (255, 116), (255, 117), (255, 118), (255, 119), (255, 121), (256, 51), (256, 59), (256, 62), (256, 63), (256, 64), (256, 65), (256, 66), (256, 67), (256, 68), (256, 69), (256, 70), (256, 71), (256, 72), (256, 75), (256, 91), (256, 95), (256, 96), (256, 97), (256, 98), (256, 99), (256, 100), (256, 101), (256, 102), (256, 103), (256, 104), (256, 105), (256, 106), (256, 107), (256, 108), (256, 109), (256, 110), (256, 111), (256, 112), (256, 113), (256, 114), (256, 115), (256, 116), (256, 117), (256, 118), (256, 119), (256, 120), (256, 122), (257, 60), (257, 63), (257, 64), (257, 65), (257, 66), (257, 67), (257, 68), (257, 69), (257, 70), (257, 71), (257, 72), (257, 73), (257, 76), (257, 93), (257, 97), (257, 98), (257, 99), (257, 100), (257, 101), (257, 102), (257, 103), (257, 104), (257, 105), (257, 106), (257, 107), (257, 108), (257, 109), (257, 110), (257, 111), (257, 112), (257, 113), (257, 114), (257, 115), (257, 116), (257, 117), (257, 118), (257, 119), (257, 120), (257, 122), (258, 62), (258, 64), (258, 65), (258, 66), (258, 67), (258, 68), (258, 69), (258, 70), (258, 71), (258, 72), (258, 73), (258, 74), (258, 75), (258, 78), (258, 95), (258, 99), (258, 100), (258, 101), (258, 102), (258, 103), (258, 104), (258, 105), (258, 106), (258, 107), (258, 108), (258, 109), (258, 110), (258, 111), (258, 112), (258, 113), (258, 114), (258, 115), (258, 116), (258, 117), (258, 118), (258, 119), (258, 120), (258, 121), (258, 123), (259, 63), (259, 65), (259, 66), (259, 67), (259, 68), (259, 69), (259, 70), (259, 71), (259, 72), (259, 73), (259, 74), (259, 75), (259, 76), (259, 79), (259, 97), (259, 101), (259, 102), (259, 103), (259, 104), (259, 105), (259, 106), (259, 107), (259, 108), (259, 109), (259, 110), (259, 111), (259, 112), (259, 113), (259, 114), (259, 115), (259, 116), (259, 117), (259, 118), (259, 119), (259, 120), (259, 121), (259, 122), (259, 123), (260, 64), (260, 67), (260, 68), (260, 69), (260, 70), (260, 71), (260, 72), (260, 73), (260, 74), (260, 75), (260, 76), (260, 77), (260, 78), (260, 81), (260, 99), (260, 103), (260, 104), (260, 105), (260, 106), (260, 107), (260, 108), (260, 109), (260, 110), (260, 111), (260, 112), (260, 113), (260, 114), (260, 115), (260, 116), (260, 117), (260, 118), (260, 119), (260, 120), (260, 121), (260, 122), (260, 124), (261, 65), (261, 68), (261, 69), (261, 70), (261, 71), (261, 72), (261, 73), (261, 74), (261, 75), (261, 76), (261, 77), (261, 78), (261, 79), (261, 82), (261, 101), (261, 104), (261, 105), (261, 106), (261, 107), (261, 108), (261, 109), (261, 110), (261, 111), (261, 112), (261, 113), (261, 114), (261, 115), (261, 116), (261, 117), (261, 118), (261, 119), (261, 120), (261, 121), (261, 122), (261, 123), (261, 125), (262, 67), (262, 69), (262, 70), (262, 71), (262, 72), (262, 73), (262, 74), (262, 75), (262, 76), (262, 77), (262, 78), (262, 79), (262, 80), (262, 81), (262, 83), (262, 103), (262, 106), (262, 107), (262, 108), (262, 109), (262, 110), (262, 111), (262, 112), (262, 113), (262, 114), (262, 115), (262, 116), (262, 117), (262, 118), (262, 119), (262, 120), (262, 121), (262, 122), (262, 123), (262, 124), (262, 126), (263, 68), (263, 70), (263, 71), (263, 72), (263, 73), (263, 74), (263, 75), (263, 76), (263, 77), (263, 78), (263, 79), (263, 80), (263, 81), (263, 82), (263, 85), (263, 105), (263, 108), (263, 109), (263, 110), (263, 111), (263, 112), (263, 113), (263, 114), (263, 115), (263, 116), (263, 117), (263, 118), (263, 119), (263, 120), (263, 121), (263, 122), (263, 123), (263, 124), (263, 126), (264, 69), (264, 72), (264, 73), (264, 74), (264, 75), (264, 76), (264, 77), (264, 78), (264, 79), (264, 80), (264, 81), (264, 82), (264, 83), (264, 86), (264, 106), (264, 107), (264, 110), (264, 111), (264, 112), (264, 113), (264, 114), (264, 115), (264, 116), (264, 117), (264, 118), (264, 119), (264, 120), (264, 121), (264, 122), (264, 123), (264, 124), (264, 125), (264, 127), (265, 70), (265, 73), (265, 74), (265, 75), (265, 76), (265, 77), (265, 78), (265, 79), (265, 80), (265, 81), (265, 82), (265, 83), (265, 84), (265, 85), (265, 88), (265, 108), (265, 110), (265, 111), (265, 112), (265, 113), (265, 114), (265, 115), (265, 116), (265, 117), (265, 118), (265, 119), (265, 120), (265, 121), (265, 122), (265, 123), (265, 124), (265, 125), (265, 126), (265, 128), (266, 71), (266, 74), (266, 75), (266, 76), (266, 77), (266, 78), (266, 79), (266, 80), (266, 81), (266, 82), (266, 83), (266, 84), (266, 85), (266, 86), (266, 89), (266, 110), (266, 112), (266, 113), (266, 114), (266, 115), (266, 116), (266, 117), (266, 118), (266, 119), (266, 120), (266, 121), (266, 122), (266, 123), (266, 124), (266, 125), (266, 126), (266, 127), (266, 129), (267, 73), (267, 75), (267, 76), (267, 77), (267, 78), (267, 79), (267, 80), (267, 81), (267, 82), (267, 83), (267, 84), (267, 85), (267, 86), (267, 87), (267, 88), (267, 91), (267, 110), (267, 112), (267, 113), (267, 114), (267, 115), (267, 116), (267, 117), (267, 118), (267, 119), (267, 120), (267, 121), (267, 122), (267, 123), (267, 124), (267, 125), (267, 126), (267, 127), (267, 128), (267, 130), (268, 74), (268, 76), (268, 77), (268, 78), (268, 79), (268, 80), (268, 81), (268, 82), (268, 83), (268, 84), (268, 85), (268, 86), (268, 87), (268, 88), (268, 89), (268, 93), (268, 107), (268, 108), (268, 109), (268, 110), (268, 111), (268, 112), (268, 113), (268, 114), (268, 115), (268, 116), (268, 117), (268, 118), (268, 119), (268, 120), (268, 121), (268, 122), (268, 123), (268, 124), (268, 125), (268, 126), (268, 127), (268, 128), (268, 130), (269, 75), (269, 78), (269, 79), (269, 80), (269, 81), (269, 82), (269, 83), (269, 84), (269, 85), (269, 86), (269, 87), (269, 88), (269, 89), (269, 90), (269, 91), (269, 94), (269, 97), (269, 98), (269, 99), (269, 100), (269, 101), (269, 102), (269, 103), (269, 104), (269, 105), (269, 106), (269, 110), (269, 111), (269, 112), (269, 113), (269, 114), (269, 115), (269, 116), (269, 117), (269, 118), (269, 119), (269, 120), (269, 121), (269, 122), (269, 123), (269, 124), (269, 125), (269, 126), (269, 127), (269, 128), (269, 129), (269, 131), (270, 76), (270, 79), (270, 80), (270, 81), (270, 82), (270, 83), (270, 84), (270, 85), (270, 86), (270, 87), (270, 88), (270, 89), (270, 90), (270, 91), (270, 92), (270, 93), (270, 96), (270, 106), (270, 107), (270, 108), (270, 109), (270, 110), (270, 111), (270, 112), (270, 113), (270, 114), (270, 115), (270, 116), (270, 117), (270, 118), (270, 119), (270, 120), (270, 121), (270, 122), (270, 123), (270, 124), (270, 125), (270, 126), (270, 127), (270, 128), (270, 129), (270, 130), (270, 132), (271, 77), (271, 80), (271, 81), (271, 82), (271, 83), (271, 84), (271, 85), (271, 86), (271, 87), (271, 88), (271, 89), (271, 90), (271, 91), (271, 92), (271, 93), (271, 94), (271, 95), (271, 97), (271, 98), (271, 99), (271, 100), (271, 101), (271, 102), (271, 103), (271, 104), (271, 105), (271, 106), (271, 107), (271, 108), (271, 109), (271, 110), (271, 111), (271, 112), (271, 113), (271, 114), (271, 115), (271, 116), (271, 117), (271, 118), (271, 119), (271, 120), (271, 121), (271, 122), (271, 123), (271, 124), (271, 125), (271, 126), (271, 127), (271, 128), (271, 129), (271, 130), (271, 131), (271, 133), (272, 79), (272, 81), (272, 82), (272, 83), (272, 84), (272, 85), (272, 86), (272, 87), (272, 88), (272, 89), (272, 90), (272, 91), (272, 92), (272, 93), (272, 94), (272, 95), (272, 96), (272, 97), (272, 98), (272, 99), (272, 100), (272, 101), (272, 102), (272, 103), (272, 104), (272, 105), (272, 106), (272, 107), (272, 108), (272, 109), (272, 110), (272, 111), (272, 112), (272, 113), (272, 114), (272, 115), (272, 116), (272, 117), (272, 118), (272, 119), (272, 120), (272, 121), (272, 122), (272, 123), (272, 124), (272, 125), (272, 126), (272, 127), (272, 128), (272, 129), (272, 130), (272, 131), (272, 132), (272, 134), (273, 80), (273, 82), (273, 83), (273, 84), (273, 85), (273, 86), (273, 87), (273, 88), (273, 89), (273, 90), (273, 91), (273, 92), (273, 93), (273, 94), (273, 95), (273, 96), (273, 97), (273, 98), (273, 99), (273, 100), (273, 101), (273, 102), (273, 103), (273, 104), (273, 105), (273, 106), (273, 107), (273, 108), (273, 109), (273, 110), (273, 111), (273, 112), (273, 113), (273, 114), (273, 115), (273, 116), (273, 117), (273, 118), (273, 119), (273, 120), (273, 121), (273, 122), (273, 123), (273, 124), (273, 125), (273, 126), (273, 127), (273, 128), (273, 129), (273, 130), (273, 131), (273, 132), (273, 133), (273, 135), (274, 81), (274, 83), (274, 84), (274, 85), (274, 86), (274, 87), (274, 88), (274, 89), (274, 90), (274, 91), (274, 92), (274, 93), (274, 94), (274, 95), (274, 96), (274, 97), (274, 98), (274, 99), (274, 100), (274, 101), (274, 102), (274, 103), (274, 104), (274, 105), (274, 106), (274, 107), (274, 108), (274, 109), (274, 110), (274, 111), (274, 112), (274, 113), (274, 114), (274, 115), (274, 116), (274, 117), (274, 118), (274, 119), (274, 120), (274, 121), (274, 122), (274, 123), (274, 124), (274, 125), (274, 126), (274, 127), (274, 128), (274, 129), (274, 130), (274, 131), (274, 132), (274, 133), (274, 136), (275, 82), (275, 85), (275, 86), (275, 87), (275, 88), (275, 89), (275, 90), (275, 91), (275, 92), (275, 93), (275, 94), (275, 95), (275, 96), (275, 97), (275, 98), (275, 99), (275, 100), (275, 101), (275, 102), (275, 103), (275, 104), (275, 105), (275, 106), (275, 107), (275, 108), (275, 109), (275, 110), (275, 111), (275, 112), (275, 113), (275, 114), (275, 115), (275, 116), (275, 117), (275, 118), (275, 119), (275, 120), (275, 121), (275, 122), (275, 123), (275, 124), (275, 125), (275, 126), (275, 127), (275, 128), (275, 129), (275, 130), (275, 131), (275, 132), (275, 133), (275, 134), (276, 83), (276, 86), (276, 87), (276, 88), (276, 89), (276, 90), (276, 91), (276, 92), (276, 93), (276, 94), (276, 95), (276, 96), (276, 97), (276, 98), (276, 99), (276, 100), (276, 101), (276, 102), (276, 103), (276, 104), (276, 105), (276, 106), (276, 107), (276, 108), (276, 109), (276, 110), (276, 111), (276, 112), (276, 113), (276, 114), (276, 115), (276, 116), (276, 117), (276, 118), (276, 119), (276, 120), (276, 121), (276, 122), (276, 123), (276, 124), (276, 125), (276, 126), (276, 127), (276, 128), (276, 129), (276, 130), (276, 131), (276, 132), (276, 133), (276, 134), (276, 135), (276, 137), (277, 84), (277, 87), (277, 88), (277, 89), (277, 90), (277, 91), (277, 92), (277, 93), (277, 94), (277, 95), (277, 96), (277, 97), (277, 98), (277, 99), (277, 100), (277, 101), (277, 102), (277, 103), (277, 104), (277, 105), (277, 106), (277, 107), (277, 108), (277, 109), (277, 110), (277, 111), (277, 112), (277, 113), (277, 114), (277, 115), (277, 116), (277, 117), (277, 118), (277, 119), (277, 120), (277, 121), (277, 122), (277, 123), (277, 124), (277, 125), (277, 126), (277, 127), (277, 128), (277, 129), (277, 130), (277, 131), (277, 132), (277, 133), (277, 134), (277, 135), (277, 136), (277, 138), (278, 86), (278, 88), (278, 89), (278, 90), (278, 91), (278, 92), (278, 93), (278, 94), (278, 95), (278, 96), (278, 97), (278, 98), (278, 99), (278, 100), (278, 101), (278, 102), (278, 103), (278, 104), (278, 105), (278, 106), (278, 107), (278, 108), (278, 109), (278, 110), (278, 111), (278, 112), (278, 113), (278, 114), (278, 115), (278, 116), (278, 117), (278, 118), (278, 119), (278, 120), (278, 121), (278, 122), (278, 123), (278, 124), (278, 125), (278, 126), (278, 127), (278, 128), (278, 129), (278, 130), (278, 131), (278, 132), (278, 133), (278, 134), (278, 135), (278, 136), (278, 137), (278, 139), (279, 87), (279, 89), (279, 90), (279, 91), (279, 92), (279, 93), (279, 94), (279, 95), (279, 96), (279, 97), (279, 98), (279, 99), (279, 100), (279, 101), (279, 102), (279, 103), (279, 104), (279, 105), (279, 106), (279, 107), (279, 108), (279, 109), (279, 110), (279, 111), (279, 112), (279, 113), (279, 114), (279, 115), (279, 116), (279, 117), (279, 118), (279, 119), (279, 120), (279, 121), (279, 122), (279, 123), (279, 124), (279, 125), (279, 126), (279, 127), (279, 128), (279, 129), (279, 130), (279, 131), (279, 132), (279, 133), (279, 134), (279, 135), (279, 136), (279, 137), (279, 138), (279, 140), (280, 88), (280, 90), (280, 91), (280, 92), (280, 93), (280, 94), (280, 95), (280, 96), (280, 97), (280, 98), (280, 99), (280, 100), (280, 101), (280, 102), (280, 103), (280, 104), (280, 105), (280, 106), (280, 107), (280, 108), (280, 109), (280, 110), (280, 111), (280, 112), (280, 113), (280, 114), (280, 115), (280, 116), (280, 117), (280, 118), (280, 119), (280, 120), (280, 121), (280, 122), (280, 123), (280, 124), (280, 125), (280, 126), (280, 127), (280, 128), (280, 129), (280, 130), (280, 131), (280, 132), (280, 133), (280, 134), (280, 135), (280, 136), (280, 137), (280, 138), (280, 139), (280, 141), (281, 89), (281, 92), (281, 93), (281, 94), (281, 95), (281, 96), (281, 97), (281, 98), (281, 99), (281, 100), (281, 101), (281, 102), (281, 103), (281, 104), (281, 105), (281, 106), (281, 107), (281, 108), (281, 109), (281, 110), (281, 111), (281, 112), (281, 113), (281, 114), (281, 115), (281, 116), (281, 117), (281, 118), (281, 119), (281, 120), (281, 121), (281, 122), (281, 123), (281, 124), (281, 125), (281, 126), (281, 127), (281, 128), (281, 129), (281, 130), (281, 131), (281, 132), (281, 133), (281, 134), (281, 135), (281, 136), (281, 137), (281, 138), (281, 139), (281, 140), (281, 142), (282, 90), (282, 93), (282, 94), (282, 95), (282, 96), (282, 97), (282, 98), (282, 99), (282, 100), (282, 101), (282, 102), (282, 103), (282, 104), (282, 105), (282, 106), (282, 107), (282, 108), (282, 109), (282, 110), (282, 111), (282, 112), (282, 113), (282, 114), (282, 115), (282, 116), (282, 117), (282, 118), (282, 119), (282, 120), (282, 121), (282, 122), (282, 123), (282, 124), (282, 125), (282, 126), (282, 127), (282, 128), (282, 129), (282, 130), (282, 131), (282, 132), (282, 133), (282, 134), (282, 135), (282, 136), (282, 137), (282, 138), (282, 139), (282, 140), (282, 141), (282, 143), (283, 91), (283, 94), (283, 95), (283, 96), (283, 97), (283, 98), (283, 99), (283, 100), (283, 101), (283, 102), (283, 103), (283, 104), (283, 105), (283, 106), (283, 107), (283, 108), (283, 109), (283, 110), (283, 111), (283, 112), (283, 113), (283, 114), (283, 115), (283, 116), (283, 117), (283, 118), (283, 119), (283, 120), (283, 121), (283, 122), (283, 123), (283, 124), (283, 125), (283, 126), (283, 127), (283, 128), (283, 129), (283, 130), (283, 131), (283, 132), (283, 133), (283, 134), (283, 135), (283, 136), (283, 137), (283, 138), (283, 139), (283, 140), (283, 141), (283, 142), (283, 145), (284, 95), (284, 96), (284, 97), (284, 98), (284, 99), (284, 100), (284, 101), (284, 102), (284, 103), (284, 104), (284, 105), (284, 106), (284, 107), (284, 108), (284, 109), (284, 110), (284, 111), (284, 112), (284, 113), (284, 114), (284, 115), (284, 116), (284, 117), (284, 118), (284, 119), (284, 120), (284, 121), (284, 122), (284, 123), (284, 124), (284, 125), (284, 126), (284, 127), (284, 128), (284, 129), (284, 130), (284, 131), (284, 132), (284, 133), (284, 134), (284, 135), (284, 136), (284, 137), (284, 138), (284, 139), (284, 140), (284, 141), (284, 142), (284, 143), (284, 146), (285, 94), (285, 96), (285, 97), (285, 98), (285, 99), (285, 100), (285, 101), (285, 102), (285, 103), (285, 104), (285, 105), (285, 106), (285, 107), (285, 108), (285, 109), (285, 110), (285, 111), (285, 112), (285, 113), (285, 114), (285, 115), (285, 116), (285, 117), (285, 118), (285, 119), (285, 120), (285, 121), (285, 122), (285, 123), (285, 124), (285, 125), (285, 126), (285, 127), (285, 128), (285, 129), (285, 130), (285, 131), (285, 132), (285, 133), (285, 134), (285, 135), (285, 136), (285, 137), (285, 138), (285, 139), (285, 140), (285, 141), (285, 142), (285, 143), (285, 144), (285, 146), (286, 95), (286, 97), (286, 98), (286, 99), (286, 100), (286, 101), (286, 102), (286, 103), (286, 104), (286, 105), (286, 106), (286, 107), (286, 108), (286, 109), (286, 110), (286, 111), (286, 112), (286, 113), (286, 114), (286, 115), (286, 116), (286, 117), (286, 118), (286, 119), (286, 120), (286, 121), (286, 122), (286, 123), (286, 124), (286, 125), (286, 126), (286, 127), (286, 128), (286, 129), (286, 130), (286, 131), (286, 132), (286, 133), (286, 134), (286, 135), (286, 136), (286, 137), (286, 138), (286, 139), (286, 140), (286, 141), (286, 142), (286, 143), (286, 145), (287, 96), (287, 98), (287, 99), (287, 100), (287, 101), (287, 102), (287, 103), (287, 104), (287, 105), (287, 106), (287, 107), (287, 108), (287, 109), (287, 110), (287, 111), (287, 112), (287, 113), (287, 114), (287, 115), (287, 116), (287, 117), (287, 118), (287, 119), (287, 120), (287, 121), (287, 122), (287, 123), (287, 124), (287, 125), (287, 126), (287, 127), (287, 128), (287, 129), (287, 130), (287, 131), (287, 132), (287, 133), (287, 134), (287, 135), (287, 136), (287, 137), (287, 138), (287, 139), (287, 140), (287, 141), (287, 142), (287, 143), (287, 145), (288, 97), (288, 99), (288, 100), (288, 101), (288, 102), (288, 103), (288, 104), (288, 105), (288, 106), (288, 107), (288, 108), (288, 109), (288, 110), (288, 111), (288, 112), (288, 113), (288, 114), (288, 115), (288, 116), (288, 117), (288, 118), (288, 119), (288, 120), (288, 121), (288, 122), (288, 123), (288, 124), (288, 125), (288, 126), (288, 127), (288, 128), (288, 129), (288, 130), (288, 131), (288, 132), (288, 133), (288, 134), (288, 135), (288, 136), (288, 137), (288, 138), (288, 139), (288, 140), (288, 141), (288, 142), (288, 144), (289, 98), (289, 100), (289, 101), (289, 102), (289, 103), (289, 104), (289, 105), (289, 106), (289, 107), (289, 108), (289, 109), (289, 110), (289, 111), (289, 112), (289, 113), (289, 114), (289, 115), (289, 116), (289, 117), (289, 118), (289, 119), (289, 120), (289, 121), (289, 122), (289, 123), (289, 124), (289, 125), (289, 126), (289, 127), (289, 128), (289, 129), (289, 130), (289, 131), (289, 132), (289, 133), (289, 134), (289, 135), (289, 136), (289, 137), (289, 138), (289, 139), (289, 140), (289, 141), (290, 99), (290, 102), (290, 103), (290, 104), (290, 105), (290, 106), (290, 107), (290, 108), (290, 109), (290, 110), (290, 111), (290, 112), (290, 113), (290, 114), (290, 115), (290, 116), (290, 117), (290, 118), (290, 119), (290, 120), (290, 121), (290, 122), (290, 123), (290, 124), (290, 125), (290, 126), (290, 127), (290, 128), (290, 129), (290, 130), (290, 131), (290, 132), (290, 133), (290, 134), (290, 135), (290, 136), (290, 137), (290, 138), (290, 139), (290, 140), (290, 143), (291, 100), (291, 103), (291, 104), (291, 105), (291, 106), (291, 107), (291, 108), (291, 109), (291, 110), (291, 111), (291, 112), (291, 113), (291, 114), (291, 115), (291, 116), (291, 117), (291, 118), (291, 119), (291, 120), (291, 121), (291, 122), (291, 123), (291, 124), (291, 125), (291, 126), (291, 127), (291, 128), (291, 129), (291, 130), (291, 131), (291, 132), (291, 133), (291, 134), (291, 135), (291, 136), (291, 137), (291, 138), (291, 139), (291, 141), (292, 102), (292, 104), (292, 105), (292, 106), (292, 107), (292, 108), (292, 109), (292, 110), (292, 111), (292, 112), (292, 113), (292, 114), (292, 115), (292, 116), (292, 117), (292, 118), (292, 119), (292, 120), (292, 121), (292, 122), (292, 123), (292, 124), (292, 125), (292, 126), (292, 127), (292, 128), (292, 129), (292, 130), (292, 131), (292, 132), (292, 133), (292, 134), (292, 135), (292, 136), (292, 137), (292, 140), (293, 103), (293, 105), (293, 106), (293, 107), (293, 108), (293, 109), (293, 110), (293, 111), (293, 112), (293, 113), (293, 114), (293, 115), (293, 116), (293, 117), (293, 118), (293, 119), (293, 120), (293, 121), (293, 122), (293, 123), (293, 124), (293, 125), (293, 126), (293, 127), (293, 128), (293, 129), (293, 130), (293, 131), (293, 132), (293, 133), (293, 134), (293, 135), (293, 138), (293, 139), (294, 104), (294, 107), (294, 108), (294, 109), (294, 110), (294, 111), (294, 112), (294, 113), (294, 114), (294, 115), (294, 116), (294, 117), (294, 118), (294, 119), (294, 120), (294, 121), (294, 122), (294, 123), (294, 124), (294, 125), (294, 126), (294, 127), (294, 128), (294, 129), (294, 130), (294, 131), (294, 132), (294, 133), (294, 137), (295, 105), (295, 108), (295, 109), (295, 110), (295, 111), (295, 112), (295, 113), (295, 114), (295, 115), (295, 116), (295, 117), (295, 118), (295, 119), (295, 120), (295, 121), (295, 122), (295, 123), (295, 124), (295, 125), (295, 126), (295, 127), (295, 128), (295, 129), (295, 130), (295, 135), (296, 106), (296, 109), (296, 110), (296, 111), (296, 112), (296, 113), (296, 114), (296, 115), (296, 116), (296, 117), (296, 118), (296, 119), (296, 120), (296, 121), (296, 122), (296, 123), (296, 124), (296, 125), (296, 126), (296, 131), (296, 132), (297, 108), (297, 113), (297, 114), (297, 115), (297, 116), (297, 117), (297, 118), (297, 119), (297, 120), (297, 121), (297, 127), (297, 128), (297, 129), (297, 130), (298, 109), (298, 111), (298, 112), (298, 122), (298, 123), (298, 124), (298, 125), (298, 126), (299, 113), (299, 114), (299, 115), (299, 116), (299, 117), (299, 118), (299, 119), (299, 120), (299, 121))
coordinates_993300 = ((222, 20), (222, 22), (222, 23), (222, 24), (222, 25), (222, 26), (222, 27), (222, 28), (222, 29), (222, 30), (222, 31), (222, 32), (222, 33), (222, 34), (222, 35), (222, 36), (222, 37), (222, 38), (222, 39), (222, 40), (222, 41), (222, 42), (222, 43), (222, 44), (222, 45), (222, 46), (222, 47), (222, 48), (222, 49), (222, 50), (222, 51), (222, 52), (222, 53), (222, 55), (222, 73), (222, 75), (222, 76), (222, 77), (222, 78), (222, 79), (222, 80), (222, 81), (222, 82), (222, 83), (222, 84), (222, 85), (222, 86), (222, 87), (222, 88), (222, 89), (222, 90), (222, 91), (222, 92), (222, 93), (222, 94), (222, 95), (222, 96), (222, 97), (222, 98), (222, 99), (222, 100), (222, 101), (222, 102), (222, 103), (222, 104), (222, 105), (222, 106), (222, 107), (222, 108), (222, 109), (222, 110), (222, 111), (222, 112), (222, 113), (222, 114), (222, 115), (222, 116), (222, 117), (222, 118), (222, 119), (222, 120), (222, 121), (222, 122), (222, 123), (222, 124), (222, 125), (222, 126), (222, 127), (222, 128), (222, 129), (222, 130), (222, 131), (222, 132), (222, 133), (222, 134), (222, 135), (222, 136), (222, 137), (222, 138), (222, 139), (222, 140), (222, 141), (222, 142), (222, 143), (222, 144), (222, 145), (222, 146), (222, 147), (222, 148), (222, 149), (222, 150), (222, 151), (222, 152), (222, 153), (222, 154), (222, 155), (222, 156), (222, 158), (223, 20), (223, 22), (223, 23), (223, 24), (223, 25), (223, 26), (223, 27), (223, 28), (223, 29), (223, 30), (223, 31), (223, 32), (223, 33), (223, 34), (223, 35), (223, 36), (223, 37), (223, 38), (223, 39), (223, 40), (223, 41), (223, 42), (223, 43), (223, 44), (223, 45), (223, 46), (223, 47), (223, 48), (223, 49), (223, 50), (223, 51), (223, 52), (223, 53), (223, 55), (223, 73), (223, 75), (223, 76), (223, 77), (223, 78), (223, 79), (223, 80), (223, 81), (223, 82), (223, 83), (223, 84), (223, 85), (223, 86), (223, 87), (223, 88), (223, 89), (223, 90), (223, 91), (223, 92), (223, 93), (223, 94), (223, 95), (223, 96), (223, 97), (223, 98), (223, 99), (223, 100), (223, 101), (223, 102), (223, 103), (223, 104), (223, 105), (223, 106), (223, 107), (223, 108), (223, 109), (223, 110), (223, 111), (223, 112), (223, 113), (223, 114), (223, 115), (223, 116), (223, 117), (223, 118), (223, 119), (223, 120), (223, 121), (223, 122), (223, 123), (223, 124), (223, 125), (223, 126), (223, 127), (223, 128), (223, 129), (223, 130), (223, 131), (223, 132), (223, 133), (223, 134), (223, 135), (223, 136), (223, 137), (223, 138), (223, 139), (223, 140), (223, 141), (223, 142), (223, 143), (223, 144), (223, 145), (223, 146), (223, 147), (223, 148), (223, 149), (223, 150), (223, 151), (223, 152), (223, 153), (223, 154), (223, 155), (223, 156), (223, 158))
coordinates_ffff7_f = ((192, 109), (192, 110), (192, 111), (192, 112), (192, 113), (192, 114), (192, 115), (192, 116), (192, 117), (192, 118), (192, 119), (192, 120), (192, 121), (193, 99), (193, 100), (193, 101), (193, 102), (193, 103), (193, 104), (193, 105), (193, 106), (193, 107), (193, 108), (193, 122), (193, 123), (193, 124), (193, 125), (194, 90), (194, 91), (194, 92), (194, 93), (194, 94), (194, 95), (194, 96), (194, 97), (194, 98), (194, 99), (194, 109), (194, 110), (194, 111), (194, 112), (194, 113), (194, 114), (194, 115), (194, 116), (194, 117), (194, 118), (194, 119), (194, 120), (194, 121), (194, 126), (194, 128), (195, 80), (195, 82), (195, 83), (195, 84), (195, 85), (195, 86), (195, 87), (195, 88), (195, 89), (195, 99), (195, 100), (195, 101), (195, 102), (195, 103), (195, 104), (195, 105), (195, 106), (195, 107), (195, 108), (195, 109), (195, 110), (195, 111), (195, 112), (195, 113), (195, 114), (195, 115), (195, 116), (195, 117), (195, 118), (195, 119), (195, 120), (195, 121), (195, 122), (195, 123), (195, 124), (195, 125), (195, 129), (195, 130), (195, 131), (196, 80), (196, 90), (196, 91), (196, 92), (196, 93), (196, 94), (196, 95), (196, 96), (196, 97), (196, 98), (196, 99), (196, 100), (196, 101), (196, 102), (196, 103), (196, 104), (196, 105), (196, 106), (196, 107), (196, 108), (196, 109), (196, 110), (196, 111), (196, 112), (196, 113), (196, 114), (196, 115), (196, 116), (196, 117), (196, 118), (196, 119), (196, 120), (196, 121), (196, 122), (196, 123), (196, 124), (196, 125), (196, 126), (196, 127), (196, 128), (196, 132), (196, 133), (196, 134), (197, 80), (197, 82), (197, 83), (197, 84), (197, 85), (197, 86), (197, 87), (197, 88), (197, 89), (197, 90), (197, 91), (197, 92), (197, 93), (197, 94), (197, 95), (197, 96), (197, 97), (197, 98), (197, 99), (197, 100), (197, 101), (197, 102), (197, 103), (197, 104), (197, 105), (197, 106), (197, 107), (197, 108), (197, 109), (197, 110), (197, 111), (197, 112), (197, 113), (197, 114), (197, 115), (197, 116), (197, 117), (197, 118), (197, 119), (197, 120), (197, 121), (197, 122), (197, 123), (197, 124), (197, 125), (197, 126), (197, 127), (197, 128), (197, 129), (197, 130), (197, 131), (197, 136), (197, 137), (198, 81), (198, 84), (198, 85), (198, 86), (198, 87), (198, 88), (198, 89), (198, 90), (198, 91), (198, 92), (198, 93), (198, 94), (198, 95), (198, 96), (198, 97), (198, 98), (198, 99), (198, 100), (198, 101), (198, 102), (198, 103), (198, 104), (198, 105), (198, 106), (198, 107), (198, 108), (198, 109), (198, 110), (198, 111), (198, 112), (198, 113), (198, 114), (198, 115), (198, 116), (198, 117), (198, 118), (198, 119), (198, 120), (198, 121), (198, 122), (198, 123), (198, 124), (198, 125), (198, 126), (198, 127), (198, 128), (198, 129), (198, 130), (198, 131), (198, 132), (198, 133), (198, 134), (198, 135), (198, 139), (198, 140), (199, 82), (199, 86), (199, 87), (199, 88), (199, 89), (199, 90), (199, 91), (199, 92), (199, 93), (199, 94), (199, 95), (199, 96), (199, 97), (199, 98), (199, 99), (199, 100), (199, 101), (199, 102), (199, 103), (199, 104), (199, 105), (199, 106), (199, 107), (199, 108), (199, 109), (199, 110), (199, 111), (199, 112), (199, 113), (199, 114), (199, 115), (199, 116), (199, 117), (199, 118), (199, 119), (199, 120), (199, 121), (199, 122), (199, 123), (199, 124), (199, 125), (199, 126), (199, 127), (199, 128), (199, 129), (199, 130), (199, 131), (199, 132), (199, 133), (199, 134), (199, 135), (199, 136), (199, 137), (199, 138), (199, 143), (200, 84), (200, 91), (200, 92), (200, 93), (200, 94), (200, 95), (200, 96), (200, 97), (200, 98), (200, 99), (200, 100), (200, 101), (200, 102), (200, 103), (200, 104), (200, 105), (200, 106), (200, 107), (200, 108), (200, 109), (200, 110), (200, 111), (200, 112), (200, 113), (200, 114), (200, 115), (200, 116), (200, 117), (200, 118), (200, 119), (200, 120), (200, 121), (200, 122), (200, 123), (200, 124), (200, 125), (200, 126), (200, 127), (200, 128), (200, 129), (200, 130), (200, 131), (200, 132), (200, 133), (200, 134), (200, 135), (200, 136), (200, 137), (200, 138), (200, 139), (200, 140), (200, 144), (200, 145), (200, 146), (201, 87), (201, 88), (201, 89), (201, 90), (201, 99), (201, 100), (201, 101), (201, 102), (201, 103), (201, 104), (201, 105), (201, 106), (201, 107), (201, 108), (201, 109), (201, 110), (201, 111), (201, 112), (201, 113), (201, 114), (201, 115), (201, 116), (201, 117), (201, 118), (201, 119), (201, 120), (201, 121), (201, 122), (201, 123), (201, 124), (201, 125), (201, 126), (201, 127), (201, 128), (201, 129), (201, 130), (201, 131), (201, 132), (201, 133), (201, 134), (201, 135), (201, 136), (201, 137), (201, 138), (201, 139), (201, 140), (201, 141), (201, 142), (201, 143), (201, 148), (202, 91), (202, 92), (202, 93), (202, 94), (202, 95), (202, 96), (202, 97), (202, 98), (202, 104), (202, 105), (202, 106), (202, 107), (202, 108), (202, 109), (202, 110), (202, 111), (202, 112), (202, 113), (202, 114), (202, 115), (202, 116), (202, 117), (202, 118), (202, 119), (202, 120), (202, 121), (202, 122), (202, 123), (202, 124), (202, 125), (202, 126), (202, 127), (202, 128), (202, 129), (202, 130), (202, 131), (202, 132), (202, 133), (202, 134), (202, 135), (202, 136), (202, 137), (202, 138), (202, 139), (202, 140), (202, 141), (202, 142), (202, 143), (202, 144), (202, 145), (202, 146), (202, 149), (203, 99), (203, 100), (203, 101), (203, 102), (203, 103), (203, 104), (203, 105), (203, 106), (203, 107), (203, 108), (203, 109), (203, 110), (203, 111), (203, 112), (203, 113), (203, 114), (203, 115), (203, 116), (203, 117), (203, 118), (203, 119), (203, 120), (203, 121), (203, 122), (203, 123), (203, 124), (203, 125), (203, 126), (203, 127), (203, 128), (203, 129), (203, 130), (203, 131), (203, 132), (203, 133), (203, 134), (203, 135), (203, 136), (203, 137), (203, 138), (203, 139), (203, 140), (203, 141), (203, 142), (203, 143), (203, 144), (203, 145), (203, 146), (203, 147), (203, 148), (203, 150), (204, 51), (204, 53), (204, 54), (204, 55), (204, 56), (204, 57), (204, 58), (204, 59), (204, 104), (204, 105), (204, 106), (204, 107), (204, 108), (204, 109), (204, 110), (204, 111), (204, 112), (204, 113), (204, 114), (204, 115), (204, 116), (204, 117), (204, 118), (204, 119), (204, 120), (204, 121), (204, 122), (204, 123), (204, 124), (204, 125), (204, 126), (204, 127), (204, 128), (204, 129), (204, 130), (204, 131), (204, 132), (204, 133), (204, 134), (204, 135), (204, 136), (204, 137), (204, 138), (204, 139), (204, 140), (204, 141), (204, 142), (204, 143), (204, 144), (204, 145), (204, 146), (204, 147), (204, 148), (204, 150), (205, 51), (205, 59), (205, 60), (205, 61), (205, 62), (205, 63), (205, 64), (205, 65), (205, 66), (205, 67), (205, 68), (205, 69), (205, 70), (205, 71), (205, 104), (205, 106), (205, 107), (205, 108), (205, 109), (205, 110), (205, 111), (205, 112), (205, 113), (205, 114), (205, 115), (205, 116), (205, 117), (205, 118), (205, 119), (205, 120), (205, 121), (205, 122), (205, 123), (205, 124), (205, 125), (205, 126), (205, 127), (205, 128), (205, 129), (205, 130), (205, 131), (205, 132), (205, 133), (205, 134), (205, 135), (205, 136), (205, 137), (205, 138), (205, 139), (205, 140), (205, 141), (205, 142), (205, 143), (205, 144), (205, 145), (205, 146), (205, 147), (205, 148), (205, 150), (206, 51), (206, 53), (206, 54), (206, 55), (206, 56), (206, 57), (206, 58), (206, 59), (206, 72), (206, 73), (206, 74), (206, 75), (206, 76), (206, 77), (206, 78), (206, 79), (206, 80), (206, 104), (206, 106), (206, 107), (206, 108), (206, 109), (206, 110), (206, 111), (206, 112), (206, 113), (206, 114), (206, 115), (206, 116), (206, 117), (206, 118), (206, 119), (206, 120), (206, 121), (206, 122), (206, 123), (206, 124), (206, 125), (206, 126), (206, 127), (206, 128), (206, 129), (206, 130), (206, 131), (206, 132), (206, 133), (206, 134), (206, 135), (206, 136), (206, 137), (206, 138), (206, 139), (206, 140), (206, 141), (206, 142), (206, 143), (206, 144), (206, 145), (206, 146), (206, 147), (206, 148), (206, 149), (206, 151), (207, 50), (207, 52), (207, 53), (207, 54), (207, 55), (207, 56), (207, 57), (207, 58), (207, 59), (207, 60), (207, 61), (207, 62), (207, 63), (207, 64), (207, 65), (207, 66), (207, 67), (207, 68), (207, 69), (207, 70), (207, 71), (207, 81), (207, 82), (207, 83), (207, 103), (207, 105), (207, 106), (207, 107), (207, 108), (207, 109), (207, 110), (207, 111), (207, 112), (207, 113), (207, 114), (207, 115), (207, 116), (207, 117), (207, 118), (207, 119), (207, 120), (207, 121), (207, 122), (207, 123), (207, 124), (207, 125), (207, 126), (207, 127), (207, 128), (207, 129), (207, 130), (207, 131), (207, 132), (207, 133), (207, 134), (207, 135), (207, 136), (207, 137), (207, 138), (207, 139), (207, 140), (207, 141), (207, 142), (207, 143), (207, 144), (207, 145), (207, 146), (207, 147), (207, 148), (207, 149), (207, 151), (208, 50), (208, 52), (208, 53), (208, 54), (208, 55), (208, 56), (208, 57), (208, 58), (208, 59), (208, 60), (208, 61), (208, 62), (208, 63), (208, 64), (208, 65), (208, 66), (208, 67), (208, 68), (208, 69), (208, 70), (208, 71), (208, 72), (208, 73), (208, 74), (208, 75), (208, 76), (208, 77), (208, 78), (208, 79), (208, 80), (208, 85), (208, 86), (208, 102), (208, 104), (208, 105), (208, 106), (208, 107), (208, 108), (208, 109), (208, 110), (208, 111), (208, 112), (208, 113), (208, 114), (208, 115), (208, 116), (208, 117), (208, 118), (208, 119), (208, 120), (208, 121), (208, 122), (208, 123), (208, 124), (208, 125), (208, 126), (208, 127), (208, 128), (208, 129), (208, 130), (208, 131), (208, 132), (208, 133), (208, 134), (208, 135), (208, 136), (208, 137), (208, 138), (208, 139), (208, 140), (208, 141), (208, 142), (208, 143), (208, 144), (208, 145), (208, 146), (208, 147), (208, 148), (208, 149), (208, 151), (209, 49), (209, 51), (209, 52), (209, 53), (209, 54), (209, 55), (209, 56), (209, 57), (209, 58), (209, 59), (209, 60), (209, 61), (209, 62), (209, 63), (209, 64), (209, 65), (209, 66), (209, 67), (209, 68), (209, 69), (209, 70), (209, 71), (209, 72), (209, 73), (209, 74), (209, 75), (209, 76), (209, 77), (209, 78), (209, 79), (209, 80), (209, 81), (209, 82), (209, 83), (209, 84), (209, 87), (209, 88), (209, 100), (209, 101), (209, 103), (209, 104), (209, 105), (209, 106), (209, 107), (209, 108), (209, 109), (209, 110), (209, 111), (209, 112), (209, 113), (209, 114), (209, 115), (209, 116), (209, 117), (209, 118), (209, 119), (209, 120), (209, 121), (209, 122), (209, 123), (209, 124), (209, 125), (209, 126), (209, 127), (209, 128), (209, 129), (209, 130), (209, 131), (209, 132), (209, 133), (209, 134), (209, 135), (209, 136), (209, 137), (209, 138), (209, 139), (209, 140), (209, 141), (209, 142), (209, 143), (209, 144), (209, 145), (209, 146), (209, 147), (209, 148), (209, 149), (209, 150), (209, 152), (210, 48), (210, 50), (210, 51), (210, 52), (210, 53), (210, 54), (210, 55), (210, 56), (210, 57), (210, 58), (210, 59), (210, 60), (210, 61), (210, 62), (210, 63), (210, 64), (210, 65), (210, 66), (210, 67), (210, 68), (210, 69), (210, 70), (210, 71), (210, 72), (210, 73), (210, 74), (210, 75), (210, 76), (210, 77), (210, 78), (210, 79), (210, 80), (210, 81), (210, 82), (210, 83), (210, 84), (210, 85), (210, 86), (210, 89), (210, 90), (210, 91), (210, 92), (210, 93), (210, 94), (210, 95), (210, 96), (210, 97), (210, 98), (210, 99), (210, 102), (210, 103), (210, 104), (210, 105), (210, 106), (210, 107), (210, 108), (210, 109), (210, 110), (210, 111), (210, 112), (210, 113), (210, 114), (210, 115), (210, 116), (210, 117), (210, 118), (210, 119), (210, 120), (210, 121), (210, 122), (210, 123), (210, 124), (210, 125), (210, 126), (210, 127), (210, 128), (210, 129), (210, 130), (210, 131), (210, 132), (210, 133), (210, 134), (210, 135), (210, 136), (210, 137), (210, 138), (210, 139), (210, 140), (210, 141), (210, 142), (210, 143), (210, 144), (210, 145), (210, 146), (210, 147), (210, 148), (210, 149), (210, 150), (210, 152), (211, 47), (211, 49), (211, 50), (211, 51), (211, 52), (211, 53), (211, 54), (211, 55), (211, 56), (211, 57), (211, 58), (211, 59), (211, 60), (211, 61), (211, 62), (211, 63), (211, 64), (211, 65), (211, 66), (211, 67), (211, 68), (211, 69), (211, 70), (211, 71), (211, 72), (211, 73), (211, 74), (211, 75), (211, 76), (211, 77), (211, 78), (211, 79), (211, 80), (211, 81), (211, 82), (211, 83), (211, 84), (211, 85), (211, 86), (211, 87), (211, 88), (211, 99), (211, 100), (211, 101), (211, 102), (211, 103), (211, 104), (211, 105), (211, 106), (211, 107), (211, 108), (211, 109), (211, 110), (211, 111), (211, 112), (211, 113), (211, 114), (211, 115), (211, 116), (211, 117), (211, 118), (211, 119), (211, 120), (211, 121), (211, 122), (211, 123), (211, 124), (211, 125), (211, 126), (211, 127), (211, 128), (211, 129), (211, 130), (211, 131), (211, 132), (211, 133), (211, 134), (211, 135), (211, 136), (211, 137), (211, 138), (211, 139), (211, 140), (211, 141), (211, 142), (211, 143), (211, 144), (211, 145), (211, 146), (211, 147), (211, 148), (211, 149), (211, 150), (211, 151), (211, 153), (212, 46), (212, 48), (212, 49), (212, 50), (212, 51), (212, 52), (212, 53), (212, 54), (212, 55), (212, 56), (212, 57), (212, 58), (212, 59), (212, 60), (212, 61), (212, 62), (212, 63), (212, 64), (212, 65), (212, 66), (212, 67), (212, 68), (212, 69), (212, 70), (212, 71), (212, 72), (212, 73), (212, 74), (212, 75), (212, 76), (212, 77), (212, 78), (212, 79), (212, 80), (212, 81), (212, 82), (212, 83), (212, 84), (212, 85), (212, 86), (212, 87), (212, 88), (212, 89), (212, 90), (212, 91), (212, 92), (212, 93), (212, 94), (212, 95), (212, 96), (212, 97), (212, 98), (212, 99), (212, 100), (212, 101), (212, 102), (212, 103), (212, 104), (212, 105), (212, 106), (212, 107), (212, 108), (212, 109), (212, 110), (212, 111), (212, 112), (212, 113), (212, 114), (212, 115), (212, 116), (212, 117), (212, 118), (212, 119), (212, 120), (212, 121), (212, 122), (212, 123), (212, 124), (212, 125), (212, 126), (212, 127), (212, 128), (212, 129), (212, 130), (212, 131), (212, 132), (212, 133), (212, 134), (212, 135), (212, 136), (212, 137), (212, 138), (212, 139), (212, 140), (212, 141), (212, 142), (212, 143), (212, 144), (212, 145), (212, 146), (212, 147), (212, 148), (212, 149), (212, 150), (212, 151), (212, 153), (213, 45), (213, 47), (213, 48), (213, 49), (213, 50), (213, 51), (213, 52), (213, 53), (213, 54), (213, 55), (213, 56), (213, 57), (213, 58), (213, 59), (213, 60), (213, 61), (213, 62), (213, 63), (213, 64), (213, 65), (213, 66), (213, 67), (213, 68), (213, 69), (213, 70), (213, 71), (213, 72), (213, 73), (213, 74), (213, 75), (213, 76), (213, 77), (213, 78), (213, 79), (213, 80), (213, 81), (213, 82), (213, 83), (213, 84), (213, 85), (213, 86), (213, 87), (213, 88), (213, 89), (213, 90), (213, 91), (213, 92), (213, 93), (213, 94), (213, 95), (213, 96), (213, 97), (213, 98), (213, 99), (213, 100), (213, 101), (213, 102), (213, 103), (213, 104), (213, 105), (213, 106), (213, 107), (213, 108), (213, 109), (213, 110), (213, 111), (213, 112), (213, 113), (213, 114), (213, 115), (213, 116), (213, 117), (213, 118), (213, 119), (213, 120), (213, 121), (213, 122), (213, 123), (213, 124), (213, 125), (213, 126), (213, 127), (213, 128), (213, 129), (213, 130), (213, 131), (213, 132), (213, 133), (213, 134), (213, 135), (213, 136), (213, 137), (213, 138), (213, 139), (213, 140), (213, 141), (213, 142), (213, 143), (213, 144), (213, 145), (213, 146), (213, 147), (213, 148), (213, 149), (213, 150), (213, 151), (213, 152), (213, 154), (214, 43), (214, 46), (214, 47), (214, 48), (214, 49), (214, 50), (214, 51), (214, 52), (214, 53), (214, 54), (214, 55), (214, 56), (214, 57), (214, 58), (214, 59), (214, 60), (214, 61), (214, 62), (214, 63), (214, 64), (214, 65), (214, 66), (214, 67), (214, 68), (214, 69), (214, 70), (214, 71), (214, 72), (214, 73), (214, 74), (214, 75), (214, 76), (214, 77), (214, 78), (214, 79), (214, 80), (214, 81), (214, 82), (214, 83), (214, 84), (214, 85), (214, 86), (214, 87), (214, 88), (214, 89), (214, 90), (214, 91), (214, 92), (214, 93), (214, 94), (214, 95), (214, 96), (214, 97), (214, 98), (214, 99), (214, 100), (214, 101), (214, 102), (214, 103), (214, 104), (214, 105), (214, 106), (214, 107), (214, 108), (214, 109), (214, 110), (214, 111), (214, 112), (214, 113), (214, 114), (214, 115), (214, 116), (214, 117), (214, 118), (214, 119), (214, 120), (214, 121), (214, 122), (214, 123), (214, 124), (214, 125), (214, 126), (214, 127), (214, 128), (214, 129), (214, 130), (214, 131), (214, 132), (214, 133), (214, 134), (214, 135), (214, 136), (214, 137), (214, 138), (214, 139), (214, 140), (214, 141), (214, 142), (214, 143), (214, 144), (214, 145), (214, 146), (214, 147), (214, 148), (214, 149), (214, 150), (214, 151), (214, 152), (214, 154), (215, 42), (215, 45), (215, 46), (215, 47), (215, 48), (215, 49), (215, 50), (215, 51), (215, 52), (215, 53), (215, 54), (215, 55), (215, 56), (215, 57), (215, 58), (215, 59), (215, 60), (215, 61), (215, 62), (215, 63), (215, 64), (215, 65), (215, 66), (215, 67), (215, 68), (215, 69), (215, 70), (215, 71), (215, 72), (215, 73), (215, 74), (215, 75), (215, 76), (215, 77), (215, 78), (215, 79), (215, 80), (215, 81), (215, 82), (215, 83), (215, 84), (215, 85), (215, 86), (215, 87), (215, 88), (215, 89), (215, 90), (215, 91), (215, 92), (215, 93), (215, 94), (215, 95), (215, 96), (215, 97), (215, 98), (215, 99), (215, 100), (215, 101), (215, 102), (215, 103), (215, 104), (215, 105), (215, 106), (215, 107), (215, 108), (215, 109), (215, 110), (215, 111), (215, 112), (215, 113), (215, 114), (215, 115), (215, 116), (215, 117), (215, 118), (215, 119), (215, 120), (215, 121), (215, 122), (215, 123), (215, 124), (215, 125), (215, 126), (215, 127), (215, 128), (215, 129), (215, 130), (215, 131), (215, 132), (215, 133), (215, 134), (215, 135), (215, 136), (215, 137), (215, 138), (215, 139), (215, 140), (215, 141), (215, 142), (215, 143), (215, 144), (215, 145), (215, 146), (215, 147), (215, 148), (215, 149), (215, 150), (215, 151), (215, 152), (215, 153), (215, 155), (216, 41), (216, 44), (216, 45), (216, 46), (216, 47), (216, 48), (216, 49), (216, 50), (216, 51), (216, 52), (216, 53), (216, 54), (216, 55), (216, 56), (216, 57), (216, 58), (216, 59), (216, 60), (216, 61), (216, 62), (216, 63), (216, 69), (216, 72), (216, 73), (216, 74), (216, 75), (216, 76), (216, 77), (216, 78), (216, 79), (216, 80), (216, 81), (216, 82), (216, 83), (216, 84), (216, 85), (216, 86), (216, 87), (216, 88), (216, 89), (216, 90), (216, 91), (216, 92), (216, 93), (216, 94), (216, 95), (216, 96), (216, 97), (216, 98), (216, 99), (216, 100), (216, 101), (216, 102), (216, 103), (216, 104), (216, 105), (216, 106), (216, 107), (216, 108), (216, 109), (216, 110), (216, 111), (216, 112), (216, 113), (216, 114), (216, 115), (216, 116), (216, 117), (216, 118), (216, 119), (216, 120), (216, 121), (216, 122), (216, 123), (216, 124), (216, 125), (216, 126), (216, 127), (216, 128), (216, 129), (216, 130), (216, 131), (216, 132), (216, 133), (216, 134), (216, 135), (216, 136), (216, 137), (216, 138), (216, 139), (216, 140), (216, 141), (216, 142), (216, 143), (216, 144), (216, 145), (216, 146), (216, 147), (216, 148), (216, 149), (216, 150), (216, 151), (216, 152), (216, 153), (216, 155), (217, 40), (217, 42), (217, 43), (217, 44), (217, 45), (217, 46), (217, 47), (217, 48), (217, 49), (217, 50), (217, 51), (217, 52), (217, 53), (217, 54), (217, 55), (217, 56), (217, 57), (217, 58), (217, 59), (217, 60), (217, 64), (217, 65), (217, 66), (217, 67), (217, 68), (217, 69), (217, 70), (217, 71), (217, 73), (217, 74), (217, 75), (217, 76), (217, 77), (217, 78), (217, 79), (217, 80), (217, 81), (217, 82), (217, 83), (217, 84), (217, 85), (217, 86), (217, 87), (217, 88), (217, 89), (217, 90), (217, 91), (217, 92), (217, 93), (217, 94), (217, 95), (217, 96), (217, 97), (217, 98), (217, 99), (217, 100), (217, 101), (217, 102), (217, 103), (217, 104), (217, 105), (217, 106), (217, 107), (217, 108), (217, 109), (217, 110), (217, 111), (217, 112), (217, 113), (217, 114), (217, 115), (217, 116), (217, 117), (217, 118), (217, 119), (217, 120), (217, 121), (217, 122), (217, 123), (217, 124), (217, 125), (217, 126), (217, 127), (217, 128), (217, 129), (217, 130), (217, 131), (217, 132), (217, 133), (217, 134), (217, 135), (217, 136), (217, 137), (217, 138), (217, 139), (217, 140), (217, 141), (217, 142), (217, 143), (217, 144), (217, 145), (217, 146), (217, 147), (217, 148), (217, 149), (217, 150), (217, 151), (217, 152), (217, 153), (217, 154), (217, 156), (218, 40), (218, 42), (218, 43), (218, 44), (218, 45), (218, 46), (218, 47), (218, 48), (218, 49), (218, 50), (218, 51), (218, 52), (218, 53), (218, 54), (218, 55), (218, 56), (218, 57), (218, 61), (218, 62), (218, 63), (218, 72), (218, 74), (218, 75), (218, 76), (218, 77), (218, 78), (218, 79), (218, 80), (218, 81), (218, 82), (218, 83), (218, 84), (218, 85), (218, 86), (218, 87), (218, 88), (218, 89), (218, 90), (218, 91), (218, 92), (218, 93), (218, 94), (218, 95), (218, 96), (218, 97), (218, 98), (218, 99), (218, 100), (218, 101), (218, 102), (218, 103), (218, 104), (218, 105), (218, 106), (218, 107), (218, 108), (218, 109), (218, 110), (218, 111), (218, 112), (218, 113), (218, 114), (218, 115), (218, 116), (218, 117), (218, 118), (218, 119), (218, 120), (218, 121), (218, 122), (218, 123), (218, 124), (218, 125), (218, 126), (218, 127), (218, 128), (218, 129), (218, 130), (218, 131), (218, 132), (218, 133), (218, 134), (218, 135), (218, 136), (218, 137), (218, 138), (218, 139), (218, 140), (218, 141), (218, 142), (218, 143), (218, 144), (218, 145), (218, 146), (218, 147), (218, 148), (218, 149), (218, 150), (218, 151), (218, 152), (218, 153), (218, 154), (218, 155), (219, 39), (219, 58), (219, 60), (219, 73), (219, 158), (220, 39), (220, 41), (220, 42), (220, 43), (220, 44), (220, 45), (220, 46), (220, 47), (220, 48), (220, 49), (220, 50), (220, 51), (220, 52), (220, 53), (220, 54), (220, 55), (220, 56), (220, 57), (220, 73), (220, 75), (220, 76), (220, 77), (220, 78), (220, 79), (220, 80), (220, 81), (220, 82), (220, 83), (220, 84), (220, 85), (220, 86), (220, 87), (220, 88), (220, 89), (220, 90), (220, 91), (220, 92), (220, 93), (220, 94), (220, 95), (220, 96), (220, 97), (220, 98), (220, 99), (220, 100), (220, 101), (220, 102), (220, 103), (220, 104), (220, 105), (220, 106), (220, 107), (220, 108), (220, 109), (220, 110), (220, 111), (220, 112), (220, 113), (220, 114), (220, 115), (220, 116), (220, 117), (220, 118), (220, 119), (220, 120), (220, 121), (220, 122), (220, 123), (220, 124), (220, 125), (220, 126), (220, 127), (220, 128), (220, 129), (220, 130), (220, 131), (220, 132), (220, 133), (220, 134), (220, 135), (220, 136), (220, 137), (220, 138), (220, 139), (220, 140), (220, 141), (220, 142), (220, 143), (220, 144), (220, 145), (220, 146), (220, 147), (220, 148), (220, 149), (220, 150), (220, 151), (220, 152), (220, 153), (220, 154), (220, 155), (220, 156), (220, 158), (225, 43), (225, 45), (225, 46), (225, 47), (225, 48), (225, 49), (225, 50), (225, 51), (225, 52), (225, 53), (225, 54), (225, 55), (225, 56), (225, 58), (225, 72), (225, 74), (225, 75), (225, 76), (225, 77), (225, 78), (225, 79), (225, 80), (225, 81), (225, 82), (225, 83), (225, 84), (225, 85), (225, 86), (225, 87), (225, 88), (225, 89), (225, 90), (225, 91), (225, 92), (225, 93), (225, 94), (225, 95), (225, 96), (225, 97), (225, 98), (225, 99), (225, 100), (225, 101), (225, 102), (225, 103), (225, 104), (225, 105), (225, 106), (225, 107), (225, 108), (225, 109), (225, 110), (225, 111), (225, 112), (225, 113), (225, 114), (225, 115), (225, 116), (225, 117), (225, 118), (225, 119), (225, 120), (225, 121), (225, 122), (225, 123), (225, 124), (225, 125), (225, 126), (225, 127), (225, 128), (225, 129), (225, 130), (225, 131), (225, 132), (225, 133), (225, 134), (225, 135), (225, 136), (225, 137), (225, 138), (225, 139), (225, 140), (225, 141), (225, 142), (225, 143), (225, 144), (225, 145), (225, 146), (225, 147), (225, 148), (225, 149), (225, 150), (225, 151), (225, 152), (225, 153), (225, 154), (225, 155), (225, 156), (225, 158), (226, 44), (226, 60), (226, 70), (226, 158), (227, 45), (227, 48), (227, 49), (227, 50), (227, 51), (227, 52), (227, 53), (227, 54), (227, 55), (227, 56), (227, 57), (227, 58), (227, 61), (227, 69), (227, 72), (227, 73), (227, 74), (227, 75), (227, 76), (227, 77), (227, 78), (227, 79), (227, 80), (227, 81), (227, 82), (227, 83), (227, 84), (227, 85), (227, 86), (227, 87), (227, 88), (227, 89), (227, 90), (227, 91), (227, 92), (227, 93), (227, 94), (227, 95), (227, 96), (227, 97), (227, 98), (227, 99), (227, 100), (227, 101), (227, 102), (227, 103), (227, 104), (227, 105), (227, 106), (227, 107), (227, 108), (227, 109), (227, 110), (227, 111), (227, 112), (227, 113), (227, 114), (227, 115), (227, 116), (227, 117), (227, 118), (227, 119), (227, 120), (227, 121), (227, 122), (227, 123), (227, 124), (227, 125), (227, 126), (227, 127), (227, 128), (227, 129), (227, 130), (227, 131), (227, 132), (227, 133), (227, 134), (227, 135), (227, 136), (227, 137), (227, 138), (227, 139), (227, 140), (227, 141), (227, 142), (227, 143), (227, 144), (227, 145), (227, 146), (227, 147), (227, 148), (227, 149), (227, 150), (227, 151), (227, 152), (227, 153), (227, 154), (227, 155), (227, 157), (228, 47), (228, 49), (228, 50), (228, 51), (228, 52), (228, 53), (228, 54), (228, 55), (228, 56), (228, 57), (228, 58), (228, 59), (228, 60), (228, 63), (228, 64), (228, 65), (228, 66), (228, 67), (228, 70), (228, 71), (228, 72), (228, 73), (228, 74), (228, 75), (228, 76), (228, 77), (228, 78), (228, 79), (228, 80), (228, 81), (228, 82), (228, 83), (228, 84), (228, 85), (228, 86), (228, 87), (228, 88), (228, 89), (228, 90), (228, 91), (228, 92), (228, 93), (228, 94), (228, 95), (228, 96), (228, 97), (228, 98), (228, 99), (228, 100), (228, 101), (228, 102), (228, 103), (228, 104), (228, 105), (228, 106), (228, 107), (228, 108), (228, 109), (228, 110), (228, 111), (228, 112), (228, 113), (228, 114), (228, 115), (228, 116), (228, 117), (228, 118), (228, 119), (228, 120), (228, 121), (228, 122), (228, 123), (228, 124), (228, 125), (228, 126), (228, 127), (228, 128), (228, 129), (228, 130), (228, 131), (228, 132), (228, 133), (228, 134), (228, 135), (228, 136), (228, 137), (228, 138), (228, 139), (228, 140), (228, 141), (228, 142), (228, 143), (228, 144), (228, 145), (228, 146), (228, 147), (228, 148), (228, 149), (228, 150), (228, 151), (228, 152), (228, 153), (228, 154), (228, 155), (228, 157), (229, 48), (229, 50), (229, 51), (229, 52), (229, 53), (229, 54), (229, 55), (229, 56), (229, 57), (229, 58), (229, 59), (229, 60), (229, 61), (229, 62), (229, 69), (229, 70), (229, 71), (229, 72), (229, 73), (229, 74), (229, 75), (229, 76), (229, 77), (229, 78), (229, 79), (229, 80), (229, 81), (229, 82), (229, 83), (229, 84), (229, 85), (229, 86), (229, 87), (229, 88), (229, 89), (229, 90), (229, 91), (229, 92), (229, 93), (229, 94), (229, 95), (229, 96), (229, 97), (229, 98), (229, 99), (229, 100), (229, 101), (229, 102), (229, 103), (229, 104), (229, 105), (229, 106), (229, 107), (229, 108), (229, 109), (229, 110), (229, 111), (229, 112), (229, 113), (229, 114), (229, 115), (229, 116), (229, 117), (229, 118), (229, 119), (229, 120), (229, 121), (229, 122), (229, 123), (229, 124), (229, 125), (229, 126), (229, 127), (229, 128), (229, 129), (229, 130), (229, 131), (229, 132), (229, 133), (229, 134), (229, 135), (229, 136), (229, 137), (229, 138), (229, 139), (229, 140), (229, 141), (229, 142), (229, 143), (229, 144), (229, 145), (229, 146), (229, 147), (229, 148), (229, 149), (229, 150), (229, 151), (229, 152), (229, 153), (229, 154), (229, 155), (229, 157), (230, 49), (230, 51), (230, 52), (230, 53), (230, 54), (230, 55), (230, 56), (230, 57), (230, 58), (230, 59), (230, 60), (230, 61), (230, 62), (230, 63), (230, 64), (230, 65), (230, 66), (230, 67), (230, 68), (230, 69), (230, 70), (230, 71), (230, 72), (230, 73), (230, 74), (230, 75), (230, 76), (230, 77), (230, 78), (230, 79), (230, 80), (230, 81), (230, 82), (230, 83), (230, 84), (230, 85), (230, 86), (230, 87), (230, 88), (230, 89), (230, 90), (230, 91), (230, 92), (230, 93), (230, 94), (230, 95), (230, 96), (230, 97), (230, 98), (230, 99), (230, 100), (230, 101), (230, 102), (230, 103), (230, 104), (230, 105), (230, 106), (230, 107), (230, 108), (230, 109), (230, 110), (230, 111), (230, 112), (230, 113), (230, 114), (230, 115), (230, 116), (230, 117), (230, 118), (230, 119), (230, 120), (230, 121), (230, 122), (230, 123), (230, 124), (230, 125), (230, 126), (230, 127), (230, 128), (230, 129), (230, 130), (230, 131), (230, 132), (230, 133), (230, 134), (230, 135), (230, 136), (230, 137), (230, 138), (230, 139), (230, 140), (230, 141), (230, 142), (230, 143), (230, 144), (230, 145), (230, 146), (230, 147), (230, 148), (230, 149), (230, 150), (230, 151), (230, 152), (230, 153), (230, 154), (230, 155), (230, 157), (231, 50), (231, 52), (231, 53), (231, 54), (231, 55), (231, 56), (231, 57), (231, 58), (231, 59), (231, 60), (231, 61), (231, 62), (231, 63), (231, 64), (231, 65), (231, 66), (231, 67), (231, 68), (231, 69), (231, 70), (231, 71), (231, 72), (231, 73), (231, 74), (231, 75), (231, 76), (231, 77), (231, 78), (231, 79), (231, 80), (231, 81), (231, 82), (231, 83), (231, 84), (231, 85), (231, 86), (231, 87), (231, 88), (231, 89), (231, 90), (231, 91), (231, 92), (231, 93), (231, 94), (231, 95), (231, 96), (231, 97), (231, 98), (231, 99), (231, 100), (231, 101), (231, 102), (231, 103), (231, 104), (231, 105), (231, 106), (231, 107), (231, 108), (231, 109), (231, 110), (231, 111), (231, 112), (231, 113), (231, 114), (231, 115), (231, 116), (231, 117), (231, 118), (231, 119), (231, 120), (231, 121), (231, 122), (231, 123), (231, 124), (231, 125), (231, 126), (231, 127), (231, 128), (231, 129), (231, 130), (231, 131), (231, 132), (231, 133), (231, 134), (231, 135), (231, 136), (231, 137), (231, 138), (231, 139), (231, 140), (231, 141), (231, 142), (231, 143), (231, 144), (231, 145), (231, 146), (231, 147), (231, 148), (231, 149), (231, 150), (231, 151), (231, 152), (231, 153), (231, 154), (231, 156), (232, 51), (232, 53), (232, 54), (232, 55), (232, 56), (232, 57), (232, 58), (232, 59), (232, 60), (232, 61), (232, 62), (232, 63), (232, 64), (232, 65), (232, 66), (232, 67), (232, 68), (232, 69), (232, 70), (232, 71), (232, 72), (232, 73), (232, 74), (232, 75), (232, 76), (232, 77), (232, 78), (232, 79), (232, 80), (232, 81), (232, 82), (232, 83), (232, 84), (232, 85), (232, 86), (232, 87), (232, 88), (232, 89), (232, 90), (232, 91), (232, 92), (232, 93), (232, 94), (232, 95), (232, 96), (232, 97), (232, 98), (232, 99), (232, 100), (232, 101), (232, 102), (232, 103), (232, 104), (232, 105), (232, 106), (232, 107), (232, 108), (232, 109), (232, 110), (232, 111), (232, 112), (232, 113), (232, 114), (232, 115), (232, 116), (232, 117), (232, 118), (232, 119), (232, 120), (232, 121), (232, 122), (232, 123), (232, 124), (232, 125), (232, 126), (232, 127), (232, 128), (232, 129), (232, 130), (232, 131), (232, 132), (232, 133), (232, 134), (232, 135), (232, 136), (232, 137), (232, 138), (232, 139), (232, 140), (232, 141), (232, 142), (232, 143), (232, 144), (232, 145), (232, 146), (232, 147), (232, 148), (232, 149), (232, 150), (232, 151), (232, 152), (232, 153), (232, 154), (232, 156), (233, 52), (233, 54), (233, 55), (233, 56), (233, 57), (233, 58), (233, 59), (233, 60), (233, 61), (233, 62), (233, 63), (233, 64), (233, 65), (233, 66), (233, 67), (233, 68), (233, 69), (233, 70), (233, 71), (233, 72), (233, 73), (233, 74), (233, 75), (233, 76), (233, 77), (233, 78), (233, 79), (233, 80), (233, 81), (233, 82), (233, 83), (233, 84), (233, 85), (233, 86), (233, 87), (233, 88), (233, 89), (233, 90), (233, 91), (233, 92), (233, 93), (233, 94), (233, 95), (233, 96), (233, 97), (233, 98), (233, 99), (233, 100), (233, 101), (233, 102), (233, 103), (233, 104), (233, 105), (233, 106), (233, 107), (233, 108), (233, 109), (233, 110), (233, 111), (233, 112), (233, 113), (233, 114), (233, 115), (233, 116), (233, 117), (233, 118), (233, 119), (233, 120), (233, 121), (233, 122), (233, 123), (233, 124), (233, 125), (233, 126), (233, 127), (233, 128), (233, 129), (233, 130), (233, 131), (233, 132), (233, 133), (233, 134), (233, 135), (233, 136), (233, 137), (233, 138), (233, 139), (233, 140), (233, 141), (233, 142), (233, 143), (233, 144), (233, 145), (233, 146), (233, 147), (233, 148), (233, 149), (233, 150), (233, 151), (233, 152), (233, 153), (233, 154), (233, 156), (234, 52), (234, 54), (234, 55), (234, 56), (234, 57), (234, 58), (234, 59), (234, 60), (234, 61), (234, 62), (234, 63), (234, 64), (234, 65), (234, 66), (234, 67), (234, 68), (234, 69), (234, 70), (234, 71), (234, 72), (234, 73), (234, 74), (234, 75), (234, 76), (234, 77), (234, 78), (234, 79), (234, 80), (234, 81), (234, 85), (234, 86), (234, 101), (234, 102), (234, 103), (234, 104), (234, 105), (234, 106), (234, 107), (234, 108), (234, 109), (234, 110), (234, 111), (234, 112), (234, 113), (234, 114), (234, 115), (234, 116), (234, 117), (234, 118), (234, 119), (234, 120), (234, 121), (234, 122), (234, 123), (234, 124), (234, 125), (234, 126), (234, 127), (234, 128), (234, 129), (234, 130), (234, 131), (234, 132), (234, 133), (234, 134), (234, 135), (234, 136), (234, 137), (234, 138), (234, 139), (234, 140), (234, 141), (234, 142), (234, 143), (234, 144), (234, 145), (234, 146), (234, 147), (234, 148), (234, 149), (234, 150), (234, 151), (234, 152), (234, 156), (235, 53), (235, 55), (235, 56), (235, 57), (235, 58), (235, 59), (235, 60), (235, 61), (235, 62), (235, 63), (235, 64), (235, 65), (235, 66), (235, 67), (235, 68), (235, 69), (235, 70), (235, 71), (235, 72), (235, 73), (235, 74), (235, 75), (235, 76), (235, 77), (235, 78), (235, 79), (235, 80), (235, 81), (235, 83), (235, 84), (235, 85), (235, 86), (235, 87), (235, 88), (235, 89), (235, 90), (235, 91), (235, 92), (235, 93), (235, 94), (235, 95), (235, 96), (235, 97), (235, 98), (235, 99), (235, 102), (235, 103), (235, 104), (235, 105), (235, 106), (235, 107), (235, 108), (235, 109), (235, 110), (235, 111), (235, 112), (235, 113), (235, 114), (235, 115), (235, 116), (235, 117), (235, 118), (235, 119), (235, 120), (235, 121), (235, 122), (235, 123), (235, 124), (235, 125), (235, 126), (235, 127), (235, 128), (235, 129), (235, 130), (235, 131), (235, 132), (235, 133), (235, 134), (235, 135), (235, 136), (235, 137), (235, 138), (235, 139), (235, 140), (235, 141), (235, 142), (235, 143), (235, 144), (235, 145), (235, 146), (235, 147), (235, 148), (235, 149), (235, 150), (235, 153), (235, 155), (236, 53), (236, 55), (236, 56), (236, 57), (236, 58), (236, 59), (236, 60), (236, 61), (236, 62), (236, 63), (236, 64), (236, 65), (236, 66), (236, 67), (236, 68), (236, 69), (236, 70), (236, 71), (236, 72), (236, 73), (236, 74), (236, 75), (236, 76), (236, 77), (236, 78), (236, 79), (236, 81), (236, 101), (236, 103), (236, 104), (236, 105), (236, 106), (236, 107), (236, 108), (236, 109), (236, 110), (236, 111), (236, 112), (236, 113), (236, 114), (236, 115), (236, 116), (236, 117), (236, 118), (236, 119), (236, 120), (236, 121), (236, 122), (236, 123), (236, 124), (236, 125), (236, 126), (236, 127), (236, 128), (236, 129), (236, 130), (236, 131), (236, 132), (236, 133), (236, 134), (236, 135), (236, 136), (236, 137), (236, 138), (236, 139), (236, 140), (236, 141), (236, 142), (236, 143), (236, 144), (236, 145), (236, 146), (236, 147), (236, 148), (236, 149), (236, 152), (237, 54), (237, 56), (237, 57), (237, 58), (237, 59), (237, 60), (237, 61), (237, 62), (237, 63), (237, 64), (237, 65), (237, 66), (237, 67), (237, 68), (237, 69), (237, 70), (237, 81), (237, 102), (237, 104), (237, 105), (237, 106), (237, 107), (237, 108), (237, 109), (237, 110), (237, 111), (237, 112), (237, 113), (237, 114), (237, 115), (237, 116), (237, 117), (237, 118), (237, 119), (237, 120), (237, 121), (237, 122), (237, 123), (237, 124), (237, 125), (237, 126), (237, 127), (237, 128), (237, 129), (237, 130), (237, 131), (237, 132), (237, 133), (237, 134), (237, 135), (237, 136), (237, 137), (237, 138), (237, 139), (237, 140), (237, 141), (237, 142), (237, 143), (237, 144), (237, 145), (237, 146), (237, 147), (237, 150), (238, 54), (238, 56), (238, 57), (238, 58), (238, 59), (238, 60), (238, 61), (238, 62), (238, 63), (238, 64), (238, 71), (238, 72), (238, 73), (238, 74), (238, 75), (238, 76), (238, 77), (238, 78), (238, 80), (238, 103), (238, 105), (238, 106), (238, 107), (238, 108), (238, 109), (238, 110), (238, 111), (238, 112), (238, 113), (238, 114), (238, 115), (238, 116), (238, 117), (238, 118), (238, 119), (238, 120), (238, 121), (238, 122), (238, 123), (238, 124), (238, 125), (238, 126), (238, 127), (238, 128), (238, 129), (238, 130), (238, 131), (238, 132), (238, 133), (238, 134), (238, 135), (238, 136), (238, 137), (238, 138), (238, 139), (238, 140), (238, 141), (238, 142), (238, 143), (238, 144), (238, 145), (238, 146), (238, 149), (239, 54), (239, 65), (239, 66), (239, 67), (239, 68), (239, 69), (239, 70), (239, 104), (239, 106), (239, 107), (239, 108), (239, 109), (239, 110), (239, 111), (239, 112), (239, 113), (239, 114), (239, 115), (239, 116), (239, 117), (239, 118), (239, 119), (239, 120), (239, 121), (239, 122), (239, 123), (239, 124), (239, 125), (239, 126), (239, 127), (239, 128), (239, 129), (239, 130), (239, 131), (239, 132), (239, 133), (239, 134), (239, 135), (239, 136), (239, 137), (239, 138), (239, 139), (239, 140), (239, 141), (239, 142), (239, 143), (239, 144), (239, 145), (240, 54), (240, 56), (240, 57), (240, 58), (240, 59), (240, 60), (240, 61), (240, 62), (240, 63), (240, 64), (240, 104), (240, 106), (240, 107), (240, 108), (240, 109), (240, 110), (240, 111), (240, 112), (240, 113), (240, 114), (240, 115), (240, 116), (240, 117), (240, 118), (240, 119), (240, 120), (240, 121), (240, 122), (240, 123), (240, 124), (240, 125), (240, 126), (240, 127), (240, 128), (240, 129), (240, 130), (240, 131), (240, 132), (240, 133), (240, 134), (240, 135), (240, 136), (240, 137), (240, 138), (240, 139), (240, 140), (240, 141), (240, 142), (240, 143), (240, 144), (240, 146), (241, 54), (241, 55), (241, 104), (241, 106), (241, 107), (241, 108), (241, 109), (241, 110), (241, 111), (241, 112), (241, 113), (241, 114), (241, 115), (241, 116), (241, 117), (241, 118), (241, 119), (241, 120), (241, 121), (241, 122), (241, 123), (241, 124), (241, 125), (241, 126), (241, 127), (241, 128), (241, 129), (241, 130), (241, 131), (241, 132), (241, 133), (241, 134), (241, 135), (241, 136), (241, 137), (241, 138), (241, 139), (241, 140), (241, 141), (241, 142), (241, 143), (241, 145), (242, 103), (242, 105), (242, 106), (242, 107), (242, 108), (242, 109), (242, 110), (242, 111), (242, 112), (242, 113), (242, 114), (242, 115), (242, 116), (242, 117), (242, 118), (242, 119), (242, 120), (242, 121), (242, 122), (242, 123), (242, 124), (242, 125), (242, 126), (242, 127), (242, 128), (242, 129), (242, 130), (242, 131), (242, 132), (242, 133), (242, 134), (242, 135), (242, 136), (242, 137), (242, 138), (242, 139), (242, 140), (242, 141), (242, 142), (243, 100), (243, 101), (243, 104), (243, 105), (243, 106), (243, 107), (243, 108), (243, 109), (243, 110), (243, 111), (243, 112), (243, 113), (243, 114), (243, 115), (243, 116), (243, 117), (243, 118), (243, 119), (243, 120), (243, 121), (243, 122), (243, 123), (243, 124), (243, 125), (243, 126), (243, 127), (243, 128), (243, 129), (243, 130), (243, 131), (243, 132), (243, 133), (243, 134), (243, 135), (243, 136), (243, 137), (243, 138), (243, 139), (243, 140), (243, 141), (243, 142), (243, 144), (244, 90), (244, 91), (244, 92), (244, 93), (244, 94), (244, 95), (244, 96), (244, 97), (244, 98), (244, 99), (244, 103), (244, 104), (244, 105), (244, 106), (244, 107), (244, 108), (244, 109), (244, 110), (244, 111), (244, 112), (244, 113), (244, 114), (244, 115), (244, 116), (244, 117), (244, 118), (244, 119), (244, 120), (244, 121), (244, 122), (244, 123), (244, 124), (244, 125), (244, 126), (244, 127), (244, 128), (244, 129), (244, 130), (244, 131), (244, 132), (244, 133), (244, 134), (244, 135), (244, 136), (244, 137), (244, 138), (244, 139), (244, 140), (244, 141), (244, 143), (245, 86), (245, 88), (245, 89), (245, 100), (245, 101), (245, 102), (245, 103), (245, 104), (245, 105), (245, 106), (245, 107), (245, 108), (245, 109), (245, 110), (245, 111), (245, 112), (245, 113), (245, 114), (245, 115), (245, 116), (245, 117), (245, 118), (245, 119), (245, 120), (245, 121), (245, 122), (245, 123), (245, 124), (245, 125), (245, 126), (245, 127), (245, 128), (245, 129), (245, 130), (245, 131), (245, 132), (245, 133), (245, 134), (245, 135), (245, 136), (245, 137), (245, 138), (245, 139), (245, 140), (245, 142), (246, 84), (246, 90), (246, 91), (246, 92), (246, 93), (246, 94), (246, 95), (246, 96), (246, 97), (246, 98), (246, 99), (246, 100), (246, 101), (246, 102), (246, 103), (246, 104), (246, 105), (246, 106), (246, 107), (246, 108), (246, 109), (246, 110), (246, 111), (246, 112), (246, 113), (246, 114), (246, 115), (246, 116), (246, 117), (246, 118), (246, 119), (246, 120), (246, 121), (246, 122), (246, 123), (246, 124), (246, 125), (246, 126), (246, 127), (246, 128), (246, 129), (246, 130), (246, 131), (246, 132), (246, 133), (246, 134), (246, 135), (246, 136), (246, 137), (246, 138), (246, 139), (246, 141), (247, 83), (247, 86), (247, 87), (247, 88), (247, 89), (247, 90), (247, 91), (247, 92), (247, 93), (247, 94), (247, 95), (247, 96), (247, 97), (247, 98), (247, 99), (247, 100), (247, 101), (247, 102), (247, 103), (247, 104), (247, 105), (247, 106), (247, 107), (247, 108), (247, 109), (247, 110), (247, 111), (247, 112), (247, 113), (247, 114), (247, 115), (247, 116), (247, 117), (247, 118), (247, 119), (247, 120), (247, 121), (247, 122), (247, 123), (247, 124), (247, 125), (247, 126), (247, 127), (247, 128), (247, 129), (247, 130), (247, 131), (247, 132), (247, 133), (247, 134), (247, 135), (247, 136), (247, 137), (247, 138), (247, 140), (248, 83), (248, 118), (248, 119), (248, 120), (248, 121), (248, 122), (248, 123), (248, 125), (248, 126), (248, 127), (248, 128), (248, 129), (248, 130), (248, 131), (248, 132), (248, 133), (248, 134), (248, 135), (248, 136), (248, 137), (248, 139), (249, 83), (249, 85), (249, 86), (249, 87), (249, 88), (249, 89), (249, 90), (249, 91), (249, 92), (249, 93), (249, 94), (249, 95), (249, 96), (249, 97), (249, 98), (249, 99), (249, 100), (249, 101), (249, 102), (249, 103), (249, 104), (249, 105), (249, 106), (249, 107), (249, 108), (249, 109), (249, 110), (249, 111), (249, 112), (249, 113), (249, 114), (249, 115), (249, 116), (249, 117), (249, 120), (249, 121), (249, 124), (249, 128), (249, 129), (249, 130), (249, 131), (249, 132), (249, 133), (249, 134), (249, 135), (249, 136), (249, 138), (250, 83), (250, 118), (250, 121), (250, 122), (250, 126), (250, 130), (250, 131), (250, 132), (250, 133), (250, 134), (250, 137), (251, 128), (251, 136), (252, 121), (252, 130), (252, 132), (252, 134))
coordinates_f8_f8_ff = ((164, 154), (164, 155), (164, 156), (164, 157), (164, 158), (164, 159), (165, 151), (165, 153), (165, 161), (166, 151), (166, 154), (166, 155), (166, 156), (166, 157), (166, 158), (166, 159), (166, 161), (167, 150), (167, 152), (167, 153), (167, 154), (167, 155), (167, 156), (167, 157), (167, 158), (167, 160), (168, 150), (168, 152), (168, 153), (168, 154), (168, 155), (168, 156), (168, 157), (168, 159), (169, 149), (169, 151), (169, 152), (169, 153), (169, 154), (169, 155), (169, 156), (169, 158), (170, 148), (170, 150), (170, 151), (170, 152), (170, 153), (170, 154), (170, 155), (170, 156), (170, 158), (171, 147), (171, 149), (171, 150), (171, 151), (171, 152), (171, 153), (171, 154), (171, 155), (171, 156), (171, 158), (172, 146), (172, 148), (172, 149), (172, 150), (172, 151), (172, 152), (172, 153), (172, 154), (172, 155), (172, 156), (172, 158), (173, 146), (173, 148), (173, 149), (173, 150), (173, 151), (173, 152), (173, 153), (173, 154), (173, 155), (173, 156), (173, 158), (174, 145), (174, 148), (174, 149), (174, 150), (174, 151), (174, 152), (174, 153), (174, 154), (174, 155), (174, 156), (174, 157), (174, 159), (175, 145), (175, 147), (175, 150), (175, 151), (175, 152), (175, 153), (175, 154), (175, 155), (175, 156), (175, 157), (175, 159), (176, 148), (176, 149), (176, 152), (176, 153), (176, 154), (176, 155), (176, 156), (176, 157), (176, 159), (177, 150), (177, 153), (177, 154), (177, 155), (177, 156), (177, 157), (177, 158), (177, 160), (178, 154), (178, 155), (178, 156), (178, 157), (178, 158), (178, 160), (179, 153), (179, 155), (179, 156), (179, 157), (179, 158), (179, 159), (179, 161), (180, 153), (180, 155), (180, 156), (180, 157), (180, 158), (180, 159), (180, 160), (180, 162), (181, 139), (181, 154), (181, 156), (181, 157), (181, 158), (181, 159), (181, 160), (181, 162), (182, 139), (182, 155), (182, 157), (182, 158), (182, 159), (182, 160), (182, 161), (183, 138), (183, 155), (183, 157), (183, 158), (183, 159), (183, 160), (183, 161), (183, 162), (183, 165), (184, 137), (184, 156), (184, 158), (184, 159), (184, 160), (184, 161), (184, 162), (184, 163), (184, 164), (184, 166), (185, 136), (185, 137), (185, 156), (185, 158), (185, 159), (185, 160), (185, 161), (185, 162), (185, 163), (185, 164), (185, 165), (186, 135), (186, 137), (186, 157), (186, 159), (186, 160), (186, 161), (186, 162), (186, 163), (186, 164), (186, 165), (186, 166), (186, 169), (187, 134), (187, 136), (187, 137), (187, 157), (187, 159), (187, 160), (187, 161), (187, 162), (187, 163), (187, 164), (187, 165), (187, 166), (187, 167), (187, 170), (188, 133), (188, 135), (188, 137), (188, 158), (188, 160), (188, 161), (188, 162), (188, 163), (188, 164), (188, 165), (188, 166), (188, 167), (188, 168), (189, 121), (189, 124), (189, 132), (189, 134), (189, 135), (189, 136), (189, 138), (189, 158), (189, 160), (189, 161), (189, 162), (189, 163), (189, 164), (189, 165), (189, 166), (189, 167), (189, 168), (189, 169), (189, 172), (189, 174), (190, 120), (190, 133), (190, 134), (190, 135), (190, 136), (190, 137), (190, 139), (190, 158), (190, 160), (190, 161), (190, 162), (190, 163), (190, 164), (190, 165), (190, 166), (190, 167), (190, 168), (190, 169), (190, 170), (190, 171), (190, 174), (191, 123), (191, 125), (191, 129), (191, 132), (191, 133), (191, 134), (191, 135), (191, 136), (191, 137), (191, 138), (191, 140), (191, 159), (191, 161), (191, 162), (191, 163), (191, 164), (191, 165), (191, 166), (191, 167), (191, 168), (191, 169), (191, 170), (191, 171), (191, 172), (191, 174), (192, 127), (192, 128), (192, 133), (192, 134), (192, 135), (192, 136), (192, 137), (192, 138), (192, 139), (192, 142), (192, 159), (192, 161), (192, 162), (192, 163), (192, 164), (192, 165), (192, 166), (192, 167), (192, 168), (192, 169), (192, 170), (192, 171), (192, 172), (192, 174), (193, 130), (193, 132), (193, 136), (193, 137), (193, 138), (193, 139), (193, 140), (193, 144), (193, 159), (193, 161), (193, 162), (193, 163), (193, 164), (193, 165), (193, 166), (193, 167), (193, 168), (193, 169), (193, 170), (193, 171), (193, 173), (194, 133), (194, 134), (194, 135), (194, 139), (194, 140), (194, 141), (194, 142), (194, 145), (194, 146), (194, 147), (194, 160), (194, 162), (194, 163), (194, 164), (194, 165), (194, 166), (194, 167), (194, 168), (194, 169), (194, 170), (194, 171), (194, 173), (195, 136), (195, 137), (195, 138), (195, 142), (195, 143), (195, 144), (195, 148), (195, 160), (195, 164), (195, 165), (195, 166), (195, 167), (195, 168), (195, 169), (195, 170), (195, 171), (195, 173), (196, 139), (196, 140), (196, 141), (196, 145), (196, 146), (196, 148), (196, 161), (196, 162), (196, 163), (196, 166), (196, 167), (196, 168), (196, 169), (196, 170), (196, 172), (197, 142), (197, 144), (197, 148), (197, 164), (197, 165), (197, 168), (197, 169), (197, 171), (198, 145), (198, 146), (198, 149), (198, 166), (198, 167), (198, 169), (198, 171), (199, 147), (199, 149), (199, 168), (199, 170), (200, 150), (200, 169), (200, 170), (201, 151), (201, 170), (202, 152), (202, 170), (203, 152), (204, 152), (204, 155), (205, 153), (205, 156), (205, 169), (206, 153), (206, 155), (206, 158), (206, 169), (207, 153), (207, 155), (207, 156), (207, 160), (207, 161), (207, 167), (207, 169), (208, 154), (208, 156), (208, 157), (208, 158), (208, 162), (208, 163), (208, 164), (208, 165), (208, 166), (208, 169), (209, 154), (209, 156), (209, 157), (209, 158), (209, 159), (209, 160), (209, 161), (209, 167), (209, 169), (210, 155), (210, 156), (210, 157), (210, 158), (210, 159), (210, 160), (210, 161), (210, 162), (210, 163), (210, 164), (210, 165), (210, 166), (210, 167), (210, 169), (211, 155), (211, 157), (211, 158), (211, 159), (211, 160), (211, 161), (211, 162), (211, 163), (211, 164), (211, 165), (211, 166), (211, 167), (211, 169), (212, 155), (212, 157), (212, 158), (212, 159), (212, 160), (212, 161), (212, 162), (212, 163), (212, 164), (212, 165), (212, 166), (212, 167), (212, 169), (213, 156), (213, 158), (213, 159), (213, 160), (213, 161), (213, 162), (213, 163), (213, 164), (213, 165), (213, 166), (213, 167), (214, 156), (214, 158), (214, 159), (214, 160), (214, 161), (214, 162), (214, 163), (214, 164), (214, 165), (214, 166), (214, 168), (215, 157), (215, 159), (215, 160), (215, 161), (215, 162), (215, 167), (216, 158), (216, 163), (216, 164), (216, 166), (217, 159), (217, 161), (217, 162), (225, 160), (225, 162), (226, 160), (226, 164), (226, 166), (227, 160), (227, 162), (227, 163), (227, 167), (227, 169), (228, 159), (228, 161), (228, 162), (228, 163), (228, 164), (228, 165), (228, 166), (228, 171), (229, 159), (229, 161), (229, 162), (229, 163), (229, 164), (229, 165), (229, 166), (229, 167), (229, 168), (229, 170), (230, 159), (230, 161), (230, 162), (230, 163), (230, 164), (230, 165), (230, 166), (230, 167), (230, 169), (231, 159), (231, 161), (231, 162), (231, 163), (231, 164), (231, 165), (231, 166), (231, 168), (232, 158), (232, 160), (232, 161), (232, 162), (232, 163), (232, 164), (232, 165), (232, 166), (232, 168), (233, 158), (233, 160), (233, 161), (233, 162), (233, 163), (233, 164), (233, 165), (233, 166), (233, 167), (233, 168), (233, 169), (234, 158), (234, 167), (234, 169), (235, 158), (235, 160), (235, 161), (235, 162), (235, 163), (235, 164), (235, 165), (235, 166), (235, 170), (236, 167), (236, 170), (237, 155), (237, 169), (237, 171), (238, 152), (238, 155), (238, 170), (238, 171), (239, 150), (239, 154), (239, 170), (239, 172), (240, 149), (240, 152), (240, 154), (240, 170), (240, 172), (241, 148), (241, 150), (241, 151), (241, 153), (241, 170), (241, 173), (242, 147), (242, 149), (242, 150), (242, 169), (242, 171), (242, 173), (243, 146), (243, 148), (243, 149), (243, 152), (243, 169), (243, 171), (243, 172), (243, 174), (244, 145), (244, 147), (244, 148), (244, 151), (244, 168), (244, 170), (244, 171), (244, 172), (244, 174), (245, 144), (245, 146), (245, 147), (245, 150), (245, 167), (245, 169), (245, 170), (245, 171), (245, 172), (245, 174), (246, 143), (246, 146), (246, 149), (246, 166), (246, 168), (246, 169), (246, 170), (246, 171), (246, 172), (246, 174), (247, 143), (247, 145), (247, 148), (247, 165), (247, 167), (247, 168), (247, 169), (247, 170), (247, 171), (247, 172), (247, 174), (248, 142), (248, 144), (248, 164), (248, 166), (248, 167), (248, 168), (248, 169), (248, 170), (248, 171), (248, 172), (248, 174), (249, 141), (249, 143), (249, 145), (249, 163), (249, 165), (249, 166), (249, 167), (249, 168), (249, 169), (249, 170), (249, 171), (249, 172), (249, 174), (250, 140), (250, 142), (250, 144), (250, 162), (250, 164), (250, 165), (250, 166), (250, 167), (250, 168), (250, 169), (250, 170), (250, 171), (250, 172), (250, 174), (251, 139), (251, 141), (251, 143), (251, 161), (251, 163), (251, 164), (251, 165), (251, 166), (251, 167), (251, 168), (251, 169), (251, 170), (251, 171), (251, 172), (251, 174), (252, 140), (252, 141), (252, 161), (252, 163), (252, 164), (252, 165), (252, 166), (252, 167), (252, 168), (252, 169), (252, 170), (252, 171), (252, 172), (252, 174), (253, 136), (253, 139), (253, 140), (253, 142), (253, 160), (253, 162), (253, 163), (253, 164), (253, 165), (253, 166), (253, 167), (253, 168), (253, 169), (253, 170), (253, 171), (253, 172), (253, 174), (254, 133), (254, 135), (254, 138), (254, 139), (254, 141), (254, 160), (254, 162), (254, 163), (254, 164), (254, 165), (254, 166), (254, 167), (254, 168), (254, 169), (254, 170), (254, 171), (254, 172), (254, 174), (255, 136), (255, 137), (255, 138), (255, 140), (255, 159), (255, 161), (255, 162), (255, 163), (255, 164), (255, 165), (255, 166), (255, 167), (255, 168), (255, 169), (255, 170), (255, 174), (256, 134), (256, 136), (256, 137), (256, 138), (256, 140), (256, 159), (256, 161), (256, 162), (256, 163), (256, 164), (256, 165), (256, 166), (256, 167), (256, 168), (256, 169), (256, 172), (256, 174), (257, 135), (257, 137), (257, 138), (257, 140), (257, 159), (257, 161), (257, 162), (257, 163), (257, 164), (257, 165), (257, 166), (257, 167), (257, 170), (258, 136), (258, 138), (258, 140), (258, 158), (258, 160), (258, 161), (258, 162), (258, 163), (258, 164), (258, 165), (258, 166), (258, 169), (259, 136), (259, 138), (259, 140), (259, 158), (259, 160), (259, 161), (259, 162), (259, 163), (259, 164), (259, 165), (259, 167), (260, 137), (260, 140), (260, 157), (260, 159), (260, 160), (260, 161), (260, 162), (260, 163), (260, 164), (260, 166), (261, 138), (261, 140), (261, 157), (261, 159), (261, 160), (261, 161), (261, 162), (261, 163), (261, 165), (262, 138), (262, 141), (262, 156), (262, 158), (262, 159), (262, 160), (262, 161), (262, 162), (262, 163), (262, 165), (263, 139), (263, 142), (263, 156), (263, 158), (263, 159), (263, 160), (263, 161), (263, 162), (263, 164), (264, 140), (264, 155), (264, 157), (264, 158), (264, 159), (264, 160), (264, 161), (264, 163), (265, 142), (265, 144), (265, 155), (265, 157), (265, 158), (265, 159), (265, 160), (265, 161), (265, 163), (266, 144), (266, 145), (266, 154), (266, 156), (266, 157), (266, 158), (266, 159), (266, 160), (266, 162), (267, 145), (267, 146), (267, 153), (267, 155), (267, 156), (267, 157), (267, 158), (267, 159), (267, 160), (267, 162), (268, 146), (268, 147), (268, 152), (268, 154), (268, 155), (268, 156), (268, 157), (268, 158), (268, 159), (268, 160), (268, 162), (269, 147), (269, 150), (269, 153), (269, 154), (269, 155), (269, 156), (269, 157), (269, 158), (269, 159), (269, 161), (270, 148), (270, 152), (270, 153), (270, 154), (270, 155), (270, 156), (270, 157), (270, 158), (270, 159), (270, 161), (271, 151), (271, 152), (271, 153), (271, 154), (271, 155), (271, 156), (271, 157), (271, 158), (271, 159), (271, 161), (272, 149), (272, 151), (272, 152), (272, 153), (272, 154), (272, 155), (272, 156), (272, 157), (272, 158), (272, 159), (272, 161), (273, 150), (273, 152), (273, 153), (273, 154), (273, 155), (273, 156), (273, 157), (273, 158), (273, 159), (273, 160), (273, 162), (274, 151), (274, 153), (274, 154), (274, 155), (274, 156), (274, 157), (274, 158), (274, 159), (274, 160), (274, 162), (275, 152), (275, 154), (275, 155), (275, 156), (275, 157), (275, 158), (275, 159), (275, 160), (275, 161), (275, 162), (275, 164), (276, 152), (276, 154), (276, 155), (276, 156), (276, 157), (276, 158), (276, 159), (276, 160), (276, 161), (276, 162), (276, 164), (277, 153), (277, 155), (277, 156), (277, 157), (277, 158), (277, 159), (277, 160), (277, 161), (277, 163), (278, 153), (278, 155), (278, 156), (278, 157), (278, 158), (278, 159), (278, 160), (278, 163), (279, 154), (279, 156), (279, 157), (279, 158), (279, 159), (279, 162), (280, 154), (280, 156), (280, 157), (280, 160), (281, 154), (281, 159), (282, 155), (282, 157))
coordinates_f45_df4 = ((177, 144), (177, 146), (178, 94), (178, 95), (178, 96), (178, 97), (178, 98), (178, 100), (178, 143), (178, 147), (178, 149), (179, 91), (179, 93), (179, 100), (179, 142), (179, 144), (179, 145), (179, 146), (179, 150), (180, 89), (180, 94), (180, 95), (180, 96), (180, 97), (180, 99), (180, 142), (180, 144), (180, 145), (180, 146), (180, 147), (180, 148), (180, 149), (180, 151), (181, 87), (181, 91), (181, 92), (181, 93), (181, 94), (181, 95), (181, 99), (181, 141), (181, 143), (181, 144), (181, 145), (181, 146), (181, 147), (181, 148), (181, 149), (181, 150), (181, 152), (182, 85), (182, 86), (182, 89), (182, 90), (182, 91), (182, 92), (182, 97), (182, 141), (182, 143), (182, 144), (182, 145), (182, 146), (182, 147), (182, 148), (182, 149), (182, 150), (183, 84), (183, 87), (183, 88), (183, 89), (183, 93), (183, 94), (183, 95), (183, 140), (183, 142), (183, 143), (183, 144), (183, 145), (183, 146), (183, 147), (183, 148), (183, 149), (183, 150), (183, 151), (183, 153), (184, 82), (184, 85), (184, 86), (184, 90), (184, 91), (184, 92), (184, 140), (184, 142), (184, 143), (184, 144), (184, 145), (184, 146), (184, 147), (184, 148), (184, 149), (184, 150), (184, 151), (184, 152), (184, 154), (185, 81), (185, 87), (185, 88), (185, 89), (185, 139), (185, 141), (185, 142), (185, 143), (185, 144), (185, 145), (185, 146), (185, 147), (185, 148), (185, 149), (185, 150), (185, 151), (185, 152), (185, 154), (186, 79), (186, 84), (186, 85), (186, 86), (186, 139), (186, 141), (186, 142), (186, 143), (186, 144), (186, 145), (186, 146), (186, 147), (186, 148), (186, 149), (186, 150), (186, 151), (186, 152), (186, 154), (187, 77), (187, 83), (187, 139), (187, 141), (187, 142), (187, 143), (187, 144), (187, 145), (187, 146), (187, 147), (187, 148), (187, 149), (187, 150), (187, 151), (187, 152), (187, 153), (187, 155), (188, 76), (188, 79), (188, 81), (188, 139), (188, 142), (188, 143), (188, 144), (188, 145), (188, 146), (188, 147), (188, 148), (188, 149), (188, 150), (188, 151), (188, 152), (188, 153), (188, 155), (189, 74), (189, 77), (189, 78), (189, 80), (189, 140), (189, 144), (189, 145), (189, 146), (189, 147), (189, 148), (189, 149), (189, 150), (189, 151), (189, 152), (189, 153), (189, 154), (189, 156), (190, 72), (190, 76), (190, 77), (190, 79), (190, 142), (190, 146), (190, 147), (190, 148), (190, 149), (190, 150), (190, 151), (190, 152), (190, 153), (190, 154), (190, 156), (191, 71), (191, 74), (191, 75), (191, 76), (191, 78), (191, 144), (191, 148), (191, 149), (191, 150), (191, 151), (191, 152), (191, 153), (191, 154), (191, 156), (192, 69), (192, 72), (192, 73), (192, 74), (192, 75), (192, 76), (192, 78), (192, 146), (192, 147), (192, 150), (192, 151), (192, 152), (192, 153), (192, 154), (192, 155), (192, 157), (193, 67), (193, 68), (193, 71), (193, 72), (193, 73), (193, 74), (193, 75), (193, 77), (193, 148), (193, 150), (193, 151), (193, 152), (193, 153), (193, 154), (193, 155), (193, 157), (194, 66), (194, 69), (194, 70), (194, 71), (194, 72), (194, 73), (194, 74), (194, 75), (194, 77), (194, 150), (194, 152), (194, 153), (194, 154), (194, 155), (194, 156), (194, 158), (195, 64), (195, 67), (195, 68), (195, 69), (195, 70), (195, 71), (195, 72), (195, 73), (195, 74), (195, 75), (195, 77), (195, 150), (195, 152), (195, 153), (195, 154), (195, 155), (195, 156), (195, 158), (196, 62), (196, 66), (196, 67), (196, 68), (196, 69), (196, 70), (196, 71), (196, 72), (196, 73), (196, 74), (196, 75), (196, 76), (196, 78), (196, 150), (196, 152), (196, 153), (196, 154), (196, 155), (196, 156), (196, 157), (196, 159), (197, 60), (197, 64), (197, 65), (197, 66), (197, 67), (197, 68), (197, 69), (197, 70), (197, 71), (197, 72), (197, 73), (197, 74), (197, 75), (197, 76), (197, 78), (197, 151), (197, 153), (197, 154), (197, 155), (197, 156), (197, 157), (197, 158), (197, 160), (198, 58), (198, 59), (198, 62), (198, 63), (198, 64), (198, 65), (198, 66), (198, 67), (198, 68), (198, 69), (198, 70), (198, 71), (198, 72), (198, 73), (198, 74), (198, 75), (198, 76), (198, 77), (198, 79), (198, 151), (198, 153), (198, 154), (198, 155), (198, 156), (198, 157), (198, 158), (198, 159), (198, 162), (199, 56), (199, 57), (199, 60), (199, 61), (199, 62), (199, 63), (199, 64), (199, 65), (199, 66), (199, 67), (199, 68), (199, 69), (199, 70), (199, 71), (199, 72), (199, 73), (199, 74), (199, 75), (199, 76), (199, 77), (199, 78), (199, 80), (199, 152), (199, 154), (199, 155), (199, 156), (199, 157), (199, 158), (199, 159), (199, 160), (199, 163), (199, 165), (200, 53), (200, 54), (200, 55), (200, 58), (200, 59), (200, 60), (200, 61), (200, 62), (200, 63), (200, 64), (200, 65), (200, 66), (200, 67), (200, 68), (200, 69), (200, 70), (200, 71), (200, 72), (200, 73), (200, 74), (200, 75), (200, 76), (200, 77), (200, 78), (200, 81), (200, 155), (200, 156), (200, 157), (200, 158), (200, 159), (200, 160), (200, 161), (200, 162), (200, 167), (201, 51), (201, 63), (201, 64), (201, 65), (201, 66), (201, 67), (201, 68), (201, 69), (201, 70), (201, 71), (201, 72), (201, 73), (201, 74), (201, 75), (201, 76), (201, 77), (201, 78), (201, 79), (201, 82), (201, 154), (201, 156), (201, 157), (201, 158), (201, 159), (201, 160), (201, 161), (201, 162), (201, 163), (201, 164), (201, 165), (201, 168), (202, 51), (202, 53), (202, 54), (202, 55), (202, 56), (202, 57), (202, 58), (202, 59), (202, 60), (202, 61), (202, 62), (202, 63), (202, 75), (202, 76), (202, 77), (202, 78), (202, 79), (202, 80), (202, 81), (202, 84), (202, 85), (202, 155), (202, 158), (202, 159), (202, 160), (202, 161), (202, 162), (202, 163), (202, 164), (202, 165), (202, 166), (202, 168), (203, 64), (203, 65), (203, 66), (203, 67), (203, 68), (203, 69), (203, 70), (203, 71), (203, 72), (203, 73), (203, 74), (203, 86), (203, 87), (203, 88), (203, 156), (203, 160), (203, 161), (203, 162), (203, 163), (203, 164), (203, 165), (203, 166), (203, 168), (204, 75), (204, 76), (204, 77), (204, 78), (204, 79), (204, 80), (204, 81), (204, 82), (204, 85), (204, 89), (204, 90), (204, 91), (204, 92), (204, 93), (204, 94), (204, 95), (204, 96), (204, 97), (204, 158), (204, 163), (204, 164), (204, 165), (204, 166), (204, 168), (205, 83), (205, 84), (205, 87), (205, 88), (205, 89), (205, 98), (205, 99), (205, 100), (205, 102), (205, 160), (205, 162), (205, 167), (206, 85), (206, 86), (206, 89), (206, 90), (206, 91), (206, 92), (206, 93), (206, 94), (206, 95), (206, 96), (206, 102), (206, 163), (206, 165), (206, 166), (207, 87), (207, 88), (207, 98), (207, 99), (207, 101), (208, 89), (208, 90), (208, 91), (208, 92), (208, 93), (208, 94), (208, 95), (208, 96), (208, 97), (237, 89), (237, 91), (237, 92), (237, 93), (237, 94), (237, 95), (237, 96), (237, 97), (237, 99), (237, 157), (237, 159), (237, 160), (237, 161), (237, 162), (237, 163), (237, 164), (237, 165), (238, 88), (238, 100), (238, 157), (238, 166), (238, 167), (238, 168), (239, 87), (239, 89), (239, 90), (239, 91), (239, 92), (239, 93), (239, 94), (239, 95), (239, 96), (239, 97), (239, 98), (239, 99), (239, 101), (239, 157), (239, 159), (239, 160), (239, 161), (239, 162), (239, 163), (239, 164), (239, 165), (239, 168), (240, 73), (240, 74), (240, 75), (240, 76), (240, 77), (240, 78), (240, 79), (240, 80), (240, 81), (240, 82), (240, 83), (240, 84), (240, 85), (240, 88), (240, 89), (240, 90), (240, 91), (240, 92), (240, 93), (240, 94), (240, 95), (240, 96), (240, 97), (240, 98), (240, 102), (240, 156), (240, 158), (240, 159), (240, 160), (240, 161), (240, 162), (240, 163), (240, 164), (240, 165), (240, 166), (240, 168), (241, 67), (241, 68), (241, 69), (241, 70), (241, 71), (241, 72), (241, 87), (241, 99), (241, 101), (241, 156), (241, 158), (241, 159), (241, 160), (241, 161), (241, 162), (241, 163), (241, 164), (241, 165), (241, 166), (241, 168), (242, 60), (242, 61), (242, 62), (242, 63), (242, 64), (242, 65), (242, 66), (242, 73), (242, 74), (242, 75), (242, 76), (242, 77), (242, 78), (242, 79), (242, 80), (242, 81), (242, 82), (242, 83), (242, 84), (242, 88), (242, 89), (242, 90), (242, 91), (242, 92), (242, 93), (242, 94), (242, 95), (242, 96), (242, 97), (242, 98), (242, 155), (242, 157), (242, 158), (242, 159), (242, 160), (242, 161), (242, 162), (242, 163), (242, 164), (242, 165), (242, 167), (243, 54), (243, 55), (243, 56), (243, 57), (243, 58), (243, 59), (243, 67), (243, 68), (243, 69), (243, 70), (243, 71), (243, 72), (243, 73), (243, 74), (243, 75), (243, 76), (243, 77), (243, 78), (243, 79), (243, 80), (243, 81), (243, 82), (243, 85), (243, 86), (243, 87), (243, 154), (243, 156), (243, 157), (243, 158), (243, 159), (243, 160), (243, 161), (243, 162), (243, 163), (243, 164), (243, 166), (244, 54), (244, 55), (244, 57), (244, 61), (244, 62), (244, 63), (244, 64), (244, 65), (244, 66), (244, 67), (244, 68), (244, 69), (244, 70), (244, 71), (244, 72), (244, 73), (244, 74), (244, 75), (244, 76), (244, 77), (244, 78), (244, 79), (244, 80), (244, 81), (244, 84), (244, 153), (244, 155), (244, 156), (244, 157), (244, 158), (244, 159), (244, 160), (244, 161), (244, 162), (244, 163), (244, 165), (245, 59), (245, 60), (245, 63), (245, 64), (245, 65), (245, 66), (245, 67), (245, 68), (245, 69), (245, 70), (245, 71), (245, 72), (245, 73), (245, 74), (245, 75), (245, 76), (245, 77), (245, 78), (245, 79), (245, 80), (245, 81), (245, 152), (245, 154), (245, 155), (245, 156), (245, 157), (245, 158), (245, 159), (245, 160), (245, 161), (245, 162), (245, 164), (246, 61), (246, 65), (246, 66), (246, 67), (246, 68), (246, 69), (246, 70), (246, 71), (246, 72), (246, 73), (246, 74), (246, 75), (246, 76), (246, 77), (246, 78), (246, 79), (246, 80), (246, 82), (246, 151), (246, 153), (246, 154), (246, 155), (246, 156), (246, 157), (246, 158), (246, 159), (246, 160), (246, 161), (246, 163), (247, 63), (247, 67), (247, 68), (247, 69), (247, 70), (247, 71), (247, 72), (247, 73), (247, 74), (247, 75), (247, 76), (247, 77), (247, 78), (247, 79), (247, 81), (247, 150), (247, 152), (247, 153), (247, 154), (247, 155), (247, 156), (247, 157), (247, 158), (247, 159), (247, 160), (247, 162), (248, 65), (248, 69), (248, 70), (248, 71), (248, 72), (248, 73), (248, 74), (248, 75), (248, 76), (248, 77), (248, 78), (248, 79), (248, 81), (248, 149), (248, 151), (248, 152), (248, 153), (248, 154), (248, 155), (248, 156), (248, 157), (248, 158), (248, 159), (248, 161), (249, 67), (249, 70), (249, 71), (249, 72), (249, 73), (249, 74), (249, 75), (249, 76), (249, 77), (249, 78), (249, 80), (249, 148), (249, 150), (249, 151), (249, 152), (249, 153), (249, 154), (249, 155), (249, 156), (249, 157), (249, 158), (249, 160), (250, 69), (250, 72), (250, 73), (250, 74), (250, 75), (250, 76), (250, 77), (250, 78), (250, 80), (250, 147), (250, 149), (250, 150), (250, 151), (250, 152), (250, 153), (250, 154), (250, 155), (250, 156), (250, 157), (250, 158), (250, 160), (251, 70), (251, 73), (251, 74), (251, 75), (251, 76), (251, 77), (251, 78), (251, 80), (251, 146), (251, 148), (251, 149), (251, 150), (251, 151), (251, 152), (251, 153), (251, 154), (251, 155), (251, 156), (251, 157), (251, 159), (252, 72), (252, 75), (252, 76), (252, 77), (252, 78), (252, 79), (252, 81), (252, 145), (252, 147), (252, 148), (252, 149), (252, 150), (252, 151), (252, 152), (252, 153), (252, 154), (252, 155), (252, 156), (252, 158), (253, 73), (253, 76), (253, 77), (253, 78), (253, 79), (253, 80), (253, 83), (253, 144), (253, 146), (253, 147), (253, 148), (253, 149), (253, 150), (253, 151), (253, 152), (253, 153), (253, 154), (253, 155), (253, 156), (253, 158), (254, 75), (254, 78), (254, 79), (254, 80), (254, 81), (254, 84), (254, 143), (254, 145), (254, 146), (254, 147), (254, 148), (254, 149), (254, 150), (254, 151), (254, 152), (254, 153), (254, 154), (254, 155), (254, 157), (255, 76), (255, 79), (255, 80), (255, 81), (255, 82), (255, 83), (255, 86), (255, 143), (255, 145), (255, 146), (255, 147), (255, 148), (255, 149), (255, 150), (255, 151), (255, 152), (255, 153), (255, 154), (255, 155), (255, 157), (256, 78), (256, 81), (256, 82), (256, 83), (256, 84), (256, 88), (256, 142), (256, 144), (256, 145), (256, 146), (256, 147), (256, 148), (256, 149), (256, 150), (256, 151), (256, 152), (256, 153), (256, 154), (256, 155), (256, 157), (257, 79), (257, 82), (257, 83), (257, 84), (257, 85), (257, 86), (257, 89), (257, 142), (257, 144), (257, 145), (257, 146), (257, 147), (257, 148), (257, 149), (257, 150), (257, 151), (257, 152), (257, 153), (257, 154), (257, 156), (258, 81), (258, 84), (258, 85), (258, 86), (258, 87), (258, 88), (258, 91), (258, 142), (258, 144), (258, 145), (258, 146), (258, 147), (258, 148), (258, 149), (258, 150), (258, 151), (258, 152), (258, 153), (258, 154), (258, 156), (259, 82), (259, 85), (259, 86), (259, 87), (259, 88), (259, 89), (259, 90), (259, 93), (259, 142), (259, 144), (259, 145), (259, 146), (259, 147), (259, 148), (259, 149), (259, 150), (259, 151), (259, 152), (259, 153), (259, 154), (259, 155), (259, 156), (260, 84), (260, 87), (260, 88), (260, 89), (260, 90), (260, 91), (260, 95), (260, 142), (260, 144), (260, 145), (260, 146), (260, 147), (260, 148), (260, 149), (260, 150), (260, 151), (260, 152), (260, 153), (260, 155), (261, 85), (261, 88), (261, 89), (261, 90), (261, 91), (261, 92), (261, 93), (261, 97), (261, 143), (261, 145), (261, 146), (261, 147), (261, 148), (261, 149), (261, 150), (261, 151), (261, 152), (261, 153), (261, 155), (262, 87), (262, 90), (262, 91), (262, 92), (262, 93), (262, 94), (262, 95), (262, 99), (262, 143), (262, 145), (262, 146), (262, 147), (262, 148), (262, 149), (262, 150), (262, 151), (262, 152), (262, 154), (263, 88), (263, 91), (263, 92), (263, 93), (263, 94), (263, 95), (263, 96), (263, 97), (263, 101), (263, 144), (263, 146), (263, 147), (263, 148), (263, 149), (263, 150), (263, 151), (263, 152), (263, 154), (264, 90), (264, 93), (264, 94), (264, 95), (264, 96), (264, 97), (264, 98), (264, 99), (264, 103), (264, 145), (264, 147), (264, 148), (264, 149), (264, 150), (264, 151), (264, 153), (265, 91), (265, 94), (265, 95), (265, 96), (265, 97), (265, 98), (265, 99), (265, 100), (265, 101), (265, 105), (265, 146), (265, 148), (265, 149), (265, 150), (265, 152), (266, 93), (266, 105), (266, 107), (266, 147), (266, 152), (267, 94), (267, 96), (267, 97), (267, 98), (267, 99), (267, 100), (267, 101), (267, 102), (267, 103), (267, 148), (267, 150))
coordinates_ff5500 = ((168, 161), (169, 161), (169, 165), (170, 160), (170, 162), (170, 163), (170, 166), (171, 160), (171, 162), (171, 163), (171, 164), (171, 165), (171, 167), (172, 160), (172, 161), (172, 162), (172, 163), (172, 164), (172, 165), (172, 166), (172, 168), (173, 161), (173, 163), (173, 164), (173, 165), (173, 166), (173, 168), (174, 161), (174, 163), (174, 164), (174, 165), (174, 166), (174, 167), (174, 169), (175, 161), (175, 163), (175, 164), (175, 165), (175, 166), (175, 167), (175, 168), (175, 169), (176, 162), (176, 164), (176, 165), (176, 166), (176, 167), (176, 168), (176, 170), (177, 162), (177, 164), (177, 165), (177, 166), (177, 167), (177, 168), (177, 169), (177, 170), (178, 163), (178, 165), (178, 166), (178, 167), (178, 168), (178, 169), (178, 171), (179, 163), (179, 165), (179, 166), (179, 167), (179, 168), (179, 169), (179, 171), (180, 164), (180, 167), (180, 168), (180, 169), (180, 170), (180, 172), (181, 165), (181, 168), (181, 169), (181, 170), (181, 172), (182, 167), (182, 169), (182, 170), (182, 171), (182, 172), (182, 173), (183, 168), (183, 170), (183, 171), (183, 173), (184, 169), (184, 171), (184, 173), (185, 170), (185, 173), (186, 171), (186, 174), (187, 172), (187, 174), (258, 172), (258, 174), (259, 170), (260, 169), (260, 173), (261, 168), (261, 170), (261, 171), (261, 173), (262, 167), (262, 169), (262, 170), (262, 171), (262, 173), (263, 166), (263, 168), (263, 169), (263, 170), (263, 172), (264, 166), (264, 168), (264, 169), (264, 170), (264, 172), (265, 165), (265, 167), (265, 168), (265, 169), (265, 170), (265, 171), (265, 172), (266, 165), (266, 167), (266, 168), (266, 169), (266, 171), (267, 164), (267, 166), (267, 167), (267, 168), (267, 169), (267, 171), (268, 164), (268, 166), (268, 167), (268, 168), (268, 170), (269, 164), (269, 166), (269, 167), (269, 168), (269, 170), (270, 163), (270, 164), (270, 165), (270, 166), (270, 167), (270, 169), (271, 163), (271, 165), (271, 166), (272, 168), (273, 164), (273, 167))
coordinates_cc3300 = ((163, 143), (164, 142), (164, 144), (165, 141), (165, 143), (165, 146), (165, 147), (165, 149), (166, 140), (166, 142), (166, 143), (166, 144), (167, 139), (167, 141), (167, 142), (167, 143), (167, 144), (167, 145), (167, 146), (167, 148), (168, 141), (168, 142), (168, 143), (168, 144), (168, 145), (168, 147), (169, 138), (169, 140), (169, 141), (169, 142), (169, 143), (169, 144), (169, 146), (170, 137), (170, 139), (170, 140), (170, 141), (170, 142), (170, 143), (170, 145), (171, 136), (171, 138), (171, 139), (171, 140), (171, 141), (171, 142), (171, 143), (171, 145), (172, 138), (172, 139), (172, 140), (172, 141), (172, 142), (172, 144), (173, 135), (173, 137), (173, 138), (173, 139), (173, 140), (173, 141), (173, 143), (174, 134), (174, 136), (174, 137), (174, 138), (174, 139), (174, 140), (174, 141), (174, 143), (175, 133), (175, 135), (175, 136), (175, 137), (175, 138), (175, 139), (175, 140), (175, 141), (175, 143), (176, 133), (176, 135), (176, 136), (176, 137), (176, 138), (176, 139), (176, 140), (176, 143), (177, 132), (177, 134), (177, 135), (177, 136), (177, 137), (177, 138), (177, 139), (178, 131), (178, 133), (178, 134), (178, 135), (178, 136), (178, 137), (178, 138), (178, 140), (179, 131), (179, 133), (179, 134), (179, 135), (179, 136), (179, 137), (179, 139), (180, 130), (180, 132), (180, 133), (180, 134), (180, 135), (180, 136), (180, 138), (181, 131), (181, 132), (181, 133), (181, 134), (181, 135), (181, 137), (182, 129), (182, 131), (182, 132), (182, 133), (182, 134), (182, 136), (183, 128), (183, 130), (183, 131), (183, 132), (183, 133), (183, 135), (184, 128), (184, 130), (184, 131), (184, 132), (184, 134), (185, 127), (185, 129), (185, 130), (185, 131), (185, 133), (186, 127), (186, 129), (186, 130), (186, 132), (187, 126), (187, 128), (187, 129), (187, 131), (188, 126), (188, 130), (189, 126), (189, 129), (190, 127), (252, 123), (252, 126), (253, 123), (253, 128), (254, 123), (254, 125), (254, 126), (254, 130), (255, 124), (255, 125), (255, 126), (255, 127), (255, 128), (255, 131), (256, 124), (256, 126), (256, 127), (256, 128), (256, 129), (256, 130), (256, 132), (257, 125), (257, 127), (257, 128), (257, 129), (257, 130), (257, 131), (257, 133), (258, 125), (258, 127), (258, 128), (258, 129), (258, 130), (258, 131), (258, 133), (259, 126), (259, 128), (259, 129), (259, 130), (259, 131), (259, 132), (259, 134), (260, 127), (260, 129), (260, 130), (260, 131), (260, 132), (260, 133), (260, 135), (261, 127), (261, 129), (261, 130), (261, 131), (261, 132), (261, 133), (261, 135), (262, 128), (262, 130), (262, 131), (262, 132), (262, 133), (262, 134), (262, 136), (263, 129), (263, 131), (263, 132), (263, 133), (263, 134), (263, 135), (263, 137), (264, 130), (264, 132), (264, 133), (264, 134), (264, 135), (264, 136), (264, 138), (265, 130), (265, 132), (265, 133), (265, 134), (265, 135), (265, 136), (265, 137), (265, 139), (266, 131), (266, 133), (266, 134), (266, 135), (266, 136), (266, 137), (266, 138), (266, 140), (267, 132), (267, 134), (267, 135), (267, 136), (267, 137), (267, 138), (267, 139), (267, 142), (268, 133), (268, 135), (268, 136), (268, 137), (268, 138), (268, 139), (268, 140), (268, 143), (269, 134), (269, 136), (269, 137), (269, 138), (269, 139), (269, 140), (269, 141), (269, 142), (269, 144), (270, 137), (270, 138), (270, 139), (270, 140), (270, 141), (270, 142), (270, 143), (270, 145), (271, 135), (271, 137), (271, 138), (271, 139), (271, 140), (271, 141), (271, 142), (271, 143), (271, 144), (271, 146), (272, 136), (272, 138), (272, 139), (272, 140), (272, 141), (272, 142), (272, 143), (272, 144), (272, 145), (272, 147), (273, 137), (273, 139), (273, 140), (273, 141), (273, 142), (273, 143), (273, 144), (273, 145), (273, 146), (273, 148), (274, 138), (274, 140), (274, 141), (274, 142), (274, 143), (274, 144), (274, 145), (274, 146), (275, 139), (275, 141), (275, 142), (275, 143), (275, 144), (275, 145), (275, 146), (275, 147), (275, 149), (276, 140), (276, 142), (276, 143), (276, 144), (276, 145), (276, 146), (276, 147), (276, 148), (276, 150), (277, 141), (277, 143), (277, 144), (277, 145), (277, 146), (277, 147), (277, 148), (277, 149), (278, 142), (278, 144), (278, 145), (278, 146), (278, 147), (278, 148), (278, 151), (279, 143), (279, 145), (279, 146), (279, 147), (279, 149), (279, 150), (279, 152), (280, 144), (280, 146), (280, 148), (281, 145), (281, 147), (282, 146))
coordinates_ffcccc = ((159, 58), (159, 59), (160, 58), (161, 58), (161, 59), (163, 58), (163, 59), (183, 29), (183, 31), (184, 27), (184, 34), (185, 25), (185, 28), (185, 29), (185, 30), (185, 31), (185, 32), (185, 35), (185, 36), (185, 37), (186, 24), (186, 27), (186, 28), (186, 29), (186, 30), (186, 31), (186, 32), (186, 33), (186, 34), (186, 38), (186, 40), (187, 23), (187, 25), (187, 26), (187, 27), (187, 28), (187, 29), (187, 30), (187, 31), (187, 32), (187, 33), (187, 34), (187, 35), (187, 36), (187, 37), (187, 40), (188, 22), (188, 24), (188, 25), (188, 26), (188, 27), (188, 28), (188, 29), (188, 30), (188, 31), (188, 32), (188, 33), (188, 34), (188, 35), (188, 36), (188, 37), (188, 38), (188, 39), (188, 41), (189, 24), (189, 25), (189, 26), (189, 27), (189, 28), (189, 29), (189, 30), (189, 31), (189, 32), (189, 33), (189, 34), (189, 35), (189, 36), (189, 37), (189, 38), (189, 39), (189, 40), (189, 43), (189, 44), (189, 46), (190, 21), (190, 23), (190, 24), (190, 25), (190, 26), (190, 27), (190, 28), (190, 29), (190, 30), (190, 31), (190, 32), (190, 33), (190, 34), (190, 35), (190, 36), (190, 37), (190, 38), (190, 39), (190, 40), (190, 41), (190, 46), (191, 20), (191, 22), (191, 23), (191, 24), (191, 25), (191, 26), (191, 27), (191, 28), (191, 29), (191, 30), (191, 31), (191, 32), (191, 33), (191, 34), (191, 35), (191, 36), (191, 37), (191, 38), (191, 39), (191, 40), (191, 41), (191, 42), (191, 43), (191, 44), (191, 45), (191, 47), (192, 19), (192, 21), (192, 22), (192, 23), (192, 24), (192, 25), (192, 26), (192, 27), (192, 28), (192, 29), (192, 30), (192, 31), (192, 32), (192, 33), (192, 34), (192, 35), (192, 36), (192, 37), (192, 38), (192, 39), (192, 40), (192, 41), (192, 42), (192, 43), (192, 44), (192, 45), (192, 47), (193, 19), (193, 21), (193, 22), (193, 23), (193, 24), (193, 25), (193, 26), (193, 27), (193, 28), (193, 29), (193, 30), (193, 31), (193, 32), (193, 33), (193, 34), (193, 35), (193, 36), (193, 37), (193, 38), (193, 39), (193, 40), (193, 41), (193, 42), (193, 43), (193, 44), (193, 45), (193, 47), (194, 18), (194, 20), (194, 21), (194, 22), (194, 23), (194, 24), (194, 25), (194, 26), (194, 27), (194, 28), (194, 29), (194, 30), (194, 31), (194, 32), (194, 33), (194, 34), (194, 35), (194, 36), (194, 37), (194, 38), (194, 39), (194, 40), (194, 41), (194, 42), (194, 43), (194, 44), (194, 45), (194, 46), (194, 48), (195, 18), (195, 20), (195, 21), (195, 22), (195, 23), (195, 24), (195, 25), (195, 26), (195, 27), (195, 28), (195, 29), (195, 30), (195, 31), (195, 32), (195, 33), (195, 34), (195, 35), (195, 36), (195, 37), (195, 38), (195, 39), (195, 40), (195, 41), (195, 42), (195, 43), (195, 44), (195, 45), (195, 46), (195, 48), (196, 17), (196, 19), (196, 20), (196, 21), (196, 22), (196, 23), (196, 24), (196, 25), (196, 26), (196, 27), (196, 28), (196, 29), (196, 30), (196, 31), (196, 32), (196, 33), (196, 34), (196, 35), (196, 36), (196, 37), (196, 38), (196, 39), (196, 40), (196, 41), (196, 42), (196, 43), (196, 44), (196, 45), (196, 46), (196, 47), (196, 49), (197, 17), (197, 19), (197, 20), (197, 21), (197, 22), (197, 23), (197, 24), (197, 25), (197, 26), (197, 27), (197, 28), (197, 29), (197, 30), (197, 31), (197, 32), (197, 33), (197, 34), (197, 35), (197, 36), (197, 37), (197, 38), (197, 39), (197, 40), (197, 41), (197, 42), (197, 43), (197, 44), (197, 45), (197, 46), (197, 47), (197, 49), (198, 16), (198, 18), (198, 19), (198, 20), (198, 21), (198, 22), (198, 23), (198, 24), (198, 25), (198, 26), (198, 27), (198, 28), (198, 29), (198, 30), (198, 31), (198, 32), (198, 33), (198, 34), (198, 35), (198, 36), (198, 37), (198, 38), (198, 39), (198, 40), (198, 41), (198, 42), (198, 43), (198, 44), (198, 45), (198, 46), (198, 47), (198, 49), (199, 16), (199, 18), (199, 19), (199, 20), (199, 21), (199, 22), (199, 23), (199, 24), (199, 25), (199, 26), (199, 27), (199, 28), (199, 29), (199, 30), (199, 31), (199, 32), (199, 33), (199, 34), (199, 35), (199, 36), (199, 37), (199, 38), (199, 39), (199, 40), (199, 41), (199, 42), (199, 43), (199, 44), (199, 45), (199, 46), (199, 47), (199, 49), (200, 15), (200, 17), (200, 18), (200, 19), (200, 20), (200, 21), (200, 22), (200, 23), (200, 24), (200, 25), (200, 26), (200, 27), (200, 28), (200, 29), (200, 30), (200, 31), (200, 32), (200, 33), (200, 34), (200, 35), (200, 36), (200, 37), (200, 38), (200, 39), (200, 40), (200, 41), (200, 42), (200, 43), (200, 44), (200, 45), (200, 46), (200, 47), (200, 49), (201, 15), (201, 17), (201, 18), (201, 19), (201, 20), (201, 21), (201, 22), (201, 23), (201, 24), (201, 25), (201, 26), (201, 27), (201, 28), (201, 29), (201, 30), (201, 31), (201, 32), (201, 33), (201, 34), (201, 35), (201, 36), (201, 37), (201, 38), (201, 39), (201, 40), (201, 41), (201, 42), (201, 43), (201, 44), (201, 45), (201, 46), (201, 47), (201, 49), (202, 15), (202, 17), (202, 18), (202, 19), (202, 20), (202, 21), (202, 22), (202, 23), (202, 24), (202, 25), (202, 26), (202, 27), (202, 28), (202, 29), (202, 30), (202, 31), (202, 32), (202, 33), (202, 34), (202, 35), (202, 36), (202, 37), (202, 38), (202, 39), (202, 40), (202, 41), (202, 42), (202, 43), (202, 44), (202, 45), (202, 46), (202, 47), (202, 49), (203, 14), (203, 16), (203, 17), (203, 18), (203, 19), (203, 20), (203, 21), (203, 22), (203, 23), (203, 24), (203, 25), (203, 26), (203, 27), (203, 28), (203, 29), (203, 30), (203, 31), (203, 32), (203, 33), (203, 34), (203, 35), (203, 36), (203, 37), (203, 38), (203, 39), (203, 40), (203, 41), (203, 42), (203, 43), (203, 44), (203, 45), (203, 46), (203, 47), (203, 49), (204, 14), (204, 16), (204, 17), (204, 18), (204, 19), (204, 20), (204, 21), (204, 22), (204, 23), (204, 24), (204, 25), (204, 26), (204, 27), (204, 28), (204, 29), (204, 30), (204, 31), (204, 32), (204, 33), (204, 34), (204, 35), (204, 36), (204, 37), (204, 38), (204, 39), (204, 40), (204, 41), (204, 42), (204, 43), (204, 44), (204, 45), (204, 46), (204, 47), (204, 49), (205, 14), (205, 16), (205, 17), (205, 18), (205, 19), (205, 20), (205, 21), (205, 22), (205, 23), (205, 24), (205, 25), (205, 26), (205, 27), (205, 28), (205, 29), (205, 30), (205, 31), (205, 32), (205, 33), (205, 34), (205, 35), (205, 36), (205, 37), (205, 38), (205, 39), (205, 40), (205, 41), (205, 42), (205, 43), (205, 44), (205, 45), (205, 46), (205, 47), (205, 49), (206, 13), (206, 14), (206, 15), (206, 16), (206, 17), (206, 18), (206, 19), (206, 20), (206, 21), (206, 22), (206, 23), (206, 24), (206, 25), (206, 26), (206, 27), (206, 28), (206, 29), (206, 30), (206, 31), (206, 32), (206, 33), (206, 34), (206, 35), (206, 36), (206, 37), (206, 38), (206, 39), (206, 40), (206, 41), (206, 42), (206, 43), (206, 44), (206, 45), (206, 46), (206, 47), (206, 48), (207, 13), (207, 15), (207, 16), (207, 17), (207, 18), (207, 19), (207, 20), (207, 21), (207, 22), (207, 23), (207, 24), (207, 25), (207, 26), (207, 27), (207, 28), (207, 29), (207, 30), (207, 31), (207, 32), (207, 33), (207, 34), (207, 35), (207, 36), (207, 37), (207, 38), (207, 39), (207, 40), (207, 41), (207, 42), (207, 43), (207, 44), (207, 45), (207, 46), (207, 48), (208, 13), (208, 15), (208, 16), (208, 17), (208, 18), (208, 19), (208, 20), (208, 21), (208, 22), (208, 23), (208, 24), (208, 25), (208, 26), (208, 27), (208, 28), (208, 29), (208, 30), (208, 31), (208, 32), (208, 33), (208, 34), (208, 35), (208, 36), (208, 37), (208, 38), (208, 39), (208, 40), (208, 41), (208, 42), (208, 43), (208, 44), (208, 45), (208, 47), (209, 13), (209, 15), (209, 16), (209, 17), (209, 18), (209, 19), (209, 20), (209, 21), (209, 22), (209, 23), (209, 24), (209, 25), (209, 26), (209, 27), (209, 28), (209, 29), (209, 30), (209, 31), (209, 32), (209, 33), (209, 34), (209, 35), (209, 36), (209, 37), (209, 38), (209, 39), (209, 40), (209, 41), (209, 42), (209, 43), (209, 44), (209, 46), (210, 13), (210, 15), (210, 16), (210, 17), (210, 18), (210, 19), (210, 20), (210, 21), (210, 22), (210, 23), (210, 24), (210, 25), (210, 26), (210, 27), (210, 28), (210, 29), (210, 30), (210, 31), (210, 32), (210, 33), (210, 34), (210, 35), (210, 36), (210, 37), (210, 38), (210, 39), (210, 40), (210, 41), (210, 42), (210, 43), (210, 45), (211, 13), (211, 15), (211, 16), (211, 17), (211, 18), (211, 19), (211, 20), (211, 21), (211, 22), (211, 23), (211, 24), (211, 25), (211, 26), (211, 27), (211, 28), (211, 29), (211, 30), (211, 31), (211, 32), (211, 33), (211, 34), (211, 35), (211, 36), (211, 37), (211, 38), (211, 39), (211, 40), (211, 41), (211, 42), (211, 44), (212, 15), (212, 16), (212, 17), (212, 18), (212, 19), (212, 20), (212, 21), (212, 22), (212, 23), (212, 24), (212, 25), (212, 26), (212, 27), (212, 28), (212, 29), (212, 30), (212, 31), (212, 32), (212, 33), (212, 34), (212, 35), (212, 36), (212, 37), (212, 38), (212, 39), (212, 40), (212, 41), (212, 43), (213, 14), (213, 16), (213, 17), (213, 18), (213, 19), (213, 20), (213, 21), (213, 22), (213, 23), (213, 24), (213, 25), (213, 26), (213, 27), (213, 28), (213, 29), (213, 30), (213, 31), (213, 32), (213, 33), (213, 34), (213, 35), (213, 36), (213, 37), (213, 38), (213, 39), (213, 42), (214, 15), (214, 17), (214, 18), (214, 19), (214, 20), (214, 21), (214, 22), (214, 23), (214, 24), (214, 25), (214, 26), (214, 27), (214, 28), (214, 29), (214, 30), (214, 31), (214, 32), (214, 33), (214, 34), (214, 35), (214, 36), (214, 37), (214, 38), (214, 41), (215, 18), (215, 19), (215, 20), (215, 21), (215, 22), (215, 23), (215, 24), (215, 25), (215, 26), (215, 27), (215, 28), (215, 29), (215, 30), (215, 31), (215, 32), (215, 33), (215, 34), (215, 35), (215, 36), (215, 37), (215, 38), (215, 40), (216, 16), (216, 18), (216, 19), (216, 20), (216, 21), (216, 22), (216, 23), (216, 24), (216, 25), (216, 26), (216, 27), (216, 28), (216, 29), (216, 30), (216, 31), (216, 32), (216, 33), (216, 34), (216, 35), (216, 36), (216, 37), (216, 39), (217, 17), (217, 19), (217, 20), (217, 21), (217, 22), (217, 23), (217, 24), (217, 25), (217, 26), (217, 27), (217, 28), (217, 29), (217, 30), (217, 31), (217, 32), (217, 33), (217, 34), (217, 35), (217, 36), (217, 38), (218, 18), (218, 20), (218, 21), (218, 22), (218, 23), (218, 24), (218, 25), (218, 26), (218, 27), (218, 28), (218, 29), (218, 30), (218, 31), (218, 32), (218, 33), (218, 34), (218, 35), (218, 37), (219, 19), (219, 37), (220, 20), (220, 22), (220, 23), (220, 24), (220, 25), (220, 26), (220, 27), (220, 28), (220, 29), (220, 30), (220, 31), (220, 32), (220, 33), (220, 34), (220, 35), (220, 37), (225, 19), (225, 21), (225, 22), (225, 23), (225, 24), (225, 25), (225, 26), (225, 27), (225, 28), (225, 29), (225, 30), (225, 31), (225, 32), (225, 33), (225, 34), (225, 35), (225, 36), (225, 37), (225, 38), (225, 40), (226, 18), (226, 41), (227, 18), (227, 20), (227, 21), (227, 22), (227, 23), (227, 24), (227, 25), (227, 26), (227, 27), (227, 28), (227, 29), (227, 30), (227, 31), (227, 32), (227, 33), (227, 34), (227, 35), (227, 36), (227, 37), (227, 38), (227, 39), (227, 40), (228, 17), (228, 19), (228, 20), (228, 21), (228, 22), (228, 23), (228, 24), (228, 25), (228, 26), (228, 27), (228, 28), (228, 29), (228, 30), (228, 31), (228, 32), (228, 33), (228, 34), (228, 35), (228, 36), (228, 37), (228, 38), (228, 39), (228, 40), (228, 41), (228, 44), (229, 16), (229, 18), (229, 19), (229, 20), (229, 21), (229, 22), (229, 23), (229, 24), (229, 25), (229, 26), (229, 27), (229, 28), (229, 29), (229, 30), (229, 31), (229, 32), (229, 33), (229, 34), (229, 35), (229, 36), (229, 37), (229, 38), (229, 39), (229, 40), (229, 41), (229, 42), (229, 45), (230, 15), (230, 17), (230, 18), (230, 19), (230, 20), (230, 21), (230, 22), (230, 23), (230, 24), (230, 25), (230, 26), (230, 27), (230, 28), (230, 29), (230, 30), (230, 31), (230, 32), (230, 33), (230, 34), (230, 35), (230, 36), (230, 37), (230, 38), (230, 39), (230, 40), (230, 41), (230, 42), (230, 43), (230, 44), (230, 46), (231, 14), (231, 16), (231, 17), (231, 18), (231, 19), (231, 20), (231, 21), (231, 22), (231, 23), (231, 24), (231, 25), (231, 26), (231, 27), (231, 28), (231, 29), (231, 30), (231, 31), (231, 32), (231, 33), (231, 34), (231, 35), (231, 36), (231, 37), (231, 38), (231, 39), (231, 40), (231, 41), (231, 42), (231, 43), (231, 44), (231, 45), (232, 14), (232, 16), (232, 17), (232, 18), (232, 19), (232, 20), (232, 21), (232, 22), (232, 23), (232, 24), (232, 25), (232, 26), (232, 27), (232, 28), (232, 29), (232, 30), (232, 31), (232, 32), (232, 33), (232, 34), (232, 35), (232, 36), (232, 37), (232, 38), (232, 39), (232, 40), (232, 41), (232, 42), (232, 43), (232, 44), (232, 45), (232, 46), (232, 48), (233, 13), (233, 15), (233, 16), (233, 17), (233, 18), (233, 19), (233, 20), (233, 21), (233, 22), (233, 23), (233, 24), (233, 25), (233, 26), (233, 27), (233, 28), (233, 29), (233, 30), (233, 31), (233, 32), (233, 33), (233, 34), (233, 35), (233, 36), (233, 37), (233, 38), (233, 39), (233, 40), (233, 41), (233, 42), (233, 43), (233, 44), (233, 45), (233, 46), (233, 47), (233, 49), (234, 13), (234, 15), (234, 16), (234, 17), (234, 18), (234, 19), (234, 20), (234, 21), (234, 22), (234, 23), (234, 24), (234, 25), (234, 26), (234, 27), (234, 28), (234, 29), (234, 30), (234, 31), (234, 32), (234, 33), (234, 34), (234, 35), (234, 36), (234, 37), (234, 38), (234, 39), (234, 40), (234, 41), (234, 42), (234, 43), (234, 44), (234, 45), (234, 46), (234, 47), (234, 48), (234, 50), (235, 13), (235, 15), (235, 16), (235, 17), (235, 18), (235, 19), (235, 20), (235, 21), (235, 22), (235, 23), (235, 24), (235, 25), (235, 26), (235, 27), (235, 28), (235, 29), (235, 30), (235, 31), (235, 32), (235, 33), (235, 34), (235, 35), (235, 36), (235, 37), (235, 38), (235, 39), (235, 40), (235, 41), (235, 42), (235, 43), (235, 44), (235, 45), (235, 46), (235, 47), (235, 48), (235, 49), (235, 51), (236, 13), (236, 15), (236, 16), (236, 17), (236, 18), (236, 19), (236, 20), (236, 21), (236, 22), (236, 23), (236, 24), (236, 25), (236, 26), (236, 27), (236, 28), (236, 29), (236, 30), (236, 31), (236, 32), (236, 33), (236, 34), (236, 35), (236, 36), (236, 37), (236, 38), (236, 39), (236, 40), (236, 41), (236, 42), (236, 43), (236, 44), (236, 45), (236, 46), (236, 47), (236, 48), (236, 49), (236, 51), (237, 13), (237, 15), (237, 16), (237, 17), (237, 18), (237, 19), (237, 20), (237, 21), (237, 22), (237, 23), (237, 24), (237, 25), (237, 26), (237, 27), (237, 28), (237, 29), (237, 30), (237, 31), (237, 32), (237, 33), (237, 34), (237, 35), (237, 36), (237, 37), (237, 38), (237, 39), (237, 40), (237, 41), (237, 42), (237, 43), (237, 44), (237, 45), (237, 46), (237, 47), (237, 48), (237, 49), (237, 51), (238, 12), (238, 13), (238, 14), (238, 15), (238, 16), (238, 17), (238, 18), (238, 19), (238, 20), (238, 21), (238, 22), (238, 23), (238, 24), (238, 25), (238, 26), (238, 27), (238, 28), (238, 29), (238, 30), (238, 31), (238, 32), (238, 33), (238, 34), (238, 35), (238, 36), (238, 37), (238, 38), (238, 39), (238, 40), (238, 41), (238, 42), (238, 43), (238, 44), (238, 45), (238, 46), (238, 47), (238, 48), (238, 49), (238, 50), (238, 52), (239, 13), (239, 15), (239, 16), (239, 17), (239, 18), (239, 19), (239, 20), (239, 21), (239, 22), (239, 23), (239, 24), (239, 25), (239, 26), (239, 27), (239, 28), (239, 29), (239, 30), (239, 31), (239, 32), (239, 33), (239, 34), (239, 35), (239, 36), (239, 37), (239, 38), (239, 39), (239, 40), (239, 41), (239, 42), (239, 43), (239, 44), (239, 45), (239, 46), (239, 47), (239, 48), (239, 49), (239, 50), (239, 52), (240, 13), (240, 15), (240, 16), (240, 17), (240, 18), (240, 19), (240, 20), (240, 21), (240, 22), (240, 23), (240, 24), (240, 25), (240, 26), (240, 27), (240, 28), (240, 29), (240, 30), (240, 31), (240, 32), (240, 33), (240, 34), (240, 35), (240, 36), (240, 37), (240, 38), (240, 39), (240, 40), (240, 41), (240, 42), (240, 43), (240, 44), (240, 45), (240, 46), (240, 47), (240, 48), (240, 49), (240, 50), (240, 52), (241, 13), (241, 15), (241, 16), (241, 17), (241, 18), (241, 19), (241, 20), (241, 21), (241, 22), (241, 23), (241, 24), (241, 25), (241, 26), (241, 27), (241, 28), (241, 29), (241, 30), (241, 31), (241, 32), (241, 33), (241, 34), (241, 35), (241, 36), (241, 37), (241, 38), (241, 39), (241, 40), (241, 41), (241, 42), (241, 43), (241, 44), (241, 45), (241, 46), (241, 47), (241, 48), (241, 49), (241, 50), (241, 52), (242, 13), (242, 15), (242, 16), (242, 17), (242, 18), (242, 19), (242, 20), (242, 21), (242, 22), (242, 23), (242, 24), (242, 25), (242, 26), (242, 27), (242, 28), (242, 29), (242, 30), (242, 31), (242, 32), (242, 33), (242, 34), (242, 35), (242, 36), (242, 37), (242, 38), (242, 39), (242, 40), (242, 41), (242, 42), (242, 43), (242, 44), (242, 45), (242, 46), (242, 47), (242, 48), (242, 49), (242, 50), (242, 52), (243, 13), (243, 15), (243, 16), (243, 17), (243, 18), (243, 19), (243, 20), (243, 21), (243, 22), (243, 23), (243, 24), (243, 25), (243, 26), (243, 27), (243, 28), (243, 29), (243, 30), (243, 31), (243, 32), (243, 33), (243, 34), (243, 35), (243, 36), (243, 37), (243, 38), (243, 39), (243, 40), (243, 41), (243, 42), (243, 43), (243, 44), (243, 45), (243, 46), (243, 47), (243, 48), (243, 49), (243, 50), (243, 52), (244, 13), (244, 15), (244, 16), (244, 17), (244, 18), (244, 19), (244, 20), (244, 21), (244, 22), (244, 23), (244, 24), (244, 25), (244, 26), (244, 27), (244, 28), (244, 29), (244, 30), (244, 31), (244, 32), (244, 33), (244, 34), (244, 35), (244, 36), (244, 37), (244, 38), (244, 39), (244, 40), (244, 41), (244, 42), (244, 43), (244, 44), (244, 45), (244, 46), (244, 47), (244, 48), (244, 49), (244, 50), (244, 52), (245, 13), (245, 15), (245, 16), (245, 17), (245, 18), (245, 19), (245, 20), (245, 21), (245, 22), (245, 23), (245, 24), (245, 25), (245, 26), (245, 27), (245, 28), (245, 29), (245, 30), (245, 31), (245, 32), (245, 33), (245, 34), (245, 35), (245, 36), (245, 37), (245, 38), (245, 39), (245, 40), (245, 41), (245, 42), (245, 43), (245, 44), (245, 45), (245, 46), (245, 47), (245, 48), (245, 49), (245, 50), (245, 52), (246, 14), (246, 16), (246, 17), (246, 18), (246, 19), (246, 20), (246, 21), (246, 22), (246, 23), (246, 24), (246, 25), (246, 26), (246, 27), (246, 28), (246, 29), (246, 30), (246, 31), (246, 32), (246, 33), (246, 34), (246, 35), (246, 36), (246, 37), (246, 38), (246, 39), (246, 40), (246, 41), (246, 42), (246, 43), (246, 44), (246, 45), (246, 46), (246, 47), (246, 48), (246, 49), (246, 50), (246, 52), (247, 14), (247, 16), (247, 17), (247, 18), (247, 19), (247, 20), (247, 21), (247, 22), (247, 23), (247, 24), (247, 25), (247, 26), (247, 27), (247, 28), (247, 29), (247, 30), (247, 31), (247, 32), (247, 33), (247, 34), (247, 35), (247, 36), (247, 37), (247, 38), (247, 39), (247, 40), (247, 41), (247, 42), (247, 43), (247, 44), (247, 45), (247, 46), (247, 47), (247, 48), (247, 49), (247, 50), (247, 52), (248, 14), (248, 16), (248, 17), (248, 18), (248, 19), (248, 20), (248, 21), (248, 22), (248, 23), (248, 24), (248, 25), (248, 26), (248, 27), (248, 28), (248, 29), (248, 30), (248, 31), (248, 32), (248, 33), (248, 34), (248, 35), (248, 36), (248, 37), (248, 38), (248, 39), (248, 40), (248, 41), (248, 42), (248, 43), (248, 44), (248, 45), (248, 46), (248, 47), (248, 48), (248, 49), (248, 50), (248, 52), (249, 15), (249, 17), (249, 18), (249, 19), (249, 20), (249, 21), (249, 22), (249, 23), (249, 24), (249, 25), (249, 26), (249, 27), (249, 28), (249, 29), (249, 30), (249, 31), (249, 32), (249, 33), (249, 34), (249, 35), (249, 36), (249, 37), (249, 38), (249, 39), (249, 40), (249, 41), (249, 42), (249, 43), (249, 44), (249, 45), (249, 46), (249, 47), (249, 48), (249, 49), (249, 51), (250, 15), (250, 17), (250, 18), (250, 19), (250, 20), (250, 21), (250, 22), (250, 23), (250, 24), (250, 25), (250, 26), (250, 27), (250, 28), (250, 29), (250, 30), (250, 31), (250, 32), (250, 33), (250, 34), (250, 35), (250, 36), (250, 37), (250, 38), (250, 39), (250, 40), (250, 41), (250, 42), (250, 43), (250, 44), (250, 45), (250, 46), (250, 47), (250, 48), (250, 49), (250, 51), (251, 15), (251, 17), (251, 18), (251, 19), (251, 20), (251, 21), (251, 22), (251, 23), (251, 24), (251, 25), (251, 26), (251, 27), (251, 28), (251, 29), (251, 30), (251, 31), (251, 32), (251, 33), (251, 34), (251, 35), (251, 36), (251, 37), (251, 38), (251, 39), (251, 40), (251, 41), (251, 42), (251, 43), (251, 44), (251, 45), (251, 46), (251, 47), (251, 48), (251, 49), (251, 51), (252, 16), (252, 18), (252, 19), (252, 20), (252, 21), (252, 22), (252, 23), (252, 24), (252, 25), (252, 26), (252, 27), (252, 28), (252, 29), (252, 30), (252, 31), (252, 32), (252, 33), (252, 34), (252, 35), (252, 36), (252, 37), (252, 38), (252, 39), (252, 40), (252, 41), (252, 42), (252, 43), (252, 44), (252, 45), (252, 46), (252, 47), (252, 48), (252, 50), (253, 16), (253, 18), (253, 19), (253, 20), (253, 21), (253, 22), (253, 23), (253, 24), (253, 25), (253, 26), (253, 27), (253, 28), (253, 29), (253, 30), (253, 31), (253, 32), (253, 33), (253, 34), (253, 35), (253, 36), (253, 37), (253, 38), (253, 39), (253, 40), (253, 41), (253, 42), (253, 43), (253, 44), (253, 45), (253, 46), (253, 47), (253, 48), (253, 50), (254, 17), (254, 19), (254, 20), (254, 21), (254, 22), (254, 23), (254, 24), (254, 25), (254, 26), (254, 27), (254, 28), (254, 29), (254, 30), (254, 31), (254, 32), (254, 33), (254, 34), (254, 35), (254, 36), (254, 37), (254, 38), (254, 39), (254, 40), (254, 41), (254, 42), (254, 43), (254, 44), (254, 45), (254, 46), (254, 50), (255, 18), (255, 20), (255, 21), (255, 22), (255, 23), (255, 24), (255, 25), (255, 26), (255, 27), (255, 28), (255, 29), (255, 30), (255, 31), (255, 32), (255, 33), (255, 34), (255, 35), (255, 36), (255, 37), (255, 38), (255, 39), (255, 40), (255, 41), (255, 42), (255, 43), (255, 44), (255, 47), (255, 49), (256, 18), (256, 20), (256, 21), (256, 22), (256, 23), (256, 24), (256, 25), (256, 26), (256, 27), (256, 28), (256, 29), (256, 30), (256, 31), (256, 32), (256, 33), (256, 34), (256, 35), (256, 36), (256, 37), (256, 38), (256, 39), (256, 40), (256, 41), (256, 42), (256, 43), (256, 45), (256, 46), (256, 49), (257, 19), (257, 21), (257, 22), (257, 23), (257, 24), (257, 25), (257, 26), (257, 27), (257, 28), (257, 29), (257, 30), (257, 31), (257, 32), (257, 33), (257, 34), (257, 35), (257, 36), (257, 37), (257, 38), (257, 39), (257, 40), (257, 41), (257, 42), (257, 44), (258, 20), (258, 22), (258, 23), (258, 24), (258, 25), (258, 26), (258, 27), (258, 28), (258, 29), (258, 30), (258, 31), (258, 32), (258, 33), (258, 34), (258, 35), (258, 36), (258, 37), (258, 38), (258, 43), (259, 23), (259, 24), (259, 25), (259, 26), (259, 27), (259, 28), (259, 29), (259, 30), (259, 31), (259, 32), (259, 33), (259, 34), (259, 35), (259, 39), (259, 40), (259, 41), (259, 43), (260, 22), (260, 25), (260, 26), (260, 27), (260, 28), (260, 29), (260, 30), (260, 31), (260, 32), (260, 36), (260, 37), (260, 38), (261, 23), (261, 33), (261, 34), (261, 35), (262, 25), (262, 26), (262, 27), (262, 28), (262, 29), (262, 30), (262, 31), (264, 48), (264, 50), (265, 52), (265, 53), (266, 49), (266, 51), (266, 54), (267, 50), (267, 53), (267, 56), (268, 51), (268, 54), (268, 57), (269, 53), (269, 55), (269, 56), (270, 54), (270, 56), (270, 57), (271, 54), (271, 56), (271, 57), (271, 58), (271, 60), (272, 54), (272, 56), (272, 57), (272, 58), (272, 59), (272, 61), (273, 54), (273, 56), (273, 57), (273, 58), (273, 59), (273, 61), (274, 53), (274, 55), (274, 56), (274, 57), (274, 58), (274, 59), (274, 60), (274, 62), (275, 53), (275, 55), (275, 56), (275, 57), (275, 58), (275, 59), (275, 60), (275, 62), (276, 53), (276, 55), (276, 56), (276, 57), (276, 58), (276, 59), (276, 60), (276, 62), (277, 53), (277, 55), (277, 56), (277, 57), (277, 58), (277, 59), (277, 61), (278, 52), (278, 54), (278, 55), (278, 56), (278, 57), (278, 58), (278, 59), (278, 61), (279, 52), (279, 54), (279, 55), (279, 56), (279, 57), (279, 58), (279, 59), (279, 61), (280, 53), (280, 54), (280, 55), (280, 56), (280, 57), (280, 58), (281, 53), (281, 60), (282, 54), (282, 56), (282, 57), (282, 59))
coordinates_ff6600 = ((157, 76), (157, 78), (158, 74), (158, 78), (158, 79), (159, 68), (159, 73), (159, 76), (159, 77), (159, 78), (159, 80), (159, 81), (159, 82), (159, 83), (159, 84), (159, 86), (160, 66), (160, 68), (160, 73), (160, 75), (160, 76), (160, 77), (160, 78), (160, 83), (160, 85), (161, 64), (161, 69), (161, 72), (161, 74), (161, 79), (161, 80), (161, 82), (162, 61), (162, 65), (162, 66), (162, 67), (162, 68), (162, 75), (162, 76), (162, 77), (162, 78), (163, 61), (163, 63), (163, 64), (163, 65), (163, 66), (163, 67), (163, 68), (163, 69), (163, 73), (163, 74), (164, 61), (164, 63), (164, 64), (164, 65), (164, 66), (164, 67), (164, 68), (164, 72), (165, 58), (165, 60), (165, 61), (165, 62), (165, 63), (165, 64), (165, 65), (165, 66), (165, 67), (165, 70), (166, 59), (166, 61), (166, 62), (166, 63), (166, 64), (166, 65), (166, 68), (167, 60), (167, 62), (167, 63), (167, 64), (167, 67), (168, 60), (168, 61), (168, 62), (168, 65), (169, 61), (169, 64), (170, 60), (170, 62), (171, 61), (172, 57), (172, 60), (173, 55), (173, 58), (174, 54), (174, 57), (175, 52), (175, 56), (176, 50), (176, 55), (177, 49), (177, 54), (178, 47), (178, 50), (178, 53), (179, 46), (179, 49), (179, 52), (180, 45), (180, 47), (180, 48), (180, 49), (180, 51), (181, 44), (181, 46), (181, 47), (181, 48), (181, 50), (182, 43), (182, 45), (182, 46), (182, 47), (182, 49), (183, 42), (183, 44), (183, 45), (183, 46), (183, 48), (184, 42), (184, 44), (184, 45), (184, 47), (185, 42), (185, 44), (185, 45), (185, 47), (186, 42), (187, 43), (187, 46), (258, 46), (258, 48), (258, 49), (258, 50), (258, 51), (258, 52), (258, 53), (258, 54), (258, 55), (258, 56), (258, 57), (258, 59), (259, 45), (259, 60), (260, 46), (260, 48), (260, 49), (260, 50), (260, 51), (260, 52), (260, 53), (260, 54), (260, 55), (260, 56), (260, 57), (260, 58), (260, 59), (260, 61), (261, 47), (261, 52), (261, 53), (261, 54), (261, 55), (261, 56), (261, 57), (261, 58), (261, 59), (261, 60), (261, 63), (262, 48), (262, 50), (262, 51), (262, 54), (262, 55), (262, 56), (262, 57), (262, 58), (262, 59), (262, 60), (262, 61), (262, 64), (263, 52), (263, 53), (263, 56), (263, 57), (263, 58), (263, 59), (263, 60), (263, 61), (263, 62), (263, 63), (263, 65), (264, 54), (264, 58), (264, 59), (264, 60), (264, 61), (264, 62), (264, 63), (264, 64), (264, 66), (265, 56), (265, 59), (265, 60), (265, 61), (265, 62), (265, 63), (265, 64), (265, 65), (265, 68), (266, 58), (266, 60), (266, 61), (266, 62), (266, 63), (266, 64), (266, 65), (266, 66), (266, 69), (267, 59), (267, 61), (267, 62), (267, 63), (267, 64), (267, 65), (267, 66), (267, 67), (267, 70), (268, 60), (268, 62), (268, 63), (268, 64), (268, 65), (268, 66), (268, 67), (268, 68), (268, 69), (268, 71), (269, 61), (269, 63), (269, 64), (269, 65), (269, 66), (269, 67), (269, 68), (269, 69), (269, 70), (269, 72), (270, 62), (270, 64), (270, 65), (270, 66), (270, 67), (270, 68), (270, 69), (270, 70), (270, 71), (270, 74), (271, 63), (271, 65), (271, 66), (271, 67), (271, 68), (271, 69), (271, 70), (271, 71), (271, 72), (271, 75), (272, 63), (272, 65), (272, 66), (272, 67), (272, 68), (272, 69), (272, 70), (272, 71), (272, 72), (272, 73), (272, 76), (273, 64), (273, 67), (273, 68), (273, 69), (273, 70), (273, 71), (273, 72), (273, 73), (273, 74), (273, 75), (273, 77), (274, 64), (274, 66), (274, 69), (274, 70), (274, 71), (274, 72), (274, 73), (274, 74), (274, 75), (274, 76), (274, 78), (275, 68), (275, 71), (275, 72), (275, 73), (275, 74), (275, 75), (275, 76), (275, 77), (275, 79), (276, 69), (276, 72), (276, 73), (276, 74), (276, 75), (276, 76), (276, 77), (276, 78), (276, 81), (277, 71), (277, 74), (277, 75), (277, 76), (277, 77), (277, 78), (277, 79), (277, 82), (278, 72), (278, 75), (278, 76), (278, 77), (278, 78), (278, 79), (278, 80), (278, 83), (279, 74), (279, 76), (279, 77), (279, 78), (279, 79), (279, 80), (279, 81), (279, 82), (279, 84), (280, 75), (280, 77), (280, 78), (280, 79), (280, 80), (280, 81), (280, 82), (280, 83), (280, 85), (281, 76), (281, 79), (281, 80), (281, 81), (281, 82), (281, 83), (281, 84), (281, 86), (282, 77), (282, 80), (282, 81), (282, 82), (282, 83), (282, 84), (282, 85), (282, 88), (283, 81), (283, 82), (283, 83), (283, 84), (283, 85), (283, 86), (283, 89), (284, 80), (284, 82), (284, 83), (284, 84), (284, 85), (284, 86), (284, 87), (284, 90), (285, 81), (285, 83), (285, 84), (285, 85), (285, 86), (285, 87), (285, 88), (285, 89), (285, 91), (286, 82), (286, 85), (286, 86), (286, 87), (286, 88), (286, 89), (286, 90), (286, 92), (287, 83), (287, 86), (287, 87), (287, 88), (287, 89), (287, 90), (287, 91), (287, 93), (288, 84), (288, 87), (288, 88), (288, 89), (288, 90), (288, 94), (289, 86), (289, 89), (289, 90), (289, 92), (290, 87), (291, 90))
coordinates_ff9966 = ((152, 74), (152, 76), (153, 71), (153, 73), (153, 77), (154, 69), (154, 74), (154, 75), (154, 77), (155, 67), (155, 71), (155, 72), (155, 73), (155, 77), (156, 65), (156, 74), (156, 75), (157, 63), (157, 64), (157, 67), (157, 68), (157, 69), (157, 70), (157, 71), (157, 72), (158, 62), (158, 65), (158, 66), (159, 61), (159, 64), (160, 61), (160, 62), (276, 64), (276, 66), (277, 64), (277, 68), (278, 63), (278, 64), (278, 65), (278, 66), (278, 69), (279, 63), (279, 65), (279, 66), (279, 67), (279, 68), (279, 71), (280, 63), (280, 65), (280, 66), (280, 67), (280, 68), (280, 69), (280, 72), (281, 62), (281, 64), (281, 65), (281, 66), (281, 67), (281, 68), (281, 69), (281, 70), (281, 71), (281, 73), (282, 62), (282, 63), (282, 64), (282, 65), (282, 66), (282, 67), (282, 68), (282, 69), (282, 70), (282, 71), (282, 72), (282, 75), (283, 63), (283, 64), (283, 65), (283, 66), (283, 67), (283, 68), (283, 69), (283, 70), (283, 71), (283, 72), (283, 73), (283, 76), (284, 58), (284, 62), (284, 63), (284, 64), (284, 65), (284, 66), (284, 67), (284, 68), (284, 69), (284, 70), (284, 71), (284, 72), (284, 73), (284, 74), (284, 77), (285, 58), (285, 60), (285, 61), (285, 62), (285, 63), (285, 64), (285, 65), (285, 66), (285, 67), (285, 68), (285, 69), (285, 70), (285, 71), (285, 72), (285, 73), (285, 74), (285, 75), (285, 76), (285, 78), (286, 59), (286, 61), (286, 62), (286, 63), (286, 64), (286, 65), (286, 66), (286, 67), (286, 68), (286, 69), (286, 70), (286, 71), (286, 72), (286, 73), (286, 74), (286, 75), (286, 76), (286, 77), (286, 79), (287, 60), (287, 62), (287, 63), (287, 64), (287, 65), (287, 66), (287, 67), (287, 68), (287, 69), (287, 70), (287, 71), (287, 72), (287, 73), (287, 74), (287, 75), (287, 76), (287, 77), (287, 78), (288, 61), (288, 63), (288, 64), (288, 65), (288, 66), (288, 67), (288, 68), (288, 69), (288, 70), (288, 71), (288, 72), (288, 73), (288, 74), (288, 75), (288, 76), (288, 77), (288, 78), (288, 79), (288, 82), (289, 62), (289, 65), (289, 66), (289, 67), (289, 68), (289, 69), (289, 70), (289, 71), (289, 72), (289, 73), (289, 74), (289, 75), (289, 76), (289, 77), (289, 78), (289, 79), (289, 80), (289, 83), (290, 63), (290, 66), (290, 67), (290, 68), (290, 69), (290, 70), (290, 71), (290, 72), (290, 73), (290, 74), (290, 75), (290, 76), (290, 77), (290, 78), (290, 79), (290, 80), (290, 81), (290, 82), (290, 84), (291, 65), (291, 68), (291, 69), (291, 70), (291, 71), (291, 72), (291, 73), (291, 74), (291, 75), (291, 76), (291, 77), (291, 78), (291, 79), (291, 80), (291, 81), (291, 82), (291, 83), (291, 86), (292, 66), (292, 69), (292, 70), (292, 71), (292, 72), (292, 73), (292, 74), (292, 75), (292, 76), (292, 77), (292, 78), (292, 79), (292, 80), (292, 81), (292, 82), (292, 83), (292, 84), (292, 87), (293, 68), (293, 71), (293, 72), (293, 73), (293, 74), (293, 75), (293, 76), (293, 77), (293, 78), (293, 79), (293, 80), (293, 81), (293, 82), (293, 83), (293, 84), (293, 85), (293, 89), (293, 90), (294, 69), (294, 73), (294, 74), (294, 75), (294, 76), (294, 77), (294, 78), (294, 79), (294, 80), (294, 81), (294, 82), (294, 83), (294, 89), (295, 71), (295, 75), (295, 76), (295, 77), (295, 78), (295, 79), (295, 80), (295, 81), (295, 84), (295, 85), (295, 89), (296, 73), (296, 83), (296, 88), (296, 89), (297, 76), (297, 77), (297, 78), (297, 79), (297, 81), (297, 89))
coordinates_ccff33 = ((237, 83), (237, 86), (238, 83), (238, 85)) |
class EmailAddress:
def __init__(self, email):
self.email = email
self._email_tpl = tuple(self._email.split('@'))
def __str__(self):
return self.email
def __repr__(self):
return f"{EmailAddress.__name__}('{self.email}')"
@property
def email(self):
return self._email
@email.setter
def email(self, email):
self._email = str(email)
if not self._is_valid():
raise ValueError(f'{self.email} is not a valid email address')
@property
def user(self):
return self._email_tpl[0]
@property
def domain(self):
return self._email_tpl[1]
def _is_valid(self):
email_split = self._email.split('@')
if len(email_split) != 2:
return False
domain_split = email_split[1].split('.')
if len(domain_split) < 2:
return False
return True
| class Emailaddress:
def __init__(self, email):
self.email = email
self._email_tpl = tuple(self._email.split('@'))
def __str__(self):
return self.email
def __repr__(self):
return f"{EmailAddress.__name__}('{self.email}')"
@property
def email(self):
return self._email
@email.setter
def email(self, email):
self._email = str(email)
if not self._is_valid():
raise value_error(f'{self.email} is not a valid email address')
@property
def user(self):
return self._email_tpl[0]
@property
def domain(self):
return self._email_tpl[1]
def _is_valid(self):
email_split = self._email.split('@')
if len(email_split) != 2:
return False
domain_split = email_split[1].split('.')
if len(domain_split) < 2:
return False
return True |
x = int(input())
y = int(input())
ans = 0
if x > 0:
if y > 0:
ans = 1
else: ans = 4
else:
if y > 0:
ans = 2
else: ans = 3
print(ans) | x = int(input())
y = int(input())
ans = 0
if x > 0:
if y > 0:
ans = 1
else:
ans = 4
elif y > 0:
ans = 2
else:
ans = 3
print(ans) |
# filename : csc_checks.py
# description : check definitions (security best practices and CVEs)
# create date : 2018-05-07 14:07:33.569768
csc1_1 = {'check_name': 'csc1_1',
'check_type': 'check_in_simple',
'match1': 'banner motd',
'match2': 'n/a',
'required': 'yes',
'result_ok': 'Test successful.',
'result_failed': 'Test failed.',
'info': 'A banner shoud be set',
'url': 'n/a',
'fix': 'Command to fix',}
csc1_2 = {'check_name': 'csc1_2',
'check_type': 'check_in_simple',
'match1': 'no cdp enable',
'match2': 'n/a',
'required': 'yes',
'result_ok': 'Test successful.',
'result_failed': 'Test failed.',
'info': 'CDP should not be enabled globally',
'url': 'n/a',
'fix': 'Command to fix',}
csc1_3 = {'check_name': 'csc1_3',
'check_type': 'check_in_simple',
'match1': 'snmpv1',
'match2': 'n/a',
'required': 'no',
'result_ok': 'Test successful.',
'result_failed': 'Test failed.',
'info': 'SNMP version 1 should not be configured',
'url': 'n/a',
'fix': 'Command to fix',}
csc1_4 = {'check_name': 'csc1_4',
'check_type': 'check_in_simple',
'match1': 'snmp-server host \d{1,3}\.\d{1,3}\.\d{1,3}\.\d{1,3} traps version 2c',
'match2': 'n/a',
'required': 'yes',
'result_ok': 'Test successful.',
'result_failed': 'Test failed.',
'info': 'SNMP version 2c ',
'url': 'n/a',
'fix': 'Command to fix',}
csc1_5 = {'check_name': 'csc1_5',
'check_type': 'check_parameter',
'match1': 'ssh key rsa',
'match2': '2048',
'required': 'yes',
'result_ok': 'Test successful.',
'result_failed': 'Test failed.',
'info': 'RSA key length [2048]',
'url': 'n/a',
'fix': 'Command to fix',}
csc1_6 = {'check_name': 'csc1_6',
'check_type': 'check_in_simple',
'match1': 'no ssh key dsa',
'match2': 'n/a',
'required': 'yes',
'result_ok': 'Test successful.',
'result_failed': 'Test failed.',
'info': 'SNMP source interface [mgmt0]',
'url': 'n/a',
'fix': 'Command to fix',}
csc1_7 = {'check_name': 'csc1_7',
'check_type': 'check_parameter',
'match1': 'snmp-server source-interface traps',
'match2': 'mgmt0',
'required': 'yes',
'result_ok': 'Test successful.',
'result_failed': 'Test failed.',
'info': 'SNMP source interface [mgmt0]',
'url': 'n/a',
'fix': 'Command to fix',}
csc1_8 = {'check_name': 'csc1_8',
'check_type': 'check_parameter',
'match1': 'snmp-server location',
'match2': 'FR.*',
'required': 'yes',
'result_ok': 'Test successful.',
'result_failed': 'Test failed.',
'info': 'SNMP location string',
'url': 'n/a',
'fix': 'Command to fix',}
csc1_9 = {'check_name': 'csc1_9',
'check_type': 'check_parameter',
'match1': 'snmp-server host',
'match2': '\d{1,3}\.\d{1,3}\.\d{1,3}\.\d{1,3}',
'required': 'yes',
'result_ok': 'Test successful.',
'result_failed': 'Test failed.',
'info': 'SNMP destination server',
'url': 'n/a',
'fix': 'Command to fix',}
csc1_10 = {'check_name': 'csc1_10',
'check_type': 'check_parameter',
'match1': 'snmp-server community',
'match2': 'your_community_string_here',
'required': 'yes',
'result_ok': 'Test successful.',
'result_failed': 'Test failed.',
'info': 'SNMP community string',
'url': 'n/a',
'fix': 'Command to fix',}
csc1_11 = {'check_name': 'csc1_11',
'check_type': 'check_parameter',
'match1': 'ntp server',
'match2': '\d{1,3}\.\d{1,3}\.\d{1,3}\.\d{1,3}',
'required': 'yes',
'result_ok': 'Test successful.',
'result_failed': 'Test failed.',
'info': 'NTP server have to be configured',
'url': 'n/a',
'fix': 'Command to fix',}
csc1_12 = {'check_name': 'csc1_12',
'check_type': 'check_parameter',
'match1': 'ntp source-interface',
'match2': 'mgmt0',
'required': 'yes',
'result_ok': 'Test successful.',
'result_failed': 'Test failed.',
'info': 'NTP source interface [mgmt0]',
'url': 'n/a',
'fix': 'Command to fix',}
csc1_13 = {'check_name': 'csc1_13',
'check_type': 'check_in_simple',
'match1': 'no feature telnet',
'match2': 'n/a',
'required': 'yes',
'result_ok': 'Test successful.',
'result_failed': 'Test failed.',
'info': 'no feature telnet',
'url': 'n/a',
'fix': 'Command to fix',}
csc1_14 = {'check_name': 'csc1_14',
'check_type': 'check_in_simple',
'match1': 'password strength-check',
'match2': 'n/a',
'required': 'yes',
'result_ok': 'Test successful.',
'result_failed': 'Test failed.',
'info': 'password strength-check',
'url': 'n/a',
'fix': 'Command to fix',}
csc1_15 = {'check_name': 'csc1_15',
'check_type': 'check_in_simple',
'match1': 'password secure-mode',
'match2': 'n/a',
'required': 'yes',
'result_ok': 'Test successful.',
'result_failed': 'Test failed.',
'info': 'password secure-mode',
'url': 'n/a',
'fix': 'Command to fix',}
csc1_16 = {'check_name': 'csc1_16',
'check_type': 'check_in_simple',
'match1': 'no ssh key dsa',
'match2': 'n/a',
'required': 'yes',
'result_ok': 'Test successful.',
'result_failed': 'Test failed.',
'info': 'no ssh key dsa',
'url': 'n/a',
'fix': 'Command to fix',}
csc1_17 = {'check_name': 'csc1_17',
'check_type': 'check_in_simple',
'match1': 'aaa authentication login default group',
'match2': 'n/a',
'required': 'yes',
'result_ok': 'Test successful.',
'result_failed': 'Test failed.',
'info': 'aaa authentication login default group',
'url': 'n/a',
'fix': 'Command to fix',}
csc1_18 = {'check_name': 'csc1_18',
'check_type': 'check_in_simple',
'match1': 'aaa authentication login console group',
'match2': 'n/a',
'required': 'yes',
'result_ok': 'Test successful.',
'result_failed': 'Test failed.',
'info': 'aaa authentication login console group',
'url': 'n/a',
'fix': 'Command to fix',}
csc1_19 = {'check_name': 'csc1_19',
'check_type': 'check_in_simple',
'match1': 'no ip source-route',
'match2': 'n/a',
'required': 'yes',
'result_ok': 'Test successful.',
'result_failed': 'Test failed.',
'info': 'no ip source-route',
'url': 'n/a',
'fix': 'Command to fix',}
csc1_20 = {'check_name': 'csc1_20',
'check_type': 'check_in_simple',
'match1': 'no ip igmp snooping',
'match2': 'n/a',
'required': 'yes',
'result_ok': 'Test successful.',
'result_failed': 'Test failed.',
'info': 'no ip igmp snooping',
'url': 'n/a',
'fix': 'Command to fix',}
csc1_21 = {'check_name': 'csc1_21',
'check_type': 'check_in_simple',
'match1': 'exec-timeout 15',
'match2': 'n/a',
'required': 'yes',
'result_ok': 'Test successful.',
'result_failed': 'Test failed.',
'info': 'minimize axec timeout to 15s',
'url': 'n/a',
'fix': 'Command to fix',}
CVE_2018_0102 = {'check_name': 'CVE_2018_0102',
'check_type': 'check_two_parameters',
'match1': 'feature pong',
'match2': 'feature-set fabricpath',
'required': 'no',
'result_ok': 'Test successful.',
'result_failed': 'Test failed.',
'info': 'Affected versions: 7.2(2)d1(1), 7.2(2)d1(2), 7.2(1)d(1)',
'url': 'https://www.cvedetails.com/cve/CVE-2018-0102/',
'fix': 'Command to fix',}
CVE_2018_0090 = {'check_name': 'CVE_2018_0090',
'check_type': 'check_two_parameters',
'match1': 'cisco Nexus(20|30|55|56|60|70|77)00',
'match2': 'access-list',
'required': 'no',
'result_ok': 'Test successful.',
'result_failed': 'Test failed.',
'info': 'Affected versions: 7.3(2)n1(0.6), 8.3(0)kms(0.31), 8.8(3.5)s0',
'url': 'https://www.cvedetails.com/cve/CVE-2018-0090/',
'fix': 'Command to fix',}
CVE_2018_0092 = {'check_name': 'CVE_2018_0092',
'check_type': 'check_two_parameters',
'match1': 'cisco Nexus(30|36|90|95)00',
'match2': 'role network-operator',
'required': 'yes',
'result_ok': 'Test successful.',
'result_failed': 'Test failed.',
'info': 'Affected versions: 7.0(3)i5(2), 7.0(3)i6(1), 7.0(3)i7(1)',
'url': 'https://www.cvedetails.com/cve/CVE-2018-0092/',
'fix': 'Command to fix',}
CVE_2017_12341 = {'check_name': 'CVE_2017_12341',
'check_type': 'check_in_simple',
'match1': '8.1\(1\)|8.2\(1\)|8.1\(0.59\)s0',
'match2': 'n/a',
'required': 'no',
'result_ok': 'Test successful.',
'result_failed': 'Test failed.',
'info': 'Affected versions: 8.1(1), 8.2(1), 8.1(0.59)s0',
'url': 'https://www.cvedetails.com/cve/CVE-2017-12341/',
'fix': 'Command to fix',}
CVE_2017_12331 = {'check_name': 'CVE_2017_12331',
'check_type': 'check_two_parameters',
'match1': 'cisco Nexus(70|77)00',
'match2': '8.1\(1\)',
'required': 'no',
'result_ok': 'Test successful.',
'result_failed': 'Test failed.',
'info': 'Affected versions: 8.1(1)',
'url': 'https://www.cvedetails.com/cve/CVE-2017-12331/',
'fix': 'Command to fix',}
| csc1_1 = {'check_name': 'csc1_1', 'check_type': 'check_in_simple', 'match1': 'banner motd', 'match2': 'n/a', 'required': 'yes', 'result_ok': 'Test successful.', 'result_failed': 'Test failed.', 'info': 'A banner shoud be set', 'url': 'n/a', 'fix': 'Command to fix'}
csc1_2 = {'check_name': 'csc1_2', 'check_type': 'check_in_simple', 'match1': 'no cdp enable', 'match2': 'n/a', 'required': 'yes', 'result_ok': 'Test successful.', 'result_failed': 'Test failed.', 'info': 'CDP should not be enabled globally', 'url': 'n/a', 'fix': 'Command to fix'}
csc1_3 = {'check_name': 'csc1_3', 'check_type': 'check_in_simple', 'match1': 'snmpv1', 'match2': 'n/a', 'required': 'no', 'result_ok': 'Test successful.', 'result_failed': 'Test failed.', 'info': 'SNMP version 1 should not be configured', 'url': 'n/a', 'fix': 'Command to fix'}
csc1_4 = {'check_name': 'csc1_4', 'check_type': 'check_in_simple', 'match1': 'snmp-server host \\d{1,3}\\.\\d{1,3}\\.\\d{1,3}\\.\\d{1,3} traps version 2c', 'match2': 'n/a', 'required': 'yes', 'result_ok': 'Test successful.', 'result_failed': 'Test failed.', 'info': 'SNMP version 2c ', 'url': 'n/a', 'fix': 'Command to fix'}
csc1_5 = {'check_name': 'csc1_5', 'check_type': 'check_parameter', 'match1': 'ssh key rsa', 'match2': '2048', 'required': 'yes', 'result_ok': 'Test successful.', 'result_failed': 'Test failed.', 'info': 'RSA key length [2048]', 'url': 'n/a', 'fix': 'Command to fix'}
csc1_6 = {'check_name': 'csc1_6', 'check_type': 'check_in_simple', 'match1': 'no ssh key dsa', 'match2': 'n/a', 'required': 'yes', 'result_ok': 'Test successful.', 'result_failed': 'Test failed.', 'info': 'SNMP source interface [mgmt0]', 'url': 'n/a', 'fix': 'Command to fix'}
csc1_7 = {'check_name': 'csc1_7', 'check_type': 'check_parameter', 'match1': 'snmp-server source-interface traps', 'match2': 'mgmt0', 'required': 'yes', 'result_ok': 'Test successful.', 'result_failed': 'Test failed.', 'info': 'SNMP source interface [mgmt0]', 'url': 'n/a', 'fix': 'Command to fix'}
csc1_8 = {'check_name': 'csc1_8', 'check_type': 'check_parameter', 'match1': 'snmp-server location', 'match2': 'FR.*', 'required': 'yes', 'result_ok': 'Test successful.', 'result_failed': 'Test failed.', 'info': 'SNMP location string', 'url': 'n/a', 'fix': 'Command to fix'}
csc1_9 = {'check_name': 'csc1_9', 'check_type': 'check_parameter', 'match1': 'snmp-server host', 'match2': '\\d{1,3}\\.\\d{1,3}\\.\\d{1,3}\\.\\d{1,3}', 'required': 'yes', 'result_ok': 'Test successful.', 'result_failed': 'Test failed.', 'info': 'SNMP destination server', 'url': 'n/a', 'fix': 'Command to fix'}
csc1_10 = {'check_name': 'csc1_10', 'check_type': 'check_parameter', 'match1': 'snmp-server community', 'match2': 'your_community_string_here', 'required': 'yes', 'result_ok': 'Test successful.', 'result_failed': 'Test failed.', 'info': 'SNMP community string', 'url': 'n/a', 'fix': 'Command to fix'}
csc1_11 = {'check_name': 'csc1_11', 'check_type': 'check_parameter', 'match1': 'ntp server', 'match2': '\\d{1,3}\\.\\d{1,3}\\.\\d{1,3}\\.\\d{1,3}', 'required': 'yes', 'result_ok': 'Test successful.', 'result_failed': 'Test failed.', 'info': 'NTP server have to be configured', 'url': 'n/a', 'fix': 'Command to fix'}
csc1_12 = {'check_name': 'csc1_12', 'check_type': 'check_parameter', 'match1': 'ntp source-interface', 'match2': 'mgmt0', 'required': 'yes', 'result_ok': 'Test successful.', 'result_failed': 'Test failed.', 'info': 'NTP source interface [mgmt0]', 'url': 'n/a', 'fix': 'Command to fix'}
csc1_13 = {'check_name': 'csc1_13', 'check_type': 'check_in_simple', 'match1': 'no feature telnet', 'match2': 'n/a', 'required': 'yes', 'result_ok': 'Test successful.', 'result_failed': 'Test failed.', 'info': 'no feature telnet', 'url': 'n/a', 'fix': 'Command to fix'}
csc1_14 = {'check_name': 'csc1_14', 'check_type': 'check_in_simple', 'match1': 'password strength-check', 'match2': 'n/a', 'required': 'yes', 'result_ok': 'Test successful.', 'result_failed': 'Test failed.', 'info': 'password strength-check', 'url': 'n/a', 'fix': 'Command to fix'}
csc1_15 = {'check_name': 'csc1_15', 'check_type': 'check_in_simple', 'match1': 'password secure-mode', 'match2': 'n/a', 'required': 'yes', 'result_ok': 'Test successful.', 'result_failed': 'Test failed.', 'info': 'password secure-mode', 'url': 'n/a', 'fix': 'Command to fix'}
csc1_16 = {'check_name': 'csc1_16', 'check_type': 'check_in_simple', 'match1': 'no ssh key dsa', 'match2': 'n/a', 'required': 'yes', 'result_ok': 'Test successful.', 'result_failed': 'Test failed.', 'info': 'no ssh key dsa', 'url': 'n/a', 'fix': 'Command to fix'}
csc1_17 = {'check_name': 'csc1_17', 'check_type': 'check_in_simple', 'match1': 'aaa authentication login default group', 'match2': 'n/a', 'required': 'yes', 'result_ok': 'Test successful.', 'result_failed': 'Test failed.', 'info': 'aaa authentication login default group', 'url': 'n/a', 'fix': 'Command to fix'}
csc1_18 = {'check_name': 'csc1_18', 'check_type': 'check_in_simple', 'match1': 'aaa authentication login console group', 'match2': 'n/a', 'required': 'yes', 'result_ok': 'Test successful.', 'result_failed': 'Test failed.', 'info': 'aaa authentication login console group', 'url': 'n/a', 'fix': 'Command to fix'}
csc1_19 = {'check_name': 'csc1_19', 'check_type': 'check_in_simple', 'match1': 'no ip source-route', 'match2': 'n/a', 'required': 'yes', 'result_ok': 'Test successful.', 'result_failed': 'Test failed.', 'info': 'no ip source-route', 'url': 'n/a', 'fix': 'Command to fix'}
csc1_20 = {'check_name': 'csc1_20', 'check_type': 'check_in_simple', 'match1': 'no ip igmp snooping', 'match2': 'n/a', 'required': 'yes', 'result_ok': 'Test successful.', 'result_failed': 'Test failed.', 'info': 'no ip igmp snooping', 'url': 'n/a', 'fix': 'Command to fix'}
csc1_21 = {'check_name': 'csc1_21', 'check_type': 'check_in_simple', 'match1': 'exec-timeout 15', 'match2': 'n/a', 'required': 'yes', 'result_ok': 'Test successful.', 'result_failed': 'Test failed.', 'info': 'minimize axec timeout to 15s', 'url': 'n/a', 'fix': 'Command to fix'}
cve_2018_0102 = {'check_name': 'CVE_2018_0102', 'check_type': 'check_two_parameters', 'match1': 'feature pong', 'match2': 'feature-set fabricpath', 'required': 'no', 'result_ok': 'Test successful.', 'result_failed': 'Test failed.', 'info': 'Affected versions: 7.2(2)d1(1), 7.2(2)d1(2), 7.2(1)d(1)', 'url': 'https://www.cvedetails.com/cve/CVE-2018-0102/', 'fix': 'Command to fix'}
cve_2018_0090 = {'check_name': 'CVE_2018_0090', 'check_type': 'check_two_parameters', 'match1': 'cisco Nexus(20|30|55|56|60|70|77)00', 'match2': 'access-list', 'required': 'no', 'result_ok': 'Test successful.', 'result_failed': 'Test failed.', 'info': 'Affected versions: 7.3(2)n1(0.6), 8.3(0)kms(0.31), 8.8(3.5)s0', 'url': 'https://www.cvedetails.com/cve/CVE-2018-0090/', 'fix': 'Command to fix'}
cve_2018_0092 = {'check_name': 'CVE_2018_0092', 'check_type': 'check_two_parameters', 'match1': 'cisco Nexus(30|36|90|95)00', 'match2': 'role network-operator', 'required': 'yes', 'result_ok': 'Test successful.', 'result_failed': 'Test failed.', 'info': 'Affected versions: 7.0(3)i5(2), 7.0(3)i6(1), 7.0(3)i7(1)', 'url': 'https://www.cvedetails.com/cve/CVE-2018-0092/', 'fix': 'Command to fix'}
cve_2017_12341 = {'check_name': 'CVE_2017_12341', 'check_type': 'check_in_simple', 'match1': '8.1\\(1\\)|8.2\\(1\\)|8.1\\(0.59\\)s0', 'match2': 'n/a', 'required': 'no', 'result_ok': 'Test successful.', 'result_failed': 'Test failed.', 'info': 'Affected versions: 8.1(1), 8.2(1), 8.1(0.59)s0', 'url': 'https://www.cvedetails.com/cve/CVE-2017-12341/', 'fix': 'Command to fix'}
cve_2017_12331 = {'check_name': 'CVE_2017_12331', 'check_type': 'check_two_parameters', 'match1': 'cisco Nexus(70|77)00', 'match2': '8.1\\(1\\)', 'required': 'no', 'result_ok': 'Test successful.', 'result_failed': 'Test failed.', 'info': 'Affected versions: 8.1(1)', 'url': 'https://www.cvedetails.com/cve/CVE-2017-12331/', 'fix': 'Command to fix'} |
print("What is yas?")
word = input()
def isYas(word):
Yasses = True
state=0
for i in range(len(word)):
if word[i].isalpha():
if state == 0:
if word[i] in ["Y","y"]:
state=1
else:
Yasses = False
elif state == 1:
if word[i] in ["Y","y"]:
state=1
elif word[i] in ["A","a"]:
state=2
else:
Yasses = False
elif state == 2:
if word[i]in ["A","a"]:
state = 2
elif word[i]in ["S","s"]:
state = 3
else:
Yasses = False
elif state == 3:
if word[i]in ["S","s"]:
state = 3
else:
Yasses = False
if state != 3:
Yasses = False
return Yasses
isYas(word)
answer=isYas(word)
print(answer)
| print('What is yas?')
word = input()
def is_yas(word):
yasses = True
state = 0
for i in range(len(word)):
if word[i].isalpha():
if state == 0:
if word[i] in ['Y', 'y']:
state = 1
else:
yasses = False
elif state == 1:
if word[i] in ['Y', 'y']:
state = 1
elif word[i] in ['A', 'a']:
state = 2
else:
yasses = False
elif state == 2:
if word[i] in ['A', 'a']:
state = 2
elif word[i] in ['S', 's']:
state = 3
else:
yasses = False
elif state == 3:
if word[i] in ['S', 's']:
state = 3
else:
yasses = False
if state != 3:
yasses = False
return Yasses
is_yas(word)
answer = is_yas(word)
print(answer) |
class NGram:
# @param {int} n a integer
# @param {str} string a string
def mapper(self, _, n, string):
# Write your code here
# Please use 'yield key, value' here
for i in range(len(string) - n + 1):
yield string[i:i + n], 1
# @param key is from mapper
# @param values is a set of value with the same key
def reducer(self, key, values):
# Write your code here
# Please use 'yield key, value' here
yield key, sum(values)
| class Ngram:
def mapper(self, _, n, string):
for i in range(len(string) - n + 1):
yield (string[i:i + n], 1)
def reducer(self, key, values):
yield (key, sum(values)) |
class Vector:
def __init__(self,x,y):
self.x=x
self.y=y
def __repr__(self):
return str(self.x) +"i, "+ str(self.y)+"j"
def dotProduct(v1,v2):
return v1.x*v2.x + v1.y*v2.y | class Vector:
def __init__(self, x, y):
self.x = x
self.y = y
def __repr__(self):
return str(self.x) + 'i, ' + str(self.y) + 'j'
def dot_product(v1, v2):
return v1.x * v2.x + v1.y * v2.y |
#poly_limit=10
def poly_check(seq,poly_limit):
if 'A'*poly_limit not in seq and 'T'*poly_limit not in seq and 'G'*poly_limit not in seq and 'C'*poly_limit not in seq:
return True
else:
return False
def var_check(change_from, change_to, seq,var_limit):
ALL=['A','T','C','G']
tmp=[]
for one in ALL:
if one !=change_from.upper() and one !=change_to.upper():
tmp.append(one)
flag=1
for one in tmp:
if seq.count(one) < var_limit/(float(len(tmp))+2):
flag=0
if flag==1:
return True
else:
return False
def reverse_base(base):
base=base.upper()
if base=='A':
return 'T'
elif base=='C':
return 'G'
elif base=='G':
return 'C'
elif base=='T':
return 'A'
else:
return 'N'
def recover_sam(sam_in_dir,sam_out_dir, var_limit=20,poly_limit=10,rm_multi=0):
fi=open(sam_in_dir)
fo=open(sam_out_dir,'w')
for line in fi:
seq=line.split('\t')
if line[0]=='@':
fo.write(line)
elif seq[1]=='4' and seq[2]=='*':
break
elif seq[1]!='4' and len(seq)>=9:
seq=line.split('\t')
seq[9]=seq[9].upper()
seq[1]=int(seq[1])
if len(bin(seq[1]))>=7:
if bin(seq[1])[-3]!='1':
if bin(seq[1])[-5]=='1':
seq[1]='16'
else:
seq[1]='0'
seq[1]=str(seq[1])
record=bin(int(seq[0].split('_|_')[2]))[3:]
change_from=seq[0].split('_|_')[1].split('_')[0]
change_to=seq[0].split('_|_')[1].split('_')[2]
if len(bin(int(seq[1]))) > 5 and bin(int(seq[1]))[-5]=='1': #seq[1]=='16':
change_from=reverse_base(change_from)
change_to=reverse_base(change_to)
record=record[::-1]
else:
record=record
changed_read=seq[9]
i=0
recovered_read=''
while i<len(seq[9]):
if record[i]=='1' and seq[9][i]==change_to:
recovered_read += change_from
elif record[i]=='1' and seq[9][i]!=change_to:
#print "recover error in "+seq[0]
recovered_read += 'N'
else:
recovered_read += seq[9][i]
i=i+1
seq[9]=recovered_read
#fo.write(seq[0])
#if len(record)==len(seq[9]) and 'I' not in seq[5] and 'D' not in seq[5] and len(record)-changed_read.count(change_to) > 25 and poly_check(seq[9],poly_limit):
if len(record)==len(seq[9]) and len(record)-changed_read.count(change_to) > var_limit and poly_check(seq[9],poly_limit): #and var_check(change_from,change_to,seq[9],var_limit):
if (rm_multi==1 and "XA:Z:" not in line) or rm_multi==0:
fo.write(seq[0])
j=1
while j<len(seq):
fo.write('\t'+seq[j])
j=j+1
# 1+1
fo.close()
fi.close()
| def poly_check(seq, poly_limit):
if 'A' * poly_limit not in seq and 'T' * poly_limit not in seq and ('G' * poly_limit not in seq) and ('C' * poly_limit not in seq):
return True
else:
return False
def var_check(change_from, change_to, seq, var_limit):
all = ['A', 'T', 'C', 'G']
tmp = []
for one in ALL:
if one != change_from.upper() and one != change_to.upper():
tmp.append(one)
flag = 1
for one in tmp:
if seq.count(one) < var_limit / (float(len(tmp)) + 2):
flag = 0
if flag == 1:
return True
else:
return False
def reverse_base(base):
base = base.upper()
if base == 'A':
return 'T'
elif base == 'C':
return 'G'
elif base == 'G':
return 'C'
elif base == 'T':
return 'A'
else:
return 'N'
def recover_sam(sam_in_dir, sam_out_dir, var_limit=20, poly_limit=10, rm_multi=0):
fi = open(sam_in_dir)
fo = open(sam_out_dir, 'w')
for line in fi:
seq = line.split('\t')
if line[0] == '@':
fo.write(line)
elif seq[1] == '4' and seq[2] == '*':
break
elif seq[1] != '4' and len(seq) >= 9:
seq = line.split('\t')
seq[9] = seq[9].upper()
seq[1] = int(seq[1])
if len(bin(seq[1])) >= 7:
if bin(seq[1])[-3] != '1':
if bin(seq[1])[-5] == '1':
seq[1] = '16'
else:
seq[1] = '0'
seq[1] = str(seq[1])
record = bin(int(seq[0].split('_|_')[2]))[3:]
change_from = seq[0].split('_|_')[1].split('_')[0]
change_to = seq[0].split('_|_')[1].split('_')[2]
if len(bin(int(seq[1]))) > 5 and bin(int(seq[1]))[-5] == '1':
change_from = reverse_base(change_from)
change_to = reverse_base(change_to)
record = record[::-1]
else:
record = record
changed_read = seq[9]
i = 0
recovered_read = ''
while i < len(seq[9]):
if record[i] == '1' and seq[9][i] == change_to:
recovered_read += change_from
elif record[i] == '1' and seq[9][i] != change_to:
recovered_read += 'N'
else:
recovered_read += seq[9][i]
i = i + 1
seq[9] = recovered_read
if len(record) == len(seq[9]) and len(record) - changed_read.count(change_to) > var_limit and poly_check(seq[9], poly_limit):
if rm_multi == 1 and 'XA:Z:' not in line or rm_multi == 0:
fo.write(seq[0])
j = 1
while j < len(seq):
fo.write('\t' + seq[j])
j = j + 1
fo.close()
fi.close() |
x = input()
if x == ".helpf":
print(".help : to show help menu")
| x = input()
if x == '.helpf':
print('.help : to show help menu') |
class Config(object):
SQLALCHEMY_DATABASE_URI = 'sqlite:///app.db'
SQLALCHEMY_TRACK_MODIFICATIONS = False
SECRET_KEY = '1234567890'
SQLALCHEMY_ECHO = False
FLASK_ADMIN_SWATCH = 'united'
if __name__ == '__main__':
for key in Config.__dict__:
print(key, Config.__dict__[key]) | class Config(object):
sqlalchemy_database_uri = 'sqlite:///app.db'
sqlalchemy_track_modifications = False
secret_key = '1234567890'
sqlalchemy_echo = False
flask_admin_swatch = 'united'
if __name__ == '__main__':
for key in Config.__dict__:
print(key, Config.__dict__[key]) |
# https://leetcode.com/problems/generate-a-string-with-characters-that-have-odd-counts
def generate_the_string(n):
if n % 2 == 0:
return 'a' * (n - 1) + 'b'
return 'a' * n | def generate_the_string(n):
if n % 2 == 0:
return 'a' * (n - 1) + 'b'
return 'a' * n |
class Queue2Stacks:
def __init__(self):
self.stack1 = []
self.stack2 = []
def size(self):
return len(self.stack1)
def isEmpty(self):
return self.stack1 == []
def enqueue(self,item):
self.stack1.append(item)
def dequeue(self):
if(self.stack2 != []):
return self.stack2.pop()
else:
if(self.stack1 == []):
return "empty!!"
else:
for x in range(len(self.stack1)):
self.stack2.append(self.stack1.pop())
return self.stack2.pop()
#return out
q = Queue2Stacks()
q.enqueue("h")
q.enqueue("a")
q.enqueue("r")
q.enqueue("s")
q.enqueue("h")
print(q.size())
print(q.dequeue())
print(q.dequeue())
q.enqueue("r")
q.enqueue("a")
q.enqueue("j")
print(q.dequeue())
print(q.dequeue())
print(q.dequeue())
print(q.dequeue())
print(q.dequeue())
print(q.dequeue())
q.enqueue(1)
q.enqueue(2)
q.enqueue(3)
print(q.dequeue())
print(q.dequeue())
print(q.dequeue())
print(q.dequeue()) | class Queue2Stacks:
def __init__(self):
self.stack1 = []
self.stack2 = []
def size(self):
return len(self.stack1)
def is_empty(self):
return self.stack1 == []
def enqueue(self, item):
self.stack1.append(item)
def dequeue(self):
if self.stack2 != []:
return self.stack2.pop()
elif self.stack1 == []:
return 'empty!!'
else:
for x in range(len(self.stack1)):
self.stack2.append(self.stack1.pop())
return self.stack2.pop()
q = queue2_stacks()
q.enqueue('h')
q.enqueue('a')
q.enqueue('r')
q.enqueue('s')
q.enqueue('h')
print(q.size())
print(q.dequeue())
print(q.dequeue())
q.enqueue('r')
q.enqueue('a')
q.enqueue('j')
print(q.dequeue())
print(q.dequeue())
print(q.dequeue())
print(q.dequeue())
print(q.dequeue())
print(q.dequeue())
q.enqueue(1)
q.enqueue(2)
q.enqueue(3)
print(q.dequeue())
print(q.dequeue())
print(q.dequeue())
print(q.dequeue()) |
def gen_counter(cnt=None):
res = 0
while True:
yield res
res += 1 if cnt is None else cnt
if __name__=='__main__':
cnt = gen_counter()
print(next(cnt))
print(next(cnt))
print(next(cnt))
print(next(cnt))
print(next(cnt))
cnt = gen_counter(5)
print(next(cnt))
print(next(cnt))
print(next(cnt))
print(next(cnt))
print(next(cnt))
| def gen_counter(cnt=None):
res = 0
while True:
yield res
res += 1 if cnt is None else cnt
if __name__ == '__main__':
cnt = gen_counter()
print(next(cnt))
print(next(cnt))
print(next(cnt))
print(next(cnt))
print(next(cnt))
cnt = gen_counter(5)
print(next(cnt))
print(next(cnt))
print(next(cnt))
print(next(cnt))
print(next(cnt)) |
#
# PySNMP MIB module NBS-MIB (http://snmplabs.com/pysmi)
# ASN.1 source file:///Users/davwang4/Dev/mibs.snmplabs.com/asn1/NBS-MIB
# Produced by pysmi-0.3.4 at Mon Apr 29 20:07:17 2019
# On host DAVWANG4-M-1475 platform Darwin version 18.5.0 by user davwang4
# Using Python version 3.7.3 (default, Mar 27 2019, 09:23:15)
#
ObjectIdentifier, Integer, OctetString = mibBuilder.importSymbols("ASN1", "ObjectIdentifier", "Integer", "OctetString")
NamedValues, = mibBuilder.importSymbols("ASN1-ENUMERATION", "NamedValues")
SingleValueConstraint, ValueRangeConstraint, ValueSizeConstraint, ConstraintsUnion, ConstraintsIntersection = mibBuilder.importSymbols("ASN1-REFINEMENT", "SingleValueConstraint", "ValueRangeConstraint", "ValueSizeConstraint", "ConstraintsUnion", "ConstraintsIntersection")
ModuleCompliance, NotificationGroup = mibBuilder.importSymbols("SNMPv2-CONF", "ModuleCompliance", "NotificationGroup")
IpAddress, Integer32, MibScalar, MibTable, MibTableRow, MibTableColumn, ObjectIdentity, Unsigned32, enterprises, iso, NotificationType, TimeTicks, Counter32, MibIdentifier, Bits, Counter64, Gauge32, ModuleIdentity = mibBuilder.importSymbols("SNMPv2-SMI", "IpAddress", "Integer32", "MibScalar", "MibTable", "MibTableRow", "MibTableColumn", "ObjectIdentity", "Unsigned32", "enterprises", "iso", "NotificationType", "TimeTicks", "Counter32", "MibIdentifier", "Bits", "Counter64", "Gauge32", "ModuleIdentity")
DisplayString, TextualConvention = mibBuilder.importSymbols("SNMPv2-TC", "DisplayString", "TextualConvention")
nbsMib = ModuleIdentity((1, 3, 6, 1, 4, 1, 629, 250))
if mibBuilder.loadTexts: nbsMib.setLastUpdated('201309170000Z')
if mibBuilder.loadTexts: nbsMib.setOrganization('NBS')
nbs = ObjectIdentity((1, 3, 6, 1, 4, 1, 629))
if mibBuilder.loadTexts: nbs.setStatus('current')
class Unsigned16(TextualConvention, Integer32):
status = 'current'
subtypeSpec = Integer32.subtypeSpec + ValueRangeConstraint(0, 65535)
class Unsigned64(TextualConvention, Counter64):
status = 'current'
class WritableU64(TextualConvention, OctetString):
status = 'current'
subtypeSpec = OctetString.subtypeSpec + ValueSizeConstraint(8, 8)
fixedLength = 8
class NbsTcTemperature(TextualConvention, Integer32):
status = 'current'
subtypeSpec = Integer32.subtypeSpec + ValueRangeConstraint(-2147483648, 1000)
class NbsTcMilliVolt(TextualConvention, Integer32):
status = 'current'
subtypeSpec = Integer32.subtypeSpec + ValueRangeConstraint(-1, 1000000)
class NbsTcMilliAmp(TextualConvention, Integer32):
status = 'current'
subtypeSpec = Integer32.subtypeSpec + ValueRangeConstraint(-1, 1000000)
class NbsTcMicroAmp(TextualConvention, Integer32):
status = 'current'
subtypeSpec = Integer32.subtypeSpec + ValueRangeConstraint(-1, 2147483647)
class NbsTcMilliDb(TextualConvention, Integer32):
status = 'current'
subtypeSpec = Integer32.subtypeSpec + ValueRangeConstraint(-2147483648, 100000)
class NbsTcMilliWatts(TextualConvention, Integer32):
status = 'current'
class NbsTcMHz(TextualConvention, Unsigned32):
status = 'current'
subtypeSpec = Unsigned32.subtypeSpec + ValueRangeConstraint(1, 4294967295)
class NbsTcStatusSimple(TextualConvention, Integer32):
status = 'current'
subtypeSpec = Integer32.subtypeSpec + ConstraintsUnion(SingleValueConstraint(1, 2, 3, 4))
namedValues = NamedValues(("notSupported", 1), ("bad", 2), ("good", 3), ("notInstalled", 4))
class NbsTcStatusLevel(TextualConvention, Integer32):
status = 'current'
subtypeSpec = Integer32.subtypeSpec + ConstraintsUnion(SingleValueConstraint(1, 2, 3, 4, 5, 6))
namedValues = NamedValues(("notSupported", 1), ("statusLowError", 2), ("statusLowWarning", 3), ("statusGood", 4), ("statusHighWarning", 5), ("statusHighError", 6))
class NbsTcPartIndex(TextualConvention, Unsigned32):
status = 'current'
class NbsTcStagingCommit(TextualConvention, Integer32):
status = 'current'
subtypeSpec = Integer32.subtypeSpec + ConstraintsUnion(SingleValueConstraint(1, 2, 3, 4))
namedValues = NamedValues(("notSupported", 1), ("supported", 2), ("revertToCommitted", 3), ("apply", 4))
mibBuilder.exportSymbols("NBS-MIB", NbsTcStatusLevel=NbsTcStatusLevel, NbsTcPartIndex=NbsTcPartIndex, NbsTcStagingCommit=NbsTcStagingCommit, NbsTcMilliVolt=NbsTcMilliVolt, NbsTcTemperature=NbsTcTemperature, NbsTcMilliWatts=NbsTcMilliWatts, WritableU64=WritableU64, NbsTcMHz=NbsTcMHz, NbsTcStatusSimple=NbsTcStatusSimple, Unsigned16=Unsigned16, nbsMib=nbsMib, PYSNMP_MODULE_ID=nbsMib, nbs=nbs, NbsTcMilliAmp=NbsTcMilliAmp, NbsTcMicroAmp=NbsTcMicroAmp, Unsigned64=Unsigned64, NbsTcMilliDb=NbsTcMilliDb)
| (object_identifier, integer, octet_string) = mibBuilder.importSymbols('ASN1', 'ObjectIdentifier', 'Integer', 'OctetString')
(named_values,) = mibBuilder.importSymbols('ASN1-ENUMERATION', 'NamedValues')
(single_value_constraint, value_range_constraint, value_size_constraint, constraints_union, constraints_intersection) = mibBuilder.importSymbols('ASN1-REFINEMENT', 'SingleValueConstraint', 'ValueRangeConstraint', 'ValueSizeConstraint', 'ConstraintsUnion', 'ConstraintsIntersection')
(module_compliance, notification_group) = mibBuilder.importSymbols('SNMPv2-CONF', 'ModuleCompliance', 'NotificationGroup')
(ip_address, integer32, mib_scalar, mib_table, mib_table_row, mib_table_column, object_identity, unsigned32, enterprises, iso, notification_type, time_ticks, counter32, mib_identifier, bits, counter64, gauge32, module_identity) = mibBuilder.importSymbols('SNMPv2-SMI', 'IpAddress', 'Integer32', 'MibScalar', 'MibTable', 'MibTableRow', 'MibTableColumn', 'ObjectIdentity', 'Unsigned32', 'enterprises', 'iso', 'NotificationType', 'TimeTicks', 'Counter32', 'MibIdentifier', 'Bits', 'Counter64', 'Gauge32', 'ModuleIdentity')
(display_string, textual_convention) = mibBuilder.importSymbols('SNMPv2-TC', 'DisplayString', 'TextualConvention')
nbs_mib = module_identity((1, 3, 6, 1, 4, 1, 629, 250))
if mibBuilder.loadTexts:
nbsMib.setLastUpdated('201309170000Z')
if mibBuilder.loadTexts:
nbsMib.setOrganization('NBS')
nbs = object_identity((1, 3, 6, 1, 4, 1, 629))
if mibBuilder.loadTexts:
nbs.setStatus('current')
class Unsigned16(TextualConvention, Integer32):
status = 'current'
subtype_spec = Integer32.subtypeSpec + value_range_constraint(0, 65535)
class Unsigned64(TextualConvention, Counter64):
status = 'current'
class Writableu64(TextualConvention, OctetString):
status = 'current'
subtype_spec = OctetString.subtypeSpec + value_size_constraint(8, 8)
fixed_length = 8
class Nbstctemperature(TextualConvention, Integer32):
status = 'current'
subtype_spec = Integer32.subtypeSpec + value_range_constraint(-2147483648, 1000)
class Nbstcmillivolt(TextualConvention, Integer32):
status = 'current'
subtype_spec = Integer32.subtypeSpec + value_range_constraint(-1, 1000000)
class Nbstcmilliamp(TextualConvention, Integer32):
status = 'current'
subtype_spec = Integer32.subtypeSpec + value_range_constraint(-1, 1000000)
class Nbstcmicroamp(TextualConvention, Integer32):
status = 'current'
subtype_spec = Integer32.subtypeSpec + value_range_constraint(-1, 2147483647)
class Nbstcmillidb(TextualConvention, Integer32):
status = 'current'
subtype_spec = Integer32.subtypeSpec + value_range_constraint(-2147483648, 100000)
class Nbstcmilliwatts(TextualConvention, Integer32):
status = 'current'
class Nbstcmhz(TextualConvention, Unsigned32):
status = 'current'
subtype_spec = Unsigned32.subtypeSpec + value_range_constraint(1, 4294967295)
class Nbstcstatussimple(TextualConvention, Integer32):
status = 'current'
subtype_spec = Integer32.subtypeSpec + constraints_union(single_value_constraint(1, 2, 3, 4))
named_values = named_values(('notSupported', 1), ('bad', 2), ('good', 3), ('notInstalled', 4))
class Nbstcstatuslevel(TextualConvention, Integer32):
status = 'current'
subtype_spec = Integer32.subtypeSpec + constraints_union(single_value_constraint(1, 2, 3, 4, 5, 6))
named_values = named_values(('notSupported', 1), ('statusLowError', 2), ('statusLowWarning', 3), ('statusGood', 4), ('statusHighWarning', 5), ('statusHighError', 6))
class Nbstcpartindex(TextualConvention, Unsigned32):
status = 'current'
class Nbstcstagingcommit(TextualConvention, Integer32):
status = 'current'
subtype_spec = Integer32.subtypeSpec + constraints_union(single_value_constraint(1, 2, 3, 4))
named_values = named_values(('notSupported', 1), ('supported', 2), ('revertToCommitted', 3), ('apply', 4))
mibBuilder.exportSymbols('NBS-MIB', NbsTcStatusLevel=NbsTcStatusLevel, NbsTcPartIndex=NbsTcPartIndex, NbsTcStagingCommit=NbsTcStagingCommit, NbsTcMilliVolt=NbsTcMilliVolt, NbsTcTemperature=NbsTcTemperature, NbsTcMilliWatts=NbsTcMilliWatts, WritableU64=WritableU64, NbsTcMHz=NbsTcMHz, NbsTcStatusSimple=NbsTcStatusSimple, Unsigned16=Unsigned16, nbsMib=nbsMib, PYSNMP_MODULE_ID=nbsMib, nbs=nbs, NbsTcMilliAmp=NbsTcMilliAmp, NbsTcMicroAmp=NbsTcMicroAmp, Unsigned64=Unsigned64, NbsTcMilliDb=NbsTcMilliDb) |
def test_calculator_add_returns_correct_result():
result = calc_add(2,2)
assert result == 4
# def calc_add(x,y):
# pass
# return x+y
# if isinstance(x, number_types) and isinstance(y, number_types):
# return x + y
# else:
# raise ValueError("Non-numeric input given")
# def test_calculator_returns_error_message_if_both_args_not_numbers():
# try:
# calc_add("two", "three")
# except ValueError:
# print("Exception caught")
# assert True, "Fail: ValueError exception not caught"
# except:
# assert False, "Fail: Exception other than ValueError caught"
# else:
# assert False, "Fail: No exception caught"
# def test_calculator_returns_error_message_if_both_args_not_numbers():
# with pytest.raises(ValueError):
# calc_add("two", "three")
# def test_calculator_returns_error_message_if_x_arg_not_number():
# with pytest.raises(ValueError):
# calc_add("two", 3)
# def test_calculator_returns_error_message_if_y_arg_not_number( ):
# with pytest.raises(ValueError):
# calc_add(2, "three") | def test_calculator_add_returns_correct_result():
result = calc_add(2, 2)
assert result == 4 |
def getGroupCount(line):
#print("Line "+line)
curSet = set(())
for curChar in line:
curSet.add(curChar)
#print("Set: "+str(curSet))
return len(curSet)
filename = "inputs\\2020\\input-day6.txt"
with open(filename) as f:
lines = f.readlines()
group = ""
sum = 0
for line in lines:
if len(line.strip()) == 0:
sum += getGroupCount(group.strip())
group = ""
else:
group += line.strip()
sum += getGroupCount(group.strip())
print("Sum: "+str(sum)) | def get_group_count(line):
cur_set = set(())
for cur_char in line:
curSet.add(curChar)
return len(curSet)
filename = 'inputs\\2020\\input-day6.txt'
with open(filename) as f:
lines = f.readlines()
group = ''
sum = 0
for line in lines:
if len(line.strip()) == 0:
sum += get_group_count(group.strip())
group = ''
else:
group += line.strip()
sum += get_group_count(group.strip())
print('Sum: ' + str(sum)) |
def up_array(arr):
if not arr:
return None
else:
string = ''
for item in arr:
if not str(item).isdigit() or item > 9:
return None
else:
string += str(item)
total = []
for char in str(int(string)+1):
total.append(int(char))
return total | def up_array(arr):
if not arr:
return None
else:
string = ''
for item in arr:
if not str(item).isdigit() or item > 9:
return None
else:
string += str(item)
total = []
for char in str(int(string) + 1):
total.append(int(char))
return total |
def findDecision(obj): #obj[0]: Passanger, obj[1]: Weather, obj[2]: Time, obj[3]: Coupon, obj[4]: Coupon_validity, obj[5]: Gender, obj[6]: Age, obj[7]: Maritalstatus, obj[8]: Children, obj[9]: Education, obj[10]: Occupation, obj[11]: Income, obj[12]: Bar, obj[13]: Coffeehouse, obj[14]: Restaurant20to50, obj[15]: Direction_same, obj[16]: Distance
# {"feature": "Occupation", "instances": 85, "metric_value": 0.9879, "depth": 1}
if obj[10]<=19:
# {"feature": "Education", "instances": 80, "metric_value": 0.971, "depth": 2}
if obj[9]<=2:
# {"feature": "Restaurant20to50", "instances": 60, "metric_value": 0.9183, "depth": 3}
if obj[14]<=2.0:
# {"feature": "Maritalstatus", "instances": 56, "metric_value": 0.9403, "depth": 4}
if obj[7]>0:
# {"feature": "Age", "instances": 37, "metric_value": 0.9868, "depth": 5}
if obj[6]<=4:
# {"feature": "Time", "instances": 33, "metric_value": 0.9993, "depth": 6}
if obj[2]<=3:
# {"feature": "Bar", "instances": 25, "metric_value": 0.9896, "depth": 7}
if obj[12]>0.0:
# {"feature": "Coupon", "instances": 14, "metric_value": 0.8631, "depth": 8}
if obj[3]>0:
# {"feature": "Income", "instances": 13, "metric_value": 0.7793, "depth": 9}
if obj[11]<=3:
# {"feature": "Distance", "instances": 10, "metric_value": 0.8813, "depth": 10}
if obj[16]<=2:
# {"feature": "Coffeehouse", "instances": 8, "metric_value": 0.9544, "depth": 11}
if obj[13]>1.0:
# {"feature": "Coupon_validity", "instances": 5, "metric_value": 0.7219, "depth": 12}
if obj[4]>0:
return 'False'
elif obj[4]<=0:
# {"feature": "Passanger", "instances": 2, "metric_value": 1.0, "depth": 13}
if obj[0]<=1:
# {"feature": "Weather", "instances": 2, "metric_value": 1.0, "depth": 14}
if obj[1]<=0:
# {"feature": "Gender", "instances": 2, "metric_value": 1.0, "depth": 15}
if obj[5]<=0:
# {"feature": "Children", "instances": 2, "metric_value": 1.0, "depth": 16}
if obj[8]<=0:
# {"feature": "Direction_same", "instances": 2, "metric_value": 1.0, "depth": 17}
if obj[15]<=0:
return 'True'
else: return 'True'
else: return 'True'
else: return 'True'
else: return 'True'
else: return 'True'
else: return 'True'
elif obj[13]<=1.0:
# {"feature": "Gender", "instances": 3, "metric_value": 0.9183, "depth": 12}
if obj[5]<=0:
return 'True'
elif obj[5]>0:
return 'False'
else: return 'False'
else: return 'True'
elif obj[16]>2:
return 'False'
else: return 'False'
elif obj[11]>3:
return 'False'
else: return 'False'
elif obj[3]<=0:
return 'True'
else: return 'True'
elif obj[12]<=0.0:
# {"feature": "Income", "instances": 11, "metric_value": 0.9457, "depth": 8}
if obj[11]<=6:
# {"feature": "Distance", "instances": 6, "metric_value": 0.9183, "depth": 9}
if obj[16]<=1:
return 'False'
elif obj[16]>1:
# {"feature": "Coupon", "instances": 3, "metric_value": 0.9183, "depth": 10}
if obj[3]>0:
return 'True'
elif obj[3]<=0:
return 'False'
else: return 'False'
else: return 'True'
elif obj[11]>6:
return 'True'
else: return 'True'
else: return 'True'
elif obj[2]>3:
# {"feature": "Coffeehouse", "instances": 8, "metric_value": 0.8113, "depth": 7}
if obj[13]>0.0:
return 'True'
elif obj[13]<=0.0:
# {"feature": "Passanger", "instances": 3, "metric_value": 0.9183, "depth": 8}
if obj[0]<=1:
return 'False'
elif obj[0]>1:
return 'True'
else: return 'True'
else: return 'False'
else: return 'True'
elif obj[6]>4:
return 'True'
else: return 'True'
elif obj[7]<=0:
# {"feature": "Gender", "instances": 19, "metric_value": 0.7425, "depth": 5}
if obj[5]>0:
# {"feature": "Coffeehouse", "instances": 11, "metric_value": 0.9457, "depth": 6}
if obj[13]<=1.0:
# {"feature": "Distance", "instances": 6, "metric_value": 0.9183, "depth": 7}
if obj[16]<=2:
# {"feature": "Passanger", "instances": 5, "metric_value": 0.7219, "depth": 8}
if obj[0]<=1:
return 'False'
elif obj[0]>1:
# {"feature": "Time", "instances": 2, "metric_value": 1.0, "depth": 9}
if obj[2]>2:
return 'False'
elif obj[2]<=2:
return 'True'
else: return 'True'
else: return 'False'
elif obj[16]>2:
return 'True'
else: return 'True'
elif obj[13]>1.0:
return 'True'
else: return 'True'
elif obj[5]<=0:
return 'True'
else: return 'True'
else: return 'True'
elif obj[14]>2.0:
return 'True'
else: return 'True'
elif obj[9]>2:
# {"feature": "Coffeehouse", "instances": 20, "metric_value": 0.971, "depth": 3}
if obj[13]>1.0:
# {"feature": "Gender", "instances": 15, "metric_value": 0.9968, "depth": 4}
if obj[5]>0:
# {"feature": "Income", "instances": 11, "metric_value": 0.9457, "depth": 5}
if obj[11]<=5:
# {"feature": "Direction_same", "instances": 9, "metric_value": 0.7642, "depth": 6}
if obj[15]<=0:
# {"feature": "Distance", "instances": 8, "metric_value": 0.5436, "depth": 7}
if obj[16]>1:
return 'False'
elif obj[16]<=1:
return 'True'
else: return 'True'
elif obj[15]>0:
return 'True'
else: return 'True'
elif obj[11]>5:
return 'True'
else: return 'True'
elif obj[5]<=0:
return 'True'
else: return 'True'
elif obj[13]<=1.0:
return 'False'
else: return 'False'
else: return 'False'
elif obj[10]>19:
return 'False'
else: return 'False'
| def find_decision(obj):
if obj[10] <= 19:
if obj[9] <= 2:
if obj[14] <= 2.0:
if obj[7] > 0:
if obj[6] <= 4:
if obj[2] <= 3:
if obj[12] > 0.0:
if obj[3] > 0:
if obj[11] <= 3:
if obj[16] <= 2:
if obj[13] > 1.0:
if obj[4] > 0:
return 'False'
elif obj[4] <= 0:
if obj[0] <= 1:
if obj[1] <= 0:
if obj[5] <= 0:
if obj[8] <= 0:
if obj[15] <= 0:
return 'True'
else:
return 'True'
else:
return 'True'
else:
return 'True'
else:
return 'True'
else:
return 'True'
else:
return 'True'
elif obj[13] <= 1.0:
if obj[5] <= 0:
return 'True'
elif obj[5] > 0:
return 'False'
else:
return 'False'
else:
return 'True'
elif obj[16] > 2:
return 'False'
else:
return 'False'
elif obj[11] > 3:
return 'False'
else:
return 'False'
elif obj[3] <= 0:
return 'True'
else:
return 'True'
elif obj[12] <= 0.0:
if obj[11] <= 6:
if obj[16] <= 1:
return 'False'
elif obj[16] > 1:
if obj[3] > 0:
return 'True'
elif obj[3] <= 0:
return 'False'
else:
return 'False'
else:
return 'True'
elif obj[11] > 6:
return 'True'
else:
return 'True'
else:
return 'True'
elif obj[2] > 3:
if obj[13] > 0.0:
return 'True'
elif obj[13] <= 0.0:
if obj[0] <= 1:
return 'False'
elif obj[0] > 1:
return 'True'
else:
return 'True'
else:
return 'False'
else:
return 'True'
elif obj[6] > 4:
return 'True'
else:
return 'True'
elif obj[7] <= 0:
if obj[5] > 0:
if obj[13] <= 1.0:
if obj[16] <= 2:
if obj[0] <= 1:
return 'False'
elif obj[0] > 1:
if obj[2] > 2:
return 'False'
elif obj[2] <= 2:
return 'True'
else:
return 'True'
else:
return 'False'
elif obj[16] > 2:
return 'True'
else:
return 'True'
elif obj[13] > 1.0:
return 'True'
else:
return 'True'
elif obj[5] <= 0:
return 'True'
else:
return 'True'
else:
return 'True'
elif obj[14] > 2.0:
return 'True'
else:
return 'True'
elif obj[9] > 2:
if obj[13] > 1.0:
if obj[5] > 0:
if obj[11] <= 5:
if obj[15] <= 0:
if obj[16] > 1:
return 'False'
elif obj[16] <= 1:
return 'True'
else:
return 'True'
elif obj[15] > 0:
return 'True'
else:
return 'True'
elif obj[11] > 5:
return 'True'
else:
return 'True'
elif obj[5] <= 0:
return 'True'
else:
return 'True'
elif obj[13] <= 1.0:
return 'False'
else:
return 'False'
else:
return 'False'
elif obj[10] > 19:
return 'False'
else:
return 'False' |
###Database
#database typy Option:(mongodb, mysql, redis)
DB_TYPE = 'mongdb'
#database ip
DB_HOST = 'localhost'
#database port
DB_PORT = '1'
#username
#USERNAME = None
#passward
#PASSWARD = None
#database name
DB_DBNAME = 'quickspy'
###
| db_type = 'mongdb'
db_host = 'localhost'
db_port = '1'
db_dbname = 'quickspy' |
x = 1
while True:
x = input("Number:\n> ")
if int(x) == 0:
break
| x = 1
while True:
x = input('Number:\n> ')
if int(x) == 0:
break |
#!/usr/bin/env python
# coding: utf-8
# # *section 4: Strings*
#
# ### writer : Faranak Alikhah 1954128
# ### 12.Check Subset:
#
#
# In[ ]:
num_testCase=int(input())
for i in range(num_testCase):
num_testCase1=int(input())
a=set(input().split())
num_testCase2=int(input())
b=set(input().split())
print(a.issubset(b))
#
| num_test_case = int(input())
for i in range(num_testCase):
num_test_case1 = int(input())
a = set(input().split())
num_test_case2 = int(input())
b = set(input().split())
print(a.issubset(b)) |
# Exercise 105 - Parsing and Generating Dictionaries
'''Write a program that has a grades() function that can receive multiple grades
from students and will return a dictionary with the following information:
- Number of notes
- The highest grade
- The lowest grade
- The class average
- The situation (optional)
Also add the docstrings of this function for query by the developer.'''
| """Write a program that has a grades() function that can receive multiple grades
from students and will return a dictionary with the following information:
- Number of notes
- The highest grade
- The lowest grade
- The class average
- The situation (optional)
Also add the docstrings of this function for query by the developer.""" |
# Test case for PR#183; print of a recursive PyStringMap causes a JVM stack
# overflow.
g = globals()
print(g)
| g = globals()
print(g) |
###########################################################################
#
# Copyright 2019 Google Inc.
#
# Licensed under the Apache License, Version 2.0 (the "License");
# you may not use this file except in compliance with the License.
# You may obtain a copy of the License at
#
# https://www.apache.org/licenses/LICENSE-2.0
#
# Unless required by applicable law or agreed to in writing, software
# distributed under the License is distributed on an "AS IS" BASIS,
# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
# See the License for the specific language governing permissions and
# limitations under the License.
#
###########################################################################
CUSTOM_DIMENSION_SCHEMA = [{
'name': 'accountName',
'type': 'STRING'
}, {
'name': 'accountId',
'type': 'STRING'
}, {
'name': 'propertyName',
'type': 'STRING'
}, {
'name': 'propertyId',
'type': 'STRING'
}, {
'name': 'id',
'type': 'STRING'
}, {
'name': 'name',
'type': 'STRING'
}, {
'name': 'index',
'type': 'STRING'
}, {
'name': 'scope',
'type': 'STRING'
}, {
'name': 'active',
'type': 'STRING'
}, {
'name': 'created',
'type': 'TIMESTAMP'
}, {
'name': 'updated',
'type': 'TIMESTAMP'
}, {
'name': 'date',
'type': 'DATE'
}, {
'name': 'selfLink',
'type': 'STRING'
}]
CUSTOM_METRIC_SCHEMA = [{
'name': 'accountName',
'type': 'STRING'
}, {
'name': 'accountId',
'type': 'STRING'
}, {
'name': 'propertyName',
'type': 'STRING'
}, {
'name': 'propertyId',
'type': 'STRING'
}, {
'name': 'id',
'type': 'STRING'
}, {
'name': 'name',
'type': 'STRING'
}, {
'name': 'index',
'type': 'STRING'
}, {
'name': 'scope',
'type': 'STRING'
}, {
'name': 'active',
'type': 'STRING'
}, {
'name': 'created',
'type': 'TIMESTAMP'
}, {
'name': 'updated',
'type': 'TIMESTAMP'
}, {
'name': 'date',
'type': 'DATE'
}, {
'name': 'selfLink',
'type': 'STRING'
}, {
'name': 'type',
'type': 'STRING'
}, {
'name': 'min_value',
'type': 'INTEGER'
}, {
'name': 'max_value',
'type': 'INTEGER'
}]
VIEW_SCHEMA = [{
'name': 'date',
'type': 'DATE'
}, {
'name': 'id',
'type': 'STRING'
}, {
'name': 'selfLink',
'type': 'STRING'
}, {
'name': 'accountId',
'type': 'STRING'
}, {
'name': 'webPropertyId',
'type': 'STRING'
}, {
'name': 'accountName',
'type': 'STRING'
}, {
'name': 'webPropertyName',
'type': 'STRING'
}, {
'name': 'name',
'type': 'STRING'
}, {
'name': 'currency',
'type': 'STRING'
}, {
'name': 'timezone',
'type': 'STRING'
}, {
'name': 'websiteUrl',
'type': 'STRING'
}, {
'name': 'defaultPage',
'type': 'STRING'
}, {
'name': 'excludeQueryParameters',
'type': 'STRING'
}, {
'name': 'siteSearchQueryParameters',
'type': 'STRING'
}, {
'name': 'stripSiteSearchQueryParameters',
'type': 'BOOLEAN'
}, {
'name': 'siteSearchCategoryParameters',
'type': 'STRING'
}, {
'name': 'stripSiteSearchCategoryParameters',
'type': 'BOOLEAN'
}, {
'name': 'type',
'type': 'STRING'
}, {
'name': 'created',
'type': 'TIMESTAMP'
}, {
'name': 'updated',
'type': 'TIMESTAMP'
}, {
'name': 'eCommerceTracking',
'type': 'BOOLEAN'
}, {
'name': 'enhancedECommerceTracking',
'type': 'BOOLEAN'
}, {
'name': 'botFilteringEnabled',
'type': 'BOOLEAN'
}, {
'name': 'starred',
'type': 'BOOLEAN'
}]
GOAL_SCHEMA = [{
'name': 'date',
'type': 'DATE'
}, {
'name': 'id',
'type': 'STRING'
}, {
'name': 'accountId',
'type': 'STRING'
}, {
'name': 'webPropertyId',
'type': 'STRING'
}, {
'name': 'internalWebPropertyId',
'type': 'STRING'
}, {
'name': 'profileId',
'type': 'STRING'
}, {
'name': 'name',
'type': 'STRING'
}, {
'name': 'accountName',
'type': 'STRING'
}, {
'name': 'webPropertyName',
'type': 'STRING'
}, {
'name': 'profileName',
'type': 'STRING'
}, {
'name': 'value',
'type': 'FLOAT'
}, {
'name': 'active',
'type': 'BOOLEAN'
}, {
'name': 'type',
'type': 'STRING'
}, {
'name': 'created',
'type': 'TIMESTAMP'
}, {
'name': 'updated',
'type': 'TIMESTAMP'
}, {
'name':
'urlDestinationDetails',
'type':
'RECORD',
'fields': [{
'name': 'url',
'type': 'STRING'
}, {
'name': 'caseSensitive',
'type': 'BOOLEAN'
}, {
'name': 'matchType',
'type': 'STRING'
}, {
'name': 'firstStepRequired',
'type': 'BOOLEAN'
}, {
'name':
'steps',
'type':
'RECORD',
'mode':
'REPEATED',
'fields': [{
'name': 'number',
'type': 'INTEGER'
}, {
'name': 'name',
'type': 'STRING'
}, {
'name': 'url',
'type': 'STRING'
}]
}]
}, {
'name':
'visitTimeOnSiteDetails',
'type':
'RECORD',
'fields': [{
'name': 'comparisonType',
'type': 'STRING'
}, {
'name': 'comparisonValue',
'type': 'STRING'
}]
}, {
'name':
'visitNumPagesDetails',
'type':
'RECORD',
'fields': [{
'name': 'comparisonType',
'type': 'STRING'
}, {
'name': 'comparisonValue',
'type': 'STRING'
}]
}, {
'name':
'eventDetails',
'type':
'RECORD',
'fields': [{
'name': 'useEventValue',
'type': 'BOOLEAN'
}, {
'name':
'eventConditions',
'mode':
'REPEATED',
'type':
'RECORD',
'fields': [{
'name': 'type',
'type': 'STRING'
}, {
'name': 'matchType',
'type': 'STRING'
}, {
'name': 'expression',
'type': 'STRING'
}, {
'name': 'comparisonType',
'type': 'STRING'
}, {
'name': 'comparisonValue',
'type': 'STRING'
}]
}]
}]
GOOGLE_ADS_LINK_SCHEMA = [{
'name': 'date',
'type': 'DATE'
}, {
'name': 'id',
'type': 'STRING'
}, {
'name': 'kind',
'type': 'STRING'
}, {
'name': 'selfLink',
'type': 'STRING'
}, {
'name':
'entity',
'type':
'RECORD',
'fields': [{
'name':
'webPropertyRef',
'type':
'RECORD',
'fields': [{
'name': 'id',
'type': 'STRING'
}, {
'name': 'kind',
'type': 'STRING'
}, {
'name': 'href',
'type': 'STRING'
}, {
'name': 'accountId',
'type': 'STRING'
}, {
'name': 'internalWebPropertyId',
'type': 'STRING'
}, {
'name': 'name',
'type': 'STRING'
}]
}]
}, {
'name':
'adWordsAccounts',
'type':
'RECORD',
'mode':
'REPEATED',
'fields': [{
'name': 'kind',
'type': 'STRING'
}, {
'name': 'customerId',
'type': 'STRING'
}, {
'name': 'autoTaggingEnabled',
'type': 'BOOLEAN'
}]
}, {
'name': 'name',
'type': 'STRING'
}, {
'name': 'profileIds',
'type': 'RECORD',
'mode': 'REPEATED',
'fields': [{
'name': 'id',
'type': 'STRING'
}]
}]
REMARKETING_AUDIENCE_SCHEMA = [{
'name': 'date',
'type': 'DATE'
}, {
'name': 'kind',
'type': 'STRING'
}, {
'name': 'id',
'type': 'STRING'
}, {
'name': 'accountId',
'type': 'STRING'
}, {
'name': 'webPropertyId',
'type': 'STRING'
}, {
'name': 'webPropertyName',
'type': 'STRING'
}, {
'name': 'accountName',
'type': 'STRING'
}, {
'name': 'internalWebPropertyId',
'type': 'STRING'
}, {
'name': 'created',
'type': 'TIMESTAMP'
}, {
'name': 'updated',
'type': 'TIMESTAMP'
}, {
'name': 'name',
'type': 'STRING'
}, {
'name': 'description',
'type': 'STRING'
}, {
'name':
'linkedAdAccounts',
'mode':
'REPEATED',
'type':
'RECORD',
'fields': [{
'name': 'kind',
'type': 'STRING'
}, {
'name': 'id',
'type': 'STRING'
}, {
'name': 'accountId',
'type': 'STRING'
}, {
'name': 'webPropertyId',
'type': 'STRING'
}, {
'name': 'internalWebPropertyId',
'type': 'STRING'
}, {
'name': 'remarketingAudienceId',
'type': 'STRING'
}, {
'name': 'linkedAccountId',
'type': 'STRING'
}, {
'name': 'type',
'type': 'STRING'
}, {
'name': 'status',
'type': 'STRING'
}, {
'name': 'eligibleForSearch',
'type': 'BOOLEAN'
}]
}, {
'name': 'linkedViews',
'type': 'RECORD',
'mode': 'REPEATED',
'fields': [{
'name': 'id',
'type': 'STRING'
}]
}, {
'name': 'audienceType',
'type': 'STRING'
}, {
'name':
'audienceDefinition',
'type':
'RECORD',
'fields': [{
'name':
'includeConditions',
'type':
'RECORD',
'fields': [{
'name': 'kind',
'type': 'STRING'
}, {
'name': 'isSmartList',
'type': 'BOOLEAN'
}, {
'name': 'segment',
'type': 'STRING'
}, {
'name': 'membershipDurationDays',
'type': 'INTEGER'
}, {
'name': 'daysToLookBack',
'type': 'INTEGER'
}]
}]
}, {
'name':
'stateBasedAudienceDefinition',
'type':
'RECORD',
'fields': [{
'name':
'includeConditions',
'type':
'RECORD',
'fields': [{
'name': 'kind',
'type': 'STRING'
}, {
'name': 'isSmartList',
'type': 'BOOLEAN'
}, {
'name': 'segment',
'type': 'STRING'
}, {
'name': 'membershipDurationDays',
'type': 'INTEGER'
}, {
'name': 'daysToLookBack',
'type': 'INTEGER'
}]
}, {
'name':
'excludeConditions',
'type':
'RECORD',
'fields': [{
'name': 'segment',
'type': 'STRING'
}, {
'name': 'exclusionDuration',
'type': 'STRING'
}]
}]
}]
ACCOUNT_SUMMARIES_SCHEMA = [{
'name': 'date',
'type': 'DATE'
}, {
'name': 'id',
'type': 'STRING'
}, {
'name': 'kind',
'type': 'STRING'
}, {
'name': 'name',
'type': 'STRING'
}, {
'name': 'starred',
'type': 'BOOLEAN'
}, {
'name':
'webProperties',
'type':
'RECORD',
'mode':
'REPEATED',
'fields': [{
'name': 'kind',
'type': 'STRING'
}, {
'name': 'id',
'type': 'STRING'
}, {
'name': 'name',
'type': 'STRING'
}, {
'name': 'internalWebPropertyId',
'type': 'STRING'
}, {
'name': 'level',
'type': 'STRING'
}, {
'name': 'websiteUrl',
'type': 'STRING'
}, {
'name': 'starred',
'type': 'BOOLEAN'
}, {
'name':
'profiles',
'type':
'RECORD',
'mode':
'REPEATED',
'fields': [
{
'name': 'kind',
'type': 'STRING'
},
{
'name': 'id',
'type': 'STRING'
},
{
'name': 'name',
'type': 'STRING'
},
{
'name': 'type',
'type': 'STRING'
},
{
'name': 'starred',
'type': 'BOOLEAN'
},
]
}]
}]
| custom_dimension_schema = [{'name': 'accountName', 'type': 'STRING'}, {'name': 'accountId', 'type': 'STRING'}, {'name': 'propertyName', 'type': 'STRING'}, {'name': 'propertyId', 'type': 'STRING'}, {'name': 'id', 'type': 'STRING'}, {'name': 'name', 'type': 'STRING'}, {'name': 'index', 'type': 'STRING'}, {'name': 'scope', 'type': 'STRING'}, {'name': 'active', 'type': 'STRING'}, {'name': 'created', 'type': 'TIMESTAMP'}, {'name': 'updated', 'type': 'TIMESTAMP'}, {'name': 'date', 'type': 'DATE'}, {'name': 'selfLink', 'type': 'STRING'}]
custom_metric_schema = [{'name': 'accountName', 'type': 'STRING'}, {'name': 'accountId', 'type': 'STRING'}, {'name': 'propertyName', 'type': 'STRING'}, {'name': 'propertyId', 'type': 'STRING'}, {'name': 'id', 'type': 'STRING'}, {'name': 'name', 'type': 'STRING'}, {'name': 'index', 'type': 'STRING'}, {'name': 'scope', 'type': 'STRING'}, {'name': 'active', 'type': 'STRING'}, {'name': 'created', 'type': 'TIMESTAMP'}, {'name': 'updated', 'type': 'TIMESTAMP'}, {'name': 'date', 'type': 'DATE'}, {'name': 'selfLink', 'type': 'STRING'}, {'name': 'type', 'type': 'STRING'}, {'name': 'min_value', 'type': 'INTEGER'}, {'name': 'max_value', 'type': 'INTEGER'}]
view_schema = [{'name': 'date', 'type': 'DATE'}, {'name': 'id', 'type': 'STRING'}, {'name': 'selfLink', 'type': 'STRING'}, {'name': 'accountId', 'type': 'STRING'}, {'name': 'webPropertyId', 'type': 'STRING'}, {'name': 'accountName', 'type': 'STRING'}, {'name': 'webPropertyName', 'type': 'STRING'}, {'name': 'name', 'type': 'STRING'}, {'name': 'currency', 'type': 'STRING'}, {'name': 'timezone', 'type': 'STRING'}, {'name': 'websiteUrl', 'type': 'STRING'}, {'name': 'defaultPage', 'type': 'STRING'}, {'name': 'excludeQueryParameters', 'type': 'STRING'}, {'name': 'siteSearchQueryParameters', 'type': 'STRING'}, {'name': 'stripSiteSearchQueryParameters', 'type': 'BOOLEAN'}, {'name': 'siteSearchCategoryParameters', 'type': 'STRING'}, {'name': 'stripSiteSearchCategoryParameters', 'type': 'BOOLEAN'}, {'name': 'type', 'type': 'STRING'}, {'name': 'created', 'type': 'TIMESTAMP'}, {'name': 'updated', 'type': 'TIMESTAMP'}, {'name': 'eCommerceTracking', 'type': 'BOOLEAN'}, {'name': 'enhancedECommerceTracking', 'type': 'BOOLEAN'}, {'name': 'botFilteringEnabled', 'type': 'BOOLEAN'}, {'name': 'starred', 'type': 'BOOLEAN'}]
goal_schema = [{'name': 'date', 'type': 'DATE'}, {'name': 'id', 'type': 'STRING'}, {'name': 'accountId', 'type': 'STRING'}, {'name': 'webPropertyId', 'type': 'STRING'}, {'name': 'internalWebPropertyId', 'type': 'STRING'}, {'name': 'profileId', 'type': 'STRING'}, {'name': 'name', 'type': 'STRING'}, {'name': 'accountName', 'type': 'STRING'}, {'name': 'webPropertyName', 'type': 'STRING'}, {'name': 'profileName', 'type': 'STRING'}, {'name': 'value', 'type': 'FLOAT'}, {'name': 'active', 'type': 'BOOLEAN'}, {'name': 'type', 'type': 'STRING'}, {'name': 'created', 'type': 'TIMESTAMP'}, {'name': 'updated', 'type': 'TIMESTAMP'}, {'name': 'urlDestinationDetails', 'type': 'RECORD', 'fields': [{'name': 'url', 'type': 'STRING'}, {'name': 'caseSensitive', 'type': 'BOOLEAN'}, {'name': 'matchType', 'type': 'STRING'}, {'name': 'firstStepRequired', 'type': 'BOOLEAN'}, {'name': 'steps', 'type': 'RECORD', 'mode': 'REPEATED', 'fields': [{'name': 'number', 'type': 'INTEGER'}, {'name': 'name', 'type': 'STRING'}, {'name': 'url', 'type': 'STRING'}]}]}, {'name': 'visitTimeOnSiteDetails', 'type': 'RECORD', 'fields': [{'name': 'comparisonType', 'type': 'STRING'}, {'name': 'comparisonValue', 'type': 'STRING'}]}, {'name': 'visitNumPagesDetails', 'type': 'RECORD', 'fields': [{'name': 'comparisonType', 'type': 'STRING'}, {'name': 'comparisonValue', 'type': 'STRING'}]}, {'name': 'eventDetails', 'type': 'RECORD', 'fields': [{'name': 'useEventValue', 'type': 'BOOLEAN'}, {'name': 'eventConditions', 'mode': 'REPEATED', 'type': 'RECORD', 'fields': [{'name': 'type', 'type': 'STRING'}, {'name': 'matchType', 'type': 'STRING'}, {'name': 'expression', 'type': 'STRING'}, {'name': 'comparisonType', 'type': 'STRING'}, {'name': 'comparisonValue', 'type': 'STRING'}]}]}]
google_ads_link_schema = [{'name': 'date', 'type': 'DATE'}, {'name': 'id', 'type': 'STRING'}, {'name': 'kind', 'type': 'STRING'}, {'name': 'selfLink', 'type': 'STRING'}, {'name': 'entity', 'type': 'RECORD', 'fields': [{'name': 'webPropertyRef', 'type': 'RECORD', 'fields': [{'name': 'id', 'type': 'STRING'}, {'name': 'kind', 'type': 'STRING'}, {'name': 'href', 'type': 'STRING'}, {'name': 'accountId', 'type': 'STRING'}, {'name': 'internalWebPropertyId', 'type': 'STRING'}, {'name': 'name', 'type': 'STRING'}]}]}, {'name': 'adWordsAccounts', 'type': 'RECORD', 'mode': 'REPEATED', 'fields': [{'name': 'kind', 'type': 'STRING'}, {'name': 'customerId', 'type': 'STRING'}, {'name': 'autoTaggingEnabled', 'type': 'BOOLEAN'}]}, {'name': 'name', 'type': 'STRING'}, {'name': 'profileIds', 'type': 'RECORD', 'mode': 'REPEATED', 'fields': [{'name': 'id', 'type': 'STRING'}]}]
remarketing_audience_schema = [{'name': 'date', 'type': 'DATE'}, {'name': 'kind', 'type': 'STRING'}, {'name': 'id', 'type': 'STRING'}, {'name': 'accountId', 'type': 'STRING'}, {'name': 'webPropertyId', 'type': 'STRING'}, {'name': 'webPropertyName', 'type': 'STRING'}, {'name': 'accountName', 'type': 'STRING'}, {'name': 'internalWebPropertyId', 'type': 'STRING'}, {'name': 'created', 'type': 'TIMESTAMP'}, {'name': 'updated', 'type': 'TIMESTAMP'}, {'name': 'name', 'type': 'STRING'}, {'name': 'description', 'type': 'STRING'}, {'name': 'linkedAdAccounts', 'mode': 'REPEATED', 'type': 'RECORD', 'fields': [{'name': 'kind', 'type': 'STRING'}, {'name': 'id', 'type': 'STRING'}, {'name': 'accountId', 'type': 'STRING'}, {'name': 'webPropertyId', 'type': 'STRING'}, {'name': 'internalWebPropertyId', 'type': 'STRING'}, {'name': 'remarketingAudienceId', 'type': 'STRING'}, {'name': 'linkedAccountId', 'type': 'STRING'}, {'name': 'type', 'type': 'STRING'}, {'name': 'status', 'type': 'STRING'}, {'name': 'eligibleForSearch', 'type': 'BOOLEAN'}]}, {'name': 'linkedViews', 'type': 'RECORD', 'mode': 'REPEATED', 'fields': [{'name': 'id', 'type': 'STRING'}]}, {'name': 'audienceType', 'type': 'STRING'}, {'name': 'audienceDefinition', 'type': 'RECORD', 'fields': [{'name': 'includeConditions', 'type': 'RECORD', 'fields': [{'name': 'kind', 'type': 'STRING'}, {'name': 'isSmartList', 'type': 'BOOLEAN'}, {'name': 'segment', 'type': 'STRING'}, {'name': 'membershipDurationDays', 'type': 'INTEGER'}, {'name': 'daysToLookBack', 'type': 'INTEGER'}]}]}, {'name': 'stateBasedAudienceDefinition', 'type': 'RECORD', 'fields': [{'name': 'includeConditions', 'type': 'RECORD', 'fields': [{'name': 'kind', 'type': 'STRING'}, {'name': 'isSmartList', 'type': 'BOOLEAN'}, {'name': 'segment', 'type': 'STRING'}, {'name': 'membershipDurationDays', 'type': 'INTEGER'}, {'name': 'daysToLookBack', 'type': 'INTEGER'}]}, {'name': 'excludeConditions', 'type': 'RECORD', 'fields': [{'name': 'segment', 'type': 'STRING'}, {'name': 'exclusionDuration', 'type': 'STRING'}]}]}]
account_summaries_schema = [{'name': 'date', 'type': 'DATE'}, {'name': 'id', 'type': 'STRING'}, {'name': 'kind', 'type': 'STRING'}, {'name': 'name', 'type': 'STRING'}, {'name': 'starred', 'type': 'BOOLEAN'}, {'name': 'webProperties', 'type': 'RECORD', 'mode': 'REPEATED', 'fields': [{'name': 'kind', 'type': 'STRING'}, {'name': 'id', 'type': 'STRING'}, {'name': 'name', 'type': 'STRING'}, {'name': 'internalWebPropertyId', 'type': 'STRING'}, {'name': 'level', 'type': 'STRING'}, {'name': 'websiteUrl', 'type': 'STRING'}, {'name': 'starred', 'type': 'BOOLEAN'}, {'name': 'profiles', 'type': 'RECORD', 'mode': 'REPEATED', 'fields': [{'name': 'kind', 'type': 'STRING'}, {'name': 'id', 'type': 'STRING'}, {'name': 'name', 'type': 'STRING'}, {'name': 'type', 'type': 'STRING'}, {'name': 'starred', 'type': 'BOOLEAN'}]}]}] |
def score_hand(player_one: list, player_two: list):
if len(player_one) != 7 or len(player_two) != 7:
raise RuntimeError('invalid hands')
# pairs
player_one_pairs = player_one[1]
player_two_pairs = player_two[1]
player_one_has_pairs = len(player_one_pairs)
player_two_has_pairs = len(player_two_pairs)
if player_one_has_pairs and not player_two_has_pairs:
return 1
elif not player_one_has_pairs and player_two_has_pairs:
return -1
elif player_one_has_pairs and player_two_has_pairs:
make_list_same_size(player_one_pairs, player_two_pairs)
player_one_pairs, player_two_pairs = get_high_values(player_one_pairs, player_two_pairs)
player_one_pairs = player_one_pairs if len(player_one_pairs) < 3 else player_one_pairs[:2]
player_two_pairs = player_two_pairs if len(player_two_pairs) < 3 else player_two_pairs[:2]
# get highest two pairs
if len(player_one_pairs) != len(player_two_pairs):
return 1 if len(player_one_pairs) > len(player_two_pairs) else -1
for player_one_pair_value, player_two_pair_value in zip(player_one_pairs, player_two_pairs):
if player_one_pair_value > player_two_pair_value:
return 1
elif player_one_pair_value < player_two_pair_value:
return -1
# high cards
player_one_high_cards = player_one[0]
player_two_high_cards = player_two[0]
for player_one_card, player_two_card in zip(player_one_high_cards, player_two_high_cards):
player_one_card_value = get_card_value(player_one_card)
player_two_card_value = get_card_value(player_two_card)
if player_one_card_value == player_two_card_value:
continue
elif player_one_card_value > player_two_card_value:
return 1
else:
return -1
return 0
def get_high_values(player_one_pairs, player_two_pairs):
player_one_values = []
player_two_values = []
for player_one_pair, player_two_pair in zip(player_one_pairs, player_two_pairs):
player_one_has_pairs = len(player_one_pair)
player_two_has_pairs = len(player_two_pair)
player_one_current_value = get_card_value(player_one_pair[0]) if player_one_has_pairs else 0
player_two_current_value = get_card_value(player_two_pair[0]) if player_two_has_pairs else 0
if player_one_current_value:
player_one_values.append(player_one_current_value)
if player_two_current_value:
player_two_values.append(player_two_current_value)
player_one_values.sort(reverse=True)
player_two_values.sort(reverse=True)
return player_one_values, player_two_values
def make_list_same_size(list_one: list, list_two: list) -> None:
length_list_one = len(list_one)
length_list_two = len(list_two)
while length_list_one != length_list_two:
if length_list_one > length_list_two:
list_two.append([])
length_list_two += 1
else:
list_one.append([])
length_list_one += 1
def get_card_value(card):
return int(card[1:])
| def score_hand(player_one: list, player_two: list):
if len(player_one) != 7 or len(player_two) != 7:
raise runtime_error('invalid hands')
player_one_pairs = player_one[1]
player_two_pairs = player_two[1]
player_one_has_pairs = len(player_one_pairs)
player_two_has_pairs = len(player_two_pairs)
if player_one_has_pairs and (not player_two_has_pairs):
return 1
elif not player_one_has_pairs and player_two_has_pairs:
return -1
elif player_one_has_pairs and player_two_has_pairs:
make_list_same_size(player_one_pairs, player_two_pairs)
(player_one_pairs, player_two_pairs) = get_high_values(player_one_pairs, player_two_pairs)
player_one_pairs = player_one_pairs if len(player_one_pairs) < 3 else player_one_pairs[:2]
player_two_pairs = player_two_pairs if len(player_two_pairs) < 3 else player_two_pairs[:2]
if len(player_one_pairs) != len(player_two_pairs):
return 1 if len(player_one_pairs) > len(player_two_pairs) else -1
for (player_one_pair_value, player_two_pair_value) in zip(player_one_pairs, player_two_pairs):
if player_one_pair_value > player_two_pair_value:
return 1
elif player_one_pair_value < player_two_pair_value:
return -1
player_one_high_cards = player_one[0]
player_two_high_cards = player_two[0]
for (player_one_card, player_two_card) in zip(player_one_high_cards, player_two_high_cards):
player_one_card_value = get_card_value(player_one_card)
player_two_card_value = get_card_value(player_two_card)
if player_one_card_value == player_two_card_value:
continue
elif player_one_card_value > player_two_card_value:
return 1
else:
return -1
return 0
def get_high_values(player_one_pairs, player_two_pairs):
player_one_values = []
player_two_values = []
for (player_one_pair, player_two_pair) in zip(player_one_pairs, player_two_pairs):
player_one_has_pairs = len(player_one_pair)
player_two_has_pairs = len(player_two_pair)
player_one_current_value = get_card_value(player_one_pair[0]) if player_one_has_pairs else 0
player_two_current_value = get_card_value(player_two_pair[0]) if player_two_has_pairs else 0
if player_one_current_value:
player_one_values.append(player_one_current_value)
if player_two_current_value:
player_two_values.append(player_two_current_value)
player_one_values.sort(reverse=True)
player_two_values.sort(reverse=True)
return (player_one_values, player_two_values)
def make_list_same_size(list_one: list, list_two: list) -> None:
length_list_one = len(list_one)
length_list_two = len(list_two)
while length_list_one != length_list_two:
if length_list_one > length_list_two:
list_two.append([])
length_list_two += 1
else:
list_one.append([])
length_list_one += 1
def get_card_value(card):
return int(card[1:]) |
'''
Title : Zipped!
Subdomain : Built-Ins
Domain : Python
Author : codeperfectplus
Created : 17 January 2020
'''
# Enter your code here. Read input from STDIN. Print output to STDOUT
n, x = map(int, input().split())
sheet = []
for _ in range(x):
sheet.append(map(float, input().split()) )
for i in zip(*sheet):
print( sum(i)/len(i) )
| """
Title : Zipped!
Subdomain : Built-Ins
Domain : Python
Author : codeperfectplus
Created : 17 January 2020
"""
(n, x) = map(int, input().split())
sheet = []
for _ in range(x):
sheet.append(map(float, input().split()))
for i in zip(*sheet):
print(sum(i) / len(i)) |
Subsets and Splits
No saved queries yet
Save your SQL queries to embed, download, and access them later. Queries will appear here once saved.